<%BANNER%>

Thyroid-Gonad Axis of the American Alligator (Alligator mississippiensis)

Permanent Link: http://ufdc.ufl.edu/UFE0021752/00001

Material Information

Title: Thyroid-Gonad Axis of the American Alligator (Alligator mississippiensis) An Examination of Physiological and Morphological Endpoints
Physical Description: 1 online resource (135 p.)
Language: english
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2008

Subjects

Subjects / Keywords: alligator, gene, gonad, qpcr, thyroid
Zoology -- Dissertations, Academic -- UF
Genre: Zoology thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Thyroid hormones are known to have a cooperative role in gonadal development and function. There is a growing body of work demonstrating that thyroid hormones play a crucial role in the development of Sertoli and Leydig cells in the testis. Thyroid hormones at proper levels are necessary for ovulation and severe hypothyroidism can cause ovarian atrophy and amenorrhea. Thyroid receptors are found in various parts of the ovary such as granulose cells, oocytes and cumulus cells of the follicle, and corpora lutea, indicating that thyroid hormones can play a role in various cells of the ovary. The mechanisms of action are still not well understood. In many vertebrate species, including humans, thyroid disorders are more frequent in the female population. In addition, studies have shown that neoplastic thyroids have a higher number of estrogen receptors (ER) compared to normal tissue, suggesting a relationship between the sex of an individual and susceptibility to thyroid abnormalities. Recently, it has been shown that thyroid hormone concentrations parallel sex steroid patterns in American alligators. We investigate the mechanism of communication between the thyroid and gonad axis of the American alligator. Previous studies have demonstrated a one directional endocrine pathway from the thyroid to the gonad. We describe a possible new avenue of communication from the gonad to thyroid via the estrogen receptor located on alligator thyroid follicles. Through the use of genetic markers for thyroid and gonad physiology, we describe a novel mechanism of communication between these two axes.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Thesis: Thesis (Ph.D.)--University of Florida, 2008.
Local: Adviser: Guillette, Louis J.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2008
System ID: UFE0021752:00001

Permanent Link: http://ufdc.ufl.edu/UFE0021752/00001

Material Information

Title: Thyroid-Gonad Axis of the American Alligator (Alligator mississippiensis) An Examination of Physiological and Morphological Endpoints
Physical Description: 1 online resource (135 p.)
Language: english
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2008

Subjects

Subjects / Keywords: alligator, gene, gonad, qpcr, thyroid
Zoology -- Dissertations, Academic -- UF
Genre: Zoology thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Thyroid hormones are known to have a cooperative role in gonadal development and function. There is a growing body of work demonstrating that thyroid hormones play a crucial role in the development of Sertoli and Leydig cells in the testis. Thyroid hormones at proper levels are necessary for ovulation and severe hypothyroidism can cause ovarian atrophy and amenorrhea. Thyroid receptors are found in various parts of the ovary such as granulose cells, oocytes and cumulus cells of the follicle, and corpora lutea, indicating that thyroid hormones can play a role in various cells of the ovary. The mechanisms of action are still not well understood. In many vertebrate species, including humans, thyroid disorders are more frequent in the female population. In addition, studies have shown that neoplastic thyroids have a higher number of estrogen receptors (ER) compared to normal tissue, suggesting a relationship between the sex of an individual and susceptibility to thyroid abnormalities. Recently, it has been shown that thyroid hormone concentrations parallel sex steroid patterns in American alligators. We investigate the mechanism of communication between the thyroid and gonad axis of the American alligator. Previous studies have demonstrated a one directional endocrine pathway from the thyroid to the gonad. We describe a possible new avenue of communication from the gonad to thyroid via the estrogen receptor located on alligator thyroid follicles. Through the use of genetic markers for thyroid and gonad physiology, we describe a novel mechanism of communication between these two axes.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Thesis: Thesis (Ph.D.)--University of Florida, 2008.
Local: Adviser: Guillette, Louis J.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2008
System ID: UFE0021752:00001


This item has the following downloads:


Full Text





THYROID-GONAD AXIS OF THE AMERICAN ALLIGATOR (Alligator mississippiensis):
AN EXAMINATION OF PHYSIOLOGICAL AND MORPHOLOGICAL ENDPOINTS



















By

DIELDRICH SALOMON BERMUDEZ


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA

2008





































O 2008 Dieldrich Salomon Bermudez


































To my friends and family. Without your continuous support and inspiration, none of this would
be possible. And to those kindred spirits lost in the struggle.









ACKNOWLEDGMENTS

No man is an island: the time and work dedicated to this proj ect reinforced this belief. I

first thank Lou Guillette for all the guidance, mentoring and friendship given. He made a large

impact on my life and how I will approach it. I would also like to thank my committee members

for their guidance and support. Taisen Iguchi's generous hospitality, insight, and use of your lab

have been invaluable. Marty Cohn, I would like to thank for your enthusiasm, knowledge and

encouragement. Dave Evans, thank you for your recommendations, suggestions, and approach.

And Mike Fields, thank you for being ready available for comments and questions. I am forever

grateful for all your service, and will emulate your styles in my approach to science and life.

I want to thank the members of my laboratory, the graduate students and post-doctorates I

was privileged to work and learn from. Andy Rooney, Ed Orlando, Drew Crain, Matt Milnes,

Mark Gunderson, Satomi Kohno, Thea Edwards, Gerry Binczik, Teresa Bryan, Iske Larkin,

Brandon Moore, Heather Hamlin, Ashley Boggs, Nicole Botteri and Lori Albergotti. Some of

you I met at the end of your tenure at UF, others somewhere in the middle and yet others in the

beginning. I want to thank you from the bottom of my heart for all the technical help,

intellectual support, and camaraderie I was given by you. I consider you all family. I also want

to thank all the undergraduates who helped collect data, catch alligators, and all other forms of

laboratory work. I especially want to thank the following who I am indebted to for you hard

work: Jeremy Skotko, Jenna Norton, Mellisa Rodgers, Katie Sydes, Bridget Lawler, Mauricio

Hernandez, Jonathan Shivers, Adrienne Buckman, Malerie Metz, Al Sardari.

Field collection of wild alligators and of eggs was made possible through the help of the

Florida Fish and Wildlife Conservation Commission. I especially thank Allan "Woody"

Woodward, Dwayne Carboneau, Chris Tubbs, Cameron Carter, John White, Arnold Brunnel and









Chris Visscher for their continuous assistance and support out in the field. A large portion of this

work would not have been possible without you.

Funding for my research was provided through several graduate students fellowships from

the following: NIEHS, NSF, Sigma Xi and Florida-Georgia Louis Stokes Alliance for Minority

Participation. Funding was also provided through several research assistantships and supplies

supported through grants from Louis Guillette. Also, the University of Florida, Zoology

department provided support that made this work possible.

Lastly, I would like to thank all the friends I have gained and support I have received

during my stay with the Zoology Department and the city of Gainesville. I especially thank

Deena M. Bermudez, my beautiful wife. Your support and editing made this manuscript

possible. You inspire me to excel everyday. I have been blessed. Thank you all, with all my

heart.












TABLE OF CONTENTS


page

ACKNOWLEDGMENTS .............. ...............4.....


LIST OF TABLES ................. ...............8............ ....


LI ST OF FIGURE S .............. ...............9.....


LI ST OF AB BREVIAT IONS ................. ................. 12......... ....


AB S TRAC T ............._. .......... ..............._ 15...


CHAPTER


1 INTRODUCTION ................. ...............17.......... ......


General Review .............. ...............17....
Metabolic Effects ................. ...............19.................
Effects on Differentiation .............. ...............20....
Permissive Actions .............. ... .... ...............21.
Sexual Dimorphism in Thyroid Disease ................. ...............23...............
Thyroid and EDCs: An Emerging Field .............. ...............24....
Thyroid and Gonadal Development............... ..............2
Hypotheses............... ...............2

2 SEASONAL VARIATION IN PLASMA THYROXINE, TESTOSTERONE AND
ESTRADIOL-17P CONCENTRATIONS IN JUVENILE ALLIGATORS (Alligator
mississippiensis) FROM THREE FLORIDA LAKES ................. ................ ......... .33

Introducti on ................. ...............33.................
Materials and Methods .............. ...............34....

Study Sites ................. ...............34.................
Sample Collection .............. .. .. ............ ... ...........3
Thyroxine Radioimmunoassay and Statistical Analysis .............. ....................3
Re sults ................ ...............38.................
Discussion ................. ...............39.................


3 ESTROGEN RECEPTOR EXPRESSION IN THE THYROID FOLLICLE OF THE
AMERICAN ALLIGATOR (Alligator mississippiensis) DURING DIFFERENT LIFE
STAGES. ............. ...............48.....


Introducti on ................. ...............48.................
Materials and Methods .............. ...............49....
A nim als........ ... ............. ...............4
Histological Analysis and Statistics .............. .......... .......... .........5
Isolation of RNA, Reverse Transcription and Northern Blots ................. ................ ..5 1












Re sults................ ... ... ....... .. ......... ..................5
Immunohistochemical Localization of ERa .............. ...............52....

Quantitative RT-PCR .............. ...............53....
Discussion ................. ...............53.................


4 EFFECTS OF IN OVO AND IN VIVO PROPYLTHIOURACIL EXPOSURE ON
THYROID AND GONAD GENE EXPRESSION INTNEONATAL AMERICAN
ALLIGATORS (Alligator mississippiensis)............... ...........6


Introducti on ................. ...............62.................
Materials and Methods .............. ...............65....
Animals................ ...............6
In Ovo PTU Treatment ................... ............ ...............66......
hr Ovo Dissections and Tissue Collection ................. ...............66...........
hr Vivo PTU Treatment ........................ ...............6
In Vivo Dissections and Tissue Collection .............. ...............67....
Histological Analysis and Statistics .............. .......... .......... .........6
Isolation of RNA, Reverse Transcription and Northern Blots ................. ................ ..68
Gene sequence and QPCR primer design............... ...............69.
R e sults................... ......... ..... .. ......... .............7

Thyroid: hr Ovo PTU Treatment .................. ........... ...............70.....
Thyroid: hr Vivo after Neonatal Acute PTU Exposure .............. ....................7
Gonad: hr Ovo PTU Exposure ................. ...............73........... ...
Gonad: hr Vivo after Acute PTU Exposure .............. ...............75....
Di scussion ................. ...............75..............

Thyroid .............. ...............76....
G onads ............ ............ ...............78....
Sum m ary ............ ............ ...............80....


5 SUMMARY OF RESULTS .............. ...............106....


Introducti on .................. ...... ._ ...............106......
Seasonal Thyroxine Variation .............. ...............107....
Characterization of ERs on the Thyroid .........___............ ...............108.
PTU Exposure in the Thyroid and Gonad .............. ...............108....


APPENDIX


A STAINING PROTOCOL FOR ERa IHC ............ ....._ ....__ ..........18


B PARTIAL SEQUENCES FOR CLONED THYROID GENES ............ .. ......... .....119


LI ST OF REFERENCE S ............ ...... __ ..............1 1...


BIOGRAPHICAL SKETCH ............. ..... __ ...............134..










LIST OF TABLES


Table page

4-1 Primers used for Quantitative Real-time RT-PCR as markers for thyroid and gonad
physiology in the American alligator (A. mississippiensis) ................. ............ .........82

A-1 Immunohistochemistry staining protocol for ERoc. ................ ............................118










LIST OF FIGURES


Figure page

1-1 Location, structure and basic function of the thyroid follicle in a representative
reptile, such as the American alligator ................. ...............30......_.__...

1-2 Gonadal expression of alligator TRP and TRa mRNAs as determined by quantitative
RT -PCR ................. ...............3.. 1..............

1-3 Thyroid-gonad axis of regulation. TSH secreted from pituitary has stimulatory role
on thyroid and gonad. ............. ...............32.....

2-1 Average cloacal temperature (oC) for juvenile American alligators during the months
of March 2001 through April 2002 from Lakes Woodruff, Apopka, and Orange,
Florida, U SA. .............. ...............44....

2-2 Mean (high and low) ambient air temperature (oC) during the months of March 2001
through April 2002 from Lakes Woodruff, Apopka, and Orange, Florida, USA..............45

2-3 Mean (a 1 SE) plasma thyroxine (T4) COncentration (ng/ml) for male juvenile
American alligators during the months of March 2001 through April 2002 from
Lakes Woodruff, Apopka, and Orange, Florida, USA. ............. ...... ............... 4

2-4 Mean (a 1 SE) plasma thyroxine (T4) COncentration (ng/ml) for female juvenile
American alligators during the months of March 2001 through April 2002 from
Lakes Woodruff, Apopka, and Orange, Florida, USA. ............. ...... ............... 4

3-1 Three types of slides used (control, experimental, and normal) and how the tissue
was oriented to ensure the ease and accuracy of the analysis ................. ............... .....57

3-2 Thyroid follicle from a juvenile alligator ................. ...............57........... ..

3-3 Mean ratio for IHC ERa expression (measured by ratio of IHC ERa stained to
normal hemotoxylin and eosin stain) in the thyroid at three life stages in the
American alligator. ............. ...............58.....

3-4 Neonate mRNA gene expression in thyroid tissue from the American alligator, A.
naississippiensis. .............. ...............59....

3-5 Juvenile mRNA gene expression in thyroid tissue from the American alligator, A.
naississippiensis. .............. ...............60....

3-6 Adult mRNA gene expression in thyroid tissue from the American alligator, A.
naississippiensis. .............. ...............61....

4-1 Thyroid axis of the American alligator, Alligator naississippiensis ................. ...............83










4-2 Gonad axis of the American alligator, Alligator naississippiensis. ................ ................84

4-3 Estrogen receptor alpha (ERu) mRNA gene expression from in ovo PTU treatment
in thyroid tissue from the American alligator, A. naississippiensis. ................. ...............85

4-4 Deiodinase type 2 mRNA gene expression from in ovo PTU treatment in thyroid
tissue from the American alligator, A. naississippiensis ................. ................ ...._..86

4-5 Sodium-iodide symporter (NIS) mRNA gene expression from in ovo PTU treatment
in thyroid tissue from the American alligator, A. naississippiensis. ................. ...............87

4-6 Pendrin (PEN) mRNA gene expression from in ovo PTU treatment in thyroid tissue
from the American alligator, A. naississippiensis. .............. ...............88....

4-7 Deiodinase 2 (D2) mRNA gene expression from in vivo PTU treatment in thyroid
tissue from the American alligator, A. naississippiensis ................. ............... ...._...89

4-8 Androgen receptor (AR) mRNA gene expression from in vivo PTU treatment in
thyroid tissue from the American alligator, A. naississippiensis. ............. ....................90

4-9 Estrogen receptor alpha (ERu) mRNA gene expression from in vivo PTU treatment
in thyroid tissue from the American alligator, A. naississippiensis. ................. ...............91

4-10 Estrogen receptor beta (ERP) mRNA gene expression from in vivo PTU treatment in
thyroid tissue from the American alligator, A. naississippiensis. ............. ....................92

4-11 Thyrotropin receptor (TSHr) mRNA gene expression from in vivo PTU treatment in
thyroid tissue from the American alligator, A. naississippiensis. ............. ....................93

4-12 Pendrin (PEN) mRNA gene expression from in vivo PTU treatment in thyroid tissue
from the American alligator, A. naississippiensis. .............. ...............94....

4-13 Sodium-iodide symporter (NIS) mRNA gene expression from in vivo PTU treatment
in thyroid tissue from the American alligator, A. naississippiensis. ................. ...............95

4-14 Androgen receptor (AR) mRNA gene expression from in ovo PTU treatment in
gonad tissue from the American alligator, A. naississippiensis. .............. ....................96

4-15 Estrogen receptor alpha (ERu) mRNA gene expression from in ovo PTU treatment
in gonad tissue from the American alligator, A. naississippiensis. .................. ...............97

4-16 Estrogen receptor beta (ERP) mRNA gene expression from in ovo PTU treatment in
gonad tissue from the American alligator, A. naississippiensis. .............. ....................98

4-17 Steroidogenic acute regulatory protein (StAR) mRNA gene expression from in ovo
PTU treatment in gonad tissue from the American alligator, A. naississippiensis. ............99










4-18 Aromatase (AROM) mRNA gene expression from in ovo PTU treatment in gonad
tissue from the American alligator, A. mississippiensis ................. ........................100

4-19 Androgen receptor (AR) mRNA gene expression from in vivo PTU treatment in
ovary tissue from the American alligator, A. mississippiensis ................. ................ ..101

4-20 Estrogen receptor alpha (ERot) mRNA gene expression from in vivo PTU treatment
in ovary tissue from the American alligator, A. mississippiensis.. ............ ...................102

4-21 Estrogen receptor beta (ERP) mRNA gene expression from in vivo PTU treatment in
ovary tissue from the American alligator, A. mississippiensis ................. ................ ..103

4-22 Deiodinase type 1 (DI) mRNA gene expression from in vivo PTU treatment in ovary
tissue from the American alligator, A. mississippiensis ................. ................. ...._104

4-23 Deiodinase type 2 (D2) mRNA gene expression from in vivo PTU treatment in ovary
tissue from the American alligator, A. mississippiensis ................. ................. ...._105

5-1 Thyroid-gonad axis of regulation revisited. ......___ ... .... ..._. .... .._._.........10

5-2 In Ovo PTU mRNA expression of genes analyzed for sexual dimorphism via QPCR
in thyroid tissue of juvenile American alligators (A. mississippiensis). ................... .........111

5-3 In Ovo PTU mRNA expression of genes analyzed via QPCR in thyroid tissue of
male juvenile American alligators (A .mississippiensis) ................. .......... .............111

5-4 In Ovo PTU mRNA expression of genes analyzed via QPCR in thyroid tissue of
female juvenile American alligators (A .mississippiensis) ............... ............ .........112

5-5 In Vivo PTU mRNA expression of genes analyzed for sexual dimorphism via QPCR
in thyroid tissue of juvenile American alligators (A. mississippiensis). ................... .........113

5-6 In Vivo PTU mRNA expression of genes analyzed via QPCR in thyroid tissue of
male juvenile American alligators (A .mississippiensis) ................. ........................114

5-7 In Vivo PTU mRNA expression of genes analyzed via QPCR in thyroid tissue of
female juvenile American alligators (A .mississippiensis) ............... ............ .........115

5-8 In Ovo PTU mRNA expression of genes analyzed for sexual dimorphism via QPCR
in gonad tissue of juvenile American alligators (A.mississippiensis). ................... ..........11 6

5-9 In Ovo PTU mRNA expression of genes analyzed for treatment effects via QPCR in
gonad tissue of juvenile American alligators (A.mississippiensis). ................ ...............116

5-10 In Vivo PTU mRNA expression of genes analyzed via QPCR in gonad tissue of
female juvenile American alligators (A .mississippiensis) ............... ............ .........117









LIST OF ABBREVIATIONS

AR Androgen receptor involved in receptor-ligand interactions.

AROM Aromatase. Major enzyme needed to convert testosterone into estradiol-17P

cDNA Complementary DNA is synthesized from mRNA template in a reverse
transcription reaction.

CIP/KIP One of two families of cyclin-dependant kinase inhibitors and well characterized
for their role as negative regulators of G-phase cell cycle progression.

DDE 1,1 -Dichloro-2,2-bis(p-chlorophenyl) ethylene (DDE) is a breakdown product of
DDT and a known EDC.

DDT Dichloro-diphenyl-tricloroethane is one of the first modern pesticides and a
common synthetic. It was developed early in WWII and initially used to combat
mosquitoes from spreading malaria, typhus and other insect-borne human
diseases. It is known as an organochlorine insecticide and EDC.

DIT Two linked iodinated tyrosine molecules are diiodotyrosine. It is a component of
thyroid hormones.

DNA Deoxyribonucleic acid is a molecule that contains the genetic code used in the
development and functioning of all living organisms.

E2 Estradiol-17P. Major estrogen hormone studied in this dissertation.

EDC Endocrine disrupting contaminants. Chemicals known to have an affect on the
endocrine system.

ER Estrogen receptors involved in receptor-ligand interactions. Focus was on
estrogen receptor alpha (ot) and beta (P) of the American alligator.

ICC Immunocytochemistry is a technique used to localize and stain specific proteins in
cells of a tissue. Interchangeable with IHC.

IGF Insulin-like growth factors. These are peptide growth stimulators that are
structurally related to insulin and have some insulin-like activity in addition to
their growth promoting actions.

IHC Immunohi stochemi stry. A technique used to localize and stain specific proteins
in cells of a tissue. This technique exploits the principles of antibodies binding to
specific antigens.

LH Luteinizing hormone.










MIT One iodinated tyrosine molecule is termed monoiodiotyrosine. It is a component
of thyroid hormones.

NIS Sodium-iodide symporter. Iodide pump in the thyroid.

mRNA Messenger ribonucleic acid is a molecule of RNA encoding for a specific protein.
mRNA is transcribed from a DNA template.

p27Kip l p27Kipl1 is a member of the CIP/KIP family of cdk inhibitors that negatively
regulates cyclin- cdk complexes. A cyclin-dependent kinase (cdk) inhibitor, it
plays important roles in cell cycle progression in normal cells.

PCB Polychlorinated biphenyls are a class of organic compounds known to be EDC.
Most PCBs were manufactured as cooling and insulating fluids for industrial
transformers and capacitors.

PCR Polymerase chain reaction is a molecular biology technique for isolating and
amplifying a fragment of DNA.

PEN Pendrin. Cloride-iodide pump on the thyroid.

PTU Proplythiouracil, an anti-thyroid compound used to treat hyperthyroidism
pharmaceutically.

Q-PCR Quantitative PCR is a molecular biology technique used to quantify relative gene
expression.

RNA Ribonucleic acid is a polymer composed of nucleic monomers that play various
important roles in the processes that translate genetic information from DNA into
proteins.

RT-PCR Reverse transcription PCR is a technique used to amplify, isolate or identify a
known sequence from RNA

StAR Steroidogenic acute regulatory protein.

T3 Triiodothyronine is a thyroid hormone. It is a combination of MIT and DIT. This
form of thyroid hormone is considered the active form in tissue.

T4 Thyroxine or tetraiodothyronine is a thyroid hormone. It is commonly considered
the transport and non-active form of the thyroid hormones. It is considered a
prohormone but nonetheless is known to be functional/active in tissues.

Tg Thyroglobulin. Large protein used in the thyroid to make thyroid hormones.

Tp Thyroperoxidase. Enzyme used in the thyroid for the organification of iodide.









TR Thyroid hormone receptors involved in receptor-ligand interactions. Focus was
on thyroid hormone receptor alpha (ot) and beta (P) of the American alligator.

TRE Thyroid response elements, play a role in the molecular mechanism for
transcription.

TRH Thyrotropin releasing hormone or thyroid hormone releasing hormone.

TSH Thyroid stimulating hormone also known as thyrotropin.

TSHr Thyrotropin receptor.









Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

THYROID-GONAD AXIS OF THE AMERICAN ALLIGATOR (Alligator mississippiensis):
AN EXAMINATION OF PHYSIOLOGICAL AND MORPHOLOGICAL ENDPOINTS

By

Dieldrich Salomon Bermudez

May 2008

Chair: Louis J Guillette, Jr.
Major: Zoology

Thyroid hormones are known to have a cooperative role in gonadal development and

function. There is a growing body of work demonstrating that thyroid hormones play a crucial

role in the development of Sertoli and Leydig cells in the testis. Thyroid hormones at proper

levels are necessary for ovulation and severe hypothyroidism can cause ovarian atrophy and

amenorrhea. Thyroid receptors are found in various parts of the ovary such as granulosa cells,

oocytes and cumulus cells of the follicle, and corpora lutea, indicating that thyroid hormones can

play a role in various cells of the ovary. The mechanisms of action are still not well understood.

In many vertebrate species, including humans, thyroid disorders are more frequent in the

female population. In addition, studies have shown that neoplastic thyroids have a higher number

of estrogen receptors (ER) compared to normal tissue, suggesting a relationship between the sex

of an individual and susceptibility to thyroid abnormalities.

Recently, it has been shown that thyroid hormone concentrations parallel sex steroid

patterns in American alligators. We investigate the mechanism of communication between the

thyroid and gonad axis of the American alligator. Previous studies have demonstrated a one

directional endocrine pathway from the thyroid to the gonad. We describe a possible new

avenue of communication from the gonad to thyroid via the estrogen receptor located on alligator










thyroid follicles. Through the use of genetic markers for thyroid and gonad physiology, we

describe a novel mechanism of communication between these two axes.









CHAPTER 1
INTTRODUCTION

General Review

The thyroid has been studied for thousands of years. The first description of thyroid

disease was of abnormal enlargement of the thyroid in humans, recognized by Chinese

physicians about 3000 B.C. Since then, thyroid-associated problems have been recognized and

even became fashionable at one time; the painting of 'The Mona Lisa', with her goiter, is a

famous example. In 1896, Bauman discovered that an organic iodine-containing compound

could be extracted from the thyroid. The iodine-containing hormone, thyroxine (T4) WAS isolated

and crystallized by Edward C. Kendall in 1915. This discovery was a milestone in endocrine

research, since it was the first hormone isolated in pure form. The importance of the thyroid and

its functions can be grasped simply by observing that the incidence of thyroid disease in humans

is exceeded only by the incidence of diabetes mellitus (Norris 1997).

In amphibians, reptiles (including alligators), birds and mammals, the thyroid gland is a bi-

lobed organ that lies ventrally to the trachea in the mid-throat region (Fig. 1-1). Histologically,

the thyroid is composed of many follicles surrounded by connective tissue. The follicles are

filled with a proteinaceous fluid called colloid that is secreted by the single layer epithelium that

comprises the wall of the follicle (Fig. 1-1). Within this colloid, several important precursor

molecules accumulate that will be used to form the thyroid hormones.

In the simplest terms, thyroid hormones are iodinated tyrosine molecules. One iodinated

tyrosine molecule is termed monoiodotyrosine (MIT). Two linked iodinated tyrosine molecules

are diiodotyrosine (DIT). When a MIT and DIT bind, they form the active form of the thyroid

hormone triiodothyronine (T3) whereas two bound DIT molecules form thyroxine (T4) (Fig. 1-1).









Thyroxine and T3 are preSent in all vertebrates as well as annelid worms and various other

invertebrates such as cnidarians, arthropods and echinoderms (Eales 1997; Norris 1997).

Thyroid hormones influence many aspects of reproduction, growth, differentiation, and

metabolism (Lynn 1970; Bentley 1982; Eales 1997; Norris 1997). The thyroid is possibly the

most highly vascularized endocrine gland in mammals and appears to be one of the oldest

endocrine glands phylogenetically (Dickhoff et al. 1983).

The hypothalamus-pituitary-thyroid axis regulation of thyroid hormone synthesis is well

known (Fig. 1-3). Thyrotropin releasing hormone (or corticotropin releasing hormone in some

non-mammalian species) from the hypothalamus stimulates the production of pituitary

thyrotropin (TSH, thyroid stimulating hormone)(Norris 1997; Denver 1999). Thyrotropin

stimulates the thyroid to produce and secrete thyroid hormones (mostly thyroxine, T4). Thyroid

hormones (THs) are transported to target tissues/cells where T4 is converted to T3 Via

iodothyronine deiodinases (Norris 1997). Following the binding of thyroid hormones to nuclear

or mitochondrial receptors, THs initiate genomic gene transcription ultimately leading to

synthesis of new proteins. Thyroid hormone receptors (TRs) recognize specific thyroid response

elements (TREs) and bind predominantly as heterodimers with the retinoid X receptors but may

also form homodimers in the promoters region of targeted genes (Bassett et al. 2003). Non-

genomic actions and binding to TH receptors have been shown at the plasma membrane,

cytoplasm and cellular organelles. TRs are members of the nuclear receptor superfamily and act

as hormone inducible transcription factors (Evans 1988; Bassett et al. 2003). Two maj or

isoforms of TRs have been well described in the literature, TRoc and TRP.









Collaboration with Caren Helbing, of the University of Victoria, has recently produced

cloned TRa and TRP2 from the American alligator. Using quantitative RT-PCR (Q-PCR), we

have observed that both TRa and TRP2 are expressed in the gonads of juvenile alligators

(Helbing et al. 2006), with greatly elevated levels of TRP2 relative to TRa (Fig. 1-2). Further,

there appears to be a differential response to TSH treatment, with no effect on TRP2 mRNA

levels in either gonad 24 or 48 hr after treatment (Fig. 1-2). In contrast, TRa mRNA levels were

elevated in the testis but not the ovary 24 hr after treatment (Fig. 1-2). These data suggest that,

like the rodent gonad, cells in the alligator gonad express TR, suggesting that this tissue is

responsive to the actions of thyroid hormones. Further, given the differential response in TRa

future studies are needed to determine if this response could play a role in gonad development.

There appears to be sparse data in the literature indicating whether or not TRs are expressed in a

sexually dimorphic manner and data on the topic suggest that sexual dimorphism is absent in

TRs gene expression (Helbing et al. 2006; Bermudez in press; Bermudez unpublished data).

Metabolic Effects

Metabolic effects of the thyroid hormones in mammals have been well documented.

Thermogenic actions, as well as specific effects on carbohydrate, protein, and lipid metabolism,

are among some of the well-studied effects of T3 and T4. Thyroid hormones increase synthesis

of several mitochondrial respiratory proteins such as cytochrome c, cytochrome oxidase, and

succinoxidase (Stevens et al. 1995; Norris 1997). A decrease of basal metabolic rate would be

advantageous to animals during a period of hibernation or low caloric intake. Many non-

hibernating mammals, such as the beaver and the muskrat, have depressed thyroid activity during

the winter period. Hypothyroidism has been shown to occur in hibernating ground squirrels and

badgers (Silva 1993). The shark embryos of Squalus suckleyi show an increase in oxygen









consumption following T3 and T4 treatment (Blaxter 1988). Increased oxygen consumption is

also demonstrated with tissue obtained from the frog, Rana pipiens,~RR~~RR~~RR~~R when treated with T4 iYZ ViO

(May et al. 1976). A study examining the lizard, Dipsossaurus dorsalis found that thyroid

hormones (T4/T3) influenCe lOcomotory endurance, suggesting an essential activity on muscular

energetic (Eales 1985b).

Effects on Differentiation

Thyroid hormones affect differentiation, including growth, development, and

metamorphosis. Thyrotoxicosis, Grave's disease, Hashimoto's disease, cretinism and juvenile

myxedema in humans are examples of disorders in growth and development caused by altered

thyroid hormone action (Norris 1997; Kilpatrick 2002). The thyroid is known to influence

metabolic rate and inhibit calcium loss in bones (Gu et al. 2001). These two actions are necessary

for development and normal growth (Segal 1990; Norris 1997; Kisakol et al. 2003). Thyroid

hormones also are necessary for the normal development of the nervous system. Thyroid

hormone treatment of early Xenopus larvae promotes neurogenesis in the spinal cord, where

thyroid receptor TRa is expressed from early larval stages onward and results in precocious up-

regulation of several other genes (Schlosser et al. 2002). Shark (S. suckleyi) embryos treated

with T4 and T3 have accelerated differentiation of the hypothalamic neurosecretory centers,

which suggest thyroid hormones play a role in differentiation and maturation of the

hypothalamo-hypophysial system (Blaxter 1988).

Replacement of hair in adult mammals is stimulated by the thyroid hormones. The

postnuptial molt cycle in harbor seals, Phoca vitulina, gray seals (Halichoerus grypus) and the

molt cycles in the red fox, badger (M~eles meles L.) and mink are examples of thyroid hormone

influenced hair replacement (Maurel et al. 1987; Boily 1996; Norris 1997). Molting in










amphibians, reptiles and birds is also stimulated by thyroid hormones (Kar et al. 1985b;

Sekimoto et al. 1987; Norris 1997).

Metamorphosis in amphibians and fish and smoltification in salmonid fishes are probably

the best-known effects of thyroid hormones in non-mammalian vertebrates. Thyroid hormones

play crucial roles in the metamorphosis of a frog from a tadpole (Denver 1998; Wright et al.

2000). During flounder metamorphosis, T4 COncentrations increase and are associated with the

migration of the eye and attendant neural structure to one side and the mouth and associated

structures to the other side of the head (Blaxter 1988). Behavioral changes are associated with

this alteration as well. Another example of thyroid-regulated metamorphosis is smoltification in

many salmonids like the Atlantic salmon (Salmo salar) (Kulczykowska et al. 2004) and Coho

salmon (Oncorhynchus kisutch) (Sweeting et al. 1994). Smoltification is the transformation from

freshwater parr to smolt with pre-adapted osmoregulation for salt water.

Permissive Actions

Thyroid hormones also play a role in modifying the action of other cell signals, generally

termed "permissive actions". Many of the actions of thyroid hormones occur cooperatively with

different hormones or cell signaling agents (paracrines or autocrines). This cooperative role or

permissive action is common, where the thyroid hormone enhances the effectiveness/sensitivity

of the other hormones or neural stimuli. The permissive actions of THs may be related to events

such as the stimulation of the synthesis of components of second-messenger systems, up-

regulation of receptors for another regulator, effects on structural components, etc. (Norris 1997).

For example, several of the non-genomic actions of thyroid hormones include the modulation of

Na Ca and glucose transport, activation of protein kinase C, protein kinase A and estrogen

receptor kinases/mitogen activated protein kinases and regulation of phospholipid metabolism by

activation of phospholipase C and phospholipase D (Kavok et al. 2001). In addition, many










thyroid mediated metabolic actions occur in cooperation with other hormones such as

epinephrine and growth hormone. Thyroid hormones alter nitrogen balance and are either

protein anabolic or catabolic (Kawaguchi et al. 1994; DeFeo 1996; Rendakov et al. 2003). These

actions are related to an enhancement of the effects normally regulated by other hormones.

Thyroid hormones, for example, can stimulate insulin-like growth factors or IGF production,

which augments the action of growth hormone (Nanto-Salonen et al. 1993).

Thyroid hormones also have a cooperative role in gonadal development and function.

Cycles in the plasma concentrations of thyroid hormones are positively correlated with

reproductive cycles in various vertebrate species. For example, thyroid hormone serum

concentrations of the sheath-tailed bat, Taxphozous longimanus were higher during gonadal

recrudescence and the breeding period during late winter dormancy but were minimal during

gonadal quiescence and the initial stages of pregnancy (Singh et al. 2002a). Ovarian T4

concentrations have been shown to increase during vitellogenesis and oocyte final maturation but

decrease during embryogenesis in the viviparous rockfish, Seba~stes inermis (Kwon et al. 1999a).

Serum T4 COncentrations also fluctuated seasonally in Kemp's ridley sea turtles (Lepidochelys

kempi), with elevated concentrations observed in females during vitellogenesis when plasma E2

concentrations are elevated (Rostal et al. 1998a). Thyroid hormones are increased in many

teleost fishes during periods when they are exhibiting spawning, pre-migratory, and migratory

behaviors (Blaxter 1988). The thyroid hormones are hypothesized to have a permissive role as

opposed to a causative role in these behaviors. The behavioral changes that occur during and

after metamorphosis in vertebrates are also thought to be permi ssive roles of thyroid hormones.

During metamorphosis in amphibians, thyroid hormones act to augment the effects of

corticotrophins, thus providing a permission action (Denver 1998).









Sexual Dimorphism in Thyroid Disease

In many vertebrate species, including humans, thyroid disorders are more frequent in the

female population (Arain et al. 2003). In addition, studies have shown that neoplastic thyroids

have a higher number of nuclear estrogen receptors (ER) compared to normal tissue (Manole et

al. 2001), suggesting a relationship between the sex of an individual and susceptibility to thyroid

abnormalities. ERs are part of a family of nuclear receptors that act as transcription factors,

response for significant changes in gene expression following exposure to such hormones as sex

and stress steroids. Additionally, since the thyroid plays a role in hormone regulation, and

hormone production changes during an animal's development from neonate to juvenile through

adulthood, it is possible that estrogen receptor expression changes with developmental

maturation. Adults are expected to have greater estrogen receptor expression and seasonal

variation in receptor expression since they have elevated circulating sex hormone concentrations

due to reproductive activity. For example, our laboratory has reported dramatic changes in

circulating concentrations of estradiol-17P in female alligators throughout the reproductive cycle

(Guillette et al. 1997). We have also reported that peri-pubertal alligators show seasonal changes

in plasma concentrations of E2, but these levels are 10 to 100 fold lower than those reported in

adult females (Rooney et al. 2004) and yearling alligators have further reduced, but detectable

plasma E2 COncentrations (Guillette et al. 1994). Our initial study in juvenile alligators

demonstrated that exogenous E2 WOuld depress expression of ERoe but not ERP in the ovary

suggesting that as with other species, ER expression can be influenced by changing plasma

concentrations of E2 (Katsu et al. 2004).

Is the phenomenon of greater thyroid disease in females due to a sexually dimorphic

pattern in the expression of steroid receptors? Could there be differences in the expression of









estrogen and androgen receptors (ER and AR, respectively) or even TRs in the thyroid at

different life stages that might explain these observed differences in disease rates? One study on

human thyroid tissue showed no significant difference in ER incidence (Hiasa et al. 1993). These

questions, however, have been poorly studied in vertebrates and will be addressed in this

dissertation.

Thyroid and EDCs: An Emerging Field

Endocrine disrupting contaminants (EDCs) have been shown to modify or impair function

in various endocrine organs, including the thyroid (Zoeller 2003). DDT (an organochlorine used

as a pesticide), its metabolites and various other environmental contaminants exert an effect on

the thyroid by disrupting one of several possible steps in the biosynthesis and/or secretion of

thyroid hormones (Fig. 1-1). These steps include: (1) inhibition of the iodine trapping

mechanism (thiocyanate or perchlorate have been shown to exhibit this mode of action), (2)

blockage of organic binding of iodine and coupling of iodothyronines to form thyroxine (T4) and

triiodothyronine (T3) (Sulfonamides, thiourea, methimazole, aminotiazole act at this stage), or (3)

inhibition of T3/T4 Secretion by affecting proteolysis of active hormone from the colloid

(methimazole, propylthiouracil and flavanoids are known to affect secretion)(Capen 1992; Capen

1994; Hamann et al. 2006; Moriyama et al. 2007).

Contaminants can also alter thyroid hormone action by other mechanisms. For example,

DDT has been shown to disrupt thyroid hormone availability by increasing the peripheral

metabolism of thyroid hormones through an induction of hepatic microsomal enzymes (Capen

1992; Capen 1994). Male juvenile alligators from Lake Apopka, that are exposed to a wide array

of environmental chemicals and have elevated organochlorine pesticide residues in their tissues

and blood (especially p,p'-DDE), exhibit elevated plasma T4 COncentrations when compared to

male juvenile alligators from Lake Woodruff, FL, a reference site and National Wildlife Refuge










(Crain et al. 1998). DDT-treatment in rats increased thyroid mass as well as plasma T3 and T4

concentrations. Rats also displayed decreased thyroid iodine, serum iodine and protein-bound

iodine levels (Seidler et al. 1976; Goldman 1981). A metabolite of DDT, p,p'-DDE has been

shown to have similar effects on thyroid hormones. There is a positive correlation between

serum concentrations of DDE and T4/FreeT4 in pOlar bears (Skaare et al. 2001). Another DDT

metabolite, o,p'-DDD has been shown to increase T3, T4 and free T4 COncentrations in dogs.

This compound can be used to treat hyperadrenocorticism in canines as well, as it suppresses

adrenal steroidogenesis (Ruppert et al. 1999). Japanese quails exposed to DDT displayed a slight

decrease in T4 but a moderate increase in T3 (Rattner et al. 1984). Ring doves (Streptopelia

risoria) fed a diet dosed with DDE and PCB (Aroclor 1254) had plasma T4 inCreaSe in a dose

dependant manner that caused a doubling in the birds exposed to the highest doses (McArthur et

al. 1983). In freshwater catfish (Claria~s batrachus), endosulfan (an insecticide used on various

crops) decreases T3 but increases T4, whereas malathion (an insecticide, used in mosquito

control) induces a decrease in T3 and no change in T4, and carbaryl (a broad spectrum insecticide

used in forestry) increases T3 and provokes a decrease in T4 (Sinha et al. 1991). The

mechanisms that induce these varying effects are unknown. Other known EDCs, such as the

polychlorinated biphenyls (PCBs; used as coolants and lubricants in transformers, capacitors and

other electrical equipment), PBDEs and dioxin inhibit thyroid hormone binding to plasma

transport proteins, such as transthyretin, resulting in more rapid clearance and decreased plasma

thyroid hormone concentrations (Brouwer et al. 1998).

Nitrogen pollution, in the form of nitrates, has recently emerged as another area of concern

as they appear to have the potential to disrupt the thyroid axis. Bulls administered nitrates orally

within environmentally relevant ranges had depressed thyroid activity with a decrease in plasma










T4 COncentrations as well as suppressed hypothalamic function with non-detectable levels (<

0.001 Cpg/ml) of the pituitary hormone thyrotropin (TSH) following a challenge test with the

hypothalamic releasing hormone TRH (Zraly et al. 1997). Elevated nitrates in the diet also has

been shown to depress thyroid function in humans and are associated with goiter in some nitrate-

exposed children (Gatseva et al. 1998a; Gatseva et al. 2000a).

Nitrates have been shown to depress circulating thyroid hormones in other mammals and

some fishes (Lahti et al. 1985; Katti et al. 1987; Gatseva et al. 1992; Brunigfann et al. 1993;

Kursa et al. 2000). Animals exposed to nitrates also exhibit altered thyroid morphologies,

including hypertrophy of the thyroid, increased cell height of the thyroid follicle cells,

vacuolation in the periphery of the folliculi, and reduction of colloid (van Maanen et al. 1994).

Nitrate contamination has also been shown to decrease iodide uptake (Lahti et al. 1985; Katti et

al. 1987). The inability to take up iodide at adequate levels by the thyroid would alter thyroid

action if this effect were chronic.

Thyroid and Gonadal Development

There is a growing body of work demonstrating that thyroid hormones play a crucial role

in the development of Sertoli (cell assisting spermatozoa production) and Leydig cells (steroid

producing cells) in the testis. Manipulation of the thyroid environment can be used to produce

increases in testis size, Sertoli cell number, and sperm production (Cooke et al. 2004). Neonatal

hypothyroidism is shown to impair testicular development (Jannini et al. 1995). However,

hypothyroidism in neonatal rats, which is followed by a recovery to euthyroidism, leads to an

increase in testis size and daily sperm production in adult rats (Cooke et al. 1991a). This body of

work, in conjunction with other studies indicating that thyroid hormone receptors (TRs) are

present in high quantities in the neonatal testis, led to the hypothesis that thyroid hormones could

have key roles in testicular development (Palmero et al. 1988; Jannini et al. 1990).









Cooke et al. (1994) state that it appears T3 HOrmally inhibits Sertoli cell proliferation

directly while stimulating differentiation. These actions are observed in neonatal hypothyroid

animals. Also, neonatal Sertoli cells express both TRa and TRP although the relative

contribution of these receptors in thyroid signaling remains unclear (Jannini et al. 1994; Palmero

et al. 1995; Buzzard et al. 2000). Developmental hypothyroidism and an increase in adult testis

size is not solely described in rats but also in mice (Joyce et al. 1993), humans (Jannini et al.

2000), bulls (Majdic et al. 1998), roosters (Kirby et al. 1996) and fish (Matta et al. 2002).

Additionally, recent work indicates that the mechanism of Sertoli cell proliferation in

hypothyroidism is through regulation of p27Kip1, a member of the Cip/Kip family of cyclin-

dependant kinase inhibitors and a critical regulator of proliferation of many cell types (Cooke et

al. 2004). Thyroid hormones increase p27Kipl expression in developing Sertoli cells (Buzzard et

al. 2003; Holsberger et al. 2003) and hypothyroidism leads to a down regulation of p27Kipl

expression (Holsberger et al. 2003). This recent work provides a mechanistic template for further

molecular studies in this area.

Thyroid hormones also play an active role with Leydig cells during development and

adulthood. Several studies demonstrate how hypothyroidism decreases testosterone

concentrations in adults and is attributed to a decrease in response to tropic hormones like

luteinizing hormone (LH) (Hoffman et al. 1991; Anthony et al. 1995; Maran et al. 2001).

Recently, it was demonstrated that thyroid hormones influence steroidogenic acute regulatory

protein (StAR). Lack of thyroid hormone causes a down regulation of StAR mRNA and protein,

resulting in impaired testosterone production in these cells (Manna et al. 2001b).

The literature on the role of thyroid hormones on ovarian function and development is

sparse compared to studies on testis. Thyroid hormones at proper levels are necessary for









ovulation (Maruo et al. 1992). Doufas et al. (2000) demonstrated that severe hypothyroidism can

cause ovarian atrophy and amenorrhea. TRs are found in various parts of the ovary such as

granulosa cells (Maruo et al. 1992; Zhang et al. 1997), oocytes and cumulus cells of the follicle

(Zhang et al. 1997), and corpora lutea (Bhattacharya et al. 1988), indicating that thyroid

hormones can play a role in various cells of the ovary. The mechanisms of action are still not

well understood.

Recent evidence also suggest that thyrotropin receptors found on gonadal tissue play a

direct role in reproductive physiology of several teleost species (Goto-Kazeto et al. 2003; Rocha

et al. 2007). Recent work on the American alligator also suggest that the gonads are being

stimulated by thyrotropin and upregulating expression of TRs in the gonad (Helbing et al. 2006).

The literature on thyroid-gonad interaction details pathways from the thyroid axis to the gonad

(Fig. 1-3) (Norris 1997; Johnson et al. 2000; Senger 2003). Regulation via estrogen receptors to

the hypothalamus and pituitary has also been documented but no pathway from the gonad to the

thyroid has been shown in the literature. Is there a regulatory pathway from the gonad directly to

the thyroid?

Hypotheses

This study will examine the thyroidal/gonadal axis of the American alligator. We will

examine two maj or areas of thyroidal and gonadal activity; the affect of the thyroid axis on the

development of the gonad and a mechanism of communication between the thyroid and gonad.

In particular, I will attempt to address whether the thyroid plays a role in the sexual

differentiation of the gonads and reproduction in alligators. The role of the thyroid axis in the

development and functioning of the gonad during the neonatal and peripubertal periods will also

be investigated. The experiments performed are divided into two groups, developmental studies

and juvenile studies. The developmental studies examine gonadal differentiation and









development following exposure to an antithyroid-agent during the window of sexual

differentiation. In the studies of adolescent alligators (juvenile peripubertal individuals ranging

100 150 cm in length), I will describe normal physiology and morphology of the thyroid/gonad

axis. Does the thyroid axis influence seasonal reproductive hormone variation? We will

ultimately attempt to describe a novel mechanism of communication between the thyroid and

gonad axis. This mechanism will include the characterization of ER and AR on the thyroid

follicle as well as expression levels of these receptors to manipulations. I propose to test several

hypotheses stated below.

* Hypothesis 1: Plasma thyroxine concentrations display seasonal variation that parallels
seasonal variation in sex steroid concentrations, not seasonal activity patterns.

* Hypothesis 2: ER, AR and TR expression on the thyroid will vary among life stages and
show sexual dimorphism.

* Hypothesis 3: Treatment of the thyroid with proplythiouracil (PTU), and anti thyroidal
pharmaceutical agent, will alter the expression of genes related to gonadal physiology.

* Hypothesis 4: By blocking the thyroid with PTU during the temperature dependant sexual
differentiation period of the alligator embryo, an alteration in the development of the testis or
ovary will be observed.





+-Folndwkr Lansea


VV-\ ~ ~ ~ ~ ~ l <--A ~4JL pied Metmbrne~







STPD. Tg mRNA







CAMPA~ gy
I Ns T4 T 3
4-B~asarllensr~ane





Figure 1-1: Location, structure and basic function of the thyroid follicle in a representative
reptile, such as the American alligator. The thyroid is a bi-lobed structure, composed
of follicles that accumulate iodine, and form iodinated tyrosine molecules that are
used to make the thyroid hormones T3 and T4.












0000TRoe
C00
co7000


mE 4000
5 000
2000


1000


I-leart Lung Liver Thyroid Phal us Gonad








m a 40'
20 b12
a ...
Hear Lung Lie hrodPalu o


Fiue12 Gndleprsino allgtrTOadTo R~ sdtrie yqatttv
RT-CR Juenl mal an feal aliatr weetetdwt vn S yiv
ineto n ise wr band2 r48h fe ramn. Hlige l 06

















4/T3 -


Figure 1-3: Thyroid-gonad axis of regulation. TSH secreted from pituitary has stimulatory role
on thyroid and gonad. FSH secreted from pituitary has stimulatory role on gonads.
E2 Secreted from gonads plays an inhibitory role in pituitary on FSH secretion. E2
possibly plays a regulatory role on thyroid.


Hyp mus









CHAPTER 2
SEASONAL VARIATION INT PLASMA THYROXINE, TESTOSTERONE AND
ESTRADIOL-17P CONCENTRATIONS INT JUVENILE ALLIGATORS (Alligator
mississippiensis) FROM THREE FLORIDA LAKES .

Introduction

The thyroid hormones influence many aspects of reproduction, growth, differentiation, and

metabolism in vertebrates. Metabolic effects of these thyroid hormones have been well

documented (Lynn 1970; Eales 1985a; Eales 1988). Thermogenic action, such as positive and

negative effects on carbohydrate, protein, and lipid metabolism, are among the actions of these

hormones. Further, thyroid hormones increase synthesis of several mitochondrial respiratory

proteins, such as cytochrome c, cytochrome oxidase, and succinoxidase (Norris 1997). These

compounds are necessary for normal development of the nervous system and influence molting

in amphibians, reptiles and birds as well as smoltification in many salmonids (Lynn 1970; Norris

1997; Shi 2001).

Circulating concentrations of thyroxine (T4) have been observed to fluctuate during the

year in various species (Kar et al. 1985a; Kuhn et al. 1985; Gancedo et al. 1997). For example,

the frog RanaRRRRR~~~~~~~RRRRRR ridibunda has a plasma T4 cycle which peaks during the months of February

through April, T4 plaSma concentrations then drop and peaks again during October\November.

The two peaks occur during periods of changing photoperiod and rainfall (Kuhn et al. 1985). A

similar pattern in plasma concentrations of T4 is found in a reptile, the Indian garden lizard,

Calotes versicolor, from the same geographical region (Kar et al. 1985a). The first peak is found

prior to reproduction and the second prior to hibernation or a period of low metabolic activity.

Decreased basal metabolic rate would be advantageous to animals during a period of hibernation

or low caloric intake. Reduced food intake in mammals and fish has been shown to reduce


SPart of this chapter is published in Comparative Biochemistry and Physiology A (Bermudez et al., 2005).










thyroid hormone production (Eales 1988; MacKenzie et al. 1998). Thyroxine concentration

decreases prior to winter months and is lowest during hibernation in the Chinese cobra, Naja

naja and the Desert iguana, Dipsosaurus dorsalis (Bona-Gallo et al. 1980; John-Alder 1984).

Although alligators in Florida do not exhibit true hibernation, they do endure a period of

low caloric intake and inactivity during the winter months. Do alligators exhibit seasonal

variation in circulating T4 COncentration similar to that observed in other vertebrates

experiencing winter inactivity? Is an abiotic environmental factor, such as temperature correlated

with plasma concentrations of T4? For example, stress can influence thyroid hormone

concentrations in humans, mice, birds, and fish (Bau et al. 2000; Davis et al. 2000; Kioukia et al.

2000; Morgan et al. 2000; Steinhardt et al. 2002; Coleman et al. 2003). Our laboratory has

previously reported that contaminants can alter hormone concentrations in alligators and fish,

including sex steroids and thyroid hormones (Crain 1997; Guillette et al. 2000; Orlando et al.

2002; Toft et al. 2003). Thyroxine concentrations have been shown to be elevated in male

juvenile alligators from a contaminated site when compared to reference juveniles (Crain et al.

1998). That study, however, only examined animals for a single period in time. Would the

pattern of plasma T4 COncentration found in alligators from a contaminated site mimic that found

in alligators from reference sites or would it be different? Further, would the alterations, if

present, be consistent throughout the year?

Materials and Methods

Study Sites

This study examined seasonal variation in plasma concentrations of T4 in jUVenile

American alligators from three populations in central Florida, USA. One site, Lake Woodruff

National Wildlife Refuge, is considered a reference site whereas the other two lakes, Lake

Apopka and Orange Lake, are significantly impacted by human activity. Lake Woodruff (lat.









29006'N, long. 81025'W) is a relatively pristine environment with little modern agricultural

activity in its watershed and little discharge of nutrient-ladened agricultural or storm water

discharge. For example, alligators from this lake have lower concentrations of various

organochlorine (OC) pesticides or their metabolites in their blood than lake Apopka (Heinz et al.

1991; Guillette et al. 1999b). Animals from Orange Lake (lat. 29026'N, long. 82011'W) have

similar low levels of OC pollutants as those from Lake Woodruff (Guillette et al. 1999c) but is

eutrophic. The third population (Lake Apopka) is a historically contaminated site, receiving city

effluent until 1970's as well as direct agricultural runoff until 1998 (Woodward et al. 1993;

Guillette et al. 2000). Lake Apopka (lat. 28040'N, long. 81038'W) is the fourth largest lake in

Florida and 1.5 miles downstream from an EPA Superfund site (EPA 1994). Lake Apopka was

directly connected via a freshwater stream to the site of a maj or pesticide spill of dicofol

(composed of 15% DDT) and sulfuric acid in 1980 (EPA, unpublished report). Animals and

eggs from this lake environment exhibit elevated concentrations of OCs and the lake is highly

eutrophic relative to other areas (Heinz et al. 1991; Sengal et al. 1991; Schelske et al. 1992;

Guillette et al. 1999b).

Sample Collection

Juvenile American alligators (A. mississippiensis) ranging from 75cm 150cm in total

length were hand captured at night during the hours (h) of 8 pm 1 am. The majority (80 90

%) of the samples where collected during the period of 9 pm 11 pm. Alligators of this size,

range from 2 6 years of age (Milnes et al. 2002). A majority of juveniles collected were first

time captures with a small percentage (approximately 10%) of recaptures. All animals captured

conformed to the same size and age class. Approximately 30 alligators were collected each night

with a minimum of 10 males and 10 females obtained from each lake. Collections occurred









during the middle 2 weeks of each month and all samples where collected within a week of each

other for all three sites. Samples from juvenile alligators living in Orange Lake were collected

from November 2000 April of 2002, except during March 2002. No collections of juvenile

alligators where possible on Orange Lake during May and June of 2001 because of a drought that

lowered water levels enough to prevent entry with boats. Blood samples were collected from

juvenile alligators from Lake Woodruff between March 2001 April 2002, except during March

2002. Finally, samples from the alligators living in Lake Apopka were collected between

February 2001 April 2002, except March 2002.

An immediate blood sample (within 3 min of capture) was obtained from the postcranial

supravertebral blood vessel once the animals where secured. Approximately 10 ml of blood was

taken from each animal (depending on size). Blood was collected in a heparinized Vacutainer@

and stored on ice for 8 10 h until centrifugation at 1,500 g for 20 min. Plasma T4

concentrations do not change in whole and clotted blood stored for 72 h at 4oC or room

temperature (22 26oC) (Reimers et al. 1982). Plasma was stored at -800C. On site water and air

temperature was collected as well as body temperature within the first 5 min of capture. Figure

2-1 displays the average cloacal temperature for the juvenile alligators from each lake during the

months of this study. The average (high, low) air temperature for each month from all three

lakes is displayed in Figure 2. Other morphometric measurements were then obtained. These

measurements included total length, snout-vent length, weight, sex, and if male, phallic tip and

cuff length using predefined criteria (Allsteadt et al. 1995; Guillette et al. 1996). Animals were

released in the vicinity of capture once all measurements were recorded.










Thyroxine Radioimmunoassay and Statistical Analysis

Total thyroxine (T4) WAS analyzed using a radioimmunoassay (RIA) previously validated

for alligator plasma (Crain et al. 1998). A previous study from our laboratory (Crain et al. 1998)

demonstrated that body length of juvenile alligators was a covariate of plasma T4 COncentrations.

Thus, a subset of all the samples collected, based on juvenile snout vent length, was used for RIA

analysis. That is, 7 to 10 males and 7 to 10 females of a matched size were selected from each

lake for each month to remove the possible confounding effects of body size. Animals ranged in

length from 79 cm to 122.5 cm with a mean of 104. 1 cm. Juvenile alligators sampled ranged in

weight from 1.7 kg to 9.7 kg and had a mean weight of 3.2 kg. Hormone concentrations were

determined from raw CMP (counts per min) data using a log-linear cubic spline standard curve

generated by Microplate Manager PC 4.0 (Bio-Rad Laboratories, Inc., Hercules, CA). Interassay

variance was 16.3% whereas intraassay variance was 6.6%. Intraassay variation was determined

by calculating the average variation between duplicate samples in every assay (n = 1466).

Interassay variation was determined by calculating the average variation in interassay sample

from each assay (n = 17) of plasma created from a pool of juvenile plasma. Values were

corrected for interassay variation. Briefly, the assay most median in variation was chosen as the

"base". The other assays and their respective T4 COncentrations where then corrected by

multiplying the percentage of variation from the "base assay". This procedure was applied to all

assays until interassay variation was not present. Analysis of variance (ANOVA) was performed

to determine if differences in T4 COncentrations occurred among months, lake or between sexes

for animals in the three alligator populations. All statistical tests were performed with Statview

5.0 (SAS Institute Inc., Cary, NC). Statistical significance was considered if p < 0.05.









Results

To determine if ANCOVA analyses were required, we examined if a relationship existed

between plasma T4 COncentrations and weight, snout-vent length (SVL), or cloacal temperature,

using linear regression analyses with data for all months combined or each month separately.

Significant relationships were not observed between plasma T4 COncentration and either weight

(r2 = 0.001; p = 0.47) or SVL (r2 < 0.001; p = 0.92) when all months were examined together. A

relatively weak relationship, however, was detected between plasma T4 COncentration and

cloacal temperature (r2 = 0.074; p < 0.0001).

Plasma T4 COncentration and weight, SVL and cloacal temperature were then regressed for

each month; no relationships were significant. Figure 2-1 displays the average cloacal

temperature for the juvenile alligators from each lake during the months of the study. The

average (high, low) air temperature for each month from all three lakes is displayed in Fig. 2-2.

We examined plasma T4 COncentrations in juvenile alligators using a 3 way ANOVA,

with lake of capture, month of capture and sex as variables. The effect of month of capture on

plasma T4 COncentrations was highly significant (F = 58.8; df = 12, P < 0.0001: Fig. 2-3, 2-4).

Although not consistent every month, in spring and fall male and female alligators from lake

Apopka had higher concentrations of T4 whereas in winter the concentrations where lower than

those observed in animals from lake Woodruff and Orange. Likewise, the lake from which the

animals were obtained also influenced plasma T4 COncentrations (F = 7.94; df = 2, P = 0.0004:

Fig. 2-3, 2-4). Sex of the individual had no influence on plasma T4 COncentrations alone (P =

0.82) but the interaction between sex and date of capture was significant (F = 2.68; df = 36, 569;

P < 0.0001). Although a difference was noted in plasma T4 COncentration when males and

females were examined, no consistent pattern of sexual dimorphism was noted, as females had

elevated levels compared to males in some months whereas males had the higher concentrations









in other months or no difference was noted (Fig. 2-3, 2-4). The one major difference seen

between males and females was a dramatic peak in plasma T4 COncentrations in females captured

in September, whereas males showed no change from the previous month.

Discussion

Plasma T4 COncentrations in juvenile alligators exhibit seasonal variation that are not

driven by ambient temperature alone, as we obtained a poor correlation between body

temperature and plasma T4 COncentration. The poor correlation and lack of significance when

plasma T4 COncentrations were regressed against weight and SVL also were expected as the

subset of samples examined in this study was selected for conformity for these variables.

However, by constructing our samples sets in this way, we removed the possible confounding

effects of SVL and weight as variables influencing the analysis. The significant relationship

found between cloacal temperature and plasma T4 COncentration had a relatively low r2 ValUe

(less than 0.07 0.2 for a given month of capture) suggesting that variation in plasma thyroxine

concentration is apparently induced by additional biotic and abiotic factors such as water level,

nutritional level, behavior or contaminants. We observed that ambient and body temperatures

were highest during spring and summer months with an expected drop during the fall and winter

months. Our data reveal that plasma T4 COncentrations in both male and female juvenile

alligators were increased during the transition from winter to spring months and late fall and

winter. The increase in plasma concentrations in spring coincides with increasing ambient

temperature but the greatest variation occurs during the fall and winter months when

temperatures drop precipitously from October November. However, we observed a highly

significant increase in plasma T4 COncentrations during the period when ambient temperatures

were lowest, the period of December February.










Thyroid cycles are positively correlated with reproductive cycles in various vertebrate

species. Thyroid hormone concentrations in serum of the sheath-tailed bat, Taxphozous

longimanus were elevated during gonadal recrudescence and the breeding period, during late

winter dormancy, and minimal during gonadal quiescence and the initial stages of first

pregnancy (Singh et al. 2002b). Ovarian thyroxine concentrations have been shown to increase

during vitellogenesis and oocyte final maturation and decrease during embryogenesis in the

viviparous rockfish, Seba~stes inermis (Kwon et al. 1999b). Serum thyroxine also fluctuated

seasonally in Kemp's ridley sea turtles (Lepidochelys kempi), with elevated levels observed in

females associated with the period of vitellogenesis (Rostal et al. 1998b). Thyroid hormones are

increased during spawning, premigratory, and migratory behaviors of many teleost fishes

(Blaxter 1988).

Plasma T4 COncentrations in juvenile alligators exhibit a pattern similar to that seen in

plasma testosterone (T) and estradiol-17P (E2) COncentrations reported by our group for a

different set of plasma samples obtained several years earlier from juvenile alligators (these

animals are of a size and age reported to be non sexually mature) (Rooney et al. 2004). We have

suggested, based on these and other data (Edwards et al. 2004) that alligators exhibit a multi-year

onset of puberty and that 'juvenile' animals, of the size studied by our group previously and in

this study, are actually peripubertal. Juvenile males display a peak in plasma T concentrations in

March, followed by a decline and then a rise again in August (Rooney et al. 2004). Females

showed a rapid rise in plasma E2 COncentration during the spring, with a peak in June (Rooney et

al. 2004). In the present study, plasma T4 COncentrations peaked during April. Given these

patterns, we hypothesize that thyroid hormones could play a cooperative role with T and E2 in

juveniles, helping stimulate important events in puberty.









Ando et al. (2001) has shown that prolonged exposure to T3 in neonatal rats is a

mechanism by which thyroid hormone can down regulate aromatase activity in Sertoli cells.

Also, work with Meishan boars found that transient neonatal hyperthyroidism during late

gestation was associated with a decline in proliferation and early maturation of Sertoli cells,

followed by early onset of puberty (McCoard et al. 2003). These observations indicate a

possible role for thyroid hormone in modification of Sertoli cell development, thereby

influencing growth and differentiation of the testis. Precocious puberty has been reported as a

complication of severe acquired hypothyroidism in children (Chattopadhyay et al. 2003).

Additionally, T4 plaSma concentration increased during prepubertal and peripubertal periods in

rhesus monkeys and appear to occur in concert with the peripubertal increase in testicular size

(Mann et al. 2002). The changes in T4 during the peripubertal period suggest that thyroid status

could be a significant contributor to the process of sexual development.

We also observed a significant rise in plasma T4 COncentrations between November and

December in males and females; a pattern similar to that found in vertebrates that hibernate (Kar

et al. 1985a; Kowalczyk et al. 2000). Animals captured in December also display an increase in

cloacal temperature. This peak could be attributed to the rise in plasma T4 Seen in December

since thyroid hormones are potent stimulators of thermogenesis and metabolism. Although

Florida has short and relatively mild winters compared to more northern temperate regions, this

peak could be 'prehibernatory' for alligators, a subtropical species. Alligators do not exhibit

hibernation but do display cold temperature torpor, involving relatively low body temperature,

reduced or no food intake and greatly reduced activity levels (Mcllhenny 1987; Grenard 1991;

Levy 1991).









Juveniles from Lake WoodrUff appear to exhibit a seasonal pattern in plasma T4

concentration that is significantly different from that seen in animals from Lake Apopka.

Animals from Orange Lake appeared to display a pattern intermediate to that observed on the

other two lakes. We noted that the seasonal patterns between lakes Woodruff and Apopka were

reasonably similar although the concentrations of T4 in aH} giVen month could vary significantly.

The populations of alligators in these three lakes were chosen as they represented three unique

environments as discussed earlier, but also represented populations with many similarities.

Samples were obtained each month on consecutive nights to minimize weather, photoperiod and

temperature difference. These lakes are less than 75 miles apart on a north south axis with

Lake Apopka being the southernmost lake and Orange Lake being the northernmost (for map of

lake locations see (Guillette et al. 1999a). A recent population genetics study indicated that the

animals from these three lakes are similar; a panel of molecular markers could not distinguish

animals taken from these three lakes (Davis et al. 2002). A number of studies have shown that

xenobiotic contaminants, such as organochlorine (OC) pesticides (or their metabolites), PCBs

(polychlorinated biphenyls) and PBDEs (polybrominated diphenyl ethers) influence the thyroid

axis (Brucker-Davis 1998; Zoeller et al. 2000; Zoeller et al. 2002). Further, additional studies

have begun to document the role of nitrates in the disruption of the thyroid axis (Guillette et al.

2005). Nitrates/nitrites have recently been shown to depress thyroid function and are associated

with goiter in some nitrate-exposed children (Gatseva et al. 1998b; Gatseva et al. 2000b). They

also alter gene expression for the thyroid receptor in an amphibian (Barbeau et al. 2007). Many

Florida lakes exhibit nitrate contamination. Our lab has previously shown altered T4

concentrations in juvenile alligators living in Lake Apopka and Lake Okeechobee, both

eutrophic lakes (Crain et al. 1998). The fact that plasma T4 COncentrations from alligators in









Lake Apopka seem to vary from the pattern displayed in the reference lake, Lake Woodruff,

could be due to the elevated exposure to pollutants in Lake Apopka; that is, both elevated OCs

and NO3/NO4, whereas the primary pollutant in Orange Lake is NO3/NO4. Plasma

concentrations of T4 are but one measure of thyroid action and future studies need to reexamine

other aspects of the thyroid axis before we can determine if the differences we have observed

among the animals from these lakes are biologically significant.

In conclusion, we have observed that juvenile American alligators display seasonal

variation in circulating T4 COncentrations. Plasma T4 COncentrations peak in March or April but

the pattern observed does not parallel that of ambient or body temperature. Although we have

detected significant differences in the basic pattern, especially when month and plasma

concentrations are compared among the animals from the three lakes, the general seasonal

patterns observed for both sexes for the three lakes are generally similar. Future studies are

required to determine if the differences observed among the populations are related to

contaminants found in these wetlands or if other factors contribute to the observed differences.

Further, comparing the seasonal pattern observed in plasma concentrations of Tq with the

seasonal patterns in other hormones, such as testosterone, estradiol-17P and corticosterone could

provide insight into the endocrinology of the multiyear puberty this species appears to exhibit.













32-

30-

28 -8

26-

a, 24-

-- 22 -

20-

18-

16


W" o odruffo o o ~, o, o~ ~





ofMrh20 hog pi 02fo ae Woodruff, ppa n rne




Florida, USA. The sample size for each cloacal temperature ranged from 11 20 data
points per month. Only temperatures from samples for which thyroxine
concentrations were obtained are presented.













28-

26-

24-
O
S22- -C O

20 -( v


E 18-

16-

14-

12-

10




-e Woodruff
-0 Apopka
-9 Orange


Figure 2-2: Mean (high and low) ambient air temperature (oC) during the months of March 2001
through April 2002 from Lakes Woodruff, Apopka, and Orange, Florida, USA. The
temperature information obtained from the cities nearest the lakes as listed by the
Weather Channel@.











b,c
E 14 -a,c


cr 12 b,c


~ loa,b a,b

O a,b b
o ol a,c/ a,c

x 6-
o
1- 4 -


0 R \


Wodrf
-0 pok

o" Orangeo o o o~ ~o~




bewe ueilsfo ae Woodruff and Apopafragvnmnh .5



satistican lly igniianto differences bentwee juveniles hrug Ari2 from Lakes Worf n
WOorange f pora givnd mornth <00, Foiand cS. = statistically significant difference
between juveniles from Lakes Apopkau and AOrang for a given month, p < 0.05.












a a,b,c
E 14-

b,c
c 12-


o
10 a~c
X 6 "' a
C
ca

,1 8 2
aI I

C"o "o "o "o"o "oo ~ ~
... C3 o o'~e o
X 6-P-







SWoodruff
-0 Apopka
-Y- Orange



Figure 2-4: Mean (+ 1 SE) plasma thyroxine (T4) COncentration (ng/ml) for female juvenile
American alligators during the months of March 2001 through April 2002 from Lakes
Woodruff, Apopka, and Orange, Florida, USA. a = statistically significant difference
between juveniles from Lakes Woodruff and Apopka for a given month, p < 0.05, b
= statistically significant difference between juveniles from Lakes Woodruff and
Orange for a given month, p < 0.05, and c = statistically significant difference
between juveniles from Lakes Apopka and Orange for a given month, p < 0.05 .









