<%BANNER%>

Distribution and Occurrence of Stachybotrys chartarum in North Central Florida Habitats

Permanent Link: http://ufdc.ufl.edu/UFE0021763/00001

Material Information

Title: Distribution and Occurrence of Stachybotrys chartarum in North Central Florida Habitats
Physical Description: 1 online resource (114 p.)
Language: english
Creator: Selke, Sarah B Clark
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2007

Subjects

Subjects / Keywords: air, chartarum, chemotypes, distribution, indoor, media, pollution, selective, stachybotrys
Plant Pathology -- Dissertations, Academic -- UF
Genre: Plant Pathology thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Stachybotrys chartarum is a mycotoxin-producing, cosmopolitan fungus that occurs on a variety of natural substrates as well as cellulose-based building materials such as drywall and ceiling tiles. This black mold has aroused public interest because it has been implicated in cases of sick building syndrome and pulmonary hemorrhage. Because it is likely that outdoor populations serve as the source of inoculum for mold colonies in water-damaged structures, it is critical to understand the types of environments that support natural populations of S. chartarum. The primary objective of this research was to identify outdoor habitats in north central Florida where S. chartarum is found and the times of year it is most abundant. Several semi-selective media were identified for this purpose; however, detection of S. chartarum from outdoor air was a rare event, suggesting that air sampling would not be appropriate for investigating the occurrence of S. chartarum in outdoor habitats. Instead, traps with pieces of wetted drywall were placed in four habitats in Gainesville, Florida: a pine grove, a citrus grove, a lakeside and a hardwood forest. Over the course of 24 months, S. chartarum was found growing at all four habitats but only rarely, occurring on only 0.02% of the pieces collected. Because the frequency of S. chartarum was so low, most differences in abundance between sites were not significant. Stachybotrys chartarum was recovered most frequently from the citrus grove, and at all sites, it was found only during the summer months. There was a correlation between S. chartarum occurrence and temperature but not with rainfall. The morphological species S. chartarum contains two chemotypes, S. chartarum chemotype S and S. chartarum chemotype A, which produce different mycotoxins. The Florida field isolates were compared phylogenetically using the trichodiene synthase 5 and chitin synthase 1 gene fragments. Seventy percent of the outdoor isolates were identified as S. chartarum chemotype A and only 30% were identified as chemotype S. This may have a positive implication for public health in north central Florida since chemotype A does not produce highly toxic macrocyclic tricothecenes. As a diagnostic tool, neither locus correctly identified all isolates, and more accurate molecular markers should be identified.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Sarah B Clark Selke.
Thesis: Thesis (Ph.D.)--University of Florida, 2007.
Local: Adviser: Kimbrough, James W.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2007
System ID: UFE0021763:00001

Permanent Link: http://ufdc.ufl.edu/UFE0021763/00001

Material Information

Title: Distribution and Occurrence of Stachybotrys chartarum in North Central Florida Habitats
Physical Description: 1 online resource (114 p.)
Language: english
Creator: Selke, Sarah B Clark
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2007

Subjects

Subjects / Keywords: air, chartarum, chemotypes, distribution, indoor, media, pollution, selective, stachybotrys
Plant Pathology -- Dissertations, Academic -- UF
Genre: Plant Pathology thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Stachybotrys chartarum is a mycotoxin-producing, cosmopolitan fungus that occurs on a variety of natural substrates as well as cellulose-based building materials such as drywall and ceiling tiles. This black mold has aroused public interest because it has been implicated in cases of sick building syndrome and pulmonary hemorrhage. Because it is likely that outdoor populations serve as the source of inoculum for mold colonies in water-damaged structures, it is critical to understand the types of environments that support natural populations of S. chartarum. The primary objective of this research was to identify outdoor habitats in north central Florida where S. chartarum is found and the times of year it is most abundant. Several semi-selective media were identified for this purpose; however, detection of S. chartarum from outdoor air was a rare event, suggesting that air sampling would not be appropriate for investigating the occurrence of S. chartarum in outdoor habitats. Instead, traps with pieces of wetted drywall were placed in four habitats in Gainesville, Florida: a pine grove, a citrus grove, a lakeside and a hardwood forest. Over the course of 24 months, S. chartarum was found growing at all four habitats but only rarely, occurring on only 0.02% of the pieces collected. Because the frequency of S. chartarum was so low, most differences in abundance between sites were not significant. Stachybotrys chartarum was recovered most frequently from the citrus grove, and at all sites, it was found only during the summer months. There was a correlation between S. chartarum occurrence and temperature but not with rainfall. The morphological species S. chartarum contains two chemotypes, S. chartarum chemotype S and S. chartarum chemotype A, which produce different mycotoxins. The Florida field isolates were compared phylogenetically using the trichodiene synthase 5 and chitin synthase 1 gene fragments. Seventy percent of the outdoor isolates were identified as S. chartarum chemotype A and only 30% were identified as chemotype S. This may have a positive implication for public health in north central Florida since chemotype A does not produce highly toxic macrocyclic tricothecenes. As a diagnostic tool, neither locus correctly identified all isolates, and more accurate molecular markers should be identified.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Sarah B Clark Selke.
Thesis: Thesis (Ph.D.)--University of Florida, 2007.
Local: Adviser: Kimbrough, James W.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2007
System ID: UFE0021763:00001


This item has the following downloads:


Full Text
xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E20110209_AAAADG INGEST_TIME 2011-02-09T19:30:46Z PACKAGE UFE0021763_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES
FILE SIZE 3684 DFID F20110209_AABXLA ORIGIN DEPOSITOR PATH selke_s_Page_083thm.jpg GLOBAL false PRESERVATION BIT MESSAGE_DIGEST ALGORITHM MD5
df1dfe67ef2ef19d55d8111842619936
SHA-1
eb4762124847834254bad6695bbf13d9fb209016
84640 F20110209_AABXKL selke_s_Page_031.jpg
64ca1999d4f383200e93c8e70e958945
c400c6cb47c87610284b72d9cc78b97f9838528b
24597 F20110209_AABXJX selke_s_Page_027.QC.jpg
f435d0354a64f8a33c96f7c187890d3d
3d1151431da370f1764274f571394625f09859ad
553224 F20110209_AABXLB selke_s_Page_033.jp2
69f95a1c96c41305e8223bf8565a0274
6ba4c9770d5b6496c45aeeba688a6b9c6f32fa1a
32507 F20110209_AABXKM selke_s_Page_060.pro
320fd024fc1deb8647ef21fc334e52c7
7489d16940f0ebd3e8b83dd1cb562a0a27cd13c0
1051986 F20110209_AABXJY selke_s_Page_007.jp2
c303c5b612b9ee763315036984c5fe0c
7e3231ac1dfee606df7c0f159377ab91e2f00d19
7084 F20110209_AABXLC selke_s_Page_088thm.jpg
554475025a6806b5e5c824deb30ec2c6
c376323a1cab931f39fdb3aff7e95be7080df05b
2143 F20110209_AABXKN selke_s_Page_028.txt
54ebc0962bc2c24c433b54d0ee087f54
cd2baacc5bc08427230057cfaf3c47edc8c6a70e
25271604 F20110209_AABXJZ selke_s_Page_114.tif
5a9e290e00f250dc99e048ceb17bf56e
d67cd454bcc0a963a6e143f9e4b126c7f6b468c5
F20110209_AABXLD selke_s_Page_018.tif
8d1be2b1fa911aa5a7bc96b882e4ea51
a732ebc348fa8eb9081cd5533c8a07731f15b153
483900 F20110209_AABXKO selke_s_Page_080.jp2
bd3546d2d1a938bd11102449dcaacba2
70ae72c714033f0fb1ab6b1a3179581a7e6e55a1
153061 F20110209_AABXLE selke_s_Page_094.jpg
6829a04a86192d1ba5c9d9e2cad269e9
fa56c50a13c08e7567be8ed0f34846c0f27d667b
59347 F20110209_AABXKP selke_s_Page_062.jpg
7cdd9b5a85393abb7f37b04ff7e1ef37
d4b3630a6126457273dcd7ae273c395fa811c538
1988 F20110209_AABXKQ selke_s_Page_088.txt
419af02ccc315bde0ba2cd5d266f7919
d8f1770b49a2db10468dfd5b58ed90e2c78518b2
56112 F20110209_AABXKR selke_s_Page_082.jpg
6d9d79cc20dcf4894dd71cf698d79333
f240706f0a84c8ef583c60bbff14eadd7cfb9cd2
43858 F20110209_AABXLF selke_s_Page_010.jpg
d37074c6f7d9fcefffc01cf0f9f5657f
941baeef49bf491361721cd969bce1d9f12668aa
F20110209_AABXKS selke_s_Page_063.tif
2da79e69503a4553e6639560aa17a991
2e7a84d0f7e00007501095ed86c89daebcb20c5b
30456 F20110209_AABXLG selke_s_Page_061.jpg
d0a3ca7207163b71e33322e304d711ef
08f80c9dc515d0aa6ed62c0648a260aa1eb7a1b7
F20110209_AABXKT selke_s_Page_005.tif
933c83cb252886e76b95c1e4c4c1ecbc
778eec93469a1fc01042fd4fb6e2f4b61248d0df
60926 F20110209_AABXLH selke_s_Page_035.jpg
03733c2b486f6be23aea4083b1441610
2b1d432f67bf9b19cf6fc91a72c4862f577e3165
6531 F20110209_AABXKU selke_s_Page_032thm.jpg
4906720fd2ada14076a33231ad88cab1
dbe6205246ff048b89bb42460953b0d33b9c6639
1051985 F20110209_AABXLI selke_s_Page_068.jp2
6f3bd6310161f4a3f9483f95b24cffa2
95b9503b2610a6f0b83f1436f9dee3ec9dde5fd1
1346 F20110209_AABXKV selke_s_Page_081.txt
e60c831ea36440d0965b80ac96d23800
a7056dd030c484a6b193c7bfb0dc8f4c99acd2e8
833796 F20110209_AABXLJ selke_s_Page_067.jp2
6fb12c5a2556d6b9dac3058d56a3749d
f138e55ad9b3e78f402c1d968115957b0d4cfa61
39377 F20110209_AABXKW selke_s_Page_059.jpg
bb3adaa631728c87f917a1c011cb57a4
d69e77c31cda02d316b385e9d16a8cf62c5b9adf
1608 F20110209_AABXLK selke_s_Page_039.txt
b2880c27bbc84c68f4c8f068de33f078
b0f4bdd34e3df64cbb46a7448bdab067f7fcda9a
47079 F20110209_AABXKX selke_s_Page_072.pro
368801b35b5e1f3814ebebac34cd6935
0fdd1000ecb15254a013ed9e35a9b413889b5be6
7429 F20110209_AABXMA selke_s_Page_097thm.jpg
363c15d361679259c2909251baa294b6
7d0feb035cf584216ad510179371145e82bd9569
6871 F20110209_AABXLL selke_s_Page_013thm.jpg
3ab952915f77c3d69212c1b117cb5d0c
a92e9c6b3c6632e430d2095e29926824f53ff274
444 F20110209_AABXKY selke_s_Page_056.txt
d17a477c772a5cae4713f67bdc428ea4
5cc109a4cabe6cc6d039e9be8c16eba242faed73
2720 F20110209_AABXMB selke_s_Page_093.txt
3fc35a5c47ad3e8471d9bb0baf3b14b7
6d60f724761802aea0a87c16e974f145cd67104e
2392 F20110209_AABXLM selke_s_Page_001thm.jpg
fa374e18938d7504025da2460c17e384
cc04dc98e23fb5cd17884045b309b539c34fd93e
84187 F20110209_AABXKZ selke_s_Page_049.jpg
2cdac00d4189654c3d86d4062f22ffcb
c7ff255ed0a5631de6ba0c723b378b08a79f7d9f
F20110209_AABXMC selke_s_Page_070.tif
f991739c364a4b38f7085739803b2678
b2c274066524c9118f166772122dabc0b2a27b4d
1051980 F20110209_AABXLN selke_s_Page_106.jp2
5f87c73fc1640502c38c5ec10976f6d7
24976ba42fafaf8be04f39e8561b54019c17a281
F20110209_AABXMD selke_s_Page_069.jp2
1fe65cad879361d19e56822ecfbc4cde
08b9f9c418f2e08395a9191984d2acd73722246d
62339 F20110209_AABXLO selke_s_Page_066.jpg
4b5f101b0e69fdfb0110716e6e93c199
9dfd7c05f7fffe16389440e97956d16d7bdede42
F20110209_AABXME selke_s_Page_113.tif
54e8ce89f09fd210f06dc2c34bec06d0
b1fcca87340601188085a2ce39694639f9029fc1
105213 F20110209_AABXLP selke_s_Page_110.jpg
689a4a444fdfa93350c37f9b48128775
f928fb12a779b6aaf5a16cfe8d70727f9c431044
52747 F20110209_AABXMF selke_s_Page_016.pro
f75992a096d528037b76edbf77712c73
a10c62fdca054327aa44dd0b9044271ac68731f8
20345 F20110209_AABXLQ selke_s_Page_053.jpg
70ca3e1deaec9ca6f4fd15dfcb113250
c4e32e9e6a2c932c51e07669e625858b0f6b9e16
1051966 F20110209_AABXLR selke_s_Page_075.jp2
b22a85f87c7d12d19b81e4cf2f1807f4
a83b62b446d8e76cc2149e77a438a2853f54d15e
57944 F20110209_AABXMG selke_s_Page_054.jpg
4dad4c425cc6b41569831b531eb868f6
4365b4f3bf49a61ab5456f0d0bf87e2d700bb06e
F20110209_AABXLS selke_s_Page_016.tif
90e7fd8ff8138388a048cdb3d78a4be0
c39a061ed36ea2cf8ac1eb8cd8aee5902c0b13ee
1051977 F20110209_AABXMH selke_s_Page_018.jp2
504471769563deadc9800571cb7660ed
dfe43df3bee919d23a0651b172670a1ccd71b249
46545 F20110209_AABXLT selke_s_Page_027.pro
6a7116a2b03a038d0f0520f033d0605f
3c241d3f8f6829c5f6e491d6d796fb176156f480
F20110209_AABXMI selke_s_Page_105.tif
1e9ca921a4349f4e77ae00dea16af4f4
c3adb99ea33a3acef1c675dbef10785c1865594b
28355 F20110209_AABXLU selke_s_Page_026.QC.jpg
51f9064f59adfb89d96656aafc9a1885
153af65fcd8af0cdea3649ac674b6cb79332eb4c
F20110209_AABXMJ selke_s_Page_055.tif
b9af3e6ad32e0ab55c70beef7b306266
a13f6d99541476375159a719d88461ab3253e00d
25934 F20110209_AABXLV selke_s_Page_080.pro
388a444394ee4552465f070ec7ccc00a
2ea4802d852492e5625a69a963890a92075fa405
46519 F20110209_AABXMK selke_s_Page_089.jpg
2deb74e8501d4cb7cd9f923656f1d2d2
a5310a0979ae7df209ecf2e312caa767231221ed
677 F20110209_AABXLW selke_s_Page_061.txt
31df69908125f6dced50ed6ddad580a4
1f9bb91bceaea0c65905102e9355f2667dd20672
1051981 F20110209_AABXNA selke_s_Page_041.jp2
9764eff6b3fb370361417da098660d1f
bcd5b29674ef63a47df592eaff52b9275ed2fbbb
2060 F20110209_AABXML selke_s_Page_100.txt
93ccb3870ed4cba8e21d8259ccf5e781
5702d5e95c673aa297a94cfa15dbd7af56497b0c
27389 F20110209_AABXLX selke_s_Page_020.QC.jpg
144517258535d205e303d028c9a2f2d3
a909928ca4d80f6b579eaeed1c32a9f0414cf809
F20110209_AABXNB selke_s_Page_038.tif
8783d54b9a0d4bffa84d91277e93386d
02b7622dd368e07e0f6d4364753cf8964f03d866
26515 F20110209_AABXMM selke_s_Page_043.QC.jpg
5c889e438c3b5983f0a7e6b629d7a3c4
e3bd8da310722c626ae73a5f6b58ba2d3a8feb6a
91348 F20110209_AABXLY selke_s_Page_108.jpg
6647d6f94faef30cae3a31ae7ddadf57
01fc39cf20092f41d2dd9533c8ef82f8523dc56f
F20110209_AABXNC selke_s_Page_069.tif
02c4b5cc325c138fb8d4afac6d2d2735
10e96d49257a942449beb50802a1d9e9ac71edb6
2067 F20110209_AABXMN selke_s_Page_073.txt
02efbf57bc6bfbc78ab31611dfadc193
f9ef474d3f54b6acf67bfcea7ed3b9b8b55c020b
38381 F20110209_AABXLZ selke_s_Page_035.pro
effe78205ad5ff701d5db9a8aed4fa56
c0becef7de815554eaa2f0049e10b43db656a9b9
3657 F20110209_AABXND selke_s_Page_006.txt
3236f971ac472c08231bc14901f761f9
3e0bb203964786547bfde4d2ed7d5781b0634c75
3007 F20110209_AABXMO selke_s_Page_091.txt
5e28863c025757db66bff2fad199ae5f
1c8bca88c3287fec0edf15522b13cdb9adafc988
F20110209_AABXNE selke_s_Page_101.tif
e444d8d0ec6c97ec2634b0608728cfb9
3cc50d515ea23b0560f6a4d6c06173f4260cca89
7467 F20110209_AABXMP selke_s_Page_052thm.jpg
801df00d3362b852e9dd9e48544485ba
4bdf2ef47284e3b5830a4ba9b5a63312bd3503b9
4749 F20110209_AABXNF selke_s_Page_066thm.jpg
724ab40063455240afe4fa01d35d6749
612daa2ffd2fa866fb37a54bcff0daf2cdb2ab3a
F20110209_AABXMQ selke_s_Page_019.tif
0b2c859464dc481bce7aadefde06abc5
cadb9d9d3780a140ad15ee5b0ae57944b627ca2c
3560 F20110209_AABXNG selke_s_Page_089thm.jpg
96181773ff3a6cd85bd718fae521d79e
2fc1478417cdad755917d4d7eeebb4a798cfa589
85334 F20110209_AABXMR selke_s_Page_069.jpg
e58dcdc5e844dca0d1a45a354a8b23c4
3f8211b200206d409e9781568f0933de090b6178
2117 F20110209_AABXMS selke_s_Page_049.txt
e020f33a97da532877c344a2bf634219
25e781016e14bf20f35edfc9a2d784d8f57f3ba6
6758 F20110209_AABXNH selke_s_Page_091thm.jpg
c3dd0d19aa86ad15e81c3d942614c664
dea42a939d96ce93986d58a937f1ff60fae94ba7
53792 F20110209_AABXMT selke_s_Page_044.pro
f0e70004fc25522e344a2cefc2dc19eb
5ee44d9d5dc6f78d825067ccfb2498fdd1e38d0a
F20110209_AABXNI selke_s_Page_109.tif
7526b967162a8fec70178213919d19d0
000d0849a8257700565600b1e024c93b0ae8b7cb
7291 F20110209_AABXMU selke_s_Page_077thm.jpg
c63a63fcbba462d4f5942bef517b70ff
6ae879723b1f008c614bf40aedc833b9062f615d
1051946 F20110209_AABXNJ selke_s_Page_044.jp2
e69cb8abcc8c796ba0279ef757decb73
89168e0b47164c81e448e5d46cd67738ece02d71
154418 F20110209_AABXMV selke_s_Page_104.jpg
61b813b416c289ebc58b9143bd9e171c
dbc843f3debbb95a4ca3bf4b184d781a9a69a079
53236 F20110209_AABXNK selke_s_Page_029.pro
4588b9f9e6034f6daf98b2959e6ac674
3597ce97817e7e510a5dc8c9443eb69f99c2a2e9
70267 F20110209_AABXMW selke_s_Page_093.pro
c91720e149deb6815a652becda88e307
0cef57f11848bbd07ec107c08edc04f658c37b3a
773349 F20110209_AABXNL selke_s_Page_036.jp2
10f035e0302bf8891b8239bfc1342883
c523df93762b95c4ac5d7f83a8b91f9188c803e8
F20110209_AABXMX selke_s_Page_090.tif
f8bc153b3d16f8a78e4803332ffcfd15
8aa2532ac0b342ec983f63adecfd27c698151c61
F20110209_AABXOA selke_s_Page_057.tif
bd836689bc96b2947f3b12d79a6999cb
76ae354ec25cb0d3e9d748843f8067e1b873b25c
146742 F20110209_AABXNM selke_s_Page_099.jpg
8eb57a85085dd9040fedd75fe0077e52
92ba5e305adf875ac436142d52420046ed321cc8
3183 F20110209_AABXMY selke_s_Page_059thm.jpg
30a2fa084c2c20e837ee6daafb88954c
27092cd280d44e071a94fbcdb53887ca9cb2a431
1051970 F20110209_AABXOB selke_s_Page_014.jp2
4332d4de5ca88e5e97ec2e33d29b0ae2
15d8bad85fc7e892ff4e912fb2bade45b272ef7a
52568 F20110209_AABXNN selke_s_Page_022.pro
c2a0b76d01211e013c96d39969849e0b
273bd01822e4bbe362a73874550099d86e1a723f
F20110209_AABXMZ selke_s_Page_110.tif
f38a022b4267f322b69ef138c52f057a
4fb382b70253ee01fc6f2ef3847ec66c41744999
7834 F20110209_AABXOC selke_s_Page_085.pro
2846566b8bb50dd739999b7c9d6abdc0
f99c8e6c2c9ff1200143eb53e8a34a0ea16c595c
7324 F20110209_AABXNO selke_s_Page_016thm.jpg
2364f6056b4a7c72c5ba82ba88e1216d
96242a0d57ad19fab2c9b0723cb4c9b8b56d67a5
7818 F20110209_AABXOD selke_s_Page_101thm.jpg
a080a45483b4722106b04997fd307705
5ff6b660473d7465af1eff3a56caade8f20307ab
590875 F20110209_AABXNP selke_s_Page_060.jp2
a070f91497f18affc5787be2e9424454
6f56400628488c3568311ca6fc747dbb66c19c9b
F20110209_AABXOE selke_s_Page_026.tif
b9c7b2013af367043c859959f9e7b4d1
00cda61c56fbd1fcb514c24e608ed68854b0c5b7
87450 F20110209_AABXNQ selke_s_Page_074.jpg
ae74efc41a2c5e39ad82f4c8ab622102
9da207184bd800048a0312634eca247f0e860eaa
84853 F20110209_AABXOF selke_s_Page_025.jpg
5e956b17a011ae524440d02f1e1ee7d7
5d8131c541583a5f0a8839b87fa9797f720074f3
7281 F20110209_AABXNR selke_s_Page_099thm.jpg
3d7b9b1b963e1f496f85d762ef33d099
cbde5420355f8f9cd319e315d5a17396f824f789
90715 F20110209_AABXOG selke_s_Page_006.pro
af534aae71f87ab921d85ce36acd00da
9f2ea1c8194210ccbcaca3f43bf057326d7a54a4
F20110209_AABXNS selke_s_Page_084.tif
f546c7619db08cc6b27af454682852b0
6d43b786ba7707ca2017a03509fb4ea67ab64904
151487 F20110209_AABXOH selke_s_Page_093.jpg
050c097c4db63908ff04eb0eaf2aa99c
72a0f43bf8751feb445264fa7afec72eb077a99f
7470 F20110209_AABXNT selke_s_Page_023thm.jpg
631ed5454d95464eaf54f371f2c3885b
bdcd2e1e143a65e094fa3d3aebad63490a67167e
26685 F20110209_AABXNU selke_s_Page_076.QC.jpg
49966e7ec880f5808f479157399f1cd1
71fe33092bac2dbc5f85e561d1533ff85ac1f990
27191 F20110209_AABXOI selke_s_Page_029.QC.jpg
8f05e2ed3541842455bb6c8f94858632
8ca11d4a774936d782342a1cf206368387eafe77
2174 F20110209_AABXNV selke_s_Page_030.txt
858a5e611fc82315d589704ebd871972
9363af958fcdd0ecc729639e215023775efcbcce
2104 F20110209_AABXOJ selke_s_Page_069.txt
d73bb29099b0d123416c22802c04fc5b
bd1616c1c1f79f35c1e23eb249b9efef64e79a21
70286 F20110209_AABXNW selke_s_Page_097.pro
fef822d209f851627ef3e6c788cd8cfe
29c16e86132cb47829f4e6183b935c3958fc2726
1999 F20110209_AABXOK selke_s_Page_070.txt
0fab187da2f3c3f98b48f82b592a165c
afc9398c251f9ded227d817a96418344597c88ed
7001 F20110209_AABXNX selke_s_Page_046thm.jpg
bd2a6c002d32f1445f081db25fe1d662
efde4d53f28ebdf31f357fc45f7a5ef2ce6385fa
51471 F20110209_AABXPA selke_s_Page_073.pro
cefca0b918c3f5397ef73122fd64155d
0e33efc56f4e9cb6ba33f5d2002df588ffb2f6b5
6868 F20110209_AABXOL selke_s_Page_017thm.jpg
7dbfb72658b7450b64a94e58d6ab8dbc
8f097a029e2bf791899743e3adbbb6464c865758
2132 F20110209_AABXNY selke_s_Page_029.txt
cb9cf6440f913d812fbcff3ecc22f266
c1e5778a7034840e7cb5bf635def521279615cc8
2049 F20110209_AABXPB selke_s_Page_042.txt
7d5eb85a6edb7c984d76e9fd614d5aab
cd176301b4fd399b6638d62de7645dd2b8a056ed
7577 F20110209_AABXOM selke_s_Page_047thm.jpg
5d01b0f8234d5f481a6f914ac6f5d847
1cc8de4b02d6403f6e351a1c4424b012f715c8c8
35240 F20110209_AABXNZ selke_s_Page_095.QC.jpg
4a2e653f64cb89e02b82ee40fdde031b
a4a49f1f0d801476e63aae25112fda7324e12b60
F20110209_AABXPC selke_s_Page_046.tif
39b1df6c1f1e39485dbeeb8530505993
a9ec68fe04e88f27dea406a312d6287a369e12cf
3396 F20110209_AABXON selke_s_Page_033thm.jpg
538e175d8917d152cf1a13fefe3f5099
4768c8e19f624c6ae4dba43ec5cbadcc0b00c62f
2114 F20110209_AABXPD selke_s_Page_015.txt
2e13bd1ca65fc92f3d73bca856f96843
01a7ce35dca3c79db9f1ef551e4c7ffe86fd091f
F20110209_AABXOO selke_s_Page_071.tif
ab5bba4c3c81b993d9131ccd10c4b342
4e6c5674aac6b64a15c041e5f0a24b05b82a4d95
506 F20110209_AABXPE selke_s_Page_001.txt
80d0b1f52913273fb0e1e7fb1d96dd3e
c6d0344b1590d98dcb299189f0f9b87478c748c2
27258 F20110209_AABXOP selke_s_Page_113.QC.jpg
ea99e5b4789394b9f00e6fcda866937a
b1c98684b906ffcb6ec8c82442e5ea1d427abd71
1051967 F20110209_AABXPF selke_s_Page_013.jp2
0e1846afe3f9afa67fb7999e74a18182
6ff9123497fe8c79242b2e2f4b821c905c3a5125
11401 F20110209_AABXOQ selke_s_Page_059.QC.jpg
e348699b205158e3db7f756a0f35769a
b5210df329b9bf031d766aba44326f8116237f64
26289 F20110209_AABXPG selke_s_Page_048.QC.jpg
2c452a552535149459ec1763a57dcecc
a04be495834bacaa80288fba6f7c3e00b164af20
17962 F20110209_AABXOR selke_s_Page_067.QC.jpg
1c0350e3802ce92e834cdde3b85072b1
d774953b0b17b7842cc8c28acacea3d91f2caf02
2009 F20110209_AABXPH selke_s_Page_071.txt
7ba9acb4da9617253e773de8d2f78ada
56c5bd1b4c8d710133f2b8e3528210f70e8f5cbc
F20110209_AABXOS selke_s_Page_003.tif
1f7b9a6a85f86a4ce618c9082de87d6f
4a0dea00a4f81336a2f959303d0c746a7f96edf7
F20110209_AABXPI selke_s_Page_072.tif
1abf799ab7f6af9d47a0d8f9ec03ec03
8979b4553335cb458c45c383268e204354d4e035
12138 F20110209_AABXOT selke_s_Page_003.jpg
930aa5fda1a8238a926182576a8d87c7
4e07edd62f179a5a1d5792f7d6a791b9da033520
26980 F20110209_AABXOU selke_s_Page_107.QC.jpg
84a67fa5ae740fbc69e82b7f99a1cb23
0d223aed1a2857b7795882b49dacf6d29e84ecdd
49624 F20110209_AABXPJ selke_s_Page_013.pro
895285953d5f11a7afaf84d4ba33460b
81acaad70fe73bcfb55633728285d94b22db3a3e
15664 F20110209_AABXOV selke_s_Page_063.QC.jpg
8bad371d560a01f0af5b503b375d318f
41687736093dc4905955724ad4b1f7ac75c3ee9b
2112 F20110209_AABXPK selke_s_Page_047.txt
37225ae8e8c1c8dd7dba8cef75b06049
d6dc0b8f63bdd8bcba2e53026c7673cd1a80fe3a
35226 F20110209_AABXOW selke_s_Page_096.QC.jpg
b9f7191e02a70d01e1c3c892f0a58724
0044f308e872f41fb4ea567ac4628846e0178a40
708364 F20110209_AABXQA selke_s_Page_082.jp2
64f8851d717c2d7d81b179a0aacb8030
1fd45de2e8cf14d50ff408ce38257b1e82c9adb4
42859 F20110209_AABXPL selke_s_Page_090.jpg
04fd933ab539aeb25f699770cdaa0df8
fa502179b859aaad7fe1ecf58989880c8f111389
7440 F20110209_AABXOX selke_s_Page_096thm.jpg
9620255035ecec6ac876dfb1288db707
d3ed67856001265674c51d3fff7e1206e8f7b89a
F20110209_AABXQB selke_s_Page_025.tif
bd3edd446d27b63678a7660f71cb16ac
bfb2b258afaab05aff09b3623d319c62fcad3138
808214 F20110209_AABXPM selke_s_Page_065.jp2
ab4e6b680eeab765e1e30a299b31afe2
1b3a364bbbee60ee7286bf356ea8ca19057d1cad
7604 F20110209_AABXOY selke_s_Page_028thm.jpg
c9b21e3c1a8a0bfbc3d2150e2bed921b
c7be5a2718f69a9dabc68cabca4ee569964b508b
7251 F20110209_AABXPN selke_s_Page_020thm.jpg
ec4c3b61603c8777139aedc16eb175f5
afbb5a726fb50d706324726265f99abf3615767a
26538 F20110209_AABXOZ selke_s_Page_073.QC.jpg
dbc95134c8bd78e4870431fa09b54990
e4874b3962c72edf38723716e111cc7278daa7b8
16734 F20110209_AABXQC selke_s_Page_066.QC.jpg
b6bf6f168caf6a60c2cfc505d11b2b06
c117d3d7ffb0bb97f42924b57b40319c6aa79275
83035 F20110209_AABXPO selke_s_Page_046.jpg
eb15ecbc4f697752bd5a3f369faca402
234749bf93005824ec04d716988d98779fa00160
F20110209_AABXQD selke_s_Page_088.tif
238be3aa18d76628189ea6e655b81f64
256f3564b8ff5d86d87fafc6df41f1a04e457c86
58310 F20110209_AABXPP selke_s_Page_107.pro
bfe2f35ad0eeb537b925272679b97111
273bc8baf9cc5c0828c3c154827cefef09ecd20b
27655 F20110209_AABXQE selke_s_Page_100.QC.jpg
c42baefc29234719c65c720965bd0200
58f347ee04e1187adab0671c325f68100ace0621
F20110209_AABXPQ selke_s_Page_022.tif
fc8c3fd6b76b2fe317778c5676138178
958070f1d0e9d44ebef8cd5bf27013b0c3f4a232
4083 F20110209_AABXQF selke_s_Page_039thm.jpg
9682191b80aad82a0517e257bec072ab
4d2d30d24ceb9d4f8f414f0053385790b1e40fc1
54816 F20110209_AABXPR selke_s_Page_039.jpg
f6b03f5e418fa800cdeac0dd6a772e11
f561b81f95287fe690f342c693a9bbc279127b94
1051972 F20110209_AABXQG selke_s_Page_072.jp2
78a773600ced92c7c0a476a5f56adb8d
d5a472f3521694111352d24d0d43a0cde8950d90
35688 F20110209_AABXPS selke_s_Page_102.QC.jpg
f76b1eada4107b75968106af684f24c3
f58bc7929543025ee27e53ce8b6ca908f9646e6c
2972 F20110209_AABXQH selke_s_Page_008.txt
184c971afe9f006bff8c936b1901b02f
ea68af4239e6c33df42516eba299472bac947c57
4219 F20110209_AABXPT selke_s_Page_037thm.jpg
5678e2101e9f28073ac10f347e698ac4
e9db96a84a4dca0664b436fa96abee5e0f269c1a
7335 F20110209_AABXQI selke_s_Page_024thm.jpg
d49f42581a86305ca19f89a5ae7efb0a
f8824b5822e6318f55ef5c706a941ea7b5b2b46f
12315 F20110209_AABXPU selke_s_Page_005.jpg
e3f863b8299ee9ed4c2906c62fd8680b
7682012e53364eba993017b1c71c6ce51d83f1b2
F20110209_AABXQJ selke_s_Page_102.txt
a9231638bf717a90f9ed086b337e166d
f5fe915ad1d3d5392ce89b5266ba7eeda8e55782
57073 F20110209_AABXPV selke_s_Page_017.pro
5b0647428c17917bf31613e3e655df0c
3582c72cca275459f24636ea0893b31fcbdf95b6
45232 F20110209_AABXPW selke_s_Page_007.jpg
5cfb3fbcb4e3a67f43c586b91d3212f0
b2b8ab9c7b424b673613c4b499d0685943782f6f
3354 F20110209_AABXQK selke_s_Page_078thm.jpg
7efd01829d29a7199682772c2ad55411
f83e36928091004aa12cf705d5d4a886f726c365
2333 F20110209_AABXPX selke_s_Page_113.txt
10de0dbdf58aeee74786450a00ea935e
46e13c2fac514104896ec01c4afcc01182c3e0ff
7671 F20110209_AABXRA selke_s_Page_004thm.jpg
60900f1a4b49eab565d965cdf3c2f249
0e0bc2a38aa94259c95e64ba90db346b6ea2a511
6721 F20110209_AABXQL selke_s_Page_045thm.jpg
546db413e582232e27a982a390a070c1
2b990f891fd742f5172ba0d8024af0f214905c9d
11389 F20110209_AABXPY selke_s_Page_080.QC.jpg
303002642ca0b358aaacdcbde0de3ec6
44078dbc1913762d9fdb170bde1f3b25e8828731
53449 F20110209_AABXRB selke_s_Page_086.pro
cdbc5a010e2e3abb53ff95f15a441711
21f159f1b44730ae219b2860ad02562986023b67
443888 F20110209_AABXQM selke_s_Page_059.jp2
d18129f97dba9463303d63dc2b2d50c7
af3f599862312c28b89bc4e1b58630eee9c767e7
26646 F20110209_AABXPZ selke_s_Page_025.QC.jpg
ea53dfb89142648bd29a968ab17346fe
dde29da128b18c89d9f8fee856c2e8af92164565
1051982 F20110209_AABXRC selke_s_Page_030.jp2
4986932df2b6960cd44fbea3d23697d3
626f6423607aa22b264f597ac83c50c4f18944ac
27988 F20110209_AABXQN selke_s_Page_110.QC.jpg
aee44cbf9eb0ff62a809d00bdbf8d68b
2a008a43fff5164149573fa06ae5879ab9c0aa49
F20110209_AABXRD selke_s_Page_035.tif
360eea2684b8a7e72a8bf179f9ef65bb
ff36b5549e7ea23c9e70bdcc1e6f1341ab7659f8
84608 F20110209_AABXQO selke_s_Page_019.jpg
58d0eb6d3ba9d6bdf31fd2b6b85139eb
b0428877bd525e96460e16638221900f3cdf009d
56818 F20110209_AABXRE selke_s_Page_087.pro
db45eec1e9e0263d388b486bed8f4176
b300ff16fffd44f6e8a19e8f67ac5d7588c2bb5c
2159 F20110209_AABXQP selke_s_Page_040.txt
3b68b8cf28727d372432ba376ff1db6b
9fd8827ba38d43abce8b92dd90d781ad105892c3
35768 F20110209_AABXRF selke_s_Page_094.QC.jpg
69669d27514a84b20c5735e0275926a3
b74da75ea2984bbb2ff8924fc25bf2d392b3b380
F20110209_AABXQQ selke_s_Page_095.tif
f6a286087fff41e57465877bd591cc08
051fcc1ed25fe96b85603c05a020cc08ecf1411b
26715 F20110209_AABXRG selke_s_Page_049.QC.jpg
83e59a32a7010202761b3b3e8c0303a0
7e4e3e0f71e0a22788e1003c9b00f0ca868fdc1f
782269 F20110209_AABXQR selke_s_Page_035.jp2
b02979869a77c33bd871993e0261978c
de0239404d8f8dacebc867e09004c7f977710a72
8670 F20110209_AABXRH selke_s_Page_001.pro
628bd95e8d9d4cfbc57d898f7240cc1a
07aac1551126fa8bc679d1b649bcf78b4aff1aaa
F20110209_AABXQS selke_s_Page_102.jp2
1d622fca8d4f2272cb58b5d1a29ebe59
9a131b67e9015ed7318eff126aa67920f33cefc8
35197 F20110209_AABXRI selke_s_Page_103.QC.jpg
b9430e6b7a776981a426c4b375740c68
874d7e4728b88f08c496ac6d6b5e1fea885b30fa
23454 F20110209_AABXQT selke_s_Page_089.pro
826bfbd2e70f1340cd01c7fe5ffc1570
1331663e4de8acaefa34c13db48cb6fedabc3ddd
F20110209_AABXRJ selke_s_Page_111.jp2
163e1618f048dd893c991b2e4a63802a
a12ca849954d1ce93aaf9fc7b21394cf59fb9595
7791 F20110209_AABXQU selke_s_Page_110thm.jpg
917930193cdc1e3293febec9189ee815
8de4465f59d770e4fcc6c753f4b5913d3aec1d4c
7478 F20110209_AABXRK selke_s_Page_103thm.jpg
822292fc9831c87881a9ad7f1fc4d572
282d973bf71b597ba45a0e03a6f9dfe4579ed098
25350 F20110209_AABXQV selke_s_Page_079.jpg
f1fef871f16ac748675070c812371f7c
e9f0f22d2d13f8dd0351390a2d2250750a145b74
2046 F20110209_AABXQW selke_s_Page_043.txt
d4fe892021e2bfd6759158d67b8f978c
f06871681f5afac9d3e24dd789495c9d0bbdd3df
1051975 F20110209_AABXSA selke_s_Page_011.jp2
f932a007ff33be5111543e0d05ded447
cc77b0428cf0e9824253d92920bca8448e5be602
2193 F20110209_AABXRL selke_s_Page_074.txt
a470df77069f2ad8605a33b85c5447e6
03b2d3959dd777f57fdbe15afee07ee5448998c4
1051963 F20110209_AABXQX selke_s_Page_093.jp2
b29dae3e02cb9ccfc8ffdaf743882fcf
341d35ecfeea556a70df7532dc20251d9d8e62df
17040 F20110209_AABXSB selke_s_Page_034.QC.jpg
ed0f7f21fa2ee9549e97e62886253f48
10b645550759fbd953a4cf00c25cb940d1fc66f0
86647 F20110209_AABXRM selke_s_Page_042.jpg
d5e6b728661817e763a9abe4d6b9f25c
67f5097c359629a11ea84e386c2c447783fb16c6
51949 F20110209_AABXQY selke_s_Page_043.pro
ddab41e63e171de21aab371740546151
54ef945b16cef9ec7c2071ab2b6eb7ad4baed180
2105 F20110209_AABXSC selke_s_Page_044.txt
43001d6223119e95da6f2df3cded8a71
7fccb60cd888231a6dc78a4cfb13739017df4f86
35229 F20110209_AABXRN selke_s_Page_105.QC.jpg
30276e1a73cd77ef2e254875267db162
0ef7a8606659f4c26535ad3063dc22618b8f8c05
14775 F20110209_AABXQZ selke_s_Page_039.QC.jpg
9688b6d5774b4e76a58620b9b97c3df6
dd9d550ce6a341513593c481a24743d5a72ddfc9
27494 F20110209_AABXSD selke_s_Page_051.QC.jpg
8800ec9744dd50194a6d51ab8a9cf321
793606bd95bd07e02dfeae96acc58f8ec9ad3c35
F20110209_AABXRO selke_s_Page_075.tif
c27df9e9764e38a04772899485fb7058
75546a33578f630d62a8f7fcff74e684533917de
53033 F20110209_AABXSE selke_s_Page_100.pro
fdd5b804049b24a2814140cacdb6beb0
57fd4c61cf9e279bc528926e19798f53e9b5ee5c
657738 F20110209_AABXRP selke_s_Page_063.jp2
e1270695e80b0b4202beba08b2294758
7f07bc5a8cbda36220bbe42e7dfab0725c99ab22
27336 F20110209_AABXSF selke_s_Page_090.pro
ca584d62fc51d8ef33ce87f507ebefa6
c966d0731343a711b112e1fbd92c7727461c0004
27921 F20110209_AABXRQ selke_s_Page_111.QC.jpg
9d44b41c0a10a041e2c50076ba3a7acc
0d4edfa5685dd71c1c42743cd45542dd19209d12
2524 F20110209_AABXSG selke_s_Page_110.txt
4c3f9d8b86c480041eb0bc142d6c637e
ce6d12b935ee3d65ae83d14e21e6190212c89d96
1935 F20110209_AABXRR selke_s_Page_045.txt
b6fb62f2c94f06b10e7a01658301e65a
824e77568c3926c783a0416ce0f55cea80cf22b1
1051863 F20110209_AABXSH selke_s_Page_097.jp2
263cbb0201b3a14a577c924a66a10f8e
4b99146dbfa0ab2f9005be7ace77c6b48a3a3a04
903529 F20110209_AABXRS selke_s_Page_114.jp2
89da102d12530351b3d6b3432600e6e3
877a822b5125de440fed6c998d26afce6c7cae2c
25530 F20110209_AABXSI selke_s_Page_088.QC.jpg
83514570de7e5196084c7fc88683ba7e
fa5b686abd9e3a2870c327404eb769637c174ec1
36857 F20110209_AABXRT selke_s_Page_037.pro
14a2e30964eaace217dc66f0e421e70b
55955829288a16c6180a270c52f84c770778a7cf
2724 F20110209_AABXSJ selke_s_Page_092.txt
c7cec3580cce72bda6cfb275aedce7ca
b9c757d9580bb8b0a4a9b23cdd34666fd69c0084
6007 F20110209_AABXRU selke_s_Page_114thm.jpg
02f44abbd02fea61f4ac2a272e80671e
1345c136921ee6dbee4c6c86632399cffac3d533
29875 F20110209_AABXSK selke_s_Page_082.pro
59797e654b14ea2bb8fcf837fa6f65aa
0ad2415d2dcf8bebcdfc5e9812e28714f988c944
F20110209_AABXRV selke_s_Page_028.jp2
eb9a68806d85f1f5417a8b3e8ac7e947
741d9bf3b5b4ff992a36833d974315af0ff7069b
F20110209_AABXSL selke_s_Page_111.tif
93bc8a1d4a50f7523551d0bd69cf5e0a
a1c85674cd734dd2667e07de34b218afb7ea65d4
26090 F20110209_AABXRW selke_s_Page_008.QC.jpg
193f34b8a5097044229ccf7676794926
27f2682db0ea5daa051c7c4b7618cfe913574543
23807 F20110209_AABXRX selke_s_Page_032.QC.jpg
6ffad43a109edae0e9f42a6c82a27ce0
da744dc08807bfe77ff6adf1bdaf83039e1538b3
70403 F20110209_AABXTA selke_s_Page_104.pro
d802cc2f68bb8b41b6f39098c8d38ecd
0bcfab7bc45f562cf4c5446e82a797169e524f62
55414 F20110209_AABXSM selke_s_Page_030.pro
bcc7362f10ec8a1db2ee275836823441
5c00648e4a96f1736302077c4d2f8ef42d1fcf4a
70280 F20110209_AABXRY selke_s_Page_095.pro
ef14d35f1c38fdddd63f9e170a4c5fce
44f5b9b89e5c40363b6b2ad5d77238ed60ebbc39
734 F20110209_AABXTB selke_s_Page_078.txt
a8f185d60cdb5ed972a92f154bfe7be7
d9ffd38030393334b51e0507b4faacc5ab700572
1051955 F20110209_AABXSN selke_s_Page_108.jp2
067a28d2defb4015fc787b1442ad0ed9
5deebaee447c6b56bcd009fcd8b02eae6877479b
53918 F20110209_AABXRZ selke_s_Page_052.pro
1e805f022bd143e394bc5cd4693cd1d8
ccb55724ca0c8e0fea37e7408a196bf8f442d6e2
1051936 F20110209_AABXTC selke_s_Page_047.jp2
ab91acb096aaaf4302905cc066b9acc3
2b3535e79adff8321271c72c2fa1910e025040cf
1051979 F20110209_AABXSO selke_s_Page_026.jp2
38a5aa1578171e5b3e07ab4bf462e42f
bfe36f48d89e08ff4b32e0cfdb57b182586115db
13036 F20110209_AABXTD selke_s_Page_007.QC.jpg
8b31aa976f4e0cd60204e18dba01800d
65e60b3125d9fc3d63a6b4f91ebdecdb318052e2
29703 F20110209_AABXSP selke_s_Page_112.QC.jpg
1f9fa6952ce1ce3e1ac20076369b0de4
65a02db054bc34d72216edf8dc13ab98bfedb1a3
55455 F20110209_AABXTE selke_s_Page_004.pro
30745be1724de9fc3628bca6c4e0fa59
8a13b6509e73f6b5f5f3ee68a7d80297d8aadfac
35180 F20110209_AABXSQ selke_s_Page_097.QC.jpg
6052666d84ad47c04085b4b10fd30b19
fa71af0a1e89c43c6016121ad393e2e2de120be5
26700 F20110209_AABXTF selke_s_Page_017.QC.jpg
5224ab2869fceab1b476aa5db509ee23
380a7aeb0818c7c0fd6714957bae670a507b77ac
150184 F20110209_AABXSR selke_s_Page_102.jpg
484bb84d2a4ee255b3eb388a5d4bb4c5
5c0079c21020d82c60f5848760e63b8073d41402
7372 F20110209_AABXTG selke_s_Page_042thm.jpg
cf1cb54c3066234589452c0bfdb92179
d8c34631074ccc323c8e8f4aa860a84e6c5bce4b
1757 F20110209_AABXSS selke_s_Page_034.txt
13ac8b401b5435de3dc35de4afc19bdd
b7bf8017949683aff37741320d30933104104fb6
1051950 F20110209_AABXTH selke_s_Page_015.jp2
a98b98e73b456ffa271eddbef7c7d27f
7a1cadb8122c1b0320c313e41b1a24350d561662
2616 F20110209_AABXST selke_s_Page_058.txt
efd512a9994f56a92ec5970ef3898ec7
1840f2ff5173b3db5e8bae071704bccc598208ed
85409 F20110209_AABXTI selke_s_Page_068.jpg
d2d413353fc574b474419e49fb59f88a
98a7dd74e035200d03f3b7275e8e3fe8b2ca6d5f
69382 F20110209_AABXSU selke_s_Page_005.jp2
3375202b9ea8b1b82a3e17f8650a1c98
dbca94dd9b92f33a2298eb3501427706bf3c91bd
F20110209_AABXTJ selke_s_Page_006.tif
8bb2e46090be24b46b808591dd872417
ce61dfbf6592624759fe0ec996bc9f0ae2fab797
80554 F20110209_AABXSV selke_s_Page_070.jpg
b1a081fa1ed68c30bb105c7752f37f0d
e2db72fc792324364af6395c01d88d9a13273c4c
42539 F20110209_AABXTK selke_s_Page_062.pro
c3908fcf3b6ee0946d6b6bdab28845fb
03f9fdadcbd241e44c75d118e5d35f3f3337d7dd
3613 F20110209_AABXSW selke_s_Page_080thm.jpg
1adcf51df2827a3d2641398aeb8d4889
fb9bdc5876acaeec16ac861e4436e46e9f02b051
33932 F20110209_AABXTL selke_s_Page_106.QC.jpg
2915f88ab18da6027c936ff6f125289a
b09e44b868f6c38c82df4567a8cfd55717b0d816
62413 F20110209_AABXSX selke_s_Page_034.jpg
359389c2e31d22bcf964aa7a14da7673
ced6f33e71783bf6d67b7043f841c2fee63781da
F20110209_AABXUA selke_s_Page_037.tif
56e77a9ebdbd580a2bde3615596b0dbe
26f1ee77f64e24db9757c4c09b27a3f71d027c0c
F20110209_AABXTM selke_s_Page_094.tif
ca30a0ddd7ce51ea839699c84131c1c8
f750cd74c8331c439e324b4047732a5bfb52e8f9
85397 F20110209_AABXSY selke_s_Page_076.jpg
197154098f1decbe30c38232a8d24a3b
399d77894809ce8675377750b29234abd3420058
2175 F20110209_AABXUB selke_s_Page_026.txt
de8574bea512e786790a5488d88af61f
34de5f2ae3ed22c912ed487f5f3bd0577cc9138f
38600 F20110209_AABXSZ selke_s_Page_064.pro
d892b38eb4e0e946acec17548085d664
5f38ef3f0dbe10e2272bc0e2a4c457ac931c8bc6
56720 F20110209_AABXUC selke_s_Page_018.pro
325c0b71fe31af00d700a90a3a5fbf5d
7a239c76c96e1f0735f1c2b95b125ffe96a880d9
F20110209_AABXTN selke_s_Page_010.tif
e9fb1043caceaeb4655690c6fac4dd9f
70aee906825fe0cfe5de9f34aaf760aad26ca94e
4322 F20110209_AABXUD selke_s_Page_035thm.jpg
6c6da81dc3b1db44905b65aba91d3312
4b8f377c825ede7a49292c013936dbb712d49341
2726 F20110209_AABXTO selke_s_Page_103.txt
488add90d195e2dd831220710d73841e
ecdd7598ba45e9df8785e1742d079b87d73352c3
27985 F20110209_AABXUE selke_s_Page_075.QC.jpg
9ecf14e4915c99cdd0ca212df66fb609
38ce44f474b4d05f9c9095aaa09953f611d2f13d
50591 F20110209_AABXTP selke_s_Page_070.pro
1e1846d9d0f6cfd2f796ae7075e54cd1
8c0a98b560edadd55ce48922758034acc28dc3b7
F20110209_AABXUF selke_s_Page_106.tif
4d7d7b8c77df4065156e43ed763a03d4
84ff8b784b1e5ef4862b52b8ceafd32187090ffd
2179 F20110209_AABXTQ selke_s_Page_051.txt
adeebd97293a4be1e651d43f3e5f3bfa
64d89c867f02129bde4718a7204e55f4b63baaf6
1051917 F20110209_AABXUG selke_s_Page_076.jp2
6cdc5964677bfb161d03498a215e567c
411edba755ffd2c31a8a4effee4dd91af154b0d0
4902 F20110209_AABXTR selke_s_Page_067thm.jpg
57bbb90fd2a96aa6990eb7948c416e9d
b42c9fd599f5ea5d45a93265a2d2518b79e94fe2
70268 F20110209_AABYAA selke_s_Page_094.pro
95a142535051e0bd27a01204e7e66b27
a554c047eb6427cd3aa26d6c47c89d2762cc77c5
25475 F20110209_AABXUH selke_s_Page_013.QC.jpg
f6cfdf454d7c14eec1edca2d863f7041
ba26e4e1f5ea6dc7a183917691d9e9d65bc0f139
157859 F20110209_AABXTS selke_s_Page_101.jpg
698609fdf872ad47fcfd6c7542b8dd8d
279360a99770d8646bb0f59475b7f921a8b2ed3f
83617 F20110209_AABYAB selke_s_Page_077.jpg
ade556218586bde82d8e1d26ba823687
c68bbbc9807e3ce33f8c7388dcfb98fa32dd70f7
2080 F20110209_AABXUI selke_s_Page_003.pro
5d888239f1d6dcef8f30670a5056d750
9799e8456324caf54a935423f200d56fe3d06507
7112 F20110209_AABXTT selke_s_Page_008thm.jpg
be5fee7e62131aee1ce3ee40b0fe7153
9b5110c9eedf3300c16a5d22c896d43055c51aa1
1192 F20110209_AABYAC selke_s_Page_057.pro
c23d8b2a4ff1ff63baf079c0f6741489
ab0bd0a8530c05fddcf33600c9687d5209061fef
26901 F20110209_AABXUJ selke_s_Page_016.QC.jpg
42ddda76f22930d4a7bb6e9837465129
431584a1db01c18a4f025edfb9089c0811d562ef
53856 F20110209_AABXTU selke_s_Page_015.pro
01910b16f9b93bc94813a5d0a70aa271
6b0137b0a75260b8e3a89a8599fb944e099981d0
207 F20110209_AABYAD selke_s_Page_054.txt
5b4703a0e22264909cce10cd8bc283ae
7d6ca62c86a46fb5f3bcfd25f2209fed5918f3bc
F20110209_AABXUK selke_s_Page_100.jp2
32cc0cef1ecda754ca677a416f7cf323
a1b69f67ce2133d27b1a95a4fe605ef103e58121
F20110209_AABXTV selke_s_Page_091.tif
74bc799b3e5f66c3a3b5963518aadf3b
e7534af15a006df848bbb3f69bf9f5a5f066309a
2222 F20110209_AABYAE selke_s_Page_087.txt
1a72dd2c9c9ea95ee01624f2efe58ae0
3815a402d0fefe9b2846cf86d594b4bbdee2fc76
33174 F20110209_AABXUL selke_s_Page_057.jpg
57397f75015d7a65a71f7d2394eff7bd
641e63998acc985624295a5cf79d0487f0ea0e18
F20110209_AABXTW selke_s_Page_064.tif
aef4dc72ee6c8fd4b68120fb3628ee2d
39ce36a1c47e476732718337ce3b2459962de28e
3517 F20110209_AABYAF selke_s_Page_081thm.jpg
6446fe97dff5128d78926539382a9f4d
1c2b4d4c7b13662fb099848839976afc73c893fc
27022 F20110209_AABXUM selke_s_Page_031.QC.jpg
4327c2e69e35d0793990f1400d12522e
84948a7a9c512ac953526ba123f1e0550d289d90
F20110209_AABXTX selke_s_Page_102.tif
6b4b3b18718eeeab18c99f013a9020a8
daa0167a57c0ee235f98e80b9e6b106c35041220
119 F20110209_AABYAG selke_s_Page_005.txt
88474f704717b69689c48987f8097d4b
53c88b12c98e5c4922b06e36f8fee8da8f6cb972
7534 F20110209_AABXVA selke_s_Page_044thm.jpg
10fcdf3fc8af6a59681daa8d2ae7f6b3
09a526899b602bec4fe0aa4359fdef5e5524ecf4
798079 F20110209_AABXUN selke_s_Page_055.jp2
883ad9b35b31b4f5bffe09a13cc9b19b
a31c02f68ca165943bf339fdfd9fd140a066fbbe
1051945 F20110209_AABXTY selke_s_Page_099.jp2
dbb048f983baaa16f7e980a35f5383c5
5da659d21178a886f1af13ddd3b46f72b37796f0
4993 F20110209_AABYAH selke_s_Page_062thm.jpg
7c08885821ed1bbcbce6a4a9149e1b58
c7d43704e42efbcf143186104d9dd9d12cdb3217
1051983 F20110209_AABXVB selke_s_Page_017.jp2
f19f46bca5ba55406aa8a1852f47bdb6
e2dcf789a80224de8a4cb07be362cfd423e757a6
3808 F20110209_AABXTZ selke_s_Page_012thm.jpg
cf12e1626e4891740da5790c7fcc1886
335677ffcaccc1fe9627fba75f33d2c3b8759ffc
F20110209_AABYAI selke_s_Page_080.tif
78a0b76a108898bdb9761a25cfb1b158
bdf55a4d66504aa5c8f7322f2b0c47607b77e4d3
2596 F20110209_AABXVC selke_s_Page_106.txt
aa817b427a572b622033c09f8af93783
07e26b32fcf7b4bd9bf759ef7e11e666fdd7f4a0
48042 F20110209_AABXUO selke_s_Page_045.pro
ec06b16769ceebfca4e89d041529125e
ed2dd703abf132cb7ba326763d30487022c03792
F20110209_AABYAJ selke_s_Page_009.jp2
e66e4ccfeda0b9cc01e087d23d5c2da7
778cc634e4fb87ca032ee6b2ee38babff9fb851b
910 F20110209_AABXVD selke_s_Page_055.pro
6079bf9f2acbfdc5ebb83c085b6f63b3
3e939290eae59f6c059034ea438132c7ae9f0158
34819 F20110209_AABXUP selke_s_Page_099.QC.jpg
cb739b7dd89c642fff895c072c25439d
3de42863b12e07934f80dde1279a6e6f9455fd05
F20110209_AABYAK selke_s_Page_059.tif
1f59ff9182c51db0a1b79df06c5ff0a0
260ab9fc0ac9a3f2727101442c8ce7fa45701f8c
51286 F20110209_AABXVE selke_s_Page_041.pro
ed18d37c221ea2fce61bca5a4d864b39
ec96f930cb286a3f2bd65b3c117607e7244129b6
197671 F20110209_AABXUQ selke_s_Page_053.jp2
3648271d88d0772a3d76a2a028197fc0
51d1071d4a2da07c6964218726bc72b52dfc5e9d
86167 F20110209_AABYAL selke_s_Page_022.jpg
f37ba856d7c5db64b1f8c336b01b5b22
cb16c053affc9dd578f63ebbd82dbe0a3508de08
F20110209_AABXVF selke_s_Page_096.tif
12440d4ea78c0c8308b24516a432e9ed
f3a2dca64d5f9468fc33657b0fe11baeead64113
63010 F20110209_AABXUR selke_s_Page_065.jpg
603c5b461a164a6c66ac7ceed962ba22
4fbd61f7a21830eeb7246dd54bc4b653b6582d98
F20110209_AABYBA selke_s_Page_027.tif
35c1c2801a78f5de6c8573bf2c31bcc4
6938adc8d7ffede573dbcc05321e9005c04c4b1a
133917 F20110209_AABYAM UFE0021763_00001.mets FULL
6025de288e1004698937e116963172c7
becf4460661155b83679125412a0889eda6fc7df
84027 F20110209_AABXVG selke_s_Page_086.jpg
cb2f58c3d0f51e1ad2e39b8f69153874
a5fd020e7af67712e156f13aa70b951e44c125b8
15858 F20110209_AABXUS selke_s_Page_037.QC.jpg
e003718edf8199cb28adb78f3c7cd951
ced159df4bd7dccdbd437d8a5b231a21b1b11e98
F20110209_AABYBB selke_s_Page_029.tif
e258afafc9e95894df50e2ba4da52234
a353cf1413fc6af76f8ce9fbdff86a5f89cdc770
F20110209_AABXVH selke_s_Page_023.tif
50064d057653399345bd10790bd9f001
a60bba795a62eb4a9496ecc6087ad09d8898e2e5
11837 F20110209_AABXUT selke_s_Page_081.QC.jpg
087bc38d4876262156c9a906c2381ecb
edf39ebad79204a4b898392fb8951e3a3075bc6a
F20110209_AABYBC selke_s_Page_030.tif
9461bf674be126d77da86e2c96e4dc89
d356d2457be7f066850cf7f852686851040a21ec
3169 F20110209_AABXVI selke_s_Page_002.QC.jpg
9286d0d68e6b5065bc58b76950749009
6bc587bc9a9fa94307c7938fccba7b939010a977
3048 F20110209_AABXUU selke_s_Page_061thm.jpg
61027a49fc2c3805ea3cb9b03b6112b1
06fbab7c8fbf1185bd4821dc7df0fec761ac528c
F20110209_AABYBD selke_s_Page_031.tif
a9b5e2d358ee8b16412d2b75e5386e3f
1f68bb3e0f203dea3c968674f33e218366689b04
F20110209_AABYAP selke_s_Page_001.tif
b714054ca0dd69e66bd2c371b3f2101f
4b0c943113d70d7f9cf8ab71a0f244696df152e6
54637 F20110209_AABXVJ selke_s_Page_020.pro
dc1adfe95d8a5e58aa97b1afed9fa8f8
7600fbbb456fe3cf51ed80430095399d6bb373c3
F20110209_AABXUV selke_s_Page_023.jp2
9698a872446828237006926f2c156fdd
a2ddc40ccc91c5b73290e8db5acef01e64422726
F20110209_AABYBE selke_s_Page_032.tif
cf6bc4c62f96883770ec3e4104d00e56
60fa0baa3a16203c312ac8b01465b8ce08b34019
F20110209_AABYAQ selke_s_Page_002.tif
30012d77022c12c9760043d1e9b940a1
f6d9f2330f49d49306ccfa7b192cb13ad759f3f6
F20110209_AABXVK selke_s_Page_100.tif
9dab63d0a727a3987a2215f27aaab425
98ab69b6b182a20a809335c15f9e157263a4aa5c
7523 F20110209_AABXUW selke_s_Page_105thm.jpg
a14bbfccd45214b301c6b1536044128c
070aa7d574aee6f0dc629e81baac41909fb3b943
F20110209_AABYBF selke_s_Page_036.tif
cc2b808b7322bda633c173cad04af795
1d4bdf72f5157fc8de704116dc7c5fcf75d4b3ee
F20110209_AABYAR selke_s_Page_004.tif
e6947c06ca3259dcb3f4cc75ebf0b680
cf566e522bb54c82b9186938eb27dbc18a72987b
87840 F20110209_AABXVL selke_s_Page_075.jpg
6c5e6104ea3728622a0f214cae983276
e6ca1d6d7c9d013e95b6665efe124545ec58fc55
73805 F20110209_AABXUX selke_s_Page_091.pro
c4a7ec32c1776a8306632f2d34de4aca
c4fbbe0a984e7da3f7ef3660f6c14ed72adf003a
F20110209_AABYBG selke_s_Page_039.tif
42d38d4d59072dee405b21ac7c8342c0
c8fc8dd536643a88350b50e05c8ac361e69713a1
7719 F20110209_AABXWA selke_s_Page_112thm.jpg
622250df0d034fcc40aef112e7f8b865
81d5a4987de2ada4a85c999638f0b5ccc9328f5f
F20110209_AABYAS selke_s_Page_007.tif
65d73cef692bc0e051cfd611d04982e3
1bf3be0000a5700cd641402e66d3b0616ac00d70
55525 F20110209_AABXVM selke_s_Page_075.pro
f05002bba4aca128235294ad4a649a11
97f81b25390b3ad44a9ca068d41b1107e8cf931c
16578 F20110209_AABXUY selke_s_Page_036.QC.jpg
1631bba9618f0de7b45c149aa29fc26c
1e731c976491664fe203fe420a2489eaf0fbcfd9
F20110209_AABYBH selke_s_Page_040.tif
32a4a5792a800d2f0a95980877d98394
d5a3fc196b7c30e6e5281ce308ac85d6f44c4be8
1051978 F20110209_AABXWB selke_s_Page_112.jp2
75c12fc7e4b2e6fce2c6e2a29cd00a44
cb34303a3ebb4cccfa6580377b0dae267697e1e3
F20110209_AABYAT selke_s_Page_009.tif
1231fac9f8d06befd52fc1197dc49858
d8498dd30ba97bd67be3854e06beafb2c5fb3e58
7083 F20110209_AABXVN selke_s_Page_072thm.jpg
261fd7d8d2f52e637840f38118007f03
fd740d2eb9116b59fb034a84c56b3d4155e20a2d
7522 F20110209_AABXUZ selke_s_Page_029thm.jpg
1e1542b1425de5143f25d8c35af7b9c5
d86e74c92388d5130ee2589fde994a8a8d14e9d0
F20110209_AABYBI selke_s_Page_041.tif
8127a73720dd7e72542708283d256399
8e2b87bc2544897d03c5f89cbe564a35f19c139a
7023 F20110209_AABXWC selke_s_Page_048thm.jpg
e0dfb9e53ddaa99900e16d059cef5094
854e12d0db206999ae71d394375979bc5d3c0c1a
F20110209_AABYAU selke_s_Page_011.tif
5eb785a7c2c03a97417d6d2f3af2dad7
170c220445f8f6d4fa2d3dd490c9a2ef30278023
85211 F20110209_AABXVO selke_s_Page_047.jpg
ed27a307848a17a0571e5b7f3df4c3da
2b747249847fd0bfac87b2c723d04ca7f2e0b08e
F20110209_AABYBJ selke_s_Page_042.tif
33c5e6d3988d0c91cc75b6e1b81e58c5
6ecf7fb4e8e341e6ea9d4680bcbd8baa2d2d6fad
2145 F20110209_AABXWD selke_s_Page_020.txt
b25ccfcfd194b14ffe0b56e55131ff95
8c56a05d01e21a36cbff7c483c50a78823df58a7
F20110209_AABYAV selke_s_Page_012.tif
e46d4d6c6d6ef47d4c31646824d89ee6
4a2d3f26bc562f9606f7df78204d30150dbd5619
F20110209_AABYBK selke_s_Page_044.tif
041e2a01831be4923bd935b2d85160ce
e3b74eb5ab3786700a4d10eb24ae9a5281109a4b
695089 F20110209_AABXWE selke_s_Page_039.jp2
a1dcb4ef845873c64f4e1a963c0b437e
3dc7877361a22fbc4b38f101cf01d7e89db7f878
F20110209_AABYAW selke_s_Page_013.tif
006a414f33e6c5f1115576d0c25ca0be
1b052c91352f1151a1d841756aa15202a422ecab
1991 F20110209_AABXVP selke_s_Page_021.txt
b7b10e6918360a4e0fadeb98ab6380bd
076d4e0670e36622bf56dddadb3f5abc0c813fd7
F20110209_AABYBL selke_s_Page_045.tif
9e215788edc37c45eca26450b2590f07
1d21391e1dc5c1a8a6a14eecf2ae17378fa0516d
51369 F20110209_AABXWF selke_s_Page_025.pro
e850f56ff93eb2ab37850265c7456def
eda3a4d46df4b0258b14ae782c5a83767b5fc2e2
F20110209_AABYAX selke_s_Page_014.tif
30647a3984dc796a6d580efaed9c6d07
6d03da35e3ad4f0c4e63c6d97438306d87dcad5b
F20110209_AABXVQ selke_s_Page_017.tif
3e73a8ed8bbbe8e546dac9210e7dacaa
13e08ef8f7d4cf6567d5c9cac6354e593a247aa0
F20110209_AABYBM selke_s_Page_047.tif
1cba042f69d610da8820ae381c7c21b5
5980ca13cdeb6c0e749fabb1215048d2d6f1c369
701436 F20110209_AABXWG selke_s_Page_084.jp2
4585e47036aab1163818932986297935
764b9213b628684cf1be108194cd8fc30f16134f
F20110209_AABYAY selke_s_Page_020.tif
07036d41ae45b6f5e22568f442c005aa
975c706e0ab3aa1acd1b7fc77ff709fdd7016cdb
F20110209_AABXVR selke_s_Page_033.tif
777fc67b447b01175b981beedf03afba
f54f74128d8622079e176a789334b5e1bc2f0590
F20110209_AABYCA selke_s_Page_089.tif
23352646bf7e709805a5cba562e3d6a3
871a8907d726a6f616843da3844f495610d59b37
F20110209_AABYBN selke_s_Page_048.tif
9334b334bba59a95fa7eb297fdef19e1
10c770b14bc0930b89aa43425824f883836694dc
7270 F20110209_AABXWH selke_s_Page_085.QC.jpg
b69a3f5cfaef6b1e649c7c2bfeb78c09
102b083366ef432b27837afe54ff3cf7963dc44b
7594 F20110209_AABXVS selke_s_Page_093thm.jpg
87c81425ed9711d24f56a0c0d19f03b3
13c5e3eb1a96c3220fc583c4b05e2ec9a42d4a0a
F20110209_AABYCB selke_s_Page_093.tif
f3eee290994f4457368c7b543d8b2273
1a5c1d233033725076f7039ed63cf3fabcf1d58e
F20110209_AABYBO selke_s_Page_049.tif
e3869d3bee069d3ef396a554126154a4
077f29f61ab7e116f44598ba34f0d47984311a0f
52264 F20110209_AABXWI selke_s_Page_042.pro
4ade303b1332d27b73c47d012ce1fb6f
d30f0455c31593fc93d6b2deb2215752a9235c0d
F20110209_AABYAZ selke_s_Page_024.tif
6661eeb919824571f3b236fbbdb9e28e
ab93a1e74f9e75d36b5e8772277377505d96bb73
2186 F20110209_AABXVT selke_s_Page_086.txt
d51781fe4977efec5894fa54057afea2
fc57a2566d248c90595b7a182f503821aa269967
F20110209_AABYCC selke_s_Page_097.tif
c3a2f1295dd318e8659a6c3b31c41aee
31780c9e5cb9d94f66b34d078b8fe04005b00a26
F20110209_AABYBP selke_s_Page_050.tif
d69375ce224124ffc37b849c0510f867
c15c14c2894c85bf4515a89e87c67b8d7a34e3d9
F20110209_AABXWJ selke_s_Page_066.tif
9c1a63746fab0c84ad51d70dcc63a226
7aae217a6a00928ac1488b6bec471c12cb0b97a9
47171 F20110209_AABXVU selke_s_Page_032.pro
6a9cc4fe50ef20537a058112540d98f1
fd71cd6a14bfcbba65005b531a9b17957d640e22
F20110209_AABYCD selke_s_Page_098.tif
cc4d0cdb1ea03b2a06327d45d4e60a55
3400f4ec2bc0c391195c467cda6fff8ac759e734
F20110209_AABYBQ selke_s_Page_053.tif
7f9860807c411f0850eccd175073fd6a
b5c385277973b9e740d96727a2c4433d0a103a0c
37509 F20110209_AABXWK selke_s_Page_101.QC.jpg
65972750fd21b5298ed5ddbe0806b8ae
b2a816dd45565021a1cae46848eff628cd523986
F20110209_AABXVV selke_s_Page_021.tif
fee99cf661be539652bd93ec7c96de3b
0d976d31aae8fec7eacb63b6b04e4a16408c0eca
F20110209_AABYCE selke_s_Page_103.tif
2a4a2a9e5b4d1783e318641b2fe48b59
07ea2774ef27b82bdf3685d03f1e40c547b3cc05
F20110209_AABYBR selke_s_Page_054.tif
c53855f9da606d275631b118608a2915
562a225bf863fa2fa974f6e7d04fd84fa4eae669
7729 F20110209_AABXWL selke_s_Page_001.QC.jpg
3ac1cee48bfdec054252a092d1f72aaa
792451eb595aae6b025fbf9a50618b05403182dc
27575 F20110209_AABXVW selke_s_Page_015.QC.jpg
e0690ffa677a8037504a22c0f3b8aa37
fb4aeff7c8584e539db35e87b411cb5c92204b7a
F20110209_AABYCF selke_s_Page_107.tif
339735dd9ca2047d2d112ae26c368a45
30841b405ce89e470c80cd4a6709a6e7687491fc
2330 F20110209_AABXXA selke_s_Page_108.txt
fb85da481c6b3802bc591d036e584bbd
e138402dceccfd21f3fdd55e24690538f05b8bbb
F20110209_AABYBS selke_s_Page_061.tif
a6e09a6b9302f8bb358cd438e1e2673a
16099ac1a3b4613f6cc7af23580aefa124f25b40
1051968 F20110209_AABXWM selke_s_Page_019.jp2
9c4ce9e4c74007dce53c6f1a454f4f40
c150a15bf94c7c1fe43b1affbb21393f22f420cd
F20110209_AABXVX selke_s_Page_049.jp2
e308e4e8c1a9bb9f1954680f4036d220
3735899dd15f6423527a84534145c1f42ecef45e
F20110209_AABYCG selke_s_Page_112.tif
b23a7efff2e2b020c56176f5dda7646b
782b21e988c5612b01df00ef8961929eb031382e
1051954 F20110209_AABXXB selke_s_Page_073.jp2
7e293e59e50a8d2457b4e34d3ebec955
b4b6a90ccafba92d636f901f87560674e2630cce
F20110209_AABYBT selke_s_Page_065.tif
c7bbd7fc2c2f2853a64cd2c03f853654
a0f09fdb488f9dc772dba950d72adfa13e6603ce
63277 F20110209_AABXWN selke_s_Page_064.jpg
ca0435b29ca6f9c3a36a74c713521988
7c022f4b8a33bd30cdd3689ba96b3cfa2b2b0574
53483 F20110209_AABXVY selke_s_Page_047.pro
51880b0f801dc687ca69d510ffd20952
4526dd3f1859fdd2fd1eb1413046564b8a547dcb
99 F20110209_AABYCH selke_s_Page_002.txt
2c09bb462b898c7158c729ae780d4ee7
4c5509fee2148bb2dcd91650f6484a8ff86379d0
7406 F20110209_AABXXC selke_s_Page_109thm.jpg
047d9bb6ee4b30f6c41ea67d89b15c90
fbf0b1c9768e2034f9cb7504ec563fc5828d3fdf
F20110209_AABYBU selke_s_Page_067.tif
7d6740d01526fa7e7e1cfddd25f4fee8
3d640e97d7a12d172ea8df80f77332f77f690c9e
F20110209_AABXWO selke_s_Page_043.tif
1a53b800ee3ff44607c35b0677eb89af
6447d1f2cf4dd8fec3e4b2f2ce9854d58fd18819
3239 F20110209_AABXVZ selke_s_Page_054.pro
cfb913cb1d15f8136ae4430c89997fd9
245dcb42d67279231cd82ac4d8e4d0ae35803c66
134 F20110209_AABYCI selke_s_Page_003.txt
6d1b0049c99f42e39d5e73d377d41a84
ec921955750dc581acf395a4af899447b870320e
27372 F20110209_AABXXD selke_s_Page_050.QC.jpg
1980c9b7e05fc19c06869358abdcf008
ca6f31cbddb7613d15285626fffaa3c0de02f675
F20110209_AABYBV selke_s_Page_079.tif
d8d7887c276b3028cc16d987ad5e8bef
3639805086064ccc0774357f22162d20be26d8dc
F20110209_AABXWP selke_s_Page_074.jp2
016ebe250fc3be6d3bde8ea0747e6a7d
bed7e04e007983d2fcc9fc41c039fdadbfa9898c
1489 F20110209_AABYCJ selke_s_Page_007.txt
79927aae6b3344e10b2dba6e68a93d2c
7ee43f9c8fa61829f1c1e68ad91acf59f766d972
38684 F20110209_AABXXE selke_s_Page_034.pro
77991d09a3807061cf1076e0ba6322dc
cc7ad288e14dfcf7d639dc5a440fcd59ca69247d
F20110209_AABYBW selke_s_Page_081.tif
488875e6ee2a458b552d103df9d1ad22
577205d6591a8a598e350ddd26d6a576a915dd7b
1596 F20110209_AABYCK selke_s_Page_009.txt
46577f87248fef7f3e10efafe54b2858
b806d33c4ab4de71992fd895b710e3eb35828c23
2634 F20110209_AABXXF selke_s_Page_112.txt
a98a40d2c4f32be0c497fc3d25c223d5
3841815cecf4d03bb0bf5f21a5426db68082cc7d
F20110209_AABYBX selke_s_Page_082.tif
91b90b6f4ad404d3984ac922dc59b6bd
7041d0ff23af6376a1a52169e526f19953e75bfb
39155 F20110209_AABXWQ selke_s_Page_038.pro
cb64f6b9c3cbbb59983aa49a997dac2c
9c90f798602daf1f45add2aa5745a40bf8f05530
1423 F20110209_AABYCL selke_s_Page_010.txt
d76e5b7026c088f8701973877658179b
621ee427382b664d01234602c142743d04dbbde2
F20110209_AABXXG selke_s_Page_076.tif
7891c0f738026febdd38ae74f374f27a
72d772603576f2cbc738b671e81a887e7dd3d2d8
F20110209_AABYBY selke_s_Page_083.tif
d2027d9b45559d92e4e81a4c9dcc9174
996399c74df93a04d29fcc15f8adedb2067c2a94
3556 F20110209_AABXWR selke_s_Page_007thm.jpg
658afedac741d550560c3eac47594aa7
f6664c47b2791b7546c97a4652b9a0ad2f4b0ee6
1646 F20110209_AABYDA selke_s_Page_060.txt
74d5c1b22849c932d33437275452a969
6595f531da5de81d23da47b5924ba61a790e0501
2154 F20110209_AABYCM selke_s_Page_011.txt
c18e1320e19fbc85372eae80df420762
e4f8d7e9bb6966585d24b5b7875032b1805db025
16618 F20110209_AABXXH selke_s_Page_062.QC.jpg
8c8d3d1ad931947fc9f03fc39ced5816
449de6ad96c6ba6844a3d331784be9a8134e2a1f
F20110209_AABYBZ selke_s_Page_087.tif
41a133c7f07fa7abb47aa4fcb605dace
794e4efaa247c7448f624d2a77ae7f381e8c0f98
27572 F20110209_AABXWS selke_s_Page_040.QC.jpg
1f1626246ad3015515ca97b8b7e185de
87ebd61c07803f237149b1cb8936d0962f422e09
1537 F20110209_AABYDB selke_s_Page_063.txt
b56ce71da2e8e58124f89a00d1e79e3f
4e781077e3405c553ca1a9cc946fdcace88d97d1
876 F20110209_AABYCN selke_s_Page_012.txt
a41a995227da18085b7593bf2fc34f53
5e922b3db6ebd0fc17abc22dc8915a1b687b111d
F20110209_AABXXI selke_s_Page_074.tif
5d9b0846ba6738a654007b1e8ff03e7b
29c4fba9f59c4d2212a107316e1cf6c58a35f3fc
7184 F20110209_AABXWT selke_s_Page_071thm.jpg
a954469ccf68c73e3b1344689c38fe5d
f228d6eb1ea7ba46c8b82c3f841894528e0ef47c
F20110209_AABYDC selke_s_Page_065.txt
3573c3e686b8a64ba8f0da5b5653d1b1
5f5ba6c77ead80c88e6679a5d3cb08126c923396
2043 F20110209_AABYCO selke_s_Page_013.txt
ca033313d14c888fba8d7874916e0353
687f813bcac41a43fae6c087cf8022bdf1f092a2
3416 F20110209_AABXXJ selke_s_Page_090thm.jpg
a74d495709e0ec879c2ba9c120c549d3
d5f7cc863add42bd04f4eee0701cdd5e6fab4784
1051951 F20110209_AABXWU selke_s_Page_032.jp2
932568cf4ee8be9dafa0cd79c96779d3
d6eee2661d2e8690c73d20a418c53c91169be040
1905 F20110209_AABYDD selke_s_Page_066.txt
f88d6620e23ff047cbdef9fe93a3911e
315276a3ed369221e74132ccff85a6ef71ed4cbd
2199 F20110209_AABYCP selke_s_Page_014.txt
30d728f25b65a876a37dec6b09f1c827
a983551e6b5437167f7dd0a2c3bd15956210b6c0
197878 F20110209_AABXXK selke_s_Page_085.jp2
0994bf0248b0f871dde726c0c6734e00
035d29e882f1a734eb9f6d0ffc1bb9b039b518dd
75238 F20110209_AABXWV selke_s_Page_032.jpg
d5eeb8e6fd8305f95e1c95037cdab7ee
4a737c249891ed0b1bb9d1b83252c453b769c3d4
2183 F20110209_AABYDE selke_s_Page_068.txt
e1063db36ea1a42e348ae888411bf989
320bef32eebe13a7b5514812970b2014f0673cc9
2078 F20110209_AABYCQ selke_s_Page_016.txt
0c1fdd81410d2865a59aa77019165e37
3468a993ac43e18662ff7575a844511e76582028
8703 F20110209_AABXXL selke_s_Page_053.pro
751d6ee531cbde96d766474b7e361de6
e39fd40e7b1d99d178cda8234a5e04d11186ff85
27323 F20110209_AABXWW selke_s_Page_047.QC.jpg
5aa698d14fe1276ee86c4ca2336f1400
a7afe710afb8a8fd04e85e19b0a3ae8a1c22b760
1874 F20110209_AABYDF selke_s_Page_072.txt
e6f9d060eae94185c6db0d4d99d69ad7
410dcc0c2a7a2d61f54183ea0cd3de0b88cc4767
2304 F20110209_AABYCR selke_s_Page_017.txt
76e8428d95d20724d9199637d497e9c3
9bcfe7df34c07c2950415017a35ccdf6784f2e26
1051947 F20110209_AABXXM selke_s_Page_046.jp2
f64269105a1c430e9686adb00d58a849
fc52d540eba27328e03a75d8629d18ecff0106b4
11498 F20110209_AABXWX selke_s_Page_090.QC.jpg
6a57ee22de331708349e87946c946de6
9b86a81622bb627e737408fe1ad03239e224d5cc
2223 F20110209_AABYDG selke_s_Page_075.txt
159b3b11246bedda94f8ac5f1810e74d
530a63b7e05fcc2fae5135cd9cb8e5c7aa46798f
1179 F20110209_AABXYA selke_s_Page_084.txt
915f6cdebef6e95a5031165011cf2fb9
ab67bbd286e0c85d3dde43f4c86ee6d257c29859
2261 F20110209_AABYCS selke_s_Page_018.txt
3b04e78ff97cfa12c28cf3267e0a111b
4715ec9f19ba22cffd5c7408aeac7547d3073138
101 F20110209_AABXXN selke_s_Page_055.txt
facbb0e92c47aca40502aa6fc2c016f5
7aa73fb8202476e96dd40db87ac88b7d5d0dd8ae
F20110209_AABXWY selke_s_Page_008.tif
0b23689b854860bd4e2152af871bfbaf
ef6e43f8377fc46500bb87f6f9345370058eb649
2103 F20110209_AABYDH selke_s_Page_076.txt
420ca2e621466c333e46b8687b39c38a
aa99b3ae39ddb48008e4d92ed2ac0d80c53efcf7
80403 F20110209_AABXYB selke_s_Page_024.jpg
67cbeca47c4f229e2b5e04d9a22664c7
72cd40166e0247cd91e63ca408b6de047320a9c2
2173 F20110209_AABYCT selke_s_Page_022.txt
88388d336a1144c327b68f4aa12e3e2c
b30d8572ed8bdc451ff66376ee9bfdcbfd3fede3
86429 F20110209_AABXXO selke_s_Page_051.jpg
762deb9a0f1b6acbd51a7f91d59d790d
55a5b0bad19ff828c96f13e847db1051d67f6a24
52859 F20110209_AABXWZ selke_s_Page_040.pro
5cf9e8179dd6366b795a6f9f1a010d09
c7ceaa2836f2af6758fd72019b6ab2ad106f3c06
2059 F20110209_AABYDI selke_s_Page_077.txt
6f6f376df3d56ed080d22c92406f664b
85c1be3ad3d2a980dfe34192335a0931042a1418
F20110209_AABXYC selke_s_Page_099.tif
6c0d4cc9dac9e2c90f633f72bff2a7dc
901e09b73acbfbe46889948d0379c989345ebc1a
2077 F20110209_AABYCU selke_s_Page_023.txt
d0b9a94b26c192f7234dd7e33a883241
652a95fa2b023ddf1427b001482090879462175e
1051916 F20110209_AABXXP selke_s_Page_027.jp2
5e9202f5192ac8263fa200f5909b69b7
bf2caf34bd643cd5a803c6926e0ff2b9de77d627
296 F20110209_AABYDJ selke_s_Page_079.txt
e6fd5c38057eea39d99a49e22c778c15
d0080fa5af12cf368ed8f90a9f0c314f63cf1b1f
70651 F20110209_AABXYD selke_s_Page_096.pro
6bae061c6b4e630ccc89429181c5a403
c0892a27ba68fde7463a32d13bd51c3fc68c5244
2020 F20110209_AABYCV selke_s_Page_025.txt
afc9899b75111134ae31110ba31eb40e
836f21826244c4fda03ff21d5d124367148fd262
27084 F20110209_AABXXQ selke_s_Page_069.QC.jpg
b848d130ec8726321a61bc6779af0939
d051f37cae74c6088cf943a97a23ea0ab8ebda88
1308 F20110209_AABYDK selke_s_Page_080.txt
8399048f6fbf0a060006464c8bdd89da
0fba54508c1fd5ff38ccf24e4d0005d84829e32f
F20110209_AABXYE selke_s_Page_078.tif
6d5cb1d8bf2eb5471d743e340edd6a57
b1ea86f5efa493747d85909e4b26a51285737bff
1692 F20110209_AABYCW selke_s_Page_037.txt
97f81e4ede4bb80d3c50423f90c67b3f
a613d36c9a36a97f7e71a44076d6da6643f0e65e
1443 F20110209_AABYDL selke_s_Page_082.txt
9e59fd5851bfcaa1473148133c06eb9c
64c17bc7129a4cfcd75274485fa22a341adfbc55
F20110209_AABXYF selke_s_Page_104.tif
11eed4f8010b6951357206945048d95e
6efa03af8cdd72c4be8b43870758d1d83845bb3a
2056 F20110209_AABYCX selke_s_Page_041.txt
55fbdc0b5ddb34a92c5004fabbf02b43
8aa88e38206e6e359e359403fa9206173bd709cd
4385 F20110209_AABXXR selke_s_Page_034thm.jpg
39c70c21408f473515d9dfbe37955546
e759c797ef0f1ca6c4a9aac9b104cb9972366d82
36937 F20110209_AABYEA selke_s_Page_007.pro
7fad171b9d7a95fbc1762c24b7d79dcf
14f69a49a447180c4fbffcc084510989fd11d606
1298 F20110209_AABYDM selke_s_Page_083.txt
692694bcd35e083a134bb0266838ef6d
d9f9b3fdf2414ea456341c7108b8ecd0889e65c6
7477 F20110209_AABXYG selke_s_Page_111thm.jpg
bc9f3fa0604a6b46111ddb0fd05dd0eb
5f6e8403d0f020228f8c7e8a90a9852bce15d606
2125 F20110209_AABYCY selke_s_Page_052.txt
376874534aa1869491175ff32b71f770
c4b9a1807ae1d3db0e6fd6742d3f26bcbb438235
7960 F20110209_AABXXS selke_s_Page_079.QC.jpg
184a869ce5099cb14a73d5e8c54ac1d7
50b4c471a1d0ca4657afd6baaf4d57703634e55a
73577 F20110209_AABYEB selke_s_Page_008.pro
73b74e3f6c758fb43a6daf883874f5bb
6c268e8d1d0a2c9e0ef538c557ece0845aedac1d
390 F20110209_AABYDN selke_s_Page_085.txt
944429701fedaae60685ac83449e551c
8b78305b8d49c1533f6fe3fd794331e9c052b458
7496 F20110209_AABXYH selke_s_Page_026thm.jpg
2c97906f774610c5e5f1f4900b2d4adb
47d4a43ae26a001d0443c873be051cccad54072d
1096 F20110209_AABYCZ selke_s_Page_059.txt
d8bcdea7faddfd719961019fad713e0a
0e56b8fa50302f695b648f64c983fd69e7bb7136
20894 F20110209_AABXXT selke_s_Page_114.QC.jpg
612edc41ab168c1b1f263dc2401bd50c
45df9cd88b06ae54880be0f533022c0167f8f1b7
39331 F20110209_AABYEC selke_s_Page_009.pro
24bc3a9759eaec3cc2257006fb811431
535f9fe36b5314e95ac898b96a367bf14bea9978
1244 F20110209_AABYDO selke_s_Page_090.txt
6b062984f3703d4018fb950c912c6d3d
d1cdfc300e8c8ca1ba73c68701d4dba83c66eb03
25688 F20110209_AABXYI selke_s_Page_077.QC.jpg
7e2d42e150ac405e62e36499f05a9ac8
44928f474a9575684868c87c88968da47b45e943
36236 F20110209_AABXXU selke_s_Page_093.QC.jpg
3d53c0469b5c56244ef38f0bedd61b5a
6a12834833ab3328d1080a88e7e234d18230cd0d
34547 F20110209_AABYED selke_s_Page_010.pro
0b3bd9640e71a4eb8108bc9eaa9a5454
a14e4f716c22231f42e9dc9c55a00d815613e3b0
2718 F20110209_AABYDP selke_s_Page_094.txt
c9eebd694437bdc662de440c9269c2f4
ba510c3ba24df6023be4349a6a4a11e1df8e83ee
53423 F20110209_AABXYJ selke_s_Page_069.pro
37ab4f7c4a1366d1d186979ed74dabbb
144d2bb565e786f3f530351996f26141ccd11afd
4138 F20110209_AABXXV selke_s_Page_005.QC.jpg
c44aba4c410f0f14ebde4673168a4aad
64d921e11f229a1f0442fac8b7cded07f4271736
49881 F20110209_AABYEE selke_s_Page_011.pro
0d32d4d3f7029f6c5eb153f9e908f0fc
0c15242c834b3da9acbf48e46c7c2231d36efae9
2716 F20110209_AABYDQ selke_s_Page_095.txt
32b64301b60e1056382ba64e3a500f7f
0329f1913d41d2e081d6f40b8e0b9c621a7b9934
F20110209_AABXYK selke_s_Page_086.tif
48739678cedcff9417fd8557f8e1d915
fffac297dad939ba8cc0793e7b9cc75e0e85576a
F20110209_AABXXW selke_s_Page_092.tif
75a163c006dbc84f2f4663852fd4a2da
baff8e9f4c71ac2e4ca7d40670797c1fcdd90643
22054 F20110209_AABYEF selke_s_Page_012.pro
e9aa07109a2a7f7a74ef54666a953862
a7c983e321381b95a39bc308c6c7f868be8c9be9
2763 F20110209_AABYDR selke_s_Page_096.txt
272e465bfe1214bf0dccfb16cc0ab36f
c1462f8695198afef44b368004ff8d533926bdc3
F20110209_AABXYL selke_s_Page_062.tif
9d0c1a86312200bb32d62f767bd6bdaf
ba5f09590daeeec7e02008da9747ebb140f1cab2
55089 F20110209_AABYEG selke_s_Page_014.pro
34d64c838e490a82219e267a20564aaf
726c974abccd4ac7eebb1e9e1ef256f7b303adf0
53526 F20110209_AABXZA selke_s_Page_076.pro
9f02933023af006a23391586eaab46d9
d0388ceda2dd9f42cee30fd1e29cd3747e77aec0
F20110209_AABYDS selke_s_Page_098.txt
3637e08c3964ffd4780dd0a893424093
13e25ed5f793dcdf4ab4b5cb19a42b1b2ddf35d3
F20110209_AABXYM selke_s_Page_052.tif
2ff00d48fb9f101aadf0c4763c9481f6
314f3e94e30ae926f59bb569330a67a8ebb194e8
232 F20110209_AABXXX selke_s_Page_033.txt
ec955425026b830d5e8cad594fbfbe24
d3f7f199b794e52bf0e2cb6f1da33a92100a4e00
53575 F20110209_AABYEH selke_s_Page_019.pro
b5160776300e7fc91142419328924b2d
050178c0522852d87fe6b141e57dfe2cf4404a62
55471 F20110209_AABXZB selke_s_Page_050.pro
a697beae32cfec29c3f8cc5fa4168142
1c5364b4267e5e130652ad9ee76b8c7ff657d45f
2930 F20110209_AABYDT selke_s_Page_101.txt
592e5e9208257514034da5fb066a48ac
a12f2aac2f51fcc790340caa936d3af4824bebda
27495 F20110209_AABXYN selke_s_Page_004.QC.jpg
fb5c17ec21e64799d497861b6151e352
32ba7cf907828891d2fec49d5745d440927fea37
7278 F20110209_AABXXY selke_s_Page_041thm.jpg
e45e84b2f1c2a57117626b8ace6fcaac
c824df49785e3a2c59350cbb631e229e68ddadf4
52908 F20110209_AABYEI selke_s_Page_023.pro
b0d22be8c871a04e3ff2f68ef84a29e3
3bd10712ad9ca7fc1a5c5a054f296a1900498347
60793 F20110209_AABXZC selke_s_Page_038.jpg
be42ad052d75047d9b92e099ac50477d
20e6fa04dc8e98c5887a0e08b816380a9c6d17de
2725 F20110209_AABYDU selke_s_Page_104.txt
f2203faaefaa2471d8e2ecd1227b5b0f
857d29891de3ca353532bf4d8d76da87a0bce82c
F20110209_AABXYO selke_s_Page_099.txt
b501e624e6f803efcc872f126366bad7
4453e2f52b85ccd78eb4e71e7a7b740775eb91bb
50518 F20110209_AABXXZ selke_s_Page_021.pro
7f21314f10b7d010e7f0a0099a2ca513
e1697732e05750918224d82e941b1fadb3e02cf9
50408 F20110209_AABYEJ selke_s_Page_024.pro
2adb98e3057d1885b2b3621f3e4f0cae
ee3f9bbb1b9534f74c8091a6f607bcf68b3d2daa
F20110209_AABXZD selke_s_Page_021.jp2
12e70662d3feff667e959c456e7c49f9
b8f9a1bb0e28803acfb910209d843519eb553bba
F20110209_AABYDV selke_s_Page_105.txt
1a9ae1253c5595263d8dbfefbd2b99de
31044488c7f8d593b128d442f8458df20097f641
800751 F20110209_AABXYP selke_s_Page_066.jp2
c32157b2f605ea2b9595bda0f66c635e
20c0ea26319e5a2349db3ead235a0db1cd19fb31
F20110209_AABYEK selke_s_Page_026.pro
9cd7753708f0fbb26b4c7284ffb6e00f
823f9b94ba91b8f633be008a2129f049aab2b4bf
F20110209_AABXZE selke_s_Page_019thm.jpg
e33b5cf659fadb0f04d3a4b466cb9733
1d34d9abcccd8a37b939ce644936baaa510408b9
2529 F20110209_AABYDW selke_s_Page_109.txt
1d7eede388feeade090ff85b25bed8e1
c1885357bb75545b433f9986c0aa47514022ff45
10633 F20110209_AABXYQ selke_s_Page_057.QC.jpg
6f20a0ca4c9ac43f0523c33d9dc0d4cc
165406ae58ab39216b3260f7b2e27b4ae2473ee5
54489 F20110209_AABYEL selke_s_Page_028.pro
8b57dd402c099127351da49d723d9d6d
0f987b7600dccfa22d04a6990e11c2466c676867
638970 F20110209_AABXZF selke_s.pdf
e690e6088dd40a1f072ab307a1f582f1
2463bbfd3564e0aa30be6e57a6656fbdf87e299c
2403 F20110209_AABYDX selke_s_Page_111.txt
fc2fbb76c4d4fbabdf3507068b1f309f
8e8b394040f624bc5f9f8ccaaa6d8d35810d6f9f
7094 F20110209_AABXYR selke_s_Page_011thm.jpg
f2855914d4f17ec91e4eb76a1c366fe6
46776b0812852ef7736424226b3ef9e1830527da
54190 F20110209_AABYEM selke_s_Page_031.pro
8ec54c9e403be91340cc5fb364091e5a
f2ce66094a65a37160b84c61da3ae5af616803a9
F20110209_AABXZG selke_s_Page_024.jp2
267a09f04e4acb19fda906a9ac7d2109
421037675cd934ef6ae1f63cb77b47352fd8a4d4
1120 F20110209_AABYDY selke_s_Page_002.pro
1ef721dc276726672cfc4c54297c5c1d
91fd74cafe481809fb8a7f65a48a0c12976a6e91
50817 F20110209_AABYFA selke_s_Page_071.pro
2cd29cff5db3cfe82783b460b1661ed8
17e8975824e8afc8a3063b0762ab7c27af66898d
4773 F20110209_AABYEN selke_s_Page_033.pro
f65c4ae546ad6c268114cbfd4654264b
61c27a3ec45d31cd6de49866c789e19d13388477
25182 F20110209_AABXZH selke_s_Page_045.QC.jpg
f39feb78ef36a723d5d760b7258b01d7
b924b37f2f6a81be583f028df789752ade9bfa22
2823 F20110209_AABYDZ selke_s_Page_005.pro
3be5494a225400121f493caf84642b16
e17c8b4c30f537493397ec56a4fb850f71350a01
F20110209_AABXYS selke_s_Page_077.tif
14e2a2038c6be4cce36b29b4773db1d9
45829df2038cad5a2e64b305aedb95cd4e692725
52257 F20110209_AABYFB selke_s_Page_077.pro
8c75d500b406835e5d10b476a0ed50d2
2c079d82c5c5318d3fceff5391e046b3dce61ed8
34433 F20110209_AABYEO selke_s_Page_039.pro
0e4eb5e9d0a622067fd91c48c978fa34
8507b75f90f6e36834eec20fa139488308ed5204
1914 F20110209_AABXZI selke_s_Page_064.txt
c0d5b14b16673df84ed308fb07d02f40
1a3a32ddc1c746a48ff7e86810ee2b6c27737b71
55983 F20110209_AABXYT selke_s_Page_074.pro
5c82a3d0e59bf9de546c2ae1ab5604c9
75686dd06726a2329e5a1eb4491b1bf7116370c1
18294 F20110209_AABYFC selke_s_Page_078.pro
2124488897f30b90bebcdad5e23f42c4
9da3eda3546261f17399e1250aea9a9a1ef52825
51809 F20110209_AABYEP selke_s_Page_046.pro
f44c2250fa8601fd39bd811edc492099
832b8ae3ce1a36e432660c294553e9602e01938f
89618 F20110209_AABXZJ selke_s_Page_026.jpg
fd2b92ce9da3cfcd2639fc0bf1eafa6b
b523ff3dff77c3cb3df802e7269f0be2538c98cc
57552 F20110209_AABXYU selke_s_Page_113.pro
b701e563718b87ecef0de7203d9ddf0b
d24358f6817180416feb26141610986ef9d7fba5
6218 F20110209_AABYFD selke_s_Page_079.pro
9b0b4aea3a7896046a4e2a92a05bda0d
c332623356a0470866aa6342c0ab9ece98a56457
49439 F20110209_AABYEQ selke_s_Page_048.pro
af8cee40d5f79bfa89bcda59fe52d29b
85abd1f23f14579c9625a808bc5701e4cf9b0883
F20110209_AABXZK selke_s_Page_019.txt
33ced7a5269a0d0f967d9c954c3febd2
467149ad7e298fba957f5ef5f24d054d6bcdbdb0
4530 F20110209_AABXYV selke_s_Page_065thm.jpg
a681bfb0a47ed34d383c72337d4e4dbc
6a70bc114ed92d8be6cb972dc3f166bd576f558d
27102 F20110209_AABYFE selke_s_Page_081.pro
b9bf3b35f998f5cad3d21ecc3c76e6f7
601d35e41d9908c586e472976ca2bac013d998cf
53920 F20110209_AABYER selke_s_Page_049.pro
97613d9831322bd2a57247033865575d
57b442bd09284fa58fa7acb4c57337488a70a1c4
F20110209_AABXZL selke_s_Page_058.tif
69fc3fe93ae773ffebe7d5e95ce8b01b
3b9b85e00427e3ba5ce04355e50d0b966f912731
2128 F20110209_AABXYW selke_s_Page_031.txt
5b6a08252318b68b5d493e915f7630e5
30281726b2d310effc1a720f8b1bd2a6b4b62348
25430 F20110209_AABYFF selke_s_Page_083.pro
d00306a8c13514338f8317142f7c6a67
4e4d45f43662f7300ce3f6c70aef551f264cb6cf
4535 F20110209_AABYES selke_s_Page_056.pro
ec5fede91d7e506cc0e47fddb50edea9
51ebcd4e416552edc546240cf00a71c05f2d2ed0
17211 F20110209_AABXZM selke_s_Page_064.QC.jpg
6d0d23671bef7735121b9f5d4f0f4ca3
b1600e5ed7fc205076faedff4b5ae3218973f0bc
1878 F20110209_AABXYX selke_s_Page_027.txt
901d7e2570f61cf7876209c04e024f42
fb92b45290f45de260885cb314d3c6a3f6951d7b
50315 F20110209_AABYFG selke_s_Page_088.pro
0751d9951952f5b3a11eb7f8ce165a83
9e4ced621d463316731cf86d17f79c97dc8c6ad8
58783 F20110209_AABYET selke_s_Page_058.pro
c7ffc09f8420b800bf269a3482540c54
e5a9eafdb8565532271e1b5a47d8683bf503f4cf
85583 F20110209_AABXZN selke_s_Page_044.jpg
f1a239f96bfd653dd5e15657268508bb
00fb2c4ed86d40a109512a5fcb58071cb13ac87a
16533 F20110209_AABXYY selke_s_Page_082.QC.jpg
99b515771e08e70795e51033e9ad03fa
afff84f764f7f31aa22e37714f172934bd05faee
70505 F20110209_AABYFH selke_s_Page_092.pro
0889ee2ae8a0fc142662a78d3754dcd7
4a2003a6e3f7a04c05ba1033f09e9d932053f416
23058 F20110209_AABYEU selke_s_Page_059.pro
8da9739c8eb18db01da1ccb14d6f020b
7ab62909fc2fe08880d7eb8c4ce1535e9fd9152b
2305 F20110209_AABXZO selke_s_Page_085thm.jpg
f715e82c84e5a960ce1ff334c9c4b791
773ac7f4f9f035a1d84bd116fbdf2dfc5b89e81a
F20110209_AABXYZ selke_s_Page_052.jp2
c2d6620cf6e3e4b7fff209469ba33f2c
641fa0f109563f76561e19af75617e79aab6f212
70318 F20110209_AABYFI selke_s_Page_099.pro
a6b74822fe4c51cdbc13ad0e01064369
70b1656a244c96c86e13b22ea290443d6301bfed
F20110209_AABXZP selke_s_Page_077.jp2
f14a9edac6eadbf15b631a915a3780b8
7212313dff94982eaec8604a78a12831b154995f
74995 F20110209_AABYFJ selke_s_Page_101.pro
b4451dd28058d8db3b92a27f7dd5de8f
b9543031a12f7a4202dde82b4a89fb982bd0c70b
15201 F20110209_AABYEV selke_s_Page_061.pro
f7ebc7e61f5f65965bdec18cefe4f76f
92cf88014f9ab84f60bc1aba5254f1705e371aff
2211 F20110209_AABXZQ selke_s_Page_004.txt
094f8eb3f3adee3be01eaee3fc001380
873f079ec7d3cb2d9418fbc3e53f81326e1c8b62
F20110209_AABYFK selke_s_Page_102.pro
5a30815892b638a55da8dfa213bccd76
136ee8bac92c42cae9038ad1b3b886c2ad38271c
33638 F20110209_AABYEW selke_s_Page_063.pro
26a928705f1ac51f4fcc38fb84d7f193
3468e6e1d840f7b918957469789b3a3d0ca54f1a
479896 F20110209_AABXZR selke_s_Page_083.jp2
50edfb6ed71a0840078999426c1e1be7
d0ed327dac5c69c2e46086a4fd2b7b53218a8054
70380 F20110209_AABYFL selke_s_Page_103.pro
d30a58298859694f50c1537488142ced
b75be1a5f03b5911678da09c2e3862a7849e1788
42584 F20110209_AABYEX selke_s_Page_065.pro
f29aa5fdd8b508dfc124bee608873704
a66ebe53251c41dbca77bada4c988cfdb0578d51
6994 F20110209_AABXZS selke_s_Page_107thm.jpg
7e30a1c97a3bb109a761f2ae3b113b85
fe87f58bae3a910cb187ea1dd4c24d00dbed2c36
81119 F20110209_AABYGA selke_s_Page_013.jpg
fa5bbbe326c1db6cac621340a8ab8b5e
b90b4d3b37cfacacc4519fcdada303e07f4ea029
70473 F20110209_AABYFM selke_s_Page_105.pro
87a5fae4f58ac1cb0be9a3767bbdc808
c3546d9f2ec9dc7e70098ce00a55bff5a5ccbaa1
39423 F20110209_AABYEY selke_s_Page_066.pro
d23a41acc84b67ce61939de156d6a2a5
9a6a1f621d94d9c1f497e9341adaf191a33b2ed4
86700 F20110209_AABYGB selke_s_Page_015.jpg
6922979ede5566bc18e3ec957e2eef31
b472736454d18e5fe59f661bf96170337ae8d852
66940 F20110209_AABYFN selke_s_Page_106.pro
2c5100cd2f4d861d6990ebd0d7b52f19
39a7c33b3e96f933f2d7a8765251258fed20241b
42780 F20110209_AABYEZ selke_s_Page_067.pro
3882cd4fa83fc6bf1de358164f430d2d
b92d7fb8474be360135ce7f2bbe89b42c81b812c
1051956 F20110209_AABXZT selke_s_Page_042.jp2
15a8c6102a29c663a6d48aba2b08c2ac
1b0518bb1c8507ef4d82700af02a05900989c5c3
84330 F20110209_AABYGC selke_s_Page_016.jpg
9deca0239dd80d95c758a69874c65f42
181c0aa2b3e80efc556f20ba13e5bfcd5ea7612d
57570 F20110209_AABYFO selke_s_Page_108.pro
0917cd06140e16b47f4ed08c593abb91
9a6bcbb3b96752ea6325d1a0701c4ece7a3520b0
85837 F20110209_AABXZU selke_s_Page_014.jpg
855c6f39b1a4ff8f4d79dcc1ce1810e1
b0809c3a7e6e5e72192fe275b0546dcb734aed21
90083 F20110209_AABYGD selke_s_Page_018.jpg
fffab0e5cb7d80e37bbea14086e380fd
a2cf283ed951947473dba5ccf442b883316607a1
62722 F20110209_AABYFP selke_s_Page_109.pro
25ccdb25ca65eb0274626dce33dce7a9
5fda2df73b12cf797e7d7f947ef66677a7289b1a
59831 F20110209_AABXZV selke_s_Page_036.jpg
315d0cd42d635800c2306305f6ad83ad
8b5c32a749f44d6592d6fb7733ed59c1c5a7bf05
86786 F20110209_AABYGE selke_s_Page_020.jpg
5d71f3359030ce094de2dd0c811368ff
03e590eca2351864dfac3ad543008e0dcc475242
62627 F20110209_AABYFQ selke_s_Page_110.pro
bc377da921aeb38d8ba8696a948509d2
039e5faf270671f346b008ce647015b6144bd3b7
F20110209_AABXZW selke_s_Page_056.tif
d5873243db9d6ab6871b9f6427f7bf6b
1413c9b6cf3c78925a3e4273f55262ff1b092441
87163 F20110209_AABYGF selke_s_Page_023.jpg
43e140027e10d560a12beb072fb1a915
f35cf377f00f2b1abff56b83d6f5cfbd0642695b
59384 F20110209_AABYFR selke_s_Page_111.pro
c6b5fb3e9bdd11c30b36c5120eeeafca
fb9f47a26f00f347def067b6f2d62da8ae69e389
F20110209_AABXZX selke_s_Page_108.tif
5a974d28f554c76c0fdfa66462666990
a4fef44d2a4a7636057ce55f3ff8f1fb2fcf7a10
76202 F20110209_AABYGG selke_s_Page_027.jpg
b2f199838f75f4e1ef0969b036ce74ee
0e8b9bc71a045a0933a2937484b2bd1d896f9cba
39063 F20110209_AABYFS selke_s_Page_114.pro
70bd0c858c39f4fbcd225aa6343c0196
b55b1719c46337f022236351005c47ac58308e42
7480 F20110209_AABXZY selke_s_Page_022thm.jpg
826da7a9cce8df72659966b90c66d434
7cf37c73db504bcc0b9d90be81f1ef631b935d21
88247 F20110209_AABYGH selke_s_Page_028.jpg
b720b3b8abc2cda415622087afa1512e
63f026013af4f1e492df5bcb911e84af92c7c2c3
25221 F20110209_AABYFT selke_s_Page_001.jpg
28a83823a70eb77ea525cc36492fde59
f504d5839ef93b93a36ee0abb47ba350504b26df
2359 F20110209_AABXZZ selke_s_Page_107.txt
31b7b7d25f1ad8d66d67f6aa63aaa971
9378badef3c7e4f3b4126f58b33e34662aba8a10
84310 F20110209_AABYGI selke_s_Page_029.jpg
50c62946daa12e981fe191da4a3c427d
60ba6547ac4462b27626aca8ac7cf1ee67a20773
10446 F20110209_AABYFU selke_s_Page_002.jpg
5a33a1b8484d0fc5c40622b67b3ade7d
545f7663f9412276b8a77ea4241efa884f4bce4a
88301 F20110209_AABYGJ selke_s_Page_040.jpg
3dadfdcef82991982a1c96f7ae60e9b8
37ba810b67bcb36730628921a5bd0c352bfd2da2
88846 F20110209_AABYFV selke_s_Page_004.jpg
120576f270f409a1b4434b575a956e74
0b48b86915d707f108c5d37cc473f1465bedb079
81042 F20110209_AABYGK selke_s_Page_041.jpg
42030f6008ba91eb12789bf1935902aa
03353f32e3dfd22eca40e13e50680aade3997ab9
79533 F20110209_AABYFW selke_s_Page_006.jpg
2fcfbea1161afd118599f0ae9a2d50a2
9b45c70576226769953da58d319ac29e1fe358fe
81817 F20110209_AABYGL selke_s_Page_043.jpg
1b0c5ac1f3e95a91f8d23da0ee1c9e26
a9cdc36cf3864d3fb1f05b5917bfd9669b40a73f
91331 F20110209_AABYFX selke_s_Page_008.jpg
eb85ff129e6d12fad745f902f9a33e4e
954e6bf1150a78fb7c9355a4507bdf2ee1ca5793
77645 F20110209_AABYGM selke_s_Page_045.jpg
9be1172010eaff70c3e5cef79a01366b
64adccb2a610a1048ff1508d9b6e1d8b5a846e3b
53212 F20110209_AABYFY selke_s_Page_009.jpg
8ad0397a8dcd623fb5f3677740649869
911eed7406d2ea93d966d190bdad24671b3b1b35
42240 F20110209_AABYHA selke_s_Page_081.jpg
6f68f6bf5273fa28741052dd8b0d21c6
e947097956fa887a47297bb74b193eeefac61023
80257 F20110209_AABYGN selke_s_Page_048.jpg
09d18a8a31679bbebda1c66c35d3136f
a8242b4bd22fbc48d9478d6db03eb22f8a247c90
81642 F20110209_AABYFZ selke_s_Page_011.jpg
fa6ad4d6e1fd94090e2e9f6927502bb7
cf5abde18d291dc81b5a3696a1fb2f21fba657a3
43127 F20110209_AABYHB selke_s_Page_083.jpg
243f298375334f86a7dd1ae055c6320f
43da7c529def5e5066aa1774c8e7f83e57354e64
86388 F20110209_AABYGO selke_s_Page_050.jpg
cc211f326812aadefc0357ad31874740
f4e7c4df305486d43eacf21891b22572e306ac67
57145 F20110209_AABYHC selke_s_Page_084.jpg
92ce0a7e7b0358607db9563e6586a5d1
aa74516d0b908e1e926b742101e53d655eef6936
84464 F20110209_AABYGP selke_s_Page_052.jpg
3989c219eb1c7002bc504bde18945edd
16cb7e995ecd664920f2483175851c5f53783877
88904 F20110209_AABYHD selke_s_Page_087.jpg
0766afe6f9c37a9a2804336c56c7953c
0a744d61c9b79628e75c5f2a18a60a7cacc4b4c4
38971 F20110209_AABYGQ selke_s_Page_055.jpg
c7af3773c62bd328e81b5b21c2272ee2
d5628257729172d9822fec74aefffba2e7f55bd1
80195 F20110209_AABYHE selke_s_Page_088.jpg
3d414106bb8efb482e5f3e9bc9eecf55
1c9d111e7093a36db5c8915477df7979f73c6e5e
89869 F20110209_AABYGR selke_s_Page_056.jpg
7b796b529406e89cdc10863dbc8ce7fc
04249d4df39002e73d480f612a3ff56ea773881f
150923 F20110209_AABYHF selke_s_Page_092.jpg
2f5e26f92f90c8c05b4036ec49141544
398bc6a02a6b76e862b6202a823e6a77669f70ea
87465 F20110209_AABYGS selke_s_Page_058.jpg
93ecc7c398f2bb41d65cc1096f3496db
374bcb79fa242d15a014aa54f3910c6980a0bdbd
150147 F20110209_AABYHG selke_s_Page_095.jpg
9800dbb2a77df1fbb266b3934a97f5fc
3fe31fa9b11ae862ba7409360610956a4367b156
51214 F20110209_AABYGT selke_s_Page_060.jpg
63ea60edb596ef63253acc6c40c489af
b8c72f211b8087999533f1f8108a39601e0bc282
151206 F20110209_AABYHH selke_s_Page_096.jpg
ea44b83abe7ef6e40b789377daaa0609
a9e3620f5fef549e99a7395a60bc406f6631a057
53665 F20110209_AABYGU selke_s_Page_063.jpg
70367c375dd42cdc8dfcc28b902877c9
f2d2e07e85c5adfce7c1842343015e6fc57aab1d
149775 F20110209_AABYHI selke_s_Page_097.jpg
5774e311fd071abd554c22ba6b2c27c6
a1f44af753fcd4d420f491bb8f7f4cfd778c652b
65397 F20110209_AABYGV selke_s_Page_067.jpg
22adbfa83a1cfcc418cd6adf11d2af96
6dc31d038aaca8afd2ce2eec75bb4b1aa8247b69
152407 F20110209_AABYHJ selke_s_Page_098.jpg
1753e6ebc9e6de4487bebf54711b0015
df7513cb87375b3bc09b5130338bd2d21519902c
83691 F20110209_AABYGW selke_s_Page_071.jpg
d60fab43dafe216b44b3a684cbdf638a
8ca7113b0cb5f0cd72213d83e5421d4f31e85790
114724 F20110209_AABYHK selke_s_Page_100.jpg
2a705ac8278d52727c5a0a21070ecd68
ef05c7f13159de7e4fa83c8719a64114166244ec
80592 F20110209_AABYGX selke_s_Page_072.jpg
30d1cdb48f290ac58aa34e691e69415f
5c1a378703134611cd704329cefda981df9fabc6
512888 F20110209_AABYIA selke_s_Page_012.jp2
94a9b97db14e77e2be0a3d188b0e7f16
628acd7be2b7ac9c7893d87c48ab1f8b7c88f200
147811 F20110209_AABYHL selke_s_Page_103.jpg
ccccda11d20215e7108e35e5fb4359af
9c31afb61d22b6b6410437715f8a12f77fc2a5ef
83721 F20110209_AABYGY selke_s_Page_073.jpg
901df9d0b535ccd150dbbdacf9eee682
16f13757372164eaf60fc00e906f38d8c4d53d75
148823 F20110209_AABYHM selke_s_Page_105.jpg
2f8f4d7ea0ae8f44667651e0d4e80764
a141f543b4696d86f086e7b0037f3277e88b3fdb
41402 F20110209_AABYGZ selke_s_Page_080.jpg
559e02ec31ba6fda621a2a93163d585b
ec9aeae3bbe4221a542067e68f52c74190a6bfd6
1051915 F20110209_AABYIB selke_s_Page_016.jp2
875f8fbd22f8fd9744cfd9a3c4c35bf3
e97d36afbb88311691ced154837288f1c61669bc
141918 F20110209_AABYHN selke_s_Page_106.jpg
4a1d4497df65ac6f9a90e63ad6dfdaea
a9f267c1339ee5bb12c3f15f2b97a39ce233d694
F20110209_AABYIC selke_s_Page_020.jp2
a0640569fe3b9ba19a9b8d6cc6b84454
ddc4ce326a4f9710985e3f286195ee7521ef71cf
92791 F20110209_AABYHO selke_s_Page_107.jpg
915984246c0e53d25c4a4a1980fe9a86
b1506ae2599a18ab4451e34c951c70a16e8e83b5
1051932 F20110209_AABYID selke_s_Page_022.jp2
df0d7d138ae2c5cc54b6b40b70580198
099c47208936a87efb752195ba404281329fa9f7
94280 F20110209_AABYHP selke_s_Page_109.jpg
49640d5aec045acf35f6925502e08c5a
56a18352e42368f7f1e087d8a226679a39a114c1
1051976 F20110209_AABYIE selke_s_Page_025.jp2
ea310da17d76ab6a38d260613ae417f7
9f455f57d811beb835e6c0880c752334eecd176d
95699 F20110209_AABYHQ selke_s_Page_111.jpg
eaf5aa05ab527adee35aafdbd9e03f1a
f92b258c0a7f61df2db84e88a29d1b3769c9edf2
F20110209_AABYIF selke_s_Page_031.jp2
c88c559c2f52048ee5d9348345d3443a
fbe538b3eb895688739bf71c39aa29320b5fa5ef
105367 F20110209_AABYHR selke_s_Page_112.jpg
a3f3523426ace4d64b917acd05880600
e3a1eced2ae7a87fbbe4b585136dc3f6545b665f
799634 F20110209_AABYIG selke_s_Page_034.jp2
0632d8f2bbaa9c6461cc82aaa120e48d
7e20e769f6aabe87ae20c7d9f008466849fc1392
101629 F20110209_AABYHS selke_s_Page_113.jpg
713ccf7bfa7e35d5f5872eb939379879
32fe000edbb43e98bb7600aed974366d0d2ad209
F20110209_AABYIH selke_s_Page_040.jp2
c124d2838271c6dadb231562c857c81c
a48bd9ba86b888fe268afc95825053cb14880e5f
258577 F20110209_AABYHT selke_s_Page_001.jp2
3e09e46ac25ac547159bba786f6e86b8
71d03eb5de90dab92ea2ab3ef81ec3e63fc587aa
1051894 F20110209_AABYII selke_s_Page_043.jp2
63f9324f1c225d06815e3d4ad891075c
b39ae613552654e49c408614f5ccdadcbfa19f51
31662 F20110209_AABYHU selke_s_Page_002.jp2
07f200be7d5f2727431ee4d6b57429a5
69465865562a79295b4bbc01a2df83177842cb5f
F20110209_AABYIJ selke_s_Page_045.jp2
b5637e1b8f4bea9b5d2486e97a2a5d48
b294fa1f66d6aaf3407ced1c858ca2fe8147e5d7
54220 F20110209_AABYHV selke_s_Page_003.jp2
8c03bbcae9cb9a6fa9abe79ec2850f84
0ef77c4f6f171640536ae304cbcf7c8ae46fa44d
1051914 F20110209_AABYIK selke_s_Page_048.jp2
8962ebce77ff29877600dcd82ed25fd4
1d4300a23e0083b0b590016619b2c787e02e150a
F20110209_AABYHW selke_s_Page_004.jp2
8022bde940aaebc2e15a7bd57f3b1b08
d4e7831ea7d9838c8ec1ed53a93d07215a57c9b8
551272 F20110209_AABYJA selke_s_Page_089.jp2
a499e23d4a6b964fe7cdfcb146e87af1
deea637c2846f556b7f22a842e60824e04a13f03
F20110209_AABYIL selke_s_Page_050.jp2
b75c9da8341df639ef50f9c44bdc03d7
b26294b7d07c41a2b88bb7cacefe9ae22aab3014
F20110209_AABYHX selke_s_Page_006.jp2
c0fc17c7087f96860eb5d960acf44a34
71403e06a8392b321914d0a09aca9a1d9e186bdc
508647 F20110209_AABYJB selke_s_Page_090.jp2
7aa65aa31df4b574f5a845b0cfd66b04
63631d4d497e417a41e193a551930ca9875555b7
F20110209_AABYIM selke_s_Page_051.jp2
411801ddc42f2c94f0d304fecd99c168
8f50dcf316b4da8305414eb9ec87500d061ae6ed
F20110209_AABYHY selke_s_Page_008.jp2
d3b063043cd64e2c25b1c414a9b9fd20
1dd23f13048dad533f610d114fc2ca0e02b87e09
1051962 F20110209_AABYIN selke_s_Page_054.jp2
aad779792cf60c5423f453de7314fead
ff742b5fc35881bbab970c3b1f416f63196d4caf
F20110209_AABYHZ selke_s_Page_010.jp2
9d1af369406c79af15375629db742228
0798139e85b8c03de0d7367ba53bc1a5316c9e4c
F20110209_AABYJC selke_s_Page_091.jp2
6d7814bd75d1172f7c9c1c4fb1a6e2de
0b90456d9fdf2d43458e89714bddded8bcebc653
620344 F20110209_AABYIO selke_s_Page_057.jp2
a010ede7108acf5184891fe947a7dc4b
95a943e856b94180b2061fa5c3e4c83343286974
1051924 F20110209_AABYJD selke_s_Page_092.jp2
3540ef463949ab3226e9a59a1e114345
0060bd2eeb3d9522a578d8c79abf7e99ebc13148
1051900 F20110209_AABYIP selke_s_Page_058.jp2
a2f5906f6b5b20a599e8f4949c402436
73f919304893dbb948a65929f1cfb9a6cd5f94cd
1051949 F20110209_AABYJE selke_s_Page_094.jp2
8f8a183289d667db94b1523f386fb1c6
0face287b0ed9b7b9133f075862c4b233424757a
326991 F20110209_AABYIQ selke_s_Page_061.jp2
89d20d51ec3360193a9e030d2bb7cfa3
dfd8b0587970d3387017df02e343103b834e495f
F20110209_AABYJF selke_s_Page_098.jp2
3939b2e4dd497e939f2eea0b9fae8f05
f1c094f87fe31435e4d6a5970ca392f4e880988f
759079 F20110209_AABYIR selke_s_Page_062.jp2
358a94f5a3b30b4d70af6a243bfd3d17
fd955490fe037c9bcf04a6d473c43e4b3f37f575
F20110209_AABYJG selke_s_Page_101.jp2
d030227824a173eeb8c5975ac8b56d08
5c0fbda2e91952be87735d672ddc9266d9d4db3c
833994 F20110209_AABYIS selke_s_Page_064.jp2
982a0e3c15406754b2eb246ba46583af
efd9131fc4a6b0a896016de382a081eb3e9df334
1051952 F20110209_AABYJH selke_s_Page_103.jp2
25319075be3ef5d7d38e5efcc1369583
5b1d6819d353978425c5c0d90c5740030f35960f
1051971 F20110209_AABYIT selke_s_Page_070.jp2
a2050065b331a18578430b97d217e45c
3d598ab5db221b5bd07777b5019ae6b5b08d2aff
F20110209_AABYJI selke_s_Page_104.jp2
8856a088c5246dd704c6ea4fedc203b3
c6085d92cabcba62500d68da3bc81684ee1e6372
430671 F20110209_AABYIU selke_s_Page_078.jp2
f74d8ebde5323234c4e11a4ad6a8286e
9b6ff52a3d8332f884d39ab4900c821f17d72666
1051736 F20110209_AABYJJ selke_s_Page_105.jp2
fc0796bfc63b4a4d1bd544b479f22404
9ad0df7c4dc31ceaa457c919b828b0c16360eff7
328857 F20110209_AABYIV selke_s_Page_079.jp2
e219f64fb5131eabb61a086267bda148
ff5520b603c242f3c0958cfba4606c6b50433d61
F20110209_AABYJK selke_s_Page_110.jp2
e6a2eafdf55aeec038344be1a93acf02
fb215f08965348863696c923df7646991bea5baa
517197 F20110209_AABYIW selke_s_Page_081.jp2
2cb7cd28e4cfaa0afaf48fca01e0d0a3
55859843f3c8074cf442e8f7560350cf125fafab
F20110209_AABYJL selke_s_Page_113.jp2
88d6f5b4188ea728c7c9a0daf8a8049d
ebfade4a59c848b10adb41c7cd1521c09ca73fd3
F20110209_AABYIX selke_s_Page_086.jp2
1d667ad4439e676a3b4d91ddbc44e153
d5576fac0333dd857859143b5f269deb896f9cee
5995 F20110209_AABYKA selke_s_Page_100thm.jpg
5591bb47c7a7f772b8cbfbf8e51745d6
b1196c7ce337ff45ad350024ff387691d3e1b98a
6984 F20110209_AABYJM selke_s_Page_021thm.jpg
8e178077349c510a06e077baf054b44a
138b6fb284a251beeb369c55bb20b955194f24e5
F20110209_AABYIY selke_s_Page_087.jp2
f4d376e7e5e4b56d828f40c974ddd76e
e111cb066ba52a10a200d649ba6f0a7878b88544
7368 F20110209_AABYKB selke_s_Page_076thm.jpg
ed7de0825462d2dc125d04b3adc71473
c5be8b635b8be76f5aaeab9aa6ea24e53d9fe2be
7347 F20110209_AABYJN selke_s_Page_092thm.jpg
8200ff6e2b426e28420cfa55c29032c8
926f423e9d67afc9a57077ccbfb848610f709ed0
F20110209_AABYIZ selke_s_Page_088.jp2
3e81f43bfa74aa7d09cb7d89be8f8afb
a1675557fb7c83bc7b15db63c1cf653959c06be7
25295 F20110209_AABYKC selke_s_Page_041.QC.jpg
f061979f2794b24591115ce9812af825
0a96cc4006d5593103bfff6f9bc6e9bdde577da0
28316 F20110209_AABYJO selke_s_Page_087.QC.jpg
9670fcdf5eaf25a1d0f9445ff1557838
ab2722b01b3366c9682d13f0104f6215a08f68f4
35657 F20110209_AABYJP selke_s_Page_092.QC.jpg
af37fcc57b77f50db7fd0c813521540f
808407391594db0d7416d1cc9a017a55ced3ed4c
27852 F20110209_AABYKD selke_s_Page_030.QC.jpg
c0c343485c138dcd69074f5aa4dc7d5a
04a5bf8d7a5946253d0cc53e51d0bec076f3d107
25271 F20110209_AABYJQ selke_s_Page_070.QC.jpg
8ebe93fed7bbfd7bb5e8006bf48f2f0e
579a0523b9d70ecce7e0b38df3a30642c1ea94fe
4329 F20110209_AABYKE selke_s_Page_063thm.jpg
a661b7b4ca58ad9f96ba2f5a1b6c7f2b
5fcca41398b574893a616317c50b0f07442a3f9e
2267 F20110209_AABYJR selke_s_Page_053thm.jpg
d1a3803a774dadcf5b02dd8d75755cd8
4ac10338115296857a9be7dff50841515d2791d5
7669 F20110209_AABYKF selke_s_Page_104thm.jpg
bb3976b03d16f840ed74332d2f3df86d
7456c2bf1f6a46b3e16528bdd92f53fc2c464aa9
25195 F20110209_AABYKG selke_s_Page_072.QC.jpg
898e8933e72a6273df7aa21809ecdba4
cd80633d9d7f963601ffbcd23c67f34c9216f80d
7476 F20110209_AABYJS selke_s_Page_074thm.jpg
07543e5d51754781aff4385ec28b3701
3d3e5afbe7e69dc935077c1e4441e3e85f1e618d
1488 F20110209_AABYKH selke_s_Page_003thm.jpg
914e48cd3564e1fe33936bffbdd7ec84
cc31e19ba4064e35907c2b8308537bcbf4e52cd7
14766 F20110209_AABYJT selke_s_Page_009.QC.jpg
58f7c39ba7fda37dcb79d73786683481
78e05409534e4e5c88ab9c59f9021e0f86859b1d
7396 F20110209_AABYKI selke_s_Page_095thm.jpg
27b072398b566b1d619c2853834186aa
7efa90bce9e8d567f950d4017c0d1fc5ed36b2ed
27316 F20110209_AABYJU selke_s_Page_042.QC.jpg
6d1b6acdb0dcad85398ace0bc3fdcf8a
fc3f4a19cf218c8f36de9203cb3db2892e48e35b
7628 F20110209_AABYKJ selke_s_Page_087thm.jpg
52b19cbf51ce19e56bb1cce65f34c3d1
d3edc1da861096bcab785f3a0dc06848bc3ed743
6608 F20110209_AABYJV selke_s_Page_058thm.jpg
b33e4d5166a38a8554ac9da8d591c65d
5c523890f0296ba9842d1724f851401e5ccb8922
7201 F20110209_AABYKK selke_s_Page_014thm.jpg
950a29f80b7e68a954d51a9ebd9af9d6
8bfe0f6204593677feb879ebe1e0bef7c11c524e
7471 F20110209_AABYJW selke_s_Page_050thm.jpg
d4e93db162df23aad8b1d16364f70a95
fbd386d5a815c7cd75b9eea785bfdbfabbfe5feb
27259 F20110209_AABYLA selke_s_Page_022.QC.jpg
258ad4a0d24f1d5732a7595472399f5c
9d0198fdb2c2280ee6da87b77f8b1160ed99f20c
9983 F20110209_AABYKL selke_s_Page_033.QC.jpg
5230959c928843661653f1d463ed93f9
b227ebdcdef6d2bc9372bdf83458be5ecfb2249a
F20110209_AABYJX selke_s_Page_055thm.jpg
bada0d9708dc5887baad566703d8ef99
8b06850a18fe5694bbe98be900f3b65b2ea16cca
27340 F20110209_AABYLB selke_s_Page_023.QC.jpg
88f6872b9efdd421ab421061217be816
edca983a0de63f07ce0a2772a9fd504f2260ec6e
26904 F20110209_AABYKM selke_s_Page_052.QC.jpg
e0add835da81c6824b40fe0d49bc58d6
5c8815e781d3e5ad63f5a8955aa4301b8319167a
7268 F20110209_AABYJY selke_s_Page_043thm.jpg
977ce2003059fcaffbeb85d213ae17de
df7aba421680a879618d40eb2e5efe5100674576
135485 F20110209_AABXIA selke_s_Page_091.jpg
6da5c9e32154cf0d17ae73d0b68d11de
eb27bb4f4e16f59fb28713cd72b0a81dc21df964
26540 F20110209_AABYLC selke_s_Page_024.QC.jpg
5b218d6ce2c78237a8069726e34734cd
a03fa2ff87bcb92db9dc07c9f063d7b2002d646f
7163 F20110209_AABYKN selke_s_Page_113thm.jpg
582e0bd2722ec277ae5e882c75c9515a
9c5b3f7df9ea4c6cbebaffcc4ddedc6ca10f1504
16701 F20110209_AABYJZ selke_s_Page_038.QC.jpg
6d4c13e6bfb96361536d723dd9518ae2
387ccc3a59f2c8ec7d4190d81773ac1aeef377e7
81570 F20110209_AABXIB selke_s_Page_021.jpg
24fcafd4a0a3b575a3684662ee780ea2
b549a9bd46ff8eaeb0d35770cb2ebb19b35a697c
27383 F20110209_AABYLD selke_s_Page_044.QC.jpg
389f7c31b487ec9045c093d104a71f92
5d8ea025e6758a0636a5e292c0761e94ca99934f
4886 F20110209_AABYKO selke_s_Page_064thm.jpg
0580c6d02183589b39cf525c59892d9e
575747db8ed15c43e26f1c9d43ebdb144073cdeb
27823 F20110209_AABYKP selke_s_Page_018.QC.jpg
3413d2694458af1554c8ab3740bcac41
6c9a8f6c0596184154a83194cab3c2313edca809
1054 F20110209_AABXIC selke_s_Page_089.txt
537f431c67124a421bccf5113cf310c1
79121c4ca93d97286b1fc5bbad997f0e70a5cd06
6592 F20110209_AABYLE selke_s_Page_053.QC.jpg
4fb7be5a1101583733fdb0513d597131
3bd7668efff156e6b02115cf92323408f8a3f154
14407 F20110209_AABYKQ selke_s_Page_060.QC.jpg
85e325888f44d2516f26057801a84228
ef0ea59cdfe4b0150e42a51e6e3f3ea86ee0cd05
7126 F20110209_AABXID selke_s_Page_086thm.jpg
184a3b5476f24d89c8d8463307e44421
81e55e762e3a422e8dc599dac9bf0274804502c5
16191 F20110209_AABYLF selke_s_Page_054.QC.jpg
ebdf2fde0c9877fb7485337f9c11e26d
ee9bfe302bad0633b176febe806feb3b9514710a
4868 F20110209_AABXHP selke_s_Page_054thm.jpg
92bbedc61d3f94344cfc6d60d4042e1e
890ecfe6a9f5783c6e572a9965664e895ea60fe7
15539 F20110209_AABYKR selke_s_Page_084.QC.jpg
0340bb4c8470e002be952216e8799188
f2cc7d68ba271322d432a6bfcfb7e9cff68370d0
26318 F20110209_AABXIE selke_s_Page_046.QC.jpg
939d5f17e3c38988035585d58eca0886
39e6c2d5ea2695e37c2d9155144b014c6d4cd7ef
12984 F20110209_AABYLG selke_s_Page_055.QC.jpg
26f5bcc5c0ecd17dcf15af46443ac931
32f99e9d91d4482ed6f3eff68447b3ab52905109
28715 F20110209_AABXHQ selke_s_Page_028.QC.jpg
46061bd51e19ce1f49fd978eac20253c
c15b549dacee2dea2135b049893bb2dbc54c359c
12946 F20110209_AABYKS selke_s_Page_089.QC.jpg
f3bf37306d67814c1b1f00126477ad46
1fc1996cccc7390cbf0791451571a4f6bd4c1f56
52787 F20110209_AABXIF selke_s_Page_068.pro
03762765d4f09866e7eac520b4161c28
95e55e62cc8e47f974443d47cbef858733f0a442
24492 F20110209_AABYLH selke_s_Page_058.QC.jpg
60a73e8b58b61b4f4b174f5c3ced07ac
fef1f234ee61e93bfb51477c0a928797e500c006
F20110209_AABXHR selke_s_Page_068.tif
db64ce011235be1018d867e3214a9d9d
bda5d0a9e67e50a3577600facd2936ba58cf8b10
6902 F20110209_AABYKT selke_s_Page_027thm.jpg
acfbf8e858b322b7530326cc6fa58c88
6901f89be78cf6f966ea57c631aae1a7b0174a91
7436 F20110209_AABXIG selke_s_Page_030thm.jpg
2edfa740edd61949eaec4bedee92a4b6
b82850a52f8d5295aa6585060ec0ed208182aefc
9706 F20110209_AABYLI selke_s_Page_061.QC.jpg
394375fe39265317e6e7d589a36055a1
3aef07a15e0f38b356e8d57be3d10ef8a7934089
2036 F20110209_AABXHS selke_s_Page_067.txt
9d958054783013769254ad7d8381876a
80314a3e0ab931a8115fcf0dc3ed68a0ef31475d
3564 F20110209_AABYKU selke_s_Page_003.QC.jpg
e3a6ea3bd6d8bed52dbd4807c9cc4158
cac8a2afd84fd2bb698e75ab5ff500c1cc4b8e5b
90071 F20110209_AABXIH selke_s_Page_017.jpg
0cdf7aa6d1781bff9ad6ef05742ba827
4c57f497d6c420b21a9c7a4e4bc3783d7c180388
26367 F20110209_AABYLJ selke_s_Page_071.QC.jpg
6177564b31edd2b2222fe166a4a769dd
2d36527e0e30d5c1a09dd0b745b0b5170eb39cef
12511 F20110209_AABXHT selke_s_Page_012.QC.jpg
9ff586630c89e162b1cf02ebc0e1d9c6
ab44e783e0bc80d56f59c8e3b057de72188f61aa
183837 F20110209_AABYKV UFE0021763_00001.xml
c53e7d87eb6946f0ee66298429a67588
c9faea1c1321a3ac938c7e892575f9203b535857
25922 F20110209_AABXII selke_s_Page_021.QC.jpg
57c7974f5d5a95e6c7570bde9183e848
40482ae58ade0be63be7edad615fa109add19b1e
27833 F20110209_AABYLK selke_s_Page_074.QC.jpg
0cbeb9d5489487231ad1a14405176a5d
0c583bcebc2f360731c186aba841c996c06ce219
1051934 F20110209_AABXHU selke_s_Page_095.jp2
d23efb9159df071ef52ef8108e66465c
73ed98fcd06101e15aec72d2b4694517a9065ac4
22036 F20110209_AABYKW selke_s_Page_006.QC.jpg
2cef61844664cbfb9cd9443f0d190cf7
88753553e5c4a948fbb2f966839f772f0603250b
4033 F20110209_AABYMA selke_s_Page_060thm.jpg
15f503dbc12eb4aa89063a0d94b0df94
43fc0b3413eba4ae1bb1bc175d6ef8396756adaf
26531 F20110209_AABXIJ selke_s_Page_086.QC.jpg
6ad95f1938ef6ce54696be31a26c2d3c
0c1778b463426e40e40bd404cc057cbff712fcc9
31607 F20110209_AABYLL selke_s_Page_091.QC.jpg
c6566bd8562cfdcb7a27a5b6c1f3a9b9
d13232f1682e6d12d399257bf107072364bc709e
F20110209_AABXHV selke_s_Page_109.jp2
c996b208d719e57f7814cd8800e6f924
06f7f9f0dc1189f5c04363fad0fc0ab392868deb
25066 F20110209_AABYKX selke_s_Page_011.QC.jpg
fbc3734b3b37e24ca459268c795b6e45
ca11c554f7c4cd74b6a410024e9b26b2245d19b1
7275 F20110209_AABYMB selke_s_Page_068thm.jpg
35fba4fef4f7f8c579d8f9d7c93985c4
526446e553b1b06a24161bb3ac7947f26547c9f4
204 F20110209_AABXIK selke_s_Page_057.txt
9207dbde44782e826fb40e97ed06a5af
d76c1f79c6ba856c905b759e3c3f7654fe742fd3
35202 F20110209_AABYLM selke_s_Page_098.QC.jpg
f1943f93d3bf7f86ec259c7c369f9010
b8ca6e679cede3d4e243a86e8f46edddc629e9e6
55505 F20110209_AABXHW selke_s_Page_051.pro
e234f8b92ef61514ee8e4f268b761d07
1ced94081edbd87cd50c43e006fedde71cbf3d5c
26647 F20110209_AABYKY selke_s_Page_014.QC.jpg
26b07611d50c37cd99c44db194b494f5
3c3029651655177a467206309c22b8a897224e82
7228 F20110209_AABYMC selke_s_Page_069thm.jpg
ae149fd49644f450804ce98e7ed0918a
1c55dd5a1a04a04e9f833d6b680f1575e14acb20
12644 F20110209_AABXIL selke_s_Page_083.QC.jpg
a79c2f3ae35f1b7175af035760db442e
e31cd17140b9cd7d8e327a70b90c57d9dfd14a33
35963 F20110209_AABYLN selke_s_Page_104.QC.jpg
5563d550f1894ea777b5c36d0c34076a
a52df6413bae2c9494c024d70e2c435188eb3ba1
F20110209_AABXHX selke_s_Page_024.txt
6bdee6dfb945bf07b919d06b0916890d
55f2597411590a6ee99072e21346ce9f21af6864
27000 F20110209_AABYKZ selke_s_Page_019.QC.jpg
b7e3297b3d1741ccd88b123a3384ab0c
f7d7b623ea69f981fa8ae1986a92167495faf2aa
1779 F20110209_AABXJA selke_s_Page_038.txt
330b97ad58ab078ec7bc792e1472b1b6
f986a7bda0a9d241f54d4ca20421bf50e20accff
6969 F20110209_AABYMD selke_s_Page_070thm.jpg
a34079e6eaa9ac767f1c9241f3144388
df236cdfcfd102540fab802550f934451e6c0cfe
37901 F20110209_AABXIM selke_s_Page_036.pro
a21d582263fd4a6f5ca236e92c170ac5
294cbaba90159acc141b013d34ab50e375fca5f5
26346 F20110209_AABYLO selke_s_Page_108.QC.jpg
23cc09b699d6481508c81be873b66c1f
ea7244257009cb38f91d57701df6fce302265464
F20110209_AABXHY selke_s_Page_034.tif
4dae658f20a62d6a2812b86777c90daa
c9e2122a67c99073b1e01bb781e6f64c57e08bb4
31960 F20110209_AABXJB selke_s_Page_033.jpg
b90800d516a2d9d2f40300e03b5a770d
2b018e5b33399b525090407755e7c0a8bad57a72
2892 F20110209_AABYME selke_s_Page_079thm.jpg
71ee7be7be8ebefafe27bbbb8871144b
3bdf7e29791f9b4969553cb2a257f0a34ac8ebb1
34290 F20110209_AABXIN selke_s_Page_078.jpg
cc83cfd82d5f2eaffa736d477c614354
8ba8b09a68b158fb31b0948ff18e747e60a1d6f3
1368 F20110209_AABYLP selke_s_Page_002thm.jpg
4e7a586923194d4ef3fa945b45c3500b
72f2d7b4344d2a6bb9f23e68fcb88d4a5a238c7f
7461 F20110209_AABXHZ selke_s_Page_025thm.jpg
d904684cd23cf3cf64196b7f49bc1d84
3a7bf98b0645e623be58c57142cc849e4547ff98
F20110209_AABXJC selke_s_Page_028.tif
cccb72eaed0e5a53d5f39aafbf93cce6
e23222a34349e12e442f5947c96d9385717a9b98
27994 F20110209_AABXIO selke_s_Page_109.QC.jpg
021b31dc13c3d2afa1f29f0289ce623a
b6708e30df72e79741f19d802318541bd7ee700b
1585 F20110209_AABYLQ selke_s_Page_005thm.jpg
9e8cb63f559b3da00f61eadf2f791f0f
60d4f551356ba2a6bf28e2bfa89e307b53a77659
4609 F20110209_AABYMF selke_s_Page_082thm.jpg
0966dccac9166251c300bafdc97a865f
33e528f50781060f3ab58938cd26e1dbfda24cc7
F20110209_AABXIP selke_s_Page_085.tif
7aeaa12fa53831d6b80ac805dfd0f197
4adfe139c1497b4c02244fa9e69ee853b51d077f
5523 F20110209_AABYLR selke_s_Page_006thm.jpg
6d236bb2fb8db378edaccf133d6498ab
b75459dfee0403a77488fbec22a5e50c4d47504f
1051919 F20110209_AABXJD selke_s_Page_096.jp2
ec0e53ac1fde7b7e085c52d75afc2a97
b014bb6aed0d4301e021a5b34aa623417a323bbe
3779 F20110209_AABYMG selke_s_Page_084thm.jpg
e8bdd5a0d5f35633e7c930550894fe7f
2f50c4c9767461d49fbf75fa4f3d2763779741bc
17566 F20110209_AABXIQ selke_s_Page_065.QC.jpg
27efea3e5b60a8a53e2b83112d23cae5
567f2016c2370c19a5f499583a69bd8455863528
3993 F20110209_AABYLS selke_s_Page_009thm.jpg
8f682c479b0af19a500d1fbfcd0fb8fa
99abd5bf45f7acf14ab39efcbb1ee5e999e2ecea
348 F20110209_AABXJE selke_s_Page_053.txt
8eb44426d0adb9f6a482d5e2fdf91ecf
8b84c3bec775d16710b6f6bfdf267236209d0967
7377 F20110209_AABYMH selke_s_Page_094thm.jpg
1de96e86322e02417f731f4c52429e52
e5228dcda563d6eef51d40c88bb29e251377011f
1866 F20110209_AABXIR selke_s_Page_032.txt
66a553410d7b3e27f83102361eefca51
6a579a1c9c7b3a7c463279a058d9e736565dfa05
3802 F20110209_AABYLT selke_s_Page_010thm.jpg
3f2638ba087585b72148e8bb79a7a83e
66e3846db0122fd75f72996ac8c5584f678cbc36
1051953 F20110209_AABXJF selke_s_Page_029.jp2
3c4561d3d11fc4debdd1d686bcfb0e96
64712de3d685cb606eca998507e879bcbfbbce13
7497 F20110209_AABYMI selke_s_Page_098thm.jpg
3c0a2edd30282cddade38cddc88a56cb
ff6d7944ec4404e3c303b182a163aadb644e9dd4
2027 F20110209_AABXIS selke_s_Page_062.txt
71e91f1bb1a7d7b0e2dc95876ef489d6
5ec8d7868745c21526b75f3637f2e02a12664494
7259 F20110209_AABYLU selke_s_Page_031thm.jpg
e38d8d74e578da7a22f66bc1779aae0d
a537204eaecb3f715f0501007b05f6ad560601a6
27431 F20110209_AABXJG selke_s_Page_068.QC.jpg
5d15447a483407e277e2e4b7d6622fc7
d43298f83b57c82ee465c64514bf7eb131f6e2bf
7641 F20110209_AABYMJ selke_s_Page_102thm.jpg
a8063ae224d6860bfe1771c7e773d8c8
b4e042e7c99543e7c3d0fe6dc46d8f566dd9b5b1
4382 F20110209_AABYLV selke_s_Page_038thm.jpg
dc78fadc039219072446f8f2826cdc39
4315e02a49b32117108eaa46857fbe5c5818ec03
F20110209_AABXIT selke_s_Page_051.tif
bae02552d8184aac5ab6aef3a1b84bf0
8f49fd05750460df0812097ba14b8a2b6781e5f7
24930 F20110209_AABXJH selke_s_Page_084.pro
e032dcb82c3ad515137341847bb3141e
bd08223ce5e09dd9ee1cc0d6f92820441f905fcf
7265 F20110209_AABYMK selke_s_Page_106thm.jpg
7a4b0b508490411af6994c1a1bd5b05d
64a9576e628ed98f85635118360e35065015520d
7405 F20110209_AABYLW selke_s_Page_040thm.jpg
40ce932d51dbe379f886a2efe6a964e8
d9634d5e5b4fc24f210e9e8d7709b935073b58be
87616 F20110209_AABXIU selke_s_Page_030.jpg
7c7be9e5c3b025a1bbc9b2c4fbbcb7e8
7fd8a5562647c4a9aeea11945ab8a7cd1cce8254
24923 F20110209_AABXJI selke_s_Page_056.QC.jpg
49e0cef24916d7bffc41b74b00eadd74
2d255e0e29fdf2dd08e0041f1f96e6d6f23aeac8
7541 F20110209_AABYML selke_s_Page_108thm.jpg
cc054b8fe434cfc1cd203446c1871b8b
994fe43a0868891b7124f6d68301d55603b40e8b
6997 F20110209_AABYLX selke_s_Page_049thm.jpg
5a2d15fb20ff2990428764c2ab684e84
7edb7133a3424fd387865b7fb7cc58a5b73bb2c0
57572 F20110209_AABXIV selke_s_Page_037.jpg
6d87eec7a630e39519bdf05877cb9264
07124144b407058e554255f65d911078145466ee
F20110209_AABXJJ selke_s_Page_071.jp2
177768c95ee031d445ec22ddbb05a93a
67ce0da08581f5e7956828174c54064696f9ae4c
7292 F20110209_AABYLY selke_s_Page_051thm.jpg
1b1a466ed3dc1bf60ba81b3a9e742cb9
db4eef5d98276265233f4aaf77a4955a0b6ae618
2004 F20110209_AABXIW selke_s_Page_048.txt
a5512ced3943703996e4cb483f41f8fe
4fb2effafc823aad9cb6b61349de670a515ee67f
40536 F20110209_AABXJK selke_s_Page_012.jpg
7210285718fcdd50a834398f07307097
5e96a810bf905034d53cdf569ee6963a715192cf
6471 F20110209_AABYLZ selke_s_Page_056thm.jpg
f835e5f34de3283c5ab002dfa423b0f1
d9f725286ece00e336dd8e45bf74ab4408edbb91
10650 F20110209_AABXIX selke_s_Page_078.QC.jpg
201a8a3d03f593846c0533b45a04ee71
fb2c28ecf7804dc8a1ed75aad6f6993250acc603
792097 F20110209_AABXKA selke_s_Page_038.jp2
ecb3be97d2b86e7f569e13036aa5bd72
9e2de59ae41b428e194a379632a42f0c63b4fec1
23229 F20110209_AABXJL selke_s_Page_085.jpg
8dfd519830ece3edb8248f4056a972b9
742730ac594794c371a2afbe52556e6ea509dfbc
2177 F20110209_AABXIY selke_s_Page_050.txt
b475630276942c24d1c03d5097ebd29f
c83fa42ffa139765e342931ca903f3f58813e7b0
7622 F20110209_AABXKB selke_s_Page_018thm.jpg
10833f50e5240d15af0f200fe0795933
e9b31705ce87a5b1aa71001b2804437c7cd60e5a
16985 F20110209_AABXJM selke_s_Page_035.QC.jpg
56d80bad75e37092e5109db5f5c486bd
107318928b80a1ad302686427aa6e2883cfa3b52
12600 F20110209_AABXIZ selke_s_Page_010.QC.jpg
cda090932fcded41e0bd22c31568c81c
65ee6cee1ea066bff45edaf8ba1229634e9d611e
7388 F20110209_AABXKC selke_s_Page_073thm.jpg
ef34b14444015da26af402b1c71df075
17a157b5ffd070a5611bd646df0985cae8d2d827
2047 F20110209_AABXJN selke_s_Page_046.txt
68e1ba613c1861dbd8181b1003606376
d4b0110a57532e68d5e29bbca6dace6672095a7d
741341 F20110209_AABXKD selke_s_Page_037.jp2
9543fa06ff3e8b35df384e5126264bb9
bc0eda02c175e0e110ed817489a62463c050b42e
F20110209_AABXJO selke_s_Page_060.tif
d725613b02c03407b3f60b7b38749b83
db02c4af1f878659c29275f446188641b41dba4e
F20110209_AABXJP selke_s_Page_097.txt
867cfb227080d9482f35fd545f19a871
289c4bf99539d3d23cbaa06709134e579fb0d868
F20110209_AABXKE selke_s_Page_107.jp2
ad3ca615bdec5a8e4f70af0c8fcbae92
c4f89041be3db07bbdaf2fb449e6e51623751443
F20110209_AABXJQ selke_s_Page_073.tif
c9253ab732081272a821be89fb47ca6c
4d3167b9e977648731918d45a094773f28354bea
66502 F20110209_AABXKF selke_s_Page_114.jpg
c5c16186e70e521afb49303cab353339
12ca2f5c959c03962b85ce25b7a9db5aedaeb367
3932 F20110209_AABXJR selke_s_Page_057thm.jpg
fad20c4d45bd5cfc9f1d5360159f8fdc
564b1332db2ffd03656e90b2aa92c2c67ab5d839
F20110209_AABXKG selke_s_Page_015thm.jpg
a75e44b711b9359d16c846a916986368
35368920f416950a8a43e2087c03d37af3ad36cb
65393 F20110209_AABXJS selke_s_Page_112.pro
8c59707251b64ae97eb3cd67b31819b5
ae4f7ce3c0e28a015984e0000d33fec50bfe0334
1601 F20110209_AABXKH selke_s_Page_114.txt
915b39cb352825ad5585bc6fb89d0f1a
1f0ee7493e1c4f342bc1b08c7d279d3481b5f666
1051802 F20110209_AABXJT selke_s_Page_056.jp2
0d20050a20ccbf442d84e9c278d8e96b
2c598713dc937b800d099941a5b0f094dd69afe5
1722 F20110209_AABXKI selke_s_Page_036.txt
cd6f8227886c2557a92f26bb74f6c52a
578be792c3265b74cbeadc6696b6b4a5501f0653
F20110209_AABXJU selke_s_Page_075thm.jpg
1c8b4d40744439fbf24b1990b36549d5
87b3ece1e2c4742b6fae94289f9f0ad912d8e571
4332 F20110209_AABXKJ selke_s_Page_036thm.jpg
45120543d65ced4ec695127ba0923d19
5b09f7234705121e5cf2825d6db2ffcd09d655a7
70278 F20110209_AABXJV selke_s_Page_098.pro
8fdc3f879d38a1e3683b043a0ac43507
db55c92fce02791d1b8b3f5ee0ebd07b81206820
F20110209_AABXKK selke_s_Page_015.tif
c36c9be5b5a47e7c941ea3d69bcc7c84
45d4e09e63b4b90cbed5d7b99de63a1ffffff45b
1752 F20110209_AABXJW selke_s_Page_035.txt
d633f0abb0e262b1f650ff94c6b124d2
4eaa70e3e96445f247e1bad026f5ddd785a899e3







