<%BANNER%>

In Vitro Selection and Development of Aptamers for Biomarker Discovery and Targeted Therapy

Permanent Link: http://ufdc.ufl.edu/UFE0021612/00001

Material Information

Title: In Vitro Selection and Development of Aptamers for Biomarker Discovery and Targeted Therapy
Physical Description: 1 online resource (137 p.)
Language: english
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2008

Subjects

Subjects / Keywords: aptamers, biomarkers, photodynamictherapy, pkcdelta, selex
Chemistry -- Dissertations, Academic -- UF
Genre: Chemistry thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Increasing emphasis on molecular level understanding of cellular processes has allowed certain diseases to be redefined in terms of underlying molecular level abnormalities rather than pathological differences. In an attempt to understand some of these molecular level characteristics, this research was undertaken to utilize aptamers as molecular probes in cancer studies. Aptamers are short DNA/RNA strands that show a preferential binding with variety of molecules, and are generated by a process called Systematic Evolution of Ligands by Exponential enrichment (SELEX). First, in an attempt to develop sensitive probes for intracellular proteins, DNA aptamers were selected utilizing Capillary Electrophoresis based SELEX (CE-SELEX) targeting Protein Kinase C delta (PKC-delta). PKC-delta is an important signal transduction protein that plays a significant role in tumor initiation. The selected aptamer was later labeled with a fluorophore and developed into a fluorescent probe for protein detection studies. Second, a novel strategy to identify over-expressed proteins on the cell membranes utilizing aptamers has been implemented. Here, an aptamer selected using Cell based SELEX (Cell-SELEX) has been utilized as a tool for biomarker identification. The aptamer TD05 selected against a Burkitt's lymphoma (BL) cell line was chemically modified to covalently crosslink with its target and to capture and to enrich the target receptors using streptavidin coated magnetic beads. The separated target protein was identified using mass spectrometry. Using this method, we were able to identify membrane bound Immunoglobin Heavy mu chain (IGHM) which is an established marker protein as the target for aptamer TD05. This study demonstrates aptamers selected against whole cells can be effectively utilized to identify cancer related marker proteins. Third, since the identified biomarker is expressed only on the target BL cells, this selectivity was exploited to demonstrate that the aptamer can be used as a drug carrier. Aptamer-photosensitizer conjugates were engineered to effectively target cancer cells that express identified biomarker. Introduction of the aptamer-photosensitizer conjugates followed by irradiation with light has selectively destroyed target cancer cells utilizing induced singlet oxygen. Finally, to avoid undesirable side effects associated with photosensitizers, as a proof-of-concept a FRET principle based 'prodrug' and an aptamer based drug delivery platform were engineered. The engineered hypothetical 'prodrug' was effectively activated upon reaching aptamer platform aided by DNA Template based functional Group Transfer Reactions (DTGTR). The developed strategy further demonstrates that aptamers can be used as drug delivery platforms.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Thesis: Thesis (Ph.D.)--University of Florida, 2008.
Local: Adviser: Tan, Weihong.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2008
System ID: UFE0021612:00001

Permanent Link: http://ufdc.ufl.edu/UFE0021612/00001

Material Information

Title: In Vitro Selection and Development of Aptamers for Biomarker Discovery and Targeted Therapy
Physical Description: 1 online resource (137 p.)
Language: english
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2008

Subjects

Subjects / Keywords: aptamers, biomarkers, photodynamictherapy, pkcdelta, selex
Chemistry -- Dissertations, Academic -- UF
Genre: Chemistry thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Increasing emphasis on molecular level understanding of cellular processes has allowed certain diseases to be redefined in terms of underlying molecular level abnormalities rather than pathological differences. In an attempt to understand some of these molecular level characteristics, this research was undertaken to utilize aptamers as molecular probes in cancer studies. Aptamers are short DNA/RNA strands that show a preferential binding with variety of molecules, and are generated by a process called Systematic Evolution of Ligands by Exponential enrichment (SELEX). First, in an attempt to develop sensitive probes for intracellular proteins, DNA aptamers were selected utilizing Capillary Electrophoresis based SELEX (CE-SELEX) targeting Protein Kinase C delta (PKC-delta). PKC-delta is an important signal transduction protein that plays a significant role in tumor initiation. The selected aptamer was later labeled with a fluorophore and developed into a fluorescent probe for protein detection studies. Second, a novel strategy to identify over-expressed proteins on the cell membranes utilizing aptamers has been implemented. Here, an aptamer selected using Cell based SELEX (Cell-SELEX) has been utilized as a tool for biomarker identification. The aptamer TD05 selected against a Burkitt's lymphoma (BL) cell line was chemically modified to covalently crosslink with its target and to capture and to enrich the target receptors using streptavidin coated magnetic beads. The separated target protein was identified using mass spectrometry. Using this method, we were able to identify membrane bound Immunoglobin Heavy mu chain (IGHM) which is an established marker protein as the target for aptamer TD05. This study demonstrates aptamers selected against whole cells can be effectively utilized to identify cancer related marker proteins. Third, since the identified biomarker is expressed only on the target BL cells, this selectivity was exploited to demonstrate that the aptamer can be used as a drug carrier. Aptamer-photosensitizer conjugates were engineered to effectively target cancer cells that express identified biomarker. Introduction of the aptamer-photosensitizer conjugates followed by irradiation with light has selectively destroyed target cancer cells utilizing induced singlet oxygen. Finally, to avoid undesirable side effects associated with photosensitizers, as a proof-of-concept a FRET principle based 'prodrug' and an aptamer based drug delivery platform were engineered. The engineered hypothetical 'prodrug' was effectively activated upon reaching aptamer platform aided by DNA Template based functional Group Transfer Reactions (DTGTR). The developed strategy further demonstrates that aptamers can be used as drug delivery platforms.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Thesis: Thesis (Ph.D.)--University of Florida, 2008.