CHAPTER 3
ESTROGEN RECEPTOR EXPRESSION INT THE THYROID FOLLICLE OF THE
AMERICAN ALLIGATOR (Alligator mississippiensis) DURING DIFFERENT LIFE STAGES.

Introduction

The thyroid and its hormones play essential roles during development and growth of

numerous tissues such as the central nervous system and skeleton (Norris 1997; Styne 1998;

Cayrou et al. 2002; Bernal et al. 2003). Additionally, this axis has been shown to play various

roles in homeostasis, cellular metabolism and reproduction (Cooke et al. 1991b; Norris 1997;

Arambepola et al. 1998). Recently, it has been shown that seasonal variations in plasma

thyroxine concentrations parallel seasonal variations in sex steroid concentrations in juvenile

alligators (Bermudez et al. 2005). This observed pattern suggests that the thyroid axis could

have a role in regulating gonadal activity and vice versa. Sex steroid receptors on the thyroid are

thought to be nuclear receptors, which regulate target gene expression involved in metabolism,

development, and reproduction (McKenna et al. 2001). The role these sex steroids, and their

receptors, play in the regulation of the thyroid is not currently well understood.

The presence of estrogen receptors (ER) and androgen receptors (AR) in the thyroid has

been reported for only a couple of vertebrates, namely humans and rats (Fujimoto et al. 1992;

Giani et al. 1993; Kawabata et al. 2003). Additionally, many vertebrate species, including

humans, have thyroid disorders more frequently diagnosed in the female than the male

population (approximately 3:1)(Paterson et al. 1999; Manole et al. 2001; Arain et al. 2003).

Studies have shown that neoplastic thyroids have a higher number of ERs compared to normal

tissue (Manole et al. 2001), suggesting a potential relationship between sex and susceptibility to

thyroid abnormalities. These findings also suggest that ER signaling could play a larger role in

the thyroid than the AR.










This study describes the presence and distribution of sex steroid and thyroid receptors

(ERu, ERP, AR, TRu, and TRP) in the thyroid gland obtained from alligators at several life

history stages and provides a semi-quantification of the sex steroid receptor types using an

immunocytochemical approach. Quantitative differences in mRNA expression of ERu, ERP,

TRu, TRP and the AR was determined on the same tissue using quantitative real time PCR (Q-

PCR) with primers designed specifically for alligators. This study examines the potential sexual

dimorphism in receptor expression in the alligator thyroid. Due to the presence of both ERa and

ERP nuclear receptors throughout life in the thyroids of humans (Kawabata et al. 2003), we

expected other vertebrates, such alligators, would also express both estrogen receptors in the

thyroid.

The thyroid axis plays a role in hormone regulation, and since hormone production

changes during an animal's development from neonate to adult, it is possible that steroid receptor

expression changes with developmental maturity. To investigate whether sex steroid receptor

expression changes throughout an animal's life, we examined alligators from three different life

stages.

Materials and Methods

Animals

Five male and five female neonatal, juvenile, and adult alligators were collected from

Lake Woodruff(lat. 29006'N, long. 81025'W), Florida, USA. In June of 2003, the juvenile

specimens were captured at night from an airboat by a hand-restraint technique. The juvenile

American alligators (A. mississippiensis) ranged from 84.6 cm 137.6 cm in total length with a

mean length of 1 10.2 cm and were hand captured during the hours (h) of 9 pm 1 am. Upon

capture, these alligators were sexed and placed in a cloth bag for transport back to the University









of Florida. The specimens were euthanized and tissues dissected within 10 h of the capture. In

mid July of 2003, 12 eggs were collected from Lake Woodruff and transported to the University

of Florida, Florida, USA. Since the sex of alligators is temperature dependent, six eggs were

incubated at 33.50C, the male determining temperature, and six eggs were incubated at 300C, the

female determining temperature for alligators from central Florida, USA. In mid August, as each

egg hatched, the neonate was euthanized and tissues dissected. The neonates ranged 23.5 cm -

26 cm in total length with a mean length of 24.9 cm. In September of 2003, the adult specimens

were captured at night using a standard noose technique. The adult alligators ranged from 178

cm 333 cm in total length with a mean length of 225.4 cm and were captured during the hours

of 11 pm- 2 am. The specimens were sexed in the field and transported to the University of

Florida. Within 7 h of capture, alligators were euthanized and tissues dissected.

In all cases, alligator euthanasia was performed by an overdose of sodium pentabarbitol,

inj ected intravenously into the post-cranial vertebral vein, a protocol approved by the University

of Florida IACUC. Thyroids were removed from all specimens and divided into two lobes. One

thyroid lobe was preserved in cold Bouins fixative (fixative was on ice), whereas the other lobe

was flash frozen in liquid nitrogen for molecular studies. Additional tissues (gonad, liver, heart,

phallus, and brain) were harvested for use in other ongoing studies.

Histological Analysis and Statistics

Thyroid tissues from each age group were prepared using standard histological techniques.

Each animal was represented by a set of slides and each set contained three slides: one control

slide, one experimental slide, and one normal Hemotoxylin and Eosin stain slide. The control

slides contained sections 1, 4, and 7; the experimental slides included sections 2, 5, and 8; the

normal slides included sections 3, 6, and 9 (Fig. 3-1). After the tissues were mounted, the









sections on the control and experimental slides were treated using immunocytochemistry (ICC)

techniques and an antibody specific for ERa (Appendix A) to visualize the presence of estrogen

receptors. The two slides differ in that experimental slides received antibody specific for a

receptor and control slides did not. Detection was performed using the Vector Elite ICC kit and

antibodies from Santa Cruz Biotechnology, Inc.: androgen receptor AR (C-19): sc-815 and the

estrogen receptor ERa (MC-20): sc-542. Recently, Japanese collaborators (Ohta, Y.

unpublished data) have validated the use of these antibodies for alligator ERa and AR. The third

slide of the set was stained with Hemotoxylin and Eosin stain (Fig. 3-2).

Once the slides were stained, sections through three intact thyroid follicles were analyzed.

The total number of counted stained nuclei from the experimental slide was divided by the total

number of counted stained nuclei from the same follicle in the normal slide. These data were

then converted to the arcsine of the ratio obtained. This figure was used to represent the relative

ERa protein expression in the thyroid of that specific alligator. This technique was used to semi-

quantify ERa protein expression levels in the thyroid. Comparisons between the sex was

analyzed using StatView software with a significance a = .05 (version 5.0; SAS Institute Inc.,

Cary, NC, USA). We had very limited success with AR immunostaining on alligator thyroid

follicles. Although the presence of an AR-like protein was localized, staining was never

consistent enough so that we could perform a distribution analysis.

Isolation of RNA, Reverse Transcription and Northern Blots

Quantitative real time-PCR (Q-PCR) was performed to quantify mRNA expression levels

for ERu, ERP, AR, TRu, and TRP in neonatal, juvenile and adult thyroid tissue. The technique

used was that which validated previously for alligator tissues (Katsu et al. 2004; Helbing et al.

2006).









Q-PCR was performed using standard techniques. In short, total RNA was isolated with

an RNeasy kit (QIAGEN, Chatsworth, CA). First strand cDNA synthesis was performed on 4

Clg of total RNA using Super Script II RNase H- Reverse Transcriptase (Invitrogen, Gaithersburg,

MD) and oligo (dT)12-18 (Invitrogen, Gaithersburg, MD) to reverse transcribe polyA+ mRNA.

Primer annealing was carried out at 700C for 10 min, before reverse transcriptase was added.

Conditions for first-strand synthesis were 420C for 60 min, followed by 10 min at 700C. Primers

for Q-PCR were designed from the alligator coding sequences (chapter 4, Table 4-1). A sequence

also was previously obtained for alligator p-actin and ribosomal L8 for the purpose of

normalization; primers have been designed based on alligator sequences. Q-PCR was carried out

in a BioRad MyiQ single color real-time PCR detection system according to the manufacturer' s

protocol, with the exception that 15 CIL per well was used. Q-PCR conditions were 2 min at

500C, 950C for 10 min and 40 cycles at 950C for 15 sec, and 600C for 1 min. To normalize data,

the mean Ct (threshold cycle) for ribosomal L8 was used on the mean Ct of the genes of interest

(ERu, ERP, TRu, TRP and AR). Relative expression counts were calculated using the 2-aact

method (Livak et al. 2001). Northern analysis was preformed using standard techniques to

determine quality of the mRNA prior to Q-PCR; gels were loaded with 20 Clg total RNA.

Labeling of cDNA probes was achieved by random priming (Prime-It II, Stratagene, La Jolla,

CA) using (ATP-32P) dCTP (SA 3,000 Ci/mmol; New England Nuclear) according to the

manufacturer' s protocol.

Results

Immunohistochemical Localization of ERa

Localization of ERa was visualized in the thyroid follicle using a mammalian polyclonal

antibody (Fig. 3-2). An ANOVA revealed that no sexual dimorphism was detected in ERa










protein expression, as determined by immunocytochemistry, at any of the life stages examined in

this study. The ratio of ICC ERa stained to normal hemotoxylin and eosin stain is displayed in

Fig. 3-3.

Quantitative RT-PCR

Relative expression of thyroid tissue mRNA for ERu, ERP, TRu, TRP and AR were

analyzed using QPCR to determine whether sexual dimorphism existed. An ANOVA was

performed on the genes of interest with sex as the independent factor. No statistically significant

difference was observed between male or female thyroid mRNA expression for any of the genes

analyzed. Thyroid relative mRNA expression for genes analyzed in neonate, juvenile and adult

alligators are displayed in Figs. 3-4, 3-5 and 3-6 respectively.

Discussion

Thyroid disorders are approximately three times more prevalent in females across species

(Paterson et al. 1999; Manole et al. 2001; Arain et al. 2003). Our data demonstrate that the

thyroid expresses both forms of ER in the alligator thyroid. Both forms of ER (a and P) are

known to be expressed in the human thyroid (Kawabata et al. 2003). Our data demonstrate that

mRNA for both ER and AR is expressed in the thyroid as well as for both forms of TR. Further,

we observed that the mRNA for ERa is translated to protein as we were able to detect its

presence in the thyroid follicle cells. When thyroid tissues from the American alligator were

analyzed histologically, no sexually dimorphic pattern was observed for ERa staining when

tissues from all three life stages were examined. These results are contrary to our hypothesis

that females would show higher ERa expression. Quantitative PCR data from these tissues

supports this conclusion as well as the results from another study that examined potential

sexually dimorphic patterns of ERa expression in humans (Manole et al. 2001) Recent studies









examining the mammalian thyroid suggest that ER expression is not sexually dimorphic, but

rather, the post-ligand binding response of ERs to E2 in the thyroid cell is dimorphic (Correa da

Costa et al. 2001; Lima et al. 2006; Marassi et al. 2007). That is, estrogens enhance expression of

cyclin Dl protein, which plays a role in regulation of transition from G1 to S phase in the cell

cycle. Estrogens exert effects by activation of MAP kinases as well as by binding to ERs.

As alligators sexually mature, the plasma concentrations of sex steroids increase. We

hypothesized that, as adults have higher plasma concentration of E2 COmpared to the other two

life stages (Guillette, 2000; Rooney et al. 2004; Milnes, M. R. personal communication), the

adult alligators would show lower ERa ratios and, therefore, lower ERa expression due to

potential feedback loops down regulating the expression of the receptor. Our data suggest that

neonates have a significantly higher ratio of ERa compared to both the juvenile and the adult

specimens. Our Q-PCR data for mRNA expression for ERa and ERP, however, did not support

this observation, suggesting that differential translation could occur at different life stages.

One observational difference of note, is that we have demonstrated that ERa protein and

mRNA for ERa and ERP are expressed in the thyroid of juvenile alligators obtained

immediately after hatching in late August, during mid summer (June) in juveniles and during

September in adults. A previous study examining the tissue distribution of ERa observed no ER

mRNA expression for juvenile alligator thyroid tissue (Helbing et al. 2006). Interestingly, the

animals in that study were collected from the wild (Lake Woodruff NWR, Florida, USA) in

September, the same location from which we obtained the animals for this study in June.

Further, the animals used in the present study are approximately 20 cm longer in snout vent

length, suggesting that they are approximately 1-2 years older (Milnes et al. 2000) than those

examined by Helbing et al (2006). These data suggest possible life stage differences, but that is









unlikely given that we observed mRNA ER expression in the thyroid tissue of neonates,

juveniles and adults. We suggest that possible seasonal variation in the expression of the ER in

the thyroid is more likely and this needs to be tested, although the protected status of this animal

may preclude monthly sampling for such a test.

In addition to the expression of both forms of ER, we demonstrate that the alligator thyroid

expresses mRNA for the AR. Both adult and neonatal stages displayed significantly lower

mRNA expression levels when compared to juveniles. Androgens have been found in circulation

in both juvenile male and female alligators (Rooney et al. 2004; Bermudez, D. S. unpublished

data). Further, juvenile alligators of the size we examined in this study display seasonal variation

in plasma testosterone concentrations (Rooney et al. 2004). Further, juvenile alligators appear to

display a multiyear period of puberty and these data suggest a hypothesis that AR function

during the juvenile life stage could play a role during peripubertal maturation of the thyroid.

Androgens have been suggested to increase thyroid function by up regulating expression of

genes such as thyroperoxidase and thyroglobulin (Correa da Costa et al. 2001). The increase in

androgen concentration in the blood during puberty could up-regulate thyroid function, which

consequentially, would increase activity and growth in tissues responsive to thyroid hormones.

Future studies need to test this hypothesis.

TRoc as well as TRP display mRNA expression in the thyroid. TRs mRNA expression in

thyroid tissue is seen in neonate, juvenile and adult life stages. TRs exert a regulatory role on the

thyroid axis to maintain proper thyroid hormone balance (Norris 1997; Helbing et al. 2006)

previously showed TRs mRNA expression in the thyroid and our data support those findings.

This study has shown that mRNA for both forms of the ER, both forms of TR and AR are

found on the thyroid of the American alligator (A. mississippiensis). No sexual dimorphism was









observed in the mRNA expression of these genes in the thyroid tissue examined. However, the

presence of sex steroid receptors provides a potential mechanism by which the gonadal steroid

could influence thyroid development and function. This is the first study to describe ERs in the

thyroid a none-mammalian species and to characterize the expression with mRNA expression

and protein expression. Further studies are required to determine if such a regulatory pathway

exists via ERs in the thyroid.






























Figure 3-1 :Three types of slides used (control, experimental, and normal) and how the tissue
was oriented to ensure the ease and accuracy of the analysis. The numbers descend in
order from the earliest section of thyroid used to the latest.


Figure 3-2: Thyroid follicle from a juvenile alligator. (A) Control, (B) experimental, and (C)
normal stained. The control and experimental tissues underwent the same IHC
protocol; however, only the experimental tissues were treated with the ERoc antibody.
The normal follicle underwent a Hemotoxylin and Eosin stain. This stains for every
nucleus present on the follicle.


















0.8-



o






0.0
Nent uenl dl



Fgre -:Ma ai o H n xrsin(esrdb ai fICEasandt
nomlhmtxlnadesnsti)i h hri ttre iesae nteA eia
aliao.Errbr r tnaderrfrmma.N eulydmrhcpteni
obevd



















8-

O














ERa ERb AR TRa TRb




Figure 3-4: Neonate mRNA gene expression in thyroid tissue from the American alligator, A.
mississippiensis. Genes were normalized to ribosomal L8 and relative expression
counts were calculated using the 2-act method. Error bar represents 1 standard error
from mean. No sexual dimorphic pattern was observed.















16 0 Male







S11




0, 8





ERa ERb AR TRa TRb




Figure 3-5: Juvenile mRNA gene expression in thyroid tissue from the American alligator, A.
mississippiensis. Genes were normalized to ribosomal L8 and relative expression
counts were calculated using the 2-act method. Error bar represents 1 standard error
from mean. No sexual dimorphic pattern was observed.


















10 -1 I












Er ~ R ~ ~


Fiur 3-:AutmN eeepeso ntyodtsu rmteA eia liaoA
missipess ee er omlzdt iooa L n eaieepeso
conswr acltduigte2atmthd ro a ersns1sadr ro
fro men osxa iopi atr a bevd









CHAPTER 4
EFFECTS OF IN OVO AND IN VIVO PROPYLTHIOURACIL EXPOSURE ON THYROID
AND GONAD GENE EXPRESSION INT NEONATAL AMERICAN ALLIGATORS (Alligator
mississippiensis)

Introduction

The thyroid axis plays diverse roles and functions in vertebrates. Metabolic effects of

thyroid hormones, such as increases in the synthesis of several mitochondrial respiratory proteins

such as cytochrome c, cytochrome oxidase, and succinoxidase, are well known (Stevens et al.

1995; Norris 1997). Also, shark embryos of Squalus suckleyi and tissue obtained from the frog,

Rana pipiens, have been shown to increase oxygen consumption following triiodothyronine (T3)

and/or thyroxine (T4) treatment (Blaxter 1988;May and Packer 1976). Effects on growth and

development such as the human disorders thyrotoxicosis, Grave's disease, Hashimoto's disease,

cretinism and juvenile myxedema are caused by imbalances in the thyroid axis (Norris 1997;

Kilpatrick 2002). In amphibians and fish, metamorphosis and smoltification are classic

examples of roles played by the thyroid axis (Denver 1998; Wright et al. 2000; Kulczykowska et

al. 2004).

The general permissive/cooperative roles played by the thyroid axis on the reproductive

axis is yet another demonstration of the diversity of functions by this axis. Cycles in the plasma

concentrations of thyroid hormones are positively correlated with reproductive cycles in various

vertebrate species such as the sheath-tailed bat, Taxphozous longimanus (Singh et al. 2002), the

viviparous rockfish, Seba~stes inermis (Kwon et al. 1999) and the American alligator, Alligator

mississippiensis (Bermudez et al. 2005, this dissertation). Thyroid hormones play a crucial role

in the development of testicular Sertoli (cell assisting spermatozoa production) and Leydig cells

(steroid producing cells). Manipulation of the thyroid environment can be used to produce an









increase in testicular size, Sertoli cell number, and sperm production (Cooke et al. 2004).

Neonatal hypothyroidism has been shown to impair testicular development (Jannini et al. 1995).

Plasma concentrations of thyroid hormones, at proper levels, are necessary for ovulation

(Maruo et al. 1992). Doufas and Mastorakos (2000) demonstrated that severe hypothyroidism

causes ovarian atrophy and amenorrhea. Thyroid receptors (TRs) are found in various parts of

the ovary such as granulosa cells (Maruo et al. 1992; Zhang et al. 1997), oocytes and cumulus

cells of the follicle (Zhang et al. 1997), and corpora lutea (Bhattacharya et al. 1988). Recent

evidence also suggests that thyrotropin receptors found in gonadal tissue play a direct role on the

reproductive physiology of several teleost species (Goto-Kazeto et al. 2003; Rocha et al. 2007).

Recent work from our group, examining the American alligator, also suggest that the gonads are

capable of being stimulated by thyrotropin as we observed an up regulation of expression of TRs

in the gonad following treatment (Helbing et al. 2006). These studies, in conjunction with other

available data, indicate that TRs are present in high quantities in the testis and ovary, leading to

the hypothesis that thyroid hormones could have key roles in gonadal development and function.

This study examines the potential role the thyroid plays on the developing reproductive

axis of the American alligator. This investigation will focus on the thyroid axis and address what

happens to the reproductive axis if the thyroid axis is depressed with a pharmaceutical agent.

Alligators were treated with proplythiouracil (PTU) in ovo during the window of sexual

differentiation of the gonad in developing embryos and in vivo in neonates. PTU is a commonly

used anti-thyroid agent for the treatment of hyperthyroidism. PTU functions as an inhibitor of

gap-junction-intercellular communication in the thyroid follicular cells. Two thyroid hormones,

manufactured by the thyroid gland, T4 and T3, are formed by combining iodine and the protein

thyroglobulin with the enzymatic assistance of peroxidase. PTU inhibits the normal interaction









of iodine and peroxidase on thyroglobulin, thus blocking the formation of T4 and T3. PTU also

interferes with the conversion of T4 to T3, and, since T3 is more active than T4 at the cellular

level, this also reduces the activity of the thyroid axis. By blocking the thyroid with PTU during

the temperature dependant sexual differentiation period of the alligator embryo, we predict an

alteration in the development of the testis or ovary and change in gene expression. We also

predict a change in gene expression on both gonad and thyroid tissue treated with PTU as

neonates.

This study examines the thyroid axis primarily through changes in gene expression using

quantitative RT-PCR (QPCR) of markers of thyroid and reproductive steroid hormone function.

We examined markers such as the nuclear receptors for estrogens (ERu, ERP), androgens (AR),

thyroid hormones (TRu, TRP), plasma membrane receptors for thyrotropin (TSHr), deiodinases

(DI, D2), sodium-iodide symporter (NIS), pendrin (PEN), thyroglobulin (Tg) and thyroperoidase

(Tp) (Fig. 4-1). ERsl and ARs2 are believed to play a possible regulatory role on the thyroid

axis. TRs3 are known regulatory agents of the thyroid axis. Both deiodinase 1 and 2 help convert

T4 to T3, which is believed to be the more active thyroid hormone in tissues. The last four

endpoints play roles in the synthesis of thyroid hormones. The sodium-iodide symporter6 (NIS)

is located in the basal membrane of an epithelial cell of thyroid follicles. It pumps sodium (Na )

and iodide (T~) ions into the epithelial cell where it is then transported to the apical surface and

released into the lumen of the follicle. Pendrin7 (PEN) is a co-transporter found at the apical

membrane of a thyroid epithelial cell. Pendrin pumps iodide (T) from the epithelial cell into the

thyroid follicular lumen and chloride (C1E) from the follicular lumen into the epithelial cells.

Thyroglobulins is a large protein that plays a role in the coupling of iodinated tyrosine molecules

to form thyroid hormones T3 and T4. Lastly, thyroperoxidase9 is an enzyme that helps convert









inorganic iodide to active iodide, which then readily binds to a tyrosine molecule leading to an

organically bound iodine.

The mRNA expression of several additional biomarkers of gonadal function were

examined as well using QPCR. Gene expression in gonadal tissue was examined for the nuclear

receptors for estrogens (ERot, ERP), androgens (AR), the plasma membrane receptor for

thyrotropin (TSHr), deiodinases (DI, D2), P450 aromatase (AROM) and steroidogenic acute

regulatory protein (StAR) (Fig. 4-2). ERsl and ARs2 are known to regulate the gonadal axis as

well as other tissues. Likewise, TRs3 actively modulate the physiology of the gonads. Thyroid

stimulating hormone, presumably acting via its receptor4 has been recently shown to increase the

expression of TRs the alligator gonad (Helbing, Crump et al. 2006). Steroidogenic acute

regulatory protein' is known to shuttle cholesterol into the mitochondria for conversion in the

steroidogenic pathway. Both deiodinase6 1 and 2 help convert T4 to T3, which is the more active

thyroid hormone in tissues. Aromatase7 is an enzyme necessary for the conversion of

testosterone to estradiol-17P.

Materials and Methods

Animals

Alligator clutches from Lake WoodruffNational Wildlife Refuge (lat. 29006'N, long.

81025'W), Florida, USA were collected during late June 2003 for the in ovo study. Alligator

clutches from Lake Woodruff were collected during late June 2004 for the in vivo study.

Alligator Eggs from these clutches were candled and staged. Eggs were then systematically

sorted into groups with an N = 10. One set of eggs was incubated at 300C (female determining

temperature) whereas the other set was incubated at 33.50C (male determining temperature).









Each set had five subsets: control, ethanol vehicle control, low dose PTU, medium dose PTU,

and high dose PTU

In2 Ovo PTU Treatment

Given that no previous studies of embryonic exposure to PTU had been done in

alligators, we created doses de novo with suggestions taken from toxicology. The high dose was

to be 50 % of the LD5o for rats. The LD5o for PTU in the laboratory rat is 1,250 mg/kg. The

average weight (n = 10) of an alligator egg was 90 g. The high dose for an egg was calculated to

be approximately 56 mg PTU/egg. However, given the solubility of this compound in our

vehicle 95 % ethanol (90 g/100 ml), we treated eggs with a topical dose of 100 Cll. Thus, the high

dose was 900 Gig/egg with a medium dose 100 fold less at 9 Gig/egg and a low dose of 90 pg/egg.

Eggs were dosed each day for five consecutive days starting when eggs were at embryonic stage

19, just prior to the period of sex determination. Vehicle controls received 100 Cll of ethanol as

did each treatment group where as the non-vehicle control received no treatment.

Inz Ovo Dissections and Tissue Collection

Embryos were allowed to incubate and gestate to hatching. Once neonates hatched, they

were immediately euthanized with an overdose of pharmaceutical grade sodium pentabarbitol,

inj ected intravenously into the post-cranial vertebral vein, a protocol approved by the University

of Florida IACUC. Approximately 2-3 ml of blood was extracted, centrifuged and plasma

collected for analyses of plasma hormone concentrations by validated RIA. Thyroid and gonadal

tissues where immediately removed, partitioned into separate lobes (thyroid) or pieces (gonad)

and flash frozen with liquid nitrogen and stored at -80.C until processed for QPCR. One piece of

thyroid tissue was fixed in chilled Bouin's fixative and stored in 75% ETOH for standard









histology and ICC of ER. Snout vent length (SVL), Total length (TL), body mass, and thyroid

and gonad weight were also collected.

In Vivo PTU Treatment

Treatment was administered 14 days post hatch to allow for the absorption of the yolk sac.

High dose treatment was at 5 ng PTU/g body weight of neonate, whereas the medium dose

treatment was 0.05 ng/g neonate and low dose treatment was 0.005 ng/g neonate. The average

neonate weighed 65 g yielding a high dose of approximately 325 ng, medium dose of 3.25 ng,

and low dose of 0.325 ng. PTU was dissolved in 95% ethanol and inj sections involved a volume

of 50 Cll each, intravenously into the post-cranial vertebral vein. Control groups received no

treatment or 50 Cll ethanol injections. After the initial treatment, a second identical treatment was

given 6 h later. After a total 12 h since the initial treatment, animals were euthanized with an

overdose of sodium pentabarbitol and tissues collected.

In Vivo Dissections and Tissue Collection

Immediately prior to euthanasia, 2-3 ml of blood was obtained from the supravertebral

blood vessel with a sterile needle and syringe. Neonates then were euthanized with an overdose

of sodium pentabarbitol, inj ected intravenously into the supravertebral vein, a protocol approved

by the University of Florida IACUC. Thyroid tissue was immediately removed, weighed,

partitioned into two distinct lobes and fixed or flash frozen with liquid nitrogen and stored at -

80oC. Gonadal tissue was handled in a similar manner. Snout vent length, TTL, and body mass

were also collected.

Histological Analysis and Statistics

Thyroid tissues from in ovo PTU experiment were prepared using standard histological

techniques (Humason 1972). Tissues were stained using Hemotoxylin and Eosin. Once the

slides were stained, sections through six intact thyroid follicles were analyzed. Briefly, tissue









slides from each individual were examined and the six largest intact thyroid follicles were

selected for analysis. Follicle diameter and epithelial cell height were measured. Four epithelial

cells were randomly selected form the chosen follicles and epithelial cell height was measured

from the basal membrane to the apical membrane. Follicle diameter was measured from the

apical membrane. Morphometric measurements were taken using Scion Image analysis

software. Data were analyzed using StatView software with a significance a = .05 (version 5.0;

SAS Institute Inc., Cary, NC, USA).

Isolation of RNA, Reverse Transcription and Northern Blots

Quantitative real time-PCR (Q-PCR) was performed to quantify mRNA expression levels

for ERu, ERP, AR, TRu,TRP, DI, D2, Arom, StAR, Tg, Tp and TSHr in neonatal thyroid and

gonadal tissues. The technique used was that which has been previously validated for alligator

tissues (see Katsu et al., 2004; Helbing et al., 2006).

In short, total RNA was isolated with an RNeasy kit (QIAGEN, Chatsworth, CA). First

strand cDNA synthesis was performed on 4 Clg total RNA using Super Script II RNase H-

Reverse Transcriptase (Invitrogen, Gaithersburg, MD) and oligo (dT)12-18 (Invitrogen,

Gaithersburg, MD) to reverse transcribe polyA+ mRNA. Primer annealing was carried out at

700C for 10 min, before reverse transcriptase was added. Conditions for first-strand synthesis

were 420C for 60 min, followed by 10 min at 700C. Primers for Q-PCR were designed from the

alligator coding sequences (Table 4-1). A sequence also was previously obtained for alligator P-

actin and ribosomal L8 for the purpose of normalization; primers designed based on alligator

sequences. Q-PCR was carried out in a BioRad MyiQ single color real-time PCR detection

system according to the manufacturer's protocol, with the exception that 15 CIL per well was









used. Q-PCR conditions were 2 min at 500C, 950C for 10 min and 40 cycles at 950C for 15 sec,

and 600C for 1 min. To normalize data, the mean Ct (threshold cycle) for ribosomal L8 was used

on the mean Ct of the genes of interest. Relative expression counts were calculated using the 2-

Mct method (Livak and Schmittgen 2001). Northern analysis was preformed using standard

techniques to determine quality of the mRNA prior to Q-PCR; gels were loaded with 20 Clg of

total RNA. Labeling of cDNA probes was achieved by random priming (Prime-It II, Stratagene,

La Jolla, CA) using (ATP-32P) dCTP (SA 3,000 Ci/mmol; New England Nuclear) according to

the manufacturer's protocol.

Gene Sequence and QPCR Primer Design

Several partial clones of the genes in the thyroid axis were created for this study. These

genes include deiodinases (D1,D2), thyroglobulin (Tg), thyroperoxidase (Tp), Pendrin (PEN)

and sodium-iodide symporter (NIS). There partial sequences can be found in appendix A. Using

the NCBI search browser a "protein search" was performed for candidate gene. Once a sequence

from an animal close to alligators on the phylogenetic tree was selected, candidate gene from

various animals close to alligators where selected. CLUSTALX program was used to align the

various sequences. Conserved regions with minimal degenerative sequences were selected for

the upstream and downstream primers. Forward and reverse sequences were created and sent to

Operon for degenerate primer creation. Degenerate primers were then used to get candidate gene

full sequence and to determine proper sequence for quantitative PCR primers. First,

degenerative primer PCR and gel electrophoresis was run to visualize if primer set was binding

and amplifying the correct DNA sequence but checking if the correct base pair length for the

primer set was seen in gel. Once correct band was visualized, the band was cut out of the gel and

QIAquick DNA gel extraction kit was used to extract the DNA from the gel. The protocol









described in the kit manual was used with slight modifications. The DNA from the gel was then

inserted into an E. coli vector through TA cloning. Petri dish cultures where made and clones

with the insert were picked up for culturing. After culturing, we used Wizard Plus SV Minipreps

DNA Purifieation System to extract DNA from the cell cultures. The "quick" centrifugation

protocol was used. The plasmid DNA was then checked for insert DNA through gel

electrophoresis. Once inserts where confirmed, samples were prepared for sequencing reactions.

After sequencing, ABI Prism software for Mac was used to remove vector inserts of SP6 and T7

from the produced sequence. Then GENETYX-MAC software was used to check sequence

homology and correct any unpaired nucleotide.

Results

Thyroid: In Ovo PTU Treatment

Relative expression of mRNA for ERu, ERP, TRu, TRP, DI, D2, TSHr, Tg, Tp, NIS and

PEN were analyzed using QPCR to determine whether sexual dimorphism or differences among

treatment groups existed. A 2-way ANOVA was performed on the genes of interest with sex and

treatment as independent factors. No statistically significant sexual dimorphism was observed in

thyroid tissue for mRNA expression of ERP, TRu, DI, Tg, and Tp. A statistically significant

difference in expression for Dl mRNA in males was observed between vehicle treatment and

high and low dose in ovo PTU treatment (p < 0.001). Sexual dimorphism was observed for

expression of Tp mRNA in the vehicle treatment groups (p < 0.001) but this pattern of sexual

dimorphism was lost with PTU treatment. TSHr mRNA expression in the thyroid tissue from

females displayed differences between vehicle treatment and high dose PTU exposure (p = 0.05)

whereas males displayed no differences following treatment. ERa mRNA displayed sexually

dimorphic expression in thyroid tissue in the vehicle control treatment (p = 0.045) that was lost










following in ovo PTU treatment (Fig. 4-3). Expression of ERa mRNA was significantly

increased in females following high dose PTU exposure in ovo (p = 0.011) whereas males

displayed differences following exposure to low dose (p = 0.046) and medium dose (p = 0.05)

PTU (Fig. 4-3). Sexual dimorphism was observed in the mRNA expression of D2 in vehicle (p =

0.007) and medium PTU exposed neonates (p = 0.029). Treatment with PTU in ovo had no

effect on D2 mRNA expression in females, however males exhibited statistically different

expression between vehicle and high dose (p = 0.028) and low dose (p = 0.045) PTU exposure

(refer to Fig. 4-4). NIS displayed a sexually dimorphic expression pattern in vehicle treated

thyroids (p = 0.001). No treatment effect was found for thyroids from females for NIS mRNA

expression. NIS mRNA expression in males displayed differences following PTU treatment

with low dose PTU exposed thyroids exhibiting different expression that either vehicle (p =

0.001) and medium dose (p = 0.009) treatment groups (Fig. 4-5). PEN mRNA expression

displayed sexual dimorphism following PTU exposure in ovo at all doses: low dose (p = 0.05),

medium dose (p = 0.05) and high dose (p < 0.001) (Fig. 4-6). Interestingly, this sexual

dimorphism is due to an increase in PEN mRNA expression in males, not females. No PTU

treatment effect was found in PEN for either males or females.

Thyroid: In Vivo after Neonatal Acute PTU Exposure

Relative expression of mRNA for ERu, ERP, TRu, TRP, AR, DI, D2, TSHr, Tg, Tp, NIS

and PEN were analyzed in thyroid tissue to determine whether sexual dimorphism or differences

between treatment groups existed. A 2-way ANOVA was performed on the expression levels of

genes of interest with sex and treatment as independent factors. No statistically significant

difference in treatment or sexual dimorphism was found in TRu, TRP, DI, Tg, and Tp. We did

observed statistically significant sexual dimorphism in D2 mRNA expression in the vehicle









treatment group (p = 0.022) (Fig. 4-7). Females showed differences between high PTU exposure

and either vehicle and medium dose (p = 0.05) treatments for D2 mRNA expression. Males

exposed to either high dose (p = 0.008) or low dose (p = 0.023) PTU exhibited differences in D2

mRNA thyroid expression. No sexual dimorphism was found in AR mRNA expression in the

neonatal thyroid (Fig. 4-8). When AR was examined following PTU treatment, males showed

differences between vehicle and high dose PTU treatment (p = 0.031) (Fig. 4.8). Females

displayed differences between control and all treatment groups: vehicle (p = 0.025), low dose (p

= 0.002), medium dose (p = 0.025) and high dose (p < 0.001) (Fig. 4-8). ERa mRNA expression

in the thyroid exhibited sexual dimorphism in vehicle treated animals (p = 0.016). ERa mRNA

expression also was difference in males when vehicle and medium PTU dose (p = 0.029)

exposed animals were compared. ERa mRNA expression in thyroid tissue from females were

different between controls and low, medium, or high dose (p = 0.001) PTU treatments as well as

between vehicle and low dose (p = 0.031) or medium dose (p = 0.047) PTU treatment (Fig. 4-9).

ERP also is expressed in a sexually dimorphic pattern in vehicle exposed thyroid tissues (p =

0.001). ERP expression in thyroids from females displayed differences between control and

vehicle treatments (p = 0.0331). Likewise, we observed that ERP expression in thyroids from

males was difference between control and low dose (p = 0.045), medium dose (p = 0.014) or

high dose (p = 0.011) PTU treatments as well as between vehicle and low dose, medium dose or

high dose (p < 0.001) PTU treatments (Fig. 4-10).

TSHr displayed a sexually dimorphic pattern in both control and high PTU treatment (p =

0.05) (Fig. 4-11). Females exhibited no change in TSHr mRNA expression with PTU treatment

whereas males treated with high dose PTU displayed a significant increase in TSHr expression in

the thyroid (Fig. 4-11). PEN was expressed in a sexually dimorphic pattern in thyroid tissue









obtained from non-treatment control animals as well as those exposed to the medium PTU dose

(p = 0.037). PEN had differences in females exposed to high PTU exhibited significantly

increased PEN expression compared to control (p = 0.026), vehicle (p < 0.001) or medium dose

PTU (p = 0.006) treatments. Likewise, a difference was observed between low dose PTU

treatment and vehicle (p = 0.03) in female thyroid tissue (Fig. 4-12). No sexual dimorphism was

seen in NIS mRNA expression except in those animals treated with high dose PTU (p = 0.05).

No treatment effect was seen in NIS mRNA expression in females whereas males exhibited

differences between high dose PTU and vehicle (p = 0.002) or medium dose (p = 0.042)

treatments as well as between vehicle and low dose (p = 0.034) treatment (Fig. 4-13).

Gonad: In Ovo PTU Exposure

Relative expression in gonadal mRNA for AR,ERot, ERP, StAR and Arom was analyzed

to determine whether sexually dimorphic patterns and differences between treatments existed. A

2-way ANOVA was performed on the mRNA expression of genes of interest with sex and

treatment as independent factors.

No sexual dimorphism was observed in AR mRNA expression in control or vehicle

exposed gonadal tissues whereas at low (p = 0.018), medium and high dose (p < 0.001) PTU

treatments pronounced sexual dimorphism in AR expression is observed (Fig. 4-14).

Interestingly, the pattern of AR expression changes creating this dimorphism (Fig. 4-14). For

example, AR expression in ovarian tissue increased with medium and high dose PTU exposure

in ovo when compared to controls (p = 0.009; p = 0.03, respectively) or vehicle (p < 0.001; p =

0.003, respectively) exposed tissues. AR mRNA expression in testicular tissue exhibited a

complex pattern with low dose exposure (p = 0.012) increasing AR mRNA expression whereas









high dose exposure significantly decreasing (p = 0.05) AR mRNA expression compared to

control or vehicle treated animals

Expression of ERa mRNA was sexually dimorphic in the gonadal tissue of vehicle (p =

0.05) exposed animals as well as in those exposed to the medium (p < 0.001) and high doses (p =

0.013) of PTU (Fig. 4-15). PTU treatment did not effect ERa mRNA expression in testicular

tissue. In contrast, ovarian ERa expression changed with PTU treatment at medium (p < 0.001)

and high (p = 0.005) doses compared to control and vehicle treatments. ERP mRNA expression

was also sexual dimorphic but only in those neonates exposed to the medium PTU dose in ovo (p

< 0.001) (Fig. 4-16). No treatment effect was found for ERP expression in males. In contrast,

ERP mRNA expression in the ovary changed with PTU treatment in ovo, as we observed

differences in ovarian expression between females exposed to medium PTU dose and control (p

= 0.039), vehicle (p = 0.005) and low dose (p = 0.022) as well as between vehicle and high dose

(p = 0.019) exposure. Expression of StAR mRNA displayed sexual dimorphism in controls (p =

0.032), as well as those treated with vehicle (p = 0.033), low (p = 0.01) and high dose PTU (p =

0.011) (Fig. 4-17). Treatment in ovo with PTU at medium ( p = 0.015) and high doses (p =

0.016) altered StAR mRNA expression in the testis with the medium dose depressing expression

and the high dose increasing expression over that of the control. In ovarian tissue obtained from

females exposed in ovo to PTU, treatment increased StAR mRNA expression following exposure

to medium (p < 0.001) and high (p < 0.001) doses. Control tissues exhibited a highly significant

pattern of sexual dimorphism in AROM mRNA expression, which was lost with exposure in ovo

to the vehicle (Fig. 4-18). AROM expression was sexual dimorphic in tissues obtained from

PTU treated animals at all dose: low dose (p < 0.012), medium dose (p = 0.007) and high dose (p










= 0.001) (Fig. 4-18). No treatment effects were found for AROM expression in either males or

female tissues.

Gonad: In Vivo after Acute PTU Exposure

Male gonadal samples for the quantitative RT-PCR were lost due to degradation and poor

mRNA quality, only ovary tissue were used and analyzed for this portion of the study. Relative

expression mRNA for AR, ERu, ERP, DI, D2, StAR, AROM was analyzed to determine

whether differences between treatments existed. A 1-way ANOVA was performed on the genes

of interest with treatment as the independent factor.

There were no treatment effects found for either StAR or AROM (figures not shown). AR

mRNA expression decreased following high dose PTU exposure (p = 0.033) (Fig. 4-19). In

contrast, treatment with PTU increased ERa mRNA expression following exposure to the high

dose (p = 0.007)(Fig. 4-20) whereas ERP mRNA expression increased following treatment with

either medium (p = 0.029) or high dose PTU (p = 0.014) (Fig. 4-21). Likewise, both deiodinases

responded to PTU treatment, with Dl mRNA expression increasing following high dose

exposure (p = 0.026) and (Fig. 4-22) as did mRNA expression for D2 (p = 0.003) (Fig. 4-23).

Discussion

We examined the potential role of thyroid hormones on the developing reproductive axis

of the American alligator. We focused on the potential effects of depressing this axis with a

pharmaceutical agent, PTU. This study examined both organizational effects with in ovo PTU

treatment during the window of sexual differentiation of the gonad in developing embryos as

well as activational effects with in vivo PTU treatment in neonates.









Thyroid

We examined gene expression for the same mRNAs in thyroids treated either in ovo and in

vivo in neonate, and found a number of interesting patterns. As reported in Chapter 3, thyroid

expresses mRNA for both ERs. ERa mRNA expression showed sexual dimorphism with

females exhibiting higher concentrations than males following in ovo treatment with a vehicle.

This dimorphism was lost with PTU treatment in ovo. Likewise, we observed that neonates

exhibited a similar dimorphism in the expression of mRNA for both ERs, that was lost following

acute treatment with PTU. Few studies have examined ER expression in the thyroid at any life

stage (Fujimoto et al. 1992; Giani et al. 1993; Kawabata et al. 2003), and we know of no studies

that have focused on steroid receptor expression in the thyroid of neonatal animals of any

species. What is intriguing is that this study examining 12-24 h old neonates (Chapter 3)

reported no sexual dimorphism in expression of either ER. However, in neonates 24-48 h old, a

clear sexual dimorphism exists that is lost if the thyroid axis is pharmacologically perturbed with

PTU. Two other genes, NIS and Tp examined, also exhibited sexual dimorphism in the vehicle

treatment group at birth, which was lost when neonates were exposed to PTU in ovo. These data

clearly demonstrate that our dosing altered the thyroid axis. In fact, we observed that all doses of

PTU in ovo altered the expression of PEN in males, inducing a sexually dimorphic pattern that

did not exist in vehicle treated hatchlings. Acute exposure to PTU in 14 day old neonates also

altered gene expression profiles in the thyroid. We observed a sexually dimorphic pattern of

mRNA expression for ERu, ERP and D2 in the neonatal thyroid that was lost with acute

treatment with PTU. In contrast, thyroid tissue from male neonates all showed an increase in

TSHr, NIS and PEN following PTU exposure. Tp and NIS have been observed to increase

activity in the thyroid of female rats exposed to E2, Suggesting a possible dimorphic pattern










(Lima et al. 2006). Also, in a study from the Netherlands measuring anti-Tp antibodies in a

human population observed 8.6% males and 18.5% females had the anti-TP antibodies

(Hoogendoorn et al. 2006). The presence of Tp antibodies was associated with abnormally high

and low TSH concentrations and thyroid disorders.

One of the main questions we addressed with the current studies was to determine if

altering the thyroid axis altered markers of the reproductive axis, such as steroid hormone

receptors. Few studies directly examine the role of sex steroids on the thyroid and yet, this study

and others have shown that the thyroid expresses sex steroid receptors (Chapter 3; Fujimoto et al.

1992; Giani et al. 1993; Kawabata et al. 2003). Current studies have shown that disruption of

thyroid hormone synthesis in ovo alters the mRNA expression patterns for ERa in male and

female thyroids. As predicted, various markers of thyroid function were altered such as TRu,

Di, D2 and Tp expression in male thyroid tissue and yet the same pattern was not observed in

thyroids removed from neonatal females treated with PTU in ovo. The basis for this difference

in response is not obvious at this time, unless incubation temperature, cooler for females, could

potential alter how the thyroid axis responses to PTU treatment, given that thyroid hormones are

central to the regulation of metabolism (Blaxter 1988; Stevens et al. 1995; Norris 1997). We

should note that we did see effects in the female, as expression for ERu, TSHr and Tp all

exhibited a decrease in expression with in ovo PTU exposure. However, this initial study clearly

demonstrates for the first time that steroid hormone receptor expression in the thyroid, at least

estrogen receptor expression, is regulated in part by the thyroid axis.

This conclusion is further supported by our data from the acute PTU exposure study. We

observed that ERa and ERP mRNA expression decreased significantly in the thyroid obtained

from males following PTU exposure. Interestingly, contrary to that observed with in ovo










treatment, females treated in vivo with PTU responded with an increase in the expression of ERa

and ERP. Again, these data provide support for the hypothesis that the thyroid axis appears to

regulate the expression of ER in thyroid tissue. These data, along with data from Chapter 3,

demonstrating mRNA and protein for ER are present in the thyroid indicate that significantly

more work is needed to address the regulation of ER expression and its role in the thyroid. For

example, a study examining whether ER expression varies seasonally in the thyroid coincident

with changes in plasma T3 and T4 COncentrations is needed.

In addition to changes in ER expression, we observed that in vivo treatment altered the

expression of many of the markers of the thyroid axis, such as increased expression of TRa, D2,

Tp and PEN in thyroid tissue from females and TSHr, NIS and PEN in male tissue. These data

provide support that our doses were capable of altering thyroid hormone regulation and

presumably feedback to the thyroid. A large literature exists in mammals demonstrating that

PTU can alter many components of the thyroid axis (Moriyama et al. 2007; Gilbert and

Paczkowski 2003; Diav-Citrin and Ornoy 2002 for review). However, similar studies are rare in

wildlife and no previous study has examined this system in alligators. Further studies need to

address the functioning of the thyroid axis following PTU treatment in vivo and in ovo by

examining changes in circulating T4 aS well as other genes that are regulated by this axis.

Gonads

As we reported above, one aspect of this work was to address whether an alteration of the

thyroid axis altered thyroid biology. We were also interested to determine of changes in thyroid

physiology, following PTU exposure altered gonadal biology as well. The gonad of males and

females express both ERs as well as the ARs. Likewise, they are steroid producing organs and

thus, have the enzymes and proteins required for steroidogenesis. We noted that ERa mRNA










expression displayed a sexually dimorphic pattern with testicular tissue having higher levels than

that observed in ovarian tissue. However, following in ovo PTU treatment, mid and high dose

treatment induced a reversal. Expression of ERP mRNA was not dimorphic in vehicle treated

animals but following the mid PTU treatment in ovo it was dimorphic with females expressing

greater levels. Similar complex responses were seen for StAR and the AR. In fact, the

expression of the androgen receptor was decreased in testicular tissue following high dose PTU

in ovo whereas it was increased in ovarian tissue. Previous studies have shown that altering the

thyroid axis dramatically alters testis biology (Cooke et al. 2004; Jannini et al. 1995; Cooke et al.

1991). Manipulation of the thyroid environment can be used to produce increases in testis size,

Sertoli cell number, and sperm production (Cooke et al. 2004). Neonatal hypothyroidism is

shown to impair testicular development (Jannini et al. 1995). However, hypothyroidism in

neonatal rats, which is followed by a recovery to euthyroidism, leads to an increase in testis size

and daily sperm production in adult rats (Cooke et al. 1991). Cooke et al. (1994) state that it

appears T3 HOrmally inhibits Sertoli cell proliferation directly while stimulating differentiation.

These actions are observed in neonatal hypothyroid animals. Developmental hypothyroidism

and an increase in adult testis size is not solely described in rats but also in mice (Joyce et al.

1993), humans (Jannini et al. 2000), bulls (Majdic et al. 1998), roosters (Kirby et al. 1996) and

fish (Matta et al. 2002).

In contrast, little is known about the ovarian response to altered thyroid physiology during

the developmental or neonatal periods. Thyroid hormones at proper levels are necessary for

ovulation (Maruo et al. 1992). Doufas and Mastorakos (2000) demonstrated that severe

hypothyroidism can cause ovarian atrophy and amenorrhea. TRs are found in various parts of

the ovary such as granulosa cells (Maruo et al. 1992; Zhang et al. 1997), oocytes and cumulus










cells of the follicle (Zhang et al. 1997), and corpora lutea (Bhattacharya et al. 1988), indicating

that thyroid hormones can play a role in various cells of the ovary. The mechanisms of action

are still not well understood.

We do know that hypothyroidism is associated with reduced fertility and the likelihood

that a woman can not carry an infant to term (Buhling et al. 2007; Krassass 2000). Our data

suggest that like the developing testis, the developing ovary is likely a target of the thyroid axis.

Moreover, given the differential response to PTU treatment seen on testicular and ovarian tissues

following in ovo or in vivo PTU treatment, it is unlikely that we can predict the ovarian response

based on previous studies of the testis. For example, we noted that acute in vivo treatment with

PTU increased AR mRNA expression at low doses and depressed expression at high doses. In

contrast, PTU treatment in vivo, and thus a likely drop in thyroid hormone action induced an

increased in ovarian mRNA expression for the AR, both ERs and StAR. Recently, it was

demonstrated that thyroid hormones influence StAR. Lack of thyroid hormone causes a down

regulation of StAR mRNA and protein (Manna et al. 2001b). Clearly, much further work is

needed to examine the potential interaction between the developing thyroid and reproductive

sy stem s.

Summary

We predicted by blocking the thyroid with PTU during the temperature dependant sexual

differentiation period of the alligator embryo, an alteration in the development of the testis or

ovary and change in gene expression. We also predicted a change in gene expression on both

gonad and thyroid tissue treated with PTU as neonates. Both predictions appear to be supported

by these data.










In the thyroid we find that both ERa and D2 show a similar pattern suggesting influence

by estrogens on D2 expression. We also note that ERP may not play as large of role during

embryonic development and increases in function as neonate. AR data suggest that this might be

a regulatory mechanism on the thyroid. Both NIS and PEN appear to be good candidate genes

for regulation of the thyroid axis via sex steroids.

In the gonad, we find changes in gene expression caused by depressing the thyroid axis.

AR shows possible organization changes from the in ovo PTU series. ERa and ERP also appear

to be influenced by treatment, especially in females. This trend is followed in AROM and StAR

as well suggesting up regulation of the steroidogenic pathway in the ovary when thyroid is

depressed.










Table 4-1: Primers used for quantitative real-time RT-PCR as markers for thyroid and gonad
physiology in the American alligator (A. mississippiensis). Primer source are novel
creations unless stated. Abbreviations represent the genes as follows: androgen
receptor (AR); aromatase (Arom); deiodinases type 1, 2 (DI, D2); estrogen receptors
a,p (ERu,P); ribosomal house keeping gene (L8); sodium-iodide symporter (NIS);
pendrin (PEN); steroidogenic acute regulatory protein (StAR); thyroglobulin (Tg);
thyroperoxidase (Tp); thyroid hormone receptors a,p (TRaP); and thyrotropin
receptor (TSHr).
Quantitative Real-Time RT-PCR Primers
Gene Primer 5' to 3' Source
D TGTGTTCAGGC CATGACAACA Gunderson et al. 2006
AR
U GCCCATTTCACCACATGCA
D CAGCCAGTTGTGGA CTTGATCA Kohno, unpublished data
Arom
U TTGTCCCCTTTTTCACAGGATAG
D CCACAACAACTGGGCATAAGGG
D1
U GCTCATGCAACAGACGGATGG
D CTGCCAC CACTGATGC CATTG
D2
U CTGCGTTGCGTCTGGAATAGC
D AAGCTGCCC CTTCAACTTTTTA Katsu et al. 2004
ERO
U TGGACATC CTCTCC CTGCC
D AAGACCAGGCGCAAAAGCT Katsu et al. 2004
ERO
U GCGACATTTCATCATTCCCAC
D ACGACGCAGCAATAAGAC Katsu et al. 2004
L8
U GGTGTGGCTATGAATCCT
D CTCGGGAGTGGTTGTACG
NIS
D AGGTGTTCGTGATGCTCTC
D TCACCACAACTGTCAGTAATC C
PEN
U TCATGCAGGTATGTGATGTTCC
D GTTGGACCGCGAGATTTTGT Kohno, unpublished data
StAR
U TGTTGAGC CGCGTCTCTTAGT
D ATCCCTTCTGAGTCCACACACC
Tg
U AGCAGCACCATCTCCTACATC
D AATGAAAGCACTGAGGGAAGG
Tp
U AGCATCAACTGGCACTTCTG
D CAGAAGTGGGGAATGTTGTG Helbing et al. 2006
TRO
U TGCCAAAAAACTGCCCAT
D GTCTCACTCTCGGGGTCATA Helbing et al. 2006
TRO
U CACAAGGAAGCCACTGGAA
D TTGTGAAC CTC CTTGCCATCC
TSHr
U GCAGAAGTCGGCGAAGGC





Figur 4-1 Thyoid xis f th Ameicanalliator Allgato misissipienis. he tyroi is
biloedorannete vntaly o hetrahai h i-hotrgo.Tefntoa
untiste hrid olce ubr rersnt;?C~ enpits ntyodfnto n
physiology: 1) estrogen receptors 2,0 2) anrognrcpo;3 hri omn




receptos 2,0;4) thyrtropinreceptr; )didnse ,2 )soimidd
symporer; 7)clorid-iodid c-rnprter; 8) t'hyrgoui;9tyoeoiae









rc~p~sl


Figure 4-2: Gonad axis of the American alligator, Alligator mississippiensis. The gonads are one
the primary sites for steroidogenesis. A basic steroidogenic pathway is depicted.
Numbers represent endpoints in gonad function and physiology: 1) estrogen receptors
a, ; 2) androgen receptor; 3) thyroid hormone receptors a,P; 4) thyrotropin receptor;
5) steroidogenic acute regulatory protein; 6) aromatase; 7) deiodinases 1, 2.
C=cholesterol
















2.0-








0] .5 -






0.0


Vehicle Low Medium High



Figure 4-3: Estrogen receptor alpha (ERu) mRNA gene expression from in ovo PTU treatment in
thyroid tissue from the American alligator, A. mississippiensis. Genes were
normalized to ribosomal L8 and relative expression counts were calculated using the
2-aact method. Error bar represents 1 standard error from mean. Statistically
significant (a = 0.05) sexual dimorphism depicted by an asterisk (*). Different
capital letter characters signify statistically different means in females and lower case
letter characters signify statistically different means in males.













I Male b49

bce


3-








a,c I a,b




Vehicle Lowv Medium High



Figure 4-4: Deiodinase type 2 mRNA gene expression from in ovo PTU treatment in thyroid
tissue from the American alligator, A. mississippiensis. Genes were normalized to
ribosomal L8 and relative expression counts were calculated using the 2-act method.
Error bar represents 1 standard error from mean. Statistically significant (oc = 0.05)
sexual dimorphism depicted by an asterisk (*). Different lower case letter characters
signify statistically different means in males.














I Male


5-11











Veil LwMdimHg

Figur 4-:Sdu-oiesmotr(I)mN eeepeso rmi v T ramn









Figure 2-5. c Simethod.d Errpor br epresents 1 standard exrrssor from men.ooT Saitically


significant (oc = 0.05) sexual dimorphism depicted by an asterisk (*). Different lower
case letter characters signify statistically different means in males.










10

I Male -




















Vehicle Low Medium Hig h


Figure 4-6: Pendrin (PEN) mRNA gene expression from in ovo PTU treatment in thyroid tissue
from the American alligator, A. mississippiensis. Genes were normalized to
ribosomal L8 and relative expression counts were calculated using the 2-act method.
Error bar represents 1 standard error from mean. Statistically significant (oc = 0.05)
sexual dimorphism depicted by an asterisk (*).



















L.. 2.0


LlJ
a.b


1.0




0.5-A


0.0
Control Ve hicle Low Mred ium High


Figure 4-7: Deiodinase 2 (D2) mRNA gene expression from in vivo PTU treatment in thyroid
tissue from the American alligator, A. mississippiensis. Genes were normalized to
ribosomal L8 and relative expression counts were calculated using the 2-act method.
Error bar represents 1 standard error from mean. Statistically significant (oc = 0.05)
sexual dimorphism depicted by an asterisk (*). Different capital letter characters
signify statistically different means in females and lower case letter characters signify
statistically different means in males.













12 0 Ivale -


*10-








~~1 C






Control Vehicle LowJ Medium High


Figure 4-8: Androgen receptor (AR) mRNA gene expression from in vivo PTU treatment in
thyroid tissue from the American alligator, A. mississippiensis. Genes were
normalized to ribosomal L8 and relative expression counts were calculated using the
2-aact method. Error bar represents 1 standard error from mean. Different capital
letter characters signify statistically different means in females and lower case letter
characters signify statistically different means in males (oc = 0.05).













I Male


6-B
C




2 A.B



I, b


Control Vehicle Low Medium High


Figure 4-9: Estrogen receptor alpha (ERu) mRNA gene expression from in vivo PTU treatment
in thyroid tissue from the American alligator, A. mississippiensis. Genes were
normalized to ribosomal L8 and relative expression counts were calculated using the
2-aact method. Error bar represents 1 standard error from mean. Statistically
significant (a = 0.05) sexual dimorphism depicted by an asterisk (*). Different
capital letter characters signify statistically different means in females and lower case
letter characters signify statistically different means in males.




















CL A,B
j 3-1 A a



A,B b






Control Ve hicle Low Med ium High


Figure 4-10: Estrogen receptor beta (ERP) mRNA gene expression from in vivo PTU treatment
in thyroid tissue from the American alligator, A. mississippiensis. Genes were
normalized to ribosomal L8 and relative expression counts were calculated using the
2aact method. Error bar represents 1 standard error from mean. Statistically
significant (oc = 0.05) sexual dimorphism depicted by an asterisk (*). Different
capital letter characters signify statistically different means in females and lower case
letter characters signify statistically different means in males.



























1 a~b






Control Vehicle Low M~ediurn High


Figure 4-11: Thhyrotropin receptor (TSHr) mRNA gene expression from in vivo PTU treatment in
thyroid tissue from the American alligator, A. mississippiensis. Genes were
normalized to ribosomal L8 and relative expression counts were calculated using the
2-aact method. Error bar represents 1 standard error from mean. Statistically
significant (oc = 0.05) sexual dimorphism depicted by an asterisk (*). Different lower
case letter characters signify statistically different means in males.

















U] B,D


(n I
r~ a C D



A.C

A.C



Control Ve hicle Low Mred ium High


Figure 4-12: Pendrin (PEN) mRNA gene expression from in vivo PTU treatment in thyroid tissue
from the American alligator, A. mississippiensis. Genes were normalized to
ribosomal L8 and relative expression counts were calculated using the 2-act method.
Error bar represents 1 standard error from mean. Statistically significant (oc = 0.05)
sexual dimorphism depicted by an asterisk (*). Different capital letter characters
signify statistically different means in females and lower case letter characters signify
statistically different means in males.


















fi V II bbcc

e! 4 -a,b,c







a,c
1r -I I a,c



Control Vehicle Low Medium High


Figure 4-13: Sodium-iodide symporter (NIS) mRNA gene expression from in vivo PTU
treatment in thyroid tissue from the American alligator, A. mississippiensis. Genes
were normalized to ribosomal L8 and relative expression counts were calculated
using the 2-Mct method. Error bar represents 1 standard error from mean.
Statistically significant (oc = 0.05) sexual dimorphism depicted by an asterisk (*).
Different lower case letter characters signify statistically different means in males.




















ac ac



Q8b








Control Vehicle Low Medium High



Figure 4-14: Androgen receptor (AR) mRNA gene expression from in ovo PTU treatment in
gonad tissue from the American alligator, A. mississippiensis. Genes were
normalized to ribosomal L8 and relative expression counts were calculated using the
2-aact method. Error bar represents 1 standard error from mean. Statistically
significant (oc = 0.05) sexual dimorphism depicted by an asterisk (*). Different
capital letter characters signify statistically different means in females and lower case
letter characters signify statistically different means in males.













0 Male B*



o4-
u, B,CA






A,C
A,C
1CI AC




Control Vehicle Low Medium High



Figure 4-15: Estrogen receptor alpha (ERu) mRNA gene expression from in ovo PTU treatment
in gonad tissue from the American alligator, A. mississippiensis. Genes were
normalized to ribosomal L8 and relative expression counts were calculated using the
2aact method. Error bar represents 1 standard error from mean. Statistically
significant (a = 0.05) sexual dimorphism depicted by an asterisk (*). Different
capital letter characters signify statistically different means in females.











5 -

9 B,C





I~i I
0 a, 2 -1 I I


Control Vehicle Low Medium High


Figure 4-16: Estrogen receptor beta (ERP) mRNA gene expression from in ovo PTU treatment in
gonad tissue from the American alligator, A. mississippiensis. Genes were
normalized to ribosomal L8 and relative expression counts were calculated using the
2-aact method. Error bar represents 1 standard error from mean. Statistically
significant (oc = 0.05) sexual dimorphism depicted by an asterisk (*). Different
capital letter characters signify statistically different means in females.












18-*
0 Male cG

16

C- 14-







4 .t ~


w 0
Conro Veil Lw Mdim Hg










Diferntcaitl leterharcter signif sttsiclydiffeen mensinemlsn




lowferen caseta letter characters signify statistically different means in males. an














50-










20 -0








Control Vehicle LowI Medium High


Figure 4-18: Aromatase (AROM) mRNA gene expression from in ovo PTU treatment in gonad
tissue from the American alligator, A. mississippiensis. Genes were normalized to
ribosomal L8 and relative expression counts were calculated using the 2-act method.
Error bar represents 1 standard error from mean. Statistically significant (oc = 0.05)
sexual dimorphism depicted by an asterisk (*).
















4- -









AB








Control Vehicle Low Mnedium High



Figure 4-19: Androgen receptor (AR) mRNA gene expression from in vivo PTU treatment in
ovary tissue from the American alligator, A. mississippiensis. Genes were normalized
to ribosomal L8 and relative expression counts were calculated using the 2-act
method. Error bar represents 1 standard error from mean. Different capital letter
characters signify statistically different means in females (oc = 0.05).
















2.5 -I
A.B

,9 2.0-
u, A


Li 1.5-






0.5-




Control Vehicle Low Medium High




Figure 4-20: Estrogen receptor alpha (ERu) mRNA gene expression from in vivo PTU treatment
in ovary tissue from the American alligator, A. mississippiensis. Genes were
normalized to ribosomal L8 and relative expression counts were calculated using the
2-Act method. Error bar represents 1 standard error from mean. Different capital
letter characters signify statistically different means in females (a = 0.05).
















2.0 B

c= A, B









0. I I I A,
Coto eil o eim Hg


Fiue42:Etoe eetr ea(R)mN eeepesinfo nvv T ramn








Figue 42-A.c method.n rError bear repreet 1N standard exrrsor from men. DifferPUteentcail


letter characters signify statistically different means in females (oc = 0.05).


















o AB



9! A









Control Vehicle Low Medium High



Figure 4-22: Deiodinase type 1 (DI) mRNA gene expression from in vivo PTU treatment in
ovary tissue from the American alligator, A. mississippiensis. Genes were normalized
to ribosomal L8 and relative expression counts were calculated using the 2-act
method. Error bar represents 1 standard error from mean. Different capital letter
characters signify statistically different means in females (oc = 0.05).






















S2-
co A
a, A







Control Vehicle Low Medium High



Figure 4-23: Deiodinase type 2 (D2) mRNA gene expression from in vivo PTU treatment in
ovary tissue from the American alligator, A. mississippiensis. Genes were normalized
to ribosomal L8 and relative expression counts were calculated using the 2-act
method. Error bar represents 1 standard error from mean. Different capital letter
characters signify statistically different means in females (oc = 0.05).









CHAPTER 5
SUMMARY OF RESULTS

Introduction

This manuscript examined the thyroid/gonad axis of the American alligator. We

investigated two maj or areas of thyroid/gonad activity; the affect of the thyroid axis on the

development of the gonad and a mechanism of communication between the thyroid and gonad

axes. In particular, the role of the thyroid axis in the development and functioning of the gonad

during the neonatal and peripubertal periods was investigated. Developmental studies focused on

gonadal differentiation and development following exposure to an antithyroid-agent during the

window of sexual differentiation. In the studies of adolescent alligators, we described normal

physiology and morphology of the thyroid/gonad axis as well as how these respective organs

respond to hormonal challenges. Does the thyroid axis influence seasonal reproductive hormone

variation? We also described a novel mechanism of communication between the thyroid and

gonad axes. This mechanism included the characterization of ER and AR receptors on the

thyroid follicle as well as expression levels of these receptors to manipulations. We proposed to

test several hypotheses stated below.

* Hypothesis 1: Plasma thyroxine concentrations display seasonal variation that parallels
seasonal variation in sex steroid concentrations, not seasonal activity patterns.

* Hypothesis 2: ER, AR and TR expression on the thyroid will vary among life stages and
show sexual dimorphism.

* Hypothesis 3: Treatment of the thyroid with PTU will alter gene expression on the gonad to
genes related to gonad physiology.

* Hypothesis 4: By blocking the thyroid with PTU during the temperature dependant sexual
differentiation period of the alligator embryo, we predict an alteration in the development of
the testis or ovary.









In addition, Chapter one began to elucidate on questions regarding the hypothalamus-

pituitary-thyroid-gonad (H-P-T-G) axes of regulation. Collaboration with professor Caren

Helbing, University of Victoria, has recently produced cloned TRa and TRP2 fTOm the American

alligator. Using quantitative RT-PCR (Q-PCR), we have observed that both TRa and TRP2 aef

expressed in the gonads of juvenile alligators (Helbing et al. 2006), with greatly elevated levels

of TRP2 relative to TRu. Further, there appears to be a differential response to TSH treatment,

with no effect on TRP2 mRNA after treatment, but elevation of TRa mRNA levels in the testis

but not the ovary. These data suggest that, like the rodent gonad, cells in the alligator gonad

express TR, suggesting that this tissue is responsive to the actions of thyroid hormones. We also

answer whether TSH has an effect on the gonad (Fig. 5-1). We find that TSH up-regulates TR

mRNA expression in the gonad, possibly through stimulation of the thyroid.

Seasonal Thyroxine Variation

In Chapter 2, we addressed hypothesis 1: whether or not plasma thyroxine concentrations

display seasonal variation that parallels seasonal variation in sex steroid concentrations, not

seasonal activity patterns. We observed that juvenile American alligators display seasonal

variation in circulating T4 COncentrations. Further, comparing the seasonal pattern observed in

plasma concentrations of T4 with the seasonal patterns in other hormones, such as T and E2 we

find that the thyroxine follows a similar pattern of variation to sex steroids in juvenile alligators.

We hypothesized that thyroid hormones could play a cooperative role with T and E2 in jUVenileS,

helping stimulate important events in puberty. We demonstrated that a relationship exist between

the thyroid axis and the gonad axis. The relationship found with circulating levels of thyroxine

and sex steroids led us to ask how are the thyroid and gonad axes communicating with one

another?









Characterization of ERs on the Thyroid

In Chapter 3, we addressed hypothesis 2: ER, AR and TR expression on the thyroid will

vary among life stages and show sexual dimorphism. The thyroid axis may have a role in

regulating the gonads and vice versa. Sex steroid receptors on the thyroid are thought to be

nuclear receptors, which regulate target gene expression involved in metabolism, development,

and reproduction (McKenna and O-Malley, 2001). The role that these sex steroids and their

receptors play in the regulation of the thyroid is not currently well understood.

This study demonstarted that mRNA for both forms of the ER, both forms of TR and AR

are found on the thyroid of the American alligator (A. mississippiensis). No sexual dimorphism

was observed in the mRNA expression of these genes in the thyroid tissue examined. However,

the presence of sex steroid receptors provides a potential mechanism by which gonadal steroids

could influence thyroid development and function. This also brings insights to how the gonad

axis communicated back to the thyroid axis via the H-P-T-G axes (Fig. 5-1). This is the first

study to describe ERs in the thyroid of a none-mammalian species and to characterize the

expression with mRNA expression and protein expression. Further studies are required to

determine if such a regulatory pathway exists via ERs in the thyroid.

PTU Exposure in the Thyroid and Gonad

Hypothesis 3 and 4 are addressed in Chapter 4. Treatment of the thyroid with PTU does

alter gene expression on the gonad to genes related to gonad physiology (hypothesis 3). Also, by

blocking the thyroid with PTU during the temperature dependant sexual differentiation period of

the alligator embryo, we observed organization changes in mRNA expression in the thyroid,

testis or ovary.

In the thyroid we find that both ERoc and D2 show similar patterns suggesting that D2

could potentially, be influenced by estrogens. We also noted that ERP may not play as large of









role during embryonic development and increases in function as neonate. AR data suggest that

this might be a regulatory mechanism on the thyroid. Both NIS and PEN appear to be good

candidate genes for regulation of the thyroid axis via sex steroids.

In the gonad we found changes in gene expression caused by depressing the thyroid axis.

