<%BANNER%>

Biological Control of Imperata cylindrica in West Africa Using Fungal Pathogens

Permanent Link: http://ufdc.ufl.edu/UFE0021764/00001

Material Information

Title: Biological Control of Imperata cylindrica in West Africa Using Fungal Pathogens
Physical Description: 1 online resource (140 p.)
Language: english
Creator: Den Breeyen, Alana
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2007

Subjects

Subjects / Keywords: biocontrol, cogongrass, fungi, genetic, variation
Plant Pathology -- Dissertations, Academic -- UF
Genre: Plant Pathology thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Imperata cylindrica (cogongrass, speargrass) is a noxious, rhizomatous grass with a pan-tropical distribution. It is ranked as one of the top 10 invasive weeds in the world. The plant has several survival traits that include an extensive rhizome system, wind disseminated seeds and high genetic plasticity. In the southeastern USA, it is a very serious invasive species and a federally designated noxious weed. In West Africa, cogongrass represents one of the most serious constraints to crop production and poverty alleviation. Within the genus Imperata, cogongrass is the most variable species and specimens have been found ranging from the western Mediterranean to South Africa, throughout Australia, India and Southeast Asia (including the Pacific Islands). Included in the study were other Imperata taxa including I. brevifolia, I. brasiliensis, and the ornamental variety I. cylindrica var. rubra. Due to possible hybridization, introgression, and overlapping morphological characters, there is often taxonomic confusion between cogongrass and I. brasiliensis, especially in North America. Biological control would be an economical and environmentally friendly method for controlling this invasive weed and the objective of this study was to determine the suitability of the West African cogongrass as a host to two pathogens, Bipolaris sacchari and Drechslera gigantea, found to be effective biological control agents in the southeastern USA. Understanding the extent of genetic variation can be of importance in the detection of ecotypes or races of a species as they may differ considerably in their susceptibility to predators, parasites, or herbicides. In the course of this study, USA and West African I. cylindrica accessions were found to be geographically and genetically distinct. These differences were defined by three distinct groups. Within the Florida cogongrass accessions, genetic variation was high confirming that I. cylindrica was introduced in the USA multiple times. Imperata brasiliensis was not genetically distinct from the USA I. cylindrica population forming a sister species to the Florida I. cylindrica accessions. In addition, Imperata cylindrica var. rubra was more closely related to the African accessions. Imperata brevifolia was found to be genetically distinct from all the Imperata accessions within the ISSR study. Bipolaris sacchari and D. gigantea isolates from the USA and West Africa were evaluated in greenhouse trials to determine their efficacy as biological control agents on the West African I. cylindrica. There were no significant differences in disease incidence and disease severity between the Florida and Benin isolates inoculated on the Benin cogongrass. The Florida isolates of B. sacchari and D. gigantea are not suitable for use in a formulated mycoherbicide product for cogongrass control in West Africa because of low levels of disease and lack of weed suppression. An indigenous fungus Colletotrichum caudatum, evaluated in conjunction with the B. sacchari and D. gigantea isolates, was consistently found to cause similar or greater disease symptoms on the Benin accessions than the latter. Puccinia imperatae, P. fragosoana and, Sporisorium schweinfurthianum, associated with cogongrass in South Africa were evaluated for control of cogongrass in West Africa. Neither Puccinia spp. produced symptoms on I. cylindrica Benin, whereas S. schweinfurthianum replaced the inflorescences with a teliospore-producing stroma, causing floral sterility. The amended C. caudatum spore formulation elicited more severe symptoms compared with the mycelial inoculum and control treatments.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Alana Den Breeyen.
Thesis: Thesis (Ph.D.)--University of Florida, 2007.
Local: Adviser: Charudattan, Raghavan.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2007
System ID: UFE0021764:00001

Permanent Link: http://ufdc.ufl.edu/UFE0021764/00001

Material Information

Title: Biological Control of Imperata cylindrica in West Africa Using Fungal Pathogens
Physical Description: 1 online resource (140 p.)
Language: english
Creator: Den Breeyen, Alana
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2007

Subjects

Subjects / Keywords: biocontrol, cogongrass, fungi, genetic, variation
Plant Pathology -- Dissertations, Academic -- UF
Genre: Plant Pathology thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Imperata cylindrica (cogongrass, speargrass) is a noxious, rhizomatous grass with a pan-tropical distribution. It is ranked as one of the top 10 invasive weeds in the world. The plant has several survival traits that include an extensive rhizome system, wind disseminated seeds and high genetic plasticity. In the southeastern USA, it is a very serious invasive species and a federally designated noxious weed. In West Africa, cogongrass represents one of the most serious constraints to crop production and poverty alleviation. Within the genus Imperata, cogongrass is the most variable species and specimens have been found ranging from the western Mediterranean to South Africa, throughout Australia, India and Southeast Asia (including the Pacific Islands). Included in the study were other Imperata taxa including I. brevifolia, I. brasiliensis, and the ornamental variety I. cylindrica var. rubra. Due to possible hybridization, introgression, and overlapping morphological characters, there is often taxonomic confusion between cogongrass and I. brasiliensis, especially in North America. Biological control would be an economical and environmentally friendly method for controlling this invasive weed and the objective of this study was to determine the suitability of the West African cogongrass as a host to two pathogens, Bipolaris sacchari and Drechslera gigantea, found to be effective biological control agents in the southeastern USA. Understanding the extent of genetic variation can be of importance in the detection of ecotypes or races of a species as they may differ considerably in their susceptibility to predators, parasites, or herbicides. In the course of this study, USA and West African I. cylindrica accessions were found to be geographically and genetically distinct. These differences were defined by three distinct groups. Within the Florida cogongrass accessions, genetic variation was high confirming that I. cylindrica was introduced in the USA multiple times. Imperata brasiliensis was not genetically distinct from the USA I. cylindrica population forming a sister species to the Florida I. cylindrica accessions. In addition, Imperata cylindrica var. rubra was more closely related to the African accessions. Imperata brevifolia was found to be genetically distinct from all the Imperata accessions within the ISSR study. Bipolaris sacchari and D. gigantea isolates from the USA and West Africa were evaluated in greenhouse trials to determine their efficacy as biological control agents on the West African I. cylindrica. There were no significant differences in disease incidence and disease severity between the Florida and Benin isolates inoculated on the Benin cogongrass. The Florida isolates of B. sacchari and D. gigantea are not suitable for use in a formulated mycoherbicide product for cogongrass control in West Africa because of low levels of disease and lack of weed suppression. An indigenous fungus Colletotrichum caudatum, evaluated in conjunction with the B. sacchari and D. gigantea isolates, was consistently found to cause similar or greater disease symptoms on the Benin accessions than the latter. Puccinia imperatae, P. fragosoana and, Sporisorium schweinfurthianum, associated with cogongrass in South Africa were evaluated for control of cogongrass in West Africa. Neither Puccinia spp. produced symptoms on I. cylindrica Benin, whereas S. schweinfurthianum replaced the inflorescences with a teliospore-producing stroma, causing floral sterility. The amended C. caudatum spore formulation elicited more severe symptoms compared with the mycelial inoculum and control treatments.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Alana Den Breeyen.
Thesis: Thesis (Ph.D.)--University of Florida, 2007.
Local: Adviser: Charudattan, Raghavan.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2007
System ID: UFE0021764:00001


This item has the following downloads:


Full Text





BIOLOGICAL CONTROL OF Imperata cylindrica IN WEST AFRICA USING FUNGAL
PATHOGENS




















By

ALANA DEN BREEYEN


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA

2007


































2007 Alana Den Breeyen

































To my parents, Henk and Pathia Den Breeyen









ACKNOWLEDGMENTS

I thank my major professor, Dr. Raghavan Charudattan, for his belief in me even at times

when it didn't seem justified and for giving me the opportunities to grow professionally. I thank

Dr. Fen Beed, for helping me realize that if I'm not part of the solution then I am part of the

problem and for his generous hospitality and friendship during my time at IITA, Cotonou, Benin.

I also thank my committee members, Dr Jeffrey Rollins, Dr. Greg MacDonald, and Dr. Fredy

Altpeter for their time, interest and support. My thanks go to the many people who have helped

me with my research: Jim DeValerio, for always being a willing 'driver' and one of my first

friends in Gainesville, Mark Elliott, whose love and friendship has made life here well worth the

journey, to Gabriella Maia, for her love and friendship and willingness to sit in the midday sun

harvesting cogongrass rhizomes, and to Adolphe Avocanh who willing shared his office,

expertise and friendship during my time at IITA, Benin. My thanks go to Eldon Philman and

Herman Brown for the help they provided during the course of my experiments. Thanks go to

my former labmates, Jennifer Cook and Jonathan Horrell. My special thanks go to my lab mate,

Abby Guerra, who often put up with more than he should have and whose special friendship has

brightened my days. To the students and staff at IITA, Benin who were always willing to help

with my research and for reminding me to slow down, merci beaucoup! Thanks to Ms. Gail

Harris, Ms. Donna Perry, Ms. Lauretta Rahmes, Ms. Jan Sapp, Ms. Sherri Mizell and Ms. Dana

Lecuyer who helped me in their own special way. My thanks go to Mark and Maria Minno for

allowing me access to their cogongrass collection and Meghan Brenan for help with my

statistical data analysis. My special thanks to Sarah Clark Selke, Linley Smith, Tara Taranowski,

Heidi HansPetersen, and Amanda Watson, the amazingly talented women who have become my

friends.









My special thanks go to my Mom and Dad, who made the realization of the dream that

much easier, and to my brother and sister-in-law, Ashley and Izelle for their love and support.

To all my friends, back home and around the world, thank you for your special blend of

friendship.









TABLE OF CONTENTS

page

A C K N O W L E D G M E N T S .................................................................................... .....................4

L IS T O F T A B L E S ................................................................................. 8

LIST OF FIGURES ................................. .. .... ..... ................. 10

ABSTRAC T ............................... ..................... 12

CHAPTER

1 INTRODUCTION ............... .......................................................... 14

Biology and M orphology ................................................................ .. ...... 15
C ogongrass in the U united States ............................................................................. ............16
C ogongrass in W est A frica ........................................................................... .......... .......... 18
Biological Control Strategies for Forest W eeds ........................................ .....................20
Biological Control Strategies for Cogongrass.............................................. .................. 26
Potential Insect and Nematode Biocontrol Agents...................................................27
Potential Plant Pathogenic Biocontrol Agents ..................................... .................28
M y c o h erb icid e s .................... ........ .... .... ...... ..... .... ..... .. ............... ...............3 0
Genetic Variation in Invasive Weeds: The Implication for Biological Control...................31
B biological Control and G enetic M arkers.................................................................... ...... 33

2 AN EXAMINATION OF GENETIC DIVERSITY OF Imperata cylindrica BASED ON
INTER-SIMPLE SEQUENCE REPEATS AND SEQUENCE ANALYSIS OF
INTERNAL TRANSCRIBED AND CHLOROPLAST TRNL-F SPACER DNA................36

Introduction ..... ..................................... ..............................................36
M materials and M methods ........................ .. ......................... .... ........ ......... 40
Population Sam pling ..................... .... .... .......... .. ......... .......... 40
Extraction of Genomic DNA and PCR Amplification of ISSR Population Markers......40
R e su lts ............................................................................................................................... 4 4
A naly sis of IS SR M arkers ............................................................... ....... ...................44
A n a ly sis o f IT S ..................................................................................................4 5
Analysis of trnL-F ...... ........................................... ...................... 47
D iscu ssion .......... ..........................................................47

3 EVALUATION OF FUNGAL PATHOGENS AS BIOLOGICAL CONTROL
AGENTS OF Imperata cylindrica (L.) BEAUV. FROM THE USA AND BENIN..............60

Introduction ..... ..................................... ..............................................60
M materials and M methods ........................ .. ........................ .. .... ........ ........ 62
Propagation of Test Plants .......................................................................... ............... 62
Inoculum Production ............................................ .. .. .... ........ ......... 63









Imperata cylindrica Inoculations .......................................................64
Efficacy ofBipolaris sacchari and Drechslera gigantea Applied Singly or as a
M ix tu re .......................................................................... 6 4
Statistical Analysis ................................... ..... .. ...... ............... 65
Results .......................... ................. ............................. 65
Efficacy ofBipolaris sacchari and Drechslera gigantea Applied Singly or as a
M ixtu re .................................................. ..........................................6 5
Florida Imperata cylindrica Accessions and Fungal Isolates..............................65
Benin Imperata cylindrica Accessions and Fungal Isolates.....................................68
D discussion ................................... ...................................... ................ 69

4 EVALUATION OF OBLIGATE BIOTROPHIC FUNGI ASSOCIATED WITH
Imperata cylindrica IN SOUTH AFRICA AS POTENTIAL BIOCONTROL AGENTS
FOR COGONGRASS IN WEST AFRICA.................................................. 92

Introduction ..... ..................................... ..............................................92
M materials and M methods ........................ .. ........................ .. .... ........ ........ 95
P ropagation of T est P plants .............................................................................. ........ 95
Source of Pathogens and Inoculum ................................... ............................................ 95
Treatm ents and Experim ental D esign ........................................ ........................ 96
R esu lts ......... ................... .......... ......... .............................. .. ............ 9 6
D discussion .................................... ..................................... ................. 97

5 SUMMARY AND CONCLUSIONS ....................................................... ............. 103

APPENDIX

A FIELD EVALUATION OF THE INDIGENOUS FUNGUS, Colletotrichum caudatum,
ASSOCIATED WITH COGONGRASS IN BENIN .................... ......................... 108

Introduction.........................................108
M materials and M methods .................. ............................ .. ....... .................. .. 111
Inoculum Production .................. ............................... ...... .............. 111
Inoculation ................................................................ .. ........ ...............111
D disease A ssessm ent .................. ................................... .. ................ 112
Statistical Analysis .......................................... ................... .... ........ 112
R e su lts ................... ...................1.............................2
D iscu ssion ...... .........................................................113

B ACCESSION AND GENBANK DATA FOR THE USA Imperata cylindrica AND
CLO SELY RELA TED SPECIES...................................................................................119

C ACCESSION AND GENBANK DATA FOR THE WEST AND SOUTH AFRICAN
Imperata cylindrica ................................... .. .......... ..............121

L IST O F R E F E R E N C E S ......... ......... ................ .............................. ...................................122

B IO G R A PH IC A L SK E T C H ....................................... ................................ .......................... 140









LIST OF TABLES


Table page

2-1 Genetic variability of all single sampled populations oflmperata cylindrica and
closely related species with the ISSR prim ers. ....................................... ............... 53

2-2 Comparison of genetic diversity measures for all sampled populations oflmperata
cylindrica and closely related species as determined using ISSR population markers ....54

2-3 Summary of analysis of molecular variance (AMOVA) based on ISSR genotypes of
the African and USA Imperata cylindrica accessions..............................................55

3-1 Pairwise comparison of least square means of disease severity (DS) from different
treatments on Florida accessions of Imperata cylindrica at 7 days after inoculation........75

3-2 Pairwise comparison of least square means of disease severity (DS) from different
treatments on Florida accessions of Imperata cylindrica at 21 days after inoculation......75

3-3 Disease severity statistical classes ofBipolaris sacchari, Drechslera gigantea, and
their mixture on the Florida Imperata cylindrica accessions at 7 days after
in o cu nation .............................................................................................. 7 6

3-4 Disease severity statistical classes ofBipolaris sacchari, Drechslera gigantea, and
their mixture on the Florida Imperata cylindrica accessions at 21 days after
in o cu nation .............................................................................................. 7 7

3-5 Pairwise comparison of least square means of disease severity (DS) from different
treatments on the Benin accession oflmperata cylindrica at 7 days after inoculation
(T ria l 1 ). ......................................................................................... 7 8

3-6 Pairwise comparison of least square means of disease severity (DS) from different
treatments on the Benin accession oflmperata cylindrica at 7 days after inoculation
(T rial 2) ......................................................... ................................. 79

3-7 Pairwise comparison of least square means of disease severity (DS) from different
treatments on the Benin accession oflmperata cylindrica at 21 days after inoculation
(T ria l 1 ). ........................................................................................ 8 0

3-8 Pairwise comparison of least square means of disease severity (DS) from different
treatments on the Benin accession oflmperata cylindrica at 21 days after inoculation
(T rial 2 ) ......................................................................................... 8 1

4-1 Collections of obligate fungi associated with Imperata cylindrica in South Africa........100

4-2 Number oflmperata cylindrica inflorescences infected with the head smut,
Sporisorium \ hl einI thi 1illul / .................................. .................... 100









A-1 Analysis of variance for disease incidence of Colletotrichum caudatum at 7 days
after inoculation. .. ............ ...................... ............. 116

B-l Imperata cylindrica and closely related species sampled in USA for population
structure and virulence studies................................................ ............................. 119

C-1 Imperata cylindrica and closely related species sampled in West and South Africa
for population structure and virulence studies. ...................................... ............... 121









LIST OF FIGURES


Figure page

2-1 Photographs of ISSR gels.. ............................... .. ........................................... 56

2-2 UPGMA dendrogram of all Imperata cylindrica accessions and closely related
species sam pled based on ISSR data. ........................................ .......................... 57

2-3 Parsimony tree inferred from ITS sequence data for all Imperata cylindrica
accessions and closely related species. ........................................................................58

2-4 Neighbor-joining tree of distances derived from ITS sequence data for all Imperata
cylindrica accessions and closely related species ................................... ............... 59

3-1 Disease symptoms and disease severity on Imperata cylindrica Florida accessions at
2 1 day s after in ocu nation ........................................................................... ...................82

3-2 Disease symptoms and diseases severity on Imperata cylindrica Benin accession at
21 days after inoculation ........................ ........................ ......... 83

3-3 Mean disease ratings ofBipolaris sacchari on Imperata cylindrica Florida
accessions (T rial 1).. .........................................................................84

3-4 Mean disease ratings ofDrechslera gigantea on Imperata cylindrica Florida
accession s (T rial 1).. .........................................................................85

3-5 Mean disease ratings of the Mixture on Imperata cylindrica Florida accessions (Trial
1). ....................... ..................................................86

3-6 Mean disease ratings ofBipolaris sacchari on Imperata cylindrica Florida
accessions (T rial 2).. .........................................................................87

3-7 Mean disease ratings ofDrechslera gigantea on Imperata cylindrica Florida
accessions (T rial 2). ...................................................... ................. 88

3-8 Mean disease ratings of the Mixture on Imperata cylindrica Florida accessions (Trial
2 ) .. .......................................................... ...................................... 8 9

3-9 Disease severity of Florida (Fl) and Benin (B) isolates of Bipolaris sacchari,
Drechslera gigantea, and their mixture on the Benin accession of Imperata
cy lindrica. ................................................... ......... ... ..... ......... ............... 90

4-1 Imperata cylindrica seedlings prior to inoculation with a 1 x 10s sori ml-1
Sporisorium \. l nI eilel tfil 11tlll/ll soil drench treatment. ...............................................101

4-2 Imperata cylindrica inflorescence infected with the head smut, Sporisorium
\. h eii C iil I/in n11111 four months after a soil drench treatment.................. ...............102









A-1 Field trial site with reemerging Imperata cylindrica plants at IITA, Cotonou, Benin. ...117

A-2 Field inoculation of Imperata cylindrica Benin using an amended Colletotrichum
caudatum form ulation. ............ ........................................... ...... .. ..... 118









Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

BIOLOGICAL CONTROL OF Imperata cylindrica IN WEST AFRICA USING FUNGAL
PATHOGENS

By

Alana Den Breeyen

December 2007

Chair: Raghavan Charudattan
Major: Plant Pathology

Imperata cylindrica (cogongrass, speargrass) is a noxious, rhizomatous grass with a pan-

tropical distribution. It is ranked as one of the top 10 invasive weeds in the world. The plant has

several survival traits that include an extensive rhizome system, wind disseminated seeds and

high genetic plasticity. In the southeastern USA, it is a very serious invasive species and a

federally designated noxious weed. In West Africa, cogongrass represents one of the most

serious constraints to crop production and poverty alleviation. Within the genus Imperata,

cogongrass is the most variable species and specimens have been found ranging from the western

Mediterranean to South Africa, throughout Australia, India and Southeast Asia (including the

Pacific Islands). Included in the study were other Imperata taxa including I. brevifolia, I.

brasiliensis, and the ornamental variety I. cylindrica var. rubra. Due to possible hybridization,

introgression, and overlapping morphological characters, there is often taxonomic confusion

between cogongrass and I. brasiliensis, especially in North America. Biological control would

be an economical and environmentally friendly method for controlling this invasive weed and

the objective of this study was to determine the suitability of the West African cogongrass as a

host to two pathogens, Bipolaris sacchari and Drechslera gigantea, found to be effective

biological control agents in the southeastern USA. Understanding the extent of genetic









variation can be of importance in the detection of ecotypes or races of a species as they may

differ considerably in their susceptibility to predators, parasites, or herbicides. In the course of

this study, USA and West African I. cylindrica accessions were found to be geographically and

genetically distinct. These differences were defined by three distinct groups. Within the Florida

cogongrass accessions, genetic variation was high confirming that I. cylindrica was introduced in

the USA multiple times. Imperata brasiliensis was not genetically distinct from the USA I.

cylindrica population forming a sister species to the Florida I. cylindrica accessions. In addition,

Imperata cylindrica var. rubra was more closely related to the African accessions. Imperata

brevifolia was found to be genetically distinct from all the Imperata accessions within the ISSR

study. Bipolaris sacchari and D. gigantea isolates from the USA and West Africa were

evaluated in greenhouse trials to determine their efficacy as biological control agents on the West

African I. cylindrica. There were no significant differences in disease incidence and disease

severity between the Florida and Benin isolates inoculated on the Benin cogongrass. The Florida

isolates ofB. sacchari and D. gigantea are not suitable for use in a formulated mycoherbicide

product for cogongrass control in West Africa because of low levels of disease and lack of weed

suppression. An indigenous fungus Colletotrichum caudatum, evaluated in conjunction with the

B. sacchari and D. gigantea isolates, was consistently found to cause similar or greater disease

symptoms on the Benin accessions than the latter. Puccinia imperatae, P. fragosoana and,

Sporisorium \/I hl et'iil hini tlunII, associated with cogongrass in South Africa were evaluated for

control of cogongrass in West Africa. Neither Puccinia spp. produced symptoms on I. cylindrica

Benin, whereas S. L. Mh 'i tfin I, ti1t1tt replaced the inflorescences with a teliospore-producing

stroma, causing floral sterility. The amended C. caudatum spore formulation elicited more

severe symptoms compared with the mycelial inoculum and control treatments.









CHAPTER 1
INTRODUCTION

Invasive exotic species are a threat to global biodiversity second only to habit loss and

landscape fragmentation, and the economic impact of these species is a serious concern

worldwide (Allendorf and Lundquist, 2003). An estimated 50,000 non-indigenous species

established in the United States cause major environmental damage and economic losses totaling

over an estimated $125 billion, with 79 of these exotic species causing over $97 billion in

damages from 1906 to 1991 (Pimental et al, 2005; Allendorf and Lundquist, 2003). In crop

systems, more than 500 introduced species are considered serious weeds while over 5,000

introduced species are found in natural ecosystems (Pimentel et al., 1989, Morin, 1995). In

1999-2000, over $41 million was spent in Florida for the management of invasive terrestrial and

aquatic plant species occurring in waterways, roadsides, rights-of-way, forests, and other natural

areas (Florida DEP, 2000). As a result of altering ecosystem processes, invasive plant species

displace native plant and animal species, support exotic animals and pathogens, and subsequently

alter gene pools by hybridizing with native species (Randall, 1996).

In the United States, invasive weeds cause an approximate 12% reduction in crop yields.

Agriculture, the mainstay of most national economies in Africa, provides 60% of all employment

and generates more than 40% of the continent's foreign exchange earnings (GISP Brochure,

2007). In rural communities, agriculture supports 80% of the population and together with food

security, is critical to the livelihoods and survival of individuals, communities and countries in

Africa. According to McGinley (2007), Africa spends an estimated $60 million annually to

control invasive alien species. The threats posed by invasive species consequently have a greater

impact in developing countries, whose economies rely heavily on agriculture, forestry and

fishing (GISP Brochure, 2007). Rural communities in developing countries, whose livelihoods









are exclusively based on these economic sectors, are the most at risk while the poorest section of

these communities are wholly dependent on biodiversity-based products for food, fuel and

construction material.

Biology and Morphology

A warm-season, rhizomatous, grass species, cogongrass [Imperata cylindrica (L.) Beauv.]

is found throughout tropical and subtropical regions of the world (Holm et al., 1977). It employs

several survival strategies that include an extensive rhizome system, adaption to poor soil,

drought tolerance, adaptability to fire, wind disseminated seeds and high genetic plasticity

(MacDonald, 2004). Cogongrass is a perennial, C4 plant species which allows it to

photosynthesize more efficiently under high light intensities and temperatures, and under

conditions of limited moisture availability (Groves, 1991).

Growing in loose -to- compact tufts, cogongrass plants can reach up to 1 meter in height

(Clewell, 1985). Considered stemless except for the flowering stalk, one to eight basal leaves

(4- to 10- mm wide; 15- to 150- cm long) originate from the rhizomes. The linear-lanceolate

leaves, with a characteristic off-center white midrib, have high silicon content (Coile and

Shilling, 1993) that results in coarse leaf texture and serrated leaf margins. Cogongrass

rhizomes, comprising of greater than 60% total plant biomass, are covered with tough scale

leaves (cataphylls) that are thought to protect the rhizomes from desiccation, physical

degradation and fire (Holm et al., 1997). The rhizomes have short intemodes and form

extensive, dense underground mats. The rhizomes can develop in two stages: primary seedling

rhizomes, and secondary rhizomes that sprout from seedling rhizomes (Gabel, 1982). In central

Florida, Gaffney (1996) found cogongrass rhizomes were restricted to the top 10 tol5 cm of soil

on a phosphate mine site, but grew down to 80 cm below ground on a clay settling pond site. In

Southeast Asia, rhizomes typically occur 10 to 40 cm below ground and form dense, extensive









layers with some rhizomes growing as deep as 1 m (Ayeni and Duke, 1985; Mumiati, 2002).

The cylindrical inflorescence is a dense panicle of paired spikelets (3 to 20 cm long, 0.5 to 2.5

cm). The spikelets are unawned with long silky hairs (Clewell, 1985) producing small seeds (1

to 1.3 mm long) (King and Grace, 2000a, b).

Worldwide, cogongrass shows variable phenological development depending upon climate

and population genetics. In its native Japan, cogongrass flowers from May to June (Ohwi, 1965)

while populations growing in the Mediterranean tend to flower during the spring and summer

(October to March). In tropical and subtropical areas, including Florida, cogongrass tends to

flower year-round (Bryson and Carter, 1993). Flowering is often caused by stress due to

mowing, burning, grazing, cool temperatures, defoliation, and nitrogen fertilization (Holm et al.,

1997; Coile and Shilling, 1993).

Cogongrass reproduces by seed, with a single plant producing several thousand which can

be wind-dispersed over long distances. Although seed movement is usually limited to 15 m or

less, seeds were reported to travel up to 24 km when in open country (Hubbard, 1944). Seed

dormancy is absent and mature seeds germinate within a week of shedding (Santiago, 1965) and

remain viable for up to one year. Imperata cylindrica also reproduces vegetatively through the

rhizomes allowing the plant to rapidly colonize new areas. Eussen (1980) reported that a single

rhizome node could lead to the production of 350 shoots in 6 weeks and ground cover of 4 m2 in

11 weeks.

Cogongrass in the United States

Cogongrass, ranked as one of the world's top ten invasive weeds (Holm et al., 1977),

infests over 500 million ha worldwide including 200 million ha in Asia and an estimated 100,000

hectares in southeastern USA (Schmitz and Brown, 1994). Several known introductions

occurred in the United States during the last century with the variety major accidentally









introduced into Alabama (1912) from Japan while cogongrass from the Philippines was

purposefully introduced to Mississippi in 1921 as potential forage (MacDonald, 2004).

Additional forage trials were conducted in Florida, Texas (where the planting died out in the first

year) and Alabama with the consequence that by the late 1940s over 1000 acres had become

established in central and northwest Florida. By 2004, greater than 500,000 hectares with some

level of cogongrass infestation was present in Florida (MacDonald, 2004). Cogongrass infests

ditch banks, pastures, road sides/right of ways, golf courses, lawns, forests and recreational and

natural areas throughout Florida with the reclaimed phosphate mining areas of Central Florida

supporting hundreds of acres of cogongrass monoculture (MacDonald et al., 2002).

Cogongrass infestations, in areas other than closed canopy forests, plantations and heavily

cultivated lands, are managed using relatively expensive, laborious and repetitive control

measures. In the United States, the most effective management strategies require an integrated

approach utilizing mechanical discingg, mowing), cultural (burning), chemical (herbicide

applications of glyphosate and imazapyr) and revegetation methods (Van Loan et al., 2002).

Effective control strategies may be hampered by the existence of genetic variation and

potentially adapted genotypes due to fact that there were at least two separate cogongrass

introductions and the occurrence oflmperata brasiliensis Trin. (Brazilian satintail) in the United

States. According to McDonald et al. (1996), crosses of cylindrica and I. brasiliensis produced

viable seeds. This observation raises the question of whether these two species should be

considered forms of the same species. Hall (1983, 1998) has considered these to be members fo

the same species due to the evidence of frequent hybridization (Gabel, 1982). The 'ornamental'

variety I. cylindrica var. rubra (Red Baron or Japanese Blood Grass), sold in nurseries

throughout the United States, is extremely cold-tolerant (-23C) unlike cylindrica var. major.









In Alabama, cogongrass rhizomes were able to survive winter temperatures of -14C (Wilcut et

al., 1988), but were unable to survive winters in Mississippi when the temperature reached -8 C

(Hubbard, 1944). The creation of new potentially cold-tolerant biotypes through the

hybridization of cylindrica with var. rubra could possibly extend the range of this invasive

weed north and westward (Shilling et al., 1997).

Cogongrass in West Africa

Imperata cylindrica var. africana (cogongrass and/or speargrass) ranges from Senegal to

Cameroon and from the south coast to the arid Sudan zone in the north. It is a serious weed in

the moist savanna and forest zones especially in areas under intensive agricultural practices

including recurrent fires, tillage, weeding and other farm activities (Chikoye et al., 2001).

Although cogongrass occurs in South Africa, Madagascar and East Africa, it has greater invasive

significance in Western Africa than either Eastern or Southern Africa (Ivens, 1983). According

to Ivens (1983), cylindrica var. africana differs morphologically from the var. major of

Southeast Asia (and consequently of the USA) with generally narrower leaf width, longer

ligules, slightly longer spikelets with longer hairs and anthers. However, it has similar growth

habits and ecological requirements as var. major.

Cogongrass infestations place major constraints on the production of coconut, oil-palm,

rubber, cereals, legumes, root and tuber crops (Chikoye et al., 1999). Annual crop yields are

drastically reduced when grown in competition with I cylindrica often causing losses of 80% to

100%. When crops were grown in slash plots without additional weeding, complete crop failure

usually occurred (Koch et al., 1990; Udensi et al., 1999). Koch et al. (1990) reported that I.

cylindrica infestations of cassava fields intercropped with maize, caused yield losses greater than

90% while physical injuries caused by the sharp cogongrass rhizomes to roots and tubers of

cassava and yam increased fungal disease incidences resulting in additional crop loss. In









addition, I. cylindrica increases the risk of fires in perennial crops, plantations, and forest

reserves and recurring fires result in soil degradation due to significant loss of organic matter

(Holm et al., 1977, Terry et al., 1997). Cogongrass is a serious invasive weed that can decimate

crop yields and demands the commitment of significant proportions of resources, such as capital,

labor, and herbicides, for effective control. West African farmers perceived cogongrass to be

their most serious weed (Chikoye et al., 1999). Labor-intensive farming practices such as hoe-

weeding, slashing and fallowing are the most common control practices. Long-term land

abandonment has been the traditional way to manage severe infestations of cogongrass in West

Africa. This is because long-term land abandonment of 10 to 15 years results in extensive

natural bush regrowth that effectively smothers the weed (Chikoye et al., 1999). However, long-

term fallow cropping is no longer feasible due to increasing population pressure on limited arable

land. Glyphosate or paraquat are the only two herbicides available if farmers chose to utilize

chemical control as part of their management strategy. However, the high cost of herbicides,

lack of awareness, lack of capital, and the non-availability of effective herbicides were cited as

reasons for the low utilization of herbicides (Chikoye et al., 2000). Farmers can combine several

control practices in an integrated management strategy for enhanced suppression of the weed.

Lack of capital resources however, was the most widely stated reason for the non-development

of sustainable management strategies. Other reasons included: 1) the lack of better management

strategies, 2) the lack of adequate labor, 3) the lack of equipment, and 4) health problems.

Chikoye et al. (1999) concluded that research to develop a comprehensive management strategy

for cogongrass in West Africa must become a priority as this weed threatens the livelihood of

over 200 million people in the region.









Biological Control Strategies for Forest Weeds

Invasive weeds cause significant economic and ecological losses in both commercial and

native forest ecosystems. These weeds are highly successfully and compete for resources such

as light, nutrients and water which results in the suppression of young or naturally regenerating

trees (Green, 2003). According to Campbell (1998), an estimated 138 alien tree and shrub

species including salt cedar (Tamarixpendantra Pallas), eucalyptus (Eucalyptus spp.), Brazilian

pepper (Schinus terebinthifolius Raddi), and Australian melaleuca (Melaleuca quinquenervia

(Cav.) S.T. Blake), have invaded native U.S. forest and shrub ecosystems (Pimental et al., 2005).

Melaleuca quinquenervia is spreading at a rate of 11,000 ha/year throughout the forest and

grassland ecosystems of the Florida Everglades causing damage to the natural vegetation and

wildlife (Pimental et al., 2005).

Acacia saligna Uromycladium tepperianum. One of the most successful classical

biocontrol programs documented is the control of Acacia saligna (Labill.) H. Wendl. in South

Africa, by the Australian rust fungus Uromycladium tepperianum (Sacc.) McAlpine (reviewed

by Charudattan, 2001). As one of the most serious invasive weeds in South Africa, A. saligna

(Port Jackson willow) forms dense stands that replace indigenous vegetation and interfere with

agricultural practices (Morris, 1997). As the weed is difficult and costly to control mechanically

and chemically, it was an excellent candidate for biological control. In 1987, a gall-forming rust

fungus, U. tepperianum, was imported into South Africa after extensive host-range testing

undertaken in Australia confirmed its specificity (Morris, 1987). Morris (1987) studied the

teliospore germination, early stages of host infection, host specialization and the reactions of

some African Acacia and Albizia species to inoculation with U. tepperianum in Australia. Cross-

inoculation of teliospores isolated from A. implexa Benth., A. saligna and Paiut ielin/hw

lophantha spp. lophantha (Willd.) Nielson with the same three species suggested that distinct









genotypes of the rust occur on these species. As the reactions were distinguishable at the host-

species level, they should, according to Anikster (1984), be termedformae specials. Morris

(1987) showed that normal galls only developed on the species from which the teliospores were

collected even though several known U. tepperianum host species were included in the study.

Although the results indicated that these rust genotypes may be specific to a single host species,

Morris (1987) recommended that a larger range of recorded host species be tested prior to

formally designating theformae specials. Since the initial releases in the late 1980s, U.

tepperianum, has subsequently spread and established throughout the range of A. saligna

(Morris, 1997). Fifteen years of monitoring (1991-2005) showed that tree density declined by

between 87% and 98% compared with data recorded prior to the U. tepperianum release (Wood

and Morris, 2007). The introduction of the seed-feeding weevil, Melanterius compactus Lea,

should accelerate a continuous decline in stand density over time. According to Wood and

Morris (2007), U. tepperianum remains a highly effective biological control agent against the

invasive tree A. saligna in South Africa.

Passiflora tarminiana-Septoria passiflorae. Passiflora tarminiana Coopens (banana

passion flower, banana poka vine), native to the South American Andes, is an aggressive and

invasive tropical vine in Hawaii. It invades disturbed areas and its effects include a loss of

biodiversity, smothering of trees and the encouragement of other invasive species such as feral

pigs that feed on the fruit (ISSG Database, 2005). By 1983, more than 50,000 ha of wet and

mesic forests in Hawaii were infested with P. tarminiana costing the Division of Forestry and

Wildlife $90,000 annually in the Hilo Forest Reserve (Trujillo, 2005). In 1991, Septoria

passiflorae Syd. was isolated from infected Hawaiian banana poka seedlings growing in

Colombia. Subsequent to the pathogen's importation to Hawaii, host-range tests, completed in









1994, confirmed its specificity to banana poka vine (Trujillo et al., 1994). Septoriapassiflorae

was approved as a biocontrol agent for banana poka vine in 1995. In 1996/1997, field

inoculations using spore suspensions resulted in significant control of banana poka vines on the

islands of Hawaii, Maui and Kauai (Trujillo, 2005). In the Hilo Forest Reserve, Hawaii, banana

poka vine biomass was reduced between 40 to 60% annually after the first inoculations. Four

years later, a 95% biomass reduction was observed (Trujillo, 2005). The introduction of S.

passiflorae has resulted in the preservation of endangered species and the regeneration of the

indigenous Acacia koa Gray forest (the source of the most valuable timber species in Hawaii)

while saving millions of dollars in weed control and forest revitalization in Kauai, Maui and

Hawaii.

Ageratina riparia-Entyloma ageratinae. Ageratina riparia (Regel) R. King &

H.Robinson (mist flower, Hamakua 'Pa-makani'), a low-growing perennial with tiny white

daisy-like flowers, was accidentally introduced to Hawaii in 1925. By 1972, mist flower

infestations extended over 100,000 ha of range and forest lands on the Hawaiian Islands (Morin

et al., 1997; Trujillo, 1985). The foliar smut fungus, Entyloma ageratinae Barreto and Evans

was introduced to Hawaii from Jamaica in 1975 to attack this aggressive weed in the mid-1970s.

Initally misidentified as a Cercosporella sp., the pathogen was renamed E. ageratinae sp. nov.

Barreto and Evans (Barreto and Evans, 1988), based on physiological host reactions rather than

morphological differences. However, Trujillo (2005) renamed the fungus as E. compositarum f

sp. ageratinae. After extensive host range studies confirmed that the pathogen was specific to

mist flower, field inoculations were made at invaded sites throughout the Hawaiian Islands

(Trujillo, 2005). Total control of the plant was achieved in less than seven months in wet areas

and within three to eight years in dry areas. Biological control of mist flower in Hawaii has been









an outstanding success in Hawaii with extensive rehabilitation of the Hawaiian rangelands.

Entyloma ageratinae was subsequently released in New Zealand in 1998 to suppress mist flower.

Within two years, it had become established at all the initial release sites and was found up to 80

km from the nearest release site (Barton et al., 2007). Within 5.5 years it had spread to the entire

North Island mist flower sites with the most distant site found 440 km from the nearest release.

Results showed that almost 60% infection of live leaves was quickly reached and maximum

plant height declined significantly. As the mist flower cover significantly decreased due to the

introduction of the fungus, the species richness and mean percentage cover of native plants

increased. It is interesting to note that no significant change was observed in the species richness

and mean percentage cover of exotic plants (excluding mist flower). According to Barton et al.

(2007) the introduction of E. ageratinae as a biological control agent of mist flower in New

Zealand has been very successful.

Broad-leaved tree species-Chondrostereum purpureum and Cylindrobasdium laeve.

The use of endemic wood-rotting fungi as bioherbicides to control invasive woody weed species

has been successfully implemented in the Netherlands and South Africa (Green, 2003). Applied

directly on freshly cut stump surfaces, these fungi prevent re-sprouting of inoculated tree stumps.

Chondrostereum purpureum (Pers:Fr.) Pouzar was developed as the mycoherbicide BIOCHON

in the Netherlands, where it was used to control the introduced Prunus serotina Ehrh. (de Jong et

al., 1990). BIOCHON was commercially available for several years as a method for combating

the invasive North American Prunus and Populus spp. in natural and commercial forests in the

Netherlands (de Jong, 2000). In Canada, two stump treatment products, Myco-techTM and

ChontrolTM, containing native isolates of C. purpureum have been developed and registered.

Extensive epidemiological evidence showed that C. purpureum posed no threat to susceptible









crops grown further than 500 m from the application site (de Jong et al., 1990). The use of this

control method will have only a limited impact on non-target trees since the spores of this fungus

are ubiquitous and healthy trees are resistant to attack. However, Setliff (2002) showed that C.

purpureum is an important pathogen with epidemic potential in forest tree species especially in

the Betulaceae (Betula and Alnus) and the Saliaceae (Populus and Salix) families. A thorough

investigation into the ecological impacts of C. purpureum for each geographical region should be

undertaken with the purpose of identifying low disease risk areas where C. purpureum can be

applied with the minimum environmental impact (Setliff, 2002). In South Africa, a

basidiomycete Cylindrobasidium laeve (Pers.) Chamuris was registered as the bioherbicide,

Stumpout. It is applied directly to freshly cut stumps of several invasive Acacia spp.. According

to Morris et al. (1999), this bioherbicide kills 95 to 100% of resprouting stumps.

Clidemia hirta-Colletotrichum gloeosporioides f.sp. clidemiae. Clidemia hirta (L.) D.

Don (Koster's curse), a perennial shrub native to Central and South America, and the islands of

the West Indies (Wester and Wood, 1977, Steyermark and Huber, 1978 in Peters, 2001) is

invasive in tropical forest understories particularly in the Hawaiian Islands. The negative effect

on the native ecosystem has led to the fear that similar effects will be felt in the other introduced

regions including the islands of Seychelles, the Comoros Island, Reunion, Mauritius, the

Malaysian Peninsula and parts of Micronesia (Palau) (Gerlach, 2006). First reported in Oahu in

1941 (Anon, 1954), Clidemia populations reached significant proportions by 1984 with more

than 60,000 ha infested forested areas on Kauai, Molokai, Maui, and Hawaii (Trujillo, 2005).

All management strategies implemented to date including physical removal and herbicide

treatments implemented have not proven practical and generally failed especially when initiated

after first fruit set. A fungus, Colletotrichum gloeosporioides (Penz) Sacc. f sp. clidemiae was









isolated from diseased clidemia leaves collected in Panama in 1985 (Trujillo, 2005). Following

the confirmation of specificity of this pathogen to C. hirta, permission was granted in 1986 by

the Hawaii Board of Agriculture to use C. gloeosporioides f. sp. clidemiae to control clidemia.

Repeated field inoculations undertaken from 1986 until 1992 at Aiea State Park, Oahu resulted in

significant control of the weed (Trujillo, 2005). After several spore formulations were tested for

field applications, a 5 x 105 per ml spore suspension amended with 0.5% gelatin and 2.0%

sucrose that caused severe defoliation was selected. Annual sprays directed at clidemia in Aiea

State Park, Oahu using this spore formulation resulted in effective control of the weed and in the

regeneration of several native species such as Acacia koa and fern species (Trujillo, 2005).

Hedychium gardnerianum-Pseudomonas solanacearum. Native to India, Hedychium

gardnerianum Ker-Gawl (wild ginger or kahili ginger) is widespread throughout the tropics and

is invasive in many forest ecosystems including Hawaii, New Zealand, Reunion, South Africa

and Jamaica (Anderson and Gardner, 1999). In 1954, H. gardnerianum was brought into Hawaii

as an ornamental plant where it subsequently escaped cultivation and is currently considered a

naturalized plant species. According to Anderson and Gardner (1999), kahili ginger has invaded

500 ha of Hawaii Volcanoes National Park forests (1000-1300 m elevation) and is found on all

islands in Hawaii (Smith, 1985). Displacing native plants in forest ecosystems, kahili ginger

forms dense stands that smother the native understory. Further spread is facilitated by rhizomes

which make this weed difficult to control (ISSG Database, 2006). Due to the fact that kahili

ginger is widely distributed throughout the Hawaiian national parks, environmental concerns

regarding herbicide use to control kahili ginger has resulted in biological control being

considered as the only practical approach for long-term management of this invasive weed in

native forests. A Hawaiian Ralstonia (=Pseudomonas) solanacerum (E.F. Smith) Yabuuchi et









al. strain was isolated from both edible (Zingiber officinale Roscoe) and ornamental gingers.

The isolate from edible ginger was less virulent than the isolate from ornamental ginger

(Anderson and Gardner, 1999). Ralstonia solanacerum systemically infects edible and

ornamental gingers causing decay and wilting of the infected tissue. Host-specificity tests

showed that this strain did not infect the tested native and cultivated solanaceous species. All

inoculated H. gardnerianum plants including rhizomes developed symptoms within 3 to 4 weeks

after inoculation, with most inoculated plants completely dead within 4 months (Anderson and

Gardner, 1999). While limited infection occurred close to the inoculation sites on H. coronarium

J. Konig, Z. zerumbet (L.) Sm., Heliconia latispatha Benth., and Musa sapientum Gros Michel,

no further systemic infection was observed in these species and the plants continued to grow

normally (Anderson and Gardner, 1999). Despite concerns about the potential negative impacts

of the bacterium on the edible ginger Z. officinale, Anderson and Gardner (1999) concluded that

kahili ginger infestations were often remote enough to limit the risk of contamination to edible

ginger plants. Ralstonia solanacerum should contribute to the control of H gardnerianum,

however, possible contamination of agricultural lands from runoff water from treatment areas

should be considered when using the R. solanacearum as a biocontrol agent (Anderson and

Gardner, 1999).

Biological Control Strategies for Cogongrass

The use of one or more biotic organisms to maintain another pest organism at a level where

it is no longer a problem is known as biological control. Agents are selected on the basis of their

specificity and ability to cause significant damage to the target organism (Evans, 1991).

Biological control of weeds with plant pathogens can adopt either a classical, augmentative or an

inundative (bioherbicide) approach. The classical biocontrol approach involves the introduction

of natural enemies from the center of origin to an area where it does not occur to control the









target weed in exotic environment, and augmentative approach involves periodic releases of the

control agent to augment an existing biocontrol population, while an inundative approach utilizes

the application of indigenous biocontrol agents in massive doses to create an epidemic within the

target weed population. During the 1970s, when weed biocontrol was still the domain of

entomologists, there was a rapid increase in interest by scientists in exploiting pathogens,

particularly fungi, for weed control (Freeman, 1981). Until fairly recently there has been a

dearth of information on the biological control of grassy weeds (Evans, 1991) with information

on the natural enemy complex. The effect of this complex on the population dynamic is largely

unknown and a general lack of basic botanical information on the centers of origin and diversity.

Implementing biological control strategies to manage cogongrass is especially pertinent in

natural ecosystems and low maintenance areas where the costs of using chemical and mechanical

control methods would be prohibitive. Based on literature records and on-line databases, there

are a number of potential biocontrol agents, including plant pathogens, arthropods and other

invertebrates associated with cogongrass throughout the world (Van Loan et al., 2002). This list

includes 24 fungi, 51 insects, six nematodes, four mites and a parasitic plant in the USA (Minno

and Minno, 1998).

Potential Insect and Nematode Biocontrol Agents

In Malaysia, Vayssiere (1957) reported several polyphagous insect species that caused

damage on cogongrass as well as other cultivated cereals. Although Bryson (1985, 1987)

reported that three species of the North American skipper butterfly (Lepidoptera: Hesperiidae)

fed on cogongrass, they were deemed to be unsuitable as biocontrol agents due to their lack of

host specificity. The gall midge, Orseoliajavanica Kieffer and van Leeuwen-Reijnvaan

reportedly host specific to I. cylindrica (Mangoendihardjo, 1980; Soenarjo, 1986) and destroys

the apical shoot meristem particularly in areas where I. cylindrica is regularly cut or slashed. By









reducing photosynthesis due to leaf blade reduction, heavy infestations could ultimately lead to

lower rhizome carbohydrate reserves. Unfortunately, gall midges are known to be highly

parasitized by generalist parasitoids (Van Loan, 2002) thereby limiting their effectiveness as

biocontrol agents.

Other potential agents include the nematode Heterodera sinensis Chen, Zheng and Peng,

the mite Aceria imperata Zaher and Abou-Awad and two unidentified dipteran stem borers (Van

Loan, 2002). An extensive survey of herbivorous arthropods and pathogens of cogongrass

throughout Florida (Minno and Minno, 1998) showed that the insect fauna associated with

cogongrass in Florida was similar to that associated with cogongrass in Africa and Asia. Several

fungi, nematodes, mites, elaterid and scarab beetles, skipper butterfly and moth caterpillars, and

grasshoppers were shown to cause damage.

Potential Plant Pathogenic Biocontrol Agents

Pathogens associated with cogongrass include Myrellina imperatae Sankaran and Sutton

which causes leaf spots and chlorosis and Giberella imperatae C. Booth and Prior which

originates from from Papua New Guinea and Australia and causes dieback of cogongrass

(Sankaran and Sutton, 1992; Booth and Prior, 1984). Xanthomonas albilineans (Ashby)

Dowson, the causal agent of leaf scald of sugarcane, reportedly caused the appearance of

discolored lines along the leaf veins of cogongrass in Australia (Persley, 1973). Other reported

pathogens include Puccinia rufipes Diet., Claviceps imperatae Tanda and Kawatani, Monodisma

fragilis Alcorn, Deightoniella africana Hughes, Mycosphaerella imperatae Sawada, Bipolaris

maydis (Y. Nisik.) Shoemaker, Colletotrichum caudatum (Sacc.) Peck, C. graminicola (Ces.)

G.W. Wilson, Aschochyta sp., Didymaria sp., Dinemasporium sp., Chaetomiumfusiforme

Chivers and Helminthosporium, Curvularia and Fusarium species (Chadrasrikul, 1962; Chase et

al., 1996; Caunter, 1996).









In the late 1980s, Caunter and Wong (1988) surveyed for foliar pathogens ofl. cylindrica

throughout Malaysia and, while they generally found low disease incidence, several candidate

fungi were isolated including Colletotrichum caudatum, Aschochyta sp., P. rufipes, C.

graminicola, Didymaria sp., and Dinemasporium sp. An investigation into the bioherbicide

potential of the pathogen C. caudatum in Malaysia showed that greenhouse inoculations caused

necrotic streaks along the leaf edges but no plant death was observed (Caunter, 1996). C.

caudatum was recently identified on cogongrass in Florida (Minno and Minno, 1998).

Chase et al. (1996) evaluated the pathogenicity of several fungi isolated from diseased

cogongrass collected at various sites in Florida. Research showed that four of the six isolates

were pathogenic to cogongrass causing up to 100% disease incidence. There was no record of

weed mortality. Chaetomiumfusiforme and an isolate from the Helminthosporium species group

were found to be the most promising based on the level of disease incidence recorded in the

greenhouse. In 2001, Yandoc (2001) screened both fungal isolates collected from cogongrass

stands in north central Florida and fungal pathogens previously isolated from various diseased

grasses collected throughout Florida for pathogenicity and biocontrol potential. The study

revealed that an isolate of B. sacchari from cogongrass and D. gigantea from large crabgrass had

potential as biocontrol agents. Several obligate biotrophs including Puccinia imperatae Poirault,

P. fragosoana F. Beltran and P. rufipes Diet. should be considered as potential classical

biocontrol agents for cogongrass. A smut, Sphacelotheca \/I hl e'inti Ilhi, it (Thum.) Sacc., is

well represented on cogongrass in the Old World, mainly Africa (Evans, 1991) and recently,

Minno and Minno (1998) found the smut on cogongrass in Florida. It is interesting to note that

these obligate parasites are common in the Mediterranean region where cylindrica is not a

serious weed (Evans, 1991; Holm et al., 1977).









Mycoherbicides

Mycoherbicides utilize indigenous fungi isolated from weeds and cultured to produce large

quantities of spores or mycelia that can be applied at rates that will cause high levels of infection.

The eventual goal of the mycoherbicide approach is the suppression of the target weed before

economic losses are incurred (Templeton, 1982). One to several applications is generally

required annually as the pathogens do not maintain sufficient inoculum to initiate new epidemics

on new weed infestations (Charudattan, 1988; TeBeest et al., 1992). According to Yandoc-Ables

et al. (2007), 200 or more plant pathogens, including foliar and soil-borne fungi, bacteria and

deleterious rhizobacteria have been or are currently under evaluation as potential bioherbicides.

Worldwide, 10 bioherbicides have been registered since 1980; in South Africa, Stumpout

(Cylindrobasidium laeve) and Hakatak (Colleotrichum acutatum J.H. Simmonds); in the USA,

Lockdown[formerly Collego] (Colletotrichum gloeosporioides (Penz.) Penz. and Sacc. in

Penz. f. sp. aeschynomene), Dr. BioSedge [Puccinia canaliculata (Schwein.) Lagerh], DeVine

[Phytophthora palmivora (E.J. Butler) E.J. Butler], Smolder (Alternaria destruens E.G.

Simmons); in Canada, Mallet WP [formerly BioMal] (Colletotrichum gloeosporioides f sp.

malvae); in Japan, CampericoT (Xanthomonas campestris Migula pv. poae); in China, Lubao

(Colletotrichum gloeosporioides f.sp. cuscutae); and the Netherlands, BioChon

(Chondrostereum purpureum) (Charudattan, 2001) were or currently are registered as

bioherbicides in the USA and Canada. Limited availability of many other bioherbicides can be

ascribed to the continued lack of commercial backing, high costs of mass production, limited

markets, resistant weed biotypes and new chemical herbicide chemistries (Charudattan, 2001).

A major constraint in bioherbicide development is the requirement for appropriate formulations

for successful establishment of the bioherbicide in the field to overcome the dew requirement

that exists for several of them (Auld, 1992; Greaves and McQueen, 1990). Various invert and









vegetable oil emulsion formulations have eliminated or greatly reduced the free moisture

requirements and increased efficacy of spore inoculum (Boyette et al., 1999). Environmental

conditions are among the primary factors that influence formulation performance of

bioherbicides as inoculum production is dependent on sporulation of the formulation. One likely

limitation on the practical efficacy of using D. gigantea as a mycoherbicide is the fact it does not

readily sporulate in liquid culture (Chandramohan, 1999). Yandoc and Charudattan (1998) were

able to culture D. gigantea and B. sacchari readily on several grains. Chandramohan (1999)

showed that by using a biphasic culturing system, where the blended fungal cultures, derived

from the liquid phase, are spread on trays and allowed to dry gradually. This system allows for

multiple spore harvests with up to three years viability when stored at 40C in sterile soil or as dry

spores. However, spore viability ofD. gigantea and B. sacchari on solid substrates was reduced

even after a short-term storage. The dew period and temperature requirements for both fungi

were determined (Chandramohan, 1999; Yandoc et al., 2005) and these two factors should not be

a limiting factor in their practical application as bioherbicides. Chandramohan (1999) showed

that a 12 h dew period at 28 C was optimal for D. gigantea and within a range that occurs

normally under field conditions. Chandramohan et al. (2002) demonstrated that several

pathogens could control different weedy grasses under field conditions using an emulsion based

inoculum preparation either singly or in combination. Yandoc (2001) showed that the efficacy

ofD. gigantea and B. sacchari could be improved by formulating their spores in an oil emulsion

and that the formulation caused higher levels of disease and damage with as little as a 4 h dew

period in the field.

Genetic Variation in Invasive Weeds: The Implication for Biological Control

Knowledge of the taxonomy of a selected target weed is a prerequisite for undertaking

extensive and often costly explorations for potential biological control agents in the native range









(Morin et al., 2006). Although host specific biological control agents are most likely to be found

within the native range of the target weed, agents have been used from the introduced range, and

from congeners when host-specific requirements were broad (Van Klinken and Julien, 2003;

Wapshere et al., 1989). Biological control agents are likely to be more diverse and hosts-specific

in the centre of diversity for the genus and these regions should always be considered for initial

exploration (Wapshere et al., 1989; Miller-Scharer et al., 1991). Determining the native host

range starts with an extensive literature search and consultations with herbaria worldwide, with

additional taxonomic and/or molecular work to fine tune the distribution and occurrence of

genotypes (Goolsby et al., 2006). The importance of identifying the origin and/or the genetic

diversity of invasive weed populations has been essential to implementing successful biocontrol

program. Within the following biological control program examples, Salvinia (Forno and

Harley, 1979); Chondrilla (Chaboudez, 1994); Rubus (Evans et al., 1998); Onopordum

(O'Hanlon et al., 2000a), Chromolaena (Ye et al., 2004) and Ligustrum (Milne and Abbott,

2004), all incorporated molecular studies to determine the genetic diversity of related native

species or populations to determine the putative centre of origin (Wardill et al., 2005). The

genetic variation of invasive plant populations, through the selection of resistant genotypes and

differential efficacy resulting from genotypic variation, can be challenging for weed management

strategies (Sterling et al., 2004). Weed populations vary significantly in size and morphological

character expression as a consequence of phenotypic plasticity as individual genotypes respond

to changes in environmental factors by changing their growth and development. Genetic

differentiation, between and within populations, causes variation in weed species and if weed

populations are persistent in an area long enough to enable local environment adaptation, then

genetic differentiation is favored (Barrett, 1982). Increasing evidence suggests that rapid









adaptive evolution of invasive plants is occurring during the process of range expansion (Miller-

Scharer et al., 2004). Whether this evolutionary change affects plant-antagonist interactions will

have significant implications for biological control of invasive plant programs. Practical

implications of understanding the population genetic structure of a target invasive weed include

the reconstruction of the historical process of migration and colonization. Insights into the

ecological persistence and evolutionary potential of populations in new habitats ultimately lead

to a better understanding of weedy adaptation (Shilling et al., 1997). According to Shilling et al.

(1997), Florida cogongrass is highly outcrossed, as indicated by morphological, RAPDs and

mode-of-reproduction studies. However, evidence of clonal populations was also observed.

Cogongrass populations develop greater genetic diversity by reproducing through seed and

vegetatively propagating rhizomes, allowing the weed greater adaptive changes to the

environment.

Biological Control and Genetic Markers

Molecular genotyping of the target weed using DNA-based molecular markers may

provide information that allows biocontrol researchers to pinpoint the origin of an invasive

species or population (Nissen et al., 1995). Different DNA-based marker techniques, including

chloroplast DNA restriction fragment length polymorphisms (cpDNA RFLP) and random

amplified polymorphic DNA (RAPD) analysis, provide estimates of genetic variation,

identifying species and other locally adapted forms, and define genetic relationships. These tools

are well-established and widely used in weed research (Nissen et al., 1995; O'Hanlon et al.,

2000b). A study by Wardill et al. (2005) used internal transcribed spacer regions (ITS1) and

non-coding chloroplast trnL DNA fragments to identify eight of nine described subspecies of

Acacia nilotica (L.) Delile and reported a previously unknown Pakistan genotype. The study

verified that the Australian populations were mostly comprised ofA. nilotica ssp. indica (Benth.)









Brenan and suggested that surveys for biocontrol agents should concentrate on the Indian

subcontinent, A. nilotica ssp. indica's native range.

Inter simple sequence repeat (ISSR) techniques employ an approach similar to RAPD

except that ISSR primer sequences are designed from microsatellite regions dispersed throughout

the various nuclear genomes and the annealing temperatures used are higher than those used for

RAPD markers. The ISSR method is an intermediate technique between RAPD-PCR and more

advanced techniques including simple sequence repeats (SSR) and amplified fragment length

polymorphisms (AFLP). Inter simple sequence repeat analysis involves PCR amplification of

genomic DNA using a single primer that targets the repeat, with 1 to 3 bases that anchor the

primer at the 3' or 5 end. In addition to freedom from the necessity of obtaining flanking

genomic sequence information, ISSR analysis is technically simpler than many other marker

systems. The method provides highly reproducible results and generates abundant

polymorphisms in many systems. The first studies employing ISSR markers were published in

1994 (Zietkiewicz et al., 1994; Gupta et al., 1994) with the initial studies focusing on cultivated

species and the hyper variable nature of ISSR markers was demonstrated (Wolfe and Liston,

1998). To test the utility of the method in natural populations, Wolfe et al. (1998a, b)

reexamined a known hybrid complex of four species of Penstemon for which three other

molecular data sets were available. Their results clearly demonstrated the utility of ISSR

markers for addressing questions of hybridization and diploid hybrid speciation. Based on the

published, unpublished and in-progress studies conducted using ISSR markers, it is clear that

ISSR markers have great potential for studies of natural populations (Wolfe et al., 1998b).

O'Hanlon et al. (2000b) classified and discussed the goals of genetic weed research into

three areas of investigation: (i) patterns of genetic diversity within invading weeds; (ii) the









taxonomic identity of weeds; and (iii) determining the origins) of introduced weeds.

Widespread concerns that weed species with higher levels of genetic diversity will exhibit

considerable potential for adaptation; thereby reducing the effectiveness of weed control has led

to the prioritization of determining the extent of variation in weed species (Dekker, 1997). There

is, despite these efforts, a lack of evidence correlating genetic diversity with physiological,

morphological or other ecological adaptations, including adaptations to biocontrol agents

(Chaboudez and Sheppard, 1995).

The objectives of this study were to: 1) determine the genetic variation between

Southeastern USA and African cogongrass using populations markers and DNA sequence data to

interpret the relation with respect to implementing biological control strategies using two fungi,

Bipolaris sacchari and Drechslera gigantea, in Benin, West Africa; 2) determine the

applicability of using the B. sacchari and D. gigantea associated with cogongrass in Florida and

Benin as bioherbicides on the West African cogongrass by assessing the disease severity of the

pathogens, individually and as a mixture, on cogongrass populations from Southeastern USA and

West Africa; 3) assess the effectiveness of biotrophic fungi as potential classical biological

control agents on the West African cogongrass; and 4) implement a field trial using an amended

oil Colletotrichum caudatum formulation on West African cogongrass.









CHAPTER 2
AN EXAMINATION OF GENETIC DIVERSITY OF Imperata cylindrica BASED ON INTER-
SIMPLE SEQUENCE REPEATS AND SEQUENCE ANALYSIS OF INTERNAL
TRANSCRIBED AND CHLOROPLAST TRNL-F SPACER DNA

Introduction

The genetic variability of weedy plant populations presents significant challenges for weed

management, primarily because this variability may influence the effectiveness of control

methods. Generally, exotic invasive plants as colonizing species have fairly low levels of

genetic variation due to genetic bottlenecks resulting from a single introduction (Barrett, 1988;

Warwick, 1990). Despite low levels of variability, many exotic weeds colonize new areas

extremely well. Multiple founder events and hybridization within the founder populations may

lead to increased diversity, and unique genetic combinations could yield novel phenotypes

(Ellstrand and Schierenbeck, 2000). As with many invasive weeds, Imperata cylindrica (L.)

Beauv., has been introduced multiple times in the USA and has been present long enough to have

potentially evolved unique ecotypes. Some of this evolution may create genotypic variability

within a host that can influence the efficacy of management approaches (Sterling et al., 2004).

Understanding the interplay between host and pathogen with respect to pathogen life history and

genetic factors that affect pathogen establishment and spread is central to the choice of biological

control agents (Thrall and Burdon, 2004). Genetic diversity studies should reveal both the

underlying genetic diversity and the divergent evolution of target plant species. Highly diverse

populations might harbor differing levels of resistance to pathogens and ultimately prove more

difficult to control (Charudattan, 2005).

Imperata is a member of the family Poaceae within the subtribe Saccharinae and tribe

Andropogoneae (Panicoideae). There are nine Imperata species with a worldwide distribution in

the warm regions of both hemispheres. The genus is economically significant due to the weedy









characteristics of cylindrica [cogongrass] (Gabel, 1982). According to Gabel (1982), Imperata

cylindrica is the most variable species within this genus, with a wide geographic range. As such,

it would be expected to possess a high degree of morphological variability. This variability is

thought to be responsible for the multitude of scientific names for the species. Hubbard (1944)

and Santiago (1980) separated the species into five major varieties based on growth, geographic

origin, morphological characteristics and karyotype. Imperata cylindrica var. major, is native to

Asia, Australia, the Pacific Islands and East Africa and it is characterized by 2n = 20

chromosomes. Imperata cylindrica var. europa, found in North Africa, the Mediterranean, and

east to Afghanistan and is characterized by 2n=40 chromosomes. Imperata cylindrica var.

africana found in Southern, Central and West Africa has a chromosome count of 2n=60.

Imperata cylindrica var. condensata and I. cylindrica var. latifolia are present in Chile, South

America and Northern India respectively but chromosome numbers for these species have not

been reported. Hubbard (1944) and Santiago (1980) also reported differences in floral and leaf

morphology that distinguishes the different varieties within I. cylindrica. However, Gabel

(1982) cited that the variability between the varieties of cylindrica was greater than between

the species of Imperata as a whole and does not recognize the varietal distinctions as described

by Hubbard (1944).

In the United States, the potential for genetic variability and the development of adapted

genotypes exist because there were at least two separate cogongrass introductions into the U.S.

Southeast during the last century (Shilling et al., 1997). The variety major was accidentally

introduced into Alabama from Japan in 1912 and purposefully introduced to Mississippi in 1921

from the Philippines as a potential forage crop. Forage trials were conducted in Florida, Texas

(where the planting died out in the first year) and Alabama (Dickens, 1974; Hall, 1983; Tabor,









1949; Tanner and Werner, 1986), leading to the establishment of populations. Adding to the

genetic variability is I. brasiliensis Trin. (Brazilian satintail), which is native to North, Central

and South America and overlaps in its distribution with cogongrass in Florida and possibly

elsewhere in the Southeast. The Brazilian satintail and cogongrass are morphologically and

genetically very similar, and their hybrids produce fertile offspring (Shilling et al., 1997).

Hybridization, introgression, and overlapping morphological characters often cause taxonomic

confusion between the two species, especially in North America. Both are both nonnative,

rhizomatous perennial grasses in the USA, similar in appearance and are primarily distinguished

by stamen numbers. The Brazilian satintail usually has one stamen per flower while cogongrass

has two stamens per flower (Gabel, 1982; Hubbard, 1944). Other distinguishing characteristics

include Brazilian satintail's relatively shorter spikelets (<3.5 mm) and narrower culm leaves (<5

mm) compared to cogongrass (Allen and Thomas, 1991). These characteristics overlap (Gabel,

1982; Lippincott, 1997) and it is likely that the two grasses have been misidentified in the

Southeast (Lippincott, 1997). Identification is further confounded by Brazilian satintail x

cogongrass hybridization in the Southeast, the extent of which is unknown (Willard et al., 1988).

Some systematists consider the two species synonymous. Hall (1978) suggests that Brazilian

satintail be classified as an infrataxon within I. cylindrica, while Gabel (1982) separates the taxa

as two distinct species based upon continents of origin and morphological, cytological and

genetic attributes. At present, it is unlikely that I. cylindrica will spread outside of the USA Gulf

Coast States due to the plant's lack of low-temperature tolerance. An ornamental variety I.

cylindrica var. rubra (Red Baron/Japanese Blood Grass) is being sold in nurseries in the United

States, which is more cold tolerant than var. major (Wilcut et al., 1988). If this variety were

introduced into the southeastern USA and it hybridizes with var. major, the resulting offspring









may be more cold hardy and potentially extend its invasive range north and westward (Shilling et

al., 1997).

Molecular characterization could potentially fill in the taxonomic gaps that exist within I.

cylindrica. Within cogongrass populations in Florida, RAPD analyses, coupled with

morphological characterization studies, showed that cogongrass was highly outcrossed but clonal

populations were also observed. This suggested that cogongrass spread in Florida was through

both seeds and rhizomes (Shilling et al., 1997). Using RAPD analyses, Cheng and Chou (1997)

identified distinct ecotypes within six cogongrass sites selected from diverse habitats in Taiwan.

The I. cylindrica phenotypes varied with habitat and environment, being affected by soil

conditions, temperature, and other climatic factors. Genetic variation, determined by restriction

fragment-length polymorphisms (RFLPs) of the intergenic spacer region (IGS) of ribosomal

DNA (rDNA) in inter- and intra-specific populations of cogongrass in Taiwan revealed two

major clusters. One population (Chuwei) was found to be distinctly different from the remaining

14 populations studied based on the phylogenetic study (Chou and Tsai, 1999).

DNA sequence analysis is used extensively for phylogenetic studies at many different

taxonomic levels (Chase et al., 1993; Soltis et al., 1999; Salamin et al., 2002). The internal

transcribed spacer (ITS) region has often been utilized in phylogenetic studies of flowering

plants and grasses (Baldwin et al., 1995; Hodkinson et al., 2002a; Hodkinson et al., 2002b). The

chloroplast genome has also been used in plant systematics for phylogeny reconstruction (Souza-

Chies et al., 1997). Some noncoding regions of chloroplast DNA such as the trnL-intron and

trnL-F spacer (Taberlet et al., 1991; Chase et al., 2000) have been used for evolutionary studies

of closely related taxa.









The objective of my study was to characterize the genetic variation between the

Southeastern USA and West African cogongrass using inter-simple sequence repeat (ISSR)

markers and sequence analysis of the internal transcribed spacer region (ITS) and the noncoding

chloroplast trnL-trnF spacer DNA. The data were interpreted in relation to the implementation

of biological control strategies using the fungi, Bipolaris sacchari (E. Butler) Shoem. and

Drechslera gigantea (Heald and F.A. Wolf) Ito, in Benin West Africa.

Materials and Methods

Population Sampling

Florida Imperata cylindrica accessions. Imperata cylindrica accessions were collected

from 32 counties throughout Florida, USA during summer 2004 (Appendix C). Two sites were

sampled within each county, and the sites were at least 20 miles apart. Five individual plants

were collected from every site; each sampled at least 10 m apart to minimize progeny sampling.

Samples were brought back to Gainesville and established under greenhouse conditions in a

commercial potting mix (Metromix 300; Scott's Sierra Horticultural Products Co., Marysville,

Ohio).

West African Imperata cylindrica accessions. West African I. cylindrica accessions were

collected from infested cogongrass sites during the summer of 2005 and 2006. Rhizomes were

collected from natural and invasive cogongrass sites in Cameroon, The Guinea, Benin and

Nigeria and transported to the International Institute of Tropical Agriculture (IITA), Benin

experimental station (Appendix D). The rhizomes were cut into 4-cm segments and planted in

plastic tubs containing field soil.

Extraction of Genomic DNA and PCR Amplification of ISSR Population Markers

Genomic DNA was extracted from fresh leaf samples (50 mg) using the DNeasy plant

mini kit according to the manufacturer's directions (QIAGEN, Chatsworth, California).









Inter Simple Sequence Repeats. Three ISSR primers used in the study, UBC-825

([AC]sT), UBC-830 ([TG]sG) and UBC-841 ([GA]sYC; Y = C or T), were obtained from the

University of British Columbia (UBC). The PCR amplifications were carried out in volumes of

25 pl containing 18 il of ddH20, 2.5 il of 10X buffer (Invitrogen), 1.5 C1 of 50 mM MgCl2

(Invitrogen, Carlsbad, California), 0.5 il of an equal mixture of 10 mM dNTPs (Invitrogen), 1

unit of Taq DNA polymerase, and 2.0 pl template DNA. DNA amplification was performed in

an MJ Research PTC-100 thermocycler (Watertown, Massachusetts) and the initial denaturation

step was setup to run for 1.5 min at 94 C, followed by 34 cycles of 40 s at 94 oC, 45 s at 48 C

(UBC-825), and 50 C (UBC-830; UBC- 841), 40 s at 72 C, 45 s at 94 oC, 45 s at 47 C (UBC-

825) and 49 C (UBC-830 and UBC-841) (modified from Wolfe et al., 1998b). Different

annealing temperatures were obtained for optimization of the West and South African I.

cylindrica accessions with 45 s at 51.7 C (UBC-825), 52.6 C (UBC-830), and 48.4 C (UBC-

841). The final extension step was run for 5 min at 72 C. PCR products were separated by

electrophoresis at 70V for 2.5 h in 1.2% agarose gels prepared in IX TAE buffer stained with

2% ethidium bromide. Band sizes were estimated using 100bp ladder (Invitrogen; Biolabs).

Negative controls, lacking template DNA, were included in each PCR reaction and all

sample/primer combinations were repeated at least once. Replicate DNA extractions were

carried out on a subset of the samples and the arbitrary 'fingerprint' of these was compared with

the original. In all cases, an identical profile was obtained. In studies using ISSR primers in

natural populations (Wolfe et al., 1998a, b), three primers were generally sufficient to genotype

every individual in the study. The ISSR primer sequences, obtained from the University of

British Columbia Biotechnology Laboratory, were selected as they yielded polymorphisms in a









preliminary genetic diversity study (The Soltis Lab, Florida Museum of Natural History,

Dickinson Hall, University of Florida, Gainesville, Florida).

Bands were scored for presence or absence for each DNA sample (See Figure 2-1 A, B for

examples of gel photographs). The binary data matrix was inputted into POPGENE (Yeh et al.,

1997), assuming all loci were dominant and in Hardy-Weinberg equilibrium. The following

indices were used to quantify the amount of genetic diversity within the Imperata populations

examined: the number and percentage of polymorphic loci, Nei's genetic identity (h) (Nei,

1973), and Shannon index of phenotypic diversity (1) (King and Schaal, 1989). Genetic

differentiation among populations was estimated by Nei's gene diversity statistics. Pairwise

genetic distance among populations was calculated to construct an unweighted pair-group

method arithmetic average (UPGMA) dendrogram. An analysis of molecular variance

(AMOVA; Excoffier et al., 1992) computed with Arlequin 1.1. (Schneider et al., 1997), which

assumes these data are haplotypic, was conducted to calculate variance components and their

significance levels for variation between cogongrass accessions from Africa and the USA,

among accessions within a region, and within populations.

DNA sequence analysis. The ITS region was amplified by PCR using a forward primer

(F=CTAGGGCGTCAAGGAACACTTCTATTGC) and the reverse primer

(R=CGATGCGCTGCGGTGCTCGATGGGTCCT) designed from the I. cylindrica genotype

122 [AY116297] (Hodkinson et al., 2002b). The plastid trnL intron and the trnL-F intergenic

spacer for noncoding chloroplast DNA were amplified as one unit using the Universal C and F

primers described by Taberlet et al. (1991). For ITS, the thermal cycling (MJ Research PTC-

100, Watertown, Massachusetts) comprised 30 cycles, each with 3 min denaturation at 940C, 30 s

annealing at 57C, and an extension of 45 s at 720C. A final extension of 5 min at 720C was also









included. For trnL-F, the thermal cycling comprised 30 cycles, each with 1 min denaturation at

94C, 1 min annealing at 530C and 55 C for the USA and West Africa samples respectively, and

an extension of 3 min at 720C, including a final extension of 5 min at 720C. Amplified DNA

fragments were purified using Qiagen PCR purification kit.

Nucleotide sequencing of the DNA samples was carried out at the University of Florida

DNA Sequencing Core Laboratory using ABI Prism BigDye Terminator cycle sequencing

protocols (part number 4303153) developed by Applied Biosystems (Perkin-Elmer Corp., Foster

City, CA). The excess dye-labeled terminators were removed using MultiScreen 96-well

filtration system (Millipore, Bedford, MA, USA). The purified extension products were dried in

SpeedVac ((ThermoSavant, Holbrook, NY, USA) and then suspended in Hi-diformamide.

Sequencing reactions were performed using POP-7 sieving matrix on 50-cm capillaries in an

ABI Prism 3130 Genetic Analyzer (Applied Biosystems, Foster City, CA, USA) and were

analyzed by ABI Sequencing Analysis software v. 5.2 and KB Basecaller.

Forward and reverse DNA sequences were aligned with CLUSTAL X (Thompson et al.,

1997) with subsequent manual correction using MacClade 4 (Maddison and Maddison, 2000).

Gaps were coded as missing data. Phylogenetic analysis was by a distance method (neighbor

joining) and parsimony (strict consensus). Support for internal branches was assessed by using

1,000 bootstrapped data sets but saving no more than 10 trees per replicate to reduce time spent

swapping on large numbers of trees (Felsenstein, 1985). Parsimony and distance analyses were

conducted with the computer software program PAUP [PAUP: Phylogenetic Analysis Using

Parsimony, version 4.0b8] (Swofford, 1998). Heuristic searches included 1,000 replicates of

step-wise addition sequence with tree-bisection reconnection (TBR). Four supplementary .

cylindrica accessions [I. cylindrica var. major AF345653, AF345653; AY116297; AF190764]









were included in the analyses after a BLAST search was performed (Altschul et al., 1997).

Erianthus rockii Keng (AY345217), Miscanthus sinensis Andersson (EF211950; EF211950),

Saccharum arundinaceum Retz. (AY116295), Pennisetum purpureum Schumach. (AF325232),

Setariaparviflora (Poir.) Kerguelen (AF 109831) and Echinochloa crus-galli (L.) Beauv.

(AJ113708) were chosen as outgroups for the analyses from GenBank (as described by

Hodkinson et al., 2002b).

Voucher specimens of the USA and African cogongrass accessions treated in the ITS study

are listed in Appendix A and Appendix B.

Results

Analysis of ISSR Markers

The three primers, UBC-825 ([AC]sT), UBC-830 ([TG]sG) and UBC-841 ([GA]sYC; Y =

C or T), produced multiple, clear and reproducible bands with heterogeneity

within/between/among populations (Figure 2-1 A, B). The three primers yielded 36 putative loci

among all I. cylindrica accessions and the three closely related species, I. brasiliensis, I.

brevifolia Vasey and I. cylindrica var. rubra. At the species level, the Imperata cylindrica from

North West Florida had the highest number of polymorphic loci, 19 (h = 0.1702,1 = 0.2594).

Imperata cylindrica from Benin and Nigeria followed closely with 18 polymorphic loci (Benin:

h = 0.1667,I= 0.2524; Nigeria: h = 0.1535; I= 0.2388), respectively (Table 2-1). WhileI.

cylindrica var. rubra had only 4 polymorphic loci (h = 0.0448, I= 0.0656), 1. brasiliensis, I.

brevifolia and I. cylindrica (The Guinea) showed no polymorphisms and this is possibly due to

the small sample size (1- 4 samples) analyzed. At the population level, the percentage of

polymorphic loci (P), Nei's gene diversity (h), and Shannon's index (1) were 94.44%, 0.2662 and

0.4121, respectively (Table 2-1). The coefficient of gene differentiation was high (GST

0.6542). All three parameters indicated that genetic diversity within populations was









comparatively equal. When populations were grouped according to geographic region, genetic

diversity of the African Imperata cylindrica was higher than the USA I. cylindrica and closely

related Imperata species as revealed by the percentage polymorphic loci and total gene diversity

(Table 2-2). The African populations exhibited higher genetic differentiation (GST = 0.5683)

than those in USA (GST = 0.3842) and closely related Imperata species (GST = 0.5777).

A UPGMA dendrogram based on pairwise genetic differences identified three strongly

supported geographic clusters [80%] (Figure 2-2) was generated. However, not all the African

accessions grouped together within the African cluster. The Nigerian accessions, with the

exception of accession 11, form a separate, strongly supported cluster (82%) and are genetically

different from all the Imperata accessions. One var. rubra accession (CGS66_1) is included

within the Nigerian cluster. It is interesting to note that a second var. rubra accession

(CGS66_2) is closely related to the I. cylindrica Florida accessions. The Guinea accession fell

within the I. cylindrica Florida accessions, forming a sister group with the I. cylindrica Florida

accessions, CGS52 and CGS64. The I. cylindrica Florida accessions grouped according to the

area from which they were sampled. The Imperata brevifolia formed a sister group with the

African accessions. Imperata brasiliensis groups together with the North West Florida

accessions.

AMOVA analysis indicated that more than a third of the total variation (33.63%) was

accounted for by differentiation among the African and USA Imperata groups, with a further

21.91% accounting for variation among populations within groups, and the remainder (44.45%)

was partitioned within the populations (Table 2-3).

Analysis of ITS

The aligned ITS matrix was 472 base pairs (bp) long yielding 296 constant, 71

uninformative and 105 parsimony-informative characters. Figure 2-3 shows one of 9,840









equally most parsimonious trees for the ITS sequence data with groups consistent in all shortest

trees marked as solid lines. The tree has 276 steps, with a consistency index (CI) of 0.8188 and a

homoplasy index (HI) of 0.1812.

The parsimony tree showed three main clusters, including the majority of I. cylindrica

accessions sampled from the USA and Africa (Figure 2-3). There was strong support for the

grouping (100%) containing the Florida cylindrica accessions (CGS27, CGS33, CGS21,

CGS38, CGS5, CGS41, CGS29, CGS56, CGS1, CGS20, CGS18, CGS19, CGS26, CGS30,

CGS35, CGS36, CGS37) including the brasiliensis accession. There was another strong

grouping (93% bootstrap support) for the remaining Florida cylindrica accessions (CGS42,

CGS52, CGS43, CGS48, CGS51, CGS53). There was no partitioning of accessions according to

the regions sampled within Florida (Appendix B). In addition, there was medium support (72%)

for the group containing all the West and South African accessions with the exception of a single

accession from Nigeria (CGN1) and Cameroon (CGC6) that were more closely associated with

the first group of Florida cylindrica accessions. There was strong support for the two .

cylindrica var. rubra accessions (89%) while the I. brevifolia was strongly grouped with Florida

/. cylindrica accession CGS63 (100% bootstrap support) and forms a sister group to the I.

cylindrica var. rubra.

The neighbor-joining tree (NJ) showed a more branched topology with different groupings

than those inferred from the parsimony tree (Figure 2-4). Compared with the parsimony tree,

there was a strong support (98%) for the group containing the Florida I. cylindrica accessions

CGS21, CGS5, CGS33, CGS38 and CGS41 and low support (67%) for the remaining accessions

in the clade (CGS29, CGS56, CGS18, CGS30, CGS1, CGS20, CGS37, CGS19, CGS26, CGS36

and CGS35). As with the parsimony tree, there was strong support (88%) for the group









containing the I. cylindrica Florida accessions CGS42, CGS52, CGS43, CGS48, CGS53 and

CGS5 land the distance analyses supported CGS42, CGS52, CGS43 and CGS48, CGS53,

CGS51 as sister groups. The NJ tree grouped the West and South African I. cylindrica

accessions together (98% bootstrap support) with the exception of single accessions from Nigeria

(CGN1) and Cameroon (CGC6) as seen in the parsimony tree. However, one Benin accession

(CGB2) was not included within the West/South Africa group and was more closely associated

with the Florida L cylindrica. There was strong support for the two L cylindrica var. rubra

accessions (86%) while the I. brevifolia was strongly grouped with Florida I cylindrica

accession CGS63 (94%) and is a sister group to the var. rubra.

The supplementary GenBank L cylindrica sequences grouped within the cylindrica

accessions. The one exception was I. cylindrica AF190764 which grouped within outgroups. A

possible reason for this is that the inputted sequence contained poor quality sequence

information.

Analysis of trnL-F

The aligned trnL-F matrix was 816 bp and yielded 796 constant, 11 uninformative and 9

parsimony-informative characters of which 5 were found in the two outgroups. Due to the low

variability of the locus, no additional analyses were undertaken (data not shown).

Discussion

In this study, the genetic variation in Imperata cylindrica using polymorphism among the

ISSR regions within the genome was assessed. The ISSR method proved to be robust and

reproducible and provided a relatively simple method of examining genetic variation with the

plant accessions.

Accurate estimates of genetic diversity within exotic invasive weeds are useful for

optimizing the application of both classical and inundative fungal biological control agents.









Several population-level studies of invasive weed species have used ISSR markers. In Phalaris

minor Retz., a diploid, predominantly inbreeding, annual grass weed found in India, relatively

low levels of polymorphisms were found within and between populations in comparison with

other grassy weed species (McRoberts et al., 1999). These finding are indicative of the

predominantly inbreeding behavior of P. minor (McRoberts et al., 2005).

Carthamus lanatus L. (saffron thistle), a widespread, invasive weed of crops and pastures

in Australia, is targeted for both inundative and classical biological control (Ash et al., 2003).

They identified two distinct groups of C. lanatus that correlated with location (northern and

southern regions). Within-group genetic diversity was lower in the northern group than the

southern group and the difference in these groups might have implications for the biological

control using exotic fungi.

Knowledge of the genetic variation in both native and invasive stands of Pueraria lobata

(Willd.) Ohwi [kudzu] could potentially lead to effective biological control measures (Sun et al.,

2005). ISSR studies of USA and Chinese populations of P. lobata and four closely related

cogeneric species, P. edulis Pampanini, P. montana (Lour.) Merr., P. phaseoloides (Roxb.)

