<%BANNER%>

Uptake and Survival of Vibrio vulnificus in Oysters

Permanent Link: http://ufdc.ufl.edu/UFE0021791/00001

Material Information

Title: Uptake and Survival of Vibrio vulnificus in Oysters
Physical Description: 1 online resource (97 p.)
Language: english
Creator: Srivastava, Milan
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2007

Subjects

Subjects / Keywords: oysters, survival, vibrio
Food Science and Human Nutrition -- Dissertations, Academic -- UF
Genre: Food Science and Human Nutrition thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Vibrio vulnificus is a halophilic, gram-negative, opportunistic pathogen that is associated with plankton and shellfish (oysters, clams, and mussels). This bacterium exhibits distinct seasonality and is frequently isolated at temperatures greater than 20 degree C and is associated with consumption of contaminated raw oysters. Adaptations in the surface structures of V. vulnificus may influence the environmental reservoirs of disease. Additionally, survival of V. vulnificus may also be dependent on phase variation of these cell surface structures. This research study examined the contributions of known virulence factors, such as capsular polysaccharide (CPS), pili, and flagella to the survival of V. vulnificus in oysters, using mutational analysis in an oyster model of infection. Oysters (Crassostrea virginica) were acclimated in artificial seawater (16ppt), and background V. vulnificus was reduced to less than 10 CFU per gram of oyster meat with tetracycline (2 microgram per mL) treatment, followed by transferring to fresh artificial seawater (ASW) with charcoal filtration to remove the residual antibiotic. Survival in inoculated oysters (106 CFU/mL) was determined by plate count on non-selective (total bacteria count) and selective (V. vulnificus count) agars. Strains included virulent, encapsulated wild type strain with opaque colonies; translucent reversible phase variant (T1) with reduced CPS and virulence, rugose (wrinkled colonies) phase variant with enhanced biofilm; or mutants with deletion in CPS (wzb) deletion mutant, and in the operon for Type IV Pilus (pilA) deletion and double deletion mutant (pilAwzb), or deletions in either one (flaCDE) or both (flaCDEflaFBA) flagellar genetic loci and flagellar motor (motAB) components. Wild type opaque V. vulnificus was recovered from oysters at significantly higher levels as compared to the rugose variant (p=0.005), or to CPS deletion mutant (p=0.025), pilA deletion mutant (p=0.01), pilAwzb (p=0.002) double deletion mutant, or flaFBAE/flaCDE (p=0.03) deletion mutant.On the other hand rugose, pilA and pilA/wzb deletion mutants showed greater recovery in seawater compared to oysters, indicating that in vitro biofilm function may be independent of survival of V. vulnificus in oysters. Translucent phase variants (T1) did not differ from the wild type, and both T1 and rugose phase variants reverted to opaque morphotype at high frequency (72 and 100 percent, respectively) in oysters, while maintaining their stable morphology in the seawater. Competition studies confirmed that encapsulation contributes to the survival of V. vulnificus in oysters. Distribution of strains differed somewhat in oyster gills and intestinal tract, but significant reductions in recovery from the hemolymph were observed for rugose variant, CPS deletion mutant, pilA deletion mutant, pilA/wzb double deletion mutant and for all the flagella mutants as compared to the wild type. Thus, surface structures such as CPS, pili and flagella, and motility of V. vulnificus contribute not only to survival in whole oysters but also to dissemination of the bacterium, especially to the hemolymph of the oyster. Furthermore, observations of phase variation within the oyster host indicate that variable expression of CPS is a survival strategy of V. vulnificus in oysters. The research study described herein may ultimately lead to an understanding of the contribution of surface structures of V. vulnificus in their molluscan shellfish host and thereby aid in designing post harvest treatment methods to bring about more efficient reduction of this potential pathogen to safe levels in seafood for human consumption.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Milan Srivastava.
Thesis: Thesis (M.S.)--University of Florida, 2007.
Local: Adviser: Wright, Anita C.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2007
System ID: UFE0021791:00001

Permanent Link: http://ufdc.ufl.edu/UFE0021791/00001

Material Information

Title: Uptake and Survival of Vibrio vulnificus in Oysters
Physical Description: 1 online resource (97 p.)
Language: english
Creator: Srivastava, Milan
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2007

Subjects

Subjects / Keywords: oysters, survival, vibrio
Food Science and Human Nutrition -- Dissertations, Academic -- UF
Genre: Food Science and Human Nutrition thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Vibrio vulnificus is a halophilic, gram-negative, opportunistic pathogen that is associated with plankton and shellfish (oysters, clams, and mussels). This bacterium exhibits distinct seasonality and is frequently isolated at temperatures greater than 20 degree C and is associated with consumption of contaminated raw oysters. Adaptations in the surface structures of V. vulnificus may influence the environmental reservoirs of disease. Additionally, survival of V. vulnificus may also be dependent on phase variation of these cell surface structures. This research study examined the contributions of known virulence factors, such as capsular polysaccharide (CPS), pili, and flagella to the survival of V. vulnificus in oysters, using mutational analysis in an oyster model of infection. Oysters (Crassostrea virginica) were acclimated in artificial seawater (16ppt), and background V. vulnificus was reduced to less than 10 CFU per gram of oyster meat with tetracycline (2 microgram per mL) treatment, followed by transferring to fresh artificial seawater (ASW) with charcoal filtration to remove the residual antibiotic. Survival in inoculated oysters (106 CFU/mL) was determined by plate count on non-selective (total bacteria count) and selective (V. vulnificus count) agars. Strains included virulent, encapsulated wild type strain with opaque colonies; translucent reversible phase variant (T1) with reduced CPS and virulence, rugose (wrinkled colonies) phase variant with enhanced biofilm; or mutants with deletion in CPS (wzb) deletion mutant, and in the operon for Type IV Pilus (pilA) deletion and double deletion mutant (pilAwzb), or deletions in either one (flaCDE) or both (flaCDEflaFBA) flagellar genetic loci and flagellar motor (motAB) components. Wild type opaque V. vulnificus was recovered from oysters at significantly higher levels as compared to the rugose variant (p=0.005), or to CPS deletion mutant (p=0.025), pilA deletion mutant (p=0.01), pilAwzb (p=0.002) double deletion mutant, or flaFBAE/flaCDE (p=0.03) deletion mutant.On the other hand rugose, pilA and pilA/wzb deletion mutants showed greater recovery in seawater compared to oysters, indicating that in vitro biofilm function may be independent of survival of V. vulnificus in oysters. Translucent phase variants (T1) did not differ from the wild type, and both T1 and rugose phase variants reverted to opaque morphotype at high frequency (72 and 100 percent, respectively) in oysters, while maintaining their stable morphology in the seawater. Competition studies confirmed that encapsulation contributes to the survival of V. vulnificus in oysters. Distribution of strains differed somewhat in oyster gills and intestinal tract, but significant reductions in recovery from the hemolymph were observed for rugose variant, CPS deletion mutant, pilA deletion mutant, pilA/wzb double deletion mutant and for all the flagella mutants as compared to the wild type. Thus, surface structures such as CPS, pili and flagella, and motility of V. vulnificus contribute not only to survival in whole oysters but also to dissemination of the bacterium, especially to the hemolymph of the oyster. Furthermore, observations of phase variation within the oyster host indicate that variable expression of CPS is a survival strategy of V. vulnificus in oysters. The research study described herein may ultimately lead to an understanding of the contribution of surface structures of V. vulnificus in their molluscan shellfish host and thereby aid in designing post harvest treatment methods to bring about more efficient reduction of this potential pathogen to safe levels in seafood for human consumption.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Milan Srivastava.
Thesis: Thesis (M.S.)--University of Florida, 2007.
Local: Adviser: Wright, Anita C.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2007
System ID: UFE0021791:00001


This item has the following downloads:


