<%BANNER%>

Estrogen Treatment in the Hippocampus

Permanent Link: http://ufdc.ufl.edu/UFE0021680/00001

Material Information

Title: Estrogen Treatment in the Hippocampus Analysis of Gene Expression and Congnitive Function in the Aging Female Mouse
Physical Description: 1 online resource (163 p.)
Language: english
Creator: Aenlle, Kristina
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2009

Subjects

Subjects / Keywords: aging, estrogen, hippocampus, memory, mice
Neuroscience (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy ESTROGEN TREATMENT IN THE HIPPOCAMPUS: ANALYSIS OF GENE EXPRESSION AND CONGNITIVE FUNCTION IN THE AGING FEMALE MOUSE By Kristina K Aenlle August 2009 Chair: Thomas C Foster Major: Medical Sciences Neuroscience The use of estrogen replacement therapy to treat age-related cognitive decline remains controversial. While many basic, translational and clinical studies show protective effects of estrogen treatment, others show little if any cognitive reinforcement. The discrepancies in these studies, for the most part, are due to the lack of knowledge researchers have in estrogen signaling and how estrogen signaling changes with age. To gain a better understanding of estrogen s effect on the hippocampus during aging, Morris Water Maze and microarray analyses were used to compare hippocampal function and gene expression responses to estogen treatment during aging. The results show that estrogen treatment maintains hippocampal dependent spatial memory in middle-aged female mice. Moreover, estrogen treatment reversed age related gene expression and promoted the expression of neuroprotective genes in both young and middle-aged mice but the gene expression response in aged animals was attenuated. Furthermore, while estrogen treatment supported the expression of genes involved in synapse in young and middle-aged mice, gene expression in aged mice was shifted toward rapid signaling pathways. The differences in gene expression likely involved age-related decreases in estrogen receptors. Accordingly, microarray analyses of estrogen receptor alpha knockout and estrogen receptor beta knockout mice revealed significant alteration of hippocampal gene expression resulting from the alteration of receptor ratio. Together, these results suggest that age-related alteration of estrogen receptors and membrane activity contribute to the reduced gene expression changes found in aged mice.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Kristina Aenlle.
Thesis: Thesis (Ph.D.)--University of Florida, 2009.
Local: Adviser: Foster, Tom.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2011-12-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2009
System ID: UFE0021680:00001

Permanent Link: http://ufdc.ufl.edu/UFE0021680/00001

Material Information

Title: Estrogen Treatment in the Hippocampus Analysis of Gene Expression and Congnitive Function in the Aging Female Mouse
Physical Description: 1 online resource (163 p.)
Language: english
Creator: Aenlle, Kristina
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2009

Subjects

Subjects / Keywords: aging, estrogen, hippocampus, memory, mice
Neuroscience (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy ESTROGEN TREATMENT IN THE HIPPOCAMPUS: ANALYSIS OF GENE EXPRESSION AND CONGNITIVE FUNCTION IN THE AGING FEMALE MOUSE By Kristina K Aenlle August 2009 Chair: Thomas C Foster Major: Medical Sciences Neuroscience The use of estrogen replacement therapy to treat age-related cognitive decline remains controversial. While many basic, translational and clinical studies show protective effects of estrogen treatment, others show little if any cognitive reinforcement. The discrepancies in these studies, for the most part, are due to the lack of knowledge researchers have in estrogen signaling and how estrogen signaling changes with age. To gain a better understanding of estrogen s effect on the hippocampus during aging, Morris Water Maze and microarray analyses were used to compare hippocampal function and gene expression responses to estogen treatment during aging. The results show that estrogen treatment maintains hippocampal dependent spatial memory in middle-aged female mice. Moreover, estrogen treatment reversed age related gene expression and promoted the expression of neuroprotective genes in both young and middle-aged mice but the gene expression response in aged animals was attenuated. Furthermore, while estrogen treatment supported the expression of genes involved in synapse in young and middle-aged mice, gene expression in aged mice was shifted toward rapid signaling pathways. The differences in gene expression likely involved age-related decreases in estrogen receptors. Accordingly, microarray analyses of estrogen receptor alpha knockout and estrogen receptor beta knockout mice revealed significant alteration of hippocampal gene expression resulting from the alteration of receptor ratio. Together, these results suggest that age-related alteration of estrogen receptors and membrane activity contribute to the reduced gene expression changes found in aged mice.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Kristina Aenlle.
Thesis: Thesis (Ph.D.)--University of Florida, 2009.
Local: Adviser: Foster, Tom.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2011-12-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2009
System ID: UFE0021680:00001


This item has the following downloads:


Full Text

PAGE 1

ESTROGEN TREATM ENT IN THE HIPPOCAMP US: ANALYSIS OF GENE EXPRESSION AND CONGNITIVE FUNCTION IN THE AGING FEMALE MOUSE By KRISTINA K. AENLLE A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2009 1

PAGE 2

2009 Kristina K. Aenlle 2

PAGE 3

To Jeffrey, Dante and Dom inic 3

PAGE 4

ACKNOWL EDGMENTS I would not have been able to accomplish all that I have with out the love and support from my friends and family. First, I want to thank my husband, Jeff, for the encouragement, love and sacrifice he has shown me. I must also thank my amazing beau tiful boys, Dante and Dominic. Their smiling faces, laughs and love make each and every day more than I could ever dream of. Next, I want to ackowledge the love and support my family and I have seen especially from, Tom, Marianne, Liz, Steve, Beverly, Tony, Lisa, Scot, Michel e, Jenny, Robert, Josephine and our Aunts, Uncles and cousins. I ap preciate all of you have done for us. During my time at the Univeristy of Florida, I meet many amazing people and made many wonderful friendships. Thank you to: Dustin, Kr isti, Amber, Tolga, Missy, Shannon, Shankar and Stephanie for their support and friendships. I would like to thank my colleagues and ment ors at the University of Florida for their guidance and encouragment. In particular, I tha nk Dr. Thomas Foster for the honor of working with him and his support and guidance. Also, I thank Dr. Sue Semple-Rowland for her guidance and assistance. Finally I tha nk the Foster lab, Ashok, Li, Asha, Travis, Karthik, Wei, Olga and Zane for making everyday so much fun. 4

PAGE 5

TABLE OF CONTENTS page ACKNOWLEDGMENTS...............................................................................................................4 LIST OF TABLES................................................................................................................. ..........8 LIST OF FIGURES.........................................................................................................................9 ABSTRACT...................................................................................................................................10 CHAPTER 1 INTRODUCTION................................................................................................................. .12 Estrogen and Cognition......................................................................................................... .12 Estrogen Signaling Pathways.................................................................................................21 Classical Processes..........................................................................................................21 Nonclassical Rapid Processes......................................................................................21 Classical and Non-classical Crosstalk.............................................................................25 The Hippocampus...................................................................................................................26 Morris Water Maze..........................................................................................................27 Estrogen Action in the Hippocampus..............................................................................29 Estrogens Effect in the Aging Hippocampus.................................................................31 2 ESTROGEN EFFECTS ON COGNITI ON AND HIPPOCAMPAL TRANSCRIPTION IN MIDDLE-AGED MICE....................................................................................................34 Introduction................................................................................................................... ..........34 Material and Methods.............................................................................................................35 Animals............................................................................................................................35 Hormone Administration.................................................................................................35 Water Maze..................................................................................................................... 36 Cue Discrimination Training...........................................................................................36 Spatial Discrimination Training......................................................................................37 cDNA Microarray............................................................................................................38 Oligonucleotide Array.....................................................................................................39 RT-PCR...........................................................................................................................40 Statistical Analysis..........................................................................................................4 1 Results.....................................................................................................................................42 Uterine Weight................................................................................................................4 2 Cue Discrimination..........................................................................................................42 Spatial Discrimination.....................................................................................................42 Acquisition Probe Trials..................................................................................................43 Retention Probe Trials.....................................................................................................44 Microarray Results..........................................................................................................44 Discussion...............................................................................................................................48 5

PAGE 6

Gene Profiles Associated with Aging and Estradiol Treatm ent......................................49 Treatment Effects on Transcrip tion in the Aging Hippocampus.....................................49 3 AGING ALTERS THE EXPRESSION OF GENES FOR NEUROPROTECTION AND SYNAPTIC FUNCTION FOLLOWING ACUTE ESTRADIOL TREATMENT................66 Introduction................................................................................................................... ..........66 Materials and Methods...........................................................................................................67 Subjects............................................................................................................................67 Hormone Administration.................................................................................................68 Microarray Hybridizatio n and Signal Detection.............................................................69 RT-PCR...........................................................................................................................69 Statistical Analysis..........................................................................................................7 0 Results.....................................................................................................................................71 Age Differences in Estradiol-Responsive Genes for Synaptogenesis, and Neuroprotection 6hr After Treatment..........................................................................71 Age Differences in Estradiol-Respon sive Genes 12hr After Treatment.........................73 Discussion...............................................................................................................................74 Age Differences in Estradiol-Responsive Gene Signatures 6hr After Treatment...........74 Age Differences in Estradiol-Responsive Gene Signatures 12hr After Treatment.........76 Mechanisms for Age-Related Differences in Estradiol-Responsive Gene Signatures....76 4 ANALYSIS OF HIPPOCAMPAL GENE EXPRESSION IN ESTROGEN RECEPTOR ALPHA AND ESTROGEN RECEPTOR B ETA KNOCKOUT MICE AFTER ACUTE ESTRADIOL TREATMENT.................................................................................................97 Introduction................................................................................................................... ..........97 Materials and Methods...........................................................................................................98 Subject.............................................................................................................................98 Hormone Administration.................................................................................................99 Microarray Hybridizatio n and Signal Detection...........................................................100 Data Filtering and Statistical Analysis..........................................................................100 RT-PCR.........................................................................................................................101 Results...................................................................................................................................102 Alteration of Basal Gene Expr ession Levels in ERKO Mice........................................102 Alteration of Gene Expression After Acute EB Treatment...........................................103 Estrogen Receptor Alpha Gene Expression Levels.......................................................105 RT-PCR.........................................................................................................................105 Discussion.............................................................................................................................106 Acute Estrogen Treatment Differentially Alters Hippocampal Gene Expression in WT, ER KO and ER KO Mice................................................................................108 Conclusion.....................................................................................................................110 5 CONCLUSION................................................................................................................... ..131 Summary and Discussion.....................................................................................................131 Microarray Relaiblity a nd Scientific Significance...............................................................136 6

PAGE 7

7 Future Directions..................................................................................................................138 LIST OF REFERENCES.............................................................................................................142 BIOGRAPHICAL SKETCH.......................................................................................................163

PAGE 8

LIST OF TABLES Table page 2-1 Microarray results for genes increasing with age and decreasing with EB treatment.............53 2-2 Microarray results for genes decreasing with age and increasing with EB treatment.............55 2-3 Oligonucleotide array and RT-PCR fold changes...................................................................60 3-1 Context Sequence of Genes for RT-PCR Analysis.................................................................79 3-2 Synaptic Component Genes Increa sed at 6 hr in Young and MA Mice..................................80 3-3 Estradiol-Responsive Pathways 6 hr Post Treatment.............................................................82 3-4 Oxidative Phosphorylation a nd Mitochondrial Dysfunction Gene s Altered at 6 hr in Young and Middle-Aged Mice..........................................................................................82 3-5 Estradiol-Responsive Path ways 12 hr Post Treatment............................................................85 3-6 Signaling Genes Altered at 12 hr in Aged Mice......................................................................86 3-7 Genes from aged mice which exhibited expression opposite young or MA mice at 12 hr.....90 4-1 The top pathways affected in ER KO Oil treated mice........................................................111 4-2 The 22 genes involved in synapse in ER KO Oil treated mice............................................113 4-3 Genes involved in RAR Activation and PPAR that are significantly altered in WT EB treated and ER KO Oil treated mice...............................................................................114 4-4 The 191 genes significant in WT EB treated and ER KO Oil treated mice.........................115 5-1 Genes significant after 6hr of EB treatment in young animals in Chapter 3 and Chapter 4.140 8

PAGE 9

9 LIST OF FIGURES Figure page 2-1 Schedule of injections and behavioral testing.........................................................................61 2-2 Comparison of young and middle-age Oil and EB treated mice during cue discrmination training...............................................................................................................................62 2-3 Comparison of young and middle-age Oi l and EB treated mice during spatial discrmination training across days.....................................................................................63 2-4 Comparison of young and middle-age Oi l and EB treated mice during spatial discrmination probe trial....................................................................................................64 2-5 Confirmation of age and EB treatment effects using oligonucleotide array...........................65 3-1 Estradiol-responsive gene expression is altered over the course of aging..............................95 3-2 Validation of estradiol treatment effect s in young animals at 6 hr using RT-PCR.................96 4-1 Hippocampal gene expression is sensitive to the loss of ER ..............................................121 4-2 Fold change of the 674 genes significantly altered in ER KO mice....................................122 4-3 Differential effect of EB tr eatment in WT and ERKO mice.................................................123 4-4 Venn Diagram of genes differentially expres sed in WT Oil vs WT EB and WT Oil vs ER KO Oil......................................................................................................................124 4-5 ERKO mice display similar gene expression levels after an acute EB treatment as WT mice..................................................................................................................................125 4-6 EB treatment enhances basal activity in ERKO mice. .........................................................126 4-7 ERKO mice display monotonic response to EB treatment....................................................127 4-8 ER mRNA is upregulated in ER KO mice........................................................................129 4-9 Validation of microarra y results using RT-PCR. .................................................................130

PAGE 10

Abstract of Dissertation Pres ented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy ESTROGEN TREATMENT IN THE HIPPOCAMP US: ANALYSIS OF GENE EXPRESSION AND CONGNITIVE FUNCTION IN THE AGING FEMALE MOUSE By Kristina K. Aenlle December 2009 Chair: Thomas C Foster Major: Medical Sciences Neuroscience The use of estrogen replacement therapy to tr eat age-related cognitive decline remains controversial. While many basic, translational and clinical studie s show protective effects of estrogen treatment, others show little if any co gnitive reinforcement. The discrepancies in these studies, for the most part, are due to the lack of knowledge researchers ha ve in estrogen signaling and how estrogen signaling changes w ith age. To gain a better unders tanding of estrogens effect on the hippocampus during aging, Morris Water M aze and microarray analyses were used to compare hippocampal function and gene expression responses to estogen treatment during aging. The results show that estrogen treatment maintains hippocampal dependent spatial memory in middle-aged female mice. Moreover, estrogen tr eatment reversed age related gene expression and promoted the expression of neuroprotectiv e genes in both young and middle-aged mice but the gene expression response in aged animals was attenuated. Furthermore, while estrogen treatment supported the expression of genes invol ved in synapse in young and middle-aged mice, gene expression in aged mice was shifted toward rapid signaling pathways. The differences in gene expression likely involved age-related d ecreases in estrogen receptors. Accordingly, microarray analyses of estrogen receptor alpha knockout and estrogen receptor beta knockout mice revealed significant alteration of hippocampa l gene expression resulting from the alteration 10

PAGE 11

11 of receptor ratio. Together, these results suggest that age-related alteration of estrogen receptors and membrane activity contribute to the reduced gene expres sion changes found in aged mice.

PAGE 12

CHAP TER 1 INTRODUCTION Estrogen and Cognition Dementia is one of the leading concerns in the public health comm unity. Affecting only 1% of the population at age 65, the numbers escalate to roughly 25% by the age of 85. Alzheimers disease accounts for the majority (50-60%) of dementia diagnoses. By 2040 it is projected that 81 million people worldwide will su ffer from Alzheimers disease(Ferri et al., 2005) with the majority of cases being wo men (68%) (Brookmeyer et al., 1998). Current research suggests estrogen treatment may delay the onset of memory loss associated with normal aging and Alzheimers disease (Henderson, 2004; Kawas et al., 1997). However, estrogen has diverse effects throughout the central nervous system and the challenge remains to determine which of these effects are important for memory This challenge has grown more complicated due to the discovery of several estrogen recep tors and the emerging evidence of rapid effects from estrogen. The use of estrogen to treat menopausal sympto ms began in the 1940s (for review of the history of estrogen use (Stefanic k, 2005); however, as research be gan to show that estrogen may protect against age related cogniti ve decline and may delay the onset of Alzheimers disease, the use of estrogen rapidly increased. Furthermore, as life expectancy has increased, the age at which women enter menopause (cessation of menstrual cycle) has remained relatively constant; therefore, women are spending potentially one third of their lifespan in an estrogen-depleted state, leaving women more vulne rable to cognitive impairments. In the late 1980s Sherwin demonstrated that premenopausal women who had their uterus and/or ovaries removed maintained their performance on a test of verb al memory when receiving estrogen replacement. The participants receiving placebo experienced a significant decrease in their verbal memory 12

PAGE 13

scores Halbreich et al. (1995) followed up Sher wins study and found that m enopause was associated with a potential acceleration of age-related cognitive deficits. These initial studies illustrated that estrogen is not only involved in reproductive systems but may protect against cognitive decline found during aging. However, the mechanism in which estrogen can ameliorate age-related cognitive impairments is unknown and the data supporting estrogens positive influence on cognition is not without controversy. The divergence between the copi ous amount of basic science, epidemiological and clinical studies that supported the potenti al benefit of hormone therapy in preventing age-associated cognitive impairment and the results of st udies suggesting adverse effects was recently emphasized by the published results of the Wome n's Health Initiative Memory Study (WHIMS) (Espeland et al., 2004; Shumaker et al., 2004). WHIMS compared the effect of estrogen alone and estrogen with progesterone on the incidence of probable dementia and global cognitive function in older women (Espeland et al., 2004; Shumaker et al., 2004). The WHIMS had a vast impact on the perception of estrogen therapy du e to its large number of participants (2808 women) and the medias excitement over the WH IMS findings that indicat ed that not only did estrogen treatment with or with out progester one fail to improve cogni tive function, but may augment cognitive decline in postmenopausal wo men. Beyond WHIMS, other studies have also suggested no effect of estrogen treatment on memory impairments (Henderson et al., 2000; Wang et al., 2000). The question remains as to why rodent models, non-human primate models and many clinical trials show improved cogniti ve performance after estrogen treatment and others do not. Following the conclusion of WHIMS many scien tists speculated as to why the study failed to confirm previous findings of the beneficial effects of estrogen treatment. Sherwin (2005) 13

PAGE 14

reviewed WHIMS and previous random ized contro lled trials (RCTs) a nd found that the initial setup of many of the RCTs, including WHIMS, failed at many points. First, WHIMS failed to use a full assortment of cognitive tests. WH IMS used only 3MS (Modified Mini-Mental State Examination); therefore, any improvement on verbal memory, which previous RCTs found to benefit from estrogen treatment, was not assessed. The 3MS is a test of cognitive decline that is not suited to distinguis h between specific cognitive domains. It is believed that estrogen can influence only certain ty pes of memory; such as verbal a nd spatial memory. Second, many of the previous RCTs used estrogen alone and a combination of estrogen and progesterone treatment, referred to as hormone replacement therapy (HRT ). More specifically many of these studies, including WHIMS, used a form of progest erone called medroxyprogesterone acetate (MPA). Research indicates that MPA c ounteracts estrogens ability to pr otect neurons against glutamate induced neurotoxicity (Nilsen and Brinton, 2002). The WHIMS study found that estrogen + MPA treatment increased the risk of probable dementia and estrogen treatment alone did not improve cognitive function. Furthermore, previous studies have shown that progesterone may have opposing effects on biology (Woolley and McEwen, 1993) and memory compared to estrogen (El-Bakri et al., 2004). For example, aged ovariectomized (removal of the ovaries, OVX) rats given progesterone exhibited more wo rking memory errors, compromised learning of working memory and reference memory errors compared with aged OVX rats that did not receive progesterone (Bimonte-Nelson et al ., 2004). This same study showed OVX improved working memory in aged animals compared to shams, suggesting the removal of ovaries may eliminate the negative impact of progesterone. Considering that menopause and estropause is associated with increased levels of progesteron e and decreased levels of estrogen, it is believed that an increase of progesterone may contribut e to cognitive deficits in aged animals. 14

PAGE 15

More im portant for understanding estrogens effects on cognition, and a more compelling explanation for the failure of WH IMS, may be the age at which treatment was initiated. Evidence is mounting which suggests that beneficial eff ects from estrogen treatment may be reduced or nonexistent if treatment is init iated several years after estroge n declines during menopause (for review see, Sherwin, 2006). The age of the wo men in WHIMS ranged from 65-79 (mean age of 72), at least 15 years after menopa use. In comparing the results of WHIMS to previous work examining the relationship between hormones and c ognitive decline, it is evident that estrogen treatment is beneficial to cognition within a critical amount of time after estrogen depletion. Accordingly, the authors of WHIMS did not ru le out the potential benefit of HRT in younger women. Together these studies s uggest that the benefits of es trogen therapy may be dependent on the amount of time women remain in a hormone depleted state. Beyond clinical studies, much of the evidence in favor of the be neficial effects of estrogen comes from animal studies. Rode nts and non-human primates are useful models in the study of aging and estrogen. Non-human primates display a menstrual cycle, hormonal fluctuation, and menopausal state similar to that found in women (Gilardi et al., 1997; Goodman et al., 1977). Mice also exhibit similar hormonal modulation wi th irregular estrous cycles occurring during middle-age and subsequent drop off of estrogen levels Rats exhibit an irre gular estrous cycle at middle age; however, estrogen levels do not drop off immediately as seen in the human and mice. As mentioned, non-human primates make a great model for estrogen research due to their similar menstrual cycle, hormonal fluctuation, a nd menopausal state found in women (Gilardi et al., 1997) (Goodman et al., 1977). Similar to clini cal data, age-dependence for beneficial effects of estrogen has been observed in primates. Recentl y, it has been shown that aged female rhesus 15

PAGE 16

monkeys display cognitive changes during fluctua tion of the m enstrual cycle (Lacreuse et al., 2001). Also, following natural or surgical menopause (Lacreuse et al., 2001; Roberts et al., 1997) aged female rhesus monkeys have displayed cognitive impairments. The results from estrogen therapy in monkeys indicate that estrogen can improve some aspects of cognition in aged monkeys. For example, estrogen improved spa tial working memory in aged OVX rhesus monkeys that were without estrogen for at leas t 10 years (Lacreuse et al., 2002). Furthermore, cyclic estrogen treatment has also been s hown to improve cognitive function in aged OVX rhesus monkeys (Rapp et al., 2003). Finally, Tinkl er and Voytko (2005) compared results from young and middle-aged female rhesus monkeys a nd found effects of OVX and ERT on cognition that was dependent on age. These results indi cate that estrogen ha s beneficial effects on cognition but these benefits may be decreasing with age or as the amount of time in an estrogen depleted state increases. By far the bulk of research examining the role of estrogen in cognitive function comes from rodent studies. In a series of studies, Heikkinen and associates (2002, 2004) assessed the role of estropause in age-asso ciated cognitive decline in fema le mice. In the first study, OVX animals at 3 months of age were deprived of estrogen for 4 months then placed on estrogen minipellets at 7 months of age, 40 days before behavior testing. In th e second study, 5 month old mice were OVX and without estrogen for 19 mont hs. These aged mice were placed on estrogen minipellets at 24 months of age, again 40 days pr ior to behavior testing. When the two groups (4 months vs 19 months of estrogen of deprivation) were compared the results showed that estrogen treatment was associated with improvement in cognitive performance in young mice compared to age-matched untreated mice. While aged mice did show estrogen effects in the same direction as their young counterparts, the results were no t significant. In a similar study, rats OVXd at 16

PAGE 17

m idlife were treated with either estrogen or vehicle 3 or 10 months post OVX (Gibbs, 2000). Those receiving estrogen 3 months after surgery preformed be tter on delayed spatial memory task (i.e. matching to position T-maze) compared to their vehicle treated counterparts. In contrast, when estrogen treatment was initiate d 10 months after OVX, animals did not exhibit memory improvements. Gibbs (2000) suggested an important window between 3 and 10 months of estrogen withdrawal that is cr itical for the beneficial effects of estrogen. Taken together, the results from humans, primates, a nd rodents indicate that estrogen can have beneficial effects on cognition when treatment is administer ed soon after estrogen deprivation. It has been shown that estroge n treatment administered with in a critical time period can delay cognitive impairments associated with agin g. The work included in this dissertation set out to determine how the effect of estrogen cha nges with age. More sp ecifically, how estrogen influences gene expression levels during aging and the role of estroge n receptors in gene expression response in the hippocampus. Estrogen Receptors Estrogen, a powerful pleiotropi c steroid hormone, is produced by the aromatization of testosterone within the ovaries; however, aromatase activity is also present in the brain, including the hippocampus. Three types of estrogen are produced in cycling women; estradiol, estrone and estriol, with the primary estrogen being 17 -estradiol. Estrogen binds to nuclear receptors, the most prevalent being estrogen receptor alpha and estrogen re ceptor beta (ER and ER respectively). ER and ER share many structural and func tional similarities but can also induce different responses. Despite the fact that the two estrogen receptor subtypes have a similar structure, equivalent binding affinity for estrogen and share ~90% homo log, they seem to have unique roles. The N17

PAGE 18

term inal domain of ER and ER which contains the AF-1 domain (ligand independent domain), shares only 20% amino acid homology a nd displays promoter and cell specific activity. The central domain of ER and ER is highly conserved between the two receptors with 95% homology. The central domain contains the DNA binding domain, important for specific DNA binding and receptor dimerization. The ligand bind ing domain or E domain contains the AF-2 and shares 55% homology between ER and ER This domain has a similar 3D structure between the two receptors but contains differe nt amino acids in the cavity of the domain resulting in a 20% smalle r ligand-binding cavity in ER and may be important for receptor specificity. Studies have shown that ER has a weaker AF-1 domain and relies more on AF2 domain (Delaunay et al., 2000). Thes e subtle differences in gene structures can lead to diverse actions on transcrip tional regulation. Results indicate that ER and ER share a set of primary ERE but differ in their ability to associate with other EREs resulting in differe nces in transcriptional activation properties (Barkhem et al., 1998). Furthermore, the combinati on of receptor subtypes can have different or even display opposite effects on transcription rela ted cellular activities (Paech et al., 1997). For example, ER and ER show different effects on cyclin D promoter, with ER inducing expression and ER repressing cyclin D expression (Liu et al., 2002). Patr one et al. (2000) provided evidence in neuroblastoma cells that estrogen activated specific signaling pathways dependent on the receptor subtype. The group showed that in SK-N-BE (neu ral cell deri vatives), ER activation increases length a nd neurite number, whereas ER activation only induces neurite elongation. These studies show that es trogens vast impact may be due in part by specialization of its receptor subtypes. Through the use of chimeric receptors the authors further demonstrated that the presence of both transc ription activation functions located in the NH218

PAGE 19

term inus and COOH-terminus are necessary for the differential biologica l activity. Their data highlight ER activity in mature neural cells and displays the role of ER in regulating neuronal morphology. Although most of the focus of ER localizati on is in neurons, ER staining is found in nonneuronal cells. ER staining has been found in select astroc ytic processes, in close association with dendritic spines (Milner et al., 2005). Similarly, ER labeling is shown in astrocytes in monolayer cultures (Garcia-Segura et al., 1999; Santagati et al., 1994) and gonadal steroids are shown to regulate glial mo rphology and the expression of glial fi brillary acid protein (Day et al., 1993). Furthermore, ER expression is found in glial cel ls, using double immunohistochemical localization of ER and the specific astroglial marker glia l fibrillary acidic protein (GFAP), and ER -immunoreactive glial cells are found in all layers of CA1, CA2 and CA3 of male and female rats (Azcoitia et al., 1999; Bjornstrom and Sjoberg, 2005). Furthermore, estrogen receptors have been associated with numerous subcellular structures. Chen et al., (2004a, 2004b) found that, not only are both ER and ER present in mitochondria, but estrogen treatment significantly increased the le vel of mitochondria ERs in a time-and dose-dependent manner. Recently, aggregates of ER have been localized within mitochondria, endomembranes, and the plasma memb rane (Milner et al., 2001). Work by Zhai et al., (2000), examined the effect of estrogen on the structure and function of mitochondria of wild type mice that were either sham or ovariectomized (OVX) and ER knockout (KO) mice and found that the mitochondria of the OVX and ER KO were abnormal in shape, with abnormal cristea and loss of matrix area, compared to the wild type counterparts. Together these studies display estrogens potential ferv ent influence on cellular function. 19

PAGE 20

Recent data from aortas indicate distinct pathways for ER and ER signaling. ER increases overall gene expression and ER decreases overall expression in aortic tissue (O'Lone et al., 2007). Similar results are se en in the regulation of apolipoprotein E, a protein believed to be involved in the accumulation of plaque formations in Alzheimers disease. ER increases levels of APOE mRNA and protein, whereas ER decreases the leve ls (Wang et al., 2006). Other studies have suggested opposition on ER signaling by ER (Gonzalez et al., 2007). Gonzales et al., (2008) showed that in the presence of a specific ER agonist the levels of the progesterone receptor were increased compared to estradiol alone. However, when an ER selective agonist was used the levels of progesterone were a ttenuated. Together these results show that ER activation can lead to activation of distinct path ways and cross talk between the two, possible by inhibiting the activity of the other receptor. As mentioned, estrogen receptors have been demonstrated at the plasma membrane (Kuroki et al., 2000; Milner et al ., 2001; Ramirez et al., 1996). Toran-Allerand et al. (2002) has described a putative plasma memb rane-associated ER-X, which is thought to be involved with estrogen-induced activation of the mitogen-activated protein kinase cascade. However, ER-X is believed to be expressed during development and after injury(Toran-Allerand et al., 2002). The role ER-X would have in the healthy adult brain is unknown. Inte restingly, a G-protein coupled receptor, GPR30, is described to have estrog en specific binding(Funakoshi et al., 2006). Although controversial (Levin, 2009), GPR30 is belie ved to be a plasma membrane receptor that mediates some of the rapid effects of estrogen (GPR30 will be discussed further in a later section). Also, Lu et al. (2004) reported a change in compartmentalization of the ER that may characterize a regulator of in tracellular signal transduction from membrane to cytosol in hippocampal neurons. Lastly, it is believed that non-nuclear and nuclear ERs may be the same 20

PAGE 21

protein, but translocated to another cell com partment, a nd capable of producing nonclassical processes. Estrogen Signaling Pathways 17 -Estradiol (EB) exerts many of these benefi ts through classical influences, as well as exhibiting rapid nonclassical eff ects. While both classical and nonc lassical pathways have been found to be active within the hippocampus, th e entire processes of both are not fully known(Bjornstrom and Sjoberg, 2005) Classical Processes Estrogen can induce transcripti on through classic nuclear recept ors. Estrogen binds to an ER and causes a conformational change in the receptor, promoting homodimerization or heterodimerization. Once dimerized, the classica l mechanism involves the translocation ERs to the nucleus and binds to palindromic estroge n response elements (EREs). Binding to EREs results in the recruitment of specific coregulator s that increase or decreas e the transcription of genes. Each homodimer or heterodimer may ha ve specific coregulators influencing the genes transcribed under each receptor. However, only a third of the genes in humans found to be regulated by EB contain ERE or ERE-like sequences (O'Lone et al., 2004). Moreover, the classical process of estrogen activation of tran scription can take several hour (O'Lone et al., 2004) and estrogen has been found to induce rapid effect on signaling cascades within minutes of administration. Therefore, other nonclassical pr ocesses must also be involved in estrogen mediated gene transcription. Nonclassical Rapid Processes Within the last ten years researchers have discovered rapid estrogenic actions, not mediated through the classical ERE driven gene transcription. This disse rtation refers to any estrogen signaling pathways not driving gene transcription through classical ER dimerization 21

PAGE 22

and binding to ERE as non-classi cal. These non-classical m echanisms can be characterized into three groups; ligand-inde pendent, rapid non-genomic a nd ERE-Independent signaling (Bjornstrom and Sjoberg, 2005). Ligand-independent gene activation refers to the induction of second messenger pathways that lead to the activ ation of phosphate and kinase activity and go on to phosphorylate the estrogen receptor. Rapid-ge nomic activity includes membrane-associated receptors such as G-coupled protein receptors. ERE-independent signaling refers to direct protein-protein interactions be tween the ligand-bound ER and tr anscription factor complexes such as, c-Fos, SP-1 or NF-kB. Ligand-independ ent and rapid-genomic activity are characterized by the rapid activation of estrogenic responses (w ithin minutes), ERE-independent activity can take several hours similar to classical processe s. It is known that non-genomic activation of signaling is not mutually exclusive, cross-ta lk between genomic and nongenomic contribute to the diverse effects of estroge n (Foster, 2005). However, it is not known how the processes contribute to estrogenic properties and which e ffects are exclusive to each pathway and which are dependent on the contributions of each. Ligand-independent: Estrogen most notably binds to the estrogen receptor, alters its configuration and influences tr anscriptional regulation by bindi ng to ERE on promoter/enhancer regions of target genes; however, this pro cess can also be initia ted without ligand binding. Estrogen receptors can be phosphor ylated by growth factors and signaling pathways to go on to bind to ERE on promoter/enhancer re gions of target genes. Growth factors, such as epidermal growth factor (EGF) and its recep tor, initiate signaling cascades leading to the phosphorylation of ERs and to subsequent binding to ERE (L eong et al., 2004). The signaling cascade ERK1/2 /MAPK has been found to activate ER in a ligand-independent manner by phosphorylating serine 104 and 106. The biological relevance of ligand-independent activation of ER is still 22

PAGE 23

under investigation. However, recent work has com pared the temporal pattern of chromatin remodeling and mRNA transcription between ce lls treated with EB and EGF (Berno et al., 2008). Results show that EGF ra pidly activates chromatin rem odeling and mRNA transcription whereas EB has more of a cyclic effect. More wo rk is needed to determ ine if ligand-dependent and ligand-independent mechanisms activate the same genes, influence the activation of each other or work independently. Rapid non-genomic: Although still controversial, the existence of memb rane-associated ERs have been isolated in several cell types (Kelly and Levin, 2001; Levin, 2002). Researchers have found that 5-10% of endogenous estrogen re ceptors are membrane associated (Pedram et al., 2006). This small proportion of estrogen recept ors is believed to ha ve a large impact on signaling cascades and estrogenic properties. Membrane-associated ERs initiate rapid effects by interacting with G-protein coupled receptors and Ca 2+ signaling cascades, leading to (among others) increases in cAMP levels and ultimately altering the balance of phosphates and kinase activity (Sawai et al., 2002; Setalo et al., 2002; Shingo and Kito, 2002). Activation of the tyrosine kinase cascades and MAP kinase (MAP K) signaling by rapid calcium influx occurs within minutes of estrogen exposure (Kuroki et al., 2000; Singh et al ., 1999). Once activated, MAPK phosphorylates CREB, an important com ponent of hippocampal learning and memory and a key component of estrogens neuroprotec tive signaling mechanisms (Murphy and Segal, 1997). Recently published work by Minano et al (2007) found the phosphorylation of CREB was dependent on SRC/RAS/ERK activity and went on to hypothesized that activation of the signaling cascade could have been initiated by To ran-Allerands recently characterized putative membrane receptor, ER-X (Minano et al., 2008); however, involvement of ER-X needs further investigation due to findings that it is only activated during development or injury (Toran23

PAGE 24

Allerand, 2004). The cellular responses to this ac tivation include, adhesion, m igration, survival, neurite maintenance and proliferation (Ke lly and Levin, 2001; Minano et al., 2008). Influence on CREB phosphorylation also occu rs through the interac tion and activ ation of metabotrophic glutamate receptors (mGluR) (Boulw are et al., 2005). Through ERs at the plasma membrane, EB activates group I and group II mGlu Rs. Activation of group I receptors sets off a cascade of events including activation of PKC and MAPK, which phosporylate CREB. In contrast, activation of group II receptors decr eases L-type calcium channel-dependent CREB phosphorylation by inhibiting adenylate cyclase and PKA. Interestingly, ER has been found to solely interact with mG LuR1a receptors but both ER and ER interact with mGlur2/3 receptors. Further studies are needed to better characterize ERs and other membrane receptors triggering these signal cascades Recently, a novel G-protein-c oupled receptor (GPR30) has been described as a membrane estrogen recepto r. GPR30 has been localized to the plasma membrane and there is a report of the receptor being only localized to the endoplasmic reticulum (Raz et al., 2008). However, GPR30 was first is olated in MC7 breast cancer cells and high affinity binding by estrogen was confirmed in ER -negative breast SKBR3 cancer cells (Filardo et al., 2007). Even though SKBR3 cells show abundant expression of GPR30 they display low estrogen binding interaction and little cAMP resp onse(Raz et al., 2008). It should be noted that ER and ER might be able to tether to GPR30 through a currently unknown mechanism and mediate rapid estrogen effects. Given the in teresting but limited know ledge of GPR30 more research is needed to determine its role in estrogen signaling. ERE-independent signaling: ERE-independent signaling refers to ERs regulation of gene expression through direct pr otein-protein interactions with other transcription factors. Examples of these genotropic interactions include; c-Fo s/c-Jun (AP-1), Sp1 and NF-kB (Jakacka et al., 24