Local: Adviser: Tan, Weihong.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2008
System ID: UFE0021612:00001


This item has the following downloads:


Full Text
xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E20101108_AAAAAD INGEST_TIME 2010-11-08T05:53:29Z PACKAGE UFE0021612_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES
FILE SIZE 1051944 DFID F20101108_AAACII ORIGIN DEPOSITOR PATH mallikaratchy_p_Page_018.jp2 GLOBAL false PRESERVATION BIT MESSAGE_DIGEST ALGORITHM MD5
0fcac7f381c447d43863eb14af2d43b3
SHA-1
ee69af618603c98743203826b4026e8d69eca171
17950 F20101108_AAACHT mallikaratchy_p_Page_118.pro
bec8da31f6c05d0d65b14c71d517fe61
ed20529a47fc44e0db73e099053bd64f38d001cc
1051979 F20101108_AAACIJ mallikaratchy_p_Page_129.jp2
9ed6aa12a9a37dfd6246a2be5ea44ddf
ee917430e41d4ac1ce851c6de857f117dbea4796
1051986 F20101108_AAACHU mallikaratchy_p_Page_058.jp2
477779f6d1c4ba7c0a18815222972f28
2553d00ad3843e0f310a217b6d78285fa3b611b3
25271604 F20101108_AAACIK mallikaratchy_p_Page_041.tif
491e1b1fbbfb52e29fdd9889adc63452
46112c5ead08928ebbe400ef0a92c6ad1435037d
F20101108_AAACHV mallikaratchy_p_Page_071.tif
4c174788a7a69a3da98cf61f2410c891
58b33b93d58479fd354605ee98cdaf6da275762e
1023483 F20101108_AAACIL mallikaratchy_p_Page_038.jp2
12175c23886dbe8c0c6932aaf4234f06
c16769cb6c50b2bdf74445b0b73bc0d64829a602
56481 F20101108_AAACHW mallikaratchy_p_Page_095.pro
2dd5af7a33463de71650448040e9e27f
1fc4c3989f83a150c582ca060c0d0cbf1b5c98d2
20553 F20101108_AAACIM mallikaratchy_p_Page_061.QC.jpg
02657782aa4cf3f6939aff6f3f9803c6
743716b674122227579f4a5ca8c8c09a0a67542c
F20101108_AAACHX mallikaratchy_p_Page_018.tif
489d0f904cf92b29e5c6286fca138efe
c36c63a206f4d239320cbfff4d0e547e4d53008c
78578 F20101108_AAACJA mallikaratchy_p_Page_042.jpg
ff6e18c0d43f669242b11b590fe8102f
0efec664559fd7e3a3e85ef3624bab28d70e26f0
2279 F20101108_AAACIN mallikaratchy_p_Page_116thm.jpg
a28472730341d97952d80267e241ef7a
3d5138b584ddc398d3cd29c970c3d813239084fb
23929 F20101108_AAACHY mallikaratchy_p_Page_089.QC.jpg
f821efbaa5b1623616f2705df8747f7d
a02f0165a57310ab68f5848e0c05d7084dc222e7
5152 F20101108_AAACJB mallikaratchy_p_Page_007thm.jpg
232aa4bd2f3f998ecf1645a6e57094cf
2745bea41b13188ab650deb241c2a176cdd8e3e0
35533 F20101108_AAACIO mallikaratchy_p_Page_090.pro
94b0368bf0118a247c4b31943b98e941
1f53f6b016d7e09a262607a80ff9fea01b73d35b
2568 F20101108_AAACHZ mallikaratchy_p_Page_125.txt
b862ad6c7efd618d29391d104227e436
fbbbc07762942c12e2143ea69e0047f2691de34b
1051964 F20101108_AAACJC mallikaratchy_p_Page_070.jp2
d6b59de5bed42e86f0e96a100c37ae4e
96612b1d9fb5669462caf6a09cbeb317f7acfa46
3448 F20101108_AAACIP mallikaratchy_p_Page_121thm.jpg
0bf9d8a7cbb33c54e9a9584da92c528a
8882e8221bb07ad80ab5a73bf7202db5504a2336
46933 F20101108_AAACJD mallikaratchy_p_Page_042.pro
5e419d85508babfb992377660a2e8609
4029f7ddb4fd0ecac5d296f60fce84971078ed1e
58209 F20101108_AAACIQ mallikaratchy_p_Page_009.pro
105eb9f53a510df08077aa3b129a6052
4a6a7b637a3c1e2048ac23433f8703fa0e9cd48e
F20101108_AAACJE mallikaratchy_p_Page_050.tif
937fc58c78151bd150aa196261afdb5f
1715b8eefb79bb7576011e90d4b5a3ff9ddd98f8
1051981 F20101108_AAACIR mallikaratchy_p_Page_130.jp2
5ed7bac572f5972e7adc8e12fcecd77f
9036e1410c283873b07574b8acb181407203a9da
6081 F20101108_AAACJF mallikaratchy_p_Page_069thm.jpg
efa0b863667d906bc63f02c2e116a22a
a384b973337ed0e925691ee6df84f90f794b4993
6024 F20101108_AAACJG mallikaratchy_p_Page_090thm.jpg
03d9ce5eb8f842a6bf33fa5dbb049e9e
4ec98fdb7c226aec15e84504480f1e564b5ddbe8
26428 F20101108_AAACIS mallikaratchy_p_Page_119.QC.jpg
2546ef676a8e82fbcefe798e40f570b4
799f309526379e383ad0ea56adb977c1f183062a
F20101108_AAACJH mallikaratchy_p_Page_128.jp2
f6f077b641eeca1f17cdc7682801e020
4786904e2155104d250c5ada678002f20a4977b8
F20101108_AAACJI mallikaratchy_p_Page_134.tif
004604a0a40b15eaf2ebf0de387332bd
2013eb4b7ce336e8808b6f4df15fdc605cffbe03
F20101108_AAACIT mallikaratchy_p_Page_121.tif
223d0cc5cf99adfed0a5a54c8c371936
898083e57fa15b521c5cfdf1aa63864f160bc726
F20101108_AAACJJ mallikaratchy_p_Page_080.tif
52b74f3576c14a4f25a6e809d01cb5b8
d6133ffff144a46457f5d0efa94817ebffd79207
68175 F20101108_AAACIU mallikaratchy_p_Page_128.pro
e95d213bb47a4c8f64634318d26278aa
69d4ebe7b9631438ac8a5e1fb5e91df7382c9254
F20101108_AAACJK mallikaratchy_p_Page_110.tif
c4bc7c38c6084e4f6784afd0b4bbff84
78ccbd32f219b40de6a7b97b3dc6817a9503b9da
1718 F20101108_AAACIV mallikaratchy_p_Page_038.txt
6a01ca7418ed79adcded528a9b6dce3f
c9cbb2faaac06ed7c7e6354f6de513a5b426cfc9
16914 F20101108_AAACJL mallikaratchy_p_Page_011.QC.jpg
648a0921f6c993b902764fb519038f32
2653b98c091ac28a89e9f9af42e20b93440557a1
38562 F20101108_AAACIW mallikaratchy_p_Page_072.pro
18d1e78371d26899a7c06f4c39045894
868569ec53f69e032e04c0f21cdb2566eabe9abe
89938 F20101108_AAACKA mallikaratchy_p_Page_010.jpg
ad7197a50b2d3639ca1510705ad1693f
3665572a19055a9d5af43f7d1c3f911746359f40
82678 F20101108_AAACJM mallikaratchy_p_Page_057.jpg
2b809d93f60b83d67f9c1d1630ef2b5e
6895c11fd919a92b44f22e71ff5bbce932031fd9
52951 F20101108_AAACIX mallikaratchy_p_Page_057.pro
a8657af52388a9fc87e7ce6261bf9956
483beb2be200a1c59b04429a1777430ba082d02e
55652 F20101108_AAACKB mallikaratchy_p_Page_011.jpg
47161ec49499d04a7656c0378a8aa3d0
a4d1faa1fdab20dc1ee2a9e196beb49ecb5450ad
740453 F20101108_AAACJN mallikaratchy_p_Page_087.jp2
1e6bf1ce94c11fe8cd6703e7c0d65d9e
9df24f5c06ca8d581eaa42427364f99e8f29844a
F20101108_AAACIY mallikaratchy_p_Page_108.tif
9451d02ed42b53587ac0e7e764f3810c