Full Text
xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E20110331_AAAADC INGEST_TIME 2011-03-31T20:34:29Z PACKAGE UFE0021791_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES
FILE SIZE 21370 DFID F20110331_AACMUC ORIGIN DEPOSITOR PATH srivastava_m_Page_90.jp2 GLOBAL false PRESERVATION BIT MESSAGE_DIGEST ALGORITHM MD5
c6a758e05a1b0a54d22a5645fa8b5019
SHA-1
e3b15e201f38aafc7c86ac79a18721134da656f4
112449 F20110331_AACMTO srivastava_m_Page_76.jp2
09f588dfece48a6ef8cec8cee1ea7e0f
5b1ce8633eabea0bdcbb24c85f29fdb69feaf778
645452 F20110331_AACMSZ srivastava_m_Page_61.jp2
3e83c54117a4398f2e7f887f8dcc08ec
131a3da8261d66afedd4957cd2f9f6a1ee1d4bd2
134959 F20110331_AACMUD srivastava_m_Page_91.jp2
81141f000bbdedb5865e66afa4b86055
f0e567f9a5f3551db05c3cff774051f4af4ee9d2
135131 F20110331_AACMUE srivastava_m_Page_92.jp2
71dc75737c3aa7d01b804e63485d5adf
7c5079ef8464e5b3ce42b3280b34f8b2f5aea018
119167 F20110331_AACMTP srivastava_m_Page_77.jp2
e690c9f8d7efed43777637d723d30810
72af4e35126a2d4938165c5fb9aeb619ee55224b
136787 F20110331_AACMUF srivastava_m_Page_93.jp2
d0c0294dcc050aaf9a026a5924eb89fa
70f56fe102890e28991d5cd0048565e8699f838f
114957 F20110331_AACMTQ srivastava_m_Page_78.jp2
92d838911d4d721961da59d634fcb3b6
01052a2bc05c8c687170e98fba42a01ba30e4542
139970 F20110331_AACMUG srivastava_m_Page_94.jp2
d966be55bdaba896afbf49ccde97fc96
471a8081dbbb2044fcc26749d68ad3d4cb4f9fa1
123350 F20110331_AACMTR srivastava_m_Page_79.jp2
c0491b0410b4442b032a4a4422c24793
51284c7810c6883bc78927575738ba872dedf025
130272 F20110331_AACMUH srivastava_m_Page_95.jp2
db5bb292b86a72578c8091a47e1cf91b
a3672de5509ea7f8bf1f9642d6b8a5fbe11de44f
115682 F20110331_AACMTS srivastava_m_Page_80.jp2
e5df6e325f0f4cc469798bedb49761b1
0071e50d6871a33885a8c2db4590cc90b532aa5b
25197 F20110331_AACMUI srivastava_m_Page_96.jp2
1e88b0c49351ad36d2d6e3c285fd2155
5c4b616e757de9e149e8abf31601aea21e4f7470
117373 F20110331_AACMTT srivastava_m_Page_81.jp2
9f22c49083e179ff5d6fac2705f5541f
e9e0145d605236f2f16ad7ce36e5c2a5061f7705
93838 F20110331_AACMUJ srivastava_m_Page_97.jp2
cbf7c8d9cc0443879fb5bb02abaee032
4b441193c67f330afa0df3661cf253297618338d
119089 F20110331_AACMTU srivastava_m_Page_82.jp2
a352e4df13535fc01ec459b16d382fa0
2fdd920fc675e6393f80cd92525aa0da7a3c184c
1891 F20110331_AACMUK srivastava_m_Page_01thm.jpg
a4d685c6d8d311ae5a290b05bda9f874
3e89a85ddcbbf798b75b9b427bea969b96071ff6
119964 F20110331_AACMTV srivastava_m_Page_83.jp2
83254f6415ef38db267e3d146290b7f7
cfc9f60d5f5ea3efd22c56b5300357b53c209a5a
526 F20110331_AACMUL srivastava_m_Page_02thm.jpg
b61e44d268221f9717f6ec69f0df6e9d
12db322eb42993d786db1ed05bbbe47c01c45870
118696 F20110331_AACMTW srivastava_m_Page_84.jp2
b8d386c034ac3dfc55181309d21caf9d
66f0c1392e9c120691b1630ecfbdc4ea7ba28202
527 F20110331_AACMUM srivastava_m_Page_03thm.jpg
3b352f2f4ab7fd7812557d9e1539a2aa
9bdaa9a728f1f245c8c31b1da1d1d93a20e34f72
122345 F20110331_AACMTX srivastava_m_Page_85.jp2
32bde332e1c24a1ee01db751113a86ee
d0a5f673f91dfae925bfb88713de84df8b30bcf1
8744 F20110331_AACMVA srivastava_m_Page_17thm.jpg
3af042d117fe09000425849fcb185ca8
47a2989de4b5db44d847e2cf248eb921afb3e33e
8931 F20110331_AACMUN srivastava_m_Page_04thm.jpg
ec39efd16098ed68ceb40543a998bc3a
c2aff161c1645d0129b1d4095216527c6fa95e9e
117839 F20110331_AACMTY srivastava_m_Page_86.jp2
e57127d66dcccd9a6ea04f631fc2c8a9
c39d97890bc0061dfbe7a79853f5002c24026f48
8818 F20110331_AACMVB srivastava_m_Page_18thm.jpg
ffb49b002a365c95353e6eab2a3aefbc
e7e90c36fd56be77abfa8214307a3e5358aa5904
3785 F20110331_AACMUO srivastava_m_Page_05thm.jpg
06278a58758d7d3d34ff51881f47b133
dfb460147b77994cb01fc215fbfbe1e6073eca7c
1051913 F20110331_AACMTZ srivastava_m_Page_87.jp2
9ae0316c9c81c3cb8d116dc4bc50f36a
c69f53fc25a2e5a01c9a96048592570f25f1e609
8995 F20110331_AACMVC srivastava_m_Page_19thm.jpg
cb4461254b7cb7af842ce9c1d1facea5
2ded2bed5490ea3f1c90176a507aaa5bdf8fe839
6806 F20110331_AACMUP srivastava_m_Page_06thm.jpg
a17fde2b5cf1bb02e9bbd3c56090dd49
5311d613820d447129a3985060df54dda3a322f6
9111 F20110331_AACMVD srivastava_m_Page_20thm.jpg
4a978d350bb8f654f1ab67e14b16b7a8
bb35540d797fe269f7d9c3185ca935a3b2c53ffd
8934 F20110331_AACMVE srivastava_m_Page_21thm.jpg
57fe3533884e22835813562cae6c0d6c
85ccfa14e0f957e0d33d7477453295dad28718b1
5254 F20110331_AACMUQ srivastava_m_Page_07thm.jpg
2a7efc4b600263952ca354d782c557f4
f07f46f5f4ff7df19d6daa27c56e550f5c618916
9143 F20110331_AACMVF srivastava_m_Page_22thm.jpg
6497fe5899a23736923f1420eb76ee12
410becebe75fca45e39eda12c53cb70928c1a209
2641 F20110331_AACMUR srivastava_m_Page_08thm.jpg
8db7f5d32bff417746c68a4adc01276a
8e3eefdc08e5937f307dfd12cb8419a88d7abb53
8966 F20110331_AACMVG srivastava_m_Page_23thm.jpg
616f2ef133a6e689b6deb3e1b3888f1e
e76e4610b80d150f7bd27e786a4b0f228a748e75
6542 F20110331_AACMUS srivastava_m_Page_09thm.jpg
2a9677b9e1dc79500fa6efb490eb9507
4d23a993b538a39b279e791d4a0e3e3f0ddf69eb
9213 F20110331_AACMVH srivastava_m_Page_24thm.jpg
528964db031c5b8f3c57fe96dd5ff821
e872627899043e8835d35104bf448f80a4163ce7
4095 F20110331_AACMUT srivastava_m_Page_10thm.jpg
1c5e5afda0eb9942cd6802a808e84aab
b50842cdf4d7c7135221a63e6371fc6b6ef5cbe6
8708 F20110331_AACMVI srivastava_m_Page_25thm.jpg
0a87da3e960b8c239c4b37693f576b33
8ce59d0738962e703f8e0704f82308b9038a4c28
1515 F20110331_AACMUU srivastava_m_Page_11thm.jpg
362aa94ad20c96e4cf62b5147f0f18a5
67aed4eba6ba0b7c6269c37ecb9c88915ca6ad43
5657 F20110331_AACMVJ srivastava_m_Page_26thm.jpg
7ab8bb9804c09b6581f25efa60263705
b0568e41ca5d6c700a58dfeca611f354abea674d
7851 F20110331_AACMUV srivastava_m_Page_12thm.jpg
adf95f5cbaec840be533eda4fede5e1f
e9aaa9cc2502cee5b2c1034c0ee176b57e671887
3640 F20110331_AACMVK srivastava_m_Page_27thm.jpg
05adad05ae2e8057883ce5623bdcb327
93e87f5cbd8962df857eb72d1b07a069d34d2cb8
8490 F20110331_AACMUW srivastava_m_Page_13thm.jpg
191a9f0eb0311ac9135fe0ca5b2d6b36
728947b813ccc31f42d22149a5958ca40cd3bd17
5442 F20110331_AACMVL srivastava_m_Page_28thm.jpg
25e8734b03a51905b8b9b598f0bc6111
b8a113278b0c9010cbe56c8c0d63132fc1435007
8894 F20110331_AACMUX srivastava_m_Page_14thm.jpg
64cf0e5b6deee9f33270648da94bc293
ece7981922c84645858d303e836531b0a4febad2
4992 F20110331_AACMWA srivastava_m_Page_43thm.jpg
64ea4aa0a895b6abf46fdc1c30b12b00
30d8d7eeaa11c165ddda3765ac209348a7b0d4b2
8914 F20110331_AACMVM srivastava_m_Page_29thm.jpg
74c75691e30c25509a67fea0f1d9efa5
45ecef9d56dad43fe5160401fb464180e9319e20
7968 F20110331_AACMWB srivastava_m_Page_44thm.jpg
7fc52a55758993b331ab81982f71c57a
00148c84ccb662b6dd82cabaa975b8e34499e02f
9113 F20110331_AACMVN srivastava_m_Page_30thm.jpg
e2cfb66939acdca8adeefc693dd2ce4e
9f9e60504d9428c03f76ff985aa78dd5afe0351f
9089 F20110331_AACMUY srivastava_m_Page_15thm.jpg
dce7a2d17118a51c343e3918222d03bd
4349bdf08cf4e8fa84f90e4d5614d46d0b55da8c
9037 F20110331_AACMWC srivastava_m_Page_45thm.jpg
8a4f429bfc68570e3f62815b6e7db068
af109871315398ba30082e034bc5cdb5ed08c110
8957 F20110331_AACMVO srivastava_m_Page_31thm.jpg
101c2932a19a1c2393abd611c0a1b2b4
ad62c10d86d80a67cf62199d4155467d86adf316
9275 F20110331_AACMUZ srivastava_m_Page_16thm.jpg
fb05a021fde0a147393b964f4898e3b2
6eed51732cc7da42ba2d877732cdca2c33925e29
2378 F20110331_AACMWD srivastava_m_Page_46thm.jpg
228c23ea796832b4009db02e4d75087e
f85f8496eba0ce543ecae5b0c2c524a84247cf3b
F20110331_AACMVP srivastava_m_Page_32thm.jpg
16bf6963363830428d57f13fcfaa4f58
53335606037bafe5c5a8a9313f2cac614ab12104
4409 F20110331_AACMWE srivastava_m_Page_47thm.jpg
47eddcf1f0332d0a6ff395b60066a936
548578e63d86ee0eb81256097327500cbe30580b
F20110331_AACMVQ srivastava_m_Page_33thm.jpg
fa90d20bd77d8a048c61d1c31cdcc5bc
9cc1b4dada30ee9fe8b42a95785db31ae5426fac
4570 F20110331_AACMWF srivastava_m_Page_48thm.jpg
38e634b684494a8bf029da570a984131
c1fbf77c8b5382dd87b0ddd83b4f04170373e5bf
4101 F20110331_AACMWG srivastava_m_Page_49thm.jpg
cef5829ac5f68962a2c53ed4c025144b
16a6e95672d8ae0997f2a64a8da5a1f4200441db
9127 F20110331_AACMVR srivastava_m_Page_34thm.jpg
dae383e6c722e23c14780526fd23ef8d
1f077410385eccef852dc237bfbc5b89df8f65ee
4615 F20110331_AACMWH srivastava_m_Page_50thm.jpg
a41c0f8fc9f4ba3055b5e1245eb57b53
f1e3c549aa4ce50c10aa3108a029018b52bc1fde
F20110331_AACMVS srivastava_m_Page_35thm.jpg
ec57ca9547c458a22eb5e1a48b679380
fc329f0b9c16c2bca431f035857d4d5379a6283e
8710 F20110331_AACMWI srivastava_m_Page_51thm.jpg
6612e96f7b03dae6f58b7e9903c1dff2
34ea0fbf88d3f0ff410c1fdc565efb36667da490
8637 F20110331_AACMVT srivastava_m_Page_36thm.jpg
6fbab87c49d63cd0521f68950455b1c0
b0a450ca520b8857ffbbece4c11ce2ccae78e48f
8896 F20110331_AACMWJ srivastava_m_Page_52thm.jpg
b47ba124e88b5503b8b058c660b054e4
459d8ae68f2862d8461454db8cf5400fd9b579a4
9300 F20110331_AACMVU srivastava_m_Page_37thm.jpg
96e8b17fc744a34f11381be424de7b86
b5709c8993cf9940934d84b32b6d9c12ec4b5c05
8888 F20110331_AACMWK srivastava_m_Page_53thm.jpg
dfe861a4f82649657fee046c32948f3f
a184c538933e1a599c0516bbab9a30c1476e76a8
9104 F20110331_AACMVV srivastava_m_Page_38thm.jpg
790a78970c28c5fbb3ffd9fe93913104
cc5491d5d9b12c2fbb7d5a724f2152461a3ff4a5
9197 F20110331_AACMWL srivastava_m_Page_54thm.jpg
77667bf9714da729ce6b693937b7e090
3d337d54d08314768fa10ac5e3c750a276c2ca2c
F20110331_AACMVW srivastava_m_Page_39thm.jpg
11ef0f6a0483e117af5dc91bdd65fd98
5d5e1c1e67ddede5e4cabfa31a703cd4d82fd9ce
9101 F20110331_AACMWM srivastava_m_Page_55thm.jpg
d3126afcc8119f661cd85a2d5b9be957
d2a0b87582e8b5570dd1926a0f6c158a685ec7fa
4590 F20110331_AACMVX srivastava_m_Page_40thm.jpg
ffcdc0bd3b531ce4d9f6aa65860c63dc
8a7d8b17253e24b1d7d40d50f51e9edbf657388d
5052 F20110331_AACMXA srivastava_m_Page_69thm.jpg
6a8dd32c17bfe6692b6ecfe06d6bb75d
3b0f1bf81360212044e12e6e4151d6537872bad9
4436 F20110331_AACMWN srivastava_m_Page_56thm.jpg
7b33f45adcc7872e40f1b316e8abedae
1cf310bfa63fdad00b4b697bafcf2d23c6d5a2b0
5321 F20110331_AACMVY srivastava_m_Page_41thm.jpg
dde88aab08bd3bc0fb02f1f091779b09
2c5dcad389d3a53441bc33a9b878df5336132305
8429 F20110331_AACMXB srivastava_m_Page_70thm.jpg
83fa9637de8ef37d400ba5ce540d32cc
c474dad48dd70f408edacfb09955617d05d99961
3441 F20110331_AACMWO srivastava_m_Page_57thm.jpg
7d26790f7f2161f69303096d1ac163f1
2a3ad3ec204faa96c485847c10c6244b8636685b
9801 F20110331_AACMVZ srivastava_m_Page_42thm.jpg
dacee149f4fa6c53abce28272df3a76a
1d3979011d0494c4089aff4e67e21282cdc6d3d7
8918 F20110331_AACMXC srivastava_m_Page_71thm.jpg
15f328cf9f7b1357f9271ad4b02e4fa6
bd5406c77d2e49e0d171a0dc821714d72f2ff4bd
3402 F20110331_AACMWP srivastava_m_Page_58thm.jpg
2ca71fa89c512dfdeb9da7e371ab6723
a69fed9f4f51d28e07b3c1f4d8906752f78bd28b
6244 F20110331_AACMXD srivastava_m_Page_72thm.jpg
6549299d65b28c23134bc1fd7fb79aa0
5ce97791f6c539680be724ffa3f074d26e04f51d
3717 F20110331_AACMWQ srivastava_m_Page_59thm.jpg
b29bf88649d11a2063511cbc18916c6f
fb06840c1727d7434ffeb4be3d81b19826f554ab
2248 F20110331_AACMXE srivastava_m_Page_73thm.jpg
1f4a11d4412577d96281138748962a46
a94fbc8b768362ba26fd30b0143b28e4b82a5fb7
4976 F20110331_AACMWR srivastava_m_Page_60thm.jpg
f8d9997c1ff3bd37ab8e431581ddd62a
e2068b141e4fbb573b46c1ed14e3b55afd4a7790
4332 F20110331_AACMXF srivastava_m_Page_74thm.jpg
07e7032c1d32573477abcd5299a4db37
ccae966edcdcb00b08b8555c5867c7fcf059342d
4556 F20110331_AACMXG srivastava_m_Page_75thm.jpg
ad36bb5ba4062feb7c3ad7f74fb6f243
58066310bed62548dc4227d4783ca79d7b3cde59
5007 F20110331_AACMWS srivastava_m_Page_61thm.jpg
8d707818b01414a1e86ac4f0f723ea87
e6d2be37ad04c272d1dbcde6e9f7525bc4861bf1
8334 F20110331_AACMXH srivastava_m_Page_76thm.jpg
07d92525523d0f9b24a44710ce7cf74c
6805b6dd7a1e49cedfba70f00b8fee93cabc2825
F20110331_AACMWT srivastava_m_Page_62thm.jpg
0027703d26fe51b37c7442f2b161f400
f801906fe4ee4e44a4c0aa23313714a24c91af3c
1053954 F20110331_AACMAA srivastava_m_Page_51.tif
7ddd36e9dad16acffdbb37c50adfad1d
734fa96858c157e0ecaae70fcbbdffd394579314
8866 F20110331_AACMXI srivastava_m_Page_77thm.jpg
5342b9bc599be4f10a75f336f1afbbb7
b52fef52129835cf61ba88b575ef181a3f873098
F20110331_AACMWU srivastava_m_Page_63thm.jpg
e89bb1ffacae680f554318dc5c3ff298
ed2c6ebb14494eb82fa5b06850a4a09ea8f9f002
F20110331_AACMAB srivastava_m_Page_52.tif
4be863d4072101fe5289294d9534a17b
e5f0c5b00242e2121da18eba66aa0e0384f5a8d0
8639 F20110331_AACMXJ srivastava_m_Page_78thm.jpg
69c63b144b4850b7fab963ee624a55e7
1be015a757991aaaf84c6f85fdf50d57420b39a6
F20110331_AACMWV srivastava_m_Page_64thm.jpg
8eb144413b0802ee4abd59ab912bace5
1f0784cf16ab9d25d4fdf391d325597cc09d611a
F20110331_AACMAC srivastava_m_Page_53.tif
1c2170a867d41525c54f490c4ac0ec1c
b6ad76418dc49609a356dbde537d37140e727914
9109 F20110331_AACMXK srivastava_m_Page_79thm.jpg
87354e1516ae564b08f0922142344562
f741b68f9bdf384ea892364566200ec3c90f230b
5971 F20110331_AACMWW srivastava_m_Page_65thm.jpg
fd16b0d246041b16aaace4e625f7fba3
5256cf5fb5a484977e6559605b169c711c340980
F20110331_AACMAD srivastava_m_Page_54.tif
d0987bed14188981fe7de3d166395a42
640934057d67ea05079618f2908bbe3585102b72
8672 F20110331_AACMXL srivastava_m_Page_80thm.jpg
64a5213ba498273b46b55120d60069c0
ef58b421615fe921cf6029d8f2f70c5562bc9c88
2343 F20110331_AACMWX srivastava_m_Page_66thm.jpg
abe0bdd6c3454e2d2c7955ddbb889158
4170cc0639be6d838012c5c0b48b4d83bd9fbbb7
F20110331_AACMAE srivastava_m_Page_55.tif
581e0976df375340cacec128c00855e1
76cc7d0fb348f7e7aa69189785e5581bf2c8556c
9008 F20110331_AACMYA srivastava_m_Page_95thm.jpg
2594854663fb7eb9e0b9a194841cf50a
bfa1fa56c88d4399d4c1a6cde1e236532767e673
8830 F20110331_AACMXM srivastava_m_Page_81thm.jpg
c845b31bf769340f6fe00738238c193f
780aa5b8e0dcf2dd46a0474fb468263404016589
4815 F20110331_AACMWY srivastava_m_Page_67thm.jpg
bd47f077c24f59da7cbdf14272d1fee7
050c7869c4f8ace0a72e0837da9b2fada921b68b
F20110331_AACMAF srivastava_m_Page_56.tif
222844cc54a6486ee7fe24f7c7184566
84b86d9577dd72fe2810f2a5c9ee751c6f5305f9
1771 F20110331_AACMYB srivastava_m_Page_96thm.jpg
b2c65b4e37f42ca23078daa02d1aa9ac
74772e3e93639347fb93e4671b6a2f6eb29f3839
8902 F20110331_AACMXN srivastava_m_Page_82thm.jpg
fe944f733748832fa6cddeb218d56882
d4830d61d3aa3363486169dd686589b579e0ab7c
4960 F20110331_AACMWZ srivastava_m_Page_68thm.jpg
0ca45ee0cee5da986f2e76fa482517f7
135a12c010473a85e5020a92cc80557722883eb8
F20110331_AACMAG srivastava_m_Page_57.tif
f2d71d63d45a33b33b414293d2cb5822
443a0049feb2b6cdd6d7742acc2e049f1611d614
6759 F20110331_AACMYC srivastava_m_Page_97thm.jpg
7c9b3242317cdeeb8dbe67a6b8882716
6bc76b333eb980f1846939e437c7f0c333d1102a
9032 F20110331_AACMXO srivastava_m_Page_83thm.jpg
0d254e034a34b56b75ff05665cea01ca
22a15cfdc1bee1b5155b9b8533823fab99311123
F20110331_AACMAH srivastava_m_Page_58.tif
52d4e9507906779c0a26ef3ef98535fc
f21dd47c80af339b70b65d692579170f9c114d48
1005173 F20110331_AACMYD srivastava_m.pdf
cef2fdab6d64a7b083780ea4049989d5
f55acc1fb68d73628e5a024162f7c84d6827ad6b
8901 F20110331_AACMXP srivastava_m_Page_84thm.jpg
47d41d17e83fd63aac866b9ccf8606d9
d11b5ad5134e456977f12b136d866674d401183c
F20110331_AACMAI srivastava_m_Page_59.tif
5a048b5e3989db26d86a88bad6b15ac0
9e83832a9684ea35935f3d5f73052f6ad02d2189
116092 F20110331_AACMYE UFE0021791_00001.mets FULL
a5682f70e0d5805007eab13bcf52bff1
6bd78ae14283accd950b3cc676cd0c9acfbcc970
9053 F20110331_AACMXQ srivastava_m_Page_85thm.jpg
1bf83a39bf0b64b62694122266fce0b5
a96910eb04665d81e1b8819a846f4607cfb603f5
8423998 F20110331_AACMAJ srivastava_m_Page_60.tif
2ac803abcc2f2dd1a727b412e02f2947
2810e03a534b48415330224ac1f980ee83be9cfe
8882 F20110331_AACMXR srivastava_m_Page_86thm.jpg
8c215a82d428da7ac7ef1bf266b3ea3e
ec19eba7a81879bc850b0864ae08720bf5deb95a
F20110331_AACMAK srivastava_m_Page_61.tif
cbd5fdecba6f6128e14138b44b6cf1c2
b6e2fddf923a9ccc6cafff9696ea5c88aefe8309
8865 F20110331_AACMXS srivastava_m_Page_87thm.jpg
6f1be5278c243d2cc4572c5c78fc8d52
98c39c36cbf81181d94cdc99ece68fa32b0ea0fd
F20110331_AACMAL srivastava_m_Page_62.tif
3f3904e00a9b58130ed977752d16d223
b7c7d240cc43528c6504e241b18d51a3c36f32af
F20110331_AACMAM srivastava_m_Page_63.tif
d0749c4c71e30551c5270156abbe9eea
e87a05993f8d4340184c3133bbf67fe5ed6c2ec1
8750 F20110331_AACMXT srivastava_m_Page_88thm.jpg
5c1a04075d5836b2deb13322d366a28f
7c7a8639216c3877dce9809c0167bc006dcc70b8
F20110331_AACMBA srivastava_m_Page_77.tif
1de8483b694dddb8d0e2c165bca0b090
e05d7b95dd23f2b37cbd6dc85a97ccd93a35dfa2
F20110331_AACMAN srivastava_m_Page_64.tif
b4c8da75208088a3fdf3e9ad83948a7e
06a94ec95dcfca03e7d53a33597f86db91930714
8851 F20110331_AACMXU srivastava_m_Page_89thm.jpg
9a353dbdb09c5511db7e8e9fdba24da9
7e38ee060c5b850c63a358e791dfb38843809c8f
F20110331_AACMBB srivastava_m_Page_78.tif
4357b3857c16f8749f1984a9218a7ece
9e27ecf4121fa267cac9651a49b19eff0e382b06
F20110331_AACMAO srivastava_m_Page_65.tif
6b1a7dfbab592a5bf1d0f66f55b59526
0298b465a034037d5ffca3422ad90e0d46915b78
1851 F20110331_AACMXV srivastava_m_Page_90thm.jpg
b460bb7a8bf4a5dcbac23ecc300d805b
ba10b380eaf148b25e877bbcd256caabbba4c0f9
F20110331_AACMBC srivastava_m_Page_79.tif
42970ff0955a0caabf5b297de3eddafa
09437b043795a6b15adb0c9deccb085f9c38a90e
F20110331_AACMAP srivastava_m_Page_66.tif
f368c0c4be9df943deadb6046efc3610
43b601e3a9d336f8c031702fc7e534a872273015
9180 F20110331_AACMXW srivastava_m_Page_91thm.jpg
c99ae10f6e1c2a29019b2c464f1738be
9fbda0516cef8bae67fb24f7599b44d42c06701c
F20110331_AACMBD srivastava_m_Page_80.tif
067c9fedfbb4c20c5d9172bcd0c2b1cf
028e586f9b9fffafba1973a37a1cc9aaf35e5e0b
F20110331_AACMAQ srivastava_m_Page_67.tif
70cbe1ac1e2d9b63c188673bf5ed21dc
6b554925c01ef606a956e200f944acef3a73c481
9215 F20110331_AACMXX srivastava_m_Page_92thm.jpg
c8e2e05075afa37d282653d4f9881c0d
c7be27012aeaf50d9ea3696e34802c6a2b9011eb
F20110331_AACMBE srivastava_m_Page_81.tif
c11fb55d76d9c2102bb2df177bf0e059
2106a7b3968b42148e79aa458ff1e508f9e3f233
25271604 F20110331_AACMAR srivastava_m_Page_68.tif
3ac4821339b15f00234e1212f679a203
420461f08779527e1b8cf095e7644a3b69bf7e2e
9002 F20110331_AACMXY srivastava_m_Page_93thm.jpg
0a3b1a7cdb1fcb741396da4b28d10035
a46869beb9be1f7e1dda486c11c2e8686b6992f1
F20110331_AACMBF srivastava_m_Page_82.tif
1cdf1d177614f690c17b3633da599332
cf33a5bb8698722d85c70df77f8a034a5c2c0d70
F20110331_AACMAS srivastava_m_Page_69.tif
b40099557316a45362204251835c530d
f080ed2a82a5d392afaaa7c518edc16624e8742b
9500 F20110331_AACMXZ srivastava_m_Page_94thm.jpg
fd35235be62a729da3d03c6b272fe744
a1d752bfb404deaf593c56436ac2e84a12fc9f49
F20110331_AACMBG srivastava_m_Page_83.tif
89c086b434a14f4882305aeb81f351e2
8b03be50ca04180ac64d34493745bc9b5cfc88e2
F20110331_AACMAT srivastava_m_Page_70.tif
387626584748c5129a446e40fda83771
da0b7db4240aa9f59b9ce6ad177cb7edc245ed59
F20110331_AACMBH srivastava_m_Page_84.tif
7799dc7eb5d45dc8cfee1e4e09ed9d96
02d7075c4100b5152440847c5d37f356dc1b228b
F20110331_AACMAU srivastava_m_Page_71.tif
e68c6e615b41a90c605aa907cc3d57e1
6303189509876069cac7745af778f2eb04f6fe9a
F20110331_AACMBI srivastava_m_Page_85.tif
4141f1a63b77b1847dc0391ca9b194f8
b72f657e1acfda730c4c4f08cb4464b7ef7fa862
F20110331_AACMAV srivastava_m_Page_72.tif
38c774182013a9590ddecd37e5713abc
53a2f737da36570377bcde0d005e77f20f20be41
F20110331_AACMBJ srivastava_m_Page_86.tif
d2c4d51a0c78ccd2f29d2c9dc5f1c561
cb95f776354ce334c1102f4099860234720b2cfd
F20110331_AACMAW srivastava_m_Page_73.tif
8ba60a00d0d85b43b6e049f5f3beed2b
6cf25892a5549ed1208c1232b130c4368c1e1baa
F20110331_AACMBK srivastava_m_Page_87.tif
999fb2a275519548956a6fd4ff4421e3
2532b45b84e0cf7105740ed5e6f86f32b0cebe29
F20110331_AACMAX srivastava_m_Page_74.tif
0d2ed037a7080fc0ea98894b50a2c43e
c7c6a913cccfe0358ce4db30684334b847214f3d
F20110331_AACMBL srivastava_m_Page_88.tif
7b614a16a6b8b787caf612788ad35ea2
80767a72566310ddf0953291961cc3f3694addba
F20110331_AACMAY srivastava_m_Page_75.tif
5c6ed662b0c4be4d04e5104218326680
635ebe79ee9aef0c0526fe0fd4e9045bdb0d378d
3552 F20110331_AACMCA srivastava_m_Page_06.txt
d7a67525123f225747ec4bca74bd339e
a4eee137361f55c1730a043516cf0ac22c8063b8
F20110331_AACMBM srivastava_m_Page_89.tif
7e8ff672d85db7ad5341d3e6a5fa802a
314ef87a3ae81f8651692703d3a80e123db6b163
F20110331_AACMAZ srivastava_m_Page_76.tif
325abe8908e519e4ae23b68df73885b2
413cd6e2b17d69bbd9723ea3eaf07d4d59aeaec2
1816 F20110331_AACMCB srivastava_m_Page_07.txt
8d8b7f105d252eb8340fdc59b1d6113f
a7252cb2f0b9e8c3c0e7e15b379c14a9749e0e87
F20110331_AACMBN srivastava_m_Page_90.tif
211bb7638d0dedf024c5c3a89834a7bf
9251135b07baa4692115f2b44783dbd410217a09
716 F20110331_AACMCC srivastava_m_Page_08.txt
ae5ebb42396ae06b65b9753b06e7c1c0
0182c92b3954ea7d305aa7576d1455d00dab07ba
F20110331_AACMBO srivastava_m_Page_91.tif
40b4ea76a23120f1e688dc14677594d2
e3dda637f3ccd746a66811fc25bbfa101bacfb46
2090 F20110331_AACMCD srivastava_m_Page_09.txt
baa0bc8e2831b0f1eff424538316d8a6
7a12d647c80cdc3b3c154804f1cecddd54e7e31d
F20110331_AACMBP srivastava_m_Page_92.tif
9a26215f1eac5c216fae3069568bd71e
f332e90194daf9118e7f323d4a2331d67ff1c76e
1145 F20110331_AACMCE srivastava_m_Page_10.txt
70203afd140d3f6cc1a0fd640653503a
64390b4cfa168712b39e3b937a2e7a823ebd4003
F20110331_AACMBQ srivastava_m_Page_93.tif
76a30748afdaf867ed8b2510320327dc
c7f9a9e2b82b1209d0e627a222055127a973860e
328 F20110331_AACMCF srivastava_m_Page_11.txt
e8588de45b1b421dbee72061885802b8
8ef57005774832a33f6977ab2384455641a941d8
F20110331_AACMBR srivastava_m_Page_94.tif
7b357078e0efe07efdcdef13e6e8694e
e765932e7fe51ed7efd3f5515c48cdf99cbe0847
2107 F20110331_AACMCG srivastava_m_Page_12.txt
12f0e0d2442cecc9867b37a43f9c92a8
c63b24b5cc371dc4f730ff450b810603b23ef8ee
F20110331_AACMBS srivastava_m_Page_95.tif
c6b034e24705688f9daa8cb1ebbb1745
bd1b7dd7d2f38e0c98bb3aaa7a3b274e5bf11664
2083 F20110331_AACMCH srivastava_m_Page_13.txt
07f4fbee922c7956959c70ef3e66d734
a0da675c4b4e7dc451d2b0aca6c3e40812bc12f1
F20110331_AACMBT srivastava_m_Page_96.tif
012f05591dc9554a9c90faf2218573c3
9d612bb71e822d9aa09e344409dc8600d7302afe
2195 F20110331_AACMCI srivastava_m_Page_14.txt
c21bbd7bdf0770eea9d884d9c3a056c5
dc7a864077e5e9b896a6c2b51526fa5a5680ce0f
F20110331_AACMBU srivastava_m_Page_97.tif
5ba5358ae6cf42bb30e4f2f61427c24c
264c52e21f8c9bb04d2a097082fa3add40402a37
2271 F20110331_AACMCJ srivastava_m_Page_15.txt
b1730a2cb2aa4b506e71a3f08d5008b8
074bf2eb625935e25644c2cb76588e22458e27fc
416 F20110331_AACMBV srivastava_m_Page_01.txt
23ccb79c6dbfe6c019456e883efc2618
df753e869b25e2a71487a393d869438c9538c205
2296 F20110331_AACMCK srivastava_m_Page_16.txt
81a7b57cb17f4100e27af570b7b9ac50
469e8bc42910d361cbc20e3676d79bfb3de6dc49
90 F20110331_AACMBW srivastava_m_Page_02.txt
cb48b477656d18abdf19069e3818693c
a2c460125cf4fb9d5914495c64ae8dbd639ecb9b
2172 F20110331_AACMCL srivastava_m_Page_17.txt
b442655607b360c5968f7058efbd0537
feaaa058e6d8c239ae90b8bc8d976eea6fd1e8ab
89 F20110331_AACMBX srivastava_m_Page_03.txt
a93e9b30d0b842d79a772d1d6f033583
a00cd3a90eea3b1c4b1120bee1d867465ee25c56
2212 F20110331_AACMDA srivastava_m_Page_32.txt
d7bcf2ba760c1a8c38c2b11bfe626ecf
cb5f6ffc458fff95d8fa3b5f7a89076d1d26bb7e
2219 F20110331_AACMCM srivastava_m_Page_18.txt
70fb085c96774a91d7ab4cdc0751afd5
e54b478608ba261d21ffa9ee9986afbf53bbd2dd
2170 F20110331_AACMBY srivastava_m_Page_04.txt
5c21eb728ec069209367411e66431343
a7c2d7a2b65ef655e7d6f79ae21e5da993af550a
2205 F20110331_AACMDB srivastava_m_Page_33.txt
150a67768d343c76feb256dc054576b7
b54cca063e17c6c272276c273ae63858a86d0754
2252 F20110331_AACMCN srivastava_m_Page_19.txt
f26c4a9fd211cb19a2ba40e748b7d51a
e9c96338ccfea2fc0bec351c545f0abd1b16c2cc
832 F20110331_AACMBZ srivastava_m_Page_05.txt
ee85722093ce6e92ea3114992c20ec62
8e04a35700e5fdbf241ce15724e9c22c24c59230
2210 F20110331_AACMDC srivastava_m_Page_34.txt
27467c1df4e02c23fb47e72168ebaf25
6c0af32bd63b6463aa93cd6fbc2b42481f58b908
2138 F20110331_AACMCO srivastava_m_Page_20.txt
83d7e984b550692dbe5ddf56b27288d7
17da53fc7ef6a615c06ee5c1ec4207af30887544
2269 F20110331_AACMDD srivastava_m_Page_35.txt
1841c3fbe96d3e866064c34fdd2e61e1
8d17746f77d2d8dab45c440b88dcd8c92d1752d9
2204 F20110331_AACMCP srivastava_m_Page_21.txt
71cd05f875fb3800fc7eb8f8615b605b
e996318de7c7faa9b3bd2b9961cbd9db9b95bd1a
2141 F20110331_AACMDE srivastava_m_Page_36.txt
c8a3c185c0c295268156efac8927563a
f1e10987893df5fd426dda36f4c3604f5676ed1b
F20110331_AACMCQ srivastava_m_Page_22.txt
46f2c0a16f098802fd6ff1a69cb407c3
625f8f32cb5c07522efe0a0d717d5873f2362659
F20110331_AACMDF srivastava_m_Page_37.txt
6cef811fefa2317db2a0dbdda8136665
c600196991654f7bef3f9caecd20c52011c2fa6e
2293 F20110331_AACMCR srivastava_m_Page_23.txt
b3d018b4ede1ff26b74b4955c6c8f3f6
55921ed8d55528fc51f2630a5a319403259b8e26
2144 F20110331_AACMDG srivastava_m_Page_38.txt
b2fa1bdccf97b56d400a751ddb93e8e3
916dbf74cde0a4d0b180b42ca72832d753d0fe58
2302 F20110331_AACMCS srivastava_m_Page_24.txt
92c5feb174973bc8e9c3b2fa90ffd495
05351deaa481d3be5f86cb8926c9c98585e741b7
2235 F20110331_AACMDH srivastava_m_Page_39.txt
eaa749524b1fd2c67a2f8c329f1f401c
9f4426757e76db448ba8b4213027285964ad7ecb
F20110331_AACMCT srivastava_m_Page_25.txt
c0578b6cb15d90156b3d0742f0de3a75
9c94cc2ff7d4494a1a88906785d9423233f5881c
F20110331_AACLYC srivastava_m_Page_01.tif
3f4e4d12959b9d12ca4978ec7905f7b9
c0f8bb293df41421e15acb76e8fb6841c544a202
1570 F20110331_AACMCU srivastava_m_Page_26.txt
da3d34e54a9d487ac246ba67b4eaf864
21ca321b5314a53ba7b5bf6e9fa50e999fad35d8
1074 F20110331_AACMDI srivastava_m_Page_40.txt
02edd456f4faa2f2627aed997520e0a3
d1e31d9a246ec375da15fe80b2d4dcea84cca650
F20110331_AACLYD srivastava_m_Page_02.tif
160255d471094e9a1f1a849ba9cfebd1
a79cdcae2a67ee99ea2d6ad5ca20ebd9313a847a
642 F20110331_AACMCV srivastava_m_Page_27.txt
645459f2f88288a82bcaedf79944fc94
9b72761a6e3c69005008f375995241b5b10a4079
1842 F20110331_AACMDJ srivastava_m_Page_41.txt
edc2db28cc5536d7693aa50e4077144c
2313e6a9821faa6d120b45e635ba1d0f3301dff0
F20110331_AACLYE srivastava_m_Page_03.tif
6ca50d4a358dfeb64dec91a5da88d6cc
0a3b95b3c5d654e75bb3a8a575c3e82df3f5d664
309 F20110331_AACMCW srivastava_m_Page_28.txt
8d5525d476f88f6820906d24bbf3ed18
6aa0de6a89c8b49651763c555df3315ba5ee13ac
753 F20110331_AACMDK srivastava_m_Page_42.txt
b5fa07afc629d5f791793c85b32e06d6
26caf47471276926aa772110d8d07bff9825aa13
F20110331_AACLYF srivastava_m_Page_04.tif
eff7d5facccf42e02ccb62156f777e9f
91d26273234ff500d6b3dbe4c079e66d72b5b555
2142 F20110331_AACMCX srivastava_m_Page_29.txt
131a19ac36bc12822926257d0c6f62ad
421a57800b51bf5f7cc12752d4d56f6366bce123
337 F20110331_AACMDL srivastava_m_Page_43.txt
dc7ff1e14df225bd69640547121eefc4
46a8c94c3b641c8027a05c2a19f8ad09f125166a
F20110331_AACLYG srivastava_m_Page_05.tif
4a910d5e03527e1d5d27192aceba6436
433c38300593df12ad0107565f4274cdc8845bbb
F20110331_AACMCY srivastava_m_Page_30.txt
dbccca1ab28d82baa2070a48dbe9e55a
0abec98f5ff8d3101358cdd8bc52ddfd5714f9b3
1179 F20110331_AACMEA srivastava_m_Page_58.txt
f90a82608615e2600cf261935b8c03b4
29ebdd4b082748d14644a83b5c7f34a4f72013d5
1998 F20110331_AACMDM srivastava_m_Page_44.txt
9d1f793c47841fa64fd1867522da65f2
6c56849ee87246c2036f563e4cbb58d8a85ee679
F20110331_AACLYH srivastava_m_Page_06.tif
4030f561bec2fea94b4363ad03787c2e
d7c3aca8b9a0097fd3085c00068d3af45685aa1c
2160 F20110331_AACMCZ srivastava_m_Page_31.txt
a19c5cc2660e3593fc1972440a64534c
0622fae2f72fdd43dd506fe2e4f09f556b6de90a
1121 F20110331_AACMEB srivastava_m_Page_59.txt
e8f5fcfe456febb47bfd5b41b82a5654
385b94fb688d87191ec72f476bdb23ba3f5e2644
2211 F20110331_AACMDN srivastava_m_Page_45.txt
ba9b3e62fbeb884cc0db888b6fa58526
95caf8a548c2d38a3689cbf5fd94d214577a1692
F20110331_AACLYI srivastava_m_Page_07.tif
6667733e66e6b0e13071f0463bb94ef2
2c3cd335ddd3a4a9221aadfdbd004b5e58192efe
1163 F20110331_AACMEC srivastava_m_Page_60.txt
8a51688268a2a6a213af9879d62fae97
98c105f79c79a79f8c709a670dd42a347acd7578
514 F20110331_AACMDO srivastava_m_Page_46.txt
b6fd73717a84372ff16d8c2ad99ac51f
acd83554f36362c60d634ed37e3ea87f8f674d5a
F20110331_AACLYJ srivastava_m_Page_08.tif
6ce83bde330a97b4dfa7c12694dc0aad
67c9545c63c549589eed90f7f96cf2e40b6fcce0
1279 F20110331_AACMED srivastava_m_Page_61.txt
87117766fe7a506fbafb1856d6a0dfbe
510e6150c0aac8afa1192583d26c894aa5e3b283
855 F20110331_AACMDP srivastava_m_Page_47.txt
5b253ec29d28c172b38f90f0c80259a2
b9a118c1b970840daf0311aa2e1c4b991faba084
F20110331_AACLYK srivastava_m_Page_09.tif
707c018160f48e5c83a2a5abc04581d4
154d26beb64ebb9dae05526293b3b6214f2eb494
1207 F20110331_AACMEE srivastava_m_Page_62.txt
dbaaeb805087fc30408dfbed931fee48
ae4979d7605edaaaf18c92c97a0ff225994af234
853 F20110331_AACMDQ srivastava_m_Page_48.txt
bb67e1372dc03755996c2af9dc1a8246
61ab5b101d202b5d6a2631a5e51d01abfb65f1e5
F20110331_AACLYL srivastava_m_Page_10.tif
de55e907017d183ee741112e571e2f6a
0c2a453769b40411c9913447af723b9a7b9e05cf
2191 F20110331_AACMEF srivastava_m_Page_63.txt
e2016d017638c9a2d566f55b657e64e7
87d8b2e4f36416b1e9d4599a701f8e2a6d8b9e90
703 F20110331_AACMDR srivastava_m_Page_49.txt
058ddac48f16de9a3de7aa5b3c190d30
0da403218dfdef6b143cf3003164cfe17693cee3
F20110331_AACLYM srivastava_m_Page_11.tif
b2e1f272559bfae77bf6492a3a90adbe
be538af9f1442df168cfef5277a1e17c1a76dab5
2202 F20110331_AACLXX srivastava_m_Page_77.txt
cfeba2ef14727266617a94e3a4bdb010
31450653c41e628f0cc3ac2ce5676e2a4a0a1337
2262 F20110331_AACMEG srivastava_m_Page_64.txt
5dd0875efb36d9f0daa6183820fb0927
b46e86f57c53a3e0617967cbc6ac0c1a410a8870
F20110331_AACLZA srivastava_m_Page_25.tif
c5cc4db79ae8bee12b60a643c089d14c
a60307f3005f7b076fe6a0103b22124913de2a39
973 F20110331_AACMDS srivastava_m_Page_50.txt
4f638ba010c9443116acc22c493cff96
2a928dfcb2c196e8685f1b19c730a5010b7ea144
F20110331_AACLYN srivastava_m_Page_12.tif
6a089f96a310ad2ecb2bf355a025a468
734de187459a8ce8b93a00e3b1e06d8638a169e6
121827 F20110331_AACLXY srivastava_m_Page_32.jp2
4d6b34ec5590e26838da271b5bcdb699
f64f08b0eb867ff79f5e4dce97c9c2b33296262b
1403 F20110331_AACMEH srivastava_m_Page_65.txt
a628e8b81ab3eee406190a2ed19e226c
a12ba5c159c20755eb705940b49916c144b924d7
F20110331_AACLZB srivastava_m_Page_26.tif
e466c7d4fc75345013b231affb9ebba2
6337bbcb011ce167818d864fd272bda709050af7
2156 F20110331_AACMDT srivastava_m_Page_51.txt
c13218bc5d3da914d4febc8d51b6431d
9f20a7e9111bace5b3d36232332bda2d4372d2f9
F20110331_AACLYO srivastava_m_Page_13.tif
25e843c915b5399585ecc517130ee8d2
e9a1a5a29e2f587eb5c9d601dc41b3c4208cf6f3
159264 F20110331_AACLXZ UFE0021791_00001.xml
5e2e002bc06cd9325cbe5bbaa58b24fd
df4082dde085477c26295db24b7a35d5cf35701a
754 F20110331_AACMEI srivastava_m_Page_66.txt
8eb3a5b000a06757da7edd045fbbf15b
8ad486afa4b04e8d1dd5aadc01b18db61f6915d5
F20110331_AACLZC srivastava_m_Page_27.tif
2ddfdea37e9ab813a46ef9c8bdf4621b
852a0fbbcea88d7da891ea6e5eac5a6ef085595e
2242 F20110331_AACMDU srivastava_m_Page_52.txt
cb4e3d99ce0a929e57a3b5ed4d7ce6c7
14a6f29cd2b39d87897356b89e922fb729cc88b1
F20110331_AACLYP srivastava_m_Page_14.tif
f9c10dbe9aef717e4325511e4cdf9769
190a5d616a6d3cd64df729dfee148ea4e2d4f52e
1286 F20110331_AACMEJ srivastava_m_Page_67.txt
ddf3951336660b18aa0a0bba3c6c5896
6c2601e6519e25e55bfea1137614cb6e3d5b55cd
F20110331_AACLZD srivastava_m_Page_28.tif
6b195c6e5291d9fb078c8b73b43406fc
6041bd6a4fc35a3841279953dbf3cade57e92d14
2203 F20110331_AACMDV srivastava_m_Page_53.txt
f7dd2778d692f1bd81b525c6053d5de5
ca9a4cc88f51b2733aaca5ad8eedb8d3ff8dc7f8
F20110331_AACLYQ srivastava_m_Page_15.tif
0cb75d101e5496c4506e7264c4d4518e
2c6846090d263a7a6225dc43a086d660f9f1934d
1178 F20110331_AACMEK srivastava_m_Page_68.txt
7fdbb229dcdeacfdfe953948facb602c
3c83501c917019e1bdcf31866741345f05c6e296
F20110331_AACLZE srivastava_m_Page_29.tif
d06697748881e71efa8e072ba150721a
e369b3385dc18fc30a31daa8b60af3762fb91c88
2258 F20110331_AACMDW srivastava_m_Page_54.txt
e5d8c2282f9a0a9178d3a22792d3804b
440f98914b3717f0731b36bfd20cf3001b6b43e2
F20110331_AACLYR srivastava_m_Page_16.tif
3473a64cf6fcab920e8a1913dd2e4684
44ebc30d3e82f39d38884dc2500975a397bd7e9c
2233 F20110331_AACMFA srivastava_m_Page_85.txt
d105158ac5a2793a4d7418af8c4fa891
16184a7ccc4da683bae54cde6a032d85be257ffc
967 F20110331_AACMEL srivastava_m_Page_69.txt
061fa8d0a644c57c83ce8f2f5097f7e2
b886730efb75f6e74ae82dd6cf6dedd91ef56197
F20110331_AACLZF srivastava_m_Page_30.tif
c015c1b5d536e206bb17c884f8ae1368
7adcd7d796869ff12db84bf6df75b005943273c1
2124 F20110331_AACMDX srivastava_m_Page_55.txt
c4513ed9b725249c9cacf856f4bbeb41
98bd1d89bf003949db3363b13bd870b8b7e9550c
F20110331_AACLYS srivastava_m_Page_17.tif
c51c7d27cb16c47eab590ceb4691414b
ec4ddd13a414a776bd3a116764b5042720312713
2184 F20110331_AACMEM srivastava_m_Page_70.txt
e27f3a4f832d33b6b48c17e0e22c1a74
eca865d72445132e650ffee362446663e6caf736
F20110331_AACLZG srivastava_m_Page_31.tif
6b38a51aab00587fea0f74e38ae4186e
5c3ddc84f003f35f7210c569905ccd06182ff977
1001 F20110331_AACMDY srivastava_m_Page_56.txt
1b13faa79a25edaa150d2cad8bfc5578
53181216119b2fdc3ba8716c72ecb153632b20f8
F20110331_AACLYT srivastava_m_Page_18.tif
d6cca09c77f61f3697a227d6228384bd
ce9061f331de9b6b56ab7742924c56e4455a0272
2207 F20110331_AACMFB srivastava_m_Page_86.txt
a48fc5da91f3979e5f65abb3b7812327
4eb6a06128410058a10960e777d470b9560a4261
F20110331_AACMEN srivastava_m_Page_71.txt
f76270128a00759b990a844bbf4bae0d
54e04f8a68146e10d5f3b59762d7c96bee163200
F20110331_AACLZH srivastava_m_Page_32.tif
4138c7a40973b0ea05e81fc8e1a5d2a4
de6b45a7a33a0c53e8f34d5cac37a45deafcb727
1220 F20110331_AACMDZ srivastava_m_Page_57.txt
69638dc734b1960c07a851deed12d5b1
7726c810caff17df290bda40dfebffb93d1fcf7b
F20110331_AACLYU srivastava_m_Page_19.tif
95ac75bbf5139920d37fc70a2fc80503
955d6cb442c82b2a2745f009e8eca601316020da
2193 F20110331_AACMFC srivastava_m_Page_87.txt
363a642f6fe79cf95c8407da13a66852
1bf3be4f1828844f41dd1e82beda88c0c2952669
1499 F20110331_AACMEO srivastava_m_Page_72.txt
89474e9babf46e451a0d4dab7a798284
7ea96efe3ef77d8a3e2f4a784757d92191be760a
F20110331_AACLZI srivastava_m_Page_33.tif
13d7a6bac57741be079d33aabf219eec
6bb2d1239529614af7dd2bd185caa3e063818a1b
F20110331_AACMFD srivastava_m_Page_88.txt
fc4eb87389d069dc62061c1e8d110557
29d56fa324ee23a6d7ef1b5a61a2e17b1a396de0
833 F20110331_AACMEP srivastava_m_Page_73.txt
b6515094b548d7d45bb3885cb5b455f3
95386d3c3ba8880d0a68f39186a5314aea132342
F20110331_AACLZJ srivastava_m_Page_34.tif
e778ea70a35171e4fdb67cb58b8c0589
0fbee24de147c0a37eb08233630d2240fa634e9c
F20110331_AACLYV srivastava_m_Page_20.tif
bb77c072281c620bf6e1ace658de67a4
9645e7e853d7c5a4a9825e45922f91c291d177fd
2199 F20110331_AACMFE srivastava_m_Page_89.txt
a9c7e4befd4437a4506760f99e10adb5
06183f0b872254d47cf31df1bbd4c70583291e46
916 F20110331_AACMEQ srivastava_m_Page_74.txt
b367e886d2b22dceb4c17c082d21fd0c
16a874a3439f8328bece78f1185490b9ceb3803e
F20110331_AACLZK srivastava_m_Page_35.tif
e000d4e9ab18e88b37c10dc64835b3e8
b6724086758d924cf84cdffabb2ad4c876ef1559
F20110331_AACLYW srivastava_m_Page_21.tif
e5c3d3b60089a08f91d8d7e7aecd77be
7ffec423f9dc0ad5f8a12d82cf6ec506bc929da1
333 F20110331_AACMFF srivastava_m_Page_90.txt
b046f5af03b89ceeda1b72fcd9a916a8
c5c61e1944f86aaa38f6ea37fe6a40e7c806205f
1011 F20110331_AACMER srivastava_m_Page_75.txt
77f3ff1000b150a4247bd661b54fe2aa
785a574323f01e944194748341d654c4f163ab70
F20110331_AACLZL srivastava_m_Page_36.tif
e52831762dad10acd1b9e1b2107df36a
0612b78c742c81ad3e3bf018a85dc89e87f98211
F20110331_AACLYX srivastava_m_Page_22.tif
e7173a2fc9ba8248fe507da22153946c
7215e4fcfcf6371e6b1abebb402cbd16e3a5d1d0
2501 F20110331_AACMFG srivastava_m_Page_91.txt
0e3a37cec6e399b722f492eaf423ebb1
930c169681aab80b32ab21844f9e4c47992a22bc
F20110331_AACMES srivastava_m_Page_76.txt
4734fc9b6e5372b8e8a8cc123c6973e7
b8eb9c532f1c31e8fed5f431d91cb06a737d815f
F20110331_AACLZM srivastava_m_Page_37.tif
a0cd68b282448d37ecf6c87aed31b2d8
194345eb5bba2b591484cbfad0f530c001b808d5
F20110331_AACLYY srivastava_m_Page_23.tif
0439d43b70f4875bb8b4767effc98198
ad072d06f46e9ce9b20c33f589f5b731e32ebd3e
2585 F20110331_AACMFH srivastava_m_Page_92.txt
085c2a47ae27a649ed29b3b812e642b3
2322138b6ec85bea477c03ebdf11e00c8e4fbe82
F20110331_AACMET srivastava_m_Page_78.txt
21d3d5149b495a5292cc3ac9f005ceee
c03417a7833305191c2fb0f77bf65374ff31367a
F20110331_AACLZN srivastava_m_Page_38.tif
8cbfa18b8ab4916b30f5238945cdb954
998ee5d939f1abeb198d6184b0db733be6ad61d3
F20110331_AACLYZ srivastava_m_Page_24.tif
d5ab593a524d86abc2c3d672515c783f
9fe99fea974f7b995f1012f952fc8242590126c8
2650 F20110331_AACMFI srivastava_m_Page_93.txt
23617f31a209c6522bdf45648b51f6b6
a61aa64e959c9692f325bd1e822e0455b31e1dd8
F20110331_AACMEU srivastava_m_Page_79.txt
4287a7c6683d6756ac70a887b390be3b
0ee4644cefc8faff5cc9b63a659aa9a9a3f554fe
F20110331_AACLZO srivastava_m_Page_39.tif
93ba971eee3234cf634a0811363f7248
7612fa4afad1fe68b1dbbf161180f297f0204354
2651 F20110331_AACMFJ srivastava_m_Page_94.txt
0fbe9269b653940965e022b84c041ac5
2bf436a6f5b19911a5010c04a0bb925fb26dd9c0
F20110331_AACMEV srivastava_m_Page_80.txt
4f0c34d91c22a56eba4c6d01d5eadba5
bc1b48909e9b3b7a792d261e5c8f66e063091692
F20110331_AACLZP srivastava_m_Page_40.tif
036604b06898ea22d339f7f18c93f330
48a753cfcca716ad12eec8c5b0d23a15ad55c249
2490 F20110331_AACMFK srivastava_m_Page_95.txt
59fe2eabc3f9e4328a393289ecf65d5a
565240d8c96417542ae6d6a982990420201315d4
2147 F20110331_AACMEW srivastava_m_Page_81.txt
334f6e167d716e93a95bc68901b5185c
70ce9b3059160212a5359c656acd90290960f023
F20110331_AACLZQ srivastava_m_Page_41.tif
8e0f2f4f8eba29ac536f61f15fc7c6bc
ee433047b592a5b605d8b007b336ae5284dfc155
411 F20110331_AACMFL srivastava_m_Page_96.txt
5d0c32a3add7a65542081f4e7e1f093c
66ba33001b31b2be8d87d74644ad7c19ede7f71c
2158 F20110331_AACMEX srivastava_m_Page_82.txt
3b1df2194e63897243c18afdda3740d1
0a44ee70ac74052f042d7eac63e4bbd5244ff41b
F20110331_AACLZR srivastava_m_Page_42.tif
ac4f5bb2ffe6ad100e578a1ffc36638b
78570bcf20c3d9eb2f2f06acbb44a77fb77f90b8
53967 F20110331_AACMGA srivastava_m_Page_14.pro
768047a64038087973a76622fe7169ab
1f4fb8cd5292fc27bc6344e9e21f2766c5d01320
1682 F20110331_AACMFM srivastava_m_Page_97.txt
cc97e22039fc443c0f4f6cac7cc7eb44
90eaf7ea69145ac27f1bdb41ad127cfef81a09c1
2221 F20110331_AACMEY srivastava_m_Page_83.txt
e10bae436d7880c1aee02b1ee3605958
173ef6f093008b98e8ecc9b0f21193b8dd904e27
F20110331_AACLZS srivastava_m_Page_43.tif
0c68abc1fe7c20ccda95e652d5e198c0
db9db813d6dfa4caea4720bdbd432ade378386e7
57270 F20110331_AACMGB srivastava_m_Page_15.pro
d356c580320f965e964e9226c6e8f4c3
bd58e084fa0a5dcc825634045616b2f55323f7c0
7243 F20110331_AACMFN srivastava_m_Page_01.pro
365ee6db104d551ddb81c06fbf657ac7
1207cf0c865953d2b78d5efc2151fbd9395478cc
F20110331_AACMEZ srivastava_m_Page_84.txt
dd9428aec06bead3d48c679eeae9a886
7697543f73a9c6fb943b6cd7c31a2822afe9bd53
F20110331_AACLZT srivastava_m_Page_44.tif
ba1eb40363059152061cef50a622dcc8
cc0b2aa4a4be7ea022761480f5bb8d96614edeee
890 F20110331_AACMFO srivastava_m_Page_02.pro
eb1f247c2df4e8e879f81ddaf1c93839
a32f39e8ba2b49f44cecce50329cd2640faaf9c7
F20110331_AACLZU srivastava_m_Page_45.tif
ff7ff1c9d6a3c5677861d57249cea04a
67d81096a130fccbdbd61d1d7c3b3fdaa0e4eeb0
57628 F20110331_AACMGC srivastava_m_Page_16.pro
fc27680810386acb85ca4351cb3d6ad5
01a052287ffebd5ef43fa5a3527cd9f166ac6cb9
914 F20110331_AACMFP srivastava_m_Page_03.pro
cf329b7564adbf257bb6e88949410040
d14827d8eb8cf3792d74023c87895ff7fceb7e62
F20110331_AACLZV srivastava_m_Page_46.tif
b569a29840683c4d3b1224c610495ede
005e6c8a871f8f06e87e233ea8eaf698a4ac8645
54893 F20110331_AACMGD srivastava_m_Page_17.pro
46fdd4eb3256f73b712709df1cdb4e0e
52d9eed9f5c7a49e2d319beacb45b63035c25d0a
54408 F20110331_AACMFQ srivastava_m_Page_04.pro
40558d0a56e963ceca6d6201dc8cd9a0
3ad70d027a8fd7ec784d3c1c5f360f952badd4ee
56123 F20110331_AACMGE srivastava_m_Page_18.pro
7c4ee1b96a3dc82947fda711aa86894a
761156fdb20b58e1761cfc88e6d54a5ca25dab7b
20846 F20110331_AACMFR srivastava_m_Page_05.pro
58572b82b8dbc73dd4b7c8fadc6267ea
b1379faf30be3c0cfebccfafca6b3654b51bf021
F20110331_AACLZW srivastava_m_Page_47.tif
da2c2932725eba5a05558e78ff2f9b1c
088743feb0276d0b0479bd6c5a9be5dd9f938781
57001 F20110331_AACMGF srivastava_m_Page_19.pro
3771626ac4e12c7a9f57dcd4fa8c912e
eb700fb02e31db423a8026644455880c52066458
86995 F20110331_AACMFS srivastava_m_Page_06.pro
b600d8a1a259807fa8a417a8579644c3
5c746d07610b48a2b4d2d5dc8990931f6b66209e
F20110331_AACLZX srivastava_m_Page_48.tif
30fbac7c6bc757ab248d07967a3bf14c
36c851935a5326c8f848d4197697706e6a197f5b
54635 F20110331_AACMGG srivastava_m_Page_20.pro
f3c14c29c1911b040ce705bcb1f41b49
fe0578955086ffdbe5cddf20891ac356df5909f9
45212 F20110331_AACMFT srivastava_m_Page_07.pro
8151818f9458abdf6ddb706847a71e08
1e7d812ab48b7c39e36e6fca42d65003efa4a2ee
F20110331_AACLZY srivastava_m_Page_49.tif
101c1998883fc119a1e5a23cdc392d63
430ae5d9939b04a669dbd76f408f4c7ec9676829
55382 F20110331_AACMGH srivastava_m_Page_21.pro
19425acdf0636b0d718319120643368c
4546e811c2fd63f91a3db79462ae2b80ee426a13
17003 F20110331_AACMFU srivastava_m_Page_08.pro
aaf5054c17133549209b9530694a9700
54ee4f51f5b77a2b795130e35cdef2b980621c8f
F20110331_AACLZZ srivastava_m_Page_50.tif
2032ec511fb03041e6a5bd73b4a832ce
d9c2535aa848ab6b74214fd44b77fe859d8b497b
56675 F20110331_AACMGI srivastava_m_Page_22.pro
70477230d6da03a60029f22854a468d8
3005f38c70935d89fc15babf865cc330fa09215c
51383 F20110331_AACMFV srivastava_m_Page_09.pro
0e3f5245031470a6f14b2187183d848e
b5aac7e7e95e8f153491adb1544b5e296cd1fc43
57770 F20110331_AACMGJ srivastava_m_Page_23.pro
24f6f8594e8c4bd6c8d17f83fc04e8ae
5b3b52336bfbf39aee8d1fb94093682f4f3848dd
23167 F20110331_AACMFW srivastava_m_Page_10.pro
e6870560e4cfa1338bc20b0a073d5751
7377bd767ea7664f62cdb970d76979fed9768c7f
58630 F20110331_AACMGK srivastava_m_Page_24.pro
7b2012dfb86529edaa16f6d60a44c5e4
77b969a1741b5539abe58df299bf7d29097bbe9e
6825 F20110331_AACMFX srivastava_m_Page_11.pro
468f9e628351a58745957d609b31cf0f
d25498a4066165a40415e0e9f206f431d72b5997
25988 F20110331_AACMHA srivastava_m_Page_40.pro
e6c6d02e49e36261f90985facb8fc8d3
b70447556afc397b3291b790d2ba4a69813e224b
55267 F20110331_AACMGL srivastava_m_Page_25.pro
46f6a6a6eb01b744c0a970fa90b034c4
dc2346b1754164a619ced4e7d6eba2984e7648c7
48725 F20110331_AACMFY srivastava_m_Page_12.pro
840d42f56282e45858f1b3f35a776dfe
53f89a0ded86764414419d1235eaf55401f3f7a9
41014 F20110331_AACMHB srivastava_m_Page_41.pro
63e9328d372b71bee02de3aa090da72a
3b1ca67456c2d1c41344d600b51a5fb02628bcc4
38303 F20110331_AACMGM srivastava_m_Page_26.pro
5590d84b206f77d0d53046ea35ff46aa
6742b5e56fde856060399305d56c21b874b3b3fb
53022 F20110331_AACMFZ srivastava_m_Page_13.pro
6fb2f4340676917bfe7487041b0a195a
184def1f60d332606d8e911da909978ce6e09f31
16644 F20110331_AACMHC srivastava_m_Page_42.pro
62b3a2109779ae689fdca1536802dbbd
796192388d97e6d29a8affb3c15632128df318ab
15064 F20110331_AACMGN srivastava_m_Page_27.pro
f751742868f93ea3d0a1da61c9da5baa
ccb50f55eb6134ac43203bdd62348ca2bcdcc7f4
4454 F20110331_AACMGO srivastava_m_Page_28.pro
e34e7ff061a90b95b40a6d91e6e562f5
c6db142891619cc5c550f01c5be2e8c52bc050fc
6976 F20110331_AACMHD srivastava_m_Page_43.pro
231dbd855c748e5fd7942f03a4ac5d16
4c60b4d595b60550cfcd1b23878b78c6312ddc66
52208 F20110331_AACMGP srivastava_m_Page_29.pro
5efe4343b10e4ca3cb06f26d90233c99
716d418fb2178d16d7d3fc3b641ba23f2475e543
48470 F20110331_AACMHE srivastava_m_Page_44.pro
8adb8880b18eaadf419601e94ab8be9b
dfd5e610f21c5b26df396ddaa30b87028a85791d
54761 F20110331_AACMGQ srivastava_m_Page_30.pro
0607126cc31730b241bec9fc494ecce8
588710897eb86a0804d342b4a75ea6e94f28630c
55311 F20110331_AACMHF srivastava_m_Page_45.pro
951b3ffdd96ec814f5e0a3fc6d505dc9
ea618edc61d191e82d44478b628afa8ab30d51ae
55090 F20110331_AACMGR srivastava_m_Page_31.pro
b144d4612f1cd0fa0dc7c4edfd97cd63
cdace79dbf57c5739e12cbf089b6b551f7ede064
12960 F20110331_AACMHG srivastava_m_Page_46.pro
d5229422284930ef62c40513a82df0d3
9cac59dc202cbee1151440558682daf1f24c431f
55760 F20110331_AACMGS srivastava_m_Page_32.pro
f2268f73d8094d3fae56988932c0f62d
61ac58216d6c079f9badf7e11f8bee5203923e2d
19169 F20110331_AACMHH srivastava_m_Page_47.pro
62c23cd88ef7153441a3bfa1a014c55f
dc98b8b0ef780c2eb073a3bff11ba5b0566d0c4e
55538 F20110331_AACMGT srivastava_m_Page_33.pro
2ff3baba80b0daf44dd24a17d70f39af
692f5fc762ef00dcef4f07ff7ddf9aea7d9f2798
19297 F20110331_AACMHI srivastava_m_Page_48.pro
51b0c9097201819ae0474ffa2be914e7
f39ad352f069985050c230c71ea5834b33265dbf
56489 F20110331_AACMGU srivastava_m_Page_34.pro
0e5dfdd2ffdf3065f38e4bb472b29311
3d2615752ddae2c27e1250bcfda723c6cfcd26ff
15963 F20110331_AACMHJ srivastava_m_Page_49.pro
5090d20b27cc874f41f2b482d4201ec8
8b06f4048019e3b73d08f02afccb79200bb04f66
57678 F20110331_AACMGV srivastava_m_Page_35.pro
e8e952fb3b730bd6f08f24601e272291
b9dd4169d667dc81cc044ccf5a6ba0e483f50a4c
19900 F20110331_AACMHK srivastava_m_Page_50.pro
08cd596debd1667800a1644830a8c733
53c78c97ce8c6df3b40d8b54fe18ac044ce922c1
53779 F20110331_AACMGW srivastava_m_Page_36.pro
cd0ad467dcee6fcb6f256c96d2b417a6
edfed2ba04cad30af558161f3a8191dafb86be28
16770 F20110331_AACMIA srivastava_m_Page_66.pro
5ad43f33a34843a05e49c43deccc467d
8c176e245dba614133920e45184e0ee75bd02756
53767 F20110331_AACMHL srivastava_m_Page_51.pro
705a80941ba3eaf3fa3974b3b8c8fff6
71fbf91aa3a2eeacd61120035f8343a01756a055
55705 F20110331_AACMGX srivastava_m_Page_37.pro
b8320a6f4f92c3728841a33717dd1691
cd711c9070130b93a12d79eed376a75ba013ef02
23192 F20110331_AACMIB srivastava_m_Page_67.pro
c0c3660f5566f0b45e42fba5d5ece4f4
66a8cc9e48f94411b2aea8ff9f56070a5c81d199
56662 F20110331_AACMHM srivastava_m_Page_52.pro
a025e7f8ef38972b7423c396ab0799b6
7beecf35d8f6d8d574f76d351b071845d27a3722
54733 F20110331_AACMGY srivastava_m_Page_38.pro
32b94e3608ef23b7ecbb92fdf65b8057
67629301bc40fc4a1cb23b1d1581453cefcf1317
26248 F20110331_AACMIC srivastava_m_Page_68.pro
2e50a491f010b5620b21a07c6ce73b6c
586ff75a33f4097df660ec830d4bc9d81f3c0c32
F20110331_AACMHN srivastava_m_Page_53.pro
71d97c9ca56d8d851a593e2b65c6e466
aed40806ea6ea4c683ec044e7681d371b67f1fb7
55324 F20110331_AACMGZ srivastava_m_Page_39.pro
bb7c3f64a9f14fc53ad031bc069ba058
80433bcf5009e86e20e52e09d7e8a8197a77a41d
22020 F20110331_AACMID srivastava_m_Page_69.pro
98548d759b53633745355d5970f94705
9f35ca914fa3fa16091b6b404a68f834da6c0d23
57552 F20110331_AACMHO srivastava_m_Page_54.pro
e00edbb2a6c88dac15d5f5e76001bbd3
bbbec8355d04d2637811484a1068d3dc089302bc
54262 F20110331_AACMHP srivastava_m_Page_55.pro
89b59ca3ca45ce11d5aa1dd527500e52
cc1fc04ec894f10510dbea78c26f2581194110ac
53283 F20110331_AACMIE srivastava_m_Page_70.pro
3d17b39268fb6cc2be13dedb1f03531b
726c93a1855d65ee50c0549beae35d70d71a9f54
25245 F20110331_AACMHQ srivastava_m_Page_56.pro
bad7ecf5cf8831f5f0fa4160437d219b
132688f1c084ce15f6dc56407b71a03dbde76406
24758 F20110331_AACMHR srivastava_m_Page_57.pro
8cd1a8bdfa8f65905d99ddeed17505a1
b3578f44870feba70f5e5aeb2a1d145ad3c03e39
55634 F20110331_AACMIF srivastava_m_Page_71.pro
db750a2201bbd107dbad5f616889159d
a386bb2b80a493abd03f4ca99d1876452e29fdeb
24647 F20110331_AACMHS srivastava_m_Page_58.pro
ec88fe7f9aadcf084ef64869a1d50140
49c603344941c35ed8bd8ed8f7e5299059740d9c
37447 F20110331_AACMIG srivastava_m_Page_72.pro
de755f822cc8ca7ccd3d2fe0ee6d98d6
bd216ba57ac1b73317bebcd2e5a88633df9afe18
27243 F20110331_AACMHT srivastava_m_Page_59.pro
f62bba95e062cebffa66f870198d2775
da3aeacc8f1b1b496548586e85e184965079eb52
16218 F20110331_AACMIH srivastava_m_Page_73.pro
2bf27a6be3f39df8a7ff5cf515b0f5b7
29a69b9b23201d17304eed018735b5dcb003642f
25720 F20110331_AACMHU srivastava_m_Page_60.pro
03304cb376ccb1dc7e5574470391482f
63c66df7a01162511a62c3c9c25b19aaa9758958
20332 F20110331_AACMII srivastava_m_Page_74.pro
b55adb0b634ac4aad5c8c2f1a6fbf2c3
d6d31e215b1435e0d1fdc703a2b5e1121b771bbf
28549 F20110331_AACMHV srivastava_m_Page_61.pro
dee1147510911c2f8163dc3bfc44e534
6426e6a5ba28b596fd4e0c6313c5468189446044
22214 F20110331_AACMIJ srivastava_m_Page_75.pro
2698c3992b03ad221e6c693eff081ca7
57d4680a3519436ad6e1b72aca3169a814ce72cc
26984 F20110331_AACMHW srivastava_m_Page_62.pro
b0b8605046de291ad5ddfc75ef2941cf
345125fbbabba50e7dfa5c6da3051852bf6b3bdc
51806 F20110331_AACMIK srivastava_m_Page_76.pro
1d1534c2f975950c764ce5d5319313ee
4e7952e8b7089fd03f555db6d551755fd95a9a6e
54159 F20110331_AACMHX srivastava_m_Page_63.pro
fa1366fd76a500570698a9d54095e036
7312dfb1c36d2c70b5bf97b31c07d95bd3d899e6
64235 F20110331_AACMJA srivastava_m_Page_92.pro
7c12a2899e025049a4b28eb24e293a16
9a3c777881b458d759ea5753dfbfc772e3c6eb2e
56140 F20110331_AACMIL srivastava_m_Page_77.pro
915d06bd6b47068f27f800a781e7098c
500a2b43fb9e3437370130e7696d6711fc3ffa63
57268 F20110331_AACMHY srivastava_m_Page_64.pro
13f305cfcc0db90ba2fa3c3b41faf264
b5821f80b00a2e1f18fede5edeb10c0c50f39c82
65897 F20110331_AACMJB srivastava_m_Page_93.pro
ed2b717fe6f475ac67a98c2d1b4e863f
35094a462c4519724987391946193785d5b42c9d
54350 F20110331_AACMIM srivastava_m_Page_78.pro
cefd05eb1920f8eee3d6d6f4f3c91f7f
f8b75473891fd8651db645f54e26f8841ef356fc
35289 F20110331_AACMHZ srivastava_m_Page_65.pro
66c9740e84567100bc9f19fdd7743f01
75cdf66d740ff2bba383364a4e969d482a990d3f
66296 F20110331_AACMJC srivastava_m_Page_94.pro
f08735f48e159ef66c8ee59e58c05676
bdccabbc42c1e64580c43fd3ef49a167c8a023b1
57144 F20110331_AACMIN srivastava_m_Page_79.pro
7772de1658e4595672149d98ab829ddc
56cd807ea6af13b989fc9d9bbcb623cfc6b30918
62143 F20110331_AACMJD srivastava_m_Page_95.pro
ed0fb70310387a1749e3c88f7fe4f162
2992fbb5f6f67c9506c5ad86190a76bb958cf252
53706 F20110331_AACMIO srivastava_m_Page_80.pro
00d113db5432566ed74399be9d630bf9
f2102ef52b8fff4446584c5bf625c49de544293e
10048 F20110331_AACMJE srivastava_m_Page_96.pro
c67fdc2bf897b3ebe8ae0b98d7d33582
408c09de786b845c4e51d08b4ae9304f4ea63023
54718 F20110331_AACMIP srivastava_m_Page_81.pro
7397543f640f681ddf42562d619ae169
af0c18416e49673307bfac47787a7a9a415ae74b
54916 F20110331_AACMIQ srivastava_m_Page_82.pro
cc50bf72a1e8ccf78e753f6a60111db0
4f079973ce4b75585fee056d576b32506a5de34b
41355 F20110331_AACMJF srivastava_m_Page_97.pro
8091c0993a8cca41c576d08db97d8479
a9e75b4c831d2df2b70ec3a7b88d69d93844183e
56804 F20110331_AACMIR srivastava_m_Page_83.pro
b5d09eca109ed5d9b804e1dc5e654905
ce8d3f65b4c172496faa81e2c530f6b0dfe34788
21622 F20110331_AACMJG srivastava_m_Page_01.jpg
3e92c7d65f568d72288a9885332fb549
29f9f03c95bf52349c566899b3d277b5342d4705
55832 F20110331_AACMIS srivastava_m_Page_84.pro
ff922da45aa0606b5de6bc48db336844
12ec3f9997e50c5513c5710c2ecbfcfa2ad02c4a
6768 F20110331_AACMJH srivastava_m_Page_01.QC.jpg
1bd8fa6d9b73f5b8e50d13708dcb5333
de08f255054dacf5b845c6b77845d827eccdf28f
57094 F20110331_AACMIT srivastava_m_Page_85.pro
21af9ee9d5a07274cce69378d6b2b816
6dd93d716fe2e2153a1f9c5539cd214c238fd75e
3966 F20110331_AACMJI srivastava_m_Page_02.jpg
0e080fcefdfb6cbb201271f6e3b60d11
cfe62e3e4a36c0396e7b64d5a38452197ebff820
56221 F20110331_AACMIU srivastava_m_Page_86.pro
cc93e114e97b767018fb77b415916ae9
f65315d1407d225f9ab9a57d50d94d1995729692
1180 F20110331_AACMJJ srivastava_m_Page_02.QC.jpg
a0d0f7750b0e896f7637020077ce7fad
18f5c04d4988d081527585f0686a0b43591bcb33
55946 F20110331_AACMIV srivastava_m_Page_87.pro
af9862e2ae83b46945064831f7dfaebb
ad9a4185a757c4dd0d79bee69d688e59c049e502
4014 F20110331_AACMJK srivastava_m_Page_03.jpg
48291332e43b99eede2c257daa3266ea
8e7b477f77be2a55b482838e3967a60ed09f633a
56298 F20110331_AACMIW srivastava_m_Page_88.pro
d253bdaad6456f1b0df631d1da3c5610
4a9eaa7d7126ff4faa13d6df6d4f75f6d28a9557
15150 F20110331_AACMKA srivastava_m_Page_11.jpg
83024cb77f6c7b9be5f3b428d82038ca
1637be89c868dabce0796211304962570accd962
F20110331_AACMJL srivastava_m_Page_03.QC.jpg
23fd0bdc4810d014ee53aafeb8b3a756
099d285fa658495836b8e0d3e4a82e52087b1be4
55967 F20110331_AACMIX srivastava_m_Page_89.pro
454a3fa8e3950821203768c7d9970710
8a9e17779621129ac783e957e0f1d61227a435ea
5393 F20110331_AACMKB srivastava_m_Page_11.QC.jpg
cca930a680e5065be8761d3dd598d993
b771b7d5d083af9a48d4abe36b73dd5d77867921
111896 F20110331_AACMJM srivastava_m_Page_04.jpg
2e98e601451e7389a586308c96b6cac0
95d20cf57b50a4f8030b8adbd472676dfd36a180
8317 F20110331_AACMIY srivastava_m_Page_90.pro
1fbe4e323d289e5aa3d10b62a75d7fa7
8d8e01b6a71861952e7495c18a97981cff0b0718
99285 F20110331_AACMKC srivastava_m_Page_12.jpg
24c6c3b2e8dc49e6294a63de24188634
9195ed636e8008e13e0626580b361b6baa0e44f4
36350 F20110331_AACMJN srivastava_m_Page_04.QC.jpg
8fe5713f5f9b8afcfbf71e014497df71
456afcab8513c49d10b7996e7ab05d52d1feba9f
62342 F20110331_AACMIZ srivastava_m_Page_91.pro
36c075538701b377bb96a4f34b45ea33
e942fffd09c4fd39a465cdf0c5154be70240601c
31268 F20110331_AACMKD srivastava_m_Page_12.QC.jpg
2fd659b6718e2145a928cdc1816c2d35
0813579af1cecd9b6ddac0f62eb90ba86b0c9f2d
45482 F20110331_AACMJO srivastava_m_Page_05.jpg
38dcc1007b5a2c11cf5ab652ea209d16
ecc719981dcf4782883e8aa849cf2d10f6a5c0e1
108090 F20110331_AACMKE srivastava_m_Page_13.jpg
db0f52cad969546a401f37dfd8938c4c
ac11d933ecc468f0f5adbc380f3f0cc3df75a112
15181 F20110331_AACMJP srivastava_m_Page_05.QC.jpg
80cc1cd00553d0dde0a8357aab9f414b
c90323d3b91282195d7a36e3839e398a971acc51
34993 F20110331_AACMKF srivastava_m_Page_13.QC.jpg
f09b4f2c22d6fb42b3d18314b9dd7895
328d9536faf5668e3e0e71fea7fcf1e9ca229b36
118832 F20110331_AACMJQ srivastava_m_Page_06.jpg
7b7a5143e535c44f38dae4de4d3ad5b6
a16696cd6665dac7ad0853a07e00b57170c4c19a
27452 F20110331_AACMJR srivastava_m_Page_06.QC.jpg
f1c3672004fcb57e1480f4f5c6b74bd2
440592316faed0382e6e77666d074d2031e1d29e
109421 F20110331_AACMKG srivastava_m_Page_14.jpg
8d507ff3a179523f17a911cda8932290
6fc9f4793c14e9c55eb62ff632c3be048d3852e9
79566 F20110331_AACMJS srivastava_m_Page_07.jpg
5f66fe3afa6b4ff8659ffbe8f148365b
f1bcbfc2f17f878376910b6d021bf43ac67da550
35424 F20110331_AACMKH srivastava_m_Page_14.QC.jpg
68e70d2e4a20758fb3757534996af506
93da1412fdb921490fa8dc0de4483dcf0e17b76b
21086 F20110331_AACMJT srivastava_m_Page_07.QC.jpg
4720d7cd55065048df494192e97e0fb0
c2646131c0cc3f68eec71fa0f1c3429327dac5fa
116298 F20110331_AACMKI srivastava_m_Page_15.jpg
ffb0ec76c4a734a2d30648b9454f69a2
01b43a8ad0dcfdd75b2be7f10d2c6f7753382d73
30697 F20110331_AACMJU srivastava_m_Page_08.jpg
b461310afb8c823be1e48bd4f2e4d4cc
7aef52e488b4e0b7476d169af8699e379fc7a170
38374 F20110331_AACMKJ srivastava_m_Page_15.QC.jpg
3a291788bd437c76acb143ae6dd2890b
3175df80b8143af9fc6cd8303e0f143e2b15d206
9075 F20110331_AACMJV srivastava_m_Page_08.QC.jpg
9604241b21f6718465673f2147730ba7
8d20888a02d0282f5a794242f5d84d7d3065904a
116372 F20110331_AACMKK srivastava_m_Page_16.jpg
e003c464e2fd93b061e8979df901d72d
c9c0640645a38a23e8136baaf1ec3d26faf5a21c
93796 F20110331_AACMJW srivastava_m_Page_09.jpg
c38d3b8ec5367319da5f2c180724b628
2e7e5f9e01bf69397b8968d8ae699eacf1428f74
38504 F20110331_AACMKL srivastava_m_Page_16.QC.jpg
a07204c77a5488ea08dd3db50db7f006
ab9c9a4e8d2c37b40a723c22644b914587551e28
27256 F20110331_AACMJX srivastava_m_Page_09.QC.jpg
327304036ecd67ef8c315547bc047fc5
3549d1056fe64294fd50f0609b6d974d880bba3f
117215 F20110331_AACMLA srivastava_m_Page_24.jpg
676d463525418afe617af1711f5fa166
93d1bb80334493e5a05cc1608bdea7ac4f493ec2
110039 F20110331_AACMKM srivastava_m_Page_17.jpg
02fabd6a676094fb923f2aec904594d4
296f5f903c8d6d5b157825374f124fac83dc5c83
43773 F20110331_AACMJY srivastava_m_Page_10.jpg
a00934fd214c203870965da85adf2b89
fbc01124567db2c1fd5f1930c81ab5d412ee5e26
38248 F20110331_AACMLB srivastava_m_Page_24.QC.jpg
62992c056e1fd33e86e94c51968f44f4
90cfe99c9def9ee2aa9ecaf64307529bbc8ae5ca
36443 F20110331_AACMKN srivastava_m_Page_17.QC.jpg
1cde887fa9facf02aaac1fea00c81598
0306a75e4f5ef5aa6c2b2a810562bfb36bc5ca01
15549 F20110331_AACMJZ srivastava_m_Page_10.QC.jpg
ed229fe2f5fcc17f47e3a469120b0b21
724ba527398c5f3a8d3690abebf0265faf43d18f
110837 F20110331_AACMLC srivastava_m_Page_25.jpg
cdf4ba23d24b2d9940c9a0cedd43861e
4c0c8ed2b25c893f8c6eb595f4613db63c7b4ab3
113599 F20110331_AACMKO srivastava_m_Page_18.jpg
f4172e779912992c7b48dc01dfc6f3bf
bb298414ce64a46e287f7b2e1f34570463d13bec
36251 F20110331_AACMLD srivastava_m_Page_25.QC.jpg
014cfe8dd59b240f99c20a761eab3ba5
4d90ba0fd68d3ac601a0f17a6930667866413a0a
37494 F20110331_AACMKP srivastava_m_Page_18.QC.jpg
13fef9e2411926d0c8c4ed5f72bffac1
f07c9ed634a97fc3e06b4fe7d1dfcc9c48f70bed
77958 F20110331_AACMLE srivastava_m_Page_26.jpg
a229e7614edee70f18d059b70a8aa5c1
4f52ee7553e9d63f9a63e69cf8e6ccba543eff96
113886 F20110331_AACMKQ srivastava_m_Page_19.jpg
01bc890a1feed2641d2309c43fd50f9d
54757bdb861d579bd2c1be1bbbcfc529561bbaf7
22432 F20110331_AACMLF srivastava_m_Page_26.QC.jpg
ea730b30bb6e699005adfca9321aad96
877356e43e041985564ed8a5faa676a5ff59e49b
37945 F20110331_AACMKR srivastava_m_Page_19.QC.jpg
a0593592503d5ebb2fd4aaa8c5e7207b
e388b269043ccc6473dbea66d9363a51c1755a0f
39412 F20110331_AACMLG srivastava_m_Page_27.jpg
6577d8c02dee83853116f1ae5c7eb981
2f755fb04280441711427db3a7d775edd3a69d4f
112097 F20110331_AACMKS srivastava_m_Page_20.jpg
edaa03effde51846d166126e75806c6f
549ec520edb19d3799eb00a931c5eadcf856c620
36511 F20110331_AACMKT srivastava_m_Page_20.QC.jpg
eb7a88a18d4eff43923ae871608740f3
28611fa231703b9ded08ca69cfdb68dd5bdb768b
12403 F20110331_AACMLH srivastava_m_Page_27.QC.jpg
aab992cdf03da216b6bd01341039d97d
34718dd1b355caa74c6af02028cb27457da5d0a4
110396 F20110331_AACMKU srivastava_m_Page_21.jpg
605c042166f5637bb7f848ceb0a76b60
1b5c0b2bddfe47bc26c4e4de72b2cd62609f2112
51391 F20110331_AACMLI srivastava_m_Page_28.jpg
4e86774f968c1c0dc5de8930bd10c806
6ae209dcfd94689ffce7df6de84b7daf5f1540b4
36965 F20110331_AACMKV srivastava_m_Page_21.QC.jpg
76f49c12ddd9c07a179509d37c058bbe
625e9028484e43b52af5be87fe57dfc493cca8c5
16594 F20110331_AACMLJ srivastava_m_Page_28.QC.jpg
8615059b826054e1b160232cede0f9c9
028526c4b45eec76f70cdde4f007a96124d4a945
115036 F20110331_AACMKW srivastava_m_Page_22.jpg
622091db7308fc078ffc221e1f80498a
17fa78f24d6f1e2056a64a0b1d5a4b5ee7d62a9b
109773 F20110331_AACMLK srivastava_m_Page_29.jpg
11c8f0c8cf323d4e4bc303ceb5a0a442
db02d48138511f5bb5cfa88f0296b3feb5ef678e
37149 F20110331_AACMKX srivastava_m_Page_22.QC.jpg
527347c8ae91e8ae64689ddca8e2ed21
585aba4d89cf5bda6014bc7b0eb4bd3e993fd542
115266 F20110331_AACMMA srivastava_m_Page_37.jpg
769df1e8f66ec3a3cf94458ba9b5ca8f
88d0fc5463aca7ce28cc7a22cb0f15f2fbd10c99
35905 F20110331_AACMLL srivastava_m_Page_29.QC.jpg
0137258f5d7fa36f560cc47a34d00fc9
b904f13562252064161db9c7ef7c45e9fa84ba15
116668 F20110331_AACMKY srivastava_m_Page_23.jpg
9b2b2364cfa2521e01bc03b7191c0761
a02cfbca78faafb788ed2f470afb99e9c9d8607b
38728 F20110331_AACMMB srivastava_m_Page_37.QC.jpg
be0e3e370d1a608699cee28f2bb8b8eb
08dcf7fc6b254be0c35f075e7d46b7d1a86605d3
112161 F20110331_AACMLM srivastava_m_Page_30.jpg
651c1e749c9f9ec6f52ca8a1b3e518f5
4f4041d38e3f3b5a012acc4c0b68d18212ba6168
38276 F20110331_AACMKZ srivastava_m_Page_23.QC.jpg
49139b9c53b7e7035fab1557e2f3c3da
04901379791a12fea2c1a96cf19fb1126229b88f
113920 F20110331_AACMMC srivastava_m_Page_38.jpg
ed9fc0831defc195ed8774916ce07d5f
f1b1171540752fabecf6c0ffe08d85d0b1f36aeb
36801 F20110331_AACMLN srivastava_m_Page_30.QC.jpg
8578cbd9e7b528f13fa1d0619a29c9c6
719265e60854468e9c7dac83647932bc8ec14568
37100 F20110331_AACMMD srivastava_m_Page_38.QC.jpg
15c9c9599f93658e9eda43d48c611809
1401af0507a34a4635e9b7bb35fc140f69b2495e
113313 F20110331_AACMLO srivastava_m_Page_31.jpg
b2ebaa84c691e63babf4acfefce5cf6d
33d4db108925e68e2cbb60bfad1528f0732deae9
112729 F20110331_AACMME srivastava_m_Page_39.jpg
bbee1d1f9efda3b0dd99506d1db33975
da23a5a35ef42f174ba5092b0baa11d865e6a4f3
37003 F20110331_AACMLP srivastava_m_Page_31.QC.jpg
1d45692bc34cbfa34ed630be936cddc1
7d2cc0caf77c3fe585ae3ccf349e403597da2063
36916 F20110331_AACMMF srivastava_m_Page_39.QC.jpg
89f78b751bc2e034d2024e7cccd107d7
7dccae464b020bd115de820ff0c5345ddd711f58
113726 F20110331_AACMLQ srivastava_m_Page_32.jpg
ee4f084934fffa13b947668a3312238e
8dcbc32d0ab2ac8738a051c3eb54ce46be68ee08
54613 F20110331_AACMMG srivastava_m_Page_40.jpg
9388a9a6305cf97b2a08be7eaae742c2
7b4b0a2815542b7ca95bd10b211beb66169a2eda
37521 F20110331_AACMLR srivastava_m_Page_32.QC.jpg
cb303353571ed5e2b526c24fa074e181
734d3b3cf7b274d1271a2aebd6597eb48b8a343a
18150 F20110331_AACMMH srivastava_m_Page_40.QC.jpg
3cb31970d1f4c46acd38a4a7cc7693c3
7a52058cd98ae5563e8af4d1337db571613c3e45
116014 F20110331_AACMLS srivastava_m_Page_33.jpg
f8999d870017318227fa86cbbf88dec4
84ced9728c9e2f62bada5759cd2361328614549d
38520 F20110331_AACMLT srivastava_m_Page_33.QC.jpg
b3962a89c0bbe805eb884f428504131f
72384192b562a8f2d4b5df72298c31a7eff2aff9
82820 F20110331_AACMMI srivastava_m_Page_41.jpg
32829c793bed12dd1bbb54c6d37ca4cf
66595b75f63943d35f645a7ed32016550c7f055b
113389 F20110331_AACMLU srivastava_m_Page_34.jpg
ccd48a0038fe3151571125dc874afc95
2468d995ed833eef1b682741e45b9b03eca00a15
22508 F20110331_AACMMJ srivastava_m_Page_41.QC.jpg
f5ee5ab58886b29cff024a4a000d3b7b
87f62d83e615b7f53de52db5ef0bcfb07cd8a36d
36901 F20110331_AACMLV srivastava_m_Page_34.QC.jpg
7cdb8e75bff1c268106c1caeaf92a3ba
446509e0bc34f808b84be35d7ee79e75303453de
95816 F20110331_AACMMK srivastava_m_Page_42.jpg
e921ad0160a3f17ab98ca289b409c204
65073056b933244d192f928af41f5c7dbf80fd36
117157 F20110331_AACMLW srivastava_m_Page_35.jpg
f09a833e1fdd27836970606d8eaccd94
e536d4eaebc7291d904d586c2676556b8e2bc666
50349 F20110331_AACMNA srivastava_m_Page_50.jpg
8b555b3277d30af4d4cd1de91886114c
5eef5aa32ccb4665b7a4b7cd0a235c73174ea331
31912 F20110331_AACMML srivastava_m_Page_42.QC.jpg
e8b16aa1f7260987828611934c6dc447
50fd93ad84aae54de1a30512444dd41ee7c452b2
38839 F20110331_AACMLX srivastava_m_Page_35.QC.jpg
e8e69bb4831ff5867ea8ad399819e7c7
5e9fd41d622c16689f8f04fb3b4e46d2b6625cc2
15627 F20110331_AACMNB srivastava_m_Page_50.QC.jpg
cde2112cfd43a5bbabce335387170825
77f3e27b8f10a6718d56fd0788e8ba0d0080ec68
53052 F20110331_AACMMM srivastava_m_Page_43.jpg
9dfaa59d0097931b365e3acf5787c0b3
83f04671eec932493e627f2201d83928a15e0576
107587 F20110331_AACMLY srivastava_m_Page_36.jpg
5b11f9ea87b05c0866dd3c22a1ffa3d0
084bc112a998fe830ab71629fa738d86f7913231
110092 F20110331_AACMNC srivastava_m_Page_51.jpg
32b36e188fa543b3d4e50d43a6448ca5
35dc28fb3269616b24b40a86cefbab3366220ad0
16045 F20110331_AACMMN srivastava_m_Page_43.QC.jpg
5542f7fd3f2c8e718a7be313228bb602
3f2417fa37b72a2371efe98c99d1dad619727d8b
35322 F20110331_AACMLZ srivastava_m_Page_36.QC.jpg
6af90a92cb3f866859f5fbace1e2f19d
c760e1ab8e51e539bc19302b9b2af421039c3e71
99256 F20110331_AACMMO srivastava_m_Page_44.jpg
4ab1d05c6478801a8541984354e8694b
720cd141585878ef198be89f13772945dc1b9cac
35757 F20110331_AACMND srivastava_m_Page_51.QC.jpg
1d4fb9f5d08245ea7b3687acb7559586
264d7e6d7c2eb2a0c4db10c2d8fa54549df4fc12
31980 F20110331_AACMMP srivastava_m_Page_44.QC.jpg
a68faa9468b952eb90f30d0b86c35650
376fce882fb015fb952a1e133f42d4699101eaa5
112528 F20110331_AACMNE srivastava_m_Page_52.jpg
4693041be0ffb4e7452d3867107b4d63
7314977d339a31ed5c3760ee47f632426ad2ee1c
109734 F20110331_AACMMQ srivastava_m_Page_45.jpg
1c8262392e33cf507207330864c8cce5
5e63f12cd21b9741e2e41e6eff9d7e01fad52bef
37756 F20110331_AACMNF srivastava_m_Page_52.QC.jpg
4a7a5aa4aeee3f4038b7155dac15b55a
e0f2a2571614d64dd99fc920974a2d45cfc2c0b8
35902 F20110331_AACMMR srivastava_m_Page_45.QC.jpg
09e50d0c07d3b4f8d1044b58652b3922
164aa7a267e60f6d6747e394c90120908a84c829
112699 F20110331_AACMNG srivastava_m_Page_53.jpg
e7c766d464b855077fe252faf0edd7d5
21454d34b7e81bca20bbfb76f1cbdf7d59b1135f
28136 F20110331_AACMMS srivastava_m_Page_46.jpg
09f5e9d17b71a48d80d453475226ded5
5340ce0062f48c62072176ac582e3b97badf6317
36836 F20110331_AACMNH srivastava_m_Page_53.QC.jpg
fc9ba71990557e51b15bf884216a2a56
6724b33df949619adccff6b4e0f1bf7a07bdd243
9490 F20110331_AACMMT srivastava_m_Page_46.QC.jpg
951ce72a6dbdce74fdd62a6b824a952a
cb4b45fe5a0cc6a905b974c85b3a95fa43eb9ecf
115515 F20110331_AACMNI srivastava_m_Page_54.jpg
60c40e99a56caad105ef4feae938d190
30e14399faf3fe2c8997a8b2dcc5019be237a3b9
47586 F20110331_AACMMU srivastava_m_Page_47.jpg
d42b8422da3fdfa7be77e2bd285a8232
f2718652c29c60f0c4eda5f54aeda713307c6039
14797 F20110331_AACMMV srivastava_m_Page_47.QC.jpg
73daeb8d340787a2dc7cc82e38b3e8ec
1250b6853b63d88b3e388f3289fba67a9adb237d
37859 F20110331_AACMNJ srivastava_m_Page_54.QC.jpg
982c2cb34cdad949f77bc44812fbd97a
b95d4aec9bbc4211e855ecf800f12b8453956e91
48874 F20110331_AACMMW srivastava_m_Page_48.jpg
5bb22ab1841fca11b3ba3c03b87cb06c
d28db78fdb6af1349af8197d1d9838019e1df6b3
111280 F20110331_AACMNK srivastava_m_Page_55.jpg
764557bcf7108111e636987b03ee8478
e378a4a848b33fa771d824d2b76d2a659cdfc3a1
14721 F20110331_AACMMX srivastava_m_Page_48.QC.jpg
bc35e40541f35d81ca4eacd7e954fa88
46d8c002282b3e2957799f888f7d2ab8ae1b726d
110191 F20110331_AACMOA srivastava_m_Page_63.jpg
e330e8787ec76e76b706b73de3ac1887
efd2625ae919b3363c1284d3c75a541a5150cb3c
35841 F20110331_AACMNL srivastava_m_Page_55.QC.jpg
0a63a594715be6f8936679d3ef1ae15b
7a06b17982a4721502664272d567cf8f16baa010
40121 F20110331_AACMMY srivastava_m_Page_49.jpg
7fb351c79a0512a0d5a613fabdc07df8
ff1cd30ab5356443efc5e80915d70b7a6fac5b4b
36347 F20110331_AACMOB srivastava_m_Page_63.QC.jpg
e062494df95a8604b7f81c81005d9bd2
f956a17a8cf69ce66d6120623b9762b3d081f0ab
54325 F20110331_AACMNM srivastava_m_Page_56.jpg
53a9f40b93e186756835526fad42059c
603c50edcc2e7ac2ac4e4c1af3b537e50d432135
12909 F20110331_AACMMZ srivastava_m_Page_49.QC.jpg
bf5cf0fed98f842194fc9936d5e67c11
0c709170b07c509a245013ff7a550b2dce5299ae
114778 F20110331_AACMOC srivastava_m_Page_64.jpg
3dda5fe59b3ae7d409f24c2380425da9
2154ba8bc899eb488427281dbfe98ca6ad877a93
18077 F20110331_AACMNN srivastava_m_Page_56.QC.jpg
73e087cd4f7db8a57057982d70e95ac2
e734e0ef859033f4c77594e8c112b97b49e4de83
38448 F20110331_AACMOD srivastava_m_Page_64.QC.jpg
32f30c65f243333ba7806454535740e3
80cddefd2bfa6a88c2f69cc2f962da815de57a49
49542 F20110331_AACMNO srivastava_m_Page_57.jpg
cf2ff08761358f28c1972013dd3e2ace
2da887ffefea7596c5fd19d1885414eb71a0b258
73762 F20110331_AACMOE srivastava_m_Page_65.jpg
dfb042b59ccca9cdcbe1ecd66e4e5042
7b8bc87b6f8681d20115c3ec9667a7a0be9b3d24
13861 F20110331_AACMNP srivastava_m_Page_57.QC.jpg
be36cf9b06bc17e12543d09d8aa4391b
c7ed03db0459a0d7ab85ab964f9dfc0732104727
24592 F20110331_AACMOF srivastava_m_Page_65.QC.jpg
b5f577c2c757f3eb6ffa6bcb4fb408a6
ec1c5e183c0ee47610c4ec2c0af006d8258ab9c3
48181 F20110331_AACMNQ srivastava_m_Page_58.jpg
280d6791b1641fe0ed541efd2249ba87
49db133cbe0a82342ec15ee65320a54ff1ad10f9
34492 F20110331_AACMOG srivastava_m_Page_66.jpg
5370e8c1038a53e8db1ec829b753c3df
4282d15d667ddcadbffd415a84c06bc5a3ea2f8c
13629 F20110331_AACMNR srivastava_m_Page_58.QC.jpg
8db1ad387d8774d625fd38ebecd28a9c
f802d8c786aa6e86bb1522dcd52f5b132ee52e49
9624 F20110331_AACMOH srivastava_m_Page_66.QC.jpg
f0d591bb380d0bc5f7bc3352c290b65d
0d01aab3a5baf5d6010a108f9f5cabff11279ee2
56853 F20110331_AACMNS srivastava_m_Page_59.jpg
ef91fb4faf1e9e50da88277a85caa704
d62e52c39838f2308d52ad990345f08f88a4d601
53406 F20110331_AACMOI srivastava_m_Page_67.jpg
91872a46e6d33b172d47033a890d9347
ce94c1defab35a3113425e06938593116891123b
16232 F20110331_AACMNT srivastava_m_Page_59.QC.jpg
a92dc56b5cc53855617a23f9a25178be
b6404d6e7d1d89463f422d8cba09e504692135b9
17035 F20110331_AACMOJ srivastava_m_Page_67.QC.jpg
cd394034cd2c06f1f50f6139c835c922
69879db35b30351061d995854cbff99425f9a812
62038 F20110331_AACMNU srivastava_m_Page_60.jpg
a65d33235753fd6b733d478e2c71049d
beae50ea1d6bd6fcfdcc038357e22afe029ee986
17911 F20110331_AACMNV srivastava_m_Page_60.QC.jpg
b10429b75c7d71222cb9bb89c07eb79c
7d044019cfbc0c0a973b73cd3ba079eaa346b466
59903 F20110331_AACMOK srivastava_m_Page_68.jpg
93612d6ea3b7f84d307ff3bc80384fb1
a8940d79cbd909f1d602907458228567ba9f4db6
64752 F20110331_AACMNW srivastava_m_Page_61.jpg
ee0b565774fc78bcf0563b4518c6f31b
61b176dfb0b2c22a5c89d88314a309b25509ec10
105615 F20110331_AACMPA srivastava_m_Page_76.jpg
4fceb5fd402676417ddac0f863c80553
f8045fe3268abd88d210ef99a8a90403485b24d5
17558 F20110331_AACMOL srivastava_m_Page_68.QC.jpg
0231270831b113acbfc57b8dc175632c
4b1b8f8a89dd7c39657ed1f88fd1428a0be6469a
18516 F20110331_AACMNX srivastava_m_Page_61.QC.jpg
7c744320bde0a1fe6a47908660a59132
5e8e9fc19a324a1b9641117833902969b50d2caa
34470 F20110331_AACMPB srivastava_m_Page_76.QC.jpg
cc1900a59b2502193192f995db9cda79
1657d80544dfd85eb603bf06eb3526f6097f6863
56202 F20110331_AACMOM srivastava_m_Page_69.jpg
2d951e2f3a0bc950cc9a27d48c390a09
0055a029bbe23dfca928368b4134617448973d14
64335 F20110331_AACMNY srivastava_m_Page_62.jpg
3f838d7eb012ed980609f6c2793b00b0
c4fe9aaea6d3d5e94bae6e27558ae7f816aefea1
110936 F20110331_AACMPC srivastava_m_Page_77.jpg
c0f56cbfb65f364a41d3565aa47a71d6
c7dac449ab405085091eb51e9e1d28a99939c925
17107 F20110331_AACMON srivastava_m_Page_69.QC.jpg
10608fb23c8fdcfbf039d65ce092eae0
737d3101272eb8b0da9e2901222358ff216cf1e2
18686 F20110331_AACMNZ srivastava_m_Page_62.QC.jpg
12b1c08856675c22f44e8889afc33286
6dc3ad1fd593a0d28d5f373b899f68c0dcf1aef4
35737 F20110331_AACMPD srivastava_m_Page_77.QC.jpg
b9c7b13f5417f77a925ab76c5363853c
956a39d7c317ac7878a5067cf68cf3f040198e99
108381 F20110331_AACMOO srivastava_m_Page_70.jpg
49cfd241471a22960f5006be50958cb9
62c20dabe233afdc4c8980c0af3b3599f893acf5
107010 F20110331_AACMPE srivastava_m_Page_78.jpg
570bd59476ff1c1b8bd5a3f2b76a1ee0
83018826a062417c727388e00ee4ed5ea9112bdf
35270 F20110331_AACMOP srivastava_m_Page_70.QC.jpg
92fadf141b5236831acda2f463800811
9853e11698cdaf19c2f17473cd9feb7613a73cfe
35186 F20110331_AACMPF srivastava_m_Page_78.QC.jpg
5da01324b8c3f8049dff16866dc86a06
9cc59321cb7fd8899a8f97650747280a7dbce19d
113052 F20110331_AACMOQ srivastava_m_Page_71.jpg
9948a482b2e46f06274f175e8a76e675
f18aaff1f77c1fbfc30b61e5b50dcd9ae04d39db
114817 F20110331_AACMPG srivastava_m_Page_79.jpg
2cf7d59240fa5edb0430d327b401a750
9371af0d9447b1bfe62c093e80ba21eaa95fd924
36898 F20110331_AACMOR srivastava_m_Page_71.QC.jpg
069743fb7da132654304cccb311bcc6f
4bb7fde82eefdbb9b509fa4b95225a836a60ca55
37364 F20110331_AACMPH srivastava_m_Page_79.QC.jpg
c5024c94a376dd9609c17b1025bfe15b
85350d10c5d21a4445f00e00dea35f9205c98501
77762 F20110331_AACMOS srivastava_m_Page_72.jpg
e3244cab8ef0d4865226ef569acea7c3
6f1e2e0d8fbe5c32bce7e831fdc11251e78a73e5
108287 F20110331_AACMPI srivastava_m_Page_80.jpg
894afbd5a9c92ad4adcbceb2594b136a
bd08fe133c89c716dd70775219a7588e6f1e8454
26064 F20110331_AACMOT srivastava_m_Page_72.QC.jpg
a9ce080da0ad5f629f66a6cf9840b20f
961c4206eed3c94de669f63b1dac8e6094eb81dc
35221 F20110331_AACMPJ srivastava_m_Page_80.QC.jpg
5f922622fc3361834b6652512a18d26d
47b9fd6b7d8ddaab2894c35d3e06d28f9dcc02b9
32697 F20110331_AACMOU srivastava_m_Page_73.jpg
dcd47b008d6543ad285c9c07861d38dd
86ea3b69e9dedc4a6e6b536d5327aba9cc0713df
109681 F20110331_AACMPK srivastava_m_Page_81.jpg
7b25be687dcd33cd6da0ad7db8aa1ba4
31883d5e631652d8ff2a2e2c24f899c48bf2f95b
9535 F20110331_AACMOV srivastava_m_Page_73.QC.jpg
0109cbdf663032c7cc94aa2b5580a769
6f651f512968b4ae7054a708444285459299a9c4
48324 F20110331_AACMOW srivastava_m_Page_74.jpg
25739dd0b8cd26d6057d19d690f3b358
dc79df3e92d4c9b3e62716dd7c5cf24b4fa368de
35422 F20110331_AACMPL srivastava_m_Page_81.QC.jpg
ed8b2b989b55935ce86e56e19f16df97
4a4f54c492b4f6cf81bc316681703a8841e05d14
14382 F20110331_AACMOX srivastava_m_Page_74.QC.jpg
2dd7b7c83a34e53a539364dbf1ff4ed3
a7c6187d3f5b281a0b21a0e8af22c622a8ede808
112406 F20110331_AACMQA srivastava_m_Page_89.jpg
dd23fbcb9db7b9e9b5d2e6419ded8962
9c7a86e57e2a8f15b299e60c2b0e671a7f3aaa97
110413 F20110331_AACMPM srivastava_m_Page_82.jpg
32749de1ff210eddfe59345e19798946
43f813b5ae30c6ff395bb9341e560c90117088f7
52898 F20110331_AACMOY srivastava_m_Page_75.jpg
00fef33e427eeda617777abef7d71e6b
30115419f76154a6a50e529bc25575bbfff5e6fa
36504 F20110331_AACMQB srivastava_m_Page_89.QC.jpg
bdc9f77a3ba405bec686ea1008be6ad8
0ef8895fce1a314fb0ee33712b6ead714ee7bc50
35901 F20110331_AACMPN srivastava_m_Page_82.QC.jpg
d90384b6ef21e57f1562a089e38d8b50
e0301e076b768d155d60ff992dff762c727fa0e7
16445 F20110331_AACMOZ srivastava_m_Page_75.QC.jpg
05cddfe57106217932d19670be860984
971d3cf6a604ab9a53c6f81769e81b677a8ee507
19318 F20110331_AACMQC srivastava_m_Page_90.jpg
f1ed0bd9a2915763343f97c9dcd5f9de
76f249c5330b00bd61627b1e8f58686acc1461b4
113188 F20110331_AACMPO srivastava_m_Page_83.jpg
16feb0783eabffa4465a3d80c542c130
534fffdc578373972d266b47864b5d9c1519e3b5
6780 F20110331_AACMQD srivastava_m_Page_90.QC.jpg
12ce637b0e3e716fa072041b210b3c24
dd88aed2ca0bd5fc4ec39cdb90992c365a07c2e9
37037 F20110331_AACMPP srivastava_m_Page_83.QC.jpg
61e58e7fd9c68984cb1cfd48798c14eb
962326c7c1ddca879453be6925f0ad4b3d81f52e
125578 F20110331_AACMQE srivastava_m_Page_91.jpg
7bd3a4b4c20c5f321f9502aeee330b07
2f08252e119aa5a866ec2a2785ac16851dc01bee
111559 F20110331_AACMPQ srivastava_m_Page_84.jpg
29dfda2e848a97287337e548c94ca10b
b34b952438edecdf72c22e9515bb113ac55a4335
36887 F20110331_AACMQF srivastava_m_Page_91.QC.jpg
7fe8a5effa15920b3224b61281f19c18
cc30a6c1a5ea01df7cbeaf47179b3ce271f91e68
35995 F20110331_AACMPR srivastava_m_Page_84.QC.jpg
6bbbff63036ebe127e608fb58cc3e2d9
d40d0516805c076b97b934d30c9521cfcc026710
128673 F20110331_AACMQG srivastava_m_Page_92.jpg
415cae4dfa621f75da59b89788f5d4b3
e5f98dddc1c39b1517a84d91c9e4a4498668f0d3
113666 F20110331_AACMPS srivastava_m_Page_85.jpg
32a7647f6dc28fb4c39ca3be16cc7110
77c32cf82865988728dfad6682e38d661d7b3ec9
36156 F20110331_AACMQH srivastava_m_Page_92.QC.jpg
f2c21c7b39749fe89a1531aa858bc223
5527b50da089ba0d8af9342e11df730e3f47f130
36868 F20110331_AACMPT srivastava_m_Page_85.QC.jpg
72df2f7358d050d71d253fb8ebc92af8
0872a3a2dc4a586f4403f8e6145fe4d484935cd1
133110 F20110331_AACMQI srivastava_m_Page_93.jpg
450824a26b0cdea67d0cf0c535e5b385
22f43623931ebb9d5b186a63bd330c000eed7707
110028 F20110331_AACMPU srivastava_m_Page_86.jpg
652ee0d35990e5036977da730e2c9804
7e5778696c97331808f44c295307416eb484d6da
36705 F20110331_AACMQJ srivastava_m_Page_93.QC.jpg
07fa535d993bb7593f71291a1af4bbde
938390655b6bce7e3198efb09b1852aca8800119
35794 F20110331_AACMPV srivastava_m_Page_86.QC.jpg
b67d44757ced0a022a342742614887a3
d560cd3313e9ea22c9f32e6ae125d21716060908
128222 F20110331_AACMQK srivastava_m_Page_94.jpg
2e20bdee9dc8f3c80d7e0d121e65e213
fbbeb50a8d0b6a8cbac45e66abc04465d1dfcaab
112166 F20110331_AACMPW srivastava_m_Page_87.jpg
6c5f5f90883b7e772c9b9cf39857bf46
9dd0a65f59e57a51bf74f2c8c4feec98d2261eba
36832 F20110331_AACMQL srivastava_m_Page_94.QC.jpg
25ca4cc0dc6f5fe664dc419d93690b72
39be95c629fdf70268bc3b2586ea60cab58a4453
36117 F20110331_AACMPX srivastava_m_Page_87.QC.jpg
4ccc2c09305661af0c2541a5872b1cd3
5af170f1346b27f0aefca47e171db18f8506c033
1051984 F20110331_AACMRA srivastava_m_Page_09.jp2
d31cd480bdfb89d6705a02c22e696fca
ade8c09e3be2f99a8a2a82b2bfebda089f2dc635
109811 F20110331_AACMPY srivastava_m_Page_88.jpg
6f10282396a43cce130636c8941ffbd6
969935fa4a7165ac9a59051927e73a07247d6271
46969 F20110331_AACMRB srivastava_m_Page_10.jp2
017fcab231d5766c86d5d4039bed01bb
326c4ae2627ce1aa312b8cea1a4ff17c3ae0eb82
120008 F20110331_AACMQM srivastava_m_Page_95.jpg
5517e4f130fcf88fd73f54a069b92f8a
ab06f4c7c1881d76b8d68577ebeb3e8d94fca50a
35191 F20110331_AACMPZ srivastava_m_Page_88.QC.jpg
4567775a5fa681b400c3bf8406b35e5d
163030d7ffc80e78995ec03f2fc1a764242c2d8c
F20110331_AACMRC srivastava_m_Page_11.jp2
56b9955cdbdc1ee1233c527c35fc629f
ab32317a8123d18e04f9cb9c087819edc9a15838
35036 F20110331_AACMQN srivastava_m_Page_95.QC.jpg
228514fb886e5f0e8440012834817e08
b7da16c5a84cab3fb99cadab47d7921fdde793da
106094 F20110331_AACMRD srivastava_m_Page_12.jp2
2f9ff5b2025a1feaf5775df01fbd901f
b13be4019775f6d067fa01dc679d761cff081c81
23845 F20110331_AACMQO srivastava_m_Page_96.jpg
ef1fbf28797b5b8a6a290b5da0c1191f
a8931aa2e8d6409b315b626b6d7497dca934bf20
114697 F20110331_AACMRE srivastava_m_Page_13.jp2
91d6008e38a2b2359ace84cf9b3f2bdb
a9a83d36fb56221a4b1cd8663d2754da570cacb6
6983 F20110331_AACMQP srivastava_m_Page_96.QC.jpg
74a7594aba199cfa27d908464d37ee01
04a672bebe280d8b35a6d69ed273b9156b16d150
116465 F20110331_AACMRF srivastava_m_Page_14.jp2
5b5b9a30f740abff301b0f1ab387e4c7
ef50e6c2b4c6e9d3b27f200d8cfc140de6b0ee6c
88107 F20110331_AACMQQ srivastava_m_Page_97.jpg
50ac4f9e65edfbb1bdf21f2217077c4f
f7a68db3164bc4cbb18b05b2f66acdd4bcd12607
124618 F20110331_AACMRG srivastava_m_Page_15.jp2
18720bce27c818da821d25d9addb7358
42020c76688c1561b26593a4c22cc8dbd1a500ab
28608 F20110331_AACMQR srivastava_m_Page_97.QC.jpg
8bed4bc6a543747758079f1af668ab2b
335f9484ba8091bb34489619f1b7c8fc11ad736b
124259 F20110331_AACMRH srivastava_m_Page_16.jp2
80dfca1874ffee0ec3388e0670fd6393
143e7b2c2daf9666a6bc338a34c989775f522a35
22032 F20110331_AACMQS srivastava_m_Page_01.jp2
e153d378c26b9ae7c508efd7d229fa9d
1f25874f41be3777d23a14064aa17c39132ec750
117308 F20110331_AACMRI srivastava_m_Page_17.jp2
9ef3d036f1d974c9c2fd5ff319c5116a
c881ddb80d325ee9d2295f447afff27e40676f7a
5092 F20110331_AACMQT srivastava_m_Page_02.jp2
6f27f845d706013239b19651426c22b0
bd07efc0f7de543f2b717af2d5c16f3e8dde487f
119728 F20110331_AACMRJ srivastava_m_Page_18.jp2
4373811fee000b2f7d2bc2e73bc9823f
d358dfea8febccfb4ce19aba29a8a6bdb610b538
5073 F20110331_AACMQU srivastava_m_Page_03.jp2
3fd7f1d09b8cbfaf4380af8675ba1905
669790bb953c6ac529de8591b78ead95241f3f65
122985 F20110331_AACMRK srivastava_m_Page_19.jp2
1c58570328da107b9e7eeff78773c9ff
6c008f46a2677791aee83ef812a0f39505f58b00
116834 F20110331_AACMQV srivastava_m_Page_04.jp2
7c1984a764db45289687cba0804b3ee5
dfbb80ebb89710faec001bd66960bc0c02d6f26c
119404 F20110331_AACMRL srivastava_m_Page_20.jp2
7a50c5d5f9fa6f73208f260f1038ea00
4420657407717330599e114d8b4c62a0d7407709
47711 F20110331_AACMQW srivastava_m_Page_05.jp2
b139f8fade407866d0c09861b409dcc2
d182cc8a0ec743dbe4c3feeeada4a1bb16e02abc
119299 F20110331_AACMRM srivastava_m_Page_21.jp2
2c1d198eb92fa5d77a8b6f1f6202cadd
7fc79018d281699cc9faa5cc7ad4f538572fe8e5
1051986 F20110331_AACMQX srivastava_m_Page_06.jp2
a59ffcdaecbfeef0a4cb3e911239e8ad
244b6f23d5c0aed0a9a491eee418a702e9ca520a
116036 F20110331_AACMSA srivastava_m_Page_36.jp2
fcdd40ed89ba3fe5c7ed4d40ca406bae
77fd4d9a88ac81493fa37e5a366c3b5b253406f6
1051970 F20110331_AACMQY srivastava_m_Page_07.jp2
a645ab02803ea9349067a7c70191f931
824aed638f32552c8466ffa278c5e0717684f247
120658 F20110331_AACMSB srivastava_m_Page_37.jp2
9c74025e2f174aa69e187730f5b7488f
2d9f0c4c35873edef1c16778c80328c7485b9025
121368 F20110331_AACMRN srivastava_m_Page_22.jp2
2df4ba08e47e484bf0473df3f2d73f8b
471b1a6bed1bd64d2a0468a1c88b1bf34769883f
513347 F20110331_AACMQZ srivastava_m_Page_08.jp2
85af1f4307594fdc9555b0ee840ddf1a
00be21b7e252215eb7bd42ea9bd0f717777e9532
120994 F20110331_AACMSC srivastava_m_Page_38.jp2
c770969ba2bd8b9430b089a990d59633
e679f891eb181530036e8370932cb4dbd30d806b
124381 F20110331_AACMRO srivastava_m_Page_23.jp2
b23025dce2f1fb793689873b1f598c5e
91b748933f871a89b660e2d318a79ba8c9d30854
120878 F20110331_AACMSD srivastava_m_Page_39.jp2
cea21a2fbb4c8c3a35eb79aff6f40712
c4ea0ed8897ffa1938ecbe95adac1256e5849b2a
124485 F20110331_AACMRP srivastava_m_Page_24.jp2
f61c477f78c39a4927f1a5e1859a87ee
36ec8b02a0f23f9e200952c7bcc33f281513f1e0
60176 F20110331_AACMSE srivastava_m_Page_40.jp2
902cc9a049ff027e1ec61337c6352ce1
480a1dc6d5c4abbec52a022d432d0b458c5baa84
117885 F20110331_AACMRQ srivastava_m_Page_25.jp2
ec12537bc24d9bdc815daa358171f061
2b3b1482aee1fa69bedab59e24a67c623fe067aa
892358 F20110331_AACMSF srivastava_m_Page_41.jp2
b32b80c50c152601acb1b315cf5d566d
0419a927b0fa3b0a908569dbe0e33f8ad490fdf2
81452 F20110331_AACMRR srivastava_m_Page_26.jp2
6fe6f563a5e21a4da808444ccfa19fa5
c7bc03e0849bd3ad1738137188c64c29eb16739e
1051985 F20110331_AACMSG srivastava_m_Page_42.jp2
c46a32c19c5eaa67bca39c6c9ef43029
ccb0dfc65a2f730f6665db8a65ad356c69d47542
381090 F20110331_AACMRS srivastava_m_Page_27.jp2
d1b5e0983cdeaa494379419f544469df
44cfea721ae1502f82c4933d16fad08837089ae8
1051933 F20110331_AACMSH srivastava_m_Page_43.jp2
5137b757c03146dce1faff45811831cd
dde99e6d833cf651429ab79c643d9fae28a3f931
656902 F20110331_AACMRT srivastava_m_Page_28.jp2
22c26fb84ed6dfcb36c5823f4172d5a4
e42ed86d1b1ef487295e7564d39becfbfe53fd4e
105676 F20110331_AACMSI srivastava_m_Page_44.jp2
d8ddae60335051af07a54c2d03a169ff
f27568b877e404d5967d90d99af2d19bc2ef910f
116032 F20110331_AACMRU srivastava_m_Page_29.jp2
494bae3ecbda15d5ef5b57966c279c72
514637b333638e7ae461fc66c414b6917c051262
118069 F20110331_AACMSJ srivastava_m_Page_45.jp2
b92743a068a5d3bbe2116de29e6b7e86
412e0d12a0ce38e80026af7e5ff5b1b938c82f3f
119607 F20110331_AACMRV srivastava_m_Page_30.jp2
cd92fb47b66fdca474c742c97c964d6f
28818efc65f8ca6c7f0e70dafce070f0ff7e23e3
30423 F20110331_AACMSK srivastava_m_Page_46.jp2
ae53e97afb1ce915a1b0c0e5bd19bb07
ae6d5d2e9c23bce3aa47639363a988bbdb8f18db
118939 F20110331_AACMRW srivastava_m_Page_31.jp2
0cd6a13c4cc36d49284b615a339962ff
6e7e0923fce582b6863fd4340d32e141e7eaf53a
462400 F20110331_AACMSL srivastava_m_Page_47.jp2
e7e8e92767fd5c854ee8c3dcd2589eea
369d294a0de8d5830ad5a682fd78250becf60427
121332 F20110331_AACMRX srivastava_m_Page_33.jp2
47e70bf2509ec650fba4ac0de72c336c
7b1ff146415afe3e1a46cc7a948685a1b043559e
633273 F20110331_AACMTA srivastava_m_Page_62.jp2
d510712d0c46a29f1cb99a192e8c8794
00223990c86c0dc8bd2564a4d56b096ebe30d59c
468906 F20110331_AACMSM srivastava_m_Page_48.jp2
1ee673cbd51184f96f611c3765bf5a61
24ffb4aaf69be2a06a36fb3ef6e879b5c3c9a3fc
121021 F20110331_AACMRY srivastava_m_Page_34.jp2
2ecae6d4def54468431eadbca9302d8f
2318422b2864ec7db364cb48dc924f6631049a96
117113 F20110331_AACMTB srivastava_m_Page_63.jp2
0f8576174e510fa711f289a7da45b6be
c79e2dadf3e537877b67c58f5fed98a2762718a0
393996 F20110331_AACMSN srivastava_m_Page_49.jp2
e5d339515674864c9b4e85bd286a33ca
4caae8e9f3d5048d56257bd34776b54d453067a1
124267 F20110331_AACMRZ srivastava_m_Page_35.jp2
01b19a80ea20aff5d7b34e4079e07bf4
72bb3d1353361b4532de4781f79ac86fe14a622c
122947 F20110331_AACMTC srivastava_m_Page_64.jp2
41e2d4ece2eb3dddd68afee48ad3aa19
56e54fe67dc0ef04e978eb40362c112620a6bbe9
79150 F20110331_AACMTD srivastava_m_Page_65.jp2
98f1fab069cff2a2e5739959948d08e5
575058afd9cf8f7d487cdf147e643f587604a26b
463857 F20110331_AACMSO srivastava_m_Page_50.jp2
a6dd45fd1dcd81bd42e46b006d5e8af3
524d5b15d2fc170dbfd30f560a61d8860b0df649
36326 F20110331_AACMTE srivastava_m_Page_66.jp2
4f72016371a362cc4f1e82d4555310d6
300a8700b76a50a399a0f2f718167439ec3b3bd0
117098 F20110331_AACMSP srivastava_m_Page_51.jp2
5b9597835cbc3899225eab10f05adf54
6d3310fbdab3b40329019d2c1309b70c79f98a5a
526650 F20110331_AACMTF srivastava_m_Page_67.jp2
a8b7150e1001c379614a2e4a62175f0a
fe27f3a7e8f68a2b620df0749f4e202af87bd881
120802 F20110331_AACMSQ srivastava_m_Page_52.jp2
d3304fd353a97c3e9e1dcd6192296f9d
38e9708b94c0d162dd3f21cfd4f847c3fff57a5d
600911 F20110331_AACMTG srivastava_m_Page_68.jp2
ceab97f9eea98d9f63c382f120afd45a
1f281dafb79c872651be547191240723b2130226
119622 F20110331_AACMSR srivastava_m_Page_53.jp2
b3060c581d3ca283fd7a8e2148a485d1
f3565fdea96c453cbd1e378bc927d970cc3b493c
547069 F20110331_AACMTH srivastava_m_Page_69.jp2
121f914e4020653e7aaf2dd6a03b00af
5d602802f087edcfcb5b0931850b134240906f96
122827 F20110331_AACMSS srivastava_m_Page_54.jp2
b709ed6a0c3d916fda07b532d22ae48f
b7bd678064d28980dab0de74c6f38249d32fccd3
114229 F20110331_AACMTI srivastava_m_Page_70.jp2
354472270b2d45873048f4558b1a74d3
957d929ccafa6d170dc8c1fb37c2f704d58a0e26
118214 F20110331_AACMST srivastava_m_Page_55.jp2
0a3220ded433805795266213b5e24502
a605bffdc82d40c8bb86d941cd1db5ebe4d2edf7
120328 F20110331_AACMTJ srivastava_m_Page_71.jp2
2487cecb3a3bfc3acd0d79048406b452
c9db8bc434663bed21f0cf4ddbeb33385c4da6b2
57133 F20110331_AACMSU srivastava_m_Page_56.jp2
b4009052b3c8c50f1d0afc199c79eb99
0c2195ce776135e68572050eb23290e4d96b5975
82032 F20110331_AACMTK srivastava_m_Page_72.jp2
95dbb080baa4ea64045919c22bc04b64
313895ddad72c388669584ca48319fc942ad9ee7
51587 F20110331_AACMSV srivastava_m_Page_57.jp2
833a500990a7e6e9febe859e713dca45
01e5407a590bb8b0dd32b0310119b9796330b4ca
34130 F20110331_AACMTL srivastava_m_Page_73.jp2
99c9a71eaa9b9b21fc143e79e5389af2
24dda7eda0c758fe1104992927a2bcd303835618
50228 F20110331_AACMSW srivastava_m_Page_58.jp2
436d3f63a52a73ac847354ee74fd7872
cfb6722198685f488ac66d4c5fc60f4be6c4af72
117450 F20110331_AACMUA srivastava_m_Page_88.jp2
b122bdeab6559045eb29f789bbac8fae
49bc92c1da9cb1e39c3334b245079dcce11cfaa5
468254 F20110331_AACMTM srivastava_m_Page_74.jp2
f6f10a03bd836d0577efaa2b3d232324
a3ed40ff3da84aa27e0edb2aa89a61bd5ce1f1e0
59125 F20110331_AACMSX srivastava_m_Page_59.jp2
9effad41d0b241ad8af95e766940bd78
1552475c91f13669f73e969e7313c6911f651b8b
119633 F20110331_AACMUB srivastava_m_Page_89.jp2
8e7ad0a78caafe1b25d3357fae3b6271
31cbbda2f841b0d6d5ade9cc58b5b8f98f6be653
511168 F20110331_AACMTN srivastava_m_Page_75.jp2
cc5efaad6efbfa63dda2a0f507f76198
15266e918a4f300817be05687d7bb49f5c27a5f7
605904 F20110331_AACMSY srivastava_m_Page_60.jp2
73acc2eb8a158a7da3c806dbf02132d1
1769b7999e217dc506fe72509e1339e81d6f754e