PAGE 25

2002; Safe, 2001). The estrogen rece ptor binds to cofactors such as; SP1, AP-1, NF-kB and then to response elem ent sites on DNA. Interestingl y, genotropic effects can differ between ER and ER resulting in differential regula tion of genes. Estradiol induces transcription via AP-1 sites through ER but inhibits tran scription through ER However, the anti-estrogenic compounds; raloxifene and tamoxifene induce transcription through ER and AP-1 interaction but minimal activation through ER (Paech et al., 1997). ERs show high specificity or preferential binding to many of the transcription factors but further investigation is needed to determine which ER activates which transcri ption factors and which cofactors are involved. Classical and Non-classical Crosstalk Estrogens classical and non-classical signaling events are not independent pathways. Much of estrogens signaling results from the combination of classic and non-classic mechanisms. For example, brain derived neurot rophic factor (BDNF), a promoter of neuronal survival and regulator of synapt ic plasticity, is a good example of estrogens ability to influence gene transcription through the contribution of both mechanisms (Lu et al., 2003; Suzuki and Handa, 2004). BDNF is activated by EB through ER E elements, classic genomic events. BDNF is also activated via a cAMP response element in its promoter. CREB is phosphorylated by EB through cAMP/protien kinase A, MAPK, a nd CAMKII activity. Once phosphorylated CREB binds to CRE site and induced transcription of BDNF. Dendritic spine formation is also sensitive to estrogen levels and responds to estrogen through numerous classical and non-classical m echanisms, including NMDA receptor activation. Recently, Morrissette et al. (2008), showed that the expression of NMDA receptor subunit N2B was dependent on genomic activation by ER in the hippocampus (Morissette et al., 2008b). NMDA receptor function is also enhanced throu gh tyrosine phosphorylation by c-src, which may 25

PAGE 26

be activated by EB interacti on with a m embrane receptor (Murphy and Segal, 1996). Finally, estrogen has been shown to rapidly activate Akt, a pathway implicated in synatogenesis, spine number and morphology (Akama and McEwen, 2003). Phosphorylated Akt in the hippocmapus is increased during proestrus when compared to estrus, diestrus and ovariectomized animals (Znamensky et al., 2003). Akt may also be activated indirectly by estrogen through BDNFs activation of TrkB receptor. Estrogens activatio n of the AKT pathway may be one-way estrogen is influencing new spine forma tion, transcription/translation of synaptic proteins, and cell survival (Du et al., 2004). Together these studie s on signaling pathways show that classic and non-classic mechanism work togeth er to produce estrogens tr ophic neuroprotective effects. The Hippocampus For over 20 years research has focused on estrogens affect on the hippocampus due to its well-established role in acquisition and consolida tion of memory and due to the recent discovery of estrogen receptors within the hippocampus The hippocampus has also been found to be morphologically, physiologically, and functionally responsive to estrogen treatment and estrogen removal (Foster, 2005). Therefore, the hippocampus is a prominent target to explorer estrogens effect on cognition. The rodent hippocampus is a curved structure lo cated in the medial te mporal lobe of the brain, within the limbic system. The hippocampus is generally broken down into a series of Cornu Ammonis (CA) areas: beginning with CA 4, next CA3, followed by CA2 and finally CA1. The hippocampus formation also includes the dentate gyrus. These well-defined structures are easily distinguishable due to th e pyramidal cells of the CA1 a nd CA3 and dentate gyrus granule cells. The major pathway of the hippocampus is the unidirectional perf orant path, where axons from the entorhinal cortex (EC) enter the hi ppocampus via dentate gyrus and CA3 regions. There is also a projection from layer 3 of the EC to the CA1. Granule cells of the dentate gyrus send 26

PAGE 27

their fibers to the CA3 and the axons of the pyram idal cells of CA3 send their axons to the CA1. Axons of the CA1 finish the loop by projecting to the s ubiculum and deep layers of the EC. The hippocampus also receives inputs from other br ain areas including but not limited to; amygdala, thalamus, and areas of the lateral hypothalamus. One of the early observations of hippocampa l role in memory and consolidation came form the data of H.M. Patient HM suffered seve re seizures and underwent surgery to remove the affected areas of his brain. The surgery left him with only 1/3 of his hippocampus and with extensive anterograde amnesia and partial retrog rade amnesia. HM has an intact short-term memory but has a general inabili ty to form long-term memories Data obtained from HM over the years has helped pinpoint the role of the hippocampus in memory consolidation, declarative memory and regions of the hippocampus possibly involved in spatial memory (Gabrieli et al., 1988). Furthermore, studies using hippocampal ablation and lesion studies in rodents have ascertained the hippocampuss role in learni ng and memory. Morris et al., (1990) and initial studies using septo-hippocampal c onnection lesions found clear defici ts in the ability to perform a spatial memory task (Olton, 1977). Morris Water Maze The gold standard for investiga tion of hippocampal function in rodents is the Morris water maze (MWM). The MWM was designed in 1984 by Ri chard G Morris to test spatial memory in rodents (Morris, 1984). The MW M uses a small pool in which a platform is hidden or unhidden. Animals are placed into the opaque colored warm pool and escape the pool by finding the platform using either the platform as a cue or finding the hidden platform using their spatial memory of the surrounding environment. In the cu e discrimination task, the platform is visible with a flag attached to the top of the platfo rm. The platform and release location is varied between the 4 quadrants (N, S, E,W). during testi ng. In our MWM protocol, we use the cue task 27

PAGE 28

to tes t the animals vision, ability to swim, and to learn the task. Fi ve days after the cue discrimination task we perform the spatial disc rimination task. During the spatial discrimination task the platform is hidden underneath the water. The platform is kept in the same quadrant (goal quadrant, can be either N, S, E, W) for the entire testing and the animal is placed in the water at any of the 4 quadrants. The animal must find the platform from spatial cue in the testing room (lamps, chairs, tables, posters). During spatial trai ning (3 trails /4 blocks /day over three days) the amount of time and distance the animals takes to reach the platform is recorded and compared across groups. To test the animals spatial memo ry, we use a probe test, where the platform is removed from the goal quadrant and the animal is released from the quadrant opposite the goal. For example if the goal quadrant is in quadrant N the animal would be released from quadrant S during the probe trial. During the probe test we record how much time the animal spend in the goal quadrant and how many tim e the animal crossed over the platform area. The probe trail is a direct measure of the animals spatial memory. The MWM is a hippocampal dependent spatial memory task and sensitive to memory deficits associated to hippocampal aging. Rapp et al (1987) found that aged hooded rats showed an acquisition deficit in locati ng a submerged platform. However, with subsequent training aged animals learned the task to the same extent as young and middle-aged (Rapp et al., 1987). Rapp and colleagues concluded that aged animals disp lay deficit in the ability to utilize spatial information, suggesting an age-related impairment in hippocampal function. Estrogen researchers have also utilized the MWM to test estrogens effect on hippcampaldependent spatial memory. Researchers have fo und that performance on the MWM fluctuates over the estrus cycle and the ag e-related impairments seen during the MWM is associated with the loss of circulating hormones during estropaus e (Frick, 2009; Healy et al., 1999). Therefore, 28

PAGE 29

the MW M is a powerful tool to study estroge ns effect on hippocampal-dependent spatial memory during aging. Estrogen Action in the Hippocampus Both ER and ER are present in the hippocampus but differ in their level of expression and distribution. Early ER localization studi es found that the majority of nuclear ER receptor expression was located in GABAerg ic interneurons throughout the hippocampus (Weiland et al., 1997). The evidence for ER in the hippocampus was hampered by the lack of a good antibody. However in 1999, Shughrue and associates showed the ER mRNA was translated into active protein in the brain (Shughrue et al., 1999). Shughrue and Merche nthaler (2000) also reported the existence of both ER and ER mRNA in the neurons of pyramidal cells of CA1-CA3 in ovariectomized rat hippocampus; however, the maximum labeling was found localized to CA2CA3 cells of the ventral hippocampus (Shughrue et al., 1999). Later, ER (protein and RNA) was found localized to only a few interneurons in the CA3 region (Shughru e and Merchenthaler, 2001). Mitra et al. (2003) we nt onto show that within the hipp ocampus there is an asymmetrical distribution of ERs, with more nuclear staining of ER in ventral hippocampus and more fiber staining in the fibers of the dorsal hippocampus and stronger ER labeling in the ventral portion of the hippocampus than in the dorsal of ovariectomized mice. Recent reports indicate that ER and ER are observed on dendritic sp ines, axon terminals and with in axons of CA1 pyramidal cells (Adams et al., 2002; Milner et al., 2005; Milner et al., 2001; Romeo et al., 2005). Furthermore, ER displays extranuclear localization in the cell cytosol within the excitatory neurons of the CA3 region of the hippocampus; whereas, ER is found primarily in the cell nuclei (Kalita et al., 2005). These regional differences in receptor density may contribute to the divergent signaling pathways and morphological responses. 29

PAGE 30

A significant increase in the num ber of ER immunoreactivity dendritic spines is observed in the hippocampus during proestrus females as co mpared to diestrus females and intact males (Romeo et al., 2005). Whereas, increased levels of ER mRNA and protein are found during estrous. These results are in parallel with earlie r studies where the maximal level of nuclear ER expression is observed during diestrus, when estrogen levels are low to moderate (Weiland et al., 1997). Even though remarkable progress has been made to determine localizati on of ERs, it is still unclear how ERs impact the function of the hippocampus. To determine some of the ways ERs impact the hippocampus, knockout (KO) animals ha ve been employed to test behavioral and physiological changes due to the loss of the receptor. While ER KO mice present severe impairment in reproductive behaviors, they al so exhibit memory impairments on hippocampal dependent inhibitory avoi dance tasks (Fugger et al ., 2000). In contrast, ER KO mice display only slight attenuation in reproductive behavi or but pronounced morphological abnormalities in their brain (Krezel et al., 2001; L ubahn et al., 1993). Furthermore, ER KO mice show deficits in hippocampus-mediated-fear-conditi oning paradigm and attenuated hippocampal CA1 long-term potentiation (Day et al., 2005). It has also been reported that ER KO display learning deficits on the MWM (Rissman et al., 2002) neuronal loss a nd shrinkage by 3 months of age, and cellular disorganization, astroglial proliferation, incr eased apoE and significant amyloid plaque deposition throughout the CNS by 12 months of ag e (Zhang et al., 2004). It is clear that ER and ER can influence separate signaling pathways and have potentially different effects on behavior, however; it is not clear the role ERs have in cogniti ve impairments associated with the aging hippocampus. 30

PAGE 31

Estrogens Effect in th e Aging Hippocampus Many of the memory deficits found in natural aging affect hippocampus-dependent memory, through structural and functional cha nges within the hippocam pus. Moreover, the hippocampus has been found to be particularly se nsitive to aging and disease (Himeda et al., 2005; West et al., 2000). For example, a signif icant decrease in spine density in the CA1, decrease in spine length in the CA1 and dentat e gyrus and subsequent deficits in hippocampusdependent spatial memory tasks were found in aged mice (von Bohlen und Halbach et al., 2006). Aging has an impact on hippocampal plasticity due to the loss of synapses in dentate and CA1, decrease of NMDA-receptor mediated responses in dentate gyrus, and an alteration of CA2+ homeostasis in CA1 (Rosenzweig and Barnes, 2003). Moreover, synapt ophysin has been found to decrease with age in the hippocampus and in patients with Alzheimers disease (Sze et al., 1997). It is believed that the decrease in synapt ophysin is correlated with impaired cognitive abilities (King and Arendash, 2002). Several studies have demonstrated estroge n-reduced responsiveness in the hippocampus. For example, compared to young animals, aged rats show a smaller increase in axospinous density in the CA1 (Adams et al., 2001b) and es trogen fails to alter the distribution of ER as seen in young animals (Adams et al., 2002). Estr ogen treatment in aged animals does increase the levels of NMDA receptor 2B, a mediator of synaptic plasticity (Adams et al., 2004). Therefore, many of the mechanisms involved in EB effects on hippocampal function are attenuated in aging but other mechanisms or ne w mechanisms continue to compensate for the loss of neuroprotection. Furthermore, researcher s are currently looking into a critical period hypothesis for estrogen treatment (Maki, 2006; Sherwin, 2007). Simply stated, estrogen treatment needs to be initiated within a critic al time period (perimenopausal or immediately 31

PAGE 32

following menopause) to be beneficial to c ognitive function. The physiological, cellular and molecular changes occurring in the hippocampus and causing the truncated effects of EB treatment during this time are still under investigation but likely involve an age-related alteration of transcriptional regulation by EB. The relative ratio of estrogen receptor is altere d with age. Mehra et al., (2005) described a significant decrease in the number of ER and ER positive neurons in both CA1 and CA3 along with a decrease in ER and ER protein level in rats (the author s did not discuss or show results for DG). In the mouse, researchers found a decrease in ER mRNA and protein in the cortex while ER levels remained constant during aging (Thakur and Sh arma, 2007). A comparison of ER expression in the hippocampus of young and ag ed mice has not been done but similar results in the cortex have been reported in rats (Wilson et al., 2002). More over, it is believed that the loss of estrogen receptors is due to the loss of protein rather than loss of neurons. Rapp and Gallagher (1996) demonstrated that there is not a decrease in ne uron numbers in the hippocampus of aged rats with spatial learning deficits. Therefore, the age related alteration of ERs in the hippocampus may leave it more susceptib le to deterioration by certain excitotoxic and oxidative insults. Together, the results suggest that EB can delay aging when initiated in middle-age. Therefore, the project presented in Chapter 2 wa s designed to test the hypothesis that EB will reverse age-related cognitive decline and gene expression in middle-age female mice. Furthermore, the critical period theory suggests that EB treatment initiate d at middle-age will be beneficial to cognitive function but treatment initiated later in life may be detrimental to cognitive function. Chapter 3 was designed to te st this theory by comparing hippocampal gene expression response to an acute EB treatment in young, middle-age, and aged female mice. 32

PAGE 33

33 While the results of Chapter 2 and 3 found that EB treatment initiated in middle-aged maintained hippocampal response to EB, aged animals display a reduced response to EB treatment. In this regard, Chapter 4 was designed to test the theory that the loss of ERs is contributing to a reduced response to EB.

PAGE 34

CHAP TER 2 ESTROGEN EFFECTS ON COGNITION A ND HIPPOCAMPAL TRANSCRIPTION IN MIDDLE-AGED MICE Introduction The hypothesis that estrogen therapies slow cognitive decline in normal aging and Alzheimers disease continues to draw debate Research in humans (MacLennan et al., 2006; Sherwin, 2006), primates (Lacreuse et al., 2002; Rapp et al., 2003), and r odents (Foster et al., 2003; Frick et al., 2002; Gibbs, 2000; Markham et al., 2002; Markowska and Savonenko, 2002) indicate that estrogen replacement may prevent or delay memory impairments, if initiated during middle-age, while reduced benefits of estrogen replacement are observed with increasing age (Foster et al., 2003). This suggests that mi ddle-age represents a time limited window for estrogens protective influence. Research indicates that estrogen can influence cell growth and synaptic connectivity of the hippocampus in a manner opposite that observe d during aging (Adams and Morrison, 2003; Foster, 2005; Gibbs and Aggarwal, 1998; McEwen et al., 1997; Sandstrom and Williams, 2001). Interestingly, estrogen improves memory functi on examined several days after treatment, suggesting the involvement of long-term and possibly genomic mechanisms (Markowska and Savonenko, 2002; Rapp et al., 2003; Sandstrom and Williams, 2001). However, the examination of genomic regulation is complicated by the f act that estrogen can influence transcription through nuclear receptors (e.g. ER and ER ) and rapid signal tran sduction cascades which influence the activity of several transcription f actors. Moreover, age dependent changes in the expression of estrogen receptors and signaling cascad e activity further co mplicate the study of estrogens genomic mechanisms (Foster, 2005). The overwhelming complexity of estrogen signaling emphasizes the limits of studies that focus on a single gene or a single age. 34

PAGE 35

Gene array technology p rovides a powerful tool for examining multifaceted transcription processes through the ability to monitor parallel e xpression of thousands of genes. However, the power of this technique is limited by the increas ed chance for Type I error associated with multiple comparisons. The current study uses micr oarray technology to test the hypothesis that estrogen interacts with age to influence tran scription in the hippocampus. We employed a system of filtering in order to limit Type I error and verified age and estrogen sensitivity for a subset of genes. Material and Methods Animals Procedures involving animal subjects have been reviewed and approved by the Institutional Animal Care and Use Committ ee and were in accordance with guidelines established by the U.S. Public Health Servi ce Policy on Humane Care and Use of Laboratory Animals. A total of sixty-seven female C57B L/6 mice (young: n = 28, 3-5 months; middle-aged: n = 39, 11-13 months) were obtained from Nationa l Institute of Aging. Animals were housed 3-5 per cage and maintained on 12:12 lig ht: dark cycle. Following at least one week of habituation, mice were anesthetized (2 mg ketamine and 0.2 mg xylazine per 20 grams of body weight) and ovaries were removed through a small midline in cision on the abdomen. All mice received ad lib access to food (Purina mouse chow, St Louis, MO) and water, until the surgery when they were placed on Casein based chow (Cincinnati Lab Supply, Cincinnati, OH), which is low in phytoestrogens found in soy based chow. Hormone Administration Following surgery, mice were separate d into four groups: young receiving -estradiol 3benzoate (Sinagra et al.) (n = 10), young receiving oil (n = 18), middle-aged receiving EB (n = 18), middle-aged receiving oil (n = 21). EB (Sigma) was dissolved in light mineral oil (Fisher 35

PAGE 36

Scientific, Pittsbu rgh, PA) to concentration of 0.5 mg/ml. Oil and EB (5g) were injected subcutaneously at the nape of the neck in volumes of 0.05 ml. Inject ions were given on two continuous days of a five day cycle. The schedule for a series of eight cycles of injections and behavioral training is i llustrated in Figure 2-1. Briefly, injections were initiated one week after surgeries and continued for a tota l of eight cycles during which an imals were behaviorally tested on the water maze, starting 48 hr af ter completion of cycle five in jections. A subset of animals employed for confirmation of cDNA microarray data received eight cycles of treatment in the absence of behavioral training. At 24 hr following the final injec tion of oil or EB, all animals were anesthetized with CO2 and decapitated. The brain was quickly removed and placed in ice cold artificial cerebral spinal fluid. Both hippocampi were removed, frozen in liquid nitrogen, and stored at -80C. In some cases, uteri were also excised, excess tissue was removed and wet weight of uteri was immediately measured. Water Maze A circular black plastic pool (120 cm diamet er) was filled with water (29 C, colored white with nontoxic white paint) to a level of 8 cm below the rim of the tank. The water maze task was located in a well-lit testing room. Du ring testing on the cued discrimination task the pool was surrounded by a black curtain. The curtain was pulled back during spatial discrimination training in order to expose spatial cues in the room. A camera mounted above the center of the pool tracked the animals movement. Cue Discrimination Training Behavioral training be gan when animals were approximate ly 5 months and 12 months of age and was preformed during the light phase of the cycle. The cued discrimination training began during week four of hormone replacement, 48 hr after the fi fth set of injections. A white flag was attached to a circular escape platform (10 cm diameter). Initially, mice were given a 36

PAGE 37

habituation swim in which they were placed in the pool and after 30 sec they were guided to the platform and permitted to climb up on the platform where they remained for 15 sec. Following habituation, mice received cued disc rimination training consisting of f our blocks with three trials per block. Each animal was released from one of four equally spaced starting locations (N, S, E, and W). The location of the escape platform and the release point were randomly assigned for each trial. The position of the escape platfo rm and release point for each trial was kept consistent between animals. The mouse was allo wed to swim until it located the escape platform. If the mouse failed to escape to the platform in 60 sec, it was then guided to the platform. After every trial, the animal remained on the platform for 15 sec. Between blocks, the animals were towel dried, placed back in the home cage, and warm air was blown over the cages. The interblock interval was 15-20 min. Spatial Discrimination Training For spatial discrimination, the platform was lo calized just below the surface of the water and maintained in one quadrant (the goal quadr ant) for the duration of testing. Training was conducted over three consecutive days and began in week five of the injection schedule, 48 hr after the sixth set of injections. Mice received four bl ocks of training per day, each block consisting of three trials. The release point for each trial was randomly assigned. The animal had 60 sec to escape during the trial. If the mouse did not escape within the allotted time they were guided to the platform and allowed to rest fo r 15 sec. A probe trial was performed during the penultimate trial for each day to determine the extent of learning. In addition, a probe trial to examine retention was conducted for the first tria l on days two and three of spatial training. For probe trials, the platform was removed and the animal was released from the quadrant opposite the goal quadrant and allowed to swim freely for 60 sec. Following completion of each probe 37

PAGE 38

trial, the platfor m was returned to the pool and the animal placed on the platform for 15 sec to rest. Behavioral data for cue and spatial discrimination tasks were recorded and analyzed by Water Maze 4.31 (Columbus Instruments, Colum bus, OH). Measures included latency and path length to escape from the pool and time spent n ear the pool wall (thigmot axis) during each trial. For probe trials, the time spent searching the goa l quadrant and number of goal platform location crossings was determined. cDNA Microarray Microarray analyses were performed on hi ppocampal tissues from each of the same behaviorally characterized animals (one chip per animal). Hippocampal RNA was isolated using Qiagen RNeasy Lipid Tissue Mini Kit (Qia gen, Germantown, MD) and RNA quality was analyzed on a subset of representative samples using Agilent Bioanalyzer (Santa Clara, CA). m17K mouse cDNA arrays were obtained from th e JHU/NIA Microarray Facility (Bethesda, MD). Microarray procedure protocols used in the study are described in the National Institute on Aging Gene Expression a nd Genomic Unit website (http://www.daf.jhmi.edu/microa rray/protocols.htm). Briefly, 5 g total RNA from a single animal was reverse transcribed in the presence of 33P-dCTP, labeled cDNA was purified using QIAquick Nucleotide Removal Kit (Qiagen), d iluted in hybridization buffer and hybridized to the m17k array for 16 h at 55 C with rotation. H ybridized arrays were washed with 2 X SSC and 0.1% SDS one to two times for 15 min each at 65C followed by one to two washes of 1 X SSC and 0.1% SDS at 65C for 15 min each. The ar rays were exposed to phosphoimager screens for 48 hr and scanned in a Molecular Dynamics Storm Phosphor Imager (Molecular Dynamics, Sunnyvale, CA) at 50 m resoluti on. Array-Pro Analyzer (Media Cybernetics, Silver Spring, MD) was used to extract the log of the net signa l (raw data minus background) from the scanned 38

PAGE 39

im ages. The data were exported into Microsoft Ex cel spreadsheets and converted to standard scores (z-score = (probe signal mean signal for all probes acro ss the array)/sta ndard deviation of all probes across the array). Oligonucleotide Array Custom designed oligo GEArray Micr oarrays were obtained form SuperArray Bioscience Corporation (Frederic k, MD). The custom arrays were designed to contain two or three probes for each gene of interest. Custom array procedures were followed according to SuperArray protocol (User Manual part #1018A version 3.0, 2005). Brie fly total of 3 g of total RNA from a single animals was used to make cRNA. cRNA purificati on was performed using ArrayGrade cRNA Cleanup Kit (SuperArray). UV sp ectrophotometry was used to quantify and assess the quality of cRNA. A total of 2 g of biotin-labeled cRNA was hybridized rotating in 0.75 ml of pre-warmed GEAhyb Hybridization Solu tion (SuperArray) over night at 60C. After overnight hybridization, membranes were washed with 5 ml of 2X SSC and 1% SDS for 15 min at 60C and with 0.1X SSC and 0.5% SDS for 15 min at 60C and incubated with streptavidinAP conjugate (SuperArray,) (1:8,000). Arra y images were developed using CDP-star chemiluminescent substrate and imaged usi ng a CCD camera (Chemic Doc XRS, Bio-Rad Laboratories, Hercules, CA). Images were analyz ed using Array-Pro and da ta were exported to Microsoft Excel spreadsheets. The background signa l was subtracted from the probe signal to provide net expression. The net expression for each probe of a specific gene was averaged across probes for that gene and the aver ages were normalized to the averaged signal derived from an internal cyclophilin A standard on the same membrane. Thus, the expression was calculated using the following formula: mRNA expression = [( average gene signal background signal)/ (a verage cyclophilin A signal background signal)]. 39

PAGE 40

RT-PCR In som e cases, RNA from animals employed in the oligonucleotide array study was used for RT-PCR. RNA was converted to cDNA using the High Capacity cDNA Archive Kit (Applied Biosystems, Foster City, CA). Briefly 3 g of total RNA from a single animal was incubated with appropriate reagents at 25C fo r 10 min and then heated to 37C for 120 min using 7300 Fast Real Time PCR System (Applied Biosystems). For relative quantification of RNA, 2.5 l of cDNA was added to 12.5 l of TaqMan Universal PCR Master Mix (2X), 1.25 l of 20X Gene Expression Assay Mix, and 8.75 l of nuclease-free water for a total volume of 25 l. The TaqMan probes used for RT-PCR were selected from the Applied Biosystems Library and included; Hist one deacetylase 2 (Hdac2) (TCAGTTGCTGGGGCTGTGAAATTAA), assay identification number Mm00515108_m1), Longevity assurance homolog 2 (Lass2 ) (GCACCGGACGCCGAGATGCTCCAGA), assay identification number Mm00504086_m1), POU domai n, class 3, transcription factor 1 (Pou3f1) (GCAGCGGTGCCTCCGGCGCGCAGTT), assay identification number Mm00843534_s1), and the probe for Glyceraldehyde-3phosphate dehydrogenase (Gapdh) was used as an internal control (TGAACGGATTTGGCCGTAATTGGGCG ), assay identification number Mm99999915_g1). Thermal cycle conditions were set at 2 min at 50C, 10 min at 95C and cycled between 15 sec at 95C and 1 min at 60 C for 40 cycles. Relative quantification was determined with 7300 Fast Real-Time PCR Syst em and SDS Software 1.3.1 analysis software (Applied Biosystems). Each sample was examined in triplicate and the rela tive quantities (Liu et al.) were normalized by the level of Gapdh. The three RQ values were averaged for each animal and the means for animals in the treated groups were normalized by the mean for the control samples (young oil treated) in orde r to derive the fold change. 40

PAGE 41

Statistical Analysis In general, repeated m easures analyses of variance (ANOVAs) were used to establish main effects and interactions on behavioral measures. Follow-up ANOVAs either collapsing the data across days of training or examining behavi or within each day were employed to localize specific differences. For analysis of cDNA microarr ays, the data underwent a two phase filtering process. The first phase was designed to exclude probe sets in which a substantial number of chips did not exhibit reliable detectio n/hybridization and remove probes wi th uncertain function. This was done by first calculating the mean and standard deviation of the blank probe sets for each microarray. A cut off was chosen as three standa rd deviations above the mean for the blanks. Scores below this value were considered as lacking specific hybridization. The probe was considered absent for a treatment group if the majo rity, greater than 60%, of the arrays in this group exhibited hybridization below this cut-off. Finally, the probe set was removed from further consideration if the probe set wa s judged absent for at least three of the four treatment groups. The remaining probe sets were further filtered to remove expressed sequence tags and probes for hypothetical proteins and pseudo gene s that did not have an indica tion of biological or molecular function as expressed through gene ontology (GO) Finally, when a gene was represented by multiple probes, the probes for the gene were averaged for each animal and the averages were used as measures of expression. To generate a list of likely age or estrogen sensitive genes, a second filter was employed using statistical sorting. The alpha level was se t at 0.025 in accordance with previous studies (Blalock et al., 2003) and t -tests were used to detect differenc es associated with age or treatment. Once a subgroup of genes was identified as probab le age sensitive, the stringency of the alpha value was reduced (e.g. p < 0.01) to examine the eff ects of the other variable (e.g. EB treatment) 41

PAGE 42

for this subgroup of genes. Fals e discovery rate (FDR) was calcula ted as the num ber of expected false positives/number of genes observed to change. Results Uterine Weight Uterine weight was measured in a subset of animals (middleaged EB treated (n = 14) 140 + 6 mg; middle-aged oil treated (n = 14) 40 + 6 mg; young EB treated (n = 5) 106 + 7 mg; young oil treated (n = 13) 39 + 4 mg). An ANOVA indicat ed a significant effect of age [F(1,42) = 7.6, p < 0.01] and treatment [F(1,42) = 174.3, p < 0.0001]. Cue Discrimination Forty-seven mice received the treatment sche dule outlined in Figure 1 (young EB = 10, young oil = 12, middle-aged EB = 11, middle-aged oil = 14) and were tested for cue and spatial discrimination. Figure 2-2 illustrates the perf ormance on the cue task. Two-way repeated measures ANOVAs across the training blocks indicated a significant effect of training on escape latency [F (3,129) = 32.6, p < 0.0001] in the absence of age or treatment effects. A significant effect of training [F (3,129) = 20.5, p < 0.0001] on escape path length was observed in the absence of age or treatment effects. No age, treatment, or training effects were observed for swim speed (dat a not shown). Spatial Discrimination The behavioral measures indicated improved performance across days of training for all groups. In addition, age x treatm ent interactions were observed due to poorer performance by middle-aged oil treated mice. An ANOVA on escape latency (Figure 2-3A) indicated a significant effect of training [F(2, 86) = 41.2, p < 0.0001] (Figure 2-3A) a nd an interaction of day x age x treatment [F(2, 86) = 4.5, p < 0.05] Examination within each day indicated a 42

PAGE 43

tendency for an age x treatm ent interaction on Da y 3 (p = 0.06), due to longer escape latencies for middle-aged oil treated mice. Additional evidence for an age x treatment interaction was pr ovided by analysis of escape path length (Figure 2-3B). An ANOVA revealed significant effects of tr aining across days [F(2, 86) = 35.0, p < 0.0001] and a day x age x treatme nt interaction [F(2, 86) = 6.7, p < 0.005]. Examination within each day indicated an age x treatment interaction on Day 3 [F(1, 43) = 5.0, p < 0.05], again with the poorest poor performance observed in the middle-aged oil treated group. Finally examination of the per cent of the escape latency time the animals spent along the wall (i.e. thigmotaxis) decreased over days of trai ning F(2, 86) = 27.0, p < 0.0001] in the absence of age or treatment effects (Figure 2-3C). Acquisition Probe Trials Probe trial measures confirmed that middleaged oil treated mice were impaired in acquiring the spatial discrimination. A repeated measures ANOVA for percent time in the goal quadrant for the three acquisition probe trials de monstrated a significant effect of training [F(2,86) = 25.1, p < 0.0001] and an interaction of day x age x treatment [F(2,86) = 3.3, p < 0.05]. ANOVAs within each day revealed an age x tr eatment interaction on Day 2 [F(1,43) = 7.2, p < 0.01] and ANOVAs within each age and treatment condition indicated an age difference for oil treated mice [F(1,24) = 9.5, p < 0.01] with poorer performance for middle-aged mice (Figure 24A). A repeated measures ANOVA for platform cro ssings indicated a main effect of training [F(2,86) = 22.6, p < 0.0001] and age [F(1,86) = 4.6, p < 0.05] and a training x age x treatment interaction [F(2,86) = 3.3, p < 0.05]. ANOVAs within each day revealed an age x treatment interaction on Day 1 [F(1,43) = 4.2, p < 0.05] and Day 2 [F(1,43) = 6.0, p < 0.05] and ANOVAs within each age and treatment condition indicated an age difference for EB treated mice on Day 43

PAGE 44

1 [F(1,19) = 8.5, p < 0.01] and confirm ed poorer perf ormance of middle-aged oil treated animals on Day 2 [F(1,24) = 9.5, p < 0.005] (Fig 4B). Retention Probe Trials An ANOVA examining the percent time in th e goal quadrant during the retention probe trials delivered as the first trial on Days 2 and 3 indicated a significant effect of training [F(1,43) = 5.3, p < 0.05] and a significant age x treatment interaction [F(1,43) = 5.1, p < 0.05]. Analyses within each day revealed diffe rences on Day 2 due to poorer performance by middle-aged oil treated mice such that treatment effects were observed for middle-aged animals [F(1,23) = 5.1, p < 0.05] and age difference were observed for o il treated mice [F(1,24) = 8.9, p < 0.01] (Figure 24C). Examination of platform cro ssings during the rete ntion probe trials confirmed age x treatment effects (Figure 2-4D). An ANOVA indicat ed a main effect of training [F(1,42) = 6.7, p < 0.05] and a tendency for an age x treatment interaction (p = 0.07). ANOVAs for each day localized an age x treatment interaction to the Day 2 probe trial [F(1,42) = 8.8, p < 0.005]. Analysis of treatment effects during the Day 2 retention probe trial indicated more crossings in middle-aged EB treated mice relative to aged matched oil treated mice [F(1,22) = 4.7, p < 0.05]. Examination of age differences indicated an ag e effect for oil treated mice [F(1,24) = 9.9, p < 0.005]. Microarray Results Microarray analyses were performed on hippoc ampal RNA from each of the behaviorally characterized animals (one chip per animal). cDNA microarray data were not obtained for 10 animals due to poor hybridization or poor quality of RNA. The remaining 37 microarrays (young EB = 10, young oil = 8, middle-aged EB = 9, middleaged oil = 10) were submitted to the first phase filtering process to eliminate probes w ith low hybridization and uncertain biological 44

PAGE 45

function. This initial filtering pr ocess resulted in 4217 probes that were eligible for the second phase of filtering to identify lik ely genes that are sensitive to age and treatment effects. Our previous work and that of others suggests that a substantial number of genes are altered between young and middle-aged animals. In order to examin e the relative influence of age and treatment, t -tests with alpha set at 0.025 were used to estimate the number of genes influenced by age regardless of treatment. An age difference was obse rved for 567 probes. In contrast, with alpha set at 0.025, only 187 probes exhibited a treatment e ffect regardless of age. An examination of treatment effects within each age group suggested that treatment effects were more common in middle-aged animals. Only 58 probes exhibited differences between oil and EB treatment in young animals, while 244 probes were influenced by EB treatment in middle-aged animals. Our interest is for genes which exhibit EB effects in a manner opposite that observed during aging. If EB has effects oppos ite that of age, it is likely that the probes of interest are missed by collapsing across treatments or ages. Accord ingly, in order to id entify candidate aging genes for further analysis, we used statistical sorting according to expression differences between middle-aged oil treated and young oil treated mice, before examining EB effects only in middleaged mice. Using t -tests with alpha set at 0.025, the num ber of probes expected to reach significance by chance alone is 105. A comparison indicated that 570 probes (FDR = 0.18) were differentially expressed in oil treated middle-aged mice relative to oil treated young mice. These 570 probes were classified as potenti al age-related genes, and this set of genes was used to test for EB effects. Because we were only interested in effects oppos ite that of aging, we employed one tailed t -tests (alpha set at 0.025) with the direc tion specified as opposite that observed for aging and compared middle-aged oil treated and middle-aged EB treated mice. For the 570 potential age-related genes, 132 probes (FDR = 0.1) were observed to exhibit transcription 45

PAGE 46

changes in a m anner opposite that observed for aging. Gene expression profiles of the 132 ageEB sensitive genes were examined using the Unigene EST Profile Viewer from the National Center for Biotechnology Information and a cut off for expression for the gene of interest was set at > 10-4 out of every one million transcripts normally f ound in neural tissue, brain or dorsal root ganglion. This procedure resulted in 119 age-EB sensitive genes that are moderately to highly expressed in the brain (Table 2-1&2-2). Using gene ontology, Swiss-Prot protein knowledgebase, and literature searches, the ageEB sensitive genes were characterized according to likely biological processes. In most cases, gene s could be categorized as involved in more than one biological function; however, the majority could be classified as involved in transcription, apoptosis/cell health, receptor /cell signaling pathways, cell gr owth/structural organization, cholesterol/lipid metabolism, and protein metabolism. In order to provide some validation of the findings, custom oligonucleotide arrays containing probes for 10 representative age-EB sensitive genes and a cyclophillin A (Ppia) control were constructed. The ge nes were selected in order to have a balance of those that exhibited an increase (5 genes) and decrease (5 genes) with age. In addition, genes were selected to represent the various biol ogical processes including transc ription (Ldb2, Hdac2, Pou3f1), apoptosis/cell health (Foxo3a), receptor/cell sign aling (Kctd3, Cbln1), cell growth/structural organization (Ppfia1), choleste rol/lipid metabolism (Lass2), and protein metabolism (Fbxw8, Ube2r2). RNA was obtained from an independent set of young oil (n = 6) middle-aged oil (n = 7), and middle-aged EB treated (n = 7) mice which received the same ovariectomy-injection schedule (see Fig 1) in the absence of behavi oral training and cRNA wa s hybridized to the oligonucleotide arrays. 46

