<%BANNER%>

Type I Interferon in the Pathogenesis of Systemic Lupus Erythematosus

Permanent Link: http://ufdc.ufl.edu/UFE0021694/00001

Material Information

Title: Type I Interferon in the Pathogenesis of Systemic Lupus Erythematosus
Physical Description: 1 online resource (126 p.)
Language: english
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2008

Subjects

Subjects / Keywords: autoantibodies, monocyte, systemic, trisomy, type
Immunology and Microbiology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Systemic lupus erythematosus (SLE) is a chronic inflammatory autoimmune disease with multiple organ involvements. Cytokines, such as type I interferon (IFN-I) play an important role in the immune system, including regulating the activation and survival of B and T cells, up-regulation of MHC II expression, and acting as adjuvant in antibody production. In this study, we have shown that the production of IFN-I was increased in peripheral blood mononuclear cells compared to normal controls or patients with other autoimmune disease. The elevated production of IFN-I was associated with the autoantibodies against dsDNA, Sm/RNP, Ro/La and was negatively associated with anti-phospholipid antibody. The increased IFN-I production was also correlated with disease activity and renal involvement. Paradoxically the major IFN-I producing cells, namely plasmacytoid dendritic cells (PDCs) were decreased in SLE patients when compare to normal controls. We have shown that the decreased number of PDCs was also correlated with certain autoantibody production. We found a subset of monocytes which were CD14+CD71+ in lupus patients. These cells were correlated with IFN-I production. At last we show that over production of IFN-I could lead to a lupus like disease. We studied two patients with an inbalanced translocation of chromosome 9 and 21 with 3 copies of IFN-I cluster. These patients exhibit a lupus like disease as well as increased IFN-I production and decreased PDC number as other SLE patients. In conclusion, we found IFN-I was important in the pathogenesis of SLE and that CD14+CD71+ monocytes were responsible for the IFN-I production. Over expression of IFN-I was sufficient to induce a lupus like disease.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Thesis: Thesis (Ph.D.)--University of Florida, 2008.
Local: Adviser: Reeves, Westley H.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2010-05-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2008
System ID: UFE0021694:00001

Permanent Link: http://ufdc.ufl.edu/UFE0021694/00001

Material Information

Title: Type I Interferon in the Pathogenesis of Systemic Lupus Erythematosus
Physical Description: 1 online resource (126 p.)
Language: english
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2008

Subjects

Subjects / Keywords: autoantibodies, monocyte, systemic, trisomy, type
Immunology and Microbiology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Systemic lupus erythematosus (SLE) is a chronic inflammatory autoimmune disease with multiple organ involvements. Cytokines, such as type I interferon (IFN-I) play an important role in the immune system, including regulating the activation and survival of B and T cells, up-regulation of MHC II expression, and acting as adjuvant in antibody production. In this study, we have shown that the production of IFN-I was increased in peripheral blood mononuclear cells compared to normal controls or patients with other autoimmune disease. The elevated production of IFN-I was associated with the autoantibodies against dsDNA, Sm/RNP, Ro/La and was negatively associated with anti-phospholipid antibody. The increased IFN-I production was also correlated with disease activity and renal involvement. Paradoxically the major IFN-I producing cells, namely plasmacytoid dendritic cells (PDCs) were decreased in SLE patients when compare to normal controls. We have shown that the decreased number of PDCs was also correlated with certain autoantibody production. We found a subset of monocytes which were CD14+CD71+ in lupus patients. These cells were correlated with IFN-I production. At last we show that over production of IFN-I could lead to a lupus like disease. We studied two patients with an inbalanced translocation of chromosome 9 and 21 with 3 copies of IFN-I cluster. These patients exhibit a lupus like disease as well as increased IFN-I production and decreased PDC number as other SLE patients. In conclusion, we found IFN-I was important in the pathogenesis of SLE and that CD14+CD71+ monocytes were responsible for the IFN-I production. Over expression of IFN-I was sufficient to induce a lupus like disease.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Thesis: Thesis (Ph.D.)--University of Florida, 2008.
Local: Adviser: Reeves, Westley H.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2010-05-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2008
System ID: UFE0021694:00001


This item has the following downloads:


Full Text

PAGE 1

1 TYPE I INTERFERON IN THE PAT HOGENESIS OF SYSTEMIC LUPUS ERYT HEMATOSUS By HAOYANG ZHUANG A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE RE QUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2008

PAGE 2

2 2008 Haoyang Zhuang

PAGE 3

3 To my parents and my sister, for their endless love.

PAGE 4

4 ACKNOWLEDGMENTS I thank my mentor, Dr. Westley Reeves, fo r his guidance, patience and support. His enthusiasm and curiosity for science inspired me constantly. I want to thank my committee, Dr. Eric Sobel, Dr. Mark Atkinson a nd Dr. Daniel Driscoll, for for their encouragement, technical support, and insightful suggestions. I truly appreciate the invaluable support both clinically and scientifically. Dr. Driscoll prov ided excellent subject on the st udy, without which my research could not be completed. I would like to tha nk Dr. Atkinson for his professional advice on immunology. I also want to thank Dr. Clayton Ma thews, who provided excellent advice for my thesis with great patients and details. I thank Dr. Minoru Satoh for his excellent s upport and perceptive critiques. I thank D r. Mark Siegal for providing study specimens from their clinic.I thank all the members of the Reeves lab, Dina, Kindra, Jason, Pui, Rob, Yi Ed, Julie, Errin, for their friendship and encouragement. They serve as colleagues and also as family.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS...............................................................................................................4LIST OF TABLES................................................................................................................. ..........8LIST OF FIGURES.........................................................................................................................9LIST OF ABBREVIATIONS........................................................................................................ 10ABSTRACT...................................................................................................................................13CHAPTER 1 INTRODUCTION..................................................................................................................15Autoimmunity and Autoimmune Disease..............................................................................15Systemic Lupus Erythematosus..............................................................................................15SLE 101...........................................................................................................................15Genetics of SLE............................................................................................................... 16Environmental Factors..................................................................................................... 18Autoantibodies in SLE....................................................................................................20Type III hypersensitivity and SLE.................................................................................. 20Clinical Manifestations....................................................................................................22Measurement of Disease Activity................................................................................... 24Current Treatment...........................................................................................................25Anti-inflammatory Agents....................................................................................... 25Antimalarials............................................................................................................ 26Anti-cytokine Agents...............................................................................................26Methotrexate.............................................................................................................27Anti-T Lymphocyte Therapy...................................................................................27Anti-B Lymphocyte Therapy...................................................................................29Intravenous Immunoglobulin (IVIG)....................................................................... 29Animal Models of SLE....................................................................................................30Type I Interferon.............................................................................................................. .......31Induction of IFN-I...................................................................................................................32Toll Like Receptors Dependent Pathways......................................................................32TLR Independent Pathway.............................................................................................. 34Crosstalk of Type I Interf eron and Other Cytokines.......................................................35IFN-I is Involved In Pathogenesis of SLE.............................................................................. 37Subsets of Dendritic Cells (DCs) Produce IFN-I...................................................................382 MATERIAL AND METHOD................................................................................................ 44Subjects...................................................................................................................................44Reagent...................................................................................................................................44

PAGE 6

6 RNA Preparation....................................................................................................................45Real-Time PCR.................................................................................................................. .....45Effect of Corticosteroids and Antim alarials on Cytokine Production.................................... 46Serological Testing............................................................................................................ .....46Flow Cytometry................................................................................................................. .....46Karyotype Analysis............................................................................................................. ...47Cell Enrichment......................................................................................................................47Flow Cytometric Cell Sorting................................................................................................. 48Electron Microscopy...............................................................................................................48Statistical Method...................................................................................................................493 RESULTS AND DISCUSSION: ASSOCI ATI ON OF ANTI-NUCLEOPROTEIN AUTOANTIBODIES WITH TYPE I INTER FERON PRODUCTION IN SYSTEMIC LUPUS ERYTHEMATOSUS................................................................................................ 53Introduction................................................................................................................... ..........53Results.....................................................................................................................................54Increased IFN-I Production and Low Peripheral Blood Dendritic Cells in SLE............ 54IFN-I and PDC/MDC Abnormalities Are not Explained by Medication Use................. 55Increased Mx1 and Low PDC/MDC Counts Are Associated With A Subset of Autoantibodies.............................................................................................................56Relationship of Mx1 Expression and Dendr itic Cell Counts to Disease Activity........... 57Discussion...............................................................................................................................584 RESULTS AND DISCUSSION: CD71+ MONOCYT ES IN PERIPHERAL BLOOD FROM LUPUS PATIENTS PRODUCE INTERFERON / ................................................70Introduction................................................................................................................... ..........70Results.....................................................................................................................................71Low PDC Numbers Correlate with Hi gh Interferon Levels in SLE............................... 71CD14+ Cells from SLE Patients Produce IFN-I in Response to TLR Ligands...............72Circulating CD71+ Monocytes in SLE Express IFN-I.................................................... 73Increased CD14+CD71+ Monocytes in Patients with Anti-U1A Antibodies..................73Phenotype of CD14+CD71+ Cells....................................................................................74Discussion...............................................................................................................................74Production of IFN-I by CD71+ Monocytes in SLE......................................................... 75Mechanism of IFN-I Production..................................................................................... 775 RESULTS AND DISCUSSION: LUPUS-LI KE DISEASE AND HIGH INTERFERON LEVELS CORRESPONDING TO TRISOMY OF THE TYPE I INTERFERON CLUSTER ON CHROMOSOME 9P.....................................................................................86Introduction................................................................................................................... ..........86Results.....................................................................................................................................87Pedigree....................................................................................................................... ....87Case Reports....................................................................................................................87Immunologic Findings..................................................................................................... 89

PAGE 7

7 Discussion...............................................................................................................................916 CONCLUSION AND FUTURE DIRECTIONS.................................................................. 100LIST OF REFERENCES.............................................................................................................104BIOGRAPHICAL SKETCH.......................................................................................................126

PAGE 8

8 LIST OF TABLES Table page 2-1 Patient demographics....................................................................................................... ..50 2-2 Primers for real time PCR.................................................................................................. 51

PAGE 9

9 LIST OF FIGURES Figure page 1-1 Toll like receptor signaling pathway and induction of type I interferon.. ......................... 41 1-2 Production of IFN-I induced by TLR independent pathway.............................................42 1-3 Type I interferon signaling................................................................................................ .43 3-1 Increased expression of IFN inducible genes in SLE........................................................ 63 3-2 Reduced circulating PDCs and MDCs in SLE..................................................................64 3-3 Effect of medications on M x1 expression in SLE patients................................................ 66 3-4 Increased Mx1 expression corre lates with autoantibody production................................. 67 3-5 Decreased dendritic cell counts correlate with autoantibody production.......................... 68 3-6 Relationship of Mx1 expression, PDC and MDC counts to disease severity.................... 69 4-1 Reduced plasmacytoid dendritic cells in SLE and correlation between CD14+CD71+ monocytes..........................................................................................................................79 4-2 Production of IFN-I by CD14+ cells................................................................................. 80 4-3 SLE monocytes express high level of TLR7, IRF7 and CD14 and produce IL-6 as well as IFN in response to loxoribine stimulation........................................................... 81 4-4 Increased CD14+ CD71+ monocyte in SLE and correlation of IFN-I production............. 82 4-5 Production of IFN-I by CD14+CD71+ monocytes............................................................. 83 4-6 Percentage of CD71+ cells correl ates with anti-U1A antibody production...................... 84 5-1 Pedigree................................................................................................................... ...........95 5-2 Karyotype analysis of A, subject UB2 and B, subject B1.................................................96 5-3 Autoantibody testing....................................................................................................... ...97 5-4 Type I interferon (IFN) expression....................................................................................98 5-5 Regulation of interferon (IFN) production .......................................................................99

PAGE 10

10 LIST OF ABBREVIATIONS ADCC Antibody-dependent ce llular cytotoxicity ANA Anti-nuclear antibody ANCA Antineutrophil cytoplasmic antibodies APC Antigen presenting cell BILAG the British Isles Lupus Assessment Group CARD Caspase recruitment domains COX Cyclooxygenase CR1 C3b receptors 1 CRP C reactive protein ECLAM European Consensus Lupus Activity Measurement GN Glomerulonephritis HCV Hepatitis C virus HLA Human leukocyte antigen IFN-I Type I interfereon IFNAR Interferon recep tor IPC Interferon producing cells IRF Interferon regulatory factor ISGF IFN-stimulated gene factor ISRE IFN-stimulated response element IVIG Intravenous immunoglobulin LPS Lipopolysaccharide MCP Metacarpophalangeal MDA5 Melanoma differentiationassociated gene 5 MDC Myloid dendritic cell

PAGE 11

11 MHC Major histocompatibility complex NFAT Nuclear factor of activated T cells NK Natural killer nRNP Nuclear ribonuclear protein NSAIDs Nonsteroidal anti-inflammatory drugs OAS 2-oligoadenylate synthetase PBMC Peripheral blood mononuclear cell PDC Plasmacytoid dendritic cell PIP Proximal interphalangeal PKR Protein kinase R Poly (I:C) Polyinosin icpolycytidylic acid RA Rheumatoid Arthritis RD Repression domain RIG-I Retinoic acidinducible gene I SIS SLE Index Score SLAM Systemic Lupus Activity Measures SLE Systemic lupus erythematosus SLEDAI Systemic Lupus Erythematosus Disease Activity Index SNP Single nucleotide polymorphism SOCS Suppressors of cytokine signaling STAT Signal Transducers and Ac tivators of Transcription TGF Transforming growth factor TLR Toll like receptor TICAM Toll-interleukin 1 receptor dom ain (TIR)-containing adaptor m olecule TIR TLRinterleukin-1 receptor

PAGE 12

12 TIRAP Toll-interleukin 1 receptor (T IR) dom ain-containing adapter protein TNF Tumor necrosis factor TMPD 2,6,10,14 tetramethylpentadecane TRAM Toll-receptor-associated molecule TRIF TIR-domain-containing adapter-indu cing interferonVSV Vesicular stomatitis virus YAA Y chromosome-linked autoimmune acceleration

PAGE 13

13 Abstract of Dissertation Pres ented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy TYPE I INTERFERON IN THE PAT HOGENESIS OF SYSTEMIC LUPUS ERYT HEMATOSUS By Haoyang Zhuang May 2008 Chair: Westley H. Reeves Major: Medical Sciences--Immunology and Microbiology Systemic lupus erythematosus (SLE) is a chr onic inflamm atory auto immune disease with multiple organ involvements. Cytokines, such as t ype I interferon (IFN-I) pl ay an important role in the immune system, includi ng regulating the activation and survival of B and T cells, up-regulation of MHC II expr ession, and acting as adjuvant in antibody production. In this study, we have shown that the pr oduction of IFN-I was increased in peripheral blood m ononuclear cells compared to normal controls or patients with othe r autoimmune disease. The elevated production of IFN-I was associ ated with the autoan tibodies against dsDNA, Sm/RNP, Ro/La and was negatively associated with anti-phospholipid antibody. The increased IFN-I production was also co rrelated with disease activity and renal involvement. Paradoxically the major IFN-I producing cells, nam ely plasmacytoid dendritic cells (PDCs) were decreased in SLE patients when compare to normal controls. We have shown that the decreased number of PDCs was also correlate d with certain autoanti body production. We found a subset of monocyt es which were CD14+CD71+ in lupus patients. These cells were correlated with IFN-I production. At last we show that over production of IFN-I could lead to a lupus like disease. W e studied two patients with an inbalanced transloc ation of chromosome 9 and 21 with 3 copies of

PAGE 14

14 IFN-I cluster. These pati ents exhibit a lupus like disease as well as increased IFN-I production and decreased PDC number as other SLE patients. In conclusion, we found IFN-I was important in the pathogenesis of SLE and that CD14+CD71+ monocytes were responsible for the IF N-I production. Over expression of IFN-I was sufficient to induce a lupus like disease.

PAGE 15

15 CHAPTER 1 INTRODUCTION Autoimmunity and Autoimmune Disease As early as 1904, Paul Ehrlich used the term autoimmunity to signify an immune response against self and introduced th e phrase horror autotoxicus (1). However the concept of autoimm unity was not fully accepted until 1960. Over the years, it has become recognized that autoimmunity is not an uncommon occurrence an d is not necessarily detrimental. Thus, an important distinction must be drawn between au toimmunity, which is indicated by the presence of immune response to self antigen, (e.g. the formation of autoantibod ies) and autoimmune disease, which occurs when autoimmunity leads to an inflammatory res ponse resulting in tissue injury. Autoimmunity may be asymptomatic a nd it cannot be assumed that an autoimmune response implies the existence of autoimmune disease. Systemic Lupus Erythematosus Systemic Lupus Erythematosus 101 Systemic lupus erythematosus (SLE) is a chr onic inflamm atory auto immune disease with multiple organ involvement. It is characterized of the production of autoantibodies against components of the cell nucleus and cytoplasm. Curre ntly there is no single diagnosis of SLE, and the SLE is defined for research purposes as th e presence of any 4 out of following 11 criteria: malar rash, dicoid rash, photosensitivity, oral ulcers, arthritis, sero sitis, renal disord er, neurologic disorder, hematologic disorder, immunologi c disorder (anti-dsDNA, Sm, phospholipid antibodies), and antinuc lear antibodies (2). SLE primarily affects young women and the peak of incidence occurs between the ages of 15 and 40 (2). In this age range the ratio of affected wom en to men is around 10:1 whereas before or after this period th e ratio is around 4:1, suggesting that estrogen plays a role in the

PAGE 16

16 pathogenesis of SLE (3). The disease is more common among African Americans, Asians, and Hispanics whereas the prevalence is lower in Caucasians (around 1 in 2000). The prevalence in non-Caucasian females is as high as 1 in 200. The frequency of autoimmune disease in f irst degree relatives of SLE patients is significantly higher than in non-re latives, consistent with a ge netic contribution. However, it does not appear to follow the classical Mendelian pattern (4). Environmen tal factors, such as sunlight and infections, also play impor tant role in the pathogenesis of SLE Genetics of SLE Genetics factors play important roles in the pa thogenesis of SLE. Twin studies show that nom ozygotic twins have a 24-58% risk of devel oping SLE compared to only 2-5% for dizygotic twins (5). An individual with an affected first-degree relative is 20 times more likely to develop autoimmune disease (6, 7). Several genome wide linkage scans have been p erformed in families and large cohorts of lupus patients. Although none of the loci reveal ed to be associated with lupus have been reproduced in all the studies, seven regions show strong evidence of linkage in at least 2 studies. These regions include 1q22-24(8, 9), 1q41-42(8), 2q32-37(9), 4p16(8, 9), 6p11-21(8-10), 11p13(11), 12p11(8, 9), 12q24(9),16q12-13( 10, 11) and 19q13(8). The studies suggest potential candidate genes for further studies. The lack of consistency among studies may be due to the fact that SLE is a heterogeneous di sease or maybe related to diffe rent ethnic compositions of the study population. The most studied locus is 1q22-24, which wa s identified in m any populations (8, 9). Studies have been focused on the low affinity Fc receptor gene CGR2A and B FCGR3A and B which locate on Chromosome 1. Fc RIIa (CD32) is widely expressed on monocytes, macrophages, neutrophils, dendritic cells and pl atelets. A single nucleotide polymorphism (SNP)

PAGE 17

17 results in a histidine (H)/argini ne (R) switch at amino acid posi tion 131 leading to a much lower binding affinity for IgG2, and potentially a lo wer capacity to clear IgG2 containing immune complexes. Some studies showed homozygous RR individuals have higher susceptibility to SLE (12). Fc RIIIa (CD16) is expressed primarily on monocytes, macrophages, NK cells, and some T-cells. A valine (V) to phenylal anine (F) switch at amino acid position 158 results in a reduction in binding affinity for IgG1 and IgG3 as well as immune comp lexes containing these isotypes (13). Some studies suggest the 158F allele is associated with l upus nephritis (14) and homozygous FF SLE patients have a higher risk for nephritis compared with the homozygous VV patients (15, 16). In addition to the F158 allele, F176 allele which has been shown to be associated with increased risk of SLE in both African American and Euro pean American (17, 18). Fc RIIIb is a stimulatory receptor expressed primar ily on neutrophils. It exhibits a copy number polymorphism. However, the association between the Fc IIIb copy number and SLE has been controversial (19). Another candidate gene on 1q23 is C reactive protein (CRP). CRP is an acute phase protein which is up-regulated by IL-6 and inflammation. It binds to CRP receptor on macrophages and enhances phagocytosis as well as complement binding to foreign antigens. In some studies this CRP polymorphism is also associated with SLE (20, 21). Major histocompatibility comple x (MHC) m olecule was found to be associated with lupus 20 years ago (22). The human MHC region locates on Chromosome 6p11-21. It spans 3.6 Mb of DNA and contains over 200 ge nes, divided into the class I region containing HLA A, B and C the class II region containing HLA DR DQ and DP and the class III region containing a variety of immunological genes including tumor necrosis factor (TNF) and complement components C2 and C4 The association between MHC haplotype and lupus is highly consistent. An association of HLA DR2 and DR3 with SLE has been reported in several populations, with a relative risk for

PAGE 18

18 the development of disease of approximately two to five (23, 24). A specialcombination of DR2/DR3 heterozygous individual has a moderate risk of developing SLE. The HLA class II genes are also associated with the production of certain autoantibodies such as anti-Sm (small nuclear ribonucleoprotein, as well as anti-R o, anti-La, anti-nRNP, and anti-DNA antibodies (25-27). C4 protein is tr anscribed from two genes, C4A and C4B and also exhibits a copy number polymorphism. The C4A null allele (C4AQ*0) has been a ssociated with SLE in some studies. C2Q*0 is carried on a rare DRB1*1501 containing MHC haplotype and homozygote of C2Q*0 is associated with SLE development, ye t there is no evidence fo r heterozygote of C2Q*0 with higher risk for lupus (28-30). More recent studies showed increased type I interferon expression in SL E (31, 32). Interferon regulatory factor 5 (IRF5) is an interfer on regulated transcription factor that plays an important role in the production of the proinflammatory cytokines TNF IL-12, and IL-6 in response to toll-like receptor stimulation. IRF5 has a complex splicing pattern. There are three alternative 5 UTR exons (exon1-A, exon1-B, and e xon1-C). The three alternative 5 UTRs lead to the translation of several different is oform named V1V12. SNP rs2004640 (G
PAGE 19

19 (320-400 nm). UVB irradiation is mostly absorbed in the upper layers of the epidermis, whereas the longer wavelength UVA is able to reach the dermis. UV exposure can induce apoptosis and release of immune mediators, activ ating of resident dendritic cells and T cells (37). It has been suggested that expression of certain self-ant igens, such as Ro60/Ro52, on the surface of the apoptotic cells may lead to antibody-mediated infl ammatory responses that could play a role in the pathogenesis of skin rashes in lupus (37, 38). The importance of environmental factors is furt her illustrated by the induction of a murine lupus syndrom e by the hydrocarbon pristane (see Animal Models, below), which appears to act, in part, through the induction of Type I interferon (IFN and IFN ) production (39). Many other chemicals and drugs have been implicated as tri ggers of autoimmunity or autoimmune disease. Procainamide, hydralazine, chlorpromazine methyldopa, quinidine, minocycline, and nitrofurantoin all have been associated with th e induction of antinuclear antibodies and in cases antineutrophil cytoplasmic antibodies (ANCA) as well as in the pathogenesis of drug-induced lupus, most frequently manifest ed by serositis (inflammation of the pleura or pericardium) and arthritis (40-42). Silica is recognized as a precip itating factor for sclero derma (43, 44), cigarette smoke may aggravate rheumatoid arthritis (45) and trichloroethylene is thought to promote lupus in animal models and po ssibly humans (46). Other chemic al agents implicated in the pathogenesis of autoimmunity include heavy metals such as mercury, gold, and cadmium, pesticides, herbicides, hydrazine and certain dyes (47) (48). Infections also are implicated in the pathogenesis of auto immune disease. The classic exam ple is rheumatic fever, which is thought to be a consequence of cross-reactivity or molecular mimicry between antigens carried by certain strains of streptococci and self-antigens of the heart. A variety of parasitic (e.g. schistosomiasis, Chagas disease) (49, 50),

PAGE 20

20 bacterial (e.g. Helicobacter pylori staphylococci, salmonella, Ly me borreliosis) (51, 52), mycobacterial (e.g. tuberculosis, leprosy) (50), and viral (e.g. cytomegalovirus, Epstein-Barr virus, hepatitis C, coxsackievirus, parvovirus B19) (53, 54) infections can be complicated by autoimmunity. Proposed mechanisms incl ude molecular mimicry and the chronic over-production of cytokines, such as interferon Indeed, therapy with IFN can itself lead to the development of autoimmune diseases su ch as autoimmune thyroiditis and SLE. Autoantibodies in SLE The immunological hallmark of SLE is th e production of autoantibodies. These autoantibodies include antibodies against RNA-pr otein com plexes (e.g. an ti-Sm, RNP, Ro/SS-A, and La/SS-B antibodies) and DNA-protein co mplexes (e.g. anti-double stranded DNA, anti-histone, anti-chromatin anti bodies). The target antigens are found mainly in the cell nucleus, although in some cases (e.g. anti-ribosomal antibodies) they may be cytoplasmic. Over 95% of the SLE patients are positive fo r antinuclear antibodies (ANA), however the specificity of ANA test for SLE is only around 70 % (55). Norm al individuals have an increased frequency of ANA production with aging. Pati ents with scleroderma, polymyositis, and Sjogrens syndrome usually are ANA positive as well (55). Anti-dsDNA, anti-Sm, anti-ribosomal protei n, and anti-RNA helicas e A antibodies are relatively specific for SLE (55). This m akes specifi cities useful diagnosti cally. In some patients the titer of anti-dsDNA antibodies increases wi th disease acitivity, making anti-dsDNA antibody a useful marker for nomitoring lupus fl ares and the response to therapy (56). Type III Hypersensitivity and SLE Tissue damage in autoimmune diseases can occur through several m echanisms, which are analogous to three of the clas sical types of hypersensitivity reactions: Type II (caused by

PAGE 21

21 autoantibodies reactive with cell surface or ma trix antigens), Type III (caused by immune complexes), and Type IV (delayed type hypersensitivity, mediated by T cells). Autoantibodies can cause disease by forming networks of autoantibodies bound to their antigens (im mune complexes). The antigen-antib ody complexes can deposit in tissues, causing inflammatory lesions. Studies of serum sickness led to the first description of an immune complex disease (57). Serum sickness is manife sted by fever, glomerulonephritis, vasculitis, urticaria, and arthritis, appearing 7-21 days after primary immunizati on or 2-4 days after secondary immunization with a foreign protein. Two consequences of immune complex formation are complement fixation and binding to Fc or complement receptors on phagocytes. Clearance is facilitated by the binding of immune complexes to C3b receptors (CR1) on erythrocytes, which retain the complexes in the circulation until their removal by the reticuloendothelial cells of the spleen or liver. Immune complex formation is a normal proces s, which removes foreign antigens from the circulation. Re moval of immune complexes by phagocytes bearing Fc or complement receptors prevents their deposition at othe r sites. The efficiency of uptake of immune complexes by either Fc receptors or CR1 is proportional to the number of IgG molecules associated with the complex. Immune complexes can activate either the clas sical or the alternative co mplement pathway. The classical pathway plays a major role in ma intaining immune complexes in a soluble form, preventing their deposition in tissues. C3b bound to the solubilized immune complexes promotes their clearance by the erythrocyte complement receptor CR1. If the rate of immune complex formation exceeds the ability to clear these complexes via Fc receptors and CR1, the immune complexes can deposit within tissues, leading to inflammation. This efficient immune complex transport and removal by Fc and complement r eceptors can be overwhelmed, however, leading

PAGE 22

22 to tissue deposition and immune complex disease. This situation may result from overproduction of immune complexes, blockade of phagoc ytosis by the reticuloe ndothelial system, or complement depletion resulting in inefficien t solubilization of immune complexes. SLE is the prototype of human immune complex disease. T issue damage in lupus is mainly caused by immune complexes containing autoanti bodies to soluble antigens. Autoantibodies containing immune complexes, especially anti -double stranded DNA antibodies, are selectively enriched in the renal glomeruli of patients with lupus nephritis and are thought to play a critical role in establishing the inflammatory response. Immune complex deposit ion in the kidney leads to proliferative glomerulonephritis and effacement of the normal glomerular architecture. As is the case in serum sickness, active lupus ne phritis frequently is associated with hypocomplementemia. In addition to the kidneys (glomeruli), immunoglobulin and complement deposits are found in blood vessels (vasculitis) skin (rashes), nervous system, and other locations. Preformed immune complexes may become trapped in the glomerular filter or immune complexes may develop in situ as a consequence of the inte raction of cationic antigens (e.g. histones) with heparan sulfate glycosaminogly can in the glomerular basement membrane. Clinical Manifestations As mentioned above, SLE is a complex systemic disease. At onset it m ight just affect one organ system with additional symptoms in other organs appearing later o n. The disease typically follows a relapsing-remitting course. Systemic sy mptoms include fatigue, malaise, weight loss and anorexia and are frequently prominent. Almost all SLE patients experience arthralg ias and m yaligias and eventually develop arthritis. The most common site of swelling jo ins includes proximal interphalangeal (PIP) and metacarpophalangeal (MCP) of the hands, wrists, and knees. Arthritis in lupus is usually non-erosive and symmetric which is diffe rent from rheumatoid arthritis.