DISTRIBUTION AND OCCURRENCE OF Stachybotrys chartarum IN NORTH CENTRAL
FLORIDA HABITATS




















By

SARAH BRINTON CLARK SELKE


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA

2007

































2007 Sarah Brinton Clark Selke

































To my parents, Newton and Patricia Clark, and my husband, Gregg Selke









ACKNOWLEDGMENTS

My most sincere thanks go to my committee chair, Dr. Jim Kimbrough, for his invaluable

guidance, advice and patience during these four years. It took me a while to find his lab, but it

was clear once I did that I had found my scientific home, and it has been my great privilege to be

his student. I am also very thankful for the support I have received from all of the members of

my supervisory committee. Dr. Gerald Benny has been an enormous help on nearly every aspect

of this project, Dr. Robert McSorley tirelessly answered countless statistical questions, Dr. Jeff

Jones supported my efforts to become a broadly-trained biologist, and Dr. Bill Zettler provided

me with numerous and valuable teaching experiences. I am so appreciative that my entire

committee has understood and supported my interest in teaching while at the same time

contributing to my development as a researcher. In addition I thank Drs. Bob McGovern and

Raghavan "Charu" Charudattan for their guidance during my first two years in Gainesville and

Dr. Gail Wisler who provided a teaching assistantship for me.

I am very grateful for all the friends that I made while in Gainesville and whose presence

in my life has been critical for my success. Dr. Alana Den Breeyen, Heidi Hanspetersen, Linley

Smith, and Tara Tarnowski have made my professional and personal lives richer. In particular, I

thank Linley and Tara for invaluable advice on phylogenetics, Alana and Dr. Abby Guerra for

daily tea, and the Jeff and Heidi Hanspetersen Guest House for their company and support while

writing this dissertation. I also thank Ms. Gail Harris, Ms. Donna Perry, Ms. Lauretta Rahmes,

Ms. Jan Sapp, Ms. Sherri Mizell and Ms. Dana Lecuyer for hugs, candy and endless behind-the-

scenes help. Mr. Cecil Shine and Mr. John Thomas were an enormous help with many aspects of

my field research, for which I am very grateful.

My family's love, unconditional support and encouragement demand special mention. I

thank my parents, Newt and Pat Clark, and my sister, Abby Luchies, for always believing that I










could complete this journey. I especially thank my husband, Dr. Gregg Selke, for leading the

way.









TABLE OF CONTENTS

page

A C K N O W L E D G M E N T S ..............................................................................................................4

L IST O F T A B L E S .............. ..... ................ ........................................................... . 8

LIST OF FIGURES .................................. .. .... ..... ................. 10

A B S T R A C T ........................................... ................................................................. 1 1

CHAPTER

1 INTRODUCTION ............... ................. ........... .............................. 13

Taxonomic History of Stachybotrys chartarum and Related Species...............................13
M orphology of Stachybotrys chartarum .......................................................... ......... .......17
Stachybotrys chartarum, Mycotoxin Production and Human Health ..................................18

2 COMPARISON OF SEMI-SELECTIVE MEDIA FOR DETECTION OF Stachybotrys
chartarum FROM AIR SAM PLES ............................................... ............................. 22

Introduction ................. .................................... ............................22
M materials and M methods ...................................... .. .......... ....... ...... 24
Indoor Sampling ............... ......... ................. 24
O outdoor Sam pling ................. .................................... .. ........ .. .............26
R results ......... ... ............................ .........................27
In d o o r S tu dy ................................................................2 7
O u td o o r S tu d y ........................................................................................................... 2 8
D iscu ssion ......... ....... .. ............. .. ...................................................... 2 9

3 FREQUENCY AND ABUNDANCE OF Stachybotrys chartarum AND OTHER
COMMON FUNGAL GENERA IN OUTDOOR HABITATS IN NORTH CENTRAL
F L O R ID A ............. .. ......... .................................................................................................. 4 0

Intro du action ......... ............................................................................... 4 0
M materials an d M eth o d s ..................................................................................................... 4 1
S tu d y S ite s ........................................................... ..................................4 1
Description of Traps ............ ...... ......... ................. 43
Sam pling .......................................................................... .........................43
D ata A n a ly sis ............................................................................................................. 4 4
Results ............. ........ ......... ............................ 45
Stachybotrys chartarum............................. 45
Other Stachybotrys species................................................. 47
O th er G en era .............................................................................4 8
D discussion ......... ....... .... ............................. ......................... 48









4 IDENTIFICATION OF PUTATIVE Stachybotrys chartarum ISOLATES FROM
NORTH-CENTRAL FLORIDA HABITATS.................................... ........................ 68

Introduction ................. .................................... ............................68
M materials and M methods ...................................... .. .......... ....... ...... 71
Preparation of Fungal Isolates ............. .............. ........ ................................ 71
DNA Extraction, PCR Amplification, and Sequencing ...............................................71
Phylogenetic A analysis .................................... ..... .......... ...... ........ .. 73
R e su lts ................... ...................7...................3..........
D iscu ssio n ................... ...................7...................5..........

5 D IS C U S S IO N ........................................................................................................8 6

APPENDIX

A lOCATION OF SITES AND SAMPLING DATES FOR FIELD STUDY ...........................89

B ALIGNMENTS OF TRI5 AND CHS] NUCLEOTIDE SEQUENCES ................................. 91

L IST O F R E F E R E N C E S ....................................................................................................... 107

BIOGRAPHICAL SKETCH ................................................................... ........... 114









LIST OF TABLES


Table page

2-1 Total number of fungal and bacterial colonies recovered on different media from
master bedroom, for two different samplings. ......................................... ...............34

2-2 Total fungal and bacterial colonies recovered on different media from living room,
for tw o different sam plings ......... ................. ......................................... ............... 35

2-3 Total Stachybotrys chartarum colonies recovered on different media from master
bedroom for two different sam plings.................................................. .. ..................... 36

2-4 Total Stachybotrys chartarum colonies recovered on different media from living
room for tw o different sam plings. ............................................ ............................ 37

2-5 Stachybotrys chartarum colonies as percent of total colonies recovered on different
media from master bedroom, for two different samplings. .............................................38

2-6 Stachybotrys chartarum colonies as percent of total colonies recovered on different
media from living room, for two different samplings............................................ 39

3-1 Frequency of recovery of Stachybotrys chartarum at four sites, 2005...........................58

3-2 Frequency of recovery of Stachybotrys chartarum at four sites, 2006 ...........................58

3-3 Abundance of Stachybotrys chartarum at four sites, 2005.....................................58

3-4 Abundance of Stachybotrys chartarum at four sites, 2006 ........................ ............58

3-5 Colony size determined as average number of sampled drywall cells with
Stachybotrys chartarum growth.................. ........................................... ............... 59

3-6 W weather data June 2005 to M ay 2007........................................ ............................ 60

3-7 Frequency of recovery of Stachybotrys chlorohalonata, June 2005 to May 2007, at
fou r sites.......... ............................... ................................................6 1

3-8 Frequency of recovery of Stachybotrys bisbyi, June 2005 to May 2007, at four sites. .....62

3-9 Abundance of Stachybotrys bisbyi, June 2005 to May 2007, at four sites ......................62

3-10 Frequency of recovery of Stachybotrys kampalensis, June 2005 to May 2007, at four
site s ......................................................... .................................... 6 3

3-11 Abundance of Stachybotrys kampalensis, June 2005 to May 2007, at four sites ............63

3-12 Abundance of Cladosporium spp., June 2005 to May 2007, at four sites ........................64









3-13 Abundance ofAlternaria spp., June 2005 to May 2007, at four sites ..............................65

3-14 Abundance ofEpicoccum spp., June 2005 to May 2007, at four sites. ..........................66

3-15 Abundance ofBipolaris, Drechslera, Curvularia spp.complex, June 2005 to May
2007, at four sites ............................................. ............................ 67

4-1 Isolate number, species, origin and collection date of 44 Stachybotrys isolates from
outdoor habitats in north central Florida ....................................................... ............... 82

4-2 Comparison of pigmentation and tri5 and chs] sequence data for Stachybotrys
chartarum and S. chlorohalonata isolates from outdoor habitats in north central
F lorid a .......................................................... .................................. 83

4-3 Genbank accession numbers for chs] and tri5 nucleotide sequences for Stachybotrys
chartarum ................. ..................................... ...........................84

4-4 Genbank accession numbers for chs] and tri5 nucleotide sequences for Stachybotrys
chlorohalonata ...................................... .............................85

A -i G P S location of study sites ....................................................................... ................... 89

A -2 Sum m ary of sam pling dates...................................................................... ...................90









LIST OF FIGURES


Figure page

2-1 Private residence in Gainesville, FL with Stachybotrys chartarum infestation.................33

3-1 Study sites in G ainesville, Florida ............................................................................... 54

3-2 T rap design .......................................................... ................. 55

3-3 Trap place ent in the field. ...... ........................... ........................................... 56

3-4 Sam pling technique................................ .. ...... ...... .. ............57

4-1 Extracellular pigmentation on Czapek yeast autolysate agar (CYA). ............................79

4-2 Neighbor-joining tree for chs 1 gene for Stachybotrys chartarum and S.
chlorohalonata outdoor isolates. ............................................. .............................. 80

4-3 Neighbor-joining tree for tri 5 gene for Stachybotrys chartarum and S.
chlorohalonata outdoor isolates. ............................................. .............................. 81

B- Alignment of tri5 nucleotide sequence. ........................................ ......................... 91

B-2 Alignment of chs nucleotide sequence. .................. ........ ...................101









Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

DISTRIBUTION AND OCCURRENCE OF Stachybotrys chartarum IN NORTH CENTRAL
FLORIDA HABITATS

By

Sarah Brinton Clark Selke

December 2007

Chair: James W. Kimbrough
Major: Plant Pathology

Stachybotrys chartarum is a mycotoxin-producing, cosmopolitan fungus that occurs on a

variety of natural substrates as well as cellulose-based building materials such as drywall and

ceiling tiles. This black mold has aroused public interest because it has been implicated in cases

of sick building syndrome and pulmonary hemorrhage. Because it is likely that outdoor

populations serve as the source of inoculum for mold colonies in water-damaged structures, it is

critical to understand the types of environments that support natural populations of S. chartarum.

The primary objective of this research was to identify outdoor habitats in north central Florida

where S. chartarum is found and the times of year it is most abundant. Several semi-selective

media were identified for this purpose; however, detection of S. chartarum from outdoor air was

a rare event, suggesting that air sampling would not be appropriate for investigating the

occurrence of S. chartarum in outdoor habitats. Instead, traps with pieces of wetted drywall

were placed in four habitats in Gainesville, Florida: a pine grove, a citrus grove, a lakeside and a

hardwood forest. Over the course of 24 months, S. chartarum was found growing at all four

habitats but only rarely, occurring on only 0.02% of the pieces collected. Because the frequency

of S. chartarum was so low, most differences in abundance between sites were not significant.

Stachybotrys chartarum was recovered most frequently from the citrus grove, and at all sites, it









was found only during the summer months. There was a correlation between S. chartarum

occurrence and temperature but not with rainfall. The morphological species S. chartarum

contains two chemotypes, S. chartarum chemotype S and S. chartarum chemotype A, which

produce different mycotoxins. The Florida field isolates were compared phylogenetically using

the trichodiene synthase 5 and chitin synthase 1 gene fragments. Seventy percent of the outdoor

isolates were identified as S. chartarum chemotype A and only 30% were identified as

chemotype S. This may have a positive implication for public health in north central Florida

since chemotype A does not produce highly toxic macrocyclic tricothecenes. As a diagnostic

tool, neither locus correctly identified all isolates, and more accurate molecular markers should

be identified.









CHAPTER 1
INTRODUCTION

Stachybotrys chartarum (Ehrenb.) Hughes (= Stachybotrys atra Corda) is a dermatiaceous

hyphomycete of worldwide distribution. It has been isolated from soil (Barron 1968, Ellis 1971),

from decaying plant material (Ellis 1971, Whitton et al. 2001), on animal fodder (Drobotko

1945), as a parasite of other fungi (Siqueira et al. 1984), and in association with living plants (El-

Morsy 1999, Li et al. 2001). Some of the more unusual natural substrates include woodchuck

dung (Jong and Davis 1976) and seaweed (Andersen et al. 2002). A strongly cellulolytic fungus,

S. chartarum has also been isolated from a variety of cosmopolitan materials derived from plant

fibers such as paper, cotton, and canvas (Bisby 1943, Jong and Davis 1976). Of current interest

is the frequent isolation of S. chartarum from construction materials including drywall, ceiling

tiles and wallpaper in buildings that have experienced water damage (Li and Yang 2005). The

recovery of S. chartarum spores from indoor air samples and its known production of

mycotoxins have led to increased public interest in this fungus in recent years (Nelson 2001,

Money 2004).

Taxonomic History of Stachybotrys chartarum and Related Species

The genus Stachybotrys Corda was first described in 1837 to accommodate a black mold

found growing on the wall of an apartment in Prague, Czech Republic. The type species is S.

atra Corda, and the genus is characterized by septate and branched hyphae, conidiophores that

terminate in a whirl of phialides, and two-celled pigmented conidia (Corda 1837). The

etymology of Stachybotrys refers to its characteristic crown of phialides, with the Greek prefix

stachy- referring to a "spike" and -botrys meaning a "bunch of grapes." From 1837 to 1886,

seven new species were described, one with two-celled spores, and the other six have one-celled









conidia. By 1943, there was a total of twenty Stachybotrys species, with the twelve new taxa all

being unispored (Bisby 1943).

Bisby undertook the first major revision of the genus, reducing the number of Stachybotrys

species to two, S. atra Corda and S. subsimplex Cooke. Based on studies of cultures and

herbarium specimens, S. alternans Bonord., S. asperula Massee, S. atrogrisea Ellis & Everh., S.

cylindrospora Jensen, S. dakotense Sacc., S. dichroa Grove, S. elasticae Koord., S. gracilis E.J.

Marchal, S. pulchra Speg., S. scabra Cooke & Harkn., and S. verrucosa Cooke & Massee were

reduced to synonymy with S. atra as were Aspergillus alternatus Berk., Spororcybe lobulata

Berk., Synsporium biguttatum Preuss, and Memnonium sphaerospermum Fuckel. Bisby (1943)

suggested that there was great morphological variation in Stachybotrys atra which accounted for

the 15 synonyms and hypothesized that even an unnamed "pink .l, I Ii, yu yii" could belong to

this species. He attributed Corda's observation of two-celled conidia to the one, three or, most

commonly, two guttulae which he observed, noting that under Corda's microscope such spores

would seem definitely septate. Thus, the emended description of the genus Stachybotrys read as

follows:

Hyphae, phialophores, and phialides hyaline, brightly coloured, or dark; strands or ropes of
hyphae may be produced. Conidia (slime-spores) one-celled, normally dark and
accumulating into a cluster. The distinctive characteristic of the genus is the septate
phialophore or simple conidiophore bearing a crown of phialides and generally becoming
dark. A phialophore arises directly from a hypha, or, frequently, from another phialophore.
Perfect stage unknown.

Stachybotrys atra was described as having phialides 10-16 x 5-7 [m and conidia 8-12 (14)

x 4-9 (12) jm, elliptical to oval on younger growth of the fungus, often subglobose on older

growth.

Stachybotrys subsimplex was described as having simple, rather than branched,

conidiophores, and smaller phialides (6-12 x 4-6 im) and conidia (4-10 x 3-5 im) than S. atra.









The species was thought to be synonymous with Gliobotrys alboviridis Hohn. and Memnoniella

echinata (Rivolta) Galloway (Bisby 1943). Bisby felt that the genus Memnoniella Hohn., which

had as its only major difference from Stachybotrys the occurrence of its conidia in chains as

opposed to a slimy head, could actually be S. simplex with slime production reduced sufficiently

to allow the retention of spores in chains.

The binomial Stachybotrys chartarum was first used by Hughes in 1958 after reexamining

the type material ofS. atra. He identified three homotypic synonyms, Stilbospora chartarum

Ehrenb. 1818, Oidium chartarum Ehrenb. ex Link 1824 and Oospora chartarum (Ehrenb. ex

Link) Wallr. 1833. Hughes recombined the names as Stachybotrys chartarum (Ehrenb.) Hughes

(= S. atra Corda). Although some authors continued to use S. atra for some time (Ellis 1971),

Stachybotrys chartarum currently is the universally accepted name.

Jong and Davis (1976) recognized 11 species of Stachybotrys (S. altipes (Berk. & Broome)

S.C. Jong & Davis, S. bisbyi (Sriniv.) G.L. Barron, S. chartarum, S. cylindrospora, S. dichroa, S.

kampalensis Hansf., S. microspora B.L. Mathur & Sankhla, S. nephrospora Hansf, S. oecnuithe

Ellis, S. parvispora Hughes, S. theobromae Hansf.) and two species of Memnoniella. S.

cylindrospora and S. dichroa were taxa resurrected from Bisby's treaties, and two new

combinations were proposed, S. albipes (Berk. & Br.) Jong & Davis and S. microspora (Mathur

& Sankha) Jong & Davis. In addition, S. saccharia (Srinivasan) Barron was synonymized with

S. bisbyi (Srinivasan) Barron, as was S. reniformis Tubaki. Stachybotrys sinuatophora Matsush.

was considered the synonym of S. nephrospora Hansf. The most recently published key includes

52 species of Stachybotrys, and four species of Memnoniella (Pinruan et al. 2004). However,

only a few of these fungi are reported frequently in literature (Andersen et al. 2003).

Stachybotrys sinuatophora is not considered a synonym of S. nephrospora in this key.









Taxonomic uncertainty in the genus continues as recently as 2007 when the type species of S.

cylindrospora was reclassified as S. chartarum and a new species, S. eucylindrospora Li was

described (Li 2007)

Andersen et al. (2002, 2003) proposed two chemotypes of S. chartarum based on differing

metabolite production. Chemotype S produces macrocyclic trichothecenes including satratoxins

and roridins. Chemotype A produces atranones and dolabellanes.

Jong and Davis (1976) confirmed that Stachybotrys and Memnoniella represented two

different genera based on morphological differences in the arrangement of the conidia, and

reported work by Campbell (1972, 1974) that showed that in Stachybotrys, the new conidia arise

after the previous ones are mature and have been released from the phialide neck. This is in

contrast with Memnoniella, where the new conidia arise in basipetal succession before the

previous ones are mature. Therefore, the conidial chains formed by Memnoniella are not a result

of less slime production as suggested by Bisby (1943).

The status of the genus Memnoniella continues to be controversial (Li et al. 2003, Pinruan

et al. 2004). Using sequence data from 18S, 28S, 5.8S rDNA genes and the ITS1 and ITS2

regions, Haughland et al. (2001) evaluated the evolutionary relationship between the two genera.

They concluded that Memnoniella and Stachybotrys are paraphyletic and proposed renaming M.

echinata and M subsimplex as S. echinata and S. subsimplex, respectively. One strain in the

study, identified as an isolate ofM subsimplex, showed morphological features typical ofM.

subsimplex, but fell into the M. echinata clade based upon a phylogenetic analysis. After further

study, this culture was described as a new species, Memnoniella longistipitata D.W. Li, Chin S.

Yang, Vesper & Haugland (Li et al. 2003) with the note that since Memnoniella was apparently

still accepted, the new species was being placed in that genus. Other authors believe that









Memnoniella is not a valid genus and advocate transferring all Memnoniella species to

Stachybotrys (Smith 1962, Carmichael et al. 1980, Pinruan et al. 2004).

Stachybotrys albipes is the only species for which a sexual state, Melanopsamma

pomiformis (Pers. ex Fr.) Sacc., has been identified (Booth 1957, Castlebury et al. 2004). The

genus Melanopsamma Niessel was placed in the Niessliaceae (Hypocreales) by Samuels and

Barr (1997), but this classification has been questioned. Castlebury et al. (2004) investigated

higher-level phylogenetic relationships of the genus Stachybotrys and found that it formed a

previously unknown monophyletic lineage within the Hypocreales that also included species of

SMyi the1 it 11n Tode. Like Stachybotrys, Myi~ 1i the iitn produces macrocyclic trichothecenes

(Jarvis et al. 1985), and the two genera share morphological features such as slimy dark black to

green conidia that are produced from phialides. It has been suggested that these genera comprise

a newly discovered sister lineage to the other families currently accepted in the Hypocreales

(Castlebury et al. 2004).

Morphology of Stachybotrys chartarum

Bisby (1943) recognized the morphological variety that exists among isolates of S.

chartarum, and subsequent authors have reaffirmed this observation (Andersen et al. 2002,

Andersen et al. 2003, Li and Yang 2005). Jong and Davis (1976) described the species when

grown on Corn Meal Agar as follows:

... Condiophores determinate, macronematous, solitary or in groups, erect, straight or
slightly curved, simple or irregularly branched, 2-4 septate, hyaline at the base, dark
olivaceous toward the apex, length variable, up to 1000 [m long, 3-6 [m wide, the basal
cell slightly inflated, sometimes minutely rough-walled at the upper parts, sometimes more
or less smooth throughout the length, slightly enlarged at the apex which bears terminal
phialides in a whorl of 3-9 around a central phialides.

Phialides enteroblastic, determinate, discrete, unicellular, at first hyaline, later dark
olivaceous, obovate or ellipsoid, smooth-walled, 9-14 x 4-6 [im, with conspicuous
collarettes.









Phialoconidia acrogenous, arising singly and successively as separate units, aggregated in
slimy masses, at first hyaline, when mature dark olive gray, more or less opaque, smooth-
walled or showing banded or ridged, ellipsoidal, unicellular, 7-12 x 4-6 im. ....

Jong and Davis (1976) described the distinguishing features of S. chartarum as the ridged

or banded surface of the mature conidia as well as their size. Therefore, it is interesting that Ellis

(1971) described the conidial dimensions as 8-11 x 5-10 [im and Bisby (1943) as 8-12 x 4-9 inm.

The range of measurements in these various descriptions of S. chartarum led to some confusion

regarding its species delineation (Andersen et al. 2002, 2003, Li and Yang 2005). The

recognition of S. chlorohalonata B. Andersen & Thrane as a distinct species, and the use of

metabolic profiles to identify chemotypes of S. chartarum may clarify the current situation

(Andersen et al. 2003).

Stachybotrys chartarum, Mycotoxin Production and Human Health

Although some authors trace reports of mold-induced sick building syndrome back to

books of Exodus and Leviticus in the Old Testament (Heller et al. 2003, Jarvis 2003), the

widely-accepted first report of S. chartarum causing illness in humans or other animals was in

the USSR in the 1930s when stachybotryotoxicosis epidemics occurred in horses in the Ukraine

which had consumed Stachybotrys-infested hay (Drobotko 1945). Although

stachybotryotoxicosis has occurred in animals in Eastern Europe throughout the 20th century,

(Forgacs 1972), it has not been a problem in North America where a combination of favorable

farming conditions and good agricultural practices have thwarted serious infestations of fodder

with S. chartarum (Jarvis 2003).

Drobotko (1945) characterized the disease in horses as having three stages. Stage one is

marked by irritation and ulcers of the mouth, throat, nose and lips. The second stage lasts several

days to a month during which a low white blood cell count occurs. Only a few cases pass into

the third stage where a fever of 40 41C develops and remains until death. Disease progression









depends upon the amount of mold that is consumed and the period of time over which

consumption occurs (Hintikka 1978b). An atypical form of the disease, characterized by

neurological disorders including loss of reflex response and vision and noted by Forgacs et al.

(1958), follows the ingestion of large quantities of contaminated feed. Afflicted animals usually

die within 24 hours of showing symptoms.

Although it was suspected that stachybotryotoxicosis was caused by mycotoxins

(Drobotko 1945), they were not characterized until Eppley and Bailey (1973) identified five

toxic compounds from isolates of S. chartarum, including the macrocyclic trichothecenes roridin

E and satratoxin G and H. Named after the fungus Trichothecium roseum (Pers.) Link from

which the first trichothecene was isolated in 1948 (Desjardins et al. 1993), trichothecenes are an

important class of sesquiterpenes that include the T-2 toxin produced by several species of

Fusarium Link. A sub-class of this group is the macrocyclic tricothecenes which are the most

potent inhibitors of eukaryotic protein synthesis; they are considered to be among the most

important and acutely toxic of the mycotoxins (Jarvis 2003). Macrocyclic tricothecenes shown

to be produced by S. chartarum include roridin E and L-2, satratoxins F, G and H, isosatratoxins

F, G, and H, verrucarins B and J, and two types of trichoverroids, trichoverrols A and B and

trichoverrins A and B (Nelson 2001).

Stachybotrys chartarum produces several other types of metabolites that are toxic to

mammalian cells. Approximately 10-40 spirocyclic drimanes have been identified, and this class

of metabolites has a broad range of activities including enzyme inhibition, cytotoxicity and

neurotoxicity (Jarvis et al. 1995, Nielsen 2003). In addition, stachylysin causes leakage or

rupturing of red blood cells (Vesper et al. 1999, 2001), and spirocyclic drimanes are potent

immunosuppresants (Jarvis et al. 1995, Jarvis 2003). A novel class of compounds, the atranones,









was recently identified (Hinkley et al. 2000), although it is unknown if they have significant

biological activity (Jarvis 2003).

In European regions that reported occurrences of equine stachybotryotoxicosis, humans

who handled Stachybotrys-contaminated material developed symptoms similar to those found in

horses (Forgacs 1972, Hintikka 1978a). Common symptoms included a rash, particularly in

areas of perspiration such as underarms, dermatitis, pain, inflammation and/or a burning

sensation in the mouth and nasal passages, tightness of the chest, cough, fever, headache and

fatigue (Nelson 2001). The first report of stachybotryotoxicosis in North America was in a

residence in Chicago (Croft et al. 1986). Over a five-year period, a family of five individuals

exhibited symptoms including cold and flu-like illness, sore throats, diarrhea, headaches, fatigue,

dermatitis, intermittent hair loss, and generalized malaise. Stachybotrys chartarum spores were

isolated from an interior duct as well as from ceiling material. Extracts from spores collected

from these areas were injected into mice, and within 24 hours of exposure, all of the animals

died. Extracts from the ceiling fiber board were shown to contain the macrocyclic trichothecenes

verrucarin J and satratoxin H as well as the precursors trichoverrins A and B.

This report was believed to be an isolated incident until the mid-1990s (Jarvis 2003,

Money 2004). Between January 1993 and December 1994, ten infants were hospitalized with

bleeding lungs at Rainbow Babies' and Childrens' Hospital in Cleveland, Ohio and diagnosed

with acute pulmonary hemorrhage/ hemosiderosis (Anonymous 1994, 1997). These patients

represented an unusually high number of cases, as only three infants had been diagnosed with

acute pulmonary hemosiderosis from 1983-1993 (Anonymous 1994). All of the infants lived in

homes that had been severely water damaged in the previous six-months, and S. chartarum was

isolated from eight of nine homes that were tested (Anonymous 1997, Etzel et al. 1998, Dearborn









et al. 1999). R.A. Etzel, a pediatrician from the Centers for Disease Control (CDC, Atlanta, GA)

and D.G. Dearborn, a pulmonary pediatrician from the Rainbow Babies' and Children's

Hospital, both hypothesized that infant pulmonary hemorrhage might be caused by exposure to

mycotoxins produced by S. chartarum (Anonymous 1997, Etzel et al. 1998, Dearborn et al.

1999). Although the CDC eventually retracted its earlier support of this association (Anonymous

2000), evidence continues to grow regarding the link between the two (Elidemir et al. 1999,

Vesper and Vesper 2002).

Despite the significance of S. chartarum in issues regarding public health and the fact that

it has been isolated from a wide variety of materials, a comprehensive ecological study that

identifies different habitats that support S. chartarum populations in nature has never been

undertaken. It is critical to understand the types of environments that support natural populations

of S. chartarum because it is likely that the source of indoor contamination is air-borne spores

that are deposited on the surface of building materials at their construction sites (Nelson 2001,

Koster 2006). The development of a semi-selective growth medium that affords the usually

slow-growing S. chartarum a competitive advantage when present with other common air-borne

spores is the focus of chapter 2. Chapter 3 focuses on the distribution and occurrence of

Stachybotrys spp. across four different habitats. The mycotoxin profile of S. chartarum can no

longer be associated with particular morphological criteria (Andersen et al. 2003). A molecular

characterization of the north central Florida isolates collected from these field studies was

undertaken to distinguish between the two chemotypes and determine their prevalence (Chapter

4). In chapter 5, a summary of the information is provided and future suggestions for research

are discussed.









CHAPTER 2
COMPARISON OF SEMI-SELECTIVE MEDIA FOR DETECTION OF Stachybotrys
chartarum FROM AIR SAMPLES

Introduction

Stachybotrys chartarum is a mycotoxin-producing, cosmopolitan fungus that occurs on

water-damaged, cellulose-based building materials such as drywall and ceiling tiles. This black

mold has aroused public interest because it has been implicated in cases of sick building

syndrome and pulmonary hemorrhage (Croft et al. 1986, Etzel et al. 1998, Dearborn et al. 1999).

From a human health perspective, it is of paramount importance that S. chartarum be accurately

and consistently isolated from environmental samples.

Common detection methods of suspected mold contamination are bioaerosol, swab, tape,

or bulk sampling (Miller 2001). There is no ideal method for the sampling of fungal particles in

indoor air, in part because no one medium exists for air sampling that is ideal for use in every

environment (Samson et al. 1994). Recommended broad-spectrum media for use in indoor air

sampling are Dichloran 18% Glycerol Agar (DG18), Malt Extract Agar (MEA) and Water Agar

(Samson et al. 1994). However, S. chartarum has rarely been isolated from fungal air samples

using these media (Andersen and Nissen 2000, Tiffany and Bader 2000). It is possible that S.

chartarum spores do not become airborne easily because they are produced in wet slimy heads

(Tucker et al. 2007). In addition, it has been reported that up to 90% of the spores that do

become airborne may not be viable (Miller 1992).

An alternative hypothesis is that viable S. chartarum spores are airborne but that they are

underreported in air sampling studies because 1) often they are found in conjunction with other

common, fast-growing fungi such as species ofPenicillium, Aspergillus, Cladosporium, and

Curvularia that outcompete the slower-growing S. chartarum and 2) commonly-used media do

not meet its growth requirements. For example, S. chartarum will not sporulate on DG18, which









is recommended for general detection of fungi indoors (Andersen and Nissen 2000). This is not

surprising since DG18 is selective for xerophilic fungi; Stachybotrys requires a water activity

higher than 0.9 for growth (Grant et al. 1989). Stachybotrys chartarum growth on MEA, another

recommended medium, is very restricted, and some isolates will not sporulate on it (Andersen

and Nissen 2000).

The necessity of a selective medium for S. chartarum has been recognized by professionals

for over a decade (Samson et al. 1994), and researchers have proposed several possibilities that

favor the isolation of S. chartarum from an environmental sample containing many different

organisms. This medium must meet its growth requirements while restricting the growth of

competing fungi. Since S. chartarum is a cellulose-digesting saprobe, a cellulose-based agar

medium amended with Rose Bengal to inhibit other fungi has been recommended (Petri 1983,

Henry and Stetzenbach 2000). El-Kady (1988) suggests a similar medium, Cellulose-Czapek's

Agar, amended with Rose Bengal and adjusted to a pH of 8. Tsai et al. (1999) included Czapek's

Cellulose Agar and Rose Bengal Agar in their survey of selective media, but they recommended

using unamended Cornmeal Agar (CMA) because they found interference from species of

Aspergillus, Chaetomium, Cladosporium, and Penicillium on Czapek's celluose agar. Billups et

al. (1999) did not get satisfactory results using cellulose agar when trying to isolate Stachybotrys

from mixed cultures with Aspergillusflavus, A. niger, Cladosporium brevitomosum and

Penicillium chrysogenum. Potato dextrose agar (PDA) amended with the antibiotic/antimycotic

agent Miconazole was a better isolation medium (Billups et al. 1999). Other authors have

recommended Oatmeal Agar, Hay Agar (Samson et al. 2002), a low nutrient medium such as

Water Agar with a piece of sterile filter paper on the surface (Harrington 2003) or V8 Agar with

antibiotics (Andersen and Nissen 2000).









In this study, air samples were collected from indoor and outdoor air in Florida, a state

with temperate and subtropical climates that are conducive to fungal growth. Huang and

Kimbrough (1997) conducted a survey of 41 Florida homes with children ages 4-14, some of

whom suffered from mold allergies. Species of Cladosporium, Penicillium, Curvularia,

Epicoccum and Alternaria accounted for 80% of the total fungi isolated. Bishop (2002) sampled

outdoor air during summer months in north central Florida and did not report the occurrence of

any Stachybotrys spp. Species of Cladosporium, Geotrichum, Fusarium, and Penicillium

accounted for over 85% of the total fungi found outdoors. This study used low pH Mycological

Agar which is not considered to be a good medium for recovery of S. chartarum.

The objective of the present study was to identify a medium or media that are semi-

selective for S. chartarum spores in indoor and outdoor air. A medium that favors the recovery

of S. chartarum from indoor air samples would be useful to industrial hygienists. In addition, it

has been suggested that the source of S. chartarum building contamination is likely inoculum

from outdoor air (Koster 2006). Stachybotrys chartarum is only rarely reported from outdoor air

samples; a semi-selective medium could be used to provide a better understanding of the

presence of S. chartarum in outdoor environments.

Materials and Methods

In this study, ten media were exposed in a residence with known S. chartarum

contamination. The media with the best recovery of S. chartarum were then evaluated in

outdoor settings in order to determine which was most effective when recovering S. chartarum at

low concentrations.

Indoor Sampling

In July 2006, air sampling was undertaken at a private residence in Gainesville, FL, USA,

that was known to be contaminated with S. chartarum. There was visible growth of S.









chartarum that had been present for several weeks on the master bedroom carpet, covering

approximately 0.3 m3. Sampling was done in the master bedroom and the living room (Figure 2-

1). Previously, S. chartarum had been recovered from the living room; remediation occurred at

that time, and the carpet was removed, the mold cleaned, and wood flooring was laid. At the

time of sampling, the master bedroom was unoccupied.

Air samples were taken for 2 min in the master bedroom and the living room using an

Andersen one-stage culture plate impactor (N6, Andersen Samplers, Inc., Atlanta, GA) with an

Aerolite pump (Aerotech Instruments, Aerotech P & K, Allegro Industries) drawing 28.3 L of air

per minute. Sampling occurred at a height of 0.6 m above the ground. Effort was made not to

disturb the area of fungal growth in the bedroom so as to prevent the release of spores that would

not normally be airborne. Ten media were used: BBLTM Corn Meal Agar (CMA, Becton,

Dickson and Co., Sparks, MD), DifcoTM Potato Dextrose Agar (PDA, Becton, Dickson and Co,

Sparks, MD), Potato Dextrose Agar with 0.05 g Rose Bengal per liter (PDA RB), Potato

Dextrose Agar with ml Tergitol per liter (PDA T), Potato Dextrose Agar with 0.05 g Rose

Bengal and 1 ml Tergitol per liter (PDA RB/T), V8 Agar with 2 g of CaCO3 per L (V8/2, Atlas

1993), V8 Agar with 4 g of CaCO3 per L (V8/4), Water Agar with sterile filter paper (WAFP,

Atlas 1993), Water Agar with sterile filter paper and 0.05 g Rose Bengal per liter (WAFP RB),

and wetted 4 cm x 4 cm squares of 1.3 cm (/2") thick sterile drywall. All agar plates contained

24 mL of medium. There were three replications for each medium, and a randomized complete

block design was used. The Andersen N6 sampler was wiped down with 95% ethanol before

sampling, between each sample, and at the end of sampling. Sampling was repeated the

following day. Samples were incubated in the dark at 240C for seven days.









Total number of fungal and bacterial colonies and number of S. chartarum colonies were

counted and recorded as colony forming units per cubic meter of air (CFU/m3). Stachybotrys

chartarum was identified microscopically at 400x. Representative colonies from each room

were grown on Czapek Yeast Autolysate Agar (CYA, Samson et al. 2002) and incubated in the

dark for seven days at 240C at which point they were evaluated for pigment production. This

was done to differentiate between S. chartarum and S. chlorohalonata which are similar

morphologically. Stachybotrys chlorohalonata produces a dark green extracellular pigment on

CYA. Percent recovery of S. chartarum from total colonies was calculated. Data were log-

transformed, except for percent recovery of S. chartarum, and the data were analyzed as a two-

way factorial. The analysis of variance showed an interaction between room and media, so the

data were analyzed by room. P-values less than 0.10 were considered significant, and in these

cases, means were separated by the Waller-Duncan k-ratio t test. Data were analyzed using SAS

statistical software (Version 9.1, SAS Institute, Cary, NC).

Outdoor Sampling

Four media from the indoor air study (CMA, PDA RB, V8/2, WAFP RB) were used in this

study. The V8 agar was amended with 0.1 g streptomycin sulfate and 0.05 g chlorotetracycline

hydrochloride per liter. Sampling occurred at two sites on the University of Florida campus,

Gainesville, FL, USA, a managed citrus grove (29o38' 10"N, 8221'53"W) and a grassy parking

area (29o38' 17"N, 8221'46"W). Sampling occurred between 8 AM and 11 AM on ten dates

from Apr July 2007 at intervals of approximately ten days. Air samples were taken for 2 min

using the Andersen N6 sampler with an Aerolite pump (Aerotech Instruments, Aerotech P & K,

Allegro Industries) drawing 28.3 L of air per minute. Sampling occurred at a height of 0.6 m.

There were three replications for each medium, and a randomized complete block design was

used. The Andersen air sampler was wiped down with 95% ethanol before sampling, between









each sample, and at the end of sampling. Samples were incubated in the dark at 240C for ten

days. Total numbers of colonies of filamentous fungi were counted on day 3 and recorded as

colony forming units per cubic meter of air (CFU/m3), with the exception of the WAFP RB

plates which were read on Day 10. On day 5, the plates were observed at 30x, and the number of

colonies of Stachybotrys, Alternaria, Curvularia, Cladosporium, Bipolaris/Dreschlera,

Epicoccum, Penicillium, and Aspergillus was recorded for all samples on PDA RB and V8/2

media. The presence or absence of these genera was noted for samples on CMA and WAFP RB.

Putative S. chartarum colonies were isolated and grown on Czapek Yeast Autolysate Agar

(CYA, Samson et al. 2002) and incubated in the dark for seven days at 240C, at which point they

were evaluated for pigment production.

Results

Indoor Study

Because there was a significant interaction between room and media for total colonies

(p<0.01 Day 1, p<0.001 Day 2), Stachybotrys colonies (p<0.001 Day 1, p<0.001 Day 2) and

Stachybotrys as a percent of total colonies (p<0.001 Day 1, p<0.01 Day 2), the data were

analyzed by room.

The means of the total number of CFU/m3 of air for each room are reported in Tables 2-1

and 2-2. The media detected significantly different (p<0.001) numbers of fungal colonies in

each room on both days. The two V8-based media recovered high numbers of colonies in both

rooms; however, it was noted that the plates were dominated by bacterial colonies. The actual

number of filamentous fungi recovered by these media was much lower. Zero to few colonies

grew on the pieces of wetted drywall. Each medium recovered a higher number of colonies from

the master bedroom than from the living room.









The means of the number of S. chartarum (CFU/m3 of air) for each room are reported in

Tables 2-3-and 2-4. In the master bedroom, differences in recovery among media were

significant on both days (p<0.001). Seven media, WAFP RB, PDA RB, V8/2, V8/4, CMA, PDA

RB/T, and PDA T, recovered multiple colonies of S. chartarum from the master bedroom on

both days. WAFP recovered an average of 135 CFU/m3 ofS. chartarum on day 1 but none on

day 2. Overall, fewer S. chartarum colonies were noted on day 2 in the master bedroom.

Relatively few colonies of S. chartarum were recovered from the living room. Only the

two V8 media were significantly different (p<0.01) from the media that failed to recover any S.

chartarum. Only V8/2 was able to capture S. chartarum from the living room on both days of

sampling. Representative isolates from both rooms did not produce green pigment on CYA.

Recoveries of S. chartarum as a percent of total colonies are presented in Tables 2-5 and 2-

6. In the bedroom, WAFP RB recovered a significantly higher percent of S. chartarum than all

other media on both days (p<0.001 on day 1, p<0.01 on day 2). Other media for which S.

chartarum represented 16% or more of the total colonies included CMA, WAFP, both V8 agars

and PDA RB. In the living room, no significant differences among media occurred on either day

(p=0.2935 on day 1, p=0.5181 on day 2).

Outdoor Study

The total number of fungal colonies recovered from all 240 samples taken in this study was

12,545 colonies at the citrus site and 10,422 colonies at the grassy parking area. Of these 22,967

total colonies, the recovery of S. chartarum was a rare event, occurring on only two often

sampling dates and totaling only seven colonies from six plates, or 0.025% of all plates. One

colony of S. chartarum was observed on a PDA RB plate and one colony on a WAFP RB plate

from those sampled on May 25 2007 at the grassy lot. The plates from the Jun 5 2007 sampling

period recovered four colonies of S. chartarum from the citrus grove (one colony on a V8/2









plate, two colonies on one WAFP RB plate and one colony on a second WAFP RB plate) and

one colony from the grassy lot site, on a PDA RB plate. No S. chartarum colonies were

recovered on any of the CMA plates. None of the putative S. chartarum isolates produced green

extracellular pigment when grown on CYA.

Cladosporium spp. were the most commonly recovered colonies from all media at both

sites. This genus represented anywhere from 39.3% of total colonies (PDA, citrus grove) to

69.7% (V8, grassy lot). The second most common genus was Penicillium which ranged from

1.9% of total colonies (V8, grassy lot) to 4.1% (PDA, grassy lot). Species ofAlternaria,

Curvularia, Bipolaris/Dreschlera, Epicoccum, and Aspergillus all appeared but less regularly

and/or abundantly. No notable difference in the frequency or abundance of these genera appears

in the two sampling dates that recovered S. chartarum.

It should be noted that mites were discovered in the plates from the May 25 and Jun 5

sampling dates, including the ones that had S. chartarum colonies. The sampled plates were kept

in an incubator that also housed pure cultures of S. chartarum that were found to have mites. No

mites were present in plates from the other ten sampling dates.

Discussion

There has been ongoing discussion about the accuracy of air sampling for detection of S.

chartarum in cases of suspected mold contamination, whether due to sampling method, spore

dispersal, spore viability, or competitiveness on common media (Andersen and Nissen 2000,

Kuhn et al. 2005). A recent study (Tucker et al. 2007) examined the biomechanics of conidial

dispersal of S. chartarum and concluded that its conidia are poorly adapted for dispersal by

airspeeds common in indoor environments. In addition, Stachybotrys growth most commonly

occurs hidden in natural cracks and openings in structures, such as behind wallpaper or in a wall

cavity, protected from air flow (Andersen and Nissen 2000). Stachybotrys chartarum spores are









present in indoor air in low concentrations, so it is important to use a growth medium that is

semi-selective and affords the best opportunity for detection of the fungus. This study showed

that when using an appropriate agar medium, it is possible for an air sample to pick up viable S.

chartarum spores. There are, however, limitations to this method.

In the indoor air study, there was ample and consistent recovery of S. chartarum on many

different media from bedroom air when the sampler was in close proximity (
fungal growth. The percentage of S. chartarum spores of all collected spores in the bedroom was

16% or greater for WAFP RB, CMA, WAFP, V8/2, V8/4 and PDA RB. These results

demonstrate that S. chartarum spores do become airborne under conditions of normal household

activity and that these spores are viable. Because large numbers of bacterial colonies grew on

the V8 plates, this medium should always be amended with antibiotics as suggested by Andersen

and Nissen (2000). If the bacterial colonies had been suppressed, the percent recovery of S.

chartarum by these two media would have been much higher. This study also confirms the

suggestions that WAFP (Harrington 2003), V8 agar with antibiotics (Andersen and Nissen

2000), PDA (Billups et al. 1999), and CMA (Tsai et al. 1999) may be the best culture media, of

those tested, for recovering viable S. chartarum from bioaerosol samples. Of these, WAFP

amended with Rose Bengal also recovered fewer total numbers of colonies. Thus it seems that

this medium, along with V8 agar amended with antibiotics, best meets the challenge of

selectively recovering S. chartarum while reducing the total number of other colonies recovered.

More colonies of S. chartarum were recovered in the master bedroom than in the living

room and on a greater number of media. At the time of sampling, S. chartarum was present on

carpet in the master bedroom while there was no visible growth in the living room, which is

located at the other end of the house (Figure 2-1). It is likely that the distance of the sampler









from the source of primary inoculum affects the accuracy of detection. These results highlight

the difficulty in detecting S. chartarum from indoor air even when inoculum is visible and semi-

selective media are used. Previous studies have shown that fewer S. chartarum colonies were

detected on agar plates than by other sampling methods (Tiffany and Bader 2000, Spurgeon

2003, Kuhn et al. 2005). In this study, it was expected that better detection of S. chartarum

could be obtained by using semi-selective media; however, it is possible that other methods such

as impaction plates or cassettes may be better suited for accurate sampling of this particular

fungus.

Of the two rooms sampled in the indoor air study, the living room best represented typical

outdoor air, which would likely have a low concentration of S. chartarum spores. Therefore, the

media that successfully recovered S. chartarum from the living room air samples were used in

the outdoor air study. In addition WAFP RB was selected because it consistently recovered the

most colonies of S. chartarum in the master bedroom. Bishop (2002) showed that, in north

central Florida, an Andersen sampler collects more fungi from outdoor air in the morning than in

the afternoon. In addition, this same study showed that the amount of Cladosporium as a percent

of total fungi measured is less at 9 AM than it is at 3 PM and 9 PM (Bishop 2002). In an effort

to sample from the largest number of spores while limiting the amount of Cladosporium present,

samples were collected in the morning for the outdoor air study. Sampling occurred at a time of

year when S. chartarum is present outdoors (Chapter 3).

The detection of S. chartarum from outdoor air was a rare event although 1) the media

used had successfully recovered S. chartarum in the indoor air study and 2) the samples were

taken in an area and at a time of year that S. chartarum had been recovered by other sampling

techniques (Chapter 3). It is likely that S. chartarum is present in outdoor air at such a low









concentration that it falls below the detectable threshold of even semi-selective media. This

study suggests that air sampling would not be an appropriate method for research investigating

the occurrence of S. chartarum in outdoor habitats. Studies that have used slide impaction or

cassette samplers, which allow detection on non-viable spores, have reported higher levels of S.

chartarum in outdoor air than this study, from 3 9% of samples (Baxter et al. 2005, Kuhn et al.

2005).

The fact that S. chartarum was recovered on plates from two of the ten sampling dates and

only from plates that were also infested with mites suggests the possibility that it was, in fact, not

ever recovered from outdoor air and was instead introduced from mites that migrated in the

laboratory from pure cultures of S. chartarum. Fungi are known to be dispersed by a wide

variety of arthropods such as beetles (Paine et al. 1997) and collembola (Visser et al. 1987).

Mites are known to vector spores from a range of fungal taxa that includes Basidiomycota,

Ascomycota and Zygomycota (Renker et al. 2005, Greif and Currah 2007). In particular, species

that produce sticky spores, such as Ophiostoma ulmi, the causal agent of Dutch Elm disease, are

associated with arthropods. Stachybotrys is unusual among common indoor air fungi in that it

produces spores in a mucilaginous mass, whereas species ofAspergillus, Penicillium, and

Cladosporium produce dry spores that seem well-adapted to air dispersal (Tucker et al. 2007). It

has been hypothesized that S. chartarum can be spread indoors by insect movement, although

research has yet to confirm this (Money 2004, Koster 2006). The results of this study suggest

that further research should investigate mites as possible vectors of S. chartarum spores.

























Figure 2-1. Private residence in Gainesville, FL with Stachybotrys chartarum infestation. A)
Bedroom showing S. chartarum growing on carpet. B) Living room and dining room.