AR shows possible organization changes from the in ovo PTU series. ERoc and ERP also appear

influenced by treatment, especially in females. This trend is followed in aromatase and StAR as

well suggesting up regulation of the steroidogenic pathway in the ovary when thyroid is

depressed. Results for mRNA expression in the thyroid or gonad are summarized in figures

below. PTU in ovo sexual dimorphism and treatment effects in thyroid tissue for males or

females are displayed in Figs. 5-2, 5-3 and 5-4 respectively. PTU in vivo sexual dimorphism and

treatment effects in thyroid tissue for males or females are displayed in Figs. 5-5, 5-6 and 5-7

respectively. Figure 5-8 displays PTU in ovo sexual dimorphism in gonad tissue. PTU in ovo

treatment effects in gonad tissue for males or females is displayed in Fig. 5-9. PTU in vivo

treatment effects in gonad tissue for females are displayed in Fig. 5-10.

We examined the potential role of thyroid hormones on the developing reproductive axis

of the American alligator. We focused on the potential effects of depressing this axis with a

pharmaceutical agent, PTU. This study examined both organizational effects with in ovo PTU

treatment during the window of sexual differentiation of the gonad in developing embryos as

well as activational effects with in vivo PTU treatment in neonates. Further work is necessary to

elucidate the mechanisms involved in the regulation of the thyroid from the gonad. These

studies provide a good foundation to begin to understand the interactions between the thyroid

and gonadal axes.










































Figure 5-1: Thyroid-gonad axis of regulation revisited. TSH secreted from pituitary has
stimulatory role on thyroid and gonad. FSH secreted from pituitary has stimulatory
role on gonads. Estradiol secreted from gonads plays an inhibitory role in pituitary
on FSH secretion. Estradiol possibly plays a regulatory role on thyroid.




























SMalla= = Famnala~ > IMala >
Femsal Male Femaale
Figure 5-2: In Ovo PTU mRNA expression of genes analyzed via QPCR in thyroid tissue of
juvenile American alligators (A.mississippiensis). This graphic represents whether
sexual dimorphism existed.

G~ene Vehicle Law PTU M~ediurn PTU High PTU


ERB
TRa
TrRB


D~2

Tg


NIS
PEN




Figure 5-3: In Ovo PTU mRNA expression of genes analyzed via QPCR in thyroid tissue of
male juvenile American alligators (A .mississippiensis). This graphic represents
whether treatment effects existed. Intermediate expression not statistically different
from either vehicle or treatment represented by fade effect.











Gjene Vehicle LawN PT;U Mediurn PTU High PTU
ERa

ERB
"TRa~
TR|$
D2
TSHr




NIS
PEN





Figure 5-4: In Ovo PTU mRNA expression of genes analyzed via QPCR in thyroid tissue of
female juvenile American alligators (A .mississippiensis). This graphic represents
whether treatment effects existed. Intermediate expression not statistically different
from either vehicle or treatment represented by fade effect.






























M alla = Famalnr > Mnla >
Female Ma e Femnale


Figure 5-5: In Vivo PTU mRNA expression of genes analyzed via QPCR in thyroid tissue of
juvenile American alligators (A.mississippiensis). This graphic represents whether
sexual dimorphism existed.










Gene Vehicle Low PTU Mediurn PTU High PTU


TRa.


TRB
AR
01


"TSHr

Tg
Tp
NIS
PEN





Figure 5-6: In Vivo PTU mRNA expression of genes analyzed via QPCR in thyroid tissue of
male juvenile American alligators (A .mississippiensis). This graphic represents
whether treatment effects existed. Intermediate expression not statistically different
from either vehicle or treatment represented by fade effect.


































Figure 5-7: In Vivo PTU mRNA expression of genes analyzed via QPCR in thyroid tissue of
female juvenile American alligators (A .mississippiensis). This graphic represents
whether treatment effects existed. Intermediate expression not statistically different
from either vehicle or treatment represented by fade effect.




















SMala = Famanl~ Min n>
Female Ma e Female

Figure 5-8: In Ovo PTU mRNA expression of genes analyzed via QPCR in gonad tissue of
juvenile American alligators (A.mississippiensis). This graphic represents whether
sexual dimorphism existed.

Mal
Gene Vehicle LowN PTU Medi[um PTU High PTU
ERa

E R)
AR
StAR
AROM




Gene V~ehicle Low PTU Medium PTU High PTU
ERar


AR
StAR
AROIM





Figure 5-9: In Ovo PTU mRNA expression of genes analyzed via QPCR in gonad tissue of
juvenile American alligators (A.mississippiensis). This graphic represents treatment
effects existed in males or females.










Femal
Gene Vehicle Low PTU iiMedium PTU High PTU
ERa
EAB
AR
01


StAR
AROMI




Figure 5-10: In Vivo PTU mRNA expression of genes analyzed via QPCR in gonad tissue of
female juvenile American alligators (A .mississippiensis). This graphic represents
whether treatment effects existed. No males mRNA expression was examined.















Table A-1: Immunohistochemistry staining protocol for ERu. Both the Vector Elite IHC kit and
the ER-a antibody were obtained from the Santa Cruz Biotechnology Inc. (Santa
Cruz, California n.
DAY ONE SLUTION TM

Citrisolve X2 for 5 min, 100% EtOH X2 for 5 min, 95% EtOH for 5
Dparaffinize and hydrate mi.Wash in deionized H20 for 1 min with stirring 30 min
0.02M Citrate Buffer (pH 6.0); Microwave (>7000W)- High 3 min,
Unmask antigens Meim3 min, Low 3 min, and cool to room temp ~20 min 35 min
Rinse PS 2-3 times
Pap pen Wipeawa excess liquid around the sections and circle dy1-2 min
SokPS 5min
Block enoeosprxidase 3% HyrgnPeroxide 30min
Ris BS 2min
Block nrmal ot serum (~20 pl 0min
AsiaeAprate serum from slides >1min
Piayantibody (dilute 1:400 with normal goat serum); negative Ovr night at
Icbate cotol4

DAY TWO SLUTION TM

Rinse PBS 2min

Incubate Scndary Antibody (~20 pl 0 min

Ris BS 2min

Icbate Prxidase reagent (~20 C1l) 30 min

Rinse PBS 2min
Ina mixing bottle, add 1.6 mL of deionized water, 5 drops 10X substrate
buffer, 1 drop 50X DAB chromagen, and 1 drop 50X peroxidase
Make HRP substrate sbstrate

Visualize HP substrate (1-3 drp)8min

Rneand wash ionized water 2min
etaosdhydrate (2X 95% -10 sec; 2X 100% 10 sec; Citrisolve until
Hydrate and mount hunting with Permount


APPENDIX A
APPENDIX STAINING PROTOCOL FOR ERa IHC









APPENDIX B
APPENDIX PARTIAL SEQUENCES FOR CLONED THYROID GENES

NIS Sodium-lodide Symporter 180/2,070 bp 8.7%
3-5
TGGACTGATGTGTTTCAGGTGTTCGTGATGCTCTCCGGGTTGCCAGCTC
AGGGCACGTTGATGGTGGGAAGCCCCGGAGGGGTCCTGGGCCGTAACC
TCCCGAGTGAACTTTGCTGACTTCGACCCCGACCCCCGGAGCGTCCTCG
ACCTTCGTA
5-3
TACGAAGGTCCAGAAGGTGTAGCGGCTCCGGGTGGGGTCGAAGTCGAAG
TCACTCGGGAGTGGTTGTACGCGGCGCCCAGGACCCCTCCGGGTCCCAC
ACGTGCCCTGGATGGCGATGGCGACGAACCCGGGAGCACCAACACTGAA
ACATCAGTCCA
PEN Pendrin 780/2,349 bp 33.2%
5-3
AATCAGGAGTTTATTGCATTTGGGATCAGCAATGTGCTTTCGATTTCGT
TTGTTGCTACAACTGCACTTTCACGTACTGCTGTCCAGGAAACCGTGAA
CTCAGGTTGCTGGCCTAATCTCAGCTGGGATTGTTATGATTGCTGTNCG
GGAAATTGCTAGAGCCCTTGCAAAAGTCTGTGTTGGCAGCTGTTATCAC
TGAAAGGGATGTTCATGCAGGTATGTGATGTTCCCAGATTGGACGATG
GTGGATGCTATGATCTGGGTTTTCACATGTGTGGCATCCATACGGCCAT
TGGGATTACTTGCTGGCCCTGTGTTTGGATTACTGACAGTTGTAATCAT
TCCTTCTTGGGGTGGCCTTGGGAACGTTCCTGGCACAGATCTTTAATTA
GGAATACAAAAATGTTGTTGAACCACAAGGTGTGAAGATTCTCGTTCGC
TATTTTTTATGCCAATATCGATGGATTGAAAAGCAGCCTCATCCGGGTT
GAT GCAGT TAGGGTATACAACAAGAGAC TCAAAGCAC TAAGAAAGATAC AGAAAC T
AATCAAGAAGGGGAAGTTGAAAGCAACTAAGAATGGTATCACGATTGG
TTGCAAATGAAGCTTTTGAGCCTGATGAAGATCCAGAAGAGCAGTTGA
ATTCCAACTAGAGAAATAGAAATCCAAGTCGACTGGAAC
Tn Thvronlobulin 561/8,322 bp 6.7% 3-5
AATATCTTTGAGTATCAGGTGGAATCCCAGCCTCTACGTCCAGGGTCGG
GAAAAGGC CTTTCTGGAAGGAGAAGATCATGTTC CCCAGTGC TCAGAAGATGGCCA
GTTCCGGACTGTGCAGTGCAGCAAGAACAACCTTTCCTGCTGTTTGTAA
GGGAGCTGAAGTACCAGGCAGTAAACAGAATGGAGTTCCCATTCGTACT
TTGTCAGCTGCAAAAGCAGCAGGTCTTGGTAAGTCGCTACATACGACCA
CTCCTACATCCCTCAGTGCTTGGATTCGGGGGAGTTTGCTCCGGATTAG
GGGCCTGGGACAATGCTGGTGTGTGGACTCAGAAGGGATGGATAGCCA
GGCAGACAGGGAAACCAACCCAGTGTCCAGGGAGCTGTGAGTCACGCT
ATTCTGCATGGAGTTGGGGACAGGAGTCCACCACAGTGTTCGACGGAT
TTTGCCTGTTCAGTGCAAATTTGTCAACATGACCGACATGAGTTCT
Tp Thvroperoxidase 519/2,700 bp 19.2%
3-5
CACCCGGATAATATTGATGTATGGCTTGGTGGCCTAGCAGAAATCTCAA
GCTAGAACTGGCCCACTGTTTGCATGTCTAATTGGAAAACATGACCGG
GGAAGGTGACCGATTTTGGTGGGAAAATGATGATATTTTCA
CAGAAGTGCAAAGGCATGAGCTCAAAAAACATTCTTTGTCCCCTACGGC









ATACAGGACTTTCAGAAGTGCCAGTTGATGCTTTTCAACTTGGATTCGA
ACTTTGAGTCATGTGACAATATACCAGGAATAAATTTAGAAGTGCGAAC
ATGAGCAAGAGGAAACATGTGGAGTCCCAATGAAAGTGGAACGTCTGA
TATTGTTCAGAACTCGGAAAATCCATAGTGATTTATTCATGCATGTCAC
TACAAGGAGAAGAACAATTAACCTGTACAAATAAAGAATGGATCACCA
GTTTGTAAAGACGTCAACGAATGC

TSH-r Thyrotropin receptor 550/2,475 bp 22.2%
3-5
CATTGTTGTGCATTTAAGAACTGGAAGAAAACGAAGATCGAATACCGAT
GTGTAACCAGACCAGCAGTTATAACGTCCGTAAAAGAAGATCGAGGCTA
TGGTCCTTTTTACCAAGACTATGCAGAAGGAGATACAGAGCATGGATT
ATGACAAAAACTCCAAATTCAGGGATTTTTATGGCAATTCCATTTGTTT
TGAAGAGCAGGGGGATGGAGATGTTGGATTTGGCCAAGAAACGACTAG
AGGAAAATGCCCAGGCATTTGACAGCCACTATGACTATACTCGGGGAT
GAAGAAATAGTATGCACC C CAGAGC C TGATGAGT TTAATC C CTGT GAAGACATAAT
GGGGTATACATTTCTAAGGATTGTGGTTTGGTTTGTGAACCCTGACTGT
AATATTTTTGTCCTGTTCATCCTTCTCACCAGCCATTACAATGCTCAGT
TTTTGATGTGCAACCTGGCCTTCGCCGACTTCTGCATGG

Dl Deiodinase type 1 Helbinn lab/Nik Veldhoen 10/20/2005 306/540 bp
5-3
CTGTTGAAATTTGACGAGTTCAACAAGCTTGTCGAAGATTTCACTTAAA
TTCCTTTTAATCTACATTGAAGAAGCTCATGCAACAGACGGAGGTTAAA
AATATTGTTATTAAAAATCACCAAAACCTTGAAGATCGAAAATGTCCGT
CTTCTGAAAAAGAACCCCTTATGCCCAGTTGTTGTGGATACTTGAACCG
AGCTCAAAGTATGCTGCTCTCCCAGAAAGACTTTACCTGCTTAGAGAGT
GTTTATAAGGGTGGAGCAGGA

D2 Deiodinase type 2 Helbinn lab/NikVeldhoen 10/20/2005 526 bp
5-3
CTTCCTTGCACTCTATGATTCTGTGATCCTCCTGAAGCACAGTCTTTAT
CGGTCTAAGTCTGCGCGTGGTGAGTGGCGAAGGATGCTGACTAGGCGG
TTGCGTCTGGAATAGCTTCCTCCTAGATGCTTACAAACAGGTAATGTGG
AGCCCCAAACTCCAGAGTGATTCACATAACCAATGGCATCATGGCTCA
GAT GCAAGAAT GT TGGTGGAAAGT TGGGGAGC GAGT GTC ATC TC TTGGAT TT TGC CA
ACTCTGAGCGTCCCCTGGTGGTCAACTTTGGTTCAGCTACCTACCATAG
GCCAGCTGTCAGCCTTCAGCAAGCTGGTGGAGGAGTTTTCAGTTGCATC
TGTTGGTCTACATTGACGAGGCTCACCCATCGGATGGTTGGGTCCTGAC
CGCCCTCTTCATTTGAGGTGAAGAAGCACAAGAACCAGGAACGTTCGT
GCTCACCAGCTCCTG










LIST OF REFERENCES


Allsteadt, J., Lang, J.W., 1995. Sexual dimorphism in the genital morphology of young
American alligators, Alligator mississippiensis. Herpetologica 51, 314-325.

Anthony, F.F., Aruldhas, M.M., Udhayakumar, R.C., Maran, R.R., Govindarajulu, P., 1995.
Inhibition of Leydig cell activity in vivo and in vitro in hypothyroid rats. J. Endocrinol. 144, 293-
300.

Arain, S.A., Shah, M.H., Meo, S.A., Jamal, Q., 2003. Estrogen receptors in human thyroid gland-
An immunohistological study. Saudi Med. J. 24, 174-178.

Arambepola, N.K., Bunick, D., Cooke, P.S., 1998. Thyroid hormone effects on androgen
receptor messenger RNA expression in rat Sertoli and peritubular cells. Endocrinology 156, 43-
50.

Barbeau, T.R., Guillette L.J., J., 2007. Altered ovarian steroids in Xenopus laevis exposed to
environmentally relevant concentrations of nitrate. J. Herpotol. 41, 590-597

Bassett, J.H., Harvey, C.B., Williams, G.R., 2003. Mechanisms of thyroid hormone receptor-
specific nuclear and extra nuclear actions. Mol. Cell. Endocrinol. 213, 1-11.

Bau, F., Parent, J.P., 2000. Seasonal variations of thyroid hormone levels in wild fish. Comptes
Rendus De L Academie Des Sciences Serie lii-Sciences De La Vie-Life Sciences 323, 365-372.

Bentley, P.J., 1982. Comperative vertebrate endocrinology. Cambridge University Press, New
York.

Bermudez, D.S., Milnes, M.R., Bryan, T.A., Gunderson, M.P., Tubbs, C., Woodward, A.,
Guillette L. J., J., 2005. Seasonal variation in plasma thyroxine concentrations in juvenile
alligators (Alligators mississippiensis) from three Florida lakes. Comp. Biochem. Phys. A 141, 8-
14.

Bernal, J., Guadano-Ferraz, A., Morte, B., 2003. Perspectives in the study of thyroid hormone
action on brain development and function. Thyroid 13, 1005-1012.

Bhattacharya, S., Banerjee, J., Jamaluddin, M., Banerjee, P.P., Maitra, G., 1988. Thyroid
hormone binds to human corpus luteum. Experientia 44, 1005-1007.

Blaxter, J.S., 1988. Pattern and variety in development. In: Hoar, W.S., Randall, D.J. (Eds.), Fish
physiology. The physiology of developing fish., vol. 11A. Academic Press, San Diego, pp. 1-58

Boily, P., 1996. Metabolic and hormonal changes during the molt of captive gray seals
(Halichoerus grypus). Am. J. Physiol. 270, 1051-1058.










Bona-Gallo, A., Licht, P., MacKenzie, D.S., Lofts, B., 1980. Annual cycles in levels of pituitary
and plasma gonadotropin, gonadal steroids, and thyroid activity in the Chinese cobra (Naja
naja). Gen. Comp. Endocr. 42, 477-493.

Brouwer, A., Morse, D., Lans, M., Schuur, A., Murk, A., Klasson-Wehler, E., Bergman, A.,
Visser, T., 1998. Interactions of persistent environmental organohalogens with the thyroid
hormone system: mechanisms and possible consequences for animal and human health. Toxicol.
Ind. Health 14, 59-84.

Brucker-Davis, F., 1998. Effects of environmental synthetic chemicals on thyroid function.
Thyroid 8, 827-856.

Brunigfann, C., Kaneene, J., 1993. The effects of nitrate, nitirte, and N-nitroso compounds on
animal health. Vet. Hum.Toxicol. 35, 237-253.

Buzzard, J.J., Morrison, J.R., O'Bryan, M.K., Song, Q., Wreford, N.G., 2000. Developmental
expression of thyroid hormone receptors in the rat testis. Biol. Reprod. 62, 664-669.

Buzzard, J.J., Wreford, N.G., Morrison, J.R., 2003. Thyroid hormone, retinoic acid, and
testosterone suppress proliferation and induce markers of differentiation in cultured rat Sertoli
cells. Endocrinol. 144, 3722-3731.

Capen, C.C., 1992. Pathophysiology of chemical injury of the thyroid gland. Toxicol. Lett. 64,
381-388.

Capen, C.C., 1994. Mechanisms of chemical injury of the thyroid gland. Prog. Clin. Biol. Res.
387, 173-191.

Cayrou, C., Denver, R.J., Puymirat, J., 2002. Suppression of the basic transcription element-
binding protein in brain neural cultures inhibits thyroid hormone-induced neurite branching.
Endocrinology 143, 2242-2249.

Chattopadhyay, A., Kumar, V., Marulaiah, M., 2003. Polycystic ovaries, precocious puberty and
acquired hypothyroidism: the Van Wyk and Grumbach syndrome. J. Pediatr. Surg. 38, 1390-
1392.

Coleman, M.D., Gaskin, C.A., Fernandes, S., Khanderia, L., 2003. The use of xenobiotic-
mediated methaemoglobin formation to assess the effects of thyroid hormones on diabetic and
non- diabetic human erythrocytic oxidant defence mechanisms in vitro. Environ. Toxicol. Phar.
13, 15-19.

Cooke, P.S., Hess, R.A., Porcelli, J., Meisami, E., 1991a. Increase sperm production in adult rats
after transient neonatal hypothyroidism. Endocrinology 129, 244-248.










Cooke, P.S., Holsberger, D.R., Witorsch, R.J., Sylvester, P.W., Meredith, J.M., Treinen, K.A.,
Chapin, R.E., 2004. Thyroid hormone, glucocorticoids, and prolactin at the nexus of physiology,
reproduction, and toxicology. Toxicol. Appl. Pharm. 194, 309-335.

Cooke, P.S., Meisami, E., 1991b. Early hypothyroidism in rats causes increased adult testis and
reproductive organ size but does not change testosterone levels. Endocrinology 129, 237-243.

Correa da Costa, V.M., Moreira, D.G., Rosenthal, D., 2001. Thyroid function and aging: gender-
related differences. J. Endocrinol. 171, 193-198.

Crain, D.A., 1997. Endocrine-disrupting contaminants and reproduction in vertebrate wildlife.
Environ. Toxicol.; Rev. Toxicol. 1, 47-70.

Crain, D.A., Guillette L. J., J., Pickford, D.B., Percival, H.F., Woodward, A.R., 1998. Sex-
steroid and thyroid hormone concentrations in juvenile alligators (Alligator mississippiensis)
from contaminated and reference lakes in Florida, USA. Environ. Toxicol. Chem. 17, 446-452.

Davis, G.S., Anderson, K.E., Carroll, A.S., 2000. The effects of long-term caging and molt of
Single Comb White Leghorn hens on herterophil to lymphocyte ratios, corticosterone and
thyroid hormones. Poultry Sci. 79, 514-518.

Davis, L.M., Glenn, T.C., Strickland, D.C., Guillette, L.J., Jr., Elsey, R.M., Rhodes, W.E.,
Dessauer, H.C., Sawyer, R.H., 2002. Microsatellite DNA analyses support an east-west
phylogeographic split of American alligator populations. J. Exp. Zool. 294, 352-372.

DeFeo, P., 1996. Hormonal regulation of human protein metabolism. Eur. J. Endocrinol. 135, 7-
18.

Denver, R.J., 1998. Hormonal correlates of environmentally induced metamorphosis in the
Western spadefoot toad, Scaphiopus hamnmondii. Gen. Comp. Endocr. 110, 326-336.

Denver, R.J., 1999. Evolution of the corticotropin-releasing hormone signaling system and its
role in stress-induced phenotypic plasticity. In: Neuropeptides: Structure and Function in
Biology and Behavior, 897, 46-53

Dickhoff, W.W., Darling, D.S., 1983. Evolution of thyroid function and its control in lower
vertebrates. Am. Zool. 23, 697-708.

Eales, J.G., 1985a. The peripheral metabolism of thyroid hormones and regulation of thyroidal
status in poikilotherms. Can. J. Zool. 63, 1217-1231.

Eales, J.G., 1985b. The peripheral metabolism of thyroid hormones and regulation of thyroidal
status in poikilotherms. Can. J. Zool. 63, 1217-1231.

Eales, J.G., 1988. The influence of nutritional state on thyroid function in various vertebrates.
Amer. Zool. 28, 351-362.










Eales, J.G., 1997. Iodine metabolism and thyroid-related functions in organisms lacking thyroid
follicles: are thyroid hormones also vitamins? P. S. E. B. M. 214, 302-317.

Edwards, T.M., Gunderson, M.P., Milnes, M.R., Guillette L. J., J., 2004. Gonadotropin-induced
testosterone response in peripubertal male alligators. Gen. Comp. Endocr. 135, 372-380.

EPA, 1994. Tower Chemical company superfund site biological assessment. In: U.S.
Environmental Protection Agency, Athens, GA,

Evans, R.M., 1988. The steroid and thyroid hormone receptor superfamily. Science 240, 889-
895.

Fujimoto, N., Sakai, Y., Ito, A., 1992. Increase in estrogen-receptor levels in MNU induced
thyroid-tumors in LE rats. Carcinogenesis 13, 1315-1318.

Gancedo, B., Alonso-Gomez, A.L., de Pedro, N., Delgado, M.J., Alonso-Bedate, M., 1997.
Changes in thyroid hormone concentrations and total contents through ontogeny in three anuran
species: Evidence for daily cycles. Gen. Comp. Endocr. 107, 240-250.

Gatseva, P., Mardirosian, Z., Popova, E., St. Iskrenova, E., Vladeva, S., Pavlova, K., 2000a.
Evaluation of health hazards in children from regions with nitrate pollution. Folia Medica XLII,
19-22.

Gatseva, P., Marinova, S., Vurtigova, L., 1992. Changes in the thyroid and other internal organs
of experimental animals exposed to a drinking regimen with high nitrate content. Probl Khig 17,
43-47.

Gatseva, P., Vladeva, S., Pavlova, K., 1998a. Incidence of goiter among children in a village
with nitrate contamination of drinking water. Folia Medica XXXX, 19-23.

Gatseva, P.D., Mardirosian, Z.H., Popova, E.J., St. Iskrenova, E., Vladeva, S.V., Pavlova, K.I.,
2000b. Evaluation of health hazards in children from regions with nitrate pollution. Folia Med.
XLII, 19-22.

Gatseva, P.D., Vladeva, S.V., Pavlova, K.I., 1998b. Incidence of goiter among children in a
village with nitrate contamination of drinking water. Folia Med. XXXX, 19-23.

Giani, C., Campani, D., Denegri, F., Martini, L., Fabbri, R., Bonacci, R., Ciancia, E.M.,
Gigliotti, A., Fierabracci, P., Pinchera, A., 1993. Interferance of thyroperoxidase on immuno-
cytochemical determination of steroid-receptors in thyroid tissue. J. Endocrinol. Invest. 16, 37-
43.

Goldman, M., 1981. The effect of a single dose of DDT on thyroid function in male rats. Arch.
Int. Pharmacodyn. Ther. 252, 327-334.










Goto-Kazeto, R., Kazeto, Y., Trant, J.M., 2003. Cloning and seasonal changes in ovarian
expression of a TSH receptor in the channel catfish, Ictalurus puncta~tus. Fish Physiol. and
Biochem. 28, 339-340.

Grenard, S., 1991. Handbook of alligators and crocodiles. Krieger Publishing Company,
Malabar.

Gu, W.X., Stern, P.H., Madison, L.D., Du, G.G., 2001. Mutual up-regulation of thyroid hormone
and parathyroid hormone receptors in rat osteoblastic osteosarcoma 17/2.8 cells. Endocrinology
142, 157-164.

Guillette L. J., J., Edwards, T.M., 2005. Is nitrate an ecologically relevant endocrine disruptor in
vertebrates? Integr. Comp. Biol. 45, 19-22

Guillette, L.J., Gross, T.S., Masson, G.R., Matter, J.M., Percival, H.F., Woodward, A.R., 1994.
Developmental abnormalities of the gonad and abnormal sex-hormone concentrations in juvenile
alligators from contaminated and control lakes in Florida. Environ. Health Persp. 102, 680-688.

Guillette, L.J., Jr., Brock, J.W., Rooney, A.A., Woodward, A.R., 1999. Serum concentrations of
various environmental contaminants and their relationship to sex steroid concentrations and
phallus size in juvenile alligators. Arch. Environ. Con. Tox. 36, 447-455.

Guillette, L.J., Jr., Crain, D.A., Gunderson, M.P., Kools, S.A.E., Milnes, M.R., Orlando, E.F.,
Rooney, A.A., Woodward, A., 2000. Alligators and endocrine disrupting contaminants: a current
perspective. Amer. Zool. 40, 438-452.

Guillette, L.J., Jr., Pickford, D.B., Crain, D.A., Rooney, A.A., Percival, H.F., 1996. Reduction in
penis size and plasma testosterone concentrations in juvenile alligators living in a contaminated
environment. Gen. Comp. Endocr. 101, 32-42.

Guillette, L.J., Jr., Rooney, A.A., Crain, D.A., Orlando, E.F., 1999c. Steroid hormones as
biomarkers of endocine disruption in wildlife. In: Henshel, D.S., Black, M.C., Harrass, M.C.
(Eds.), Environmental Toxicology and Risk Assessment: Standardization of Biomarkers for
Endocrine Disruption and Environmental Assessment, vol. 8. American Society for Testing and
Materials, West Consshohocken, PA,

Guillette, L.J., Jr., Woodward, A., Crain, D.A., Masson, G.R., Palmer, B.D., Cox, C., You-
Xiang, Q., Orlando, E.F., 1997. The reproductive cycle of the female American alligator
(Alligator mississippiensis). Gen. Comp. Endocr. 108, 87-101.

Hamann, I., Seidlova-Wuttke, D., Wuttke, W., Kohrle, J., 2006. Effects of isoflavonoids and
other plant-derived compounds on the hypothalamus-pituitary-thyroid hormone axis. Maturitas
55, S14-S25.

Heinz, G.H., Percival, H.F., Jennings, M.L., 1991. Contaminants in American alligator eggs
from lakes Apopka, Griffin and Okeechobee, Florida. Environ. Monit. Assess. 16, 277-285.










Helbing, C.C., Crump, K., Bailey, C.M., Kohno, S., Veldhoen, N., Bryan, T.A., Bermudez, D.S.,
Guillette L. J., J., 2006. Isolation of the alligator (Alligator mississippiensis) thyroid hormone
receptor a and p transcripts and their responsiveness to thyroid stimulating hormone. Gen.
Comp. Endocr. 149, 141-150.

Hiasa, Y., Nishioka, H., Kitahori, Y., Yane, K., Nakaoka, S., Ohshima, M., Konishi, N., Nishii,
K., Kitamura, M., Matsunaga, T., 1993. Immunohistochemical analysis of estrogen-receptors in
3 13 paraffin section cases of human thyroid-tissue. Oncology 50, 132-136.

Hoffman, W.H., Kovacs, K.T., Gala, R.R., Keel, B.A., Jarrell, T.S., Ellegood, J.O., Bureck, C.L.,
1991. Macroorchidism and testicular fibrosis associated with autoimmune thyroiditis. J.
Endocrinol. Invest. 14, 609-616.

Holsberger, D.R., Jirawatnotai, S., Kiyokawa, H., Cooke, P.S., 2003. Thyroid hormone regulates
the cedll cycle inhibitor p27Kipl in postnatal murine Sertoli cells. Endocrinology 144, 3732-
3738.

Humason, G.L., 1972. Animal Tissue Techniques. In: Freeman & Company, New York.

Jannini, E.A., Crescenzi, A., Rucci, N., Screponi, E., Carosa, E., de Matteis, E., Macchia, E.,
d'Amati, G., D'Armiento, M., 2000. Ontogenetic pattern of thyroid hormone receptor expression
in the human testis. J. Clin. Endocr. Metab. 85, 3453-3457.

Jannini, E.A., Dolci, S., Ulisse, S., Nikodem, V.M., 1994. Developmental regulation of the
thyroid hormone receptor alpha 1 mRNA expression in the rat testis. Mol. Endocrinol. 8, 89-96.

Jannini, E.A., Olivieri, M., Francavilla, S., Gulino, A., Ziparo, E., D'Armiento, M., 1990.
Ontogenisis of the nuclear 3,5,3'-triiodothyronine receptor in the rat testis. Endocrinology 126,
2521-2526.

Jannini, E.A., Ulisse, S., D'Armiento, M., 1995. Macroorchidism in juvenile hypothyroidism. J.
Clin. Endocr. Metab. 80, 2543-2544.

John-Alder, H.B., 1984. Seasonal variation in activity, aerobic energetic capacities, and plasma
thyroid hormones (T3 and T4) in an iguanid lizard. J. Comp. Physiol. B 154, 409-419.

Johnson, M.H., Everitt, B.J., 2000. Essential Reproduction. Blackwell Publishing, Williston, VT.
Joyce, K.L., Porcelli, J., Cooke, P.S., 1993. Neonatal goitrogen treatment increases adult testis
size and sperm production in the mouse. J. Androl. 14, 448-455.

Kar, A., Chandola-Saklani, A., 1985a. Circulating thyroid hormone concentration in relation to
seasonal events in the male Indian garden lizard, Calotes versicolor. Gen. Comp. Endocr. 60, 14-
19.










Kar, A., Chandola-Saklani, A., 1985b. Circulating thyroid hormone concentrations in relation to
seasonal events in the male Indian garden lizard, Calotes versicolor. Gen. Comp. Endocr. 60, 14-
19.

Katsu, Y., Bermudez, D.S., Braun, E.L., Helbing, C., Miyagawa, S., Gunderson, M.P., Kohno,
S., Bryan, T.A., Guillette L. J., J., Iguchi, T., 2004. Molecular cloning of the estrogen and
progesterone receptors of the American alligator. Gen. Comp. Endocr. 136, 122-133.

Katti, S., Sathyanesan, A., 1987. Lead nitrate induced changes in thyroid physiology of the
catfish Claria~s batrachus. Ecotox. Environ. Safe. 13, 1-6.

Kavok, N.S., Krasilnikova, O.A., A., B.N., 2001. Thyroxine signal transduction in liver cells
involves phospholipase C and phospholipase D activation. Genomic independent action of
thyroid hormone. BMC Cell. Biol. 2:5.

Kawabata, W., Suzuki, T., Moriya, T., Fujimori, K., Naganuma, H., Inoue, S., Kinouchi, Y.,
Kameyama, K., Takami, H., Shimosegawa, T., Sasano, H., 2003. Estrogen receptors (a and P)
and 17P-hydroxysteroid dehydrogenase type 1 and 2 in thyroid disorders: possible in situ
estrogen synthesis and actions. Modern Pathology 16, 437-444.

Kawaguchi, H., Pilbeam, C.C., Raisz, L.G., 1994. Anabolic effects of 3,3',5-triiodothyronine and
triiodothyroacetic acid in cultured neonatal mouse parietal bones. Endocrinology 135, 971-976.

Kilpatrick, S., 2002. Thyroid disease in pregnancy. Int. J. Gynecol. Obstet. 79, 171-180.
Kioukia, N., Bekris, S., Antoniou, K., Papadopoulou-Daifoti, Z., Christofidis, I., 2000. Effects of
chronic mild stress (CMS) on thyroid hormone function in two rat strains.
Psychoneuroendocrino. 25, 247-257.

Kirby, J.D., Mankar, M.V., Hardesty, D., Kreider, D.L., 1996. Effects of transient prepubertal 6-
N-propyl-2-thiuracil treatment on testis development and function in the domestic fowl. Biol.
Reprod. 55, 910-916.

Kisakol, G., Kaya, A., Gonen, S., Tunc, R., 2003. Bone and calcium metabolism in subclinical
autoimmune hyperthyroidism and hypothyroidism. Endocr. J. 50, 657-661.

Kowalczyk, P., Sotowska-Brochocka, J., 2000. Changes in thyroid hormones in the serum and
the thyroid gland of hibernating frogs, Rana temporaria L. Gen. Comp. Endocr. 119, 172-180.

Kuhn, E.R., Darras, V.M., Verlinden, T.M., 1985. Annual variations of thyroid reactivity
following thyrothropin stimulation and circulating levels of thyroid hormones in the frog RanaRRRRR~~~~~~~RRRRRR
ridibunda. Gen. Comp. Endocr. 57, 266-273.

Kulczykowska, E., Sokolowska, E., Takvam, B., Stefansson, S., Ebbesson, L., 2004. Influence of
exogenus thyroxine on plasma melatonin in juvenile Atlantic salmon (Salmo salar). Comp.
Biochem. Phys. B 137, 43-47.










Kursa, J., Travnicek, J., Rambeck, W., Kroupova, V., Vitrovec, J., 2000. Goitrogenic effects of
extracted rapeseed meal and nitrates in sheep and their progeny. Vet. Med.-Czech. 45, 129-140.

Kwon, J., Chang, Y., Sohn, Y., Aida, K., 1999a. Plasma and ovarian thyroxine levels in relation
to sexual maturation and gestation in female Seba~stes inermis. J. Fish Biol. 54, 370-379.

Kwon, J.Y., Chang, Y.J., Sohn, Y.C., Aida, K., 1999b. Plasma and ovarian thyroxine levels in
relation to sexual maturation and gestation in female Seba~stes inermis. J. Fish Biol. 54, 370-379.

Lahti, E., Harri, M., Lindqvist, O., 1985. Uptake and distribution of radioiodine, and the effects
of ambient nitrate, in some fish species. Comp. Biochem. Physiol. 80A, 337-342.

Levy, C., 1991. Endangered species: crocodiles and alligators. Chartwell Books, London.
Lima, L.P., Barros, I.A., Lisboa, P.C., Araujo, R.L., Silva, A.C.M., Rosenthal, D., Ferreira,
A.C.F., Carvalho, D.P., 2006. Estrogen effects on thyroid iodide uptake and thyroperoxidase
activity in normal and ovariectomized rats. Steroids 71, 653-659.

Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time
quantitative PCR and the 2-delta delta Ct method. Methods 25, 402-408.

Lynn, W.G., 1970. The Thyroid. In: Gans, C. (Ed.) Biology of the Reptilia, vol. 3, morphology
C. Academic Press, New York, pp. 201-234

MacKenzie, D.S., VanPutte, C.M., Leiner, K.A., 1998. Nutrient regulation of endocrine function
in fish. Aquaculture 161, 3-25.

Majdic, G., Snoj, T., Horvat, A., Mrkun, J., Kosec, M., Cesnik, V., 1998. Higher thyroid
hormone levels in neonatal life results in reduced testis volume in postpubertal bulls. Int. J.
Androl. 21, 352-357.

Mann, D.R., Akinbami, M.A., Gould, K.G., Castracane, V.D., 2002. Leptin and thyroxine during
sexual development in male monkeys: effect of neonatal gonadotropin-releasing hormone
antagonist treatment and delayed puberty on the development pattern of leptin and thyroxine
secretion. Eur. J. Endocrinol. 146, 891-898.

Manna, P.R., Roy, P., Clark, B.J., Stocco, D.M., Huhtaniemi, I.T., 2001. Interaction of thyroid
hormone and steroidogenic acute regulatory (StAR) protein in the regulation of murine Leydig
cell steroidogenisis. J. Steroid. Biochem. Mol. Biol. 76, 167-177.

Manole, D., Schildknecht, B., Gosnell, B., Adams, E., Derwahl, M., 2001. Estrogen promotes
growth of human thyroid tumor cells by different molecular mechanisms. J. Clin. Endocr. Metab.
86, 1072-1077.

Maran, R.R., Ravichandran, K., Arunakaran, J., Aruldas, M.M., 2001. Impact of neonatal
hypothyroidism on Leydig cell number, plasma, and testicular interstitial fluid sex steroid
concentration. Endocr. Res. 27, 119-141.










Marassi, M.P., Fortunato, R.S., Matos da Silva, A.C., Pereira, V.S., Carvalho, D.P., Rosenthal,
D., Correa da Costa, V.M., 2007. Sexual dimorphism in thyroid function and type 1
iodothyronine deiodiase activity in pre-pubertal and adult rats. J. Endocrinol. 192, 121-130.

Maruo, T., Hiramatsu, S., Otani, T., Hayashi, M., Mochizuki, M., 1992. Increase in the
expression of thyroid hormone receptors in porcine granulosa cells early in follicular maturation.
Acta Endocrinol. (Copenh.) 127, 152-160.

Matta, S.L., Vilela, D.A., Godinho, H.P., Franca, L.R., 2002. The goitrogen 6-n-propyl-2-
thiouracil (PTU) given during testis development increases Sertoli and germ cell numbers per
cyst in fish: the tilapia (Oreochromis niloticus) model. Endocrinology 143, 970-978.

Maurel, D., Coutant, C., Boissin, J., 1987. Thyroid and gonadal regulation of hair growth during
the seasonal molt in the male European badger, M~eles meles L. Gen. Comp. Endocr. 65, 317-
327.

May, T.W., Packer, R.K., 1976. Thyroid-hormones stimulate in vivo oxygen-consumption of
adult Rana pipiens-beR~~R~~R~Rrlandier at high environmental temperatures. Gen. Comp. Endocr. 30,
525-527.

McArthur, M.L.B., Fox, G.A., Peakall, D.B., Philogene, B.J.R., 1983. Ecological significance of
behavior and hormonal abnormalities in breeding ring doves fed an organochlorine chemical
mixture. Arch. Environ. Contam. Toxicol. 12, 343-353.

McCoard, S.A., Wise, T.H., Ford, J.J., 2003. Endocrine and molecular influences on testicular
development in Meishan and White Composite boars. J. Endocrinol. 178, 405-416.

McKenna, N.J., O'Malley, B.W., 2001. Nuclear Receptors, Coregulators, Ligands, and Selective
Receptor Modulators: Making Sense of the Patchwork Quilt.
.Annals New York Academy of Sciences 949, 3-5.

Mcllhenny, E.A., 1987. The alligator's life history. Ten Speed Press, Berkeley.

Milnes, M.R., Woodward, A.R., Rooney, A.A., Guillette L. J., J., 2002. Plasma steroid
concentration in relation to size and age in juvenile alligators from two Florida lakes. Comp.
Biochem. Phys. A 131, 923-930.

Morgan, C.A., Wang, S., Mason, J., Southwick, S.M., Fox, P., Hazlett, G., Charney, D.S.,
Greenfield, G., 2000. Hormone profiles in humans experiencing military survival training. Biol.
Psychiat. 47, 891-901.

Moriyama, K., Tagami, T., Usui, T., Naruse, M., Nambu, T., Hataya, Y., Kanamoto, N., Li, Y.S.,
Yasoda, A., Arai, H., Nakao, K., 2007. Antithyroid drugs inhibit thyroid hormone receptor-
mediated transcription. Journal of Clinical Endocrinology and Metabolism 92, 1066-1072.










Nanto-Salonen, K., Muller, H.L., Hoffman, A.R., Vu, T.H., Rosenfeld, R.G., 1993. Mechanisms
of thyroid hormone action on the insulin-like growth factor system: all thyroid hormone effects
are not growth hormone mediated. Endocrinology 132, 781-788.

Norris, D.O., 1997. Vertebrate Endocrinology. Academic Press, San Diego.

Orlando, E.F., Davis, W.P., Guillette L. J., J., 2002. Aromatase activity in the ovary and brain of
the eastern mosquitofish (Gamnbusia holbrooki) exposed to paper mill effluent. Environ. Health
Persp. 110, 429-433.

Palmero, S., De Marco, P., Fugassa, E., 1995. Thyroid receptor beta mRNA expression in the
Sertoli cells isolated from prepuberal testis. J. Mol. Endocrinol. 14, 131-134.

Palmero, S., Maggiani, S., Fugassa, E., 1988. Nuclear triiodothyronine receptors in rat Sertoli
cells. Mol. Cell. Endocrinol. 58, 253-256.

Paterson, C.M., Greenlee, R., Adam Jones, D., 1999. Thyroid cancer in Wales 1985-1996: a
cancer registry-based study. Clin. Oncol. 11, 245-251.

Rattner, B.A., Eroschenko, V.P., Fox, G.A., Fry, D.M., Gorsline, J., 1984. Avian endocrine
responses to environmental pollutants. J. Exp. Zool. 232, 683-689.

Reimers, T.J., McCann, J.P., Cowan, R.G., Concannon, P.W., 1982. Effects of storage,
hemolysis, and freezing and thawing on concentrations of thyroxine, cortisol, and insulin in
blood-samples. Proc. Soc. Exp. Biol. Med. 170, 509-516.

Rendakov, N.L., Tyutyunnik, N.N., Sirotkina, L.N., Krupnova, M.Y., Nemova, N.N., 2003.
Thyroid hormones and activities of lysosomal proteolytic enzymes in organs of the arctic fox
Alopex lagopus. J. Evol. Biochem. Phys. 39, 302-305.

Rocha, A., Gomez, A., Galay-Burgos, M., Zanuy, S., Sweeney, G.E., Carrillo, M., 2007.
Molecular characterization and seasonal changes in gonadal expression of a thyrotropin receptor
in the European sea bass. Gen. Comp. Endocr. 152, 89-101.

Rooney, A.A., Crain, D.A., Woodward, A., Guillette L. J., J., 2004. Seasonal variation in plasma
sex steroid concentrations in juvenile American alligators. Gen. Comp. Endocr. 135, 25-34.

Rostal, D., Owens, D., Grumbles, J., MacKenzie, D., Amoss, M., 1998a. Seasonal reproductive
cycle of the Kemp's ridley sea turtle (Lepidochelys kempi). Gen. Comp. Endocrinol. 109, 232-
243.

Rostal, D.C., Owens, D.W., Grumbles, J.S., MacKenzie, D.S., Amoss, M.S., 1998b. Seasonal
reproductive cycle of the Kemp's ridley sea turtle (Lepidochelys kempi). Gen. Comp. Endocr.
109, 232-243.










Ruppert, C., Kraft, W., 1999. Examination in dogs with spontaneous hyperadrenocortism. Part 3.
Thyroid hormone concentrations before and after treatment with mitotane (Lysodren 9).
Tierarztl. Prax. K. H. 27, 167-171.

Schelske, C., Brezonik, P., 1992. Can Lake Apopka be restored? Restoration of aquatic
ecosystems: Science, technology and public policy. In: National Academy, Washington, DC, pp.
393-398

Schlosser, G., Koyano-Nakagawa, N., Kintner, C., 2002. Thyroid hormone promotes
neurogenesis in the Xenopus spinal cord. Dev. Dynam. 225, 485-498.

Segal, J., 1990. Calcium is the first messenger for the action of thyroid hormone at the level of
the plasma membrane: first evidence for an acute effect of the thyroid hormone on calcium
uptake in the heart. Endocrinology 126, 2693-2702.

Seidler, H., Hartig, M., Engst, R., 1976. Effects of DDT and lindane on thyroid function in the
rat. Nahrung 20, 399-406.

Sekimoto, K., Imai, K., Suzuki, M., Takikawa, H., Hoshino, N., Totsuka, K., 1987. Throxine-
induced molting and gonadal function of laying hens. Poult. Sci. 66, 752-756.

Sengal, D.S., Pollman, C.D., 1991. Assessment of potential sediment contamination for the
restoration of Lake Apopka. In: St. Johns River Water Management District, Palatka, FL,
Senger, P.L., 2003. Pathways to pregnancy and parturition. Cadmus Professional
Communications, Ephrata, PA.

Shi, Y., 2001. Amphibian Metamorphosis: From morphology to molecular biology. Wiley-Liss,
New York.

Silva, J.E., 1993. Hormonal control of thermogenesis and energy dissipation. Trends Endocrin.
Met. 5, 36-42.

Singh, U., Krishna, A., Bhatnagar, K., 2002a. Seasonal changes in thyroid activity in female
sheath-tailed bat, Taxphozous longimanus. ACTA Biol. Hunga. 53, 267-278.

Singh, U.P., Krishna, A., Bhatnagar, K.P., 2002b. Seasonal changes in thyroid activity in female
sheath-tailed bat, Taxphozous longimanus. ACTA Biol. Hunga. 53, 267-278.

Sinha, N., Lal, B., Singh, T.P., 1991. Pesticide induced changes in circulating thyroid hormones
in the freshwater catfish Claria~s batrachus. Comp. Biochem. Phys. C 100, 107-110.

Skaare, J.U., Bernhoft, A., Wiig, O., Norum, K.R., Haug, E., Eide, D.M., Derocher, A.E., 2001.
Relationships between plasma levels of organochlorines, retinol and thyroid hormones from
polar bears (Ursus maritimus) at Svalbard. J. Toxicol. Eny. Heal. A. 62, 227-241.










Steinhardt, M., Thielscher, H.H., 2002. Transport stress in young calves. Effects of animal breed
and of husbandry system on biochemical, metabolic and hormonal variables. Tierarztl. Prax. G.
N. 30, 369-377.

Stevens, R.J., Nishio, M.L., Hood, D.A., 1995. Effects of hypothyroidism on the expression of
cytochrome c and cytochrome c oxidase in heart and muscle during development. Mol. Cell.
Biochem. 143, 119-127.

Styne, D.M., 1998. Fetal growth. Clin. Perinatol. 25, 917-938.

Sweeting, R.M., Alexander, G.P., Eales, J.G., McKeown, B.A., 1994. Hepatic and branchial
thyroid hormone deiodinase activities associated with the parr-smolt transformation of coho
salmon (Oncorhynchus kisutch). Gen. Comp. Endocr. 94, 171-181.

Toft, G., Edwards, T.M., Baatrup, E., Guillette L. J., J., 2003. Disturbed sexual characteristics in
male mosquitofish (Gamnbusia holbrooki) from a lake contaminated with endocrine disrupters.
Environ. Health Perspect. 111, 695-701.

van Maanen, J.M. S., van Dijk, A., Mulder, K., de Baets, M.H., Menheere, P.C.A., van der Heide,
D., Mertens, P.L.J.M., Kleinj ans, J.C.S., 1994. Consumption of drinking water with high nitrate
levels causes hypertrophy of the thyroid. Toxicol. Lett. 72, 365-374.

Woodward, A.R., Percival, H.F., Jennings, M.L., Moore, C.T., 1993. Low clutch viability of
American alligators on Lake Apopka. Fla. Sci. 56, 52-63.

Wright, M.L., Cuthbert, K.L., Donohue, M.J., Solano, S.D., Proctor, K.L., 2000. Direct influence
of melatonin on the thyroid and comparison with prolactin. J. Exp. Zool. 286, 625-631i.

Yasoda, A., Arai, H., Nakao, K., 2007. Anti-thyroid drugs inhibit thyroid receptor-mediated
transcription. J. Clin. Endocrinol. Metab. 92, 1066-1072.

Zhang, S.S., Carrillo, A.J., Darling, D.S., 1997. Expression of multiple thyroid hormone receptor
mRNAs in human oocytes, cumulus cells, and granulosa cells. Mol. Hum. Reprod. 3, 555-562.

Zoeller, R.T., 2003. Challenges confronting risk analysis of potential thyroid toxicants. Risk
Anal. 23, 143-162.

Zoeller, R.T., Dowling, A.L.S., Herzig, C.T.A., lannacone, E.A., Gauger, K.J., Bansal, R., 2002.
Thyroid hormone, brain development, and the environment. Environ. Health Perspect. 110,
355-361.

Zoeller, R.T., Dowling, A.L.S., Vas, A.A., 2000. Developmental exposure to polychlorinated
biphenyls exerts thyroid hormone-like effects on the expression of RC3/neurogranin and myelin
basic protein messenger ribonucleic acids in the developing rat brain. Endocrinology 141, 181-
189.










Zraly, Z., Bendova, J., Svecova, D., Faldikova, L., Veznik, Z., Zajicova, A., 1997. Effects of oral
intake of nitrates on reproductive functions of bulls. Vet. Med.-Czech. 42, 345-3 54.









BIOGRAPHICAL SKETCH

Dieldrich Salomon Bermudez was born in the summer 1976 at 7:49 pm in Managua,

Nicaragua. At age 2, his family moved to Los Angeles, California. He rejoined them 2 years

later. Dieldrich attended elementary school in La Puente, CA. When he turned 10, he and his

family moved to Miami, Florida. There he attended public school and graduated from Miami

Coral Park Senior High in 1995. During high school, he volunteered at the Miami Museum of

Science Falcon Batchelor Bird of Prey Center and was student body president. He then attended

the University of Florida, Gainesville, FL. Dieldrich received a Bachelor in Science from the

University of Florida in 1999, graduating with honors. He double-majored in psychology and

zoology. During his tenure as an undergrad, he completed an undergraduate research project

titled "Immunological effects of endocrine-disrupting contaminants on alligator (A.

mississippiensis) spleen morphology" directed by Drs. Louis J. Guillette, Jr. and Andrew A.

Rooney. Dieldrich was awarded a CLAS Undergraduate Research award for the project. After

graduation, Dieldrich worked for the Florida Fish and Wildlife Conservation commission as a

field biologist and alligator egg research technician.

In August 2000, Dieldrich began his graduate career at the University of Florida, Zoology

department under the tutelage of Dr. Louis J. Guillette, Jr. In 2004, he completed the

requirements for his Master' s (via bypass) and continued with his Ph.D. work. During his

graduate tenure at the University of Florida, Dieldrich received a Florida-Georgia Louis Stokes

Alliance for Minority Participation fellowship, a Sigma Xi Grants in Aid of Research, an NSF

East Asia and Pacific Summer Institutes fellowship, a Delores A. Auzenne Graduate Scholars

fellowship, a Science Partners in Inquiry-based Collaborative Education fellowship and an

NIEHS Minority Predoctoral fellowship. Also while at the University of Florida he was

employed as a graduate teaching assistant for Introductory Biology, Animal Physiology, and









Biology of Reproduction. Dieldrich also engaged in an active mentoring program directing 25

students in research proj ects. Eight students under his direction completed senior undergraduate

research thesis or earned co-authorship on papers derived from this dissertation or peripheral

proj ect





PAGE 1

THYROID-GONAD AXIS OF TH E AMERICAN ALLIGATOR ( Alligator mississippiensis): AN EXAMINATION OF PHYSIOLOGICA L AND MORPHOLOGICAL ENDPOINTS By DIELDRICH SALOMON BERMUDEZ A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2008 1

PAGE 2

2008 Dieldrich Salomon Bermudez 2

PAGE 3

To my friends and family. W ithout your continuous support and inspiration, none of this would be possible. And to those kindred spirits lost in the struggle. 3

PAGE 4

ACKNOWLEDGMENTS No man is an island: the time and work dedicated to this project reinforced this belief. I first thank Lou Guillette for all the guidance, me ntoring and friendship given. He made a large impact on my life and how I will approach it. I would also like to thank my committee members for their guidance and support. Taisen Iguchis generous hospitality, insight, and use of your lab have been invaluable. Marty Cohn, I would lik e to thank for your enthusiasm, knowledge and encouragement. Dave Evans, thank you for your recommendations, suggestions, and approach. And Mike Fields, thank you for being ready availa ble for comments and questions. I am forever grateful for all your service, and will emulate your styles in my a pproach to science and life. I want to thank the members of my laborator y, the graduate students and post-doctorates I was privileged to work and learn from. Andy Rooney, Ed Orlando, Drew Crain, Matt Milnes, Mark Gunderson, Satomi Kohno, Thea Edwards, Gerry Binczik, Teresa Bryan, Iske Larkin, Brandon Moore, Heather Hamlin, Ashley Boggs, Nico le Botteri and Lori Al bergotti. Some of you I met at the end of your tenure at UF, others somewhere in the middle and yet others in the beginning. I want to thank you from the botto m of my heart for a ll the technical help, intellectual support, and camarader ie I was given by you. I consider you all family. I also want to thank all the undergraduates who helped collect data, catch alli gators, and all other forms of laboratory work. I especially want to thank the following who I am indebted to for you hard work: Jeremy Skotko, Jenna Norton, Mellisa Rodger s, Katie Sydes, Brid get Lawler, Mauricio Hernandez, Jonathan Shivers, Adrienne Buckman, Malerie Metz, Al Sardari. Field collection of wild alligat ors and of eggs was made possible through the help of the Florida Fish and Wildlife Cons ervation Commission. I es pecially thank Allan Woody Woodward, Dwayne Carboneau, Chris Tubbs, Came ron Carter, John White, Arnold Brunnel and 4

PAGE 5

Chris Visscher for their continuous assistance and support ou t in the field. A large portion of this work would not have been possible without you. Funding for my research was provided through se veral graduate students fellowships from the following: NIEHS, NSF, Sigma Xi and Fl orida-Georgia Louis Stokes Alliance for Minority Participation. Funding was also provided through several research assist antships and supplies supported through grants from Louis Guillette. Also, the University of Florida, Zoology department provided support that made this work possible. Lastly, I would like to thank all the friends I have gained and support I have received during my stay with the Zoology Department and the city of Gainesville I especially thank Deena M. Bermudez, my beautiful wife. Y our support and editing made this manuscript possible. You inspire me to excel everyday. I have been blessed. Thank you all, with all my heart. 5

PAGE 6

TABLE OF CONTENTS page ACKNOWLEDGMENTS ............................................................................................................... 4 LIST OF TABLES ...........................................................................................................................8 LIST OF FIGURES .........................................................................................................................9 LIST OF ABBREVIATIONS ........................................................................................................1 2 ABSTRACT ...................................................................................................................... .............15 CHAPTER 1 INTRODUCTION ................................................................................................................ ..17 General Review ......................................................................................................................17 Metabolic Effects ....................................................................................................................19 Effects on Differentiation .......................................................................................................20 Permissive Actions ............................................................................................................ .....21 Sexual Dimorphism in Thyroid Disease .................................................................................23 Thyroid and EDCs: An Emerging Field .................................................................................24 Thyroid and Gonadal Development ........................................................................................26 Hypotheses .................................................................................................................... ..........28 2 SEASONAL VARIATION IN PLASMA THYROXINE, TESTOSTERONE AND ESTRADIOL-17 CONCENTRATIONS IN JUVENILE ALLIGATORS ( Alligator mississippiensis) FROM THREE FLORIDA LAKES ..........................................................33 Introduction .................................................................................................................. ...........33 Materials and Methods ...........................................................................................................34 Study Sites .......................................................................................................................34 Sample Collection ...........................................................................................................35 Thyroxine Radioimmunoassay a nd Statistical Analysis .................................................37 Results .....................................................................................................................................38 Discussion .................................................................................................................... ...........39 3 ESTROGEN RECEPTOR EXPRESSION IN THE THYROID FOLLICLE OF THE AMERICAN ALLIGATOR ( Alligator mississippiensis ) DURING DIFFERENT LIFE STAGES. ....................................................................................................................... .........48 Introduction .................................................................................................................. ...........48 Materials and Methods ...........................................................................................................49 Animals ....................................................................................................................... .....49 Histological Analysis and Statistics ................................................................................50 Isolation of RNA, Reverse Tran scription and Northern Blots ........................................51 6

PAGE 7

Results .....................................................................................................................................52 Immunohistochemical Localization of ER ...................................................................52 Quantitative RT-PCR ......................................................................................................53 Discussion .................................................................................................................... ...........53 4 EFFECTS OF IN OVO AND IN VIVO PROPYLTHIOURACIL EXPOSURE ON THYROID AND GONAD GENE EXPRE SSION IN NEONATAL AMERICAN ALLIGATORS ( Alligator mississippiensis)...........................................................................62 Introduction .................................................................................................................. ...........62 Materials and Methods ...........................................................................................................65 Animals ....................................................................................................................... .....65 In Ovo PTU Treatment ....................................................................................................66 In Ovo Dissections and Tissue Collection .......................................................................66 In Vivo PTU Treatment ...................................................................................................67 In Vivo Dissections and Tissue Collection ......................................................................67 Histological Analysis and Statistics ................................................................................67 Isolation of RNA, Reverse Tran scription and Northern Blots ........................................68 Gene sequence and QPCR primer design ........................................................................69 Results .....................................................................................................................................70 Thyroid: In Ovo PTU Treatment .....................................................................................70 Thyroid: In Vivo after Neonatal Acute PTU Exposure ...................................................71 Gonad: In Ovo PTU Exposure .........................................................................................73 Gonad: In Vivo after Acute PTU Exposure .....................................................................75 Discussion .................................................................................................................... ...........75 Thyroid ....................................................................................................................... .....76 Gonads .............................................................................................................................78 Summary ....................................................................................................................... ...80 5 SUMMARY OF RESULTS .................................................................................................106 Introduction .................................................................................................................. .........106 Seasonal Thyroxine Variation ..............................................................................................107 Characterization of ERs on the Thyroid ...............................................................................108 PTU Exposure in the Thyroid and Gonad ............................................................................108 APPENDIX A STAINING PROTOCOL FOR ER IHC ............................................................................118 B PARTIAL SEQUENCES FOR CLONED THYROID GENES ..........................................119 LIST OF REFERENCES .............................................................................................................121 BIOGRAPHICAL SKETCH .......................................................................................................134 7

PAGE 8

LIST OF TABLES Table page 4-1 Primers used for Quantitative Real-tim e RT-PCR as markers for thyroid and gonad physiology in the American alligator ( A. mississippiensis ) ...............................................82 A-1 Immunohistochemistry staining protocol for ER .........................................................118 8

PAGE 9

LIST OF FIGURES Figure page 1-1 Location, structure and basic function of the thyroid follicle in a representative reptile, such as the American alligator. ..............................................................................30 1-2 Gonadal expression of alligator TR and TR mRNAs as determined by quantitative RT-PCR..............................................................................................................................31 1-3 Thyroid-gonad axis of regulation. TSH s ecreted from pituitary has stimulatory role on thyroid and gonad. ........................................................................................................3 2 2-1 Average cloacal temperature ( C) for juvenile American al ligators during the months of March 2001 through April 2002 from La kes Woodruff, Apopka, and Orange, Florida, USA. .....................................................................................................................44 2-2 Mean (high and low) ambient air temperature ( C) during the months of March 2001 through April 2002 from Lakes Woodruff, A popka, and Orange, Florida, USA. .............45 2-3 Mean ( 1 SE) plasma thyroxine (T4) concentration (ng/ml) for male juvenile American alligators during the months of March 2001 through April 2002 from Lakes Woodruff, Apopka, and Orange, Florida, USA. .....................................................46 2-4 Mean ( 1 SE) plasma thyroxine (T4) concentration (ng/ml) for female juvenile American alligators during the months of March 2001 through April 2002 from Lakes Woodruff, Apopka, and Orange, Florida, USA. .....................................................47 3-1 Three types of slides used (control, experimental, and normal) and how the tissue was oriented to ensure the ease and accuracy of the analysis. ...........................................57 3-2 Thyroid follicle from a juvenile alligator.. .........................................................................57 3-3 Mean ratio for IHC ER expression (measured by ratio of IHC ER stained to normal hemotoxylin and eosin stain) in th e thyroid at three life stages in the American alligator. ........................................................................................................... .58 3-4 Neonate mRNA gene expression in thyr oid tissue from the American alligator, A. mississippiensis. .................................................................................................................59 3-5 Juvenile mRNA gene expression in thyr oid tissue from the American alligator, A. mississippiensis. .................................................................................................................60 3-6 Adult mRNA gene expression in thyr oid tissue from the American alligator, A. mississippiensis. .................................................................................................................61 4-1 Thyroid axis of the American alligator, Alligator mississippiensis .. .................................83 9

PAGE 10

4-2 Gonad axis of the American alligator, Alligator mississippiensis. ....................................84 4-3 Estrogen receptor alpha (ER ) mRNA gene expression from in ovo PTU treatment in thyroid tissue from the American alligator, A. mississippiensis. ...................................85 4-4 Deiodinase type 2 mR NA gene expression from in ovo PTU treatment in thyroid tissue from the American alligator, A. mississippiensis. ....................................................86 4-5 Sodium-iodide symporter (NIS) mRNA gene expression from in ovo PTU treatment in thyroid tissue from the American alligator, A. mississippiensis. ...................................87 4-6 Pendrin (PEN) mRNA gene expression from in ovo PTU treatment in thyroid tissue from the American alligator, A. mississippiensis. ..............................................................88 4-7 Deiodinase 2 (D2) mR NA gene expression from in vivo PTU treatment in thyroid tissue from the American alligator, A. mississippiensis. ....................................................89 4-8 Androgen receptor (AR) mRNA gene expression from in vivo PTU treatment in thyroid tissue from the American alligator, A. mississippiensis. .......................................90 4-9 Estrogen receptor alpha (ER ) mRNA gene expression from in vivo PTU treatment in thyroid tissue from the American alligator, A. mississippiensis. ...................................91 4-10 Estrogen receptor beta (ER ) mRNA gene expression from in vivo PTU treatment in thyroid tissue from the American alligator, A. mississippiensis. .......................................92 4-11 Thyrotropin receptor (TSHr) mRNA gene expression from in vivo PTU treatment in thyroid tissue from the American alligator, A. mississippiensis. .......................................93 4-12 Pendrin (PEN) mRNA gene expression from in vivo PTU treatment in thyroid tissue from the American alligator, A. mississippiensis. ..............................................................94 4-13 Sodium-iodide symporter (NIS) mRNA gene expression from in vivo PTU treatment in thyroid tissue from the American alligator, A. mississippiensis. ...................................95 4-14 Androgen receptor (AR) mRNA gene expression from in ovo PTU treatment in gonad tissue from the American alligator, A. mississippiensis. .........................................96 4-15 Estrogen receptor alpha (ER ) mRNA gene expression from in ovo PTU treatment in gonad tissue from the American alligator, A. mississippiensis. .....................................97 4-16 Estrogen receptor beta (ER ) mRNA gene expression from in ovo PTU treatment in gonad tissue from the American alligator, A. mississippiensis. .........................................98 4-17 Steroidogenic acute re gulatory protein (StAR) mRNA gene expression from in ovo PTU treatment in gonad tissue from the American alligator, A. mississippiensis. ............99 10

PAGE 11

4-18 Aromatase (AROM) mR NA gene expression from in ovo PTU treatment in gonad tissue from the American alligator, A. mississippiensis. ..................................................100 4-19 Androgen receptor (AR) mRNA gene expression from in vivo PTU treatment in ovary tissue from the American alligator, A. mississippiensis.. .......................................101 4-20 Estrogen receptor alpha (ER ) mRNA gene expression from in vivo PTU treatment in ovary tissue from the American alligator, A. mississippiensis. ..................................102 4-21 Estrogen receptor beta (ER ) mRNA gene expression from in vivo PTU treatment in ovary tissue from the American alligator, A. mississippiensis. ........................................103 4-22 Deiodinase type 1 (D1) mRNA gene expression from in vivo PTU treatment in ovary tissue from the American alligator, A. mississippiensis. ..................................................104 4-23 Deiodinase type 2 (D2) mRNA gene expression from in vivo PTU treatment in ovary tissue from the American alligator, A. mississippiensis. ..................................................105 5-1 Thyroid-gonad axis of regulation revisited. .....................................................................110 5-2 In Ovo PTU mRNA expression of genes anal yzed for sexual dimorphism via QPCR in thyroid tissue of juvenile American alligators ( A.mississippiensis ). ...........................111 5-3 In Ovo PTU mRNA expression of genes analyz ed via QPCR in thyroid tissue of male juvenile American alligators ( A.mississippiensis).. .................................................111 5-4 In Ovo PTU mRNA expression of genes analyz ed via QPCR in thyroid tissue of female juvenile American alligators ( A.mississippiensis ). ..............................................112 5-5 In Vivo PTU mRNA expression of genes anal yzed for sexual dimorphism via QPCR in thyroid tissue of juvenile American alligators ( A.mississippiensis ). ...........................113 5-6 In Vivo PTU mRNA expression of genes analyz ed via QPCR in thyroid tissue of male juvenile American alligators ( A.mississippiensis). ..................................................114 5-7 In Vivo PTU mRNA expression of genes analyz ed via QPCR in thyroid tissue of female juvenile American alligators ( A.mississippiensis ). ..............................................115 5-8 In Ovo PTU mRNA expression of genes anal yzed for sexual dimorphism via QPCR in gonad tissue of juvenile American alligators ( A.mississippiensis). .............................116 5-9 In Ovo PTU mRNA expression of genes analyz ed for treatment effects via QPCR in gonad tissue of juvenile American alligators ( A.mississippiensis). .................................116 5-10 In Vivo PTU mRNA expression of genes anal yzed via QPCR in gonad tissue of female juvenile American alligators ( A.mississippiensis ). ..............................................117 11

PAGE 12

LIST OF ABBREVIATIONS AR Androgen receptor involved in receptor-ligand in teractions. AROM Aromatase. Major enzyme needed to convert testosterone into estradiol-17 cDNA Complementary DNA is synthesized from mRNA template in a reverse transcription reaction. CIP/KIP One of two families of cyclin-dependant kinase inhibitors and well characterized for their role as negative regulator s of G-phase cell cycle progression. DDE 1,1-Dichloro-2,2-bis(p-chlorophenyl) ethylene (DDE) is a breakdown product of DDT and a known EDC. DDT Dichloro-diphenyl-tricloroethane is one of the first modern pesticides and a common synthetic. It was developed early in WWII and initially used to combat mosquitoes from spreading malaria, typhus and other insect-borne human diseases. It is known as an or ganochlorine insecticide and EDC. DIT Two linked iodinated tyrosine molecules ar e diiodotyrosine. It is a component of thyroid hormones. DNA Deoxyribonucleic acid is a molecule that contains the genetic code used in the development and functioning of all living organisms. E2 Estradiol-17 Major estrogen hormone studi ed in this dissertation. EDC Endocrine disrupting contaminants. Ch emicals known to have an affect on the endocrine system. ER Estrogen receptors involved in recep tor-ligand interactions. Focus was on estrogen receptor alpha ( ) and beta ( ) of the American alligator. ICC Immunocytochemistry is a technique used to localize a nd stain specific proteins in cells of a tissue. Interchangeable with IHC. IGF Insulin-like growth factors. These are peptide growth s timulators that are structurally related to insulin and have some insulin-like activity in addition to their growth promoting actions. IHC Immunohistochemistry. A technique used to localize and stain specific proteins in cells of a tissue. This technique exploits the principl es of antibodies binding to specific antigens. LH Luteinizing hormone. 12

PAGE 13

MIT One iodinated tyrosine molecule is term ed monoiodiotyrosine. It is a component of thyroid hormones. NIS Sodium-iodide symporter. Iodide pump in the thyroid. mRNA Messenger ribonucleic acid is a molecule of RNA encoding for a specific protein. mRNA is transcribed from a DNA template. p27Kip1 p27Kip1 is a member of the CIP/KIP family of cdk inhibitors that negatively regulates cyclincdk complexes. A cyclin -dependent kinase (cdk) inhibitor, it plays important roles in cell cy cle progression in normal cells. PCB Polychlorinated biphenyls are a clas s of organic compounds known to be EDC. Most PCBs were manufactured as cooli ng and insulating fluids for industrial transformers and capacitors. PCR Polymerase chain reaction is a molecu lar biology techniqu e for isolating and amplifying a fragment of DNA. PEN Pendrin. Cloride-iodi de pump on the thyroid. PTU Proplythiouracil, an anti-thyroid compound used to treat hyperthyroidism pharmaceutically. Q-PCR Quantitative PCR is a molecular biology t echnique used to quantify relative gene expression. RNA Ribonucleic acid is a polymer composed of nucleic monomers that play various important roles in the processes that tran slate genetic information from DNA into proteins. RT-PCR Reverse transcription PCR is a techni que used to amplify, isolate or identify a known sequence from RNA StAR Steroidogenic acu te regulatory protein. T3 Triiodothyronine is a thyroid hormone. It is a combination of MIT and DIT. This form of thyroid hormone is consid ered the active form in tissue. T4 Thyroxine or tetraiodothyroni ne is a thyroid hormone. It is commonly considered the transport and non-active form of the thyroid hormones. It is considered a prohormone but nonetheless is known to be functional/active in tissues. Tg Thyroglobulin. Large protein used in the thyroid to make thyroid hormones. Tp Thyroperoxidase. Enzyme used in the thyroid for the organification of iodide. 13

PAGE 14

TR Thyroid hormone receptors involved in receptor-ligand interactions. Focus was on thyroid hormone receptor alpha ( ) and beta ( ) of the American alligator. TRE Thyroid response elements, play a role in the molecular mechanism for transcription. TRH Thyrotropin releasing hormone or thyroid hormone releasing hormone. TSH Thyroid stimulating hormone also known as thyrotropin. TSHr Thyrotropin receptor. 14

PAGE 15

Abstract of Dissertation Pres ented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy THYROID-GONAD AXIS OF TH E AMERICAN ALLIGATOR ( Alligator mississippiensis): AN EXAMINATION OF PHYSIOLOGICA L AND MORPHOLOGICAL ENDPOINTS By Dieldrich Salomon Bermudez May 2008 Chair: Louis J Guillette, Jr. Major: Zoology Thyroid hormones are known to have a coope rative role in gona dal development and function. There is a growing body of work demons trating that thyroid hor mones play a crucial role in the development of Sertoli and Leydig cells in the testis. Thyroid hormones at proper levels are necessary for ovulation and severe hypothyroidism can cau se ovarian atrophy and amenorrhea. Thyroid receptors are found in various parts of the ovary such as granulosa cells, oocytes and cumulus cells of the follicle, and co rpora lutea, indicating that thyroid hormones can play a role in various cells of the ovary. The me chanisms of action are still not well understood. In many vertebrate species, including humans, thyroid disorders are more frequent in the female population. In addition, studies have shown that neoplastic thyroids have a higher number of estrogen receptors (ER) compared to normal tissue, suggesting a relationship between the sex of an individual and susceptibility to thyroid abnormalities. Recently, it has been shown that thyroid horm one concentrations parallel sex steroid patterns in American alligators. We investig ate the mechanism of communication between the thyroid and gonad axis of the American alligator. Previous studies ha ve demonstrated a one directional endocrine pathway from the thyroi d to the gonad. We describe a possible new avenue of communication from the gonad to thyroi d via the estrogen recept or located on alligator 15

PAGE 16

16 thyroid follicles. Through the use of gene tic markers for thyroid and gonad physiology, we describe a novel mechanism of co mmunication between these two axes.