e3db7ce26e9c4d2601a6c03b8168ab66bdaffa2d
82582 F20101108_AAACKC mallikaratchy_p_Page_014.jpg
2468019feabbaeb2b66d0f1301fb5ee4
0fe436ba119acb9446f17c1a5596965b92093449
163461 F20101108_AAACJO UFE0021612_00001.mets FULL
f31370950f93172f78be7d43ac0f7428
abf9bccc74bc6afd3b66cdca46a8a61a2037b6a2
22181 F20101108_AAACIZ mallikaratchy_p_Page_087.pro
4378334850f3517fcdf3f262600baf5c
78dbf636aeae7444e1cce73fd9d7733cf5a257ab
82939 F20101108_AAACKD mallikaratchy_p_Page_016.jpg
13b933b2a45be75ef23a524109cf3a00
49f0e432bf09343ec5e56aa14a16dc3666201949
87104 F20101108_AAACKE mallikaratchy_p_Page_017.jpg
791709462a10c64d4f5ae530679b3e79
8af47c260e532c031adf52430a7afa90741e5dc7
80772 F20101108_AAACKF mallikaratchy_p_Page_018.jpg
59682c6c3f635156a5242982b9176ad0
a93f6deedb90be3e9002f04ee325bf77a2c5e1a2
26710 F20101108_AAACJR mallikaratchy_p_Page_001.jpg
d041379618390f0fe44fc8ccef9fe57d
04e97b94c3f6b90d6d0dab6442301116eae0cfd9
61935 F20101108_AAACKG mallikaratchy_p_Page_019.jpg
13337a66d2b4648bc4d9abaf4e822496
1792606b2b7eaff52f3c526ac1bdfd646dc54e60
10254 F20101108_AAACJS mallikaratchy_p_Page_002.jpg
2b5e803ebcbd72a7ae65fbed7df8ede9
1dde849022d8a179005200a25d07ee5ed0bc1cc9
69771 F20101108_AAACKH mallikaratchy_p_Page_020.jpg
080d9df093c7d2f9eea906cc8f52daba
5e2a79b6bfdc2fece437e68d21c382420b305ba6
83740 F20101108_AAACKI mallikaratchy_p_Page_022.jpg
44b0a254a7115d2ccae966c5c1d7d1c7
9f2891103f5c4810748be4687c0db4deff9fc78b
9529 F20101108_AAACJT mallikaratchy_p_Page_003.jpg
483882bbba7fbfe364a380a4ef01f6d6
c3a71372c9fb1b0790d68f10fd4c39cda4ee9922
86760 F20101108_AAACKJ mallikaratchy_p_Page_024.jpg
12a9c13ff1252eb4b19492999ea8e825
2a51cb1e34c62f30ace0d01da6edb64ffe95b114
74280 F20101108_AAACJU mallikaratchy_p_Page_004.jpg
7364c030638adf2af35814a2c88aedf3
41ac00f87b4558ce443347afad0962da8adfa277
82759 F20101108_AAACKK mallikaratchy_p_Page_025.jpg
c97101b3abd95a70c6c3ff52f6828a11
423e79700bdb8ebb54e944203fdd1cfed8997f45
95175 F20101108_AAACJV mallikaratchy_p_Page_005.jpg
0fcbba0d3e861998ff1fc0a466a9a760
7596dfc6de4702fb43751abc5b6b645c1c0a99d1
68651 F20101108_AAACKL mallikaratchy_p_Page_027.jpg
74b4ac0b04fd1904454848dfed1b08c8
d7acc4b2d634d6117f797c04b7986a348d7ec9f1
116170 F20101108_AAACJW mallikaratchy_p_Page_006.jpg
5b92a518464942dda24e1f627573edac
857aae160ca86e7ef40c3238181695e27b237c4f
86663 F20101108_AAACKM mallikaratchy_p_Page_028.jpg
5aeba96f82de056272764afd893db156
76dc5659f979fc3501491525f8c920d0b21cd907
77245 F20101108_AAACJX mallikaratchy_p_Page_007.jpg
9a50ad99c5e4955a3d4fb1dcc417f4bd
9bc5f2d1b5dacf6ad9067d270d01a37fbfaaef65
84166 F20101108_AAACLA mallikaratchy_p_Page_046.jpg
bd0f1f3238c4b8250ea0dccd75cd602c
a6dec3a2642784ff00710458c17af92f72a054f9
85257 F20101108_AAACKN mallikaratchy_p_Page_029.jpg
acbb10336396a3bb6ccf9c81e33706f2
b588a2a9838b14b933d5e3c891ea110addf34f68
39376 F20101108_AAACJY mallikaratchy_p_Page_008.jpg
c743efc55c5d6e443c164883871ab552
0ab484eb0802c1e089db2469bced443f58ae94a5
84013 F20101108_AAACLB mallikaratchy_p_Page_047.jpg
338fbdd0472acbe14328b96233f14d00
c0fc3d1b917776bf1192aa10199c3dc82a1526b3
85415 F20101108_AAACKO mallikaratchy_p_Page_030.jpg
f3bb9d4a0fe78b4988e14c139a287d14
fb9f5ec626a9e588e10dbb1aea797be6aa531647
79823 F20101108_AAACJZ mallikaratchy_p_Page_009.jpg
27323d5451ceb695e480ff92f9868710
4581c9d5a6f96341a86aa91c27754c83e0adcca4
81273 F20101108_AAACLC mallikaratchy_p_Page_049.jpg
28ea70eb1f30e05cd24665dd61f81a2a
6774b20f418cac97d512a477a9a379feedcfcaf4
87013 F20101108_AAACKP mallikaratchy_p_Page_031.jpg
42a5632b92e369ee5fd347a281d41eb4
67ba7b601b5da3b85f5827dd299fe031a98906d1
83654 F20101108_AAACLD mallikaratchy_p_Page_050.jpg
05b501a099dbb7bd330f1ad87fc90eb8
9d75be83c86877789bbe0af52aab85f8cfee3a88
85546 F20101108_AAACKQ mallikaratchy_p_Page_032.jpg
3a93fda9caea99fe19d121528d4e94c5
06f81d1a90fda99aabc8159f78e5e521bf9720bd
92660 F20101108_AAACLE mallikaratchy_p_Page_051.jpg
0ac9f659bf5f02336f3bf391047fd62f
4da62a4fc4d4dbed8b115252e68796ff614ea941
69083 F20101108_AAACKR mallikaratchy_p_Page_033.jpg
7f7ab472ccd34c2717a4e0d6c00e8a59
9407b1ee49d0c3b29a0f686c88140f58bbdf2d0c
63748 F20101108_AAACLF mallikaratchy_p_Page_052.jpg
d8652b724e5141b99867333f69fcf807
c8ed6715f887fd33806dbae55aa8f46c21af5023
52180 F20101108_AAACKS mallikaratchy_p_Page_034.jpg
5df271f5f6de1c239ba74a423ef305b3
74b0e8a9f7c639fea156d2ab9b55ce1f299cdfaa
85370 F20101108_AAACLG mallikaratchy_p_Page_056.jpg
a10057af9eda2a5054136ac9d7fb7310
cd155a07396abe55319ee9dda4bc2895281c0a6a
30304 F20101108_AAACKT mallikaratchy_p_Page_035.jpg
ee1d7923e99d65ae4f29ea3427b247c3
f24054ecebfdbdc30701a8a71eb093d7e186187c
79579 F20101108_AAACLH mallikaratchy_p_Page_058.jpg
9b2933d2d87918efd3340bbf34c0c79a
7255f158df63565f14758dbe6b094355462dae4e
68362 F20101108_AAACLI mallikaratchy_p_Page_059.jpg
4b6e2c94227ce1e7b12d113391cb2b56
487c2770116438407dd508d96fe92c20b1c44e4b
79342 F20101108_AAACKU mallikaratchy_p_Page_036.jpg
ed8eecee9e3f7b4aa7d538422085dd4d
59067eff6d1570d483a5199b8c8c93334dc712ee
83681 F20101108_AAACLJ mallikaratchy_p_Page_060.jpg
6c6dc67ba404c83d457824588b3fdb1c
9be98c1edba484e99e1a32b953d647621d6195d8
86178 F20101108_AAACKV mallikaratchy_p_Page_037.jpg
ed7754224d7c751318382608061bbd1d
d213b9fca3be30225e427d5e54ddb7196ea3abda
66747 F20101108_AAACLK mallikaratchy_p_Page_061.jpg
c9aa63e1585d6eeb9168307910aa89d7
d2eacce152a0b326a915eef0608d4bf72dc402f4
75157 F20101108_AAACKW mallikaratchy_p_Page_038.jpg
ed33bb9d36f5adfb51a706edf4d3a3a2
