<%BANNER%>

Characterization of Genomic, Subgenomic and Defective Interfering RNAs and Development of Molecular and Serological Diag...

Permanent Link: http://ufdc.ufl.edu/UFE0021734/00001

Material Information

Title: Characterization of Genomic, Subgenomic and Defective Interfering RNAs and Development of Molecular and Serological Diagnostic Methods for Cytoplasmic Citrus Leprosis Virus (CCLV) Isolated from Panama
Physical Description: 1 online resource (116 p.)
Language: english
Creator: Guerra, Abby S
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2007

Subjects

Subjects / Keywords: antibodies, citrus, cytoplasmic, defectives, elisa, hibrydization, interfering, leprosis, panama, pcr, rnas, rt, serological, subgenomic, virus
Plant Pathology -- Dissertations, Academic -- UF
Genre: Plant Pathology thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Citrus leprosis is one of the most important viral diseases of citrus in Brazil, with more than 21 % of the total citrus production cost (US$ 75 million/year) used for miticides to control Brevipalpus mites that vector the virus. The disease has been present in South American countries for almost a century. Leprosis disease is now an economically important emerging disease of citrus in Central America and Mexico, and threatens citrus industries in North America and the Caribbean Basin. The sequence of the Cytoplasmic citrus leprosis virus (CCLV) isolated from Panama and further characterization of the subgenomic (sg-) and defective interfering (DI-) RNAs associated with this isolate are reported in this study. CCLV is a positive-sense bipartite RNA virus, which shares low homology with the sequenced genomes of other positive-sense RNA viruses. The bipartite nature of the CCLV genome was shown by Northern blot analyses using probes targeting different regions of the CCLV genome and by sequencing of the genomic (g-), sg- and DI-RNAs associated with CCLV. All of the g-, sg- and DI-RNAs were capped with a 5? m7GpppN structure and had 3? poly(A) tails. RNA 1 possessed two ORFs. ORF 1 encoded a putative 276 kDa polyprotein containing domains similar to the Sindbis-like virus super group. ORF 2 showed no similarity with other sequences in the GenBank. RNA 2 had four ORFs. While ORFs 1, 2 and 4 showed no similarity with sequences in the GenBank, ORF 3 encoded a putative 31 kDa movement protein. Four sg-RNAs, ranging from 937 to 3389 nt, were identified in CCLV-infected citrus tissue. There was one sg-RNA associated with RNA 1 and three sg-RNAs associated with RNA 2. Smaller than full genome DI-RNAs, ranging from 1047 to 1886 nt, also were found. CCLV is a unique virus sharing little homology with other reported viruses, and in having 5? m7GpppN-capped and a 3? poly(A) tailed g-, sg- and DI-RNAs. The Panamanian CCLV isolate shared more than 99.2 % nt identity with the sequences of CCLV sequences from Brazil previously reported in the GenBank. Molecular and serological assays for the detection of CCLV also are reported in this study. Both RT-PCR primers and polyclonal antibodies against CCLV were designed based on the properties of the highly expressed ORF 2 of RNA 1 and ORF 4 of RNA 2. Using the newly developed RT-PCR diagnostic method, the CCLV was detected in samples with leprosis symptoms collected from Panama, Brazil, Guatemala and Venezuela, but not from healthy samples from Panama and Florida. Using polyclonal antibodies developed in rabbit and chicken, raised against to a non-structural CCLV protein (ORF 2 RNA 1), CCLV was detected in naturally infected citrus plants and also in Brevipalpus mites collected from infected citrus trees. While serological methods are less sensitive than RT-PCR methods, the serological methods presented in this study are more appropriate for large scale surveys. The implementation of the molecular and serological procedures detailed here will be useful for epidemiological surveys as well for use in certification and quarantine programs
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Abby S Guerra.
Thesis: Thesis (Ph.D.)--University of Florida, 2007.
Local: Adviser: Brlansky, Ronald H.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2008-12-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2007
System ID: UFE0021734:00001

Permanent Link: http://ufdc.ufl.edu/UFE0021734/00001

Material Information

Title: Characterization of Genomic, Subgenomic and Defective Interfering RNAs and Development of Molecular and Serological Diagnostic Methods for Cytoplasmic Citrus Leprosis Virus (CCLV) Isolated from Panama
Physical Description: 1 online resource (116 p.)
Language: english
Creator: Guerra, Abby S
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2007

Subjects

Subjects / Keywords: antibodies, citrus, cytoplasmic, defectives, elisa, hibrydization, interfering, leprosis, panama, pcr, rnas, rt, serological, subgenomic, virus
Plant Pathology -- Dissertations, Academic -- UF
Genre: Plant Pathology thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Citrus leprosis is one of the most important viral diseases of citrus in Brazil, with more than 21 % of the total citrus production cost (US$ 75 million/year) used for miticides to control Brevipalpus mites that vector the virus. The disease has been present in South American countries for almost a century. Leprosis disease is now an economically important emerging disease of citrus in Central America and Mexico, and threatens citrus industries in North America and the Caribbean Basin. The sequence of the Cytoplasmic citrus leprosis virus (CCLV) isolated from Panama and further characterization of the subgenomic (sg-) and defective interfering (DI-) RNAs associated with this isolate are reported in this study. CCLV is a positive-sense bipartite RNA virus, which shares low homology with the sequenced genomes of other positive-sense RNA viruses. The bipartite nature of the CCLV genome was shown by Northern blot analyses using probes targeting different regions of the CCLV genome and by sequencing of the genomic (g-), sg- and DI-RNAs associated with CCLV. All of the g-, sg- and DI-RNAs were capped with a 5? m7GpppN structure and had 3? poly(A) tails. RNA 1 possessed two ORFs. ORF 1 encoded a putative 276 kDa polyprotein containing domains similar to the Sindbis-like virus super group. ORF 2 showed no similarity with other sequences in the GenBank. RNA 2 had four ORFs. While ORFs 1, 2 and 4 showed no similarity with sequences in the GenBank, ORF 3 encoded a putative 31 kDa movement protein. Four sg-RNAs, ranging from 937 to 3389 nt, were identified in CCLV-infected citrus tissue. There was one sg-RNA associated with RNA 1 and three sg-RNAs associated with RNA 2. Smaller than full genome DI-RNAs, ranging from 1047 to 1886 nt, also were found. CCLV is a unique virus sharing little homology with other reported viruses, and in having 5? m7GpppN-capped and a 3? poly(A) tailed g-, sg- and DI-RNAs. The Panamanian CCLV isolate shared more than 99.2 % nt identity with the sequences of CCLV sequences from Brazil previously reported in the GenBank. Molecular and serological assays for the detection of CCLV also are reported in this study. Both RT-PCR primers and polyclonal antibodies against CCLV were designed based on the properties of the highly expressed ORF 2 of RNA 1 and ORF 4 of RNA 2. Using the newly developed RT-PCR diagnostic method, the CCLV was detected in samples with leprosis symptoms collected from Panama, Brazil, Guatemala and Venezuela, but not from healthy samples from Panama and Florida. Using polyclonal antibodies developed in rabbit and chicken, raised against to a non-structural CCLV protein (ORF 2 RNA 1), CCLV was detected in naturally infected citrus plants and also in Brevipalpus mites collected from infected citrus trees. While serological methods are less sensitive than RT-PCR methods, the serological methods presented in this study are more appropriate for large scale surveys. The implementation of the molecular and serological procedures detailed here will be useful for epidemiological surveys as well for use in certification and quarantine programs
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Abby S Guerra.
Thesis: Thesis (Ph.D.)--University of Florida, 2007.
Local: Adviser: Brlansky, Ronald H.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2008-12-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2007
System ID: UFE0021734:00001


This item has the following downloads:


Full Text

PAGE 1

1 CHARACTERIZATION OF GENOMIC, SU BGENOMIC AND DEFECTIVE INTERFERING RNAS AND DEVELOPMENT OF MOLECUL AR AND SEROLOGICAL DIAGNOSTIC METHODS FOR CYTOPLASMIC CITRUS LEPRO SIS VIRUS (CCLV) ISOLATED FROM PANAMA By ABBY SAID GUERRA-MORENO A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2007

PAGE 2

2 2007 Abby Said Guerra-Moreno

PAGE 3

3 Al igual que durante mi s estudios de maestra, esta vez dedicar este logro a cuatro seres inigualables. En primera instancia al Seor Todopoderoso por ser la luz en la oscuridad y mi fuente de inspiracin. Igualmen te dedico este triunfo a mi madre querida, quien es la persona ms especial que jams he conocido, que siempr e me ha brindado su apoyo y comprensin en las desiciones que he tomado en esta, mi vida.Tambien quiero dedicar este gran logro de mi vida a dos sere s que, a pesar del poco tiempo de conocerlos, han cambiado el rumbo de mi vida por comp leto: mi amada novia/prometida/esposa/amiga Signy y nuestro querido(a) hijo(a) que ya vi ene en camino. DIOS, Mally, Signy y mi Bebe, por siempre conmigo en mi corazon...

PAGE 4

4 ACKNOWLEDGMENTS My most sincere thanks go to the chair of my committee, Dr. Ronald Brlansky, for all of his support, guidance and supervis ion during these years of my P h.D. studies. I also desire to express high gratitude to memb ers of my supervisory committee Drs. Jane Polston, and Gloria Moore, for their invaluable advice and patience. I will like to extend my special thanks to Dr. Richard Lee who went beyond the call of duty and offered me 100% support since I came from Panama in 2001 with no knowledge about this new language and lab t echniques. Dr. K. L. Manjunath requires special mention for his daily input and unwave ring support. Almost everything that I have learned during this process is thanks to him. My familys love, unconditional support, and encouragement demand special mention. There are not enough words of kindness and gratitude to give them proper thanks. I will like to express my gratitude to Ma lly, Lala, Golla and Berta. The friends I have made while in Gainesville ha ve been critical to my success. All of these people, especially Alana, Choaa, Amandeep, Vicente, Denise, Oscar, Osvaldo, Bo, Jessica, Sylvia and Kris now occupy a permanent niche in my heart, and I am eternally grateful to them all. An sincere thanks to all of the members of the Plant Pathology Department for their heartfelt help during all these years as gr aduate student. Dr. E. Hiebert de serves a special mention for his daily mentoring in the lab. Finally, I will like to express my eternal gratitude to my lovely esposa/amiga/compaera, Signy, for her careful support, company (from far, but close to my heart) a nd love during the last year of my Ph.D. studies. I can not leave behind, and also say thanks to my adorable kid that is coming soon (Thais Rocio or Sebastian).

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS...............................................................................................................4 LIST OF TABLES................................................................................................................. ..........7 LIST OF FIGURES................................................................................................................ .........8 ABSTRACT....................................................................................................................... ............10 CHAPTER 1 LITERATURE REVIEW.......................................................................................................12 Citrus and Citrus Diseases Worldwide...................................................................................12 Economic Importance of Citrus Le prosis and its Mite Vectors.............................................13 Symptoms of Citrus Leprosis.................................................................................................14 Historic Perspective and Impact of Citrus Leprosis Disease..................................................15 Geographical Distribution of Leprosis...................................................................................17 Citrus Leprosis in Panama......................................................................................................18 Virus Properties, Morphology and Cytopathological Effect..................................................18 Host Range of Leprosis......................................................................................................... .20 Genetic Resistance to Leprosis...............................................................................................21 Transmission of Citrus Leprosis.............................................................................................22 Mite Vectors Biology and Transmission...............................................................................23 Molecular Characterization of Leprosis Virus.......................................................................25 Methods of Detection for Leprosis.........................................................................................27 Management of Leprosis Disease...........................................................................................28 Purpose of the Current Research............................................................................................30 2 MOLECULAR CHARACTERIZATION OF GENOMIC, SUBGENOMIC AND DEFECTIVE INTERFERING RNAS OF A PANAMANIAN ISOLATE OF CYTOPLASMIC CITRUS LEPROSIS VIRUS....................................................................31 Introduction................................................................................................................... ..........31 Material and Methods........................................................................................................... ..33 Virus Samples..................................................................................................................33 Total Nucleic Acid Extraction and RNA Isolation..........................................................34 Analysis of Putative Viral Se quences from a cDNA Library..........................................34 Comparison of Putative Viral Sequences........................................................................35 Primer Design..................................................................................................................35 Northern Blot Analys is Using DNA Probes....................................................................35 Further Sequencing of CCLV RNAs...............................................................................36 Determination of the 5 and 3 Ends of CCLV gand sgRNAs......................................37 Analysis of the 5 and 3 UTRs of CCLV RNAs............................................................39 Cloning, Sequencing and Analysis of CCLV sgand DI-RNAs.....................................39

PAGE 6

6 Phylogenetic Relationships Among the ORFs of CCLV and Other Plant Viruses.........40 Prediction of the Transmembrane Do main of CCLV Putative Proteins.........................41 Sequence Analysis of CCLV Isolates From Panama and Brazil.....................................41 Results........................................................................................................................ .............41 Analysis of Putative Viral Se quences From a cDNA Library.........................................41 Northern Blot Analys is Using DNA Probes....................................................................42 Further Sequencing of the CCLV Genomic RNAs.........................................................43 Analysis of CCLV Genomic RNAs................................................................................44 Analysis of the 5 and 3 UTRs of CCLV RNAs............................................................45 Phylogenetic Relationships Among the ORFs of CCLV and Other Plant Viruses.........45 Sequence Analysis of CCLV Isolates From Panama and Brazil.....................................46 Cloning, Sequencing and Analysis of CCLV sgand DI-RNAs.....................................46 Discussion..................................................................................................................... ..........48 3 MOLECULAR AND SEROLOGICAL DETECTION OF THE CYTOPLASMIC CITRUS LEPROSIS VIRUS (CCLV) USING RT-PCR PRIMERS TARGETING DIFFERENT CCLV GENES AND POLYCLONAL ANTISERA.......................................71 Introduction................................................................................................................... ..........71 Materials and Methods.......................................................................................................... .72 Virus Source................................................................................................................... .72 Total Nucleic Acid Extraction and RNA Isolation..........................................................73 Primer Design..................................................................................................................73 Reverse Transcription (RT) and Polymerase Chain Reaction (PCR).............................74 Protein Extraction............................................................................................................75 Cloning and Expression of CCLV p29 Protein...............................................................75 Western Blot Detec tion of CCLV p29............................................................................76 Immuno Imprint Detection of CCLV Using Antibodies Against p29............................76 Enzyme-linked Immunosorbent Assay (ELISA) for CCLV...........................................77 Results........................................................................................................................ .............78 Reverse Transcription (RT) and Polymerase Chain Reaction (PCR).............................78 Western Blot Detec tion of CCLV p29............................................................................79 Immuno Imprint Detection of CCLV Using Antibodies Against p29............................80 Enzyme-linked Immunosorbent Assay (ELISA) for CCLV...........................................80 Discussion..................................................................................................................... ..........81 4 GENERAL CONCLUSIONS.................................................................................................96 LIST OF REFERENCES.............................................................................................................100 BIOGRAPHICAL SKETCH.......................................................................................................116

PAGE 7

7 LIST OF TABLES Table page 2-1 Primers used for analysis of Cytoplasmic citrus leprosis virus (CCLV)...........................57 2-2 Nucleotide sequence comparison between Panamanian and Brazilian isolates of Cytoplasmic citrus leprosis virus (CCLV)........................................................................58 3-1 Detailed description of the citrus samp les collected from Chiriqu and Veraguas, Panama during July 2005 and used in DASI-ELISA assays.............................................86 3-2 Primers used for RT-PCR analysis of Cytoplasmic citrus leprosis virus (CCLV)............87

PAGE 8

8 LIST OF FIGURES Figure page 2-1 Symptoms of leprosis disease on citrus leaves..................................................................59 2-2 Symptoms of leprosis diseas e on citrus fruit and twigs.....................................................60 2-3 Northern blot analysis of total RNA extr actions from citrus tissue using DIG-labeled DNA probe from ORF 1 CCLV RNA 1............................................................................61 2-4 Northern blots using DNA probes from ORFs 3 and 4 of CCLV RNA 2.........................62 2-5 Long distance RT-PCR amplif ication of CCLV g-RNAs.................................................63 2-6 RT-PCR amplification of 5 term ini of decapped CCLV RNA 1 and 2............................64 2-7 Schematic genome (g-) and subgenomic (sg-) organization of CCLV RNAs...................65 2-8 Sequence alignment analysis of the 5 and 3 UTRs of CCLV g-RNAs. .........................66 2-9 Phylogenetic analysis between cons erved motifs in CCLV ORF 1 RNA 1, ORF 3 RNA 2 and related plant viruses........................................................................................67 2-10 Graphic representation of the putative transmembrane domains found in ORFs 2 and 4 of CCLV RNA 2 using TM HMM computer software....................................................68 2-11 Schematic representation of the CCLV gand DI-RNAs .................................................69 2-12 Junction sequence regions of CCLV DI-RNAs molecules................................................70 3-1 RT-PCR amplification of CCLV RNA 1 ORFs 1 and 2; and RNA 2 ORF 4....................88 3-2 RT-PCR detection of CCLV in samples collected from different countries.....................89 3-3 Western blot detection of CCLV p29 using polyclonal antibodies...................................90 3-4 Immuno Imprint detection of CCLV p29 in citrus samples collected from Potrerillos and Boquete, Panama using polyclonal antibodies developed in rabbits (R_p29-27).........91 3-5 Immuno imprint detection of CCLV p29 in citrus samples collected from Potrerillos and Boquete, Panama using polyclonal antibodies raised in chicken (C_p29-28)..............92 3-6 DASI-ELISA detection of CCLV in sample s from citrus leaves, fruits and twigs collected from Boquete and Potrer illos, Panama during July 2005...................................93 3-7 DASI-ELISA detection of CCLV in sample s from citrus leaves, fruits and twigs collected from Boquete and Potreril los, Panama during December 2006.........................94

PAGE 9

9 3-8 DASI-ELISA detection of CCLV in sample s from citrus leaves, fruits and twigs collected from Boquete and Potrer illos, Panama during June 2007..................................95

PAGE 10

10 Abstract of Dissertation Pres ented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy CHARACTERIZATION OF GENOMIC, SU BGENOMIC AND DEFECTIVE INTERFERING RNAS AND DEVELOPMENT OF MOLECUL AR AND SEROLOGICAL DIAGNOSTIC METHODS FOR CYTOPLASMIC CITRUS LEPRO SIS VIRUS (CCLV) ISOLATED FROM PANAMA By Abby Said Guerra-Moreno December, 2007 Chair: Ronald H. Brlansky Major: Plant Pathology Citrus leprosis is one of the most important vi ral diseases of citrus in Brazil, with more than 21 % of the total citrus production cost (US$ 75 million/year) used for miticides to control Brevipalpus mites that vector the vi rus. The disease has been present in South American countries for almost a century. Leprosis dis ease is now an economically important emerging disease of citrus in Central America and Mexi co, and threatens citrus industries in North America and the Caribbean Basin. The sequence of the Cytoplasmic citrus leprosis virus (CCLV) isolated from Panama and further characterization of the subgenomic (sg-) and defective interfering (DI-) RNAs associated with this isolate are reported in this study. CCLV is a positive-sense bipartite RNA virus, which shares low homology with the sequenced genomes of other positive-sense RNA viruses. The bipartite nature of the CCLV genome was show n by Northern blot analyses using probes targeting different regions of the CCLV genome and by sequenci ng of the genomic (g-), sgand DI-RNAs associated with CCLV. All of the g-, sgand DI-RNAs were capped with a 5 m7GpppN structure and had 3 poly(A) tails. RNA 1 possessed two ORFs. ORF 1 encoded a putative 276 kDa polyprotein containing domains similar to the Sindbis-like virus super group.

PAGE 11

11 ORF 2 showed no similarity with other sequences in the GenBank. RNA 2 had four ORFs. While ORFs 1, 2 and 4 showed no similarity with seque nces in the GenBank, ORF 3 encoded a putative 31 kDa movement protein. Four sg-RNAs, rangi ng from 937 to 3389 nt, were identified in CCLV-infected citrus tissue. There was one sg -RNA associated with RNA 1 and three sg-RNAs associated with RNA 2. Smaller than full ge nome DI-RNAs, ranging from 1047 to 1886 nt, also were found. CCLV is a unique virus sharing little homology with other reported viruses, and in having 5 m7GpppN-capped and a 3 poly(A) tailed g-, sgand DI-RNAs. The Panamanian CCLV isolate shared more than 99.2 % nt identity with the sequences of CCLV sequences from Brazil previously reported in the GenBank. Molecular and serological assays for the detect ion of CCLV also are reported in this study. Both RT-PCR primers and polyclonal antibodi es against CCLV were designed based on the properties of the highly expressed ORF 2 of RNA 1 and ORF 4 of RNA 2. Using the newly developed RT-PCR diagnostic method, the CCLV was detected in samples with leprosis symptoms collected from Panama, Brazil, Guat emala and Venezuela, but not from healthy samples from Panama and Florida. Using polycl onal antibodies developed in rabbit and chicken, raised against to a non-structural CCLV prot ein (ORF 2 RNA 1), CCLV was detected in naturally infected citrus plants and also in Brevipalpus mites collected from infected citrus trees. While serological methods are less sensitive than RT-PCR methods, the serological methods presented in this study are more appropriate for large scale surveys. The implementation of the molecular and serological procedur es detailed here will be useful for epidemiological surveys as well for use in certification and quarantine programs.

PAGE 12

12 CHAPTER 1 LITERATURE REVIEW Citrus and Citrus Diseases Worldwide Citrus is one of the most economically im portant agribusinesses worldwide (Whiteside, 2000). There has been a significant increase in the production and consumption of sweet oranges and other citrus types since the 1980s. The a nnual production of citrus worldwide for the 2000 2004 period was estimated at over 105 million metric tons (MT) and sweet oranges constituted more than half of the total production (UNCTA D, 2005). Although, citrus is produced in about 140 countries worldwide, the major producers (70%) are Brazil, the Mediterranean countries, the United States, and China (U SDA, 2004; UNCTAD, 2005). In Florida, the citrus industry is estimated to have a US $9 billion-a-year economic impact and is second only to tourism in importance (Florida Department of Citrus, 2003). There are 323,750 ha of citrus and more than 100 million citr us trees in Florida (Florida Agricultural Statistics Service, 2003). The total US productio n of citrus was estimated at 15 million MT for the 2003-2004 period (USDA, 2004). Approximately 90,000 Floridians work in the citrus industry or in related businesses (FDACS; 2003; USDA, 2003). Florida production accounts for 74% of the total US citrus production; with Ca lifornia contributing 23% and Texas and Arizona making up the remaining 3% (USDA, 2003). Citrus is also important for the national economy of Panama. About 14,000 ha of citrus are grown in Panama for fresh fruit and processed markets internally and for international trade (Dominguez et al., 2001). The citriculture in Panama is based mainly on the cultivation of sweet orange; with the production for the year 2005 estimated at 42,000 MT (FAO, 2006). The increasing local demand for citrus has helped the growth of the Panamanian citrus industry in recent years (MIDA, 2000). During the last 10 year s, the area used for citrus production has

PAGE 13

13 increased considerably, mainly in Chiriqu, Ve raguas and Cocl province s (Contralora General de la Repblica de Panam, 2003). The Florida citrus industry has been threatened during the la st two decades by several new and emerging diseases. Citrus canker, caused by Xanthomonas axonopodis pv. citri thought to be eradicated in the 1980s, was found again in South Florida in 1995 (Gottwald et al., 2001; Graham et al., 2004). The most efficient vector of Citrus tristeza virus (CTV), the brown citrus aphid, Toxoptera citricida was discovered in Florida in 1995 (Halbert & Manjunath, 2004; Halbert et al. 2004) and spread endemic decline CTV st rains. The psyllid vector of citrus huanglongbing (citrus greening), Di aphorina citri, was first discovered in 1998 (Halbert & Manjunath, 2004), and the causal agent Candidatus Liberibacter asiaticus, was first detected in Florida in 2005 (Li et al., 2006). Other citrus diseases such as citrus leprosis, citrus variegated chlorosis caused by Xyllela fastidiosa (Chang et al., 1993); citrus sudden death (CSD) and other graft-transmissible disease of unknown etiology (Bassanezi et al., 2003) have occurred in Brazil and caused great concern to the Florida citrus industry. Brevipalpus spp mite vectors of citrus leprosis are already present in Florida and other citrus produci ng states in the USA (Childers et al., 2003b; Knorr, 1968; Knorr, et al. 1968). The introduction of citrus leprosis disease into the United States could have a major economic impact. Economic Importance of Citrus Leprosis and its Mite Vectors Citrus leprosis disease is one of the most important viral diseases of citrus in Brazil (Bastianel et al. 2006b; Rodrigues, 2000). The Brazilian citrus industry spends over US $75 million annually (about 21% of the total cost of citrus production) on miticides to control the Brevipalpus spp mites vector of leprosis (Omoto, 1998; Rodrigues et al. 2003; Rodrigues & Machado, 2000). Leprosis diseas e is spread mainly through the movement of infected Brevipalpus spp. mites in citrus groves (Teodoro & Reis, 2006). The flat anatomy of Brevipalpus

PAGE 14

14 mites (also known as flat or false spider mite s) helps its long distan ce dispersal by wind flows (Bassanezi & Laranj eira, 2007; Rodrigues et al. 2003). The economical importance of Brevipalpus is based on its high fecundity and survival rates, asexual reproduction (thely tokous parthenogenesis), ubiqu itous behavior, polyphagia, and its ability to vector several viral diseases to citrus, coffee and ornamentals (Childers et al. 2001a; Guerra-Moreno, 2004; Kitajima et al. 2003a; Rodrigues et al. 2003; Rodrigues, 2000; Teodoro & Reis, 2006). The mites are cosmopolitan (Haram oto, 1969), and they are found in all citrus producing areas worldwide, but they are consid ered a major pest in those countries where leprosis is present (Bastianel et al. 2006b; Rodrigues, 2000). Symptoms of Citrus Leprosis Leprosis disease usually causes diagnositic sy mptoms on citrus leaves, fruit, twigs and bark (Childers et al., 2001b; Lovisolo, 2001). In many places, leprosis outbreaks become severe, causing defoliation and premature fruit fall as de scribed for lepra explosiva in Argentina (Childers et al. 2003b; Childers et al. 2001b; Frezzi, 1940).However, symptoms may vary depending on citrus variety, region, and the stage of orchard de velopment (Childers et al. 2001a; Lovisolo, 2001; Rodrigues, 2000). On green fruit, the lesions are initially yellow, becoming more brown or black as they age, sometimes also becoming depressed. On mature fr uit, lesions are 10-15 mm wide with a necrotic center. Gum exudation is also observed occasiona lly on the lesion (Bitancourt, 1937; Lovisolo, 2001; Rossetti, 1996; 2001). Highly in fected citrus fruit may cont ain up to 30 lesions covering much of the fruit surface (Guerra-Moreno, 2004; Rodrigues, 2000). Leprosis is economically important because of significan t long-term tree decline, loss in production, and ultimately death of the trees if mite control is not done (Bassanezi & Laranjeira, 2007; Bastianel et al. 2006b; Rodrigues, 2000). Leprosis disease affects the app earance of citrus fruit and not only reduces the

PAGE 15

15 fresh market value, but also the nutritional value of the fruit (Rodrigues, 2000). In infected citrus fruits, lower levels of N, but higher levels of Ca, S and Fe have been documented compared to healthy plants (Nogueira et al. 1996). The leaf symptoms of leprosis are usually round lesions with a dark-brown or black central spot about 2-7 mm in diameter, surrounded by a chlo rotic halo, in which 1 to 3 brownish rings frequently appear surrounding the central spot (Rodrigue s, 2000). On bark and twigs, lesions can be protuberant, cortical, and grey or brown in color. Lesions ma y coalesce on the twig or branch, leading to the death of the twig or die back (Bitancourt, 1937; Frezzi, 1940; Rossetti, 2001). Although leprosis lesions are us ually characteristic leaf symptoms may sometimes be mistaken for lesions of citrus canker (Rossetti, 1980). The bark symptoms of leprosis may sometimes be confused with zonate chlorosis; false leprosis, African concentric ring blotch of citrus, psorosis or genetic brown spot (Lovisolo, 2001; R odrigues, 2000). The misidentification of the disease has reinforced the needs for quick and reliable diagnostic methods to detect the virus. Historic Perspective and Impact of Citrus Leprosis Disease Leprosis disease has been called by several common names. In Florida, leprosis was known as scaly bark because of symptoms on the bark and as nail head rust because of the symptoms on the fruit (Fawcett & Lee, 1926; K norr, 1973; Knorr & Price, 1958). In Argentina the disease was called lepra expl osiva because of the severity of the disease (Frezzi, 1940), and in Brazil as leprose or variola (Bitancourt, 193 7) because of the similarities of the symptoms with the homonymous human disease. For many years the etiology of leprosis disease was unknown and was erroneously attributed to various pathogens (Childers et al., 2003b; Knorr, 1968; Rodrigues, 2000). Interestingly, the first report of citrus leprosis came from Pi nellas County, Florida, where the