PAGE 47

For two probes (Ppfia1, Ube2r2 ) hybridization of at least 8 of the 20 chips exhibited an absence of signal and data were considered unreliable for parametric statistical analysis. The signal for the remaining genes was normalized by the level of Ppia on the array. These normalized scores were then divided by the mean for young animals in order to determine directional changes and fold changes. Predicted di rection of change due to age or EB treatment was based on results of the cDNA arrays. For the remaining 8 genes, the predicted direction of change associated with age, increasing or decreas ing in middle-aged oil treated mice relative to young oil treated mice, was confirmed for all genes except Pou3f1, in which the mean response for middle-aged oil treated mice was elevated relative to young oil trea ted mice (Figure 2-5). Furthermore, the predicted direction of change for EB treatment in middle-aged EB treated mice relative to middle-aged oil treated animals was observed in 8 of the 8 genes. Thus, for the set of eight genes, the relative direc tion of change due to age and EB treatment could be predicted correctly ~94 % of the time. Genes were separated according to the expected directional influence of age and EB and repeated measures ANOVAs were employed to ex amine group effects. A repeated measures ANOVA across the 5 genes expected to increase with age and decrease with EB treatment (Ldb2, Foxo3a, Hdac2, Lass2, Kctd3) indicated a difference across groups [F(2,68) = 4.10, p < 0.05]. Subsequent ANOVAs comparing young oil treat ed relative to middl e-aged oil treated indicated a significant [F(1,44) = 6.91, p < 0.05] in crease in expression with age. Although, the mean for each gene was reduced in the middle-ag ed EB treated group relative to middle-aged oil treated animals, an ANOVA examining EB treatment effects in middle-aged animals indicated no difference. For three genes (Fbxw8, Pou3f1, Cbln1) expected to decrease with age and increase with EB treatment, a repeated measur es ANOVA indicated a difference across the genes 47

PAGE 48

[F(2,34) = 5.24, p < 0.05] and subsequent ANOVAs indi cated a treatm ent effect in aged animals due to an increased expression associated with EB treatment [F(1,24) = 10.67, p < 0.01]. An examination of the oligonucleotide arrays revealed several genes that were expected to exhibit at least a 2 fold in crease in middle-aged oil or EB treated animals compared to young oil treated mice (e.g. Hdac2, Lass2). Thus, RNA is olated for the oligonucleotide array study was also employed for RT-PCR studies (3-4 animals pe r group) to further validate the gene profiling results (Table 2-3). The results confirmed th at histone deacetylase 2 and LAG1 longevity assurance homolog 2 increased by at least 2 fold in middle-aged oil animals. Furthermore, RTPCR of octamer-binding transcription factor 6 (Pou3f1) confirmed an increased expression in middle-aged animals treated with EB relative to young oil treated mice. Discussion While middle-aged oil treated mice exhibited learning over the course of training, age and treatment interactions were observed for spatial discrimination escape latency and path length, as well as probe trial measures due in part to poo rer performance by middle-aged oil treated mice. In contrast, the performance of middle-aged EB treated animals was similar to young mice and treatment effects were not observed for younger an imals. The poor performance of middle-aged oil treated mice was not due to sensory-motor defi cits since there was no difference in latency or swim speed on the cue discrimination task. Furt hermore, no age or treatment effects were observed for thigmotaxis, measured as the percent time swimming along the pool wall, suggesting that the disparity in performan ce was not due to differences in anxiety. The results are consistent with previous studies in humans (Foster, 2006) and rodents (Verbitsky et al., 2004; Ziegler a nd Gallagher, 2005), which indicate mild cognitive impairments emerge in mid-life and cognitive weakening conti nues with advancing age. Further, age-related impairments may be enhanced by hormone de privation, and estrogen treatment in humans 48

PAGE 49

(MacLennan et al., 2006; Sherwin, 2005) and anim al s (Daniel et al., 2006; Foster et al., 2003; Frick et al., 2002; Markham et al., 2002; Markowska and Savonenko, 2002) may delay the decline of certain cognitive pro cesses. Interestingly, beneficial effects of estrogen treatment may not be evident if the treatment is initiated afte r long-term hormone depriv ation or the behavioral demands of the task do not reveal an age difference (Daniel et al., 2006; Markowska and Savonenko, 2002; Ziegler and Gallagher, 2005). The interaction of aging and hormonal status on cognition suggests that middle-age may provide an important window for examining hormonal influences on markers of brain aging. Gene Profiles Associated with Aging and Estradiol Treatment For cDNA arrays examined across treatment groups, 567 probes exhibited age differences; confirming that a considerable number of gene s alter their expression during middle-age. In contrast, only 187 genes exhibited altered expression in response to EB treatment, independent of age, suggesting that a rela tively low number of hippocampal genes are sensitive to our EB treatment. However, the effects of age are relatively chronic, and the number of EB responsive genes, and magnitude of EB eff ects, is likely to be a function of the time between treatment and sample collection. Furthermore, when EB effect s were examined within each age group, the number of probes increased four fold between middle-aged animals relative to young animals (244 versus 58 probes) indicating that older animals are more sensitive to hormonal status. Treatment Effects on Transcript ion in the Aging Hippocampus While the set of EB responsive genes in aged animals is likely to be important for determining treatment effects on hippocampal function, the curre nt study focused on a subset that were age and EB responsive. Age-EB respon sive genes were distinct from those normally seen with learning, which often involve synapse specific molecules (Cavallaro et al., 2002; D'Agata and Cavallaro, 2003; Irwin, 2001; Leil et al., 2003; Luo et al., 2001). The difference 49

PAGE 50

m ight be due to the fact that hippocampi were harvested several days after training when training effects may have dissipated. Thus, the set of age-EB genes may contribute to overall hippocampal function rather than being induced by behavioral traini ng. Estrogen has enduring effects on synaptic plasticity, memory, the grow th, and vitality of neurons, processes which depend on transcriptional regulation. Microarray results indicate hormonal status of middle-aged animals regulates transcriptional mechanisms ; including an EB associated reduction in transcription repressors (Hdac2, Zik1, Sap18) and an increase in products which enable transcription/translation (Gtf 3c2, Bop1, Sfrs7, Tcf12) includi ng Mms19l, a possible estrogen receptor coactivator of transcription (Wu et al ., 2001). The findings suggest EB influenced the production of components of th e transcription apparatus. Estrogen modulates structural plasticity of dendr itic spines (Gould et al., 1990; Li et al., 2004), which maybe age specific (Miranda et al., 1999). EB treatment was associated with genes for biosynthesis (Gmppa, Axot, Rpl23), protein folding (Tcp1, Cct6 a, Erp29), and vesicle/protein transport (Copg, Vps28, Vps33a, Rab11fip2, Kifc2). An increase was observed for genes associated with growth (Nrp1, Emp1, Sema3e) (Pozas et al., 2001; Wulf and Suter, 1999), structural organization (Bsg, Lr tm1, Mical2, Flnb) (Fan et al ., 1998; Lauren et al., 2003; Naruhashi et al., 1997; Sheen et al., 2002; Terman et al., 2002; Zhang et al., 1998), regulation of neural connections and glutamate receptor trafficking (Pcdhgc3, Lmtk2, Ppfia1) (Dunah et al., 2005; Kawa et al., 2004; Ko et al., 2003; Serra-P ages et al., 1998; Wu and Maniatis, 1999). Finally, neurogenesis is altered by aging and estrogen (Galea et al., 2006; Kempermann et al., 2004; Saravia et al., 2007) and we observed a shift in expression of genes supporting neurogenesis, dendritic formation, and synaptogenesis (Pou3f1, Vldlr, Adam19, Tcf12, Emp1) (Frantz et al., 1994; Kurisaki et al., 2002; Niu et al., 2004; Si nagra et al., 2005; Uittenbogaard 50

PAGE 51

and Chiaram ello, 2002; Wulf and Suter, 1999). Togeth er, these results suggest estrogens actions on hippocampal function in middle-ag e include trophic influences. Brain aging involves enhanced inflammation and stress responses (Prolla, 2002; Verbitsky et al., 2004) and EB treatment is neuroprot ective (Singh et al., 2006). Middle-aged mice exhibited reduced expression of genes for preven ting oxidative (Akr1c13) and ischemic damage (Egln2), as well as genes preventing damage from inflammation (C1qbp). EB increased transcription of these protective proteins, and reversed an elevation in the expression of genes associated with stress (Foxo3a, Rps9, Myd116) and in flammation (Socs7). EB also increased the expression of mRNA coding for enzymes involved in DNA repair (Mms19l, Giyd2, Polb), ubiquitin ligase activity, and protein degradation (Derl3, Fbxw 8, Psmd3, Psmb5, Ube2r2). This effect is consistent with studies indicating that improved performance in aged animals is associated with transcriptional up-regulation of ge nes associated with the proteasome (Blalock et al., 2003; Burger et al., 2007). Furthermore, an increased expression of Fbxw8 has been associated with memory consolidation in young animals (Cavallaro et al., 2001). Thus, an EB dependent increase in neuroprotective genes ma y contribute to maintenance of hippocampal function with age. Some aging-EB responsive genes have been linked to premature aging (Tbl2, Il13ra1), transcriptional changes in the hippocampus of senescence-accelerated mice (Dusp12) (Cheng et al., 2007; Kyng et al., 2003; Meng et al., 1998), and aging in differe nt organisms (Lass2) (Obeid and Hannun, 2003), or organs (Peli1) (Chelvarajan et al., 2006; Cheng et al., 2004). Some genes may be associated with biological markers of aging including altered lipid/cholesterol metabolism (Abca2, Vldlr, Acsl5, Srebf1, Apoa 1) (Foster, 2006), lip id composition (Ptdss2) (Giusto et al., 2002), mitochondrial function (Atp5g1, Aco2) (Poon et al., 2006), and structural 51

PAGE 52

changes (Ctsb) (Bednarski et al., 1997). Indee d, specific genes m ay be markers for an aging hippocampus. Similar changes were found in CA1 of aged rats, including decreased Ilkap (i.e. protein phosphatase 2C), Polb, Bsg, and Cct6a and an increase in Nrp1(Blalock et al., 2003). Importantly, this transcriptional profile was reve rsed by EB treatment in middle-aged females. Many of the aging-EB responsive genes can be classified under one of the following cell signaling processes: cytokine signal transduction (Socs7, Il 13ra1, Peli1, Irak4), G-protein coupled receptor signaling (Adcyap1r1, Gpr125, Cbln1, Tmem11, Trh), and phosphatase/kinase activity (Ilkap, Lmtk2, Adck1, Hs1bp3, Dusp12, Irak4, Nagk, Pace4, Ppfia1, Ppp1r2). Agerelated changes in these signaling cascades may contribute to altered s ynaptic plasticity and memory impairments (Foster, 1999; Lynch, 1998). Thus, estrogen influences on these signaling pathways may preserve physiological processe s involved in memory (Foster, 2005). EB treatment of ovariectomized middle-age mice reversed transcriptional markers of brain aging, which have been previously described. It may be import ant that altered transcription emerges by middle-age, prior to cognitive decline, possibly in response to oxidative stress, or altered neural activity (Blalock et al., 2003; Lu et al., 2004). Unchecke d, these processes may initiate cascades for altered cell si gnaling and transcriptional regula tion, resulting in a decrease in neuronal growth and enhanced inflammation. T hus, middle age may be a critical period for treatments that can delay agi ng processes that begin in middle-age and cumulate over time to weaken cognition. In this regar d, it may be important the EB tr eatment of middle-aged animals counteracts changes in transcrip tion for proteins associated with cell signaling cascades, and reverses a decline in markers for neuroprot ection, biosynthesis, and neurite growth. 52

PAGE 53

Table 2-1 Microarray results for genes increasi ng with age and decreasi ng with EB treatment Gene Name Gene Symbol Mean ZScore MAEB Mean ZScore MAOil Mean ZScore Y-EB Mean ZScore Y-Oil Age Effect P value EB Effect P value General transcription factor IIH, polypeptide 3 Gtf2h3 -0.49 0.15 -0.46 -0.81 Up 0.00001 Down 0.02 ATP-binding cassette, sub-family A, member 2 Abca2 -0.73 -0.09 -0.88 -0.92 Up 0.0001 Down 0.0025 MethylcrotonoylCoenzyme A carboxylase 2 Mccc2 -0.54 -0.01 -0.6 -0.8 Up 0. 0001 Down 0.01 Zinc finger protein interacting with K protein 1 Zik1 -0.39 0.4 -0.39 -0.57 Up 0.0002 Down 0.0025 Transducin (beta)-like 2 Tbl2 0.39 0.7 -0.08 -0.03 Up 0.0002 Down 0.01 Translocase of inner mitochondrial membrane 50 homolog Timm50 -0.96 0.07 -0.25 -1.12 Up 0.0002 Down 0.0025 Sin3-associated polypeptide 18 Sap18 -0.66 0.01 -0.76 -0.84 Up 0.0002 Down 0.01 Histone deacetylase 2 Hdac2 -0.56 -0.02 -0.61 -0.66 Up 0.0004 Down 0.001 Cleavage stimulation factor, 3' pre-RNA, subunit 1 Cstf1 0.52 0.73 0.04 0.09 Up 0.0005 Down 0.02 Protein tyrosine phosphatase, receptor type, f polypeptide, interacting protein, alpha 1 Ppfia1 -0.53 -0.03 -0.72 -0.76 Up 0.0008 Down 0.02 Calcitonin gene-related peptide-receptor component protein Crcp -0.36 0.4 -0.29 -0.4 Up 0.0009 Down 0.01 Potassium channel tetramerisation domain containing 3 Kctd3 -0.03 0.35 -0.21 -0.16 Up 0.0009 Down 0.02 N-deacetylase/Nsulfotransferase (heparan glucosaminyl) 1 Ndst1 -0.93 0.09 -0.72 -0.77 Up 0.0009 Down 0.001 Adenylate cyclase activating polypeptide 1 receptor 1 Adcyap1r1 -0.66 -0.13 -0.56 -0.64 Up 0.001 Down 0.015 Myeloid differentiation primary response gene 116 Myd116 -0.9 -0.2 -0.84 -0.99 Up 0.001 Down 0.015 Forkhead box O3a Foxo3a -0.87 -0.31 -0.72 -0.9 Up 0.002 Down 0.02 LIM domain binding 2 Ldb2 -0.51 0.31 -0.45 -0.41 Up 0.002 Down 0.01 Fatso Fto -0.47 -0.09 -0.61 -0.29 Up 0.003 Down 0.0035 53

PAGE 54

54 Table 2-1 Continued Gene Name Gene Symbol Mean ZScore MAEB Mean ZScore MAOil Mean ZScore Y-EB Mean ZScore Y-Oil Age Effect P value EB Effect P value Ribosomal protein S9 Rps9 -0.03 0.38 0.02 -0.11 Up 0.006 Down 0.02 G protein-coupled receptor 125 Gpr125 1.18 1.52 1.06 1.2 Up 0.01 Down 0.0035 TBC1 domain family, member 1 Tbc1d15 -0.11 0.29 -0.29 -0.06 Up 0.01 Down 0.005 RCC1 and BTB domain-containing protein 2 Rcbtb2 0.34 0.6 0.2 0.25 Up 0.01 Down 0.0025 Longevity assurance homolog 2 Lass2 -0.29 0.09 -0.09 -0.38 Up 0.02 Down 0.015 Suppressor of cytokine signaling 7 Socs7 0.83 1.17 0.73 0.66 Up 0.02 Down 0.02 Protocadherin gamma subfamily C, 3 Pcdhgc3 0.71 0.96 0.63 0.64 Up 0.02 Down 0.0025 Phosphatidylserine synthase 2 Ptdss2 2.08 2.67 2.08 2.19 Up 0.02 Down 0.00004 Ubiquitin specific peptidase 53 Usp53 -0.22 0.16 -0.28 -0.2 Up 0.02 Down 0.02 General transcription factor IIIC, polypeptide 4, Gtf3c4 -0.29 0.27 -0.35 -0.21 Up 0.02 Down 0.02 Purkinje cell protein 4like 1 Pcp4l1 -0.07 0.26 -0.13 -0.09 Up 0.02 Down 0.02 FGF receptor activating protein 1 Frag1 -0.27 -0.04 -0.26 -0.41 Up 0.02 Down 0.005 Zinc finger protein 426 Zfp426 0.02 0.31 -0.2 -0.26 Up 0.02 Down 0.005 Ankyrin repeat domain 25 Ankrd25 -0.33 0.2 -0.1 -0.33 Up 0.02 Down 0.015 Protein phosphatase 1, regulatory subunit 2 Ppp1r2 -1.07 -0.39 -0.77 -0.97 Up 0.02 Down 0.01

PAGE 55

Table 2-2 Microarray results for genes decreasing with age and increasing with EB treatment Gene Name Gene Symbol Mean ZScore MAEB Mean ZScore MAOil Mean ZScore Y-EB Mean ZScore Y-Oil Age Effect P value EB Effect P value Interleukin-1 receptorassociated kinase 4 Irak4 1.36 0.51 1.35 1.22 Down 0.00008 Up 0.00035 EGL nine homolog 2 Egln2 1.5 0.78 1.63 1.49 Down 0.0002 Up 0.01 Natural killer tumor recognition sequence Nktr 0.45 -0.08 0.11 0.43 Down 0.0002 Up 0.0004 Ubiquitin-conjugating enzyme E2R 2 Ube2r2 1.03 -0.17 0.76 1.16 Down 0.0002 Up 0.0015 Aldo-keto reductase family 1, member C13 Akr1c1 3 1.51 1.08 1.83 1.75 Down 0.0002 Up 0.02 Apolipoprotein A-I Apoa1 1.66 1.03 1.76 1.78 Down 0.0003 Up 0.015 Cerebellin 1 precursor protein Cbln1 1.46 0.74 1.56 1.47 Down 0.0008 Up 0.01 Histocompatibility 2, K region H2-K1 2.25 1.88 2.32 2.3 Down 0.001 Up 0.02 Proteasome subunit, beta type 5 Psmb5 1.54 0.94 1.36 1.51 Down 0.001 Up 0.015 CNDP dipeptidase 2 Cndp2 1.86 1.31 2.09 1.9 Down 0.001 Up 0.02 Block of proliferation 1 Bop1 1.19 0.61 1.29 1.15 Down 0.001 Up 0.02 POU domain, class 3, transcription factor 1 Pou3f1 0.99 0.41 1.12 1.16 Down 0.001 Up 0.015 Glycerol-3-phosphate dehydrogenase 1-like Gpd1l 0.65 0.16 0.75 0.76 Down 0.001 Up 0.01 RAN GTPase activating protein 1 Rangap 1 1.52 0.58 1.59 1.37 Down 0.002 Up 0.002 Integrin-linked kinaseassociated serine/threonine phosphatase 2C Ilkap 1.98 1.35 2.06 2.14 Down 0.002 Up 0.025 Interleukin 13 receptor, alpha 1 Il13ra1 1.07 0.48 0.98 1.02 Down 0.002 Up 0.01 Thyrotropin releasing hormone Trh 1.77 1.09 1.96 1.88 Down 0.002 Up 0.015 Nudix type motif 14 Nudt14 2.18 1.31 1.86 1.98 Down 0.002 Up 0.003 T-complex protein 1 Tcp1 1.42 0.71 1.58 1.47 Down 0.002 Up 0.01 55

PAGE 56

Table 2-2 Continued Gene Name Gene Symbol Mean ZScore MAEB Mean ZScore MAOil Mean ZScore Y-EB Mean ZScore Y-Oil Age Effect P value EB Effect P value Polymerase beta Polb 1.14 0.43 1.18 1.14 Down 0.003 Up 0.015 Leucine-rich repeats and transmembrane domains 1 Lrtm1 1.37 0.69 1.55 1.3 Down 0.003 Up 0.015 Semaphorin 3E Sema3e 1.18 0.74 1.45 1.41 Down 0.003 Up 0.025 ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c, isoform 1 Atp5g1 0.97 0.24 0.75 0.91 Down 0.003 Up 0.0003 Aconitase 2, mitochondrial Aco2 1.22 -0.03 1.07 1.03 Down 0.003 Up 0.0035 Surfeit gene 5 Surf5 0.25 -0.18 0.33 0.3 Down 0.004 Up 0.01 Basal cell adhesion molecule Bcam 1.64 0.65 1.31 1.57 Down 0.004 Up 0.01 Dual specificity phosphatase 12 Dusp12 1.6 0.88 1.67 1.62 Down 0.004 Up 0.02 Microtubule associated monoxygenase, calponin and LIM domain containing 2 Mical2 1.45 0.83 1.6 1.51 Down 0.004 Up 0.02 Ribosomal protein L23 Rpl23 1.01 0.79 1.08 1.03 Down 0.004 Up 0.005 Proprotein convertase subtilisin/kexin type 6 Pace4 0.87 0.36 0. 78 0.84 Down 0. 004 Up 0.015 Lupus brain antigen 1 Lba1 1.45 0.73 1.48 1.26 Down 0.004 Up 0.0035 Vacuolar protein sorting 28 Vps28 0.91 0.37 0.88 0.89 Down 0.004 Up 0.02 RAB11 family interacting protein 2 Rab11fi p2 1.65 0.99 1.38 1.58 Down 0.004 Up 0.015 Neuropilin Nrp1 0.27 -0.02 0.33 0.46 Down 0.005 Up 0.015 Ubiquitously transcribed tetratricopeptide repeat gene, X chromosome Utx 1.33 0.96 1.48 1.46 Down 0.005 Up 0.025 Solute carrier family 21, member 2 Slco2a1 0.68 -0.34 0.65 0.72 Down 0.005 Up 0.02 F-box and WD-40 domain protein 8 Fbxw8 0.9 0.26 0.95 0.92 Down 0.006 Up 0.015 56

PAGE 57

Table 2-2 Continued Gene Name Gene Symbol Mean ZScore MAEB Mean ZScore MAOil Mean ZScore Y-EB Mean ZScore Y-Oil Age Effect P value EB Effect P value Chaperonin subunit 6a; Tcomplex protein 1, zeta subunit Cct6a 1.46 0.61 1.51 1.24 Down 0.007 Up 0.005 Histidine triad nucleotide binding protein Hint1 1.31 0.73 1.34 1.2 Down 0.008 Up 0.015 Splicing factor, arginine/serine-rich 7 Sfrs7 0.66 0.22 0.58 0.7 Down 0.008 Up 0.02 MMS19-like Mms19 l 0.49 -0.07 0.35 0.4 Down 0.008 Up 0.00045 Transcription factor 12 Tcf12 0.66 0.22 0.58 0.7 Down 0.008 Up 0.015 AarF domain containing kinase 1 Adck1 -0.07 -0.53 -0.03 0.01 Down 0.01 Up 0.01 Pellino 1 Peli1 0.29 -0.17 0.29 0.32 Down 0.01 Up 0.01 GIY-YIG domain containing 2 Giyd2 1.08 0.25 0.87 0.75 Down 0.01 Up 0.0025 General transcription factor IIIC, polypeptide 2, beta Gtf3c2 1.04 0.19 0.88 0.97 Down 0.01 Up 0.025 Filamin, beta Flnb 1.1 0.47 1.13 1.05 Down 0.01 Up 0.01 Solute carrier family 35, member B4 Slc35b 4 1.28 1.01 1.28 1.35 Down 0.01 Up 0.02 Endoplasmic reticulum protein 29 Erp29 0.91 0.43 0.86 0.82 Down 0.01 Up 0.025 Cathepsin B Ctsb 0.88 0.47 0.88 0.75 Down 0.01 Up 0.01 ERBB receptor feedback inhibitor 1 Errfi1 1.44 0.83 1.43 1.33 Down 0.01 Up 0.01 Homeobox containing 1 Hmbox 1 1.02 -0.64 0.86 0.9 Down 0.01 Up 0.01 Teashirt zinc finger family member 2 Tshz2 0.74 -0.92 -0.32 -0.08 Down 0.01 Up 0.00005 Nucleoporin 205 Nup205 1.67 1.15 1.21 1.61 Down 0.01 Up 0.01 Coatomer protein complex, subunit gamma 1 Copg 0.83 0.37 0.9 0.83 Down 0.01 Up 0.025 57

PAGE 58

Table 2-2 Continued Gene Name Gene Symbol Mean ZScore MAEB Mean ZScore MAOil Mean ZScore Y-EB Mean ZScore Y-Oil Age Effect P value EB Effect P value Transmembrane protein 11 Tmem1 1 1.2 0.81 1.2 1.22 Down 0.02 Up 0.015 Limb region 1 Lmbr1 1.24 0.6 0.89 1.02 Down 0.02 Up 0.01 Very low density lipoprotein receptor Vldlr 1.06 0.23 0.9 0.67 Down 0.02 Up 0.0035 Mannoside acetylglucosaminyltransferase 1 Mgat1 1.53 0.25 1.51 1.2 Down 0.02 Up 0.005 Epithelial membrane protein 1 Emp1 0.87 0.09 0.77 0.65 Down 0.02 Up 0.0045 Transmembrane protein 34 Tmem3 4 -0.22 -0.75 -0.39 -0.17 Down 0.02 Up 0.02 A disintegrin and metalloproteinase domain 19 Adam1 9 0.74 0.08 0.39 0.53 Down 0.02 Up 0.0025 N-acetylglucosamine kinase Nagk 1.88 1.25 1.49 1.78 Down 0.02 Up 0.025 Complement component 1, q subcomponent binding protein C1qbp 0.81 0.16 0.64 0.61 Down 0.02 Up 0.01 Proteasome 26S subunit, nonATPase, 3 Psmd3 0.67 0.13 0.63 0.61 Down 0.02 Up 0.01 Axotrophin Axot 0.99 0.11 1.07 0.96 Down 0.02 Up 0.02 Tubulin tyrosine ligase-like family, member 4 Ttll4 1.08 0.02 1.01 0.8 Down 0.02 Up 0.01 Der1-like domain family, member 3 Derl3 1.84 1.2 1.64 1.73 Down 0.02 Up 0.025 LPS-responsive beige-like anchor Lrba 0.63 0.15 0.52 0.51 Down 0.02 Up 0.01 PHD finger protein 23 Phf23 -0.04 -0.62 -0.19 -0.06 Down 0.02 Up 0.005 Suppression of tumorigenicity 7-like St7l 1.74 1.2 1.68 1.6 Down 0.02 Up 0.005 Vacuolar protein sorting 33A Vps33a 0.97 -0.16 1.07 0.82 Down 0.02 Up 0.02 58

PAGE 59

59 Table 2-2 Continued Gene Name Gene Symbol Mean ZScore MAEB Mean ZScore MAOil Mean ZScore Y-EB Mean ZScore Y-Oil Age Effect P value EB Effect P value Trophoblast glycoprotein Tpbg 0.98 0.32 0.86 0.88 Down 0.006 Up 0.02 GDP-mannose pyrophosphorylase A Gmppa 2.02 1.22 1.91 1.95 Down 0.01 Up 0.01 Kinesin family member C2 Kifc2 1.74 0.99 1.67 1.51 Down 0.01 Up 0.01 ZW10 interactor Zwint 1.13 0.93 1.34 1.37 Down 0.002 Up 0.025

PAGE 60

Table 2-3 Oligonucleotide arra y and RT-PCR fold changes Array RT-PCR Array RT-PCR Fold change Fold Change Fold change Fold Change Gene Symbol Y vs MA-Oil Y vs MA-Oil Y vs MA-EB Y vs MA-EB Hdac2 3.62 + 0.77 2.57 + 1.00 2.77 + 0.66 1.83 + 0.30 Lass2 3.58 + 0.38 3.83 + 0.97 2.78 + 1.08 3.42 + 0.92 Pou3f1 1.30 + 0.13 1.28 + 0.66 2.84 + 0.29 2.25 + 0.44 (+ SEM) for genes increased during aging or increased by estrogen treatment. 60

PAGE 61

Figure 2-1.Schedule of injections and behavioral testing. The bars represent days starting with the day of ovariectomy (OVX, striped bar). Injections (light grey bars) of EB (5 /0.05ml) or vehicle began one week after ovariectomy and took place on two consecutive days of a five da y cycle. Animals received eight sets of injections over the course of the study. Arrows indicate be havioral training days Cue discrimination training began in week 5 (W5), 48hr afte r the fifth set of injections. Spatial discrimination training began in week 6 (W6), 48 hr after the sixt h set of injections and continued for three consecutive days. The seventh set of injections was initiated after completion of the third day of spatial training. Animals were sacrificed (Sac, dark grey bar) in week 7 (W7), 24hr after the eighth set of injections 61

PAGE 62

Figure 2-2. Cue Discrimination Tr aining. Mean escape latency (A) and escape path length (B) for middle-aged (MA, filled symbols) and young (open symbols) mice receiving either EB (squares) or oil (circles) ac ross the four trial blocks (1-4) of cue discrimination training. 62

PAGE 63

Figure 2-3. Spatial Discrimination Training. Mean escape latency A) escape path length B) and percent time on the edge of the pool (C) acro ss days of spatial discrimination training for middle-aged EB (MA-EB, dark grey bars ), middle-aged oil (MA-Oil, black bars), young EB ( Young-EB light grey bars), and young oil (Young-Oil open bars). 63

PAGE 64

Figure 2-4. Probe trials delivered during the last block of training each day (Acquisition) and on the first trial of Day 2 and 3 (Retention) were used to measure the percent time searching the goal quadrant during Acquisi tion (A) and Retention (C) trials and number of platform crossings during Acqui sition (B) and Retention (D) trials. The bars represent the means + SEM for middle-aged (MA) and young (Young) mice treated with oil (open bars) or EB (filled bars). In general middle-aged oil treated mice exhibit reduced time in the goal qua drant and reduced platform crossings on testing Days 2 and 3 and significant differences are noted for Day 2. Pound signs indicate a difference due to treatment within the same age group(p < 0.05) and asterisks indicate a difference across age w ithin the same treatment group (p<0.05). 64

PAGE 65

Figure 2-5. Confirmation of age and EB treat ment effects using oligonucleotide array. Expression for a subset of eight genes was normalized by the means for young mice 65

PAGE 66

CHAP TER 3 AGING ALTERS THE EXPRESSION OF GENES FOR NEUROPROTECTION AND SYNAPTIC FUNCTION FOLLOWI NG ACUTE ESTRADIOL TREATMENT Introduction In humans, age-related impairments in hippocampal-dependent memory begin in middleage and cognitive weakening continues with a dvancing age (Foster, 2006; Small et al., 1999). Estrogen treatment in women (Sherwin, 2006), nonhuman primates (Lacreuse et al., 2002; Rapp et al., 2003), and rodents(Aenlle et al., 2009; Blalock et al., 2003; Markham et al., 2002) has been shown to protect against cognitive decline. However, it is becoming apparent that estradiol treatment initiated late in life is less effective (Adams et al., 2001a; Daniel et al., 2006; Foster et al., 2003; Sherwin and Henry, 2008). The mechanism for differential estradiol eff ects across the lifespan is unclear. In younger animals, estradiol has numerous effects on the hippocampus that could provide a mechanism for improved cognition. For example, estradiol can rapidly activate signaling pathways for neuroprotection (Guerra et al., 2004 ; Jover-Mengual et al., 2007; Ku roki et al., 2001; Sarkar et al., 2008; Wu et al., 2005) and synaptogenesis (Akama and McEwen, 2003; Mukai et al., 2007) and estradiol effects on neuroprot ection and synaptogenesis may be impaired in aged animals (Adams et al., 2001a; Brinton, 2008; Miranda et al., 1999; Yildir im et al., 2008) suggesting a possible breakdown in estrogen signaling. To determine whether the age differences in synaptogenesis and neuroprotection result from a weakening of the signaling pathways, we investigated differences in gene expression following an acute estradiol treatment. In vitro (Carroll et al., 2006) (S chnoes et al., 2008) and in vivo studies (Fertuck et al., 2003; Naciff et al., 2007; Pechenino and Frick, 2009) have provided evidence for distinct temporal patterns of estrogen-mediated gene expression. In general, genes related to the regulation of tran scription are altered within the first 2 hrs of treatment. Protein 66

PAGE 67

changes ass ociated with this early transcription contribute to the amplifi cation in the number of altered genes occurring between 4-12 hr. Furt hermore, this second wave of altered genes expression, between 4-12 hr, includes genes re lated to the functional effects of estrogen treatment for specific cell systems. Therefore, 17 -estradiol was injected in ovariectomized mice and estradiol-responsive genes were identified by transcript profiling at 6 and 12 hr after treatment. Pathway analysis of estradiol-respons ive genes identified agerelated differences in functional pathways related to oxidative phosphorylation, synaptic plasticity, and estrogen responsive signaling cascades. Materials and Methods Subjects Procedures involving animal subjects ha ve been reviewed and approved by the Institutional Animal Care and Use Committee at the University of Florida and were in accordance with guidelines established by the U. S. Public Health Service Policy on Humane Care and Use of Laboratory Animals. Initially 85 female C57/BL6 mice were obtained from National Institute of Aging for gene array analys is, with one gene chip per animal. However, quality controls for gene arrays indicate that 5 chips were outliers and the data for these animals was removed from further analysis. Therefor e, a total of 80 female mice (young: n = 26, 4 months; middle-aged: n = 26, 12 months; aged: n = 28, 18 months) were employed in this study. Animals were housed 3-5 per cage and maintained on 12:12 light:dark cycle ( lights on at 6 am). Following one-week habituation, mice were anesthetized (2 mg ketamine and 0.2 mg xylazine per 20 gm of body weight) and ovaries were rem oved through a small midline incision on the abdomen. All mice received ad lib access to food (Purina mouse chow, St Louis, MO) and water, until the surgery when they were placed on Casein based chow (Cincinnati Lab Supply, Cincinnati, OH), which is low in phyt oestrogens found in soy based chow. 67

PAGE 68

Hormone A dministration Briefly, a single injection of 17 -estradiol (Sigma Chemical Co, St Louis, MO) or mineral oil was initiated 10 days after ovariectomy (OVX) at 10 pm or 4 am. To c ontrol for time of day effects, all animal were sacrificed between 10 11 am, ~4 hr after lights on and either 6 hrs (injection at 4 am) or 12 hrs (inj ection at 10 pm) following the injection of estradiol or oil. Estradiol was dissolved in light mineral oil (Fishe r Scientific, Pittsburgh, PA ) to concentration of 0.1 mg/ml. Oil or estradio l (5g) in oil was injected subcutane ously at the nape of the neck in volumes of 0.05 ml. The groups incl uded: young receiving oil and sacr ificed 6 hr (n = 5) and 12 hr (n = 3) later; young receiving es tradiol and sacrificed 6 hr (n = 10) and 12 hr (n = 8) later; middle-aged receiving oil and sacrificed 6 hr (n = 5) and 12 hr (n = 6) later; middle-aged receiving estradiol and sacrificed 6 hr (n = 9) and 12 hr (n = 6) later; aged receiving oil and sacrificed 6 hr (n = 5) an d 12 hr (n = 7) later; aged receiving estradiol and sacrificed 6 hr (n = 9) and 12 hr (n = 7) later. To determine effectiveness of estradiol treatment, uteri were excised at the time of sacrifice and weighed immediately. An analysis of variance (ANOVA) was used to compare main effects on uterine weight. At the time of sacrifice, each animal was anesthetized with CO2 and decapitated. The brain was quickly removed and placed in ice-co ld artificial cerebral spinal fluid. Both hippocampus were removed, frozen in liquid nitr ogen, and stored at -80 C. RNA was isolated from each sample using Qiagen RNeasy Lipid Tissue Mini Kit (Qiagen, Germantown, MD). RNA concentration was determined using sp ectrophometer and a subset of samples was examined using Agilent 2100 Bioanalyzer (Santa Clara, CA). Microa rray analysis was performed for individual animal s (one chip per animal). 68

PAGE 69

Microarray Hybridiz ation and Signal Detection An amount of 5 g of total RNA was synthesized to cRNA using Affymetrix amplification kit following the manufactures protocol. H ybridization of cRNA wa s carried out by the Interdisciplinary Center for Biot echnology Research Microarray Core, University of Florida. Hybridization of Affymetrix Mouse 4 30 2.0 Arrays occurred for 17 hours at 60 C in accordance with manufactures instructions and arrays were scanned using an Affymetrix Microarray scanner. Images were analyzed using Affymetrix Gene Chip Operating System software (GCOS version 1.1) and scaled to 500. Hybridization signal intensities between GeneChips were normalized using dChips (Li and Wong, 2001) mode l-based expression index with the PM-only model. The model was used to set thresholds for identify outlier probe sets. Arrays with a large number of outlier probe sets (> 5% of total) were removed from further analysis. Data was then transferred into Microsoft excel for further analysis. Probe sets were annotated using Affymetrix NetAffx (12/2007). RT-PCR Real time PCR (RT-PCR) was performed to verify microarray results. RNA from each group was treated with Turbo DNAfree (Ambion, Austin TX) to remove any remaining genomic DNA. RNA was then converted to cDNA using High Capacity cDNA Archive Kit (Applied Biosystems, Foster City, CA). Primers a nd probes for WDFY1, GABRA2, NNT, PPARGC1A, AFT4, ENTPD4 and GAPDH were purchased from Applied Biosystems. Briefly, 3 g of total RNA from a single animal was incubate d with appropriate reagents at 25 C for 10 min and then heated to 37 C for 120 min using 7300 Fast Real-Time PCR System (Applied Biosystems). For relative quantification of RNA, 100ng in 2.5 l of cDNA was added to 12.5 l of Taqman Universal PCR Master Mix (2X), 1.25 l of 20X Gene Expression Assay Mix, a probe specific 69