PAGE 23

23 The malar rash (referred as butterfly rash which is an erythematosus rash over the cheeks and bridge of the nose) is a typical S LE cutaneous manifestation. A more diffused maculopapular rash can appear on any part of the body and usually exacerbated by UV or sun light exposure. These rashes can be reversed without scarring. Di scoid rashes are different kinds of lesions which are circular with an erythemotous rim, raised and scaly with follicular plugging and telangiectasia. It usually re sults in depigmentation and scar Vasculitic skin lesions are common. These include subcutaneous nodules, ulcers purpura, and infarcts of skin or digits. Renal manifestations are seen in the major ity of SLE patients. Although most SLE patients have imm une complex deposited in glomeruli, not all of them have clin ical nephritis. Patients can be asymptomatic, or may present with prot einuria and edema (nephritic syndrome) or with hematuria, pyuria, and urinary casts (nephritic syndrome). Renal involvement can be severe, and in fact renal failure is one of the major causes of death. Any part of the nervous system including the brain, spinal cord, cran ial, and peripheral nerves can b e involved in SLE. Involvement of thecentral nervous system usually occurs with active disease although mild mental dysfunction is more common and can be seen in the absence of disease activity. Nervous manifestations includ e seizures, psychosis, headaches, focal infarcts, and many others. Depression and anxiety are frequent. Some SLE patients exhibit vasculitis and thrombosis. It is believed that thrombosis is associated w ith production of anti-phospholipids antibodies, whic h promote coagulation. Anemia, thrombocytopenia, and leucopenia (or lymphope nia) is a common finding in SLE patients. Pericardial pain is the most frequent symptom of cardiac lupus. Pleurisy and pleural effusions are not rare; however the most common cause of pulmonary infiltrates in patients with SLE is infection.

PAGE 24

24 Measurement of Disease Activity Measurement of disease activity in SLE is ch allenging becau se of the complexity of the disease manifestations. Almost any organ may be affected. Clinical symptoms of SLE can mimic the appearance of many other diseases. There is no single marker that adequa tely reflects disease activity. Several systems have been developed to asse s s of disease activity in SLE. The most commonly used ones are the Systemic Lupus Erythematosus Disease Activity Index (SLEDAI), the British Isles Lupus Assessment Group (BIL AG), the Systemic Lupus Activity Measures (SLAM), the European Consensu s Lupus Activity Measurement (ECLAM), and the SLE Index Score (SIS) by National In stitute of Health. SLEDAI is the most commonly used disease act ivity m easure. It was initially proposed in 1992 by Bombardier et al in Canada (58). It is an index that we ights the importance of different organ involved. There are 24 organ criteria, each weighted from 1 to 8 points. The sum of the total score falls between 0 and105 with a higher score representing more active disease. It is relatively easy to perform and is reliable a nd reproducible. However the SLEDAI system does not take into account severity already exist or pa rtial improvement of a particular manifestation. The SLEDAI also does not account for subjectiv e symptoms such as fatigue or myalgia. The SLAM index was design to assess the sever ity of disease (59). 32 criteria are d ivided into 11 organs systems and a numeric score (1 -3) is given according to the severity of manifestation of a particular organ, and the possible score is as much as 86. Although the SLAM is considered a measurement of severity, it gives equal weight to mild and serious manifestation. The BILAG was developed by Symm ons et al in 1988 (60). It is a com prehensive scoring system for assessing both current lupus disease activity and changes in that activity since the patient was last seen. It is base d on the intention of the physicians intention to treat. The newest

PAGE 25

25 version of the BILAG was released in 2004. Ther e are eight systems: general, mucocutaneous, neurological, musculoskeletal, ca rdiorespiratory, vasculitis, renal and haematological. A score is calculated for each system depending on the clinical features present and whether they are new=4, worse=3, the same=2 or improving=1 in th e last 4 weeks compared to the previous measures. Scores for eight different or gan systems are calculated separately. Current Treatment Treatments for autoimmune disease are divers e and in recent years the options have increased rapidly. The m ajority of systemic autoi mmune diseases, such as SLE, are treated with immunosuppressive medications. Immunosuppressive medications can be categorized by mode of action. Anti-inflammatory agents Nonsteroidal anti-inflammatory drugs (NSAID s) have been used since the 1800s when salicin was extracted fro m willow bark (1828) an d sodium salicylate (1875) and aspirin (1899) were synthesized. A large number of these drugs, whic h either selectivel y or non-selectively inhibit the enzyme cyclooxygenase (COX, a synthetic enzyme for prostaglandins), are currently in use for the treatment of inflammatory dis ease. Although most of their anti-inflammatory properties derive from the inhibition of prostaglandin synthesis, at high doses there is inhibition of the transcription factor NF B, a key mediator of inflammatory cytokine production. Corticosteroids have a more potent effect on NF B and consequently a greater anti-inflammatory effect. The anti-inflammatory properties of cortisone were discovered by Hench in 1949 (61). Corticos teroids are a mainstay of therapy for many systemic autoimmune diseases, including SLE, rheumatoid arthritis, and inflammatory m yopathies such as polymyositis. Corticosteroid therapy also is used for the treatment of some of the more serious organ specific autoimmune

PAGE 26

26 diseases, such as autoimmune hemolytic anemia, autoimmune thrombocytopenia, multiple sclerosis, and Goodpastures disease. Cor ticosteroids reduce inflammation by multiple mechanisms of action. One major action is enha nced transcription of an inhibitor of NF B called I B. I B dimerizes with NF B, inhibiting the production of infl ammatory cytokines mediated by this transcriptional pathway (62). In addition, corticosteroids promote the differentiation of a subset of anti-inflammatory macrophages that produce the cytokine IL-10 (63). Antimalarials Antimalarials have been used for the treatmen t of SLE and rheumatoid arthritis (RA) since the early 1900s. The precise mechanism of action remains uncertain, but they have been shown to inhibit cytokine (IL -1 and IL-6) production in vitro (64). The antimalarials pass freely through cell membranes at neutral pH, but in acidic e nvironments, such as endosomes, they become protonated and can no longer diffuse freely. This leads to concentration of the drug within endosomes and the collapse of e ndosomal pH gradients (65). It has been proposed that the inhibition of endosomal acidification interferes with antigen processing or alternatively, that there is an effect on the interaction of microbial substances such as unmethylated CpG DNA or uridine-rich RNA with endosom al Toll-like receptors (TLR9 a nd TLR7/TLR8, respectively) (66). In addition to SLE and RA, antimalarials are us ed in the treatment of juvenile rheumatoid arthritis, Sjogrens syndrome, and inflammatory myopathies. Anti-cytokine agents The development of TNF inhibitors in the 1990s ushere d in a new era of therapy of autoimm une disease using biologicals capable of interfering with the interactions between cytokines and their receptors. The initial clinical use of TNF inhibitors such as etanercept (a soluble recombinant TNF receptor II linked to the Fc portion of human IgG1) (67), infliximab (a chimeric human-mouse anti-TNF monoclonal antibody) (68), and adalimumab (a fully

PAGE 27

27 humanized monoclonal antibody against TNF ) (69) in RA demonstrated that although multiple cytokines may be involved in disease pathogenesis (in RA, IL-1 and IL-6 in addition to TNF ), inhibitors of a single cytokine pathway may sh ow therapeutic efficacy. In addition to RA, TNF inhibitors are used for treating in flammatory bowel disease, psoria sis and psoriatic arthritis, and are being tested in sarcoidosis, Wegeners gr anulomatosis, pyoderma gangrenosum, SLE, and Behcets disease. Usage of TNF inhibitor in SLE is controversial since TNF has been shown to have inhibitory effect on IFN production. Anti-TNF therapy is only the tip of the bio log ical iceberg. Reco mbinant IL-1 receptor antagonist (anakinra) has been approved for the treatment of RA and nu merous other cytokine antagonists are curre ntly in clinical trials or under development. Methotrexate Methotrexate is a folic acid analog used extens iv ely for the treatment of RA. It appears that its ability to inhibit dihydrofol ate reductase is not responsible for its efficacy in RA. Instead, activity may be related to effects on aminoi midazole-carboxamide-ribotide-transformylase, leading to the release of adenos ine, a potent anti-inflammatory mo lecule that inhibits neutophil adherence to fibroblasts and endot helial cells (70). Methotrexate in hibits IL-1 and increases the expression of TH2 cytokines (e.g. IL-4), leadi ng to decreased production of TH1 cytokines (e.g. interferon ) (71). Anti-T Lymphocyte therapy T cells play a key role in the pathogenesis of Type IV autoim mune reactions and also are critical for generating the T cell-dependent autoantibodies mediating Type II and Type III autoimmune diseases. Consequently, considerab le effort has gone into the development of therapeutic agents that selectively or non-selectively target T lymphocytes. Drugs that target primarily T cells include cyclophosphamide, azathioprine, cyclosporin A, tacrolimus, and the

PAGE 28

28 biological CTLA4-Ig. Cyclophosphamide is an alkyl ating agent that substit utes alkyl radicals into DNA and RNA. The drug is inactive by itself, but is converted to an active metabolite responsible for its immunosuppressive effects. It is used for the treatment of lupus nephritis and other life-threatening comp lications of SLE (72). Azathioprine is a purine analog th at inhibits the synthesis of adenosine and guanine. L ike cyclophosphamide, it is converted to an active metabolite (6-mercap topurine), which inhibits the division of activated B and T cells. Azathioprin e is used in the treatment of RA, SLE, autoimmune hepatitis, inflammatory myopathy, vasc ulitis, and other autoimm une disorders (73). Unlike cyclophosphamide and azathioprine, cy closporin and tacrolim us (FK506) have immunosuppressive effects that ar e highly selective for T cells. Bo th agents interfere with the phosphatase calcineurin, ultimately l eading to the inhibition of the activation of the transcription factor NFAT (nuclear factor of activated T cells). Cyclosporin binds to the intracellular protein cyclophilin and tacrolimus to a protein called FK binding protein. The cyclosporin-cyclophilin and tacrolimus-FK binding protein complexes bind to calcineurin, prev enting its activation by intracellular calcium, preventing the activation of NFAT (74). Although used most frequently to prevent transplant rejection, thes e agents have been shown to have activity in the treatment of RA, SLE, and certain forms of vasculitis (75). The CTLA4 (CD152) molecule is an inhibitory receptor expre ssed by activated T cells that blocks the co-stimulatory interaction between CD80 or CD86 on the surface of antigen-presenting cells and CD28 on T cells. It acts by bi nding CD80/CD86 with greater affinity than CD28. CTLA4 is expressed late in T cell activati on, and serves to turn off the activated state. CTLA4-Ig (abatacept) is a reco mbinant chimera of CTLA4 and the Fc fragment

PAGE 29

29 of IgG1. CTLA4-Ig/abatacept is us ed for the treatment of rheumato id arthritis and is active in mouse models of lupus (73). Clinical trials in SLE patients are in progress. Anti-B Lymphocyte therapy Rituximab is a cytotoxic chimeric human-m ouse monoclonal antibody with a high affinity for CD20, a pan-B cell surface antig en. It was deve loped originally for the treatment of B cell lymphomas (76). The killing of B cells by rit uximab is thought to depend on both the specific recognition of B cells by this monoclonal anti body and natural killer (NK) cell-mediated antibody-dependent cellular cytoto xicity (ADCC) of those cells. Th ere is considerable evidence that the interaction of B cell-bound monoclonal antibod ies with NK cell CD16 (Fc RIIIA) is a critical event leading to ADCC following treatm ent with rituximab (77). Rituximab has been shown to have activity in a variety of autoi mmune diseases associat ed with autoantibody production, including RA, SLE, polymyositis/der matomyositis, Sjogrens syndrome, and cryoglobulinemic vasculitis (78). Intravenous immunoglobulin (IVIG) IVIG is a preparation of human immunoglobulin pooled from thousands of healthy individuals. It was originally developed for replacem ent therapy in humoral immunodeficiency syndromes, but has more recently become an important therapeutic modality in severe autoimmune disorders, such as thrombocytopenic purpura, autoimmune hemolytic anemia, neuroimmunological diseases such as Guillain-Barre syndrome, SLE, certain forms of vasculitis, and polymyositis/dermatomyositis. The mechanism of action remains unclear, but IVIG may block the function of Fc receptors expressed by ph agocytes of the reticuloendothelial system and also induces Fc RIIB (inhibitory Fc receptor) expre ssion on infiltrating macrophages in the K/BxN model of RA (79). An additional m ode of action may involve the presence of anti-idiotypic antibodies that bl ock the antigen combining sites of pathogenic antibodies (80).

PAGE 30

30 The duration of action is limited by the meta bolism of serum immunoglobulin, and generally IVIG is regarded as a temporary measure that is follo wed by more definitive therapy. Animal Models of SLE Spontaneous SLE models have offered an appropriate starting point to investigate the effects of environm ental agents on genetic sus ceptibility and autoimmune disease progression. The NZB/W model was the first murine model de scribed for lupus nephritis. It is the F 1 hybrid of the New Zealand Black mice which de velop autoimmune hemolytic anemia and New Zealand White mice which spontaneously develop mesangial glomerulonephr itis (GN) late in life. The F1 hybrid termed NZB/W mice has dis ease closely resembled human lupus, including the production of autoantibodies (ANA, anti-chro matin, anti-dsDNA) and the deposition of the immune complexes on the glomerular basement me mbrane, result in a severe glomerulonephritis. Genetic analysis has revealed three major suscep tibility loci on chromosomes 1, 4 and 7 related with SLE (81). MRL/ lpr mice develop an autoimmune disorder characterized by marked hypergammaglobulimenia, production of autoantibodi es, and very impressive lymphadenopathy. This results from an ETn retrotransposon inser tion into the Fas gene which encodes a protein important for apoptosis (82). The defec tive apoptosis leads to the massive CD3+ CD4 CD8 cell proliferation. There also are some simila rities with human cutaneous lupus including microscopic changes and IgG deposits at the de rmoepidermal junction (83). The inflammatory response in the salivary glands also makes the MRL/lpr mice a model useful for studying Sjogrens syndrome (84). Unlike other mouse model and human SLE, m ale, but not female BXSB mice develop severe form of lupus. This strain was created by crossing male SB/Le mice and female C57BL/6J mice. A mutant gene located on the BX SB Y chromosome, designated Yaa (Y

PAGE 31

31 chromosome-linked autoimmune acceleration), is re sponsible for the acceleration of the disease observed in male BXSB mice. Male BXSB mice exhibit lymph node enlargement, autoimmune hemolytic anemia, hypergammaglobulinemia, sp lenomegaly, production of autoantibodies and severe glomerulonephritis (85). Recently it was found that the phenotype of mice with the Yaa mutation results from translocation of a 4-me gabase portion of the X chromosome to the Y chromosome, leading to an increase in the expre ssion of several genes that are normally X linked, including TLR7. It can be shown th at the autoimmune defect is due to the extra copy of TLR7 in these mice (86). Intraperitoneal injection of pristane ( 2,6,10,14 tetram ethylpentadecane, TMPD) can induce lupus like syndrome in normal mice (87). Pris tane-treated BALB/c and SJL mice develop autoantibodies characteristic of SLE, incl uding production of auto antibodies, a severe glomerulonephritis with immune complex de position, mesangial or mesangiocapillary proliferation, and proteinuria. Noticeable production of anti Sm/RNP and anti Su antibody and interferon signature is seen in TMPD treated mice which closely resembled human SLE (87). Type I Interferon Type I interferons (IFN-I), including multiple IFN subtypes, IFN IFN and IFN have m any immune effects. IFN-I (IFN ) was first identified in fibrobl asts by Isaacs and Lindeman in 1959 and termed viral interference factor (88, 89 ). However, Type I IFNs also are produced by leukocytes and other cells and it ha s been recognized that in addi tion to antiviral effects, IFN-I has protean effects on immune function and cell su rvival. IFN-I induces MHC class II expression on antigen presenting cells (APCs), promotes dendrit ic cell (DC) maturation, and the survival of activated T cells and antigen-activated B cells. A dditionally, IFN-I can eith er promote or inhibit apoptosis (90).

PAGE 32

32 All IFN-I species bind to a single receptor com posed of two subunits, IFNAR1 and IFNAR2 (91, 92). Interactions of Type I IFNs with the IFNAR cause reciprocal transphosphorylation of the non-r eceptor tyrosine kinases Tyk2 and Jak1, leading to receptor phosphorylation and phosphorylation of transcription factor Stat1 and Stat2. IFNAR1 interacts with Tyk2 and IFNAR2 with Jak1, Stat1, and Stat2 (93). Phosphorylation of Stat1/Stat2 leads to the activation of interferon regulat ory factors (IRFs), such as IRF9, to form the heterotrimeric complex IFN-stimulated gene factor 3 (ISGF3) The ISGF3 then binds to upstream regulatory consensus sequences of IFN/ -inducible genes (IFN-stimulated response elements, or ISRE) and initiates transcription of a group of interferon inducible genes (ISGs) (94) (Fig.1-3). Up to 100 ISGs have been identified. Am ong them, a group of secondary anti-viral response genes, such as the 2-oligoadenyl ate synthetase (O AS) family, RNase L, dsRNA dependent protein kinase (PKR), and the GTPase Mx1 (protein product Mx A) are best studied (95). MxA is a large GTPase that interferes with viral transcripti on and replication (96). Mx1 gene expression is tightly regul ated by IFN-I but not other cyt okines, making it a good candidate for estimating IFN-I level. Additionally it has be en reported that the level of the MxA protein (determined by ELISA) can be used as a very sensitive and selective bioassay for Type I IFN levels (97). Induction of IFN-I IFN-I is a key mediator of host defense to viral and bacterial inf ection. At least three pathways had been shown to induce the production of IFN-I. These pathw ays utilize distinctive adapter proteins: MyD88, TRIF, IPS-1 and TBK-1 (98, 99). Toll-like Receptors Dependent Pathways TLRs are pattern reorganization receptors recognizing m olecule s that are shared by groups of related pathogens (patterns). Thirteen TLRs ha ve been identified in mammals (100), and these

PAGE 33

33 receptors are the first line of host defense and play an important role in innate immunity. Each of the TLRs responds to a specific ligand or ligands. TLR 1, 2, 4, 5, 6, and 11 are expressed on cell surface, and detects lipids, lipoproteins or pe ptidoglycans shared by extracellular pathogens including bacteria, fungi or pr otozoa. TLR 7, 8 are intracellular and can be activated by GU-rich ssRNA. Intracellular TLR9 is activated by unmet hylated DNA which is distinguishable from mammalian methylated DNA. Whether TLR3 express on cell surface or intracel lular is debatable, and it binds to double stranded RNA and its analog Polyinosinicpol ycytidylic acid (poly (I:C)) (PIC). TLR8/10 is expressed in humans, but not mice, and the ligand for TLR10 remains unknown. TLRs 11, 12, and 13 are expressed in mice but not humans (100-102). All TLRs express TLRinterleukin-1 recep tor (T IR) domains which will undergo dimerization and conformational changes upon ac tivation. TIR domains can bind to several specific adaptors, such as TRIF (TICAM1), TRAM (TICAM2), TIRAP (Mal), and MyD88. Plasmacytoid dendritic cells, known as profe ssional IFN-I producing cells, express T LR7 (both mouse and human)/TLR8 (human) and TLR 9 but not TLR2, TLR3, TLR4, or TLR5 (103). Unmethelated CpG DNA motif stimulates TLR 9, and TLR9-induced IFN production is MyD88 dependent but not TRIF dependent. Lysosomal inhibitors such as chloroquine block TLR9 induced IFN-I production, indicating the reorganization of TLR9 ligand involvement of endosome (104). In addition, single-stranded RNAs rich in GU or U sequences also stimulate IFN-I production throug h interactions with TLR7 and/or TLR8. Imidazoquinolones, such as imiquimod, also engage these receptors, stimul ating IFN-I production. Th e activation of TLR7/8 is also dependent on MyD88 (Fig 1-1) (66, 105). Upon activation, TRL7/8/9 recruits and bind to an adaptor protein myeloid differentiation primary response gene 88 (Myd88) after dimerization of TIR. MyD88 in turn forms a complex with me mbers of the IL-1 receptorassociated kinase

PAGE 34

34 (IRAK) family (IRAK1 and IRAK4) and TRAF 6, which lead to the activation of I B kinases (IKKs) IKK and IKK Phosphorylated IKKs degrade NFB inhibitor I B, allowing nuclear factor NFB to translocate into the nucleus (106, 107). Transcription factor IRF7 forms a complex with activated MyD88, and then can be phosphorylated by IRAK1 though the MyD88 dependent pathway leads to the production of IL-6, TNF and IFN-I (107). In addition to TLR7/8 and TLR9, activation by ligands of TLR3 and TLR4 can induce the production of IFN-I as well. TRL3 uniquely si gnals through adaptor pr otein TRIF, and it is independent of MyD88. TRIF inte racts with TB K1 and IKKi whic h leads to the activation of transcription factor IRF3 ( 108). TRIF also mediates NFB activation through non-TIR region with PIP1 as well as TRAF6. TLR4 can signal through both MyD88 dependent and independent pathway (109). Activation of TLRs leads to initial production of IFN which in turn b inds to the Type I IFN receptor (IFNAR), acting in an autocrine manner to induce the expression of a set of secondary antiviral response genes, such as MxA/Mx1, Irf7 and Oas. Expression of these genes is tightly regulated by IFN-I (94). Toll-like Receptor Independent Pathway Its been increasingly clear that cytosolic RNA helicases, retinoic acidinducible gene (RIG-I) and m elanoma differentiationassociated gene 5 (MDA5, also called Helicard) can induce IFN/ induction independent from TLRs (110-112). RIG-I contains a extreme C-terminal repression domain (RD), two caspase recruitment domains (CARD) in the N terminus. In the absence of appropriate ligands, RIG-I is self locked in an autorepressed conformation through binding of RD with CA RD though linker region between the RNA helicase domains III and IV (cis repression) (113, 114). Upon activat ion, RIG-I and MDA5 can bind to their RNA

PAGE 35

35 ligand, and leads to a conformati on change and dimerization of RIG-I, and become associated with CARD to mitochondrial MAVS (also known as IPS-1, VISA or Cardif). This triggers activation of the protein kinases TBK1 and IKK and in turn activates tr anscription factors IRF3 and IRF7, leading to IFN/ expression. It al so activates NFB and AP-1 through IKK / / RIG-I and MDA5 are upregulated by IFN/ through a positive feedback mechanism (115, 116). RIG-I recognizes cytosolic uncapped ssRNA with 5 -triphosphates which is generated by som e virus such as influenza, Senda virus, vesi cular stomatitis virus (VSV), rabies virus, and viruses of the Flaviviridae family, includi ng hepatitis C virus (HCV)(117), whereas MDA5 might recognize viruses with protected 5' RNA ends, such as in picornaviruses (112, 118, 119). Some studies suggested MDA5, but not TLR3, seems to be the dominant receptor for polyI:C in vivo (120). LGP2 is a RIG-I/MDA5 inhibitor which is a RNA helicase that is hom ologous to RIG-I and MDA5, but lacks CARD domains. It acts in similar fashion as the RD domain of RIG-I that blocks the RIG-I activ ity by binding with CARD The RIG-I/MDA5 pathway is essential for IFN/ production by fibroblasts, co nventional splenic and thymic DCs and macrophages, but not PDCs (113, 114, 121). Crosstalk of Type I Interferon and Other Cytokines IFN/ is expressed in low levels constitutively. Basal IFN/ expression is required for rapid production of cytokines in response to viral infecti on; it also appears to be required for efficient IFNsignaling (122). Not only are IFNAR -/cells unresponsive to IFN / but they are defective in IFNresponses as well (123). Because thes e cells fail to induce dimerization of STAT1, it is thought that IFNAR signaling induced by spontaneous low levels of IFN/ (which is not enough to activate downstream si gnaling events), provi des docking sites on

PAGE 36

36 tyrosine residues of IFNAR1 for more efficient STAT1 recruitmen t after stimulation through the IFNreceptor (IFNGR). This cooperation is depe ndent on the interaction between the IFNAR1 chain and the IFNGR2 chains on caveolar membra ne domains, which alon g with the increased STAT1 recruitment leads to at l east a ten fold increase of IFNsignaling (124). IFN/ signaling also upregulates IFNproduction by T cells favoring the induction and maintenance of Th1 cells (124). Convers ely, pretreatment of IFNincreases signaling through IFNAR by upregulating STAT1 expression ( 124). Other studies suggest th at upregulation of ISGF3 may enhance IFN-I signaling (125). The effect of STAT1 depends on the activation of tyrosine kinase Syk (126). Thus, type I and II IFNs reciprocally influence both the production of one another and signaling through the respective receptors. Type I IFNs can also influence the expression and function of a num ber of other cytokines. Basal levels of IFN/ enhance IL-6 signaling by providing docking sites for STAT1 and STAT3 on the phosphorylated IFNAR1 (127). In addition, IFN-I stimulates production of anti-inflammatory cytokines, such as transforming growth factor (TGF) (128), and IL-1 receptor antagonist (129). Besides favoring the production Th1 cytokines, it also inhibits Th2 cytokines IL-4 and IL-12 signaling by inducing SOCS-1 expres sion (130). A low concentration of IFN/ also upregulates expression of the high-af finity IL-12R 2 subunit on CD4+ T cells and IL-15 expression by DCs, causing strong and selectiv e stimulation of memory CD8+ T cells.(131) IL-10 reduces IFN-I signaling by suppressi ng the phosphorylation of STAT1 favoring Th2 polarization (132). Similarly, r eciprocal suppression of IFN/ and TNFproduction has been reported. It has been proposed that the relativ e abundance of these two cytokines may influence the type of autoimmune di sease. For example, IFN/ predominantly leads to lupus and TNF

PAGE 37

37 leads to RA (133). The successful treatment of RA with TNF inhibitors and the fact that these drugs can worsen SLE supports possibility (134, 135). However, the role of TNFin lupus is controversial, since other st udies have shown that TNFmay also have a proinflammatory effects in lupus. In fact, there are also reports of beneficial effects of TNFinhibitor in lupus patients (136). Type I Interferon is Involve d In Pathogenesis of SLE Several studies have suggested that IFN-I is invo lved in the pathogenesis of SLE. Patients treated with IFN for m alignant carcinoid syndrome or he patitis C infection sometimes develop antinuclear antibodies or even overt SLE (137-139). In the course of IFN therapy of carcinoid tumors, as many as 22% of patients develop ANA, 8% develop anti-dsDNA antibodies, and 0.7% develops lupus (139). Serum levels of IFN correlate with anti-dsDNA antibody levels and disease activity in SLE and incr eased IFN-I expression is seen in lupus skin lesions (140). Moreover, recent studies point to an IFN-I gene expression signature associated with SLE (141, 142). Our laboratory has reported that the intraper itoneal injection of pristane in BALB/c and other non-autoimmune strains of mice results in the production of autoantibodies characteristic of SLE, such as anti-Sm, anti-nRNP, anti -dsDNA, and anti-ribosomal P as well as immune complex-mediated glomerulonephritis resembling lupus nephritis (87). We have found recently that IFN-I inducible gene expr ession is greatly up-regulated in pristane treated mice (39). Interestingly, TLR4 deficient mice are less susc eptible to pristane induced lupus and TLR7 deficient mice are highly resistant, arguing th at TLR signaling may play a role in the pathogenesis of dysregulated IFN-I producti on in lupus (Lee et al, submitted).