Table 2-1. Total number of fungal and bacterial colonies recovered on different media from
master bedroom, for two different samplings.
Day Mediaa Meanb
1 PDARB/T 3842.7 a
1 PDAT 3168.0 ab
1 PDARB 2364.3 ab
1 V8/4 1830.4 ab
1 V8/2 1783.5 ab
1 PDA 2147.2 abc
1 WAFPRB 1302.4 abc
1 CMA 1009.1 bc
1 WAFP 662.9 c
1 drywall 0.0 d
2 V8/4 2405.3 a
2 V8/2 2217.6 a
2 PDARB 2323.2 a
2 PDAT 1672.0 ab
2 CMA 1519.5 ab
2 PDA 1355.2 ab
2 PDARB/T 1243.7 ab
2 WAFPRB 1014.9 ab
2 WAFP 727.5 b
2 drywall 5.9 c
a Media are Corn Meal Agar (CMA), Potato Dextrose Agar (PDA), Potato Dextrose Agar with
0.05 g Rose Bengal per liter (PDA RB), Potato Dextrose Agar with ml Tergitol per liter (PDA
T), Potato Dextrose Agar with 0.05 g Rose Bengal and 1 ml Tergitol per liter (PDA RB/T), V8
Agar with 2 g of CaCO3 per L (V8/2), V8 Agar with 4 g of CaCO3 per L (V8/4), Water Agar
with sterile filter paper (WAFP), Water Agar with sterile filter paper and 0.05 g Rose Bengal per
liter (WAFP RB), and wetted 4 cm x 4 cm squares of 1.3 cm (1/2") thick sterile drywall.
b Differences among media are significant at p<0.0001. Means reported are actual means; units
are colony forming units per cubic meter of air (CFU/m3). For each sampling date, means in
column followed by the same letter are not different, based on log(x+l) transformed data.









Table 2-2. Total fungal and bacterial colonies recovered on different media from living room,
for two different samplings.
Day Mediaa Meanb
1 V8 4 516.3 a
1 V8 2 440.0 ab
1 PDA 404.8 abc
1 CMA 305.1 abc
1 PDAT 275.7 abc
1 PDARB/T 328.5 abcd
1 PDARB 164.3 bcd
1 WAFPRB 146.7 cd
1 WAFP 111.5 d
1 drywall 0.0 e
2 V8 4 598.4 a
2 V8 2 580.8 a
2 PDA 287.5 ab
2 PDAT 211.2 bc
2 PDARB 181.9 bcd
2 CMA 170.1 bcd
2 PDARB T 129.1 bcd
2 WAFP 93.9 cd
2 WAFPRB 88.0 d
2 drywall 5.9 e
a Media are Corn Meal Agar (CMA), Potato Dextrose Agar (PDA), Potato Dextrose Agar with
0.05 g Rose Bengal per liter (PDA RB), Potato Dextrose Agar with ml Tergitol per liter (PDA
T), Potato Dextrose Agar with 0.05 g Rose Bengal and 1 ml Tergitol per liter (PDA RB/T), V8
Agar with 2 g of CaCO3 per L (V8/2), V8 Agar with 4 g of CaCO3 per L (V8/4), Water Agar
with sterile filter paper (WAFP), Water Agar with sterile filter paper and 0.05 g Rose Bengal per
liter (WAFP RB), and wetted 4 cm x 4 cm squares of 1.3 cm (1/2") thick sterile drywall.
b Differences among media are significant at p<0.0001. Means reported are actual means; units
are colony forming units per cubic meter of air (CFU/m3). For each sampling date, means in
column followed by the same letter are not different, based on log(x+l) transformed data.









Table 2-3. Total Stachybotrys chartarum colonies recovered on different media from master
bedroom, for two different samplings.
Day Mediaa Meanb
1 WAFPRB 686.4 a
1 V8 4 733.3 ab
1 CMA 316.8 ab
1 V82 305.1 ab
1 PDARB 258.1 ab
1 WAFP 134.9 b
1 PDARB/T 105.6 b
1 PDA T 41.1 c
1 PDA 0.0 d
1 drywall 0.0 d
2 WAFPRB 164.3 a
2 PDARB 146.7 a
2 V8 4 93.9 ab
2 CMA 70.4 ab
2 V8 2 58.7 ab
2 PDARB/T 58.7 ab
2 PDAT 58.7 b
2 drywall 0.0 c
2 PDA 0.0 c
2 WAFP 0.0 c
a Media are Corn Meal Agar (CMA), Potato Dextrose Agar (PDA), Potato Dextrose Agar with
0.05 g Rose Bengal per liter (PDA RB), Potato Dextrose Agar with ml Tergitol per liter (PDA
T), Potato Dextrose Agar with 0.05 g Rose Bengal and 1 ml Tergitol per liter (PDA RB/T), V8
Agar with 2 g of CaCO3 per L (V8/2), V8 Agar with 4 g of CaCO3 per L (V8/4), Water Agar
with sterile filter paper (WAFP), Water Agar with sterile filter paper and 0.05 g Rose Bengal per
liter (WAFP RB), and wetted 4 cm x 4 cm squares of 1.3 cm (1/2") thick sterile drywall.
b Differences among media are significant at p<0.0001. Means reported are actual means; units
are colony forming units per cubic meter of air (CFU/m3). For each sampling date, means in
column followed by the same letter are not different, based on log(x+l) transformed data.









Table 2-4. Total Stachybotrys chartarum colonies recovered on different media from living
room, for two different samplings.
Day Mediaa Meanb
1 V8 2 17.6 a
1 V8 4 11.7 ab
1 CMA 5.9 bc
1 WAFP 5.9 bc
1 PDARB/T 0.0 c
1 PDA T 0.0 c
1 PDA 0.0 c
1 PDA RB 0.0 c
1 WAFPRB 0.0 c
1 drywall 0.0 c
2 V82 5.9
2 PDARB 5.9
2 CMA 0.0
2 drywall 0.0
2 PDARB/T 0.0
2 PDAT 0.0
2 PDA 0.0
2 V84 0.0
2 WAFPRB 0.0
2 WAFP 0.0
a Media are Corn Meal Agar (CMA), Potato Dextrose Agar (PDA), Potato Dextrose Agar with
0.05 g Rose Bengal per liter (PDA RB), Potato Dextrose Agar with ml Tergitol per liter (PDA
T), Potato Dextrose Agar with 0.05 g Rose Bengal and 1 ml Tergitol per liter (PDA RB/T), V8
Agar with 2 g of CaCO3 per L (V8/2), V8 Agar with 4 g of CaCO3 per L (V8/4), Water Agar
with sterile filter paper (WAFP), Water Agar with sterile filter paper and 0.05 g Rose Bengal per
liter (WAFP RB), and wetted 4 cm x 4 cm squares of 1.3 cm (1/2") thick sterile drywall.
b Differences among media are significant at p<0.01. Means reported are actual means; units are
colony forming units per cubic meter of air (CFU/m3). For each sampling date, means in column
followed by the same letter are not different, based on log(x+l) transformed data.









Table 2-5. Stachybotrys chartarum colonies as percent of total colonies recovered on different
media from master bedroom, for two different samplings.
Day Mediaa Meanb
1 WAFPRB 50.4 a
1 CMA 33.1 ab
1 V8 4 30.5 b
1 WAFP 18.8 bc
1 V82 18.1 bcd
1 PDARB 16.5 bcd
1 PDARB/T 5.1 cd
1 PDA T 3.1 cd
1 PDA 0.0 d
1 drywall 0.0 d
2 WAFPRB 13.6 a
2 PDARB 5.4 b
2 CMA 4.8 b
2 PDARB/T 4.3 b
2 V84 3.6 b
2 V82 2.8 b
2 PDAT 2.3 b
2 drywall 0.0 b
2 PDA 0.0 b
2 WAFP 0.0 b
a Media are Corn Meal Agar (CMA), Potato Dextrose Agar (PDA), Potato Dextrose Agar with
0.05 g Rose Bengal per liter (PDA RB), Potato Dextrose Agar with ml Tergitol per liter (PDA
T), Potato Dextrose Agar with 0.05 g Rose Bengal and 1 ml Tergitol per liter (PDA RB/T), V8
Agar with 2 g of CaCO3 per L (V8/2), V8 Agar with 4 g of CaCO3 per L (V8/4), Water Agar
with sterile filter paper (WAFP), Water Agar with sterile filter paper and 0.05 g Rose Bengal per
liter (WAFP RB), and wetted 4 cm x 4 cm squares of 1.3 cm (1/2") thick sterile drywall.
b Differences among media are significant at p=0.0002 for Day 1 and p=0.0017 for Day 2.
Means reported are actual means; units are colony forming units per cubic meter of air
(CFU/m3). For each sampling date, means in column followed by the same letter are not
different, based on log(x+l) transformed data.









Table 2-6. Stachybotrys chartarum colonies as percent of total colonies recovered on different
media from living room, for two different samplings.
Day Mediaa Meanb
1 WAFP 5.6
1 V8 2 5.3
1 V8 4 2.7
1 CMA 1.4
1 PDA RB/T 0.0
1 PDA T 0.0
1 PDA 0.0
1 PDA RB 0.0
1 WAFP RB 0.0
1 drywall 0.0
2 PDARB 3.3
2 V82 1.1
2 CMA 0.0
2 drywall 0.0
2 PDA RB/T 0.0
2 PDAT 0.0
2 PDA 0.0
2 V84 0.0
2 WAFPRB 0.0
2 WAFP 0.0
a Media are Corn Meal Agar (CMA), Potato Dextrose Agar (PDA), Potato Dextrose Agar with
0.05 g Rose Bengal per liter (PDA RB), Potato Dextrose Agar with ml Tergitol per liter (PDA
T), Potato Dextrose Agar with 0.05 g Rose Bengal and 1 ml Tergitol per liter (PDA RB/T), V8
Agar with 2 g of CaCO3 per L (V8/2), V8 Agar with 4 g of CaCO3 per L (V8/4), Water Agar
with sterile filter paper (WAFP), Water Agar with sterile filter paper and 0.05 g Rose Bengal per
liter (WAFP RB), and wetted 4 cm x 4 cm squares of 1.3 cm (1/2") thick sterile drywall.
b Differences among media are not significant at p Means reported are actual means; units are colony forming units per cubic meter of air
(CFU/m3).









CHAPTER 3
FREQUENCY AND ABUNDANCE OF Stachybotrys chartarum AND OTHER COMMON
FUNGAL GENERA IN OUTDOOR HABITATS IN NORTH CENTRAL FLORIDA

Introduction

Stachybotrys chartarum (Ehrenb.) Hughes (= Stachybotrys atra Corda) is a dermatiaceous

hyphomycete of worldwide distribution that has been isolated from a variety of substrates in both

indoor and outdoor environments. In natural environments, it has been most commonly isolated

from soil (Barron 1968, Ellis 1971, El-Morsy 1999); however, it has also been isolated from

decaying plant material (Ellis 1971, Whitton et al. 2001), on animal fodder (Drobotko 1945), as a

parasite of other fungi (Siqueira et al. 1984), and in association with living plants (El-Morsy

1999, Li et al. 2001). Some of the more unusual natural substrates include woodchuck dung

(Jong and Davis 1976) and seaweed (Andersen et al. 2002). A strongly cellulolytic fungus, S.

chartarum has also been isolated from a variety of human-made materials derived from plant

fibers such as paper, cotton, and canvas (Bisby 1943, Jong and Davis 1976). Of current interest

is the frequent isolation of S. chartarum from construction materials including drywall, ceiling

tiles and wallpaper in buildings that have experienced water damage (Li and Yang 2005).

Stachybotrys chartarum, which produces macrocyclic trichothecenes that are among the

most potent mycotoxins known to man (Jarvis 2003), has been implicated in cases of sick

building syndrome and pulmonary hemorrhage (Croft et al. 1986, Etzel et al. 1998, Dearborn et

al. 1999). A recent study suggests that outdoor inoculum is the most likely source for indoor S.

chartarum contamination (Koster 2006), possibly from air-borne spores that are deposited on the

surface of building materials at the construction site (Nelson 2001). Despite the significance of

S. chartarum regarding public health, no comprehensive ecological study that identifies different

habitats that support S. chartarum populations has been done.









Previous studies of outdoor air have reported none to very low levels of S. chartarum

spores when sampling using a Samplair particle sampler (Li and Kendrick 1995, Baxter et al.

2005), an Air-O-Cell slit bioaerosal cassette (Baxter et al. 2005), or an Andersen N6 sampler

(Chapter 2, Bishop 2002, Shelton et al. 2002). However, drywall is the most commonly found

human-associated substrate for S. chartarum, and numerous studies have shown it supports

extensive fungal growth when wet (Andersson et al. 1997, Nikulin et al. 1994, Karunasena et al.

2000, Hyvarinen et al. 2002). For this reason, drywall was the medium of choice for this study.

The primary ingredient of drywall is the naturally occurring mineral gypsum or calcium sulfate

dihydrate (CaSO4-2H20), sandwiched between two sheets of paper. Both the cellulose in the

liner and starch, which is used as an adhesive, have been shown to be important nutrient sources

for S. chartarum (Murtoniemi et al. 2003).

The objective of this project was to identify outdoor habitats in north central Florida where

S. chartarum is found and the times of year when it is most abundant. It is critical to understand

the types of environments that support natural populations of S. chartarum because it is likely

that these populations play an important role in the establishment of mold colonies in water-

damaged structures.

Materials and Methods

Study Sites

Four study sites representing diverse habitats in Gainesville, Florida, USA, were selected

(Figure 3-1). Three sites, the pine grove, the citrus grove, and the lakeshore, are located on the

University of Florida campus. The fourth site, a hardwood forest, is on private property

approximately 11 km from the other three sites.

The citrus and pine groves are managed agricultural sites, and the dominant plant species are

species of Citrus and Pinus elliottii (Slash pine), respectively. The lakeshore and hardwood









forest sites are unmanaged and relatively ecologically diverse. Common tree species at the

lakeshore site include Acer negundo (Ashleaved maple), A. rubrum (Red maple), Taxodium

distichum (Bald cypress), Quercus virginiana (Live oak), Sabalpalmetto (Cabbage palm), and

Salix nigra (Black willow). Common shrubs and herbaceous plants include Adiantum pedatum

(Maidenhair fern), Ampelopsis arborea (Peppervine), Andropogon virginicus (Broomgrass),

Baccharis halimifolia, Bidens alba (syn. B. pilosa, Hairy beggarticks, Spanish needles), Capsella

bursa-pastoris (Shepherd's purse), Celtis occidentalis (Common hackberry), Cuscuta sp.

(Dodder), Eupatorium capillifolium (Dog fennel), Laurocerasus caroliniana (Carolina

laurelcherry), Menispermum canadense (Moonseed), Myrica cerifera (Southern wax myrtle),

Parthenocissus quinquefolia (Virgina creeper), Rubus sp. (Wild blackberry), Sambucus sp.

(Elderberry), Smilax bona-nox (Saw greenbrier), Typha sp. (Cattail), and Vitis rotundifolia (Wild

grape). Common tree species at the hardwood forest site include Acer barbatum (Southern sugar

maple), Betula lutea (Yellow birch), Carpinus caroliniana (American hornbeam/Bluebeech),

Liquidambar styraciflua (Sweetgum), Magnolia grandiflora (Southern magnolia), Pinus taeda

(Loblolly pine), P. glabra (Spruce pine), Quercus michauxii (Swamp chestnut oak), Q. nigra

(Water oak), Q. phellos (Willow oak), Q. virginiana, and Tilia americana (American basswood).

Common understory trees, shrubs, and herbaceous plants include Adiantum sp., Bidens alba,

Callicarpa americana (American beautyberry), Celtis occidentalis, Fraxinus americana (White

ash), Hedera sp. (Ivy), Koelreuteriapaniculata (Golden rain tree), Laurocerasus caroliniana,

Ligustrum vulgare (Privet), Mitchella repens (Partridgeberry), Morus rubra (Red mulberry),

Phytolacca americana (American pokeweed), Serenoa repens (Saw palmetto), Smilax bona-nox,

Toxicodendron radicans (Poison ivy), and Viola sp. (Wild violet).









Description of Traps

In this experiment, traps were designed to hold eight pieces of drywall with dimensions 20 cm

x 4 cm (Figure 3-2). Standard drywall sheets, 1.3 cm x 121.9 cm x 243.8 cm (/2 in x 4 ft x 8 ft

sheets) and manufactured in Palatka, Florida (Lafarge), were purchased at a national chain home-

improvement store and cut into strips. The exception was October 2006 when Tough Rock

brand drywall (George Pacific, Atlanta, GA) was purchased. A 12-cm x 4-cm grid consisting of

12 2-cm x 2-cm cells was drawn on the front of each strip. The strips were soaked overnight in

tap water before being placed upright in 20 mm Nalgene UnwireTM test tube racks (250 x 102 x

83 mm) that were modified by removing some partitions. In each rack, the drywall pieces were

oriented so that two pieces were placed along each side. Prior to being placed in the field, the

wet drywall pieces and racks were sterilized for 5 minutes at full power in a 120V microwave

(Frigidaire, Martinez, GA).

In the field, the sterile drywall strips and test tube racks were placed in 4-quart clear plastic

storage boxes (34.3 cm x 20.3 cm x 10.2 cm, Sterilite, Townsend, MA) with drainage holes

drilled 3.2 cm from the base. At each site, five traps were placed along a transect line, 10 m

apart. GPS location data is reported in Appendix A (Table A-i). The drywall strips in each trap

were oriented so that they faced due North, South, East, and West (Figure 3-2). One liter of

sterile tap water was added to each trap when placed in the field. Traps were placed in the field

on the following dates: June 05, Aug 05, Oct 05, Dec 05, Feb 06, May 06, Jun 06, Aug 06, Nov

06, Jan 07, and Apr 07.

Sampling

Each trap was sampled at four and eight weeks, with the exception of the May 06 traps which

were only sampled once. Collection dates are summarized in Appendix A (Table A-2). A

sample from one trap consisted of four drywall pieces, one from each direction. A total of 80









drywall pieces were collected each month. Samples were collected 21 times. In the lab, each

strip of drywall was cut into three pieces using sterile instruments and placed in 100-mm x 20-

mm disposable Petri dishes (Figure 3-3).

Each 2-cm x 2-cm grid was observed at 30x magnification under a dissecting microscope, and

the presence of species of Cladosporium, Alternaria, Epicoccum, Curvularia, Bipolaris,

Dreschlera, and Stachybotrys was recorded. Putative Stachybotrys colonies were isolated,

grown on BBLTM Corn Meal Agar (Becton, Dickson and Co., Sparks, MD) in the dark for 14

days at 240C, and identified at 400x and 1000x based on morphological features as described by

Jong and Davis (1976), with the exception ofS. bisbyi which was identified by tape mounts

(Miller 2001) made directly from the drywall. In order to distinguish between S. chartarum and

S. chlorohalonata, these isolates were inoculated on Czapek yeast autolysate agar (CYA,

Samson et al. 2002), incubated in the dark for 7 days at 240C, and then they were evaluated for

pigment production. Stachybotrys chlorohalonata receives its name from the dark green

pigment it produces on this medium.

Data Analysis

Data from each month were analyzed separately. Abundance was defined as the number of

2-cm x 2-cm squares on a 12-cm x 4-cm grid that contained S. chartarum colonies and was

analyzed as a two-way factorial analysis of variance (ANOVA) to determine effects of location,

direction, and location x direction interaction. When direction and the interaction were not

significant, data were reanalyzed by one-way ANOVA to determine effects of location. P-values

less than 0.10 were considered significant, and in these cases, means were separated by the

Waller-Duncan k-ratio t test. Data were analyzed using SAS statistical software (Version 9.1,

SAS Institute, Cary, NC). Occurrences of species of Cladosporium, Alternaria, Epicoccum,

Dreschlera, Bipolaris, and Curvularia were analyzed in the same fashion, with the exception that









all data for species ofDreschlera, Bipolaris, and Curvularia were combined for statistical

analysis. Approximate colony size was estimated by averaging the number of cells with S.

chartarum growth at each site on each date. Weather information was gathered from the Florida

Automated Weather Network for the Gainesville, FL, weather site which is located

approximately 24 km from the campus sites and 18 km from the hardwood forest site (FAWN

2007).

Results

Stachybotrys chartarum

Over the course of 24 months, 1680 pieces of drywall were placed in the field. Fifteen

pieces were damaged or unable to be recovered and were not included in the statistical analysis.

Stachybotrys chartarum was found on 33 pieces of drywall or 0.02% of the pieces collected.

Four pieces of drywall showed two colonies each of S. chartarum with distinct boundaries, so a

total of 37 colonies were isolated from the field. Stachybotrys chartarum was found during 9 of

the 24 months that traps were in the field: June, July, August, and September 2005, and May,

June, August, September, and December 2006 (Tables 3-1 and 3-2). No S. chartarum was found

on the drywall placed in the field January 17 June 1, 2007. In 2005, S. chartarum occurred in

the citrus grove, the pine grove, and the weedy lakeshore. In 2006, S. chartarum occurred in the

citrus grove, the pine grove, and the hardwood forest. Stachybotrys chartarum was isolated most

frequently from the citrus grove where it occurred during eight different months. Although it

was not recovered from the hardwood forest in 2005, S. chartarum was recovered from that site

in July, August, September, and December 2006. Stachybotrys chartarum was only recovered

twice from the weedy lakeshore and three times from the pine grove during the course of this

two-year study.









Abundance was defined as the number of cells per grid with S. chartarum growing on

them; the maximum value was twelve. Abundance was not significantly affected by the

direction that the drywall faced (N, S, E, W), except for December 2006 (p=0.0558); therefore,

direction was pooled for each month. There was no significant difference in the abundance of S.

chartarum among sites for each month except for September-October 2006 (p=0.0381, Table 3-

4) and December 2006 (p=0.0558, Table 3-4) when the hardwood forest site had significantly

more S. chartarum growing on the drywall pieces than did most other sites. Approximate colony

size is reported in Table 3-5.

Putative S. chartarum colonies that were identified at 30x, but which could not be isolated

in order to confirm their identification, occurred on four pieces. In each case, attempts to isolate

the sample failed because only a few condiophores were found on the piece of drywall. These

minute colonies occurred in July 2005 at the lakeside and pine sites, and in July and August 2006

at the lakeside. These colonies were not included in the statistical analysis because they could

have been S. chlorohalonata.

Additionally, five pieces of drywall had large S. chartarum colonies growing off the grid

(i.e. growing on the ungridded, bottom-third of the strip) that were visible to the naked eye.

These colonies were isolated, grown on CMA and identified as S. chartarum. These isolates

occurred in July 2005 at the citrus and pine sites, September 2005 at the hardwood and citrus

sites, and May and September/October 2006 at the citrus site. These isolates were not used in

the statistical analysis. All of these colonies occurred at months when on-grid colonies were

recovered at the same sites with the exception of the September 2005 recovery of off-grid S.

chartarum from the hardwood site. This off-grid colony was the only S. chartarum recovered

from the hardwood site in 2005.









Average temperature, total rainfall and average relative humidity for each sampling period

are presented in Table 3-6. The majority of S. chartarum isolates were recovered during months

when average daily temperature ranged from 23.6 to 26.90C. Average daily low temperatures

during these months ranged from 16.2 C to 21.60C; average daily high temperatures during these

months ranged from 31.4 C to 34. 1C. The exception to this observation was December 2006

when average daily temperature was 15.3C and S. chartarum was recovered from the hardwood

forest site. All months that S. chartarum was not present on the drywall traps had average

temperatures that fell below these ranges.

Other Stachybotrys species

Stachybotrys chlorohalonata colonies grew on the drywall grid four times during the 2-

year study: citrus in Nov-Dec 2005, lakeside in July 2006, hardwood in Sept-Oct 2006 and citrus

in May 2007 (Table 3-7). This species was never recovered from the pine site. Two colonies of

S. chlorohalonata were visible with the naked eye but did not appear on the grid. These

additional colonies occurred at the citrus site in September 2005 and the hardwood site in August

2006.

Five other species of Stachybotrys were recovered during the 2-year study. Of these, the

two most commonly-occurring species were S. kampalensis and S. bisbyi. Both have unique

morphological characteristics that make them easy to identify. Stachybotrys bisbyi produces

hyaline conidiophores, phialides and conidia, and S. kampalensis produces hyaline phialides but

very dark ellipsoidal spores that usually contain two oil drops (Jong and Davis 1976).

Stachybotrys bisbyi was the second most commonly found Stachybotrys species and was

recovered 31 times (Table 3-8). It was found consecutively from June to September 2005 and

June to December 2006. It was not recovered between January and June 1, 2007. It was found

once at the citrus site (June 2005), twice at the hardwood site (July 2006 twice), and three times









at the pine site (July 2005 twice and August 2005 once). All of the other 25 occurrences were

from the lakeside site. Significantly more S. bisbyi was found at the lakeshore site in September

2005 (p=0.0537), June 2006 (p<0.01), July 2006 (p=0.0668) and August 2006 (p<0.01) than at

the other three sites at those times (Table 3-9).

Stachybotrys kampalensis was identified from colonies on 16 pieces of drywall (Table 3-

10). It was discovered twice at the hardwood site (June and July 2006) and 14 times at the

lakeside site. Stachybotrys kampalensis was not recovered from the pine or citrus sites.

Significantly more S. kampalensis was found at the lakeside site in September 2005 (p<0.01) and

August 2006 (p=0.0393) than was found at the other three sites at those times (Table 3-11).

Additional species of Stachybotrys that were observed include S. albipes (July 2006,

hardwood site), S. nephrospora (July 2006, pine site), and S. parvispora (August 2006,

hardwood site).

Other Genera

The abundance of species of Cladosporium, Alternaria, Epicoccum, Dreschlera, Bipolaris,

and Curvularia is reported in Tables 3-12 to 3-15. All genera showed a significant difference in

abundance among the four sites at different times over 21 months of sampling. The abundance

of Cladosporium spp. and the Dreschlera/Bipolaris/Curvularia spp. group differed significantly

among sites during 15 different months. Epicoccum spp. and Alternaria spp. differed during 13

and 11 months, respectively. There is no apparent seasonal pattern at any site in any of the four

genera groups.

Discussion

Over the course of 24 months, S. chartarum was found growing in all four habitats. It was

predicted that S. chartarum would be the dominant fungus on the drywall, occurring frequently,

in multiple and large colonies. Instead, it was found rarely, on only 0.02% of the pieces









collected. Even if one considers the colonies that grew off-grid, the frequency of S. chartarum

was unexpectedly low. In addition, it was thought that S. chartarum would be more abundant

than observed. Abundance was measured as the number of cells with S. chartarum growth and

reflected both the number of colonies present and the relative size of the colonies. On 4 of 33

pieces of drywall, two colonies were observed; all other pieces had only one colony. With the

exception of the hardwood forest site in September-October 2006, the mean number of cells on

the grid with S. chartarum was less than 1 cell. In part, this is due to the low number of pieces

with S. chartarum growth, but it was also observed that the colony size was relatively small. It

is, therefore, more appropriate to examine the mean number of cells with S. chartarum growth as

an indicator of colony size. Two-thirds of samples (11 of 17), the average colony covered less

than half of the 12-cm x 4-cm grid. It is unclear why the colonies did not dominate the drywall

surface.

Because the frequency of S. chartarum was low, most differences in abundance between

sites were not significant. The only two times that differences in abundance were significant,

more S. chartarum was recovered at the hardwood site than at the other sites. It is unknown

whether a large reservoir of inoculum was present, or if environmental conditions in Sept-Oct

2006 and December 2006 were particularly conducive to rapid growth at that site. The largest

colony size also occurred during the Sept-Oct 2006 sampling period, with the average colony

covering just over 75% of the total grid surface.

It is important to note, however, that S. chartarum was recovered more than once from

each habitat. This is not surprising since 1) S. chartarum has been recovered from a variety of

natural substrates in the past, and 2) its preferred substrate is cellulose which is common at all

four sites. At all sites, S. chartarum was only found during the summer months, which was









anticipated since it is a hydrophilic fungus, and north central Florida typically receives abundant

rainfall during this time. There was no trend in frequency of occurrence at the sites between

years with the exception of the citrus grove where S. chartarum occurred both years from July to

September. Originally, it was thought that the weedy lakeshore might harbor the highest

populations of S. chartarum because the abundance of herbaceous annual plants in this habitat

would supply a ready source of cellulose and the nearby water would keep relative humidity

high. Instead, S. chartarum was recovered most frequently from the citrus grove where plant

diversity was low. This site was included in the study because S. chartarum had been recovered

previously in the area from citrus leaves (J.W. Kimbrough personal communication).

Several recent studies have suggested that S. chartarum spores are not naturally wind

dispersed (Koster 2006, Tucker et al. 2007); thus it is unlikely that the inoculum was transported

over long distances. Most likely the source of the drywall colonies is local; therefore, one can

conclude that S. chartarum is found in a variety of outdoor habitats in north central Florida. If it

is true that these outdoor populations serve as the inoculum for indoor contamination (Koster

2006), then there appear to be multiple reservoirs for mold contamination in natural habitats in

north central Florida.

It is possible that S. chartarum was found less often than expected because unfavorable

environmental conditions at the micro-level prevented viable spores that landed on the traps from

sporulating (i.e. low moisture). If this were true, the traps would have underestimated the

abundance of S. chartarum in each habitat. Water activity (aw) is a measure of the available

water in a substrate (Flannigan and Miller 2001). Stachybotrys chartarum requires a water

activity between 0.91-0.93 for growth and sporulation (Grant et al. 1989) and is characterized as

hydrophilic (Flannigan and Miller 2001). Nielsen et al. (2004) found S. chartarum growing on









drywall only at 95% relative humidity. However, S. chartarum requires a lower minimum water

activity when grown at higher temperatures (Flannigan and Miller 2001). Although each trap

was filled with 1 L sterile water when placed in the field, it was noted that the traps dried out

during periods of low rainfall, so it is possible that moisture was a limiting factor. This idea is

supported by the observation that most S. chartarum isolates were recovered from the citrus

grove which is a managed agricultural site. The traps at this site were near irrigation heads and

received more moisture than the traps at the other three sites. The citrus grove is irrigated year-

round, so the citrus traps also received extra moisture during months when S. chartarum failed to

be recovered at that site. In fact, of the four sampling periods that received the highest total

rainfall, July 2005 (32.7 cm), Nov Dec 2005 (26.6 cm), Feb 2006 (35.1 cm), and April 2006

(24.1 cm), S. chartarum was only recovered during the July 2005 period. Thus while it is

possible that there were isolated incidents where a viable spore was unable to germinate due to

limited moisture, it is unlikely that this was a consistent problem over the 24 months of

sampling.

A positive correlation was seen between S. chartarum occurrence and daily temperature.

With the exception of December 2006, every S. chartarum recovery was during a month with an

average daily temperature above 23C. Average daily low temperatures during these months did

not fall below 16.2C. Average daily high temperatures during these months ranged from 31.4

C to 34.1C. The recovery of S. chartarum from the December 2006 sampling shows that lower

temperatures do not prevent it from sporulating on the drywall. Instead it is likely that the data

accurately reflect that there are more airborne spores of S. chartarum outdoors during warmer

months. A related finding was reported by Billups et al. (1999) who found that S. chartarum was

preferentially recovered from air samples when the plates were incubated at 350C as opposed to









25C. However, it should be noted that the weather data in the present study are general data for

the Gainesville, FL area, and they do not represent conditions that were present at the micro-

level at each trap.

Stachybotrys chlorohalonata was found even more rarely than S. chartarum. This species

was only recently recognized (Andersen et al. 2003) and has been found indoors in conjunction

with S. chartarum. Initial studies have shown that S. chlorohalonata is found less commonly

than S. chartarum indoors (Cruse et al. 2002, Koster et al. 2003, Andersen et al. 2003). This

study is the first to compare population levels of these two species in nature, and it is interesting

that the same trend has been observed. Stachybotrys bisbyi and S. kampalensis were the other

two species most commonly found, and in both cases, significantly more fungal growth was

found at the weedy lakeshore than at the other three sites.

Although this study found less S. chartarum than predicted, the use of drywall traps for

measuring occurrence and frequency of common airborne fungi is a valid technique (Flannigan

and Miller 2001). All of the other selected genera of fungi grew on the drywall traps, and

differences in frequency were seen for all of the other genera measured in this study. Species of

Cladosporium were the dominant drywall colonizers in all 21 months. This is not surprising,

since this genus was also most commonly recovered from other outdoor air samples (Li and

Kendrick 1995, Li et al. 1995, Bishop 2002, Shelton et al. 2002, Baxter et al. 2005).

Ultimately, the results of this study suggest that although S. chartarum is less common

among the outdoor air spora of north-central Florida than had been predicted, it occurs in a

variety of natural and managed habitats, primarily during summer months. Having identified

these habitats, it would be interesting to expand sampling to other habitats to increase our

knowledge about the geographic range of this fungus. It would also be useful to sample a variety









of substrates from these environments to determine if this species prefers a particular substrate.

Caution should be taken during summer months to limit drywall exposure at building sites to

prevent the deposition of S. chartarum spores that could germinate if there is a future water

intrusion in the completed structure.










































Figure 3-1. Study sites in Gainesville, Florida. A) Hardwood forest. B) Citrus grove. C)
Lakeside. D) Pine grove.







































Figure 3-2. Trap design.




































A






,,r




















BFigure 3-3. Trap placement in the field. A) Citrus grove. B) Lakeside.
Figure 3-3. Trap placement in the field. A) Citrus grove. B) Lakeside.


- t-


















































Figure 3-4. Sampling technique.














57










Table 3-1. Frequency of recovery of Stachybotrys chartarum at four sites, 2005.
Month Hardwood Citrus Lakeside Pine
June + +
July + + +
August +
September + +
a Traps in field June 1, 2005 December 17, 2005. No S. chartarum was recovered during
months not shown in table.
b + = present; = absent.
c Stachybotrys chartarum occurred in the Hardwood forest on one piece in September; however,
the colony was located below the grid.

Table 3-2. Frequency of recovery of Stachybotrys chartarum at four sites, 2006.
Month Hardwood Citrus Lakeside Pine
May +
July + + +
August + +
Sept- Oct + +
December +
a Traps in field December 20, 2005 January 6, 2007. No S. chartarum was recovered during
months not shown in table.
b + = present; = absent.

Table 3-3. Abundance of Stachybotrys chartarum at four sites, 2005.
Month Hardwood Citrus Lakeside Pine
June 0.00a 0.13 0.00 0.05
July 0.00 0.25 0.85 0.70
August 0.00 0.45 0.00 0.00
September 0.00 0.90 0.45 0.00
a Data are means of 20 observations (5 replicates pooled across 4 directions). Data are mean
numbers of cells in sampling grid. Max value = 12 cells per sample with fungus present. There
were no significant differences (p<0.10) among locations in any month.

Table 3-4. Abundance of Stachybotrys chartarum at four sites, 2006.
Month Hardwood Citrus Lakeside Pine
May 0.00a 0.10 0.00 0.00
June 0.00 0.00 0.00 0.00
July 0.30 0.13 0.00 0.05
August 0.40 0.40 0.00 0.00
Sept-Oct 2.06a 0.90ab 0.OOb 0.OOb
December 0.10a 0.OOb 0.0b 0.OOb
a Data are means of 20 observations (5 replicates pooled across 4 directions). Data are mean
numbers of cells in sampling grid. Max value = 12 cells per sample with fungus present. Means
in rows followed by the same letter do not differ (p test. No letters in row indicate no differences at p









Table 3-5. Colony size determined as average number of sampled drywall cells with
Stachybotrys chartarum growth.
Date Location Number of cells
June 2005 Citrus 1.0
June 2005 Pine 1.0
July 2005 Citrus 2.0
July 2005 Lakeside 5.7
July 2005 Pine 7.0
August 2005 Citrus 9.0
September 2005 Citrus 6.0
September 2005 Lakeside 4.5
May 2006 Citrus 2.0
July 2006 Hardwood 6.0
July 2006 Citrus 2.0
July 2006 Pine 1.0
August 2006 Hardwood 8.0
August 2006 Citrus 4.0
Sept Oct 2006 Hardwood 9.3
Sept Oct 2006 Citrus 4.3
December 2006 Hardwood 1.0
a Means represent the total number of cells with S. chartarum growth divided by the total number
of infested drywall pieces at each site on each sampling date.





Table 3-6. Weather data June 2005 to May 2007.
Date Average daily temp Low temp
June 2005 25.2 21.0
July 2005 26.2 21.6
August 2005 26.5 22.2
September 2005 26.0 21.3
Oct Nov 2005 17.3 10.3
Nov Dec 2005 15.4 8.4
January 2006 12.8 5.2
February 2006 12.0 4.2
March 2006 16.6 8.1
April 2006 17.8 9.8
May 2006 23.6 16.2
June 2006 25.2 18.5
July 2006 25.8 19.3
August 2006 26.9 21.2
Sept Oct 2006 24.7 18.2
November 2006 14.7 7.9
December 2006 15.3 8.8
Jan Feb 2007 10.9 3.5
March 2007 12.9 4.9
April 2007 18.4 9.4
May 2007 20.1 11.5


High temp
31.4
32.4
33.7
33.0
25.7
23.4
21.0
20.2
25.1
26.1
31.6
32.7
33.5
34.1
32.3
22.7
22.8
18.6
21.1
27.1
28.6


Rainfall
15.8
32.7
11.7
11.7
3.3
26.6
9.6
35.1
19.8
24.1
5.2
14.5
20.2
7.4
14.2
2.3
16.5
6.5
10.5
3.2
8.9


Note: Weather data were generated at the
(http://fawn.ifas.ufl.edu/).


Alachua, Florida weather station


% Relative humidity
80.7
79.9
82.1
79.5
76.7
76.7
74.2
72.4
67.7
69.3
68.6
73.3
73.8
75.3
74.1
74.9
77.1
67.0
66.0
60.6
63.0










Table 3-7. Frequency of recovery of Stachybotrys chlorohalonata, June 2005 to May 2007, at
four sites.
Datea Hardwood Citrus Lakeside Pine
September 2005 b c
Nov-Dec 2005 +
July 2006 +
August 2006
Sept-Oct 2006 +
May 2007 +
a Traps in field June 1, 2005 June 1, 2007. No S. chlorohalonata was recovered from the grid
during months not shown in table.
b + = present; = absent.
S. chlorohalonata occurred twice off-grid, September 2005 at the citrus site and August 2006 at
the hardwood site.










Table 3-8. Frequency of recovery of Stachybotrys bisbyi, June 2005 to May 2007, at four sites.
Datea Hardwood Citrus Lakeside Pine
June 2005 +
July 2005 -+ +
August 2005 -+ +
September 2005 -- +
June 2006 -- +
July 2006 + +
August 2006 +
Sept-Oct 2006 +
November 2006 +
December 2006 +
a Traps in field June 1, 2005 June 1, 2007. No S. bisbyi was recovered during months not
shown in table.
b + = present; = absent.

Table 3-9. Abundance of Stachybotrys bisbyi, June 2005 to May 2007, at four sites.
Date Hardwood Citrus Lakeside Pine
June 2005 0.00a 0.10 0.00 0.00
July 2005 0.00 0.00 0.30 0.45
August 2005 0.00 0.00 0.60 0.15
September 2005 0.OOb 0.OOb 0.40a 0.OOb
June 2006 0.OOb 0.OOb 0.40a 0.OOb
July 2006 0.30ab 0.OOb 0.55a 0.OOb
August 2006 0.OOb 0.OOb 1.00a 0.OOb
Sept-Oct 2006 0.00 0.00 0.15 0.00
November 2006 0.00 0.00 0.40 0.00
December 2006 0.00 0.00 0.20 0.00
a Data are means of 20 observations (5 replicates pooled across 4 directions). Data are mean
numbers of cells in sampling grid. Max value = 12 cells per sample with fungus present. Means
in rows followed by the different letters differ significantly (p<0.10) according to Waller-Duncan
k-ratio t-test. No letters in row indicate no differences at p<0.10.










Table 3-10. Frequency of recovery of Stachybotrys kampalensis, June 2005 to May 2007, at four
sites.
Datea Hardwood Citrus Lakeside Pine
September 2005 -b +
June 2006 +
July 2006 + +
August 2006 -- +
Sept-Oct 2006 -- +
December 2006 +
a Traps in field June 1, 2005 June 1, 2007. No S. kampalensis was recovered during months
not shown in table.
b + = present; = absent

Table 3-11. Abundance of Stachybotrys kampalensis, June 2005 to May 2007, at four sites.
Date Hardwood Citrus Lakeside Pine
September 2005 0.OOba 0.00b 0.75a 0.OOb
June 2006 0.25 0.00 0.00 0.00
July 2006 0.15 0.00 0.35 0.00
August 2006 0.OOb 0.OOb 0.20a 0.OOb
Sept-Oct 2006 0.00 0.00 0.10 0.00
December 2006 0.00 0.00 0.10 0.00
a Data are means of 20 observations (5 replicates pooled across 4 directions). Data are mean
numbers of cells in sampling grid. Max value = 12 cells per sample with fungus present. Means
in rows followed by the different letters differ significantly (p<0.05) according to Waller-Duncan
k-ratio t-test. No letters in row indicate no differences at p<0.10.











Table 3-12. Abundance of Cladosporium spp., June 2005


Date
June 2005
July 2005
August 2005
September 2005
Oct-Nov 2005
Nov-Dec 2005
January 2006
February 2006
March 2006
April 2006
May 2006
June 2006
July 2006
August 2006
Sept-Oct 2006
November 2006
December 2006
Jan-Feb 2007
March 2007
April 2007
May 2007


Hardwood
7.45ba
4.90b
0.65b
0.45c
7.55ab
8.90b
9.75a
10.95a
10.85a
11.58a
7.80b
11.40a
10.40b
8.65b
5.94c
12.00a
11.70a
10.00a
10.75a
9.80b
10.85b


Citrus
9.69a
8.88a
1.50b
1.90b
8.95a
6.45c
9.80a
9.40b
9.95a
11.50a
9.90a
11.70a
12.00a
6.90c
6.50bc
12.00a
11.90a
9.85a
10.60a
11.40a
11.15b


Lakeside
6.05b
4.60b
1.75b
1.30bc
8.50a
9.75b
10.15a
11.10a
11.40a
12.00a
11.20a
11.55a
11.85a
8.15bc
7.85b
11.95a
11.80a
10.00a
10.90a
5.65c
11.80a


to May 2007,
Pine
9.95a
8.65a
6.65a
4.70a
6.25b
11.95a
1.95b
11.80a
10.55a
11.70a
10.15a
11.60a
12.00a
11.15a
10.30a
12.00a
11.60a
4.55b
10.10a
0.40d
12.00a


a Data are means of 20 observations (5 replicates pooled across 4 directions). Data are mean
numbers of cells in sampling grid. Max value = 12 cells per sample with fungus present. Means
in rows followed by the different letters differ significantly (p<0.10) according to Waller-Duncan
k-ratio t-test.


at four sites.
p-value
<0.0001
<0.0001
<0.0001
<0.0001
0.03
<0.0001
<0.0001
<0.0001
0.25
0.13
0.0008
0.88
<0.0001
0.0002
<0.0001
0.40
0.32
<0.0001
0.11
<0.0001
<0.0001










Table 3-13. Abundance ofAlternaria spp., June 2005 to May 2007, at four sites.
Date Hardwood Citrus Lakeside Pine p-value
June 2005 4.60aa 5.94a 4.30a 5.70a 0.58
July 2005 4.35a 4.50a 3.90a 4.40a 0.96
August 2005 0.05b 0.90ab 0.35b 1.60a 0.0048
September 2005 0.40a 0.65a 0.15a 0.20a 0.39
Oct-Nov 2005 0.05a 0.05a 0.OOa 0.OOa 0.59
Nov-Dec 2005 0.15b 0.OOb 0.OOb 0.75a 0.020
January 2006 0.OOb 0.50a 0.05b 0.OOb 0.0013
February 2006 0.10b 1.40a 0.OOb 0.OOb <0.0001
March 2006 0.45b 0.55b 0.60b 2.05a 0.030
April 2006 0.74a 0.65ab 1.10a 0.05b 0.016
May 2006 0.05a 0.85a 0.55a 0.55a 0.33
June 2006 3.65a 2.10b 2.50b 0.20c <0.0001
July 2006 4.45a 0.19c 0.40bc 1.10b <0.0001
August 2006 1.05a 0.70a 0.90a 0.25a 0.21
Sept-Oct 2006 2.33a 0.OOb 0.20b 0.OOb <0.0001
November 2006 7.40ab 8.85a 5.65b 9.00a 0.058
December 2006 6.65a 6.00a 5.60a 5.40a 0.85
Jan-Feb 2007 0.10a 0.OOa 0.15a 0.OOa 0.24
March 2007 0.25a 0.45a 0.60a 0.OOa 0.14
April 2007 0.OOb 0.80a 0.05b 0.OOb <0.0001
May 2007 0.75a 0.60a 0.50a 0.35a 0.80
a Data are means of 20 observations (5 replicates pooled across 4 directions). Data are mean
numbers of cells in sampling grid. Max value = 12 cells per sample with fungus present. Means
in rows followed by the different letters differ significantly (p<0.10) according to Waller-Duncan
k-ratio t-test.











Table 3-14. Abundance ofEpicoccum spp., June 2005 to May 2007, at four sites.


Date
June 2005
July 2005
August 2005
September 2005
Oct-Nov 2005
Nov-Dec 2005
January 2006
February 2006
March 2006
April 2006
May 2006
June 2006
July 2006
August 2006
Sept-Oct 2006
November 2006
December 2006
Jan-Feb 2007
March 2007
April 2007
May 2007


Hardwood
0.60ba
0.05b
0.OOa
0.00
0.OOa
0.55a
0.050b
1.80a
0.15b
1.58ab
0.10
1.40ab
1.60a
0.00
0.00
3.00a
2.95b
0.15a
1.05a
0.OOb
3.50a


a Data are means of 20 observation


Citrus Lakeside Pine p-value
3.63a 0.85b 3.75a <0.001
1.88a 1.05a 1.20a 0.0011
0.OOa 0.050a 0.OOa 0.40
0.00 0.00 0.00 N/A
0.05a 0.OOa 0.OOa 0.40
0.050b 0.OOb 0.50a 0.012
1.60a 0.050b 0.OOb <0.0001
0.45b 0.85b 0.85b 0.017
1.35b 1.40b 2.95a 0.0013
1.75a 0.70bc 0.OOc 0.0006
0.75 0.80 0.00 0.089
2.60a 0.95bc 0.05c 0.0024
1.38a 0.65a 0.70a 0.13
0.00 0.00 0.00 N/A
0.00 0.00 0.00 N/A
3.60a 3.40a 2.80a 0.73
1.80c 1.80c 4.75a <0.0001
0.OOa 0.50a 0.OOa 0.1031
1.05a 0.55ab 0.OOb 0.0040
3.20a 0.050b 0.OOb <0.0001
1.05c 2.15b 0.05c <0.0001
ns (5 replicates pooled across 4 directions). Data are mean


numbers of cells in sampling grid. Max value = 12 cells per sample with fungus present. Means
in rows followed by the different letters differ significantly (p<0.10) according to Waller-Duncan
k-ratio t-test.










Table 3-15. Abundance of Bipolaris, Drechslera, Curvularia spp.complex, June 2005 to May
2007, at four sites.
Date Hardwood Citrus Lakeside Pine p-value
June 2005 2.20ba 4.69a 4.25a 5.05a 0.014
July 2005 1.30a 0.50a 1.30a 1.15a 0.40
August 2005 2.50b 6.65a 3.25b 8.00a <0.0001
September 2005 2.15b 3.35a 1.60b 1.20b 0.0032
Oct-Nov 2005 0.20b 0.85a 0.OOb 0.OOb 0.0006
Nov-Dec 2005 1.85b 0.75c 1.15bc 3.35a <0.0001
January 2006 0.OOb 0.55a 0.OOb 0.OOb 0.0014
February 2006 0.OOb 1.25a 0.OOb 0.OOb <0.0001
March 2006 0.25a 0.35a 0.50a 0.65a 0.63
April 2006 0.95a 0.40bc 0.45b 0.OOc 0.006
May 2006 0.OOa 0.050a 0.25a 0.OOa 0.29
June 2006 3.85a 1.85b 3.20a 0.OOc <0.0001
July 2006 2.30a 0.13b 0.85b 2.45a <0.0001
August 2006 6.30ab 5.30b 6.80a 2.00c <0.0001
Sept-Oct 2006 5.28a 1.80b 4.30a 0.50c <0.0001
November 2006 6.00a 5.80a 6.75a 5.05a 0.31
December 2006 7.60b 8.25b 7.75b 9.70a 0.0063
Jan-Feb 2007 0.15a 0.OOa 0.OOa 0.OOa 0.15
March 2007 0.20b 0.70a 0.10b 0.OOb 0.0064
April 2007 0.OOb 0.25a 0.OOb 0.OOb 0.0096
May 2007 0.20a 0.15a 0.30a 0.OOa 0.29
a Data are means of 20 observations (5 replicates pooled across 4 directions). Data are mean
numbers of cells in sampling grid. Max value = 12 cells per sample with fungus present. Means
in rows followed by the different letters differ significantly (p<0.10) according to Waller-Duncan
k-ratio t-test.









CHAPTER 4
IDENTIFICATION OF PUTATIVE Stachybotrys chartarum ISOLATES FROM NORTH-
CENTRAL FLORIDA HABITATS

Introduction

In the 1930s, Ukrainian horses faced a microscopic nemesis that threatened their

usefulness in the Soviet cavalry. They were fed contaminated hay and fell ill; some eventually

died. Russian scientists identified the causal agent as a black mold, Stachybotrys chartarum

(Ehrenberg ex Link) Hughes, and they named the disease "stachybotryotoxicosis" (Hintikka

1978b). Sixty years later, doctors in Cleveland, Ohio questioned if an unexplained surge in

infant deaths caused by bleeding of the lungs was due to the inhalation of toxic spores of the

same fungus (Dearborn et al. 1999, Etzel et al. 1998). Although a connection was not

conclusively proven, the health consequences of exposure to S. chartarum remain of great

interest to physicians and the public alike.

An efficient cellulolytic degrader, this fungus is found indoors on building materials such

as drywall, a major component of modern structures. Requiring high humidity for growth and

sporulation, S. chartarum is particularly problematic in water-damaged structures. With the

current public interest in indoor air pollution and "toxic mold", combined with the active 2004

and 2005 hurricane seasons in the United States, S. chartarum has remained at the forefront of

mycological research (Kuhn et al. 2005, Li and Yang 2005, Koster 2006, Tucker et al. 2007).

Stachybotrys chartarum is known to produce several classes of mycotoxins, including

trichothecenes, spirocyclic drimanes, hemolysin, and atranones (Jarvis et al. 1995, Jarvis 2003,

Vesper et al. 2001). Trichothecenes are a class of sesquiterpenes that inhibit protein synthesis

and include the well-known T-2 toxin produced by Fusarium spp. As a group, they are

considered to be among the most important and acutely toxic of known mycotoxins (Jarvis

2003). In addition to many simple trichothecenes, S. chartarum produces macrocyclic









trichothecenes, including satratoxin G which Yang et al. (2000) reports to be more toxic to

mammalian cells than T-2 toxin. In contrast, atranones have not been shown to possess

significant biological activity to humans (Jarvis 2003).

As researchers worked to identify and characterize these S. chartarum metabolites, they

repeatedly found variation in levels of toxin production among S. chartarum isolates (Jarvis et al.

1998, Ruotsalainen et al. 1998, Vesper et al. 1999, Elanskii et al. 2004). Randomly amplified

polymorphic DNA (RAPD) analysis also showed variation among isolates (Vesper et al. 1999,

Peltola et al. 2002) as did phylogenetic analysis of protein-coding genes (Andersen et al. 2002,

Cruse et al. 2002, Andersen et al. 2003, Koster et al. 2003). Ultimately, the morphological

species S. chartarum was recognized as three phylogenetic taxa (Stachybotrys chlorohalonata

Andersen & Thrane, S. chartarum chemotype S and S. chartarum chemotype A) based on a

combination of morphological, chemical, and molecular characteristics (Andersen et al. 2003).

Stachybotrys chlorohalonata is similar to S. chartarum morphologically. Conidiophores

and phialids are similar in appearance, but S. chlorohalonta conidiophores and phialids are

shorter, and S. chlorhalonata produces smooth spores while S. chartarum spores are rough

(Andersen et al. 2003). In addition, S. chlorohalonata is named for the unique, green

extracellular pigment it produces on Czapek Yeast Agar. Stachybotrys chlorohalonata isolates

produce atranones and dolabellanes; they do not produce macrocyclic tricothecenes such as

satratoxins or roridins (Andersen et al. 2002, 2003).

Stachybotrys chartarum chemotypes S and A are identical morphologically, but each

produces a different set of toxins (Andersen et al. 2002, 2003). Stachybotrys chartarum

chemotype S produces macrocyclic trichothecenes but no atranones, while S. chartarum

chemotype A produces atranones but no macrocyclic trichothecenes (as does S. chlorohalonata).









These fungi must be identified based on differences in their toxological and/or molecular

characteristics. It is crucial to differentiate between the two chemotypes because only S.

chartarum chemotype S produces the highly-toxic macrocyclic trichothecenes. Genes that are

currently known to distinguish between the two chemotypes are chitin synthase 1 and trichodiene

synthase 5 (Cruse et al. 2002, Andersen et al. 2003). To date, neither S. chartarum chemotype A

nor S. chartarum chemotype S has been conclusively identified as S. chartarum sensu strict,

nor has a new species been erected to accommodate the second chemotype.

The majority of the isolates (-90%) used in past phylogenetic studies were collected

indoors (Andersen et al. 2002, 2003, Cruse et al. 2002, Koster et al. 2003). All of these studies

included geographically diverse populations of S. chartarum chemotype A, S. chartarum

chemotype S, and S. chlorohalonata. No study appears to have included multiple isolates from

one location collected over a period of time. Andersen et al. (2002, 2003) and Koster et al.

(2003) did not include any Florida isolates of S. chartarum sensu lato in their studies. Cruse et

al. (2002) included a single isolate from Florida among the 30 isolates in his study, and this

isolate was determined to belong to the new species, S. chlorohalonata.

This is the first study to use outdoor samples exclusively and the first to include multiple

isolates from Florida, a state with environmental conditions that are conducive to mold growth.

Most importantly, since the two chemotypes have different biochemical profiles, this study will

also provide important toxicological data regarding the outdoor populations of S. chartarum in

north central Florida. It is important to know which chemotype of S. chartarum is most

prevalent in nature for reasons that range from public health to planning of building projects.









Materials and Methods


Preparation of Fungal Isolates

Forty-three putative environmental samples of S. chartarum were isolated from drywall

that had been placed outdoors in Gainesville, Florida, USA (Chapter 3). Drywall traps were

placed in four habitats, a managed citrus grove, a pine grove, a weedy lakeshore and a mature

hardwood forest, for a period of one to two months. One sample, isolate # 52, was isolated from

drywall from a Gainesville, Florida apartment with a history of water leaks, for a total of 44

Florida isolates (Table 4-1). Six isolates used in previous studies were obtained from the IBT

culture collection at BioCentrum-DTU, Denmark: S. chlorohalonata IBT 9825 and IBT 40292,

S. chartarum chemtotype A IBT 9290 and IBT 14915, and S. chartarum chemotype S IBT 7711

and IBT 40293 (Andersen et al. 2003).

Florida samples were tentatively identified as S. chartarum at 400x and 1000x based on

morphological features as described by Jong and Davis (1976). Pure cultures were single-spored

and maintained on DifcoTM Potato Dextrose Agar plates (Becton, Dickinson and Co., Sparks,

MD). Mycelium for DNA extraction was grown at 220C in 50 mL of yeast extract broth (20 g

glucose, 10 g yeast extract, 2 g peptone per 1 liter water) as described by Cruse et al. (2002).

After three days, mycelium was collected by vacuum filtration, frozen in liquid nitrogen and

lyophilized. In addition, all Florida isolates were inoculated on Czapek Yeast Autolysate Agar

(CYA, Samson et al. 2002) and incubated in the dark for seven days at 240C at which point they

were evaluated for pigment production. Proxy isolates were deposited at the University of

Florida Mycological Herbarium.

DNA Extraction, PCR Amplification, and Sequencing

Lyophilized mycelium was manually disrupted using a metal spatula. DNA was extracted

using the DNeasy Plant Mini Kit (Qiagen, Valencia, California) and stored at -200C.









Primer sequences for the trichodiene synthase 5 (tri5) and chitin synthase 1 (chsl) gene

fragments were obtained from Cruse et al. (2002). The tri5 5' primer was 5'-

CATCAATCCAACAGTTTCAC-3'. The tri5 3' primer was 5'-

GCAACCTTCAAAGACTATTG-3'. The chs] 5' primer was 5'-

ATCTCACCACAAGCACCGCCACACA-3'. The chs] 3' primer was 5'-

GGAAGAAGATCGTTGTGTGCGTGGT-3'. The loci were amplified in 50 [tL polymerase

chain reactions (PCR) in a PTC-200 Peltier Thermal cycler (Bio-Rad Laboratories, Inc.,

Hercules, California) using Invitrogen reagents (Carlsbad, CA, USA). Each reaction contained 5

ItL of 10x Taq buffer, 1.5 [iL of 50 mM MgC12, 1 [iL of 10 mM dNTPs, 1 [iL each of 10 mM

forward and reverse primers, 0.25 [iL of Taq polymerase and 2 [iL of template DNA. PCR

conditions for tri5 amplification were as follows: 94C for 4 min, 35 cycles at 940C for 1 min,

51C for 1 min and 72C for 1 min, with a final extension of 72C for 4 min (Koster et al. 2003).

PCR conditions for chs] amplification were identical with the exception of an annealing

temperature of 61C. PCR products were visualized on a 1% agarose gel before being submitted

for sequencing.

Sequencing of the DNA sample was done at the University of Florida DNA Sequencing

Core Laboratory using ABI Prism BigDye Terminator cycle sequencing protocols (part number

4303153) developed by Applied Biosystems (Perkin-Elmer Corp., Foster City, CA). The excess

dye-labeled terminators were removed using MultoScreen 96-well filtration system (Millipore,

Bedford, MA). The purified extension products were dried in SpeedVac (ThermoSavant,

Holbrook, NY) and then suspended in Hi-di formamide. Sequencing reactions were performed

using POP-7 sieving matrix on 50-cm capillaries in an ABI Prism 3130 Genetic Analyzer









(Applied Biosystems, Foster City, CA) and were analyzed by ABI Sequencing Analysis software

v. 5.2 and KB Basecaller.

Phylogenetic Analysis

Forward and reverse sequences obtained from the tri5 and chs] primers were combined

using Sequencher version 4.5 (Gene Codes Corporation, Ann Arbor, MI, USA), and only bases

sequenced in both directions were included. The exceptions were isolate 27 for which only the

chs] forward sequence was obtained and isolate 20 for which only a chs] reverse sequence was

obtained. Two sequences from GenBank were included, S. charatarum AF468154 and S.

chartarum AF 468155 (Cruse et al. 2002). Sequences were aligned in ClustalX version 1.83.1

using the default settings before being manually corrected in MacClade 4. The aligned

sequences were exported as NEXUS files and analyzed using PAUP version 4.0b 10.

Phylogenetic trees for each locus were constructed with neighbor-joining (Saitou and Nei 1987)

using default settings. Ties, if encountered, were broken randomly. Distance bootstrap values

were determined using neighbor-joining with 100,000 replications.

Results

Of the 44 Florida isolates, six produced a dark green extracellular pigment on CYA, and

eight other isolates produced an orange pigment. The remaining 30 isolates produced no

pigment. (Figure 4-1, Table 4-2). Eight of the 11 isolates (73%) that were identified through

sequencing as S. chartarum chemotype S produced orange pigment; three produced no pigment.

None of the S. chartarum chemotype A isolates produced extracellular pigment on CYA.

The tri 5 sequence is 485 base pairs with 29 informative characters, and the chs 1 sequence

is 297 base pairs with 12 informative characters. Sequence data have been submitted to Genbank

(Table 4-3, Table 4-4); aligments are reported in Appendix B. Both the tri5 and the chs]

neighbor-joining trees separate the majority of the isolates into three clades that correspond with









the taxa/chemotypes S. chlorohalonata, S. chartarum chemotype A, and S. chartarum chemotype

S (Figures 4-2 and 4-3). At both loci, there are multiple base pair differences between the S.

chlorohalonata and the S. chartarum clades resulting in strong bootstrap support. In the case of

the two S. chartarum clades, there is only a one nucleotide difference between the sequences at

each locus that resulted in weaker bootstrap support. The difference in the tri 5 sequence is at

base pair 278 where S. chartarum chemotype A has a thymine and S. chartarum chemotype S

has a cytosine. The difference in the chs 1 sequence is at base pair 18 where S. chartarum

chemotype A has a thymine and S. chartarum chemotype S has a guanine.

The two trees have similar topologies with the exception of isolate #1, which groups with

the S. chartarum chemotype S clade in the chs 1 tree and the S. chartarum chemotype A clade in

the tri 5 tree. This incongruence is due to a reversal of the nucleotide substitution at these loci.

In addition the placement of isolate #41 is unresolved in the chs 1 tree because it was not

determined during sequencing if base pair 18 was a guanine or a thymine. In the tri 5 tree, this

isolate groups with the chemotype A clade. Two Florida isolates, isolates #12 and 46, as well as

isolates ITB7711 and ITB40293 from Andersen et al. (2003), are unresolved in the tri 5 tree and

group as a sister clade to the two S. chartarum chemotypes. However, when the sequence data

are examined, it is apparent that they should group with S. chartarum chemotype S clade because

they all have a cytosine base at position 278. Their placement is unresolved because these

isolates have a cytosine base at position 290 in common with the S. chartarum chemotype A

clade, while the other S. chartarum chemotype S isolates have a thymine base at this position.

The tri 5 tree also shows the S. chartarum chemotype A clade and the S. chlorohalonata clade as

each containing sister clades. These additional clades are also due to a one nucleotide

substitution, at base pair position 480 and 116, respectively.









The one indoor isolate was identified as S. chartarum chemotype A. Of the 43 outdoor

isolates, 6 were S. chlorohalonata (14%), 11 were S. chartarum chemotype S (26%), and 26

were S. chartarum chemotype A (60%). If only the S. chartarum isolates were considered, 70%

were chemotype A (26 of 37 isolates) and 30% were chemotype S (11 of 37 isolates). The

chemotype A isolates were recovered from all four habitats over the course of two years.

However, 8 of the 11 chemotype S isolates were recovered from the hardwood site, and all were

recovered in either September or October 2006 from the same replicate (Table 4-1).

Discussion

Extracellular pigment production and molecular analyses of suspected isolates of S.

chartarum sensu lato are necessary to differentiate among S. chlorohalonata, S. chartarum

chemotype S, and S. chartarum chemotype A. This study confirms that S. chlorohalonata can be

identified accurately by production of a dark green extracellular pigment on CYA (Andersen et

al. 2003). All of the isolates that produced this pigment also fell into the S. chlorohalonata clade

in the phylogenetic analysis. Researchers have remarked on the difficulty of distinguishing

between S. chlorohalonata and S. chartarum isolates based on morphological characteristics

alone (Li and Yang 2005, Koster 2006). In the present study, it was not possible to consistently

identify isolates of S. chlorohalonata using oil immersion (1000x magnification), and pigment

production and DNA sequencing were used for identification. Given the time and expense of

preparing a sample for DNA sequencing and the reliability of the pigment test on CYA, it is

recommended that all putative S. chartarum isolates be screened on CYA.

Seventy-three percent of the S. chartarum chemotype S isolates produced a yellow-orange

pigment on CYA. This is a much higher percentage than observed by Andersen et al. (2003),

who found only three of nine S. chartarum chemotype S isolates produced a yellow-orange

pigment. However, these results still suggest that extracellular pigment production cannot be









used alone as a method to differentiate between S. chartarum chemotypes S and A. While an

isolate that produces orange pigment on CYA can be identified confidently as S. chartarum

chemotype S, lack of pigment would require further testing for identification purposes. It should

also be noted that one pigment-producing isolate, isolate #1, was incongruent between the two

loci in the phylogenetic analysis. Andersen et al. (2003) reported a similar situation from a non-

pigment producing isolate and used metabolite production to confirm its identification. In this

case, pigment production was able to confirm that isolate #1 was S. chartarum chemotype S.

However, these examples illustrate the challenge of using sequence data with only a single

nucleotide substitution, as do the cases of isolates #12, 41 and 46, all of which were unable to be

placed into either S. chartarum clade in one of the two trees.

Generally speaking, sequence analysis of both gene fragments used in this study

successfully differentiated between the two chemotypes. However, as a diagnostic tool, neither

locus was 100% accurate, and final identification relied on information from both loci plus

pigment production. Additional loci, hopefully with more than one nucleotide substitution

between the two chemotypes, should be identified if sequencing is to be widely used. Other

species-specific molecular primers for use in PCR assays have been designed for the purpose of

identifying S. chartarum from indoor samples; however, none of these authors differentiated

between S. chlorohalonata and the two S. chartarum chemotypes (Haugland and Heckman 1998,

Haugland et al. 1999, Cruz-Perez et al. 2001, Dean et al. 2005). An alternative molecular

technique is amplified fragment length polymorphism (AFLP) fingerprinting, which Koster

(2006) successfully used to study intraspecific genetic variation among S. chartarum isolates.

This technique could be developed into a diagnostic tool, as could measurement of metabolite

production.









Previous studies that have used DNA sequencing to identify S. chlorohalonata and

chemotypes of S. chartarum have looked primarily at indoor isolates from diverse geographic

origins. Andersen et al. (2002) examined isolates of which the majority were collected from

buildings in Europe and the United States; approximately 20% of the 122 isolates were identified

as S. chlorohalonata, 49% as S. chartarum chemotype A, and 31% as S. chartarum chemotype

S. Cruse et al. (2002) examined 30 isolates collected primarily in northern California;

approximately 23% were S. chlorohalonata, 47% were S. chartarum chemotype S and 30% were

S. chartarum chemotype A. While the exact distribution of isolates among the three taxa varied

between the two studies, these studies as well as another (Koster 2006) found no correlation

between genetic isolation and geographic distance.