PAGE 16

16 disease was attributed to the fungus Caldosporium herbarum var. citricolum (Fawcett, 1911). In Paraguay during the 1920s, the diseas e was associated with the fungus Amylorosa aurantiarum (Knorr, 1968). Later observations su ggested that mite nymphs reared from virus-free eggs were able to cause leprosis symptoms after feeding fo r several hours on uninfected citrus trees, as well as mites taken from infected c itrus trees (Knorr, 1968; Knorr, et al. 1968), suggesting that the disease was caused by mite feeding damage or by a toxin injected into ci trus by mites (Chagas & Rossetti, 1980; Chagas et al. 1984; Knorr, 1968). However, mechanical and graft transmission of leprosis, together with the electron microscopy evidence of rhabdovirus-like pa rticles found in leprosis-affected citrus tissu e and in leprosis-infected B. phoenicis mites, discounted the idea that leprosis was caused by mite toxins or by mite feeding (Colariccio et al. 1995; Rodrigues et al. 2003). Further experimental transm ission of leprosis using mites from infected plants supported the idea that leprosis was caused by a pat hogen, probably a virus, which was vectored by Brevipalpus mites (Colariccio et al. 1995; Kitajima et al. 1972; Rossetti, 1996). During the early 1900s, citrus leprosis had a serious negative impact on Florida citrus production (Fawcett, 1911; Fawce tt & Lee, 1926). After 1926, the incidence of leprosis in Florida drastically declined. This decline coincide d with the increased use of sulfur in the late 1920s as an effective miticide for controlli ng citrus rust mites (Knorr, 1968; Knorr et al. 1968). Childers et al., (2001a; 2001b; 2003b) speculated that the freeze of December 1962 may have been another contributing factor for the disappearance of the disease, because leprosis has not been detected in Florida following that freeze. Othe r factors, such as grov e management tactics, changes in the mites ability to transmit the virus or changes in the pathogen virulence, may have contributed to the disappearance of the disease in Florida (Childers et al. 2001a; Childers et al. 2003b). For whatever reason, citrus leprosis no longer occurs in Florida (Childers et al. 2003b),

PAGE 17

17 although the mite vectors are present in Florida, Texas and California (Childers et al. 2003b; Childers et al. 2003c; Knorr, 1968). The northward movement of leprosis from South America into Central America and towards North America suggests that the disease could be reintrodu ced into Florida and other US states (Childers et al. 2003b; Childers et al. 2003c; Guerra-Moreno et al. 2003; GuerraMoreno, 2004; Guerra-Moreno et al. 2005a; Knorr, 1968). Recently, more than 80 mite species, including B. phoenicis were detected in air cargo shipment s of ornamental rooted plants and cuttings arriving from Central Am erican countries where citrus le prosis is present (Childers & Rodrigues, 2005); highlighting the danger to the Florida and U.S. citrus and ornamental industries. Geographical Distribution of Leprosis Citrus leprosis disease was first reported in Paraguay South America in the 1920s and late reports then was found in Argentina, Braz il, and Uruguay (Bitancourt, 1937; Childers et al. 2001a; Childers et al. 2003b; Fawcett & Lee, 1926; Knorr et al. 1968; Rodrigues et al. 2003). It is now emerging as a spreadi ng disease in Venezuela (Childers et al. 2001a) and Panama (Dominguez et al. 2001; Guerra-Moreno, 2004; Guerra-Moreno et al. 2005a; Guerra-Moreno et al. 2005b). Recently the disease has been report ed in Costa Rica (Araya-Gonzalez, 2000), Guatemala (Palmieri et al. 2005), Honduras (Rodrigues et al. 2007), Nicaragua (Meza Guerrero, 2003), Bolivia (Gmez et al. 2005), Mexico (Snchez-Anguiano, 2005) and Colombia (Leon M. et al. 2006). Citrus leprosis now poses a seriou s threat to citrus production in North America and the Caribbean Basin. Sy mptoms of leprosis-like diseas es have been reported from citrus-producing areas of Asia and Africa (Fawcett & L ee, 1926; Knorr & Pr ice, 1958; Rhoads & DeBusk, 1931), but none of these reports have b een confirmed to be leprosis (Lovisolo, 2001).

PAGE 18

18 Citrus Leprosis in Panama Citrus leprosis-like symptoms were first repo rted during the early 1990s in citrus orchards in Boquete and Potrerillos, Chiriqu State, Panama (Botello, L., pe rsonal communication). The presence of citrus leprosis virus in those areas was confir med using transmission electron microscopy (TEM) (Dominguez et al. 2001; Guerra-Moreno et al. 2003; Guerra-Moreno, 2004; Guerra-Moreno et al. 2004). The disease may have been introduced by infected mites or budwood in the 1980s through illegal importatio ns from Brazil (Botello, L., personal communication). Recommendations were made to eradicate the disease from Panama (Dominguez et al. 2001; Fernandez, O. and Botello, L ., personal communication). Other scientists from Brazil and USA also made recomm endations to avoid the spreading of the disease by pruning and burning of the infected trees, appli cation of miticides, and quarantine programs to stop the movement of infected materials (B otello, L., personal communication; Childers et al., 2001b; Guerra-Moreno, 2004). However, none of these recommendations were successfully implemented, and leprosis has been observed in ot her provinces of Panama (Bernal, A., personal communication). Virus Properties, Morphology and Cytopathological Effect Early in the 1970s the observation of rod-lik e particles (40-50 nm 100-110 nm) in the nucleus and cytoplasm of leprosis-affect ed citrus tissue was reported (Kitajima et al. 1972). The particles were associated with nuclear and endoplasmic reticulum membranes and at times electro-lucent, amorphous viroplas ms were found in the nuclei of infected cells. Based on the particle shape and cytopathological effects observed in infected ti ssue, the virus was tentatively placed into the Rhabdoviridae family (Kitajima et al. 1972; Rodrigues, 2000; Rodrigues & Machado, 2000). In later TEM studies, the virus was reported to occur only in the cytoplasm (Colariccio et al. 1995; Kitajima, 1974; Rodrigues, 2000). Th ese virus particles were bacilliform

PAGE 19

19 (50-60 nm 100-110 nm) and found within cist ernae of the endoplasmic reticulum with electron-dense, vacuolated viroplasms in the cyt oplasm. These two distinct cytological features suggested that citrus leprosis maybe caused by two different viruses; one virus present in cytoplasm only and the other virus presen t predominantly in the nucleus (Childers et al. 2001a; Kitajima et al. 2003a). Also, it has been hypothesized that the virus may be located either in the nucleus or the cytoplasm, depending on the early or late developmental stage of the virus, respectively (Colariccio et al. 1995). Based on virion morphology, subcellular local ization, cytopathological effects and sequence analysis, at least two different viruses have been associated with citrus leprosis (Guerra-Moreno, 2004; Guerra-Moreno, et al. 2005; Kitajima et al. 1972; Kitajima et al, 1974; Rodrigues, 2000 Locali-Fabris et al. 2006; Pascon et al. 2006). The Cytoplasmic citrus leprosis virus (CCLV) with particles observed only in the cy toplasm, is seen most frequently, compared to the nuclear citrus leprosis virus (NCLV) wher e particles accumulate mainly in the nucleus, but some virions are also seen in the cytoplasm of infected citrus cel ls (Guerra-Moreno, 2004; Guerra-Moreno et al. 2005a; Kitajima et al. 2003a; Kitajima et al. 2000; Kitajima et al. 1972; Colariccio et al. 1995; Rodrigues, 2000). NCLV was re ported initially in Brazil (Kitajima et al. 1972); and since then has been repo rted only in So Paulo and Rio Grande do Sul States in Brazil (Bastianel et al. 2006b) and in Boquete, Chiriqu State, Panama (Dominguez et al. 2001; Guerra-Moreno et al. 2003; Guerra-Moreno, 2004; Guerra-Moreno et al. 2005a). Although CCLV has not been purified and accumula te in low concentration in infected citrus tissue (Rodrigues et al., 2003; Lovisolo et al., 2000), its physical properties was reported more than a decade ago. CCLV is a thermopile vi rus that multiplies only if the day temperature is above 24 C and the night temperature is above 21 C; the thermal inactivation point is 55-60

PAGE 20

20 C; longevity in vitro is 6 days at 4 C and 3 days at room te mperature as determined on herbaceous host by Lovisolo et al. (1996; 2000). The CCLV d ilution end point is 10-3 and it maintains its infectivity for a bout 45 months in dried leaves. CCLV coulb be partially purified from inoculated leaves of Chenopodium quinoa starting from 24 hours after inoculation (Lovisolo, 2001; Lovisolo et al. 2000). The cytopathological effects caus ed by CCLV inside citrus cells are similar to those caused by other plant pathogens (Dominguez et al., 2001; Guerra-Moreno, 2004; Kitajima et al., 1972). Light micrographs show abnormal cytopathol ogical effects including hypertrophy, hyperplasia and necrosis in tissues infected w ith CCLV from Panama (Guerra-Moreno et al. 2003; GuerraMoreno, 2004). Virus particles have been found only in symptomatic tissue and the surrounding asymptomatic tissue contained no virus particles (Guerra-Moreno et al. 2003; Guerra-Moreno, 2004; Kitajima et al. 1972; Kitajima et al. 1974). Host Range of Leprosis Leprosis was first documented in the late ni neteenth century in Pi nellas County, Florida (Fawcett & Lee, 1926; Knorr, 1973; Rhoads & DeBusk, 1931). All of the twelve known natural hosts of leprosis are in the genus Citrus (Chagas & Rossetti, 1980; Lovisolo, 2001; Lovisolo, et al., 2000). All commercial citrus vari eties are susceptible to leprosis and diffe rent reactions have been detected within the citrus varieties (R odrigues, 2000; Rodrigues & Machado, 2000). Sweet orange is the most susceptible natural host, while mandarins, le mons and other hybrids such as tangor Murcott ( Citrus sinensis C. reticulata ) are less susceptible under natural conditions (Bastianel et al. 2006a; Rodrigues, 2000; Rodrigues et al. 2007). Several ornamental and herbaceous plants ha ve been found with leprosis-like symptoms under natural and greenhous e conditions (Bastianel et al. 2006b; De Andrade-Maia & Leite De Oliveira, 2005; Lovisolo et al. 2000; Rodrigues et al. 2005). Also sweet ora nge varieties Natal

PAGE 21

21 and Valencia were found having leprosis-like symp toms after being inocul ated with infectious Brevipalpus mites raised on Ageratum conyzoides Commelina benghalensis Bixa orellana or Sida cordifolia (De Andrade-Maia & Leite De Oliveira 2005); however the presence of CCLV was not confirmed by TEM or RT-PCR analysis. The species B. orellana has been used largely as windbreaks and hedge rows, while S. cordifolia, A. conyzoides and C benghalensis are considered weeds. There is a ge neral concern that these plants may be alternative hosts for the virus as well as hosts for the vector (Bastianel et al. 2006b; De Andrade-Maia & Leite De Oliveira, 2005). Further, or namental plants of the Geraniaceae, Solanaceae and Acanthaceae families with leprosis-like symptoms have been identified, and virus-like particles were observed in symptomatic tissue by TEM analysis (Nogueira et al. 2003). More studies are needed to determine whether CCLV is presen t in these host plants and if Brevipalpus mites can vector the virus to or from these plant species. Recently, another herbaceous plant, Solanum violaefolium, was found with typical leprosis symptoms, and fo und to contain virus particles and gave positive results by RT-PCR after infection with Brevipalpus mites maintained on infected citrus seedlings (Rodrigues et al. 2005). Genetic Resistance to Leprosis Research toward understanding the genetic basis for resistance to leprosis is at an initial stage. It is known that mandari n and citrus hybrids are less susceptible to leprosis. Under natural conditions mandarin and others ci trus hybrids have showed minima l leprosis lesions (Rodrigues, 2000; Rodrigues et al, 2007). Recently, the progenies of cr osses between Pera sweet orange and tangor Murcott displayed a high level of resistance to c itrus leprosis, suggesting that inheritance of resist ance may be controlled by a majo r gene or few genes (Bastianel et al. 2006a), but plants have not been tested under field conditions.

PAGE 22

22 Transmission of Citrus Leprosis Mechanical transmission of CCLV has been reported by sap inoculation from infected sweet orange leaves, fruit peel, and young bark and from symptomatic Cleopatra mandarin leaves to herbaceous species such, as Chenopodium spp. and to Citrus sinensis cv. Caipira (Lovisolo et al. 1996; Lovisolo et al. 2000). The herbaceous species that are susceptible following mechanical inoc ulation belong to the Chenopodiaceae Amaranthaceae or Tetragoniaceae families; in the order Centrospermae Mechanical inoculation of the virus to these herbaceous hosts resulted in necrotic local lesions devel oping 2-3 days later. However, it has not been possible to i noculate the virus back to Citrus spp., even after partial purification (Bastianel et al. 2006b; Lovisolo, 2001; Rodrigues et al. 2007). Unsuccessful transmissions have been obtained by grafting techniques (Chagas et al. 1984; Rodrigues et al., 2003; Rodrigues, 2000). Symptomatic leaf tissue grafte d into healthy young citrus plants developed leprosis-like lesi ons 4.5 to 13 months later (Chagas & Rossetti, 1980; Chagas & Rossetti, 1984; Chagas et al. 1984). However, symptoms on the receptor plants remained adjacent to the symptomatic tissue grafted from the donor plant. After mechanical and mite transmission, the appearance of typical leprosis symptoms varied from few days to months (Kitajima et al. 2003a; Kitajima et al. 2000; Rodrigues, 2000; Rodrigues et al. 2003). Leprosis symptoms on infected ti ssue appeared 17-20 days to 2 months after inoculation with infected mites (Chiavegat o & Salibe, 1984; De A ndrade-Maia & Leite De Oliveira, 2005; Kitajima et al. 2003a; Kitajima et al. 2000; Rodrigues et al. 2003). Recently, mite transmission of NCLV from citrus to citrus was achieved; however, mechanical transmission has been unsuccessful (Bastianel et al. 2006b). Transmission of leprosis through seed has not been reported (Rodrigues, 2000).

PAGE 23

23 Mite Vectors Biol ogy and Transmission The false spider mites in the genus Brevipalpus (Acari: Tenuipalpidae ) are considered the vectors of the virus (Chagas et al. 1984; Rodrigues, 2000; R odrigues & Machado, 2000; Rodrigues et al. 2007). The association of lepros is with false spider mite ( B. obovatus ) was first reported in Argentina (Frezzi, 1940); B. californicus was associated with leprosis in Florida (Knorr, 1968; Knorr et al. ,1968); while leprosis in Br azil was associated with B. phoenicis (Musumeci & Rossetti, 1963). According to Haramoto (1969) and Gonzlez (1975), Brevipalpus mites are cosmopolitan and occur on citrus around the world. The three species of Brevipalpus ( B. phoenicis, B. californicus and B. obovatus ) have been collected from citrus in Florida (Childers et al. 2003b; Childers et al. 2003c; Kitajima et al. 2003a; Knorr, 1968); while only B. californicus and B. phoenicis have been reported from Texas (Childers, 1994; Denmark, 1984; French & Rakha, 1994b; Knorr, 1968). The mite B. phoenicis was the most common tenuipalpid species in Central America and was found on 114 different plants including traditional and non-traditional cr op, trees as well as ornamental, medicinal and weed plants (Ochoa et al. 1994). Lately, Brevipalpus spp. have been found on 928 plant species belonging to 139 families (Childers et al. 2003c). Under field conditi ons, the mites preferred habitat sites are fruit, due to fruit dented surfaces (Bastianel et al. 2006b; Childers et al. 2001a; Reis et al. 2003; Rodrigues et al. 2003; Teodoro & Reis, 2004). As many as a thousand mites can occur on a single citrus fruit infected with leprosis (Knorr, 1968). Nevertheless, citrus leaves are the main reservoir of mites (R odrigues, 2000). Citrus leaves are also the more suitable site for the development of mites in cap tivity (Teodoro & Reis, 2006). The transmission rates varied for the differe nt mite developmental stages; the nymphal stages of Brevipalpus mites were found to be more efficient as vectors of leprosis than adults by Chagas et al., (1984); Chagas & Rossetti ( 1984). In contrast, Chiavegato et al. (1997);

PAGE 24

24 Chiavegato & Salibe (1984) reported that all active stages of the Brevipalpus mites transmitted the virus and that there were no differe nces in transmission efficiencies. TEM have been used to look for virus-like particles in Brevipalpus mites (Rodrigues et al. 1997). A large number of virus-like pa rticles were observed in female B. phoenicis mites collected from CCLV-infected tissue (Rodrigues et al. 1997). The quantity and location of these particles suggested that the virus multiplies inside the vector, and that trans-stadial transmission of the virus occurs in B. phoenicis Conversely, mites originating from eggs contained no viruslike particles and did not transmit the disease, indicating that the viru s is not passed to the progeny trans-ovarially (Rodrigues, 2000; R odrigues & Machado, 2000). After mites acquire virus, they retain the ability to transmit the vi rus for their lifetime (trans-stadial transmission), even when feeding only on non symptomatic host pl ants and after successive molts (Rodrigues et al. 2003; Rodrigues, 2000; Rodrigues et al. 1997). Mites belonging to B. phoenicis species also have been reported to vector coffee ringspot virus (putative member of the Rhabdoviridae family) in Coffea arabica and passionfruit green spot virus (PFGSV) in pa ssionfruit plants (Chagas et al. 2003; Childers & Derrick, 2003; Childers et al. 2003c; Kitajima et al. 2003a; Kitajima et al. 2003b). However, neither of these viruses could be transmitted to citrus, similarly CCLV could not be transmitted into either coffee or passionfruit plants using Brevipalpus mites (Chagas et al. 2003; Kitajima et al. 2003a; Kitajima et al. 2003b; Kitajima et al. 2000). Mite populations in citrus orchards are dyna mic and fluctuate around the year (Bassanezi & Laranjeira, 2007; Bastianel et al. 2006b; Rodrigues, 2000). Citrus plants infected with leprosis as well as mite populations tend to occur in clus ters within citrus or chards (Bassanezi & Laranjeira, 2007). In Brazil, Brevipalpus populations reach their peak during the dry season with

PAGE 25

25 lower populations during the rainy season due main ly to the rain wash-off effect (Bassanezi & Laranjeira, 2007; Bastianel et al. 2006b; Rodrigues, 2000). A sim ilar situation is observed in Panama (Guerra-Moreno, et al ., unpublished results). Molecular Characterization of Leprosis Virus The characterization of citrus leprosis has been delayed sinc e it has been difficult to purify the virus (Lovisolo et al. 2000). Although citrus leprosis has b een present in South America for almost a century (Bitancourt, 1937; Frezzi, 1940), the molecular characterization has been done until recently years. The presence of double-strand ed RNA (dsRNA) in leprosis infected citrus plants was reported (Colariccio et al. 2000). The same authors obtained purified extractions from herbaceous hosts following mechanical tran smission from citrus and reported three dsRNA bands of molecular weights between 6 to 8 MD a. Molecular studies s howing the presence of RNAs only in the symptomatic tissu e (Guerra-Moreno, 2004; Guerra-Moreno et al. 2005a) and TEM analyses detecting no viru s particles in the surrounding asymptomatic areas (GuerraMoreno, 2004; Kitajima et al. 1972; Kitajima, 1974) supported the earlier hypothesis that CCLV has limited or non-systemic moveme nt in citrus tissue (Kitajima et al. 2003a; Kitajima et al. 2000; Rossetti, 1980; Rossetti, 1996). Initial molecular characteriza tion and the construc tion of cDNA libraries were performed by different groups (Gue rra-Moreno, 2004; Locali et al. 2003). In Florida, a total RNA extraction of CCLV-infected citrus tissue was us ed to construct a cDNA library (Guerra-Moreno et al. 2003; Guerra-Moreno, 2004; Guerra-Moreno et al. 2005a). Some putative CCLV genome sequences were found which had similarities to other plant viruses. Hybridization studies indicated a leprosis viral genome of about 10-12 kb. A DNA probe based on putative CCLV sequence hybridized with the genomic RNA a nd a smaller RNA of about 1.5 kb in infected tissues (Guerra-Moreno et al. 2003; Guerra-Moreno, 2004; Guerra-Moreno et al. 2005a). In

PAGE 26

26 Brazil, a cDNA library was create d using dsRNA isolated from le sions of CCLV-infected citrus tissue and two gene segments encoding the putati ve movement protein and replicase genes were identified (Locali et al. 2003). Diagnostic methods based on RT-PCR detection were developed to amplify putative CCLV genome regions (Guerra-Moreno, 2004; Locali et al. 2003) Recently, a few negative-stranded plant viruses such as Orchid fleck virus (OFV) and Lettuce big-vein associate virus (LBVaV), with similarities in particle morphology and genome organization to Rhabdoviridae have been characterized (Kondo et al. 2006; Kondo, 1998; Sasaya et al. 2001; Sasaya et al. 2004). However, they differ from rhabdoviruses (single component negative-sense RNA viruses) in havi ng multipartite genomes. In LBVaV, both the positive-sense and negative-sense RNAs are encapsidated but in separate virions (Sasaya et al. 2002; Sasaya et al. 2004). In the light of these findings, a re-evaluation of the taxonomic position of LBVaV was recommended. OFV has a bipartite, negative-sense RNA genome (Kondo et al. 2006; Kondo et al. 2003; Kondo, 1998). Based on morphology of the virion particle, vector transmission, genome structure and organization, it was recommended that OFV and other associated plant viruses such as Coffee ringspot virus (CoRSV) (Chagas et al. 2003) and Passionfruit green spot virus (PFGSV) (Kitajima et al. 2003b) as well as other viruses causing diseases in ornamental pl ants be placed in a new genus Dichorhabdovirus in the family Rhabdoviridae of the order Mononegavirales (Kitajima et al. 2003a; Kondo et al. 2006; Kondo et al. 2003). The complete bipa rtite negative-sense RNA ge nome of OFV was recently sequenced (Kondo et al. 2006), and its nucleotide sequence, genomic structure and organization is different from the RNA genome of CCLV (Guerra-Moreno, 2004; Guerra-Moreno et al. 2005a; Locali et al., 2003). The NCLV could provisionally be placed under same genus as OFV,

PAGE 27

27 based on its similarity in virus pa rticle (Guerra-Moreno, 2004; Kitajima et al. 2003a) until further molecular studies clarify its position. Methods of Detection for Leprosis The lack of quick and accurate methods to identify leprosis-causing viruses and the superficial similarity of leprosis symptoms with other bark scaling diseases has led to difficulty in the identification of ci trus leprosis (Colariccio et al. 2000; Lovisolo, 20 01; Rossetti, 1996). The diagnosis of CCLV has been mainly ba sed on symptomatology (Lovisolo, 2001), with confirmation by visualization of rhabdovirus-like partic les in the cytoplasm by TEM (Colariccio et al. 2000; Lovisolo et al. 2000; Rodrigues et al. 2000). The use of herbaceous hosts that developed local lesions have been used for the detection of CCLV has been reported (Lovisolo et al., 2000; Rodrigues, 2000). The use of Chenopodium quinoa as a herbaceous indicator for the detection of CCLV takes as short of time as three days after inoculation under appr opriate conditions (Lovisolo et al. 2000). However, this assay can not be back transmitted to citrus to verify that CCLV is, in fact, causing the local lesions. The development of molecular information on CCLV has resulted in the development of new, accurate and rapid molecular approaches for the detection of CCLV. RT-PCR methods have been reported (Guerra-Moreno, 2004; Locali et al. 2003). Serological approaches also are being developed. A CCLV protein (O RF2 of RNA 1) was expressed in bacteria and used to raise CCLV-specific polyclonal antibodies in rabbits and chickens (Rangel et al. 2005). These polyclonal antibodies have been used in double-antibody-sandwich-in direct ELISA (DASIELISA) and in Western blot assays for di agnosis of CCLV in citrus plants and Brevipalpus mites (Manjunath, et al. unpublished results).

PAGE 28

28 Management of Leprosis Disease Current management strategies for citrus lepros is are based on contro l of the mite vectos by acaricides and removal of symptomatic plant tissue. Leprosis symptoms and Brevipalpus mites are found in citrus groves through out the year (B assanezi & Laranjeira, 2007; Rodrigues, 2000). Miticides are expensive, and may be ine ffective because successful virus transmission may have occurred prior to treatment (Gravena et al. 2005). Miticides must be applied up to three or more times per year, after a field survey indicates that the mite population is at economic threshold levels (Bassanezi & Laranjeira, 2007; Gravena et al. 2005; Omoto, 1998; Omoto et al. 2003; Rodrigues, 2000; Rodrigues & Machado, 2000). However, a recent study revealed that infected citrus plants tend to occur in clusters and that most of the time the Brevipalpus mites are not observed on diseased plants (Bassanezi & Laranjeira, 2007). Changes in the methodology for mites and leprosis sampling was recommended, sin ce low levels of mite populations were not detected using current methodology (Bassanezi & Laranjeira, 2007). At present, miticides are the first option to control mite populations on highly infested citrus orchards (Bassanezi & Laranjeira, 2007 ; Omoto, 1998; Rodrigues, 2000). Most of the acaricides used to suppress Brevipalpus mites populations belong to the organoestamic group, and mite resistance to these chemical has been well documented in several research studies (Campos & Omoto, 2002; Campos & Omoto, 2006; Gravena et al. 2005; Omoto, 1998). Hexythiazox (mite growth regulator; DuPont, Brazil) is one of the most used miticide to suppress Brevipalpus populations in citrus areas in Brazil, but mites have quickly developed resistance (Campos & Omoto, 2002; Omoto, 1998). The exact mode of action of He xythiazox is not well understood; however it kills the eggs before ha tching and may kill the nymphal immature stages (Brown, 2005). It has been suggested that resi stance to Hexythiazox under field conditions may

PAGE 29

29 be avoided by rotating with miticides that have different modes of action (Campos & Omoto, 2006). Mite populations also can be suppressed by cu ltural and mechanical control strategies (Bassanezi & Laranjeira, 2007; Childers et al. 2001a; Childers et al. 2001b; Rodrigues, 2000). These strategies includes the reduction of symptomatic tissu e by pruning of symptomatic branche; planting windbreaks to help limit the spread of the mite vectors; control of weed hosts of the mites; the use of healthy seedlings to replant orchards and minimizing the movement of people, equipment and plant materials, such as budwood, fruit, and rooted plants in and out of citrus orchards (Bassanezi & Laranjeira, 2007; Childers et al. 2001a; Childers et al. 2001b; Guerra-Moreno, 2004; Kitajima et al. 2003a; Omoto, 1998; Palmieri et al. 2005). If leprosis is not present in a region, the best management strategy is a strict qua rantine (Omoto, 1998; Rodrigues, 2000; Rodrigues & Machado, 2000). The use of wi ndbreaks has been recommended (Omoto, 1998; Rodrigues, 2000), however recent st udies showed that some plants used as windbreakers and hedge rows in Brazil could be hosts of CCLV (De Andrade-Maia & Leite De Oliveira, 2005). Natural products also have been used to control mite populations keeping them under the threshold levels (Chen et al. 2006; Omoto; 1998; Reis et al. 2003; Rodrigues, 2000). Plant extracts from species such as Luffa cylindrical Allium sativum Hedera helix and Datura metel to repel or reduce the activity of Brevipalpus mites (Guirado et al. 2001), have been tested in citrus orchards infected with Brevipalpus mites, but without good results. The use of biological agents to control Brevipalpus mite populations is another strategy used to mitigate mite damage and transmission of the leprosis virus. Predacious mite spec ies belonging to the Phytoseiidae family, which are naturally present in ci trus orchards have a negative effect on Brevipalpus mite

PAGE 30

30 populations (Chen et al. 2006; Reis et al. 2003; Rodrigues, 2000). Entomopathogenic fungi such as Hirsutella thompsonii have been deployed with promis ing results as an alternative strategy to control mites (R ossi-Zalaf & Alves, 2006). Purpose of the Current Research Leprosis threatens citrus produc tion in North America and the Caribbean Basin as it moves northward from South and Central America. Since little is known about the molecular properties of CCLV, molecular information of this virus is critically needed for the development of better, reliable and quick detection tool s for this virus and for the development of better management methods of the disease. Th e present research was undert aken to conduct a molecular characterization of genomic, subgenomic and def ective interfering RNAs of CCLV isolated from Panama and use this information to develop rapi d and reliable nucleic aci d based and serological methods to detect the virus. The rapid and reliab le identification of the virus will be useful to monitor and avoid the possible in troduction and spreading of CCLV from infected countries into North American, Caribbean countries, or possibl y other continents. These diagnostic methods will assist the economic production of citrus in countries where leprosis is present.