PAGE 38

38 Subsets of Dendritic Cells (DCs) Produce IFN-I DCs are professional antigen presenting cells that serve as na tures adjuvant. Immature DCs reside in the periphery and afte r interacting with a maturation s timulus, such as TLR ligands or TNF migrate to secondary lymphoid tissues where they undergo maturation (143, 144). Maturation is accompanied by the down-regulation of phagocytic activity and a concomitant upregulation of MHC class I and class II expr ession (145, 146). Thus, DCs mature from cells specialized in antigen sampling to cells specia lized for antigen presentation to nave T cells (147). DC precursors derived from bone marrow migrate to the periphery where they sample antigen. Once they capture antigen and receive an activation signal, they migrate to secondary lymphoid organs. Immature DCs express low levels of MHC I and II molecules, the co-stimulatory molecules CD80 and CD86, a nd adhesion molecules important for their interactions with T cells. They also express certain chemokine recepto rs, such as CCR1, CCR2, CCR5, CCR6, CXCR1, and CXCR2, whic h mediate their migration into sites of inflammation where the ligands for these receptors, such as MIP-1 and CCL5 (RANTES), are expressed. Human blood contains two major subsets of DC : CD11c (-) CD123 (+) plasmacytoid dendritic cells (PDCs) [also BDCA-2 (CD302) and BD CA-4 (CD304) positive] and CD11c (+) CD123 (-) myeloid dendritic cells (MDCs) [also BDCA-1 (C D301) positive]. They lack lineage markers of T cells (CD3), B cells (CD19), monocytes (CD14), and NK cells (CD56) (147, 148). Some studies have shown that CD14+ monocytes can serve as MDC precursors, differentiating into MDC under the influence of GM-CSF and IL-4 ( 149). Monocytes also differentiate into DC when incubated with GM-CSF and IL-3, or SLE serum, and this is thought to be due to IFN-I (150, 151).

PAGE 39

39 Although most, if not all, nucleat ed cells are capable of producing IFN-I, the existence of a m inor population of cells in the peripheral blood that produces large amounts of IFN-I was recognized about 20 years ago (152). These i nterferon producing cells (IPCs) have only recently been shown to be PDCs (153). In res ponse to viral infection or oligonucleotides containing unmethylated CpG motifs, PDCs produce ~1000-fold more IFN-I than most other cell types (153). However, MDCs also can pr oduce large amounts of IFN-I in response to intracellular viral inf ections (154-156). MDCs produce IF N-I following electroporation or lipofection of the double-stranded (ds) RNA analog PIC in amounts comparable to that of PDCs stimulated with CpG DNA (154). Unlike PDCs, which are activated following endosomal uptake of bacterial DNA or ssRNA in a chloroquine-dep endent manner, MDCs are activated following cytoplasmic (non-endosomal) recognition of dsRNA mediated by the cytosolic enzyme protein kinase R (PKR) and/or DAI (154, 157). DCs also express different subsets of su rface receptors m ediat ing innate immunity. Specifically, PDCs express large amounts of TLR7 and TLR9, whereas MDCs express TLR3, TLR4, and TLR8 (147). Thus, PDCs are stimul ated preferentially by viral GU-rich single-stranded RNA and unmethyl ated CpG DNA, whereas MDCs are stimulated preferentially by dsRNA and LPS. In view of the correlation between TLR expression and responsiveness of different types of DCs to microbial stimuli, the differential expression of TLRs is likely to play a significant role in the regulat ion of IFN-I production by DCs ( 147). There is evidence that signaling from TLRs can vary depending on the cell type or maturation state (144). Once activated, immature DCs down-regul ate CCR1, CCR2, CCR5, CCR6, CXCR1, and CXCR2, and up-regulate CCR7, a receptor for CCL21 (SLC) and CCR19 (ELC) (147). SLC is produced by high endothelial venules in the secondary lymphoid organs and ELC is expressed in

PAGE 40

40 T cell zones of the secondary lymphoid tissues. Thus, mature MDCs and PDCs migrate to SLC and ELC, which is mediated in part by incr eased expression of CC R7. Strikingly, although immature PDCs express high levels of CCR7, a maturation signal is required to couple CCR7 to cell migration (148). MDCs respond to CCL2/MCP-1, CCL20/MIP-3 whereas PDCs do not respond to these chemokines, although they expr ess the corresponding chemokine receptor (158). Thus, not only must the appropriate receptor be expressed in order for DC migration to take place, but the signal must be coupled to cell migration by mechanisms that remain poorly defined.

PAGE 41

41 Figure1-1. Toll like receptor si gnaling pathway and induction of type I interferon. Engagem ent of TLR3 by dsRNA, TLR7/8 by ssRNA or TLR9 by CpG DNA in endosomes and of TLR4 by LPS at the cell surface mediates IFN/ production. TLR3 utilizes a TRIF-dependent pathway, whereas TLR7/ 8 induces a MyD88-dependent pathway. TLR4 can signal through both TRIF and MyD 88 pathways. The activation of adaptor protein TRIF and MyD88 can in turn activate transcription factor NF B and IRF3, which induces the production of IL-6, TNF and type I interferon. TLR9 TLR 7/8 TLR4 TLR3 M y D88 TRIF IL-6 TNF IFN / IRF3 LPS dsRNA C p G ssRNA NF B Cell Membrane Endosome

PAGE 42

42 Figure 1-2. Production of IFN-I induced by TLR independent pathway. Engagem ent of RNA with the cytosolic RNA helicases RI G-I and MDA5 induces activation of RIG-I/MDA5, and allow CARD disassociate with RD, and CARD in turn interacts mitochondrial adaptor MAVS (IPS-1). MAVS then activates NF B through IKK / / with cooperation of RIP and FADD. It also induces IRF3 phosphorylation through TBK-1/IKK In addition, MAVS also activates MAPK and AP-1. Translocation of these transcription factors to the nu cleus then induce Ifnb1 transcription. RIG-I MDA-5 MDA-5 RIG-I CARD CARD CARD CARD CARD dsRNA MAVS (IPS-1) Mitochondrion TBK-1 IRF3 NF B AP-1 Production of IFN-I FADD RIP IKKi I K K MAPK MAPK MAPK Cell Membrane

PAGE 43

43 Figure 1-3. Type I interferon signaling. IFN-I bind to hetero geneous interferon receptor com posed by IFNAR1 and IFNAR2, which induces conformation change of IFNAR and recruits adaptor protein Jak1 and Tyk2. Phosphorylation of Jak1 and Tyk2 in turn recruits STAT1/2. IRF9 phosphorylates STAT1 and STAT2 and form a complex with these molecules which translocates to nucleus and bind to RSRE9, inducing the transcription of downstream IS Gs including Mx1, OAS etc. IFNAR1 Jak1 STAT2 STAT1 Cell Membrane IFNAR2 IFN / TYK2 STAT2 STAT1 IRF9 IRF9 ISRE9Cytoplasm Nucleus ISGs (Mx1, OAS) P P P P

PAGE 44

44 CHAPTER 2 MATERIAL AND METHOD Subjects Subjects seen at the University of Florida Ce nter for Autoimmune Disease were classified as having S LE, scleroderma, Sjogrens syndr ome, polymyositis/dermatomyositis, rheumatoid arthritis, mixed connective tissue disease, or undifferentiated connectiv e tissue disease using established criteria (2). Patient demographics are summarized in Table 2-1. Disease activity was assessed by SLEDAI and renal disease was scored as described (58). Subjects were questioned about viral or bacterial infections within 2 w eeks and medication use. Self-reported ethnicity of each subjects grandparents was r ecorded along with the subjects birth date. These studies were approved by the University of Florida Institutional Review Board. Reagent Polyinosinic-polycytidylic acid [poly (I:C)] and L PS ( Salmonella minnesota Re 595) were from Sigma-Aldrich (St. Louis, MO). Cp G oligodeoxyribonucleotide (ODN #2006,) was from Coley Pharmaceutical Group (Wellesley, Massa chusetts) and CpG oligodeoxyribonucleotide (ODN #2216, 2395, 2336) are from Invivogen (Carls bad, CA). Serum-free lymphocyte medium AIM-V and LMG-3 was from Invitrogen Life Technologies (Carlsbad, California). Antibodies against Lin-FITC (a cocktail of anti-CD 3, -CD14, -CD16, -CD19, -CD20, and -CD56), CD123-PE, CD11c-APC, HLA-DR-PerCP were fr om BD-Biosciences (San Diego, CA). anti-CD14-FITC, anti-CD71-PE, anti-CD36APC, anti-CD33-APC, anti-CD45RA-PB, anti-CD163-biotin, anti-CD62L -AF750, anti-CD64-FITC, antiCD16-APC-Cy7 antibodies are from eBioscience (San Diago, CA), anti-CD117-APC antibody is from Biolegend (San Diego CA), anti-BDCA-2FITC, anti-BDCA-4-APC, anti-CD123-APC antibodies are from Miltenyi Auburn CA)

PAGE 45

45 RNA Preparation Peripheral blood from SLE patient s, patients with other autoimmune disease, and healthy controls was collected into PAXgene blood RNA tubes and tota l RNA was isolated using the PAXgene RNA kit (Qiagen, Valencia, CA). In other experiments, cultured or fragm ented peripheral blood cells were lysied in Trizol reagent (Invitrogen) and RNA were isolated as manufactures instruction. RNA (1 g) was treated with DNase I (Invitrogen) to remove genomic DNA and reverse transcribed to cDNA us ing Superscript First-St rand Synthesis System (Invitrogen) for RT-PCR. Real-Time PCR Gene expression was determined by real-time PCR using SYBR green (A pplied Biosystems, Foster City, CA). Primers used in thes e experiments are listed in Table 2-2. One L of cDNA was added to a reacti on mixture containing 3 mM MgCl2, 1 mM dNTP mixture, 0.025 U of Amplitaq Gold, SYBR Gr een dye (Applied Biosystems), optimized concentrations of specific forward and reverse primers, and DEPC-treated water in a final volume of 20 l. Amplification conditions were as follows: 95C (10 min), followed by 45 cycles of 94 C (15 sec), 60 C (25 sec), 72 C (25 sec), with a fi nal extension at 72 C for 8 minutes. Transcripts were quantified using the comparative (2 Ct) method. In some experiments, Mx1 and -actin expression levels were determined by real-time PCR with LUX primers and platinum PCR supermix kit (Invitrogen). Amplifi cation conditions were as follows: 50 C (2 min), 95 C (2 min), followed by 45 cycles of 95 C (15 sec), 55 C (30 sec), 72 C (30 sec), and a final extension at 72 C for 8 minutes.

PAGE 46

46 Effect of Corticosteroids and Anti malarials on Cytokine Production PBMCs from healthy controls we re prepared within 2 hours of collection from heparinized blood by Ficoll-Hypaque density gradient centri fugation. They were cultured for 6 hours at 1.5-2.5 106 /ml in the presence or absence of dexamethasone (0.1 or 10 g/ml) or hydroxychloroquine (0.1 or 10 g/ml) or were pre-incubated with dexamethasone or hydroxychloroquine for 1 hour before stimula tion with LPS (100 ng/ml), poly (I:C) (50 g/ml), loxoribine (50 g/ml) or CpG ODN #2006 (10 g/ml) for 6-hours. RNA was extracted using TRIzol, and gene expression was measured as above. In other experiments, PBMCs were cultured with 0.01, 0.1 or 1 g/m l of dexamethasone for 6, 16, 48 hours. 50 l of cells were used in the following flow cytometry. The rest of cells were lysed in Trizol and culture medium was collect for ELISA. Serological Testing ANA were tested by immunofluor escence using HeLa cells as substrate (serum dilution 1:160) and Alexa 488-conjuga ted goat anti-human + light chain antibodies (1:50 dilution, Molecular Probes, Eugene, OR). Cells were mounted in Vectashield containing DAPI (Vector Laboratories, Burlingame, CA) to stain DNA. Anti-nRNP, -Sm, -Ro (SS-A), and -La (SS-B) autoantibodies were detected by immunoprecipitation of [35S] labeled K562 (human erythroleukemia cell) extract as described (159). Anti-dsDNA, an ti-RNP, -Sm, -Ro (SS-A), and -La (SS-B) autoantibodies anti bodies were quantified by ELISA. Flow Cytometry Heparinized blood was processed within 4 hour s and m ononuclear cells were isolated on Ficoll-Paque Plus (Amersham Bi osciences, Piscataway, NJ), washed, and resuspended in PBS + 3% fetal bovine serum. The equivalent of 0.1 ml of starting whole blood was stained with saturating amounts of antibodies (BD Bioscience s). For dendritic cell characterization, this

PAGE 47

47 consisted of Lin-FITC (a cocktail of anti -CD3, -CD14, -CD16, -CD 19, -CD20, and -CD56), anti-CD123-PE, anti-HLA-DR-PerCP, and anti-CD11c-APC. Following incubation for 30 min at 4oC in the dark, the cells were rinsed in PBS and fixed in 2% paraformaldehyde. Samples were run on a four-color FACSCalibur flow cytome ter (BD Biosciences). At least 100,000 events were acquired per sample. In parallel, the red blood cells from 100 l of whole blood was lysed (BD FACS Lysing Solution), fixed in 2% parafo rmaldehyde, and used to obtain a total white blood cell count and differential (lymphocytes, m onocytes, and neutrophils) by forward and side scatter characteristics. The absolute monocyte count was cal culated. These results showed excellent correlation with results from the clinic al laboratory. Data were analyzed with FCS Express V2 (DeNovo Software, Thornhill, Ontari o). Size gating was used to eliminate any residual neutrophils or RBCs, which were t ypically less than 15%. MDCs and PDCs were defined as Lin-, HLA-, DR+ cells that were either CD11c-, CD123+, (PDCs) or CD11c+, CD123(MDCs). Absolute numbers of dendritic cells and monocytes were calculated as a percentage of the complete blood cell count. Karyotype Analysis Metaphase chromosome spreads were prep a red from PHA-stimulated PBMC cultures following standard cytogenetic procedures. Chromosome prepar ations were banded utilizing a standard GTG-banding procedure. Metaphase imag ing and karyotype production were facilitated by computer assisted methods (CytoVision softwa re, Applied Imaging). Twenty metaphase cells were analyzed for each family member studied. Cell Enrichment Peripheral blood mononuclear cells (PBMCs) we re isolated by Ficoll-Hypaque density gradient centrifugation. Monocytes B cells and plasm acytoid de ndritic cells (PDCs) were positively selected by anti-CD14, anti-CD 19 or anti-CD304 (BDCA4) labeled magnetic

PAGE 48

48 microbeads, respectively. The purity of the positively selected cell fractions was typically 90% or greater. Flow Cytometric Cell Sorting PBMCs were isolated on Ficoll-Paque Plus (Am ersham Biosciences, Piscataway, NJ), washed and resuspended in 1ml of RPMI1640 with 10% fetal bovine serum. Cells were stained with anti-CD14-FITC (BD science) a nd anti-CD71-PE (ebioscience). CD14+CD71+ and CD14+CD71cells were sorted with FACS Va ntage SE Turbosort (BDbioscience). Electron Microscopy Sorted CD14+CD71+ or CD14+CD71cells were fixed in 2% paraformaldehyde and 1% glutaraldehyde in Tyrode buffer over night. After washing with tyrode buffer, fixed cells were washed with 0.1 M Na cacodylate pH=7.4 for 15 min, stained with 2% osmic acid in 0.1 M Na cacodylate buffer at 4 for 1 hour. TAAB mixture consists TAAB: Dodecenylsuccinic anhydride: Methylnadic anhydride (Sigma-Aldrich, Inc, St. Loui s, MO) 48:19:33 were prepared in advance. Stained cells were dehydrated in graded concentrati on of ethanol, and immersed in 1:1 TAAB: ethanol for 1 hour, 2:1 TAAB: ethanol overnight and 100% TAAB for 2 hours, and 100% TAAB with 2,4,6-Tris(dimethylaminomet hyl)phenol (dmp-30) (Sigma) for 1.5 hours before embedded in TAAB with dmp30 and polymerized at 60 overnight Blockes were trimmed, sectioned to 800-900 nm, placed onto 150 mesh copper grids and allowed to air dry for 30 minutes. Sections were floated in filtered alco holic 8% uranyl acetate for 4 min and washed with 50% ethanol and allowed to dry for 30 mi n. Grids were stained with one drop of lead citrate/grid for 60 seconds and washed with di stilled water and before drying. Sections were viewed with Zeiss EM10 electr on microscope (Carl Zeiss, Inc ., Peabody MA) and images were captured by Finger Lakes digital camera (Fin ger Lakes Instrumentation, LLC., Lima, NY)

PAGE 49

49 Statistical Method All tests were done with Prism 4.03 (GraphP ad software). Difference among categories was tested w ith one way ANOVA or student t test. Significance was reached when P<0.05

PAGE 50

50 Table 2-1. Patient demographics SLE Healthy Controls Other1 Number of subjects (total observations) 88 (134) 57 (69) 82 (119) Percentage of female 94.3 83.93 85.37 Mean age (range) 36.7 (12-68) 40.05 (21-75) 47.56 (20-73) Race Black 36.77 37.50 19.75 White 41.40 44.64 70.07 Other 21.83 17.86 6.17 Percentage of taking corticosteroids 64.18 -33.6 Mean corticosteroid dose (range) 16.30 (2-60 mg/day) -18.04 (2.5-60 mg/day) Percentage of taking antimalarials 65.67 -31.93 Percentage of taking cytotoxics2 34.33 -27.73 1 Includes Sjogrens syndrome (13), polymyos itis/dermatomyositis (6), scleroderma (9), undifferentiated connective tissue disease (5), rh eumatoid arthritis (2), positive ANA (27), and miscellaneous diagnoses (20) 2 methotrexate, azathioprine, cyclophosphamide, or mofetil mycophenolate

PAGE 51

51 Table 2-2. Primers for real time PCR Gene mRNA start Length GC% primer Beta actin NM_001101 9502055 tccctggagaagagctacga 9692055 agcactgtgttggcgtacag CXCL 10 (IP10) NM_001565 45 2055 ctccagtctcagcaccatga 2362040 caaaattggcttgcaggaat IL-6 NM_000600 3062045 aaagaggcactggcagaaaa 4872055 gctctggcttgttcctcact IL-1 beta NM_666576 2262055 ggcatccagctacgaatctc 4192045 tcgttatcccatgtgtcgaa IL-1R II NM_004633 8682045 tgaaggccagcaatacaaca 10222050 cggttcccagaaacacctta CCL5 NM_2985 922050 cgctgtcatcctcattgcta 2412055 gagcacttgccactggtgta ISG15 NM_5101 1432055 tgtcggtgtcagagctgaag 3332055 caccaggatgctcagaggtt SOCS1 NM_003745 8212045 actgggatgccgtgttattt 10682060 ggtaggaggtgcgagttcag TRIF NM_014261 3302060 caggagcctgaggagatgag 5572050 tttgaccggctccagaatag TRAF6 NM_145803 641 2050 tccagccagtctgaaagtga 6582045 tggacatttgtgacctgcat MyD88 NM_002468 615 2055 gaggaggctgagaagccttt 6272055 gcggtcagacacacacaact IRAK4 NM_016123 4872060 gccacctgactcctcaagtc 7052045 accattgctgcaagcttctt IRAK-M NM_007199 2162050 ctggctggatgttcgtcata 4622050 ggtgacattggctgtttcct Mx1 NM_002462 11422055 acctcgtgttccacctgaag 11612060 gtgtgatgagctcgcgtggta Flt3l NM_001459 1122050 tggagcccaacaacctatct 2712055 ccacggtgactgggtaatct IL-8 NM_000584 2812045 ctgcgccaacacagaaatta 5122050 tctggcaaccctacaacaga GM-CSF NM_000758 1962050 acttcctgtgcaacccagat 2152055 cttggtccctccaagatgac CXCL1 NM_001511 3252050 gaaagcttgcctcaatcctg 4252055 tgagcttcctcctcccttct CXCL2 NM_002089 3062050 ctcaagaatgggcagaaagc 4352050 aggaacagccaccaataagc CCL3 NM_002983.1 1362050 gcaaccagttctctgcatca 2502050 tggctgctcgtctcaaagta CCL5 NM_002985.2 1642050 ctgctgctttgcctacattg 2872050 acacacttggcggttctttc Ly6E NM_002346.1 1972050 tgatgtgcttctcctgcttg 3982045 atggaagccacaccaacatt MCP-1 NM_002982.3 942055 tctgtgcctgctgctcatag 2962050 agatctccttggccacaatg IFNA1 NM_024013 438 2050 ggagtttgatggcaaccagt 450 2055 ctctcctcctgcatcacaca

PAGE 52

52 Table 2-2. Continued TLR7 NM_016562 245 2050 atcttggcacctctcatgct 2572055 gagtgacatcacagggcaga TLR9 NM_017442.2 5472055 gaagggacctcgagtgtgaa 7482060 ctggagctcacagggtagga IL-10 NM_000572 3462055 cccaagctgagaaccaagac 4522050 gggaagaaatcgatgacagc TGF b NM_000660 13922050 caacaattcctggcgatacc 15842050 gaacccgttgatgtccactt

PAGE 53

53 CHAPTER 3 RESULTS AND DISCUSSION: ASSOCI ATI ON OF ANTI-NUCLEOPROTEIN AUTOANTIBODIES WITH TYPE I INTERFER ON PRODUCTION IN SYSTEMIC LUPUS ERYTHEMATOSUS Introduction Most SLE patients produce autoantibodies agai nst ribonucleoproteins, such as the Sm /RNP, Ro (SS-A), and La (SS-B) antigens, or deoxyr ibonucleoproteins such as chromatin (160-162), often to the exclusion of other cellular antigens. It is unclear why nucleoproteins are selectively targeted for an autoimmune response in this di sease. We have reported that the RNA components of the Sm/RNP and Ro60 antigens, U1 RNA and Y1-5 RNAs, respectively, stimulate the production of Type I interferons (IFN-I) and i nduce dendritic cell matura tion, hallmarks of the adjuvant effect (163). The Type I interferons IFN and IFN prom ote dendritic cell maturation, primary and memory B cell responses, and are powerful ad juvants (164). Precursors of plasmacytoid dendritic cells (PDCs), the primary IFN-I producing cells, represent ~0.5 % of peripheral blood mononuclear cells (PBMCs) (165, 166) and expre ss IL-3 receptors (CD123) and MHC class II, but not CD11c or other lin eage (lin) markers (165, 167). My eloid dendritic cell (MDC) precursors (CD11c+, CD123-, class II+, lin-) also circulate (168) a nd undergo maturation in response to IFN-I (169, 170). The maturation stat e of MDCs is a key determinant of whether antigen presentation is tolerogenic as in the cas e of self-antigens pres ented by immature MDCs or immunogenic, as in the case of foreign antigens presented by MDCs activated by Toll-like receptor (TLR) ligands (171). Double-stranded (ds) RNA and certain single-stranded (ss) RNAs are ligands for TLR3 and TLR7/8, respectivel y (66, 105, 172, 173) and cellular DNA sequences have recently been shown to activate TLR9 ( 174). Engagement of Toll-like receptors by these nucleic acid ligands stimulates IFN -I production through MyD88-dependent and

PAGE 54

54 MyD88-independent pathways. Since nucleoprote ins carry endogenous TLR ligands in the form of their associated nucleic acids it was of interest to see if autoantibodies against the Sm/RNP, Ro (SSA), and chromatin (dsDNA) autoantigens are associated with hi gh levels of IFN-I. Results Increased IFN-I Production and Low Peri pheral Blood Dendritic Cells in SLE As total IFN-I consists of 14 IFN isofor ms plus IFN the specificity of ELISA depends on the specificities of the detec tion antibodies (175). Measuremen t of the expression of IFN-I inducible genes such as Mx1 by real-time PCR perm its an estimate of total IFN-I production and has been shown previously to correlate with IFNI levels (176). We first examined the stability of mRNA from PBMCs to verify that degrad ation did not occur during processing. Mx1 and -actin mRNA from blood collected in PAXGene tubes was stable for 8 hours at room temperature and was largely intact after 5 days at room temperature (Fig. 3-1A). When processed immediately, Mx1 expression levels were simila r in blood collected in heparinized tubes vs. PAXGene tubes (Fig. 3-1B). However, when blo od collected in heparini zed tubes was incubated at room temperature, there was a time-dependent increase in Mx1 expression suggesting that the PBMCs became activated after blood collection (Fig. 3-1B). The increase was nearly 3-fold at 3 hours of incubation. For this reason, gene expr ession in this study was measured using blood collected in PAXGene tubes. Mx1 expression was increased up to 7000-fold in a subset of SLE patients in com parison with healthy controls and patients with other autoimmune cond itions (P < 0.0001, ANOVA; post-test comparison data shown in the figure) (Fig. 3-1C). Expr ession was higher than the mean of healthy controls in 22 % of patients and higher than the mean + 2 S.D. (= 642 units) in 22% of SLE patients. Expression of a second IFN-I regu lated gene, OAS, correlated well with Mx1 (P <

PAGE 55

55 0.0001 Pearsons correlation test) (Fig. 3-1D). In addition, the Mx1 expression in PBMCs correlated well with levels of mRNA for the Type I interferon IFN (R2 = 0.68, P < 0.0001 Pearsons correlation test) (Fig. 3-1E). In other experiments, we found that Mx1 expression was induced in K562 cells by IFN-I but not by IL-6, TNF or IFN (data not shown), verifying its specificity for IFN-I. We next examined the numbers of circula ting PD C precursors, the major IFN-I producing cell type. Peripheral bl ood PDC counts (CD123+, CD11c-, lincells) were greatly reduced in SLE patients (n = 126) vs. healthy controls (n = 66) as were the MDC counts (CD123-, CD11c+, lincells) (P < 0.0001 for both PDCs and MDCs, unpaired t-test) (Fig. 3-2A-B). About half (52%) of lupus patients had low PDC and MDC counts defi ned as values lower than 95% of controls (abnormal < 0.66 PDCs/ l or < 1.1 MDCs/ l) whereas 20% had values lower than the mean of healthy controls. PDC and MDC counts correlated highly with one another (P < 0.0001, Pearsons correlation test) (Fig. 32C). In contrast, monocyte count s were comparable in SLE vs. healthy controls (Fig. 3-2D). Take n together, these data indicate th at SLE is associated with high IFN-I production and low nu mbers of circulating PD C and MDC precursors. IFN-I and PDC/MDC Abnormalities a re not Explained by Medication Use The high IFN-I (Mx1) expression and the low numbers of circulating PDCs and MDCs could be a consequence of the disease itself or of therapy. Th e two m ost common medications used in our lupus cohort were antimalarial s (mainly hydroxychloroquine ) and corticosteroids (mainly prednisone). In comparison with patien ts not receiving antimal arials, those receiving antimalarials did not have higher or lower PD C/MDC counts or Mx1 expression (Fig. 3-3A). Overall comparison of SLE patients and controls also did not reveal differences attributable to corticosteroid treatment, but when the SLE patie nts were considered separately from controls,

PAGE 56

56 both absolute PDC (P = 0.04, unpaired t-test) and MDC (P = 0.01, unpaired t-test) counts were lower in steroid-treated patients than in pa tients not receiving ster oids, suggesting that corticosteroids could have a modest effect (Fi g. 3-3B). There also was a trend toward higher Mx1 expression in steroid-treated patients (P = 0.06, unpaired t-test). Thus, although the low PDC/MDC counts were not primarily due to cortic osteroid therapy, steroids may have a small effect or else the patients with low PDC/MDC c ounts may be more likely to receive steroids. To further explore the effects of pharmacoth erapy, PBMCs fr om healthy controls were pre-incubated for 1 hour with dexamethasone or chloroquine before adding LPS, poly (I:C), or CpG oligodeoxyribonucleotide. As shown in Fig. 3-3C, dexamethasone (0.1-10 g/ml) had no effect on either basal (unstimulated) or TLR ligand-stimulated Mx1 expression. However, as expected (177) expression of IL-6 (Fig. 3-3C) and TNF (not shown) mRNA decreased in a dose-dependent manner, suggesting that dexa methasone inhibited TLR4 signaling via the MyD88/NF B dependent pathway more than signaling via the TRIF/IRF-3 pathway. These in vitro results are consistent with the in vivo data (Fig. 3-3B). Chloroquine (0.1-10 M) also had no effect on LPSor poly (I:C)-s timulated IFN-I (Mx1) or IL-6 production (Fig. 3-3D). However, IFN-I and IL-6 production stimulated by CpG DNA (TLR9 ligand) we re inhibited in a dose-dependent manner as expected.(104) Increased Mx1 and Low PDC/ MDC Counts Are Associa t ed With a Subset of Autoantibodies In view of the association between exogenous IFN adm inistration and antinuclear antibodies, we investigated whether increa sed endogenous IFN-I production and low PDC/MDC counts were associated with autoantibody pr oduction. SLE patients who were anti-Sm/nRNP autoantibody positive had higher Mx1 expression than those who were negative; similarly, patients with autoantibodies against the Ro (SSA) or La (SSB) ribonucleoproteins had higher