UPTAKE AND SURVIVAL OF Vibrio vulnificus IN OYSTERS


By

MILAN SRIVASTAVA
















A THESIS PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
MASTER OF SCIENCE

UNIVERSITY OF FLORIDA

2007

































2007 Milan Srivastava

































To my family and friends









ACKNOWLEDGMENTS

The substantial amount of work done in this study could not have been completed without

the help of many people. First, I would like to extend my most profound gratitude to my advisor

Dr. Anita C. Wright. I want to thank her for believing in me and giving me an opportunity to

continue my graduate school. I am thankful for her encouragement throughout my research work

and polish my skills that helped me become a researcher. I would also like to extend my thanks

my committee members, Dr. Rodrick E. Gary for his guidance and valuable suggestions. Special

thanks to Dr. Max Teplitski for his insightful suggestions on improving on my poster

presentation in Marine biotech conference, and in preparing this document.

My research would not have been possible without the help of Ms. Jennette Villeda and

Ms. Melissa Evans, my lab mates and above all my friends. These two people stood by me in

tough times with the shoulders to lean on. Ms. Villedajoined our lab during my initial phases of

research and provided the helping hand whenever I needed it. Her reliable hands helped me a lot

in developing the methodology of this project. Special thanks to Melissa Evans for being my

support pillar. She was always present with the positive attitude and warming hug on every other

tough day in the graduate school. I would like to thank for her love and support, for

accompanying me to the lab after hours to finish up experiments, reading my thesis again and

again, and for listening to me ranting and raving about life as graduate student. Special note of

thanks goes to Dr. Maria Chatzidaki-Livanis for sharing her technical knowledge for the benefit

of my research work and motivation to do well all the time. I would also like to thank Dr.

Melissa Jones, for all her easy access and suggestions in the molecular work involved in this

research project. All my Lab mates, Mr. Mike Hubbard, Mr. Koo-Whang Chang, Ms. Lina

Jacques deserve a special note of thanks for always being handy and helpful throughout my

research project.









My friends were my pillars for the moral support and encouragement; in particular Mr.

Chambal and Ms. Sumita Pandey deserves a special note of thanks. They were filling elements in

the dip during my graduate school. I can't even thank enough my family, my parents, my in-laws

for their unbending support and loving words, which always helped me through thick and thin.

Last but not least, my deepest gratitude and love goes to my husband, Saurabh Srivastava, for his

love and support when the pressures of life overwhelmed me. He gave me the lifetime of

encouragement and instilled in me the confidence to know that I can accomplish anything I set

my mind to. His valuable positive suggestions and role as closet critique made a remarkable

difference in the formulation of this document









TABLE OF CONTENTS

page

A C K N O W L E D G M E N T S ..............................................................................................................4

LIST O F TA B LE S ..........................................................................................................

LIST OF FIGURES ................................... .. .... ..... ................. .9

LIST OF ABBREVIATIONS ............................ ...... .............. ........... 10

A B S T R A C T ............ ................... ............................................................ 12

CHAPTER

1 INTRODUCTION ............... ................. ........... .............................. 14

V. vulnificus D distribution and O ccurrence........................................ .......................... 15
V. vulnificus Pathogenesis ................ ........................................................... ....................16
Potential V vulnificus Secreted Virulence Factors............................................................17
Lipopolysaccharide and Capsular Polysaccharide........................ ...... ...............18
The Genetics of CPS and Phase Variation .................. ......................................... 19
V. vulnificus Flagella ........................ ........ .. ... ... .. .................. 21
V. vulnificus Type IV Pilus ............................ .... .................. ...... ............................... 23
V. vulnificus Surface Structures and Environmental Survival..............................................24
G oals an d O bjectiv es ........ .. .................... ...................................................... 2 5

2 M A TER IA L A N D M ETH O D S...................................................................... ..................29

Bacterial Strains and Culture Conditions ........................................ .......................... 29
Generation of a Double Mutant for pilA and wzb.................................................32
Oyster M odel for V vulnificus Infection ........................................................... ................... 33
Bacterial Inoculation and Determination of Bacterial Content in Oysters.............................35
D issection of O y ster T issues ......................................................................... ................... 36
Evaluation of Phase V ariation in O ysters.........................................................................37
Com petition Studies............ ...... ....................... ............ 39
Statistical A n aly sis............................. ........................................................... ............... 4 0

3 DEVELOPMENT OF OYSTER MODEL OF INFECTION.....................................44

O ptim ization of Tetracycline Treatm ent ..................................................... .....................44
Recovery of V vulnificus in Post Tetracycline Treated Oysters ........................................45
Effects of Extended Incubation Post Tetracycline Treated Oysters.................................45
Bacterial Recovery in Tetracycline and Non-tetracycline Treated Oysters .........................45










4 ROLE OF CAPSULAR POLYSACCHARIDE IN SURVIVAL OF V. vulnificus IN
O Y S T E R S ................... ........................................................... ................ 5 1

Distribution of CPS Mutant and Phase Variants in Oyster Tissues............... ............... 52
Recovery of V. vulnificus CPS Strains in Oysters after Extended Inoculation ....................52
Phase variation of V vulnificus in Oysters........................................................ ..................53
Confirmation of Phase Variation of Translucent V. vulnificus with Growth Plasmid............54

5 ROLE OF TYPE IV PILUS IN SURVIVAL OF V vulnificus IN OYSTERS ......................63

Distribution of V. vulnificus pilA Mutants in Oyster Tissues ..........................................63
Recovery of V. vulnificus ApilA Mutants in Oysters after Extended Inoculation ..................64
Survival of V. vulnificus in Oysters as a Result of Bacterial Competition.............................64

6 ROLE OF FLAGELLA IN SURVIVAL OF V. vulnificus IN OYSTERS............................. 70

M utility Test of V. vulnificus Strains ........................................................... .....................70
Distribution of V. vulnificus Flagella Mutants in Oyster Tissues......................................71

7 DISCUSSION AND CONCLUSION .............................................................................76

L IST O F R E F E R E N C E S ...................................................................................... ...................9 1

B IO G R A PH IC A L SK E T C H .............................................................................. .....................97









LIST OF TABLES


Table page

2-1 Summary of V. vulnificus strains used in this study .................................. ............... 41

4-1 Phase variation of V vulnificus in oysters .............................................. ............... 57

4-2 Phase variation of V vulnificus in artificial seawater.....................................................58

4-3 Confirmation of phase variation in MO6-24/T1 using pGRT902 in oysters...................59

6-1 Relative m otility of V. vulnificus strains.................................................. ..... .......... 73









LIST OF FIGURES


Figure p e

1-1 Genetic organization of Group 1 CPS operons................. ............................................27

1-2 Differences in the colony morphology of Vibrio vulnificus strains.......................... 28

2-1 Sum m ary of oyster m odel of infection ................................ ..............................................42

2-2 Oyster dissection........ .......... .............................. ........... 43

3-1 Effect of tetracycline (TC) treatment on survival of V vulnificus in oysters ..................47

3-2 Recovery of V. vulnificus from tetracycline (TC) treated oysters. ...................................48

3-3 Effects of extended incubation on Tetracycline (2[tg/mL) treated oysters.....................49

3-4 Comparison of tetracycline (TC) and non-tetracycline treated oysters. ..........................50

4-1 Recovery of V. vulnificus CPS mutant and phase variants in oysters.............................60

4-2 Distribution of CPS mutant and phase variants of V. vulnificus in oyster tissues ............61

4-3 Recovery of V. vulnificus in oysters after extended inoculation time......................... 62

5-1 Bacterial recovery of V vulnificuspilA mutants in oysters........................ ...............67

5-2 Distribution of V. vulnificus ApilA mutant and ApilAAwzb double mutant in oyster
tissue es ............... .............................. ................................................6 8

5-3 Recovery of V. vulnificus ApilA and ApilAAwzb double mutant in oysters after
extended inoculation. .......................... ...... .................... .. ............. .. ......69

6-1 Recovery of V. vulnificus flagella mutants in oysters......................................................74

6-2 Distribution of V. vulnificus flagella mutants in oyster tissues................. ............. ...75









LIST OF ABBREVIATIONS

APW Alkaline peptone water

ASW Artificial sea water

AI Autoinducer

CDC Centers for Disease Control and Prevention

CPS Capsular polysaccharide

CFU Colony forming units

C Degree centigrade

EPS Extra-polymeric substance

FDA Food and Drug Administration

Kan Kanamycin

LA Luria-Bretani agar

LB Luria-Bretani broth

LD50 Lethal dose 50%

LPS Lipopolysaccharide

mCPC Modified Cellobiose-Polymyxin B-Colistin

MSHA Mannose-sensitive hemagglutinin

NPW3 Neutral peptone water 3

OMP Outer membrane protein

PBS Phosphate buffered saline

PCR Polymerase chain reaction

PHT Post harvest treatment

Pol Polymixin B

ppt Parts per thousand

rpm Rotations per minute









RTX Repeats in the structural toxin

TC Tetracyline

TCP Toxin-coregulated pilus

TR1 Translucent Genotype 1 (intact CPS operon)

TR2 Translucent Genotype 2 (deletion ofwzb)

VBNC Viable but non-culturable









Abstract of Thesis Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Master of Science

UPTAKE AND SURVIVAL OF Vibrio vulnificus IN OYSTERS

By

Milan Srivastava

December 2007

Chair: Anita C. Wright
Major: Food Science and Human Nutrition

Vibrio vulnificus is a halophilic, gram-negative, opportunistic pathogen that is associated

with plankton and shellfish (oysters, clams, and mussels). This bacterium exhibits distinct

seasonality and is frequently isolated at temperatures greater than 20C and is associated with

consumption of contaminated raw oysters. Adaptations in the surface structures of V. vulnificus

may influence the environmental reservoirs of disease. Additionally, survival of V. vulnificus

may also be dependent on phase variation of these cell surface structures. This research study

examined the contributions of known virulence factors, such as capsular polysaccharide (CPS),

pili, and flagella to the survival of V. vulnificus in oysters, using mutational analysis in an oyster

model of infection. Oysters (Crassostrea virginica) were acclimated in artificial seawater

(16ppt), and background V vulnificus was reduced to <10 CFU/gram of oyster meat with

tetracycline (2gg/mL) treatment, followed by transferring to fresh artificial seawater (ASW) with

charcoal filtration to remove the residual antibiotic. Survival in inoculated oysters (106 CFU/mL)

was determined by plate count on non-selective (total bacteria count) and selective (V vulnificus

count) agars. Strains included virulent, encapsulated wild type strain with opaque colonies;

translucent reversible phase variant (T ) with reduced CPS and virulence, rugose (wrinkled

colonies) phase variant with enhanced biofilm; or mutants with deletion in CPS (Awzb), and in









the operon for Type IV Pilus (ApilA) and double deletion mutant (ApilAAwzb), or deletions in

either one (AflaCDE) or both (AflaCDEAflaFBA) flagellar genetic loci and flagellar motor

(AmotAB) components. Wild type opaque V. vulnificus was recovered from oysters at

significantly higher levels as compared to the rugose variant (p=0.005), or to Awzb (p=0.025),

ApilA (p=0.01), ApilAAwzb (p=0.002), or ACDE/AFBA (p=0.03) deletion mutants. On the other

hand rugose, ApilA and ApilAAwzb strains showed greater recovery in seawater compared to

oysters, indicating that in vitro biofilm function may be independent of survival of V vulnificus

in oysters. Translucent phase variants (T1) did not differ from the wild type, and both T1 and

rugose phase variants reverted to opaque morphotype at high frequency (72 and 100%,

respectively) in oysters, while maintaining their stable morphology in the seawater. Competition

studies confirmed that encapsulation contributes to the survival of V vulnificus in oysters.

Distribution of strains differed somewhat in oyster gills and intestinal tract, but significant

reductions in recovery from the hemolymph were observed for rugose variant, Awzb, ApilA,

ApilAAwzb mutants and for all the flagella mutants as compared to the wild type. Thus, surface

structures such as CPS, pili and flagella, and motility of V vulnificus contribute not only to

survival in whole oysters but also to dissemination of the bacterium, especially to the

hemolymph of the oyster. Furthermore, observations of phase variation within the oyster host

indicate that variable expression of CPS is a survival strategy of V vulnificus in oysters.

The research study described herein may ultimately lead to an understanding of the

contribution of surface structures of V. vulnificus in their molluscan shellfish host and thereby

aid in designing post harvest treatment methods to bring about more efficient reduction of this

potential pathogen to safe levels in seafood for human consumption.









CHAPTER 1
INTRODUCTION

Vibrio vulnificus is the most common cause of seafood associated deaths in Florida (Hlady

et al., 1993; Hlady and Klontz, 1996). V vulnificus is a Gram-negative, flagellated, curved

bacterium that was first identified and described by the Centers for Disease Control and

Prevention (CDC) in 1976 (Hollis., 1987). V vulnificus belongs to the family of Vibrionaceae

and is a mesophilic and obligate halophilic bacterium. Formerly referred as the "lactose-positive"

Vibrio (Farmer, 1979), the ability of V. vulnificus to ferment lactose distinguishes this bacterium

from other member of Vibrio genus. V. vulnificus exists naturally in sediments, coastal waters

and resides in high numbers in filter-feeding shellfish (oysters, clams and mussels) (Tamplin and

Capers, 1992; DePaola et al., 1994; Wright et al., 1996; Motes et al., 1998). Oysters harvested

during warm months, when the water temperature is greater than 22 C from the Gulf of Mexico,

have high concentrations of V. vulnificus that may reach or exceed 105 bacteria per gram of

oyster meats (Murphy and Oliver, 1992; Kaspar and Tamplin, 1993; Levine, 1993; Wright et al.,

1996; Kelley et al., 1997). Approximately 80% of all reported V. vulnificus infections occur

when the level of this bacterium in the environmental reservoir and marine environment are high,

typically between the months of May and October (Hlady et al., 1993; Kelley et al., 1997; Motes

et al., 1998). V vulnificus infections are usually associated with the consumption of

contaminated molluscan shellfish.

V. vulnificus infections in humans include primary septicemia and wound infections.

Ingestion of V vulnificus contaminated oysters is the most common mode of exposure that can

result in primary septicemia in immune deficient individuals (FDA, 1992; as reviewed by Gulig

et al., 2005; Ross et al., 1994; CDC, 1996; Hlady and Klontz, 1996). Wound infection can occur

as a result of exposure of open and/or breached skin surface to the sea water or to the handling









and cleaning of shellfish (Howard and Lieb, 1988; Shapiro et al., 1998; as reviewed by Oliver,

2005). While the fatality rate from wound infections is low (15%), primary septicemia has a high

(> 50%) mortality rate (Hollis et al., 1976). V vulnificus is also recognized as an emerging

pathogen (Altekruse, 1997), due to an increase in annual harvesting of oysters during summer

months (oyster harvesting increased from 8% in 1970 to 30% in 1994) or possibly due to

increase in water temperatures as a result of global warming.

According to the CDC's report on Vibrio illnesses from 1997-2004, V. vulnificus was the

most frequently isolated Vibrio species from the Gulf Coast states. Based on the report, V.

vulnificus was isolated from 121 patients, out of which 90% were hospitalized while 26% of total

reported cases resulted in death (CDC, 2005). Due to the severity of V. vulnificus infections

(Hlady et al., 1993; CDC, 1996; Hlady and Klontz, 1996), the United States Food and Drug

Administration (FDA) has mandated post harvest treatment (PHT) of oysters (FDA, 1995), such

as ice immersion, low temperature pasteurization, individual quick freezing and high hydrostatic

pressure. The use of irradiation exposure with no apparent reduction in sensory qualities has also

been suggested for enhancement of microbial quality of seafood (Venugopal et al., 1999). These

methods have been proposed to reduce V vulnificus levels in seafood to non-detectable levels,

thus reducing the risk of infection associated with raw oyster consumption (Andrews, 2000;

Quevedo et al., 2005). More recently, use of a green fluorescent protein-labeled strain of V

vulnificus was suggested for studying the behavior of V. vulnificus during post harvest handling

of molluscan shellfish with respect to growth characteristics, heat tolerance, freeze-thaw

tolerance, acid tolerance, cold storage tolerance and cold adaptation (Drake et al., 2006).

V. vulnificus Distribution and Occurrence

Studies have reported that the main cause of V. vulnificus disease is the consumption of

contaminated raw oysters (CDC, 1993) harvested from Gulf coast estuaries (Shapiro et al.,









1998). Temperature is a key factor in the isolation of V vulnificus. The V vulnificus numbers in

Gulf coast estuaries can range from 103 to 105 bacteria per gram of oyster meat during warmer

months (Kelly, 1982; Tamplin et al., 1982; Tamplin and Capers, 1992). Although V vulnificus

can be isolated at water temperature of 15C (Tamplin et al., 1982; Kaspar and Tamplin, 1993),

the appearance of this bacterium in seawater, shellfish and the incidence of V vulnificus

infection increases with water temperature during warmer months, when the water temperature

reaches 30 37C. V. vulnificus survives poorly below 8.5C (Kaspar and Tamplin, 1993) and

"fails" to multiply in oysters at water temperature of 13C and lower (Murphy and Oliver, 1992;

Cook, 1994). Low to moderate salinities are also associated with the presence of V. vulnificus,

which is a salt-requiring bacterium with salinity preferences ranging from 7-16 parts per

thousand (ppt) in Gulf coast sites. High salinity levels, (more than 25ppt) are not favorable and

can have a negative effect on the survival of V vulnificus (Kaspar and Tamplin, 1993; Motes et

al., 1998). The association of V. vulnificus with oyster hemocytes is also dependent on the

temperature (Rodrick, 1984). Numbers of V vulnificus associated with hemocytes decrease at

lower temperatures such as 4 and 15C and increase at 370C and 44C (Rodrick, 1984).

V vulnificus Pathogenesis

V. vulnificus is one of the most invasive and opportunistic human pathogen among the

Vibrio species, that is often associated with primary septicemia. Primary septicemia is defined as

a systemic illness caused by V vulnificus, which is associated with ingestion of raw and

undercooked shellfish. Wound infection is another common manifestation of V vulnificus

infection in humans. V. vulnificus can easily infect pre-existing wounds due to exposure of the

wound to seawater or marine organisms harboring the bacterium (Blake, 1979, Blake et al.,

1983). Gastroenteritis is another, less frequently occurring symptom of V vulnificus disease. The

commonly reported symptoms of systemic infection by V vulnificus include fever, nausea, and









hypotension (Blake et al., 1979; Klontz et al., 1988). Development of secondary bullous lesions

on legs and feet is another feature of primary septicemia and they are characterized by fluid-

filled blisters, typically resulting in tissue and muscle destruction (Tacket et al., 1984; Klontz et

al., 1988).

The severity of V. vulnificus infections and the infectious dose required for appearance of

this disease are dependent upon a number of host factors. People who are most susceptible to V.

vulnificus infection usually have underlying health conditions such as alcoholism, liver disease

(hepatitis, cirrhosis), diabetes mellitus, cancer, hemochromatosis (iron-overload) and immune

system dysfunction (Hlady et al., 1993; CDC, 2005; as reviewed by Gulig et al., 2005). The

infectious dose of V. vulnificus that causes disease in humans is not known. However, people

with a recent history of gastro-intestinal illness and infection of skin and open wounds have a

higher risk of getting V vulnificus infections (Klontz et al., 1988; Hlady and Klontz, 1996).

Thus, host immune status is important for the pathogenesis of V vulnificus (as reviewed by

Gulig et al., 2005).

Potential V vulnificus Secreted Virulence Factors

V. vulnificus exhibits multiple virulence factors that may be involved in or required for the

manifestation of this disease in humans. Iron is important for bacterial growth, and bacteria have

mechanisms to scavenge iron from the host through the production of siderophores. V vulnificus

produces hydroxymate and phenolate (catechol) siderophores for the acquisition of iron from

mammalian host to cause fulminating septicemia and invasive wound infection in animal models

(Wright et al., 1981; Simpson and Oliver, 1983; Litwin et al., 1996). Both clinical and

environmental strains of V vulnificus expresses secreted factors such as cytolysin/hemolysin

(vvhA gene) and metalloprotease (vvpE), which were initially thought to contribute to

pathogenicity in mammalian models. However, mutations in either of the two genes indicated no









apparent role of these proteins in the virulence of this bacterium (Wright and Morris, 1991).

Quorum sensing has also been related to the regulation of gene expression and virulence of V.

vulnificus (Kim et al., 2003). It has been reported that autoinducer-2 (AI-2) communication

molecules play an important role in the stress response in starvation and stationary growth phase

of V. vulnificus (McDougald et al., 2006) and may be important for the virulence of V. vulnificus.

Exotoxin (s) belonging to the family of pore-forming proteins, named as RTX toxins (repeats in

the structural toxin), may also play an important role in virulence in many gram-negative

bacterial pathogens. The RTX toxin operon consists of four genes namely rtxA, rtxB, rtxC, and

rtxD. RTX toxin is encoded by rtxA. The transportation and delivery of RTX toxin outside the

bacterial cell is facilitated by rtxB and rtxD (Welch, 1992). It has been shown that RtxA toxin

cause pore formation in red blood cells, and necrotic cell death in Hep-2 cells (Lee et al. 2007).

A rtxA mutant in V. vulnificus exhibited a 100-fold increase in lethal dose 50% (LD5o) in mouse

model suggesting that RTX toxin plays a critical role in virulence of V. vulnificus (Lee et al.,

2007).