Benth. and P. thomsoni Benth. revealed clear separation of the five species. Pueraria lobata

populations from the USA were genetically closer to the Chinese P. lobata populations than the

other congeneric populations. High genetic differentiation was observed in the Chinese samples

of P. lobata, P. montana, and P. thomsoni, while within the USA P. lobata population, a high

genetic diversity and low population differentiation was observed. Sun et al. (2005) stated that

these results supported the hypothesis of multiple introductions into the USA from different

sources in Japan or China, followed by subsequent gene exchange and recombination. The









results would suggest that the USA P. lobata population may not respond uniformly to classical

biocontrol agents.

A study of the genetic variation of Chromolaena odorata (L.) R.M. King & H. Robinson

across its invasive range in China using ISSR markers revealed low levels of variation with low

genetic population differentiation (Ye et al., 2004). The genetically homogeneous C. odorata

populations in China suggest that if a suitable biological control agent were effective for control,

there could potentially be a uniform host response to this biocontrol agent.

In the present study, all three genetic diversity indices (P = 94.44%, h = 0.2662 and I=

0.4121) revealed that the genetic diversity of L cylindrica is high. Genetic diversity within the

USA accessions was found to be higher than within the African accessions and this outcome

could be due to ecogeographic variation since the USA accesseions were located at different

latitudes and subtropical regions than the African accessions.

A high GST value (0.6542) indicated distinct genetic differentiation among the Imperata

accessions studied. Forty-four percent of the genetic variation in the samples can be attributed to

variation within populations (i.e., accessions). This differs from a study of RAPD and ISSR

techniques to detect genetic diversity ofMonochoria vaginalis (Burman f) C. Presl, a common

aquatic weed found in rice fields in southern China (Li et al., 2005). Despite slightly different

results between the RAPD and ISSR data, the study indicated low levels of genetic variation

within populations (23.30%) and a high degree of genetic variation (76.60%) among populations

ofM. vaginalis in southern China. In a recent study of the population genetic variation and

structure of the invasive weed Mikania micrantha H.B.K., high levels of genetic variation and

differentiation were detected in the introduced M. micrantha populations (Wang et al., 2007).

Although multiple introductions mitigated the loss of genetic variation associated with









bottlenecks, the authors found that the bottlenecks enhanced the population differentiation. An

AMOVA analysis indicated that 67.74% of the variation was partitioned within populations, with

28.83% attributed to differences among populations within regions, and 8.43% of the variation

due to regional differences.

An AMOVA analysis revealed that differentiation between the African and USA

accessions was 33.63% of the total gene variance while 44.45% of the variation was attributed to

variation within the accessions. This differentiation could possibly be explained by the

geographical isolation between the USA and Africa. Compared with population genetic

estimates based on ISSR analyses of other invasive weed species (Ye et al., 2004; Chapman et

al., 2004; Sun et al., 2005), substantial amounts ofintraspecific and within-population variation

was revealed across the introduced range ofL. cylindrica. By transforming among-population

variation from different geographical sources into within-population variation, high genetic

variation in introduced populations could be created through multiple introductions (Kolbe et al.,

2004). In this study, multiple introductions are inferred among the populations of cylindrica

and the results substantiate the fact that multiple introductions played a role in the spread of

cogongrass in the USA and possibly West Africa. Imperata cylindrica accessions that are

genetically more similar appear to maintain an equivalent level of genetic variation (Figure 2-2;

Table 2-1). Imperata cylindrica propagates by seeds and vegetatively through rhizomes. The

high genetic variation within populations and lower genetic differentiation among populations

suggests that the cylindrica accessions sampled are outcrossing with the cylindrica Florida

accessions seemingly more outcrossed compared to the African accessions. RAPD analyses of

10 Florida I. cylindrica populations revealed that cogongrass was highly outcrossed (Shilling et

al., 1997) though the data also showed evidence of clonal populations.









The results from this study indicates that the cylindrica accessions and the closely related

species I examined formed three distinct clusters, with the African and USA cylindrica

accessions geographically and genetically separated. Imperata cylindrica var. rubra formed a

sister group to the African accessions. The Imperata brasiliensis was not genetically distinct

from the cylindrica Florida accessions and are closely related.

The ITS phylogenetic analyses generated different tree topologies, with the African I.

cylindrica accessions distinct from the USA Imperata accessions. Within the Florida I.

cylindrica, the accessions sampled from West and East Florida did not group together. The .

brasiliensis grouped within the USA I. cylindrica accessions. However, the I. brevifolia was not

genetically distinct from all Imperata populations as seen in the ISSR dendrogram and formed a

strong group with a single Florida I. cylindrica accession (CGS63). Imperata cylindrica var.

rubra grouped together with and was genetically more similar to the African accessions, as

reflected in the ISSR data.

In summary, I. cylindrica maintains high levels of diversity throughout the USA and West

Africa. Multiple introductions, sexual reproduction allowing gene flow within populations, and

possible multiple founding populations by more than one genetically distinct individual are

factors that influence the high levels of diversity. The population structure ofL. cylindrica

revealed in this study has implications for cogongrass biological control management strategies

in USA and West Africa. The genetic difference between the USA and African I. cylindrica

accessions suggests that using West African accession would not be a suitable host for fungi

associated with cogongrass in the USA. It is interesting to note that the levels of disease

incidence and disease severity of the Florida isolates of B. sacchari and D. gigantea on the Benin

L. cylindrica accession were not significantly different when compared with the Benin isolates of









the same fungi. It is probable that, under an inundative biocontrol strategy, high inoculum levels

would negate any differences in host response. It is also important that multiple accessions of .

cylindrica be included for pathogencity screening with other candidate fungal biological control

agents.

Understanding weed population genetics can help biocontrol researchers determine

whether different genotypes exist within the target weeds exotic and native ranges. Variation in

response to disease within and among populations may be due to a number of causes: a) genetic

variation among plants for traits influencing their susceptibility to attack; b) local variation in

density or in genotype of pathogens; and c) local variation in the abiotic and biotic environment

factors (de Nooij and van Damme, 1988). Most weed species grow over a broad range of

environmental conditions and display large differences in size and morphology (Barrett, 1982).

Unfortunately, management aimed at the control of weeds is often developed without

consideration of the genetic diversity of the target populations, and studies on the genetic

variation of weeds on relevant spatial scales are still limited. The work reported here should

guide us to consider the level of genetic variation of selected weed targets, in conjunction with

other biotic and abiotic environmental conditions, when considering the implemention of

biological control programs.









Table 2-1. Genetic variability of all single sampled populations oflmperata cylindrica and
closely related species with the ISSR primers.
No. of Shannon
Accessions polymorphic loci P (%)a Nei's diversity index
36 loci total (h) (1)
South Africa 14 38.89 0.1454 0.2137
Benin 18 50.00 0.1667 0.2524
Cameroon 8 22.22 0.0899 0.1305
Nigeria 18 50.00 0.1535 0.2388
Central Florida 14 38.89 0.1325 0.1993
Central East Florida 9 25.00 0.1114 0.1587
Central West Florida 10 27.78 0.1141 0.1659
North Central Florida 15 41.67 0.1347 0.2056
North East Florida 12 33.33 0.1124 0.1695
North West Florida 19 52.78 0.1702 0.2594
cylindrica var. rubra 4 11.11 0.0448 0.0656
Total 34 94.44 0.2672 0.4159
Note: aPercentage polymorphic loci.










Table 2-2. Comparison of genetic diversity measures for all sampled populations of Imperata
cylindrica and closely related species as determined using ISSR population markers.
Parameters P (%)a Total gene Within Coefficient of
diversity (Ht) population (Hs) gene differentiation
(GST)

Total 94.44 0.2784 0.0226 0.0963 0.0037 0.6542

Africa 83.33 0.2574 0.0378 0.1111 0.0099 0.5683

USA 58.33 0.2017 + 0.0438 0.1246 0.0171 0.3824
USA and related
species 72.22 0.2085 + 0.0341 0.0880 + 0.0080 0.5777
a Percentage polymorphic loci.









Table 2-3. Summary of analysis of molecular variance (AMOVA) based on ISSR genotypes of
the African and USA Imperata cylindrica accessions.
Variance Percentage
Source of variation SSb components variation
Among groups 132.839 0.62830 33.63
Among populations within groups 40.0170 0.40996 21.91
Within populations 287.165 1.25219 45.45
Total 460.021
aDF = Degrees of freedom, b SS = Sum of squares,












North West Florida Accessions


1500






500 -







B










1500










Figure 2-1. Photographs of ISSR gels. A) Imperata cylindrica Florida accessions showing bands
generated with primer UBC-841. B) I. cylindrica Benin accessions showing bands
generated with all primers individually. Each lane is the result of an independent PCR
reaction. M is a 100-bp ladder.


Central Florida accessions















Scylmdrica South Africa (CGSA1)
I cylndrica Nigeria (CGN2)
I cylmdrica Bemnn (CGB1)
I cylmdrica Benin (CGB2)
I cylmdrica Benin (CGB5)
I cylmdrica Benin (CGB6)
75 I cylindrca Cameroon (CGC1)
I cylindrica Cameroon (CGC2)
I cylndrica Cameroon (CGC3)
78 1 clmdrnca Cameroon (CGC4)
I cynldrica Benin (CGB3)
79 I cylmndrca Bemn (CGB4)
77I cylmdrtca Nigeria (CGN11)
I brevifolia Californa (CGS6)
I cylmdrca North East Flonda (CGS61)
I cylmdrica The Guinea (CGG1)
I cylmdrica Central Flonda (CGS64)
I cylmdrica Central East Flonda (CGS52)
I cylndrica Central Florida (CGS2)
I cylmdrica Central Florida (CGS32)
I cylmdrica Central Florida (CGS36)
I cylmdrica Central East Florida (CGS51)
I cylindrica North Central Florida (CGS24)
I cylmdrica North Central Flonda (CGS35)
I cylmdrica Central Florida (CGS33)
I cylmdrica Central Florida (CGS55)
I cylmdrica Central Florida (CGS54)
I cylmdrica Central Florida (CGS56)
I cylmdrica Central Florida (CGS34)
I cylmndrca Central East Flonda (CGS47)
I cylmdrica Central Florida (CGS53)
I cylmndrca North Central Flonda (CGS22)
I cylmndrca North Central Flonda (CGS23)
I cylmndrca North Central Flonda (CGS47)
I cvlndrica North Central Fonda (CGS4)
I cvlndrica North Central Fonda (CGS19)
80 I cylmndrca North Central Flonda (CGS21)
I- I cylmdrica North East Florida (CGS41)
I cylmndrca North East Florida (CGS42)
I cylmndrca North East Florida (CGS61)
I cylndrica North East Flonda (CGGS43)
I cylmndrca Central Flonda (CGGS64)
I cylmndrca North Central Flonda (CGS60)
I cylndrica Central East Florida (CGS45)
I cylindrca Central East Flonda (CGS49)
71 ceylmndrca Central East Flonda (CGS46)
-I cylmdrica Central East Florida (CGS50)
I cylndrica Central East Fonda (CGS48)
I cylmdrtca Central Florida (CGS63)
I cylindrca North Central Florida (CGS20)
0 I cylimdrica North West Flonda (CGS9)
I cylmdrica North West Florida (CGS11)
72 I cylindrca North West Florida (CGS12)
F -I cylindrica North West Florida (CGS14)
I cylmndrca North West Florida (CGS58)
I brasihensis South East Flonda (CGS3)
I cylndrica Central West Flonda (CGS5)
I cylmndrca Central West Flonda (CGS25)
I cylmndrca Central West Flonda (CGS26)
I cvlmdrlca Central West Flonda (CGS27)
I cylindrca Central West Flonda (CGS29)
74 1I cylmdrica Central West Flonda (CGS30)
I cylindrca Central West Flonda (CGS31)
I cylindrca Central West Flonda (CGS57)
I cylmdrica North West Flonda (CGS59)
I cylmndrca South West Fonda (CGS65)
I cylmndrca Central West Florida (CGS28)
82 I cylmndrca North West Florida (CGS15)
8I cvlmdrica North West Flonda (CGS8)
SI cylmndrca North West Florida (CGS17)
I cylmndrca North West Flonda (CGS13)
L I cylmndrca North West Flonda (CGS16)
73 1- I cylmndrca North West Flonda (CGS18)
I cylmndrca North East Flonda (CGS38)
I cylindrca North East Florida (CGS40)
I cylmndrca North East Flonda (CGS62)
I cylmndrca North East Flonda (CGS39)
I cylmdrica var rubra (CGS66 1)
76 I cylindrca Nigena (CGN6)
6 I cylindrica var rubra (CGS66 2)
I cylndrica Nigeria (CGN8)
I cylndrica Nigena (CGN9)
I cylndrica Nigena (CGN10)



Figure 2-2. UPGMA dendrogram of all Imperata cylindrica accessions and closely related

species sampled based on ISSR data. Numbers above branches are bootstrap

percentages above 70%.














I cylindrca Central West Flonda (CGS27)
I cylindrca Central Flonda (CGS33)
I cylindrca North Central Flonda (CGS21)
I cylndrica North East Flonda (CGS38)
I cylndrica Central West Flonda (CGS5)
I cylndricaNorth East Flonda (CGS41)
I cylindrca Central West Flonda (CGS29)
I cylindrca Central Flonda (CGS56)
I cylindrca Central Flonda (CGS1)
I cylindrca North Central Flonda (CGS20)
I cylndricaNorthWest Flonda (CGS18)
I cylndrica North Central Flonda (CGS19)
I cylindrca Central West Flonda (CGS26)
100 I cylindrca Central West Flonda (CGS30)
I bras-ilensis South East Flonda (CGS3)
I cylindrca North Central Flonda (CGS35)
10- I cylindrca Central Flonda (CGS36)
I cylindrca North Central Flonda (CGS37)
I cylindrca Nigena (CGN1)
I cylndrica Cameroon (CGC6)

I cylindrca North East Flonda (CGS42)
I cylindrca Central East Flonda (CGS52)

93 I cylindrca North East Flonda (CGS43)
I cylindrca Central East Flonda (CGS48)
I cylindrica Central East Flonda (CGS51)
I cylindrca Central Flonda (CGS53)
96- I brevifoha Calfornma
I cylndrica Central Flonda (CGS63)

100 I cylndrca (AF092512)
cyhndrca (AF345653)
I cylndrica Bemnn (CGB5A)
I cylndrica Cameroon (CGC11)
I cylndrica Benn (CGB1)
I cylndrica Benn (CGB3A)
I cylndrica Nigena (CGN2)
I cylndrica Nigena (CGN4)
I cylndrica Bemnn (CGB2)
I cylndrica Cameroon (CGC2)
98 I cylndrica Nigena (CGN3)
I cylndrica Bemn (CGB5)
I cylndrica Nigena (CGN3A)
I cylndrica Nigena (CGN4A)
I cylndrica Nigena (CGN 2A)

I cyhndricava rubra(CGS66)
I cyhndricavar rubra(CGS66)
I cyhndrica South Africa (CGSA1)

I cylindrica (AY116297)
Sacc arundnaceum(AY116295)

100 98 Miscanthus snensis (EF211951)
Miscanthus sinensis (EF211950)

Ernanthus rock (AY345217)
I cyhndrica(AF190764)
89- Pennisetum purpureum (AF345232)
Setariaparvflora (AF019831)
Echnochloa crus-gali (AJ 113708)




Figure 2-3. Parsimony tree inferred from ITS sequence data for all Imperata cylindrica

accessions and closely related species. Numbers above branches are bootstrap

percentages above 80%. Numbers in parentheses represent the GENBANK accession

numbers.
















I cyhndrica North Central Florida (CGS21)
I cyhndrica Central West Florida (CGS5)
I cyhndrica Central Florida (CGS33)
I cyhndrica North East Florida (CGS38)
8 cylndrica Central West Florida (CGS27)
I cyhndrica North East Florida (CGS41)
I cyhndrica Central West Florida (CGS29)
I cyhndrica Central Florida (CGS56)
I cyhndrica North West Florida (CGS18)
I cylhndrca North West Florida (CGS30)
I cyhndrica Central Florida (CGS1)
I cyhndrica North Central Florida (CGS20)
I cyhndrica North Central Florida (CGS37)
I cylhndrica North Central Florida (CGS19)

I brasiliensis South East Florida (CGS3)
I cyhndrica Central West Florida (CGS26)

100 r I cyhndrica Central Florida (CGS36)
100 ----I cyhndrica North Central Florida (CGS36)
97 F I cyhndrica Nigeria (CGN1)
I cyhndrica Cameroon (CGC6)

I cylindrca Benin (CGB2)
I cylndrica Benin (CGB3A)
I cyhndrica Nigeria (CGN4A)

I cyhndrica Nigeria (CGN4)

I cyhndrica Benin (CGB5)
I cyhndrica Nigeria (CGN3A)
I cyhndrica Nigeria (CGN2)

I cyhndrica Nigeria (CGN2)
I cylhndrca Cameroon (CGC11)
I cylindrca South Africa (CGSA1)
I cylindrca Nigeria (CGN2A)

I cyhndrica Cameroon (CGC2)
I cylindrca Benin (CGB1)
I cyhndrica Benin (CGB1)

94 I brevifola
I cyhndrica Central Florida (CGS63)
I cyhndrca var rubra (CGS66)

I cyndrica var rubra (CGS66)
I cyindrica (AF092512)
I cylhndrca(AF092512)
I cyhndrica North East Florida (CGS42)
I cyhndrica Central East Florida (CGS52)
I cyhndrica North East Florida (CGS43)
I cyhndrica Central East Florida (CGS48)
I cyhndrica Central Florida (CGS53)
I cyhndrica Central East Florida (CGS51)
--I cylindrca (AY116297)
10 --- Sacc arundinaceum (AY116295)
SMscanthus smnensis (EF211951)
SMscanthus sinensis (EF211950)
Erianthus rock (AY345217)

I cylindrca (AF190764)

97 Pennisetumpurpureum (AF345232)
Setarnaparvflora (AF019831)
Echinochloa crus-galh (AJ113708)
0 005 substitutions/site


Figure 2-4. Neighbor-joining tree of distances derived from ITS sequence data for all Imperata

cylindrica accessions and closely related species. Numbers above branches are

bootstrap percentages above 80%. Numbers in parentheses represent the GENBANK

accession numbers.









CHAPTER 3
EVALUATION OF FUNGAL PATHOGENS AS BIOLOGICAL CONTROL AGENTS OF
Imperata cylindrica (L.) BEAUV. FROM THE USA AND BENIN

Introduction

Biological control is defined as the selective process in which a pathogen or insect is used

against a targeted weed without damaging nontarget species such as native plants and crops

(Ghosheh, 2005). The use of biological control agents in locations requiring low-maintenance

and natural areas, where high-input weed control is neither feasible nor practical, is the

biocontrol ideal. Classical biological control agents selected should have the biological

characteristics to ensure successful establishment and continued development in locations where

suppression of the target weed population is desired (Morin et al., 2006).

Ranked as one of the 10 worst invasive weeds in tropical and subtropical regions of the

world (Holm et al., 1977), Imperata cylindrica is recorded as a weed of 35 economically

important crops in 73 countries in the tropics. It infests more than 500 million ha worldwide,

including 200 million ha in Asia and Africa. The potential of biological control using plant

pathogens to manage cogongrass infestations in the USA has been considered (Van Loan et al.,

2002). In the southeastern USA, two fungi Bipolaris sacchari (Butler) Shoem., isolated from

cogongrass, and Drechslera gigantea (Heald & F.A. Wolf) Ito, isolated from large crabgrass

[Digitaria sanguinalis (L.) Scop.], were shown to be pathogenic on a single Florida Imperata

cylindrica accession collected from the Lake Alice area on the University of Florida campus

(Yandoc, 2001). Yandoc et al. (2005) evaluated the efficacy ofB. sacchari and D. gigantea in

various formulations in greenhouse and miniplot trials. Amended spore suspensions of B.

sacchari and D. gigantea, containing 105 spores ml-1 in a 1% aqueous gelatin solution, caused

disease symptoms on cogongrass under greenhouse conditions with disease severity ranging

from 42 to 49% (Yandoc et al., 2005). An amended spore in oil emulsion suspension (4%









horticultural oil, 10% light mineral oil, and 86% water) yielded higher levels of disease severity

than spores amended in 1% gelatin. Higher levels of disease severity were achieved when a

mixture of both pathogens were applied under field conditions. Foliar injury ranged from 30 to

86% for B. sacchari and from 9 to 70% for D. gigantea. Despite the promising levels of disease

severity and weed mortality recorded for these fungi, the regenerative potential of the cogongrass

rhizomes allowed the plants to outgrow the effects of these pathogens.

In West Africa, cogongrass is the most dominant and difficult weed to control and thereby

it limits yields of maize, cassava, yam, cowpea, groundnut, cotton, sorghum and plantation crops

(Chikoye et al., 1999, 2000, 2001; Ivens, 1980). Several control strategies, including mechanical

removal, herbicide applications, solar drying of rhizomes after cultivation and the use of cover

crops have not been found effective to prevent the unrelenting spread of cogongrass in West

Africa. As a result, increasing land areas have become unsuitable for agricultural cultivation and

thus I. cylindrica is considered the most serious constraint to crop production and poverty

alleviation in West Africa (Holm et al., 1977; Ivens, 1980; Udensi, 1994; Terry et al., 1997).

Bipolaris sacchari and D. gigantea isolates associated with cogongrass in Benin and

Florida were evaluated for pathogenicity and virulence using detached cogongrass leaf material

(Adolphe Avocanh, 2006; unpublished data). Results showed that the Florida isolates of both

fungi were pathogenic and highly virulent on the Benin cogongrass accession while the Benin

isolates were moderately virulent. Weed populations with limited amounts of genetic variation

are likely to be better candidates for biological control agents (Burdon and Marshall, 1981) and

therefore understanding the extent of genetic variation can be of importance in the detection of

ecotypes or races of a species as they may differ considerably in their susceptibility to predators,

parasites, or herbicides. Achieving a precise genetic match between the targeted weed and









pathogen genotype during the selection process is often a necessary criterion for the success of

biological control programs (Charudattan, 2005). Determining whether intraspecific variation in

resistance exists within invasive weed species can be determined by challenging various

accessions or genotype(s) of the weed with a range of pathogen strains (Hasan et al., 1995;

Morin and Syrett, 1996; Den Breeyen and Morris, 2003; Ellison et al., 2004).

With the goal of seeking suitable biological control agent for cogongrass in West Africa

the objectives of this study were to: 1) determine the virulence of fungi, B. sacchari and D.

gigantea, associated with I. cylindrica from the USA, on the USA I. cylindrica as well as I.

brasiliensis, I. brevifolia and I. cylindrica var. rubra; 2) determine the virulence of fungi

associated with I. cylindrica from West Africa and USA by inoculating West African Benin I.

cylindrica with B. sacchari, D. gigantea, and Colletotrichum caudatum isolates; and 3) compile

a virulence ranking system.

Materials and Methods

Propagation of Test Plants

Florida Imperata cylindrica accessions. Cogongrass rhizomes, collected from 32

counties throughout Florida, USA, were brought back to Gainesville and established under

greenhouse conditions in Metromix 300 (Scott's Sierra Horticultural Products Co., Marysville,

Ohio) and fertilized with 14-14-14 Osmocote (Scott's Sierra Horticultural Products Co.

Marysville, OH). The rhizomes were cut into 4-cm segments and planted in plastic trays (13 x

17 x 56 cm). After 3-4 wk, rhizomes with healthy shoots were transplanted to 3-inch diameter

plastic pots containing Metromix 300.

Benin Imperata cylindrica accessions. Cogongrass rhizomes were collected from infested

cogongrass sites in Benin during the summer of 2005 and 2006. Collections were taken from

natural and invasive cogongrass populations in the field and transported to the experimental field









site at the International Institute of Tropical Agriculture (IITA), Benin. The rhizomes were cut

into 4-cm segments and planted in plastic tubs containing field soil. After 4-6 wk, rhizomes with

healthy shoots were transplanted to 3-inch diameter plastic pots containing field soil.

Inoculum Production

Florida fungal isolates. Pure cultures of B. sacchari and D. gigantea were obtained from

Dr. R. Charudattan's collection (Plant Pathology Department, University of Florida, Gainesville,

FL). These pathogens were previously isolated from diseased grasses collected in Florida and

their pathogenicity on several weedy grass species was previously evaluated (Chandramohan,

1999; Yandoc, 2001). Inoculum was produced by transferring mycelial blocks, from stored slant

cultures, to fresh potato dextrose agar (PDA) plates and incubating the plates at 28 C for 8 d.

Spores were harvested by adding 10 ml sterile distilled water to the cultures, gently scraping the

surface with a rubber policeman, and transferring the suspension to PDA medium in two liter

Erlenmeyer flasks with resulting spore suspension. The PDA flasks were incubated at 280C for

14 d (12h light/12h dark) until the agar was fully colonized.

Benin fungal isolates. West African cultures of B. sacchari, D. gigantea, and C.

caudatum (Sacc.) Peck were obtained from Dr. F. Beed's culture collection (IITA, Cotonou,

Benin). These pathogens were isolated from diseased grasses collected in Benin and their

pathogenicity had been previously evaluated on several weedy grass species (Adolphe Avocanh,

2006; unpublished data). Inoculum was produced by transferring mycelial blocks from stored

slant cultures to PDA plates and allowing cultures to grow at 250C (24h/24h) for 8 d. Spores

were harvested by adding 10 ml sterile distilled water amended with 0.1% Tween 80 and the

spores were released from culture plates by gently scraping the surface with a sterile glass rod.

Tween 80 was used to improve spore adhesion on the leaves during inoculation. The spore

concentration for both experiments was determined with the aid of a haemocytometer.









Imperata cylindrica Inoculations

University of Florida, USA. Inoculations were carried out in a greenhouse 6 wk after the

rhizomes were planted. Spores suspensions, 1 x 106 ml-1, were applied until run-off with hand-

pumped sprayers (Figure 1-1). All inoculated and nontreated control plants were incubated in a

dew chamber for 24 h (27 1C, RH>90%) and then transferred to the greenhouse for

observation.

International Institute of Tropical Agriculture, Benin. Inoculations were carried out in

a shade house 8 wk after the rhizomes were planted. Spore suspensions, 1 x 106 ml-1, were

applied, until run-off, with hand-pumped sprayers. All inoculated and nontreated control plants

were incubated in a dew chamber for 24 h (27 1C, RH >90%) and then transferred to the

shade house for observation.

All experiments consisted of 9 replications per treatment with 3 replications for the

nontreated control plants and were repeated. Koch's postulates were completed by isolating the

fungi from inoculated cogongrass plants and comparing them with the original isolates used in

the inoculation for cultural characteristics and morphology.

Efficacy of Bipolaris sacchari and Drechslera gigantea Applied Singly or as a Mixture

The spore concentrations of B. sacchari, D. gigantea, and their mixture were 1 x 106

spores ml- respectively. Spores were suspended in 250 ml sterilized distilled water amended

with 0.1% Tween 80. The Tween 80 was used to improve spore adhesion on the leaves during

inoculation. Control plants were sprayed with sterile distilled water containing 0.1% Tween 80.

The efficacy of the two isolates and their mixture was measured in terms of the percentage

disease severity (DS) and rated with the aid of pictorial key for southern corn leaf blight (James,

1971) and gray leaf blotch (Smith, 1989), with 50% as the maximum level of disease.









Assessments were made at 7 and 21 d after inoculation (DAI). The experiment had a completely

randomized design with nine replications per treatment.

Statistical Analysis

All statistical analyses were performed using SAS statistical software (Version 9.1, SAS

Institute, Cary, NC). A repeated-measure analysis (PROC MIXED) was used to determine the

statistical significance of the main effects (treatments and/or accessions) and pairwise

comparisons between levels of significant effects were performed using the least significant

differences. PROC GLM was used to determine the analysis of variance for the virulence and

accession data. Data were not pooled due to the significant interaction within treatment and

accessions. Means and standard errors were calculated using the PROC MEANS procedure and

are reported for each treatment x time combination. All reported differences among treatments

are significant at P < 0.05, unless otherwise stated.

Results

Efficacy of Bipolaris sacchari and Drechslera gigantea Applied Singly or as a Mixture

Florida Imperata cylindrica Accessions and Fungal Isolates

Discrete leaf lesions were visible within 24 h after inoculation with each treatment. At the

end of the monitoring period (21 DAI), the infected leaves were chlorotic, the lesions had

coalesced and turned necrotic (Figure 3-1). However, no secondary disease spread was observed

on the plants in the greenhouse, and the infection was confined to the sprayed foliage. New

emerging leaves from inoculated plants were disease-free, thus decreasing the level of DS.

Disease severity means were scored between 0 (= no disease present no lesions observed) and 3

(= 15 30% of leaf blade diseased; many longitudinal lesions on leaf blade) at 7 and 21 DAI.

In the first trial, the fixed-effect analysis showed a significant treatment effect on the

Florida accessions at 7 DAI (F-value = 355.49; Pr>F = <0.0001) and 21 DAI (F-value = 345.34;









Pr>F = <0.0001) for B. sacchari and D. gigantea applied singly or as a mixture. There were

significant differences between the B. sacchari and the D. gigantea applied singly and their

mixture at 7 DAI (Table 3-1). However, the mixture treatments with both fungi were more

damaging to cogongrass than with the individual treatments. At 21 DAI, there were no

significant differences between any of the treatments applied singly or as a mixture (Figure 3-2).

The control treatment was significantly different from the B. sacchari and D. gigantea applied

singly or as a mixture at 7 and 21 DAI.

In the second trial, the fixed-effect analysis showed a significant treatment effect on the

Florida accessions treated at 7 DAI (F-value = 109.97; Pr>F = 0.0003) and 21 DAI (F-value =

211.64; Pr>F = <0.0001) for the B. sacchari, D. gigantea, and their mixture. There were no

significant differences between treatments applied singly or as a mixture at 7 and 21 DAI (Table

3-1, Table 3-2). The control treatment was significantly different from the B. sacchari and D.

gigantea applied singly or as a mixture at 7 and 21 DAI, which confirms that both fungi are

virulent pathogens of cogongrass.

Different cogongrass accessions were susceptible to B. sacchari and D. gigantea applied

singly or in a mixture, over two trials at 7 and 21 DAI (Figure 3-3 Figure 3-8). Trial 1 at 7

DAI, the B. sacchari was most damaging on accession 22 (mean = 2.3333) and least virulent on

accession 32 (mean = 0.6667) [Figure 3-3 A]. Drechslera gigantea was most damaging on

accessions 49, 32 and 39 (mean = 2.0) and least damaging on accession 23 (mean = 0.4444)

[Figure 3-4 A]. The mixture treatment was most damaging on accession 59 (mean = 3.111) and

least virulent on accession 12 (mean = 0.444) [Figure 3-5 A]. Whereas at 21 DAI, the B.

sacchari was most damaging on accession 59 (mean = 2.1667) and least damaging on accessions

12 and 52 (mean = 0.7778) [Figure 3-3 B]. Drechslera gigantea was most damaging on









accession 49 (mean = 2.25) and least damaging on accessions 12, 38, and 57 (mean = 0.6667)

[Figure 3-4 B]. The mixture was most damaging on accession 44 (mean = 2.2222) and least

damaging on accession 12 (mean = 0.3333) [Figure 3-5 B].

For trial two, the B. sacchari was most damaging on accession 46 (mean = 1.6667) and

least damaging on accession 35 (mean = 0.5) [Figure 3-6 A]. Drechslera gigantea was most

damaging on accessions 59 and 21 (mean = 1.1111) and not at all damaging on I. brasiliensis, I.

brevifolia Vasey and I. cylindrica var. rubra (mean = 0.000) [Figure 3-7 A]. The mixture was

most damaging on accession 56 (mean = 2.0) and least damaging on accession 40 (mean = 0.00)

[Figure 3-8 A] at 7 DAI. While at 21 DAI, the B. sacchari was most damaging on accession 53

(mean = 2.0) and least damaging on I. brasiliensis Trin. (mean = 0.3333) [Figure 3-6 B]. The D.

gigantea treatment was most damaging on accession 56 (mean = 2.0) and not damaging at all on

I. brasiliensis and I. cylindrica var. rubra (mean = 0.000) [Figure 3-7 B]. The mixture was most

damaging on accession 43 (mean = 1.6667) and not damaging at all on I cylindrica var. rubra

and accession 39 (mean = 0.000) [Figure 3-8 B]. Disease severity of the three treatments was

observed to be more staggered over all accessions for trial one (Figure 3-3 Figure 3-5) when

compared with the more uniform response to all treatments for trial two (Figure 3-6 Figure 3-

8). No consistent response to the different treatments was observed over the two trials at 7 or 21

DAI for all accessions treated.

The Florida accessions were grouped according to their statistical variance in disease

severity to B. sacchari and D. gigantea applied singly or in a mixture (Table 3-7, Table 3-8).

Over the two trials, there were no significant differences in treatment effect between the majority

of accessions inoculated at 7 and 21 DAI compared with the control treatment.









Benin Imperata cylindrica Accessions and Fungal Isolates

In contrast to the Florida accessions, discrete leaf lesions became visible after 72 h for each

treatment on the Benin cogongrass accession (Figure 3-1 and Figure 3-2). By the end of the

monitoring period, the inoculated plants were slightly chlorotic and lesions were coalescing and

turned necrotic (Figure 3-2).

For the first trial, the fixed-effect analysis showed a significant treatment effect on the

Benin accession treated at 7 DAI (F-value = 2.94; Pr>F = 0.0444) and at 21 DAI (F-value = 5.05;

Pr>F = 0.0059) for the B. sacchari and D. gigantea applied singly or as a mixture. Results of the

first trial showed a low disease incidence score of between 0 (= no disease present no lesions

observed) and 1 (= 0.1 0.5% of leaf blade diseased; only a few longitudinal lesions with or

without chlorotic margins) for all the isolates tested at 7 and 21 DAI. When the data sets were

analyzed separately, there were significant differences between the B. sacchari isolates from

Florida and Benin, the Benin mixture and the controls at 7 DAI (Figure 3-9 A). At 21 DAI, there

was a significant difference between the treatments and control but no significant difference

between any of the treatments (Figure 3-9 C).

Pairwise comparisons between all the treatments showed a significant difference between

the B. sacchari isolates from Benin and Florida and the B. sacchari isolate from Florida and the

mixture from Florida and Benin at 7 DAI (Table 3-5). The Bipolaris sacchari from Florida and

C. caudatum from Benin were significantly different from the control at 7 DAI. At 21 DAI, the

only significant differences were recorded for the control and fungi applied singly while the

Benin mixture was significantly different from the control (Table 3-7).

For the second trial, the fixed-effect analysis showed no significant treatment effect on the

Benin accessions (F-value = 5.01; Pr>F = 0.0059). There was a significant treatment effect at 21

DAI (F-value = 3.2; Pr>F = 0.0304) for the treatment B. sacchari, D. gigantea, and their mixture.









Results for the second trials showed a higher disease incidence score of between 0 and 4 (= 45 -

55% leaf blade diseased; many lesions with some coalescing on leaf blade) at 7 and 21 DAI

compared with the first trial (Figure 3-9 C, Figure 3-9 D). There was a significant treatment

difference between the D. gigantea Benin and D. gigantea Florida isolates, B. sacchari Benin

and C. caudatum isolates compared to the control at 7 DAI (Figure 3-9 B). There was no

significant difference among treatments and the control at 7 DAI (Figure 3-9 C). At 21 DAI, the

C. caudatum, B. sacchari Florida and D. gigantea Benin isolates were significantly different

from the control (Figure 3-9 D).

Pairwise comparisons for all treatments at 7 DAI showed a significant difference between

the B. sacchari Benin and C. caudatum Benin, B. sacchari Benin and D. gigantea Florida

isolates and between the Benin mixture and C. caudatum Benin, D. gigantea Benin and D.

gigantea Florida isolates (Table 3-6). All treatments, with the exclusion of the B. sacchari Benin

isolate, were significantly different from the control. At 21 DAI, significant differences were

observed between the B. sacchari Florida and the Florida mixture and C. caudatum and the

Florida mixture (Table 3-8). All treatments, with the exclusion of B. sacchari Benin and the

Benin mixture, were significantly different from the control treatment.

Discussion

The biocontrol potential of four isolates of the fungal pathogens B. sacchari and D.

gigantea, applied singly or as a mixture, on different I. cylindrica accessions and closely related

species (I. brasiliensis, I. brevifolia, and I. cylindrica var. rubra) was confirmed in repeated

greenhouse trials on cogongrass accessions in Florida, USA and in shade house trials in Benin,

West Africa. In addition, an indigenous C. caudatum isolate was included in the Benin study.

Gene-for-gene type resistance-pathogenicity relationships are well documented for

pathogen-host interactions in weed systems (Espiau et al., 1998; Ellison et al., 2004). The









assumption that intraspecific variation in host plants pertaining to disease resistance is present in

all weed-pathogen systems is incorrect. Morin et al. (1993) showed that four different, but

closely related Xanthium species were highly susceptible to the same strain of the rust Puccinia

xanthii Schwein. The detection of intraspecific variation in resistance has significant

implications for biological control programs. Firstly, it is possible that more than a single strain

of the pathogen will be required to control all genotypes of the exotic weed as shown with the

rust fungi used against Chondrillajuncea L. [skeletonweed] (Hassan et al., 1995) and Mikania

micrantha Kunth. [mile-a-minute weed] (Ellison et al., 2004), the hemibiotrophic pathogen,

Mycovellosiella lantanae (Chupp) Deighton var. lantanae on Lantana camera (L.) in South

Africa (Den Breeyen and Morris, 2003; Den Breeyen, 2004). Additionally, finding the most

virulent strain of the pathogen may require exact host-matching in the native range for the

genotypes of the exotic weed found in the introduced country (Morin et al., 2006). Pathogenicity

testing of strains of the bridal creeper rust, Puccinia myrsiphylli (Thuem.) Winter from two

different rainfall regions in South Africa, revealed that Australian bridal creeper [Asparagus

asparagoides (L.) Druce] populations were only susceptible to strains from the winter rainfall

areas where the Australian bridal creeper originated (Morin and Edwards, 2006). As found with

the rust fungi on mile-a-minute weed (Ellison et al., 2004), skeletonweed (Hasan, 1985) and

blackberry (Bruzzese and Hasan, 1986), further extensive testing of strains and weed accessions

might be required depending on the genetics of the weed and pathogen. While different

pathogen genotypes (i.e., races) can vary in their ability to cause disease in a host, it is equally

true that different host genotypes can be affected by particular pathogen races (Cousens and

Croft, 2000). Examples of race and host-pathogen specificity in biological control systems

include Puccinia chondrillina Bubak & Syd., a rust pathogen introduced to control Chondrilla









juncea in Australia and the rust, Phragmidium violaceum (Schultz) Winter to control Rubus spp.

Only one of the three distinct morphological forms of C. juncea in Australia (wide, medium, and

narrow leaved forms) was susceptible to the single pathotype ofP. chondrillina released which

resulted in an increase in abundance of the other C. juncea forms. In 1980, a second race that

attacked only the intermediate form was introduced, which subsequently resulted in an increase

in the third morphological form (Thrall and Burdon, 2004). Bruzzese and Hasan (1986) showed

that of 15 isolates of Ph. violaceum (Schultz) Winter tested for host specificity, one that was

most pathogenic on two Rubus spp. was only slightly pathogenic on another Rubus and caused

no symptoms on a fourth species. Biocontrol is therefore more likely to succeed if the pathogen

is relatively nonspecific to host genotypes or if multiple races of pathogen were introduced

together. When considering the release of a classical biological control agent, we should be

concerned with more than the climatic match of the pathogen and its host specifity. Given the

high cost of biocontrol programs, we need to maximize the success rate of releases, and this

should logically involve an understanding of the ecology of the host. The epidemiology of a

pathogen is likely to be intimately related to the ecology of its host in a dynamic weed

population as well as the effect of the ecology of interacting organisms affected by their abiotic

environment (Cousens and Croft, 2000). Genetic diversity and the size, abundance, and spatial

distribution of host plants will most likely affect the pathogen's ability to reproduce and spread.

Disease severity induced by the pathogen will ultimately affect the host size and vigor. As a

result, disease severity will affect the weed population dynamics and interactions with other

components of the ecosystem.

Chandramohan and Charudattan (1996) developed a multiple-pathogen strategy that

targeted several weedy grass species simultaneously using three or more host-specific pathogens









combined and applied inundatively. The research showed that the pathogen mixture was either

superior or comparable to the single pathogen application in biocontrol efficacy (Chandramohan,

1999). However, they concluded that using a pathogen mixture did not necessarily result in

significant disease severity on most of the grass species tested. The possibility of a multiple-

pathogen strategy for I. cylindrica in West Africa should only be considered if the pathogens

effectively affect different tissues of plant such as leaf (Bipolaris, rusts, and others) and seed

pathogens (smuts), and fungi associated with the rhizome (Rhizoctonia sp.). All pathogens

should be evaluated to determine their overall affect on plant fitness. Applying a single, host-

specific agent should be preferable for cogongrass control within field crop situations, although

the scope of my cogongrass project was to assess the control of a single target weed with two or

more pathogens. However, results from this study indicate that applying the B. sacchari and D.

gigantea as a mixture had no enhanced effects on the cogongrass in Florida and Benin. Using oil

formulations, such as the oil emulsions used by Yandoc (2001) is one way to increase the level

of damage from these pathogens, but the cost of such formulations is likely to be disincentive for

their use in West Africa.

Genetic variation is high within the the USA and African I. cylindrica accessions (Chapter

2) with the two sets of accessions genetically distinct. This would suggest that the West African

accessions would be an incompatible host for the USA B. sacchari and D. gigantea isolates. The

indigenous fungus C. caudatum associated with cogongrass in Benin, evaluated in conjunction

with the B. sacchari and D. gigantea, was found to cause similar or greater disease symptoms on

the Benin accessions. Although the isolates were able to cause foliar disease, disease severity on

all accessions was consistently lower than observed in previous studies (Yandoc et al., 2005).

The slight decrease in disease severity noted in several accessions at 21 DAI could be due to the









emergence of new healthy leaves and new healthy shoots from the soil. No plant mortality was

observed over the entire experimental period.

Tropical African agriculture is dominated by smallholdings. In Nigeria, more than 80% of

small-scale farms were found to range from 0.1 to less than 6.0 ha (Olayide, 1980). The

situation is similar in other West African countries, where most holdings are less than 2 ha and

96% cover less than 10 ha (Harrison, 1987, cited by Ker, 1995). Small-scale farmers are most

affected by cogongrass infestations as they rely on manual weeding which requires massive labor

input and is not effective on underground rhizomes (Chikoye et al., 2000). To design, develop,

and implement an inundative biocontrol strategy for cogongrass in West Africa that has a high

probability of acceptance by users, research programs should be participatory and address the

priorities and potential socio-economic constraints of the farmers. Technology transfer,

preferably, using locally available and low-cost materials, will play an important if not a pivotal

role in the success of the selected mycoherbicides. Small-scale farming communities will be

directly involved in the application and evaluation of the mycoherbicide. The practical

effectiveness of mycoherbicide applications in West Africa is most affected by the limited

availability and the prohibitive costs of materials to produce sufficient spore quantities and

limited availability of appropriate spray equipment.

Currently there is no single management strategy that effectively controls cogongrass

infestations in a sustainable way throughout the world and management strategies need to

incorporate integrated approaches including preventive, cultural, biological, mechanical, and

chemical control methods. Evaluating the management requirements for each cogongrass

infestation and implementing the most appropriate and therefore the most effective control

method would go a long way in addressing the apparent ineffectiveness of current control









methods. The prospect of implementing native fungal biological control agents as part of an

integrated management strategy for cogongrass in West Africa appears to be promising.

Investigations into fungal species associated with closely related Imperata species (I. brevifolia

and I. brasiliensis) might yield additional, potentially effective biocontrol agents. Undertaking a

comprehensive international survey for virulent pathogens should be seriously considered given

the apparent lack of effective biocontrol agents to date.









Table 3-1. Pairwise comparison of least square means of disease severity (DS) from different
treatments on Florida accessions oflmperata cylindrica at 7 days after inoculation.
Treatment la Treatment 2a DS Estimate Pr > t
Trial 1
B. sacchari D. gigantea 0.1088 0.1555
B. sacchari Mixture -0.4811 0.0003
Mixture D. gigantea 0.5900 0.0001
B. sacchari Control 1.2769 <0.0001
Control D. gigantea -1.1680 <0.0001
Mixture Control 1.7580 <0.0001

Trial 2
B. sacchari D. gigantea 0.04916 0.3038
B. sacchari Mixture 0.03465 0.4596
Mixture D. gigantea 0.01451 0.7492
B. sacchari Control 0.9631 <0.0001
Control D. gigantea -0.9139 <0.0001
Mixture Control 0.9284 <0.0001
Note: All reported differences among treatments are significant at P < 0.05. a Treatments were
compared pairwise by Treatment 1 vs. Treatment 2.

Table 3-2. Pairwise comparison of least square means of disease severity (DS) from different
treatments on Florida accessions of Imperata cylindrica at 21 days after inoculation.
Treatment "a Treatment 2a DS Estimate Pr > t
Trial 1
B. sacchari D. gigantea 0.1387 0.0502
B. sacchari Mixture 0.1325 0.0559
Mixture D. gigantea -0.006197 0.9146
B. sacchari Control 1.3336 <0.0001
Control D. gigantea -1.1949 <0.0001
Mixture Control 1.2011 <0.0001

Trial 2
B. sacchari D. gigantea 0.1248 0.0192
B. sacchari Mixture 0.1847 0.0053
Mixture D. gigantea -0.05994 0.1493
B. sacchari Control 1.0639 <0.0001
Control D. gigantea -0.9392 <0.0001
Mixture Control 0.8792 <0.0001
Note: All reported differences among treatments are significant at P < 0.05. a Treatments were
compared pairwise by Treatment 1 vs. Treatment 2.









Table 3-3. Disease severity statistical classes ofBipolaris sacchari, Drechslera gigantea, and
their mixture on the Florida Imperata cylindrica accessions at 7 days after
inoculation.
Accession number B. sacchari D. gigantea Mixture Control
Trial 1


8, 14, 16,
11, 23, 29, 33, 34, 37, 41,


39,40,
43,44,
56,58,


Trial 2
3, 4, 5, 7, 8, 9, 15, 16, 21, 22, 23,
29,30,31,32,33,34,37,38,41,
49, 50, 51, 52, 54, 55, 57, 58,


52,54,61
46,47,48 A
59,60,65 B
38 A
12,15,22 A
49 AB
45, 53, 57 B
32,51 C



24,26,27
43,47,48
59,60,61 A
56 B
6,46 A
53 A
66 A


11 A A B C
36,40,42 A A B B
65 A AB AB B
35 AB A AB B
25, 45 AB B A C


See Figure 3-1 and


Note: All reported differences among treatments are significant at P < 0.05.
Figures 3-3 3-7.









Table 3-4. Disease severity statistical classes ofBipolaris sacchari, Drechslera gigantea, and
their mixture on the Florida Imperata cylindrica accessions at 21 days after
inoculation.
Accession number B. sacchari D. gigantea Mixture Control


Trial 1
11, 15,


16, 22, 29, 32, 37, 39, 41, 43, 46, 48
51, 52, 54, 58, 59, 60, 65 A
44,57 B
33, 53, 34 A
8,38,45 A
14, 40, 47 A
61 A
12 A
49 A
56 B


Trial 2
5, 6, 7, 8, 9, 11, 12, 13, 15, 16, 21,
25, 26, 27, 29, 30, 31, 32, 34, 37, 38,
48, 49, 50, 51, 52, 55, 58,


23,24
42,47
60,61 A
3B
22,46 A


43,54,57,59 A B B C
33 A B AB B
53 A B C D
35 B A B C
4 B A AB C
56 AB A AB B
45 AB B AB C
Note: All reported differences among treatments are significant at P < 0.05. See Figure 3-1 and
Figures 3-3 3-7.









Table 3-5. Pairwise comparison of least square means of disease severity (DS) from different
treatments on the Benin accession oflmperata cylindrica at 7 days after inoculation


(Trial 1).
Treatment 1a
B. sacchari (Benin)
B. sacchari (Benin)
B. sacchari (Benin)
B. sacchari (Benin)
B. sacchari (Benin)
B. sacchari (Benin)
B. sacchari (Benin)
B. sacchari (Florida)
B. sacchari (Florida)
B. sacchari (Florida)
B. sacchari (Florida)
B. sacchari (Florida)
B. sacchari (Florida)
Mixture (Benin)
Mixture (Benin)
Mixture (Benin)
Mixture (Benin)
Mixture (Benin)
Mixture (Florida)
Mixture (Florida)
Mixture (Florida)
Mixture (Florida)
Control (Benin)
Control (Benin)
Control (Benin)
C. caudatum (Benin)
C. caudatum (Benin)
D. gigantea (Benin)


Treatment 2a
B. sacchari (Florida)
Mixture (Benin)
Mixture (Florida)
Control (Benin)
C. caudatumb (Benin)
D. gigantea (Benin)
D. gigantea (Florida)
Mixture (Benin)
Mixture (Florida)
Control (Benin)
C. caudatum (Benin)
D. gigantea (Benin)
D. gigantea (Florida)
Mixture (Florida)
Control (Benin)
C. caudatum (Benin)
D. gigantea (Benin)
D. gigantea (Florida)
Control (Benin)
C. caudatum (Benin)
D. gigantea (Benin)
D. gigantea (Florida)
C. caudatum (Benin)
D. gigantea (Benin)
D. gigantea (Florida)
D. gigantea (Benin)
D. gigantea (Florida)
D. gigantea (Florida)


DS Estimate
-0.7778
-0.0556
-0.2761
0.1111
-0.4444
-0.3333
-0.3333
0.7222
0.5016
0.8889
0.3333
0.4444
0.4444
-0.2206
0.1667
-0.3889
-0.2778
-0.2778
0.3872
-0.1683
-0.0572
-0.0572
-0.5556
-0.4444
-0.4444
0.1111
0.1111
0.0000


Pr> t
0.0049
0.8324
0.2329
0.6373
0.0756
0.1713
0.1713
0.0148
0.0406
0.0020
0.1713
0.0756
0.0756
0.3916
0.5285
0.1547
0.3000
0.3000
0.1028
0.4593
0.7995
0.7995
0.0313
0.0756
0.0756
0.6373
0.6373
1.0000


Note: All reported differences among treatments are significant at P < 0.05. aTreatments were
compared pairwise by Treatment 1 vs. Treatment 2. bAn indigenous Colletotrichum caudatum
isolate was included in the study.









Table 3-6. Pairwise comparison of least square means of disease severity (DS) from different
treatments on the Benin accession oflmperata cylindrica at 7 days after inoculation


(Trial 2).
Treatment 1a
B. sacchari (Benin)
B. sacchari (Benin)
B. sacchari (Benin)
B. sacchari (Benin)
B. sacchari (Benin)
B. sacchari (Benin)
B. sacchari (Benin)
B. sacchari (Florida)
B. sacchari (Florida)
B. sacchari (Florida)
B. sacchari (Florida)
B. sacchari (Florida)
B. sacchari (Florida)
Mixture (Benin)
Mixture (Benin)
Mixture (Benin)
Mixture (Benin)
Mixture (Benin)
Mixture (Florida)
Mixture (Florida)
Mixture (Florida)
Mixture (Florida)
Control (Benin)
Control (Benin)
Control (Benin)
C. caudatum (Benin)
C. caudatum (Benin)
D. gigantea (Benin)


Treatment 2a
B. sacchari (Florida)
Mixture (Benin)
Mixture (Florida)
Control (Benin)
C. caudatumb (Benin)
D. gigantea (Benin)
D. gigantea (Florida)
Mixture (Benin)
Mixture (Florida)
Control (Benin)
C. caudatum (Benin)
D. gigantea (Benin)
D. gigantea (Florida)
Mixture (Florida)
Control (Benin)
C. caudatum (Benin)
D. gigantea (Benin)
D. gigantea (Florida)
Control (Benin)
C. caudatum (Benin)
D. gigantea (Benin)
D. gigantea (Florida)
C. caudatum (Benin)
D. gigantea (Benin)
D. gigantea (Florida)
D. gigantea (Benin)
D. gigantea (Florida)
D. gigantea (Florida)


DS Estimate
-1.1095
0.00304
-0.5540
1.0016
-1.9434
-1.8541
-1.8541
1.1125
0.5556
2.1111
-0.8339
-0.7446
-0.7446
-0.5570
0.9986
-1.9465
-1.8571
-1.8571
1.5556
-1.3895
-1.3001
-1.3001
-2.9450
-2.8557
-2.8557
0.8933
0.8933
0.0000


Pr> t
0.1350
0.9967
0.4416
0.1741
0.0167
0.0214
0.0214
0.1239
0.4159
0.0066
0.2400
0.2917
0.2917
0.4261
0.1638
0.0143
0.0183
0.0183
0.0341
0.0602
0.0764
0.0764
0.0007
0.0009
0.0009
0.8997
0.8997
1.0000


Note: All reported differences among treatments are significant at P < 0.05. aTreatments were
compared pairwise by Treatment 1 vs. Treatment 2. bAn indigenous Colletotrichum caudatum
isolate was included in the study.









Table 3-7. Pairwise comparison of least square means of disease severity (DS) from different
treatments on the Benin accession oflmperata cylindrica at 21 days after inoculation


(Trial 1).
Treatment 1a
B. sacchari (Benin)
B. sacchari (Benin)
B. sacchari (Benin)
B. sacchari (Benin)
B. sacchari (Benin)
B. sacchari (Benin)
B. sacchari (Benin)
B. sacchari (Florida)
B. sacchari (Florida)
B. sacchari (Florida)
B. sacchari (Florida)
B. sacchari (Florida)
B. sacchari (Florida)
Mixture (Benin)
Mixture (Benin)
Mixture (Benin)
Mixture (Benin)
Mixture (Benin)
Mixture (Florida)
Mixture (Florida)
Mixture (Florida)
Mixture (Florida)
Control (Benin)
Control (Benin)
Control (Benin)
C. caudatum (Benin)
C. caudatum (Benin)
D. gigantea (Benin)


Treatment 2a
B. sacchari (Florida)
Mixture (Benin)
Mixture (Florida)
Control (Benin)
C. caudatumb (Benin)
D. gigantea (Benin)
D. gigantea (Florida)
Mixture (Benin)
Mixture (Florida)
Control (Benin)
C. caudatum (Benin)
D. gigantea (Benin)
D. gigantea (Florida)
Mixture (Florida)
Control (Benin)
C. caudatum (Benin)
D. gigantea (Benin)
D. gigantea (Florida)
Control (Benin)
C. caudatum (Benin)
D. gigantea (Benin)
D. gigantea (Florida)
C. caudatum (Benin)
D. gigantea (Benin)
D. gigantea (Florida)
D. gigantea (Benin)
D. gigantea (Florida)
D. gigantea (Florida)


DS Estimate
0.08333
-0.2222
-0.3333
0.5556
-0.2222
-0.3333
0.0000
-0.3056
-0.4167
0.4722
-0.3056
-0.4167
-0.0833
-0.1111
0.7778
0.0000
-0.1111
0.2222
0.8889
0.1111
0.0000
0.3333
-0.7778
-0.8889
-0.5556
-0.1111
0.2222
0.3333


Pr> t


0.6334
0.2448
0.1261
0.0094
0.2448
0.1261
1.0000
0.0966
0.0506
0.0160
0.0966
0.0297
0.6334
0.5951
0.0009
1.0000
0.5529
0.2448
0.0008
0.5951
1.0000
0.1261
0.0009
0.0003
0.0094
0.5529
0.2448
0.0907


Note: All reported differences among treatments are significant at P < 0.05. aTreatments were
compared pairwise by Treatment 1 vs. Treatment 2. bAn indigenous Colletotrichum caudatum
isolate was included in the study.









Table 3-8. Pairwise comparison of least square means of disease severity (DS) from different
treatments on the Benin accession oflmperata cylindrica at 21 days after inoculation


(Trial 2).
Treatment 1a
B. sacchari (Benin)
B. sacchari (Benin)
B. sacchari (Benin)
B. sacchari (Benin)
B. sacchari (Benin)
B. sacchari (Benin)
B. sacchari (Benin)
B. sacchari (Florida)
B. sacchari (Florida)
B. sacchari (Florida)
B. sacchari (Florida)
B. sacchari (Florida)
B. sacchari (Florida)
Mixture (Benin)
Mixture (Benin)
Mixture (Benin)
Mixture (Benin)
Mixture (Benin)
Mixture (Florida)
Mixture (Florida)
Mixture (Florida)
Mixture (Florida)
Control (Benin)
Control (Benin)
Control (Benin)
C. caudatum (Benin)
C. caudatum (Benin)
D. gigantea (Benin)


Treatment
B. sacchari (FL)
Mixture (Benin)
Mixture (Florida)
Control (Benin)
C. caudatumb (Benin)
D. gigantea (Benin)
D. gigantea (Florida)
Mixture (Benin)
Mixture (Florida)
Control (Benin)
C. caudatum (Benin)
D. gigantea (Benin)
D. gigantea (Florida)
Mixture (Florida)
Control (Benin)
C. caudatum (Benin)
D. gigantea (Benin)
D. gigantea (Florida)
Control (Benin)
C. caudatum (Benin)
D. gigantea (Benin)
D. gigantea (Florida)
C. caudatum (Benin)
D. gigantea (Benin)
D. gigantea (Florida)
D. gigantea (Benin)
D. gigantea (Florida)
D. gigantea (Florida)


DS Estimate
-1.4390
-0.0411
0.3388
1.4499
-1.6612
-0.8361
-0.4886
1.3979
1.7778
2.8889
-0.2222
0.6028
0.9503
0.3799
1.4910
-1.6201
-0.7951
-0.4476
1.1111
-2.0000
-1.1750
-0.8275
-3.1111
-2.2861
-1.9386
0.8250
1.1725
0.3475


Pr> t


0.0975
0.9611
0.6822
0.0952
0.0596
0.3292
0.5640
0.1065
0.0418
0.0027
0.7836
0.4692
0.2605
0.6464
0.0871
0.0654
0.3523
0.5969
0.1832
0.0245
0.1691
0.3245
0.0015
0.0136
0.0313
0.3259
0.1699
0.6807


Note: All reported differences among treatments are significant at P < 0.05. aTreatments were
compared pairwise by Treatment 1 vs. Treatment 2. bAn indigenous Colletotrichum caudatum
isolate was included in the study.




















Ai.ii ..... .....
A B













C D


Figure 3-1. Disease symptoms and disease severity on Imperata cylindrica Florida accessions at
21 days after inoculation. A) B. sacchari. B) D. gigantea. C) Mixture. D) Control.


I



















A B










C D












E F











Figure 3-2. Disease symptoms and diseases severity on Imperata cylindrica Benin accession at
21 days after inoculation. A) B. sacchari Florida. B) B. sacchari Benin. C) D.
gigantea Florida. D) D. gigantea Benin. E) Mixture Florida. F) Mixture Benin. G)
Control.















32 A
16
44
11
26
17
51
64
34
56
42
14
23
41
57
33
12
48
60
29
52
65
62
9
39
13
47
40
8
61
63
37
59
58
20
53
45
46
43
38
49
15
54
22

0 05 1 15 2 2.5


Treatment Means


52
12
22
51
56
16
60
32
13
41
41
57
11
9
42
26
64
65
29
S 34
48
14
S37
17
43
47
62
15
8
44
33
58
49
53
46
63
20
54
38
45
40
59

0 0.5 1 1.5 2 2.5


Treatment means

Figure 3-3. Mean disease ratings of Bipolaris sacchari on Imperata cylindrica Florida accessions

(Trial 1). A) 7 days after inoculation. B) 21 days after inoculation.





84















23
57
12
33
53
38
1
64
14
11
34
52
9
22
60
30
45
41
7
S 63
S65
44
15
58
40
59
62
50
42
46
48
54
61
56
51
43
29
47
37
39
32
49

O 05 1 1.5 2 2.

Treatment means

57
12
38
1
16
23
33
53
34
8
64
15
14
51
63
30
22
11
60
41
44
42
46
U 45
4 58
62
32
65
48
29
52
54
9
47
39
25
61
50
56
40
43
59
37
49

0 0.5 1 1.5 2 2.


Treatment means

Figure 3-4. Mean disease ratings of Drechslera gigantea on Imperata cylindrica Florida

accessions (Trial 1). A) 7 days after inoculation. B) 21 days after inoculation.








85
















12
7
14
16
I brasiliensi
49
var 'ubra'
52
22
35
8
6
15
34
5
13
24
39
1
55
61
48
41
23
65
11

3
S 29
51
36
47
40
54
38
45
53
37
21
32
44
4
33
46
60
26
56
58
43
57
27
59


0 05 1 15 2 2.5 3 3.


Treatment means


12
49
14
I brasiiensis
16
13
I. brvfolia
7
52
8
35
38
1
47
51
45
var 'ubra'
15
55
58
5
40
30
S 61
S 24
29
S 28
34
< 31
36
41
43
39
11
56
53
37
32
65
26
54
59
60
57
23
4
46
33
27
21
44


Treatment means


Figure 3-5. Mean disease ratings of the Mixture on Imperata cylindrica Florida accessions (Trial

1). A) 7 days after inoculation. B) 21 days after inoculation.
















35




16
9
45
58

15
65
41


56
54
48
0 40
S 3
21
34
49

30
5
60

47
24
51

50
28
42

37
23
25

46


Treatment means


I brasiHensis
44
35
4
29
39
7
65
16
9
43
47
58
22
11
24
I br~i'ol'a
45
48
57
30
61
40
41
2 36




28
15
21
49
34
37
50
51
23
42
38
26
52
56
54
33
27
5
25
59
46
53


Treatment means


Figure 3-6. Mean disease ratings ofBipolaris sacchari on Imperata cylindrica Florida accessions

(Trial 2). A) 7 days after inoculation. B) 21 days after inoculation.


I I I I


I I I I


















var ubra'
. br iolia
I braoiloenm
17
45
65
35

7
46
5
44
54
30
22
57
26
29
58
33
56
48
0 40

52
2 42
41
32
31
34
37
27
43
25
24
23
55
38
53
16
15
11
49
8
47
4
61
21
59


0 0.5 1 15 2 2.5


Treatment means


v- 'y-b-a
I brollba

45
22
57
43
7
8
11
9
55
16
65
46
60
44
30
29
41
26
23
58
40
*n 42
S 53
S 32
51
"1 34
33
48
31
54
61
50
39
38
24
21
47
49
36
27
35
15
5
25
37
59
4
52
56


Treatment means


Figure 3-7. Mean disease ratings of Drechslera gigantea on Imperata cylindrica Florida

accessions (Trial 2). A) 7 days after inoculation. B) 21 days after inoculation.
















40
42
36
varz "bra
11
65
35
L brasiliens
8
53
52
41
57
60
55
30
54
37

59
5C
2s
r 49
58
47
S6
15
33
5 3b
31
29
22
24
i brviftolt
16
51
4
32
48
9
27
23
45
26
21
43
46
25
56







vat "rubra
39
65
40
57
36
41
35
55
16
53
52
42
11
60
34
8
58
9
32
29
48
37
S 31
"a 24
S 4'
S 61
30
27
59
49
56
5
4
15
22
51
50
23

54
26
33
25
38
45
21


Treatment means


Figure 3-8. Mean disease ratings of the Mixture on Imperata cylindrica Florida accessions (Trial

2). A) 7 days after inoculation. B) 21 days after inoculation.






89


0 05 1 15 2 2.5 3 3.


Treatment means


46
43


IJ


kisarb en>ia


I































b


b


B. saccharin (Fl) C. caudatum D. gigantea (B) D. gigantea (Fl) Mixture (Fl) Mixture (B) B. sacchan (B) Control

Treatments


D. gigantea (B) C. caudatum D. ggantea (Fl) B. sacchan (Fl) Mixture (Fl) Mixture (B) B. sacchan (B) Control

Treatments

Figure 3-9. Disease severity of Florida (Fl) and Benin (B) isolates of Bipolaris sacchari,
Drechslera gigantea, and their mixture on the Benin accession oflmperata
cylindrica. Included in the trial was a Colletotrichum caudatum, indigenous to Benin.
A) Trial 1 at 7 days after inoculation (DAI). B) Trial 2 at 7 DAI. C) Trial 2 at 21 DAI.
D) Trial 2 at 21 DAI. Bars with the same letters are not significantly different.


















2.5-


D. gagantea (B) Mixture (l1)


ture () C. caudaum B. acchar (B) D. gga a () B. saccha (F) Control
Mixture (B) C. caudatum B sacchan (B) D. ggantea (Fl) B. sacckan (El) Control


Treatments


C. caudatumn B. sacchan (Fl) D. gigantea (B) D. gigantea (Fl) B. sacchan (B) Mixture (B) Mixture (Fl) Control


Treatments


Figure 3-9. Continued.









CHAPTER 4
EVALUATION OF OBLIGATE BIOTROPHIC FUNGI ASSOCIATED WITH Imperata
cylindrica IN SOUTH AFRICA AS POTENTIAL BIOCONTROL AGENTS FOR
COGONGRASS IN WEST AFRICA

Introduction

The classical approach to biological control of weeds involves the introduction,

establishment and self sustenance of herbivores or pathogens from the native range of the target

weed into the area where the weed has naturalized and become a problem (Briese, 2000). The

aim is to achieve a long-term equilibrium between the population of natural enemies and the

weed, and in the process trigger a reduction of the weed population below the economic or

ecological threshold. In a rangeland, pasture, or natural areas, a reduction in weed density will

open up niches for other desirable native or introduced plant species to invade, thereby restoring

a level of balance in the ecosystem. A strategic land management approach, however,

combining classical biocontrol with other techniques such as herbicides, fertilizers, and

revegetation, is recommended to control the whole spectrum of weed species present in the

system. Until recently, there has been a dearth of information on the biological control of grassy

weeds (Evans, 1991). Information on the natural enemy complex and the effect of this complex

on the population dynamics is largely unknown with a general lack of basic botanical

information on the centers of origin and diversity of a majority of the invasive grasses. This has

resulted in a general absence of attempted, and thus of successful, biological control projects

against grasses (Waterhouse, 1999).

Despite the importance of the problems caused by cogongrass throughout the tropical areas

of the world, biological control efforts have been few and rather piecemeal (Caunter, 1996).

Other complicating factors include existence of closely related grasses of economic and ecologic

value (Holm et al., 1977) and potential conflict of interest with groups that value cogongrass









(Evans, 1991). Similarly, little information exists on the pathogens of cogongrass and their

potential as biological control agents (Evans, 1991) and it is likely that fungi associated with

cogongrass are more diverse and abundant than indicated by herbarium records (Evans, 1991;

Charudattan, 1997; Minno and Minno, 1998).

The rust fungi are particularly well suited as biocontrol agents as they are typically wind

dispersed, may infect directly through the host epidermis or through stomata and do not require

wounds, are virulent, and highly host specific (Quimby, 1982). Rust fungi have complex life

cycles that vary among genera and species. A complete life cycle (macrocyclic) contains five

successive spore stages basidiosporess, pycniospores, aeciospores, urediniospores, and

teliospores) but most rusts are microcyclic and lack one or more of the stages. Autoecious rusts

are capable of completing their entire life cycle on one host species while heteroecious rusts

require two hosts in two different plant families to complete their life cycle (Littlefield, 1981).

Infection is usually local, forming individual colonies in leaves or other aerial parts of the host

and dependent on reinfection each year. Infection is sometimes systemic and persistent in the

plant.

Smut fungi present a rather uniform life cycle with a saprophytic haploid phase and a

parasitic dikaryophase. The haploid phase usually commences with the formation of

basidiospores in the basidium and ends with the production of dikaryotic, parasitic hyphae. The

dikaryotic phase ends with the production ofbasidia. The young basidium becomes a thick-

walled teliospore and separates at maturity from the sorus and functions as a dispersal unit.

Most of the Ustilaginomycetes are dimorphic, producing a yeast or yeast-like phase in the

haploid state (Bauer et al., 1997). Studies have been conducted that aim to develop a classical

biological control for itch-grass, Rottboellia cochinchinensis (Lour.) Clayton using the head









smut, Sporisorium ophiuri (P. Henn.) Vanky (Ellison and Evans, 1990), which has recently been

approved for release in Costa Rica. This is the first time that a true smut fungus has been used in

a classical biocontrol program.

Evans (1987, 1991) suggested that some of the known fungal pathogens of cogongrass

should be considered for introduction as classical biological control agents on this invasive weed.

Promising species include the rust fungi, Pucciniafragosoana Beltran, P. rufipes Diet. [USDA -

ARS, 2001] and P. imperatae Poirault (Evans, 1987); a smut fungus, Sporisorium

(=Sphacelotheca) \ hlI elufi hiil unl (Thuem.) Sacc. (Evans, 1987) that is well represented on

cogongrass in the Old World, mainly Africa (Evans, 1991) and the hemibiotrophic fungus

Colletotrichum caudatum (Sacc.) Peck (Caunter, 1996). It is interesting to note that the three

rust species and smut fungus are common in the Mediterranean region where I. cylindrica is not

a serious weed (Evans, 1991; Holm et al., 1977). The aecial stages of P. imperatae and P.

fragosoana are unknown while P. rufipes has a known aecial stage on Thunbergia, an alternate

host (Cummins, 1971). The presence of an economically important plant as an alternate host

potentially excludes this rust from further evaluation as a biocontrol agent due to potential

nontarget effects. Besides, Caunter (1996) cited that although P. rufipes was present in

Malaysia, it was having little effect on cogongrass.

The objective of this study were to: 1) determine the efficacy of two rust pathogens,

Puccinia fragosoana and P. imperatae and a head smut fungus, Sporisorium \ hi// e 'ilfin i/n Ilthiiun

(associated with the South African Imperata cylindrica) on the West African Benin I. cylindrica,

and 2) determine the inoculation method required for successful infection of the biotrophic fungi

on the West African Benin I. cylindrica.









Materials and Methods


Propagation of Test Plants

Viable Imperata cylindrica seeds were germinated by placing on water-soaked cotton wool

in petri dishes and leaving the dishes in a shade house for 14 to 21 d. Germinated seedlings were

subsequently replanted in 8-cm-diameter pots containing sterilized field soil and allowed to

establish for 25 d (Figure 4-1).

Source of Pathogens and Inoculum

Collections of I. cylindrica leaves infected with the rusts, P. fragosoana and P. imperatae

and inflorescences infected with the head smut, S. 'L hi cintfi hi, itntiu, all from South Africa,

were stored at 40C until required. The geographic source of these pathogens are given in Table

4-1.

Pucciniafragosoana and P. imperatae. For the first inoculation, uredospores of P.

fragosoana and P. imperatae were harvested by placing rust infected I. cylindrica leaf tissue in

200 ml distilled water amended with 0.1% Tween 80 and agitating manually for 5 min. For the

second inoculation, uredospores of P. fragosoana and P. imperatae were harvested by scraping a

sharp bent needle over the respective open uredinia (pustules) and collecting the spores which

were then stored separately in plastic vials at -200C until inoculation. Both spore suspensions

were adjusted to a final suspension of 1 x 106 spores ml-1 using a haemocytometer.

Sporisorium schweinfurthianum. The smut sori were harvested by placing the infected

inflorescences in a 250 ml Erlenmeyer beaker filled with 150 ml distilled H20 amended with

0.1% Tween 80 with a final suspension of 1 x 108 sori ml-1. Control plants for both experiments

were inoculated with distilled water amended with 0.1% Tween 80 only.









Treatments and Experimental Design

Pucciniafragosoana and P. imperatae. Eight-week-old I. cylindrica plants (5-blade

stage) per treatment were inoculated with a 1 x 106 ml-1 spore suspension amended with 0.1%

Tween 80, using either a small hand-held sprayer, until the liquid started to drip (i.e., runoff) or

by applying the spore suspension directly onto the leaves using a small, sterilized paint brush.

The inoculated plants were lightly misted with water before being covered with black plastic

sheeting for 24 h at 280C to facilitate uredospore germination. After 24 h, the black plastic

sheeting was removed and the inoculated plants were left in the shade house and monitored

weekly for lesion and pustule development for 30 d.

Sporisorium schweinfurthianum. There were three treatments including the controls. A

1 x 108 sori ml-1 suspension amended with 0.1% Tween 80 was applied to 15 cylindrica

seedlings as a soil drench and leaf inoculation, respectively. For the soil drench treatment, 15

potted seedlings were drenched until through-flow and the pots remained submersed in the spore

suspension for 24 h. The seedlings for the soil drench treatment were not watered for the first 7

days to maintain the level of spore concentration. For the leaf inoculation, 15 potted seedlings

were inoculated with a 1 x 108 ml- spore suspension amended with 0.1% Tween 80, using a hand

held sprayer, until runoff. Seedlings in both treatments were incubated at 280C (RH<80%) for

24 h.

The inoculated seedlings were placed in the shade house for 14 d and subsequently moved

to the field plot for up to 6 months. Distilled water amended with 0.1% Tween 80 was applied as

both soil drench and leaf inoculation control treatments. All experiments were repeated twice.

Results

Pucciniafragosoana and P. imperatae. Four weeks after inoculation, no disease

symptoms were observed for either P. fragosoana or P. imperatae. Neither inoculum method









was successful because no pustules developed. Possible reasons for the lack of infection could

possibly be attributed to a decrease in spore viability due to long-term storage and the low

temperature germination requirements of Pucciniafragosoana.

Sporisorium schweinfurthianum. In trial one, typical smut symptoms appeared after

flowering 4 months after inoculation with a 1 x 108 sori ml-1 soil drench treatment on I.

cylindrica Benin plants. Five of the 15 plants inoculated produced a single inflorescence. Four

of the five inflorescences were replaced with a brown, powdery mass of teliospores (Figure 4-2;

Table 4-2). No disease symptoms were observed on the cogongrass plants treated with the leaf

inoculation. For trial two, no smut symptoms were observed on the single inflorescence

produced after four months. No disease symptoms were observed on the cogongrass plants

treated with the leaf inoculation. No inflorescences emerged in the control treatment and it was

therefore not possible to compare the efficacy of the three treatments statistically.

Discussion

For any classical biocontrol program to be implemented, the researchers need to address

the level of pathogenicity (i.e., the biocontrol potential of the agent) and determine the host range

(the agent's safety to nontarget plants). Consideration of ecological principles in the selection

and evaluation process for potential biocontrol agents should reduce future risks (Louda and

Arnett, 1999). Biological control of weeds using imported plant pathogens is safe,

environmentally sound, and cost effective (Barton, 2004). There are several successful classical

biocontrol programs using rust fungi to control invasive weeds. The control of Acacia saligna

(Labill.) H. Wendl. in South Africa, by the rust fungus Uromycladium tepperianum (Sacc.)

McAlpine, which is indigenous to Australia, is one of the most successful classical biocontrol

programs documented (Morris, 1999). In Australia, the rust fungus Puccinia chondrillina Bubak

& Syd. has been successfully established on skeletonweed (Chondrillajuncea L.), formerly a









major weed of wheat throughout the eastern states of Australia. The weed has been reduced to

tolerable densities. Puccina carduorum Jacky, a rust imported from Turkey and released into the

USA to control musk thistle, Carduus thoermeri J.A Weinm., has spread widely from its original

introduction in the northeastern United States to Wyoming and California in the west (Bruckart

et al., 1996; Luster et al., 1999). Baudoin et al. (1993) showed that P. carduorum can

significantly reduce musk thistle density. In Australia, release of rust fungi for control of

blackberries (Rubus spp.), Parthenium, Mimosapigra L. and rubber vine [Cryptostegia

grandiflora (Roxb. ex R. Br.) R. Br.] has been moderately successful while the bridal creeper

rust fungus P. myrsiphylli, released in 2000, is showing promise of becoming a spectacular

success (Morin et al., 2002).

Head smut fungi are extremely host specific (Valverde et al., 1999) and the host range of

the genus Sporisorium is restricted to the Poaceae. A head smut, Sporisorium ophiuri (P. Henn)

Vanky (Ustilaginales), has been thoroughly studied on itchgrass, Rottboellia cochinchinensis, an

erect, strongly tufted, C4, annual grass. An important weed in several crops including maize,

sugarcane, upland and rain-fed rice, beans, sorghum, and some perennials, such as citrus and oil

palm at early growth stages, itchgrass has been reported as a weed of many crops in several

countries (Holm et al. 1977, Ellison, 1987, 1993; Reeder et al. 1996). The smut is a soilborne

pathogen, infecting itchgrass seedlings before they emerge from the soil, thereby causing a

systemic infection that leads to seed sterility. Sporisorium ophiuri has been recorded as a head

smut of itchgrass in Africa and Asia and is restricted to the Old World (Reeder and Ellison,

1999). Reeder et al. (1996) screened S. ophiuri on graminaceous species to which the genus

Sporisorium is restricted. The inflorescence of infected plants emerges covered with a mass of

dark brown teliospores that are shed back to the soil to start a new infection in the next seedling









generation of R. cochinchinensis (Reeder et al., 1996). Infection with head smut should

effectively reduce seed rain and reduce R. cochinchinensis density in subsequent crops. There is

no plant-to-plant spread within a generation, as the smut infects only young seedlings. The smut

is also capable of growth on artificial media and produces large numbers of sporidia in liquid

fermentation. Sporidia are recognized as the infective propagule for a number of smut species,

including many belonging to the genus Sporisorium. Therefore, the possibility exists that

sporidia could eventually form the basis of a mycoherbicide formulation that is applied

inundatively. This would allow for a much faster spread of the biocontrol agent, and thus hasten

the impact of the smut on the weed population (Reeder et al., 1996).

A single cogongrass plant can produce up to 3000 seeds per inflorescence; implementing a

classical biological control program with the head smut fungus, S. Mwi elfil ihiintlni1, could

effectively reduce the number of seeds produced leading to a reduction in cogongrass density.

The value of implementing S. lM i'iihtfi t/hiti int as a classical biocontrol agent, in combination

with the foliar pathogens, such as the rust fungus, P. imperatae, and C. caudatum, B. sacchari,

and D.gigantea (see Chapter 3) could provide an effective means to manage this invasive weed.

The lack of infection following the inoculation of two rust species, P. fragosoana and P.

imperatae, makes it impossible to reach any conclusions with regard to the biocontrol potential

of these pathogens. The success with respect to the head smut, S. 'L ilncfit I/llitlnnill, on the

Benin cogongrass, albeit limited, offers hope that this pathogen may have potential as a classical

as well as an inundative biocontrol agent. The reason for the presenting these results are to have

a record of the research completed to date. Although a relatively small piece of the puzzle,

results from this research will benefit other researchers embarking on follow-up work.









Table 4-1. Collections of obligate fungi associated with Imperata cylindrica in South Africa.
Fungi and life stages
Locality and GPS coordinates (in Roman numerals
East North East of Utrecht, Central North KwaZulu-Natal
(2732.834'S 30028.690'E) P. fragosoana, II and III
Church St East, Pretoria, Gauteng P. fragosoana, II and III
(2544.349'S 28015.659'E) S. ,111n if ill Nif I/inm
South of Sabie, Mpumalanga
(25o09.929'S 30046.164'E) Puccinia imperatae II


Table 4-2. Number ofImperata cylindrica inflorescences infected with the head smut,
Sporisorium \%/M i eillfji Ili ntllllln
Number of emerged Number of
inflorescences infected
Treatment (N=15)a inflorescences
Soil drench 5 4
Leaf inoculation 1 0
Control 0 0
a Total number of seedlings inoculated per treatment.










































. . . . . . .. .I*


Figure 4-1. Imperata cylindrica seedlings prior to inoculation with a 1 x 108 sori ml-1
Sporisorium \ /n eiI Cill ii ///// soil drench treatment.



































Figure 4-2. Imperata cylindrica inflorescence infected with the head smut, Sporisorium
\, hi eifinl ihi, tllnII four months after a soil drench treatment.









CHAPTER 5
SUMMARY AND CONCLUSIONS

Imperata cylindrica (L.) Beauv. (cogongrass, speargrass) is a noxious, rhizomatous grass

with a pan tropical distribution. It is ranked as one of the top 10 invasive weeds in the world.

Several survival strategies that include an extensive rhizome system, wind-disseminated seeds

and high genetic plasticity enable this plant to be a highly invasive colonizer (MacDonald, 2004).

Within the genus Imperata, cogongrass is the most variable species and specimens have been

found ranging from the western Mediterranean to South Africa, throughout Australia, India, and

Southeast Asia (including the Pacific Islands). In a previous study, it was demonstrated that two

fungal pathogens, Bipolaris sacchari (Butler) Shoem. and Drechslera gigantea (Heald & F.A.

Wolf) Ito, were pathogenic and had potential as biological control agents of cogongrass in the

USA.

The genetic diversity between the USA and African cogongrass was assessed using ISSR

markers and DNA sequence analysis of the ITS. DNA-based molecular marker techniques offer

novel approaches to quantify genetic diversity of weeds in native and introduced habitats; they

were employed in this study to better understand the relationship between the USA and West

African cogongrass. Included in the study were three closely related Imperata species: Imperata

brasiliensis Trin., is native to North, Central and South America and overlaps in its distribution

with cogongrass in Florida and possibly elsewhere in the Southeast, and is morphologically and

genetically very similar; Imperata brevifolia Vasey is native to California, and I. cylindrica var.

rubra, an ornamental variety sold in nurseries throughout the USA.

Weed populations with limited amounts of genetic variation are likely to be better targets

for biological control agents (Burdon and Marshall, 1981; Chaboudez and Sheppard, 1995).

Understanding the extent of genetic variation can be of importance in the detection of ecotypes









or races of a species as they may differ considerably in their susceptibility to predators, parasites,

or herbicides. In this study, the ISSR analyses showed that the USA and African I. cylindrica

accessions, which were defined by three distinct groups, were genetically separated. Within the

USA cogongrass, there was a distinction between cogongrass accessions collected throughout the

state of Florida and this study confirms that cogongrass was introduced multiple time into the

USA.

Imperata brasiliensis grouped with the Florida L cylindrica and forms a sister species to

the Florida cogongrass. In addition, I. cylindrica var. rubra was more closely related to the

African accessions. Imperata brevifolia was not genetically distinct from all the Imperata

accessions treated within this study. Different tree topologies were generated with the ITS

sequence analyses, which further confirmed that the African I. cylindrica was distinct from the

USA Imperata species. The Florida I. cylindrica accessions formed two distinct groups within

the tree, one representing the majority of accessions collected in West and Central Florida and one

representing accessions collected in East Florida. Imperata brasiliensis grouped within the USA

L cylindrica accessions. The Imperata cylindrica var. rubra accessions grouped together and

were genetically more similar to the African cogongrass than to the USA cogongrass. The

African cogongrass exhibited higher genetic differentiation than those in USA and closely

related Imperata species.

These findings have implications for implementing a biological control approach to

manage cogongrass. The hypothesis that fungal biological control within the USA and African

cogongrass would result in differential responses across the different accessions was not

supported by this study as the West African (Benin accession) was found to be equally

susceptible to the Florida and Benin isolates of B. sacchari and D. gigantea. However, it is









recommended that samples from different groups of cylindrica be included when screening

other candidate biological control pathogens in the future. Low genetic variation among the

different West African cogongrass would suggest that the Florida isolates of B. sacchari and D.

gigantea could potentially control the West African variety of cogongrass if employed in a

mycoherbicide formulation.

Virulence of the fungal pathogens, B. sacchari and D. gigantea, applied singly or as a

mixture associated with cylindrica accessions in Florida and Benin, and closely related species,

I. brasiliensis, I. brevifolia and I. cylindrica var. rubra, was confirmed in repeated greenhouse

trials on cogongrass accessions in Florida, USA and in shade house trials in Benin, West Africa.

An indigenous Colletotrichum caudatum (Sacc.) Peck isolate was included in the Benin study.

No consistent response was observed over the two trials to the different treatments on the Florida

cogongrass accessions over the monitoring period. The majority of the Florida cogongrass

accessions exhibited no significant differences in their reaction to the treatments compared with

the control treatment over the monitoring period, and there was no uniformity in the variance of

disease severity over accessions. Testing in Benin revealed that there were no significant

differences between the Florida and Benin isolates when inoculated on the Benin cogongrass.