PAGE 57

57 IFN-I levels than those wit hout (P = 0.0025, ANOVA; post-test comparison data shown in the figure) (Fig.3-4A). When Mx1 expression was so rted and the SLE patients were divided into four equal groups (group 1 = lowest Mx1, group 4 = highest), the number of patients with anti-Sm/RNP/Ro/La autoantibodies increased progressively, further suggesting that higher Mx1 expression was associated with a higher li kelihood of having autoantibodies against ribonucleoproteins (not shown). Autoantibodies to dsDNA also were associated with high Mx1 (P = 0.02, unpaired t-test) (Fig. 3-4B). In striki ng contrast, Mx1 expression was negatively associated with anti-phospholip id antibodies (APLA, P < 0.0001, unpa ired t-test) (Fig. 3-4C), suggesting that increased IFN-I production was ch aracteristic only of th e subset of patients producing autoantibodies against RNA-protein (anti-Sm, -RNP, -Ro/SSA, or -La/SSB) or DNA-protein (anti-dsDNA) antigens. Similarly, anti-dsDNA, -nRNP and -Sm antibodies were associated with low circulating MDC counts (P = 0.02 and P = 0.03, respectively, unpaired t-test) wherea s anti-phospholipid antibodies w ere not (P = 0.16) (F ig. 3-5). Strikingly, anti-nRN P/Sm autoantibodies (but not anti-dsDNA or anti-phospholipid antibodies) also were associated with low PDC counts (P < 0.0001). These data suggest that the association of autoantibody production with increased IFN-I expression and decreased circul ating PDC/MDC precursors is se lective for ribonucleoprotein (Sm, RNP, Ro60, La) and deoxyrib onucleoprotein (dsDNA) antigens. Relationship of Mx1 Expression and De ndritic Cell Counts to Disease Activity Clinical significance of the abnormal IF N-I production and low PDC/MDC counts was evaluated using the num ber of A CR SLE criteria met (a measure of extent of disease) and the presence or absence of renal involvement. There was no apparent relationship between Mx1 expression and number of ACR criteria met or th e presence of renal di sease (Fig. 3-6). In contrast, low PDC/MDC counts were strongly associated with more extensive disease and renal

PAGE 58

58 involvement (Fig. 3-6). Thus, the disappearance of PDCs and MDCs from the peripheral blood is associated with more severe immune complex disease. Discussion Autoantibodies to small ribonucle oproteins, such as the U1, U2, U4-6, and U5 s mall nuclear ribonucleoproteins (snRNPs) and the cytoplasmic Ro60 (Y1-Y5) ribonucleoproteins are strongly associated with systemic autoimmune diseas es such as SLE and Sjogrens syndrome (161, 162, 178). Over half of lupus patients produce autoan tibodies against one or more of these antigens and about 70% produce anti-dsDNA antibodies ( 179). Titers of these autoantibodies can be extraordinarily high, sometimes approaching 20% of the total immunoglobulin (180). The reasons for the striking propensity of lupus patients to produce autoantibodies against nucleoprotein antigens remain poorly defined desp ite intensive study. We recently reported that U1 RNA and the Y1-5 RNAs are immunostimulato ry and others have shown that eukaryotic DNA may be stimulatory as well (181), suggesting th at one explanation for the high frequency of autoantibodies against nucleoproteins may that they carry endogenous adjuvant in the form of immunostimulatory nucleic acids. Adjuvant activity is operationally define d as the capacity to induce proinflammatory cytokines, notably IF N-I or IL-12 and to promote dendritic cell maturation as indicated by increased expres sion of CD80, CD86, class II, and CD40 and homing to lymphoid tissues (148, 164, 182). The present findings add support to the idea th at the production of au toantibodies against nucleoprotein autoantigens is associated with evidence of adjuvant activity. As com pared with autoantibody negative SLE patients, patient s who produced anti-RNP/Sm or anti-Ro60 autoantibodies had increased Mx1 and OAS gene expression, markers of the production of IFN-I (Fig. 3-1). Expression of IFN was increased as well (Fig. 3-1). These changes were specific for

PAGE 59

59 patients with anti-nucleoprotein autoantibodie s, as anti-phospholipid autoantibody positive patients had significantly lower IF N-I expression than negative pa tients. Increased expression of IFN-I inducible genes has been noted prev iously in SLE (141, 142, 183) and increased production of the proteins has been reported as well (184-186), though this is seen less consistently. The difficulty in detecting IFN-I prot eins in the serum of SLE patients may relate to interference of rheumatoid f actors with sandwich-type ELISAs as well as the binding of circulating IFN-I to IFN-I recep tors, the expression of which is widespread. Because the 14 or more Type I IFNs all interact with the same receptor (187), measurement of Mx1 gene expression by real-time PCR affords the means of specifically assaying the bioactivity of all Type I IFN proteins, offering si gnificant advantages over the meas urement of serum IFN-I levels using sandwich ELISAs. This approach has been validated in patients treated with exogenous IFN (176) and we confirmed a strong correlation between the expression of Mx1 and the expression of other IFN-I inducible genes (Fig. 3-1). The increased Mx1 expression seen here in ~20% of adult lupus patients differs from previous rep orts that virtually all children (95%) and adults (77%) with SLE over-express IFN-inducible genes (141, 142). This likely reflects primarily differences in data analysis. In the microarray studies, increased gene expression wa s defined as greater th an the expression in healthy controls (141, 142). Here, increased Mx1 was defined as greater than the mean + 2 S.D. of the normal group. Using the former definition, ~60% of our SLE patients had increased Mx1, a figure approximating what was reported previousl y. An alternative explanation is that the lower prevalence of high IFN-I seen here was related to mRNA degradation. We think this is unlikely because the Mx1, OAS, IFN 2, and IFN expression levels correlated with each other and all were compared with -actin expression. It would therefore be necessary to postulate that the

PAGE 60

60 degradation was specific for interferons and IFNI inducible genes. Moreover, all blood samples in the present study were colle cted in PAXgene tubes to minimize RNA degradation. The effectiveness of this approach is illustrated by Fig. 3-1A. Indeed, collection of blood in heparinized tubes is a potential so urce of bias (Fig. 3-1B) that may have contributed to the high frequency of elevated IFN-I inducible gene expression reported in prior studies. Along with IFN-I production, dendri tic cell activation is a hallm ark of the adjuvant effect (182). Although we have not shown directly that the production of autoan tibodies against the U1 and Y1-5 ribonucleoproteins or against dsDNA is associated with dendritic cell activ ation, the deficiency of circulating PDC and MDC precursors in SLE (Fig. 3-2) is likely an indirect measure of dendritic cell activat ion. Activated PDCs home to ly mphoid tissues (188) where they produce IFN-I (166), which then promotes MDC maturation (127, 150) Like PDCs, MDCs acquire chemokine receptors mediating homing to secondary lymphoid tissues (189). This may explain the strong correlation between the numbers of circulating MDCs and PDCs (Fig. 3-2C). Similar mechanisms may account for the PDC/MD C deficit in HIV inf ection (190). Although it has been suggested that certain medications, no tably corticosteroids, can cause the number of circulating PDCs to fall (191, 192), standard doses of antimalarials or oral corticosteroids did not have a major effect on either Mx1 expression or the numbers of circ ulating dendritic cell precursors, as SLE patients had higher Mx1 expression and lower PDC and MDC counts than healthy controls regardless of whet her or not they were treated w ith these medications (Fig. 3-3). It is worth noting, however, that the corticostero id doses reported to depress PDC counts (192) were substantially higher than th e usual doses of oral prednisone. In preliminary studies, we have confirmed that high dose methylprednisolone (1 gram IV daily for 3 days) decreases Mx1 expression and PDC/MDC counts (dat a not shown). However, in pa tients receiving a daily dose

PAGE 61

61 of up to 60 mg of prednisone orally, the low PDC/MDC counts probably re flect either abnormal production or increased homing to other sites. Ci rculating PDC/MDC precurs ors originate in the bone marrow and are mobilized by G-CSF and ot her cytokines (193). It remains to be determined whether the low numbers of circulati ng PDCs and MDCs in lupus reflects deficient production of G-CSF or other cytokines or abnormally ra pid PDC/MDC maturation and recruitment to the periphery. A major question raised by our findings is whet h er increased IFN-I pr oduction is a primary stimulus of the production of autoantibodies to nucleoproteins or a secondary event resulting from the endosomal processing of the nucleic acids associated with these antigens. Certainly, it has been shown that therapy with IFN is associated with auto immune phenomena, including antinuclear antibody production a nd the induction of ove rt autoimmune diseases such as autoimmune thyroiditis and SLE (139, 194). However, the specificities of the autoantibodies appearing during IFN therapy have not been investigated systematically, and it is unclear whether there is a preference for nucleoprotein antigens. Conversely, in view of the ability of U1 and Y1-5 RNA as well as unmethylated CpG DNA motifs to stimulate IFN-I production, it is possible that the increased produc tion of IFN-I seen in patients who produce autoantibodies to nucleoproteins is secondary to th e activation of dendritic cells due to the endosomal uptake of these antigens (163). In this case, conditions th at enhance the exposure of activated MDCs to nucleoproteins, perhaps in the form of blebs (195) from apoptotic cells, may be critical to the generation of autoantibodies. The two possibilities are not mutually exclusive. Mechanisms exist to prevent the activati on of B cells upon exposure to endogeno us chromatin and dendritic cells might also be susceptible to desensitization under appropriate conditions. Exposure to either endogenous or exogenous IFN could lead to partial activa tion of dendritic cell precursors

PAGE 62

62 and/or monocytes, thereby bypassi ng this checkpoint. When thes e cells encounter nucleoprotein autoantigens such as the U1 or Y1-5 ribonuc leoproteins, they may undergo further maturation into fully immunostimulatory MDCs capable of inciting an immune response against peptides derived from self-antigens. In th is scenario, exposure of partia lly activated MDCs or monocytes to immunostimulatory small RNAs derived from self-antigens may act as a positive feedback mechanism promoting autoimmunity, which is dire cted mainly against the protein components of these antigens. Importantly, the nucleic acid com ponents of autoantigens may also act on B cells to promote autoantibody production. For instan ce, the interaction of cellular DNA from chromatin with TLR9 acts in concert with B cell receptor interactions to promote B cell activation. Similarly, since B cells express TLR7/ 8, the likely receptor for U1 and Y1-5 RNA (163), it is likely that the R NA components of self antigens al so can promote B cell activation. Thus, IFN-I and endogenous nucleic acids with immunostimulatory properties may act together to promote autoantibody production and the formati on of immune complexes, leading to immune complex disease. The association of high Mx1 ex pression and low numbers of circulating PDCs and MDCs with both extent of disease and lupus nephritis (Fig. 3-6) is compatible with this model. In conclusion, immunostimulatory effects of th e nucleic acid com ponents of autoantigens on dendritic cell activation/maturation and IFN-I production may help explain the high prevalence of autoantibodies against nucleoprotein antigens in SLE, raising the possibility that therapy directed against IFN-I might lower autoantibody leve ls and alleviate disease. Very recent studies in mice support the potential valu e of this approach (196).

PAGE 63

63 Figure 3-1. Increased expression of IFN inducible genes in S LE. A) Stability of PBMC RNA in PAXgene tubes. Whole blood was incubated in PAXgene tubes at room temperature for 2 hours to 5 days and then processed. B) Mx1 expression in heparinized blood. Blood samples were collected either in s odium heparin tubes or PAXgene tubes and incubated at room temperature for 0 to 6 hours before isolation of RNA for quantification of Mx1 expr ession by real-time PCR. C) Mx1 expression in SLE patients and controls. Mx1 e xpression (real-time PCR) in SLE patients (n = 88) was increased in comparison with healthy controls (n = 57) and patients with other diagnoses (n = 82). Levels were higher in SLE vs. controls and other diagnoses (P < 0.0001, ANOVA; P < 0.001 SLE vs. Control; P < 0.001 SLE vs. Other (Bonferronis multiple comparison test). Dotted line show s the mean of healthy controls + 2 S.D. (642 cells/ l). NS, not significant. D) Correla tion of Mx1 and OAS expression. Mx1 gene expression correlated strongly with expression of the IFN-I inducible gene OAS (real-time PCR) in a group of 54 consecutive ly tested patients from the original 88 SLE patients (R2 = 0.18, P < 0.0001 Spearman rank correlation test). E) Correlation of Mx1 and IFN expression. Mx1 expression correla ted strongly with expression of IFN (real-time PCR) in a group of 38 cons ecutively tested SLE patients (R2 = 0.68, P < 0.0001 Spearman rank correlation test). C SLE Control Other 0 500 1000 1500 2000 2000 4500 7000Relative Mx1 expression642 NS P < 0.001 P < 0.001 0 200 400 600 0 200 400 600 Relative OAS ex p ressionRelative Mx1 expressionD R 2 = 0.18 P < 0.0001 0 20 40 60 80 100 2 hrs8 hrs5 daysMx1 expression (% of original v 0 100 200 300 400 PAXgene0 hr3 hr6 hrMx1 expression (% of ori g A B 0 200 400 0 200 400 Relative IFNb expressionRelative Mx1 expressionER 2 = 0.68 P < 0.0001

PAGE 64

64 Figure 3-2. Reduced circulating PDCs and MDCs in SLE. Ci rculating PDC and M DC counts were analyzed in 33 controls and 76 S LE patients by flow cytometry. PDCs were defined as lineage(CD3, CD14, CD16, CD19, CD20, CD56); HLA-DR+, CD123+, CD11c-. MDCs were defined as lineage, HLA-DR+, CD123-, CD11c+. A) and B) Absolute PDC and MDC counts. The dotte d lines indicate the 5th percentile of healthy control counts (0.66 cells/ l and 1.1 cells/ l for PDCs and MDCs, respectively). C) Correlation of the absolute PDC and MDC counts (P < 0.0001, Pearsons correlation test). D) Absolute monocyte counts. Monocyte counts in SLE patients vs. controls were not significantly different. Control SLE 0 2 4 6 8 10 10 30Absolute PDC count (per l) Control SLE 0 2 4 6 8 10 10 30MDC count (per l)A 1.11 cells/ l 0.66 cells/ l Control SLE 0 1 2Monocyte count (x103/ml)C 0 10 20 30 0 10 20 30PDC count (per ml)MDC count (per ml)P < 0.0001 B D P < 0.0001 P < 0.0001

PAGE 65

65

PAGE 66

66 Figure 3-3. Effect of medications on Mx1 expression in SLE patient s. A) Ef fect of antimalarial therapy. Peripheral blood PDC and MDC counts and Mx1 expression in patients treated with antimalarials (hydroxychloroqui ne or quinacrine), patients not taking antimalarials, and controls. B) Effect of corticosteroid therap y. Peripheral blood PDC and MDC counts and Mx1 expression in SLE pa tients treated with corticosteroids vs. patients not taking steroids and controls. In each of the figures, the difference between the three groups was analyzed by ANOVA. Bonferronis test was used to measure the inter-group differences. C) In vitro effect of corticosteroids. PBMCs were pre-treated with dexamethasone (0, 100 ng/ml, or 10 g/ml) for 1 hour prior to stimulation with poly (I:C) (PIC, 50 g/ ml), LPS (100 ng/ml), or CpG ODN (10 g/ml) for 6 hours. Expression of Mx1 a nd IL-6 was measured by real-time PCR normalized to -actin. D) In vitro effect of an timalarials. PBMCs were pre-treated with chloroquine (0, 100 nM, or 10 mM) for 1 hour prior to stimulation with PIC, LPS, or CpG ODN and measurement of Mx1 and IL-6 expression as in C.

PAGE 67

67 Figure 3-4. Increased Mx1 expression co rrelates with autoan tibody production. A) Autoantibodies to ribonucleoproteins. Mx1 expression was increas ed in individuals with either anti-nRNP/Sm or anti-Ro (SS-A)/La (SS-B) (immunoprecipitation assay) vs. individuals without any of these specificities (P = 0.0025, ANOVA; P < 0.01 anti-nRNP/Sm vs. contro l; P < 0.05 anti-Ro /La, Bonferronis multiple comparison test). B) Anti-DNA autoantibodies. Mx1 e xpression also was increased in patients with anti-dsDNA antibody (ELISA, P = 0.02, unpa ired t-test). C) Anti-phospholipid antibodies. Mx1 expression was negativel y associated with the presence of anti-phospholipid antibodies (IgG or Ig M anti-cardiolipin by ELISA or lupus anticoagulant, P < 0.0001, unpaired t-test).

PAGE 68

68 Figure 3-5.Decreased dendritic cell counts correlate with autoantibody production. A bsolute peripheral blood counts of myeloid dendritic cells (mDC, left) and plasmacytoid dendritic cells (pDC, right) were determin ed (flow cytometry) in patients who were positive or negative for anti-dsDNA anti bodies (Top), anti-RNP/Sm antibodies (middle), or anti-phospholipid antibod ies (APLA, bottom). MDC counts were significantly lower in anti-dsDNA and anti-RNP/Sm positive patients than in autoantibody negative patients (P = 0.02 a nd P = 0.03, respectively, unpaired t-test). PDC counts were significantly lower in anti-RNP/Sm positive patients than in autoantibody negative controls (P < 0.0001, unpaired t-test). anti-dsDNA (-) anti-dsDNA (+) 0 20 40 60 pDC anti-dsDNA ( ) anti-dsDNA ( + ) 0 20 40 60 mDC anti sm ( ) anti sm ( + ) 0 20 40 60 pDC anti sm ( ) anti sm ( + ) 0 20 40 60 mDC APLA (-) APLA (+) 0 20 40 60 pDC A PLA ( ) A PLA ( + ) 0 20 40 60 mDCdsDN RNP/Sm APLAP = 0.02 P < 0.0001 P = 0.03

PAGE 69

69 Figure 3-6. Relationship of M x1 expression, PD C and MDC counts to disease severity. Mx1 expression (real-time PCR) and PDC/MDC c ounts (flow cytometry) were correlated with extent of disease (number of SLE criteria met) in 66 SLE patients (Spearman). Mx1 expression and PDC/MDC counts in SLE patients with and without renal involvement were compared by unpaired t-test. 3 4 5 6 7 8 9 10 0 5 10 15 20SLE criteriaAbsolute PDC count (perl) 3 4 5 6 7 8 9 10 0 5 10 15 20SLE criteriaAbsolute MDC count (per ml)P=0.02 P=0.008 SLE no renal SLE renal 0 2000 4000 6000Relative Mx1 expression 3 4 5 6 7 8 9 10 0 1500 3000 4500 6000 7500SLE CriteriaRelative Mx1 expressionP =0.6 SLE no renal SLE renal 0 5 10 15 20Absolute PDC count (perl) SLE no renal SLE renal 0.0 2.5 5.0 7.5 10.0 12.5 15.0 17.5Absolute MDC count (perl)P =0.5 P=0.02 P=0.014 Renal Diseas SLE Criteri Mx1 expression Absolute PDC count Absolute MDC count

PAGE 70

70 CHAPTER 4 RESULTS AND DISCUSSION: CD71+ MONOCY T ES IN PERIPHERAL BLOOD FROM LUPUS PATIENTS PR ODUCE INTERFERON / Introduction Most lupus patients produce abnormal high levels of interferons (IFN) and as ind icated by the up-regulation of a group of IFN-I-stimu lated genes (ISGs) (141, 142, 183, 197). This interferon signature correlates with active dis ease, renal involvement, and the production of lupus-associated autoantibodies such as anti -dsDNA and anti-Sm/RNP. Therapeutic use of recombinant IFN is associated with a variety of au toimmune disorders including SLE (139). Moreover, a lupus-like disease with excess IFN -I production was seen in two patients with a chromosomal translocation result ing in trisomy of chromosome 9p, which carries the IFN-I gene cluster (198). These observations suggest that Type I interferons (IFN-I) c ould be involved in the pathogenesis of SLE. Further evidence for a direct pathogenic role of IFN-I com e s from the observation that experimental lupus induced by tetramethylpentadecane (TMPD) is greatly attenuated in mice lacking the Type I interferon re ceptor (199). Although plasmacytoid dendritic cells (PDCs) are the most efficient IFN-I producing cells (153, 16 6), studies of TMPD lupus indicate that immature monocytes bearing the marker Ly6C are responsible much of the IFN-I (200). These cells have low phagocytic activity, express high levels of TLR7, and respond well to TLR7 ligands, but only weakly to TLR9 ligands [(200) and PY Lee, et al., Submitted]. A monocyte phagocytosis defect affecting the clearance of dying cells has been reported in about half of lupus patients (201-203). This ha s been attributed to defects in the phagocytes them selves as well as serum factors (203, 204). Since the immature interferon-producing monocytes in TMPD-lupus also are poorly phagocy tic (200), we hypothesized that similar cells in the peripheral blood of SLE patients might be responsible for the observed monocyte

PAGE 71

71 phagocytosis defect. Although Ly6C is not expr essed by human monocytes, increased numbers of circulating CD71+ (transferrin receptor 1+) monocytes are seen in SLE (205). CD71 is expressed on rapidly dividing cells and is generally expres sed at only low levels in non-proliferating cells (206). Thus CD71 may be a marker for rela tively immature/proliferating monocytes. In the present study, we show that in SLE patients, circul ating monocytes bearing CD71 produce significant amounts of IFN-I and may be the human equivalent of the Ly6Chi monocyte subset in murine lupus. Results Low PDC Numbers Correlate with High Interferon Levels in SLE In normal individuals, circulating PDCs express endosom al TLR7 and TLR9, and upon stimulation by virus or other lig ands, produce large amounts of IFN-I (182, 207). Consistent with previous reports (197, 208), we found that PDCs are depleted from the blood of lupus patients compared with healthy controls (Fig. 4-1A-B). Using expression of the IFN-I inducible gene Mx1 as a measure of total IFN-I expression (mainly IFN and IFN ), we found a negatively relationship between Mx1 expressi on and circulating PDCs (Fig. 4-1C). It has been suggested that this apparent paradox may be explained by sequestration of the IFN-I producing cells in affected tissues, such as the skin lesions of SLE patients (209, 210). However, we found that peripheral blood mononuclear cells (PBMCs) from SLE patients expressed significantly higher levels of IFN 2 than those of healthy controls (P < 0.001, Mann Whitney test) (Fig. 4-2A). Interestingly, when PBMCs from SLE patients were fractionated into CD14+ and CD14populations using magnetic beads, the CD14+ subset exhibited higher IFN 2 expression than the CD14subset (P < 0.01, Mann-Whitney). Similarly, PBMCs from SLE patients expressed high levels of IFN mRNA, a significantly higher frac tion of which was found in the CD14+ subset than in the CD14subset (P < 0.05, Mann-Whitney) (Fig. 4-2B ). In contrast, depletion of PDCs

PAGE 72

72 had little effect on the level of IFN mRNA in lupus PBMCs. PBMCs and CD14+ cells from healthy controls also expressed IFN but the level was about 20-fold lower than that seen in lupus PBMCs (Fig. 4-2C) In contrast to the SLE patients, IFN mRNA seemed to be associated with PDCs in majority. CD14+ Cells from SLE Patients Produce IFN-I in Response to TLR Ligands Endogenous and exogenous RNA ligands can stimulate TLR7 to induce IFN-I production. In lupus PBMCs, TLR7 expression was significantly higher than norm al controls but not patients with other autoimmune diseas e (Fig 4-3A) (One way ANOVA P<0.05). Interestingly CD14+ monocytes from lupus patients expressed TLR7, but in lower level compar ed to B cells (Fig 4-3B). Normal CD14+ monocytes express TLR7 in very low level (dat a not shown). IRF7, a transcription factor involved in TLR signaling, was expressed higher in monocytes compare to non-monocytes (Fig. 4-3C). Flow cytometry reve aled a significant stronger CD14 expression on lupus monocytes compared to normal individuals (Fig. 4-3D). These results indicated abnormal TLR signaling in SLE monocytes. Along this line we stimulated PBMCs, CD14+ monocytes and CD14fraction with TLR3, 4, 7, 9 ligands PIC, LPS, loxoribine, or CpG 2216 for 6 hours. As expected, CD14+ monocytes from lupus pati ents responded to LPS challenge and produced cytokines such as IL-6 (Fig 4-3E). LPS stimulation also induced IFN expression by lupus monocytes (Fig. 4-3F). Interestingly, lupus monocytes also responded to stimulation of loxoribine, a TLR7 ligand. Loxoribine stimulated IFN-I production in lupus monocytes was higher than LPS induced response (Fig. 4-3F) wh ereas IL-6 production in response to LPS was higher than loxoribine (Fig. 4-3E). CpG 2216 induced IFN-I production in CD14cells (presumably dendritic cells and B cells), wherea s it did not stimulate cytokine production above baseline in CD14+ monocytes (Fig. 4-3F).