56c33df595e196bc4035804efca7c98bda98c3c3
87730 F20101108_AAACLL mallikaratchy_p_Page_062.jpg
5a62b6cbbcd931d92d13201d0762af50
21c8c4d6f734e957998bcac845e2482adc1210a3
78750 F20101108_AAACKX mallikaratchy_p_Page_039.jpg
a00dfda5255d639226c70eccf5dfe66c
78d6ea366603ce6574a0dbfbf71cd552de189c96
87153 F20101108_AAACMA mallikaratchy_p_Page_079.jpg
bf9faf9a55add90bc14bccc44500321c
ed9e0be75cf00c57d9e49291297af25acb0a0008
77434 F20101108_AAACLM mallikaratchy_p_Page_063.jpg
d2e98b6cf35b0cb88dd10d79de89210f
560c67378016a6027fc857ccdca3bd845c10ca04
80365 F20101108_AAACKY mallikaratchy_p_Page_044.jpg
f4ce450babc2653b53458d691864d359
84443ee3e411a26bfb620d1b932487ccc1fe1799
22560 F20101108_AAACMB mallikaratchy_p_Page_080.jpg
d06b7f410510866ded638eac45003b42
4828756a92d16b44b6c91e903dffc9d5e748a0ae
83404 F20101108_AAACLN mallikaratchy_p_Page_064.jpg
c03c4366af22d875af131c334fb2ca9f
1fd1f5e2b881aafd201a0a1a5d7f4e0c78812fc7
64474 F20101108_AAACKZ mallikaratchy_p_Page_045.jpg
2db23652380742bcd503b259d132cc14
8f6c66b7d6bf3578ad9749920f89cd985adc3104
82388 F20101108_AAACMC mallikaratchy_p_Page_081.jpg
9bc27c4881f65d4e23041413412949c1
4ce699bc5a4d35f45fcdd066ac31b2a46c303c6c
82489 F20101108_AAACLO mallikaratchy_p_Page_066.jpg
b1f49810560d77db2a995b2792088c27
7b98190ea1510a702aba351500e11ebcdc082a82
76756 F20101108_AAACMD mallikaratchy_p_Page_082.jpg
5d109e6f6ba8c9b0f845a7ff10275f2d
a89571332da0267b5d386e2298dad690af232069
86465 F20101108_AAACLP mallikaratchy_p_Page_067.jpg
7ec8b429034ef329297632ee4a2f45e3
0cd07eb044a52cf049cf8f222591d77449dca359
81095 F20101108_AAACME mallikaratchy_p_Page_083.jpg
bd6d20f67e2f30c19a4e76579f6a481d
8e56a5b7023ced629f1948b091e9b2937d0f9306
39763 F20101108_AAACLQ mallikaratchy_p_Page_068.jpg
86910a93bb287c79a4fa91cf8db0b02a
d29aafccd37e97be05059e016d98fc4fb0a30428
83660 F20101108_AAACMF mallikaratchy_p_Page_084.jpg
768e5b4025a813b2301822b813538e11
6935eea7f6862d1cfdd96623afcef383e00bc148
68848 F20101108_AAACLR mallikaratchy_p_Page_069.jpg
4a8e05383418c6b2fa2ee3013d71a8a3
a47f81b947e0fe948599a3735308c6d73de7ba6e
74289 F20101108_AAACMG mallikaratchy_p_Page_085.jpg
7fcce3229886877e9009f70808113e58
717ed823c604549a3c2b205320cd5c5ca426689b
77158 F20101108_AAACLS mallikaratchy_p_Page_071.jpg
b0d5eaa87e3f675dad09aaff5523c2f7
6efbfd23d5db263fc3c13284defeb3aa7b0e4aac
59098 F20101108_AAACMH mallikaratchy_p_Page_086.jpg
9578af4003c6e460189e118ac42941b0
0b18a250e42c2ad024d8d80e477d2c63bfa82dee
70484 F20101108_AAACLT mallikaratchy_p_Page_072.jpg
6e6c67bffa8545b81af4210b5be6a178
e6970f32dd4f9281229f2fdabcbe15937ba78838
51189 F20101108_AAACMI mallikaratchy_p_Page_087.jpg
b6324c61073dfc68e7ef7c098adb2f72
20180c56b32d9670778c1cd70a3168eb3185ba60
67960 F20101108_AAACLU mallikaratchy_p_Page_073.jpg
11bb1a2db9940b254c3fb12df03e3dd8
29a5982bc1314991ef51f2bb4ddee30132351677
77080 F20101108_AAACMJ mallikaratchy_p_Page_089.jpg
21414cb1a525a42d3bfceb235a96103b
3b38746ccfbe196bd142d47fd3c6473f5b7a3889
64606 F20101108_AAACMK mallikaratchy_p_Page_090.jpg
8214f012a66b1bc912075dfcd642c758
9d4cf6b66dc8d70bd2ea73d6afb342220a58dbc8
80338 F20101108_AAACLV mallikaratchy_p_Page_074.jpg
1144b7df68f0ef61dd839ffdf90de23f
c7b67bb3e02306acfb5df0af5016a153508376e2
75628 F20101108_AAACML mallikaratchy_p_Page_092.jpg
5e1acffa6cd49c67157bef52b8006ec0
773eba2271ee6d17f613d885bcaca8b94195bb59
57409 F20101108_AAACLW mallikaratchy_p_Page_075.jpg
8b51ea9b6fbb017c0f552e0ab1f4f060
ee38283ff00e6a9bcdaf24bb40876e1a752eafe4
77574 F20101108_AAACNA mallikaratchy_p_Page_110.jpg
ef9f74d74f3e6a893735dd252b2f3aac
33ea851e5e6699e72a60c6173ab2994789261ff9
91293 F20101108_AAACMM mallikaratchy_p_Page_095.jpg
130e49d743f2fab8dafd5b2ab9c96033
8ae4932dd85198614f653c97e379f2872a280762
53958 F20101108_AAACLX mallikaratchy_p_Page_076.jpg
7bc1c2dccc3d7c56e7db474794cebad4
1db65cf88ed156235a65036155d5841bfca1a556
88504 F20101108_AAACNB mallikaratchy_p_Page_111.jpg
90e7049d6e44ca149f8ef05baa9d2672
c1c8e902aeef1c9b6a041e8b90c959e9a9d692b7
71018 F20101108_AAACMN mallikaratchy_p_Page_096.jpg
91c0bf91ee4ec29289ff8e199b57d986
3878b1927ccf50d46e9544cfc41ec30131df51ed
88614 F20101108_AAACLY mallikaratchy_p_Page_077.jpg
c0eeb5609811ad2a664a36836eab00e5
ffb06c080fcb439b6241471c216465c646a9322a
89078 F20101108_AAACNC mallikaratchy_p_Page_114.jpg
bd05dc9e78b9c3e2879975d25d7775bb
e100a8855e91f460091ade2142f8f77c852f25bf
83438 F20101108_AAACMO mallikaratchy_p_Page_097.jpg
722da4bd6b5140305a18ea36bfcd6270
bc9304778c7868980af1e564a6dbd08c504251d5
86353 F20101108_AAACLZ mallikaratchy_p_Page_078.jpg
a34310eab928d5a0fdbb01140f8ecfe1
231479ad53f9d3e94c3371c54ff1a72563ccf8a8
24550 F20101108_AAACND mallikaratchy_p_Page_115.jpg
46113958a7027e282af52f1f738b723f
76f9bdcd4e106674dabb362553f2347f85611710
56756 F20101108_AAACMP mallikaratchy_p_Page_098.jpg
0147fea70b69d360ec6b5313a249b97f
1df2578dc09f80174f61e204f32d458da7d5e72b
16609 F20101108_AAACNE mallikaratchy_p_Page_116.jpg
433418c56951cc0369c5fd7af8c88d3e
87eefe0f2a5dd98faa0f78ceb3db2bd0573c0a5c
81173 F20101108_AAACMQ mallikaratchy_p_Page_099.jpg
b27f879ad9c868e111f7076a643fd473
9f5b96b64c6d2c3c47edcf250fa894a4cbca8b69
46049 F20101108_AAACNF mallikaratchy_p_Page_117.jpg
f76b1b825f3a2f449a79e058d552e9e0
56b01b4cbdcc9d082b39c8b853e3d08c00e56c1e
88328 F20101108_AAACMR mallikaratchy_p_Page_100.jpg
0d99eb87cc249b6158848b959ff71d69
6526f2cede47272a518733602041433a59e31fe1
62311 F20101108_AAACNG mallikaratchy_p_Page_118.jpg
2aa6fe0b7b92dba28447f60f4b800242
ccd57c233d52dd99d2304c77278af8c3037be189