When compared to the B. sacchari and the D. gigantea isolates, the indigenous fungus C.

caudatum consistently caused similar or greater disease symptoms on the Benin accession. The

slight decrease in disease severity noted can be attributed to the regrowth i.e., emergence of new

leaves and shoots. At no time during experimental period was plant mortality observed. From

these results, the potential to use B. sacchari and D. sacchari as inundative biocontrol agents to

control cogongrass in the USA and West Africa appears limited. Follow-up research, with

respect to the indigenous Colletotrichum caudatum, should be undertaken in West Africa. These









should include extensive host range testing to exclude the potential for nontarget effects.

Additional field trials, using available local resources, should be further examined.

Herbaceous weeds have been targeted for classical biological control strategies the most

frequently, while grassy weeds have not, until recently, been considered as suitable targets.

Despite the importance of the problems caused by cogongrass throughout the tropical areas of

the world, biological control efforts have been very limited (Caunter, 1996) and only scant

information exists on the pathogens of cogongrass and their potential as biological control agents

(Evans, 1991). Evans (1987, 1991) suggested that some of the known fungal pathogens of

cogongrass should be considered for introduction as classical biological control agents on this

invasive weed. Promising species include the rust fungi, Pucciniafragosoana Beltran, P. rufipes

Diet. and P. imperatae Poirault and a smut fungus, Sporisorium \In eilni t/iumll iin / (Thuem.)

Sacc. that is well represented on cogongrass in the Old World, mainly Africa, and the

hemibiotrophic fungus Colletotrichum caudatum. In this study, neither of the two rust

pathogens, P. fragosoana and P. imperatae was successful in causing infection on Benin

cogongrass in glasshouse trials. Two reasons for the negative response are that the rust spores

where possibly not viable after long-term storage and the uredosporeos of P. fragosoana requires

low temperature for germination. Typical smut symptoms appeared after flowering 4 months

after inoculation with a soil drench treatment on the Benin accession while no diseased

inflorescences were observed on the leaf-inoculated cogongrass. It is interesting to note that the

control plants did not flower within the experimental time-frame. The assumption would be that

the smut caused the inoculated plants to flower earlier, but more studies are needed to test this

hypothesis. The efficacy of the C. caudatum under field conditions was improved by









formulating the spores in an oil emulsion. The oil sformulation caused high levels of disease

incidence and disease severity even with no period of dew after inoculation.

The detection of intraspecific variation in resistance has significant implications biological

control programs as more than one strain of the pathogen might be required to control all

genotypes of the exotic weed. Finding the most virulent strain of the pathogen may require exact

host-matching in the native range for the specific genotypes of the exotic weed targeted for

control. Determining the level of genetic variation within weed species and populations can be

employed as an essential tool in the selection of the most suitable, and ultimately the most

effective, biological control agents. Implementing an amended C. caudatum formulation could

potentially play a role in an augmentative biocontrol strategy for long-term control of cogongrass

in West Africa. A classical biological control program using the head smut fungus, S.

\h e/I I hfillj ItNiiiiit might effectively reduce the number of seeds produced, leading to a

reduction in cogongrass density over time and to the success of biocontrol of this invasive weed.










APPENDIX A
FIELD EVALUATION OF THE INDIGENOUS FUNGUS, Colletotrichum caudatum,
ASSOCIATED WITH COGONGRASS IN BENIN

Introduction

The use of indigenous plant pathogens, isolated from weeds, cultured to produce effective

levels of infective propagules and used at inundative levels of inoculum is known as the

bioherbicide or approach to biological control of invasive weeds (Charudattan, 2001). Applying

infective propagules at rates high enough to cause extensive infection suppresses the target weed

before economic losses occur. One or several applications are required annually as these

pathogens generally do not reproduce in sufficient numbers between growing seasons to initiate

new epidemics on new weed infestations (Smith, 1982; Templeton, 1982; Charudattan, 1988).

Of the nine fungi that were developed as practical mycoherbicides or were considered to have

excellent prospects of being commercially available for use in the future, five are Colletotrichum

strains (Templeton, 1992). College, a formulation of the endemic anthracnose fungus C.

gleosporiodes (Penz.) Penz. & Sacc. in Penz. f sp. aeschynomene, was developed to control

northern joint vetch (Aeschynomene virginica (L.) B.S.P.) in rice and soybean fields. Registered

in 1982, the active ingredient contains 15% C. gleosporiodes f sp. aeschynomene conidia as a

dry powder formulation with shelf-life of 18 months. It was the first commercially available

mycoherbicide for use in annual weed in annual crops giving 90% control efficiency (TeBeest

and Templeton, 1985). The successful development of Collego led to the discovery of another

Collectotrichum-based mycoherbicide, by Philom Bios Inc., Canada. It contains conidia of C.

gleosporiodes (Penz.) Penz. & Sacc. in Penz. f sp. malvae to control Malvapusilla Sm. (round-

leaved mallow) in Canada and USA. The most effective period of application of a









mycoherbicide is at the early growth stage of the weed, although it can be effective at any stage

of weed growth (Makowski and Mortensen, 1992).

One of the possible reasons why Colletotrichum spp. are more successful than others are

that their pathogenicity strategies which include a hemibiotrophic phase that often precedes the

necrotrophic phase. Many Colletotrichum species produce large quantities of extracellular lytic

enzymes as well as toxins, while other species are known to produce local epidemics. While the

relative contribution of each property is unclear, it is most likely that a combination of these

factors make these fungi superior weed biological control agents (Sharon, 1998).

Hemibiotrophic pathogens are characterized by their initial infection of living host cells

followed by their necrotrophic phase and typical sporulation on dead tissues (Luttrell, 1974).

Hemibiotrophs are divided into biotrophic hemibiotrophs, species in which colonization of host

tissues is entirely biotrophic, with the death of host cells delayed until about the time the

pathogen begins to sporulate (Parbery, 1996). Necrotrophic hemibiotrophs have a short

biotrophic phase that allows them to take possession of host tissue prior to killing and invading

the tissue. Examples of necrotrophic hemibiotrophs include various species of Colletotrichum

(Latunde-Dada et al., 1996; O'Connell et al., 1993; Wei et al., 1997), including C.

lindemuthianum (Sacc. & Magnus) Lams.-Scrib. (O'Connell and Bailey, 1991). Colletotrichum

species produce two major sources of inoculum; conidia produced in acervuli and ascospores

produced in and released from perithecia (Bailey et al., 1992). Dissemination of spores from

young acervuli occurs in drops of water while wind distributes the dry spore masses from older

acervuli and ascospores from perithecia. Successful Colletotrichum mycoherbicides products

such as Collego are easily isolated and cultured on various solid and liquid media. All require

relatively long dew periods of between 12 and 24 h at optimal temperatures of between 20-30C.









Colletotrichum acutatum (Sacc.) Peck, incorrectly identified as C. gloeosporioides, utilized for

mycoherbicidal use on Hakea sericea Schrad. & J.C.Wendl. in South Africa was cultured on

sterilized bran and effectively used on hakea seedlings under field conditions (Morris, 1989).

In the late 1980s, Caunter and Wong (1988) surveyed for foliar pathogens ofl. cylindrica

throughout Malaysia and, while they generally found low disease incidence, several candidate

fungi were isolated including a tentatively identified isolate of C. caudatum. The pathogen's

widespread distribution and previous confirmation of host specificity made it a suitable candidate

for investigation into its potential as a bioherbicide (Caunter, 1996). The conidia germinated via

a single germ tube within 12 h after inoculation and appressoria formed within 24 h with

symptoms visible after 48 h (Caunter, 1996). Initial symptoms were chlorotic spots on the leaf

tips which developed into necrotic streaks along the leaf edges. At 34 DAI, only 40% of the

leaves had died and no plant death was observed. No effect was observed on regenerative ability

of the rhizomes. The addition of adjuvants and amendments, which affect spore germination,

virulence or environmental requirement, can influence disease severity. Caunter (1996) showed

that amendments of 0.1 5.0% sucrose, glucose, and yeast-extract had little or no effect on spore

germination but had an influence on appressorial formation and possibly plays a role in

increasing disease severity.

During a survey for pathogens and insects associated with cogongrass in the southeastern

USA, C. caudatum was identified on cogongrass in Florida (Minno and Minno, 1998). In

November 2002, C. caudatum was observed on infected I. cylindrica plants in the field in Benin

(J. Hotegni, personal communication) and an isolate (COCBEN8) was confirmed to be

pathogenic and highly virulent on I. cylindrica in Benin (Adolphe Avocanh, 2006, unpublished









data). The objective of this study was to evaluate the efficacy of this indigenous leaf-spot

causing fungus isolate from Benin on the I. cylindrica Benin accession under field conditions.

Materials and Methods

Inoculum Production

A pure culture of Colletotrichum caudatum (isolate COCBEN8) was obtained from Dr. F.

Beed's culture collection (IITA, Cotonou, Benin). Initial isolations were made from diseased

cogongrass plants growing at the IITA Station, Cotonou, Benin and their pathogenicity

confirmed (Adolphe Avocanh, 2006, unpublished data). The inoculum was produced by

transferring mycelial blocks, from stored slant cultures, to 150 ml potato salts broth. The broth

was prepared by steeping 200 g grated potato in distilled water for 1 hour, boiled for 5 min,

filtered through cheese cloth and the filtrate made up to 1 liter. To the filtrate was added 20 g

sucrose, 10 g KNO3, 5 g KH2PO4 2.5 g MgSO4.7 H20, 0.02 g FeC12 up to. The pH was adjusted

to 6 using NaOH and the medium was autoclaved at 1210C for 15 min. The inoculated flasks

were placed on a rotary shaker at 100 rpm and the fungua allowed to grow at 250C for 8 d under

laboratory conditions. Spores and mycelia were harvested by filtering the resulting suspension

through sterile cheese cloth. The spore concentration was determined with the aid of a

haemocytometer.

Inoculation

A field site was selected on the IITA-Benin station and all existing cogongrass plants were

removed from the site (Figure A-i). The cogongrass plants were allowed to regenerate naturally.

Sixteen 0.50 m2 plots with 0.25 m2 clearing between plots were marked in a randomized

complete block design. A 1 x 106 spores ml-1 amended with 1% paraffin oil and finely ground

kaolin (0.006 ml of 1 x 1010 spore ml-1 suspension and 6 g of kaolin made up to 60 ml) and a

mycelial suspension amended with 1% paraffin oil and kaolin (6 g dried mycelia and 6 g of









kaolin) were applied respectively at a rate of 100 ml amended spore or mycelial suspension per

plot at 15 s per plot. The two control treatments included a 1% kaolin in water and 1% paraffin

oil and 1% kaolin in water. Field plots were inoculated in the late afternoon to limit the effect of

high temperature on the outcome of the experiment. Due to the fact that C. caudatum is

ubiquitous throughout Benin, an initial disease assessment was made prior to inoculation (0 days

after inoculation [DAI]).

Disease Assessment

Disease was assessed as disease incidence (DI) and disease severity (DS). Disease

incidence was based on the number of plants infected among the total number of plants

inoculated, expressed as a percentage of diseased plants (Horsfall and Cowling, 1978). Disease

severity rating was based on the Horsfall-Barrett scale (Horsfall and Barrett, 1945). The disease

rating scale consisted of 12 class-values representing the percentage of disease severity as: 0 =

0%; 1 = 0 3%;2 =3 6%;3=6- 12%;4=12- 25%;5 =25 50%;6 =50 75%;7 =75-

88%; 8 = 88 94%; 9 = 94 97%; 10 = 97 100%; 11 = 100%. The mean class value was used

to determine the final disease severity value.

Statistical Analysis

Percentage data were transformed using an arcsine square root transformation. Analysis of

variance (ANOVA) was performed using the General Linear Models Procedure (SAS Institute,

Cary, NC). Means were compared using the Student-Newman-Keuls test at P<0.05.

Results

Due to the fact that the fungus, Colletotrichum caudatum is ubiquitous in the field in

Benin, an initial disease incidence assessment was made prior to inoculation at 0 DAI. Results

showed that after an initial DI rating of 30% for the mycelial and 53.33% for the spore

suspension treatments respectively, DI was observed at 100% for both treatments for the









experiment duration (Figure A-2A). There were no significant differences in DI at any of the

observation dates (Table A-i). Both control treatments had equal or higher DI ratings compared

with the fungal treatments at 0 DAI. Similarly, DI increased to 100% after 7 DAI (Figure A-

2A). Disease severity (DS) ratings ranged from one (0-3%) to six (50-75%) between treatments

(Figure B-2B). The two control treatments had similar DS ratings to the mycelial treatment,

ranging from 1 to 4. However, the DS rating for the spore suspension treatment ranged from 1 to

6 for the same observation period. Compared with the mycelial and control treatments, the spore

suspension treatment caused the most disease severity starting at 7 DAI and continuing up to 35

DAI.

Discussion

Many fungi have a requirement for free water, such as dew, for germination and infection

(Dhingra and Sinclair, 1985). While these requirements often limit the efficacy and therefore the

commercial potential of bioherbicides (Auld, 1993), they can be overcome by formulation,

application technology and careful timing of application (Walker and Boyette, 1986; Makowski

and Mortensen, 1990). Fungal propagules formulated in invert oil emulsions (water in oil) and

suspension oil emulsions (oil in water) have been employed for the enhancement of bioherbicide

fungal agents as a result of their ability overcome the limitation of insufficient free water and

spore protection (Amsellem et al., 1990; Daigle et al., 1990; Auld, 1993; Boyette et al., 1993;

Womack and Burge, 1993, Chandramohan et al, 2002; Yandoc et al., 2005). Due to their high

viscosity, invert emulsions are considered to be difficult to prepare and apply, and can be

fungitoxic (Womack et al., 1996), phytotoxic (Auld, 1993; Womack and Burge, 1993; Yang et

al., 1993) and cause nontarget plant damage (Daigle et al., 1990; Amsellem et al., 1991).

Suspension oil emulsions were developed in an effort to reduce the high and costly oil content of

invert emulsions and showed promise in reducing the free water limitation in two weed-pathogen









systems (Auld, 1993; Boyette, 1994) and reduced the spray volume and number of conidia of C.

truncatum (Schwein.) Andrus & W.D. Moore required for control of Sesbania exaltata (Raf.)

Cory. Boyette et al. (2007) showed, in greenhouse and field experiments, that an oil in water

emulsion of unrefined corn oil and a surfactant, Silwet L-77 increased the biological control

efficacy of C. truncatum for S. exaltata by stimulating the germination and appressoria formation

in vivo and in vitro and delaying the required dew period. Soybean yields were significantly

higher in the weed-controlled plots. Oil suspension emulsions of the potential mycoherbicide, C.

orbiculare (Berk. & Mont.) Arx, which causes anthracnose of Bathurst burr, Xanthium spinosum

L., were evaluated in field trials (Klein et al., 1995). Spores of C. orbiculare in kaolin were

mixed with different rates of vegetable and mineral oils and applied at several spore

concentrations at field sites over two seasons. Results varied, with improved mycoherbicide

activity in the kaolin formulation compared to an aqueous spore suspension treatment in the first

season, but the improvement was not repeatable at sites sprayed for the second season (Klein et

al., 1995). The effective control of seven weed species using three pathogens formulated with an

oil emulsion of Sunspray 6E and paraffin oil (4:1 ratio) was demonstrated by Chandramohan

(1999). A similar oil emulsion was used by Yandoc (2001) to improve the level ofbiocontrol

efficacy ofB. sacchari (Butler) Shoem. and D. gigantea (Heald & F.A. Wolf) Ito on cogongrass.

Greenhouse trials showed that an oil emulsion containing 4% horticultural oil, 10% light mineral

oil, and 86% water resulted in higher levels of foliar blight with no dew exposure or shorter dew

periods (Yandoc et al., 2005). Field trials showed that both fungi, when applied at 105 spores ml

1 in an oil emulsion, caused foliar injury while phytotoxic damage was also observed from the oil

emulsion.









The efficacy of the C. caudatum may be improved by formulating the spores in an oil

emulsion. The results show that using a properly formulated C. caudatum spore suspension

could be applied as an augmentative biocontrol strategy for long-term control of cogongrass in

West Africa.









Table A-1. Analysis of variance for disease incidence of Colletotrichum caudatum at 7 days after
inoculation.
Degrees of
Source freedom Sum of squares Mean Square F value Pr > F
Model 3 1366.66667 455.555556 0.52 0.6799
Error 8 7000.00 875.000
Corrected total 11 8366.667






































Figure A-1. Field trial site with reemerging Imperata cylindrica plants at IITA, Cotonou, Benin.

























Time (weeks after inoculation)


M Spore suspension


EI Controll Control 2


Time (weeks after inoculation)


Figure A-2. Field inoculation ofImperata cylindrica Benin using an amended Colletotrichum
caudatum formulation. A) Disease incidence. B) Disease severity.


E Mycelium









APPENDIX B
ACCESSION AND GENBANK DATA FOR THE USA Imperata cylindrica AND CLOSELY
RELATED SPECIES

Table B-1. Imperata cylindrica and closely related species sampled in USA for population
structure and virulence studies.


GenBank
Collection sites accessiona GPS coordinates


Plant accesssion
USA:
CGS1
CGS2
CGS4
CGS5
CGS7
CGS8
CGS9
CGS11
CGS12
CGS13
CGS14
CGS15
CGS16
CGS17
CGS18
CGS19
CGS20
CGS21
CGS22
CGS23
CGS24
CGS25
CGS26
CGS27
CGS28
CGS29
CGS30
CGS31
CGS32
CGS33
CGS34
CGS35
CGS36


Marion
Marion
Leon
Hernanado
Alabama
Walton
Walton
Santa Rosa
Santa Rosa
Santa Rosa
Escambia
Escambia
Santa Rosa
Okaloosa
Holmes
Lafayette
Hamilton
Gilchrist
Gilchrist
Levy
Levy
Citrus
Citrus
Hernando
Pasco
Pasco
Hillsborough
Hillsborough
Polk
Polk
Sumter
Bradford
Marion


EU267045



EU267064













EU267046
EU267047
EU267048
EU267049





EU267050
EU267051

EU267052
EU267054



EU267055

EU267056
EU267057


N 29015.608' W 82009.896'
N 29018.310' W 82009.091'
N 30040.254' W 84016.961'
N 28027.875' W 82026.706'
N 30040.326'W 87054.130'
N 30043.586' W 86007.776'
N 30047.492' W 86011.174'
N 30044.110'W 86044.576'
N 30042.725' W 86052.698'
N 30037.832' W 86059.453'
N 30028.580' W 87019.427'
N 30018.206' W 86025.652'
N 30023.318'W 87004.563'
N 30024.688' W 86045.406'
N 30043.224' W 85055.624'
N 30008.252' W 83013.608'
N 30028.398' W 83013.629'
N 29037.373' W 82045.162'
N 29036.435' W 82052.418'
N 29033.715' W 82054.492'
N 29021.127' W 82044.324'
N 28058.153'W 82038.117'
N 28048.924' W 82034.672'
N 28026.977' W 82038.017'
N 28021.359' W 8241.964'
N 28021.426' W 82030.263'
N 28008.527' W 82009.039'
N 28004.824' W 82003.870'
N 28007.627' W 81058.434'
N 28014.921' W 82003.338'
N 28050.072' W 82002.738'
N 29054.220' W 82008.143'









Table B-1. Continued.
GenBank
Plant accessions Collection sites accession GPS coordinates


CGS37 Alachua
CGS38 Clay
CGS39 Clay
CGS40 St Johns
CGS41 St Johns
CGS42 Nassau
CGS43 Putnam
CGS44 Flagler
CGS45 Volusia
CGS46 Volusia
CGS47 Brevard
CGS48 Brevard
CGS49 St Lucie
CGS50 St Lucie
CGS51 Okeechobee
CGS52 Okeechobee
CGS53 Highlands
CGS54 Highlands
CGS55 Hardee
CGS56 Hardee
CGS57 Manatee
CGS58 Osceola
CGS59 Osceola
CGS60 Union
CGS61 Putnam
CGS62 Putnam
CGS63 Lake
CGS64 Lake
CGS65 Lee
Imperata brasiliensis
CGS3 Miami-Dade
Imperata brevifolia
CGS6 California
Imperata cylindrica var.
rubra
CGS66 (1) Nursery plants
CGS66 (2) Nursery plants
a GenBank accession numbers given to the ITS


EU267058
EU267059


EU267060
EU267061
EU267062





EU267063



EU267065
EU267066
EU267067



EU267068


N 29042.983' W 82008.340'
N 29058.670' W 81052.670'
N 29059.020' W 81043.750'
N 29059.381' W 81036.600'
N 30007.422' W 81037.500'
N 30032.016' W 81051.466'
N 29036.377' W 82001.835'
N 29028.762' W 81026.834'
N 29008.601' W 81000.838'
N 29001.097' W 80059.512'
N 28045.072' W 80053.307'
N 28001.671' W 80039.093'
N 27022.254' W 80029.867'
N 27022.467' W 80027.920'
N 27015.923' W 80051.903'
N 27021.853' W 80058.177'
N 27022.229' W 81004.776'
N 27024.754' W 81030.792'
N 27029.580' W 81046.557'
N 27028.953' W 81054.951'
N 27028.038' W 82004.612'
N 27046.315' W 81006.769'
N 27041.826' W 80053.968'

N 29043.141' W 81048.750'
N 29043.141' W 81048.750'


EU267070


EU267053


N 26043.765' W 81039.222'

N 25029.344' W 80027.305'


N 34030.154'W 119020.768'


EU267072
EU267072
sequences from the present study.









APPENDIX C
ACCESSION AND GENBANK DATA FOR THE WEST AND SOUTH AFRICAN Imperata
cylindrica

Table C-1. Imperata cylindrica and closely related species sampled in West and South Africa for
population structure and virulence studies.
Plant GenBank
accessions Collection sites accessionsa GPS coordinates


Nkom pipeline invasive
Alae invasive
Eteme nkom invasive
Essong MF Savane natural
Ateba invasive
Etengue invasive

Alabata 1
Alabata 2
Ijaiya 1
Ijaiya 2


EU267036
EU267037


N 40 4.725' E 11034.320'
N40 5.076'E 11035.212'
N40 5.642'E 1135.574'
N 40 6.065' E 11036.214'
N 40 5.505'E 11035.521'


EU267035

EU267038
EU267039
EU267041
EU267043


Benin:
CGB1 IITA Research Station EU267030 N 6025.252' E 219.720'
CGB2 IITA Research Station EU267031 N 6025.252' E 219.720'
CGB3 Savalou 1 EU267032
CGB4 Savalou 2
CGB5 Sirarou 1 EU267033
CGB6 Sirarou 2
CGB7 IITA Research Station N 6025.252' E 219.720'
South Africa:
CGSA1 KwaZulu Natal EU267073 S 27032.834' E 30028.690'
CGSA2 KwaZulu Natal S 27032.834' E 30028.690'
CGSA3 KwaZulu Natal S 27032.834' E 30028.690'
CGSA4 KwaZulu Natal S 27032.834' E 30028.690'
CGSA5 KwaZulu Natal S 2732.834' E 30028.690'
CGSA6 KwaZulu Natal S 27032.834' E 30028.690'
a GenBank accession numbers given to the ITS sequences from the present study.


Cameroon:
CGC2
CGC6
CGC8
CGC9
CGC10
CGC11
Nigeria:
CGN1
CGN2
CGN3
CGN4
Guinea:
CGG1









LIST OF REFERENCES


Allen, C.M., Thomas, R.D., 1991. Brachiariaplantaginea, Imperata cylindrica, and Panicum
maximum: three grasses (Poaceae) new to Louisiana and a range extension for Rottboellia
cochinchinensis. Sida, Contributions to Botany 14, 613.

Allendorf, F.W., Lundquist, L.L., 2003. Introduction: Population biology, evolution and control
of invasive species. Conservation Biology 17(1), 24-30.

Altschul, S. F., Madden, T. L., Schaffer, A. A., Zhang, J., Zhang, Z., Miller, W., Lipman, D. J.,
1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs. Nucleic Acids Research 25, 3389-3402.

Amsellem, Z., Sharon, A., Gressel, J., Quimby, P.C. Jr., 1990. Complete abolition of high
inoculum threshold of two mycoherbicides (Alternaria cassiae and A. crassa) when
applied in invert emulsion. Phytopathology 80, 925-929.

Anderson, R.C., Gardner, E.D., 1999. An evaluation of the wilt-causing bacterium Ralstonia
solancearum as a potential biological control agent for the alien kahili ginger (Hedychium
garderianum) in Hawaiian forests. Biological Control 15, 89-96.

Anikster, Y., 1984. The formae specials. In: Bushnell, W.R., Roelfs, A.P. (Eds.), The Cereal
Rusts Vol. I. Academic Press. Orlando, pp. 115-130.

Anon., 1954. Notes and exhibitions. In: Proceedings of the Hawaiian Entomological Society
(Honolulu). Volume 15, pp 263-265; 279-281; 282-283.

Ash, G.J., Raman, R., Crump, N.S., 2003. An investigation of genetic variation in Carthamus
lanatus in New South Wales, Australia, using intersimple sequence repeats (ISSR)
analysis. Weed Research 43, 208-213.

Auld, B.A., 1992. Development and commercialization of biocontrol agents. In: Proceedings of
First International Weed Control Congress. Agmedia, Melbourne, Australia, pp. 269-272.

Auld, B.A., 1993. Vegetable oil suspension emulsions reduce dew dependence of a
mycoherbicide. Crop Protection 12, 477-479.

Ayeni, A.O., Duke, W.B., 1985. The influence of rhizome features on subsequent regenerative
capacity in speargrass [Imperata cylindrica (L.) Beauv.]. Agriculture, Ecosystems and
Environment 13(3/4), 309-317.

Bailey, J.A., O'Connell, R.J., Pring, R.J., Nash, C., 1992. Infection strategies of Colletotrichum
species. In: Bailey J.A., Jeger, M.J. (Eds.), Colletotrichum: Biology, Pathology and
Control. C.A.B. International: Wallingford, U.K., pp. 88-120.









Baldwin, B.G., Sanderson, M.J., Porter, J.M., Wojciechowski, M.F., Cambell, C.S., Donoghue,
M.J., 1995. The ITS region of nuclear ribosomal DNA: a valuable source of evidence on
angiosperm phylogeny. Annals of the Missouri Botanical Garden 82, 247-277.

Barreto, R.B., Evans, H.C., 1988. Taxonomy of a fungus introduced into Hawaii for biological
control ofAgeratina riparia (Eupatoriae; Compositae) with observations on related weed
pathogens. Transactions of the British Mycological Society 91, 81-97.

Barrett, S.C.B., 1982. Genetic variation in weeds. In: Charudattan, R., Walker H.L. (Eds.),
Biological Control of Weeds with Plant Pathogens. John Wiley & Sons, New York, pp. 78-
112.

Barrett, S.C.B., 1988. Genetics and evolution of agricultural weeds. In: Altieri, M.A., Liebman,
M. (Eds.), Weed Management in Agroecosystems: Ecological Approaches. Boca Raton,
FL: CRC, pp. 57-75.

Barton, J., 2004. How good are we at predicting the field host-range of fungal pathogens used for
classical biological control of weeds? Biological Control 31, 99-122.

Barton, J., Fowler, S.V., Gianotti, A.F., Winks, C.J., de Beurs, M., Arnold, G.C., Forrester, G.,
2007. Successful biological control of mist flower (Ageratina riparia) in New Zealand:
Agent establishment, impact and benefits to the native flora. Biological Control 40, 370-
385.

Baudoin, A.B.A.M., Abad, R.G., Kok, L.T., Bruckart, W.L., 1993. Field evaluation of Puccinia
carduorum for biological control of musk thistle. Biological Control 3, 53-60.

Bauer, R., Begerow, D., Oberwinkler, F., 1997. Ustilaginomycotina. Ustilaginomycetes. The true
smut fungi. Version 30 November 1997. The Tree of Life Project,
http://tolweb.org/Ustilaginomycetes/20530/1997.11.

Booth, C., Prior, C., 1984. A new Giberella species on Imperata (Graminae). Transactions of the
British Mycological Society 82, 180-182.

Boyette, C.D., 1994. Unrefined corn oil improved the mycoherbicidal activity of Colletotrichum
truncatum for hemp sesbania (Sesbania exaltata ) control. Weed Technology 8, 526-529.

Boyette, C.D., Hoagland, R.E., Weaver, M.A., 2007. Biocontrol efficacy of Colletotrichum
truncatum for hemp sesbania (Sesbania exaltata) is enhanced with unrefined corn oil and
surfactant. Weed Biology and Management 7, 70-76.

Boyette, C.D., Jackson, M.A., Quimby, P.C. Jr., Connick, W.J. Jr., Zidak, N.K. Abbas, H.K.,
1999. Biological control of the weed hemp sesbania with Colletotrichum truncatum. In:
Abstracts of the 10th International Symposium on Biological Control of Weeds, Montana
State University, Bozeman, MT, USA.









Boyette, C.D., Quimby, P.C. Jr, Bryson, C.T., Egley, G.H., Fulgham, F.E., 1993. Biological
control of hemp sesbania (Sesbania exaltata) under field conditions with Colletotrichum
truncatum formulated in an invert emulsion. Weed Science 41, 497-500.

Briese, D.T., 2000. Classical biological control. In: Sindel, B.M. (Ed), Australian Weed
Management Systems. R.G. & F.J. Richardson Publishers, Melbourne, Victoria, pp. 161-
192.

Bruckart, W.L., Politis, D.J., Defago, G., Rosenthal, S.S., Supkoff, D.M., 1996. Susceptibility of
Carduus, Cirsium, and Cynara species artificially inoculated with Puccinia carduorum
from musk thistle. Biological Control 6, 215-221.

Bruzzese, E., Hasan, S., 1986. The collection and selection in Europe of isolates of Phragmidium
violaceum (Uredinales) pathogenic to species of European blackberry naturalised in
Australia. Annals of Applied Biology 108, 527-533.

Bryson, C.T., 1985. A new food plant record for Atalopedes campestris (Boisduival)
Hesperiidae. Journal of the Lepidopterists' Society 39 (4), 335.

Bryson, C.T., 1987. Native butterflies accepted cogongrass (Imperata cylindrica [L.] Beauv.) as
host plant. Journal of the Mississippi Academic Society 3, 1.

Bryson, C.T., Carter, R., 1993. Cogongrass, Imperata cylindrica, in the United States. Weed
Technology 7(4), 1005-1009.

Burdon, J. J., Marshall, D.R., 1981. Biological control and the reproductive mode of weeds.
Journal of Applied Ecology 18, 649-658.

Campbell, F.T., 1998. Worst Invasive Plant Species in the Conterminous United States. Report,
Western Ancient Forest Campaign, Springfield, VA.

Caunter, I.G., 1996. Colletotrichum caudatum, a potential bioherbicide for control of Imperata
cylindrica. In: Moran, V.C., Hoffmann, J.H. (Eds.), Proceedings of the IX International
Symposium on Biological Control of Weeds. University of Cape Town, Cape Town, South
Africa, pp. 525-527.

Caunter, I.G., Wong, S.H., 1988. Foliar diseases of Lalang in Penang: biocontrol potential.
MAPPS Newsletterl2, 6.

Chaboudez, P., 1994. Patterns of clonal variation in skeleton weed (Chondrillajuncea), an
apomictic species. Australian Journal of Botany 42, 283-295.

Chaboudez, P., Sheppard, A.W., 1995. Are particular weeds more amenable to biological
control? A reanalysis of mode of reproduction and life history. In: Delfosse, E.S., Scott,
R.R. (Eds.), Proceedings of the Eighth International Symposium on Biological Control of
Weeds, Lincoln, New Zealand, pp. 95-102.









Chandramohan, S., 1999. Multiple-Pathogen Strategy for Bioherbicidal Control of Several
Weeds. PhD Dissertation, University of Florida, Gainesville FL, 191p.

Chandramohan, S., Charudattan, R., 1996. Multiple-pathogen strategy for bioherbicidal control
of several weeds. Weed Science Society of America Abstract 36, 49.

Chandramohan, S., Charudattan, R., Sonoda, R.M., Singh, M., 2002. Field evaluation of a fungal
pathogen mixture for the control of seven weedy grasses. Weed Science 50, 204-213.

Charudattan, R., 1988. Inundative control of weeds with indigenous fungal plant pathogens. In:
Burge, M. N. (Ed), Fungi in Biological Control Systems. Manchester University Press,
Manchester U.K., pp. 86-110.

Charudattan, R., 1997. Development of biological control for noxious plant species Progress
report May 15 -November 1997, University of Florida, Gainesville, Florida, USA.

Charudattan, R., 2001. Biological control of weeds by means of plant pathogens: Significance
for integrated weed management in modem agro-ecology. BioControl 46, 229-260.

Charudattan, R., 2005. Ecological, practical, and political inputs into selections of weed targets:
what makes a good biological control agent? Biological Control 35, 183-196.

Chase, M.W., Soltis, D.E., Olmstead, R.G., Morgan, D., Les, D.H., Mishler, B.D., Duvall, M.R.,
Price, R.A., Hills, H.G., Qiu, Y.L., Kron, K.A., Rettig, J.H., Conti, E., Palmer, J.D.,
Manhart, J.R., Sytsma, K.J., Michaels, H.J., Kress, W.J., Karol, K.G., Clark, W.D.,
Hedren, M., Gaut, B.S., Jansen, R.K., Kim, K.J., Wimpee, C.F., Smith, J.F., Furnier, G.R.,
Strauss, S.H., Xiang, Q.Y., Plunkett, G.M., Soltis, P.S., Swensen, S.M., Williams, S.E.,
Gadek, P.A., Quinn, C.J., Eguiarte, L.E., Golenberg, E., Learn, G.H., Graham, S.W.,
Barrett, S.C.H., Dayanandan, S., Albert, V.A., 1993. Phylogenetics of seed plants: an
analysis of nucleotide sequences from the plastid gene rbcL. Annals of the Missouri
Botanical Garden 80, 528-580.

Chase, M.W., de Bruijn, A.Y., Reeves, G., Cox, A.V., Rudall, P.J., Johnson, M.A.T., Eguiarte,
L.E., 2000. Phylogenetics of Asphodelaceae (Asparagales): an analysis of plastid rbcL and
trnL-F DNA sequences. Annals of Botany (London) 86, 935-956.

Chase, C.A., Shilling, D.G., Bewick, T.A., Charudattan, R., 1996. Fungal isolates with potential
for the biological control of cogongrass [Imperata cylindrica (L.) Beauv.]. Weed Science
Society of America Abstract 160, 49.

Cheng, K.T., Chou, C.H., 1997. Ecotypic variation of Imperata cylindrica populations in
Taiwan: I. Morphological and molecular evidences. Botanical Bulletin of Academia Sinica
38, 215-223.

Chikoye, D., Ekeleme, F., Ambe, J.T., 1999. Survey of distribution and farmers' perceptions of
speargrass [Imperata cylindrica (L.) Raeuschel] in cassava-based systems in West Africa.
International Journal of Pest Management 45 (4), 305-311.









Chikoye, D., Ekeleme, F., Udensi, U.E., 2001. Cogongrass suppression by intercropping cover
crops in corn/cassava systems. Weed Science 49, 658-667.

Chikoye, D., Manyong, V.M., Ekeleme, F., 2000. Characteristics of speargrass (Imperata
cylindrica) dominated in West Africa: crops, soil properties, farmer perceptions and
management strategies. Crop Protection 19, 481-487.

Chou, C.H., Tsai, C.C., 1999. Genetic variation in the intergenic spacer of ribosomal DNA of
Imperata cylindrica (L.) Beauv. var. major (Cogongrass) populations in Taiwan. Botanical
Bulletin of Academia Sinica 40, 319-327.

Clewell, A.F., 1985. Guide to the vascular plants of the Florida Panhandle. Tallahassee, FL:
Florida State University Press, 605p.

Coile, N.C., Shilling, D.G., 1993. Cogongrass, Imperata cylindrica (L.) Beauv.: a good grass
gone bad! Botany Circular No. 28. Gainesville, FL: Florida Department of Agriculture and
Consumer Services, Division of Plant Industry, 3p.

Cousens, R., Croft, A.M., 2000. Weed populations and pathogens. Weed Research 40, 63-82.

Cummins, G.B., 1971. The rust fungi of cereals, grasses, and bamboos. Springer-Verlag, New
York.

Daigle, D.J., Connick, W.J. Jr, Quimby, P.C. Jr, Evans, J., Trask-Morrell, B., Fulgham, F.E.,
1990. Invert emulsion: carrier and water source for the mycoherbicide, Alternaria cassiae.
Weed Technology 4, 327-331.

de Jong, M.D., 2000. The BioChon story: deployment of Chondrostereum purpureum to
suppress stump sprouting in hardwoods. Mycologist 14, 58-62.

de Jong, M.D., Scheepens, P.C., Zadoks, J.C., 1990. Risk analysis for biological control: a Dutch
case study in biocontrol of Prunus serotina by the fungus Chondrostereum purpureum.
Plant Disease 74, 189-194.

de Nooij, M.P., van Damme, J.M.M., 1988. Variation in host susceptibility among and within
populations ofPlantago lanceolata L. infected by the fungus Phomopsis subordinaria
(Desm.) Trav. Oecologia 75, 535-538.

Dekker, J., 1997. Weed diversity and weed management. Weed Science 45, 357-363.

Den Breeyen, A., 2004. Release strategies for the establishment of the leaf spot pathogen,
Mycovellosiella lantanae var. lantanae, on Lantana camera in South Africa. In: Cullen,
J.M., Briese, D.T., Kriticos, D.J., Lonsdale, W.M., Morin, L., Scott, J.K. (Eds.),
Proceedings of the XI International Symposium on Biological Control of Weeds. CSIRO
Entomology, Canberra, Australia, pp. 386-388.









Den Breeyen, A., Morris, M.J., 2003. Pathogenicity and host specificity ofMycovellosiella
lantanae var. lantanae, a potential biocontrol agent for Lantana camera in South Africa.
Biocontrol Science and Technology 13, 313-322.

Dhingra, O.D., Sinclair, J.B., 1985. Basic plant pathology methods. CRC Press Inc., Boca Raton,
FL.

Dickens, R., 1974. Cogongrass in Alabama after sixty years. Weed Science 22, 177-179.

Ellison, C.A., 1987. Preliminary studies to assess the potential of fungal pathogens for biological
control agents of the graminaceous weed Rottboellia cochinchinensis (Lour.) Clayton.
MSc thesis. Imperial College, University of London.

Ellison, C.A., 1993. An evaluation of fungal pathogens for biological control of the tropical
graminaceous weed Rottboellia cochinchinensis. PhD thesis, University of London.

Ellison, C.A., Evans, H.C., 1990. Preliminary studies to assess the potential of fungal pathogens
as biological control agents for Rottboellia cochinchinensis (Graminae). In: Delfosse, E.S.
(Ed), Proceedings of the VIII International Symposium on Biological Control of Weeds,
Istituto Sperimentale per la Patologia Vegetale, Ministero dell'Agricoltura e delle Foreste,
Rome, Italy, pp. 477-482.

Ellison, C.A., Evans, H.C., Ineson, J., 2004. The significance ofintraspecifies pathogenicity in
the selection of a rust pathotype for the classical biological control ofMikania micrantha
(mile-a-minute weed) in Southeast Asia. In: Cullen, J.M., Briese, D.T., Kriticos, D.J.,
Lonsdale, W.M., Morin, L., Scott, J.K. (Eds.), Proceedings of the XI International
Symposium on Biological Control of Weeds. CSIRO Entomology, Canberra, Australia, pp.
103-107.

Ellstrand, N.C., Schierenbeck, K.A., 2000. Hybridization as a stimulus for the evolution of
invasiveness in plants? Proceedings of the National Academy of Sciences USA 97, 7043-
7050.

Espiau, C., Riviere, D., Burdon, J.J., Gartner, S., Daclinat, B., Hasan, S., Chaboudez, P., 1998.
Host-pathogen diversity in a wild system: Chondrillajuncea-Puccinia chondrillina.
Oecologia 113, 133-139.

Eussen, J.H.H., 1980. Biological and ecological aspects of alang-alang [Imperata cylindrica (L.)
Beauv.)]. In: Proceedings of BIOTROP workshop on alang-alang in Bogor, 27-29 July
1976. Biotropica Special Publication No. 5, Bogor, Indonesia, pp. 15-22.

Evans, H.C., 1987. Fungal pathogens of some subtropical and tropical weeds and the possibilities
for biological control. Biocontrol News and Information 8, 7-30.

Evans, H.C., 1991. Biological control of tropical grassy weeds. In: Baker, F.W.G., Terry, P.J.
(Eds.), Tropical Grassy Weeds. CAB International, Wallingford, UK, pp. 52-72.









Evans, H.C., Symon, D.E., Roush, R.T., Groves, R.H., Williams, J., Corey, S., 1998. Taxonomy
and genotypes of the Rubusfructicosus L. aggregate in Austalia. Plant Protection Quarterly
13, 152-156.

Excoffier, L., Smouse, P.E., Quattro, J.M., 1992. Analysis of molecular variance inferred from
metric distance among DNA haplotypes: applications to human mitochondrial DNA
restriction data. Genetics 131, 479-491.

Felsenstein, J., 1985. Confidence limits on phylogenies: an approach using the bootstrap.
Evolution 39, 783-791.

Forno, I.W., Harley, K.L.S., 1979. Occurrence of Salvinia molesta in Brazil. Aquatic Botany 6,
185-187.

Freeman, T.E., 1981. Use of conidial fungi in biological control. In: Cole, G.T., Kendrick, B.
(Eds.), Biology of Conidial Fungi,Vol. 2. Academic Press, New York, USA, pp. 143-165.

Gabel, M.L., 1982. A biosystematic study of the genus Imperata (Graminae: Andropogoneae).
PhD. dissertation, Iowa State University, Ames, Iowa, USA.

Gaffney, J.F., 1996. Ecophysiological and technological factors influencing the management of
cogongrass (Imperata cylindrica). PhD Dissertation, Gainesville, FL: University of
Florida, 114p.

Gerlach, J., 2006. Invasive Species Specialist Group Database, Ecology of Clidemia hirta.
http://www.issg.org/database/species/ecology.asp.

Ghosheh, H.Z., 2005. Constraints in implementing biological weed control: A review. Weed
Biology and Management 5, 83-92.

Global Invasive Species Programme (GISP): Invasive Species and Poverty: Exploring the Links.
www.gisp.org/publications/brochures/invasivesandpoverty.pdf.

Goolsby, J.A., Van Klinken, R.D., Palmer, W.A., 2006. Maximising the contribution of native-
range studies towards the identification and prioritisation of weed biocontrol agents.
Australian Journal of Entomology 45, 276-286.

Greaves, M.P., McQueen, M.D., 1990. The use of mycoherbicides in the field. Aspects of
Applied Biology 23, 163-168.

Green, S., 2003. A review of the potential use of bioherbicides to control forest weeds in the UK.
Forestry 76(3), 285-298.

Groves, R.H., 1991. The physiology of grassy weeds in tropical agriculture. In: Baker, F.W.G.,
Terry, P.J. (Eds.), Tropical Grassy Weeds. CAB International, United Kingdom, pp. 39-51.









Gupta, M., Chyi, Y-S., Romero-Severson, J., Owen, J.L., 1994. Amplification ofDNA markers
from evolutionarily diverse genomes using single primers of simple-sequence repeats.
Theoretical and Applied Genetics 89, 998-1006.

Hall, D.W., 1978. The grasses of Florida. PhD. Dissertation, Gainesville, FL: University of
Florida, 498p.

Hall, D.W., 1983. Weed watch Cogongrass. Florida Weed Science Society Newsletter 5, 1-3.

Hall, D.W., 1998. Is cogongrass really an exotic? Wildland Weeds 1, 14.

Hasan, S., 1985. Search in Greece and Turkey for Puccinia chondrillina strains suitable to
Australian forms of skeleton weed. In: Delfosse, E.S. (Ed.), Proceedings of the VI
International Symposium on Biological Control of Weeds. Agriculture Canada, Ottawa,
Canada, pp. 625-632.

Hasan, S., Chaboudez, P., Espiau, C., 1995. Isozyme patterns and susceptibility of North
American forms of Chondrillajuncea to European strains of the rust fungus, Puccinia
chondrillina. In: Delfosse, E.S., Scott, R.R. (Eds.), Proceedings of the VIII International
Symposium on Biological Control of Weeds. CSIRO Publishing, Melbourne, Australia, pp.
367-373.

Hodkinson, T.R., Chase, M.W., Takahashi, C., Leitch, I.J., Bennett, M.D., Renvoize, S.A.,
2002a. The use of DNA sequencing (ITS and trnL-F), AFLP and fluorescent in-situ
hybridisation to study allopolyploid Miscanthus (Poaceae). American Journal of Botany
89, 279-286.

Hodkinson, T.R., Chase, M.W., Lled6, M.D., Salamin, N., Renvoize, S.A., 2002b. Phylogenetics
of Miscanthus, Saccharum and related genera (Saccharinae, Andropogoneae, Poaceae)
based on DNA sequences from ITS nuclear ribosomal DNA and plastid trnL intron and
trnL-F intergenic spacers. Journal of Plant Research 115, 381-392.

Holm, L.G., Plucknett, D.L., Pancho, J.V., Herberger, J.P., 1977. The World's Worst Weeds:
Distribution and Biology. Honolulu,University Press of Hawaii. 609p.

Horsfall, J.G., Cowling, E.B., 1978. Pathometry: The measurement of plant disease. In: Horsfall,
J.G., Cowling, E.B. (Eds.), Plant Diseases: An Advance Treatise, Vol. 2. Academic Press,
New York, NY, pp. 119-136.

Horsfall, J.G., Barratt, R.W., 1945. An improved grading system for measuring plant disease.
Phytopathology Abstracts 35, 655.

Hubbard, C.E., 1944. Imperata cylindrica. Taxonomy, Distribution, Economic Significance, and
Control. Imperial Agriculture Bureau Joint Publication No. 7, Imperial Bureau Pastures
and Forage Crops, Aberystwyth, Wales, UK.

Invasive Species Specialist Group Database [ISSG], 2005. Ecology ofPassiflora tarminiana.
http://www.issg.org/database/species/ecology.asp.









Invasive Species Specialist Group Database [ISSG], 2006. Ecology of Hedychium
gardnerianum. http://www.iss. org/database/species/ecology.asp.

Ivens, G.W., 1983. The natural control of Imperata cylindrica Nigeria and Northern Thailand.
Mountain Research and Development 3(4), 372-377.

James, C., 1971. A Manual of Assessment Keys for Plant Diseases. Canada Department of
Agriculture, Ottawa, Canada. American Phytopathological Society, St. Paul, MN, 78p.

Ker, A., 1995. Farming systems of the African savanna: a continent in crisis. International
Development Research Centre, Ottawa, ON, Canada, 167p.

King, L.M., Schaal, B.A., 1989. Ribosomal-DNA variation and distribution in Rudbeckia
missouriensis. Evolution 43, 1117-1119.

King, S.E., Grace, J.B., 2000a. The effects of gap size and disturbance type on invasion of wet
pine savanna by cogongrass, Imperata cylindrica (Poaceae). American Journal of Botany
87(9), 1279-1286.

King, S.E., Grace, J.B., 2000b. The effects of soil flooding on the establishment of cogongrass
(Imperata cylindrica), a nonindigenous invader of the southeastern United States.
Wetlands 20(2), 300-306.

Klein, T.A., Auld, B.A., Fang, W., 1995. Evaluation of oil suspension emulsion of
Colletotrichum orbiculare as a mycoherbicide in field trials. Crop Protection 14 (3), 193-
197.

Koch, W., Grobmann, F., Weber, A., Lutzeyer, H.J., Akobundu, 1.0., 1990. Weeds as
components of maize/cassava cropping systems. In: Standortgemaesse Landwirtschaft in
West Africa (IITA, Ibadan and University of Hohenheim, Stuttgard, Germany), pp. 219-
244.

Kolbe, J.J., Glor, R.E., Schettino, L.R., Lara, A.C., Larson, A., Losos, J.B., 2004. Genetic
variation increases during biological invasion by a Cuban lizard. Nature 431, 177-181.

Latunde-Dada, A.O., O'Connell, R.J., Nash, C., Pring, R.J., Lucas, J.A., Bailey, J.A., 1996.
Infection process and identity of the hemibiotrophic anthracnose fungus (Colletotrichum
destructivum) from cowpea (Vigna unguiculata). Mycological Research 100, 1133-1141.

Li, W.G., Shen, J.J., Wang, J.B., 2005. Genetic diversity of the annual weed Monochoria
vaginalis in southern China detected by random amplified polymorphic DNA and inter-
simple sequence repeat analysis. Weed Research 45, 424-430.

Lippincott, C.L., 1997. Ecological consequences of Imperata cylindrica (cogongrass) invasion in
Florida sandhill. PhD. Dissertation, Gainesville, FL: University of Florida, 165p.

Littlefield, L.J., 1981. Biology of the Plant Rusts: An Introduction. Ames: Iowa State University
Press, 103p.









Louda S.M., Arnett A.E., 1999. In: Spencer, N.R. (Ed). Predicting Non-Target Ecological
Effects of Biological Control Agents: Evidence from Rhinocyllus conicus, Proceedings of
the X International Symposium on Biological Control of Weeds, 4-14 July 1999. Montana
State University, Bozeman, Montana, USA, pp. 551-567.

Luster, D.G., Berthier, Y.T., Bruckart, W.L., Hack, M.A., 1999. In: Spencer, N.R. (Ed), Post-
Release Spread of Musk Thistle Rust Monitored from Virginia to California Using DNA
Sequence Information, Program Abstracts, Proceedings of the X International Symposium
on Biological Control of Weeds, 4-14 July 1999. Montana State University, Bozeman,
Montana, USA, p. 75.

Luttrell, E.S., 1974. Parasitism of fungi on vascular plants. Mycologia 66 (1), 1-15.

MacDonald, G.E., 2004. Cogongrass (Imperata cylindrica) Biology, ecology, and
management. Critical Reviews in Plant Sciences 23(5), 367-380.

MacDonald, G.E., Shilling, D.G., Brecke, B.J., Gaffney, J.F., Langeland, K.A., Ducar, T.A.,
2002. Weeds in the sunshine: Cogongrass [Imperata cylindrica (L.) Beauv.] biology,
ecology and management in Florida. University of Florida IFAS Extension Publication SS-
AGR-52.

Maddison, D., Maddison, W., 2000. MacClade 4: Analysis of phylogeny and character analysis.
CD-ROM, Sinauer Associates, Inc.

Makowski, R.M.D., Mortensen, K., 1990. Colletotrichum gloeosporioides f. sp. malvae as a
bioherbicide for roundleaved mallow (Malva pusilla): conditions for successful control in
the field. In: Delfosse, E.S. (Ed.), Proceedings of VII International Symposium on
Biological Control ofWeeds, Rome: Istituto Sperimentale per la Patologia Vegetale,
Minister dell'Agricoltura e delle Foreste, pp. 513-522.

Makowski, R.M.D., Mortensen, K., 1992. The first mycoherbicide in Canada: Colletotrichum
gloeosporioides f. sp. malvae for round-leaved mallow control. Proceedings of the First
International Weed Control Congress 2, 298-300.

Mangoendihardjo, S., 1980. Some notes on the natural enemies of Alang-alang [Imperata
cylindrica (L.). Beauv.] in Java. In: Soewardi, B. (Ed), Proceedings of BIOTROP
Workshop on Alang-alang, Bogor, Indonesia. BIOTROP SEAMO Regional Center for
Tropical Biology, Bogor, Indonesia, pp. 47-55.

McDonald, S.K., Shilling, D.G., Bewick, T.A., Gordon, D., Hall, D., Smith, R., 1996. Factors
influencing cogongrass, Imperata cylindrica (L.) Beauv., dispersion, establishment, and
persistence. Weed Science Society of America Abstracts 36, 46.

McGinley, M., 2007. Invasive alien species and development challenges in Africa. In: Cleveland,
C.J. (Ed.), Encyclopedia of Earth. Washington, D.C.: Environmental Information
Coalition, National Council for Science and the Environment.
http://www.eoearth.org/article/Invasivealien species anddevelopment challenges in A
rica









McRoberts, N., Finch, R.P., Sinclair, W., 1999. Assessing the significance of molecular diversity
data in natural plant populations. Journal of Experimental Botany 50, 1635-1645.

McRoberts, N., Sinclair, W., McPherson, A., Franke, A.C., Saharan, R.P., Malik, R.K., Singh,
S., Marshall, G., 2005. An assessment of genetic diversity within and between populations
of Phalaris minor using ISSR markers. Weed Research 45, 431-439.

Miller, M.P., 1997. Tools for population genetics analysis (TFPGA) 1.3: a Windows program for
the analysis of allozyme and molecular population genetic data. Computer software
distributed by author; http://bioweb.usu.edu/mpmbio/tfpga.htm.

Milne, R.I., Abbott, R.T., 2004. Geographic origin and taxonomic status of the invasive Privet,
Ligustrum robustum (Oleaceae), in the Mascarene Islands, determined by chloroplast DNA
and RAPDs. Heredity 92, 78-87.

Minno, M.C., Minno, M., 1998. Survey of herbivorous arthropods and pathogens of cogongrass
in Florida. Final Report to D. Shilling, University of Florida, Jay, FL and J. Meeker,
FDACS, Gainesville FL.

Morin, L., Auld, B.A., Brown, J.F., 1993. Host-range of Puccinia xanthii and post-penetration
development on Xanthium occidentale. Canadian Journal of Botany 71, 959-965.

Morin, L., Edwards, P.B., 2006. Selection of biological control agents for bridal creeper a
retrospective review. Australian Journal of Entomology 45, 286-290.

Morin, L., Evans, K.J., Sheppard, A.W., 2006. Selection of pathogen agents in weed biological
control: critical issues and peculiarities in relation to arthropod agents. Australian Journal
of Entomology 45, 349-365.

Morin, L., Hill, R.L., Matayoshi, S., 1997. Hawaii's successful biological control strategy for
mist flower (Ageratina riparia) Can it be transferred to New Zealand? Biocontrol News
and Information 18, 77N-88N.

Morin, L., Syrett, P., 1996. Prospects for biological control ofHieraciumpilosella with the rust
Puccinia hieracii var. piloselloidarum in New Zealand. In: Moran, V.C., Hoffmann, J.H.
(Eds.), Proceedings of the IX International Symposium on Biological Control of Weeds.
University of Cape Town, Cape Town, South Africa, pp. 199-204.

Morin, L., Willis, A.J., Armstrong, A., Kriticos, D., 2002. Spread, epidemic development and
impact of the bridal creeper rust in Australia: summary of results. In: Spafford Jacob, H.,
Dodd, J., Moore, J.H. (Eds.), Proceedings of the 13th Australian Weeds Conference. Plant
Protection Society of WA Inc., Perth, W.A., pp. 385-388.

Morin, M., 1995. Vascular plants of the United States. In: La Roe, E.T., Farris, G.S., Puckett,
C.E., Doran, P.D., Mac, M.J. (Eds.), Our Living Resources: A Report to the Nation on
Distribution, Abundance, and Health of U.S. Plants, Animals, and Ecosystems. U.S.
Department of the Interior, National Biological Service, Washington, D.C., pp. 200-205.









Morris, M.J., 1987. Biology of the Acacia gall rust, Uromycladium tepperianum. Plant Pathology
36, 100-106.

Morris, M.J., 1989. A method for controlling Hakea sericea Schrad. seedlings using the fungus
Colletotrichum gloeosporioides (Penz.) Sacc. Weed Research 29 (6), 449-454.

Morris, M.J., 1997. Impact of the gall-forming rust fungus Uromycladium tepperianum on the
invasive tree Acacia saligna in South Africa. Biological Control 10, 75-82.

Morris, M.J., 1999. The contribution of the gall-forming rust fungus Uromycladium tepperianum
(Sacc.) McAlp. to the biological control of Acacia saligna (Labill.) Wendl. (Fabaceae) in
South Africa. African Entomology Memoir 1, 125-128.

Morris, M.J., Wood, A.R., den Breeyen, A., 1999. Plant pathogens and biological controlof
weeds in South Africa: a review of projects and progress during the last decade. African
Entomology Memoir 1, 129-137.

Muller-Scharer, H., Lewisohn, T.M., Lawton, J.H. 1991. Searching for weed biocontrol agents -
when to move on? Biocontrol Science and Technology 1, 271-280.

Miller-Scharer, H., Schaffner, U., Steinger, T., 2004. Evolution in invasive plants: implications
for biological control. Trends in Ecology and Evolution 19(8), 417-422.

Murniati, G., 2002. From Imperata cylindrica grasslands to productive agroforestry. PhD.
Dissertation, Aula, Wageningen: Wageningen University, 172p.

Nei, M., 1978. Estimation of average heterozygosity and genetic distance from a small number
of individuals. Genetics 89, 583-590.

Nissen, S.J., Masters, R.A., Lee, D.J., Rowe, M.L., 1995. DNA-based marker systems to
determine genetic diversity of weedy species and their application to biocontrol. Weed
Science 43, 504-513.

O'Connell, R.J., Bailey, J.A., 1991. Hemibiotrophy in Colletotrichum lindemuthianum. In:
Mendgen, K., Leseman, D.E. (Eds.), Electron Microscopy of Plant Pathogens. Springer-
Verlag: New York, pp. 211-222.

O'Hanlon, P.C., Briese, D.T., Peakall, R., 2000a. Know your enemy: the use of molecular
ecology in the Onopordum biological control project. In: Spencer, N.R. (Ed.), Proceedings
of the X International Symposium of Biological Control of Weeds. Montana State
University, Montana, pp. 281-288.

O'Hanlon, P.C., Peakall, R., Briese, D.T., 2000b. A review of new PCR-based genetic markers
and their utility to weed ecology. Weed Research 40, 239-254.

O'Connell, R.J., Uronu, A.B., Waksman, G., Nash, C., Keon, J.P.R., Bailey, J.A., 1993.
Hemibiotrophic infection ofPisum sativum by Colletotrichum truncatum. Plant Pathology
42, 774-783.









Ohwi, J., 1965. Flora of Japan. Washington, DC: Smithsonian Institution. 1067p.

Olayide, S.O., 1980. Characteristics, problems and significance of farmers. In: Olayide, S.O.,
Eweka, J.A., Bello-Osagie, V.E. (Eds.), Nigerian small farmers' problems and prospects in
integrated rural development, Centre for Agricultural Rural and Development, University
of Ibadan, Ibadan, Nigeria. pp. 2-9.

Persley, G.J., 1973. Naturally occurring alternative hosts of Xanthomonas albilineans in
Queensland. Plant Disease Reporter 57, 1040-1042.

Peters, H.A., 2001. Clidemia hirta invasion at the Pasoh Forest Reserve: an unexpected plant
invasion in an undisturbed tropical forest. Biotropica 33 (1), 60-68.

Pimental, D., Zuniga, R., Morrison, D., 2005. Update on the environmental and economic costs
associated with alien-invasive species in the United States. Ecological Economics 52, 273-
288.

Quimby, P.C., Jr., 1982. Impact of diseases on plant populations. In: Charudattan, R., Walker,
H.L., (Eds.), Biological control of weeds with plant pathogens. John Wiley & Sons: New
York, pp. 47-60.

Randall, J.M., 1996. Weed control for the preservation of biological diversity. Weed Technology
10, 370-383.

Reeder, R.H., Ellison, C.A., 1999. Estado actual de la investigaci6n en control biol6gico clasico
de la Rottboellia cochinchinensis con el carbon Sporisorium ophiuri: potential y riesgos..
In: Sanchez, V., (Ed), Control biol6gico de Rottboellia cochinchinensis. Centro
Agron6mico Tropical de Ensefianza (CATIE), Informe Tecnico No. 308, Turrialba, Costa
Rica, pp. 101-135.

Reeder, R.H., Ellison, C.A., Thomas, M.B., 1996. Population dynamic aspects of the interaction
between the week Rottobellia cocinchinensis (itch grass) and the potential biological
control agent Sporisorium ophiuri (head smut). In: Moran, V. C., Hoffman, J. H. (Eds.),
Proceedings of the IX International Symposium on Biological Control of Weeds.
University of Cape Town, Rondebosch, South Africa, pp. 205-211.

Salamin, N., Hodkinson, T.R., Savolainen, V., 2002. Building supertrees: an empirical
assessment using the grass family (Poaceae). Systematic Biology 51, 136-150.

Sankaran, K.V., Sutton, B.C., 1991. Myrellina imperatae sp. Nov. on Imperata from Papua New
Guinea and Australia. Mycological Research 95, 1021-1022.

Santiago, A., 1965. Studies on the autoecology of Imperata cylindrica (L.) Beauv. In:
Proceedings of the Ninth International Grassland Congress, San Paulo, Brazil, pp. 499-
502.

Santiago, A., 1980. Gene ecological aspects for the Imperata weed and practical implications.
BIOTROP 5, 23-34.









Schmitz, D.C., Brown, T.C., 1994. As assessment of invasive non-indigenous species in
Florida's public lands. Technical Report No. TSS-94-100. Florida Department of
Environmental Protection, Tallahassee, Florida, USA.

Schneider, S., Kueffer, J.M., Roessli, D., Excoffier, L. 1997. Arlequin: a software for population
genetic data analysis, version 1.1. Genetics and Biometry Laboratory Department of
Anthropology, University of Geneva, Geneva, Switerzerland.

Sharon, A., 1998. The potential of weed-pathogenic Colletotrichum species as mycoherbicides
(abstract). Phytoparasitica 26, 4.

Shilling, D.G., Bewick, T.A., Gaffney, J.F., McDonald, S.K., Chase, C.A., Johnson, E.R.R.L.,
1997. Ecology, Physiology, and Management of Cogongrass (Imperata cylindrica). Final
Report. Florida Institute of Phosphate Research, IFAS, University of Florida, Gainesville
FL. 128p.

Smith, K.L., 1989. Epidemiology of gray leaf spot of field corn caused by Cercospera zeae-
maydis. PhD. dissertation, University of Maryland.

Smith, R.J., Jr., 1982. Integration of microbial herbicides with existing pest management
programs. In: Charudattan, R., Walker, H.L. (Eds.), Biological Control of Weeds with
Plant Pathogens. John Wiley & Sons, New York, pp. 189-203.

Soenarjo, E., 1986. Alang-alang gall midge potential as an alternate host for parasitoids.
International Rice Research Newsletter 11(5), 22-23.

Soltis, P.S., Soltis, D.E., Chase, M.W., 1999. Angiosperm phylogeny inferred from multiple
genes as a tool for comparative biology. Nature 402, 402-404.

Sterling, T.M., Thompson, D.C., Abbott, L.B., 2004. Implications of invasive plant variation for
weed management. Weed Technology 18, 1319-1324.

Sun, J.H., Li, Z-C., Jewett, D.K., Britton, K.O., Ye, W.H., Ge, X-J., 2005. Genetic diversity of
Pueraria lobata (kudzu) and closely repeated taxa as revealed by inter-simple sequence
repeat analysis. Weed Research 45, 255-260.

Swofford, D.L., 1998. PAUP*: Phylogenetic analysis using parsimony (*and other methods)
version 4.0. Sinauer Associates, Inc.

Taberlet, P., Gielly, L., Pautou, G., Bouvet, J., 1991. Universal primers for amplification of three
non-coding regions of chloroplast DNA. Plant Molecular Biology 17, 1105-1109.

Tabor, P., 1949. Cogongrass, Imperata cylindrica (L.) Beauv. in the southeastern United States.
Agronomy Journal 41, 270.

Tanner, G.W., Werner, M.R., 1986. Cogongrass in Florida an encroaching problem. Florida
Cooperative Extension Service Fact Sheet WRS-5, 4p.









TeBeest, D.O., Templeton, G.E., 1985. Mycoherbicides: progress in the biological control of
weeds. Plant Disease 69, 6-10.

TeBeest, D.O., Yang, X., Cisar, C.R., 1992. The status of biological control of weeds with fungal
pathogens. Annual Review of Phytopathology 30, 637-657.

Templeton, G.E., 1982. Status of weed control with plant pathogens. In: Charudattan, R.,
Walker, H.L. (Eds), Biological Control of Weeds with Plant Pathogens. John Wiley &
Sons, Inc., New York, pp. 29-44.

Templeton, G.E., 1992. Use of Colletotrichum strains as mycoherbicides. In: Colletotrichum:
Biology, Pathology and Control. British Society of Plant Pathology, UK, pp. 358 380.

Terry, P.J., Adjers, G, Akobundu, 1.0., Anoka, A.U., Drilling, M.E., Tjitrosemito, S., Utomo,
M., 1997. Herbicides and mechanical control oflmperata cylindrica as a first step in
grassland rehabilitation. Agroforestry Systems 36, 151-179.

Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G., 1997. The
CLUSTALX windows interface: flexible strategies for multiple sequence alignment aided
by quality analysis tools. Nucleic Acids Research 25, 4876-4882.

Thrall, P.H., Burdon, J.J., 2004. Host-pathogen life history interactions affect biological control
success. Weed Technology 18 (5), 1269-1274.

Trujillo, E.E., 1985. Biological control of Hamakua pa-makani with Cercosporella sp. in Hawaii.
In: Delfosse, E.S. (Ed.), Proceedings of the VI International Symposium on Biological
Control of Weeds. Agriculture Canada, Ottawa, Canada, pp.661-671.

Trujillo, E.E., 2005. History and success of plant pathogens for biological control of introduced
weeds in Hawaii. Biological Control 33, 113-122.

Trujillo, E.E., Norman, D.J., Killgore, E.M., 1994. Septoria leaf spot, a potential biocontrol
control of banana poke vine in forests of Hawaii. Plant Disease 78, 883-885.

Udensi, E.U., 1994. Mucuna (Mucunapruriens var utilis [Wight] Burck) for control of
speargrass (Imperata cylindrica [L.] Raeuschel) in a derived savannah environment. MSc
thesis, IITA.

Udensi, E.U., Akobundu, 1.0., Ayeni, A.O, Chikoye, D., 1999. Management of Imperata
cylindrica with velvetbean (Macunapruriens var. utilis) and herbicides. Weed Technology
13, 201-208.

USDA-ARS., 2001. U.S. Department of Agriculture, ARS National Programs, Crop Protection
and Quarantine. http://www.nps.ars.usda.gov/programs.htm?npnumber=304









Valverde, B.E., Merayo, A., Reeder, R., Riches, C.R., 1999. Integrated management of itchgrass
(Rottboellia cochinchinensis) in maize in seasonally dry Central America: Facts and
perspectives. In: Proceedings of the Brighton Crop Protection Conference-Weeds,
Farnham, United Kingdom: British Crop Protection Council, pp. 131-140.

Van Klinken, R.D., Julien, M.H., 2003. Learning from past attempts: does classical biological
control of Noogoora burr (Asteraceae: Xanthium occidentale) have a promising future?
Biocontrol Science and Technology 13, 139-153.

Van Loan, A.N., Meeker, J.R., Minno, M.C., 2002. Cogon Grass. In: Van Driesche, R. et
al.(Eds.), Biological Control of Invasive Plants in the Eastern United States. USDA Forest
Service Publication FHTET-2002-04, 413p.

Vayssiere, P., 1957. Les mauvaises herbes en Indo-Malasie. Journal d' Agriculture Tropical et de
Botanique applique 4 (9-10), 392-401.

Walker, H.L., Boyette, C.D., 1986. Influence of sequential dew periods on biocontrol of
sicklepod (Cassia obtusifolia) by Alternaria cassiae. Plant Disease 70, 962-963.

Wang, T., Su, Y., Chen, G., 2007. Population genetic variation and structure of the invasive
weed Mikania micrantha in Southern China: consequences of rapid range expansion.
Journal of Heredity Advanced Access, September 28, 2007. doi:10.1093/jhered/esm080.

Wapshere, A.J., Delfosse, E.S, Cullen, J.M., 1989. Recent developments in biological control of
weeds. Crop Protection 8, 227-250.

Wardill, T.J., Graham, G.C., Zalucki, M., Palmer, W.A., Payford, J., Scott, K.D., 2005. The
importance of species identity in the biocontrol process: identifying the subspecies of
Acacia nilotica (Leguminosae:Mimosoideae) by genetic distance and the implications for
biological control. Journal of Biogeography 32, 2145-2159.

Warwick, S.I., 1990. Genetic variation in weeds with particular reference to Canadian
agricultural weeds. In: Kawano, S. (Ed.), Biological Approaches and Evolutionary Trends
in Plants. London: Academic Press, pp. 3-18.

Waterhouse, D.F., 1999. When is classical biological control the preferred option for exotic
weeds? In: Proceedings of the Symposium of Biological Control in the Tropics, MARDI
Training Centre, Serdang, Selangor, 18-19 March 1999, Malaysia. CABI Publishing,
Kuala Lumpur, Malaysia, pp. 52-53.

Wei, Y.D., Byer, K.N., Goodwin, P.H., 1997. Hemibiotrophic infection of round-leaved mallow
by Colletotrichum gloeosporioides f sp. malvae in relation to leaf senescence and reducing
reagents. Mycological Research 101, 357-364.

Wester, L.L., Wood, H.B., 1977. Koster's curse (Clidemia hirta), a weed pest in Hawaiian
Forest. Environmental Conservation 4, 35-41.









Wilcut, J.W., Dute, R.R., Truelove, B., Davis, D.E., 1988. Factors limiting the distribution of
cogongrass, Imperata cylindrica, and torpedograss, Panicum repens. Weed Science. 36,
577-582.

Wolfe, A.D., Liston, A., 1998. Contributions of PCR-based methods to plant systematics and
evolutionary biology. In: Soltis D.E., Soltis, P.S., Doyle, J.J. (Eds.), Molecular systematics
of plants. II. DNA sequencing. Chapman and Hall:New York, pp. 43-86.

Wolfe, A.D., Xiang, Q-Y, Kephart, S.R., 1998a. Diploid hybrid speciation in Penstemon
(Scrophulariaceae). Proceedings of the National Academy of Sciences of the USA 95,
5112-5115.

Wolfe, A.D., Xiang, Q-Y, Kephart, S.R., 1998b. Assessing hybridization in natural populations
of Penstemon (Scrophulariaceae) using hypervariable inter-simple sequence repeat
markers. Molecular Ecology 7, 1107-1125.

Womack, J.G., Burge, M.N., 1993. Mycoherbicide formulation and the potential for bracken
control. Pesticide Science 37, 337-341.

Womack, J.G., Eccleston, G.M., Burge, M.N., 1996. A vegetable oil-based invert emulsion for
mycoherbicide delivery. Biological Control 6, 23-28.

Wood, A.W., Morris, M.J., 2007. Impact of the gall-forming rust fungus Uromycladium
tepperianum on the invasive tree Acacia saligna in South Africa: 15 years of monitoring.
Biological Control 41, 68-77.

Yandoc, C.B., 2001. Biological Control of Cogongrass, Imperata cylindrica (L.) Beauv. PhD
Dissertation, Gainesville, FL: University of Florida, 194p.

Yandoc, C.B., Charudattan, R., 1998. Use of natural substrates for the production of fungal
inoculum for biological weed control studies. Weed Science Society of America Abstracts
38, 80.

Yandoc, C.B., Charudattan, R., Shilling, D.G., 2005. Evaluation of fungal pathogens as
biological control agents for cogongrass (Imperata cylindrica). Weed Technology 19, 19-
26.

Yandoc-Ables, C.B., Rosskopf, E.N., Charudattan, R., 2006. Plant pathogens at work: progress
and possibilities for weed biocontrol, Part 1: Classical vs. bioherbicidal approach.
APSNET online feature, August 2006, http://apsnet.org/online/feature/weed1.

Yang, S., Johnson, D.R., Dowler, W.M., Connick, W.J. Jr., 1993. Infection of leafy spurge by
Alternaria alternate and A. angustiovoidea in the absence of dew. Phytopathology 83, 953-
958.

Ye, W.H., Mu, H.P., Cao, H.L., Ge, X.J., 2004. Genetic structure of the invasive Chromolaena
odorata in China. Weed Research 44, 129-135.









Zietkiewicz, E., Rafalski, A, Labuda, D., 1994. Genome fingerprinting by simple sequence
repeat (SSR)-anchored polymerase chain reaction amplification. Genomics 20, 176-183.









BIOGRAPHICAL SKETCH

Alana Den Breeyen was born in Cape Town, South Africa, in 1965. She entered the

University of Stellenbosch at Stellenbosch in 1987, majoring in plant pathology and botany and

received her Bachelor of Science degree in natural sciences in 1990.

In 1991, she started a master's program at the Department of Plant Pathology of the

University of Stellenbosch and graduated in March 1994. She worked as a research assistant for

Dr. Pedro Crous at the University of Stellenbosch where she was involved in mycological

research and taught an Introductory Mycology to undergraduate agriculture students. She

worked as a researcher at the Agricultural Research Council Plant Protection Research Institute

based in Stellenbosch from 1997 to 2003. She worked on several fungal biocontrol projects

using classical and bioherbicide control strategies on invasive weed species including Lantana

camera, Chromolaena odorata and Eichhornia crassipes (waterhyacinth). Her research

involved traveling to exotic places in Brazil, Jamaica, Cuba, and China to survey for and collect

fungal pathogens associated with the above-mentioned invasive weeds.

In 2004, she embarked on a new adventure when she started on a doctoral program at the

Plant Pathology Department at the University of Florida. She won the Outstanding Graduate

Student Award in 2004 and the Davidson Travel Scholarship in 2007. She served as president of

the Plant Pathology Graduate Student Association from August 2005 to June 2006. She is a

student member of the American Phytopathological Society (APS) and the Florida and

International Weed Science Societies. She also served on the APS Joint Committee of Women

in Plant Pathology and Cultural Diversity in 2005-2006.