PAGE 73

73 Circulating CD71+ Monocytes in SLE Express IFN-I In agreement with a previ ous study (205), we found increa sed expression of CD71 on the surface of CD14+ monocytes from a subset of SLE pa tients vs. healthy co ntrols (P = 0.01, Mann-Whitney test) (Fig. 4-4A-C). The % of m onocytes positive for CD71 negatively correlated with the number of circulating PDCs (Fig. 4-4D) and correlated positively with the expression of IFN mRNA expression in PBMCs and with in terferon-inducible gene (Mx1) expression, a marker of IFN-I protein level (P = 0.001 and P = 0.01 respectively, Spearmans test) (Fig. 4-4E,F). To directly examine IFN-I production by the CD14+CD71+ subset, we isolated these cells by FACS sorting. Both CD14+CD71+ and CD14+CD71cells expressed more IFN mRNA than CD14cells, but the highest levels were seen in CD14+CD71+ monocytes (p = 0.02, one-way ANOVA) (Fig. 4-5A). Moreover, by el ectron microscopy the sorted CD14+CD71+ cells exhibited typical monocytoid morphological featur es more consistent with the features of immature monocytes than of more mature ph agocytes (Fig. 4-5B). The extensive rough endoplasmic reticulum typical of PDCs was not seen in this cell population. Longitudinal analysis of CD71+ monocytes and Mx1 gene expression provided further evidence that CCD71+ monocytes produce physiologically significant am ounts of IFN-I (Fig. 4-5C). As shown in Figure 4-5C, the number of CD71+ monocytes closely paralleled total IFN-I levels over time. This was not explained by an induction of CD71+ expression by IFN-I, as monocytes cultured in vitro with IFN failed to upregulate CD71 (data not shown). Increased CD14+CD71+ Monocytes in Patients with Anti-U1A Antibodies SLE patients who make autoantibodies ag ainst ribonucleoproteins such as the U (anti-Sm /RNP) and Y (anti-Ro) ribonucleoproteins have higher IFN-I levels than patients who do not produce these antibodies (197). Circulating CD71+ monocyte numbers were higher in

PAGE 74

74 anti-U1A (anti-RNP) positive SLE patients than in anti-U1A negative patients (P = 0.01, Mann-Whitney test) (Fig. 4-6). In contrast, there was no difference in the number of circulating PDCs and myeloid dendritic cel ls (MDCs) (Fig. 4-6 B-C). Phenotype of CD14+CD71+ Cells To further characterize the surface propertie s of CD14+ CD71+ m onocytes, we analyzed additional monocyte markers by flow cytometry (Fig. 4-7). The expres sion of HLA-DR, and CD64 (Fc RI), and CD62L was significantly increased on the CD14+CD71+ population vs CD14+CD71cells (Fig. 4-7A,B). Expression of PDC marker CD123 and myeloid marker CD11c was not upregulated on these cells (F ig. 4-7D and data not shown). The CD14+CD71+ population are negative for the PDC markers BDCA -2, BDCA-4 or MDC marker BDCA-1 (Data not shown). These data suggested th at a population of activated (CD71+, HLA-DRhi, CD62hi, CD64+) monocytes produces substantial amount of IFN-I in SLE and that these cells do no express high levels of surface markers char acteristic of dendri tic cells (CD123, CD11c) Discussion There is increasing evidence th at IFN-I is involved in the pathogenesis of SLE, but the source of the high levels of IFN-I in lupus is unknown. Although m any cell types can produce type I IFNs in response to viral infection, PDCs are the most efficient IFN-producing cells (153, 166). Although individual PDCs can generate up to 1000-fold more IFN then other cell types in response to viral infection, the frequency of circulating PDCs is greatly decreased in SLE patients (197, 208). Nevertheless, the expression of IFN-I is significan tly higher in SLE peripheral blood than in normal controls (141, 142, 183, 197). The presence of PDCs in SLE patients skin lesions has been invoked as an explanation for this paradox (209, 210). However, recent data in TMPD-induced murine lupus indicate that most of the IFN-I is derived from an

PAGE 75

75 immature Ly6Chi monocyte population (200). The presen t study was an effort to determine whether a similar cell type might be involved in IFN-I production in human lupus. As human monocytes do not express Ly6C, additional surface markers were evaluated. We show here that CD14+CD71+monocytes produce a significant amount of IFN-I in SLE and may be the human equivalent of Ly6Chi monocytes in murine lupus. Depl etion of these cells from PBMC populations using magnetic beads gr eatly reduced the amount of IFN and IFN mRNA whereas purified CD14+CD71+ cells exhibited higher levels of IFN gene expression than CD14+CD71or CD14cells. Moreover, the num ber of circulating CD71+ monocytes correlated with IFN and Mx1 expression by PBMCs, whereas the number of PDCs correlated in versely. These data challenge the concept that PDCs are exclusively responsible for the increased level of IFN-I in SLE. Production of IFN-I by CD71+ Monocytes in SLE In murine TMPD-induced lupus, the developm ent of glom erulonephriti s and autoantibodies against the Sm/RNP and dsDNA antigens require s signaling through the Type I IFN receptor (199). Much of the IFN-I driving these autoantibodies appears to be derived from a population of immature (Ly6C+) monocytes (200). Elimination of dendr itic cells by diphtheria toxin treatment of CD11c-diphtheria toxin receptor (CD11c-DTR) tr ansgenic mice has little effect on the ability of TMPD to induce IFN-I production, whereas elim ination of monocytes using clodronate loaded liposomes nearly abrogates TMPD-induced IFN-I production (200). The IFN-I producing monocytes have an immature phenotype (Ly6chiCD11b+Mac3+Moma2+Sca1+) and although short-lived, are rapidly replen ished from the bone marrow. Unfortunately, other than CD11b, these markers are not expressed on human cells necessitating the eval uation of additional surface markers for the identif ication of a putative human equivalent. The human CD14+CD71+ IFN-I producing cells, like the cells found previously in mice, appear to be immature monocytes.

PAGE 76

76 CD71 is found in proliferating cells, suggesting that the circulating CD14+CD71+ cells may have been exported recently from the bone marrow. In addition, CD14 is down-regulated during terminal differentiation of monocytes to either macr ophages or dendritic cells. It is unclear at this point whether, as in the mouse model (203), the CD14+CD71+ cells are somehow prevented from undergoing maturation. However, high IFN-I levels may help maintain their phenotype because they lose CD71 expression in culture in vitro within 4 hours, whereas the CD71+ phenotype can be maintained in the presence of IFN (data not shown). Although there is considerable overlap between monocytes a nd dendritic cells (25,26) (211, 212), we think that the interferon producing CD14+CD71+ cells are more closely akin to monocytes than to PDCs. These cells are strongly HLA-DR+, but surface markers characteristic of PDCs (CD11c and CD123) are not expres sed at higher levels than seen on CD14+CD71cells (Fig. 4-7 and data not shown). Moreover, by electron microscopy (Fig. 4-5B), these cells have the typical appearance of immature monocytes rather than the ex tensive rough endoplasmic reticulum and eccentrically placed nucleus typical of PDCs (153). Although PDCs are considered by some investigators to be the ma in source of IFN-I in SLE (213), a significant amount of IFN-I can be produced by non-PDCs from SLE peripheral blood (150). Monocyte derived IFN-DCs express high levels of TLR7 and produce IFN as do the CD14+CD71+ cells, but unlike the latter subset, th ese cells down-regulate CD14 e xpression (214). While we cannot exclude the possibility that the CD14+CD71+ IFN-producing cells are IFN-DCs, the fact that monocytes from SLE patient s are more strongly CD14+ than those from healthy controls (Fig. 4-3C) and that the expr ession was similar on CD71+ vs. CD71cells (Fig. 4-4) further supports the viewpoint that the CD14+CD71+ cells are immature monocytes.

PAGE 77

77 Mechanism of IFN-I Production The striking correlation between the level of IFN mRNA on the one hand and Mx1 expression on the other with num bers of circulating CD71+ monocytes (Fig. 4-4D-E) and the inverse relationship between the numbers of circulating PDCs and Mx1 expression (Fig. 4-1C) raises the possibility that the mu ch of the interferon responsible for increased IFN-inducible gene expression in lupus PBMCs may be produced locally (i.e. in the circulation). Unfortunately, it is difficult to evaluate the contributi on of IFN-I produced at distant site s, such as lupus skin lesions (209, 210). At present, it is not known how the CD14+CD71+ cells are triggered to produce IFN-I. In mouse models, the importance of signaling vi a TLR7 is becoming increasingly clear (86, 215, 216). It is noteworthy, therefore, that the RNA components of the common lupus autoantigens Sm/RNP (U1 RNA) and Ro60 (Y RNAs) are TLR7 ligands capable of stimulating IFN-I production in vitro (163). It ha s been reported that U1 RNA exclusively stimulates IFN-I production in CD14+ monocytes bu t not PDCs (217). Consistent these observations, we found a strong association of anti-U1-A (RNP) autoantibodies with the pr esence of increased numbers of CD71+ monocytes (Fig. 4-7). In addition, we f ound that expression of TLR7 is expressed on lupus monocytes at levels approaching the expre ssion of this molecule on B cells (Fig. 4-3). Preliminary study showed that level of TLR7 in lupus monocytes was higher than on control monocytes (data not shown). Stimulation wi th TLR7 ligands was able to induce IFN-I production in lupus monocytes (Fig. 4-3F). Intere stingly, we also found th at IRF-7 is expressed at high levels in monocytes from SLE patients vs healthy controls (Fi g. 4-3C). IRF-7 is an interferon-inducible transcription factor that interacts with and is activated by MyD88/TRAF6 and is absolutely required for IFN-I production (218, 219). It is e xpressed constitutively at high levels in PDCs (157, 220), but also is expressed in monocytes where it is thought to play a role in terminal differentiation into macrophages (221-223). The high level of IRF-7 expression in

PAGE 78

78 CD14+ cells from SLE patients sugges ts that, like PDCs, these cells may be poised to respond to ligands capable of interacting wi th endosomal TLRs (TLR7, 8, and 9). It is of some interest, therefore, that the activati on of TLR9 by its ligands occu rs in transferrin receptor (CD71)-positive endoso mes and leads to IFN production (224). Furthe r studies are needed, however, to define the role if any of endos omal TLRs in activating IFN-I production by CD14+CD71+ cells.

PAGE 79

79 Figure 4-1. Reduced plasmacytoid dendritic cells in SLE and correlation between CD14+CD71+ monocytes. A) Flow cytom etry of PDCs from SLE patients and health controls. PDCs were characterized as LinHLA-DR+CD 11c-CD123+ cells. B) frequency of PDCs was decreased in SLE patients (n=) compar e to healthy controls (n=) (p<0.01) C. Negative correlation between frequency of CD14+CD71+ monocyte and PDCs (p<0.05) CD11C-APC CD123-PE 100101102103104 100101102103104 Gate 3 CD11c-APC CD123-PE 100101102103104 10010110210310 4 Gate 3B A SLE 0.06% 0.4% CD11c CD123 Lin SS FS HLADRC 0 1 2 3 0 2000 4000 6000 8000 10000 P < 0.05PDC (%)Relative Mx1 expression SLE NHC 0.0 0.5 1.0 1.5 2.0 2.5P = 0.001 (n = 75)(n = 21)PDC (%) SS FS 016384327684915265536 0 16384 32768 49152 65536 Gate 1 HLA-DR-PerCP LIn-FITC 100101102103104 10010110210310 4 70.39%12.70% 12.08%4.83% HLA-DR-PerCP LIN-FITC 100101102103104 100101102103104 20.58%4.74% 73.74%0.94% ___y_ SS FS 016384327684915265536 0 16384 32768 49152 65536 Gate 1Healthy Control

PAGE 80

80 Figure 4-2. Production of IFN-I by CD14+ cells. PBMCs from S LE patients or healthy were isolated from fresh peripheral blood by Fi coll. C D14+ cells and CD19+ cells were enriched by magnetic beads respectively. R NA were isolated by Trizol reagent and reverse transcripted into cDNA. Expression of A) IFN 2 or B) IFN in lupus patients and C) IFN in healthy controls were de termined by real time PCR. A PBMC CD14+ CD141 10 100 1000 10000SLE NHC IFN2 expressionB PBMC PDC dpl CD14+ CD14 dpl 1 10 100 1000 10000 SLEIFNb expression PBMC CD14+ CD14CD19+ CD190 1000 2000 3000 IFNb expression PBMC PDC dpl CD14+ CD14 dpl 0 50 100 150 200 250Healthy controlsRelative IFN expressionC

PAGE 81

81 Figure4-3. SLE monocytes express high level of TLR7, IRF7 and CD14 and produce IL-6 as well as IFN in response to loxoribine stim ulation. A), TLR7 expression in monocytes from SLE patients, patients with other autoimmune disease and normal controls. (One way ANOVA). B, C), TLR7 and IRF7 expression in PBMCs, CD14+ monocytes, CD14cells, CD19+ B cells and CD19cells determined by real time PCR. D, CD14 expression determined by fl ow cytometry in normal controls and SLE patients without steroid treatment. E, F) PBMCs, CD14+ monocytes and CD14cells were stimulated with PIC (50 g/ml), LPS (100 ng/ml), loxoribine (50 g/ml) or CpG2216 (10 g/ml) for 6 hours. IL-6 and IFN expression was measured by real time PCR. PBMC CD14+ CD14CD19+ CD190 50 100 150 200TLR7 expression PBMC CD14+ CD14CD19+ CD190 50 100 150 200SLE NHC IRF 7 expression SLE Other NHC 0 5 10 15 20 25TLR7 P<0.05 ns ns C PIC LPS LOX CpG 10 100 1000 10000 100000PBMC CD14+ CD14Relative IL-6 expression Control SLE no steroid 0 400 800 1200 n = 92 P < 0.04MFI of CD14 on monocyte C PIC LPS LOX CpG 1 10 100 1000 10000 100000PBMC CD14+ CD14Relative IFN expression E F C D A B

PAGE 82

82 Figure 4-4. Increased CD14+ CD71+ monocyte in SLE and correlation of IFN-I production. A,B) Flow cytometry showing increased CD14+ CD71+ monocyte in SLE. Upper panels, flow cytometry of monocytes in normal c ontrols (left) and SLE patients (right). Lower panel, isotype control. Results is a representative staini ng of over 60 of such experiments. C) percentage of CD71+ cell of total monocytes was increased in SLE patients compare to normal controls (unpaired t-test, p<0.005). D) correlation between frequency of CD14+CD71+ monocytes and PDCs. E, F) The percentage of CD71+ monocyte was positively correlated with IFN and Mx1 expression (Spearmans test, p=0.003, p=0.01 re spectively). Expression of IFN and Mx1 in whole blood was determined by real time PCR. A B 0 10 20 30 40 50 60 70 0.0 0.5 1.0 1.5 2.0 2.5CD71+ monocytes(%)PDC (%)D CD71-PE CD14-PerCP 100101102103104 100101102103104 0.78% 93.30% 0.10% 5.83% CD71-PE CD14-PerCP 100101102103104 100101102103104 5.71% 1.24% 90.15% 2.90% ISO-PE CD14-PerCP 100101102103104 10010110210310 4 0.41% 92.94% 0.19% 6.47% ISO-PE CD14-PerCP 100101102103104 10010110210310 4 5.84%0.05% 94.07%0.05%C F SLE NHC 0 10 20 30 40 50 60P= 0.01 (n = 75) (n = 21)CD71+(% of CD14+)P=0.01 E 0 10 20 30 40 50 60 70 0 1000 2000 P = 0.003CD71+ monocytes (%) Relative IFN expression 0 10 20 30 40 50 60 70 0 2000 4000 6000 8000 10000 P = 0.01CD71+ monocytes (%)Relative Mx1 expression

PAGE 83

83 Figure4-5. Production of IFN-I by CD14+CD71+ m onocytes. PBMCs were isolated by Ficoll. CD14+CD71+ or CD14+CD71m onocytes we re enriched by cell sorting. IFN expression was detected by real time PCR. A), IFN expression in CD14+CD71+ monocytes, CD14+CD71monocytes and CD 14cells. B), Electron microscopy of CD14+CD71+ monocytes. C), longitudinal study of Mx1 expression and CD14+ CD71+ monocytes in one lupus patients. A B CD14+CD71+ CD14+CD71CD14-CD710 1000 2000 3000Relative IFN expressionP = 0.016 6/26 9/11 10/7 0 10 20 30 40Date of sampleCD71+ monocytes (%) 6/26 9/11 10/7 700 900 1100 1300Date of sampleRelative Mx1 expressionC

PAGE 84

84 Figure4-6. Percentage of CD71+ cells correla tes with anti-U1A an tibody production. A), CD71+ monocytes counts were significantly higher in patients with anti-U1A antibody com pared to anti-U1A negative patients. B,C), MDC or PDC counts were not associated with anti-U1A antibodies. anti-U1A (+) anti-U1A (-) 0 1 2 3MDC (%) anti-U1A (+) anti-U1A(-) 0 1 2 3PDC (%) anti-U1A (+) anti-U1A (-) 0 20 40 60P = 0.01CD71+ monocytes (%)A B C

PAGE 85

85 Figure 4-7. Characterizations of CD14+CD71+ monocyte in S LE blood. Surface expression of HLA-DR, CD64, CD62L and CD11 c were determined by flow cytometry. For each individual marker, MFI was shown on the le ft and histogram was shown on the right. CD14+CD71CD14+CD71+ 0 100 200 300 P <0.001HLA-DR (MFI)A HLA-DR-PerCP Count 100101102103104 0 13 27 40 53 CD71+ CD71IsotypeB C CD14+CD71+ CD14+CD710 50 100 150CD11c (MFI)D DC62L-APC-Cy7 Count 100101102103104 0 173 347 520 693 CD11C-APC Count 100101102103104 0 4 8 12 16 CD14+CD71CD14+CD71+ 0 200 400 600CD62L (MFI)P < 0.05 CD14+CD71CD14+CD71+ 0 200 400 600 P = 0.005CD64 (MFI) CD62LF Count 100101102103104 0 13 25 38 50 CD64-FITC

PAGE 86

86 CHAPTER 5 RESULTS AND DISCUSSION: LUPUS-LI KE DISEASE AND HIGH INTERFERON LEVELS CORRESPONDING TO TRISOMY OF THE TYPE I INTER FERON CLUSTER ON CHROMOSOME 9P Introduction Systemic lupus erythematosus (SLE) is a multisystem autoimmune disease characterized by antinuclear antibodies (ANAs) and immune com plex deposition in the kidneys and other organs (225). Susceptibility is conferred by multiple genes in a manner consistent with a threshold liability model, whereas disease onset may be influenced by environmental triggers (226, 227). Hereditary complement deficiency, defective complement receptor function (228), and Fc receptor polymorphisms (229) are among the genetic factors contributing to SLE. Recent interest has focused on the role of type I in terferons (IFNs), such as IFN and IFN. Patients with SLE exhibit increased levels of IFN in the serum (184, 186), Moreover, in the peripheral blood mononuclear cells (PBMCs) of SLE patients, IFN-inducible genes are expressed at increased levels (141, 142, 183, 197). Therapeutic use of IFN induces ANAs or even overt SLE in some individuals (139, 194), s uggesting that IFN may pl ay a causative role. It is unknown whether the increased IFN production in SLE reflects a genetic defect or the action of unidentified environmental factors. Type I IFNs, produced by most cell types in response to viral in fection, link innate immunity with adaptive imm unity (172, 230, 231). The 14 IF N genes, 4 IFN pseudogenes, and single IFN and IFN genes are clustered on the sh ort arm of chromosome 9 within a genomic duplication (187, 232, 233). Decreased IFN production by cells with only 1 copy of the type I IFN cluster may promote neoplasia (234). The pr esent study addresses the question of whether individuals with 3 copies of th e type I IFN cluster produce high levels of type I IFN due to a gene-dosage effect, resulting in in creased susceptibility to SLE.

PAGE 87

87 Results Pedigree There have been more than 150 reports of indivi duals with a partial or complete trisomy of Chrom osome 9 (235). About half of the cases of a partial tris omy of Chromosome 9 were the result of a 3:1 segregation of a balanced parental translocatio n (236). We herein describe a family in which 4 of the members had a ba lanced translocation of Chromosome 9 to Chromosome 21, referred to as 9;21, while 2 individuals had an unbalanced translocation resulting in trisomy of 9p, the chromosomal regi on encoding the type I IFN cluster (Figure 5-1). The proband subject (designated UB1), who had an unbalanced translocation and trisomy of 9p, was evaluated for joint pain and ANA positivity. His similarly affected half -brother (subject UB2) was also evaluated, along with 3 relatives who had balanced transl ocations (subjects B1, B2, and B3) (Figure 5-1). Case Reports Subject UB1, a 28-year-old white man with dysmorphia, had developmental delay, protuberant ears, m icrognathia, clubbed feet, bilateral syndactyl y of the second and third toes, bilateral camptodactyly of th e third and fourth metacarpophalangeal (MCP) joints, smooth transverse palmar creases, and profound mental retardation, as we ll as a history of grand mal seizures since age 10 years that were treated with phenytoin and carbamazepine. His karyotype was 46,XY,-21,+der(9),t(9;21)(q22.3;q21)mat, rendering him partially monosomic for the proximal third of the long (q) arm of Chromosome 21, and partially trisomic for the short (p) arm of Chromosome 9 as well as for the proximal portion of the q arm of Chromosome 9 (Figure 5-2A). The subject was evaluated for polyarthralgias and progressive joint deformities as well as a positive test result for ANAs (>1:1,280, speckled), and he was observed to have faint m alar

PAGE 88

88 erythema, livedo reticularis of the legs, and mu ltiple reducible subluxations of the proximal interphalangeal and MCP joints, with ulnar deviation bilaterally. Radiographs revealed nonerosive subluxation of the MCP joints and bo utonniere deformity of the third digit of the right hand, suggestive of Jaccoud's arthropat hy. Blood cell counts and renal function were normal. The erythrocyte sedimentation rate was 51 mm/hour. Anti-RNP autoantibodies and IgM-anticardiolipin an tibodies (33 IgM phospholipid units) were detected by ELISA. Anti-Sm, anti-Ro/SSA, anti-La/SSB, anti-dsDNA antibodies, and rheumatoid factor were not detected. Levels of C3 and C4 were 110 and 18 arbitrar y units, respectively. The subject was treated successfully with nonsteroidal anti inflammatory agents. Subject UB2, the 14-year-old half-brother of subject UB1, had the sam e chromosomal, developmental, and physical abnor malities as those described above, with joint pain and mild sicca symptoms (Figure 5-2A). He was obser ved to have facial erythema, Raynaud's phenomenon, joint tenderness without swelling, a nd mild joint deformities. Hand radiographs showed narrowing of the carpa l joint spaces and diffuse bony demineralization. The subject had a history of grand mal seizures si nce age 3 years that were treated with phenytoin for 8 years. At the time of evaluation, phenytoin had been repla ced with divalproex sodium and oxcarbazepine and, 1 year later, with oxcarbazepine and leve tiracetam because of poor ly controlled seizures. His serum was anti-Ro positive (by ELISA) and negative for anti-Sm, anti-RNP, anti-La, anti-dsDNA, rheumatoid factor, a nd anticardiolipin antibodies. The levels of C3 and C4 were 99 and 31 arbitrary units, respectively. There was no change in his ANA status after phenytoin was changed to divalproex/oxcarbazepine or when le vetiracetam was substitu ted for divalproex. The patient achieved relief of symp toms following treatment with ar tificial tears and nonsteroidal antiinflammatory agents.

PAGE 89

89 The karyotype of the mother of these 2 patients (subject B1 in Figure 5-1) was 46,XX,t(9;21)(q22.31;q21.2), consistent with a bala nced translocation in volving the long arm of Chromosome 9 and the long arm of Chromoso me 21 (breakpoints 9q22.31 and 21q21.2) (Figure 2B). The subject was healthy, without evidence of autoimmunity. In addition to her 2 sons (subjects UB1 and UB2), the mother had a male child with a balanced translocation at 9;21 (subject B2 in Figure 5-1), a male child who died neonatally, and 2 miscarriag es (solid circles in Figure 1). One of the mother's siblings also ha d a balanced translocati on (subject B3 in Figure 5-1). Similar to subject B1, subjects B2 and B3 had no developmental abnormalities, seizures, or autoimmunity. There was no other fa mily history of autoimmunity. Immunologic Findings ANA patterns were speckled and nuclear (in subject UB1) and cyt oplasmic (in subject UB2) (Figure 5-3A). Sera from their healthy mother (subject B1) (Figure 5-3A) and from subjects B2 and B3 (results not shown) did not contain ANAs. Analysis of serum autoantibodies by radioimmunoprecipitation confirmed the pr esence of serum anti-RNP and anti-Ro 60 autoantibodies in subjects UB1 and UB2, respec tively (Figure 5-3B). Anti-Ro 60 antibodies remained detectable in the half-brother (subje ct UB2) after valproic acid was discontinued (results not shown). In contrast, sera from healthy rela tives B1, B2, and B3 showed an autoantibody pattern similar to that in nonauto immune controls (Figure 5-3B, right). Anti-Ro 52 autoantibodies were undetectable in the sera fr om subjects UB1, UB2, B1, B2, and B3 (results not shown). Because subjects UB1 and UB2 were both recei ving anticon vulsant medications, some of which have been associated with a low risk of drug-induced lupus syndrome (40), their sera were tested for autoantibodies char acteristic of the drug-induced lupus syndrome (anti-ssDNA and antichromatin). Tests of the sera of subjects UB1 and UB2 as well as the sera of family members

PAGE 90

90 B1, B2, and B3 all yielded negative results (not shown) for these autoanti bodies associated with drug-induced lupus. The absence of autoantibodies that are us ually found in drug-induced lupus and the presence of autoantibodies that are not asso ciated with drug-induced lupus (anti-RNP and anti-Ro 60) along with the continued producti on of anti-Ro 60 in subject UB2 after anticonvulsant therapy was changed led us to inve stigate other potential explanations for the developm ent of lupus-like disease and serologic changes in both of the subjects with an unbalanced translocation compared with the absen ce of these features in their relatives with a balanced translocation. In view of recent eviden ce implicating IFN in the pathogenesis of SLE (139, 194, 237), it was notable that the IFN cluster is located on the short arm of Chromosome 9 (9p21) (Figure5-2) (187, 232). Karyotype analysis indicated th at subjects UB1 and UB2 wer e trisomic for the IFN cluster (Figure 5-2A). Coincidentally, genes for the 2 chains of the type I IFN receptor (IFNAR1 and IFNAR2) as well as the IFN-inducible genes Mx1 and Mx2 are located on Chromosome 21, but these were not involved in the translocation (i.e ., subjects UB1 and UB2 had 2 copies of each). We therefore investigated IFN 4 and IFN expression in PBMCs from subjects UB1 and UB2 and their healthy mother (subject B1) in co mparison with that in the PBMCs from 10 SLE patients and 10 normal healthy controls (Figures 5-4A and B). In comparison with controls, IFN 4 and IFN expression was increased in the PBMC s from subjects UB1 and UB2 and was increased in those from the patients with SLE (Figures 5-4A and B). Expression of IFN 4 and IFN in subjects UB1 and UB2 was increased 7-8-fo ld over the mean value in healthy controls. In contrast, the mother (subject B1) expressed IFN 4 and IFN messenger RNA (mRNA) at normal levels. Not only was type I IFN mRNA expr ession increased in the PBMCs from subjects

PAGE 91

91 UB1 and UB2, but IFN protein expression was increas ed as well, since the expression of Mx1, a gene induced specifically by IFN (176), also wa s increased in the PBMCs from subjects UB1 and UB2 and in those from the SLE patients, as co mpared with those from healthy controls and subject B1 (Figure 5-4C). Expression of the -chain of IFNAR2 is down -regulated upon binding of IFN / (23 8). The levels of IFNAR2 in the PBMCs from subjects UB1, UB2, and the SLE patients were somewhat decreased compared with those in hea lthy controls and subject B1 (results not shown). Comparison of subjects UB1, UB2, and B1 with SLE patients and healthy controls did not reveal significant differences in the levels of IL-6 (Figure 5-4D) or TNF (results not shown). Subject UB2 exhibited persiste ntly high levels of IFN, since blood sam ples obtained 10 months apart showed similar IFN 4, IFN and Mx1 expression (Figure 5-5A). Circulating plasmacytoid dendritic cells, the major IFN-prod ucing cell type, were examined in subjects UB1 and UB2 by flow cytometry (Figure 5-5B). It is known that SLE patients have low numbers of circulating plasmacytoid dendritic cells compar ed with healthy controls (150, 194), probably reflecting activation and migrati on to secondary lymphoid tissues (190). Subjects UB1 and UB2 had plasmacytoid dendritic cell counts that were lower than those in healthy controls (n = 10) and comparable with those in SLE patients (n = 10). Unexpectedly, subject B1 also had low numbers of circulating plasmacytoid dendritic cells (Figure 5-5B). Discussion We describe herein a pedigree with a chro m osomal translocation involving Chromosomes 9 and 21. Three individuals with a balanced translocation (subjects B1, B2, and B3) had no signs of autoimmunity. Two other family member s (subjects UB1 and UB2) had chromosome aberrations due to a 1:3 segregation (1 of the 4 translocated chromosomes segregated to one pole, while 3 segregated to the other pole), leading to trisomy of ch romosome 9p and the proximal arm

PAGE 92

92 of 9q as well as monosomy of the proximal arm of 21q. Remarkably, both patients with trisomy of 9p presented with lupus-like autoimmunity and abnormalities in the regulation of type I IFN. We hypothesize that their autoimmun ity may have been related to having 3 copies of the type I IFN cluster located on the p ar m of chromosome 9 (187, 232). It is unlikely that the presence of lupus-like disease in 2 family members with an unbalanced translocation and its absence in 3 relatives with a balanced translocation w as coincidental. Since subjects UB1 and UB2 had di fferent fathers, a genetic predisposition to autoimmunity, if present, would most likely ha ve been derived from the mother. However, neither the mother nor any maternal relatives had evidence of autoimmunity. Although their mother had low numbers of circulating plasmacyto id dendritic cells, as has been seen in patients with SLE (150, 197), unlike subjects UB1 and UB2, the mother did not express high levels of IFN 4 or IFN mRNA (Figures 5-4 A and B), nor was there increased type I IFN signaling, as indicated by the low Mx1 expressi on (Figure 5-4C). Thus, although it is possible that subject B1 had an abnormality in regulating plasmacytoid dendritic cells, she appeared to have normal regulation of type I IFN production. The most lik ely interpretation is that the autoimmune phenotype exhibited by subjects UB 1 and UB2 was related to the presence of 3 copies of the type I IFN gene cluster. A previous report of lupus-like diseas e in a patient with the karyotype 46,XX,-6,+der(6),+t(6,9)pat, which resulted in a partial trisomy of Chromosom e 9 (239, 240), further supports the idea that the lupus-like disease was related to a chromosomal abnormality. Similar to subjects UB1 and UB2, this patient wi th a translocation 6;9 had seizures. Although her lupus-like disease was attributed to anticonvulsan t therapy with sodium valproate (239), this would be a rare occurrence, and definitive evidence supporting the diagnosis of drug-induced

PAGE 93

93 lupus was not presented. It is unlikely that subjects UB1 and UB2 had drug-induced lupus. Subject UB1 was taking phenytoin, which is associ ated with a low risk of drug-induced lupus (40), whereas subject UB2 initially received phenytoin, but it was re placed with sodium valproate/oxcarbazepine and subsequently with le vetiracetam. Sodium valproate is associated only anecdotally with drug-induced lupus (239, 241-243), and the anti-Ro 60 autoantibodies persisted after sodium valproate was replaced by oxcarbazepine and levetiracetam, neither of which is associated with drug-induced lupus (244). Since the l upus-like syndrome and autoantibody production did not abate when th e anticonvulsant regimen was altered, and since the autoantibodies classically associated with drug-induced lupus (anti-ssDNA and antichromatin) (40) were not detected, whereas subjects UB1 and UB2 both produced autoantibodies (anti-RNP, anti-Ro 60) not associated with drug-induced lupus, we conclude that subjects UB1 and UB2 did not have drug-induced lupus. Because Chromosome 9p was involved in th e translocation (187, 232) an d the patients with trisomy of the type I IFN cluster had higher levels of IFN4 IFN and Mx1 than did their mother or healthy controls (Figure 5-4), we suggest that increased gene dosage may have promoted lupus-like disease by enhancing IFN production. It is often assumed that genes present in 3 copies in trisomic individuals will be expres sed at a 1.5-fold higher le vel relative to euploid, a prediction that has been formally tested in the case of chromoso me 21 (245). The mean overexpression of all aneuploid genes on chromosome 21 was very close to the predicted 1.5-fold increase in a mouse Down syndrome mo del. However, only 37% of the genes were expressed at the theoretical va lue of 1.5-fold, whereas 45% were significantly underexpressed. Interestingly, 18% were overexpr essed (levels significantly highe r than 1.5-fold). Our data (Figures 5-4-5) are consistent with the possibili ty that the type I IFNs (on Chromosome 9) may

PAGE 94

94 be among the genes overexpressed in tr isomic individuals. It is possibl e that this is related to the positive feedback regulation of type I IFN production, i.e., interaction of secreted type I IFN with the type I IFN receptor stimulates the production of additional type I IFN (246). Another issue is the fact that alterations in gene expression measured at the tran script level may not always be accurately reflected at the protein level (247) However, the strikingly high Mx1 expression (induced by IFN protein binding to the IFN recep tor) strongly suggests that in this case, increased transcript level was closel y tied to increased protein level. Subjects UB1 and UB2 may exemplify individual s having a genetic defect that affects the regulation of type I IFN production and prom otes susceptibility to SLE. The data are consistent with the possibility that ot her genetic polymorphisms, point mutations, or chromosomal abnormalities affecting type I IFN production may be associated with lupus (31). Some patients treated with recombinant IFN develop ANAs, SLE, or autoimm une thyroiditis (139, 194), and disease is accelerated in lupus -prone mice treated with IFN (237). However, increased type I IFN also is associated with idiopathic SLE (141, 142, 183, 184, 186). Thus, the high levels of IFN exhibited by subjects UB1 and UB2 could be e ither the cause of their lupus or secondary to lupus. Although it is impossible to completely exclude the possibility that the increased IFN expression was secondary to lupus, the fact that disease was restri cted only to family members with a partial trisomy of 9p supports a causal role. In summary, disordered regulation of t ype I IFN was found in association with a chrom osomal translocation resulting in trisomy of the type I IFN clus ter. Individuals with trisomy of 9p developed a lupus-like syndrome, whereas their relative s with the balanced translocation showed no evidence of autoimmuni ty. The data support the idea that abnormal regulation of type I IFN production is invol ved in the pathogenesis of SLE (160).