43470 F20101108_AAACMS mallikaratchy_p_Page_101.jpg
c904ec8f861a6743c21a3af349a9a16e
3d4b6c58965a204a616032c8751044268a9e7180
40282 F20101108_AAACNH mallikaratchy_p_Page_120.jpg
efe627c9a2fc75b519b5b9e68414f2da
476cd1707ed6b0030bb201df5e8bb33d669ab65b
69972 F20101108_AAACMT mallikaratchy_p_Page_102.jpg
b2a9ccfbbac84baadd821205619f821b
c633cce20aed038ff05f5f0559ead23086ad18bc
36548 F20101108_AAACNI mallikaratchy_p_Page_121.jpg
f0ed22f20521ee086ab7b8b23f48854e
6a1cf09375298b06774f16b8c466e8a97f1ca4e8
58329 F20101108_AAACMU mallikaratchy_p_Page_103.jpg
4aacc9e3b5beda76b62bdf29b3e8ea2d
13b837293bd1b77aeb90a7ca160743fdfeaa281a
94046 F20101108_AAACNJ mallikaratchy_p_Page_122.jpg
3d0737e68d29c6be370edc92f985954d
39b36222b51ca13c8e01d0bd3e4eec1d0afde4d6
34692 F20101108_AAACMV mallikaratchy_p_Page_104.jpg
3d1429d00597227b49c808d6a0c41542
96de1733376705130df947e0584dec762899df5b
113103 F20101108_AAACNK mallikaratchy_p_Page_123.jpg
d858ab82af7e7a7415aedc4e039f9320
28fa34a486e6df2c6f454a424a87d5fa775920fb
114700 F20101108_AAACNL mallikaratchy_p_Page_124.jpg
9e7dcdc80aca6a6a2e398fe480dc338f
861ecc6e54d143b388f77e34cf9791d8e6852955
86094 F20101108_AAACMW mallikaratchy_p_Page_105.jpg
b2f24fddfe3d50671b98214b61973487
b1ff81a21b92bc7200efcd8d290bd0b3c3f0ca69
97619 F20101108_AAACNM mallikaratchy_p_Page_125.jpg
cfadbd4d7fa5e3f48b2c0b12e3c15ec0
c9c6dafff0e86e0c0a4c23ce468d66315700f84f
49533 F20101108_AAACMX mallikaratchy_p_Page_106.jpg
83ed817394d2d4f6f012c61368b60ae0
c61f404889c5e167143d0ab4b67a9b01ad64b792
1051965 F20101108_AAACOA mallikaratchy_p_Page_011.jp2
d1f023813a78179788d500c9dfda2761
3568e446a283f26d4026e0bbc2f8fe123475755f
102619 F20101108_AAACNN mallikaratchy_p_Page_126.jpg
e99c0d01cc3b741c7f3f9abe8d927d52
4d6771b159cf555a655e99ebd3d60997e60f9b8b
68129 F20101108_AAACMY mallikaratchy_p_Page_107.jpg
9b4968df080eec138c82948c3cc3de9d
e842e1e5e1513a43d291ce719464dcb3bfbd54b3
1050986 F20101108_AAACOB mallikaratchy_p_Page_012.jp2
3f9e18fe8e4562453d403ea7efc0c495
1d011513e2160048f9783a53ada2b60ed06ca71a
94831 F20101108_AAACNO mallikaratchy_p_Page_129.jpg
4ae757f19c092845803b58813c2e7ece
126dc8c08162d96d3d8a6cb4c06755011dbad9d1
24328 F20101108_AAACMZ mallikaratchy_p_Page_109.jpg
440383f238b674a926f8080f9d27ddfd
85928e0ed2ff0d8d5c8014b73e2750ecc9ca8800
855750 F20101108_AAACOC mallikaratchy_p_Page_013.jp2
14106cfde426a24a9599a0136666d5e9
44633b7883e3f8d48f264982b3a7b71d0adb3aba
88667 F20101108_AAACNP mallikaratchy_p_Page_131.jpg
c16bed568caf5ccb1d8f3d894a918309
9c482877e99bd5d128e93899a9da4455d8d4caf2
1051915 F20101108_AAACOD mallikaratchy_p_Page_014.jp2
6ac11b17af5b8ee90aabb08ca397aae3
90c4b774cd0b11c339b319dd9c35c9fc41bc53a5
106527 F20101108_AAACNQ mallikaratchy_p_Page_132.jpg
eff81a32470c22c4da0334575b5f6125
42de677fd38dc3d369efb3d102a44abc1c42f912
1051980 F20101108_AAACOE mallikaratchy_p_Page_016.jp2
7800d914f36f751b508df7ef03896a82
b5d1de6be48220f684f7471422961a58faaf05b8
1051954 F20101108_AAACOF mallikaratchy_p_Page_017.jp2
57a61754bd33f1dcf873229bd3d9c70e
36d519fa4ec7b69fcafd07e6d9956ae0031e969b
95434 F20101108_AAACNR mallikaratchy_p_Page_133.jpg
bc0766c2e277e8ca801ba9ac95b27b35
14f9c1a0fcd3735dd518f074d228f988580bd3d0
1051969 F20101108_AAACOG mallikaratchy_p_Page_019.jp2
b41b71042f58da51e237ee828eab7eab
4ea76265ee0efb40b05f2d16d7d2bc8fbd885693
68630 F20101108_AAACNS mallikaratchy_p_Page_136.jpg
e8d3a2a42f89115bb4c186b07571bd76
7b8c1905c5f5c487d36cae9e8f208b4877d26b64
1051983 F20101108_AAACOH mallikaratchy_p_Page_020.jp2
40702100963c994f6260ce71f6b1431c
835654652d021eef1bba8c30e6131c67f6c5a812
42191 F20101108_AAACNT mallikaratchy_p_Page_137.jpg
ea2d131253a1c7240d3f43f98854cb8e
c3b1c12e15958dd71753f7f23c1762576a55ab86
1051953 F20101108_AAACOI mallikaratchy_p_Page_021.jp2
afd6f09cfe84c6252f2208a02e55ff9a
cc1c39ce972d2f7cf6b9d2254540aab772400f80
32258 F20101108_AAACNU mallikaratchy_p_Page_002.jp2
fb8604180d4c3aa71456022d585fe71e
2f7f5b41d89c60983c7bfabca4a8606dba67816e
1051888 F20101108_AAACOJ mallikaratchy_p_Page_022.jp2
0192a2e76d7d65960155b292dc0796d7
0dcb36101c981d196b7521f9c1fa981dd87abdd5
17819 F20101108_AAACNV mallikaratchy_p_Page_003.jp2
c14023bea4e8cad67b7c356c6aee8df6
347d10c6085e08a22001d665e21b9a0d2069e86a
1051978 F20101108_AAACOK mallikaratchy_p_Page_023.jp2
2dd017090b3781aabb0d2e4dd218bb02
7422d7da6931a1637e6a09d5c69b0d8706a70417
F20101108_AAACNW mallikaratchy_p_Page_005.jp2
5a6a4bcd8b44e97ec6351fb9773a2656
2d2e1a7efe0def56d6f911de2bc83f3ec8f1ee66
1051973 F20101108_AAACOL mallikaratchy_p_Page_024.jp2
9c0195f063a0371a30f11f287651d8ee
3b4da6f8a1dae7936ea3a53eac3c33433307b75c
1051939 F20101108_AAACPA mallikaratchy_p_Page_051.jp2
d7770dc9dc9f2a60740d021a49d2ec83
3c1e7ed57d5aebd8e7d56f493508e836d7a41734
1051972 F20101108_AAACOM mallikaratchy_p_Page_025.jp2
894f7ccba8653874de37fb9f7bc2e924
6f704067741bc86f5a56d8958639d59d1f7b0808
F20101108_AAACNX mallikaratchy_p_Page_007.jp2
d529916d11cc61aa445df2f4089d89f6
aedd0de7c9c196f0b0d58a26a4b894acb655f010
927198 F20101108_AAACPB mallikaratchy_p_Page_054.jp2
71149d6004ace43b33da223ceee7e7fb
d4ad95a2442e2b3e3c896dab23a135fc06c601d6
1051970 F20101108_AAACON mallikaratchy_p_Page_026.jp2
9c77172ace91cb9a2c0f4db78707f26f
7893cb3bbda2d4f1430b2ee0af2e56adf3fc8dc4
F20101108_AAACNY mallikaratchy_p_Page_009.jp2
2c2a5f52ce225e584c79b64ed04892b3
d983850075d2683afbefed56e18b19a372855c71
558824 F20101108_AAACPC mallikaratchy_p_Page_055.jp2
1183dd6b4b23ddd18eed0317c3f92180
dfc07d515e91b8fc42a67ff94cd6476c20c47bb8