PAGE 1

BIOLOGICAL CONTROL OF Imperata cylindrica IN WEST AFRICA USING FUNGAL PATHOGENS By ALANA DEN BREEYEN A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2007 1

PAGE 2

2007 Alana Den Breeyen 2

PAGE 3

To my parents, Henk and Pathia Den Breeen 3

PAGE 4

ACKNOWLEDGMENTS I thank my major professor, Dr. Raghavan Charud attan, for his belief in me even at times when it didnt seem justified and for giving me the opportunities to grow professionally. I thank Dr. Fen Beed, for helping me realize that if Im not part of the solution then I am part of the problem and for his generous hospitality and fr iendship during my time at IITA, Cotonou, Benin. I also thank my committee members, Dr Jeffrey Rollins, Dr. Greg MacDonald, and Dr. Fredy Altpeter for their time, interest and support. My thanks go to the many people who have helped me with my research: Jim DeValerio, for always being a willing drive r and one of my first friends in Gainesville, Mark Elliott, whose love and friendship has made life here well worth the journey, to Gabriella Maia, for her love and friendship and willingness to sit in the midday sun harvesting cogongrass rhizomes, and to Adolphe Avocanh who willing shared his office, expertise and friendship during my time at IITA, Benin. My thanks go to Eldon Philman and Herman Brown for the help they provided during the course of my experiments. Thanks go to my former labmates, Jennifer Cook and Jonathan Ho rrell. My special thanks go to my lab mate, Abby Guerra, who often put up with more than he should have and whose special friendship has brightened my days. To the students and staff at IITA, Benin who were always willing to help with my research and for reminding me to slow down, merci beaucoup! Thanks to Ms. Gail Harris, Ms. Donna Perry, Ms. Lauretta Rahmes, Ms. Jan Sapp, Ms. Sherri Mizell and Ms. Dana Lecuyer who helped me in their own special way. My thanks go to Mark and Maria Minno for allowing me access to their cogongrass collectio n and Meghan Brenan for help with my statistical data analysis. My special thanks to Sarah Clark Selke, Linley Smith, Tara Taranowski, Heidi HansPetersen, and Amanda Watson, the am azingly talented women who have become my friends. 4

PAGE 5

My special thanks go to my Mom and Dad, who made the rea lization of the dream that much easier, and to my brother and sister-in-law, Ashley and Izel le for their love and support. To all my friends, back home and around the world, thank you for your special blend of friendship. 5

PAGE 6

TABLE OF CONTENTS page ACKNOWLEDGMENTS ...............................................................................................................4 LIST OF TABLES ...........................................................................................................................8 LIST OF FIGURES .......................................................................................................................10 ABSTRACT ...................................................................................................................................12 CHAPTER 1 INTRODUCTION................................................................................................................. .14 Biology and Morphology ........................................................................................................15 Cogongrass in the United States .............................................................................................16 Cogongrass in West Africa .....................................................................................................18 Biological Control Strate gies for Forest Weeds .....................................................................20 Biological Control Stra tegies for Cogongrass ........................................................................26 Potential Insect and Nematode Biocontrol Agents ..........................................................27 Potential Plant Pathogenic Biocontrol Agents ................................................................28 Mycoherbicides ...............................................................................................................30 Genetic Variation in Invasive Weeds: The Implication for Biological Control .....................31 Biological Control and Genetic Markers ................................................................................33 2 AN EXAMINATION OF GE NETIC DIVERSITY OF Imperata cylindrica BASED ON INTER-SIMPLE SEQUENCE REPEATS AND SEQUENCE ANALYSIS OF INTERNAL TRANSCRIBED AND CHLOROPLAST TRNL-F SPACER DNA................36 Introduction .............................................................................................................................36 Materials and Methods ...........................................................................................................40 Population Sampling .......................................................................................................40 Extraction of Genomic DNA and PCR Amplif ication of ISSR Population Markers ......40 Results .....................................................................................................................................44 Analysis of ISSR Markers ...............................................................................................44 Analysis of ITS ................................................................................................................45 Analysis of trnL-F ...........................................................................................................47 Discussion ...............................................................................................................................47 3 EVALUATION OF FUNGAL PATHOGENS AS BIOLOGICAL CONTROL AGENTS OF Imperata cylindrica (L.) BEAUV. FROM THE USA AND BENIN..............60 Introduction .............................................................................................................................60 Materials and Methods ...........................................................................................................62 Propagation of Test Plants ...............................................................................................62 Inoculum Production .......................................................................................................63 6

PAGE 7

Imperata cylindrica Inoculations ....................................................................................64 Efficacy of Bipolaris sacchari and Drechslera gigantea Applied Singly or as a Mixture .........................................................................................................................64 Statistical Analysis ..........................................................................................................65 Results .....................................................................................................................................65 Efficacy of Bipolaris sacchari and Drechslera gigantea Applied Singly or as a Mixture .........................................................................................................................65 Florida Imperata cylindrica Accessions and Fungal Isolates ..........................................65 Benin Imperata cylindrica Accessions and Fungal Isolates ............................................68 Discussion ...............................................................................................................................69 4 EVALUATION OF OBLIGATE BIOTROPHIC FUNGI ASSOCIATED WITH Imperata cylindrica IN SOUTH AFRICA AS POTENTIAL BIOCONTROL AGENTS FOR COGONGRASS IN WEST AFRICA............................................................................92 Introduction .............................................................................................................................92 Materials and Methods ...........................................................................................................95 Propagation of Test Plants ...............................................................................................95 Source of Pathogens and Inoculum .................................................................................95 Treatments and Experimental Design .............................................................................96 Results .....................................................................................................................................96 Discussion ...............................................................................................................................97 5 SUMMARY AND CONCLUSIONS...................................................................................103 APPENDIX A FIELD EVALUATION OF THE INDIGENOUS FUNGUS, Colletotrichum caudatum ASSOCIATED WITH C OGONGRASS IN BENIN...........................................................108 Introduction ...........................................................................................................................108 Materials and Methods .........................................................................................................111 Inoculum Production .....................................................................................................111 Inoculation .....................................................................................................................111 Disease Assessment .......................................................................................................112 Statistical Analysis ........................................................................................................112 Results ...................................................................................................................................112 Discussion .............................................................................................................................113 B ACCESSION AND GENBANK DATA FOR THE USA Imperata cylindrica AND CLOSELY RELATED SPECIES.........................................................................................119 C ACCESSION AND GENBANK DATA FOR THE WEST AND SOUTH AFRICAN Imperata cylindrica ..............................................................................................................121 LIST OF REFERENCES .............................................................................................................122 BIOGRAPHICAL SKETCH .......................................................................................................140 7

PAGE 8

LIST OF TABLES Table page 2-1 Genetic variability of all single sampled populations of Imperata cylindrica and closely related species with the ISSR primers. ..................................................................53 2-2 Comparison of genetic diversity m easures for all sampled populations of Imperata cylindrica and closely related species as dete rmined using ISSR population markers. ....54 2-3 Summary of analysis of molecular variance (AMOVA) based on ISSR genotypes of the African and USA Imperata cylindrica accessions. ......................................................55 3-1 Pairwise comparison of least square means of disease severity (DS) from different treatments on Florida accessions of Imperata cylindrica at 7 days after inoculation. .......75 3-2 Pairwise comparison of least square means of disease severity (DS) from different treatments on Florida accessions of Imperata cylindrica at 21 days after inoculation. .....75 3-3 Disease severity statistical classes of Bipolaris sacchari Drechslera gigantea and their mixture on the Florida Imperata cylindrica accessions at 7 days after inoculation.. ........................................................................................................................76 3-4 Disease severity statistical classes of Bipolaris sacchari, Drechslera gigantea and their mixture on the Florida Imperata cylindrica accessions at 21 days after inoculation. .........................................................................................................................77 3-5 Pairwise comparison of least square means of disease severity (DS) from different treatments on the Benin accession of Imperata cylindrica at 7 days after inoculation (Trial 1). .............................................................................................................................78 3-6 Pairwise comparison of least square means of disease severity (DS) from different treatments on the Benin accession of Imperata cylindrica at 7 days after inoculation (Trial 2). .............................................................................................................................79 3-7 Pairwise comparison of least square means of disease severity (DS) from different treatments on the Benin accession of Imperata cylindrica at 21 days after inoculation (Trial 1). .............................................................................................................................80 3-8 Pairwise comparison of least square means of disease severity (DS) from different treatments on the Benin accession of Imperata cylindrica at 21 days after inoculation (Trial 2). .............................................................................................................................81 4-1 Collections of obligate fungi associated with Imperata cylindrica in South Africa. .......100 4-2 Number of Imperata cylindrica inflorescences infected with the head smut, Sporisorium schweinfurthianum ......................................................................................100 8

PAGE 9

A-1 Analysis of variance for disease incidence of Colletotrichum caudatum at 7 days after inoculation. ..............................................................................................................116 B-1 Imperata cylindrica and closely related species sampled in USA for population structure and virulence studies. ........................................................................................119 C-1 Imperata cylindrica and closely related species samp led in West and South Africa for population structure and virulence studies. ................................................................121 9

PAGE 10

LIST OF FIGURES Figure page 2-1 Photographs of ISSR gels..................................................................................................56 2-2 UPGMA dendrogram of all Imperata cylindrica accessions and closely related species sampled based on ISSR data. ................................................................................57 2-3 Parsimony tree inferred from ITS sequence data for all Imperata cylindrica accessions and closely related species. ..............................................................................58 2-4 Neighbor-joining tree of distances de rived from ITS sequence data for all Imperata cylindrica accessions and closely related species. .............................................................59 3-1 Disease symptoms and disease severity on Imperata cylindrica Florida accessions at 21 days after inoculation. ...................................................................................................82 3-2 Disease symptoms and diseases severity on Imperata cylindrica Benin accession at 21 days after inoculation. ...................................................................................................83 3-3 Mean disease ratings of Bipolaris sacchari on Imperata cylindrica Florida accessions (Trial 1).. ..........................................................................................................84 3-4 Mean disease ratings of Drechslera gigantea on Imperata cylindrica Florida accessions (Trial 1).. ..........................................................................................................85 3-5 Mean disease ratings of the Mixture on Imperata cylindrica Florida accessions (Trial 1).. ......................................................................................................................................86 3-6 Mean disease ratings of Bipolaris sacchari on Imperata cylindrica Florida accessions (Trial 2).. ..........................................................................................................87 3-7 Mean disease ratings of Drechslera gigantea on Imperata cylindrica Florida accessions (Trial 2). ...........................................................................................................88 3-8 Mean disease ratings of the Mixture on Imperata cylindrica Florida accessions (Trial 2). .......................................................................................................................................89 3-9 Disease severity of Florida (Fl) and Benin (B) isolates of Bipolaris sacchari Drechslera gigantea and their mixture on the Benin accession of Imperata cylindrica ...........................................................................................................................90 4-1 Imperata cylindrica seedlings prior to i noculation with a 1 x 108 sori ml-1 Sporisorium schweinfurthianum soil drench treatment. ..................................................101 4-2 Imperata cylindrica inflorescence infected with the head smut, Sporisorium schweinfurthianum four months after a soil drench treatment. ........................................102 10

PAGE 11

A-1 Field trial site with reemerging Imperata cylindrica plants at IITA, Cotonou, Benin. ...117 A-2 Field inoculation of Imperata cylindrica Benin using an amended Colletotrichum caudatum formulation. ...................................................................................................118 11

PAGE 12

Abstract of Dissertation Pres ented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy BIOLOGICAL CONTROL OF Imperata cylindrica IN WEST AFRICA USING FUNGAL PATHOGENS By Alana Den Breeyen December 2007 Chair: Raghavan Charudattan Major: Plant Pathology Imperata cylindrica (cogongrass, speargrass) is a noxi ous, rhizomatous grass with a pantropical distribution. It is ranked as one of the top 10 invasive weeds in the world. The plant has several survival traits that include an exte nsive rhizome system, wind disseminated seeds and high genetic plasticity. In the southeastern USA, it is a very serious invasive species and a federally designated noxious weed. In West Africa, cogongrass represents one of the most serious constraints to crop production and poverty allevi ation. Within the genus Imperata cogongrass is the most variable species and spec imens have been found ranging from the western Mediterranean to South Africa, throughout Austra lia, India and Southeast Asia (including the Pacific Islands). Included in the study were other Imperata taxa including I. brevifolia, I. brasiliensis and the ornamental variety I. cylindrica var. rubra. Due to possible hybridization, introgression, and overlapping mo rphological characters, there is often taxonomic confusion between cogongrass and I. brasiliensis especially in North America. Biological control would be an economical and environmentally friendly me thod for controlling this invasive weed and the objective of this study was to determine the suitability of th e West African cogongrass as a host to two pathogens, Bipolaris sacchari and Drechslera gigantea, found to be effective biological control agents in th e southeastern USA. Unde rstanding the extent of genetic 12

PAGE 13

variation can be of importance in the detection of ecotypes or races of a species as they may differ considerably in their susceptibility to predators, parasites, or herbicides. In the course of this study, USA and West African I. cylindrica accessions were found to be geographically and genetically distinct. These diffe rences were defined by three dist inct groups. Within the Florida cogongrass accessions, genetic varia tion was high confirming that I. cylindrica was introduced in the USA multiple times. Imperata brasiliensis was not genetically distinct from the USA I. cylindrica population forming a sister species to the Florida I. cylindrica accessions. In addition, Imperata cylindrica var. rubra was more closely related to the African accessions. Imperata brevifolia was found to be genetically distinct from all the Imperata accessions within the ISSR study. Bipolaris sacchari and D. gigantea isolates from the USA and West Africa were evaluated in greenhouse trials to determine their efficacy as biological control agents on the West African I. cylindrica There were no significant differences in disease incidence and disease severity between the Florida and Benin isolates inoculated on the Benin cogongrass. The Florida isolates of B. sacchari and D. gigantea are not suitable for use in a formulated mycoherbicide product for cogongrass control in West Africa because of low levels of disease and lack of weed suppression. An indigenous fungus Colletotrichum caudatum, evaluated in conjunction with the B. sacchari and D. gigantea isolates, was consistently found to cause similar or greater disease symptoms on the Benin accessions than the latter. Puccinia imperatae, P. fragosoana and, Sporisorium schweinfurthianum, associated with cogongrass in S outh Africa were evaluated for control of cogongrass in West Africa. Neither Puccinia spp. produced symptoms on I. cylindrica Benin whereas S. schweinfurthianum replaced the inflorescences with a teliospore-producing stroma, causing floral st erility. The amended C. caudatum spore formulation elicited more severe symptoms compared with the my celial inoculum and control treatments. 13

PAGE 14

CHAPTER 1 INTRODUCTION Invasive exotic species are a threat to global biodiversit y second only to habit loss and landscape fragmentation, and the economic impact of these species is a serious concern worldwide (Allendorf and Lundquist, 2003). An estimated 50,000 non-indigenous species established in the United States cause major e nvironmental damage and economic losses totaling over an estimated $125 billion, w ith 79 of these exotic species causing over $97 billion in damages from 1906 to 1991 (Pimental et al, 200 5; Allendorf and Lundquist, 2003). In crop systems, more than 500 introduced species ar e considered serious weeds while over 5,000 introduced species are found in natural ecosyst ems (Pimentel et al., 1989, Morin, 1995). In 1999-2000, over $41 million was spent in Florida for th e management of invasive terrestrial and aquatic plant species occurring in waterways, roadsides, rights-of-w ay, forests, and other natural areas (Florida DEP, 2000). As a result of alte ring ecosystem processes, invasive plant species displace native plant and animal species, support e xotic animals and pathoge ns, and subsequently alter gene pools by hybridizing w ith native species (Randall, 1996). In the United States, invasive weeds cause an approximate 12% reduction in crop yields. Agriculture, the mainstay of most national econo mies in Africa, provides 60% of all employment and generates more than 40% of the continen ts foreign exchange ear nings (GISP Brochure, 2007). In rural communities, agriculture supports 80% of the population and together with food security, is critical to the liv elihoods and survival of individua ls, communities and countries in Africa. According to McGinley (2007), Afri ca spends an estimated $60 million annually to control invasive alien species. The threats posed by invasive speci es consequently have a greater impact in developing countries, whose economies rely heavily on agriculture, forestry and fishing (GISP Brochure, 2007). Rural communitie s in developing countries, whose livelihoods 14

PAGE 15

are exclusively based on these ec onomic sectors, are the most at risk while the poorest section of these communities are wholly dependent on bi odiversity-based products for food, fuel and construction material. Biology and Morphology A warm-season, rhizomatous, grass species, cogongrass [ Imperata cylindrica (L.) Beauv.] is found throughout tropical and subtropical regions of the world (Holm et al., 1977). It employs several survival strategies th at include an extensive rhizome system, adaption to poor soil, drought tolerance, adaptability to fire, wind di sseminated seeds and hi gh genetic plasticity (MacDonald, 2004). Cogongra ss is a perennial, C 4 plant species which allows it to photosynthesize more efficiently under high light intensities and temperatures, and under conditions of limited moisture availability (Groves, 1991). Growing in loose -tocompact tufts, cogongra ss plants can reach up to 1 meter in height (Clewell, 1985). Considered st emless except for the flowering stalk, one to eight basal leaves (4 to 10mm wide; 15 to 150cm long) originate from the rhizomes. The linear-lanceolate leaves, with a characteristic off-center white midrib, have high silicon content (Coile and Shilling, 1993) that results in coarse leaf texture and serrat ed leaf margins. Cogongrass rhizomes, comprising of greater than 60% tota l plant biomass, are covered with tough scale leaves (cataphylls) that are thought to protect the rhizomes from desiccation, physical degradation and fire (Holm et al., 1997). The rhizomes have short internodes and form extensive, dense underground mats. The rhizomes can develop in two stages: primary seedling rhizomes, and secondary rhizomes that sprout fr om seedling rhizomes (Gabel, 1982). In central Florida, Gaffney (1996) found cogongrass rhizomes we re restricted to the top 10 to15 cm of soil on a phosphate mine site, but grew down to 80 cm below ground on a clay settling pond site. In Southeast Asia, rhizomes typically occur 10 to 40 cm below ground and form dense, extensive 15

PAGE 16

layers with some rhizomes growing as deep as 1 m (Ayeni and Duke 1985; Murniati, 2002). The cylindrical inflorescence is a dense panicle of paired spikelets (3 to 20 cm long, 0.5 to 2.5 cm). The spikelets are unawned with long sil ky hairs (Clewell, 1985) pr oducing small seeds (1 to 1.3 mm long) (King and Grace, 2000a, b). Worldwide, cogongrass shows variable phenol ogical development depending upon climate and population genetics. In its native Japan, c ogongrass flowers from May to June (Ohwi, 1965) while populations growing in the Mediterranean tend to flower during the spring and summer (October to March). In tropica l and subtropical areas, including Florida, cogongrass tends to flower year-round (Bryson and Carter, 1993). Fl owering is often caused by stress due to mowing, burning, grazing, cool temperatures, defoliation, and nitrogen fertilization (Holm et al., 1997; Coile and Shilling, 1993). Cogongrass reproduces by seed, with a single plant producing several thousand which can be wind-dispersed over long distan ces. Although seed movement is usually limited to 15 m or less, seeds were reported to travel up to 24 km when in open country (Hubbard, 1944). Seed dormancy is absent and mature seeds germinate within a week of shedding (Santiago, 1965) and remain viable for up to one year. Imperata cylindrica also reproduces vegetatively through the rhizomes allowing the plant to rapidly colonize new areas. Eussen (1980) reported that a single rhizome node could lead to the production of 350 shoots in 6 weeks and ground cover of 4 m 2 in 11 weeks. Cogongrass in the United States Cogongrass, ranked as one of the worlds t op ten invasive weeds (Holm et al., 1977), infests over 500 million ha worldwide including 200 million ha in Asia and an estimated 100,000 hectares in southeastern USA (Schmitz and Brown, 1994). Several known introductions occurred in the United States during the last century with the variety major accidentally 16

PAGE 17

introduced into Alabama (1912) from Japan while cogongrass from the Philippines was purposefully introduced to Mississippi in 1921 as potential forage (MacDonald, 2004). Additional forage trials were conduc ted in Florida, Texas (where th e planting died out in the first year) and Alabama with the consequence that by the late 1940s over 1000 acres had become established in central and north west Florida. By 2004, greater than 500,000 hectares with some level of cogongrass infestati on was present in Florida (Mac Donald, 2004). Cogongrass infests ditch banks, pastures, road sides/ right of ways, golf courses, la wns, forests and recreational and natural areas throughout Florida with the reclaimed phosphate mi ning areas of Central Florida supporting hundreds of acres of cogongra ss monoculture (MacDonald et al., 2002). Cogongrass infestations, in areas other than cl osed canopy forests, plantations and heavily cultivated lands, are managed using relatively expensive, laborious and repetitive control measures. In the United States, the most effectiv e management strategies require an integrated approach utilizing mechanical (discing, mowing), cultural (burning), chemical (herbicide applications of glyphosate and imazapyr) and re vegetation methods (Van Loan et al., 2002). Effective control strategies may be hampered by the existence of genetic variation and potentially adapted genotypes due to fact that there were at least two separate cogongrass introductions and the occurrence of Imperata brasiliensis Trin. (Brazilian satintail) in the United States. According to McDonald et al. (1996), crosses of I. cylindrica and I. brasiliensis produced viable seeds. This observati on raises the question of whethe r these two species should be considered forms of the same species. Hall (1983, 1998) has considered these to be members fo the same species due to the evidence of freque nt hybridization (Gabel, 19 82). The ornamental variety I. cylindrica var rubra (Red Baron or Japanese Blood Grass), sold in nurseries throughout the United States, is extr emely cold-tolerant (-23C) unlike I. cylindrica var. major. 17

PAGE 18

In Alabama, cogongrass rhizomes were able to su rvive winter temperatures of -14C (Wilcut et al., 1988), but were unable to survive winters in Mississippi when the temp erature reached -8 C (Hubbard, 1944). The creation of new poten tially cold-tolerant biotypes through the hybridization of I. cylindrica with var. rubra could possibly extend the range of this invasive weed north and westward (Shilling et al., 1997). Cogongrass in West Africa Imperata cylindrica var. africana (cogongrass and/or speargra ss) ranges from Senegal to Cameroon and from the south coast to the arid Suda n zone in the north. It is a serious weed in the moist savanna and forest zones especially in areas under intensive agricultural practices including recurrent fires, tillage, weeding and other farm activities (Chikoye et al., 2001). Although cogongrass occurs in South Africa, Madagasc ar and East Africa, it has greater invasive significance in Western Africa than either Eastern or Southern Africa (Ivens, 1983). According to Ivens (1983), I. cylindrica var. africana differs morphologically from the var. major of Southeast Asia (and consequently of the USA) with generally narrower leaf width, longer ligules, slightly longer spikelets with longer hairs and anthers. However, it has similar growth habits and ecological requirements as var. major Cogongrass infestations place major constraint s on the production of coconut, oil-palm, rubber, cereals, legumes, root and tuber crops (Chikoye et al., 1999). Annual crop yields are drastically reduced when grown in competition with I. cylindrica often causing losses of 80% to 100%. When crops were grown in slash plots w ithout additional weeding, complete crop failure usually occurred (Koch et al., 1990 ; Udensi et al., 1999). Koch et al. (1990) reported that I. cylindrica infestations of cassava fields intercropped with maize, caused yield losses greater than 90% while physical injuries caused by the shar p cogongrass rhizomes to roots and tubers of cassava and yam increased fungal disease incidences resulting in additio nal crop loss. In 18

PAGE 19

addition, I. cylindrica increases the risk of fires in pere nnial crops, plantations, and forest reserves and recurring fires result in soil degrad ation due to significant loss of organic matter (Holm et al., 1977, Terry et al., 1997). Cogongrass is a serious invasive weed that can decimate crop yields and demands the commitment of significan t proportions of resource s, such as capital, labor, and herbicides, for effective control. West African farmers perceived cogongrass to be their most serious weed (Chikoye et al., 1999). Labor-intensive farming practices such as hoeweeding, slashing and fallowing are the most common control practices. Long-term land abandonment has been the traditi onal way to manage severe infe stations of cogongrass in West Africa. This is because long-term land aba ndonment of 10 to 15 years results in extensive natural bush regrowth that effectively smothers the weed (Chikoye et al., 1999). However, longterm fallow cropping is no longer feasible due to increasing population pre ssure on limited arable land. Glyphosate or paraquat are the only two herb icides available if farmers chose to utilize chemcical control as part of their management strategy. However, the high cost of herbicides, lack of awareness, lack of capita l, and the non-availability of eff ective herbicides were cited as reasons for the low utilization of herbicides (Chi koye et al., 2000). Farm ers can combine several control practices in an integrat ed management strategy for enhanced suppression of the weed. Lack of capital resources however, was the most widely stated reason for the non-development of sustainable management strategies. Other reas ons included: 1) the lack of better management strategies, 2) the lack of adequa te labor, 3) the lack of equipm ent, and 4) health problems. Chikoye et al. (1999) concluded that research to develop a comprehensive management strategy for cogongrass in West Africa must become a prio rity as this weed th reatens the livelihood of over 200 million people in the region. 19

PAGE 20

Biological Control Strategies for Forest Weeds Invasive weeds cause significant economic a nd ecological losses in both commercial and native forest ecosystems. These weeds are highly successfully and compete for resources such as light, nutrients and water which results in the suppression of young or naturally regenerating trees (Green, 2003). According to Campbell ( 1998), an estimated 138 alien tree and shrub species including salt cedar ( Tamarix pendantra Pallas), eucalyptus (Eucalyptus spp.), Brazilian pepper (Schinus terebinthifolius Raddi), and Australian melaleuca ( Melaleuca quinquenervia (Cav.) S.T. Blake), have invaded native U.S. forest and shrub ecosystems (Pimental et al., 2005). Melaleuca quinquenervia is spreading at a rate of 11,000 ha/year throughout the forest and grassland ecosystems of the Florida Everglades causing damage to the natural vegetation and wildlife (Pimental et al., 2005). Acacia saligna Uromycladium tepperianum. One of the most successful classical biocontrol programs documented is the control of Acacia saligna (Labill.) H. Wendl. in South Africa, by the Australian rust fungus Uromycladium tepperianum (Sacc.) McAlpine (reviewed by Charudattan, 2001). As one of the most serious invasive weeds in South Africa A. saligna (Port Jackson willow) forms dense stands that replace indigenous vegetation and interfere with agricultural practices (Morri s, 1997). As the weed is difficult and costly to control mechanically and chemically, it was an excellent candidate for biological control. In 1987, a gall-forming rust fungus, U. tepperianum was imported into South Africa after extensive host-range testing undertaken in Australia confirmed its specificity (Morris, 1987). Morris (1987) studied the teliospore germination, early stages of host inf ection, host specialization and the reactions of some African Acacia and Albizia species to inoculation with U. tepperianum in Australia. Crossinoculation of teliosp ores isolated from A. implexa Benth., A. saligna and Paraserienthes lophantha spp. lophantha (Willd.) Nielson with the same thr ee species suggested that distinct 20

PAGE 21

genotypes of the rust occur on these species. As the reactions were dist inguishable at the hostspecies level, they should, accordin g to Anikster (1984), be termed formae speciales Morris (1987) showed that normal galls only developed on the species from which the teliospores were collected even though several known U. tepperianum host species were included in the study. Although the results indicated that these rust genotypes may be speci fic to a single host species, Morris (1987) recommended that a larger range of recorded hos t species be tested prior to formally designating the formae speciales. Since the initial releas es in the late 1980s, U. tepperianum, has subsequently spread and es tablished throughout the range of A. saligna (Morris, 1997). Fifteen years of monitoring (1991) showed that tr ee density declined by between 87% and 98% compared with data recorded prior to the U. tepperianum release (Wood and Morris, 2007). The introductio n of the seed-feeding weevil, Melanterius compactus Lea, should accelerate a continuous decline in stand density over time. According to Wood and Morris (2007), U. tepperianum remains a highly effective biologi cal control agent against the invasive tree A. saligna in South Africa. Passiflora tarminiana-Septoria passiflorae Passiflora tarminiana Coopens (banana passion flower, banana poka vine), native to the South American Andes, is an aggressive and invasive tropical vine in Hawaii. It invades disturbed areas and its effects include a loss of biodiversity, smothering of trees and the encouragement of other i nvasive species such as feral pigs that feed on the fruit (ISSG Database, 2005). By 1983, more than 50,000 ha of wet and mesic forests in Hawaii were infested with P. tarminiana costing the Division of Forestry and Wildlife $90,000 annually in the Hilo Forest Reserve (Truji llo, 2005). In 1991, Septoria passiflorae Syd was isolated from infected Hawaiian banana poka seedlings growing in Colombia. Subsequent to the pathogens importation to Hawaii, host-range tests, completed in 21

PAGE 22

1994, confirmed its specificity to banana poka vine (Trujillo et al., 1994). Septoria passiflorae was approved as a biocontrol agent for banana poka vine in 1995. In 1996/1997, field inoculations using spore suspensi ons resulted in significant cont rol of banana poka vines on the islands of Hawaii, Maui and Kauai (Trujillo, 2005). In the Hilo Forest Reserve, Hawaii, banana poka vine biomass was reduced between 40 to 60% annually after the first inoculations. Four years later, a 95% biomass reduction was obs erved (Trujillo, 2005). The introduction of S. passiflorae has resulted in the preser vation of endangered species and the regeneration of the indigenous Acacia koa Gray forest (the source of the mo st valuable timber species in Hawaii) while saving millions of dollars in weed contro l and forest revitalization in Kauai, Maui and Hawaii. Ageratina riparia-Entyloma ageratinae. Ageratina riparia (Regel) R. King & H.Robinson (mist flower, Hamakua Pa-makani) a low-growing perennial with tiny white daisy-like flowers, was accidentally introdu ced to Hawaii in 1925. By 1972, mist flower infestations extended over 100,000 ha of range a nd forest lands on the Hawaiian Islands (Morin et al., 1997; Trujillo, 1985). The foliar smut fungus, Entyloma ageratinae Barreto and Evans was introduced to Hawaii from Jamaica in 1975 to a ttack this aggressive weed in the mid-1970s. Initally misidentified as a Cercosporella sp., the pathogen was renamed E. ageratinae sp. nov. Barreto and Evans (Barreto and Evans, 1988), base d on physiological host reactions rather than morphological differences. However, Tr ujillo (2005) renamed the fungus as E. compositarum f. sp. ageratinae. After extensive host range studies confirmed that th e pathogen was specific to mist flower, field inoculations were made at invaded site s throughout the Hawaiian Islands (Trujillo, 2005). Total control of the plant was achieved in less than seven months in wet areas and within three to eight years in dry areas. Biol ogical control of mist flower in Hawaii has been 22

PAGE 23

an outstanding success in Hawaii with extensive rehabilitation of the Hawaiian rangelands. Entyloma ageratinae was subsequently released in New Z ealand in 1998 to suppress mist flower. Within two years, it had become established at all the initial release sites and was found up to 80 km from the nearest releas e site (Barton et al., 2007). Within 5.5 years it had spread to the entire North Island mist flower sites wi th the most distant site found 440 km from the nearest release. Results showed that almost 60% infection of live leaves was quickly reached and maximum plant height declined significan tly. As the mist flower cover significantly decreased due to the introduction of the fungus, the species richness and mean percentage co ver of native plants increased. It is interesting to note that no significant change wa s observed in the species richness and mean percentage cover of exotic plants (exc luding mist flower). According to Barton et al. (2007) the introduction of E. ageratinae as a biological control agen t of mist flower in New Zealand has been very successful. Broad-leaved tree species-Chondrostereum purpureum and Cylindrobasdium laeve The use of endemic wood-rotting fungi as bioher bicides to control invasive woody weed species has been successfully implemented in the Neth erlands and South Africa (Green, 2003). Applied directly on freshly cut stump surfaces, these fungi prevent re-sprouting of inoculated tree stumps. Chondrostereum purpureum (Pers:Fr.) Pouzar was developed as the mycoherbicide BIOCHON in the Netherlands, where it was used to control the introduced Prunus serotina Ehrh. (de Jong et al., 1990). BIOCHON was commercia lly available for several years as a method for combating the invasive North American Prunus and Populus spp. in natural and commercial forests in the Netherlands (de Jong, 2000). In Canada, two stump treatment products, Myco-tech and Chontrol containing native isolates of C purpureum have been developed and registered. Extensive epidemiological evidence showed that C purpureum posed no threat to susceptible 23

PAGE 24

crops grown further than 500 m from the application site (de Jong et al., 1990). The use of this control method will have only a limited impact on nontarget trees since the spores of this fungus are ubiquitous and healthy trees ar e resistant to attack. Howeve r, Setliff (2002) showed that C. purpureum is an important pathogen with epidemic pot ential in forest tree sp ecies especially in the Betulaceae ( Betula and Alnus) and the Saliaceae ( Populus and Salix ) families. A thorough investigation into the ecological impacts of C. purpureum for each geographical region should be undertaken with the pur pose of identifying low di sease risk areas where C. purpureum can be applied with the minimum environmental im pact (Setliff, 2002). In South Africa, a basidiomycete Cylindrobasidium laeve (Pers.) Chamuris was regist ered as the bioherbicide, Stumpout. It is applied directly to fr eshly cut stumps of several invasive Acacia spp.. According to Morris et al. (1999), this bioherbicide kills 95 to 100% of resprouting stumps. Clidemia hirta-Colletotrichum gloeosporioides f.sp. clidemiae. Clidemia hirta (L.) D. Don (Kosters curse), a perennial shrub native to Central and Sout h America, and the islands of the West Indies (Wester and Wood, 1977, Steyer mark and Huber, 1978 in Peters, 2001) is invasive in tropical forest understories particular ly in the Hawaiian Islands. The negative effect on the native ecosystem has led to the fear that si milar effects will be felt in the other introduced regions including the islands of Seychelles, the Comoros Island, Runion, Mauritius, the Malaysian Peninsula and parts of Micronesia (Palau) (Gerlach, 2006). First reported in Oahu in 1941 (Anon, 1954), Clidemia populations reached significant proportions by 1984 with more than 60,000 ha infested forested areas on Kauai, Molokai, Maui, and Hawaii (Trujillo, 2005). All management strategies implemented to da te including physical removal and herbicide treatments implemented have not proven practical and generally failed especially when initiated after first fruit set. A fungus, Colletotrichum gloeosporioides (Penz) Sacc. f. sp. clidemiae was 24

PAGE 25

isolated from diseased clidemia leaves collect ed in Panama in 1985 (Trujillo, 2005). Following the confirmation of specific ity of this pathogen to C. hirta permission was granted in 1986 by the Hawaii Board of Agriculture to use C. gloeosporioides f. sp. clidemiae to control clidemia. Repeated field inoculations undertaken from 1986 until 1992 at Aiea State Park, Oahu resulted in significant control of the weed (T rujillo, 2005). After several spore formulations were tested for field applications, a 5 x 10 5 per ml spore suspension ame nded with 0.5% gelatin and 2.0% sucrose that caused severe defoliati on was selected. Annual sprays directed at clidemia in Aiea State Park, Oahu using this spore formulation resulted in effective control of the weed and in the regeneration of several native species such as Acacia koa and fern species (Trujillo, 2005). Hedychium gardnerianum Pseudomonas solanacearum. Native to India, Hedychium gardnerianum Ker-Gawl (wild ginger or kahili ginger) is widespread throughout the tropics and is invasive in many forest ecosystems incl uding Hawaii, New Zeal and, Runion, South Africa and Jamaica (Anderson and Gardner, 1999). In 1954, H. gardnerianum was brought into Hawaii as an ornamental plant where it subsequently es caped cultivation and is currently considered a naturalized plant species. Acco rding to Anderson and Gardner (1999), kahili ginge r has invaded 500 ha of Hawaii Volcanoes National Park forest s (1000-1300 m elevation) and is found on all islands in Hawaii (Smith, 1985). Displacing native plants in forest ecosystems, kahili ginger forms dense stands that smother the native understor y. Further spread is facilitated by rhizomes which make this weed difficult to control (ISSG Database, 2006). Due to the fact that kahili ginger is widely distributed throughout the Hawaiian national pa rks, environmental concerns regarding herbicide use to control kahili gi nger has resulted in biological control being considered as the only practical approach for lo ng-term management of th is invasive weed in native forests. A Hawaiian Ralstonia (=Pseudomonas ) solanacerum (E.F. Smith) Yabuuchi et 25

PAGE 26

al. strain was isolated from both edible ( Zingiber officinale Roscoe) and ornamental gingers. The isolate from edible ginger was less virule nt than the isolate from ornamental ginger (Anderson and Gardner, 1999). Ralstonia solanacerum systemically infects edible and ornamental gingers causing decay and wilting of the infected tissue. Host-specificity tests showed that this strain did not infect the tested native and culti vated solanaceous species. All inoculated H. gardnerianum plants including rhizomes devel oped symptoms within 3 to 4 weeks after inoculation, with most inoculated plants completely dead within 4 months (Anderson and Gardner, 1999). While limited infection o ccurred close to the inoculation sites on H. coronarium J. Knig, Z. zerumbet (L.) Sm., Heliconia latispatha Benth., and Musa sapientum Gros Michel, no further systemic infection was observed in these species and the plan ts continued to grow normally (Anderson and Gardner, 1999). Despite concerns about the poten tial negative impacts of the bacterium on the edible ginger Z. officinale, Anderson and Gardner (1999) concluded that kahili ginger infestations were often remote enough to limit the risk of contamin ation to edible ginger plants. Ralstonia solanacerum should contribute to the control of H. gardnerianum however, possible contamination of agricultural lands from runoff water from treatment areas should be considered when using the R. solanacearum as a biocontrol agent (Anderson and Gardner, 1999). Biological Control Strategies for Cogongrass The use of one or more biotic organisms to ma intain another pest organism at a level where it is no longer a problem is known as biological control. Agents ar e selected on the basis of their specificity and ability to cause significant damage to the ta rget organism (Evans, 1991). Biological control of weeds with plant pathogens can adopt either a classical, augmentative or an inundative (bioherbicide) approa ch. The classical biocontrol approach involve s the introduction of natural enemies from the center of origin to an area where it does not occur to control the 26

PAGE 27

target weed in exotic environment, and augmenta tive approach involves peri odic releases of the control agent to augment an exis ting biocontrol population, while an inundative approach utilizes the application of indigenous biocon trol agents in massive doses to create an epidemic within the target weed population. During the 1970s, when weed biocontrol was still the domain of entomologists, there was a rapid increase in in terest by scientists in exploiting pathogens, particularly fungi, for weed control (Freeman, 1981). Until fairly recently there has been a dearth of information on the biological control of grassy weeds (Evans, 1991) with information on the natural enemy complex. The effect of th is complex on the population dynamic is largely unknown and a general lack of basic botanical information on the cente rs of origin and diversity. Implementing biological control st rategies to manage cogongrass is especially pertinent in natural ecosystems and low maintenance areas wher e the costs of using chemical and mechanical control methods would be prohibitive. Based on literature records and on-line databases, there are a number of potential biocontrol agents, including plant pathogens, arthropods and other invertebrates associated with c ogongrass throughout the world (Van Loan et al., 2002). This list includes 24 fungi, 51 insects, six nematodes, four mites and a pa rasitic plant in the USA (Minno and Minno, 1998). Potential Insect and Nematode Biocontrol Agents In Malaysia, Vayssiere (1957) reported seve ral polyphagous insect species that caused damage on cogongrass as well as other cul tivated cereals. Although Bryson (1985, 1987) reported that three species of the North American skipper butterfly (Lepidoptera: Hesperiidae) fed on cogongrass, they were deemed to be unsuita ble as biocontrol agents due to their lack of host specificity. The gall midge, Orseolia javanica Kieffer and van Leeuwen-Reijnvaan reportedly host specific to I. cylindrica ( Mangoendihardjo, 1980; Soenarjo, 1986) and destroys the apical shoot meristem particularly in areas where I. cylindrica is regularly cut or slashed. By 27

PAGE 28

reducing photosynthesis due to leaf blade reduction, heavy infestations could ultimately lead to lower rhizome carbohydrate reserves. Unfort unately, gall midges are known to be highly parasitized by generalist parasi toids (Van Loan, 2002) thereby limiting their effectiveness as biocontrol agents. Other potential agents include the nematode Heterodera sinensis Chen, Zheng and Peng, the mite Aceria imperata Zaher and Abou-Awad and two uniden tified dipteran stem borers (Van Loan, 2002). An extensive survey of herbi vorous arthropods and pa thogens of cogongrass throughout Florida (Minno and Min no, 1998) showed that the inse ct fauna associated with cogongrass in Florida was similar to that associated with cogongra ss in Africa and Asia. Several fungi, nematodes, mites, elaterid and scarab beetles, skipper bu tterfly and moth caterpillars, and grasshoppers were shown to cause damage. Potential Plant Pathogenic Biocontrol Agents Pathogens associated with cogongrass include Myrellina imperatae Sankaran and Sutton which causes leaf spots and chlorosis and Giberella imperatae C. Booth and Prior which originates from from Papua New Guinea and Australia and causes dieback of cogongrass (Sankaran and Sutton, 1992; Booth and Prior, 1984). Xanthomonas albilineans (Ashby) Dowson, the causal agent of leaf scald of sugarcane, reporte dly caused the appearance of discolored lines along the leaf veins of cogongrass in Australia (Persley, 1973). Other reported pathogens include Puccinia rufipes Diet., Claviceps imperatae Tanda and Kawatani, Monodisma fragilis Alcorn, Deightoniella africana Hughes, Mycosphaerella imperatae Sawada, Bipolaris maydis (Y. Nisik.) Shoemaker, Colletotrichum caudatum (Sacc.) Peck, C. graminicola (Ces.) G.W. Wilson, Aschochyta sp., Didymaria sp., Dinemasporium sp., Chaetomium fusiforme Chivers and Helminthosporium Curvularia and Fusarium species (Chadrasrikul, 1962; Chase et al., 1996; Caunter, 1996). 28

PAGE 29

In the late 1980s, Caunter and Wong ( 1988) surveyed for foliar pathogens of I. cylindrica throughout Malaysia and, while they generally f ound low disease inciden ce, several candidate fungi were isolated including Colletotrichum caudatum, Aschochyta sp., P. rufipes, C. graminicola Didymaria sp., and Dinemasporium sp. An investigation into the bioherbicide potential of the pathogen C. caudatum in Malaysia showed that greenhouse inoculations caused necrotic streaks along the leaf edges but no plant death wa s observed (Caunter, 1996). C. caudatum was recently identified on cogongra ss in Florida (Minno and Minno, 1998). Chase et al. (1996) evaluated th e pathogenicity of several fungi isolated from diseased cogongrass collected at vari ous sites in Florida. Research show ed that four of the six isolates were pathogenic to cogongrass causing up to 100% disease inciden ce. There was no record of weed mortality. Chaetomium fusiforme and an isolate from the Helminthosporium species group were found to be the most promising based on th e level of disease inci dence recorded in the greenhouse. In 2001, Yandoc (2001) screened both fungal isolates collected from cogongrass stands in north central Florida and fungal pathog ens previously isolated from various diseased grasses collected throughout Fl orida for pathogenicity and bi ocontrol potential. The study revealed that an isolate of B. sacchari from cogongrass and D. gigantea from large crabgrass had potential as biocontrol agents. Several obligate biotrophs including Puccinia imperatae Poirault, P. fragosoana F. Beltran and P. rufipes Diet. should be considered as potential classical biocontrol agents for cogongrass. A smut, Sphacelotheca sc hweinfurthiana (Thum.) Sacc., is well represented on cogongrass in the Old Wo rld, mainly Africa (Evans, 1991) and recently, Minno and Minno (1998) found the smut on cogongrass in Florida. It is interesting to note that these obligate parasites are common in the Mediterranean region where I. cylindrica is not a serious weed (Evans, 1991; Holm et al., 1977). 29

PAGE 30

Mycoherbicides Mycoherbicides utilize indigenous fungi isolat ed from weeds and cultured to produce large quantities of spores or mycelia that can be applied at rates that will cause hi gh levels of infection. The eventual goal of the mycoherbicide approach is the suppression of th e target weed before economic losses are incurred (Templeton, 1982). On e to several applica tions is generally required annually as the pathogens do not maintain sufficient inoculum to initiate new epidemics on new weed infestations (Charudattan, 1988; TeBeest et al., 1992). According to Yandoc-Ables et al. (2007), 200 or more plant pathogens, incl uding foliar and soil-borne fungi, bacteria and deleterious rhizobacteria have been or are curr ently under evaluation as po tential bioherbicides. Worldwide, 10 bioherbicides have been regi stered since 1980; in South Africa, Stumpout ( Cylindrobasidium laeve ) and Hakatak ( Colleotrichum acutatum J.H. Simmonds); in the USA, Lockdown [formerly Collego ] ( Colletotrichum gloeosporioides (Penz.) Penz. and Sacc. in Penz. f. sp. aeschynomene), Dr. BioSedge [ Puccinia canaliculata (Schwein.) Lagerh], DeVine [ Phytophthora palmivora (E.J. Butler) E.J. Butler], Smolder ( Alternaria destruens E.G. Simmons); in Canada, Mallet WP [formerly BioMal] (Colletotrichum gloeosporioides f. sp malvae ); in Japan, Camperico ( Xanthomonas campestris Migula pv. poae ); in China, Lubao ( Colletotrichum gloeosporioides f.sp. cuscutae ); and the Netherlands, BioChon ( Chondrostereum purpureum ) (Charudattan, 2001) were or cu rrently are registered as bioherbicides in the USA and Canada. Limited availability of many other bioherbicides can be ascribed to the continued lack of commercial backing, high co sts of mass production, limited markets, resistant weed biotypes and new chemic al herbicide chemistrie s (Charudattan, 2001). A major constraint in bioherbici de development is the requiremen t for appropriate formulations for successful establishment of the bioherbicide in the field to overcome the dew requirement that exists for several of them (Auld, 1992; Greaves and McQueen, 1990). Various invert and 30

PAGE 31

vegetable oil emulsion formulations have elim inated or greatly reduced the free moisture requirements and increased efficacy of spore inoc ulum (Boyette et al., 1999). Environmental conditions are among the primary factors that influence formulation performance of bioherbicides as inoculum production is dependent on sporulation of the formulation. One likely limitation on the practical efficacy of using D. gigantea as a mycoherbicide is the fact it does not readily sporulate in liquid culture (Chandram ohan, 1999). Yandoc and Charudattan (1998) were able to culture D. gigantea and B. sacchari readily on several grains. Chandramohan (1999) showed that by using a biphasic culturing system, where the bl ended fungal cultures, derived from the liquid phase, are spread on trays and allo wed to dry gradually. This system allows for multiple spore harvests with up to three years viabili ty when stored at 4C in sterile soil or as dry spores. However, spore viability of D. gigantea and B. sacchari on solid substrates was reduced even after a short-term storag e. The dew period and temperat ure requirements for both fungi were determined (Chandramohan, 1999; Yandoc et al., 2005) and these two factors should not be a limiting factor in their practical application as bioherbicides Chandramohan (1999) showed that a 12 h dew period at 28 C was optimal for D. gigantea and within a range that occurs normally under field conditions. Chandramohan et al. (2002) demonstrated that several pathogens could control different weedy grasse s under field conditions using an emulsion based inoculum preparation either singly or in comb ination. Yandoc (2001) showed that the efficacy of D. gigantea and B. sacchari could be improved by formulating th eir spores in an oil emulsion and that the formulation caused high er levels of disease and damage with as little as a 4 h dew period in the field. Genetic Variation in Invasive Weeds: The Implication for Biological Control Knowledge of the taxonomy of a selected target weed is a prerequisite for undertaking extensive and often costly explor ations for potential biological c ontrol agents in the native range 31

PAGE 32

(Morin et al., 2006). Although host specific biological c ontrol agents are most likely to be found within the native range of the ta rget weed, agents have been us ed from the introduced range, and from congeners when host-specific requirement s were broad (Van Klinken and Julien, 2003; Wapshere et al., 1989). Biological control agents are likely to be more diverse and hosts-specific in the centre of diversity for the genus and thes e regions should always be considered for initial exploration (Wapshere et al., 1989 ; Mller-Schrer et al., 1991). Determining the native host range starts with an extensive literature search and consultations with herbaria worldwide, with additional taxonomic and/or molecular work to fine tune the distribution and occurrence of genotypes (Goolsby et al., 2006). The importance of identifying the origin and/or the genetic diversity of invasive weed populations has been essential to implementing successful biocontrol program. Within the following biol ogical control program examples, Salvinia (Forno and Harley, 1979); Chondrilla (Chaboudez, 1994); Rubus (Evans et al., 1998); Onopordum (OHanlon et al., 2000a), Chromolaena (Ye et al., 2004) and Ligustrum (Milne and Abbott, 2004), all incorporated molecular studies to dete rmine the genetic diversity of related native species or populations to determine the putative centre of origin (Wardill et al., 2005). The genetic variation of invasive pl ant populations, through the select ion of resistant genotypes and differential efficacy resulting from genotypic vari ation, can be challenging for weed management strategies (Sterling et al., 2004). Weed populatio ns vary significantly in size and morphological character expression as a conse quence of phenotypic plasticity as individual genotypes respond to changes in environmental factors by changi ng their growth and development. Genetic differentiation, between and within populations, causes variation in weed species and if weed populations are persistent in an area long enough to enable loca l environment adaptation, then genetic differentiation is favor ed (Barrett, 1982). Increasing evidence suggests that rapid 32

PAGE 33

adaptive evolution of invasive plants is occurr ing during the process of range expansion (MllerSchrer et al., 2004). Whether this evolutionary change affects pl ant-antagonist interactions will have significant implications for biological c ontrol of invasive plant programs. Practical implications of understanding the po pulation genetic structure of a target invasive weed include the reconstruction of the historical process of migration and coloniza tion. Insights into the ecological persistence and evolut ionary potential of populations in new habitats ultimately lead to a better understanding of w eedy adaptation (Shilling et al., 1997) According to Shilling et al. (1997), Florida cogongrass is highly outcrossed, as indicated by morphological, RAPDs and mode-of-reproduction studies. However, evidence of clonal populations was also observed. Cogongrass populations develop gr eater genetic diversity by reproducing through seed and vegetatively propagating rhizomes, allowing th e weed greater adaptive changes to the environment. Biological Control and Genetic Markers Molecular genotyping of the target weed using DNAbased molecular markers may provide information that allows biocontrol researchers to pinpoint the origin of an invasive species or population (Nissen et al., 1995). Different DNA-based marker techniques, including chloroplast DNA restriction fragment leng th polymorphisms (cpDNA RFLP) and random amplified polymorphic DNA (RAPD) analysis, provide estimates of genetic variation, identifying species and other locally adapted forms, and define genetic rela tionships. These tools are well-established and widely used in weed research (Nissen et al ., 1995; OHanlon et al ., 2000b). A study by Wardill et al. (2005) used inte rnal transcribed spacer regions (ITS1) and non-coding chloroplast trnL DNA fragments to identify eight of nine described subspecies of Acacia nilotica (L.) Delile and reported a previous ly unknown Pakistan genotype. The study verified that the Australian populat ions were mostly comprised of A. nilotica ssp. indica (Benth.) 33

PAGE 34

Brenan and suggested that surv eys for biocontrol agents shou ld concentrate on the Indian subcontinent, A. nilotica ssp. indicas native range. Inter simple sequence repeat (ISSR) techniqu es employ an approach similar to RAPD except that ISSR primer sequences are designed from microsatellite regions dispersed throughout the various nuclear genomes and th e annealing temperatures used are higher than those used for RAPD markers. The ISSR method is an interm ediate technique between RAPD-PCR and more advanced techniques including simple sequence repeats (SSR) and amplified fragment length polymorphisms (AFLP). Inter simple sequence re peat analysis involves PCR amplification of genomic DNA using a single primer that targets th e repeat, with 1 to 3 bases that anchor the primer at the 3 or 5 end. In addition to freedom from the necessity of obtaining flanking genomic sequence information, ISSR analysis is technically simpler th an many other marker systems. The method provides highly re producible results an d generates abundant polymorphisms in many systems. The first studi es employing ISSR markers were published in 1994 (Zietkiewicz et al., 1994; Gupt a et al., 1994) with the initial studies focusing on cultivated species and the hyper variable na ture of ISSR markers was de monstrated (Wolfe and Liston, 1998). To test the utility of the method in natural populations, Wo lfe et al. (1998a, b) reexamined a known hybrid complex of four species of Penstemon for which three other molecular data sets were available. Their results clearly demonstrated the utility of ISSR markers for addressing questions of hybridizat ion and diploid hybrid sp eciation. Based on the published, unpublished and in-progre ss studies conducted using ISSR markers, it is clear that ISSR markers have great potenti al for studies of natural popu lations (Wolfe et al., 1998b). OHanlon et al. (2000b) classified and discussed the goals of genetic weed research into three areas of investigation: (i) patterns of genetic diversity wi thin invading weeds; (ii) the 34

PAGE 35

taxonomic identity of weeds; and (iii) determ ining the origin(s) of introduced weeds. Widespread concerns that weed species with hi gher levels of geneti c diversity will exhibit considerable potential for adaptation; thereby re ducing the effectiveness of weed control has led to the prioritization of determining the extent of variation in weed species (Dekker, 1997). There is, despite these efforts, a lack of evidence correlating genetic dive rsity with physiological, morphological or other ecological adaptations, including adaptations to biocontrol agents (Chaboudez and Sheppard, 1995). The objectives of this stu dy were to: 1) determine th e genetic variation between Southeastern USA and African cogongrass usin g populations markers and DNA sequence data to interpret the relati on with respect to implementing biological control strategies using two fungi, Bipolaris sacchari and Drechslera gigantea in Benin, West Africa; 2) determine the applicability of using the B. sacchari and D. gigantea associated with cogongrass in Florida and Benin as bioherbicides on the West African co gongrass by assessing the di sease severity of the pathogens, individually and as a mixture, on cogongrass populations from Southeastern USA and West Africa; 3) assess the effectiveness of biotrophic fungi as potential classical biological control agents on the West African cogongrass; and 4) implement a field trial using an amended oil Colletotrichum caudatum formulation on West African cogongrass. 35

PAGE 36

CHAPTER 2 AN EXAMINATION OF GE NETIC DIVERSITY OF Imperata cylindrica BASED ON INTERSIMPLE SEQUENCE REPEATS AND SEQUENCE ANALYSIS OF INTERNAL TRANSCRIBED AND CHLOROPLAST TRNL-F SPACER DNA Introduction The genetic variability of weedy plant populations presents significant challe nges for weed management, primarily because this variability may influence the effectiveness of control methods. Generally, exotic invasi ve plants as colonizing specie s have fairly low levels of genetic variation due to geneti c bottlenecks resulting from a si ngle introduction (Barrett, 1988; Warwick, 1990). Despite low levels of variab ility, many exotic weeds colonize new areas extremely well. Multiple founder events and hybridization within the founder populations may lead to increased diversity, and unique gene tic combinations coul d yield novel phenotypes (Ellstrand and Schierenbeck, 2000). As with many invasive weeds, Imperata cylindrica (L.) Beauv ., has been introduced multiple times in the USA and has been present long enough to have potentially evolved unique ecotypes. Some of this evolution may create genotypic variability within a host that can influence the efficacy of management approaches (Sterling et al., 2004). Understanding the interplay between host and pathogen with respect to pathogen life history and genetic factors that affect pathog en establishment and spread is ce ntral to the choice of biological control agents (Thrall and Burdon, 2004). Genetic diversity studies should reveal both the underlying genetic diversity and the divergent evolution of target pl ant species. Highly diverse populations might harbor differing levels of resistance to pathogens and ultimately prove more difficult to control (Charudattan, 2005). Imperata is a member of the family Poaceae within the subtribe Saccharinae and tribe Andropogoneae (Panicoideae). There are nine Imperata species with a worldwide distribution in the warm regions of both hemispheres. The genus is economically significant due to the weedy 36

PAGE 37

characteristics of I. cylindrica [cogongrass] (Gabel, 1982). According to Gabel (1982), Imperata cylindrica is the most variable species within this genus, with a wide geographic range. As such, it would be expected to possess a high degree of morphological variability. This variability is thought to be responsible for the multitude of scientific names for the species. Hubbard (1944) and Santiago (1980) separated the species into five major varieties based on growth, geographic origin, morphological characte ristics and karyotype. Imperata cylindrica var major is native to Asia, Australia, the Pacific Is lands and East Africa and it is characterized by 2n = 20 chromosomes. Imperata cylindrica var europa, found in North Africa, the Mediterranean, and east to Afghanistan and is char acterized by 2n=40 chromosomes. Imperata cylindrica var africana found in Southern, Centra l and West Africa has a chromosome count of 2n=60. Imperata cylindrica var condensata and I. cylindrica var latifolia are present in Chile, South America and Northern India respectively but ch romosome numbers for these species have not been reported. Hubbard (1944) a nd Santiago (1980) also reported differences in floral and leaf morphology that distinguishes the different varieties within I. cylindrica However, Gabel (1982) cited that the variability between the varieties of I. cylindrica was greater than between the species of Imperata as a whole and does not recognize the varietal distinctions as described by Hubbard (1944). In the United States, the poten tial for genetic variability and the development of adapted genotypes exist because there were at least two separate cogongrass intro ductions into the U.S. Southeast during the last century (S hilling et al., 1997). The variety major was accidentally introduced into Alabama from Japan in 1912 and purposefully introduced to Mississippi in 1921 from the Philippines as a potential forage crop. Forage trials were conducted in Florida, Texas (where the planting died out in the first y ear) and Alabama (Dickens, 1974; Hall, 1983; Tabor, 37

PAGE 38

1949; Tanner and Werner, 1986), leading to the es tablishment of populations. Adding to the genetic variability is I. brasiliensis Trin. (Brazilian satintail), whic h is native to North, Central and South America and overlaps in its distribu tion with cogongrass in Florida and possibly elsewhere in the Southeast. The Brazilian satintail and cogongrass are morphologically and genetically very similar, and th eir hybrids produce fertile offs pring (Shilling et al., 1997). Hybridization, introgre ssion, and overlapping morphological characters often cause taxonomic confusion between the two species, especially in North America. Both are both nonnative, rhizomatous perennial grasses in the USA, similar in appearance and are primarily distinguished by stamen numbers. The Brazilian satintail usua lly has one stamen per flower while cogongrass has two stamens per flower (Gabel, 1982; Hubbar d, 1944). Other distingui shing characteristics include Brazilian satintail's rela tively shorter spikel ets (<3.5 mm) and narrower culm leaves (<5 mm) compared to cogongrass (Allen and Thomas 1991). These characteristics overlap (Gabel, 1982; Lippincott, 1997) and it is li kely that the two grasses have been misidentified in the Southeast (Lippincott, 1997). Identification is further confounded by Brazilian satintail cogongrass hybridization in the Sout heast, the extent of which is unknown (Willard et al., 1988). Some systematists consider the two species s ynonymous. Hall (1978) su ggests that Brazilian satintail be classified as an infrataxon within I. cylindrica, while Gabel (1982) separates the taxa as two distinct species base d upon continents of origin a nd morphological, cytological and genetic attributes. At present, it is unlikely that I. cylindrica will spread outside of the USA Gulf Coast States due to the plants lack of low-te mperature tolerance. An ornamental variety I. cylindrica var rubra (Red Baron/Japanese Blood Grass) is being sold in nurseries in the United States, which is more cold tolerant than var. major (Wilcut et al., 1988). If this variety were introduced into the southeastern USA and it hybridizes with var. major, the resulting offspring 38

PAGE 39

may be more cold hardy and potentially extend its invasive range north and westward (Shilling et al., 1997). Molecular characterization could potentially fill in the taxono mic gaps that exist within I. cylindrica Within cogongrass populations in Flor ida, RAPD analyses, coupled with morphological characterization studies, showed that cogongrass was highly outcrossed but clonal populations were also observed. This suggested that cogongrass spread in Florida was through both seeds and rhizomes (Shilling et al., 1997). Using RAPD analys es, Cheng and Chou (1997) identified distinct ecotypes within six cogongrass s ites selected from diverse habitats in Taiwan. The I. cylindrica phenotypes varied with habitat and environment, being affected by soil conditions, temperature, and other climatic factors. Genetic vari ation, determined by restriction fragment-length polymorphisms (RFLPs) of the intergenic spacer region (IGS) of ribosomal DNA (rDNA) in interand intra-specific populati ons of cogongrass in Ta iwan revealed two major clusters. One population (Chuwei) was found to be distinctly different from the remaining 14 populations studied based on the phylogenetic study (Chou and Tsai, 1999). DNA sequence analysis is used extensively for phylogenetic studies at many different taxonomic levels (Chase et al., 1993; Soltis et al., 1999; Salamin et al., 2002). The internal transcribed spacer (ITS) region has often been utilized in phylogenetic studies of flowering plants and grasses (Baldwin et al., 1995; Hodkinson et al., 2002a ; Hodkinson et al., 2002b). The chloroplast genome has also been used in plan t systematics for phylogeny reconstruction (SouzaChies et al., 1997). Some noncoding regi ons of chloroplast DNA such as the trnL -intron and trnL-F spacer (Taberlet et al., 1991; Chase et al., 2000) have been used for evolutionary studies of closely related taxa. 39

PAGE 40

The objective of my study was to character ize the genetic vari ation between the Southeastern USA and West African cogongrass using inter-simple sequence repeat (ISSR) markers and sequence analysis of the internal transcribed spacer regi on (ITS) and the noncoding chloroplast trnL-trnF spacer DNA. The data were interpre ted in relation to the implementation of biological control stra tegies using the fungi, Bipolaris sacchari (E. Butler) Shoem. and Drechslera gigantea (Heald and F.A. Wolf) Ito, in Benin West Africa. Materials and Methods Population Sampling Florida Imperata cylindrica accessions. Imperata cylindrica accessions were collected from 32 counties throughout Florida, USA dur ing summer 2004 (Appendix C). Two sites were sampled within each county, and the sites were at least 20 miles apart. Five individual plants were collected from every site; each sampled at least 10 m apart to minimize progeny sampling. Samples were brought back to Gainesville and established under gree nhouse conditions in a commercial potting mix (Metromix 300; Scotts Sier ra Horticultural Prod ucts Co., Marysville, Ohio). West African Imperata cylindrica accessions. West African I. cylindrica accessions were collected from infested cogongrass sites duri ng the summer of 2005 and 2006. Rhizomes were collected from natural and invasive cogongra ss sites in Cameroon, The Guinea, Benin and Nigeria and transported to the International In stitute of Tropical Agriculture (IITA), Benin experimental station (Appendix D). The rhizomes were cut into 4-cm segments and planted in plastic tubs cont aining field soil. Extraction of Genomic DNA and PCR Amplification of ISSR Population Markers Genomic DNA was extracted from fresh leaf samples (50 mg) using the DNeasy plant mini kit according to the manufacturers directions (QIAGEN, Chatsworth, California). 40

PAGE 41

Inter Simple Sequence Repeats. Three ISSR primers used in the study, UBC-825 ([AC] 8 T), UBC-830 ([TG] 8 G) and UBC-841 ([GA] 8 YC; Y = C or T), were obtained from the University of British Columbia (UBC). The PCR am plifications were carried out in volumes of 25 l containing 18 l of ddH 2 O, 2.5 l of 10X buffer (Invi trogen), 1.5 l of 50 mM MgCl 2 (Invitrogen, Carlsbad, California), 0.5 l of an equal mixture of 10 mM dNTPs (Invitrogen), 1 unit of Taq DNA polymerase, and 2.0 l template DNA. DNA amplification was performed in an MJ Research PTC-100 thermocycler (Watertow n, Massachusetts) and th e initial denaturation step was setup to run for 1.5 min at 94 C, follo wed by 34 cycles of 40 s at 94 C, 45 s at 48 C (UBC-825), and 50 C (UBC-830; UBC841), 40 s at 72 C, 45 s at 94 C, 45 s at 47 C (UBC825) and 49 C (UBC-830 and UBC-841) (modified from Wolfe et al., 1998b). Different annealing temperatures were obtained for optimization of the West and South African I. cylindrica accessions with 45 s at 51.7 C (UBC825), 52.6 C (UBC-830), and 48.4 C (UBC841). The final extension step was run for 5 min at 72 C. PCR products were seperated by electrophoresis at 70V for 2.5 h in 1.2% agarose ge ls prepared in 1X TA E buffer stained with 2% ethidium bromide. Band sizes were esti mated using 100bp ladder (Invitrogen; Biolabs). Negative controls, lacking template DNA, we re included in each PCR reaction and all sample/primer combinations were repeated at least once. Replicate DNA extractions were carried out on a subset of the samples and the ar bitrary fingerprint of these was compared with the original. In all cases, an identical profile was obtained. In studies using ISSR primers in natural populations (Wolfe et al., 1998a, b), thr ee primers were generally sufficient to genotype every individual in the study. The ISSR primer sequences, obtained from the University of British Columbia Biotechnology Laboratory, were selected as they yielded polymorphisms in a 41

PAGE 42

preliminary genetic diversity study (The Soltis Lab, Florida Museum of Natural History, Dickinson Hall, University of Florida, Gainesville, Florida). Bands were scored for presence or absence for each DNA sample (See Figure 2-1 A, B for examples of gel photographs). Th e binary data matrix was inpu tted into POPGENE (Yeh et al., 1997), assuming all loci were dominant and in Hardy-Weinberg equilibrium. The following indices were used to quantify the am ount of genetic diversity within the Imperata populations examined: the number and percentage of pol ymorphic loci, Neis genetic identity ( h ) (Nei, 1973), and Shannon index of phenotypic diversity ( I ) (King and Schaal, 1989). Genetic differentiation among populations was estimated by Neis gene diversity st atistics. Pairwise genetic distance among populati ons was calculated to constr uct an unweighted pair-group method arithmetic average (UPGMA) dendrogram An analysis of molecular variance (AMOVA; Excoffier et al., 1992) computed with Arlequin 1.1. (S chneider et al., 1997), which assumes these data are haplotypic, was conducte d to calculate variance components and their significance levels for varia tion between cogongrass accessions from Africa and the USA, among accessions within a region, and within populations. DNA sequence analysis The ITS region was amplified by PCR using a forward primer (F=CTAGGGCGTCAAGGAACACTTCTATTGC) and the reverse primer (R=CGATGCGCTGCGGTGCTCGATGGGTCCT) designed from the I. cylindrica genotype 122 [AY116297] (Hodkinson et al., 2002b). The plastid trnL intron and the trnL-F intergenic spacer for noncoding chloroplast DNA were amplified as one unit using the Universal C and F primers described by Taberlet et al. (1991). For ITS, the thermal cycling (MJ Research PTC100, Watertown, Massachusetts) comprised 30 cycles each with 3 min denaturation at 94C, 30 s annealing at 57C, and an extensi on of 45 s at 72C. A final extens ion of 5 min at 72C was also 42

PAGE 43

included. For trnL-F the thermal cycling comprised 30 cycl es, each with 1 min denaturation at 94C, 1 min annealing at 53C a nd 55 C for the USA and West Africa samples respectively, and an extension of 3 min at 72C, including a fi nal extension of 5 min at 72C. Amplified DNA fragments were purified using Qiagen PCR purification kit. Nucleotide sequencing of the DNA samples was car ried out at the University of Florida DNA Sequencing Core Laboratory using ABI Prism BigDye Terminator cycle sequencing protocols (part number 4303153) developed by Applied Biosystems (Perkin-Elmer Corp., Foster City, CA). The excess dye-labeled te rminators were removed using MultiScreen 96-well filtration system (Millipore, Bedford, MA, USA). The purified extension products were dried in SpeedVac ((ThermoSavant, Holbrook, NY, USA) and then suspended in Hi-diformamide. Sequencing reactions were performed using POP7 sieving matrix on 50-cm capillaries in an ABI Prism 3130 Genetic Analyzer (Applied Biosyste ms, Foster City, CA, USA) and were analyzed by ABI Sequencing Analysis software v. 5.2 and KB Basecaller. Forward and reverse DNA sequences were aligned with CLUSTAL X (Thompson et al., 1997) with subsequent manual correction usin g MacClade 4 (Maddison and Maddison, 2000). Gaps were coded as missing data. Phylogenetic analysis was by a distance method (neighbor joining) and parsimony (strict consensus). Support for internal branches was assessed by using 1,000 bootstrapped data sets but saving no more than 10 trees per replicate to reduce time spent swapping on large numbers of trees (Felsenstein, 1985). Parsimony and distance analyses were conducted with the computer software program PAUP [PAUP: Phylogenetic Analysis Using Parsimony, version 4.0b8] (Swofford, 1998). Heuristic search es included 1,000 replicates of step-wise addition sequence with tree-bisecti on reconnection (TBR). Four supplementary I. cylindrica accessions [ I. cylindrica var. major AF345653, AF345653; AY116297; AF190764] 43

PAGE 44

were included in the analyses after a BLAST search was performed (Altschul et al., 1997). Erianthus rockii Keng (AY345217), Miscanthus sinensis Andersson (EF211950; EF211950), Saccharum arundinaceum Retz. (AY116295), Pennisetum purpureum Schumach (AF325232), Setaria parviflora (Poir.) Kergulen (AF109831) and Echinochloa crus-galli (L.) Beauv. (AJ113708) were chosen as outgroups for the analyses from GenBank (as described by Hodkinson et al., 2002b). Voucher specimens of the USA and African co gongrass accessions trea ted in the ITS study are listed in Appendix A and Appendix B. Results Analysis of ISSR Markers The three primers, UBC-825 ([AC] 8 T), UBC-830 ([TG] 8 G) and UBC-841 ([GA] 8 YC; Y = C or T), produced multiple, clear and reproducible bands with heterogeneity within/between/among populations (Figure 2-1 A, B) The three primers yielded 36 putative loci among all I. cylindrica accessions and the three closely related species I. brasiliensis I. brevifolia Vasey and I. cylindrica var. rubra. At the species level, the Imperata cylindrica from North West Florida had the highest number of polymorphic loci, 19 ( h = 0.1702, I = 0.2594). Imperata cylindrica from Benin and Nigeria followed clos ely with 18 polymorphic loci (Benin: h = 0.1667, I = 0.2524; Nigeria: h = 0.1535; I = 0.2388), respectively (Table 2-1). While I. cylindrica var. rubra had only 4 polymorphic loci ( h = 0.0448, I = 0.0656), I. brasiliensis, I. brevifolia and I. cylindrica (The Guinea) showed no polymorphisms and this is possibly due to the small sample size (14 samples) analyzed. At the population level, the percentage of polymorphic loci ( P ), Neis gene diversity ( h), and Shannons index ( I ) were 94.44%, 0.2662 and 0.4121, respectively (Table 2-1). The coeffici ent of gene differentiation was high ( G ST = 0.6542). All three parameters indicated that genetic diversity within populations was 44

PAGE 45

comparatively equal. When populations were grouped according to geographic region, genetic diversity of the African Imperata cylindrica was higher than the USA I. cylindrica and closely related Imperata species as revealed by the percentage pol ymorphic loci and total gene diversity (Table 2-2). The African populations e xhibited higher genetic differentiation ( G ST = 0.5683) than those in USA ( G ST = 0.3842) and closely related Imperata species ( G ST = 0.5777). A UPGMA dendrogram based on pa irwise genetic differences identified three strongly supported geographic clusters [80%] (Figure 2-2) was generated. However, not all the African accessions grouped together within the African cl uster. The Nigerian accessions, with the exception of accession 11, form a separate, strongly supported cluster (82%) and are genetically different from all the Imperata accessions. One var. rubra accession (CGS66_1) is included within the Nigerian cluster. It is interesting to note that a second var. rubra accession (CGS66_2) is closely related to the I. cylindrica Florida accessions. The Guinea accession fell within the I. cylindrica Florida accessions, forming a sister group with the I. cylindrica Florida accessions, CGS52 and CGS64. The I. cylindrica Florida accessions grouped according to the area from which they were sampled. The Imperata brevifolia formed a sister group with the African accessions. Imperata brasiliensis groups together with the North West Florida accessions. AMOVA analysis indicated that more than a third of the total variation (33.63%) was accounted for by differentiation among the African and USA Imperata groups, with a further 21.91% accounting for variation among populations within groups, and the remainder (44.45%) was partitioned within th e populations (Table 2-3). Analysis of ITS The aligned ITS matrix was 472 base pa irs (bp) long yieldi ng 296 constant, 71 uninformative and 105 parsimony-informative ch aracters. Figure 23 shows one of 9,840 45

PAGE 46

equally most parsimonious trees for the ITS sequen ce data with groups consistent in all shortest trees marked as solid lines. The tree has 276 st eps, with a consistency index (CI) of 0.8188 and a homoplasy index (HI) of 0.1812. The parsimony tree showed three main clusters, including the majority of I. cylindrica accessions sampled from the USA and Africa (Fi gure 2-3). There was strong support for the grouping (100%) containing the Florida I. cylindrica accessions (CGS27, CGS33, CGS21, CGS38, CGS5, CGS41, CGS29, CGS56, CGS 1, CGS20, CGS18, CGS19, CGS26, CGS30, CGS35, CGS36, CGS37) including the I. brasiliensis accession. There was another strong grouping (93% bootstrap support) for the remaining Florida I. cylindrica accessions (CGS42, CGS52, CGS43, CGS48, CGS51, CGS53). There wa s no partitioning of acce ssions according to the regions sampled within Florida (Appendix B). In addition, there was medium support (72%) for the group containing all the West and South African accessions with the exception of a single accession from Nigeria (CGN1) and Ca meroon (CGC6) that were more closely associated with the first group of Florida I. cylindrica accessions. There was strong support for the two I. cylindrica var. rubra accessions (89%) while the I. brevifolia was strongly grouped with Florida I. cylindrica accession CGS63 (100% bootstrap support) and forms a sister group to the I. cylindrica var. rubra. The neighbor-joining tree (NJ) showed a more branched topology with different groupings than those inferred from the parsimony tree (Fi gure 2-4). Compared with the parsimony tree, there was a strong support (98%) fo r the group containing the Florida I. cylindrica accessions CGS21, CGS5, CGS33, CGS38 and CGS41 and low support (67%) for the remaining accessions in the clade (CGS29, CGS56, CGS18, CGS30, CGS1, CGS20, CGS37, CGS19, CGS26, CGS36 and CGS35). As with the parsimony tree, there was strong support (88%) for the group 46

PAGE 47

containing the I. cylindrica Florida accessions CGS42, CG S52, CGS43, CGS48, CGS53 and CGS51and the distance analyses supporte d CGS42, CGS52, CGS43 and CGS48, CGS53, CGS51 as sister groups. The NJ tree grouped the West and South African I. cylindrica accessions together (98% bootstrap support) with the exception of single accessions from Nigeria (CGN1) and Cameroon (CGC6) as seen in the parsimony tree. However, one Benin accession (CGB2) was not included within the West/South Africa group and was more closely associated with the Florida I. cylindrica There was strong support for the two I. cylindrica var. rubra accessions (86%) while the I. brevifolia was strongly grouped with Florida I. cylindrica accession CGS63 (94%) and is a sister group to the var. rubra The supplementary GenBank I. cylindrica sequences group ed within the I. cylindrica accessions. The one exception was I. cylindrica AF190764 which grouped within outgroups. A possible reason for this is that the inputted sequence contained poor quality sequence information. Analysis of trnL-F The aligned trnL-F matrix was 816 bp and yielded 796 constant, 11 uninformative and 9 parsimony-informative characters of which 5 were found in the two outgroups. Due to the low variability of the locus, no additional analyses were undertaken (data not shown). Discussion In this study, the ge netic variation in Imperata cylindrica using polymorphism among the ISSR regions within the genome was assessed. The ISSR method proved to be robust and reproducible and provided a relativ ely simple method of examini ng genetic variation with the plant accessions. Accurate estimates of genetic diversity within exotic invasive weeds are useful for optimizing the application of both classical a nd inundative fungal biological control agents. 47

PAGE 48

Several population-level studies of invasive weed species have used ISSR markers. In Phalaris minor Retz. a diploid, predominantly inbreeding, annual grass weed found in India, relatively low levels of polymorphisms were found within and between populations in comparison with other grassy weed species (McRoberts et al., 1999). These findinga are indicative of the predominantly inbreeding behavior of P. minor (McRoberts et al., 2005). Carthamus lanatus L. (saffron thistle) a widespread, invasive weed of crops and pastures in Australia, is targeted for bot h inundative and classical biologi cal control (Ash et al., 2003). They identified two distinct groups of C. lanatus that correlated with location (northern and southern regions). Within-gr oup genetic diversity was lower in the northern group than the southern group and the difference in these groups might have implications for the biological control using exotic fungi. Knowledge of the genetic variation in both native and invasive stands of Pueraria lobata (Willd.) Ohwi [kudzu] could potentially lead to effective biological control measures (Sun et al., 2005). ISSR studies of USA and Chinese populations of P. lobata and four closely related cogeneric species, P. edulis Pampanini, P. montana (Lour.) Merr., P. phaseoloides (Roxb.) Benth. and P. thomsoni Benth. revealed clear separation of the five species. Pueraria lobata populations from the USA were gene tically closer to the Chinese P. lobata populations than the other congeneric populations. Hi gh genetic differentiation was obs erved in the Chinese samples of P. lobata, P. montana, and P. thomsoni, while within the USA P. lobata population, a high genetic diversity and low populatio n differentiation was observed. S un et al. (2005) stated that these results supported the hypothesis of multiple introductions into the USA from different sources in Japan or China, followed by subse quent gene exchange and recombination. The 48

PAGE 49

results would suggest that the USA P. lobata population may not respon d uniformly to classical biocontrol agents. A study of the genetic variation of Chromolaena odorata (L.) R.M. King & H. Robinson across its invasive range in China using ISSR markers revealed lo w levels of variation with low genetic population differentiation (Ye et al., 2004). The gene tically homogeneous C. odorata populations in China suggest that if a suitable biol ogical control agent were effective for control, there could potentially be a uniform hos t response to this biocontrol agent. In the present study, all three genetic diversity indices ( P = 94.44%, h = 0.2662 and I = 0.4121) revealed that the genetic diversity of I. cylindrica is high. Genetic diversity within the USA accessions was found to be higher than within the African accessions and this outcome could be due to ecogeographic variation since the USA accesseions were located at different latitudes and subtropical regions than the African accessions. A high G ST value (0.6542) indicated distinct genetic differentiation among the Imperata accessions studied. Forty-four percent of the genetic variation in the samples can be attributed to variation within populations (i.e., accessions). This differs from a study of RAPD and ISSR techniques to detect genetic diversity of Monochoria vaginalis (Burman f.) C. Presl, a common aquatic weed found in rice fields in southern Ch ina (Li et al., 2005). Desp ite slightly different results between the RAPD and I SSR data, the study i ndicated low levels of genetic variation within populations (23.30%) and a high degree of genetic variation (76.60%) among populations of M. vaginalis in southern China. In a recent st udy of the population genetic variation and structure of the invasive weed Mikania micrantha H.B.K., high levels of genetic variation and differentiation were detected in the introduced M. micrantha populations (Wang et al., 2007). Although multiple introductions mitigated the lo ss of genetic variation associated with 49

PAGE 50

bottlenecks, the authors found that the bottleneck s enhanced the population differentiation. An AMOVA analysis indicated that 67.74% of the va riation was partitioned within populations, with 28.83% attributed to differences among populations within regions, and 8.43% of the variation due to regional differences. An AMOVA analysis revealed that diffe rentiation between the African and USA accessions was 33.63% of the total gene variance wh ile 44.45% of the varia tion was attributed to variation within the accessions. This diffe rentiation could possibl y be explained by the geographical isolation between the USA and Africa. Compared with population genetic estimates based on ISSR analyses of other inva sive weed species (Ye et al., 2004; Chapman et al., 2004; Sun et al., 2005), substantial amounts of intraspecific and with in-population variation was revealed across the introduced range of I. cylindrica By transforming among-population variation from different geogra phical sources into within-po pulation variation, high genetic variation in introduced populations could be crea ted through multiple introductions (Kolbe et al., 2004). In this study, multiple introductions are inferred among the populations of I. cylindrica and the results substantiate the fact that multiple introductions played a ro le in the spread of cogongrass in the USA and possibly West Africa. Imperata cylindrica accessions that are genetically more similar appear to maintain an eq uivalent level of geneti c variation (Figure 2-2; Table 2-1). Imperata cylindrica propagates by seeds and vegetatively through rhizomes. The high genetic variation within populations and lo wer genetic differentiation among populations suggests that the I. cylindrica accessions sampled are outcrossing with the I. cylindrica Florida accessions seemingly more outcrossed compared to the African accessions. RAPD analyses of 10 Florida I. cylindrica populations revealed that cogongrass was highly outcrossed (Shilling et al., 1997) though the data also showed evidence of clonal populations. 50

PAGE 51

The results from this study indicats that the I. cylindrica accessions and the closely related species I examined formed three distin ct clusters, with the African and USA I. cylindrica accessions geographically and genetically separated. Imperata cylindrica var. rubra formed a sister group to the African accessions. The Imperata brasiliensis was not genetically distinct from the I. cylindrica Florida accessions and are closely related. The ITS phylogenetic analyses generated diffe rent tree topologies with the African I. cylindrica accessions distinct from the USA Imperata accessions. Within the Florida I. cylindrica the accessions sampled from West and Ea st Florida did not group together. The I. brasiliensis grouped within the USA I. cylindrica accessions. However, the I. brevifolia was not genetically distinct from all Imperata populations as seen in the ISSR dendrogram and formed a strong group with a single Florida I. cylindrica accession (CGS63). Imperata cylindrica var. rubra grouped together with and wa s genetically more similar to the African accessions, as reflected in the ISSR data. In summary, I. cylindrica maintains high levels of dive rsity throughout the USA and West Africa. Multiple introductions, sexual reproduc tion allowing gene flow within populations, and possible multiple founding populations by more than one genetically distinct individual are factors that influence the high levels of diversity. The popul ation structure of I. cylindrica revealed in this study has implications for cogongr ass biological control management strategies in USA and West Africa. The genetic difference between the USA and African I. cylindrica accessions suggests that using West African acce ssion would not be a suitable host for fungi associated with cogongrass in the USA. It is interesting to note that the levels of disease incidence and disease severity of the Florida isolates of B. sacchari and D. gigantea on the Benin I. cylindrica accession were not significantly different when compared with the Benin isolates of 51

PAGE 52

the same fungi. It is probable that, under an inundative biocontrol strategy, high inoculum levels would negate any differences in host response. It is also important that multiple accessions of I. cylindrica be included for pathogencity screening w ith other candidate f ungal biological control agents. Understanding weed population genetics can help biocontrol researchers determine whether different genotypes exist within the target weeds exotic and native ranges. Variation in response to disease within and among populations may be due to a number of causes: a) genetic variation among plants for traits influencing their susceptibility to attack; b) local variation in density or in genotype of pathoge ns; and c) local varia tion in the abiotic and biotic environment factors (de Nooij and van Damme, 1988). Most weed species grow over a broad range of environmental conditions and display large differe nces in size and morphology (Barrett, 1982). Unfortunately, management aimed at the cont rol of weeds is ofte n developed without consideration of the genetic di versity of the target populations, and studies on the genetic variation of weeds on relevant spatial scales are still limited. The work reported here should guide us to consider the level of genetic variation of selected weed targets, in conjunction with other biotic and abiotic environmental condi tions, when considering the implemention of biological control programs. 52

PAGE 53

Table 2-1. Genetic variability of all single sampled populations of Imperata cylindrica and closely related species with the ISSR primers. Accessions No. of polymorphic loci P (%) a Neis diversity Shannon index 36 loci total ( h) (I ) South Africa 14 38.89 0.1454 0.2137 Benin 18 50.00 0.1667 0.2524 Cameroon 8 22.22 0.0899 0.1305 Nigeria 18 50.00 0.1535 0.2388 Central Florida 14 38.89 0.1325 0.1993 Central East Florida 9 25.00 0.1114 0.1587 Central West Florida 10 27.78 0.1141 0.1659 North Central Florida 15 41.67 0.1347 0.2056 North East Florida 12 33.33 0.1124 0.1695 North West Florida 19 52.78 0.1702 0.2594 I. cylindrica var. rubra 4 11.11 0.0448 0.0656 Total 34 94.44 0.2672 0.4159 Note: a Percentage polymorphic loci. 53

PAGE 54

Table 2-2. Comparison of genetic diversity measures for all sampled populations of Imperata cylindrica and closely related species as dete rmined using ISSR population markers. Parameters P (%) a Total gene Within Coefficient of diversity (H t ) population (H S ) gene differentiation (G ST ) Total 94.44 0.2784 0.0226 0.0963 0.0037 0.6542 Africa 83.33 0.2574 0.0378 0.1111 0.0099 0.5683 USA 58.33 0.2017 0.0438 0.1246 0.0171 0.3824 USA and related species 72.22 0.2085 0.0341 0.0880 0.0080 0.5777 a Percentage polymorphic loci. 54

PAGE 55

Table 2-3. Summary of analysis of molecula r variance (AMOVA) based on ISSR genotypes of the African and USA Imperata cylindrica accessions. Source of variation SS b Variance components Percentage variation Among groups 132.839 0.62830 33.63 Among populations within groups 40.0170 0.40996 21.91 Within populations 287.165 1.25219 45.45 Total 460.021 a DF = Degrees of freedom, b SS = Sum of squares, 55

PAGE 56

Figure 2-1. Photographs of ISSR gels. A) Imperata cylindrica Florida accessions showing bands generated with primer UBC-841. B) I. cylindrica Benin accessions showing bands generated with all primers individually. Each lane is the result of an independent PCR reaction. M is a 100-bp ladder. A M 5 25 26 27 28 29 30 31 32 M 89 11 12 13 14 15 16 17 18 58 59 1500 1000 500 500 500 1500 1000 1 2 3 4 5 6 7 8 1 23 4567 8 1 23 45 6 7 8 Central Florida accessions North W est F lorida Accessions M B 56

PAGE 57

Figure 2-2. UPGMA dendrogram of all Imperata cylindrica accessions and closely related species sampled based on ISSR data. Numbers above branches are bootstrap percentages above 70%. 78 77 75 79 71 70 72 73 74 76 82 80 I cylindrica South Africa (CGSA1) I cylindrica Nigeria (CGN2) I cylindrica Benin (CGB1) I cylindrica Benin (CGB2) I cylindrica Benin (CGB5) I cylindrica Benin (CGB6) I cylindrica Cameroon (CGC1) I cylindrica Cameroon (CGC2) I cylindrica Cameroon (CGC3) I cylindrica Cameroon (CGC4) I cylindrica Benin (CGB3) I cylindrica Benin (CGB4) I cylindrica Nigeria (CGN11) I c y lindrica The Guinea (CGG1) I brevifolia California (CGS6) I cylindrica North East Florida (CGS61) I cylindrica Central Florida (CGS64) I cylindrica Central East Florida (CGS52) I cylindrica Central Florida (CGS2) I cylindrica Central Florida (CGS32) I cylindrica Central Florida (CGS36) I cylindrica Central East Florida (CGS51) I cylindrica North Central Florida (CGS24) I cylindrica North Central Florida (CGS35) I cylindrica Central Florida (CGS33) I cylindrica Central Florida (CGS55) I cylindrica Central Florida (CGS54) I cylindrica Central Florida (CGS56) I cylindrica Central Florida (CGS34) I cylindrica Central East Florida (CGS47) I cylindrica Central Florida (CGS53) I cylindrica North Central Florida (CGS22) I cylindrica North Central Florida (CGS23) I cylindrica North Central Florida (CGS47) I cylindrica North Central Florida (CGS4) I cylindrica North Central Florida (CGS19) I cylindrica North Central Florida (CGS21) I cylindrica North East Florida (CGS41) I cylindrica North East Florida (CGS42) I cylindrica North East Florida (CGS61) I cylindrica North East Florida (CGGS43) I cylindrica Central Florida (CGGS64) I cylindrica North Central Florida (CGS60) I cylindrica Central East Florida (CGS45) I cylindrica Central East Florida (CGS46) I cylindrica Central East Florida (CGS49) I cylindrica Central East Florida (CGS50) I cylindrica Central East Florida (CGS48) I cylindrica Central Florida (CGS63) I cylindrica North Central Florida (CGS20) I cylindrica North West Florida (CGS9) I cylindrica North West Florida (CGS11) I cylindrica North West Florida (CGS12) I cylindrica North West Florida (CGS14) I cylindrica North West Florida (CGS58) I brasiliensis South East Florida (CGS3) I cylindrica Central West Florida (CGS5) I cylindrica Central West Florida (CGS25) I cylindrica Central West Florida (CGS26) I cylindrica Central West Florida (CGS27) I cylindrica Central West Florida (CGS29) I cylindrica Central West Florida (CGS30) I cylindrica Central West Florida (CGS31) I cylindrica Central West Florida (CGS57) I cylindrica North West Florida (CGS59) I cylindrica South West Florida (CGS65) I cylindrica Central West Florida (CGS28) I cylindrica North West Florida (CGS15) I cylindrica North West Florida (CGS8) I cylindrica North West Florida (CGS17) I cylindrica North West Florida (CGS13) I cylindrica North West Florida (CGS16) I cylindrica North West Florida (CGS18) I cylindrica North East Florida (CGS38) I cylindrica North East Florida (CGS40) I cylindrica North East Florida (CGS62) I cylindrica North East Florida (CGS39) I cylindrica var rubra (CGS66_1) I cylindrica Nigeria (CGN6) I cylindrica var rubra (CGS66_2) I c y lindrica Nigeria (CGN8) I cylindrica Nigeria (CGN9) I cylindrica Nigeria (CGN10) 57

PAGE 58

CGS27 CGS33 CGS21 CGS38 CGS5 CGS41 CGS29 CGS56 CGS1 CGS20 CGS18 CGS19 CGS26 CGS30 CGS3 CGS35 CGS36 CGS37 CGN1 CGC6 CGS42 CGS52 CGS43 CGS48 CGS51 CGS53 CGS6 CGS63 AF092512 AF345653 CGB5A CGC11 CGB1 CGB3A CGN2 CGN4 CGB2 CGC2 CGN3 CGB5 CGN3A CGN4A CGN2A CGS66 1 CGS66 2 CGSA1 AY116297 AY116295.1 EF211951.1 EF211950.1 AF345217 AF190764 AF345232 AF019831.1 AJ133707.1100 100 93 96 100 98 98 89 100 Strict I. cylindrica (AF345653) I. cylindrica (AF092512) I. cylindrica (AY116297) Sacc. arundinaceum (AY116295) Miscanthussinensis (EF211951) Miscanthussinensis (EF211950) I. cylindrica (AF190764) Pennisetumpurpureum (AF345232) Erianthusrockii (AY345217) Setariaparviflora (AF019831) Echinochloacrus-galli (AJ113708) I. brevifolia California I. cylindrica var rubra (CGS66) I. cylindrica var rubra (CGS66) I. brasiliensis South East Florida (CGS3) I. cylindrica Central West Florida (CGS27) I. cylindrica Central Florida (CGS33) I. cylindrica North Central Florida (CGS21) I. cylindrica North East Florida (CGS38) I. cylindrica Central West Florida (CGS5) I. cylindrica North East Florida (CGS41) I. cylindrica Central West Florida (CGS29) I. cylindrica Central Florida (CGS56) I. cylindrica Central Florida (CGS1) I. cylindrica NorthCentral Florida (CGS20) I. cylindrica NorthWest Florida (CGS18) I. cylindrica NorthCentral Florida (CGS19) I. cylindrica Central West Florida (CGS26) I. cylindrica Central West Florida (CGS30) I. cylindrica North Central Florida (CGS35) I. cylindrica Central Florida (CGS36) I. cylindrica NorthCentral Florida (CGS37) I. cylindrica Nigeria (CGN1) I. cylindrica Cameroon (CGC6) I. cylindrica NorthEast Florida (CGS42) I. cylindrica South Africa (CGSA1) I. cylindrica CentralEast Florida (CGS52) I. cylindrica NorthEast Florida (CGS43) I. cylindrica Central East Florida (CGS48) I. cylindrica Central East Florida (CGS51) I. cylindrica Central Florida (CGS53) I. cylindrica Central Florida (CGS63) I. cylindrica Benin (CGB5A) I. cylindrica Cameroon (CGC11) I. cylindrica Benin (CGB1) I. cylindrica Benin (CGB3A) I. cylindrica Nigeria (CGN2) I. cylindrica Nigeria (CGN4) I. cylindrica Benin (CGB2) I. cylindrica Cameroon (CGC2) I. cylindrica Nigeria (CGN3) I. cylindrica Benin (CGB5) I. cylindrica Nigeria (CGN4A) I. cylindrica Nigeria (CGN3A) I. cylindrica Nigeria (CGN 2A) CGS27 CGS33 CGS21 CGS38 CGS5 CGS41 CGS29 CGS56 CGS1 CGS20 CGS18 CGS19 CGS26 CGS30 CGS3 CGS35 CGS36 CGS37 CGN1 CGC6 CGS42 CGS52 CGS43 CGS48 CGS51 CGS53 CGS6 CGS63 AF092512 AF345653 CGB5A CGC11 CGB1 CGB3A CGN2 CGN4 CGB2 CGC2 CGN3 CGB5 CGN3A CGN4A CGN2A CGS66 1 CGS66 2 CGSA1 AY116297 AY116295.1 EF211951.1 EF211950.1 AF345217 AF190764 AF345232 AF019831.1 AJ133707.1100 100 93 96 100 98 98 89 100 Strict I. cylindrica (AF345653) I. cylindrica (AF092512) I. cylindrica (AY116297) Sacc. arundinaceum (AY116295) Miscanthussinensis (EF211951) Miscanthussinensis (EF211950) I. cylindrica (AF190764) Pennisetumpurpureum (AF345232) Erianthusrockii (AY345217) Setariaparviflora (AF019831) Echinochloacrus-galli (AJ113708) I. brevifolia California I. cylindrica var rubra (CGS66) I. cylindrica var rubra (CGS66) I. brasiliensis South East Florida (CGS3) I. cylindrica Central West Florida (CGS27) I. cylindrica Central Florida (CGS33) I. cylindrica North Central Florida (CGS21) I. cylindrica North East Florida (CGS38) I. cylindrica Central West Florida (CGS5) I. cylindrica North East Florida (CGS41) I. cylindrica Central West Florida (CGS29) I. cylindrica Central Florida (CGS56) I. cylindrica Central Florida (CGS1) I. cylindrica NorthCentral Florida (CGS20) I. cylindrica NorthWest Florida (CGS18) I. cylindrica NorthCentral Florida (CGS19) I. cylindrica Central West Florida (CGS26) I. cylindrica Central West Florida (CGS30) I. cylindrica North Central Florida (CGS35) I. cylindrica Central Florida (CGS36) I. cylindrica NorthCentral Florida (CGS37) I. cylindrica Nigeria (CGN1) I. cylindrica Cameroon (CGC6) I. cylindrica NorthEast Florida (CGS42) I. cylindrica South Africa (CGSA1) I. cylindrica CentralEast Florida (CGS52) I. cylindrica NorthEast Florida (CGS43) I. cylindrica Central East Florida (CGS48) I. cylindrica Central East Florida (CGS51) I. cylindrica Central Florida (CGS53) I. cylindrica Central Florida (CGS63) I. cylindrica Benin (CGB5A) I. cylindrica Cameroon (CGC11) I. cylindrica Benin (CGB1) I. cylindrica Benin (CGB3A) I. cylindrica Nigeria (CGN2) I. cylindrica Nigeria (CGN4) I. cylindrica Benin (CGB2) I. cylindrica Cameroon (CGC2) I. cylindrica Nigeria (CGN3) I. cylindrica Benin (CGB5) I. cylindrica Nigeria (CGN4A) I. cylindrica Nigeria (CGN3A) I. cylindrica Nigeria (CGN 2A) I. cylindrica (AF345653) I. cylindrica (AF092512) I. cylindrica (AY116297) Sacc. arundinaceum (AY116295) Miscanthussinensis (EF211951) Miscanthussinensis (EF211950) I. cylindrica (AF190764) Pennisetumpurpureum (AF345232) Erianthusrockii (AY345217) Setariaparviflora (AF019831) Echinochloacrus-galli (AJ113708) I. brevifolia California I. cylindrica var rubra (CGS66) I. cylindrica var rubra (CGS66) I. brasiliensis South East Florida (CGS3) I. cylindrica Central West Florida (CGS27) I. cylindrica Central Florida (CGS33) I. cylindrica North Central Florida (CGS21) I. cylindrica North East Florida (CGS38) I. cylindrica Central West Florida (CGS5) I. cylindrica North East Florida (CGS41) I. cylindrica Central West Florida (CGS29) I. cylindrica Central Florida (CGS56) I. cylindrica Central Florida (CGS1) I. cylindrica NorthCentral Florida (CGS20) I. cylindrica NorthWest Florida (CGS18) I. cylindrica NorthCentral Florida (CGS19) I. cylindrica Central West Florida (CGS26) I. cylindrica Central West Florida (CGS30) I. cylindrica North Central Florida (CGS35) I. cylindrica Central Florida (CGS36) I. cylindrica NorthCentral Florida (CGS37) I. cylindrica Nigeria (CGN1) I. cylindrica Cameroon (CGC6) I. cylindrica NorthEast Florida (CGS42) I. cylindrica South Africa (CGSA1) I. cylindrica CentralEast Florida (CGS52) I. cylindrica NorthEast Florida (CGS43) I. cylindrica Central East Florida (CGS48) I. cylindrica Central East Florida (CGS51) I. cylindrica Central Florida (CGS53) I. cylindrica Central Florida (CGS63) I. cylindrica Benin (CGB5A) I. cylindrica Cameroon (CGC11) I. cylindrica Benin (CGB1) I. cylindrica Benin (CGB3A) I. cylindrica Nigeria (CGN2) I. cylindrica Nigeria (CGN4) I. cylindrica Benin (CGB2) I. cylindrica Cameroon (CGC2) I. cylindrica Nigeria (CGN3) I. cylindrica Benin (CGB5) I. cylindrica Nigeria (CGN4A) I. cylindrica Nigeria (CGN3A) I. cylindrica Nigeria (CGN 2A) Figure 2-3. Parsimony tree inferred from ITS sequence data for all Imperata cylindrica accessions and closely related species. Nu mbers above branches are bootstrap percentages above 80%. Numbers in parentheses represent the GENBANK accession numbers. 58