PAGE 95

95 Figure5-1. Pedigree. Diagram of the kindred, indicating individuals with an unbalanced translocation 9;21 resulting in trisom y of chromosome 9p (subjects UB1 and UB2) and with a balanced translocation 9;21 (s ubjects B1, B2, and B3). The maternal grandmother of subjects UB1 and UB2 was also known to have a balanced translocation (not shown). Miscarriages ar e indicated as solid circles. The proband (index case) is indicat ed with an arrow. t9;21 (unbalanced trisomy 9p) t9;21 (balanced translocation) unaffected UB1 UB2 B1 B2 B3

PAGE 96

96 Figure 5-2. Karyotype analysis of subject UB2 and subject B1. A) The karyotype of subject UB2 was determ ined by GTG-banding (similar to th at of subject UB1 [ not shown]). Right, diagram of 9;21 and the derivative chro mosomes 9 and 21 from subjects UB1 and UB2. Chromosome 9 is shown in dark hatc hing and chromosome 21 in light hatching. Chromosome bands 9p21 (type I interfer on [IFN-I] gene cluster), 21q22.11 (IFN-I receptors 1 and 2), and 21q22.3 (Mx1, Mx2) are shown as dark bands on their respective chromosomes. B) The karyotype of subject B1 (the mother of subjects UB1 and UB2) was determined by GTG-banding. Right, diagram of 9;21 and the derivative chromosomes from subjects B1, B2, and B3.

PAGE 97

97 Figure 5-3. Autoantibody testing. A) Fluorescence antinuclear antibody test. HeLa cells were stained with sera from subjects UB 1, UB2, and B1 (1:160) followed by Alexa-conjugated goat anti-human IgG and 4 ,6-diamidino-2-phenylindole staining as described in patients and methods. Subject UB1, nucle oplasmic immunofluorescence pattern. Subject UB2, cytoplasmic pattern. Subject B1, no difference from control normal human serum (not shown). B) I mmunoprecipitation. Serum samples from subjects UB1, UB2, and B1, B2, and B3 were used to immunoprecipitate proteins from 35S-methonine/cysteine-labeled K 562 cell extract followed by analysis on 12.5% sodium dodecyl sulfate-polyacrylamide gels. Radiolabeled proteins were detected by fluorography. Sm = anti-Sm reference serum; Ro/La = anti-Ro/SSA/anti-La/SSB reference serum; Ro = anti-Ro/SSA reference serum; N = normal human serum. Positions of the U1 small ribonucleoprotein antigens A, B /B, C, D1/D2/D3, E, F, and G as well as the 200K (doublet) U5 small ribonucleoprotein antigens are indicated. An ti-Sm antibodies immunoprecipitate A-G plus 200K, whereas anti-RNP antibodies immunoprecipita te only A-G. Positions of the Ro60 and La/SSB antigens are also indicated.

PAGE 98

98 Figure 5-4. Type I interferon (IFN) expressi on. P eripheral blood mononuclear cells (PBMCs) were isolated as described in pati ents and methods. Expression of IFN 4 (A), IFN (B), the IFN-inducible gene Mx1 (C), and interleukin-6 (IL-6) (D) was analyzed by real-time polymerase chain reaction. Tota l RNA was isolated from PBMCs (subjects UB1, UB2, and B1) and from patients with systemic lupus erythematosus (SLE) and 10 healthy controls (NHC). SLENHCB1UB2UB1 0 25 50 75 100Mx1 expression SLENHCB1UB2UB1 0 25 50 75 100IL-6 expression SLE NHC B1 UB2 UB1 0 200 400 600IFN 4 expression SLE NHC B1 UB2 UB1 0 25 50 75 100IFN expressionA C B D D

PAGE 99

99 Figure 5-5. Regulation of interfer on (IFN) production. A) Gene e xpression pattern in subject UB2 re mains similar over time. RNA was isolated from peripheral blood mononuclear cells (subject UB2) on 2 separa te occasions 10 months apart, and Mx1, IFN IFN 4, IFNAR2, interleukin-6 (IL-6), and tumor necrosis factor (TNF ) gene expression was measured by realtime polymerase chain reaction. B) Low numbers of circulating plasm acytoid dendritic cells (PDC ). Numbers of circulating plasmacytoid dendritic cells (Lin-,HL A-DR+,CD123+,CD11c-) in peripheral blood of subjects UB1, UB2, and B1 and from 10 patients with systemic lupus erythematosus (SLE) and 10 healthy contro ls (NHC) were enumerated by flow cytometry. Bars show the median, boxes indi cate the 25th and 75th percentiles, and bars outside the boxes indicate the 10th and 90th percentiles. UB2 UB2 B1 0 100 200Mx1 IFNb IFNa4 IFNAR 2 IL-6 TNFa 1000 2000Relative expressionA NHC SLE B1 UB1 UB2 0.0 0.4 0.8 1.2Percentage of PDCB

PAGE 100

100 CHAPTER 6 CONCLUSION AND FUTURE DIRECTIONS The main goal of this research was to study the role of IFN-I and IFN-I producing cells in the pathogenesis of SLE. IFN-I levels were asses sed using real-time PCR to measure IFN-I inducible gene expression. IFN-I producing cells were character ized in the peripheral blood of lupus patients and finally, individuals with a tr isomy of chromosome 9p (l ocation of the Type I interferon gene cluster) provided a natural model to study the effects of IFN-I over-production in the pathogenesis of lupus. We found that IFN-I is up-regulated in patie nts with SLE in comparison with healthy controls and patients with other autoimmune di sease. Abnormally high IF N-I inducible gene expression (Mx1) was seen in about 30% of l upus patients. The high IFN-I levels were not associated with age, race or gender. Common treatments of SLE (low-does corticosteroids, antimalarials) did not have significant eff ects on IFN-I levels although high does of corticosteroids (e.g. 1 gram of methylpredniso lone IV daily for 3 days) did reduce IFN-I expression dramatically. High IFN-I levels in SLE were associated with the production of certain autoantibodies, such as ANA, anti-dsDNA, an ti-Sm/RNP antibodies and was negatively associated with antiphospholipid an tibodies. High IFN-I levels were also associated with active disease. The numbers of PDCs, the most efficient IFN producing cells, as well as MDCs were significantly decreased in lupus circulation. We further demonstr ated that low PDC/MDC counts were correlated with production of anti-Sm/R NP antibodies and negativ ely associated with antiphospholipid antibodies. Low PDC/MDC count s were seen in patients with renal involvement as well as more extensive disease. Secondly, we found increased numbers of circulating CD14+CD71+ monocytes in SLE compared with healthy controls. The numbers of these cells were negatively correlated with PDC

PAGE 101

101 numbers and positively with IFN-I levels in lupu s patients. These cells produced significantly higher IFN-I in compared with CD14+CD71or CD14cells. We also found increased TLR7 expression on lupus monocytes. Stimulation w ith the TLR7 ligand loxorib ine induced IFN-I as well as IL-6 production by lupus monocytes. Stim ulation of LPS (TLR4 ligand) also stimulated IFN-I by SLE monocytes, but less efficiently than loxoribine. We also f ound that the numbers of CD14+CD71+ monocytes were higher in patients with antibodies against U1 small nuclear ribonucleoproteins (snRNPs), suggesting that endogenous RNA ligands for TLR7 might play a role in the pathogenesis of the int erferon signature in SLE patients.. Finally we reported a pedigree with a chro m osomal translocation involving chromosomes 9 and 21. Three individuals with a balanced translocation had no signs of autoimmunity. Two other family members had chromosome aberrations due to a 1:3 segregation resulting in trisomy of the proximal arm of 9q includ ing the IFN-I cluster which is located on 9p22 as well as monosomy of the proximal arm of 21q. Both patients with trisomy of 9p presented with lupus-like autoimmunity and production of ANA as well as anti Sm/RNP or anti-Ro60 antibodies. Both patients had highe r IFN-I levels than the normal family members with balanced translocation or normal controls. IF N-I levels were comparable to those found in idiopathic lupus. Interestingly both patients had low dendritic cell numbers, similar to SLE patients, and this was also seen in their mothers peripheral blood (bal anced translocation 9:21 w ithout autoimmunity). Type I interferon is important cytokine in both innate and adaptive immunity. In addition to its antiviral effects, IF N-I also induces MH C class II expression on antigen presenting cells, promotes dendritic cell (DC) matu ration and survival and the surv ival of activated T cells and antigen-activated B cells. The high IFN-I levels as well as low dendritic cell count might be explained by the maturation of DCs. It has be en proposed that upon maturation, PDCs upregulate

PAGE 102

102 expression of chemokine receptor CCR7 and become responsive to chemokines such as SLC and ELC, resulting in migration out of the circulatio n and into secondary lymphoid tissues. Further studies of the distribu tion as well as maturation of dendritic cells, monocytes, and macrophages in skin, kidney and other lymphoid tissues will be helpful to unders tand the fate of IFN-I producing cells in SLE. Gene e xpression assays and immunostaining of IFN-I in these tissues could be used to define the origin of IFN-I directly. A monocyte phagocytosis defect affecting the clearance of dying cells has been reported in about half of lupus patients. In the T MPD -lupus model, immature interferon producing monocytes also are poorly phagocytic. We hypothesized that similar cells in the peripheral blood of SLE patients might be responsible for the obser ved monocyte phagocytosis defect. To test this hypothesis, phagocytosis assays will be carri ed out in the future using purified CD14+CD71+ monocytes and CD14+CD71monocytes. Genomic variability exists in different scales including SNP, sm all insertion and deletions, and large scale chromosome structure variatio ns. Here we reported patients with unbalanced translocation between Chromosome 9 and 21 deve loped a lupus like disease, suggesting gene dosage effect of IFN cluster was responsible for the increased risk of SLE. With recent development of gene array technology, several studies have revealed the existence of copy number variants of small DNA regions (248, 249 ). This phenomenon exists abundantly not only under pathogenic conditions but also in normal individuals. To test th e hypothesis that the elevated production of IFN-I in subgroup of SLE patients might due to copy number variants of IFN cluster, microarray experiments of regions related to IFN cluster will be performed. In conclusion, IFN-I produced by a novel population of imma ture CD71+) monocytes appear to be a significant factor in the pathogeneisis of SLE.

PAGE 103

103

PAGE 104

104 LIST OF REFERENCES 1. Silverstein, A. M. 2001. Autoimmunity vers us horror autotoxicu s: the struggle for recognition. Nat Immunol 2:279-281. 2. Tan, E. M., A. S. Cohen, J. F. Fries, A. T. Masi, D. J. McShane, N. F. Rothfield, J. G. Schaller, N. Talal, and R J. Winchester. 1982. The 1982 revised criteria for the classification of systemic lupus erythematosus. Arthritis Rheum 25:1271-1277. 3. Formiga, F., I. Moga, M. Pac, F. Mitjavila, A. Rivera, and R. Pujol. 1999. Mild presentation of system ic lupus erythematosus in elderly patients assessed by SLEDAI. SLE Disease Activity Index. Lupus 8:462-465. 4. Fessel, W. J. 1988. Epidemiology of systemic lupus erythematosus. Rheum Dis Clin North Am 14:15-23. 5. Deapen, D., A. Escalante, L. Weinrib, D. Horwitz, B. Bachm an, P. Roy-Burman, A. Walker, and T. M. Mack. 1992. A revised estimat e of twin concordance in systemic lupus erythematosus. Arthritis Rheum 35:311-318. 6. Hochberg, M. C. 1987. The application of genetic epidemiology to systemic lupus erythem atosus. J Rheumatol 14:867-869. 7. Sestak, A. L., T. S. Shaver, K. L. Moser, B. R. Neas, and J. B. Harley. 1999. Familial aggregation of lupus and autoimm unity in an unusual multiplex pedigree. J Rheumatol 26:1495-1499. 8. Moser, K. L., B. R. Neas, J. E. Salmon, H. Yu, C. Gray-McGuire, N. Asundi, G. R. Bruner, J. Fox, J. Kelly, S. Henshall, D. Bacino, M. Dietz, R. Hogue, G. Koelsch, L. Nightingale, T. Shaver, N. I. Abdou, D. A. Albert, C. Carson, M. Petri, E. L. Treadwell, J. A. Ja mes, and J. B. Harley. 1998. Genome scan of human systemic lupus erythematosus: evidence for linkage on chromosome 1q in Af rican-American pedigrees. Proc Natl Acad Sci U S A 95:14869-14874. 9. Gray-McGuire, C., K. L. Moser, P. M. Gaffney, J. Kelly, H. Yu, J. M. Olson, C. M. Jedrey, K. B. Jacobs, R. P. Ki mberly, B. R. Neas, S. S. Rich, T. W. Behrens, and J. B. Harley. 2000. Genome scan of human systemic lupus erythematosus by regression modeling: evidence of linkage and epistasis at 4p16-15.2. Am J Hum Genet 67:1460-1469. 10. Gaffney, P. M., W. A. Ortmann, S. A. Selby, K. B. Shark, T. C. Ockenden, K. E. Rohlf, N. L. W algrave, W. P. Boyum, M. L. Malmgren, M. E. Miller, G. M. Kearns, R. P. Messner, R. A. King, S. S. Rich, and T. W. Behrens. 2000. Genome screening in human systemic lupus erythematosus: results from a second Mi nnesota cohort and co mbined analyses of 187 sib-pair families. Am J Hum Genet 66:547-556.

PAGE 105

105 11. Gaffney, P. M., G. M. Kearns, K. B. Shark, W A. Ortmann, S. A. Selby, M. L. Malmgren, K. E. Rohlf, T. C. Ockenden, R. P. Messner, R. A. King, S. S. Rich, and T. W. Behrens. 1998. A genome-wide search for susceptibility genes in human systemic lupus erythematosus sib-pair families. Proc Natl Acad Sci U S A 95:14875-14879. 12. Yap, S. N., M. E. Phipps, M. Manivasagar, S. Y. Tan, and J. J. Bosco. 1999. Hum an Fc gamma receptor IIA (FcgammaRIIA) genotypin g and association with systemic lupus erythematosus (SLE) in Chinese and Malays in Malaysia. Lupus 8:305-310. 13. Leppers-van de Straat, F. G., W L. van der Pol, M. D. Jansen, N. Sugita, H. Yoshie, T. Kobayashi, and J. G. van de Winkel. 2000. A novel PCR-based method for direct Fc gamma receptor IIIa (CD16) allotyping. J Immunol Methods 242:127-132. 14. Oh, M., M. A. Petri, N. A. Kim, and K. E. Sullivan. 1999. Frequency of the Fc gamma RIIIA-158F allele in African Am erican patients with systemic lupus erythematosus. J Rheumatol 26:1486-1489. 15. Seligman, V. A., C. Suarez, R. Lum, S. E. I nda, D. Lin, H. Li, J. L. Olson, M. F. Seldin, and L. A. Criswell. 2001 The Fcgamma receptor IIIA-158F allele is a major risk factor for the development of lupus nephritis am ong Caucasians but not non-Caucasians. Arthritis Rheum 44:618-625. 16. Kobayashi, T., S. Ito, K. Yamamoto, H. Hasegawa, N. Sugita, T. Kuroda, S. Kaneko, I. Narita, K. Yasuda, M. Nakano, F. Gejyo, and H. Yoshie. 2003. Risk of periodontitis in system ic lupus erythematosus is associat ed with Fcgamma receptor polymorphisms. J Periodontol 74:378-384. 17. Yun, H. R., H. K. Koh, S. S. Kim, W. T. C hung, D. W Kim, K. P. Hong, G. G. Song, H. K. Chang, J. Y. Choe, S. C. Bae, J. E. Salmon, D. H. Yoo, T. Y. Kim, and S. Y. Kim. 2001. FcgammaRIIa/IIIa polymorphism and its associ ation with clinical manifestations in Korean lupus patients. Lupus 10:466-472. 18. Zuniga, R., S. Ng, M. G. Peterson, J. D. Reveille, B. A. Baethge, G. S. Alarcon, and J. E. Salm on. 2001. Low-binding alleles of Fcgamma receptor types IIA and IIIA are inherited independently and are associated with systemic lupus erythematosus in Hispanic patients. Arthritis Rheum 44:361-367. 19. Aitman, T. J., R. Dong, T. J. Vyse, P. J. Norsworthy, M. D. Johnson, J. Smith, J. Mangion, C. Roberton-Lowe, A. J. Marshall, E Petretto, M. D. Hodges, G. Bhangal, S. G. Patel, K. Sheehan-Rooney, M. Duda, P. R. Cook, D. J. Evans, J. Domin, J. Flint, J. J. Boyle, C. D. Pusey, and H. T. Cook. 2006. Copy number pol ymorphism in Fcgr3 predisposes to glomerulonephritis in rats and humans. Nature 439:851-855. 20. Szalai, A. J., M. A. McCrory, G. S. Cooper, J. W u, and R. P. Kimberly. 2002. Association between baseline levels of C-reactive protein (CRP) and a dinucleotide repeat polymorphism in the intron of the CRP gene. Genes Immun 3:14-19.

PAGE 106

106 21. Russell, A. I., D. S. Cunninghame Graham, C. Shepherd, C. A. Roberton, J. Whittaker, J. Meeks, R. J. Powell, D. A. Isenberg, M. J. W alport, and T. J. Vyse. 2004. Polymorphism at the C-reactive protein locus influences gene expression and predisposes to systemic lupus erythematosus. Hum Mol Genet 13:137-147. 22. Goldberg, M. A., F. C. Arnett, W. B. Bi as, and L. E. Shul man. 1976. Histocompatibility antigens in systemic lupus erythematosus. Arthritis Rheum 19:129-132. 23. Salmon, J. E., R. P. Kimberly, A. Gibofsky, and M. Fotino. 1986. Altered phagocytosis by monocytes from HLA-DR2 and DR3-positive healt hy adults is Fc ga mma receptor specific. J Immunol 136:3625-3630. 24. Kachru, R. B., W. Sequeira, K. K. Mitt al, M. E Siegel, and M. Telischi. 1984. A significant increase of HLA-DR3 and DR2 in systemic lupus erythematosus among blacks. J Rheumatol 11:471-474. 25. Hamilton, R. G., J. B. Harley, W. B. Bias, M. Roebber, M. R eichlin, M. C. Hochberg, and F. C. Arnett. 1988. Two Ro (SS-A) auto antibody responses in systemic lupus erythematosus. Correlation of HLA-DR/DQ spec ificities with quantitative expression of Ro (SS-A) autoantibody. Arthritis Rheum 31:496-505. 26. Dumortier, H., M. Abbal, M. Fort, J. P. Briand, A. Cantagrel, and S. Muller. 1999. MHC class II gene associations with autoantibodies to U1A and SmD1 proteins. Int Immun ol 11:249-257. 27. Sanchez, M. L., K. Katsumata, T. Atsumi, F. I. Rom ero, M. L. Bertolaccini, A. Funke, O. Amengual, E. Kondeatis, R. W. Vaughan, A. C ox, G. R. Hughes, and M. A. Khamashta. 2004. Association of HLA-DM polymorphism with the production of antiphospholipid antibodies. Ann Rheum Dis 63:1645-1648. 28. Schur, P. H., I. Meyer, M. Garovoy, and C. B. Car penter. 1982. Associations between systemic lupus erythematosus and the major histocompatibility complex: clinical and immunological considerations. Clin Immunol Immunopathol 24:263-275. 29. Christiansen, F. T., R. L. Dawkins, G. Uko, J. McCluskey, P. H. Ka y, and P. J. Zilko. 1983. Com plement allotyping in SLE: association with C4A null. Aust N Z J Med 13:483-488. 30. Fielder, A. H., M. J. Walport, J. R. Batchelor, R. I. Rynes, C. M. Black, I. A. Dodi, and G. R. Hughes. 1983. Fa mily study of the major histocompatibility complex in patients with systemic lupus erythematosus: importance of null alleles of C4A and C4B in determining disease susceptibility. Br Med J (Clin Res Ed) 286:425-428. 31. Sigurdsson, S., G. Nordmark, H. H. Goring, K. Lindroos, A. C. W iman, G. Sturfelt, A. Jonsen, S. Rantapaa-Dahlqvist, B. Moller, J. Kere, S. Koskenmies, E. Widen, M. L. Eloranta, H. Julkunen, H. Kristjansdottir, K. Steinsson, G. Alm, L. Ronnblom, and A. C. Syvanen. 2005. Polymorphisms in the tyrosine ki nase 2 and interferon regulatory factor 5 genes are associated with systemic lupus erythematosus. Am J Hum Genet 76:528-537.

PAGE 107

107 32. Graham, R. R., S. V. Kozyrev, E. C. Baechler, M. V. Reddy, R. M. Plenge, J. W Bauer, W. A. Ortmann, T. Koeuth, M. F. Gonzalez Escriban o, B. Pons-Estel, M. Petri, M. Daly, P. K. Gregersen, J. Martin, D. Altshuler, T. W. Be hrens, and M. E. Alarcon-Riquelme. 2006. A common haplotype of interfer on regulatory factor 5 (IR F5) regulates splicing and expression and is associated with increased risk of systemic lupus erythematosus. Nat Genet 38:550-555. 33. Mancl, M. E., G. Hu, N. Sangster-Guity, S. L. Olshalsky, K. Hoops, P. Fi tzgerald-Bocarsly, P. M. Pitha, K. Pinder, and B. J. Barn es. 2005. Two discrete promoters regulate the alternatively spliced human interferon regulator y factor-5 isoforms. Mu ltiple isoforms with distinct cell type-specific expression localization, regula tion, and function. J Biol Chem 280:21078-21090. 34. Garnier, S., P. Dieude, L. Michou, S. Barbet, A. Tan, S. Lasbleiz, T. Bardin, B. Prum and F. Cornelis. 2007. IRF5 rs2004640-T allele, the new genetic factor for systemic lupus erythematosus, is not associated with rheumatoid arthritis. Ann Rheum Dis 66:828-831. 35. Sanchez, F. O., M. V. Linga Reddy, K. Sakurab a, M. Stahle, and M. E. Alarcon-Riquelm e. 2008. IFN-Regulatory Factor 5 Gene Variants Interact with the Class I MHC Locus in the Swedish Psoriasis Population. J Invest Dermatol. 36. Cunninghame Graham, D. S., H. Manku, S. Wagne r, J. Reid, K. Ti mms, A. Gutin, J. S. Lanchbury, and T. J. Vyse. 2007. Association of IRF5 in UK SLE families identifies a variant involved in polyadenylation. Hum Mol Genet 16:579-591. 37. Shilyansky, J., P. Jacobs, K. Doffek, and S. L. Sugg. 2007. Induction of cytolytic T lym phocytes against pediatric solid tumors in vitro using autologous de ndritic cells pulsed with necrotic primary tumor. J Pediatr Surg 42:54-61; discussion 61. 38. Cavanagh, L. L., R. S. Barnetson, A. Basten, and G. M. Hallid ay. 1997. Dendritic epidermal T-cell involvement in induction of CD8+ T cell-mediated immunity against an ultraviolet radiation-induced skin tumor. Int J Cancer 70:98-105. 39. Nacionales, D. C., K. M. Kelly, P. Y. Lee, H. Zhuang, Y. Li, J. S. W einstein, E. Sobel, Y. Kuroda, J. Akaogi, M. Satoh, and W. H. Reeves. 2006. Type I interferon production by tertiary lymphoid tissue de veloping in response to 2,6,10,14tetramethyl-pentadecane (pristane). Am J Pathol 168:1227-1240. 40. Rubin, R. L. 2005. Drug-induced lupus. Toxicolo gy 209:135-147. 41. Elkayam, O., M. Yaron, and D. Caspi. 1999. Minocycline-induced autoimmune syndromes: an overview. Semin Arth ritis Rheum 28:392-397. 42. Bonaci-Nikolic, B., M. M. Nikolic, S. A ndrejevic, S. Zoric, and M. Bukilica. 2005. Antineutrophil cytoplasm ic an tibody (ANCA)-associated autoim mune diseases induced by antithyroid drugs: comparison with idiopathic ANCA vasculitides. Arthritis Res Ther 7:R1072-1081.