PAGE 31

31 CHAPTER 2 MOLECULAR CHARACTERIZATION OF GENOMIC, SUBGENOMIC AND DEFECTIVE INTERFERING RNAS OF A PANAMANIAN ISOLATE OF CYTOPLASMIC CITRUS LEPROSIS VIRUS Introduction Citrus leprosis is one of the most important vi ral diseases of citrus in Brazil, with more than 21 % of the total citrus production cost (US$ 75 million/year) used for miticides to control the Brevipalpus mite vector (Omoto, 1998; Omoto et al. 2003 ; Rodrigues et al. 2003; Rodrigues, 2000; Rodrigues & M achado, 2000). For more than six de cades, leprosis disease has been present in Argentina, Brazil, Para guay, and Uruguay (Bittancourt, 1937; Childers et al. 2003a; Childers et al. 2001; Fawcett & Lee, 1926; Knorr, 1968; Rodrigues et al. 2003) and is now an emerging and spreading disease in Venezuela (Childers et al. 2003b) and Panama (Dominguez et al. 2001). There are also recent reports of citrus leprosis from Costa Rica (Araya-Gonzalez, 2000), Guatemala (Palmieri et al. 2005), Honduras and Nicaragua (Meza Guerrero, 2003), Bolivia (Gmez et al. 2005), Mexico (Snchez-Anguiano, 2005) and Colombia (Leon M. et al. 2006). Vectors of the virus have a broad host range and are present in most of the citrus production areas around the world (Childers et al. 2003b; Childers et al. 2001; Knorr, 1968; Rodrigues et al. 2003). Citrus leprosis does not occu r in North America and the Caribbean Basin, but it poses a serious threat for introduction in these areas. The first cytological study in Brazil (Kitajima et al. 1972) reported the presence of rodlike particles (40-50 100-110 nm ) in the nucleus and cytoplas m of virus-infected cells, commonly associated with the nuclear and endopl asmic reticulum (ER) membranes. More recent cytological studies of the le prosis disease (Colariccio et al. 1995; Kitajima et al. 2003a; Kitajima et al., 1974) reported the presence of a differe nt virus morphology: bacilliform, membrane-bound virus-like particles (50-60 100110 nm) within the cister nae of the ER with

PAGE 32

32 electron dense, vacuolated viroplasms in the cy toplasm and no virions were seen in the nucleus. This from of citrus leprosis virus, located in the cytoplasm and referred as Cytoplasmic citrus leprosis virus (CCLV) appears to be more commonly f ound and geographically widespread than form found in the nucleus and referred as nucle ar citrus leprosis vi rus (NCLV) which was reported in 1972 (Kitajima et al. 2003a). NCLV has been reported only in areas of So Paulo and Rio Grande do Sul States in Brazil (Bastianel et al. 2006b) and Boquete, Chiriqu State, Panama (Dominguez et al. 2001; Guerra-Moreno et al. 2003; Guerra-Moreno, 2004; GuerraMoreno et al. 2005a). Even though CCLV was tentatively placed in the family Rhabdoviridae based on particle morphology and host cytopathology (Colariccio et al. 1995; Dominguez et al. 2001; Kitajima et al. 2003b; Kitajima et al. 1972; Rodrigues, 2000), the viri on morphology and cytopathological effects of CCLV and the NCLV are fully distin ct. Recent studies suggest that a multipartite positive-sense RNA virus is associated with leprosis disease (Guerra-Moreno et al. 2003; Guerra-Moreno, 2004; Guerra-Moreno, et al. 2004; Guerra-Moreno et al. 2005a). Hybridization assays using CCLV-specific probes failed to hybrid ize with the extracts from tissues infected with the NCLV type further demonstrating that the leprosis disease symptoms are caused by two distinct viruses (Guerra-Moreno, et al. 2004) and verified the mi crographic observations of Kitajima et al. (2003a) and Guerra-Moreno et al. (2003). Hybridizations assays, RT-PCR assays a nd transmission electron microscopy (TEM) studies have shown the association of a multipartite positive-stranded RNA virus with CCLV (Guerra-Moreno et al. 2003; Guerra-Moreno et al. 2004; Guerra-Moreno et al. 2005a; GuerraMoreno et al. 2005b; Locali et al. 2003). In 2003, RT-PCR assays were reported by different groups to diagnose CCLV based on the sequences of ORF 2 in RNA 1 (Guerra-Moreno et al.

PAGE 33

33 2003) and ORF 1 in RNA 1 and ORF 3 in RNA 2 (Locali et al. 2003). Partial sequence characterization of ORF 2 of RNA 1 of CCLV and an estima ted size for RNA 1 (about 10 kb) was reported from a leprosis isolate collected in Western Panama in 2004 (Guerra-Moreno, 2004). Research was continued to obta in the complete CCLV sequence. Many viruses, for example Brome mosaic virus (BMV), Citrus tristeza virus (CTV), Tobacco mosaic virus (TMV), Tomato bushy stunt virus (TBSV), Tobacco rattle virus (TRV) and Lettuce infectious yellows virus (LiYV) produce an array of smaller than genomic (g-) RNAs including subgenomic (sg-) and defective interfering RNA (DI-RNA) species (Ayllon et al., 1999; Domingo & Holland, 1997; Hilf et al., 1995; Holland & Domingo, 1998; Holland et al. 1982; Roux et al. 1991; White et al. 1991). ). It is unknown whether sgand DI-RNAs are produced during CCLV infections. The present study was undertak en to develop a better unders tanding of the etiology of CCLV and to understand the nature of the gand other RNA molecules associated with CCLV and methods of replication. This information should facilitate the development of better diagnostic methods which would help deve lop improved management of leprosis. Material and Methods Virus Samples Leaves, fruits and twigs from lepros is affected sweet orange plants, Citrus sinensis (L). Osbeck (Figures 2-1 and 2-2), in the field were collected from two locations in Western Panama: Boquete and Potrerillos, Chiriqu State. Tissues from lesion and non-lesion areas were used for total nucleic acid extractions. Similar samples were collected from asymptomatic trees in Potrerillos and Boquete, Panama and from apparen tly healthy trees in Flor ida for use as negative controls.

PAGE 34

34 Total Nucleic Acid Extraction and RNA Isolation The extraction of total nucleic acids from leaf fruit and bark tissue was done in Panama. About 2-5 g of tissue was powdered in liquid nitrogen and used for extraction following a modified protocol of Morris & Dodds (1979). Brie fly, the powdered tissue was transferred to a 50 ml beaker and the following reagents were ad ded: 7 ml of 2 X STE, pH 6.8 (20 mM Tris, pH 6.8; 0.2 M NaCl; 2 mM EDTA, pH 8.0); 10 ml of phenol (equilibrated with 0.5 M Tris, pH 8.0); 1 ml of 10% SDS; and 0.1% bentonite. The mi xture was stirred for 30 min at 4 C, then centrifuged at 8,000 g for 20 min at 4 C. The upper aqueous phase was collected and adjusted to 10 ml with 1 X STE, pH 6.8, and precipitated by adding 0.1 volume of 3.0 M sodium acetate, pH 5.2, and 2.5 volumes of 95% ethanol and stored at -20 C. The tota l nucleic acid extracts were shipped to University of Florida, Gainesville, and stored at -80 oC. The isolation of total RNA was performed by centrifuging about 4 ml of the total nucleic acid extract at 17,000 g for 20 min at 4 C, and th e pellet was resuspended in 100 l of RNasefree water. A QIAgen RNeasy Plan t Mini Kit (QIAgen) was then used to extract total RNAs according to the manufactures protocol. The quality of RNA obtained from thes e samples was analyzed by agarose gel electrophoresis and by RT-PCR using primers speci fic for the 18S ribosomal RNA (rRNA) using primers K616 (5-TATGCTTGTCTCAAAGATTAAG-3) and K617 (5TAATTCTCCGTCACCCGTC-3). The concentrati on of the total RNA was determined by measuring the absorbance at 260 nm (A260) in a SmartSpec 3000TM spectrophotometer (BioRad), according to manufacturers protocol, and the average ratio A260/A280 was about 1.9. Analysis of Putative Viral Sequences from a cDNA Library In a previous study, the total RNA extracts from leprosis fruit lesions were used for the construction of a cDNA library using the SmartTM cDNA Library Construction Kit (Clontech),

PAGE 35

35 and selected phage clones were submitted for sequencing using universal reverse and forward primers (Guerra-Moreno, 2004). Later, select ed clones also were sequenced using CCLVspecific forward and reverse primers (Table 2-1). Comparison of Putative Viral Sequences Clone sequences were analyzed using the Ba sic Local Alignment Search Tool (BLAST) (Altschul et al. 1997) and compared to sequences deposit ed in GenBank at both the nucleotide (nt) and amino acid (aa) levels. Sequences showing high levels of homology with plant sequences were discarded. The remaining seque nces without similari ties with known plant sequences were aligned using SEQUENCER vers ion 4.5 software (Gene Codes Corporation). Contig maps were created and analyzed. Primer Design Based on putative viral sequences, several se ts of forward and reverse primers were designed (Table 2-1). The primers were s ynthesized by Integrated DNA Technologies, Inc (http://www.idtdna.com/). Northern Blot Analysis Using DNA Probes Three clones containing putativ e CCLV sequences in the vector pTriplEx2 (Figures 2-3 and 2-4) were used for synthesis of Digoxi genin (DIG)-labeled DNA probes by PCR using universal primers according to manufacturers prot ocol (Roche Applied Science). Approximately 5 g each of the total RNA extractions of tested samples were subjected to electrophoresis on a 1.2% agarose gel containing 2% formaldehyde in 1 X MOPS buffer, pH 7.0 (20 mM MOPS, 5 mM sodium acetate, 2 mM EDTA), and electroph oresced at 70 volts for 4 h. The gels were stained with ethidium bromide (0.5 g ml-1) for visualization of rRNAs as loading controls. The electrophoresced RNAs were transferred from th e agarose gels to a positively-charged nylon membrane by capillary transfer Hybridization was carried ou t using 100 ng of DIG-labeled

PAGE 36

36 DNA probe in 5 ml of hybridization buffer. Af ter incubating the membrane with anti-DIG antibody alkaline phosphatase conjugate, the probe was visualized by chemiluminescent detection using CDP-Star according to the manuf acturers protocol (Roche Applied Science). Further Sequencing of CCLV RNAs Cloned sequences that belonged to a previ ously created cDNA lib rary (Guerra-Moreno, 2004) were subjected to a deta iled screening and some were found to contain putative viral sequences. Based on similar hybridization patter ns seen with probes 1 (Guerra-Moreno, 2004) and 2 from plasmids AGpl-1-C09 and AGpl-2-F 08 (Figure 2-3), respectively, primers Kpr745 and Kpr659 (Table 2-1) were designed and used for RT-PCR analysis. First, the RT reaction was performed using the ThermoScript Reverse Transcriptase kit (Invitrogen), according to the manufacturers in structions. In sterile 0.5 ml PCR tubes the following reagents were added: 3.0 g of to tal RNA extract, 1 l of Kpr-745 and Kpr-659 primers (10 M each), 10 mM dNTP Mix and RNas e-free water to 12 l. The tube contents were mixed, incubated at 65 C for 5 min and transfer red to ice immediately. A mixture containing 4 l of 5 X cDNA synthesis buffer, 1 l of 0.1 M DTT, 1 l RNaseOUT (40 U l-1) and 1 l of ThermoScript RT enzyme (15 units l-1) was added to each tube. The mixture was incubated at 60 C for 1 h. The reaction was terminated by a fi nal incubation at 85 C for 5 min. One l of E coli RNase H (2 U l-1) was added to the tube, and the tube s were incubated at 37 C for 20 min to remove the complementary RNA strand. The generated cDNA strand was either immediately used or stored at -20 C for further use. The PCR reaction was performed usi ng the MasterAmp Extra-Long PCR Kit (Epicentre). The PCR reaction mixture consisted of 4 l of first stra nd cDNA, 1 l of each CCLV-specific primers [Kpr-745 and Kpr-659 (10 M each)]; 1 l MasterAmp Extra-Long DNA Polymerase Mix and sterile wa ter to a reaction volume of 25 ml Then, an aliquot of 25 l

PAGE 37

37 of the MasterAmp Extra-Long PCR 2 X Pre-Mix was added to the mixture. Amplification parameters included an initial denaturation cycl e at 94 C for 3 minutes; follow by 15 cycles of 94 C for 15 seconds and 68 C for 8 min; then 15 cy cles of 92 C for 20 seconds and 68 C for 8 min (with 20 seconds increase in time every roun d or cycle); followed by a final incubation at 68 C for 10 minutes. Ten l of each of the RT-PCR products were electrophor etically separated on 0.8 % agarose in 1 X TAE buffer (40 mM Tris-A cetate and 1 mM EDTA, pH 8.0) at 100 volts for 55 minutes, and stained with ethidium br omide. The RT-PCR-amplified products were visualized using a Bio-Rad Gel-Doc imaging system. The amplified products of approximately 6.6 kb were column purified using the QIAquick Gel Extraction Kit, following the manufacturers instructions (QIAge n). The purified RT-PCR product was cloned into pCR-XL -TOPO vector (Invitrogen) a nd sequenced using the genomewalking method (Fazeli & Rezaian, 2000; Livieratos et al. 1999a). Sequence information from the cloned RT-PCR products were used to desi gn new CCLV primers to obtain the remaining sequences from those clones. The CCLV sequences were confirmed by amplifying the genomic region of several CCLV clones from independent RT-PCRs using CCLV specific primers (Table 2-1). Similarly, the region between clones AGpl1-A01 and AGpl-2-D08 (probes 3 and 4; Figure 2-7) that also showed comparable hybrid ization patterns was am plified (about 1050 nt) by using Kpr-671 and AGpr-04 primers (Table 2-1). The MasterAmp Extra-Long PCR Kit (Epicentre) was used to perform the PCR assa y. The products were cloned and sequenced as described previously using primers Kpr745 and Kpr659 (Table 2-1). Determination of the 5 and 3 Ends of CCLV gand sgRNAs The 5 and 3 ends of the g, sgRNAs a nd DI-RNAs were obtained by using two different techniques; the SMART RACE cD NA amplification kit (BD Bios cience) and the GeneRacer kit

PAGE 38

38 (Invitrogen). CCLV-specific primers AGpr06, Kpr659, Kp r658, AGpr32, AGpr20, Kpr643, Kpr670 and Kpr671 (Table 2-1) were used indi vidually with the SMART II and CDSIII oligos for RACE ready using the SMART RACE cD NA amplification kit (BD Bioscience) to generate the first strand cDNA. The PCR amp lification of both the 5and 3-ends were completed using 1 l of universal primer and 1 l of CCLV-specific primer following the manufactures protocols. The PCR products were purified (Q IAquick Gel Extraction Kit, QIAgen), cloned (TOPO TA cloning kit, Invitrogen) and sequenced. The GeneRacer method (Invitrogen) was used to determine the 5 end of capped sequences and the 3 end of CCLV RNAs. Briefly, the total RNA preparation was dephosphorylated and decapped, followed by ligation with an RNA ad apter oligonucleotide according to the manufacturers protocols. Th e cDNA synthesis was performe d using Thermoscript reverse transcriptase (Invitrogen) at 60 oC for 55 min with CCLV-specific primers AGpr-06, Kpr-659, Kpr-658 AGpr-32, AGpr-20, Kpr-643, Kpr-670 and Kpr671 (Table 2-1) in separate reactions. The PCR amplifications were conducted using Taq DNA Polymerase recombinant kit (Invitrogen) and the provided 5 universal primer and a CCLV-specific primer. Control HeLa total RNA extractions (positive control from Inv itrogen) and water control (negative control) also were used in RT-PCR assays. Selected P CR products were gel purified, cloned (TOPO TA cloning kit, Invitroge n), and sequenced. Gradient and nested RT-PCR reactions were pe rformed to obtain a better definition of the DNA bands. RT-PCR amplifications using GeneRacer 5 Primer in combination with Kpr-731 and AGpr-34 (Table 2-1), belonging to RNA 1, we re optimized by performing a gradient PCR at different annealing temperatures (55, 60 and 65 C). Sequences fr om RNA 2 also were obtained by performing gradient and nested RT-PCR assa ys as follows: GeneRacer 5 Primer in

PAGE 39

39 combination with AGpr-32 and AGpr-37 (Table 2-1) were performed by gradient PCR at different annealing temperatur es (55, 60 and 65 C). The PCR products were analyzed by agarose gel electrophoresis (Sambrook et al. ; 1989). Discrete bands we re gel purified (QIAgen), cloned (TOPO TA cloning kit, Invitrogen) and sequenced. Analysis of the 5 and 3 UTRs of CCLV RNAs The sequence from the 5 and 3 UTRs of RNAs 1 and 2 were analyzed for secondary structure and similarities. First, the sequences of the 5 and 3 UT Rs of both RNAs 1 and 2 were aligned and analyzed using the progr ams CLUSTAL_X version 1.83.1 (Thompson et al. 1997; Thompson et al. 1994) and GenDoc version 3.2 (Nicholas & Nicholas, 1997). Later, these sequences were submitted to the Mfold website (Mathews et al. 1999) and also loaded into the RNAdraw software version 1.1 (Matzura & Wennborg, 1996) for predicting the putative secondary structure of the RNAs. Cloning, Sequencing and Analysis of CCLV sgand DI-RNAs The GeneRacer and the SMART RACE cDNA amp lification kits were used to obtain the sequences of both sgRNAs and DI-RNAs. To obt ain the sgRNA and DI-RNA sequences, the RT step was done using 5 GeneRacer and Oligo dT primers according to the manufacturers protocols. The PCR amplification for sgRNAs was done by using the provided 5 universal primer and CCLV-specific reverse primers Kpr-659, AGpr-22, AGpr-09 and Kpr-671 (Table 21), respectively, for sgRNA 1, 2, 3 and 4. Finally the sequences of the DI-RNAs were obtained by using an oligo dT primer in conjunction with primers for the 5-most end of both RNA 1 and 2 [AGpr-12 and AGpr-41 (Table 2-1), respective ly, for RNA 1 and 2]. RT-PCR products of the expected size were cloned and sequenced. These clones were ali gned using SEQUENCER version 4.5 software (Gene Codes Corporation) and visually anal yzed to determine the length,

PAGE 40

40 the 5 and 3 ends and the nt sequences at the junction sites of the recombinant DI-RNA molecules. Phylogenetic Relationships Among the OR Fs of CCLV and Other Plant Viruses The sequences of CCLV RNAs were edited and assembled using SEQUENCHER program and further analyzed at both the nt and aa le vel using BLAST, ExPASy and Pfam programs (Altschul et al. 1997; Finn et al. 2005). Multiple alignments of aa sequences of the methyltranferase, RNA helicase and RNA-depende nt RNA polymerase (RdRp) motifs of ORF 1 from RNA 1, and the putative movement protein (ORF 3 of RNA 2) and protein sequences of related viruses were generated by using th e program CLUSTAL_X version 1.83.1 (Thompson et al. 1994). The aa sequence alignments were corr ected using MacClade version 4.08 OS X. Aligned aa sequences were exported using pa rsimony (PAUP) format to PAUP version 4.0 10 for phylogenetic tree construction. Parsimony with heuristic phylogenetic tr ees were constructed using the aligned aa sequences, and bootstrap co nfidence values were calculated based on 10,000 replicates. Virus abbreviations and NCBI acce ssion numbers of the sequences used are as follows: Alfalfa mosaic virus (AlMV), 75586; Barley stripe mosaic virus (BSMV), 55585711, 19744918 and 1016774; Beet soil-borne virus (BSBV), 2791890; Beet virus Q (BVQ), 3549698; Beet yellows virus (BYV), 6492368; Broad bean necrosis virus (BBNV), 3928743; BMV, 58729 and 331499; Carrot mottle mimic virus (CMoMV), 9628911; Cucumber green mottle mosaic virus (CGMMV), 19908647 and 61237518; Cucumber mosaic virus (CMV), 7242505; Cucurbit yellow stunting disorder virus (CYSDV), 30691648; Fragaria chiloensis latent virus (FCILV), 56692629; Grapevine leafroll-associated virus 2 (GLRaV-2), 3123911; Hibiscus virus S (HVS), 33307858; Indian peanut clump virus (IPCV), 30023940 and 1430839; LIYV), 641982; Oat golden stripe virus (OGSV) 6018639, 6018640 and 9635456; Olive latent virus 2 (OLV-2), 20178604; Parietaria mottle virus (PMoV), 46393297; Peanut clump virus (PCV), 20178596;

PAGE 41

41 Pepper ringspot virus (PepRSV), 0178599 and 20178600; Prunus necrotic ringspot virus (PNRSV), 13785187; Raspberry bushy dwarf virus (RBDV), 419117; Soil-borne wheat mosaic virus (SBWMV), 7634687; Sorghum chlorotic spot virus (SgCSV), 21427640; Spring beauty latent virus (SBLV), 22550378; and TRV, 42733084. Prediction of the Transmembrane Do main of CCLV Puta tive Proteins The nt sequences of CCLV RNAs were converted to aa sequences (ExPASy Translate Tool, http://ca.expasy.org/tools/dna.html ) and loaded into the TMHMM program (Krogh et al. 2001; Moller et al. 2001) for predicting the transmembrane domain helices in all CCLV proteins. Output graphic resu lts were visually analyzed. Sequence Analysis of CCLV Isolates From Panama and Brazil At the time of this research, CCLV genome sequences were deposited in the GenBank. Sequences from two Brazilian isolates (Pascon et al. 2006; Locali et al. 2006) and a Panamanian (this study) isolat es were analyzed using CLUSTAL_X version 1.83.1 (Thompson et al. 1994) and multiple alignments of nt sequences were generated. The nt alignments were submitted to GeneDoc version 3.2 (Nicholas & Ni cholas, 1997), and the sequence alignments were visually checked, corrected and analyzed. Results Analysis of Putative Viral Sequences From a cDNA Library The cDNA library was constructed from extract s from Potrerillos which contained only CCLV particles as verify by TEM (Guerra-More no, 2004). Most of the sequences overlapped with other sequences and grouped into one of the four contigs: contig 1 (ORF 2 RNA 1, Figure 2-7) consisted of a total of 41 clones comprisi ng 1121 nt with a putative ORF of 789 nt (263 aa) (Guerra-Moreno, 2004); contig 2 (ORF 4 RNA 2, Figure 2-7), which consisted of 38 clone and was 985 nt long and contained a putative ORF of 642 nt long (214 aa); contig 3 (ORF 1 RNA 1,

PAGE 42

42 Figure 2-7) which consisted of three clones, was 325 nt long, and showed similarity with the RdRp of many positive-stranded RNA viruses incl uding Furo-, Tobamo-, Tobra-, Hordeiand Pomovirus in BLAST analysis. The sequence fr om clone AG2-D08 (ORF 3 RNA 2; Figure 2-7) was 180 nt long and showed similarities with th e movement proteins from different virus families including Bromo -, Furo and Umbraviridae Northern Blot Analysis Using DNA Probes A 325 bp DIG-labeled DNA probe, based on th e putative CCLV sequence from clone AGpl-2-F08 (probe 2, Figure 2-7) was used for No rthern blot analysis. This probe hybridized with two RNAs of approximately 9.0 and 1.0 kb in RNA extracts from leprosis symptomatic tissue from Potrerillos (Figure 2-3, lanes 1-2), but not with RNA extracts from similar tissue collected from Boquete (Figure 2-3, lane 5) RNA extracts from non-symptomatic tissues surrounding lesion areas from the same trees c ontained predominately the 1.0 kb RNA (Figure 23, lanes 3-4) after 10 minutes exposure. The 9 kb RNA was visible only af ter a long exposure (50 minutes). The DNA probe generated from clone AGpl-2-F08 did not hybridize with the 1.5 kb RNA molecule recognized by the AG1-C09 probe (Guerra-Moreno, 2004). A PCR product from the plasmid AGpl-2-F08 was used as positive cont rol (Figure 2-3, lane 6). The banding patterns obtained with a probe from clone AG1-C09 were si milar to those obtained with probe 1 from plasmid AGpl-1-C09 (Guerra-Moreno, 2004). A 691 bp DNA probe from clone AGpl-1-A01 (pr obe 4, Figure 2-7) hybridized with RNAs of approximately 4.7, 3.0, 1.5 and 0.8 kb in extr acts from CCLV-infected samples from Potrerillos (Figure 2-4, panel A) RNA extracts from the non-lesion area of symptomatic leaves showed no hybridization at 5 min exposure, but a longer exposure of 50 min showed a banding pattern similar to the RNA extracts from lesions from symptomatic leaves. Using the DNA probe 3 generated from the clone AGpl-2-D08 (Figur e 2-7), RNAs of about 4.7, 1.5, and 0.8 kb (Figure

PAGE 43

43 2-4, panel B) were recognized and were similar in size to those found when probe 3 specific for clone AGpl-1-A01 (Figure 2-7) was used. Howe ver, probe 3 from clone AGpl-D08 did not hybridize with the 3.0 kb RNAs which hybridized with probe 4. Sequences from contig 1 and 2 (Figure 2-3) were shown to have similar hybridization patterns and were grouped together (Guerra-More no, 2004). Similarly, the sequences from contig 3 and 4 were grouped together based on the simila rities of their Northern Blots (Figure 2-4). Further Sequencing of the CCLV Genomic RNAs After performing the long distance RT-PCR assays, larger RT-PCR products were obtained. A 6.6 kb long amplified product (belon ging to RNA 1) was obtained using CCLVspecific primers Kpr-745 and Kpr-659 (Figure 2-5, la ne 4). Based on the nuc leotide sequences of the fragments, new CCLV-specific primers were designed and used to obtain the internal sequences of several clones. Similarly, the in ternal regions of the 1050 nt RT-PCR products (belonging to RNA 2) were obtained using Kpr-6 71 and AGpr-04 primers (Figure 2-5, lane 2). Additionally, the 5 and 3 te rmini of both RNAs 1 and 2 were obtained by using two methods [the SMART RACE cDNA amplification kit (BD Bioscience) and the GeneRacer kit (Invitrogen)]. Amplification using only GeneR acer assays generated unspecific (smear-like) banding patterns of the target samples (Figure 26, panel A, lanes 1-5), however a clear band of the positive HeLa mRNA control was obtained (Fi gure 2-6, panel A, lane 6). After gradient and nested PCR assays using cDNAs generated by th e GeneRacer assays, a be tter definition of the amplified products from RNA 1 (Figure 2-6, pane l B; lanes 1 3; 317 bp; and Figure 2-6, panel C, lanes 4 6; 132 bp) and RNA 2 (Figure 2-6, panel C, lanes 1 3; 1520 bp; and Figure 2-6, panel C, lanes 4 6; 1000 bp) was obtained.