PAGE 17

CHAPTER 1 INTRODUCTION General Review The thyroid has been studied for thousands of years. The first description of thyroid disease was of abnormal enlargement of th e thyroid in humans, recognized by Chinese physicians about 3000 B.C. Since then, thyroid-a ssociated problems have been recognized and even became fashionable at one time; the painting of The Mona Lisa, with her goiter, is a famous example. In 1896, Bauman discovere d that an organic iodine-containing compound could be extracted from the thyroid. The iodine-containing hormone, thyroxine (T4) was isolated and crystallized by Edward C. Kendall in 1915. This discovery was a milestone in endocrine research, since it was the first hormone isolated in pure form. The importance of the thyroid and its functions can be grasped simply by observing that the incidence of thyroid disease in humans is exceeded only by the incidence of diabetes mellitus (Norris 1997). In amphibians, reptiles (including alligators), birds and mammals, the thyroid gland is a bilobed organ that lies ventrally to the trachea in the mid-throat re gion (Fig.1-1). Histologically, the thyroid is composed of many follicles surrounded by connec tive tissue. The follicles are filled with a proteinaceous fluid called colloid that is secreted by the single layer epithelium that comprises the wall of the follicle (Fig. 1-1). Within this colloid, several important precursor molecules accumulate that will be us ed to form the thyroid hormones. In the simplest terms, thyroid hormones are i odinated tyrosine molecules. One iodinated tyrosine molecule is termed monoiodotyrosine (MIT). Two linked iodinated tyrosine molecules are diiodotyrosine (DIT). When a MIT and DIT bind, they form the active form of the thyroid hormone triiodothyronine (T3) whereas two bound DIT molecules form thyroxine (T4) (Fig. 1-1). 17

PAGE 18

Thyroxine and T3 are present in all vertebrates as well as annelid worms and various other invertebrates such as cnidar ians, arthropods and echinoderm s (Eales 1997; Norris 1997). Thyroid hormones influence many aspects of reproduction, growth, differentiation, and metabolism (Lynn 1970; Bentley 1982; Eales 1997; Norris 1997). The thyroid is possibly the most highly vascularized endocri ne gland in mammals and appears to be one of the oldest endocrine glands phylogenetical ly (Dickhoff et al. 1983). The hypothalamus-pituitary-thyroid axis regula tion of thyroid hormone synthesis is well known (Fig.1-3). Thyrotropin rel easing hormone (or corticotropi n releasing hormone in some non-mammalian species) from the hypothalamus stimulates the production of pituitary thyrotropin (TSH, thyroid stimulating hor mone)(Norris 1997; Denver 1999). Thyrotropin stimulates the thyroid to produce and secr ete thyroid hormones (mostly thyroxine, T4). Thyroid hormones (THs) are transported to target tissues/cells where T4 is converted to T3 via iodothyronine deiodinases (Norris 1997). Following the binding of thyroid hormones to nuclear or mitochondrial receptors, THs initiate genomic gene transcription ultimately leading to synthesis of new proteins. Thyroid hormone r eceptors (TRs) recognize specific thyroid response elements (TREs) and bind predominantly as hete rodimers with the retinoid X receptors but may also form homodimers in the promoters region of targeted genes (Ba ssett et al. 2003). Nongenomic actions and binding to TH receptors have been shown at the plasma membrane, cytoplasm and cellular organelles. TRs are member s of the nuclear receptor superfamily and act as hormone inducible transcription factors (Evans 1988; Bassett et al. 2003). Two major isoforms of TRs have been well described in the literature, TR and TR 18

PAGE 19

Collaboration with Caren Helbing, of the Univ ersity of Victoria, has recently produced cloned TR and TR from the American alligator. Us ing quantitative RT-PCR (Q-PCR), we have observed that both TR and TR are expressed in the gonads of juvenile alligators (Helbing et al. 2006), with grea tly elevated levels of TR relative to TR (Fig. 1-2). Further, there appears to be a differential respons e to TSH treatment, with no effect on TR mRNA levels in either gonad 24 or 48 hr after treatment (Fig. 1-2). In contrast, TR mRNA levels were elevated in the testis but not th e ovary 24 hr after treatment (Fig. 1-2). These data suggest that, like the rodent gonad, cells in the alligator gona d express TR, suggesting that this tissue is responsive to the actions of thyroid hormones. Further, given the differential response in TR future studies are needed to dete rmine if this response could play a role in gonad development. There appears to be sparse data in the literature indicating whether or not TRs are expressed in a sexually dimorphic manner and data on the topic s uggest that sexual dimorphism is absent in TRs gene expression (Helbing et al. 2006; Bermudez in press; Bermudez unpublished data). Metabolic Effects Metabolic effects of the thyroid hormone s in mammals have been well documented. Thermogenic actions, as well as specific eff ects on carbohydrate, protein, and lipid metabolism, are among some of the well-studied effects of T3 and T4. Thyroid hormones increase synthesis of several mitochondrial respirat ory proteins such as cytochrome c, cytochrome oxidase, and succinoxidase (Stevens et al. 1995 ; Norris 1997). A decrease of basal metabolic rate would be advantageous to animals during a period of hi bernation or low caloric intake. Many nonhibernating mammals, such as the beaver and the muskrat, have depressed thyroi d activity during the winter period. Hypothyroidism has been show n to occur in hibernat ing ground squirrels and badgers (Silva 1993). The shark embryos of Squalus suckleyi show an increase in oxygen 19

PAGE 20

consumption following T3 and T4 treatment (Blaxter 1988). In creased oxygen consumption is also demonstrated with tissue obtained from the frog, Rana pipiens when treated with T4 in vivo (May et al. 1976). A study examining the lizard, Dipsossaurus dorsalis found that thyroid hormones (T4/T3) influence locomotory endurance, sugges ting an essential activity on muscular energetics (Eales 1985b). Effects on Differentiation Thyroid hormones affect differentiation, including growth, development, and metamorphosis. Thyrotoxicosis, Graves disease, Hashimotos disease, cretinism and juvenile myxedema in humans are examples of disorders in growth and development caused by altered thyroid hormone action (Norris 1997; Kilpatri ck 2002). The thyroid is known to influence metabolic rate and inhibit calcium loss in bones (G u et al. 2001). These two actions are necessary for development and normal growth (Segal 1990 ; Norris 1997; Kisakol et al. 2003). Thyroid hormones also are necessary for the normal de velopment of the nervous system. Thyroid hormone treatment of early Xenopus larvae promotes neurogenesis in the spinal cord, where thyroid receptor TR is expressed from early larval stages onward and results in precocious upregulation of several other genes (Schlosser et al. 2002). Shark ( S. suckleyi) embryos treated with T4 and T3 have accelerated differentiation of th e hypothalamic neurosecretory centers, which suggest thyroid hormones play a role in differentiation and maturation of the hypothalamo-hypophysial system (Blaxter 1988). Replacement of hair in adult mammals is stimulated by the thyroid hormones. The postnuptial molt cycle in harbor seals, Phoca vitulina gray seals ( Halichoerus grypus ) and the molt cycles in the red fox, badger ( Meles meles L. ) and mink are examples of thyroid hormone influenced hair replacement (Maurel et al. 1987; Boily 1996; Norris 1997). Molting in 20

PAGE 21

amphibians, reptiles and birds is also stimul ated by thyroid hormones (Kar et al. 1985b; Sekimoto et al. 1987; Norris 1997). Metamorphosis in amphibians and fish and sm oltification in salmonid fishes are probably the best-known effects of thyroid hormones in non-mammalian vertebrates. Thyroid hormones play crucial roles in the metamorphosis of a frog from a tadpole (Denver 1998; Wright et al. 2000). During flounder metamorphosis, T4 concentrations increase and are associated with the migration of the eye and attendant neural struct ure to one side and the mouth and associated structures to the other side of the head (Blaxter 1988). Behavior al changes are a ssociated with this alteration as well. Another example of thyroid-regulated metamorphosi s is smoltification in many salmonids like the Atlantic salmon ( Salmo salar ) (Kulczykowska et al. 2004) and Coho salmon (Oncorhynchus kisutch ) (Sweeting et al. 1994). Smoltific ation is the transformation from freshwater parr to smolt with pre-ad apted osmoregulation for salt water. Permissive Actions Thyroid hormones also play a role in modifying the action of other cell signals, generally termed permissive actions. Many of the actions of thyroid hormones occur cooperatively with different hormones or cell signaling agents (paracri nes or autocrines). This cooperative role or permissive action is common, where the thyroid ho rmone enhances the effectiveness/sensitivity of the other hormones or neural stimuli. The perm issive actions of THs may be related to events such as the stimulation of the synthesis of components of second-messenger systems, upregulation of receptors for another regulator, eff ects on structural components, etc. (Norris 1997). For example, several of the non-genomic actions of thyroid hormones include the modulation of Na+, Ca+, and glucose transport, activ ation of protein kinase C, protein kinase A and estrogen receptor kinases/mitogen activated protein kinases and regulation of phospholipid metabolism by activation of phospholipase C and phospholipase D (Kavok et al. 2001). In addition, many 21

PAGE 22

thyroid mediated metabolic actions occur in cooperation with other hormones such as epinephrine and growth hormone. Thyroid hor mones alter nitrogen ba lance and are either protein anabolic or catabolic (Kawaguchi et al. 1994; DeFeo 1996; Rendakov et al. 2003). These actions are related to an enhancement of th e effects normally regulated by other hormones. Thyroid hormones, for example, can stimulate insulin-like growth fact ors or IGF production, which augments the action of growth hor mone (Nanto-Salonen et al. 1993). Thyroid hormones also have a cooperative role in gonadal development and function. Cycles in the plasma concentrations of thyroid hormones are positively correlated with reproductive cycles in various vertebrate spec ies. For example, thyroid hormone serum concentrations of the sheath-tailed bat, Taphozous longimanus were higher during gonadal recrudescence and the breeding period during late winter dormancy but were minimal during gonadal quiescence and the initial stages of pregnancy (Singh et al. 2002a). Ovarian T4 concentrations have been shown to increase duri ng vitellogenesis and oocy te final maturation but decrease during embryogenesis in the viviparous rockfish, Sebastes inermis (Kwon et al. 1999a). Serum T4 concentrations also fluctuated season ally in Kemps ridley sea turtles (Lepidochelys kempi ), with elevated concentrations observed in females during vitellogenesis when plasma E2 concentrations are elevated (Rostal et al. 1998a). Thyroid hormones are increased in many teleost fishes during periods when they are exhibiting spawning, pre-migratory, and migratory behaviors (Blaxter 1988). The thyroid hormones are hypothesized to have a permissive role as opposed to a causative role in these behaviors. The behavioral changes that occur during and after metamorphosis in vertebrate s are also thought to be permi ssive roles of thyroid hormones. During metamorphosis in amphibians, thyroid hormones act to augment the effects of corticotrophins, thus providi ng a permission action (Denver 1998). 22

PAGE 23

Sexual Dimorphism in Thyroid Disease In many vertebrate species, including humans, thyroid disorders are more frequent in the female population (Arain et al. 2003). In addition, studies have shown that neoplastic thyroids have a higher number of nuclear estrogen receptors (ER) compared to normal tissue (Manole et al. 2001), suggesting a relationship be tween the sex of an individual and susceptibility to thyroid abnormalities. ERs are part of a family of nuclear receptors that act as transcription factors, response for significant changes in gene expre ssion following exposure to such hormones as sex and stress steroids. Additionally, since the thyr oid plays a role in hormone regulation, and hormone production changes during an animals de velopment from neonate to juvenile through adulthood, it is possible that estrogen recep tor expression changes with developmental maturation. Adults are expected to have grea ter estrogen receptor expression and seasonal variation in receptor expression since they have elevated circulat ing sex hormone concentrations due to reproductive activity. For example, our laboratory has reported dramatic changes in circulating concentrations of estradiol-17 in female alligators throughout the reproductive cycle (Guillette et al. 1997). We have also reported that peri-pubertal alligators show seasonal changes in plasma concentrations of E2, but these levels are 10 to 100 fold lower than those reported in adult females (Rooney et al. 2004) and yearling al ligators have further reduced, but detectable plasma E2 concentrations (Guillette et al. 1994). Our initial study in juvenile alligators demonstrated that exogenous E2 would depress expression of ER but not ER in the ovary suggesting that as with other species, ER e xpression can be influenced by changing plasma concentrations of E2 (Katsu et al. 2004). Is the phenomenon of greater thyroid diseas e in females due to a sexually dimorphic pattern in the expression of steroid receptors? Could there be differences in the expression of 23

PAGE 24

estrogen and androgen receptors (ER and AR, resp ectively) or even TRs in the thyroid at different life stages that might explain these observed differences in disease rates? One study on human thyroid tissue showed no significant differen ce in ER incidence (Hiasa et al. 1993). These questions, however, have been poorly studied in vertebrates and will be addressed in this dissertation. Thyroid and EDCs: An Emerging Field Endocrine disrupting contaminants (EDCs) have been shown to modify or impair function in various endocrine organs, including the thyroid (Zoeller 2003). DDT (an organochlorine used as a pesticide), its metabolites and various othe r environmental contaminants exert an effect on the thyroid by disrupting one of several possible steps in the bi osynthesis and/or secretion of thyroid hormones (Fig. 1-1). These steps include: (1) inhibi tion of the iodine trapping mechanism (thiocyanate or perchl orate have been shown to exhi bit this mode of action), (2) blockage of organic binding of iodine and coupling of iodot hyronines to form thyroxine (T4) and triiodothyronine (T3) (sulfonamides, thiourea, methimazole, am inotiazole act at this stage), or (3) inhibition of T3/T4 secretion by affecting proteolysis of active hormone from the colloid (methimazole, propylthiouracil and flavanoids are known to affect secretio n)(Capen 1992; Capen 1994; Hamann et al. 2006; Moriyama et al. 2007). Contaminants can also alter thyroid hormone action by other mechanisms. For example, DDT has been shown to disrupt thyroid hormone availability by increasing the peripheral metabolism of thyroid hormones through an induc tion of hepatic microsomal enzymes (Capen 1992; Capen 1994). Male juvenile al ligators from Lake Apopka, that are exposed to a wide array of environmental chemicals and have elevated or ganochlorine pesticide re sidues in their tissues and blood (especially p,p-DDE), exhibit elevated plasma T4 concentrations when compared to male juvenile alligators from Lake Woodruff, FL, a reference s ite and National Wildlife Refuge 24

PAGE 25

(Crain et al. 1998). DDT-treatment in rats increased thyroid mass as well as plasma T3 and T4 concentrations. Rats also displayed decreased thyroid iodine, serum iodine and protein-bound iodine levels (Seidler et al 1976; Goldman 1981). A metabolit e of DDT, p,p-DDE has been shown to have similar effects on thyroid hormones. There is a positive correlation between serum concentrations of DDE and T4/FreeT4 in polar bears (Skaare et al. 2001). Another DDT metabolite, o,p-DDD has been shown to increase T3, T4 and free T4 concentrations in dogs. This compound can be used to treat hyperadrenoc orticism in canines as well, as it suppresses adrenal steroidogenesis (Ruppert et al. 1999). Japanese quails expos ed to DDT displayed a slight decrease in T4 but a moderate increase in T3 (Rattner et al 1984). Ring doves ( Streptopelia risoria ) fed a diet dosed with DDE and PCB (Aroclor 1254) had plasma T4 increase in a dose dependant manner that caused a doubling in the bi rds exposed to the highest doses (McArthur et al. 1983). In freshwater catfish ( Clarias batrachus), endosulfan (an insecticide used on various crops) decreases T3 but increases T4, whereas malathion (an insecticide, used in mosquito control) induces a decrease in T3 and no change in T4, and carbaryl (a broa d spectrum insecticide used in forestry) increases T3 and provokes a decrease in T4 (Sinha et al. 1991). The mechanisms that induce these varying effects are unknown. Other known EDCs, such as the polychlorinated biphenyls (PCBs; us ed as coolants and lubricants in transformers, capacitors and other electrical equipment), PBDEs and dioxi n inhibit thyroid horm one binding to plasma transport proteins, such as tran sthyretin, resulting in more rapi d clearance and decreased plasma thyroid hormone concentrati ons (Brouwer et al. 1998). Nitrogen pollution, in the form of nitrates, has recently emerged as another area of concern as they appear to have the potenti al to disrupt the thyroi d axis. Bulls administ ered nitrates orally within environmentally relevant ranges had depre ssed thyroid activity with a decrease in plasma 25

PAGE 26

T4 concentrations as well as suppressed hypothalamic function with non-detectable levels (< 0.001 g/ml) of the pituitary hormone thyrotropin (TSH) following a challenge test with the hypothalamic releasing hormone TRH (Zraly et al. 1997) Elevated nitrates in the diet also has been shown to depress thyroid function in humans and are associated with goiter in some nitrateexposed children (Gatseva et al 1998a; Gatseva et al. 2000a). Nitrates have been shown to depress circul ating thyroid hormones in other mammals and some fishes (Lahti et al. 1985; Katti et al. 1987; Gatseva et al. 1992; Brunigfann et al. 1993; Kursa et al. 2000). Animals exposed to nitrates also exhibit altered thyroid morphologies, including hypertrophy of the thyroid, increased cell height of the thyroid follicle cells, vacuolation in the periph ery of the folliculi, and reduction of colloid (van Maanen et al. 1994). Nitrate contamination has also been shown to decrease iodide uptake (Lahti et al. 1985; Katti et al. 1987). The inability to take up iodide at adequate levels by the thyroi d would alter thyroid action if this eff ect were chronic. Thyroid and Gonadal Development There is a growing body of work demonstrating that thyroid hormones play a crucial role in the development of Sertoli (cell assisting spermatozoa production) and Leydig cells (steroid producing cells) in the testis. Manipulation of the thyroid environment can be used to produce increases in testis size, Sert oli cell number, and sperm producti on (Cooke et al. 2004). Neonatal hypothyroidism is shown to impair testicular development (Jannini et al. 1995). However, hypothyroidism in neonatal rats, which is followed by a recovery to euthyroidism, leads to an increase in testis size and da ily sperm production in adult rats (Cooke et al. 1991a). This body of work, in conjunction with other studies indicat ing that thyroid hormone receptors (TRs) are present in high quantities in the neonatal testis, led to the hypothesis that thyroid hormones could have key roles in testicular development (Palmero et al. 1988; Jannini et al. 1990). 26

PAGE 27

Cooke et al. (1994) st ate that it appears T3 normally inhibits Sertoli cell proliferation directly while stimulating differentiation. Thes e actions are observed in neonatal hypothyroid animals. Also, neonatal Se rtoli cells e xpress both TR and TR although the relative contribution of these receptors in thyroid signaling remains unclear (Jannini et al. 1994; Palmero et al. 1995; Buzzard et al. 2000). Developmental hypothyroidism and an increase in adult testis size is not solely described in rats but also in mice (Joyce et al. 1993), humans (Jannini et al. 2000), bulls (Majdic et al. 1998), roosters (Kirby et al. 1996) a nd fish (Matta et al. 2002). Additionally, recent work indicates that the mechanism of Sertoli cell proliferation in hypothyroidism is through regulation of p27Kip1, a member of the Cip/Kip family of cyclindependant kinase inhibitors and a critical regulator of prolifer ation of many cell types (Cooke et al. 2004). Thyroid hormones increase p27Kip1 expression in developing Sertoli cells (Buzzard et al. 2003; Holsberger et al. 2003) and hypothyroidism leads to a down regulation of p27Kip1 expression (Holsberger et al. 2003). This recent work provides a m echanistic template for further molecular studies in this area. Thyroid hormones also play an active role with Leydig cells during development and adulthood. Several studies demonstrate how hypothyroidism decreases testosterone concentrations in adults and is attributed to a decrease in response to tropic hormones like luteinizing hormone (LH) (Hof fman et al. 1991; Anthony et al 1995; Maran et al. 2001). Recently, it was demonstrated that thyroid horm ones influence steroidogenic acute regulatory protein (StAR). Lack of thyroid hormone cause s a down regulation of St AR mRNA and protein, resulting in impaired testosterone produc tion in these cells (M anna et al. 2001b). The literature on the role of thyroid horm ones on ovarian function and development is sparse compared to studies on testis. Thyroi d hormones at proper levels are necessary for 27

PAGE 28

ovulation (Maruo et al. 1992). Doufas et al. (2000) demonstrated that severe hypothyroidism can cause ovarian atrophy and amenorrhea. TRs are found in various parts of the ovary such as granulosa cells (Maruo et al. 1992; Zhang et al. 1997), oocytes and cumulus cells of the follicle (Zhang et al. 1997), and corpora lutea (Bhattach arya et al. 1988), i ndicating that thyroid hormones can play a role in various cells of th e ovary. The mechanisms of action are still not well understood. Recent evidence also suggest that thyrotro pin receptors found on gonadal tissue play a direct role in reproductiv e physiology of several teleost spec ies (Goto-Kazeto et al. 2003; Rocha et al. 2007). Recent work on the American allig ator also suggest that the gonads are being stimulated by thyrotropin and upregulating expressi on of TRs in the gonad (Helbing et al. 2006). The literature on thyroid-gonad inte raction details pathways from the thyroid axis to the gonad (Fig.1-3) (Norris 1997; Johnson et al. 2000; Senger 2003). Regulati on via estrogen receptors to the hypothalamus and pituitary has also been doc umented but no pathway from the gonad to the thyroid has been shown in the liter ature. Is there a regulatory pa thway from the gonad directly to the thyroid? Hypotheses This study will examine the thyroidal/gonadal ax is of the American alligator. We will examine two major areas of thyroidal and gonadal act ivity; the affect of the thyroid axis on the development of the gonad and a mechanism of communication between the thyroid and gonad. In particular, I will attempt to address whet her the thyroid plays a role in the sexual differentiation of the gonads and re production in alligators. The role of the thyroid axis in the development and functioning of the gonad during the neonatal and peripubertal periods will also be investigated. The experiments performed are divided into two groups, developmental studies and juvenile studies. The developmental studies examine gonadal differentiation and 28

PAGE 29

development following exposure to an antithyroid-agent during th e window of sexual differentiation. In the studies of adolescent al ligators (juvenile peripube rtal individuals ranging 100 150 cm in length), I will describe normal physiology and morphology of the thyroid/gonad axis. Does the thyroid axis influence seasonal reproductive hormone variation? We will ultimately attempt to describe a novel mechan ism of communication between the thyroid and gonad axis. This mechanism will include the ch aracterization of ER and AR on the thyroid follicle as well as expression levels of these rece ptors to manipulations. I propose to test several hypotheses stated below. Hypothesis 1 : Plasma thyroxine concentrations display seasonal variatio n that parallels seasonal variation in sex steroid concen trations, not seasonal activity patterns. Hypothesis 2 : ER, AR and TR expression on the t hyroid will vary am ong life stages and show sexual dimorphism. Hypothesis 3 : Treatment of the thyroid with proply thiouracil (PTU), and anti thyroidal pharmaceutical agent, will alte r the expression of genes related to gonadal physiology. Hypothesis 4 : By blocking the thyroid with PTU dur ing the temperature dependant sexual differentiation period of the alligator embryo, an alteration in the development of the testis or ovary will be observed. 29

PAGE 30

Figure 1-1: Location, structure a nd basic function of the thyroid follicle in a representative reptile, such as the American alligator. The thyroid is a bi-lobed structure, composed of follicles that accumulate iodine, and form iodinated tyrosine molecules that are used to make the thyroid hormones T3 and T4. 30

PAGE 31

Figure 1-2: Gonadal expr ession of alligator TR and TR mRNAs as determined by quantitative RT-PCR. Juvenile male and female alliga tors were treated with ovine TSH by i.v. injection and tissues were obtained 24 or 48 hr after treatment. (Helbing et al. 2006) 31

PAGE 32

32 Figure 1-3: Thyroid-gonad axis of regulation. TSH secreted from pituitary has stimulatory role on thyroid and gonad. FSH secreted from p ituitary has stimulatory role on gonads. E2 secreted from gonads plays an inhibitory role in pituitary on FSH secretion. E2 possibly plays a regulat ory role on thyroid.

PAGE 33

CHAPTER 2 SEASONAL VARIATION IN PLASMA THYROXINE, TESTOSTERONE AND ESTRADIOL-17 CONCENTRATIONS IN JUVENILE ALLIGATORS ( Alligator mississippiensis) FROM THREE FLORIDA LAKES1. Introduction The thyroid hormones influence many aspects of reproduction, growt h, differentiation, and metabolism in vertebrates. Metabolic effect s of these thyroid hormones have been well documented (Lynn 1970; Eales 1985a; Eales 1988). Thermogenic action, such as positive and negative effects on carbohydrate, pr otein, and lipid metabolism, ar e among the actions of these hormones. Further, thyroid hormones increase synthesis of several mitochondrial respiratory proteins, such as cytochrome c, cytochrome oxidase, and succinoxidase (Norris 1997). These compounds are necessary for normal development of the nervous system and influence molting in amphibians, reptiles and birds as well as sm oltification in many salmonids (Lynn 1970; Norris 1997; Shi 2001). Circulating concentrat ions of thyroxine (T4) have been observed to fluctuate during the year in various species (Kar et al. 1985a; Kuhn et al. 1985; Gancedo et al. 1997). For example, the frog Rana ridibunda has a plasma T4 cycle which peaks during the months of February through April, T4 plasma concentrations then drop a nd peaks again during October\November. The two peaks occur during periods of changi ng photoperiod and rainfall (Kuhn et al. 1985). A similar pattern in plasma concentrations of T4 is found in a reptile, the Indian garden lizard, Calotes versicolor, from the same geographical region (Kar et al. 1985a). The first peak is found prior to reproduction and the second prior to hibernation or a pe riod of low metabolic activity. Decreased basal metabolic rate would be advantageous to animals during a period of hibernation or low caloric intake. Reduced food intake in mammals and fish has been shown to reduce 1 Part of this chapter is published in Comparative Biochemistry and Physiology A (Bermudez et al., 2005). 33

PAGE 34

thyroid hormone production (Eales 1988; MacKenzie et al. 1998) Thyroxine concentration decreases prior to winter months and is lowe st during hibernation in the Chinese cobra, Naja naja and the Desert iguana, Dipsosaurus dorsalis (Bona-Gallo et al. 1980; John-Alder 1984). Although alligators in Florida do not exhibit true hibernati on, they do endure a period of low caloric intake and inactivity during the winter months. Do alligators exhibit seasonal variation in circulating T4 concentration similar to that observed in ot her vertebrates experiencing winter inactivity? Is an abiotic envi ronmental factor, such as temperature correlated with plasma concentrations of T4? For example, stress can influence thyroid hormone concentrations in humans, mice, birds, and fish (Bau et al. 2000; Davis et al. 2000; Kioukia et al. 2000; Morgan et al. 2000; Steinh ardt et al. 2002; Coleman et al. 2003). Our laboratory has previously reported that contaminants can alter hormone concentrations in alligators and fish, including sex steroids and thyroid hormones (Crain 1997; Guillette et al. 2000; Orlando et al. 2002; Toft et al. 2003). Thyroxine concentrations have been shown to be elevated in male juvenile alligators from a contaminated site when compared to reference juveniles (Crain et al. 1998). That study, however, only examined animal s for a single period in time. Would the pattern of plasma T4 concentration found in alligators from a contaminated site mimic that found in alligators from reference sites or would it be different? Further, w ould the alterations, if present, be consiste nt throughout the year? Materials and Methods Study Sites This study examined seasonal variation in plasma concentrations of T4 in juvenile American alligators from three populations in ce ntral Florida, USA. One site, Lake Woodruff National Wildlife Refuge, is considered a refere nce site whereas the other two lakes, Lake Apopka and Orange Lake, are significantly impa cted by human activity. Lake Woodruff (lat. 34

PAGE 35

2906N, long. 81 25W) is a relatively pristine environm ent with little modern agricultural activity in its watershed and little discharge of nutrient-ladened agri cultural or storm water discharge. For example, alligators from this lake have lower concentrations of various organochlorine (OC) pesticides or their metabolites in their blood than lake Apopka (Heinz et al. 1991; Guillette et al. 1999b). Anim als from Orange Lake (lat. 29 26N, long. 82 11W) have similar low levels of OC pollutants as those fr om Lake Woodruff (Guillette et al. 1999c) but is eutrophic. The third population (L ake Apopka) is a historically contaminated site, receiving city effluent until 1970s as well as direct agricultural runoff until 1998 (Woodward et al. 1993; Guillette et al. 2000). Lake Apopka (lat. 28 40N, long. 81 38W) is the fourth largest lake in Florida and 1.5 miles downstream from an EP A Superfund site (EPA 1994). Lake Apopka was directly connected via a freshwater stream to the site of a major pesticide spill of dicofol (composed of 15% DDT) and sulfuric acid in 1980 (EPA, unpublished report). Animals and eggs from this lake environment exhibit elevated concentrations of OCs and the lake is highly eutrophic relative to other areas (Heinz et al. 1991; Sengal et al. 1991; Schelske et al. 1992; Guillette et al. 1999b). Sample Collection Juvenile American alligators ( A. mississippiensis ) ranging from 75cm 150cm in total length were hand captured at nigh t during the hours (h) of 8 pm 1 am. The majority (80 90 %) of the samples where collected during the period of 9 pm 11 pm. Alligators of this size, range from 2 6 years of age (Milnes et al. 2002). A majority of juveniles collected were first time captures with a small percentage (approximat ely 10%) of recaptures. All animals captured conformed to the same size and age class. Appr oximately 30 alligators were collected each night with a minimum of 10 males and 10 females obtai ned from each lake. Collections occurred 35

PAGE 36

during the middle 2 weeks of each month and all sa mples where collected within a week of each other for all three sites. Samples from juvenile alligators living in Orange Lake were collected from November 2000 April of 2002, except during March 2002. No collections of juvenile alligators where possible on Orange Lake during May and June of 2001 because of a drought that lowered water levels enough to prevent entry with boats. Blood sample s were collected from juvenile alligators from Lake Woodruff be tween March 2001 April 2002, except during March 2002. Finally, samples from the alligators living in Lake Apopka were collected between February 2001 April 2 002, except March 2002. An immediate blood sample (within 3 min of capture) was obtained from the postcranial supravertebral blood vessel once the animals wh ere secured. Approximately 10 ml of blood was taken from each animal (depending on size). Bl ood was collected in a heparinized Vacutainer and stored on ice for 8 10 h until centrifugation at 1,500 g for 20 min. Plasma T4 concentrations do not change in whole and clotted blood stored for 72 h at 4 C or room temperature (22 26 C) (Reimers et al. 1982). Pl asma was stored at -80 C. On site water and air temperature was collected as well as body temperatur e within the first 5 min of capture. Figure 2-1 displays the average cloacal temperature for the juvenile alligators from each lake during the months of this study. The average (high, low) air temperature for each month from all three lakes is displayed in Figure 2. Other morphometr ic measurements were then obtained. These measurements included total length, snout-vent le ngth, weight, sex, and if male, phallic tip and cuff length using predefined criteria (Allsteadt et al. 1995; Guillette et al. 1996). Animals were released in the vicinity of capture once all measurements were recorded. 36

PAGE 37

Thyroxine Radioimmunoassay and Statistical Analysis Total thyroxine (T4) was analyzed using a radioimmunoassay (RIA) previously validated for alligator plasma (Crain et al. 1998). A prev ious study from our laboratory (Crain et al. 1998) demonstrated that body length of juvenile alligators was a covariate of plasma T4 concentrations. Thus, a subset of all the sample s collected, based on juvenile snout vent length, was used for RIA analysis. That is, 7 to 10 males and 7 to 10 females of a matched size were selected from each lake for each month to remove the possible c onfounding effects of body size. Animals ranged in length from 79 cm to 122.5 cm with a mean of 1 04.1 cm. Juvenile alligators sampled ranged in weight from 1.7 kg to 9.7 kg and had a mean wei ght of 3.2 kg. Hormone concentrations were determined from raw CMP (counts per min) data using a log-linear cubic spline standard curve generated by Microplate Manager PC 4.0 (Bio-Rad Laboratories, Inc., Hercules, CA). Interassay variance was 16.3% whereas intraas say variance was 6.6%. Intraassay variation was determined by calculating the average variation between dup licate samples in every assay (n = 1466). Interassay variation was determined by calculating the average variation in interassay sample from each assay (n = 17) of plasma created fr om a pool of juvenile plasma. Values were corrected for interassay variation. Briefly, the assay most medi an in variation was chosen as the base. The other assays and their respective T4 concentrations where then corrected by multiplying the percentage of variation from the b ase assay. This procedure was applied to all assays until interassay variation was not present. Analysis of variance (ANOVA) was performed to determine if differences in T4 concentrations occurred among months, lake or between sexes for animals in the three alligator populations. All statistical tests were performed with Statview 5.0 (SAS Institute Inc., Cary, NC). Sta tistical significance was considered if p 0.05. 37

PAGE 38

Results To determine if ANCOVA analyses were requ ired, we examined if a relationship existed between plasma T4 concentrations and weight snout-vent length (SVL), or cloacal temperature, using linear regression analyses wi th data for all months combined or each month separately. Significant relationships were not observed between plasma T4 concentration and either weight (r2 = 0.001; p = 0.47) or SVL (r2 < 0.001; p = 0.92) when all months were examined together. A relatively weak relationship, however was detected between plasma T4 concentration and cloacal temperature (r2 = 0.074; p < 0.0001). Plasma T4 concentration and weight, SVL and cloacal temperature were then regressed for each month; no relationships were significant. Figure 2-1 displays the average cloacal temperature for the juvenile alligators from each lake during the months of the study. The average (high, low) air temperature for each month from all three lakes is displayed in Fig. 2-2. We examined plasma T4 concentrations in juvenile alligators using a 3 way ANOVA, with lake of capture, month of capture and sex as variables. The effect of month of capture on plasma T4 concentrations was highly significant (F = 58.8; df = 12, P < 0.0001: Fig. 2-3, 2-4). Although not consistent every month, in spring a nd fall male and female alligators from lake Apopka had higher concentrations of T4 whereas in winter the concentrations where lower than those observed in animals from lake Woodruff a nd Orange. Likewise, the lake from which the animals were obtained also influenced plasma T4 concentrations (F = 7.94; df = 2, P = 0.0004: Fig. 2-3, 2-4). Sex of the indivi dual had no influence on plasma T4 concentrations alone (P = 0.82) but the interaction between sex and date of capture was significant (F = 2.68; df = 36, 569; P < 0.0001). Although a difference was noted in plasma T4 concentration when males and females were examined, no consistent pattern of sexual dimorphism was noted, as females had elevated levels compared to males in some mo nths whereas males had the higher concentrations 38

PAGE 39

in other months or no difference was noted (F ig. 2-3, 2-4). The one major difference seen between males and females was a dramatic peak in plasma T4 concentrations in females captured in September, whereas males showed no change from the previous month. Discussion Plasma T4 concentrations in juvenile alligators exhibit seasonal variation that are not driven by ambient temperature alone, as we obtained a poor co rrelation between body temperature and plasma T4 concentration. The poor correla tion and lack of significance when plasma T4 concentrations were regressed against we ight and SVL also were expected as the subset of samples examined in this study was selected for conformity for these variables. However, by constructing our samples sets in this way, we removed the possible confounding effects of SVL and weight as variables influenc ing the analysis. The significant relationship found between cloacal temperature and plasma T4 concentration had a relatively low r2 value (less than 0.07 0.2 for a given mo nth of capture) suggesting that variation in plasma thyroxine concentration is apparently induced by additional biotic and abiotic factor s such as water level, nutritional level, behavior or contaminants. We observed that ambient and body temperatures were highest during spring and summer months w ith an expected drop during the fall and winter months. Our data reveal that plasma T4 concentrations in both male and female juvenile alligators were increased during the transition from winter to spring months and late fall and winter. The increase in plasma concentrations in spring coincides with increasing ambient temperature but the greatest variation occurs during the fall and winter months when temperatures drop precipitously from October November. However, we observed a highly significant increase in plasma T4 concentrations during the period when ambient temperatures were lowest, the period of December February. 39

PAGE 40

Thyroid cycles are positively correlated with reproductive cycles in various vertebrate species. Thyroid hormone concentrations in serum of the sheath-tailed bat, Taphozous longimanus were elevated during gon adal recrudescence and the breeding period, during late winter dormancy, and minimal during gonadal quiescence and the initial stages of first pregnancy (Singh et al. 2002b). Ovarian thyroxine concentrations have been shown to increase during vitellogenesis and oocyte final matura tion and decrease during embryogenesis in the viviparous rockfish, Sebastes inermis (Kwon et al. 1999b). Serum thyroxine also fluctuated seasonally in Kemps ridley sea turtles ( Lepidochelys kempi), with elevated levels observed in females associated with the pe riod of vitellogenesis (Rostal et al. 1998b). Thyroid hormones are increased during spawning, premigratory, and migratory behaviors of many teleost fishes (Blaxter 1988). Plasma T4 concentrations in juvenile alligators e xhibit a pattern similar to that seen in plasma testosterone (T) and estradiol-17 (E2) concentrations reported by our group for a different set of plasma samples obtained several years earlier from juvenile alligators (these animals are of a size and age reported to be non sexually mature) (Rooney et al. 2004). We have suggested, based on these and other data (Edwards et al. 2004) that alligators exhibit a multi-year onset of puberty and that juvenile animals, of the size studied by our group previously and in this study, are actually peripubertal. Juvenile males display a peak in plasma T concentrations in March, followed by a decline and then a rise again in August (Rooney et al. 2004). Females showed a rapid rise in plasma E2 concentration during the spring, w ith a peak in June (Rooney et al. 2004). In the present study, plasma T4 concentrations peaked during April. Given these patterns, we hypothesize that thyroid hormones could play a cooperative role with T and E2 in juveniles, helping stimulate im portant events in puberty. 40

PAGE 41

Ando et al. (2001) has shown that prolonged exposure to T3 in neonatal rats is a mechanism by which thyroid hormone can down re gulate aromatase activity in Sertoli cells. Also, work with Meishan boars found that tr ansient neonatal hyperthyroidism during late gestation was associated with a decline in pro liferation and early maturation of Sertoli cells, followed by early onset of puberty (McCoard et al. 2003). These obser vations indicate a possible role for thyroid horm one in modification of Sertoli cell development, thereby influencing growth and differentia tion of the testis. Precocious puberty has been reported as a complication of severe acquired hypothyroidism in children (Chattopa dhyay et al. 2003). Additionally, T4 plasma concentration increased during prepubertal and peri pubertal periods in rhesus monkeys and appear to occur in concert with the peripubertal increa se in testicular size (Mann et al. 2002). The changes in T4 during the peripubertal period suggest that thyroid status could be a significant contributor to the process of sexual development. We also observed a significant rise in plasma T4 concentrations between November and December in males and females; a pattern similar to that found in vertebrates that hibernate (Kar et al. 1985a; Kowalczyk et al. 2000 ). Animals captured in Decemb er also display an increase in cloacal temperature. This peak could be attributed to the rise in plasma T4 seen in December since thyroid hormones are potent stimulators of thermogenesis and metabolism. Although Florida has short and relatively mild winters compared to more northern temperate regions, this peak could be prehibernatory for alligators, a subtropical sp ecies. Alligators do not exhibit hibernation but do display cold temperature to rpor, involving relatively low body temperature, reduced or no food intake and greatly reduced activity levels (Mcl lhenny 1987; Grenard 1991; Levy 1991). 41

PAGE 42

Juveniles from Lake Woodruff appear to exhibit a seasonal pattern in plasma T4 concentration that is si gnificantly different from that s een in animals from Lake Apopka. Animals from Orange Lake appeared to display a pattern intermediate to that observed on the other two lakes. We noted th at the seasonal patterns between lakes Woodruff and Apopka were reasonably similar although the concentrations of T4 in any given month could vary significantly. The populations of alligators in these three lakes were chosen as they represented three unique environments as discussed earlier, but also re presented populations with many similarities. Samples were obtained each month on consecutiv e nights to minimize weather, photoperiod and temperature difference. These lakes are less th an 75 miles apart on a no rth south axis with Lake Apopka being the southernmost lake and Or ange Lake being the northernmost (for map of lake locations see (Guill ette et al. 1999a). A recent populat ion genetics study indicated that the animals from these three lakes are similar; a pa nel of molecular markers could not distinguish animals taken from these three la kes (Davis et al. 2002). A numb er of studies have shown that xenobiotic contaminants, such as organochlorine (OC) pesticides (or th eir metabolites), PCBs (polychlorinated biphenyls) a nd PBDEs (polybrominated diphenyl ethers) influence the thyroid axis (Brucker-Davis 1998; Zoelle r et al. 2000; Zoeller et al. 2002). Further, additional studies have begun to document the role of nitrates in th e disruption of the thyroid axis (Guillette et al. 2005). Nitrates/nitrites have rece ntly been shown to depress thyr oid function and are associated with goiter in some nitrate-exposed children (Gat seva et al. 1998b; Gatsev a et al. 2000b). They also alter gene expression for the thyroid recepto r in an amphibian (Barbeau et al. 2007). Many Florida lakes exhibit nitrate contamination. Our lab has previously shown altered T4 concentrations in juvenile alligators living in Lake Apopka and Lake Okeechobee, both eutrophic lakes (Crain et al. 1998). The fact that plasma T4 concentrations from alligators in 42

PAGE 43

Lake Apopka seem to vary from the pattern di splayed in the reference lake, Lake Woodruff, could be due to the elevated exposure to pollutants in Lake Apopka; that is, both elevated OCs and NO3/NO4, whereas the primary polluta nt in Orange Lake is NO3/NO4. Plasma concentrations of T4 are but one measure of thyroid action and future studies need to reexamine other aspects of the thyroid axis before we can determine if the differences we have observed among the animals from these lake s are biologically significant. In conclusion, we have observed that j uvenile American allig ators display seasonal variation in circulating T4 concentrations. Plasma T4 concentrations peak in March or April but the pattern observed does not parallel that of ambient or body temperature. Although we have detected significant differences in the basi c pattern, especially when month and plasma concentrations are compared among the animals from the three lakes, the general seasonal patterns observed for both sexes fo r the three lakes are generally similar. Future studies are required to determine if the differences obs erved among the populations are related to contaminants found in these wetlands or if other factors contribute to the observed differences. Further, comparing the seasonal pattern obs erved in plasma concentrations of T4 with the seasonal patterns in other hormones, such as testosterone, estradiol-17 and corticosterone could provide insight into the endocrino logy of the multiyear puberty this species appears to exhibit. 43

PAGE 44

Figure 2-1: Average cloacal temperature ( C) for juvenile American al ligators during the months of March 2001 through April 2002 from La kes Woodruff, Apopka, and Orange, Florida, USA. The sample size for each cl oacal temperature ranged from 11 20 data points per month. Only temperatures from samples for which thyroxine concentrations were obtained are presented. 44

PAGE 45

Figure 2-2: Mean (high and lo w) ambient air temperature ( C) during the months of March 2001 through April 2002 from Lakes Woodruff, Apop ka, and Orange, Florida, USA. The temperature information obtained from the ci ties nearest the lakes as listed by the Weather Channel. 45

PAGE 46

Figure 2-3: Mean ( 1 SE) plasma thyroxine (T4) concentration (ng/ml) for male juvenile American alligators during the months of March 2001 through April 2002 from Lakes Woodruff, Apopka, and Orange, Florida, USA. a = statistically significant difference between juveniles from Lakes Wood ruff and Apopka for a given month, p 0.05, b = statistically significant di fference between juveniles from Lakes Woodruff and Orange for a given month, p 0.05, and c = statistically significant difference between juveniles from Lakes Apopka and Orange for a given month, p 0.05. 46

PAGE 47

47 Figure 2-4: Mean ( 1 SE) plasma thyroxine (T4) concentration (ng/ml) for female juvenile American alligators during the months of March 2001 through April 2002 from Lakes Woodruff, Apopka, and Orange, Florida, USA. a = statistically significant difference between juveniles from Lakes Woodru ff and Apopka for a given month, p 0.05, b = statistically significant difference betw een juveniles from Lakes Woodruff and Orange for a given month, p 0.05, and c = statistically significant difference between juveniles from Lakes Apopka and Orange for a given month, p 0.05 .

PAGE 48

CHAPTER 3 ESTROGEN RECEPTOR EXPRESSION IN THE THYROID FOLLICLE OF THE AMERICAN ALLIGATOR ( Alligator mississippiensis ) DURING DIFFERENT LIFE STAGES. Introduction The thyroid and its hormones play essentia l roles during developm ent and growth of numerous tissues such as the central nervous system and skeleton (Norris 1997; Styne 1998; Cayrou et al. 2002; Bernal et al. 2003). Additionally, this axis has been shown to play various roles in homeostasis, cellular metabolism and reproduction (C ooke et al. 1991b; Norris 1997; Arambepola et al. 1998). Recently, it has been shown that seasonal variations in plasma thyroxine concentrations parallel seasonal variations in sex ster oid concentrations in juvenile alligators (Bermudez et al. 2005). This observed pattern suggests that the thyroid axis could have a role in regulating gonadal activity and vice versa. Sex steroid receptors on the thyroid are thought to be nuclear receptors, which regulate target gene expression involved in metabolism, development, and reproduction (M cKenna et al. 2001). The role these sex steroids, and their receptors, play in the regulation of the thyroid is not currently well understood. The presence of estrogen receptors (ER) and androgen receptors (AR) in the thyroid has been reported for only a couple of vertebrates, namely humans and rats (Fujimoto et al. 1992; Giani et al. 1993; Kawabata et al. 2003). Additionally, many vertebrate species, including humans, have thyroid disorders more frequen tly diagnosed in the female than the male population (approximately 3:1)(Paterson et al. 1999; Manole et al. 2001 ; Arain et al. 2003). Studies have shown that neoplas tic thyroids have a higher numb er of ERs compared to normal tissue (Manole et al. 2001), sugge sting a potential relationship between sex and susceptibility to thyroid abnormalities. These findings also suggest that ER signaling could play a larger role in the thyroid than the AR. 48

PAGE 49

This study describes the presence and distribu tion of sex steroid and thyroid receptors (ER ER AR, TR and TR ) in the thyroid gland obtained from alligators at several life history stages and provides a semi-quantificati on of the sex steroid receptor types using an immunocytochemical approach. Quantitative differences in mRNA expression of ER ER TR TR and the AR was determined on the same tissue using quantitative real time PCR (QPCR) with primers designed specifically for alligators. This study examines the potential sexual dimorphism in receptor expression in the allig ator thyroid. Due to th e presence of both ER and ER nuclear receptors throughout life in the thyr oids of humans (Kawabata et al. 2003), we expected other vertebrates, such alligators, w ould also express both estrogen receptors in the thyroid. The thyroid axis plays a role in horm one regulation, and since hormone production changes during an animals development from neonate to adult, it is possible that steroid receptor expression changes with developmental maturity. To investigate whether sex steroid receptor expression changes throughout an animals life, we examined alligators from three different life stages. Materials and Methods Animals Five male and five female neonatal, juveni le, and adult alligators were collected from Lake Woodruff (lat. 29 06N, long. 81 25W), Florida, USA. In June of 2003, the juvenile specimens were captured at night from an airboa t by a hand-restraint tec hnique. The juvenile American alligators ( A. mississippiensis) ranged from 84.6 cm 137.6 cm in total length with a mean length of 110.2 cm and were hand captured during the hours (h) of 9 pm 1 am. Upon capture, these alligators were sexed and placed in a cloth bag for transport back to the University 49

PAGE 50

of Florida. The specimens were euthanized and tis sues dissected within 10 h of the capture. In mid July of 2003, 12 eggs were collected from La ke Woodruff and transported to the University of Florida, Florida, USA. Since the sex of alligators is temperature dependent, six eggs were incubated at 33.5 C, the male determining temperature, and six eggs were incubated at 30 C, the female determining temperature for alligators from central Florida, USA. In mid August, as each egg hatched, the neonate was euthanized and tissues dissected. The neonates ranged 23.5 cm 26 cm in total length with a mean length of 24.9 cm. In September of 2003, the adult specimens were captured at night using a standard noose te chnique. The adult alligators ranged from 178 cm 333 cm in total length with a mean length of 225.4 cm and were captured during the hours of 11 pm2 am. The specimens were sexed in th e field and transported to the University of Florida. Within 7 h of capture, alligators were euthanized and tissues dissected. In all cases, alligator euthanasia was perfor med by an overdose of sodium pentabarbitol, injected intravenously into the post-cranial vertebral ve in, a protocol approved by the University of Florida IACUC. Thyroids we re removed from all specimens a nd divided into two lobes. One thyroid lobe was preserved in co ld Bouins fixative (fixative wa s on ice), whereas the other lobe was flash frozen in liquid nitrogen for molecula r studies. Additional tissues (gonad, liver, heart, phallus, and brain) were harveste d for use in other ongoing studies. Histological Analysis and Statistics Thyroid tissues from each age group were prepar ed using standard hi stological techniques. Each animal was represented by a set of slides and each set contained th ree slides: one control slide, one experimental slide, and one normal Hemotoxylin and Eosin stain slide. The control slides contained sections 1, 4, a nd 7; the experimental slides in cluded sections 2, 5, and 8; the normal slides included sections 3, 6, and 9 (F ig. 3-1). After the tissues were mounted, the 50

PAGE 51

sections on the control and experimental slides were treated using immunocytochemistry (ICC) techniques and an antibody specific for ER (Appendix A) to visuali ze the presence of estrogen receptors. The two slides differ in that experi mental slides received antibody specific for a receptor and control slides did not. Detection wa s performed using the Vector Elite ICC kit and antibodies from Santa Cruz Biotechnology, Inc.: androgen receptor AR (C-19): sc-815 and the estrogen receptor ER (MC-20): sc-542. Recently, Japanese collaborators (Ohta, Y. unpublished data) have validated the use of these antibodies for alligator ER and AR. The third slide of the set was stained with Hemo toxylin and Eosin st ain (Fig. 3-2). Once the slides were stained, sections through th ree intact thyroid follicles were analyzed. The total number of counted stai ned nuclei from the experimental slide was divided by the total number of counted stained nuclei from the same follicle in the normal slide. These data were then converted to the arcsine of the ratio obtained. This figure wa s used to represent the relative ER protein expression in the thyr oid of that specific alligator. Th is technique was used to semiquantify ER protein expression levels in the thyr oid. Comparisons between the sex was analyzed using StatView software with a significance = .05 (version 5.0; SAS Institute Inc., Cary, NC, USA). We had very limited success with AR immunostaining on alligator thyroid follicles. Although the presence of an ARlike protein was localized, staining was never consistent enough so that we coul d perform a distribution analysis. Isolation of RNA, Reverse Tran scription and Northern Blots Quantitative real time-PCR (Q-PCR) was perfor med to quantify mRNA expression levels for ER ER AR, TR and TR in neonatal, juvenile and adu lt thyroid tissue. The technique used was that which validated previously for allig ator tissues (Katsu et al. 2004; Helbing et al. 2006). 51

PAGE 52

Q-PCR was performed using standa rd techniques. In short, total RNA was isolated with an RNeasy kit (QIAGEN, Chatsworth, CA). Fi rst strand cDNA synthesis was performed on 4 g of total RNA using SuperScript II RNase HReverse Transcriptase (Invitrogen, Gaithersburg, MD) and oligo (dT)12-18 (Invitrogen, Gaithersbur g, MD) to reverse transcribe polyA+ mRNA. Primer annealing was carried out at 70C for 10 min, before reverse transcriptase was added. Conditions for first-strand synthesis were 42C for 60 min, followed by 10 min at 70C. Primers for Q-PCR were designed from the alligator codi ng sequences (chapter 4, Table 4-1). A sequence also was previously obtained for alligator -actin and ribosomal L8 for the purpose of normalization; primers have been designed based on alligator sequences. Q-PCR was carried out in a BioRad MyiQ single color real-time PCR de tection system according to the manufacturers protocol, with the exception that 15 L per well was used. Q-PCR conditions were 2 min at 50C, 95C for 10 min and 40 cycles at 95C for 15 sec, and 60C for 1 min. To normalize data, the mean Ct (threshold cycle) for ribosomal L8 wa s used on the mean Ct of the genes of interest (ER ER TR TR and AR). Relative expression c ounts were calculated using the 2Ct method (Livak et al. 2001). Northern analysis was preformed using standard techniques to determine quality of the mRNA prior to Q-PCR; gels were loaded with 20 g total RNA. Labeling of cDNA probes was achieved by random priming (Prime-It II, Stratagene, La Jolla, CA) using (ATP-32P) dCTP (SA 3,000 Ci/mmol; New England Nuclear) according to the manufacturers protocol. Results Immunohistochemical Localization of ER Localization of ER was visualized in the thyroid follicle using a mammalian polyclonal antibody (Fig. 3-2). An ANOVA revealed that no sexual dimorphism was detected in ER 52

PAGE 53

protein expression, as determined by immunocytochemistry, at any of the life stages examined in this study. The ratio of ICC ER stained to normal hemotoxylin and eosin stain is displayed in Fig. 3-3. Quantitative RT-PCR Relative expression of th yroid tissue mRNA for ER ER TR TR and AR were analyzed using QPCR to determine whether se xual dimorphism existed. An ANOVA was performed on the genes of interest with sex as the independent fact or. No statistically significant difference was observed between male or female thyroid mRNA expression for any of the genes analyzed. Thyroid relative mRNA expression for genes analyzed in neonate, juvenile and adult alligators are displayed in Figs 3-4, 3-5 and 3-6 respectively. Discussion Thyroid disorders are approximately three times more prevalent in females across species (Paterson et al. 1999; Manole et al. 2001; Arain et al. 2003). Ou r data demonstrate that the thyroid expresses both forms of ER in th e alligator thyroid. Both forms of ER ( and ) are known to be expressed in the hum an thyroid (Kawabata et al. 2003). Our data demonstrate that mRNA for both ER and AR is expr essed in the thyroid as well as for both forms of TR. Further, we observed that the mRNA for ER is translated to protein as we were able to detect its presence in the thyroid follicle cells. When t hyroid tissues from the American alligator were analyzed histologically, no sexually di morphic pattern was observed for ER staining when tissues from all three life stages were examine d. These results are contrary to our hypothesis that females would show higher ER expression. Quantitative PCR data from these tissues supports this conclusion as well as the result s from another study that examined potential sexually dimorphic patterns of ER expression in humans (Manole et al. 2001) Recent studies 53

PAGE 54

examining the mammalian thyroid suggest that ER expression is not sexually dimorphic, but rather, the post-ligand binding response of ERs to E2 in the thyroid cell is dimorphic (Correa da Costa et al. 2001; Lima et al. 2006 ; Marassi et al. 2007). That is, estrogens enhanc e expression of cyclin D1 protein, which plays a role in regulation of transition from G1 to S phase in the cell cycle. Estrogens exert effects by activation of MAP kinases as well as by binding to ERs. As alligators sexually mature, the plasma concentrations of sex steroids increase. We hypothesized that, as adults have higher plasma concentration of E2 compared to the other two life stages (Guillette, 2000; Rooney et al. 2004 ; Milnes, M. R. personal communication), the adult alligators would show lower ER ratios and, therefore, lower ER expression due to potential feedback loops down regulating the expre ssion of the receptor. Our data suggest that neonates have a signific antly higher ratio of ER compared to both the juvenile and the adult specimens. Our Q-PCR data for mRNA expression for ER and ER however, did not support this observation, suggesting that di fferential translation could occur at different life stages. One observational difference of note, is that we have demonstrated that ER protein and mRNA for ER and ER are expressed in the thyroid of juvenile alligators obtained immediately after hatching in late August, dur ing mid summer (June) in juveniles and during September in adults. A previous stu dy examining the tissue distribution of ER observed no ER mRNA expresssion for juvenile alligator thyroid tissue (Helbing et al. 2006). Interestingly, the animals in that study were collected from the wild (Lake Woodruff NWR, Florida, USA) in September, the same location from which we obtained the animals for this study in June. Further, the animals used in the present study are approximately 20 cm longer in snout vent length, suggesting that they are approximately 12 years older (Milnes et al. 2000) than those examined by Helbing et al (2006). These data suggest possible life stage differences, but that is 54

PAGE 55

unlikely given that we observed mRNA ER e xpression in the thyroi d tissue of neonates, juveniles and adults. We suggest that possible s easonal variation in the expression of the ER in the thyroid is more likely and this needs to be tested, although the protected status of this animal may preclude monthly sampling for such a test. In addition to the expression of both forms of ER, we demonstrate that the alligator thyroid expresses mRNA for the AR. Both adult and ne onatal stages displayed significantly lower mRNA expression levels when comp ared to juveniles. Androgens have been found in circulation in both juvenile male and female alligators (Rooney et al. 2004; Bermudez, D. S. unpublished data). Further, juvenile alligator s of the size we examined in this study display seasonal variation in plasma testosterone concentra tions (Rooney et al. 2004). Further, juvenile alligators appear to display a multiyear period of puberty and these data suggest a hypothe sis that AR function during the juvenile life stage could play a role during peripubertal maturation of the thyroid. Androgens have been suggested to increase thyroid function by up re gulating expression of genes such as thyroperoxidase and thyroglobulin (Correa da Costa et al. 2001). The increase in androgen concentration in the blood during pube rty could up-regulate th yroid function, which consequentially, would increase ac tivity and growth in tissues responsive to thyroid hormones. Future studies need to test this hypothesis. TR as well as TR display mRNA expression in the thyroid. TRs mRNA expression in thyroid tissue is seen in neonate, juvenile and adult life stages. TRs exert a regulatory role on the thyroid axis to maintain pr oper thyroid hormone balance (N orris 1997; Helbing et al. 2006) previously showed TRs mRNA e xpression in the thyroid and our data support those findings. This study has shown that mRNA for both forms of the ER, both forms of TR and AR are found on the thyroid of the American alligator ( A. mississippiensis ). No sexual dimorphism was 55

PAGE 56

observed in the mRNA expression of these genes in the thyroid tissue examined. However, the presence of sex steroid receptors provides a potential mechanism by which the gonadal steroid could influence thyroid development and function. Th is is the first study to describe ERs in the thyroid a none-mammalian species and to char acterize the expression with mRNA expression and protein expression. Further studies are required to dete rmine if such a regulatory pathway exists via ERs in the thyroid. 56

PAGE 57

1 4 7 2 5 8 3 6 9 Control Experimental Normal Figure 3-1 :Three types of slides used (control, experimental, and normal) and how the tissue was oriented to ensure the ease and accuracy of the analysis. The numbers descend in order from the earliest section of thyroid used to the latest. A B C Figure 3-2: Thyroid follicle from a juvenile alligator. (A) Cont rol, (B) experimental, and (C) normal stained. The control and experime ntal tissues underwent the same IHC protocol; however, only the experiment al tissues were treated with the ER antibody. The normal follicle underwent a Hemotoxylin and Eosin stain. This stains for every nucleus present on the follicle. 57

PAGE 58

Figure 3-3: Mean ratio for IHC ER expression (measured by ratio of IHC ER stained to normal hemotoxylin and eosin stai n) in the thyroid at three li fe stages in the American alligator. Error bars are 1 standard error from mean. No sexually dimorphic pattern is observed. 58

PAGE 59

Figure 3-4: Neonate mRNA gene expression in thyroid tissue fr om the American alligator, A. mississippiensis. Genes were normalized to ribosom al L8 and relative expression counts were calculated using the 2Ct method. Error bar repres ents 1 standard error from mean. No sexual dimorphic pattern was observed. 59

PAGE 60

Figure 3-5: Juvenile mRNA gene expression in thyroid tissue from the American alligator, A. mississippiensis. Genes were normalized to ribosom al L8 and relative expression counts were calculated using the 2Ct method. Error bar repres ents 1 standard error from mean. No sexual dimorphic pattern was observed. 60

PAGE 61

Figure 3-6: Adult mRNA gene expression in thyroid tissue from the American alligator, A. mississippiensis. Genes were normalized to ribosom al L8 and relative expression counts were calculated using the 2Ct method. Error bar repres ents 1 standard error from mean. No sexual dimorphic pattern was observed. 61

PAGE 62

CHAPTER 4 EFFECTS OF IN OVO AND IN VIVO PROPYLTHIOURACIL EXPOSURE ON THYROID AND GONAD GENE EXPRESSION IN NE ONATAL AMERICAN ALLIGATORS ( Alligator mississippiensis ) Introduction The thyroid axis plays diverse roles and functions in vertebrates. Metabolic effects of thyroid hormones, such as increases in the synthe sis of several mitochondrial respiratory proteins such as cytochrome c, cytochrome oxidase, a nd succinoxidase, are well known (Stevens et al. 1995; Norris 1997). Also, shark embryos of Squalus suckleyi and tissue obtained from the frog, Rana pipiens, have been shown to increase oxygen consumption following triiodothyronine (T3 ) and/or thyroxine (T4) treatment (Blaxter 1988;May and Pa cker 1976). Effects on growth and development such as the human di sorders thyrotoxicosis, Graves disease, Hashimotos disease, cretinism and juvenile myxedema are caused by imbalances in the thyroid axis (Norris 1997; Kilpatrick 2002). In amphibians and fish, metamorphosis and smoltification are classic examples of roles played by the thyroid axis (D enver 1998; Wright et al. 2000; Kulczykowska et al. 2004). The general permissive/cooperative roles pl ayed by the thyroid ax is on the reproductive axis is yet another demonstration of the diversity of functions by this axis. Cycles in the plasma concentrations of thyroid hormones are positively correlated with reproduc tive cycles in various vertebrate species such as the sheath-tailed bat, Taphozous longimanus (Singh et al. 2002), the viviparous rockfish, Sebastes inermis (Kwon et al. 1999) and th e American alligator, Alligator mississippiensis (Bermudez et al. 2005, this dissertation) Thyroid hormones play a crucial role in the development of testicular Sertoli (cell assisting spermatozoa production) and Leydig cells (steroid producing cells). Manipulation of the thyroid environm ent can be used to produce an 62

PAGE 63

increase in testicular size, Sertoli cell number, and sperm production (Cooke et al. 2004). Neonatal hypothyroidism has been shown to impair testicular development (J annini et al. 1995). Plasma concentrations of thyroid hormones, at proper levels, are necessary for ovulation (Maruo et al. 1992). Doufas and Mastorakos (2 000) demonstrated that severe hypothyroidism causes ovarian atrophy and amenorrhea. Thyroid receptors (TRs) are found in various parts of the ovary such as granulosa cel ls (Maruo et al. 1992; Zhang et al. 1997), oocytes and cumulus cells of the follicle (Zhang et al. 1997), and co rpora lutea (Bhattacharya et al. 1988). Recent evidence also suggests that thyrotropin receptors found in gonadal ti ssue play a direct role on the reproductive physiology of several te leost species (Goto-K azeto et al. 2003; Rocha et al. 2007). Recent work from our group, examining the American alligator, also suggest that the gonads are capable of being stimulated by thyrotropin as we observed an up regulatio n of expression of TRs in the gonad following treatment (Helbing et al. 2006). These studies, in conjunction with other available data, indicate that TRs are present in high quantities in the testis and ovary, leading to the hypothesis that thyroid hormone s could have key roles in gona dal development and function. This study examines the potential role the thyroid plays on th e developing reproductive axis of the American alligator. This investigat ion will focus on the thyroid axis and address what happens to the reproductive axis if the thyroid axis is depressed with a pharmaceutical agent. Alligators were treated with proplythiouracil (PTU) in ovo during the window of sexual differentiation of the gonad in developing embryos and in vivo in neonates. PTU is a commonly used anti-thyroid agent for the treatment of hyperthyroidism. PTU functions as an inhibitor of gap-junction-intercellular communication in the t hyroid follicular cells. Two thyroid hormones, manufactured by the thyroid gland, T4 and T3, are formed by combining iodine and the protein thyroglobulin with the enzymatic assistance of peroxidase. PTU inhibits the normal interaction 63

PAGE 64

of iodine and peroxidase on thyroglobu lin, thus blocking the formation of T4 and T3. PTU also interferes with the conversion of T4 to T3, and, since T3 is more active than T4 at the cellular level, this also reduces the act ivity of the thyroid axis. By bl ocking the thyroid with PTU during the temperature dependant sexual differentiation period of the alligator embryo, we predict an alteration in the development of the testis or ovary and change in gene expression. We also predict a change in gene expression on both gonad and thyroid tissue treated with PTU as neonates. This study examines the thyroid axis primar ily through changes in gene expression using quantitative RT-PCR (QPCR) of markers of thyr oid and reproductive ster oid hormone function. We examined markers such as the nuclear receptors for estrogens (ER ER ), androgens (AR), thyroid hormones (TR TR ), plasma membrane receptors fo r thyrotropin (TSHr), deiodinases (D1, D2), sodium-iodide symporter (NIS), pendrin (PEN), thyroglobulin (Tg) and thyroperoidase (Tp) (Fig. 4-1). ERs1 and ARs2 are believed to play a possibl e regulatory role on the thyroid axis. TRs3 are known regulatory agents of the thyroid ax is. Both deiodinase 1 and 2 help convert T4 to T3, which is believed to be the more active thyroid hormone in tissues. The last four endpoints play roles in the synthesis of thyr oid hormones. The sodium-iodide symporter6 (NIS) is located in the basal membrane of an epithelial cell of thyroid follicles. It pumps sodium (Na+) and iodide (I-) ions into the epithelial cell where it is then transported to the apical surface and released into the lumen of the follicle. Pendrin7 (PEN) is a co-transpor ter found at the apical membrane of a thyroid epithelial cell. Pendrin pumps iodide (I-) from the epithelial cell into the thyroid follicular lu men and chloride (Cl-) from the follicular lumen into the epithelial cells. Thyroglobulin8 is a large protein that plays a role in the coupling of iodinated tyrosine molecules to form thyroid hormones T3 and T4. Lastly, thyroperoxidase9 is an enzyme that helps convert 64