PAGE 59

CGS21 CGS5 CGS33 CGS38 CGS27 CGS41 CGS29 CGS56 CGS18 CGS30 CGS1 CGS20 CGS37 CGS19 CGS3 CGS26 CGS36 CGS35 CGN1 CGC6 CGB2 CGB3A CGN4A CGN4 CGB5 CGN3A CGN2 CGN3 CGC11 CGSA1 CGN2A CGC2 CGB1 CGB5A CGS6 CGS63 CGS66 1 CGS66 2 AF092512 AF345653 CGS42 CGS52 CGS43 CGS48 CGS53 CGS51 AY116297 AY116295.1 EF211951.1 EF211950.1 AF345217 AF190764 AF345232 AF019831.1 AJ133707.1 0.005 substitutions/site NJ I. cylindrica (AF092512) I. cylindrica (AF092512) I. cylindrica (AY116297) Sacc. arundinaceum (AY116295) Miscanthussinensis (EF211951) Miscanthussinensis (EF211950) Erianthusrockii (AY345217) I. cylindrica (AF190764) Pennisetumpurpureum (AF345232) Setariaparviflora (AF019831) Echinochloacrus-galli (AJ113708) 100 100 97 92 949488 100 97 I. brasiliensis South East Florida (CGS3) I. brevifolia I. cylindrica var rubra (CGS66) I. cylindrica var rubra (CGS66)98 I. cylindrica North Central Florida (CGS21) I. cylindrica Central West Florida (CGS5) I. cylindrica Central Florida (CGS33) I. cylindrica North East Florida (CGS38) I. cylindrica Central West Florida (CGS27) I. cylindrica North East Florida (CGS41) I. cylindrica Central West Florida (CGS29) I. cylindrica Central Florida (CGS56) I. cylindrica North West Florida (CGS18) I. cylindrica North West Florida (CGS30) I. cylindrica Central Florida (CGS1) I. cylindrica NorthCentral Florida (CGS20) I. cylindrica NorthCentral Florida (CGS37) I. cylindrica NorthCentral Florida (CGS19) I. cylindrica Central West Florida (CGS26) I. cylindrica Central Florida (CGS36) I. cylindrica NorthCentral Florida (CGS36) I. cylindrica Nigeria (CGN1) I. cylindrica Cameroon (CGC6) I. cylindrica Benin (CGB2) I. cylindrica Benin (CGB3A) I. cylindrica Nigeria (CGN4A) I. cylindrica Nigeria (CGN4) I. cylindrica Benin (CGB5) I. cylindrica Nigeria (CGN3A) I. cylindrica Nigeria (CGN2) I. cylindrica Nigeria (CGN2A) I. cylindrica Cameroon (CGC11) I. cylindrica South Africa (CGSA1) I. cylindrica Nigeria (CGN2) I. cylindrica Cameroon (CGC2) I. cylindrica Benin (CGB1) I. cylindrica Benin (CGB1) I. cylindrica Central Florida (CGS63) I. cylindrica NorthEast Florida (CGS42) I. cylindrica CentralEast Florida (CGS52) I. cylindrica NorthEast Florida (CGS43) I. cylindrica CentralEast Florida (CGS48) I. cylindrica Central Florida (CGS53) I. cylindrica Central East Florida (CGS51) CGS21 CGS5 CGS33 CGS38 CGS27 CGS41 CGS29 CGS56 CGS18 CGS30 CGS1 CGS20 CGS37 CGS19 CGS3 CGS26 CGS36 CGS35 CGN1 CGC6 CGB2 CGB3A CGN4A CGN4 CGB5 CGN3A CGN2 CGN3 CGC11 CGSA1 CGN2A CGC2 CGB1 CGB5A CGS6 CGS63 CGS66 1 CGS66 2 AF092512 AF345653 CGS42 CGS52 CGS43 CGS48 CGS53 CGS51 AY116297 AY116295.1 EF211951.1 EF211950.1 AF345217 AF190764 AF345232 AF019831.1 AJ133707.1 0.005 substitutions/site NJ I. cylindrica (AF092512) I. cylindrica (AF092512) I. cylindrica (AY116297) Sacc. arundinaceum (AY116295) Miscanthussinensis (EF211951) Miscanthussinensis (EF211950) Erianthusrockii (AY345217) I. cylindrica (AF190764) Pennisetumpurpureum (AF345232) Setariaparviflora (AF019831) Echinochloacrus-galli (AJ113708) CGS21 CGS5 CGS33 CGS38 CGS27 CGS41 CGS29 CGS56 CGS18 CGS30 CGS1 CGS20 CGS37 CGS19 CGS3 CGS26 CGS36 CGS35 CGN1 CGC6 CGB2 CGB3A CGN4A CGN4 CGB5 CGN3A CGN2 CGN3 CGC11 CGSA1 CGN2A CGC2 CGB1 CGB5A CGS6 CGS63 CGS66 1 CGS66 2 AF092512 AF345653 CGS42 CGS52 CGS43 CGS48 CGS53 CGS51 AY116297 AY116295.1 EF211951.1 EF211950.1 AF345217 AF190764 AF345232 AF019831.1 AJ133707.1 0.005 substitutions/site NJ I. cylindrica (AF092512) I. cylindrica (AF092512) I. cylindrica (AY116297) Sacc. arundinaceum (AY116295) Miscanthussinensis (EF211951) Miscanthussinensis (EF211950) Erianthusrockii (AY345217) I. cylindrica (AF190764) Pennisetumpurpureum (AF345232) Setariaparviflora (AF019831) Echinochloacrus-galli (AJ113708) 100 100 97 92 949488 100 97 I. brasiliensis South East Florida (CGS3) I. brevifolia I. cylindrica var rubra (CGS66) I. cylindrica var rubra (CGS66)98 I. cylindrica North Central Florida (CGS21) I. cylindrica Central West Florida (CGS5) I. cylindrica Central Florida (CGS33) I. cylindrica North East Florida (CGS38) I. cylindrica Central West Florida (CGS27) I. cylindrica North East Florida (CGS41) I. cylindrica Central West Florida (CGS29) I. cylindrica Central Florida (CGS56) I. cylindrica North West Florida (CGS18) I. cylindrica North West Florida (CGS30) I. cylindrica Central Florida (CGS1) I. cylindrica NorthCentral Florida (CGS20) I. cylindrica NorthCentral Florida (CGS37) I. cylindrica NorthCentral Florida (CGS19) I. cylindrica Central West Florida (CGS26) I. cylindrica Central Florida (CGS36) I. cylindrica NorthCentral Florida (CGS36) I. cylindrica Nigeria (CGN1) I. cylindrica Cameroon (CGC6) I. cylindrica Benin (CGB2) I. cylindrica Benin (CGB3A) I. cylindrica Nigeria (CGN4A) I. cylindrica Nigeria (CGN4) I. cylindrica Benin (CGB5) I. cylindrica Nigeria (CGN3A) I. cylindrica Nigeria (CGN2) I. cylindrica Nigeria (CGN2A) I. cylindrica Cameroon (CGC11) I. cylindrica South Africa (CGSA1) I. cylindrica Nigeria (CGN2) I. cylindrica Cameroon (CGC2) I. cylindrica Benin (CGB1) I. cylindrica Benin (CGB1) I. cylindrica Central Florida (CGS63) I. cylindrica NorthEast Florida (CGS42) I. cylindrica CentralEast Florida (CGS52) I. cylindrica NorthEast Florida (CGS43) I. cylindrica CentralEast Florida (CGS48) I. cylindrica Central Florida (CGS53) I. cylindrica Central East Florida (CGS51) Figure 2-4. Neighbor-joining tree of distances derived from ITS sequence data for all Imperata cylindrica accessions and closely related species. Numbers above branches are bootstrap percentages above 80%. Numbers in parentheses represent the GENBANK accession numbers. 59

PAGE 60

CHAPTER 3 EVALUATION OF FUNGAL PATHOGENS AS BIOLOGICAL CONTROL AGENTS OF Imperata cylindrica (L.) BEAUV. FROM THE USA AND BENIN Introduction Biological control is defined as the selective process in which a pathogen or insect is used against a targeted weed without damaging nontarget species such as native plants and crops (Ghosheh, 2005). The use of biological control ag ents in locations requiring low-maintenance and natural areas, where high-inpu t weed control is neither feasible nor practical, is the biocontrol ideal. Classical biological control agents selected should have the biological characteristics to ensure successful establishmen t and continued development in locations where suppression of the target weed popula tion is desired (Morin et al., 2006). Ranked as one of the 10 worst invasive weeds in tropical and subtr opical regions of the world (Holm et al., 1977), Imperata cylindrica is recorded as a weed of 35 economically important crops in 73 countries in the tropics. It infests more than 500 million ha worldwide, including 200 million ha in Asia and Africa. The potential of biological control using plant pathogens to manage cogongrass infe stations in the USA has been considered (Van Loan et al., 2002). In the southeas tern USA, two fungi Bipolaris sacchari (Butler) Shoem. isolated from cogongrass, and Drechslera gigantea (Heald & F.A. Wolf) Ito isolated from large crabgrass [ Digitaria sanguinalis (L.) Scop.], were shown to be pathogenic on a single Florida Imperata cylindrica accession collected from the Lake Alice ar ea on the University of Florida campus (Yandoc, 2001). Yandoc et al. (2005) evaluated the efficacy of B. sacchari and D. gigantea in various formulations in gree nhouse and miniplot trials. Am ended spore suspensions of B. sacchari and D. gigantea containing 10 5 spores ml -1 in a 1% aqueous gelatin solution, caused disease symptoms on cogongrass under greenhous e conditions with dise ase severity ranging from 42 to 49% (Yandoc et al., 2005). An am ended spore in oil emulsion suspension (4% 60

PAGE 61

horticultural oil, 10% light minera l oil, and 86% water) yielded higher levels of disease severity than spores amended in 1% gelatin. Higher levels of disease severity were achieved when a mixture of both pathogens were applied under fi eld conditions. Foliar injury ranged from 30 to 86% for B. sacchari and from 9 to 70% for D. gigantea Despite the promising levels of disease severity and weed mortality reco rded for these fungi, the regene rative potential of the cogongrass rhizomes allowed the plants to outgrow the effects of these pathogens. In West Africa, cogongrass is the most dominan t and difficult weed to control and thereby it limits yields of maize, cassava, yam, co wpea, groundnut, cotton, sorghum and plantation crops (Chikoye et al., 1999, 2000, 2001; Iven s, 1980). Several control stra tegies, including mechanical removal, herbicide applications, solar drying of rhizomes after cultivati on and the use of cover crops have not been found effective to preven t the unrelenting spread of cogongrass in West Africa. As a result, increasing land areas have become unsuitable for agricultural cultivation and thus I. cylindrica is considered the most serious c onstraint to crop pr oduction and poverty alleviation in West Africa (H olm et al., 1977; Ivens, 1980; Ud ensi, 1994; Terry et al., 1997). Bipolaris sacchari and D. gigantea isolates associated w ith cogongrass in Benin and Florida were evaluated for pathogenicity and vi rulence using detached cogongrass leaf material (Adolphe Avocanh, 2006; unpublished data). Results showed that the Florida isolates of both fungi were pathogenic and highly virulent on the Benin cogongrass ac cession while the Benin isolates were moderately virule nt. Weed populations with limite d amounts of genetic variation are likely to be better candida tes for biological control agents (Burdon and Marshall, 1981) and therefore understanding the extent of genetic variation can be of importance in the detection of ecotypes or races of a species as they may differ c onsiderably in their susc eptibility to predators, parasites, or herbicides. Ac hieving a precise genetic match between the targeted weed and 61

PAGE 62

pathogen genotype during the selec tion process is often a necessary criterion for the success of biological control programs (Charudattan, 2005). De termining whether intraspecific variation in resistance exists within invasive weed speci es can be determined by challenging various accessions or genotype(s) of the weed with a ra nge of pathogen strains (Hasan et al., 1995; Morin and Syrett, 1996; Den Breeen a nd Morris, 2003; Ellison et al., 2004). With the goal of seeking suitable biological control agent for cogongrass in West Africa the objectives of this study were to: 1) determine the virulence of fungi, B. sacchari and D. gigantea, associated with I. cylindrica from the USA, on the USA I. cylindrica as well as I. brasiliensis, I. brevifolia and I. cylindrica var. rubra; 2) determine the virulence of fungi associated with I. cylindrica from West Africa and USA by in oculating West African Benin I. cylindrica with B. sacchari D. gigantea and Colletotrichum caudatum isolates ; and 3) compile a virulence ranking system. Materials and Methods Propagation of Test Plants Florida Imperata cylindrica accessions Cogongrass rhizomes, collected from 32 counties throughout Florida, USA, were brought back to Gainesville and established under greenhouse conditions in Metromix 300 (Scotts Si erra Horticultural Products Co., Marysville, Ohio) and fertilized with 14-14-14 Osmocote (Scotts Sierra Hortic ultural Products Co. Marysville, OH). The rhizomes were cut into 4cm segments and planted in plastic trays (13 x 17 x 56 cm). After 3 wk, rhizomes with healthy shoots were transplanted to 3-inch diameter plastic pots containing Metromix 300. Benin Imperata cylindrica accessions. Cogongrass rhizomes were collected from infested cogongrass sites in Benin during the summer of 2005 and 2006. Co llections were taken from natural and invasive cogongrass pop ulations in the field and transp orted to the experimental field 62

PAGE 63

site at the International Institute of Tropical Agriculture (IITA), Benin. The rhizomes were cut into 4-cm segments and planted in plastic tubs containing field soil. After 4-6 wk, rhizomes with healthy shoots were transplanted to 3-inch diameter plastic pots containing field soil. Inoculum Production Florida fungal isolates. Pure cultures of B. sacchari and D. gigantea were obtained from Dr. R. Charudattans collection (Pla nt Pathology Department, Univer sity of Florida, Gainesville, FL). These pathogens were previously isolated from diseased grasses co llected in Florida and their pathogenicity on several weedy grass species was previo usly evaluated (Chandramohan, 1999; Yandoc, 2001). Inoculum was produced by tran sferring mycelial blocks, from stored slant cultures, to fresh potato dextrose agar (PDA) plates and incubating the plates at 28 C for 8 d. Spores were harvested by adding 10 ml sterile distilled water to the cultures, gently scraping the surface with a rubber policeman, and transferring the suspension to PDA medium in two liter Erlenmeyer flasks with resulting spore suspension. The PDA flasks were incubated at 28C for 14 d (12h light/12h dark) until th e agar was fully colonized. Benin fungal isolates. West African cultures of B. sacchari D. gigantea and C. caudatum (Sacc.) Peck were obtained from Dr. F. Beeds culture collection (IITA, Cotonou, Benin). These pathogens were isolated from diseased grasses collected in Benin and their pathogenicity had been previously evaluated on several weedy grass species (Adolphe Avocanh, 2006; unpublished data). Inoculum was produced by transferring mycelial blocks from stored slant cultures to PDA plates and allowing cultures to grow at 25C (24h/24h) for 8 d. Spores were harvested by adding 10 ml sterile distilled water ame nded with 0.1% Tween 80 and the spores were released from culture plates by gently scraping the su rface with a sterile glass rod. Tween 80 was used to improve spore adhesion on the leaves during inoculation. The spore concentration for both experiments was determ ined with the aid of a haemocytometer. 63

PAGE 64

Imperata cylindrica Inoculations University of Florida, USA. Inoculations were carried out in a greenhouse 6 wk after the rhizomes were planted. Spores suspensions, 1 x 10 6 ml -1 were applied until run-off with handpumped sprayers (Figure 1-1). All inoculated an d nontreated control plants were incubated in a dew chamber for 24 h (27 1C, RH>90%) and then transferred to the greenhouse for observation. International Institute of Tr opical Agriculture, Benin. Inoculations were carried out in a shade house 8 wk after the rhizomes we re planted. Spore suspensions, 1 x 10 6 ml -1 were applied, until run-off, with hand-pumped sprayers. All inoculated and non treated control plants were incubated in a dew chamber for 24 h (27 1C, RH >90%) and then transferred to the shade house for observation. All experiments consisted of 9 replications per treatment with 3 replications for the nontreated control plants and were repeated. Ko chs postulates were co mpleted by isolating the fungi from inoculated cogongrass plants and compar ing them with the original isolates used in the inoculation for cultural characteristics and morphology. Efficacy of Bipolaris sacchari and Drechslera gigantea Applied Singly or as a Mixture The spore concentrations of B. sacchari D. gigantea, and their mixture were 1 x 10 6 spores ml -1 respectively. Spores were suspended in 250 ml sterilized distilled water amended with 0.1% Tween 80. The Tween 80 was used to improve spore adhesion on the leaves during inoculation. Control plants were sprayed with sterile distille d water containing 0.1% Tween 80. The efficacy of the two isolates and their mixt ure was measured in terms of the percentage disease severity (DS) and rated wi th the aid of pictorial key for s outhern corn leaf blight (James, 1971) and gray leaf blotch (Smith, 1989), with 50% as the maximum level of disease. 64

PAGE 65

Assessments were made at 7 and 21 d after inocul ation (DAI). The experiment had a completely randomized design with nine replications per treatment. Statistical Analysis All statistical analyses were performed us ing SAS statistical so ftware (Version 9.1, SAS Institute, Cary, NC). A repeated-measure anal ysis (PROC MIXED) was used to determine the statistical significance of the main effects (t reatments and/or acce ssions) and pairwise comparisons between levels of significant effect s were performed using the least significant differences. PROC GLM was used to determine the analysis of variance for the virulence and accession data. Data were not pooled due to th e significant interaction within treatment and accessions. Means and standard errors were ca lculated using the PROC MEANS procedure and are reported for each treatment x time combina tion. All reported differences among treatments are significant at P < 0.05, unless otherwise stated. Results Efficacy of Bipolaris sacchari and Drechslera gigantea Applied Singly or as a Mixture Florida Imperata cylindrica Accessions and Fungal Isolates Discrete leaf lesions were visible within 24 h after inoculation with each treatment. At the end of the monitoring period (21 DAI), the infected leaves were chlorotic, the lesions had coalesced and turned necrotic (Figure 3-1). Ho wever, no secondary disease spread was observed on the plants in the greenhouse, and the infecti on was confined to the sprayed foliage. New emerging leaves from inoculated plants were di sease-free, thus decreasing the level of DS. Disease severity means were scored between 0 (= no disease present no lesions observed) and 3 (= 15 30% of leaf blade dis eased; many longitudinal lesions on leaf blade) at 7 and 21 DAI. In the first trial, the fixed-effect analysis showed a significant treatment effect on the Florida accessions at 7 DAI (F-value = 355.49; Pr>F = <0.0001) and 21 DAI (F-value = 345.34; 65

PAGE 66

Pr>F = <0.0001) for B. sacchari and D. gigantea applied singly or as a mixture. There were significant differences between the B. sacchari and the D. gigantea applied singly and their mixture at 7 DAI (Table 3-1). However, the mixture treatments with both fungi were more damaging to cogongrass than with the individua l treatments. At 21 DAI, there were no significant differences between any of the treatments applied singly or as a mixture (Figure 3-2). The control treatment was significantly different from the B. sacchari and D. gigantea applied singly or as a mixt ure at 7 and 21 DAI. In the second trial, the fixed-effect analysis showed a significant treatment effect on the Florida accessions treated at 7 DAI (F-value = 109.97; Pr>F = 0.0003) and 21 DAI (F-value = 211.64; Pr>F = <0.0001) for the B. sacchari D. gigantea and their mixture. There were no significant differences between treatments applied singly or as a mixture at 7 and 21 DAI (Table 3-1, Table 3-2). The control treatment was significantly different from the B. sacchari and D. gigantea applied singly or as a mixtur e at 7 and 21 DAI, which conf irms that both fungi are virulent pathogens of cogongrass. Different cogongrass accessions were susceptible to B. sacchari and D. gigantea applied singly or in a mixture, over two tr ials at 7 and 21 DAI (Figure 33 Figure 3-8). Trial 1 at 7 DAI, the B. sacchari was most damaging on accession 22 (mean = 2.3333) and least virulent on accession 32 (mean = 0.6667) [Figure 3-3 A]. Drechslera gigantea was most damaging on accessions 49, 32 and 39 (mean = 2.0) and least damaging on accession 23 (mean = 0.4444) [Figure 3-4 A]. The mixture treatment was most damaging on accession 59 (mean = 3.111) and least virulent on accession 12 (mean = 0.444) [Figure 3-5 A]. Whereas at 21 DAI, the B. sacchari was most damaging on accession 59 (mean = 2.1667) and least damaging on accessions 12 and 52 (mean = 0.7778) [Figure 3-3 B]. Drechslera gigantea was most damaging on 66

PAGE 67

accession 49 (mean = 2.25) and least damaging on accessions 12, 38, and 57 (mean = 0.6667) [Figure 3-4 B]. The mixture was most da maging on accession 44 (mean = 2.2222) and least damaging on accession 12 (mean = 0.3333) [Figure 3-5 B]. For trial two, the B. sacchari was most damaging on accession 46 (mean = 1.6667) and least damaging on accession 35 (mean = 0.5) [Figure 3-6 A]. Drechslera gigantea was most damaging on accessions 59 and 21 (mean = 1.1111) and not at all damaging on I. brasiliensis, I. brevifolia Vasey and I. cylindrica var. rubra (mean = 0.000) [Figure 37 A]. The mixture was most damaging on accession 56 (mean = 2.0) and least damaging on accession 40 (mean = 0.00) [Figure 3-8 A] at 7 DAI. While at 21 DAI, the B. sacchari was most damaging on accession 53 (mean = 2.0) and least damaging on I. brasiliensis Trin. (mean = 0.3333) [Figure 3-6 B]. The D. gigantea treatment was most damaging on accession 56 (mean = 2.0) and not damaging at all on I. brasiliensis and I. cylindrica var. rubra (mean = 0.000) [Figure 3-7 B]. The mixture was most damaging on accession 43 (mean = 1.6667) and not damaging at all on I. cylindrica var. rubra and accession 39 (mean = 0.000) [Figure 3-8 B]. Di sease severity of the three treatments was observed to be more staggered over all accessions for trial one (Figure 3-3 Figure 3-5) when compared with the more uniform response to all treatments for trial two (Figure 3-6 Figure 38). No consistent response to the different treatments was observed over the two trials at 7 or 21 DAI for all accessions treated. The Florida accessions were grouped according to their statistical variance in disease severity to B. sacchari and D. gigantea applied singly or in a mixt ure (Table 3-7, Table 3-8). Over the two trials, there were no significant differe nces in treatment effect between the majority of accessions inoculated at 7 and 21 DAI compared with the control treatment. 67

PAGE 68

Benin Imperata cylindrica Accessions and Fungal Isolates In contrast to the Florida accessi ons, discrete leaf lesions beca me visible after 72 h for each treatment on the Benin cogongrass accession (Figure 3-1 and Figure 3-2). By the end of the monitoring period, the inoculated pl ants were slightly chlorotic and lesions were coalescing and turned necrotic (Figure 3-2). For the first trial, the fixed-effect analysis showed a significant treatment effect on the Benin accession treated at 7 DAI (F-value = 2.94; Pr>F = 0.0444) and at 21 DAI (F-value = 5.05; Pr>F = 0.0059) for the B. sacchari and D. gigantea applied singly or as a mixture. Results of the first trial showed a low disease incidence score of between 0 (= no diseas e present no lesions observed) and 1 (= 0.1 0.5% of leaf blade diseased; only a fe w longitudinal lesions with or without chlorotic margins) for all the isolates tested at 7 and 21 DAI. When the data sets were analyzed separately, there were si gnificant differences between the B. sacchari isolates from Florida and Benin, the Benin mixtur e and the controls at 7 DAI (F igure 3-9 A). At 21 DAI, there was a significant difference between the treatmen ts and control but no significant difference between any of the treatments (Figure 3-9 C). Pairwise comparisons between all the treatments showed a significant difference between the B. sacchari isolates from Benin and Florida and the B. sacchari isolate from Florida and the mixture from Florida and Benin at 7 DAI (Table 3-5). The Bipolaris sacchari from Florida and C. caudatum from Benin were significantly different fr om the control at 7 DAI. At 21 DAI, the only significant differences were recorded for the control and fungi applied singly while the Benin mixture was significantly differe nt from the control (Table 3-7). For the second trial, the fixed-effect analysis showed no significant treatment effect on the Benin accessions (F-value = 5.01; Pr>F = 0.0059). There was a significant treatment effect at 21 DAI (F-value = 3.2; Pr>F = 0.0304) for the treatment B. sacchari D. gigantea, and their mixture. 68

PAGE 69

Results for the second trials showed a higher dise ase incidence score of between 0 and 4 (= 45 55% leaf blade diseased; many lesions with some coalescing on leaf blade) at 7 and 21 DAI compared with the first trial (Figure 3-9 C, Figure 3-9 D). There was a significant treatment difference between the D. gigantea Benin and D. gigantea Florida isolates, B. sacchari Benin and C. caudatum isolates compared to the control at 7 DAI (Figure 3-9 B). There was no significant difference among treatmen ts and the control at 7 DAI (Figure 3-9 C). At 21 DAI, the C. caudatum B. sacchari Florida and D. gigantea Benin isolates were significantly different from the control (Figure 3-9 D). Pairwise comparisons for all treatments at 7 DAI showed a significant difference between the B. sacchari Benin and C. caudatum Benin, B. sacchari Benin and D. gigantea Florida isolates and between the Benin mixture and C. caudatum Benin, D. gigantea Benin and D. gigantea Florida isolates (Table 3-6). All treatments, with the exclusion of the B. sacchari Benin isolate, were significantly different from the c ontrol. At 21 DAI, signifi cant differences were observed between the B. sacchari Florida and the Florida mixture and C. caudatum and the Florida mixture (Table 3-8). All treatments, with the exclusion of B. sacchari Benin and the Benin mixture, were significantly di fferent from the control treatment. Discussion The biocontrol potential of four isolates of the fungal pathogens B. sacchari and D. gigantea applied singly or as a mixture, on different I. cylindrica accessions and closely related species (I. brasiliensis I. brevifolia, and I. cylindrica var rubra ) was confirmed in repeated greenhouse trials on cogongrass acce ssions in Florida, USA and in shade house trials in Benin, West Africa. In addition, an indigenous C. caudatum isolate was included in the Benin study. Gene-for-gene type resistance-pathogenici ty relationships are well documented for pathogen-host interactions in weed systems (E spiau et al., 1998; Elli son et al., 2004). The 69

PAGE 70

assumption that intraspecific variation in host plants pertaining to disease resistance is present in all weed-pathogen systems is incorrect. Morin et al. (1993) showed that four different, but closely related Xanthium species were highly susceptible to the same strain of the rust Puccinia xanthii Schwein. The detection of intraspecific variation in resistan ce has significant implications for biological control programs. Firstl y, it is possible that mo re than a single strain of the pathogen will be required to control all genotypes of the exotic weed as shown with the rust fungi used against Chondrilla juncea L. [skeletonweed] (Hassan et al., 1995) and Mikania micrantha Kunth. [mile-a-minute weed] (Ellison et al., 2004), the hemibiotrophic pathogen, Mycovellosiella lantanae (Chupp) Deighton var. lantanae on Lantana camara (L.) in South Africa (Den Breeen and Morris, 2003; Den Breeen, 2004). Additionally, finding the most virulent strain of the pathogen may require ex act host-matching in the native range for the genotypes of the exotic weed found in the introduced country (Morin et al., 2006). Pathogenicity testing of strains of the bridal creeper rust, Puccinia myrsiphylli (Thuem.) Winter from two different rainfall regions in South Africa, revealed that Australian bridal creeper [Asparagus asparagoides (L.) Druce] populations were only susceptibl e to strains from the winter rainfall areas where the Australian bridal creeper originated (Morin a nd Edwards, 2006). As found with the rust fungi on mile-a-minute weed (Ellis on et al., 2004), skeletonweed (Hasan, 1985) and blackberry (Bruzzese and Hasan, 1986), further exte nsive testing of strains and weed accessions might be required depending on the genetics of the weed and pathogen. While different pathogen genotypes (i.e., races) can va ry in their ability to cause di sease in a host, it is equally true that different host genotypes can be affected by particul ar pathogen races (Cousens and Croft, 2000). Examples of race and host-pathogen specificity in biological control systems include Puccinia chondrillina Bubak & Syd., a rust pathog en introduced to control Chondrilla 70

PAGE 71

juncea in Australia and the rust, Phragmidium violaceu m (Schultz) Winter to control Rubus spp. Only one of the three distin ct morphological forms of C. juncea in Australia (wide, medium, and narrow leaved forms) was susceptib le to the single pathotype of P. chondrillina released which resulted in an increase in abundance of the other C. juncea forms. In 1980, a second race that attacked only the intermediate form was introduce d, which subsequently resu lted in an increase in the third morphological form (Thrall and Bu rdon, 2004). Bruzzese and Hasan (1986) showed that of 15 isolates of Ph. violaceum (Schultz) Winter tested for host specificity, one that was most pathogenic on two Rubus spp. was only slightly pathogenic on another Rubus and caused no symptoms on a fourth species. Biocontrol is therefore more likely to succeed if the pathogen is relatively nonspecific to host genotypes or if multiple races of pathogen were introduced together. When considering the release of a cl assical biological control agent, we should be concerned with more than the climatic match of the pathogen and its host specifity. Given the high cost of biocontrol programs, we need to ma ximize the success rate of releases, and this should logically involve an unders tanding of the ecology of the host. The epidemiology of a pathogen is likely to be intimately related to the ecology of its hos t in a dynamic weed population as well as the effect of the ecology of interacting organisms affected by their abiotic environment (Cousens and Croft, 2000). Genetic diversity and the size, abundance, and spatial distribution of host plants will most likely affect the pathogens ability to reproduce and spread. Disease severity induced by the pathogen will ultim ately affect the host size and vigor. As a result, disease severity will affect the weed population dynamics and interactions with other components of the ecosystem. Chandramohan and Charudattan (1996) developed a multiple-pathogen strategy that targeted several weedy grass species simultaneously using three or more host-specific pathogens 71

PAGE 72

combined and applied inundatively. The research showed that the pathogen mixture was either superior or comparable to the single pathoge n application in biocont rol efficacy (Chandramohan, 1999). However, they concluded that using a pathogen mixture did not necessarily result in significant disease severity on most of the grass species tested. The possibility of a multiplepathogen strategy for I. cylindrica in West Africa should only be considered if the pathogens effectively affect different tissu es of plant such as leaf ( Bipolaris, rusts, and others) and seed pathogens (smuts), and fungi a ssociated with the rhizome ( Rhizoctonia sp ). All pathogens should be evaluated to determine their overall a ffect on plant fitness. Applying a single, hostspecific agent should be preferable for cogongra ss control within field crop situations, although the scope of my cogongrass project was to assess the control of a single target weed with two or more pathogens. However, results from this study indicate that applying the B. sacchari and D. gigantea as a mixture had no enhanced effects on the cogongrass in Florida and Benin. Using oil formulations, such as the oil emulsions used by Yandoc (2001) is one way to increase the level of damage from these pathogens, but the cost of su ch formulations is likely to be disincentive for their use in West Africa. Genetic variation is high w ithin the the USA and African I. cylindrica accessions (Chapter 2) with the two sets of accessions genetically distinct. This would suggest that the West African accessions would be an incompatible host for the USA B. sacchari and D. gigantea isolates. The indigenous fungus C. caudatum associated with cogongrass in Benin, evaluated in conjunction with the B. sacchari and D. gigantea, was found to cause similar or greater disease symptoms on the Benin accessions. Although the isolates were ab le to cause foliar disease, disease severity on all accessions was consistently lower than obser ved in previous studies (Yandoc et al., 2005). The slight decrease in disease severity noted in several accessions at 21 DAI could be due to the 72

PAGE 73

emergence of new healthy leaves and new healthy shoots from the soil. No plant mortality was observed over the entire experimental period. Tropical African agriculture is dominated by sma llholdings. In Nigeria, more than 80% of small-scale farms were found to range from 0.1 to less than 6.0 ha (Olayide, 1980). The situation is similar in other West African countri es, where most holdings are less than 2 ha and 96% cover less than 10 ha (Harrison, 1987, cited by Ker, 1995). Small-scale farmers are most affected by cogongrass infestations as they rely on manual weeding which requires massive labor input and is not effective on underground rhizomes (Chikoye et al., 2000). To design, develop, and implement an inundative biocontrol strate gy for cogongrass in West Africa that has a high probability of acceptance by users, research programs should be participatory and address the priorities and potential socio-economic constr aints of the farmers. Technology transfer, preferably, using locally available and low-cost ma terials, will play an important if not a pivotal role in the success of the selected mycoherbicides. Small-scale farming communities will be directly involved in the application and evaluation of the mycoherbic ide. The practical effectiveness of mycoherbicide applications in West Africa is most affected by the limited availability and the prohibitiv e costs of materials to produce sufficient spore quantities and limited availability of appr opriate spray equipment. Currently there is no single management strategy that effectively controls cogongrass infestations in a sustainable way throughout the world and mana gement strategies need to incorporate integrated approaches including preventive, cultural, biological, mechanical, and chemical control methods. Evaluating the management requirements for each cogongrass infestation and implementing the most appropri ate and therefore the most effective control method would go a long way in addressing the a pparent ineffectivenes s of current control 73

PAGE 74

methods. The prospect of implementing native funga l biological control ag ents as part of an integrated management strategy for cogongrass in West Africa appears to be promising. Investigations into fungal species associated with closely related Imperata species ( I. brevifolia and I. brasiliensis ) might yield additional, potentially eff ective biocontrol agents. Undertaking a comprehensive international survey for virulent pathogens should be seriously considered given the apparent lack of effectiv e biocontrol agents to date. 74

PAGE 75

Table 3-1. Pairwise comparison of least square m eans of disease severity (DS) from different treatments on Florida accessions of Imperata cylindrica at 7 days after inoculation. Treatment 1 a Treatment 2 a DS Estimate Pr > t Trial 1 B. sacchari D. gigantea 0.1088 0.1555 B. sacchari Mixture -0.4811 0.0003 Mixture D. gigantea 0.5900 0.0001 B. sacchari Control 1.2769 <0.0001 Control D. gigantea -1.1680 <0.0001 Mixture Control 1.7580 <0.0001 Trial 2 B. sacchari D. gigantea 0.04916 0.3038 B. sacchari Mixture 0.03465 0.4596 Mixture D. gigantea 0.01451 0.7492 B. sacchari Control 0.9631 <0.0001 Control D. gigantea -0.9139 <0.0001 Mixture Control 0.9284 <0.0001 Note: All reported differences among treatments are significant at P < 0.05. a Treatments were compared pairwise by Treatment 1 vs. Treatment 2. Table 3-2. Pairwise comparison of least square m eans of disease severity (DS) from different treatments on Florida accessions of Imperata cylindrica at 21 days after inoculation. Treatment 1 a Treatment 2 a DS Estimate Pr > t Trial 1 B. sacchari D. gigantea 0.1387 0.0502 B. sacchari Mixture 0.1325 0.0559 Mixture D. gigantea -0.006197 0.9146 B. sacchari Control 1.3336 <0.0001 Control D. gigantea -1.1949 <0.0001 Mixture Control 1.2011 <0.0001 Trial 2 B. sacchari D. gigantea 0.1248 0.0192 B. sacchari Mixture 0.1847 0.0053 Mixture D. gigantea -0.05994 0.1493 B. sacchari Control 1.0639 <0.0001 Control D. gigantea -0.9392 <0.0001 Mixture Control 0.8792 <0.0001 Note: All reported differences among treatments are significant at P < 0.05. a Treatments were compared pairwise by Treatment 1 vs. Treatment 2. 75

PAGE 76

Table 3-3. Disease severity statistical classes of Bipolaris sacchari Drechslera gigantea, and their mixture on the Florida Imperata cylindrica accessions at 7 days after inoculation. Accession number B. sacchari D. gigantea Mixture Control Trial 1 8, 14, 16, 39, 40, 52, 54, 61 11, 23, 29, 33, 34, 37, 41, 43, 44, 46, 47, 48 A A A B 56, 58, 59, 60, 65 B B A C 38 A B A C 12, 15, 22 A B B C 49 AB A B C 45, 53, 57 B C A D 32, 51 C B A D Trial 2 3, 4, 5, 7, 8, 9, 15, 16, 21, 22, 23, 24, 26, 27 29, 30, 31, 32, 33, 34, 37, 38, 41, 43, 47, 48 49, 50, 51, 52, 54, 55, 57, 58, 59, 60, 61 A A A B 56 B B A C 6, 46 A B A C 53 A B B C 66 A A A A 11 A A B C 36, 40, 42 A A B B 65 A AB AB B 35 AB A AB B 25, 45 AB B A C Note: All reported differences among treatments are significant at P < 0.05. See Figure 3-1 and Figures 3-3 3-7. 76

PAGE 77

Table 3-4. Disease severity statistical classes of Bipolaris sacchari, Drechslera gigantea and their mixture on the Florida Imperata cylindrica accessions at 21 days after inoculation. Accession number B. sacchari D. gigantea Mixture Control Trial 1 11, 15, 16, 22, 29, 32, 37, 39, 41, 43, 46, 48 51, 52, 54, 58, 59, 60, 65 A A A B 44, 57 B B A C 33, 53, 34 A B A C 8, 38, 45 A B B C 14, 40, 47 A A B C 61 A AB B C 12 A AB BC C 49 A B C C 56 B A AB C Trial 2 5, 6, 7, 8, 9, 11, 12, 13, 15, 16, 21, 23, 24 25, 26, 27, 29, 30, 31, 32, 34, 37, 38, 42, 47 48, 49, 50, 51, 52, 55, 58, 60, 61 A A A B 3 B B A C 22, 46 A B A C 43, 54, 57, 59 A B B C 33 A B AB B 53 A B C D 35 B A B C 4 B A AB C 56 AB A AB B 45 AB B AB C Note: All reported differences among treatments are significant at P < 0.05. See Figure 3-1 and Figures 3-3 3-7. 77

PAGE 78

Table 3-5. Pairwise comparison of least square m eans of disease severity (DS) from different treatments on the Benin accession of Imperata cylindrica at 7 days after inoculation (Trial 1). Treatment 1 a Treatment 2 a DS Estimate Pr> t B. sacchari (Benin) B. sacchari (Florida) -0.7778 0.0049 B. sacchari (Benin) Mixture (Benin) -0.0556 0.8324 B. sacchari (Benin) Mixture (Florida) -0.2761 0.2329 B. sacchari (Benin) Control (Benin) 0.1111 0.6373 B. sacchari (Benin) C. caudatum b (Benin) -0.4444 0.0756 B. sacchari (Benin) D. gigantea (Benin) -0.3333 0.1713 B. sacchari (Benin) D. gigantea (Florida) -0.3333 0.1713 B. sacchari (Florida) Mixture (Benin) 0.7222 0.0148 B. sacchari (Florida) Mixture (Florida) 0.5016 0.0406 B. sacchari (Florida) Control (Benin) 0.8889 0.0020 B. sacchari (Florida) C. caudatum (Benin) 0.3333 0.1713 B. sacchari (Florida) D. gigantea (Benin) 0.4444 0.0756 B. sacchari (Florida) D. gigantea (Florida) 0.4444 0.0756 Mixture (Benin) Mixture (Florida) -0.2206 0.3916 Mixture (Benin) Control (Benin) 0.1667 0.5285 Mixture (Benin) C. caudatum (Benin) -0.3889 0.1547 Mixture (Benin) D. gigantea (Benin) -0.2778 0.3000 Mixture (Benin) D. gigantea (Florida) -0.2778 0.3000 Mixture (Florida) Control (Benin) 0.3872 0.1028 Mixture (Florida) C. caudatum (Benin) -0.1683 0.4593 Mixture (Florida) D. gigantea (Benin) -0.0572 0.7995 Mixture (Florida) D. gigantea (Florida) -0.0572 0.7995 Control (Benin) C. caudatum (Benin) -0.5556 0.0313 Control (Benin) D. gigantea (Benin) -0.4444 0.0756 Control (Benin) D. gigantea (Florida) -0.4444 0.0756 C. caudatum (Benin) D. gigantea (Benin) 0.1111 0.6373 C. caudatum (Benin) D. gigantea (Florida) 0.1111 0.6373 D. gigantea (Benin) D. gigantea (Florida) 0.0000 1.0000 Note: All reported differences among treatments are significant at P < 0.05. a Treatments were compared pairwise by Treatment 1 vs. Treatment 2. b An indigenous Colletotrichum caudatum isolate was included in the study. 78

PAGE 79

Table 3-6. Pairwise comparison of least square m eans of disease severity (DS) from different treatments on the Benin accession of Imperata cylindrica at 7 days after inoculation (Trial 2). Treatment 1 a Treatment 2 a DS Estimate Pr > t B. sacchari (Benin) B. sacchari (Florida) -1.1095 0.1350 B. sacchari (Benin) Mixture (Benin) 0.00304 0.9967 B. sacchari (Benin) Mixture (Florida) -0.5540 0.4416 B. sacchari (Benin) Control (Benin) 1.0016 0.1741 B. sacchari (Benin) C. caudatum b (Benin) -1.9434 0.0167 B. sacchari (Benin) D. gigantea (Benin) -1.8541 0.0214 B. sacchari (Benin) D. gigantea (Florida) -1.8541 0.0214 B. sacchari (Florida) Mixture (Benin) 1.1125 0.1239 B. sacchari (Florida) Mixture (Florida) 0.5556 0.4159 B. sacchari (Florida) Control (Benin) 2.1111 0.0066 B. sacchari (Florida) C. caudatum (Benin) -0.8339 0.2400 B. sacchari (Florida) D. gigantea (Benin) -0.7446 0.2917 B. sacchari (Florida) D. gigantea (Florida) -0.7446 0.2917 Mixture (Benin) Mixture (Florida) -0.5570 0.4261 Mixture (Benin) Control (Benin) 0.9986 0.1638 Mixture (Benin) C. caudatum (Benin) -1.9465 0.0143 Mixture (Benin) D. gigantea (Benin) -1.8571 0.0183 Mixture (Benin) D. gigantea (Florida) -1.8571 0.0183 Mixture (Florida) Control (Benin) 1.5556 0.0341 Mixture (Florida) C. caudatum (Benin) -1.3895 0.0602 Mixture (Florida) D. gigantea (Benin) -1.3001 0.0764 Mixture (Florida) D. gigantea (Florida) -1.3001 0.0764 Control (Benin) C. caudatum (Benin) -2.9450 0.0007 Control (Benin) D. gigantea (Benin) -2.8557 0.0009 Control (Benin) D. gigantea (Florida) -2.8557 0.0009 C. caudatum (Benin) D. gigantea (Benin) 0.8933 0.8997 C. caudatum (Benin) D. gigantea (Florida) 0.8933 0.8997 D. gigantea (Benin) D. gigantea (Florida) 0.0000 1.0000 Note: All reported differences among treatments are significant at P < 0.05. a Treatments were compared pairwise by Treatment 1 vs. Treatment 2. b An indigenous Colletotrichum caudatum isolate was included in the study. 79

PAGE 80

Table 3-7. Pairwise comparison of least square m eans of disease severity (DS) from different treatments on the Benin accession of Imperata cylindrica at 21 days after inoculation (Trial 1). Treatment 1 a Treatement 2 a DS Estimate Pr > t B. sacchari (Benin) B. sacchari (Florida) 0.08333 0.6334 B. sacchari (Benin) Mixture (Benin) -0.2222 0.2448 B. sacchari (Benin) Mixture (Florida) -0.3333 0.1261 B. sacchari (Benin) Control (Benin) 0.5556 0.0094 B. sacchari (Benin) C. caudatum b (Benin) -0.2222 0.2448 B. sacchari (Benin) D. gigantea (Benin) -0.3333 0.1261 B. sacchari (Benin) D. gigantea (Florida) 0.0000 1.0000 B. sacchari (Florida) Mixture (Benin) -0.3056 0.0966 B. sacchari (Florida) Mixture (Florida) -0.4167 0.0506 B. sacchari (Florida) Control (Benin) 0.4722 0.0160 B. sacchari (Florida) C. caudatum (Benin) -0.3056 0.0966 B. sacchari (Florida) D. gigantea (Benin) -0.4167 0.0297 B. sacchari (Florida) D. gigantea (Florida) -0.0833 0.6334 Mixture (Benin) Mixture (Florida) -0.1111 0.5951 Mixture (Benin) Control (Benin) 0.7778 0.0009 Mixture (Benin) C. caudatum (Benin) 0.0000 1.0000 Mixture (Benin) D. gigantea (Benin) -0.1111 0.5529 Mixture (Benin) D. gigantea (Florida) 0.2222 0.2448 Mixture (Florida) Control (Benin) 0.8889 0.0008 Mixture (Florida) C. caudatum (Benin) 0.1111 0.5951 Mixture (Florida) D. gigantea (Benin) 0.0000 1.0000 Mixture (Florida) D. gigantea (Florida) 0.3333 0.1261 Control (Benin) C. caudatum (Benin) -0.7778 0.0009 Control (Benin) D. gigantea (Benin) -0.8889 0.0003 Control (Benin) D. gigantea (Florida) -0.5556 0.0094 C. caudatum (Benin) D. gigantea (Benin) -0.1111 0.5529 C. caudatum (Benin) D. gigantea (Florida) 0.2222 0.2448 D. gigantea (Benin) D. gigantea (Florida) 0.3333 0.0907 Note: All reported differences among treatments are significant at P < 0.05. a Treatments were compared pairwise by Treatment 1 vs. Treatment 2. b An indigenous Colletotrichum caudatum isolate was included in the study. 80

PAGE 81

Table 3-8. Pairwise comparison of least square m eans of disease severity (DS) from different treatments on the Benin accession of Imperata cylindrica at 21 days after inoculation (Trial 2). Treatment 1 a Treatment a DS Estimate Pr > t B. sacchari (Benin) B. sacchari (FL) -1.4390 0.0975 B. sacchari (Benin) Mixture (Benin) -0.0411 0.9611 B. sacchari (Benin) Mixture (Florida) 0.3388 0.6822 B. sacchari (Benin) Control (Benin) 1.4499 0.0952 B. sacchari (Benin) C. caudatum b (Benin) -1.6612 0.0596 B. sacchari (Benin) D. gigantea (Benin) -0.8361 0.3292 B. sacchari (Benin) D. gigantea (Florida) -0.4886 0.5640 B. sacchari (Florida) Mixture (Benin) 1.3979 0.1065 B. sacchari (Florida) Mixture (Florida) 1.7778 0.0418 B. sacchari (Florida) Control (Benin) 2.8889 0.0027 B. sacchari (Florida) C. caudatum (Benin) -0.2222 0.7836 B. sacchari (Florida) D. gigantea (Benin) 0.6028 0.4692 B. sacchari (Florida) D. gigantea (Florida) 0.9503 0.2605 Mixture (Benin) Mixture (Florida) 0.3799 0.6464 Mixture (Benin) Control (Benin) 1.4910 0.0871 Mixture (Benin) C. caudatum (Benin) -1.6201 0.0654 Mixture (Benin) D. gigantea (Benin) -0.7951 0.3523 Mixture (Benin) D. gigantea (Florida) -0.4476 0.5969 Mixture (Florida) Control (Benin) 1.1111 0.1832 Mixture (Florida) C. caudatum (Benin) -2.0000 0.0245 Mixture (Florida) D. gigantea (Benin) -1.1750 0.1691 Mixture (Florida) D. gigantea (Florida) -0.8275 0.3245 Control (Benin) C. caudatum (Benin) -3.1111 0.0015 Control (Benin) D. gigantea (Benin) -2.2861 0.0136 Control (Benin) D. gigantea (Florida) -1.9386 0.0313 C. caudatum (Benin) D. gigantea (Benin) 0.8250 0.3259 C. caudatum (Benin) D. gigantea (Florida) 1.1725 0.1699 D. gigantea (Benin) D. gigantea (Florida) 0.3475 0.6807 Note: All reported differences among treatments are significant at P < 0.05. a Treatments were compared pairwise by Treatment 1 vs. Treatment 2. b An indigenous Colletotrichum caudatum isolate was included in the study. 81

PAGE 82

A B C D Figure 3-1. Disease symptoms and disease severity on Imperata cylindrica Florida accessions at 21 days after inoculation. A) B. sacchari B) D. gigantea C) Mixture. D) Control. 82

PAGE 83

A B D C F G E Figure 3-2. Disease symptoms and diseases severity on Imperata cylindrica Benin accession at 21 days after inoculation. A) B. sacchari Florida. B) B. sacchari Benin. C) D. gigantea Florida. D) D. gigantea Benin. E) Mixture Florid a. F) Mixture Benin. G) Control. 83

PAGE 84

Figure 3-3. Mean disease ratings of Bipolaris sacchari on Imperata cylindrica Florida accessions (Trial 1). A) 7 days after inocula tion. B) 21 days after inoculation. 84

PAGE 85

Figure 3-4. Mean disease ratings of Drechslera gigantea on Imperata cylindrica Florida accessions (Trial 1). A) 7 days after i noculation. B) 21 days after inoculation. 85

PAGE 86

Figure 3-5. Mean disease ra tings of the Mixture on Imperata cylindrica Florida accessions (Trial 1). A) 7 days after inoculation. B) 21 days after inoculation. 86

PAGE 87

Figure 3-6. Mean disease ratings of Bipolaris sacchari on Imperata cylindrica Florida accessions (Trial 2). A) 7 days after inocula tion. B) 21 days after inoculation. 87

PAGE 88

88 Figure 3-7. Mean disease ratings of Drechslera gigantea on Imperata cylindrica Florida accessions (Trial 2). A) 7 days after i noculation. B) 21 days after inoculation.

PAGE 89

Figure 3-8. Mean disease ra tings of the Mixture on Imperata cylindrica Florida accessions (Trial 2). A) 7 days after inoculation. B) 21 days after inoculation. 89

PAGE 90

90 Figure 3-9. Disease severity of Florida (Fl) and Benin (B) isolates of Bipolaris sacchari Drechslera gigantea and their mixture on the Benin accession of Imperata cylindrica Included in the trial was a Colletotrichum caudatum indigenous to Benin. A) Trial 1 at 7 days after i noculation (DAI). B) Trial 2 at 7 DAI. C) Trial 2 at 21 DAI Disease means Treatments Disease means A B Treatments D) Trial 2 at 21 DAI. Bars with the same letters are not significantly different.

PAGE 91

Figure 3-9. Continued. C Disease means Treatments D Disease means Treatments 91

PAGE 92

CHAPTER 4 EVALUATION OF OBLIGATE BIOTROPHIC FUNGI ASSOCIATED WITH Imperata cylindrica IN SOUTH AFRICA AS POTENT IAL BIOCONTROL AGENTS FOR COGONGRASS IN WEST AFRICA Introduction The classical approach to biological control of weeds involv es the introduction, blishment and self sustenance of herbivores or pathogens from the native range of the target eed into the area where the weed has naturali zed and become a problem (Briese, 2000). The im is to achieve a long-term equilibrium be tween the population of natural enemies and the eed, and in the process trig ger a reduction of the weed population below the economic or nd, pasture, or natural areas, a reduction in weed density will open up niches for other desirable native or intro t species to in vade, thereby restoring level of balance in the ecosystem. A st rategic land management approach, however, ombining classical biocontrol with other tec hniques such as herbicid es, fertilizers, and egetation, is recommended to control the w hole spectrum of weed species present in the tem. Until recently, there has been a dearth of information on the biological control of grassy ds (Evans, 1991). Information on the natural enemy complex and the effect of this complex n the population dynamics is largely unknown w ith a general lack of basic botanical ation on the centers of origin and diversity of a majority of the invasive grasses. This has resulted in a general absence of attempted, and thus of successful, biolog ical control projects against grasses (Waterhouse, 1999). tance of the problems cause d by cogongrass throughout the tropical areas of the world, biological control efforts have be en few and rather piecemeal (Caunter, 1996). Other complicating factors include existence of closely related grasses of economic and ecologic value (Holm et al ., 1977) and potential conflict of interest with groups that value cogongrass esta w a w ecological threshold. In a rangela duced plan a c re v sys wee o inform Despite the impor 92

PAGE 93

(Evans, 1991). Similarly, little informatio pathogens of cogongrass and their potenti h cogongrass are more diverse and abundant than indicated by herbariu m records (Evans, 1991; Charudattan, 1997; Minno and Minno, 1998). dispersed, may infect directly through the host epidermis or through stom ata and do not require are capable of completing their entire life cycle on one host species while heteroecious rusts Smut fungi present a rather uniform life cy cle with a saprophytic haploid phase and a basidiospores in the basidium and ends with th e production of dikaryotic, parasitic hyphae. The basidia. The young basidium becomes a thickwalled teliospore and separates at m Most of the Ustilaginomycetes are dimorphic, producing a yeast or yeast-like phase in the biological control for itch-grass, Rottboellia cochinchinensis (Lour.) Clayton using the head n ex ists on the al as biological control ag ents (Evans, 1991) and it is lik ely that fungi associated wit The rust fungi are particularly well suited as biocontrol agents as they are typically wind wounds, are virulent, and highly host specific (Quimby, 1982). Ru st fungi have complex life cycles that vary among genera and species. A co mplete life cycle (macrocyclic) contains five successive spore stages (basidiospores, pycniospores, aeciospores, urediniospores, and teliospores) but most rusts are microcyclic and lack one or more of the stages. Autoecious rusts require two hosts in two different plant families to complete their life cy cle (Littlefield, 1981). Infection is usually local, formi ng individual colonies in leaves or other aerial parts of the host and dependent on reinfection each year. Infection is sometimes sy stemic and persistent in the plant. parasitic dikaryophase. The haploid phase usually commences with the formation of dikaryotic phase ends with the production of aturity from the sorus and functions as a dispersal unit. haploid state (Bauer et al., 1997). Studies have been conducted that aim to develop a classical 93

PAGE 94

smut, Sporisorium ophiuri (P. Henn.) Vnky (Ellison and Evans, 1990), which has recently b approved for release in Costa Rica. This is the first time that a tr ue smut fungus has been used a classical biocontrol program. Evans (1987, 1991) suggested that some of the known fungal pathogens of cogongrass een in shoul d. us ot ally excludes this rust from further ev aluation as a biocontrol agent due to potential nonta um rica and 2 d be considered for introductio n as classical biological control agents on this invasive wee Promising species include the rust fungi, Puccinia fragosoana Beltran, P. rufipes Diet. [USDA ARS, 2001] and P. imperatae Poirault (Evans, 1987); a smut fungus, Sporisorium (=Sphacelotheca) schweinfurthianum (Thuem.) Sacc. (Evans, 1987) that is well represented on cogongrass in the Old World, mainly Africa (Evans, 1991) and the hemibiotrophic fung Colletotrichum caudatum (Sacc.) Peck (Caunter, 1996). It is interesting to note that the three rust species and smut fungus are comm on in the Mediterranean region where I. cylindrica is n a serious weed (Evans, 1991; Holm et al., 1977). The aecial stages of P. imperatae and P. fragosoana are unknown while P. rufipes has a known aecial stage on Thunbergia an alternate host (Cummins, 1971). The presence of an econo mically important plant as an alternate host potenti rget effects. Besides, Ca unter (1996) cited that although P. rufipes was present in Malaysia, it was having litt le effect on cogongrass. The objective of this study were to: 1) determine the efficacy of two rust pathogens, Puccinia fragosoana and P. imperatae and a head smut fungus, Sporisorium schweinfurthian (associated with the South African Imperata cylindrica ) on the West African Benin I. cylind ) determine the inoculation method required for successful infection of the biotrophic fungi on the West African Benin I. cylindrica 94

PAGE 95

Materials and Methods Propagation of Test Plants Viable Imperata cylindric a seeds were germinated by plac ing on water-soaked cotton wool in pet ere a, e e ing a hich until inoculation. Both spore suspensions were ded with 0.1% Tween 80 only. ri dishes and leaving the dishes in a shade house for 14 to 21 d. Germinated seedlings w subsequently replanted in 8-cm-diameter pots c ontaining sterilized field soil and allowed to establish for 25 d (Figure 4-1). Source of Pathogens and Inoculum Collections of I. cylindrica leaves infected with the rusts, P. fragosoana and P. imperatae and inflorescences infected with the head smut, S. schweinfurthianum all from South Afric were stored at 4C until required. The geographic source of these pathogens are given in Tabl 4-1. Puccinia fragosoana and P. imperatae For the first inoculation, uredospores of P. fragosoana and P. imperatae were harvested by placing rust infected I. cylindrica leaf tissue in 200 ml distilled water amended with 0.1% Tween 80 and agitating manually for 5 min. For th second inoculation, uredospores of P. fragosoana and P. imperatae were harvested by scrap sharp bent needle over the respective open uredin ia (pustules) and collecting the spores w were then stored separately in plastic vials at -20C adjusted to a final suspension of 1 x 10 6 spores ml -1 using a haemocytometer. Sporisorium schweinfurthianum. The smut sori were harvested by placing the infected inflorescences in a 250 ml Erlenmeyer beaker filled with 150 ml distilled H 2 O amended with 0.1% Tween 80 with a final suspension of 1 x 10 8 sori ml -1 Control plants for both experiments were inoculated with distilled wa ter amen 95

PAGE 96

Treatments and Experimental De d P. imperatae. Eight-week-old I. cylindrica plants (5-blade stage) ly misted with water before being cove red with black plastic redospore germination. After 24 h, the black plastic sheeti 08 sori ml-1 suspension amended with 0.1% Tween 80 was applied to 15 I. cylindrica seedli 15 d as Puccinia fragosoana and P. imperatae. Four weeks after inoculation, no disease symptoms were observed for either P. fragosoana or P. imperatae. Neither inoculum method sign Puccinia fragosoana an per treatment were inoculated with a 1 x 10 6 ml -1 spore suspension amended with 0.1% Tween 80, using either a small hand-held sprayer, un til the liquid started to drip (i.e., runoff) or by applying the spore suspension dir ectly onto the leaves using a small, sterilized paint brush The inoculated plants were light sheeting for 24 h at 28C to f acilitate u ng was removed and the inoculated plants were left in the shade house and monitored weekly for lesion and pustule development for 30 d. Sporisorium schweinfurthianum There were three treatmen ts including the controls. A 1 x 1 ngs as a soil drench and leaf inoculation, respec tively. For the soil drench treatment, potted seedlings were drenched until through-flow and the pots remained submersed in the spore suspension for 24 h. The seedlings for the soil dren ch treatment were not watered for the first 7 days to maintain the level of spore concentration. For the leaf inoculation, 15 potted seedlings were inoculated with a 1 x 10 8 ml -1 spore suspension amended with 0.1% Tween 80, using a han held sprayer, until runoff. Seedlings in both treatments were incubated at 28C (RH<80%) for 24 h. The inoculated seedlings were placed in th e shade house for 14 d and subsequently moved to the field plot for up to 6 months. Distille d water amended with 0.1% Tween 80 was applied both soil drench and leaf inoculation control treatments. All expe riments were repeated twice. Results 96

PAGE 97

was successful because no pustules devel oped. Possi ble reasons for the lack of infection could possib r 4-2; af served on the single inflorescence produ was e 1999). Biological control of weeds using imported plant pathogens is safe, enviro McAlpine which is indigenous to Australia, is one of th e most successful classical biocontrol progr Bubk ly be attributed to a decr ease in spore viability due to long-term storage and the low temperature germination requirements of Puccinia fragosoana Sporisorium schweinfurthianum In trial one, typical smut symptoms appeared after flowering 4 months after inoculation with a 1 x 10 8 sori ml -1 soil drench treatment on I. cylindrica Benin plants. Five of the 15 plants inoculated produced a single inflorescence. Fou of the five inflorescences were replaced with a brown, powdery mass of te liospores (Figure Table 4-2). No disease symptoms were observed on the cogongr ass plants treated with the le inoculation. For trial two, no smut symptoms were ob ced after four months. No disease sy mptoms were observed on the cogongrass plants treated with the leaf i noculation. No inflorescences emerge d in the control treatment and it therefore not possible to compare the efficacy of the three treatm ents statistically. Discussion For any classical biocontrol pr ogram to be implemented, the researchers need to address the level of pathogenicity (i.e., the biocontrol potential of the agent) and determine the host rang (the agents safety to no ntarget plants). Consideration of eco logical principles in the selection and evaluation process for poten tial biocontrol agents should re duce future risks (Louda and Arnett nmentally sound, and cost effective (Barton, 2004). There are several successful classical biocontrol programs using rust fungi to control invasive weeds. The control of Acacia saligna (Labill.) H. Wendl. in South Africa, by the rust fungus Uromycladium tepperianum (Sacc.) ams documented (Morris, 1999). In Australia, the rust fungus Puccinia chondrillina & Syd. has been successfully established on skeletonweed ( Chondrilla juncea L. ), formerly a 97

PAGE 98

major weed of wheat throughout the eastern states of Australia. The weed has been reduced to tolerable densities. Puccina carduorum Jacky, a rust imported from Turkey and released in USA to control musk thistle, Carduus thoermeri J.A Weinm., ha to the s spread wi dely from its original introd rt r uri (P. Henn) Vnky (Ustilaginales), has been thoroughly studied on itchgrass, Rottboellia cochinchinensis an erect, using a uction in the northeastern United States to Wyoming and California in the west (Brucka et al., 1996; Luster et al., 1999). Baudoin et al. (1993) showed that P. carduorum can significantly reduce musk thistle density. In Australia, release of rust fungi for control of blackberries ( Rubus spp.), Parthenium Mimosa pigra L. and rubber vine [ Cryptostegia grandiflora ( Roxb. ex R. Br.) R. Br. ] has been moderately successf ul while the bridal creeper rust fungus P. myrsiphylli released in 2000, is showing promise of becoming a spectacula success (Morin et al., 2002). Head smut fungi are extremely host specific (Valverde et al ., 1999) and the host range of the genus Sporisorium is restricted to the Poaceae. A head smut, Sporisorium ophi strongly tufted, C 4 annual grass. An important weed in several crops including maize, sugarcane, upland and rain-fed rice, beans, sorghu m, and some perennials, such as citrus and oil palm at early growth stages, itchgrass has been reported as a weed of many crops in several countries (Holm et al. 1977, Ellison, 1987, 1993; Reeder et al. 1996) The smut is a soilborne pathogen, infecting itchgrass seedlings before th ey emerge from the soil, thereby ca systemic infection that leads to seed sterility. Sporisorium ophiuri has been recorded as a head smut of itchgrass in Africa and Asia and is re stricted to the Old World (Reeder and Ellison, 1999). Reeder et al (1996) screened S. ophiuri on graminaceous species to which the genus Sporisorium is restricted. The inflorescence of infect ed plants emerges c overed with a mass of dark brown teliospores that are shed back to the soil to start a new infection in the next seedling 98

PAGE 99

generation of R. cochinchinensis (Reeder et al., 1996). Infection with head smut should effectively reduce seed rain and reduce R. cochinchinensis density in subsequent crops. There is no plant-to-plant spread within a generation, as the smut infects only young seedlings. The smut is also capable of growth on ar tificial media and produces large numbers of sporidia in liquid fermentation. Sporidia are recognized as the infective propagule for a number of smut including many belonging to the genus Sporisorium Therefore, the possibility exists that sporidia could eventually form the basis of a mycoherbicide formulation that is applied inundatively. This would allow for a much faster spread of the biocontrol agent, and thus haste the impact of the smut on the w eed population (Reeder et al., 1996). A single cogongrass pla species, n nt can produce up to 3000 seeds per inflorescence; implementing a classi ave cal biological control program with the head smut fungus, S. schweinfurthianum could effectively reduce the number of seeds produced leading to a reduction in cogongrass density. The value of implementing S. schweinfurthianum as a classical biocontrol agent, in combination with the foliar pathogens, such as the rust fungus, P. imperatae, and C. caudatum, B. sacchari and D.gigantea (see Chapter 3) could provi de an effective means to manage this invasive weed. The lack of infection following the inoculation of two rust species, P. fragosoana and P. imperatae, makes it impossible to reach any conclusions with regard to th e biocontrol potential of these pathogens. The success wi th respect to the head smut, S. schweinfurthianum on the Benin cogongrass, albeit limited, o ffers hope that this pathogen may have potential as a classical as well as an inundative biocontrol agent. The re ason for the presenting these results are to h a record of the research completed to date. Although a relatively small piece of the puzzle, results from this research will benefit other researchers embarking on follow-up work. 99

PAGE 100

Table 4-1. Collections of obligate fungi associated with Imperata cylindrica in South Afr Locality and GPS coordinates (in Roman numerals ica. Fungi and life stages East North East of Utrecht, Central North KwaZulu-Natal (27.834S 30.690E) P. fragosoana, II and III Church St East, Pretoria, Gauteng P. fragosoana, II and III (25.349S 28.659E) S. schweinfurthianum South of Sabie, Mpumalanga (25.929S 30.164E) Puccinia imperatae II Table 4-2. Number of Imperata cylindrica inflorescences infected wi th the head smut, Sporisorium schweinfurthianum inflorescences infected Treatment Number of emerged (N=15) a Number of inflorescences Soil drench 5 4 Leaf inoculation 1 0 Control 0 0 a Total number of seedlings inoculated per treatment. 100

PAGE 101

F ulation with a 1 x 108 sori ml-1 Sporisorium schweinfurthianum soil drench treatment. igure 4-1. Imperata cylindrica seedlings prior to i noc 101

PAGE 102

Figure 4-2. schweinfurthianum four months after a soil drench treatment. Imperata cylindrica inflorescence infected with the head smut, Sporisorium 102

PAGE 103

CHAPTER 5 SUMMARY AND CONCLUSIONS (L.) Beauv. (cogongrass, speargra with a pan tropical distribution. It is ranked as one of the top 10 invasive weeds in the world. tegies that include an ex tensive rhizome system and high genetic plasticity enable this plant to be a highly invasive col ta cogongrass is the most variable species and specim the western Mediterranean to ia (including the Pacific Islands). In a previous study, it was Bipolaris sacchari (Butler) Shoem. and Drechslera gigantea d potential as biological contro Imperata cylindrica ss) is a noxious, rhizomatous grass Several survival stra wind-disseminated seeds onizer (MacDonald, 2004). Within the genus Impera ens have been found ranging from South Africa, throughout Australia, India, and Southeast As demonstrated that two fungal pathogens, (Heald & F.A. Wolf) Ito, were pathogenic and ha l agents of cogongrass in the USA. ISSR markers and DNA seque arker techniques offer novel approaches to quantify genetic diversity of weeds in native and intr oduced habitats; they were employed in this study to better understa nd the relationship betw een the USA and West African cogongrass. Included in th e study were three closely related Imperata species: Imperata brasiliensis Trin. is native to North, Central and South America and overlaps in its distribution with cogongrass in Florida and possibly elsewhere in the Southeast, and is morphologically and genetically very similar; Imperata brevifolia Vasey is native to California, and I. cylindrica var. rubra, an ornamental variety sold in nurseries throughout the USA. Weed populations with limited amounts of geneti c variation are likely to be better targets for biological control agents (Burdon and Marshall, 1981; Chaboudez and Sheppard, 1995). Understanding the extent of genetic variation can be of importance in the detection of ecotypes The genetic diversity between the USA and African cogongrass was assessed using nce analysis of the ITS. DNA-based molecular m 103

PAGE 104

or races of a species as they may differ co eir susceptibility to predators, parasites, or herbicides. In this study, the ISSR analyses showed that the USA and African I. cylindrica accessions, which were defined by three distinct gr oups, were genetically separated. Within the USA cogongrass, there was a distinction betw een cogongrass accessions co llected throughout the state of Florida and this study confirms that cogongrass was introduced multiple time into the USA. Imperata brasiliensis grouped with the Florida I. cylindrica and forms a sister species to the Florida cogongrass. In addition, I. cylindrica var. rubra was more closely related to the African accessions. Imperata brevifolia was not genetically di stinct from all the Imperata accessions treated within this study. Different tree topologies were generated with the ITS sequence analyses, which further confirmed that the African I. cylindrica was distinct from the USA Imperata species. The Florida I. cylindrica accessions formed two distinct groups within the tree, one representing the majority of accessions colleted in West and Central Florida and one representing accessions collected in East Florida. Imperata brasiliensis grouped within the USA I. cylindrica accessions. The Imperata cylindrica var. rubra accessions grouped together and were genetically more similar to the African cogongrass than to th e USA cogongrass. The African cogongrass exhibited higher genetic di fferentiation than thos e in USA and closely related Imperata species. These findings have implications for impleme nting a biological c ontrol approach to manage cogongrass. The hypothesis that fungal biological control within the USA and African cogongrass would result in differential respon ses across the different accessions was not supported by this study as the West African (Benin accession) was found to be equally susceptible to the Florida and Benin isolates of B. sacchari and D. gigantea However, it is nsiderably in th 104

PAGE 105

recommended that samples from different groups of I. cylindrica be included when screening other candidate biological control pathogens in the future. Low genetic variation among the different West African cogongrass would suggest that the Florida isolates of B. sacchari and D. gigantea could potentially control th e West African variety of cogongrass if employed in a mycoherbicide formulation. Virulence of the fungal pathogens, B. sacchari and D. gigantea applied singly or as a mixtu s, e rica. y. a s. sed similar or greater disease symptoms on the Benin accession. The slight f new nts to ith hese re associated with I. cylindrica accessions in Florida and Benin, and closely related specie I. brasiliensis I. brevifolia and I. cylindrica var rubra, was confirmed in repeated greenhous trials on cogongrass accessions in Florida, USA a nd in shade house trials in Benin, West Af An indigenous Colletotrichum caudatum (Sacc.) Peck isolate was in cluded in the Benin stud No consistent response was observe d over the two trials to the diffe rent treatments on the Florid cogongrass accessions over the monitoring period. The majority of the Florida cogongrass accessions exhibited no significant differences in th eir reaction to the treatments compared with the control treatment over the monitoring period, and there was no uniformity in the variance of disease severity over accessions. Testing in Benin revealed that there were no significant differences between the Florida and Benin isolat es when inoculated on the Benin cogongras When compared to the B. sacchari and the D. gigantea isolates, the indigenous fungus C. caudatum consistently cau decrease in disease severi ty noted can be attributed to th e regrowth i.e., emergence o leaves and shoots. At no time during experime ntal period was plant mortality observed. From these results, the potential to use B. sacchari and D. sacchari as inundative biocontrol age control cogongrass in the USA and West Afri ca appears limited. Follow-up research, w respect to the indigenous Colletotrichum caudatum, should be undertaken in West Africa. T 105

PAGE 106

should include extensive host range testing to ex clude the potential for nontarget effects. Additional field trials, using available loca l resources, should be further examined. Herbaceous weeds have been targeted for cla ssical biological control strategies the most frequently, while grassy weeds ha ve not, until recently, been cons idered as suitable targets. Despite the importance of the problems caused by cogongrass throughout th e tropical areas of the w s res es ths t orld, biological control efforts have b een very limited (Caunter, 1996) and only scant information exists on the pathogens of cogongrass a nd their potential as biological control agents (Evans, 1991). Evans (1987, 1991) suggested that some of the known fungal pathogens of cogongrass should be considered for introduction as classical biological c ontrol agents on this invasive weed. Promising species include the rust fungi, Puccinia fragosoana Beltran, P. rufipe Diet. and P. imperatae Poirault and a smut fungus, Sporisorium schweinfurthianum (Thuem.) Sacc. that is well represented on cogongrass in the Old World, mainly Africa, and the hemibiotrophic fungus Colletotrichum caudatum In this study, neither of the two rust pathogens, P. fragosoana and P. imperatae was successful in causing infection on Benin cogongrass in glasshouse trials. Tw o reasons for the negative res ponse are that the rust spo where possibly not viable after long-term storage and the uredosporeos of P. fragosoana requir low temperature for germination. Typical smut symptoms appeared after flowering 4 mon after inoculation with a soil drench treatment on the Benin accession while no diseased inflorescences were observed on the leaf-inoculated cogongrass. It is intere sting to note that the control plants did not flower w ithin the experimental time-frame. The assumption would be tha the smut caused the inoculated plants to flower ea rlier, but more studies are needed to test this hypothesis. The efficacy of the C. caudatum under field conditions was improved by 106

PAGE 107

formulating the spores in an oil emulsion. Th e oil sformulation caused high levels of disea incidence and disease seve rity even with no period of dew after inoculation. se l ct a ve weed. The detection of intraspecific variation in resistance has significant implications biologica control programs as more than one strain of the pathogen might be required to control all genotypes of the exotic weed. Finding the most vi rulent strain of the pathogen may require exa host-matching in the native range for the specif ic genotypes of the exotic weed targeted for control. Determining the level of genetic variation within weed species and populations can be employed as an essential tool in the selection of the most suitable, and ultimately the most effective, biological control agents. Implementing an amended C. caudatum formulation could potentially play a role in an augmentative biocontrol strategy for long-term control of cogongrass in West Africa. A classical biological control program using the head smut fungus, S. schweinfurthianum might effectively reduce the number of seeds produced, leading to reduction in cogongrass density over time and to the success of biocontro l of this invasi 107

PAGE 108

APPENDIX A hum caudatum ASSOCIATED WITH C OGONGRASS IN BENIN Introduction bioherbicide or approach to biol ogical control of invasive we eds (Charudattan, 2001). Applying before economic losses occur. One or severa l applications are requi red annually as these Of the nine fungi that were developed as practical mycoherbicides or were considered to have ichum strains (Templeton, 1992). Collego, a formul ation of the endemic anthracnose fungus C. (Penz.) Penz. & Sacc. in Penz. f. sp aeschynomene, was developed to control northern joint vetch ( Aeschynomene virginica (L.) B.S.P.) in rice and so ybean fields. Registered in 1982, the active ingredient contains 15% C. gleosporiodes f. sp. aeschynomene conidia as a dry powder formulation with shelf-life of 18 months. It was th e first commercially available mycoherbicide for use in annual weed in annual crops giving 90% control efficiency (TeBeest and Templeton, 1985). The successful development of Collego led to the discovery of another Collectotrichum -based mycoherbicide, by Philom Bios In c., Canada. It c ontains conidia of C. gleosporiodes (Penz.) Penz. & Sacc. in Penz. f. sp. malvae to control Malva pusilla Sm. (roundleaved mallow) in Canada and USA. The most effective period of application of a FIELD EVALUATION OF THE INDIGENOUS FUNGUS, C olletotric The use of indigenous plant pathogens, isolated from weeds, cultured to produce effective levels of infective propagules and used at inundative levels of inoculum is known as the infective propagules at rates high enough to cause extensive infection supp resses the target weed pathogens generally do not reprodu ce in sufficient numbers between growing seasons to initiate new epidemics on new weed infestations (S mith, 1982; Templeton, 1982; Charudattan, 1988). excellent prospects of being commercially available for use in the future, five are Colletotr gleosporiodes 108

PAGE 109

mycoherbicide is at the early growth stage of th e weed, although it can be effective at any stage of w One of the possible reasons why Colletotrichum spp. are more successful than others are that their pathogenicity strategies which include enzymes as well as toxins, while other species are known to produce local epidemics. While the Hemibiotrophs are divided into biotrophic hemibiotrophs, species in which colonization of host (Latunde-Dada et al., 1996; OConnell et al., 1993; W species produce two major sources of inoculum; conidia produced in acervuli and ascospores perithecia. Successful ichum mrelatively long dew periods of between 12 and 24 h at optimal temperatures of between 20C. eed growth (Makowski and Mortensen, 1992). a hemibiotrophic phase th at often precedes the necrotrophic phase. Many Colletotrichum species produce large quanti ties of extracellular lytic relative contribution of each property is unclear, it is most likely that a combination of these factors make these fungi superior weed biological control agents (Sharon, 1998). Hemibiotrophic pathogens are characterized by their initial infecti on of living host cells followed by their necrotrophic phase and typical s porulation on dead tissu es (Luttrell, 1974). tissues is entirely biotrophic, with the deat h of host cells delayed until about the time the pathogen begins to sporulate (Parbery, 1996). Necrotrophic hemibi otrophs have a short biotrophic phase that allows them to take posse ssion of host tissue prior to killing and invading the tissue. Examples of necrotrophic he mibiotrophs include various species of Colletotrichum ei et al., 1997), including C. lindemuthianum (Sacc. & Magnus) Lams.-Scrib. (OConnell and Bailey, 1991). Colletotrichum produced in and released from perithecia (Bailey et al., 1992). Dissemination of spores from young acervuli occurs in drops of water while wind distributes the dry spore masses from older acervuli and ascospores from Colletotr ycoherbicides products such as Collego are easily isolated and cultured on various solid and liquid media. All require 109

PAGE 110

Colletotrichum acutatum (Sacc.) Peck incorrectly identified as C. gloeosporioides, utilized for mycoherbicidal use on Hakea sericea Schrad. & J.C .Wendl. in South Africa was cultured on sterili date germinated via a sing ability tion, e e in zed bran and effectively used on hak ea seedlings under field c onditions (Morris, 1989). In the late 1980s, Caunter and Wong ( 1988) surveyed for foliar pathogens of I. cylindrica throughout Malaysia and, while they generally f ound low disease inciden ce, several candidate fungi were isolated including a te ntatively identified isolate of C. caudatum The pathogens widespread distribution and previo us confirmation of host specificity made it a suitable candi for investigation into its potential as a bioherbicide (Caunter, 1996) The conidia le germ tube within 12 h after inoculat ion and appressoria formed within 24 h with symptoms visible after 48 h (Caunter, 1996). Initi al symptoms were chlorotic spots on the leaf tips which developed into necrotic streaks along the leaf edges. At 34 DAI, only 40% of the leaves had died and no plant death was observed. No effect was observed on regenerative of the rhizomes. The addition of adjuvants and amendments, which affect spore germina virulence or environmental requirement, can infl uence disease severity. Caunter (1996) showed that amendments of 0.1 5.0% sucrose, glucose, and yeast-extract had little or no effect on spor germination but had an influence on appressori al formation and possi bly plays a rol increasing disease severity. During a survey for pathogens and insects asso ciated with cogongrass in the southeastern USA, C. caudatum was identified on cogongrass in Fl orida (Minno and Minno, 1998). In November 2002, C. caudatum was observed on infected I. cylindrica plants in the field in Benin (J. Hotegni, personal communica tion) and an isolate (COCBE N8) was confirmed to be pathogenic and highly virulent on I. cylindrica in Benin (Adolphe Avocanh, 2006, unpublished 110

PAGE 111

data). The objective of this study was to eval uate the efficacy of this indigenous leaf-spot causing fungus isolate from Benin on the I. cylindrica Benin accession under field conditions. Materials and Methods Inocu broth Inocu were kaolin (0.006 ml of 1 x 1010 spore ml-1 suspension and 6 g of kaolin made up to 60 ml) and a mycelial suspension amended with 1% paraffin o il and kaolin (6 g drie d mycelia and 6 g of lum Production A pure culture of Colletotrichum caudatum (isolate COCBEN8) was obtained from Dr. F Beeds culture collection (IITA, Cotonou, Benin). Initial isolations were made from diseased cogongrass plants growing at the IITA Station, Cotonou, Benin and their pathogenicity confirmed (Adolphe Avocanh, 2006, unpublished da ta). The inoculum was produced by transferring mycelial blocks, from stored slant cu ltures, to 150 ml potato salts broth. The was prepared by steeping 200 g grated potato in distilled water for 1 hour, boiled for 5 min, filtered through cheese cloth and the filtrate made up to 1 liter. To the filtrate was added 20 g sucrose, 10 g KNO 3 5 g KH 2 PO 4 2.5 g MgSO 4 .7 H 2 O, 0.02 g FeCl 2 up to. The pH was adjusted to 6 using NaOH and the medium was autoclaved at 121C for 15 min. The inoculated flasks were placed on a rotary shaker at 100 rpm and the fungua allowed to grow at 25C for 8 d under laboratory conditions. Spores and mycelia were harvested by filtering the resulting suspension through sterile cheese cloth. The spore concen tration was determined with the aid of a haemocytometer. lation A field site was selected on the IITA-Benin st ation and all existing cogongrass plants removed from the site (Figure A-1). The cogongrass plants were allowed to regenerate naturally. Sixteen 0.50 m 2 plots with 0.25 m 2 clearing between plots were marked in a randomized complete block design. A 1 x 10 6 spores ml -1 amended with 1% para ffin oil and finely ground 111