Lipopolysaccharide and Capsular Polysaccharide

The expression of lipopolysaccharide (LPS) on the cell surface was also thought to

contribute to the virulence and toxic shock of V. vulnificus (Martin and Siebeling, 1991).

However, LPS from V. vulnificus was less pyrogenic than the LPS from other Gram- negative

pathogens (McPherson et al., 1991; Powell et al., 1997).On the other hand, studies have

suggested a positive relationship between the degree of capsular polysaccharide (CPS) expressed

and virulence in animal models (Yoshida et al., 1985; Simpson et al., 1987; Wright et al., 1990;

Wright et al., 1999; Wright et al., 2001; Chatzidaki-Livanis et al., 2006).

V. vulnificus expresses an extracellular acidic capsular polysaccharide on its cell surface.

There is a relation between the capsular expression, the colony opacity and the virulence of V.









vulnificus (Amako, 1984). Colonies that exhibit capsule have an opaque phenotype, but these

cells can also undergo a reversible switch to a translucent phenotype, characterized by reduced or

patchy expression of capsule (Simpson et al., 1987; Wright et al., 1990). Presence of capsule is

correlated with virulence in animal models, antiphagocytic activity, tissue invasiveness and

resistance to the bactericidal activity of normal human serum. On the other hand, loss of capsule

is accompanied by decrease in virulence, hydrophilicity and serum susceptibility (Wright et al.,

1990). Additionally, unencapsulated strains have significantly higher LD50 than the wild type

encapsulated strain (Wright et al., 1990). Heterogeneous capsular types have been found among

the various clinical and environmental isolates of V vulnificus (Hayat et al., 1993). Thus,

different V vulnificus strains have differences in their CPS composition, and are likely to use

different metabolic pathways for biosynthesis of CPS (Reddy et al., 1992; Hayat et al., 1993).

However, most strains isolated from human infections or oysters appear to be encapsulated

(Simpson et al., 1987; Stelma et al., 1992; Wright et al., 1996). Expression of CPS can also vary

depending on the growth phase and other environmental conditions, especially temperature

(Wright et al., 1999; Wright et al., 2001). It has been reported that surface expression of CPS

increases during logarithmic growth phase and decreases during stationary phase in the wild type

strain. Additionally, greater CPS is expressed during growth at 300C as compared to 37C

(Wright et al., 1999).

The Genetics of CPS and Phase Variation

Both CPS expression and virulence are associated with opaque colony morphology.

However, opaque colonies can spontaneously revert to the translucent phenotype, reduced or

patchy expression of surface polysaccharide (Figure 1-2), by a process called phase variation.

The V. vulnificus opaque strain exhibits a reversible-phase variation to a translucent morphotype

that occurs within a population at a rate of 10-3 to 10-4 (Wright et al., 1990; Wright et al., 1999;









Wright et al., 2001). The avirulent, unencapsulated translucent, spontaneous phase variant of V

vulnificus can also revert back to the original opaque, encapsulated phenotype (Wright et al.,

1999).

Epimerase genes encoding the CPS biosynthetic gene (Zuppardo and Siebeling, 1998) and

wza, encoding a CPS outer membrane transporter (Wright et al., 2001) have been reported. More

recently, the latter gene was found to reside within the group 1 CPS operon of V vulnificus

strains, and the entire operon was sequenced for opaque and translucent strains (Figure 1-1). V

vulnificus CPS genes show homology in the organization and sequence of previously described

group 1 CPS operons in E. coli (Wright et al., 1999; Chatzidaki-Livanis et al., 2006). E. coli

group 1 capsule is defined by the presence ofwza-wzb-wzc genes in the CPS operon, and a

similar gene cluster was found in V vulnificus (Chatzidaki-Livanis et al., 2006) (Figure 1-1).

Wza is an outer membrane lipoprotein that is involved in surface assembly of group 1 capsules

and transportation of polysaccharide to the outer surface (Drummelsmith and Whitfield, 1999).

Wzb is a cytoplasmic acid phosphatase that functions to catalyze the removal of phosphates from

Wzc. Wzc is tyrosine kinase, located in the plasma membrane, is involved in the surface

assembly of the capsular layer (Drummelsmith and Whitfield, 1999). Multiple genotypes (Tl, T2

and T3) from the translucent isolates of V. vulnificus were identified (Chatzidaki-Livanis et al.,

2006). T1 (M06-24/T1) strain with reduced CPS expression showed a CPS operon that was

identical to that of the opaque strain. M06-24/T2 (Awzb) cells showed a deletion mutation in the

wzb, resulting in acapsular colonies locked in the translucent phase, which were unable to revert

to opaque colony morphology (Chatzidaki-Livanis et al., 2006). T3 (M06-24/T3) strains had

more extensive genetic deletions that also included the wzb. Complementation of the CPS

deletion mutant with wzb, restored the opaque phenotype, and electron microscopy confirmed









that the strain recovered the surface expression of CPS (Chatzidaki-Livanis et al., 2006). Thus,

different mechanisms were proposed to be responsible for reversible phase variation in CPS

expression versus irreversible genetic deletions in V. vulnificus (Chatzidaki-Livanis et al., 2006).

However, the precise role of phase variation in Vibrio species is less clear, and the genetic

mechanism (s) responsible for phase variation is still unknown.

V. vulnificus also produces a rugose or wrinkled colony type from both opaque and

translucent strains at high frequencies, that can switch back to opaque or translucent colony

morphology (Figure 1-2C) (Grau et al., 2005). Rugose colonies show enhanced biofilm

formation and survival under adverse environmental conditions (Grau et al., 2005). In V

cholerae, these rugose variants express alternate CPS composition with neutral (glucose and

galactose) sugars (Yildiz and Schoolnik, 1999) as opposed to the acidic sugar (uronic acid)

expressed by Group 1 CPS. However, the composition of rugose CPS in V. vulnificus is

unknown. Upon further characterization of rugose strains, it was found that the V vulnificus

rugose strain is relatively less motile and more resistant to serum killing than the parental opaque

or translucent version. Despite their decreased motility, the rugose strain was reported to possess

a polar flagellum.

V vulnificus Flagella

Flagella help in the initial absorption of bacteria to surfaces, biofilm substrates, and

invasion of host (McCarter, 2001; Harshey, 2003). Flagellum based motility is required for the

localization of V vulnificus to sites of infection or for invasion in the host cell (Lee et al., 2004).

McCarter studied the genetic and molecular characterization of the polar flagellum of Vibrio

parahaemolyticus (McCarter, 1995). It was reported that multiple (six) flagellin genes encode the

filament subunits of the flagellum, namely flaA, flaB, flaC, flaD, flaE andflaF, organized in two

genetic loci,flaFBA andflaCDE (McCarter, 1995). Further analysis revealed that none of the six









flagellin genes were essential for filament formation, and loss of a single flagellin gene has no

significant effect on the motility or the flagella structure (McCarter, 1995). However, deletion of

the AflaCDE genetic locus showed reduced motility, but deletion of both loci

(AflaFBAAflaCDE) completely abolished the motility and the flagella expression (McCarter,

1995; Tucker, 2006). More recently, (Tucker, 2006) examined the roles of flagella, motility, and

chemotaxis in the virulence of V vulnificus using a mouse model of disease. It was found that a

mutant with a deletion in the AflaFBA locus was equally motile and virulent for either localized

skin or systemic liver infection as compared to that of wild-type. On the other hand, deletions in

the AflaCDE locus resulted in strain with reduced motility and virulence (both localized and

systemic) as compared to the wild-type. Furthermore, deletion of flagella motor genes (AmotAB)

resulted in a non-motile strain that showed attenuated skin infection in the mouse model.

Complementation of this mutant with cloned motAB fully restored the motility to levels of the

wild-type. The AflaFBAAflaCDE double deletion mutant was also non-motile and showed

attenuated virulence for systemic infection in a mouse model. Other studies have focused on the

role of flagellar basal body rod proteins (flgC) as a potential virulence determinant of V

vulnificus (Ran Kim, 2003). A transposon insertion mutation in the AflgC gene showed

decreased motility, biofilm formation, cytotoxicity to the He-Le cells and virulence in mice

models. Furthermore, flagella related motility mutant (AflgE) was also less virulent and deficient

in the biofilm formation to INT-407 cells (Lee et al., 2006). Recently, expression of methyl-

accepting chemotaxis protein was found to be during V. vulnificus infection, and it was theorized

that MCP might play an important role in invasion of V vulnificus during gastrointestinal

infection (Kim et al., 2003). Furthermore, it was reported that defects in chemotaxis can alter the

ability of V vulnificus to cause disease in animal models (Tucker, 2006).









V vulnificus Type IV Pilus

Expression of pili on V vulnificus cells was identified by electron microscopy, and more

pilus fibers were seen on clinical isolates from blood or wounds than environmental isolates

(Gander and LaRocco, 1989). Presence of pilus-like structures on V. vulnificus can facilitate

adherence, attachment and colonization to the HEp-2 cells of host surface receptor (Paranjpye et

al., 1998). Type IV pili are common to many gram-negative bacteria that allows for flagellum-

independent movement, termed as twitching motility. Genes encoding proteins required for the

biogenesis of type IV pili in V. vulnificus have been reported (Paranjpye and Strom, 2005). It has

been shown that mutations in a gene encoding IV prepilin peptidase/N-methyltransferase, vvpD

orpilD, results in a loss of all pili expression on the cell surface of V. vulnificus, which

significantly decreases cell cytotoxicity in Chinese Hamster Ovary (CHO) cells, adherence to

HEp-2 cells and reduces virulence in mouse model (Paranjpye and Strom, 2005).

The amino acid sequence of V. vulnificus type IV pilin (PilA) shares extensive homology

to group A type IV pilin expressed by many pathogens, including V. cholerae (PilA) and P.

aeruginosa (PilA). The V vulnificuspilA is part of an operon that also includes three other pilus

biogenesis genes (pilBCD), that encodes for pilin precursor protein in the type IV pilus

biogenesis gene cluster. A deletion in the V. vulnificus ApilA, resulted in reduced biofilm

formation, decreased adherence to HEp-2 cells, and attenuated virulence in iron dextran-treated

mouse models (Paranjpye and Strom, 2005). However, pili were still present on the surface of

the ApilA mutant strain as shown by transmission electron microscope, suggesting that V

vulnificus produces other type (s) of pili. The genome of V vulnificus also encodes a second type

IV pilin, mannose-sensitive hemagglutinin (MSHA) that is homologous to V cholerae MSHA,

but carries only a single prepilin peptidase gene (Yamaichi et al., 1999). Therefore, the loss of all

surface pili on the ApilD mutant suggests thatpilD processes both type IV pilins of V. vulnificus









(Paranjpye et al., 1998). Recently, it has been reported the pilA and pilD of V vulnificus in the

colonization of bacterium in oysters by comparing the uptake and persistence of the wild type V

vulnificus to that of the pilA and pilD mutant strains (Paranjpye et al., 2007). The authors

reported that expression ofpilA and pilD are important for V. vulnificus to persist in American

oysters, Crassostrea virginica.

V vulnificus Surface Structures and Environmental Survival

Biofilm formation is an essential mode of bacterial survival in the natural environment, as

reviewed by (Watnick and Kolter, 1999). Biofilms are complex interactions of surface structures

of bacteria, constituting a protected community that allows bacteria to attach to surfaces,

providing an adaptive advantage for enhanced survival under adverse conditions (Watnick and

Kolter, 2000). Surface structures of bacteria such as flagella, fimbriae, pili, and extra polymeric

substances that are major determinants of virulence, helps in biofilm formation. For example, V

cholerae motility genes, motA and motB, are required for flagellar rotation and initiating cell-to-

surface contact in biofilm formation. The mannose-sensitive hemagglutinin (MSHA) pilus helps

the bacterium pull onto the abiotic surface, leading to the attachment of V cholerae El Tor

(Watnick and Kolter, 1999). Alternatively, V cholerae El Tor does not use virulence associated

toxin coregulated pilus (TCP) to form biofilms. Extra polymeric substances are necessary to

stabilize cell-to-cell interactions and formation of 3-dimension biofilms (Watnick and Kolter,

1999). Polysaccharides are not always critical to initial attachment, but are considered major

constitutes of the complex architecture of the later stages of biofilm formation. Expression of

capsular polysaccharide is also important for virulence in animal models (Yoshida et al., 1985;

Wright et al., 1999; Wright et al., 2001), but it inhibits biofilm formation in V. vulnificus (Joseph

and Wright, 2004). On the other hand, motility of V vulnificus is reported to be both a potential

virulence factor and an important determinant for initial cell-to-surface contact and colonization









in the host. In this regard, surface expression ofpili (type IV pilus) (Paranjpye et al., 1998;

Paranjpye and Strom, 2005; Paranjpye et al., 2007) and flagellar motility (Lee et al., 2004; Lee et

al., 2006; Tucker, 2006) are also reported to contribute to both biofilm formation and to the

virulence of V vulnificus in animal models.

Surface structures of V vulnificus such as CPS, flagella, flagellar motility and type IV pili,

that are associated with biofilms and virulence, may also provide adaptations for increased

survival of V vulnificus in their oyster host. Vibrio species attach to algae and plankton (Hood,

1997; Chiavelli, 2001). Oysters being filter-feeders trap suspended food particles including

bacteria and concentrate Vibrios in their tissues (Tamplin and Capers, 1992; Harris-Young et al.,

1993; Kennedy, 1999). Expression of CPS facilitates the survival of V. vulnificus by providing

resistance to phagocytosis by oyster hemocytes (Harris-Young et al., 1995). The degree of

encapsulation may also provide resistance to lysis by oyster lysozyme, as V vulnificus opaque

strain is more resistant to the intracellular bactericidal effects of oyster hemocytes than the

translucent strain (Harris-Young et al., 1995). Moreover, it has been proposed that reversion of

phase variation from translucent to the opaque phenotype may also allow the bacterium to regain

the CPS expression and enhance survival (Chatzidaki-Livanis et al., 2006). Expression ofpilA

and pilD are important for the persistence of V vulnificus in American oysters (Paranjpye et al.,

2007); however, the role of flagella and motility in the survival of V vulnificus in oysters in not

clear.

Goals and Objectives

The overall goal of this research study was to examine the hypothesis that different surface

structures of V. vulnificus, such as CPS, pili and flagella, contribute to the survival of V

vulnificus in an oyster model. These surface structures of V vulnificus, which are virulence

factors in mammalian models, may also provide adaptations for survival in oysters. Furthermore,









phase variation of cell surface structures such as CPS can potentially influence the behavior of

this bacterium in oysters. For validation of the hypothesis, mutational analysis was used to

examine these variables in an oyster model of infection. Survival of mutant and phase variants of

V. vulnificus was compared to the wild type encapsulated strain. The specific objectives of this

research include the following items:

1 To develop an oyster model of infection in order to assess the contribution of surface
structures such as CPS, pili and flagella expression in the survival and colonization of V.
vulnificus in an Eastern oyster, Crassostrea virginica.

2 To examine the uptake and distribution of V. vulnificus mutant and phase variants in
hemolymph, gills and digestive tract of oyster tissues.

3 To examine the relative importance of different surface structures of V. vulnificus at
different stages (extended inoculation up to 72 hours) of colonization.

4 To examine the rate of survival of V. vulnificus in oysters as a result of bacterial
competition between wild type and wzb deletion mutant and AwzbApilA double mutant
strain.

5 To examine the phase variation in oysters using the growth plasmid pGTR902 into V.
vulnificus as a marker for the appearance of opaque colonies resulting from phase variation
of translucent to the opaque phenotype. These experiments should distinguish phase
variation from die off within a population











BIOSYNTHETIC REGION


A) V. vulnificus M06-24/0 (allele 1):

OR wza y fwzzUI 'wecC wbpP waf HP3 HP4 rfaG wbjB rnlD wbjD wbuB wbfT wbfU wbfYe

B) V. vulnificus YJ106/O (allele 2):

oRwl a wV HP2P w^^ zc wecBGlwecC wbpP wzx ---------POLYMORPHIC GENES--wb
VVR2 V R2 YR2 V R3


OLYMORPHIC GENES------




>OLYMORPHIC GENES-------


Figure 1-1. Genetic organization of Group 1 CPS operons. Source: (Chatzidaki-Livanis et al.,
2006)


C) V. fischen:

ORD) E co K30:


D) E. coli K30:

EGrE-V


---------------------- ---P


TRANSPORT REGION



































C

Figure 1-2. Differences in the colony morphology of Vibrio vulnificus strains. A) Opaque
colonies, B) Translucent colonies, and C) Rugose (wrinkled) colonies









CHAPTER 2
MATERIAL AND METHODS

Bacterial Strains and Culture Conditions

The capsular polysaccharide (CPS) phase variants, CPS (wzb) deletion mutant of V.

vulnificus (Chatzidaki-Livanis et al., 2006), pili mutants (Paranjpye and Strom, 2005) and

flagella mutants of CMCP6 (Tucker, 2006) used in this research study are summarized in Table

2-1. All strains were stored in Luria-Bertani broth (LB; 1.0% tryptone, 0.5% yeast extract, and

1.0% NaC1) with 50% glycerol at -800C. The strains were recovered from frozen stock by

streaking for isolation on Luria-Bertani agar, LA (LB with 1.5% Bacto Agar) and incubated at

370C. For V. vulnificus plate counts, a species-specific medium, modified cellobiose-polymyxin

B-colistin (mCPC) agar, prepared with 1.0% peptone, 0.5% beef extract, 2.0% NaC1, 0.1% of the

1000X dye stock solution (4.0% bromothymol blue, 4.0% cresol red in 95% Methanol), and 10%

of filtered antibiotic solution (1.0% cellobiose, 3.0% colistin, 1.3 % polymyxin B dissolved in

100mL distilled water), as described in Bacteriological Analytical Manual (BAM), 2001 was

used. When required, kanamycin (50-300 [tg/mL) and polymyxin B (50 [tg/mL) were added to

LA and LB, to facilitate the growth of antibiotic resistant strains. The Escherichia coli (E. coli)

strain S17-k pir with pGTR902 (provided by Dr. Paul Gulig, University of Florida) was used for

introducing antibiotic resistance marker in V. vulnificus. The E. coli strain was grown in LB with

kanamycin (50[tg/mL) and arabinose (1%).

V. vulnificus CPS phase variants and the deletion mutant of MO6-24/O were from a

previous study by (Chatzidaki-Livanis et al., 2006). MO6-24/Opaque is a wild type encapsulated

clinical isolate that expresses CPS on the cell surface, marked by opaque colonies on solid

medium (LA) and is virulent in animal models. MO6-24/T1 is a reversible phase variant derived

from MO6-24/O, with undefined mutation that shows reduced or patchy CPS expression on the









cell surface. The strain is marked by translucent colonies and is less virulent in animal models.

M06-24/Awzb is an irreversible deletion mutant derived from M06-24/O with precise deletion

ofwzb of the CPS operon, eliminating CPS surface expression and locking the strain into

translucent phenotype (Chatzidaki-Livanis et al., 2006). Complementation ofwzb in trans

restores the CPS expression, and translucent colonies return back to the opaque phenotype

(Chatzidaki-Livanis et al., 2006). Another reversible phase mutant of opaque is M06-24/

Rugose, known for enhanced biofilm formation, is marked by wrinkled and dry morphotype.

This strain is relatively less motile than the parental opaque strain, but yet possesses a polar

flagellum (Grau et al., 2005).

V. vulnificus pili mutant was kindly provided by Dr. Rohinee Paranjype, and consisted of

strain M06-24/PilA with deletion mutation inpilA (Paranjpye and Strom, 2005). ThispilA is a

part of an operon and is clustered with three other pilus biogenesis genes, pilBCD. PilA is the

precursor of a substrate of PilD, and mutations inpilD, the gene encoding the type IV leader

peptidaseN-methyltransferase (type IV prepilin peptidase), result in the absence of pili on the

surface of V. vulnificus (Paranjpye et al., 1998). M06-24/ApilA strain has a specific deletion

mutation in pilA in M06-24/O parent strain, but does produce other type(s) of pili such as

mannose-sensitive haemagglutinin (MSHA), homologous to the V cholerae MSHA. This strain

shows intact CPS operon and is marked by opaque colonies on solid medium (LA). However,

this strain is defective in biofilm formation, adherence to epithelial cells and virulence in mouse

model (Paranjpye and Strom, 2005). Complementation ofpilA mutation restores PilA expression,

adherence to Hep-2 cells, biofilm formation on borosilicate glass surface, and virulence in iron

dextran-treated mouse model (Paranjpye and Strom, 2005). Another strain used in this study was

MO6-24ApilAAwzb, double deletion mutant derived from M06-24ApilA that has a precise









deletion ofwzb of the CPS operon. Deletion ofwzb eliminated the CPS surface expression and as

a result the cells were locked in the translucent phenotype (This study).

Flagellar mutants were kindly provided by Dr. Paul Gulig and were described previously

in the M.S. thesis of Matt Tucker (online access: Tucker, Matthew S; Analysis of flagella,

chemotaxis, and motility in the virulence of Vibrio vulnificus [electronic resource] / [Gainesville,

Fla.] : University of Florida, 2006) (Tucker, 2006). V. vulnificus flagella has six flagellin genes,

namely flaA, flaB, flaF,flaC, flaD andflaE that are organized into two genetic loci,flaFBA and

flaCDE. Briefly, these mutants consisted of mutations in one (AflaCDE) or both

(AflaFBAAflaCDE) genetic loci encoding the genes for the production of flagella and motility.

Using the CMCP6 strain, deletion was made in the gene locus of FLA 677(AflaCDE) strain

(Tucker, 2006). This resulted in a strain with reduced motility as compared to the wild type, but

had flagella and caused skin infections similar to that of the wild type but was absent in the liver

(Tucker, 2006). Strain FLA 711 (AflaFBAAflaCDE) is a double mutant, with deletion in all

flagella genesflaC, flaD, andflaE, flaF, flaB andflaA. Deletion of both genetic loci of V.

vulnificus flagella, resulted in a non-motile, non- flagellated strain that showed attenuated

virulence in both skin and liver in a mouse model. Mutations in flagellar propulsion (motility)

due to the deletion of motAB resulted in a non-motile and flagellated strain FLA 674 (AmotAB),

that was capable of causing skin infection but showed no systemic infection in mouse model

(Tucker, 2006). Complementation of FLA (AmotAB) strain with cloned motAB in trans fully

restored the motility and the virulence to the levels of the wild type (Tucker, 2006). However,

complementation to the strains FLA 677 (ACDE) and FLA 711 (AflaFBAAflaCDE) restored the

motility but the mutants were not virulent to the levels of wild type strain in the mouse model

(Personal communication with Dr. Paul Gulig).









To assess the motility of the V. vulnificus flagella mutant strains, the bacteria were grown

in the logarithmic growth phase and were stabbed into the motility agar (1% Bacto tryptone,

0.5% Sodium Chloride and 0.5% Bacto agar, Difco laboratories). Flagella strains that exhibited

motility swam through the agar, and created rings of growth. These rings of growth were

measured to record the motility after overnight incubation at 370C.

Generation of a Double Mutant for pilA and wzb

A double deletion mutant, defective in bothpilA and wzb expression, was constructed for

this study using the V. vulnificus strain M06-24/ApilA, previously described by (Paranjpye and

Strom, 2005). The protocol for generation of this strain was adopted from Jones, Ph.D

dissertation (online access: Jones, Melissa Kolsch; Regulation of phase variation and deletion

mutation in the Vibrio vulnificus group 1 CPS operon [electronic resource] / [Gainesville, Fla.]:

University of Florida, 2006) (Jones, 2006). M06-24/ApilA is an encapsulated strain as indicated

by opaque colony morphology. The Jones protocol induces spontaneous deletion mutant (Awzb),

with the precise excision of the wzb in group 1 CPS operon of V. vulnificus. The deletion ofwzb

results in a strain that does not express CPS that is indicated by translucent colony morphology

and the cells do not revert back to the opaque phenotype. This CPS (Awzb) deletion mutant was

used as control in this experiment.

For induction of wzb deletion mutant, a frozen culture of M06-24/ApilA was streaked on

LA that was grown overnight at 300C. Isolated colonies were inoculated into 25mL of LB and

incubated at 370C in an Orbital Shaker overnight, shaking at 70 rotations per minute (rpm) (C24

Incubator Shaker, New Brunswick Scientific). To obtain the inoculum concentration (106)

colony forming units per mL (CFU/mL), the overnight culture was used and the optical density

(OD) of overnight culture at wavelength A600 using spectrophotomer (Spectra Max, Molecular

devices) (A600) was measured. The inoculum concentration was also confirmed by serial









dilutions and plate counts. An inoculum of ImL at 106 CFU/mL with concentration (106

CFU/mL) was then centrifuged at 13,000 rpm (Eppendorf 5810R), suspended in PBS twice, and

transferred into Neutral Peptone water 3 (NPW3; 10 g of protease peptone 3, 1Og of NaCl in 1

litre (L) of water at pH 7.0) broth. This culture was incubated, statically at 370C. On days 1, 2, 3,

and 7 post incubations, samples were serially diluted in phosphate buffer saline (PBS) and spread

plated on LA, to determine changes in the colony morphology. Mutations were indicated by

appearance of translucent colonies and confirmed by polymerase chain reaction (PCR) as

previously described by (Chatzidaki-Livanis et al., 2006).

DNA for PCR was extracted using the boiling extraction method (Chatzidaki-Livanis et

al., 2006) and amplified by PCR under the following conditions: incubation at 940C for 5 min,

25 cycles of 940C for 1 min, 56C for 1 min, and 720C for 1 min with a final 7 min extension at

720C on a thermocycler (Eppendorf Master Cycler). Primers for wzaFl (5'-

gacgattccagcaggctctta-3') and wzcR2 (5'tccatcatcgcaaaatgcaagctg-3') were used for the

amplification (Chatzidaki-Livanis et al., 2006). The PCR products were visualized on 1%

agarose gels with ethidium bromide and compared to M06-24/opaque, M06-24/T1, and M06-

24/ Awzb standards. Amplicon size was determined by comparison to the Hi-Lo DNA ladder. A

negative control without template was also included the assay. The M06-24/ApilAAwzb strain

was confirmed by a decreased size of PCR amplicon that was equivalent to the CPS (Awzb)

control. When available, the strain was stored in LB with glycerol (50%) in -80C.

Oyster Model for V vulnificus Infection

An oyster model of infection was designed to study the role of bacterial surface structures,

such as CPS, pili and flagella, in the survival of V vulnificus in live oysters. High background

levels of V. vulnificus are present in the oysters during the summer month (April to November)

(Kelly, 1982; Murphy and Oliver, 1992; Wright et al., 1996; Motes et al., 1998). Presence of









background V vulnificus in oysters can lead to difficulties in examining the in vivo interactions

of this bacterium in a live oyster model. Therefore, the primary objective of developing this

model was to reduce the amount of indigenous V vulnificus present in oysters, utilizing an

antibiotic treatment. Following treatment, the oysters were artificially inoculated with the

mutants and phase variants of V vulnificus in order to compare the survival of these different

strains to that of the wild type strain. All experiments were conducted between the months of

April 2006 to August 2007 using live oysters (Crassostrea virginicia) obtained from the

Apalachicola Bay (Site 1611, Buddy Ward & Sons Seafood & Trucking, LLC, Florida). Oysters

were transported to the University of Florida on ice packs and used within 24 hours post harvest.

Prior to transferring oysters to artificial seawater, oysters were acclimated in dry storage at room

temperature for 30 minutes (min) in order to avoid temperature shock. Subsequently, oysters

were placed in wet storage at room temperature using ASW (Instant Ocean, Aquarium systems)

at salinity of 16 parts per thousand (ppt) in 25 gallons tanks that contained 8 gallons of ASW.

The oysters were acclimated for 72 hours. The tank was equipped with two filter pumps (Tetra

Whisper Internal Power Filter 10i) and the filters were filled with ultra-activated carbon filter

cartridges (Whisper Bio-Bag Cartridges, Tetra).

To achieve lower background levels of V. vulnificus in oysters, the experimental oysters

were treated with the antibiotic tetracycline (TC). For TC treatment, acclimated oysters (n=6 per

tank) were transferred to smaller tanks (capacity of 5 gallons) without filtration, and filled with 2

gallons of ASW. In order to determine the optimum TC concentration for bacterial reduction in

oysters, three different concentrations of tetracycline (1 lg, 2[g and 5 [g/mL) were added to

tanks containing the oysters. Following overnight TC treatment, oysters were transferred to 5

gallon tanks containing fresh ASW (2 gallons). The tank was equipped with one pump (carbon









filtration), and TC treated oysters were incubated overnight to remove residual antibiotic from

the oyster tissues as described in the Figure 2-1. Total bacterial counts and V. vulnificus in

oysters, before and after treatment, were determined as described below.

Bacterial Inoculation and Determination of Bacterial Content in Oysters

To examine the role of V. vulnificus surface structures in survival of this bacterium in

oysters, TC treated oysters (n=6) described above were inoculated withl06 colony forming units

per mL of individual strains of V vulnificus. Bacterial inocula were prepared from overnight

cultures that were grown in LB, shaking at 370C at 70 rpm. Cultures were diluted in alkaline

peptone water (APW), and numbers of bacteria were estimated by optical density at wavelength

A600. Actual numbers of bacterial inocula were determined by plate count on LA.

To determine bacterial content of oysters, before and after TC treatment and before and

after inoculation, oysters were shucked under sterile conditions as described in Figure 2-2A

using a shucking knife, rinsed with ethanol (70%) and flamed. The shucked oyster meats were

aseptically removed from the shell and rinsed three times with sterile phosphate buffer saline

(PBS) to remove the loosely attached bacterium on the surface of oyster tissues. Individual

oyster meats were collected in a sterile stomacher bag (Fisherbrand bags for stomacher, catalog

number # 01-002-54) and weighed. The average weight of the rinsed oyster meat was between

20-25 grams. Sterile PBS, equal to the weight of the oyster meat, was then added to the

stomacher bags. Individual oyster meats were then homogenized in a stomacher (Seward,

Stomacher 80 Biomaster, Lab System) for 180 seconds. Serial dilutions of oyster homogenates

were prepared in APW using 2 mL from the first homogenate, in the first dilution (9mL of APW)

to obtain a 1:10 dilution of oyster and ImL of the diluted homogenates in 9 mL APW for the

subsequent dilutions. Undiluted oyster homogenates (200tL) were plated on non-selective LA

for total bacterial count and on mCPC for V. vulnificus counts, and diluted homogenates used









100tL for plate counts. The LA and mCPC plates were incubated for 24 hours at 370C and 40C,

respectively.

After incubation, Log CFU/mL ofinocula and bacterial recovery of V. vulnificus strains

(Log CFU/gram of oyster) from oysters were calculated. Isolates of V. vulnificus strains,

recovered after oyster passage were also examined for changes in colony morphology on LA

plates. Colony morphology was recorded, and results were summarized as changes in colony

morphology following oyster infections, recorded as a percentage (%) of total colonies on LA.

Each experiment used at least six oysters for each strain inoculated and included an un-

inoculated control (n=6). Bacterial content was determined for individual oyster meats. TC-

treated oysters (n=6) were also inoculated with 100tL of APW without V vulnificus inocula as a

negative control for the study. Oysters without any TC treatment (n=6) were also examined in

order to determine the initial levels of bacterium present in oysters. Some experiments were

conducted in winter oysters that have natural reductions in bacterial load, in order to compare the

bacterial recovery in TC treated oysters versus non-TC treated oysters. All experiments were

repeated in triplicate.

Dissection of Oyster Tissues

Hemolymph, digestive tract, and gills of oysters were examined in order to determine the

distribution of V. vulnificus in oyster tissues using the oyster model of infection. Oyster

hemolymph was collected by drilling a notch in the oyster shell with a power drill, avoiding

contact with oyster tissue. With a 21-gauge needle, oyster hemolymph was withdrawn into a

sterile 5-mL syringe. For dissections, oysters were shucked using sterile shucking knife (Figure

2-2A). Using sterile scissors and forceps, the gills (located directly underneath the mantle) and

the digestive tract of oysters were dissected. The dissected oyster tissues were rinsed with sterile

PBS three times and weighed in stomacher bag. Equal amounts of PBS were added and the









oyster meats were homogenized. As described above, serial dilutions were made in APW;

homogenates were plated on LA and mCPC, incubated at 37 and 40C for 24 hours, to determine

the survival of total and V vulnificus bacteria (Log CFU/gram of oyster tissue), respectively.

Evaluation of Phase Variation in Oysters

A growth plasmid (pGTR902) was used to determine if appearance of opaque colonies

recovered from oyster infection are a result of phase variation of the translucent to the opaque

phenotype or just a reflection of die-off within the translucent population. E. coli S17-k pir

containing the growth plasmid pGTR902 was provided by Dr. Paul Gulig at the University of

Florida. This plasmid was conjugated into V. vulnificus MO6-24/T1. This plasmid has a

kanamycin resistant gene marker (Starks et al., 2000). Additionally, the plasmid only replicates

in the presence of arabinose. Therefore, absence of arabinose will result in loss of the plasmid in

daughter cells (growing population) and those cells will not grow when subsequently plated on

antibiotic medium (LA with kanamycin and arabinose). On the other hand, in the presence of

arabinose, the growing cells will inherit the plasmid in the daughter cells. Thus, the appearance

of kanamycin opaque colonies on antibiotic medium will be indicative of phase variation within

the originally translucent culture.

The growth plasmid was conjugated to V vulnificus MO6-24/T1, followed by plating the

culture on LA with arabinose (1%), kanamycin and polymyxin B. Briefly, an isolated colony of

MO6-24/T1 was grown in LB at 370C overnight. E. coli with pGTR902 was also grown

overnight in LB with kanamycin (50g/mL) with 1% arabinose. Each culture (1 mL) was

centrifuged for 10 min at 13,000 rpm and resuspended in ImL of LB, to a total of three times.

Final pellets were resuspended in 5mL LB, and the cultures were incubated at 370C with shaking

for 2.5 hours. E. coli with pGTR902 was then incubated statically at 370C for 30 min to re-grow

sex pili. For conjugation, 200[L of E. coli S17 was added to 200[L of MO6-24/T1 and









transferred to a 0.45 [im filter (Millipore filters Bedford, Mass., USA) placed on a 3 mm

Whatman filter paper and dried for one hour. Dried filters were the placed on the LA, filter cell

side up, and incubated overnight at 370C. Following incubation, the filters were transferred to the

LB with kanamycin (300 [g/mL), polymyxin B (50 [g/mL) and arabinose (1%) and incubated

for one hour with shaking at 370C. Cultures (150L) were spread onto antibiotic LA (kanamycin

and polymyxin and arabinose) and incubated overnight at 370C. The original M06-24/T1

inoculum was also plated as a negative control on LA /kanamycin (50 [g/mL), polymyxin B (50

[g/mL), arabinose 1%. Colonies that grew on LA (300 [g/mL), polymyxin B (50 [g/mL),

arabinose 1%, were stored. The presence of plasmid in M06-24/T1 was confirmed by plasmid

extraction kit (Promega, DNA purification, SV Minipreps, Catalog # A1460), for potential M06-

24/T1/pGTR902 strains. The extraction was simultaneously performed on E. coli S17/pGTR902

as a positive control. The extracted plasmid was visualized on 1% agarose gel, and the band

sizes were compared. The isolates having same band size as the E. coli S17/pGTR902 confirmed

the presence of plasmid in M06-24/T 1, and positive colonies were streaked onto LA with

kanamycin (150gg/mL) for storage at -800C.

The transconjugan M06-24/T1 pGTR902 only replicates in the presence of arabinose, and

growth under non-permissive conditions results in loss of plasmid in the newly generated cells.

Consequently, the growing populations under conditions without arabinose were negative for the

plasmid and for antibiotic resistance (LA with kanamycin and arabinose). This property of the

plasmid was used for distinguishing the original inoculum from the growing population, as

kanamycin positive cells indicated the original inoculum. Additionally, the appearance of

kanamycin opaque colonies will indicate phase variation within the originally translucent culture.

Therefore, M06-24/T1 pGTR902 was inoculated in the oyster model of infection, and the









inoculum concentration was determined by plate count on LA. Recovery of bacteria after 24

hours of inoculation was determined by plating the oyster homogenate on LA and on LA with

arabinose (1%) and kanamycin (300g/mL). The plates were incubated at 300C. The colonies

were examined for changes in colony morphology and phase variation. Opaque cells that

retained antibiotic resistance were presumed to be derived from phase variation of surviving

translucent cells. Calculation of death within the original population was determined by the

killing proportion, which was calculated using the following equation:

S. Concentration of pGTR902 containing bacteria recovered from oysters
Killing proportion =
Concentration of pGTR902 containing bacteria in the initial inoculum

Competition Studies

For competition studies, CPS deletion mutant (wzb) and double deletion mutant (pilA/wzb)

of V. vulnificus were used. The purpose of this study was to examine the recovery of V.

vulnificus strains in a mixed culture as a result of enhanced survival. Mixed overnight cultures of

either opaque and CPS deletion mutant (wzb) or opaque and ApilAAwzb double mutant, were

inoculated (106 CFU/mL) in oysters using the oyster model of infection. The relative survival of

each V. vulnificus strain recovered from oysters was determined by examining the colony

morphology. V vulnificus CPS (Awzb) mutant is lockedin the translucent phase and does not

show phase variation to opaque colony morphology (Chatzidaki-Livanis et al., 2006). Therefore,

difference in the colony morphology was used as a marker to distinguish the recovery of

different bacterial strains (opaque versus translucent) in the mixed culture. Experiments with the

pure culture of MO6-24/O (opaque) were also conducted simultaneously as a control to

determine any changes in the recovered colony morphology of opaque cells. The colony

morphology recovered after oyster passage on LA (polymyxin 50) incubated at 300C for 24 hours,

was recorded as a percentage of opaque and translucent colonies of total colonies recovered.









Recovery of wild type encapsulated opaque strain was compared with to recovered translucent

colonies from oysters incubated with the mixed culture of opaque and Awzb mutant. Similarly,

for the oysters incubated with the mixed culture of opaque-ApilAAwzb mutant, the survival of

opaque strain was compared to that of recovered translucent ApilAAwzb double mutant.

Statistical Analysis

Student's t-test was used to evaluate the survival of V. vulnificus in oysters by comparing

the mutants and phase variants of V vulnificus on selective media (mCPC). Bacterial

concentrations were log transformed and average and standard deviation of oysters within one

experiment and within multiple experiments were calculated. All the strains were compared to

the wild type encapsulated opaque strain to calculate the significant differences in the survival of

V. vulnificus strains in the oysters using a Student's t-test two samples assuming unequal

variance, a = 0.05 in Microsoft Excel, 2003.









Table 2-1. Summary of V. vulnificus strains used in this study
Strain Description
M06-24/O Wild-type, encapsulated, virulent, clinical isolate (Chatzidaki-Livanis
et al., 2006)
CMCP6 Wild-type, encapsulated, virulent, clinical isolate (Lee et al., 2004)
M06-24/T1 Reversible phase variant, patchy CPS expression, reduced virulence
(Chatzidaki-Livanis et al., 2006)
M06-24/T2 Deletion mutant with precise deletion of wzb, no CPS surface
(Awzb) expression (Chatzidaki-Livanis et al., 2006)
M06-24/R Reversible phase variant with enhanced biofilm formation and
(Rugose) wrinkled rugosee) colonies (Grau et al., 2005)
M06-24/ApilA Specific deletion mutation inpilA, but with intact CPS operon, marked
(ApilA) by opaque colonies (Paranjpye and Strom, 2005)
M06-24/ApilA/T2 Deletion mutant derived from M06-24/ApilA with precise deletion of
(ApilAAwzb) wzb gene of CPS operon, eliminating CPS surface expression,
marked by translucent colonies (This study)
FLA 677 Virulent strain with deletion in one gene locus (ACDE), reduced
(AflaCDE) motility, showed flagella, wild-type level of skin infection but was
absent in liver (Tucker, 2006)
FLA 711 Double deletion mutant (AflaCDEAflaFBA) replacing all the flagella
(AflaCDEAflaFBA) genes, showed attenuated virulence in both skin and liver of mouse
model (Tucker, 2006)
FLA 674 Deletion of (AmotAB) resulting in no motility but showed flagella,
(AmotAB) produced local infection but no systemic infection (Tucker, 2006)







OYSTER MODEL

Fresh live oysters are acclimated
(72h) in artificial sea water 16ppt
(ASW)
3 days

Tetracycline treatment (2Qg/ml)

*r O.N.

Residual antibiotic is removed
by incubation in fresh ASW with
charcoal filtration

*W O.N.
Oysters are placed in ASW with
106 CFU/ml V.vulnificus


S O.N.


Oyster meats are washed in PBS,
homogenized in stomacher and
plated on non-selective (LA) and
selective (mCPC) agars


O.N.


CFU/g is determined by colony
counts and colony morphology
recorded


Figure 2-1. Summary of oyster model of infection


[a1]


Da '


ayq


Day


fmO




S





























Figure 2-2. Oyster dissection. Oysters are shucked using A) sterile oyster knife, and B) gills and
C) oyster digestive tract tissue removed. (Source: http://www.mdsg.umd.edu/issues/
chesapeake/oysters/education/anatlab/lab i.htm Last accessed 08/22/2007)









CHAPTER 3
DEVELOPMENT OF OYSTER MODEL OF INFECTION

Presence of indigenous V. vulnificus in oysters can complicate the experimental

investigation into the interaction of these bacteria with their molluscan shellfish host. The

problem is particularly severe during summer months when levels of V vulnificus may approach

or exceed 105 bacteria per gram of oysters (Tamplin and Capers, 1992; Kaspar and Tamplin,

1993; Wright et al., 1996; Motes et al., 1998). In order to facilitate the development of an in vivo

oyster model of infection, antibiotic treatment was used to reduce the background V vulnificus

levels in oysters. V vulnificus is particularly sensitive to tetracycline (Bowdre et al., 1983);

therefore, tetracycline (TC) was selected as a pre-treatment prior to the artificial inoculation of

oysters with V vulnificus

Optimization of Tetracycline Treatment

As described in Materials and Methods (Chapter 2), oysters were acclimated in artificial

sea water (ASW) with filtration for several days prior to treatment. Following acclimation, the

oysters were immersed in ASW containing the antibiotic, followed by transfer of oysters to the

fresh ASW with charcoal filtration overnight to remove the residual antibiotic. Three different

concentrations (1 lg/mL, 2ig/mL, and 5 [g/mL) of tetracycline were tested for the removal of

background V vulnificus levels in the oysters. As shown in Figure 3-1, pre-treatment with

tetracycline at 2[g/mL and 5 [g/mL resulted in significant reduction (less than 10 CFU per gram

of oyster meat) of V vulnificus level oysters, compared to oysters without any TC treatment

(p=0.001 and 0.002 respectively). On the other hand, oysters treated with TC concentration of

1 Cg/mL did not show significant difference in reduction in V vulnificus levels when compared to

non-treated oysters.









Recovery of V vulnificus in Post Tetracycline Treated Oysters

Tetracycline-treated oysters were inoculated with V vulnificus (106 CFU/mL) to examine

the bacterial recovery after the tetracycline treatment. Figure 3-2 illustrates that a significantly

higher recovery of V vulnificus was seen in oysters treated with 2[g/mL of TC as compared to

the bacterial recovery seen in oysters that received TC concentration of 5[g/mL (p=0.01). It is

possible that high concentration of 5 g/mL of TC may have inhibited the survival of V.

vulnificus in oysters due to the accumulation of excess TC in oyster tissues. Therefore, pre-

treatment with 2[ig/mL of tetracycline was chosen as the optimum concentration to remove the

background V vulnificus contents in oysters.

Effects of Extended Incubation Post Tetracycline Treated Oysters

Tetracycline (2[g/mL) treated oysters were examined for the effectiveness of antibiotic

treatment to maintain low levels of V. vulnificus for time period of 24, 48 and 72 hours. Figure 3-

3 shows that the levels of V. vulnificus in TC treated oysters without V. vulnificus inocula were

significantly lower after 24, 48 and 72 hours (p=0.001, p=0.01 and p=0.03 respectively), as

compared to the initial V vulnificus contents in oysters. These data suggest that tetracycline was

effective in reducing the V vulnificus levels in oysters, which subsequently facilitated the in vivo

experimental assays.

Bacterial Recovery in Tetracycline and Non-tetracycline Treated Oysters

Antibiotic treatment of oysters reduced the V vulnificus levels in the oysters; however

there is a possibility that concomitant reduction in non-V vulnificus bacterial counts may alter

the results independently from other variables within the experimental oysters. The natural levels

of V. vulnificus in oysters are reduced during winter months as compared to the levels in warmer

months (Tamplin and Capers, 1992; Kaspar and Tamplin, 1993; Wright et al., 1996; Motes et al.,

1998). Therefore, in order to examine the suitability of tetracycline treatment in the oyster model









of infection, the survival of artificially inoculated V vulnificus was compared in TC treated and

non-TC treated winter oysters. As shown in Figure 3-4, no significant differences were seen in

the survival of V. vulnificus strains in TC-treated oysters compared to non-TC -treated oysters.

These results show that treatment with tetracycline reduces the background V. vulnificus levels in

oysters without altering the survival of artificially inoculated bacteria in this in vivo assay.










O Total Bacteria in Oysters (LA)

* V.vulnificus in oysters (mCPC)


4.0


S3.0


2.0


1 2
Concentration of Tetracycline (jg/mL)


&


Figure 3-1. Effect oftetracycline (TC) treatment on survival of V. vulnificus in oysters. V.
vulnificus concentrations were examined with or without different concentrations of
TC. Asterisk denotes significant (p<0.05) differences in V. vulnificus levels in oysters
after TC treatment at different concentrations (2 [g and 5 [g/mL) compared to initial
count of V vulnificus in oysters without TC treatment using Students t-test (p=0.001
and 0.002 respectively). Results are based on the mean of triplicate experiments using
data from six individual oysters in each experiment.










O Total Bacterial counts (LA)

* V.vulnificus counts (mCPC)


Pre-inoculation
(2gig/mL)


Post-inoculation Pre-inoculation
(2Tg/mL) (5cg/mL)
Tetracycline concentration


Post-inoculation
(5gg/mL)


Figure 3-2. Recovery of V. vulnificus from tetracycline (TC) treated oysters. V vulnificus (Log
CFU/g) contents were examined in oysters receiving TC (either 2[g/mL or 5[g/mL)
before and after artificial inoculation of bacteria. Asterisk denotes significantly higher
bacterial recovery (p<0.05) in TC oysters at 2[g/mL (p= 0.01) as compared with the
TC oysters at 5[g/mL using Student's t-test. Data are based on the means of triplicate
experiments using data from six individual oysters in each experiment.


u 3.0


2.0











O Total bacterial counts (LA)

* V.vulnificus counts (mCPC)


Prior TC (2tg/mL) 2-


Ih 48 h
Hours of incubation (h)


Figure 3-3. Effects of extended incubation on Tetracycline (2[ig/mL) treated oysters. Asterisk
denotes significant (p<0.05) difference in V vulnificus counts in TC (2[g/mL) oysters
after 24h, 48 h and 72 hours of extended incubation as compared to initial V.
vulnificus in oysters (p= 0.001, 0.01 and 0.03 respectively) using the Student's t-test.
Data are based on the means of triplicate experiments using data from six individual
oysters in each experiment.


72 h











* V.vulnificus in TC treated oysters (mCPC)

O V.vulnificus in non-TC treated oysters (mCPC)


5.0


t 4.0


3.0


I 2.0


1.0


0.0


CONTROL OPAQUE T1 T2 RUGOSE ApilA ApilAAwzb
Mutants and Phase variants of V. vulnificus

Figure 3-4. Comparison of tetracycline (TC) and non-tetracycline treated oysters. Oysters with
TC (2tg/mL) treatment and non-TC treatment were compared to examine the
appropriateness of tetracycline and recovery of Vvulnificus in winter oysters. Control
represents un-inoculated oysters. No significant (p>0.05) differences were found
between the oysters with TC and without TC using the Student's t-test. Results are
based on the means of triplicate experiments using data from six individual oysters in
each experiment.









CHAPTER 4
ROLE OF CAPSULAR POLYSACCHARIDE IN SURVIVAL OF V. vulnificus IN OYSTERS

Encapsulation has been shown to contribute to resistance of bacteria to ingestion and

degradation by oyster hemocytes (Harris-Young et al., 1995). Therefore, the role of capsular

polysaccharide (CPS) in survival of V. vulnificus in oysters was examined using V. vulnificus

CPS mutant and phase variants (Table 2-1). Tetracycline (TC) treatment of 2[g/mL was used to

reduce the background V. vulnificus in oysters using the oyster model of infection followed by

artificial inoculation (106 CFU/mL) of oysters with CPS mutants and phase variants (Chapter 3).

Figure 4-1 shows that wild type encapsulated V. vulnificus survived in oysters at

significantly higher levels as compared to the CPS (wzb) deletion mutant with no capsule

expression (p= 0.025), after 24 hours of inoculation in oysters (Figure 4-1). However, the

translucent phase variant, which shows reduced capsule expression and can revert back to the

wild type, did not differ significantly from the opaque strain. These results suggest that

expression of CPS may confer an advantage for enhanced survival of V. vulnificus in oysters. A

translucent phase variant of V. vulnificus has been previously shown to have enhanced biofilm

formation (Joseph and Wright, 2004). Therefore, these data suggest that in vitro biofilm

formation may be independent of survival of V. vulnificus in oysters. Unlike group 1 CPS, other

capsular types have been implicated in promoting biofilm in V. cholerae and V. vulnificus (Yildiz

and Schoolnik, 1999; Grau et al., 2005). These strains are identified by the formation of rugose

or wrinkled colonies. Survival of V. vulnificus rugose variant was found in significantly lower

amounts in oysters (p=0.005) when compared to the wild type opaque strain. Survival

comparison of rugose and opaque strains in artificial seawater, showed that rugose had a higher

rate of recovery (p=0.03) than the wild type opaque strain. Based on these results, it can be









suggested that rugose strains are better adapted to survive in artificial seawater as compared to

survival in oysters.

Distribution of CPS Mutant and Phase Variants in Oyster Tissues

Vibrio species attach to plankton found in estuarine and marine environment. Molluscan

shellfish such as oysters filter-feed on the plankton by drawing the water using their gills and the

beating of cilia. Suspended plankton and food particles including bacteria get trapped in the

mucus of gills and are transported to the mouth. From the mouth, plankton including attached

bacteria is transported to the digestive tract and subsequently bacteria are disseminated into the

hemolymph and concentrated in oyster tissues (Kennedy, 1999). Therefore, CPS mutant and

phase variants were examined for the distribution of V. vulnificus in gills, digestive tract and the

hemolymph of oysters. As shown in Figure 4-2, significant differences were not found in the

survival of V vulnificus CPS mutant and phase variants in the digestive tract of oysters.

However, survival of the wild-type encapsulated opaque strain was significantly higher in the

hemolymph of the oyster as compared to that of CPS (wzb) deletion mutant (p=0.03) and the

rugose phase variant (p=0.02). Moreover, distribution of the opaque strain was significantly

higher in gills of the oyster as compared to that of CPS (wzb) deletion mutant and rugose phase

variant (p=0.02, 0.01, respectively). Conversely, the survival of the translucent phase variant

(T1) did not differ from the wild type opaque strain. These results indicate that expression of

CPS did not appear to alter the initial attachment of bacteria to the intestine but is important for

the persistence of V. vulnificus in gills and dissemination to the hemolymph of oysters.

Recovery of V vulnificus CPS Strains in Oysters after Extended Inoculation

V. vulnificus CPS mutant and phase variants were also examined for survival in

colonization in an oyster model after extended inoculation periods from 24 to 72 hours. As

shown in Figure 4-3, the survival of the encapsulated opaque strain was significantly higher as









compared to that of V. vulnificus CPS (wzb) deletion mutant after 24, 48 and 72 hours of

inoculation (p=0.03, p=0.04 and p=0.01, respectively. ). Survival of the rugose strain was also

found to be significantly lower than the survival of the wild type strain at 24 hours (p=0.009) and

48 hours (p=0.02) of inoculation. However, after 72 hours of inoculation, the survival of rugose

and the opaque was not found to be significantly different. On the other hand, the survival of

translucent strain with reduced capsular expression did not differ from the wild type

encapsulated strain at all during the extended periods of inoculation (24, 48 and 72 hours). This

study suggests that expression of capsule is important for the long term survival of V. vulnificus

in oysters.