PAGE 70

prim er mixture (Table 3-1), and 8.75 l of nuclease-free water for a total volume of 25 l. Thermal cycler conditions were set at 2 min at 50 C 10 min at 95 C and cycles 15s at 95 C and 1 min at 60 C for 40 cycles. The point at which the fluorescence crosses the threshold (Ct) was determined using 7300 Real-Time PCR System and SDS Software 1.3.1 analysis software (Applied Biosystems). Each sample was in tr iplicate and normalized to corresponding GAPDH values ( Ct sample ) and then compared to normalized young oil ( Ct reference ). The mean normalized values were compared using Ct method as described by Applied Biosystems to derive fold change (Aenlle et al., 2009), where Ct=( Ct sample ) -( Ct reference ). Statistical Analysis Probe set filtering and initial statistica l analysis was performed according to our previously published work (Aen lle et al., 2009; Blalock et al ., 2003). Briefly, the number of present calls for each probe was determined acr oss all chips and the probed was removed if fewer than 80% of the chips exhibited a presen t call for the probe. For all studies, differential expression was determined using two-tailed t -tests with the alpha le vel set at 0.025 in accordance with our previous studies (A enlle et al., 2009; Blalock et al., 2003). The probes sets that exhibited an increase or decrease in expressi on following treatment were submitted to Ingenuity Pathway Analysiss (IPA; Ingenuity Systems). With alpha set at p<0.025 we were able to obtain >800 molecules for generating networks, in acco rdance with IPA best practices for pathway analysis. The IPA program uses a right-tailed Fisher's Exact Test to compute the likelihood that the relationship between the list of submitted genes and a set of genes representing a given pathway is due to chance. A similar procedure was employed for determining overrepresentation of genes related to synaptic structure using the Expression Analysis System atic Explorer (EASE) through the NIH DAVID Bioinformatics Resources (Hosack et al., 2003). 70

PAGE 71

Results For each age group, all anim als treated with oil (young = 8, MA = 11, aged = 12) were used as controls to determine effects of treatme nt for age matched animals sacrificed 6 hr (young = 10, MA = 9, aged = 9) or 12 hr (young = 8, MA = 6, aged = 7) after a single estradiol injection. To determine the effectiveness of the estradio l treatment uterine weight was compared across groups (young oil 20 + 5 mg; young estradiol 6 hr 54 + 3 mg; young estradiol 12 hr 50 + 3 mg; middle-aged oil 30 + 6 mg; middle-aged estradiol 6 hr 52 + 3 mg; middle-aged estradiol 12 hr 43 + 10 mg; aged oil 34 + 4 mg; aged estradiol 6 hr 56 + 3 mg; aged estradiol 12 hr 56 + 4 mg). An ANOVA indicated an overall treatment effect (p < 0.0001) in the absence of an age differences and post hoc FLSD tests indicated a significant in crease in uterine weight at 6 hr (p < 0.0001) and 12 hr (p < 0.0001) following treatment relative to oil tr eated controls. Age Differences in Estradiol-Responsive Ge nes for Synaptogenesis, and Neuroprotection 6hr After Treatment Figure 3-1 illustrates the number of estrad iol-responsive probes for the 6 and 12 hr time points. At the 6 hr time point the MA mice exhibited the greatest shift in gene expression with approximately twice as many probes exhibiting a ltered expression relative to young animals and approximately a ten fold increase in the number of altered probes relative to aged mice. Agerelated differences in the pattern of estradiol-re sponsive gene expression we re also apparent. For probes that were observed to change expres sion at 6 hrs, young and MA mice exhibited increased expression for ~60% of the probes, wh ile the majority (64%) of estradiol-responsive probes were decreased in aged animals. A few probes were altered in the same direction across the different age groups; however, in some cases estradiol effects were in the opposite direction (Figure 3-1B). 71

PAGE 72

To examine markers of synaptic components, estradiol-responsive genes were grouped according to age and whether the genes increased or decreased expression. The gene groups were submitted to DAVID Bioinformatics Resources to determine overrepresentation of genes related to the gene ontology classifica tion for synapse cellular components (GO: 0045202). The results indicate that estradiol treatment was associated with increased expression of synaptic genes only for young (17 genes, p < 0.0005) and MA animals ( 26 genes, p < 0.00005) at the 6 hr time point. Four of the genes (ENAH, GRIA4, PJA2, GRIP1, GRIA1) were increased in both age groups (Table 3-2). A significant clus tering was not observed for syna ptic component genes that decreased expression (young: 4 gene s; MA: 6 genes). Furthermore, aged animals did not exhibit altered expression, increasing or decreasing, for genes related to synaptic components. Estrogen responsive genes were submitted to IPA to determine whether expression changes were associated with gene-enrichmen t for signaling pathways. Table 3-3 shows the pathways that exhibited significant (p < 0.01) overrepresenta tion. For genes that increased expression at the 6 hr time point, only young anim als exhibited overrepresentation in specific signaling pathways including PPA R/RAR signaling, which has been linked to neuroprotection (Martin et al., 2006; Rosa et al., 2008; Sanguino et al., 2006; Santos et al ., 2005). Interestingly, while significant gene enrichme nt was not observed for the PPAR/RAR pathway in MA mice, three of the six genes that increased in MA mice were common for the young group (CLOCK, GNAQ, NCOR1). For genes that decreased e xpression at the 6 hr time point, young and MA animals exhibited clustering of genes fo r oxidative phosphorylation and mitochondrial dysfunction (Table 4), with two genes NDUFV1 and NDUFV2 decreased in both age groups. Four genes that increased (WDFY1, GABRA 2, NNT, PPARGC1) and two that decreased (ATF4, ENTPD4) in young mice treated with estradiol were selected for validation of microarray 72

PAGE 73

results using RT-PCR. These genes were selected because they exhibited altered expression in the same direction at 6 hr and 12 hr after tr eatment at p < 0.025, except for PPARGC1 which was increased at 12 hr for p < 0.05. R NA isolated from oil treated mice (n = 3) was used as the control to calculate the fold change for mice (n = 3) treated 6 hr earlier with estradiol. Similarly, the fold change was calculated for values on the microarray for young oil and estradiol (6 hr) treated mice. Figure 3-2 illustrates that the direction and extent of altered transcription was similar for the microarray and RT-PCR. Age Differences in Estradiol-Resp onsive Genes 12hr After Treatment The number of probes influenced by treatment decreased from the 6 to 12 hr time points for young and MA mice. In contrast, aged animals exhibited approximately a five fold increase in the number of estradiol-responsive probes at 12 hr relative to the 6 hr time point (Fig 3-1A). Most of the probes (67%) for aged animals e xhibited decreased expression at 12 hr. When estradiol-responsive genes were compared ac ross age groups, common probes were usually altered in the opposite dir ection in aged animals compared to the other two groups (Fig 1C) and include a number of genes involved in the regulation of transcri ption (Table 3-7). To examine overrepresentation in functional ca tegories, the list of significantly altered genes was submitted to DAVID Bioinformatics Resources for examination of synaptic components. For all age groups, overrepresentation of synaptic component genes was not observed. Data were then submitted to IPA for determination of over representation in functional pathways (p < 0.01). No significan t clustering was observed for ge nes that exhibited decreased expression, regardless of age group (Table 3-5). In the case of increased expression, only aged animals exhibited gene enrichment which was la rgely focused on signaling pathways that are rapidly influenced by estrogen including a-adrene rgic signaling (Aydin et al., 2008; Bowman et al., 2002; Favit et al., 1991; Heikkinen et al., 2002), Ca2+ signaling (Brewer et al., 2006; Foster, 73

PAGE 74

2005; Zhao and Brinton, 2007), synaptic plasticity (Cordoba Montoya and Carrer, 1997; Sm ith and McMahon, 2005; Warren et al ., 1995), and IGF-1 signaling (Azcoitia et al., 1999; Donahue et al., 2006; Perez-Martin et al., 2003). Several of the genes interact with multiple signaling pathways (Table 3-6). Finally, the PPAR pathway was increased at 6 hr in young an 12 hr in aged mice; however, only one gene, CHUK, was common for young 6 hr and aged 12 hr groups. The increase in the number of altered genes at 12 hr for aged animals suggests that gene changes observed in younger mice may have been delayed in older animals. To examine this possibility we employed the gene expression da ta for 6 hr in young and MA mice and compared it to gene expression in aged mice at 6 and 12 hr to determine the number of genes that changed in the same direction. As illustrated in Figure 3-1B for age mice, the number of genes that changes in the same direction at 6 hr was 13 compared to you ng and 18 compared to MA. When we used the gene expression from age mice at 12 hr we expected to observe an increase of ~4 fold, since the number of genes for the aged gr oup increase from 198 to 940. However, relative to the young 6 hr group we saw a small increase from 13 to 19 and relative to MA animals the number of genes decreased from 18 to 4. Discussion Age Differences in Estradiol-Responsive Gene Signatures 6hr After Treatment The current study examined altered gene expression in the hippocampus following estradiol treatment over the course of aging. Th e results reveal that aged animals were less responsive to estradiol treatment examined 6 hr after an acu te treatment. In young and MA animals, estradiol treatment re duced expression for genes involv ed in oxidative phosphorylation and mitochondrial dysfunction. The decreased expression may represent feedback regulation due estradiol effects on ox idative phosphorylation. Altered ox idative phosphorylation is a major outcome of estradiol treatment in young animals and recent work indicates that in the brain, 74

PAGE 75

estradiol can enhance m itochondria l efficiency and decrease oxid ative stress (Irwin et al., 2008; Massart et al., 2002; Nilsen et al., 2007; Stirone et al., 2005; Zh eng and Ramirez, 1999). It is unclear whether estradiol influe nces oxidative phosphorylation to the same extent in aged animals. This point is important since prev ious research indicates that regulation of mitochondrial function and oxidative phosphoryl ation may constitute a corner stone for estrogens neuroprotective effects (Simpkins and Dykens, 2008). The results of the current study suggest that the acute effects of estradiol on oxidative phosphorylation may be less pronounced with advanced age. Age differences in genes that increased expression were also apparent. Estradiol treatment is associated with an increase in de ndritic spines in the hippocampus of young adult rats (Gould et al., 1990; Woo lley et al., 1990; Woolley and McEwen, 1992; Woolley and McEwen, 1993; Woolley et al., 1996), and this proce ss is impaired in older rats (Adams et al., 2001a; Miranda et al., 1999; Yildirim et al., 200 8). We observed that young and MA, but not aged mice, exhibited an increase in expression of genes related to the synapse 6 hr after acute estradiol treatment. Young mice exhibited an increase in genes re lated to PPAR signaling. Although, MA did not exhibit a significant number of genes in this pathway, for the 6 genes that increased, 3 were common to young and MA anim als. Aged animals exhibited increased expression of genes related to the PPAR pathwa y at 12 hr post treatment suggesting that the interaction of estrogen and PPAR signaling is ma intained in advanced age. The ability of estrogen to increase gene expression of this pathway may be important for hippocampal aging since PPAR signaling has been implicated in th e progression of Alzhei mers disease (Dupuy et al., 2001) and neuroprotection from inflammation (Kapadia et al., 2008; Vegeto et al., 2008). 75

PAGE 76

Furtherm ore, age and sex specific changes ha ve been noted for hippocampal PPAR signaling (Sanguino et al., 2006), suggesti ng that older females may be at greater risk. Age Differences in Estradiol-Responsive Gene Signatures 12hr After Treatment In contrast to young and MA mice, which exhibited a decline in the num ber of altered gene between 6 and 12 hr, the number of genes with altered expression increa sed during this time in aged animals. For aged mice at the 12 hr time point after an acute in jection, gene expression increased in signaling pathways that are rapidly influenced by estradiol including; Ca2+ signaling (Brewer et al., 2006; Foster, 2005; Zhao and Brinton, 2007), cAMP signaling (Gu and Moss, 1996), IGF-1 signaling (Azcoitia et al., 1999), and syna ptic plasticity (Foy et al., 2008a; Sharrow et al., 2002). The rapid activation of these pathways by estrogen is due to membrane interactions and not the result of classic tran scriptional regu lation. However, there is some indication for a reciprocal interaction between rapid membrane effects of estrogen on Ca2+, G-protein coupled receptor, and trophic factor signaling and estrog enic modulation of genes in these pathways (Foster, 2005). Mechanisms for Age-Related Differences in Estradiol-Responsive Gene Signatures In the case of increased expression of ge nes for rapid signaling cascades, it may be important that these same signaling cascades decline during aging (Fos ter, 2005). Thus, aged cells may be differentially sensitive to estradiol influences due to age-re lated changes in baseline transcriptional activity and the activation of rapid signaling cascades by estradiol. Estradiol effects on Ca2+ signaling provides a prime example. Estradiol rapidly influences Ca2+ signaling (Sarkar et al., 2008; Wu et al., 2005). In turn, Ca2+ signaling can regulate gene expression through non-classical transcrip tional regulation, independent of estrogen nuclear receptor mechanisms (Bading et al., 1993; Foster, 2005). Aged hippocampal neurons exhibit altered Ca2+ homeostasis and estrogen has effects on Ca2+-dependent processes, which are opposite that 76

PAGE 77

observed during aging (Foster, 2007). For example, the Ca2+-dependent afterhyperpolarization is increased with age and estradio l reduces the afterhyperpolariz ation (Kumar and Foster, 2002). Furthermore, estradiol pretreatment may have a greater effect on Ca2+ regulation in aged cells (Brewer et al., 2006; Brewer et al ., 2009). Together the results i ndicate that age differences in gene expression for rapid signaling pathways may relate to disparity in basal pathway activity and estrogen mediated activati on of rapid signaling cascades. In addition, to age-related changes in rapid si gnaling cascades, it is likely that changes in estrogen receptors contribute to differences in gene expressio n. In brain regions, like the hippocampus, that express both estrogen receptor alpha (ER ) and beta (ER ), the magnitude and direction of gene regulation will depend on the relative expression of each receptor and the interaction of receptors (Gonzalez et al., 2007; Gottfried-Blackmore et al., 2007). While it is unclear how estrogen receptor ex pression changes in the hippo campus of mice, aging female mice exhibit a decrease in the tr anscription and expression of ER in the cortex (Thakur and Sharma, 2007). In contrast, an age-relate d shift in the hippocampal expression of ER splice variants may reduce the sensitivity to estroge n treatment in women (Ishunina and Swaab, 2007). In the hippocampus of rats, expression of both ER and ER declines during aging (Mehra et al., 2005) and the loss of ER is associated with the decrea sed responsiveness of hippocampal synapses to estradiol (Adams et al., 2002). Indeed, previous work indicates an important role for ER in the estrogen-mediated increase in synaptic markers (Jelks et al., 2007; Morissette et al., 2008b; Mukai et al., 2006). However, several of these studies report a similar, though usually blunted effect of ER activation (Jelks et al., 2007; Morissette et al., 2008b; Patrone et al., 2000), suggesting that ER may be less active but have similar e ffects on transcripti on (Lindberg et al., 2003). 77

PAGE 78

An age-related change in ER and ER or a decline in rapid signaling pathways could have reduced or delayed estradiol induced si gnaling and gene regulati on. In the current study there appears to be a delay in the ex pressi on of PPAR genes. However, only one gene was common for young 6 hr and aged 12 hr groups. Furt hermore, IPA analysis indicated that many more pathways were differentially influen ced across young 6 hr and aged 12 hr groups. Similarly, synaptic component gene s did not increase in aged animals for either time point. Finally, examination of all genes indicated litt le correspondence in the gene changes between young 6 hr and aged 12 hr groups. Together, the resu lts indicate that delayed activation is not responsible for most of the age differences in altered gene expression between 6 and 12 hr. It is possible that gene changes observed in aged animals could act as a priming response for successive estradiol induced changes beyond the 12 hr time poi nt. For example, estradiol application to hippocampal sli ces rapidly increases ERK/MAPK activation and NMDA receptor function (Bi et al., 2003) and th e magnitude of LTP (Foy et al., 2008b) in young, but not aged animals. In contrast, in vivo priming with estradiol 48 hr prio r to sacrifice can enhance LTP in slices from young and aged animals (Smith and McMahon, 2005; Yun et al., 2007). Previous works suggests that both estrogen receptors and rapid signaling cascades are involved in the estradiol-mediated spine growth and synapt ogenesis (Akama and McEwen, 2003; Lee et al., 2004; Mukai et al., 2007; Murphy and Segal, 1996; Murphy and Segal, 1997; Yildirim et al., 2008; Znamensky et al., 2003). Thus, while young mi ce exhibit a rapid incr ease in the expression of the synaptic marker synaptophysin, an increase in synaptophysin can also be observed in aged mice following treatment with estradiol over severa l days (Frick et al., 2002; Spencer et al., 2008a). Similarly, behavioral stud ies suggest that a single estradiol injection delivered after training can improve memory in young and MA animals, but not aged animals (Frick, 2009), 78

PAGE 79

consistent w ith the idea that aged animals are less responsive to a single injection. Estradiol treatment for several days prior to training re liably improves memory in middle-aged animals (Foster, 2005; Frick, 2009); however, the effect s in aged animals can vary across species. Treatment prior to training improves memory in mice (Frick et al., 2002; Heikkinen et al., 2004; Vaucher et al., 2002), and is less effective in aged rats (Foster et al., 2003; Savonenko and Markowska, 2003; Talboom et al., 2008). Similar differences in responsiveness are noted for estradiol effects on synaptic markers, which can be increased in aged mice (Frick et al., 2002; Spencer et al., 2008a), but not in aged rats (Adams et al., 2001a; Miranda et al., 1999; Yildirim et al., 2008). The difference in rats and mice may be due to differences in the expression of estrogen receptors during aging. Regardless, the results indicate that aged animals are less responsive to a single injecti on of estradiol, however; depe nding on the species, estradiol priming may rescue estrogen res ponsiveness. It would be enlight ening to determine whether an increase in the expression of estrogen recepto rs or an enhancement of rapid signaling would ameliorate age-related differences in gene cha nges, synaptic plasticity and memory following estradiol treatment. Table 3-1 Context Sequence of Genes for RT-PCR Analysis Gene Symbol Assay ID Context Sequence WDFY1 Mm00840455_m1 GGGGTGTGATGGAATTTCACGTTT GABRA2 Mm01211683_m1 CGGGAA GAGTGTAGTCAATGACAAG NNT Mm01298455_m1 GCCAAC ATCTCTGGTTATAAGGCTG PPARGC1A Mm00447183_m1 CGC AACATGCTCAAGCCAAACCAAC ATF4 Mm00515324_m1 GCCATGGCGCTCTTCACGAAATCCA ENTPD4 Mm00491888_m1 TTCCT GCCCTTGAGAGACATCCGGC GAPDH Mm99999915_g1 GAACGGATTTG GCCGTATTGGGCGC 79

PAGE 80

Table 3-2 S ynaptic Component Genes In creased at 6 hr in Young and MA Mice Affymetrix Symbol Description p-value Fold Young 1458298_at CADPS Ca2+ dependent activator protein for secretion 1.58E-02 1.20 1443876_at CAMK2A Calcium/calmodulin-dependent protein kinase II alpha 1.00E-02 1.19 1423286_at CBLN1 Cerebellin 1 precursor protein 1.33E-02 1.53 1433607_at CBLN4 Cerebellin 4 precursor protein 9.86E-03 1.38 1433451_at CDK5R1 Cyclin-dependent kinase 5, regulatory subunit (p35) 1 1.49E-03 1.26 1422887_a_at CTBP2 c-terminal binding protein 2 9.81E-03 1.20 1442223_at ENAH Enabled homolog (drosophila) 9.46E-03 1.20 1455444_at GABRA2 Gamma-aminobutyric acid receptor, subunit alpha 2 1.06E-06 2.75 1434098_at GLRA2 Glycine receptor, alpha 2 subunit 1.29E-02 1.34 1458285_at GRIA1 Glutamate receptor, ionotropic, ampa1 (alpha 1) 5.61E-03 1.34 1440891_at GRIA4 Glutamate receptor, ionotropic, ampa4 (alpha 4) 1.55E-02 1.48 1436575_at GRIN3A Glutamate receptor ionotropic, nmda3a 1.35E-02 1.20 1435951_at GRIP1 Glutamate receptor interacting protein 1 4.60E-03 1.20 1437363_at HOMER1 Homer homolog 1 (drosophila) 1.94E-02 1.19 1417376_a_at IGSF4A Immunoglobulin superfamily, member 4a 1.19E-02 1.22 1450435_at L1CAM L1 cell adhesion molecule 1.18E-02 1.15 1452328_s_at PJA2 Praja 2, ring-h2 mo tif containing 1.78E-02 1.41 Middle-age 1439220_at ANK3 Ankyrin 3, epithelial 1.93E-02 2.01 1445798_at DLGH1 Discs, large homolog 1 (drosophila) 1.95E-02 1.74 1446585_at DLGH2 Discs, large homolog 2 (drosophila) 1.32E-02 1.37 1429768_at DTNA Dystrobrevin alpha 5.52E-03 1.27 1445329_at DTNB Dystrobrevin, beta 5.79E-03 1.66 1446426_at ENAH Enabled homolog (drosophila) 4.17E-03 1.85 1454022_at EPHB2 Eph receptor b2 9.43E-03 1.58 1458285_at GRIA1 Glutamate receptor, ionotropic, ampa1 (alpha 1) 1.36E-02 1.37 1453098_at GRIA2 Glutamate receptor, ionotropic, ampa2 (alpha 2) 1.27E-02 1.75 80

PAGE 81

Table 3-2 Continued Affymetrix Symbol Description p-value Fold 1443285_at GRIA4 Glutamate receptor, ionotropic, 4.53E-03 2.08 1440602_at GRIK2 Glutamate receptor, ionotropic, kainate 2 (beta 2) 6.52E-03 2.57 1421350_a_at GRIP1 Glutamate receptor interacting protein 1 1.69E-02 1.57 1458861_at GRM7 Glutamate receptor, metabotropic 7 2.12E-02 1.42 1440637_at ITSN1 Intersectin 1 (sh3 domain protein 1a) 1.58E-02 1.75 1424848_at KCNMA1 Potassium large conductance calcium-activated channel 9.27E-03 2.99 1440807_at MAGI2 Membrane associated guanylate kinase 1.97E-03 2.90 1420171_s_at MYH9 Myosin, heavy polypeptide 9, nonmuscle 1.25E-02 1.34 1422520_at NEF3 Neurofilament 3, medium 2.28E-02 1.13 1447216_at NRXN1 Neurexin I 1.37E-02 2.10 1457212_at NRXN3 Neurexin III 9.69E-04 2.11 1444126_at PJA2 Praja 2, ring-h2 mo tif containing 1.52E-04 2.07 1442620_at PSD3 Pleckstrin and sec7 domain containing 3 3.20E-04 2.12 1438282_at SYT1 Synaptotagmin I 2.99E-03 2.02 1429729_at SYT11 Synaptotagmin 11 1.22E-02 1.88 1459009_at UTRN Utrophin 2.27E-02 1.44 The Affymetrix probe identifier, gene symbol, gene description, t -test p-value and fold change are provided for genes of synaptic components that increase 6 hr following treatment in young and MA mice. 81

PAGE 82

Table 3-3 E stradiol-Responsive Pathways 6 hr Post Treatment Increasing p-value Genes Decreasing p-value Genes Young PPAR/RARa activation 5.E-03 15 Oxidative phosphorylation 5.E-05 17 Glutamate receptor signaling 5.E-03 8 Mytochondrial dysfunction 1.E-03 14 Circadian rhythm signaling 1.E-02 4 Middle-age None Oxidative phosphorylation 1.E-05 24 Mytochondrial dysfunction 5.E-03 18 Protein ubiquination pathway 1.E-02 25 Aged None None Pathways with overrepresentation of genes that were observed to increase or decrease expression 6 hr following treatment. The p-value is calculated from a right-tailed Fisher's Exact Test. The number of altered genes is also provided. Table 3-4 Oxidative Phosphorylation and Mito chondrial Dysfunction Genes Altered at 6 hr in Young and Middle-Aged Mice Affymetrix Symbol Description p-value FC Young 1417607_at COX6A2 cytochrome c oxidase subunit VIa polypeptide 2 4.53E-03 -1.37 1424364_a_at UCRC ubiquinol-cytochrome c reductase complex (7.2 kD) 1.86E-02 -1.31 1416057_at NDUFB11 NADH de hydrogenase (ubiquinone) 1 beta subcomplex, 11, 17.3kDa 1.98E-02 -1.28 1417286_at NDUFA5 NADH dehydr ogenase (ubiquinone) 1 alpha subcomplex, 5, 13kDa 9.06E-03 -1.27 1454716_x_at COX5B cytochrome c oxidase subunit Vb 2.13E-02 -1.25 1437680_x_at GLRX2 glutaredoxin 2 7.65E-03 -1.22 1428360_x_at NDUFA7 NADH dehydr ogenase (ubiquinone) 1 alpha subcomplex 1.42E-02 -1.16 82

PAGE 83

Table 3-4 Continued Affymetrix Symbol Description p-value FC 1423676_at ATP5H (includes ATP synthase, H+ transporting, mitochondrial F0 complex, subunit 2.48E-02 -1.17 1416495_s_at NDUFS5 NADH de hydrogenase (ubiquinone) Fe-S protein 5, 15kDa (NADHcoenzyme Q reductase) 2.01E-03 -1.14 1428322_a_at NDUFB10 (includes EG:4716) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10, 22kDa 3.85E-03 -1.14 1455283_x_at NDUFS8 NADH dehydr ogenase (ubiquinone) Fe-S protein 8, 23kDa (NADHcoenzyme Q reductase) 1.12E-02 -1.14 1415980_at ATP5G2 ATP synthase, H+ transporting, mitochondrial F0 complex, subunit C2 (subunit 9) 1.45E-02 -1.13 1428075_at NDUFB4 NADH dehydr ogenase (ubiquinone) 1 beta subcomplex, 4, 15kDa 3.76E-03 -1.13 1426689_s_at SDHA succinate dehydrogenase complex, subunit A, flavoprotein (Fp) 1.11E-02 -1.11 1428179_at NDUFV2 NADH dehydr ogenase (ubiquinone) flavoprotein 2, 24kDa 9.55E-03 -1.10 1415966_a_at NDUFV1 NADH de hydrogenase (ubiquinone) flavoprotein 1, 51kDa 1.02E-02 -1.07 1449622_s_at ATP6AP1 ATPase, H+ transporting, lysosomal accessory protein 1 1.66E-02 -1.07 Middle-age 1429329_at COX10 COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase (yeast) 7.36E-04 -1.38 1419544_at ATP6V1C1 ATPase, H+ transporting, lysosomal 42kDa, V1 subunit c1 1.98E-02 -1.32 1426742_at ATP5F1 ATP synthase, H+ transporting, mitochondrial F0 complex, subunit B1 9.93E-03 -1.30 1415967_at NDUFV1 NADH dehydr ogenase (ubiquinone) flavoprotein 1, 51kDa 3.37E-03 -1.30 1428782_a_at UQCRC1 ubiquinol-cytochrome c reductase core protein I 3.35E-03 -1.29 1417799_at ATP6V1G2 ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G2 1.13E-02 -1.25 83

PAGE 84

Table 3-4. Continued Affymetrix Sy mbol Description p-value FC 1417799_at ATP6V1G2 ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G2 1.13E-02 -1.25 1455640_a_at TXN2 thioredoxin 2 7.96E-03 -1.29 1423711_at NDUFAF1 NADH dehydr ogenase (ubiquinone) 1 alpha subcomplex, assembly factor 1 1.42E-03 -1.27 1423737_at NDUFS3 NADH dehydr ogenase ( 5.67E-04 -1.24 1424488_a_at PPA2 pyrophosphatase (inorganic) 2 4.49E-04 -1.23 1448331_at NDUFB7 NADH dehydr ogenase (ubiquinone) 1 beta subcomplex, 7, 18kDa 8.45E-03 -1.22 1450968_at UQCRFS1 ubiquinol-c ytochrome c reductase, Rieske iron-sulfur polypeptide 1 1.08E-02 -1.22 1437013_x_at ATP6V0B ATPase, H+ transporting, lysosomal 21kDa, V0 subunit b 4.57E-03 -1.21 1432264_x_at COX7A2L cytochrome c oxidase subunit VIIa polypeptide 2 like 1.44E-02 -1.21 1448153_at COX5A cytochrome c oxidase subunit Va 2.60E-05 -1.20 1448292_at UQCR ubiquinol-cytochrome c reductase 6.4kDa subunit 2.33E-02 -1.20 1448286_at HSD17B10 hydroxysteroid (17-beta) dehydrogenase 10 4.13E-03 -1.19 1448589_at NDUFB5 NADH dehydr ogenase (ubiquinone) 1 beta subcomplex, 5, 16kDa 1.29E-03 -1.18 1451096_at NDUFS2 NADH dehydr ogenase (ubiquinone) Fe-S protein 2, 49kDa (NADHcoenzyme Q reductase) 4.95E-03 -1.18 1428631_a_at ubiquinol-cytochrome c reductasecore protein II 2.34E-02 -1.17 1428179_at NDUFV2 NADH dehydr ogenase (ubiquinone) flavoprotein 2, 24kDa 1.60E-03 -1.16 1416663_at NDUFA9 (includes EG:4704) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 9, 39kDa 2.01E-03 -1.16 1416952_at ATP6V1D ATPase, H+ transporting, lysosomal 34kDa, V1 subunit D 1.41E-02 -1.16 1448203_at ATP5L ATP synthase, H+ transporting, mitochondrial F0 complex, subunit G 7.34E-03 -1.15 1415671_at ATP6V0D1 ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d1 1.19E-03 -1.13 1428075_at NDUFB4 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 4, 15kDa 1.56E-02 -1.12 84

PAGE 85

85 The Affymetrix probe identifier, gene symbol, gene description, t -test p-value and fold change (FC) are provided for genes of in the oxidative phosphorylation and mitochondrial dysfunction pathways that were decrease 6 hr following treatment in young and MA mice. Table 3-5 Estradiol-Responsive Pathways 12 hr Post Treatment Increasing p-value Genes Decreasing p-value Genes Young None None MA None None Aged -Adrenergic signaling 5.E-05 13 None Calcium signaling 1.E-04 16 Long-term depression signaling 5.E-04 13 Long-term potentiation signaling 1.E-03 12 G-protein coupled receptor signaling 5.E-03 13 cAMP-mediated signaling 1.E-02 11 IGF-1 signaling 1.E-02 10 PPAR signaling 1.E-02 7 Neuregulin signaling 1.E-02 8 Pathways with overrepresentation of genes with alte red expression 12 hr following treatment. The p-value is calculated from a right-tailed Fisher's Exact T est. The number of altered genes is also provided.

PAGE 86

Table 3-6 Signaling Genes Altered at 12 hr in Aged Mice Signaling Pathways AffyID Symbol Description pvalue Fold Adrenergic Calcium LTD LTP GProtein cAMP IG F PPAR Neure gulin 1426585_s_ at MAPK1 mitogen-activated protein kinase 1 1.47 E-02 1.14 x x x x x x x x x 1416351_at MAP2K 1 mitogen-activated protein kinase kinase 1 1.08 E-02 1.11 x x x x x x x x 1453419_at MRAS muscle RAS oncogene homolog 1.27 E-02 1.25 x x x x x x x 1452032_at PRKAR1 A protein kinase, cAMP-dependent, regulatory, type I, alpha (tissue specific extinguisher 1) 4.08 E-05 1.12 x x x x x x 1440132_s_ at PRKAR1 B protein kinase, cAMP-dependent, regulatory, type I, beta 5.23 E-03 1.14 x x x x x x 1460419_a_ at PRKCB protein kinase C, beta 2.03 E-02 1.16 x x x x x 1418754_at ADCY8 adenylate cyclase 8 (brain) 1.26 E-02 1.24 x x x x x 1426582_at ATF2 activating transcription factor 2 2.39 E-02 1.28 x x x x 1433592_at CALM1 calmodulin 1 (phosphorylase kinase, delta) 3.37 E-03 1.18 x x x x 1434440_at GNAI1 guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1 2.30 E-02 1.12 x x x x 86

PAGE 87

Table 3-6 Continued AffyID Symbol Description pvalue Fold Adrenergic Calcium LTD LTP GProtein cAMP IGF PPAR Neure gulin 1422103_a_ at STAT5B signal transducer and activator of transcription 5B 2.07 E-02 1.16 x x 1450186_s GNAS GNAS complex 1.9 1.14 x x x x 1417091_at CHUK conserved helixloop-helix ubiquitous kinase 1.42 E-03 1.26 x x 1421622_a_ at RAPGEF 4 Rap guanine nucleotide exchange factor (GEF) 4 2.09 E-02 1.49 x x 1416286_at RGS4 regulator of Gprotein signaling 4 5.89 E-04 1.23 x x 1450202_at GRIN1 glutamate receptor, ionotropic, Nmethyl Daspartate 1 4.12 E-03 1.35 x x 1452533_at RYR3 ryanodine receptor 3 1.02 E-03 1.36 x x 1440962_at SLC8A3 solute carrier family 8 (sodium/calcium exchanger), member 3 3.51 E-03 1.26 x x 1450655_at PTEN phosphatase and tensin homolog 2.15 E-02 1.28 x x 1419073_at TMEFF2 transmembrane protein with EGFlike and two follistatin-like domains 2 1.08 E-02 1.16 87

PAGE 88

Table 3-6 Continued AffyID Symbol Description pvalue Fold Adrenergic Calcium LTD LTP GProtein cAMP IGF PPAR Neure gulin 1422313_a_ at IGFBP5 insulin-like growth factor binding protein 5 1.65 E-03 1.57 x 1418099_at TNFRSF 1B tumor necrosis factor receptor 5.29 E-03 1.26 x 1417933_at IGFBP6 insulin-like growth factor binding protein 6 8.90 E-03 1.35 x 1450431_a_ at NEDD4 neural precursor cell expressed, developmentally down-regulated 4 1.33 E-02 1.10 x 1452046_a_ at PPP1CC protein phosphatase 1, catalytic subunit, gamma isoform 1.95 E-02 1.15 x 1420534_at GUCY1 A3 guanylate cyclase 1, soluble, alpha 3 8.46 E-03 1.56 x 1420871_at GUCY1 B3 guanylate cyclase 1, soluble, beta 3 3.69 E-03 1.43 x 1453260_a_ at PPP2R2 A protein phosphatase 2 (formerly 2A), regulatory subunit B, alpha isoform 2.23 E-02 1.23 x 1452788_at PPP2R5 E protein phosphatase 2, regulatory subunit B', epsilon isoform 1.44 E-02 1.87 x 1417943_at GNG4 guanine nucleotide binding protein (G protein), gamma 4 4.75 E-04 1.30 x 88

PAGE 89

89 Table 3-6. Continued AffyID Symbol Description pvalue Fold Adrenergic Calcium LTD LTP GProtein cAMP IGF PPAR Neure gulin 1424852_at MEF2C myocyte enhancer factor 2C 6.59 E-03 1.27 x 1452363_a_ at ATP2A2 ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 1.76 E-03 1.15 x 1450243_a_ at RCAN2 regulator of calcineurin 2 1.57 E-02 1.50 x 1423721_at TPM1 tropomyosin 1 (alpha) 1.41 E-02 1.13 x The Affymetrix probe identifier, gene symbol, gene description, t -test p-value and fold increase are provi ded for genes increased 12 hr following treatment in signaling pathways in aged mice. An x i ndicates that the gene is a member of the pathway.