PAGE 108

108 43. Reiser, K. M., and J. A. Last. 1979. Silic os is and fibrogenesis: fact and artifact. Toxicology 13:51-72. 44. Haustein, U. F., V. Ziegler, K. Herrmann, J. Mehlhorn, and C. Schmidt. 1990. Silic a-induced scleroderma. J Am Acad Dermatol 22:444-448. 45. Askling, J., C. M. Fored, L. Brandt, E. Baecklun d, L. Bertilsson, N. Feltelius, L. Coster, P. Geborek, L. T. Jacobsson, S. Lindblad, J. Lys holm, S. Rantapaa-Dahlqvist, T. Saxne, and L. Klareskog. 2005. Risks of solid cancers in patients with rheumatoid arthritis and after treatment with tumour necr osis factor antagonists. Ann Rheum Dis 64:1421-1426. 46. Khan, M. F., B. S. Kaphalia, B. S. Pra bhakar, M. F. Kanz, and G. A. Ansari. 1995. Trichloroethene-induced autoimm une response in female MRL +/+ mice. Toxicol Appl Pharmacol 134:155-160. 47. Bigazzi, P. E. 1994. Autoimmunity and heavy metals. Lupus 3:449-453. 48. Vial, T., B. Nicolas, and J. Descotes. 1996. Clinical imm unotoxicity of pesticides. J Toxicol Environ Health 48:215-229. 49. Pujol, F. H., and I. M. Cesari. 1990. Antigen icity of adult Schistosom a mansoni alkaline phosphatase. Parasite Immunol 12:189-198. 50. Sewell, D. L., E. K. Reinke, L. H. Hogan, M. Sandor, and Z. Fabry. 2002. Immunoregulation of CNS autoimmunity by helm inth and mycobacterial infections. Immunol Lett 82:101-110. 51. Moran, A. P., and M. M. Prendergast. 2001. Molecular m imicry in Campylobacter jejuni and Helicobacter pylori lipopolysaccharides: contri bution of gastrointest inal infections to autoimmunity. J Autoimmun 16:241-256. 52. Lo, W. F., A. S. Woods, A. De Cloux, R. J. Cotter, E. S. Metcalf, and M. J. Soloski. 2000. Molecu lar mimicry mediated by MHC cla ss Ib molecules after infection with gram-negative pathogens. Nat Med 6:215-218. 53. Gharavi, A. E., S. S. Pierangeli, and E. N. Harris. 2003. Viral origin of antiphospholipid antibodies: endothelial cell activation and throm bus enhancement by CMV peptide-induced APL antibodies. Immunobiology 207:37-42. 54. Garzelli, C., A. Pacciardi, F. Basolo, and G. Falcone. 1989. Mechanism s other than polyclonal B cell activation possibly involved in Epstein-Barr virus-induced autoimmunity. Clin Exp Immunol 76:412-416. 55. Smeenk, R., T. Westgeest, and T. Swaak. 1985. Antinuclear antibody determ ination: the present state of diagnostic and clinical relevance. Scand J Rheumatol Suppl 56:78-92. 56. Hahn, B. H. 1998. Antibodies to DNA. N Engl J Med 338:1359-1368.

PAGE 109

109 57. Silverstein, A. M. 2000. Clemens Freihe rr von P irquet: explaining immune complex disease in 1906. Nat Immunol 1:453-455. 58. Bombardier, C., D. D. Gladman, M. B. Urowitz, D. Caron, and C. H. Cha ng. 1992. Derivation of the SLEDAI. A disease activity index for lupus patients. The Committee on Prognosis Studies in SLE. Arthritis Rheum 35:630-640. 59. Liang, M. H., S. A. Socher, W. N. Robert s, and J. M. Esdaile. 1988. Measurem ent of systemic lupus erythematosus activity in clinical research. Arthritis Rheum 31:817-825. 60. Symmons, D. P., J. S. Coppock, P. A. Bacon, B. Bresnihan, D. A. Isenberg, P. Maddison, N. McHugh, M. L. Snaith, and A. S. Zom a. 1988. Development and assessment of a computerized index of clinical disease activity in systemic lupus erythematosus. Members of the British Isles Lupus Assessment Group (BILAG). Q J Med 69:927-937. 61. Hench, P. 1950. Effects of cortis one in the rheumatic diseases. Lancet 2:483-484. 62. Barnes, P. J., and M. Karin. 1997. Nuclear facto r-kappaB: a pivotal tran scription factor in chronic inflammatory dis eases. N Engl J Med 336:1066-1071. 63. Berrebi, D., S. Bruscoli, N. Cohen, A. Foussa t, G. Migliorati, L. Bouchet-Delbos, M. C. Maillot, A. Portier, J. Couderc, P. Galanaud, M. Peuchm aur, C. Riccardi, and D. Emilie. 2003. Synthesis of glucocorticoid-induced leucine zipper (GILZ) by macrophages: an anti-inflammatory and immunosuppressive mechanism shared by glucocorticoids and IL-10. Blood 101:729-738. 64. Ertel, W., M. H. Morrison, A. Ayala, a nd I. H. Chaudry. 1991. Chloroquine attenuates hem orrhagic shock-induced suppression of K upffer cell antigen pr esentation and major histocompatibility complex class II antigen ex pression through blockade of tumor necrosis factor and prostaglandin release. Blood 78:1781-1788. 65. Fox, R. I., and H. I. Kang. 1993. Mechanism of a ction of antimalarial dr ugs: inhibition of antigen processing and presentation. Lupus 2 Suppl 1:S9-12. 66. Lund, J. M., L. Alexopoulou, A. Sato, M. Karow, N. C. Ada ms, N. W. Gale, A. Iwasaki, and R. A. Flavell. 2004. Recognition of singl e-stranded RNA viruses by Toll-like receptor 7. Proc Natl Acad Sci U S A 101:5598-5603. 67. Moreland, L. W., S. W. Baumgartner, M. H. Schiff, E. A. Tindall, R. M. Fleischm ann, A. L. Weaver, R. E. Ettlinger, S. Cohen, W. J. Koopman, K. Mohler, M. B. Widmer, and C. M. Blosch. 1997. Treatment of rheumatoid ar thritis with a recombinant human tumor necrosis factor receptor (p75)-Fc fusion protein. N Engl J Med 337:141-147. 68. Lipsky, P. E., D. M. van der Heijde, E. W. St Clair, D. E. Furst, F. C. Breedveld, J. R. Kalden, J. S. Sm olen, M. Weisman, P. Emer y, M. Feldmann, G. R. Harriman, and R. N. Maini. 2000. Infliximab and methotrexate in the treatment of rheumatoid arthritis. Anti-Tumor Necrosis Factor Trial in Rheumatoid Arthritis with Concomitant Therapy Study Group. N Engl J Med 343:1594-1602.

PAGE 110

110 69. Weinblatt, M. E., E. C. Keystone, D. E. Fu rst, L. W Moreland, M. H. Weisman, C. A. Birbara, L. A. Teoh, S. A. Fischkoff, and E. K. Chartash. 2003. Adalimumab, a fully human anti-tumor necrosis factor alpha monoclonal antibody, for the treatment of rheumatoid arthritis in patients taking c oncomitant methotrexate: the ARMADA trial. Arthritis Rheum 48:35-45. 70. Johnston, A., J. E. Gudjonsson, H. Sigmundsdottir, B. R. Ludviksson, and H. Valdim arsson. 2005. The anti-inflammatory actio n of methotrexate is not mediated by lymphocyte apoptosis, but by the suppression of activation and adhesion molecules. Clin Immunol 114:154-163. 71. Segal, R., M. Dayan, H. Zinger, and E. Mo zes. 1995. Methotrexate treatm ent in murine experimental systemic lupus erythematosus (SLE); clinical benefits associated with cytokine manipulation. Clin Exp Immunol 101:66-72. 72. Ginzler, E. M., M. A. Dooley, C. Aranow, M. Y. Ki m, J. Buyon, J. T. Merrill, M. Petri, G. S. Gilkeson, D. J. Wallace, M. H. We isman, and G. B. Appel. 2005. Mycophenolate mofetil or intravenous cyclophosphamide for lupus nephritis. N Engl J Med 353:2219-2228. 73. Zimmerman, R., J. Radhakrishnan, A. Vale ri, and G. Appel. 2001. Advances in the treatm ent of lupus nephritis. Annu Rev Med 52:63-78. 74. Lee, M., and J. Park. 2006. Regulation of NFAT activation: a potential therapeutic target for immunosuppression. Mol Cells 22:1-7. 75. Manger, K., J. R. Kalden, and B. Mange r. 1996. Cyclosporin A in the treatm ent of systemic lupus erythematosus: re sults of an open clinical study. Br J Rheumatol 35:669-675. 76. McLaughlin, P., C. A. White, A. J. Grillo-Lope z, and D. G. Maloney. 19 98. Clinical status and optimal use of rituximab for B-cell lymphomas. Oncology (Williston Park) 12:1763-1769; discussion 1769-1770, 1775-1767. 77. Cragg, M. S., and M. J. Glennie. 2004. An tibody specificity contro ls in vivo effector m echanisms of anti-CD20 reagents. Blood 103:2738-2743. 78. Eisenberg, R., and D. Albert 2006. B-cell targeted therapies in rheum atoid arthritis and systemic lupus erythematosus. Nat Clin Pract Rheumatol 2:20-27. 79. Crow, A. R., S. Song, J. W. Semple, J. Freedman, and A. H. Lazarus. 2001. IVIg inhibits reticuloendo thelial system function a nd ameliorates murine passive-immune thrombocytopenia independent of anti-idiotype reactivity. Br J Haematol 115:679-686. 80. Shoenfeld, Y., L. Rauova, B. Gilburd, F. Kvapil, I. Goldberg, J. Kopolovic, J. Rovensky, and M. Blank. 2002. Effi cacy of IVIG a ffinity-purified anti-double-stranded DNA anti-idiotypic antibodies in the treatment of an experimental murine model of systemic lupus erythematosus. Int Immunol 14:1303-1311.

PAGE 111

111 81. Morel, L., and E. K. Wakeland. 1998. Suscep tibility to lupus nephr itis in the NZB/ W model system. Curr Opin Immunol 10:718-725. 82. Steinberg, A. D. 1994. MRL-lpr/lpr disease: theories meet Fas. Semin Immunol 6:55-69. 83. Furukawa, F., and T. Yoshimasu. 2005. Animal models of spontaneous and drug-induced cutaneous lupus erythem atosus. Autoimmun Rev 4:345-350. 84. Hayashi, Y., N. Haneji, and H. Hamano. 1994. Pathogenesis of Sjogren' s syndrome-like autoimmune lesions in MRL/lpr mice. Pathol Int 44:559-568. 85. Hang, L. M., S. Izui, and F. J. Dixon. 1981. (NZW x BXSB) F1 hybrid. A model of acute lupus and coronary vascular dis ease with myocardial infarction. J Exp Med 154:216-221. 86. Pisitkun, P., J. A. Deane, M. J. Difilippant onio, T Tarasenko, A. B. Satterthwaite, and S. Bolland. 2006. Autoreactive B cell responses to RNA-related antigens due to TLR7 gene duplication. Science 312:1669-1672. 87. Satoh, M., and W. H. Reeves. 1994. Inducti on of lupus-associated autoantibodies in BALB/c m ice by intraperitoneal injection of pristane. J Exp Med 180:2341-2346. 88. Isaacs, A., and J. Lindenmann. 1957. Viru s interference. I. Th e interferon. Proc R Soc Lond B Biol Sci 147:258-267. 89. Isaacs, A., J. Lindenmann, and R. C. Valentine. 1957. Virus interference. II. Some properties of interferon. Proc R Soc Lond B Biol Sci 147:268-273. 90. Theofilopoulos, A. N., R. Baccala, B. Beutle r, an d D. H. Kono. 2005. Type I interferons (alpha/beta) in immunity and autoimmunity. Annu Rev Immunol 23:307-336. 91. Uze, G., G. Lutfalla, and I. Gresser. 1990. Genetic transfer of a functional hum an interferon alpha receptor into mouse cells : cloning and expression of its cDNA. Cell 60:225-234. 92. Novick, D., B. Cohen, and M. Rubinstein. 1994. The hum an interferon alpha/beta receptor: characterization and molecular cloning. Cell 77:391-400. 93. Su, L., and M. David. 2000. Distinct mechanisms of STAT phosphorylation via the interferon-alpha/beta receptor. Selective inhi bition of STAT3 and STAT5 by piceatannol. J Biol Chem 275:12661-12666. 94. Samuel, C. E. 2001. Antiviral Actions of Interferons. Clin. Microbiol. Rev. 14:778-809. 95. de Veer, M. J., M. Holko, M. Frevel, E. Walker S. Der, J. M. Paranjape, R. H. Silverman, and B. R. William s. 2001. Func tional classification of in terferon-stimulated genes identified using microarrays. J Leukoc Biol 69:912-920.

PAGE 112

112 96. Kochs, G., and O. Haller. 1999. Interferoninduced hum an MxA GTPase blocks nuclear import of Thogoto virus nucleocapsids. Proc Natl Acad Sci U S A 96:2082-2086. 97. Towbin, H., A. Schmitz, D. Jakschies, P. Von W ussow, and M. A. Horisberger. 1992. A whole blood immunoassay for the interf eron-inducible human Mx protein. J Interferon Res 12:67-74. 98. Baccala, R., K. Hoebe, D. H. Kono, B. Beutler, an d A. N. Theofilopoulos. 2007. TLR-dependent and TLR-independent pathways of type I interferon induction in systemic autoimmunity. Nat Med 13:543-551. 99. Kawai, T., and S. Akira. 2006. Innate immune recognition of viral infection. Nat Immunol 7:131-137. 100. Takeda, K., T. Kaisho, and S. Akira. 2003. Toll-like receptors. Annu Rev Immunol 21:335-376. 101. Iwasaki, A., and R. Medzhitov. 2004. Toll-lik e receptor control of the adaptive immune responses. N at Immunol 5:987-995. 102. Akira, S. 2003. Toll-like receptor signaling. J B iol Chem 278:38105-38108. 103. Liu, Y. J. 2005. IPC: professional type 1 in terferon-producing cells and plasm acytoid dendritic cell precursors. Annu Rev Immunol 23:275-306. 104. Lund, J., A. Sato, S. Akira, R. Medzhitov, and A. Iwasaki. 2003. Toll-like receptor 9-m ediated recognition of Herpes simplex virus-2 by plasmacytoid dendritic cells. J Exp Med 198:513-520. 105. Diebold, S. S., T. Kaisho, H. Hemmi, S. Akira, and C. Reis e Sousa. 2004. Innate antiviral responses by m eans of TLR7-mediated recognition of single-stranded RNA. Science 303:1529-1531. 106. Barton, G. M., and R. Medzhitov. 2004. Toll signaling: RIPping off the TNF pathway. Nat Immunol 5:472-474. 107. Akira, S., M. Yamamoto, and K. Takeda. 2003. Role of adapters in Toll-like receptor signalling. B iochem Soc Trans 31:637-642. 108. Sato, S., M. Sugiyama, M. Yamamoto, Y. Wata nabe, T. Kawai, K. Takeda, and S. Akira. 2003. Toll/IL-1 recep tor domain-containing adap tor inducing IFN-beta (TRIF) associates with TNF receptor-associated factor 6 a nd TANK-binding kinase 1, and activates two distinct transcription factors, NF-kappa B and IFN-regulator y factor-3, in the Toll-like receptor signaling. J Immunol 171:4304-4310. 109. Fitzgerald, K. A., D. C. Rowe B. J. Barnes, D. R. Caffrey, A. Visintin, E. Latz, B. Monks, P. M. Pitha, and D. T. Golenbock. 2003. LPS-TLR4 Signaling to IRF-3/7 and NF-{kappa}B Involves the Toll Adapters TRAM and TRIF. J. Exp. Med. 198:1043-1055.

PAGE 113

113 110. Yoneyama, M., M. Kikuchi, T. Natsukawa, N. Shinobu, T. Im aizumi, M. Miyagishi, K. Taira, S. Akira, and T. Fujita. 2004. The RNA helicase RIG-I has an essential function in double-stranded RNA-induced innate antiviral responses. Nat Immunol 5:730-737. 111. Kawai, T., and S. Akira. 2006. TLR signaling. Cell Death Differ 13:816-825. 112. Meylan, E., and J. Tschopp. 2006. Toll-like r ecep tors and RNA helicases: two parallel ways to trigger antiviral responses. Mol Cell 22:561-569. 113. Vitour, D., and E. F. Meurs. 2007. Regulation of interferon producti on by RIG-I and L GP2: a lesson in self-control. Sci STKE 2007:pe20. 114. Saito, T., R. Hirai, Y. M. Loo, D. Owen, C. L. Johnson, S. C. Sinha, S. Akira, T. Fujita, and M. Gale, Jr. 2007. Regulation of innate an tiviral defenses through a shared repressor dom ain in RIG-I and LGP2. Proc Natl Acad Sci U S A 104:582-587. 115. Kang, D. C., R. V. Gopalkrishnan, Q. Wu, E. Jankowsky, A. M. Pyle, and P. B. Fisher. 2002. m da-5: An interferoninducible putative RNA helicase with double-stranded RNA-dependent ATPase activity and melanoma growth-suppressive properties. Proc Natl Acad Sci U S A 99:637-642. 116. Kovacsovics, M., F. Martinon, O. Micheau, J. L. Bodmer, K. Hofmann, and J. Tschopp. 2002. Overexpression of Helicard, a CARD-contai ning helicase cleaved during apoptosis, accelerates DNA degradation. Curr Biol 12:838-843. 117. Yang, Y., C. T. Huang, X. Huang, and D. M. Pardoll. 2004. Persiste nt T oll-like receptor signals are required for reversal of re gulatory T cell-mediated CD8 tolerance. Nat Immunol 5:508-515. 118. Kato, H., O. Takeuchi, S. Sato, M. Yoneya m a, M. Yamamoto, K. Matsui, S. Uematsu, A. Jung, T. Kawai, K. J. Ishii, O. Yamaguchi, K. Otsu, T. Tsujimura, C. S. Koh, C. Reis e Sousa, Y. Matsuura, T. Fujita, and S. Akir a. 2006. Differential roles of MDA5 and RIG-I helicases in the recogni tion of RNA viruses. Nature 441:101-105. 119. Ishii, K. J., C. Coban, H. Kato, K. Takahashi, Y. Torii, F. Takeshita, H. Ludwig, G. Sutter, K. Suzuki, H. He mmi, S. Sato, M. Yamamoto, S. Uematsu, T. Kawai, O. Takeuchi, and S. Akira. 2006. A Toll-like receptor-indepe ndent antiviral response induced by double-stranded B-form DNA. Nat Immunol 7:40-48. 120. Eisenacher, K., C. Steinberg, W. Reindl, a nd A. Krug. 2007. The role of viral nucleic acid recognition in dendritic cells for i nnate and adaptive antiviral immunity. Immunobiology 212:701-714. 121. Yoneyama, M., M. Kikuchi, K. Matsumoto, T. Im aizumi, M. Miyagishi, K. Taira, E. Foy, Y. M. Loo, M. Gale, Jr., S. Akira, S. Yone hara, A. Kato, and T. Fujita. 2005. Shared and unique functions of the DExD /H-box helicases RIG-I, MDA5, and LGP2 in antiviral innate immunity. J Immunol 175:2851-2858.

PAGE 114

114 122. Brinkmann, V., T. Geiger, S. Alkan, and C. H. Heusser. 1993. Inte rferon alpha increases the frequency of interferon gamma -producing hum an CD4+ T cells. J Exp Med 178:1655-1663. 123. Ousman, S. S., J. Wang, and I. L. Campbell. 2005. Differential regula tion of interferon regulatory f actor (IRF)-7 and IRF-9 gene expression in the central nervous system during viral infection. J Virol 79:7514-7527. 124. Taniguchi, T., and A. Takaoka. 2001. A weak signal for strong responses: interferon-alpha/beta revisited. Nat R ev Mol Cell Biol 2:378-386. 125. Kessler, D. S., S. A. Veals, X. Y. Fu, and D. E. Levy. 1990. Interferon-alpha regulates nuclear translocation and DNA-binding affinity of ISGF3, a multim eric transcriptional activator. Genes Dev 4:1753-1765. 126. Tassiulas, I., X. Hu, H. Ho, Y. Kashyap, P. Pa ik, Y. Hu, C. A. Lowell, and L. B. Ivashkiv. 2004. Am plification of IFN-alpha-induced ST AT1 activation and inflammatory function by Syk and ITAM-containing adaptors. Nat Immunol 5:1181-1189. 127. Luft, T., P. Luetjens, H. Hochrein, T. Toy, K. A. Masterm an, M. Rizkalla, C. Maliszewski, K. Shortman, J. Cebon, and E. Maraskovsky. 2002. IFN-alpha enhances CD40 ligand-mediated activation of immature monocyte-derived dendritic cells. Int Immunol 14:367-380. 128. Sonmez, M., B. Sonmez, N. Eren, M. Yilmaz, S. S. Karti, and E. Ovali. 2004. Effects of interferon-alpha-2a on T h3 cytokine re sponse in multiple myeloma patients. Tumori 90:387-389. 129. Reznikov, L. L., A. J. Puren, G. Fantuzzi, H. Muhl, L. Shapiro, D. Y. Yoon, D. L. Cutler, and C. A. Di narello. 1998. Spontaneous and inducible cytokine responses in healthy humans receiving a single dose of IFN-alpha 2b: increased producti on of interleukin-1 receptor antagonist and suppression of IL-1-induced IL-8. J Interferon Cytokine Res 18:897-903. 130. Song, M. M., and K. Shuai. 1998. The suppre ssor of cytokine signaling (S OCS) 1 and SOCS3 but not SOCS2 proteins inhibit interferon-mediated antiviral and antiproliferative activities. J Biol Chem 273:35056-35062. 131. Biron, C. A. 2001. Interferons alpha and beta as immune regulators--a new look. Immunity 14:661-664. 132. Ito, S., P. Ansari, M. Sakatsume, H. Dicken sheets, N. Vazquez, R. P. Donnelly, A. C. Larner, and D. S. Finbloom 1999. Interleukin-10 inhibits ex pression of both interferon alphaand interferon gammainduced genes by suppressing tyrosine phosphorylation of STAT1. Blood 93:1456-1463.

PAGE 115

115 133. Palucka, A. K., J. P. Blanck, L. Bennett, V. Pascual, and J. Banchereau. 2005. Cross-regulation of TNF and IFNalp ha in autoimmune diseases. Proc Natl Acad Sci U S A 102:3372-3377. 134. Kang, M. J., Y. H. Lee, and J. Lee. 2006. Etanercept-induced system ic lupus erythematosus in a patient with rheumatoid arthritis. J Korean Med Sci 21:946-949. 135. Eriksson, C., S. Engstrand, K. G. Su ndqvist, and S. Rant apaa-Dahlqvist. 2005. Autoantibod y formation in patients with rheuma toid arthritis treated with anti-TNF alpha. Ann Rheum Dis 64:403-407. 136. Lamprecht, P. 2005. TNF-alpha inhibitors in system ic vasculitides and connective tissue diseases. Autoimmun Rev 4:28-34. 137. Wilson, L. E., D. Widman, S. H. Dikman, and P. D. Gorevic. 2002. Autoimmune disease com plicating antiviral therapy for hepatitis C virus infection. Semin Arthritis Rheum 32:163-173. 138. Ronnblom, L. E., G. V. Alm, and K. E. Oberg. 1990. Possible induction of system ic lupus erythematosus by interferon-alph a treatment in a patient with a malignant carcinoid tumour. J Intern Med 227:207-210. 139. Ronnblom, L. E., G. V. Alm, and K. E. Oberg. 1991. Autoimmunity after alpha-interferon therapy for m alignant carcinoid tumors. Ann Intern Med 115:178-183. 140. Vallin, H., A. Perers, G. V. Alm, and L. Ronnblom 1999. Anti-double-stranded DNA antibodies and immunostimulatory plasmid DNA in combination mimic the endogenous IFN-alpha inducer in systemic lupus erythematosus. J Immunol 163:6306-6313. 141. Bennett, L., A. K. Palucka, E. Arce, V. Cantre ll, J. Borvak, J. Banchereau, and V. Pascual. 2003. Interf eron and granulopoiesis signatures in systemic lupus erythematosus blood. J Exp Med 197:711-723. 142. Baechler, E. C., F. M. Batliwalla, G. Karypi s, P. M. Gaffney, W A. Ortmann, K. J. Espe, K. B. Shark, W. J. Grande, K. M. Hughes, V. Kapur, P. K. Gregersen, and T. W. Behrens. 2003. Interferon-inducible gene expression signatu re in peripheral bl ood cells of patients with severe lupus. PNAS 100:2610-2615. 143. Hertz, C. J., S. M. Kiertscher, P. J. Godowski, D. A. Bouis, M. V. Norgard, M. D. Roth, and R. L. Modlin. 2001. Microbial lipopeptides stim ulate dendritic cell maturation via Toll-like receptor 2. J Immunol 166:2444-2450. 144. Munz, C., R. M. Steinman, and S. Fujii. 2005. D endritic cell maturation by innate lymphocytes: coordinated stimulation of innate and adaptive immunity. J Exp Med 202:203-207. 145. Blander, J. M. 2007. Coupling Toll-like recep tor signaling with phagoc ytosis: potentiation of antigen presentation. T rends Immunol 28:19-25.

PAGE 116

116 146. Hornell, T. M., T. Burster, F. L. Jahnsen, A. Pashine, M. T. Ochoa, J. J. Harding, C. Macaubas, A. W Lee, R. L. Modlin, and E. D. Mellins. 2006. Human dendritic cell expression of HLA-DO is subset sp ecific and regulated by maturation. J Immunol 176:3536-3547. 147. Shortman, K., and Y. J. Liu. 2002. Mous e and hum an dendritic cell subtypes. Nat Rev Immunol 2:151-161. 148. Caux, C., S. Ait-Yahia, K. Chemin, O. de B outeiller, M. C. Dieu-Nosjean, B. Hom ey, C. Massacrier, B. Vanbervliet, A. Zlotnik, a nd A. Vicari. 2000. Dendritic cell biology and regulation of dendritic cell trafficking by chemokines. Springer Semin Immunopathol 22:345-369. 149. Pickl, W. F., O. Majdic, P. Kohl, J. Stockl E. Riedl, C. Scheinecker, C. Bello-Fernandez, and W Knapp. 1996. Molecular and functional char acteristics of dendritic cells generated from highly purified CD14+ peripheral blood monocytes. J Immunol 157:3850-3859. 150. Blanco, P., A. K. Palucka, M. Gill, V. Pascual, and J. Banchereau. 200 1. Induction of dendritic cell differentiation by IFN-alpha in systemic lupus erythematosus. Science 294:1540-1543. 151. Jefford, M., M. Schnurr, T. Toy, K. A. Masterman, A. Shin, T. Beecroft, T. Y. Tai, K. Shortm an, M. Shackleton, I. D. Davis, P. Pa rente, T. Luft, W. Chen, J. Cebon, and E. Maraskovsky. 2003. Functional comparison of DCs generated in vivo with Flt3 ligand or in vitro from blood monocytes: differential re gulation of function by specific classes of physiologic stimuli. Blood 102:1753-1763. 152. Facchetti, F., C. de Wolf-Peeters, D. Y. Mason, K. Pulford, J. J. van den Oord, and V. J. Des met. 1988. Plasmacytoid T cells. Immunohistochemical evidence for their monocyte/macrophage origin. Am J Pathol 133:15-21. 153. Siegal, F. P., N. Kadowaki, M. Shodell, P. A. Fitzgerald-Bocarsly, K. Shah, S. Ho, S. Antonenko, and Y. J. Liu. 1999. The nature of the principal type 1 interferon-producing cells in human blood. Science 284:1835-1837. 154. Diebold, S. S., M. Montoya, H. Unger, L. Alexopoulou, P. Roy, L. E. Haswell, A. Al-Sham khani, R. Flavell, P. Borrow, and C. Reis e Sousa. 2003. Vira l infection switches non-plasmacytoid dendritic cells into high interferon producers. Nature 424:324-328. 155. Hochrein, H., B. Schlatter, M. O'Keeffe, C. Wagner, F. Schmitz, M. Schiem ann, S. Bauer, M. Suter, and H. Wagner. 2004. Herpes simplex virus type-1 induces IFN-{alpha} production via Toll-like receptor 9-de pendent and -independent pathways. PNAS 101:11416-11421. 156. Ryman, K. D., K. C. Meier, E. M. Nangle, S. L. Ragsdale, N. L. Korneeva, R. E. Rhoads, M. R. MacDonald, and W. B. Klim stra. 2005. Sindbis virus translati on is inhibited by a PKR/RNase L-independent effector induced by alpha/beta interferon priming of dendritic cells. J Virol 79:1487-1499.