1051967 F20101108_AAACOO mallikaratchy_p_Page_027.jp2
e38640fc393b6d4930b9958d03554a1e
1233d0b9f69917bc49f844fe0b23099f7a66009a
F20101108_AAACNZ mallikaratchy_p_Page_010.jp2
4696c660733addba43f5732fea3addf8
b94f3706a01b2fcb02dbb241b0b58b4f737197af
1013696 F20101108_AAACPD mallikaratchy_p_Page_059.jp2
352010c9bd5c79349f5d9c8138958881
bcebf4ca6c896c26e866a035f64ec6bd7a4d13f2
1051968 F20101108_AAACOP mallikaratchy_p_Page_028.jp2
df6523a2aad9ccc4dc462e1e1dcdcced
7bf55826e17241e3bbd9ff7a926b74d6aa7848a2
1051933 F20101108_AAACPE mallikaratchy_p_Page_060.jp2
f3335d20c153aedb245160da4bb4b4a3
65f5dba4891ca94fd8921bfc4b8a7faaa703dc24
F20101108_AAACOQ mallikaratchy_p_Page_029.jp2
a6de83f63f3684571036792602bcdba0
156a7b31a6daa9bb67674a394a5a2271355af1fd
1051961 F20101108_AAACPF mallikaratchy_p_Page_061.jp2
e2089c2a54abeb4608bcdbc945ba596c
8033af16d98240160f37b5e834da61c435c549f4
1051952 F20101108_AAACOR mallikaratchy_p_Page_030.jp2
e32406989777ace464b63487c9ad0ba2
e63145a2daa887aedeafa2789a02fbe87f11d645
1051985 F20101108_AAACPG mallikaratchy_p_Page_062.jp2
711b872a4d55ff389004cda85a52e669
3a5d395ea52c84a58ebe5ba43f39113d1038f684
F20101108_AAACOS mallikaratchy_p_Page_032.jp2
f5606f30f7766cc9e6f120cd33be8741
ff72731d9dff3c69db146f8026503f876d9c9a0b
F20101108_AAACPH mallikaratchy_p_Page_063.jp2
ffa417954d11b85738ea3c6966ddc8c4
1d7120aae957791ece74255f58fe819a3d4ab315
977129 F20101108_AAACOT mallikaratchy_p_Page_033.jp2
e1fab9d0edc3995cfcb869ad8ccad1ef
9d29ac6a0d4475327df74e9bd26dc051a3f2bb3c
1051868 F20101108_AAACPI mallikaratchy_p_Page_064.jp2
27e6565236dc3b2f079a13fededa1dc6
cdd58447f359b0f356bd4e9b79a7d54f162ec617
948117 F20101108_AAACOU mallikaratchy_p_Page_041.jp2
865c6e6c55aa8e1d8806b2aa81bb1ec3
7bf7d79607fe23cf70ce53119ba5dde89822c710
F20101108_AAACPJ mallikaratchy_p_Page_065.jp2
9fc69f888d5b43fea346b71edfb96f21
e76c775a8f3c4440ec816c7dc9f986cd5782f717
1051962 F20101108_AAACOV mallikaratchy_p_Page_043.jp2
a1371fe895d5a1e5f8caf1fa13d3d188
d8e57e429f7704c85b5cbd682b465517b561e51c
1051966 F20101108_AAACPK mallikaratchy_p_Page_066.jp2
60cbd2a4ddbf0a84c222fb6e0226b5bd
681f522fdbb68dd2a1892e40963ca7b97c3090b1
951108 F20101108_AAACOW mallikaratchy_p_Page_045.jp2
19e93795e9bb72942273ee05f8f5f0b5
d18282df273ca78b091c3f3f529ae37aeb8ca2cb
F20101108_AAACPL mallikaratchy_p_Page_067.jp2
891e4d17a98992cbea1c96507047dc18
69b8bbcfb161ba9d049fcba0087fb15e077da790
1051956 F20101108_AAACOX mallikaratchy_p_Page_047.jp2
0319a6fcaacf7280adea2c046629f711
c584060d7c6a8da48718f8caf507e8cb8861619c
1051984 F20101108_AAACPM mallikaratchy_p_Page_071.jp2
fc37a0569501d03bd4d22f7679282e56
75af2c199e8181abbc828a943452f3da52558711
1051788 F20101108_AAACQA mallikaratchy_p_Page_091.jp2
d431450a260aa52ad24d0de28ca7133e
6013339256b8658bea3ec02797d893386169fc9b
1051926 F20101108_AAACPN mallikaratchy_p_Page_072.jp2
ac9c29b5c3b5f365917a8b94d6ab68e8
9dafcb7fabb17f325c4a0a34c4d6f56c345a519c
1051946 F20101108_AAACOY mallikaratchy_p_Page_049.jp2
c6e0fabdec7af75a825f8a76e48ef4f8
924347bfe065f1fcec0b9240cda64a4212a691b9
F20101108_AAACQB mallikaratchy_p_Page_092.jp2
33f5d35abb18fd8233522030adee4e1f
1da9dde93cb4136aed1b64f7296a0f6e8ee2b00f
F20101108_AAACPO mallikaratchy_p_Page_074.jp2
0028554f4881e7d4ff45badd5190f1cf
c3cfa1bbde5c4eb6d37e8c40e863b7e52418c81e
F20101108_AAACOZ mallikaratchy_p_Page_050.jp2
14c422428d32e8a2a81a6f9207e930f8
82ed34e211a652f1ab40d11ca5787fb387af0207
998645 F20101108_AAACQC mallikaratchy_p_Page_093.jp2
826a7c8d3eebd7f7945bb4ed127c912e
52cb41307b50323bdbe4b7b985f093e5b71dc9ab
1051976 F20101108_AAACPP mallikaratchy_p_Page_075.jp2
58d88c9b109f8301b145eb888bc70ef0
295b125da3d8a5367ac8baed41e7f9e02367de62
939183 F20101108_AAACQD mallikaratchy_p_Page_094.jp2
c695462ab1c9cbaa5d6b3ce07b512653
32d384a13e310c3489ca0242588e0d432f5ea687
1050021 F20101108_AAACPQ mallikaratchy_p_Page_076.jp2
40e5c9666879c4d980222a0de0a0bff6
8d39076300f991f32f36ef287b81d7d1a16e5c62
F20101108_AAACQE mallikaratchy_p_Page_095.jp2
2c19350b061ff74a594a502cc9a7b59e
7133dd77cca3bc07e29c1807b4a7b9225a1e62bc
1051959 F20101108_AAACPR mallikaratchy_p_Page_077.jp2
6d96e7650c112e60ff8f2150544b4426
1288ebc12db76806235339fd9556ef58c0ddf423
F20101108_AAACQF mallikaratchy_p_Page_096.jp2
d126b7dc1b8f8ab313678a26b98af457
c598c714b6e82de013452289a57b949ead4d949a
F20101108_AAACPS mallikaratchy_p_Page_078.jp2
13a53111cba9fbce64165dc4a03ab529
9a66865c6b0519c3a98141a02aeb28fd7fe6fdb4
F20101108_AAACQG mallikaratchy_p_Page_097.jp2
04e627fc734ebaad887442f30b58a0bd
a69e0a545ff8626828221f3f0ecb1394dcea14c9
229657 F20101108_AAACPT mallikaratchy_p_Page_080.jp2
8b240e24641fec4149b039a51ea3d731
a1ca191892c197531b6e1c2aab9447b516670497
812331 F20101108_AAACQH mallikaratchy_p_Page_098.jp2
640283d8d757cc4b6766d2aefd728b6f
8df9128efa281fa93f7b959d8c86062d260f145f
F20101108_AAACPU mallikaratchy_p_Page_081.jp2
8131a43a758a1bddac59fc0237ba9314
a13dab518992ab40df09f94016b69e29eff1e91b
F20101108_AAACQI mallikaratchy_p_Page_099.jp2
09e0eef497676412f147fc388e33d8ef
01acd41eb74c1f74e250503d63eaa69d239c9223
F20101108_AAACPV mallikaratchy_p_Page_082.jp2
1de404a07408dbe46716c76eaa1ee909
cd21aaebf53d4903904f43f5cd5fc5c4b183e237
1051949 F20101108_AAACQJ mallikaratchy_p_Page_100.jp2
7363dad1b565527a8795f7811c0a6067
2e992a26971f37567024115bd4771a2f031cf1fb
F20101108_AAACPW mallikaratchy_p_Page_085.jp2
3bf0611ac05a8654f93e3bb861aca551
bfcd09f1009da713baf3b045b0fc7913fa57e7c9
1025798 F20101108_AAACQK mallikaratchy_p_Page_102.jp2