PAGE 90

Table 3-7 G enes from aged mice which exhibite d expression opposite young or MA mice at 12 hr p-value Fold Change Affy ID Gene Description Y MA A Y MA A 1452369_at MAGI1 MEMBRANE ASSOCIATED GUANYLATE KINASE, WW AND PDZ DOMAIN CONTAINING 1 6.3E-04 4.4E-01 3.8E -03 -1.29 -1.10 1.51 1434008_at SCN4B SODIUM CHANNEL, TYPE IV, BETA 2.2E-02 3.9E-01 3.9E -03 -1.26 -1.16 1.47 1419008_at NPY5R NEUROPEPTIDE Y RECEPTOR Y5 9.2E-01 2.1E-02 5.3E -05 1.01 -1.52 1.45 1426495_at 2410042D21RIK RIKEN CDNA 2410042D21 GENE 5.2E-01 1.2E-02 1.9E -03 1.08 -1.51 1.41 1448795_a_at TBRG4 TRANSFORMING GROWTH FACTOR BETA REGULATED GENE 4 6.8E-01 1.6E-02 5.3E -03 -1.05 -1.34 1.33 1427329_a_at IGH-6 IMMUNOGLOBULIN HEAVY CHAIN 6 (HEAVY CHAIN OF IGM) 5.0E-02 2.3E-02 1.3E -02 -1.41 -1.27 1.32 1455277_at HHIP HEDGEHOG-INTERACTING PROTEIN 8.4E-05 7.1E-01 1.1E -02 -1.45 1.06 1.29 1426582_at ATF2 ACTIVATING TRANSCRIPTION FACTOR 2 1.4E-01 2.1E-02 2.4E -02 1.27 -1.45 1.28 1429249_at 4833424O15RIK RIKEN CDNA 4833424O15 GENE 7.1E-01 1.9E-02 5.9E -03 1.04 -1.58 1.27 1456904_at EST 8.0E-01 1.0E02 2.2E-02 1.02 -1.18 1.26 1426806_at OBFC2A OLIGONUCLEOTIDE BINDING FOLD CONTAINING 2A 2.6E-01 1.9E-02 1.9E -02 1.15 -1.51 1.25 1428429_at RGMB RGM DOMAIN FAMILY, MEMBER B 2.9E-01 2.2E-02 1.3E -02 1.13 -1.43 1.25 1435165_at CNTN2 CONTACTIN 2 2.1E-02 4. 4E-01 1.1E-02 -1.23 -1.09 1.25 1416286_at RGS4 REGULATOR OF G-PROTEIN SIGNALING 4 4.9E-01 2.3E-02 5.9E -04 1.05 -1.13 1.23 90

PAGE 91

Table 3-7 C ontinued p-value Fold Change Affy ID Gene Description Y MA A Y MA A 1433719_at SLC9A9 SOLUTE CARRIER FAMILY 9 (SODIUM/HYDROGEN EXCHANGER), ISOFORM 9 2.3E-02 4.4E-01 3.5E -03 -1.18 -1.07 1.21 1455734_at CRBN CEREBLON 2.1E-01 2.4E -02 2.3E-03 1.09 -1.15 1.20 1436056_at KIF13B KINESIN FAMILY MEMBER 13B 7.6E-03 6.6E-01 2.4E -02 -1.23 1.04 1.20 1419184_a_at FHL2 FOUR AND A HALF LIM DOMAINS 2 4.7E-03 5.6E-01 1.7E -02 -1.17 -1.03 1.20 1456967_at TRIM66 KIAA0298 HYPOTHETICAL PROTEIN (HUMAN) 1.2E-02 7.4E-01 1.8E -02 -1.24 1.04 1.19 1448752_at CAR2 CARBONIC ANHYDRASE 2 7.9E01 2.4E-02 9.7E-03 1.02 -1.25 1.16 1449164_at CD68 CD68 ANTIGEN 9.2E-01 1. 3E-02 7.7E-03 -1.00 -1.33 1.15 1428903_at 3110037I16RIK RIKEN CDNA 3110037I16 GENE 9.8E-03 9.8E-01 1.2E -02 -1.13 -1.00 1.14 1429227_x_at NAP1L1 NUCLEOSOME ASSEMBLY PROTEIN-1 2.1E-01 1.5E-02 2.4E -03 1.09 -1.25 1.13 1424801_at ENAH ENABLED HOMOLOG (DROSOPHILA) 3.8E-01 1.9E-02 2.5E -02 1.05 -1.20 1.12 1416458_at ARF2 ADP-RIBOSYLATION FACTOR 2 9.6E-01 1.4E-02 2.0E -02 -1.00 -1.26 1.12 1434440_at GNAI1 GUANINE NUCLEOTIDE BINDING PROTEIN, ALPHA INHIBITING 1 6.2E-01 1.4E-02 2.3E -02 1.05 -1.10 1.12 1424594_at LGALS7 LECTIN, GALACTOSE BINDING, SOLUBLE 7 1.0E-02 3.1E-01 6.3E -03 -1.12 -1.05 1.12 1455403_at MANEA MANNOSIDASE, ENDOALPHA 1.8E-02 9.3E-01 2.3E -02 -1.12 1.01 1.11 91

PAGE 92

Table 3-7 C ontinued p-value Fold Change Affy ID Gene Description Y MA A Y MA A 1448963_at NFYC NUCLEAR TRANSCRIPTION FACTOR-Y GAMMA 1.8E-02 4.5E-01 1.9E -03 -1.10 -1.05 1.11 1434612_s_at SBNO1 SNO, STRAWBERRY NOTCH HOMOLOG 1 (DROSOPHILA) 8.1E-01 2.2E-02 2.4E -02 1.01 -1.17 1.11 1455011_at STARD4 RIKEN CDNA 4632419C16 GENE 9.2E-03 4.4E-03 2.1E -02 -1.23 -1.17 1.10 1417364_at EEF1G EUKARYOTIC TRANSLATION ELONGATION FACTOR 1 GAMMA 8.8E-01 2.4E-02 1.2E -02 -1.01 -1.13 1.09 1452159_at 2310001A20RIK RIKEN CDNA 2310001A20 GENE 2.1E-04 2.4E-01 2.2E -02 1.17 -1.10 -1.10 1417252_at NT5C 5',3'-NUCLEOTIDASE, CYTOSOLIC 1.4E-03 1.2E-01 2.9E -03 1.32 -1.17 -1.12 1429048_at BLOC1S2 BIOGENESIS OF LYSOSOMERELATED ORGANELLES COMPLEX-1, SUBUNIT 2 2.1E-02 2.4E-02 1.5E -02 1.24 -1.28 -1.14 1434521_at RFXDC2 REGULATORY FACTOR X DOMAIN CONTAINING 2 HOMOLOG (HUMAN) 7.8E-01 9.3E-03 7.9E -03 -1.01 1.20 -1.15 1459874_s_at MTMR4 MYOTUBULARIN RELATED PROTEIN 4 4.9E-03 1.9E-01 1.3E -02 1.22 1.14 -1.16 1434745_at CCND2 CYCLIN D2 1.1E-03 2. 3E-01 1.5E-02 1.23 -1.09 -1.16 92

PAGE 93

Table 3-7. C ontinued p-value Fold Change Affy ID Gene Description Y MA A Y MA A 1426858_at INHBB INHIBIN BETA-B 1.5E-02 5.6E-01 2.2E-02 1.20 -1.05 -1.17 1456748_a_at NIPSNAP1 4NITROPHENYLPHOSPHATAS E DOMAIN AND NONNEURONAL SNAP25-LIKE PROTEIN H... 1.3E-02 6.0E-01 2.2E -02 1.21 1.04 -1.17 1455940_x_at WDR6 WD REPEAT DOMAIN 6 2.4E -02 3.6E-01 2.0E-02 1.16 1.14 -1.20 1447320_x_at RPO1-3 RNA POLYMERASE 1-3 7.7E-03 1.4E-01 1.3E-02 1.29 -1.20 -1.20 1436443_a_at KDELC1 KDEL (LYS-ASP-GLU-LEU) CONTAINING 1 7.4E-03 9.5E-01 1.6E -02 1.31 -1.01 -1.21 1448694_at JUN JUN ONCOGENE 3.4E-01 1. 4E-02 2.8E-03 -1.05 1.13 -1.22 1436114_at Rnf165 Ring finger protein 165 2.3E-02 2.4E-01 1.3E-03 1.19 1.11 -1.25 1455039_a_at SIN3B TRANSCRIPTIONAL REGULATOR, SIN3B (YEAST) 1.8E-02 6.7E-01 4.5E -03 1.23 1.04 -1.30 1441727_s_at ZFP467 HYPOTHETICAL PROTEIN, MNCB-3350 1.6E-02 3.1E-01 5.6E -03 1.34 1.10 -1.33 1456573_x_at NNT NICOTINAMIDE NUCLEOTIDE TRANSHYDROGENASE 2.0E-03 5.8E-01 1.7E -02 1.77 1.09 -1.33 1434210_s_at LRIG1 LEUCINE-RICH REPEATS AND IMMUNOGLOBULINLIKE DOMAINS 1 2.1E-03 9.9E-01 2.1E -02 1.42 -1.00 -1.34 93

PAGE 94

94 Table 3-7. Continued p-value Fold Change Affy ID Gene Description Y MA A Y MA A 1446464_at PSME4 PROTEASOME (PROSOME, MACROPAIN) ACTIVATOR SUBUNIT 4 9.3E-01 5.4E-03 1.5E -02 -1.02 2.11 -1.58 1438157_s_at NFKBIA NUCLEAR FACTOR OF KAPPA LIGHT CHAIN GENE ENHANCER IN B-CELLS INHIBITOR 1.4E-02 3.0E-01 2.4E -03 1.29 1.14 -1.35 1439422_a_at C1QDC2 C1Q DOMAIN CONTAINING 2 2.4E-02 4.1E-01 3.2E -03 1.25 -1.06 -1.37 1429372_at SOX11 SRY-BOX CONTAINING GENE 11 3.5E-03 6.7E-01 1.3E -02 1.51 1.06 -1.39 1454869_at WDR40B WD REPEAT DOMAIN 40B 8.2E -01 2.1E-02 1.3E-03 -1.07 1.59 -1.74 Genes from aged mice which exhibited expr ession opposite young or MA mice at 12 hr. The Affymetrix probe identifier, gene symbol, gene description, t -test p-value and fold change are provided for genes in young (Y), MA, and aged (A) mice 12 hr following treatment. The p-value s are all < 0.025 for aged mice and for either young or MA mice

PAGE 95

Figure 3-1. Estradiol-responsive gene expression is altered over the course of aging. A) Illustration of the number of probes that were increased or decreased by estradiol treatment in young (Young), middle-aged (MA) and aged (Aged) animals at 6 hr (filled bars) or 12 hr (open bars) after a single estrad iol injection. MA animals exhibited over two times the number of altere d probes at 6 hr rela tive to the other two age groups. The number of altered probes decr eased at 12 hr relative to 6 hr for young and MA animals. In contrast, aged anim als exhibited approximately a five fold increase in the number of estradiol-res ponsive probes during this time period. B&C) Venn diagrams of the number of differenti ally expressed probes in response to estradiol treatment at B) 6 hr and C) 12 hr. The numbers in parentheses represent probes that changes in opposite directions. 95

PAGE 96

96 Figure 3-2. Validation of estradiol treatment effect s in young animals at 6 hr for six genes using RT-PCR. The bars represent the mean fold change in gene expression for young mice 6 hr following estradiol treatment compared to the mean of age-matched oil treated animals using RT-PCR (open bars) and fo r microarray measures (filled bars)..

PAGE 97

CHAP TER 4 ANALYSIS OF HIPPOCAMPAL GENE EXPRESSION IN ESTROGEN RECEPTOR ALPHA AND ESTROGEN RECEPTOR BETA KNOCKOUT MICE AFTER ACUTE ESTRADIOL TREATMENT Introduction Steroid hormones and their receptors play im portant roles in development, sexual, nonsexual behaviors and neuronal function. In partic ular, estradiol (the most potent form of estrogen) and its two main receptor s, estrogen receptor alpha (ER ) and estrogen receptor beta (ER ), have powerful neurotrophic and protective effects within the central nervous system (CNS). Since the discovery of ERs in the hi ppocampus researchers have examined the role estrogen on hippocampal function (Foster, 2005; McEwen and Alves, 1999; Spencer et al., 2008b). Estrogen has powerful effects on hippocam pal dendritic spine density by increasing the density of spines across the estrus cycle and af ter EB treatment in ovari ectomized rats(Gould et al., 1990; Woolley et al., 1990; Woolley and McEw en, 1992). Moreover, research suggests that estrogen receptors influence neuronal phys iology and hippocampal dependent memory (Woolley, 2007). However, it is not clear how es trogen receptors are involved in regulating hippocampal function. Thus, a better understanding of estrogen receptors and the mechanisms supporting its influence on hippocampa l function must be established. Despite the fact that ER and ER have a similar structure, binding affinity for estrogen and share ~90% homolog, their behavior can be quite different (Nilsson et al., 2001). The Nterminal domain of ER and ER which contains the AF-1 domain (ligand independent domain), shares only 20% amino acid homology a nd displays promoter and cell specific activity. The central domain of ER and ER is highly conserved between the two receptors with 95% homology and contains the DNA binding dom ain, important for specific DNA binding and receptor dimerization (Enmark et al., 1997). The ligand binding domain or E domain contains the 97

PAGE 98

AF-2 dom ain and shares 55% homology between ER and ER This domain has a similar 3D structure between the two receptors but contains different amino acids in the cavity of the domain resulting in a 20% sma ller ligand-binding cavity in ER This may be an important region of receptor specificit y. Studies have shown that ER has a weaker AF-1 domain and relies more on AF-2 domain (Delaunay et al., 2000). These subtle differences in gene structures can lead to diverse actions on transcriptional regulation. The current study was designed to te st the effect of the loss of ER and ER on hippocampal gene expression with a nd without EB treatment using ER knockout (KO) and ER knockout (KO) female mice. Using microarray an alysis we found distinct differences in the hippocampal response to loss of functional ER and ER and response to EB treatment. However, estrogens ability to promote neuroprot ection is maintained afte r the loss of ERs with and without EB treatment. Our results highlight the adaptable relationship between the two receptors and suggest that even as the ratio of ERs are altered, young mi ce are still able to maintain transcriptional respons e to an acute EB treatment. Materials and Methods Subject ER -/(ER KO)(Lubahn et al., 1993) and ER -/(ER KO)(Krege et al., 1998) were created from heterozygous mouse colonies. Mice were screened using PCR amplification as previously described (Krege et al., 1998; Lubahn et al ., 1993). Wildtype (Adams et al.) liter mates were obtained from the same ER KO and ER KO colonies and combined into one WT group. All procedures involving animal subjects have been reviewed and approved by the Institutional Animal Care and Use Committee at the University of Florida and were in accordance with guidelines established by the U. S. Public Health Service Policy on Humane 98

PAGE 99

Care and Use of Laboratory Anim als. A total of 35 female mice (WT: n=14, 4months; ER KO n=10, 4 months; ER KO n=11, 4 months) were employed in this study. Animals were housed 35 per cage and maintained on 12:12 li ght: dark cycle (lights on at 6 am). After 3 months of age, mice were anesthetized (2 mg ketamine and 0.2 mg xylazine per 20 grams of body weight) and ovaries were removed through a small midline in cision on the abdomen. All mice received ad lib access to food (Purina mouse chow, St Louis, MO) and water, until the surgery when they were placed on Casein based chow (Cincinnati Lab Supply, Cincinnati, OH), which is low in phytoestrogens found in soy based chow. Hormone Administration Briefly, ten days after ovariectomy (OVX) anim als received either a single injection of estradiol or oil and were sacrificed 6 hrs after injection. Estradiol (17 -estradiol benzoate, EB) (Sigma Chemical Co, St Louis MO) was dissolved in light mineral oil (Fisher Scientific, Pittsburgh, PA) to a concentration of 0.1 mg/ml. Oil and EB (5 g) was injected subcutaneously at the nape of the neck in a final volume of 0.05ml. Animals were separated into groups including WT receiving EB (n=7), WT receiving Oil (n=7), ER KO receiving EB (n=5), ER KO receiving Oil (n=5), ER KO receiving EB (n=6) and ER KO receiving Oil (n=5). At the time of sacrifice, animals were an esthetized with CO2 and decapitated. The brain was quickly removed and placed in ice-cold artif icial cerebral spinal fluid. Both hippocampi were removed, frozen in liquid nitrogen, and stored in -80 C until processing. RNA was isolated from each sample using Qiagen RNeasy Lipid Tissue Mini Kit (Qiagen, Germantown, MD). RNA concentration was determined using sp ectrophometer and a subset of samples was examined using Agilent 2100 Bioanalyzer (Agilent, Santa Clara, CA). 99

PAGE 100

Microarray Hybridiz ation and Signal Detection One mouse per array was used for all microarray procedures. An amount of 5 g of total RNA was synthesized to cRNA us ing Affymetrix amplification kit following the manufactures protocol. Hybridization of cRNA was carried out by the Interdisci plinary Center for Biotechnology Research Microarray Core, University of Florida. Hybridization of Affymetrix Mouse 430 2.0 Arrays (one chip per animal) occurred for 17 hours at 60 C in accordance with manufactures instructions and arrays were scan ned using an Affymetrix Microarray scanner. Images were analyzed using Affymetrix Gene Chip Operating System software (GCOS version 1.1) and hybridization signal intensity levels be tween GeneChips were normalized using dChip (Li & Hung Wong, 2001). Data was then transferred into Microsoft excel for further analysis. Data Filtering and Statistical Analysis Probe sets were annotated using Affymetrix NetAffx (12/2007). The detection of signal (presence/absence) was determined by MAS5.0 (Affymetrix). The number of present calls for each probe set was determined across all a rrays by setting criteria that more than 80% of the chips had to exhibit a present call for that probe. The remaining probe sets were submitted to Ingenuity Pathway Analysis (IPA; Ingenuity Sy stems, Redwood City, CA) to determine the number of genes available for generating networks. This filtering procedure resulted in a total data set of 9602 genes. These 9602 genes comprised the total data set used for all statistical comparisons. Two-tailed t -tests were used to determine diff erentially expressed probe sets and alpha level cut-off was set at 0.025 according to previously published wo rk (Aenlle et al., 2007; Blalock et al., 2003). For each set of comparisons the false discovery rate (FDR) was calculated as the expected number of false positives from multiple testing/total observations. Probe sets with a FDR > 0.5 were considered as unaccepta ble for pathway investigation and no further 100

PAGE 101

analys is was performed (Ewens and Grant, 2005) Acceptable data sets were submitted to IPA for pathway mapping of differentially expressed tr anscripts. IPA uses a right-tailed Fisher's Exact Test to compute the likelihood that the re lationship between the list of submitted genes and a set of genes representing a given pathway is due to chance. In accordance with best practices, we attempted to limit the IPA analysis to ~800 molecules or less for generating networks. A similar procedure was employed for determining ove rrepresentation of genes related to synaptic structure using the Expression Analysis Syst ematic Explorer (EASE) through the NIH DAVID Bioinformatics Resources (Hosack et al., 2003). RT-PCR RNA from each group was treated with Tur bo DNAfree (Ambion, Austin TX) to remove any remaining genomic DNA. Total RNA (3 g) was then converted to cDNA using High Capacity cDNA Archive Kit (Applied Biosystems, Foster City, CA). For relative quantification of RNA, 100ng in 2.5 l of cDNA was added to 12.5 l of Taqman Universal PCR Master Mix (2X), 1.25 l of 20X Gene Expression Assay Mix (pri mer sequences can be found in Table 4), and 8.75 l of nuclease-free water for a total volume of 25 l. Thermal cycler conditions were set at 2 min at 50 C, 10 min at 95C and cycles 15s at 95 C and 1 min at 60 C for 40 cycles. The point at which the fluorescence crosses the thre shold (Ct) was determined using 7300 Real-Time PCR System and SDS Software 1.3.1 analysis soft ware (Applied Biosystems). Each sample was in triplicate and normalized to corresponding GAPDH values ( Ct sample ) and then compared to normalized young oil ( Ct reference ). The mean normalized values were compared using Ct method as described by Applied Biosystems to de rive fold change (Aenlle et al., 2009), where Ct=( Ct sample ) -( Ct reference ). 101

PAGE 102

Results Alteration of Basal Gene Expression Levels in ERKO Mice To determine differences in basal gene expression we compared estrogen receptor knockout (ERKO) Oil treated animal s to WT Oil treated controls Comparisons between WT Oil treated and ER KO Oil treated mice indicated 181 genes with altered expression (Figure 4-1). The FDR was > 0.5; therefore, no fu rther analysis was conducted on th ese genes. In contrast to ER KO mice, comparisons of WT Oil treated and ER KO Oil treated animals revealed 674 differentially expressed genes (FDR = 0.35). The majority of the genes (543, 80%) increased expression in ER KO Oil treated animals (Figure 4-1) Moreover, 353 genes exhibited an increase greater than 1.5 fold (Figure 4-2). For the 131 genes that decrease d expression only four genes displayed a greater than 1.5 fold decrease in expression. The genes from ER KO Oil treated animals that di splayed a significant change in expression from baseline were submitted to IPA to determine whether ex pression changes were restricted to specific signa ling pathways. For the 543 genes that were increased in ER KO Oil treated animals, IPA indicated overrepresentation in several pathways (Table 4-1). The top five pathways included IGF-1 signaling (p< 0.001), PPAR signaling (0.005), RAR activation (p<0.005), Clarthrin-mediated endocytosis (p<0.007), and Wnt/ -catenin signaling (p<0.007). For the 131 genes that d ecreased expression in ER KO Oil treated mice, tw o pathways exhibited gene clustering including, SAP/JNK signaling (p<0.03), and Calcium signaling (p<0.04). Previous research indicates a role for estrogen in regulating and the expression of synaptic proteins and synapse number. Ther efore, we submitted the 674 genes that were differentially expressed in ER KO Oil treated mice to the Expression Analysis Systematic Explorer (EASE) through th e NIH DAVID Bioinformatics Re sources (Huang, 2009; Dennis 102

PAGE 103

2003) to exam ine overrepresentation of gene s related to the synapse (GO: 0045202). The analysis indicate significant (p <0.004) clustering of genes fo r synaptic components, with 19 genes increasing in expression and 3 genes decrea sing in expression relati ve to WT Oil treated mice (Table 4-2). Alteration of Gene Expression After Acute EB Treatment To examine differential gene expression fo llowing EB treatment we determined the number of altered genes between Oil and EB tr eated within each genotype (Figure 4-3). A total of 937 (FDR=0.25) genes were differentially ex pressed between WT EB and WT Oil treated mice. Within the 937 genes, 436 (46%) genes increased in expression and 501 (54%) genes decreased in expression. Further, 65 genes had a fold change of greater than 1.5, with 41 increasing and 24 decreasing. Compared to WT animals, ERKO mice exhibited reduced responsiveness to acute EB treatment (Figure 4-3). Two-tailed t-tests of ER KO EB treated relative to ER KO Oil treated mice and ER KO EB treated relative to ER KO Oil treated mice revealed 171 and 121 genes, respectively, were a ltered after EB treatment In both cases the FDR was >0.5. The apparent lack of EB effects in ERKO anim als suggests that both receptors are required for EB influences on gene expression. Alternativ ely, the lack of responsiveness may be due to the altered basal gene expression in ERKO mice, attributable to th e release of inhibition and thus enhanced activity of the remaining receptor (Pettersson et al., 2000; Williams et al., 2008). Interestingly, of the 937 genes differentially ex pressed in WT Oil vs WT EB treated mice, 191 were also differentia lly expressed in ER KO Oil treated mice compared to WT Oil (Figure 4-4). Most of the genes were differentially express in the same direction (136 increasing, 49 decreasing) (Table 4-3,Table 4-4), suggesti ng ceiling/floor effects of EB induced gene 103

PAGE 104

expression due to uninhibited ER a ctivity. If the shift in basal gene expression is due to enhanced activity of the remain ing receptor, then EB treatment may eliminate gene expression differences. Indeed, a compar ison between WT EB and ER KO EB treated mice reveal only 87 differentially expressed genes. Similarly, 196 genes were differentially expressed between ER KO EB and WT EB treated mice (Figure 4-5) Finally, analysis of gene expression differences between ER KO EB and ER KO EB treated mice found 100 differentially expressed genes. Therefore, at least for the 6 hr time point examin ed, ERKO mice and WT mice display similar gene expression following a single EB treatment. The idea that the removal of one receptor will enhance activity of the remaining receptors was further tested by comparing the gene expr ession levels between WT Oil treated and ERKO EB treated mice. For this analysis genes were se lected that exhibited a significant difference (p < 0.025) between WT Oil and ERKO EB treated mice. Furthermore, we set a criterion that expression change had to be monotonic with respect to the presumed increased receptor activation, such that for genes that increased expression followi ng EB treatment, the level of expression had to follow the pattern of WT O il treated< ERKO Oil treated< ERKO EB treated. A similar criterion was set for genes that decr eased in expression following EB treatment (ERKO EB treated< ERKO Oil treated< WT Oil treated). Comparison of WT Oil treated versus ER KO EB treated animals revealed 1182 (FDR=0.20) gene s out of the total data set were altered between WT Oil and ER KO EB treated animals and exhibite d a directional change across the three groups (Figure 4-6). The number of differen tially expressed genes was 6.5 fold greater than the number of genes differentially expressed for WT Oil versus ER KO Oil treated animals. Similar gene expression changes were seen in ER KO EB treated mice with a total of 1164 (FDR=0.20) genes out of the total data set altered between WT Oil and ER KO EB treated mice 104

PAGE 105

(Figure 4-6), which was a 1.7 fold increase in the num ber of gene s altered relative to comparisons between WT Oil and ER KO Oil treated animals. A total of 276 genes were differentially expressed in all three genot ypes treated with EB compared to WT Oil. Figure 4-7 displays the av erage percent change in gene expression in WT, ER KO and ER KO relative to WT Oil and indicates that the maximum response to EB treatment across genes is simila r across genotypes. Furthermore, for those genes that increased with EB treatment, the baseline expression (i.e in Oil treated animals) was increased in ER KO mice. Estrogen Receptor Alpha Gene Expression Levels Interestingly, a significant increase (p<0.0001) in ER expression was found in ER KO EB and Oil treated compared to WT and ER KO in both EB and Oil treated animals (Figure 48). There was no significant difference in ER gene expression levels between ER KO EB and Oil treated animals or between WT (EB or Oil treated) to ER KO (EB or Oil treated). At least, a 3-fold increase in expression was found in ER KO compared to WT and ER KO animals regardless of treatment. No significant differences between groups were found in ER gene expression levels (data not shown). RT-PCR Validations of microarray results were preformed on 7 genes. Of the 7 primers used to confirm microarray results; 2 genes (Camk2a, Atp2b1) were significantly altered by the loss of the ER (WT Oil versus ER KO Oil), 4 genes (Sqk1, Fut, March7, Eif2s1) were influenced by EB treatment in WT animals and ESR1 which was found to be increased in ER KO animals. All 7 primers showed at least a 1.25 fold increase in expression, confirming microarray results (Figure 4-8 and 4-9). 105

PAGE 106

Discussion Our analyses reveal distinct roles of ER and ER on hippocam pal gene expression with and without EB treatment. Th e absence of functional ER appears to have a greater impact on basal hippocampal gene expression. Re lative to WT Oil treated mice, ER KO mice treated with Oil exhibited few gene changes. In contrast, ER KO mice treated with Oil exhibited a relatively large number of altered genes, with 80% of the genes incr easing expression. Moreover, the magnitude of expression was conspicuous such th at 52% of the differentially expressed genes exhibited increased expre ssion greater than 1.5 fold. The shift in basal hippocampal gene expression in ER KO animals is likely due to the loss of ER inhibition on transcription normally induced by ER activity. In a number of systems, ER acts as a dominate inhibitory regulator by forming heterodimer complexes to limit ER binding to estrogen response elements (Gonzalez et al., 2007; Hall and McDonnell, 1999; Pettersson et al., 2000; Strom et al., 2004; W illiams et al., 2008; Zhao et al., 2007). Gene profiling studies in bone (Lindberg et al., 2003) and aortic tiss ue (O'Lone et al., 2007) of ER KO and ER KO mice demonstrate increased transcriptional activity associated with ER activation, which is enhanced in ER KO mice. It is important to note that these studies observed differences in gene expression after EB treatment. In cont rast, we observed significant alteration of basal gene expression in ER KO relative to WT mice. The differe nce in basal expression found in ovariectomized animals is likely due to endogenous hippocampal estrogen driving ER mediated changes in gene expression. Even after the remo val of gonadal hormones, the level of locally synthesized estrogen in the hippocampal is ~1 nM a level which will preferentially activate ER (Barkhem et al., 1998; Pettersson et al., 2000). Thus, in the absence of exogenous hormone, 106

PAGE 107

hippocam pal ER appears to act mainly as an inhibitory regulator of gene expression driven by ER Estrogen is neuroprotective against ischemia and neurodegenerative diseases, although the exact mechanisms are unclear. The results of th e current study indicate that in the absence of a functional ER ER increases the expression of genes i nvolved in several neuroprotection pathways including; IGF-1 signaling, PPAR signaling, RAR activation, and Wnt/ -catenin signaling. The link between ER and IGF-I signaling has been well established using both in vitro and in vivo methods (Azcoitia et al., 1999; Cardona -Gomez et al., 2000; Garcia-Segura et al., 2007; Garcia-Segura et al., 2006; Mendez et al., 2005). Recent work suggests estrogen enhances neuroprotection by interacting with the Wnt/ -catenin pathway (Zhang et al., 2008) and increasing the expression of genes for components of PPAR signalin g (Aenlle and Foster, 2009). The enhancement of neuroprotective pathways by unopposed ER activity may explain why ER KO animals displayed less infarct volume after middle cerebral artery occlusion compared to ER KOs (Dubal et al., 2006; Dubal et al., 2001) and the differential effects of ER and ER agonisits in protecting hippocampal neurons (Dai et al., 2007). Together the results indicate that ER activity, unopposed by ER acts on gene expression to augment several neuroprotective pathways, In addition, the results of the current study indicate that ER plays a prominent role in regulating synapses. Estrogen induces the growth of hippocampal dendritic spines (Gould et al., 1990; Woolley et al., 1990; Woolley and Mc Ewen, 1992) and synaptogenesis (Akama and McEwen, 2003; Choi et al., 2003; Jelks et al., 2007; Kretz et al., 2004; Rune and Frotscher, 2005). We observed an increased in the basal expression of synaptic component genes in ER KO Oil treated mice compared to WT Oil treat ed mice. The results are consistent with 107

PAGE 108

several previous studies indica ting that local estrogen synthesis can drive the maintenance of synapses (Kretz et al., 2004), and ER activity mediates an increase in synaptic markers (Jelks et al., 2007; Morissette et al., 2008a; Murakami et al., 2006; Patrone et al ., 2000; Romeo et al., 2005). However, it should be noted that several of these studies report a similar, though usually blunted effect of ER activation (Jelks et al., 2007; Liu et al., 2008; Morisset te et al., 2008a; Patrone et al., 2000), suggesting that ER may be less active but have similar effects (Lindberg et al., 2003). Acute Estrogen Treatment Differentially Alters Hippocampal Gene Expression in WT, ER KO and ER KO Mice Our results reveal that EB treatment of ER KO and ER KO mice enhanced differences in gene expression relative to WT Oil treated mice indicating th at both receptors are responsive to EB. Furthermore, a similar pattern of gene expression was observed in all three genotypes, WT, ER KO, and ER KO, treated with EB indicating that EB having similar effects on gene expression regardless of receptor type. It possibl e that, rather than the classical ER genomic signaling, the similarity in gene expression observed 6 hr after EB treatment was mediated through activation of ERs on the membrane whic h then activate signaling cascades which are common to multiple membrane receptors (Foster, 2005). Nevertheless, the fact that EB treatment was required to observed changes in ER KO mice, which were evident under basal conditions in ER KO mice, indicates that membrane ER may be predominately activated under conditions of low estrogen or genomic ER induced transcription has feed -forward effects to promote elements involved in rapid estrogen-medi ated processes (Aenlle and Foster, 2009) Together our results indicate that when circ ulating estrogen levels are relatively low, ER is the principal receptor regul ating gene expression. In several systems that express both receptors, ER acts as an inhibitory regulator of gene expression driven by ER possibly by 108

PAGE 109

for ming heterodimer complexes to limit ER binding to estrogen respon se elements (Hall and McDonnell, 1999; Strom et al., 2004; Zhao et al., 2007) (Pettersson et al ., 2000; Williams et al., 2008). This is consistent with the notion that hi gher levels of estrogen are required to affect behavior when ER is present (Rissman, 2008). Our results indicate that ER activation can have effects similar to that observed for ER ; however, in ovariectomized mice, locally synthesi zed estrogen may not reach a level needed to activate ER ; therefore, activation of ER may be observed following estrogen treatment. Accordingly, the effect of EB treatment on hippocampal functions, includ ing memory, is likely dependent on the level of ongoing ER activity. Previ ous research indicates that, in the absence of estrogen treatment, ovariectomized ER KO mice exhibit normal learning and memory (Fugger et al., 2000; Liu et al., 2008; Rissman et al., 2002), possibly due to unopposed ER activity acting to maintain or increase genes for synap tic growth and remodeling. We observed that, due to enhanced baseline expression, subsequent EB treatment had minimal effect on gene expression in ER KO mice. As such we might expect that estrogen treatment of ER KO mice would have minimal influence on memory (Liu et al., 2008) or could possi bly impair learning if over activation of ER resulted in a feed back reduction in ER expression (Rissman et al., 2002) or an uncoupling of recepto r-transcription activity (Foste r, 2005). In contrast to ER KO mice, ovariectomized ER KO mice exhibit impaired learning and memory relative to WT controls, possibly due to the inability of locally synthe sized estrogen to activate ER This impairment can be rescued by viral mediated delivery of ER (Foster et al., 2008) or estrogen treatment (Fugger et al., 2000), which would be expected to drive ER to activate pathways normally induced by ER The idea that ER activity maintain hippocampal function and that estrogen treatment is required when ER activity is disrupted may extend to women in which 109

PAGE 110

ER polym orphisms are associated with memory de ficits that emerge postmenopausally (Corbo et al., 2006; Ji et al., 2000; Olsen et al., 2006; Yaffe et al., 2009). For animals that express both receptors in th e hippocampus, the effect of EB treatment is likely to reflect the relative expression and function of each receptor. Whereby, ERs can act antagonistically or synergistically to promote or inhibit the expression of genes. Furthermore, these effects are tissue and state dependent, as the ratio of rece ptors differ according to brain region and adjust to changes in the environment such as af ter injury. Work by Wise and colleagues have found that ER KO mice display less total infarct after middle-cerebral artery occlusion (MCAO) and WT mice s how an initial increase in ER immediately following injury (Dubal et al., 2006; Dubal et al., 200 1). Suggesting an upregulation of ER or unopposed ER promotes neuroprotective pathways. Conclusion Finally, our results have important implicati ons on the effects of estrogen to treat agerelated cognitive impairments. The effect of estr ogen decreases with age with a possible critical period where treatment should be initiated du ring middle-age (Craig and Murphy, 2008; Maki, 2006; Sherwin and Henry, 2008). This critical time period coincides with estropause in mice and menopause in humans, a time of fluctuating horm ones before cessation of the menstrual cycle. Similar to humans, rodents show a decrease in circulating hormones, d ecrease in responsiveness to EB and an age-related alteration in estroge n receptors (Adams and Morrison, 2003; Espeland et al., 2004; Foster, 2005; Shumaker et al., 2004). A better unders tanding of the behavior of estrogen receptors and how a change in the ra tio of estrogen recept ors affects hippocampal function, may provide better treatment options during this critical period. 110

PAGE 111

Table 4-1 T he top pathways affected in ER KO Oil treated mice Increasing IGF-1 Signaling Affymetrix ID pvalue FC CSNK2A1 casein kinase 2, alpha 1 polypeptide 1419038_a _at 0.009 5.56 CSNK2A2 casein kinase 2, alpha prime polypeptide 1453099_a t 0.022 2.16 CTGF connective tissue growth factor 1416953_a t 0.013 1.51 IGF1R insulin-like growth factor 1 receptor 1428967_a t 0.012 1.56 KRAS v-Ki-ras2 Kirsten rat sarcom a viral oncogene homolog 1434000_a t 0.013 1.08 NOV nephroblastoma overexpressed gene 1426852_x _at 0.014 1.19 PIK3R1 phosphoinositide-3-kinase, regulatory subunit 1 (alpha) 1425514_a t 0.003 1.69 RASA1 RAS p21 protein activator (GTP ase activating protein) 1 1426478_a t 0.017 1.43 RPS6KB1 ribosomal protein S6 kina se, 70kDa, polypeptide 1 1460705_a t 0.020 1.42 YWHAQ tyrosine 3-monooxygenase/tryp tophan 5-monooxygenase activation protein, theta polypeptide 1460621_x _at 0.023 1.07 PPAR Signaling Affymetrix ID pvalue FC CREBBP CREB binding protein 1435224_a t 0.014 1.22 HSP90AA1 heat shock protein 90kDa alpha (c ytosolic), class A member 1 1437497_a _at 0.022 1.37 KRAS v-Ki-ras2 Kirsten rat sarcom a viral oncogene homolog 1434000_a t 0.013 1.08 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1426627_a t 0.007 1.24 4 MED1 mediator complex subunit 1 1421907_a t 0.004 3.64 NCOR1 nuclear receptor co-repressor 1 1423201_a t 0.014 2.78 NRIP1 nuclear receptor interacting protein 1 1418469_a t 0.006 2.11 PDGFD platelet derived growth factor D 1426319_a t 0.012 1.30 PPARGC1A peroxisome proliferator-activated receptor gamma, coactivator 1 alpha 1437751_a t 0.010 1.35 RAR Activation Affymetrix ID pvalue FC CREBBP CREB binding protein 1435224_a t 0.014 1.22 CSNK2A1 casein kinase 2, alpha 1 polypeptide 1419038_a _at 0.009 5.56 CSNK2A2 casein kinase 2, alpha prime polypeptide 1453099_a t 0.022 2.16 DUSP1 dual specificity phosphatase 1 1448830_a t 0.022 1.54 MED1 mediator complex subunit 1 1421907_a0.004 3.63 111