PAGE 44

44 Analysis of CCLV Genomic RNAs The full length sequences of both CCLV RNA 1 and RNA 2 from the Panama isolates were obtained (GenBank accession number : DQ388512 and DQ388513) and analyzed for potential ORFs (Figure 2-7). Both 5 m7GpppN-cap and 3 poly(A) ta il structures were found at the termini of both CCLV g-RNAs 1 and 2, as we ll as for all sgRNAs and DI-RNAs. The length of the poly(A) tail was determined to be be tween 35 and 70 nt. The se quences of the g-RNA, sgRNA and DI-RNAs had a 5 non-templa te guanine (G) as the first nt. The CCLV RNA 1 (8730 nt; 43 % GC content) contained two ORFs of 7,539 and 792 nt long (Figure 2-7). ORF 1 codes for a putativ e 276 kDa polyprotein of 2,512 aa containing domains similar to those of the super group of Sindbis-like viruses (Karasev, 2000; Koonin & Dolja, 1993; Rozanov et al. 1992) with putative methyltransferase (located at aa position 126 528), OTU-like cysteine protease (located at aa position 689 797), RNA helicase (located at aa position 1558 1841), and RdRp motifs (located at aa position 2062 2494) (Figure 2-7). Using the Pfam and BLAST programs, another domain sc ored higher than the gathering threshold (Bateman et al. 2004; Finn et al. 2005). This ORF 1 domain is termed the FtsJ-like methyltransferase (located at aa position 991 1050). The ORF 2 of RNA 1 codes for a putative protein of 263 aa (about 29 kDa) which showed no similarity with known virus proteins by BLAST analysis. ORF 1 was highl y transcribed through a sgRNA in leprosis infected plants (Guerra-Moreno, 2004) and large nu mber of clones (41 out of 300 clones) contained sequences belonging to this ORF. The CCLV RNA 2 (4969 nt; 40 % GC content) c ontains four ORFs ba sed on Northern blot analysis (Figure 2-3 and 2-4), sequencing and co mputer analysis (Figure 2-7). The four ORFs were 393, 1614, 537 and 279 nt long and coded for putative proteins of 15, 60, 31 and 24 kDa, respectively (Figure 2-7). While ORFs 1, 2 and 4 of RNA 2 showed no similarity with sequences

PAGE 45

45 in the GenBank, ORF 3 encoded a putative 31 kD a viral movement protein (MP) which showed similarities to the MP of plant viruses belongi ng to the Furo-, Bromo-, Tombus-, Umbraand Ilarvirus genera. The ORF 4 of RNA 2 was highly transcri bed through a sgRNA in tissue infected with the virus (Figure 2-4) and larg e numbers of clones (39 out of 300 clones) had sequences that aligned into ORF 4. The TMHMM program did not predict any tran smembrane domain helices for either ORF 1 or 2 of RNA 1. However, ORFs 2 and 4 of RNA 2 had predicted transmembrane domains (Figure 2-10). The ORF 2 of RNA 2 has a putative transmembr ane domain at aa position 485 to 511; whereas ORF 4 of RNA 2 contains 4 predic ted transmembrane domains at aa position (I) 46 63, (II) 83 105, (III) 151 170, and (IV) 151 170. Analysis of the 5 and 3 UTRs of CCLV RNAs The CCLV 5 and 3 UTRs were aligned usi ng CLUSTAL_X, then exported to GeneDoc. RNAs 1 and 2 contain 5 UTRs of 107 and 65 nt respectively. The 3 UTRs of RNAs 1 and 2 contain 229 and 234 nt, respectively. The 5 UT Rs differ in length and do not share a long homologous region (Figure 2-8, panel A). Th e complementarity between the 5' and 3 UTRs of the CCLV genome is low (lower than 15 % identity). However the 3 UTRs of RNAs 1 and 2 are similar in length (5 nt difference), contain a long homologous region (Fig ure 2-8, B), and share 85 % identity. The Mfold website and the RNAd raw version 1.1 did, not predict any putative secondary structure at the 5 and 3 termini of either RNA 1 or 2. Phylogenetic Relationships Among the OR Fs of CCLV and Other Plant Viruses The methyltransferase (Figure 2-9, A), RNA he licase (Figure 2-9, B) and RdRp (Figure 29, C) domains of ORF 1 of CCLV RNA 1 showed low similarities with corresponding domains of plant viruses belonging to Tobamo-, Clostero-, Tobra-, Fu ro-, Hordei-, Pomoand other positive-sense RNA viruses, but were not highly similar to any of these virus families. The

PAGE 46

46 putative MP (ORF 3 of RNA 2) of CCLV (Figur e 2-9, D) showed low similarities with MP domains of viruses belonging to the Furo-, Brom o-, Tombus-, Umbra-, and Ilarvirus genera, but did not cluster with the MP se quences from these viruses. Sequence Analysis of CCLV Isolates From Panama and Brazil Sequence analysis of the thr ee genomic CCLV present in the GenBank confirmed that all three sequences belong to the same virus specie s with >99.2 % identity (Table 2-2). The most frequent nucleotide substitution was the change from cytosine to thymine (approximately 33 %). The lengths of the 5 and 3 UTRs were also identical. The start and the stop codons of each ORF were located at similar positions. The nucle otide composition, the GC contents and other features are summarized in Table 2-2. Cloning, Sequencing and Analysis of CCLV sgand DI-RNAs The sequences of four 3 end co-terminal sg RNAs and several DI-RNAs that aligned into 10 groups also were obtained (Figure 2-7 and 2-11). The presence of sgRNA molecules was confirmed based on hybridization assays usi ng probes for ORF 2 RNA 1(Guerra-Moreno, 2004) and ORF 3 and 4 RNA 2 (Figure 2-4). These smaller than genome RNA molecules were observed on Northern blots using RNA extracted from CCLV-infected tissue from Panama. The sequences from four sgRNA molecules rangi ng from 937 to 3389 nt l ong were obtained and analyzed. SgRNA 1 is 1068 nt in length (Figure 27), showed more than 99% identity with the 3 end of RNA 1. It containing 46 nt upstream of the start codon and was present in high concentrations in infect ed tissue (Guerra-Moreno et al., 2005a). No RNA fragments corresponding to the hypothetical sgRNAs for the RdRp were obtained using either the GeneRacer or SMART RACE cDNA amplification approaches, even after several attempts. The length of the sgRNAs 2, 3 and 4 were 937, 1751 and 3389 nt, respectively, and showed more than 99% identity with the 3 end of CCLV gRNA 2 (Figures 2-4 and 2-7). The SgRNA 4 is

PAGE 47

47 highly expressed in infected tissue as seen in Northern blots (Figure 2-4). The SgRNAs 2 and 3 had 8 nt upstream of the start codon, whereas sg RNA 4 contained a longer (58 nt) 5 UTR. The sgRNAs 1 and 3 started with the same 3 nt (ATG ) at the 5 end; while the sgRNAs 2 and 4 had the first 4 nt (ATTG) in common. The presence of additional RNAs that differed in size and hybridization patterns from the CCLV gand sgRNA was observed in RNA extracts using probes specific for a region near to the 5 end of CCLV genome (Figures 2-3 and 2-4). These RNAs were cloned, sequenced and analyzed by computer programs. These RNA mol ecules were classified as DI-RNAs, because they contain both the 5 and 3 end of the viru s (CCLV), and they lacked a large portion of the genomic central region sequence (Figure 2-11). The DI-RNA molecules which ranged from 1047 to 1886 nt (Figure 2-11) were found in citrus tissue infected with CCLV. These DI-RNAs aligned into 10 different groups (Figure 2-11) and were classified as follows: (I) DI-RNAs with the 5 termini of RNA 1 and the 3 termini of R NA 2 (Figure 2-11; DI-1 a nd DI-2;), and their 5 end codes for part of the methyltransferase dom ain of ORF1 of RNA 1; (II) DI-RNAs containing both the 5 and 3 end of RNA 2 (Figure 2-11; DI -3 DI-7, DI-9 and DI-10) and their 5 end codes for the whole ORF1 of R NA 2; and (III) DI-RNAs having th e 5 end of RNA 2 and the 3 end of RNA 1 (Figure 2-11; DI-8); and its 5 end codes for the fu ll ORF1 of RNA 2. A particular feature of the DI-10 group was th at the DI-RNA contained an extra central insert of 74 nt, with the insert contained a reverse and complementar y sequence derived from g-RNA 2 (from nt 1344 to 1417). The junction areas of all the CCLV DI-RNAs except DI-1, were flanked by short (3 to 12 nt) direct or reverse repeats (Figure 2-12). Computer analysis of the sequences upand downstream of the junction site in these CCLV DI-RNAs did not s how the presence of extensive

PAGE 48

48 secondary structure. The CCLV DI-RNA molecules showed more than 99 % nucleotide identity with their respective CCLV g-RNAs (Table 2-2). Discussion This study reports the first complete sequence of a CCLV isolate from Panama. CCLV is a positive-sense bipartite RNA virus which shares low similarity with other positive-sense RNA virus groups. This was shown by No rthern blot analysis using pr obes targeting different regions of the CCLV genome (Figures 23 and 2-4) and by sequence analys is of the g-, sgand DI-RNAs associated with CCLV (Figures 2-7 and 2-11). Previously, a cDNA was c onstructed using total RNA extracts from leprosis infected samples co llected from Potrerillos, Panama which were confirmed to contain only cytoplasmic viru s particles by TEM (Guerra-Moreno, 2004). Eighty out of the 300 clones sequenced (26.67 %) fr om the cDNA library showed no significant homology to known plant sequences. These sequen ces aligned mostly into four contigs. Hybridization patterns in Northe rn blot analysis with probes from RNAs 1 and 2 (Figures 2-3 and 2-4) and sequence analysis of the R NA genome indicate that the CCLV is a bipartite virus with a gene expression st rategy consisting of 3 co-ter minal sgRNAs. This hypothesis was confirmed by sequencing all of the CCLV sgR NAs; sgRNA 1 from RNA 1 and sgRNAs 2, 3 and 4 from RNA 2 (Figure 2-7). Genomic RNAs, sgRNAs and DI-RNAs had 5 m7GpppN-caps and 3 poly(A) tail structures at their 5 and 3 termini, respecti vely. It was previously reported that CCLV genomic sequences started with a guanine (G) (Locali-Fabris et al. 2006; Pascon et al. 2006). Controversially, in this st udy, it was found that the first 5 nucleotide is a non-template G, which belongs to the 5 m7GpppN-cap structure. The sequen ce around the initia tion codon of all ORFs in RNA 1 and 2 corresponds only partially to the plant initiation consensus sequence AACAAUGGC (Lutcke et al. 1987).

PAGE 49

49 CCLV RNA 1 contains two ORFs. ORF 1 c odes for a putative 276 kDa polyprotein of 2,512 aa containing domains similar to those of th e super group of Sindbislike viruses (Karasev, 2000; Koonin & Dolja, 1993; Rozanov et al. 1992) with putative methyltransferase, OTU-like cysteine protease, RNA helicase and RdRp motif s (Figure 2-7). In addition, ORF 1 contains a conserved domain related to the FtsJ-like methyltransferase. The RNA methyltransferase domain is a unique characteristic found in the Alphavirus superfamily (Rozanov et al ., 1992; Ahola et al ., 2000) which has been involved in capping of the mRNA in the nucleus in eukaryotic systems (Ahola & Ahlquist, 1999; Ahola et al. 2000). Therefore, many plant viruses that replicate in the cytoplasm, su ch as CCLV, must encode their own methyltransferase (Ahola et al. 2000; Ahola et al. 1997). The OTU-like family constitutes a new group of computer predicted cysteine proteases, which share homology with the ovarian tumor gene (OTU) found originally in Drosophila spp (Steinhauer et al. 1989). Members include proteins from eukaryotes, viruses and the pathogenic bacterium Chlamydia pneumoniae (Makarova et al. 2000). However, this is the first report of an OUT-like cysteine protease family member in pl ant viruses. The FtsJ protein is a well conserved heat shock protein present in prok aryotes, Achaea, and eukaryotes (Bugl et al. 2000). The RNA helicase domain is widely found in virus families with positive-sense RNA genomes sequences (Koonin & Dolja, 1993) and it is thought to be involved in double-strand unwinding during replication of the viral RNAs (Ahola et al. 1997; Gomez de Cedron et al. 1999). The RdRp domain is present in a broad range of positive-stranded RNA virus families (Koonin & Dolja, 1993; Ward, 1993). The ORF 2 of CCLV RNA 1 showed no similari ty with known proteins using BLAST and Pfam analyses. Based on the similarity of this protein with the CP of other positive-stranded

PAGE 50

50 RNA viruses, it was hypothesized that ORF 2 coul d be involved in encapsidation of the viral RNA (Locali-Fabris et al. 2006). Inmunodetection TEM assays using polyclonal antibodies raised in rabbits and chickens against the produc t of ORF 2 RNA 1 failed to label virus particles inside infected cells. Instead, th ey labeled a virus inclusion pr otein localized inside of the viroplasm in the cytoplasm of infected cells (Brlansky et al ., unpublished results). The same polyclonal antibodies gave strong positive re sults when used in double-antibody-sandwichindirect ELISA (DASI-ELISA) assa ys with infected citrus and Brevipalpus mites (Manjunath et al ., unpublished results). These result s suggest that ORF 2 of RNA 1 is an inclusion body protein and not a structural protein (coat protein). The role this protein pa ys inside citrus and/or mite cells, which need to be further studied. The CCLV RNA 2 contains four ORFs. While ORFs 1, 2 and 4 show no similarity with other sequences in the GenBank, ORF 3 encodes a putative viral MP, which showed similarities with MP of other positive-sense RNA viruses be longing to Furo-, Bromo-, Tombus-, Umbraand Ilarvirus genera (Canto et al ., 1997). On the other hand, plant RNA viruses with small genomes are expected to make efficient use of their ge nome (Bustamante & Hull, 1998). However the role of a long RNA sequence (1122 nt; Figure 2-7) that did not code for any protein, and is located between ORF 1 and 2 in RNA 2 remains to be determined. The 5 and 3 termini of CCLV were obtaine d using two different methodologies (SMART RACE cDNA amplification and GeneRacer). Ma ny plant and animal viruses contain genomes ending with a poly(A) tail (B uck, 1996; Dreher, 1999). It was found, by sequencing several clones from g-RNA, sgRNA and DI-RNAs, that they contain a poly(A) tail at the 3 termini and their length ranges from 35-70 nt and are similar to those reported for the host mRNAs (Ahlquist & Kaesberg, 1979; Jacobson & Peltz, 1996; Thivierge et al. 2005). The GeneRacer results also

PAGE 51

51 indicated the presence of a 5 m7GpppN-cap in the g-, sgand DI-RNAs. In eukaryotic systems, many positive-strand RNA viruses contain a 5 m7GpppN-cap and 3poly(A) tail structures similar to those present at the termini of most cellular mRNAs (Dreher & Miller 2006; Thivierge et al. 2005). These results indicated that CCLV is a bipartite positive-stranded RNA virus with 5 m7GpppN-cap and a 3 poly(A) tail on its g-, sgRNAs and D I-RNAs. Less than 20% of all positive-stranded RNA plant viral genera have their gand sgRNAs resembling host mRNAs with a 5 -cap and poly(A) tail (Dreher & Miller, 2006; Fauquet et al. 2005; van Regenmortel, 2000). Many viruses with capped RNAs harbor elem ents that enhance cap-dependent translation, independently of the nature of the 5 and 3 UTR (Dreher & Miller, 2006). These elements apparently facilitate translation of the viral sgRNAs (Dreher & Miller, 2006; Ivanov et al. 1997). The 5 UTRs of CCLV RNAs 1 and 2 lack long regions of homology, however the 3 UTRs of those RNAs have a homologous region with 85 % identity. Homologous regions at the 5' end are found commonly at the 5' e nds of virus-complementary (negative-sense) RNA in segmented positive-sense RNA viruses such as TRV and AlMV (Hamilton et al. 1987; van Rossum et al. 1997) and are thought to play a role in the interaction of the viral RdRp with the 3' termini region of viral RNA ge nome during replication (Duggal et al. 1994; van Rossum et al. 1997). A computer-assisted secondary structure predicti on did not reveal tRNA-like structures in the 3 termini of CCLV, but loops and hairpin-structures may form at both termini. The small conserved sequence ATAAAA/TCT was found at the farthest 5end region of CCLV RNAs; the ATG sequence was found at the 5 end of both sgRNA 1 and 3; and the sequence ATTG was found at the 5 end of sgRNA 1 and 4. These conserved sequences could play a role in translation, negative-strand initia tion and replication of CCLV g-, sgand DI-RNAs as reported

PAGE 52

52 for other virus systems (Dreher & Miller, 2006; Frolov et al. 2001; Gorchakov et al. 2004; Hardy & Rice, 2005; Skulachev et al. 1999),. No putative CCLV proteins were shown to ha ve any transmembrane domains, except for the ORFs 2 and 4 of RNA 2 (Figure 2-10). ORF 2 product was predicted to contain only one transmembrane helical domain. ORF 4 had four predicted transmembrane domains suggesting that this protein may be localized to the memb ranes. Its size (24 kDa; Figure 2-7), which is comparable to other viral coat proteins (Albiach-Marti et al. 2000; Canto et al. 1997; Livieratos et al. 1999); and its hydrophobic nature suggests that it could possibl y be the CCLV coat protein. Additional research is required to clarif y the identity and cellu lar location of all CCLV proteins. Phylogenetic analysis of CCLV conserved motifs with other positive-sense RNA viruses showed relationships with several other posi tive-sense plant RNA viruses (Ahola & Ahlquist, 1999; Ahola et al. 2000; Fazeli & Rezaian, 2000; Kaariain en & Ahola, 2002; Karasev, 2000; Karasev et al. 1996; Makarova et al. 1999; Melzer et al. 2001; Merits et al. 1999; Savenkov et al. 1998; Shirako et al. 2000; Ward, 1993). However, CCLV is distinctly different from other known positive-sense, plant RNA viruses with re spect to its genome organization, mechanism of gene expression, as well as the presence of novel viral proteins. This su ggests that CCLV may belong to a new genus of positive-sense multipartite RNA viruses. It has been proposed that it be tentatively placed in a new genus called Cycilevirus (Guerra-Moreno, et al. unpublished results) These studies have revealed that citrus plants infected with CCLV had in addition to the two viral g-RNAs, an array of less than full length genome RNA species. These RNA species could be classified as follows: (a) four 3 co -terminal sgRNAs and; (b) defective interfering RNA species that have both the 5 and 3 end of either RNA 1 and/or 2, but lack the central

PAGE 53

53 region. Many plant viruses including CTV, Sweet potato chlorotic stunt virus (SPCSV), TMV, TRV, BMV, TBSV (Adkins & Kao, 1998; Albiach-Marti et al ., 2000; Hernandez et al ., 1996; Hilf et al ., 1995; Rubio et al ., 2000; Wu & White, 1998) and CCLV encode for more than one ORF on the viral g-RNA. However, it is known th at only the first ORF of an eukaryotic mRNA is translated by the plant host protein synthesis machinery (Mill er & Koev, 2000). The ORF 1 of both CCLV RNA 1 and 2 is believed to be translated from the gRNAs, but the results here and those of others (Mille r & Koev, 2000; Skulachev et al ., 1999) suggest that all downstream ORFs on the bipartite g-RNA are expressed via sgR NAs as occurs in many other positive-stranded RNA viruses (Dreher & Miller, 2006; Duggal et al ., 1994; Miller & Koev, 2000; Skulachev et al ., 1999). This study revealed that CCLV has 4 sgRNAs ranging in length from 937 to 3389 nt. The sgRNA 1 is used as the template for tran slating ORF 2 of RNA 1. The sgRNAs 2, 3 and 4 are used to generate the gene products of OR F 2, 3 and 4 of RNA 2, respectively. On another hand, an additional fragment that was detected w ith the negative sense probe is probably a DIRNA molecule or the hypotheti cal sgRNA for the RdRp region. However, using the SMART RACE cDNA amplification and the GeneRacer t echniques, no sequences corresponding to the hypothetical sgRNAs of RdRp were obtained. The data implies that the sgRNA for the RdRp does not exist or is not capped or it accumulates at very low levels. The RdRp protein is most likely expressed as a polyprotein from ORF 1 which is subsequently post-translationally processed. Probes designed based on the sequences of the RdRp region would further elucidate the presence or not of the RdRp sgR NAs in CCLV-infected citrus tissue. The RNA fragments (about 1.5 kb) observed wh en the sequence for the RdRp protein was used as a probe (Figure 2-3) could represen t the presence of DI-RNA molecules, since it hybridized with the probes from the 5 as well the 3 end of RNA 1. The RdRp is thought to be

PAGE 54

54 expressed from the g-RNA only, and not from any sgRNAs. DI-RNAs were initially reported in animal viruses (Holland et al. 1982), however later they also have been found associated with several plant viruses, such as closteroviruses (Ayllon et al. 1999; Kreuze et al. 2002; Rubio et al. 2000; Yang et al. 1997), cucumoviruses (Graves & Roossinck, 1995), potexviruses (White et al. 1991), tombusviruses (Wu & White 1998), tobraviruses (Hernandez et al. 1996) and bromoviruses (Damayanti et al. 1999; Pogany et al. 1995). This is the first report of the presence of naturally occurring DI-RNAs in citr us plants infected with CCLV (Figure 2-11). These DI-RNAs are recombinant or chimeric mo lecules thought to be generated by aberrant RNA synthesis during virus replication as occurs with other RNA viruses (Ayllon et al. 1999; Wu & White, 1998). They were not generated from error prone RT or PCR reactions; as their presence was confirmed by Northern blots and by sequence analyses. Analysis of the sequences upand downstream of the DI-RNAs junction sites revealed that the borders were flanked by shor t direct and inverted repeats. The replicase driven-template switching mechanism (Ayllon et al. 1999; Hernandez et al. 1996; Mawassi et al. 1995; Nagy & Simon, 1997) best explains the generation of the DI-RNAs produced during CCLV infections. The observation that some CCLV DI-RNAs (DI-1, DI-2 and DI-8; Figure 2-11) are recombinant molecules between RNA 1 and 2 implies that bot h RNAs replicate using a similar mechanism, and may use the same pool of the viral replicase complex. DI-RNAs that interfere with symptom expre ssion caused by the help er virus are called defective interfering RNAs (DI-RNAs) (Li et al. 1989; Perrault, 1981). The alteration of symptoms in CCLV infection caused by the pres ence of these DI-RNAs has not been studied. However, the presence of DI-RNAs in high titers suggests that they may modify the expression of symptoms caused by CCLV.

PAGE 55

55 Taken together, these data provides further evidence that CCLV is a bipartite positivestranded RNA virus, with at least four co-t erminal sgRNAs, several DI-RNAs, and does not belong to the family Rhabdoviridae of the order Mononegavirales even though it was considered an unassigned member (Fauquet et al. 2005; van Regenmortel, 2000). CCLV should be placed in a new virus group (Cycilevirus) based on the re sults of this study and other recent studies (Locali-Fabris et al. 2006; Pascon et al. 2006). The CCLV sequences from Brazil and Panama deposited in the GenBank share more than 99.2 % nucleotide identity. It has been hypothesized that CCLV was first introduced into Panama during the middle 1980s through illegal shipping of infected budwood from Brazil (Botello L., personal communication). Based on the sequence similarity of the CCLV isolates present in th e GenBank, it is suggested that the Panamanian isolate came from Brazil. Despite the fact that a larg e amount of information about the molecular properties of CCLV has been generated in the last decade, mo re studies are needed to better understand the leprosis pathosystem. At the moment, only two CCLV proteins ha ve similarities with proteins from other plant viruses. The unique CCLV proteins may have dua l functionality in the mite vectors and /or citrus plants. Plan t viruses encode suppressors of gene silencing to avoid the hostsilencing response (Brigneti et al. 1998; Ding et al. 2004; Li & Ding, 2006; Lu et al. 2004). However, CCLV is adapted at overcoming the in nate citrus plant defense system and causing disease. Yet its gene silencing suppressor(s) are not known. Further studies are required to help filling the gaps of knowledge a bout CCLV and citrus leprosis. The nuclear type of leprosis virus (NCL V) has been reported less often than CCLV (Bastianel et al. 2006b; Dominguez et al. 2001; Guerra-Moreno et al. 2003; Guerra-Moreno, 2004; Guerra-Moreno et al. 2005a). Even though the molecular information developed here

PAGE 56

56 would facilitate the improvement of management st rategies to be used in certification, quarantine and eradication programs against the CCLV-citrus-mite pathosystem, there is a need for the molecular characteri zation of the NCLV.

PAGE 57

57 Table 2-1. Primers used for analysis of Cytoplasmic citrus leprosis virus (CCLV). Primer RNA Primer Sequence Kpr658 RNA 1 5_7804AAGGTCTGCGTGATATTAGCAAGCCTA7830_3 Kpr659 RNA 1 5_8228TATGGGTCGCTTCGGGAAGCCCATAC8203_3 Kpr680 RNA 1 5_1698TTGGTAACTATGAAGATGTTAG1719_3 Kpr680r RNA 1 5_1719CTAACATCTTCATAGTTACCAA1698_3 Kpr681 RNA 1 5_3182 ATCCTCAAATAGCGTGGTTAG 3162_3 Kpr684 RNA 1 5_2448TCTAACAAAGGTTCGAGGTTCATT 2471_3 Kpr685 RNA 1 5_2477CAATTAGAGCATAGCCATTATAG2500_3 Kpr686 RNA 1 5_3166GTTAGCGTATTCAAGGATTCTGGA3143_3 Kpr687 RNA 1 5_3688AACGTGCTGTGGTTGTGGAGAC3709_3 Kpr688 RNA 1 5_3849TGCTATTCAGATGTTGAGATAT3870_3 Kpr689 RNA 1 5_7733GAGTATCGTAACTTTCACTTTG7712_3 Kpr690 RNA 1 5_7780TCAATGGCCTGCATAATCTCAG7759_3 Kpr708 RNA 1 5_4321AAGCTGTCTACGAGTACAGGTCGTA4345_3 Kpr709 RNA 1 5_4427TCCTAAGAGGCTTAATGAGATGTAC4451_3 Kpr710 RNA 1 5_7066AATCCTGATCTCCTATCTTTAACGA7042_3 Kpr711 RNA 1 5_7038ACTCAACATGTGACTTGAACCAAAT7014_3 Kpr712 RNA 1 5_5091TTCTGCGTTGGCGATAAGAAGCAG5114_3 Kpr713 RNA 1 5_5155AGAAATTGTGTGATTTTGTCAACACT5180_3 Kpr714 RNA 1 5_6364ACCTATGACTGCATGATTCCTAGACT6339_3 Kpr730 RNA 1 5_396TTCTCCCATTGAGCTGCTCACGAATCTC369_3 Kpr731 RNA 1 5_316GAAGTGATAACCTCACTGTCGCTAACGA289_3 Kpr732 RNA 1 5_7520TGTTGACCCCGCTGAGGTCTTTAGAGTC7547_3 Kpr745 RNA 1 5_1602GATCCGTCTTTTCCTATTCCTGTAC1625_3 AGpr06 RNA1 5_1717AGTCGGGGTTTGGTGCACGTATTAGCT1690_3 AGpr12 RNA 1 5_1GATAAAACTGTCAAGTGATATACCACATT29_3 AGpr33 RNA 1 5_131TTCAACGGTGCTATGTGTAGACATCTT105_3 AGpr34 RNA 1 5_225TGGTATGTGTCGCCGTGAACCTAGGTT199_3 Kpr586 RNA 2 5_4876CAACCTCGCCCAGCTGACAACG4855_3 Kpr588 RNA 2 5_4902AGAAATTAATCAAACTTGAGG4882_3 Kpr643 RNA 2 5_3702AGTTCACAGGCGGCTTGGTATACA3679_3 Kpr670 RNA 2 5_4130AGGCGCGCAGCTAACGTTAGGCAAAG4155_3 Kpr671 RNA 2 5_4386ACCAGAGCACCACAGATCCTGAAGAAG4360_3 Kpr682 RNA 2 5_3961GGTTAAGAAGAGTACTGGTC3980_3 Kpr683 RNA 2 5_4007GATAATCAAAGAAAACATCCTG4028_3 AGpr04 RNA2 5_3363AGACCGTTTGCATTCGGACTGACAA3339_3 AGpr09 RNA2 5_3339AGACCGTTTGCATTCGGACTGACAA3363_3 AGpr18 RNA 2 5_2261TATGAGGAGAGGCTTATAAAAGTCCAC2287_3 AGpr19 RNA 2 5_2670TCATGAAGATGATTAACATCAAAGCCTT2643_3 AGpr22 RNA 2 5_1980AACACTTCACCAATATGCTTCTGCCCAT1953_3 AGpr27 RNA 2 5_791GGATTTGTCTGCAATATCTACGGATCAA818_3 AGpr32 RNA 2 5_1605AGCTGAAATAGCGCCATTTGACAATAC1579_3 AGpr35 RNA 2 5_907TTGGGGCAAGCGGATTAAGGCTGGTTT881_3 AGpr41 RNA2 5_124TTGGGGCAAGCGGATTAAGGCTGGTTT98_3

PAGE 58

58 Table 2-2. Nucleotide sequence comparison betw een Panamanian and Brazilian isolates of Cytoplasmic citrus leprosis virus (CCLV). a Nucleotide (nt). b Adenines. c The identity percentage expresse d here is derived from comparing the nt sequence of the Panamanian and the Brazilian isolates. RNA Accession number Country origin Length (nt)a GC contain (%) Poly(A) tailb Identity (%)c DQ388512 Panama 8730 42.57 35-70 -----DQ157466 Brazil 8730 42.50 ? 99.21 RNA 1 NC_008169 Brazil 8745 42.41 ? 99.26 DQ388513 Panama 4969 40.55 35-70 -----DQ157465 Brazil 4975 40.52 ? 99.54 RNA 2 NC_008170 Brazil 4986 40.51 ? 99.58

PAGE 59

59 Figure 2-1. Symptoms of leprosis disease on citrus leaves. A) Disease symptoms on a mature citrus leaf showing a large le sion. B) Citrus leaf with se veral small leprosis disease lesions. Lesions on leaves could cover more than 50% of the leaf surface. C) Citrus leaf with early leprosis symptoms. D) Cl ose-up view of the lesion from Panel A; where small corky-like necrotic spot are observed in the surrounding area. All leaves were collected from sweet orange cv. Valencia trees from Potrerillos, Chiriqu State, Panama. A B C D

PAGE 60

60 Figure 2-2. Symptoms of leprosis disease on citrus fruit and twigs. A) Typical leprosis symptoms on a mature fruit. Fruit lesions are concentric chlorotic rings with a necrotic and dark central area. B) Close-up view of a sunken le prosis lesion (arrow), th at penetrates into the fruit peel. C) Leprosis symptoms on a necrotic and girdled twig. The twig was showing die-back symptoms. D) Multiple concentric rings on a leprosis-affected citrus twig. All these sweet orange cv. Valencia fru its and twigs were from Potrerillos, Chiriqu State, Panama.