Phase variation of V vulnificus in Oysters

V. vulnificus exhibits phase variation in the expression of CPS, which is manifested by

changes in the colony morphology of opaque encapsulated strains by switching to translucent

colony morphology that is indicative of reduced CPS expression. Some translucent strains may

also revert to the opaque phenotype. It is hypothesized that survival of V. vulnificus in oysters

may be dependent on its ability to phase shift the expression of cell surface structures in response

to adverse environmental conditions (Chatzidaki-Livanis et al., 2006). In order to validate the

hypothesis, isolates of V. vulnificus strains were recovered from oysters and ASW following

oyster infection. The colony forming units from the recovered isolates were examined for

changes in the colony morphology that would indicate phase variation from the original

phenotype, on solid medium (LA), incubated for 24 hours at 300C.

Results showed that opaque strains maintained stable morphology after oyster passage, and

all the colonies recovered from oysters were opaque on LA plates. However, both translucent

phase variant (T1) and rugose strains, showed changes in colony morphology by switching to the

opaque morphology at high frequency (Table 4-2). Nearly 72% of the original translucent









colonies inoculated in oysters were opaque on LA plates, whereas, the remaining 28% of

colonies maintained the translucent phenotype after oyster passage. Interestingly, 100% of the

initially rugose strain appeared opaque on LA plates, 24 hours post inoculation. Furthermore,

after extended incubation of rugose cells on LA plates for another 24 hours, originally rugose

strains produced atypical opaque colonies; those were either larger (68.9%) or smaller (9.9%)

than the typical wild type opaque phenotype, while 22% of colonies reverted back to the rugose

morphotype. These data suggest that phase variation of CPS expression in V. vulnificus could be

a survival strategy for enhanced survival. Opaque strains are reported to resist the phagocytosis

action of oyster hemocytes; therefore, it is possible that phase variation of translucent and rugose

cells to the opaque phenotype could provide adaptations to these V vulnificus strains for better

endurance.

V. vulnificus isolates were also recovered from the artificial seawater to examine changes

in the colony morphology on LA, 24 hours post inoculation. Data showed that all the V

vulnificus isolates recovered from water samples exhibited their original morphotype, and no

phase variation to opaque colonies was observed in any of the V. vulnificus strains (Table 4-3). In

contrast to translucent and rugose colonies, that showed phase variation to opaque colonies in

oysters, these strains maintained their stable colony morphology in artificial sea water on LA, 24

hours post inoculation in oysters. Rugose cells were also monitored for extended incubation of

LA plates for another 24 hours (a total of 48 hours on LA), and were found to maintain their

wrinkled colony morphology (Table 4-2). These results suggest that V. vulnificus does not

demonstrate phase variation in artificial seawater but exhibits phase variation in oysters.

Confirmation of Phase Variation of Translucent V vulnificus with Growth Plasmid

In order to determine whether or not the appearance of opaque colonies from originally

translucent strains was a result of phase variation or just the result of die-off within the









translucent population, a growth plasmid was transformed into V vulnificus. A growth plasmid

(pGTR902) was introduced into V vulnificus M06-24/T1 by conjugation in order to

experimentally confirm phase variation. The plasmid pGTR902 (Starks et al., 2000) has a

kanamycin resistance gene marker, but the plasmid replicates only in the presence of arabinose.

Therefore, inoculation in media without arabinose, results in the loss of the resistance marker in

newly dividing cells. The loss of the resistance marker in dividing cells will subsequently

prevent the recovery of these cells on LA with arabinose and kanamycin. The dividing cells that

will inherit the plasmid will form colony forming units on antibiotic LA that will be indicative of

recovered M06-24/T1pGTR902 in oysters. Thus, the initial inoculum can be distinguished from

the residual flora or dividing population within the oyster by growth on medium with arabinose

and kanamycin.

Translucent V vulnificus (106 CFU/mL) containing the growth plasmid (M06-24/T1

pGTR902) was inoculated into oysters, and after 24 hours of inoculation, oyster homogenates

were plated simultaneously onto LA and antibiotic LA (kanamycin300 and 1% arabinose). The

plates were incubated for 24 hours at 300C and colony morphology was recorded. Results

showed that approximately 71.2 % of translucent cells containing the growth plasmid

(pGTR902) formed opaque colonies following the oyster passage on antibiotic LA, confirming

that phase variation from translucent to opaque occurred in oysters (Table 4-4). Approximately

28.8% of the colonies forming units were translucent on the LA antibiotic media indicating that

no phase variation occurred in these cells. The total number of bacteria recovered from the

oysters (incubated with M06-24/T1) on LA was slightly higher (5.02 Log CFU/gram of oyster)

than the total resistant bacteria recovered from oysters (4.9 Log CFU/gram of oyster), that could

be due to the presence of the other bacteria or the dividing population of V vulnificus in the









oyster tissue. However, the difference in the total bacterial counts (LA) and the total resistant

bacteria on antibiotic LA was not significant (Table 4-4). Approximately one Log CFU/mL of

the cells were killed as indicated by the killing proportion, which measures the concentration of

bacteria retaining pGTR902 after oyster passage divided by concentration of bacteria with

pGTR902 initially inoculated into culture. Experiments with a pure culture of M06-24/T1

without plasmid were also conducted, serving as a control. The control experiments also showed

similar results of phase variation from translucent to opaque colonies. As shown in Table 4-4,

approximately, 70.4 % of original translucent strain inoculated in the oysters appeared opaque on

LA, 24 hours post inoculation in oysters and remaining 29.6% of the colonies appeared

translucent. These data confirm the phase variation of translucent colonies to the opaque

phenotype in the oysters.









Table 4-1. Phase variation of V. vulnificus in oysters
Changes in the colony morphology after oyster passage (%) b
Inoculated straina
Opaque Translucent Rugose Large Small
Opaque Opaque
MO6- 24/O(Opaque) 100 0 0 0 0
MO6- 24/T1Translucent 72 0.5 28 0.4 0 0 0
MO6- 24/T2 (Awzb) 0 100 0 0 0
MO6- 24/Rugose (24 hours) 100 0 0 0 0
MO6- 24/Rugose (48 hours) 0 0 21 + 0.5 68 + 0.5 11 + 0.9
aStrain inoculated in oysters bChanges in colony morphology following oyster infections was
recorded as a percent (%) of total colonies, 24 hours post inoculation of V. vulnificus strains
in oysters. Rugose cells were monitored for changes in colony morphology for additional 24
hours on LA plates (total of 48 hours on LA plates). Results are based on mean of triplicate
experiments using data from six individual oysters in each experiment.









Table 4-2. Phase variation of V. vulnificus in artificial seawater
Changes in the colony morphology in water sample (%) b
S 1 a


inocuiatea strain Opaque Translucent Rugose Large Small
Opaque Opaque
MO6- 24/0 (Opaque) 100 0 0 0 0
MO6- 24/T1 (Translucent) 0 100 0 0 0
MO6- 24/T2 (Awzb) 0 100 0 0 0
MO6- 24/Rugose (24 hours) 0 0 100 0 0
'MO6- 24/Rugose (48 hours) 0 0 100 0 0
aV. vulnificus strains inoculated in oysters bChanges in colony morphology following oyster
infections in artificial seawater was recorded, 24 hours post incubation of V. vulnificus
strains in oysters. Rugose cells were monitored for changes in colony morphology for
additional 24 hours (a total of 48 hours) on LA plates. Data are based on mean of triplicate
experiments using data from six individual oysters in each experiment.









Table 4-3. Confirmation of phase variation in MO6-24/T1 using pGRT902 in oysters
Strain Bacterial recovery Phase Variation' (%)
inoculated Total Resistant Translucent Opaque Killing Proportion
bacteria bacteria


MO6-24/T1 5.06 0.4 4.89 0.2 28.8 0.4 71.2 0.3 1.2 0.2
pGRT902
MO6-24/T1 5.03 0.3 N.G 29.6 + 0.7 70.4 0.4 N.A.
ab
aStrain inoculated in the oysters bBacteria (Log CFU/g) were recovered on LA (total) or
antibiotic LA (total resistant) from oysters, inoculated with the cultures of V. vulnificus, 24
hours post inoculation. NG= no growth.c Phase variation of V. vulnificus in oysters; bacteria
recovered from oysters was calculated as a fraction of total colony forming units on LA for
(MO6-24/T1) and LA with kanamycin and arabinose for (MO6-24/T1pGRT902). dKilling
proportion (Log CFU/mL) was calculated by concentration of bacteria with pGTR902 initially
inoculated into the oysters dividing the concentration bacteria of retaining pGTR902 in the
oyster. NA= not applicable











O Total Bacteria in oysters (LA)
* V.vulnificus in oysters (mCPC)
O V.vulnificus in water (mCPC)


6.0


5.0


S4.0


0 3.0


2.0


1.0


0.0


CONTROL OPAQUE T1 T2 (Awzb) RUGOSE
V. vulnificus CPS deletion mutant and phase variants


Figure 4-1. Recovery of V. vulnificus CPS mutant and phase variants in oysters. Tetracycline
(TC) treated oysters were inoculated with 106 CFU/mL of V. vulnificus and examined
for bacterial recovery, 24 hours post inoculation, on LA and mCPC. Strains include
M06-24/O, M06-24/T1, M06-24/T2 and M06-24/rugose and TC treated un-
inoculated oysters were used as control. Asterisks are indicative of significant
(p<0.05) differences in the recovery of opaque strain as compared to CPS (wzb)
deletion mutant and rugose variant in oysters (p=0.025, 0.005 respectively) and the
water sample (p= 0.03) using the Student's t-test. Results are based on the means of
triplicate experiments using data from six individual oysters in each experiment.










3.0


* V.vulnificus in Hemolymph(mCPC)
O V.vulnificus in Gills (mCPC)
O V.vulnificus in Digestive tract (mCPC)


2.5


2.0


o Q 1.5


I 1.0
-U


CONTROL OPAQUE T1 T2 (Awzb) RUGOSE
V vulnificus CPS mutant and phase variants


Figure 4-2. Distribution of CPS mutant and phase variants of V. vulnificus in oyster tissues.
Oysters were inoculated with 106 CFU/mL of mutants and phase variants of V.
vulnificus. Gills, intestine and hemolymph of oysters were dissected and examined for
the distribution of V vulnificus after 24 hours post inoculation; by examining growth
on mCPC. Asterisk denotes significant (p<0.05) difference in recovery of wild type
opaque strain with the CPS Awzb mutant and rugose in the hemolymph of the oysters
(p=0.03, p=0.02 respectively) using the Student's t-test. Significant differences were
also seen in the distribution of opaque strain as compared to the CPS Awzb mutant
and rugose in oyster gills (p=0.02 and p=0.01). Data are based on the means of
triplicate experiments using data from six individual oysters in each experiment.










* V.vulnificus in oysters (24h)
O V.vulnificus in oysters (48h)
O V.vulnificus in oysters (72h)


4.0


U 3.0


2.0


CONTROL OPAQUE T1 T2 (Awzb) RUGOSE
V. vulnificus CPS mutant and Phase Variants


Figure 4-3. Recovery of V. vulnificus in oysters after extended inoculation time. Survival of V
vulnificus was examined after 24, 48 and 72 hours of inoculation of V. vulnificus in
oysters, and by examining the growth of strains on mCPC. Asterisk denotes
significant (p<0.05) difference in the recovery of wild type strain with CPS mutants
and phase variants in oysters at extended inoculation times. Recovery of opaque
strain was significantly higher than T2 at 24, 48 and 72 hours of inoculation (p=0.03,
p=0.04, p=0.01 respectively). Recovery of rugose strain was significantly lower than
the opaque strain at 24 and 48 hour of inoculation (p=0.009 and p=0.02) using the
Student's t-test. Results are based on of the means of triplicate experiments using data
from six individual oysters in each experiment.









CHAPTER 5
ROLE OF TYPE IV PILUS IN SURVIVAL OF V vulnificus IN OYSTERS

V. vulnificus type IV pilus (ApilA) has been associated with biofilm formation and

virulence in mammalian models (Paranjpye and Strom, 2005). To analyze the role of pilA and

additive effects ofwzb and pilA in the survival of V. vulnificus in oysters, V vulnificuspilA

deletion mutant and ApilAAwzb double mutant (described in Chapter 2), were examined using

the oyster model of infection. Wild type encapsulated opaque strain survived in significantly

higher levels in oysters as compared to the Vvulnificus ApilA (p=0.01) mutant and ApilAAwzb

double mutant (p=0.002), as shown in Figure 5-1. These data indicate that expression of both

pilA and wzb is important for the survival of V vulnificus in oysters. The lower level of the

double deletion mutant (ApilAAwzb) as compared to the V vulnificus strains with a single

mutation, indicated the additive contribution of PilA and encapsulation in the survival of V

vulnificus in oysters. Both pilA deletion mutant and the ApilAwzb double deletion mutant showed

higher recovery in artificial seawater (ASW) as compared to the wild-type encapsulated strain

(p= 0.04 and p=0.01, respectively).

Distribution of V vulnificuspilA Mutants in Oyster Tissues

Hemolymph, gills and digestive tract of oysters were dissected to examine the distribution

of V. vulnificus ApilA and V vulnificusApilAAwzb mutants in oyster tissues. Figure 5-2 shows

that there were significant differences in the distribution of the wild type encapsulated opaque

strain in the hemolymph of the oyster as compared to that of ApilA and ApilAAwzb mutant strains

(p=0.02 and 0.01, respectively). On the other hand, there was no significant difference in the

distribution of V. vulnificus ApilA and ApilAAwzb mutants in the digestive tract of oyster as

compared to the wild type opaque strain. The levels of wild type were significantly higher in the

gills of the oysters (p=0.04) as compared to the ApilAAwzb strain, however, the ApilA mutant did









not differ from the wild type encapsulated strain. These data suggest that both type IV pilus and

encapsulation help in the dissemination of V. vulnificus to the hemolymph of oysters. Expression

of pili and CPS did not appear to alter the initial attachment of bacteria to the intestine. However,

the lower levels of V. vulnificus ApilAAwzb in gills suggest that encapsulation, but not type IV

pilus is important for the persistence of V. vulnificus in oyster gills, as results were similar to

those observed for CPS (Awzb) mutant alone (Figure4-2).

Recovery of V vulnificus ApilA Mutants in Oysters after Extended Inoculation

Survival of V. vulnificus ApilA and ApilAAwzb double mutant was also examined after

extended inoculation of oysters for up to 72 hours. Figure 5-3 shows that the survival of

encapsulated opaque strain was significantly higher than the V vulnificus ApilA mutant after 24,

48 and 72 hours of inoculation (p=0.02, 0.03 and 0.04 respectively). Significant differences were

also seen in the recovery of V vulnificus ApilAAwzb double mutant (p=0.005, 0.03 and 0.01,

respectively) after 24, 48 and 72 hours of extended inoculation as compared to the wild type

strain (Figure 5-3). These results suggest that expression of both wzb and pilA are important for

the long term survival of V vulnificus in oysters.

Survival of V vulnificus in Oysters as a Result of Bacterial Competition

In the natural environment, bacteria in a mixed community compete for available nutrients,

and more successful species may outgrow the other members of the community for enhanced

survival. The purpose of this study was to examine the relative survival of V. vulnificus strains as

a result of bacterial competition in oysters. Mixed overnight cultures of opaque and CPS deletion

mutant (wzb) or opaque and ApilAAwzb double mutant were inoculated (106 CFU/mL) in oysters

using the oyster model of infection. V vulnificus (wzb) deletion mutant is locked in the

translucent phase and does not show phase variation to opaque morphotype (Chatzidaki-Livanis

et al., 2006). Therefore, difference in colony morphology was used to monitor the recovery of









opaque, Awzb and ApilA Awzb strains from oysters. Oysters were also incubated with the pure

culture of M06-24/O (opaque) simultaneously as a control, to determine recovered colony

morphology of opaque strains after oyster passage. The majority of colonies recovered from

oysters inoculated with mixed culture of either opaque and wzb deletion mutant or opaque and

ApilAAwzb double mutant, were always wild type encapsulated opaque cells (Table 5-1). Results

showed that the survival of opaque was significantly higher than that of CPS (Awzb) mutant

(p=0.002) and ApilAAwzb double mutant (p=0.001). Additionally, significant differences were

also seen in the recovery of translucent strains from oysters incubated with opaque and Awzb

mutant as compared to that of opaque and ApilAAwzb (p= 0.03).

These data support the previous results with individual strains (Figures 4-1, 2 and 3) and

confirm that expression of CPS is important for the survival of V vulnificus in oysters. These

results also suggest the additive contribution ofpilA and wzb in the increased survival of V.

vulnificus strains in oysters. Results also suggest that encapsulation may provide protective

adaptations for increased survival of opaque strains within the mixed bacterial community in

aquatic habitats and within molluscan shellfish host, particularly oysters.









Table 5-1. Survival of V. vulnificus in oysters as a result of bacterial competition
Strains Inoculated a Colony morphology recovered (%) b
Opaque (%) Translucent (%)
Opaque 100 + 0.0 0.0 + 0.0
OpaqueAwzb 71.17 0.48 29.59 0.49
OpaqueApilAAwzb 76.60 + 0.41 23.40 + 0.43
a Strain inoculated in oysters b Colony morphology recovered after oyster
passage at 300C and recorded as a percent (%) of total colonies on LA pol 50,
24hours post inoculation. Standard deviation was calculated using the average
of duplicate experiments using six individual oysters in each experiment.











.u Total Bacterial counts (LA)
U V.vulnificus counts (mCPC)
6.0
6O V.vulnificus in water (mCPC)

5.0

0 4.0


0 34.0 *
*21

S2.0


1.0


0.0
CONTROL OPAQUE ApilA ApilAAwzb
V. vulnificus pil A mutants

Figure 5-1. Bacterial recovery of V. vulnificuspilA mutants in oysters. Tetracycline (TC) treated
oysters were inoculated with V. vulnificus ApilA and ApilAAwzb mutants and
examined for their recovery after 24 hours post inoculation, on LA and mCPC. Un-
inoculated oysters were used as control in this study. Asterisk indicates significant
differences in the survival of opaque strain as compared to ApilA and ApilAAwzb
mutant strains in oysters (p= 0.04 and p=0.01) using Student's t-test. Data are based
on the means of triplicate experiments using data from six individual oysters in each
experiment.










3.0


2.5


' 2.0


o 1.5


S 1.0


CONTROL


* V.vulnificus in Hemolymph(mCPC)
O V.vulnificus in Gills (mCPC)
O V.vulnificus in Digestive tract (mCPC)


*F *
Tffl


OPAQUE ApilA
V vulnificus pili mutants


ApilAAwzb


Figure 5-2. Distribution of V. vulnificus ApilA mutant and ApilAAwzb double mutant in oyster
tissues. Oysters were incubated with V vulnificus ApilA and ApilA/Awzb mutants and
examined for their distribution on mCPC in oyster gills, digestive tract and
hemolymph, 24 h post inoculation. Un-inoculated oysters were used as control in this
study. Asterisk denotes significant (p<0.05) difference in distribution of wild type
opaque strain with ApilA and ApilAAwzb mutants in the hemolymph (p=0.02 and
p=0.01) using the Student t-test. The levels ApilAAwzb were significantly lower in the
oyster gills (p=0.04) as compared to the wild type strain. Results are based on the
means of triplicate experiments using data from six individual oysters in each
experiment.










* V.vulnificus in oysters (24h)
O V.vulnificus in oysters (48h)
O V.vulnificus in oysters (72h)


CONTROL


OPAQUE A pilA
V. vulnificuspilA mutants


Figure 5-3: Recovery of V. vulnificus ApilA and ApilAAwzb double mutant in oysters after
extended inoculation. Survival of V vulnificuspilA mutant strains was examined after
24, 48 and 72 hours of inoculation in oysters, as determined by growth on mCPC at
40C. Asterisk denotes significant (p<0.05) difference in the survival of wild type
opaque as compared to the ApilA mutant (p= 0.02, 0.03 and 0.04) and ApilAAwzb
double mutant (p=0.005, 0.03 and 0.01) after 24, 48 and 72 hours of inoculation using
Student's t-test. Results are based on the means of triplicate experiments using data
from six individual oysters in each experiment.


-3.0



2.0


0.0


ApiAinwzb









CHAPTER 6
ROLE OF FLAGELLA IN SURVIVAL OF V vulnificus IN OYSTERS

V. vulnificus possesses a single flagellum, and motility is important for the

attachment/initial steps of adhesion to surfaces, biofilm formation and virulence (Harshey, 2003;

Lee et al., 2004). However, the role of flagella and flagella-related motility in the survival of V

vulnificus in oysters is less clear. Therefore, mutational analysis was used to examine the

survival of V vulnificus strains that were either defective or lacking flagella or the flagellar

motor in oysters. The V vulnificus flagella mutants (detailed description in Chapter 3) were

constructed by (Tucker, 2006) and provided by Dr. Paul Gulig, University of Florida.

Motility Test of V vulnificus Strains

V. vulnificus flagella mutant strains used in this study were either defective in motility or

were non-motile (Tucker, 2006). The V vulnificus rugose strain is also reported to possess a

polar flagellum, but has relatively reduced motility as compared to the opaque and translucent

strains (Grau et al., 2005). Therefore, to compare the relative motility of V. vulnificus strains, the

motility agar test was performed on the strains as shown in Table 6-1. Results from motility test

were in agreement with (Grau et al., 2005), and showed the reduced motility of rugose strain, as

compared to the encapsulated opaque strain. The motility of rugose was also found to be similar

to that of the flagella mutant strain AflaCDE. The flagella mutant AflaCDEAflaFBA strain,

which lacks flagella showed the least motility as expected due to the deletion of all six flagellar

genes. The flagellated strain, FLA(AmotAB), showed comparatively less motility than the wild

type strain, due to the deletions in genes that encode flagellar propulsion, as described by (Grau

et al., 2005)

Motility-deficient strains were assayed for survival in oysters using the oyster model of

infection. As shown in Figure 6-1, the survival of non-flagellated V vulnificus double mutant









strain flaACDEAflaFBA, was significantly lower in artificially inoculated oysters as compared to

the wild type CMCP6 strain (p=0.03). However, the survival of V. vulnificus deletion mutant A

flaCDE and flagellar motor mutant (AmotAB) strain was not different from the wild type CMCP6

strain. Additionally, no significant differences were found in the levels of above mentioned

flagella mutants in artificial seawater (ASW) as compared to the levels of the wild type strain.

V. vulnificus rugose strain showed similar motility to AflaCDE mutant strain and was also

found in significantly lower levels in oysters (p=0.005), but the levels of rugose were higher in

the ASW as compared to the wild type strain (p=0.03). These results differed from flagellated

mutants with defective motility i.e. no significant difference was found in AflaCDE and

FLA(AmotAB) mutant strain, as compared to the wild type strain, suggesting that motility is not

the only reason for low levels of rugose V vulnificus in oysters. Furthermore, unlike rugose,

these strains did not show increase in numbers in ASW. On the other hand, the loss of both

flagella and motility (AflaCDEAflaFBA) resulted in significant decrease in survival of vulnificus

in oysters, Figure 6-1.

Distribution of V vulnificus Flagella Mutants in Oyster Tissues

It is possible that flagella and flagella-related motility are important for the dissemination

of V. vulnificus to hemolymph and internal organs of oysters. To experimentally examine the

distribution of V. vulnificus in the hemolymph, gills and digestive tract were dissected and

examined for distribution of V vulnificus flagella and motility mutant strains. Results showed

that the wild type encapsulated strain (CMCP6) survived better in the hemolymph of oysters as

compared to all the three V vulnificus flagella mutants. As shown in Figure 6-2, significant

differences were found in the survival of wild type V. vulnificus in the hemolymph of oysters as

compared to that offlaACDE, FLA (AmotAB) and AflaCDEAflaFBA mutant strains (p=0.04,

p=0.04 and p=0.02 respectively).









Significant differences found in the survival of AflaCDE, FLA(AmotAB) and AflaCDEA

flaFBA in the hemolymph of the oyster as compared to the wild type strain suggests that

expression of flagella and flagellar motility are important for the dissemination of V vulnificus to

the hemolymph of oysters. However, the survival of all three flagella mutants, such as AflaCDE,

FLA (AmotAB) and AflaCDEAflaFBA did not differ from the wild type CMCP6 strain in the gills

and digestive tract of the oyster. These results indicate that expression of flagella and flagella

related motility may not contribute to the initial attachment of bacteria to the digestive tract and

the gills of the oyster but may be important in dissemination of bacteria to hemolymph.

On the other hand, V vulnificus rugose, which showed similar motility to AflaCDE mutant

strain, was found to be in significantly lower levels in both the hemolymph and the gills of the

oyster, but the levels of this bacterium did not differ in intestines (Chapter 4). This contrast in the

survival of the rugose strain with the flagella mutant strain (AflaCDE) indicates that reduced

motility is not the sole contributing factor towards the lower levels of rugose in the whole oyster

and oyster tissues. These data support the hypothesis that perhaps the altered expression of the

rugose phenotype and the CPS may be related to the lower level of this bacterium in oysters.









Table 6-1. Relative motility of V. vulnificus strains
Strains Diameter in motility agar
(cm)b
M06-24/O (Opaque) 3.8 + 0.3
CMCP6 3.7 0.2
Rugose 2.5 0.3
FLA677 (AflaCDE) 2.1 0.3
FLA 711 (AflaCDEAflaFBA) 0.7 0.2
FLA 674 (AmotAB) 1.0 + 0.4
SV. vulnificus strains used in this study are described in Chapter 3. V
vulnificus strains were stabbed into the motility agar and the diameter
of rings of growth after overnight incubation in motility agar at 37C
was measured. Results are based on mean of duplicate experiments.













O Total Bacteria in Oysters (LA)
* V.vulnificus in oysters (mCPC)
O V.vulnificus in water (mCPC)


E
h
o
.ri 9
-3
$U
8"


u
m
eg


Control CMCP6 AflaCDE AflaCDEAflaFBA AmotAB

V vulnificus Flagella mutants


Figure 6-1. Recovery of V. vulnificus flagella mutants in oysters. Survival of V vulnificus
flagella mutants in oysters were examined, 24 hours post inoculation, on LA and
mCPC. Un-inoculated oysters were used as control for this study. Asterisk denotes
significant (p<0.05) difference in the recovery of wild type CMCP6 strain in oysters
as compared to the V. vulnificus (AflaCDEAflaFBA) strain using Student's t-test
(p=0.03). Results are based on the means of triplicate experiments using data from six
individual oysters in each experiment.











* V.vulnificus in hemolymph (mCPC)
O V.vulnificus in gills (mCPC)
O V.vulnificus in digestive tract(mCPC)


2.5

E

-S
g 2.0

r

S 1.5
U


I 1.0
pa


0.0 -


Control CMCP6 AflaCDE AflaCDEAflaFBA AmotAB
V vulnificus flagella mutants


Figure 6-2. Distribution of V. vulnificus flagella mutants in oyster tissues. Hemolymph, gills and
the intestine of oysters were examined for the distribution of V. vulnificus in oyster
tissues, 24 hours post inoculation. Asterisk denotes significant (p<0.05) difference in
survival of CMCP6 strain in the hemolymph of the oysters as compared to the V.
vulnificus AflaCDE, AmotAB and AflaCDEAflaFBA mutants using Student's t-test,
(p= 0.04, 0.04 and 0.02 respectively). Results are based on the means of triplicate
experiments using data from six individual oysters in each experiment.









CHAPTER 7
DISCUSSION AND CONCLUSION

Vibrio vulnificus naturally inhabits in warm estuarine environments, possibly existing in

mutual association with molluscan shellfish such as oysters (Tamplin and Capers, 1992; Harris-

Young et al., 1993; Harris-Young et al., 1995). Environmental factors favoring the growth of this

bacterium are low salinity levels (7-21 ppt) and warmer water temperatures (Kelly, 1982; Kaspar

and Tamplin, 1993). Occurrence of V vulnificus has been positively correlated with warm water

temperature (Kelly, 1982; Kelly and Dinuzzo, 1985; Murphy and Oliver, 1992; Wright et al.,

1996; Motes et al., 1998), which is also linked with an increase in V vulnificus related illnesses

(CDC, 1993; Hlady et al., 1993; CDC, 1996; Hlady and Klontz, 1996; FDA, 2003; CDC, 2005b,

a). Vibrios attach to plankton found in the estuarine environment. Filter-feeding shellfish such as

oysters (Crassostrea virginica) feed on plankton including bacteria, and concentrate the bacteria

in their tissues (Blake, 1983; Tamplin and Capers, 1992; Harris-Young et al., 1993; Harris-

Young et al., 1995). Raw oysters contaminated with this bacterium act as a vector of V

vulnificus infections in humans, particularly as a result of consumption of raw oysters harvested

from warm waters in the Gulf of Mexico (Kelly and Dinuzzo, 1985; Hlady et al., 1993; CDC,

1996; FDA, 2003; CDC, 2005b).

This research study examined the possibility that surface structures of V. vulnificus may

provide an adaptation for increased survival of this bacterium in their environmental oyster

reservoir. Bacterial surface structure such as capsular polysaccharide (CPS), pili and flagella can

help anchor the bacterium to nutrient-rich surfaces of the host and may also provide protection

against the host defense mechanisms by avoiding the phagocytosis (Harris-Young et al., 1995).

These functions can lead to an increased endurance of V vulnificus in the oyster host and,









subsequently may facilitate human infection by increasing bacterial contamination of food

intended for human consumption.

Surface structures of V vulnificus also contribute to biofilm formation and increased

survival under hostile environments. Capsular polysaccharide in V vulnificus inhibits in vitro

biofilm formation (Joseph and Wright, 2004), but it appears to be important for the survival of V

vulnificus in oyster hemocytes (Harris-Young et al., 1993; Harris-Young et al., 1995).

Expression ofpilD and pilA are important for the persistence of V. vulnificus in American oysters

(Paranjpye et al., 2007). Other studies have focused on the role of V vulnificus flagella and

flagellar motility in biofilm formation and virulence in mouse model (Kim 2003; Lee et al.,

2004). However, the role of these structures in the survival of V vulnificus in oysters has not

been established. Therefore, this research study was conducted to gain better understanding on

the contribution of these surface structures to the survival of V. vulnificus in oysters.

Presence of indigenous V. vulnificus in oysters can complicate the in vivo investigation,

particularly during summer months when V. vulnificus levels may approach or exceed to 105

bacteria per gram of oyster meat (Kelly, 1982; Oliver et al., 1983; Oliver, 1989; Wright et al.,

1996; Motes et al., 1998). Therefore, to facilitate the in vivo examination of V. vulnificus in their

environmental reservoir of disease, an oyster model of infection that utilizes antibiotic treatment

was developed. V vulnificus is particularly sensitive to tetracycline (TC) (Bowdre et al., 1983);

therefore, oysters were bathed overnight in different concentrations of TC. Subsequently, the TC

treated oysters were transferred to fresh artificial seawater with overnight charcoal filtration to

remove residual antibiotic. Data showed that the reduction of V vulnificus levels in oysters was

accomplished with an increase in concentration of TC. The greatest reduction in V. vulnificus

levels was seen with TC concentration of 5 ig/mL. However, the bacterial recovery post TC









treatment at 5[g/mL was significantly reduced, presumably due to the excess accumulation of

TC in the oyster tissues, leading to inhibition of V vulnificus recovery in oysters. Therefore, TC

concentration of 2[g/mL was used as optimum concentration for V. vulnificus reduction and was

shown to maintain low V vulnificus levels in oysters after 24, 48 and 72 hours of post TC

treatment. These data showed that TC was effective in reducing the V vulnificus levels in oysters

and facilitating in vivo experimental assays.

Environmental conditions, such as water temperature, play an important role in the

proliferation of V vulnificus in molluscan shellfish and their natural surroundings. The levels of

V. vulnificus are lower during winter months as compared to summer months (Oliver et al., 1983;

Kaspar and Tamplin, 1993; Cook, 1994; Wright et al., 1996; Motes et al., 1998). Treatment of

oysters with TC reduced both the total bacterial count and the V vulnificus counts in oysters, but

it is possible that it may have additional consequences that could alter the outcome of

experiments. Therefore, different V. vulnificus strains were evaluated for their survival in oysters

with or without TC treatment, using winter oysters that had a natural reduction of bacteria.

Statistical analysis on the survival of both the total bacteria and V. vulnificus recovered from

oysters using winter oysters revealed no significant differences as a consequence of TC treatment

for any of the V. vulnificus strains that were tested. Additionally, bacterial contents in TC-treated

summer oysters did not differ from bacterial levels found in winter oysters. Therefore, these data

imply that antibiotic treatment of oysters "artificially simulates" the bacterial content similar to

that of winter oysters, providing a model for in vivo mutational analysis of V vulnificus in

oysters.

The role of capsular polysaccharide in survival of V. vulnificus in oysters was verified

using the oyster model of infection. The survival of the encapsulated opaque strain was









consistently higher than the CPS deletion mutant (Awzb) and translucent phase variant (T1) in

oysters at 24 hours post inoculation. Significant differences were noted in the survival of CPS

deletion mutant (T2) as compared to the wild type encapsulated opaque strain. However, the

partially encapsulated CPS translucent phase variant did not differ significantly from the wild

type strain. Thus, the data suggest that degree of encapsulation contributes to the survival of V.

vulnificus in oysters. Alternatively, the instability of translucent phase variants may have caused

the switching of cells to the more resistant opaque phenotype.

Survival of the rugose phenotype was found to be significantly lower in oysters as

compared to the wild type strain. On the other hand, high levels of rugose were recovered from

artificial seawater. These data propose the possibility that the type of CPS may be related to the

lower survival of rugose strain in oysters as well as to the higher survival of rugose strains in

artificial seawater. Differences in the composition of CPS have been reported for V. vulnificus

and rugose V. cholerae that may explain the observed discrepancies in the survival of rugose and

opaque strains in oysters. A higher net negative charge on the cell surface due to polysaccharide

capsule results in a greater degree of resistance to phagocytosis, as reviewed by (Roberts, 1996).

Biochemical analysis of Group 1 CPS revealed that V. vulnificus M06-24 produces highly

charged and acidic CPS (uronic acid), and is composed of four sugar residues three residues of 2-

acetomido-2, 6- dideoxyhexopyranose and one residue of 2-acetomido hexouronate (Reddy et

al., 1992; Hayat et al., 1993). On the other hand, the polysaccharide structure of rugose V.

cholerae EPS is composed of neutral sugars (glucose and galactose) that are more hydrophobic

(Yildiz and Schoolnik, 1999; Ali et al., 2002) in contrast to the hydrophilic V. vulnificus CPS

(Reddy et al., 1992; Hayat et al., 1993; Wright et al., 1999). The EPS of the rugose phase variant

of V. cholera 01 TSI-4 contains N-acetyl-D-glucosamine, D-mannose, 6-deoxy-D-galactose,









and D-galactose and contains equal amounts of 4-linked galactose and 4-linked glucose (Yildiz

and Schoolnik, 1999). It is likely that hydrophobic EPS produced by wrinkled rugose colonies

promote cell aggregation, leading to the attachment of bacteria to one another in the ASW

medium; however, this aggregation may inhibit uptake by oyster or enhanced degradation by

hemocytes. Therefore, the differences in the polysaccharide composition of V. cholerae rugose

may provide clues to increased survival of opaque V. vulnificus in oysters, as well as the

increased numbers of rugose strains in seawater. Unfortunately, the composition of rugose in V.

vulnificus has not been determined, and further investigation will be required to understand the

role of polysaccharide in survival of rugose in oysters.

The survival of CPS mutant and phase variants was also examined for persistence at

extended inoculation up to 24, 48 and 72 hours in whole oysters. In agreement with the results at

24 hours post inoculation, the survival of encapsulated opaque strain was always highest as

compared to other CPS phase variants and mutants of V. vulnificus, and the translucent phase

variant did not differ significantly from the wild type opaque strain at any of the extended

inoculation time. Survival of the opaque strain was always significantly higher than the CPS

(Awzb) deletion mutant at 24, 48 and 72 hours of extended inoculation periods. The rugose phase

variant also differed significantly at 24 and 48 hours of extended inoculation but did not differ

from the opaque, after 72 hours post inoculation. A possible explanation for this lack of

significant difference at this time point could be that the initial concentration of rugose cells in

oysters was so low as compared to the opaque strain that further reduction by oyster defense

mechanism was not possible or the surviving rugose cells were better adapted to survive and

resist further destruction. Alternatively, survival of rugose strain in oysters could be enhanced









after extended inoculation by continued seeding from their relatively high numbers surviving in

the seawater.

Molluscan shellfish such as oysters are filter feeders accumulate indigenous bacteria

attached to plankton or algae and concentrate the bacteria in their tissues (Kumazawa, 1991;

Hood, 1997; Maugeri et al., 2006). To determine the distribution of V vulnificus in oyster

tissues, hemolymph, intestines and gills of oysters were examined. Data consistently showed

increased survival of encapsulated opaque in hemolymph of oysters as compared to V vulnificus

CPS deletion (Awzb) mutant and rugose phase variant. However, there were no differences in the

survival of CPS V. vulnificus strains in the intestinal tract of the oyster. Only rugose and CPS

deletion mutant were found to be deficient in attachment to the oyster gills. These data suggest

that CPS contributes to the attachment of V vulnificus in the gills but not the gut and is required

for the dissemination of the bacterium to the hemolymph of the oyster.

Phase variation has been observed in many bacteria by different surface structures and

involves capsule, pili, fimbriae, and outer membrane proteins that can be recognized by their

effect on colony morphology, as reviewed by (van der Woude and Baumler, 2004). Phase

variation in V vulnificus is exhibited by changes in colony morphology that reflect alteration of

CPS surface expression. V. vulnificus phase variation is marked by reversible changes in colony

morphology such as opaque (encapsulated, virulent) versus translucent (decreased CPS,

attenuated virulence) and smooth versus rugose (wrinkled) phenotype (Wright et al., 1999;

Wright et al., 2001; Grau et al., 2005; Chatzidaki-Livanis et al., 2006; Hilton et al., 2006). In a

recent study, an irreversible deletion mutation in V. vulnificus CPS operon was reported. MO6-

24/Awzb is a result of a deletion mutation of wzb in the group 1 CPS operon, thus locking the cell

in a translucent phase that is unable to revert to opaque morphotype (Chatzidaki-Livanis et al.,









2006). To examine the phase variation in oysters, V vulnificus strains recovered after oyster

passage were monitored for changes in the colony morphology on LA plates. Results

demonstrated that the opaque strain maintained a stable phenotype, while the translucent and

rugose phase variant switched to the opaque morphotype at a high frequency (72 and 100%,

respectively) following oyster infection. Moreover, rugose strains were unstable on LA plates

and after extended incubation of rugose cells on LA for additional 24 hours (total of 48 hours),

atypical opaque colonies were observed or the cells reverted back to the rugose (wrinkled)

morphotype. V vulnificus isolates from the water samples contrasted greatly from those

recovered for oysters. No changes in the colony morphology of V. vulnificus strains were

observed in any of isolate recovered from the ASW. Thus, phase variation was specific to oyster

passage and did not occur in cells that remained in seawater.

In order to experimentally confirm this phase variation, a growth plasmid (pGTR902) was

introduced into V vulnificus translucent strain to track the growing population during oyster

infection. Results showed that approximately 72% cells that were initially translucent contained

the growth plasmid now formed opaque colonies on solid medium when recovered from oysters,

which conformed that phase variation from translucent to opaque phenotype had occurred in

vivo. The growth plasmid was also used to monitor the killing proportion of the translucent cells.

Results showed that only about 1 Log CFU/mL of the translucent inoculum died during oyster

passage, indicating that phase variation rather than die off of translucent cells in the oysters was

primarily responsible for appearance of opaque cells. Overall, these data confirmed the phase

variation of V. vulnificus translucent to opaque phenotype in oysters.

Formation of biofilm and attachment of microbial communities to the nutrient-rich

surfaces serve as a survival mechanism for bacteria in adverse environments, as reviewed by









(Davey and O'Toole G, 2000). Although, expression of group 1 CPS in V. vulnificus inhibits the

in vitro biofilm formation, results from this study showed that it promotes survival of V.

vulnificus in oysters. Thus, it is possible that some facets of in vitro biofilm formation may be

independent of in vivo survival of this bacterium. Unlike group 1 CPS, other capsular types are

associated with the formation of biofilm, which are marked by rugose or wrinkled colonies in V.

cholerae (Watnick et al., 1999; Yildiz and Schoolnik, 1999) and V. vulnificus (Grau et al., 2005).

Comparing the survival of V. vulnificus CPS mutants and phase variants in oysters, it was found

that among all the strains examined, rugose strain showed least survival in the oysters. On the

other hand, rugose was found in significantly higher concentrations in ASW samples. These data

imply that the rugose strains are probably better adapted for increased survival in sea water as

compared to the oysters and that in vivo survival of V. vulnificus in oysters is not dependent in

biofilm formation.

Pili are important for survival of bacteria in biofilm formation and oysters (Paranjpye and

Strom, 2005; Paranjpye et al., 2007) and it is possible that they are likely to contribute towards

dissemination of V. vulnificus to the internal tissues of oysters. Therefore, the role of type IV

pilus in the survival of V. vulnificus in oysters was investigated. V. vulnificus ApilA, deficient in

adherence to epithelial cells, biofilm formation and virulence in animal models (Paranjpye and

Strom, 2005), was used in this study. A double deletion mutant of MO6-24/ApilA with deletions

inpilA and wzb was constructed in this study to evaluate the additive roles ofpilA and

encapsulation (wzb) in survival of V. vulnificus in oysters. Results showed that the survival of

wild-type encapsulated strain was significantly higher than that of V. vulnificus pili mutant

strains. These findings were in agreement with (Paranjpye et al., 2007) that deletion ofpilD and

pilA genes significantly reduced the ability of V. vulnificus to colonize and persist in oysters. The









additive effects of pili and encapsulation in the survival of V. vulnificus in oysters were

evidenced by the lower survival of V vulnificus ApilAAwzb double mutant in oysters as

compared to the single deletion mutants of V. vulnificus. Significantly higher amounts of ApilA

and ApilAAwzb mutants were found in ASW samples as compared to the wild type, similar to

observations regarding rugose strain, which indicated that in vitro biofilm formation was

independent of survival of these bacteria in oysters.

Distribution of V. vulnificusA pilA mutants was also examined in the hemolymph, gills and

intestines of the oyster. Results showed significantly higher levels of the encapsulated wild-type

strain in the hemolymph of oyster as compared to levels of ApilA and ApilAAwzb double mutant.

Compared to the double ApilAAwzb mutant, opaque strain was recovered in significantly higher

levels from the gills; however, the ApilA mutant did not differ from the wild type strain.

Additionally, no significant differences were seen in the distribution of V vulnificus opaque,

ApilA and ApilAAwzb double deletion mutants in the intestinal tract of oyster. Based on these

results, it can be concluded that although the expression ofpilA and capsule may not be

important for the initial attachment in the gut, they contribute towards the dissemination of V

vulnificus to the hemolymph of oyster. Furthermore, this study again confirmed that the

expression of CPS is also important for the distribution of V vulnificus in the gills of the oyster.

In a natural environment, bacteria compete with each other for attachment to nutrient rich

surfaces for enhanced survival. In this regard, in vivo competition studies can indicate the fitness

for survival of different bacteria in host. Experiments were conducted to confirm the enhanced

survival of wild type V. vulnificus as compared to the CPS deletion mutant and the pili double

deletion mutant in oysters. Therefore, oysters were incubated with the mixed cultures of V

vulnificus opaque and CPS mutant (Awzb) or opaque and ApilAAwzb double deletion mutant.









Both of these wzb deletion mutants are locked in the translucent phase, therefore, examination of

colony morphology was used as a marker to distinguish these mutants from wild type

(Chatzidaki-Livanis et al., 2006). Results revealed that majority of strains recovered from the

oysters were always encapsulated opaque strain, and only 25-30% of colonies recovered were

translucent. Results also showed that the recovery of the double deletion mutant was further

reduced as compared to the single deletion mutant, which also confirmed that the additive effects

ofpilA and wzb contributes to the enhanced survival of V. vulnificus in oysters.

V. vulnificus rugose strain is relatively less motile than either opaque or translucent phase

variant, but yet possesses a polar flagellum (Grau et al., 2005). Therefore, it is possible that

reduced motility of the rugose strain resulted in the lower levels of this strain in oysters, as

motility also contributes to biofilm formation and invasion of host tissues (McCarter, 2001;

Harshey, 2003). V. vulnificus possesses six flagellin structural genesflaA, flaB, flaF, flaC, flaD

andflaE organized in two distinct genetic loci, namelyflaFBA andflaCDE (Tucker, 2006). To

examine the role of motility in the uptake and survival of V. vulnificus in oysters, flagella mutant

strains were tested using the oyster model of infection. Results from survival of V. vulnificus

flagella mutants in oysters showed that the survival of the double deletion mutant

(AflaCDEAflaFBA), lacking all flagella genes, was significantly lower than the wild type

CMCP6 strain in the whole oyster preparation. However, the survival of flagella mutant strain

with defective flagella and reduced motility (AflaCDE), or the strain with no flagellar motor

components (AmotAB), did not differ from the wild type in whole oyster preparations. A similar

conclusion was also reported by Lee et al., 2004, as flagellum-deficient and non-motile V.

vulnificus mutant (AflgE gene, encoding the flagellar hook protein), showed decreased virulence

in iron dextran-treated mice, defect in adherence to the cells, and less biofilm formation on a









polystyrene surface. Flagella mutant strains were also analyzed for distribution of V. vulnificus in

the hemolymph, gills and the digestive tract of the oyster. Data showed significantly higher

survival of V vulnificus wild type strain as compared to all flagella mutant strains in the

hemolymph of the oyster. However, the distribution of flagella mutants did not differ from the

wild type strain in gills and the digestive tract of oysters. Overall, these results suggest that

motility or flagella may not be a contributing factor to the initial attachment of V vulnificus in

oyster tissues, but expressions of both is probably important for the survival and dissemination of

V. vulnificus to the hemolymph of oysters.

Comparative analysis on the motility of all the V vulnificus strains examined, revealed that

the motility of rugose was similar to the single gene locus deletion flagella mutant (AflaCDE),

but data for survival of AflaCDE mutant strain in whole oysters differed greatly from the survival

of rugose V. vulnificus in oysters. The rugose phase variant showed lower survival in oysters but

was found to be in greatest number in seawater. On the other hand, the AflaCDE mutant did not

differ from wild type in either seawater or oysters. Moreover, rugose was also found in

significantly lower levels than the wild type in oyster gills, but the survival of the flagellar

(AflaCDE) deletion mutant was not significantly different in the gills as compared to the wild

type. Therefore, it can be concluded that reduced motility of rugose was not the only sole factor

contributing to the outcome of this strain in oysters. Further, it is likely that an alternate

composition of rugose CPS, reported for V cholerae (Yildiz and Schoolnik, 1999), could be

related to the lower survival of rugose in oysters.

However, it is difficult to sort out the contribution of flagella to attachment versus motility

in the mutational analysis employed in this study, as loss of ligand also results in loss of motility.

V. vulnificus express H antigen in the core proteins of the polar flagella, and an anti-flagellar









(anti-H) antibody is produced in rabbits immunized with flagellar core protein prepared from V

vulnificus (Simonson and Siebeling, 1986). Therefore, additional experiments utilizing antibody

to block attachment to oyster would be useful in drawing conclusions about the role of flagella in

attachment versus motility and subsequently interactions within the oyster tissues. Furthermore,

oysters are filter-feeders and use their gills to filter particles out of the water. Through the

beating of cilia on the gills, water currents are generated and the gills transport water and

planktons towards the mouth. Therefore, it is also possible that the action of oyster filtration was

contributing greatly towards the uptake of V vulnificus flagella mutants in oysters, and the

contribution of bacterial motility may be minor compared to the filtering activity of the oyster.

In conclusion, this research study demonstrated the contribution of surface structures in the

survival of V vulnificus in their molluscan shellfish host, Crassostrea virginica. V. vulnificus

attaches to plankton in seawater, and oysters are bivalve mollusks that feed by filtering water and

plankton, ingesting bacteria and concentrating in the tissues (Maugeri et al., 2006). Bacteriolytic,

heat stable lysozyme is present in the hemolymph of oysters (McDade, 1967a), which provides

active defense against bacteria (Rodrick, 1974). However, V vulnificus disseminates in the

hemolymph and concentrates in oyster tissues (Kennedy, 1999), possibly by avoiding the lysis

by lysozyme. Little is known about the biology of V. vulnificus in oyster survival, but studies

have reported that expression of V. vulnificus CPS provides resistance to phagocytosis and

degradation by oyster hemocytes (Harris-Young et al., 1995). It has been shown that a protease

from the oyster parasite Perkinsus marinus may inhibit the phagocytic function of oyster

hemocytes (Tall et al., 1999). More recently, it has been reported that expression ofpilD andpilA

is important for persistence of V. vulnificus in oysters (Paranjpye et al., 2007). The present study









provides evidence that surface structures of V. vulnificus may also have important roles in

survival of this bacterium in the oyster host.

Survival of bacteria in hostile environments has been studied in extensively detail in vitro.

Formation of biofilms requires a cooperative effort by surface structures of bacteria such as

flagella, pili, outer membrane proteins, and EPS. Results from this research study suggest that

surface structures of V. vulnificus that are involved in biofilm formation and virulence contribute

differentially towards the survival of V. vulnificus in oysters. The survival strategy of V.

vulnificus in oysters appears to be multi-factorial. The expression of capsular polysaccharide,

pili, and flagella together with motility, are all important for survival of V. vulnificus in the

environmental reservoirs of the disease. As evidenced by lower survival of V. vulnificus

ApilAwzb double mutant in oysters, it can be concluded that surface structures of V. vulnificus

put together an additive effort to fight the defense mechanism of oysters, leading to increased

endurance in their oyster host. Although CPS expression of V. vulnificus inhibits the biofilm

formation (Joseph and Wright, 2004), results from this study showed that it is important for the

survival of this bacterium in oysters. Therefore, it can be concluded that some facets of in vitro

biofilm formation may be different from in vivo survival of V. vulnificus in oysters. On the other

hand, expression of pili, flagella and flagellar motility, that are important surface structures

contributing to the biofilm formation (Lee et al., 2004; Paranjpye and Strom, 2005; Lee et al.,

2006), also appears to be important for survival of V. vulnificus in oysters.

Studies have reported occurrence of vast genetic variation among the stains of V.

vulnificus. It has also been shown that individual oyster can harbor numerous genetically

divergent V. vulnificus strains (Buchrieser et al., 1995). However, most of the strains isolated

from environmental reservoir appear to be encapsulated and are virulent as clinical strains in









animal models (Tison and Kelly, 1986; Simpson et al., 1987; Tilton and Ryan, 1987; Wright et

al., 1996; DePaola et al., 2003). Evaluation of environmental strains recovered from the

Chesapeake Bay also showed only encapsulated opaque phenotype (Wright et al., 1996). Results

from this study showed that encapsulation contributes to the increased survival of this bacterium

in the mixed V vulnificus culture, supporting the hypothesis that CPS expression determines the

enhanced survival of V. vulnificus in its environmental reservoir.

This is the first study to demonstrate that phase variation of V. vulnificus CPS occurs

within the oyster host. Phase-variable surface structure of V. vulnificus such as capsular

polysaccharide can play a role in the adaptation of bacteria to adverse conditions in the host

(Henderson, 1999; van der Woude and Baumler, 2004; Chatzidaki-Livanis et al., 2006). As

compared to the translucent phase variant, the encapsulated opaque V vulnificus appears to be

better adapted for survival in oysters, due to its ability to avoid host immune responses (Harris-

Young et al., 1995). On the other hand, translucent cells may be better adapted for survival in

aquatic medium through enhanced biofilm formation (Joseph and Wright, 2004). It is possible

that V vulnificus translucent cells attached to plankton, contribute the uptake and concentration

of V. vulnificus in oysters during filter-feeding. Once inside the oyster, translucent cells are likely

to switch back to the opaque phenotype. This phase variation of translucent cells to opaque cells

provides a survival strategy for V vulnificus and a possible explanation as to why the majority of

the strains isolated from raw oysters are always encapsulated and virulent. Therefore, susceptible

individuals who consume raw oysters are more likely to encounter the pathogenic opaque form

of V. vulnificus that can lead to V vulnificus disease.

This research study describes the role of V vulnificus surface structures for increased

survival in their molluscan shellfish host. Understanding the parameters that influence the









survival of V vulnificus in their environmental reservoir is vital. Better understanding of these

parameters can help in developing improved post-harvest processes, which will effectively

reduce the level of V. vulnificus in edible oyster, and therefore, reduce the risks of seafood borne

disease in humans.









LIST OF REFERENCES


Ali, A., Rashid, M.H., and Karaolis, D.K.R. (2002) High-Frequency Rugose Exopolysaccharide
Production by Vibrio cholerae. Appl Environ Microbiol 68: 5773-5778.

Altekruse, S.F., Cohen, M.L., and Swerdlow, D.L. (1997) Emerging Foodborne Diseases.
Emerg Infect Dis. 3.