PAGE 112

t NCOR1 nuclear receptor co-repressor 1 1423201_a t 0.014 2.78 NRIP1 nuclear receptor interacting protein 1 1418469_a t 0.006 2.11 PIK3R1 phosphoinositide-3-kinase, regulatory subunit 1 (alpha) 1425514_a t 0.003 1.69 PNRC1 proline-rich nuclear receptor coactivator 1 1433668_a t 0.005 1.26 PPARGC1A peroxisome proliferator-activated receptor gamma, coactivator 1 alpha 1437751_a t 0.010 1.35 2 PTEN phosphatase and tensin homolog 1422553_a t 0.003 3.84 SMAD1 SMAD family member 1 1416081_a t 0.009 1.58 SMAD4 SMAD family member 4 1422485_a t 0.015 1.42 Table 4-1. Continued Clathrin-mediated Endocytosis Affymetrix ID pvalue FC AP2B1 adaptor-related protei n complex 2, beta 1 subunit 1427077_a _at 0.005 1.52 CSNK2A1 casein kinase 2, alpha 1 polypeptide 1419038_a _at 0.009 5.56 CSNK2A2 casein kinase 2, alpha prime polypeptide 1453099_a t 0.022 2.16 DNM3 dynamin 3 1446265_a t 0.012 2.1 FGF12 fibroblast growth factor 12 1451693_a _at 0.004 1.27 FGF14 fibroblast growth factor 14 1435747_a t 0.006 1.23 FGF9 fibroblast growth factor 9 (glia-activating factor) 1438718_a t 0.017 1.27 HIP1 huntingtin interacting protein 1 1424755_a t 0.005 1.24 HSPA8 heat shock 70kDa protein 8 1420622_a _at 0.004 1.12 PDGFD platelet derived growth factor D 1426319_a t 0.012 1.30 PIK3R1 phosphoinositide-3-kinase, regulatory subunit 1 (alpha) 1425514_a t 0.003 1.69 WASL Wiskott-Aldrich syndrome-like 1426777_a _at 0.007 2.79 Wnt/ -catenin Signaling Affymetrix ID pvalue FC CDH2 cadherin 2, type 1, N-cadherin 1418815_a t 0.010 1.36 CREBBP CREB binding protein 1435224_a t 0.014 1.22 CSNK1A1 casein kinase 1, alpha 1 1424827_a _at 0.008 1.20 CSNK1E casein kinase 1, epsilon 1417176_a t 0.012 2.09 CSNK2A1 casein kinase 2, alpha 1 polypeptide 1419038_a _at 0.009 5.56 CSNK2A2 casein kinase 2, alpha prime polypeptide 1453099_a 0.022 2.16 112

PAGE 113

t GSK3B glycogen synthase kinase 3 beta 1437001_a t 0.009 6.41 MAP3K7 mitogen-activated prot ein kinase kinase kinase 7 1426627_a t 0.007 1.24 NLK nemo-like kinase 1419112_a t 0.004 1.97 PPM1L protein phosphatase 1 (formerly 2C)-like 1438012_a t 0.007 2.24 PPP2R5C protein phosphatase 2, regulatory subunit B', gamma isoform 1434206_s _at 0.008 1.44 PPP2R5E protein phosphatase 2, regula tory subunit B', epsilon isoform 1428463_a _at 0.006 1.47 SOX11 SRY (sex determining region Y)-box 11 1436790_a _at 0.012 1.14 Decreasing SAPK/JNK Signaling Affymetrix ID pvalue FC FADD Fas (TNFRSF6)-associated via death domain 1416888_a t 0.002 1.40 GNG11 guanine nucleotide binding protein (G protein), gamma 11 1448942_a t 0.006 1.15 RIPK1 receptor (TNFRSF)-interacting serine-threonine kinase 1 1449485_a t 0.008 1.14 Table 4-1 Continued Calcium Signaling Affymetrix ID pvalue FC ATP2B3 ATPase, Ca++ trans porting, plasma membrane 3 1442645_a t 0.009 -1.2 CHRNA5 cholinergic receptor, nicotinic, alpha 5 1442035_a t 0.016 1.18 HTR3A 5-hydroxytryptamine (serotonin) receptor 3A 1418268_a t 0.022 1.12 RYR1 ryanodine receptor 1 1427306_a t 0.008 1.19 The pathways with overrepresentation of genes that were observed to increase or decrease expression in ER KO Oil treated mice. The p-valuse is calculated from a right-talied Foshers Exact T Table 4-2 The 22 genes involved in synapse in ER KO Oil treated mice Symbol Description Affymetrix p-value Fold Change CADM1 cell adhesion molecule 1 1417378_at 0.014 1.16 CAMK2A calcium/calmodulin-dependent protein kinase II alpha 1442707_at 0.018 2.66 113

PAGE 114

CDH2 cadherin 2, type 1, N-cadherin (neuronal) 1418815_at 0.010 1.36 CHRNA5 cholinergic receptor, nicotinic, alpha 5 1442035_at 0.016 -1.18 DLG2 discs, large homolog 2 (Drosophila) 1437927_at 0.011 1.35 DOK7 docking protein 7 1434812_s_at 0.008 -1.13 DTNA dystrobrevin, alpha 1425292_at 0.001 1.29 GABRA4 gamma-aminobutyric acid (GABA) A receptor, alpha 4 1429330_at 0.005 2.04 GPHN gephyrin 1426462_at 0.015 1.18 GRIA1 glutamate receptor, ionotropic, AMPA 1 1448972_at 0.011 2.20 GRM3 glutamate receptor, meta botropic 3 143013 6_at 0.002 1.52 HTR3A 5-hydroxytryptamine (serotonin) receptor 3A 1418268_at 0.022 -1.12 ITSN1 intersectin 1 (SH3 domain protein) 1425899_a_at 0.009 1.17 KCNMA1 potassium large conducta nce calcium-activated channel, subfamily M, alpha member 1 1424848_at 0.012 4.12 MYH9 myosin, heavy chain 9, non-muscle 1417472_at 0.008 1.25 NLGN1 neuroligin 1 1437160_at 0.022 1.31 NRXN1 neurexin 1 1428240_at 0.021 2.06 PCLO piccolo (presynaptic cytomatrix protein) 1452423_at 0.015 1.46 RIMS1 regulating synaptic membrane exocytosis 1 1438305_at 0.020 1.46 RPS6KB1 ribosomal protein S6 kinase, 70kDa, polypeptide 1 1460705_at 0.020 1.42 SNAP29 synaptosomal-associated protein, 29kDa 1423356_at 0.008 1.21 The Affymetrix probe identifier, gene symbol, gene description, t -test p-value and fold change are provided for genes of synaptic component s that are increasing and decreasing in ER KO Oil treated mice Table 4-3 Genes involved in RAR Activation and PPAR that are significantly altered in WT EB treated and ER KO Oil treated mice WT Oil vs. WT EB WT Oil vs. ER KO Oil RAR Activation p-value p-value CREBBP 0.009 CREBBP 0.014 PIK3R1 0.020 PIK3R1 0.003 SNW1 0.023 MED1 0.004 SMAD4 0.012 SMAD4 0.015 NCOR1 0.021 NCOR1 0.014 PRKCA 0.003 SMAD1 0.009 PPARGC1A 0.025 PPARGC1A 0.010 CSNK2A2 0.020 CSNK2A2 0.022 PNRC1 0.020 PNRC1 0.005 114

PAGE 115

JUN 0.004 CSNK2A1 0.009 NCOA1 0.005 DUSP1 0.022 NRIP1 0.017 NRIP1 0.006 PRKACB 0.021 PTEN 0.003 PPAR Signaling p-value p-value CREBBP 0.009 CREBBP 0.014 JUN 0.004 MED1 0.004 NCOR1 0.021 NCOR1 0.014 MAPK1 0.024 HSP90AA1 0.022 NCOA1 0.005 PDGFD 0.012 PDGFB 0.021 KRAS 0.013 PPARGC1A 0.025 PPARGC1A 0.010 NRIP1 0.017 NRIP1 0.006 MAP3K7 0.020 MAP3K7 0.007 Genes involved in RAR Activation and PPAR that ar e significantly altered in WT EB treated and ER KO Oil treated mice Table 4-4 The 191 genes significant in WT EB treated and ER KO Oil treated mice WT Oil vs. WT EB WT Oil vs. ER KO Oil Symbol Description p-value FC p-value FC ADSL adenylosuccinate lyase 0.005 -1.14 0.014 -1.15 ALKBH3 alkB, alkylation repair homolog 3 (E. coli) 0.022 -1.13 0.007 -1.18 APRT adenine phosphoribosyltransferase 0.024 -1.10 0.006 -1.14 ARHGAP5 Rho GTPase activating protein 5 0.021 -1.15 0.020 1.67 ASCC1 activating signal cointegrator 1 complex subunit 1 0.014 -1.19 0.013 -1.18 ATXN10 ataxin 10 0.018 -1.09 0.006 -1.108 BLVRB biliverdin reductase B (flavin reductase (NADPH)) 0.019 -1.13 0.019 -1.144 C19ORF62 chromosome 19 open reading frame 62 0.004 -1.14 0.022 -1.11 Table 4-4 Continued WT Oil vs. WT EB WT Oil vs. ER KO Oil Symbol Description p-value FC p-value FC C1QTNF2 C1q and tumor necrosis factor related protein 2 0.004 -1.32 0.008 -1.34 C1ORF35 chromosome 1 open reading frame 35 0.023 -1.13 0.020 -1.18 C6ORF134 chromosome 6 open reading frame 134 0.006 -1.34 0.020 -1.20 C9ORF64 chromosome 9 open reading frame 64 0.004 -1.12 0.023 -1.12 CBX5 chromobox homolog 5 (HP1 alpha homolog, Drosophila) 0.002 -1.12 0.017 1.48 CCBL1 cysteine conjugate-beta lyase, cytoplasmic 0.008 -1.26 0.021 -1.26 CCDC134 coiled-coil domain containing 134 0.021 -1.07 0.013 -1.10 CCNT2 cyclin T2 0.004 -1.55 0.004 -1.51 CDON Cdon homolog (mouse) 0.001 -1.19 0.006 -1.20 CYB561D2 cytochrome b-561 domain containing 2 0.018 -1.13 0.022 -1.14 DHX35 DEAH (Asp-Glu-Ala-His) box polypeptide 35 0.006 -1.18 0.015 -1.19 EGFL7 EGF-like-domain, multiple 7 0.005 -1.23 0.022 -1.22 115

PAGE 116

FADD Fas (TNFRSF6)-associated via death domain 0.003 -1.30 0.002 -1.40 FAM113A family with sequence similarity 113, member A 0.007 -1.12 0.024 -1.13 GJB2 gap junction protein, beta 2, 26kDa 0.003 -1.56 0.009 -1.44 GMPPA GDP-mannose pyrophosphorylase A 0.017 -1.13 0.017 -1.15 GNG11 guanine nucleotide binding protein (G protein), gamma 11 0.001 -1.17 0.006 -1.15 GSTM2 glutathione S-transferase mu 2 (muscle) 0.016 -1.16 0.006 -1.22 HPCA hippocalcin 0.017 -1.15 0.017 -1.18 HS1BP3 HCLS1 binding protein 3 0.023 -1.09 0.015 -1.14 HSPA8 heat shock 70kDa protein 8 0.002 -1.36 0.004 1.123 IFITM3 interferon induced transmembrane protein 3 (1-8U) 0.006 -1.30 0.019 -1.29 KCTD13 potassium channel tetramerisation domain containing 13 0.007 -1.14 0.020 -1.14 LUC7L2 LUC7-like 2 (S. cerevisiae) 0.023 -1.17 0.018 2.83 METTL2B methyltransfer ase like 2B 0.016 -1.25 0.00 5 -1.35 MVD mevalonate (diphospho) decarbo xylase 0.014 -1 .25 0.01 0 -1.29 NAT6 N-acetyltransferase 6 (GCN5-re lated) 0.009 -1 .14 0.02 0 -1.15 NSD1 nuclear receptor binding SET domain protein 1 0.000 -1.19 0.019 -1.07 ORAI1 ORAI calcium release-activated calcium modulator 1 0.011 -1.23 0.001 -1.28 PDLIM7 PDZ and LIM domain 7 (enigma) 0.016 -1.32 0.013 -1.24 PLEKHG2 pleckstrin homology domain containing, family G (with RhoGef domain) member 2 0.022 -1.13 0.013 -1.13 POLD2 polymerase (DNA directed), delta 2, regulatory subunit 50kDa 0.007 -1.15 0.014 -1.16 PORCN porcupine homolog (Drosophila) 0.019 -1.20 0.014 1.17 RELB v-rel reticuloendotheliosis viral oncogene homolog B 0.015 -1.16 0.004 -1.24 RGS10 regulator of G-protein signaling 10 0.022 -1.09 0.011 -1.12 RPS17 ribosomal protein S17 0.023 -1.17 0.018 -1.24 SCAMP3 secretory carrier membrane protein 3 0.024 -1.10 0.022 -1.11 Table 4-4 Continued WT Oil vs. WT EB WT Oil vs. ER KO Oil Symbol Description p-value FC p-value FC TAGLN2 transgelin 2 0.005 -1.19 0.017 -1.13 SMYD2 SET and MYND domain containing 2 0.005 -1.14 0.018 -1.12 SORD sorbitol dehydrogenase 0.006 -1.19 0.005 -1.19 TARBP2 TAR (HIV-1) RNA binding protein 2 0.005 -1.23 0.017 -1.22 THYN1 thymocyte nuclear protein 1 0.018 -1.12 0.006 -1.16 TNFAIP8L1 tumor necrosis factor, alpha-induced protein 8-like 1 0.004 -1.13 0.007 -1.13 ZFAND2B zinc finger, AN1-type domain 2B 0.018 -1.13 0.017 -1.16 ABL2 v-abl Abelson murine leukemia viral oncogene homolog 2 (arg, Abelson-related gene) 0.016 1.09 0.020 2.162 ACSL3 acyl-CoA synthetase long-chain family member 3 0.006 1.29 0.002 1.34 AP2B1 adaptor-related protein complex 2, beta 1 subunit 0.022 1.52 0.005 1.52 116

PAGE 117

APH1B anterior pharynx defective 1 homolog B (C. elegans) 0.021 1.18 0.005 1.43 AR androgen receptor 0.002 1.29 0.011 1.31 ARIH1 ariadne homolog, ubiquitin-conjugating enzyme E2 binding protein, 1 (Drosophila) 0.022 1.28 0.010 1.31 ASB7 ankyrin repeat and SOCS box-containing 7 0.003 1.19 0.017 1.43 ASH1L ash1 (absent, small, or homeotic)-like (Drosophila) 0.005 1.14 0.005 1.36 ATP2B1 ATPase, Ca++ transporting, plasma membrane 1 0.024 1.34 0.011 3.73 C10ORF46 chromosome 10 open reading frame 46 0.021 1.10 0.019 1.27 CAND1 cullin-associated and neddylationdissociated 1 0.011 1.15 0.017 1.17 CBX3 chromobox homolog 3 (HP1 gamma homolog, Drosophila) 0.017 1.18 0.006 1.24 CCAR1 cell division cycle and apoptosis regulator 1 0.008 1.63 0.016 1.87 CCNT1 cyclin T1 0.004 1.28 0.023 1.29 CLOCK clock homolog (mouse) 0.002 1.33 0.019 1.28 CNKSR2 connector enhancer of kinase suppressor of Ras 2 0.008 1.21 0.001 1.33 CPEB3 cytoplasmic polyadenylation element binding protein 3 0.005 1.71 0.013 1.87 CREB1 cAMPresponsive element binding protein1 0.004 1.51 0.003 1.83 CREBBP CREB binding protein 0.009 1.17 0.014 1.22 CTNND2 catenin (cadherin-associ ated protein), delta 2 (neural plakophilin-related arm-repeat protein) 0.017 1.13 0.023 1.18 DAB1 disabled homolog 1 (Drosophila) 0.024 1.10 0.012 1.85 DIO2 deiodinase, iodothyronine, type II 0.006 1.45 0.014 1.23 DKC1 dyskeratosis congenita 1, dyskerin 0.015 1.15 0.017 1.22 DLG2 discs, large homolog 2 (Drosophila) 0.015 1.31 0.011 1.35 DPH5 DPH5 homolog (S. cerevisiae) 0.020 1.26 0.003 1.41 DTNA dystrobrevin, alpha 0.012 1.24 0.001 1.29 Table 4-4 Continued WT Oil vs. WT EB WT Oil vs. ER KO Oil Symbol Description p-value FC p-value FC EIF3A eukaryotic translation initiation factor 3, subunit A 0.008 1.24 0.002 1.38 EIF2S1 eukaryotic translation initiation factor 2, subunit 1 alpha, 35kDa 0.004 1.86 0.019 1.68 EIF2S3 eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa 0.011 1.15 0.022 1.15 EIF5 eukaryotic translation initiation factor 5 0.014 1.55 0.007 1.88 EPRS glutamyl-prolyl-tRNA synthetase 0.015 1.58 0.011 1.87 ESF1 ESF1, nucleolar pre-rRNA processing protein, homolog (S. cerevisiae) 0.002 1.64 0.003 1.97 FAM107A family with sequence similarity 107, member A 0.012 1.20 0.016 1.12 FRYL FRY-like 0.009 1.40 0.021 1.51 FUT9 fucosyltransferase 9 (alpha (1,3) fucosyltransferase) 0.025 2.13 0.002 4.20 117

PAGE 118

G3BP2 GTPase activating protein (SH3 domain) binding protein 2 0.018 1.06 0.010 2.36 GABRA4 gamma-aminobutyric acid (GABA) A receptor, alpha 4 0.007 1.73 0.005 2.04 GIGYF2 GRB10 interacting GYF protein 2 0.003 1.18 0.010 1.21 HCCS holocytochrome c synthase (cytochrome c heme-lyase) 0.012 1.17 0.023 1.22 HEXIM1 hexamethylene bis-acetamide inducible 1 0.00 6 1.14 0. 021 1.15 HIP1 huntingtin interacting protein 1 0.021 1.15 0.005 1.24 HMG1L1 high-mobility group box 1-like 1 0.005 1.08 0.018 1.55 HTRA1 HtrA serine peptidase 1 0.015 1.27 0.018 1.21 ICK intestinal cell (MAK-like) kinase 0.009 1.32 0.011 1.41 IDE insulin-degrading enzyme 0.024 1.33 0.011 1.56 IGF1R insulin-like growth factor 1 receptor 0.001 1.45 0.012 1.56 ITFG1 integrin alpha FG-GAP repeat containing 1 0.023 1.14 0.024 1.16 JARID1B jumonji, AT rich interactive domain 1B 0.018 1.51 0.004 1.95 KCNA1 potassium voltage-gated channel, shakerrelated subfamily, member 1 (episodic ataxia with myokymia) 0.010 1.09 0.012 2.76 KHSRP KH-type splicing regulatory protein 0.004 1.79 0.013 1.92 KIAA1128 KIAA1128 0.008 1.15 0.003 2.54 KIAA1881 KIAA1881 0.005 1.32 0.012 1.16 KLF9 Kruppel-like factor 9 0.001 1.17 0.024 1.12 KLHL9 kelch-like 9 (Drosophila) 0.005 1.18 0.018 1.18 LIMCH1 LIM and calponin homology domains 1 0.012 1.45 0.022 1.54 MAPRE1 microtubule-associated protein, RP/EB family, member 1 0.016 1.43 0.008 1.60 MARCH7 membrane-associated ring finger (C3HC4) 7 0.001 1.14 0.009 1.88 MARCKS myristoylated alanine-rich protein kinase C substrate 0. 013 1.61 0.014 1.66 MAT2A methionine adenosyltransferase II, alpha 0.009 1.49 0.025 1.55 Table 4-4 Continued WT Oil vs. WT EB WT Oil vs. ER KO Oil Symbol Description p-value FC p-value FC MBOAT2 membrane bound O-acyltransferase domain containing 2 0.005 1.22 0.003 1.38 MERTK c-mer proto-oncogene tyrosine kinase 0.006 1.48 0.003 1.41 MTPN myotrophin 0.019 1.20 0.004 1.29 MYH9 myosin, heavy chain 9, non-muscle 0.009 1.16 0.008 1.25 NAPB N-ethylmaleimide-sensitive factor attachment protein, beta 0.017 1.26 0.023 1.81 NAT13 N-acetyltransferase 13 (GCN 5-related) 0.00 1 1.10 0. 018 1.09 NCOR1 nuclear receptor co-repressor 1 0.021 1.42 0.014 2.77 NEK7 NIMA (never in mitosis gene a)-related kinase 7 0.010 1.43 0.018 1.47 NLK nemo-like kinase 0.023 1.49 0.004 1.97 NRIP1 nuclear receptor interacting protein 1 0.017 1.19 0.006 2.11 NRXN3 neurexin 3 0.019 1.34 0.010 1.47 118

PAGE 119

NUCKS1 nuclear casein kinase and cyclindependent kinase substrate 1 0.011 1.11 0.000 1.24 OPCML opioid binding protein/cell adhesion molecule-like 0.016 1.15 0.006 1.18 PAQR5 progestin and adipoQ receptor family member V 0.001 1.26 0.016 1.24 PCDH17 protocadherin 17 0.014 1.33 0.004 1.79 PCNP PEST proteolytic signal containing nuclear protein 0.006 1.27 0.008 1.35 PGM2L1 phosphoglucomutase 2-like 1 0.008 1.21 0.007 1.23 PHIP pleckstrin homology domain interacting protein 0.024 2.39 0.004 3.95 PIK3R1 phosphoinositide-3-kinase, regulatory subunit 1 (alpha) 0.020 1.26 0.003 1.69 PIP4K2A phosphatidylinositol-5-phosphate 4kinase, type II, alpha 0.001 1.19 0.013 1.16 PITPNC1 phosphatidylinositol transfer protein, cytoplasmic 1 0.024 1.22 0.014 1.41 PLXNA2 plexin A2 0.012 1.12 0.016 1.42 PNRC1 proline-rich nuclear receptor coactivator 1 0.020 1.18 0.005 1.26 PPARGC1A peroxisome proliferator -activated receptor gamma, coactivator 1 alpha 0.025 1.22 0.010 1.35 PPAT phosphoribosyl pyrophosphate amidotransferase 0.007 1.18 0.020 1.22 PRKG2 protein kinase, cGMP-dependent, type II 0.008 1.22 0.020 1.26 PRPF38A PRP38 pre-mRNA processing factor 38 (yeast) domain containing A 0.008 1.82 0.002 2.1 PTGES3 prostaglandin E synthase 3 (cytosolic) 0.002 1.35 0.002 1.54 PTP4A1 protein tyrosine phosphatase type IVA, member 1 0.018 1.14 0.023 1.17 PUM2 pumilio homolog 2 (Drosophila) 0.001 1.13 0.004 1.11 RB1CC1 RB1-inducible coiled-coil 1 0.012 1.15 0.004 2.04 RHOU ras homolog gene family, member U 0.016 1.37 0.015 1.45 RIN2 Ras and Rab interactor 2 0.006 1.47 0.005 1.34 ROCK2 Rho-associated, coiled-coil containing protein kinase 2 0. 004 1.21 0.025 1.36 Tabe 4-4 Continued WT Oil vs. WT EB WT Oil vs. ER KO Oil Symbol Description p-value FC p-value FC RPGRIP1 retinitis pigmentosa GTPase regulator interacting protein 1 0.006 1.49 0.010 1.49 RPL34 ribosomal protein L34 0.001 1.11 0.011 1.08 RPL37A ribosomal protein L37a 0.019 1.08 0.001 -1.21 RPS6KB1 ribosomal protein S6 kinase, 70kDa, polypeptide 1 0.011 1.33 0.020 1.42 SAP30 Sin3A-associated protein, 30kDa 0.020 1.23 0.005 1.21 SCHIP1 schwannomin interacting protein 1 0.001 1.12 0.024 1.13 SDC4 syndecan 4 0.015 1.21 0.003 1.53 SEPHS2 selenophosphate synthetase 2 0.007 1.41 0.005 1.43 SESN3 sestrin 3 0.019 1.81 0.008 4.01 119

PAGE 120

SLC24A4 solute carrier family 24 (sodium/potassium/calcium exchanger), member 4 0.003 1.21 0.006 1.3 SLITRK4 SLIT and NTRK-like family, member 4 0.024 1.59 0.002 2.38 SMAD4 SMAD family member 4 0.012 1.24 0.015 1.42 SMC3 structural maintenance of chromosomes 3 0.002 1.15 0.022 1.13 SMEK2 SMEK homolog 2, suppressor of mek1 (Dictyostelium) 0.009 1.23 0.021 1.43 SNAP29 synaptosomal-associated protein, 29kDa 0.004 1.15 0.008 1.21 ST18 suppression of tumorigenicity 18 (breast carcinoma) (zinc finger protein) 0.014 1.24 0.003 1.23 SUZ12 suppressor of zeste 12 homolog (Drosophila) 0.011 1.27 0.020 1.34 SYNM synemin, intermediate filament protein 0.020 1.82 0.011 2.06 TARDBP TAR DNA binding protein 0.005 1.15 0.004 1.18 THOC2 THO complex 2 0.003 1.11 0.006 1.65 TMED9 transmembrane emp24 protein transport domain containing 9 0.007 1.13 0.014 1.17 TOP1 topoisomerase (DNA) I 0.003 1.18 0.015 1.19 TRIP12 thyroid hormone receptor inte ractor 12 0.02 2 1.09 0. 021 1.13 TROVE2 TROVE domain family, member 2 0.022 1.61 0.004 2.14 TSHZ1 teashirt zinc finger homeobox 1 0.021 1.18 0.016 1.33 UBE2D3 ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast) 0.012 1.15 0.024 1.20 UBXN4 UBX domain protein 4 0.007 1.23 0.007 1.29 USP15 ubiquitin specific peptidase 15 0.008 1.49 0.003 1.74 VEZF1 vascular endothelial zinc finger 1 0.005 1.13 0.005 1.16 WAC WW domain containing adaptor with coiled-coil 0.004 1.16 0.007 1.79 WASF3 WAS protein family, member 3 0.006 1.15 0.011 1.16 WDR12 WD repeat domain 12 0.008 1.25 0.000 1.56 ZC3H7B zinc finger CCCH-type containing 7B 0.008 1.48 0.015 1.36 ZNF148 zinc finger protein 148 0.016 1.18 0.013 2.19 ZNF451 zinc finger protein 451 0.021 1.16 0.021 1.48 The gene symbol, gene name, p-value and fold chan ge of genes that were significantly increasing an decreasing in WT EB vs WT Oil treated mice and ER KO Oil and WT Oil treated mice. 120

PAGE 121

Figure 4-1. Hippocampal gene expressi on is sensitive to the loss of ER Illustration of the total number of genes signific antly (p<0.025) increasi ng and decreasing in ER KO Oil treated and ER KO Oil treated mice compared to WT Oil treated. ER KO Oil treated mice exhibited a number of probes above chance, with the majority (80%) decreasing. 121

PAGE 122

Figure 4-2. Fold change of the 674 genes significantly increasing and decreasing in ER KO Oil treated mice compared to WT Oil treated mice. 122

PAGE 123

Figure 4-3. Differential effect of EB treatment in WT and ERKO mice. Illustration of the total number of genes signific antly (p<0.025) increasing and decreasing in WT EB, ER KO EB and ER KO EB treated mice compared to Oil treated counterparts. 123

PAGE 124

Figure 4-4. Venn Diagram of genes differentially e xpressed in WT Oil vs WT EB and WT Oil vs ER KO Oil. The number in parentheses repres ents genes with expression levels in opposite directions. 124

PAGE 125

Figure 4-5. ERKO mice display similar gene expression levels after an acute EB treatment as WT mice. Illustration of the total number of genes significantly (p<0.025) increasing and decreasing in ER KO EB and ER KO EB treated mice compared to WT EB treated. The number of gene s significantly different be tween ERKO EB treated and WT EB treated is below chance. 125

PAGE 126

Figure 4-6. EB treatment enhances basal ac tivity in ERKO mice. Comparison of genes significantly differentially expressed in ERKO mice treated with Oil and EB compared to WT Oil treated mice. Illu stration of the total number of genes significantly (p<0.025) increas ing and decreasing in ER KO EB and ER KO EB treated mice compared to WT Oil treated. 126

PAGE 127

Figure 4-7. ERKO mice display m onotonic response to EB treat ment. The average percent change in gene expression of ER KO and ER KO relative to WT Oil treated mice across treatment groups. While ER KO mice show an intial change in gene expression without EB treatment, ER KO display an increase in gene expre ssion after EB treatment. Additionaly, ER KO and ER KO mice regardless of treatment displa y similar gene expression levels when those the level of gene expression decreases. Erro r bars represent standard error of the mean. 127

PAGE 128

128

PAGE 129

Figure 4-8. ER mRNA is upregulated in ER KO mice. Microarray expr ession levels and Real time (RT)-PCR analysis of ER mRNA relative to WT Oil treated mice. 129

PAGE 130

130 Figure 4-9. Validation of microarray results for 7 genes using RT-PCR. The bars represent the mean fold change in the expression for ER KO Oil treated and WT EB treated compared to mean of WT Oil treate d animals using RT-PCR (filled bars) and microarray analysis (open bars).

PAGE 131

CHAP TER 5 CONCLUSION Summary and Discussion Together classic and non-classic mechanisms contribute to estroge ns trophic influence within the hippocampus; for example, estrogen has been shown to promote proliferation of neurons in the adult dentate gyru s, block apoptotic signal cascad es to encourage neuron survival, and induce dendritic growth in the hippocampus (Jover et al., 2002; Tana pat et al., 1999). An influential discovery was the finding that hi ppocampal CA1 cells displa y a fluctuating spine density coupled to the estrus cy cle with the spine density peaking at proestrus, when estrogen levels have peaked (Woolley et al., 1990). Gould et al. (1990) showed that ovariectomy for 6 days results in decrease of dendr itic spine density of hippocamapal CA1 pyramidal cells. At the same time it was shown that estrogen can preven t ovariectomy induced decrease in spine density (Gould et al., 1990). Woolley and McEwen (1993) further demonstrated that estrogen can reverse the ovariectomy induced decrease in spin e density 48-72 hours after treatment. This work suggests that estrogen has long-term possibly genomic influences th at out lasts the presence of estrogen in the plasma. Furthermore, estrogens trophic responses have been shown to contribute to synaptic growth and strength. For example, GAP-43 (also known as B-50), a presynaptic protein associated with growth and regeneration of a xons, is increased by estrogen in preoptic area (Shughrue and Dorsa, 1993). Estrogen increases th e expression of insulin like growth factor-1 (IGF-1) and interacts with IGF-1 to induce dendr itic growth and synaptic plasticity (CardonaGomez et al., 2000). Toran-Allerand et al. (1996) reported that es trogen receptors colocalize with neurotrophin receptors; p75, trkA, and trkB in th e basal forebrain. However, the direction in which estrogen influences nerve growth factor (NGF) is still unclear (G ibbs, 1998; Gibbs et al., 131

PAGE 132

1994; Scully and Otten, 1995). W hile, estrogen has also been shown to incr ease the expression of NGF in the hippocampus (Simpkins et al., 1997), Gibbs (1998) found no changes in NGF mRNA in the hippocampus after estrogen treatment. These conflicting results may be due to the system being used (in vitro versus in vivo), time point (20 minutes ve rsus 24 hours), or product being examined (protein versus mRNA) and may also represent a homeostatic control over certain signaling cascades by estrogen. The ab ility to turn on or turn off particular genes/protein and cascades may help regulate the system. Together these results indicat e that estrogen, possibly throug h transcription, has trophic influences involved in the regula tion of the growth of dendritic sp ines, synapse number, and cell survival. The trophic influences are likely important for understanding estrogens effects in delaying brain aging; unfortunate ly, much of the research has been conducted in young animals and cell cultures. Therefore, it was estentially to determine how estrogen effects middle-aged and aged animals, the functional relevance of ER and ER and to determine the potential mechanism mediating estrogens abil ity to reverse age related changes particularly in areas of the brain sensitive to aging processes, such as the hippocampus In this study we used a combination of beha vioral testing and micr oarray analysis to determine age-related alterati on in hippocampal gene expres sion in young, middle-aged, and aged animals. It was our hypothesis that EB treatment initiated at middle-age will maintain hippocampal function and gene expression. Moreove r, we hypothesized that the alteration of receptor ratio is contributing to reduced responses in aged animals; this theory was tested in ERKO mice. Middle-age is a time of vulnerability, when the hippocampus begins to undergo age-related alteration in gene expression, CA 2+ homeostasis, decrease in synaptic proteins, shift in 132

PAGE 133

phosphate/kinase activity (Adam s et al., 2008; Blal ock et al., 2003) (Foste r and Kumar, 2002). It has been postulated that middle-age is a time when treatment to fight age-related changes in the hippocampus should be initiated (Maki, 2006; Sherwin, 2007). Accordingly, when we initiated EB treatment in middle-age animals they main tained cognitive function after long-term EB treatment by performing better on MW M than middle-aged oil treated counterparts (Chapter 2). In addition, we found that long-term cyclic treat ment of EB could reve rse these age related changes in hippocampal transcription; incl uding the expression of genes involved in transcription, apoptosis/cell he alth, receptor/cell signaling, cell growth/structura l organization among others. The results suggest that EB trea tment initiated in middle-aged mice prevents cognitive decline and maintains youthful hippocampal transcriptional regulation. Similarly, microarray analyses reveal that after acute EB treatment middle-age animals maintain youthful hippocampal gene expression. However, it is unclear how long treatment would need to be continued to maintain the cognitive benefits seen in middle-age and therefore important to determine if long-term cyclic treatm ent initiated at middle-ag ed and continued into the later part of life will remain neuroprotective. Thus, we will need to maintain middle-aged mice on EB treatments through late life a nd test their cognitive function (MWM) and hippocampal gene expression (microarray analysis). Given recent reports that EB treatment initiated in postmenopausal women will not improve cognition (Espeland et al ., 2004), or increase dendritic spine density (a marker of learning and memory) (Adams et al., 2001b), it may be surprising that aged female mice maintained a transcriptional response to a single injection of EB 12hr after treatment. However, the aged hippocampus has been found to respond to EB treatment by reversing age-related increase in L-type voltage gated calcium channe ls (Brewer et al., 2009) a nd increasing synaptic 133

PAGE 134

NMDAR 2B levels (Adam s et al ., 2004). These processes play an important role in synaptic plasticity but the effects are st ill not enough to revers e age-related cognitive decline. Therefore, EB treatment alone is not e nough to restore hippocampal functi on and results suggest other mechanisms contributing to the age-related de crease in gene expression regulation by EB. Our results found that aged animals display a response to EB treatment by an increase of genes involved in rapid estr ogen response pathways, while th e effects of EB on young and MA increased genes involved in synapses. This shif t away from an increase genes involved in synapse may explain why aged animals are unable to increase dendritic spine density. Moreover, differential gene expression in aged mice may be a compensatory mechanism for changes in estrogen signaling needed to prime the system fo r subsequent responses to EB (Yun et al., 2007), suggesting the aged animals do not have the necessary kinases, phosphatases, scaffolding proteins, coregulators or receptors ready for signaling (Foster, 2005). Notably, the reduced response in gene expression and a lteration in synaptic responses to EB in aged mice coincides with age-related decrease in ERs (Mehra et al., 2005; Thakur and Sharma, 2007). This led us to hypothesize that the decrease of ERs is contributing to the truncated response to EB in the aged hippocampus. To test the theory that decrease of ERs w ill affect hippocampal gene expression we used ERKO mice treated with and without EB. Chapte r 4 provided evidence that the receptor ratio impacts hippocampal gene expression even w ith out circulating EB. More specifically, ER KO Oil treated mice displayed an increase of genes involved in neuroprotection, while ER KO Oil treated mice showed little change in gene expr ession compared to WT Oil treated. Moreover, ER KO mice displayed an increase in the expres sion of genes involved in synapse suggesting that unregulated ER is influencing synaptic func tion and supporting reports that ER is 134

PAGE 135

involved in synaptic plasticity(A dam s and Morrison, 2003). Therefore, an alteration of receptor ratio where the levels of ER are higher than ER promotes the expression of genes involved in synapse, suggesting that altering the ratio of ER and ER my be a compensatory mechanism to help maintain EBs neuroprotective properties. Similarly, neuroprotective effects have been seen ER KO mice following middle cerebral artery occlusion (MCAO) by displaying less total infarct volume. Moreover, increased levels of ER in cortex immediately following MCAO correlate with smaller infarct volume (Dubal et al., 2006). These results suggest that the levels of ERs are altered in re sponse to injury in the cortex and increasing the level of ER compared to ER will promote neuroprotective pathways. An increase in the level of either ER or ER can impact hippocampal function by focusing the estrogen response on different signaling pathway. For example, ER has been found to solely interact with metabotropic glutamate receptor (m GLuR) 1a but both ERs interact with mGlur2/3 receptors. Therefore an increase in ER could lead to an increase in mGLuR1a receptor activation and subsequent activation of CREB. Conversel y, an age-related decrease of ER could promote the activation of mGlur2/3 a nd lead to a decrease in CREB phosphorylation. Additionally, age-related decrease in NMDARs and AMPARs can also be contributing to reduced response to EB treatment in aged an imals. Finally, our results found that young ER KO and ER KO EB treated mice displayed similar gene expression levels as WT EB treated mice, suggesting other mechanisms (ERX, mER, GPR30) are contributing to estrogen signaling and the impact these receptors have in the aging hippocampus still needs to be determined. Therefore, age-related decrease in an estrogen receptor combined with age-related decrease in synaptic proteins is likely contributing to reduced and shifted response in aged animals. 135