PAGE 61

61 Figure 2-3. Northern blot analysis of total RNA extractions from citrus tissue using DIG-labeled DNA probe from ORF 1 CCLV RNA 1. Total R NA extractions from different citrus leaf tissue were loaded in la nes 1 to 5. The citrus tissue samples were collected from Potrerillos, Panama and hybridized w ith a DNA probe for ORF 1 CCLV RNA 1. Lesion (lanes 1 and 2), and non-lesion areas (lanes 3 and 4) of symptomatic leaves were used. Leaves from healthy trees (lane 5) were used as a negative control. RTPCR products using universal primers and clone AGpl-2-F08 (325 bp; lane 6) were used as positive controls. In each lane (1 to 5), 5 g of total RNA extractions were loaded. Lane M represents 100 ng of RNA mo lecular weight marker I (Roche cat. # 1526529); marker sizes are indicated on the left of the picture. The g-RNA and putative DI-RNAs are shown by black arrows. M 1 2 3 4 5 6 6948 4742 4742 2661 18211821 15171517 10491049 g g R R N N A A 1 1 D D I I R R N N A A s s

PAGE 62

62 Figure 2-4. Northern blots using DNA probes fro m ORFs 3 and 4 of CCLV RNA 2. Total RNA extracts from leprosis-affected citrus leav es (lanes 1) and fru its (lanes 2) were collected from Potrerillos, Chiriqu Stat e, Panama. A) Banding patterns when ORF 3 was used as probe. B) Banding patterns of a probe made from ORF 4. Each lane was loaded with 5 g of total RNA extractions from leprosis-symptomatic citrus tissue. The marker sizes are indicated on the le ft. The gand sg-RNAs are shown by double headed black arrows. The sg-RNA 4 that is only observed in Panel A is shown by a single headed black arrow. 1 2 1 2 g g RNA 2 RNA 2 Sg Sg RNA 4 RNA 4 Sg Sg RNA 3 RNA 3 Sg Sg RNA 2 RNA 2 A B 474247424742 266126612661 182118211821 151715171517 104910491049

PAGE 63

63 Figure 2-5. Long distance RT-PCR amplificatio n of CCLV g-RNAs. RT-PCR amplification done with total RNA extracted from Po trerillos, Chiriqu State, Panama. Thermoscript RT-PCR (Invitrogen) and Mast erAmp Extra Long PCR (Epicentre) kits were used to amplify the regions between CCLV clones showing similar banding patterns in Northern blot analysis. Prim ers AGpr-04 and Kpr-670 (lane 1), and AGpr04 and Kpr-671 (lane 2) were used to am plify the region betw een clones AGpl-1-A01 and AGpl-2-D08 from RNA 2. Similarly, pr imers Kpr675 and Kpr-658 (lane 3), and Kpr675 and Kpr-659 (lane 4) were used to amplify the region located between the clones AGpl-1-C09 and AGpl-2-F08 from RNA 1. Each lane was loaded with 10 l of the RT-PCR reaction mixture. Lanes M and M* were loaded with 0.5 g of 100 bp DNA ladder (Invitrogen) and 0.5 g of DNA/ Hind III fragments (Invitrogen), respectively. M 1 2 3 4 M* 2322 6557 565 4361 600 2072 1500 23,130

PAGE 64

64 Figure 2-6. RT-PCR amplification of 5 te rmini of decapped CCLV RNA 1 and 2. RT-PCR amplifications were performed using tota l RNA extracted from leprosis-infected citrus tissue collected from Potrerillos, Chiriqu State, Panama. A) Shows the products of RT-PCR amplifications using Ge neRacer 5 primer in combination with Kpr-730 (RNA 1; lane 1), AGpr-20 (RNA 2; lane 2), AGpr-32 (RNA2; lane 3), AGpr-34 (RNA 1; lane 4), AGpr-20 (RNA 2; la ne 5) and control primer B1 (HeLa cell; lane 6). Citrus leaves (lanes 1-3), fru its (lanes 4 and 5), HeLa total RNA extracts (positive control; lane 6) and water contro l (lane 7) were used in RT-PCR assays. B) Shows a gradient and nested PCR for RNA 1 using the cDNA (Panel A, lanes 1 5) from the GeneRacer assays. RT-PCR amplifi cations using GeneRacer 5 Primer in combination with Kpr-731 (317 bp; lanes 1 3), and AGpr-34 (132 bp; lanes 4 6) were optimized by performing a gradient PCR at different annealing temperatures: 55 C (lanes 1 and 4); 60 C (lan es 2 and 5); 65 C (lanes 3 and 6). C) Shows a gradient and nested PCR for RNA 2 using the c DNA from the GeneRacer assays. RT-PCR amplifications using GeneRacer 5 primer in combination with AGpr-32 (1520 bp; lanes 1 3; white arrow) and AGpr-37 ( 1000 bp; lanes 4 6; black arrow) were performed by gradient PCR at different anne aling temperatures: 55 C (lanes 1 and 4); 60 C (lanes 2 and 5); 65 C (l anes 3 and 6). Each lane was loaded with 10 l of the RT-PCR reactions. Lanes M were loaded w ith 0.5 g of 100 bp DNA ladder (Fisher Scientific). C BM 1 2 3 4 5 6 M 1 2 3 4 5 6 1000 2000 500 1000 2000 500 AM 1 2 3 4 5 6 7 1000 2000 500

PAGE 65

65 Figure 2-7. Schematic genome (g-) and subgenom ic (sg-) organization of CCLV RNAs. Conserved methyltransferase, OTU-lik e cysteine transferase FtsJ-like methyltransferase, RNA helicase and Rd RP domains of ORF 1 RNA 1 are shown. The boxes show the coding regions with th e final putative gene product identified. SgRNAs are indicated below its respective RNA. The black balloons at the 5 end and the triple A located at the 3 ends of both gand sgRNAs correspond to the 5 m7GpppN-cap structure and the poly(A) tail s, respectively. The length of both gand sgRNAs are showed. The location of the probe s (1-4) used for Northern analysis are shown. The scale at the top correspo nds to the length (in thousand nt). ORF 1 ORF 1 ORF 1 ORF 1 ORF 4 ORF 4 ORF 3 ORF 3 ORF 2 ORF 2 Conserved domains of ORF 1, RNA 1 Conserved domains of ORF 1, RNA 1 Methyltransferase OTU-like cysteine transferase FtsJ-like methyltransferase Helicase RdRP ORF 2 ORF 2CCLV RNA 1 CCLV RNA 1 8730 nt CCLV RNA 2 CCLV RNA 2 4969 nt *Probe 2 Probe 2 *Probe 1 Probe 1* *Probe 3 Probe 3* *Probe 4 Probe 4 Sg Sg RNA 1 RNA 1 1068 nt Sg Sg RNA 2 RNA 2 937 nt Sg Sg RNA 3 RNA 3 1751 nt Sg Sg RNA 4 RNA 4 3389 nt 3 2 1457 689 0AAA AAA AAA AAA AAA AAA AAA AAA AAA AAA AAA AAA

PAGE 66

66 Figure 2-8. Sequence alignment analysis of the 5 and 3 UTRs of CCLV g-RNAs. A) Shows the complementarity between the 5' UTRs of CCLV RNAs 1 and 2. B) Shows the complementarity between the 3' UTRs of CCLV RNAs 1 and 2. Numbers at the beginning and the end of the lines indicat e the position of th e nucleotide in the genomic RNAs. Conserved nucleotide re gions are shown as shaded boxes. A B

PAGE 67

67 Figure 2-9. Phylogenetic analysis between c onserved motifs in CCLV ORF 1 RNA 1, ORF 3 RNA 2 and related plant viruses. Un rooted dendograms showing phylogenetic relationships of the A) methyltransferase B) RNA helicase, and C) RNA dependent RNA polymerase (RdRp) motifs in ORF 1RNA 1, and D) the putative movement protein in ORF 3 RNA 2 with proteins of related positive-stranded RNA viruses. The aa sequences of the conserved motifs and flanking sequences of ORF 1 RNA 1 and ORF 3 RNA 2 were aligned using Clusta l_X Multiple Alignment Program and bootstrapped 100,000 times using the PAUP prog ram (percent scores are shown at nodes). Horizontal branches are proportio nal to genetic distance. The scale bar corresponds to substitutions per aa site. The virus names, virus acronyms and accession numbers are described in the text. 100 83 77 74 99 BSMV BSMV OGSV OGSV BSBV BSBV TRV TRV SBLV SBLV HVS HVS CCLV CCLV 100 changes AIMV AIMV FCILV FCILV IPCV IPCV 100 83 77 74 99 BSMV BSMV OGSV OGSV BSBV BSBV TRV TRV SBLV SBLV HVS HVS CCLV CCLV 100 changes AIMV AIMV FCILV FCILV IPCV IPCV 99 96 52 80 57 78 60 CCLV CCLV PMTV PMTV BYV BYV CYSDV CYSDV RBDV RBDV CGMVS CGMVS PepRSV PepRSV BSMV BSMV PCV PCV SBWMV SBWMV BBNV BBNV CMV CMV BMV BMV50 changes 97 98 71 92 77 100 changes BSMV BSMV IPCV IPCV BVQ BVQ OGSV OGSV CGMMV CGMMV PepRSV PepRSV CCLV CCLV GLRaV GLRaV 2 2 LIYV LIYV 99 100 changes SgCSV SgCSV OGSV OGSV CCLV CCLV OLV OLV 2 2 PNRSV PNRSV BMV BMV CMoMV CMoMV A B C D

PAGE 68

68 Figure 2-10. Graphic representa tion of the putative transmembrane domains found in ORFs 2 and 4 of CCLV RNA 2 using TMHMM co mputer software. A) Transmembrane domain of ORF 2 RNA 2 located at the C te rminal portion of this protein. B) Four transmembrane domains of ORF 4 RNA 2. The red bars and lines represent the location and the probability of the transm embrane domains. The blue and pink lines represent the putative cellular lo cation of the protein segments. Amino acid positions ProbabilityAmino acid positions. Probability B A Amino acid positions ProbabilityAmino acid positions. Probability B A

PAGE 69

69 Figure 2-11. Schematic representation of the CCLV gand DI-RNAs. RNA 1 and 2 sequences are represented as gray and black horizontal solid bars with coding region showed as open and filled boxes. The respective positions of CCLV ORFs, as well as the size of all DI-RNAs are shown. The dotted lines correspond to the deleted regions not present in the corresponding DI-RNAs, but appear in the parental g-RNAs. The black and grey balloons at the 5 end and the triple A located at the 3 ends of both gand sgRNAs represent the 5 m7GpppN-cap stru cture and the poly(A) tails, respectively. The scale at the top corres ponds to the length (in thous and nt) of all CCLV RNAs. The red arrow represent a 74 nt inverted and complementary insert present in D10. AAA AAA AAA AAA 3 2 1457 689 0 AAA AAA AAA AAA DI-1 1062 nt DI-2 1047 nt AAA AAA DI-3 1464 nt DI-4 1521 nt RNA-1 8730 nt RNA-2 4969 nt AAA AAA AAA AAA DI-5 1609 nt AAA AAA DI-6 1818 nt DI-7 1456 nt AAA AAA AAA AAA DI-8 1886 nt AAA AAA DI-9 1714 nt AAA AAA DI-10 1680 nt

PAGE 70

70 Figure 2-12. Junction sequence regions of CCLV D I-RNAs molecules. The letters represents the sequences surrounding the junction site s in CCLV DI-RNAs. Capital letters correspond to the sequences which are pres ent in the DI-RNAs upand downstream of the junction site, while the lowercase le tters correspond to the sequences which are absent in the DI-RNAs, but are presen t in the corresponding parental g-RNA molecules. Direct and reverse (and co mplementary) sequences surrounding the junction sites are underlined. The nucleotid e position corresponds to those on the gRNA 1 and 2. The dotted lines represent the sequences present in the g-RNAs molecules. DI-1 TGAAGAAGTATAtctactctcatgccgtcaactttgGTTGACACCTAC3 DI-2 ACCC GAGG GGTAtcacgtcaagaaccaacgaacaatT GAGG AAGCTTT2 DI-3 TACTACT AGGGTtt agtcctaataactggtgttatgCGG AGGGTTT TC3 DI-4 ATA CTACTAGGGttt agtcctaatttgccaataggg CTTCTAGGGTGT 3 DI-5 TGGTCATT TGATtgcta tttgactttccatg tgtatGCTA AGGCTAAA2 DI-6 GCGTTG GCTTCC aggttgatgccgaacgaacaattgA GGAAGC TTTAT2 DI-7 CTGGTACGTATActact agggttt ctactggtgttaTGCGG AGGGTTT 3 DI-8 GCCGA CCGGTTT gtatatattgtactaaggact ccgTTT CTGACTATG1 DI-9 AACCATAATTGAttt ggg agcgttatagggcttcta GGG TGTCTACTG3 DI-10 GG TTTA GTCCTAatagtattcattaacaattgaggaAGC TTTA TGCTG1DI-RNA Junction sites # of clones 8224731 6914614 12474753 1445 1484 1237 1464 1162 1246 1256 4621 4701 8321 4751 4616 4523 4695

PAGE 71

71 CHAPTER 3 MOLECULAR AND SEROLOGICAL DETECTION OF THE CYTOPLASMIC CITRUS LEPROSIS VIRUS (CCLV) USING RT-PCR PRIMERS TARGETING DIFFERENT CCLV GENES AND POLYCLONAL ANTISERA Introduction Leprosis disease is currently one of the most important viral diseases in Brazil (LocaliFabris et al. 2006; Pascon et al. 2006). The disease has been pres ent in several South American countries for over six decades (Kitajima et al. 2003; Rodrigues, 2000). Recent reports of leprosis occurring in Central America and Mexico (Dominguez et al. 2001; Guerra-Moreno et al. 2005; Kitajima et al. 2003; Meza Guerrero, 2003; Rodrigues et al. 2003; Rodrigues et al. 2007; Snchez-Anguiano, 2005) highlight its northward spread which poses the economic threat of this disease to the USA and Caribbean Basin citrus industries where it does not occur (Childers et al. 2003a; Guerra et al. 2005). In the past diagnosis of leprosis has de pended primarily on the assessment of typical leprosis symptoms on leprosis-infected citrus tr ees and then confirmation of the presence of the virus using transmission electron microscopy (T EM). The diagnosis of leprosis based on symptoms alone is not reliable (Locali et al. 2003). Leaf symptoms may be confused with those caused by other citrus pathogens, such as citrus canker ( Xanthomonas axonopodis pv. citri ) while the bark/twig symptoms could be confused with those caused by Citrus psorosis virus (Omoto, 1998; Rodrigues, 2000; Rossetti, 1980). The use of TEM for confirmation is time consuming and costly; requiring tr ained technicians, high cost e quipment and several days to obtain results (Guerra-Moreno, 2004; Locali et al. 2003). There has been recent progress on the molecular characterization of the Cytoplasmic citrus leprosis virus (CCLV) (Guerra-Moreno et al. 2005; Locali-Fabris et al. 2006; Pascon et al. 2006). This information has proved to be useful for the development of rapid diagnostic methods.

PAGE 72

72 Even though the first report of virus-like par ticles being associated w ith leprosis was made over 30 years (Kitajima et al. 1972), the virus has not been purified due to the low virus accumulation in infected ti ssue (Lovisolo, 2001; Lovisolo et al. 2000) and the nonor limited systemic behavior of the virus (Chagas & Rossetti, 1984; Guerra, 2004; Rodrigues, 2000; Rossetti, 1996). These intrinsic characteristics of CCLV have hampered the molecular characterization of the virus and the subsequent development of more sensitive diagnostic methods. The present study was undertaken to develop rapid and accurate molecular and serological diagnostic methods for the detectio n of CCLV, the most prevalent virus associated with citrus leprosis disease (Childers et al. 2001a; Childers et al. 2003; Kitajima et al. 2003b). Such applications would be very useful for quarantin e and certification progra ms, as well as gaining additional information for the developm ent of better management programs. Materials and Methods Virus Source Leprosis infected sweet orange Citrus sinensis (L). Osbeck leaf, fr uit and bark showing typical leprosis symptoms were collected from tw o locations in Panama: Boquete and Potrerillos, Chiriqu State (Table 3-1). Citrus tissue with leprosis lesions (c hlorotic areas) as well as from non-lesion (green) leaf areas, fruit and twigs was used for total nucleic acid extractions. In addition, tissues from symptomatic leprosis and apparently hea lthy sweet orange trees were collected from So Paulo and Minas Gerais St ates, Brazil; Santa Rosa State, Guatemala and Maracay, Aragua State, Venezuela and used fo r total nucleic acid extractions. These samples were kindly provided by Richard F. Lee, Maragarita Palmieri a nd Ezequiel Rangel, respectively. Citrus leaves, fruits and twigs from trees withou t leprosis symptoms were collected as negative

PAGE 73

73 controls from areas in Santiago, Veraguas State, Panama City, Panama, and the University of Florida Citrus Research and Education Center (CREC), Lake Alfred, Florida. Total Nucleic Acid Extraction and RNA Isolation The extraction of total nucleic acids was done in the country of collection by using two to five g of tissue which were powdered in a mortar and pestle after freezi ng with liquid nitrogen, and the total nucleic acids were extracte d using the protocol described by Rosner et al. ( 1986). The extracts were shipped to University of Flor ida, Gainesville, FL. Total nucleic acids were resuspended as follows: two to four ml aliquots of the total nucleic acid ex tracts were centrifuged at 14,000 rpm for 20 min at 4 C. Th e pellet was resuspended in a total volume of 100 l RNasefree water which was then applied to the QIAgen RNeasy Plant Mini Kit (QIAgen) according to manufacturers instruct ions. The final total RNA extraction was resuspended in 30 l of DNaseRNase-free water, and stored at -80 C for futu re use. The concentration of the total RNA was determined by measuring absorbance at 260 nm (A260) in a SmartSpec 3000TM spectrophotometer (Bio-Rad). The RNA purity and integrity of the citrus RNA extracts were checked by electrophoresis on a 1.0% agarose gel followed by ethidium bromide (0.5 g ml-1) staining. In addition, the RNA quality was assessed using primers K 616 (5-TATGCTTGTCTCAAAGATTAAG-3) and K617 (5-TAATTCTCCGTCACCCGTC-3) for the detec tion of 18S ribosomal mRNAs by the RTPCR method as described pr eviously (Guerra-Moreno, 2004). Primer Design Based on CCLV open reading frames (ORFs) with high levels of expr essions, as seen in Northern blots (Guerra-Moreno, 2004; Figure 2-7 in Chapter 2), several sets of forward and reverse primers were designed for the RNA 1 OR F 2 and RNA 2 ORF 4 (Table 3-2). The primer pairs Kpr-658 and Kpr-659 (RNA 1 ORF 2) a nd Kpr-670-671 (RNA 2 ORF 4) amplify 425 and

PAGE 74

74 257 bp fragments, respectively. In addition, prim er pairs Kpr-685 and Kpr-686 located between the OTU-like cysteine protease and RNA helicase domains of the replicase protein in RNA1 ORF 2 (Figure 2-7 in Chapter 2) also were desi gned (Table 3-1). The primers were synthesized by Integrated DNA Technologies, In c (http://www.idtdna.com/). Reverse Transcription (RT) and Po lymerase Chain Reaction (PCR) The total RNA extracts from citrus sample s collected from Potr erillos and Boquete, Chiriqu State, Panama were tested by RT -PCR using CCLV-specific primers sets Kpr-658-659, Kpr-670-671 and Kpr-685-686 (Table 3-1). Primer set K616-617, which detects the 18S rRNAs, was used as positive control and to determine th e quality of the RNA extracts. The RT reaction was performed using a ThermoScript Reverse Transcriptase kit (Invitrogen) according to manufacturers inst ructions. In a sterile 0.5 ml PCR tube the following were added: 1.0 g of total RNA extraction, 1 l of each CCLV-specific primer (10 M each), 10 mM dNTPs mix and RNase-free water to 12 l total volume. The tube contents were mixed, quickly centrifuged and incubated at 65 C for 5 min, then immediately tran sferred to ice. A mixtur e containing 4 l of 5x cDNA synthesis buffer, 1 l of 0.1 M Dithio threitol (DTT), 1 l RNaseOUT (40 U l-1) and 1 l of ThermoScript RT enzyme (15 units l-1) was added to the tube. The mixture was incubated at 60 C for 1 h. The reaction was terminated by a final incubation at 85 C for 5 min. The generated cDNAs were either used immediately or stored at -20 C for further use. The PCR reaction mixture consisted of 2 l of first strand cDNA, 5 l 10X PCR buffer (50 mM KCL, 10 mM Tris-HCL pH 9.0 and 0.1% Tr iton X-100), 5 l 25 mM MgCl2, 1 l dNTPs (10 mM each), 1 l each of primer set (10 M of each), 1 U Taq DNA polymerase (Invitrogen) and DNase and RNase free water to 50 l total vo lume. The PCR amplification parameters were: 94 C for 3 min; then 30 cycles at 94 C for 30 s, 55 C for 30 s, 72 C for 45 s, followed by a final incubation at 72 C for 10 min. Ten l of each RT-PCR product wa s electrophoretically

PAGE 75

75 separated on 1.0 % agarose in 1X TAE buffer (40 mM Tris-Acetate a nd 1 mM EDTA, pH 8.0), at 100 volts for 55 minutes, and them stained with ethidium bromide. A Bio-Rad Gel-Doc imaging system was used for visualiza tion of the RT-PCR amplified products. The total RNA extracts from citrus samples collected from Panama (Potrerillos and Boquete), Brazil, Guatemala, Venezuela, a nd Florida were tested by RT-PCR using CCLV specific primers sets Kpr-658-659 (Table 3-1). Plasmid AGpl-1 -C09, having the complete RNA 1 ORF 2, was used as positive control for PCR. Primer set K616-617 (18S rRNAs) was used as positive control and as quality control for the RNA extracts. Protein Extraction The total proteins from CCLV-infect ed citrus tissue (leaf and fruit), Brevipalpus mites and healthy leaf and fruit tissue we re extracted as described by Erny et al. (1992). Briefly, 0.5 g fresh citrus tissue was cutting into small pieces and powdered after freezing in liquid nitrogen. Thirty Brevipalpus spp mites also were ground after freezing in liquid nitrogen. The powdered tissue was mixed with 0.4 ml of plant extracti on buffer (25 mM Tris-HCl pH 7.5; 10 mM NaCl; 10 mM MgCl2, 5 mM EDTA, 10 mM -mercaptoethanol, and 1 mM PM SF), then transferred to a 2.0 ml tube. The samples were centrifuged at 8 ,000 g for 20 min at 4 C. The supernatant (0.20.3 ml) was transferred to a fresh 1.5 ml tube, mixed with an equal volume of 2 X Laemmli buffer (Laemmli, 1970) and incubated at 95 C for 10 minutes. The extracted proteins were stored overnight at -20 C, shipped to University of Florida, Gainesville FL, and stored at -20 oC until further use. Cloning and Expression of CCLV p29 Protein The complete ORF 2 of CCLV RNA 1 was clone d and used for the bacterial expression and production of CCLV sp ecific antibodies (Rangel et al. 2005). The soluble and insoluble fraction of the bacterial expresse d protein were processed and used as antigens to raise antibodies

PAGE 76

76 in rabbits (R) and chicke ns (C) (Cocalico Biologi cals, Inc.) (Manjunath et al. unpublished results; Rangel et al. 2005). Western Blot Detection of CCLV p29 The total protein extracts from infected and h ealthy citrus tissue were incubated for 10 min at 95 C and subject to West ern blot detection using R_p29-27 and C_p29-28 polyclonal antibodies (Manjunath et al. unpublished results; Rangel et al. 2005) according to a protocol described elsewhere (Towbin et al. 1979). The samples were analyzed by 4-20% gradient SDS-PAGE. Total proteins were transfered by electroblotti ng to a Polyvinylidene fluoride membrane (PVDF; Millipore) using a Trans-Blot Semi-Dry ce ll following manufactures protocol (Bio-Rad). Immuno-blots were blocked for 2 h in 5% Bovine Serum Albumin (BSA; Fi sher Scientific) in TBS-T buffer (20 mM Tris-HCl pH 7.5, 150 mM NaCl, 0.05% Tween-20). PVDF membranes were carefully washed in TBS-T buffer 3 time s for 5 min each between steps. After blocking, immunoblots were incubated for 2 h with 1:10,000 dilution of R_p29-27 and C_p29-28 in TBS-T buffer, individually; followed by 2 h incubation with 1:30,000 dilutions of anti-rabbit and antichicken IgG alkaline phosphata se (AP) conjugate (Sigma) in TBS-T buffer, respectively. Immuno-reactive proteins were vi sualized using Western Blue st abilized substrate for alkaline phosphatase (Promega). One l of the CCLV p29 bacterial expre ssed protein (concentration of 1 g ml-1) was used as positive control. Immuno Imprint Detection of CCLV Using Antibodies Against p29 Leaf and fruit tissue of healt hy and leprosis-affected citrus were washed with a solution containing 1% chlorine. The tissue was rolled, th en transversally or longitudinally cut with a razor blade and pressed into a PVDF membrane (Millipore) for 5-10 s following standard protocol (Helguera et al. 1997). The PVDF membranes were air-dried, then shipped to University of Florida, Gainesville FL, and stored at 4 oC until further use. Membranes were