Amako, K., Okada, K., and Miake, S. (1984) Evidence for the presence of a capsule in Vibrio
vulnificus. J Gen Microbiol. 130: 2741-2743.

Blake, P.A. (1983) Vibrios on the half shell: what the walrus and the carpenter didn't know. Ann
Intern Med. 99: 558-559.

Blake, P.A., Merson, M. H., Weaver, R. E., Hollis, D. G., and Heublein, P. C. (1979) Disease
caused by a marine Vibrio. Clinical characteristics and epidemiology. NEngl JMed 300.

Bowdre, J.H., Hull, J.H., and Cocchetto, D.M. (1983) Antibiotic efficacy against Vibrio
vulnificus in the mouse: superiority oftetracycline. JPharmacolExp Ther 225: 595-598.

Buchrieser, C., Gangar, V.V., Murphree, R.L., Tamplin, M.L., and Kaspar, C.W. (1995) Multiple
Vibrio vulnificus strains in oysters as demonstrated by clamped homogeneous electric field
gel electrophoresis. ApplEnviron Microbiol 61: 1163-1168.

Center for Disease Control, CDC (1993) Vibrio vulnificus infections associated with raw oyster
consumption--Florida, 1981-1992. MMfWR Morb Mortal Wkly Rep 42: 405-407.

Center for Disease Control, CDC (2005) Annual Summaries of Surveillance of Outbreaks of
Vibrio infection, 1997 2004.

CDC. (2005) Vibrio vulnificus. In Technical information. Coordinating Center for Infectious
Diseases / Division of Bacterial and Mycotic Diseases: Centers for Disease Control and
Prevention.

Chatzidaki-Livanis, M., Jones, M.K., and Wright, A.C. (2006) Genetic variation in the Vibrio
vulnificus group 1 capsular polysaccharide operon. JBacteriol. 188: 1987-1998.

Chiavelli, D.A., Jane, W. M., and Ronald, K. T. (2001) The Mannose-Sensitive Hemagglutinin
of Vibrio cholerae Promotes Adherence to Zooplankton. Appl Environ Microbiol. 67:
3220 -3225..

Davey, M.E., and O'Toole, G. A. (2000) Microbial biofilms: from ecology to molecular genetics.
MicrobiolMol Biol Rev 64: 847-867.

DePaola, A., Nordstrom, J.L., Dalsgaard, A., Forslund, A., Oliver, J., Bates, T. et al. (2003)
Analysis of Vibrio vulnificus from market oysters and septicemia cases for virulence
markers. Appl Environ Microbiol 69: 4006-4011.









Drake, S.L., Elhanafi, D., Bang, W., Drake, M.A., Green, D.P., and Jaykus, L.A. (2006)
Validation of a green fluorescent protein-labeled strain of Vibrio vulnificus for use in the
evaluation of postharvest strategies for handling of raw oysters. Appl Environ Microbiol
72:7205-7211.

Drummelsmith, J., and Whitfield, C. (1999) Gene products required for surface expression of the
capsular form of the group 1 K antigen in Escherichia coli (O9a:K30). Mol Microbiol 31:
1321-1332.

Farmer, J.J., (1979) Vibrio ("Beneckea") vulnificus, the bacterium associated with sepsis,
septicaemia, and the sea. Lancet 2: 903.

Food and Drug Administration FDA (1995) Procedures for the safe and sanitary processing and
importing of fish and fishery products. Federal Register 60: 65096- 65186.

Gander, R.M., and LaRocco, M.T. (1989) Detection of piluslike structures on clinical and
environmental isolates of Vibrio vulnificus. J Clin Microbiol. 27: 1015-1021.

Genthner, F.J., Volety, A.K., Oliver, L.M., and Fisher, W.S. (1999) Factors influencing in vitro
killing of bacteria by hemocytes of the Eastern oyster (Crassostrea virginica). Appl
Environ Microbiol 65: 3015-3020.

Grau, B.L., Henk, M.C., and Pettis, G.S. (2005) High-frequency phase variation of Vibrio
vulnificus 1003: isolation and characterization of a rugose phenotypic variant. JBacteriol
187: 2519-2525.

Gulig, P.A., Bourdage, K.L., and Starks, A.M. (2005) Molecular Pathogenesis of Vibrio
vulnificus. JMicrobiol 43 Spec No: 118-131.

Harris-Young, L., Tamplin, M.L., Mason, J.W., Aldrich, H.C., and Jackson, J.K. (1995) Viability
of Vibrio vulnificus in association with hemocytes of the American oyster (Crassostrea
virginica). Appl Environ Microbiol 61: 52-57.

Hayat, U., Reddy, G.P., Bush, C.A., Johnson, J.A., Wright, A.C., and Morris, J.G., Jr. (1993)
Capsular types of Vibrio vulnificus: an analysis of strains from clinical and environmental
sources. Jlnfect Dis 168: 758-762.

Henderson, I.R., Owen, P., and Natraro, J.P. (1999) Molecular switches the ON and OFF of
bacterial phase variation. MolMicrobiol 33: 919-932.

Hlady, W.G., Mullen, R.C., and Hopkin, R.S. (1993) Vibrio vulnificus from raw oysters. Leading
cause of reported deaths from foodborne illness in Florida. JFlaMedAssoc. 80: 536-538.

Hollis, D.G., Weaver, R.E., Baker, C.N., and Thornsberry, C. (1976) Halophilic Vibrio species
isolated from blood cultures. J Clin Microbiol3: 425-431.









Hollis., R. (1987) Vibrio vulnificus. Infect Control 8: 430-433.


Hood, M.A., and Winter, P. A. (1997) Attachment of Vibrio cholerae under various
environmental conditions and to selected substrates. FEMSMicrobiolEco. 22: 215-223.

Jones, M.K. (2006) Regulatin of phase variation and deletion mutation in the Vibrio vulnificus
group 1 CPS operon. In Food Science and Human Nutrition. Gainesville: University of
Florida.

Joseph, L.A., and Wright, A.C. (2004) Expression of Vibrio vulnificus capsular polysaccharide
inhibits biofilm formation. JBacteriol. 186: 889-893.

Kaspar, C.W., and Tamplin, M.L. (1993) Effects of temperature and salinity on the survival of
Vibrio vulnificus in seawater and shellfish. Appl Environ Microbiol 59: 2425-2429.

Kennedy, V.S., Newell, R.I.E., and Eble, A. F. (1999) The Eastern Oysters. Crassostrea
virginica: Maryland Sea Grant College, University of Maryland system, College Park.

Kim YR, L.S., Kim, C.M., Kim, S.Y., Shin, E.K., Shin, D.H., Chung, S.S., Choy, H.E.,
Progulske-Fox A., Hillman, J.D., Handfield, M., and Rhee, J.H. (2003) Characterization
and Pathogenic significance of Vibrio vulnificus antigens preferentially expressed in
septicemic patients. Infect Immun 71: 5461-5471.

Lee, J.H., Rho, J.B., Park, K.J., Kim, C.B., Han, Y.S., Choi, S.H., Lee, K.H., Park, S.J. (2004)
Role of flagellum and motility in pathogenesis of Vibrio vulnificus. Infect Immun 72:
4905-4910.

Lee, J.H., Kim, M.W., Kim, B.S., Kim, S.M., Lee, B.C., Kim, T.S., and Choi, S.H. (2007)
Identification and characterization of the Vibrio vulnificus rtxA essential for cytotoxicity in
vitro and virulence in mice. JMicrobiol 45: 146-152.

Lee, S.E., Kim, S.Y., Jeong, B.C., Kim, Y.R., Bae, S.J., Ahn, O.S. Lee, J.J., Song, H.C., Kim,
J.M., Choy, H.E., Chung, S.S., Kweon, M.N, Rhee, J.H. (2006) A bacterial flagellin, Vibrio
vulnificus FlaB, has a strong mucosal adjuvant activity to induce protective immunity.
Infect Immun 74: 694-702.

Martin, S.J., and Siebeling, R.J. (1991) Identification of Vibrio vulnificus 0 serovars with
antilipopolysaccharide monoclonal antibody. J Clin Microbiol 29: 1684-1688.

Maugeri, T.L., Carbone, M., Fera, M.T., and Gugliandolo, C. (2006) Detection and
differentiation of Vibrio vulnificus in seawater and plankton of a coastal zone of the
Mediterranean Sea. Res Microbiol 157: 194-200.

McCarter, L.L. (1995) Genetic and molecular characterization of the polar flagellum of Vibrio
parahaemolyticus. J. Bacteriol 177: 1595-1609.









McDade, J.E., and Tripp, M.R. (1967a) Lysozyme in the hemoplymph of the oyster, Crassostrea
virginica. JInvertebr Pathol 9: 531-535.

McDougald, D., Lin, W.H., Rice, S.A., and Kjelleberg, S. (2006) The role of quorum sensing
and the effect of environmental conditions on biofilm formation by strains of Vibrio
vulnificus. Biofouling 22: 133-144.

Oliver, J.D. (2005) Wound infections caused by Vibrio vulnificus and other marine bacteria.
EpidemiolInfect 133: 383-391.

Paranjpye, R.N., and Strom, M.S. (2005) A Vibrio vulnificus type IV pilin contributes to biofilm
formation, adherence to epithelial cells, and virulence. Infect Immun 73: 1411-1422.

Paranjpye, R.N., Johnson, A.B., Baxter, A.E., and Strom, M.S. (2007) Role of type IV pilins of
Vibrio vulnificus in persistence in oysters, Crassostrea virginica. Appl Environ Microbiol.

Ran Kim Y., and Rhee, J.H. (2003) Flagellar basal body fig operon as a virulence determinant of
Vibrio vulnificus. Biochem Biophys Res Commun. 304: 405-410.

Roberts, I.S. (1996) The biochemistry and genetics of capsular polysaccharide production in
bacteria. Annu Rev Microbiol. 50: 285-315.

Rodrick, G.E., and Cheng, T.C. (1974) Kinetic properties of Lysozyme from the hemolymph of
Crassostrea virginica. Jlnvertebr Pathol 24: 41-48.

Rodrick, G.E., and Ulrich, S. A. (1984) Micropscopical studies on the hemocytes of bivalves and
their phagocytic interaction with selected bacteria. Helgolander Meeresuntersuchungen
37: 167- 176.

Ross, E.E., Guyer, L., Varnes, J., and Rodrick, G. (1994) Vibrio vulnificus and molluscan
shellfish: The necessity of education for high-risk individuals. JAm DietAssoc 94:
312-314.

Simonson, J., and Siebeling, R.J. (1986) Rapid serological identification of Vibrio vulnificus by
anti-H coagglutination. Appl Environ Microbiol 52: 1299-1304.

Simpson, L.M., White, V.K., Zane, S.F., and Oliver, J.D. (1987) Correlation between virulence
and colony morphology in Vibrio vulnificus. Infect Immun 55: 269-272.

Starks, A.M., Schoeb, T.R., Tamplin, M.L., Parveen, S., Doyle, T.J., Bomeisl, P.E. et al. (2000)
Pathogenesis of infection by clinical and environmental strains of Vibrio vulnificus in
iron-dextran-treated mice. Infect Immun 68: 5785-5793.

Tall, B.D., La Peyre, J.F., Bier, J.W., Miliotis, M.D., Hanes, D.E., Kothary, M.H. et al. (1999)
Perkinsus marinus extracellular protease modulates survival of Vibrio vulnificus in eastern
oyster (Crassostrea virginica) hemocytes. Appl Environ Microbiol 65: 4261-4263.










Tilton, R.C., and Ryan, R.W. (1987) Clinical and ecological characteristics of Vibrio vulnificus
in the northeastern United States. Diagn Microbiol Infect Dis 6: 109-117.

Tison, D.L., and Kelly, M.T. (1986) Virulence of Vibrio vulnificus strains from marine
environments. Appl Environ Microbiol 51: 1004-1006.

Tucker, M.S. (2006) Analysis of flagella, motility and chemotaxis in the pathoegenesis of Vibrio
vulnificus. In Department of molecular biology. Gainesville: University of Florida.

van der Woude, M.W., and Baumler, A.J. (2004) Phase and antigenic variation in bacteria. Clin
Microbiol Rev 17: 581-611.

Venugopal, V., Doke, S.N., and Thomas, P. (1999) Radiation processing to improve the quality
of fishery products. Crit Rev Food Sci Nutr 39: 391-440.

Watnick, P., and Kolter, R. (2000) Biofilm, city of microbes. JBacteriol 182: 2675-2679.

Watnick, P.I., and Kolter, R. (1999) Steps in the development of a Vibrio cholerae El Tor
biofilm. MolMicrobiol 34: 586-595.

Welch, R.A., Forestier, C., Lobo, A., Pellett, S., Thomas, W., and Rowe, G. (1992) The synthesis
and function of the Escherichia coli hemolysins and related RTX exotoxins. FEMS
MicrobiolImmunol 105: 29-36.

Wright, A.C., and Morris, J.G., Jr. (1991) The extracellular cytolysin of Vibrio vulnificus:
inactivation and relationship to virulence in mice. Infect Immun 59: 192-197.

Wright, A.C., Simpson, L.M., Oliver, J.D., and Morris, J.G., Jr. (1990) Phenotypic evaluation of
acapsular transposon mutants of Vibrio vulnificus. Infect Immun 58: 1769-1773.

Wright, A.C., Powell, J.L., Kaper, J.B., and Morris, J.G., Jr. (2001) Identification of a group 1-
like capsular polysaccharide operon for Vibrio vulnificus. Infect Immun 69: 6893-6901.

Wright, A.C., Hill, R.T., Johnson, J.A., Roghman, M.C., Colwell, R.R., and Morris, J.G., Jr.
(1996) Distribution of Vibrio vulnificus in the Chesapeake Bay. Appl Environ Microbiol
62: 717-724.

Wright, A.C., Powell, J.L., Tanner, M.K., Ensor, L.A., Karpas, A.B., Morris, J.G., Jr., and
Sztein, M.B. (1999) Differential expression of Vibrio vulnificus capsular polysaccharide.
Infect Immun 67: 2250-2257.

Yamaichi, Y., lida, T., Park, K.S., Yamamoto, K., and Honda, T. (1999) Physical and genetic
map of the genome of Vibrio parahaemolyticus: presence of two chromosomes in Vibrio
species. MolMicrobiol 31: 1513-1521.









Yildiz, F.H., and Schoolnik, G.K. (1999) Vibrio cholera 01 El Tor: Identification of a gene
cluster required for the rugose colony type, exopolysaccharide production, chlorine
resistance, and biofilm formation. PNAS 96: 4028-4033.

Zuppardo, A.B., and Siebeling, R.J. (1998) An epimerase gene essential for capsule synthesis in
Vibrio vulnificus. Infect Immun 66: 2601-2606.









BIOGRAPHICAL SKETCH

Milan Srivastava was born in the State of Bihar in India. She completed her undergraduate

degree from Allahabad University in 1999, where she was awarded a gold medal for being first

in her graduating class. She continued her studies and obtained a master's degree in food science

and applied nutrition from Allahabad Agricultural Institute (Deemed University) (AAIDU) in

2001. At AAIDU she was selected the vice president of academic affairs and she also

participated in regional level seminar entitled "Diabetes and Diet" as a project leader. She

secured first position in her graduating class of masters degree and was awarded a gold medal.

She then started working as a sales & technical division Officer for Molecular Diagnostics Pvt.

Ltd (MDPL) in Pune, India. At MDPL she supervised a 40-member sales and technical team of

the Pune sub-division. She was responsible for overall training of the executives, developing and

implementing strategies for marketing and technical support.

She started her masters education at University of Florida in food microbiology under the

guidance of Dr. Anita C. Wright in 2006. During her graduate studies at University of Florida

she presented her research work at Florida Marine Biotechnology Summit V, 2006, where she

was awarded the Best Student Research award. She was also awarded the William Angnes

Brown graduate scholarship in 2007 for excellence in academics in food science and human

nutrition department. After completing her graduate studies she plans to work in the field of food

microbiology.





PAGE 1

1 UPTAKE AND SURVIVAL OF Vibrio vulnificus IN OYSTERS By MILAN SRIVASTAVA A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2007

PAGE 2

2 2007 Milan Srivastava

PAGE 3

3 To my family and friends

PAGE 4

4 ACKNOWLEDGMENTS The substantial amount of work done in this study could not have been completed without the help of many people. First, I would like to extend my most profound gratitude to my advisor Dr. Anita C. Wright. I want to thank her for be lieving in me and giving me an opportunity to continue my graduate school. I am thankful for her encouragement throughout my research work and polish my skills that helped me become a res earcher. I would also like to extend my thanks my committee members, Dr. Rodrick E. Gary for his guidance and valuable suggestions. Special thanks to Dr. Max Teplitski for his insi ghtful suggestions on improving on my poster presentation in Marine bi otech conference, and in preparing this document. My research would not have been possible wi thout the help of Ms. Jennette Villeda and Ms. Melissa Evans, my lab mates and above al l my friends. These two people stood by me in tough times with the shoulders to lean on. Ms. V illeda joined our lab dur ing my initial phases of research and provided the helping hand whenever I needed it. Her reliable hands helped me a lot in developing the methodology of this project. Sp ecial thanks to Melissa Evans for being my support pillar. She was always present with the positive attitude and warming hug on every other tough day in the graduate school. I would like to thank for her love and support, for accompanying me to the lab after hours to finish up experiments, reading my thesis again and again, and for listening to me ranting and raving a bout life as graduate student. Special note of thanks goes to Dr. Maria Chatzidaki-Livanis for sharing her technical kno wledge for the benefit of my research work and motivation to do well all the time. I would al so like to thank Dr. Melissa Jones, for all her easy access and sugges tions in the molecular work involved in this research project. All my Lab mates, Mr. Mi ke Hubbard, Mr. Koo-Whang Chang, Ms. Lina Jacques deserve a special note of thanks for always being handy and helpful throughout my research project.

PAGE 5

5 My friends were my pillars for the moral s upport and encouragement; in particular Mr. Chambal and Ms. Sumita Pandey deserves a special no te of thanks. They were filling elements in the dip during my graduate schoo l. I cant even thank enough my family, my parents, my in-laws for their unbending support and loving words, wh ich always helped me through thick and thin. Last but not least, my deepest gratitude and love goes to my hus band, Saurabh Srivastava, for his love and support when the pre ssures of life overwhe lmed me. He gave me the lifetime of encouragement and instilled in me the confiden ce to know that I can accomplish anything I set my mind to. His valuable positive suggestions and role as closet critique made a remarkable difference in the formulation of this document

PAGE 6

6 TABLE OF CONTENTS page ACKNOWLEDGMENTS...............................................................................................................4 LIST OF TABLES................................................................................................................. ..........8 LIST OF FIGURES................................................................................................................ .........9 LIST OF ABBREVIATIONS........................................................................................................10 ABSTRACT....................................................................................................................... ............12 CHAPTER 1 INTRODUCTION..................................................................................................................14 V. vulnificus Distribution and Occurrence..............................................................................15 V. vulnificus Pathogenesis......................................................................................................16 Potential V. vulnificus Secreted Virulence Factors.................................................................17 Lipopolysaccharide and Capsular Polysaccharide..................................................................18 The Genetics of CPS and Phase Variation.............................................................................19 V. vulnificus Flagella..............................................................................................................21 V. vulnificus Type IV Pilus.....................................................................................................23 V. vulnificus Surface Structures and Environmental Survival................................................24 Goals and Objectives........................................................................................................... ...25 2 MATERIAL AND METHODS..............................................................................................29 Bacterial Strains and Culture Conditions...............................................................................29 Generation of a Double Mutant for pilA and wzb ...................................................................32 Oyster Model for V. vulnificus Infection................................................................................33 Bacterial Inoculati on and Determination of Bact erial Content in Oysters.............................35 Dissection of Oyster Tissues..................................................................................................36 Evaluation of Phase Va riation in Oysters...............................................................................37 Competition Studies............................................................................................................ ....39 Statistical Analysis........................................................................................................... .......40 3 DEVELOPMENT OF OYSTER MODEL OF INFECTION.................................................44 Optimization of Tetracycline Treatment................................................................................44 Recovery of V. vulnificus in Post Tetracycline Treated Oysters............................................45 Effects of Extended Incubation Post Tetracycline Treated Oysters.......................................45 Bacterial Recovery in Te tracycline and Non-tetrac ycline Treated Oysters...........................45

PAGE 7

7 4 ROLE OF CAPSULAR POLYSACCHARIDE IN SURVIVAL OF V. vulnificus IN OYSTERS........................................................................................................................ .......51 Distribution of CPS Mutant and Phas e Variants in Oyster Tissues........................................52 Recovery of V. vulnificus CPS Strains in Oysters af ter Extended Inoculation......................52 Phase variation of V. vulnificus in Oysters.............................................................................53 Confirmation of Phase Va riation of Translucent V. vulnificus with Growth Plasmid............54 5 ROLE OF TYPE IV PILUS IN SURVIVAL OF V. vulnificus IN OYSTERS......................63 Distribution of V. vulnificus pilA Mutants in Oyster Tissues.................................................63 Recovery of V. vulnificus pilA Mutants in Oysters after Extended Inoculation..................64 Survival of V. vulnificus in Oysters as a Result of Bacterial Competition.............................64 6 ROLE OF FLAGELLA IN SURVIVAL OF V. vulnificus IN OYSTERS.............................70 Motility Test of V. vulnificus Strains......................................................................................70 Distribution of V. vulnificus Flagella Mutants in Oyster Tissues...........................................71 7 DISCUSSION AND CONCLUSION....................................................................................76 LIST OF REFERENCES............................................................................................................. ..91 BIOGRAPHICAL SKETCH.........................................................................................................97

PAGE 8

8 LIST OF TABLES Table page 2-1 Summary of V. vulnificus strains used in this study..........................................................41 4-1 Phase variation of V. vulnificus in oysters.........................................................................57 4-2 Phase variation of V. vulnificus in artificial seawater........................................................58 4-3 Confirmation of phase variation in MO6-24/T1 using pGRT902 in oysters.....................59 6-1 Relative motility of V. vulnificus strains............................................................................73

PAGE 9

9 LIST OF FIGURES Figure page 1-1 Genetic organization of Group 1 CPS operons..................................................................27 1-2 Differences in the colony morphology of Vibrio vulnificus strains...................................28 2-1 Summary of oyster model of infection..............................................................................42 2-2 Oyster dissection.......................................................................................................... ......43 3-1 Effect of tetracycline (T C) treatment on survival of V. vulnificus in oysters....................47 3-2 Recovery of V. vulnificus from tetracycline (T C) treated oysters.....................................48 3-3 Effects of extended incubation on Te tracycline (2g/mL) treated oysters........................49 3-4 Comparison of tetracycline (TC) and non-tetracycline treated oysters.............................50 4-1 Recovery of V. vulnificus CPS mutant and phase variants in oysters................................60 4-2 Distribution of CPS muta nt and phase variants of V. vulnificus in oyster tissues.............61 4-3 Recovery of V. vulnificus in oysters after exte nded inoculation time................................62 5-1 Bacterial recovery of V. vulnificus pilA mutants in oysters...............................................67 5-2 Distribution of V. vulnificus pilA mutant and pilA wzb double mutant in oyster tissues........................................................................................................................ .........68 5-3 Recovery of V. vulnificus pilA and pilA wzb double mutant in oysters after extended inoculation..........................................................................................................69 6-1 Recovery of V. vulnificus flagella mutants in oysters........................................................74 6-2 Distribution of V. vulnificus flagella mutants in oyster tissues..........................................75

PAGE 10

10 LIST OF ABBREVIATIONS APW Alkaline peptone water ASW Artificial sea water AI Autoinducer CDC Centers for Disease Control and Prevention CPS Capsular polysaccharide CFU Colony forming units oC Degree centigrade EPS Extra-polymeric substance FDA Food and Drug Administration Kan Kanamycin LA Luria-Bretani agar LB Luria-Bretani broth LD50 Lethal dose 50% LPS Lipopolysaccharide mCPC Modified Cellobios e-Polymyxin B-Colistin MSHA Mannose-sensitive hemagglutinin NPW3 Neutral peptone water 3 OMP Outer membrane protein PBS Phosphate buffered saline PCR Polymerase chain reaction PHT Post harvest treatment Pol Polymixin B ppt Parts per thousand rpm Rotations per minute

PAGE 11

11 RTX Repeats in the structural toxin TC Tetracyline TCP Toxin-coregulated pilus TR1 Translucent Genotype 1 (intact CPS operon) TR2 Translucent Genotype 2 (deletion of wzb ) VBNC Viable but non-culturable

PAGE 12

12 Abstract of Thesis Presen ted to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Master of Science UPTAKE AND SURVIVAL OF Vibrio vulnificus IN OYSTERS By Milan Srivastava December 2007 Chair: Anita C. Wright Major: Food Science and Human Nutrition Vibrio vulnificus is a halophilic, gram-negative, opport unistic pathogen that is associated with plankton and shellfish (oysters, clams, a nd mussels). This bacterium exhibits distinct seasonality and is frequently isolat ed at temperatures greater than 20oC and is associated with consumption of contaminated raw oysters. Adaptations in the surface structures of V. vulnificus may influence the environmental reservoirs of disease. Additionally, survival of V. vulnificus may also be dependent on phase variation of th ese cell surface structur es. This research study examined the contributions of known virulence fa ctors, such as capsular polysaccharide (CPS), pili, and flagella to the survival of V. vulnificus in oysters, using mutational analysis in an oyster model of infection. Oysters ( Crassostrea virginica ) were acclimated in artificial seawater (16ppt), and background V. vulnificus was reduced to <10 CFU/gram of oyster meat with tetracycline (2g/mL) treatment, followed by transfe rring to fresh artificial seawater (ASW) with charcoal filtration to remove the residual an tibiotic. Survival in inoculated oysters (106 CFU/mL) was determined by plate count on non-selectiv e (total bacteria count) and selective ( V. vulnificus count) agars. Strains included virulent, encapsu lated wild type strain with opaque colonies; translucent reversible phase va riant (T1) with reduced CPS a nd virulence, rugose (wrinkled colonies) phase variant with enhanced bi ofilm; or mutants with deletion in CPS ( wzb ), and in

PAGE 13

13 the operon for Type IV Pilus ( pilA ) and double deletion mutant ( pilA wzb ), or deletions in either one ( flaCDE ) or both ( flaCDE flaFBA ) flagellar genetic loci and flagellar motor ( motAB ) components. Wild type opaque V. vulnificus was recovered from oysters at significantly higher levels as compared to the rugose variant (p=0.005), or to wzb (p=0.025), pilA (p=0.01), pilA wzb (p=0.002), or CDE/ FBA (p=0.03) deletion mutants. On the other hand rugose, pilA and pilA wzb strains showed greater recove ry in seawater compared to oysters, indicating that in vitro biofilm function may be inde pendent of survival of V. vulnificus in oysters. Translucent phase variants (T1) did not differ from the wild type, and both T1 and rugose phase variants reverted to opaque mo rphotype at high frequency (72 and 100%, respectively) in oysters, while maintaining their stable morphology in the seawater. Competition studies confirmed that encapsulation contributes to the survival of V. vulnificus in oysters. Distribution of strains differed somewhat in oys ter gills and intestinal tract, but significant reductions in recovery from the hemoly mph were observed for rugose variant, wzb pilA, pilA wzb mutants and for all the flagella mutants as compared to the wild type. Thus, surface structures such as CPS, pili and flagella, and motility of V. vulnificus contribute not only to survival in whole oysters but also to dissemi nation of the bacterium, especially to the hemolymph of the oyster. Furthermore, observatio ns of phase variation within the oyster host indicate that variable expression of CPS is a survival strategy of V. vulnificus in oysters. The research study described herein may ulti mately lead to an understanding of the contribution of surface structures of V. vulnificus in their molluscan shellfish host and thereby aid in designing post harvest treatment methods to bring about more effici ent reduction of this potential pathogen to safe levels in seafood for human consumption.

PAGE 14

14 CHAPTER 1 INTRODUCTION Vibrio vulnificus is the most common cause of seafood associated deaths in Florida (Hlady et al., 1993; Hlady and Klontz, 1996). V. vulnificus is a Gram-negative, flagellated, curved bacterium that was first identified and desc ribed by the Centers for Disease Control and Prevention (CDC) in 1976 (Hollis., 1987). V. vulnificus belongs to the family of Vibrionaceae and is a mesophilic and obligate hal ophilic bacterium. Formerly referred as the lactose-positive Vibrio (Farmer, 1979), the ability of V. vulnificus to ferment lactose distinguishes this bacterium from other member of Vibrio genus V. vulnificus exists naturally in sediments, coastal waters and resides in high numbers in filter-feeding shel lfish (oysters, clams and mussels) (Tamplin and Capers, 1992; DePaola et al., 1994 ; Wright et al., 1996; Motes et al., 1998). Oysters harvested during warm months, when the water temperature is greater than 22 oC from the Gulf of Mexico, have high concentrations of V. vulnificus that may reach or exceed 105 bacteria per gram of oyster meats (Murphy and Oliver, 1992; Kaspar and Tamplin, 1993; Levine, 1993; Wright et al., 1996; Kelley et al., 1997). Approxi mately 80% of all reported V. vulnificus infections occur when the level of this bacterium in the envir onmental reservoir and marine environment are high, typically between the months of May and Octobe r (Hlady et al., 1993; Kelley et al., 1997; Motes et al., 1998). V. vulnificus infections are usually associ ated with the consumption of contaminated molluscan shellfish. V. vulnificus infections in humans include primar y septicemia and wound infections. Ingestion of V. vulnificus contaminated oysters is the most common mode of exposure that can result in primary septicemia in immuno defici ent individuals (FDA, 1992; as reviewed by Gulig et al., 2005; Ross et al., 1994; CD C, 1996; Hlady and Klontz, 1996) Wound infection can occur as a result of exposure of open and/or breached sk in surface to the sea wa ter or to the handling

PAGE 15

15 and cleaning of shellfish (Howar d and Lieb, 1988; Shapiro et al., 1998; as reviewed by Oliver, 2005). While the fatality rate from wound infections is low (15%), primary septicemia has a high (> 50%) mortality rate (Hollis et al., 1976). V. vulnificus is also recognized as an emerging pathogen (Altekruse, 1997), due to an increase in annual harvesting of oysters during summer months (oyster harves ting increased from 8% in 1970 to 30% in 1994) or possibly due to increase in water temperatures as a result of global warming. According to the CDCs report on Vibrio illnesses from 1997-2004, V. vulnificus was the most frequently isolated Vibrio species from the Gulf Coast states. Based on the report, V. vulnificus was isolated from 121 patients, out of which 90% were hospitalized while 26% of total reported cases resulted in death (CDC 2005). Due to the severity of V. vulnificus infections (Hlady et al., 1993; CDC, 1996; Hlady and Kl ontz, 1996), the United States Food and Drug Administration (FDA) has mandated post harvest treatment (PHT) of oysters (FDA, 1995), such as ice immersion, low temperatur e pasteurization, individual qui ck freezing and high hydrostatic pressure. The use of irradiation exposure with no apparent reduction in sensory qualities has also been suggested for enhancement of microbial quality of seafood (Venugopa l et al., 1999). These methods have been proposed to reduce V. vulnificus levels in seafood to non-detectable levels, thus reducing the risk of infection associat ed with raw oyster consumption (Andrews, 2000; Quevedo et al., 2005). More recently, use of a green fluorescent protein-labeled strain of V. vulnificus was suggested for studying the behavior of V. vulnificus during post harvest handling of molluscan shellfish with re spect to growth characteristics, heat tolerance, freeze-thaw tolerance, acid tolerance, cold storage tolera nce and cold adaptation (Drake et al., 2006). V. vulnificus Distribution and Occurrence Studies have reported that the main cause of V. vulnificus disease is the consumption of contaminated raw oysters (CDC, 1993) harvested from Gulf coast estuar ies (Shapiro et al.,

PAGE 16

16 1998). Temperature is a key f actor in the isolation of V. vulnificus. The V. vulnificus numbers in Gulf coast estuaries can range from 103 to 105 bacteria per gram of oyster meat during warmer months (Kelly, 1982; Tamplin et al., 1982; Tamplin and Capers, 1992). Although V. vulnificus can be isolated at water temperature of 15oC (Tamplin et al., 1982; Kaspar and Tamplin, 1993), the appearance of this bacterium in s eawater, shellfish a nd the incidence of V. vulnificus infection increases with water temperature durin g warmer months, when the water temperature reaches 30 37oC. V. vulnificus survives poorly below 8.5oC (Kaspar and Tamplin, 1993) and fails to multiply in oysters at water temperature of 13oC and lower (Murphy and Oliver, 1992; Cook, 1994). Low to moderate salinities are also associated with the presence of V. vulnificus which is a salt-requiring bacterium with sali nity preferences rangi ng from 7-16 parts per thousand (ppt) in Gulf coast sites. High salinity levels, (more than 25ppt) are not favorable and can have a negative effect on the survival of V. vulnificus (Kaspar and Tamplin, 1993; Motes et al., 1998). The association of V. vulnificus with oyster hemocytes is also dependent on the temperature (Rodrick, 1984). Numbers of V. vulnificus associated with hemocytes decrease at lower temperatures such as 4o and 15oC and increase at 37oC and 44oC (Rodrick, 1984). V. vulnificus Pathogenesis V. vulnificus is one of the most invasive and opportunistic human pathogen among the Vibrio species, that is often associated with primar y septicemia. Primary septicemia is defined as a systemic illness caused by V. vulnificus which is associated w ith ingestion of raw and undercooked shellfish. Wound infection is another common manifestation of V. vulnificus infection in humans. V. vulnificus can easily infect pre-existing wounds due to exposure of the wound to seawater or marine organisms har boring the bacterium (Blake, 1979, Blake et al., 1983). Gastroenteritis is another, less frequently occurring symptom of V. vulnificus disease. The commonly reported symptoms of systemic infection by V. vulnificus include fever, nausea, and

PAGE 17

17 hypotension (Blake et al., 1979; Klontz et al., 1988). Development of secondary bullous lesions on legs and feet is another feature of primary septicemia and they are characterized by fluidfilled blisters, typically resulti ng in tissue and muscle destructi on (Tacket et al., 1984; Klontz et al., 1988). The severity of V. vulnificus infections and the infectious dose require d for appearance of this disease are dependent upon a number of host factors. People who are most susceptible to V. vulnificus infection usually have underlying health conditions such as alcoholism, liver disease (hepatitis, cirrhosis), diabetes mellitus, cance r, hemochromatosis (iron-overload) and immune system dysfunction (Hlady et al., 1993; CDC, 20 05; as reviewed by Gulig et al., 2005). The infectious dose of V. vulnificus that causes disease in humans is not known. However, people with a recent history of gastro-intestinal illne ss and infection of skin and open wounds have a higher risk of getting V. vulnificus infections (Klontz et al., 1988; Hlady and Klontz, 1996). Thus, host immune status is impor tant for the pathogenesis of V. vulnificus (as reviewed by Gulig et al., 2005). Potential V. vulnificus Secreted Virulence Factors V. vulnificus exhibits multiple virulen ce factors that may be involved in or required for the manifestation of this disease in humans. Iron is important for bacterial gr owth, and bacteria have mechanisms to scavenge iron from the hos t through the produc tion of siderophores. V. vulnificus produces hydroxymate and phenolate (catechol) side rophores for the acquisition of iron from mammalian host to cause fulminating septicemia a nd invasive wound infection in animal models (Wright et al., 1981; Simpson and Oliver, 1983; Litwin et al., 1996). Both clinical and environmental strains of V. vulnificus expresses secreted factors such as cytolysin/hemolysin ( vvhA gene) and metalloprotease ( vvpE ), which were initially thought to contribute to pathogenicity in mammalian models. However, muta tions in either of the two genes indicated no

PAGE 18

18 apparent role of these proteins in the virule nce of this bacterium (Wright and Morris, 1991). Quorum sensing has also been related to the re gulation of gene expression and virulence of V. vulnificus (Kim et al., 2003). It has been reported that autoin ducer-2 (AI-2) communication molecules play an important role in the stress re sponse in starvation and st ationary growth phase of V. vulnificus (McDougald et al., 2006) and may be important for the virulence of V. vulnificus Exotoxin (s) belonging to the family of pore-form ing proteins, named as RTX toxins (repeats in the structural toxin), may also play an impor tant role in virulence in many gram-negative bacterial pathogens. The RTX toxin oper on consists of four genes namely rtxA, rtxB, rtxC and rtxD. RTX toxin is encoded by rtxA. The transportation and deliver y of RTX toxin outside the bacterial cell is facilitated by rtxB and rtxD (Welch, 1992). It has been shown that RtxA toxin cause pore formation in red blood cells, and necrotic cell death in Hep-2 ce lls (Lee et al. 2007). A rtxA mutant in V. vulnificus exhibited a 100-fold increase in lethal dose 50% (LD50) in mouse model suggesting that RTX toxin plays a critical role in virulence of V. vulnificus (Lee et al., 2007). Lipopolysaccharide and Capsular Polysaccharide The expression of lipopolysaccharide (LPS) on the cell surface was also thought to contribute to the virule nce and toxic shock of V. vulnificus (Martin and Siebeling, 1991). However, LPS from V. vulnificus was less pyrogenic than the L PS from other Gramnegative pathogens (McPherson et al., 1991; Powell et al., 1997).On the other hand, studies have suggested a positive relationship be tween the degree of capsular polysaccharide (CPS) expressed and virulence in animal models (Yoshida et al., 1985; Simpson et al., 1987; Wright et al., 1990; Wright et al., 1999; Wright et al., 2001; Chatzidaki-Liv anis et al., 2006). V. vulnificus expresses an extracellular acidic caps ular polysaccharide on its cell surface. There is a relation between the capsular expressi on, the colony opacity and the virulence of V.

PAGE 19

19 vulnificus (Amako, 1984). Colonies that exhibit capsule have an opaque phenotype, but these cells can also undergo a reversible switch to a tr anslucent phenotype, characterized by reduced or patchy expression of capsule (Simpson et al., 1987; Wright et al., 1990). Presence of capsule is correlated with virulence in animal models, antiphagocytic activity, ti ssue invasiveness and resistance to the bactericidal activity of normal human serum. On the other hand, loss of capsule is accompanied by decrease in virulence, hydroph ilicity and serum susceptibility (Wright et al., 1990). Additionally, unencapsulated st rains have significantly higher LD50 than the wild type encapsulated strain (Wright et al., 1990). Hete rogeneous capsular types have been found among the various clinical and e nvironmental isolates of V. vulnificus (Hayat et al., 1993). Thus, different V. vulnificus strains have differences in their CPS composition, and are likely to use different metabolic pathways for biosynthesis of CPS (Reddy et al., 1992; Hayat et al., 1993). However, most strains isolated from human inf ections or oysters appear to be encapsulated (Simpson et al., 1987; Stelma et al., 1992; Wright et al., 1996). Expression of CPS can also vary depending on the growth phase and other envi ronmental conditions, especially temperature (Wright et al., 1999; Wright et al., 2001). It has been reported that su rface expression of CPS increases during logarithmic growth phase and decreases during stati onary phase in the wild type strain. Additionally, greater CPS is expressed during growth at 30oC as compared to 37oC (Wright et al., 1999). The Genetics of CPS and Phase Variation Both CPS expression and virulence are associated with opaque colony morphology. However, opaque colonies can spontaneously reve rt to the translucent phenotype, reduced or patchy expression of surface polysaccharide (Fig ure 1-2), by a process called phase variation. The V. vulnificus opaque strain exhibits a reversible-phase variation to a translucent morphotype that occurs within a pop ulation at a rate of 10-3 to 10-4 (Wright et al., 1990; Wright et al., 1999;

PAGE 20

20 Wright et al., 2001). The avirulent, unencapsula ted translucent, spontan eous phase variant of V. vulnificus can also revert back to the original opaque, encapsulated phenotype (Wright et al., 1999). Epimerase genes encoding the CPS biosynthe tic gene (Zuppardo and Siebeling, 1998) and wza, encoding a CPS outer membrane transporter (W right et al., 2001) have been reported. More recently, the latter gene was found to re side within the group 1 CPS operon of V. vulnificus strains, and the entire operon was sequenced fo r opaque and translucent strains (Figure 1-1). V. vulnificus CPS genes show homology in the organizat ion and sequence of previously described group 1 CPS operons in E. coli (Wright et al., 1999; Chat zidaki-Livanis et al., 2006). E. coli group 1 capsule is defined by the presence of wza wzb wzc genes in the CPS operon, and a similar gene cluster was found in V. vulnificus (Chatzidaki-Livanis et al., 2006) (Figure 1-1). Wza is an outer membrane lipoprotein that is involved in surface assembly of group 1 capsules and transportation of polysaccharide to the ou ter surface (Drummelsmith and Whitfield, 1999). Wzb is a cytoplasmic acid phosphatase that functi ons to catalyze the removal of phosphates from Wzc. Wzc is tyrosine kinase, located in th e plasma membrane, is involved in the surface assembly of the capsular layer (Drummelsmith and Whitfield, 1999). Multiple genotypes (T1, T2 and T3) from the translucent isolates of V. vulnificus were identified (Chatzidaki-Livanis et al., 2006). T1 (MO6-24/T1) strain with reduced C PS expression showed a CPS operon that was identical to that of the opaque strain. MO6-24/T2 ( wzb ) cells showed a deletion mutation in the wzb resulting in acapsular colonies locked in the translucent phase, which were unable to revert to opaque colony morphology (Chatzidaki-Livani s et al., 2006). T3 (MO6-24/T3) strains had more extensive genetic deleti ons that also included the wzb Complementation of the CPS deletion mutant with wzb restored the opaque phenotype, and electron microscopy confirmed

PAGE 21

21 that the strain recovered the surface expression of CPS (Chatzid aki-Livanis et al., 2006). Thus, different mechanisms were proposed to be resp onsible for reversible phase variation in CPS expression versus irreversib le genetic deletions in V. vulnificus (Chatzidaki-Livanis et al., 2006). However, the precise role of phase variation in Vibrio species is less clear, and the genetic mechanism (s) responsible for pha se variation is still unknown. V. vulnificus also produces a rugose or wrinkled colony type from both opaque and translucent strains at high frequencies, that can switch back to opaque or translucent colony morphology (Figure 1-2C) (Grau et al., 2005). Rugose colonies show enhanced biofilm formation and survival under adverse envir onmental conditions (Grau et al., 2005). In V. cholerae these rugose variants express alternate CPS composition with neutral (glucose and galactose) sugars (Yildiz a nd Schoolnik, 1999) as opposed to the acidic sugar (uronic acid) expressed by Group 1 CPS. However, the composition of rugose CPS in V. vulnificus is unknown. Upon further characterization of rugose strains, it was found that the V. vulnificus rugose strain is relatively less motile and more re sistant to serum killing than the parental opaque or translucent version. Despite their decreased mo tility, the rugose strain was reported to possess a polar flagellum. V. vulnificus Flagella Flagella help in the initial absorption of bacteria to surfaces, biofilm substrates, and invasion of host (McCarter, 2001; Harshey, 2003). Flagellum based motility is required for the localization of V. vulnificus to sites of infection or for invasi on in the host cell (Lee et al., 2004). McCarter studied the genetic and molecular characterization of the polar flagellum of Vibrio parahaemolyticus (McCarter, 1995) It was reported that multiple (six) flagellin genes encode the filament subunits of the flagellum, namely flaA flaB flaC flaD flaE and flaF organized in two genetic loci, flaFBA and flaCDE (McCarter, 1995). Further analysis revealed that none of the six

PAGE 22

22 flagellin genes were essential for filament form ation, and loss of a single flagellin gene has no significant effect on the motility or the flagella st ructure (McCarter, 1995). However, deletion of the flaCDE genetic locus showed reduced motility, but deletion of both loci ( flaFBA flaCDE ) completely abolished the motility and the flagella expression (McCarter, 1995; Tucker, 2006). More recently, (Tucker, 2006) examined the roles of flagella, motility, and chemotaxis in the virulence of V. vulnificus using a mouse model of disease. It was found that a mutant with a deletion in the flaFBA locus was equally motile and virulent for either localized skin or systemic liver infection as compared to that of wild-type. On the other hand, deletions in the flaCDE locus resulted in strain with reduced motili ty and virulence (both localized and systemic) as compared to the wild-type. Furt hermore, deletion of flagella motor genes ( motAB ) resulted in a non-motile strain that showed a ttenuated skin infection in the mouse model. Complementation of this mutant with cloned motAB fully restored the motility to levels of the wild-type. The flaFBA flaCDE double deletion mutant was also non-motile and showed attenuated virulence for systemic infection in a mouse model. Other studies have focused on the role of flagellar basa l body rod proteins ( flgC ) as a potential virulence determinant of V. vulnificus (Ran Kim, 2003). A trans poson insertion mutation in the flgC gene showed decreased motility, biofilm formation, cytotoxic ity to the He-Le cells and virulence in mice models. Furthermore, flagella related motility mutant ( flgE ) was also less viru lent and deficient in the biofilm formation to INT-407 cells (L ee et al., 2006). Recently, expression of methylaccepting chemotaxis protein was found to be during V. vulnificus infection, and it was theorized that MCP might play an impor tant role in invasion of V. vulnificus during gastrointestinal infection (Kim et al., 2003). Furthermore, it was re ported that defects in chemotaxis can alter the ability of V. vulnificus to cause disease in anim al models (Tucker, 2006).

PAGE 23

23 V. vulnificus Type IV Pilus Expression of pili on V. vulnificus cells was identified by el ectron microscopy, and more pilus fibers were seen on clin ical isolates from blood or wounds than environmental isolates (Gander and LaRocco, 1989). Presence of pilus-like structures on V. vulnificus can facilitate adherence, attachment and colonization to the HE p-2 cells of host surface receptor (Paranjpye et al., 1998). Type IV pili are common to many gram-n egative bacteria that allows for flagellumindependent movement, termed as twitching motility. Genes encoding proteins required for the biogenesis of type IV pili in V. vulnificus have been reported (Paranj pye and Strom, 2005). It has been shown that mutations in a gene encoding IV prepilin peptidase/N-methyltransferase, vvpD or pilD, results in a loss of all pili expression on the cell surface of V. vulnificus which significantly decreases cell cytotoxicity in Ch inese Hamster Ovary (CHO) cells, adherence to HEp-2 cells and reduces virulence in m ouse model (Paranjpye and Strom, 2005). The amino acid sequence of V. vulnificus type IV pilin (PilA) shares extensive homology to group A type IV pilin expre ssed by many pathogens, including V cholerae (PilA) and P. aeruginosa (PilA). The V. vulnificus pilA is part of an operon that also includes three other pilus biogenesis genes ( pilBCD ), that encodes for pilin precursor protein in the type IV pilus biogenesis gene cluste r. A deletion in the V. vulnificus pilA resulted in reduced biofilm formation, decreased adherence to HEp-2 cells, a nd attenuated virulence in iron dextran-treated mouse models (Paranjpye and Strom, 2005). Howeve r, pili were still pr esent on the surface of the pilA mutant strain as shown by transmissi on electron microscope, suggesting that V. vulnificus produces other type (s) of pili. The genome of V. vulnificus also encodes a second type IV pilin, mannose-sensitive hemagglutin in (MSHA) that is homologous to V. cholerae MSHA, but carries only a single prepilin peptidase gene (Yamaichi et al., 1999). Therefore, the loss of all surface pili on the pilD mutant suggests that pilD processes both type IV pilins of V. vulnificus

PAGE 24

24 (Paranjpye et al., 1998). Recen tly, it has been reported the pilA and pilD of V. vulnificus in the colonization of bacterium in oysters by compari ng the uptake and persiste nce of the wild type V. vulnificus to that of the pilA and pilD mutant strains (Paranjpye et al., 2007). The authors reported that expression of pilA and pilD are important for V. vulnificus to persist in American oysters, Crassostrea virginica V. vulnificus Surface Structures and Environmental Survival Biofilm formation is an essential mode of bact erial survival in the natural environment, as reviewed by (Watnick and Kolter, 1999). Biofilms are complex interactions of surface structures of bacteria, constituting a protec ted community that allows bacteria to attach to surfaces, providing an adaptive advantage for enhanced su rvival under adverse conditions (Watnick and Kolter, 2000). Surface structures of bacteria such as flagella, fimbriae, pili, and extra polymeric substances that are major determinants of viru lence, helps in biofilm formation. For example, V. cholerae motility genes, motA and motB are required for flagellar rotation and initiating cell-tosurface contact in biofilm formation. The mannose -sensitive hemagglutinin (MSHA) pilus helps the bacterium pull onto the abiotic surf ace, leading to the attachment of V. cholerae EI Tor (Watnick and Kolter, 1999). Alternatively, V. cholerae EI Tor does not use virulence associated toxin coregulated pilus (TCP) to form biofilms. Extra polymeric substances are necessary to stabilize cell-to-cell interactions and formati on of 3-dimension biofilms (Watnick and Kolter, 1999). Polysaccharides are not always critical to initial attachment, but are considered major constitutes of the complex architecture of the la ter stages of biofilm fo rmation. Expression of capsular polysaccharide is also im portant for virulence in animal models (Yoshida et al., 1985; Wright et al., 1999; Wright et al., 2001) but it inhibits biofilm formation in V. vulnificus (Joseph and Wright, 2004). On the other hand, motility of V. vulnificus is reported to be both a potential virulence factor and an important determinant fo r initial cell-to-surface contact and colonization

PAGE 25

25 in the host. In this regard, surface expression of pili (type IV pilus) (Paranjpye et al., 1998; Paranjpye and Strom, 2005; Paranj pye et al., 2007) and flagellar motility (Lee et al., 2004; Lee et al., 2006; Tucker, 2006) are also re ported to contribute to both biofilm formation and to the virulence of V. vulnificus in animal models. Surface structures of V. vulnificus such as CPS, flagella, flagellar motility and type IV pili, that are associated with biofilms and virulen ce, may also provide adaptations for increased survival of V. vulnificus in their oyster host. Vibrio species attach to algae and plankton (Hood, 1997; Chiavelli, 2001). Oysters being filter-feed ers trap suspended food particles including bacteria and concentrate Vibrios in their tissues (T amplin and Capers, 1992; Harris-Young et al., 1993; Kennedy, 1999). Expression of C PS facilitates the survival of V. vulnificus by providing resistance to phagocytosis by oyster hemocyte s (Harris-Young et al., 1995). The degree of encapsulation may also provide resist ance to lysis by oyster lysozyme, as V. vulnificus opaque strain is more resistant to the intracellular bactericidal effects of oyster hemocytes than the translucent strain (Harris-Young et al., 1995). Moreover, it has been proposed that reversion of phase variation from translucent to the opaque ph enotype may also allow the bacterium to regain the CPS expression and enhance survival (Chatz idaki-Livanis et al., 2006). Expression of pilA and pilD are important for the persistence of V. vulnificus in American oysters (Paranjpye et al., 2007); however, the role of flagella and motility in the survival of V. vulnificus in oysters in not clear. Goals and Objectives The overall goal of this research study was to examine the hypothesis that different surface structures of V. vulnificus such as CPS, pili and flagella, contribute to the survival of V. vulnificus in an oyster model. Th ese surface structures of V. vulnificus which are virulence factors in mammalian models, may also provide adap tations for survival in oysters. Furthermore,

PAGE 26

26 phase variation of cell surface structures such as CPS can potentially influence the behavior of this bacterium in oysters. For validation of the hypothesis, mu tational analysis was used to examine these variables in an oyste r model of infection. Survival of mutant and phase variants of V. vulnificus was compared to the wild type encapsula ted strain. The specific objectives of this research include the following items: 1 To develop an oyster model of infection in order to assess the contribution of surface structures such as CPS, pili and flagella e xpression in the survival and colonization of V. vulnificus in an Eastern oyster, Crassostrea virginica 2 To examine the uptake and distribution of V. vulnificus mutant and phase variants in hemolymph, gills and digestive tract of oyster tissues. 3 To examine the relative importance of different surface structures of V. vulnificus at different stages (extended inocula tion up to 72 hours) of colonization. 4 To examine the rate of survival of V. vulnificus in oysters as a result of bacterial competition between wild type and wzb deletion mutant and wzb pilA double mutant strain. 5 To examine the phase variation in oyster s using the growth plasmid pGTR902 into V. vulnificus as a marker for the appearance of opaque colonies resulting from phase variation of translucent to the opaque phenotype. Th ese experiments should distinguish phase variation from die off within a population

PAGE 27

27 Figure 1-1. Genetic organization of Group 1 CPS operons. Source: (Chatzidaki-Livanis et al., 2006)

PAGE 28

28 A B C Figure 1-2. Differences in the colony morphology of Vibrio vulnificus strains. A) Opaque colonies, B) Translucent colonies, and C) Rugose (wrinkled) colonies .