PAGE 136

The data presented in this disse rtation used gene expression an alysis as a novel approach to com pare EB effects in the aging hippocampus. The results reveal EB increases the expression of genes involved in neuroprote ction through middle-age. Howeve r, the regulation of gene expression in aged animals is reduced and shif ted toward rapid signaling pathways, which may represent compensation mechanism due to the di srupted estrogen receptor signaling. Together, these results suggest that age-re lated decrease of estrogen recept ors are contributi ng to the gene expression changes found in aged mice. Therefore, more research is needed to determine how the regualtion of gene expression effects hippocampal function and how the results can be translated into improved treatment strategies for women. Microarray Relaiblity and Scientific Significance The use of microarrays has grown over the past 20 years and with it comes improved technology. Microarrays enable a researcher to scan thousands of gene expression levels simultaneously and can result in important biological findings. However, microarray data can be limited by poor study design and interpretation; th erefore, microarrays are not the end all experiment but are just the begi nning observation. Moreover, key steps can be taken to improve microarray reliability and scientific integrity. These key steps include; a clear objective hypothesis, large sample size, and appropriate in terpretation. I will address these key steps and discuss how I implemented them into my own ex periments to improve the reliability of my microarray studies. A scientific experiment begins by produci ng a clear and concise hypothesis. Microarray experiments are often criticized for not being hypothesis driven experiments but rather discovery driven. I argue that gene expres sion analysis can be hypothesis dr iven. A scientific experiment asks a question, tests that question and determines if your question was true or false. In our first microarray experiment we asked the simply question, Does estrogen treatment reverse age136

PAGE 137

related changes in gene expression? W e co mpared the gene expression in young and middleaged mice and found that estrogen treatment did reverse age-related changes in transcription. That leads us to the why? Even though we have proved our hypothesis, answ ering the why is still difficult and needs further testing, beyond RT-PCR validation. Therefore, micr oarray analysis is the starting point to future more in depth studies. Another serious problem with microarrays ca n be sample size. The initial microarray experiments were plagued with many problems, th e biggest was the small sample size used in the analysis. Using a small sample size will increase the likelihood of biological variablilty and outliers due to experimental erro r. Due to the large expense of microarray analysis, it is difficult to run large studies. However, appropriate sa mple numbers are necessary to obtain reliable scientific data. Once the data has been collected accordingly, the results of the data must be appropriately interpreted. It is important to re mind the reader what you are deal ing with. Microarrays indirectly measure the levels of thousands of RNA levels a nd with the measure of thousands of genes will also come error. One will control for error but wi th any scientific test error is possible and in testing tens of thousands of genes a few thousand genes may be false posi tives (type II error). Furthermore, microarrays need to be validated an d for a publication or within one lab it is not feasible to validate thousands of genes. Therefore the vast majority of data will not be validated. Due to limited validation, the read er should understand that gene X has been found to increase or decrease in your test but further examination in it s role in a particular process is needed. Often researches find a significant change in Gene X and concluded that it is involve in memory. This interpretation is premature. While microa rray data gleams interesting insight on the 137

PAGE 138

potential role of a particular gene it cannot conclusively say that it is involved in anything. Additional tests and screening need to be done to conclusively state the role of Gene X. I have attem pted to reduce microarray variab ility by using larger sample size (n>5) and performing the isolation and processing of sample s myself, to reduce processing error. Also, I have focused our results on clustering of gene path ways that are significantly altered rather than changes in the expression of pa rticular genes. Given the potentia l error, 10% of my genes are likely false positives, if I had a pathway with 10 genes significantly altered by my treatment, one gene may be a false positive. However, one gene may be significantly altered but 9 genes are still significant in that pathway and that pathway is still significantly influenced by my treatment. Focusing my results and interpretation on pathwa y analysis has yielde d useful biological information and confers additional reliability in the statistical analysis. Future Directions Microarray studies enable a researcher to sc an thousands of potential estrogen responsive genes in a single test and pave the way for mo re in depth research but can also leave the researcher with more questions. The same is true of the current data. For example, by analyzing the entire mouse hippocampus we were unable to determine regional specificity of the gene expression changes. A recent microarray study in the mouse found 2% of the genes tested were differentially expressed between CA1 and CA 3, 1% between CA1 and DG, and 1% between CA3 and DG (Zhao et al., 2001). These result sugge st that there is differential gene expression between hippocampal regions; ther efore, future studies will employ in situ hybridization techniques to examine regional changes in gene expression. In this regard, I have compiled a list of genes that may be of interest to the lab for further explorati on of the regional response to EB 138

PAGE 139

in the hippocam pus (Table 5.1). These genes were chosen because they were found significantly altered between young oil treated and young EB treated (6hr) mice in Chapter 3 and Chapter 4. Utilizing KO mice is a valuable tool in estroge n research and has given us insight into the mechanisms of estrogen signaling; however, it is di fficult to determine if the effects seen are due to treatment in our animals or from developmenta l changes that occurred due to the lack of an ER. Our lab has shown that by viral mediated delivery of ER into ER KO mice restores cognitive function, suggesting the developmental loss of ER is not completely contributing to the behavior deficits seen grown mice. Theref ore, the results from the current KO study are probably not due to developmental loss of ERs. However, this issue can be avoided by blocking ERs in adult animals using antagonists. Addition ally, it is unclear if the results from KO study are from one receptor taking over the transcriptio nal activity of the othe r, another type of estrogen receptor or a non-estrogen receptor-s ignaling pathway influencing gene expression changes. The results presented in Chapter 4, ERKO EB treated mice display similar gene expression to WT EB treated, suggests a non-es trogen receptor mechanism contributing to the transcriptional response to EB treatment. To help determine other potential mechanisms contributing EB mediated gene expression we can use ER ER and GPR30 agonists and antagonist. Using microarray technology in combination with these pharmacological measures to compare gene expression activity in young, middl e-age and aged animals will help delineate changes in estrogen signaling path ways during aging. Moreover, to determine if the alteration of estrogen receptors are contributing to reduced response to EB in ag ed animals we need to alter the level of estrogen receptor in aged animals. This can be done using viral vector mediated delivery of ER and ER into the hippocampus of aged animal s. Therefore, we can determine if 139

PAGE 140

m aintaining the levels of ER ER or both will improve estr ogen responsiveness in aged animals and protect against age-related cognitive decline. Also, it would be interesting to use RNA interference to reduce the levels of ERs in th e entire hippocampus or specific regions of the hippocampus in young animals and see if they disp lay similar reduced res ponsiveness to EB as aged animals. Table 5-1 Genes significant after 6hr of EB treatment in young animals Chapter 3 Chapter 4 Y Oil vs Y EB 6hr WT Oil vs WT EB 6hr Affy ID Symbol Description pvalue FC pvalue FC 1436918_at 4932442E05RIK RIKEN cDNA 1810038L18 gene 0.00 1.31 0.00 1.27 1453529_at 6330418B08RIK RIKEN cDNA 6330418B08 gene 0.01 -1.13 0.01 -1.41 1452599_s_at AI413582 expressed sequence AI413582 0.01 -1.30 0.01 -1.15 1435768_at ARID4B AT rich interactive domain 4B (Rbp1 like) 0.01 1.11 0.02 1.15 1449622_s_at ATP6AP1 ATPase, H+ transporting, lysosomal accessory protein 1 0.00 -1.20 0.01 -1.08 1435397_at BC038156 cDNA sequence BC038156 0.02 1.24 0.02 1.19 1418660_at CLOCK circadian locomoter output cycles kaput 0.01 1.18 0.00 1.33 1428738_a_at D14ERTD449E DNA segment, Chr 14, ERATO Doi 449, expressed 0.00 -1.15 0.01 -1.21 1439986_at DGKI diacylglycerol kinase, iota 0.01 -1.19 0.00 -1.17 1421882_a_at ELAVL2 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B) 0.01 1.23 0.01 1.35 1427329_a_at IGH-6 immunoglobulin heavy chain 6 (heavy chain of IgM) 0.01 -1.13 0.01 -1.21 1429431_at IKZF5 zinc finger protein, subfamily 1A, 5 0.00 1.26 0.00 1.36 1451047_at ITM2A integral membrane protein 2A 0.02 -1.52 0.01 -1.32 1420276_x_at MMRN2 multimerin 2 0.01 -1.12 0.02 -1.12 1419077_at MPP3 membrane protein, palmitoylated 3 (MAGUK p55 subfamily member 3) 0.01 1.08 0.01 1.09 1452670_at MYL9 myosin, light polypeptide 9, regulatory 0.00 -1.26 0.00 -1.46 1415966_a_at NDUFV1 NADH dehydrogenase (ubiquinone) flavoprotein 1 0.01 -1.10 0.01 -1.12 1419127_at NPY neuropeptide Y 0.00 -1.15 0.01 -1.26 1424413_at OGFRL1 opioid growth factor receptor-like 1 0.00 1.23 0.00 1.19 1435486_at PAK3 P21 (CDKN1A)-activated kinase 3 0.02 1.15 0.01 1.14 140

PAGE 141

141 Table 5-1. Continued Y Oil vs Y EB 6hr WT Oil vs WT EB 6hr Affy ID Gene Symbol Description pvalue FC pvalue FC 1426658_x_at PHGDH 3-phosphoglycerate dehydrogenase 0.02 -1.23 0.01 -1.16 1423771_at PRKCDBP protein kinase C, delta binding protein 0.02 -1.15 0.01 -1.14 1437697_at RAD23A RAD23a homolog (S. cerevisiae) 0.01 -1.08 0.02 -1.23 1441737_s_at RASSF1 Ras association (R alGDS/AF-6) domain family 1 0.01 -1.21 0.02 -1.11 1416882_at RGS10 regulator of G-protein signalling 10 0.02 -1.11 0.02 -1.09 1418318_at RNF128 ring finger protein 128 0.00 1.20 0.01 1.28 1417508_at RNF19A ring finger protein (C3HC4 type) 19 0.01 1.15 0.00 1.21 1448845_at RPP25 ribonuclease P 25 subunit (human) 0.00 -1.25 0.01 -1.20 1417719_at SAP30 sin3 associated polypeptide 0.00 1.13 0.02 1.23 1457118_at SHC4 RIKEN cDNA 6230417E10 gene 0.00 1.62 0.01 1.16 1417954_at SST somatostatin 0.01 -1.39 0.01 -1.12 1456147_at ST8SIA6 ST8 alpha-N-acetyl-neuraminide alpha2,8-sialyltransferase 6 0.00 1.25 0.01 1.14 1420895_at TGFBR1 transforming growth factor, beta receptor I 0.02 1.17 0.01 1.29 1416890_at WDR74 WD repeat domain 74 0.00 -1.19 0.01 -1.11 1453156_s_at ZADH1 zinc binding alcohol dehydrogenase, domain containing 1 0.00 3.05 0.02 1.14 1437556_at ZFHX4 zinc finger homeodomain 4 0.02 1.27 0.02 1.18 1435188_at similar to chromosome 1 open reading frame 51 0.02 -1.22 0.00 -1.19

PAGE 142

LIST OF REFERE NCES Adams MM, Fink SE, Janssen WG, Shah RA, Mo rrison JH. 2004. Estrogen modulates synaptic N-methyl-D-aspartate receptor subunit dist ribution in the aged hippocampus. J Comp Neurol 474(3):419-26. Adams MM, Fink SE, Shah RA, Janssen WG, Hayashi S, Milner TA, McEwen BS, Morrison JH. 2002. Estrogen and aging affect the subcellu lar distribution of estrogen receptor-alpha in the hippocampus of female ra ts. J Neurosci 22(9):3608-14. Adams MM, Morrison JH. 2003. Estrogen and the ag ing hippocampal synapse. Cereb Cortex 13(12):1271-5. Adams MM, Oung T, Morrison JH, Gore AC. 2001a Length of postovariectomy interval and age, but not estrogen replacement, regulate N-me thyl-D-aspartate recep tor mRNA levels in the hippocampus of female ra ts. Exp Neurol 170(2):345-56. Adams MM, Shah RA, Janssen WG, Morrison JH. 2001b. Different modes of hippocampal plasticity in response to estrogen in young and aged female rats. Proc Natl Acad Sci U S A 98(14):8071-6. Adams MM, Shi L, Linville MC, Forbes ME, Long AB, Bennett C, Newton IG, Carter CS, Sonntag WE, Riddle DR and others. 2008. Calori c restriction and age affect synaptic proteins in hippocampal CA3 and spatial le arning ability. Exp Ne urol 211(1):141-9. Aenlle KK, Foster TC. 2009. Aging alters the expression of genes fo r neuroprotection and synaptic function following acute estradiol treatment. Hippocampus In Press. Aenlle KK, Kumar A, Cui L, Jackson TC, Foster TC. 2009. Estrogen effects on cognition and hippocampal transcription in middle-ag ed mice. Neurobiol Aging 30(6):932-45. Akama KT, McEwen BS. 2003. Estrogen stimulat es postsynaptic density-95 rapid protein synthesis via the Akt/protein kinase B pathway. J Neurosci 23(6):2333-9. Aydin M, Yilmaz B, Alcin E, Nedzvetsky VS, Sa hin Z, Tuzcu M. 2008. Effects of letrozole on hippocampal and cortical catecholaminergic neurotransmitter levels, neural cell adhesion molecule expression and spatial learning a nd memory in female rats. Neuroscience 151(1):186-94. Azcoitia I, Sierra A, Garcia-Segura LM. 1999. Neur oprotective effects of es tradiol in the adult rat hippocampus: interaction with insulin-like growth factor-I signalli ng. J Neurosci Res 58(6):815-22. Bading H, Ginty DD, Greenberg ME. 1993. Regulat ion of gene expression in hippocampal neurons by distinct calcium signalin g pathways. Science 260(5105):181-6. 142

PAGE 143

Barkhem T, Carlsson B, Nilsson Y, Enmark E, Gustafsson J, Nilsson S. 1998. Differential response of estrogen receptor alpha and es trogen receptor beta to partial estrogen agonists/antagonists. Mo l Pharmacol 54(1):105-12. Bednarski E, Ribak CE, Lynch G. 1997. Suppr ession of cathepsins B and L causes a proliferation of lysosomes and the formati on of meganeurites in hippocampus. J Neurosci 17(11):4006-21. Berno V, Amazit L, Hinojos C, Zhong J, Mancini MG, Sharp ZD, Mancini MA. 2008. Activation of estrogen receptor-alpha by E2 or EG F induces temporally distinct patterns of large-scale chromatin modification and mR NA transcription. PLoS ONE 3(5):e2286. Bi R, Foy MR, Thompson RF, Baudry M. 2003. E ffects of estrogen, age, and calpain on MAP kinase and NMDA receptors in female rat brain. Neurobiol Aging 24(7):977-83. Bimonte-Nelson HA, Singleton RS, Williams BJ, Granholm AC. 2004. Ovarian hormones and cognition in the aged female rat: II. progest erone supplementation re verses the cognitive enhancing effects of ovariectomy. Behav Neurosci 118(4):707-14. Bjornstrom L, Sjoberg M. 2005. Mechanisms of estrogen receptor signaling: convergence of genomic and nongenomic actions on target genes. Mol Endocrinol 19(4):833-42. Blalock EM, Chen KC, Sharrow K, Herman JP Porter NM, Foster TC, Landfield PW. 2003. Gene microarrays in hippocampal aging: statistical profiling iden tifies novel processes correlated with cognitive impairment. J Neurosci 23(9):3807-19. Boulware MI, Weick JP, Becklund BR, Kuo SP, Groth RD, Mermelstein PG. 2005. Estradiol activates group I and II metabotropic glutam ate receptor signaling, leading to opposing influences on cAMP response element-bi nding protein. J Neurosci 25(20):5066-78. Bowman RE, Ferguson D, Luine VN. 2002. Effects of chronic restraint st ress and estradiol on open field activity, spatial memory, and monoaminergic neurotransmitters in ovariectomized rats. Neuroscience 113(2):401-10. Brewer GJ, Reichensperger JD, Brinton RD. 2006. Prevention of age-related dysregulation of calcium dynamics by estrogen in neur ons. Neurobiol Aging 27(2):306-17. Brewer LD, Dowling AL, Curran-Rauhut MA, Landfield PW, Porter NM, Blalock EM. 2009. Estradiol reverses a calcium-related biomarker of brain aging in female rats. J Neurosci 29(19):6058-67. Brinton RD. 2008. The healthy cell bias of estrog en action: mitochondri al bioenergetics and neurological implications. Tr ends Neurosci 31(10):529-37. Brookmeyer R, Gray S, Kawas C. 1998. Projections of Alzheimer's disease in the United States and the public health impact of delaying dise ase onset. Am J Public Health 88(9):1337-42. 143

PAGE 144

Burger C, Lopez MC, Feller JA, Baker HV, Muzyczka N, Mandel RJ. 2007. Changes in transc ription within the CA1 field of the hippocampus are associated with age-related spatial learning impairments. Neurobiol Learn Mem 87(1):21-41. Cardona-Gomez GP, DonCarlos L, Garcia-Segur a LM. 2000. Insulin-lik e growth factor I receptors and estrogen receptors colocalize in female rat brain. Neuroscience 99(4):751-60. Carroll JS, Meyer CA, Song J, Li W, Geistlinger TR, Eeckhoute J, Brodsky AS, Keeton EK, Fertuck KC, Hall GF and others. 2006. Genome-wide analysis of estrogen receptor binding sites. Nat Genet 38(11):1289-97. Cavallaro S, Dagata V, Alkon DL. 2002. Programs of gene expression du ring the laying down of memory formation as revealed by DNA microarrays. Neurochem Res 27(10):1201-7. Cavallaro S, Schreurs BG, Zhao W, D'Agat a V, Alkon DL. 2001. Gene expression profiles during long-term memory consolid ation. Eur J Neurosci 13(9):1809-15. Chelvarajan RL, Liu Y, Popa D, Getchell ML Getchell TV, Stromberg AJ, Bondada S. 2006. Molecular basis of age-associ ated cytokine dysregulation in LPS-stimulated macrophages. J Leukoc Biol 79(6):1314-27. Cheng RY, Birely LA, Lum NL, Perella CM, Cherry JM, Bhat NK, Kasprzak KS, Powell DA, Alvord WG, Anderson LM. 2004. Expressions of hepatic genes, especially IGF-binding protein-1, correlating with serum corticosterone in microarray analysis. J Mol Endocrinol 32(1):257-78. Cheng XR, Zhou WX, Zhang YX, Zhou DS, Ya ng RF, Chen LF. 2007. Differential gene expression profiles in the hippocampus of sene scence-accelerated mouse. Neurobiol Aging 28(4):497-506. Choi JM, Romeo RD, Brake WG, Bethea CL, Rosenwaks Z, McEwen BS. 2003. Estradiol increases preand post-synaptic proteins in the CA1 region of the hippocampus in female rhesus macaques (Macaca mula tta). Endocrinology 144(11):4734-8. Corbo RM, Gambina G, Ruggeri M, Scacchi R. 2006. Association of estrogen receptor alpha (ESR1) PvuII and XbaI polymorphisms with sporadic Alzheimer's disease and their effect on apolipoprotein E concentrations. De ment Geriatr Cogn Disord 22(1):67-72. Cordoba Montoya DA, Carrer HF. 1997. Estrogen f acilitates induction of long term potentiation in the hippocampus of awake rats. Brain Res 778(2):430-8. Craig MC, Murphy DG. 2008. Alzheimer's disease in women. Best Pract Res Clin Obstet Gynaecol. D'Agata V, Cavallaro S. 2003. Hippocampal gene expression profiles in passive avoidance conditioning. Eur J Neurosci 18(10):2835-41. 144

PAGE 145

Dai X, Chen L, Sokabe M. 2007. Neurosteroid estradiol rescues ischem ia -induced deficit in the long-term potentiation of rat hippocampal CA1 neurons. Neuropharmacology 52(4):112438. Daniel JM, Hulst JL, Berbling JL. 2006. Estradiol replacement enhances working memory in middle-aged rats when initiated immediatel y after ovariectomy but not after a long-term period of ovarian hormone depr ivation. Endocrinology 147(1):607-14. Day JR, Laping NJ, Lampert-Etchells M, Brown SA, O'Callaghan JP, McNeill TH, Finch CE. 1993. Gonadal steroids regulate the expression of glial fibrillary acidic protein in the adult male rat hippocampus. Ne uroscience 55(2):435-43. Day M, Sung A, Logue S, Bowlby M, Arias R. 2005. Beta estrogen receptor knockout (BERKO) mice present attenuated hippocampal CA1 long-term potentiation and related memory deficits in contextual fear conditioning. Behav Brain Res 164(1):128-31. Delaunay F, Pettersson K, Tujague M, Gustaf sson JA. 2000. Functional differences between the amino-terminal domains of estrogen receptors alpha and beta. Mol Pharmacol 58(3):58490. Donahue CP, Kosik KS, Shors TJ. 2006. Growth hor mone is produced within the hippocampus where it responds to age, sex, and stress. Proc Natl Acad Sci U S A 103(15):6031-6. Du B, Ohmichi M, Takahashi K, Kawagoe J, Ohshima C, Igarashi H, Mori-Abe A, Saitoh M, Ohta T, Ohishi A and others. 2004. Both estr ogen and raloxifene protect against betaamyloid-induced neurotoxicity in estroge n receptor alpha-transfected PC12 cells by activation of telomerase activity via Akt cascade. J Endoc rinol 183(3):605-15. Dubal DB, Rau SW, Shughrue PJ, Zhu H, Yu J, Cashion AB, Suzuki S, Gerhold LM, Bottner MB, Dubal SB and others. 2006. Differential mo dulation of estrogen receptors (ERs) in ischemic brain injury: a role for ERalpha in estradiol-mediated protection against delayed cell death. Endocrinology 147(6):3076-84. Dubal DB, Zhu H, Yu J, Rau SW, Shughrue PJ, Merchenthaler I, Kindy MS, Wise PM. 2001. Estrogen receptor alpha, not beta is a critical link in estradiol-mediated protection against brain injury. Proc Natl Acad Sci U S A 98(4):1952-7. Dunah AW, Hueske E, Wyszynski M, Hoogenraad CC, Jaworski J, Pak DT, Simonetta A, Liu G, Sheng M. 2005. LAR receptor protein tyrosine phosphatases in the development and maintenance of excitatory syna pses. Nat Neurosci 8(4):458-67. Dupuy AM, Mas E, Ritchie K, Descomps B, Badiou S, Cristol JP, Touchon J. 2001. The relationship between apolipoprotein E4 and lip id metabolism is impaired in Alzheimer's disease. Gerontology 47(4):213-8. El-Bakri NK, Islam A, Zhu S, Elhassan A, Mohammed A, Winblad B, Adem A. 2004. Effects of estrogen and progesterone treatment on rat hippocampal NMDA receptors: relationship to Morris water maze performance. J Cell Mol Med 8(4):537-44. 145

PAGE 146

Enm ark E, Pelto-Huikko M, Grandien K, Lagercra ntz S, Lagercrantz J, Fried G, Nordenskjold M, Gustafsson JA. 1997. Human estrogen recep tor beta-gene structure, chromosomal localization, and expression pattern. J Clin Endocrinol Metab 82(12):4258-65. Espeland MA, Rapp SR, Shumaker SA, Brunner R, Manson JE, Sherwin BB, Hsia J, Margolis KL, Hogan PE, Wallace R and others. 2004. Conjugated equine estrogens and global cognitive function in postmenopausal women: Women's Health Ini tiative Memory Study. JAMA 291(24):2959-68. Ewens WJ, Grant GR. 2005. Statistical methods in bioinformatics : an introduction. New York, N.Y.: Springer. xx, 597 p. Fan QW, Yuasa S, Kuno N, Senda T, Kobayashi M, Muramatsu T, Kadomatsu K. 1998. Expression of basigin, a member of the imm unoglobulin superfamily, in the mouse central nervous system. Neurosci Res 30(1):53-63. Favit A, Fiore L, Nicoletti F, Canonico PL 1991. Estrogen modulates stimulation of inositol phospholipid hydrolysis by norepinephrine in rat brain slices. Brain Res 555(1):65-9. Ferri CP, Prince M, Brayne C, Brodaty H, Fra tiglioni L, Ganguli M, Hall K, Hasegawa K, Hendrie H, Huang Y and others. 2005. Global pr evalence of dementia: a Delphi consensus study. Lancet 366(9503):2112-7. Fertuck KC, Eckel JE, Gennings C, Zacharewski TR. 2003. Identification of temporal patterns of gene expression in the uteri of immature ovariectomized mice following exposure to ethynylestradiol. Physiol Genomics 15(2):127-41. Filardo E, Quinn J, Pang Y, Graeber C, Shaw S, Dong J, Thomas P. 2007. Activation of the novel estrogen receptor G protein-coupled re ceptor 30 (GPR30) at the plasma membrane. Endocrinology 148(7):3236-45. Foster TC. 1999. Involvement of hippocampal synap tic plasticity in age-re lated memory decline. Brain Res Brain Res Rev 30(3):236-49. Foster TC. 2005. Interaction of rapid signal transduction cascad es and gene expression in mediating estrogen effects on memory over the life span. Front Neuroendocrinol 26(2):5164. Foster TC. 2006. Biological markers of age-relate d memory deficits: treatment of senescent physiology. CNS Drugs 20(2):153-66. Foster TC. 2007. Calcium homeostasis and modulation of synaptic plasticity in the aged brain. Aging Cell 6(3):319-25. Foster TC, Kumar A. 2002. Calcium dysregulation in the aging brain. Ne uroscientist 8(4):297301. 146

PAGE 147

Foster TC, Rani A, Kum ar A, Cui L, Semple -Rowland SL. 2008. Viral v ector-mediated delivery of estrogen receptor-alpha to the hippocam pus improves spatial learning in estrogen receptor-alpha knockout mice. Mol Ther 16(9):1587-93. Foster TC, Sharrow KM, Kumar A, Masse J. 20 03. Interaction of age and chronic estradiol replacement on memory and markers of brain aging. Neurobiol Aging 24(6):839-52. Foy MR, Baudry M, Diaz Brinton R, Thompson RF. 2008a. Estrogen and hippocampal plasticity in rodent models. J Alzheimers Dis 15(4):589-603. Foy MR, Baudry M, Foy JG, Thompson RF. 2008b. 17beta-estradiol modifies stress-induced and age-related changes in hippocampal synaptic plasticity. Behav Neur osci 122(2):301-9. Frantz GD, Bohner AP, Akers RM, McConnell SK. 1994. Regulation of the POU domain gene SCIP during cerebral cortical deve lopment. J Neurosci 14(2):472-85. Frick KM. 2009. Estrogens and age-related memory decline in rodents: what have we learned and where do we go from here? Horm Behav 55(1):2-23. Frick KM, Fernandez SM, Bulinski SC. 2002. Estrogen replacement improves spatial reference memory and increases hippocampal synaptophysin in aged female mice. Neuroscience 115(2):547-58. Fugger HN, Foster TC, Gustafsson J, Rissman EF. 2000. Novel effects of estradiol and estrogen receptor alpha and beta on cognitive function. Brain Res 883(2):258-64. Funakoshi T, Yanai A, Shinoda K, Kawano MM, Mizukami Y. 2006. G prot ein-coupled receptor 30 is an estrogen receptor in the plasma membrane. Biochem Biophys Res Commun 346(3):904-10. Gabrieli JD, Cohen NJ, Corkin S. 1988. The impa ired learning of semantic knowledge following bilateral medial temporal-lobe resection. Brain Cogn 7(2):157-77. Galea LA, Spritzer MD, Barker JM, Pawlus ki JL. 2006. Gonadal hormone modulation of hippocampal neurogenesis in the adult. Hippocampus 16(3):225-32. Garcia-Segura LM, Diz-Chaves Y, Perez-Martin M, Darnaudery M. 2007. Estradiol, insulin-like growth factor-I and brain aging. Psychoneuroendocrinology 32 Suppl 1:S57-61. Garcia-Segura LM, Naftolin F, Hutchison JB, Azco itia I, Chowen JA. 1999. Role of astroglia in estrogen regulation of synaptic plasticity and brain repair. J Neurobiol 40(4):574-84. Garcia-Segura LM, Sanz A, Mendez P. 2006. Cro ss-talk between IGF-I and estradiol in the brain: focus on neuroprotecti on. Neuroendocrinology 84(4):275-9. Gibbs RB. 1998. Levels of trkA and BDNF mRNA, but not NGF mRNA, fluctuate across the estrous cycle and increase in response to acute hormone replacement. Brain Res 787(2):259-68. 147

PAGE 148

Gibbs RB. 2000. Long-term treatment with estrogen and progesterone enhances acquisition of a spatial memory task by ovariectomized aged rats. Neurobiol Aging 21(1):107-16. Gibbs RB, Aggarwal P. 1998. Estrogen and basal fo rebrain cholinergic neurons: implications for brain aging and Alzheimer's disease-related cognitive decline. Horm Behav 34(2):98-111. Gibbs RB, Wu D, Hersh LB, Pfaff DW. 1994. Eff ects of estrogen replacement on the relative levels of choline acetyltransf erase, trkA, and nerve growth factor messenger RNAs in the basal forebrain and hippocampal formati on of adult rats. Exp Neurol 129(1):70-80. Gilardi KV, Shideler SE, Valverde CR, Robert s JA, Lasley BL. 1997. Characterization of the onset of menopause in the rhesus macaque. Biol Reprod 57(2):335-40. Giusto NM, Salvador GA, Castagnet PI, Pas quare SJ, Ilincheta de Boschero MG. 2002. Ageassociated changes in central nervous syst em glycerolipid com position and metabolism. Neurochem Res 27(11):1513-23. Gonzalez M, Cabrera-Socorro A, Perez-Garcia CG, Fraser JD, Lopez FJ, Alonso R, Meyer G. 2007. Distribution patterns of estrogen receptor alpha and beta in the human cortex and hippocampus during development and a dulthood. J Comp Neurol 503(6):790-802. Goodman AL, Descalzi CD, Johns on DK, Hodgen GD. 1977. Compos ite pattern of circulating LH, FSH, estradiol, and progesterone during the menstrual cy cle in cynomolgus monkeys. Proc Soc Exp Biol Med 155(4):479-81. Gottfried-Blackmore A, Croft G, McEwen BS, Bulloch K. 20 07. Transcriptional activity of estrogen receptors ERalpha and ERbeta in the EtC.1 cerebellar granule cell line. Brain Res 1186:41-7. Gould E, Woolley CS, Frankfurt M, McEwen BS. 1990. Gonadal steroids regulate dendritic spine density in hippocampal pyramidal cells in adulthood. J Neur osci 10(4):1286-91. Gu Q, Moss RL. 1996. 17 beta-Estradiol potentiat es kainate-induced currents via activation of the cAMP cascade. J Neurosci 16(11):3620-9. Guerra B, Diaz M, Alonso R, Marin R. 2004. Pl asma membrane oestrogen receptor mediates neuroprotection against beta-amyloid toxi city through activati on of Raf-1/MEK/ERK cascade in septal-derived cholinergi c SN56 cells. J Neurochem 91(1):99-109. Hall JM, McDonnell DP. 1999. The estrogen receptor beta-isoform (ERbeta) of the human estrogen receptor modulates ERal pha transcriptional activity a nd is a key regulator of the cellular response to estr ogens and antiestrogens. Endocrinology 140(12):5566-78. Healy SD, Braham SR, Braithwaite VA. 1999. Spatial working memory in rats: no differences between the sexes. Proc Biol Sci 266(1435):2303-8. 148

PAGE 149

Heikkinen T Puolivali J, Liu L, Rissanen A, Tanila H. 2002. Effects of ovariectomy and estrogen treatment on learning and hippocampal neurotransmitters in mice. Horm Behav 41(1):22-32. Heikkinen T, Puolivali J, Tanila H. 2004. E ffects of long-term ovariectomy and estrogen treatment on maze learning in aged mice. Exp Gerontol 39(9):1277-83. Henderson VW. 2004. Hormone therapy and Alzheimer' s disease: benefit or harm? Expert Opin Pharmacother 5(2):389-406. Henderson VW, Paganini-Hill A, Miller BL, Elble RJ, Reyes PF, Shoupe D, McCleary CA, Klein RA, Hake AM, Farlow MR. 2000. Estrogen for Alzheimer's disease in women: randomized, double-blind, placebo-controll ed trial. Neurology 54(2):295-301. Himeda T, Mizuno K, Kato H, Araki T. 2005. E ffects of age on immunohistochemical changes in the mouse hippocampus. Mech Ageing Dev 126(6-7):673-7. Hosack DA, Dennis G, Jr., Sherman BT, Lane HC, Lempicki RA. 2003. Identifying biological themes within lists of genes w ith EASE. Genome Biol 4(10):R70. Irwin LN. 2001. Gene expression in the hippocampus of behaviorally stimulated rats: analysis by DNA microarray. Brain Res Mol Brain Res 96(1-2):163-9. Irwin RW, Yao J, Hamilton RT, Cadenas E, Br inton RD, Nilsen J. 2008. Progesterone and estrogen regulate oxidative metabolis m in brain mitochondria. Endocrinology 149(6):3167-75. Ishunina TA, Swaab DF. 2007. Alterations in the human brain in menopause. Maturitas 57(1):20-2. Jakacka M, Ito M, Martinson F, Ishikawa T, Lee EJ, Jameson JL. 2002. An estrogen receptor (ER)alpha deoxyribonucleic acidbinding domain knock-in mutation provides evidence for nonclassical ER pathway signaling in vivo. Mol Endocrinol 16(10):2188-201. Jelks KB, Wylie R, Floyd CL, McAllister AK, Wise P. 2007. Estradiol targets synaptic proteins to induce glutamatergic synapse formation in cultured hippocampal neurons: critical role of estrogen receptor-alpha. J Neurosci 27(26):6903-13. Ji Y, Urakami K, Wada-Isoe K, Adachi Y, Nakashima K. 2000. Estrogen receptor gene polymorphisms in patients with Alzheimer's disease, vascular dementia and alcoholassociated dementia. Dement Ge riatr Cogn Disord 11(3):119-22. Jover T, Tanaka H, Calderone A, Oguro K, Bennett MV, Etgen AM, Zukin RS. 2002. Estrogen protects against global ischemia-induced ne uronal death and prevents activation of apoptotic signaling cascades in the hippocampal CA1. J Neurosci 22(6):2115-24. Jover-Mengual T, Zukin RS, Etgen AM. 2007. MAPK si gnaling is critical to estradiol protection of CA1 neurons in global isch emia. Endocrinology 148(3):1131-43. 149

PAGE 150

Kalita K, Szym czak S, Kaczmarek L. 2005. Non-nucle ar estrogen receptor beta and alpha in the hippocampus of male and female rats. Hippocampus 15(3):404-12. Kapadia R, Yi JH, Vemuganti R. 2008. Mechanis ms of anti-inflammatory and neuroprotective actions of PPAR-gamma agonist s. Front Biosci 13:1813-26. Kawa S, Fujimoto J, Tezuka T, Nakazawa T, Yamamoto T. 2004. Involvement of BREK, a serine/threonine kinase enrich ed in brain, in NGF signalli ng. Genes Cells 9(3):219-32. Kawas C, Resnick S, Morrison A, Brookmeyer R, Corrada M, Zonderman A, Bacal C, Lingle DD, Metter E. 1997. A prospective study of estrog en replacement therapy and the risk of developing Alzheimer's disease: the Baltim ore Longitudinal Study of Aging. Neurology 48(6):1517-21. Kelly MJ, Levin ER. 2001. Rapid actions of plas ma membrane estrogen receptors. Trends Endocrinol Metab 12(4):152-6. Kempermann G, Wiskott L, Gage FH. 2004. Functiona l significance of adult neurogenesis. Curr Opin Neurobiol 14(2):186-91. King DL, Arendash GW. 2002. Maintained synaptophysin immunoreactivity in Tg2576 transgenic mice during aging: correlations with cognitive impairment. Brain Res 926(12):58-68. Ko J, Na M, Kim S, Lee JR, Kim E. 2003. In teraction of the ERC family of RIM-binding proteins with the liprin-alpha family of multidomain proteins. J Biol Chem 278(43):4237785. Krege JH, Hodgin JB, Couse JF, Enmark E, Wa rner M, Mahler JF, Sar M, Korach KS, Gustafsson JA, Smithies O. 1998. Generation and reproductive phenotypes of mice lacking estrogen receptor beta. Proc Na tl Acad Sci U S A 95(26):15677-82. Kretz O, Fester L, Wehrenberg U, Zhou L, Brau ckmann S, Zhao S, Prange-Kiel J, Naumann T, Jarry H, Frotscher M and others. 2004. Hi ppocampal synapses depend on hippocampal estrogen synthesis. J Neurosci 24(26):5913-21. Krezel W, Dupont S, Krust A, Chambon P, Chap man PF. 2001. Increased anxiety and synaptic plasticity in estrogen receptor beta -d eficient mice. Proc Natl Acad Sci U S A 98(21):12278-82. Kumar A, Foster TC. 2002. 17beta-estradiol be nzoate decreases the AHP amplitude in CA1 pyramidal neurons. J Neurophysiol 88(2):621-6. Kurisaki T, Wakatsuki S, Sehara-Fujisawa A. 2002. Meltrin beta mini, a new ADAM19 isoform lacking metalloprotease and disintegrin domains, induces morphological changes in neuronal cells. FEBS Lett 532(3):419-22. 150