PAGE 77

77 briefly wetted in 100% ethanol and transferre d to a container contai ning TBS (without Tween 20) for 2 min. Then, membranes were subject to immuno-detection using R_p29-27 and C_p29-28 polyclonal antibodies (Manjunath et al. unpublished results) as described above for Western blotting. The R_p29-27 and C_p29-28 antibodies were used in 1:10,000 dilutions. One l of the CCLV p29 bacterial expressed pr otein (concentration of 1 g ml-1) was spotted on the PVDF membrane as positive control. Enzyme-linked Immunosorbent Assay (ELISA) for CCLV Samples were collected from Potrerillos and Boquete, Chiriqu State; Santiago, Veraguas State; and Panama City, Panama. Samples were subjected to double anti body sandwich indirect (DASI) ELISA (Clark & Adams, 1977) using the R_p29-27, C_p29-28, R_p29-29 and C_p29-30 antibodies (Manjunath et al. unpublished results). The ELISA plates were coated with 200 l of antibodies R_p29-27 and R_p29-29 (as primary antibodies) dilu ted in coating buffer (14 mM Na2CO3, 35 mM NaHCO3, 3 mM NaN3, pH 9.6) independently, followed by overnight incubation at 4 C. The primary antibodies were used at the dilution indicated: 1:5,000 (year 2005) or 1:10,000 (years 2006 and 2007, respectively ). The plates were loaded with 200 l aliquots of the sample (with 3 to 5 replicas scattered throughout the plate) which has been extracted in sample extracti on buffer [PBST + 2% polyvinyl py rrolidone (PVP-40, Sigma)] and incubated for 2 hours at 37 C. Two hundred l of the secondary antibodies (C_p29-28 and C_p2930) diluted (1:5,000 for year 2005 and 1:10,000 for years 2006, 2007) in conjugate buffer [PBST + 2% PVP + 0.2% egg albumin (Sigma)] were added to each well and incubated for 2 h at 37 C. Two hundred l of anti-rabbit or anti-chicken (depending on which antibody was used as the secondary antibody) IgG alkaline phosphatase conjugate (Sigma ) diluted 1:30,000 in conjugate buffer was added to each well and incubated at 37 C for 2 h. The substrate was p-nitrophenyl phosphate (Sigma) (1 mg ml-1) in 0.1 M diethanolamine buffer, pH 9.8. ELISA plates were

PAGE 78

78 thoroughly washed three times for 5 min betw een each step with phosphate-buffered saline buffer (PBS-T; 10 mM Na2HPO4, 1.75 mM KH2 PO4, 13.7 mM NaCl, 2.65 mM KCl and 3 mM NaN3, pH 7.4 containing 0.05 % Tween 20) and bl otted by tapping upside down on tissue paper. The plates were incubated in the dark at room temperature for 30-60 min. Fifty l of 3M NaOH was added to each well to stop the reactions 60 in after adding the substrate. The reaction was read at 405 nm using an ELx800 Absorbance Microplate Reader (BioTek). The CCLV p29 bacterial expressed prot ein (concentration of 1 g ml-1) was used as positive control, diluted in the sample extraction buffer (1:750). The assays were repeated for th ree consecutive years (2005-2007) using samples collected from Pa nama. The threshold value for a positive measurement was set to an equal or greater than three times the average value of the healthy control. Optical density (OD) measurements represent the aver age value of the replicated readings with five and three replicas for sa mples collected and assa yed in years 2005 and 20062007, respectively. In year 2006, leaf tissues from the non-lesion ar ea of symptomatic citrus leaves were used to monitor the virus titer and systemic movement in non-chlorotic areas. Us ing a razor blade, leaf tissue from 2-4 mm and 4-6 mm from the lesion ar ea was excised and included as samples in the DASI-ELISA experiments. Results Reverse Transcription (RT) and Po lymerase Chain Reaction (PCR) RT-PCR products of the expect ed sizes (690, 425 and 257 bp) we re obtained with extracts from samples infected with CCLV collected from Potrerillos, Panama using primer pairs Kpr685-686 (RNA 1 ORF 1), Kpr-658-659 (RNA 1 OR F 2) and Kpr-670-671 (RNA 2 ORF 4), respectively (Figure 3-1, panels A-C). No RT-PCR amplification was obtained with samples extracted from Boquete or Santia go (Figure 3-1, panels A-C, lanes 4 and 5). The sample extracts

PAGE 79

79 from Santiago were considered as healthy c ontrols. The expected RT-PCR products (350 bp) were amplified from all the citrus samples (F igure 3-1, panel D) using the primer set Kpr-616617 for the citrus 18 S rRNA. A RT-PCR amplified product of 425 bp was obt ained using primers pair Kpr-685-659 and RNA extracts from Potrerillos (Panama), Brazil, Guatemala, and Venezuela (Figure 3-2, panel A, lanes 1, 2, and 5-10). No amplification was obta ined from healthy citrus or leprosis affected samples collected from Boquete, Panama (Figure 3-2, panel A, lanes 3, 4, 11-13). The quality of the total RNA extracts used for RT-PCR was evaluated by testing for RT-PCR amplification of the 18S ribosomal RNA (Figure 3-2, panel B). Western Blot Detection of CCLV p29 The antiserum produced against the CCLV p29 fusion protein reacted strongly and specifically with a protein band of 29 kDa using infected citrus tissue from Panama. Polyclonal antibodies R_p29-27 and C_p29-28 reacted with a protein band of about 29 kDa (Figure 3-3, panels A and B, respectively) corresponding to p29 and dete cted in CCLV-infected citrus leaf and fruit tissue collected from Potrerillos, Panama. No sero logical reactive protein ba nds were detected in samples from NCLV-infected citr us leaf tissue collected from Boquete or with the healthy controls collected from Panama City (Figure 33, panels A and B, lanes 7 and 8, respectively). The antibody R_p29-27 had the highest titer. Two distinct bands (29 and 26 kDa, respectively) were observed with both antibodies (R_p29-27 and C_p29-28) developed against the expressed CCLV p29 (Figure 3-3, lanes 1-6). Pr otein degradation (smear-like pa tterns) was seen in most of the samples (Figure 3-3, lanes 1-6) and is also seen with the e xpressed protein (positive control; Figure 3-3, lanes +) where bands of a lower mol ecular weight than the expected 35 kDa protein band were observed. The expresse d p29 protein (35 kDa) is larger than the natural p29 protein, because the His-tag locate d at its carboxyl termini.

PAGE 80

80 Immuno Imprint Detection of CCLV Using Antibodies Against p29 Viral presence was detected in leaf and fru it tissue from leprosis-affected citrus using R_p29-27 and C_p29-28 and the immuno imprint detection (F igures 3-4 and 3-5). Fruit imprint blots produced a better color defi nition/reaction as compared with the leaf imprint blots (Figures 3-4 and 3-5, panels D-F and A-C, respectiv ely). Antibodies developed in rabbits (R_p29-27) had the highest titer (compare color strength between Figures 3-4 and 3-5). No reaction was detected with NCLV-infected citrus tissue or healthy control tissue (Figures 3-4 and 3-5, panels H and I, respectively). A strong positive reaction was obs erved with the positive control of the p29 expressed protein (Figures 3-4 and 3-5, panel G). Enzyme-linked Immunosorbent Assay (ELISA) for CCLV Brevipalpus mites collected from CCLV-infected citr us trees, as well citrus leaf, fruit and twigs samples collected from Potrerillos were tested by DASI-ELISA using CCLV rabbit antibodies (R_p29-27 and R_p29-29) for coating and chicken an tibodies as secondary antibodies (C_p29-28 and C_p29-30). The antibodies reacted specifically with symptomatic leprosis samples from citrus and mite samples collected from symtmatic trees from Potrerillos (Figures 3-6, 3-7 and 3-8) but did not react with si milar citrus samples collected fr om Boquete, healthy samples or non-infected Brevipalpus mites (collected from Boquete) (Figures 3-6, 3-7 and 3-8). The OD405nm values of the CCLV-infected samples and positive control (expressed protein) were at least 5 fold higher than the OD405nm values from healthy controls. Lower OD405nm values (up to 50% reduction compared with OD405nm values from symptomatic areas) were obtained with citrus samples excised 2-4 mm from the symptomatic areas (Figure 3-7), and OD405nm values below the threshold and considered negative were obtained in non-systemic tissue samples excised 4-6 mm from the symptomatic area (Fig ure 3-7). Both rabbit and chicken antibodies reacted with infected tissue in DASI-ELISA.

PAGE 81

81 Discussion In this study molecular detection methods for CCLV are report ed including RT-PCR assays targeting different regions of the CCLV genome as well as serological assays including DASI-ELISA, Western blotting a nd immuno imprinting. The RT-PCR and serological assays designed based on the properties of the highl y expressed RNA 1 ORFs 1 and 2, and RNA 2 ORFs 3 and 4 (Chapter 2). While screening of the cDNA library created with leprosis-affected citrus tissue (Guerra-Moreno, 2004; Chapter 2) a large number of clones were found to contain sequences from RNA 1 ORF 2 (41 out of 300 clones) and RNA 2 ORF 4 (39 out of 300 clones), making them ideal targets for de signing specific and sensitive diagnostic methods (Chapter 2). Molecular approaches using RT-PCR targeting th e movement protein (MP) and RNA dependent RNA polymerase (RdRp) were reported recently (Locali et al. 2003). While, this RT-PCR assay allows fast detection of the pathogen, the primer s are targeted to conserved regions of the viral genome which are not highly expressed in infected tissue. Primers designed for highly expressed CCLV genes should result in more sensitive de tection of CCLV. The new sets of primers designed in this study belong to highly expre ssed ORFs (RNA 1 ORF 2 and RNA 2 ORF 4) and will detected the virus, even when present in low titer. It is remarkably clear that in Panama, the samples that were collected from areas with low elevation [less than 500 meter above the sea le vel (masl)] were positice for CCLV by both RTPCR and serological assays; in contrats samples collected in areas with higher elevation (more than 1200 masl; Table 3-1) were negative for CCLV in RT-PCR and serological test and upon TEM, contained only NCLV (Guerra, 2004; Guerra et al. 2005). In Panama, NCLV tends to be found in specific niches having characteristic agro climatic conditions including high altitude and low temperatures. However, the CCLV is found in vast locations ranging from the sea level up to 1500 masl. In Brazil, NCLV is also found in few locations with distinct climatic conditions

PAGE 82

82 (Kitajima et al., 2003a; Bastianel et al., 2006a) as is seen in Pana ma. However in Guatemala, CCLV was present in costal areas as well as the high plateau (Palmieri et al. 2005). The RT-PCR procedure using three CCLV-speci fic primer pairs amplified the expected product from leprosis symptomatic leaf, fruit and bark samples collected from Potrerillos, but not from the samples from visually healthy trees or samples from Boquete (Figure 3-1). The RTPCR primer pairs for CCLV showed high specif icity, amplifying the expected products from CCLV-infected citrus tissue only. As all three OR Fs are highly conserved and specific (RNA 1 ORF 1; Chapter 2) or they are highly expresse d in leprosis-infected plants (RNA 1 ORF 2 and RNA 2 ORF 4; Chapter 2), these detection assays targeting those ORFs should be sensitive and accurate. The primer pair Kpr-658-659 amplified a 425 bp product of RNA 1 ORF 2 from RNA extracts collected from Panama, Brazil, Venezuela, and Guatemala, but not from healthy extracts or extracts from symptomatic trees at Boquete (Figure 3-2). The function of this RNA 1ORF 2 remains to be determined, as the sequence has no relation with sequenc es available in the GenBank (Chapter 2). RT-PCR assays using this pr imer pair amplified pr oducts of the expected size from all countries sampled (Figure 3-2). Th is suggests that CCLV is associated with the spreading form of citrus lepros is in these countries, whereas NC LV has been only reported in few locations (Dominguez et al., 2001; Guerra-Mor eno, 2004; Kitajima et al., 2003b). A distinct 29 kDa protein band was observed in Western blot assa ys using polyclonal antibodies raised against CCLV p29 (Figure 3-3) but no protein bands were detected from healthy or from samples from Boquete which contain only NCLV by TEM analysis (Dominguez et al., 2001; Guerra-Moreno, 2004; Guerra-Moreno et al., 2005). A second protein band (approximately 25-26 kDa in size) also was present (Figure 3-3). This prot ein could be the result

PAGE 83

83 of post-translation prot eolytic processes or degradation of protein in the extracts. Protein degradation could occur because the proteins were extracted in Panama, shipped to Florida and were stored several months at -20 C. Antibodies developed in ra bbit had the highest titer when compared with those developed in chic ken (Figures 3-3, panels A and B). The immuno imprint assays using polyclona l antibodies raised ag ainst CCLV p29 allowed the detection of CCLV in infected citrus leaf and fruit samples co llected from Potrerillos, but not in samples from Boquete or healthy controls (Figures 3-4 and 3-5). The polyclonal antibodies reacted most strongly with infected citrus frui t samples as seen by the deep purple color on the membrane (Figures 3-4 and 3-5, panels D-F). The leaf samples were lighter purple color compared with fruit tissue; however they were highly distinguishable from the healthy controls which showed no color reaction (Figures 3-4 and 3-5, panels H and I). As seen with Western blot, the rabbit antibodies had th e higher titers as compared with the chicken antibodies. Citrus samples infected with CCLV collected from Potrerillos, Panama gave positive results in DASI-ELISA tests over a three year period from 2005-2007 (Fi gures 3-6, 3-7 and 3-8). The presence of the virus was detected in infected leaf, bark and fruit ti ssue. Healthy plants did not react with CCLV polyclonal antibodi es. The presence of the virus in Brevipalpus mites also was detected by the DASI-ELISA assays. The 2006-2007 years OD405nm values were up to 10 times higher compared to healthy plants (Fig ure 3-7), confirming the specificity of these antibodies and their value for detection of CCLV. In other virus-pathosystems antibodies developed against non-structural pr oteins such as inclusion bodies proteins such as RNA 1 ORF 2, are expected to be more effective at dete cting the presence of the virus than from the antibodies reacting with the coat protein (Rubinson et al. 1997). These nonstructural or inclusion body proteins may be pr esent in greater quantities or may be more immunogenic than

PAGE 84

84 capsid proteins (Brakke, 1990; Hampton et al. 1990; Rubinson et al. 1997). These antibodies have proven to be excellent tools for quick and accurate serological dete ction of CCLV in field samples. It has been reported that CCLV has limited or no systemic movement within citrus tissue as compared with other c itrus viruses (Colariccio et al. 2000; Kitajima et al. 2003a; Kitajima et al. 2000; Rodrigues et al. 2003; Rossetti, 1980; Rossetti, 1 996). Using the DASI-ELISA assay for CCLV, citrus leaf tissue excised 2-4 mm from the chloroti c lesion (non-symptomatic area), reduced OD405nm values by 50% as compared with samples from the chlorotic areas, but the OD405nm values were still far above the threshold va lue and would considered as positive (Figure 3-7). Nevertheless, when tissue excised 4-6 mm from the lesion was tested in DASI-ELISA, low OD405nm values were obtained, and were the cut off values for declaration of being positive for CCLV (Figure 3-7, panels A-D). These observations are important, especially for personnel in diagnostic clinics and quarantine facilities, as samples collected could produce a false negative if the wrong type of tissue (non-symptomatic) is sel ected for processing. The low titer of the CCLV protein found in non-symptomatic ti ssue near the lesion (4-6 mm), along with the findings from Chapter 2 where molecular studies showed the presence of RNA molecules only in the symptomatic tissue and TEM analyses which det ected no virions in the surrounding symptomatic areas (Guerra-More no, 2004; Kitajima et al. 1972; Kitajima et al. 1974) supports the hypothesis that CCLV has nonor limited sy stemic movement in citrus. The molecular (RT-PCR) and serological (DASI-ELISA, immuno imprint and Western blot) detection systems reported in this study were designed based on the properties of the highly expressed ORFs of CCLV. While serological me thods are less sensitive than RT-PCR methods (Livieratos et al. 1999; Monis & Bestwick, 1997; Rubinson et al. 1997), the serological

PAGE 85

85 methods are more appropriate for large scale su rveys. The DASI-ELISA assay should be useful for large scale uses and for epidemiological st udies to confirm the pr esence of CCLV. Immuno imprint, Western blot and RT-PCR assays could be used as back-up methods to re-confirm the results obtained by DASI-ELISA. The implementation of the molecular and serological detection procedures detailed here could be useful in epidemiology and cer tification programs in countries where the disease is present; and would be invaluab le for quarantine programs at port of entry in countries such as USA, where the disease is absent.

PAGE 86

86 Table 3-1. Detailed description of the citrus samples collected from Chiriqu and Veraguas, Panama during July 2005 and used in DASI-ELISA assays.a Common name Tissue type Loca tionb Geographical Position Elevation (masl)c ELISA Results Comments Sweet Orange Leaf 1 Potr 8 36.755 N 82 26.215 W 422.87 + CCLVinfected Sweet Orange Leaf 2 Potr 8 36.711 N 82 26.228 W 418.60 + CCLVinfected Sweet Orange Leaf 3 Potr 8 36.747 N 82 26.238 W 420.43 + CCLVinfected Mandarin Leaf Potr 8 36.724 N 82 26.223 W 419.26 + CCLVinfected Sweet Orange Fruit Potr 8 36.717 N 82 26.233 W 419.82 + CCLVinfected Sweet Orange Bark Potr 8 36.746 N 82 26.224 W 421.65 + CCLVinfected Mandarin Bark Potr 8 36.724 N 82 26.223 W 418.90 + CCLVinfected Sweet Orange Leaf Sant 8 5.474 N 80 59.082 W 106.70 Healthy control Lemon Leaf Boq 8 47.686 N 82 26.479 W 1205.79 NCLVinfected Mandarin Leaf Sant 8 5.471 N 80 59.094 W 105.79 Healthy control Grapefruit Leaf Boq 8 47.697 N 82 26.490 W 1208.54 Healthy control Wash. Navel Leaf Boq 8 47.697 N 82 26.494 W 1210.68 NCLVinfected Lemon Bark Boq 8 47.686 N 82 26.479 W 1219.51 NCLVinfected aBoquete and Potrerillos are in Chiriqu provi nce, and Santiago are in Veraguas Province b Potr = Potrerillos; Sant= Sa ntiago; Boq= Boquete. cmasl = meters above sea level.

PAGE 87

87 Table 3-2. Primers used for RT-PCR analysis of Cytoplasmic citrus leprosis virus (CCLV). Primer RNA Primer Sequence Kpr658 RNA 1 5'_7804AAGGTCTGCGTGATATTAGCAAGCCTA7830_3' Kpr659 RNA 1 5'_8228TATGGGTCGCTTCGGGAAGCCCATAC8203_3' Kpr668 RNA 1 5'_7714AACATATGTCGGAT:CGATGAGTATCGTAACTTTCACTTTGAC7739_3' Kpr669 RNA 1 5'_8477AGGAGGACGACTCCGACTCAGCGCAGAAGCTTGCGGCCGCA8502_3' Kpr685 RNA 1 5'_2477CAATTAGAGCATAGCCATTATAG2500_3' Kpr686 RNA 1 5'_3166GTTAGCGTATTCAAGGATTCTGGA3143_3' Kpr670 RNA 2 5'_4130AGGCGCGCAGCTAACGTTAGGCAAAG4155_3' Kpr671 RNA 2 5'_4386ACCAGAGCACCACAGATCCTGAAGAAG4360_3' Primers Kpr-658, 659, 668, 669, 685 and 686 were desi gned based on sequences from RNA 1; while primers Kpr-670 and 671 correspond to sequences from RNA 2.

PAGE 88

88 Figure 3-1. RT-PCR amplification of CCLV RNA 1 ORFs 1 and 2; and RNA 2 ORF 4. Citrus samples were collected from Potrerillos and Boquete, Chiriqu State, and Santiago, Veraguas State, Panama. Leprosis-affected leaf (lane 1), bark (lane 2) and fruit (lane 3) were used as target samples. Healthy leaf tissue (lanes 4 an d 5) was used as a negative control. Water controls were al so used for RT and PCR (lanes 6 and 7, respectively). A) Primer pair Kpr-685-686 was used to amplify a 690 bp fragment from the RNA1 ORF 1. B) RT-PCR detecti on of a 425 bp fragment from the RNA 1 ORF 2 using primers Kpr-658-659. C) Dete ction of a 257 bp RT-PCR product from RNA 2 ORF 4 using CCLV-specific Kpr-670-67 1 primers. D) RT-PCR amplification of a 350 bp amplicon from citrus 18 S rRNAs using Kpr-616-617 primers. The arrows indicate the position of the e xpected amplified RT-PCR products. The DNA marker sizes are indicated between the panels by double headed arrows. Each lane was loaded with 10 l of RT-PCR produc ts. Lanes M were loaded with 100 bp DNA ladder (Invitrogen). 1 2 3 4 5 6 7 M 257 bp 350 bp 600 bp 425 bp 600 bp A B C DM 1 2 3 4 5 6 7 1 2 3 4 5 6 7 M M 1 2 3 4 5 6 71500 bp 1500 bp 690 bp

PAGE 89

89 Figure 3-2. RT-PCR detection of CCLV in sample s collected from different countries. A). Agarose gel electrophoresis of RT-PCR produc ts (10 l each). Leprosis affected sample extracts from Potrerillos, Panama (lanes 1 and 2); Boquete, Panama (lanes 3 and 4); Brazil (lanes 5 and 6), Guatemala (l anes 7 and 8); and Venezuela (lanes 9 and 10) were tested. Healthy tissue from Flor ida (lanes 11 and 12) and Potrerillos, Panama (lane 13) were used as negative controls. A PCR product from a control DNA plasmid (AGpl-1-C09) containing a CCL V insert (lane 14) was used as a positive control. B). Detection of a 350 bp product of 18 S rRNA gene by RT-PCR. Test samples in lanes 1 to 13 were from the same sources as in panel A, lanes 1-13. Lanes M were loaded with 100 bp DNA ladder (Invitrogen). M1 2 3 4 5 6 7 8 9 10 11 12 13 14300 1500 600 2072 300 600 M1 2 3 4 5 6 7 8 9 10 11 12 13 A B

PAGE 90

90 Figure 3-3.Western blot detecti on of CCLV p29 using polyclonal antibodies. Leprosis-affected citrus leaf (lanes 1-3) and fr uit (lanes 4-6) tissue were us ed for total protein extraction followed by Western blot detection. Healthy leaf tissue from Boquete, Chiriqu State (lane 7) and Panama City, Panama (lane 8) were used as negative controls. A) Immuno-detection of CCLV p29 using polyc lonal antibody developed in rabbits (R_p29-27). B) Western immunoblot detec tion of CCLV p29 using polyclonal antibody raised in chicken (C_p29-28). The top band (panel A and B, lanes 1-6) represent the CCLV p29. The lower bands may represent the CCLV p29 after posttranslation processes or pr otein degradation. Protein degradation, probably due to long term shipment and storage, is observed in all lanes (mainly in lane +). Rabbit and chicken raised antibodies were used in 1:10,000 dilutions. Fifteen l of total protein extraction were loaded in each well, except for lane +, where 1 l of the CCLV p29 bacterial expressed pr otein (concentration of 1 g ml-1) was loaded as positive control. 1 2 3 4 5 6 7 8 + 1 2 3 4 5 6 7 8 + A B 35 kDa 31 kDa 35 kDa 31 kDa

PAGE 91

91 Figure 3-4. Immuno Imprint detectio n of CCLV p29 in citrus sample s collected from Potrerillos and Boquete, Panama using polyclonal antibodies developed in rabbits (R_p29-27). AC) Immuno-chemical detection of CCLV p29 in leprosis-affected citrus leaves collected from Potrerillos. D-F) Imm uno-chemical detection of CCLV p29 in leprosis-affected citrus fruit collected from Potrerillos. G) Immuno-detection of CCLV p29 bacterial expressed protein that was used as a positive control (2 l of 1 g ml-1 concentration). H-I) Healt hy citrus leaves collected from Boquete were used as negative controls. The R_p29-27 antibody was used at 1:10,000 dilution.

PAGE 92

92 Figure 3-5. Immuno imprint detectio n of CCLV p29 in citrus sample s collected from Potrerillos and Boquete, Panama using polyclonal antibodies raised in chicken (C_p29-28). A-C) Immuno imprint detection of CCLV p29 in le prosis-affected citrus leaves collected from Potrerillos. D-F) Immuno imprint de tection of CCLV p29 in leprosis-affected citrus fruits collected from Potrerillos. G) Immuno-detection of CCLV p29 bacterial expressed protein that was used as a positive control (2 l of 1 g ml-1 concentration). H-I) healthy citrus leaves collected from B oquete were used as negative controls. The polyclonal antibody (R_p29-28) was developed in chicken and used in 1:10,000 dilution.

PAGE 93

93 Figure 3-6. DASI-ELISA detection of CCLV in samples from citrus leaves, fruits and twigs collected from Boquete and Potrerillos, Panama during July 2005. CCLV specific antibodies raised in rabbits (R_p29-27 and R_p29-29) and chicken (C_p29-28 and C_p2930) were utilized. A) DAS I-ELISA detection using R_p29-27 and C_p29-28 as primary and secondary antibodies, respectively. B) DASI-ELISA detection of CCLV using R_p29-27 and C_p29-30 as primary and secondary an tibodies, respectively. C) DASIELISA detection of CCLV using R_p29-29 and c_p29-28 as primary and secondary antibodies, respectively. D) DASIELISA detection of CCLV using R_p29-29 and C_p29-30 as primary and secondary antibodi es, respectively. The dashed lines represent threshold values (3 X healthy c ontrol values). Bacterial expressed protein was used as positive control (last column in each graph). Both primary and secondary antibodies were used at 1:5,000 dilutions. E ach measurement value is the average of the readings from five replications. 0 0.05 0.1 0.15 0.2 0.25 0.3Absorbance at 405 nm -0.2 0 0.2 0.4 0.6 0.8 1 1.2 1.4Absorbance at 405 nm 0 0.2 0.4 0.6 0.8 1 1.2 1.4 1.6Absorbance at 405 nm 0 0.2 0.4 0.6 0.8 1 1.2 1 4 Absorbance at 405 nm A B C D 0.058 0.45 0.39 0.36 Sweet orange leaf 1. Potrerillos. Sweet orange leaf 2. Potrerillos. Sweet orange leaf 3. Potrerillos. Mandarin leaf. Potrerillos. Sf Sweet orange fruit. Potrerillos. Sweet orange bark. Potrerillos. Mandarin bark. Potrerillos. Sweet orange leaf. Boquete. Lemon leaf. Boquete. Whashintong Navel leaf. Boquete. Grapefruit fruit. Boquete. Lemon bark. Boquete. Bact. Expr. Protein (Positive Control) Washington Navel leaf Boquete. Sweet orange leaf 1. Potrerillos. Sweet orange leaf 2. Potrerillos. Sweet orange leaf 3. Potrerillos. Mandarin leaf. Potrerillos. Sf Sweet orange fruit. Potrerillos. Sweet orange bark. Potrerillos. Mandarin bark. Potrerillos. Sweet orange leaf. Boquete. Lemon leaf. Boquete. Whashintong Navel leaf. Boquete. Grapefruit fruit. Boquete. Lemon bark. Boquete. Bact. Expr. Protein (Positive Control) Washington Navel leaf Boquete.

PAGE 94

94 Figure 3-7. DASI-ELISA detection of CCLV in samples from citrus leaves, fruits and twigs collected from Boquete and Potreril los, Panama during December 2006. CCLV specific antibodies rais ed in rabbits (R_p29-27 and R_p29-29) and chicken (C_p29-28 and C_p29-30) were used. A) DASIELISA detection using R_p29-27 and C_p29-28 as primary and secondary antibodies, respect ively. B) DASI-ELISA detection of CCLV using R_p29-27 and C_p29-30 as primary and secondary antibodies, respectively. C) DASI-ELISA detection of CCLV using R_p29-29 and c_p29-28 as primary and secondary antibodies, respectively. D) DASI-ELISA detection of CCLV using R_p2929 and C_p29-30 as primary and secondary antibodie s, respectively. The dashed lines represent threshold values (3 X healthy c ontrol values). Bacterial expressed protein was used as positive control (last column in each graph). Both primary and secondary antibodies were used at 1:10,000 dilutions. E ach measurement value is the average of readings from three replications. 0 0.2 0.4 0.6 0.8 1 1.2 1.4 Ab sor b ance at 40 5 nm -0.1 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8Absorbance at 405 nm 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9Absorbance at 405 nm -0.1 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7Absorbance at 405 nm A B C D0.127 0.036 0.103 0.021 Sweet orange leaf 1. Potrerillos. Sweet orange leaf 2. Potrerillos. Sweet orange fruit. Potrerillos. Sweet orange fruit. Potrerillos. 2 4 mm from leaf lesion. Potrerillos. 4 6 mm from leaf lesion. Potrerillos. Brevipalpus spp. Potrerillos. Brevipalpus spp. Boquete. Mandarin leaf. Potrerillos. Whashintong Navel leaf 1. Boquete. Whashintong Navel leaf 2. Boquete. Healthy leaf 1. Panama Healthy leaf 2. Panama Bact. Ex p r. Protein ( Positive control ) Washington Navel leaf 1. Boquete. Washington Navel leaf 2. Boquete.