PAGE 112

kaolin) were applied re spectively at a rate of 100 ml amended spore or mycelial suspension plot at 15 s per plot. The two control treatment s included a 1% kaolin in water and 1% paraffin per oil and 1% kaolin in water. Fiel d pl ternoon to limit the effect of outcome of the experiment. Due to the fact that C. caudatum is ubiqu ase e ata were transformed using an arcs ine square root transformation. Analysis of OVA) was performed using the Genera l Linear Models Procedure (SAS Institute, Cary, n ots were inoculated in the late af high temperature on the itous throughout Benin, an initial disease asse ssment was made prior to inoculation (0 days after inoculation [DAI]). Disease Assessment Disease was assessed as disease incidence (DI) and disease severi ty (DS). Disease incidence was based on the number of plants infected among the total number of plants inoculated, expressed as a percen tage of diseased plants (Hor sfall and Cowling, 1978). Dise severity rating was based on the Horsfall-Barrett s cale (Horsfall and Barre tt, 1945). The diseas rating scale consisted of 12 class-values represen ting the percentage of disease severity as: 0 = 0%; 1 = 0 3%; 2 = 3 6%; 3 = 6 12%; 4 = 12 25%; 5 = 25 50%; 6 = 50 75%; 7 = 75 88%; 8 = 88 94%; 9 = 94 97%; 10 = 97 100%; 11 = 100%. The mean class value was used to determine the final disease severity value. Statistical Analysis Percentage d variance (AN NC). Means were compared usi ng the Student-Newman-Keuls test at P <0.05. Results Due to the fact that the fungus, Colletotrichum caudatum is ubiquitous in the field i Benin, an initial disease incidence assessment was made prior to inoculation at 0 DAI. Results showed that after an initia l DI rating of 30% for the my celial and 53.33% for the spore suspension treatments respectively, DI was observed at 100% for both treatments for the 112

PAGE 113

experiment duration (Figure A-2A). There were no significant differences in DI at any of the observation dates (Table A-1). Both control treat ments had equal or higher DI ratings compared with the fungal treatments at 0 DAI. Similarl y, DI increased to 100% after 7 DAI (Figure A2A). Disease severity (DS) ra tings ranged from one (0-3%) to six (50-75%) between trea (Figure B-2B). The two control treatments had similar DS ratings to the mycelial treatment, ranging from 1 to 4. Howe tments ver, the DS rating for the spore suspension treatment ranged from 1 to tion period. Compared with the mycelial and contro l treatments, the spore suspe to 35 e mulated in invert oil emulsions (water in oil) and ons (oil in water) have been employed for the enhan cement of bioherbicide funga heir high viscosity, invert emulsions are considered to lt to prepare and apply, and can be fungi et ontent of thogen 6 for the same observa nsion treatment caused the most disease severity starting at 7 DAI and continuing up DAI. Discussion Many fungi have a requirement for free water, such as dew, for germination and infection (Dhingra and Sinclair, 1985). While these requirements often limit the efficacy and therefore th commercial potential of bioherb icides (Auld, 1993), they can be overcome by formulation, application technology and careful timing of application (Walker and Boyette, 1986; Makowski and Mortensen, 1990). Fungal propagules for suspension oil emulsi l agents as a result of thei r ability overcome the limitation of insufficient free water and spore protection (Amsellem et al., 1990; Daigle et al., 1990; Auld, 1993; Boyette et al., 1993; Womack and Burge, 1993, Chandramohan et al, 2002; Yandoc et al., 2005). Due to t be difficu toxic (Womack et al., 1996), phytotoxic (A uld, 1993; Womack and Burge, 1993; Yang al., 1993) and cause nontarget plant damage (Dai gle et al., 1990; Amsellem et al., 1991). Suspension oil emulsions were devel oped in an effort to reduce the high and costly oil c invert emulsions and showed promise in reduci ng the free water limitation in two weed-pa 113

PAGE 114

systems (Auld, 1993; Boyette, 1994) and reduced the spray volume and number of conidia of C. truncatum (Schwein.) Andrus & W.D. Moore required for control of Sesbania exaltata (Raf.) Cory Boyette et al. (2007) showed, in greenhouse and field experiments, that an oil in water emulsion of unrefined corn oil and a surfactant, Silwet L-77 in creased the biological control efficacy of C. truncatum for S. exaltata by stimulating the germination and appressoria forma in vivo and in vitro and delaying the required dew period. Soybean yields were significantly higher in the weed-controlled plots. Oil suspen sion emulsions of the potential mycoherbicide, C. orbiculare (Berk. & Mont.) Arx, which causes anthracnose of Bathurst burr, Xanthium spinosum L. we tion re evaluated in field trials (Klein et al., 1995). Spores of C. orbiculare in kaolin were mixed with different rates of vegetable and and applied at several spore conce n et ss. al res ml-il mineral oils ntrations at field sites over two seasons. Results varied with improved mycoherbicide activity in the kaolin formulation compared to an aqueous spore suspension treatment in the first season, but the improvement was not repeatable at sites sprayed for the second season (Klei al., 1995). The effective control of seven weed species using three pathogens formulated with an oil emulsion of Sunspray 6E and paraffin oil (4:1 ratio) was demons trated by Chandramohan (1999). A similar oil emulsion was used by Yandoc (2001) to improve the level of biocontrol efficacy of B. sacchari (Butler) Shoem. and D. gigantea (Heald & F.A. Wolf) Ito on cogongra Greenhouse trials showed that an oil emulsion c ontaining 4% horticultural oil, 10% light miner oil, and 86% water resulted in higher levels of foliar blight with no dew exposure or shorter dew periods (Yandoc et al., 2005). Field trials showed that bo th fungi, when applied at 10 5 spo1 in an oil emulsion, caused foliar injury while ph ytotoxic damage was also observed from the o emulsion. 114

PAGE 115

The efficacy of the C. caudatum may be improved by formulating the spores in an oil emulsion. The results show that using a properly formulated C. caudatum spore suspension could be applied as an augmen tative biocontrol strategy for longterm control of cogongrass in West Africa. 115

PAGE 116

Table after inoculation. Source freedom Sum of squares Mean Square F value Pr > F A-1. Analysis of varian ce for disease incidence of Colletotrichum caudatum at 7 days Degrees of Model 31366.66667455.5555560.52 0.679 9 Error 8 Corrected to 7000.00875.000 tal 118366.667 116

PAGE 117

Figure A-1. Field trial site with reemerging Imperata cylindrica plants at IITA, Cotonou, Benin. 117

PAGE 118

118 caudatum formulation. A) Disease inci dence. B) Disease severity. A ) Figure A-2. Field inoculation of Imperata cylindrica Benin using an amended Colletotrichum Disease incidence ( % Time(weeksafterinoculation) Control2 Mycelium Spore suspension Control1 B Disease severity (mean rating) Tim e (weeks a fter i noculation)

PAGE 119

APPENDIX B ACCESSION AND GENBANK DATA FOR THE USA Imperata cylindrica AND CLOSE RELATED SPECIES Table B-1. Imperata cylindrica and closely related species sampled in USA for population structure and virulence studies. Plant accesssion Collection sites GenBank accessionaGPS coordinates LY USA: CGS1 Marion EU267045N 29.608' W 82.896' CGS2 Marion N 29.310' W 82.091' CGS4 Leon N 30.254' W 84.961' CGS5 Hernanado EU267064N 28.875' W 82.706' CGS7 Alabama N 30.326' W 87.130' CGS8 Walton N 30.586' W 86.776' CGS9 Walton N 30.492' W 86.174' CGS11 Santa R N 30.110' W 86.576' CGS12 Santa Rosa N 30.725' W 86.698' CGS13 a 3039.453' CGS14 Escambia N 30.580' W 87.427' CGS15 Escambia N 30.206' W 86.652' CGS16 Santa Rosa N 30.318' W 87.563' CGS17 Okaloosa N 30.688' W 86.406' CGS18 Holmes EU267046N 30.224' W 85.624' CGS19 Lafayette EU267047N 30.252' W 83.608' CGS20 Hamilton EU267048N 30.398' W 83.629' CGS21 Gilchrist EU267049N 29.373' W 82.162' CGS22 Gilchrist N 29.435' W 82.418' CGS23 Levy N 29.715' W 82.492' CGS24 Levy N 29.127' W 82.324' CGS25 Citrus N 28.153' W 82.117' CGS26 Citrus EU267050N 28.924' W 82.672' CGS27 Hernando EU267051N 28.977' W 82.017' CGS28 Pasco N 28.359' W 82.964' CGS29 Pasco EU267052N 28.426' W 82.263' CGS30 Hillsbo N 28.527' W 82.039' CGS31 Hillsboroug N 28.824' W 82.870' 4' CGS33 21' W 82.338' CGS34 Sumter N 28.072' W 82.738' CGS35 Bradford N 29.220' W 82.143' CGS36 Marion osa Rosa N 2' W 86 Sant .8 rough EU267054 h CGS32 Polk N 28.627' W 81.43 Polk EU267055N 28.9 EU267056 EU267057 119

PAGE 120

Table B-1. Continued. Plant accessions Collectio GPS coordinates n sites GenBank accession CGS37 Alachua EU267058N 29.983' W 82.340' CGS38 Clay EU267059N 29.670' W 81 Clay .670' CGS39 N 29.020' W 81.750' W 81.600' t Johns EU267060N 30.422' W 81.500' EU267062 EU267063 EU267065 e EU267066 EU267067 EU267070 brasiliensis Dade brevifolia N cylindrica var. 1) lants 2) ants CGS40 St Johns N 29.381 CGS41 S CGS42 Nassau EU267061 N 30.016' W 81.466' CGS43 Putnam N 29.377' W 82.835' CGS44 Flagler N 29.762' W 81.834' CGS45 Volusia N 29.601' W 81.838' CGS46 Volusia N 29.097' W 80.512' CGS47 Brevard N 28.072' W 80.307' CGS48 Brevard N 28.671' W 80.093' CGS49 St Lucie N 27.254' W 80.867' CGS50 St Lucie N 27.467' W 80.920' CGS51 Okeechobee N 27.923' W 80.903' CGS52 Okeechobe N 27.853' W 80.177' CGS53 Highlands N 27.229' W 81.776' CGS54 Highlands N 27.754' W 81.792' CGS55 Hardee N 27.580' W 81.557' CGS56 Hardee EU267068 N 27.953' W 81.951' CGS57 Manatee N 27.038' W 82.612' CGS58 Osceola N 27.315' W 81.769' CGS59 Osceola N 27.826' W 80.968' CGS60 Union CGS61 Putnam N 29.141' W 81.750' CGS62 Putnam N 29.141' W 81.750' CGS63 Lake CGS64 Lake CGS65 Lee N 26.765' W 81.222' Imperata CGS3 MiamiEU267053 N 25.344' W 80.305' Imperata CGS6 California 34.154' W 119.768' Imperata rubra CGS66 ( Nursery p EU267072 CGS66 ( Nursery pl EU267072 ak accession numbe the ITS semthe p GenBan rs given to quences fro resent study. 120

PAGE 121

APPENDIX C ACCESSION AND GENBANK DATA FO RST AND SOUTH AFRICAN Imperata Table C-1. Imperata cylindr sely relatemp led in West and South Africa for population struct virulence stu ns Collection GenBank accessionsaG THE WE lindrica cy ica and clo d species sa dies. ure and Plant accessio sites PS coordinates Cameroo n: CGC2 Nkom pipeline invasive 036 Alae inv 037 Eteme nkom invasive Essong MF Savane natural Ateba in Etengue EU267035 Alabata 1 EU267038 Alabata 2 EU267039 Ijaiya 1 041 Ijaiya 2 043 IITA Research Station 030 IITA Research Station EU267031 Savalou 1 EU267032 Savalou 2 Sirarou 1 EU267033 Sirarou 2 IITA Research Station frica: KwaZulu EU267073S 27.834' E 30.690' KwaZulu Natal ulu atal S 27.834' E 30.690' KwaZulu Zulu atal S 27.834' E 30.690' u EU267 N 4 4.725' E 11.320' CGC6 asive EU267 N 4 5.076' E 11.212' CGC8 N 4 5.642' E 11.574' CGC9 N 4 6.065' E 11.214' CGC10 vasive N 4 5.505' E 11.521' CGC11 invasive Nigeria: CGN1 CGN2 CGN3 EU267 CGN4 EU267 Guinea: CGG1 Benin: CGB1 EU267 N 6.252' E 2.720' CGB2 N 6.252' E 2.720' CGB3 CGB4 CGB5 CGB6 CGB7 N 6.252' E 2.720' South A CGSA1 Natal CGSA2 S 27.834' E 30.690' CGSA3 KwaZ N CGSA4 Natal S 27.834' E 30.690' CGSA5 Kwa N CGSA6 KwaZul Natal S 27.834' E 30.690' aes given to the ITS sequences from the present study. GenBank accession numb r 121

PAGE 122

LIST ES Allen, C.M., Thomas, R.D., 1991. Brachiaria plantaginea, Imperata cylindrica and Panicum coch 4, 613. Allendorf, F.W., L 003. Introduct ion b nd control ive ecies. Cons ervation Biology 17(1), 24-30. Altschul, S. F., Madden, T. L., Schaffer, A. A., ZhangZ., M 7. Gapp SI-BLAST: a new f pr grams. Nucleic Acids Research 25, 3389-3402. A, Z., Sharon, A., Gressel, J., Quim by, P.C. Jr., 1990. Compl ulum th herbicides ( Alternaria cassiae and ied in in opathology 80, Anderson, R.C., Gardner, E.D., 1999. An evaluation of the wilt-causing bacterium Ralstonia ncearum tial biologic al control agent for the alien kahili ginger ( Hedychium derianum aiian forests. Biological C9-96. Anikster, Y., 1984. The formae speciales. In: Bushne lelfs, A.P. (Eds.), The Cereal ts Vol. IAcademic Press. Orlando, pp. 115-130. Anon., 1954. Notes and exhibitions. In: Proceedings of the Hawaiian Entomological Society nolulu). ; 279-281; 2 Ash, G.J., Raman An investigetic atus in New South Wales, Australia, us ing inquence repeats (ISSR) lysis. Wh 43, 208-213. Auld, B.A., 1992. Development and commercializati on of biocontrol agents. In: Proceedings of st Interna ngress. Agmedia, Melbourne, Australia, pp. 269-272. Auld, B.A., 1993. Vegetable oil suspension emulsions reduce dew dependence of a oherbic ion 12, 477-479. AO., Duk e influence of rhizome features o city in ata cylindrica (L.) Beauv.]. Agri ironment 13(3/4), 309-317. gy and Control. C.A.B. International: Wallingford, U.K., pp. 88-120. OF REFERENC maximum : three grasses (Poaceae) new to L ouisiana and a range extension for Rottboellia inchinensis Sida, Contributions to Botany 1 undquist, L.L., 2 ion: Populat iology, evolution a of invas sp J., Zhang, iller, W., Lipman, D. J., 199 ed BLAST and P gene ration o otein database search pro msellem ete abolition of high A. crassa) when inoc reshold of two myco ert emul sion. Phyt appl v 925-929. sola as a poten gar ) in Haw ontrol 15, 8 l, W.R., Ro Ru s (Ho Volume 15, pp 263-265 82-283. R., Crump N.S., 2003. ation of gen tersimple se variation in Carthamus lan ana eed Researc Fir tional W eed Control Co myc ide. Crop Protect yeni, A. e, W.B., 1985. Th n subsequent regenerative capa speargrass [ Imper culture, Ecosystems and Env B., O'Co R.J., Nash, C., 1992. Infection s species. In: Bailey J.A., Jeger, M.J. (Eds.), Colletotrichum : Biology, Patholo ailey, J.A nnell, R.J., Pring trategies of Colletotrichum 122

PAGE 123

Baldwin, B.G., Sanderson, M.J., Po M.F., Cambell, C.S., Donoghue, M.J., 1995. The ITS region of nuclear ribosomal DNA: a valuable source of evidence on angiosperm phylogeny. Annals of the Missouri Botanical Garden 82, 247. Barre ith observations on related weed pathogens. Transactions of the Br itish Mycological Society 91, 81-97. Barre an, R., Walker H.L. (Eds.), Biological Control of Weeds with Plant Pathogens. John Wiley & Sons, New York, pp. 78Barre ral weeds. In: A ltieri, M.A., Liebman, M. (Eds.), Weed Management in Agroecosystems: Ecological Approaches. Boca Raton, Barto nge of fungal pathogens used for classical biological control of weeds? Biological Control 31, 99. Barto ria ) in New Zealand: Agent establishment, impact and benefits to the native flora. Bi ological Control 40, 370Baudoin, A.B.A.M., Abad, R.G., Kok, L.T., Bruckart, W.L., 1993. Field evaluation of Puccinia Bauer, R., Begerow, D., Oberwinkler, F., 1997. Us tilaginomycotina. Ustilaginomycetes. The true Booth, C., Prior, C., 1984. A new Giberella species on Imperata (Graminae). Transactions of the Boyette, C.D., 1994. Unrefined corn oil im proved the mycoherbicidal activity of Colletotrichum 526-529. Boyette, C.D., Hoagland, R.E., Weaver, M.A., 2007. Biocontrol efficacy of Colletotrichum Boyette, C.D., Jackson, M.A., Quimby, P.C. Jr., Connick, W.J. Jr., Zidak, N.K. Abbas, H.K., tana rter, J.M., Wo jciechowski, to, R.B., Evans, H.C., 1988. Taxonomy of a fungus introduced into Hawaii for biological control of Ageratina riparia (Eupatoriae; Compositae) w tt, S.C.B., 1982. Genetic variation in weed s. In: Charudatt 112. tt, S.C.B., 1988. Genetics and evolution of ag ricultu FL: CRC, pp. 57. n, J., 2004. How good are we at predicting the field host-ra n, J., Fowler, S.V., Gianotti, A.F., Winks, C. J., de Beurs, M., Arnold, G.C., Forrester, G., 2007. Successful biological control of mist flower ( Ageratina ripa 385. carduorum for biological control of mu sk thistle. Biological Control 3, 53. smut fungi. Version 30 November 1997. The Tree of Life Project, http://tolweb.org/Us tilaginomycetes/20530/1997.11. British Mycological Society 82, 180-182. truncatum for hemp sesbania ( Sesbania exaltata ) control. Weed Technology 8 truncatum for hemp sesbania ( Sesbania exaltata ) is enhanced with unr efined corn oil and surfactant. Weed Biology and Management 7, 70-76. 1999. Biological control of the weed hemp sesbania with Colletotrichum truncatum. In: Abstracts of the 10th Internat ional Symposium on Biological Control of Weeds, Mon State University, Bozeman, MT, USA. 123

PAGE 124

Boyette, C.D., Quimby, P.C. Jr, Bryson, C.T ., Egley, G.H., Fulgham, F.E., 1993. Biological control of hemp sesbania ( Sesbania exaltata ) under field conditions with Colletotrichum truncatum formulated in an invert emulsion. Weed Science 41, 497-500. Briese, D.T., 2000. Classical biological contro l. In: Sindel, B.M. (Ed), Australian Weed Management Systems. R.G. & F.J. Richardson Publishers, Melbourne, Victoria, pp. 161 192. Bruckart, W.L., Politis, D.J., Defago, G., Rosenthal, S.S., Supkoff, D.M., 1996. Susceptibili Carduus Cirsium and Cynara species artificially inoculated with Puccinia carduorum from m ty of usk thistle. Biological Control 6, 215. pplied Biology 108, 527-533. Bryson, C.T., Carter, R., 1993. Cogongrass, Imperata cylindrica in the United States. Weed Technology 7(4), 1005-1009. Burdo eeds. Journal of Applied Ecology 18, 649-658. Camp United States. Report, (E ds.), Proceedings of the IX International Symposium on Biological Control of Weeds. University of Cape Town, Cape Town, South Caunter, I.G., Wong, S.H., 1988. Fo liar diseases of Lalang in Penang: biocontrol potential. Chaboudez, P., 1994. Patterns of clonal variation in skeleton weed ( Chondrilla juncea ), an apomictic species. Australia n Journal of Botany 42, 283-295. Chab nte rnational Symposium on Biological Control of Weeds, Lincoln, New Zealand, pp. 95-102. Bruzzese, E., Hasan, S., 1986. The collection an d selection in Europe of isolates of Phragmidium violaceum (Uredinales) pathogenic to species of European blackberry naturalised in Australia. Annals of A Bryson, C.T., 1985. A new food plant record for Atalopedes campestris (Boisduival) Hesperiidae. Journal of the Lepi dopterists Society 39 (4), 335. Bryson, C.T., 1987. Native butterflies accepted cogongrass ( Imperata cylindrica [L.] Beauv.) as host plant. Journal of the Mi ssissippi Academic Society 3, 1. n, J. J., Marshall, D.R., 1981. Biological c ontrol and the reproduct ive mode of w bell, F.T., 1998. Worst Invasive Plant Specie s in the Conterminous Western Ancient Forest Campaign, Springfield, VA. Caunter, I.G., 1996. Colletotrichum caudatum a potential bioherbicide for control of Imperata cylindrica. In: Moran, V.C., Hoffmann, J.H Africa, pp. 525-527. MAPPS Newsletter12, 6. oudez, P., Sheppard, A.W., 1995. Are partic ular weeds more amenable to biological control? A reanalysis of mode of reproducti on and life history. In: Delfosse, E.S., Scott, R.R. (Eds.), Proceedings of the Eighth I 124

PAGE 125

Chandramohan, S., 1999. Multiple-Pathogen Strate gy for Bioherbicidal Control of Several Weeds. PhD Dissertation, University of Florida, Gainesville FL, 191p. Chandramohan, S., Charudattan, R., 1996. Multiple -pathogen strategy for bioherbicidal control Chanhan, S., Charudattan, R., Sonoda, R.M ., Singh, M., 2002. Field evaluation of a fungal pathogen mixture for the control of seve n weedy grasses. Weed Science 50, 204-213. Charu : tems. Manchester University Press, Manchester U.K., pp. 86-110. Charu ess a, Gainesville, Florida, USA. ificance ontrol 46, 229-260. ol 35, 183-196. R., .L., Kron, K.A., Rettig, J.H., Conti, E., Palmer, J.D., Manhart, J.R., Sytsma, K.J., Michaels, H.J ., Kress, W.J., Karol, K.G., Clark, W.D., .R., Soltis, P.S., Swensen, S.M., Williams, S.E., Gadek, P.A., Quinn, C.J., Eguiarte, L.E., Go lenberg, E., Learn, G.H., Graham, S.W., rbcL. Annals of the Missouri Chase es. Annals of Botany (London) 86, 935. tial f cogongrass [Imperata cylindrica (L.) Beauv.]. Weed Science Society of America Abstract 160, 49. Chen drica populations in Chiko el] in cassava-b ased systems in West Africa. International Journal of Pest Management 45 (4), 305-311. of several weeds. Weed Science Society of America Abstract 36, 49. dramo dattan, R., 1988. Inundative cont rol of weeds with indigenous fungal plant pathogens. In Burge, M. N. (Ed), Fungi in Biological Cont rol Sys dattan, R., 1997. Development of biological control for noxious plant species Progr report May 15 November 1997, University of Florid Charudattan, R., 2001. Biological co ntrol of weeds by means of plant pathogens: Sign for integrated weed management in modern agro-ecology. BioC Charudattan, R., 2005. Ecological, pract ical, and political inputs into selections of weed targets: what makes a good biological control agent? Biological Contr Chase, M.W., Soltis, D.E., Olmstead, R.G., Morga n, D., Les, D.H., Mishler, B.D., Duvall, M. Price, R.A., Hills, H.G., Qiu, Y Hedren, M., Gaut, B.S., Jansen, R.K., Kim, K. J., Wimpee, C.F., Smith, J.F., Furnier, G Strauss, S.H., Xiang, Q.Y., Plunkett, G.M. Barrett, S.C.H., Dayanandan, S., Albert, V. A., 1993. Phylogenetics of seed plants: an analysis of nucleotide sequences from the plastid gene Botanical Garden 80, 528. M.W., de Bruijn, A.Y., Reeves, G., C ox, A.V., Rudall, P.J., Johnson, M.A.T., Eguiarte L.E., 2000. Phylogenetics of Asphodelaceae (Asp aragales): an analysis of plastid rbcL and trnL-F DNA sequenc Chase, C.A., Shilling, D.G., Bewick, T.A., Char udattan, R., 1996. Fungal isolates with poten for the biological control o g, K.T., Chou, C.H., 1997. Ecotypic variation of Imperata cylin Taiwan: I. Morphological and molecular eviden ces. Botanical Bulletin of Academia Sinica 38, 215-223. ye, D., Ekeleme, F., Ambe, J.T., 1999. Survey of distribution and farmers perceptions of speargrass [ Imperata cylindrica (L.) Raeusch 125

PAGE 126

Chikoye, D., Ekeleme, F., Udensi, U.E., 2001. Cogongrass suppression by intercropping co crops in corn/cassava systems. Weed Science 49, 658-667. ver rceptions and management strategies. Crop Protection 19, 481-487. Chou f Imperata cylindrica (L.) Beauv. var. major (Cogongrass) populations in Taiwan. Botanical Clewell, A.F., 1985. Guide to the vascular plan ts of the Florida Panhandle. Tallahassee, FL: Florida State University Press, 605p. Coile ss gone bad! Botany Circular No. 28. Gainesville, FL: Florida Department of Agriculture and Cousens, R., Croft, A.M., 2000. Weed populatio ns and pathogens. Weed Research 40, 63-82. Cumm lag, New York. Daigl ., ssiae. de Jon de Jong, M.D., Scheepens, P.C., Zadoks, J.C., 1990. Ri by the fungus Chondrostereum purpureum de No y among and within Dekk ympos ium on Biological Control of Weeds. CSIRO Chikoye, D., Manyong, V.M., Ekeleme, F., 2000. Characteristics of speargrass ( Imperata cylindrica ) dominated in West Africa: crops, so il properties, farmer pe C.H., Tsai, C.C., 1999. Genetic variation in the intergenic spacer of ribosomal DNA o Bulletin of Academia Sinica 40, 319-327. N.C., Shilling, D.G., 1993. Cogongrass, Imperata cylindrica (L.) Beauv.: a good gra Consumer Services, Division of Plant Industry, 3p. ins, G.B., 1971. The rust fungi of cereals, grasses, and bamboos Springer-Ver e, D.J., Connick, W.J. Jr, Quimby, P.C. Jr, Evans, J., Trask-Morrell, B., Fulgham, F.E 1990. Invert emulsion: carrier and water source for the mycoherbicide, Alternaria ca Weed Technology 4, 327-331. g, M.D., 2000. The BioChon story: deployment of Chondrostereum purpureum to suppress stump sprouting in ha rdwoods. Mycologist 14, 58-62. sk analysis for biological control: a Dutch case study in biocontrol of Prunus serotina Plant Disease 74, 189-194. oij, M.P., van Damme, J.M.M., 1988. Varia tion in host susceptibilit populations of Plantago lanceolata L. infected by the fungus Phomopsis subordinaria (Desm.) Trav. Oecologia 75, 535-538. er, J., 1997. Weed diversity and weed management. Weed Science 45, 357-363. Den Breeen, A., 2004. Release strategies for the establishment of the leaf spot pathogen, Mycovellosiella lantanae var. lantanae on Lantana camara in South Africa. In: Cullen, J.M., Briese, D.T., Kriticos, D.J., Lonsdale W.M., Morin, L., Scott, J.K. (Eds.), Proceedings of the XI International S Entomology, Canberra, Australia, pp. 386-388. 126

PAGE 127

Den Breeen, A., Morris, M.J., 2003. Pat hogenicity and host specificity of Mycovellosiella lantanae var. lantanae, a potential biocontrol agent for Lant ana camara in South Africa. Biocontrol Science and Technology 13, 313-322. Dhing aton, Elliso th e potential of fungal pathogens for biological control agents of the graminaceous weed Rottboellia cochinchinensis (Lour.) Clayton. Ellison, C.A., 1993. An evaluation of fungal pathogens for biological cont rol of the tropical Elliso sess the potential of fungal pathogens as biological control agents for Rottboellia cochinchinensis (Graminae). In: Delfosse, E.S. Istituto Sperimentale per la Patologia Vegetale, Ministero dell'Agricoltura e delle Foreste, Ellison, C.A., Evans, H.C., Ineson, J., 2004. The signi ficance of intraspecifi es pathogenicity in a tt, J.K. (Eds.), Proceedings of the XI International Symposium on Biological Contro l of Weeds. CSIRO Entom Espiau, C., Riviere, D., Burdon, J.J., Gartner, S., Daclinat, B., Hasan, S., Chaboudez, P., 1998. (L.) 9 July Evans es Evans y weeds. In: Bake r, F.W.G., Terry, P.J. (Eds.), Tropical Grassy Weeds. CAB International, Wallingford, UK, pp. 52-72. ra, O.D., Sinclair, J.B., 1985. Basic plan t pathology methods. CRC Pr ess Inc., Boca R FL. Dickens, R., 1974. Cogongrass in Alabama afte r sixty years. Weed Science 22, 177-179. n, C.A., 1987. Preliminary studies to assess MSc thesis. Imperial College, University of London. graminaceous weed Rottboellia cochinchinensis PhD thesis, University of London. n, C.A., Evans, H.C., 1990. Preliminary studies to as (Ed), Proceedings of the VIII International Symposium on Biological Control of Weeds, Rome, Italy, pp. 477-482. the selection of a rust pathotype fo r the classical biol ogical control of Mikania micranth (mile-a-minute weed) in Southeast Asia. In: Cullen, J.M., Briese, D.T., Kriticos, D.J., Lonsdale, W.M., Morin, L., Sco ology, Canberra, Australia, pp. 103-107. Ellstrand, N.C., Schierenbeck, K.A., 2000. Hybridi zation as a stimulus for the evolution of invasiveness in plants? Proceedings of th e National Academy of Sciences USA 97, 7043 7050. Host-pathogen diversity in a wild system: Chondrilla juncea-Puccinia chondrillina Oecologia 113, 133-139. Eussen, J.H.H., 1980. Biological and ecological aspects of alang-alang [ Imperata cylindrica Beauv.)]. In: Proceedings of BIOTROP workshop on alang-alang in Bogor, 27-2 1976. Biotropica Special Publication No. 5, Bogor, Indonesia, pp. 15-22. H.C., 1987. Fungal pathogens of some subtropical and tropical weeds and the possibiliti for biological control. Biocontrol News and Information 8, 7-30. H.C., 1991. Biological control of tropical grass 127

PAGE 128

Evans, H.C., Symon, D.E., Roush, R.T., Grove s, R.H., Williams, J., Corey, S., 1998. Taxono and genotypes of the Rubus fructicosus L. aggregate in Austalia. Plant Protection Quarterl 13, 152-156. my y ic distance among DNA haplotypes: ap plications to hu man mitochondrial DNA restriction data. Genetics 131, 479-491. Felsenstein, J., 1985. Confidence limits on phylo genies: an approach using the bootstrap. Forno olesta in Brazil. Aquatic Botany 6, 185-187. Freem (Eds.), Biology of Conidial Fungi,Vol. 2. Academic Press, New York, USA, pp. 143-165. Gabe Gaffney, J.F., 1996. Ecophysiological and technologi cal factors influencing the management of cogongrass ( Imperata cylindrica ). PhD Dissertation, Gainesville, FL: University of Gerla Excoffier, L., Smouse, P.E., Quattro, J.M., 1992. Analysis of molecular variance inferred from metr Evolution 39, 783-791. I.W., Harley, K.L.S., 1979. Occurrence of Salvinia m an, T.E., 1981. Use of conidial fungi in bi ological control. In: Cole, G.T., Kendrick, B l, M.L., 1982. A biosystematic study of the genus Imperata (Graminae: Andropogoneae). PhD. dissertation, Iowa State University, Ames, Iowa, USA. Florida, 114p. ch, J., 2006. Invasive Species Sp ecialist Group Database, Ecology of Clidemia hirta http://www.issg.org/databa se/species/ecology.asp Ghosheh, H.Z., 2005. Constraints in implementi ng biological weed control: A review. Weed ent 5, 83-92. Biology and Managem Global Invasive Species Programme (GISP): Invasi ve Species and Poverty: Exploring the Links. www.gisp.org/publications/bro chures/invasivesandpoverty.pdf Goolsby, J.A., Van Klinken, R.D., Palmer, W. A., 2006. Maximising the contribution of nativerange studies towards the identification and prioritisation of weed biocontrol agents. Australian Journal of Entomology 45, 276-286. Greaves, M.P., McQueen, M.D., 1990. The use of mycoherbicides in the field. Aspects of Applied Biology 23, 163-168. biohe rbicides to control forest weeds in the UK. Green, S., 2003. A review of the potential use of Grove ure. In: Baker, F.W.G., 1. Forestry 76(3), 285-298. s, R.H., 1991. The physiology of grassy weeds in tropical agricult Terry, P.J. (Eds.), Tropical Grassy Weeds. CAB International, Un ited Kingdom, pp. 39-5 128

PAGE 129

Gupta, M., Chyi, Y-S., Romero-Severson, J., Owen, J.L., 1994. Amplification of DNA markers from evolutionarily diverse genomes using si ngle primers of simp le-sequence repeats. Theoretical an d Applied Genetics 89, 998-1006. Hall, D.W., 1983. Weed watch C ogongrass. Florida Weed Scien ce Society Newsletter 5, 1-3. Hall, s really an exotic? Wildland Weeds 1, 14. forms of skeleton weed. In: Delf osse, E.S. (Ed.), Proceedings of the VI International Symposium on Bi ological Control of Weeds. Agriculture Canada, Ottawa, Hasan, S., Chaboudez, P., Espiau, C., 1995. Isoz yme patterns and susceptibility of North al Symposium on Biological Contro l of Weeds. CSIRO Publishing, Melbourne, Australia, pp. Hodkinson, T.R., Chase, M.W., Takahashi, C ., Leitch, I.J., Bennett, M.D., Renvoize, S.A., 2002a. The use of DNA sequencing (ITS and trnL-F ), AFLP and fluorescent in-situ ny ics d genera (Saccharinae, Andropogoneae, Poaceae) Horsf easurement of plant disease. In: Horsfall, Horsfall, J.G., Barratt, R.W., 1945. An improved gr ading system for measuring plant disease. Invasive Species Specialist Group Database [ISSG], 2005. Ecology of Passiflora tarminiana. http://www.issg.org/databa se/species/ecology.asp Hall, D.W., 1978. The grasses of Florida. PhD. Dissertation, Gainesville FL: University of Florida, 498p. D.W., 1998. Is cogongras Hasan, S., 1985. Search in Greece and Turkey for Puccinia chondrillina strains suitable to Australian Canada, pp. 625-632. American forms of Chondrilla juncea to European strains of the rust fungus, Puccinia chondrillina. In: Delfosse, E.S., Scott, R.R. (Eds.) Proceedings of the VIII Internation 367-373. hybridisation to study allopolyploid Miscanthus (Poaceae). American Journal of Bota 89, 279. Hodkinson, T.R., Chase, M.W., Lled, M.D., Sa lamin, N., Renvoize, S.A., 2002b. Phylogenet of Miscanthus, Saccharum and relate based on DNA sequences from ITS nuc lear ribosomal DNA and plastid trnL intron and trnL-F intergenic spacers. Journal of Plant Research 115, 381-392. Holm, L.G., Plucknett, D.L., Pancho, J.V., Herb erger, J.P., 1977. The Worlds Worst Weeds: Distribution and Biology Honolulu,University Press of Hawaii. 609p. all, J.G., Cowling, E.B., 1978. Pathometry: Th e m J.G., Cowling, E.B. (Eds.), Plant Diseases: An Advance Treatise, Vol. 2. Academic Press, New York, NY, pp. 119-136. Phytopathology Abstracts 35, 655. Hubbard, C.E., 1944. Imperata cylindrica. Taxonomy, Distribution, Economic Significance, and Control. Imperial Agriculture Bureau Joint P ublication No. 7, Imperial Bureau Pastures and Forage Crops, Aberystwyth, Wales, UK. 129

PAGE 130

Invasive Species Specialist Group Database [ISSG], 2006. Ecology of Hedychium gardnerianum http://www.issg.org/database/species/ecology.asp Ivens, G.W., 1983. The natural control of Imperata cylindrica Nigeria and Northern Thailand. James, C., 1971. A Manual of Assessment Keys for Plant Diseases. Canada Department of is. International Development Research Centre, Ottawa, ON, Canada, 167p. King, King, S.E., Grace, J.B., 2000a. The effects of gap size and disturbance type on invasion of wet tany King, cylindrica ), a nonindigenous invader of th e southeastern United States. Wetlands 20(2), 300-306. Klein 431, 177-181. igna unguiculata ). Mycological Research 100, 1133-1141. by ra ndom amplified polymorphic DNA and intersimple sequence repeat anal ysis. Weed Research 45, 424-430. Lippi in e, FL: University of Florida, 165p. ty Mountain Research and De velopment 3(4), 372-377. Agriculture, Ottawa, Canada. American Phytopathological Society, St. Paul, MN, 78p. Ker, A., 1995. Farming systems of the African sa vanna: a continent in cris L.M., Schaal, B.A., 1989. Ribosomal-DNA variation and distribution in Rudbeckia missouriensis. Evolution 43, 1117-1119. pine savanna by cogongrass, Imperata cylindrica (Poaceae). American Journal of Bo 87(9), 1279-1286. S.E., Grace, J.B., 2000b. The effects of soil flooding on the establishment of cogongrass ( Imperata T.A., Auld, B.A., Fang, W., 1995. Evaluation of oil suspension emulsion of Colletotrichum orbiculare as a mycoherbicide in field tr ials. Crop Protection 14 (3), 193197. Koch, W., Grobmann, F., Weber, A., Lu tzeyer, H.J., Akobundu, I.O., 1990. Weeds as components of maize/cassava cropping systems. In: Standor tgemaesse Landwirtschaft in West Africa (IITA, Ibadan and University of Hohenheim, Stuttgard, Germany), pp. 219244. Kolbe, J.J., Glor, R.E., Schettino, L.R., Lara, A.C., Larson, A., Losos, J.B., 2004. Genetic variation increases during biological invasion by a C uban lizard. Nature Latunde-Dada, A.O., O'Connell, R.J., Nash, C., Pring, R.J., Lucas, J.A., Bailey, J.A., 1996. Infection process and identity of th e hemibiotrophic anthracnose fungus ( Colletotrichum destructivum ) from cowpea ( V Li, W.G., Shen, J.J., Wang, J.B., 2005. Ge netic diversity of the annual weed Monochoria vaginalis in southern China detected ncott, C.L., 1997. Ecol ogical consequences of Imperata cylindrica (cogongrass) invasion Florida sandhill. PhD. Dissertation, Gainesvill Littlefield, L.J., 1981 Biology of the Plant Rusts: An Intr oduction. Ames: Iowa State Universi Press, 103p. 130

PAGE 131

Louda S.M., Arnett A.E., 1999. In: Spencer, N.R. (Ed). Predicting Non-Target Ecol Effects of Biological Cont rol Agents: Evidence from Rhinocyllus c ogical onicus, Proceedings of the X International Symposiu m on Biological Control of Weeds, 4-14 July 1999. Montana Luster, D.G., Berthier, Y.T., Bruckart, W.L., Hack, M.A., 1999. In: Spencer, N.R. (Ed), PostA m MacD cylindrica ) Biology, ecology, and MacD sunshine: Cogongrass [ Imperata cylindrica (L.) Beauv.] biology, Madd 00. MacClade 4: Analysis of phylogeny and character analysis. Mako rbicide for roundleaved mallow ( Malva pusilla ): conditions for successful control in the field. In: Delfosse, E.S. (Ed.), Proceed ings of VII International Symposium on Makowski, R.M.D., Mortensen, K., 1992. Th e first mycoherbicide in Canada: Colletotrichum gloeosporioides malvae tors State University, Bozeman, Montana, USA, pp. 551-567. Release Spread of Musk Thistle Rust Mon itored from Virginia to California Using DN Sequence Information, Program Abstracts, Proceedings of the X International Symposiu on Biological Control of Weeds, 4-14 July 1999. Montana State University, Bozeman, Montana, USA, p. 75. Luttrell, E.S., 1974. Parasitism of fungi on vascular plants. Mycologia 66 (1), 1-15. onald, G.E., 2004. Cogongrass ( Imperata management. Critical Reviews in Plant Sciences 23(5), 367-380. onald, G.E., Shilling, D.G., Brecke, B.J., Gaffney, J.F., Langeland, K.A., Ducar, T.A., 2002. Weeds in the ecology and management in Florida. University of Florida IFAS Extension Publication SSAGR-52. ison, D., Maddison, W., 20 CD-ROM, Sinauer Associates, Inc. wski, R.M.D., Mortensen, K., 1990. Colletotrichum gloeosporioides f. sp. malvae as a biohe Biological Control ofWeeds, Rome: Istituto Sperimentale per la Patologia Vegetale, Ministero dellAgricoltura e delle Foreste, pp. 513-522. f. sp. for round-leaved mallow control. Proceedings of the First International Weed Control Congress 2, 298-300. Mangoendihardjo, S., 1980. Some notes on th e natural enemies of Alang-alang [ Imperata cylindrica (L.). Beauv.] in Java. In: Soewardi B. (Ed), Proceedings of BIOTROP Workshop on Alang-alang, Bogor, Indonesia. BIOTROP SEAMO Regional Center for Tropical Biology, Bogor Indonesia, pp. 47-55. McDonald, S.K., Shilling, D.G., Bewick, T.A., Gordon, D., Hall, D., Smith, R., 1996. Fac influencing cogongrass, Imperata cylindrica (L.) Beauv., dispersion, establishment, and persistence. Weed Science Soci ety of America Abstracts 36, 46 McGinley, M., 2007. Invasive alien species and development challe nges in Africa. In: Cleveland, C.J. (Ed.), Encyclopedia of Earth. Wash ington, D.C.: Environmental Information Coalition, National Council for Sc ience and the Environment. http://www.eoearth.org/articl e/Invasive_alien_species_a nd_development_challenges_in_A rica 131

PAGE 132

McRoberts, N., Finch, R.P., Sinc lair, W., 1999. Assessing the signifi cance of molecular div data in natural plant populations. Jo urnal of Experimental Botany 50, 1635-1645. berts, N., Sinclair, W., McPherson, A., Franke, A.C., Saha ersity McRo ran, R.P., Malik, R.K., Singh, S., Marshall, G., 2005. An assessment of genetic diversity within and between populations Mille ttp://bioweb.usu.edu/mpmbio/tfpga.htm of Phalaris minor using ISSR markers. Weed Research 45, 431-439. r, M.P., 1997. Tools for population genetics analysis (TFPGA) 1.3: a Windows program for the analysis of allozyme and molecular population genetic data. Computer software distributed by author; h Milne, R.I., Abbott, R.T., 2004. Geographic origin and taxonomic status of the invas ive Privet, Ligustrum robustum (Oleaceae), in the Mascarene Isla nds, determined by chloroplast DNA Minno, M.C., Minno, M., 1998. Survey of herbivor ous arthropods and pathogens of cogongrass Morin, L., Auld, B.A., Brown, J.F., 1993. Host-range of Puccinia xanthii and post-penetration development on Xanthium occidentale Canadian Journal of Botany 71, 959-965. Morin of biological control agents for bridal creeper a retrospective review. Au stralian Journal of En tomology 45, 286-290. Morin ournal Morin, L., Hill, R.L., Matayoshi, S., 1997. Hawaiis l biological control strategy for Morin, L., Syrett, P., 1996. Prospects for biological control of Hieracium pilosella with the rust J.H. eeds. Morin, L., Willis, A.J., Armstrong, A., Kriticos, D., 2002. Spread, epidemic development and t on nd Ecosystems. U.S. and RAPDs. Heredity 92, 78-87. in Florida. Final Report to D. Shilling, University of Florida, Jay, FL and J. Meeker, FDACS, Gainesville FL. L., Edwards, P.B., 2006. Selection L., Evans, K.J., Sheppard, A.W., 2006. Sele ction of pathogen agents in weed biological control: critical issues and peculiarities in relation to arthropod agents. Australian J of Entomology 45, 349-365. successfu mist flower ( Ageratina riparia ) Can it be transferred to New Zealand? Biocontrol News and Information 18, 77N-88N. Puccinia hieracii var. piloselloidarum in New Zealand. In: Moran, V.C., Hoffmann, (Eds.), Proceedings of the IX Internationa l Symposium on Biological Control of W University of Cape Town, Cape Town, South Africa, pp. 199-204. impact of the bridal creeper rust in Austra lia: summary of results. In: Spafford Jacob, H., Dodd, J., Moore, J.H. (Eds.), Proceedings of the 13th Australian Weeds Conference. Plan Protection Society of WA Inc., Perth, W.A., pp. 385. Morin, M., 1995. Vascular plants of the United Stat es. In: La Roe, E.T., Farris, G.S., Puckett, C.E., Doran, P.D., Mac, M.J. (Eds.), Our Living Resources: A Repor t to the Nation Distribution, Abundance, and H ealth of U.S. Plants, Animals, a Department of the Interior, National Bi ological Service, Washington, D.C., pp. 200-205. 132

PAGE 133

Morris, M.J., 1987. Biology of the Acacia gall rust, Uromycladium tepperianum. Plant Pathology 36, 100. Morris, M.J., 1989. A method for controlling Hakea sericea Schrad. seedlings using the fungus Colletotrichum gloeosporioides (Penz.) Sacc. Weed Research 29 (6), 449-454. Morris, M.J., 1997. Impact of the gall-forming rust fungus Uromycladium tepperianum on the Morri romycladium tepperianum (Sacc.) McAlp. to the biological control of Acacia saligna (Labill.) Wendl. (Fabaceae) in Morri A., 1999. Plant pathogens and biological controlof weeds in South Africa: a review of projects and progress during the last decade. African Mller-Schrer, H., Lewisohn, T.M., Lawton, J.H. 1991. Searching for weed biocontrol agents when to move on? Biocontrol Science and Technology 1, 271-280. Mlle cations for biological control. Trends in Ecology and Evolution 19(8), 417-422. Murn restry. PhD. Dissertation, Aula, Wageningen: Wageningen University, 172p. Nei, M 83-590. OHanlon, P.C., Briese, D.T., Peakall, R., 2000a olecular s OHanlon, P.C., Peakall, R., Br arkers OCo invasive tree Acacia saligna in South Africa. Biological Control 10, 75-82. s, M.J., 1999. The contribution of the gall-forming rust fungus U South Africa. African Entomology Memoir 1, 125. s, M.J., Wood, A.R., den Breeen Entomology Memoir 1, 129. r-Schrer, H., Schaffner, U., Steinger, T., 2 004. Evolution in invasive plants: impli iati, G., 2002. From Imperata cylindrica grasslands to producti ve agrofo ., 1978. Estimation of average heterozygosity and genetic distance from a small number of individuals. Genetics 89, 5 Nissen, S.J., Masters, R.A., Lee, D.J., Ro we, M.L., 1995. DNA-based marker systems to determine genetic diversity of weedy species and their application to biocontrol. Weed Science 43, 504-513. OConnell, R.J., Bailey, J.A., 1991. Hemibiotrophy in Colletotrichum lindemuthianum. In: Mendgen, K., Leseman, D.E. (Eds.), Electron Microscopy of Plant Pathogens. SpringerVerlag: New York, pp. 211-222. Know your enemy: the use of m ecology in the Onopordum biological control project. In: Sp encer, N.R. (Ed.), Proceeding of the X International Sym posium of Biological Control of Weeds. Montana State University, Montana, pp. 281-288. iese, D.T., 2000b. A review of new PCR-based genetic m and their utility to weed ecology. Weed Research 40, 239-254. nnell, R.J., Uronu, A.B., Waksman, G., Nash, C., Keon, J.P.R., Bailey, J.A., 1993. Hemibiotrophic infection of Pisum sativum by Colletotrichum truncatum Plant Pathology 42, 774-783. 133

PAGE 134

Ohwi, J., 1965. Flora of Japan. Washi ngton, DC: Smithsonian Institution. 1067p. Olayide, S.O., 1980. Characteristics, problems and significance of farmers. In: Olayide, S.O., niversity of Ibadan, Ibadan, Nigeria. pp. 2. Persle ans in Queensland. Plant Disease Reporter 57, 1040-1042. Peters 1), 60. sts Wiley & Sons: New York, pp. 47-60. Rand eed Technology 10, 370-383. Reede control biolgico clsico de la Rottboellia cochinchinensis con el carbn Sporisorium ophiuri : potencial y riesgos.. ATIE), Informe Tcnico No. 308, Turrialba, Costa Reede on obellia cocinchinensis (itch grass) and th e potential biological Sporisorium ophiuri Sanka a New Research 95, 1021-1022. Paulo, Brazil, pp. 499Santia 23-34. Eweka, J.A., Bello-Osagie, V.E. (Eds.), Nigerian small farmers' problems and prospects in integrated rural development, Centre for Ag ricultural Rural and Development, U y, G.J., 1973. Naturally occu rring alternative hosts of Xanthomonas albiline H.A., 2001. Clidemia hirta invasion at the Pasoh Forest Reserve: an unexpected plant invasion in an undisturbed tropical forest. Biotropica 33 ( Pimental, D., Zuniga, R., Morrison, D., 2005. Update on the environmental and economic co associated with alien-invasive species in the United States. Ecological Economics 52, 273 288. Quimby, P.C., Jr., 1982. Impact of diseases on pl ant populations. In: Charudattan, R., Walker, H.L., (Eds.), Biological control of weeds w ith plant pathogens. John all, J.M., 1996. Weed control for the preser vation of biological diversity. W r, R.H., Ellison, C.A., 1999. Estado actual de la investigacin en In: Snchez, V., (Ed), Control biolgico de Rottboellia cochinchinensis Centro Agronmico Tropical de Enseanza (C Rica, pp. 101-135. r, R.H., Ellison, C.A., Thomas, M.B., 1996. P opulation dynamic aspects of the interacti between the week Rott control agent (head smut). In: Moran, V. C., Hoffman, J. H. (Eds.), Proceedings of the IX International Sym posium on Biological Control of Weeds. University of Cape Town, Rondebosch, South Africa, pp. 205. Salamin, N., Hodkinson, T.R., Savolainen, V ., 2002. Building supertrees: an empirical assessment using the grass family (Poaceae). Systematic Biology 51, 136. ran, K.V., Sutton, B.C., 1991. Myrellina imperatae sp. Nov. on Imperata from Papu Guinea and Australia. Mycological Santiago, A., 1965. Studies on the autoecology of Imperata cylindrica (L.) Beauv. In: Proceedings of the Ninth International Gr assland Congress, San 502. go, A., 1980. Gene ecological aspects for the Imperata weed and practical implications. BIOTROP 5, 134

PAGE 135

Schmitz, D.C., Brown, T.C., 1994. As assessmen t of invasive non-indigenous spec ies in Floridas public lands. Technical Repor t No. TSS-94-100. Florida Department of Schne netics and Biometry Laboratory Department of Anthropology, University of Ge neva, Geneva, Switerzerland. Sharo trichum species as mycoherbicides (abstract). Phytoparasitica 26, 4. Shilli Johnson, E.R.R.L., 1997. Ecology, Physiology, and Ma nagement of Cogongrass ( Imperata cylindrica ). Final Smith, K.L., 1989. Epidemiology of gray leaf spot of field corn caused by Cercospera zeaeSmith, R.J., Jr., 1982. Integration of microbial herbicides with existing pest management programs. In: Charudattan, R., Walker, H.L. (Eds.), Biological Control of Weeds with Soenarjo, E., 1986. Alang-alang gall midge potentia l as an alternate host for parasitoids. Soltis ltiple Sterling, T.M., Thompson, D.C., Abbott, L.B., 2004. Im plications of invasive plant variation for Sun, J ence ods) ogy 17, 1105-1109. d States. Tanner, G.W., Werner, M.R., 1986 Cogongrass in Florida an encroaching problem. Florida Environmental Protection, Ta llahassee, Florida, USA. ider, S., Kueffer, J.M., Roessli, D., Exco ffier, L. 1997. Arlequin: a software for population genetic data analysis, version 1.1. Ge n, A., 1998. The potential of weed-pathogenic Colleto ng, D.G., Bewick, T.A., Gaffney, J.F., McDonald, S.K., Chase, C.A. Report. Florida Institute of Phosphate Researc h, IFAS, University of Florida, Gainesville FL. 128p. maydis PhD. dissertation, University of Maryland. Plant Pathogens. John Wiley & Sons, New York, pp. 189-203. International Rice Research Newsletter 11(5), 22-23. P.S., Soltis, D.E., Chase, M.W., 1999. A ngiosperm phylogeny inferred from mu genes as a tool for compar ative biology. Nature 402, 402. weed management. Weed Technology 18, 1319-1324. .H., Li, Z-C., Jewett, D.K., Britton, K.O., Ye, W.H., Ge, X-J., 2005. Genetic diversity of Pueraria lobata (kudzu) and closely repeated taxa as revealed by inter-simple sequ repeat analysis. Weed Research 45, 255-260. Swofford, D.L., 1998. PAUP*: Phylogenetic anal ysis using parsimony (*and other meth version 4.0. Sinauer Associates, Inc. Taberlet, P., Gielly, L., Pautou, G., Bouvet, J., 1991. Universal primers for amplification of three non-coding regions of chloroplast D NA. Plant Molecular Biol Tabor, P., 1949. Cogongrass, Imperata cylindrica (L.) Beauv. in the southeastern Unite Agronomy Journal 41, 270. Cooperative Extension Serv ice Fact Sheet WRS-5, 4p. 135

PAGE 136

TeBeest, D.O., Templeton, G.E., 1985. Mycoherbicides: progress in the biological contro weeds. Plant Disease 69, 6-10. l of TeBeest, D.O., Yang, X., Cisar, C.R., 1992. The stat us of biological contro l of weeds with fungal Temp In: Charudattan, R., Walker, H.L. (Eds), Biological Control of Weeds with Plant Pathogens. John Wiley & Templeton, G.E., 1992. Use of Colletotrichum strains as mycoherbicides. In: Colletotrichum : Terry erbicides and m echanical control of Imperata cylindrica as a first step in grassland rehabilitation. Agro forestry Systems 36, 151-179. Thom ., Higgins, D.G., 1997. The CLUSTAL_X windows interface: flexible strate gies for multiple sequence alignment aided Thral s affe ct biological control success. Weed Technology 18 (5), 1269-1274. Trujil ni with Cercosporella sp. in Hawaii. In: Delfosse, E.S. (Ed.), Proceedings of the VI International Symposium on Biological Trujillo, E.E., 2005. History and success of plant pathogens for biological control of introduced Trujillo, E.E., Norman, D.J., Killgore, E.M., 1994. Septoria leaf spot, a potential biocontrol Uden [Wight] Burck) for control of speargrass ( Imperata cylindrica [L.] Raeuschel) in a deri ved savannah environment. MSc Udensi, E.U., Akobundu, I.O., Ayeni, A.O, Chikoye, D., 1999. Management of Imperata nps.ars.usda.gov/programs.htm?npnumber=304 pathogens. Annual Review of Phytopathology 30, 637-657. leton, G.E., 1982. Status of weed control with plant pathogens. Sons, Inc., New York, pp. 29-44. Biology, Pathology and Control. British So ciety of Plant Pathology, UK, pp. 358 380. P.J., Adjers, G, Akobundu, I.O., Anoka, A. U., Drilling, M.E., Tjitrosemito, S., Utomo, M., 1997. H pson, J.D., Gibson, T.J., Plewniak, F ., Jeanmougin, F by quality analysis tools. Nucleic Acids Research 25, 4876. l, P.H., Burdon, J.J., 2004. Host-pathogen life hi story interaction lo, E.E., 1985. Biological control of Hamakua pa-maka Control of Weeds. Agriculture Canada, Ottawa, Canada, pp.661-671. weeds in Hawaii. Biological Control 33, 113-122. control of banana poke vine in fore sts of Hawaii. Plant Disease 78, 883-885. si, E.U., 1994. Mucuna ( Mucuna pruriens var utilis thesis, IITA. cylindrica with velvetbean ( Macuna pruriens var. utilis ) and herbicides. Weed Technology 13, 201-208. USDA-ARS., 2001. U.S. Department of Agricult ure, ARS National Programs, Crop Protection and Quarantine. http://www. 136

PAGE 137

Valverde, B.E., Merayo, A., Reeder, R., Riches, C.R., 1999. Integrated management of itchgra ( Rottboellia cochinchinensis ) in ss maize in seasonally dry Central America: Facts and perspectives. In: Proceedings of the Br ighton Crop Protection ConferenceWeeds, Van Klinken, R.D., Julien, M.H., 2003. Learning fr om past attempts: does classical biological re? Van Loan, A.N., Meeker, J.R., Minno, M.C., 2002. Cogon Grass. In: Van Driesche, R. et st de Walker, H.L., Boyette, C.D., 1986. Influence of sequential dew periods on biocontrol of Wang ure of the invasive weed Mikania micrantha in Southern China: consequences of rapid range expansion. Wapshere, A.J., Delfosse, E.S, Cullen, J.M., 1989. Recent developments in biological control of Ward .D., 2005. The importance of species identity in the biocontrol process: id entifying the subspecies of 5-2159. nary Trends in Plants. London: Academ Wate oceedings of the Symposium of Biological Control in the Tropics MARDI Wei, Y.D., Byer, K.N., Goodwin, P.H., 1997. Hemi biotrophic infection of round-leaved mallow Wester, L.L., Wood, H.B ., 1977. Kosters curse ( Clidemia hirta ), a weed pest in Hawaiian Forest. Environmental Conservation 4, 35-41. Farnham, United Kingdom: British Crop Protection Council, pp. 131. control of Noogoora burr (Asteraceae: Xanthium occidentale ) have a promising futu Biocontrol Science and Technology 13, 139-153. al.(Eds.), Biological Control of Invasive Plan ts in the Eastern United States. USDA Fore Service Publication FHTET-2002-04, 413p. Vayssiere, P., 1957. Les mauvaises herbes en Indo-M alasie. Journal d Agricu lture Tropical et Botanique appliqu 4 (9-10), 392-401. sicklepod ( Cassia obtusifolia ) by Alternaria cassiae Plant Disease 70, 962-963. T., Su, Y., Chen, G., 2007. Po pulation genetic variation and struct Journal of Heredity Advanced Access, September 28, 2007. doi:10.1093/jhered/esm080. weeds. Crop Protection 8, 227-250. ill, T.J., Graham, G.C., Zalucki, M., Palm er, W.A., Payford, J., Scott, K Acacia nilotica (Leguminosae:Mimosoideae) by geneti c distance and the implications for biological control. Journal of Biogeography 32, 214 Warwick, S.I., 1990. Genetic variation in weeds with particular reference to Canadian agricultural weeds. In: Kawano, S. (Ed.), Biological Appro aches and Evolutio ic Press, pp. 3. rhouse, D.F., 1999. When is classical biolog ical control the preferred option for exotic weeds? In: Pr Training Centre, Serdang, Selangor, 18-19 March 1999, Malaysia. CABI Publishing, Kuala Lumpur, Malaysia, pp. 52-53. by Colletotrichum gloeosporioides f. sp. malvae in relation to leaf senescence and reducing reagents. Mycological Research 101, 357-364. 137

PAGE 138

Wilcut, J.W., Dute, R.R., Truelove, B., Davis, D.E., 1988. Factors limiting the distribution of cogongrass, Imperata cylindrica and torpedograss, Panicum repens. Weed Science. 3 577-582. 6, Wolfe, A.D., Liston, A., 1998. Contributions of PCR-based methods to plant systematics and cs Wolfe, A.D., Xiang, Q-Y, Kephart, S. R., 1998a. Diploid hybrid speciation in Penstemon 5, Wolfe, A.D., Xiang, Q-Y, Kepha rt, S.R., 1998b. Assessing hybridi zation in natura l populations 25. ken r Wood, A.W., Morris, M.J., 2007. Impact of the gall-forming rust fungus Uromycladium Yand th e production of fungal inoculum for biological weed control studies. Weed Science Society of America Abstracts Yand Evaluation of fungal pathogens as biological control agents for cogongrass ( Imperata cylindrica ). Weed Technology 19, 19Yand ess Part 1: Classical vs. bioh erbicidal approach. APSNET online feature, August 2006, http://apsnet.org/online/feature/weed1. evolutionary biology. In: Soltis D.E., Soltis, P. S., Doyle, J.J. (Eds.), Molecular systemati of plants. II. DNA sequencing. Ch apman and Hall:New York, pp. 43-86. (Scrophulariaceae). Proceedings of the Nati onal Academy of Sciences of the USA 9 5112-5115. of Penstemon (Scrophulariaceae) using hypervariable inter-simple sequence repeat markers. Molecular Ecology 7, 1107-11 Womack, J.G., Burge, M.N., 1993. Mycoherbicide formulation and the potential for brac control. Pesticid e Science 37, 337-341. Womack, J.G., Eccleston, G.M., Burge, M.N., 1996. A vegetable oil-based invert emulsion fo mycoherbicide delivery. Biological Control 6, 23-28. tepperianum on the invasive tree Acacia saligna in South Africa: 15 years of monitoring. Biological Control 41, 68-77. Yandoc, C.B., 2001. Biological Control of Cogongrass, Imperata cylindrica (L.) Beauv. PhD Dissertation, Gainesville, FL: University of Florida, 194p. oc, C.B., Charudattan, R., 1998. Use of natu ral substrates for 38, 80. oc, C.B., Charudattan, R., Shilling, D.G ., 2005. 26. oc-Ables, C.B., Rosskopf, E.N., Charudatta n, R., 2006. Plant pathogens at work: progr and possibilities for weed biocontrol, Yang e absence of dew. Phytopathology 83, 953958. Ye, W tic structure of the invasive Chromolaena odorata in China. Weed Research 44, 129-135. S., Johnson, D.R., Dowler, W.M., Connick, W.J. Jr., 1993. Infection of leafy spurge by Alternaria alternata and A. angustiovoidea in th .H., Mu, H.P., Cao, H.L., Ge, X.J., 2004. Gene 138

PAGE 139

Zietkiewicz, E., Rafalski, A, Labuda, D., 1994. Genome fingerprinting by simple sequence repeat (SSR)-anchored polymerase chain reaction amplification. Genomics 20, 176-183. 139

PAGE 140

BIOGRAPHICAL SKETCH Alana Den Breeen was born in Cape Town, South Africa, in 1965. She entered the University of Stellenbosch at Stellenbosch in 1987, majoring in plant pathology and botany and received her Bachelor of Science degree in natural sciences in 1990. In 1991, she started a masters program at the Department of Plant Pathology of the University of Stellenbosch and graduated in Marc h 1994. She worked as a research assistant for Dr. Pedro Crous at the Univer sity of Stellenbosch where she was involved in mycological research and taught an Introductory Mycology to undergraduate agriculture students. She worked as a researcher at the Agricultural Rese arch Council Plant Protec tion Research Institute based in Stellenbosch from 1997 to 2003. She worked on several fungal biocontrol projects using classical and bioherbicide control stra tegies on invasive w eed species including Lantana camara, Chromolaena odorata and Eichhornia crassipes (waterhyacinth). Her research involved traveling to exotic places in Brazil, Jama ica, Cuba, and China to survey for and collect fungal pathogens associated with th e above-mentioned invasive weeds. In 2004, she embarked on a new adventure when she started on a doctoral program at the Plant Pathology Department at the University of Florida. She won the Outstanding Graduate Student Award in 2004 and the Davi dson Travel Scholarship in 2007. She served as president of the Plant Pathology Graduate Student Associat ion from August 2005 to June 2006. She is a student member of the American Phytopathol ogical Society (APS) and the Florida and International Weed Science Societies. She al so served on the APS Joint Committee of Women in Plant Pathology and Cultu ral Diversity in 2005-2006. 140


xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E20110209_AAAADE INGEST_TIME 2011-02-09T19:05:06Z PACKAGE UFE0021764_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES
FILE SIZE 1053954 DFID F20110209_AABWHJ ORIGIN DEPOSITOR PATH denbreeyen_a_Page_022.tif GLOBAL false PRESERVATION BIT MESSAGE_DIGEST ALGORITHM MD5
e3261e9400e4a3df33988526e2f75dda
SHA-1
5b0adcd60f5226e6fe07e7826d0fcdd7c1e39858
F20110209_AABWGV denbreeyen_a_Page_005.tif
bba8c2529963cd5bedd5e382d9e46c6c
b6db687b33ba6b4effbf43b445eecde8c06c5ba3
F20110209_AABWHK denbreeyen_a_Page_024.tif
f61f60dbfc6a0b22133045bc691692d8
a1256737a1c875f75861f97ec1a821f20f1d3886
25271604 F20110209_AABWGW denbreeyen_a_Page_006.tif
0e52df2f91137e753bb229799b05c534
4d4ca21c4133546dcaeda9ab1d327e4eb5f0c9a2
F20110209_AABWHL denbreeyen_a_Page_025.tif
5bff1fc06b065cdd1f54207403c1f7ae
2b5c3837d9adc4421f77d3a1df810f3881598d29
F20110209_AABWGX denbreeyen_a_Page_007.tif
381a9dd537654ac842b743f05ad5adec
47b47eda467281a659288cbf5fc806a095c024e1
F20110209_AABWIA denbreeyen_a_Page_045.tif
6ee8803bbe6adaf5edb3513d48a9958f
77ca1fa5c1f381a60e3d4a2c8365adc6755c8f84
F20110209_AABWHM denbreeyen_a_Page_026.tif
b777d3cf5587745f4374d92d7bd2c4b7
ae77b7bb42977cef03f304a91cd0ab2f357fb0d6
F20110209_AABWGY denbreeyen_a_Page_009.tif
ab40b51f1d88b56c562544ccf7bbbfff
0f7ba9d03f2b026fc59106bdb4db61330247dcf0
F20110209_AABWIB denbreeyen_a_Page_046.tif
74804806b67ca1ebcf74c02533ccb590
f5dd82bf94f889ce88fdcd293701d2a92cff66c7
F20110209_AABWHN denbreeyen_a_Page_027.tif
4882824ef9e798ad046f9a672eb2d6b0
9919821a2065940b8694636966ab7aac83c30f6f
F20110209_AABWGZ denbreeyen_a_Page_010.tif
6ef3f9c264f60bbba130551f961f48b8
7cfa02b56eba68ec8bf64a318adf0c34bf304bcf
F20110209_AABWIC denbreeyen_a_Page_047.tif
9c07ce4d6908944c88888ecc1dd6c236
0e9340deabdced9af6b3579b9e9aca91cfcbc0c9
F20110209_AABWHO denbreeyen_a_Page_030.tif
49f76e23ddb4f90e28e819f41212cb55
cf941d00ed069e9f4ac42536822abbda5c46f1cb
F20110209_AABWHP denbreeyen_a_Page_032.tif
96a7cb9e659915308f38dcd5d4e11dfb
c489d32310c9bc31d53754f96fb147c76ff65608
F20110209_AABWID denbreeyen_a_Page_048.tif
8a192c4bcfcd4cfa5a6942d648efd5ae
7e07ed30efade1549f47e83dfdb827358a1dcd76
F20110209_AABWHQ denbreeyen_a_Page_033.tif
0159c509fade4750a3e49cd3e878c0ec
c89610cf79acae1c8ec5ff07b8307f4b5a96f2fb
F20110209_AABWIE denbreeyen_a_Page_050.tif
640c1d5ace32d8ccba8263915f746cb8
83b95e1a80cb7d7c95e09cd825e01ea9efcd4606
F20110209_AABWHR denbreeyen_a_Page_034.tif
0991669e891f791ad238add65e05d82c
648ea29a64cf28134dda2f835dfec8467d12fd1a
F20110209_AABWIF denbreeyen_a_Page_051.tif
ecdeafa780d5e154b80e4b5afb55e65d
74f478e53970878c908e0aeaa6c2343c9c30a9ca
F20110209_AABWHS denbreeyen_a_Page_035.tif
4ad57ac1e5958eeffd9725e86e604679
243ae727b14e92ebf40e9317a56357a4190e4e84
F20110209_AABWIG denbreeyen_a_Page_052.tif
ac2dda8c9a4a8f903af5b187915bb94d
b91cb9e02d14270d7a73c2ebafc9a43877eff0ac
F20110209_AABWHT denbreeyen_a_Page_036.tif
47193815ed318c06f12bcdae23f0e404
cff0aeba6b12005c99cadbdcffea5a08168aaa1d
F20110209_AABWIH denbreeyen_a_Page_053.tif
6d12f4087d873d772038348a7425d27e
387ab93237f361eae1ce5ec06a6e8e4c67262e70
F20110209_AABWHU denbreeyen_a_Page_037.tif
ffd26d34a87146480f73528b3c1a2167
c65f488626111ba1e247786f184a2b3c89d8dc5e
F20110209_AABWII denbreeyen_a_Page_054.tif
33cd84c85044d23e7f91162449284456
8ad545f1da40375d6441ab6e47b9c1cabba36434
F20110209_AABWHV denbreeyen_a_Page_038.tif
97f44206fe82f01f182751d592070074
bb4ef0960c0bf1fa6f6065dbd818fc483ab1c0fb
F20110209_AABWIJ denbreeyen_a_Page_055.tif
385333639e21319add55c44bc2ec4833
5291aef51e4e04eb3c0bc0d3f3841692d9a1dc2b
F20110209_AABWHW denbreeyen_a_Page_040.tif
a5aeb9739a502e3d3ae2cdd13048a8cb
6fd1cd4cfa90e78ac106ec060c56c734872dfab6
F20110209_AABWIK denbreeyen_a_Page_056.tif
b21ddc08279b874d568d0b7c4209b5ff
03d5018d324561b1c6e636865aea30c628ed97ed
F20110209_AABWHX denbreeyen_a_Page_041.tif
6f05721176c71ce366456abc2c302cb5
b8b5c2eec35eb26d7cbd2ff30c421bb54d92172e
F20110209_AABWJA denbreeyen_a_Page_080.tif
ae4a06a4cd193b9064cc9e80587b3d45
879b34df973b144b5d27ab459ae3e61ca52874f8
F20110209_AABWIL denbreeyen_a_Page_057.tif
c42e371f02eac9f4e908cb9d7231cd33
4a28d1037a6d429733c66a6d50b0e47b6a95e84e
F20110209_AABWHY denbreeyen_a_Page_042.tif
8588028b5b52b965c77283cae0a7d21e
2a537c5eae4b120fe2359e5963c38ae6ab109bcc
F20110209_AABWJB denbreeyen_a_Page_081.tif
de84a4e06ea2219168c579327b6bd7fb
1a8738451773507bb930b0f65ae5791a3c605f69
F20110209_AABWIM denbreeyen_a_Page_058.tif
4288ba205200fa56975aa0e2738ec092
df591e71f4c8378aa0b20eb4ef8a7b36543059da
F20110209_AABWHZ denbreeyen_a_Page_044.tif
db56f2fbe98a50413e6ca3933e05acd6
88a2de86a9dda7f6139555c8de8d80c56e65f735
F20110209_AABWJC denbreeyen_a_Page_082.tif
f5e6673a9c27770cd6312e7926f17a74
c5e01401f9b82726868a215c06a4c19661f9a802
F20110209_AABWIN denbreeyen_a_Page_060.tif
5ec54244964a851a8c4c6cbbe213f258
7885e666929f9777901d11e22db8fc714e361cfb
F20110209_AABWJD denbreeyen_a_Page_083.tif
48405a47c8b3795ca8adc5a9021e712b
65df856a75a66f3f70efc2262c4cdd26fca238a0
F20110209_AABWIO denbreeyen_a_Page_061.tif
58de7b5481ca37c1572841facba919d9
a245d87766e5f3fda45eb4e17bf1e470c73735e0
F20110209_AABWIP denbreeyen_a_Page_063.tif
a9a731f477fc8ad5ef7abef83f753917
bfb505e187e6353aaacfc54dce964a2afd213894
F20110209_AABWJE denbreeyen_a_Page_084.tif
0c163478b18a3840397a8c60f6a82a09
7794ac997e7322354a99a50e5c224303e1d4bdfa
F20110209_AABWIQ denbreeyen_a_Page_065.tif
1d0bde2a9de459bc95155e85d8ce1af0
eeefb3d53a2b080701b9d016a0f819e50b50ddfc
F20110209_AABWJF denbreeyen_a_Page_086.tif
f51dda828be6c5183e2b84c50ebbd455
f69b8963cf053440812574acea4fb8c88a76521b
F20110209_AABWIR denbreeyen_a_Page_066.tif
583167757066990be918b390b4506679
44695c865f0f5e2e43d4a12f1393158d0ac32096
F20110209_AABWJG denbreeyen_a_Page_087.tif
b4231205fe23009c4c939c2d0e9e5ccf
5d245b2fcfb1435b18baced477d7fb52a65ee87c
F20110209_AABWIS denbreeyen_a_Page_068.tif
313872d54b5cd2dc85a0ef0264f62835
c7f1739547b3c5fbeab7b86279cd6560e13e9324
F20110209_AABWJH denbreeyen_a_Page_089.tif
36b101ee66f74962ab31f34a130bdf1a
ee44fabf5e5dea668e4ce1052162f7ba8c61016c
F20110209_AABWIT denbreeyen_a_Page_069.tif
7a1eb6806eeb66e1c47546c88ede8d29
50491caaf1bc5d5c298842c3aaa1f5253c563e99
F20110209_AABWJI denbreeyen_a_Page_090.tif
6cee3c8398a482c170e1cf8697d35bce
c0212f62f7377b9054fe6b91e4fd743a1f624711
F20110209_AABWIU denbreeyen_a_Page_070.tif
0f2f9237ae6ecaf2ea8557f620c7e998
34f41a1e460d787170dc16a560b4c94c5b24f74e
F20110209_AABWJJ denbreeyen_a_Page_092.tif
81ce5e07f496f57605e45cc2f806b48d
b74053ca04cf2baeb8738b3dbf8212073c75f702
F20110209_AABWIV denbreeyen_a_Page_072.tif
c79d2cc05a1eb51abf95853168ed1e08
fbe1640c4c9ba92ff9e00bf77479346255f85619
F20110209_AABWJK denbreeyen_a_Page_093.tif
394250b86f70280242fe925e19314103
73fdb6e674608b22b2bea54a18fb4f2a6fe3ebd3
F20110209_AABWIW denbreeyen_a_Page_075.tif
ebbf525b1ca80c1b3f51602ad28b2e91
ac6f07efde03492ec95ed7d5d8a07617f4c01d5d
F20110209_AABWKA denbreeyen_a_Page_120.tif
3ef22e6d5a030bd06197daed9445816b
66dbd650150c5ee5cd8060112f419415646d7d1d
F20110209_AABWJL denbreeyen_a_Page_094.tif
2ed622285dba0240eb8f801df0774297
f28b2ef9588b106ce777bbee0a8c245598d9d42f
F20110209_AABWIX denbreeyen_a_Page_076.tif
7d8312bf146b09cfc30fb7933aa56222
8383330e37fd5727d2e0183d4d4daa14c8b5943e
F20110209_AABWKB denbreeyen_a_Page_121.tif
80884bd0b83b56cd6bdfa7d65ab88d63
10e473ed54653b0c0feb2628c3b300a56d4a508e
F20110209_AABWJM denbreeyen_a_Page_095.tif
e019e24b0dde0bfb775a2211ad21d036
9315f85aae3f13035238d131691c8914f197b3b6
F20110209_AABWIY denbreeyen_a_Page_077.tif
fa33584badf4802cb12ae49570f63e5e
16b45f948672a4348764aa95ea474488b6cd92de
F20110209_AABWKC denbreeyen_a_Page_122.tif
0d586b663799052d3b0bf56fc4897b1b
8825940dea7983b11b57a99521a7093cf26b8b89
F20110209_AABWJN denbreeyen_a_Page_096.tif
17a654592429ebb258f6be0029bed74d
67af632e6550dc5783a52fdd5c2897f23f292e11
F20110209_AABWIZ denbreeyen_a_Page_078.tif
703558bdbbcdb93572d51b7958c9eef9
28d24ad902e15843578ee7d7306f2b21baaeb075
8423998 F20110209_AABWKD denbreeyen_a_Page_123.tif
4b115a0a9bab857f44b05ecac49fc2cd
dc6870ade3f2111a84e8f68d5cdf0bc08014177e
F20110209_AABWJO denbreeyen_a_Page_099.tif
209e88fd6312422ccaf2e2240b02d5fa
375ec7e6064ac3a0e3afc75445c284c1c52cf86b
F20110209_AABWKE denbreeyen_a_Page_125.tif
348fa8f485ab3de863163f65b607a55a
faabe8b07c0cc9fc00780a09f9a8f1e6e6a8b423
F20110209_AABWJP denbreeyen_a_Page_100.tif
b216504ad663967c82e9e8f3dbb3435b
4f42c18e407504a7c5010fc6cd361dcdcc6254ff
F20110209_AABWJQ denbreeyen_a_Page_101.tif
ac7b0f4c9e7ddd595b90e7d33bc96a4d
d825d695890cbee1ef9f42b01cc64005cfab192d
F20110209_AABWKF denbreeyen_a_Page_126.tif
d6e9b3bcb0aae7fd75c66aa2f8518a83
41fb38103609d8b3c897a9740aa572a2939596f3
F20110209_AABWJR denbreeyen_a_Page_103.tif
ce655a0f1b3b78d388a300d47342e154
da3bfcc7ec78daee65ad6ce058c7e270ce277bea
F20110209_AABWKG denbreeyen_a_Page_127.tif
40f15b18913c4cbf9d683d61ae84973f
b1143df32e4430d5f6ba76261730ad3a4825cfb1
F20110209_AABWJS denbreeyen_a_Page_104.tif
a04c2d3908ed883940cecbea610418ba
dac8ca80cb43dcccf9db5b868cae0a433f5263ed
F20110209_AABWKH denbreeyen_a_Page_130.tif
89868aee35effe3aaeffc1d1fd7001ac
5c21086252b4195772580b287cdd716d43018a60
F20110209_AABWJT denbreeyen_a_Page_107.tif
a39cff089812940c8a000f83af47ea63
fe8e9f30130c1437324746f4d8f782c8a9de23d2
F20110209_AABWKI denbreeyen_a_Page_134.tif
e890091486411a0eab0f60d2773d5073
4f78306c3d4bc536c18095001bfd60449106b8dd
F20110209_AABWJU denbreeyen_a_Page_112.tif
59465cc6baca874b486f78bea39220ec
2e1a48d58cef6938b8c33e40cae7b1c4ab44a77d
F20110209_AABWKJ denbreeyen_a_Page_135.tif
fe7d75e4ca19677a2476cff96ffce984
67340efed774c516cb328d6f9d8dcb2bca3278ee
F20110209_AABWJV denbreeyen_a_Page_113.tif
1a71aa733b5762f6647036f8d822425f
b9479671c3b5cce3d089c1a92884e4c1d054922a
F20110209_AABWKK denbreeyen_a_Page_137.tif
cf76d68568caab9276868d5b2ce32fac
4413d6ef5335da73ff5db7d4029849e8603d9caf
F20110209_AABWJW denbreeyen_a_Page_114.tif
dc2478b96dd7bb55dd846568daac0188
5a8f6f64021b8ca7844c78374c31027bef6d6a3f
F20110209_AABWKL denbreeyen_a_Page_138.tif
4e8fd806c98615ae1ab9616d7d4c630f
0c73a13f9f806dfdc1762ddb28e5640e3788b490
F20110209_AABWJX denbreeyen_a_Page_116.tif
f49400b2ff70e273fba44fcbee5860d8
f4bdc9226bc03aaf20081e58513c156e1e572839
2105 F20110209_AABWLA denbreeyen_a_Page_019.txt
5f755b553f51ce96d79e2429e4fab7d6
c17c8a1e5b3f187945058fcddafd04fd2b9e925b
493 F20110209_AABWKM denbreeyen_a_Page_001.txt
2be69ddcb835816fc54e28ecb4e85e4d
8e0919eedac86def090d366c08237166996d7807
F20110209_AABWJY denbreeyen_a_Page_118.tif
e732924d64d8ec6fd79f91f296dc4579
32d59b7b70482c8bf6f2df4d2c80d8ce68a77b8c
2246 F20110209_AABWLB denbreeyen_a_Page_020.txt
d597105bec50df60e9c0a0aaa3e8bba1
0760587f78963479a02a5dd7f063b63b0afac199
2077 F20110209_AABWKN denbreeyen_a_Page_004.txt
0f3ddd70aa7986bcf0daed491571dcb9
daa93f08ac558dac43515df6ed371551050d7912
F20110209_AABWJZ denbreeyen_a_Page_119.tif
0f6c802985f3ef7569e97957279fda7f
1ad62439aeea4a2b59fd17ad2093ea4162e02e0d
2172 F20110209_AABWLC denbreeyen_a_Page_023.txt
59b4c477a70f792509b6a401d2ce18cf
0bdbaa48a4c46db7c5eb4923bbacf3e8e75e148d
308 F20110209_AABWKO denbreeyen_a_Page_005.txt
ff15478c25c62fade0dd66247bfcd4cc
76101e33f92efb358b99b9a6e0555614d495b487
2229 F20110209_AABWLD denbreeyen_a_Page_024.txt
cbe6bc2da3cac5fbc2eeb1907bd60c13
f50ac5018d99506a9b7de2162b1b8cc9a0ccfb1f
3842 F20110209_AABWKP denbreeyen_a_Page_007.txt
d8ec8dfbcb3f6cb9b8baaf3ca9ea5240
c46c1ecf810f31fea07f80aa6b6b0c6bde1f7fa2
2230 F20110209_AABWLE denbreeyen_a_Page_025.txt
74b8220b3d538dd8b4069c6980188b87
e1d5bb435689c6f16dca584a91933088196b1389
3211 F20110209_AABWKQ denbreeyen_a_Page_008.txt
bad5ea48c9d730fe163f11fc1431a8d1
055c0bbcae3d9a19bde3a03fcc931ab6ed644b75
2217 F20110209_AABWLF denbreeyen_a_Page_027.txt
cce7ecce65ff63c6c363eebc235d4f17
7ae31fe43e0deff34ba5d5d31bd2108d6a539a5f
3161 F20110209_AABWKR denbreeyen_a_Page_010.txt
50d49644592b72a3b6fca814e4da4d78
d98a689f7bf6091590acdddcf76d7d1241388f57
2157 F20110209_AABWLG denbreeyen_a_Page_029.txt
0625d06b87753661b2dcae0879264041
3a031db98db19aeae9b8d99979c8cc92474214cd
317 F20110209_AABWKS denbreeyen_a_Page_011.txt
146ab1f4eb1404e1698ebe0ed1b40b32
97aa6622d7cdd6a7da3164c7f8382ae44432f970
2251 F20110209_AABWLH denbreeyen_a_Page_031.txt
d243ac39d1fbc042e3a432a1bf088710
7c4f1dfa34c227cdf7cedbe761661c5e8023ccfb
2124 F20110209_AABWKT denbreeyen_a_Page_012.txt
67e63f7cf02b54aecff1061779a4b8b0
759cab090c34873a7caaa864b4987a5b4dc3b369
2240 F20110209_AABWLI denbreeyen_a_Page_032.txt
9260d30eece7f74912cc96be595d9615
b4acac3d1762bc25617c1b5fba7885c77426e13e
2254 F20110209_AABWKU denbreeyen_a_Page_013.txt
4363ed8a7a36ddfec54d7ef339b5ffb5
0a94167902ee0d4d398ac4e32d653d6d4374b02d
2194 F20110209_AABWLJ denbreeyen_a_Page_033.txt
860a677325988a63d448a046f446a79f
7dcd895aebc70d53e34de2925eb14e028aab7b5e
2203 F20110209_AABWKV denbreeyen_a_Page_014.txt
27f7fa26da0aaa79f730a74590b8233f
fb4a9a3a8532302f8936b34142910546a344c21b
2141 F20110209_AABWLK denbreeyen_a_Page_034.txt
76c69e54326dd2c763b4d5c62c253cc3
09355289fd84651e971ea611e43b198622b28747
2159 F20110209_AABWKW denbreeyen_a_Page_015.txt
8f19823dcff201019a0ee8b9a4274278
3e23257ad362c80e6563b99df17d6bd736341a7c
912 F20110209_AABWMA denbreeyen_a_Page_054.txt
f3e493632df0ec895269a790cd7ac170
2aa4cf7e1903f6ad269d2a4c16c0ab4984cd24a5
1560 F20110209_AABWLL denbreeyen_a_Page_035.txt
7711c9d9d353570e4b4342b716049121
904222373c9ce10606bd0ea304c609d3a629284b
2088 F20110209_AABWKX denbreeyen_a_Page_016.txt
37539aaff074878043fdd1f8940c9fa4
de7bf62c5dd4af9fddeb57e3b84013ae6410f613
681 F20110209_AABWMB denbreeyen_a_Page_055.txt
c9a4f9233f456b9057eb80ec69b7c2da
f624c75a3648c5b1e01014625377a27463b1fc95
2173 F20110209_AABWLM denbreeyen_a_Page_037.txt
7aa83d62d6553efe06043be7809b88d9
bae2d3d039a5244c20bf413d5e58996a212c927d
2208 F20110209_AABWKY denbreeyen_a_Page_017.txt
9fa0d232fb866608781edadcd274f6e1
00356ee03f8ef32cc438071ca044710981aa4a23
589 F20110209_AABWMC denbreeyen_a_Page_056.txt
6572167a2a34db19ded45462e8e9334a
3fbce4a9e42a94ee951d120ecac0c551af093d0f
1974 F20110209_AABWLN denbreeyen_a_Page_039.txt
a7d8476bad80b8ac58eaa85a2f8260ac
d1b46feb2cea3788070785b19c0b9b1de8a0aafd
2210 F20110209_AABWKZ denbreeyen_a_Page_018.txt
6c06c218e99737f9b4f220d6b385ed51
0299fc5e84162150e9dd21f3f4fc5ccd3248ef21
F20110209_AABWMD denbreeyen_a_Page_060.txt
4a67492b537a898768dd5abbe1e8d7da
c3559edcb8d6985145c7157b2b3b7b2469d4a83d
1986 F20110209_AABWLO denbreeyen_a_Page_040.txt
519793fbebfef3bea260e4896ef5b3b1
63bb6a51f02264be034d3b0360a218829425f174
2244 F20110209_AABWME denbreeyen_a_Page_061.txt
4eeaff680978271ac98793f0a37879b4
b4a6c1ef04713af9a6673ace93af1ec4b9950ae4
2091 F20110209_AABWLP denbreeyen_a_Page_041.txt
6db2631c6461e1ec0f12bd3a362a3316
e4a24c45eb8f33aa86a9995f79b6b095ad8e3ff9
2070 F20110209_AABWMF denbreeyen_a_Page_062.txt
6149dda56b402939f3dc4d0b3624cedc
a08883f556114e931b5815c065373747d9f3d54c
2053 F20110209_AABWLQ denbreeyen_a_Page_042.txt
8d9fe87d616c04b8d7488e6f1c73270c
147789f36b8d188f194bc2dc6936572aed5d7531
2206 F20110209_AABWMG denbreeyen_a_Page_063.txt
3fa9b2a168f7e2f4606917775743da40
73d3d9e64cd7eeeefef49dfde623ea95e38785f5
2107 F20110209_AABWLR denbreeyen_a_Page_043.txt
470c51f01c77b5207b76bed087ae51b5
730f82722b56684656782dc2234af89fea903e8a
2020 F20110209_AABWLS denbreeyen_a_Page_044.txt
ebda339d7e03067db7b8ec12723310ee
88b3b8faca5b615c7eb54c092e32a9284c0d9f8b
2083 F20110209_AABWMH denbreeyen_a_Page_065.txt
46620518853fa1e9d69f5ad8bac88203
54b9fe9028dc486cbd5102b86cadd8b00e00f19d
2033 F20110209_AABWLT denbreeyen_a_Page_046.txt
a839d95bfc3ca35b9ebb6fc0ba937185
3b9c5d10a79139fa553dfa51f800fb09fd2d1437
F20110209_AABWMI denbreeyen_a_Page_066.txt
3dcc66a42fa23ce41e0a1ace711bac1a
36fd1fed737d17c4038540ed427c869b98b35f30
1943 F20110209_AABWLU denbreeyen_a_Page_047.txt
7563fb3a7de88b941555771bcf5e25ae
f66a66ebc73e3c149e228b6c4a848c91e96ab922
F20110209_AABWMJ denbreeyen_a_Page_068.txt
6afe9363fa05e5a938bff738fd37ea51
62d07edcb000beacfd3b1a1c9700aa0b56d4c5c4
2122 F20110209_AABWLV denbreeyen_a_Page_049.txt
dbe31f1c3e7c01b3c5bc54fe5ff75050
ddc81edfc7ff5905cb307c147597da47970ff0ab
2193 F20110209_AABWMK denbreeyen_a_Page_069.txt
e2cbbe5872bde9ccf01bef1af239c739
19b8a28f6f6173e15430d6813a4d1f5a90b9964b
2140 F20110209_AABWLW denbreeyen_a_Page_050.txt
0ca568dfa169eb3b14a1b5aae2091bcd
a80e952be31901b5674f18417ce176b4fdc934be
2236 F20110209_AABWML denbreeyen_a_Page_070.txt
2d89ddee1ad5fe375c79ebdfb028fe2e
e9d8abb76900077c78b922accccbd3cec2bd2c95
2145 F20110209_AABWLX denbreeyen_a_Page_051.txt
a5ba0ee16c464b24888549406d13761f
5af5e0b1187671b6dbe0e710131f714a2e08f22a
1416 F20110209_AABWNA denbreeyen_a_Page_088.txt
f3c27f7eac3038592affd1fc53f1a572
b37bfe14a4603e9a7e38e0c2b20685af424a2609
2178 F20110209_AABWMM denbreeyen_a_Page_071.txt
27fe0d54b94486b8629cda0320a79e64
436fc83b6172e1b67acf5e83921445a257dd6fd5
1508 F20110209_AABWLY denbreeyen_a_Page_052.txt
550df508eabb24d11cdd3720ac017c34
e1e874db1b547735c33b8973fd833c5782244e7e
1564 F20110209_AABWNB denbreeyen_a_Page_089.txt
0ae155c0bf46ce85a1565385bff72e80
791d2c59df841182091f5710dcdf468a349ac4a4
2213 F20110209_AABWMN denbreeyen_a_Page_072.txt
fc8e6caaad849c136256b6ed5a07d67b
0ee967fede5b8977e331a655d1f21de4f3657f14
1519 F20110209_AABWLZ denbreeyen_a_Page_053.txt
99d3dcc32d59f97ae3c0b22a430894be
2a7cefc8977d0df89bee41174a1c2d3de2e5f8f6
890 F20110209_AABWNC denbreeyen_a_Page_090.txt
d59dbb371c2dea8bb8f938ef548e9187
56589e8b764fe08886b22f12e11adfdc363524f9
2120 F20110209_AABWMO denbreeyen_a_Page_073.txt
842086a566630ca94c9ac33f00d0de77
92d6ec98b32514749239d5295aa468e054ff1f78
2104 F20110209_AABWND denbreeyen_a_Page_093.txt
485f20a5e89e50e0e7df41e328971b22
16463ff6b40e0348bb642b7fea605af36ff0afe1
561 F20110209_AABWMP denbreeyen_a_Page_074.txt
a9c8f8ae7770d6aad2a8bdd6aa5ca239
b56ede976918399fd101d979a29a8e80ce32c125
1988 F20110209_AABWNE denbreeyen_a_Page_094.txt
06289a040e8e03c0bc6f900a073c2463
a9008c89ef491d720d5c11804f5b53dc55c0868b
2644 F20110209_AABWMQ denbreeyen_a_Page_075.txt
b497d198499b5f24eaa3197dae8a2909
571bedbdca19f02fd4359c7f556a78554e127adc
1778 F20110209_AABWNF denbreeyen_a_Page_095.txt
feb456fa6d71a0a2123859393a669fa5
b7ad9fb5d859947e35fec599a9967b7100dc16b1
1083 F20110209_AABWMR denbreeyen_a_Page_076.txt
c702e922764bf615c4ca2f620ecb10b5
038350be4f119041b8261b3f08a145be4113b3cb
2090 F20110209_AABWNG denbreeyen_a_Page_096.txt
ba6d1bf5fab2c0277a39f1570ef34f49
7e9766bbf341a6bf7b4ab66756437a8dd29a6ea1
2258 F20110209_AABWMS denbreeyen_a_Page_080.txt
6830a18639fb7530b0a95b2e0eeb61f6
3b9a94b7f768b7cc538350a40d07e7f971a3483f
2234 F20110209_AABWNH denbreeyen_a_Page_097.txt
03fbc69539aad80ff913c840a1f76e34
2423bf10c0880dbe76deebb671ffbd8f3fbe0a5a
2249 F20110209_AABWMT denbreeyen_a_Page_081.txt
5f77d110f700e379d4f818db96648961
29a1b0f5d149598b0937d643657e4a71aae7bb27
546 F20110209_AABWMU denbreeyen_a_Page_082.txt
058e6501bfd3dc641d7dfe4f3f908c5f
93d8a5e290940edb3c0699610908130e179db984
2175 F20110209_AABWNI denbreeyen_a_Page_098.txt
f0977780cf1d59d3c1e3cacfda1b42f1
b2f0945743a118e37695d8d2a5fcb940fc2b21ec
665 F20110209_AABWMV denbreeyen_a_Page_083.txt
1f6d70c8cc003a77e889d8e18040638d
0b1d25efc41065f5e627d15ec5df6479418a888b
2142 F20110209_AABWNJ denbreeyen_a_Page_099.txt
d905877c71059a019c39b597f156daf9
4d9929352296eb892f00e1f08462715d8d73f320
1621 F20110209_AABWMW denbreeyen_a_Page_084.txt
b0459465cf0091b06a3f505844291c74
e295c375a91ec6ab96c298254a3337ce2d04c5e4
302 F20110209_AABWNK denbreeyen_a_Page_101.txt
5a55f08cec2f3fc6556febbf341379dd
3f27b7cb5fcc4f92c469a96257b8181d011729e7
1502 F20110209_AABWMX denbreeyen_a_Page_085.txt
8c17df16d0997a4470057f6fcb8de7d1
4a5d704f4d8081c9f6d662c0f93317ee7bdb9827
2527 F20110209_AABWOA denbreeyen_a_Page_122.txt
ab7467c4f6f1197f11e6d04b06b07944
2a3c596166b9bb14354814a4045462a70cebffca
235 F20110209_AABWNL denbreeyen_a_Page_102.txt
586dc01641d8cdd6d306285bc349e200
dd2241721cf4b4be74d6531fa795c5fe7f3f5993
1509 F20110209_AABWMY denbreeyen_a_Page_086.txt
7f85dd7b9a75a309253d33db87a67514
a19079f5c497d8b1fcf24a704365bd667f4d0b63
2748 F20110209_AABWOB denbreeyen_a_Page_123.txt
531a13a905d955ec3c7aec0efc8e8448
74021a5ee3a693937ef71148636cd38d5381e30b
2074 F20110209_AABWNM denbreeyen_a_Page_104.txt
88109a8625632761d75a583e997e513e
a9d07cea49aadb2bbdd11b4da35e6156bf52e49c
1079 F20110209_AABWMZ denbreeyen_a_Page_087.txt
8a5fa8f1e23089f31f862621fa591ede
48d50beb895edf36539b1848c0cd873b66255ff4
2637 F20110209_AABWOC denbreeyen_a_Page_124.txt
26cbc99920807586b83c95f27be651d8
4d5f3dd378f8eb39bb459ac1a315899e4699d9d2
2110 F20110209_AABWNN denbreeyen_a_Page_106.txt
970647ff83e00ef2f078de75bc3a3199
3ac313b3c9b94089faca16a0db03d90aa98a4d84
2567 F20110209_AABWOD denbreeyen_a_Page_126.txt
9972d1f5ca2a2adda03ba6c4f6443f31
46a22b7679c96c9c6bdde918f509e865d6a03bc0
2063 F20110209_AABWNO denbreeyen_a_Page_108.txt
bbaf638e257b0cacc7b86203efaf1d66
4b20238d43512a9db79819aa381f1d3fadb328d1
2847 F20110209_AABWOE denbreeyen_a_Page_127.txt
5aaa04c1817b1900ef871a4f2acfd96a
10b229b695edf5292c5b4943a805dd73671b4eb2
2183 F20110209_AABWNP denbreeyen_a_Page_109.txt
a3d9f48096fd98f4eba187e1737c5c1e
b9b31336a48a5dc70e8c9f686ccf42662e6e6a69
2380 F20110209_AABWOF denbreeyen_a_Page_128.txt
95bd29afdccb784a0e01e4a05f919876
5a833738ab3182996a3fe1a9f067441cb7046139
F20110209_AABWNQ denbreeyen_a_Page_110.txt
592f7b635db0d7756b65d4d3bfdf9447
b8699f42c29c6f0220de12999222e970e500e16c
2776 F20110209_AABWOG denbreeyen_a_Page_129.txt
d7d09ab4f912a30faff4a6e797182f1f
f9bac718d601d437d71e3441544068c206a5a217
1985 F20110209_AABWNR denbreeyen_a_Page_112.txt
f2957841a89fa47b550d5105e8d2c97c
2a8ffacaa841ed1875bff2f7f240d5e3be259e4f
2713 F20110209_AABWOH denbreeyen_a_Page_130.txt
0a2ec428fca08eac01596d92336799b4
fc4e1ff9994995a40a75250064d63bb3598a5a86
F20110209_AABWNS denbreeyen_a_Page_113.txt
3c9198795fa49ac90567ba7f722a7afc
2e1ffa95066253f25d8734641aa3cf3a60d296dd
3002 F20110209_AABWOI denbreeyen_a_Page_131.txt
bcfb602ce1f58d824ac2034923234f2d
a8fcfded6099324d7711f60a447dc2f9a64c70a2
312 F20110209_AABWNT denbreeyen_a_Page_115.txt
f3b289400662a6fa09e2703f30509f64
d589ab2414784be27c00f437a5b55a88cf775919
466 F20110209_AABWNU denbreeyen_a_Page_116.txt
18bd4a0a0c3195a06f29c8c1df1e324c
f7ddf2dff05a867047c6f4a825adfbdc86db884d
3054 F20110209_AABWOJ denbreeyen_a_Page_132.txt
cfebf75f2dbc82226d6419acea345066
f20014249af106be17df8ec531f0f188e3385daa
171 F20110209_AABWNV denbreeyen_a_Page_117.txt
159e5b47b764411da2fba3fb4cde3608
06503c0d4bf4db4a9c15cdc5b6989029245a9ab8
2712 F20110209_AABWOK denbreeyen_a_Page_133.txt
efc8d0502b645bbc47932885b0c5e7e0
5b3ff8959a74aff0c16e2e0b2e8e487de3497857
368 F20110209_AABWNW denbreeyen_a_Page_118.txt
b54831bd18efc52f8faa260a36236ea3
1f9b0a0b62dbe90ce58e92e3b1aa8554c4ef3104
52234 F20110209_AABWPA denbreeyen_a_Page_016.pro
db3e1b021055ed5534559c3f836a3fef
ef9a5f10c9a7cf7385a21c736754dd73422ed58b
2767 F20110209_AABWOL denbreeyen_a_Page_134.txt
6c022a6998b1706281386c7c8a763221
8da244b76ee97921833e18ed08b4a00fe48f0d4a
1997 F20110209_AABWNX denbreeyen_a_Page_119.txt
b4b14379a36d0695c683f9687011198d
f8406d8e79933048512b5ddf7e8c5886d8f9eb57
56382 F20110209_AABWPB denbreeyen_a_Page_017.pro
7fede9bf503059152f396b185b910ba3
f891cd4ea1797dacca8a51eee3f448b8aff21355
2657 F20110209_AABWOM denbreeyen_a_Page_135.txt
9cd628e5c67949762cb9c30a0f11ab26
2b02d529674394bb3d068bc875c096240cd59a2c
2354 F20110209_AABWNY denbreeyen_a_Page_120.txt
46876f4ad5bc7f97d099bbdc9c0a4d5d
b9a29a65b0605248cb3708b141336bd56d5916e4
55551 F20110209_AABWPC denbreeyen_a_Page_018.pro
2490be0c20e3fbfd7d72da3168200fd5
188c20b111efcd10bc759dd21b80f6c344415d74
2541 F20110209_AABWON denbreeyen_a_Page_136.txt
ac8968e65a31cabd92fa73ea1de63815
b7f435605498cb03956595d5e4aec6ba3350324f
1955 F20110209_AABWNZ denbreeyen_a_Page_121.txt
b7e7c269d8db7e16cbc96876579c35bd
223fcc693e6bed1ca85f0c7d75ec170b9ff7e3b0
53687 F20110209_AABWPD denbreeyen_a_Page_019.pro
e7ed8a9205a780982363f3e7a75b7588
0e3cbac2a73b317c70ac0d14a3e2a656e83a8d93
2864 F20110209_AABWOO denbreeyen_a_Page_137.txt
afccea00ae3a90efdb8b9f06ab8c65e9
a8c43e34345b9d654ae4b2e1f5df84bec66f9ace
56776 F20110209_AABWPE denbreeyen_a_Page_020.pro
57e442ce6ae1aa3d9ac4d8c849823302
213ece09e5ced86a49f5e4676ce20cf8dd72b586
2599 F20110209_AABWOP denbreeyen_a_Page_138.txt
dfc450550a4f8d0d8a5b5a04b07cc788
9f34eca20cbf8e5001a98cc3b19e43e767160568
54802 F20110209_AABWPF denbreeyen_a_Page_021.pro
5d3b2f51552c1e270efe6efb75ec5692
7021b639efe66804220ca2b9ba5e4649f5fb5a52
917 F20110209_AABWOQ denbreeyen_a_Page_002.pro
25fc4b5115c6f8a9df1f6a84042b4e36
5ddc62e521eaf5277767972acefaa1f4d71eb313
54487 F20110209_AABWPG denbreeyen_a_Page_022.pro
650bfa70f8053eddd115e82df2252f5c
d90abb8967733b9a91a73bd7651d95e63d1b3e35
52001 F20110209_AABWOR denbreeyen_a_Page_004.pro
d39e587d7b30f3c95607aee813eaed89
34b3bb3a1315afb0a1a079a5055b4ec3aee8455e
56991 F20110209_AABWPH denbreeyen_a_Page_025.pro
b341916fd4e952a6892a614976d1911a
77e6c8ab0a7fb11233b92a3b37aeada9d2b46a76
7538 F20110209_AABWOS denbreeyen_a_Page_005.pro
16f631ccca3493e96a90ed140dff7305
7cc098651ed2cd1c1e43440b2ced2f17007a61b8
56424 F20110209_AABWPI denbreeyen_a_Page_026.pro
0659bb0a676ac8d4cfc335bfcd2fb286
d0fa7e581cf1d558f72b6aa92a50530587c8d455
92935 F20110209_AABWOT denbreeyen_a_Page_006.pro
ec28ce976319af16a14b5b1a3b5397c0
ca528ea29a2d4c475e4e2d74acdb22f312a3d90d
57420 F20110209_AABWPJ denbreeyen_a_Page_032.pro
187f4cea5419623b8bf0ce10eb4a64e2
a25bfc95350e3d08dd1cd85d416b731fcea8edca
95276 F20110209_AABWOU denbreeyen_a_Page_007.pro
eccda0dd03508e7a36e0f71ee7149e0a
768b0bfaaaadb26e0da3f0691112875a9355a7ae
78507 F20110209_AABWOV denbreeyen_a_Page_008.pro
35da00953d6061fb8b041e4d2b9cd483
2e09ad5d5ca1e871144efbe43422f02c42ab172b
55510 F20110209_AABWPK denbreeyen_a_Page_033.pro
34821c8caca8644debc4a0e8a19bf780
a59008618a05edc7a1073d3aa5e60cd2aa570ede
14922 F20110209_AABWOW denbreeyen_a_Page_009.pro
dc5b1586afce5eb4919eeb0c569d6368
3bc19e5ae5c57c26f78882f8b3b2e7afa0f21795
54531 F20110209_AABWPL denbreeyen_a_Page_034.pro
ab23da8e7c092d35d134146ce6d6bb6a
cf87a268badc0e00906f45cb7bb1780e7ad1feba
77867 F20110209_AABWOX denbreeyen_a_Page_010.pro
1581e153fc9f204c76927bc3c7dd4a95
71f0d34d22889411b39424a5db14ff610d5e3814
54512 F20110209_AABWQA denbreeyen_a_Page_051.pro
348e74806127524d6842d91f84ad85ae
be1f9453922bef9b94c4e1a581fc858ce7e4b4c8
39246 F20110209_AABWPM denbreeyen_a_Page_035.pro
28a8a03abec2de3f61cca8dc3ce0cfb1
01d1aaf0e460f1f5ad656d5fb2fb01cacae4315a
57761 F20110209_AABWOY denbreeyen_a_Page_013.pro
4ab3e4677465d0f3fcd89f1ec215887b
29dd6296d563daccf2b3736d6ad0cd324cf2fe53
37894 F20110209_AABWQB denbreeyen_a_Page_052.pro
8032802f74c97bcf7c7220cfa968bdab
cf9b0f7ef380cc536c05a71b7f05288c5770ee7c
53567 F20110209_AABWPN denbreeyen_a_Page_036.pro
67962593d11123252f811c59d4439d9b
b1cc201f40e9419d04d5868ba63f663540fec076
54208 F20110209_AABWOZ denbreeyen_a_Page_014.pro
774b436f25864d457b2dd4dd8d2ae5ec
3d8cf6d9b52e6b4d3257deda625327cab3e0f905
13195 F20110209_AABWQC denbreeyen_a_Page_055.pro
e46048ca469ec46f085d4bc347e5649c
51ada9a2b6776d53ba94460bb474df9a3933b018
55538 F20110209_AABWPO denbreeyen_a_Page_037.pro
dca590a28874653af469d9cf82efa379
64f4bfc23bc31f0a5e8e787aba824c9272172d52
10621 F20110209_AABWQD denbreeyen_a_Page_056.pro
41e0e6d50fdd7159f67cae74c4214658
83f84cfa57bbb687dd08c16b987be2119d86247e
92351 F20110209_AABWQE denbreeyen_a_Page_057.pro
7d5bf3f2c2a17ed996f707a353530c2b
7221893b7159d304e677c98d12cd6ec3f2ea6905
57837 F20110209_AABWPP denbreeyen_a_Page_038.pro
2d4dc7787405de87932c3d13f931d196
4e10014fdbda98ae2040156cdddb5b76bf35d373
58151 F20110209_AABWQF denbreeyen_a_Page_059.pro
93f0577411e27dbba31b96fe6d0f1328
e95f7afcf1afec5648dd80fe7725bab8774ecf09
49940 F20110209_AABWPQ denbreeyen_a_Page_039.pro
1dc432ad6b3e385e25343c14e204983f
6193bad616c7c0523ae4d766d4a9d94f3b83c3f4
54615 F20110209_AABWQG denbreeyen_a_Page_060.pro
abd0eed75d43eedac269a10af20281d5
7ab8486b5c405149a0fcb8acef1af360011a7822
49207 F20110209_AABWPR denbreeyen_a_Page_040.pro
f22d3bfe7977c1bf08c6182f152ee28c
d076b232e9a8a29213220dbf4f2e43fad1c3230d
51598 F20110209_AABWQH denbreeyen_a_Page_062.pro
00a5bdec7d4ec6e55063605d3bc38b44
afbdb38da6d6caa98543fc65cc841cd40d20bca6
52801 F20110209_AABWPS denbreeyen_a_Page_041.pro
87048d0e176c4f324bd66e48cc1c1815
7a14b485ae3d15ace4f471b9390527ae6298b924
56260 F20110209_AABWQI denbreeyen_a_Page_063.pro
6535857a5c0cc925ac74581c9339c568
646d12c021544deb957976d2966dde978647b97e
52257 F20110209_AABWPT denbreeyen_a_Page_042.pro
420b2b3b1ff334f7afdce42867b0083c
41ee5e105153acccd80366a4ae4f5cc5dfdc4cd5
51869 F20110209_AABWQJ denbreeyen_a_Page_065.pro
e88cd6dd701dedccbf839b71c4bf3cab
b02e01a7babc2263113efb1f8f3d63e23e05d649
50387 F20110209_AABWPU denbreeyen_a_Page_044.pro
3770f1d7546ad936e30bfcc28861e361
38e5d10193eec6305e97688f1b08c00093dd20c5
53020 F20110209_AABWQK denbreeyen_a_Page_066.pro
10bbfb82f56266bd29ee7fb22b1aec56
5116ce44177cd616f0c7b86b1b7c969a4046eadc
52686 F20110209_AABWPV denbreeyen_a_Page_045.pro
4a5092883357f3f4d05e4411fd8d1914
7a51ca42c39a840d0270fc0874d8fe00892fc020
51740 F20110209_AABWPW denbreeyen_a_Page_046.pro
63f65320e5ef515d35d441232f75868b
c81003726f41098499663016ed75fc0d7c38ad3f
18414 F20110209_AABWRA denbreeyen_a_Page_086.pro
d9dfc8eec1dce4814bb5b2e5617e021d
3773c408177cd58de5624c6d742e81dfc86008d7
51435 F20110209_AABWQL denbreeyen_a_Page_067.pro
7164704dafc1a43fdbbf0869bee65787
e22b59344399f6735a6b5aa6b33993cec503779c
47948 F20110209_AABWPX denbreeyen_a_Page_047.pro
c0c38f63745f8172b7ed0f594ff6c6fd
1fe3347bdba889fd8404dd540317178268637df4
18173 F20110209_AABWRB denbreeyen_a_Page_088.pro
8c2d632e993726ff710aeb30f0189338
42fa3a09519588cf52d9b3948c2309977d7a601b
54788 F20110209_AABWQM denbreeyen_a_Page_069.pro
64156a1153983e34d1be5112b6db707a
e797f3264d67e414ed3314ba6bd97c4f31fec46a
51885 F20110209_AABWPY denbreeyen_a_Page_048.pro
3dc5bdba4cdf1ce43288a6d070544644
89222819513fa0d62e3271f12590bf0da0305603
18837 F20110209_AABWRC denbreeyen_a_Page_090.pro
7470fa81938f151f7dfac11fd44e5f59
d3d9013a324c81524fbce4ba3f940b390199d4bc
57337 F20110209_AABWQN denbreeyen_a_Page_070.pro
a6d8ca3978d9065a0539429e7ffc29ab
5a218f9317baf8ad002bb9e039e8738a8f39fc28
54632 F20110209_AABWPZ denbreeyen_a_Page_050.pro
678fdf5928c585641456a9e25c38002c
5fde6507b8cf6bded32b97c1dd5d0af211f354b3
52623 F20110209_AABWRD denbreeyen_a_Page_092.pro
21922f2cec46c9a7e5d33b9e24411fda
8b8c30830423ebeff0fdec4600e7b5a54a790348
56629 F20110209_AABWQO denbreeyen_a_Page_072.pro
ed65773f4d5317991b11135c1c92d50e
d48c4b086c1708c3f06a52acbaeb6972a41d64eb
53429 F20110209_AABWRE denbreeyen_a_Page_093.pro
eaba5a3cb9a8ffd71b010d75a01d0c92
7e7292d134891e599ed55929ed674df7304946f2
53996 F20110209_AABWQP denbreeyen_a_Page_073.pro
019d3480e1072e58a700d03614d8810d
8d5773a84e7039a76303db77f8d2a2ed79c6e704
50134 F20110209_AABWRF denbreeyen_a_Page_094.pro
a45a3bb6046f6ca647d69c499c49b1dc
9b0112f50a825f9d512ca643f10112b30bf04449
14120 F20110209_AABWQQ denbreeyen_a_Page_074.pro
9cf6d34948ff2a346dbcfdef53de806f
e04d173cf7d3831b2d0c70c3ef981a6bde4364eb
44383 F20110209_AABWRG denbreeyen_a_Page_095.pro
5cd122129785435095a96f6898263c5c
ac8f4a3fbd7a0215e31814a67bb97f6a3db9d435
55210 F20110209_AABWQR denbreeyen_a_Page_075.pro
00a5253d8cd562bb5a6ea624722c22a3
4e624631d80b35826f29c95cd977f4fc45a0b04a
51758 F20110209_AABWRH denbreeyen_a_Page_096.pro
51bf78e77dce94f39db59bec436f0f97
ffffced9b988cfb5e4757e7ce9511748d2c15937
21819 F20110209_AABWQS denbreeyen_a_Page_076.pro
2ff292f0f098cb7a71b0242b7ce734c0
8aeb71d154160857520232f9aabacefdfb32f994
5712 F20110209_AABWRI denbreeyen_a_Page_101.pro
18983b8e86c02d0388611d9004024427
f1b67433fbce1ad1461b499822215a4f30426b9c
23616 F20110209_AABWQT denbreeyen_a_Page_077.pro
c58fcbc90b130e734cca3b64a7e23689
a9f70d45dfb1a1fba96d2d0ac9f041e812bb4196
4309 F20110209_AABWRJ denbreeyen_a_Page_102.pro
074e91222bc72ab52dade830a3ef8c03
8148d563a9bb3b74cc159c41cab49a82e3553a69
52830 F20110209_AABWQU denbreeyen_a_Page_078.pro
d6faa5daabeacb6a00d7feb592eb4874
7aa2c7cca360c88a6147586dfae91b83a6f877d1
52856 F20110209_AABWRK denbreeyen_a_Page_103.pro
a5909501d353ff37b31bda7fde0ae38f
4fc70cf02740e57787c60115446834db82aff14f
52919 F20110209_AABWQV denbreeyen_a_Page_080.pro
ec184ad219ab6b8d2d13839bb9937d51
0545474508a7e0ce11ee7aba3d9d539bec59a1e9
52769 F20110209_AABWRL denbreeyen_a_Page_104.pro
c4a9e1b61065db2dde220e8bf7624e43
dac570c5799a3d356f57990865784c7b1a626cf8
52688 F20110209_AABWQW denbreeyen_a_Page_081.pro
5feec4a423c6103712660ee06d070cb7
d7b81af96c0a5c92cd1857d41294558aa7e317dc
8903 F20110209_AABWQX denbreeyen_a_Page_082.pro
be5ac92c5db4a01ce476164b45567b86
883ebe5874982b14fb3a64262e67b86065cba549
70357 F20110209_AABWSA denbreeyen_a_Page_127.pro
096eeb1619809c48ef6815c314abdfbe
4cc858d73dc81fc81003b1e80dadedb7346c5b4c
53733 F20110209_AABWRM denbreeyen_a_Page_106.pro
79df6007561afc6b1167261ef3a659dc
4354e27f42ab3f879ff8df256eab3aa15d5914d8
11504 F20110209_AABWQY denbreeyen_a_Page_083.pro
4043ee30a3ff9dc19b633d5a7cfd4560
ad971151f6c825a7d798a8a7026cc8bb7def51dc
58964 F20110209_AABWSB denbreeyen_a_Page_128.pro
1a6e096f2404a11457ed78401488f53a
feadc25796be971d9b2afde849ed62fb7cff1168
49905 F20110209_AABWRN denbreeyen_a_Page_108.pro
33438d26361f58b29a5c46d2c339055e
120ee0bfbe616fbd1aa52fb47d3e89d1e3640430
17640 F20110209_AABWQZ denbreeyen_a_Page_085.pro
c8c829de34ac137f427a52ed43540d66
9ec37da59f6798e28f06f4547aab798f7371af68
67586 F20110209_AABWSC denbreeyen_a_Page_130.pro
eecaab75b883a1416058be8bc4607d89
40124401142336c5aa0154ec7ddb3e65ca161fc8
52363 F20110209_AABWRO denbreeyen_a_Page_110.pro
fd48924aaf88ad343455cd780fb44447
511244ea849a0889878d9f847d09b589bf990cc1
74547 F20110209_AABWSD denbreeyen_a_Page_131.pro
492b46bc1de735b0bd65b338bf0b7565
02cf107a18274cbd97a615e5c892bd611916147e
50874 F20110209_AABWRP denbreeyen_a_Page_111.pro
9851efb449147eb4803857d065cc1671
f97dc6073794bd86fcf9faca21d91fcf719198b4
76193 F20110209_AABWSE denbreeyen_a_Page_132.pro
ef4ca01930dfaee0870ee48eb36ba0da
3994e5462f5b4c5f3f7960c427cb5992a383cf80
49143 F20110209_AABWRQ denbreeyen_a_Page_112.pro
3e7f906446339956894b21423558bb10
3e5115627a76cdd7c13c01df4a7ca73a1545163c
67335 F20110209_AABWSF denbreeyen_a_Page_133.pro
238da38acff80b4ef40d573cd0361c6e
4bf5bb131b3479f8b9f5e6589cceb13013b11637
52775 F20110209_AABWRR denbreeyen_a_Page_114.pro
de7582d38796311b5d7b9fa92dc7e16b
6f341de43e8e2719a579e7fc16978919a38fd45d
68575 F20110209_AABWSG denbreeyen_a_Page_134.pro
19339963bd43d60dc391cd1ad3adeffe
3bda08dbc19890a406dc22981bdd43d41141cf71
7616 F20110209_AABWRS denbreeyen_a_Page_115.pro
4537dc8648442ff70cec9015c85c6893
3a23e18c70cd0084d534e3b86aa2585946a749a9
62917 F20110209_AABWSH denbreeyen_a_Page_136.pro
5d564601cfc210cc71f54f8f8a234c1e
171de9849cbf5cc23225070fbdb6840e232dd2c8
2787 F20110209_AABWRT denbreeyen_a_Page_117.pro
dc678c74b0c43a42d7d3939c0e881de9
3db9665a8b81a12ecc26bd5b2c88def54bc62b9d
70895 F20110209_AABWSI denbreeyen_a_Page_137.pro
b8de142a07ac1295f40745f2ba981046
917705d240d664da479234025384ff89f8314dbc
8232 F20110209_AABWRU denbreeyen_a_Page_118.pro
6e1d7b27d5d54c2d5aeb8ced633af559
00c2f8ccf452418441d85ccee381efe2092e96b9
64302 F20110209_AABWSJ denbreeyen_a_Page_138.pro
2b7d2907fbe32ea7c289a5dc5374562b
70714921bf578834f73e01ecba1991d905db1957
47398 F20110209_AABWRV denbreeyen_a_Page_119.pro
824f3319639eab595b8bbc06a1c3a064
ebbcbde32c5cdcb197d958d9cf578eced4e725c9
4804 F20110209_AABWSK denbreeyen_a_Page_139.pro
abafe560f5ee3695c6fc94f176e7c351
48c7f716fed8a4545b5c813c50f8d42a519f4a9e
42902 F20110209_AABWRW denbreeyen_a_Page_121.pro
10b454714545e5b91b3937081ef2a0fc
6104c2de9f04e3f88aa3530e6736be967070d72a
46088 F20110209_AABWSL denbreeyen_a_Page_140.pro
c40da68207e161acfd305203f19c705d
eefcb3067cf6492a5bad6cd559d93afff43366fe
62722 F20110209_AABWRX denbreeyen_a_Page_122.pro
dcd6ae05a43b796d42defb7dd6f08e3a
486df91ed1930f36a1e65c3833ea6848a8c17d7c
114866 F20110209_AABWTA denbreeyen_a_Page_013.jpg
20f45587dbe8be658cac3c1f5e505409
dc67cd080812508ace65ffc93bee4cc57769d3c7
1201 F20110209_AABWSM denbreeyen_a_Page_002.QC.jpg
b79652b53c459518161d4c46265f690b
38ad8ec80e8339a9a5e6c08fb842e2745ee14953
67979 F20110209_AABWRY denbreeyen_a_Page_123.pro
5c1547b4acfbd62e0fb1fabcd313777d
3703971b38e3f33a844880f2bb1c2d3bafe57bab
37307 F20110209_AABWTB denbreeyen_a_Page_013.QC.jpg
4c49e6c9e46bee8b1c4c03a76c5d28c0
d30cd74b4a5de2c3e899319ff0be4657c976eced
75936 F20110209_AABWRZ denbreeyen_a_Page_125.pro
43df6450dc97a0329573d23fb4f6e802
bb3a283f4b183916b54bd9ecf7ddb7b729f69d86
35587 F20110209_AABWTC denbreeyen_a_Page_014.QC.jpg
47abaf3fbf843f0b45e9f2b7d79e1a38
e9628d92ca7780b1d5e39a17e81fade7caf1277d
1453 F20110209_AABWSN denbreeyen_a_Page_003.QC.jpg
a548fd1a11c5e7fce641c5cd3b3b7e63
557cd65d63660d04fa2c342deb3c4ea6c0a17570
35358 F20110209_AABWTD denbreeyen_a_Page_016.QC.jpg
b638131796bb5bb199af132980467d93
98966d768ec68f5ef55a9ecbb2bbc2226fc9b1a8
108865 F20110209_AABWSO denbreeyen_a_Page_004.jpg
abe119b1a77b6d368a5c936d15843395
104d3dc366baf60ea89e8bbc746e56508aae4949
114080 F20110209_AABWTE denbreeyen_a_Page_017.jpg
55e51a7be89e1e388851148aaf94bf5a
93fc05b166ec5cf1787824304dca78c12ccb1575
35449 F20110209_AABWSP denbreeyen_a_Page_004.QC.jpg
c8f17ff051336d1e271e09f53229023f
397974d50720c130918365c09a4656bd7d0ca69a
110716 F20110209_AABWTF denbreeyen_a_Page_018.jpg
8be68fdc2eb44c0399e8987a04fcc0c4
10c19e20a0d1f41281c1a93a36234b1bf63c3e3e
6571 F20110209_AABWSQ denbreeyen_a_Page_005.QC.jpg
21b416f65b1189c4e90f27837786bca2
43404a5f94f44ef39e9cf82ca475924570204f4a
36667 F20110209_AABWTG denbreeyen_a_Page_018.QC.jpg
73dbf2acbacb9489915d47807bc631ba
745d0a8f00c76a42d8465ef6fa994c0366737628
141348 F20110209_AABWSR denbreeyen_a_Page_007.jpg
0061bc7458829dc97838da152dcf2d88
229bc543f6d848aca2d2fcd81630a192a48c4db3
108404 F20110209_AABWTH denbreeyen_a_Page_019.jpg
e1cbb5cdc7135c4184f2c8b187339a63
d52423a85e1c20f9535b8404c80ee37a872b2e6d
149985 F20110209_AABWSS denbreeyen_a_Page_008.jpg
60780f9da26770d1c1792f520db84719
9150b8456c48d599cf3042256295b94c750557cb
35526 F20110209_AABWTI denbreeyen_a_Page_019.QC.jpg
53258b95074811b7f5154e6fa79007dc
d05dd460cd4f6de45da6b6ca00fda207932e4f94
38925 F20110209_AABWST denbreeyen_a_Page_008.QC.jpg
b03cbae000ad2aacc48d7a54cdde7779
86a2468923c4b106f2e3fe630925093bebed5d3a
116295 F20110209_AABWTJ denbreeyen_a_Page_020.jpg
449ee62430ae9d234ea60d9e0bd959d5
a328712a7b798273834ae5b4fcaa6e11255f4e43
132491 F20110209_AABWSU denbreeyen_a_Page_010.jpg
be861ce97034cdafa81d334221a317f0
b5183ad6bb9ff6edacc0712e7a3f6829665cc55d
37506 F20110209_AABWTK denbreeyen_a_Page_020.QC.jpg
466f2ba95adf90fdf01323d3a5cd3cc4
1180aa11a3e25da43b17c70e6cf6a663226772a5
35708 F20110209_AABWSV denbreeyen_a_Page_010.QC.jpg
564a2924150fa8cb06c450fa6d5ed908
acd9c4740dd193e5f6eba54f42ff4a6f4b5713ca
112034 F20110209_AABWTL denbreeyen_a_Page_021.jpg
282d9db65a59f0b91969327daf854569
5c0e03c81897d74bd73a5cf55e26d2b57f498a8e
19104 F20110209_AABWSW denbreeyen_a_Page_011.jpg
76df53a22c11c9022005bf06f1e0f47f
2588b51bd6ed3dc983034ff968f70c26232d9c07
37541 F20110209_AABWUA denbreeyen_a_Page_032.QC.jpg
bd42d233905b3ad1e5a41758776fd032
33d67ebc7b846616a32ac31397bcfc78631b85e0
36359 F20110209_AABWTM denbreeyen_a_Page_021.QC.jpg
cce32be4fd5f884b18116f62de518cb6
488627a1e364a57a344bdc9a8eb442121c09dea6
5885 F20110209_AABWSX denbreeyen_a_Page_011.QC.jpg
5bc4c82b83d78c64de87e3fb3aa85c95
f150f126bc65ab235e61f0c6f0ccca62d001b992
37948 F20110209_AABWUB denbreeyen_a_Page_033.QC.jpg
846243585c852fa2a21d621d95bf7b61
55403e31afd3f28ac765cf11995747509fa6e06d
109699 F20110209_AABWTN denbreeyen_a_Page_022.jpg
93c83dd1d019eb21eee5c4db8c8f5672
1be4cd3e6d64dcd8c5fa70f9fa44d570128bb4c8
99702 F20110209_AABWSY denbreeyen_a_Page_012.jpg
b152ac78e3aa94231cc212aad7d46fd2
59f4b5165b1f82249553ccaa5b1fb3fbbd0fa58a
36346 F20110209_AABWUC denbreeyen_a_Page_034.QC.jpg
d2a67aada190d3ff8480ecaa9c69d2be
a43ec70cb632cd951632ed385c167723d0c45500
31066 F20110209_AABWSZ denbreeyen_a_Page_012.QC.jpg
beb8e331df25852cd2ec3c3983af0740
066ba574bb5bdaddb470c9e54aff0408d0d904ea
81698 F20110209_AABWUD denbreeyen_a_Page_035.jpg
3fdcef322cd66a38325998112f717536
db25225e12d3df8ecbcb0a151e4429826bf7bf0b
113387 F20110209_AABWTO denbreeyen_a_Page_023.jpg
3d52f6597ef4346fba74868e0450832a
ef512062c3959cab67f6615497ae16303dfd67e9
112501 F20110209_AABWUE denbreeyen_a_Page_037.jpg
b640b04bb157f473afd5c181432d96ec
966ee977a4c9dad45afccae828b59c9f9211928c
37164 F20110209_AABWTP denbreeyen_a_Page_023.QC.jpg
04b40bbb6c92387c93b72bf4e484849c
1e318edb40467d58fbe1bde56487ade168c00dc6
37126 F20110209_AABWUF denbreeyen_a_Page_037.QC.jpg
5a4a4def5c2985dae3c770422333f9c8
d716cb62ad56cf601df3035bd83798e03bb171ed
115937 F20110209_AABWTQ denbreeyen_a_Page_024.jpg
a169a0636079be5271f60a88068d5a71
cd1ef6391042b621618d20d101542b945a827c8e
122146 F20110209_AABXAA denbreeyen_a_Page_021.jp2
62946357e19d6ce627286d4baf422f8c
915ecc8ab5e2842995914b9110abc34138ebb894
116294 F20110209_AABWUG denbreeyen_a_Page_038.jpg
fa22f0fa8e5b318cd5d0d8ca8feb2b96
fff7e87726558084f755d45e2ec6c3480d6697c8
37925 F20110209_AABWTR denbreeyen_a_Page_024.QC.jpg
2fa9cb6144109c4f50debc5f176d0423
6708a10a0694680a692fa580536e88f2ef0da2e3
122235 F20110209_AABXAB denbreeyen_a_Page_023.jp2
9bbd81be7cf876475b13972616b7d91e
dedf26cd815e728af17df0ac33b7c6d7bcd23965
38050 F20110209_AABWUH denbreeyen_a_Page_038.QC.jpg
3484f3e323da4e5ec48d11e7d5722c0c
6cb4adf49a94c44ccb030f3b0c513030f60d7564
37786 F20110209_AABWTS denbreeyen_a_Page_025.QC.jpg
3f8965f9e82bedce0c98427fe228af6f
0fa001519c841b638eba6bbdbe1a2919d13aa0f0
124319 F20110209_AABXAC denbreeyen_a_Page_024.jp2
8b27a6bd4f508d147ad64906da5165b9
01a9b5855c6d682dafca6f7ed7ba0808e95fa7fe
102859 F20110209_AABWUI denbreeyen_a_Page_039.jpg
f566c22f53a461f5521d4aa6a91b0389
afce32fdcc66fd31672df1ad3ce875a94a01b13b
37629 F20110209_AABWTT denbreeyen_a_Page_026.QC.jpg
29fb7f94e350fd39e9e6250d955b8372
4e9099ff3a4eded051cb81c82b0a2f84a3d695f1
122837 F20110209_AABXAD denbreeyen_a_Page_026.jp2
95318319ea5dce030fa96b7c23788294
0d8d3985ace9d62c5ba53019266f2b539f134b23
36542 F20110209_AABWUJ denbreeyen_a_Page_041.QC.jpg
101fa4f8957ae2c3ebe11353d1ae8dbb
65adc6361a65ea170062ed5f9e6670664bcd5c86
108165 F20110209_AABWTU denbreeyen_a_Page_028.jpg
73e08f8822a283e669cd73b9e66b0774
0a2552e6bf738878715081e3ce64cd6af50674a8
123358 F20110209_AABXAE denbreeyen_a_Page_027.jp2
5ce7fdccf041ba2636276efea34b37ea
563be3da1800509e390580b8c0d97b4b32d8ead7
111017 F20110209_AABWUK denbreeyen_a_Page_042.jpg
a6830d0305c74f41c2f265d71097110e
6e8170cccd2b112b0fb5183884f8baac5b6f82ef
35957 F20110209_AABWTV denbreeyen_a_Page_028.QC.jpg
c6cb36aa9f06ac98d205499665fdb5f5
d4138bcab6604c5942fa6e69df335cd654eef6a7
119486 F20110209_AABXAF denbreeyen_a_Page_028.jp2
728e5f7f7c63581ea15793e56a9722b5
0bbe9c9c9548660756337574c2a0b63db61c6771
35863 F20110209_AABWUL denbreeyen_a_Page_042.QC.jpg
f20c11c811f74e0c729b171d19faed72
c0e58d61e72d0864ee57437c275de87c3dec3b78
36312 F20110209_AABWTW denbreeyen_a_Page_029.QC.jpg
c92c3a6ce8a01cb68b131b20aa8b63b5
71cdbde36a8b5955a0edbfd18a3d58132b3609eb
122681 F20110209_AABXAG denbreeyen_a_Page_029.jp2
5d3eccf760c68b0f2ba3c4bdae087096
44c960092822e4fe15c825adf5098211b6e5fbb1
113928 F20110209_AABWUM denbreeyen_a_Page_043.jpg
04c660705623b0f85dc4b719d0299ef9
405e12a9377789e26b0837e29f1cb0e88ad5cc9f
116568 F20110209_AABWTX denbreeyen_a_Page_030.jpg
3c1b89d49dcc84aeb3015ecc7d9a17b8
06a67e973d74efff062e96777cf07ab65412ba86
28482 F20110209_AABWVA denbreeyen_a_Page_055.jpg
8419f106c759c1b2f56f253b27040690
58c4865d9787e5e90dbab330983424f152fe2505
123588 F20110209_AABXAH denbreeyen_a_Page_031.jp2
431552dd6a974261d46f56b048a05681
eb3cceba4b0e35c668c6b537ca0b0715a7dec243
116883 F20110209_AABWTY denbreeyen_a_Page_031.jpg
e840784114508b8dbc60a68b53320014
93bc54aff4360fc2b46a28a59ecfc35a9b1f00c9
9196 F20110209_AABWVB denbreeyen_a_Page_055.QC.jpg
b770c38aaeef4ae272ff0fd80cfb54e2
dc04ac71288e9d4e8a8c8828e1e81025736077cf
34956 F20110209_AABWUN denbreeyen_a_Page_044.QC.jpg
ee4b2755b352b622850551d4915f9bd5
8e3b02090382189c6d4aaf80410e49533cfcbb4f
125608 F20110209_AABXAI denbreeyen_a_Page_032.jp2
ea7dd3e7971074d2ec70a33e1ec8090b
0101503d9c9c650532f020c7d92d1876e9746ab7
116229 F20110209_AABWTZ denbreeyen_a_Page_032.jpg
208a60f05edaf4e8f9584c07812c604e
7830240c7cb4bf3e5d58e0582cc15d0e0b282a92
21504 F20110209_AABWVC denbreeyen_a_Page_056.QC.jpg
7f98d597334faf5610a2d316dff36c25
0e8c189bcdb6abb012562ceb9c693220fffb3142
109045 F20110209_AABWUO denbreeyen_a_Page_045.jpg
aa9d3f7d2c419cf2f2e923e77ebe8730
13769b532f934b677db3eb255da3d064e2103823
121859 F20110209_AABXAJ denbreeyen_a_Page_033.jp2
6c47b3475e2def9baccbb399a5a71229
03ae90904741d5ba5de50069f485167c65166e66
66128 F20110209_AABWVD denbreeyen_a_Page_058.jpg
e219c24d7c14b523aa35e13dd39ad868
193a144b136960ec9eeceefcc53f3a8450b0669d
119117 F20110209_AABXAK denbreeyen_a_Page_034.jp2
e8cfbfd54468780673bf557d586b0215
b4753f6dc4034344fa68d04540694defa3d8f253
18362 F20110209_AABWVE denbreeyen_a_Page_058.QC.jpg
96ffc788188c70e05e3bfb39b974d85a
996e99fccfab7d64d7808da4f5414b3624a1a5e6
37107 F20110209_AABWUP denbreeyen_a_Page_045.QC.jpg
12d37fab8f61cb38749ab3f2aaabee74
b7c0ac7ee318a22ef09e06d8ee030f6c8033b437
90288 F20110209_AABXAL denbreeyen_a_Page_035.jp2
dda2028fc3c5ea746d08105fa4cfa175
f7b08ca60369ca1e8f0c3c14e83b182e4c6b4ecb
60163 F20110209_AABWVF denbreeyen_a_Page_059.jpg
236315a4f4b3dd2eaf4f22444769b8e9
49d37158c8e70791e53e4464b9a917db8e0dee88
99968 F20110209_AABWUQ denbreeyen_a_Page_047.jpg
3e425a17f17f48a2bf39c9c046f01524
c9a8241abe71d88367df167d3007be16f712e581
29355 F20110209_AABXBA denbreeyen_a_Page_055.jp2
e4897428e60563b3de418e0541a1211a
b1bfde09349025cc48531429c8e34fdfb8e3a668
119884 F20110209_AABXAM denbreeyen_a_Page_036.jp2
d51cfb0d8931a4a11f6be66392ae1d2d
3466c941c0a59dcfd1865e8aa8696be7571385ff
16218 F20110209_AABWVG denbreeyen_a_Page_059.QC.jpg
5de1c8f4cc3892e5b3eb61918ed80a5a
796139894668d56b68114b5b931ccd246302a2b1
106153 F20110209_AABWUR denbreeyen_a_Page_048.jpg
e43b84e4e2ed5cabe266b99a18661046
04bf73e41b7675a8ce991525430cea53888eaafa
670214 F20110209_AABXBB denbreeyen_a_Page_056.jp2
b12467499bf49fb0f489e09656210742
8010ee8a657c4d68bfd3079424a48fc4521b6dd8
1051966 F20110209_AABXAN denbreeyen_a_Page_037.jp2
afd7734573576287bd405105a6e033d6
dc73c0f2790fa22e48693218380dd20c4eb49645
113047 F20110209_AABWVH denbreeyen_a_Page_060.jpg
79c8108df4d8e3e0086f6cb91d208b8b
49c3229441492f57b4c526f7ff5419a8155cfca1
34026 F20110209_AABWUS denbreeyen_a_Page_048.QC.jpg
a6d865044ad773301c057b8d6533d641
69fa5fd191967c506c462d4383e02e132d9de081
91663 F20110209_AABXBC denbreeyen_a_Page_057.jp2
725a1f244f5197890d1d2afc6b6bc80c
f4eda57ac311fceaa252da27a5566e772009f08c
124013 F20110209_AABXAO denbreeyen_a_Page_038.jp2
ef4661ee0a0a52e7b5088176ef0d4b14
5cd21bc1b7bb2c371d92ff946de17bc6d79481a2
37444 F20110209_AABWVI denbreeyen_a_Page_060.QC.jpg
aace210e8f49b54b1ec656c1feee7321
83dd3e54142fda4521744f28eb3bbefd9cf73a13
111176 F20110209_AABWUT denbreeyen_a_Page_050.jpg
d59ecf4dd09498e0da9cb90f0f6868f1
5028ad9352dfe2488849b531f288b9ca97bf7631
66629 F20110209_AABXBD denbreeyen_a_Page_058.jp2
84e844f5d6ff7450462fd876ee5732de
5ce83d2abfacc74d6679cafbd0248da6ddf835e6
110100 F20110209_AABXAP denbreeyen_a_Page_039.jp2
bce4a4235a470204b0dcd8568a774543
a9d21b74197d60005bcd0f76ef600531b166770b
37189 F20110209_AABWVJ denbreeyen_a_Page_061.QC.jpg
721da0fa5f265869bb0ba190f17f5116
143432e5d53ba520b3eeba38f64ed0179c8fe02d
36364 F20110209_AABWUU denbreeyen_a_Page_050.QC.jpg
f128a76a4966337b6aae62edeced6a70
952b10ff458560d2def954ae5e58286a9f8b80bc
677635 F20110209_AABXBE denbreeyen_a_Page_059.jp2
341296d2e13998f0307a363af3e60fe1
575e0ad4aeedea5d414d3623eaa77137a9f36f19
115400 F20110209_AABXAQ denbreeyen_a_Page_041.jp2
0f9bae94b0c341c998c92ca210889259
0b28d723613469eb6c4cd3b4b293d741b44ffff6
105068 F20110209_AABWVK denbreeyen_a_Page_062.jpg
5fe5de8f71a34e23b6ec525a0a25c933
6695c68376deb9ed5e98f2e7e427c0dc37394377
109599 F20110209_AABWUV denbreeyen_a_Page_051.jpg
63f4744f75d4b661ae8cfbdae2dbb12e
702b43237458176223c5c18205faa9cdaee1a0a9
120998 F20110209_AABXBF denbreeyen_a_Page_060.jp2
3b7c0b0a54d5a7ae86ef0b7e909f4413
64cc2805b1aa1c3ea97bf026e97bdb9c996eda8e
117371 F20110209_AABXAR denbreeyen_a_Page_042.jp2
c45e817d13253a27e2e5e530d4ba541d
d16430e7d7a6347ada63176b03cb07837eca4126
38307 F20110209_AABWVL denbreeyen_a_Page_063.QC.jpg
11383fabdeec855f8c5ac7b67c9454bd
f06975195ba9c516736afd597f3407f6f980dfa3
36150 F20110209_AABWUW denbreeyen_a_Page_051.QC.jpg
28eceae981ce5cb778f2792aa3b1193e
beaffbd1a850d641e29576288c8176ec764f0db7
124482 F20110209_AABXBG denbreeyen_a_Page_061.jp2
33ad4ccf0b89d6f14f206e6817eeaeb4
0126093494b7b56b5a78774c283ddca3290f5917
120818 F20110209_AABXAS denbreeyen_a_Page_043.jp2
0733da064d2f9c420d65ce17c8c6f943
052145d6c8953f987736e03f2afbf8cb0f6e2820
31402 F20110209_AABWWA denbreeyen_a_Page_074.jpg
7a94453fe725ac3f8043f0fae6ce1ce4
8b31c8691e446c3382b94e8c499aa44996900116
33094 F20110209_AABWVM denbreeyen_a_Page_064.QC.jpg
5a92ac5dd3454352e0eb6a26781f5ec0
0b4d506e39003385d53131f208a0eb887ffb9820
77242 F20110209_AABWUX denbreeyen_a_Page_052.jpg
16463033773b7eda2c3e2edf7686417d
01d35ad31a3fb3d9b3772da3b4645853aafdf131
108453 F20110209_AABXBH denbreeyen_a_Page_064.jp2
71c0de5c4677a5300a40dc3c47f2501c
95eb5ff92338a4da9952a7042d3c6358134b1b69
113744 F20110209_AABXAT denbreeyen_a_Page_044.jp2
ed661cf5bdb880f5105cf8d5f90c409a
1715de285608ff8835aee04fc0291eb8c6879d55
88334 F20110209_AABWWB denbreeyen_a_Page_075.jpg
641179e56565cb5cf5a01ed984860df1
f324e168639628d3e8d45ebc8f90c2986a54516d
105003 F20110209_AABWVN denbreeyen_a_Page_065.jpg
be768ec0e01dc641877fdef21fc008b7
f3cc645df9e7641a776722cbcff2500442c67147
34012 F20110209_AABWUY denbreeyen_a_Page_054.jpg
d57a8df6cd9764a6344ad05afe195863
ded9a849e945d31b0d931675403978d1ad1cfdcb
118705 F20110209_AABXBI denbreeyen_a_Page_069.jp2
c141976a169f9c537569f4f81ada2cb7
48616b1aee8be6b65a49a16333f2ba9c1e3fefe4
118049 F20110209_AABXAU denbreeyen_a_Page_045.jp2
fffe5084c7361441fe2d651b5a68e792
06c47655a81cb5beaaa6de7756c91ff762429db0
27479 F20110209_AABWWC denbreeyen_a_Page_075.QC.jpg
9578fb4a0f0c0ae75d3705be42e763d4
cf57f2a93ab27b42aea3b00aeeca6ab343f0bc49
35640 F20110209_AABWVO denbreeyen_a_Page_065.QC.jpg
9c2e50e824c13cf0dc9b38a848900e64
6201f5c4e5bc58d6fdf33406ed57c29dd32a2f5e
10079 F20110209_AABWUZ denbreeyen_a_Page_054.QC.jpg
7cebd390d4207871818a5c16589dbac1
13082576b968ba85b9aca46f0c988b6b071547f2
124342 F20110209_AABXBJ denbreeyen_a_Page_070.jp2
af9b8d0feece844d126c53ec95d42d2b
38ad3e9003ceb5f90a5c5c34dd994cb9e21d304d
120582 F20110209_AABXAV denbreeyen_a_Page_046.jp2
fc375150f57c849888d69b300cb91988
99c721894a5b033501028e7cfe5a6c24b39395ff
51835 F20110209_AABWWD denbreeyen_a_Page_076.jpg
c2810109b38e73c8e7f49f33523bbc44
8604d2e6e714a602bc79c24068736c5b70c20745
34964 F20110209_AABWVP denbreeyen_a_Page_066.QC.jpg
076a60fcb834f3cdaed84dc9dd5cab15
f11a8ae39f26ffd275e7cff19804755f14cb488f
121289 F20110209_AABXBK denbreeyen_a_Page_071.jp2
1a7727a3b819d751b3b310f3e53ffdb1
19f773c01c53d9d88aa6749075b7764f97b9a141
110098 F20110209_AABXAW denbreeyen_a_Page_047.jp2
2a8efd0ede5c927f889da1e8a5d43d2f
75f4e3d66abf234fc62845418b2885e48e347886
16849 F20110209_AABWWE denbreeyen_a_Page_076.QC.jpg
a5686676369a788639d1c1cd52a99969
327038b348f9e3d9033724ca9e0976031791c0f6
123106 F20110209_AABXBL denbreeyen_a_Page_072.jp2
862c4bfd57922c0fe88186b5fee6e937
91a097b4c2a0727d2a99238408815c4c7cce9a11
117455 F20110209_AABXAX denbreeyen_a_Page_049.jp2
43c09163f555b42179ce82d4f631b98e
a165349e21fadca43e79ebb5edbc3a521ac983f2
52401 F20110209_AABWWF denbreeyen_a_Page_077.jpg
b98995a58874e75b98adda8b26976a2b
ada1ff652fa07008ca27e60836582f699517b7e4
105383 F20110209_AABWVQ denbreeyen_a_Page_067.jpg
35434dd5856af78b450a83b17ffbcc15
7479912922b0642eff7b9022feb13f45dfbbe264
478443 F20110209_AABXCA denbreeyen_a_Page_090.jp2
a832d6b2881c0654e9b63397aa77a189
326e1d78d70ebd18e9833caf33fa11c0dc30fd41
117791 F20110209_AABXBM denbreeyen_a_Page_073.jp2
fad908dededd6828315a00a56dfb625b
3dbaa440cfc1c074ee7cc2bc70de7429b80794c3
120699 F20110209_AABXAY denbreeyen_a_Page_050.jp2
82ac0fcedc1a467c1500ee97e70924f2
6b1174690ebaacdc957d6eb05b57718e7de61d9f
16706 F20110209_AABWWG denbreeyen_a_Page_077.QC.jpg
0b877fd7e5ecb84d5c0523fed387a25b
dc5959b8bb1828b0b4109acb548049622c04834d
36726 F20110209_AABWVR denbreeyen_a_Page_068.QC.jpg
57483116ed47deb9e4d05d415ecb5328
6932000571d0ae04564248ac63d82e993b1e5af9
244409 F20110209_AABXCB denbreeyen_a_Page_091.jp2
75eb71378649399efdc5ac1bdaeb76ec
2d0b513c48764efe25281a616774aa949cb5fb31
34370 F20110209_AABXBN denbreeyen_a_Page_074.jp2
3cb001a7ce293227e87ea8e7182e06d6
9daf22602888d105e76616b84ba99b0138f45aa7
85024 F20110209_AABXAZ denbreeyen_a_Page_052.jp2
87e5c3108ab12d9a437557ebb971c53b
68429a2179767b6336d5522c2e6ae0aeed9f835a
108193 F20110209_AABWWH denbreeyen_a_Page_078.jpg
720b8d94f1af7cd9f57da46c5ba02411
083d5364662c41da46aff956529c295790286217
108921 F20110209_AABWVS denbreeyen_a_Page_069.jpg
6ad09aed8c2e3b01e3c8fc9d791e3026
86837fd0d8d74ed79b30ae7d833b750145b30442
115875 F20110209_AABXCC denbreeyen_a_Page_092.jp2
f0ba4bd5a7703d307949f297bbb763f7
7773f33c847217f9d943e0d1d704c9886d9d5902
52383 F20110209_AABXBO denbreeyen_a_Page_077.jp2
38bce03d3fbb3847bc55d76ffb89652e
0c29f495f899df93b5ceef718fa88c8a6a38ec3d
29643 F20110209_AABWWI denbreeyen_a_Page_078.QC.jpg
a594de9b97d646fc010c18b463b06243
e0e596bcca9f868e491d98a55659354abfbcbfb4
37349 F20110209_AABWVT denbreeyen_a_Page_069.QC.jpg
e8f2f9c8da4aebb91bee181518f50199
739c2b56b39d36b239092003236ab3b44e2d8c9f
115346 F20110209_AABXCD denbreeyen_a_Page_093.jp2
5ec55e66c5e7b7714091e06ed8616493
32841d7a0795c72a7ddb1e08c6db36000c296f15
115320 F20110209_AABXBP denbreeyen_a_Page_078.jp2
637cc278c0b8dccc2329b62dbb4e251d
6e83dbcd48a0c5b51aea99588fb37da322b10dcd
29523 F20110209_AABWWJ denbreeyen_a_Page_079.QC.jpg
76e71c90423bf15599948ee697bc0128
2e4e7ebaa3871468ed1f9dc8e7f26c8be40011aa
115437 F20110209_AABWVU denbreeyen_a_Page_070.jpg
ba6d9fa22f015ae1313374778a1ed1c0
3e402a3e37a2de75867d6c8c058c3670ee6ab690
110598 F20110209_AABXCE denbreeyen_a_Page_094.jp2
84e2ba6032c39e740bc2d83aadb97000
d6d8cf10969f69bb55a0d17eea4ee838997989d2
115127 F20110209_AABXBQ denbreeyen_a_Page_079.jp2
321d62c27401177c609bdf044d72a020
c738ffa6d537ae0342ca1313d485f46dd20b0f0c
107585 F20110209_AABWWK denbreeyen_a_Page_080.jpg
0e406ba2d6ba4e17366b08ca5d4c8721
14e30d1e1fb5ded5d7d6a015cbd7bace5b5d896f
37606 F20110209_AABWVV denbreeyen_a_Page_070.QC.jpg
05714c1427963e7a5ed587c2fd4bd49f
8d3765ca8645303fd8e3cbfdb2eafad40c30344c
98222 F20110209_AABXCF denbreeyen_a_Page_095.jp2
c612cc52f7e1704fcf1062ce3d86dc6b
8037d31379a53715451d48bd8d35747d743a3a5a
116065 F20110209_AABXBR denbreeyen_a_Page_080.jp2
0a4ccc6471b3c06d26bee82b5d8e0b44
89f132b7e85397b3130b841c7c21f6bf4ed9900b
29630 F20110209_AABWWL denbreeyen_a_Page_080.QC.jpg
9a81f3f4eba4cf0c6ad0bcf3f1cd159d
66fd05d50c9a2b01a199eea55b0d384bf79c3bfb
112023 F20110209_AABWVW denbreeyen_a_Page_071.jpg
1786bfad3a789f87ac8235623d3fd559
28b1b7687101597bbcb2a9553144049d2762e619
113168 F20110209_AABXCG denbreeyen_a_Page_096.jp2
e86f7c92d43075d952f3874aecc2db91
159a05847f8a8685c0a0c0de92c3ddfb34c7e8d6
508218 F20110209_AABXBS denbreeyen_a_Page_082.jp2
157a4de85d4a75e8785ec3e08d1a53ae
66184db438bd981a7a39458eea3bc9c45132ada8
15751 F20110209_AABWWM denbreeyen_a_Page_082.QC.jpg
faa3302dee36194523903a7a080a1fd9
ec384cd6fe6564ae0f21c4ec1f21f15641fcb01e
113272 F20110209_AABWVX denbreeyen_a_Page_072.jpg
9b018849b988bc81024ab920a19dc96d
661e6ec871865675be1780f9daa5e0a8c46165f3
11494 F20110209_AABWXA denbreeyen_a_Page_091.QC.jpg
c5b0a1f2195c18f93c1c78c9bd47acb7
0cd1d7ce324c0301aa92a022fce0ce0e8a21fa66
120526 F20110209_AABXCH denbreeyen_a_Page_098.jp2
270686e08b625021bffe74fdca834ff5
839290f578388a3be13bf6bf248799154397f170
1051980 F20110209_AABXBT denbreeyen_a_Page_083.jp2
b4ff5a960f6b82b090eb6966788bfb6a
52c91eacffdfd8f1d28bece7b41425e411a035b7
102987 F20110209_AABWWN denbreeyen_a_Page_083.jpg
2f20b405b09ff9f8e5980b7525ed8a2f
a8886789346a19ffbae75e71e802dde29293d21c
36513 F20110209_AABWVY denbreeyen_a_Page_072.QC.jpg
2d41c3587dc6ade0c8bf45a72411dcd2
d9434cd1146f18ca4be943cd2687e944899bb51b
110054 F20110209_AABWXB denbreeyen_a_Page_092.jpg
2211e8ce9170a6d1cbc17b509c3ccf13
be1f4373035dc4a6c5e995a32eba5d1ad16aa400
50002 F20110209_AABXCI denbreeyen_a_Page_100.jp2
21a7bd2e86a16c9a3357ceb7b0857817
e8f9406ac528b519a0693f4d18e47fb7edeabe85
493889 F20110209_AABXBU denbreeyen_a_Page_084.jp2
cd9d1389b997f70e7e632335b4b8a4d8
cfa33b6f9f14fe1fb7ff1709013da08ee8740c33
48412 F20110209_AABWWO denbreeyen_a_Page_084.jpg
2a3294eecefaa9e09cbd360c60b2bd28
7968ac7c33aaa51ddff00305c97c394ea86cbf3f
35595 F20110209_AABWVZ denbreeyen_a_Page_073.QC.jpg
63afb7c0550553123234ae343b500b80
df2f29c72816b95f816c13e48a9aae8372c19f27
34848 F20110209_AABWXC denbreeyen_a_Page_093.QC.jpg
a891c70509ca5cac301402116282dd66
63d2a2ba1d303e87504dfa7e69208abf9f683048
948113 F20110209_AABXCJ denbreeyen_a_Page_101.jp2
dedd576266aa1e599ad06e6671eed2c5
7ad1ee923790eb48cce8a6c2c7604d992e6b10cf
472086 F20110209_AABXBV denbreeyen_a_Page_085.jp2
1c9c899799e760fecf5c56b081a36107
c0f24c30fcced9cef66749ebd6569bc192be8f5c
14385 F20110209_AABWWP denbreeyen_a_Page_084.QC.jpg
3f1ba2e3019342d0e42144b35c3eeb29
2dc0a33e5318cd5b133321497e61492874386dea
101753 F20110209_AABWXD denbreeyen_a_Page_094.jpg
9cd8cc8d5d6d1d68c1d8bab30b1e97e2
a2c9bbbf2c9beede51e1d45102a136ef2d51f7a6
508285 F20110209_AABXCK denbreeyen_a_Page_102.jp2
28aeb8c41150847b1ad05162dea8758c
9a2b6929d7b07a0d825ebab8ebb07a01d5ad66f7
500492 F20110209_AABXBW denbreeyen_a_Page_086.jp2
db3c3e9585664f1ebcfc2f725b9ae1bb
08d7dcb1f8d47daac6f96fb56be76aedd7f969e1
43544 F20110209_AABWWQ denbreeyen_a_Page_085.jpg
0466f2bcb3b35e71aaada5df38de4963
9dcb6a915c3d42c1b1ebd88c680f564b7d054c03
33688 F20110209_AABWXE denbreeyen_a_Page_094.QC.jpg
4799db6c0be46615510155934b905e2a
d87cfb8396297c3fb21753d903766908a5799233
117724 F20110209_AABXCL denbreeyen_a_Page_103.jp2
00406a01c7581ee9af15cf95a2466627
7067bec6a6a382bfcb25d5619980f2f5fd2fa79b
474499 F20110209_AABXBX denbreeyen_a_Page_087.jp2
bcd920af1c3f624d5bf1d32e17026ee7
3c51d8f4ec380a2250a11ac3e6cfa14daa9eab68
30671 F20110209_AABWXF denbreeyen_a_Page_095.QC.jpg
9b74da68e67da6b02831c26cf8813edd
60db8a28cf61bde98b27b18e429e689b7b97fbfd
137851 F20110209_AABXDA denbreeyen_a_Page_124.jp2
306f04424e1232d03248bc59682ca587
536845aa96ae3f8b127486aab4c8063b0409bb5c
117362 F20110209_AABXCM denbreeyen_a_Page_104.jp2
b9352aa8d6daa90a9bca5e0727805164
25d524c30184ed5e02923d71b67a94730db5c37b
460898 F20110209_AABXBY denbreeyen_a_Page_088.jp2
f84e8dff5a61ced0e61a771cff086858
b5e9cfd3b631b364066cc7a7af65122d3abb2693
13644 F20110209_AABWWR denbreeyen_a_Page_085.QC.jpg
d7deea1ea3a129c0c8cfbb58fbd27af9
41fca8c620fb95d6105c97875be040bda4e61aba
34729 F20110209_AABWXG denbreeyen_a_Page_096.QC.jpg
44d8cda348502365d2b22d7a9b171877
622a93da87654442cedb013e20389c483b5f1a8e
135801 F20110209_AABXDB denbreeyen_a_Page_126.jp2
3a931530df698e2a0ae0f7f3dedeea96
9217d6cf5f4485dc9e2ce9a0a5e4f6d7ede8ca80
122262 F20110209_AABXCN denbreeyen_a_Page_105.jp2
51534cd6e85bdec3e694dfebdbc91afb
09fa2dff9ccf1f40127463870ec8e9c32307172b
439057 F20110209_AABXBZ denbreeyen_a_Page_089.jp2
113fc32f1293052d3c4a0134c7b151b3
fd5226ac5e25eaf04c5843b8afc28049013f2a5d
43981 F20110209_AABWWS denbreeyen_a_Page_086.jpg
fb64e93d6524de27a2a04227c24ca470
cfdb21b3d3515dfaebd6da58b37534d6abca7a1e
111670 F20110209_AABWXH denbreeyen_a_Page_098.jpg
7395cfecced15443c553abdf1ab73f33
e012df1c5e3362d7bdf7bd5e0cc56d01561c6201
145805 F20110209_AABXDC denbreeyen_a_Page_127.jp2
374c611b36f6024e128ee7e654e7723e
ddfe070860ff4c1b8f1ce6f3d16d3cc1a8ee95a9
117120 F20110209_AABXCO denbreeyen_a_Page_106.jp2
45fd04597078f2a68f53ca6be916f7fa
f848048e11d2fc14a8fc53c6c564e4a3642c2380
44656 F20110209_AABWWT denbreeyen_a_Page_087.jpg
4023194f441c8bf4dd237511d468914a
0f2433517c2eef8f5973b6cb7607b5f7493d006a
3815 F20110209_AABWAA denbreeyen_a_Page_053thm.jpg
5de70f1e77e1c30bef92c0fda31f712a
9cb42c0d376a79c774db4b6c8d5ce7442fd2c75f
35354 F20110209_AABWXI denbreeyen_a_Page_099.QC.jpg
1ac64a3eb7cf22b33179119fd495d830
53bfa1dc2edbc9266d1fdf6cb85e6e34344f44f3
1051973 F20110209_AABXDD denbreeyen_a_Page_129.jp2
be03b79c5b47bca73d0af945a3b4990a
02876c1930d64b945c8a6c61ef8e5980a591d130
70507 F20110209_AABXCP denbreeyen_a_Page_107.jp2
b0b59c87376b0b13bc91154b039cffb4
6780e27968436cc4e36dac8f0148cba2effe081d
14012 F20110209_AABWWU denbreeyen_a_Page_087.QC.jpg
51e2e0a48b688158193617a5976b1865
313a5e440ab8d9829efde43be583d059e260a960
38847 F20110209_AABWAB denbreeyen_a_Page_031.QC.jpg
1d1199787ea8f7ef809359a8149b353d
9d42d805100b0ad0ab9f6f70b53721d802bfeb17
48033 F20110209_AABWXJ denbreeyen_a_Page_100.jpg
a88da66f251f62b999e8cf6fcfdd5831
79203ca46450f3c5f3dc500f2b9a0b074aa497ea
142083 F20110209_AABXDE denbreeyen_a_Page_130.jp2
f32d19b53c8560dde164d7324e97d689
5245fb0aa4732e656f54c2bef9a34940dadc7034
112754 F20110209_AABXCQ denbreeyen_a_Page_108.jp2