PAGE 151

Kuroki Y, Fukushim a K, Kanda Y, Mizuno K, Watanabe Y. 2000. Putative membrane-bound estrogen receptors possibly stimulate mitoge n-activated protein kinase in the rat hippocampus. Eur J Pharmacol 400(2-3):205-9. Kuroki Y, Fukushima K, Kanda Y, Mizuno K, Watanabe Y. 2001. Neuroprotection by estrogen via extracellular signal-regulated kinase against quinolinic acid-induced cell death in the rat hippocampus. Eur J Neurosci 13(3):472-6. Kyng KJ, May A, Kolvraa S, Bohr VA. 2003. Gene expression profiling in Werner syndrome closely resembles that of normal aging. Proc Natl Acad Sci U S A 100(21):12259-64. Lacreuse A, Verreault M, Herndon JG. 2001. Fluctu ations in spatial recognition memory across the menstrual cycle in female rhesus monkeys. Psychoneuroendocrinology 26(6):623-39. Lacreuse A, Wilson ME, Herndon JG. 2002. Estradio l, but not raloxifene, improves aspects of spatial working memory in aged ovariectom ized rhesus monkeys. Neurobiol Aging 23(4):589-600. Lauren J, Airaksinen MS, Saarma M, Timmusk T. 2003. A novel gene family encoding leucinerich repeat transmembrane proteins differe ntially expressed in the nervous system. Genomics 81(4):411-21. Lee SJ, Campomanes CR, Sikat PT, Greenfield AT, Allen PB, McEwen BS. 2004. Estrogen induces phosphorylation of cyclic AMP re sponse element binding (pCREB) in primary hippocampal cells in a time-dependent manner. Neuroscience 124(3):549-60. Leil TA, Ossadtchi A, Nichols TE, Leahy RM, Smith DJ. 2003. Genes re gulated by learning in the hippocampus. J Neurosci Res 71(6):763-8. Leong H, Riby JE, Firestone GL, Bjeldanes LF 2004. Potent ligand-independent estrogen receptor activation by 3,3'-diindolylmethane is mediated by cross talk between the protein kinase A and mitogen-activat ed protein kinase signaling pathways. Mol Endocrinol 18(2):291-302. Levin ER. 2002. Cellular functions of plasma memb rane estrogen receptors. Steroids 67(6):4715. Levin ER. 2009. G protein-coupled receptor 30: estrogen receptor or collaborator? Endocrinology 150(4):1563-5. Li C, Brake WG, Romeo RD, Dunlop JC, Gor don M, Buzescu R, Magarinos AM, Allen PB, Greengard P, Luine V and others. 2004. Estroge n alters hippocampal de ndritic spine shape and enhances synaptic protein immunoreactivity and spatial memory in female mice. Proc Natl Acad Sci U S A 101(7):2185-90. Li C, Wong WH. 2001. Model-base d analysis of oligonucleotid e arrays: expression index computation and outlier detection. Proc Natl Acad Sci U S A 98(1):31-6. 151

PAGE 152

Lindberg MK, Moverare S, Skrtic S, Gao H, Dahlm an-Wright K, Gustafsson JA, Ohlsson C. 2003. Estrogen receptor (ER)-beta reduces ERalpha-regulated gene transcription, supporting a "ying yang" relationship betw een ERalpha and ERbeta in mice. Mol Endocrinol 17(2):203-8. Liu F, Day M, Muniz LC, Bitran D, Arias R, Re villa-Sanchez R, Grauer S, Zhang G, Kelley C, Pulito V and others. 2008. Activation of estrogen receptor-beta regulates hippocampal synaptic plasticity and improves memory. Nat Neurosci 11(3):334-43. Liu MM, Albanese C, Anderson CM, Hilty K, Webb P, Uht RM, Price RH, Jr., Pestell RG, Kushner PJ. 2002. Opposing action of estrogen rece ptors alpha and beta on cyclin D1 gene expression. J Biol Chem 277(27):24353-60. Lu Q, Surks HK, Ebling H, Baur WE, Brown D, Pallas DC, Karas RH. 2003. Regulation of estrogen receptor alpha-mediated transcripti on by a direct interaction with protein phosphatase 2A. J Biol Chem 278(7):4639-45. Lu T, Pan Y, Kao SY, Li C, Kohane I, Chan J, Yankner BA. 2004. Gene regulation and DNA damage in the ageing human brain. Nature 429(6994):883-91. Lubahn DB, Moyer JS, Golding TS, Couse JF, Korach KS, Smithies O. 1993. Alteration of reproductive function but not prenatal sexual de velopment after insert ional disruption of the mouse estrogen receptor gene. Proc Natl Acad Sci U S A 90(23):11162-6. Luo Y, Long JM, Spangler EL, Longo DL, Ingr am DK, Weng NP. 2001. Identification of maze learning-associated genes in rat hippo campus by cDNA microarray. J Mol Neurosci 17(3):397-404. Lynch MA. 1998. Age-related impairment in long-term potentiation in hippocampus: a role for the cytokine, interleukin-1 beta ? Prog Neurobiol 56(5):571-89. MacLennan AH, Henderson VW, Paine BJ, Mathias J, Ramsay EN, Ryan P, Stocks NP, Taylor AW. 2006. Hormone therapy, timing of initiation, and cognition in women aged older than 60 years: the REMEMBER pilot study. Menopause 13(1):28-36. Maki PM. 2006. Hormone therapy and cognitive func tion: is there a critica l period for benefit? Neuroscience 138(3):1027-30. Markham JA, Pych JC, Juraska JM. 2002. Ovarian hormone replacement to aged ovariectomized female rats benefits acquisition of the mo rris water maze. Horm Behav 42(3):284-93. Markowska AL, Savonenko AV. 2002. Effectiveness of estrogen replacement in restoration of cognitive function after long-term estrogen withdrawal in aging rats. J Neurosci 22(24):10985-95. Martin B, Mattson MP, Maudsley S. 2006. Caloric restriction and intermittent fasting: two potential diets for successful brai n aging. Ageing Res Rev 5(3):332-53. 152

PAGE 153

Massart F, Paolini S, Piscitelli E, Brandi ML Solaini G. 2002. Dose-dependent inhibition of m itochondrial ATP synthase by 17 beta-est radiol. Gynecol Endocrinol 16(5):373-7. McEwen BS, Alves SE. 1999. Estrogen actions in the central nervous system. Endocr Rev 20(3):279-307. McEwen BS, Alves SE, Bulloch K, Weiland NG. 1997. Ovarian steroids and the brain: implications for cognition and ag ing. Neurology 48(5 Suppl 7):S8-15. Mehra RD, Sharma K, Nyakas C, Vij U. 2005. Estrogen receptor alpha and beta immunoreactive neurons in normal adult and aged female ra t hippocampus: a qualitative and quantitative study. Brain Res 1056(1):22-35. Mendez P, Cardona-Gomez GP, Garcia-Segura LM. 2005. Interactions of insulin-like growth factor-I and estrogen in the br ain. Adv Exp Med Biol 567:285-303. Meng X, Lu X, Li Z, Green ED, Massa H, Trask BJ, Morris CA, Keating MT. 1998. Complete physical map of the common deletion region in Williams syndrome and identification and characterization of three novel genes. Hum Genet 103(5):590-9. Milner TA, Ayoola K, Drake CT, Herrick SP, Tabori NE, McEwen BS, Warrier S, Alves SE. 2005. Ultrastructural loca lization of estrogen receptor beta immunoreactivity in the rat hippocampal formation. J Comp Neurol 491(2):81-95. Milner TA, McEwen BS, Hayashi S, Li CJ, Reagan LP, Alves SE. 2001. Ultrastructural evidence that hippocampal alpha estrogen r eceptors are located at extranuc lear sites. J Comp Neurol 429(3):355-71. Minano A, Xifro X, Perez V, Barneda-Zahone ro B, Saura CA, Rodriguez-Alvarez J. 2008. Estradiol facilitates neurite maintenance by a Src/Ras/ERK signalling pathway. Mol Cell Neurosci. Miranda P, Williams CL, Einstein G. 1999. Granule ce lls in aging rats are sexually dimorphic in their response to estradio l. J Neurosci 19(9):3316-25. Morissette M, Le Saux M, Di Paolo T. 2008a. Effect of oestrogen receptor alpha and beta agonists on brain N-methyl-D-aspartate receptors. J Neuroendocrinol 20(8):1006-14. Morissette M, Le Saux M, Di Paolo T. 2008b. E ffect of Oestrogen Receptor Alpha and Beta Agonists on Brain Nmda Receptors. J Neuroendocrinol. Morris R. 1984. Developments of a water-maze proce dure for studying spatial learning in the rat. J Neurosci Methods 11(1):47-60. Morris RG, Schenk F, Tweedie F, Jarrard LE. 1990. Ibotenate Lesions of Hippocampus and/or Subiculum: Dissociating Components of Allo centric Spatial Learning. Eur J Neurosci 2(12):1016-1028. 153

PAGE 154

Mukai H, Tsurugizawa T Murakami G, Kominami S, Ishii H, Ogiue-Ikeda M, Takata N, Tanabe N, Furukawa A, Hojo Y and others. 2007. Ra pid modulation of longterm depression and spinogenesis via synaptic estrogen recept ors in hippocampal principal neurons. J Neurochem 100(4):950-67. Mukai H, Tsurugizawa T, Ogiue-Ikeda M, Murakami G, Hojo Y, Ishii H, Kimoto T, Kawato S. 2006. Local neurosteroid production in the hi ppocampus: influence on synaptic plasticity of memory. Neuroendocrinology 84(4):255-63. Murakami G, Tsurugizawa T, Hatanaka Y, Komatsuzaki Y, Tanabe N, Mukai H, Hojo Y, Kominami S, Yamazaki T, Kimoto T and others. 2006. Comparison between basal and apical dendritic spines in estrogen-induced ra pid spinogenesis of CA1 principal neurons in the adult hippocampus. Biochem Biophys Res Commun 351(2):553-8. Murphy DD, Segal M. 1996. Regulation of dendriti c spine density in cultured rat hippocampal neurons by steroid hormones. J Neurosci 16(13):4059-68. Murphy DD, Segal M. 1997. Morphological plasticity of dendritic spines in central neurons is mediated by activation of cAMP response elem ent binding protein. Proc Natl Acad Sci U S A 94(4):1482-7. Naciff JM, Overmann GJ, Torontali SM, Carr GJ Khambatta ZS, Tiesman JP, Richardson BD, Daston GP. 2007. Uterine temporal response to ac ute exposure to 17alpha -ethinyl estradiol in the immature rat. Toxicol Sci 97(2):467-90. Naruhashi K, Kadomatsu K, Igakura T, Fan QW, Kuno N, Muramatsu H, Miyauchi T, Hasegawa T, Itoh A, Muramatsu T and others. 1997. Abnor malities of sensory and memory functions in mice lacking Bsg gene. Biochem Biophys Res Comm un 236(3):733-7. Nilsen J, Brinton RD. 2002. Impact of progestin s on estradiol potentiat ion of the glutamate calcium response. Neuroreport 13(6):825-30. Nilsen J, Irwin RW, Gallaher TK, Brinton RD 2007. Estradiol in vivo regulation of brain mitochondrial proteome. J Neurosci 27(51):14069-77. Nilsson S, Makela S, Treuter E, Tujague M, Th omsen J, Andersson G, Enmark E, Pettersson K, Warner M, Gustafsson JA. 2001. Mechanisms of estrogen action. Physiol Rev 81(4):153565. Niu S, Renfro A, Quattrocchi CC, Sheldon M, D'Arcangelo G. 2004. Reelin promotes hippocampal dendrite development through the VLDLR/ApoER2-Dab1 pathway. Neuron 41(1):71-84. O'Lone R, Frith MC, Karlsson EK, Hansen U. 2004. Genomic targets of nuclear estrogen receptors. Mol Endocrinol 18(8):1859-75. 154

PAGE 155

O'Lone R, Knorr K, Jaffe IZ, Schaffer ME, Martini PG, Karas RH, Bienkowska J, Mendelsohn ME, Hansen U. 2007. Estrogen recep tors alpha and beta mediate distinct pathways of vascular gene expression, including genes involved in mito chondrial electron transport and generation of reactive oxygen speci es. Mol Endocrinol 21(6):1281-96. Obeid LM, Hannun YA. 2003. Ceramide, stress, and a "LAG" in aging. Sci Aging Knowledge Environ 2003(39):PE27. Olsen L, Rasmussen HB, Hansen T, Bagger YZ, Tanko LB, Qin G, Christiansen C, Werge T. 2006. Estrogen receptor alpha and risk for cognitive impairment in postmenopausal women. Psychiatr Genet 16(2):85-8. Olton DS. 1977. The function of septo-hippocamp al connections in spatially organized behaviour. Ciba Found Symp(58):327-49. Paech K, Webb P, Kuiper GG, Nilsson S, Gustafsson J, Kushner PJ, Scanlan TS. 1997. Differential ligand activation of estrogen recep tors ERalpha and ERbeta at AP1 sites. Science 277(5331):1508-10. Patrone C, Pollio G, Vegeto E, Enmark E, de Curtis I, Gustafsson JA, Maggi A. 2000. Estradiol induces differential neuronal phenotypes by activating estrogen receptor alpha or beta. Endocrinology 141(5):1839-45. Pechenino AS, Frick KM. 2009. The effects of acute 17beta-estradiol treatment on gene expression in the young female mouse hippo campus. Neurobiol Learn Mem 91(3):315-22. Pedram A, Razandi M, Levin ER 2006. Nature of functional estr ogen receptors at the plasma membrane. Mol Endocrinol 20(9):1996-2009. Perez-Martin M, Azcoitia I, Trejo JL, Sie rra A, Garcia-Segura LM. 2003. An antagonist of estrogen receptors blocks the i nduction of adult neurogenesis by insulin-like growth factorI in the dentate gyrus of adult fema le rat. Eur J Neurosci 18(4):923-30. Pettersson K, Delaunay F, Gustafsson JA. 2000. Es trogen receptor beta acts as a dominant regulator of estrogen sign aling. Oncogene 19(43):4970-8. Poon HF, Shepherd HM, Reed TT, Calabrese V, St ella AM, Pennisi G, Ca i J, Pierce WM, Klein JB, Butterfield DA. 2006. Proteomics analysis provides insight into caloric restriction mediated oxidation and expression of brain proteins associated with age-related impaired cellular processes: Mitoc hondrial dysfunction, glutamate dysregulation and impaired protein synthesis. Neurobiol Aging 27(7):1020-34. Pozas E, Pascual M, Nguyen Ba-Charvet KT, Guijarro P, Sotelo C, Chedotal A, Del Rio JA, Soriano E. 2001. Age-dependent effects of secreted Semaphorins 3A, 3F, and 3E on developing hippocampal axons: in vitro effect s and phenotype of Semaphorin 3A (-/-) mice. Mol Cell Neurosci 18(1):26-43. Prolla TA. 2002. DNA microarray analysis of the aging brain. Chem Senses 27(3):299-306. 155

PAGE 156

Ra mirez VD, Zheng J, Siddique KM. 1996. Membrane receptors for estrogen, progesterone, and testosterone in the rat br ain: fantasy or reality. Cell Mol Neurobiol 16(2):175-98. Rapp PR, Morrison JH, Roberts JA. 2003. Cyc lic estrogen replacement improves cognitive function in aged ovariectomized rhes us monkeys. J Neurosci 23(13):5708-14. Rapp PR, Rosenberg RA, Gallagher M. 1987. An eval uation of spatial information processing in aged rats. Behav Neurosci 101(1):3-12. Raz L, Khan MM, Mahesh VB, Vadlamudi RK Brann DW. 2008. Rapid es trogen signaling in the brain. Neurosignals 16(2-3):140-53. Rissman EF. 2008. Roles of oestrogen receptors alpha and beta in behavioural neuroendocrinology: beyond Yin/Yang. J Neuroendocrinol 20(6):873-9. Rissman EF, Heck AL, Leonard JE, Shupnik MA, Gustafsson JA. 2002. Disruption of estrogen receptor beta gene impairs spatial learning in female mice. Proc Natl Acad Sci U S A 99(6):3996-4001. Roberts JA, Gilardi KV, Lasley B, Rapp PR. 1997. Reproductive senescence predicts cognitive decline in aged female monkeys. Neuroreport 8(8):2047-51. Romeo RD, McCarthy JB, Wang A, Milner TA, McEwen BS. 2005. Sex differences in hippocampal estradiol-induced N-methyl-D-aspartic acid binding and ultrastructural localization of estrogen receptor-alpha. Neuroendocrinology 81(6):391-9. Rosa AO, Egea J, Martinez A, Garcia AG, L opez MG. 2008. Neuroprotective effect of the new thiadiazolidinone NP00111 against oxygen-glucose deprivation in rat hippocampal slices: implication of ERK1/2 and PPARgamma receptors. Exp Neurol 212(1):93-9. Rosenzweig ES, Barnes CA. 2003. Impact of ag ing on hippocampal function: plasticity, network dynamics, and cognition. Pr og Neurobiol 69(3):143-79. Rune GM, Frotscher M. 2005. Neurosteroid synthe sis in the hippocampus: role in synaptic plasticity. Neuroscience 136(3):833-42. Safe S. 2001. Transcriptional activation of genes by 17 beta-estradiol through estrogen receptorSp1 interactions. Vitam Horm 62:231-52. Sandstrom NJ, Williams CL. 2001. Memory reten tion is modulated by acute estradiol and progesterone replacement. Behav Neurosci 115(2):384-93. Sanguino E, Roglans N, Rodriguez-Calvo R, Al egret M, Sanchez RM, Vazquez-Carrera M, Laguna JC. 2006. Ageing introduces a complex pa ttern of changes in several rat brain transcription factors dependi ng on gender and anatomical localization. Exp Gerontol 41(4):372-9. 156

PAGE 157

Santagati S, Melcang i RC, Celotti F, Martini L, Maggi A. 1994. Estrogen receptor is expressed in different types of glial cells in culture. J Neurochem 63(6):2058-64. Santos MJ, Quintanilla RA, To ro A, Grandy R, Dinamarca MC, Godoy JA, Inestrosa NC. 2005. Peroxisomal proliferation protects from beta -amyloid neurodegeneration. J Biol Chem 280(49):41057-68. Saravia F, Beauquis J, Pietranera L, De Nicola AF. 2007. Neuroprotective e ffects of estradiol in hippocampal neurons and glia of middle age mice. Psychoneuroendocrinology 32(5):48092. Sarkar SN, Huang RQ, Logan SM, Yi KD, Dill on GH, Simpkins JW. 2008. Estrogens directly potentiate neuronal L-type Ca2+ channels Proc Natl Acad Sci U S A 105(39):15148-53. Savonenko AV, Markowska AL. 2003. The cognitiv e effects of ovariectomy and estrogen replacement are modulated by ag ing. Neuroscience 119(3):821-30. Sawai T, Bernier F, Fukushima T, Hashimoto T, Ogura H, Nishizawa Y. 2002. Estrogen induces a rapid increase of calcium-calmodulin-depe ndent protein kinase II activity in the hippocampus. Brain Res 950(1-2):308-11. Schnoes KK, Jaffe IZ, Iyer L, Dabreo A, Aronovitz M, Newfell B, Hansen U, Rosano G, Mendelsohn ME. 2008. Rapid recruitment of tempor ally distinct vascul ar gene sets by estrogen. Mol Endocrinol 22(11):2544-56. Scully JL, Otten U. 1995. Neurotrophin expressi on modulated by glucocor ticoids and oestrogen in immortalized hippocampal neurons. Brain Res Mol Brain Res 31(1-2):158-64. Serra-Pages C, Medley QG, Ta ng M, Hart A, Streuli M. 1998. Liprins, a family of LAR transmembrane protein-tyrosine phosphata se-interacting proteins. J Biol Chem 273(25):15611-20. Setalo G, Jr., Singh M, Guan X, Toran-Alle rand CD. 2002. Estradiol-induced phosphorylation of ERK1/2 in explants of the mouse cerebral cortex: the roles of heat shock protein 90 (Hsp90) and MEK2. J Neurobiol 50(1):1-12. Sharrow KM, Kumar A, Foster TC. 2002. Calcineuri n as a potential cont ributor in estradiol regulation of hippocampal synaptic function. Neuroscience 113(1):89-97. Sheen VL, Feng Y, Graham D, Takafuta T, Shapiro SS, Walsh CA. 2002. Filamin A and Filamin B are co-expressed within neurons during peri ods of neuronal migration and can physically interact. Hum Mol Genet 11(23):2845-54. Sherwin BB. 2005. Estrogen and memory in women: how can we reconcile the findings? Horm Behav 47(3):371-5. Sherwin BB. 2006. Estrogen and cognitive agi ng in women. Neuroscience 138(3):1021-6. 157

PAGE 158

Sherwin BB. 2007. The critical period hypothesis: can it explain discrepanc ies in the oestrogencognition literature? J Neuroendocrinol 19(2):77-81. Sherwin BB, Henry JF. 2008. Brain aging modulates the neuroprotective effects of estrogen on selective aspects of cogniti on in women: a critical review. Front Neuroendocrinol 29(1):88-113. Shingo AS, Kito S. 2002. Estrogen induces elevati on of cAMP-dependent protein kinase activity in immortalized hippocampal neurons: im aging in living cells. J Neural Transm 109(2):171-4. Shughrue PJ, Dorsa DM. 1993. Estrogen modulates the growth-associated protein GAP-43 (Neuromodulin) mRNA in the rat pr eoptic area and basal hypothalamus. Neuroendocrinology 57(3):439-47. Shughrue PJ, Lane MV, Merchenthaler I. 1999. Biologically active estrogen receptor-beta: evidence from in vivo autoradiographic studies with estrogen receptor alpha-knockout mice. Endocrinology 140(6):2613-20. Shughrue PJ, Merchenthaler I. 2001. Distribution of estrogen receptor beta immunoreactivity in the rat central nervous system J Comp Neurol 436(1):64-81. Shumaker SA, Legault C, Kuller L, Rapp SR, Thal L, Lane DS, Fillit H, Stefanick ML, Hendrix SL, Lewis CE and others. 2004. Conjugated equine estrogens and incidence of probable dementia and mild cognitive impairment in postmenopausal women: Women's Health Initiative Memory Study. JAMA 291(24):2947-58. Simpkins JW, Dykens JA. 2008. Mitochondrial m echanisms of estrogen neuroprotection. Brain Res Rev 57(2):421-30. Simpkins JW, Green PS, Gridley KE, Singh M, de Fiebre NC, Rajakumar G. 1997. Role of estrogen replacement therapy in memory enhancement and the prevention of neuronal loss associated with Alzheimer's disease. Am J Med 103(3A):19S-25S. Sinagra M, Verrier D, Frankova D, Korwek KM, Blahos J, Weeber EJ, Manzoni OJ, Chavis P. 2005. Reelin, very-low-density lipoprotein receptor, and apolipoprotein E receptor 2 control somatic NMDA receptor composition during hippocampal maturation in vitro. J Neurosci 25(26):6127-36. Singh M, Dykens JA, Simpkins JW. 2006. Novel mechanisms for estrogen-induced neuroprotection. Exp Biol Med (Maywood) 231(5):514-21. Singh M, Setalo G, Jr., Guan X, Warren M, Toran-Allerand CD. 1999. Estrogen-induced activation of mitogen-activated pr otein kinase in cerebral cort ical explants: convergence of estrogen and neurotrophin signaling pathways. J Ne urosci 19(4):1179-88. Small SA, Stern Y, Tang M, Mayeux R. 1999. Selective decline in memory function among healthy elderly. Neurology 52(7):1392-6. 158

PAGE 159

Sm ith CC, McMahon LL. 2005. Estrogen-induced in crease in the magnitude of long-term potentiation occurs only when the ratio of NMDA transmission to AMPA transmission is increased. J Neurosci 25(34):7780-91. Spencer JL, Waters EM, Milner TA, McEwen BS 2008a. Estrous cycle re gulates activation of hippocampal Akt, LIM kinase, and neurotrophin receptors in C57BL/6 mice. Neuroscience 155(4):1106-19. Spencer JL, Waters EM, Romeo RD, Wood GE, Milner TA, McEwen BS. 2008b. Uncovering the mechanisms of estrogen effects on hi ppocampal function. Front Neuroendocrinol 29(2):219-37. Stefanick ML. 2005. Estrogens and progestins: background and history, tr ends in use, and guidelines and regimens approved by the US Food and Drug Administration. Am J Med 118 Suppl 12B:64-73. Stirone C, Duckles SP, Krause DN, Procacc io V. 2005. Estrogen increases mitochondrial efficiency and reduces oxidative stress in cerebral blood vessels. Mol Pharmacol 68(4):959-65. Strom A, Hartman J, Foster JS, Kietz S, Wi malasena J, Gustafsson JA. 2004. Estrogen receptor beta inhibits 17beta-estradiol-stimulated prolif eration of the breast cancer cell line T47D. Proc Natl Acad Sci U S A 101(6):1566-71. Suzuki S, Handa RJ. 2004. Regulation of estrogen receptor-beta expression in the female rat hypothalamus: differential effects of dexamethasone and estradiol. Endocrinology 145(8):3658-70. Sze CI, Troncoso JC, Kawas C, Mouton P, Price DL, Martin LJ. 1997. Loss of the presynaptic vesicle protein synaptophysin in hippocam pus correlates with cognitive decline in Alzheimer disease. J Neuropath ol Exp Neurol 56(8):933-44. Talboom JS, Williams BJ, Baxley ER, West SG, Bimonte-Nelson HA. 2008. Higher levels of estradiol replacement correlate with better sp atial memory in surgically menopausal young and middle-aged rats. Neurobiol Learn Mem 90(1):155-63. Tanapat P, Hastings NB, Reeves AJ, Gould E. 1999. Estrogen stimulates a transient increase in the number of new neurons in the dentate gy rus of the adult female rat. J Neurosci 19(14):5792-801. Terman JR, Mao T, Pasterkamp RJ, Yu HH, Kolodkin AL. 2002. MICALs, a family of conserved flavoprotein oxidore ductases, function in plexin-m ediated axonal repulsion. Cell 109(7):887-900. Thakur MK, Sharma PK. 2007. Transcription of estrogen receptor alpha and beta in mouse cerebral cortex: effect of age, sex, 17beta -estradiol and testosterone. Neurochem Int 50(2):314-21. 159

PAGE 160

Toran-Allerand CD. 2004. Estrogen and the brain: beyond E R-alpha and ER-beta. Exp Gerontol 39(11-12):1579-86. Toran-Allerand CD, Guan X, MacLusky NJ, Horv ath TL, Diano S, Singh M, Connolly ES, Jr., Nethrapalli IS, Tinnikov AA. 2002. ER-X: a novel, plasma membrane-associated, putative estrogen receptor that is regul ated during development and af ter ischemic brain injury. J Neurosci 22(19):8391-401. Uittenbogaard M, Chiaramello A. 2002. Expression of the bHLH transcription factor Tcf12 (ME1) gene is linked to the expansion of pr ecursor cell populations during neurogenesis. Brain Res Gene Expr Patterns 1(2):115-21. Vaucher E, Reymond I, Najaffe R, Kar S, Quirion R, Miller MM, Franklin KB. 2002. Estrogen effects on object memory and cholinergic receptors in young and old female mice. Neurobiol Aging 23(1):87-95. Vegeto E, Benedusi V, Maggi A. 2008. Estroge n anti-inflammatory activity in brain: a therapeutic opportunity for menopause a nd neurodegenerative diseases. Front Neuroendocrinol 29(4):507-19. Verbitsky M, Yonan AL, Malleret G, Kandel ER, Gilliam TC, Pavlidis P. 2004. Altered hippocampal transcript profile accompanies an age-related spatial memory deficit in mice. Learn Mem 11(3):253-60. von Bohlen und Halbach O, Zacher C, Gass P, Unsicker K. 2006. Age-related alterations in hippocampal spines and deficiencies in spatia l memory in mice. J Neurosci Res 83(4):52531. Wang JM, Irwin RW, Brinton RD. 2006. Activation of estrogen receptor alpha increases and estrogen receptor beta decrea ses apolipoprotein E expression in hippocampus in vitro and in vivo. Proc Natl Acad Sci U S A 103(45):16983-8. Wang PN, Liao SQ, Liu RS, Liu CY, Chao HT, Lu SR, Yu HY, Wang SJ, Liu HC. 2000. Effects of estrogen on cognition, mood, and cerebral blood flow in AD: a controlled study. Neurology 54(11):2061-6. Warren SG, Humphreys AG, Juraska JM, Greenough WT. 1995. LTP varies across the estrous cycle: enhanced synaptic plasticity in proestrus rats. Brain Res 703(1-2):26-30. Weiland NG, Orikasa C, Hayashi S, McEwen BS 1997. Distribution and hor mone regulation of estrogen receptor immunoreactiv e cells in the hippocampus of male and female rats. J Comp Neurol 388(4):603-12. West MJ, Kawas CH, Martin LJ, Troncoso JC. 2000. The CA1 region of the human hippocampus is a hot spot in Alzheime r's disease. Ann N Y Acad Sci 908:255-9. 160

PAGE 161

W illiams C, Edvardsson K, Lewandowski SA, Strom A, Gustafsson JA. 2008. A genome-wide study of the repressive eff ects of estrogen receptor beta on estrogen receptor alpha signaling in breast cancer cel ls. Oncogene 27(7):1019-32. Wilson ME, Rosewell KL, Kashon ML, Shughrue PJ, Merchenthaler I, Wise PM. 2002. Age differentially influences estrogen receptor -alpha (ERalpha) and estrogen receptor-beta (ERbeta) gene expression in specific re gions of the rat brain. Mech Ageing Dev 123(6):593-601. Woolley CS. 2007. Acute effects of estrogen on neuronal physiology. Annu Rev Pharmacol Toxicol 47:657-80. Woolley CS, Gould E, Frankfurt M, McEwen BS. 1990. Naturally occurring fluctuation in dendritic spine density on adult hippocampa l pyramidal neurons. J Neurosci 10(12):40359. Woolley CS, McEwen BS. 1992. Estradiol mediates fluctuation in hippocampal synapse density during the estrous cycle in the ad ult rat. J Neuros ci 12(7):2549-54. Woolley CS, McEwen BS. 1993. Roles of estradiol and progesterone in regulation of hippocampal dendritic spine density during the es trous cycle in the rat. J Comp Neurol 336(2):293-306. Woolley CS, Wenzel HJ, Schwartzkroin PA. 1996. Es tradiol increases the frequency of multiple synapse boutons in the hippocampal CA1 region of the adult female rat. J Comp Neurol 373(1):108-17. Wu Q, Maniatis T. 1999. A striki ng organization of a large family of human neural cadherin-like cell adhesion genes. Cell 97(6):779-90. Wu TW, Wang JM, Chen S, Brinton RD. 2005. 17Beta -estradiol induced Ca 2+ influx via L-type calcium channels activates the Src/ERK/cyclic-AMP response el ement binding protein signal pathway and BCL-2 expression in rat hippocampal neurons: a potential initiation mechanism for estrogen-induced neur oprotection. Neuroscience 135(1):59-72. Wu X, Li H, Chen JD. 2001. The human homologue of the yeast DNA repair and TFIIH regulator MMS19 is an AF-1-specific coactiv ator of estrogen receptor. J Biol Chem 276(26):23962-8. Wulf P, Suter U. 1999. Embryonic expression of ep ithelial membrane protein 1 in early neurons. Brain Res Dev Brain Res 116(2):169-80. Yaffe K, Lindquist K, Sen S, Cauley J, Ferrell R, Penninx B, Harris T, Li R, Cummings SR. 2009. Estrogen receptor genotype and risk of cognitive impairment in elders: findings from the Health ABC study. Neurobiol Aging 30(4):607-14. 161

PAGE 162

162 Yildirim M, Janssen WG, Tabori NE, Adams MM, Yuen GS, Akama KT, McEwen BS, Milner TA, Morrison JH. 2008. Estrogen and aging affect synaptic distribution of phosphorylated LIM kinase (pLIMK) in CA1 region of fema le rat hippocampus. Neuroscience 152(2):360370. Yun SH, Park KA, Kwon S, Woolley CS, Sullivan PM, Pasternak JF, Trommer BL. 2007. Estradiol enhances long term potentiation in hippocampal s lices from aged apoE4-TR mice. Hippocampus 17(12):1153-7. Zhang QG, Wang R, Khan M, Mahesh V, Bra nn DW. 2008. Role of Dickkopf-1, an antagonist of the Wnt/beta-catenin signaling pathway, in estrogen-induced neuroprotection and attenuation of tau phosphorylati on. J Neurosci 28(34):8430-41. Zhang QH, Huang YH, Hu YZ, Wei GZ, Han XF, Lu SY, Zhao YF. 2004. Disruption of estrogen receptor beta in mice brain resu lts in pathological alterations resembling Alzheimer disease. Acta Pharmacol Sin 25(4):452-7. Zhang W, Han SW, McKeel DW, Goate A, Wu JY. 1998. Interaction of presenilins with the filamin family of actin-binding pr oteins. J Neurosci 18(3):914-22. Zhao C, Matthews J, Tujague M, Wan J, Strom A, Toresson G, Lam EW, Cheng G, Gustafsson JA, Dahlman-Wright K. 2007. Estrogen receptor beta2 negatively regulates the transactivation of estrogen receptor alpha in human breast cancer cells. Cancer Res 67(8):3955-62. Zhao L, Brinton RD. 2007. Estrogen receptor alpha and beta differentially regulate intracellular Ca(2+) dynamics leading to ERK phosphoryl ation and estrogen neuroprotection in hippocampal neurons. Brain Res 1172:48-59. Zhao X, Lein ES, He A, Smith SC, Aston C, Gage FH. 2001. Transcriptional profiling reveals strict boundaries between hippocampal subregions. J Comp Neurol 441(3):187-96. Zheng J, Ramirez VD. 1999. Rapid inhibition of rat brain mitochondrial proton F0F1-ATPase activity by estrogens: comparison with Na+, K+ -ATPase of porcine cortex. Eur J Pharmacol 368(1):95-102. Ziegler DR, Gallagher M. 2005. Spatial memory in middle-aged female rats: assessment of estrogen replacement after ovariectomy. Brain Res 1052(2):163-73. Znamensky V, Akama KT, McEwen BS, Miln er TA. 2003. Estrogen levels regulate the subcellular distribution of phosphorylated Ak t in hippocampal CA1 dendrites. J Neurosci 23(6):2340-7.

PAGE 163

BIOGR APHICAL SKETCH Kristina Katharine Aenlle was born in Niles, Mi chigan, to Marianne and Thomas Davis, in July of 1978. Along with her older sister (Elizabeth) and younger br other (Steven), she attended Niles community schools, graduating with honor s in 1996. She then attended Michigan State University, in East Lansing, Michigan, where she received her B.S. in Psychology. During her time at MSU, Kristina had the plea sure if working in the labs of Dr. Sheryl Sisk and Dr. John I Johnson. Dr. Sisk, a leading neuroendocrinologist introduced Kristina to hormonal regulation of behavior. Dr. John Johnson, a renowned compara tive neurobiologist, taught Kristina the intricacies of brain function. It was the amazing experience and guidance at MSU that her love for research grew and in August of 2003 she enrolled in the Univer sity of Floridas Interdisciplinary Program in Biomedical Science. The interdisciplinary program allowed her to explorer many fields of research and expands her scientific resear ch experience. In the spring of 2004, Kristina joined the laborator y of Dr. Thomas C. Foster, where she conducted experiments examining the role of estrogen on cognitive function and hippocampal gene expression during aging. Using microarrays analysis of hippocampal tissue, she has found that estrogen can reverse age-related changes in the expression of ge nes of the hippocampus during middle-age but the response to estrogen treatment in aged animals is attenuated and an alteration of estrogen receptors in contributing to the truncated respons e to estrogen treatment. Kristinas dissertation work will be published in three fi rst author publications. It is he r hope that the results of her work will contribute to improved and safer therapeu tic strategies to prevent age-related cognitive decline. With her husband, Jeff, and two sons, Dante and Dominic, she enjoys spending time at the beach and traveling. 163