PAGE 29

29 CHAPTER 2 MATERIAL AND METHODS Bacterial Strains and Culture Conditions The capsular polysaccharide (CPS) phase variants, CPS ( wzb ) deletion mutant of V. vulnificus (Chatzidaki-Livanis et al., 2006), pili mutants (Paran jpye and Strom, 2005) and flagella mutants of CMCP6 (Tucker, 2006) used in this research study ar e summarized in Table 2-1. All strains were stored in Luria-Bertani br oth (LB; 1.0% tryptone, 0.5% yeast extract, and 1.0% NaCl) with 50% glycerol at -80oC. The strains were recovered from frozen stock by streaking for isolation on Luria-Bertani agar, LA (LB with 1.5% Bacto Agar) and incubated at 37C. For V. vulnificus plate counts, a species-specific me dium modified cellobiose-polymyxin B-colistin (mCPC) agar, prepared with 1.0% pept one, 0.5% beef extract, 2.0% NaCl, 0.1% of the 1000X dye stock solution (4.0% bromothymol blue, 4.0% cresol red in 95% Methanol), and 10% of filtered antibiotic solution (1.0% cellobiose, 3.0% colistin, 1.3 % polymyxin B dissolved in 100mL distilled water), as desc ribed in Bacteriological Analy tical Manual (BAM), 2001 was used. When required, kanamycin (50-300 g/mL) and polymyxin B (50 g/mL) were added to LA and LB, to facilitate the growth of antibiotic resistant strains. The Escherichia coli ( E. coli ) strain S17pir with pGTR902 (provided by Dr. Paul Guli g, University of Florida) was used for introducing antibiotic resistance marker in V. vulnificus The E. coli strain was grown in LB with kanamycin (50 g/mL) and arabinose (1%). V. vulnificus CPS phase variants and the deleti on mutant of MO6-24/O were from a previous study by (Chatzidaki-Liva nis et al., 2006). MO6-24/Opaque is a wild type encapsulated clinical isolate that expresses CPS on the ce ll surface, marked by opaque colonies on solid medium (LA) and is virulent in animal models. MO6-24/T1 is a reversible phase variant derived from MO6-24/O, with undefined mutation that shows reduced or patchy CPS expression on the

PAGE 30

30 cell surface. The strain is marked by translucent colonies and is less virulent in animal models. MO6-24/ wzb is an irreversible dele tion mutant derived from MO6-24/O with precise deletion of wzb of the CPS operon, eliminating CPS surface expression and locking the strain into translucent phenotype (Chatzidaki-Liva nis et al., 2006). Complementation of wzb in trans restores the CPS expression, and translucent colonies return b ack to the opaque phenotype (Chatzidaki-Livanis et al., 2006). Another reve rsible phase mutant of opaque is MO6-24/ Rugose, known for enhanced biofilm formation, is marked by wrinkled and dry morphotype. This strain is relatively less motile than the parental opaque strain, but yet possesses a polar flagellum (Grau et al., 2005). V. vulnificus pili mutant was kindly provided by Dr. Rohinee Paranjype, and consisted of strain MO6-24/PilA with deletion mutation in pilA (Paranjpye and Strom, 2005). This pilA is a part of an operon and is clustered with three other pilus biogenesis genes, pilBCD PilA is the precursor of a substrate of PilD, and mutations in pilD the gene encoding the type IV leader peptidaseN-methyltransferase (type IV prepilin pe ptidase), result in the absence of pili on the surface of V. vulnificus (Paranjpye et al., 1998). MO6-24/ pilA strain has a specific deletion mutation in pilA in MO6-24/O parent strain, but does produce other type(s) of pili such as mannose-sensitive haemagglutinin (MSHA), homologous to the V. cholerae MSHA. This strain shows intact CPS operon and is marked by opaque colonies on solid medium (LA). However, this strain is defective in biof ilm formation, adherence to epitheli al cells and virulence in mouse model (Paranjpye and Strom, 2005). Complementation of pilA mutation restores PilA expression, adherence to Hep-2 cells, biofilm formation on bor osilicate glass surface, and virulence in iron dextran-treated mouse model (Paranjpye and Stro m, 2005). Another strain used in this study was MO6-24 pilA wzb double deletion mutant derived from MO6-24 pilA that has a precise

PAGE 31

31 deletion of wzb of the CPS operon. Deletion of wzb eliminated the CPS surface expression and as a result the cells were locked in th e translucent phenot ype (This study). Flagellar mutants were kindly provided by Dr. Paul Gulig and were described previously in the M.S. thesis of Matt Tucker (online a ccess: Tucker, Matthew S; Analysis of flagella, chemotaxis, and motility in the virulence of Vibrio vulnificus [electronic resource] / [Gainesville, Fla.] : University of Florida, 2006) (Tucker, 2006). V. vulnificus flagella has six flagellin genes, namely flaA, flaB, flaF flaC, flaD and flaE that are organized into two genetic loci, flaFBA and flaCDE Briefly, these mutants consisted of mutations in one ( flaCDE ) or both ( flaFBA flaCDE ) genetic loci encoding the genes for the production of flagella and motility. Using the CMCP6 strain, deletion was made in the gene locus of FLA 677( flaCDE ) strain (Tucker, 2006). This resulted in a strain with re duced motility as compared to the wild type, but had flagella and caused skin infections similar to th at of the wild type but was absent in the liver (Tucker, 2006). Strain FLA 711 ( flaFBA flaCDE ) is a double mutant, with deletion in all flagella genes flaC, flaD and flaE, flaF, flaB and flaA Deletion of both genetic loci of V. vulnificus flagella, resulted in a non-motile, nonflag ellated strain that showed attenuated virulence in both skin and liver in a mouse m odel. Mutations in flag ellar propulsion (motility) due to the deletion of motAB resulted in a non-motile and flagellated strain FLA 674 ( motAB ), that was capable of causing skin infection but showed no systemic inf ection in mouse model (Tucker, 2006). Complementation of FLA ( motAB ) strain with cloned motAB in trans fully restored the motility and the viru lence to the levels of the wild type (Tucker, 2006). However, complementation to the strains FLA 677 ( CDE ) and FLA 711 ( flaFBA flaCDE ) restored the motility but the mutants were not virulent to the levels of wild type strain in the mouse model (Personal communication w ith Dr. Paul Gulig).

PAGE 32

32 To assess the motility of the V. vulnificus flagella mutant strains, the bacteria were grown in the logarithmic growth phase and were stabbed into the mo tility agar (1% Bacto tryptone, 0.5% Sodium Chloride and 0.5% B acto agar, Difco laboratories). Fl agella strains that exhibited motility swam through the agar, and created ring s of growth. These rings of growth were measured to record the motility after overnight incubation at 37oC. Generation of a Double Mutant for pilA and wzb A double deletion mutant, defective in both pilA and wzb expression, was constructed for this study using the V. vulnificus strain MO6-24/ pilA previously described by (Paranjpye and Strom, 2005). The protocol for generation of this strain was adopted from Jones, Ph.D dissertation (online access: Jones, Melissa Kols ch; Regulation of phase variation and deletion mutation in the Vibrio vulnificus group 1 CPS operon [electronic resource] / [Gainesville, Fla.]: University of Florida, 2006) (Jones, 2006). MO6-24/ pilA is an encapsulated strain as indicated by opaque colony morphology. The J ones protocol induces spont aneous deletion mutant ( wzb ), with the precise excision of the wzb in group 1 CPS operon of V. vulnificus The deletion of wzb results in a strain that does not express CPS that is indicate d by translucent colony morphology and the cells do not revert back to the opaque phenotype. This CPS ( wzb) deletion mutant was used as control in this experiment. For induction of wzb deletion mutant, a frozen culture of MO6-24/ pilA was streaked on LA that was grown overnight at 30oC. Isolated colonies were inoculated into 25mL of LB and incubated at 37oC in an Orbital Shaker overnight, shaki ng at 70 rotations per minute (rpm) (C24 Incubator Shaker, New Brunswick Scientific). To obtain the inoculum concentration (106) colony forming units per mL (CFU/mL), the overnig ht culture was used and the optical density (OD) of overnight cultu re at wavelength A600 using spectrophotomer (Spectra Max, Molecular devices) (A600) was measured. The inoculum concentration was also confirmed by serial

PAGE 33

33 dilutions and plate counts. An inoculum of 1mL at 106 CFU/mL with concentration (106 CFU/mL) was then centrifuged at 13,000 rpm (E ppendorf 5810R), suspended in PBS twice, and transferred into Neutral Peptone water 3 (NPW3; 10 g of protease peptone 3, 10g of NaCl in 1 litre (L) of water at pH 7.0) broth. This culture was incubated, statically at 37oC. On days 1, 2, 3, and 7 post incubations, samples were serially di luted in phosphate buffer saline (PBS) and spread plated on LA, to determine changes in the colony morphology. Mutations were indicated by appearance of translucent colonies and conf irmed by polymerase chain reaction (PCR) as previously described by (Cha tzidaki-Livanis et al., 2006). DNA for PCR was extracted usi ng the boiling extraction met hod (Chatzidaki-Livanis et al., 2006) and amplified by PCR under the follow ing conditions: incubation at 94C for 5 min, 25 cycles of 94C for 1 min, 56C for 1 min, and 72 C for 1 min with a final 7 min extension at 72C on a thermocycler (Eppendorf Master Cycler). Primers for wza F1 (5gacgattccagcaggctctta-3) and wzc R2 (5tccatcatcgcaaaatgcaagctg3) were used for the amplification (Chatzidaki-Livanis et al., 2006) The PCR products were visualized on 1% agarose gels with ethidium bromide and co mpared to MO6-24/opaque, MO6-24/T1, and MO624/ wzb standards. Amplicon size was determined by comparison to the Hi-Lo DNA ladder. A negative control without template was also included the assay. The MO6-24/ pilA wzb strain was confirmed by a decreased size of PCR am plicon that was equivalent to the CPS ( wzb ) control. When available, the strain was st ored in LB with gl ycerol (50%) in -80oC. Oyster Model for V. vulnificus Infection An oyster model of infection was designed to st udy the role of bacterial surface structures, such as CPS, pili and flagella, in the survival of V. vulnificus in live oysters. High background levels of V. vulnificus are present in the oysters during the summer month (A pril to November) (Kelly, 1982; Murphy and Oliver, 1992; Wright et al., 1996; Mote s et al., 1998). Presence of

PAGE 34

34 background V. vulnificus in oysters can lead to difficulties in examining the in vivo interactions of this bacterium in a live oyster model. Theref ore, the primary objective of developing this model was to reduce the amount of indigenous V. vulnificus present in oysters, utilizing an antibiotic treatment. Following treatment, the oys ters were artificially inoculated with the mutants and phase variants of V. vulnificus in order to compare the su rvival of these different strains to that of the wild t ype strain. All experiments were conducted between the months of April 2006 to August 2007 using live oysters ( Crassostrea virginicia ) obtained from the Apalachicola Bay (Site 1611, Buddy Ward & Sons Seafood & Trucking, LLC, Florida). Oysters were transported to the Universi ty of Florida on ice packs and us ed within 24 hours post harvest. Prior to transferring oysters to artificial seawater oysters were acclimated in dry storage at room temperature for 30 minutes (min) in order to avoid temperature shock. Subsequently, oysters were placed in wet storage at room temperat ure using ASW (Instant Ocean, Aquarium systems) at salinity of 16 parts per thousand (ppt) in 25 ga llons tanks that contai ned 8 gallons of ASW. The oysters were acclimated for 72 hours. The tank was equipped with two filter pumps (Tetra Whisper Internal Power Filter 10i) and the filter s were filled with ultra-activated carbon filter cartridges (Whisper BioBag Cartridges, Tetra). To achieve lower background levels of V. vulnificus in oysters, the experimental oysters were treated with the antibiotic tetracycline (TC). For TC treatm ent, acclimated oysters (n=6 per tank) were transferred to smaller tanks (capacity of 5 gallons) wit hout filtration, and filled with 2 gallons of ASW. In order to determine the optim um TC concentration fo r bacterial reduction in oysters, three different concentr ations of tetracycline (1g, 2g and 5g/mL) were added to tanks containing the oysters. Following overnight TC treatment, oysters were transferred to 5 gallon tanks containing fresh AS W (2 gallons). The tank was equipped with one pump (carbon

PAGE 35

35 filtration), and TC treated oysters were incubated overnight to remove residual antibiotic from the oyster tissues as described in th e Figure 2-1. Total bacterial counts and V. vulnificus in oysters, before and after treatment, we re determined as described below. Bacterial Inoculation and Determination of Bacterial Content in Oysters To examine the role of V. vulnificus surface structures in surviv al of this bacterium in oysters, TC treated oysters (n=6) described above were inoculated with106 colony forming units per mL of individual strains of V. vulnificus Bacterial inocula were prepared from overnight cultures that were grown in LB, shaking at 37oC at 70 rpm. Cultures were diluted in alkaline peptone water (APW), and numbers of bacteria were estimated by optical density at wavelength A600. Actual numbers of bacterial inocul a were determined by plate count on LA. To determine bacterial content of oysters, be fore and after TC treatment and before and after inoculation, oysters were shucked under st erile conditions as desc ribed in Figure 2-2A using a shucking knife, rinsed with ethanol ( 70%) and flamed. The shucked oyster meats were aseptically removed from the she ll and rinsed three times with sterile phosphate buffer saline (PBS) to remove the loosely attached bacter ium on the surface of oyster tissues. Individual oyster meats were collected in a sterile stomach er bag (Fisherbrand bags for stomacher, catalog number # 01-002-54) and weighed. The average wei ght of the rinsed oyster meat was between 20-25 grams. Sterile PBS, equal to the weight of the oyster meat, was then added to the stomacher bags. Individual oyster meats were then homogenized in a stomacher (Seward, Stomacher 80 Biomaster, Lab System) for 180 sec onds. Serial dilutions of oyster homogenates were prepared in APW using 2 mL from the firs t homogenate, in the first dilution (9mL of APW) to obtain a 1:10 dilution of oyste r and 1mL of the diluted hom ogenates in 9 mL APW for the subsequent dilutions. Undiluted oyster homogena tes (200L) were plated on non-selective LA for total bacterial c ount and on mCPC for V. vulnificus counts, and diluted homogenates used

PAGE 36

36 100L for plate counts. The LA and mCPC pl ates were incubated for 24 hours at 37oC and 40oC, respectively. After incubation, Log CFU/mL of i nocula and bacterial recovery of V. vulnificus strains (Log CFU/gram of oyster) from oysters were calculated. Isolates of V. vulnificus strains, recovered after oyster passage were also ex amined for changes in colony morphology on LA plates. Colony morphology was recorded, and resu lts were summarized as changes in colony morphology following oyster infections, recorded as a percentage (%) of total colonies on LA. Each experiment used at least six oysters fo r each strain inoculated and included an uninoculated control (n=6). Bact erial content was determined for individual oyster meats. TCtreated oysters (n=6) were also inoculated with 100L of APW without V. vulnificus inocula as a negative control for the study. Oyst ers without any TC treatment (n =6) were also examined in order to determine the initial levels of bacterium present in oysters. Some experiments were conducted in winter oysters that have natural reductions in bact erial load, in order to compare the bacterial recovery in TC treate d oysters versus non-TC treate d oysters. All experiments were repeated in triplicate. Dissection of Oyster Tissues Hemolymph, digestive tract, and gills of oysters were examined in order to determine the distribution of V. vulnificus in oyster tissues using the oyster model of infection. Oyster hemolymph was collected by drilling a notch in the oyster shell with a power drill, avoiding contact with oyster tissue. With a 21-gauge needle, oyster hemolymph was withdrawn into a sterile 5-mL syringe. For dissections, oysters we re shucked using steril e shucking knife (Figure 2-2A). Using sterile scissors a nd forceps, the gills (located directly underneath the mantle) and the digestive tract of oysters were dissected. The dissected oyster ti ssues were rinsed with sterile PBS three times and weighed in stomacher ba g. Equal amounts of PBS were added and the

PAGE 37

37 oyster meats were homogenized. As described ab ove, serial dilutions were made in APW; homogenates were plated on LA a nd mCPC, incubated at 37 and 40oC for 24 hours, to determine the survival of total and V. vulnificus bacteria (Log CFU/gram of oyster tissue), respectively. Evaluation of Phase Variation in Oysters A growth plasmid (pGTR902) was used to de termine if appearance of opaque colonies recovered from oyster infection are a result of pha se variation of the translucent to the opaque phenotype or just a reflec tion of die-off within th e translucent population. E. coli S17pir containing the growth plasmid pGTR902 was provide d by Dr. Paul Gulig at the University of Florida. This plasmid was conjugated into V. vulnificus MO6-24/T1. This plasmid has a kanamycin resistant gene marker (Starks et al ., 2000). Additionally, the plasmid only replicates in the presence of arabinose. Therefore, absence of arabinose will result in loss of the plasmid in daughter cells (growing population) and those cells will not grow when subsequently plated on antibiotic medium (LA with kanamycin and arab inose). On the other hand, in the presence of arabinose, the growing cells will inherit the plasmid in the daught er cells. Thus, the appearance of kanamycin opaque colonies on antibiotic medium will be indicative of phase variation within the originally translucent culture. The growth plasmid was conjugated to V. vulnificus MO6-24/T1, followed by plating the culture on LA with arabinose (1%), kanamycin a nd polymyxin B. Briefly, an isolated colony of MO6-24/T1 was grown in LB at 37oC overnight. E. coli with pGTR902 was also grown overnight in LB with kanamycin (50g/mL) w ith 1% arabinose. Each culture (1 mL) was centrifuged for 10 min at 13,000 rpm and resuspended in 1mL of LB, to a total of three times. Final pellets were resuspe nded in 5mL LB, and the cultu res were incubated at 37oC with shaking for 2.5 hours. E. coli with pGTR902 was then in cubated statically at 37oC for 30 min to re-grow sex pili. For conjugation, 200L of E. coli S17 was added to 200L of MO6-24/T1 and

PAGE 38

38 transferred to a 0.45 m filter (Millipore filters Bedford, Mass., USA) placed on a 3 mm Whatman filter paper and dried for one hour. Drie d filters were the placed on the LA, filter cell side up, and incubated overnight at 37oC. Following incubation, the filters were transferred to the LB with kanamycin (300 g/mL), polymyxin B ( 50 g/mL) and arabinos e (1%) and incubated for one hour with shaking at 37oC. Cultures (150L) were spread onto antibiotic LA (kanamycin and polymyxin and arabinose) and incubated overnight at 37oC. The original MO6-24/T1 inoculum was also plated as a negative contro l on LA /kanamycin (50 g/mL), polymyxin B (50 g/mL), arabinose 1%. Colonies that grew on LA (300 g/mL), polymyxin B (50 g/mL), arabinose 1%, were stored. The presence of pl asmid in MO6-24/T1 was confirmed by plasmid extraction kit (Promega, DNA purification, SV Mi nipreps, Catalog # A1460), for potential MO624/T1/pGTR902 strains. The extracti on was simultaneously performed on E. coli S17/pGTR902 as a positive control. The extracted plasmid wa s visualized on 1% agarose gel, and the band sizes were compared. The isolat es having same band size as the E. coli S17/pGTR902 confirmed the presence of plasmid in MO6-24/T1, and pos itive colonies were streaked onto LA with kanamycin (150g/mL) for storage at -80oC. The transconjugan MO6-24/T1 pGTR902 only replic ates in the presence of arabinose, and growth under non-permissive conditions results in loss of plasmid in the newly generated cells. Consequently, the growing populations under conditi ons without arabinose were negative for the plasmid and for antibiotic resistance (LA with ka namycin and arabinose). This property of the plasmid was used for distinguishing the origin al inoculum from th e growing population, as kanamycin positive cells indicated the original inoculum. Additionally, the appearance of kanamycin opaque colonies will in dicate phase variation within the originally translucent culture. Therefore, MO6-24/T1 pGTR902 wa s inoculated in the oyster model of infection, and the

PAGE 39

39 inoculum concentration was determined by plat e count on LA. Recovery of bacteria after 24 hours of inoculation was determined by plating the oyster homogenate on LA and on LA with arabinose (1%) and kanamyci n (300g/mL). The plates were incubated at 30oC. The colonies were examined for changes in colony mor phology and phase variation. Opaque cells that retained antibiotic resistance were presumed to be derived from phase variation of surviving translucent cells. Calculation of death within the original population was determined by the killing proportion, which was calcula ted using the following equation: inoculum initial in the bacteria containing pGTR902 of ion Concentrat oysters from recovered bacteria containing pGTR902 of ion Concentrat proportion Killing Competition Studies For competition studies, CPS deletion mutant ( wzb ) and double deletion mutant ( pilA/wzb ) of V. vulnificus were used. The purpose of this study was to examine the recovery of V. vulnificus strains in a mixed culture as a result of e nhanced survival. Mixed overnight cultures of either opaque and CPS deletion mutant ( wzb ) or opaque and pilA wzb double mutant, were inoculated (106 CFU/mL) in oysters using the oyster mode l of infection. The relative survival of each V. vulnificus strain recovered from oysters was determined by examining the colony morphology. V. vulnificus CPS ( wzb ) mutant is locked in the translucent phase and does not show phase variation to opaque colony morphology (Chatzidaki-Li vanis et al., 2006). Therefore, difference in the colony morphology was used as a marker to distingu ish the recovery of different bacterial strains (opaque versus translucent) in the mixe d culture. Experiments with the pure culture of MO6-24/O (opa que) were also conducted simu ltaneously as a control to determine any changes in the recovered colony morphology of opaque cells. The colony morphology recovered after oyster passage on LA (polymyxin 50) incubated at 30oC for 24 hours, was recorded as a percentage of opaque and tran slucent colonies of to tal colonies recovered.

PAGE 40

40 Recovery of wild type encapsulated opaque strain was compared with to recovered translucent colonies from oysters incubated with the mixed culture of opaque and wzb mutant. Similarly, for the oysters incubated with the mixed culture of opaquepilA wzb mutant, the survival of opaque strain was compared to that of recovered translucent pilA wzb double mutant. Statistical Analysis Students t-test was used to evaluate the survival of V. vulnificus in oysters by comparing the mutants and phase variants of V. vulnificus on selective media (mCPC). Bacterial concentrations were log transformed and average and standard deviation of oysters within one experiment and within multiple experiments were calculated. All the strains were compared to the wild type encapsulated opaque st rain to calculate the significant differences in the survival of V. vulnificus strains in the oysters using a Student s t-test two samples assuming unequal variance, = 0.05 in Microsoft Excel, 2003.

PAGE 41

41 Table 2-1. Summary of V. vulnificus strains used in this study Strain Description MO6-24/O Wild-type, encapsulated, virulent clinical isolate (Chatzidaki-Livanis et al., 2006) CMCP6 Wild-type, encapsulated, virulent clinical isolate (Lee et al., 2004) MO6-24/T1 Reversible phase variant, patchy CPS expression, reduced virulence (Chatzidaki-Livanis et al., 2006) MO6-24/T2 ( wzb ) Deletion mutant with precise deletion of wzb no CPS surface expression (Chatzidaki-Livanis et al., 2006) MO6-24/R (Rugose) Reversible phase variant with enhanced biofilm formation and wrinkled (rugose) colonies (Grau et al., 2005) MO6-24/ pilA ( pilA ) Specific deletion mutation in pilA but with intact CPS operon, marked by opaque colonies (Paran jpye and Strom, 2005) MO6-24/ pilA /T2 (pilAwzb ) Deletion mutant derived from MO6-24/ pilA with precise deletion of wzb gene of CPS operon, eliminating CPS surface expression, marked by translucent colonies (This study) FLA 677 ( flaCDE ) Virulent strain with deletion in one gene locus ( CDE ), reduced motility, showed flagella, wild-type level of skin infection but was absent in liver (Tucker, 2006) FLA 711 ( flaCDE flaFBA ) Double deletion mutant ( flaCDE flaFBA ) replacing all the flagella genes, showed attenuated virulence in both skin and liver of mouse model (Tucker, 2006) FLA 674 ( motAB ) Deletion of ( motAB) resulting in no motility but showed flagella, produced local infection but no systemic infection (Tucker, 2006)

PAGE 42

42 Figure 2-1. Summary of oyster model of infection

PAGE 43

43 A C Figure 2-2. Oyster dissection. Oyster s are shucked using A) sterile oyster knife, and B) gills and C) oyster digestive tract tissue removed. (Source: http://www.mdsg.umd.edu/issues/ chesapeake/oysters/education/anatlab/lab_i.htm Last accessed 08/22/2007) GillTissue B

PAGE 44

44 CHAPTER 3 DEVELOPMENT OF OYSTER MODEL OF INFECTION Presence of indigenous V. vulnificus in oysters can complicate the experimental investigation into the interaction of these bact eria with their molluscan shellfish host. The problem is particularly severe duri ng summer months when levels of V. vulnificus may approach or exceed 105 bacteria per gram of oysters (Tamp lin and Capers, 1992; Kaspar and Tamplin, 1993; Wright et al., 1996; Motes et al., 1998). In order to facilitate the development of an in vivo oyster model of infection, antibiotic treatment was us ed to reduce the background V. vulnificus levels in oysters. V. vulnificus is particularly sensitive to tetracycline (Bowdre et al., 1983); therefore, tetracycline (TC) was selected as a pretreatment prior to the artificial inoculation of oysters with V. vulnificus Optimization of Tetracycline Treatment As described in Materials and Methods (Chapter 2), oysters were acclimated in artificial sea water (ASW) with filtration for several days prior to tr eatment. Following acclimation, the oysters were immersed in ASW containing the antib iotic, followed by transfer of oysters to the fresh ASW with charcoal filtrati on overnight to remove the resi dual antibiotic. Three different concentrations (1g/mL, 2g/mL, and 5g/mL) of tetracycline were tested for the removal of background V. vulnificus levels in the oysters. As shown in Figure 3-1, pre-treatment with tetracycline at 2g/mL and 5g/mL resulted in significant reduction (less than 10 CFU per gram of oyster meat) of V. vulnificus level oysters, compared to oys ters without any TC treatment (p=0.001 and 0.002 respectively). On the other hand, oysters treated with TC concentration of 1g/mL did not show signifi cant difference in reduction in V. vulnificus levels when compared to non-treated oysters.

PAGE 45

45 Recovery of V. vulnificus in Post Tetracycline Treated Oysters Tetracycline-treated oysters were inoculated with V. vulnificus (106 CFU/mL) to examine the bacterial recovery after the tetracycline treatment. Figure 3-2 illustrates that a significantly higher recovery of V. vulnificus was seen in oysters treated with 2g/mL of TC as compared to the bacterial recovery seen in oys ters that received TC concentra tion of 5g/mL (p=0.01). It is possible that high concentrati on of 5g/mL of TC may have inhibited the survival of V. vulnificus in oysters due to the accumulation of excess TC in oyster tissues. Therefore, pretreatment with 2g/mL of tetracycline was chosen as the optimum concentration to remove the background V. vulnificus contents in oysters. Effects of Extended Incubation Post Tetracycline Treated Oysters Tetracycline (2g/mL) treated oysters were ex amined for the effectiveness of antibiotic treatment to maintain low levels of V. vulnificus for time period of 24, 48 and 72 hours. Figure 33 shows that the levels of V. vulnificus in TC treated oysters without V. vulnificus inocula were significantly lower after 24, 48 and 72 hours (p=0.001, p=0.01 and p=0.03 respectively), as compared to the initial V. vulnificus contents in oysters. These data suggest that tetracycline was effective in reducing the V. vulnificus levels in oysters, which subsequently facilitated the in vivo experimental assays. Bacterial Recovery in Tetracycline and Non-tetracycline Treated Oysters Antibiotic treatment of oysters reduced the V. vulnificus levels in the oysters; however there is a possibility that concomitant reduction in nonV. vulnificus bacterial counts may alter the results independent ly from other variables within the experimental oysters. The natural levels of V. vulnificus in oysters are reduced during winter months as compared to the levels in warmer months (Tamplin and Capers, 1992; Kaspar and Ta mplin, 1993; Wright et al., 1996; Motes et al., 1998). Therefore, in order to exam ine the suitability of tetracyclin e treatment in the oyster model

PAGE 46

46 of infection, the survival of artificially inoculated V. vulnificus was compared in TC treated and non-TC treated winter oysters. As shown in Fi gure 3-4, no significant differences were seen in the survival of V. vulnificus strains in TC-treated oysters compared to non-TC -treated oysters. These results show that treatment wi th tetracycline reduces the background V. vulnificus levels in oysters without altering the survival of ar tificially inoculated bacteria in this in vivo assay.

PAGE 47

47 0.0 1.0 2.0 3.0 4.0 5.0 6.00125 Concentration of Tetracycline (g/mL)Bacterial content in oysters (Log CFU/g) Total Bacteria in Oysters (LA) V.vulnificus in oysters (mCPC) Figure 3-1. Effect of tetracycline (TC) treatment on survival of V. vulnificus in oysters. V. vulnificus concentrations were examined with or without different concentrations of TC. Asterisk denotes signifi cant (p<0.05) differences in V. vulnificus levels in oysters after TC treatment at differen t concentrations (2 g and 5g/mL) compared to initial count of V. vulnificus in oysters without TC treatm ent using Students t-test (p=0.001 and 0.002 respectively). Results are based on th e mean of triplicate experiments using data from six individual oys ters in each experiment.

PAGE 48

48 0.0 1.0 2.0 3.0 4.0 5.0 6.0Pre-inoculation (2g/mL) Post-inoculation (2g/mL) Pre-inoculation (5g/mL) Post-inoculation (5g/mL) Tetracycline concentrationBacterial content in oysters (Log CFU/g ) Total Bacterial counts (LA) V.vulnificus counts (mCPC) Figure 3-2. Recovery of V. vulnificus from tetracycline (TC) treated oysters. V. vulnificus (Log CFU/g) contents were examined in oysters receiving TC (either 2g/mL or 5g/mL) before and after artificial inoc ulation of bacteria. Asterisk denotes significantly higher bacterial recovery (p<0.05) in TC oysters at 2g/mL (p= 0.01) as compared with the TC oysters at 5g/mL using Students t-test Data are based on the means of triplicate experiments using data from six indi vidual oysters in each experiment.

PAGE 49

49 0.0 1.0 2.0 3.0 4.0 5.0 6.0Prior TC (2g/mL) 24 h 48 h72 hHours of incubation (h)Bacterial content in oysters (Log CFU/g) Total bacterial counts (LA) V.vulnificus counts (mCPC) Figure 3-3. Effects of extended incubati on on Tetracycline (2g/mL) treated oysters. Asterisk denotes significant (p <0.05) difference in V. vulnificus counts in TC (2g/mL) oysters after 24h, 48 h and 72 hours of extended incubation as compared to initial V. vulnificus in oysters (p= 0.001, 0.01 and 0.03 respectiv ely) using the Students t-test. Data are based on the means of triplicate ex periments using data from six individual oysters in each experiment.

PAGE 50

50 0.0 1.0 2.0 3.0 4.0 5.0 6.0 CONTROLOPAQUET1T2 RUGOSE pilA pilA wzb Mutants and Phase variants of V. vulnificusV. vulnificus content in oysters (Log CFU/g) V.vulnificus in TC treated oysters (mCPC) V.vulnificus in non-TC treated oysters (mCPC) Figure 3-4. Comparison of tetracy cline (TC) and non-tetracycline treated oysters. Oysters with TC (2g/mL) treatment and non-TC treatment were compared to examine the appropriateness of tetrac ycline and recovery of V.vulnificus in winter oysters. Control represents un-inoculated oysters. No si gnificant (p>0.05) differences were found between the oysters with TC and without TC using the Students t-test. Results are based on the means of triplicate experiments us ing data from six i ndividual oysters in each experiment.

PAGE 51

51 CHAPTER 4 ROLE OF CAPSULAR POLYSACCHARIDE IN SURVIVAL OF V. vulnificus IN OYSTERS Encapsulation has been shown to contribute to resistance of bacteria to ingestion and degradation by oyster hemocytes (H arris-Young et al., 1995). Theref ore, the role of capsular polysaccharide (CPS) in survival of V. vulnificus in oysters was examined using V. vulnificus CPS mutant and phase variants (T able 2-1). Tetracycline (TC) trea tment of 2g/mL was used to reduce the background V. vulnificus in oysters using the oyster m odel of infection followed by artificial inoculation (106 CFU/mL) of oysters with CPS mutant s and phase variants (Chapter 3). Figure 4-1 shows that wi ld type encapsulated V. vulnificus survived in oysters at significantly higher levels as compared to the CPS ( wzb ) deletion mutant with no capsule expression (p= 0.025), after 24 hours of inoculati on in oysters (Figure 4-1). However, the translucent phase variant, which shows reduced capsule expression and can revert back to the wild type, did not differ significantly from th e opaque strain. These results suggest that expression of CPS may confer an ad vantage for enhanced survival of V. vulnificus in oysters. A translucent phase variant of V. vulnificus has been previously shown to have enhanced biofilm formation (Joseph and Wright, 2004). Th erefore, these data suggest that in vitro biofilm formation may be independent of survival of V. vulnificus in oysters. Unlike group 1 CPS, other capsular types have been implicated in promoting biofilm in V. cholerae and V. vulnificus (Yildiz and Schoolnik, 1999; Grau et al., 2005). These stra ins are identified by th e formation of rugose or wrinkled colonies. Survival of V. vulnificus rugose variant was found in significantly lower amounts in oysters (p=0.005) when compared to the wild type opaque strain. Survival comparison of rugose and opaque strains in artifi cial seawater, showed that rugose had a higher rate of recovery (p=0.03) than the wild type opaque strain. Based on these results, it can be

PAGE 52

52 suggested that rugose strains are be tter adapted to survive in artifi cial seawater as compared to survival in oysters. Distribution of CPS Mutant and Ph ase Variants in Oyster Tissues Vibrio species attach to plankton found in estu arine and marine environment. Molluscan shellfish such as oysters filter-feed on the plan kton by drawing the water using their gills and the beating of cilia. Suspended plankton and food par ticles including bacteria get trapped in the mucus of gills and are transported to the mouth. From the mouth, plankton including attached bacteria is transported to the digestive tract a nd subsequently bacteria are disseminated into the hemolymph and concentrated in oyster tissues (Kennedy, 1999). Therefore, CPS mutant and phase variants were examin ed for the distribution of V. vulnificus in gills, digest ive tract and the hemolymph of oysters. As shown in Figure 4-2, significant differences were not found in the survival of V. vulnificus CPS mutant and phase variants in the digestive tr act of oysters. However, survival of the wild-type encapsulate d opaque strain was significantly higher in the hemolymph of the oyster as compared to that of CPS ( wzb ) deletion mutant (p=0.03) and the rugose phase variant (p=0.02). Moreover, distri bution of the opaque strain was significantly higher in gills of the oyster as compared to that of CPS ( wzb ) deletion mutant and rugose phase variant (p=0.02, 0.01, respectively). Conversely, the survival of th e translucent phase variant (T1) did not differ from the wild type opaque st rain. These results indicate that expression of CPS did not appear to alter the initial attachment of bacteria to the intestine but is important for the persistence of V. vulnificus in gills and dissemination to the hemolymph of oysters. Recovery of V. vulnificus CPS Strains in Oysters after Extended Inoculation V. vulnificus CPS mutant and phase variants were also examined for survival in colonization in an oyster model after extended inoculation periods from 24 to 72 hours. As shown in Figure 4-3, the survival of the encapsu lated opaque strain was significantly higher as

PAGE 53

53 compared to that of V. vulnificus CPS ( wzb ) deletion mutant after 24, 48 and 72 hours of inoculation (p=0.03, p=0.04 and p=0.01, respectively. ). Survival of the rugose strain was also found to be significantly lower than the survival of the wild type strain at 24 hours (p=0.009) and 48 hours (p=0.02) of inoculation. However, after 72 hours of inoculation, the survival of rugose and the opaque was not found to be significantly different. On the other hand, the survival of translucent strain with reduced capsular expr ession did not differ from the wild type encapsulated strain at all duri ng the extended periods of inocul ation (24, 48 and 72 hours). This study suggests that expression of capsule is important for the long term survival of V. vulnificus in oysters. Phase variation of V. vulnificus in Oysters V. vulnificus exhibits phase variation in the expr ession of CPS, which is manifested by changes in the colony morphology of opaque encap sulated strains by swit ching to translucent colony morphology that is indicative of reduced CPS expression. Some translucent strains may also revert to the opaque phenotype. It is hypothesized that survival of V. vulnificus in oysters may be dependent on its ability to phase shift the expression of ce ll surface structures in response to adverse environmental conditi ons (Chatzidaki-Livanis et al., 2006). In order to validate the hypothesis, isolates of V. vulnificus strains were recovered fr om oysters and ASW following oyster infection. The colony forming units from the recovered isolates were examined for changes in the colony morphology that would indicate phase variation from the original phenotype, on solid medium (LA) incubated for 24 hours at 30oC. Results showed that opaque strains maintained stable morphology after oyster passage, and all the colonies recovered from oysters were opaque on LA plates. However, both translucent phase variant (T1) and rugose st rains, showed changes in co lony morphology by sw itching to the opaque morphology at high frequency (Table 4-2) Nearly 72% of the original translucent

PAGE 54

54 colonies inoculated in oysters were opaque on LA plates, whereas, the remaining 28% of colonies maintained the translucent phenotype after oyster passage. In terestingly, 100% of the initially rugose strain appeared opaque on LA plates, 24 hours post inoculation. Furthermore, after extended incubation of r ugose cells on LA plates for anot her 24 hours, originally rugose strains produced atypical opaque colonies; those were either larger (68.9%) or smaller (9.9%) than the typical wild type opaque phenotype, while 22% of colonies revert ed back to the rugose morphotype. These data sugge st that phase variati on of CPS expression in V. vulnificus could be a survival strategy for enhanced survival. Opaque strains are reported to resist the phagocytosis action of oyster hemocytes; theref ore, it is possible that phase va riation of translucent and rugose cells to the opaque phenotype c ould provide adaptations to these V. vulnificus strains for better endurance. V. vulnificus isolates were also recovered from the artificial seawater to examine changes in the colony morphology on LA, 24 hours post inoculation. Data s howed that all the V. vulnificus isolates recovered from water samples exhibited their origin al morphotype, and no phase variation to opaque coloni es was observed in any of the V. vulnificus strains (Table 4-3). In contrast to translucent and rugos e colonies, that showed phase va riation to opaque colonies in oysters, these strains maintained their stable colony morphology in artif icial sea water on LA, 24 hours post inoculation in oysters. Rugose cells we re also monitored for extended incubation of LA plates for another 24 hours (a total of 48 hours on LA), and were found to maintain their wrinkled colony morphology (Table 4-2). These results suggest th at V. vulnificus does not demonstrate phase variation in artificial seawat er but exhibits phase variation in oysters. Confirmation of Phase Variation of Translucent V. vulnificus with Growth Plasmid In order to determine whether or not the a ppearance of opaque colonies from originally translucent strains was a result of phase variation or just th e result of die-off within the

PAGE 55

55 translucent population, a growth plasmid was transformed into V. vulnificus A growth plasmid (pGTR902) was introduced into V. vulnificus MO6-24/T1 by conjugation in order to experimentally confirm phase variation. The plasmid pGTR902 (Starks et al., 2000) has a kanamycin resistance gene marker, but the plasmid replicates only in the presence of arabinose. Therefore, inoculation in media wi thout arabinose, results in the loss of the re sistance marker in newly dividing cells. The loss of the resistance marker in dividing cells will subsequently prevent the recovery of these ce lls on LA with arabinose and ka namycin. The dividing cells that will inherit the plasmid will form colony forming un its on antibiotic LA that will be indicative of recovered MO6-24/T1pGTR902 in oysters. Thus, the initial inoculum can be distinguished from the residual flora or dividing popul ation within the oyster by grow th on medium with arabinose and kanamycin. Translucent V. vulnificus (106 CFU/mL) containing the growth plasmid (MO6-24/T1 pGTR902) was inoculated into oysters, and after 24 hours of inoculation, oyster homogenates were plated simultaneously onto LA and antibiotic LA (kanamycin300 and 1% arabinose). The plates were incubated for 24 hours at 30C and colony morphology was recorded. Results showed that approximately 71.2 % of transl ucent cells containing the growth plasmid (pGTR902) formed opaque colonies following th e oyster passage on antibiotic LA, confirming that phase variation from translucent to opaque occurred in oysters (Table 4-4). Approximately 28.8% of the colonies forming units were transl ucent on the LA antibiotic media indicating that no phase variation occurred in these cells. The total number of bacteria recovered from the oysters (incubated with MO6-24/T1) on LA was s lightly higher (5.02 Log CFU/gram of oyster) than the total resistant bacteria recovered from oysters (4.9 Log CFU/gram of oyster), that could be due to the presence of the other b acteria or the dividing population of V. vulnificus in the

PAGE 56

56 oyster tissue. However, the difference in the tota l bacterial counts (LA) and the total resistant bacteria on antibiotic LA was not significant (T able 4-4). Approximately one Log CFU/mL of the cells were killed as indicat ed by the killing proportion, which measures the concentration of bacteria retaining pGTR902 after oyster passage divided by con centration of bacteria with pGTR902 initially inoculated in to culture. Experiments with a pure culture of MO6-24/T1 without plasmid were also conducted, serving as a control. The control ex periments also showed similar results of phase variation from translu cent to opaque colonies. As shown in Table 4-4, approximately, 70.4 % of original tr anslucent strain inoculated in the oysters appeared opaque on LA, 24 hours post inoculation in oysters and remaining 29.6% of the colonies appeared translucent. These data confirm the phase vari ation of translucent colonies to the opaque phenotype in the oysters.

PAGE 57

57 Table 4-1. Phase variation of V. vulnificus in oysters Changes in the colony morphology after oyster passage (%) b Inoculated straina Opaque Translucent Rugose Large Opaque Small Opaque MO624/O(Opaque) 100 0 0 0 0 MO624/T1Translucent 72 0.5 28 0.4 0 0 0 MO624/T2 ( wzb ) 0 100 0 0 0 MO624/Rugose (24 hours) 100 0 0 0 0 MO624/Rugose (48 hours) 0 0 21 0.5 68 0.5 11 0.9 aStrain inoculated in oysters bChanges in colony morphology fo llowing oyster infections was recorded as a percent (%) of total colonies, 24 hours pos t inoculation of V. vulnificus strains in oysters. Rugose cells were monitored for changes in colony morphology for additional 24 hours on LA plates (total of 48 hours on LA plat es). Results are based on mean of triplicate experiments using data from six indi vidual oysters in each experiment.

PAGE 58

58 Table 4-2. Phase variation of V. vulnificus in artificial seawater Changes in the colony morphology in water sample (%) b Inoculated straina Opaque Translucent Rugose Large Opaque Small Opaque MO624/O (Opaque) 100 0 0 0 0 MO624/T1 (Translucent) 0 100 0 0 0 MO624/T2 ( wzb ) 0 100 0 0 0 MO624/Rugose (24 hours) 0 0 100 0 0 `MO624/Rugose (48 hours) 0 0 100 0 0 aV. vulnificus strains inoculated in oysters bChanges in colony morphology following oyster infections in artificial seawater was recorded, 24 hours post incubation of V. vulnificus strains in oysters. Rugose cells were monitored for changes in colony morphology for additional 24 hours (a total of 48 hours) on LA plates. Data ar e based on mean of triplicate experiments using data from six indi vidual oysters in each experiment.

PAGE 59

59 Table 4-3. Confirmation of phase variation in MO6-24/T1 using pGRT902 in oysters Bacterial recoveryb Phase Variationc (%) Strain inoculateda Total bacteria Resistant bacteria Translucent Opaque Killing Proportiond MO6-24/T1 pGRT902 5.06 0.4 4.89 0.2 28.8 0.4 71.2 0.3 1.2 .2 MO6-24/T1 5.03 0.3 N.G 29.6 0.7 70.4 0.4 N.A. a Strain inoculated in the oysters b Bacteria (Log CFU/g) were recovered on LA (total) or antibiotic LA (total resistant) from oys ters, inoculated wi th the cultures of V. vulnificus 24 hours post inoculation. NG= no growth.c Phase variation of V. vulnificus in oysters; bacteria recovered from oysters was calcu lated as a fraction of total colony forming units on LA for (MO6-24/T1) and LA with kanamycin and arabinose for (MO6-24/T1pGRT902). d Killing proportion (Log CFU/mL) was calculated by concentr ation of bacteria with pGTR902 initially inoculated into the oysters dividing the concen tration bacteria of re taining pGTR902 in the oyster. NA= not applicable

PAGE 60

60 0.0 1.0 2.0 3.0 4.0 5.0 6.0 7.0CONTROLOPAQUET1T2 ( wzb)RUGOSEV. vulnificus CPS deletion mutant and phase variants Bacterial content in oysters (Log CFU/g) Total Bacteria in oysters (LA) V.vulnificus in oysters (mCPC) V.vulnificus in water (mCPC) Figure 4-1. Recovery of V. vulnificus CPS mutant and phase varian ts in oysters. Tetracycline (TC) treated oysters we re inoculated with 106 CFU/mL of V. vulnificus and examined for bacterial recovery, 24 hours post inoculation, on LA and mCPC. Strains include MO6-24/O, MO6-24/T1, MO6-24/T2 a nd MO6-24/rugose and TC treated uninoculated oysters were used as control. Asterisks are indica tive of significant (p<0.05) differences in the recovery of opaque strain as compared to CPS ( wzb ) deletion mutant and rugose variant in oysters (p=0.025, 0.005 respectively) and the water sample (p= 0.03) using the Students t-test. Results are based on the means of triplicate experiments using data from si x individual oysters in each experiment. *

PAGE 61

61 0.0 0.5 1.0 1.5 2.0 2.5 3.0 CONTROLOPAQUET1T2 ( wzb)RUGOSE V. vulnificus CPS mutant and phase variantsV. vulnificus content in oysters (Log CFU/g) V.vulnificus in Hemolymph(mCPC) V.vulnificus in Gills (mCPC) V.vulnificus in Digestive tract (mCPC) Figure 4-2. Distribution of CPS mu tant and phase variants of V. vulnificus in oyster tissues. Oysters were inoculated with 106 CFU/mL of mutants a nd phase variants of V. vulnificus Gills, intestine and hemolymph of oysters were dissected and examined for the distribution of V. vulnificus after 24 hours post inoculation; by examining growth on mCPC. Asterisk denotes sign ificant (p<0.05) difference in recovery of wild type opaque strain with the CPS wzb mutant and rugose in th e hemolymph of the oysters (p=0.03, p=0.02 respectively) using the Students t-test. Significant differences were also seen in the distribution of opa que strain as compared to the CPS wzb mutant and rugose in oyster gills (p=0.02 and p= 0.01). Data are based on the means of triplicate experiments using data from si x individual oysters in each experiment. *

PAGE 62

62 0.0 1.0 2.0 3.0 4.0 5.0 6.0CONTROLOPAQUET1T2 ( wzb)RUGOSE V. vulnificus CPS mutant and Phase VariantsV. vulnificus content in oysters (Log CFU/g) V.vulnificus in oysters (24h) V.vulnificus in oysters (48h) V.vulnificus in oysters (72h) Figure 4-3. Recovery of V. vulnificus in oysters after extended i noculation time. Survival of V. vulnificus was examined after 24, 48 a nd 72 hours of inoculation of V. vulnificus in oysters, and by examining the growth of strains on mCPC. Asterisk denotes significant (p<0.05) difference in the recovery of wild type strain with CPS mutants and phase variants in oyst ers at extended inoculation times. Recovery of opaque strain was significantly higher than T2 at 24, 48 and 72 hours of inoculation (p=0.03, p=0.04, p=0.01 respectively). Recovery of rugos e strain was significantly lower than the opaque strain at 24 and 48 hour of inoculation (p=0.009 and p=0.02) using the Students t-test. Results are ba sed on of the means of tripli cate experiments using data from six individual oysters in each experiment. * *

PAGE 63

63 CHAPTER 5 ROLE OF TYPE IV PILUS IN SURVIVAL OF V. vulnificus IN OYSTERS V. vulnificus type IV pilus ( pilA ) has been associated with biofilm formation and virulence in mammalian models (Paranjpye a nd Strom, 2005). To analyze the role of pilA and additive effects of wzb and pilA in the survival of V. vulnificus in oysters, V. vulnificus pilA deletion mutant and pilA wzb double mutant (described in Ch apter 2), were examined using the oyster model of infection. Wild type encapsu lated opaque strain surv ived in significantly higher levels in oysters as compared to the V.vulnificus pilA (p=0.01) mutant and pilA wzb double mutant (p=0.002), as shown in Figure 5-1. These data indicate th at expression of both pilA and wzb is important for the survival of V. vulnificus in oysters. The lo wer level of the double deletion mutant ( pilA wzb ) as compared to the V. vulnificus strains with a single mutation, indicated the additive contribution of PilA and encapsulation in the survival of V. vulnificus in oysters. Both pilA deletion mutant and the pil wzb double deletion mutant showed higher recovery in artificial seawater (ASW) as compared to the wild-type encapsulated strain (p= 0.04 and p=0.01, respectively). Distribution of V. vulnificus pilA Mutants in Oyster Tissues Hemolymph, gills and digestive tract of oysters were dissected to examine the distribution of V. vulnificus pilA and V. vulnificus pilA wzb mutants in oyster ti ssues. Figure 5-2 shows that there were significant differences in the distribution of the wild type encapsulated opaque strain in the hemolymph of the oyster as compared to that of pilA and pilA wzb mutant strains (p=0.02 and 0.01, respectively). On the other hand there was no significant difference in the distribution of V. vulnificus pilA and pilA wzb mutants in the digestive tract of oyster as compared to the wild type opaque strain. The levels of wild type were significantly higher in the gills of the oysters (p=0.04) as compared to the pilA wzb strain, however, the pilA mutant did

PAGE 64

64 not differ from the wild type en capsulated strain. These data sugge st that both type IV pilus and encapsulation help in the dissemination of V. vulnificus to the hemolymph of oysters. Expression of pili and CPS did not appear to alter the initial a ttachment of bacteria to the intestine. However, the lower levels of V. vulnificus pilA wzb in gills suggest that en capsulation, but not type IV pilus is important for the persistence of V. vulnificus in oyster gills, as results were similar to those observed for CPS ( wzb ) mutant alone (Figure4-2). Recovery of V. vulnificus pilA Mutants in Oysters after Extended Inoculation Survival of V. vulnificus pilA and pilA wzb double mutant was also examined after extended inoculation of oysters for up to 72 hours. Figure 5-3 shows that the survival of encapsulated opaque strain was si gnificantly higher than the V. vulnificus pilA mutant after 24, 48 and 72 hours of inoculation (p=0.02, 0.03 and 0.04 re spectively). Significant differences were also seen in the recovery of V. vulnificus pilA wzb double mutant (p=0.005, 0.03 and 0.01, respectively) after 24, 48 and 72 hours of extended inoculation as compared to the wild type strain (Figure 5-3). These results suggest that expression of both wzb and pilA are important for the long term survival of V. vulnificus in oysters. Survival of V. vulnificus in Oysters as a Result of Bacterial Competition In the natural environment, bacteria in a mi xed community compete for available nutrients, and more successful species may outgrow the other members of the community for enhanced survival. The purpose of this study was to examine the relative survival of V. vulnificus strains as a result of bacterial competition in oysters. Mixed overnight cultures of opaque and CPS deletion mutant ( wzb ) or opaque and pilA wzb double mutant were inoculated (106 CFU/mL) in oysters using the oyster model of infection. V. vulnificus ( wzb ) deletion mutant is locked in the translucent phase and does not show phase vari ation to opaque morphotype (Chatzidaki-Livanis et al., 2006). Therefore, differe nce in colony morphology was used to monitor the recovery of

PAGE 65

65 opaque, wzb and pilA wzb strains from oysters. Oysters were also incubated with the pure culture of MO6-24/O (opaque) simultaneously as a control, to determine recovered colony morphology of opaque strains after oyster passage The majority of colonies recovered from oysters inoculated with mixed culture of either opaque and wzb deletion mutant or opaque and pilA wzb double mutant, were always wild type encap sulated opaque cells (Table 5-1). Results showed that the survival of opaque was significantly higher th an that of CPS ( wzb) mutant (p=0.002) and pilA wzb double mutant (p=0.001). Additionally, significant differences were also seen in the recovery of translucent st rains from oysters incubated with opaque and wzb mutant as compared to that of opaque and pilA wzb (p= 0.03) These data support the previous results with individual strain s (Figures 4-1, 2 and 3) and confirm that expression of CPS is important for the survival of V. vulnificus in oysters. These results also suggest the additive contribution of pilA and wzb in the increased survival of V. vulnificus strains in oysters. Results also suggest that encapsulation may provide protective adaptations for increased survival of opaque st rains within the mixed bacterial community in aquatic habitats and within molluscan shellfish host, particularly oysters.