PAGE 65

inorganic iodide to active iodide, which then readily binds to a ty rosine molecule leading to an organically bound iodine. The mRNA expression of several additional biomarkers of gonadal function were examined as well using QPCR. Gene expression in gonadal tissue was examined for the nuclear receptors for estrogens (ER ER ), androgens (AR), the plasma membrane receptor for thyrotropin (TSHr), deiodinases (D1, D2), P 450 aromatase (AROM) and steroidogenic acute regulatory protein (StAR) (Fig. 4-2). ERs1 and ARs2 are known to regulate the gonadal axis as well as other tissues. Likewise, TRs3 actively modulate the physio logy of the gonads. Thyroid stimulating hormone, presumably acting via its receptor4 has been recently shown to increase the expression of TRs the alligator gonad (Helbi ng, Crump et al. 2006). Steroidogenic acute regulatory protein5 is known to shuttle chol esterol into the mitochondr ia for conversion in the steroidogenic pathway. Both deiodinase6 1 and 2 help convert T4 to T3, which is the more active thyroid hormone in tissues. Aromatase7 is an enzyme necessary for the conversion of testosterone to estradiol-17 Materials and Methods Animals Alligator clutches from Lake Woodr uff National Wildlife Refuge (lat. 29 06N, long. 8125W), Florida, USA were collect ed during late June 2003 for the in ovo study. Alligator clutches from Lake Woodruff were co llected during late June 2004 for the in vivo study. Alligator Eggs from these clutches were candled and staged. Eggs were then systematically sorted into groups with an N = 10. One set of eggs was incubated at 30C (female determining temperature) whereas the other set was incuba ted at 33.5C (male determining temperature). 65

PAGE 66

Each set had five subsets: control, ethanol ve hicle control, low dose PTU, medium dose PTU, and high dose PTU In Ovo PTU Treatment Given that no previous studies of em bryonic exposure to PTU had been done in alligators, we created doses de novo with suggestions taken from toxicology. The high dose was to be 50 % of the LD50 for rats. The LD50 for PTU in the laboratory rat is 1,250 mg/kg. The average weight (n = 10) of an alligator egg was 90 g. The high dose for an egg was calculated to be approximately 56 mg PTU/egg. However, given the solubility of this compound in our vehicle 95 % ethanol (90 g/100 ml), we tr eated eggs with a topical dose of 100 l. Thus, the high dose was 900 g/egg with a medium dose 100 fold less at 9 g/egg and a low dose of 90 pg/egg. Eggs were dosed each day for five consecutive da ys starting when eggs were at embryonic stage 19, just prior to the period of sex dete rmination. Vehicle controls received 100 l of ethanol as did each treatment group where as the non-vehicle control received no treatment. In Ovo Dissections and Tissue Collection Embryos were allowed to incubate and ge state to hatching. Once neonates hatched, they were immediately euthanized with an overdose of pharmaceutical grade sodium pentabarbitol, injected intravenously into the post-cranial vertebral ve in, a protocol approved by the University of Florida IACUC. Approximately 2-3 ml of blood was extracted, centrifuged and plasma collected for analyses of plasma hormone concen trations by validated RIA. Thyroid and gonadal tissues where immediately removed, partitioned into separate lobes (thyroid) or pieces (gonad) and flash frozen with liquid nitrogen and stored at -80 C until processed for QPCR. One piece of thyroid tissue was fixed in chilled Bouins fi xative and stored in 75% ETOH for standard 66

PAGE 67

histology and ICC of ER. Snout vent length (SVL), Total length (TL), body mass, and thyroid and gonad weight were also collected. In Vivo PTU Treatment Treatment was administered 14 days post hatch to allow for the absorption of the yolk sac. High dose treatment was at 5 ng PTU/g body wei ght of neonate, whereas the medium dose treatment was 0.05 ng/g neonate and low dose tr eatment was 0.005 ng/g neonate. The average neonate weighed 65 g yielding a high dose of approximately 325 ng, medium dose of 3.25 ng, and low dose of 0.325 ng. PTU was dissolved in 95% ethanol and injections involved a volume of 50 l each, intravenously into the post-cranial ve rtebral vein. Control groups received no treatment or 50 l ethanol injections. After the initial treatment, a s econd identical treatment was given 6 h later. After a total 12 h since the init ial treatment, animals were euthanized with an overdose of sodium pentabarbitol and tissues collected. In Vivo Dissections and Tissue Collection Immediately prior to euthanasia, 2-3 ml of blood was obtained from the supravertebral blood vessel with a sterile needle and syringe. Neonates then were euthan ized with an overdose of sodium pentabarbitol, injected intravenously into the supraver tebral vein, a protocol approved by the University of Florida IACUC. Thyr oid tissue was immediately removed, weighed, partitioned into two distinct lobes and fixed or fl ash frozen with liquid nitrogen and stored at 80 C. Gonadal tissue was handled in a similar manner. Snout vent length, TTL, and body mass were also collected. Histological Analysis and Statistics Thyroid tissues from in ovo PTU experiment were prepared using standard histological techniques (Humason 1972). Tissues were st ained using Hemotoxylin and Eosin. Once the slides were stained, sections th rough six intact thyroid follicle s were analyzed. Briefly, tissue 67

PAGE 68

slides from each individual were examined and the six largest intact thyroid follicles were selected for analysis. Follicle diameter and epithe lial cell height were measured. Four epithelial cells were randomly selected form the chosen follicles and epithelial cell height was measured from the basal membrane to the apical membra ne. Follicle diameter was measured from the apical membrane. Morphometric measuremen ts were taken using Scion Image analysis software. Data were analyzed using StatView software with a significance = .05 (version 5.0; SAS Institute Inc., Cary, NC, USA). Isolation of RNA, Reverse Tran scription and Northern Blots Quantitative real time-PCR (Q-PCR) was perfor med to quantify mRNA expression levels for ER ER AR, TR ,TR D1, D2, Arom, StAR, Tg, Tp a nd TSHr in neonatal thyroid and gonadal tissues. The technique used was that wh ich has been previously validated for alligator tissues (see Katsu et al., 2004; Helbing et al., 2006). In short, total RNA was isolated with an RNeasy kit (QIAGEN, Chatsworth, CA). First strand cDNA synthesis was performed on 4 g total RNA using SuperScript II RNase HReverse Transcriptase (Invitrogen, Gaither sburg, MD) and oligo (dT)12-18 (Invitrogen, Gaithersburg, MD) to reverse transcribe polyA+ mRNA. Primer annealing was carried out at 70C for 10 min, before reverse transcriptase wa s added. Conditions for first-strand synthesis were 42C for 60 min, followed by 10 min at 70C. Primers for Q-PCR were designed from the alligator coding sequences (Table 4-1). A sequence also was previously obtained for alligator actin and ribosomal L8 for the purpose of nor malization; primers desi gned based on alligator sequences. Q-PCR was carried out in a BioRad MyiQ single color real-time PCR detection system according to the manufacturers protocol, with the exception that 15 L per well was 68

PAGE 69

used. Q-PCR conditions were 2 min at 50C, 95 C for 10 min and 40 cycles at 95C for 15 sec, and 60C for 1 min. To normalize data, the mean Ct (threshold cycle) for ribosomal L8 was used on the mean Ct of the genes of interest. Rela tive expression counts were calculated using the 2Ct method (Livak and Schmittgen 2001). Northern analysis was preformed using standard techniques to determine quality of the mRNA prio r to Q-PCR; gels were loaded with 20 g of total RNA. Labeling of cDNA probes was achieved by random priming (Prime-It II, Stratagene, La Jolla, CA) using (ATP-32P) dCTP (SA 3,000 Ci/mmol; New England Nuclear) according to the manufacturers protocol. Gene Sequence and QPCR Primer Design Several partial clones of the genes in the th yroid axis were create d for this study. These genes include deiodinases (D1,D2), thyroglobulin (Tg), thyroperoxidase (Tp), Pendrin (PEN) and sodium-iodide symporter (NIS). There partia l sequences can be found in appendix A. Using the NCBI search browser a protein search was performed for candidate gene. Once a sequence from an animal close to alligators on the phyl ogenetic tree was selecte d, candidate gene from various animals close to alligators where select ed. CLUSTALX program was used to align the various sequences. Conserved regions with minimal degenerative sequences were selected for the upstream and downstream primers. Forward a nd reverse sequences were created and sent to Operon for degenerate primer creation. Degenerate primers were then used to get candidate gene full sequence and to determine proper sequenc e for quantitative PCR primers. First, degenerative primer PCR and gel electrophoresis wa s run to visualize if primer set was binding and amplifying the correct DNA sequence but checki ng if the correct base pair length for the primer set was seen in gel. Once correct band wa s visualized, the band was cut out of the gel and QIAquick DNA gel extraction kit was used to ex tract the DNA from the gel. The protocol 69

PAGE 70

described in the kit manual was used with slight modifications. The DNA from the gel was then inserted into an E.coli vector through TA cloni ng. Petri dish cultures where made and clones with the insert were picked up for culturing. Af ter culturing, we used Wizard Plus SV Minipreps DNA Purification System to extr act DNA from the cell cultures The quick centrifugation protocol was used. The plasmid DNA wa s then checked for insert DNA through gel electrophoresis. Once inserts wher e confirmed, samples were prepared for sequencing reactions. After sequencing, ABI Prism software for Mac was us ed to remove vector inserts of SP6 and T7 from the produced sequence. Then GENETYXMAC software was used to check sequence homology and correct any unpaired nucleotide. Results Thyroid: In Ovo PTU Treatment Relative expression of mRNA for ER ER TR TR D1, D2, TSHr, Tg, Tp, NIS and PEN were analyzed using QPCR to determine wh ether sexual dimorphism or differences among treatment groups existed. A 2-way ANOVA was perf ormed on the genes of interest with sex and treatment as independent factors. No statistica lly significant sexual dimorphism was observed in thyroid tissue for mR NA expression of ER TR D1, Tg, and Tp. A statistically significant difference in expression for D1 mRNA in male s was observed between vehicle treatment and high and low dose in ovo PTU treatment (p < 0.001). Sexual dimorphism was observed for expression of Tp mRNA in the vehicle treatmen t groups (p < 0.001) but this pattern of sexual dimorphism was lost with PTU treatment. TSHr mRNA expressi on in the thyroid tissue from females displayed differences between vehicle treatment and high dose PTU exposure (p = 0.05) whereas males displayed no differences following treatment. ER mRNA displayed sexually dimorphic expression in thyroid tissue in the vehicle control treat ment (p = 0.045) that was lost 70

PAGE 71

following in ovo PTU treatment (Fig. 4-3). Expression of ER mRNA was significantly increased in females following high dose PTU exposure in ovo (p = 0.011) whereas males displayed differences following exposure to lo w dose (p = 0.046) and medium dose (p = 0.05) PTU (Fig. 4-3). Sexual dimorphism was observed in the mRNA expression of D2 in vehicle (p = 0.007) and medium PTU exposed neonate s (p = 0.029). Treatment with PTU in ovo had no effect on D2 mRNA expression in females, how ever males exhibited statistically different expression between vehicle and high dose (p = 0.028) and low dose (p = 0.045) PTU exposure (refer to Fig. 4-4). NIS displayed a sexually dimorphic expression patt ern in vehicle treated thyroids (p = 0.001). No treat ment effect was found for thyroi ds from females for NIS mRNA expression. NIS mRNA expressi on in males displayed differences following PTU treatment with low dose PTU exposed thyroids exhibiting di fferent expression that either vehicle (p = 0.001) and medium dose (p = 0.009) treatment groups (Fig. 4-5). PEN mRNA expression displayed sexual dimorphism following PTU exposure in ovo at all doses: low dose (p = 0.05), medium dose (p = 0.05) and high dose (p < 0.001) (Fig. 4-6). Interestingly, this sexual dimorphism is due to an increase in PEN mRNA expression in males, not females. No PTU treatment effect was found in PEN for either males or females. Thyroid: In Vivo after Neonatal Acute PTU Exposure Relative expression of mRNA for ER ER TR TR AR, D1, D2, TSHr, Tg, Tp, NIS and PEN were analyzed in thyroid tissue to determine whether sexual dimorphism or differences between treatment groups existed. A 2-way ANOVA was performed on the expression levels of genes of interest with sex and treatment as independent factors. No st atistically significant difference in treatment or sexual dimorphism was found in TR TR D1, Tg, and Tp. We did observed statistically significant sexual dimo rphism in D2 mRNA expression in the vehicle 71

PAGE 72

treatment group (p = 0.022) (Fig. 4-7). Females showed differences between high PTU exposure and either vehicle and medium dose (p = 0.05) treatments for D2 mR NA expression. Males exposed to either high dose (p = 0.008) or low dose (p = 0.023) PTU exhibited differences in D2 mRNA thyroid expression. No sexual dimorphi sm was found in AR mRNA expression in the neonatal thyroid (Fig. 4-8). When AR was ex amined following PTU treatment, males showed differences between vehicle a nd high dose PTU treatment (p = 0.031) (Fig. 4.8). Females displayed differences between control and all treatment groups: vehicle (p = 0.025), low dose (p = 0.002), medium dose (p = 0.025) and hi gh dose (p < 0.001) (Fig. 4-8). ER mRNA expression in the thyroid exhibited sexual dimorphism in vehicle treated animals (p = 0.016). ER mRNA expression also was difference in males when vehicle and medium PTU dose (p = 0.029) exposed animals were compared. ER mRNA expression in thyroid tissue from females were different between controls and low, medium, or high dose (p = 0.001) PTU treatments as well as between vehicle and low dose (p = 0.031) or medi um dose (p = 0.047) PTU treatment (Fig. 4-9). ER also is expressed in a sexua lly dimorphic pattern in vehicl e exposed thyroid tissues (p = 0.001). ER expression in thyroids from females displayed differences between control and vehicle treatments (p = 0.0331). Likewise, we observed that ER expression in thyroids from males was difference between control and low do se (p = 0.045), medium dose (p = 0.014) or high dose (p = 0.011) PTU treatments as well as be tween vehicle and low dose, medium dose or high dose (p < 0.001) PTU treatments (Fig. 4-10). TSHr displayed a sexually dimorphic pattern in both control and high PTU treatment (p = 0.05) (Fig. 4-11). Females exhibited no change in TSHr mRNA expression with PTU treatment whereas males treated with high dose PTU displayed a significant increase in TSHr expression in the thyroid (Fig. 4-11). PEN wa s expressed in a sexually dimor phic pattern in thyroid tissue 72

PAGE 73

obtained from non-treatment control animals as well as those exposed to the medium PTU dose (p = 0.037). PEN had differences in females e xposed to high PTU exhibited significantly increased PEN expression compared to control (p = 0.026), vehicle (p < 0.001) or medium dose PTU (p = 0.006) treatments. Likewise, a di fference was observed between low dose PTU treatment and vehicle (p = 0.03) in female thyroi d tissue (Fig. 4-12). No sexual dimorphism was seen in NIS mRNA expression except in those animals treated with high dose PTU (p = 0.05). No treatment effect was seen in NIS mRNA expression in females whereas males exhibited differences between high dose PTU and vehicle (p = 0.002) or medium dose (p = 0.042) treatments as well as between vehicle and low dose (p = 0.034) treatment (Fig. 4-13). Gonad: In Ovo PTU Exposure Relative expression in go nadal mRNA for AR,ER ER StAR and Arom was analyzed to determine whether sexually dimorphic patterns and differences between treatments existed. A 2-way ANOVA was performed on the mRNA expression of genes of interest with sex and treatment as independent factors. No sexual dimorphism was observed in AR mRNA expression in control or vehicle exposed gonadal tissues whereas at low (p = 0.018), medium and high dose (p < 0.001) PTU treatments pronounced sexual dimorphism in AR expression is obs erved (Fig. 4-14). Interestingly, the pattern of AR expression chan ges creating this dimorphism (Fig. 4-14). For example, AR expression in ovarian tissue in creased with medium and high dose PTU exposure in ovo when compared to controls (p = 0.009; p = 0.03, respectively) or vehicle (p < 0.001; p = 0.003, respectively) exposed tissues. AR mRNA e xpression in testicular tissue exhibited a complex pattern with low dose exposure (p = 0.0 12) increasing AR mRNA expression whereas 73

PAGE 74

high dose exposure significantly decreasing (p = 0.05) AR mR NA expression compared to control or vehicle treated animals Expression of ER mRNA was sexually dimorphic in th e gonadal tissue of vehicle (p = 0.05) exposed animals as well as in those exposed to the medium (p < 0.001) and high doses (p = 0.013) of PTU (Fig. 4-15). PT U treatment did not effect ER mRNA expression in testicular tissue. In contrast, ovarian ER expression changed with PTU treatment at medium (p < 0.001) and high (p = 0.005) doses compared to control and vehicle treatments. ER mRNA expression was also sexual dimorphic but only in those neonates exposed to the medium PTU dose in ovo (p < 0.001) (Fig. 4-16). No treatment effect was found for ER expression in males. In contrast, ER mRNA expression in the ovary changed with PTU treatment in ovo as we observed differences in ovarian expression between female s exposed to medium PTU dose and control (p = 0.039), vehicle (p = 0.005) and low dose (p = 0.022) as well as between vehicle and high dose (p = 0.019) exposure. Expression of StAR mRNA displayed sexual dimorphism in controls (p = 0.032), as well as those treated with vehicle (p = 0.033), low (p = 0.01) and high dose PTU (p = 0.011) (Fig. 4-17). Treatment in ovo with PTU at medium ( p = 0.015) and high doses (p = 0.016) altered StAR mRNA expression in the testis with the medi um dose depressing expression and the high dose increasing expression over that of the control. In ovarian tissue obtained from females exposed in ovo to PTU, treatment increased St AR mRNA expression following exposure to medium (p < 0.001) and high (p < 0.001) doses. Control tissues exhibite d a highly significant pattern of sexual dimorphism in AROM mRNA expression, which was lost with exposure in ovo to the vehicle (Fig. 4-18). AROM expression was sexual dimorphic in tissues obtained from PTU treated animals at all dose: low dose (p < 0.012), medium dose (p = 0.007) and high dose (p 74

PAGE 75

= 0.001) (Fig. 4-18). No treatment effects were found for AROM expression in either males or female tissues. Gonad: In Vivo after Acute PTU Exposure Male gonadal samples for the quantitative RT-P CR were lost due to degradation and poor mRNA quality, only ovary tissue were used and analyzed for this portion of the study. Relative expression mRNA for AR, ER ER D1, D2, StAR, AROM was analyzed to determine whether differences between treatments existed. A 1-way ANOVA was performed on the genes of interest with treatment as the independent factor. There were no treatment effects found for either StAR or AROM (figur es not shown). AR mRNA expression decreased following high dose PT U exposure (p = 0.033) (Fig. 4-19). In contrast, treatment with PTU increased ER mRNA expression following exposure to the high dose (p = 0.007)(Fig. 4-20) whereas ER mRNA expression increased following treatment with either medium (p = 0.029) or high dose PTU (p = 0.014) (Fig. 4-21). Like wise, both deiodinases responded to PTU treatment, with D1 mRNA expression increasing following high dose exposure (p = 0.026) and (Fig. 422) as did mRNA expression fo r D2 (p = 0.003) (Fig. 4-23). Discussion We examined the potential ro le of thyroid hormones on the developing reproductive axis of the American alligator. We focused on the pot ential effects of depressing this axis with a pharmaceutical agent, PTU. This study ex amined both organizational effects with in ovo PTU treatment during the win dow of sexual differentiation of the gonad in developing embryos as well as activational effects with in vivo PTU treatment in neonates. 75

PAGE 76

Thyroid We examined gene expression for the sa me mRNAs in thyroids treated either in ovo and in vivo in neonate, and found a number of interesting patterns. As reported in Chapter 3, thyroid expresses mRNA for both ERs. ER mRNA expression showed sexual dimorphism with females exhibiting higher concentr ations than males following in ovo treatment with a vehicle. This dimorphism was lost with PTU treatment in ovo Likewise, we observed that neonates exhibited a similar dimorphism in the expressi on of mRNA for both ERs, that was lost following acute treatment with PTU. Few studies have exam ined ER expression in th e thyroid at any life stage (Fujimoto et al. 1992; Giani et al. 1993; Kawabata et al 2003), and we know of no studies that have focused on steroid receptor expressi on in the thyroid of neonatal animals of any species. What is intriguing is that this st udy examining 12-24 h old neonates (Chapter 3) reported no sexual dimorphism in expression of e ither ER. However, in neonates 24-48 h old, a clear sexual dimorphism exists that is lost if th e thyroid axis is pharmacologically perturbed with PTU. Two other genes, NIS and Tp examined, al so exhibited sexual dimorphism in the vehicle treatment group at birth, which was lost when neonates were exposed to PTU in ovo These data clearly demonstrate that our dosing altered the thyroid axis In fact, we observed that all doses of PTU in ovo altered the expression of PEN in males, inducing a sexually dimo rphic pattern that did not exist in vehicle treated hatchlings. Acute exposure to PTU in 14 day old neonates also altered gene expression profiles in the thyroid. We observed a sexually dimorphic pattern of mRNA expression for ER ER and D2 in the neonatal thyroid that was lost with acute treatment with PTU. In contrast, thyroid tissu e from male neonates all showed an increase in TSHr, NIS and PEN following PTU exposure. Tp and NIS have been observed to increase activity in the thyroid of female rats exposed to E2, suggesting a possible dimorphic pattern 76

PAGE 77

(Lima et al. 2006). Also, in a study from the Netherlands measuring anti-Tp antibodies in a human population observed 8.6% males and 18. 5% females had the anti-TP antibodies (Hoogendoorn et al. 2006). The presence of Tp an tibodies was associated with abnormally high and low TSH concentrations and thyroid disorders. One of the main questions we addressed with the current studies was to determine if altering the thyroid axis altered markers of the reproductive axis, such as steroid hormone receptors. Few studies directly examine the role of sex steroids on the thyroid and yet, this study and others have shown that the thyroid expresses sex steroid receptors (Chapter 3; Fujimoto et al. 1992; Giani et al. 1993; Kawabata et al. 2003). Current studies ha ve shown that disruption of thyroid hormone synthesis in ovo alters the mRNA expression patterns for ER in male and female thyroids. As predicted, various marker s of thyroid function were altered such as TR Di, D2 and Tp expression in male thyroid tissu e and yet the same pattern was not observed in thyroids removed from neonata l females treated with PTU in ovo The basis for this difference in response is not obvious at this time, unless in cubation temperature, cooler for females, could potential alter how the thyroid axis responses to PTU treatment, given that thyroid hormones are central to the regulati on of metabolism (Blaxter 1988; Stevens et al. 1995; Norris 1997). We should note that we did see effects in the female, as expression for ER TSHr and Tp all exhibited a decrease in expression with in ovo PTU exposure. However, this initial study clearly demonstrates for the first time that steroid hormone receptor expression in the thyroid, at least estrogen receptor expression, is regulated in part by the thyroid axis. This conclusion is further supported by our da ta from the acute PTU exposure study. We observed that ER and ER mRNA expression decreased signific antly in the thyroid obtained from males following PTU exposure. Intere stingly, contrary to that observed with in ovo 77

PAGE 78

treatment, females treated in vivo with PTU responded with an increase in the expression of ER and ER Again, these data provide support for the hypothesis that the thyroid axis appears to regulate the expression of ER in thyroid tissue. These data, along with data from Chapter 3, demonstating mRNA and protein for ER are presen t in the thyroid indicate that significantly more work is needed to address the regulation of ER expression and its ro le in the thyroid. For example, a study examining whether ER expression varies seasonally in th e thyroid coincident with changes in plasma T3 and T4 concentrations is needed. In addition to changes in ER expression, we observed that in vivo treatment altered the expression of many of the markers of the thyroid axis, such as increased expression of TRa, D2, Tp and PEN in thyroid tissue from females and TSHr, NIS and PEN in male tissue. These data provide support that our doses were capable of altering thyroid hormone regulation and presumably feedback to the thyroid. A large l iterature exists in mammals demonstrating that PTU can alter many components of the thyroid axis (Moriyama et al. 2007; Gilbert and Paczkowski 2003; Diav-Citrin and Ornoy 2002 for review ). However, similar studies are rare in wildlife and no previous study has ex amined this system in alligators. Further studies need to address the functioning of the thyr oid axis following PTU treatment in vivo and in ovo by examining changes in circulating T4 as well as other genes that are regulated by this axis. Gonads As we reported above, one aspect of this work was to address whether an alteration of the thyroid axis altered thyr oid biology. We were also interested to determine of changes in thyroid physiology, following PTU exposure altered gonadal biology as well. The gonad of males and females express both ERs as well as the ARs. Likewise, they are ster oid producing organs and thus, have the enzymes and proteins require d for steroidogenesis. We noted that ER mRNA 78

PAGE 79

expression displayed a sexually dimorphic pattern w ith testicular tissue ha ving higher levels than that observed in ovarian tissue. However, following in ovo PTU treatment, mid and high dose treatment induced a reve rsal. Expression of ER mRNA was not dimorphic in vehicle treated animals but following the mid PTU treatment in ovo it was dimorphic with females expressing greater levels. Similar complex responses were seen for StAR and the AR. In fact, the expression of the androgen receptor was decreased in testicular tissue following high dose PTU in ovo whereas it was increased in ovarian tissue. Previous studies have shown that altering the thyroid axis dramatically alters testis biology (Cooke et al. 2004; Jannini et al. 1995; Cooke et al. 1991). Manipulation of the thyroid environment can be used to produce incr eases in testis size, Sertoli cell number, and sperm production (Cooke et al. 2004). Neonatal hypothyroidism is shown to impair testicular development (Jannini et al. 1995). However, hypothyroidism in neonatal rats, which is followed by a recovery to euthyroidism, leads to an increase in testis size and daily sperm production in adu lt rats (Cooke et al. 1991). C ooke et al. (1994) state that it appears T3 normally inhibits Sertoli cell proliferati on directly while stimulating differentiation. These actions are observed in neonatal hypothyro id animals. Developmental hypothyroidism and an increase in adult testis size is not solely described in rats but also in mice (Joyce et al. 1993), humans (Jannini et al. 2000), bulls (Majdic et al. 1998), roosters (Kirby et al. 1996) and fish (Matta et al. 2002). In contrast, little is known about the ovarian response to altered t hyroid physiology during the developmental or neonatal periods. Thyroi d hormones at proper levels are necessary for ovulation (Maruo et al. 1992). D oufas and Mastorakos (2000) demonstrated that severe hypothyroidism can cause ovarian atrophy and amenorrhea. TRs are found in various parts of the ovary such as granulosa cel ls (Maruo et al. 1992; Zhang et al. 1997), oocytes and cumulus 79

PAGE 80

cells of the follicle (Zhang et al 1997), and corpora lutea (Bhatta charya et al. 1988), indicating that thyroid hormones can play a role in various cells of the ovary. The mechanisms of action are still not well understood. We do know that hypothyroidism is associated with reduced fertility and the likelihood that a woman can not carry an infant to term (Buhling et al. 2007; Krassass 2000). Our data suggest that like the developing test is, the developing ovary is likely a target of the thyroid axis. Moreover, given the differential response to PTU tr eatment seen on testicular and ovarian tissues following in ovo or in vivo PTU treatment, it is unlikely that we can predict the ovarian response based on previous studies of the testis. For example, we noted that acute in vivo treatment with PTU increased AR mRNA expression at low doses and depressed expression at high doses. In contrast, PTU treatment in vivo and thus a likely drop in th yroid hormone action induced an increased in ovarian mRNA expression for the AR, both ERs and StAR. Recently, it was demonstrated that thyroid hormones influence StAR. Lack of thyroid hormone causes a down regulation of StAR mRNA and prot ein (Manna et al. 2001b). Cl early, much further work is needed to examine the potential interaction between the developing thyroid and reproductive systems. Summary We predicted by blocking the thyroid with PTU during the temperature dependant sexual differentiation period of the alligator embryo, an alteration in the development of the testis or ovary and change in gene expression. We also predicted a change in gene expression on both gonad and thyroid tissue treated with PTU as neonate s. Both predictions appear to be supported by these data. 80

PAGE 81

In the thyroid we find that both ER and D2 show a similar pa ttern suggesting influence by estrogens on D2 expression. We also note that ER may not play as large of role during embryonic development and increases in function as neonate. AR data suggest that this might be a regulatory mechanism on the thyroid. Both NI S and PEN appear to be good candidate genes for regulation of the thyroi d axis via sex steroids. In the gonad, we find changes in gene expres sion caused by depressing the thyroid axis. AR shows possible organization changes from the in ovo PTU series. ER and ER also appear to be influenced by treatment, especially in fema les. This trend is followed in AROM and StAR as well suggesting up regulation of the steroidogenic pathway in the ovary when thyroid is depressed. 81

PAGE 82

Table 4-1: Primers used for quantitative real -time RT-PCR as markers for thyroid and gonad physiology in the American alligator ( A. mississippiensis ). Primer source are novel creations unless stated. Abbreviations represent the genes as follows: androgen receptor (AR); aromatase (Arom); deiodinases type 1, 2 (D1, D2); estrogen receptors (ER ); ribosomal house keeping gene (L8); sodium-iodide symporter (NIS); pendrin (PEN); steroidogenic acute regulat ory protein (StAR); thyroglobulin (Tg); thyroperoxidase (Tp); thyroid hormone receptors (TR ); and thyrotropin receptor (TSHr). Quantitative Real-Time RT-PCR Primers Gene Primer 5' to 3' Source AR D TGTGTTCAGGCCATGACAACA Gunderson et al. 2006 U GCCCATTTCACCACATGCA Arom D CAGCCAGTTGTGGACTTGATCA Kohno, unpublished data U TTGTCCCCTTTTTCACAGGATAG D1 D CCACAACAACTGGGCATAAGGG U GCTCATGCAACAGACGGATGG D2 D CTGCCACCACTGATGCCATTG U CTGCGTTGCGTCTGGAATAGC ER D AAGCTGCCCCTTCAACTTTTTA Katsu et al. 2004 U TGGACATCCTCTCCCTGCC ER D AAGACCAGGCGC AAAAGCT Katsu et al. 2004 U GCGACATTTCATCATTCCCAC L8 D ACGACGCAGCAATAAGAC Katsu et al. 2004 U GGTGTGGCTATGAATCCT NIS D CTCGGGAGTGGTTGTACG D AGGTGTTCGTGATGCTCTC PEN D TCACCACAACTGTCAGTAATCC U TCATGCAGGTATGTGATGTTCC StAR D GTTGGACCGCGAGATTTTGT Kohno, unpublished data U TGTTGAGCCGCGTCTCTTAGT Tg D ATCCCTTCTGAGTCCACACACC U AGCAGCACCATCTCCTACATC Tp D AATGAAAGCACTGAGGGAAGG U AGCATCAACTGGCACTTCTG TR D CAGAAGTGGGGAATGTTGTG Helbing et al. 2006 U TGCCAAAAAACTGCCCAT TR D GTCTCACTCTCGGGGTCATA Helbing et al. 2006 U CACAAGGAAGCCACTGGAA TSHr D TTGTGAACCTCCTTGCCATCC U GCAGAAGTCGGCGAAGGC 82

PAGE 83

Figure 4-1: Thyroid axis of the American alligator, Alligator mississippiensis The thyroid is a bi-lobed organ nested ventrally to the trach ea in the mid-throat region. The functional unit is the thyroid follicle. Numbers re present endpoints in thyroid function and physiology: 1) estrogen receptors ; 2) androgen receptor ; 3) thyroid hormone receptors ; 4) thyrotropin receptor; 5) de iodinases 1, 2; 6) sodium-iodide symporter; 7) cloride-iodide co-transpor ter; 8) thyroglobulin; 9) thyroperoxidase. 83

PAGE 84

Figure 4-2: Gonad axis of the American alligator, Alligator mississippiensis. The gonads are one the primary sites for steroidogenesis. A basic steroidogenic pathway is depicted. Numbers represent endpoints in gonad func tion and physiology: 1) estrogen receptors ; 2) androgen receptor; 3) thyroid hormone receptors ; 4) thyrotropin receptor; 5) steroidogenic acute regul atory protein; 6) aromatas e; 7) deiodinases 1, 2. C=cholesterol 84

PAGE 85

Figure 4-3: Estrogen receptor alpha (ER ) mRNA gene expression from in ovo PTU treatment in thyroid tissue from the American alligator, A. mississippiensis. Genes were normalized to ribosomal L8 and relative e xpression counts were calculated using the 2Ct method. Error bar represents 1 standa rd error from mean. Statistically significant ( = 0.05) sexual dimorphism depicted by an asterisk (*). Different capital letter characters signify statistically different means in females and lower case letter characters signify statistically different means in males. 85

PAGE 86

Figure 4-4: Deiodina se type 2 mRNA gene expression from in ovo PTU treatment in thyroid tissue from the American alligator, A. mississippiensis. Genes were normalized to ribosomal L8 and relative expression counts were calculated using the 2Ct method. Error bar represents 1 standard error from mean. Statistically significant ( = 0.05) sexual dimorphism depicted by an asterisk (* ). Different lower case letter characters signify statistically different means in males. 86

PAGE 87

Figure 4-5: Sodium-iodide symporte r (NIS) mRNA gene expression from in ovo PTU treatment in thyroid tissue from the American alligator, A. mississippiensis. Genes were normalized to ribosomal L8 and relative e xpression counts were calculated using the 2Ct method. Error bar represents 1 standa rd error from mean. Statistically significant ( = 0.05) sexual dimorphism depicted by an asterisk (*). Different lower case letter characters signify statis tically different means in males. 87

PAGE 88

Figure 4-6: Pendrin (PEN) mRNA gene expression from in ovo PTU treatment in thyroid tissue from the American alligator, A. mississippiensis. Genes were normalized to ribosomal L8 and relative expression counts were calculated using the 2Ct method. Error bar represents 1 standard error from mean. Statistically significant ( = 0.05) sexual dimorphism depicted by an asterisk (*). 88

PAGE 89

Figure 4-7: Deiodina se 2 (D2) mRNA gene expression from in vivo PTU treatment in thyroid tissue from the American alligator, A. mississippiensis. Genes were normalized to ribosomal L8 and relative expression counts were calculated using the 2Ct method. Error bar represents 1 standard error from mean. Statistically significant ( = 0.05) sexual dimorphism depicted by an asterisk (*). Different capital letter characters signify statistically different means in females and lower case letter characters signify statistically different means in males. 89

PAGE 90

Figure 4-8: Androgen receptor (AR) mRNA gene expression from in vivo PTU treatment in thyroid tissue from the American alligator, A. mississippiensis. Genes were normalized to ribosomal L8 and relative e xpression counts were calculated using the 2Ct method. Error bar represents 1 standa rd error from mean. Different capital letter characters signify statistically differe nt means in females and lower case letter characters signify statistically different means in males ( = 0.05). 90

PAGE 91

Figure 4-9: Estrogen receptor alpha (ER ) mRNA gene expression from in vivo PTU treatment in thyroid tissue from the American alligator, A. mississippiensis. Genes were normalized to ribosomal L8 and relative e xpression counts were calculated using the 2Ct method. Error bar represents 1 standa rd error from mean. Statistically significant ( = 0.05) sexual dimorphism depicted by an asterisk (*). Different capital letter characters signify statistically different means in females and lower case letter characters signify statistically different means in males. 91

PAGE 92

Figure 4-10: Estrogen receptor beta (ER ) mRNA gene expression from in vivo PTU treatment in thyroid tissue from the American alligator, A. mississippiensis. Genes were normalized to ribosomal L8 and relative e xpression counts were calculated using the 2Ct method. Error bar represents 1 standa rd error from mean. Statistically significant ( = 0.05) sexual dimorphism depicted by an asterisk (*). Different capital letter characters signify statistically different means in females and lower case letter characters signify statistically different means in males. 92

PAGE 93

Figure 4-11: Thyrotropin receptor (TSHr) mRNA gene expression from in vivo PTU treatment in thyroid tissue from the American alligator, A. mississippiensis. Genes were normalized to ribosomal L8 and relative e xpression counts were calculated using the 2Ct method. Error bar represents 1 standa rd error from mean. Statistically significant ( = 0.05) sexual dimorphism depicted by an asterisk (*). Different lower case letter characters signify statis tically different means in males. 93

PAGE 94

Figure 4-12: Pendrin (PEN) mR NA gene expression from in vivo PTU treatment in thyroid tissue from the American alligator, A. mississippiensis. Genes were normalized to ribosomal L8 and relative expression counts were calculated using the 2Ct method. Error bar represents 1 standard error from mean. Statistically significant ( = 0.05) sexual dimorphism depicted by an asterisk (*). Different capital letter characters signify statistically different means in females and lower case letter characters signify statistically different means in males. 94

PAGE 95

Figure 4-13: Sodium-iodide symporter (NIS) mRNA gene expression from in vivo PTU treatment in thyroid tissue from the American alligator, A. mississippiensis. Genes were normalized to ribosomal L8 and rela tive expression counts were calculated using the 2Ct method. Error bar represents 1 standard error from mean. Statistically significant ( = 0.05) sexual dimorphism depicted by an asterisk (*). Different lower case letter characters signify statistically different means in males. 95

PAGE 96

Figure 4-14: Androgen receptor (AR) mRNA gene expression from in ovo PTU treatment in gonad tissue from the American alligator, A. mississippiensis. Genes were normalized to ribosomal L8 and relative e xpression counts were calculated using the 2Ct method. Error bar represents 1 standa rd error from mean. Statistically significant ( = 0.05) sexual dimorphism depicted by an asterisk (*). Different capital letter characters signify statistically different means in females and lower case letter characters signify statistically different means in males. 96

PAGE 97

Figure 4-15: Estrogen receptor alpha (ER ) mRNA gene expression from in ovo PTU treatment in gonad tissue from the American alligator, A. mississippiensis. Genes were normalized to ribosomal L8 and relative e xpression counts were calculated using the 2Ct method. Error bar represents 1 standa rd error from mean. Statistically significant ( = 0.05) sexual dimorphism depicted by an asterisk (*). Different capital letter characters signify sta tistically different means in females. 97

PAGE 98

Figure 4-16: Estrogen receptor beta (ER ) mRNA gene expression from in ovo PTU treatment in gonad tissue from the American alligator, A. mississippiensis. Genes were normalized to ribosomal L8 and relative e xpression counts were calculated using the 2Ct method. Error bar represents 1 standa rd error from mean. Statistically significant ( = 0.05) sexual dimorphism depicted by an asterisk (*). Different capital letter characters signify sta tistically different means in females. 98

PAGE 99

Figure 4-17: Steroidogenic acu te regulatory protein (StA R) mRNA gene expression from in ovo PTU treatment in gonad tissue from the American alligator, A. mississippiensis. Genes were normalized to ribosomal L8 and relative expression counts were calculated using the 2Ct method. Error bar represents 1 standard error from mean. Statistically significant ( = 0.05) sexual dimorphism depicted by an asterisk (*). Different capital letter characters signify statistically different means in females and lower case letter characters signify statistically different means in males. 99

PAGE 100

Figure 4-18: Aromatase (AROM) mRNA gene expression from in ovo PTU treatment in gonad tissue from the American alligator, A. mississippiensis. Genes were normalized to ribosomal L8 and relative expression counts were calculated using the 2Ct method. Error bar represents 1 standard error from mean. Statistically significant ( = 0.05) sexual dimorphism depicted by an asterisk (*). 100

PAGE 101

Figure 4-19: Androgen receptor (AR) mRNA gene expression from in vivo PTU treatment in ovary tissue from the American alligator, A. mississippiensis. Genes were normalized to ribosomal L8 and relative expressi on counts were calculated using the 2Ct method. Error bar represents 1 standard error from mean. Di fferent cap ital letter characters signify statistically different means in females ( = 0.05). 101

PAGE 102

Figure 4-20: Estrogen receptor alpha (ER ) mRNA gene expression from in vivo PTU treatment in ovary tissue from the American alligator, A. mississippiensis. Genes were normalized to ribosomal L8 and relative e xpression counts were calculated using the 2Ct method. Error bar represents 1 standa rd error from mean. Different capital letter characters signify statistically different means in females ( = 0.05). 102

PAGE 103

Figure 4-21: Estrogen receptor beta (ER ) mRNA gene expression from in vivo PTU treatment in ovary tissue from the American alligator, A. mississippiensis. Genes were normalized to ribosomal L8 and relative e xpression counts were calculated using the 2Ct method. Error bar represents 1 standa rd error from mean. Different capital letter characters signify statistically different means in females ( = 0.05). 103

PAGE 104

Figure 4-22: Deiodinase type 1 (D 1) mRNA gene expression from in vivo PTU treatment in ovary tissue from the American alligator, A. mississippiensis. Genes were normalized to ribosomal L8 and relative expressi on counts were calculated using the 2Ct method. Error bar represents 1 standard error from mean. Di fferent cap ital letter characters signify statistically different means in females ( = 0.05). 104

PAGE 105

Figure 4-23: Deiodinase type 2 (D 2) mRNA gene expression from in vivo PTU treatment in ovary tissue from the American alligator, A. mississippiensis. Genes were normalized to ribosomal L8 and relative expressi on counts were calculated using the 2Ct method. Error bar represents 1 standard error from mean. Di fferent cap ital letter characters signify statistically different means in females ( = 0.05). 105

PAGE 106

CHAPTER 5 SUMMARY OF RESULTS Introduction This manuscript examined the thyroid/gonad axis of the American alligator. We investigated two major areas of thyroid/gonad activity; the aff ect of the thyroid axis on the development of the gonad and a mechanism of communication between the thyroid and gonad axes. In particular, the role of the thyroid axis in the develo pment and functioning of the gonad during the neonatal and peripubertal periods was investigated. De velopmental studies focused on gonadal differentiation and development following exposure to an antithyroid-agent during the window of sexual differentiation. In the studies of adolescent al ligators, we described normal physiology and morphology of the th yroid/gonad axis as well as how these respective organs respond to hormonal challenges. Does the thyroi d axis influence season al reproductive hormone variation? We also describe d a novel mechanism of communi cation between the thyroid and gonad axes. This mechanism included the char acterization of ER and AR receptors on the thyroid follicle as well as expres sion levels of these receptors to manipulations. We proposed to test several hypotheses stated below. Hypothesis 1 : Plasma thyroxine concentrations disp lay seasonal variatio n that parallels seasonal variation in sex steroid concen trations, not seasonal activity patterns. Hypothesis 2 : ER, AR and TR expression on the thyr oid will vary among life stages and show sexual dimorphism. Hypothesis 3 : Treatment of the thyroid with PTU w ill alter gene expression on the gonad to genes related to gonad physiology. Hypothesis 4 : By blocking the thyroid with PTU during the temperature dependant sexual differentiation period of the alligator embryo, we predict an alteration in the development of the testis or ovary. 106

PAGE 107

In addition, Chapter one began to elucidat e on questions regarding the hypothalamuspituitary-thyroid-gonad (H-P-T-G) axes of re gulation. Collaboration with professor Caren Helbing, University of Victoria has recently produced cloned TR and TR from the American alligator. Using quantitative RT-PCR (Q-PCR), we have observed that both TR and TR are expressed in the gonads of juven ile alligators (Helbing et al. 2006) with greatly elevated levels of TR relative to TR Further, there appears to be a di fferential response to TSH treatment, with no effect on TR mRNA after treatment, but elevation of TR mRNA levels in the testis but not the ovary. These data suggest that, lik e the rodent gonad, cells in the alligator gonad express TR, suggesting that this ti ssue is responsive to the actions of thyroid hormones. We also answer whether TSH has an effect on the gonad (Fig. 5-1). We find that TSH up-regulates TR mRNA expression in the gonad, possibly through stimulati on of the thyroid. Seasonal Thyroxine Variation In Chapter 2, we addressed hypothesis 1: whether or not plasma thyroxine concentrations display seasonal variation that parallels seasonal variation in sex steroid concentrations, not seasonal activity patterns. We observed that j uvenile American alliga tors display seasonal variation in circulating T4 concentrations. Further, comparing the seasonal pattern observed in plasma concentrations of T4 with the seasonal patterns in ot her hormones, such as T and E2 we find that the thyroxine follows a similar pattern of va riation to sex steroids in juvenile alligators. We hypothesized that thyroid hormones could play a cooperative role with T and E2 in juveniles, helping stimulate important events in puberty. We demonstrated that a relationship exist between the thyroid axis and the gonad axis. The relatio nship found with circulating levels of thyroxine and sex steroids led us to ask how are the thyroid and gonad axes co mmunicating with one another? 107

PAGE 108

Characterization of ERs on the Thyroid In Chapter 3, we addressed hypothesis 2: ER AR and TR expressi on on the thyroid will vary among life stages and show sexual dimorphism. The thyroid axis may have a role in regulating the gonads and vice versa. Sex steroi d receptors on the thyroid are thought to be nuclear receptors, which regulate target gene ex pression involved in metabolism, development, and reproduction (McKenna and OMalley, 2001). The role that these sex steroids and their receptors play in the regulation of the thyroid is not currently well understood. This study demonstarted that mRNA for both forms of the ER, both forms of TR and AR are found on the thyroid of the American alligator ( A. mississippiensis ). No sexual dimorphism was observed in the mRNA expression of these genes in the thyroid tissue examined. However, the presence of sex steroid re ceptors provides a potential mechanism by which gonadal steroids could influence thyroid development and function. This also brings insights to how the gonad axis communicated back to the thyroid axis via the H-P-T-G axes (Fig. 5-1). This is the first study to describe ERs in the thyroid of a none-mammalian species and to characterize the expression with mRNA expressi on and protein expression. Furthe r studies are required to determine if such a regulatory pathway exists via ERs in the thyroid. PTU Exposure in the Thyroid and Gonad Hypothesis 3 and 4 are addressed in Chapter 4. Treatment of the thyroid with PTU does alter gene expression on the gonad to genes related to gonad phys iology (hypothesis 3). Also, by blocking the thyroid with PTU during the temper ature dependant sexual differentiation period of the alligator embryo, we observed organization changes in mRNA expression in the thyroid, testis or ovary. In the thyroid we find that both ER and D2 show similar patterns suggesting that D2 could potentially, be influenced by estrogens. We also noted that ER may not play as large of 108

PAGE 109

109 role during embryonic development and increases in function as neonate. AR data suggest that this might be a regulatory m echanism on the thyroid. Both NIS and PEN appear to be good candidate genes for regulation of th e thyroid axis vi a sex steroids. In the gonad we found changes in gene expression caused by depressi ng the thyroid axis. AR shows possible organization changes from the in ovo PTU series. ER and ER also appear influenced by treatment, especially in females. This trend is followed in aromatase and StAR as well suggesting up regulation of the steroidogeni c pathway in the ovary when thyroid is depressed. Results for mRNA expression in th e thyroid or gonad are summarized in figures below. PTU in ovo sexual dimorphism and treatment effects in thyroid tissue for males or females are displayed in Figs. 5-2, 5-3 and 5-4 respectively. PTU in vivo sexual dimorphism and treatment effects in thyroid tissue for males or females are displayed in Figs. 5-5, 5-6 and 5-7 respectively. Figure 5-8 displays PTU in ovo sexual dimorphism in gonad tissue. PTU in ovo treatment effects in gonad tissue for males or females is displayed in Fig. 5-9. PTU in vivo treatment effects in gonad tissue for females are displayed in Fig. 5-10. We examined the potential ro le of thyroid hormones on the developing reproductive axis of the American alligator. We focused on the pot ential effects of depressing this axis with a pharmaceutical agent, PTU. This study ex amined both organizational effects with in ovo PTU treatment during the win dow of sexual differentiation of the gonad in developing embryos as well as activational effects with in vivo PTU treatment in neonates. Further work is necessary to elucidate the mechanisms involved in the regu lation of the thyroid from the gonad. These studies provide a good foundation to begin to understand the inte ractions between the thyroid and gonadal axes.

PAGE 110

Figure 5-1: Thyroid-gonad axis of regulation revisited. TSH secreted from pituitary has stimulatory role on thyroid and gonad. FSH secreted from pituitary has stimulatory role on gonads. Estradiol secreted from gonads plays an inhibitory role in pituitary on FSH secretion. Estradiol possibly pl ays a regulatory role on thyroid. 110

PAGE 111

Figure 5-2: In Ovo PTU mRNA expression of genes analyzed via QPCR in thyroid tissue of juvenile American alligators (A.mississippiensis ). This graphic represents whether sexual dimorphism existed. Figure 5-3: In Ovo PTU mRNA expression of genes analyzed via QPCR in thyroid tissue of male juvenile American alligators ( A.mississippiensis). This graphic represents whether treatment effects existed. Intermediate expression not statistically different from either vehicle or treatment represented by fade effect. 111

PAGE 112

Figure 5-4: In Ovo PTU mRNA expression of genes analyzed via QPCR in thyroid tissue of female juvenile American alligators ( A.mississippiensis ). This graphic represents whether treatment effects existed. Intermediate expression not statistically different from either vehicle or treatment represented by fade effect. 112

PAGE 113

Figure 5-5: In Vivo PTU mRNA expression of genes analyz ed via QPCR in thyroid tissue of juvenile American alligators (A.mississippiensis ). This graphic represents whether sexual dimorphism existed. 113

PAGE 114

Figure 5-6: In Vivo PTU mRNA expression of genes analyz ed via QPCR in thyroid tissue of male juvenile American alligators ( A.mississippiensis). This graphic represents whether treatment effects existed. Intermediate expression not statistically different from either vehicle or treatment represented by fade effect. 114

PAGE 115

Figure 5-7: In Vivo PTU mRNA expression of genes analyz ed via QPCR in thyroid tissue of female juvenile American alligators ( A.mississippiensis ). This graphic represents whether treatment effects existed. Intermediate expression not statistically different from either vehicle or treatment represented by fade effect. 115

PAGE 116

Figure 5-8: In Ovo PTU mRNA expression of genes anal yzed via QPCR in gonad tissue of juvenile American alligators (A.mississippiensis ). This graphic represents whether sexual dimorphism existed. Figure 5-9: In Ovo PTU mRNA expression of genes anal yzed via QPCR in gonad tissue of juvenile American alligators (A.mississippiensis ). This graphic represents treatment effects existed in males or females. 116

PAGE 117

117 Figure 5-10: In Vivo PTU mRNA expression of genes anal yzed via QPCR in gonad tissue of female juvenile American alligators ( A.mississippiensis ). This graphic represents whether treatment effects existed. No males mRNA expression was examined.

PAGE 118

APPENDIX A APPENDIX STAINING PROTOCOL FOR ER IHC Table A-1: Immunohistochemist ry staining protocol for ER Both the Vector Elite IHC kit and the ERantibody were obtained from the Sa nta Cruz Biotechnology Inc. (Santa Cruz, California). DAY ONE SOLUTION TIME Deparaffinize and hydrate Citrisolve X2 for 5 min, 100% EtOH X2 for 5 min, 95% EtOH for 5 min. Wash in deionized H2O for 1 min with stirring 30 min Unmask antigens 0.02M Citrate Buffer (pH 6.0); Microwave (>7000W)High 3 min, Medium 3 min, Low 3 min, and cool to room temp ~ 20 min 35 min Rinse PBS 2-3 times Pap pen Wipe away excess liquid around the sections and circle dry 1-2 min Soak PBS 5 min Block endogenous peroxidase 3% Hydrogen Peroxide 30 min Rinse PBS 2 min Block normal goat serum (~20 l) 60 min Aspirate Aspirate serum from slides >1 min Incubate Primary antibody (dilute 1:400 with normal goat serum); negative control Over night at 4C DAY TWO SOLUTION TIME Rinse PBS 2 min Incubate Secondary Antibody (~20 l) 30 min Rinse PBS 2 min Incubate Peroxidase reagent (~20 l) 30 min Rinse PBS 2 min Make HRP substrate In a mixing bottle, add 1.6 mL of deionized water, 5 drops 10X substrate buffer, 1 drop 50X DAB chromagen, and 1 drop 50X peroxidase substrate Visualize HRP substrate (1-3 drops) 8 min Rinse and wash deionized water 2 min Dehydrate and mount ethanols/dehydrate (2X 95% -10 sec; 2X 100% 10 sec; Citrisolve until mounting with Permount 118

PAGE 119

APPENDIX B APPENDIX PARTIAL SEQUENCES FOR CLONED THYROID GENES NIS Sodium-Iodide Symporter 180/2,070 bp 8.7% 3-5 TGGACTGATGTGTTTCAGGT GTTCGTGATGCTCTCCGGG TTCGTCGCCATCGCCATCC AGGGCACGTTGATGGTGGGAAGCCCCGGAGGGGTCCTGGGCGCCGCGTACAACCAC TCCCGAGTGAACTTTGCTGACTTCGACCCCGACCCCCGGAGCCGCTACACCTTCTGG ACCTTCGTA 5-3 TACGAAGGTCCAGAAGGTGTAGCGGCTCCGGGGGTCGGGGTCGAAGTCAGCAAAGT TCACTCGGGAGTGGTTGTACGCGGCGCCC AGGACCCCTCCGGGGCTTCCCACCATCA ACGTGCCCTGGATGGCGATGGCGACGAA CCCGGAGAGCATCACGAACACCTGAAAC ACATCAGTCCA PEN Pendrin 780/2,349 bp 33.2% 5-3 AATCAGGAGTTTATTGCATTTGGGATCAGCAATGTGCTTTCAGGAGCTTTTTCCTGTT TTGTTGCTACAACTGCACTTTCACGTACT GCTGTCCAGGAAAGCACTGGTGGAAAAA CTCAGGTTGCTGGCCTAATCTCAGCTGG GATTGTTATGATTGCCATTGTTGNNCTGG GGAAATTGCTAGAGCCCTTGCAAAAGTCTGT GTTGGCAGCTGTTGTCATTGCCAACT TGAAAGGGATGTTCATGCAGGTATGT GATGTTCCCAGATTGTGGAGACAGAATAAG GTGGATGCTATGATCTGGGTTTTCACATGTGTGGCATCCATCATTCTGGGGCTCGATT TGGGATTACTTGCTGGCCCTGTGTTTGGA TTACTGACAGTTGTGGTGAGAGTTCAATT TCCTTCTTGGGGTGGCCTTGGGAACGTTCCTGGCACAGATCTCTATAAGAATGTCAA GGAATACAAAAATGTTGTTGAACCACAA GGTGTGAAGATTCTTCAGTTTTCCAGTCC TATTTTTTATGCCAATATCGATGGATTGA AAAGCAGCCTCAAATCCACTGTGGGTTTT GATGCAGTTAGGGTATACAACAAGAGAC TCAAAGCACTAAGAAAGATACAGAAACT AATCAAGAAGGGGAAGTTGAAAGCAACTAAG AATGGTATCATCAGTGACTCTGGTG TTGCAAATGAAGCTTTTGAGCCTGATGAAGATCCAGAAGAGT CCGAAGATCTCGAA ATTCCAACTAGAGAAATAG AAATCCAAGTCGACTGGAAC Tg Thyroglobulin 561/8,322 bp 6.7% 3-5 AATATCTTTGAGTATCAGGTGGAATCCCAGCCTCTACGTCCATGTGAGCTTCGGAGA GAAAAGGCCTTTCTGGAAGGA GAAGATCATGTTCCCCAGTGCTCAGAAGATGGCCA GTTCCGGACTGTGCAGTGCAGCAAGAACAACCTTTCCTGCTGGTGTGTAGATGACAA GGGAGCTGAAGTACCAGGCAGTAAACAGAATGGAGTTCCCATATCCTGTTTATCCTT TTGTCAGCTGCAAAAGCAGCAGGTCTTGGT AAGTCGCTACATCAACAGCAGCACCAT CTCCTACATCCCTCAGTGCTTGGATTCGGGGGAGTTTGCTCCAGTGCAGTGTGACGT GGGCCTGGGACAATGCTGGT GTGTGGACTCAGAAGGGATGGAGATTTATGGCACAA GGCAGACAGGGAAACCAACCCAGTGTCCAGG GAGCTGTGAGATCCGAGACCGTCGT ATTCTGCATGGAGTTGGGGACAGGAGTCCACCACAGTGTTCAGCAGACGGAGAATT TTTGCCTGTTCAGTGCAAATTTGTCAAC ATGACCGACATGATGATATTCGAT Tp Thyroperoxidase 519/2,700 bp 19.2% 3-5 CACCCGGATAATATTGATGTATGGCTTGGTGGCCTAGCAGAAAACTTCCTTCCAGAT GCTAGAACTGGCCCACTGTTTGCATGTCTAATTGGAAAACAAATGAAAGCACTGAG GGAAGGTGACCGATTTTGGTG GGAAAATGATGATATTTTCA CAGAAGTGCAAAGGCATGAGCTCAAAAAACATTCTTTGTCCCGCATAATCTGTGACA 119

PAGE 120

120 ATACAGGACTTTCAGAAGTGCCAGTTGATGCTTTTCAACTTGGGAAGTTTCCTGAAG ACTTTGAGTCATGTGACAATATACCAGGAAT AAATTTAGAAGCTTGGCAGGAAACCT ATGAGCAAGAGGAAACAT GTGGAGTCCCAATGAAAGTGGAAAACGGTGACTTTGTA TATTGTTCAGAACTCGGAA AATCCATAGTGATTTATTCATGTCAATTTGGATTCCAGC TACAAGGAGAAGAACAATTAACCTGTACAAATAAAGAATGGAATTTTCCACCACCA GTTTGTAAAGACGTCAACGAATGC TSH-r Thyrotropin receptor 550/2,475 bp 22.2% 3-5 CATTGTTGTGCATTTAAGAACTGGAA GAAAACGAAAGGAGT TCCGGAATACCTGAT GTGTAACCAGACCAGCAGTTATAACGTCC GTAAAAGAAGATCTGTAAGTGCCTTTAA TGGTCCTTTTTACCAAGACTATGCAGAAGGAGATACAGAGCACACTGAGGCAGTGT ATGACAAAAACTCCAAATTCAGGGATTTTTA TGGCAATTCCCACTACTATGTCTTTTT TGAAGAGCAGGGGGATGGAGATGTTGGA TTTGGCCAAGAAATCAAGAACCCTCAAG AGGAAAATGCCCAGGCATTTGACAGCCAC TATGACTATACTGTCTGTGGGGGCAAT GAAGAAATAGTATGCACCCCAGAGCCTGA TGAGTTTAATCCCTGTGAAGACATAAT GGGGTATACATTTCTAAGGATTGTGGTTTGGTTTGTGAACCTCCTTGCCATCCTGGGT AATATTTTTGTCCTGTTCATCCTTCTCACCAGCCATTACAAGTTGACTGTCCCACGTT TTTTGATGTGCAACCTGGCCT TCGCCGACTTCTGCATGG D1 Deiodinase type 1 Helbing lab/Nik Veldhoen 10/20/2005 306/540 bp 5-3 CTGTTGAAATTTGACGAGTTCAACAAGCTTGTCGAAGATTTCAACCCTGTAACAGAT TTCCTTTTAATCTACATTGAAGAAGCTCATGCAACAGACGGATGGGCTTTTAAAAAT AATATTGTTATTAAAAATCACCAAAACCTTGAAGATCGAAAAATGGCTGCACGGTTT CTTCTGAAAAAGAACCCCTTATGCCC AGTTGTTGTGGATACTATGGAAAACCTCAGC AGCTCAAAGTATGCTGCTCTCCCAGAAAGAC TTTACCTGCTTCAAG GAAGAAAGGTT GTTTATAAGGGTGGAGCAGGA D2 Deiodinase type 2 Helbi ng lab/NikVeldhoen 10/20/2005 526 bp 5-3 CTTCCTTGCACTCTATGATTCTGTGATCC TCCTGAAGCACATGGTGCTGTTTCTGAGT CGGTCTAAGTCTGCGCGTGGTGAGTGGC GAAGGATGCTGACCTCAGAGGGGCTGCG TTGCGTCTGGAATAGCTTCCTCCTAGATGCTTACAAACAGGTGAAACTGGGTGGAGA AGCCCCAAACTCCAGAGTGATTCACATAACCAATGGCATCAGTGGTGGCAGTACCA GATGCAAGAATGTTGGTGGAAAGTTGGG GAGCGAGTGTCATCTCTTGGATTTTGCCA ACTCTGAGCGTCCCCTGGTGGTCAACTTTGGTTCAGCTACCTGACCTCCATTCACGA GCCAGCTGTCAGCCTTCAGCAAGCTGGT GGAGGAGTTTTCAGGTGTGGCCGACTTCC TGTTGGTCTACATTGACGAGGCTCACCCA TCGGATGGTTGGGCTGCTCCTGGAATCT CGCCCTCTTCATTTGAGGTGAAGAAGCACA AGAACCAGGAAGACCGATGTGCAGCT GCTCACCAGCTCCTG

PAGE 121

LIST OF REFERENCES Allsteadt, J., Lang, J.W., 1995. Sexual dimorphism in the genital morphology of young American alligators, Alligator mississippiensis Herpetologica 51, 314-325. Anthony, F.F., Aruldhas, M.M., Udhayakumar, R.C., Maran, R.R., Govindarajulu, P., 1995. Inhibition of Leydig cell activity in vivo and in vitro in hypothyroid rats. J. Endocrinol. 144, 293300. Arain, S.A., Shah, M.H., Meo, S.A., Jamal, Q., 2003. Estrogen receptors in human thyroid glandAn immunohistological study. Saudi Med. J. 24, 174-178. Arambepola, N.K., Bunick, D., Cooke, P. S., 1998. Thyroid hormone effects on androgen receptor messenger RNA expression in rat Sert oli and peritubular cells. Endocrinology 156, 4350. Barbeau, T.R., Guillette L.J., J., 2007. Altered ovarian steroids in Xenopus laevis exposed to environmentally relevant concentrations of nitrate. J. Herpotol. 41, 590-597 Bassett, J.H., Harvey, C.B., Williams, G.R., 2003 Mechanisms of thyroid hormone receptorspecific nuclear and extra nuclear ac tions. Mol. Cell. Endocrinol. 213, 1-11. Bau, F., Parent, J.P., 2000. Seasonal variations of thyroid hormone levels in wild fish. Comptes Rendus De L Academie Des Sciences Serie IiiSciences De La Vie-Life Sciences 323, 365-372. Bentley, P.J., 1982. Comperative vertebrate e ndocrinology. Cambridge University Press, New York. Bermudez, D.S., Milnes, M.R., Bryan, T.A ., Gunderson, M.P., Tubbs, C., Woodward, A., Guillette L. J., J., 2005. Seasonal variation in pl asma thyroxine concentrations in juvenile alligators ( Alligators mississippiensis ) from three Florida lakes. Comp. Biochem. Phys. A 141, 814. Bernal, J., Guadano-Ferraz, A., Morte, B., 2003. Pe rspectives in the study of thyroid hormone action on brain development and function. Thyroid 13, 1005-1012. Bhattacharya, S., Banerjee, J., Jamaluddin, M., Banerjee, P.P., Maitra, G., 1988. Thyroid hormone binds to human corpus luteum. Experientia 44, 1005-1007. Blaxter, J.S., 1988. Pattern and variety in development. In: Hoar, W.S., Randall, D.J. (Eds.), Fish physiology. The physiology of developing fish., vol 11A. Academic Press, San Diego, pp. 1-58 Boily, P., 1996. Metabolic and hormonal change s during the molt of captive gray seals ( Halichoerus grypus ). Am. J. Physiol. 270, 1051-1058. 121

PAGE 122

Bona-Gallo, A., Licht, P., MacKenzie, D.S., Loft s, B., 1980. Annual cycles in levels of pituitary and plasma gonadotropin, gonadal steroids, and thyroid activity in the Chinese cobra ( Naja naja ). Gen. Comp. Endocr. 42, 477-493. Brouwer, A., Morse, D., Lans, M., Schuur, A., Murk, A., Klasson-Wehler, E., Bergman, A., Visser, T., 1998. Interactions of persistent environmental organohalogens with the thyroid hormone system: mechanisms and possible conseque nces for animal and human health. Toxicol. Ind. Health 14, 59-84. Brucker-Davis, F., 1998. Effects of environmen tal synthetic chemicals on thyroid function. Thyroid 8, 827-856. Brunigfann, C., Kaneene, J., 1993. The effects of nitrate, nitirte, and N-nitroso compounds on animal health. Vet. Hum.Toxicol. 35, 237-253. Buzzard, J.J., Morrison, J.R., O'Bryan, M.K ., Song, Q., Wreford, N.G., 2000. Developmental expression of thyroid hormone receptors in the rat testis. Biol. Reprod. 62, 664-669. Buzzard, J.J., Wreford, N.G., Morrison, J.R ., 2003. Thyroid hormone, retinoic acid, and testosterone suppress prolifera tion and induce markers of differentiation in cultured rat Sertoli cells. Endocrinol. 144, 3722-3731. Capen, C.C., 1992. Pathophysiology of chemical inju ry of the thyroid gland. Toxicol. Lett. 64, 381-388. Capen, C.C., 1994. Mechanisms of chemical injury of the thyroid gland. Prog. Clin. Biol. Res. 387, 173-191. Cayrou, C., Denver, R.J., Puymirat, J., 2002. Suppr ession of the basic transcription elementbinding protein in brain neural cultures inhibits thyroid hor mone-induced neurite branching. Endocrinology 143, 2242-2249. Chattopadhyay, A., Kumar, V., Marulaiah, M., 20 03. Polycystic ovaries, precocious puberty and acquired hypothyroidism: the Van Wyk and Grum bach syndrome. J. Pediatr. Surg. 38, 13901392. Coleman, M.D., Gaskin, C.A., Fernandes, S., Khanderia, L., 2003. The use of xenobioticmediated methaemoglobin formation to assess th e effects of thyroid hormones on diabetic and nondiabetic human erythrocytic oxidant defenc e mechanisms in vitro. Environ. Toxicol. Phar. 13, 15-19. Cooke, P.S., Hess, R.A., Porcelli, J., Meisami, E., 1991a. Increase sperm production in adult rats after transient neonatal hypot hyroidism. Endocrinology 129, 244-248. 122

PAGE 123

Cooke, P.S., Holsberger, D.R., Witorsch, R.J., Sy lvester, P.W., Meredith, J.M., Treinen, K.A., Chapin, R.E., 2004. Thyroid hormone, glucocorticoid s, and prolactin at the nexus of physiology, reproduction, and toxicology. Toxicol. Appl. Pharm. 194, 309-335. Cooke, P.S., Meisami, E., 1991b. Early hypothyroidism in rats causes increased adult testis and reproductive organ size but does not change testosterone levels. Endocrinology 129, 237-243. Correa da Costa, V.M., Moreira, D.G., Rosent hal, D., 2001. Thyroid func tion and aging: genderrelated differences. J. Endocrinol. 171, 193-198. Crain, D.A., 1997. Endocrine-disrupting contaminan ts and reproduction in vertebrate wildlife. Environ. Toxicol.; Rev. Toxicol. 1, 47-70. Crain, D.A., Guillette L. J., J., Pickford, D.B., Percival, H.F., Woodward, A.R., 1998. Sexsteroid and thyroid hormone concentr ations in juvenile alligators ( Alligator mississippiensis ) from contaminated and reference lakes in Fl orida, USA. Environ. Toxicol. Chem. 17, 446-452. Davis, G.S., Anderson, K.E., Carroll, A.S., 2000. The effects of long-term caging and molt of Single Comb White Leghorn hens on herterophil to lymphocyte ratios, corticosterone and thyroid hormones. Poultry Sci. 79, 514-518. Davis, L.M., Glenn, T.C., Strickland, D.C., Gu illette, L.J., Jr., Elsey, R.M., Rhodes, W.E., Dessauer, H.C., Sawyer, R.H., 2002. Micros atellite DNA analyses support an east-west phylogeographic split of American allig ator populations. J. Exp. Zool. 294, 352-372. DeFeo, P., 1996. Hormonal regulation of human pr otein metabolism. Eur. J. Endocrinol. 135, 718. Denver, R.J., 1998. Hormonal correlates of envi ronmentally induced metamorphosis in the Western spadefoot toad, Scaphiopus hammondii. Gen. Comp. Endocr. 110, 326-336. Denver, R.J., 1999. Evolution of the corticotropi n-releasing hormone signaling system and its role in stress-induced phenot ypic plasticity. In: Neuropeptides : Structure and Function in Biology and Behavior, 897, 46-53 Dickhoff, W.W., Darling, D.S., 1983. Evolution of thyroid func tion and its control in lower vertebrates. Am. Zool. 23, 697-708. Eales, J.G., 1985a. The peripheral metabolism of thyroid hormones and regulation of thyroidal status in poikilotherms. Can. J. Zool. 63, 1217-1231. Eales, J.G., 1985b. The peripheral metabolism of thyroid hormones and regulation of thyroidal status in poikilotherms. Can. J. Zool. 63, 1217-1231. Eales, J.G., 1988. The influence of nutritional state on thyroid function in various vertebrates. Amer. Zool. 28, 351-362. 123