6579527c0c64a6cd785a9adffa7420c8
fa5e3735bb4e801b3862fe99773df94caa72d9fc
914335 F20101108_AAACPX mallikaratchy_p_Page_086.jp2
f28128ae3fdb93215d140301eb9eaaee
9de50726ca4117f59da0aa1a311a1dd52a395922
893248 F20101108_AAACQL mallikaratchy_p_Page_103.jp2
f1b38083d760ceef82766cf8d9be806f
d0272607890fa14aab68c9c85dc7397bab79f04e
929786 F20101108_AAACPY mallikaratchy_p_Page_088.jp2
be54326e7b71e840f74b83b93c8588c1
04ba240f47a4bf1cba826c7e4f3fe727f8016a82
1051907 F20101108_AAACRA mallikaratchy_p_Page_131.jp2
27e9fc21a557930ab4ff7c523991e3bd
2dfcad977a4fe8785d03975b0f077c9cb84edbcb
432155 F20101108_AAACQM mallikaratchy_p_Page_104.jp2
97a5040df83bd82316cd9af2dd30e8e7
6b971709481f717996f6090863aca0025da2fbca
F20101108_AAACRB mallikaratchy_p_Page_133.jp2
99b394818aa08b46234773f4c06dd8d3
95755a298ac0a7fb9d28831784a1620eefbc1662
1051947 F20101108_AAACQN mallikaratchy_p_Page_105.jp2
09086e7d94262ba725463938b19073cf
721a39d5582790504bf3aba781d911b875d1be6d
963142 F20101108_AAACPZ mallikaratchy_p_Page_090.jp2
09bba2037e77b1610552087a048a4cdb
c4dc653572e22b4b6deb770546b980ff07c03708
F20101108_AAACRC mallikaratchy_p_Page_135.jp2
4f40912d3621d52df58b3120275c7ee3
3254bc4e171e5948400543d101178780100b7da6
1018463 F20101108_AAACQO mallikaratchy_p_Page_107.jp2
72afc7cebd1afb252deaedce027d46c3
2e3b636fd9cbfb810c2d7bb690abb4e7ec450981
897934 F20101108_AAACRD mallikaratchy_p_Page_136.jp2
083af4fd70bdf41b5a47e70e1028eff4
f4c1c762a980e9ce147ec0e1810d6954d3cb558c
727854 F20101108_AAACQP mallikaratchy_p_Page_108.jp2
c806f197fb7de449d0af74f676a1c6d5
71fc7b4a4c6e77704b46a1ba74c6ed94e32d5485
F20101108_AAACRE mallikaratchy_p_Page_002.tif
3176a4aac3ccbfcec4ae398d3f80923a
7cc88ef29a5110def869afc49072958347dbf775
F20101108_AAACQQ mallikaratchy_p_Page_110.jp2
9e5b7d006b6dc414a6de434fb5a42999
ad222d7ed29e60408ec1b669ab5747e6997fc0bd
F20101108_AAACRF mallikaratchy_p_Page_003.tif
4fe03b9cf4d162be62786944fbdfd57a
41c3d10cf4301a3dc481355926a6980b206c02c5
1051960 F20101108_AAACQR mallikaratchy_p_Page_113.jp2
8d81e751b2ae1123d36690883aeaffda
a6babdb852e130f158167ea5f6d83dd39a40bc5f
F20101108_AAACRG mallikaratchy_p_Page_004.tif
326b6237abb1f1da971450641f64b4f4
539add6050b960c3bd6a982eb5db4553e1be4e9f
261460 F20101108_AAACQS mallikaratchy_p_Page_115.jp2
c7c821d33e94e13dcb4a07877fd0d2ba
cff7e0301f1eb23ec03eb2019e34cf75aeb33f7f
F20101108_AAACRH mallikaratchy_p_Page_005.tif
84b16add3beb3cc2b668c531d47b40bd
a4f57d26283a339607e564c34b9f644cdd2fa552
117076 F20101108_AAACQT mallikaratchy_p_Page_116.jp2
3b58b8b7eec769e62797507f754dd92d
a3792a53eacdc11b74496508e3cf934bd0808952
F20101108_AAACRI mallikaratchy_p_Page_006.tif
85977daaf81ec4d68e155af74c474620
8ba52dad8d3feaabeb0ef0b09b97aac31c8bb385
704113 F20101108_AAACQU mallikaratchy_p_Page_117.jp2
3c0c9ee1daf1dca6a48c61160b691f2e
35d5c458fb4b39fdab8d42cac818de1032ed9c01
F20101108_AAACRJ mallikaratchy_p_Page_007.tif
e38fb13578f206ff44d8b166cdb6cd45
a51c74c75bbdb0af7a71aa43660c769d49fd31d1
1021080 F20101108_AAACQV mallikaratchy_p_Page_118.jp2
0ae3ee0f32c5922becf2f26f1b9fc3d4
3d4802b170593f947190356cbf536f6a6d367acb
F20101108_AAACRK mallikaratchy_p_Page_008.tif
241a2a777f362d952c639882b929c2b0
831548be67cc33062a626d1c9a50587b5ac1bd1a
F20101108_AAACQW mallikaratchy_p_Page_119.jp2
eb1f80ceb8fa3fbf9fb072c76b029611
279df274aa0957ce11e20bdad8248544fa3d0534
F20101108_AAACRL mallikaratchy_p_Page_010.tif
bace80c6d50a1586cbf9b348d305a175
9656cde4519952312702bc297e44d0d287d85c92
618284 F20101108_AAACQX mallikaratchy_p_Page_120.jp2
ef22b74f181ab27d74498862e6cd1737
f9adb33fc88c1aa2062e877ae1bb0cebd60c5213
F20101108_AAACSA mallikaratchy_p_Page_035.tif
1ac000d1f6917264844efb8b49ab855a
5f953f48358f5878f1ceac27f44912209878b3e7
F20101108_AAACRM mallikaratchy_p_Page_011.tif
5a6e4b6a8349edbf41efc851575d7fdd
b9a65089e5f5c7e1cc33e09aeeff87df604c9dc9
579215 F20101108_AAACQY mallikaratchy_p_Page_121.jp2
61089220dd08f0546cc556648bd372e4
0e6abb224a2f15d527877c67289feceb77911cc1
F20101108_AAACSB mallikaratchy_p_Page_037.tif
e5f974a5736ae4b10fd1b41637c7c9d1
06ff111d6966bf422a2f2ecc2c040f6bceb91ded
F20101108_AAACRN mallikaratchy_p_Page_013.tif
e66a9c138fa6751c503c7e0dbd3e2b5b
7e15c42b3c139354c7f459880961cd7a1c2603bc
F20101108_AAACQZ mallikaratchy_p_Page_124.jp2
ebf96f7f02e7aa8914ed2fa973cb708f
8a93db4df8cfc142cc18ab35cb1d220315f465bb
F20101108_AAACSC mallikaratchy_p_Page_038.tif
68bdc1145762758c56f05b41bd15a83b
b9720bb98fb3c78dbcfb9d557dc7439a4b566224
F20101108_AAACRO mallikaratchy_p_Page_014.tif
5e054c4831dd6cbd979dd650a4153986
4205464f5980d4f1459bba2bead7a8c432a49ed2
F20101108_AAACSD mallikaratchy_p_Page_039.tif
aadcb236a48c6d69e47ac88445ed6249
fbca13cbede4737d50409cffd0d8bcb5ae6911c0
F20101108_AAACRP mallikaratchy_p_Page_015.tif
763b34808a2ac1cc48e33140333e668b
e7ae728e6174b1c8196f973afc687407c56fd7c6
F20101108_AAACSE mallikaratchy_p_Page_040.tif
c601a986a02aec12304fccae77eb84fe
e0f63b52eb7f701d5ce9cd9c297887dd8143dec4
F20101108_AAACRQ mallikaratchy_p_Page_016.tif
d53aed881ead627fa76ebf6fdc18b706
5a14e7d83ebc1a111f265009ad54e17c9d430f98
F20101108_AAACSF mallikaratchy_p_Page_042.tif
a4c38fbfac9f629890642c1a6a99d00c
2b83093ef66bddadd82da185fa589f07b8a86e0b
F20101108_AAACRR mallikaratchy_p_Page_017.tif
232946888fdb6260bcdda0aa1c6b4b5f
891dd8eb5181703887b8212e23694c9380650125
F20101108_AAACSG mallikaratchy_p_Page_043.tif
b9cde79b5e93fe6c689e3b7b0557141f
cfbfe2fd7014cc672d35efba6891916857f73149
F20101108_AAACRS mallikaratchy_p_Page_019.tif
5ce94550888ebb50fee9929154fd1938