In this study, the same four habitats were repeatedly sampled in order to accumulate a

collection that accurately reflected the population distribution of the two chemotypes in natural

settings in north central Florida. A previous study of isolates sampled within a restricted

geographical region found genome-wide genetic variation (Koster 2006). Fourteen percent of

the outdoor isolates in the present study were identified as S. chlorohalonata, 60% as S.

chartarum chemotype A and 26% as S. chartarum chemotype S. It should be noted that 8 of the

11 S. chartarum chemotype S isolates were recovered from the hardwood site, and all were

recovered in either Sept or Oct 2006 from the same trap. It is likely that a single source of

inoculum was responsible for all of these isolates, in which case, the occurrence of S. chartarum

chemotype S would be even less than suggested by the results of this study. Thus, while all three

taxa are present in north central Florida habitats, this study recovered fewer macrocyclic

trichothecene-producing isolates (S. chartarum chemotype S) than non-macrocyclic









trichothecene producers. It is unknown why S. chartarum chemotype A was the clade most

commonly recovered.

Koster (2006) hypothesizes that outdoor sources of S. chartarum serve as reservoirs of

inoculum for indoor contamination. If this is true, then the present study suggests that S.

chartarum chemotype A would also be found more commonly indoors than S. chartarum

chemotype S in north central Florida. This may have a positive implication for public health

since S. chartarum chemotype A does not produce macrocyclic tricothecenes. Further research

should compare the distribution of S. chlorohalonata and S. chartarum chemotypes in outdoor

and indoor environments of close proximity.
























Figure 4-1. Extracellular pigmentation on Czapek yeast autolysate agar (CYA). A) S.
chlorohalonata with green pigmentation. B) S. chartarum chemtoype S with orange
pigmentation. C) S. chartarum chemotype A with no pigmentation.






















































2 Lakeside
6 Citrus
26 Lakeside
3 Lakeside
30 Hardwood
AF468159
5 Citrus
- 0.0005 substitutions/site


47 Citrus
22 Citrus
34 Citrus
36 Citrus
16 Citrus
56 Pine
23 Citrus
14 Pine
20 Citrus
10 Lakeside
48 Citrus
4 Citrus
9 Lakeside
4 50 Hardwood
13 Citrus
52 Indoor
24 Citrus
31 Citrus
17 Lakeside
18 Lakeside
4 21 Citrus
15 Lakeside
19 Citrus
IBT14915
8 Citrus
11 Citrus
42 Pine
AF468158
-41 Citrus
46 Pine
1 Lakeside
27 Hardwood
28 Hardwood
49 Hardwood
29 Hardwood
12 Pine
32 Hardwood
33 Hardwood
IBT7711
35 Hardwood
25 Hardwood


S. chartarum
chemotype A






















S. chartarum
chemotype S


S. chlorohalonata


Figure 4-2. Neighbor-joining tree for chs 1 gene for Stachybotrys chartarum and S.
chlorohalonata outdoor isolates. Numbers above branches are bootstrap percentages.
AF 468158 and AF 468159 are Genbank sequences published by Cruse et al. (2002).
IBT 14915 and IBT 7711 are isolates from Andersen et al. (2003).











48 Citrus
41 Citrus
34 Citrus
24 Citrus
36 Citrus
14 Pine
56 Pine
52 Indoor
15 Lakeside
4 Citrus
13 Citrus
50 Hardwood
19 Citrus
11 Citrus
23 Citrus
63 8 Citrus
42 Pine
10 Lakeside
31 Citrus
17 Lakeside
47 Citrus
ITB14915
18 Lakeside
1 Lakeside
9 Lakeside
22 Citrus
AF46815
16 Citrus
20 Citrus
21 Citrus
ITB7711
46 Pine
12 Pine
ITB40293
33 Hardwood
32 Hardwood
35 Hardwood
60 29 Hardwood
25 Hardwood
49 Hardwood
28 Hardwood
27 Hardwood
2 Lakeside
65 3 Lakeside
5 Citrus
6 Citrus
30 Hardwood
AF468155
26 Lakeside
ITB9825


S. chartarum
chemotype A



















S. chartarum
chemotype S











S. chlorohalonata


- 0.001 substitutions/site


Figure 4-3. Neighbor-joining tree for tri 5 gene for Stachybotrys chartarum and S.
chlorohalonata outdoor isolates. Numbers above branches are bootstrap percentages.
AF 468158 and AF 468159 are Genbank sequences published by Cruse et al. (2002).
IBT 14915, IBT 40293, IBT 7711, and IBT 9825 are isolates from Andersen et al.
(2003).











Table 4-1. Isolate number, species, origin and collection date of 44 Stachybotrys isolates from
outdoor habitats in north central Florida.


Isolate


Isolate


Species
Sa
Cl
Cl
A
Cl
Cl
A
A
A
A
S
A
A
A
A
A
A
A
A
A
A
A


Site
lakeshore
lakeshore
lakeshore
citrus
citrus
citrus
citrus
lakeshore
lakeshore
citrus
pine
citrus
pine
lakeshore
citrus
lakeshore
lakeshore
citrus
citrus
citrus
citrus
citrus


Collection
Jul 04
Jun 05
Jun 05
Aug 05
Oct 05
Dec 05
Jul 05
Aug 05
Oct 05
Aug 05
Jul 05
Oct 05
Aug 05
Aug 05
Oct 05
Oct 05
Oct 05
Oct 05
Aug 05
Sep 05
Sep 05
Oct 05


Species
A
S
Cl
S
S
S
Cl
A
S
S
A
S
A
A
A
S
A
A
S
A
A
A


Site
citrus
hardwood
lakeshore
hardwood
hardwood
hardwood
hardwood
citrus
hardwood
hardwood
citrus
hardwood
citrus
citrus
pine
pine
citrus
citrus
hardwood
hardwood
indoor
pine


Collection
Jun 06
Aug 06
Aug 06
Oct 06
Oct 06
Oct 06
Oct 06
Sep 06
Sep 06
Sep 06
Sep 06
Oct 06
Oct 06
Aug 06
Aug 05
Jul 04
Oct 06
Oct 06
Oct 06
Oct 05
2004
Aug 06


a Cl = S. chlorohalonata, A = S. chartarum chemotype A, S = S. chartarum chemotype S.










Table 4-2. Comparison of pigmentation and tri5 and chsl sequence data for Stachybotrys
chartarum and S. chlorohalonata isolates from outdoor habitats in north central
Florida.
Isolate Pigment Clade Isolate Pigment Clade
1 orange Sa 24 none A
2 green Cl 25 orange S
3 green Cl 26 green C1
4 none A 27 orange S
5 green Cl 28 orange S
6 green Cl 29 orange S
8 none A 30 green Cl
9 none A 31 none A
10 none A 32 orange S
11 none A 33 orange S
12 none S 34 none A
13 none A 35 orange S
14 none A 36 none A
15 none A 41 none A
16 none A 42 none A
17 none A 46 none S
18 none A 47 none A
19 none A 48 none A
20 none A 49 none S
21 none A 50 none A
22 none A 52 none A
23 none A 56 none A
a Cl = S. chlorohalonata, A =S. chartarum chemotype A, S = S. chartarum chemotype S.











Table 4-3. Genbank accession numbers for chs] and tri5 nucleotide sequences for Stachybotrys
chartarum.
Isolate chs] tri5
1 EU288762 EU288803
4 EU288766 EU288813
8 EU288772 EU288815
9 EU288778 EU288817
10 EU288788 EU288822
11 EU288770 EU288805
12 EU288783 EU288834
13 EU288784 EU288799
14 EU288791 EU288806
15 EU288789 EU288814
16 EU288790 EU288819
17 EU288792 EU288801
18 EU288773 EU288816
19 EU288774 EU288804
20 EU288771 EU288820
21 EU288785 EU288807
22 EU288776 EU288800
23 EU288782 EU288802
24 EU288786 EU288808
25 EU288779 EU288826
27 EU288761 EU288828
28 EU288764 EU288830
29 EU288796 EU288833
31 EU288780 EU288823
32 EU288793 EU288831
33 EU288798 EU288829
34 EU288794 EU288811
35 EU288765 EU288832
36 EU288781 EU288809
41 EU288777 EU288812
42 EU288769 EU288818
46 EU288763 EU288836
47 EU288768 EU288825
48 EU288795 EU288810
49 EU288797 EU288827
50 EU288775 EU288824
52 EU288787 EU288835
56 EU288767 EU288821











Table 4-4. Genbank accession numbers for chs] and tri5 nucleotide sequences for Stachybotrys
chlorohalonata.
Isolate chs] tri5
2 EU288837 EU288843
3 EU288838 EU288844
5 EU288839 EU288846
6 EU288842 EU288847
26 EU288840 EU288848
30 EU288841 EU288845









CHAPTER 5
DISCUSSION

Stachybotrys chartarum is a mycotoxin-producing, cosmopolian fungus that occurs on a

variety of natural substrates as well as cellulose-based building materials such as drywall and

ceiling tiles. This black mold has aroused public interest because it has been implicated in cases

of sick building syndrome and pulmonary hemorrhage (Croft et al. 1986, Etzel et al. 1998,

Dearborn et al. 1999). Because it is likely that outdoor populations serve as the source of

inoculum for mold colonies in water-damaged structures (Koster 2006), it is critical to

understand the types of environments that support natural populations of S. chartarum. The

primary objective of this project was to identify outdoor habitats in north central Florida where S.

chartarum is found and the times of year it is most abundant.

Initially, it was thought that air sampling would be an appropriate method despite the fact

that S. chartarum is only rarely reported from outdoor air samples (Li and Kendrick 1995,

Tiffany and Bader 2000, Bishop 2002). The development of a semi-selective medium was

intended to overcome the difficulties that broad-spectrum media have isolating S. chartarum due

to its slow growth in relation to common airborne fungi. However, the detection of S. chartarum

from outdoor air in this study was a rare event if it was even isolated at all. It is quite possible

that the infrequent occurrence of S. chartarum on plates in this study was actually due to mite

contamination. Thus, it is likely that if S. chartarum is present in outdoor air, it is at such a low

concentration that it falls below the detectable threshold of even semi-selective media. This

study suggests that air sampling would not be an appropriate method for research investigating

the occurrence of S. chartarum in outdoor habitats.

Based on the results of this part of the study, it was decided to investigate other means of

measuring S. chartarum frequency and abundance outdoors. Since water-damaged drywall is a









common substrate for indoor S. chartarum contamination, traps were designed that incorporated

this material and were placed in four habitats in Gainesville, Florida. Over the course of 24

months, S. chartarum was found growing at all four habitats. It was expected that S. chartarum

would be the dominant fungus on the drywall, occurring frequently, in multiple and large

colonies. Instead, it was found rarely, on only 0.02% of the pieces collected. In addition, it was

expected that the abundance of S. chartarum would be more than what was observed. The

frequency of S. chartarum was low and, therefore, most differences in abundance between sites

were not significant. Stachybotrys chartarum was recovered more than once from each habitat,

was recovered most frequently from the citrus grove, and was found only during the summer

months at all sites. There was a correlation between S. chartarum occurrence and temperature

but not with rainfall. A closely related species, S. chlorohalonata, was found even more rarely

than S. chartarum. Ultimately, the results of this study suggest that although S. chartarum is less

common among the outdoor air spora of north-central Florida than had been predicted, it occurs

in a variety of natural and managed habitats, primarily during summer months.

The morphological species S. chartarum is recognized as three phylogenetically distinct

taxa based on a combination of morphological, chemical and molecular characteristics:

Stachybotrys chlorohalonata Andersen & Thrane, S. chartarum chemotype S and S. chartarum

chemotype A (Andersen et al. 2003). This study was the first to use outdoor samples exclusively

and the first to include multiple isolates from Florida, a state with environmental conditions that

are conducive to mold growth. Most importantly, since the two S. chartarum chemotypes have

different biochemical profiles, this study provides important toxicological data regarding the

outdoor populations of S. chartarum in north central Florida. It is important to ascertain which

chemotype of S. chartarum is most prevalent in nature for reasons that range from public health









to planning of building projects. Seventy percent of the outdoor isolates in this study were

identified as S. chartarum chemotype A and 30% as chemotype S. It is hoped that the collection

of Florida outdoor isolates compiled in this study will be useful to future researchers

investigating the population genetics of S. chartarum.

Future work with S. chartarum should focus on the following two areas: 1) development of

alternative sampling methods in order to expand our knowledge of the distribution and

occurrence of S. chartarum in indoor and outdoor environments, and 2) further development of

molecular markers for accurate identification of chemotypes A and S. Neither sampling method

used here (selective media and drywall) recovered S. chartarum as often as previously was

expected. Although the research presented here does elucidate some understanding of frequency

and abundance of S. chartarum, it was difficult to discern differences between habitats because

of the limited number of fungus recoveries. It is possible that bulk samples of soil and leaf litter

plated out on the semi-selective media evaluated in Chapter 2 would be more appropriate than

drywall traps which are, essentially, modified air samplers. In particular, this could determine if

populations of S. chartarum truly decline in the winter months, or if that observation was an

artifact due to lower moisture levels in the drywall traps.

The molecular techniques used in this study to distinguish between S. chartarum

chemotype A and S. charatrum chemotype S were based on minor differences in the genomic

DNA and were not infallible. If loci with more sequence differences are not found, an

alternative method such as AFLP fingerprinting should be employed. A rapid and accurate

diagnostic tool will be key to answering remaining questions about the distribution and

occurrence of the two S. chartarum chemotypes.









APPENDIX A
LOCATION OF SITES AND SAMPLING DATES FOR FIELD STUDY



Table A-1. GPS location of study sites


Site
Citrus la
Citrus 2
Citrus 3
Citrus 4
Citrus 5
Hardwood 1
Hardwood 2
Hardwood 3
Hardwood 4
Hardwood 5
Lakeside 1
Lakeside 2
Lakeside 3
Lakeside 4
Lakeside 5
Pine 1
Pine 2
Pine 3
Pine 4
Pine 5


Latitude
2938' 12" N
2938' 12" N
2938'13" N
2938'13" N
2938'13" N
29041'21" N
29041'21" N
29041'22" N
29041'22" N
29041'22" N
2938' 18" N
2938' 18" N
2938'18" N
2938'18" N
2938'18" N
2938' 12" N
2938'13" N
2938'13" N
2938'13" N
2938' 14" N


Longitude
82o21'51" W
82o21'51" W
82o21'51" W
82o21'51" W
82o21'51" W
82o24'43" W
82o24'43" W
82o24'44" W
82o24'44" W
82o24'45" W
82o21'17" W
82o21'17" W
82o21'16" W
82o21'16" W
82o21'15" W
82o21'54" W
82o21'54" W
82o21'54" W
82o21'54" W
82o21'54" W


a Numbers 1 through 5 represent replicates.





Table A-2. Summary of sampling dates
Month Date
June 2005 6/1/0'
July 2005 6/1/0'
August 2005 8/1/0'
September 2005 8/1/0
October-November 2005 10/15
November-December 2005 10/15
January 2006 12/20
February 2006 12/20
March 2006 2/21/
April 2006 2/21/
May 2006 5/5/0(
June 2006 6/1/0(
July 2006 6/1/0(
August 2006 8/1/0(
September-October 2006 8/1/0(
November 2006 11/1/
December 2006 11/1/
January-February 2007 1/17/
March 2007 1/17/
April 2007 4/2/0'
May 2007 4/2/0'


placed in field


5
/05
5

/05
/05
/05
/05
/05

)6
)6
3
3
3
3
3
6
)6

07
07
7
7


Date Collected
6/28/05
7/27/05
8/31 9/1/05
9/26/05
11/17-11/20/05
12/14-12/17/05
1/19-1/24/06
2/14-2/17-06
3/22-06, 4/8/06
4/20-4/26/06
6/2-6/5/06
6/30-7/10/06
8/5-8/606
9/1-9/4/06
10/18-10/19/06
12/1-12/7/06
1/3-1/6/07
2/18-2/23/07
3/21/07
5/1-5/2/07
6/1/07










APPENDIX B
ALIGNMENTS OF TRI5 AND CHS1 NUCLEOTIDE SEQUENCES


13 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50]
22 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50]
17 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50]
23 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50]
1 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50]
19 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50]
11 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50]
14 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50]
21 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50]
24 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50]
36 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50]
48 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50]
34 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50]
41 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50]
4 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50]
15 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50]
8 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50]
18 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50]
9 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50]
42 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50]
16 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50]
20 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50]
56 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50]
10 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50]
31 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50]
50 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50]
47 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50]
25 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50]
49 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50]
27 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50]
33 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50]
28 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50]
32 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50]
35 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50]
29 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50]
12 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50]
52 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50]
46 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50]
2 TGGAGACATTCCCGACTGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50]
3 TGGAGACATTCCCGACTGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50]
30 TGGAGACATTCCCGACTGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50]
5 TGGAGACATTCCCGACTGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50]
6 TGGAGACATTCCCGACTGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50]
26 TGGAGACATTCCCGACTGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50]
*
Figure B-1. Alignment of tri5 nucleotide sequence. = informative base pair differentiating
Stachybotrys chlorohalonata and S. chartarum. + = informative base pair differentiating
S. chartarum chemotypes A and S.












13 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100]
22 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100]
17 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100]
23 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100]
I GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100]
19 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100]
11 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100]
14 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100]
21 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100]
24 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100]
36 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100]
48 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100]
34 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100]
41 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100]
4 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100]
15 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100]
8 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100]
18 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100]
9 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100]
42 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100]
16 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100]
20 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100]
56 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100]
10 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100]
31 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100]
50 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100]
47 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100]
25 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100]
49 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100]
27 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100]
33 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100]
28 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100]
32 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100]
35 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100]
29 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100]
12 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100]
52 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100]
46 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100]
2 GAGAACGTCAAGTACAGAGACAGCAACTACACGAGGGAGGAGCGCGTTGA [100]
3 GAGAACGTCAAGTACAGAGACAGCAACTACACGAGGGAGGAGCGCGTTGA [100]
30 GAGAACGTCAAGTACAGAGACAGCAACTACACGAGGGAGGAGCGCGTTGA [100]
5 GAGAACGTCAAGTACAGAGACAGCAACTACACGAGGGAGGAGCGCGTTGA [100]
6 GAGAACGTCAAGTACAGAGACAGCAACTACACGAGGGAGGAGCGCGTTGA [100]
26 GAGAACGTCAAGTACAGAGACAGCAACTACACGAGGGAGGAGCGCGTTGA [100]


Figure B-1. Continued










13 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150]
22 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150]
17 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150]
23 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150]
1 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150]
19 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150]
11 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150]
14 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150]
21 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150]
24 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150]
36 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150]
48 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150]
34 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150]
41 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150]
4 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150]
15 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150]
8 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150]
18 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150]
9 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150]
42 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150]
16 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150]
20 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150]
56 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150]
10 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150]
31 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150]
50 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150]
47 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150]
25 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150]
49 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150]
27 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150]
33 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150]
28 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150]
32 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150]
35 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150]
29 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150]
12 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150]
52 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150]
46 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150]
2 AAATCTTCAGTATGCTTACAACAAGGCTGCGGCTCATTTCGCACAAGAAC [150]
3 AAATCTTCAGTATGCTTACAACAAGGCTGCGGCTCATTTCGCACAAGAAC [150]
30 AAATCTTCAGTATGCTTACAACAAGGCTGCGGCTCATTTCGCACAAGAAC [150]
5 AAATCTTCAGTATGCTTACAACAAGGCTGCGGCTCATTTCGCACAAGAAC [150]
6 AAATCTTCAGTATGCTTACAACAAGGCTGCGGCTCATTTCGCACAAGAAC [150]
26 AAATCTTCAGTATGCCTACAACAAGGCTGCGGCTCATTTCGCACAAGAAC [150]


Figure B-1. Continued









13 GGCAGCAACAGATTTTGAAGGTCAGCCCCAAGAGACTGGAGGCTTCCCTT [200]
22 GGCAGCAACAGATTTTGAAGGTCAGCCCCAAGAGACTGGAGGCTTCCCTT [200]
17 GGCAGCAACAGATTTTGAAGGTCAGCCCCAAGAGACTGGAGGCTTCCCTT [200]
23 GGCAGCAACAGATTTTGAAGGTCAGCCCCAAGAGACTGGAGGCTTCCCTT [200]
1 GGCAGCAACAGATTTTGAAGGTCAGCCCCAAGAGACTGGAGGCTTCCCTT [200]
19 GGCAGCAACAGATTTTGAAGGTCAGCCCCAAGAGACTGGAGGCTTCCCTT [200]
11 GGCAGCAACAGATTTTGAAGGTCAGCCCCAAGAGACTGGAGGCTTCCCTT [200]
14 GGCAGCAACAGATTTTGAAGGTCAGCCCCAAGAGACTGGAGGCTTCCCTT [200]
21 GGCAGCAACAGATTTTGAAGGTCAGCCCCAAGAGACTGGAGGCTTCCCTT [200]
24 GGCAGCAACAGATTTTGAAGGTCAGCCCCAAGAGACTGGAGGCTTCCCTT [200]
36 GGCAGCAACAGATTTTGAAGGTCAGCCCCAAGAGACTGGAGGCTTCCCTT [200]
48 GGCAGCAACAGATTTTGAAGGTCAGCCCCAAGAGACTGGAGGCTTCCCTT [200]
34 GGCAGCAACAGATTTTGAAGGTCAGCCCCAAGAGACTGGAGGCTTCCCTT [200]
41 GGCAGCAACAGATTTTGAAGGTCAGCCCCAAGAGACTGGAGGCTTCCCTT [200]
4 GGCAGCAACAGATTTTGAAGGTCAGCCCCAAGAGACTGGAGGCTTCCCTT [200]
15 GGCAGCAACAGATTTTGAAGGTCAGCCCCAAGAGACTGGAGGCTTCCCTT [200]
8 GGCAGCAACAGATTTTGAAGGTCAGCCCCAAGAGACTGGAGGCTTCCCTT [200]
18 GGCAGCAACAGATTTTGAAGGTCAGCCCCAAGAGACTGGAGGCTTCCCTT [200]
9 GGCAGCAACAGATTTTGAAGGTCAGCCCCAAGAGACTGGAGGCTTCCCTT [200]
42 GGCAGCAACAGATTTTGAAGGTCAGCCCCAAGAGACTGGAGGCTTCCCTT [200]
16 GGCAGCAACAGATTTTGAAGGTCAGCCCCAAGAGACTGGAGGCTTCCCTT [200]
20 GGCAGCAACAGATTTTGAAGGTCAGCCCCAAGAGACTGGAGGCTTCCCTT [200]
56 GGCAGCAACAGATTTTGAAGGTCAGCCCCAAGAGACTGGAGGCTTCCCTT [200]
10 GGCAGCAACAGATTTTGAAGGTCAGCCCCAAGAGACTGGAGGCTTCCCTT [200]
31 GGCAGCAACAGATTTTGAAGGTCAGCCCCAAGAGACTGGAGGCTTCCCTT [200]
50 GGCAGCAACAGATTTTGAAGGTCAGCCCCAAGAGACTGGAGGCTTCCCTT [200]
47 GGCAGCAACAGATTTTGAAGGTCAGCCCCAAGAGACTGGAGGCTTCCCTT [200]
25 GGCAGCAACAGATTTTGAAGGTCAGCCCCAAGAGACTGGAGGCTTCCCTT [200]
49 GGCAGCAACAGATTTTGAAGGTCAGCCCCAAGAGACTGGAGGCTTCCCTT [200]
27 GGCAGCAACAGATTTTGAAGGTCAGCCCCAAGAGACTGGAGGCTTCCCTT [200]
33 GGCAGCAACAGATTTTGAAGGTCAGCCCCAAGAGACTGGAGGCTTCCCTT [200]
28 GGCAGCAACAGATTTTGAAGGTCAGCCCCAAGAGACTGGAGGCTTCCCTT [200]
32 GGCAGCAACAGATTTTGAAGGTCAGCCCCAAGAGACTGGAGGCTTCCCTT [200]
35 GGCAGCAACAGATTTTGAAGGTCAGCCCCAAGAGACTGGAGGCTTCCCTT [200]
29 GGCAGCAACAGATTTTGAAGGTCAGCCCCAAGAGACTGGAGGCTTCCCTT [200]
12 GGCAGCAACAGATTTTGAAGGTCAGCCCCAAGAGACTGGAGGCTTCCCTT [200]
52 GGCAGCAACAGATTTTGAAGGTCAGCCCCAAGAGACTGGAGGCTTCCCTT [200]
46 GGCAGCAACAGATTTTGAAGGTCAGCCCCAAGAGACTGGAGGCTTCCCTT [200]
2 GGCAGCAACAGATCTTGAAGGTCAGCCCCAAGAGACTGGAGGCTTCCCTT [200]
3 GGCAGCAACAGATCTTGAAGGTCAGCCCCAAGAGACTGGAGGCTTCCCTT [200]
30 GGCAGCAACAGATCTTGAAGGTCAGCCCCAAGAGACTGGAGGCTTCCCTT [200]
5 GGCAGCAACAGATCTTGAAGGTCAGCCCCAAGAGACTGGAGGCTTCCCTT [200]
6 GGCAGCAACAGATCTTGAAGGTCAGCCCCAAGAGACTGGAGGCTTCCCTT [200]
26 GGCAGCAACAGATCTTGAAGGTCAGCCCCAAGAGACTGGAGGCTTCCCTT [200]


Figure B-1. Continued









13 CGAACCATTGTCGGCATGGTGGTTTACTCCTGGGCCAAGGTTTCCAAGGA [250]
22 CGAACCATTGTCGGCATGGTGGTTTACTCCTGGGCCAAGGTTTCCAAGGA [250]
17 CGAACCATTGTCGGCATGGTGGTTTACTCCTGGGCCAAGGTTTCCAAGGA [250]
23 CGAACCATTGTCGGCATGGTGGTTTACTCCTGGGCCAAGGTTTCCAAGGA [250]
1 CGAACCATTGTCGGCATGGTGGTTTACTCCTGGGCCAAGGTTTCCAAGGA [250]
19 CGAACCATTGTCGGCATGGTGGTTTACTCCTGGGCCAAGGTTTCCAAGGA [250]
11 CGAACCATTGTCGGCATGGTGGTTTACTCCTGGGCCAAGGTTTCCAAGGA [250]
14 CGAACCATTGTCGGCATGGTGGTTTACTCCTGGGCCAAGGTTTCCAAGGA [250]
21 CGAACCATTGTCGGCATGGTGGTTTACTCCTGGGCCAAGGTTTCCAAGGA [250]
24 CGAACCATTGTCGGCATGGTGGTTTACTCCTGGGCCAAGGTTTCCAAGGA [250]
36 CGAACCATTGTCGGCATGGTGGTTTACTCCTGGGCCAAGGTTTCCAAGGA [250]
48 CGAACCATTGTCGGCATGGTGGTTTACTCCTGGGCCAAGGTTTCCAAGGA [250]
34 CGAACCATTGTCGGCATGGTGGTTTACTCCTGGGCCAAGGTTTCCAAGGA [250]
41 CGAACCATTGTCGGCATGGTGGTTTACTCCTGGGCCAAGGTTTCCAAGGA [250]
4 CGAACCATTGTCGGCATGGTGGTTTACTCCTGGGCCAAGGTTTCCAAGGA [250]
15 CGAACCATTGTCGGCATGGTGGTTTACTCCTGGGCCAAGGTTTCCAAGGA [250]
8 CGAACCATTGTCGGCATGGTGGTTTACTCCTGGGCCAAGGTTTCCAAGGA [250]
18 CGAACCATTGTCGGCATGGTGGTTTACTCCTGGGCCAAGGTTTCCAAGGA [250]
9 CGAACCATTGTCGGCATGGTGGTTTACTCCTGGGCCAAGGTTTCCAAGGA [250]
42 CGAACCATTGTCGGCATGGTGGTTTACTCCTGGGCCAAGGTTTCCAAGGA [250]
16 CGAACCATTGTCGGCATGGTGGTTTACTCCTGGGCCAAGGTTTCCAAGGA [250]
20 CGAACCATTGTCGGCATGGTGGTTTACTCCTGGGCCAAGGTTTCCAAGGA [250]
56 CGAACCATTGTCGGCATGGTGGTTTACTCCTGGGCCAAGGTTTCCAAGGA [250]
10 CGAACCATTGTCGGCATGGTGGTTTACTCCTGGGCCAAGGTTTCCAAGGA [250]
31 CGAACCATTGTCGGCATGGTGGTTTACTCCTGGGCCAAGGTTTCCAAGGA [250]
50 CGAACCATTGTCGGCATGGTGGTTTACTCCTGGGCCAAGGTTTCCAAGGA [250]
47 CGAACCATTGTCGGCATGGTGGTTTACTCCTGGGCCAAGGTTTCCAAGGA [250]
25 CGAACCATTGTCGGCATGGTGGTTTACTCCTGGGCCAAGGTTTCCAAGGA [250]
49 CGAACCATTGTCGGCATGGTGGTTTACTCCTGGGCCAAGGTTTCCAAGGA [250]
27 CGAACCATTGTCGGCATGGTGGTTTACTCCTGGGCCAAGGTTTCCAAGGA [250]
33 CGAACCATTGTCGGCATGGTGGTTTACTCCTGGGCCAAGGTTTCCAAGGA [250]
28 CGAACCATTGTCGGCATGGTGGTTTACTCCTGGGCCAAGGTTTCCAAGGA [250]
32 CGAACCATTGTCGGCATGGTGGTTTACTCCTGGGCCAAGGTTTCCAAGGA [250]
35 CGAACCATTGTCGGCATGGTGGTTTACTCCTGGGCCAAGGTTTCCAAGGA [250]
29 CGAACCATTGTCGGCATGGTGGTTTACTCCTGGGCCAAGGTTTCCAAGGA [250]
12 CGAACCATTGTCGGCATGGTGGTTTACTCCTGGGCCAAGGTTTCCAAGGA [250]
52 CGAACCATTGTCGGCATGGTGGTTTACTCCTGGGCCAAGGTTTCCAAGGA [250]
46 CGAACCATTGTCGGCATGGTGGTTTACTCCTGGGCCAAGGTTTCCAAGGA [250]
2 CGAACCATTGTCGGCATGGTGGTTTACTCCTGGGCCAAGGTTTCCAAGGA [250]
3 CGAACCATTGTCGGCATGGTGGTTTACTCCTGGGCCAAGGTTTCCAAGGA [250]
30 CGAACCATTGTCGGCATGGTGGTTTACTCCTGGGCCAAGGTTTCCAAGGA [250]
5 CGAACCATTGTCGGCATGGTGGTTTACTCCTGGGCCAAGGTTTCCAAGGA [250]
6 CGAACCATTGTCGGCATGGTGGTTTACTCCTGGGCCAAGGTTTCCAAGGA [250]
26 CGAACCATTGTCGGCATGGTGGTTTACTCCTGGGCCAAGGTTTCCAAGGA [250]

Figure B-1. Continued










13 GCTCATGGCAGATCTCAGCATCCACTATACCTACACTCTCATCCTCGATG [300]
22 GCTCATGGCAGATCTCAGCATCCACTATACCTACACTCTCATCCTCGATG [300]
17 GCTCATGGCAGATCTCAGCATCCACTATACCTACACTCTCATCCTCGATG [300]
23 GCTCATGGCAGATCTCAGCATCCACTATACCTACACTCTCATCCTCGATG [300]
1 GCTCATGGCAGATCTCAGCATCCACTATACCTACACTCTCATCCTCGATG [300]
19 GCTCATGGCAGATCTCAGCATCCACTATACCTACACTCTCATCCTCGATG [300]
11 GCTCATGGCAGATCTCAGCATCCACTATACCTACACTCTCATCCTCGATG [300]
14 GCTCATGGCAGATCTCAGCATCCACTATACCTACACTCTCATCCTCGATG [300]
21 GCTCATGGCAGATCTCAGCATCCACTATACCTACACTCTCATCCTCGATG [300]
24 GCTCATGGCAGATCTCAGCATCCACTATACCTACACTCTCATCCTCGATG [300]
36 GCTCATGGCAGATCTCAGCATCCACTATACCTACACTCTCATCCTCGATG [300]
48 GCTCATGGCAGATCTCAGCATCCACTATACCTACACTCTCATCCTCGATG [300]
34 GCTCATGGCAGATCTCAGCATCCACTATACCTACACTCTCATCCTCGATG [300]
41 GCTCATGGCAGATCTCAGCATCCACTATACCTACACTCTCATCCTCGATG [300]
4 GCTCATGGCAGATCTCAGCATCCACTATACCTACACTCTCATCCTCGATG [300]
15 GCTCATGGCAGATCTCAGCATCCACTATACCTACACTCTCATCCTCGATG [300]
8 GCTCATGGCAGATCTCAGCATCCACTATACCTACACTCTCATCCTCGATG [300]
18 GCTCATGGCAGATCTCAGCATCCACTATACCTACACTCTCATCCTCGATG [300]
9 GCTCATGGCAGATCTCAGCATCCACTATACCTACACTCTCATCCTCGATG [300]
42 GCTCATGGCAGATCTCAGCATCCACTATACCTACACTCTCATCCTCGATG [300]
16 GCTCATGGCAGATCTCAGCATCCACTATACCTACACTCTCATCCTCGATG [300]
20 GCTCATGGCAGATCTCAGCATCCACTATACCTACACTCTCATCCTCGATG [300]
56 GCTCATGGCAGATCTCAGCATCCACTATACCTACACTCTCATCCTCGATG [300]
10 GCTCATGGCAGATCTCAGCATCCACTATACCTACACTCTCATCCTCGATG [300]
31 GCTCATGGCAGATCTCAGCATCCACTATACCTACACTCTCATCCTCGATG [300]
50 GCTCATGGCAGATCTCAGCATCCACTATACCTACACTCTCATCCTCGATG [300]
47 GCTCATGGCAGATCTCAGCATCCACTATACCTACACTCTCATCCTCGATG [300]
25 GCTCATGGCAGATCTCAGCATCCACTACACCTACACTCTTATCCTCGATG [300]
49 GCTCATGGCAGATCTCAGCATCCACTACACCTACACTCTTATCCTCGATG [300]
27 GCTCATGGCAGATCTCAGCATCCACTACACCTACACTCTTATCCTCGATG [300]
33 GCTCATGGCAGATCTCAGCATCCACTACACCTACACTCTTATCCTCGATG [300]
28 GCTCATGGCAGATCTCAGCATCCACTACACCTACACTCTTATCCTCGATG [300]
32 GCTCATGGCAGATCTCAGCATCCACTACACCTACACTCTTATCCTCGATG [300]
35 GCTCATGGCAGATCTCAGCATCCACTACACCTACACTCTTATCCTCGATG [300]
29 GCTCATGGCAGATCTCAGCATCCACTACACCTACACTCTTATCCTCGATG [300]
12 GCTCATGGCAGATCTCAGCATCCACTACACCTACACTCTCATCCTCGATG [300]
52 GCTCATGGCAGATCTCAGCATCCACTATACCTACACTCTCATCCTCGATG [300]
46 GCTCATGGCAGATCTCAGCATCCACTACACCTACACTCTCATCCTCGATG [300]
2 GCTCATGGCAGATCTCAGCATTCACTACACCTACACTCTCATCCTCGATG [300]
3 GCTCATGGCAGATCTCAGCATTCACTACACCTACACTCTCATCCTCGATG [300]
30 GCTCATGGCAGATCTCAGCATTCACTACACCTACACTCTCATCCTCGATG [300]
5 GCTCATGGCAGATCTCAGCATTCACTACACCTACACTCTCATCCTCGATG [300]
6 GCTCATGGCAGATCTCAGCATTCACTACACCTACACTCTCATCCTCGATG [300]
26 GCTCATGGCAGATCTCAGCATTCACTACACCTACACTCTCATCCTCGATG [300]
+ +

Figure B-l. Continued










13 ATAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350]
22 ATAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350]
17 ATAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350]
23 ATAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350]
1 ATAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350]
19 ATAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350]
11 ATAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350]
14 ATAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350]
21 ATAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350]
24 ATAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350]
36 ATAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350]
48 ATAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350]
34 ATAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350]
41 ATAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350]
4 ATAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350]
15 ATAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350]
8 ATAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350]
18 ATAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350]
9 ATAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350]
42 ATAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350]
16 ATAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350]
20 ATAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350]
56 ATAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350]
10 ATAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350]
31 ATAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350]
50 ATAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350]
47 ATAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350]
25 ATAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350]
49 ATAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350]
27 ATAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350]
33 ATAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350]
28 ATAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350]
32 ATAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350]
35 ATAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350]
29 ATAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350]
12 ATAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350]
52 ATAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350]
46 ATAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350]
2 ACAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350]
3 ACAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350]
30 ACAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350]
5 ACAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350]
6 ACAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350]
26 ACAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350]


Figure B-1. Continued









13 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400]
22 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400]
17 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400]
23 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400]
1 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400]
19 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400]
11 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400]
14 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400]
21 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400]
24 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400]
36 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400]
48 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400]
34 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400]
41 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400]
4 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400]
15 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400]
8 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400]
18 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400]
9 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400]
42 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400]
16 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400]
20 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400]
56 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400]
10 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400]
31 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400]
50 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400]
47 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400]
25 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400]
49 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400]
27 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400]
33 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400]
28 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400]
32 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400]
35 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400]
29 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400]
12 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400]
52 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400]
46 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400]
2 CAGAGTGGCAACCAGCAAAAGCATCCTTGGTGGATGCTGGTCAACGAGCA [400]
3 CAGAGTGGCAACCAGCAAAAGCATCCTTGGTGGATGCTGGTCAACGAGCA [400]
30 CAGAGTGGCAACCAGCAAAAGCATCCTTGGTGGATGCTGGTCAACGAGCA [400]
5 CAGAGTGGCAACCAGCAAAAGCATCCTTGGTGGATGCTGGTCAACGAGCA [400]
6 CAGAGTGGCAACCAGCAAAAGCATCCTTGGTGGATGCTGGTCAACGAGCA [400]
26 CAGAGTGGCAACCAGCAAAAGCATCCTTGGTGGATGCTGGTCAACGAGCA [400]


Figure B-1. Continued










13 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450]
22 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450]
17 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450]
23 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450]
1 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450]
19 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450]
11 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450]
14 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450]
21 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450]
24 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450]
36 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450]
48 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450]
34 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450]
41 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450]
4 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450]
15 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450]
8 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450]
18 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450]
9 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450]
42 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450]
16 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450]
20 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450]
56 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450]
10 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450]
31 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450]
50 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450]
47 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450]
25 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450]
49 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450]
27 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450]
33 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450]
28 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450]
32 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450]
35 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450]
29 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450]
12 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450]
52 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450]
46 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450]
2 CTTCCCTAATGTGCTCAGACACTTTGGCCCTTTCTGCTCCTTGAACCTCA [450]
3 CTTCCCTAATGTGCTCAGACACTTTGGCCCTTTCTGCTCCTTGAACCTCA [450]
30 CTTCCCTAATGTGCTCAGACACTTTGGCCCTTTCTGCTCCTTGAACCTCA [450]
5 CTTCCCTAATGTGCTCAGACACTTTGGCCCTTTCTGCTCCTTGAACCTCA [450]
6 CTTCCCTAATGTGCTCAGACACTTTGGCCCTTTCTGCTCCTTGAACCTCA [450]
26 CTTCCCTAATGTGCTCAGACACTTTGGCCCTTTCTGCTCCTTGAACCTCA [450]


Figure B-1. Continued










13 TTCGCAGCACACTGGACTGTAAGTCTATACTCGAC [485]
22 TTCGCAGCACACTGGACTGTAAGTCTATACTCGAC [485]
17 TTCGCAGCACACTGGACTGTAAGTCTATACTCGAC [485]
23 TTCGCAGCACACTGGACTGTAAGTCTATACTCGAC [485]
1 TTCGCAGCACACTGGACTGTAAGTCTATACTCGAC [485]
19 TTCGCAGCACACTGGACTGTAAGTCTATACTCGAC [485]
11 TTCGCAGCACACTGGACTGTAAGTCTATACTCGAC [485]
14 TTCGCAGCACACTGGACTGTAAGTCTATACTCGAC [485]
21 TTCGCAGCACACTGGACTGTAAGTCTATACTCGAC [485]
24 TTCGCAGCACACTGGACTGTAAGTCTATAGTCGAC [485]
36 TTCGCAGCACACTGGACTGTAAGTCTATAGTCGAC [485]
48 TTCGCAGCACACTGGACTGTAAGTCTATAGTCGAC [485]
34 TTCGCAGCACACTGGACTGTAAGTCTATAGTCGAC [485]
41 TTCGCAGCACACTGGACTGTAAGTCTATAGTCGAC [485]
4 TTCGCAGCACACTGGACTGTAAGTCTATACTCGAC [485]
15 TTCGCAGCACACTGGACTGTAAGTCTATACTCGAC [485]
8 TTCGCAGCACACTGGACTGTAAGTCTATACTCGAC [485]
18 TTCGCAGCACACTGGACTGTAAGTCTATACTCGAC [485]
9 TTCGCAGCACACTGGACTGTAAGTCTATACTCGAC [485]
42 TTCGCAGCACACTGGACTGTAAGTCTATACTCGAC [485]
16 TTCGCAGCACACTGGACTGTAAGTCTATACTCGAC [485]
20 TTCGCAGCACACTGGACTGTAAGTCTATACTCGAC [485]
56 TTCGCAGCACACTGGACTGTAAGTCTATACTCGAC [485]
10 TTCGCAGCACACTGGACTGTAAGTCTATACTCGAC [485]
31 TTCGCAGCACACTGGACTGTAAGTCTATACTCGAC [485]
50 TTCGCAGCACACTGGACTGTAAGTCTATACTCGAC [485]
47 TTCGCAGCACACTGGACTGTAAGTCTATACTCGAC [485]
25 TTCGCAGCACACTGGACTGTAAGTCTATACTCGAC [485]
49 TTCGCAGCACACTGGACTGTAAGTCTATACTCGAC [485]
27 TTCGCAGCACACTGGACTGTAAGTCTATACTCGAC [485]
33 TTCGCAGCACACTGGACTGTAAGTCTATACTCGAC [485]
28 TTCGCAGCACACTGGACTGTAAGTCTATACTCGAC [485]
32 TTCGCAGCACACTGGACTGTAAGTCTATACTCGAC [485]
35 TTCGCAGCACACTGGACTGTAAGTCTATACTCGAC [485]
29 TTCGCAGCACACTGGACTGTAAGTCTATACTCGAC [485]
12 TTCGCAGCACACTGGACTGTAAGTCTATACTCGAC [485]
52 TTCGCAGCACACTGGACTGTAAGTCTATACTCGAC [485]
46 TTCGCAGCACACTGGACTGTAAGTCTATACTCGAC [485]
2 TTCGCAGCACACTGGACTGTAAGTCTGCACTGTAA [485]
3 TTCGCAGCACACTGGACTGTAAGTCTGCACTGTAA [485]
30 TTCGCAGCACACTGGACTGTAAGTCTGCACTGTAA [485]
5 TTCGCAGCACACTGGACTGTAAGTCTGCACTGTAA [485]
6 TTCGCAGCACACTGGACTGTAAGTCTGCACTGTAA [485]
26 TTCGCAGCACACTGGACTGTAAGTCTGCACTGTAA [485]


Figure B-1. Continued









27 GGAGTTTCCTCCAGGTCGGGTACCGGCATCGATGAGGACACAGATGTTGG [50]
46 GGAGTTTCCTCCAGGTCGGGTACCGGCATCGATGAGGACACAGATGTTGG [50]
1 GGAGTTTCCTCCAGGTCGGGTACCGGCATCGATGAGGACACAGATGTTGG [50]
28 GGAGTTTCCTCCAGGTCGGGTACCGGCATCGATGAGGACACAGATGTTGG [50]
35 GGAGTTTCCTCCAGGTCGGGTACCGGCATCGATGAGGACACAGATGTTGG [50]
4 GGAGTTTCCTCCAGGTCTGGTACCGGCATCGATGAGGACACAGATGTTGG [50]
56 GGAGTTTCCTCCAGGTCTGGTACCGGCATCGATGAGGACACAGATGTTGG [50]
47 GGAGTTTCCTCCAGGTCTGGTACCGGCATCGATGAGGACACAGATGTTGG [50]
42 GGAGTTTCCTCCAGGTCTGGTACCGGCATCGATGAGGACACAGATGTTGG [50]
11 GGAGTTTCCTCCAGGTCTGGTACCGGCATCGATGAGGACACAGATGTTGG [50]
20 GGAGTTTCCTCCAGGTCTGGTACCGGCATCGATGAGGACACAGATGTTGG [50]
8 GGAGTTTCCTCCAGGTCTGGTACCGGCATCGATGAGGACACAGATGTTGG [50]
18 GGAGTTTCCTCCAGGTCTGGTACCGGCATCGATGAGGACACAGATGTTGG [50]
19 GGAGTTTCCTCCAGGTCTGGTACCGGCATCGATGAGGACACAGATGTTGG [50]
50 GGAGTTTCCTCCAGGTCTGGTACCGGCATCGATGAGGACACAGATGTTGG [50]
22 GGAGTTTCCTCCAGGTCTGGTACCGGCATCGATGAGGACACAGATGTTGG [50]
41 GGAGTTTCCTCCAGGTCKGGTACCGGCATCGATGAGGACACAGATGTTGG [50]
9 GGAGTTTCCTCCAGGTCTGGTACCGGCATCGATGAGGACACAGATGTTGG [50]
25 GGAGTTTCCTCCAGGTCGGGTACCGGCATCGATGAGGACACAGATGTTGG [50]
31 GGAGTTTCCTCCAGGTCTGGTACCGGCATCGATGAGGACACAGATGTTGG [50]
36 GGAGTTTCCTCCAGGTCTGGTACCGGCATCGATGAGGACACAGATGTTGG [50]
23 GGAGTTTCCTCCAGGTCTGGTACCGGCATCGATGAGGACACAGATGTTGG [50]
12 GGAGTTTCCTCCAGGTCGGGTACCGGCATCGATGAGGACACAGATGTTGG [50]
13 GGAGTTTCCTCCAGGTCTGGTACCGGCATCGATGAGGACACAGATGTTGG [50]
21 GGAGTTTCCTCCAGGTCTGGTACCGGCATCGATGAGGACACAGATGTTGG [50]
24 GGAGTTTCCTCCAGGTCTGGTACCGGCATCGATGAGGACACAGATGTTGG [50]
52 GGAGTTTCCTCCAGGTCTGGTACCGGCATCGATGAGGACACAGATGTTGG [50]
10 GGAGTTTCCTCCAGGTCTGGTACCGGCATCGATGAGGACACAGATGTTGG [50]
15 GGAGTTTCCTCCAGGTCTGGTACCGGCATCGATGAGGACACAGATGTTGG [50]
16 GGAGTTTCCTCCAGGTCTGGTACCGGCATCGATGAGGACACAGATGTTGG [50]
14 GGAGTTTCCTCCAGGTCTGGTACCGGCATCGATGAGGACACAGATGTTGG [50]
17 GGAGTTTCCTCCAGGTCTGGTACCGGCATCGATGAGGACACAGATGTTGG [50]
32 GGAGTTTCCTCCAGGTCGGGTACCGGCATCGATGAGGACACAGATGTTGG [50]
34 GGAGTTTCCTCCAGGTCTGGTACCGGCATCGATGAGGACACAGATGTTGG [50]
48 GGAGTTTCCTCCAGGTCTGGTACCGGCATCGATGAGGACACAGATGTTGG [50]
29 GGAGTTTCCTCCAGGTCGGGTACCGGCATCGATGAGGACACAGATGTTGG [50]
49 GGAGTTTCCTCCAGGTCGGGTACCGGCATCGATGAGGACACAGATGTTGG [50]
33 GGAGTTTCCTCCAGGTCGGGTACCGGCATCGATGAGGACACAGATGTTGG [50]
2 GGAGTTTCCTCCAGGTCGGGTACCGGCATCGATGAGGACGCAGATGTTGG [50]
3 GGAGTTTCCTCCAGGTCGGGTACCGGCATCGATGAGGACGCAGATGTTGG [50]
5 GGAGTTTCCTCCAGGTCGGGTACCGGCATCGATGAGGACGCAGATGTTGG [50]
26 GGAGTTTCCTCCAGGTCGGGTACCGGCATCGATGAGGACGCAGATGTTGG [50]
30 GGAGTTTCCTCCAGGTCGGGTACCGGCATCGATGAGGACGCAGATGTTGG [50]
6 GGAGTTTCCTCCAGGTCGGGTACCGGCATCGATGAGGACGCAGATGTTGG [50]
+ *
Figure B-2. Alignment of chsl nucleotide sequence. + = informative base pair differentiating S.
chartarum chemotypes A and S. = informative base pair differentiating
Stachybotrys chlorohalonata and S. chartarum.










27 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100]
46 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100]
I GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100]
28 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100]
35 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100]
4 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100]
56 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100]
47 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100]
42 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100]
11 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100]
20 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100]
8 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100]
18 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100]
19 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100]
50 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100]
22 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100]
41 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100]
9 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100]
25 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100]
31 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100]
36 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100]
23 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100]
12 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100]
13 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100]
21 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100]
24 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100]
52 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100]
10 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100]
15 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100]
16 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100]
14 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100]
17 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100]
32 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100]
34 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100]
48 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100]
29 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100]
49 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100]
33 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100]
2 GATCCAGGACGCGACCAAAGGCCTGGAAGAACCATCTGTGCGAGTTGATC [100]
3 GATCCAGGACGCGACCAAAGGCCTGGAAGAACCATCTGTGCGAGTTGATC [100]
5 GATCCAGGACGCGACCAAAGGCCTGGAAGAACCATCTGTGCGAGTTGATC [100]
26 GATCCAGGACGCGACCAAAGGCCTGGAAGAACCATCTGTGCGAGTTGATC [100]
30 GATCCAGGACGCGACCAAAGGCCTGGAAGAACCATCTGTGCGAGTTGATC [100]
6 GATCCAGGACGCGACCAAAGGCCTGGAAGAACCATCTGTGCGAGTTGATC [100]


Figure B-2. Continued









27 TTCTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGCTGGCG [150]
46 TTCTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGCTGGCG [150]
1 TTCTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGCTGGCG [150]
28 TTCTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGCTGGCG [150]
35 TTCTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGCTGGCG [150]
4 TTCTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGCTGGCG [150]
56 TTCTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGCTGGCG [150]
47 TTCTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGCTGGCG [150]
42 TTCTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGCTGGCG [150]
11 TTCTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGCTGGCG [150]
20 TTCTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGCTGGCG [150]
8 TTCTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGCTGGCG [150]
18 TTCTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGCTGGCG [150]
19 TTCTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGCTGGCG [150]
50 TTCTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGCTGGCG [150]
22 TTCTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGCTGGCG [150]
41 TTCTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGCTGGCG [150]
9 TTCTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGCTGGCG [150]
25 TTCTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGCTGGCG [150]
31 TTCTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGCTGGCG [150]
36 TTCTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGCTGGCG [150]
23 TTCTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGCTGGCG [150]
12 TTCTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGCTGGCG [150]
13 TTCTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGCTGGCG [150]
21 TTCTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGCTGGCG [150]
24 TTCTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGCTGGCG [150]
52 TTCTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGCTGGCG [150]
10 TTCTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGCTGGCG [150]
15 TTCTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGCTGGCG [150]
16 TTCTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGCTGGCG [150]
14 TTCTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGCTGGCG [150]
17 TTCTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGCTGGCG [150]
32 TTCTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGCTGGCG [150]
34 TTCTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGCTGGCG [150]
48 TTCTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGCTGGCG [150]
29 TTCTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGCTGGCG [150]
49 TTCTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGCTGGCG [150]
33 TTCTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGCTGGCG [150]
2 TTTTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGTTGGCG [150]
3 TTTTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGTTGGCG [150]
5 TTTTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGTTGGCG [150]
26 TTTTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGTTGGCG [150]
30 TTTTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGTTGGCG [150]
6 TTTTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGTTGGCG [150]


Figure B-2. Continued









27 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200]
46 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200]
1 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200]
28 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200]
35 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200]
4 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200]
56 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200]
47 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200]
42 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200]
11 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200]
20 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200]
8 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200]
18 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200]
19 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200]
50 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200]
22 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200]
41 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200]
9 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200]
25 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200]
31 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200]
36 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200]
23 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200]
12 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200]
13 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200]
21 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200]
24 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200]
52 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200]
10 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200]
15 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200]
16 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200]
14 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200]
17 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200]
32 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200]
34 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200]
48 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200]
29 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200]
49 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200]
33 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200]
2 GCGATGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200]
3 GCGATGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200]
5 GCGATGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200]
26 GCGATGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200]
30 GCGATGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200]
6 GCGATGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200]


Figure B-2. Continued









27 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250]
46 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250]
1 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250]
28 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250]
35 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250]
4 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250]
56 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250]
47 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250]
42 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250]
11 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250]
20 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250]
8 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250]
18 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250]
19 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250]
50 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250]
22 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250]
41 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250]
9 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250]
25 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250]
31 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250]
36 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250]
23 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250]
12 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250]
13 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250]
21 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250]
24 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250]
52 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250]
10 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250]
15 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250]
16 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250]
14 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250]
17 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250]
32 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250]
34 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250]
48 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250]
29 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250]
49 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250]
33 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250]
2 TCGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTGACCTGCTGC [250]
3 TCGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTGACCTGCTGC [250]
5 TCGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTGACCTGCTGC [250]
26 TCGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTGACCTGCTGC [250]
30 TCGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTGACCTGCTGC [250]
6 TCGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTGACCTGCTGC [250]


Figure B-2. Continued










27 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297]
46 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297]
1 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297]
28 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297]
35 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297]
4 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297]
56 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297]
47 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297]
42 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297]
11 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297]
20 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297]
8 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297]
18 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297]
19 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297]
50 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297]
22 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297]
41 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297]
9 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297]
25 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297]
31 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297]
36 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297]
23 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297]
12 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297]
13 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297]
21 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297]
24 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297]
52 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297]
10 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297]
15 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297]
16 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297]
14 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297]
17 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297]
32 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297]
34 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297]
48 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297]
29 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297]
49 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297]
33 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297]
2 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGTACGGCTTT [297]
3 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGTACGGCTTT [297]
5 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGTACGGCTTT [297]
26 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGTACGGCTTT [297]
30 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGTACGGCTTT [297]
6 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGTACGGCTTT [297]


Figure B-2. Continued









LIST OF REFERENCES


Andersen B, Nielsen KF, Jarvis BB. 2002. Characterization of Stachybotrys from water-
damaged buildings based on morphology, growth and metabolite production. Mycologia
94:392-403.

Andersen B, Nielsen KF, Thrane U, Szaro T, Taylor JW, Jarvis BB. 2003. Molecular and
phenotypic descriptions of Stachybotrys chlorohalonata sp. nov. and two chemotypes of
Stachybotrys chartarum found in water-damaged buildings. Mycologia 95:1227-1238.

Andersen B, Nissen AT. 2000. Evaluation of media for detection of Stachybotrys and
Chaetomium species associated with water-damaged buildings. Int Biodeter Biodegr
46:111-116.

Andersson MA, Nikulin M, Koljalg U, Andersson MC, Rainey F, Reijula K, Hintikka EL,
Salkinoja-Salonen M. 1997. Bacteria, molds, and toxins in water-damaged building
materials. Appl Environ Microbiol 63:387-393.

Anonymous. 1994. Acute pulmonary hemorrhage/hemosiderosis among infants Cleveland,
January 1993-November 1994. MMWR 43:881-883.

Anonymous. 1997. Update: pulmonary hemorrhage/hemosiderosis among infants Cleveland,
Ohio, 1993-1996. MMWR 46:33-35.

Anonymous. 2000. Update: pulmonary hemorrhage/hemosiderosis among infants Cleveland,
Ohio, 1993-1996. MMWR 49:180-184.

Atlas RM. 1993. Handbook of microbiological media. Boca Raton: CRC Press. 1079 p.

Barron, GL. 1968. The genera of hyphomycetes from soil. Baltimore: Williams & Wilkins. 364
p.

Baxter DM, Perkins L, McGhee CR, Seltzer JM. 2005. A regional comparison of mold spore
concentrations outdoors and inside "clean" and "mold contaminated" southern California
buildings. J Occup Environ Hyg 2:8-18.

Billups RA, Tilton KS, Warden PS. 1999. Identification ofStachybotrys chartarum utilizing
various media and two temperature settings [abstract]. In: 1st NSF international conference
on indoor air health: impacts, issues and solutions; May 3-5 1999; Denver CO. Ann Arbor,
MI: NSF Int. p 166-174.

Bisby GR. 1943. Stachybotrys. Trans Br Mycol Soc 26:133-143.

Bishop A. 2002. Diurnal response and periodicity of the common aerial fungal genera and
species found in north central Florida [Masters thesis]. College of Agricultural and Life
Sciences, University of Florida, Gainesville, FL. 39 p.









Booth C. 1957. Studies of pyrenomycetes: I. Four species of Chaetosphaeria, two with
Catenulaira conidia. II. Melanopsammapomiformis and its Stachybotrys conidia. Mycol
Papers 68:1-27.

Campbell R. 1972. Ultrastructure of conidium ontogeny in the Deuteromycete fungus
Stachybotrys atra Corda. New Phytol. 71:1143-1149.

Campbell R. 1974. The ultrastructure of the formation of chains of conidia in Memnoniella
echinata. Mycologia. 67:760-769.

Carmichael JW, Kendrick WB, Conners IL, Sigler L. 1980. Genera of hyphomycetes. Edmonton:
Univ Alberta Press. 386 p.

Castlebury LA, Rossman AY, Sung GH, Hyten AS, Spatafora JW. 2004. Multigene phylogeny
reveals new lineage for Stachybotrys chartarum, the indoor air fungus. Mycol Res
108:864-872.

Corda ACJ. 1837. Icones fungorum hucusque cognitorum. Vol I. Prague: Apud JG Calve. 86 p.

Croft WA, Jarvis BB, Yatawara CS. 1986. Airborne outbreak of trichothecene mycotoxicosis.
Atmos Environ 20:549-552.

Cruse M, Telerant R, Gallagher T, Lee T, Taylor JW. 2002. Cryptic species in Stachybotrys
chartarum. Mycologia 94:814-822.

Cruz-Perez P, Buttner MP, Stetzenbach LD. 2001. Specific detection ofStachybotrys chartarum
in pure culture using quantitative polymerase chain reaction. Mol Cell Probes 15:129-138.

Dean TR, Roop B, Betancourt D, Menetrez MY. 2005. A simple multiplex polymerase chain
reaction assay for the identification of four environmentally relevant fungal contaminants.
J Microbiol Meth 61:9-16.

Dearborn DG, Yike I, Sorenson WG, Miller MJ, Etzel RA. 1999. Overview of investigations into
pulmonary hemorrhage among infants in Cleveland, Ohio. Environ Health Persp
107:S495-S499.

Desjardins AE, Hohn TM, McCormick SP. 1993. Trichothecene biosynthesis in Fusarium
species: chemistry, genetics, and significance. Microbiol Rev 57:595-604.

Drobotko VG. 1945. Stachybotryotoxicosis: a new disease of horses and humans. Am Rev Sov
Med 2:238-242.

El-Kady IA. 1988. New technique for isolation of Stachybotrys chartarum. Naturalia
Monspeliensia 52:53-56.

El-Morsy, ESM. 1999. Microfungi from the ectorhizosphere-rhizoplane zone of different
halophytic plants from the Red Sea Coast of Egypt. Mycologia 91:228-236.









Elanskii SN, Petrunina YV, Lavrova OI, Likhachev AN. 2004. A comparative analysis of
Stachybotrys chartarum strains isolated in Russia. Microbiology 73:60-65.

Elidemir O, Colasurdo GN, Rossmann SN, Fan LL. 1999. Isolation of Stachybotrys from the
lung of a child with pulmonary hemosiderosis. Pediatrics 104:964-966.

Ellis MB. 1971. Dematiaceous Hyphomycetes. Kew, England: Commonwealth Mycological
Institute. 608 p.

Eppley RM, Bailey WJ. 1973. 12-13-epoxy-A9-trichothecenes as probable mycotoxins
responsible for stachybotryotoxicosis. Science 181:750-758.

Etzel RA, Montana E, Sorenson WG, Kullman GJ, Allan TM, Dearborn DG. 1998. Acute
pulmonary hemorrhage in infants associated with exposure to Stachybotrys atra and other
fungi. Arch Pediatr Adol Med 152:757-762.

Flannigan B, Miller JD. 2001. Microbial growth in indoor environments. In: Flannigan B,
Samson RA, Miller JD, eds. Microorganisms in home and indoor work environments:
diversity, health impacts, investigation and control. London: Taylor & Francis. p 35-68.

FAWN (Florida Automated Weather Network). 2007. Published on the Internet at
http://fawn.ifas.ufl.edu/.

Forgacs J. 1972. Stachybotryotoxicosis. In: Kadis S, Ciegler A, Ajl S, eds. Microbial toxins.
New York: Academic Pr. Vol 8, Fungal Toxins; p 95-128.

Forgacs J, Carll WT, Herring AS, Hinshaw WR. 1958. Toxicity of Stachybotrys atra for animals.
T New York Acad Sci 20:787-808.

Grant C, Hunter CA, Flannigan B, Bravery AF. 1989. Moisture requirements of moulds isolated
from domestic dwellings. Intl Biodeter Biodegr 25:259-284.

Greif MD, Currah RS. 2007. Patterns in the occurrence of saprophytic fungi carried by
arthropods caught in traps baited with rotted wood and dung. Mycologia 99:7-19.

Harrington B. 2003. The effect of medium used on the isolation of Stachybotrys chartarum from
air samples [abstract]. In: 103rd general meeting of the American society for microbiology;
May 18-22; Washington, DC. Herndon, VA: ASM Pr. p 212.

Haugland RA, Heckman JL. 1998. Identification of putative sequence specific PCR primers for
detection of the toxigenic fungal species Stachybotrys chartarum. Mol Cell Probes 12:387-
396.

Haugland RA, Vesper SJ, Harmon SM. 2001. Phylogenetic relationships of Memnoniella and
Stachybotrys species and evaluation of morphological features for Memnoniella species
identification. Mycologia. 93:54-65.









Haugland RA, Vesper SJ, Wyner LJ. 1999. Quantitative measurement of Stachybotrys
chartarum conidia using real time detection of PCR products with the TaqManTM
fluorogenic probe system. Mol Cell Probes 13:329-340.

Heller RM, Heller TW, Sasson JM. 2003 "Tsara'at," Leviticus, and the history of confusion.
Perspect Biol Med. 46:588-591.

Henry JL, Stetzenbach LD. 2000. Isolation of Stachybotrys chartarum from environmental
samples using a cellulose-based medium [abstract]. In: 100th general meeting of the
American society for microbiology; May 21-25; Los Angeles, CA. Herndon, VA: ASM Pr.
p 566.

Hinkley SF, Mazzola EP, Fettinger JC, Lam YKT, Jarvis BB. 2000. Atranones A-G, from the
toxigenic mold Stachybotrys chartarum. Phytochemistry 55:663-673.

Hintikka EL. 1978a. Human stachybotryotoxicosis. In: Wyllie TD, Morehouse LG, ed.
Mycotoxic fungi, mycotoxins, mycotoxicoses: an encyclopedic handbook. Vol 2. New
York: Marcel Dekker. p 87-89.

Hintikka EL. 1978b. Stachybotryotoxicosis in horses. In: Wyllie TD, Morehouse LG, ed.
Mycotoxic fungi, mycotoxins, mycotoxicoses: an encyclopedic handbook. Vol 3. New
York: Marcel Dekker. p 181-185.

Huang S, Kimbrough JW. 1997. Mold allergy is a risk factor for persistent cold-like symptoms in
children. Clin Pediatr 36:695-699.

Hughes SJ. 1958. Revisiones Hyphomycetum aliquot cum appendice de nominibus rejiciendis.
Can J Bot. 36:727-836.

Hyvarinen A, Meklin T, Vepsalainen A, Nevalainen A. 2002. Fungi and actinobacteria in
moisture-damaged building materials concentrations and diversity. Intl Biodeter Biodegr
49:27-37.

Jarvis BB. 2003. Stachybotrys chartarum: a fungus for our time. Phytochemistry 64:53-60.

Jarvis BB, Pavanasasivam GP, Bean,GA. 1985. Mycotoxin production from Myrothecium
species. In: Lacey J. ed. Trichothecenes and other mycotoxins. New York: John Wiley. p
221-231.

Jarvis BB, Salemme J, Morais, A. 1995. Stachybotrys toxins 1. Nat Toxins 3:10-16.

Jarvis BB, Sorenson WG, Hintikka EL, Nikulin M, Zhou Y, Jiang J, Wang S, Hinkley S, Etzel
RA, Dearborn DG. 1998. Study of toxin production by isolates of Stachybotrys chartarum
and Memnoniella echinata isolated during a study of pulmonary hemosiderosis in infants.
Appl Environ Microbiol 64:3620-3625.

Jong SC, Davis EE. 1976. Contribution to the knowledge of Stachybotrys and Memnoniella in
culture. Mycotaxon 3:409-485.









Karunasena E, Markham N, Brasel T, Cooley JD, Straus DC. 2000. Evaluation of fungal growth
on cellulose-containing and inorganic ceiling tile. Mycopathologia 150:91-95.

Koster B. 2006. Evolutionary relationships among members of the fungal form-genus
Stachybotrys, with emphasis on indoor-occurring taxa and the phylogenetic distribution
and evolution of the trichothecene biosynthetic gene, tri5 [Doctoral Dissertation].
University of Toronto, Ontario, Canada. 267 p.

Koster B, Scott J, Wong B, Malloch D, Straus N. 2003. A geographically diverse set of isolates
indicates two phylogenetic lineages within Stachybotrys chartarum. Can J Bot 81:633-
643.

Kuhn, RC, Trimble MW, Hofer V, Lee M, NassofRS. 2005. Prevalence and airborne spore
levels of Stachybotrys spp. in 200 houses with water incursions in Houston, Texas. Can J
Microbiol 51:25-28.

Li CS, Hsu LY, Chou CC, Hsieh KH. 1995. Fungal allergens inside and outside the residences of
atopic and control children. Arch Environ Health 50:38-43.

Li DW. 2007. Stachybotrys eucylindrospora, sp. nov. resulting from a re-examination of
Stachybotrys cylindrospora. Mycologia 99:332-339.

Li DW, Kendrick B. 1995. A year-round comparison of fungal spores in indoor and outdoor air.
Mycologia 87:190-195.

Li DW, Yang CS. 2005. Taxonomic history and current status of Stachybotrys chartarum and
related species. Indoor Air 15:5-10.

Li DW, Yang CS, Haugland R, Vesper S. 2003. A new species ofMemnoniella. Mycotaxon
85:253-257.

Li S, Hartman GL, Jarvis BB, Tak H. 2001. A Stachybotrys chartarum isolate from soybean.
Mycopathologia 154:41-49.

Miller JD. 1992. Fungi as contaminants in indoor air. Atmos Environ 26A:2163-2172.

Miller JD. 2001. Mycological investigations of indoor environments. In: Flannigan B, Samson
RA, Miller JD, eds. Microorganisms in home and indoor work environments: diversity,
health impacts, investigation and control. London: Taylor & Francis. p 231-246.