PAGE 124

Eales, J.G., 1997. Iodine metabolism and thyroid-re lated functions in organisms lacking thyroid follicles: are thyroid hormones also vitamins? P. S. E. B. M. 214, 302-317. Edwards, T.M., Gunderson, M.P., Milnes, M.R., Guillette L. J., J., 2004. Gonadotropin-induced testosterone response in peripubertal ma le alligators. Gen. Comp. Endocr. 135, 372-380. EPA, 1994. Tower Chemical company superfund site biological assessment. In: U.S. Environmental Protection Agency, Athens, GA, Evans, R.M., 1988. The steroid and thyroid hormone receptor superfamily. Science 240, 889895. Fujimoto, N., Sakai, Y., Ito, A., 1992. Increase in estrogen-receptor le vels in MNU induced thyroid-tumors in LE rats. Carcinogenesis 13, 1315-1318. Gancedo, B., Alonso-Gomez, A.L., de Pedro, N., Delgado, M.J., Alonso-Bedate, M., 1997. Changes in thyroid hormone concentrations and total contents through ontogeny in three anuran species: Evidence for daily cycles. Gen. Comp. Endocr. 107, 240-250. Gatseva, P., Mardirosian, Z., Popova, E., St. Iskrenova, E., Vladeva, S., Pavlova, K., 2000a. Evaluation of health hazards in children from re gions with nitrate pollu tion. Folia Medica XLII, 19-22. Gatseva, P., Marinova, S., Vurtigova, L., 1992. Change s in the thyroid and ot her internal organs of experimental animals exposed to a drinking re gimen with high nitrate content. Probl Khig 17, 43-47. Gatseva, P., Vladeva, S., Pavlova, K., 1998a. Incidence of goiter among children in a village with nitrate contamination of drinking water. Folia Medica XXXX, 19-23. Gatseva, P.D., Mardirosian, Z.H., Popova, E.J., St. Iskrenova, E., Vladeva, S.V., Pavlova, K.I., 2000b. Evaluation of health hazards in children from regions with nitrate pollution. Folia Med. XLII, 19-22. Gatseva, P.D., Vladeva, S.V., Pavlova, K.I ., 1998b. Incidence of goiter among children in a village with nitrate contamination of drinking water. Folia Med. XXXX, 19-23. Giani, C., Campani, D., Denegri, F., Martini, L., Fabbri, R., Bonacci, R., Ciancia, E.M., Gigliotti, A., Fierabracci, P., Pinchera, A., 1993. Interferance of t hyroperoxidase on immunocytochemical determination of steroid-receptor s in thyroid tissue. J. Endocrinol. Invest. 16, 3743. Goldman, M., 1981. The effect of a single dose of DDT on thyroid function in male rats. Arch. Int. Pharmacodyn. Ther. 252, 327-334. 124

PAGE 125

Goto-Kazeto, R., Kazeto, Y., Trant, J.M., 2003. Cloning and seasonal changes in ovarian expression of a TSH receptor in the channel catfish, Ictalurus punctatus. Fish Physiol. and Biochem. 28, 339-340. Grenard, S., 1991. Handbook of alligators and cr ocodiles. Krieger Publishing Company, Malabar. Gu, W.X., Stern, P.H., Madison, L.D., Du, G.G., 2001. Mutual up-re gulation of thyroid hormone and parathyroid hormone receptors in rat oste oblastic osteosarcoma 17/2.8 cells. Endocrinology 142, 157-164. Guillette L. J., J., Edwards, T.M., 2005. Is nitrate an ecologically relevant endocrine disruptor in vertebrates? Integr Comp. Biol. 45, 19-22 Guillette, L.J., Gross, T.S., Masson, G.R., Matte r, J.M., Percival, H.F., Woodward, A.R., 1994. Developmental abnormalities of the gonad and abnormal sex-hormone concentrations in juvenile alligators from contaminated and control lake s in Florida. Environ. Health Persp. 102, 680-688. Guillette, L.J., Jr., Brock, J.W., Rooney, A.A ., Woodward, A.R., 1999. Serum concentrations of various environmental contaminants and their re lationship to sex steroi d concentrations and phallus size in juvenile alligators. Arch. Environ. Con. Tox. 36, 447-455. Guillette, L.J., Jr., Crain, D.A., Gunderson, M.P ., Kools, S.A.E., Milnes, M.R., Orlando, E.F., Rooney, A.A., Woodward, A., 2000. A lligators and endocrine disrupting contaminants: a current perspective. Amer. Zool. 40, 438-452. Guillette, L.J., Jr., Pickford, D.B., Crain, D.A., Rooney, A.A., Percival, H.F., 1996. Reduction in penis size and plasma testosterone concentrations in juvenile alligators living in a contaminated environment. Gen. Comp. Endocr. 101, 32-42. Guillette, L.J., Jr., Rooney, A.A., Crain, D.A., Orlando, E.F., 1999c. Steroid hormones as biomarkers of endocine disrupti on in wildlife. In: Henshel, D. S., Black, M.C., Harrass, M.C. (Eds.), Environmental Toxicology and Risk Asse ssment: Standardization of Biomarkers for Endocrine Disruption and Environmental Assessment, vol. 8. Amer ican Society for Testing and Materials, West Consshohocken, PA, Guillette, L.J., Jr., Woodward, A., Crain, D.A., Masson, G.R., Palmer, B.D., Cox, C., YouXiang, Q., Orlando, E.F., 1997. The reproductive cy cle of the female American alligator ( Alligator mississippiensis). Gen. Comp. Endocr. 108, 87-101. Hamann, I., Seidlova-Wuttke, D., Wuttke, W., Kohrle, J., 2006. Effects of isoflavonoids and other plant-derived compounds on the hypothalamuspituitary-thyroid hormone axis. Maturitas 55, S14-S25. Heinz, G.H., Percival, H.F., Jennings, M.L., 1991. Contaminants in American alligator eggs from lakes Apopka, Griffin and Okeechobee, Florida. Environ. Monit. Assess. 16, 277-285. 125

PAGE 126

Helbing, C.C., Crump, K., Bailey, C.M., Kohno, S ., Veldhoen, N., Bryan, T.A., Bermudez, D.S., Guillette L. J., J., 2006. Isolation of the alligator ( Alligator mississippiensis) thyroid hormone receptor and transcripts and their responsiveness to thyroid stimulating hormone. Gen. Comp. Endocr. 149, 141-150. Hiasa, Y., Nishioka, H., Kitahori, Y., Yane, K., Nakaoka, S., Ohshima, M., Konishi, N., Nishii, K., Kitamura, M., Matsunaga, T., 1993. Immunohist ochemical analysis of estrogen-receptors in 313 paraffin section cases of human thyroid-tissue. Oncology 50, 132-136. Hoffman, W.H., Kovacs, K.T., Gala, R.R., Keel, B. A., Jarrell, T.S., Ellegood, J.O., Bureck, C.L., 1991. Macroorchidism and testicular fibrosis associated with autoimmune thyroiditis. J. Endocrinol. Invest. 14, 609-616. Holsberger, D.R., Jirawatnotai S., Kiyokawa, H., Cooke, P.S., 2003. Thyroid hormone regulates the cedll cycle inhibitor p27Ki p1 in postnatal murine Sertoli cells. Endocrinology 144, 37323738. Humason, G.L., 1972. Animal Tissue Technique s. In: Freeman & Company, New York. Jannini, E.A., Crescenzi, A., Rucci, N., Screponi, E ., Carosa, E., de Matteis, E., Macchia, E., d'Amati, G., D'Armiento, M., 2000. Ontogenetic pa ttern of thyroid hormone receptor expression in the human testis. J. Clin. Endocr. Metab. 85, 3453-3457. Jannini, E.A., Dolci, S., Ulisse, S., Nikodem, V.M., 1994. Developmental regulation of the thyroid hormone receptor alpha 1 mRNA expression in the rat testis. Mol. Endocrinol. 8, 89-96. Jannini, E.A., Olivieri, M., Fr ancavilla, S., Gulino, A., Ziparo, E., D'Armiento, M., 1990. Ontogenisis of the nuclear 3,5,3' -triiodothyronine receptor in the rat testis. Endocrinology 126, 2521-2526. Jannini, E.A., Ulisse, S., D'Armiento, M., 1995. M acroorchidism in juvenile hypothyroidism. J. Clin. Endocr. Metab. 80, 2543-2544. John-Alder, H.B., 1984. Seasonal vari ation in activity, aerobic energetic capacities, and plasma thyroid hormones (T3 and T4) in an igua nid lizard. J. Comp. Physiol. B 154, 409-419. Johnson, M.H., Everitt, B.J., 2000. Essential Re production. Blackwell Publishing, Williston, VT. Joyce, K.L., Porcelli, J., Cooke, P.S., 1993. Neonata l goitrogen treatment in creases adult testis size and sperm production in the mouse. J. Androl. 14, 448-455. Kar, A., Chandola-Saklani, A., 1985a. Circulating thyroid hormone concentr ation in relation to seasonal events in the male Indian garden lizard, Calotes versicolor. Gen. Comp. Endocr. 60, 1419. 126

PAGE 127

Kar, A., Chandola-Saklani, A., 1985b. Circulating t hyroid hormone concentra tions in relation to seasonal events in the male Indian garden lizard, Calotes versicolor. Gen. Comp. Endocr. 60, 1419. Katsu, Y., Bermudez, D.S., Braun, E.L., Helb ing, C., Miyagawa, S., Gunderson, M.P., Kohno, S., Bryan, T.A., Guillette L. J., J., Iguchi, T ., 2004. Molecular cloning of the estrogen and progesterone receptors of the American alligator. Gen. Comp. Endocr. 136, 122-133. Katti, S., Sathyanesan, A., 1987. Lead nitrate in duced changes in thyroid physiology of the catfish Clarias batrachus Ecotox. Environ. Safe. 13, 1-6. Kavok, N.S., Krasilnikova, O.A., A., B.N., 2001. Thyroxine signal transd uction in liver cells involves phospholipase C and phospholipase D ac tivation. Genomic independent action of thyroid hormone. BMC Cell. Biol. 2:5. Kawabata, W., Suzuki, T., Moriya, T., Fujimor i, K., Naganuma, H., Inoue, S., Kinouchi, Y., Kameyama, K., Takami, H., Shimosegawa, T., Sasano, H., 2003. Estrogen receptors ( and ) and 17 -hydroxysteroid dehydrogenase type 1 a nd 2 in thyroid disorders: possible in situ estrogen synthesis and actions Modern Pathology 16, 437-444. Kawaguchi, H., Pilbeam, C.C., Raisz, L.G., 1994. An abolic effects of 3,3',5-triiodothyronine and triiodothyroacetic acid in cultured neonatal mouse parietal bones. Endocrinology 135, 971-976. Kilpatrick, S., 2002. Thyroid disease in pregnancy. Int. J. Gynecol. Obstet. 79, 171-180. Kioukia, N., Bekris, S., Antoniou, K., Papadopoulou-Daifoti, Z., Chri stofidis, I., 2000. Effects of chronic mild stress (CMS) on thyroid hormone function in two rat strains. Psychoneuroendocrino. 25, 247-257. Kirby, J.D., Mankar, M.V., Hardesty, D., Kreider, D.L., 1996. Effects of transient prepubertal 6N-propyl-2-thiuracil treatm ent on testis development and func tion in the domestic fowl. Biol. Reprod. 55, 910-916. Kisakol, G., Kaya, A., Gonen, S., Tunc, R., 2003. Bone and calcium metabolism in subclinical autoimmune hyperthyroidism and hy pothyroidism. Endocr. J. 50, 657-661. Kowalczyk, P., Sotowska-Brochocka, J., 2000. Cha nges in thyroid hormones in the serum and the thyroid gland of hibernating frogs, Rana temporaria L. Gen. Comp. Endocr. 119, 172-180. Kuhn, E.R., Darras, V.M., Verlinden, T.M., 1985. Annual variations of thyroid reactivity following thyrothropin stimula tion and circulating levels of thyroid hormones in the frog Rana ridibunda. Gen. Comp. Endocr. 57, 266-273. Kulczykowska, E., Sokolowska, E., Takvam, B. Stefansson, S., Ebbesson, L., 2004. Influence of exogenus thyroxine on plasma melatoni n in juvenile Atlantic salmon ( Salmo salar ). Comp. Biochem. Phys. B 137, 43-47. 127

PAGE 128

Kursa, J., Travnicek, J., Rambeck, W., Kroupova, V., Vitrovec, J., 2000. Goitrogenic effects of extracted rapeseed meal and nitrates in sh eep and their progeny. Vet. Med.-Czech. 45, 129-140. Kwon, J., Chang, Y., Sohn, Y., Aida, K., 1999a. Plasma and ovarian thyroxine levels in relation to sexual maturation and gestation in female Sebastes inermis. J. Fish Biol. 54, 370-379. Kwon, J.Y., Chang, Y.J., Sohn, Y.C., Aida, K., 1999b. Plasma and ovarian t hyroxine levels in relation to sexual maturation and gestation in female Sebastes inermis. J. Fish Biol. 54, 370-379. Lahti, E., Harri, M., Lindqvist, O., 1985. Uptake and distribution of radi oiodine, and the effects of ambient nitrate, in some fish sp ecies. Comp. Biochem. Physiol. 80A, 337-342. Levy, C., 1991. Endangered species: crocodile s and alligators. Chartwell Books, London. Lima, L.P., Barros, I.A., Lisboa, P.C., Araujo, R.L., Silva, A.C.M., Rosenthal, D., Ferreira, A.C.F., Carvalho, D.P., 2006. Estrogen effects on thyroid iodide uptake and thyroperoxidase activity in normal and ovariectomized rats. Steroids 71, 653-659. Livak, K.J., Schmittgen, T.D., 2001. Analysis of re lative gene expression data using real-time quantitative PCR and the 2-delta de lta Ct method. Methods 25, 402-408. Lynn, W.G., 1970. The Thyroid. In: Gans, C. (Ed.) Biology of the Reptilia, vol. 3, morphology C. Academic Press, New York, pp. 201-234 MacKenzie, D.S., VanPutte, C.M., Leiner, K.A ., 1998. Nutrient regulation of endocrine function in fish. Aquaculture 161, 3-25. Majdic, G., Snoj, T., Horvat, A., Mrkun, J., Kosec, M., Cesnik, V., 1998. Higher thyroid hormone levels in neonatal life results in reduc ed testis volume in post pubertal bulls. Int. J. Androl. 21, 352-357. Mann, D.R., Akinbami, M.A., Gould, K.G., Castr acane, V.D., 2002. Leptin and thyroxine during sexual development in male monkeys: effect of neonatal gonadotropin-releasing hormone antagonist treatment and delayed puberty on the development pattern of leptin and thyroxine secretion. Eur. J. Endocrinol. 146, 891-898. Manna, P.R., Roy, P., Clark, B.J., Stocco, D.M., Huhtaniemi, I.T., 2001. Interaction of thyroid hormone and steroidogenic acute regulatory (StAR) protein in the regula tion of murine Leydig cell steroidogenisis. J. Steroi d. Biochem. Mol. Biol. 76, 167-177. Manole, D., Schildknecht, B., Gosnell, B., Adams, E., Derwahl, M., 2001. Estrogen promotes growth of human thyroid tumor cells by different molecular mechanisms. J. Clin. Endocr. Metab. 86, 1072-1077. Maran, R.R., Ravichandran, K., Arunakaran, J ., Aruldas, M.M., 2001. Impact of neonatal hypothyroidism on Leydig cell number, plasma, and testicular interstiti al fluid sex steroid concentration. Endocr. Res. 27, 119-141. 128

PAGE 129

Marassi, M.P., Fortunato, R.S., Matos da Silva, A.C., Pereira, V.S., Carvalho, D.P., Rosenthal, D., Correa da Costa, V.M., 2007. Sexual dimo rphism in thyroid function and type 1 iodothyronine deiodiase activity in pre-pubertal and adult rats. J. Endocrinol. 192, 121-130. Maruo, T., Hiramatsu, S., Otani, T., Hayashi, M., Mochizuki, M., 1992. Increase in the expression of thyroid hormone receptors in porcine granulosa cells early in follicular maturation. Acta Endocrinol. (Copenh.) 127, 152-160. Matta, S.L., Vilela, D.A., Godinho, H.P., Fran ca, L.R., 2002. The goitrogen 6-n-propyl-2thiouracil (PTU) given during testis developmen t increases Sertoli and germ cell numbers per cyst in fish: the tilapia ( Oreochromis niloticus ) model. Endocrinology 143, 970-978. Maurel, D., Coutant, C., Boissi n, J., 1987. Thyroid and gonadal regula tion of hair growth during the seasonal molt in the male European badger, Meles meles L. Gen. Comp. Endocr. 65, 317327. May, T.W., Packer, R.K., 1976. Thyroid-hormones stimulate in vivo oxygen-consumption of adult Rana pipiens berlandieri at high environmental temp eratures. Gen. Comp. Endocr. 30, 525-527. McArthur, M.L.B., Fox, G.A., Peakall, D.B., Ph ilogene, B.J.R., 1983. Ecological significance of behavior and hormonal abnormalities in breedin g ring doves fed an organochlorine chemical mixture. Arch. Environ. Contam. Toxicol. 12, 343-353. McCoard, S.A., Wise, T.H., Ford, J.J., 2003. Endocri ne and molecular infl uences on testicular development in Meishan and White Com posite boars. J. Endocrinol. 178, 405-416. McKenna, N.J., O'Malley, B.W., 2001. Nuclear R eceptors, Coregulators, Ligands, and Selective Receptor Modulators: Making Sens e of the Patchwork Quilt. Annals New York Academy of Sciences 949, 3-5. Mcllhenny, E.A., 1987. The alligator's life history. Ten Speed Press, Berkeley. Milnes, M.R., Woodward, A.R., Rooney, A.A., Guillette L. J., J., 2002. Plasma steroid concentration in relation to size and age in juve nile alligators from two Florida lakes. Comp. Biochem. Phys. A 131, 923-930. Morgan, C.A., Wang, S., Mason, J., Southwick, S.M., Fox, P., Hazlett, G., Charney, D.S., Greenfield, G., 2000. Hormone profiles in humans e xperiencing military survival training. Biol. Psychiat. 47, 891-901. Moriyama, K., Tagami, T., Usui, T., Naruse, M., Nambu, T., Hataya, Y., Kanamoto, N., Li, Y.S., Yasoda, A., Arai, H., Nakao, K., 2007. Antithyroid drugs inhibit thyroid hormone receptormediated transcription. Journal of Cl inical Endocrinology and Metabolism 92, 1066-1072. 129

PAGE 130

Nanto-Salonen, K., Muller, H.L., Hoffman, A.R., Vu, T.H., Rosenfeld, R.G., 1993. Mechanisms of thyroid hormone action on the insulin-like growth factor syst em: all thyroid hormone effects are not growth hormone mediated. Endocrinology 132, 781-788. Norris, D.O., 1997. Vertebrate Endocrinology. Academic Press, San Diego. Orlando, E.F., Davis, W.P., Guillette L. J., J., 2002. Aromatase activity in the ovary and brain of the eastern mosquitofish (Gambusia holbrooki ) exposed to paper mill effluent. Environ. Health Persp. 110, 429-433. Palmero, S., De Marco, P., Fugassa, E., 1995. Thyroid receptor beta mRNA expression in the Sertoli cells isolated from prepuberal testis. J. Mol. Endocrinol. 14, 131-134. Palmero, S., Maggiani, S., Fugassa, E., 1988. Nuclea r triiodothyronine recep tors in rat Sertoli cells. Mol. Cell. Endocrinol. 58, 253-256. Paterson, C.M., Greenlee, R., Adam Jones, D., 1999. Thyroid cancer in Wales 1985-1996: a cancer registry-based st udy. Clin. Oncol. 11, 245-251. Rattner, B.A., Eroschenko, V.P., Fox, G.A., Fry, D.M., Gorsline, J., 1984. Avian endocrine responses to environmental po llutants. J. Exp. Zool. 232, 683-689. Reimers, T.J., McCann, J.P., Cowan, R.G., Concannon, P.W., 1982. Effects of storage, hemolysis, and freezing and thawing on concentra tions of thyroxine, cortisol, and insulin in blood-samples. Proc. Soc. Exp. Biol. Med. 170, 509-516. Rendakov, N.L., Tyutyunnik, N.N., Sirotkina, L.N., Krupnova, M.Y., Nemova, N.N., 2003. Thyroid hormones and activities of lysosomal prot eolytic enzymes in orga ns of the arctic fox Alopex lagopus J. Evol. Biochem. Phys. 39, 302-305. Rocha, A., Gomez, A., Galay-Burgos, M ., Zanuy, S., Sweeney, G.E., Carrillo, M., 2007. Molecular characterization and s easonal changes in gonadal expre ssion of a thyrotropin receptor in the European sea bass. Gen. Comp. Endocr. 152, 89-101. Rooney, A.A., Crain, D.A., Woodwar d, A., Guillette L. J., J., 2004. Seasonal variation in plasma sex steroid concentrations in juvenile Amer ican alligators. Gen. Comp. Endocr. 135, 25-34. Rostal, D., Owens, D., Grumbles, J., MacKenzi e, D., Amoss, M., 1998a. Seasonal reproductive cycle of the Kemp's ridley sea turtle ( Lepidochelys kempi). Gen. Comp. Endocrinol. 109, 232243. Rostal, D.C., Owens, D.W., Grumbles, J.S., MacKenzie, D.S., Amoss, M.S., 1998b. Seasonal reproductive cycle of the Kemp 's ridley sea turtle ( Lepidochelys kempi). Gen. Comp. Endocr. 109, 232-243. 130

PAGE 131

Ruppert, C., Kraft, W., 1999. Examination in dog s with spontaneous hyperadrenocortism. Part 3. Thyroid hormone concentrations before and af ter treatment with mitotane (Lysodren ). Tierarztl. Prax. K. H. 27, 167-171. Schelske, C., Brezonik, P., 1992. Can Lake Apopka be restored? Restoration of aquatic ecosystems: Science, technology and public polic y. In: National Academ y, Washington, DC, pp. 393-398 Schlosser, G., Koyano-Nakagawa, N., Kintner, C., 2002. Thyroid hormone promotes neurogenesis in the Xenopus spinal cord. Dev. Dynam. 225, 485-498. Segal, J., 1990. Calcium is the first messenger for the action of thyroid hormone at the level of the plasma membrane: first evidence for an acu te effect of the thyr oid hormone on calcium uptake in the heart. Endocrinology 126, 2693-2702. Seidler, H., Hartig, M., Engst, R., 1976. Effects of DDT and lindane on thyroid function in the rat. Nahrung 20, 399-406. Sekimoto, K., Imai, K., Suzuki, M., Takikawa H., Hoshino, N., Totsuka, K., 1987. Throxineinduced molting and gonadal function of laying hens. Poult. Sci. 66, 752-756. Sengal, D.S., Pollman, C.D., 1991. Assessment of potential sediment contamination for the restoration of Lake Apopka. In : St. Johns River Water Management District, Palatka, FL, Senger, P.L., 2003. Pathways to pregnanc y and parturition. Cadmus Professional Communiations, Ephrata, PA. Shi, Y., 2001. Amphibian Metamorphosis: From morphology to molecular biology. Wiley-Liss, New York. Silva, J.E., 1993. Hormonal control of therm ogenesis and energy dissip ation. Trends Endocrin. Met. 5, 36-42. Singh, U., Krishna, A., Bhatnagar, K., 2002a. Seas onal changes in thyroid activity in female sheath-tailed bat, Taphozous longimanus ACTA Biol. Hunga. 53, 267-278. Singh, U.P., Krishna, A., Bhatnagar, K.P., 2002b. S easonal changes in thyroi d activity in female sheath-tailed bat, Taphozous longimanus ACTA Biol. Hunga. 53, 267-278. Sinha, N., Lal, B., Singh, T.P., 1991. Pesticide in duced changes in circul ating thyroid hormones in the freshwater catfish Clarias batrachus Comp. Biochem. Phys. C 100, 107-110. Skaare, J.U., Bernhoft, A., Wiig, O., Norum, K.R., Haug, E., Eide, D.M., Derocher, A.E., 2001. Relationships between plasma levels of orga nochlorines, retinol and thyroid hormones from polar bears ( Ursus maritimus ) at Svalbard. J. Toxicol. Env. Heal. A. 62, 227-241. 131

PAGE 132

Steinhardt, M., Thielscher, H.H ., 2002. Transport stress in young calve s. Effects of animal breed and of husbandry system on biochemical, metabolic and hormonal variables. Tierarztl. Prax. G. N. 30, 369-377. Stevens, R.J., Nishio, M.L., Hood, D.A., 1995. Effects of hypothyroidism on the expression of cytochrome c and cytochrome c oxidase in hear t and muscle during developement. Mol. Cell. Biochem. 143, 119-127. Styne, D.M., 1998. Fetal growt h. Clin. Perinatol. 25, 917-938. Sweeting, R.M., Alexander, G.P., Eales, J.G., McKeown, B.A., 1994. Hepatic and branchial thyroid hormone deiodinase activities associat ed with the parr-smolt transformation of coho salmon (Oncorhynchus kisutch ). Gen. Comp. Endocr. 94, 171-181. Toft, G., Edwards, T.M., Baatrup, E., Guillette L. J., J., 2003. Disturbed sexual characteristics in male mosquitofish ( Gambusia holbrooki ) from a lake contaminated with endocrine disruptors. Environ. Health Perspect. 111, 695-701. van Maanen, J.M.S., van Dijk, A., Mulder, K., de Baets, M.H., Menheere, P.C.A., van der Heide, D., Mertens, P.L.J.M., Kleinjans, J.C.S., 1994. C onsumption of drinking water with high nitrate levels causes hypertrophy of the thyroid. Toxicol. Lett. 72, 365-374. Woodward, A.R., Percival, H.F., Jennings, M.L., Moore, C.T., 1993. Low clutch viability of American alligators on Lake Apopka. Fla. Sci. 56, 52-63. Wright, M.L., Cuthbert, K.L., Donohue, M.J., So lano, S.D., Proctor, K.L., 2000. Direct influence of melatonin on the thyroid and comparis on with prolactin. J. Exp. Zool. 286, 625-631. Yasoda, A., Arai, H., Nakao, K., 2007. Anti-thyr oid drugs inhibit thyroid receptor-mediated transcription. J. Clin. En docrinol. Metab. 92, 1066-1072. Zhang, S.S., Carrillo, A.J., Darling, D.S., 1997. E xpression of multiple thyroid hormone receptor mRNAs in human oocytes, cumulus cells, and granulosa cells. Mol. Hum. Reprod. 3, 555-562. Zoeller, R.T., 2003. Challenges conf ronting risk analysis of poten tial thyroid toxicants. Risk Anal. 23, 143-162. Zoeller, R.T., Dowling, A.L.S., Herzig, C.T.A., Iannacone, E.A., Gauger, K.J., Bansal, R., 2002. Thyroid hormone, brain developement, and the environment. Environ. Health Perspect. 110, 355-361. Zoeller, R.T., Dowling, A.L.S., Vas, A.A., 2000. Developmental exposure to polychlorinated biphenyls exerts thyroid hormonelike effects on the expression of RC3/neurogranin and myelin basic protein messanger ribonucle ic acids in the developing rat brain. Endocrinology 141, 181189. 132

PAGE 133

133 Zraly, Z., Bendova, J., Svecova, D., Faldikova, L., Veznik, Z., Zajicova, A., 1997. Effects of oral intake of nitrates on reproductive func tions of bulls. Vet. Med.-Czech. 42, 345-354.

PAGE 134

BIOGRAPHICAL SKETCH Dieldrich Salomon Bermudez was born in the summer 1976 at 7:49 pm in Managua, Nicaragua. At age 2, his family moved to Los A ngeles, California. He rejoined them 2 years later. Dieldrich attended elementary school in La Puente, CA. When he turned 10, he and his family moved to Miami, Florida. There he attended public school a nd graduated from Miami Coral Park Senior High in 1995. During high sch ool, he volunteered at the Miami Museum of Science Falcon Batchelor Bird of Prey Center an d was student body president. He then attended the University of Florida, Gainesville, FL. Di eldrich received a Bachel or in Science from the University of Florida in 1999, graduating with honors. He double-majored in psychology and zoology. During his tenure as an undergrad, he completed an undergraduate research project titled Immunological effects of endocrine-disrupting contaminants on alligator ( A. mississippiensis) spleen morphology directed by Drs. Louis J. Guillette, Jr. and Andrew A. Rooney. Dieldrich was awarded a CLAS Undergraduate Research award for the project. After graduation, Dieldrich worked for the Florida Fi sh and Wildlife Conservation commission as a field biologist and alligator egg research technician. In August 2000, Dieldrich began his graduate ca reer at the University of Florida, Zoology department under the tutelage of Dr. Louis J. Guillette, Jr. In 2004, he completed the requirements for his Masters (via bypass) a nd continued with his Ph.D. work. During his graduate tenure at the University of Florida, Dieldrich received a Flor ida-Georgia Louis Stokes Alliance for Minority Participation fellowship, a Si gma Xi Grants in Aid of Research, an NSF East Asia and Pacific Summer Institutes fello wship, a Delores A. Auze nne Graduate Scholars fellowship, a Science Partners in Inquiry-ba sed Collaborative Educa tion fellowship and an NIEHS Minority Predoctoral fellowship. Also while at the University of Florida he was employed as a graduate teaching assistant fo r Introductory Biology, Animal Physiology, and

PAGE 135

Biology of Reproduction. Dieldric h also engaged in an active mentoring program directing 25 students in research projects. Eight students und er his direction comple ted senior undergraduate research thesis or earned co-authorship on papers derived from this dissertation or peripheral project


xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E20101117_AAAADC INGEST_TIME 2010-11-18T03:38:20Z PACKAGE UFE0021752_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES
FILE SIZE 1804 DFID F20101117_AACBCH ORIGIN DEPOSITOR PATH bermudez_d_Page_003thm.jpg GLOBAL false PRESERVATION BIT MESSAGE_DIGEST ALGORITHM MD5
9525c2c8d9af8d5005ec7f0a22ce9436
SHA-1
d4b60e70d9a057b06cc17d383bca756ec03993c3
6411 F20101117_AACAWM bermudez_d_Page_099.pro
439d3802fe040767096ea487b1e47999
8aa49ccb4324007969daf4ce4abd9826a99069dc
54219 F20101117_AACAVY bermudez_d_Page_076.pro
7c4251739a59a0394fde9ed9d5a5b361
b79c6eb336136a1dc604bd68d25aa7e77f5010af
60350 F20101117_AACAXB bermudez_d_Page_121.pro
3d591df4f85b58bf1c5349ac17f7a3c6
757fd733cff23fdeb03c19200dd128379b1f6171
7391 F20101117_AACBBS bermudez_d_Page_004thm.jpg
6ef237c83d49c18b5af50926df9b2c05
ace6ebe594a17d3eb3cfdedcee15c80a77274e98
7529 F20101117_AACBCI bermudez_d_Page_123thm.jpg
4eaf6c5b77aaa894ee68240487e2d5c4
392d1870f80207d87a9bae67590f4c931d208980
11982 F20101117_AACAWN bermudez_d_Page_101.pro
18f6003a9775a633335c6c8993406c59
3ebe947a4c592e676fab8b925b8221c012731541
54936 F20101117_AACAVZ bermudez_d_Page_077.pro
9648ebe0538459e29e173d326f03d4cf
ca0afd02f45fbd7c9cf801a5d328438727a17503
59531 F20101117_AACAXC bermudez_d_Page_122.pro
58050481904ad108a3735beef37af008
cc91bc1b5644551ee6e1cf2dbb12989fe29f1fc2
25553 F20101117_AACBBT bermudez_d_Page_020.QC.jpg
52b8cff3a5ffab1b23a44c522739d128
0f29738fd46c49a654925bacebd72f968fe56d11
7321 F20101117_AACBCJ bermudez_d_Page_124thm.jpg
8d9f7c0ebfe790cd81d3c98e26090f6a
5c31c5b7e8d675a8c809a7b7017481d024b29a3d
12125 F20101117_AACAWO bermudez_d_Page_105.pro
bdf95d12d72e73636a5f4bce2ec87618
1e7e1eb3120cdee7a0ee5214fed4a9aeb5ad5f79
84842 F20101117_AABZYA bermudez_d_Page_051.jpg
2b711c001d4d30ff224a485b038b39c1
bff9820d4627bd261b24394d78d56e1d7e0b4adb
7772 F20101117_AACBBU bermudez_d_Page_054thm.jpg
25c7db31e437c14d6aeae4a47e3ffe39
237919a9db7bfbc8982e3805c13f73c0ce0aa064
4999 F20101117_AACBCK bermudez_d_Page_029thm.jpg
183fb1870887e54d95671bfa084e395d
4c4828ac39c6a1a2956d6136248bed6678e59448
52860 F20101117_AACAWP bermudez_d_Page_107.pro
835ded4aa41b54b4970e2129b5f2c017
d2c80420748296eb41a7abc4bbb27cf6ea609264
3406 F20101117_AABZYB bermudez_d_Page_104thm.jpg
6534377b66963ef0742e6d0cfe39a13c
c28f4069eec5f7bc11182c5fcfd58751098b8af2
67236 F20101117_AACAXD bermudez_d_Page_123.pro
b7601bf26a5d43726cb58667311b195f
875c7d5745356aba09b8abd4033b326cfb63e470
7069 F20101117_AACBBV bermudez_d_Page_036thm.jpg
f5672996d90ad7c4a792ba02ab0657e9
a68262f32f2c552e90e7d58c103d5f72a68d9bf6
3056 F20101117_AACBCL bermudez_d_Page_061thm.jpg
29fb46c94f487e2400fb1e2b431d3b69
4207718753e106553ec7014666ba9f0493aa7710
52634 F20101117_AACAWQ bermudez_d_Page_108.pro
660927afaa8a928be26b2c703ae9201e
6688b5f6ec8a6abe955abebfbca1c2c8a5bfe70d
2124 F20101117_AABZYC bermudez_d_Page_076.txt
4f4a253b1731033174fbcf09f97811e1
0194ea686a492e74915e2691b3d354d6786027fb
62035 F20101117_AACAXE bermudez_d_Page_124.pro
dbb7de66a2006ccfb436f3d2a2ce5a10
f2e8a733839aef93bb238d6f9c18ead68672fbfb
7323 F20101117_AACBBW bermudez_d_Page_040thm.jpg
bede21f1cba5cefe65536da40d443d5e
bd00f41cb63a02494270763716c06d57344aae77
5021 F20101117_AACBDA bermudez_d_Page_133.QC.jpg
586d82386ffa571dd305f39d63e6e1c8
7f65f7c7769b0b8b55d47a3ff1f2dfd6d6fd8c01
6431 F20101117_AACBCM bermudez_d_Page_118thm.jpg
05100f804813c400f2759a94c632be2e
09893f703c1dffef28d9e11a9614e8e95b878145
50521 F20101117_AACAWR bermudez_d_Page_109.pro
955fefb6cd3cdaf62bb355f2c898ae7f
3562295fadaebf17506bc33b42c1ddb5bae1be19
386339 F20101117_AABZYD bermudez_d_Page_087.jp2
d7389bb0ce8be2ec41a2eeabe8a9e65b
591b9101e9a846d477b523020838d58e621e8388
71301 F20101117_AACAXF bermudez_d_Page_125.pro
0048b3066dc87b1403b744b8d0da3195
afb53cd87d6f59473bfc8faf7e5849be2de2fb40
7459 F20101117_AACBBX bermudez_d_Page_126thm.jpg
de57db9c9bb1bd09c2f7e0d21c6a5537
dfc6f052508f28248c5778ad11a19d3a91103a91
3872 F20101117_AACBDB bermudez_d_Page_086thm.jpg
20ba8710d38a68dd13de394da46c6fa6
92012725561ef9549a549461df6a282276251149
7427 F20101117_AACBBY bermudez_d_Page_025thm.jpg
b2fce8d42109c944c0ccf1b6be5c6960
ca0c3585bc77a1b5fa9706c06eab5fadf5ab0977
8858 F20101117_AACAWS bermudez_d_Page_110.pro
edf2e1baef118fa191e97cd4cbdb50bb
22d3e51edf56dddec35f28f8d846265faff4fe00
148407 F20101117_AABZYE bermudez_d_Page_119.jpg
ac38d692ecc0141d2db50a00422de8a0
6957be2c79235cae6c32511d5b008c47ae413fe5
65574 F20101117_AACAXG bermudez_d_Page_126.pro
fe8930e357f88dddd1f9e3d9f5ec0205
d017060c8305520bd0d5ef8ba86b706fd5879b3d
7274 F20101117_AACBDC bermudez_d_Page_111thm.jpg
76b5b75714ec08bbe563fe9d469a0744
e23edc88df70c0a51f6064ee7aacd87dde1a3025
25702 F20101117_AACBCN bermudez_d_Page_041.QC.jpg
a52cf2aab27a338287ddef528409bbe2
10f756083721a996c207c120c17e25ae6c90fbd0
2239 F20101117_AACBBZ bermudez_d_Page_135thm.jpg
38f1e30a9fab03aa0ccf1c70d0bf43da
b55d180d2220a332f38a64dc9d252a1cec0e4c8b
10786 F20101117_AACAWT bermudez_d_Page_112.pro
5cd53a4629263ece8668cd13d4693118
a4688b843a8143a0f497af8a1d9d04046b21f849
13620 F20101117_AACAAA bermudez_d_Page_032.QC.jpg
b8e6f1c8f821d1b78c17b0233ea8a35d
2762b931ed8bbac1e8f53532942a93c4abbed37b
25271604 F20101117_AABZYF bermudez_d_Page_066.tif
e5cdf0b4963983e6aa0bc84268b9b1ce
8e6a263255ff2f5af647a37463067ba51d0e0732
71182 F20101117_AACAXH bermudez_d_Page_127.pro
3a9891509fbb8eb87932ac42a0679031
ac636c113738146391f612854ce756fa3e901d87
26143 F20101117_AACBDD bermudez_d_Page_036.QC.jpg
82aab5232ffbd8cc8cc85a08f1e9c945
06b3de13e9311e5c81d21c4eb5ca66799c4bf7a1
6638 F20101117_AACBCO bermudez_d_Page_075thm.jpg
66c8c7d0d75e60f92a97cd81a08aae59
61ace8a91a23edfb7730dff35aaa15000e7294d3
6913 F20101117_AACAWU bermudez_d_Page_113.pro
e8f51f54f098b71380b7b82f7e98ed07
09fce1e5a315c84c5a0ba7ab4bb900c9f750ee61
84336 F20101117_AACAAB bermudez_d_Page_052.jpg
30f3a4ffbb2160f345e7c857db3c0588
42cd2a1ca995e34437acc20470f43147ff876693
903 F20101117_AABZYG bermudez_d_Page_092.txt
bd089411ada942889d916c83200f9060
aa348ff1831a6fa441097a1288c89ec8b98614c9
67529 F20101117_AACAXI bermudez_d_Page_129.pro
16f561b64e1b87bd2f145d51871edbce
a118e66d16ea2c8606d875a525df6d0ffd346692
29544 F20101117_AACBDE bermudez_d_Page_127.QC.jpg
fde97d119b7b946168c948681bd598c9
d750c6c238f5c923216124f0f1251ff10f97e183
7585 F20101117_AACBCP bermudez_d_Page_011thm.jpg
b9a1a38574f00188a7c7b304ce1577ed
d9965883209c7d053b1f87d831bda9bbbb35450b
10697 F20101117_AACAWV bermudez_d_Page_114.pro
6fe8dc1eccc56e3923e7577833bd80ac
423b56e42b2329e25fa15cbcd8886c7eae14d1bc
15400 F20101117_AACAAC bermudez_d_Page_095.pro
514a9ffe8928b6d8b02a1b640afd9ebc
fc9d42aaf79d215c99c6c49fdd05e6e5457cc357
7510 F20101117_AABZYH bermudez_d_Page_107thm.jpg
0b6d9651029ad0b367fb6f57a5ad3c7c
81fceb32ca7e544ea1dce6c58a434b9d833ae7e1
108975 F20101117_AABZXS bermudez_d_Page_128.jpg
8a76f48c591fe75750969ac857bb0d52
6cbb91bf6cd0e50d22524905cb9fa63c08f964d8
64449 F20101117_AACAXJ bermudez_d_Page_130.pro
b9da24860d230843210508c727420b1c
dfef7ba9ea9b503002504c060d06326ac864944d
7536 F20101117_AACBDF bermudez_d_Page_077thm.jpg
364d0aee47c6b81e40e37788dff2b460
2d783e644e8b96da4721cf1f6fe4a41d38b30e66
24283 F20101117_AACBCQ bermudez_d_Page_106.QC.jpg
d014306bb27e55caf02ec5cd46d5b0e4
d0cd4aacbcc0cb143ca328ad52fa4a05b06ea307
14345 F20101117_AACAAD bermudez_d_Page_005.QC.jpg
1d6491ac0f8396b131f15a8f3e75c29d
c76c5b3febd810afacd593d793333585daadca96
11514 F20101117_AABZYI bermudez_d_Page_100.pro
4974faa6ae09a1f3c7d179bb8a77e8e8
085dfbbc71855553a90a767074212e5097e26e5a
F20101117_AABZXT bermudez_d_Page_084.tif
008c99a860006bc176559f76ece97aa7
fd5c432e98947588b2c6ed46561600fb9b69d8ae
62939 F20101117_AACAXK bermudez_d_Page_131.pro
2acf5751a33262618b675a7221daffab
a78a0a71c2be8eaed0a38e8a29aec90225622d79
16174 F20101117_AACAWW bermudez_d_Page_116.pro
b74a235637988f285778d77c851eccfc
c737258d9b14f43cb2d14ff13a8a2866e1f06a36
F20101117_AACBDG bermudez_d_Page_042thm.jpg
3573cd62c32674dabfc844f1f8588f7e
2c7d2337e929af8357ba216a5b5d66df3274831f
10431 F20101117_AACBCR bermudez_d_Page_102.QC.jpg
e7378d164238e5bc645121d5c51df0fc
f4dd5a49e6e18889facfa2b07e41f79234b0654a
F20101117_AACAAE bermudez_d_Page_077.tif
438318cd442372b3c90609d0e945073f
76dfaa68fe7ad3a7d024af7292d79d7b29934162
3135 F20101117_AABZYJ bermudez_d_Page_007.txt
d19d89c23942387eae261042d3e7e7b0
b506d11d17a58be12e69cf7a69ce516a22feadd2
2223 F20101117_AACAYA bermudez_d_Page_021.txt
706ba4d35d9aad8285d90780ee1c9c1e
fc9109f5a3a5de4beac73d9a4a3ab89b951cc04a
9324 F20101117_AABZXU bermudez_d_Page_061.QC.jpg
12d86d48fffed683eafa1dfae50bdf5f
88e1430fb6c61bf15d7b1352b815b63e46e53d98
65972 F20101117_AACAXL bermudez_d_Page_132.pro
69a5d067023d060db409599e731e5e29
5b23a103172e41f61c498edc586afcce7c8ef966
8675 F20101117_AACAWX bermudez_d_Page_117.pro
671946fd2aee9d6d519a7f945f4ec895
7cc162090c2446be9f3b1ad9148d12abff7fb9e3
4760 F20101117_AACBDH bermudez_d_Page_115thm.jpg
dbd73345cf11051f7a0ca438674cc8ce
d3cbab2cf972497260e09e35bae90830135fe588
7498 F20101117_AACBCS bermudez_d_Page_129thm.jpg
f3db982930d8932a8dc9b448494b77c4
741937214f41a567b5fe62b3045de59befe5500b
275 F20101117_AACAAF bermudez_d_Page_058.txt
4621cff162c0a5b6b055df8529b60907
65d68ab6d27b568167092d7750c20670c0373c79
2170 F20101117_AACAYB bermudez_d_Page_024.txt
bdaa4fd82cb9a3f8876bae14bfbed8af
8b95d36cba9d84fd4cf8e7f37cafcf26bb6e010e
4184 F20101117_AABZXV bermudez_d_Page_044thm.jpg
cce930dd1ccd105bedfbce46f4cd8204
c8428d493f5493af60f340dcd4779fd37e1b03e3
54886 F20101117_AACAXM bermudez_d_Page_134.pro
cb7fb5f12e594b304386bce1ea0b1597
6b385cfe01764f5f3e73ff610e6c8cc6ec3a47cc
48919 F20101117_AACAWY bermudez_d_Page_118.pro
83d9221b71fdf88ee3e537eb14e25527
67017fa2bb1468926d58baabb06fdb44b5aaff48
27508 F20101117_AACBDI bermudez_d_Page_131.QC.jpg
37a19f40739d0bd3fa43532a7d8827eb
a3b7590362ea86ee9a040b97e07651c574c13b8b
7438 F20101117_AACBCT bermudez_d_Page_069thm.jpg
501ad9a287f6d27922e8a831307d3924
d0d1765df890f0a9f72b9795a3de0fa06bb3171a
7254 F20101117_AACAAG bermudez_d_Page_039thm.jpg
1b4f99d6de8785b42ce34601212574c4
fe6d65133caa92ccbb657a98dee643247d9d21f3
F20101117_AABZYK bermudez_d_Page_011.tif
1d69a0ac8446968b7fb93df5d14caaaf
a0a918e6cec567f9de0f447ce72ef58aeb23e5f2
2196 F20101117_AACAYC bermudez_d_Page_025.txt
62b30373a8ba00284ed417824a806b32
633dd3c8aef5b3e761cc2cf9edd97494ec136319
1051913 F20101117_AABZXW bermudez_d_Page_069.jp2
020d1b74003448e4f098dac55406c8cd
38d41000a69b9d5b95a22a2944fb7e26242dd879
7949 F20101117_AACAXN bermudez_d_Page_135.pro
899c3fd9442d336385740eb0c69ef4f6
ff16569173968a126ec6dd59671664352a6e3021
52317 F20101117_AACAWZ bermudez_d_Page_119.pro
0e82160f0cbfdc8c16c657e103c78ab5
4549a21ac3ef5ebe2b5014fcfe08e89b33b7a727
9996 F20101117_AACBDJ bermudez_d_Page_105.QC.jpg
d699dd067519f1a90526368966b18e29
71ef5f17e280be6fcc0c546bf02dbbb36d7a5f1c
3220 F20101117_AACBCU bermudez_d_Page_105thm.jpg
0eb1e6374b8f5b2929ce74ca03273735
660f451f1d82cafaf9d2c7223af5f6085a1873ae
9808 F20101117_AACAAH bermudez_d_Page_001.pro
fca20d971784e077e1aebeb3a005447b
e0e87454170ea4e9726b95bf6d8a355c5023dd63
1051965 F20101117_AABZZA bermudez_d_Page_072.jp2
bfa9744c5e1736cdd22caa3157a59873
4c28e2febe9255d9a8879f67097e77de53cef0fc
7380 F20101117_AABZYL bermudez_d_Page_033thm.jpg
83da20b0ad3f835ad00f51dbef24d4a8
6b2676a4a0260a5baa0bed668e06803974ca3130
2146 F20101117_AACAYD bermudez_d_Page_027.txt
a8e8786e215ea45494278de25fd455c1
94a1cbf4d90e5d4f0e06652843e9f37d22a29296
4030 F20101117_AABZXX bermudez_d_Page_092thm.jpg
23a13c936b33354106630bbdc59cc345
9129794e1d1361e3ff6aeb7b47f23bae84e27dc9
530 F20101117_AACAXO bermudez_d_Page_001.txt
0ba2c089ed9ed413d15e46e551aefdd3
789967960d85b0aca73d6bc8ce34a7e855d3bb43
26918 F20101117_AACBDK bermudez_d_Page_051.QC.jpg
8f164a8be25d1e17974b7a3f362dcf57
4ba489ec8e424fa8ca24fc01d856c6e42c92b0c7
6864 F20101117_AACBCV bermudez_d_Page_080thm.jpg
4dc682cc8398dae6eb7e0c5f1c02876a
10e2e3fa229aa334952d5580202e626f179565a6
37967 F20101117_AACAAI bermudez_d_Page_093.jpg
adc2ebccbeb96727cd22749a178072f5
a52969e3b94001ad6fb0102d1be8e4ab1b33105c
6707 F20101117_AABZZB bermudez_d_Page_013thm.jpg
782e1b3bf8182f5294779070636a2fb5
03e201d3bce91d90280675b2939976f64393d180
2106 F20101117_AABZYM bermudez_d_Page_015.txt
60df0425623214bcd5091f0d5d1fcd04
80b9a4d54e0e685777f68b37af2a71f9ddc88a7e
1051966 F20101117_AABZXY bermudez_d_Page_036.jp2
acf68fb05f20c7d2fcc751b9b165b4d8
4d6721232b0c2dc2bc6cc4ad7c40034a8a4adba8
241 F20101117_AACAXP bermudez_d_Page_003.txt
60c0709a01e65523a03c8a73380c229e
e71a1d55c9ff3e708fd5608ccaa6dd2e5da8d470
1653 F20101117_AACBDL bermudez_d_Page_133thm.jpg
11a7cdefedbeb0cbdbf95f85dff29a73
e705ca5a457d37a5ea69f4f460d1817e7558889c
16632 F20101117_AACBCW bermudez_d_Page_047.QC.jpg
1e2270e56616185a08d3998fa5606bbe
6053dbfc467cafdfb780e4f64a31c32ba22372cd
4374 F20101117_AABZZC bermudez_d_Page_003.QC.jpg
ff12325c90892c79b7e4c03ab934e394
1eda845a51582df2bc354b35990baf50887232e8
55753 F20101117_AABZYN bermudez_d_Page_021.pro
ae2686c6d8eb41fdcb4c83f340265834
2a0dd56706dd7b38b3f30b0c825eb48a0cc87bf2
2138 F20101117_AACAYE bermudez_d_Page_028.txt
2f6f3f821be42a769e60d724d97dfbf7
0f7deb4dbb8b0db52a01896cad08ae7381c6305a
55030 F20101117_AABZXZ bermudez_d_Page_057.jpg
dbec9e3ed36461cadf06d70ac8167242
1557090377a315b08b2b11082394538b907803d7
F20101117_AACAXQ bermudez_d_Page_004.txt
0b16af65e4419ea602b1e7c01a6749d7
3110a869165015be800a274c27c99a8df77cf4c2
85681 F20101117_AACAAJ bermudez_d_Page_076.jpg
581c497a7b916a5ec76c2706dffa1904
6193fa989a1e3e655eccf561db5cf3b8ae89f927
27429 F20101117_AACBEA bermudez_d_Page_071.QC.jpg
7db12b87767ad2cc8d817246fd8dd5fb
dd96aa8990ba2a65ea11539148572418b280d215
9593 F20101117_AACBDM bermudez_d_Page_060.QC.jpg
e8c804c6193bffc30a9d70c3e5fe6a90
efaa9a39065f075001c6bfd8d0135ec072bd4d3c
28161 F20101117_AACBCX bermudez_d_Page_064.QC.jpg
18e96098b1fbf6056cce5d453d1beafc
9a605f5c03b1daf282e11de284dc4b06013cb305
1051955 F20101117_AABZZD bermudez_d_Page_030.jp2
e47e3cd98bab2d27d41ebe22f3291a1b
cc0a5452c27a299c2c125617de64c724f4421b5a
1051969 F20101117_AABZYO bermudez_d_Page_024.jp2
be9833dcb0c8ff792d6cea3ec1301597
4c1af7ad060659c6f5a14a37bff4017b63f6e159
1415 F20101117_AACAYF bermudez_d_Page_029.txt
fe0c38387e412a894f958dd4dbbdfb79
5141d0376e2bca609e093415d537f778977b47ef
2912 F20101117_AACAXR bermudez_d_Page_006.txt
6af4250a9646d7eeb39d5f56e3dfd940
e8b44b1bf8829acff730be1b591c648478513a45
104660 F20101117_AACAAK bermudez_d_Page_126.jpg
d37d5564f18ba0c8f0f6ab10f1752cf7
df457ffc871a53ad5c4a2907da4c312852902fdb
13446 F20101117_AACBEB bermudez_d_Page_081.QC.jpg
45d955a3d1d18f8700f84262e1003d92
383c4f04b761d80d8e8be96cfb32018ae36d1df3
25069 F20101117_AACBDN bermudez_d_Page_066.QC.jpg
35528fc54ce4071070bad73f9bd71077
23688b084583704fc2df3f870c69687592dd39ab
6414 F20101117_AACBCY bermudez_d_Page_135.QC.jpg
febc0568c9cdd7ff60e023c77089ddcf
3dfcd43eb4e0cad7f809fb79182587b8725963cc
47828 F20101117_AABZYP bermudez_d_Page_106.pro
6d35a1661ad09907d963dd8748d2d0a9
0ef384ccc5ea263433ca656afeb26d5d3ed61e1f
799 F20101117_AACAYG bermudez_d_Page_030.txt
f27a3aa0db9d8d9cd80c7907752041ae
1dd9dc3d80c7a1896ecf07fb1a5e0ebcd64803b8
357 F20101117_AACAXS bermudez_d_Page_008.txt
8cd335c759c3ba51a478395026ea81fe
c2f2b503a8d9f90db3b960a0fb7c3b83d467aa0d
12009 F20101117_AACAAL bermudez_d_Page_104.pro
247c2baada1a44c6a210ddb8572b48c8
7514130dc0acfa17b6aa8c64cc8d97b175b07ffe
76482 F20101117_AABZZE bermudez_d_Page_053.jpg
43d63afdfd775f22a89e02f009db4f23
0d1c4cde33b21227212539642d0da20e1571f4ef
7572 F20101117_AACBEC bermudez_d_Page_063thm.jpg
6db74c940672ac7355f7ffb732e554bf
18ee454e9c73361a49cb5e3a7461559fde496a2e
27305 F20101117_AACBCZ bermudez_d_Page_079.QC.jpg
e7d892b822396d964bda0878a38bf902
f3fcb81bb07e564d593a9586c752812cf4655193
84154 F20101117_AABZYQ bermudez_d_Page_028.jpg
09e528f83d71ab6a0174fdb0ab2fb7d6
ac1a0000284b9e94fa68d19eca7a8b326dd8e21c
395 F20101117_AACAYH bermudez_d_Page_032.txt
ccd3892de53abaed34e1ac44ae3271e9
47ef258f5f34022dad300165ec1152bf0688e644
3053 F20101117_AACAXT bermudez_d_Page_010.txt
0acdce0bd06e33da9ed2de344d4be65f
2340c59e4630ca02bf4bed5a9b7f2536837dbe2b
106 F20101117_AACABA bermudez_d_Page_002.txt
97136dc653af0bedab104bad91611b9d
808baa64b27f361ac235fa367ff1fb6ac63ee49e
3965 F20101117_AABZZF bermudez_d_Page_089thm.jpg
84406c30064389ac1cacc57781bc7f4e
4e45c54a46fcbced7fb427f0f3fb3d0af44d59c8
5819 F20101117_AACBED bermudez_d_Page_008.QC.jpg
c731401596a163841b8822adce48632f
e9472e9adf50c644ceced2e133e886f8808b58ab
27215 F20101117_AACBDO bermudez_d_Page_050.QC.jpg
1b1dd572219da0d843f817db5db58e66
0d0d388d0e70790a2f4da030022b2c8009a27ac6
26169 F20101117_AABZYR bermudez_d_Page_040.QC.jpg
ec27c0a9f170fc3ef9f0efba49bd0577
469784846f6656827506f8802fd41bd4c04ad136
2197 F20101117_AACAYI bermudez_d_Page_033.txt
a0c9c64db2c2ae2185a1b98bcddf3f9a
bc8177d5a938cb291514940d1b534b29bc907530
3049 F20101117_AACAXU bermudez_d_Page_011.txt
c9587f30497b7431ae7c9d25f6c71dbf
eed616d061ee7bcc04955d0c96aa5213f9c2c585
1051982 F20101117_AACABB bermudez_d_Page_129.jp2
66cf43df9c8620880999b4ddad29aa2b
a20f581536d760cd22e99ca6e693bdfd97e49f8f
442398 F20101117_AACAAM bermudez_d_Page_096.jp2
6ae968ef5c90eb4f19ab88b920185bd7
2ce83887555b163a66dd3e61f85b31ee1e508424
F20101117_AABZZG bermudez_d_Page_007.tif
60ed6af737170942359de03d2ab39295
968d58d40760aaeb4e40ed1ba8d964af3ab36f36
6889 F20101117_AACBEE bermudez_d_Page_015thm.jpg
73b0d4c68c092ec05801dbf2baf08edd
f28d47a29b7a9494cab3e5131068e68ffbca3e35
12122 F20101117_AACBDP bermudez_d_Page_097.QC.jpg
a04054f6596f50aeb8f8c8a02361eef4
98ab28eabd15f094ae41d54909b85b24126a5247
6077 F20101117_AABZYS bermudez_d_Page_082thm.jpg
578fd9befce52a0f60b626051e520e35
c08685829a10e28443159da9a02cad3fe54c2588
2141 F20101117_AACAYJ bermudez_d_Page_034.txt
7f94469b3995c1690dcca82f8ee47ba2
4d86b1260aa2c46f08af91317e6507999b99b7a3
2214 F20101117_AACAXV bermudez_d_Page_013.txt
10d5d96236734b7d9a0d39ade1173532
7f298a02f5ef5219cbfe9b8850362405fa0f4b83
6959 F20101117_AACABC bermudez_d_Page_041thm.jpg
5a602485e60442e9bd0a1f44475bc516
e320a09c7ad93abcf0ce8c88dfdb9452d6279edd
F20101117_AACAAN bermudez_d_Page_094.tif
734781a56983708006e4b596a657b320
0140fbc9d0209833863445147981731507f88ac0
7095 F20101117_AABZZH bermudez_d_Page_109thm.jpg
2d1030e93993d5c26e8ddc21b303238a
c5584a42e639385e0a0ae916f64ed5a5048c779e
7429 F20101117_AACBEF bermudez_d_Page_019thm.jpg
b4a9a0de94c74a140e75890c252bf890
bfd7e25ef6970d4d67eeb9d6bd91c20bec172797
7358 F20101117_AACBDQ bermudez_d_Page_038thm.jpg
41f6a279b14eca95b544a4df9c162c01
b8bef1fafd90ff251aade0bd46207df375ed0b63
11248 F20101117_AABZYT bermudez_d_Page_100.QC.jpg
fcd89213bd68ffea50fea737f05927d1
7d706db312df7434565bbac69e751ff71668cc65
2221 F20101117_AACAYK bermudez_d_Page_038.txt
8bf0094392ea6bd7178547db09eded93
63ae1cb76c7ce29399d0df441a8a0517020b75bc
180 F20101117_AACAXW bermudez_d_Page_016.txt
eb93cf8a8e238888b9273564700ce5b3
1e60544c963b1caeb32a7b66fddf3924ad32b2d4
398389 F20101117_AACABD bermudez_d_Page_093.jp2
cc8200274143fbb4416988f9a7330599
14b01a94b8195b821f5e3a948b5b56ea83bbeee2
87378 F20101117_AACAAO bermudez_d_Page_026.jpg
e506093314a476f2177561a99883a74f
165e754af3a9c20aceafcfb7001831e8900f21ea
23923 F20101117_AABZZI bermudez_d_Page_013.QC.jpg
4518b72264cb2eaaade286b3dddea0c0
ded8383ad0a62477fe6d7276c0431be38e3cd13f
7513 F20101117_AACBEG bermudez_d_Page_024thm.jpg
3b132231c724c24ceb98918c07b626c8
29811a184f52898bd8d523952d2faae68dd156e5
4447 F20101117_AACBDR bermudez_d_Page_113thm.jpg
09dbebcac845b20dc8d97e76d787cd4f
969e3e0db4b95ab4e13c65200525498f71997a0a
F20101117_AABZYU bermudez_d_Page_071.tif
17a79387e763c861dd543e588ac4b344
3ad13c98396d9221ce708d865ac1b24abf552c61
2080 F20101117_AACAYL bermudez_d_Page_039.txt
25f49f0de0e283c3f2208c56ec24ca3a
31def894dc4647e47565a741cc7c9ce75c1ec43e
2060 F20101117_AACAXX bermudez_d_Page_017.txt
5982a75b5dc2a5bf7abf722b528e99ad
9d815fb6db70b311b0d1b7715891d1f3c04d32c8
2142 F20101117_AACABE bermudez_d_Page_072.txt
5b4c74c3e2bbc11070163794024c66e4
446c96d5080ec04ca4fa3f2d772db167b96c45ff
26987 F20101117_AACAAP bermudez_d_Page_034.QC.jpg
1a58bda05b665f966b140b4aa3508457
a0fca67bbef7b9d11bc4ecc7c00020b7c9b7e9ec
1051970 F20101117_AABZZJ bermudez_d_Page_038.jp2
bb03482d55b8cb3c77d158e4ebddb2ab
b7b70399044f125382d52bc595c1600694cafacf
2182 F20101117_AACAZA bermudez_d_Page_064.txt
d7a41b1b1a6e7d93df64f168e3f70919
cabfce89fe43c0ab3ce5b132dfdfcfd94f4a2657
3523 F20101117_AACBEH bermudez_d_Page_088thm.jpg
d610fe51a85fbb8e2bd8b67533d64f0d
0fc056ecc2ffb9739eee8902503a6700258cc0a0
5983 F20101117_AACBDS bermudez_d_Page_084thm.jpg
adc959c5eed7575d51f88058bafc99c2
3beb225b856e3f158aeb71fc3e28990d795f46f3
42316 F20101117_AABZYV bermudez_d_Page_099.jpg
beedf5fa27456bcf85e6924e938f926e
3f7932d8b1dde7e595f1737d9eb4a87823f5ce54
2118 F20101117_AACAYM bermudez_d_Page_040.txt
4dc5c32a6e28150b96e5492d650f9f4b
7e54ed2b4d9b3a8d72da15709c3c9b261bae9db3
1927 F20101117_AACAXY bermudez_d_Page_018.txt
1a5f136d410f64e423a4db887b0adb1b
505b4765142a9d568c2c788eb3147ff87dff5faf
1051984 F20101117_AACABF bermudez_d_Page_066.jp2
469420057c7ed812c6f7a0e8da28f006
04a81bab070c4d1a04cece238aaf066259681850
2135 F20101117_AACAAQ bermudez_d_Page_108.txt
bde9da069b26d48bcfa88f1e36df5b1d
a1b99ab98778bb994b325ecb65f13f5191503924
28451 F20101117_AABZZK bermudez_d_Page_042.QC.jpg
3e02abbcdf21c96fe2bfa29636dca886
01b84b4b8a0d4fe9182a084c635139f4b5a91fa3
1838 F20101117_AACAZB bermudez_d_Page_065.txt
694028bc0972bfb441a2d1c37ca18287
9ecc5785a211baa1473f4e350aec03922fb6c1ef
7214 F20101117_AACBEI bermudez_d_Page_027thm.jpg
7f2b494ce315d1a2339c7679054f348d
59899e11ade1798174cf57c345557294d2f33148
7307 F20101117_AACBDT bermudez_d_Page_074thm.jpg
27ea1633ba8e8f1846494ea389ca979c
eb1592a4d6d885d22cee7d76b5d88de55dbf7177
F20101117_AABZYW bermudez_d_Page_103.tif
882a87b003eeaef204980cd40f751230
1a7194fbf7c77e8b803d7dd0f7fd93f0f913638e
2017 F20101117_AACAYN bermudez_d_Page_041.txt
b3e618c02ce40125a671ec7a3c3b90e2
0df4b0290d3df7dfa27548c2c1545844f885a21f
2180 F20101117_AACAXZ bermudez_d_Page_019.txt
453cb6e21a4205fa37c0b2e5e809c649
e32ae57f0ce05d3990685b5f4331e322d828fa69
67559 F20101117_AACABG bermudez_d_Page_009.pro
70ca4179e3f58ce631d1bd08faeb8ac8
4849fb7466aa219c70b9ed95e9b9eae0028d4ba6
17323 F20101117_AACAAR bermudez_d_Page_092.pro
fb8e9d2784791ba52b4f19e961f79ad7
68ce5e7ba2751e0ec5aef603cd81f6eccdee3ab3
1921 F20101117_AACAZC bermudez_d_Page_066.txt
9e2a39056d741d1aab78f2afb82555ae
78827786b93f232192ae28cd17d055c3d332af58
13330 F20101117_AACBEJ bermudez_d_Page_085.QC.jpg
14472189b473bf6f2dbbd6c0229fff39
900ab6011a5e2ebc8ebbb19424fa3717d318241e
7099 F20101117_AACBDU bermudez_d_Page_067thm.jpg
3218ca5a6be3cc9d8e4a3c4ca3af8e3a
f74bc6107eb0e23b3a03d8fcfe1be2743399fb19
1962 F20101117_AABZYX bermudez_d_Page_036.txt
4d6cdcab5359b14f9efd2bbfb0447b67
93bd960a3f97fa41fe6b8f9391ab476acc7a7546
691 F20101117_AACAYO bermudez_d_Page_046.txt
e4b50e505beaf342d55174ae564962c3
d8cc06c21064aa7e5a459bb89e9aee03caeca281
7983 F20101117_AACABH bermudez_d_Page_125thm.jpg
4d1ebb6301cdd8f53fd4791fa87bb0ad
8f0cc08a434380bb8350630558f21ad84d7138ec
43200 F20101117_AACAAS bermudez_d_Page_110.jpg
8c1ca1f5c4a7a8b1a91cd9e4103ee4b2
6f154c44b5aee26f0da9713dd25a8afe81d48031
5002 F20101117_AABZZL bermudez_d_Page_030thm.jpg
37969924da3fa33ebd4ec7e7dc9c980f
f13b7c3afc8a02a1d310d2c02e3f48380bba93e5
1958 F20101117_AACAZD bermudez_d_Page_068.txt
375722bd374dd912c7134f2c17b880ba
2c7b748d4234f525a9c8a3674ee55cefd82b3e58
22403 F20101117_AACBEK bermudez_d_Page_116.QC.jpg
cb4226a8a72829b6b647ca7a325d3230
e464cb9d9f39818ffd6d12c86427a531d1787c28
12630 F20101117_AACBDV bermudez_d_Page_099.QC.jpg
f7cf71b6ba69acff6ee64b3dcbd67c4f
5e8d8cd8fc014ad93256f1c334bc8927c4b4ed41
2111 F20101117_AABZYY bermudez_d_Page_048.txt
5d97b6fab97fb4b63e59c35de0fcae27
ec993b87d7fd6b2e35c5e67ca3abe0fd7e086115
1935 F20101117_AACAYP bermudez_d_Page_049.txt
3e3bdf650266d1930684a76ae30bc0b8
f5653e62aee7ea1edcebc835cadf6c2445fde163
10932 F20101117_AACABI bermudez_d_Page_014.pro
6ee873911fbc7ef48d0f3c74cc1587c2
3426dbf634759af397c82dd22e67a2d496d39de5
109174 F20101117_AACAAT bermudez_d_Page_011.jpg
c45b4ac30da24678cbdedaf6e975d3a7
de5aac6a58391fe7b7fff2003fe8479f98e5446a
4397 F20101117_AABZZM bermudez_d_Page_112thm.jpg
3f2643a411bf718d2c9dd9e91a4ebedd
b304f5850af9321827080d9d9b98bbbe413cda83
2086 F20101117_AACAZE bermudez_d_Page_069.txt
dc0c0e6a9c56321cea55881e3f4f82f8
8f74e7ecb3485e33ab2116b832822d36f65c8d9a
7036 F20101117_AACBEL bermudez_d_Page_116thm.jpg
4dace5247b3a86edea05a57aace1408d
4c38a03e2d2b3942be25a71d8b2bf74f3d861db3
3719 F20101117_AACBDW bermudez_d_Page_100thm.jpg
212670ccca967e8b9358da642595c879
92f76497583359f8430237be8bfd4a2afd039919
2792 F20101117_AABZYZ bermudez_d_Page_128.txt
1825b40ebd29435b695db60386b2edfd
f07bb3963b21c7d886507bf34d3e11f6cf16e2b4
2066 F20101117_AACAYQ bermudez_d_Page_051.txt
43a86e8d4e282eef9866a17e66d33037
5e4ff714effc3f2b7880b5151a36f08ac1e87f6e
2045 F20101117_AACABJ bermudez_d_Page_020.txt
13e2cdab8af20ded60670b0b98362539
bdaa4b9e1ec7baff0e60a59b9bf96097efc9efaf
12927 F20101117_AACAAU bermudez_d_Page_102.pro
06234391e405753f43f2979adad29bf7
d0849aa87f44274c59a0779e8094a46d1590308e
281636 F20101117_AABZZN bermudez_d_Page_060.jp2
b9def39aa86d40d004d523b001fc26e3
d709d0191dc9f965f55969790cc4b7c5651da960
10161 F20101117_AACBFA bermudez_d_Page_101.QC.jpg
68f7c45bc7edff5bb3dbef083f3c1d0d
a0688c54175fb9926df39b7b223190f47d486c4b
15607 F20101117_AACBEM bermudez_d_Page_030.QC.jpg
773e6d0da28659cabc7fade10ee77a9c
d0771f402124e5196e2648d55adcff184022784c
28826 F20101117_AACBDX bermudez_d_Page_054.QC.jpg
ff60cfe219f1ed7dbd9f05f1387ae8c6
3d89e413b94acac57780116c43f94754987ef492
2016 F20101117_AACAYR bermudez_d_Page_052.txt
41e5d12db72c3c92351b10bdbb0234db
90460247d976c87e201f05efe7835c12041a4264
2860 F20101117_AACABK bermudez_d_Page_009.txt
b17346345318883fb172b8f427f09162
7cb9967fe622ef51be4ad9f0f1156e32160a3855
F20101117_AACAAV bermudez_d_Page_039.tif
bda6cd2876538654139d1f23780aebf5
3b15dce8e51fc0baba98c539685d5c40cc1c7641
87740 F20101117_AABZZO bermudez_d_Page_006.jpg
e06bef96e798c2dd88aee63efe3a743c
6760eb9ed2d6f16031ba5568cee1d57639efab4f
2021 F20101117_AACAZF bermudez_d_Page_070.txt
0ba7cae384d643af11bb596d9e770391
63e819c1e41129bb472613744562de02e8921b15
26008 F20101117_AACBFB bermudez_d_Page_068.QC.jpg
ceae821c5b6bc368e79f3c19b45893a1
8ac61cb6cafe4e8d41985cd7d79cc27e94d221d9
26236 F20101117_AACBEN bermudez_d_Page_035.QC.jpg
08a2a3ced7ca7f4655a9c8c11d630c15
7ece7973b1ee7896ab60ae64334bb2f885fed4bf
7006 F20101117_AACBDY bermudez_d_Page_066thm.jpg
9017a87fe23c0ac9a6b7c0ebc5c78eeb
a7531f42b478cf1aa015a6cd528cb9d561ee37a0
1978 F20101117_AACAYS bermudez_d_Page_053.txt
af48d7d22b816790726d72ba580b247c
20accaf70e10df1776cccbbc9432eb456f9e78e6
28483 F20101117_AACABL bermudez_d_Page_129.QC.jpg
5f554b5ad0e768c42a5212aa3641a5f7
bc157375a1d6e662e00a5e378dabf531ab01a560
F20101117_AACAAW bermudez_d_Page_006.tif
c8b21ae8bf386e33f9de32d10010ce82
5d39388f72234cf034a3b218f031da7feea12d01
1051908 F20101117_AABZZP bermudez_d_Page_039.jp2
51db0edf3120e7bc5e0b9f702517b3ad
b9fc1c0cdeb7f7ed776f8fa8207d7e704a7660fb
1920 F20101117_AACAZG bermudez_d_Page_073.txt
e4352f77c05d2dae4a4de5e114775ba8
7438306cd8d0bc900e3eee246c4f289ae9ba9736
12519 F20101117_AACBFC bermudez_d_Page_096.QC.jpg
719c7c50f40d34f31abbd3bca09c1c3d
be31581cfcbc293d305bc50cf1c13c3730dd4e78
5048 F20101117_AACBEO bermudez_d_Page_046thm.jpg
5ebeb28d5219911cf09fd99bc268062b
85d94a911eefaedf056d26e9cc3e59dded3d424d
2660 F20101117_AACBDZ bermudez_d_Page_056thm.jpg
d3cf61bd4f32bbbd3f057cf1fbdc55ce
3534f7a5dadb361bff5205e5a8ca2cbe93f7c46f
2219 F20101117_AACAYT bermudez_d_Page_054.txt
d1594fe3fefa362106eb49c263ffd3c8
5bfee2da0cb2a3690551843e37f4aba27e74a3af
32709 F20101117_AACACA bermudez_d_Page_104.jpg
f3b561d6ca59c99a1957f3903d21e39e
0066127c72953e0aa8762be5d0217f5a5260b5a6
7455 F20101117_AACABM bermudez_d_Page_078thm.jpg
552a12b0f43d12fc2c3ab9baf694641d
3944b652fa5f2e7e2ab44203e5a25bfc3e09a492
3775 F20101117_AACAAX bermudez_d_Page_117thm.jpg
df1d257dbff8d12f99c4b943243afd3e
62ae51ef6f5d0c79b37828fa2a4cfac2fd33027b
2229 F20101117_AABZZQ bermudez_d_Page_026.txt
c4b1108b6315ec3999c704921c9f784d
9cc89765026788b63213af817c7bd09a12352fae
2050 F20101117_AACAZH bermudez_d_Page_074.txt
16beedbaa8dd9454481d734244d4fa0f
90f326250a84c4cfbadaeb91c165dfda0b24bf81
4414 F20101117_AACBFD bermudez_d_Page_031thm.jpg
3f09a42c6294f323c99bfe5a9af68dcc
f7d03db853dbe377bc27d88f026cb7a18ba4c01e
2148 F20101117_AACAYU bermudez_d_Page_055.txt
cdd1faa5ef7f97c65fe9fba52fc3f231
d1f27602c2559a339dbb1e6f2b7494a0a742a40b
F20101117_AACACB bermudez_d_Page_120.tif
89bc3e44eb7ced8227b962fb6a495eb3
a10b0e4257ff5d6d7d837ece9a547837ae378054
447487 F20101117_AACAAY bermudez_d_Page_045.jp2
708c86d839ca8f9ea75dd525ce0a5c41
5e24e1de855c090bb9600fdf5a5438c3e649195d
8155 F20101117_AABZZR bermudez_d_Page_103.pro
32302e45493453515f3b2ceb6d4f2ff1
d46e483d4d066772d42add07e35121648e035bba
1752 F20101117_AACAZI bermudez_d_Page_075.txt
378bf540bd6bf5a05ba88faa77666504
b7a10e77482dfbdfd4d3842396b50307b72f1bd7
7279 F20101117_AACBFE bermudez_d_Page_108thm.jpg
0e4228532f75be902e4ffc70ef0510f3
2f72911856656547fb32ea8c3c33c36bd87c6630
27159 F20101117_AACBEP bermudez_d_Page_027.QC.jpg
38ab0cefa8e4d690884cbe7816fa76f0
7f0c8804a394458dcef53ff846fc388027ffb912
529 F20101117_AACAYV bermudez_d_Page_056.txt
6a2a59bf2ca5f0f9993e24b0ae611b9c
ac5fe0f197d2067757133bb0b10fa2983582584f
75910 F20101117_AACACC bermudez_d_Page_011.pro
c434dcfc6ed13ae7520f000d1a9748dd
723d762176b7e4d3a87a8cf2dd58b0c9aa9fedc1
9488 F20101117_AACABN bermudez_d_Page_044.pro
1fadf0fdb1e54e7ba298a66bc7f6cc56
5074ef04dc6cce75b8ce2539b2111a1f0cd3d763
744 F20101117_AACAAZ bermudez_d_Page_057.txt
6d2a3e9015abe8d0650b93b7c728d8be
81731715d8810e8d21be3f902ae7c00b713322b1
3982 F20101117_AABZZS bermudez_d_Page_097thm.jpg
2d7a2d7a58f7896b9acc0c466bc149ec
954f780fa7b576e14098dbaae42daa3d2b55a070
2161 F20101117_AACAZJ bermudez_d_Page_077.txt
b11a2aa8d066f75c113feebe7113e3aa
2a1ccef7fcdbda9f5d5fcd86413cf7e3ce1ad3ee
3875 F20101117_AACBFF bermudez_d_Page_094thm.jpg
a7a6bc91e6cb60c468e6b56544010cb6
8b7a822ae6eb2e932718e5128714fc2f89abcb63
5356 F20101117_AACBEQ bermudez_d_Page_057thm.jpg
1d221ad0076ea777e5cf05758ffe8eb4
5a8bed30c9e97cef092dee5aebf351ef0c246920
470 F20101117_AACAYW bermudez_d_Page_059.txt
f5eb9cc213f4cdd720ac20ef5eec17af
13daf54e49880fa97c7da37a6d0c6ed2fa736e91
F20101117_AACACD bermudez_d_Page_031.tif
36e6fd258d1fdfdf2ce956c8750485a4
c2827cd65f8bc67a05ee77b6569d63687d82492d
F20101117_AACABO bermudez_d_Page_030.tif
d3148f7e8ee178a232ebf0b97cd37416
91ff626889aecd35f68f1a460243af803f6cc3a2
55993 F20101117_AABZZT bermudez_d_Page_025.pro
ca574082753ae8c44a8e89d51deb3677
56f64a2c2e6b7929d2bd205ab4347af3bb4f765a
2098 F20101117_AACAZK bermudez_d_Page_078.txt
f9c45a4ab0d6745033d28398492ad475
91fa42f568ac430211bf40e7b4e4428972f6b13a
24263 F20101117_AACBFG bermudez_d_Page_012.QC.jpg
ab011f9c3c7e212b0fd7add9768cc20f
58ed58eeb9a4ce7c090c6bbf9322a2aa5320e6a1
7263 F20101117_AACBER bermudez_d_Page_070thm.jpg
f78bac6ab7a868d3c5e251d015070bb6
98cef64d80448dd81eba24cc8e853727ccd561ca
293 F20101117_AACAYX bermudez_d_Page_061.txt
e234e833830307dafc1103eb8ebc0f75
b1d9a738c9f411fff08932d037395cc3366602f3
85725 F20101117_AACACE bermudez_d_Page_027.jpg
05cb45eb5356633116bce4a67e280b4f
afa95e361c5d1edc307c6ff8a796a47c85adfd0d
37687 F20101117_AACABP bermudez_d_Page_098.jpg
bad0177ef31d900af4384d8482a9ce0b
46d4e8d3632e005e4d0ceebcb47e7b0cba132792
404083 F20101117_AABZZU bermudez_d_Page_095.jp2
37d66b12981c84f57b8084b77a513ef0
7a8c5969c6a12c2718436f4745e5d0a6af1614f9
1833 F20101117_AACAZL bermudez_d_Page_080.txt
92ef5e85a132a723e6b3f63291a8f6f8
d586f41e8c4ea82a7537924a332a5bc5714edc62
18153 F20101117_AACBFH bermudez_d_Page_029.QC.jpg
012257d691c86adbe0506441686fa0c3
ee0fc28ddb0e9db872e700c39433acd04ca82842
5379 F20101117_AACBES bermudez_d_Page_083thm.jpg
df8e4974de45a1cf14e65dda64275868
9edf4b922ca05fd9b4dd5d5362b988c94f359cad
2085 F20101117_AACAYY bermudez_d_Page_062.txt
0922ee80df255508255e5c73a029893b
7785f5d7c69f356238a65e74b79ab7012ee90806
4098 F20101117_AACACF bermudez_d_Page_085thm.jpg
00877c0dee9aa14642b61195bfe1a8de
e146cc49b45bfe82f8dfe532a5849be0e3b2df00
13222 F20101117_AACABQ bermudez_d_Page_089.QC.jpg
3ab5edbfcd5c060d9f4985db4c9f65fc
f6c41fa74d53ec4ca4260e02d25194e59043f9c9
25057 F20101117_AABZZV bermudez_d_Page_017.QC.jpg
62343cb6495d32142c159cbffae06ea9
7fc6644dce65cfcbc8dd917aad855395a0c41132
848 F20101117_AACAZM bermudez_d_Page_081.txt
e6dfbec2ea86c18552eef299b4e07c3b
a88ee5944755eae33db5beacd106101bc7d7193b
7373 F20101117_AACBFI bermudez_d_Page_021thm.jpg
5d324d85fbcb34169129a9e37403f921
b0ea270237723872438518483def3a1ca1eea4b0
7156 F20101117_AACBET bermudez_d_Page_048thm.jpg
7030b43f8ce4fdce8f50a4e611c21fcb
61d21ea6fa32ecb2e14d35794479db8874ba650d
2268 F20101117_AACAYZ bermudez_d_Page_063.txt
67b18ffd3a3843a8999aef4df212d9a0
2c2687b97cd7464931ce004111ccfebbc932cef2
29779 F20101117_AACACG bermudez_d_Page_061.jpg
ca1248d548a27160bef85fa0f5df1eae
55f01d9f1f76ffc531458a5fb27775729c8109fc
6871 F20101117_AACABR bermudez_d_Page_121thm.jpg
5a7d12cb59130467c260806b6cfc9bf5
2eebb7cc3f5612c54b876b5d77921bb30cb794e6
F20101117_AABZZW bermudez_d_Page_012.txt
4d615f2f48d6e7ff195dd52424a91d8f
abb6addf3834d4b1428672270e9250731085a929
1992 F20101117_AACAZN bermudez_d_Page_082.txt
aa47eaea55f9b1ae3460fc1cbb8a7299
ca00044fdaf1dcae7d273918d6cd0773557a0a6d
7472 F20101117_AACBFJ bermudez_d_Page_127thm.jpg
adf577f5c962deab18d16d7bcf53a958
6368db8d126f1ab126467d890a310f0c99a0f7e6
27246 F20101117_AACBEU bermudez_d_Page_124.QC.jpg
62e0b89b8485383cecc4e56db7f10133
b46e00405d8a959c674ad0ad42a8e138e0d75d76
F20101117_AACACH bermudez_d_Page_072.tif
d5d4111d5bda5f6ef4f234ffb8c24d40
cdf49c839a826029cdb7a360aba48b5772788e4a
38769 F20101117_AACABS bermudez_d_Page_097.jpg
740860ca8b17e86797b193484ae2aa96
d7c5f9a09299360b847e988df5e1669661930f8c
27292 F20101117_AABZZX bermudez_d_Page_038.QC.jpg
8c59f975cec46c2b4e02372262571456
0499a557ffa47f8df101b865c2cae9a9642716ca
F20101117_AACAZO bermudez_d_Page_084.txt
9d44918d26e262f0ac51104b87070788
4ea7f671cff512d2ea9a7c7c66707d93f6296ca1
24632 F20101117_AACBFK bermudez_d_Page_073.QC.jpg
dda44cb9a8463eaeacaab390000d0c47
3ff26dddc5a16ae776394f6c489552d9598d1eae
27207 F20101117_AACBEV bermudez_d_Page_004.QC.jpg
a59ea3230737b9ab6889956b818ec57d
72bbd424be3931d0e46a84399e5b8495a70aeb28
F20101117_AACACI bermudez_d_Page_003.tif
600b30fa355a1e0018047795b3ec61a2
2e4ad688a8c985960d2f3675be445b5e8d766c9d
29223 F20101117_AACABT bermudez_d_Page_011.QC.jpg
3254cdba9a49cd2b9ae0ec6680aa4674
894a3b9c286cace5dcaa90332e6c937127959e38
457567 F20101117_AABZZY bermudez_d_Page_089.jp2
bd119c5f51b26edd253a8961e2bd258b
cd64a7fe3889d5fd2e7021e8070c7bc56ab1ecbd
786 F20101117_AACAZP bermudez_d_Page_085.txt
5d3c390be270bc76ab71cef268875f67
e6edb15503404682dcf5fbdd6ed4959783ca6e50
26708 F20101117_AACBFL bermudez_d_Page_121.QC.jpg
ee7b9d0d63f9e948bf6552ff006276b5
e1f4af3480c9efccf3aa1d91b881fc9e69a3e91d
1476 F20101117_AACBEW bermudez_d_Page_002thm.jpg
613175a198118ffd701935c3561214bb
4c5f924954f278eecc0ef0bfaf6d9c103a978678
54637 F20101117_AACACJ bermudez_d_Page_019.pro
11248c6b3dbf3b987c54841356b5ad01
f6073cc1afb19e6783092ea8ba5ec1e40bbd9f43
503 F20101117_AACABU bermudez_d_Page_060.txt
c10216a22bef912d3837df5e8546b09b
545732a54cb25c035f963cbfae73de12ff929b23
49264 F20101117_AABZZZ bermudez_d_Page_017.pro
8f3f25919ab9c49e214e451072d973be
613423292edc37687a6cb43fcfa224cf20d5ced4
820 F20101117_AACAZQ bermudez_d_Page_086.txt
845c502c3a39210c8463f3ef09d1d447
d4113e22225f0fff4221f0c437b0f238850a898e
26864 F20101117_AACBGA bermudez_d_Page_009.QC.jpg
8296e1ec72e29a4747a7ca14b3f3aa90
92dee367fa51ae35a6503897537d7346e3de7d65
7642 F20101117_AACBFM bermudez_d_Page_120thm.jpg
442bf28cf0e5c6e9e45f0d964bca48aa
bcec21e93d592b46b3eae683dcb3b045ee1df2c3
22371 F20101117_AACBEX bermudez_d_Page_118.QC.jpg
0f7b495cb6d3fecea1853d9a3514b633
efac3c976fe2f4ecebad576f299778d021a9eb8b
789 F20101117_AACACK bermudez_d_Page_096.txt
0417a09f20590a1c5482cabf93019ec6
e5d2e927d110343dbdfe64dae690da29111efc92
90233 F20101117_AACABV bermudez_d_Page_054.jpg
c7966b1bf9ef1f644710c074dbc487e3
0b1b3ae70b49a9bd2a61379ac7fed7043c9c3d32
573 F20101117_AACAZR bermudez_d_Page_088.txt
fbc770cbb1b5373b068c45672100b769
14051218e93a1e20d615b9ca2a96e6ff235dbbb6
11761 F20101117_AACBGB bermudez_d_Page_117.QC.jpg
b02c95c3ac9286ead79d07946688ace4
ff1cee2a17971340dd5554b67d4571a83348481e
31124 F20101117_AACBFN bermudez_d_Page_128.QC.jpg
7a3e490bc9489171001a12ef41c1c4eb
4b785f311af045781333effe9584c69925e262c1
37071 F20101117_AACBEY bermudez_d_Page_119.QC.jpg
1a7304b200cb498e26c8895478c15a60
e4a9c7f56e89de28399cfe354a659612ac32955c
27740 F20101117_AACACL bermudez_d_Page_019.QC.jpg
5143baddb6543c38d099d5302d204c63
a01548f05439bfb1ad46f874c61d678f142417a9
2231 F20101117_AACABW bermudez_d_Page_042.txt
06b8ae2f9d5206a9c8b86d00b3abc874
06b19b067f817e60b0f999e1c58c0b2e89606354
843 F20101117_AACAZS bermudez_d_Page_089.txt
3fd4444db052e5d9bd9d074f42e6e08f
dbd5be49937d3c28f2a301c5e64b1b8517112e97
3514 F20101117_AACBGC bermudez_d_Page_103thm.jpg
eea08f0de565c29bffd425626df00bd6
33b1f14dc939acb94bfb9d4c39eeaa454eee9e02
12915 F20101117_AACBFO bermudez_d_Page_113.QC.jpg
f1c1485c16b8510808df6af7c95aab2f
50a64e6869b6597d4e8f22821a1ef9924c131924
17811 F20101117_AACBEZ bermudez_d_Page_083.QC.jpg
6beffc726e02277a124d7a34371aa295
db996bc4250edfa9563d688b2424adfd8244a8b2
41291 F20101117_AACACM bermudez_d_Page_096.jpg
17078fe06520f9af3a338356e2182083
464256094398ae48ec0e6e0704b4848f3c8fc8b2
13675 F20101117_AACABX bermudez_d_Page_112.QC.jpg
02a1ee6d4bc23091440addaab15cddc2
583996a03bc54c1821bbe9aa195cc3ae67acf277
732 F20101117_AACAZT bermudez_d_Page_090.txt
f73b50cee5028107808e0be17f931445
eb2183069c276d43816e24c72ce0406e8a974309
8624 F20101117_AACADA bermudez_d_Page_119thm.jpg
8a07bc150d8e6108dd8531a98c1128eb
afb6d385bd3f0a12c2002532d1eedfbe066bb01d
28576 F20101117_AACBGD bermudez_d_Page_130.QC.jpg
f489744ec3e4d76e08b8fcf2f7bc10a0
a6c2e27998c20a492b7d28fda4799147ffd76c52
24740 F20101117_AACBFP bermudez_d_Page_015.QC.jpg
503eb4fa2645fdec69fe34c7aecc85ce
fb153671f6723e14dd05f3e69f04f6b39eba06ac
451 F20101117_AACACN bermudez_d_Page_031.txt
ef11c221150bf4dc34e8480252e24ef4
510649ca47fcabb67bcd431d336ad64696926b9d
7137 F20101117_AACABY bermudez_d_Page_052thm.jpg
c1ae6638e8a4d8e504376cfc4e050e36
81147445825d888c9cda0b566d713812f8c18552
900 F20101117_AACAZU bermudez_d_Page_091.txt
b7795a89a76eec8f8024bfb830ca634c
df16d2065252de3334b08619a792dc4a9104912e
38515 F20101117_AACADB bermudez_d_Page_087.jpg
ae39717c5af773c3d9eb75caf427cb8c
eef2bef577a09223b98ff7038078b20349a193c9
25419 F20101117_AACBGE bermudez_d_Page_070.QC.jpg
e3c3b077031f5a7ae1c7664072e250ee
3481b37baa6b5048c78493074171972847d18d35
99880 F20101117_AACABZ bermudez_d_Page_003.jp2
f1d64dfbe4e343d5ae9ec93c40a1388e
d245eb1041bbc8fce09348cb524b3a56660d6d2b
695 F20101117_AACAZV bermudez_d_Page_093.txt
c02be16de3cc47ff91d3dacccc7cd647
0f05514e64d00c058384569be963edb9462476b2
27637 F20101117_AACADC bermudez_d_Page_077.QC.jpg
969cf9dee3e8a7ea00e2e3f441939fe9
2d59e86b32ec3d98db840cce8a55b7b20a155995
31021 F20101117_AACBGF bermudez_d_Page_125.QC.jpg
2d9664affb0a0a866081e7207d7197ba
16cfbca5f54f8b239903bc4c90cc77b0de9e4e5f
11962 F20101117_AACBFQ bermudez_d_Page_086.QC.jpg
bb82d3871040b2e1f979ba6627fd7bec
232b9a4c60f2c7f49941e91ef5c2d86b51848c2e
7406 F20101117_AACACO bermudez_d_Page_035thm.jpg
4d2ba25e8f20d3c6ab8905242e070aea
18477a53aedefc8f3001b5013650c6713151cd3f
F20101117_AACAZW bermudez_d_Page_095.txt
24e39ea3d7688f7727ad2d5da89c0022
f22df894907b1174dc98ad3e5b89aff960586474
1051974 F20101117_AACADD bermudez_d_Page_020.jp2
ded2c1a2e55c0721d48f918ac566826e
4f3f736a834ad2abb3f46576d2a36bac10a56653
12708 F20101117_AACBGG bermudez_d_Page_092.QC.jpg
f371c442a32516e09883227d73cdab5f
bea74cbe66ebfcea011bbb099aaa8d80376b25b9
22620 F20101117_AACBFR bermudez_d_Page_111.QC.jpg
ad5505e3385e6cb174b8ce037ef53f91
52cb6ca4e57fca138374f9a262354972eafb91ba
8773 F20101117_AACACP bermudez_d_Page_032.pro
1d0ea1e87293588e87058c6aa568cb4e
80d2d12b4c325a8336fce1c3e176615512b90dc4
F20101117_AACAZX bermudez_d_Page_098.txt
6e9da21f589606b6e1cdbe5885cc9446
ca8b1a827ade098099ac78e83b231f8dc8d8e29e
F20101117_AACADE bermudez_d_Page_036.tif
7015c4c72a2f41fd29605b0c47dbc4a1
0d519f1b196475142aca8cabb086365b1ebcdd5f
3323 F20101117_AACBGH bermudez_d_Page_058thm.jpg
08e337360796a3dbd1c1609e7917fbb3
b8767eda482a62193f5f132dd2b118ba1e9b2f99
5774 F20101117_AACBFS bermudez_d_Page_043thm.jpg
83f41b3e37c08ce284564818e47dbc2a
01bd4482414f6e37d10688148c809acbb423abd6
1051948 F20101117_AACACQ bermudez_d_Page_068.jp2
3a74ea93d984e5e226b5b2d6823265d3
288c087b542fc01d1e43a5e0bf7bbaf3ca0c0f8a
362 F20101117_AACAZY bermudez_d_Page_099.txt
e089607fb11f6de8afa47d4d849dae14
e3bdd6c64a610599df3df8e8d1b719df10be42c7
86839 F20101117_AACADF bermudez_d_Page_079.jpg
4eaadc705b5099c97e56d61894db6bf6
fcffd5457a41ddab5f9c48c8a7c789d0f43cc3ca
12239 F20101117_AACBGI bermudez_d_Page_045.QC.jpg
eea91e1264f23faf3e3e160a909518a1
1428a80dbdb51639461cee8f1c38364fba51b7e3
2496 F20101117_AACBFT bermudez_d_Page_014thm.jpg
d56eb0e0e6f3d5bbfa68e4f99fc5e763
3ed7c11bce082a44b9a1c02a2770de5fa04579f1
F20101117_AACACR bermudez_d_Page_015.tif
118420b103ca17a740ae1c48fc6139e2
78ea324a7e7a9c9e8538f838501a9a301c279a25
609 F20101117_AACAZZ bermudez_d_Page_101.txt
3329e806555214caee15b56b1ab89b16
10b2408d63f724475b5e24b39f1be5530614256a
3931 F20101117_AACADG bermudez_d_Page_045thm.jpg
52a32896c2d61b0b6d5faf4792bde26a
46d6b1c8847a88976d83a41020a53c6e0bbcfd2f
23717 F20101117_AACBGJ bermudez_d_Page_082.QC.jpg
f3b1ee2e45e4f465f7bfede543f0e5b8
7092ddd1104e79c0dd4982b18a3b8d7c8dd25b80
22973 F20101117_AACBFU bermudez_d_Page_065.QC.jpg
c326f614748059d6657263e884bc4ea4
b7c2fb5a68ee6fbcc3f2ebedfd239353110a3fce
3863 F20101117_AACACS bermudez_d_Page_096thm.jpg
4219f40505b526bf5aaad4a0806c1e22
13a91cf1822aec2155fc54d61bd40dcf2c5593a9
26928 F20101117_AACADH bermudez_d_Page_074.QC.jpg
3aafd6c363b9aab8f5f5be98f0326055
c171cd4fb433226bf1c3cab137b6cc82541e1380
27354 F20101117_AACBGK bermudez_d_Page_078.QC.jpg
e1e4fe4aa6924b9d6e4794fc1b7ad9f9
595fe910e0fea067f959b42365535751447b9f06
12404 F20101117_AACBFV bermudez_d_Page_091.QC.jpg
b588d3a4f14e20a141f044ae7c8988f5
346856f6189f446a04cdd7368e76df21ce3afc21
1051959 F20101117_AACACT bermudez_d_Page_082.jp2
f5fb27f6a7808b8500244d1d7172180e
7855e04f66183bb962870e70c4127a36933ed1e9
55358 F20101117_AACADI bermudez_d_Page_038.pro
44720cdb1f63a578e7b4a5e7ef9d1e5e
f7c14e1558265bd7220410681106aad546435dc1
25712 F20101117_AACBGL bermudez_d_Page_109.QC.jpg
128719d4888f4378d6b1f1ddd0ce05da
d54347e6aefc307c1238ec00425b8f780f53af9f
7445 F20101117_AACBFW bermudez_d_Page_050thm.jpg
96ef1b6c18017d46edd59a4b417561b4
e38099dece959afd7b2d64d454ffc7b492fa42ef
27434 F20101117_AACACU bermudez_d_Page_024.QC.jpg
2784007a0125d87a9688e48938a6f726
63c1c6cf7a610daa974147aff56321dffbc789f1
7359 F20101117_AACADJ bermudez_d_Page_028thm.jpg
d963b9c0ab1be20b6aa1ad5d14d8c31c
434bfaab4371afc1fe1cc287c2f3bbce269165a7
7329 F20101117_AACBHA bermudez_d_Page_022thm.jpg
ae766b673b2c68d27ee601d3ccb23d6f
da36854f5f633a603c08489dffb2219adb60988a
26376 F20101117_AACBGM bermudez_d_Page_067.QC.jpg
7c71e251ef3a33fd6355c3dbd031ef3c
c90120dc7bd4bce0c55575ac2f6d749e98a5f45a
3536 F20101117_AACBFX bermudez_d_Page_093thm.jpg
6f2cfb90c06976bcea82aa7b245aaf0a
a8ff7960b80fe123c8dd88dfc3f6730581b9b228
1051979 F20101117_AACACV bermudez_d_Page_074.jp2
3b6b8319e442340ccdcb86182472d799
97066323c5ef60076bb7c623662b75a1e3180eee
1002716 F20101117_AACADK bermudez_d_Page_075.jp2
c476c72cec1d74a109723db30bc9a8bc
0743bc65dc948c25340dd78893b0f9013d83df7c
27068 F20101117_AACBHB bermudez_d_Page_023.QC.jpg
6606ff7b9a6df62be71b9bc1c54d8bb4
f4229d2d232aa93a12a9e8a2abd763e4b921ee23
27901 F20101117_AACBGN bermudez_d_Page_069.QC.jpg
d885b4ef5072be2d0f56da98a683f0b9
b467f914e793c20fbdaab90b221decba5dc48df9
12821 F20101117_AACBFY bermudez_d_Page_094.QC.jpg
4048c18ead5002a62f5d789804e0aa06
6ff5c8e126f3edfec0bf6b9b7bb5cf559d4ef953
2181 F20101117_AACACW bermudez_d_Page_079.txt
30050f0b5227d65616e0205e00b863ab
afce791e6f78459ed7409f34c6b3eed4af7f6e2d
2410 F20101117_AACADL bermudez_d_Page_118.txt
d9eb0c4f4132f7ec0658781dca69b1c7
7385e6f827d8515588e3314f21257b1846a2b0fb
7348 F20101117_AACBHC bermudez_d_Page_023thm.jpg
4d38655227861af73db0ba7545464060
07b7d74acee26fb5f7fa19fdfe1656d4dfce772b
18909 F20101117_AACBGO bermudez_d_Page_084.QC.jpg
061e40627d743865c7727ef5a8a539df
f8f415018ca2c44759c66d8c7de8d0b0089d08b0
26802 F20101117_AACBFZ bermudez_d_Page_037.QC.jpg
02a952e0d3cdc9db1915ba3d239226d7
c4b8511aae51db54797fbadbd1935c6823f7b063
97474 F20101117_AACACX bermudez_d_Page_131.jpg
c9ff2213d93f8e00e622de492619cb83
63592f48e754b9b2ba933ec0b7e55c029ebc6aa0
1051977 F20101117_AACAEA bermudez_d_Page_127.jp2
1ee446ec5307caed6d7ed901d25452e4
9d32cddd99ce9028e190180c0270d990c9209b50
55283 F20101117_AACADM bermudez_d_Page_050.pro
22ce7a0320d65387d183d77c2cedc88c
25549ee3ca48fb92a5cd7451dfd6319c2117d9ae
27559 F20101117_AACBHD bermudez_d_Page_026.QC.jpg
865f04ce4fe4c7a0ae726e9bad937b7b
ce0a74b88ab33e74c31e525093b4939984d9bce1
7282 F20101117_AACBGP bermudez_d_Page_122thm.jpg
36a30f061b297568f607a863019c296a
0b93cb003c58219197331753bbef5e40b56acfdc
F20101117_AACACY bermudez_d_Page_008.tif
1bd91153f38835786355427b0318b8ca
1f65b86ad4df8bf1ef4cb62d642c5082a44070a1
15174 F20101117_AACAEB bermudez_d_Page_086.pro
8a8a58bd3509697759eab4a6daf4244f
fdfe15f8d020be2148421134cd9529c5f158924b
9450 F20101117_AACADN bermudez_d_Page_087.pro
9c46d3ac7e50fbe4b12dac2938a9fbb7
d24c860c32e13137ae24ee99a1dc9617595d0a07
7417 F20101117_AACBHE bermudez_d_Page_026thm.jpg
8a160e8831770a6656c187a574b0e0e0
a02b77a0ad550a2ae0a283fbcac0615dd3140d5a
3980 F20101117_AACBGQ bermudez_d_Page_099thm.jpg
cb0a47558e77af2e1cff6d9ae259c13b
ee61f185743e804591a8812bbef678811a69ac73
55670 F20101117_AACACZ bermudez_d_Page_079.pro
cf7aa7ba1a6c73b95a4b416758b0e291
ec684391635683df4b537ce3e2beec305afa120b
7122 F20101117_AACAEC bermudez_d_Page_049thm.jpg
bc0de04077622b7a9780de9751c533ea
09b2713e99f12195dcb1d0eee1ed1d432a1c3d69
53493 F20101117_AACADO bermudez_d_Page_028.pro
f3a612641227d7e4375f2034061f41dc
c108a92c3e0444d6ed85c1aaa83004a1e45ac4bf
4481 F20101117_AACBHF bermudez_d_Page_032thm.jpg
51ede43728acfe4c21e926ab1286f59d
71b016b481b33af020e1935d13f130fbebac72e9
53512 F20101117_AACAED bermudez_d_Page_037.pro
cca98354d58f8dba5960e63ea9db2c8f
4dcc0ed72f6957471472f2dc3e1054d299608ec4
24658 F20101117_AACBHG bermudez_d_Page_049.QC.jpg
b092b09a200daf01db770dca6f8c46ee
7abb674baafc517cdcc82ec6731f2ac43e6aabc0
11835 F20101117_AACBGR bermudez_d_Page_090.QC.jpg
cfa0197e047897e3d476b233c13d205c
bab3d82f5744216257ce3c414a0854994839b2fa
26441 F20101117_AACAEE bermudez_d_Page_039.QC.jpg
619fbddbb2a7d0267cf5b755afbc26ec
3411b1cba9d9b5b7e0857d4ea68760af7f6b6427
5799 F20101117_AACADP bermudez_d_Page_007thm.jpg
760ad26ae615468edf12127cbc3111d3
c1deeb57940726479343608b3d58290152717502
25386 F20101117_AACBHH bermudez_d_Page_053.QC.jpg
545fa397e21b886fadd9fb00832ff5eb
b340fc098f4edb648b8a6faa412e8bb26ad24813
204353 F20101117_AACBGS UFE0021752_00001.xml FULL
c2c1dc30a87d713e0cd9a01e06b9f208
1278d79d5158e7b252d621f3c24ecab426901ec4
263442 F20101117_AACAEF bermudez_d_Page_058.jp2
0792e0ecbf531ba89572f4aac6e76beb
24a91ecf5077ade1e20f788fde41322f91c7df5a
F20101117_AACADQ bermudez_d_Page_106.tif
383b2c3946887964db1d15ea648f9c7f
8352584a25b363807ec28d57dbcd552b65f7a952
7294 F20101117_AACBHI bermudez_d_Page_053thm.jpg
2d92de4696ba08b086ad24ace0bc9b86
7d07acd6e8ca23d82322dbb9f883d9103816a81e
3227 F20101117_AACBGT bermudez_d_Page_002.QC.jpg
0471db3c40be065ad54a405f81ed05e3
d9302fdd604db4bc9853e69f49038ef229371d26
26162 F20101117_AACAEG bermudez_d_Page_062.QC.jpg
2472bf66c5b69e73ea2a8c083c59b78a
a299b6a2402e56992014a0d2f6909df9d042e122
28345 F20101117_AACADR bermudez_d_Page_060.jpg
82b4dc2c8143cdd0f240182134496f0c
0f28d1f3c1d5a177199c3dba2a965c964c5cde7d
8788 F20101117_AACBHJ bermudez_d_Page_056.QC.jpg
a60f32b14608ce254ec3247495eb3b4a
97637fd81fc7b8b797113d0c6b36929eb8610746
3991 F20101117_AACBGU bermudez_d_Page_005thm.jpg
b344427b6a3d8f125537fb1b50d4694f
4b241c7f49426609c1bfc29e72425263d4a0c4cb
81737 F20101117_AACAEH bermudez_d_Page_039.jpg
f329b63fd9fdc15f34c7189139199b3c
6a9159b6078d0bf0d83dc34c80a2732cff0a9b57
2079 F20101117_AACADS bermudez_d_Page_071.txt
11764eb2fd767d9821cc9e5ddf72d327
00e51b26b8bc250b4b07c17656e017d1638e832f
9670 F20101117_AACBHK bermudez_d_Page_058.QC.jpg
01dc7364acd042425f2643ea6fbb9619
d6498a0ed9af40ad9a0374d024e41d855c5f6297
7493 F20101117_AACBGV bermudez_d_Page_014.QC.jpg
72b31eda6abfd49ee7c972d767504dd0
9d5fcffde1839462b44aba6d4930fab4661b6fe5
256531 F20101117_AACAEI bermudez_d_Page_014.jp2
2e4844a0ccc47ce5a0f74d827af31946
66c54f3f9340d8389c719501696f681131aae724
1051981 F20101117_AACADT bermudez_d_Page_132.jp2
90aa75a12c14d0949f4cad86d01893ce
d2ff9205c822109a48c46c7d5bd6c39896c8b6f3
3345 F20101117_AACBHL bermudez_d_Page_059thm.jpg
41fcf566a319dc0f09d50feaa99a806d
7b7e798ebab2dd5c55d88fea008fef7035a17123
F20101117_AACBGW bermudez_d_Page_017thm.jpg
b88ed45ef92320097ed22edd07a06c00
ce989b046f2e901b6a106a08b4ac138428b767d6
990 F20101117_AACAEJ bermudez_d_Page_005.txt
ba5a2545b399d2e759e5f9a45daf8c33
c268124cc09c2343a0eed4c020a47096f9ee66df
84831 F20101117_AACADU bermudez_d_Page_040.jpg
2298fcf1df9cd29a0dfe516f10f53f6c
d75fcc65305c98ec4fbbe95af1ffedb704ae8e25
26075 F20101117_AACBIA bermudez_d_Page_107.QC.jpg
6473cf31c9f6c42b239da471ee549356
2cc830d3e5f72b5b7612252deb481fb7660fa9c0
6936 F20101117_AACBHM bermudez_d_Page_062thm.jpg
c96e46c64d30b32effa99c1c92ec3bd5
780f2f542062e83ab868a354965d5ebae1883e9e
24902 F20101117_AACBGX bermudez_d_Page_018.QC.jpg
9c07352bcf64e4c4cbcb1c15df71e965
86b516e92df1fcd31351384a2b0d34914126eca5
502 F20101117_AACAEK bermudez_d_Page_087.txt
3552f567393f1ba72ff7e2e8e6888582
5ea5d5085518c6e809ab6edd4ad1ca6eb9b7c286
407 F20101117_AACADV bermudez_d_Page_103.txt
0a5e1fe534aec7e698e9f85539d0a31e
c7a60314afa257b27e558f80fd52a341e13376cc
25805 F20101117_AACBIB bermudez_d_Page_122.QC.jpg
2af9512fcd0778da15e63ca630ef8756
d0f9f2568ac4a17200b8d8dd0f1ab2c4a775b7cd
7507 F20101117_AACBHN bermudez_d_Page_064thm.jpg
e23aac8f58304ad61c9b57957bb6c19d
aa00873592b97fe65ad053e844f168b4e59ad029
6766 F20101117_AACBGY bermudez_d_Page_018thm.jpg
3f3eaa6c1fcddcceec9e4792ab2716a9
f869b1fe6d4a6cfc5335bce62f6361eaeba0d6b5
496840 F20101117_AACAEL bermudez_d_Page_044.jp2
44431cbdf747ebfdf3399a98964a190a
899e38379fe662228e3a49ac363895b45ca2e08b
1600 F20101117_AACADW bermudez_d_Page_043.txt
f3408aee0783f7ebaa05aaa74a905ccc
65888ad77e2cfe14219949a65450e67f04e59b17
29523 F20101117_AACBIC bermudez_d_Page_123.QC.jpg
d8d4b9218a7093471b5edf6202e8a9a2
b3d2874a70c55ffcec4420f558b85e66f7256fe5
6715 F20101117_AACBHO bermudez_d_Page_065thm.jpg
1f84c491522651cfdff62358e0f80676
8c86af38c331412b0d8b7c80c501d0d867db8fb7
6984 F20101117_AACBGZ bermudez_d_Page_020thm.jpg
7a7ebb93125d74804b0989c1c7dda0b1
ce8148d55d84702ca1ab5afdc44b8b37b68e5564
33060 F20101117_AACAFA bermudez_d_Page_120.QC.jpg
e8525be4a41a3a2e1dd8a2ad9e858006
9459ab4328b341afbdc667e0ac4fd4d0034a9b3c
1051938 F20101117_AACAEM bermudez_d_Page_125.jp2
6f72c0d89264a16c3e9157bc8908f6ac
b011707ed5f0c0ecec4071a8770a3860666f04e5
6553 F20101117_AACADX bermudez_d_Page_012thm.jpg
1deee210efc7390eb19600f4bae772d2
7d67c1673bb0f9604f3944550dbc18c16241ff1c
28187 F20101117_AACBID bermudez_d_Page_126.QC.jpg
5fb8fd26706e32bd950b2e8722ea4b42
7a97f711442a97b9ba2ed4d6ad690ce3a4ac4595
7201 F20101117_AACBHP bermudez_d_Page_068thm.jpg
1ef6500e06b7754ba2e7b3217e26a5e5
d4eb3cbd391b49c3ed21b9d559cf38aed105e914
1051983 F20101117_AACAFB bermudez_d_Page_055.jp2
861df3dad951288f6d89892251465c99
c30082414eea81eda9ad064077689d3ae6913db0
796898 F20101117_AACAEN bermudez_d_Page_029.jp2
46e80e1169232813c6baccbec177549d
b4c3c03c5ae5117b60d8ae55c7f7427aeb3cd0ed
8596 F20101117_AACADY bermudez_d_Page_115.pro
c0b638b2f83ac5ea34a72cb540313190
7001251123f79f086a8398911dde342e7235fef0
28463 F20101117_AACBIE bermudez_d_Page_132.QC.jpg
017d2682fe079f7b0579dae4e0b81b13
77966071dcf0dfe143898749f08e68170ddb0cee
7395 F20101117_AACBHQ bermudez_d_Page_076thm.jpg
dfebe95da244a5598d7f416e9118801f
82ea44a88f76ead48a4c582f1c06c56ea5c1efb9
7340 F20101117_AACAFC bermudez_d_Page_051thm.jpg
935792aaa120d87bf4612fefa54a22c3
c5958ea518eaf6931b6b5e3320661a3c55a5e02e
11654 F20101117_AACAEO bermudez_d_Page_087.QC.jpg
6588c34270dd88f0d92c87d05e67668d
bf382e31c9128693047f79a84483844bb54e74cd
399 F20101117_AACADZ bermudez_d_Page_083.txt
e0b8949cbf7a9465b441369511bf26ff
44b95d108aac5758f58a82dd3a37172b96e7e8dc
27931 F20101117_AACBIF bermudez_d_Page_134.QC.jpg
8b9af16553e4befcbd1fbbb18fd60119
7e421ea3e001a90af78c1ac55c6ab57de8d7f055
3798 F20101117_AACBHR bermudez_d_Page_081thm.jpg
c128159828a9e19d685b31532057d9c4
cdd0c340dd62626292abe543f849a9f894fe1340
44689 F20101117_AACAFD bermudez_d_Page_005.jpg
95d16e350bc9e6eb4734f3d7077c57e5
7883f31369cd109fdcf4f9ff02f3da88a6df8b2d
26757 F20101117_AACAEP bermudez_d_Page_108.QC.jpg
5497800c6a11c5d767735bb10c67e07d
fbf6f7979476f268f349c8ad24a6d8a1986b963a
12281 F20101117_AACAFE bermudez_d_Page_095.QC.jpg
7afe66299c4fc8a8a14b78d8f40910d4
811a487b948d2af54b98b40e98cb52969b2b449d
10339 F20101117_AACBHS bermudez_d_Page_088.QC.jpg
1cd37ef6ba434279ea260aca83340dbb
7573604f85e9e90391fcea87a11a2eccbdc1cca9
24579 F20101117_AACAFF bermudez_d_Page_005.pro
d5cd72effd90046b4e6478c372c12de8
eb027823a8c3e6dcb893335e92cc810ca670bc7b
1051958 F20101117_AACAEQ bermudez_d_Page_122.jp2
22e874130051548a5353474a563cfb7b
3cdd7cec50aeb38bb37e343bbfd2431d5dfaee89
4020 F20101117_AACBHT bermudez_d_Page_090thm.jpg
6c1bf74f0946a3a719f589368e9f9363
94d00824870bb8c6620d625d39e9d38b638a98d3
27781 F20101117_AACAER bermudez_d_Page_072.QC.jpg
af76989232fb8822dbf64d26eaaeb8ce
d64ac87252ec77dbe6a59e1d091ff0b9ad8980bf
20957 F20101117_AACAFG bermudez_d_Page_081.pro
6beadc34c3820218371f9ead2aa24804
6867f5d969b63bcbf58fea62a02d19a704fdb7e3
F20101117_AACBHU bermudez_d_Page_091thm.jpg
ed3f98c59d8f3bc726985b3f88c0ab4b
74fb3c62060d8c17aa030d441adeeb0718408e04
81605 F20101117_AACAES bermudez_d_Page_041.jpg
971ffa2acc14c01aa188c37bd1698692
4cf41e42bd4abeb6ebf0c64fea0d42072ab13484
77298 F20101117_AACAFH bermudez_d_Page_049.jpg
13db6e4bb71f592a8d44e327175e29fb
211ea37f8f17b455864484d51e992506a7f01405
11951 F20101117_AACBHV bermudez_d_Page_093.QC.jpg
87b72bf07eaa923481cb1789cd73ba5e
16bbfc4a8f9fa1d7884abdaa9f3a837cef3de73a
491 F20101117_AACAET bermudez_d_Page_044.txt
b31ad2c80e9516fd75656c55583d617c
c7f6b2867eeff3f28f62827721e62a7c37a7d291
1051973 F20101117_AACAFI bermudez_d_Page_062.jp2
541f35ebd549550da83f6f2f5fbadad0
a90bb5dcc4eec2b6e0736eaf2ccac8670493917e
3822 F20101117_AACBHW bermudez_d_Page_095thm.jpg
3453f3924e47ae8b7e4b91c8df101ae8
90b0e97304d626719845f165b7550f533a5735f2
7439 F20101117_AACAEU bermudez_d_Page_037thm.jpg
d78f742c7cfc7663b9403fb6c95012fa
ad926701c4c5397e19ad03efd12a6661df556b26
29768 F20101117_AACAFJ bermudez_d_Page_010.QC.jpg
7709632429c0ba38719e96e364c898fb
51fd485c6a479a593c7f76843161a470b57fbd31
3761 F20101117_AACBHX bermudez_d_Page_098thm.jpg
6ccea1ac6bb668997c6ff445bff5aebd
0e0776fb1ab8f8be784074b84753a5e1b321117c
16725 F20101117_AACAEV bermudez_d_Page_091.pro
4074916b8846aa4ee337c068f9523571
5541539d96bb33a4003565fab56b0b19901ecce1
400882 F20101117_AACAFK bermudez_d_Page_098.jp2
f7a94383cb85bf5bf8c1176bf0db2702
b8800dbb85d6783cb4f81b0e18b75f78f3f29628
10423 F20101117_AACBHY bermudez_d_Page_104.QC.jpg
711da095b41ab43d4b7cb522ae5c2601
34261343adc5c5bf78bc26f9f171e03b28cdb540
449109 F20101117_AACAEW bermudez_d_Page_092.jp2
daeab18112a8527a93609c8af71beca9
a914fa8749c5080fbb5314cd09006ed8b1931a70
53358 F20101117_AACAFL bermudez_d_Page_078.pro
0492531ed775dc659eda3e3c7f22525c
cc18710748d4106a8124666c5ffc272617d947e4
6552 F20101117_AACBHZ bermudez_d_Page_106thm.jpg
b574ff2d24827d0b0a7a4ceb839c7d01
8b6ed0b2106cb5a9adc239b9e434208ba671ff70
F20101117_AACAEX bermudez_d_Page_065.tif
307cb328cfee859d9b5f8c2aa557d2de
be2c87b5d4c8289f4b57065a003f1b679ba1a42a
27495 F20101117_AACAGA bermudez_d_Page_055.QC.jpg
484563306702bcbba8e756bb8ffcf357
7c0cadcf8092361c1e95932f4517742166bee770
2433 F20101117_AACAFM bermudez_d_Page_131.txt
01cf7c1c702cd2877d739dc364ff0467
751980e3ba7521b7ec0b3494f0ed244b32e1684d
F20101117_AACAEY bermudez_d_Page_112.tif
678c7fa6b5db88845beaa4c11981cf53
64c2cd2a4bfa3be4376817c8b821204ad33972e1
F20101117_AACAGB bermudez_d_Page_018.tif
01922db3a7cd6aa3a4dc08e06e5bf778
b131332cbcb21fffbb37e3b6643db95b3ed75481
9004 F20101117_AACAFN bermudez_d_Page_059.pro
9028e6273b3b19b8f65d80960123a3c9
ca71645d7be75b3f972f0afcf8c23c5979039c39
853 F20101117_AACAEZ bermudez_d_Page_111.txt
efece90b9ed4be6a7c873327d244ec3a
beaa71d136847cc904c88b0a1d1e6525b6b575cf
327081 F20101117_AACAGC bermudez_d_Page_104.jp2
57dce07b166b4840e554675f60f680fa
d1c3a2775aa479d4d9ee9973d9361a9aa29e1da6
41199 F20101117_AACAFO bermudez_d_Page_031.jpg
22b45572275dad695fabf48cd53e3075
856b50c48d4e70e6d343c373861a43d6a8c0bea2
44952 F20101117_AACAGD bermudez_d_Page_114.jpg
a282d6cd146b542bf1f3f1a492e9ede4
b95ed49e03cbbe6852aee4eb6282c9ecb8824554
17270 F20101117_AACAFP bermudez_d_Page_057.QC.jpg
cce1ca021012cee5a906f894fb630ad5
e375e8a9b46b73506231680de2d33eb6eeaebb8a
28346 F20101117_AACAGE bermudez_d_Page_001.jpg
a031fc3cef39198ec49b787c8198b6fc
e36cef59d72c16d30f434940a52f57cc75eae08d
F20101117_AACAFQ bermudez_d_Page_129.tif
0561e2d26f002528725f86db1076d10b
4a18116805f472ba4b94c5f2accdbaf8bd984993
2407 F20101117_AACAGF bermudez_d_Page_124.txt
de8e6bf794600b6281fd90aa9cd3a766