PAGE 95

95 Figure 3-8. DASI-ELISA detection of CCLV in samples from citrus leaves, fruits and twigs collected from Boquete and Potrerillos, Panama during June 2007. CCLV specific antibodies raised in rabbits (R_p29-27 and R_p29-29) and chicken (C_p29-28 and C_p2930) were used. A) DASIELISA detection using R_p29-27 and C_p29-28 as primary and secondary antibodies, respectively. B) DASI-ELISA detection of CCLV using R_p29-27 and C_p29-30 as primary and secondary an tibodies, respectively. C) DASIELISA detection of CCLV using R_p29-29 and c_p29-28 as primary and secondary antibodies, respectively. D) DASIELISA detection of CCLV using R_p29-29 and C_p29-30 as primary and secondary antibodi es, respectively. The dashed lines represent threshold values (3 X healthy c ontrol values). Bacterial expressed protein was used as positive control (last column in each graph). Both primary and secondary antibodies were used at 1:10,000 dilutions. Each measurement value is the average of readings from three replications. 0 0.2 0.4 0.6 0.8 1 1.2 1.4 1.6 1.8Absorbance at 405 nm 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0 9 Absorbance at 405 nm -0.5 0 0.5 1 1.5 2 2.5Absorbance at 405 nm -0.2 0 0.2 0.4 0.6 0.8 1 1.2Absorbance at 405 nm A B C D0.04 0.20 0.39 0.024 Sweet orange leaf 1. Potrerillos. 2 4 mm from leaf lesion. Potrerillos 4 6 mm from leaf lesion. Potrerillos Sweet orange leaf 2. Potrerillos. Sweet orange leaf 3. Potrerillos. Stlf4Ptill Sweet orange leaf 4. Potrerillos. Sweet orange leaf 5. Potrerillos. Lemon leaf. Boquete. Mandarin leaf. Boquete. Whashintong Navel leaf. Boquete. Grapefruit leaf. Boquete. Healthy leaf 1. Panama. Healthy leaf 2. Panama Bact. Expr. Protein (Positive Control) Washington Navel leaf Boquete. Sweet orange Fruit 1. Potrerillos. Sweet orange Fruit 2. Potrerillos. Sweet orange leaf 1. Potrerillos. 2 4 mm from leaf lesion. Potrerillos 4 6 mm from leaf lesion. Potrerillos Sweet orange leaf 2. Potrerillos. Sweet orange leaf 3. Potrerillos. Stlf4Ptill Sweet orange leaf 4. Potrerillos. Sweet orange leaf 5. Potrerillos. Lemon leaf. Boquete. Mandarin leaf. Boquete. Whashintong Navel leaf. Boquete. Grapefruit leaf. Boquete. Healthy leaf 1. Panama. Healthy leaf 2. Panama Bact. Expr. Protein (Positive Control) Washington Navel leaf Boquete. Sweet orange Fruit 1. Potrerillos. Sweet orange Fruit 2. Potrerillos.

PAGE 96

96 CHAPTER 4 GENERAL CONCLUSIONS In this study, the molecular char acterization of the genome of the Cytoplasmic citrus leprosis virus (CCLV) from Panama is reported. This include the sequence of the Panamanian isolate of CCLV which is compared with the two isolates reported from Brazil, as additionally the subgenomic (sg) and defective interfering (DI) RNAs associat ed with CCLV-infected citrus tissue are characterized. Additiona lly, RT-PCR and serological dia gnostic methods for detection of CCLV were developed base d on highly expressed ORFs. At the beginning of this re search, little was known about the molecular properties of CCLV. Although the disease was fi rst reported in South America in the 1920s, the suspected causal virus particles were not observed by tr ansmission electron microscopy (TEM) until the early 1970s. The virus was te ntatively placed under the Rhabdoviridae family (monopartite negative-sense viruses) based on the particle mor phology similarities. The low titer of the virus, its limited or non-systemic behavior in infected ti ssue, as well the difficulty in purifying the virus has hampered the characteriz ation of this pathogen. The majority of the molecular characterization data has been collected in the last seven years. Northern hybridizations and sequence anal yses have proven that at least two different viruses are associated with ci trus leprosis (Guerra-Moreno et al., 2005): the CCLV, which is an bipartite positive-stranded RNA virus and is widely spread in South and Central America, and the nuclear citrus leprosis virus (NCLV) whic h has been reported in only a few locations. Hybridization patterns with prob es targeting both RNAs 1 and 2 and sequence analysis indicate that the CCLV is a positive-sense, bipartite RNA virus with four 3 co-t erminal sgand several DI-RNAs are present in infected tissue. The viru s shows distant relationship with other positive-

PAGE 97

97 sense RNA viruses in the tobamo, furo, t obra, bromo and cucumoviruses groups, but no relationship with rhabdoviruses. CCLV is distinctly different from these posit ive-sense plant RNA viruses with respect to the genomic organization, gene expression and th e presence of novel viral proteins including the Ovarian Tumor (OTU) gene-like cyst eine protease. This is the firs t report of a plant virus with protein domains similar to OTU. Two of the six CCLV putative proteins show relationships with proteins of other plant viruses; and the remain ing four putative proteins have novel sequences with no similarities with othe r viral sequences from the GenBank. This information provides evidence that CCLV possibly belongs to a new plan t virus genus. Therefore it is proposed that CCLV be placed into a new genus called, Cycilevirus, becoming its type member. In addition to the genomic RNAs, CCLV po ssesses an array of sgand DI-RNAs which are present in infected citrus tissues. Many plant viruses produce sg and DI-RNAs, however CCLV is unique as its sg and DI-RNAs have a 5 m7GpppN-cap and 3 poly (A) tail structure at theirs termini. With these termini, CCLV g-, sgand DI-RNAs resemble the mRNAs of their hosts. These terminal structures may facilitate the translation of CCLV prot eins inside the citrus cell environment and possibly insi de mite cells as occur with other plant viruses (Dreher & Miller, 2006; Ivanov et al. 1997). The presence of DI-RNAs has been demonstrated in multiple hosts infected with RNA viruses, however this is the first report of th e presence of naturally occurring DI-RNAs in citrus plants infected with CCLV. Analysis of the sequences upand downstream of the DI-RNA junction sites revealed that the border s are flanked by short direct and inverted repeats. These DI-RNAs were chimeric recombinant molecules apparently generated by aberrant RNA synthesis by the replicase driven-template switching mechanism (Ayllon et al. 1999; Wu & White, 1998). The influence of these DI-RNAs on CCLV symptom

PAGE 98

98 expression is unknown, but the presence of these DI-RNAs in high concentration (Figures 2-3 and 2-4) in infected leaf tissu e suggests that they may possibl y interfere with the symptoms caused by CCLV, as occurs with Turnip crinkle virus (TCV; Li et al., 1989) and broad bean mottle bromovirus (BBMV; Pogany et al., 1995). Also the presence of these DI-RNAs in high concentration in citrus tissue in fected with CCLV may interfere with the replication of the gRNAs and cause a reduction on the g-RNA accumulati on (Figures 2-3 and 2-4) as occurs with other virus-pathosystem (White & Nagy, 2004). As previously mentioned, the detection of CC LV in the past was based on symptoms and the visualization of virions in infected tissue using TEM. This study repo rts the development of molecular and serological approaches for CCL V detection. Both RT-PCR primer pair and polyclonal antibodies against CCLV were design ed based on the propert ies of the highly expressed ORFs of CCLV. Molecular approaches directed toward the sequences from both RNAs 1 and 2 proved to be highly specific in detecting CCLV in samples from South and Central America. These primer pa irs contain unique sequences not shared by other plant viruses, making them ideal tools for detection when using RT-PCR. The serological assays were specific in detecting CCLV proteins in citrus samples showing lepros is symptoms and from mites collected from CCLV-infected citrus trees. The polyclonal an tibodies reacted strongly with CCLV proteins collected from infected tissues using Western blots and immuno imprint assays. Also in DASI-ELISA at least 5-fold differences in the optical measurement values between infected and healthy plants was obtained. Therefor e these antibodies are excellent tools for quick and accurate serological detecti on of CCLV and may be useful fo r large epidemiological field surveys.

PAGE 99

99 Although substantial progress was made regard ing the molecular features of CCLV in recent years, there is a need for additional stud ies to better understand the pathogen-vector-host interactions of this patho-system. Two of the six CCLV putative proteins have been assigned a function based on sequences similarities with othe r plant viruses; however the functions of the remaining four proteins remain unresolved. Development of inf ectious clones or mutants of CCLV, along with other in vivo experiments, will be require d to obtain detailed information regarding the function of the CCL V proteins. Furthermore, little is known about the nature of mite transmission and the interaction betw een mites and CCLV and/or plant proteins.

PAGE 100

100 LIST OF REFERENCES Adkins, S. & Kao, C. C. (1998). Subgenomic RNA promoters dictate the mode of recognition by bromoviral RNA-dependent RNA polymerases. Virology 252 1-8. Ahlquist, P. & Kaesberg, P. (1979). Determination of the length distribution of poly(A) at the 3' terminus of the virion RNAs of EMC vi rus, poliovirus, rhinovirus, RAV-61 and CPMV and of mouse globin mRNA. Nucleic Acids Res 7 1195-1204. Ahola, T. & Ahlquist, P. (1999). Putative RNA capping activities encoded by brome mosaic virus: methylation and covalent bindi ng of guanylate by replicase protein 1a. J Virol 73 10061-10069. Ahola, T., den Boon, J. A. & Ahlquist, P. (2000). Helicase and capping enzyme active site mutations in brome mosaic virus protein 1a cause defects in template recruitment, negative-strand RNA synthesi s, and viral RNA capping. J Virol 74 8803-8811. Ahola, T., Laakkonen, P., Vihine n, H. & Kaariainen, L. (1997). Critical residues of Semliki Forest virus RNA capping enzyme involved in methyltransferase a nd guanylyltransferaselike activities. J Virol 71 392-397. Albiach-Marti, M. R., Mawassi, M., Gowda, S ., Satyanarayana, T., Hilf, M. E., Shanker, S., Almira, E. C., Vives, M. C., Lopez, C., Guerri, J., Flores, R., Moreno, P., Garnsey, S. M. & Dawson, W. O. (2000). Sequences of Citrus triste za virus separated in time and space are essentially identical. J Virol 74 6856-6865. Altschul, S. F., Madden, T. L., Schaffer, A. A., Zhang, J., Zhang, Z., Miller, W. & Lipman, D. J. (1997). Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 25 3389-3402. Araya-Gonzalez, J. 2000 Informe sobre la prospeccin de la le prosis de los ctricos en la zona fronteriza sur (Costa Rica-Panam). Mini sterio de Agricultura y Ganaderia. 5pp Ayllon, M. A., Lopez, C., Navas-Castill o, J., Mawassi, M., Dawson, W. O., Guerri, J., Flores, R. & Moreno, P. (1999). New defective RNAs from citr us tristeza virus: evidence for a replicase-driven template swit ching mechanism in their generation. J Gen Virol 80 ( Pt 3) 817-821. Bassanezi, R. B., Bergamin Filho, A., Amorim L., Gimenes-Fernandes, N., Gottwald, T. R., & Bov, J. M ( 2003). Spatial and temporal analyses of citrus sudden death as a tool to generate hypotheses co ncerning its etiology. Phytopathology 93 :502-512. Bassanezi, R. B. & Laranjeira, F. F. (2007). Spatial patterns of leprosis and its mite vector in commercial citrus groves in Brazil. Plant Pathology 56 97-106. Bastianel, M., de Oliveira, A. C., Cristofani, M., Filho, O. G., Freitas-Asta, J., Rodrigues, V., Asta-Monge, G. & Machado, M. A. (2006a). Inheritance and Heritability of Resistance to Citrus Leprosis. Phytopathology 96 1092-1096.

PAGE 101

101 Bastianel, M., Freitas-Asta, J., Kitaj ima, E. W. & Machado, M. A. (2006b). The citrus leprosis pathosystem. Summa Phytopathologica 32 211-220. Bateman, A., Coin, L., Durbin, R., Finn, R. D., Hollich, V., Griffiths-Jones, S., Khanna, A., Marshall, M., Moxon, S., Sonnhammer, E. L., Studholme, D. J., Yeats, C. & Eddy, S. R. (2004). The Pfam protein families database. Nucleic Acids Res 32 D138-141. Bitancourt, A. A. (1937). Leprose e a prxima colheita. OBiolgico 3 37-40. Brakke, M. K. (1990). Preparation of antigen: Viruses. In Serological Methods for detection and identification of viral and bacteri al plant pathogens: A laboratory manual pp. 15-26. Edited by R. Hampton, E. Ball & S. De Boer St. Paul, Minnesota, USA: APS Press. Brigneti, G., Voinnet, O., Li W. X., Ji, L. H., Ding, S. W. & Baulcombe, D. C. (1998). Viral pathogenicity determinants are suppressors of transgene silencing in Nicotiana benthamiana. The EMBO journal 17 6739-6746. Brown, A.E. 2005. Mode of Action of Landscape Inse cticides and Miticides Pesticide Information Leaflet No. 42. Department of Entomology. Maryland Cooperative Extension. University of Maryland. http://www.entmclasses.um d.edu/peap/leaflets/pil42.pdf Accessed on November 2nd, 2007 Buck, K. W. (1996). Comparison of the replication of positive-stranded RNA viruses of plants and animals. Adv Virus Res 47 159-251. Bugl, H., Fauman, E. B., Staker, B. L., Zheng, F., Kushner, S. R., Saper, M. A., Bardwell, J. C. & Jakob, U. (2000). RNA methylation under heat shock control. Mol Cell 6 349-360. Bustamante, P. I. & Hull, R. 1998. Plant virus gene e xpression strategies. Electron. J. Biotechnol 1 13-24. ISSN 0717-3458. Available at http://www.scielo.cl/scielo.php ?script=sci_arttext&pid=S071734581998000200003&lng=es&nrm=iso Accessed on November 4th 2007 Campos, F. J. & Omoto, C. (2002). Resistance to hexythiazox in Brevipalpus phoenicis (Acari: Tenuipalpidae) from Brazilian citrus. Experimental & applied acarology 26 243-251. Campos, F. J. & Omoto, C. (2006). Stability of Brevipalpus phoenicis (Geijskes) (Acari: Tenuipalpidae) resistance to hexythiazox in citrus groves. Neotrop Entomol 35 840-848. Canto, T., Prior, D. A., Hellwald, K. H ., Oparka, K. J. & Palukaitis, P. (1997). Characterization of cucumber mosaic virus. IV. Movement protein and coat protein are both essential for cell-to-cell moveme nt of cucumber mosaic virus. Virology 237 237-248. Chagas, C. M., Kitajima, E. W. & Rodrigues, J. C. (2003). Coffee ringspot virus vectored by Brevipalpus phoenicis (Acari: Te nuipalpidae) in coffee. Experimental & applied acarology 30 203-213.

PAGE 102

102 Chagas, C. M. & Rossetti, V. (1980). Transmission Of Citrus Lepros is By Insertion Of Infected Leaf Tissue On Green Stems. Fitopatologia Brasileira 5 211-214. Chagas, C. M. & Rossetti, V. (1984). Transmission of leprosis by grafting. In Proceedings of the 9th Conference of the International Organization of Citrus Virologists pp. 215-217. Edited by S. M. Garnsey, L. W. Timmer & J. A. Dodds. Riverside CA, USA. Chagas, C. M., Rossetti, V. & Chiavegato, L. G. (1984). Effectiveness of the life cycle stages of Brevipalpus phoenicis Geijskes in leprosis transmission. In Proceedings of the 9th Conference of the International Or ganization of Citrus Virologists pp. 211-214. Edited by S. M. Garnsey, L. W. Timmer & J. A. Dodds. Riverside, CA, USA. Chang, C. J., M. Garnier, L. Z reik, V. Rossetti, & J. M. Bov. 1993. Culture and serological detection of the xylem-limited bacterium cau sing citrus variegated chlorosis and its identification as a strain of Xylella fastidiosa Curr. Microbiol 27: 137-142. Chen, T. Y., French, J. V., Liu, T. X. & Da Graa, J. V. (2006). Predation of Galendromus helveolus (Acari: Phytoseiidae) on Brevipalpus californicus (Acari: Tenuipalpidae). Biocontrol Science and Technology 16 753-759. Chiavegato, L. G., Pereira, G. M. d. & Pavarini, R. (1997). Avaliao das diferentes fases de desenvolvimento de Brevipalpus phoenicis (Geijskes, 1939) (Acari: tenuipalpidae) na transmisso da leprose em plantas ctricas. Cientifica 25 307-315. Chiavegato, L. G. & Salibe, A. A. (1984). Transmissibility of leprosis symptoms by Brevipalpus phoenicis into young citrus plants under la boratory conditions. In Proceedings of the 9th Conference of the Internati onal Organization of Citrus Virologists pp. 218-221. Edited by S. M. Garnsey, L. W. Timmer & J. A. Dodds. Riverside, CA, USA: IOCV-UCR. Childers, C. C. (1994). Feeding injury to Robinson tange rine leaves by Brevipalpus mites (Acarina: Tenuipalpidae) in Florida and evaluatio n of chemical control on citrus. Florida Entomologist 77 265-271. Childers, C. C., French, J. V. & Rodrigues, J. C. (2003a). Brevipalpus californicus, B. obovatus, B. phoenicis, and B. lewisi (Acari: Tenuipalpidae): a revi ew of their biology, feeding injury and economic importance. Experimental & applied acarology 30 5-28. Childers, C. C., Kitajima, E. W., Welbourn, W. C., Rivera, C. & Ochoa, R. (2001a). Brevipalpus mites on citrus and their st atus as vectors of citrus leprosis. Manejo Integrado de Plagas 60 66-70. Childers, C. C. & Rodrigues, J. C. (2005). Potential pest mite spec ies collected on ornamental plants from Central America at po rt of entry to the United States. Florida Entomologist 88 408-414. Childers, C. C., Rodrigues, J. C., Derrick, K. S., Achor, D. S., French, J. V., Welbourn, W. C., Ochoa, R. & Kitajima, E. W. (2003b). Citrus leprosis and its status in Florida and Texas: past and present. Experimental & applied acarology 30 181-202.

PAGE 103

103 Childers, C. C., Rodrigues, J. C., Kitajima, E. W., Derrick, K. S., Rivera, C. & Welbourn, W. C. (2001b). A control strategy for breaking the vi rus-vector cycle of Brevipalpus spp. and the Rhabdovirus disease, citrus leprosis. Manejo Integrado de Plagas 60 76-79. Childers, C. C., Rodrigues, J. C. & Welbourn, W. C. (2003c). Host plants of Brevipalpus californicus, B. obovatus, and B. phoenicis (Acari: Tenuipalpidae) and their potential involvement in the spread of viral diseases vectored by these mites. Experimental & applied acarology 30 29-105. Clark, M. F. & Adams, A. N. (1977). Characteristics of the microplate method of enzymelinked immunosorbent assay for th e detection of plant viruses. The Journal of general virology 34 475-483. Colariccio, A., Lovisolo, O., Boccardo, G., Chagas, C. M., d'Alquilo, M. & Rossetti, V. (2000). Preliminary purification and double stranded RNA analysis of Citr us leprosis virus. In Proceedings of the 14th Conference of the International Organization of Citrus Virologists pp. 159-163. Edited by J. V. da Graa, R. F. Lee & R. K. Yokomi. Campinas, So Paulo, Brazil: IOCV-UCR. Colariccio, A., Lovisolo, O., Chagas, C. M. & Galleti, S. R. (1995). Mechanical transmission and ultrastructural aspects of citrus leprosis disease. Fitopatologia brasileira 20 208. Contralora General de la Repblica de Panam. Direccin de Estadstica y censo. 2003. Sexto Censo Nacional Agropecuario. Avaliable at http://www.contraloria.gob.pa/dec/ (Accessed on 08/27/2007) De Andrade-Maia, O. M. & Le ite De Oliveira, C. A. (2005). Transmissibilidade do virus da leprose de cercas-vivas, quebra-ventos e pl antas daninhas para la ranjeiras atraves de Brevipalpus phoenicis (Geijskes). Bragantia 64 417-422 Denmark, H. A. (1984). Brevipalpus mites found on Florida citrus (Acarina: Tenuipalpidae). Florida, Dept Agric & Consumer Services, Division of Plant Industry Entomol Circ 69 Ding, S. W., Li, H., Lu, R., Li, F. & Li, W. X. (2004). RNA silencing: a conserved antiviral immunity of plants and animals. Virus research 102 109-115. Damayanti, T. A., Nagano, H., Mise, K., Furusawa, I. & Okuno, T. (1999). Brome mosaic virus defective RNAs generated dur ing infection of barley plants. J Gen Virol 80 ( Pt 9) 2511-2518. Domingo, E. & Holland, J. J. (1997). RNA virus mutations and fitness for survival. Annu Rev Microbiol 51 151-178. Dominguez, F. A., Bernal, J. A., Childers, C. C. & Kitajima, E. W. (2001). First report of citrus leprosis virus in Panama. Plant Dis 85 228. Dreher, T. W. (1999). Functions of the 3'-untranslated segions of positive strand RNA viral genomes. Annu Rev Phytopathol 37 151-174.

PAGE 104

104 Dreher, T. W. & Miller, W. A. (2006). Translational control in positive strand RNA plant viruses. Virology 344 185-197. Duggal, R., Lahser, F. C. & Hall, T. C. (1994). cis-Acting sequences in the replication of plant viruses with plus-sense RNA genomes. Annu Rev Phytopathol 32 287-309. Erny, C., Schoumacher, F., Jung, C., Gagey, M. J., Godefroy-Colburn, T., Stussi-Garaud, C. & Berna, A. (1992). An N-proximal sequence of the alfalfa mosaic virus movement protein is necessary for association w ith cell walls in transgenic plants. The Journal of general virology 73 ( Pt 8) 2115-2119. Fauquet, C. M., Mayo, M. A., Maniloff, J., Desselberger, U. & Ball, L. A., (eds) (2005). Virus Taxonomy: VIIIth Report of the Inte rnational Committee on Taxonomy of Viruses San Diego, CA: Elsevier Academic Press. Fawcett, H. S. (1911). Scaly bark or nail-head ru st of citrus. Bull. 106. In Fla Agric Exp Sta p. 41. Gainesville, FL, USA. Fawcett, H. S. & Lee, H. A. (1926). Citrus diseases and their control. New York, USA: McGraw-Hill. Fazeli, C. F. & Rezaian, M. A. (2000). Nucleotide sequence and organization of ten open reading frames in the genome of grapevine leaf roll-associated virus 1 and identification of three subgenomic RNAs. J Gen Virol 81 605-615. Finn, R. D., Marshall, M. & Bateman, A. (2005). iPfam: visualizatio n of protein-protein interactions in PDB at doma in and amino acid resolutions. Bioinformatics 21 410-412. Florida Agricultural Statistics Service. 2003. Citrus 2002-03 summary: Production, price, and value production by counties and per tree. Online version at http://www.nass.usda.gov/Statisti cs_by_State/Flo rida/index.asp (Last accessed, August 29th, 2007) 8pp. Florida Department of Agricultures and Consumer Services (FDACS); and the United States Department of Agriculture. 2003. Florida Agricultural Fa st Facts: 2003 Directory. Online version at http://www.florida-agriculture.com/pubs/agfacts.htm (Last accessed, March 29, 2004) 170pp. Florida Department of Citrus. 2003. Florida citrus economic indi cators. Economic and market research department. Lakeland, FL, USA 168pp. Food and Agricultural Organizatio n of the United Nations (FAO). 2006. Economic and Social Department. The Statistics Divisi on. Major food and agricultural commodities and producers. http://www.fao.org/es/ess/top/countr y.html?lang=en&c ountry=166&year=2005 Last accessed on October 31st, 2007. French, J. V. & Rakha, M. A. (1994b). False spider mite: damage and control on Texas citrus. Subtropical Plant Sci 46, 16-19.

PAGE 105

105 Frezzi, M. J. (1940). Lepra explosiva of orange. Studies in the pathology laboratory of Bella Vista (Corrientes). Frutas y Hortalizas 5 1-15. Frolov, I., Hardy, R. & Rice, C. M. (2001). Cis-acting RNA elements at the 5' end of Sindbis virus genome RNA regulate minusand plus-strand RNA synthesis. Rna 7 1638-1651. Gomez de Cedron, M., Ehsani, N., Mikkola, M. L., Garcia, J. A. & Kaariainen, L. (1999). RNA helicase activity of Semliki Fore st virus replicase protein NSP2. FEBS Lett 448 1922. Gmez, E. C., Vargas, M. R., Rivadameira, C., Locali, E. C., Freitas-Astua, J., AstuaMonge, G., Rodrigues, J. C. V., Mesa-Cobo, N. C. & Kitajima, E. W. (2005). First report of Citrus leprosis virus on citrus in Santa Cruz, Bolivia. Plant Dis 89 686. Gonzlez, R. H. (1975). Revision of the Brevipalpus phoenici s complex with descriptions of new species from Chile and Tha iland (Acarina: Tenuilpalpidae). Acarologia 17 81-91. Gorchakov, R., Hardy, R., Rice, C. M. & Frolov, I. (2004). Selection of functional 5' cisacting elements promoting efficien t sindbis virus genome replication. J Virol 78 61-75. Gottwald, T.R.; Hughes; G.; Graham J.H.; Sun, X. & Riley, T. (2001). The citrus canker epidemic in Florida: The scientific basis of regulatory eradication policy for an invasive species. Phytopathology 91 30-34 Graham, J. H.; Gottwald, T. R.; J. Cubero, J.; & Achor, D. S. (2004). Xanthomonas axonopodis pv. citri : factors affecting successful eradication of citrus canker. Molecular Plant Pathology 5 1-15. Gravena, S., Benvenga, S. R., Souza amorim, L. C., da Silva, J. L. & Araujo junior, N. (2005). Manejo prtico da resistncia do caro-da-leprose dos citros. Laranja 25 11-24. Graves, M. V. & Roossinck, M. J. (1995). Characterization of def ective RNAs derived from RNA 3 of the Fny strain of cu cumber mosaic cucumovirus. J Virol 69 4746-4751. Guerra-Moreno, A.-S., Manjunath, K.-L., Brlans ky, R.-H., Howd, D., Fernandez, O. & Lee, R.-F. (2003). Characterization of citrus leprosis virus from Panama. Phytopathology 93 S30. Guerra-Moreno, A. S. (2004). Partial molecular characteriza tion and development of a rapid diagnostic method for Citrus leprosis virus (CILV) from Panama. In Plant Pathology p. 80. Gainesville, FL, USA: University of Florida. Guerra-Moreno, A. S., Manjunath, K. L., Brlans ky, R. H., Howd, D. & Lee, R. F. (2004). Ultrastructural and molecular characterization of Citrus leprosis virus indicates possible association of two distinct viruses. Phytopathology 94 S37.