Money NP. 2004. Carpet monsters and killer spores: a natural history of toxic mold. Oxford:
Oxford Univ Press. 178 p.

Murtoniemi T, Nevalainen A, Hirvonen MR. 2003. Effect of plasterboard composition on
Stachybotrys chartarum growth and biological activity of spores. Appl Environ Microbiol
69:3751-3757.









Nelson BD. 2001. Stachybotrys chartarum: the toxic indoor mold. ASPnet feature story.
Published on the internet at http://www.apsnet.org/online/feature/stachybotrys/.

Nielsen KF. 2003. Mycotoxin production by indoor molds. Fungal Genet Biol 39: 103-117.

Nielsen KF, Holm G, Uttrup LP, Nielsen PA. 2004. Mould growth on building materials under
low water activities, influence of humidity and temperature on fungal growth and
secondary metabolism. Intl Biodeter Biodegr 54:325-336.

Nikulin M, Pasanen A-L, Berg S, Hinitikka E-L. 1994. Stachybotrys atra growth and toxin
production in some building materials and fodder under different relative humidies. Appl
Environ Microbiol 60:3421-3424.

Paine TD, Raffa KF, Harrington TC. 1997. Interactions among scolytid bark beetles, their
associated fungi, and live host conifers. Annu Rev Entomol 42:179-206.

Peltola J, Niessen L, Nielsen KF, Jarvis BB, Andersen B, Salkinoja-Salonen M, Moller EM.
2002. Toxigenic diversity of two different RAPD groups of Stachybotrys chartarum
isolates analyzed by potential for trichothecene production and for boar sperm cell motility
inhibition. Can J Microbiol 48:1017-1029.

Petri A. 1983. Selective medium for the isolation of Stachybotrys molds. Magy Allatorvosok
38:697-698.

Pinruan U, McKenzie EHC, Gareth Jones EB, Hyde KD. 2004. Two new species of
Stachybotrys, and a key to the genus. Fungal Divers 17:145-157.

Renker C, Otto P, Zimdars B, Maraun M, Buscot F. 2005. Oribatid mites as potential vectors for
soil microfungi: study of mite-associated fungal species. Microbiol Ecol 50:518-528.

Ruotsalainen M, Hirvonen MR, Hyvarinen A, Meklin T, Savolainen K, Nevalainen A. 1998.
Cytotoxicity, production of reactive oxygen species and cytokines induced by different
strains of Stachybotrys sp. from moldy buildings in RAW264.7 macrophages. Environ
Toxicol Pharm 6:193-199.

Samson RA, Flannigan B, Flannigan ME, Verhoeff AP, Adan OCG, Hoekstra ES, eds. 1994.
Health implications of fungi in indoor environments. Amsterdam: Elsevier. Chapter 7,
Recommendations; 529-538.

Samson RA, Hoekstra ES, Frisvad JC, Filtenborg 0, eds. 2002. Introduction to food- and air
borne fungi. 6th ed. Utrecht: Centraalbureau voor Schimmelcultures. 379 p.

Samuels GJ, Barr ME. 1997. Notes on and additions to the Niessliaceae (Hypocreales). Can J
Bot 75:2165-2176.

Saitou N, Nei M. 1987. The neighbor-joining method: a new method for reconstructing
phylogenetic trees. Mol Biol Evol 4:406-425.









Shelton BG, Kirkland KH, Flanders WD, Morris GK. 2002. Profiles of airborne fungi in
buildings and outdoor environments in the United States. Appl Environ Microbiol
68:1743-1753.

Siqueira, JO, Hubbell DH, Kimbrough JW, Schenck NC. 1984. Stachybotrys chartarum
antagonistic to azygospores of Gigaspora margarita in vitro. Soil Biol Biochem 16:679-
681.

Smith G. 1962. Some new and interesting species of micro-fungi. III. Trans Br Mycol Soc
45:387-394.

Spurgeon JC. 2003. A method for detecting fungal contaminants in wall cavities. Am Ind Hyg
Assoc J 64:40-47.

Tiffany JA, Bader HA. 2000. Detection of Stachybotrys chartarum: the effectiveness of
culturable-air sampling and other methods. J Environ Health 62:9-11.

Tsai SM, Yang CS, Heinsohn P. 1999. Comparative studies of fungal media for the recovery of
Stachybotrys chartarum from environmental samples. In: Johanning E, ed. Bioaerosols,
fungi and mycotoxins: health effects, assessment, prevention and control. Albany, NY:
Boyd Printing. 330-334.

Tucker K, Stolze JL, Kennedy AH, Money NP. 2007. Biomechanics of conidial dispersal in the
toxic mold Stachybotrys charatarum. Fungal Genet Biol 44:641-647.

Vesper SJ, Dearborn DG, Yike I, Sorenson WG, Haugland RA. 1999. Hemolysis, toxicity and
randomly amplified polymorphic analysis of Stachybotrys chartarum strain. Appl Environ
Microbiol 65:3175-3181.

Vesper SJ, Magnuson ML, Dearborn DG, Yike I, Haugland RA. 2001. Initial characterization of
the hemolysin stachylysin from Stachybotrys chartarum. Infect Immun 69:912-916.

Vesper SJ, Vesper MJ. 2002. Stachylysin may be a cause of hemorrhaging in humans exposed to
Stachybotrys chartatrum. Infect Immun 70:2065-2069.

Visser S, Parkinson D, Hassall M. 1987. Fungi associated with Onychiurus subtenuis
(Collembola) in an aspen woodland. Can J Bot 65:635-642.

Whitton SR, McKenzie EHC, Hyde KD. 2001. Microfungi on the Pandanaceae: Stachybotrys,
with three new species. New Zeal J Bot 139:489-499.

Yang G-H, Jarvis BB, Chung Y-J, Pestka JJ. 2000. Apoptosis induction by the satratoxins and
other trichothecene mycotoxins: relationships to ERK, p38 MAPK, and SAPK/JNK
activation. Toxicol Appl Pharm 164: 149-160.









BIOGRAPHICAL SKETCH

Sarah Brinton Clark Selke was born in West Hartford, Connecticut, the elder daughter of

Newton and Patricia Clark. She graduated from Bates College, Lewiston, ME, in 1995 with a

major in biology and a minor in French. Her first job was working for Bates College's Fall

Semester in Nantes, France, in Fall 1995. Enjoying the traveler's life, Sarah pursued temporary

employment for the next few years while traveling to Ecuador, New Zealand, Australia,

Indonesia, Singapore, Thailand, Turkey, and France. In 1999, Sarah joined the Peace Corps and

worked in the Kingdom of Tonga, South Pacific, where she taught biology and English at

Mailefihi-Siu'ilikutapu high school on the island ofVava'u.

Sarah returned to the United States in 2001 and taught biology and algebra at Bloomfield

High School in Bloomfield, Connecticut, while obtaining her grade 7-12 biology teaching

certification. In 2002, she began her studies at the University of Florida and joined Dr. Jim

Kimbrough's lab in early 2004. During her doctoral studies, Sarah was the lab instructor for

Fundamentals of Plant Pathology and worked with Dr. Bill Zettler in his distance-education

program. For her efforts, Sarah was awarded teaching awards from the National Association of

Colleges and Teachers of Agriculture in 2006 and from the University of Florida Graduate

School in 2007.

Sarah and her husband, Gregg, currently live in Rhode Island. Sarah looks forward to

continuing her teaching career.





PAGE 1

1 DISTRIBUTION AND OCCURRENCE OF Stachybotrys chartarum IN NORTH CENTRAL FLORIDA HABITATS By SARAH BRINTON CLARK SELKE A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2007

PAGE 2

2 2007 Sarah Brinton Clark Selke

PAGE 3

3 To my parents, Newton and Patricia Clark, and my husband, Gregg Selke

PAGE 4

4 ACKNOWLEDGMENTS My m ost sincere thanks go to my committee chair, Dr. Jim Kimbrough, for his invaluable guidance, advice and patience during these four years. It took me a while to find his lab, but it was clear once I did that I had f ound my scientific home, and it has been my great privilege to be his student. I am also very thankful for the suppo rt I have received from all of the members of my supervisory committee. Dr. Gerald Benny has b een an enormous help on nearly every aspect of this project, Dr. Robert McSorley tirelessly answered countle ss statistical questions, Dr. Jeff Jones supported my efforts to become a broadlytrained biologist, and Dr. Bill Zettler provided me with numerous and valuable teaching experi ences. I am so appreciative that my entire committee has understood and supported my inte rest in teaching while at the same time contributing to my development as a researcher In addition I thank Drs. Bob McGovern and Raghavan Charu Charudattan for their guidance during my first two years in Gainesville and Dr. Gail Wisler who provided a teaching assistantship for me. I am very grateful for all the friends that I made while in Gainesville and whose presence in my life has been critical for my success. Dr. Alana Den Breeen, Heidi Hanspetersen, Linley Smith, and Tara Tarnowski have made my professi onal and personal lives rich er. In particular, I thank Linley and Tara for invaluable advice on phylogenetics, Alana and Dr. Abby Guerra for daily tea, and the Jeff and Heidi Hanspetersen Guest House for their company and support while writing this dissertation. I also thank Ms. Gail Harris, Ms. Donna Perry, Ms. Lauretta Rahmes, Ms. Jan Sapp, Ms. Sherri Mizell and Ms. Dana Lecuyer for hugs, candy and endless behind-thescenes help. Mr. Cecil Shine a nd Mr. John Thomas were an enormous help with many aspects of my field research, for which I am very grateful. My familys love, unconditional support and encouragement demand special mention. I thank my parents, Newt and Pat Clark, and my si ster, Abby Luchies, for always believing that I

PAGE 5

5 could complete this journey. I especially th ank my husband, Dr. Gregg Selke, for leading the way.

PAGE 6

6 TABLE OF CONTENTS page ACKNOWLEDGMENTS...............................................................................................................4 LIST OF TABLES................................................................................................................. ..........8 LIST OF FIGURES.......................................................................................................................10 ABSTRACT...................................................................................................................................11 CHAP TER 1 INTRODUCTION..................................................................................................................13 Taxonomic History of Stachybotrys chartarum and Related Species .................................... 13 Morphology of Stachybotrys chartarum ................................................................................17 Stachybotrys chartarum Mycotoxin Production and Hum an Health.................................... 18 2 COMPARISON OF SEMI-SELECTIVE MEDIA FOR DETECTION OF Stachybotrys chartarum FROM AIR SAMPLES ........................................................................................ 22 Introduction................................................................................................................... ..........22 Materials and Methods...........................................................................................................24 Indoor Sampling..............................................................................................................24 Outdoor Sampling...........................................................................................................26 Results.....................................................................................................................................27 Indoor Study....................................................................................................................27 Outdoor Study.................................................................................................................28 Discussion...............................................................................................................................29 3 FREQUENCY AND ABUNDANCE OF Stachybotrys chartarum AND OTHE R COMMON FUNGAL GENERA IN OUTDO OR HABITATS IN NORTH CENTRAL FLORIDA...............................................................................................................................40 Introduction................................................................................................................... ..........40 Materials and Methods...........................................................................................................41 Study Sites.......................................................................................................................41 Description of Traps........................................................................................................ 43 Sampling..........................................................................................................................43 Data Analysis...................................................................................................................44 Results.....................................................................................................................................45 Stachybotrys chartarum ...................................................................................................45 Other Stachybotrys species ..............................................................................................47 Other Genera...................................................................................................................48 Discussion...............................................................................................................................48

PAGE 7

7 4 IDENTIFICATION OF PUTATIVE Stachybotrys chartarum ISOLATES FROM NORTH-CENTRAL FLORIDA HABITATS........................................................................ 68 Introduction................................................................................................................... ..........68 Materials and Methods...........................................................................................................71 Preparation of Fungal Isolates......................................................................................... 71 DNA Extraction, PCR Amplification, and Sequencing.................................................. 71 Phylogenetic Analysis.....................................................................................................73 Results.....................................................................................................................................73 Discussion...............................................................................................................................75 5 DISCUSSION.........................................................................................................................86 APPENDIX A lOCATION OF SITES AND SAMPLI NG DATES FOR FIELD ST UDY........................... 89 B ALIGNMENTS OF TR I5 AND CHS1 NUCLEOTIDE SEQUENCES................................. 91 LIST OF REFERENCES.............................................................................................................107 BIOGRAPHICAL SKETCH.......................................................................................................114

PAGE 8

8 LIST OF TABLES Table page 2-1 Total number of fungal and bacterial co lonies recovered on different m edia from master bedroom, for two different samplings.................................................................... 34 2-2 Total fungal and bacterial colonies rec overed on different m edia from living room, for two different samplings................................................................................................35 2-3 Total Stachybotrys chartarum colonies recovered on diffe rent m edia from master bedroom, for two diffe rent samplings................................................................................ 36 2-4 Total Stachybotrys chartarum colonies recovered on di fferent m edia from living room, for two different samplings..................................................................................... 37 2-5 Stachybotrys chartarum colonies as percent of total colonies recovere d on different m edia from master bedroom, for two different samplings................................................ 38 2-6 Stachybotrys chartarum colonies as percent of total colonies recovere d on different m edia from living room, for two different samplings........................................................ 39 3-1 Frequency of recovery of Stachybotrys chartarum at four sites, 2005. ............................. 58 3-2 Frequency of recovery of Stachybotrys chartarum at four sites, 2006. ............................. 58 3-3 Abundance of Stachybotrys chartarum at four sites, 2005. ............................................... 58 3-4 Abundance of Stachybotrys chartarum at four sites, 2006. ............................................... 58 3-5 Colony size determined as average nu m ber of sampled drywall cells with Stachybotrys chartarum growth......................................................................................... 59 3-6 Weather data June 2005 to May 2007................................................................................ 60 3-7 Frequency of recovery of Stachybotrys chlorohalonata June 2005 to May 2007, at four sites. .................................................................................................................... ........61 3-8 Frequency of recovery of Stachybotrys bisbyi June 2005 to May 2007, at four sites. ..... 62 3-9 Abundance of Stachybotrys bisbyi June 2005 to May 2007, at four sites. ....................... 62 3-10 Frequency of recovery of Stachybotrys kampalensis June 2005 to May 2007, at four sites. ......................................................................................................................... ..........63 3-11 Abundance of Stachybotrys kampalensis June 2005 to May 2007, at four sites. .............63 3-12 Abundance of Cladosporium spp., June 2005 to May 2007, at four sites. ........................64

PAGE 9

9 3-13 Abundance of Alternaria spp., June 2005 to May 2007, at four sites. .............................. 65 3-14 Abundance of Epicoccum spp., June 2005 to May 2007, at four sites. ............................. 66 3-15 Abundance of Bipolaris Drechslera, Curvularia spp.com plex, June 2005 to May 2007, at four sites...............................................................................................................67 4-1 Isolate number, species, origin and collection date of 44 Stachybotrys isolates from outdoor habitats in north central Florida............................................................................ 82 4-2 Comparison of pigmentation and tri5 and chs1 sequence data for Stachybotrys chartarum and S. chlorohalonata isolates from outdoor habitats in north central Florida........................................................................................................................ ........83 4-3 Genbank accession numbers for chs 1 and tri5 nucleotide sequences for Stachybotrys chartarum ...........................................................................................................................84 4-4 Genbank accession numbers for chs 1 and tri5 nucleotide sequences for Stachybotrys chlorohalonata ...................................................................................................................85 A-1 GPS location of study sites................................................................................................89 A-2 Summary of sampling dates............................................................................................... 90

PAGE 10

10 LIST OF FIGURES Figure page 2-1 Private residence in Gainesville, FL with Stachybotrys chartarum infestation................. 33 3-1 Study sites in Gainesville, Florida.....................................................................................54 3-2 Trap design................................................................................................................ .........55 3-3 Trap placement in the field................................................................................................ 56 3-4 Sampling technique......................................................................................................... ...57 4-1 Extracellular pigmenta tion on Czapek yeast autolysate agar (CYA). ...............................79 4-2 Neighbor-joining tree for chs 1 gene for Stachybotrys chartarum and S. chlorohalonata outdoor isolates. ....................................................................................... 80 4-3 Neighbor-joining tree for tri 5 gene for Stachybotrys chartarum and S. chlorohalonata outdoor isolates. ....................................................................................... 81 B-1 Alignment of tri5 nucleotide sequence. .............................................................................91 B-2 Alignment of chs1 nucleotide sequence.......................................................................... 101

PAGE 11

11 Abstract of Dissertation Pres ented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy DISTRIBUTION AND OCCURRENCE OF Stachybotrys chartarum IN NORTH CENTRAL FLORIDA HABITATS By Sarah Brinton Clark Selke December 2007 Chair: James W. Kimbrough Major: Plant Pathology Stachybotrys chartarum is a mycotoxin-producing, cosmopol itan fungus that occurs on a variety of natural substrates as well as cellulo se-based building material s such as drywall and ceiling tiles. This black mold has aroused public interest because it has been implicated in cases of sick building syndrome and pulmonary hemorrh age. Because it is likely that outdoor populations serve as the source of inoculum for mold colonies in water-damaged structures, it is critical to understand the t ypes of environments that support natural populations of S. chartarum The primary objective of this research was to id entify outdoor habitats in north central Florida where S. chartarum is found and the times of year it is most abundant. Several semi-selective media were identified for this purpose; however detection of S. chartarum from outdoor air was a rare event, suggesting that air sampling w ould not be appropriate for investigating the occurrence of S. chartarum in outdoor habitats. Instead, traps with pieces of wetted drywall were placed in four habitats in Gainesville, Flor ida: a pine grove, a citrus grove, a lakeside and a hardwood forest. Over the course of 24 months, S. chartarum was found growing at all four habitats but only rarely, occurr ing on only 0.02% of the pieces co llected. Because the frequency of S. chartarum was so low, most differences in abundan ce between sites were not significant. Stachybotrys chartarum was recovered most frequently from the citrus grove, and at all sites, it

PAGE 12

12 was found only during the summer months. There was a correlation between S. chartarum occurrence and temperature but not with rainfall. The morphological species S. chartarum contains two chemotypes, S. chartarum chemotype S and S. chartarum chemotype A, which produce different mycotoxins. Th e Florida field isolat es were compared phylogenetically using the trichodiene synthase 5 and ch itin synthase 1 gene fragments. Seventy percent of the outdoor isolates were identified as S. chartarum chemotype A and only 30% were identified as chemotype S. This may have a positive implica tion for public health in north central Florida since chemotype A does not produ ce highly toxic macrocyclic tricothecenes. As a diagnostic tool, neither locus correctly identified all isolates, and more accurate molecular markers should be identified.

PAGE 13

13 CHAPTER 1 INTRODUCTION Stachybotrys chartarum (Ehrenb.) H ughes (= Stachybotrys atra Corda) is a dermatiaceous hyphomycete of worldwide distribution. It has b een isolated from soil (Barron 1968, Ellis 1971), from decaying plant material (Ellis 1971, Whitton et al. 2001), on animal fodder (Drobotko 1945), as a parasite of other fungi (Siqueira et al. 1984), and in a ssociation with liv ing plants (ElMorsy 1999, Li et al. 2001). Some of the more unusual natural substrates include woodchuck dung (Jong and Davis 1976) and seaweed (Andersen et al. 2002). A strong ly cellulolytic fungus, S. chartarum has also been isolated from a variety of cosmopolitan materials derived from plant fibers such as paper, cotton, and canvas (Bisby 1943, Jong and Davis 1976). Of current interest is the frequent isolation of S. chartarum from construction material s including drywall, ceiling tiles and wallpaper in buildings that have e xperienced water damage (Li and Yang 2005). The recovery of S. chartarum spores from indoor air samp les and its known production of mycotoxins have led to increased public interest in this f ungus in recent years (Nelson 2001, Money 2004). Taxonomic History of S tachybotrys chartarum and Related Species The genus Stachybotrys Corda was first described in 1837 to accommodate a black mold found growing on the wall of an apartment in Pr ague, Czech Republic. The type species is S. atra Corda, and the genus is characterized by se ptate and branched hyphae, conidiophores that terminate in a whirl of phialides, and twocelled pigmented conidia (Corda 1837). The etymology of Stachybotrys refers to its characteristic crown of phialides, with the Greek prefix stachyreferring to a spik e and botrys meaning a bunch of grapes. From 1837 to 1886, seven new species were described, one with twocelled spores, and the other six have one-celled

PAGE 14

14 conidia. By 1943, there was a total of twenty Stachybotrys species, with the tw elve new taxa all being unispored (Bisby 1943). Bisby undertook the first major revision of the genus, reducing the number of Stachybotrys species to two, S. atra Corda and S. subsimplex Cooke. Based on studies of cultures and herbarium specimens, S. alternans Bonord., S. asperula Massee S. atrogrisea Ellis & Everh. S. cylindrospora Jensen, S. dakotense Sacc. S. dichroa Grove S. elasticae Koord. S. gracilis E.J. Marchal S. pulchra Speg., S. scabra Cooke & Harkn. and S. verrucosa Cooke & Massee were reduced to synonymy with S. atra as were Aspergillus alternatus Berk., Spororcybe lobulata Berk. Synsporium biguttatum Preuss, and Memnonium sphaerospermum Fuckel. Bisby (1943) suggested that there was great morphological variation in Stachybotrys atra which accounted for the 15 synonyms and hypothesized th at even an unnamed pink Stachybotrys could belong to this species. He attributed Cordas observati on of two-celled conidia to the one, three or, most commonly, two guttulae which he observed, noting that under Cordas microscope such spores would seem definitely septate. Thus the emended description of the genus Stachybotrys read as follows: Hyphae, phialophores, and phialides hyaline, brightly coloured, or dark; strands or ropes of hyphae may be produced. Conidia (slimespores) one-celled, normally dark and accumulating into a cluster. The distinctive characteristic of the genus is the septate phialophore or simple conidi ophore bearing a crown of phial ides and generally becoming dark. A phialophore arises directly from a hypha or, frequently, from another phialophore. Perfect stage unknown. Stachybotrys atra was described as having phialides 10-16 x 5 m and conidia 8-12 (14) x 4-9 (12) m, elliptical to oval on younger growth of the fungus, often subglobose on older growth. Stachybotrys subsimplex was described as having simple, rather than branched, conidiophores, and smaller phialides (6-12 x 4-6 m) and conidia (4-10 x 3-5 m) than S. atra.

PAGE 15

15 The species was thought to be synonymous with Gliobotrys alboviridis Hhn. and Memnoniella echinata (Rivolta) Galloway (Bisby 1943). Bisby felt that the genus Memnoniella Hhn., which had as its only major difference from Stachybotrys the occurrence of its conidia in chains as opposed to a slimy head, could actually be S. simplex with slime production reduced sufficiently to allow the retention of spores in chains. The binomial Stachybotrys chartarum was first used by Hughes in 1958 after reexamining the type material of S. atra He identified three homotypic synonyms, Stilbospora chartarum Ehrenb. 1818, Oidium chartarum Ehrenb. ex Link 1824 and Oospora chartarum (Ehrenb. ex Link) Wallr. 1833. Hughes recombined the names as Stachybotrys chartarum (Ehrenb.) Hughes (= S. atra Corda). Although some authors continued to use S. atra for some time (Ellis 1971), Stachybotrys chartarum currently is the universally accepted name. Jong and Davis (1976) recognized 11 species of Stachybotrys (S. altipes (Berk. & Broome) S.C. Jong & Davis S. bisbyi (Sriniv.) G.L. Barron S. chartarum, S. cylindrospora, S. dichroa, S. kampalensis Hansf. S. microspora B.L. Mathur & Sankhla S. nephrospora Hansf. S. oenathes Ellis S. parvispora Hughes S. theobromae Hansf.) and two species of Memnoniella S. cylindrospora and S. dichroa were taxa resurrected from Bisbys treaties, and two new combinations were proposed, S. albipes (Berk. & Br.) Jong & Davis and S. microspora (Mathur & Sankha) Jong & Davis. In addition, S. saccharia (Srinivasan) Barron was synonymized with S. bisbyi (Srinivasan) Barron, as was S. reniformis Tubaki. Stachybotrys sinuatophora Matsush. was considered the synonym of S. nephrospora Hansf. The most recently published key includes 52 species of Stachybotrys, and four species of Memnoniella (Pinruan et al. 2004). However, only a few of these fungi are reported freque ntly in literature (A ndersen et al. 2003). Stachybotrys sinuatophora is not considered a synonym of S. nephrospora in this key.

PAGE 16

16 Taxonomic uncertainty in the genus continues as recently as 2007 when the type species of S. cylindrospora was reclassified as S. chartarum and a new species, S. eucylindrospora Li was described (Li 2007) Andersen et al. (2002, 2003) proposed two chemotypes of S. chartarum based on differing metabolite production. Chemotype S produces macr ocyclic trichothecenes including satratoxins and roridins. Chemotype A produ ces atranones and dolabellanes. Jong and Davis (1976) confirmed that Stachybotrys and Memnoniella represented two different genera based on mor phological differences in the arra ngement of the conidia, and reported work by Campbell (1972, 1 974) that showed that in Stachybotrys, the new conidia arise after the previous ones are mature and have been released from the phialide neck. This is in contrast with Memnoniella where the new conidia arise in basipetal succession before the previous ones are mature. Therefore, the conidial chains formed by Memnoniella are not a result of less slime production as suggested by Bisby (1943). The status of the genus Memnoniella continues to be controve rsial (Li et al. 2003, Pinruan et al. 2004). Using sequence data from 18S, 28S, 5.8S rDNA genes and the ITS1 and ITS2 regions, Haughland et al. (2001) evaluated the evolutionary re lationship between the two genera. They concluded that Memnoniella and Stachybotrys are paraphyletic and proposed renaming M. echinata and M. subsimplex as S. echinata and S. subsimplex respectively. One strain in the study, identified as an isolate of M. subsimplex showed morphological features typical of M. subsimplex, but fell into the M. echinata clade based upon a phylogenetic analysis. After further study, this culture was described as a new species, Memnoniella longistipitata D.W. Li, Chin S. Yang, Vesper & Haugland (Li et al 2003) with the note that since Memnoniella was apparently still accepted, the new species was being placed in that genus. Other authors believe that

PAGE 17

17 Memnoniella is not a valid genus and advocate transferring all Memnoniella species to Stachybotrys (Smith 1962, Carmichael et al. 1980, Pinruan et al. 2004). Stachybotrys albipes is the only species for which a sexual state, Melanopsamma pomiformis (Pers. ex Fr.) Sacc., has been identifie d (Booth 1957, Castlebury et al. 2004). The genus Melanopsamma Niessel was placed in the Niessliaceae (Hypocreales) by Samuels and Barr (1997), but this classificati on has been questioned. Castlebur y et al. (2004) investigated higher-level phylogenetic relationships of the genus Stachybotrys and found that it formed a previously unknown monophyletic lineag e within the Hypocreales that also included species of Myrothecium Tode. Like Stachybotrys, Myrothecium produces macrocyclic trichothecenes (Jarvis et al. 1985), and the two genera share mor phological features such as slimy dark black to green conidia that are produced from phialides. It has been suggested that these genera comprise a newly discovered sister lineage to the other families currently accepted in the Hypocreales (Castlebury et al. 2004). Morphology of Stachybotrys chartarum Bisby (1943) recognized the m orphological variety that exists among isolates of S. chartarum and subsequent authors ha ve reaffirmed this obser vation (Andersen et al. 2002, Andersen et al. 2003, Li and Ya ng 2005). Jong and Davis (1976) described the species when grown on Corn Meal Agar as follows: Condiophores determinate, macronematous, solitary or in groups, erect, straight or slightly curved, simple or ir regularly branched, 2-4 septate, hyaline at the base, dark olivaceous toward the apex, length variable up to 1000 m long, 3-6 m wide, the basal cell slightly inflated, sometimes minutely rough -walled at the upper pa rts, sometimes more or less smooth throughout the length, slightly enlarged at the apex which bears terminal phialides in a whorl of 39 around a central phialides. Phialides enteroblastic, determinate, discrete unicellular, at first hyaline, later dark olivaceous, obovate or ellipsoid, smooth-wa lled, 9-14 x 4-6 m, with conspicuous collarettes.

PAGE 18

18 Phialoconidia acrogenous, arising singly and succ essively as separate units, aggregated in slimy masses, at first hyaline, when mature dark olive gray, more or less opaque, smoothwalled or showing banded or ridged, ellips oidal, unicellular, 7-12 x 4-6 m. Jong and Davis (1976) described th e distinguishing features of S. chartarum as the ridged or banded surface of the mature conidia as well as th eir size. Therefore, it is interesting that Ellis (1971) described the conidial dime nsions as 8-11 x 5-10 m and Bi sby (1943) as 8-12 x 4-9 m. The range of measurements in these various de scriptions of S. chartarum led to some confusion regarding its species delineation (Anders en et al. 2002, 2003, Li and Yang 2005). The recognition of S. chlorohalonata B. Andersen & Thrane as a distinct specie s, and the use of metabolic profiles to identify chemotypes of S. chartarum may clarify the current situation (Andersen et al. 2003). Stachybotrys chartarum Mycotoxin Production and Human Health Although some authors trace repor ts of mold-induced sick building syndrome back to books of Exodus and Leviticus in the Old Test ament (Heller et al. 2003, Jarvis 2003), the widely-accepted first report of S. chartarum causing illness in humans or other animals was in the USSR in the 1930s when stac hybotryotoxicosis epid emics occurred in horses in the Ukraine which had consumed Stachybotrys -infested hay (Drobot ko 1945). Although stachybotryotoxicosis has occurred in anim als in Eastern Europe throughout the 20th century, (Forgacs 1972), it has not been a problem in North America where a combination of favorable farming conditions and good agricult ural practices have thwarted serious infestations of fodder with S. chartarum (Jarvis 2003). Drobotko (1945) characterized the di sease in horses as having three stages. Stage one is marked by irritation and ulcers of the mouth, throat, nose and lips. The second stage lasts several days to a month during which a low white blood ce ll count occurs. Only a few cases pass into the third stage where a fever of 40 41oC develops and remains until death. Disease progression

PAGE 19

19 depends upon the amount of mold that is consumed and the period of time over which consumption occurs (Hintikka 1978b). An atypi cal form of the disease, characterized by neurological disorders including loss of reflex response and vision and noted by Forgacs et al. (1958), follows the ingestion of large quantities of contaminated feed. Afflicted animals usually die within 24 hours of showing symptoms. Although it was suspected that stachybotryot oxicosis was caused by mycotoxins (Drobotko 1945), they were not characterized un til Eppley and Bailey (1973) identified five toxic compounds from isolates of S. chartarum including the macrocyclic trichothecenes roridin E and satratoxin G and H. Named after the fungus Trichothecium roseum (Pers.) Link from which the first trichothecene was isolated in 1948 (Desjardins et al. 1993), trichothecenes are an important class of sesquiterpenes that include the T-2 toxin produced by several species of Fusarium Link. A sub-class of this group is the macr ocyclic tricothecenes which are the most potent inhibitors of eukaryotic protein synthesis; they are considered to be among the most important and acutely toxic of the mycotoxins (Jarvis 2003). Macrocyc lic tricothecenes shown to be produced by S. chartarum include roridin E and L-2, satratoxins F, G and H, isosatratoxins F, G, and H, verrucarins B and J, and two t ypes of trichoverroids, tr ichoverrols A and B and trichoverrins A and B (Nelson 2001). Stachybotrys chartarum produces several other types of metabolites that are toxic to mammalian cells. Approximately 10-40 spirocyclic dr imanes have been identified, and this class of metabolites has a broad range of activitie s including enzyme inhibition, cytotoxicity and neurotoxicity (Jarvis et al. 1995, Nielsen 2003). In addition, st achylysin causes leakage or rupturing of red blood cells (Vesper et al. 1999, 2001), and spirocyclic drimanes are potent immunosuppresants (Jarvis et al. 1995, Jarvis 200 3). A novel class of compounds, the atranones,

PAGE 20

20 was recently identified (Hinkley et al. 2000), although it is unknown if they have significant biological activity (Jarvis 2003). In European regions that reported occurren ces of equine stachybotryotoxicosis, humans who handled Stachybotrys-contaminated material developed symptoms similar to those found in horses (Forgacs 1972, Hintikka 1978a). Common symptoms included a rash, particularly in areas of perspiration such as underarms, dermatitis, pain, inflammation and/or a burning sensation in the mouth and nasal passages, tight ness of the chest, cough, fever, headache and fatigue (Nelson 2001). The first report of stachybotryotoxicosis in North America was in a residence in Chicago (Croft et al. 1986). Over a five-year peri od, a family of five individuals exhibited symptoms including cold and flu-like illness, sore throat s, diarrhea, headaches, fatigue, dermatitis, intermittent hair loss, and generalized malaise. Stachybotrys chartarum spores were isolated from an interior duct as well as from ceiling material. Extracts from spores collected from these areas were injected into mice, and within 24 hours of exposure, all of the animals died. Extracts from the ceiling fiber board were shown to contain the m acrocyclic trichothecenes verrucarin J and satratoxin H as well as the precursors trichoverrins A and B. This report was believed to be an isolat ed incident until the mid-1990s (Jarvis 2003, Money 2004). Between January 1993 and Decemb er 1994, ten infants were hospitalized with bleeding lungs at Rainbow Babies and Childrens Hospital in Cleveland, Ohio and diagnosed with acute pulmonary hemorrhage/ hemosiderosis (Anonymous 1994, 1997). These patients represented an unusually high number of cases, as only three infants had been diagnosed with acute pulmonary hemosiderosis from 1983-1993 (Anony mous 1994). All of the infants lived in homes that had been severely water da maged in the previous six-months, and S. chartarum was isolated from eight of nine homes that were tested (Anonymous 1997, Et zel et al. 1998, Dearborn

PAGE 21

21 et al. 1999). R.A. Etzel, a pediatrician from th e Centers for Disease Control (CDC, Atlanta, GA) and D.G. Dearborn, a pulmonary pediatrician from the Rainbow Babies and Childrens Hospital, both hypothesized that infant pulmona ry hemorrhage might be caused by exposure to mycotoxins produced by S. chartarum (Anonymous 1997, Etzel et al. 1998, Dearborn et al. 1999). Although the CDC eventually retracted its earlier support of this association (Anonymous 2000), evidence continues to grow regarding th e link between the two (Elidemir et al. 1999, Vesper and Vesper 2002). Despite the significance of S. chartarum in issues regarding public health and the fact that it has been isolated from a wide variety of ma terials, a comprehensive ecological study that identifies different habitats that support S. chartarum populations in nature has never been undertaken. It is critical to unders tand the types of environments that support natu ral populations of S. chartarum because it is likely that th e source of indoor contamination is air-borne spores that are deposited on the surface of building ma terials at their constr uction sites (Nelson 2001, Koster 2006). The development of a semi-selective growth medium that affords the usually slow-growing S. chartarum a competitive advantage when present with other common air-borne spores is the focus of chapter 2. Chapter 3 focuses on the distribution and occurrence of Stachybotrys spp. across four different habita ts. The mycotoxin profile of S. chartarum can no longer be associated with part icular morphological criteria (Ande rsen et al. 2003). A molecular characterization of the north central Florida is olates collected from these field studies was undertaken to distinguish between the two chemotypes and determin e their prevalence (Chapter 4). In chapter 5, a summary of the information is provided and future suggestions for research are discussed.

PAGE 22

22 CHAPTER 2 COMPARISON OF SEMI-SELECTIVE MEDIA FOR DETECTION OF Stachybotrys chartarum FROM AIR S AMPLES Introduction Stachybotrys chartarum is a m ycotoxin-producing, cosm opolitan fungus that occurs on water-damaged, cellulose-based building materials su ch as drywall and ceiling tiles. This black mold has aroused public interest because it ha s been implicated in cases of sick building syndrome and pulmonary hemorrhage (Croft et al. 1986, Etzel et al. 1998, Dearborn et al. 1999). From a human health perspective, it is of paramount importance that S. chartarum be accurately and consistently isolated from environmental samples. Common detection methods of suspected mold contamination are bioaerosol, swab, tape, or bulk sampling (Miller 2001). Th ere is no ideal method for the sa mpling of fungal particles in indoor air, in part because no one medium exists for air sampling that is ideal for use in every environment (Samson et al. 1994). Recommended broad-spectrum media for use in indoor air sampling are Dichloran 18% Glycerol Agar (DG 18), Malt Extract Agar (MEA) and Water Agar (Samson et al. 1994). However, S. chartarum has rarely been isolated from fungal air samples using these media (Andersen and Nissen 2000, Tiffany and Bader 2000). It is possible that S. chartarum spores do not become airborne easily becau se they are produced in wet slimy heads (Tucker et al. 2007). In addition, it has been re ported that up to 90% of the spores that do become airborne may not be viable (Miller 1992). An alternative hypothesis is that viable S. chartarum spores are airborne but that they are underreported in air sampling studies because 1) often they are found in conjunction with other common, fast-growing fungi such as species of Penicillium, Aspergillus, Cladosporium and Curvularia that outcompete the slower-growing S. chartarum and 2) commonly-used media do not meet its growth requirements. For example, S. chartarum will not sporulate on DG18, which

PAGE 23

23 is recommended for general detection of fungi indoors (Andersen and Nissen 2000). This is not surprising since DG18 is selective for xer ophilic fungi; Stachybotrys requires a water activity higher than 0.9 for growth (Grant et al. 1989). Stachybotrys chartarum growth on MEA, another recommended medium, is very restricted, and so me isolates will not sporulate on it (Andersen and Nissen 2000). The necessity of a selective medium for S. chartarum has been recognized by professionals for over a decade (Samson et al. 1994), and resear chers have proposed several possibilities that favor the isolation of S. chartarum from an environmental sample containing many different organisms. This medium must meet its growth requirements while restricting the growth of competing fungi. Since S. chartarum is a cellulose-digesting saprobe, a cellulose-based agar medium amended with Rose Bengal to inhib it other fungi has been recommended (Petri 1983, Henry and Stetzenbach 2000). El-Kady (1988) suggests a similar medium, Cellulose-Czapeks Agar, amended with Rose Bengal and adjusted to a pH of 8. Tsai et al. (1999) included Czapeks Cellulose Agar and Rose Bengal Agar in their su rvey of selective media, but they recommended using unamended Cornmeal Agar (CMA) because they found interference from species of Aspergillus, Chaetomium, Cladosporium, and Penicillium on Czapeks celluose agar. Billups et al. (1999) did not get satisfact ory results using cellulose ag ar when trying to isolate Stachybotrys from mixed cultures with Aspergillus flavus, A. niger, Cladosporium brevitomosum and Penicillium chrysogenum Potato dextrose agar (PDA) ame nded with the antibiotic/antimycotic agent Miconazole was a better isolation medium (Billups et al. 1999). Other authors have recommended Oatmeal Agar, Hay Agar (Samson et al. 2002), a low nutrient medium such as Water Agar with a piece of ster ile filter paper on the surface (H arrington 2003) or V8 Agar with antibiotics (Andersen and Nissen 2000).

PAGE 24

24 In this study, air samples were collected from indoor and outdoor air in Florida, a state with temperate and subtropical climates that are conducive to fungal growth. Huang and Kimbrough (1997) conducted a survey of 41 Florid a homes with children ages 4-14, some of whom suffered from mold allergies. Species of Cladosporium, Penicillium, Curvularia, Epicoccum and Alternaria accounted for 80% of the total fungi isolated. Bishop (2002) sampled outdoor air during summer months in north central Florida and di d not report the occurrence of any Stachybotrys spp. Species of Cladosporium, Geotrichum, Fusarium, and Penicillium accounted for over 85% of the to tal fungi found outdoors. This study used low pH Mycological Agar which is not considered to be a good medium for recovery of S. chartarum The obective of the present study was to id entify a medium or media that are semiselective for S. chartarum spores in indoor and outdoor air. A medium that favors the recovery of S. chartarum from indoor air samples would be useful to industrial hygieni sts. In addition, it has been suggested that the source of S. chartarum building contaminatio n is likely inoculum from outdoor air (Koster 2006). Stachybotrys chartarum is only rarely reported from outdoor air samples; a semi-selective medium could be used to provide a better understanding of the presence of S. chartarum in outdoor environments. Materials and Methods In this study, ten m edia were e xposed in a residence with known S. chartarum contamination. The media w ith the best recovery of S. chartarum were then evaluated in outdoor settings in order to determine wh ich was most effective when recovering S. chartarum at low concentrations. Indoor Sampling In July 2006, air sam pling was undertaken at a private residence in Gainesville, FL, USA, that was known to be contaminated with S. chartarum There was visible growth of S.

PAGE 25

25 chartarum that had been present for several week s on the master bedroom carpet, covering approximately 0.3 m3. Sampling was done in the master be droom and the living room (Figure 21). Previously, S. chartarum had been recovered from the livi ng room; remediation occurred at that time, and the carpet was removed, the mold cleaned, and wood floori ng was laid. At the time of sampling, the master bedroom was unoccupied. Air samples were taken for 2 min in the master bedroom and the living room using an Andersen one-stage culture plate impactor (N6, A ndersen Samplers, Inc., Atlanta, GA) with an Aerolite pump (Aerotech Instruments, Aerotech P & K, Allegro Industries) drawing 28.3 L of air per minute. Sampling occurred at a height of 0.6 m above the ground. Effort was made not to disturb the area of fungal growth in the bedroom so as to prevent the releas e of spores that would not normally be airborne. Ten media were used: BBLTM Corn Meal Agar (CMA, Becton, Dickson and Co., Sparks, MD), DifcoTM Potato Dextrose Agar (PDA, Becton, Dickson and Co, Sparks, MD), Potato Dextrose Agar with 0.05 g Rose Bengal per liter (PDA RB), Potato Dextrose Agar with1 ml Tergito l per liter (PDA T), Potato De xtrose Agar with 0.05 g Rose Bengal and 1 ml Tergitol per liter (PDA RB/T), V8 Agar with 2 g of CaCO3 per L (V8/2, Atlas 1993), V8 Agar with 4 g of CaCO3 per L (V8/4), Water Agar with sterile filter paper (WAFP, Atlas 1993), Water Agar with sterile filter pape r and 0.05 g Rose Bengal per liter (WAFP RB), and wetted 4 cm x 4 cm squares of 1.3 cm () thick sterile drywall. All agar plates contained 24 mL of medium. There were three replications for each medium, and a randomized complete block design was used. The Andersen N6 sa mpler was wiped down with 95% ethanol before sampling, between each sample, and at the e nd of sampling. Sampling was repeated the following day. Samples were incubated in the dark at 24oC for seven days.

PAGE 26

26 Total number of fungal and bacter ial colonies and number of S. chartarum colonies were counted and recorded as colony formi ng units per cubic meter of air (CFU/m3). Stachybotrys chartarum was identified microscopically at 400x. Representative colonies from each room were grown on Czapek Yeast Autolysate Agar (C YA, Samson et al. 2002) and incubated in the dark for seven days at 24oC at which point they were eval uated for pigment production. This was done to differentiate between S. chartarum and S. chlorohalonata which are similar morphologically. Stachybotrys chlorohalonata produces a dark green extracellular pigment on CYA. Percent recovery of S. chartarum from total colonies was calculated. Data were logtransformed, except for percent recovery of S. chartarum and the data were analyzed as a twoway factorial. The analysis of variance showed an interaction between ro om and media, so the data were analyzed by room. Pvalues less than 0.10 were consid ered significant, and in these cases, means were separated by th e Waller-Duncan k-ratio t test. Data were analyzed using SAS statistical software (Version 9.1, SAS Institute, Cary, NC). Outdoor Sampling Four m edia from the indoor air study (CMA, PD A RB, V8/2, WAFP RB) were used in this study. The V8 agar was amended with 0.1 g streptomycin sulfate and 0.05 g chlorotetracycline hydrochloride per liter. Sampli ng occurred at two sites on the University of Florida campus, Gainesville, FL, USA, a managed citrus grove (29o38N, 82o21W) and a grassy parking area (29o38N, 82o21W). Sampling occurred between 8 AM and 11 AM on ten dates from Apr July 2007 at intervals of approximately ten days. Air samples were taken for 2 min using the Andersen N6 sampler with an Aerolite pump (Aerotech Instruments, Aerotech P & K, Allegro Industries) drawing 28.3 L of air per minute. Sampling occurred at a height of 0.6 m. There were three replications for each medium and a randomized complete block design was used. The Andersen air sampler was wiped dow n with 95% ethanol before sampling, between

PAGE 27

27 each sample, and at the end of sampling. Samples were incubated in the dark at 24oC for ten days. Total numbers of colonies of filamentous fungi were counted on day 3 and recorded as colony forming units per cubic meter of air (CFU/m3), with the exception of the WAFP RB plates which were read on Day 10. On day 5, th e plates were observed at 30x, and the number of colonies of Stachybotrys, Alternaria, Curvularia Cladosporium, Bipolaris/Dreschlera, Epicoccum, Penicillium and Aspergillus was recorded for all samples on PDA RB and V8/2 media. The presence or absence of these gene ra was noted for samples on CMA and WAFP RB. Putative S. chartarum colonies were isolated and grow n on Czapek Yeast Autolysate Agar (CYA, Samson et al. 2002) and incubated in the dark for seven days at 24oC, at which point they were evaluated for pigment production. Results Indoor Study Because there was a sig nifican t interaction between room and media for total colonies (p<0.01 Day 1, p<0.001 Day 2), Stachybotrys colonies (p<0.001 Day 1, p<0.001 Day 2) and Stachybotrys as a percent of total colonies (p<0.001 Day 1, p<0.01 Day 2), the data were analyzed by room. The means of the total number of CFU/m3 of air for each room are reported in Tables 2-1 and 2-2. The media detected significantly diffe rent (p<0.001) numbers of fungal colonies in each room on both days. The two V8-based medi a recovered high numbers of colonies in both rooms; however, it was noted that the plates were dominated by bacterial colonies. The actual number of filamentous fungi reco vered by these media was much lower. Zero to few colonies grew on the pieces of wetted drywall. Each medi um recovered a higher number of colonies from the master bedroom than from the living room.

PAGE 28

28 The means of the number of S. chartarum (CFU/m3 of air) for each room are reported in Tables 2-3-and 2-4. In the master bedroom, differences in recovery among media were significant on both days (p<0.001) Seven media, WAFP RB, P DA RB, V8/2, V8/4, CMA, PDA RB/T, and PDA T, recovered multiple colonies of S. chartarum from the master bedroom on both days. WAFP recovered an average of 135 CFU/m3 of S. chartarum on day 1 but none on day 2. Overall, fewer S. chartarum colonies were noted on day 2 in the master bedroom. Relatively few colonies of S. chartarum were recovered from the living room. Only the two V8 media were significantly different (p<0.01) from the media that failed to recover any S. chartarum Only V8/2 was able to capture S. chartarum from the living room on both days of sampling. Representative isolates from both rooms did not produce green pigment on CYA. Recoveries of S. chartarum as a percent of total colonies are presented in Tables 2-5 and 26. In the bedroom, WAFP RB recovered a significantly higher percent of S. chartarum than all other media on both days (p<0.001 on day 1, p<0.01 on day 2). Other media for which S. chartarum represented 16% or more of the total co lonies included CMA, WAFP, both V8 agars and PDA RB. In the living room, no significant differences among media occurred on either day (p=0.2935 on day 1, p=0.5181 on day 2). Outdoor Study The total number of fungal co lonies recovered from all 240 samp les taken in this study was 12,545 colonies at the citrus site and 10,422 colonies at the grassy parking area. Of these 22,967 total colonies, the recovery of S. chartarum was a rare event, occu rring on only two of ten sampling dates and totaling only seven colonies fr om six plates, or 0.025% of all plates. One colony of S. chartarum was observed on a PDA RB plate an d one colony on a WAFP RB plate from those sampled on May 25 2007 at the grassy lot. The plates from the Jun 5 2007 sampling period recovered four colonies of S. chartarum from the citrus grove (one colony on a V8/2

PAGE 29

29 plate, two colonies on one WA FP RB plate and one colony on a second WAFP RB plate) and one colony from the grassy lot site, on a PDA RB plate. No S. chartarum colonies were recovered on any of the CMA plates. None of the putative S. chartarum isolates produced green extracellular pigment when grown on CYA. Cladosporium spp. were the most commonly recovere d colonies from a ll media at both sites. This genus represented anywhere from 39.3% of total colonies (P DA, citrus grove) to 69.7% (V8, grassy lot). The second most common genus was Penicillium which ranged from 1.9% of total colonies (V8, grassy lot) to 4.1% (PDA, grassy lot). Species of Alternaria, Curvularia, Bipolaris/Dreschlera, Epicoccum, and Aspergillus all appeared but less regularly and/or abundantly. No notable difference in the frequency or a bundance of these genera appears in the two sampling da tes that recovered S. chartarum It should be noted that mites were discovered in the plates from the May 25 and Jun 5 sampling dates, including the ones that had S. chartarum colonies. The sampled plates were kept in an incubator that al so housed pure cultures of S. chartarum that were found to have mites. No mites were present in plates from the other ten sampling dates. Discussion There has been ongoing discussion about the ac curacy of air sam pling for detection of S. chartarum in cases of suspected mold contamination, whether due to sampling method, spore dispersal, spore viability, or competitive ness on common media (Andersen and Nissen 2000, Kuhn et al. 2005). A recent study (Tucker et al. 2007) examined the biomechanics of conidial dispersal of S. chartarum and concluded that its conidia are poorly adapted for dispersal by airspeeds common in indoor environments. In addition, Stachybotrys growth most commonly occurs hidden in natural cracks a nd openings in structures, such as behind wallpaper or in a wall cavity, protected from air flow (Andersen and Nissen 2000). Stachybotrys chartarum spores are

PAGE 30

30 present in indoor air in low con centrations, so it is important to use a growth medium that is semi-selective and affords the best opportunity fo r detection of the fungus. This study showed that when using an appropriate agar medium, it is possible for an air sample to pick up viable S. chartarum spores. There are, however, limitations to this method. In the indoor air study, there was am ple and consistent recovery of S. chartarum on many different media from bedroom air when the samp ler was in close proximity (<1m) to visible fungal growth. The percentage of S. chartarum spores of all collected spores in the bedroom was 16% or greater for WAFP RB, CMA, WAFP V8/2, V8/4 and PDA RB. These results demonstrate that S. chartarum spores do become airborne und er conditions of normal household activity and that these spores are viable. Becau se large numbers of bacterial colonies grew on the V8 plates, this medium should always be am ended with antibiotics as suggested by Andersen and Nissen (2000). If the bacterial colonies had been suppressed, the percent recovery of S. chartarum by these two media would have been much higher. This study also confirms the suggestions that WAFP (Harrington 2003), V8 ag ar with antibiotics (Andersen and Nissen 2000), PDA (Billups et al. 1999), and CMA (Tsai et al l999) may be the best culture media, of those tested, for recovering viable S. chartarum from bioaerosol samples. Of these, WAFP amended with Rose Bengal also recovered fewer to tal numbers of colonies. Thus it seems that this medium, along with V8 agar amended with antibiotics, best m eets the challenge of selectively recovering S. chartarum while reducing the total number of other colonies recovered. More colonies of S. chartarum were recovered in the master bedroom than in the living room and on a greater number of media. At the time of sampling, S. chartarum was present on carpet in the master bedroom while there was no visible growth in the living room, which is located at the other end of the house (Figure 2-1). It is lik ely that the distance of the sampler

PAGE 31

31 from the source of primary inoculum affects the accuracy of detection. These results highlight the difficulty in detecting S. chartarum from indoor air even when inoculum is visible and semiselective media are used. Previous studies have shown that fewer S. chartarum colonies were detected on agar plates than by other sa mpling methods (Tiffany and Bader 2000, Spurgeon 2003, Kuhn et al. 2005). In th is study, it was expected that better de tection of S. chartarum could be obtained by using semi-selective media; however, it is possible that other methods such as impaction plates or cassettes may be better suited for accurate sampling of this particular fungus. Of the two rooms sampled in the indoor air st udy, the living room best represented typical outdoor air, which would likely have a low concentration of S. chartarum spores. Therefore, the media that successfully recovered S. chartarum from the living room air samples were used in the outdoor air study. In addition WAFP RB was sele cted because it consis tently recovered the most colonies of S. chartarum in the master bedroom. Bis hop (2002) showed that, in north central Florida, an Andersen sampler collects more fungi from outdoor air in the morning than in the afternoon. In addition, this sa me study showed that the amount of Cladosporium as a percent of total fungi measured is less at 9 AM than it is at 3 PM and 9 PM (Bis hop 2002). In an effort to sample from the largest number of spores while limiting the amount of Cladosporium present, samples were collected in the morning for the out door air study. Sampling occurred at a time of year when S. chartarum is present outdoors (Chapter 3). The detection of S. chartarum from outdoor air was a rare event although 1) the media used had successfully recovered S. chartarum in the indoor air study and 2) the samples were taken in an area and at a time of year that S. chartarum had been recovered by other sampling techniques (Chapter 3) It is likely that S. chartarum is present in outdoo r air at such a low

PAGE 32

32 concentration that it falls below the detectable threshold of even semi-selective media. This study suggests that air sampling wo uld not be an appropriate method for research investigating the occurrence of S. chartarum in outdoor habitats. Studies that have used slide impaction or cassette samplers, which allow detection on non-viab le spores, have report ed higher levels of S. chartarum in outdoor air than this study, from 3 9% of samples (Baxter et al. 2005, Kuhn et al. 2005). The fact that S. chartarum was recovered on plates from tw o of the ten sampling dates and only from plates that were also in fested with mites suggests the possi bility that it was, in fact, not ever recovered from outdoor air and was instead introduced from mites that migrated in the laboratory from pure cultures of S. chartarum Fungi are known to be dispersed by a wide variety of arthropods such as beetles (Paine et al. 1997) and collembola (Visser et al. 1987). Mites are known to vector spores from a range of fungal taxa that includes Basidiomycota, Ascomycota and Zygomycota (Renke r et al. 2005, Greif and Currah 2007 ). In particular, species that produce sticky spores, such as Ophiostoma ulmi the causal agent of Dutch Elm disease, are associated with arthropods. Stachybotrys is unusual among common indo or air fungi in that it produces spores in a mucilaginous mass, whereas species of Aspergillus Penicillium, and Cladosporium produce dry spores that seem well-adapted to air dispersal (Tuc ker et al. 2007). It has been hypothesized that S. chartarum can be spread indoors by insect movement, although research has yet to confirm this (Money 2004, Kost er 2006). The results of this study suggest that further research should investigate mites as possible vectors of S. chartarum spores.

PAGE 33

33 A B Figure 2-1. Private residence in Gainesville, FL with Stachybotrys chartarum infestation. A) Bedroom showing S. chartarum growing on carpet. B) Living room and dining room.

PAGE 34

34 Table 2-1. Total number of fungal and bacteria l colonies recovered on different media from master bedroom, for two different samplings. Day Mediaa Meanb 1 PDA RB/T 3842.7a 1 PDA T 3168.0ab 1 PDA RB 2364.3ab 1 V8/4 1830.4ab 1 V8/2 1783.5ab 1 PDA 2147.2abc 1 WAFP RB 1302.4abc 1 CMA 1009.1bc 1 WAFP 662.9c 1 drywall 0.0d 2 V8/4 2405.3a 2 V8/2 2217.6a 2 PDA RB 2323.2a 2 PDA T 1672.0ab 2 CMA 1519.5ab 2 PDA 1355.2ab 2 PDA RB/T 1243.7ab 2 WAFP RB 1014.9ab 2 WAFP 727.5b 2 drywall 5.9c a Media are Corn Meal Agar (CMA), Potato Dext rose Agar (PDA), Potato Dextrose Agar with 0.05 g Rose Bengal per liter (PDA RB), Potato Dextrose Agar with1 ml Tergitol per liter (PDA T), Potato Dextrose Agar with 0.05 g Rose Benga l and 1 ml Tergitol per liter (PDA RB/T), V8 Agar with 2 g of CaCO3 per L (V8/2), V8 Agar with 4 g of CaCO3 per L (V8/4), Water Agar with sterile filter paper (WAFP) Water Agar with sterile filte r paper and 0.05 g Rose Bengal per liter (WAFP RB), and wetted 4 cm x 4 cm squa res of 1.3 cm () thick sterile drywall. b Differences among media are significant at p<0 .0001. Means reported are actual means; units are colony forming units per cubic meter of air (CFU/m3). For each sampling date, means in column followed by the same letter are not diffe rent, based on log(x+1) transformed data.

PAGE 35

35 Table 2-2. Total fungal and bacterial colonies recovered on different media from living room, for two different samplings. Day Mediaa Meanb 1 V8 4 516.3a 1 V8 2 440.0ab 1 PDA 404.8abc 1 CMA 305.1abc 1 PDA T 275.7abc 1 PDA RB/T 328.5abcd 1 PDA RB 164.3bcd 1 WAFP RB 146.7cd 1 WAFP 111.5d 1 drywall 0.0e 2 V8 4 598.4a 2 V8 2 580.8a 2 PDA 287.5ab 2 PDA T 211.2bc 2 PDA RB 181.9bcd 2 CMA 170.1bcd 2 PDA RB T 129.1bcd 2 WAFP 93.9cd 2 WAFP RB 88.0d 2 drywall 5.9e a Media are Corn Meal Agar (CMA), Potato Dext rose Agar (PDA), Potato Dextrose Agar with 0.05 g Rose Bengal per liter (PDA RB), Potato Dextrose Agar with1 ml Tergitol per liter (PDA T), Potato Dextrose Agar with 0.05 g Rose Benga l and 1 ml Tergitol per liter (PDA RB/T), V8 Agar with 2 g of CaCO3 per L (V8/2), V8 Agar with 4 g of CaCO3 per L (V8/4), Water Agar with sterile filter paper (WAFP) Water Agar with sterile filte r paper and 0.05 g Rose Bengal per liter (WAFP RB), and wetted 4 cm x 4 cm squa res of 1.3 cm () thick sterile drywall. b Differences among media are significant at p<0 .0001. Means reported are actual means; units are colony forming units per cubic meter of air (CFU/m3). For each sampling date, means in column followed by the same letter are not diffe rent, based on log(x+1) transformed data.

PAGE 36

36 Table 2-3. Total Stachybotrys chartarum colonies recovered on diffe rent media from master bedroom, for two different samplings. Day Mediaa Meanb 1 WAFP RB 686.4a 1 V8 4 733.3ab 1 CMA 316.8ab 1 V8 2 305.1ab 1 PDA RB 258.1ab 1 WAFP 134.9b 1 PDA RB/T 105.6b 1 PDA T 41.1c 1 PDA 0.0d 1 drywall 0.0d 2 WAFP RB 164.3a 2 PDA RB 146.7a 2 V8 4 93.9ab 2 CMA 70.4ab 2 V8 2 58.7ab 2 PDA RB/T 58.7ab 2 PDA T 58.7b 2 drywall 0.0c 2 PDA 0.0c 2 WAFP 0.0c a Media are Corn Meal Agar (CMA), Potato Dext rose Agar (PDA), Potato Dextrose Agar with 0.05 g Rose Bengal per liter (PDA RB), Potato Dextrose Agar with1 ml Tergitol per liter (PDA T), Potato Dextrose Agar with 0.05 g Rose Benga l and 1 ml Tergitol per liter (PDA RB/T), V8 Agar with 2 g of CaCO3 per L (V8/2), V8 Agar with 4 g of CaCO3 per L (V8/4), Water Agar with sterile filter paper (WAFP) Water Agar with sterile filte r paper and 0.05 g Rose Bengal per liter (WAFP RB), and wetted 4 cm x 4 cm squa res of 1.3 cm () thick sterile drywall. b Differences among media are significant at p<0 .0001. Means reported are actual means; units are colony forming units per cubic meter of air (CFU/m3). For each sampling date, means in column followed by the same letter are not diffe rent, based on log(x+1) transformed data.

PAGE 37

37 Table 2-4. Total Stachybotrys chartarum colonies recovered on di fferent media from living room, for two different samplings. Day Mediaa Meanb 1 V8 2 17.6a 1 V8 4 11.7ab 1 CMA 5.9bc 1 WAFP 5.9bc 1 PDA RB/T 0.0c 1 PDA T 0.0c 1 PDA 0.0c 1 PDA RB 0.0c 1 WAFP RB 0.0c 1 drywall 0.0c 2 V8 2 5.9 2 PDA RB 5.9 2 CMA 0.0 2 drywall 0.0 2 PDA RB/T 0.0 2 PDA T 0.0 2 PDA 0.0 2 V8 4 0.0 2 WAFP RB 0.0 2 WAFP 0.0 a Media are Corn Meal Agar (CMA), Potato Dext rose Agar (PDA), Potato Dextrose Agar with 0.05 g Rose Bengal per liter (PDA RB), Potato Dextrose Agar with1 ml Tergitol per liter (PDA T), Potato Dextrose Agar with 0.05 g Rose Benga l and 1 ml Tergitol per liter (PDA RB/T), V8 Agar with 2 g of CaCO3 per L (V8/2), V8 Agar with 4 g of CaCO3 per L (V8/4), Water Agar with sterile filter paper (WAFP) Water Agar with sterile filte r paper and 0.05 g Rose Bengal per liter (WAFP RB), and wetted 4 cm x 4 cm squa res of 1.3 cm () thick sterile drywall. b Differences among media are significant at p<0 .01. Means reported are act ual means; units are colony forming units per cubic meter of air (CFU/m3). For each sampling date, means in column followed by the same letter are not differe nt, based on log(x+1) transformed data.

PAGE 38

38 Table 2-5. Stachybotrys chartarum colonies as percent of total colonies recovered on different media from master bedroom, for two different samplings. Day Mediaa Meanb 1 WAFP RB 50.4a 1 CMA 33.1ab 1 V8 4 30.5b 1 WAFP 18.8bc 1 V8 2 18.1bcd 1 PDA RB 16.5bcd 1 PDA RB/T 5.1cd 1 PDA T 3.1cd 1 PDA 0.0d 1 drywall 0.0d 2 WAFP RB 13.6a 2 PDA RB 5.4b 2 CMA 4.8b 2 PDA RB/T 4.3b 2 V8 4 3.6b 2 V8 2 2.8b 2 PDA T 2.3b 2 drywall 0.0b 2 PDA 0.0b 2 WAFP 0.0b a Media are Corn Meal Agar (CMA), Potato Dext rose Agar (PDA), Potato Dextrose Agar with 0.05 g Rose Bengal per liter (PDA RB), Potato Dextrose Agar with1 ml Tergitol per liter (PDA T), Potato Dextrose Agar with 0.05 g Rose Benga l and 1 ml Tergitol per liter (PDA RB/T), V8 Agar with 2 g of CaCO3 per L (V8/2), V8 Agar with 4 g of CaCO3 per L (V8/4), Water Agar with sterile filter paper (WAFP) Water Agar with sterile filte r paper and 0.05 g Rose Bengal per liter (WAFP RB), and wetted 4 cm x 4 cm squa res of 1.3 cm () thick sterile drywall. b Differences among media are significant at p=0.0002 for Day 1 and p=0.0017 for Day 2. Means reported are actual means; units are co lony forming units per cubic meter of air (CFU/m3). For each sampling date, means in co lumn followed by the same letter are not different, based on log(x+1) transformed data. :

PAGE 39

39 Table 2-6. Stachybotrys chartarum colonies as percent of total colonies recovered on different media from living room, for two different samplings. Day Mediaa Meanb 1 WAFP 5.6 1 V8 2 5.3 1 V8 4 2.7 1 CMA 1.4 1 PDA RB/T 0.0 1 PDA T 0.0 1 PDA 0.0 1 PDA RB 0.0 1 WAFP RB 0.0 1 drywall 0.0 2 PDA RB 3.3 2 V8 2 1.1 2 CMA 0.0 2 drywall 0.0 2 PDA RB/T 0.0 2 PDA T 0.0 2 PDA 0.0 2 V8 4 0.0 2 WAFP RB 0.0 2 WAFP 0.0 a Media are Corn Meal Agar (CMA), Potato Dext rose Agar (PDA), Potato Dextrose Agar with 0.05 g Rose Bengal per liter (PDA RB), Potato Dextrose Agar with1 ml Tergitol per liter (PDA T), Potato Dextrose Agar with 0.05 g Rose Benga l and 1 ml Tergitol per liter (PDA RB/T), V8 Agar with 2 g of CaCO3 per L (V8/2), V8 Agar with 4 g of CaCO3 per L (V8/4), Water Agar with sterile filter paper (WAFP) Water Agar with sterile filte r paper and 0.05 g Rose Bengal per liter (WAFP RB), and wetted 4 cm x 4 cm squa res of 1.3 cm () thick sterile drywall. b Differences among media are not significant at p 0.1, based on log(x+1) transformed data. Means reported are actual means; units are co lony forming units per cubic meter of air (CFU/m3).

PAGE 40

40 CHAPTER 3 FREQUENCY AND ABUNDANCE OF Stachybotrys chartarum AND OTHE R COMMON FUNGAL GENERA IN OUTDOOR HABIT ATS IN NORTH CENTRAL FLORIDA Introduction Stachybotrys chartarum (Ehrenb.) H ughes (= Stachybotrys atra Corda) is a dermatiaceous hyphomycete of worldwide distribution that has been isolated from a variety of substrates in both indoor and outdoor environments. In natural e nvironments, it has been most commonly isolated from soil (Barron 1968, Ellis 1971, El-Morsy 1999); however, it has also been isolated from decaying plant material (Ellis 1971, Whitton et al 2001), on animal fodder (Drobotko 1945), as a parasite of other fungi (Siqueira et al. 1984), and in association with living plants (El-Morsy 1999, Li et al. 2001). Some of the more unusual natural substrates include woodchuck dung (Jong and Davis 1976) and seaweed (Andersen et al. 2002). A strongly cellulolytic fungus, S. chartarum has also been isolated fr om a variety of human-made materials derived from plant fibers such as paper, cotton, and canvas (Bisby 1943, Jong and Davis 1976). Of current interest is the frequent isolation of S. chartarum from construction material s including drywall, ceiling tiles and wallpaper in buildings that have experienced water damage (Li and Yang 2005). Stachybotrys chartarum which produces macrocyclic tr ichothecenes that are among the most potent mycotoxins known to man (Jarvis 2003), has been implicated in cases of sick building syndrome and pulmonary hemorrhage (Cro ft et al. 1986, Etzel et al. 1998, Dearborn et al. 1999). A recent study suggests that outdoor in oculum is the most likely source for indoor S. chartarum contamination (Koster 2006), possibly from air-borne spores that are deposited on the surface of building materials at th e construction site (Nelson 2001). Despite the significance of S. chartarum regarding public health, no comprehensive ec ological study that id entifies different habitats that support S. chartarum populations has been done.