319607b4b6d380af146ac691da736099c8c329ae
3699 F20101117_AACAGG bermudez_d_Page_087thm.jpg
979145ecb03f076e899c7707652fd386
25bfcc3422cff22eb750d34edec0d2bc074aa4a6
1144 F20101117_AACAFR bermudez_d_Page_002.pro
fa64262e48daa54c6cb5be70b4f13967
351c791b9bdd2deaeb73f35b15f8cd3b4cafd67e
2105 F20101117_AACAGH bermudez_d_Page_037.txt
9dc4b3d4b10310c5f7c8a0e83404409e
c9413a945752aff525d9da5b9a593131d1fd5d6f
6968 F20101117_AACAFS bermudez_d_Page_073thm.jpg
2fbcffd22e17b513d4c427f596ebb00b
9421f6a55b8d6906ac27f73d1000c8b2133a820a
24673 F20101117_AACAGI bermudez_d_Page_080.QC.jpg
4d4ed04f43a319d1fd902a006b4a589a
dabdd3c7a596af8e600993f01bade56ae91b86ce
2158 F20101117_AACAFT bermudez_d_Page_023.txt
9d17bb4909482090d6295b7e56de09c6
ee817934bef08be8bf26229cf22250f42fc92d00
906151 F20101117_AACAGJ bermudez_d_Page_043.jp2
2df36545f335822a830ebb2c50a9551d
644d6f8766ecbc94fbbf7f8e481072426623d32b
8404 F20101117_AACAFU bermudez_d_Page_001.QC.jpg
069d231ad29023f33ee55895c7fabdad
a63dd1e3e85f6a239c603d5272e422272a0e5cce
1206 F20101117_AACAGK bermudez_d_Page_047.txt
136f5a388112c174c95b1618e471fa4b
217bf5e4d0347c4ec2fa084bb9512632b1ffe949
2088 F20101117_AACAFV bermudez_d_Page_035.txt
97af17cfa82ef748a9b759cf04b4801d
769b562b65d00a9494d23ea73933f2063aa0298b
84635 F20101117_AACAGL bermudez_d_Page_034.jpg
9eac9d9b01b93f7dd54d97fd9d81f90e
3a4702fc49406f00b7a949cbd90da2a17b6fb2a8
1051871 F20101117_AACAFW bermudez_d_Page_057.jp2
ed238e37ef7caf1e05e3aba994a99d47
50201196cfde227056dcb18f4cb3e493359f4688
F20101117_AACAHA bermudez_d_Page_059.tif
8e7b48114526729a067c464ac2fcb897
b4d31763d02d476db6cc468a9ce50e1e46ddf16e
28245 F20101117_AACAGM bermudez_d_Page_025.QC.jpg
a9b9fa6d012a689297410306b51dd884
3ed8af2715e288b27bf960b19db1beede33cef0a
465 F20101117_AACAFX bermudez_d_Page_014.txt
1b2026cb37305045efd90504cd49ce36
17592236ae1ecef62e3f143f16b872a60a84b353
1051980 F20101117_AACAHB bermudez_d_Page_010.jp2
a1abb3d9f40f9555f72ae9a279352727
ccec4d202dc6616adf307d657c7ec22dfc0cc53e
568 F20101117_AACAGN bermudez_d_Page_100.txt
d61f038ab6831cbb0aecc797581702c1
6c3dbf8ac25b76e6d099b2eaa2567c83599928ed
49191 F20101117_AACAFY bermudez_d_Page_015.pro
e281b74548c01b1020bd5909b79caf53
8bf7aec58f22bfca402a6f6adedcc172a60a08c9
4839 F20101117_AACAHC bermudez_d_Page_110thm.jpg
88a4875d902528ff736e18d8019d8b68
1409de452bdf87444c9e9cae9e0dbeb6b5f38ce6
7567 F20101117_AACAGO bermudez_d_Page_071thm.jpg
496dc00cf0127d2e503e493cfb1d18c7
11ed841d908bb4c8006b3c27ba7f9c5c1f16c498
F20101117_AACAFZ bermudez_d_Page_055.tif
79ea18a9698e8c989a67d5df0fde2685
7e3805fb1fadf12fd4106797f4ea0570b338bf1f
56963 F20101117_AACAHD bermudez_d_Page_042.pro
897ca23b8068e6fbbec84df6b770c0bd
197d1c288092289c824999567c2749a78e5c5835
F20101117_AACAGP bermudez_d_Page_076.tif
b39df36492625b5856d33a499bd328d9
f73bdd6853d4e87bc0292c851336c623eeab5bd9
F20101117_AACAHE bermudez_d_Page_132thm.jpg
98c04703515d0dc6f02a27f5048166b0
3da40429983833c4960a0d4f13d6e59d5fa74d89
82220 F20101117_AACAGQ bermudez_d_Page_013.jpg
dc7db30ca948160b0759e03731490b52
13340b6c83c398330109388fa9928674ec74e348
421 F20101117_AACAHF bermudez_d_Page_115.txt
ac10450e5f8fb8c89cd55f39d7010a16
1961ae8bf78730fa9ed007bdcb33f06ba4050950
616 F20101117_AACAGR bermudez_d_Page_045.txt
b78efb34a4136c11f997cbff0ff10a7c
a5a50e08e3ddc58f670348dc99751521895daf02
14720 F20101117_AACAHG bermudez_d_Page_115.QC.jpg
048b093169a2800cf6bf455e0ac82919
02e3e3bce381b4be7df131881205bce9758a314f
81490 F20101117_AACAHH bermudez_d_Page_020.jpg
7ee87461c9eb6caa0d96f9dcdfb47c92
a8e9e6610280402942c48695bfa318e775282815
87487 F20101117_AACAGS bermudez_d_Page_022.jpg
a7ee42ed22a8073e8e8f83f87970dabe
3e1cf1601d6de5b9ab5165c3319f3413c9eb5d05
2313 F20101117_AACAHI bermudez_d_Page_122.txt
ea6e3e01869f7e890e7f803109024c84
80c44040eccf311a939477379d3d4b4c5ff898f9
71353 F20101117_AACAGT bermudez_d_Page_118.jpg
6a688f3ed9df5159b79a98828c228193
fa3572bb674dd0dcdb3ce47f57c41d0c322f3977
72230 F20101117_AACAHJ bermudez_d_Page_128.pro
82337e3f956901f032ea3c06e50044b2
fc41901b027d91cfa862ba2d1531a762fd2298a0
17472 F20101117_AACAGU bermudez_d_Page_046.QC.jpg
08e76120a4f22bed1d89bebb817135bf
9447c0c838f4c7934d49c80429441fc377ecadcb
1983 F20101117_AACAHK bermudez_d_Page_067.txt
e106ff25d829a6b116101a6e731b2d2c
bdccde563ba601a75be27a277ef0655654e9f531
4383 F20101117_AACAGV bermudez_d_Page_003.pro
61357cd566f8a1bd26ff14f461134c93
1805685aeb71ca6e6fb5b6b39cd905007a3c7487
915 F20101117_AACAHL bermudez_d_Page_094.txt
e71035d4ddec05f169aecaf01831d50a
6b71a6794204cd6c4ee6538f8c2b3a07618ab623
787 F20101117_AACAGW bermudez_d_Page_097.txt
6f28eabc5f46b05d9ebc15461c91424d
4dfaf91cc3500781e3d518a66c22a426eb7b1779
54712 F20101117_AACAHM bermudez_d_Page_072.pro
15d69aa6c9370aab3aa3997de3760624
86f93b7431ba52f22b604194b205827ae6082848
14528 F20101117_AACAGX bermudez_d_Page_114.QC.jpg
e691edc022788cb6d049de261cba3b5d
fa39faeed3140c17d22d30e4d443553a210268cc
89309 F20101117_AACAIA bermudez_d_Page_072.jpg
df1e2d61cc99f344b55621bda2a485af
c6f37636c3dc13d872a9ac9375c8aaa3ac8372b8
17612 F20101117_AACAHN bermudez_d_Page_111.pro
9e7ce88af024cd40aeeb8465d8bcad33
841195fec9c2f2b74c385cacd67f106cfe7dc0fa
2171 F20101117_AACAGY bermudez_d_Page_050.txt
3cc4d9fd8d932bf937564c53f12f3db2
d4779dc4b746bdd62d4e7eda36c833c882e747d4
1051967 F20101117_AACAIB bermudez_d_Page_119.jp2
bc45d2676b42d0afa9ad59ae98ef5d67
c37f7849a6640bb47271e5a1e1c78370f85d73cd
F20101117_AACAHO bermudez_d_Page_006.jp2
c3ea527ee079383e346f41b65a6a01ac
a2a030c01706ad651106fdfb0272c61cda45b870
83480 F20101117_AACAGZ bermudez_d_Page_107.jpg
e6080cd831a54cd9e174994572760d0b
2fcce9483eea7cd651c5b86f61fce1c271376ba0
307902 F20101117_AACAIC bermudez_d_Page_056.jp2
f169a065f3b33b4c50dd670df9083bd7
5015219d53ac0a628a77167df82d0a416715070f
F20101117_AACAHP bermudez_d_Page_022.txt
7fe7f4859b1751f149e3cd607503c468
4873ad5e78945eb43d91abe74b894d89eee69a04
68166 F20101117_AACAID bermudez_d_Page_006.pro
ce184e2c5250828338346f90127f31d6
826f699e07ba90c4f3ec884d3f9ff3264306672e
1051976 F20101117_AACAHQ bermudez_d_Page_130.jp2
dcf70b33f1262b9f5f77103ec6ccfdd9
7e793424273da88b73ec617132c533b2410a966b
F20101117_AACAIE bermudez_d_Page_026.tif
f9bf27a69d5c6f42a72873beda420a10
6e899f78b30ca274ff343fa328bebba5dadfe38f
1778 F20101117_AACAHR bermudez_d_Page_120.txt
5ed39717fc8ce037ef2f14b303acdfd1
5d70b80667fb8a0908573586a137bd2642654c88
79635 F20101117_AACAIF bermudez_d_Page_017.jpg
a82def150f073cada66eb8e10172091c
6aa61dfefdb3427d64c94d0439441b258f240f24
F20101117_AACAHS bermudez_d_Page_071.jp2
7cf24c091a98de1e158cc2db79b37d2d
580221bcab962cbf9a1c5c257c0476e45e4c102b
57772 F20101117_AACAIG bermudez_d_Page_063.pro
ba714c71060ef0b6d3eab38152d3f50d
6316244afad048c9c74c5194c1b5ee9524efc02d
F20101117_AACAIH bermudez_d_Page_052.tif
7ee9acc5fc0cde26f59906676c29e9c0
e68c6edcfbef385a68da24f88421c72267e90562
7475 F20101117_AACAHT bermudez_d_Page_055thm.jpg
e26ba06879d19364fde4ff0c20116e8d
529a7a2e77d6845d605ce668ee4ae9e5ba1d4290
F20101117_AACAII bermudez_d_Page_133.tif
b684fe37a8fa1c79e41f74cb2f50ad48
a9d5df2ee9ede02cacaf59681385c34fac6c5966
13345 F20101117_AACAHU bermudez_d_Page_044.QC.jpg
96a87ee6a1ad1e468aa6c15fe9bb0f73
a866701aad559da14ac90fa198988017d5edea1d
5111 F20101117_AACAIJ bermudez_d_Page_133.pro
262e2690eaccdd3cd235e140b6bb5738
a4fc5e9dbff4f2d3be58392f7ec26bb8f70456d3
F20101117_AACAHV bermudez_d_Page_123.tif
7b0573433a8ab29d1defb0eda443fb9f
37442d4f0feb51a9b5ab2958aa56b06e724d4477
F20101117_AACAIK bermudez_d_Page_033.jp2
f0106a9d746e37bfc01beb904591b066
fda94246f11bc1950f734c1ed7c4058511148e43
28600 F20101117_AACAHW bermudez_d_Page_063.QC.jpg
d3e03055a0803fbc40a50d9059f88abb
e97dbb5c723271b9881ccb723405de671461f2fc
27123 F20101117_AACAIL bermudez_d_Page_076.QC.jpg
3338b8ce31693575cfb01fef16dfbf7a
44f95ab1eb9df94002030aec282df82e496919c8
27914 F20101117_AACAHX bermudez_d_Page_021.QC.jpg
3b3b933f3cdc3a44c86add7b84b325c5
8ac1bc8d057796d51e0ce7df662ced6fd9048df3
7824 F20101117_AACAJA bermudez_d_Page_128thm.jpg
ec6e9fea86c5ba77df843fd3f52e70d6
cef95e30cca3f434fc5caeccb351781fe595b2ee
343906 F20101117_AACAIM bermudez_d_Page_008.jp2
0faf66d6f816a1f09e46b76fdbfa92c7
524065d1b8e73eb6dda4b45846cbf448190c1895
10530 F20101117_AACAHY bermudez_d_Page_002.jpg
7c3179a962b0d9b885608180325d713c
ce7aeef69e16ef31791054348632c1b893ea7167
10275 F20101117_AACAJB bermudez_d_Page_103.QC.jpg
a2c62179c1269ac458f661951e11d8cc
2ad85fe8c8b6bb386d4bdea0633590b4de2f810f
16017 F20101117_AACAIN bermudez_d_Page_096.pro
3900ea9e493f6d3a0f8616fdaa2aee92
9f5211555b49095a78f889d75988bb7ddc329345
22251 F20101117_AACAHZ bermudez_d_Page_006.QC.jpg
571c4268814f9efa9bf13a4999b90c1f
bfb0a0ac5a6d3ea35b6cf0ca9d84e9a2cece9dc7
48108 F20101117_AACAJC bermudez_d_Page_049.pro
d60e3264a163ce268380a21e92a41a9e
4a564baafd53a51051cd7efee742592194de5fa7
328864 F20101117_AACAIO bermudez_d_Page_101.jp2
afd7bb559ae8b58035fc004a532d5922
b9027074d7b4298cbfb1f432882ac45f120318ae
F20101117_AACAJD bermudez_d_Page_032.tif
a33d6b546ad4fa7bb6d6890f1371deb1
50f8b99125ed546e3b5a89021737a67c8f71ac11
23019 F20101117_AACAIP bermudez_d_Page_075.QC.jpg
a3b462da51a8e481cb3e26739d901994
8a87c3e2418558e0ebc2b9f9d3cedc4e2439b090
F20101117_AACAJE bermudez_d_Page_034.tif
ee3c9d2eb54aa7a84b871d37d99dd017
0b29873e7b20f957a6408ae50bc10145a7168f2e
7435 F20101117_AACAIQ bermudez_d_Page_010thm.jpg
573ce80f79e3f78c6a9beb36ee47a1bd
0adb59fd2af2f0df02671d311211d47ce1f3bbf2
157801 F20101117_AACAJF UFE0021752_00001.mets
76f36871b5720eeadea5e4361131d8b9
e9e286ec64c885427abd80f0f771a29816db7a81
7157 F20101117_AACAIR bermudez_d_Page_034thm.jpg
25a9744cb381c45cfcb0ff6f60612463
4c845ea8e89b63dad60bd55935bfe5d8162379d5
F20101117_AACAIS bermudez_d_Page_107.jp2
800d11565f12a6454c5d6873048c7fd6
49da3cabcc8dd79e88949214256a62b98cb0453f
112842 F20101117_AACAIT bermudez_d_Page_125.jpg
da7e681603e3f03ada0d2895ded2409b
129d3445fe9b95b83fe8f185bb7b0dedec004523
15532 F20101117_AACAJI bermudez_d_Page_003.jpg
99d3ec74e79ee6e0f014013cb73c30a1
308da38eb64aecb04235825aad53441306d8e2a4
86150 F20101117_AACAJJ bermudez_d_Page_004.jpg
85bb524ad4d9cc1235491017e6886a8f
fa7c3b454fc1d2d566880e5d01eaae049c3d0e1a
50879 F20101117_AACAIU bermudez_d_Page_012.pro
f55be933ca77bbbbdf44a1a8cf0aa01d
6d18ad53ae2b4c85dcabfcb698ad0d804df94c03
91619 F20101117_AACAJK bermudez_d_Page_007.jpg
4567f01a1542dc0725ddf043bd38bec8
554f1b83d42654959bac0cd39f85d78fd384d94c
564313 F20101117_AACAIV bermudez_d_Page_115.jp2
11efb8e38d2e7cd1e5c730d992a296bb
e44a3de48744f75facb88274f41ecad18321ebca
20161 F20101117_AACAJL bermudez_d_Page_008.jpg
06561cb743db6ff058e1f88016950611
1f66e0e361031960d815216fdfa0c75d15da2346
F20101117_AACAIW bermudez_d_Page_035.tif
f277e0918a9eff95f5b18defddee977b
99892e5926f45faa96ae1730769db9ab39898fd5
84109 F20101117_AACAKA bermudez_d_Page_035.jpg
92246034820fab3980a0e01e91e3833e
f88b887b03f9c977fdf404775e394db9f859abfe
95862 F20101117_AACAJM bermudez_d_Page_009.jpg
99878684651b1b458bbbdbc3cadac3d5
ea9f07e8d6773e581c981d4312b327ac109eb383
86631 F20101117_AACAIX bermudez_d_Page_024.jpg
6a254083d60b2e1fb4c3abf1337651bd
f3a4b7a6be12fa95c734a2ea1d048e1072cbe122
80306 F20101117_AACAKB bermudez_d_Page_036.jpg
8ab461f0e71cb2c4544f016e7f5e48e1
75a0d9e7b69077082b5c5d8c8d00b0ff113b05bf
111239 F20101117_AACAJN bermudez_d_Page_010.jpg
10bed1ec075121cab54d025e8d47833e
308fb347ad2a6287114a48600b4f7470351742e0
F20101117_AACAIY bermudez_d_Page_130thm.jpg
2374a392ed68f7d3740a801f779f366f
6d9327c115f74760158b513fc6fa9f6683df46d4
84624 F20101117_AACAKC bermudez_d_Page_037.jpg
9f216c41c46102f7ff1aefbba1d19a11
bea446518ddcd904194d05f74d360755a3c40c57
82508 F20101117_AACAJO bermudez_d_Page_012.jpg
491b6f14fac949b508241e79dd7747a5
e545ecb667ee430eeef37e58d88aecc7c69afa2e
49669 F20101117_AACAIZ bermudez_d_Page_030.jpg
cd2681cfb09af492593428f6707d169e
bf8f820630a934d3b81ead9184e7892ddf3ad14e
23821 F20101117_AACAJP bermudez_d_Page_014.jpg
f852b72c1d0f0daad62cd6a7ba3237e6
d5cbc46f5b67897c87272bd9992b4761aed7b0e8
86461 F20101117_AACAKD bermudez_d_Page_038.jpg
2081aed4f19c0c3308ad531d73f5d1a4
4e57eee72ba4e624db75a381094dfcd45c65bd55
82643 F20101117_AACAJQ bermudez_d_Page_015.jpg
c39cc8facd2fd6b382d90f6b6b7a9747
1a1776b9e10c9266afca7f325613e15f63264338
89621 F20101117_AACAKE bermudez_d_Page_042.jpg
071f2f3c7f97a44d5c1baec49c15f1b7
0d60540b4e7d0b8977ee360b3721e7f97087745f
15118 F20101117_AACAJR bermudez_d_Page_016.jpg
7a198441d47127bc115a6d8934a108eb
f363b1bf76e5a366c5c89a168c107491797c1806
66093 F20101117_AACAKF bermudez_d_Page_043.jpg
be65c2999badde97cd74266258311018
cc9d8b3a9df7f870cf6ec9956918c62cf7e352c8
78623 F20101117_AACAJS bermudez_d_Page_018.jpg
e1aac4d1bb1bddbb526863a52e13c187
b31374e143dd6b0253fd6cf9a0677fa95a00c524
42588 F20101117_AACAKG bermudez_d_Page_044.jpg
3a27d36ce55a6a4cccfb7ecd2cdb119d
93c92d6710b7bd26446ff5ff29d742232430b377
88134 F20101117_AACAJT bermudez_d_Page_019.jpg
2f8b2f2de8b5e96ffaa967a616d40996
271e1fd41f3a4200d0dd0d7c37e3f89b9aaf4ac3
40930 F20101117_AACAKH bermudez_d_Page_045.jpg
254c4c949fb078a937e7d0162e537fec
e5ca152d53398470da0214267d2745fd7d0c83ba
88069 F20101117_AACAJU bermudez_d_Page_021.jpg
62fad3d0ea8fc9d95f806375d793bc73
5edce56be11fa1552b92c7ba207c261aff143acd
57583 F20101117_AACAKI bermudez_d_Page_046.jpg
6dbb16464c819be7b228044ab8d9ec5b
b0ddbf9de24d34323b6c66ce07cf72cb3e29d04d
57628 F20101117_AACAKJ bermudez_d_Page_047.jpg
5c65616db9ecdfcba733a506a1f1d344
b97af453b741e6b31ec000d3af81dac86c94b51b
83239 F20101117_AACAJV bermudez_d_Page_023.jpg
efbf6bcedfc02bf587f38dc6e2fa7d48
defacdb98add9956433a8181408265dbcc512e15
84836 F20101117_AACAKK bermudez_d_Page_048.jpg
34812973a3548a067ea088119954f135
9b193203ff3b30d433b0cbf1d585a84564bbd776
88485 F20101117_AACAJW bermudez_d_Page_025.jpg
bbcfac651a0c4f2cd47bdaff5d260b9e
2a53a92aa2c31200810d36ad5551c39d2f689d73
87576 F20101117_AACAKL bermudez_d_Page_050.jpg
a2323158af4280345bdb5c6c69d4259e
3d2e98b43f1655613788c8c8f32cf1831e362f27
58970 F20101117_AACAJX bermudez_d_Page_029.jpg
994018bf8ad3964ec6adcb0f0bf883bc
25843746aa7d3212446c44c5042d1355f7fde3d3
80093 F20101117_AACALA bermudez_d_Page_073.jpg
551456007f693668fa69842295aa3dac
9bc1e359493c15b7e486788b4ca3f9b251fde410
85724 F20101117_AACAKM bermudez_d_Page_055.jpg
600cd4cef0d0993588150d650b7ab3b4
0dcff221722c6f9305ffee698dfb81908d5554ab
41542 F20101117_AACAJY bermudez_d_Page_032.jpg
626295aa091e50695960bbd2c2212ed8
bf9fb80afc81ec6ff79db928105fb60d90bfee0e
85348 F20101117_AACALB bermudez_d_Page_074.jpg
3d43d626e1cad5ed43f4728b6cf649f2
fe8ca431c9f317dc29814e9082194c31b82a71d4
27391 F20101117_AACAKN bermudez_d_Page_056.jpg
791e1278d4b31a7f8085e3dbbfe039fd
3de1c32ee49c145e53ff66b576a2ed791de82ed4
87059 F20101117_AACAJZ bermudez_d_Page_033.jpg
575f977bdc675602485d1c36f49c4f77
0a7d0d8e66ed02e4f51d224948be5a5bf0400a73
72487 F20101117_AACALC bermudez_d_Page_075.jpg
0df3ec8c56a59fa753ba6f5aada9b4ff
6f60a07c606aa7e790c9f9c02d347ef9a6d73bef
30363 F20101117_AACAKO bermudez_d_Page_058.jpg
a20bfe886450a438cbac4fd349f3a9db
da22716c4e1dbe669cd4620de30a46d0e4d26115
84855 F20101117_AACALD bermudez_d_Page_077.jpg
8c98734313fa49d44ca955fa9d38caf4
5f504c846513a5d7ab4b8b99e17db3ff53a52277
30993 F20101117_AACAKP bermudez_d_Page_059.jpg
8086c9361a753f27a48a41fd914569ab
488decc7a91bb1d2ec28149e951ba700c4a5d465
84646 F20101117_AACALE bermudez_d_Page_078.jpg
97c86a32c75970c17f54e01884a27912
5a7dd9a81eed320a9ab17d4e6f04738baeae85fb
82630 F20101117_AACAKQ bermudez_d_Page_062.jpg
5f218a30d767a7b67d2680fc4ba4dd0e
07176fa643c47f0ba77d04a527bbd4555e5a593b
75617 F20101117_AACALF bermudez_d_Page_080.jpg
16dc06bd57ed1045b96c2d39ac83ca1e
dc16df3301618bc2be6e448c6ce5ff111937bc33
90376 F20101117_AACAKR bermudez_d_Page_063.jpg
8a5ea2fe821d6735bea795eee05a8519
5d43e2e6ed8a01bc3227407b71f4f344fa2e54d3
39791 F20101117_AACALG bermudez_d_Page_081.jpg
cca3e75738a46a7655d4447f2b7b07ff
0f565a976639a95090bb261e972271bfc3a5405c
89105 F20101117_AACAKS bermudez_d_Page_064.jpg
179b30d8fcdfa9c8790ff974faaa5175
506511d8102d34325de10dfa8f90b6dced51952b
89474 F20101117_AACALH bermudez_d_Page_082.jpg
304ad89505c8ee6ac5e2b868db07234e
4f87e8f24962b1d28fb7d4b3aedb01840ecab2dd
74580 F20101117_AACAKT bermudez_d_Page_065.jpg
8c2f683157e495ea69b2ade853f33ecb
fb3340bc652c0952a73c1c3ab4858d07fcec6e75
58541 F20101117_AACALI bermudez_d_Page_083.jpg
dae87f2d1219ad59f59bfccf278bb760
2a498945798a723ad9d2c6055ea82d77f0035b71
78856 F20101117_AACAKU bermudez_d_Page_066.jpg
30750097e48dbee9e8cf503c7f9ca419
ffeb5f55d4d503ecc00e5fd99560ac2828b1d7ae
57898 F20101117_AACALJ bermudez_d_Page_084.jpg
a48c9578109089a26f6a5d9dd1406082
758ab348e5983c9be0ca3c1f1a9514dc2a35ba3e
79280 F20101117_AACAKV bermudez_d_Page_067.jpg
d0356e2ffbab2fd8188119b1e883fc14
ab74a26da9880be6f76ee1ac2b487dbdb848b73f
41831 F20101117_AACALK bermudez_d_Page_085.jpg
ff6d35cf75e2c5b58032313922ae4336
96f7919f5361f6b84266a286ff055275c7506c28
38211 F20101117_AACALL bermudez_d_Page_086.jpg
8442a057be0f89ffc64f77cb9ca737d0
777114280b2726f1e9e2fd873fbb183b49b62a96
81722 F20101117_AACAKW bermudez_d_Page_068.jpg
b8383b02ee560324f9ec91ce22fc8daa
be5941c372bd14f2d8fe4899b141b080cebb3b37
80167 F20101117_AACAMA bermudez_d_Page_109.jpg
0acdcfce0a0144a3321d0a4eddecfcc5
8cd42d1ddbbbd8bfba03744630fbbace0c23ea73
32089 F20101117_AACALM bermudez_d_Page_088.jpg
98735ae07ef1539bf3a70005d76d12ea
f337dce23b0ab1b02dc0a346196b49224d5bfce6
86393 F20101117_AACAKX bermudez_d_Page_069.jpg
02cb5f3e2744b4964d32367e5cc2fac3
72db1f659f0870be28b771e9a02f7f57f28f59ad
69926 F20101117_AACAMB bermudez_d_Page_111.jpg
13f8180fba2172a3f7452fdc9806d530
9137ab8b250261bf136a306d59faf9bcfcb42565
43330 F20101117_AACALN bermudez_d_Page_089.jpg
349a5adc80cc6af5feea78475663acc6
38b8ee632c221ee46e445500f3870ba8b039016a
82858 F20101117_AACAKY bermudez_d_Page_070.jpg
73f28e05067ef0dd7ebd67dcb8715c9e
edfc7a24a8312bc48534a2e457941f9bfe7e9941
41779 F20101117_AACAMC bermudez_d_Page_112.jpg
37f0aa75418aa2b396a754473fcd92c5
13424eb965b64d1a31f471b4faeddabbc06bde29
39025 F20101117_AACALO bermudez_d_Page_090.jpg
d2030a2b6c9ee960fbd0e05d19668441
f36a7e831b9688731e392abd510074d28095d14c
87599 F20101117_AACAKZ bermudez_d_Page_071.jpg
6f0a34cc7ee9e9fcd1764f99a980e5f7
24f2634cc61a3c2510c246c43073f21e1f8b8e50
38894 F20101117_AACAMD bermudez_d_Page_113.jpg
40dc145a6a344edd67b195189c2099a9
d85c335de777dcbb8fd8870dbb93e4e645c4f673
40783 F20101117_AACALP bermudez_d_Page_091.jpg
694e037a5df0e44f3626f564278bba9d
cedaf8d173ca4653c44481e50e2a34e5cd2d81c8
44295 F20101117_AACAME bermudez_d_Page_115.jpg
4dd559977c798a161b754ddbfc27f821
04fb06a1711196e3e0ec80b42907ef41a10857ad
41435 F20101117_AACALQ bermudez_d_Page_092.jpg
45e0cff05e9f8b638a24db9d1f4fd65a
18f0d068b58fdedff6c45919b4fa0cea345fec55
64259 F20101117_AACAMF bermudez_d_Page_116.jpg
a29fb134af6d36001c5f333f1798e2e9
f42918eea28da0f51e21c515e474d9075d7d2840
41936 F20101117_AACALR bermudez_d_Page_094.jpg
39a11345bd1864c0fd475f5e22cb0921
6a64ccf3fb065f36890f68d380b4d0fae7599086
35066 F20101117_AACAMG bermudez_d_Page_117.jpg
510d0a4840968cb6f85c464c04d75d5f
732161450ef390a2fac4c2d85b6c6c3c31bc7899
39698 F20101117_AACALS bermudez_d_Page_095.jpg
d5592c8ad64f27d6b7d7b85ee2677d7b
9b68ff7535c006df6469c18f3980c5f054a50daf
130958 F20101117_AACAMH bermudez_d_Page_120.jpg
3fb5a73ca2667b2cc10d1056a926a313
a06318832efd440204bf441717fa2040f2daf70b
34101 F20101117_AACALT bermudez_d_Page_100.jpg
683436e156327171617ef2f0d67a8974
ec78cf6b794a93494cf930e753e2936a0c0c658a
92496 F20101117_AACAMI bermudez_d_Page_121.jpg
e3284c968b0438a332ad4eb7390021fe
da610c5c7adbe4c5d886d1795905973beeb57825
31774 F20101117_AACALU bermudez_d_Page_101.jpg
a652de5854e3fe9e75ab154959786b6e
8b1e6551678e0b33d714c58d6b48b00f7e7aae1e
97466 F20101117_AACAMJ bermudez_d_Page_122.jpg
5a3dd6217be6d3fbda42b429aaa00149
054346241f0e05688b3901f90fa76438b9a9ac44
33024 F20101117_AACALV bermudez_d_Page_102.jpg
9eb83837a3aee696751992c4ac894e62
ee598a34905e20dbab7abc42afa4d58d0f06625f
105332 F20101117_AACAMK bermudez_d_Page_123.jpg
77d55a7616e2746547a4525f298c2f74
e149ffb17afcb8bc9ab671ac11c6c6f1bc412868
33838 F20101117_AACALW bermudez_d_Page_103.jpg
fb6eae946ed75577906358d5f3bc49c9
edee7ddccd73968a7a2d22c0b83be335981eb02b
93718 F20101117_AACAML bermudez_d_Page_124.jpg
327c078d72ee160869139f09d3ba033a
55890ae596d27ce154bd977e28a85deeb8469596
107255 F20101117_AACAMM bermudez_d_Page_127.jpg
b9544d316aa43a3fe702c9c5fe42b7cc
7be446059e5dc1c3e437e578a85fa39eadd6f6f3
31272 F20101117_AACALX bermudez_d_Page_105.jpg
5230b8abbf8c5a4828de3dde628cccd1
6472fb32062e376774e89c9ea9d3e658e6b2e7ed
F20101117_AACANA bermudez_d_Page_012.jp2
71096f505b1a927a851fc56d0959ef5c
5e116f760ea282d268f04a46b64a44b7a346fe9b
102321 F20101117_AACAMN bermudez_d_Page_129.jpg
a378c26c5f8acb3908c185dfccaa9815
072c5b7de00645241b70010fdf6ce02206dd1d16
80500 F20101117_AACALY bermudez_d_Page_106.jpg
0766ff8557cdc0bd5daf9c1c7db83778
d6caf6a0c1175858db67e87dfda39ade36287287
F20101117_AACANB bermudez_d_Page_013.jp2
fd88aaa0e52ffa54df2d5c16b86a19fa
19b165cf1dc5c3a0c6059b37c9eb23290726871a
102853 F20101117_AACAMO bermudez_d_Page_130.jpg
f82b97274d706db6b66df116cbcc0717
d5280b2a8594a54028400473129e177d049e6b85
85978 F20101117_AACALZ bermudez_d_Page_108.jpg
e1b35c517d24f8df158937ca4443ab11
05760f0fd8a697802477e139d689b68cdade5cb1
1051952 F20101117_AACANC bermudez_d_Page_015.jp2
28d277483319dab85d49d0074e863cd8
c280ff2925acf5fba40e16e6f1e20969de134370
103934 F20101117_AACAMP bermudez_d_Page_132.jpg
13a7f716825ea0b029bc9d7f3beb4fc4
07f755a58f50c827f4c5950907a2b48229a061d7
108247 F20101117_AACAND bermudez_d_Page_016.jp2
da4ac4b2687cefc75985a4ca19472a12
02a93d7d497ebac08cc5af0f5ceb1cdc3bb23d73
16051 F20101117_AACAMQ bermudez_d_Page_133.jpg
9d482d4da7c90b0715d33f066f444321
d1629e9e468e6cfbced11c44f424f0d97c698758
1051956 F20101117_AACANE bermudez_d_Page_017.jp2
2c07029841eed594b3c843e1c3fabe10
f8e990fef99abbdef886dae1bfb00d7125fbfd86
89042 F20101117_AACAMR bermudez_d_Page_134.jpg
bc301e7ae35476ef59dc98953f7d56dc
ee8ec93e45a6e6c8a8f749300f6fc26af3f7e99e
F20101117_AACANF bermudez_d_Page_018.jp2
768a114ce7f3364a8f6a304674ab52e9
fa0818343e8dc9925a0407f48fc111126fe877bd
19329 F20101117_AACAMS bermudez_d_Page_135.jpg
3dbea86908de3f598090dd1dc146c3b8
ce29de12eebd032e371556ab9d9b113dd4c9d793
F20101117_AACANG bermudez_d_Page_019.jp2
5cc20f50dc5b2e972b484da24c6d4b9c
29c4abe5a6bf74f9e34d825216fddb8d23d4b7ef
302663 F20101117_AACAMT bermudez_d_Page_001.jp2
172d0ccdbe6ac92d4d270a9eba611c3c
429285290fec7abf789da89e7fd6a1a561047afb
1051986 F20101117_AACANH bermudez_d_Page_021.jp2
7952be548016380546f99d92c9c0dfcc
e0936938bb7bd09592fbca00e3b3a28f05827b04
33760 F20101117_AACAMU bermudez_d_Page_002.jp2
9984c0484e7b91426f90c0d446a9e7bc
30f0e378f7ea1f286352e0cc9a823035a81f3a75
1051985 F20101117_AACANI bermudez_d_Page_022.jp2
d29083b1066d5738368e9f22b5e21f95
15c8678f7d59b5c50392c8ea42433b28fd507ad4
F20101117_AACAMV bermudez_d_Page_004.jp2
99a3e685949f6c78204ef3f353d8788f
8b83bf37eb7386c15e52cde9cc51ac2a82e7a504
F20101117_AACANJ bermudez_d_Page_023.jp2
b2789ccc405afd779e3368671e8c382a
900f39fc0b9f1d58321f1e363d3c071b5b65f2e5
564908 F20101117_AACAMW bermudez_d_Page_005.jp2
307513f7cd04f959084a39be409a5721
73356e50a8277f576cfc2d8e62519885e821d151
1051914 F20101117_AACANK bermudez_d_Page_025.jp2
18f112c7dfee8295c709b52e3ec67103
4fa27eb2b1bae26133890f9b2133ae497dcd1a05
F20101117_AACAMX bermudez_d_Page_007.jp2
4c07ab64975697e375f97e49e454b1f9
50b1242871f297667476c56495c9f0635fd55a19
F20101117_AACANL bermudez_d_Page_026.jp2
60cc7ddc3acf6986d75df2e0af86f5f8
e8c8c60f87fe19f78cf7b48a75eae495663881d7
F20101117_AACAOA bermudez_d_Page_050.jp2
07d0aba5db2cbfd1b2634e9c96333366
3bc67f1d70e71f596ce8036ed65e77163f4597cd
F20101117_AACANM bermudez_d_Page_027.jp2
e76cf61d0d50318fccc100835efe90cc
e392e40231baa1e40035bc4416ee6aedc306feba
F20101117_AACAMY bermudez_d_Page_009.jp2
a1473e61454bb1d0fe51fd4923638088
fa00a4cf26f837731c246ec65ceaa805b61c1cec
1051963 F20101117_AACAOB bermudez_d_Page_051.jp2
06656dc369cf79e3b3b43923f66ac8bc
ae6bf7745c940ddf87a0d936de5d3b11a1f557b8
F20101117_AACANN bermudez_d_Page_028.jp2
7c0b3fcb280afe019a3d4520d5cdf1e3
52bef095f6081fc1191caf6e44a149632564d9fe
F20101117_AACAMZ bermudez_d_Page_011.jp2
d71129cb48e65cd8b88e12f102b4017a
8a77300d49bbe5188490ec0c189835689f63d727
F20101117_AACAOC bermudez_d_Page_052.jp2
ceb878c77ba34aa4ff87236f5f559714
e78d9c7ee65546b3f2bf215b6d48e31561662afa
417379 F20101117_AACANO bermudez_d_Page_031.jp2
2e697e4e44eb214fc2631e541a7b29c5
e35f1f86ae39153f5beae9c430b3a2aa897660bf
F20101117_AACAOD bermudez_d_Page_053.jp2
bbe0e9b829880819a316b91b1667563c
8fa5e917466a8fb3ffdd95961d306f8f5eddfed9
626200 F20101117_AACANP bermudez_d_Page_032.jp2
86440834ba85bf1891217bedd5172981
844cabab0e6863e21b4e40e374148f96cf01a3b3
1051940 F20101117_AACAOE bermudez_d_Page_054.jp2
ac0063a41b38d439971dd5aa388faec8
1a97da457b34f1417c77ee313539882fd8d2e058
1051972 F20101117_AACANQ bermudez_d_Page_034.jp2
3d6940b18a95aa273ae54b25f57778a5
9da073b8de125b7cd0edda277a1ba111f9092107
282405 F20101117_AACAOF bermudez_d_Page_059.jp2
bdb3baf3ea65e8b436a77216ece68ea9
f603abf5d6da6c15aed2550bbc641517aa31aa5c
F20101117_AACANR bermudez_d_Page_035.jp2
3a871b301c493c488f1992a6ef5cd620
1625d4dc51e3b3d52f4d94ec6038d57d759dcd5f
278663 F20101117_AACAOG bermudez_d_Page_061.jp2
170272f38de5375dbaf340db675d4e0a
650bc92042bba6fd3f21e214c2b1938a471ad14c
1051971 F20101117_AACANS bermudez_d_Page_037.jp2
d8e99e0e3760871f37fcc9ab471c7b96
5577181e33ff7298e005aa1099611f68a205cc6c
F20101117_AACAOH bermudez_d_Page_063.jp2
04ff890e7083096cfe7bbbeb33a30df1
ce1385ce0d21c10bfb30c7dcca540b3542ce77c7
F20101117_AACANT bermudez_d_Page_040.jp2
57b8c9ebb2d1b4d31ca60494040f9c25
fff73035032d2535f1d46ad1a5df4563d21a0adb
1051961 F20101117_AACAOI bermudez_d_Page_064.jp2
917e0bcebcaa1b1f4abd82f38ec70e52
484eb496cb789228a21b3616361845788091301c
1051926 F20101117_AACANU bermudez_d_Page_041.jp2
f38f314e3ccd4a7e7806f83f1947f792
d84a70388b771ccb7786fc33d90d8a3ea8484fec
1047935 F20101117_AACAOJ bermudez_d_Page_065.jp2
3f214d96f167f1992259fb90d3465ea9
6af368936e9c269c239399b864db14f5c83605a6
F20101117_AACANV bermudez_d_Page_042.jp2
2c06f92a9716e64c871095709bcd98cd
39e7612f681d3af184aafd911fa7dd190570fad8
F20101117_AACAOK bermudez_d_Page_067.jp2
2c6ae995152df2dad50688c4fa0237b6
81d63db561de6315ff890a15d48e39f95004d59d
683506 F20101117_AACANW bermudez_d_Page_046.jp2
e8f5248d6318fb749a1b5683e005f1ad
7bdd1e44b33cf3a4cee464cbbf722b2bdae3826a
1051933 F20101117_AACAOL bermudez_d_Page_070.jp2
74f1f574c285fbd648267dd325c16181
4096eae093b7d6f9b140201e78d2d88936c6d0da
688728 F20101117_AACANX bermudez_d_Page_047.jp2
f34c636a157002b4ef01e484758e661b
3aad1dd7aed6781f55a0d831461bbf7dfbd76376
1051945 F20101117_AACAOM bermudez_d_Page_073.jp2
f0328cb66e40104fae40a601a609397b
6c28f483c6785b3ea02851efd94ba2d3324467a9
F20101117_AACANY bermudez_d_Page_048.jp2
21181d7501ebea25281021c1c5a53ad1
3743ee7207b5201a3a1db379b9064f034bd394b0
443692 F20101117_AACAPA bermudez_d_Page_094.jp2
6679390978c15841e05df295e4ea6e50
31d4714d530438e4864599bc51d6df7a2fd39ef4
1051920 F20101117_AACAON bermudez_d_Page_076.jp2
0ed4efa0c5a47e9b48ef03a2f51537f2
6ef6e93a0bafdb2bde0134ca60dfb375dadda448
396396 F20101117_AACAPB bermudez_d_Page_097.jp2
13273c97c7653db91f66bf3d6ed15642
b525b5675ad338670b28757dcf674a23add8c49e
1051929 F20101117_AACAOO bermudez_d_Page_077.jp2
8487f39a18879a36b73f29adac071a72
7f90f2a6c291fd300b9e0c42a28c05a0a7c50aad
F20101117_AACANZ bermudez_d_Page_049.jp2
aba672901e4c6773056921b87e1a80ed
13072e0ecf3c1b2f271417e94dce3d8aa3d03427
464108 F20101117_AACAPC bermudez_d_Page_099.jp2
0ccac83a38b299880778e4f102bb6b3d
cdc8a1d6ede0fba6e8e2f6f32d992cee8e9d3157
1051947 F20101117_AACAOP bermudez_d_Page_078.jp2
e8876cb7abacd5f20ea0f5289ae70ec6
ace17d1daf25048d89019452b0559cf149a77d40
342269 F20101117_AACAPD bermudez_d_Page_100.jp2
d506e3d07295c088ae95d0149c0ce6e0
a8740fe0f6d46b91051b501d8a89cc7337c79e38
1051944 F20101117_AACAOQ bermudez_d_Page_079.jp2
980753293a5ac8e7c4f8625aca3da5e6
d9cabff5d615e668b052d280c17e8da2aeae3218
340736 F20101117_AACAPE bermudez_d_Page_102.jp2
41249fcff5a052e877d72da1ffbf6b3b
e855cf4059975eb88c55322b5e4143574d27ca67
1037516 F20101117_AACAOR bermudez_d_Page_080.jp2
0f92b34b845ab566fcd3440f3bae87de
9eaf6b29831565b070eff974dd1d13211b7aeffe
337289 F20101117_AACAPF bermudez_d_Page_103.jp2
31d5fee2a043c2fe7feb3b265864879c
aeb62f71e06ab38cf7efee2b4fcce67e4f3decba
489811 F20101117_AACAOS bermudez_d_Page_081.jp2
b63b7e6e78f3a6cff9bf824cb02cffd6
609d0c09f03356e15a6c4e91792a08b626655d02
318255 F20101117_AACAPG bermudez_d_Page_105.jp2
6de64acf295146aab2c8d91dac346f2e
88d28353885cfef5c7842e9f8275b36ab05bc937
1051891 F20101117_AACAOT bermudez_d_Page_083.jp2
99cfeb3bf49004a71e7e8336dec54e4e
17400513449c7d779c3a5eb5ba360b79c4aa58b7
F20101117_AACAPH bermudez_d_Page_106.jp2
c3faf1bfc18e45cda9ad35e0c022232e
768ed1c1b156e6daed6d62d81c02c7b814a8a7a9
949706 F20101117_AACAOU bermudez_d_Page_084.jp2
549345b69e2056076b435a4ca225515a
1e76947b636b8d2bd3217e490a253aac9e2cbdb4
1051978 F20101117_AACAPI bermudez_d_Page_108.jp2
45c06f1ef54817188149937a70ef7dca
7575ab2bbd63b52e088bd97c0a1c6eababa7b8e5
452827 F20101117_AACAOV bermudez_d_Page_085.jp2
248d2a33a277323df6c7a06e6e187adb
1af50ae27cb9df304ca6ccf5f986eb501ebb58da
F20101117_AACAPJ bermudez_d_Page_109.jp2
842c9da4819409e565dcdf0ee49c5d20
1d2f0b35271f2fb40c86ed343344764cc099147a
391501 F20101117_AACAOW bermudez_d_Page_086.jp2
39fd24c503e91b334a9fdd7e7ae57891
7e4ae30c37bda64b7860c388a4e8b68b8c70bd95
594889 F20101117_AACAPK bermudez_d_Page_110.jp2
06460aeb66334a25ccb8dc49890c2cb5
280771aae1f2cb81b5e5e74156bcb6eb67994799
331200 F20101117_AACAOX bermudez_d_Page_088.jp2
3bc7ddd32bf12d6627f3c183f9f63859
246be87aa4429d79be2733da605837f18c5e87d8
906529 F20101117_AACAPL bermudez_d_Page_111.jp2
cbb7eb9e85c209fc14743b06e37038ec
ec415e2989cc95c1e5811aa317a2e12e156b02da
407605 F20101117_AACAOY bermudez_d_Page_090.jp2
795148bf8bad19a69c721417f1ac5710
53efcc5e023313f144bb3207d9ceb45bf329a483
F20101117_AACAQA bermudez_d_Page_134.jp2
f04762593d211f93264cc8bcd95570ba
5653db6bd611245276e4b94fa3e47b7993a460b0
504372 F20101117_AACAPM bermudez_d_Page_112.jp2
aa5a636264db3ec3aace1b04098fa3b1
063c82bfe191140135c447282febbd87e1ce26ce
446865 F20101117_AACAOZ bermudez_d_Page_091.jp2
b71a1561f33012f8812f1bd1e59c065c
03b0470c309759a61d59491923dbab8d25c7535c
184338 F20101117_AACAQB bermudez_d_Page_135.jp2
2f8b484fe76a1fc086b30fd3501eca4c
0b9e5d73393d4880e481d8b13ecf095645257193
464326 F20101117_AACAPN bermudez_d_Page_113.jp2
2fa47e041f12a22a9128bf1542df7df7
446001fd4de576fa675dbf45d71f37f65dfeb6fc
F20101117_AACAQC bermudez_d_Page_001.tif
7fba70c1e4cd61372cdc30d6a9328991
faf53e796bd1e42c196399d5bfa8ac81bfd82a3c
540538 F20101117_AACAPO bermudez_d_Page_114.jp2
618a692cdbc27100cd74d1f300923d47
9ddb903d0889dc3ca4e7e90a6d55f833ac5e51a5
F20101117_AACAQD bermudez_d_Page_002.tif
e7c3da5ec482dca822676bd264636ed7
1b75bdf9a6e949b6029e810d650ac9e84768ac0e
857841 F20101117_AACAPP bermudez_d_Page_116.jp2
c429d9083a3973d421cf293ded8146ab
5268190fdb2eb8af8936eedb24f0b554880faa36
F20101117_AACAQE bermudez_d_Page_004.tif
042a3d8da812d711578233e222190b95
062870a5d558d0b4c7bb91592d6e485b3ba5c686
403462 F20101117_AACAPQ bermudez_d_Page_117.jp2
de13d7231386dc8b3993fa696135c69b
51ebeeda4aed28ec4ed08ffd964a052ab5a2826f
F20101117_AACAQF bermudez_d_Page_005.tif
69b45e16c0454081fb71b85533c414f2
17dfb4236928d37f1a4061e9b0f8a67f381f03f2
884949 F20101117_AACAPR bermudez_d_Page_118.jp2
56cba1040d53fb11fce8fe59dfbdcba8
c402e073fc43494a9ceaed2c169593badf803871
F20101117_AACAQG bermudez_d_Page_009.tif
8f49c0a6a89a7524145a38708114438b
7bb272d2cf3d8854a3770927d942249e36c8ff9f
1051927 F20101117_AACAPS bermudez_d_Page_120.jp2
efa84001bd0e1f6326d8c5c016084d69
83cfc23fb281953f049560f75594e7ec5daca427
F20101117_AACAQH bermudez_d_Page_010.tif
11bafe47b6b9f53e7a5f7cf6f0a8dbec
c94371713ad1b225c3225d8d0eb3e8eca4716fa5
F20101117_AACAPT bermudez_d_Page_121.jp2
c082c6ee9c2c24a8868b99be2893fd0f
c363b5f461368fff3b022a673be919c512172ba9
F20101117_AACAQI bermudez_d_Page_012.tif
09c13c5b052684f31ba91016a624fba1
8a8a8ff40b854c8e215cd332f705ba7b5b4af644
F20101117_AACAPU bermudez_d_Page_123.jp2
462321a03a49bd5daa945cc4126ec818
ae9d6965aa5dd24dd1e3be45393b21767d5196e6
F20101117_AACAQJ bermudez_d_Page_013.tif
5a5049b9502796c655d3fb80c9b83800
55fd4949a2ba9f8f010a5aa385da6766f8b61f8e
1051904 F20101117_AACAPV bermudez_d_Page_124.jp2
1263575c44fc153cd0a15634a4293df9
61b37f400b1840292407c5ce6a0af34932f00b94
F20101117_AACAQK bermudez_d_Page_014.tif
a4d2f31180e0180334b29064658cdaf2
1c15e3ef4263a1f01cecd1793643c75ec8fe2308
F20101117_AACAPW bermudez_d_Page_126.jp2
cfc93e13345adb6b0a70b19dcdb45deb
3175ce4ef4178a702c945daef33e111e44e89137
F20101117_AACAQL bermudez_d_Page_016.tif
2d5a7c1c58ec8975dd7d180381b47754
c833db87d349aa8c5369db0f1b7b324d0b2566aa
F20101117_AACAPX bermudez_d_Page_128.jp2
aba72a03ff4986405c67c483fdf2cda5
340f14b7c0c9f433d1a272b3ee02f38d00c054fb
F20101117_AACARA bermudez_d_Page_040.tif
2083f0bbd97b87ee579ae5f2e7835eee
12aba80f53b41d498316653948486eee5c21bda5
F20101117_AACAQM bermudez_d_Page_017.tif
e48303e7895200d9ae6c9637adfb6399
835df3a88707497f7886cf2f9ade00505421ff6f
1051957 F20101117_AACAPY bermudez_d_Page_131.jp2
619d16024594007fdc27eea1690f1d75
7998906c08a149554ff5beca8d57f2779b4d6100
F20101117_AACARB bermudez_d_Page_041.tif
0533bbd8a61f89cbf973c28e9f6ee055
50c054d25c48fd9f335805f68d0a654dd8319123
F20101117_AACAQN bermudez_d_Page_019.tif
f376c75ddf33ff02521303670fa99eef
99dfdc012d9d897d3bca0360714ab7677ae1345e
114097 F20101117_AACAPZ bermudez_d_Page_133.jp2
1a6f0126f7e076ad0a622f4bbb0f4728
0055b719a18cb72676467daba6ef008804298f04
F20101117_AACARC bermudez_d_Page_042.tif
e501ecfbf60dd8adefc5a44f2c6ab9c7
8781f513f0e04eb9dcef5a6e3b0301daad17f2f5
F20101117_AACAQO bermudez_d_Page_020.tif
21c06a00ae453db629c85761ad6b6ff0
13486fea29c1a43e5c7814b2463088d15aae1280
F20101117_AACARD bermudez_d_Page_043.tif
ccf9fa6811a1d2bb0c3c6d064b818d90
6415afce613464322120d8fe6d4f2774684a9c47
F20101117_AACAQP bermudez_d_Page_021.tif
e62c30377b9d2e03520e51a6202202c2
529f419010c285091543870324ca8faf61cc19fd
F20101117_AACARE bermudez_d_Page_044.tif
72756eaa0683fbb5e8698074bd961915
3a7e67fe1e2fa207925581b3bf703052d2e5051b
F20101117_AACAQQ bermudez_d_Page_022.tif
1c425db4d7ecfc01f7e554d4c13253f9
17547c7450e2bcfee8f7344b1cd02c87297605d3
F20101117_AACARF bermudez_d_Page_045.tif
685ff145842a1d4c46131058626e9643
6bc74e6d96cf4d5287cd0f2d827c4dc861bc2d00
F20101117_AACAQR bermudez_d_Page_023.tif
ef32752b0c91ed2a4bc69a4233e5933e
320f7216f29f027a6cc110586ec685becb3bba5a
F20101117_AACARG bermudez_d_Page_046.tif
76f1c376d784df5ecb115e4996111204
9393d57f83aaebf28e65ff1722ddf57a300fcf8d
F20101117_AACAQS bermudez_d_Page_024.tif
d98cba5a5c5c729ca4c3b862ec2f28c3
4e5c6738e37ad242478c4538a2e3b1f9df90722a
F20101117_AACARH bermudez_d_Page_047.tif
a94a9dc22484e33f00e5eb23c7f8aee7
857864068b1eab533073ef4466f9aff73433638f
F20101117_AACAQT bermudez_d_Page_025.tif
ef0ba7a52e4f623b013ac8412b348b9c
62e30293e707bf2cf0ca6d2124bb370d2f23c09c
F20101117_AACARI bermudez_d_Page_048.tif
7ca3e846e67e205f730848e0ad22ab33
0caf70246cd5fa2610ee2491da9f4256bd9344dd
F20101117_AACAQU bermudez_d_Page_027.tif
6efce939870b722b466428901162f0e7
a90fb90a5d8162ccd8a4d1db6b4be9c11b007da0
F20101117_AACARJ bermudez_d_Page_049.tif
c2be6da96067f42fab15600384c9fd0c
a4624fea25152ded329f0e79168d82a2983c2747
F20101117_AACAQV bermudez_d_Page_028.tif
2a23d12851eccf97b710b16474f709b7
677806078d1982ca6d21eab622832c98da2a037b
F20101117_AACARK bermudez_d_Page_050.tif
236eb22d658c97c650a16f4cadf77136
a6d39bbea3f9c02bcf6bd1327797e15e798a433a
F20101117_AACAQW bermudez_d_Page_029.tif
696754eb18718aca0dcc27b81c98ade9
95edb0ac5ab9b597c2f8a5558b0e10e8324a9416
F20101117_AACARL bermudez_d_Page_051.tif
5c9118152c3f2e370ce7c415ead0355b
6298527b6ac8750bbc5c5d3c3e5b75535ce7e45d
F20101117_AACAQX bermudez_d_Page_033.tif
aa9274adf3237bed4971a2a24192db79
59c0a7385b5b2f2614bead3502e79319906a53c5
F20101117_AACARM bermudez_d_Page_053.tif
28e8b95d20135cee3e49d55911419bc9
5774e258ca91b2514f862f18e60e176ec2466577
F20101117_AACAQY bermudez_d_Page_037.tif
01845dbc46c11ff4140fe44bc8921ea0
0048dd1d1fcb4f10ed072d4e94876942e75e59b1
F20101117_AACASA bermudez_d_Page_073.tif
00f708c93a73ff29580363015ee56d4c
615323d86b4fe7b0b77dc3aafc46c65701853671
F20101117_AACARN bermudez_d_Page_054.tif
00516241f30e6f6a40032eb132daed77
1725e9788e54b0590663c13752117c7676ba1b2c
F20101117_AACAQZ bermudez_d_Page_038.tif
8d57521606038ec288b17828c94d8613
a043586b5b042b67417ce657f31a7183eadd4aa2
F20101117_AACASB bermudez_d_Page_074.tif
56a9c9fd1c938f61c89779afe6a254c7
edc999603dac44a03b84cd9296393671ad6647ea
F20101117_AACARO bermudez_d_Page_056.tif
71d387a69d9031d2b259623cdeefff23
456c5eb7b3367face1b92f4b5224da088452bbcc
F20101117_AACASC bermudez_d_Page_075.tif
d0f1d8c086d5cb38d889a10a03e89614
79d7db74aea081f8b4dcbb877943622f6b1495a0
F20101117_AACARP bermudez_d_Page_057.tif
64d3bc0a5e5b3afceedfeab5eae5b6ea
7ef2ce26033c8c13e68a7bf7fd2f71913006ac20
F20101117_AACASD bermudez_d_Page_078.tif
bc4e282f989339f5ff2ca688e1f8151e
aff718403d0e43a7de3e2e80be2ea33b00d3b52f
F20101117_AACARQ bermudez_d_Page_058.tif
9590d232865b44f80d720b3cadc975f3
aae46ad3c664e8d71aa3ad27d2cde80e4b3b6bd8
F20101117_AACASE bermudez_d_Page_079.tif
b22d6c652a472ffbb044af81ddb85154
e845a7fd8bd75eab1e24669a2cd9587b8b2d7005
F20101117_AACARR bermudez_d_Page_060.tif
44cf696ed33c47f92dd528ba40ce243f
b327cf7c79e8094f105bbade45685c96d59cab69
F20101117_AACASF bermudez_d_Page_080.tif
58f5ba1143700c647dc92d3e01512ccf
5dce1908f8b8625810367d1d09b4bbb3a75cc525
F20101117_AACARS bermudez_d_Page_061.tif
0ddcb6e560a9d62cbd93317f91d39e49
7af5e8a888d8c4d6b26171e429b073562101de42
F20101117_AACASG bermudez_d_Page_081.tif
2a2924a0f652cca38765528b09caa37d
6a86d03a8a4efe0857c4b5ad89afa68ec8275305
F20101117_AACART bermudez_d_Page_062.tif
0c94cbd0fade31c0b373a3a38c1f05f5
278d21cace7df53abc28b2cec37933153e790084
F20101117_AACASH bermudez_d_Page_082.tif
8d38bf34948ccbc7f082814918f472e9
fad520d751cae52dbd4a2ce958a1c8dcd27e39cd
F20101117_AACARU bermudez_d_Page_063.tif
127800a9ddc1b0780028dd8f1d463810
1dfd33c878ab1df7a08747584fcb385331c534c9
F20101117_AACASI bermudez_d_Page_083.tif
531e3b082f1224ea1dccccd53925c424
706282574f1d4d2cab390fa3e74fe5d3c93dddc2
F20101117_AACARV bermudez_d_Page_064.tif
072b1d5c8cd9ab55e25206800a4d2cd8
cfbe8af914519c4b9ee92c7e56e804a3a0484a6b
F20101117_AACASJ bermudez_d_Page_085.tif
162c05cc6c45bae3c0f8fef9b9afdc7a
15aa42eec39bb9d89bb76f5c967d57afa0b24df2
F20101117_AACARW bermudez_d_Page_067.tif
321c6323a498543c657c3c611efe977a
5a53ef656144196b0eb10c51d1277b9064dbeeee
F20101117_AACASK bermudez_d_Page_086.tif
e78440dde1eebecb38fb1353b4fd5ae0
ef184b20c104c4357d3b5dc384b6f3af954fea7f
F20101117_AACARX bermudez_d_Page_068.tif
b6e1e37d2ad03148c8666145c96f9025
cd3a156c53dd47e8e64d9a2554ce9111830d42c6
F20101117_AACASL bermudez_d_Page_087.tif
5a8d77ed16447a30eb676fe8323222f0
d05aca8b65fb78891994e6efef48713ab09ecc40
F20101117_AACARY bermudez_d_Page_069.tif
f5c4b1313d1c3acc432e30fb9ef81f1b
b451b0da069cc135d798db06a63c5673ff84622b
F20101117_AACATA bermudez_d_Page_104.tif
f9706e28cde22c1ad74c4c4f9150a6b7
67c09a2db1eaf6015b66b61311664a3a790a5238
F20101117_AACASM bermudez_d_Page_088.tif
f58fbee4178df6337705dc3d70b8df2b
678fbc2d102bf83a6bd23b740b3b5552226692dc
F20101117_AACATB bermudez_d_Page_105.tif
3e11320023965a376d41155d1ec26ca1
270d2d516303d6f03a0467b3f3ca7fcda337bdf7
F20101117_AACASN bermudez_d_Page_089.tif
ab61be48f2788a59cfda8d9cff11d3d0
47059d2394cf1ca560a376c54b7e8f47e35249b3
F20101117_AACARZ bermudez_d_Page_070.tif
f031a3e04080e7748e56c3c5ed05ad89
26007fe3e1e92ae35ec61cb8bf464247b6575d89
F20101117_AACATC bermudez_d_Page_107.tif
f3626686a3a0334c80f87eb57964fec0
b5042e2d4cf9549a654ac8cd1dce7cbae6753248
F20101117_AACASO bermudez_d_Page_090.tif
0faf33f7e9874670e433aff358237e97
15a56e3c76e5eab1ffc7aa8581d7ebd9bf8c2bc3
F20101117_AACATD bermudez_d_Page_108.tif
0e33019056b043210f66eee14ae972c5
af995d7c1284b206bdcd03f30810d33148b24a10
F20101117_AACASP bermudez_d_Page_091.tif
664516a7393759f2b35331a5a62c7161
bc6fd2e0ed0f2d862795a39543f1429b19fc2f58
F20101117_AACATE bermudez_d_Page_109.tif
6fc5d077a6e805a1e46d4231c6a7628c
7fa268b4add0b25fcb7fa689eaf982e88a4bf8c5
F20101117_AACASQ bermudez_d_Page_092.tif
69acf842d95526c6e99650edb5e20688
714b1610d019085425d912f10821cd6c47d3912e
F20101117_AACATF bermudez_d_Page_110.tif
66e7aef4f133d89f9cc94192b995f28c
2e5ef7fc49bd65bee6dd7852f7e3c47cc1a78179
F20101117_AACASR bermudez_d_Page_093.tif
68ffd07cb44fe72f90a7822a3abd025f
ad843b679fd69dc0237e7d32def7f38c2ee8241c
F20101117_AACATG bermudez_d_Page_111.tif
42e3845c5a928adec05df23e4647fa61
3b85307d08ed98c71fdd95d4e5ea4a2a30cdf8f4
F20101117_AACASS bermudez_d_Page_095.tif
d173ee9537d5e0164d3b7bd734648bfe
ebe3d80c18add52fbc5e838f916219a6097b5256
F20101117_AACATH bermudez_d_Page_113.tif
b99cbf4c2d98548f441fb391027eb9b9
12c48b4ade64b9d55b6d940be175df8fb814a274
F20101117_AACAST bermudez_d_Page_096.tif
35acd2fceaafe5fc5f35ada868b48ed8
29bdafe13938c2b0a930427f1cf36bc07c491c5c
F20101117_AACATI bermudez_d_Page_114.tif
492669b3b098a28ee51f3f4aff653f6d
57a3dc43ad891382bfeb628cf3775283e50154a6
F20101117_AACASU bermudez_d_Page_097.tif
ddd196ff5b5b11a522796d90eeaec1ca
8e2990886fbdfba09ff1c490793e7e757f346987
F20101117_AACATJ bermudez_d_Page_115.tif
94a09ca5ca986bb02f61f0be01764ed1
b2a446394fbc47b5608aad130f8ee61d7f3c1d0e
F20101117_AACASV bermudez_d_Page_098.tif
59e2d3244e91f682ca920a4cb0fbaea2
d9122c8a4438b786addb26eb7f14c2bc6179a58e
F20101117_AACATK bermudez_d_Page_116.tif
c69b40669561a3e98a1810c1dbb55152
c786f85b4e97f6c6ef6629198ad7aa580d5bd8e2
F20101117_AACASW bermudez_d_Page_099.tif
6b7614d77bc729942a452bbd1bd3ed14
ed80578ad31bd4fd3c86a6b97290c9d02b69bd16
F20101117_AACATL bermudez_d_Page_117.tif
ed253e6c0fa772db53a63aa6cb1f7d8c
629e304d347b5e32321570aad83472fc31a27493
F20101117_AACASX bermudez_d_Page_100.tif
12051402e2bfea327122a803cfd42330
152cf1de0b14fef69581b7a49af3e26b303c5e3a
F20101117_AACATM bermudez_d_Page_118.tif
37f0d30f11856f5e547d05635383a07e
3f45e3218e78afd495a255a8a5d4e24f2d62105b
F20101117_AACASY bermudez_d_Page_101.tif
51380965816e8fe9644781e47ccc83ad
6bfb817e7c02a3cd3ef4a410e3ba4c4fe7e8f5ff
53644 F20101117_AACAUA bermudez_d_Page_004.pro
7c6c75421e05b14a43266a1dac8284b3
3e33aaa787fcf5f52c15ded7cbc7d6a260332b4d
F20101117_AACATN bermudez_d_Page_119.tif
4d18cd9cd548e8b5cbcb68af2c706f0a
571104b248a6bc9eb65d47e6998500c1422908bf
F20101117_AACASZ bermudez_d_Page_102.tif
68c4401403cf256848dbcc65984debfc
066a49134642782a3ee685f3fc7cc276bf59e884
74689 F20101117_AACAUB bermudez_d_Page_007.pro
9ce44177dc65c47861e5b7dd5911590d
898fc9296d2f53b4eaa8a527ea0b42619893ee67
F20101117_AACATO bermudez_d_Page_121.tif
315821dd31df659b90c1e12282371e6c
8254d61daa0f310027b7d0cf91c4f0bc173be2ef
8629 F20101117_AACAUC bermudez_d_Page_008.pro
5a8b6d6f56a3b7312f0ac6cb304d0e4a
f345330669cac08d5ca71434ccf4db13ca6f3c4f
F20101117_AACATP bermudez_d_Page_122.tif
84a9b060da4fe91b3cac1200bcef0c89
d793d79a8979fa63a36647f49742737714af9df5
75984 F20101117_AACAUD bermudez_d_Page_010.pro
b69ff66ad59ce189b39ea84875ab00e0
5d1721687d80e15898139884ad764a992b125400
F20101117_AACATQ bermudez_d_Page_124.tif
988d7b08a30011a3568238aabcba6cf0
27feaaffe6b39fe36c6c2bc34766aa25e57ed266
51407 F20101117_AACAUE bermudez_d_Page_013.pro
40e8760d6a7ee6eb225292a648417e8f
5d93fe13fa72bfda7a6401d6d538ec8fdbd9c6d6
F20101117_AACATR bermudez_d_Page_125.tif
cf2d388e9da99d66ea86a21ac8b68b29
b21e2503b8b6aa5b81dd073ec1003567020dac88
F20101117_AACBAA bermudez_d_Page_102.txt
30ab0374978a378a6103889aa6479163
05544c97d5ceb15d558211fbc9232c6f7183c4fb
4408 F20101117_AACAUF bermudez_d_Page_016.pro
0c6cc8f3ec7ee25a5c552090f151e6fc
0d486040bf9997a2bacc0c4381cfb73e64199454
F20101117_AACATS bermudez_d_Page_126.tif
79bab87434a83714e51545d7f3324c67
18d05bcd35b2f3821585b6360ae1638b84f71584
599 F20101117_AACBAB bermudez_d_Page_104.txt
274bcfe6b3e7de65bef03fedaa46f62e
2ce10def38612df26938ee919539d5c7fc565773
48661 F20101117_AACAUG bermudez_d_Page_018.pro
f3b5ee6d2b7524539c63b6f6b3d617b4
13a808bae38ee91c14fc4886f4613f052ee50ca4
F20101117_AACATT bermudez_d_Page_127.tif
9686bb77fd6aa176982fee764b50ec6a
1a87647ca265e0373400ada2720ec5204e15e769
620 F20101117_AACBAC bermudez_d_Page_105.txt
ee2d869c39307666d040265594933c89
203af62c47f5171ff682db617724f7aa54aa364e
51121 F20101117_AACAUH bermudez_d_Page_020.pro
4d1b744e13094ae8943d416efedd4cc4
58d072d86ffa13985e35b4794a422cdd7f7b653a
F20101117_AACATU bermudez_d_Page_128.tif
7baaa1772332b1c2301812c8a2554fec
25f8901555e5663c72ea9085596b7590b19ea150
2008 F20101117_AACBAD bermudez_d_Page_106.txt
f30fca56cbdf9d6a8d48e7b41d43c52c
ec2468402cb3d3bb2a6b8abb703941194afc5ca2
54407 F20101117_AACAUI bermudez_d_Page_022.pro
dd0d6060b636b941c146dbdd8a3908da
41261760816c19756f949a7e0fad75beba8ff237
F20101117_AACATV bermudez_d_Page_130.tif
bad0ec8309bb6a99a07384c25b61b2a2
f3096b82403aba9f5159e424e6dbb80d830b8487
2113 F20101117_AACBAE bermudez_d_Page_107.txt
e149075ff7c0e4ec6327197db7cb2142
344c23667b4272510dfab8b1e735b6bc868e1957
54179 F20101117_AACAUJ bermudez_d_Page_023.pro
0e138384f319d720d16aea63b08b8e15
8303c8f5d4948ed886ed83232f56576227bf5514
F20101117_AACATW bermudez_d_Page_131.tif
9d2dea7a84f9c52dea99d380dcec7f19
8c0df9d2ab3e2cc8b4d04263acd93b0dbad9265a
1997 F20101117_AACBAF bermudez_d_Page_109.txt
f0de2180f89748fb6d451559fcf00e1c
c63b0f4629cf6e906d9a2eff3512d6062fbd46ed
54665 F20101117_AACAUK bermudez_d_Page_024.pro
94165da77b3a2030e81dbd944e231740
321d0f6c7e34e33eb5b42327dc858719eff6c716
F20101117_AACATX bermudez_d_Page_132.tif
a78e6cbf73161313624a0685cd15c335
8a56f0449caa1c95df399a8bcd2a998b321ec957
447 F20101117_AACBAG bermudez_d_Page_110.txt
4ea47704a434f46cbcee42fa9ec0a695
3a3579e893310e860448e1a3a8912e509d7deeca
21397 F20101117_AACAVA bermudez_d_Page_047.pro
e5cc6398ec8761a4cfa3113021ee17e6
e0f41f271613ca4fff65e435fdbad9afaed0528e
56117 F20101117_AACAUL bermudez_d_Page_026.pro
ca81ee90fe89fe8eec359d8775bd92bf
6a4073fb1fbc152fb2542353770c9ff383e02031
F20101117_AACATY bermudez_d_Page_134.tif
13ac87d4d35939edf93ba256a4e496d3
16ee4bba31891dbc459298055b61f339520678c3
510 F20101117_AACBAH bermudez_d_Page_112.txt
d7cfd0b2ddac1165ef89f47d440198d0
dbe617f29f8a31b792aa9c89b8d02349796f008e
54276 F20101117_AACAUM bermudez_d_Page_027.pro
6f9e2db17b584c665a45e8538b57f87b
a0fc56d87750d94eb5ccc69d04d6a69493d9c86e
F20101117_AACATZ bermudez_d_Page_135.tif
2645893134480fa4bd162e1d926d1b15
15504a10d2b329d3ce0120d88f8b2eb657965550
396 F20101117_AACBAI bermudez_d_Page_113.txt
4f04b0841dc337e4672dcba71dab4514
15f27940248debfc5297fb29e119e182a100e348
51442 F20101117_AACAVB bermudez_d_Page_048.pro
960013e2d0bf6a80a087397cb4211782
1e7e2acb4b444768af1ac62cc38448a173d02e5c
35381 F20101117_AACAUN bermudez_d_Page_029.pro
9889432a497ef3da1fee9cc3844287ed
ba6510eb8b007ded256faf673024076f339ce52e
512 F20101117_AACBAJ bermudez_d_Page_114.txt
9520be61b639f032c499c3aca1d2f164
77759a9320beda89035db1f211d18e3c045e0029
52418 F20101117_AACAVC bermudez_d_Page_051.pro
4f1d77f5a3b2b93ce940c83efda1ba4d
51a08cb649b1b3404e41c5bb9c5db02535e36c3b
12185 F20101117_AACAUO bermudez_d_Page_030.pro
583bc0ae70c8f9aafd55eb8b2849dd1e
b57b24fdeb649a89d7a53cf93756f6a82b7579d6
800 F20101117_AACBAK bermudez_d_Page_116.txt
dde00ce9b4a669070db1ac490ee50f03
536fed48a3c1016b754d339bdaacf1bc8866e37c
50005 F20101117_AACAVD bermudez_d_Page_052.pro
e3cf5f25b978b43a914a906a64267711
2dc4b89f29636b6127c6085e77f99215ddb7d06a
8600 F20101117_AACAUP bermudez_d_Page_031.pro
a9f0d10b120f97a217d8b46e833bdd18
34510b8cc454cdecb33e9a155a9356293062e721
49227 F20101117_AACAVE bermudez_d_Page_053.pro
435207d543a441742b5fdb323b20b125
f7bd98455c8a97db56971860494ad93a0d36fd61
53226 F20101117_AACAUQ bermudez_d_Page_033.pro
1477be7d1871b4d618d1162535342308
d36c5325720f29e1585998346a0386cbdbe1480c
426 F20101117_AACBAL bermudez_d_Page_117.txt
8edc1508e9388ce5096fcd2cf5054992
15b294f378aed1b1b818c5f0e9e707c195103956
56542 F20101117_AACAVF bermudez_d_Page_054.pro
fdd16c103cd0106a03bdaa1f7c194960
f8b18e9a2ebe03c6d9ba4ac9b17fc6b30921226c
53494 F20101117_AACAUR bermudez_d_Page_034.pro
a796e69b4a26968b0b4ecdd768c7026f
3cff1ed1fbe8d9091c41339110a00abf81b30c61
26704 F20101117_AACBBA bermudez_d_Page_048.QC.jpg
ecb99169907b0055ff296b72e98e577d
6b26fda860010ee17cbd6c27db0a5a7db87f130a
2039 F20101117_AACBAM bermudez_d_Page_119.txt
74fac6bed934b40372e607e2faeffffc
fad24c39d4e983545ec9fffb9275a4ebc51537e1
54548 F20101117_AACAVG bermudez_d_Page_055.pro
a9f7c3020c15745dc03a70ecd40624d0
9ecf7f42d506e870bd2fc7c7cb29321d152be2f5
53306 F20101117_AACAUS bermudez_d_Page_035.pro
487279feb02fafed1b4503d9ef85feb2
1b7b9009d8683df99e20c91557e566dee6ef7001
23973 F20101117_AACBBB bermudez_d_Page_007.QC.jpg
6547888c7c3b9328212ac3b6cc923b0f
7455a6836f69284e433c9165728bc7d707a175d5
2342 F20101117_AACBAN bermudez_d_Page_121.txt
9c52e60b0a43b12d1c88551545f32400
42bfec1e6fe6d5f877da6cc73ccc9e65f150dd96
13276 F20101117_AACAVH bermudez_d_Page_056.pro
c799caf9ab8d5298c9289050441f7a8e
275c7021beb14249efa30e22f2b181434367b506
49777 F20101117_AACAUT bermudez_d_Page_036.pro
9ecb27ee5e539de0cf6a32962209a1d5
d8926176fef912bb8353cc6274c6ab6e65fc517f
7423 F20101117_AACBBC bermudez_d_Page_131thm.jpg
71f302979e336c69148631d53777fed1
de5cd4b88b0e9ef3a7dcb7f9bbb7112136d0732f
2603 F20101117_AACBAO bermudez_d_Page_123.txt
406597e8a222b9ff81fccfc114d9a65a
e2d5c7887a93983614abadfd9fc0602330b38999
16743 F20101117_AACAVI bermudez_d_Page_057.pro
b82ce7b5cb2f5c799f6bdea03858fd53
07a79ae50412e8d8dea66e1b22ea831a22e354e2
51864 F20101117_AACAUU bermudez_d_Page_039.pro
0271145762e3523e995f00e80c4dea27
642bf219a46095041a663767e68f00ed99267519
13262 F20101117_AACBBD bermudez_d_Page_031.QC.jpg
20790cee0e8fd0d00473b8a0877937e7
052bc2de1394885df1b6d69ee7fce4abdad8138e
2756 F20101117_AACBAP bermudez_d_Page_125.txt
98d6765afc42fe649864d2e04611460a
8903e55eaf6a44dd4f66465808f8f40a10e6ba2c
5139 F20101117_AACAVJ bermudez_d_Page_058.pro
a225708cde76f85e852ce1861898f83c
29e38221fd6fe45d8f04a92c2e234bb0c9b471ba
53825 F20101117_AACAUV bermudez_d_Page_040.pro
c1e5ebb469a8ab9217577eafcb3d3e60
a9d866569b652f97e09ccfb179fa4a9106deafad
7597 F20101117_AACBBE bermudez_d_Page_134thm.jpg
5b999c26b02d64951d6dfeb55a464bd4
fb6be023454ac6eacde8c9c8f70b455762896338
2546 F20101117_AACBAQ bermudez_d_Page_126.txt
a95726d7ce5b9cffff534a86ffc4b994
7a327defb8e315a466a983bdaf6a70ddf6af903d
9474 F20101117_AACAVK bermudez_d_Page_060.pro
9f7328b7ee809a20355cf0a75ec79f8d
c67e50e9489174152e8dfb34782b781e8a9436ad
51011 F20101117_AACAUW bermudez_d_Page_041.pro
edaf864c469f49d16104520275c37801
b6221e568b81bb4b5b66a4a44202e6e5ca1eb4a6
1803 F20101117_AACBBF bermudez_d_Page_016thm.jpg
56ba5369b1a6d9caf9578af1dc61035a
ae87e43a3864a3d5ce4388a1e209b57fcaa38678
46134 F20101117_AACAWA bermudez_d_Page_080.pro
ce3ac916f9c46f4f2f4ce21eba88783e
bf0ad5efccf59df6cd1a4fd0f702b1bbd20b3712
2748 F20101117_AACBAR bermudez_d_Page_127.txt
c74c7a10964445b1618afc0a366d9032
6a3a78723d29f5f2aa68c03d092b6bb1e2ebc5f8
5729 F20101117_AACAVL bermudez_d_Page_061.pro
114c354290b06cf83636bfdbef7b39e6
f7650f8dc8200c133e83e515876b3b4ac8a30467
40239 F20101117_AACAUX bermudez_d_Page_043.pro
0a6cd38fc6f6c85ad2cf21f9fa533ecd
4ad986cbf6ec3615fdadd356e9209226d1022c36
3517 F20101117_AACBBG bermudez_d_Page_102thm.jpg
468a169dc328624919a9f2da70d65755
90b799e74bf9e1a0a3bc45384c64553dc8ae766e
42490 F20101117_AACAWB bermudez_d_Page_082.pro
ca79a6755d5b0334e961e1fc020549d1
e2a5a5a3a5e7f3b822ff40f42839225a719cbc60
2612 F20101117_AACBAS bermudez_d_Page_129.txt
2bceeb5dc6617b60577e7a098cad7b2a
9dc14a099895c5db5e4ab308343a4fcb03ec8759
49995 F20101117_AACAVM bermudez_d_Page_062.pro
4bbba585ee8607b5958e1c973db6cafa
ee5fdc74e38a7d18637908a07dc729b96e127326
10662 F20101117_AACAUY bermudez_d_Page_045.pro
101d9dc2338173e89a261159c3319631
5c8e9e37147fcd7235227d9fc16eac830c5f2afe
27261 F20101117_AACBBH bermudez_d_Page_022.QC.jpg
3330040654eab89a689ffc7e2c2dd785
06d9a579f5f7272e4aeb56fe6733ca2b00feec47
2503 F20101117_AACBAT bermudez_d_Page_130.txt
a83289defc80e4208e1d51297a7ed1a0
c02d19a661a289031067d0bd229f5d46a33cb659
55784 F20101117_AACAVN bermudez_d_Page_064.pro
c73a0f4a77e3e88fa1a0c82370f16969
f6badec5da5a0139dc17c956dfe0f44521007076
12848 F20101117_AACAUZ bermudez_d_Page_046.pro
8fa974c6070ef0fe0ea6330c9358c655
7e60f871c00482f99ecb2d39c4ad4460368fce90
7132 F20101117_AACBBI bermudez_d_Page_009thm.jpg
b19fc64ef7b93436651f7af232139d94
cd036e314f595d091da89f5b0be7ec947928de92
9730 F20101117_AACAWC bermudez_d_Page_083.pro
0473dc998708ccad9033427e7ee64c14
e135f07753b2ebceb3567e1c6840210d8540f04e
2555 F20101117_AACBAU bermudez_d_Page_132.txt
4039a06cdd8b441acb880e383cf45ee4
bde01ffc568ac1604501eacedd5daea0ca2a591f
45672 F20101117_AACAVO bermudez_d_Page_065.pro
9d0e8a4ee219d3ff6c7b64c68059a818
1d5af2b0e79a7b0f047d599a3eae81d9278ff41e
9768 F20101117_AACBBJ bermudez_d_Page_059.QC.jpg
f82f766b89f11a63cbe88e67cbba66f9
76a95892e5d7e8422952701b635515bacf74de5a
12141 F20101117_AACAWD bermudez_d_Page_084.pro
1c224930916ed59d173b86204c3bf15e
4a012aaf0669bf7612ceada3adba074960d52e52
205 F20101117_AACBAV bermudez_d_Page_133.txt
d3d6d4a1a8ed5449d466a093b0ebc6e5
27b32ab09bc662981d0b66f1e47dc48eb16a3d91
48658 F20101117_AACAVP bermudez_d_Page_066.pro
43b30d083463cafce2286c90ee276ead
28b2264150a73e0c421b7e3edff6a8b2a297b305
7490 F20101117_AACBBK bermudez_d_Page_079thm.jpg
ef429f8c406b0e2b946c6945ae678a23
422a5553e2a9d2e486f2a16cc76e84e6f07a19bb
16188 F20101117_AACAWE bermudez_d_Page_085.pro
8e6f6051f6fc2929c0843c7734de55d0
0e8e091a55334118856b27eb8df348c514f0aa74
2184 F20101117_AACBAW bermudez_d_Page_134.txt
b83b21134e0c851e1b47bc4493dd7f52
7cdb04ae56465482c86c8e14b1924c2d99df72bd
50130 F20101117_AACAVQ bermudez_d_Page_067.pro
479d1e5fa7a14de10a2f98796d25c9a5
d4209e26f55c052f003fc29d2a03748457502bfe
27570 F20101117_AACBBL bermudez_d_Page_033.QC.jpg
6b2029a5f4301e15813176684ecb7058
84390a4393f8eb2d1c1f0460995ec2468d673394
7753 F20101117_AACBCA bermudez_d_Page_072thm.jpg
54da4a16df91bb7b857b6ce64aab24b2
4d470effb892d09b085439b657febab04fe979ec
11306 F20101117_AACAWF bermudez_d_Page_088.pro
52c0d5afcc9340e63813164969cb46ed
7a16170dcab0a0a61faa79374e02c5da5cf81d96
319 F20101117_AACBAX bermudez_d_Page_135.txt
7fd1145d6604610227dfd5d6da031185
e805e6293af272635d901e3e01889074b15afd9b
49683 F20101117_AACAVR bermudez_d_Page_068.pro
d86070056929bca8a6b673e4ef92aae1
03c6f94f57e662298bb7de2671b611317d2c4f8e
4793 F20101117_AACBCB bermudez_d_Page_047thm.jpg
ac74d014b8f60a5a344ddc6d180bd020
2cc8ec8543a606f85bcc1f61a47b35756419f375
16860 F20101117_AACAWG bermudez_d_Page_089.pro
3c48ddea88f77eeb2feb3911d6bd77c6
3cbbe08febfe68bb986ab1e9ca9054289b36b8ec
2533 F20101117_AACBAY bermudez_d_Page_001thm.jpg
419a8444c3e0578fd525259c4e2f690d
24bf70b30eb18495c80bb7fb323bb009dd114af1
53244 F20101117_AACAVS bermudez_d_Page_069.pro
40ee8ea4f5016205e880dfddff68ca37
dfadf27d11afad624fa7c3c03381afef9d53ce7e
5726 F20101117_AACBBM bermudez_d_Page_006thm.jpg
cd53469595abbd5564bea72c95fc2b6e
2e8206823055ee0cedd9f7e2be72ec3b3da58a21
4690 F20101117_AACBCC bermudez_d_Page_114thm.jpg
64209e94247af554d5b22fd92c62c0ea
45ee68676111f3bed04c7d1b2cb890e98e376ed7
14852 F20101117_AACAWH bermudez_d_Page_090.pro
a72902205f31d37621abc6ae9e7b381b
f8e133ffc0f6ae3e84fcbf04960909be9bec5d62
2445890 F20101117_AACBAZ bermudez_d.pdf
9e4fdc2dba60217d2994997ee6de704f
7081f81e74ded9d8bdc401c7542b9f9809f834e0
50545 F20101117_AACAVT bermudez_d_Page_070.pro
659126c12eef8e20f17679fec774944d
851b498e8844cceaf6db2aa0f72ee1c1e118b30b
21098 F20101117_AACBBN bermudez_d_Page_043.QC.jpg
7e5d91b29cae1852f62760311c4c5b33
1581e723cda2538274abd7dcfd66380f79a734c3
3274 F20101117_AACBCD bermudez_d_Page_060thm.jpg
5cef04d928defe14fd0a3681116ebae8
f975011252a68a725495e1c1b7bbccedd41541e2
14166 F20101117_AACAWI bermudez_d_Page_093.pro
d0e94c1e37589da46429004c814a9af5
93c753c6a2048d5cbf44976b54ee54cb00c2c7d7
53020 F20101117_AACAVU bermudez_d_Page_071.pro
c8dcb2b516e422153e89d2aa22326779
29f09917f24917e1b334d099292cb9ccde9b199b
14191 F20101117_AACBBO bermudez_d_Page_110.QC.jpg
fd05dc884d8fc68db0ddacb61d4006e8
0b4448f072809f21c4ccd05a07067fb32019d807
2064 F20101117_AACBCE bermudez_d_Page_008thm.jpg
477ef21d6e0168bb91693f643b2a89ac
bd8ab8b8d59bd01b42a64adb67ffdd7dc0e7f024
16704 F20101117_AACAWJ bermudez_d_Page_094.pro
d636f0c4b0ab163839c378d3b23abf2f
d7c8ae7c2d04fe004164063682d89d0c50c7d8f0
F20101117_AACAVV bermudez_d_Page_073.pro
ec9b334ec1d5aaa2b967b647c9da202b
ed5bbed5803a43314ff8d5f1d2b6855bff9a9db9
3122 F20101117_AACBBP bermudez_d_Page_101thm.jpg
d407fb6d7ead6cc2cd78a74577a5d95e
47f4204dd42ff6eda23dee02a5be83a1ed2cd260
26848 F20101117_AACBCF bermudez_d_Page_028.QC.jpg
a8a616d60268b5f53e1c1bb6b5c69146
f95fdf6a1d463ce8b9c6e16fef05a99e006e0865
14866 F20101117_AACAWK bermudez_d_Page_097.pro
b2aeabe3c215a6359c4e6bac32c51d69
b52ae52db7455a4a4fe58fecf1a67ae037e88d23
52200 F20101117_AACAVW bermudez_d_Page_074.pro
944a64005643831ed582c1bb2939a704
0d9f8b647efbd4c97b42650df8be38af53fcfb2c
26127 F20101117_AACBBQ bermudez_d_Page_052.QC.jpg
6693727cf4cc8df266d6d52a3d96da44
6e46ffd85f4ad8caadc35063f7770256086f50b2
11913 F20101117_AACBCG bermudez_d_Page_098.QC.jpg
e810878c7d1d449c489163416147f80c
39aaf7654241db3a373665b3094355ed11571b55
15832 F20101117_AACAWL bermudez_d_Page_098.pro
5cf354eb74f44fd0153d0c42ff365bef
24a7bec7db82bb84b581ba075b44599326a1398b
43006 F20101117_AACAVX bermudez_d_Page_075.pro
3af21370c3451dbbe87a345705ea85d3
94b1a931dd8f172361c2f3f8dfcc62cde55fbce7
45691 F20101117_AACAXA bermudez_d_Page_120.pro
e12f55056d7c6cd7d879eb7ba9fe538b
ad229453af898a38bcc7473453c593c6803b7fb1
5063 F20101117_AACBBR bermudez_d_Page_016.QC.jpg
a61c785eb87da1aafe7f4ea6af0680ef
d6e5a4bd7b2ba95451777a5db24cd04daa66ab0e