PAGE 117

117 157. Izaguirre, A., B. J. Barnes, S. Amrute, W. S. Yeow, N. Megjugorac, J. Dai, D. Feng, E. Chung, P. M. Pitha, and P. Fitzgerald-Bocar sly. 2003. Com parative analysis of IRF and IFN-alpha expression in human plasmacyto id and monocyte-derived dendritic cells. J Leukoc Biol 74:1125-1138. 158. Tucci, M., N. Calvani, H. B. Richards, C. Quatraro, and F. Silvestris. 2005. The interplay of che mokines and dendritic cells in the pathogenesis of lupus nephritis. Ann N Y Acad Sci 1051:421-432. 159. W.H. Reeves, M. S. a. D. P. M. 2002. Autoantibody testing by non-FITC methods. Manual of Clinical L aboratory Immunology :pp. 933. 160. Ronnblom, L., and G. V. Alm. 2001. An etiopa thogenic role for the t ype I IFN system in SLE. Trends Immunol 22:427-431. 161. Arnett, F. C., R. G. Hamilton, M. G. Ro ebber, J. B. Harley, and M. Reichlin. 1988. Increased frequencies of Sm and nRNP autoantibodies in American blacks compared to whites with systemic lupus erythematosus. J Rheumatol 15:1773-1776. 162. Craft, J. 1992. Antibodies to snRNPs in system ic lupus erythematosus. Rheum Dis Clin North Am 18:311-335. 163. Kelly, K. M., H. Zhuang, D. C. Nacionales, P. O. Scumpia, R. Lyons, J. Akaogi, P. Lee, B. W illiams, M. Yamamoto, S. Akira, M. Satoh, and W. H. Reeves. 2006. "Endogenous adjuvant" activity of the RNA components of lupus autoantigens Sm/RNP and Ro 60. Arthritis Rheum 54:1557-1567. 164. Le Bon, A., G. Schiavoni, G. D'Agostino, I. Gresser, F. Belardelli, and D. F. Tough. 2001. Type i interferons potently enhance hum oral immunity and can promote isotype switching by stimulating dendritic cells in vivo. Immunity 14:461-470. 165. Siegal, F. P., N. Kadowaki, M. Shodell, P. A. Fitzgerald-Bocarsly, K. Shah, S. Ho, S. Antonenko, and Y.-J. Liu. 1999. The Nature of the Principal Type 1 Interferon-Produci ng Cells in Hum an Blood. Science 284:1835-1837. 166. Cella, M., D. Jarrossay, F. Facchetti, O. Al ebardi, H. Nakajim a, A. Lanzavecchia, and M. Colonna. 1999. Plasmacytoid monocytes migrate to inflamed lymph nodes and produce large amounts of type I interferon. Nat Med 5:919-923. 167. Grouard, G., M. C. Rissoan, L. Filgueira, I. Durand, J. Banchereau, and Y. J. Liu. 1997. The enigm atic plasmacytoid T cells develop into dendritic cells with interleukin (IL)-3 and CD40-ligand. J Exp Med 185:1101-1111. 168. Gill, M. A., P. Blanco, E. Arce, V. Pascual, J. Banchereau, an d A. K. Palucka. 2002. Blood dendritic cells and DC-poietins in systemic lupus erythematosus. Hum Immunol 63:1172-1180.

PAGE 118

118 169. Radvanyi, L. G., A. Banerjee, M. Weir and H. Messner. 1999. Low levels of interferon-alpha induce CD86 (B 7.2) expres sion and accelerate s dendritic cell maturation from human peripheral blood mononuclear cells. Scand J Immunol 50:499-509. 170. Tough, D. F. 2004. Type I interferon as a li nk between innate and adaptive immunity through dendritic cell stimulation. Leuk Lymphoma 45:257-264. 171. Steinman, R. M., D. Hawiger, and M. C. Nussenzweig. 2003. Tolerogenic dendritic cells. Annu Rev Immunol 21:685-711. 172. Doyle, S., S. Vaidya, R. O'Connell, H. Dadgos tar, P. De mpsey, T. Wu, G. Rao, R. Sun, M. Haberland, R. Modlin, and G. Cheng. 2002. IRF3 mediates a TLR3/TLR4-specific antiviral gene program. Immunity 17:251-263. 173. Heil, F., H. Hemmi, H. Hochrein, F. Ampenbe rger, C. Kirschning, S. Akira, G. Lipford, H. Wagner, and S. Bauer. 2004. Species -specific recognition of single-stranded RNA via toll-like receptor 7 and 8. Science 303:1526-1529. 174. Hartmann, G., G. J. Weiner, and A. M. Kr ieg. 1999. CpG DNA: a potent signal for growth, activation, and maturation of human dendritic cells. Proc Natl Acad Sci U S A 96:9305-9310. 175. Hornung, V., J. Schlender, M. Guenthner-Bi ller, S. Rothenfusser, S. Endres, K. K. Conzelm ann, and G. Hartmann. 2004. Replication-dependent potent IFN-alpha induction in human plasmacytoid dendritic cells by a single-stranded RNA virus. J Immunol 173:5935-5943. 176. Gilli, F., A. Sala, C. Bancone, P. Salacone M. Gallo, E. Gaia, and A. Bertolotto. 2002 Evaluation of IFNalpha bioavailabil ity by MxA mRNA in HCV patients. J Immunol Methods 262:187-190. 177. Scheinman, R. I., P. C. Cogswell, A. K. Lofquist, and A. S. Baldwin, Jr. 1995. Role of transcriptional activation of I kappa B alpha in m ediation of immunosuppression by glucocorticoids. Science 270:283-286. 178. Hardin, J. A., and T. Mimori. 1985. Autoantibodies to ribonucleoproteins. Clin Rheum Dis 11:485-505. 179. Pisetsky, D. S. 1992. Anti-DNA antibodies in system ic lupus erythematosus. Rheum Dis Clin North Am 18:437-454. 180. Maddison, P. J., and M. Reichlin. 1977. Quan titation of precipitating an tibodies to certain soluble nuclear antigens in SLE. Arthritis Rheum 20:819-824. 181. Leadbetter, E. A., I. R. Rifkin, A. M. Hohlba um, B. C. Beaudette, M. J. Shlom chik, and A. Marshak-Rothstein. 2002. Chromatin-IgG comp lexes activate B cells by dual engagement of IgM and Toll-like receptors. Nature 416:603-607.

PAGE 119

119 182. Wagner, H. 2004. The immunobiology of the TLR9 subfamily. Trends Immunol 25:381-386. 183. Kirou, K. A., C. Lee, S. George, K. Louca, I. G. Papagiannis, M. G. Peterson, N. Ly, R. N. Woodward, K. E. Fry, A. Y. Lau, J. G. Prenti ce, J. G. W ohlgemuth, and M. K. Crow. 2004. Coordinate overexpression of interferon-al pha-induced genes in systemic lupus erythematosus. Arthritis Rheum 50:3958-3967. 184. Preble, O. T., R. J. Black, R. M. Friedman, J. H. Klippel, and J. Vilcek. 1982. System ic lupus erythematosus: presence in human serum of an unusual acid-labile leukocyte interferon. Science 216:429-431. 185. Kim, T., Y. Kanayama, N. Negoro, M. Ok a mura, T. Takeda, and T. Inoue. 1987. Serum levels of interferons in patients with systemic lupus erythematosus. Clin Exp Immunol 70:562-569. 186. Bengtsson, A. A., G. Sturfelt, L. Truedss on, J. Blom berg, G. Alm, H. Vallin, and L. Ronnblom. 2000. Activation of type I interferon system in systemic lupus erythematosus correlates with disease activity but not with an tiretroviral antibodies. Lupus 9:664-671. 187. Diaz, M. O., H. M. Pomykala, S. K. Bohla nder, E. Maltepe, K. Ma lik, B. Brownstein, and O. I. Olopade. 1994. Structure of the hum an type -I interferon gene cluster determined from a YAC clone contig. Genomics 22:540-552. 188. de la Rosa, G., N. Longo, J. L. Rodriguez-Fe rnandez, A. Puig-Kroger, A Pineda, A. L. Corbi, and P. Sanchez-Mateos. 2003. Migra tion of human blood dendritic cells across endothelial cell monolayers: adhesion mo lecules and chemokines involved in subset-specific transmigration. J Leukoc Biol 73:639-649. 189. Forster, R., A. Schubel, D. Breitfeld, E. Kr e mmer, I. Renner-Muller, E. Wolf, and M. Lipp. 1999. CCR7 coordinates the primary immune response by establishing functional microenvironments in secondary lymphoid organs. Cell 99:23-33. 190. Fonteneau, J. F., M. Larsson, A. S. Beignon, K. McKenna, I. Dasilva, A. Am ara, Y. J. Liu, J. D. Lifson, D. R. Littman, and N. Bhardw aj. 2004. Human immunodeficiency virus type 1 activates plasmacytoid dendritic cell s and concomitantly induces the bystander maturation of myeloid dendritic cells. J Virol 78:5223-5232. 191. Shodell, M., K. Shah, and F. P. Siegal. 2003. Circulating human plasm acytoid dendritic cells are highly sensitive to corticosteroid administration. Lupus 12:222-230. 192. Shodell, M., and F. P. Siegal. 2001. Cor ticosteroids depress IFN-alpha-producing plasm acytoid dendritic cells in human blood. J Allergy Clin Immunol 108:446-448. 193. Pulendran, B., J. Banchereau, S. Burkeholder, E Kraus, E. Guinet, C. Chalouni, D. Caron, C. Maliszewski, J. Davoust, J. Fay, and K. Palucka. 2000. Flt3-ligand and granulocyte colony-stimulating factor mobilize distin ct human dendritic cell subsets in vivo. J Immunol 165:566-572.

PAGE 120

120 194. Ioannou, Y., and D. A. Isenberg. 2000. Current evidence for the induction of autoimmune rheum atic manifestations by cytokine therapy. Arthritis Rheum 43:1431-1442. 195. Casciola-Rosen, L. A., G. Anhalt, and A. Rosen. 1994. Autoantigens targeted in system ic lupus erythematosus are clustered in two populations of surface structures on apoptotic keratinocytes. J Exp Med 179:1317-1330. 196. Ahonen, C. L., C. L. Doxsee, S. M. McGurran, T. R. Riter, W. F. Wade, R. J. Barth, J. P. Vasilakos, R J. Noelle, and R. M. Kedl. 2004. Combined TLR and CD40 Triggering Induces Potent CD8+ T Cell Expansion with Variable Dependence on Type I IFN. J Exp Med 199:775-784. 197. Zhuang, H., S. Narain, E. Sobel, P. Y. Lee, D. C. Nacionales, K. M. Kelly, H. B. Richards, M. Segal, C. Stewart, M. Satoh, a nd W. H. Reeves. 2005. Association of anti-nucleoprotein autoantibodies with upregulation of Type I interferon-inducible gene transcripts and dendritic cell m aturation in systemic lupus erythematosus. Clin Immunol 117:238-250. 198. Zhuang, H., M. Kosboth, P. Lee, A. Rice, D. J. Driscoll, R. Zori, S. Narain, R. Lyons, M. Satoh, E. Sobel, and W H. Reeves. 2006. L upus-like disease and high interferon levels corresponding to trisomy of the type I interferon cluster on chromosome 9p. Arthritis Rheum 54:1573-1579. 199. Nacionales, D. C., K. M. Kelly-Scumpia, P. Y. Lee, J. S. W einstein, R. Lyons, E. Sobel, M. Satoh, and W. H. Reeves. 2007. Deficiency of th e type I interferon rece ptor protects mice from experimental lupus. Arthritis Rheum 56:3770-3783. 200. Lee, P. Y., J. S. Weinstein, D. C. Nacionales, P. O. Scum pia, Y. Li, E. Butfiloski, N. van Rooijen, L. Moldawer, M. Satoh, and W. H. Reeves. 2008. A Novel Type I IFN-Producing Cell Subset in Murine Lupus. J Immunol 180:5101-5108. 201. Herrmann, M., R. E. Voll, O. M. Zoller, M. Hagenhofer, B. B. Ponner, and J. R. Kalden. 1998. Im paired phagocytosis of apoptotic cel l material by monocyte-derived macrophages from patients with systemic lupus erythematosus. Arthritis Rheum 41:1241-1250. 202. Wen, L., S. A. Shinton, R. R. Hardy, and K. Hayakawa. 2005. Association of B-1 B c ells with follicular dendritic cells in spleen. J Immunol 174:6918-6926. 203. Gaipl, U. S., L. E. Munoz, G. Grossmayer, K. Lauber, S. Franz, K. Sarter, R. E. Voll, T. W inkler, A. Kuhn, J. Kalden, P. Kern, and M. Herrmann. 2007. Clearan ce deficiency and systemic lupus erythematosus (SLE). J Autoimmun 28:114-121. 204. Ren, Y., J. Tang, M. Y. Mok, A. W. Ch an, A. Wu, and C. S. Lau. 2003. Increased apoptotic neutrophils and m acr ophages and impaired macropha ge phagocytic clearance of apoptotic neutrophils in systemic lupus erythematosus. Arthritis Rheum 48:2888-2897.

PAGE 121

121 205. Steinbach, F., F. Henke, B. Krause, B. Thiele, G. R. Burmester, and F. Hiepe. 2000. Monocytes f rom systemic lupus erythematous patients are severely altered in phenotype and lineage flexibility. Ann Rheum Dis 59:283-288. 206. Qian, Z. M., H. Li, H. Sun, and K. Ho. 2002. Targeted drug delivery via the transferrin recep tor-mediated endocytosis pathway. Pharmacol Rev 54:561-587. 207. Colonna, M., G. Trinchieri, and Y. J. Liu. 2004. Plasm acytoid dendritic cells in immunity. Nat Immunol 5:1219-1226. 208. Cederblad, B., S. Blomberg, H. Vallin, A. Perers, G. V. Al m, and L. Ronnblom. 1998. Patients with systemic lupus erythematosus have reduced numbers of circulating natural interferon-alphaproducing cells. J Autoimmun 11:465-470. 209. Farkas, L., K. Beiske, F. Lund-Johans en, P. Brandtzaeg, and F. L. Jahnsen. 2001. Plasmacytoid dendritic cells (natural interf eronalpha/beta-producing cells) accumulate in cutaneous lupus erythematosus lesions. Am J Pathol 159:237-243. 210. Blomberg, S., M. L. Eloranta, B. Cederblad, K. Nordlin, G. V. Alm, and L. Ronnblom. 2001. Presence of cutaneous interferon-alpha pro ducing cells in patients w ith systemic lupus erythematosus. Lupus 10:484-490. 211. Hume, D. A. 2006. The mononuclear phagocyte system. Cur r Opin Immunol 18:49-53. 212. Leon, B., M. Lopez-Bravo, and C. Ardavin. 2005. Monocyte-derived dendritic cells. Semin Immunol 17:313-318. 213. Ronnblom, L., and G. V. Alm. 2001. A pi votal role for the natural interferon alpha-producing cells (p lasm acytoid dendritic cells) in the pathogenesis of lupus. J Exp Med 194:F59-63. 214. Mohty, M., A. Vialle-Castellano, J. A. Nunes, D. Isnardon, D. Olive, and B. Gaugle r. 2003. IFN-{alpha} Skews Monocyte Differentiati on into Toll-Like Receptor 7-Expressing Dendritic Cells with Potent Functional Activities. J Immunol 171:3385-3393. 215. Subramanian, S., K. Tus, Q. Z. Li, A. Wang, X. H. Tian, J. Zhou, C. Liang, G. Bartov, L. D. McDaniel, X. J. Zhou, R. A. Schultz, a nd E. K Wakeland. 2006. A Tlr7 translocation accelerates systemic autoimmunity in murine lupus. Proc Natl Acad Sci U S A 103:9970-9975. 216. Lau, C. M., C. Broughton, A. S. Tabor, S. Akira, R. A. Flavell, M. J. Mamula, S. R. Christensen, M. J. Shlom chik, G. A. Viglian ti, I. R. Rifkin, and A. Marshak-Rothstein. 2005. RNA-associated autoantigens activat e B cells by combined B cell antigen receptor/Toll-like receptor 7 engagement. J Exp Med 202:1171-1177.

PAGE 122

122 217. Lovgren, T., M. L. Eloranta, U. Bave, G. V. Al m, and L. Ronnblom. 2004. Induction of interferon-alpha production in plasmacytoid dendritic cells by immune complexes containing nucleic acid released by necrotic or late apopt otic cells and lupus IgG. Arthritis Rheum 50:1861-1872. 218. Honda, K., Y. Ohba, H. Yanai, H. Negishi, T. Mizutani, A. Takaoka, C. Taya, and T. Taniguchi. 2005. Spatiotem poral regulation of MyD88-IRF-7 signalling for robust type-I interferon induction. Nature 434:1035-1040. 219. Honda, K., and T. Taniguchi. 2006. IRFs: mast er regulators of signalling by Toll-like receptors and cytosolic pattern-recognition receptors. Nat Rev Immunol 6:644-658. 220. Coccia, E. M., M. Severa, E. Giacomini, D. Monneron, M. E. Re moli, I. Julkunen, M. Cella, R. Lande, and G. Uze. 2004. Viral inf ection and Toll-like receptor agonists induce a differential expression of type I and lambda interferons in human plasmacytoid and monocyte-derived dendritic cells. Eur J Immunol 34:796-805. 221. Barnes, B. J., J. Richards, M. Mancl, S. Hanash, L. Beretta, and P. M. Pitha. 2004. Global and distinct targets of IRF-5 and IRF-7 during innate response to viral infection. J Bio l Chem 279:45194-45207. 222. Lu, R., and P. M. Pitha. 2001. Monocyte diffe rentiation to m acrophage requires interferon regulatory factor 7. J Biol Chem 276:45491-45496. 223. Sykes, D. B., J. Scheele, M. Pasillas, and M. P. Kam ps. 2003. Transcriptional profiling during the early differentiation of granuloc yte and monocyte progeni tors controlled by conditional versions of the E2a-Pbx1 oncoprotein. Leuk Lymphoma 44:1187-1199. 224. Guiducci, C., G. Ott, J. H. Chan, E. Damon, C. Ca lacsan, T. Matray, K. D. Lee, R. L. Coffman, and F. J. Barrat. 2006. Properties regulating the nature of the plasmacytoid dendritic cell response to Toll-like receptor 9 activation. J Exp Med 203:1999-2008. 225. Koffler, D., V. Agnello, R. Thoburn, and H. G. Kunkel. 1971. Systemic lupus erythem atosus: prototype of immune complex nephritis in man. J Exp Med 134:169s-179s. 226. Morel, L., U. H. Rudofsky, J. A. Longmate J. Schiffenbauer, and E. K. Wakeland. 1994. Polygenic control of suscep tibility to murine system ic lupus erythematosus. Immunity 1:219-229. 227. Hess, E. V., and Y. Farhey. 1994. Epidemiology, genetics, etiology, and environment relationships of system ic lupus erythematosus. Curr Opin Rheumatol 6:474-480. 228. Boackle, S. A., V. M. Holers, X. Chen, G. Szakonyi, D. R. Karp, E. K. Wakeland, and L. Morel. 2001. Cr2, a candidate gene in the m uri ne Sle1c lupus susceptibility locus, encodes a dysfunctional protein. Immunity 15:775-785.

PAGE 123

123 229. Salmon, J. E., S. Millard, L. A. Schachter, F. C. Arnett, E. M. Ginzler, M. F. Gourley, R. Ra msey-Goldman, M. G. Peterson, and R. P. Kimberly. 1996. Fc gamma RIIA alleles are heritable risk factors for lupus nephritis in African Americans. J Clin Invest 97:1348-1354. 230. Sen, G. C., and R. M. Ransohoff. 1993. Inte rferon-induced antiviral actions and their regulation. Adv Virus R es 42:57-102. 231. Dalod, M., T. Hamilton, R. Salomon, T. P. Sa lazar-M ather, S. C. Henry, J. D. Hamilton, and C. A. Biron. 2003. Dendritic ce ll responses to early murine cytomegalovirus infection: subset functional specialization and differe ntial regulation by interferon alpha/beta. J Exp Med 197:885-898. 232. Fountain, J. W., M. Karayiorgou, D. Taruscio, S. L. Graw, A. J. Buckler, D. C. W ard, N. C. Dracopoli, and D. E. Housman. 1992. Genetic and physical map of the interferon region on chromosome 9p. Genomics 14:105-112. 233. Humphray, S. J., K. Oliver, A. R. Hunt, R. W Plumb, J. E. Loveland, K. L. Howe, T. D. Andrews, S. Searle, S. E. Hunt, C. E. Scott, M. C. Jones, R. Ainscough, J. P. Almeida, K. D. Ambrose, R. I. Ashwell, A. K. Babbage S. Babbage, C. L. Bagguley, J. Bailey, R. Banerjee, D. J. Barker, K. F. Barlow, K. Ba tes, H. Beasley, O. Beasley, C. P. Bird, S. Bray-Allen, A. J. Brown, J. Y. Brown, D. Burf ord, W. Burrill, J. Burton, C. Carder, N. P. Carter, J. C. Chapman, Y. Chen, G. Clarke, S. Y. Clark, C. M. Clee, S. Clegg, R. E. Collier, N. Corby, M. Crosier, A. T. Cummings, J. Davies, P. Dhami, M. Dunn, I. Dutta, L. W. Dyer, M. E. Earthrowl, L. Faulkner, C. J. Fl eming, A. Frankish, J. A. Frankland, L. French, D. G. Fricker, P. Garner, J. Garnett, J. Ghori, J. G. Gilbert, C. Glison, D. V. Grafham, S. Gribble, C. Griffiths, S. Gri ffiths-Jones, R. Grocock, J. Guy, R. E. Hall, S. Hammond, J. L. Harley, E. S. Harrison, E. A. Hart, P. D. Heath, C. D. Henderson, B. L. Hopkins, P. J. Howard, P. J. Howden, E. Huckle, C. Johnson, D. Johnson, A. A. Joy, M. Kay, S. Keenan, J. K. Kershaw, A. M. Kimberley, A. King, A. Knights, G. K. Laird, C. Langford, S. Lawlor, D. A. Leongamornlert, M. Leversha, C. Lloyd, D. M. Lloyd, J. Lovell, S. Martin, M. Mashreghi-Mohammadi, L. Matthews, S. McLaren, K. E. McLay, A. McMurray, S. Milne, T. Nickerson, J. Nisbett, G. Nordsiek, A. V. Pearce, A. I. Peck, K. M. Porter, R. Pandian, S. Pelan, B. Phillimore, S. Povey, Y. Ramsey, V. Rand, M. Scharfe, H. K. Sehra, R. Shownkeen, S. K. Sims, C. D. Skuce, M. Smith, C. A. Steward, D. Swarbreck, N. Sycamore, J. Tester, A. Thorpe, A. Tracey, A. Tromans, D. W. Thomas, M. Wall, J. M. Wallis, A. P. West, S. L. Whitehead, D. L. Willey, S. A. Williams, L. Wilming, P. W. Wray, L. Young, J. L. Ashurst, A. Coulson, H. Blocker, R. Durbin, J. E. Sulston, T. Hubbard, M. J. Jackson, D. R. Bentley, S. Beck, J. Rogers, and I. Dunham. 2004. DNA sequence and analysis of human chromosome 9. Nature 429:369-374. 234. Einhorn, S., D. Grander, O. Bjork, K. Br ondum -Nielsen, and S. Soderhall. 1990. Deletion of alpha-, beta-, and omega-interferon genes in malignant cells from children with acute lymphocytic leukemia. Cancer Res 50:7781-7785. 235. Young, R. S., T. Reed, M. E. Hodes, and C. G. Palm er. 1982. The dermatoglyphic and clinical features of the 9p tris omy and partial 9p monosomy syndromes. Hum Genet 62:31-39.

PAGE 124

124 236. Wilson, G. N., A. Raj, and D. Baker. 1985. The phenotypic and cyt ogenetic spectrum of partial trisomy 9. Am J Med Genet 20:277-282. 237. Mathian, A., A. Weinberg, M. Gallego s, J. Banchereau, and S Koutouzov. 2005. IFN-{alpha} Induces Early Lethal Lupus in Preautoimmune (New Zealand Black x New Zealand White)F1 but Not in BALB/c Mice. J Immunol 174:2499-2506. 238. Dupont, S. A., S. Goelz, J. Goyal, and M. Green. 2002. Mechanism s for regulation of cellular responsiveness to human IFN-beta1a. J Interferon Cytokine Res 22:491-501. 239. Gigli, G. L., A. Scalise, F. Pauri, G. Silves tri, M. Diom edi, F. Pl acidi, M. Grazia Pomponi, and C. Masala. 1996. Valproate-induced systemic lupus erythematosus in a patient with partial trisomy of chromosome 9 and epilepsy. Epilepsia 37:587-588. 240. Gigli, G. L., A. Scalise, G. Silvestri, M. Diom edi, F. Placidi, M. G. Pomponi, and C. Masala. 1996. Clinical case report: multiple idiosyncratic adverse effects of antiepileptic drugs in trisomy 9p. Int J Neurosci 87:181-189. 241. Bleck, T. P., and M. C. Smith. 1990. Possible induction of system ic lupus erythematosus by valproate. Epilepsia 31:343-345. 242. Asconape, J. J., K. R. Manning, and M. E. Lancm an. 1994. Systemic lupus erythematosus associated with use of valproate. Epilepsia 35:162-163. 243. Bonnet, F., P. Morlat, S. De Witte, C. Com be, and J. Beylot. 2003. Lupus-like syndrome and vasculitis induced by valpromide. J Rheumatol 30:208-209. 244. Boon, D. M., J. A. van Parys, and A. J. Swaak. 1992. [Disse minated lupus erythematosus induced by carbamazepine (Tegretol)]. Ned Tijdschr Geneeskd 136:2085-2087. 245. Lyle, R., C. Gehrig, C. Neergaard-Henrichs en, S. Deutsch, and S. E. Antonarakis. 2004. Gene expression from the aneuploid chromosome in a tr isomy mouse model of down syndrome. Genome Res 14:1268-1274. 246. Doyle, S. E., R. O'Connell, S. A. Vaidya, E. K. Chow, K. Yee, and G. Cheng. 2003. Toll-like receptor 3 m ediates a more potent an tiviral response than To ll-like receptor 4. J Immunol 170:3565-3571. 247. MacKay, V. L., X. Li, M. R. Flory, E. Turcott, G. L. Law, K. A. Serikawa, X. L. Xu, H. Lee, D. R. Goodlett, R. Aebersold, L. P. Zhao, and D. R. Morris. 2004. Gene expression analyzed by high-resolution stat e array analysis and quantita tive proteom ics: response of yeast to mating pheromone. Mol Cell Proteomics 3:478-489. 248. Iafrate, A. J., L. Feuk, M. N. Rivera, M. L. Listewnik, P. K. Donahoe, Y. Qi, S. W Scherer, and C. Lee. 2004. Detection of large-s cale variation in the human genome. Nat Genet 36:949-951.

PAGE 125

125 249. Faham, M., J. Zheng, M. Moorhead, H. Fa khrai-Rad, E. Nam saraev, K. Wong, Z. Wang, S. G. Chow, L. Lee, K. Suyenaga, J. Reichert, A. Boudreau, J. Eberle, C. Bruckner, M. Jain, G. Karlin-Neumann, H. B. Jones, T. D. W illis, J. D. Buxbaum, and R. W. Davis. 2005. Multiplexed variation scanning for 1,000 amplicons in hundreds of patients using mismatch repair detec tion (MRD) on tag arrays. Proc Natl Acad Sci U S A 102:14717-14722.

PAGE 126

126 BIOGRAPHICAL SKETCH Haoyang Zhuang was born in Tianjin, China. She received her bachelors degree in m icrobiology from Nankai Unversity, Tianjin, China in 1998. She then worked as a sales manager in the Department of Import and E xport at Shenzhen Agriculture Product Co., Ltd, Guangdong, China. In 2000, she started work as a research assistant in the Institute of Microbiology, Chinese A cademy of Science, Beijing, China, under the supervision of Dr. Yanhe Ma. She was admitted to the Interdisciplinary Program in Biomedical Sciences at the University of Florida in 2002. She did her dissertation resear ch under the supervisi on of Dr. Westley H. Reeves in the Division of Rheumatology and Clinical Immunology and wa s awarded the Doctor of Philosophy in 2008.