PAGE 41

41 Previous studies of outdoor air have reported none to very low levels of S. chartarum spores when sampling using a Samplair partic le sampler (Li and Kendr ick 1995, Baxter et al. 2005), an Air-O-Cell slit bi oaerosal cassette (Baxter et al. 200 5), or an Andersen N6 sampler (Chapter 2, Bishop 2002, Shelton et al. 2002). However, drywa ll is the most commonly found human-associated substrate for S. chartarum and numerous studies have shown it supports extensive fungal growth when wet (Andersson et al. 1997, Nikulin et al. 1994, Karunasena et al. 2000, Hyvrinen et al. 2002). For this reason, drywall was the medium of choice for this study. The primary ingredient of drywall is the natura lly occurring mineral gyps um or calcium sulfate dihydrate (CaSO4H2O), sandwiched between two sheets of pa per. Both the cellulose in the liner and starch, which is used as an adhesive, have been shown to be important nutrient sources for S. chartarum (Murtoniemi et al. 2003). The objective of this project wa s to identify outdoor habitats in north central Florida where S. chartarum is found and the times of year when it is most abundant. It is critical to understand the types of environments that support natural populations of S. chartarum because it is likely that these populations play an important role in the establishment of mold colonies in waterdamaged structures. Materials and Methods Study Sites Four study sites representing dive rse habitats in G ainesville, Florida, USA, were selected (Figure 3-1). Three sites, the pine grove, the citrus grove, and the lakeshore, are located on the University of Florida campus. The fourth site, a hardwood forest, is on private property approximately 11 km from the other three sites. The citrus and pine groves are managed agricult ural sites, and the dominant plant species are species of Citrus and Pinus elliottii (Slash pine), respectively. The lakeshore and hardwood

PAGE 42

42 forest sites are unmanaged and relatively ecol ogically diverse. Common tree species at the lakeshore site include Acer negundo (Ashleaved maple), A. rubrum (Red maple), Taxodium distichum (Bald cypress), Quercus virginiana (Live oak), Sabal palmetto (Cabbage palm), and Salix nigra (Black willow). Common shrubs and herbaceous plants include Adiantum pedatum (Maidenhair fern), Ampelopsis arborea (Peppervine), Andropogon virginicus (Broomgrass), Baccharis halimifolia Bidens alba (syn. B. pilosa Hairy beggarticks, Spanish needles), Capsella bursa-pastoris (Shepherds purse), Celtis occidentalis (Common hackberry), Cuscuta sp. (Dodder), Eupatorium capillifolium (Dog fennel), Laurocerasus caroliniana (Carolina laurelcherry), Menispermum canadense (Moonseed), Myrica cerifera (Southern wax myrtle), Parthenocissus quinquefolia (Virgina creeper), Rubus sp. (Wild blackberry), Sambucus sp. (Elderberry), Smilax bona-nox (Saw greenbrier), Typha sp. (Cattail), and Vitis rotundifolia (Wild grape). Common tree species at th e hardwood forest site include Acer barbatum (Southern sugar maple), Betula lutea (Yellow birch), Carpinus caroliniana (American hornbeam/Bluebeech), Liquidambar styraciflua (Sweetgum), Magnolia grandiflora (Southern magnolia), Pinus taeda (Loblolly pine), P. glabra (Spruce pine), Quercus michauxii (Swamp chestnut oak), Q. nigra (Water oak), Q. phellos (Willow oak), Q. virginiana and Tilia americana (American basswood). Common understory trees, shrubs, and herbaceous plants include Adiantum sp., Bidens alba, Callicarpa a mericana (American beautyberry), Celtis occidentalis Fraxinus americana (White ash), Hedera sp. (Ivy), Koelreuteria paniculata (Golden rain tree), Laurocerasus caroliniana, Ligustrum vulgare (Privet), Mitchella repens (Partridgeberry), Morus rubra (Red mulberry), Phytolacca americana (American pokeweed), Serenoa repens (Saw palmetto), Smilax bona-nox Toxicodendron radicans (Poison ivy), and Viola sp. (Wild violet).

PAGE 43

43 Description of Traps In this experim ent, traps were designed to hold eight pieces of drywall with dimensions 20 cm x 4 cm (Figure 3-2). Standard drywall sheets, 1. 3 cm x 121.9 cm x 243.8 cm ( in x 4 ft x 8 ft sheets) and manufactured in Pala tka, Florida (Lafarge), were pur chased at a national chain homeimprovement store and cut into strips. The exception was October 2006 when Tough Rock brand drywall (George Pacific, Atlanta, GA) was purchased. A 12-cm x 4-cm grid consisting of 12 2-cm x 2-cm cells was drawn on the front of each strip. The strips were soaked overnight in tap water before being placed upright in 20 mm Nalgene UnwireTM test tube racks (250 x 102 x 83 mm) that were modified by removing some parti tions. In each rack, th e drywall pieces were oriented so that two pieces were placed along each side. Prior to being placed in the field, the wet drywall pieces and racks were sterilized for 5 minutes at full power in a 120V microwave (Frigidaire, Martinez, GA). In the field, the sterile drywall strips and test tube racks were placed in 4-quart clear plastic storage boxes (34.3 cm x 20.3 cm x 10.2 cm, Ster ilite, Townsend, MA) with drainage holes drilled 3.2 cm from the base. At each site, five traps were placed al ong a transect line, 10 m apart. GPS location data is reported in Appendix A (Table A-1). The drywall strips in each trap were oriented so that they faced due North, S outh, East, and West (Figur e 3-2). One liter of sterile tap water was added to each trap when placed in the field. Traps were placed in the field on the following dates: June 05, Aug 05, Oct 05, Dec 05, Feb 06, May 06, Jun 06, Aug 06, Nov 06, Jan 07, and Apr 07. Sampling Each trap w as sampled at four and eight weeks, with the exception of the May 06 traps which were only sampled once. Collection dates are summarized in Appendix A (Table A-2). A sample from one trap consisted of four drywall pieces, one from each direction. A total of 80

PAGE 44

44 drywall pieces were collected e ach month. Samples were collect ed 21 times. In the lab, each strip of drywall was cut into three pieces using sterile instruments and placed in 100-mm x 20mm disposable Petri dishes (Figure 3-3). Each 2-cm x 2-cm grid was observed at 30x ma gnification under a dissecting microscope, and the presence of species of Cladosporium, Alternaria, Epicoccum, Curvularia, Bipolaris, Dreschlera, and Stachybotrys was recorded. Putative Stachybotrys colonies were isolated, grown on BBLTM Corn Meal Agar (Becton, Dickson and Co., Sparks, MD) in the dark for 14 days at 24oC, and identified at 400x and 1000x based on morphological features as described by Jong and Davis (1976), with the exception of S. bisbyi which was identified by tape mounts (Miller 2001) made directly from the dryw all. In order to distinguish between S. chartarum and S. chlorohalonata, these isolates were inoculated on Czapek yeast autolysate agar (CYA, Samson et al. 2002), incubated in the dark for 7 days at 24oC, and then they were evaluated for pigment production. Stachybotrys chlorohalonata receives its name from the dark green pigment it produces on this medium. Data Analysis Data from each month were analyzed separate ly. Abundance was defined as the number of 2-cm x 2-cm squares on a 12-cm x 4-cm grid that contained S. chartarum colonies and was analyzed as a two-way factorial analysis of variance (ANOVA) to determine effects of location, direction, and location x direction interaction. When direc tion and the interaction were not significant, data were reanaly zed by one-way ANOVA to determine effects of location. P-values less than 0.10 were considered significant, and in these cases, means were separated by the Waller-Duncan k-ratio t test. Data were analy zed using SAS statistica l software (Version 9.1, SAS Institute, Cary, NC). Occurrences of species of Cladosporium, Alternaria, Epicoccum, Dreschlera Bipolaris and Curvularia were analyzed in the same fashion, with the exception that

PAGE 45

45 all data for species of Dreschlera Bipolaris and Curvularia were combined for statistical analysis. Approximate colony size was estima ted by averaging the number of cells with S. chartarum growth at each site on each date. Weathe r information was gathered from the Florida Automated Weather Network for the Gainesvi lle, FL, weather site which is located approximately 24 km from the campus sites and 18 km from the hardwood forest site (FAWN 2007). Results Stachybotrys chartarum Over the co urse of 24 months, 1680 pieces of drywall were placed in the field. Fifteen pieces were damaged or unable to be recovered and were not included in the statistical analysis. Stachybotrys chartarum was found on 33 pieces of drywall or 0.02% of the pieces collected. Four pieces of drywall showed two colonies each of S. chartarum with distinct boundaries, so a total of 37 colonies were isolated from the field. Stachybotrys chartarum was found during 9 of the 24 months that traps were in the field: June, July, August, and September 2005, and May, June, August, September, and December 2006 (Tables 3-1 and 3-2). No S. chartarum was found on the drywall placed in the field January 17 June 1, 2007. In 2005, S. chartarum occurred in the citrus grove, the pine grove, and the weedy lakeshore. In 2006, S. chartarum occurred in the citrus grove, the pine grove, and the hardwood forest. Stachybotrys chartarum was isolated most frequently from the citrus grove where it occu rred during eight differe nt months. Although it was not recovered from the hardwood forest in 2005, S. chartarum was recovered from that site in July, August, September, and December 2006. Stachybotrys chartarum was only recovered twice from the weedy lakeshore and three times from the pine grove during the course of this two-year study.

PAGE 46

46 Abundance was defined as the number of cells per grid with S. chartarum growing on them; the maximum value was twelve. Abunda nce was not significantly affected by the direction that the drywall faced (N, S, E, W), except for December 2006 (p=0.0558); therefore, direction was pooled for each month. There was no significant difference in the abundance of S. chartarum among sites for each month except for September-October 2006 (p=0.0381, Table 34) and December 2006 (p=0.0558, Table 3-4) when the hardwood forest site had significantly more S. chartarum growing on the drywall pieces than did most other sites. Approximate colony size is reported in Table 3-5. Putative S. chartarum colonies that were id entified at 30x, but which could not be isolated in order to confirm their identifi cation, occurred on four pieces. In each case, attempts to isolate the sample failed because only a few condiophores were found on the piece of drywall. These minute colonies occurred in July 2005 at the lake side and pine sites, and in July and August 2006 at the lakeside. These colonies were not include d in the statistical analysis because they could have been S. chlorohalonata. Additionally, five pieces of drywall had large S. chartarum colonies growing off the grid (i.e. growing on the ungridded, bottom-third of the strip) that were visible to the naked eye. These colonies were isolated, grown on CMA and identified as S. chartarum These isolates occurred in July 2005 at the ci trus and pine sites, Septembe r 2005 at the hardwood and citrus sites, and May and September/Octo ber 2006 at the citrus site. Thes e isolates were not used in the statistical analysis. All of these colonies occurred at mont hs when on-grid colonies were recovered at the same sites with the excepti on of the September 2005 recovery of off-grid S. chartarum from the hardwood site. This off-grid colony was the only S. chartarum recovered from the hardwood site in 2005.

PAGE 47

47 Average temperature, total rainfall and aver age relative humidity for each sampling period are presented in Table 3-6. The majority of S. chartarum isolates were recovered during months when average daily temperature ranged from 23.6 to 26.9oC. Average daily low temperatures during these months ranged from 16.2 oC to 21.6oC; average daily high te mperatures during these months ranged from 31.4 oC to 34.1oC. The exception to this observation was December 2006 when average daily temperature was 15.3oC and S. chartarum was recovered from the hardwood forest site. All months that S. chartarum was not present on the drywall traps had average temperatures that fell below these ranges. Other Stachybotrys sp ecies Stachybotrys chlorohalonata colonies grew on the drywall grid four times during the 2year study: citrus in Nov-Dec 2005, lakeside in July 2006, ha rdwood in Sept-Oct 2006 and citrus in May 2007 (Table 3-7). This species was never recovered from the pine s ite. Two colonies of S. chlorohalonata were visible with the naked eye but did not appear on the grid. These additional colonies occurred at th e citrus site in September 2005 and the hardwood site in August 2006. Five other species of Stachybotrys were recovered during the 2-year study. Of these, the two most commonly-occurring species were S. kampalensis and S. bisbyi. Both have unique morphological characteristics that make them easy to identify. Stachybotrys bisbyi produces hyaline conidiophores, phiali des and conidia, and S. kampalensis produces hyaline phialides but very dark ellipsoidal spores that usually contain two oil drops (Jong and Davis 1976). Stachybotrys bisbyi was the second most commonly found Stachybotrys species and was recovered 31 times (Table 3-8). It was f ound consecutively from June to September 2005 and June to December 2006. It wa s not recovered between January and June 1, 2007. It was found once at the citrus site (June 2005), twice at the hardwood site (July 2006 twice), and three times

PAGE 48

48 at the pine site (July 2005 twice and August 2005 once). All of the other 25 occurrences were from the lakeside site. Significantly more S. bisbyi was found at the lakeshore site in September 2005 (p=0.0537), June 2006 (p<0.01), July 2006 (p=0.0668) and August 2006 (p<0.01) than at the other three sites at those times (Table 3-9). Stachybotrys kampalensis was identified from colonies on 16 pieces of drywall (Table 310). It was discovered twice at the hardwood site (June and July 2006) and 14 times at the lakeside site. Stachybotrys kampalensis was not recovered from the pine or citrus sites. Significantly more S. kampalensis was found at the lakeside site in September 2005 (p<0.01) and August 2006 (p=0.0393) than was found at the other three sites at those times (Table 3-11). Additional species of Stachybotrys that were observed include S. albipes (July 2006, hardwood site), S. nephrospora (July 2006, pine site), and S. parvispora (August 2006, hardwood site). Other Genera The abundance of species of Cladosporium, Alternaria Epicoccum Dreschlera Bipolaris, and Curvularia is reported in Tables 3-12 to 3-15. All genera showed a significant difference in abundance among the four sites at different tim es over 21 months of sampling. The abundance of Cladosporium spp. and the Dreschlera/Bipolaris/Curvularia spp. group differed significantly among sites during 15 different months. Epicoccum spp. and Alternaria spp. differed during 13 and 11 months, respectively. There is no apparent seasonal pattern at any site in any of the four genera groups. Discussion Over the course of 24 months, S. chartarum was found growing in all four habitats. It was predic ted that S. chartarum would be the dominant fungus on the drywall, occurring frequently, in multiple and large colonies. Instead, it was found rarely, on only 0.02% of the pieces

PAGE 49

49 collected. Even if one cons iders the colonies that grew off-grid, the frequency of S. chartarum was unexpectedly low. In addition, it was thought that S. chartarum would be more abundant than observed. Abundance was measured as the number of cells with S. chartarum growth and reflected both the number of coloni es present and the relative size of the colonies. On 4 of 33 pieces of drywall, two colonies were observed; all other pieces had only one colony. With the exception of the hardwood forest site in Sept ember-October 2006, the mean number of cells on the grid with S. chartarum was less than 1 cell. In part, this is due to the low number of pieces with S. chartarum growth, but it was also observed that the colony size was relatively small. It is, therefore, more appropriate to ex amine the mean number of cells with S. chartarum growth as an indicator of colony size. Two-thirds of sa mples (11 of 17), the average colony covered less than half of the 12-cm x 4-cm grid. It is unc lear why the colonies did not dominate the drywall surface. Because the frequency of S. chartarum was low, most differences in abundance between sites were not significant. The only two times th at differences in abundance were significant, more S. chartarum was recovered at the hardwood site than at the other sites. It is unknown whether a large reservoir of inoculum was presen t, or if environmental conditions in Sept-Oct 2006 and December 2006 were particularly conducive to rapid growth at that site. The largest colony size also occurred during the Sept-Oct 2006 sampling period, with the average colony covering just over 75% of the total grid surface. It is important to note, however, that S. chartarum was recovered more than once from each habitat. This is not surprising since 1) S. chartarum has been recovered from a variety of natural substrates in th e past, and 2) its preferred substrate is cellulose which is common at all four sites. At all sites, S. chartarum was only found during the summer months, which was

PAGE 50

50 anticipated since it is a hydrophilic fungus, and north central Florida typically receives abundant rainfall during this time. There was no trend in frequency of occurren ce at the sites between years with the exception of the citrus grove where S. chartarum occurred both years from July to September. Originally, it was thought that the weedy lakeshore might harbor the highest populations of S. chartarum because the abundance of herbaceous annual plants in this habitat would supply a ready source of cellulose and the nearby water would keep relative humidity high. Instead, S. chartarum was recovered most frequently fro m the citrus grove where plant diversity was low. This site was included in the study because S. chartarum had been recovered previously in the area from citrus leaves (J.W. Kimbrough personal communication). Several recent studies have suggested that S. chartarum spores are not naturally wind dispersed (Koster 2006, Tucker et al. 2007); thus it is unlikely that the inoculum was transported over long distances. Most likely the source of the drywall colonies is lo cal; therefore, one can conclude that S. chartarum is found in a variety of outdoor habitats in north central Florida. If it is true that these outdoor populations serve as the inoculum for indoor contamination (Koster 2006), then there appear to be mu ltiple reservoirs for mold contam ination in natural habitats in north central Florida. It is possible that S. chartarum was found less often than expected because unfavorable environmental conditions at the micro-level preven ted viable spores that landed on the traps from sporulating (i.e. low moisture). If this were true, the traps would have underestimated the abundance of S. chartarum in each habitat. Water activity (aw) is a measure of the available water in a substrate (Flannigan and Miller 2001). Stachybotrys chartarum requires a water activity between 0.91-0.93 for growth and sporulation (Grant et al. 1989) and is characterized as hydrophilic (Flannigan and Miller 2001). Nielsen et al. (2004) found S. chartarum growing on

PAGE 51

51 drywall only at 95% relative humidity. However, S. chartarum requires a lower minimum water activity when grown at higher temperatures (F lannigan and Miller 2001). Although each trap was filled with 1 L sterile water when placed in the field, it was noted that the traps dried out during periods of low rainfall, so it is possible th at moisture was a limiting factor. This idea is supported by the observation that most S. chartarum isolates were recovered from the citrus grove which is a managed agricultural site. The tr aps at this site were near irrigation heads and received more moisture than the traps at the other three sites. The citrus grove is irrigated yearround, so the citrus traps also received extra moisture during months when S. chartarum failed to be recovered at that site. In fact, of the four sampling periods that received the highest total rainfall, July 2005 (32.7 cm), Nov Dec 2005 (26.6 cm), Feb 2006 (35.1 cm), and April 2006 (24.1 cm), S. chartarum was only recovered during the July 2005 period. Thus while it is possible that there were isolated incidents wher e a viable spore was unabl e to germinate due to limited moisture, it is unlikely that this was a consistent problem over the 24 months of sampling. A positive correlation was seen between S. chartarum occurrence and daily temperature. With the exception of December 2006, every S. chartarum recovery was during a month with an average daily temperature above 23oC. Average daily low temperat ures during these months did not fall below 16.2oC. Average daily high temperatures during these months ranged from 31.4 oC to 34.1oC. The recovery of S. chartarum from the December 2006 sampling shows that lower temperatures do not prevent it from sporulating on the drywall. In stead it is likely that the data accurately reflect that there are more airborne spores of S. chartarum outdoors during warmer months. A related finding was reported by Billups et al. (1999) who found that S. chartarum was preferentially recovered from air sample s when the plates were incubated at 35oC as opposed to

PAGE 52

52 25oC. However, it should be noted that the weat her data in the present study are general data for the Gainesville, FL area, and they do not repres ent conditions that were present at the microlevel at each trap. Stachybotrys chlorohalonata was found even more rarely than S. chartarum This species was only recently recognized (Andersen et al 2003) and has been found indoors in conjunction with S. chartarum Initial studies have shown that S. chlorohalonata is found less commonly than S. chartarum indoors (Cruse et al. 2002, Koster et al 2003, Andersen et al. 2003). This study is the first to compare populati on levels of these two species in nature, and it is interesting that the same trend has been observed. Stachybotrys bisbyi and S. kampalensis were the other two species most commonly found, and in both cases, significantly more fungal growth was found at the weedy lakeshore than at the other three sites. Although this study found less S. chartarum than predicted, the us e of drywall traps for measuring occurrence and frequency of common ai rborne fungi is a valid technique (Flannigan and Miller 2001). All of the ot her selected genera of fungi grew on the drywall traps, and differences in frequency were seen for all of the other genera measured in this study. Species of Cladosporium were the dominant drywall colonizers in all 21 months. This is not surprising, since this genus was also most commonly reco vered from other outdoor air samples (Li and Kendrick 1995, Li et al. 1995, Bishop 2002, She lton et al. 2002, Baxter et al. 2005). Ultimately, the results of this study suggest that although S. chartarum is less common among the outdoor air spora of north-central Flor ida than had been predicted, it occurs in a variety of natural and managed habitats, prim arily during summer months. Having identified these habitats, it would be interesting to expa nd sampling to other habitats to increase our knowledge about the geographic range of this fungus. It would also be useful to sample a variety

PAGE 53

53 of substrates from these environments to determine if this species prefers a particular substrate. Caution should be taken during summer months to limit drywall exposure at building sites to prevent the deposition of S. chartarum spores that could germinate if there is a future water intrusion in the completed structure.

PAGE 54

54 A B C D Figure 3-1. Study sites in Gainesville, Florida. A) Hardwood forest. B) Citrus grove. C) Lakeside. D) Pine grove.

PAGE 55

55 Figure 3-2. Trap design.

PAGE 56

56 A B Figure 3-3. Trap placement in the field. A) Citrus grove. B) Lakeside.

PAGE 57

57 Figure 3-4. Sampling technique.

PAGE 58

58 Table 3-1. Frequenc y of recovery of Stachybotrys chartarum at four sites, 2005. Montha Hardwood Citrus Lakeside Pine June -b + + July + + + August + September -c + + a Traps in field June 1, 2005 December 17, 2005. No S. chartarum was recovered during months not shown in table. b + = present; = absent. c Stachybotrys chartarum occurred in the Hardwood forest on one piece in September; however, the colony was located below the grid. Table 3-2. Frequenc y of recovery of Stachybotrys chartarum at four sites, 2006. Montha Hardwood Citrus Lakeside Pine May -b + July + + + August + + Sept Oct + + December + a Traps in field December 20, 2005 January 6, 2007. No S. chartarum was recovered during months not shown in table. b + = present; = absent. Table 3-3. Abundance of Stachybotrys chartarum at four sites, 2005. Month Hardwood Citrus Lakeside Pine June 0.00a 0.13 0.00 0.05 July 0.00 0.25 0.85 0.70 August 0.00 0.45 0.00 0.00 September 0.00 0.90 0.45 0.00 a Data are means of 20 observations (5 replicates pooled across 4 directions). Data are mean numbers of cells in sampling gri d. Max value = 12 cells per sample with fungus present. There were no significant differences (p 0.10) among locations in any month. Table 3-4. Abundance of Stachybotrys chartarum at four sites, 2006. Month Hardwood Citrus Lakeside Pine May 0.00a 0.10 0.00 0.00 June 0.00 0.00 0.00 0.00 July 0.30 0.13 0.00 0.05 August 0.40 0.40 0.00 0.00 Sept-Oct 2.06a 0.90ab 0.00b 0.00b December 0.10a 0.00b 0.00b 0.00b a Data are means of 20 observations (5 replicates pooled across 4 directions). Data are mean numbers of cells in sampling gri d. Max value = 12 cells per sample with fungus present. Means in rows followed by the same letter do not differ (p 0.10) according to Waller-Duncan k-ratio ttest. No letters in row indicate no differences at p 0.10.

PAGE 59

59 Table 3-5. Colony size determined as averag e number of sampled drywall cells with Stachybotrys chartarum growth. Date Location Number of cellsa June 2005 Citrus 1.0 June 2005 Pine 1.0 July 2005 Citrus 2.0 July 2005 Lakeside 5.7 July 2005 Pine 7.0 August 2005 Citrus 9.0 September 2005 Citrus 6.0 September 2005 Lakeside 4.5 May 2006 Citrus 2.0 July 2006 Hardwood 6.0 July 2006 Citrus 2.0 July 2006 Pine 1.0 August 2006 Hardwood 8.0 August 2006 Citrus 4.0 Sept Oct 2006 Hardwood 9.3 Sept Oct 2006 Citrus 4.3 December 2006 Hardwood 1.0 a Means represent the total number of cells with S. chartarum growth divided by the total number of infested drywall pieces at each site on each sampling date.

PAGE 60

60 Table 3-6. Weather data June 2005 to May 2007. Date Average daily tempLow tempHigh tempRainfall% Relative humidity June 2005 25.2 21.0 31.4 15.8 80.7 July 2005 26.2 21.6 32.4 32.7 79.9 August 2005 26.5 22.2 33.7 11.7 82.1 September 2005 26.0 21.3 33.0 11.7 79.5 Oct Nov 2005 17.3 10.3 25.7 3.3 76.7 Nov Dec 2005 15.4 8.4 23.4 26.6 76.7 January 2006 12.8 5.2 21.0 9.6 74.2 February 2006 12.0 4.2 20.2 35.1 72.4 March 2006 16.6 8.1 25.1 19.8 67.7 April 2006 17.8 9.8 26.1 24.1 69.3 May 2006 23.6 16.2 31.6 5.2 68.6 June 2006 25.2 18.5 32.7 14.5 73.3 July 2006 25.8 19.3 33.5 20.2 73.8 August 2006 26.9 21.2 34.1 7.4 75.3 Sept Oct 2006 24.7 18.2 32.3 14.2 74.1 November 2006 14.7 7.9 22.7 2.3 74.9 December 2006 15.3 8.8 22.8 16.5 77.1 Jan Feb 2007 10.9 3.5 18.6 6.5 67.0 March 2007 12.9 4.9 21.1 10.5 66.0 April 2007 18.4 9.4 27.1 3.2 60.6 May 2007 20.1 11.5 28.6 8.9 63.0 Note: Weather data were generated at the Alachua, Florida weather station ( http://fawn.ifas.ufl.edu/).

PAGE 61

61 Table 3-7. Frequenc y of recovery of Stachybotrys chlorohalonata June 2005 to May 2007, at four sites. Datea Hardwood Citrus Lakeside Pine September 2005 -b -c Nov-Dec 2005 + July 2006 + August 2006 -c Sept-Oct 2006 + May 2007 + a Traps in field June 1, 2005 June 1, 2007. No S. chlorohalonata was recovered from the grid during months not shown in table. b + = present; = absent. cS. chlorohalonata occurred twice off-grid, September 2005 at the citrus site and August 2006 at the hardwood site.

PAGE 62

62 Table 3-8. Frequenc y of recovery of Stachybotrys bisbyi June 2005 to May 2007, at four sites. Datea Hardwood Citrus Lakeside Pine June 2005 -b + July 2005 + + August 2005 + + September 2005 + June 2006 + July 2006 + + August 2006 + Sept-Oct 2006 + November 2006 + December 2006 + a Traps in field June 1, 2005 June 1, 2007. No S. bisbyi was recovered during months not shown in table. b + = present; = absent. Table 3-9. Abundance of Stachybotrys bisbyi June 2005 to May 2007, at four sites. Date Hardwood Citrus Lakeside Pine June 2005 0.00a 0.10 0.00 0.00 July 2005 0.00 0.00 0.30 0.45 August 2005 0.00 0.00 0.60 0.15 September 2005 0.00b 0.00b 0.40a 0.00b June 2006 0.00b 0.00b 0.40a 0.00b July 2006 0.30ab 0.00b 0.55a 0.00b August 2006 0.00b 0.00b 1.00a 0.00b Sept-Oct 2006 0.00 0.00 0.15 0.00 November 2006 0.00 0.00 0.40 0.00 December 2006 0.00 0.00 0.20 0.00 a Data are means of 20 observations (5 replicates pooled across 4 directions). Data are mean numbers of cells in sampling gri d. Max value = 12 cells per sample with fungus present. Means in rows followed by the different letters differ significantly (p 0.10) according to Waller-Duncan k-ratio t-test. No letters in row indicate no differences at p 0.10.

PAGE 63

63 Table 3-10. Frequenc y of recovery of Stachybotrys kampalensis June 2005 to May 2007, at four sites. Datea Hardwood Citrus Lakeside Pine September 2005 -b + June 2006 + July 2006 + + August 2006 + Sept-Oct 2006 + December 2006 + a Traps in field June 1, 2005 June 1, 2007. No S. kampalensis was recovered during months not shown in table. b + = present; = absent Table 3-11. Abundance of Stachybotrys kampalensis June 2005 to May 2007, at four sites. Date Hardwood Citrus Lakeside Pine September 2005 0.00ba 0.00b 0.75a 0.00b June 2006 0.25 0.00 0.00 0.00 July 2006 0.15 0.00 0.35 0.00 August 2006 0.00b 0.00b 0.20a 0.00b Sept-Oct 2006 0.00 0.00 0.10 0.00 December 2006 0.00 0.00 0.10 0.00 a Data are means of 20 observations (5 replicates pooled across 4 directions). Data are mean numbers of cells in sampling gri d. Max value = 12 cells per sample with fungus present. Means in rows followed by the different letters differ significantly (p 0.05) according to Waller-Duncan k-ratio t-test. No letters in row indicate no differences at p 0.10.

PAGE 64

64 Table 3-12. Abundance of Cladosporium spp., June 2005 to May 2007, at four sites. Date Hardwood Citrus Lakeside Pine p-value June 2005 7.45ba 9.69a 6.05b 9.95a <0.0001 July 2005 4.90b 8.88a 4.60b 8.65a <0.0001 August 2005 0.65b 1.50b 1.75b 6.65a <0.0001 September 2005 0.45c 1.90b 1.30bc 4.70a <0.0001 Oct-Nov 2005 7.55ab 8.95a 8.50a 6.25b 0.03 Nov-Dec 2005 8.90b 6.45c 9.75b 11.95a <0.0001 January 2006 9.75a 9.80a 10.15a 1.95b <0.0001 February 2006 10.95a 9.40b 11.10a 11.80a <0.0001 March 2006 10.85a 9.95a 11.40a 10.55a 0.25 April 2006 11.58a 11.50a 12.00a 11.70a 0.13 May 2006 7.80b 9.90a 11.20a 10.15a 0.0008 June 2006 11.40a 11.70a 11.55a 11.60a 0.88 July 2006 10.40b 12.00a 11.85a 12.00a <0.0001 August 2006 8.65b 6.90c 8.15bc 11.15a 0.0002 Sept-Oct 2006 5.94c 6.50bc 7.85b 10.30a <0.0001 November 2006 12.00a 12.00a 11.95a 12.00a 0.40 December 2006 11.70a 11.90a 11.80a 11.60a 0.32 Jan-Feb 2007 10.00a 9.85a 10.00a 4.55b <0.0001 March 2007 10.75a 10.60a 10.90a 10.10a 0.11 April 2007 9.80b 11.40a 5.65c 0.40d <0.0001 May 2007 10.85b 11.15b 11.80a 12.00a <0.0001 a Data are means of 20 observations (5 replicates pooled across 4 directions). Data are mean numbers of cells in sampling gri d. Max value = 12 cells per sample with fungus present. Means in rows followed by the different letters differ significantly (p 0.10) according to Waller-Duncan k-ratio t-test.

PAGE 65

65 Table 3-13. Abundance of Alternaria spp., June 2005 to May 2007, at four sites. Date Hardwood Citrus Lakeside Pine p-value June 2005 4.60aa 5.94a 4.30a 5.70a 0.58 July 2005 4.35a 4.50a 3.90a 4.40a 0.96 August 2005 0.05b 0.90ab 0.35b 1.60a 0.0048 September 2005 0.40a 0.65a 0.15a 0.20a 0.39 Oct-Nov 2005 0.05a 0.05a 0.00a 0.00a 0.59 Nov-Dec 2005 0.15b 0.00b 0.00b 0.75a 0.020 January 2006 0.00b 0.50a 0.05b 0.00b 0.0013 February 2006 0.10b 1.40a 0.00b 0.00b <0.0001 March 2006 0.45b 0.55b 0.60b 2.05a 0.030 April 2006 0.74a 0.65ab 1.10a 0.05b 0.016 May 2006 0.05a 0.85a 0.55a 0.55a 0.33 June 2006 3.65a 2.10b 2.50b 0.20c <0.0001 July 2006 4.45a 0.19c 0.40bc 1.10b <0.0001 August 2006 1.05a 0.70a 0.90a 0.25a 0.21 Sept-Oct 2006 2.33a 0.00b 0.20b 0.00b <0.0001 November 2006 7.40ab 8.85a 5.65b 9.00a 0.058 December 2006 6.65a 6.00a 5.60a 5.40a 0.85 Jan-Feb 2007 0.10a 0.00a 0.15a 0.00a 0.24 March 2007 0.25a 0.45a 0.60a 0.00a 0.14 April 2007 0.00b 0.80a 0.05b 0.00b <0.0001 May 2007 0.75a 0.60a 0.50a 0.35a 0.80 a Data are means of 20 observations (5 replicates pooled across 4 directions). Data are mean numbers of cells in sampling gri d. Max value = 12 cells per sample with fungus present. Means in rows followed by the different letters differ significantly (p 0.10) according to Waller-Duncan k-ratio t-test.

PAGE 66

66 Table 3-14. Abundance of Epicoccum spp., June 2005 to May 2007, at four sites. Date Hardwood Citrus Lakeside Pine p-value June 2005 0.60ba 3.63a 0.85b 3.75a <0.001 July 2005 0.05b 1.88a 1.05a 1.20a 0.0011 August 2005 0.00a 0.00a 0.050a 0.00a 0.40 September 2005 0.00 0.00 0.00 0.00 N/A Oct-Nov 2005 0.00a 0.05a 0.00a 0.00a 0.40 Nov-Dec 2005 0.55a 0.050b 0.00b 0.50a 0.012 January 2006 0.050b 1.60a 0.050b 0.00b <0.0001 February 2006 1.80a 0.45b 0.85b 0.85b 0.017 March 2006 0.15b 1.35b 1.40b 2.95a 0.0013 April 2006 1.58ab 1.75a 0.70bc 0.00c 0.0006 May 2006 0.10 0.75 0.80 0.00 0.089 June 2006 1.40ab 2.60a 0.95bc 0.05c 0.0024 July 2006 1.60a 1.38a 0.65a 0.70a 0.13 August 2006 0.00 0.00 0.00 0.00 N/A Sept-Oct 2006 0.00 0.00 0.00 0.00 N/A November 2006 3.00a 3.60a 3.40a 2.80a 0.73 December 2006 2.95b 1.80c 1.80c 4.75a <0.0001 Jan-Feb 2007 0.15a 0.00a 0.50a 0.00a 0.1031 March 2007 1.05a 1.05a 0.55ab 0.00b 0.0040 April 2007 0.00b 3.20a 0.050b 0.00b <0.0001 May 2007 3.50a 1.05c 2.15b 0.05c <0.0001 a Data are means of 20 observations (5 replicates pooled across 4 directions). Data are mean numbers of cells in sampling gri d. Max value = 12 cells per sample with fungus present. Means in rows followed by the different letters differ significantly (p 0.10) according to Waller-Duncan k-ratio t-test.

PAGE 67

67 Table 3-15. Abundance of Bipolaris Drechslera, Curvularia spp.complex, June 2005 to May 2007, at four sites. Date Hardwood Citrus Lakeside Pine p-value June 2005 2.20ba 4.69a 4.25a 5.05a 0.014 July 2005 1.30a 0.50a 1.30a 1.15a 0.40 August 2005 2.50b 6.65a 3.25b 8.00a <0.0001 September 2005 2.15b 3.35a 1.60b 1.20b 0.0032 Oct-Nov 2005 0.20b 0.85a 0.00b 0.00b 0.0006 Nov-Dec 2005 1.85b 0.75c 1.15bc 3.35a <0.0001 January 2006 0.00b 0.55a 0.00b 0.00b 0.0014 February 2006 0.00b 1.25a 0.00b 0.00b <0.0001 March 2006 0.25a 0.35a 0.50a 0.65a 0.63 April 2006 0.95a 0.40bc 0.45b 0.00c 0.006 May 2006 0.00a 0.050a 0.25a 0.00a 0.29 June 2006 3.85a 1.85b 3.20a 0.00c <0.0001 July 2006 2.30a 0.13b 0.85b 2.45a <0.0001 August 2006 6.30ab 5.30b 6.80a 2.00c <0.0001 Sept-Oct 2006 5.28a 1.80b 4.30a 0.50c <0.0001 November 2006 6.00a 5.80a 6.75a 5.05a 0.31 December 2006 7.60b 8.25b 7.75b 9.70a 0.0063 Jan-Feb 2007 0.15a 0.00a 0.00a 0.00a 0.15 March 2007 0.20b 0.70a 0.10b 0.00b 0.0064 April 2007 0.00b 0.25a 0.00b 0.00b 0.0096 May 2007 0.20a 0.15a 0.30a 0.00a 0.29 a Data are means of 20 observations (5 replicates pooled across 4 directions). Data are mean numbers of cells in sampling gri d. Max value = 12 cells per sample with fungus present. Means in rows followed by the different letters differ significantly (p 0.10) according to Waller-Duncan k-ratio t-test.

PAGE 68

68 CHAPTER 4 IDENTIFICATION OF PUTATIVE Stachybotrys chartarum ISOLATES FROM NORTHCENTRAL FLORIDA HABITATS Introduction In the 1930s, Ukrainian horses faced a micr oscopic nemesis that threatened their usefulness in the Soviet cavalry. They were fed contaminated hay and fell ill; some eventually died. Russian scientists identified the causal agent as a black mold, Stachybotrys chartarum (Ehrenberg ex Link) Hughes, and they named the disease stachybotryotoxicosis (Hintikka 1978b). Sixty years later, doctors in Cleveland, Ohio questione d if an unexplained surge in infant deaths caused by bleeding of the lungs was due to the inhalation of toxic spores of the same fungus (Dearborn et al. 1999, Etzel et al. 1998). Although a connection was not conclusively proven, the health consequences of exposure to S. chartarum remain of great interest to physicians and the public alike. An efficient cellulolytic degrader, this f ungus is found indoors on bu ilding materials such as drywall, a major component of modern stru ctures. Requiring high humidity for growth and sporulation, S. chartarum is particularly problematic in water-damaged structures. With the current public interest in indoor air pollution a nd toxic mold, combined with the active 2004 and 2005 hurricane seasons in the United States, S. chartarum has remained at the forefront of mycological research (Kuhn et al. 2005, Li and Yang 2005, Koster 2006, Tucker et al. 2007). Stachybotrys chartarum is known to produce several clas ses of mycotoxins, including trichothecenes, spirocyclic drimanes, hemolysi n, and atranones (Jarvis et al. 1995, Jarvis 2003, Vesper et al. 2001). Trichothecenes are a class of sesquiterpenes that inhibit protein synthesis and include the well-kno wn T-2 toxin produced by Fusarium spp. As a group, they are considered to be among the most important and acutely toxic of know n mycotoxins (Jarvis 2003). In addition to many simple trichothecenes, S. chartarum produces macrocyclic

PAGE 69

69 trichothecenes, including satrat oxin G which Yang et al. (2000) reports to be more toxic to mammalian cells than T-2 toxin. In contrast atranones have not been shown to possess significant biological activity to humans (Jarvis 2003). As researchers worked to identify and characterize these S. chartarum metabolites, they repeatedly found variation in le vels of toxin production among S. chartarum isolates (Jarvis et al. 1998, Ruotsalainen et al. 1998, Vesp er et al. 1999, Elanskii et al. 2004). Randomly amplified polymorphic DNA (RAPD) analysis also showed variation among isolates (Vesper et al. 1999, Peltola et al. 2002) as did phylogenetic analysis of protein-coding gene s (Andersen et al. 2002, Cruse et al. 2002, Andersen et al. 2003, Koster et al. 2003). Ultimately, the morphological species S. chartarum was recognized as three phylogenetic taxa ( Stachybotrys chlorohalonata Andersen & Thrane, S. chartarum chemotype S and S. chartarum chemotype A) based on a combination of morphological, chemical, and molecular characteristics (Andersen et al. 2003). Stachybotrys chlorohalonata is similar to S. chartarum morphologically. Conidiophores and phialids are similar in appearance, but S. chlorohalonta conidiophores and phialids are shorter, and S. chlorhalonata produces smooth spores while S. chartarum spores are rough (Andersen et al. 2003). In addition, S. chlorohalonata is named for the unique, green extracellular pigment it produ ces on Czapek Yeast Agar. Stachybotrys chlorohalonata isolates produce atranones and dolabellanes; they do not produce macrocyclic tricothecenes such as satratoxins or roridins (Andersen et al. 2002, 2003). Stachybotrys chartarum chemotypes S and A are identical morphologically, but each produces a different set of toxi ns (Andersen et al. 2002, 2003). Stachybotrys chartarum chemotype S produces macrocyclic tr ichothecenes but no atranones, while S. chartarum chemotype A produces atranones but no macrocyclic trichothecenes (as does S. chlorohalonata).

PAGE 70

70 These fungi must be identified based on differe nces in their toxological and/or molecular characteristics. It is crucial to differen tiate between the two chemotypes because only S. chartarum chemotype S produces the highly-toxic macr ocyclic trichothecenes. Genes that are currently known to distinguish between the two chemotypes are chitin synthase 1 and trichodiene synthase 5 (Cruse et al. 2002, Andersen et al. 2003). To date, neither S. chartarum chemotype A nor S. chartarum chemotype S has been conclusively identified as S. chartarum sensu stricto, nor has a new species been erected to accommodate the second chemotype. The majority of the isolates (~90%) used in past phylogene tic studies were collected indoors (Andersen et al. 2002, 2003, Cr use et al. 2002, Koster et al. 2003). All of these studies included geographically diverse populations of S. chartarum chemotype A, S. chartarum chemotype S, and S. chlorohalonata No study appears to have included multiple isolates from one location collected over a pe riod of time. Andersen et al (2002, 2003) and Koster et al. (2003) did not include a ny Florida isolates of S. chartarum sensu lato in their studies. Cruse et al. (2002) included a single isol ate from Florida among the 30 isolates in his study, and this isolate was determined to belong to the new species, S. chlorohalonata. This is the first study to use outdoor samples exclusively and the first to include multiple isolates from Florida, a state w ith environmental conditions that are conducive to mold growth. Most importantly, since the two chemotypes have different biochemical profiles, this study will also provide important toxicological data regarding the out door populations of S. chartarum in north central Florida. It is im portant to know which chemotype of S. chartarum is most prevalent in nature for reasons that range from public health to planning of building projects.

PAGE 71

71 Materials and Methods Preparation of Fungal Isolates Forty-th ree putative environmental samples of S. chartarum were isolated from drywall that had been placed outdoors in Gainesville, Fl orida, USA (Chapter 3). Drywall traps were placed in four habitats, a managed citrus grove, a pine grove, a weedy lakeshore and a mature hardwood forest, for a period of one to two months One sample, isolate # 52, was isolated from drywall from a Gainesville, Florida apartment w ith a history of water leaks, for a total of 44 Florida isolates (Table 4-1). Six isolates used in previous stud ies were obtained from the IBT culture collection at BioCentrum-DTU, Denmark: S. chlorohalonata IBT 9825 and IBT 40292, S. chartarum chemtotype A IBT 9290 and IBT 14915, and S. chartarum chemotype S IBT 7711 and IBT 40293 (Andersen et al. 2003). Florida samples were tentatively identified as S. chartarum at 400x and 1000x based on morphological features as descri bed by Jong and Davis (1976). Pure cultures were single-spored and maintained on DifcoTM Potato Dextrose Agar plates (Becton, Dickinson and Co., Sparks, MD). Mycelium for DNA extraction was grown at 22oC in 50 mL of yeast extract broth (20 g glucose, 10 g yeast extract, 2 g peptone per 1 l iter water) as described by Cruse et al. (2002). After three days, mycelium was collected by vacuum filtration, frozen in liquid nitrogen and lyophilized. In addition, all Florid a isolates were inoculated on Czapek Yeast Autolysate Agar (CYA, Samson et al. 2002) and incubated in the dark for seven days at 24oC at which point they were evaluated for pigment production. Proxy isol ates were deposited at the University of Florida Mycological Herbarium. DNA Extraction, PCR Amplific ation, and Seq uencing Lyophilized mycelium was manually disrupted us ing a metal spatula. DNA was extracted using the DNeasy Plant Mini Kit (Qiagen, Va lencia, California) and stored at -20oC.

PAGE 72

72 Primer sequences for the trichodiene synthase 5 ( tri5 ) and chitin synthase 1 ( chs1 ) gene fragments were obtained from Cruse et al. (2002). The tri5 5 primer was 5CATCAATCCAACAGTTTCAC-3. The tri5 3 primer was 5GCAACCTTCAAAGACTATTG-3. The chs1 5 primer was 5ATCTCACCACAAGCACCGCCACACA-3. The chs1 3 primer was 5GGAAGAAGATCGTTGTGTGCGTGGT-3. The loci were amplified in 50 L polymerase chain reactions (PCR) in a PTC-200 Peltier Th ermal cycler (Bio-Rad Laboratories, Inc., Hercules, California) using Invitr ogen reagents (Carlsbad, CA, US A). Each reaction contained 5 L of 10x Taq buffer, 1.5 L of 50 mM MgCl2, 1 L of 10 mM dNTPs, 1 L each of 10 mM forward and reverse primers, 0.25 L of Taq polymerase and 2 L of template DNA. PCR conditions for tri5 amplification were as follows: 94oC for 4 min, 35 cycles at 94oC for 1 min, 51oC for 1 min and 72oC for 1 min, with a final extension of 72oC for 4 min (Koster et al. 2003). PCR conditions for chs1 amplification were identical wi th the exception of an annealing temperature of 61oC. PCR products were visualized on a 1% agarose gel before being submitted for sequencing. Sequencing of the DNA sample was done at the University of Florida DNA Sequencing Core Laboratory using ABI Prism BigDye Terminator cycle sequencing protocols (part number 4303153) developed by Applied Biosystems (PerkinElmer Corp., Foster City, CA). The excess dye-labeled terminators were removed using Multo Screen 96-well filtration system (Millipore, Bedford, MA). The purified extension products were dried in SpeedVac (ThermoSavant, Holbrook, NY) and then suspended in Hi-di form amide. Sequencing reactions were performed using POP-7 sieving matrix on 50-cm capillaries in an ABI Prism 3130 Genetic Analyzer

PAGE 73

73 (Applied Biosystems, Foster City, CA) and were analyzed by ABI Sequencing Analysis software v. 5.2 and KB Basecaller. Phylogenetic Analysis Forward and reverse sequences obtained from the tri5 and chs1 primers were combined using Sequencher version 4.5 (Gene Codes Cor poration, Ann Arbor, MI, USA), and only bases sequenced in both directions were included. Th e exceptions were isolate 27 for which only the chs1 forward sequence was obtained and isolate 20 for which only a chs1 reverse sequence was obtained. Two sequences from GenBank were included, S. charatarum AF468154 and S. chartarum AF 468155 (Cruse et al. 2002). Sequences were aligned in ClustalX version 1.83.1 using the default settings before being manua lly corrected in MacClade 4. The aligned sequences were exported as NEXUS files and analyzed using PAUP version 4.0b10. Phylogenetic trees for each locus were construc ted with neighbor-joining (Saitou and Nei 1987) using default settings. Ties, if encountered, we re broken randomly. Distance bootstrap values were determined using neighbor-joining with 100,000 replications. Results Of the 44 Florida isolates, six produced a da rk green extracellular pigm ent on CYA, and eight other isolates produced an orange pigment. The remaining 30 isolates produced no pigment. (Figure 4-1, Table 4-2). Eight of th e 11 isolates (73%) that were identified through sequencing as S. chartarum chemotype S produced orange pigment; three produced no pigment. None of the S. chartarum chemotype A isolates produced extracellular pigment on CYA. The tri 5 sequence is 485 base pairs with 29 informative characters, and the chs 1 sequence is 297 base pairs with 12 informative characters. Sequence data have been submitted to Genbank (Table 4-3, Table 4-4); aligments are reported in Appendix B. Both the tri5 and the chs1 neighbor-joining trees separate the majority of the isolates into three clades that correspond with

PAGE 74

74 the taxa/chemotypes S. chlorohalonata S. chartarum chemotype A, and S. chartarum chemotype S (Figures 4-2 and 4-3). At both loci, there are multiple base pair differences between the S. chlorohalonata and the S. chartarum clades resulting in strong bootst rap support. In the case of the two S. chartarum clades, there is only a one nucleotid e difference between the sequences at each locus that resulted in weaker bootstrap support. The difference in the tri 5 sequence is at base pair 278 where S. chartarum chemotype A has a thymine and S. chartarum chemotype S has a cytosine. The difference in the chs 1 sequence is at base pair 18 where S. chartarum chemotype A has a thymine and S. chartarum chemotype S has a guanine. The two trees have similar topologies with the exception of isolat e #1, which groups with the S. chartarum chemotype S clade in the chs 1 tree and the S. chartarum chemotype A clade in the tri 5 tree. This incongruence is due to a reversal of the nucleotide substitution at these loci. In addition the placement of isolate #41 is unresolved in the chs 1 tree because it was not determined during sequencing if base pair 18 was a guanine or a thymine. In the tri 5 tree, this isolate groups with the chemotype A clade. Tw o Florida isolates, isolat es #12 and 46, as well as isolates ITB7711 and ITB40293 from Andersen et al. (2003), are unresolved in the tri 5 tree and group as a sister clade to the two S. chartarum chemotypes. However, when the sequence data are examined, it is apparent that they should group with S. chartarum chemotype S clade because they all have a cytosine base at position 278. Their placement is unresolved because these isolates have a cytosine base at position 290 in common with the S. chartarum chemotype A clade, while the other S. chartarum chemotype S isolates have a thymine base at this position. The tri 5 tree also shows the S. chartarum chemotype A clade and the S. chlorohalonata clade as each containing sister clades. These additiona l clades are also due to a one nucleotide substitution, at base pair position 480 and 116, respectively.

PAGE 75

75 The one indoor isolate was identified as S. chartarum chemotype A. Of the 43 outdoor isolates, 6 were S. chlorohalonata (14%), 11 were S. chartarum chemotype S (26%), and 26 were S. chartarum chemotype A (60%). If only the S. chartarum isolates were considered, 70% were chemotype A (26 of 37 isolates) and 30% were chemotype S (11 of 37 isolates). The chemotype A isolates were recovered from all f our habitats over the course of two years. However, 8 of the 11 chemotype S isolates were recovered from the hardwood site, and all were recovered in either September or October 2006 from the same replicate (Table 4-1). Discussion Extracellular pigm ent production and molecular analyses of suspected isolates of S. chartarum sensu lato are necessary to differentiate among S. chlorohalonata, S. chartarum chemotype S, and S. chartarum chemotype A. This study confirms that S. chlorohalonata can be identified accurately by production of a dark gr een extracellular pigment on CYA (Andersen et al. 2003). All of the isolates that produced this pigment also fell into the S. chlorohalonata clade in the phylogenetic analysis. Researchers have remarked on the difficulty of distinguishing between S. chlorohalonata and S. chartarum isolates based on mor phological characteristics alone (Li and Yang 2005, Koster 2006). In the pres ent study, it was not possi ble to consistently identify isolates of S. chlorohalonata using oil immersion (1000x magnification), and pigment production and DNA sequencing were used for iden tification. Given the time and expense of preparing a sample for DNA sequencing and the re liability of the pigment test on CYA, it is recommended that all putative S. chartarum isolates be screened on CYA. Seventy-three percent of the S. chartarum chemotype S isolates produced a yellow-orange pigment on CYA. This is a much higher percen tage than observed by Andersen et al. (2003), who found only three of nine S. chartarum chemotype S isolates produced a yellow-orange pigment. However, these results still suggest that extracellular pi gment production cannot be

PAGE 76

76 used alone as a method to differentiate between S. chartarum chemotypes S and A. While an isolate that produces orange pigment on CYA can be identified confidently as S. chartarum chemotype S, lack of pigment would require furthe r testing for identificati on purposes. It should also be noted that one pigment-producing isol ate, isolate #1, was incongruent between the two loci in the phylogenetic analysis. Andersen et al. (2003) reported a similar situation from a nonpigment producing isolate and used metabolite produc tion to confirm its identification. In this case, pigment production was able to confirm that isolate #1 was S. chartarum chemotype S. However, these examples illustrate the challe nge of using sequence data with only a single nucleotide substitution, as do the cases of isolates #12, 41 and 46, all of which were unable to be placed into either S. chartarum clade in one of the two trees. Generally speaking, sequence analysis of both gene fragments used in this study successfully differentiated between the two chemotypes. However, as a diagnostic tool, neither locus was 100% accurate, and final identification relied on information from both loci plus pigment production. Additional loci, hopefully with more than one nucleotide substitution between the two chemotypes, should be identified if sequencing is to be widely used. Other species-specific molecular primers for use in PC R assays have been designed for the purpose of identifying S. chartarum from indoor samples; however, none of these authors differentiated between S. chlorohalonata and the two S. chartarum chemotypes (Haugland and Heckman 1998, Haugland et al. 1999, Cruz-Perez et al. 2001, Dean et al. 2005). An alternative molecular technique is amplified fragment length polym orphism (AFLP) fingerp rinting, which Koster (2006) successfully used to study in traspecific genetic variation among S. chartarum isolates. This technique could be develope d into a diagnostic tool, as could measurement of metabolite production.

PAGE 77

77 Previous studies that have used DNA sequencing to identify S. chlorohalonata and chemotypes of S. chartarum have looked primarily at indoor isolates from diverse geographic origins. Andersen et al. (2002) examined isolat es of which the majority were collected from buildings in Europe and the United States; approximately 20% of the 122 isolates were identified as S. chlorohalonata, 49% as S. chartarum chemotype A, and 31% as S. chartarum chemotype S. Cruse et al. (2002) examin ed 30 isolates collected prim arily in northern California; approximately 23% were S. chlorohalonata, 47% were S. chartarum chemotype S and 30% were S. chartarum chemotype A. While the exact distribution of isolates among th e three taxa varied between the two studies, these studies as we ll as another (Koster 2006) found no correlation between genetic isolation and geographic distance. In this study, the same four habitats were repeatedly sampled in order to accumulate a collection that accurately reflected the population distribution of the two chemotypes in natural settings in north central Florida. A previous study of isolat es sampled within a restricted geographical region found genome-wide genetic vari ation (Koster 2006). Fourteen percent of the outdoor isolates in the pres ent study were identified as S. chlorohalonata, 60% as S. chartarum chemotype A and 26% as S. chartarum chemotype S. It should be noted that 8 of the 11 S. chartarum chemotype S isolates were recovered from the hardwood site, and all were recovered in either Sept or Oct 2006 from the same trap. It is likely that a single source of inoculum was responsible for all of these isolates, in which case, the occurrence of S. chartarum chemotype S would be even less than suggested by th e results of this study. Thus, while all three taxa are present in north central Florida ha bitats, this study recovered fewer macrocyclic trichothecene-producing isolates ( S. chartarum chemotype S) than non-macrocyclic

PAGE 78

78 trichothecene producers. It is unknown why S. chartarum chemotype A was the clade most commonly recovered. Koster (2006) hypothesizes that outdoor sources of S. chartarum serve as reservoirs of inoculum for indoor contaminati on. If this is true, then the present study suggests that S. chartarum chemotype A would also be found more commonly indoors than S. chartarum chemotype S in north central Florida. This ma y have a positive implication for public health since S. chartarum chemotype A does not produce macrocyclic tricothecenes. Further research should compare the distribution of S. chlorohalonata and S. chartarum chemotypes in outdoor and indoor environments of close proximity.

PAGE 79

79 Figure 4-1. Extracellular pigm entation on Czapek yeast autolysate agar (CYA). A) S. chlorohalonata with green pigmentation. B) S. chartarum chemtoype S with orange pigmentation. C) S. chartarum chemotype A with no pigmentation. A B C

PAGE 80

80 Figure 4-2. Neighbo r-joining tree for chs 1 gene for Stachybotrys chartarum and S. chlorohalonata outdoor isolates. Numbers above br anches are bootstra p percentages. AF 468158 and AF 468159 are Genbank sequences published by Cruse et al. (2002). IBT 14915 and IBT 7711 are isolates fr om Andersen et al. (2003). 47 Citrus 22 Citrus 34 Citrus 36 Citrus 16 Citrus 56 Pine 23 Citrus 14 Pine 20 Citrus 10 Lakeside 48 Citrus 4 Citrus 9 Lakeside 50 Hardwood 13 Citrus 52 Indoor 24 Citrus 31 Citrus 17 Lakeside 18 Lakeside 21 Citrus 15 Lakeside 19 Citrus IBT14915 Andersen et al 2002 8 Citrus 11 Citrus 42 Pine AF468158 Cruse et al 2002 41 Citrus 46 Pine 1 Lakeside 27 Hardwood 28 Hardwood 49 Hardwood 29 Hardwood 12 Pine 32 Hardwood 33 Hardwood IBT7711 Andersen et al 2002 35 Hardwood 25 Hardwood 2 Lakeside 6 Citrus 26 Lakeside 3 Lakeside 30 Hardwood AF468159 Cruse et al 2002 5 Citrus 0.0005 substitutions/site NJ S. chlorohalonata S. chartarum chemotypeS S. chartarum chemotypeA 100 64 64 47 Citrus 22 Citrus 34 Citrus 36 Citrus 16 Citrus 56 Pine 23 Citrus 14 Pine 20 Citrus 10 Lakeside 48 Citrus 4 Citrus 9 Lakeside 50 Hardwood 13 Citrus 52 Indoor 24 Citrus 31 Citrus 17 Lakeside 18 Lakeside 21 Citrus 15 Lakeside 19 Citrus IBT14915 Andersen et al 2002 8 Citrus 11 Citrus 42 Pine AF468158 Cruse et al 2002 41 Citrus 46 Pine 1 Lakeside 27 Hardwood 28 Hardwood 49 Hardwood 29 Hardwood 12 Pine 32 Hardwood 33 Hardwood IBT7711 Andersen et al 2002 35 Hardwood 25 Hardwood 2 Lakeside 6 Citrus 26 Lakeside 3 Lakeside 30 Hardwood AF468159 Cruse et al 2002 5 Citrus 0.0005 substitutions/site NJ S. chlorohalonata S. chartarum chemotypeS S. chartarum chemotypeA 100 64 64

PAGE 81

81 Figure 4-3. Neighbo r-joining tree for tri 5 gene for Stachybotrys chartarum and S. chlorohalonata outdoor isolates. Numbers above br anches are bootstra p percentages. AF 468158 and AF 468159 are Genbank sequences published by Cruse et al. (2002). IBT 14915, IBT 40293, IBT 7711, and IBT 9825 are isolates from Andersen et al. (2003). 48 Citrus 41 Citrus 34 Citrus 24 Citrus 36 Citrus 14 Pine 56 Pine 52 Indoor 15 Lakeside 4 Citrus 13 Citrus 50 Hardwood 19 Citrus 11 Citrus 23 Citrus 8 Citrus 42 Pine 10 Lakeside 31 Citrus 17 Lakeside 47 Citrus ITB14915 Andersen et al 2002 18 Lakeside 1 Lakeside 9 Lakeside 22 Citrus AF46815 Cruse et al 2002 16 Citrus 20 Citrus 21 Citrus ITB7711 Andersen et al 2002 46 Pine 12 Pine ITB40293 Andersen et al 2002 33 Hardwood 32 Hardwood 35 Hardwood 29 Hardwood 25 Hardwood 49 Hardwood 28 Hardwood 27 Hardwood 2 Lakeside 3 Lakeside 5 Citrus 6 Citrus 30 Hardwood AF468155 Cruse et al 2002 26 Lakeside ITB9825 Andersen et al 2002 0.001 substitutions/site NJ S. chartarum chemotypeA S. chartarum chemotypeS S. chlorohalonata 100 65 63 63 60 48 Citrus 41 Citrus 34 Citrus 24 Citrus 36 Citrus 14 Pine 56 Pine 52 Indoor 15 Lakeside 4 Citrus 13 Citrus 50 Hardwood 19 Citrus 11 Citrus 23 Citrus 8 Citrus 42 Pine 10 Lakeside 31 Citrus 17 Lakeside 47 Citrus ITB14915 Andersen et al 2002 18 Lakeside 1 Lakeside 9 Lakeside 22 Citrus AF46815 Cruse et al 2002 16 Citrus 20 Citrus 21 Citrus ITB7711 Andersen et al 2002 46 Pine 12 Pine ITB40293 Andersen et al 2002 33 Hardwood 32 Hardwood 35 Hardwood 29 Hardwood 25 Hardwood 49 Hardwood 28 Hardwood 27 Hardwood 2 Lakeside 3 Lakeside 5 Citrus 6 Citrus 30 Hardwood AF468155 Cruse et al 2002 26 Lakeside ITB9825 Andersen et al 2002 0.001 substitutions/site NJ S. chartarum chemotypeA S. chartarum chemotypeS S. chlorohalonata 100 65 63 63 60

PAGE 82

82 Table 4-1. Isolate number, species, origin and collection date of 44 Stachybotrys isolates from outdoor habitats in north central Florida. Isolate Species Site Collection Isolate Species Site Collection 1 Sa lakeshore Jul 0424A citrus Jun 06 2 Cl lakeshore Jun 0525S hardwood Aug 06 3 Cl lakeshore Jun 0526Cl lakeshore Aug 06 4 A citrus Aug 0527S hardwood Oct 06 5 Cl citrus Oct 0528S hardwood Oct 06 6 Cl citrus Dec 0529S hardwood Oct 06 8 A citrus Jul 0530Cl hardwood Oct 06 9 A lakeshore Aug 0531A citrus Sep 06 10 A lakeshore Oct 0532S hardwood Sep 06 11 A citrus Aug 0533S hardwood Sep 06 12 S pine Jul 0534A citrus Sep 06 13 A citrus Oct 0535S hardwood Oct 06 14 A pine Aug 0536A citrus Oct 06 15 A lakeshore Aug 0541A citrus Aug 06 16 A citrus Oct 0542A pine Aug 05 17 A lakeshore Oct 0546S pine Jul 04 18 A lakeshore Oct 0547A citrus Oct 06 19 A citrus Oct 0548A citrus Oct 06 20 A citrus Aug 0549S hardwood Oct 06 21 A citrus Sep 0550A hardwood Oct 05 22 A citrus Sep 0552A indoor 2004 23 A citrus Oct 0556A pine Aug 06 a Cl = S. chlorohalonata A = S. chartarum chemotype A, S = S. chartarum chemotype S.

PAGE 83

83 Table 4-2. Comparison of pigmentation and tri5 and chs1 sequence data for Stachybotrys chartarum and S. chlorohalonata isolates from outdoor habitats in north central Florida. Isolate Pigment Clade Isolate PigmentClade 1 orange Sa 24 none A 2 green Cl 25 orange S 3 green Cl 26 green Cl 4 none A 27 orange S 5 green Cl 28 orange S 6 green Cl 29 orange S 8 none A 30 green Cl 9 none A 31 none A 10 none A 32 orange S 11 none A 33 orange S 12 none S 34 none A 13 none A 35 orange S 14 none A 36 none A 15 none A 41 none A 16 none A 42 none A 17 none A 46 none S 18 none A 47 none A 19 none A 48 none A 20 none A 49 none S 21 none A 50 none A 22 none A 52 none A 23 none A 56 none A a Cl = S. chlorohalonata A = S. chartarum chemotype A, S = S. chartarum chemotype S.

PAGE 84

84 Table 4-3. Genbank accession numbers for chs1 and tri5 nucleotide sequences for Stachybotrys chartarum Isolate chs1 tri5 1 EU288762 EU288803 4 EU288766 EU288813 8 EU288772 EU288815 9 EU288778 EU288817 10 EU288788 EU288822 11 EU288770 EU288805 12 EU288783 EU288834 13 EU288784 EU288799 14 EU288791 EU288806 15 EU288789 EU288814 16 EU288790 EU288819 17 EU288792 EU288801 18 EU288773 EU288816 19 EU288774 EU288804 20 EU288771 EU288820 21 EU288785 EU288807 22 EU288776 EU288800 23 EU288782 EU288802 24 EU288786 EU288808 25 EU288779 EU288826 27 EU288761 EU288828 28 EU288764 EU288830 29 EU288796 EU288833 31 EU288780 EU288823 32 EU288793 EU288831 33 EU288798 EU288829 34 EU288794 EU288811 35 EU288765 EU288832 36 EU288781 EU288809 41 EU288777 EU288812 42 EU288769 EU288818 46 EU288763 EU288836 47 EU288768 EU288825 48 EU288795 EU288810 49 EU288797 EU288827 50 EU288775 EU288824 52 EU288787 EU288835 56 EU288767 EU288821

PAGE 85

85 Table 4-4. Genbank accession numbers for chs1 and tri5 nucleotide sequences for Stachybotrys chlorohalonata Isolate chs1 tri5 2 EU288837 EU288843 3 EU288838 EU288844 5 EU288839 EU288846 6 EU288842 EU288847 26 EU288840 EU288848 30 EU288841 EU288845

PAGE 86

86 CHAPTER 5 DISCUSSION Stachybotrys chartarum is a m ycotoxin-producing, cosmopol ian fungus that occurs on a variety of natural substrates as well as cellulo se-based building material s such as drywall and ceiling tiles. This black mold has aroused public interest because it has been implicated in cases of sick building syndrome and pulmonary hemo rrhage (Croft et al. 1986, Etzel et al. 1998, Dearborn et al. 1999). Because it is likely th at outdoor populations se rve as the source of inoculum for mold colonies in water-damaged structures (Koster 2006) it is critical to understand the types of environments th at support natura l populations of S. chartarum The primary objective of this project was to identify outdoor habitats in north central Florida where S. chartarum is found and the times of year it is most abundant. Initially, it was thought that air sampling would be an a ppropriate method despite the fact that S. chartarum is only rarely reported from out door air samples (Li and Kendrick 1995, Tiffany and Bader 2000, Bishop 2002). The devel opment of a semi-selective medium was intended to overcome the difficulties that broad-spectrum media have isolating S. chartarum due to its slow growth in rela tion to common airborne fungi. However, the detection of S. chartarum from outdoor air in this study was a ra re event if it was even isolated at all. It is quite possible that the infrequent occurrence of S. chartarum on plates in this study was actually due to mite contamination. Thus, it is likely that if S. chartarum is present in outdoor ai r, it is at such a low concentration that it falls below the detectable threshold of even semi-selective media. This study suggests that air sampling wo uld not be an appropriate method for research investigating the occurrence of S. chartarum in outdoor habitats. Based on the results of this part of the study, it was decided to investigate other means of measuring S. chartarum frequency and abundance outdoors. Since water-damaged drywall is a

PAGE 87

87 common substrate for indoor S. chartarum contamination, traps were designed that incorporated this material and were placed in four habitats in Gainesville, Fl orida. Over the course of 24 months, S. chartarum was found growing at all four ha bitats. It was expected that S. chartarum would be the dominant fungus on the drywall, occurring frequently, in multiple and large colonies. Instead, it was found rarely, on only 0.02% of the pieces collected. In addition, it was expected that the abundance of S. chartarum would be more than what was observed. The frequency of S. chartarum was low and, therefore, most differences in abundance between sites were not significant. Stachybotrys chartarum was recovered more than once from each habitat, was recovered most frequently from the citr us grove, and was found only during the summer months at all sites. There was a correlation between S. chartarum occurrence and temperature but not with rainfall. A closely related species, S. chlorohalonata, was found even more rarely than S. chartarum Ultimately, the results of this study suggest that although S. chartarum is less common among the outdoor air spora of north-central Florida than had been predicted, it occurs in a variety of natural and managed habitats, primarily during summer months. The morphological species S. chartarum is recognized as thre e phylogenetically distinct taxa based on a combination of morphological, chemical and molecular characteristics: Stachybotrys chlorohalonata Andersen & Thrane, S. chartarum chemotype S and S. chartarum chemotype A (Andersen et al. 2003). This study was the first to use outdoor samples exclusively and the first to include multiple isolates from Fl orida, a state with environmental conditions that are conducive to mold growth. Most importantly, since the two S. chartarum chemotypes have different biochemical profiles, this study provide s important toxicological data regarding the outdoor populations of S. chartarum in north central Florida. It is important to ascertain which chemotype of S. chartarum is most prevalent in nature for reasons that range from public health

PAGE 88

88 to planning of building projects. Seventy percent of the outdoor isolates in this study were identified as S. chartarum chemotype A and 30% as chemotype S. It is hoped that the collection of Florida outdoor isolates compiled in this study will be useful to future researchers investigating the popul ation genetics of S. chartarum Future work with S. chartarum should focus on the following two areas: 1) development of alternative sampling methods in order to expand our knowledge of the distribution and occurrence of S. chartarum in indoor and outdoor environments, and 2) further development of molecular markers for accurate identification of chemotypes A and S. Neither sampling method used here (selective media and drywall) recovered S. chartarum as often as previously was expected. Although the research presented here does elucidate some understanding of frequency and abundance of S. chartarum it was difficult to discern differences between habitats because of the limited number of fungus recoveries. It is possible that bul k samples of soil and leaf litter plated out on the semi-selective media evaluated in Chapter 2 would be more appropriate than drywall traps which are, essentiall y, modified air samplers. In part icular, this could determine if populations of S. chartarum truly decline in the winter months, or if that observation was an artifact due to lower moisture levels in the drywall traps. The molecular techniques used in this study to distinguish between S. chartarum chemotype A and S. charatrum chemotype S were based on mi nor differences in the genomic DNA and were not infallible. If loci with more sequence differences are not found, an alternative method such as AFLP fingerprinting should be employed. A rapid and accurate diagnostic tool will be key to answering re maining questions about the distribution and occurrence of the two S. chartarum chemotypes.