PAGE 66

66 Table 5-1. Survival of V. vulnificus in oysters as a result of bacterial competition Colony morphology recovered (%) b Strains Inoculated a Opaque (%) Translucent (%) Opaque 100 0.0 0.0 0.0 Opaque wzb 71.17 0.48 29.59 0.49 Opaque pilA wzb 76.60 0.41 23.40 0.43 a Strain inoculated in oysters b Colony morphology recovered after oyster passage at 30oC and recorded as a percent (%) of total colonies on LA Pol 50, 24hours post inoculation. Standard deviat ion was calculated using the average of duplicate experiments using six indi vidual oysters in each experiment.

PAGE 67

67 0.0 1.0 2.0 3.0 4.0 5.0 6.0 7.0CONTROLOPAQUE pilA pilA wzbV. vulnificus pil A mutantsBacterial content in oysters (Log CFU/g) Total Bacterial counts (LA) V.vulnificus counts (mCPC) V.vulnificus in water (mCPC) Figure 5-1. Bacterial recovery of V. vulnificus pilA mutants in oysters. Tetracycline (TC) treated oysters were inoculated with V. vulnificus pilA and pilA wzb mutants and examined for their recovery after 24 hour s post inoculation, on LA and mCPC. Uninoculated oysters were used as control in this study. Asterisk indicates significant differences in the survival of opaque strain as compared to pilA and pil A wzb mutant strains in oysters (p= 0.04 and p=0.01) using Students t-test. Data are based on the means of triplicate experiments using data from six indivi dual oysters in each experiment. *

PAGE 68

68 0.0 0.5 1.0 1.5 2.0 2.5 3.0 CONTROLOPAQUE pilA pilA wzb V. vulnificus pili mutantsV. vulnificus content in oysters (Log CFU/g) V.vulnificus in Hemolymph(mCPC) V.vulnificus in Gills (mCPC) V.vulnificus in Digestive tract (mCPC) Figure 5-2. Distribution of V. vulnificus pilA mutant and pilA wzb double mutant in oyster tissues. Oysters were incubated with V. vulnificus pilA and pilA / wzb mutants and examined for their distribution on mCPC in oyster gills, digestive tract and hemolymph, 24 h post inoculation. Un-inoculated oysters were used as control in this study. Asterisk denotes significant (p<0.05) di fference in distribution of wild type opaque strain with pilA and pilA wzb mutants in the hemolymph (p=0.02 and p=0.01) using the Student t-test. The levels pilA wzb were significantly lower in the oyster gills (p=0.04) as compared to the w ild type strain. Results are based on the means of triplicate experiments using data from six individual oysters in each experiment. **

PAGE 69

69 0.0 1.0 2.0 3.0 4.0 5.0 CONTROLOPAQUE pilA pilA/ wzb V. vulnificus pilA mutantsV. vulnificus content in oysters (Log CFU/g) V.vulnificus in oysters (24h) V.vulnificus in oysters (48h) V.vulnificus in oysters (72h) Figure 5-3: Recovery of V. vulnificus pilA and pilA wzb double mutant in oysters after extended inoculation. Survival of V. vulnificus pilA mutant strains was examined after 24, 48 and 72 hours of inoculation in oysters as determined by growth on mCPC at 40oC. Asterisk denotes significant (p<0.05) di fference in the survival of wild type opaque as compared to the pilA mutant (p= 0.02, 0.03 and 0.04) and pilA wzb double mutant (p=0.005, 0.03 and 0.01) after 24, 48 and 72 hours of inoculation using Students t-test. Results are based on the means of triplicate experiments using data from six individual oysters in each experiment. * *

PAGE 70

70 CHAPTER 6 ROLE OF FLAGELLA IN SURVIVAL OF V. vulnificus IN OYSTERS V. vulnificus possesses a single flagellum, a nd motility is important for the attachment/initial steps of adhesion to surfaces biofilm formation and virulence (Harshey, 2003; Lee et al., 2004). However, the role of flagella and flagella-related motili ty in the survival of V. vulnificus in oysters is less clear. Therefore, mutational analysis was used to examine the survival of V. vulnificus strains that were either defective or lacking flagella or the flagellar motor in oysters. The V. vulnificus flagella mutants (detailed de scription in Chapter 3) were constructed by (Tucker, 2006) and provided by Dr. Paul Gulig, University of Florida. Motility Test of V. vulnificus Strains V. vulnificus flagella mutant strains used in this study were either defective in motility or were non-motile (Tucker, 2006). The V. vulnificus rugose strain is also reported to possess a polar flagellum, but has relatively reduced motility as compared to the opaque and translucent strains (Grau et al., 2005). Therefore, to compare the relative motility of V. vulnificus strains, the motility agar test was performed on the strains as shown in Table 6-1. Results from motility test were in agreement with (Grau et al., 2005), and showed the reduced motility of rugose strain, as compared to the encapsulated opaque strain. The motility of rugose was also found to be similar to that of the flagella mutant strain flaCDE The flagella mutant flaCDE flaFBA strain, which lacks flagella showed the least motility as e xpected due to the deletion of all six flagellar genes. The flagellated strain, FLA( motAB ), showed comparatively le ss motility than the wild type strain, due to the deletions in genes that encode flagellar propulsion, as described by (Grau et al., 2005) Motility-deficient strains were assayed for surv ival in oysters using the oyster model of infection. As shown in Figure 6-1, the survival of non-flagellated V. vulnificus double mutant

PAGE 71

71 strain fla CDE flaFBA was significantly lower in artificially inoculated oysters as compared to the wild type CMCP6 strain (p= 0.03). However, the survival of V. vulnificus deletion mutant flaCDE and flagellar motor mutant ( motAB ) strain was not different from the wild type CMCP6 strain. Additionally, no significan t differences were found in the levels of above mentioned flagella mutants in artificial seawater (ASW) as compared to the levels of the wild type strain. V. vulnificus rugose strain showed similar motility to flaCDE mutant strain and was also found in significantly lower levels in oysters (p=0.005), but the le vels of rugose were higher in the ASW as compared to the wild type strain (p=0.03). These results differed from flagellated mutants with defective motility i.e. no significant difference was found in flaCDE and FLA( motAB ) mutant strain, as compared to the wild type strain, suggesting that motility is not the only reason for low levels of rugose V. vulnificus in oysters. Furtherm ore, unlike rugose, these strains did not show increase in number s in ASW. On the othe r hand, the loss of both flagella and motility ( flaCDE flaFBA ) resulted in significant decrease in survival of vulnificus in oysters, Figure 6-1. Distribution of V. vulnificus Flagella Mutants in Oyster Tissues It is possible that flagella and flagella-related motility are important for the dissemination of V. vulnificus to hemolymph and internal organs of oysters. To experimentally examine the distribution of V. vulnificus in the hemolymph, gills and dige stive tract were dissected and examined for distribution of V. vulnificus flagella and motility mutant strains. Results showed that the wild type encapsulated strain (CMCP6) su rvived better in the he molymph of oysters as compared to all the three V. vulnificus flagella mutants. As shown in Figure 6-2, significant differences were found in th e survival of wild type V. vulnificus in the hemolymph of oysters as compared to that of fla CDE FLA ( motAB ) and flaCDE flaFBA mutant strains (p=0.04, p=0.04 and p=0.02 respectively).

PAGE 72

72 Significant differences found in the survival of flaCDE FLA( motAB ) and flaCDE flaFBA in the hemolymph of the oyster as compared to the wild type strain suggests that expression of flagella and flagellar motility are important for the dissemination of V. vulnificus to the hemolymph of oysters. However, the survival of all three flagella mutants, such as flaCDE FLA ( motAB ) and flaCDE flaFBA did not differ from the wild t ype CMCP6 strain in the gills and digestive tract of the oyster. These results in dicate that expression of flagella and flagella related motility may not contribute to the initial at tachment of bacteria to the digestive tract and the gills of the oyster but may be important in dissemination of bacteria to hemolymph. On the other hand, V. vulnificus rugose, which showed similar motility to flaCDE mutant strain, was found to be in significantly lower leve ls in both the hemolymph and the gills of the oyster, but the levels of this bact erium did not differ in intestines (C hapter 4). This contrast in the survival of the rugose strain with the flagella mutant strain ( flaCDE ) indicates that reduced motility is not the sole contributing factor toward s the lower levels of rugose in the whole oyster and oyster tissues. These data s upport the hypothesis that perhaps the altere d expression of the rugose phenotype and the CPS may be related to the lower level of this bacterium in oysters.

PAGE 73

73 Table 6-1. Relative motility of V. vulnificus strains Strainsa Diameter in motility agar (cm)b MO6-24/O (Opaque) 3.8 0.3 CMCP6 3.7 0.2 Rugose 2.5 0.3 FLA677 ( flaCDE ) 2.1 0.3 FLA 711 ( flaCDE flaFBA ) 0.7 0.2 FLA 674 ( motAB ) 1.0 0.4 a V. vulnificus strains used in this study are described in Chapter 3. b V. vulnificus strains were stabbed into th e motility agar and the diameter of rings of growth after overnight incubation in motility agar at 37oC was measured. Results are based on mean of duplicate experiments.

PAGE 74

74 0.0 1.0 2.0 3.0 4.0 5.0 6.0 7.0 ControlCMCP6 flaCDE flaCDE flaFBA motAB V. vulnificus Flagella mutantsBacterial content in oysters (Log CFU/g) Total Bacteria in Oysters (LA) V.vulnificus in oysters (mCPC) V.vulnificus in water (mCPC) Figure 6-1. Recovery of V. vulnificus flagella mutants in oysters. Survival of V. vulnificus flagella mutants in oysters were examin ed, 24 hours post inoculation, on LA and mCPC. Un-inoculated oysters were used as control for this study. Asterisk denotes significant (p<0.05) difference in the recovery of wild type CMCP6 strain in oysters as compared to the V. vulnificus ( flaCDE flaFB A) strain using Students t-test (p=0.03). Results are based on the means of tr iplicate experiments using data from six individual oysters in each experiment. *

PAGE 75

75 0.0 0.5 1.0 1.5 2.0 2.5 3.0 ControlCMCP6 flaCDE flaCDE flaFBA motAB V. vulnificus flagella mutantsV. vulnificus content in oysters (Log CFU/g) V.vulnificus in hemolymph (mCPC) V.vulnificus in gills (mCPC) V.vulnificus in digestive tract(mCPC) Figure 6-2. Distribution of V. vulnificus flagella mutants in oyster tissues. Hemolymph, gills and the intestine of oysters were ex amined for the distribution of V. vulnificus in oyster tissues, 24 hours post inoculation. Asterisk denotes significant (p<0.05) difference in survival of CMCP6 strain in the hemoly mph of the oysters as compared to the V. vulnificus flaCDE motAB and flaCDE flaFBA mutants using Students t-test, (p= 0.04, 0.04 and 0.02 respectively). Results are based on the me ans of triplicate experiments using data from six indi vidual oysters in each experiment. *

PAGE 76

76 CHAPTER 7 DISCUSSION AND CONCLUSION Vibrio vulnificus naturally inhabits in warm estuar ine environments, possibly existing in mutual association with molluscan shellfish such as oysters (Tamplin and Capers, 1992; HarrisYoung et al., 1993; Harris-Young et al., 1995). Envir onmental factors favoring the growth of this bacterium are low salinity levels (7-21 ppt) and warmer water temperatures (Kelly, 1982; Kaspar and Tamplin, 1993). Occurrence of V. vulnificus has been positively correlated with warm water temperature (Kelly, 1982; Kelly and Dinuzzo, 1985; Murphy and Oliver, 1992; Wright et al., 1996; Motes et al., 1998), which is also linked with an increase in V. vulnificus related illnesses (CDC, 1993; Hlady et al., 1993; CDC, 1996; Hl ady and Klontz, 1996; FDA, 2003; CDC, 2005b, a). Vibrios attach to plankton found in th e estuarine environment. Filt er-feeding shellfish such as oysters ( Crassostrea virginica ) feed on plankton including bacter ia, and concentrate the bacteria in their tissues (Blake, 1983; Tamplin a nd Capers, 1992; Harris-Young et al., 1993; HarrisYoung et al., 1995). Raw oysters contaminated with this bacterium act as a vector of V. vulnificus infections in humans, partic ularly as a result of consum ption of raw oysters harvested from warm waters in the Gulf of Mexico (K elly and Dinuzzo, 1985; Hl ady et al., 1993; CDC, 1996; FDA, 2003; CDC, 2005b). This research study examined the possi bility that surface structures of V. vulnificus may provide an adaptation for increased survival of this bacterium in their environmental oyster reservoir. Bacterial surface structure such as cap sular polysaccharide (CPS), pili and flagella can help anchor the bacterium to nutrient-rich surf aces of the host and may also provide protection against the host defense mechanisms by avoidi ng the phagocytosis (H arris-Young et al., 1995). These functions can lead to an increased endurance of V. vulnificus in the oyster host and,

PAGE 77

77 subsequently may facilitate human infection by increasing bacterial contamination of food intended for human consumption. Surface structures of V. vulnificus also contribute to biofilm formation and increased survival under hostile environmen ts. Capsular polysaccharide in V. vulnificus inhibits in vitro biofilm formation (Joseph and Wright, 2004), but it appears to be important for the survival of V. vulnificus in oyster hemocytes (Harris-Young et al., 1993; Harris-Y oung et al., 1995). Expression of pilD and pilA are important for the persistence of V. vulnificus in American oysters (Paranjpye et al., 2007). Other stud ies have focused on the role of V. vulnificus flagella and flagellar motility in biofilm formation and vi rulence in mouse model (Kim 2003; Lee et al., 2004). However, the role of these structures in the survival of V. vulnificus in oysters has not been established. Therefore, this research study was conducted to gain better understanding on the contribution of these surface st ructures to the survival of V. vulnificus in oysters. Presence of indigenous V. vulnificus in oysters can complicate the in vivo investigation, particularly during summer months when V. vulnificus levels may approach or exceed to 105 bacteria per gram of oyster meat (Kelly, 1982; Ol iver et al., 1983; Oliver 1989; Wright et al., 1996; Motes et al., 1998). Ther efore, to facilitate the in vivo examination of V. vulnificus in their environmental reservoir of disease, an oyster model of infection that utilizes antibiotic treatment was developed. V. vulnificus is particularly sens itive to tetracycline (T C) (Bowdre et al., 1983); therefore, oysters were bathed overnight in diffe rent concentrations of TC. Subsequently, the TC treated oysters were transferred to fresh artificial seaw ater with overnight ch arcoal filtration to remove residual antibiotic. Data showed that the reduction of V. vulnificus levels in oysters was accomplished with an increase in concentr ation of TC. The greatest reduction in V. vulnificus levels was seen with TC concentration of 5g/ mL. However, the bacterial recovery post TC

PAGE 78

78 treatment at 5g/mL was significantly reduced, presumably due to the excess accumulation of TC in the oyster tissues, leading to inhibition of V. vulnificus recovery in oysters. Therefore, TC concentration of 2g/mL was used as optimum concentration for V. vulnificus reduction and was shown to maintain low V. vulnificus levels in oysters after 24, 48 and 72 hours of post TC treatment. These data showed that TC was effective in reducing the V. vulnificus levels in oysters and facilitating in vivo experimental assays. Environmental conditions, such as water temp erature, play an important role in the proliferation of V. vulnificus in molluscan shellfish and their na tural surroundings. The levels of V. vulnificus are lower during winter months as compar ed to summer months (Oliver et al., 1983; Kaspar and Tamplin, 1993; Cook, 1994; Wright et al., 1996; Motes et al., 1998). Treatment of oysters with TC reduced both th e total bacterial count and the V. vulnificus counts in oysters, but it is possible that it may have additional cons equences that could alter the outcome of experiments. Therefore, different V. vulnificus strains were evaluated for their survival in oysters with or without TC treatment, using winter oys ters that had a natural reduction of bacteria. Statistical analysis on the survival of both the total bacteria and V. vulnificus recovered from oysters using winter oysters reve aled no significant differences as a consequence of TC treatment for any of the V. vulnificus strains that were tested. Additionall y, bacterial contents in TC-treated summer oysters did not differ from bacterial levels found in winter oysters. Therefore, these data imply that antibiotic treatment of oysters artificially simulates the bacterial content similar to that of winter oysters, providing a model for in vivo mutational analysis of V. vulnificus in oysters. The role of capsular polys accharide in survival of V. vulnificus in oysters was verified using the oyster model of infection. The surv ival of the encapsulated opaque strain was

PAGE 79

79 consistently higher than the CPS deletion mutant ( wzb ) and translucent phase variant (T1) in oysters at 24 hours post inoculat ion. Significant differences were noted in the survival of CPS deletion mutant (T2) as compared to the wild type encapsulated opaque strain. However, the partially encapsulated CPS translucent phase vari ant did not differ significantly from the wild type strain. Thus, the data s uggest that degree of encapsulation contributes to the survival of V. vulnificus in oysters. Alternatively, the instability of translucent phase variants may have caused the switching of cells to the more resistant opaque phenotype. Survival of the rugose phenotype was found to be significantly lo wer in oysters as compared to the wild type strain. On the othe r hand, high levels of rugose were recovered from artificial seawater. These data propose the possibility that the type of CPS may be related to the lower survival of rugose st rain in oysters as well as to the hi gher survival of rugose strains in artificial seawater. Differen ces in the composition of CPS have been reported for V. vulnificus and rugose V. cholerae that may explain the observed discrepancie s in the survival of rugose and opaque strains in oysters. A higher net negative charge on the cell surface due to polysaccharide capsule results in a greater degr ee of resistance to phagocytosis as reviewed by (Roberts, 1996). Biochemical analysis of Group 1 CPS revealed that V. vulnificus MO6-24 produces highly charged and acidic CPS (uronic acid), and is compos ed of four sugar residu es three residues of 2acetomido-2, 6dideoxyhexopyranose and one resi due of 2-acetomido hexouronate (Reddy et al., 1992; Hayat et al., 1993). On the other hand, the polysaccharide structure of rugose V. cholerae EPS is composed of neutral sugars (glu cose and galactose) that are more hydrophobic (Yildiz and Schoolnik, 1999; Ali et al ., 2002) in contrast to the hydrophilic V. vulnificus CPS (Reddy et al., 1992; Hayat et al., 1993; Wright et al., 1999). The E PS of the rugose phase variant of V. cholerae O1 TSI-4 contains N-acetyl-D-glucosamine, D-mannose, 6-deoxy-D-galactose,

PAGE 80

80 and D-galactose and contains e qual amounts of 4-linked galactos e and 4-linked glucose (Yildiz and Schoolnik, 1999). It is likel y that hydrophobic EPS produced by wrinkled rugose colonies promote cell aggregation, leading to the attach ment of bacteria to one another in the ASW medium; however, this aggregation may inhib it uptake by oyster or enhanced degradation by hemocytes. Therefore, the differences in the polysaccharide composition of V. cholerae rugose may provide clues to increased survival of opaque V. vulnificus in oysters, as well as the increased numbers of rugose strains in seawat er. Unfortunately, the composition of rugose in V. vulnificus has not been determined, and further inve stigation will be required to understand the role of polysaccharide in surv ival of rugose in oysters. The survival of CPS mutant and phase varian ts was also examined for persistence at extended inoculation up to 24, 48 and 72 hours in whole oysters. In agreement with the results at 24 hours post inoculation, the survival of encap sulated opaque strain was always highest as compared to other CPS phase variants and mutants of V. vulnificus and the translucent phase variant did not differ significantly from the wild type opaque strain at any of the extended inoculation time. Survival of the opaque strain was always significan tly higher than the CPS ( wzb ) deletion mutant at 24, 48 and 72 hours of ex tended inoculation peri ods. The rugose phase variant also differed significantl y at 24 and 48 hours of extended inoculation but did not differ from the opaque, after 72 hours post inoculation. A possible expl anation for this lack of significant difference at this time point could be that the initial concentration of rugose cells in oysters was so low as compared to the opaque strain that further re duction by oyster defense mechanism was not possible or the surviving rugo se cells were better adapted to survive and resist further destruction. Altern atively, survival of rugose strain in oysters could be enhanced

PAGE 81

81 after extended inoculation by con tinued seeding from their relative ly high numbers surviving in the seawater. Molluscan shellfish such as oysters are filter feeders accumulate indigenous bacteria attached to plankton or algae and concentrate the bacteria in their tissues (Kumazawa, 1991; Hood, 1997; Maugeri et al., 2006) To determine the distribution of V. vulnificus in oyster tissues, hemolymph, intestines and gills of oyste rs were examined. Data consistently showed increased survival of encapsulated opaque in hemolymph of oysters as compared to V. vulnificus CPS deletion ( wzb ) mutant and rugose phase variant. Howe ver, there were no differences in the survival of CPS V. vulnificus strains in the intestinal tract of th e oyster. Only rugose and CPS deletion mutant were found to be deficient in at tachment to the oyster gi lls. These data suggest that CPS contributes to the attachment of V. vulnificus in the gills but not the gut and is required for the dissemination of the bacteriu m to the hemolymph of the oyster. Phase variation has been observed in many b acteria by different surface structures and involves capsule, pili, fimbriae, and outer membrane proteins th at can be recognized by their effect on colony morphology, as reviewed by (van der Woude and Baumler, 2004). Phase variation in V. vulnificus is exhibited by changes in colony morphology that reflect alteration of CPS surface expression. V. vulnificus phase variation is marked by reversible changes in colony morphology such as opaque (encapsulated, viru lent) versus translucent (decreased CPS, attenuated virulence) and smooth versus rugos e (wrinkled) phenotype (Wright et al., 1999; Wright et al., 2001; Grau et al ., 2005; Chatzidaki-Livanis et al., 2006; Hilton et al., 2006). In a recent study, an irreversible deletion mutation in V. vulnificus CPS operon was reported. MO624/ wzb is a result of a deletion mutation of wzb in the group 1 CPS operon, thus locking the cell in a translucent phase that is un able to revert to opaque morp hotype (Chatzidaki-Livanis et al.,

PAGE 82

82 2006). To examine the phase variation in oysters, V. vulnificus strains recove red after oyster passage were monitored for changes in th e colony morphology on LA plates. Results demonstrated that the opaque strain maintain ed a stable phenotype, while the translucent and rugose phase variant switched to the opaque morphotype at a high fr equency (72 and 100%, respectively) following oyster inf ection. Moreover, rugose strains were unstable on LA plates and after extended incubation of rugose cells on LA for additional 24 hours (total of 48 hours), atypical opaque colonies were observed or the cel ls reverted back to the rugose (wrinkled) morphotype. V. vulnificus isolates from the water sample s contrasted greatly from those recovered for oysters. No cha nges in the colony morphology of V. vulnificus strains were observed in any of isolate recovered from the AS W. Thus, phase variation was specific to oyster passage and did not occur in cells that remained in seawater. In order to experimentally confirm this pha se variation, a growth plasmid (pGTR902) was introduced into V. vulnificus translucent strain to track the growing population during oyster infection. Results showed that approximately 72% cells that were initiall y translucent contained the growth plasmid now formed opaque colonies on solid medium when recovered from oysters, which conformed that phase variation from tr anslucent to opaque phenotype had occurred in vivo The growth plasmid was also used to monitor the killing proportion of the translucent cells. Results showed that only about 1 Log CFU/mL of the translucent inoculum died during oyster passage, indicating that phase varia tion rather than die off of translucent cells in the oysters was primarily responsible for appearance of opaque cells. Overall, these data confirmed the phase variation of V. vulnificus translucent to opaque phenotype in oysters. Formation of biofilm and attachment of microbial communities to the nutrient-rich surfaces serve as a survival mechanism for bact eria in adverse environments, as reviewed by

PAGE 83

83 (Davey and O'Toole G, 2000). Although, expression of group 1 CPS in V. vulnificus inhibits the in vitro biofilm formation, results from this study showed that it promotes survival of V. vulnificus in oysters. Thus, it is possible that some facets of in vitro biofilm formation may be independent of in vivo survival of this bacterium. Unlike group 1 CPS, other capsular types are associated with the formation of biofilm, which are marked by rugose or wrinkled colonies in V. cholerae (Watnick et al., 1999; Y ildiz and Schoolnik, 1999) and V. vulnificus (Grau et al., 2005). Comparing the survival of V. vulnificus CPS mutants and phase vari ants in oysters, it was found that among all the strains examined, rugose strain showed least survival in the oysters. On the other hand, rugose was found in significantly higher concentrations in ASW samples. These data imply that the rugose strains are probably better adapted for increased survival in sea water as compared to the oysters and that in vivo survival of V. vulnificus in oysters is not dependent in biofilm formation. Pili are important for survival of bacteria in biofilm formation and oysters (Paranjpye and Strom, 2005; Paranjpye et al., 2007) and it is possible that they ar e likely to contribute towards dissemination of V. vulnificus to the internal tissues of oysters. Therefore, the ro le of type IV pilus in the survival of V. vulnificus in oysters was investigated. V. vulnificus pilA deficient in adherence to epithelial cells, biofilm formation a nd virulence in animal models (Paranjpye and Strom, 2005), was used in this st udy. A double deletion mutant of MO6-24 / pilA with deletions in pilA and wzb was constructed in this study to evaluate the addi tive roles of pilA and encapsulation ( wzb ) in survival of V. vulnificus in oysters. Results showed that the survival of wild-type encapsulated strain was significantly higher than that of V. vulnificus pili mutant strains. These findings were in agreement w ith (Paranjpye et al., 2007) that deletion of pilD and pilA genes significantly reduced the ability of V. vulnificus to colonize and persist in oysters. The

PAGE 84

84 additive effects of pili and en capsulation in the survival of V. vulnificus in oysters were evidenced by the lower survival of V. vulnificus pilA wzb double mutant in oysters as compared to the single deletion mutants of V. vulnificus Significantly higher amounts of pilA and pilA wzb mutants were found in ASW samples as co mpared to the wild type, similar to observations regarding rugose st rain, which indicated that in vitro biofilm formation was independent of survival of these bacteria in oysters. Distribution of V. vulnificus pilA mutants was also examined in the hemolymph, gills and intestines of the oyster. Results showed signifi cantly higher levels of th e encapsulated wild-type strain in the hemolymph of oyste r as compared to levels of pilA and pilA wzb double mutant. Compared to the double pilA wzb mutant, opaque strain was reco vered in significantly higher levels from the gills; however, the pilA mutant did not differ from the wild type strain. Additionally, no significant differences were seen in the distribution of V. vulnificus opaque, pilA and pilA wzb double deletion mutants in the intestinal tract of oyster. Based on these results, it can be concluded that although the expression of pilA and capsule may not be important for the initial attachment in the gut they contribute towards the dissemination of V. vulnificus to the hemolymph of oyste r. Furthermore, this stu dy again confirmed that the expression of CPS is also important for the distribution of V. vulnificus in the gills of the oyster. In a natural environment, bacteria compete w ith each other for attach ment to nutrient rich surfaces for enhanced survival. In this regard, in vivo competition studies can indicate the fitness for survival of different bacter ia in host. Experiments were co nducted to confirm the enhanced survival of wild type V. vulnificus as compared to the CPS deletion mutant and the pili double deletion mutant in oysters. Therefore, oysters were incubated with the mixed cultures of V. vulnificus opaque and CPS mutant ( wzb ) or opaque and pilA wzb double deletion mutant.

PAGE 85

85 Both of these wzb deletion mutants are locked in the tran slucent phase, therefore, examination of colony morphology was used as a marker to di stinguish these mutant s from wild type (Chatzidaki-Livanis et al., 2006). Results revealed that majority of strains recovered from the oysters were always encapsulat ed opaque strain, and only 25-30% of colonies recovered were translucent. Results also showed that the re covery of the double deletion mutant was further reduced as compared to the single deletion mutant, which also confirmed that the additive effects of pilA and wzb contributes to the enhanced survival of V. vulnificus in oysters. V. vulnificus rugose strain is relatively less motile than either opaque or translucent phase variant, but yet possesses a polar flagellum (Gra u et al., 2005). Therefore, it is possible that reduced motility of the rugose strain resulted in the lower levels of this strain in oysters, as motility also contributes to biofilm formati on and invasion of host tissues (McCarter, 2001; Harshey, 2003). V. vulnificus possesses six flagellin structural genes flaA, flaB, flaF, flaC, flaD and flaE organized in two distin ct genetic loci, namely flaFBA and flaCDE (Tucker, 2006). To examine the role of motility in the uptake and survival of V. vulnificus in oysters, flagella mutant strains were tested using the oyster model of infection. Results from survival of V. vulnificus flagella mutants in oysters showed that the survival of the double deletion mutant ( flaCDE flaFBA ), lacking all flagella genes, was si gnificantly lower than the wild type CMCP6 strain in the whole oyster preparation. Howe ver, the survival of flagella mutant strain with defective flagella and reduced motility ( flaCDE ), or the strain with no flagellar motor components ( motAB ), did not differ from the wild type in whole oyster preparations. A similar conclusion was also reported by Lee et al ., 2004, as flagellum-deficient and non-motile V. vulnificus mutant ( flgE gene, encoding the flagellar hook prot ein), showed decreased virulence in iron dextran-treated mice, defect in adherenc e to the cells, and less biofilm formation on a

PAGE 86

86 polystyrene surface. Flagella mutant strain s were also analyzed for distribution of V. vulnificus in the hemolymph, gills and the digestive tract of the oyster. Data showed significantly higher survival of V. vulnificus wild type strain as compared to all flagella mutant strains in the hemolymph of the oyster. However, the distributi on of flagella mutants did not differ from the wild type strain in gills and th e digestive tract of oysters. Over all, these results suggest that motility or flagella may not be a contributing factor to the initial attachment of V. vulnificus in oyster tissues, but expressions of both is probably important for the survival and dissemination of V. vulnificus to the hemolymph of oysters. Comparative analysis on the motility of all the V. vulnificus strains examined, revealed that the motility of rugose was similar to the single gene locus deletion flagella mutant ( flaCDE ), but data for survival of flaCDE mutant strain in whole oysters differed greatly from the survival of rugose V. vulnificus in oysters The rugose phase variant showed lower survival in oysters but was found to be in greatest number in seawater. On the other hand, the flaCDE mutant did not differ from wild type in eith er seawater or oysters. More over, rugose was also found in significantly lower levels than the wild type in oyster gills, but the survival of the flagellar ( flaCDE ) deletion mutant was not significantly different in the gills as compared to the wild type. Therefore, it can be concluded that reduced motility of rugose was not the only sole factor contributing to the outcome of this strain in oysters. Further, it is likely that an alternate composition of rugose CPS, reported for V. cholerae (Yildiz and Schoolnik, 1999), could be related to the lower surviv al of rugose in oysters. However, it is difficult to sort out the contribution of flagella to attachment versus motility in the mutational analysis employed in this study, as loss of ligand also results in loss of motility. V. vulnificus express H antigen in the core proteins of the polar flagella, and an anti-flagellar

PAGE 87

87 (anti-H) antibody is produced in rabbits immunized with flagella r core protein prepared from V. vulnificus (Simonson and Siebeling, 1986). Therefore, additional experiments utilizing antibody to block attachment to oyster would be useful in drawing conclusions about the role of flagella in attachment versus motility and subsequently interactions within the oyster tissues. Furthermore, oysters are filter-feeders and use their gills to filter particles out of the water. Through the beating of cilia on the gills, water currents are generated and the gills transport water and planktons towards the mouth. Therefore, it is also possible that the action of oyster filtration was contributing greatly towards the uptake of V. vulnificus flagella mutants in oysters, and the contribution of bacterial motility may be minor compared to the filtering activity of the oyster. In conclusion, this research study demonstrated the contribution of surface structures in the survival of V. vulnificus in their molluscan shellfish host, Crassostrea virginica V. vulnificus attaches to plankton in seawater, and oysters ar e bivalve mollusks that feed by filtering water and plankton, ingesting bacteria and co ncentrating in the tissues (Ma ugeri et al., 2006). Bacteriolytic, heat stable lysozyme is present in the hemoly mph of oysters (McDade, 1967a), which provides active defense against bacter ia (Rodrick, 1974). However, V. vulnificus disseminates in the hemolymph and concentrates in oyster tissues (Kennedy, 1999), possibly by avoiding the lysis by lysozyme. Little is known about the biology of V. vulnificus in oyster survival, but studies have reported that expression of V. vulnificus CPS provides resistance to phagocytosis and degradation by oyster hemocytes (H arris-Young et al., 1995). It has been shown that a protease from the oyster parasite Perkinsus marinus may inhibit the phagocytic function of oyster hemocytes (Tall et al., 1999). More recently, it has been reported that expression of pilD and pilA is important for persistence of V. vulnificus in oysters (Paranjpye et al., 2007). The present study

PAGE 88

88 provides evidence that surface structures of V. vulnificus may also have important roles in survival of this bacterium in the oyster host. Survival of bacteria in ho stile environments has been studied in extensively detail in vitro Formation of biofilms requires a cooperative effort by surface structures of bacteria such as flagella, pili, outer membrane pr oteins, and EPS. Results from this research study suggest that surface structures of V. vulnificus that are involved in biofilm fo rmation and virulence contribute differentially towards the survival of V. vulnificus in oysters. The survival strategy of V. vulnificus in oysters appears to be multi-factorial. The expression of capsular polysaccharide, pili, and flagella together with motilit y, are all important for survival of V. vulnificus in the environmental reservoirs of the disease. As evidenced by lower survival of V. vulnificus pil wzb double mutant in oysters, it can be concluded that surface structures of V. vulnificus put together an additive effort to fight the defense mechanism of oysters, leading to increased endurance in their oyster host. Although CPS expression of V. vulnificus inhibits the biofilm formation (Joseph and Wright, 2004), results from this study showed that it is important for the survival of this bacterium in oysters. Theref ore, it can be concluded that some facets of in vitro biofilm formation may be different from in vivo survival of V. vulnificus in oysters. On the other hand, expression of pili, flagella and flagellar motility, that are importa nt surface structures contributing to the biofilm formation (Lee et al., 2004; Paranjpye and St rom, 2005; Lee et al., 2006), also appears to be im portant for survival of V. vulnificus in oysters. Studies have reported occurrence of vast genetic variation among the stains of V. vulnificus. It has also been shown that individual oyster can ha rbor numerous genetically divergent V. vulnificus strains (Buchrieser et al., 1995). However, most of the strain s isolated from environmental reservoir appear to be encapsu lated and are virulent as clinical strains in

PAGE 89

89 animal models (Tison and Kelly, 1986; Simpson et al., 1987; Tilton and Ryan, 1987; Wright et al., 1996; DePaola et al., 2003). Evaluation of environmental strains recovered from the Chesapeake Bay also showed only encapsulated op aque phenotype (Wright et al., 1996). Results from this study showed that encapsulation contribu tes to the increased survival of this bacterium in the mixed V. vulnificus culture, supporting the hypothesis that CPS expression determines the enhanced survival of V. vulnificus in its environmental reservoir. This is the first study to demons trate that phase variation of V. vulnificus CPS occurs within the oyster host. Phase-variable surface structure of V. vulnificus such as capsular polysaccharide can play a role in the adaptation of bacteria to adverse conditions in the host (Henderson, 1999; van der Woude and Baumler, 2004; Chatzidaki-Livanis et al., 2006). As compared to the translucent phase variant, the encapsulated opaque V. vulnificus appears to be better adapted for survival in oysters, due to it s ability to avoid host im mune responses (HarrisYoung et al., 1995). On the other hand, translucent cells may be better adapted for survival in aquatic medium through enhanced biofilm forma tion (Joseph and Wright 2004). It is possible that V. vulnificus translucent cells attached to plankton, contribute the uptake and concentration of V. vulnificus in oysters during filter-feeding. Once inside the oyster, translu cent cells are likely to switch back to the opaque phenotype. This phase variation of translucent cells to opaque cells provides a survival strategy for V. vulnificus and a possible explanation as to why the majority of the strains isolated from raw oysters are always encapsulated and virulent. Therefore, susceptible individuals who consume raw oysters are more li kely to encounter the pathogenic opaque form of V. vulnificus that can lead to V. vulnificus disease. This research study de scribes the role of V. vulnificus surface structures for increased survival in their molluscan shellfish host. U nderstanding the parameters that influence the

PAGE 90

90 survival of V. vulnificus in their environmental reservoir is vital. Better unde rstanding of these parameters can help in developing improved post-harvest processes, which will effectively reduce the level of V. vulnificus in edible oyster, and therefore, reduce the risks of seafood borne disease in humans.

PAGE 91

91 LIST OF REFERENCES Ali, A., Rashid, M.H., and Karaolis, D.K.R. (2002) High-Frequency Rugose Exopolysaccharide Production by Vibrio cholerae Appl Environ Microbiol 68 : 5773-5778. Altekruse, S.F., Cohen, M.L., and Swerdlow D.L. (1997) Emerging Foodborne Diseases. Emerg Infect Dis. 3 Amako, K., Okada, K., and Miake, S. (1984) Evidence for the presence of a capsule in Vibrio vulnificus J Gen Microbiol. 130 : 2741-2743. Blake, P.A. (1983) Vibrios on the half shell: what the walrus and the carpenter didn't know. Ann Intern Med 99 : 558-559. Blake, P.A., Merson, M. H., Weaver, R. E., Ho llis, D. G., and Heublein, P. C. (1979) Disease caused by a marine Vibrio. Clinical characteristics and epidemiology. N Engl J Med 300 Bowdre, J.H., Hull, J.H., and Cocchetto, D.M. (1983) Antibiotic efficacy against Vibrio vulnificus in the mouse: superi ority of tetracycline. J Pharmacol Exp Ther 225 : 595-598. Buchrieser, C., Gangar, V.V., Murphree, R.L., Ta mplin, M.L., and Kaspar, C.W. (1995) Multiple Vibrio vulnificus strains in oysters as demonstrated by clamped homogeneous electric field gel electrophoresis. Appl Environ Microbiol 61 : 1163-1168. Center for Disease Control, CDC (1993) Vibrio vulnificus infections associated with raw oyster consumption--Florida, 1981-1992. MMWR Morb Mortal Wkly Rep 42 : 405-407. Center for Disease Control, CDC (2005) Annual Summaries of Surveillance of Outbreaks of Vibrio infection, 1997 2004. CDC. (2005) Vibrio vulnificus In Technical information. Coordinating Center for Infectious Diseases / Division of Bacterial and Mycoti c Diseases: Centers for Disease Control and Prevention. Chatzidaki-Livanis, M., Jones, M.K., and Wr ight, A.C. (2006) Genetic variation in the Vibrio vulnificus group 1 capsular polys accharide operon. J Bacteriol. 188 : 1987-1998. Chiavelli, D.A., Jane, W. M., and Ronald, K. T. (2001) The Mannose-Sensitive Hemagglutinin of Vibrio cholerae Promotes Adherence to Zooplankton. Appl Environ Microbiol. 67 : 3220 Davey, M.E., and O'Toole, G. A. (2000) Microbial biofilms: from ecology to molecular genetics. Microbiol Mol Biol Rev 64 : 847-867. DePaola, A., Nordstrom, J.L., Dalsgaard, A., Fo rslund, A., Oliver, J., Ba tes, T. et al. (2003) Analysis of Vibrio vulnificus from market oysters and se pticemia cases for virulence markers. Appl Environ Microbiol 69 : 4006-4011.

PAGE 92

92 Drake, S.L., Elhanafi, D., Bang, W., Drake, M.A., Green, D.P., and Jaykus, L.A. (2006) Validation of a green fluorescen t protein-labeled strain of Vibrio vulnificus for use in the evaluation of postharvest strategi es for handling of raw oysters. Appl Environ Microbiol 72 : 7205-7211. Drummelsmith, J., and Whitfield, C. (1999) Gene products required for surface expression of the capsular form of the group 1 K antigen in Escherichia coli (O9a:K30). Mol Microbiol 31 : 1321-1332. Farmer, J.J., (1979) Vibrio ("Beneckea") vulnificus the bacterium associated with sepsis, septicaemia, and the sea. Lancet 2 : 903. Food and Drug Administration FDA (1995) Procedures for the safe and sanitary processing and importing of fish and fishery products. Federal Register 60 : 6509665186. Gander, R.M., and LaRocco, M.T. (1989) Detecti on of piluslike structures on clinical and environmental isolates of Vibrio vulnificus J Clin Microbiol. 27 : 1015-1021. Genthner, F.J., Volety, A.K., Oliver, L.M., and Fisher, W.S. (1999) Factors influencing in vitro killing of bacteria by hemocy tes of the Eastern oyster ( Crassostrea virginica ). Appl Environ Microbiol 65 : 3015-3020. Grau, B.L., Henk, M.C., and Pettis, G.S. (2005) High-frequency phase variation of Vibrio vulnificus 1003: isolation and characterizat ion of a rugose phenotypic variant. J Bacteriol 187 : 2519-2525. Gulig, P.A., Bourdage, K.L., and Starks, A.M. (2005) Molecular Pathogenesis of Vibrio vulnificus J Microbiol 43 Spec No: 118-131. Harris-Young, L., Tamplin, M.L., Mason, J.W., Aldric h, H.C., and Jackson, J.K. (1995) Viability of Vibrio vulnificus in association with hemocy tes of the American oyster ( Crassostrea virginica ). Appl Environ Microbiol 61 : 52-57. Hayat, U., Reddy, G.P., Bush, C.A., Johnson, J.A ., Wright, A.C., and Morris, J.G., Jr. (1993) Capsular types of Vibrio vulnificus : an analysis of strains from clinical and environmental sources. J Infect Dis 168 : 758-762. Henderson, I.R., Owen, P., and Natraro, J.P. (19 99) Molecular switches the ON and OFF of bacterial phase variation. Mol Microbiol 33 : 919-932. Hlady, W.G., Mullen, R.C., and Hopkin, R.S. (1993) Vibrio vulnificus from raw oysters. Leading cause of reported deaths from foodborne illness in Florida. J Fla Med Assoc. 80 : 536-538. Hollis, D.G., Weaver, R.E., Baker, C.N., and Thornsberry, C. (1976) Halophilic Vibrio species isolated from blood cultures. J Clin Microbiol 3 : 425-431.

PAGE 93

93 Hollis., R. (1987) Vibrio vulnificus Infect Control 8 : 430-433. Hood, M.A., and Winter, P. A. (1997) Attachment of Vibrio cholerae under various environmental conditions and to selected substrates. FEMS Microbiol Eco. 22 : 215-223. Jones, M.K. (2006) Regulatin of phase variation and deletion mutation in the Vibrio vulnificus group 1 CPS operon. In Food Science and Huma n Nutrition. Gainesvi lle: University of Florida. Joseph, L.A., and Wright, A.C. (2004) Expression of Vibrio vulnificus capsular polysaccharide inhibits biofilm formation. J Bacteriol. 186 : 889-893. Kaspar, C.W., and Tamplin, M.L. (1993) Effects of temperature and salinity on the survival of Vibrio vulnificus in seawater and shellfish. Appl Environ Microbiol 59 : 2425-2429. Kennedy, V.S., Newell, R.I.E., and Eble, A. F. (1999) The Eastern Oysters. Crassostrea virginica : Maryland Sea Grant College, University of Maryland system, College Park. Kim YR, L.S., Kim, C.M., Ki m, S.Y., Shin, E.K., Shin, D.H., Chung, S.S., Choy, H.E., Progulske-Fox A., Hillman, J.D., Handfield, M ., and Rhee, J.H. (2003) Characterization and Pathogenic significance of Vibrio vulnificus antigens preferentially expressed in septicemic patients. Infect Immun 71 : 5461-5471. Lee, J.H., Rho, J.B., Park, K.J., Kim, C.B., Han, Y.S., Choi, S.H., Lee, K.H., Park, S.J. (2004) Role of flagellum and motility in pathogenesis of Vibrio vulnificus Infect Immun 72 : 4905-4910. Lee, J.H., Kim, M.W., Kim, B.S., Kim, S.M ., Lee, B.C., Kim, T.S., and Choi, S.H. (2007 ) Identification and characterization of the Vibrio vulnificus rtxA essential for cytotoxicity in vitro and virulence in mice. J Microbiol 45 : 146-152. Lee, S.E., Kim, S.Y., Jeong, B.C., Kim, Y.R., Bae, S.J., Ahn, O.S. Lee, J.J., Song, H.C., Kim, J.M., Choy, H.E., Chung, S.S., Kweon, M.N, Rhee, J.H. (2006) A bacterial flagellin, Vibrio vulnificus FlaB, has a strong mucosal adjuvant activity to induce pr otective immunity. Infect Immun 74 : 694-702. Martin, S.J., and Siebeling, R. J. (1991) Identification of Vibrio vulnificus O serovars with antilipopolysaccharide monoclonal antibody. J Clin Microbiol 29 : 1684-1688. Maugeri, T.L., Carbone, M., Fera, M.T., a nd Gugliandolo, C. (2006) Detection and differentiation of Vibrio vulnificus in seawater and plankton of a coastal zone of the Mediterranean Sea. Res Microbiol 157 : 194-200. McCarter, L.L. (1995) Genetic and molecular characterization of the polar flagellum of Vibrio parahaemolyticus J. Bacteriol 177 : 1595-1609.

PAGE 94

94 McDade, J.E., and Tripp, M.R. (1967a) Lyso zyme in the hemoplymph of the oyster, Crassostrea virginica J Invertebr Pathol 9 : 531-535. McDougald, D., Lin, W.H., Rice, S.A., and Kjelle berg, S. (2006) The role of quorum sensing and the effect of environmental conditi ons on biofilm formation by strains of Vibrio vulnificus Biofouling 22 : 133-144. Oliver, J.D. (2005) Wound infections caused by Vibrio vulnificus and other marine bacteria. Epidemiol Infect 133: 383-391. Paranjpye, R.N., and Strom, M.S. (2005) A Vibrio vulnificus type IV pilin contributes to biofilm formation, adherence to epith elial cells, and virulence. Infect Immun 73 : 1411-1422. Paranjpye, R.N., Johnson, A.B., Baxter, A.E., and St rom, M.S. (2007) Role of type IV pilins of Vibrio vulnificus in persistence in oysters, Crassostrea virginica Appl Environ Microbiol Ran Kim Y., and Rhee, J.H. (2003) Flagellar basa l body flg operon as a virulence determinant of Vibrio vulnificus Biochem Biophys Res Commun. 304 : 405-410. Roberts, I.S. (1996) The biochemistry and ge netics of capsular polysaccharide production in bacteria. Annu Rev Microbiol. 50 : 285-315. Rodrick, G.E., and Cheng, T.C. (1974) Kinetic pr operties of Lysozyme from the hemolymph of Crassostrea virginica J Invertebr Pathol 24 : 41-48. Rodrick, G.E., and Ulrich, S. A. (1984) Micropsc opical studies on the hemocytes of bivalves and their phagocytic interaction with selected bacteria. Helgolander Meeresuntersuchungen 37 : 167176. Ross, E.E., Guyer, L., Varnes, J., and Rodrick, G. (1994) Vibrio vulnificus and molluscan shellfish: The necessity of education for high-risk individuals. J Am Diet Assoc 94: 312-314. Simonson, J., and Siebeling, R.J. (1986) Rapid serological identification of Vibrio vulnificus by anti-H coagglutination. Appl Environ Microbiol 52 : 1299-1304. Simpson, L.M., White, V.K., Zane, S.F., and Oliv er, J.D. (1987) Correlation between virulence and colony morphology in Vibrio vulnificus Infect Immun 55 : 269-272. Starks, A.M., Schoeb, T.R., Tamplin, M.L., Parveen, S., Doyle, T.J., Bomeis l, P.E. et al. (2000) Pathogenesis of infection by clini cal and environmental strains of Vibrio vulnificus in iron-dextran-treated mice. Infect Immun 68 : 5785-5793. Tall, B.D., La Peyre, J.F., Bier, J.W., Miliotis, M.D., Hanes, D.E., Kothary, M.H. et al. (1999) Perkinsus marinus extracellular protease modulates survival of Vibrio vulnificus in eastern oyster ( Crassostrea virginica ) hemocytes. Appl Environ Microbiol 65 : 4261-4263.

PAGE 95

95 Tilton, R.C., and Ryan, R.W. (1987) Clinic al and ecological characteristics of Vibrio vulnificus in the northeastern United States. Diagn Microbiol Infect Dis 6 : 109-117. Tison, D.L., and Kelly, M.T. (1986) Virulence of Vibrio vulnificus strains from marine environments. Appl Environ Microbiol 51 : 1004-1006. Tucker, M.S. (2006) Analysis of flagella, motil ity and chemotaxis in the pathoegenesis of Vibrio vulnificus In Department of molecular biology Gainesville: University of Florida. van der Woude, M.W., and Baumler, A.J. (2004) Phase and antigenic va riation in bacteria. Clin Microbiol Rev 17 : 581-611. Venugopal, V., Doke, S.N., and Thomas, P. (1999) Radiation processing to improve the quality of fishery products. Crit Rev Food Sci Nutr 39 : 391-440. Watnick, P., and Kolter, R. (2000) Biofilm, city of microbes. J Bacteriol 182 : 2675-2679. Watnick, P.I., and Kolter, R. (1999) Steps in the development of a Vibrio cholerae El Tor biofilm. Mol Microbiol 34 : 586-595. Welch, R.A., Forestier, C., Lobo, A., Pellett, S., Thomas, W., and Rowe, G. (1992) The synthesis and function of the Escherichia coli hemolysins and related RTX exotoxins. FEMS Microbiol Immunol 105 : 29-36. Wright, A.C., and Morris, J.G., Jr. (1991) The extracellular cytolysin of Vibrio vulnificus : inactivation and relationship to virulence in mice. Infect Immun 59 : 192-197. Wright, A.C., Simpson, L.M., Oliver, J.D., and Mo rris, J.G., Jr. (1990) Phenotypic evaluation of acapsular transposon mutants of Vibrio vulnificus Infect Immun 58 : 1769-1773. Wright, A.C., Powell, J.L., Kaper, J.B., and Mo rris, J.G., Jr. (2001) Identification of a group 1like capsular polysaccharide operon for Vibrio vulnificus Infect Immun 69 : 6893-6901. Wright, A.C., Hill, R.T., Johnson, J.A., Roghman, M.C., Colwell, R.R., and Morris, J.G., Jr. (1996) Distribution of Vibrio vulnificus in the Chesapeake Bay. Appl Environ Microbiol 62 : 717-724. Wright, A.C., Powell, J.L., Tanner, M.K., Ensor, L.A., Karpas, A.B., Morris, J.G., Jr., and Sztein, M.B. (1999) Diffe rential expression of Vibrio vulnificus capsular polysaccharide. Infect Immun 67 : 2250-2257. Yamaichi, Y., Iida, T., Park, K.S., Yamamoto, K., and Honda, T. (1999) Physical and genetic map of the genome of Vibrio parahaemolyticus : presence of two chromosomes in Vibrio species. Mol Microbiol 31 : 1513-1521.

PAGE 96

96 Yildiz, F.H., and Schoolnik, G.K. (1999) Vibrio cholerae O1 El Tor: Identification of a gene cluster required for the rugose colony t ype, exopolysaccharide production, chlorine resistance, and biofilm formation. PNAS 96 : 4028-4033. Zuppardo, A.B., and Siebeling, R.J. (1998) An epim erase gene essential fo r capsule synthesis in Vibrio vulnificus. Infect Immun 66 : 2601-2606.

PAGE 97

97 BIOGRAPHICAL SKETCH Milan Srivastava was born in the State of Bi har in India. She completed her undergraduate degree from Allahabad University in 1999, where she was awarded a gold medal for being first in her graduating class. She continued her studie s and obtained a masters degree in food science and applied nutrition from Allaha bad Agricultural Institute (D eemed University) (AAIDU) in 2001. At AAIDU she was selected the vice pres ident of academic affairs and she also participated in regional level seminar entitled Diabetes and Diet as a project leader. She secured first position in her graduating class of masters degree and was awarded a gold medal. She then started working as a sales & technica l division Officer for Mo lecular Diagnostics Pvt. Ltd (MDPL) in Pune, India. At MDPL she superv ised a 40-member sales and technical team of the Pune sub-division. She was responsible for over all training of the executives, developing and implementing strategies for mark eting and technical support. She started her masters education at Univer sity of Florida in food microbiology under the guidance of Dr. Anita C. Wright in 2006. During he r graduate studies at University of Florida she presented her research wo rk at Florida Marine Biotechnology Summit V, 2006, where she was awarded the Best Student Research aw ard. She was also awarded the William Angnes Brown graduate scholarship in 2007 for excelle nce in academics in food science and human nutrition department. After completing her graduate st udies she plans to work in the field of food microbiology.