PAGE 106

106 Guerra-Moreno, A. S., Manjunath, K. L., Brlansky, R. H. & Lee, R. F. (2005a). Citrus leprosis symptoms can be associated with the presence of two different viruses: cytoplasmic and nuclear, the former having a multipartite RNA genome. In Proceedings of the 16th Conference of the Internati onal Organization of Citrus Virologists pp. 230-239. Edited by M. E. Hilf, N. duran-Villa & M. A. Rocha-Pea. Monterrey, Mexico: IOCVUCR. Guerra-Moreno, A. S., Manjunath, K. L., Lee, R. F. & Brlansky, R. H. (2005b). Citrus leprosis disease is associated with a bipartite positive-sense RNA virus. In XLV Annual Meeting of the American Phytopatho logical Society, Caribbean Division San Jose, Costa Rica. Guirado, N., Nogueira, N. L., Ambrosano, E. J. & Francozo, M. (2001). Efeito de extratos vegetais na atividade vetora de Brevipalpus phoenicis Summa Phytopathologica 27 343347. Halbert, S. E.; Genc, H., Cevik, B.; Brown, L. G.; Rosales, I. M.; Manjunath, K. L.; Pomerinke, M.; Davison, D. A.; Lee, R. F. & Niblett, C. L. (2004). Distribution and characterization of Citrus tristeza virus in south Florida following stablishment of Toxoptera citricida Plant Dis 88 935-941. Halbert, S. E. & Manjunath, K. L. (2004). Asian citrus pysllids (Sternorrhycha:Psyllidae) and greening disease of citrus: a literature re view and assessment of risk in Florida. Fla Entomol 87 330-353. Hamilton, W. D., Boccara, M., Robinson, D. J. & Baulcombe, D. C. (1987). The complete nucleotide sequence of tobacco rattle virus RNA-1. J Gen Virol 68 ( Pt 10) 2563-2575. Hampton, R., Ball, E. & De Boer, S. (1990). Serological Methods for detection and identification of viral and bacteri al plant pathogens: A laboratory manual St. Paul, Minnesota, USA: APS Press. Haramoto, F. H. (1969). Biology and control of Brevipalpu s phoenicis (Geijskes) (Acarina: Tenuilpalpidae). Hawaii Agric Exp Sta Tech Bull 68. Hardy, R. W. & Rice, C. M. (2005). Requirements at the 3' end of the sindbis virus genome for efficient synthesis of minus-strand RNA. J Virol 79 4630-4639. Helguera, M., Bravo-Almonacid, F., Kobayashi K., Rabinowicz, P. D., Conci, V. & Mentaberry, A. (1997). Immunological detection of a GarV -type virus in Argentine garlic cultivars. Plant Dis 81, 1005-1010. Hernandez, C., Carette, J. E., Brown, D. J. & Bol, J. F. (1996). Serial passage of tobacco rattle virus under different selection conditions results in deletion of structural and nonstructural genes in RNA 2. J Virol 70 4933-4940.

PAGE 107

107 Hilf, M. E., Karasev, A. V., Pappu, H. R., Gump f, D. J., Niblett, C. L. & Garnsey, S. M. (1995). Characterization of citrus tristeza virus subgenomic RNAs in infected tissue. Virology 208 576-582. Holland, J. & Domingo, E. (1998). Origin and evolution of viruses. Virus Genes 16 13-21. Holland, J., Spindler, K., Horodyski, F., Grab au, E., Nichol, S. & VandePol, S. (1982). Rapid evolution of RNA genomes. Science (New York, NY 215 1577-1585. Ivanov, P. A., Karpova, O. V., Skulachev, M. V., Tomashevskaya, O. L., Rodionova, N. P., Dorokhov Yu, L. & Atabekov, J. G. (1997). A tobamovirus genome that contains an internal ribosome entry site functional in vitro. Virology 232 32-43. Jacobson, A. & Peltz, S. W. (1996). Interrelationships of the pathways of mRNA decay and translation in eukaryotic cells. Annu Rev Biochem 65 693-739. Kaariainen, L. & Ahola, T. (2002). Functions of alphavirus nons tructural proteins in RNA replication. Prog Nucleic Acid Res Mol Biol 71 187-222. Karasev, A. V. (2000). Genetic Diversity And Evol ution Of Closteroviruses. Annu Rev Phytopathol 38 293-324. Karasev, A. V., Nikolaeva, O. V., Mushegian, A. R., Lee, R. F. & Dawson, W. O. (1996). Organization of the 3'-terminal half of beet yellow stunt viru s genome and implications for the evolution of closteroviruses. Virology 221 199-207. Kitajima, E. W., Chagas, C. M. & Rodrigues, J. C. (2003a). Brevipalpus-transmitted plant virus and virus-like diseases: cytopathology and some recent cases. Experimental & applied acarology 30 135-160. Kitajima, E. W., Muller, G. W., Costa, A. S. & Yuki, W. (1972). Short, rod-like particles associated with Citrus leprosis. Virology 50 254-258. Kitajima, E. W., Rezende, J. A. & Rodrigues, J. C. (2003b). Passion fruit green spot virus vectored by Brevipalpus phoeni cis (Acari: Tenuipalpidae) on passion fruit in Brazil. Experimental & Applied Acarology 30 225-231. Kitajima, E. W., Rodrigues, J. C. V., de Moraes, G. J. & Childers, C. C. (2000). Brevipalpus mite-borne viruses. Virus Review & Research 5, 44-45. Kitajima, E. W., Rosillo, M., Portillo, M.M ., Muller, G.W. & Costa, A.S. (1974). Microscopia electronica de tejidos foliares de laranjeira infeta das pela lepra explosiva da Argentina. Fitopatologia (Peru) 9 55-56. Knorr, L. C. (1968). Studies on the etiology of leprosis in citrus. In Proceedings of the 4th Conference of the International Or ganization of Citrus Virologists pp. 332-340. Edited by J. F. L. Childs. Gainesville, FL, USA.: University of Florida Pres.

PAGE 108

108 Knorr, L. C. (1973). Citrus diseases and disorders: an alphabetized compendium with particular reference to Florida. Gainesville, Fl, USA: Univ ersity of Florida Press. Knorr, L. C., Denmark, H.A., & Burnett HC. (1968). Occurrence of Brevipalpus mites, leprosis and false leprosis on citrus in Florida. Florida Entomologist 51 11-17. Knorr, L. C. & Price, W. C. (1958). Leprosis. In Florida guide to citrus diseases, and nutritional disorders in color pp. 112-113. Edited by R. M. Pratt. Florida, USA: Agricultural Experiment Station. Kondo, H., Maeda, T., Shirako, Y. & Tamada, T. (2006). Orchid fleck virus is a rhabdovirus with an unusual bipartite genome. J Gen Virol 87 2413-2421. Kondo, H., Maeda, T. & Tamada, T. (2003). Orchid fleck virus: Brevipalpus californicus mite transmission, biological prope rties and genome structure. Experimental & applied acarology 30 215-223. Kondo, H., Maeda, T., Tamada, T., & Shirako, Y. (1998). The genome structure of Orchid fleck virus shows it to be a unique bipartite ge nome virus that resembles rhabdoviruses. In Abstr 7th Int Congr Plant Pathology p. 1.11.81. Edinburgh, Scotland. Koonin, E. V. (1993). Computer-assisted identification of a putative methyltransferase domain in NS5 protein of flaviviruses a nd lambda 2 protein of reovirus. J Gen Virol 74 ( Pt 4) 733-740. Koonin, E. V. & Dolja, V. V. (1993). Evolution and taxonomy of positive-strand RNA viruses: implications of comparative an alysis of amino acid sequences. Crit Rev Biochem Mol Biol 28 375-430. Kreuze, J. F., Savenkov, E. I. & Valkonen, J. P. (2002). Complete genome sequence and analyses of the subgenomic RNAs of sweet pot ato chlorotic stunt viru s reveal several new features for the genus Crinivirus. J Virol 76 9260-9270. Krogh, A., Larsson, B., von Heijne, G. & Sonnhammer, E. L. (2001). Predicting transmembrane protein topology with a hidde n Markov model: application to complete genomes. Journal of molecular biology 305 567-580. Laemmli, U. K. (1970). Cleavage of structural proteins du ring the assembly of the head of bacteriophage T4. Nature 227 680-685. Leon M., G. A., Realpe, C. E. & Garzon, P. A. (2006). Occurrence of Citrus leprosis virus in Llanos Orientales, Colombia. Plant Dis 90 682. Li, F. & Ding, S. W. (2006). Virus counterdefense: diverse strategies for evading the RNAsilencing immunity. Annual review of microbiology 60 503-531.

PAGE 109

109 Li, W., Hartung, J. S. & Levy, L. (2006). Quantitative real-time PCR for detection and identification of Candidatus Li beribacter species associated with citrus huanglongbing. Journal of microbiological methods 66 104-115. Li, X. H., Heaton, L. A., Morris, T. J. & Simon, A. E. (1989). Turnip crinkle virus defective interfering RNAs intens ify viral symptoms and are generated de novo. Proc Natl Acad Sci U S A 86 9173-9177. Livieratos, I. C., Avgelis, A. D. & Coutts, R. H. A. (1999). Molecular characterization of the Cucurbit yellow stunting disord er virus coat protein gene. Phytopathology 89 1030-1035. Locali-Fabris, E. C., Freitas-Astua, J., Souz a, A. A., Takita, M. A., Astua-Monge, G., Antonioli-Luizon, R., Rodrigues, V., Targon, M. L. & Machado, M. A. (2006). Complete nucleotide sequence, genomic organi zation and phylogenetic analysis of Citrus leprosis virus cytoplasmic type. J Gen Virol 87 2721-2729. Locali, E. C., Freitas-Astua, J., Alves de Souza, A., Takita, M. A., Astua-Monge, G., Antonioli, R., Kitajima, E. W. & Machado, M. A. (2003). Development of a Molecular Tool for the Diagnosis of Leprosis, a Major Threat to Citrus Production in the Americas. Plant Dis 87 1317-1321. Lovisolo, O. (2001). Citrus leprosis virus: Properties, di agnosis, agro-ecol ogy and phytosanitary importance. Bulletin OEPP 31 79-89. Lovisolo, O., Colariccio, A., Chagas, C. M ., Rossetti, V., Kitajima, E. W. & Harakava, R. (1996). Partial purification of C itrus leprosis virus. In Proceedings of the 9th Conference of the International Organization of Citrus Virologists pp. 179-183. Edited by S. M. Garnsey, L. W. Timmer & J. A. Dodds. Riverside, CA, USA: IOCV-UCR. Lovisolo, O., Colariccio, A. & Masenga, V. (2000). New experimental host and further information on Citrus leprosis virus. In Proceedings of the 14th Conference of the International Organization of Citrus Virologists pp. 164-173. Edited by J. V. da Graa, R. F. Lee & R. K. Yokomi. Campinas, So Paulo, Brazil: IOCV-UCR. Lu, R., Folimonov, A., Shintaku, M., Li, W. X ., Falk, B. W., Dawson, W. O. & Ding, S. W. (2004). Three distinct suppressors of RNA silencing encoded by a 20-kb viral RNA genome. Proceedings of the National Academy of Sc iences of the United States of America 101 15742-15747. Lutcke, H. A., Chow, K. C., Mick el, F. S., Moss, K. A., Kern, H. F. & Scheele, G. A. (1987). Selection of AUG initiation codons differs in plants and animals. Embo J 6 43-48. Makarova, K. S., Aravind, L., Galperin, M. Y., Gr ishin, N. V., Tatusov, R. L., Wolf, Y. I. & Koonin, E. V. (1999). Comparative genomics of the Arch aea (Euryarchaeota): evolution of conserved protein families, the stable core, and the variable shell. Genome Res 9 608628.

PAGE 110

110 Makarova, K. S., Aravind, L. & Koonin, E. V. (2000). A novel superfamily of predicted cysteine proteases from eukaryotes viruses and Chlamydia pneumoniae. Trends Biochem Sci 2 5, 50-52. Mathews, D. H., Sabina, J., Zuker, M. & Turner, D. H. (1999). Expanded sequence dependence of thermodynamic parameters improves prediction of RNA secondary structure. J Mol Biol 288 911-940. Matzura, O. & Wennborg, A. (1996). RNAdraw: an integrated program for RNA secondary structure calculation and analysis under 32-bit Microsoft Windows. Comput Appl Biosci 12 247-249. Mawassi, M.; Mietkiewska,E.; Hilf, Mark.; Ashou lin, L.; Karasev, A. V.; gafny,R.; Lee, R. F.; Garnsey, S. M.; Dawson, W. & Bar-Joseph, M. (1995). Multiple species of defective RNAs in plants infected with Citrus tristeza virus Virology 214, 264-268 Melzer, M. J., Karasev, A. V., Sether, D. M. & Hu, J. S. (2001). Nucleotide sequence, genome organization and phylogenetic analysis of pineapple mealybug wilt-associated virus-2. J Gen Virol 82 1-7. Merits, A., Kettunen, R., Makinen, K., Lampio, A., Auvinen, P., Kaariainen, L. & Ahola, T. (1999). Virus-specific capping of tobacco mosaic virus RNA: methylation of GTP prior to formation of covalent complex p126-m7GMP. FEBS Lett 455 45-48. Meza Guerrero, C. (2003). Informe: Resultados del muestr eo regional de leprosis de los ctricos. p. 43. Costa Rica: Organismo Intern acional Regional de Sanidad Agropecuaria (OIRSA). Miller, W. A. & Koev, G. (2000). Synthesis of subgenomic RNAs by positive-strand RNA viruses. Virology 273 1-8. Ministerio de Desarrollo Agropecuario (MIDA) 2000 Acciones de diagnstico, vigilancia, campaa e investigacin orientados a la erradicac in de la Leprosis de los Ctricos en la Repblica de Panam. MIDA. Panama. 16pp Moller, S., Croning, M. D. & Apweiler, R. (2001). Evaluation of methods for the prediction of membrane spanning regions. Bioinformatics (Oxford, England) 17 646-653. Monis, J. & Bestwick, R. K. (1997). Serological detection of grapevine associated closteroviruses in infected grapevine cultivars. Plant Dis 81 802-808. Morris, T. J. & Dodds, J. A. (1979). Isolation and analysis of double strand RNA from virus infected plant and fungal tissue. Phytopathology 69, 854-858. Musumeci, M. R. & Rossetti, V. (1963). Transmissao dos sintomas de leprose dos citros pelo acaro Brevipalpus phoenicis. Ciencia e Cultura 15 228.

PAGE 111

111 Nagy, P. D. & Simon, A. E. (1997). New insights into the mechanisms of RNA recombination. Virology 235 1-9. Nicholas, K. B. & Nicholas, H. B. (1997). GeneDoc: A tool for editing and annotating multiple sequence alignments.: Distributed by the author http://www.psc.edu/biomed/genedoc. Nogueira, N. d., Rodrigues, J. C. V., Cabral, C. P. & Prates, H. S. (1996). Influence of citrus leprosis on the mineral composition of Citrus sinensis leaves. Sci Agric 53 2-3. Nogueira, N. L., Rodrigues, J. C. V. & Rossi, M. L. (2003). Particulas semelhantes a rhabdovirus em tres especies ornamentais ap resentando lesoes locais e presenca do acaro Brevipalpus. Summa Phytopathologica 29 278-282. Ochoa, R., Aguilar, H. & Vargas, C. (1994). Phytophagous mites of Central America: an illustrated guide Turrialba, Costa Rica: CATIE. Omoto, C. (1998). Acaricide resistance management of lepr osis mite (Brevipalpus phoenicis) in Brazilian citrus. Pesticide Science 52 189-198. Omoto, C., Alves, E. B., Konno, R. H. & Campos, F. J. (2003 ). Management of Brevipalpus phoenicis (Acari: Tenuipalpid ae) resistance to a caracides in Brazilian citrus. In International Society of Citriculture IX Congress p. 771. Palmieri, M., Donis, I., Salazar, A. L., Bl anco, S., Porres, M., Brlansky, R. H., GuerraMoreno, A. S., Manjunath, K. L. & Lee, R. F. (2005). Leprosis in Guatemala. In Proceedings of the 16th Conference of th e International Organization of Citrus Virologists p. 510. Edited by M. E. Hilf, N. DuranVilla & M. A. Rocha-Pea. Monterrey, Mexico: IOCV-UCR. Pascon, R. C., Kitajima, J. P., Breton, M. C ., Assumpcao, L., Greggio, C., Zanca, A. S., Okura, V. K., Alegria, M. C., Camargo, M. E., Silva, G. G., Cardozo, J. C., Vallim, M. A., Franco, S. F., Silva, V. H., Jordao, H., Jr., Oliveira, F., Giachetto, P. F., Ferrari, F., Aguilar-Vildoso, C. I., Franchiscini, F. J., Silva, J. M., Arruda, P., Ferro, J. A., Reinach, F. & da Silva, A. C. (2006). The complete nucleotide sequence and genomic organization of Citrus Leprosis asso ciated Virus, Cytoplasmatic type (CiLV-C). Virus Genes 32 289-298. Perrault, J. (1981). Origin and replication of defective interfering particles. Curr Top Microbiol Immunol 93 151-207. Pogany, J., Romero, J., Huang, Q., Sgro, J. Y., Shang, H. & Bujarski, J. J. (1995). De novo generation of defective interfering-like RNAs in broad bean mottle bromovirus. Virology 212 574-586.

PAGE 112

112 Rangel, E., Manjunath, K. L., Guerra-Moreno, A. S., Brlansky, R. H. & Lee, R. F. (2005). Bacterial Expression and Pu rification of a protein from Citrus leprosis virus. In Proceedings of the 16th Conference of th e International Organization of Citrus Virologists pp. 510-511. Edited by M. E. Hilf, N. Duran-Villa & M. A. Rocha-Pea. Monterrey, Mexi co: IOCV-UCR. Reis, P. R., Sousa, E. O., Teodoro, A. V. I. & Pedro-Neto, M. (2003). Effect of prey density on the functional and numerical responses of two species of pr edaceous mites (Acari: Phytoseiidae). Neotropical Entomology 32 461-467. Rhoads, A. S. & DeBusk, E. F. (1931). Diseases of citrus in Florida. University of Florida Agricultural Experiment Station Bulletin 229 84-91, 208-211. Rodrigues, J. C., Kitajima, E. W., Childers, C. C. & Chagas, C. M. (2003). Citrus leprosis virus vectored by Brevipalpus phoenicis (Acar i: Tenuipalpidae) on citrus in Brazil. Experimental & applied acarology 30 161-179. Rodrigues, J. C. V. ( 2000). Relaes patogeno-vector-planta no sitema leprose dos citrus. In Centro de Energia Nuclear na Agricultura p. 168. Piracicaba, Brasil da Universidade de So Paulo. Brazil. Rodrigues, J. C. V., Locali, E. C., Freitas-Astua, J. & Kitajima, E. W. (2005). Transmissibility of Citrus leprosis virus by Brevipalpus phoenicis to Solanum violaefolium Plant Disease 89 911. Rodrigues, J. C. V. & Machado, M. A. (2000). Virus-Brevipalpus-plant relationships of the citrus leprosis pathosystem. In Proceedings of the Internatio nal Society of Citriculture, pp. 768-770. Orlando, FL, USA. Rodrigues, J. C. V., Machado, M. A., Kitajima, E. W. & Muller, G. W. (2000). Transmission of citrus leprosis virus by Brevipalpus phoenicis (Acari: Tenuipalpidae). In Proceedings of the 14th Conference of the Internati onal Organization of Citrus Virologists pp. 174-178. Edited by J. V. da Graa, R. F. Lee & R. K. Yokomi. Campinas, So Paulo, Brazil: IOCVUCR. Rodrigues, J. C. V., Nogueira, N. L., Freitas, D. S. & Prates, H. S. (1997). Virus-like particles associated with Brevipalpus phoenicis Geijskes (Acari: Tenuipalpida e), vector of citrus leprosis virus. An Soc Entomol Brazil 26 391-395. Rodrigues, J. C. V., Zuniga-Reyes, J. A., Achor, D. S., Childers, C. C. & Kitajima, E. W. (2007). Occurrence and distribution of C itrus leprosis virus in Honduras. Plant Pathology 56 344. Rodriguez, O. & Romano-Gallo, J. (1968). The influence of viruses on the mineral composition of citrus leaves. In Proceedings of the 4th Conf erence of the International Organization of Citrus Virologists pp. 307-341. Edited by J. F. L. Childs. Gainesville, FL, USA: University of Florida Press.

PAGE 113

113 Rosner, A., Lee, R.F. & Bar-Joseph, M. (1986) Differential hybridization with cloned cDNA sequences for detecting a specific isolate of Citrus tristeza virus Phytopathology 76 : 820824 Rossetti, V. (1980). Diferenciao entre o cancro ctrico e outras molstias. Citrus 1 23-26. Rossetti, V. (1996). Transmission of Citrus lepros is virus (CiLV)-a review. In Procedings of the 13th Conference of the International Organization of Citrus Virologists pp. 331-335. Edited by J. V. Da Graa, P. Moreno & R. K. Yokomi. Riverside, CA, USA: IOCV-UCR. Rossetti, V. (2001). Manual ilustrado do doenas dos citros Piracicaba, Brazil: Fealq/Fundecitrus. Rossi-Zalaf, L. S. & Alves, S. B. (2006). Susceptibility of Brevipalpus phoenicis to entomopathogenic fungi. Experimental & applied acarology 40 37-47. Roux, L., Simon, A. E. & Holland, J. J. (1991). Effects of defective in terfering viruses on virus replication and pathogenesi s in vitro and in vivo. Adv Virus Res 40 181-211. Rozanov, M. N., Koonin, E. V. & Gorbalenya, A. E. (1992). Conservation of the putative methyltransferase domain: a hallmark of th e 'Sindbis-like' supergroup of positive-strand RNA viruses. J Gen Virol 73 ( Pt 8) 2129-2134. Rubinson, E., Galiakparov, N ., Radian, S., Sela, I., Tanne, E. & Gafny, R. (1997). Serological Detection of Grapevine Virus A Using Antiserum to a Nonstructural Protein, the Putative Movement Protein. Phytopathology 87 1041-1045. Rubio, L., Yeh, H. H., Tian, T. & Falk, B. W. (2000). A heterogeneous population of defective RNAs is associated with lettuce infectious yellows virus. Virology 271 205-212. Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular cloning: A laboratory manual. Second edition Cold Spring Harbor, NY, USA: Cold Spring Harbor Laboratory Press. Snchez-Anguiano, H. (2005). Detection of Citrus leprosis virus in the State of Chiapas, Mexico: http://www.pestalert.org/notific ations.cfm?region=Mexico#16 (Last accessed, August 25, 2007). Sasaya, T., Ishikawa, K. & Koganezawa, H. (2001). Nucleotide sequence of the coat protein gene of Lettuce big-vein virus. J Gen Virol 82 1509-1515. Sasaya, T., Ishikawa, K. & Koganezawa, H. (2002). The nucleotide sequence of RNA1 of Lettuce big-vein virus, genus Varicosavirus, reveals its relation to nonsegmented negativestrand RNA viruses. Virology 297 289-297. Sasaya, T., Kusaba, S., Ishikawa, K. & Koganezawa, H. (2004). Nucleotide sequence of RNA2 of Lettuce big-vein virus and evidence for a possible transcription termination/initiation strategy sim ilar to that of rhabdoviruses. J Gen Virol 85 2709-2717.

PAGE 114

114 Savenkov, E. I., Solovyev, A. G. & Morozov, S. (1998). Genome sequences of poa semilatent and lychnis ringspot hordeiviruses. Arch Virol 143 1379-1393. Schagger, H., Aquila, H. & Von Jagow, G. (1988). Coomassie blue-sodium dodecyl sulfatepolyacrylamide gel electrophoresis for dire ct visualization of polypeptides during electrophoresis. Analytical biochemistry 173 201-205. Shirako, Y., Suzuki, N. & French, R. C. (2000). Similarity and divergence among viruses in the genus Furovirus. Virology 270 201-207. Skulachev, M. V., Ivanov, P. A., Karpova, O. V., Korpela, T., Rodionova, N. P., Dorokhov, Y. L. & Atabekov, J. G. (1999). Internal initiation of tr anslation directed by the 5'untranslated region of the tobamovirus subgenomic RNA I(2). Virology 263 139-154. Steinhauer, W. R., Walsh, R. C. & Kalfayan, L. J. (1989). Sequence and structure of the Drosophila melanogaster ovarian tumor gene an d generation of an antibody specific for the ovarian tumor protein. Mol Cell Biol 9 5726-5732. Teodoro, A. V. & Reis, P. R. (2006). Reproductive performance of the mite Brevipalpus phoenicis (Geijskes, 1939) on citrus a nd coffee, using life table parameters. Braz J Biol 66 899-905. Teodoro, A. V. I. & Reis, P. R. (2004). Reproductive performance of the mite Brevipalpus phoenicis (Geijskes, 1939) on citrus a nd coffee, using life table parameters. Brazilian Journal of Biology 66 34-43. Thivierge, K., Nicaise, V., Dufresne, P. J., Cotto n, S., Laliberte, J. F., Le Gall, O. & Fortin, M. G. (2005). Plant virus RNAs. Coordinated recrui tment of conserved host functions by (+) ssRNA viruses during ear ly infection events. Plant Physiol 138 1822-1827. Thompson, J. D., Gibson, T. J., Plewniak, F., Jeanmougin, F. & Higgins, D. G. (1997). The CLUSTAL_X windows interface: flexible strate gies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res 25 4876-4882. Thompson, J. D., Higgins, D. G. & Gibson, T. J. (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22 46734680. Towbin, H., Staehelin, T. & Gordon, J. (1979). Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sh eets: procedure and some applications. Proceedings of the National Academy of Sc iences of the United States of America 76, 4350-4354. United Nations Conference on Trad e and Development (UNCTAD). 2005. Market information in the commodities area: Citrus Fruits. http://r0.unctad.org/infocomm/anglais/orange/market.htm Last accessed on October 25th, 2007.

PAGE 115

115 United States Department of Agriculture. 2003 Citrus fruits 2003 Summary: September 2003. National Agricultural Statistic s Service. NASS, USDA 7pp. United States Department of Agricultu re (USDA). Foreign Agricultural Service Horticultural & Tropical Products Division. 2004 The U.S. and World Situation: Citrus. http://www.fas.usda.gov/htp/hort iculture/citrus/2004%20Citrus.pdf Last accessed on November 1st, 2007. van Regenmortel, M. H. V., Fauquet, C..M.,. Bishop, D.H.L., Carstens, E.B., Estes, M.K., Lemon, S.M., Maniloff, J., Mayo M.A., McG eoch, D.J., Pringle, C.R., & Wickner, R.B. (2000). Virus Taxonomy: The Classification and Nomenclature of Viruses. The Seventh Report of the International Comm ittee on Taxonomy of Viruses. San Diego, CA, USA: Academic Press. van Rossum, C. M., Brederode, F. T., Neeleman, L. & Bol, J. F. (1997). Functional equivalence of common and unique sequences in the 3' untra nslated regions of alfalfa mosaic virus RNAs 1, 2, and 3. J Virol 71 3811-3816. Ward, C. W. (1993). Progress towards a high er taxonomy of viruses. Res Virol 144 419-453. White, K. A., Bancroft, J. B. & Mackie, G. A. (1991). Defective RNAs of clover yellow mosaic virus encode nonstructur al/coat protein fusion products. Virology 183 479-486. White, K. A. & Nagy, P. D. (2004). Advances in the Molecular Biology of Tombusviruses: Gene Expression, Genome Rep lication, and Recombination Progress in Nucleic Acid Research and Molecular Biology 78, 187-226 Whiteside, J. O. (2000). Citrus trees and their fruit. In Compendium of Citrus Diseases Second edn, p. 92. Edited by L. W. Timmer, S. M. Garn sey & G. J.H. St. Paul, MN.: APS Press Wu, B. & White, K. A. (1998). Formation and amplification of a novel tombusvirus defective RNA which lacks the 5' nontransla ted region of the viral genome. J Virol 72 9897-9905. Yang, G., Mawassi, M., Gofman, R., Gafny, R. & Bar-Joseph, M. (1997). Involvement of a subgenomic mRNA in the generation of a vari able population of defective citrus tristeza virus molecules. J Virol 71 9800-9802.

PAGE 116

116 BIOGRAPHICAL SKETCH Abby S. Guerra-Moreno was born and raised in Santiago City, Veraguas State, Republic of Panama. The agriculture-related t opics were his favorite classe s in primary and junior high school. He received his high school diploma, with the highest honors, from the Instituto Nacional de Agricultura (INA) located in Divisa, Panama. He obtained his BS degree at the Universidad de Panama in 2000, where he was the first of hi s class. He majored in agronomy engineering with specialization in plant pr otection. After graduation, he wa s working at the Instituto de Investigaciones Agropecuarias de Panama (IDIAP) where he was offered an opportunity to study a non-degree seeking Masters Program in Ecol ogical Agriculture at th e Centro Agronmico Tropical de Investigacin y En seanza (CATIE) in Costa Rica. Mr. Abby S. Guerra-Moreno joined the Plant Pathology Department (PLP) at the University of Florida (UF) for pursuing graduate studies in Spring 2002 and he obtai ned his M.Sc. degree in May 2004. Immediately, after graduation, Mr. Guerra-Moreno was accepted into the PLP UF Ph.D. program, to work on the molecular characterization and the developm ent of molecular and serological diagnostic methods for Cytoplasmic citrus leprosis virus (CCLV).