83128f178784d84c32cfc5f06ffba11b
474f348fd4374b4cba5a803e21248f5f428b2a02
41539 F20110209_AABWWV denbreeyen_a_Page_088.jpg
fb64d274e46036488192c20000f43da9
9ad7b6be28d02386ec87f532c800f9cef2822901
115295 F20110209_AABWAC denbreeyen_a_Page_066.jp2
cfb6bd3f9e398cadb2628b641f039b88
f5910caae8e2cd59a1328333b71dfefe7bb91bd8
14879 F20110209_AABWXK denbreeyen_a_Page_100.QC.jpg
f91fea716063f669b63c6fe1a10b5217
72d78ad98f9fc7fbd86774cd79ed25147f07fdb7
154373 F20110209_AABXDF denbreeyen_a_Page_132.jp2
40af0ea2e7376c0e08929ef700d9d956
464b39bbf76f49bc32f09e29de3988bb61902f4b
121148 F20110209_AABXCR denbreeyen_a_Page_109.jp2
3b3e96323711f4ed5265b372e4233157
df95f7a98be84e2b7adc4a322ab0579649664402
13808 F20110209_AABWWW denbreeyen_a_Page_088.QC.jpg
26120121c0978b3f8815c644fe0d3cd5
add1689052e5b854a9b7dda04abafee8f83d1cd4
8335 F20110209_AABWAD denbreeyen_a_Page_058.txt
b1ef866ce10e5ad7926fa407c214d293
54c7f1e8ffa467be7dfa06e7c75ff12dfc5c51f4
58183 F20110209_AABWXL denbreeyen_a_Page_101.jpg
d272193807f506f5be2c8f18d0f8da8a
7f97474a0fe02d14c67da98cf74e74b64eb58961
142743 F20110209_AABXDG denbreeyen_a_Page_133.jp2
a1369935127a4c456667ebd2fe2b0d79
aa43fd51239302b00f198a6168f2182d38b262e1
115811 F20110209_AABXCS denbreeyen_a_Page_110.jp2
b290fdd182349c06bafaae2ea808709e
226a1dc0bb463e7ba09afca209d2fd00ddc3f15f
12613 F20110209_AABWWX denbreeyen_a_Page_089.QC.jpg
1346157223851549ce38e19976612f74
8cd3198e4ebba37d36abf7d2b51ba4ad4cbe8daf
8259 F20110209_AABWAE denbreeyen_a_Page_001.pro
93eb94212856606e7edd9ebd90c56a13
47c7f993fef49f99c7b8872288844129168a839b
100389 F20110209_AABWYA denbreeyen_a_Page_112.jpg
b56037967bdfd70f47679491cc816210
3eaca33a6c89dcd22b07f88ced3aba161e092527
38593 F20110209_AABWXM denbreeyen_a_Page_102.jpg
d1fea1d41bd2992e13405ce17dcb6d59
3a1529072f5b0bef75a8111e0c0c97f47aadfc0d
143508 F20110209_AABXDH denbreeyen_a_Page_134.jp2
76cea9bb2decb7a4e8665ecb58f91e2f
d37c5939898bb1ba7f3889710aeb7a94ee690483
109959 F20110209_AABXCT denbreeyen_a_Page_111.jp2
264b599252ab005a212eff57d98a3125
b87c5e4e7511983bfbf2b1dd0d0ed659f776802b
16133 F20110209_AABWWY denbreeyen_a_Page_090.QC.jpg
feae63a1d0f9571be2d2533c061976f6
084a882dc5ae29fd33ca49d04478eef6f3789723
30506 F20110209_AABWAF denbreeyen_a_Page_083.QC.jpg
2aba060a752d9b780bf4f2eccc2b09f4
68ea84259516697af3a7e4434d84943a239f461f
113703 F20110209_AABWYB denbreeyen_a_Page_113.jpg
523a21efe0844f82e9a481763672c690
e5dc3dcdbd8bd50332dfb0b3e3b29331dec49d71
35870 F20110209_AABWXN denbreeyen_a_Page_103.QC.jpg
89768b55cd2844bfd7bd6dfc842342cc
453b86cefedd0a9382b2e8efc2db74e995140d13
136835 F20110209_AABXDI denbreeyen_a_Page_138.jp2
f5be2b1b0b39e1bc378bbe6bbfb75ea7
98f7776cd294efa9e44a25c63b2af9cef9cb2fbf
107927 F20110209_AABXCU denbreeyen_a_Page_112.jp2
d275e44bd978b619000d571bb090ffc5
b360178f666e74a7f02c5bf1c1b234acb47c4192
29173 F20110209_AABWWZ denbreeyen_a_Page_091.jpg
098f7f5c2d1b62bbeb3430e8894cc4b9
9d9594fd16f65144f91636951055b59e92c9559a
F20110209_AABWAG denbreeyen_a_Page_132.tif
15662f8297bf53f045f162c67a057f16
c63d4778c51a3f7c7991a83c6bfe8af08ad8b7ed
37411 F20110209_AABWYC denbreeyen_a_Page_113.QC.jpg
7f1a2b397d8479c39f87ad160a333d2e
d35d6e7af6f0145172acecaceaf320c121d0bb84
105397 F20110209_AABWXO denbreeyen_a_Page_104.jpg
b995bdf8701f35be6d87f9aa2ad7c905
0afc48daf0d34b1180a9a85abaf33a18480586c7
14018 F20110209_AABXDJ denbreeyen_a_Page_139.jp2
3ccd0440f85f039877f7b4de70e3d103
eea3acddcc7b79e04d99ed6f72e213b984e9524d
20622 F20110209_AABXCV denbreeyen_a_Page_115.jp2
f84fb4f012f864bdf87b242cb1bc619c
cfe5344e92cf0e6096848bc23e738f30867dcb02
36475 F20110209_AABWAH denbreeyen_a_Page_126.QC.jpg
7b92592e24cb3d23c9ef4239d69fc0af
9b509d07425e98ada27b148cd03cc6424d66b8e8
107868 F20110209_AABWYD denbreeyen_a_Page_114.jpg
c3add09641a4d5fe9f8935e39f325765
03ee59801db4dddf17d3226f2c71a6c244d0ed3d
34514 F20110209_AABWXP denbreeyen_a_Page_104.QC.jpg
ab7738cca2b002ef2eba8c065045d59d
2f39c883ef80e9bf99a7dbf69f6f428f577d1378
104851 F20110209_AABXDK denbreeyen_a_Page_140.jp2
c03966e286ddc89f72ef8c18a15addb6
b8219dbc8fb099afce7685b5ce441730924eb12d
1051794 F20110209_AABXCW denbreeyen_a_Page_117.jp2
ee1179ccf464216bce06f5b3d99dcb9d
440425ec2954edff96e4fdf1e61baab984610cd3
36556 F20110209_AABWAI denbreeyen_a_Page_071.QC.jpg
bb02607de50e34b4e033e9c392fc691e
10a2e7bad93cf1d7b053b25098166eaf4292c6ea
6577 F20110209_AABWYE denbreeyen_a_Page_115.QC.jpg
15a9dd5199b26b3e4ad2d25f81fa21a9
668b3183e41cedec8138a84b65020530e6585a9c
112372 F20110209_AABWXQ denbreeyen_a_Page_105.jpg
8ebc051a87e006a9aec3ac539b82ab69
48a12150dcecc9deab2f8278625c753e4789a67d
2039 F20110209_AABXDL denbreeyen_a_Page_001thm.jpg
b900de7be971bd51cc46a339a0c300f1
ba978a5baab47fab01249289cb402fa9fdc0a240
1051943 F20110209_AABXCX denbreeyen_a_Page_118.jp2
1f5bb810c28da1e4146b781f8c3d33ec
d41b93cc1438063209db392c064d1582d468ec94
F20110209_AABWAJ denbreeyen_a_Page_003.tif
85328209b0763e63fa1d0f3fa237438c
bc3fd533b5fe462180b2e6614ac471bfe1169e84
19986 F20110209_AABWYF denbreeyen_a_Page_116.jpg
3a8ea5dba1ab3e0bd0d742bf085ddcf8
0ef0e4d6151d06494166c2446399070d0806fb64
36265 F20110209_AABWXR denbreeyen_a_Page_105.QC.jpg
905f55291a4ef3c01acd6eff2bc9e30a
12489beaced2488c1bb738500a8fabab25ef0f8e
9075 F20110209_AABXEA denbreeyen_a_Page_026thm.jpg
9eb1838f2cd2288e784601bafca94970
31ffe45be581ecdcf9dff8cd16e8e438818ff51e
606 F20110209_AABXDM denbreeyen_a_Page_003thm.jpg
aef2072bfb4b142e098484b66219e3e8
4fb7ef17dfcdbb77c96d47cf5df3013d0e239cf7
92072 F20110209_AABXCY denbreeyen_a_Page_121.jp2
6b903aaac8b05ec594f3579759e44c00
cf408ec16e38e18606d056a0e944e8dff688e703
107125 F20110209_AABWAK denbreeyen_a_Page_016.jpg
5177d701a9a12a35e2334c1a48649723
6cdf5469157b2fddb5839cc196878af94132e318
120644 F20110209_AABWYG denbreeyen_a_Page_117.jpg
0400f020b7d3fe6ebd81ca008edcff96
13e35d3bd76fd2d0545d0ce41f382504ac4cc405
8888 F20110209_AABXEB denbreeyen_a_Page_028thm.jpg
6d441068e28d28232e2bfbf235219d7c
a3e3a23df942f26d406024a641c74fa4b8b8d7a8
1803 F20110209_AABXDN denbreeyen_a_Page_005thm.jpg
7ad8c5f21f44f8495453a7d1c4dbd343
86a18e635c827b09fd0e3e0e1901fb605a010fe1
132411 F20110209_AABXCZ denbreeyen_a_Page_122.jp2
71c758fe077d45c2d37ddb883b2c70f8
b5984d67145bbc69a8f8b55fefc51552a98e8244
108109 F20110209_AABWAL denbreeyen_a_Page_079.jpg
efd4ed3590b1a76ad69e0630a56a2a6f
eee66991d37889050251b48b530d235513b634e0
32040 F20110209_AABWYH denbreeyen_a_Page_117.QC.jpg
53d9a794627a5112355b0212e62297a6
8f3f1319d4649482d360f9093a445d4052429fe9
34858 F20110209_AABWXS denbreeyen_a_Page_106.QC.jpg
fa83bd92aac2fd8427a5db28fd7ea928
d584b3953497b0f4221dba39c5304d60b3e11df7
8873 F20110209_AABXEC denbreeyen_a_Page_029thm.jpg
11d0ef7427d51713ac26914849ac3ad3
7d672845c5260bbcf437ceeacc086866f07e91c3
7327 F20110209_AABXDO denbreeyen_a_Page_006thm.jpg
4b9717a439b76fda4834b2fd46e9e637
e1a28f9bfdba073c824bebcb741fbbc21661e996
F20110209_AABWAM denbreeyen_a_Page_109.tif
44b819fcd04d0fcb0f8cf32b67e0273c
c18c36c56e1056a08fab4752d32100e082b02401
116523 F20110209_AABVVG denbreeyen_a_Page_025.jpg
157bb0f24b24767e621484858cd9eb9e
5f7476b44985e04805982a42a21e27612c6af9d3
70792 F20110209_AABWYI denbreeyen_a_Page_118.jpg
221821979c3fcbf6f46b3acc0acddc6d
cb48071b7cc26deb625fc418febd1c327c633685
66187 F20110209_AABWXT denbreeyen_a_Page_107.jpg
76a783414e58bb14198037fb4039b921
94b16c8d1a53149a144113c0c59ed116d452d95f
9672 F20110209_AABWBA denbreeyen_a_Page_129thm.jpg
cae124ff7ce763b511c5545ae6846dc9
6d264ca20ca8ef0647d46851def2c61e8d63b608
9000 F20110209_AABXED denbreeyen_a_Page_031thm.jpg
b0c45dd514d7fbc306e0e59d16e0573f
f67edb70191aa21440a24f6faae3eed49c4e1fb0
8004 F20110209_AABXDP denbreeyen_a_Page_007thm.jpg
2902c4963958f5c1cb800550e28e7c3f
31ccd08422fc79f347cd8b52d665665e8d60f8ea
108314 F20110209_AABWAN denbreeyen_a_Page_120.jp2
fa4d47ba0ae3e35f538b4cc3ffbf4f78
ac5705a3913d6a22cfab28be9f78abd0b1426f93
55480 F20110209_AABVVH denbreeyen_a_Page_113.pro
25e6bd2e6710dabfd69d214e6d300ef1
78ad446a0efc8c6695ef0b03914455aaf340291b
19739 F20110209_AABWYJ denbreeyen_a_Page_118.QC.jpg
dc767397b81f15171a92cf7819a3f4b2
947cbb36d57d13b5d21ba86a2652e7f5132db3cc
21178 F20110209_AABWXU denbreeyen_a_Page_107.QC.jpg
15e08b426674b3b711cc7a4b845dffaf
df2f20af1f7c4c96c83e9d35388a3ea8fae28162
56969 F20110209_AABWBB denbreeyen_a_Page_024.pro
a6f35a67f4446663466013c64dcfdad8
62ae6b5fa832a3cd6f4616917dca5ee9cd20431a
8815 F20110209_AABXEE denbreeyen_a_Page_033thm.jpg
8ebaf60fc501f3746470f60881234d4a
02dcb926d816191c045843e9d483c2803ff39b98
1645 F20110209_AABXDQ denbreeyen_a_Page_011thm.jpg
872fb221d63df0083f474c20d8c91f26
6cdc4f1fe644687a357ccbb87e583473c99052b7
67237 F20110209_AABWAO denbreeyen_a_Page_056.jpg
76ebc0f063d473e01d65790d0f4e8cfe
cdaf226dc916c675a9513c5127880295c7a33e60
148834 F20110209_AABVVI denbreeyen_a_Page_137.jp2
3126ae5eab970e0b965558992419e8f1
ffbc91c8151dbbb71b42d0ce7ae62977d8ebfc11
31631 F20110209_AABWYK denbreeyen_a_Page_119.QC.jpg
1c81e6b7cc670d7213e39b188d1ac6ed
16984c7ab2d490ddce3a5d7f715ad4dd20941225
34323 F20110209_AABWXV denbreeyen_a_Page_108.QC.jpg
3714a7aa8b500ba40fea82cfcf32d47b
6b1c5c4fa5b4e2dc9bccd95f42f3448f8d3b8c5f
8517 F20110209_AABWBC denbreeyen_a_Page_114thm.jpg
b928ef977be7eca3bbaa7045dc411204
c7dee50a85f4e00297fafd884f9dcc552f9a1402
8939 F20110209_AABXEF denbreeyen_a_Page_034thm.jpg
75eeb484edf3c1ccda700f8bca7187ae
93de2c90385b66f402ecd48b55ae4a40e0f3160b
8017 F20110209_AABXDR denbreeyen_a_Page_012thm.jpg
3bb01135320aa2899fb38058308947b5
6d7fe8ef45933ff5994bb8c0d71114113e0b401f
107472 F20110209_AABWAP denbreeyen_a_Page_093.jpg
d39393f4d256c39d36aedb7a09fb783c
059938973571193641dbbee3fb2d33bc08adc0b3
8165 F20110209_AABVVJ denbreeyen_a_Page_039thm.jpg
a4444a3d6ce5373a7a0bfea894882801
20daf12eced515e0dc093f3767d250f56446c265
89506 F20110209_AABWYL denbreeyen_a_Page_121.jpg
a704b80c1b939f6332546c394d111d56
94e260400bd43bb7cec523b0f1fcb055692ebbd1
36526 F20110209_AABWXW denbreeyen_a_Page_109.QC.jpg
4e19dd7345a1c1e4a42023617a1a9109
c51fcd041b057dc3d95855e78556b2f3b956b660
112637 F20110209_AABWBD denbreeyen_a_Page_109.jpg
1998e6d27646e65bd369a75c85ae7372
cbc40ba530f902b9131e5e54183802bfb50ce8d5
6551 F20110209_AABXEG denbreeyen_a_Page_035thm.jpg
94eec9a5733455f9fa9344072bc30598
1edec868c0a9b13836dc7248fab6c6f9ae8034d3
9180 F20110209_AABXDS denbreeyen_a_Page_013thm.jpg
410ad03b3981afd23ce0bb44eafb9968
892595040c86631d130d95be21166c5e60e9c273
37801 F20110209_AABWAQ denbreeyen_a_Page_135.QC.jpg
7e1f4e000ed8947ed35439171c50fc9d
6df394b528155ddef53f3043fc9ed184033688ee
131049 F20110209_AABWZA denbreeyen_a_Page_133.jpg
9a0143a7daedd544f4887106a4af9ea9
ed0eb177bfd62c6d829e21a2465719e16577b3ef
37433 F20110209_AABVVK denbreeyen_a_Page_036.QC.jpg
1a262deb9b106394d942910a157feace
1491362ca5b7375edce990a411d781cd61a32462
36549 F20110209_AABWYM denbreeyen_a_Page_122.QC.jpg
614030b027c4492646d7bf7cc2238172
0f074deaa38f704c44dd71293eb891f904f451da
106856 F20110209_AABWXX denbreeyen_a_Page_110.jpg
ef28d310342583d2639b63dd2e199477
e22c00cfb13953f26170c5e1f4357e79ce25d392
38144 F20110209_AABWBE denbreeyen_a_Page_097.QC.jpg
3246680559c4aae933796df038ba188f
cea104c0fe37d408f86512e81f9e6f051482dd22
8833 F20110209_AABXEH denbreeyen_a_Page_036thm.jpg
1e035e49f7b96f6b92e072e01fe00da6
586eff7ca9b5e61c029c136653874a760dcf4f4d
9097 F20110209_AABXDT denbreeyen_a_Page_017thm.jpg
b1cb262edeb85480c1b85112bd50da11
96e761e6d81676c2e50e36164ddedebc51a5b3d7
33285 F20110209_AABWAR denbreeyen_a_Page_047.QC.jpg
7c2976741a940817fac27b17169049b5
45b16b24639417ec53358ebd1210ccf1b559a993
38288 F20110209_AABWZB denbreeyen_a_Page_133.QC.jpg
54dc9c67f4c4b11af1fc6afd55ea36fb
856bc19f183cb0a6ee35a8f9ba10bd1f12c1c43d
52908 F20110209_AABVVL denbreeyen_a_Page_079.pro
fc759cd478c30c53564ddfef3ab83120
1fc5e2bb45d35c52d2e69d2d51b65b5ba21d639d
132814 F20110209_AABWYN denbreeyen_a_Page_123.jpg
b2ff1f72eb347ee8570141555bec944c
256eced18021bdceb7ae3010970fd67e1c252ce9
104437 F20110209_AABWXY denbreeyen_a_Page_111.jpg
70ea59f8309736d9940f8e5b6667d29a
ce3ff44cf872644023b622cc1c9aa75e206fc467
F20110209_AABWBF denbreeyen_a_Page_111.tif
6c7354bc8f935c4c786a26d50639cbae
d1d38dc541dda4dd9583863736c0ecd8988250e7
9126 F20110209_AABXEI denbreeyen_a_Page_037thm.jpg
f4c230037f44a0b3ed142eb23e0c9632
f56d6a38121aea9bfa710708cf4c483de67d2e54
9014 F20110209_AABXDU denbreeyen_a_Page_018thm.jpg
5dc7e808d2bb4a656498145366a8672b
c794b7ff792ccc8920561aaf291e59c8aba7f725
F20110209_AABWAS denbreeyen_a_Page_015.tif
097d89d0b7a62379e3060aad8b41ab99
febca479c6f46d267f3a86c43f23e3c88ee85e3b
136410 F20110209_AABWZC denbreeyen_a_Page_134.jpg
53b3c2068106a4299c766ec36ae0bd6e
ecea2b1dcbd8ebb8a567b6e4ab53eaadb520a393
9270 F20110209_AABVVM denbreeyen_a_Page_009.QC.jpg
0953037dde704c869d500c18581dc876
0d8634d9fbb96220c3f734c15c94167fa0274f8d
133234 F20110209_AABWYO denbreeyen_a_Page_124.jpg
071d356cb6c70a47ac69e9a8373b9470
41efbf5dd426a18b317e9449a88970a04ee3eb15
36107 F20110209_AABWXZ denbreeyen_a_Page_111.QC.jpg
e95c3ec6ccd408bdc7375aed1753b711
433287d5fd4ea8971a8732360b6c3c3c9c9a6c7f
110062 F20110209_AABWBG denbreeyen_a_Page_015.jpg
0e222335401c25b4b4310274bc5daeda
269513912e05aca8c8eb14fd226cad82197ac3b0
114251 F20110209_AABVWA denbreeyen_a_Page_062.jp2
c0101eea0968eff17caf010c99e0efad
95a2702ded1eed4744b8c81c257a72a638d311ef
8586 F20110209_AABXEJ denbreeyen_a_Page_040thm.jpg
ca0b73f64b2ae532c197b04b218e137f
9e31593fb706e0263022ad4de0047f4525866c7e
8549 F20110209_AABXDV denbreeyen_a_Page_019thm.jpg
10144a50851f8620c3d2f034da53fe6e
3d6a402adf6d2d0db5232afb8af7b620f685fc73
F20110209_AABWAT denbreeyen_a_Page_079.tif
5ca74a88fc9f50390d885a5df12e6140
974e15b615a955b8d1ad2e05fa4c738f82b6c83b
38490 F20110209_AABWZD denbreeyen_a_Page_134.QC.jpg
a34d10672f4a04c043f10fe49a126403
09ce154d4dc16bf30390eb3fe7ba2095ef06aaf8
35646 F20110209_AABVVN denbreeyen_a_Page_054.jp2
25d0b380f87c9a39ad1491195ffa463d
999a19983cf9c369518fc339e8b59b7ffd0120c2
41277 F20110209_AABWYP denbreeyen_a_Page_125.QC.jpg
1823fbbc10f35b3025046417f8007150
eb56772ca891d8287ec093c9835df186215c49a4
8730 F20110209_AABWBH denbreeyen_a_Page_128thm.jpg
6e64cece0646b5396862cccbc2194a59
9d372286492d3062629b07f4d9c9429a35b73955
37120 F20110209_AABVWB denbreeyen_a_Page_017.QC.jpg
827d0c5ddfe5e80438bf7e8b924a52e2
968aa3441ef7d3de16caf21c50037e87eee0465a
8925 F20110209_AABXEK denbreeyen_a_Page_042thm.jpg
cf0f6f5c952150fc5c9b5980bd8a50a4
aa9fc825971022f96091ddba36344ee2359e1d3f
9026 F20110209_AABXDW denbreeyen_a_Page_020thm.jpg
7205577b82f591b6969be1d1645670f5
5b2b944bd869a429034a77caf6c47a065e8cf01f
1579 F20110209_AABWAU denbreeyen_a_Page_077.txt
6aaec278935c80eadccd9ba631994380
47efb93511e3c413407dd9fe4581453ba5ed73e0
133864 F20110209_AABWZE denbreeyen_a_Page_135.jpg
03f9c769c1c6612715386eee608a02b3
a185868db852fc5e79086a65f40c13d665f26710
34407 F20110209_AABVVO denbreeyen_a_Page_067.QC.jpg
8a169a07ce97b203d9c19126c4bf3508
821a499f16908de47277aa9fa406516c372deafe
129449 F20110209_AABWYQ denbreeyen_a_Page_126.jpg
a39db96af843710b332120d7f9eec83e
a131b836293b69d73d772582a7cd4642a7cbf82e
121492 F20110209_AABWBI denbreeyen_a_Page_097.jp2
15fc643fdf889b3ab6db2446884e5848
b381ca67f423b67389f8d68c477251b16b666a56
16682 F20110209_AABVWC denbreeyen_a_Page_054.pro
0b21c86fdee550727f3e2a94a246cea2
a45cc71fd250af9469e44008a9139eed57fcdfe8
9053 F20110209_AABXEL denbreeyen_a_Page_043thm.jpg
56878a20866fc900598ee63adacbc19a
d4dbfde456ac65732c365ff0baebc22f111fec9f
9092 F20110209_AABXDX denbreeyen_a_Page_022thm.jpg
b5b3e671ecdfcd13f20ef85363ac18f9
f4b116585cb920135ed313aaf723bf44a34fa346
F20110209_AABWAV denbreeyen_a_Page_129.tif
90113b6dfb28fdc1e2e19ef835bac63f
468c47fcffd07a5eb4dbbab27a0d686ba6c9282b
130764 F20110209_AABWZF denbreeyen_a_Page_136.jpg
fb0e7cba7e4c96c91992219a05c12c90
57e826ec65a67f791dd122434389c07aa713dd5d
F20110209_AABVVP denbreeyen_a_Page_139.tif
137ec71ed886c3f86026a282328d0faa
7f415bb22880585276c0e77503fc38ca779c099e
136600 F20110209_AABWYR denbreeyen_a_Page_127.jpg
18bc1ce668e04cf18001332e8ac5ad5e
df7838708dad752b318f289f954ea1f9a8935eb7
F20110209_AABWBJ denbreeyen_a_Page_049.tif
b881b3a77c3855e777e46d6de3461173
d20e78614bd42bf88633f771e54302382ece55f6
38815 F20110209_AABVWD denbreeyen_a_Page_137.QC.jpg
1a2d42d238d1296cd03d2b96192dbd30
84e5d96e201b98d522c4555664d6d25de1246482
9114 F20110209_AABXFA denbreeyen_a_Page_063thm.jpg
808f065f10f5a40a27effebb327eeb04
9c2fcc9a1448d1c767f685ada9f284a17b115731
8388 F20110209_AABXEM denbreeyen_a_Page_044thm.jpg
64049798b4212900c587a7e1986b774a
47ee1d0c5a6439879c43ec852a0d747ce56a461c
9105 F20110209_AABXDY denbreeyen_a_Page_023thm.jpg
9df9e982b1b051030ba706abeb228659
bf74e7b0aaa37e5f76590802a616f2b330b4f16a
103540 F20110209_AABWAW denbreeyen_a_Page_120.jpg
23a850c7b03e9e4c2942a6db53212e43
9b4e3a219d607125e2160441870b0cfff8d3e16b
36975 F20110209_AABWZG denbreeyen_a_Page_136.QC.jpg
caf06ade052e89dc50d8f74385e2059e
f332a176c8ad5da5ef2dffe4813f11ae6b4a6bf3
108645 F20110209_AABVVQ denbreeyen_a_Page_049.jpg
da7e36957e08fa6ab3df328984c2f20e
3e500c6c14957bcf57b671c0c10a5451eb7f88a4
38819 F20110209_AABWYS denbreeyen_a_Page_127.QC.jpg
8772522ce66dfaffd8702f9db0288972
c9985b328c0d8684fee60c8c2a482219c31d09c9
33944 F20110209_AABWBK denbreeyen_a_Page_112.QC.jpg
c2ec9658624d74a6c81c6a6ed429f7bc
6792692a02f385bcc15bcfb0e6f50c61be0d3025
112032 F20110209_AABVWE denbreeyen_a_Page_029.jpg
986910708f8b8034de385cb151276dd0
9a2a38266bf2c9a3c219c334dcd32c4e48b51b03
8375 F20110209_AABXFB denbreeyen_a_Page_064thm.jpg
1286304aaa06b8f953e1d8205b910c6c
b9e08288f7537a1d60d957aa00d1772585645496
8891 F20110209_AABXEN denbreeyen_a_Page_045thm.jpg
69438cebefa03f1f6e78e9dea93b149c
bb05836969345b9b81a9c52136be5d43ee12f3e7
9236 F20110209_AABXDZ denbreeyen_a_Page_024thm.jpg
57fc13a2e1e68ee99322e6b8e2bd508b
a681fd8a52ccf8ad0bcd745e28c981e3715cd4c2
35494 F20110209_AABWAX denbreeyen_a_Page_062.QC.jpg
5d910cb3366929558bd63d5f3f6c57f6
efbc93e2098896516ec763b8514d046c41d722c6
127929 F20110209_AABWZH denbreeyen_a_Page_138.jpg
328ae779b6331191bd713f369710c202
4ab5e238b8a9a32663131eb1c5543bbbba961ffe
2146 F20110209_AABWBL denbreeyen_a_Page_021.txt
6eec77e8dea820343f6457804f1e4f50
58b16a250ca044d737c851ada4775f02ce9ac363
F20110209_AABVWF denbreeyen_a_Page_039.tif
6c47fed3407aed2c1b5408d3596763e0
69dead1cfc2eecb639390c86c9020635604b8c27
8671 F20110209_AABXFC denbreeyen_a_Page_066thm.jpg
77d20584389e909bc13e3b8bd41e140c
6100ef1057ba6768d69f0cf45140543de90fe8d2
9005 F20110209_AABXEO denbreeyen_a_Page_046thm.jpg
a9559d4dd69dc8a9672807ce3d98ce32
ecffd279c706780f4bd590901dfba392a22ce5e9
13298 F20110209_AABWZI denbreeyen_a_Page_139.jpg
507196244fef05432497de0591821d7c
114fb6af9e7405909614cfa238770d43fb659915
110704 F20110209_AABVVR denbreeyen_a_Page_040.jp2
ec47e734838784665490e583b7dfd511
e0264897b747fc34d9ba832c02fe12fef3c7da2f
118118 F20110209_AABWYT denbreeyen_a_Page_128.jpg
9680fe63caeaa4afd04dbf8d14ac09db
b04efecf79fef56fa16a8176fbf7347d939d40a5
7806 F20110209_AABWCA denbreeyen_a_Page_001.QC.jpg
991c8598ba7172275f6361c5593a0a24
f6e07b3cbdaa85a897bcf57bce4c5c048846d6d4
8757 F20110209_AABWBM denbreeyen_a_Page_110thm.jpg
d01e61f26043759662f884daa4dcc747
80b06efa497b5ae40c5a3fe867b61b338a1bf90b
9424 F20110209_AABVWG denbreeyen_a_Page_091.pro
d46e94cd756b84ffefec9c69c82a9dc7
663dd1147fa0748ac8dc73c2d8f4b1b128cc8d84
32695 F20110209_AABWAY denbreeyen_a_Page_007.QC.jpg
dbafb5d22af20dc0b8e6ac4a63433bed
49430830ef856b0091e646858635abf580d26350
8575 F20110209_AABXFD denbreeyen_a_Page_067thm.jpg
324aae613bc56d4b1954bb88c686afd7
c76915ba3bff16c1de6fc5a93594f49ed5941385
8641 F20110209_AABXEP denbreeyen_a_Page_048thm.jpg
cfc6fc96c8ccbfb8451359974def804a
2789a2f7a383b3917e88f06e824bf7e9ead17875
4217 F20110209_AABWZJ denbreeyen_a_Page_139.QC.jpg
27119b3ff13cd669ab55a043866f1d93
7d70bc0d7fae4e184f36d0f3ec3b8d81af74458a
113612 F20110209_AABVVS denbreeyen_a_Page_048.jp2
828b52190783a4c2b3820f8e84a1f469
e19f74551c80ffe138f9969304e8e7218ee77dfc
34762 F20110209_AABWYU denbreeyen_a_Page_128.QC.jpg
e377cb531cb8d8b01a35e491623e605b
95e7c54cb4a5bbe1ef9f53f7cb714b936fbb937f
2026 F20110209_AABWCB denbreeyen_a_Page_067.txt
8ebacdd5c4bd5a0e197a97ed5f6f4154
7e0e4ba7ba951c5086a00fc11a1895e72fa2f461
115315 F20110209_AABWBN denbreeyen_a_Page_061.jpg
b9c46b5643060ece9329cdf7b564f232
f95a17074afe24daaf2af7a4e5068fbe45dfc162
63747 F20110209_AABVWH denbreeyen_a_Page_126.pro
993cc99ea296fb03ac45b8c101951549
8d334495b9d91e351f99ceebec4d944e4e1bb36e
6644 F20110209_AABWAZ denbreeyen_a_Page_052thm.jpg
816a3fafa1d6e12dad4aab866de3f827
994fd686d31903560041418774c4e0c202503fb6
8982 F20110209_AABXFE denbreeyen_a_Page_068thm.jpg
af4e09034c876f7ca640fbcc092f7731
0b9b17c765a4c8914a590affc751db391648bfb4
8698 F20110209_AABXEQ denbreeyen_a_Page_049thm.jpg
cae930f74cfa9a871a88625d35eb4ed8
423a0cc8713a74c24a195f071aef1788c783eb5b
145925 F20110209_AABVVT denbreeyen_a_Page_125.jpg
d64584a3db09e712cdf8ebfdf94c7993
c9f4b01e84d7833cfc7ee9ce8d4a942aa07db6b0
140251 F20110209_AABWYV denbreeyen_a_Page_129.jpg
9f0dfd78f870b141699a8bef3dc718c2
97bceaa5cceafd10c0145de33118ae7b32846337
2220515 F20110209_AABWCC denbreeyen_a.pdf
c07149de1fdf8ed9c6911eded376fd7f
abe730dc9d3d88595b54840c5da14b5d296e5fcc
113029 F20110209_AABWBO denbreeyen_a_Page_026.jpg
b49e88f5f9fb103c720adf3b8bc31966
3248b487cbf16545e277e5841dfcf8b9d47ca03a
112130 F20110209_AABVWI denbreeyen_a_Page_068.jpg
d350104fed1eba4c232b694ea0d2001d
e60c181abdb04030c8aaf0be1c187c1ff92e3c91
97649 F20110209_AABWZK denbreeyen_a_Page_140.jpg
9a852605aa27d332083f98415c8ea2fc
75a61566980bb5daa0e5f405f723e6286ee7f485
8769 F20110209_AABXFF denbreeyen_a_Page_069thm.jpg
1c9c37c09cc9656c5682bd169197cdc5
f2cdc4ca32997ba8a862154aa3216ff3bbe5a5be
9060 F20110209_AABXER denbreeyen_a_Page_050thm.jpg
79d10e7e1fa979e5e32b84192f0d6838
add32a3d88a1abc1519c4517b0529591ff603fef
102648 F20110209_AABVVU denbreeyen_a_Page_064.jpg
8f30ef5dcd2c14763a0dcda3c2a27741
e3efd0c4c8540710cca48ab530d7a670abb92d0d
39224 F20110209_AABWYW denbreeyen_a_Page_129.QC.jpg
6d7ac309445a8af7e42b08278b7c25bb
a04a142a10e52db981ca2810d2667ae73836b5a6
10647 F20110209_AABWCD denbreeyen_a_Page_074.QC.jpg
b93168f14c4ee680cdd0d2f9f00e3513
0cd0463a5e8f1fb9d2d49ce8cb8d37ca81cd3032
7753 F20110209_AABWBP denbreeyen_a_Page_011.pro
982037c980550788f55f840d2d17e62b
416156602826b4d58638a08726100af58e74c81b
4577 F20110209_AABVWJ denbreeyen_a_Page_077thm.jpg
26f319a94cacf9e13e9e4f26044de7a0
39ae422a9b90466c57a77657b5b2e824cb6cee7b
25228 F20110209_AABWZL denbreeyen_a_Page_001.jp2
5d271311fa327d3f93831f73ec0ed876
36e8b83e8365eb2185ae07e6714e1b3a332eb985
9172 F20110209_AABXFG denbreeyen_a_Page_070thm.jpg
1b67592d2106599f27b904efabc9cd1f
4776e9d1362188403e43ccbf87198f3e6de7377e
8735 F20110209_AABXES denbreeyen_a_Page_051thm.jpg
17be9b81678369928a27fe0a85b4623d
e2912ed84d263b36724ce473dfc627bf68aeed90
5550 F20110209_AABWZM denbreeyen_a_Page_002.jp2
60d867f2007f0c705b203eaa4553f7a8
015aea107aeb37c0bae649d088b364def6284025
68929 F20110209_AABVVV denbreeyen_a_Page_129.pro
21e7b076ca788bd0b859163eafbb8288
0f5d324717ea6f838546a71ea153d1152c35bf37
40292 F20110209_AABWYX denbreeyen_a_Page_131.QC.jpg
9f0acbe9561b65ff33fe4a49802f59bd
6261dd78f1f284de9d9a4efb50a62eed745e6da0
31205 F20110209_AABWCE denbreeyen_a_Page_009.jpg
2ac23980d242d1e586e3b5704de7896f
ff8d1eb0685f6c488135277e279a92a7978797ad
F20110209_AABWBQ denbreeyen_a_Page_117.tif
874391101955f92843835001f1051d96
7f61ebdde273bc9363e12bf0639fbfa4a2a1e7ff
110795 F20110209_AABVWK denbreeyen_a_Page_014.jpg
5590a69b7dd639dc0ce1b73c9a3c0447
0d3d8b24ca5212bf48c6fb2d750bd5c1b35bbbd6
9168 F20110209_AABXFH denbreeyen_a_Page_072thm.jpg
ee5a6b2125478aabf13489e399b0fe70
c00e62b4ad42e936f07e48721e5d1d0245ebfda3
2904 F20110209_AABXET denbreeyen_a_Page_054thm.jpg
2e2a8a2b837b73c695bfa5438ccbfa88
4c70f814268c23c17c696f3363e089b9655a50c8
F20110209_AABWZN denbreeyen_a_Page_006.jp2
92e6d55b6537a6993ffad9e9e46c963a
752f0a097648b25be1f5b9d42acd87af49743b3f
119781 F20110209_AABVVW denbreeyen_a_Page_113.jp2
34bfc1859796e569185b7c201ceca090
d2ee1c7a1f5195eb40dbee9b04f2044c13eec375
151119 F20110209_AABWYY denbreeyen_a_Page_132.jpg
267248cc0f105b5c851f0eedc24ee1f1
9949a2cd569408199ddca2a30ad34395e8d7f7c8
131848 F20110209_AABWCF denbreeyen_a_Page_122.jpg
f36183d557fe01e077671fb44efa5267
abd1273f684399ff1684b37b27d14748fc64700a
117317 F20110209_AABWBR denbreeyen_a_Page_099.jp2
8141045a652710e07a58220d9c765afe
a2336dbf64f7498b00603552a52f1110f00cae8d
F20110209_AABVWL denbreeyen_a_Page_108.tif
a50faed1cb733face55caa160100d5e8
c4c3c8e4bd8e1e4b8da0a81b1f20bdf2671cebb0
F20110209_AABXFI denbreeyen_a_Page_073thm.jpg
93c167ccc0aeb47e804838c1f1427742
adf5e103b0f709840666491af217865f5d175d7e
2410 F20110209_AABXEU denbreeyen_a_Page_055thm.jpg
1b6c3e087214660564831aba32a218da
eed74c74fd2a06ad3ed51fb9c466c8b1323509c8
F20110209_AABWZO denbreeyen_a_Page_007.jp2
bf62f078e5711df5b749a26dc46489b1
123d120d31b435e8659db4ebcb095f7066700b9f
112587 F20110209_AABVVX denbreeyen_a_Page_004.jp2
03066b56e500532e01d84fb16ed21cc2
96ae380c0509b6dbbaa6fead2caa05c67bac70f4
41352 F20110209_AABWYZ denbreeyen_a_Page_132.QC.jpg
cf5b4c5d1f6320848b052abee3edd545
4a0264d00e44694a609aca8fae5e8a2a6966a024
90910 F20110209_AABWCG denbreeyen_a_Page_095.jpg
ae918ffe4039a40fd3cd7d097fcab7be
afdfd326e8433b7aad85d0ccddf5dc330330450a
126062 F20110209_AABVXA denbreeyen_a_Page_128.jp2
5819408b9b84d602868c542e787d6746
5ac5f6449e7c954536544ce6545f96f45811a9c6
2222 F20110209_AABWBS denbreeyen_a_Page_030.txt
4930d307c580733c9a7bbd76402debb9
15ac5972d92ceb03cc720df7eabf618d16f5d64b
F20110209_AABVWM denbreeyen_a_Page_029.tif
0b769654f7978139917d95f6704faed9
c994d72c2a1e65c83e3e0a14734fc37eb0b62282
2558 F20110209_AABXFJ denbreeyen_a_Page_074thm.jpg
2ed48d28539ef04177a86d850acc8922
394b3c8d0738a8fa50f0df86bd61c3be485a745b
6524 F20110209_AABXEV denbreeyen_a_Page_056thm.jpg
1ad0413183c64ecd24c637621288c25a
665efb22943b7c22dd9846356dca9a8fbe637938
1051939 F20110209_AABWZP denbreeyen_a_Page_008.jp2
84b787bffe4908da22e86c0b01d26f93
80d6299c8b7f8574ce97c8c08219b68a66de7abf
18728 F20110209_AABVVY denbreeyen_a_Page_089.pro
9d784ce4df2d3fa43a45b1c915f81b12
3bff9d1b887e3bf16da747dbefd09cd11551b787
56815 F20110209_AABWCH denbreeyen_a_Page_027.pro
79d858b09c339189b02ffcd0447f6ff2
72a35f02aa1b9b512e18b5411b20060e75e31747
104553 F20110209_AABVXB denbreeyen_a_Page_108.jpg
c08a490500cb211756012e357508fde0
80bcc10c40e7091a9ebd40fb9b459d42221fc271
118510 F20110209_AABWBT denbreeyen_a_Page_022.jp2
64c8c8b206b64b67f1191cd817311f4c
8bc7589c64e7536f458525925a54f3e3847d189d
98330 F20110209_AABVWN denbreeyen_a_Page_075.jp2
fc06a58ef01b4777d07e52ff8bd81d6f
503bc69c9cecde4a6e86bb1eedfef98fb13231d6
6728 F20110209_AABXFK denbreeyen_a_Page_075thm.jpg
6b34c638ce4916ea318343d89ccc0b35
f02ac9ef1b6b61373c7ccc8a36e47b25f47bdcbb
4174 F20110209_AABXEW denbreeyen_a_Page_057thm.jpg
a5845e9f03a6fc4e50dba8bc2459a154
a4cbd40272befa57762a588019d0c1b7167ab737
582561 F20110209_AABWZQ denbreeyen_a_Page_009.jp2
dd5994ee3eca39dc74160611c6b93792
ebcdaf1d35e8c98d9c30d71a475f9a9f4ebbde61
55581 F20110209_AABVVZ denbreeyen_a_Page_098.pro
ca04a56a921f3382eceeeab0ad6f72c8
dcbcbd250393ca53b3fec0852c8ad523c7718ede
F20110209_AABWCI denbreeyen_a_Page_028.tif
dd5b837476dbef339bac886edd6d5688
166d57bb4ba9b51f1add02c13af91e81078440e7
2365 F20110209_AABVXC denbreeyen_a_Page_078.txt
8b2cd2145b6748686b991331012a59b5
68b3d79ec4389b896416d3b6384805a03cd7c898
F20110209_AABWBU denbreeyen_a_Page_071.tif
b56e80340608212576f68c2749c31cbd
3b85920c536dee9ecfbaad7feb64ac37f5b1b4cb
F20110209_AABVWO denbreeyen_a_Page_031.tif
d07402030e763d9909af12855c66263b
c4fc2921519b7cb5c41e202dabd622eab3eb51fc
4605 F20110209_AABXFL denbreeyen_a_Page_076thm.jpg
bbd1546e78ac8107ea08ea2568ca70e4
4fcf141b666a29a02269b953f9c4ba393ea1676d
8882 F20110209_AABXEX denbreeyen_a_Page_060thm.jpg
941775b9a09388bb47518e7daa267737
00f2067de42aebd0e00e3ab96ed0f185fc0e7e0b
329206 F20110209_AABWZR denbreeyen_a_Page_011.jp2
b0234f208eaa78d6790eaec61168b965
78eb1a87b8866abf3a787bc58d9051a4ae50d951
156539 F20110209_AABWCJ denbreeyen_a_Page_131.jp2
2cea74e0369676ab1d403fd562601b96
cd820ba9f259d1765a7646af0abba728ef36d2ec
122129 F20110209_AABVXD denbreeyen_a_Page_063.jp2
9709bc7860785a7502c3c429c52838e6
528d22dc85abd9b3da5eb10a40d1496996fa5b30
107 F20110209_AABWBV denbreeyen_a_Page_003.txt
3671e4afdf48f97ebefab490115e6220
05b44e49f700f327fbe16bc716460e1f4d8980cf
49616 F20110209_AABVWP denbreeyen_a_Page_064.pro
add627f7b2873b8981acfc2cec508903
9f237276be67774322f83ab807a8f7a9d08df422
8804 F20110209_AABXGA denbreeyen_a_Page_097thm.jpg
18ae8de4a4584a85f88d50744b6dcce1
c851f58960793e307606d00282683047863f2840
6855 F20110209_AABXFM denbreeyen_a_Page_078thm.jpg
55466d7459f756e624405f7026ae6f4c
2163d4fc7088fc486573a3063798c7335c7c3991
F20110209_AABXEY denbreeyen_a_Page_061thm.jpg
31d082ac25eae9e50858b5b9de25fc46
274176139e4e84292d2ad7699e6fd7b1234d427a
107653 F20110209_AABWZS denbreeyen_a_Page_012.jp2
c27aec1640d0a460e2062d8be847b5d3
e5b00e998c39be74ae06c3d794fbf3d4282883a2
F20110209_AABWCK denbreeyen_a_Page_133.tif
bc1a6c86f7ff0602fde2baebef68c22d
45f6fa4c7037795ddee390137e6eebdd3cbc131d
9252 F20110209_AABVXE denbreeyen_a_Page_025thm.jpg
ce33a6afb2703a4f7c10ad299ddfcb9c
0b8e361e712b89a371ee3c3fc39c34df4311a5a0
414 F20110209_AABWBW denbreeyen_a_Page_091.txt
e14700e9177b28436e62a675f339af81
19ac37da19f7b3405b576663d3aef0bd88115e0b
4276 F20110209_AABVWQ denbreeyen_a_Page_091thm.jpg
67dd5e0e6ac4109c44d837250adfac56
cd4488d40e400eab76c3200cdbc667257bbfd96f
8787 F20110209_AABXGB denbreeyen_a_Page_103thm.jpg
40cd5903c5427f225b175fcba0f9ef95
44ded46a5efe773bbf8937f334a4e70d4553d85b
6913 F20110209_AABXFN denbreeyen_a_Page_079thm.jpg
711df045744d3a81d57bf28a04ccfb0f
31155785b80beed97a868841ad0f04580e43e20c
8384 F20110209_AABXEZ denbreeyen_a_Page_062thm.jpg
e8f661387f1020f253bfb5332b5b283c
a0eb820ed6adbf899e15847703aa57d5921f6ee9
126543 F20110209_AABWZT denbreeyen_a_Page_013.jp2
e84f70f7ccedcaa33c5dda2237e0dde8
e05998de10093d48937cf8fb9beae06b13ecfc4f
56590 F20110209_AABWCL denbreeyen_a_Page_030.pro
78d81215fb8560b8a252bf556e73a5c6
8ea071d45b6c03677b834ff782e34c576f0c601a
31853 F20110209_AABVXF denbreeyen_a_Page_140.QC.jpg
0efe7b135c974f462200795ce0e970ff
54bb29d1a2455cd6a9ed3306be03a8078c53a559
36129 F20110209_AABWBX denbreeyen_a_Page_098.QC.jpg
202af21cdc32134de5b9be190315decb
42e11c150d46f88c854b38f5b80139131c771a8b
24680 F20110209_AABVWR denbreeyen_a_Page_001.jpg
08d52d2c14b4fe4d8aa9d27871ecf5de
76ad0afd343819eeb8c71d1c21e4fa85900673d4
8662 F20110209_AABXGC denbreeyen_a_Page_104thm.jpg
43bc1698c9e633b875880ffaa0362181
4f77d48e0c15f5e24d13ea24e2c64fdca5796c52
6917 F20110209_AABXFO denbreeyen_a_Page_080thm.jpg
db26d1b81760b3ddf76777ddbf0fb501
773f374177344e0b315bef8419e8e31e9d61166b
16492 F20110209_AABWCM denbreeyen_a_Page_101.QC.jpg
f904d2f98c0eb65861de4d454ead17c9
658d8d1e667143e8b509d2e7045c24994ff3ad4d
2176 F20110209_AABVXG denbreeyen_a_Page_092.txt
6601315fdedac62470d4ab69eb098c11
28d4ef16cf2c9a4c8989f00ccbded8c49dfe1fb6
8916 F20110209_AABWBY denbreeyen_a_Page_041thm.jpg
bc0b40e515addc3bbf8cdf89ef2af5e2
2d39609a37da434d6a0df5296dece34d0b2fb77d
4124 F20110209_AABWDA denbreeyen_a_Page_002.jpg
18a9fd6d2bb229fe9f7bb2a124baf295
23db5d3bd2845bc16083934ee38f0fe276bac2aa
9145 F20110209_AABXGD denbreeyen_a_Page_105thm.jpg
5bb2ec86b90ada41bd78acd85db5a12c
87fbb334ed82fba63e4d65281aa847d39b299b14
6819 F20110209_AABXFP denbreeyen_a_Page_081thm.jpg
b99faec8670727a2b8d7bf6e75b3fa4c
de37736c4058006066bb3637e4638d130f512da9
118696 F20110209_AABWZU denbreeyen_a_Page_014.jp2
95ff6912b32c03852dcd44b862f19d45
fa3e2be3b347281a22981912f42cc0df41e31593
2224 F20110209_AABWCN denbreeyen_a_Page_026.txt
89113261c51afad8b6968fa363527446
596b07eea892ecf1b5c0b4f1d66062b6f4a459fa
131429 F20110209_AABVXH denbreeyen_a_Page_130.jpg
f2f1e82888e2cfc2c35e481361a99f02
8682f1798333be4d104fa435ef6e77b846929823
F20110209_AABWBZ denbreeyen_a_Page_110.tif
961a5c5970d900409a75b22cbbe51d9c
8e4a52fd5e723b4a982fda975771ecde5250d8fc
54910 F20110209_AABVWS denbreeyen_a_Page_029.pro
2a62f9fad10bb97e767bb660045ff6ff
69c352ad205a8b19171cea79fd2779b8c53df09f
6509 F20110209_AABWDB denbreeyen_a_Page_059.txt
6ecd79b80bb3b1778e64b90399b52f69
1e6afb87aa261b891e5a5911daaeeb1272618645
5257 F20110209_AABXGE denbreeyen_a_Page_107thm.jpg
ddb206276d2ca3e9fa1cea3c5d17a820
c6fff97bcbe7aa4e86d8ab4b442d8940b710be64
F20110209_AABXFQ denbreeyen_a_Page_082thm.jpg
19ff57388c3cd5543c8e3fe4ed6fcb2d
f6fe8c55dda266741605e5ca5631c1a9199dbac7
117285 F20110209_AABWZV denbreeyen_a_Page_015.jp2
c6da03bab6cea5125591d805e0ed2d0d
682875a1295b58dd2ce356f7ebe00510dd225734
26513 F20110209_AABWCO denbreeyen_a_Page_052.QC.jpg
eee6acec8a8f90182db4b5bfa7dc87e6
f94b00028ce85476d4933dcf47586aa92aa74f1d
36362 F20110209_AABVXI denbreeyen_a_Page_046.QC.jpg
1d65a3bc077dd644990a05df2fea6a0d
2431b12eba9a8f51c72abc2f93bbb0201c0559b1
14821 F20110209_AABVWT denbreeyen_a_Page_053.QC.jpg
c1a85bd2fb64f53717179ad9c6c3ce64
8bcca8e1ea34dd4c3d5f9d1c697fc6e0575fbee2
119161 F20110209_AABWDC denbreeyen_a_Page_068.jp2
d651114fe608ec81a5d569a10551667b
8286a8471316166c7f7fc135844b47446432b567
8173 F20110209_AABXGF denbreeyen_a_Page_108thm.jpg
b16454eda48bcfc2bd6e8bdc164a371e
f8d33d665b073eb9fcc87b707fa2c1d39fcf4cb7
8909 F20110209_AABXFR denbreeyen_a_Page_083thm.jpg
3215a885edb93911debebf6bb237e1ba
0c8be3db85f21a3a3014791cca67187a0fa739da
114570 F20110209_AABWZW denbreeyen_a_Page_016.jp2
4e6ca2c69590fd5db037e0a1f6551794
d600945b2a28f5bf4eb1210d0e25180a5c00bd81
2151 F20110209_AABWCP denbreeyen_a_Page_103.txt
673a82e0f33fb05856d676954fe8a765
d3455529c0de463b9a13f0d70c858b076d39027d
F20110209_AABVXJ denbreeyen_a_Page_091.tif
118a1c3030ea37248b79ae0acedea346
4e938ef41f90df6753277f3a96ff965c162d77f4
54448 F20110209_AABVWU denbreeyen_a_Page_099.pro
56aec8691010a3a403c5125eb427e26a
1ccc84948f618d7f1efbf3e0cd4940c9b0d25128
7389 F20110209_AABWDD denbreeyen_a_Page_120thm.jpg
40301a32b5ade5558c26dc4804ca8068
848bc8e79a0cc5b83ec417cd998a5d12f61f314a
9006 F20110209_AABXGG denbreeyen_a_Page_109thm.jpg
8c8048e0acfa243b4c1d830c76c4f167
f0b66c5cfe47d8667266598c0b9077894ee685c9
4304 F20110209_AABXFS denbreeyen_a_Page_085thm.jpg
c1327640d3a4e7f7b11d803e4df0fdd8
38d4eb4f2ed85063f182b44a0697801281563ea9
123803 F20110209_AABWZX denbreeyen_a_Page_017.jp2
c66cd19bdfdba39860f32a6216a1da2b
29a5009fdf0dac6666181b0355b989a4d069c5ec
129487 F20110209_AABWCQ denbreeyen_a_Page_006.jpg
628b681e605b8d103b000caecfc7d0ae
81352cb1dbce361274e69b27a3df5d7fd2231c86
8134 F20110209_AABVXK denbreeyen_a_Page_047thm.jpg
02a22ff9b2a79c13164e593effcd33bf
d72eef1803aa7acf1bda4d486c14bb8308705312
17288 F20110209_AABVWV denbreeyen_a_Page_057.QC.jpg
78a6a97ebf5e6c73735d9e78262649e8
e9e09797de334f729728b8b304686d33efe53036
9583 F20110209_AABWDE denbreeyen_a_Page_133thm.jpg
5250f5ea3f9bdfa35c149787413670ba
a59b48b4f1f218a40d8d38aa2a2618e7b2c0fb31
8694 F20110209_AABXGH denbreeyen_a_Page_111thm.jpg
486914861a2fd0e8b8d8a31c24cd712b
640478e2078663e805da4b70ed3982c51eccb991
4398 F20110209_AABXFT denbreeyen_a_Page_086thm.jpg
407f31832ff064231eb59ab9c64838f5
9638b8d69efcfee9d1e97eeae80d235df5b780f6
121142 F20110209_AABWZY denbreeyen_a_Page_018.jp2
28f545b8ee8b4c02a3c779419f9eb464
ad8612161d480e02a1de09fb3a436f2ae1ef7c6f
F20110209_AABWCR denbreeyen_a_Page_008.tif
7a30396465143fd794d0a62e84993194
ec0aaf44ebcaa6cac55b69a006c6d61b2e498aa6
9298 F20110209_AABVXL denbreeyen_a_Page_098thm.jpg
741aa666c09d17c42a3636361ddea977
83076f9dffc3d1c5d688f44fc7df174cc297b1cd
19116 F20110209_AABVWW denbreeyen_a_Page_084.pro
5af242b4204c9310b02901d18272e3d3
aa6afcfc92645e8581a993971d4f2c6d78d162ad
35339 F20110209_AABWDF denbreeyen_a_Page_114.QC.jpg
91ac303a0cceae14864a521df6b173fc
201d258918d81518332ece8fbaef5e72a374304b
2036 F20110209_AABXGI denbreeyen_a_Page_116thm.jpg
5c0a32a62d5f5193fccc79c0f87684b1
5418d7ac8f3123b043a2da87644949b743f1fac0
3992 F20110209_AABXFU denbreeyen_a_Page_087thm.jpg
4108c05202aa2daf5931001f5e5d3764
adf6cecfd12c3d33d6725315ffb00f1fb51874b5
116213 F20110209_AABWZZ denbreeyen_a_Page_019.jp2
4adfe8413a506b447bdecc22c2e4bc7c
2476f1f3425f726fb4ca7d9c07b065221c779e2f
66595 F20110209_AABVYA denbreeyen_a_Page_057.jpg
f89898cf7845cfd8569fc21c550b82d1
746623a509306ce1f424b70e68ed140d94107d46
F20110209_AABWCS denbreeyen_a_Page_115.tif
bda114940171390aa4f9bd13b90ca8e4
1a8407ae377806fef00f7beaa673c980f7457eb1
108941 F20110209_AABVXM denbreeyen_a_Page_066.jpg
e3917d533aeea583e744d01967c7ec61
b53e7a6b712887fea7d2038b414d90dce01e8a5f
154695 F20110209_AABVWX denbreeyen_a_Page_125.jp2
166bd69a7b846636f1667128fac889a2
bd2b37e8d81f78c849dc3e281d03e1f08a087e46
13975 F20110209_AABWDG denbreeyen_a_Page_086.QC.jpg
710c5701b791201a39db232b0cf5c991
6f86420a21c84f244757d3a3af418fad026a0f69
7643 F20110209_AABXGJ denbreeyen_a_Page_117thm.jpg
347638144675df0d993f5fce5e1a3f1b
c4fc53b651bcc5e5db78ffa80b5d08bafe90c76d
4050 F20110209_AABXFV denbreeyen_a_Page_088thm.jpg
144c33b57a548159137c6687d3889891
0932a770b17987dcae31a89cbac48686d5a3c09e
8853 F20110209_AABVYB denbreeyen_a_Page_015thm.jpg
2772e20d55d34edaac5b21cf56ff512b
8591ebc6251583974c4690f656dc909f03cc0e30
51657 F20110209_AABWCT denbreeyen_a_Page_028.pro
efeb064acfdaea4cfeae8c8fa3df8fcc
a17493e84b074147d6ad7f7c370e6a5fdc294d5b
21880 F20110209_AABVXN denbreeyen_a_Page_116.jp2
e31e84963672ab0afe18774bb34d456b
e7c5d3816447e0b5059b2eb950129d8d0ea9d46f
8810 F20110209_AABVWY denbreeyen_a_Page_004thm.jpg
774790b473939f87e74f4e028480075e
4ccaad7e6be8f05f4f4504397ee57529e3398a76
1261 F20110209_AABWDH denbreeyen_a_Page_107.txt
c48016cdf2d7ff176e5bf08371be1814
f2ae53b47d7fd1a71e137e402ed1670ee19edd74
6021 F20110209_AABXGK denbreeyen_a_Page_118thm.jpg
7ad55e5813a59b996a67a100c840646b
9bb7d43e53edea7c9f770628972f3f06a4f5ce07
4001 F20110209_AABXFW denbreeyen_a_Page_089thm.jpg
f2400c74dbc4a2411c5258b07c9f3784
f59c22429ad99e3b45f15cbae638f0045179dbf8
2029 F20110209_AABVYC denbreeyen_a_Page_111.txt
4a6d2d3b002cf9addaa4c98f3306912e
e6a36a2bca98b4a2f553af9b73fe6f0dc959dce3
8767 F20110209_AABWCU denbreeyen_a_Page_014thm.jpg
13d6741093b4b104bbcb7ee13e36d9ea
b289bd370ef3ae00bce03e5f4b886f750e88994a
615 F20110209_AABVXO denbreeyen_a_Page_009.txt
009be083cc54c3e276e6dc1a67c92bbd
3d08c837f1a7e3bd19375a981ddee2a98be9b294
104466 F20110209_AABVWZ denbreeyen_a_Page_044.jpg
8ee7f2a691561908dff0f66ece982d19
77a902d69836aa9341b958dbbc7dfc2bc4817033
1383 F20110209_AABWDI denbreeyen_a_Page_003.pro
01dd65b30fbe2ed67a75a5bc3082bc3f
7927f36262febdce4ef3e3166722db0cee8cdb7c
1003 F20110209_AABXHA denbreeyen_a_Page_139thm.jpg
75ca151c482a35c8269e6e5fcf0b9a1a
94ebca144048901160ea799ab14eaecd0953230c
6891 F20110209_AABXGL denbreeyen_a_Page_121thm.jpg
e82ae76323548fafd657b12d1d752f6f
ee0e0dbfde27ccbd38c0bcdae63074659dbdd0d4
8677 F20110209_AABXFX denbreeyen_a_Page_093thm.jpg
be6dcf57ab1d3f0ffc2b71aaee0672b4
ac299fac79002961d405352e8d82af801d195852
27210 F20110209_AABVYD denbreeyen_a_Page_053.pro
092676a81ec77d6ec51d3f8d492df7d0
e77dfd67dbf743ba7698c548a58cdeeaa691cded
48744 F20110209_AABWCV denbreeyen_a_Page_012.pro
5f71c9bb1c020249fec419951902bc5f
7927ae2f6d50d1f6733cc08a8bea36124370884b
126043 F20110209_AABVXP denbreeyen_a_Page_020.jp2
79251b223d9c8fdd9d98eb55462e2962
1d487cec9c16c4fc8c8d105e85731b101bb48d61
9190 F20110209_AABWDJ denbreeyen_a_Page_032thm.jpg
8b5089910d3e5467260eb40df8353f25
2cd4f2efbe3066df08608719570e0f63bfebd460
F20110209_AABXGM denbreeyen_a_Page_122thm.jpg
c95159ee7cbc65ef50fc483b3a048fd6
da5498e1ed1306da075559bcad4a362475d9556f
8475 F20110209_AABXFY denbreeyen_a_Page_094thm.jpg
b9fd387074d6d483f7076032bf2b8ffc
f27e0fa40795965d57001cd57912e8c3a45b50a0
F20110209_AABVYE denbreeyen_a_Page_098.tif
88bf7790b492658d9c011dc118711ba5
a29be0fa83e7c93bdbbe0831717af85750e8608a
51363 F20110209_AABWCW denbreeyen_a_Page_120.pro
e8284f98030fda08cd852eaf5a96f46e
f445888519bc95469e954238d60bb61150d458c4
66024 F20110209_AABVXQ denbreeyen_a_Page_135.pro
3d9670c71f68395683bcc7ac7ba6dc0e
6b063c238af44ca41a7b9a8f39c6725f686478e0
137290 F20110209_AABWDK denbreeyen_a_Page_135.jp2
c232e18f3b7e588447d961d68e00302c
7bdd33704909b85e727748c5c799db348cc54096
7803 F20110209_AABXHB denbreeyen_a_Page_140thm.jpg
66b78ffeebe2db0fd1decf67ee94ea5c
0078f35d1710f0aabbb205eee1b9b2116d65afab
9143 F20110209_AABXGN denbreeyen_a_Page_123thm.jpg
481631d4f72e9a8e1e1ed07b7b278886
497ac539e51e8649edf7bf3f3f67c6d5a102f83d
8742 F20110209_AABXFZ denbreeyen_a_Page_096thm.jpg
987afaf12b8b53dbcf9846dfa2faf9ab
bccebe33f007d9ee28787fdba7203e07980f91b3
29834 F20110209_AABVYF denbreeyen_a_Page_006.QC.jpg
47ca7b0f49e97c95f17d65b2133ff124
90048627224facd3ad204f1c7b5b73737c1e6ed3
F20110209_AABWCX denbreeyen_a_Page_088.tif
f445e25d047e60006412df71fda59499
590764499bde0a65647cb61d6f436cf3ec6af009
2368 F20110209_AABVXR denbreeyen_a_Page_079.txt
2126c42661a9ef17dbfa14f3a0d9a873
48bcad9f894f860390c03f3bb35e8fc005916c86
54283 F20110209_AABWDL denbreeyen_a_Page_015.pro
7a8e95193e7547cda59f5cfa00212394
196c3b530806264e9266b55f84823adef7b27ad7
167163 F20110209_AABXHC UFE0021764_00001.mets FULL
80603152d3140397220a158382ab468a
4280f26303e1ef4a92ec19dbd06b865d1490a592
8963 F20110209_AABXGO denbreeyen_a_Page_124thm.jpg
735b47873664d9bd2633857697bbd610
242a2237c165444a10ab9b70f75555c81c45cef5
18363 F20110209_AABVYG denbreeyen_a_Page_115.jpg
7fbcb3528f0fc550b5811c0419cab97d
79bc7b89c9292e05828118da0610d099e9716347
F20110209_AABWCY denbreeyen_a_Page_085.tif
f007c8f9a65fdaa3dd57ef167abda0eb
4d0b9f896a85688c32350fbd423d96f341543431
40521 F20110209_AABVXS denbreeyen_a_Page_089.jpg
99854370a98144b82d933e291ee36d00
b9f7a9553934816902eefedadb02cb951fbb9ecf
29277 F20110209_AABWEA denbreeyen_a_Page_120.QC.jpg
65b32b8fc96945757d11da78c0a00768
929d065b6c513a82252307fbd22da8cf3bdb57fc
36482 F20110209_AABWDM denbreeyen_a_Page_138.QC.jpg
98709ced2592e0044746c62123c471f8
4a5439b22678d9d5264e56b8e679417335fcfe8b
9689 F20110209_AABXGP denbreeyen_a_Page_125thm.jpg
0c91cab09f9d1491a8bc769b948fa95b
727f264445f080bbffdf6005797975f0594fcbeb
57259 F20110209_AABVYH denbreeyen_a_Page_061.pro
b85227a0e56de78dd7774d3c92a4b96e
bed47af870e27388c16dc06e29b197fe6884244d
114337 F20110209_AABWCZ denbreeyen_a_Page_063.jpg
6cca3090cebaf02100e1ac017cf94fc2
080c568d4582961f0aa33e6ad99ca6599773f6cb
11906 F20110209_AABWEB denbreeyen_a_Page_102.QC.jpg
106d2d565ae184d6fd7eb5ada6cfc95e
dedc7f1bd5519d0738c72fcd3028bba872a54639
3721 F20110209_AABWDN denbreeyen_a_Page_100thm.jpg
f1b57dc2d4bb07e9a50632fc75cf8aae
592e3c7155ce30d051d8bf3b4990e1a12b76fe91
8832 F20110209_AABXGQ denbreeyen_a_Page_126thm.jpg
8343bd484099705667bd3037b8bd6b2b
a191ab49c17ac65eacdeedac08c225c79c346ec0
13993 F20110209_AABVYI denbreeyen_a_Page_087.pro
835f8ccbe739e27f7cd6e7c3ea1f76cb
b78dfbee6389ad7c79a4fafd127d43f8ef181a07
3956 F20110209_AABVXT denbreeyen_a_Page_059thm.jpg
4ed8ca9b144fda016587fc7672354b8c
6120d4c8586ebba74c6a8444e1e8adc9d563ddda
F20110209_AABWEC denbreeyen_a_Page_064.tif
e4be793715523bb43f64ed4dc65686ac
c62e1e855413a1c8a600894d3598838c966d653f
113044 F20110209_AABWDO denbreeyen_a_Page_036.jpg
e460272337bbf27cfc686b9cbee1ec49
495db23f1268b43a8b0e49da18457b1eae334c2e
9277 F20110209_AABXGR denbreeyen_a_Page_127thm.jpg
4e7551c03142f1cfaf17b377976478ad
5797e09664331405891df362b46390b3af23f2ca
4242 F20110209_AABVYJ denbreeyen_a_Page_084thm.jpg
8cf8830431724876b79d735606520b19
fecbec40207f92f601c452eec8f54fd62bf0fa79
5277 F20110209_AABVXU denbreeyen_a_Page_003.jpg
dc9c8ec8310eafe2fe126b988360b697
c94cf219adb56551b35cad492031a615baed8771
126158 F20110209_AABWED denbreeyen_a_Page_030.jp2
0d01f2b3eae43cc798dcae47bf57fefa
e653719dd7cceff493b4e05988baebba826a80ae
F20110209_AABWDP denbreeyen_a_Page_043.tif
88692bbfa806e770756d5c6eab447947
2b93cdd4d4022cf84cf32bc8bd8f4620679164ec
9363 F20110209_AABXGS denbreeyen_a_Page_130thm.jpg
068ffb826dcd1ca0208c07a37e67a08c
91d9cdb88587ca871c08208ec7f1c3c316533229
113579 F20110209_AABVYK denbreeyen_a_Page_065.jp2
38222cadf212b1caa7ead0ad23f38bed
16acf8f088fe1a98325ee5caa9f57047a1d8b14b
F20110209_AABVXV denbreeyen_a_Page_018.tif
1f69e61b76d6cdef9ffbe785cbe15054
f590fccd28f0275b552ae8bd72e8d3ef086fafcb
F20110209_AABWEE denbreeyen_a_Page_105.txt
2b88454d1ab7a2001a2c6c3d1cf67f88
3728ceee062758d8983af04b84e7e223c885b1ef
106845 F20110209_AABWDQ denbreeyen_a_Page_081.jpg
db9a48c681e5b60eafb8dcba6bb940a8
0b8c51f98f935787bb2ee882110fe272b3669fd0
9518 F20110209_AABXGT denbreeyen_a_Page_131thm.jpg
aef30f42f51e9dfb2c8b79eddc8f8846
c4b2ab17865f780da23b7941a1d2b8ed2762126f
37534 F20110209_AABVYL denbreeyen_a_Page_124.QC.jpg
2165b2225baaca8d3cebe6145cf0ba4d
6d209be75665aad778bc351e4c953a295ee1caf6
113113 F20110209_AABVXW denbreeyen_a_Page_097.jpg
b17559b7991b4ff7b7466f0122b80abc
5093ed4779348092ee7dae1ebeceed92e35ebe52
2044 F20110209_AABWEF denbreeyen_a_Page_048.txt
8f93543b1abb34af7ba4003b57461212
8ce7b567e2b8b73914a3070ecc12ca784fdd54a3
8737 F20110209_AABWDR denbreeyen_a_Page_016thm.jpg
fa136afacd322ad5309363e594114811
b1784b39361200761774b29191712b7fe0c9cc33
9688 F20110209_AABXGU denbreeyen_a_Page_132thm.jpg
d16c126aa7544325bf87564da7ad2b2e
643ef55a82334483f764e6bf24003af01313cfb6
F20110209_AABVYM denbreeyen_a_Page_105.tif
31306697d2971b4736d5b025c1aa17c2
5eaa2c39b4b1a08f8517e961e068ee46122758bd
37267 F20110209_AABVXX denbreeyen_a_Page_123.QC.jpg
c68831b477e1382628052962b7a52615
3bf78e5a11ae5ac75326d448b1a3c24b4a7364be
109024 F20110209_AABWEG denbreeyen_a_Page_099.jpg
9a49a50e0cd824157816eea780f6ac2f
fcf4aec6a843ac12ea06276e86cbbf7ec02e79c8
34798 F20110209_AABVZA denbreeyen_a_Page_040.QC.jpg
8ad3c76078bb8597d023c239ef9b1158
ae0d6a01b4fe797923eea69d9cf6f5a375b49ddc
113006 F20110209_AABWDS denbreeyen_a_Page_067.jp2
f104068ef97fe49941ce62e5339474b6
07f4644fa3a40fb4c7ac30ae8ba0fa2e954c7d7b
9282 F20110209_AABXGV denbreeyen_a_Page_134thm.jpg
ef528868337f9e621e1af52db9d7c0a1
5956fdde69f6d1a37f39ce95742177e3ef1e0520
24627 F20110209_AABVYN denbreeyen_a_Page_100.pro
7ac7ba2b1995e86604c77ab04e90f5a1
d53a97e7fa97c907fa2316b87c84aafc278e8c6c
2031 F20110209_AABVXY denbreeyen_a_Page_028.txt
6d0876daac186bb22112cfb6fbaf79f6
8da7adf049c6fa0014b2939357258483ebf3ed75
F20110209_AABWEH denbreeyen_a_Page_071.pro
3a07a48693246e6283fbfecced0e84d4
afe2b9c1b843f12269b176d0bca9625d6b0ec810
108570 F20110209_AABVZB denbreeyen_a_Page_106.jpg
3a9fee582267a8d040fa6a4b72ea9e14
2756204f492fc22357c2332bccad073783bdcfad
4802 F20110209_AABWDT denbreeyen_a_Page_101thm.jpg
6f6480f45fb95c8580bfb5f107f32665
1570fc87c6d0d8de24ee43d7ab63c5946450ff65
9146 F20110209_AABXGW denbreeyen_a_Page_135thm.jpg
c87a2532fd8190a772376b4377a99f63
6d3d975b86db4ce239a18f2f9be8a71743170d54
49120 F20110209_AABVYO denbreeyen_a_Page_053.jpg
2678af652c190d6fd1a6295ac7556225
4af14f17a54a950f8bf9f7554b0ca1fe708ac595
117088 F20110209_AABVXZ denbreeyen_a_Page_119.jp2
33221b36f91c8b05969c5ee1e9482382
2fc780f6a4969b93034adf8f9eeebd45fffcb95b
38046 F20110209_AABWEI denbreeyen_a_Page_027.QC.jpg
8477412a920248f3eb51d3037340fb27
a0036245e8bed86187744e2f748c2ef8fb81e5a8
F20110209_AABVZC denbreeyen_a_Page_097.tif
a3912daa1a793abebc737e500354f03b
0fef245042890c65cd1ced4c7a5abdcdd11a0e7e
F20110209_AABWDU denbreeyen_a_Page_128.tif
f2024b11dfb54475bcac21add3024af7
b1ff67fc14b86e49531335020dd06cbfd112447f
8924 F20110209_AABXGX denbreeyen_a_Page_136thm.jpg
03ab625e76623e80b5f489151908ae33
bf8b9bbb76665f6d04dd5999d98b0263fd25f478
65482 F20110209_AABVYP denbreeyen_a_Page_124.pro
04411e99536fef787ee750fe9014939a
db07d1da5318299c8b7a8476bfa91dd68b7fa3a8
93 F20110209_AABWEJ denbreeyen_a_Page_002.txt
06d942a569e371a90acd484766a24ba5
9dfb7d3179c112eb3982b08c8dd51f49fd561ade
19547 F20110209_AABVZD denbreeyen_a_Page_005.jp2
246b127ff8aa0a22c508526ff693cf92
0430d3676e16c989dd1521c29bc881b8f4f636ba
31736 F20110209_AABWDV denbreeyen_a_Page_107.pro
90a54856e981176536bfb29ec956c036
81d5e66e18720276e8908b25062f7be10b86b9b5
9123 F20110209_AABXGY denbreeyen_a_Page_137thm.jpg
e24b988de56a24c519b574f632b3516b
c8a8f3fd9f97d3db343b3128e95155c84e0b08c9
2490 F20110209_AABVYQ denbreeyen_a_Page_009thm.jpg
7a44c7708daba49a7e6a3e621d8a8d37
1b0404d8471b500cb76dca6572f44fc1661e8a98
55611 F20110209_AABWEK denbreeyen_a_Page_105.pro
221318673d2ef7739783be05079796dd
e7bc4aac3be7f00e53dbf0d892e1a0ab43dd4d7e
F20110209_AABVZE denbreeyen_a_Page_109.pro
772d59deda2ad42a22292dd3e6cec134
b7dfe26a99293bdda04085f2b332ac4f616f19b2
5304 F20110209_AABWDW denbreeyen_a_Page_090thm.jpg
fd530f4c27492633831d17b8b67d84b0
fc76d199ec7c2a054d8982ad7f8f5138a8aec27b
9148 F20110209_AABXGZ denbreeyen_a_Page_138thm.jpg
f69d38d82b57a155de644fcad5bf0e45
4a5ab40f2a1b912187c32b36646d35abbbd333a3
52906 F20110209_AABVYR denbreeyen_a_Page_076.jp2
bd86fec06619810699ac86c899e89690
693a2d5a4dcf1b5242fbcc2a0a0b099bb685aa46
F20110209_AABWEL denbreeyen_a_Page_140.tif
514bac7bc92f86c9b7bf20a05d8446ba
4edbc345654d2ed09fc988b70471cbe90adcaafb
53884 F20110209_AABVZF denbreeyen_a_Page_049.pro
fb7acced2e640f79c4c4e55f9abd1ac0
c81127fdd4c2ce819fcdedebf6810d153d640caf
35040 F20110209_AABWDX denbreeyen_a_Page_049.QC.jpg
cafeeb8ad149a5ac1c99c8704e32458d
1480969e28d58b10a6b3c5046b19f19a07a61c01
37407 F20110209_AABVYS denbreeyen_a_Page_043.QC.jpg
1eb32c96c920c5c9cdb41a2b6014bce8
c3d2bf5df10cc925914bc444455fe40534152b5d
114411 F20110209_AABWFA denbreeyen_a_Page_027.jpg
43056d2d17791d1b131e6e02c2718a43
3e2503fda0fc29450146ba3c0226e56437413ba4
2072 F20110209_AABWEM denbreeyen_a_Page_114.txt
8d64915709b568c89ae0b9e88d98e5a2
9ec1381d595bfdfbe4e4210370376a1a76dff126
7762 F20110209_AABVZG denbreeyen_a_Page_119thm.jpg
d209e6141ed3d3e5c4b7d3f1b7a380f0
07b00fe63f4737f03bee38b27dc6e4cdc2ba4560
53416 F20110209_AABWDY denbreeyen_a_Page_043.pro
8190050138eb489a7de0b9fa0d425195
905c724db03b16e24302230621a6910af5c4d677
114857 F20110209_AABVYT denbreeyen_a_Page_081.jp2
5dbcc03dc58da4687f7853065f0c4a97
b41428a208a2d6fce502fb80cf1dda3238594f83
F20110209_AABWFB denbreeyen_a_Page_074.tif
2549688d75260667f4d9ce1a48b73882
f40a6af4f3fc12d7519d6ead0539624ac7fc72c7
35158 F20110209_AABWEN denbreeyen_a_Page_110.QC.jpg
c0a0d40ca7846312a12143a3818d6e27
d833122630f10df30e69d9cb0a49b590ab1e1544
36007 F20110209_AABVZH denbreeyen_a_Page_092.QC.jpg
2f2017cc960ba7055552fa7472380225
6b39cf2660c0075cfab77a00f32e0144fb4d045a
196 F20110209_AABWDZ denbreeyen_a_Page_139.txt
25fab2783dcc041b1df339a9a5e597d3
3928b16a6c757bad3a28d3caa30c7d194d2fa539
F20110209_AABWFC denbreeyen_a_Page_124.tif
08672dd05ebfbb0b59cf18fe41356beb
f42cce5043456422261ce816acf94ada5a7741b0
F20110209_AABWEO denbreeyen_a_Page_131.tif
117147d2f8c653b9b9784f12f05204ea
e309823643616e9c7d9f8b7b4abe927a0bbc9663
1795 F20110209_AABVZI denbreeyen_a_Page_115thm.jpg
3961772bec9b903713b7e2a900c27b0b
f8efdd5b71fd4fc67985423358dd238d81de5c77
50484 F20110209_AABVYU denbreeyen_a_Page_090.jpg
1c39a8c08bf617de04c57e00b876e317
45dcf669607fbb9bef6f5f628d849a27ad9e2488
18247 F20110209_AABWFD denbreeyen_a_Page_005.jpg
c944a95d364886efb31fe01dbf90ff64
2836160f4eea57d96673523efb48077f3e12bce3
33049 F20110209_AABWEP denbreeyen_a_Page_039.QC.jpg
6436d18e8cd025836f174b46947bc464
93fe1cb6f763c30df240ec237f202317ed149b7f
37854 F20110209_AABVZJ denbreeyen_a_Page_030.QC.jpg
84e4868ccac4443031544474331679a2
dee696f6bb2485e0c49587cb7acb6c1b69090d5e
F20110209_AABVYV denbreeyen_a_Page_073.tif
72a8a7d0a3b0d9df0769d8cb030fbe85
e17b9e21aede7575320b7c44ec502c35d0ad1481
136678 F20110209_AABWFE denbreeyen_a_Page_137.jpg
bd14c92ae6fec7c8e3af00c120e5b670
2854608f4b116ff8cffe04dd8a8d054a4c5c2efa
106236 F20110209_AABWEQ denbreeyen_a_Page_096.jpg
08bd3f302620bafab3b8d5461c7b2fa8
1a4b6dc86c9798f4e330e775c673f0d94225aacf
58854 F20110209_AABVZK denbreeyen_a_Page_058.pro
1e23c1e085062c91b2b4c6d64df05949
c425f7c257756f536e6ac9e9a5d8baba0e034304
9051 F20110209_AABVYW denbreeyen_a_Page_116.pro
5459ba9c85f17fcddad3e847e3710946
5094d8786de9076ecb5998f7ee387e70b490e388
55475 F20110209_AABWFF denbreeyen_a_Page_023.pro
43dffe38a0a8bcece76c45ecf53e6546
ade1a1d9da62a8c12320e0a3e0caa8779f7fb553
114596 F20110209_AABWER denbreeyen_a_Page_033.jpg
3edebf5003227476b12a17b72603fe8f
4ad1e4c2abb19e587dccaeb0c2d8778052dcb9f9
125411 F20110209_AABVZL denbreeyen_a_Page_025.jp2
18bc706ebcf91dd4c0054aee0ff14420
d007bff961ed600914c7e06af5793e792211b477
38028 F20110209_AABWFG denbreeyen_a_Page_130.QC.jpg
22020a32df2b6e46659e6dbe1be109ce
f4cdbcd6ed541af39208e53ef4891b30c4f09216
2255 F20110209_AABWES denbreeyen_a_Page_038.txt
fab00e026f03e4f6d17847d9221ac647
f0b3d480b6ab903312af8875a47e1274873f8c7f
4869 F20110209_AABVZM denbreeyen_a_Page_058thm.jpg
29bdb6b2413952b83ee0f0b86f428ae8
410e841ca1e5168eb3541de420e7b55686931d8f
8639 F20110209_AABVYX denbreeyen_a_Page_106thm.jpg
00b7ec5af77d78978a79461423702918
171899b30af4543905edeab646ce5506c53c491c
119432 F20110209_AABWFH denbreeyen_a_Page_051.jp2
feb1b1d7d6bd93983511e1c5d2b2a749
44e684e8d18f7d1947379f286572c552153ad86e
F20110209_AABWET denbreeyen_a_Page_106.tif
66e95620931024b72768e730fe12e2d0
e3e5d381a924de5d3a6aee34aea98db50fed351e
F20110209_AABVZN denbreeyen_a_Page_067.tif
13ca2402f34807a3f2459c60c09f5ed8
64ee14c70789da9b29ee5da258b88f9110d105f7
7250 F20110209_AABVYY denbreeyen_a_Page_116.QC.jpg
0a5155d776c6d3983cfc2c028d7308d7
91c0ae365992620aa72f19055f4fd8139e48ecc1
111862 F20110209_AABWFI denbreeyen_a_Page_041.jpg
9e658c22ee952f19bdced1643f721053
13e20f7b112df388f164760d9536d4bca6221265
115496 F20110209_AABWEU denbreeyen_a_Page_119.jpg
7c9bb919b31e6b278ffe74aa657a663f
1b6f586b0f0a183179e0d302b9ab0e413da475df
2132 F20110209_AABVZO denbreeyen_a_Page_022.txt
e88787942e1b12634c4a2ec5a6efd5ef
b8a6c98bd89e412e4a56885b2f09b8745ea1da5d
3050 F20110209_AABVYZ denbreeyen_a_Page_125.txt
fa8e3bef83df22316c3105ea08f43e3d
ec7d7c5c7693fbad2cdb3853d32113f97c43266b
8889 F20110209_AABWFJ denbreeyen_a_Page_030thm.jpg
fa5c203f51ae4221b37d026a012969e7
50028e049839f8c5c7625e788fd16e48a7851d42
108576 F20110209_AABWEV denbreeyen_a_Page_073.jpg
bf93d4e3abdf2af4be970c180d140aa0
3d2c71d9370a869f6bce349b2111b129197ef2b9
9184 F20110209_AABVZP denbreeyen_a_Page_027thm.jpg
ba4bcaf082a9b79cc0bcc13f75e00de5
8f1724421271e9408ac826a6e170d797a8f74f14
8139 F20110209_AABWFK denbreeyen_a_Page_112thm.jpg
dd2f1fc139b85d5e82cd625ea214856d
50427514a18ee6e2060586cda956bff93fc9da70
8951 F20110209_AABWEW denbreeyen_a_Page_071thm.jpg
949efdec1c40238cc03028677946a595
e6d0e9c92f05147400e47395a8f610720cf01d54
30188 F20110209_AABVZQ denbreeyen_a_Page_081.QC.jpg
dab1d4da72c87fd813839a5d359d07fe
8beb02a73cf23ad0bfc865b3aa3121eac0667781
528 F20110209_AABWFL denbreeyen_a_Page_002thm.jpg
f99ea7d7daf5d59bf05a7d9724f57236
0d164fa8c9252ee5ae7907d0e937b5dc6abbcbe4
24171 F20110209_AABWEX denbreeyen_a_Page_121.QC.jpg
4aef021f9c063a6e942d30fc0e8fce21
5a57a562dc311ac0691a9c987989e83dee1e5d53
9041 F20110209_AABVZR denbreeyen_a_Page_010thm.jpg
d492c16cf7c97aad63b7a531bbda0431
a90bf4e2f511a9fc79f5ea2243bd93a6f44a68bb
1051964 F20110209_AABWGA denbreeyen_a_Page_123.jp2
6c44cd3cc32ab2c1ad2df81ca4bd11eb
37601f63b1bd3975abe21f3593a92167cd1ffba3
8986 F20110209_AABWFM denbreeyen_a_Page_113thm.jpg
e62d4534bfb294987d9f67e0e5a93f99
03eec394b0e44c8c5bbd70e3d2f400fdb0f614c7
8753 F20110209_AABWEY denbreeyen_a_Page_092thm.jpg
a468a1f7a1f6de538b8daa6f7c339f45
cadd9a16bbd73dc1ae1ee41ada04ab14ecd70ae2
3556 F20110209_AABVZS denbreeyen_a_Page_102thm.jpg
0c10eb86aed8a170b2b314bf764d0e72
cb0c856d3f5d328375a28a21c276405971836139
2082 F20110209_AABWFN denbreeyen_a_Page_045.txt
cbe551c4f916112c52d32bb26b0c2132
5989a464276ca8ab70dd6fb9c819ad291b4d4c3b
8664 F20110209_AABWEZ denbreeyen_a_Page_065thm.jpg
a00dedcc033b9438593cc865197eb8e5
3808b331952a83a907be186b4306633d54f76f17
6462 F20110209_AABVZT denbreeyen_a_Page_003.jp2
0fadc5cfa7d641caf53181321bf4c7e2
58b89257076229736d4f0a3fd6bb62f121bf5de7
111005 F20110209_AABWGB denbreeyen_a_Page_046.jpg
e2488d19468752c9378ac08c47316a7a
9dec2acd187bb329e83b119042ea0b07854b2f79
132891 F20110209_AABWFO denbreeyen_a_Page_136.jp2
044d82059f0618f1de8dc5fd51a45e20
0db260296f3635d466434c6fb0a6921dc5b2c0f6
57240 F20110209_AABVZU denbreeyen_a_Page_031.pro
6e79d8b8584e789144b6a8216d7a8f9d
1c54876f8036425a77f03ce8a34a383ed4018f60
F20110209_AABWGC denbreeyen_a_Page_059.tif
efe71471e387a3979407d7d841ea841a
6c2c7bfd660277558a90b40e29c91cb7d2d5de6c
56031 F20110209_AABWFP denbreeyen_a_Page_097.pro
3f0bbca1e072d008c98136caacba147f
c8de34ee58bf3e16c49a09173ed1da73a6a13155
9445 F20110209_AABWGD denbreeyen_a_Page_008thm.jpg
13a9e82c9532da481a2f82a04f883458
e28fb047d1bb76f99bf1e6af8b206a5bd3bb40be
36703 F20110209_AABWFQ denbreeyen_a_Page_015.QC.jpg
a567ae5c63699ac43277f897c060dc09
a2a284129889b6cee46d36af96312b4587b6650f
112086 F20110209_AABVZV denbreeyen_a_Page_034.jpg
4a079fec31066e7d1065229d218ffc6d
68f0e63913651d2f178b1a98fb257ef838b5c365
1282 F20110209_AABWGE denbreeyen_a_Page_100.txt
ec54f7f409f20b0f860445a901df5097
dbbd5bfd74b29b988994342a32212c921b2852d9
7591 F20110209_AABWFR denbreeyen_a_Page_095thm.jpg
838fec1bf2fb8d5ac23057ab5986fb7f
689aef1f505580feda12b8bbcb934407a44023f9
114738 F20110209_AABVZW denbreeyen_a_Page_114.jp2
1e3f9aece23a6bd6c45710270a26c85c
43faee2aa226be94dec6dd485533bae97cb2fb39
F20110209_AABWGF denbreeyen_a_Page_062.tif
ae0ac5ade37c793da04b62852982853c
db3f16c4d7624312e0a93130498db9d2f40c3578
8811 F20110209_AABWFS denbreeyen_a_Page_099thm.jpg
9e419931dccbcd86ab2978ca1a1f915d
7425b52baae723a0f962416d245f99694ccc7c69
35712 F20110209_AABVZX denbreeyen_a_Page_022.QC.jpg
15996508a50246fcb3f2c67e0e988aeb
4bf3f99f6dbbdca2db6b9920379c3c79c97f319d
103758 F20110209_AABWGG denbreeyen_a_Page_040.jpg
51d225ad37f972a108e678599fa442aa
a29555e6686385d4402ec9059bd05051886981b3
8866 F20110209_AABWFT denbreeyen_a_Page_021thm.jpg
9fdac90a759b644df0c734e75501c606
3100fc69898588629fc5558336b34bba3d3a72b0
F20110209_AABVZY denbreeyen_a_Page_136.tif
d277cf069153408ea6a3f904330602cb
40e5d4fe53ebf1137bae6bba7fc069cbfee8ca78
56104 F20110209_AABWGH denbreeyen_a_Page_068.pro
0e1445a43f584d6a7ff4bcfaa0c24bda
1df21211d9b33dd722c36464b65f0d77701d9cae
F20110209_AABWFU denbreeyen_a_Page_102.tif
29fc0bf5bb7ea738090218687b5f5432
146ddec5255039f04a5e3e175dabbc9eb3813ffa
1976 F20110209_AABVZZ denbreeyen_a_Page_064.txt
c0596c18526a755badbe7c6339a57589
37e6bf8832004301d62810b96ad6be9da47673d3
45533 F20110209_AABWGI denbreeyen_a_Page_082.jpg
fa0a669ce24ac907cee7dcd000dad772
cb73199ed96b52c18f8bb155454039971b4332f7
1051983 F20110209_AABWGJ denbreeyen_a_Page_010.jp2
1c5f9a7cd8161782e87fba81311175a4
6171459e14822600000f7974e2edb6c76b9d4228
9256 F20110209_AABWFV denbreeyen_a_Page_038thm.jpg
1def5246752997f189ef473a455f508b
2378da737dce4f341a58e709a50cb5f5dd82e9c6
145407 F20110209_AABWGK denbreeyen_a_Page_131.jpg
12d4c3967e60c0834893f3707d2fc38c
cef0042ab94249cef11265e5b31b93a0c1e7e742
1866 F20110209_AABWFW denbreeyen_a_Page_140.txt
d54c7b26331a45702f1df41ece522307
6990f6528eec35f96f2b1fc49cd6152333488747
F20110209_AABWHA denbreeyen_a_Page_011.tif
2a11e45de53e12f26c649008c43406f6
abed6df3d6b261cc6673671fafe9b9cca868a57d
12033 F20110209_AABWGL denbreeyen_a_Page_057.txt
b0ca77360801dd9aafdc31238fd888dd
14323e7e577e67bb5419488b97c541a14fb79ec3
3795 F20110209_AABWFX denbreeyen_a_Page_006.txt
10860c9352add91239e9a56166818f05
921f2adcba60b1481ed99d7e5d0c7e5ce465756a
F20110209_AABWHB denbreeyen_a_Page_012.tif
094ff42755aefa5636cacebff9d5ef50
dacdd456ec24da29d6da351951bb5bd4720c614f
48234 F20110209_AABWGM denbreeyen_a_Page_053.jp2
a6e276b858ee034ae85d2c9903e6484d
ae00983f807ca7013eddf28cf2da670878f0e48c
26974 F20110209_AABWFY denbreeyen_a_Page_035.QC.jpg
7bfebd1d843a2e97b66f90cef549cf4b
99f48c6d5b54ef2e7cf11086b3c0adcbd42772e4
2200 F20110209_AABWGN denbreeyen_a_Page_036.txt
701fb722552f7fc691b3b6375802474c
02931ad7b9483323bb2c223b8e9a4efc029bdb49
F20110209_AABWFZ denbreeyen_a_Page_023.tif
d8572c634002bf3b4b60d1d92dff2aaf
7a129f8a49f6693d61a3ccbf72bb42facce63e98
F20110209_AABWHC denbreeyen_a_Page_013.tif
ed58d936a2006015a237ed61e1f3cfad
e151e4ca0b1a2c90bec6bb0ddd37c3d6300f63c5
109099 F20110209_AABWGO denbreeyen_a_Page_103.jpg
e879df15f86b9e55ff037a896e1289e1
c2fff67d91565edf98f94eba35089a98c752a78a
F20110209_AABWHD denbreeyen_a_Page_014.tif
d43727fea63aefa189cbab90d44a7869
60377ed0a168945428c144381e62536f57c42a24
229944 F20110209_AABWGP UFE0021764_00001.xml
e9daacaeda49572d45ded06d8cb9a2e9
c63b6aef3d5f0889115492e083e237104f94f4b7
F20110209_AABWHE denbreeyen_a_Page_016.tif
590a6d1f0b4cab78978df37772ceaa56
2df1359ead3abc26cf8282a3d3bb33bc47cc1315
F20110209_AABWHF denbreeyen_a_Page_017.tif
23b0af873641928847006c3184448329
9e182db4f903e3116a8d2152262356bff8e016bc
F20110209_AABWHG denbreeyen_a_Page_019.tif
6312134531829912d94b1080ae432a25
50a889b8b6409432d233c3a1edd1a75726f0c9d3
F20110209_AABWGS denbreeyen_a_Page_001.tif
a2482ec7182ff97a28c138f2f601bd8d
278daae1f0eec941de88cfc044ab45c1284c694c
F20110209_AABWHH denbreeyen_a_Page_020.tif
3492fe78ff32e4980d597da728033e33
db1c82e52b552fd006a6ff75bf7e658fdc554f35
F20110209_AABWGT denbreeyen_a_Page_002.tif
8097e0758a3287840f5aec51dad5233a
e96ba31c77c95a31e591746cd267a67082ed5033
F20110209_AABWHI denbreeyen_a_Page_021.tif
4e18dd69ddde839cc01c6ac5c166b762
3b89eeedba1a090387b8444838b2ee0e46e19bd4
F20110209_AABWGU denbreeyen_a_Page_004.tif
8d9522f1e346125945e39b057b4570dc
5c5e3df0b34a9287952696cb0e221545536428fb