PAGE 89

89 APPENDIX A LOCATION OF SITES AND SAMP LING DATES FOR FIELD ST UDY Table A-1. GPS location of study sites Site Latitude Longitude Citrus 1a 29o38 N 82o21 W Citrus 2 29o38 N 82o21 W Citrus 3 29o38 N 82o21 W Citrus 4 29o38 N 82o21 W Citrus 5 29o38 N 82o21 W Hardwood 1 29o41 N 82o24 W Hardwood 2 29o41 N 82o24 W Hardwood 3 29o41 N 82o24 W Hardwood 4 29o41 N 82o24 W Hardwood 5 29o41 N 82o24 W Lakeside 1 29o38 N 82o21 W Lakeside 2 29o38 N 82o21 W Lakeside 3 29o38 N 82o21 W Lakeside 4 29o38 N 82o21 W Lakeside 5 29o38 N 82o21 W Pine 1 29o38 N 82o21 W Pine 2 29o38 N 82o21 W Pine 3 29o38 N 82o21 W Pine 4 29o38 N 82o21 W Pine 5 29o38 N 82o21 W a Numbers 1 through 5 represent replicates.

PAGE 90

90 Table A-2. Summary of sampling dates Month Date placed in field Date Collected June 2005 6/1/05 6/28/05 July 2005 6/1/05 7/27/05 August 2005 8/1/05 8/31 9/1/05 September 2005 8/1/05 9/26/05 October-November 2005 10/15/05 11/17-11/20/05 November-December 2005 10/15/05 12/14-12/17/05 January 2006 12/20/05 1/19-1/24/06 February 2006 12/20/05 2/14-2/17-06 March 2006 2/21/06 3/22-06, 4/8/06 April 2006 2/21/06 4/20-4/26/06 May 2006 5/5/06 6/2-6/5/06 June 2006 6/1/06 6/30-7/10/06 July 2006 6/1/06 8/5-8/606 August 2006 8/1/06 9/1-9/4/06 September-October 2006 8/1/06 10/18-10/19/06 November 2006 11/1/06 12/1-12/7/06 December 2006 11/1/06 1/3-1/6/07 January-February 2007 1/17/07 2/18-2/23/07 March 2007 1/17/07 3/21/07 April 2007 4/2/07 5/1-5/2/07 May 2007 4/2/07 6/1/07

PAGE 91

91 APPENDIX B ALIGNMENTS OF TR I5 AND CHS1 NUCLEOTIDE SEQUENCES 13 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50] 22 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50] 17 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50] 23 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50] 1 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50] 19 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50] 11 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50] 14 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50] 21 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50] 24 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50] 36 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50] 48 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50] 34 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50] 41 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50] 4 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50] 15 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50] 8 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50] 18 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50] 9 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50] 42 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50] 16 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50] 20 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50] 56 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50] 10 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50] 31 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50] 50 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50] 47 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50] 25 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50] 49 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50] 27 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50] 33 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50] 28 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50] 32 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50] 35 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50] 29 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50] 12 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50] 52 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50] 46 TGGAGGCATTCCCGACCGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50] 2 TGGAGACATTCCCGACTGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50] 3 TGGAGACATTCCCGACTGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50] 30 TGGAGACATTCCCGACTGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50] 5 TGGAGACATTCCCGACTGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50] 6 TGGAGACATTCCCGACTGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50] 26 TGGAGACATTCCCGACTGAGTACTTCCTGGGCACCGCTGTGCGGCTGCTG [50] Figure B-1. Alignment of tri5 nucleotide sequence. = informative base pair differentiating Stachybotrys chlorohalonata and S. chartarum. + = informative base pair differentiating S. chartarum chemotypes A and S.

PAGE 92

92 13 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100] 22 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100] 17 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100] 23 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100] 1 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100] 19 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100] 11 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100] 14 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100] 21 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100] 24 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100] 36 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100] 48 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100] 34 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100] 41 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100] 4 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100] 15 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100] 8 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100] 18 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100] 9 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100] 42 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100] 16 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100] 20 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100] 56 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100] 10 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100] 31 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100] 50 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100] 47 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100] 25 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100] 49 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100] 27 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100] 33 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100] 28 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100] 32 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100] 35 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100] 29 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100] 12 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100] 52 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100] 46 GAGAATGTCAAGTACAGGGACAGTAACTACACCAGGGAGGAGCGTGTTGA [100] 2 GAGAACGTCAAGTACAGAGACAGCAACTACACGAGGGAGGAGCGCGTTGA [100] 3 GAGAACGTCAAGTACAGAGACAGCAACTACACGAGGGAGGAGCGCGTTGA [100] 30 GAGAACGTCAAGTACAGAGACAGCAACTACACGAGGGAGGAGCGCGTTGA [100] 5 GAGAACGTCAAGTACAGAGACAGCAACTACACGAGGGAGGAGCGCGTTGA [100] 6 GAGAACGTCAAGTACAGAGACAGCAACTACACGAGGGAGGAGCGCGTTGA [100] 26 GAGAACGTCAAGTACAGAGACAGCAACTACACGAGGGAGGAGCGCGTTGA [100] * Figure B-1. Continued

PAGE 93

93 13 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150] 22 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150] 17 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150] 23 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150] 1 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150] 19 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150] 11 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150] 14 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150] 21 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150] 24 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150] 36 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150] 48 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150] 34 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150] 41 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150] 4 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150] 15 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150] 8 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150] 18 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150] 9 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150] 42 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150] 16 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150] 20 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150] 56 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150] 10 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150] 31 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150] 50 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150] 47 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150] 25 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150] 49 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150] 27 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150] 33 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150] 28 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150] 32 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150] 35 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150] 29 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150] 12 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150] 52 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150] 46 AAATCTCCAGTATGCCTACAACAAGGCTGCGGCCCACTTCGCACAAGAGC [150] 2 AAATCTTCAGTATGCTTACAACAAGGCTGCGGCTCATTTCGCACAAGAAC [150] 3 AAATCTTCAGTATGCTTACAACAAGGCTGCGGCTCATTTCGCACAAGAAC [150] 30 AAATCTTCAGTATGCTTACAACAAGGCTGCGGCTCATTTCGCACAAGAAC [150] 5 AAATCTTCAGTATGCTTACAACAAGGCTGCGGCTCATTTCGCACAAGAAC [150] 6 AAATCTTCAGTATGCTTACAACAAGGCTGCGGCTCATTTCGCACAAGAAC [150] 26 AAATCTTCAGTATGCCTACAACAAGGCTGCGGCTCATTTCGCACAAGAAC [150] * Figure B-1. Continued

PAGE 94

94 13 GGCAGCAACAGATTTTGAAGGTCAGC CCCAAGAGACTGGAGGCTTCCCTT [200] 22 GGCAGCAACAGATTTTGAAGGTCAGC CCCAAGAGACTGGAGGCTTCCCTT [200] 17 GGCAGCAACAGATTTTGAAGGTCAGC CCCAAGAGACTGGAGGCTTCCCTT [200] 23 GGCAGCAACAGATTTTGAAGGTCAGC CCCAAGAGACTGGAGGCTTCCCTT [200] 1 GGCAGCAACAGATTTTGAAGGTCAGCCCCAAGAGACTGGAGGCTTCCCTT [200] 19 GGCAGCAACAGATTTTGAAGGTCAGC CCCAAGAGACTGGAGGCTTCCCTT [200] 11 GGCAGCAACAGATTTTGAAGGTCAGC CCCAAGAGACTGGAGGCTTCCCTT [200] 14 GGCAGCAACAGATTTTGAAGGTCAGC CCCAAGAGACTGGAGGCTTCCCTT [200] 21 GGCAGCAACAGATTTTGAAGGTCAGC CCCAAGAGACTGGAGGCTTCCCTT [200] 24 GGCAGCAACAGATTTTGAAGGTCAGC CCCAAGAGACTGGAGGCTTCCCTT [200] 36 GGCAGCAACAGATTTTGAAGGTCAGC CCCAAGAGACTGGAGGCTTCCCTT [200] 48 GGCAGCAACAGATTTTGAAGGTCAGC CCCAAGAGACTGGAGGCTTCCCTT [200] 34 GGCAGCAACAGATTTTGAAGGTCAGC CCCAAGAGACTGGAGGCTTCCCTT [200] 41 GGCAGCAACAGATTTTGAAGGTCAGC CCCAAGAGACTGGAGGCTTCCCTT [200] 4 GGCAGCAACAGATTTTGAAGGTCAGCCCCAAGAGACTGGAGGCTTCCCTT [200] 15 GGCAGCAACAGATTTTGAAGGTCAGC CCCAAGAGACTGGAGGCTTCCCTT [200] 8 GGCAGCAACAGATTTTGAAGGTCAGCCCCAAGAGACTGGAGGCTTCCCTT [200] 18 GGCAGCAACAGATTTTGAAGGTCAGC CCCAAGAGACTGGAGGCTTCCCTT [200] 9 GGCAGCAACAGATTTTGAAGGTCAGCCCCAAGAGACTGGAGGCTTCCCTT [200] 42 GGCAGCAACAGATTTTGAAGGTCAGC CCCAAGAGACTGGAGGCTTCCCTT [200] 16 GGCAGCAACAGATTTTGAAGGTCAGC CCCAAGAGACTGGAGGCTTCCCTT [200] 20 GGCAGCAACAGATTTTGAAGGTCAGC CCCAAGAGACTGGAGGCTTCCCTT [200] 56 GGCAGCAACAGATTTTGAAGGTCAGC CCCAAGAGACTGGAGGCTTCCCTT [200] 10 GGCAGCAACAGATTTTGAAGGTCAGC CCCAAGAGACTGGAGGCTTCCCTT [200] 31 GGCAGCAACAGATTTTGAAGGTCAGC CCCAAGAGACTGGAGGCTTCCCTT [200] 50 GGCAGCAACAGATTTTGAAGGTCAGC CCCAAGAGACTGGAGGCTTCCCTT [200] 47 GGCAGCAACAGATTTTGAAGGTCAGC CCCAAGAGACTGGAGGCTTCCCTT [200] 25 GGCAGCAACAGATTTTGAAGGTCAGC CCCAAGAGACTGGAGGCTTCCCTT [200] 49 GGCAGCAACAGATTTTGAAGGTCAGC CCCAAGAGACTGGAGGCTTCCCTT [200] 27 GGCAGCAACAGATTTTGAAGGTCAGC CCCAAGAGACTGGAGGCTTCCCTT [200] 33 GGCAGCAACAGATTTTGAAGGTCAGC CCCAAGAGACTGGAGGCTTCCCTT [200] 28 GGCAGCAACAGATTTTGAAGGTCAGC CCCAAGAGACTGGAGGCTTCCCTT [200] 32 GGCAGCAACAGATTTTGAAGGTCAGC CCCAAGAGACTGGAGGCTTCCCTT [200] 35 GGCAGCAACAGATTTTGAAGGTCAGC CCCAAGAGACTGGAGGCTTCCCTT [200] 29 GGCAGCAACAGATTTTGAAGGTCAGC CCCAAGAGACTGGAGGCTTCCCTT [200] 12 GGCAGCAACAGATTTTGAAGGTCAGC CCCAAGAGACTGGAGGCTTCCCTT [200] 52 GGCAGCAACAGATTTTGAAGGTCAGC CCCAAGAGACTGGAGGCTTCCCTT [200] 46 GGCAGCAACAGATTTTGAAGGTCAGC CCCAAGAGACTGGAGGCTTCCCTT [200] 2 GGCAGCAACAGATCTTGAAGGTCAGCCCCAAGAGACTGGAGGCTTCCCTT [200] 3 GGCAGCAACAGATCTTGAAGGTCAGCCCCAAGAGACTGGAGGCTTCCCTT [200] 30 GGCAGCAACAGATCTTGAAGGTCAGCCCCAAGAGACTGGAGGCTTCCCTT [200] 5 GGCAGCAACAGATCTTGAAGGTCAGCCCCAAGAGACTGGAGGCTTCCCTT [200] 6 GGCAGCAACAGATCTTGAAGGTCAGCCCCAAGAGACTGGAGGCTTCCCTT [200] 26 GGCAGCAACAGATCTTGAAGGTCAGCCCCAAGAGACTGGAGGCTTCCCTT [200] Figure B-1. Continued

PAGE 95

95 13 CGAACCATTGTCGGCATGGTGGTTTACT CCTGGGCCAAGGTTTCCAAGGA [250] 22 CGAACCATTGTCGGCATGGTGGTTTACT CCTGGGCCAAGGTTTCCAAGGA [250] 17 CGAACCATTGTCGGCATGGTGGTTTACT CCTGGGCCAAGGTTTCCAAGGA [250] 23 CGAACCATTGTCGGCATGGTGGTTTACT CCTGGGCCAAGGTTTCCAAGGA [250] 1 CGAACCATTGTCGGCATGGTGGTTTACTCCTGGGCCAAGGTTTCCAAGGA [250] 19 CGAACCATTGTCGGCATGGTGGTTTACT CCTGGGCCAAGGTTTCCAAGGA [250] 11 CGAACCATTGTCGGCATGGTGGTTTACT CCTGGGCCAAGGTTTCCAAGGA [250] 14 CGAACCATTGTCGGCATGGTGGTTTACT CCTGGGCCAAGGTTTCCAAGGA [250] 21 CGAACCATTGTCGGCATGGTGGTTTACT CCTGGGCCAAGGTTTCCAAGGA [250] 24 CGAACCATTGTCGGCATGGTGGTTTACT CCTGGGCCAAGGTTTCCAAGGA [250] 36 CGAACCATTGTCGGCATGGTGGTTTACT CCTGGGCCAAGGTTTCCAAGGA [250] 48 CGAACCATTGTCGGCATGGTGGTTTACT CCTGGGCCAAGGTTTCCAAGGA [250] 34 CGAACCATTGTCGGCATGGTGGTTTACT CCTGGGCCAAGGTTTCCAAGGA [250] 41 CGAACCATTGTCGGCATGGTGGTTTACT CCTGGGCCAAGGTTTCCAAGGA [250] 4 CGAACCATTGTCGGCATGGTGGTTTACTCCTGGGCCAAGGTTTCCAAGGA [250] 15 CGAACCATTGTCGGCATGGTGGTTTACT CCTGGGCCAAGGTTTCCAAGGA [250] 8 CGAACCATTGTCGGCATGGTGGTTTACTCCTGGGCCAAGGTTTCCAAGGA [250] 18 CGAACCATTGTCGGCATGGTGGTTTACT CCTGGGCCAAGGTTTCCAAGGA [250] 9 CGAACCATTGTCGGCATGGTGGTTTACTCCTGGGCCAAGGTTTCCAAGGA [250] 42 CGAACCATTGTCGGCATGGTGGTTTACT CCTGGGCCAAGGTTTCCAAGGA [250] 16 CGAACCATTGTCGGCATGGTGGTTTACT CCTGGGCCAAGGTTTCCAAGGA [250] 20 CGAACCATTGTCGGCATGGTGGTTTACT CCTGGGCCAAGGTTTCCAAGGA [250] 56 CGAACCATTGTCGGCATGGTGGTTTACT CCTGGGCCAAGGTTTCCAAGGA [250] 10 CGAACCATTGTCGGCATGGTGGTTTACT CCTGGGCCAAGGTTTCCAAGGA [250] 31 CGAACCATTGTCGGCATGGTGGTTTACT CCTGGGCCAAGGTTTCCAAGGA [250] 50 CGAACCATTGTCGGCATGGTGGTTTACT CCTGGGCCAAGGTTTCCAAGGA [250] 47 CGAACCATTGTCGGCATGGTGGTTTACT CCTGGGCCAAGGTTTCCAAGGA [250] 25 CGAACCATTGTCGGCATGGTGGTTTACT CCTGGGCCAAGGTTTCCAAGGA [250] 49 CGAACCATTGTCGGCATGGTGGTTTACT CCTGGGCCAAGGTTTCCAAGGA [250] 27 CGAACCATTGTCGGCATGGTGGTTTACT CCTGGGCCAAGGTTTCCAAGGA [250] 33 CGAACCATTGTCGGCATGGTGGTTTACT CCTGGGCCAAGGTTTCCAAGGA [250] 28 CGAACCATTGTCGGCATGGTGGTTTACT CCTGGGCCAAGGTTTCCAAGGA [250] 32 CGAACCATTGTCGGCATGGTGGTTTACT CCTGGGCCAAGGTTTCCAAGGA [250] 35 CGAACCATTGTCGGCATGGTGGTTTACT CCTGGGCCAAGGTTTCCAAGGA [250] 29 CGAACCATTGTCGGCATGGTGGTTTACT CCTGGGCCAAGGTTTCCAAGGA [250] 12 CGAACCATTGTCGGCATGGTGGTTTACT CCTGGGCCAAGGTTTCCAAGGA [250] 52 CGAACCATTGTCGGCATGGTGGTTTACT CCTGGGCCAAGGTTTCCAAGGA [250] 46 CGAACCATTGTCGGCATGGTGGTTTACT CCTGGGCCAAGGTTTCCAAGGA [250] 2 CGAACCATTGTCGGCATGGTGGTTTACTCCTGGGCCAAGGTTTCCAAGGA [250] 3 CGAACCATTGTCGGCATGGTGGTTTACTCCTGGGCCAAGGTTTCCAAGGA [250] 30 CGAACCATTGTCGGCATGGTGGTTTACT CCTGGGCCAAGGTTTCCAAGGA [250] 5 CGAACCATTGTCGGCATGGTGGTTTACTCCTGGGCCAAGGTTTCCAAGGA [250] 6 CGAACCATTGTCGGCATGGTGGTTTACTCCTGGGCCAAGGTTTCCAAGGA [250] 26 CGAACCATTGTCGGCATGGTGGTTTACT CCTGGGCCAAGGTTTCCAAGGA [250] Figure B-1. Continued

PAGE 96

96 13 GCTCATGGCAGATCTCAGCATCCACTATACCTACACTCTCATCCTCGATG [300] 22 GCTCATGGCAGATCTCAGCATCCACTATACCTACACTCTCATCCTCGATG [300] 17 GCTCATGGCAGATCTCAGCATCCACTATACCTACACTCTCATCCTCGATG [300] 23 GCTCATGGCAGATCTCAGCATCCACTATACCTACACTCTCATCCTCGATG [300] 1 GCTCATGGCAGATCTCAGCATCCACTATACCTACACTCTCATCCTCGATG [300] 19 GCTCATGGCAGATCTCAGCATCCACTATACCTACACTCTCATCCTCGATG [300] 11 GCTCATGGCAGATCTCAGCATCCACTATACCTACACTCTCATCCTCGATG [300] 14 GCTCATGGCAGATCTCAGCATCCACTATACCTACACTCTCATCCTCGATG [300] 21 GCTCATGGCAGATCTCAGCATCCACTATACCTACACTCTCATCCTCGATG [300] 24 GCTCATGGCAGATCTCAGCATCCACTATACCTACACTCTCATCCTCGATG [300] 36 GCTCATGGCAGATCTCAGCATCCACTATACCTACACTCTCATCCTCGATG [300] 48 GCTCATGGCAGATCTCAGCATCCACTATACCTACACTCTCATCCTCGATG [300] 34 GCTCATGGCAGATCTCAGCATCCACTATACCTACACTCTCATCCTCGATG [300] 41 GCTCATGGCAGATCTCAGCATCCACTATACCTACACTCTCATCCTCGATG [300] 4 GCTCATGGCAGATCTCAGCATCCACTATACCTACACTCTCATCCTCGATG [300] 15 GCTCATGGCAGATCTCAGCATCCACTATACCTACACTCTCATCCTCGATG [300] 8 GCTCATGGCAGATCTCAGCATCCACTATACCTACACTCTCATCCTCGATG [300] 18 GCTCATGGCAGATCTCAGCATCCACTATACCTACACTCTCATCCTCGATG [300] 9 GCTCATGGCAGATCTCAGCATCCACTATACCTACACTCTCATCCTCGATG [300] 42 GCTCATGGCAGATCTCAGCATCCACTATACCTACACTCTCATCCTCGATG [300] 16 GCTCATGGCAGATCTCAGCATCCACTATACCTACACTCTCATCCTCGATG [300] 20 GCTCATGGCAGATCTCAGCATCCACTATACCTACACTCTCATCCTCGATG [300] 56 GCTCATGGCAGATCTCAGCATCCACTATACCTACACTCTCATCCTCGATG [300] 10 GCTCATGGCAGATCTCAGCATCCACTATACCTACACTCTCATCCTCGATG [300] 31 GCTCATGGCAGATCTCAGCATCCACTATACCTACACTCTCATCCTCGATG [300] 50 GCTCATGGCAGATCTCAGCATCCACTATACCTACACTCTCATCCTCGATG [300] 47 GCTCATGGCAGATCTCAGCATCCACTATACCTACACTCTCATCCTCGATG [300] 25 GCTCATGGCAGATCTCAGCATCCACTACACCTACACTCTTATCCTCGATG [300] 49 GCTCATGGCAGATCTCAGCATCCACTACACCTACACTCTTATCCTCGATG [300] 27 GCTCATGGCAGATCTCAGCATCCACTACACCTACACTCTTATCCTCGATG [300] 33 GCTCATGGCAGATCTCAGCATCCACTACACCTACACTCTTATCCTCGATG [300] 28 GCTCATGGCAGATCTCAGCATCCACTACACCTACACTCTTATCCTCGATG [300] 32 GCTCATGGCAGATCTCAGCATCCACTACACCTACACTCTTATCCTCGATG [300] 35 GCTCATGGCAGATCTCAGCATCCACTACACCTACACTCTTATCCTCGATG [300] 29 GCTCATGGCAGATCTCAGCATCCACTACACCTACACTCTTATCCTCGATG [300] 12 GCTCATGGCAGATCTCAGCATCCACTACACCTACACTCTCATCCTCGATG [300] 52 GCTCATGGCAGATCTCAGCATCCACTATACCTACACTCTCATCCTCGATG [300] 46 GCTCATGGCAGATCTCAGCATCCACTACACCTACACTCTCATCCTCGATG [300] 2 GCTCATGGCAGATCTCAGCATTCACTACACCTACACTCTCATCCTCGATG [300] 3 GCTCATGGCAGATCTCAGCATTCACTACACCTACACTCTCATCCTCGATG [300] 30 GCTCATGGCAGATCTCAGCATTCACTACACCTACACTCTCATCCTCGATG [300] 5 GCTCATGGCAGATCTCAGCATTCACTACACCTACACTCTCATCCTCGATG [300] 6 GCTCATGGCAGATCTCAGCATTCACTACACCTACACTCTCATCCTCGATG [300] 26 GCTCATGGCAGATCTCAGCATTCACTACACCTACACTCTCATCCTCGATG [300] + + Figure B-1. Continued

PAGE 97

97 13 ATAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350] 22 ATAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350] 17 ATAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350] 23 ATAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350] 1 ATAGCGAGGACGACCCTCACCCTCAGAT GTTGACATACTTTGATGATCTT [350] 19 ATAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350] 11 ATAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350] 14 ATAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350] 21 ATAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350] 24 ATAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350] 36 ATAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350] 48 ATAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350] 34 ATAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350] 41 ATAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350] 4 ATAGCGAGGACGACCCTCACCCTCAGAT GTTGACATACTTTGATGATCTT [350] 15 ATAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350] 8 ATAGCGAGGACGACCCTCACCCTCAGAT GTTGACATACTTTGATGATCTT [350] 18 ATAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350] 9 ATAGCGAGGACGACCCTCACCCTCAGAT GTTGACATACTTTGATGATCTT [350] 42 ATAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350] 16 ATAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350] 20 ATAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350] 56 ATAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350] 10 ATAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350] 31 ATAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350] 50 ATAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350] 47 ATAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350] 25 ATAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350] 49 ATAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350] 27 ATAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350] 33 ATAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350] 28 ATAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350] 32 ATAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350] 35 ATAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350] 29 ATAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350] 12 ATAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350] 52 ATAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350] 46 ATAGCGAGGACGACCCTCACCCTCAGATGTTGACATACTTTGATGATCTT [350] 2 ACAGCGAGGACGACCCTCACCCTCAGAT GTTGACATACTTTGATGATCTT [350] 3 ACAGCGAGGACGACCCTCACCCTCAGAT GTTGACATACTTTGATGATCTT [350] 30 ACAGCGAGGACGACCCTCACCCTCAGATG TTGACATACTTTGATGATCTT [350] 5 ACAGCGAGGACGACCCTCACCCTCAGAT GTTGACATACTTTGATGATCTT [350] 6 ACAGCGAGGACGACCCTCACCCTCAGAT GTTGACATACTTTGATGATCTT [350] 26 ACAGCGAGGACGACCCTCACCCTCAGATG TTGACATACTTTGATGATCTT [350] Figure B-1. Continued

PAGE 98

98 13 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400] 22 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400] 17 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400] 23 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400] 1 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400] 19 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400] 11 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400] 14 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400] 21 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400] 24 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400] 36 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400] 48 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400] 34 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400] 41 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400] 4 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400] 15 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400] 8 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400] 18 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400] 9 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400] 42 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400] 16 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400] 20 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400] 56 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400] 10 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400] 31 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400] 50 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400] 47 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400] 25 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400] 49 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400] 27 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400] 33 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400] 28 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400] 32 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400] 35 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400] 29 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400] 12 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400] 52 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400] 46 CAGAGTGGCAACCCGCAAAAGCATCCCTGGTGGATGCTGGTCAACGAGCA [400] 2 CAGAGTGGCAACCAGCAAAAGCATCCTTGGTGGATGCTGGTCAACGAGCA [400] 3 CAGAGTGGCAACCAGCAAAAGCATCCTTGGTGGATGCTGGTCAACGAGCA [400] 30 CAGAGTGGCAACCAGCAAAAGCATCCTTGGTGGATGCTGGTCAACGAGCA [400] 5 CAGAGTGGCAACCAGCAAAAGCATCCTTGGTGGATGCTGGTCAACGAGCA [400] 6 CAGAGTGGCAACCAGCAAAAGCATCCTTGGTGGATGCTGGTCAACGAGCA [400] 26 CAGAGTGGCAACCAGCAAAAGCATCCTTGGTGGATGCTGGTCAACGAGCA [400] Figure B-1. Continued

PAGE 99

99 13 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450] 22 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450] 17 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450] 23 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450] 1 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450] 19 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450] 11 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450] 14 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450] 21 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450] 24 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450] 36 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450] 48 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450] 34 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450] 41 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450] 4 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450] 15 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450] 8 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450] 18 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450] 9 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450] 42 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450] 16 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450] 20 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450] 56 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450] 10 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450] 31 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450] 50 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450] 47 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450] 25 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450] 49 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450] 27 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450] 33 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450] 28 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450] 32 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450] 35 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450] 29 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450] 12 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450] 52 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450] 46 CTTCCCTAATGTGCTGAGACACTTTGGCCCTTTCTGCTCGCTAAACCTCA [450] 2 CTTCCCTAATGTGCTCAGACACTTTGGCCCTTTCTGCTCCTTGAACCTCA [450] 3 CTTCCCTAATGTGCTCAGACACTTTGGCCCTTTCTGCTCCTTGAACCTCA [450] 30 CTTCCCTAATGTGCTCAGACACTTTGGCCCTTTCTGCTCCTTGAACCTCA [450] 5 CTTCCCTAATGTGCTCAGACACTTTGGCCCTTTCTGCTCCTTGAACCTCA [450] 6 CTTCCCTAATGTGCTCAGACACTTTGGCCCTTTCTGCTCCTTGAACCTCA [450] 26 CTTCCCTAATGTGCTCAGACACTTTGGCCCTTTCTGCTCCTTGAACCTCA [450] ** Figure B-1. Continued

PAGE 100

100 13 TTCGCAGCACACTGGACTGTAAGTCTATACTCGAC [485] 22 TTCGCAGCACACTGGACTGTAAGTCTATACTCGAC [485] 17 TTCGCAGCACACTGGACTGTAAGTCTATACTCGAC [485] 23 TTCGCAGCACACTGGACTGTAAGTCTATACTCGAC [485] 1 TTCGCAGCACACTGGACTGTAAGTCTATACTCGAC [485] 19 TTCGCAGCACACTGGACTGTAAGTCTATACTCGAC [485] 11 TTCGCAGCACACTGGACTGTAAGTCTATACTCGAC [485] 14 TTCGCAGCACACTGGACTGTAAGTCTATACTCGAC [485] 21 TTCGCAGCACACTGGACTGTAAGTCTATACTCGAC [485] 24 TTCGCAGCACACTGGACTGTAAGTCTATAGTCGAC [485] 36 TTCGCAGCACACTGGACTGTAAGTCTATAGTCGAC [485] 48 TTCGCAGCACACTGGACTGTAAGTCTATAGTCGAC [485] 34 TTCGCAGCACACTGGACTGTAAGTCTATAGTCGAC [485] 41 TTCGCAGCACACTGGACTGTAAGTCTATAGTCGAC [485] 4 TTCGCAGCACACTGGACTGTAAGTCTATACTCGAC [485] 15 TTCGCAGCACACTGGACTGTAAGTCTATACTCGAC [485] 8 TTCGCAGCACACTGGACTGTAAGTCTATACTCGAC [485] 18 TTCGCAGCACACTGGACTGTAAGTCTATACTCGAC [485] 9 TTCGCAGCACACTGGACTGTAAGTCTATACTCGAC [485] 42 TTCGCAGCACACTGGACTGTAAGTCTATACTCGAC [485] 16 TTCGCAGCACACTGGACTGTAAGTCTATACTCGAC [485] 20 TTCGCAGCACACTGGACTGTAAGTCTATACTCGAC [485] 56 TTCGCAGCACACTGGACTGTAAGTCTATACTCGAC [485] 10 TTCGCAGCACACTGGACTGTAAGTCTATACTCGAC [485] 31 TTCGCAGCACACTGGACTGTAAGTCTATACTCGAC [485] 50 TTCGCAGCACACTGGACTGTAAGTCTATACTCGAC [485] 47 TTCGCAGCACACTGGACTGTAAGTCTATACTCGAC [485] 25 TTCGCAGCACACTGGACTGTAAGTCTATACTCGAC [485] 49 TTCGCAGCACACTGGACTGTAAGTCTATACTCGAC [485] 27 TTCGCAGCACACTGGACTGTAAGTCTATACTCGAC [485] 33 TTCGCAGCACACTGGACTGTAAGTCTATACTCGAC [485] 28 TTCGCAGCACACTGGACTGTAAGTCTATACTCGAC [485] 32 TTCGCAGCACACTGGACTGTAAGTCTATACTCGAC [485] 35 TTCGCAGCACACTGGACTGTAAGTCTATACTCGAC [485] 29 TTCGCAGCACACTGGACTGTAAGTCTATACTCGAC [485] 12 TTCGCAGCACACTGGACTGTAAGTCTATACTCGAC [485] 52 TTCGCAGCACACTGGACTGTAAGTCTATACTCGAC [485] 46 TTCGCAGCACACTGGACTGTAAGTCTATACTCGAC [485] 2 TTCGCAGCACACTGGACTGTAAGTCTGCACTGTAA [485] 3 TTCGCAGCACACTGGACTGTAAGTCTGCACTGTAA [485] 30 TTCGCAGCACACTGGACTGTAAGTCTGCACTGTAA [485] 5 TTCGCAGCACACTGGACTGTAAGTCTGCACTGTAA [485] 6 TTCGCAGCACACTGGACTGTAAGTCTGCACTGTAA [485] 26 TTCGCAGCACACTGGACTGTAAGTCTGCACTGTAA [485] ** ** Figure B-1. Continued

PAGE 101

101 27 GGAGTTTCCTCCAGGTCGGGTACCGGCAT CGATGAGGACACAGATGTTGG [50] 46 GGAGTTTCCTCCAGGTCGGGTACCGGCAT CGATGAGGACACAGATGTTGG [50] 1 GGAGTTTCCTCCAGGTCGGGTACCGGC ATCGATGAGGACACAGATGTTGG [50] 28 GGAGTTTCCTCCAGGTCGGGTACCGGCAT CGATGAGGACACAGATGTTGG [50] 35 GGAGTTTCCTCCAGGTCGGGTACCGGCAT CGATGAGGACACAGATGTTGG [50] 4 GGAGTTTCCTCCAGGTCTGGTACCGGCATCGATGAGGACACAGATGTTGG [50] 56 GGAGTTTCCTCCAGGTCTGGTACCGGCAT CGATGAGGACACAGATGTTGG [50] 47 GGAGTTTCCTCCAGGTCTGGTACCGGCAT CGATGAGGACACAGATGTTGG [50] 42 GGAGTTTCCTCCAGGTCTGGTACCGGCAT CGATGAGGACACAGATGTTGG [50] 11 GGAGTTTCCTCCAGGTCTGGTACCGGCAT CGATGAGGACACAGATGTTGG [50] 20 GGAGTTTCCTCCAGGTCTGGTACCGGCAT CGATGAGGACACAGATGTTGG [50] 8 GGAGTTTCCTCCAGGTCTGGTACCGGCATCGATGAGGACACAGATGTTGG [50] 18 GGAGTTTCCTCCAGGTCTGGTACCGGCAT CGATGAGGACACAGATGTTGG [50] 19 GGAGTTTCCTCCAGGTCTGGTACCGGCAT CGATGAGGACACAGATGTTGG [50] 50 GGAGTTTCCTCCAGGTCTGGTACCGGCAT CGATGAGGACACAGATGTTGG [50] 22 GGAGTTTCCTCCAGGTCTGGTACCGGCAT CGATGAGGACACAGATGTTGG [50] 41 GGAGTTTCCTCCAGGTCKGGTACCGGCAT CGATGAGGACACAGATGTTGG [50] 9 GGAGTTTCCTCCAGGTCTGGTACCGGCATCGATGAGGACACAGATGTTGG [50] 25 GGAGTTTCCTCCAGGTCGGGTACCGGCAT CGATGAGGACACAGATGTTGG [50] 31 GGAGTTTCCTCCAGGTCTGGTACCGGCAT CGATGAGGACACAGATGTTGG [50] 36 GGAGTTTCCTCCAGGTCTGGTACCGGCAT CGATGAGGACACAGATGTTGG [50] 23 GGAGTTTCCTCCAGGTCTGGTACCGGCAT CGATGAGGACACAGATGTTGG [50] 12 GGAGTTTCCTCCAGGTCGGGTACCGGCAT CGATGAGGACACAGATGTTGG [50] 13 GGAGTTTCCTCCAGGTCTGGTACCGGCAT CGATGAGGACACAGATGTTGG [50] 21 GGAGTTTCCTCCAGGTCTGGTACCGGCAT CGATGAGGACACAGATGTTGG [50] 24 GGAGTTTCCTCCAGGTCTGGTACCGGCAT CGATGAGGACACAGATGTTGG [50] 52 GGAGTTTCCTCCAGGTCTGGTACCGGCAT CGATGAGGACACAGATGTTGG [50] 10 GGAGTTTCCTCCAGGTCTGGTACCGGCAT CGATGAGGACACAGATGTTGG [50] 15 GGAGTTTCCTCCAGGTCTGGTACCGGCAT CGATGAGGACACAGATGTTGG [50] 16 GGAGTTTCCTCCAGGTCTGGTACCGGCAT CGATGAGGACACAGATGTTGG [50] 14 GGAGTTTCCTCCAGGTCTGGTACCGGCAT CGATGAGGACACAGATGTTGG [50] 17 GGAGTTTCCTCCAGGTCTGGTACCGGCAT CGATGAGGACACAGATGTTGG [50] 32 GGAGTTTCCTCCAGGTCGGGTACCGGCAT CGATGAGGACACAGATGTTGG [50] 34 GGAGTTTCCTCCAGGTCTGGTACCGGCAT CGATGAGGACACAGATGTTGG [50] 48 GGAGTTTCCTCCAGGTCTGGTACCGGCAT CGATGAGGACACAGATGTTGG [50] 29 GGAGTTTCCTCCAGGTCGGGTACCGGCAT CGATGAGGACACAGATGTTGG [50] 49 GGAGTTTCCTCCAGGTCGGGTACCGGCAT CGATGAGGACACAGATGTTGG [50] 33 GGAGTTTCCTCCAGGTCGGGTACCGGCAT CGATGAGGACACAGATGTTGG [50] 2 GGAGTTTCCTCCAGGTCGGGTACCGGC ATCGATGAGGACGCAGATGTTGG [50] 3 GGAGTTTCCTCCAGGTCGGGTACCGGC ATCGATGAGGACGCAGATGTTGG [50] 5 GGAGTTTCCTCCAGGTCGGGTACCGGC ATCGATGAGGACGCAGATGTTGG [50] 26 GGAGTTTCCTCCAGGTCGGGTACCGGCAT CGATGAGGACGCAGATGTTGG [50] 30 GGAGTTTCCTCCAGGTCGGGTACCGGCAT CGATGAGGACGCAGATGTTGG [50] 6 GGAGTTTCCTCCAGGTCGGGTACCGGC ATCGATGAGGACGCAGATGTTGG [50] + Figure B-2. Alignment of chs1 nucleotide sequence. + = informative base pair differentiating S. chartarum chemotypes A and S. = informative base pair differentiating Stachybotrys chlorohalonata and S. chartarum.

PAGE 102

102 27 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100] 46 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100] 1 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100] 28 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100] 35 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100] 4 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100] 56 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100] 47 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100] 42 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100] 11 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100] 20 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100] 8 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100] 18 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100] 19 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100] 50 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100] 22 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100] 41 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100] 9 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100] 25 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100] 31 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100] 36 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100] 23 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100] 12 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100] 13 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100] 21 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100] 24 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100] 52 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100] 10 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100] 15 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100] 16 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100] 14 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100] 17 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100] 32 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100] 34 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100] 48 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100] 29 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100] 49 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100] 33 GATCCAGGACACGACCAAATGCCTGGAAGAACCATCTGTGCGAATTGATC [100] 2 GATCCAGGACGCGACCAAAGGCCT GGAAGAACCATCTGTGCGAGTTGATC [100] 3 GATCCAGGACGCGACCAAAGGCCT GGAAGAACCATCTGTGCGAGTTGATC [100] 5 GATCCAGGACGCGACCAAAGGCCT GGAAGAACCATCTGTGCGAGTTGATC [100] 26 GATCCAGGACGCGACCAAAGGCCTGGA AGAACCATCTGTGCGAGTTGATC [100] 30 GATCCAGGACGCGACCAAAGGCCTGGA AGAACCATCTGTGCGAGTTGATC [100] 6 GATCCAGGACGCGACCAAAGGCCT GGAAGAACCATCTGTGCGAGTTGATC [100] Figure B-2. Continued

PAGE 103

103 27 TTCTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGCTGGCG [150] 46 TTCTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGCTGGCG [150] 1 TTCTTCTGGTTCTTTTCCTTCAGGC AAAAGATCATCTGCACGGGCTGGCG [150] 28 TTCTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGCTGGCG [150] 35 TTCTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGCTGGCG [150] 4 TTCTTCTGGTTCTTTTCCTTCAGGC AAAAGATCATCTGCACGGGCTGGCG [150] 56 TTCTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGCTGGCG [150] 47 TTCTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGCTGGCG [150] 42 TTCTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGCTGGCG [150] 11 TTCTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGCTGGCG [150] 20 TTCTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGCTGGCG [150] 8 TTCTTCTGGTTCTTTTCCTTCAGGC AAAAGATCATCTGCACGGGCTGGCG [150] 18 TTCTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGCTGGCG [150] 19 TTCTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGCTGGCG [150] 50 TTCTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGCTGGCG [150] 22 TTCTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGCTGGCG [150] 41 TTCTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGCTGGCG [150] 9 TTCTTCTGGTTCTTTTCCTTCAGGC AAAAGATCATCTGCACGGGCTGGCG [150] 25 TTCTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGCTGGCG [150] 31 TTCTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGCTGGCG [150] 36 TTCTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGCTGGCG [150] 23 TTCTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGCTGGCG [150] 12 TTCTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGCTGGCG [150] 13 TTCTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGCTGGCG [150] 21 TTCTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGCTGGCG [150] 24 TTCTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGCTGGCG [150] 52 TTCTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGCTGGCG [150] 10 TTCTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGCTGGCG [150] 15 TTCTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGCTGGCG [150] 16 TTCTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGCTGGCG [150] 14 TTCTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGCTGGCG [150] 17 TTCTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGCTGGCG [150] 32 TTCTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGCTGGCG [150] 34 TTCTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGCTGGCG [150] 48 TTCTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGCTGGCG [150] 29 TTCTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGCTGGCG [150] 49 TTCTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGCTGGCG [150] 33 TTCTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGCTGGCG [150] 2 TTTTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGTTGGCG [150] 3 TTTTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGTTGGCG [150] 5 TTTTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGTTGGCG [150] 26 TTTTTCTGGTTCTTTTCCTTCAGGCAAA AGATCATCTGCACGGGTTGGCG [150] 30 TTTTTCTGGTTCTTTTCCTTCAGGCAAA AGATCATCTGCACGGGTTGGCG [150] 6 TTTTTCTGGTTCTTTTCCTTCAGGCAAAAGATCATCTGCACGGGTTGGCG [150] Figure B-2. Continued

PAGE 104

104 27 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200] 46 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200] 1 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200] 28 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200] 35 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200] 4 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200] 56 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200] 47 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200] 42 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200] 11 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200] 20 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200] 8 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200] 18 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200] 19 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200] 50 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200] 22 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200] 41 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200] 9 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200] 25 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200] 31 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200] 36 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200] 23 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200] 12 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200] 13 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200] 21 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200] 24 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200] 52 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200] 10 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200] 15 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200] 16 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200] 14 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200] 17 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200] 32 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200] 34 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200] 48 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200] 29 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200] 49 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200] 33 GCGGTGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200] 2 GCGATGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200] 3 GCGATGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200] 5 GCGATGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200] 26 GCGATGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200] 30 GCGATGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200] 6 GCGATGCACGAGCGAGACGACGTCGTTCTTGAGCTGCAGGTGAGTCTGCG [200] Figure B-2. Continued

PAGE 105

105 27 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250] 46 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250] 1 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250] 28 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250] 35 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250] 4 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250] 56 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250] 47 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250] 42 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250] 11 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250] 20 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250] 8 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250] 18 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250] 19 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250] 50 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250] 22 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250] 41 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250] 9 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250] 25 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250] 31 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250] 36 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250] 23 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250] 12 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250] 13 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250] 21 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250] 24 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250] 52 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250] 10 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250] 15 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250] 16 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250] 14 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250] 17 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250] 32 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250] 34 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250] 48 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250] 29 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250] 49 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250] 33 TGGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTAACCTGCTGC [250] 2 TCGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTGACCTGCTGC [250] 3 TCGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTGACCTGCTGC [250] 5 TCGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTGACCTGCTGC [250] 26 TCGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTGACCTGCTGC [250] 30 TCGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTGACCTGCTGC [250] 6 TCGTGTACTCGTAAATGTGCGCCGTTACGTCCTTGCCGTTGACCTGCTGC [250] Figure B-2. Continued

PAGE 106

106 27 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297] 46 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297] 1 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297] 28 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297] 35 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297] 4 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297] 56 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297] 47 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297] 42 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297] 11 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297] 20 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297] 8 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297] 18 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297] 19 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297] 50 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297] 22 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297] 41 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297] 9 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297] 25 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297] 31 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297] 36 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297] 23 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297] 12 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297] 13 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297] 21 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297] 24 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297] 52 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297] 10 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297] 15 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297] 16 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297] 14 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297] 17 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297] 32 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297] 34 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297] 48 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297] 29 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297] 49 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297] 33 TTTGCAATACCTTCCTGGTACACTCCCATACCAGAGAGCACGGCTTT [297] 2 TTTGCAATACCTTCCTGGTACAC TCCCATACCAGAGAGTACGGCTTT [297] 3 TTTGCAATACCTTCCTGGTACAC TCCCATACCAGAGAGTACGGCTTT [297] 5 TTTGCAATACCTTCCTGGTACAC TCCCATACCAGAGAGTACGGCTTT [297] 26 TTTGCAATACCTTCCTGGTACACT CCCATACCAGAGAGTACGGCTTT [297] 30 TTTGCAATACCTTCCTGGTACACT CCCATACCAGAGAGTACGGCTTT [297] 6 TTTGCAATACCTTCCTGGTACAC TCCCATACCAGAGAGTACGGCTTT [297] Figure B-2. Continued

PAGE 107

107 LIST OF REFERENCES Andersen B, Nielsen KF, Jarvis BB. 2002. Characterization of Stachybotrys from waterdamaged buildings based on morphology, grow th and metabolite pr oduction. Mycologia 94:392. Andersen B, Nielsen KF, Thrane U, Szaro T, Taylor JW, Jarvis BB. 2003. Molecular and phenotypic descriptions of Stachybotrys chlorohalonata sp. nov. and two chemotypes of Stachybotrys chartarum found in water-damaged build ings. Mycologia 95:1227-1238. Andersen B, Nissen AT. 2000. Evaluation of media for detection of Stachybotrys and Chaetomium species associated with water-dam aged buildings. Int Biodeter Biodegr 46:111-116. Andersson MA, Nikulin M, Kljalg U, Anderss on MC, Rainey F, Reijula K, Hintikka EL, Salkinoja-Salonen M. 1997. Bacteria, molds, and toxins in water-damaged building materials. Appl Environ Microbiol 63:387-393. Anonymous. 1994. Acute pulmonary hemorrhage/hemosiderosis among infants Cleveland, January 1993-November 1994. MMWR 43:881-883. Anonymous. 1997. Update: pulmonary hemorrhage/ hemosiderosis among infants Cleveland, Ohio, 1993-1996. MMWR 46:33-35. Anonymous. 2000. Update: pulmonary hemorrhage/ hemosiderosis among infants Cleveland, Ohio, 1993-1996. MMWR 49:180-184. Atlas RM. 1993. Handbook of microbiological media. Boca Raton: CRC Press. 1079 p. Barron, GL. 1968. The genera of hyphomycetes from soil. Baltimore: Williams & Wilkins. 364 p. Baxter DM, Perkins L, McGhee CR, Seltzer JM. 2005. A regional comparison of mold spore concentrations outdoors and inside clean a nd mold contaminated southern California buildings. J Occup Environ Hyg 2:8-18. Billups RA, Tilton KS, Warden PS. 1999. Identification of Stachybotrys chartarum utilizing various media and two temperatur e settings [abstract]. In: 1st NSF international conference on indoor air health: impacts, issues and solutions; May 35 1999; Denver CO. Ann Arbor, MI: NSF Int. p 166-174. Bisby GR. 1943. Stachybotrys. Trans Br Mycol Soc 26:133-143. Bishop A. 2002. Diurnal response and periodicity of the common aerial fungal genera and species found in north central Florida [Masters thesis]. College of Agricultural and Life Sciences, University of Flor ida, Gainesville, FL. 39 p.

PAGE 108

108 Booth C. 1957. Studies of pyrenom ycetes: I. Four species of Chaetosphaeria two with Catenulaira conidia. II. Melanopsamma pomiformis and its Stachybotrys conidia. Mycol Papers 68:1. Campbell R. 1972. Ultrastructure of conidium ontogeny in the Deuteromycete fungus Stachybotrys atra Corda. New Phytol. 71:1143-1149. Campbell R. 1974. The ultrastructure of th e formation of chains of conidia in Memnoniella echinata. Mycologia. 67:760-769. Carmichael JW, Kendrick WB, C onners IL, Sigler L. 1980. Genera of hyphomycetes. Edmonton: Univ Alberta Press. 386 p. Castlebury LA, Rossman AY, Sung GH, Hyte n AS, Spatafora JW. 2004. Multigene phylogeny reveals new lineage for Stachybotrys chartarum the indoor air fungus. Mycol Res 108:864-872. Corda ACJ. 1837. Icones fungorum hucusque cognito rum. Vol I. Prague: Apud JG Calve. 86 p. Croft WA, Jarvis BB, Yatawara CS. 1986. Airbor ne outbreak of trichothecene mycotoxicosis. Atmos Environ 20:549-552. Cruse M, Telerant R, Gallagher T, Lee T, Taylor JW. 2002. Cryptic species in Stachybotrys chartarum Mycologia 94:814-822. Cruz-Perez P, Buttner MP, Stetzen bach LD. 2001. Specific detection of Stachybotrys chartarum in pure culture using quantit ative polymerase chain reac tion. Mol Cell Probes 15:129-138. Dean TR, Roop B, Betancourt D, Menetrez MY. 2005. A simple multiplex polymerase chain reaction assay for the identifica tion of four environmentally relevant fungal contaminants. J Microbiol Meth 61:9-16. Dearborn DG, Yike I, Sorenson WG, Miller MJ, Et zel RA. 1999. Overview of investigations into pulmonary hemorrhage among infants in Cl eveland, Ohio. Environ Health Persp 107:S495-S499. Desjardins AE, Hohn TM, McCormick SP. 1993. Trichothecene biosynthesis in Fusarium species: chemistry, genetics, and si gnificance. Microbiol Rev 57:595-604. Drobotko VG. 1945. Stachybotryotoxicosis: a new dis ease of horses and humans. Am Rev Sov Med 2:238-242. El-Kady IA. 1988. New techni que for isolation of Stachybotrys chartarum Naturalia Monspeliensia 52:53-56. El-Morsy, ESM. 1999. Microfungi from the ector hizosphere-rhizoplane zone of different halophytic plants from the Red Sea Coast of Egypt. Mycologia 91:228-236.

PAGE 109

109 Elanskii SN, Petrunina YV, Lavrova OI, Likh achev AN. 2004. A comparative analysis of Stachybotrys chartarum strains isolated in Russi a. Microbiology 73:60-65. Elidemir O, Colasurdo GN, Rossmann SN, Fan LL. 1999. Isolation of Stachybotrys from the lung of a child with pulmonary hemosiderosis. Pediatrics 104:964-966. Ellis MB. 1971. Dematiaceous Hyphomycetes. Ke w, England: Commonwealth Mycological Institute. 608 p. Eppley RM, Bailey WJ. 1973. 12-13-epoxy9-trichothecenes as probable mycotoxins responsible for stachybotryotox icosis. Science 181:750-758. Etzel RA, Montana E, Sorenson WG, Kullm an GJ, Allan TM, Dearborn DG. 1998. Acute pulmonary hemorrhage in infants associated with exposure to Stachybotrys atra and other fungi. Arch Pediatr Adol Med 152:757-762. Flannigan B, Miller JD. 2001. Microbial growth in indoor environments. In: Flannigan B, Samson RA, Miller JD, eds. Microorganisms in home and indoor work environments: diversity, health impacts, i nvestigation and control. London: Taylor & Francis. p 35-68. FAWN (Florida Automated Weather Networ k). 2007. Published on the Internet at http://fawn.ifas.ufl.edu/. Forgacs J. 1972. Stachybotryotoxic osis. In: Kadis S, Ciegler A, Ajl S, eds. Microbial toxins. New York: Academ ic Pr. Vol 8, Fungal Toxins; p 95-128. Forgacs J, Carll WT, Herring AS Hinshaw WR. 1958. Toxicity of Stachybotrys atra for animals. T New York Acad Sci 20:787-808. Grant C, Hunter CA, Flannigan B, Bravery AF. 1 989. Moisture requirements of moulds isolated from domestic dwellings. Intl Biodeter Biodegr 25:259-284. Greif MD, Currah RS. 2007. Patterns in the oc currence of saprophytic fungi carried by arthropods caught in traps baited with rotted wood and dung. Mycologia 99:7-19. Harrington B. 2003. The effect of medium used on the isolation of Stachybotrys chartarum from air samples [abstract]. In: 103rd general meeting of the American society for microbiology; May 18-22; Washington, DC. Herndon, VA: ASM Pr. p 212. Haugland RA, Heckman JL. 1998. Iden tification of putative sequenc e specific PCR primers for detection of the toxigenic fungal species Stachybotrys chartarum Mol Cell Probes 12:387396. Haugland RA, Vesper SJ, Harmon SM. 2001. Phylogenetic relationships of Memnoniella and Stachybotrys species and evaluation of morphological features for Memnoniella species identification. Mycologia. 93:54-65.

PAGE 110

110 Haugland RA, Vesper SJ, Wyner LJ. 1999. Quantitative measurement of Stachybotrys chartarum conidia using real time detecti on of PCR products with the TaqManTM fluorogenic probe system. Mol Cell Probes 13:329-340. Heller RM, Heller TW, Sasson JM. 2003 Tsaraat, Leviticus, and the history of confusion. Perspect Biol Med. 46:588-591. Henry JL, Stetzenbach LD. 2000. Isolation of Stachybotrys chartarum from environmental samples using a cellulose-based medium [abstract]. In: 100th general meeting of the American society for microbiology; May 21-25; Los Angeles, CA. Herndon, VA: ASM Pr. p 566. Hinkley SF, Mazzola EP, Fettinger JC, Lam YKT, Jarvis BB. 2000. Atranones A-G, from the toxigenic mold Stachybotrys chartarum Phytochemistry 55:663-673. Hintikka EL. 1978a. Human stachybotryotoxicosis. In: Wyllie TD, Morehouse LG, ed. Mycotoxic fungi, mycotoxins, mycotoxico ses: an encyclopedic handbook. Vol 2. New York: Marcel Dekker. p 87-89. Hintikka EL. 1978b. Stachybotryotoxicosis in horses. In: Wyllie TD, Morehouse LG, ed. Mycotoxic fungi, mycotoxins, mycotoxico ses: an encyclopedic handbook. Vol 3. New York: Marcel Dekker. p 181-185. Huang S, Kimbrough JW. 1997. Mold allergy is a risk factor for persistent cold-like symptoms in children. Clin Pediatr 36:695-699. Hughes SJ. 1958. Revisiones Hyphomycetum aliquot cum appendice de nominibus rejiciendis. Can J Bot. 36:727-836. Hyvrinen A, Meklin T, Vepslinen A, Ne valainen A. 2002. Fungi and actinobacteria in moisture-damaged building materials concen trations and diversit y. Intl Biodeter Biodegr 49:27-37. Jarvis BB. 2003. Stachybotrys chartarum : a fungus for our time. Phytochemistry 64:53-60. Jarvis BB, Pavanasasivam GP, Bea n,GA. 1985. Mycotoxin production from Myrothecium species. In: Lacey J. ed. Trichothecenes a nd other mycotoxins. New York: John Wiley. p 221-231. Jarvis BB, Salemme J, Morais, A. 1995. Stachybotrys toxins 1. Nat Toxins 3:10-16. Jarvis BB, Sorenson WG, Hintikka EL, Nikulin M, Zhou Y, Jiang J, Wang S, Hinkley S, Etzel RA, Dearborn DG. 1998. Study of toxin production by isolates of Stachybotrys chartarum and Memnoniella echinata isolated during a study of pulmo nary hemosiderosis in infants. Appl Environ Mi crobiol 64:3620-3625. Jong SC, Davis EE. 1976. Contribution to the knowledge of Stachybotrys and Memnoniella in culture. Mycotaxon 3:409-485.

PAGE 111

111 Karunasena E, Markham N, Bras el T, Cooley JD, Straus DC. 2000. Evaluation of fungal growth on cellulose-containing and inorganic ceiling tile. Mycopathologia 150:91-95. Koster B. 2006. Evolutionary relationships among members of the fungal form-genus Stachybotrys, with emphasis on ind oor-occurring taxa and th e phylogenetic distribution and evolution of the trichothecene biosynthe tic gene, tri5 [Doctoral Dissertation]. University of Toronto, Ontario, Canada. 267 p. Koster B, Scott J, Wong B, Malloch D, Straus N. 2003. A geographically di verse set of isolates indicates two phylogene tic lineages within Stachybotrys chartarum Can J Bot 81:633643. Kuhn, RC, Trimble MW, Hofer V, Lee M, Nassof RS. 2005. Prevalence and airborne spore levels of Stachybotrys spp. in 200 houses with water incu rsions in Houston, Texas. Can J Microbiol 51:25-28. Li CS, Hsu LY, Chou CC, Hsieh KH. 1995. Fungal alle rgens inside and outside the residences of atopic and control children. Ar ch Environ Health 50:38-43. Li DW. 2007. Stachybotrys eucylindrospora sp. nov. resulting from a re-examination of Stachybotrys cylindrospora Mycologia 99:332-339. Li DW, Kendrick B. 1995. A year-round comparison of fungal spores in indoor and outdoor air. Mycologia 87:190-195. Li DW, Yang CS. 2005. Taxonomic hi story and current status of Stachybotrys chartarum and related species. Indoor Air 15:5-10. Li DW, Yang CS, Haugland R, Vesper S. 2003. A new species of Memnoniella Mycotaxon 85:253-257. Li S, Hartman GL, Jarvis BB, Tak H. 2001. A Stachybotrys chartarum isolate from soybean. Mycopathologia 154:41-49. Miller JD. 1992. Fungi as contaminants in indoor air. Atmos Environ 26A:2163-2172. Miller JD. 2001. Mycological inve stigations of indoor environments. In: Flannigan B, Samson RA, Miller JD, eds. Microorganisms in home and indoor work environments: diversity, health impacts, investigation and control. London: Taylor & Francis. p 231-246. Money NP. 2004. Carpet monsters and killer spor es: a natural history of toxic mold. Oxford: Oxford Univ Press. 178 p. Murtoniemi T, Nevalainen A, Hirvonen MR. 2003. Effect of plasterboard composition on Stachybotrys chartarum growth and biological activity of spores. Appl Environ Microbiol 69:3751-3757.

PAGE 112

112 Nelson BD. 2001. Stachybotrys chartarum : the toxic indoor mold. ASPnet feature story. Published on the internet at http://www.apsnet.org/onlin e/feature/stachybotrys/. Nielsen KF. 2003. Mycotoxin production by indoor m olds. Fungal Genet Biol 39: 103-117. Nielsen KF, Holm G, Uttrup LP, Nielsen PA 2004. Mould growth on building materials under low water activities, influence of humidity and temperature on fungal growth and secondary metabolism. Intl Biodeter Biodegr 54:325-336. Nikulin M, Pasanen A-L, Be rg S, Hinitikka E-L. 1994. Stachybotrys atra growth and toxin production in some building materials and fodder under different relativ e humidies. Appl Environ Microbiol 60:3421-3424. Paine TD, Raffa KF, Harrington TC. 1997. Interacti ons among scolytid bark beetles, their associated fungi, and live host conifers. Annu Rev Entomol 42:179-206. Peltola J, Niessen L, Nielsen KF, Jarvis BB, Andersen B, Salkinoja-Salonen M, Moller EM. 2002. Toxigenic diversity of two different RAPD groups of Stachybotrys chartarum isolates analyzed by potential for trichothecen e production and for boar sperm cell motility inhibition. Can J Microbiol 48:1017-1029. Petri A. 1983. Selective medi um for the isolation of Stachybotrys molds. Magy Allatorvosok 38:697-698. Pinruan U, McKenzie EHC, Gareth Jone s EB, Hyde KD. 2004. Two new species of Stachybotrys, and a key to the genus. Fungal Divers 17:145-157. Renker C, Otto P, Zimdars B, Maraun M, Buscot F. 2005. Oribatid mites as potential vectors for soil microfungi: study of mite-associated fungal species. Microbiol Ecol 50:518-528. Ruotsalainen M, Hirvonen MR, Hyvrinen A, Meklin T, Savolainen K, Nevalainen A. 1998. Cytotoxicity, production of reactive oxygen sp ecies and cytokines induced by different strains of Stachybotrys sp. from moldy buildings in RAW264.7 macrophages. Environ Toxicol Pharm 6:193-199. Samson RA, Flannigan B, Flannigan ME, Ver hoeff AP, Adan OCG, Hoekstra ES, eds. 1994. Health implications of fungi in indoor e nvironments. Amsterdam: Elsevier. Chapter 7, Recommendations; 529-538. Samson RA, Hoekstra ES, Frisvad JC, Filtenbor g O, eds. 2002. Introduction to foodand air borne fungi. 6th ed. Utrecht: Centraalbureau voor Schimmelcultures. 379 p. Samuels GJ, Barr ME. 1997. Notes on and additi ons to the Niessliaceae (Hypocreales). Can J Bot 75:2165-2176. Saitou N, Nei M. 1987. The neighbor-joining me thod: a new method for reconstructing phylogenetic trees. Mol Biol Evol 4:406-425.

PAGE 113

113 Shelton BG, Kirkland KH, Flanders WD, Morri s GK. 2002. Profiles of airborne fungi in buildings and outdoor environments in th e United States. Appl Environ Microbiol 68:1743-1753. Siqueira, JO, Hubbell DH, Kimbrough JW, Schenck NC. 1984. Stachybotrys chartarum antagonistic to azygospores of Gigaspora margarita in vitro. Soil Biol Biochem 16:679681. Smith G. 1962. Some new and interesting specie s of micro-fungi. III. Trans Br Mycol Soc 45:387-394. Spurgeon JC. 2003. A method for detecting fungal cont aminants in wall cavities. Am Ind Hyg Assoc J 64:40-47. Tiffany JA, Bader HA. 2000. Detection of Stachybotrys chartarum : the effectiveness of culturable-air sampling and other methods. J Environ Health 62:9-11. Tsai SM, Yang CS, Heinsohn P. 1999. Comparative st udies of fungal media for the recovery of Stachybotrys chartarum from environmental samples. In : Johanning E, ed. Bioaerosols, fungi and mycotoxins: health effects, asse ssment, prevention and control. Albany, NY: Boyd Printing. 330-334. Tucker K, Stolze JL, Kennedy AH, Money NP. 2007. Biomechanics of conidial dispersal in the toxic mold Stachybotrys charatarum Fungal Genet Biol 44:641-647. Vesper SJ, Dearborn DG, Yike I, Sorenson WG Haugland RA. 1999. Hemolysis, toxicity and randomly amplified polym orphic analysis of Stachybotrys chartarum strain. Appl Environ Microbiol 65:3175-3181. Vesper SJ, Magnuson ML, Dearborn DG, Yike I, Haugland RA. 2001. Initial characterization of the hemolysin stachylysin from Stachybotrys chartarum Infect Immun 69:912-916. Vesper SJ, Vesper MJ. 2002. Stachylysin may be a cause of hemorrhaging in humans exposed to Stachybotrys chartatrum Infect Immun 70:2065-2069. Visser S, Parkinson D, Hassall M. 1987. Fungi associated with Onychiurus subtenuis (Collembola) in an aspen woodland. Can J Bot 65:635-642. Whitton SR, McKenzie EHC, Hyde KD. 2001. Microfungi on the Pandanaceae: Stachybotrys, with three new species. New Zeal J Bot 139:489-499. Yang G-H, Jarvis BB, Chung Y-J, Pestka JJ. 200 0. Apoptosis induction by the satratoxins and other trichothecene mycotoxins: relations hips to ERK, p38 MAPK, and SAPK/JNK activation. Toxicol Appl Pharm 164: 149-160.

PAGE 114

114 BIOGRAPHICAL SKETCH Sarah Brinton Clark Selke was born in W est Hartford, Connecticut, the elder daughter of Newton and Patricia Clark. She graduated from Bates College, Lewiston, ME, in 1995 with a major in biology and a minor in French. Her first job was working for Bates Colleges Fall Semester in Nantes, France, in Fall 1995. Enj oying the travelers life, Sarah pursued temporary employment for the next few years while tr aveling to Ecuador, New Zealand, Australia, Indonesia, Singapore, Thailand, Turk ey, and France. In 1999, Sara h joined the Peace Corps and worked in the Kingdom of Tonga, South Pacifi c, where she taught biology and English at Mailefihi-Siuilikutapu high sc hool on the island of Vavau. Sarah returned to the United States in 2001 and taught biolog y and algebra at Bloomfield High School in Bloomfield, Connecticut, while obtaining her grade 7-12 biology teaching certification. In 2002, she began her studies at the University of Florida and joined Dr. Jim Kimbroughs lab in early 2004. During her doctoral studies, Sarah was th e lab instructor for Fundamentals of Plant Pathology and worked with Dr. Bill Zettler in his distance-education program. For her efforts, Sarah was awarded teaching awards from the National Association of Colleges and Teachers of Agriculture in 2006 and from the University of Florida Graduate School in 2007. Sarah and her husband, Gregg, currently live in Rhode Island. Sarah looks forward to continuing her teaching career.