4130c9a5e5333b5e53eebf6eef34a7ed874fd6ce
F20101108_AAACSH mallikaratchy_p_Page_044.tif
aee356277a4f57cca520d51cdf175335
e835499c544e2f4baa68c252e2815d92c367c797
F20101108_AAACRT mallikaratchy_p_Page_024.tif
dc1d4599bff2cedeb565266b14418dbd
fabdc013f942011aaa0e2d9e773a165c67c0e09f
F20101108_AAACSI mallikaratchy_p_Page_045.tif
82aebbe23528635bf5aad2c5890f358a
ecc73d1cc39be43aea9f4bc80695232d2c2515a4
F20101108_AAACRU mallikaratchy_p_Page_026.tif
4d94044fd0946c3cd949837aa4c5f1e2
73a85f01bbe23c69230b3192e1ee31e808c2eab1
F20101108_AAACSJ mallikaratchy_p_Page_046.tif
fb38b3c11764d789b18a83fbb4d6c051
9a6aa2d20ce8042a7120abc01bae7cc5c22622b1
F20101108_AAACRV mallikaratchy_p_Page_027.tif
1b4af6e5b763e2f871b87071a7223727
83d1de902958df9efd215cbdfae1f0c110b07382
F20101108_AAACSK mallikaratchy_p_Page_047.tif
1b8c687eb22d261a03dfac090565f930
94a702cc32fa5bd4598d27b34f7afa7cbff7d13a
F20101108_AAACRW mallikaratchy_p_Page_029.tif
2017dce8106ac8e0de581841ee78024b
0643797911010e953696129bf25d9e5f705e6063
F20101108_AAACSL mallikaratchy_p_Page_051.tif
53c37c21714568390553d13746ccc2da
4e37ff77544b271356dfda87b1280372d6d6d9c5
F20101108_AAACRX mallikaratchy_p_Page_030.tif
9d57c60218805298816688532c77f253
77f2d4af19a3b47fa2e91ec416f0518569ad63d1
F20101108_AAACSM mallikaratchy_p_Page_053.tif
5c0e4ea21cc24feeb62fcb082f14d710
25dd5974ca90d484223eb7d579272a382c717e62
F20101108_AAACRY mallikaratchy_p_Page_032.tif
5934986f2c920123a46ac14bb68b40f9
c822ec7d8b20133b9fd016bc123b3c6c938f59e5
F20101108_AAACTA mallikaratchy_p_Page_076.tif
e44a69c29ba58e14cf97dd4e533f52ac
4858ea2490f0fd512583b64fb5b26ba28875b373
F20101108_AAACSN mallikaratchy_p_Page_054.tif
6467cf0f035911d553086b8812b9f874
b919d260738eebd69a37e9b1281a9df322b56a2c
F20101108_AAACRZ mallikaratchy_p_Page_034.tif
a962366b450775e5131cbcb5d79d0f86
edad45e10999cd347320161c19c3c59c4879bdb1
F20101108_AAACTB mallikaratchy_p_Page_077.tif
6fcdb450bcebcbb140d39a8b9db6e558
cd11609c5de323f32613db35f632e1224ea99e6d
F20101108_AAACTC mallikaratchy_p_Page_079.tif
310c077b7c03dd2cb446caf80d9e5a04
eaae7d69977121931999672d863295eae119d7da
F20101108_AAACSO mallikaratchy_p_Page_056.tif
717fe56213397e045101a1f8b8b53766
ab68c0ecbac7ed508fb19dc7a490a02c1a72e1b4
F20101108_AAACTD mallikaratchy_p_Page_084.tif
1dbdeca4c9391faa782ee49b4dcd9e46
aabfed17ffc581ad57aa60ef9c732ea5776234de
F20101108_AAACSP mallikaratchy_p_Page_057.tif
ef94b17eac24c086799d9955d9053bd6
3c5d1170a790e4394e6a97bced4eba117a41beed
F20101108_AAACTE mallikaratchy_p_Page_085.tif
14dec0971e164c2b7da392f81ad7a77d
47a43da3d8917328c7c515313a65fc382eae508d
F20101108_AAACSQ mallikaratchy_p_Page_059.tif
0edd6825b377660f165ae257af231aa9
3177e3fba11d2a5f8d6b2de8ed664153e9d93513
F20101108_AAACTF mallikaratchy_p_Page_086.tif
f1a5e140bb2847b7d27e59ee53bfa150
979cb7a47ecbcec1b219c1b31932601e11006d2a
F20101108_AAACSR mallikaratchy_p_Page_060.tif
51f32657216426ab7647ba0b8432ca5d
d8944a2ab11a73e571adedf6421899bc7aae325d
F20101108_AAACTG mallikaratchy_p_Page_087.tif
d574570daf5fed9e5072919d904eba04
c99e03f2de0f40810c6223996a8ed95bb228dfa5
F20101108_AAACSS mallikaratchy_p_Page_061.tif
e2a422c021e7881dddc6f342886736dd
86b16e3ff96de3a58a37a8cdc101922ed0862932
F20101108_AAACTH mallikaratchy_p_Page_091.tif
6fdc4a010d06f1362011a5d590e95da8
d92d15ef450eaff189fbd6c0e8932486be05a1b3
F20101108_AAACST mallikaratchy_p_Page_062.tif
534667335c3082433966c44dde48630d
98dfeec20dcfd1746c0432ebe959b3dff14f6580
F20101108_AAACTI mallikaratchy_p_Page_092.tif
76c53398080dfac95431fbe934876b11
4f5075a4bd3a1d338432d05fda0a174601fae9b7
F20101108_AAACSU mallikaratchy_p_Page_063.tif
177d4a9a37d0b9a25819dceaa9b3d169
0d905f4889238bd44a98cf75872b3d959085d94e
F20101108_AAACTJ mallikaratchy_p_Page_093.tif
7917224272f32001014b57249c70e1d9
64dd1bbe9c6e5d8698eecfbf9d5f3cf9a06bcdae
F20101108_AAACSV mallikaratchy_p_Page_064.tif
1e5020009d693f807de47790d140f0ff
27df3ddceb62bf6c6da9ee558a103aabd41acfc5
F20101108_AAACTK mallikaratchy_p_Page_095.tif
4f65f9c928beb4799d57af1acc8dbdab
b8adcfd467e9dfb91daa4478e592f1f661730cd5
F20101108_AAACSW mallikaratchy_p_Page_065.tif
431ea99273966749477188f81a44d836
4f863f36ab11da1524fc6367cd744249db38e4fa
F20101108_AAACTL mallikaratchy_p_Page_097.tif
0bfaff31792775f84bdf4be5e108a133
8b5a91a616aa08033fbcf03f9c4b4237c5fa8fc7
F20101108_AAACSX mallikaratchy_p_Page_066.tif
0cc1faaa2fa2317f6d06af9277fa1e0d
38a8c5bc67179c54c52863654b57eaf523a3cf06
F20101108_AAACUA mallikaratchy_p_Page_122.tif
41b685e0e24a84db48165f3c14ef1949
e16a13fbefa8c687e9d1bc418140a99f1ee31c81
F20101108_AAACTM mallikaratchy_p_Page_099.tif
7aa3b09a41d79c3fd00009f0c36773b2
dfe9f40f85f7dcd22db22ef1ffedd837a8e74bce
F20101108_AAACSY mallikaratchy_p_Page_069.tif
cc4dc5fca3296575afbc488107427272
662f3b59eefc0d6b70338d1428d2092c5eb51f5e
F20101108_AAACUB mallikaratchy_p_Page_123.tif
324212d29403fcd7088bce5a2130a577
77d22f1f639b70845ca3921341a7e350d82b3ace
F20101108_AAACTN mallikaratchy_p_Page_100.tif
566ab71e00d0ccd5c95fa8e5babc9cd2
7ad3f46b2cb41d6ef90e35cebdcf8024f9a5f61d
F20101108_AAACSZ mallikaratchy_p_Page_074.tif
ccb03830fd8d1a4d5d1581273263b347
4efc609c36cf2653f4ca178d85e9dc7f3737e350
F20101108_AAACUC mallikaratchy_p_Page_124.tif
e822747dea450377f4096f525ca01aa3
3aa299b0039d26a555115613578cfa8862bd792e
F20101108_AAACTO mallikaratchy_p_Page_101.tif
6af6cd643f05caa88e8be5d55369955a
bfa68cca662a0cc2701a8990068175549f50b65f
F20101108_AAACUD mallikaratchy_p_Page_125.tif
30d46625e6651e9ead46c914a8546f1d
d21a86612316676c56c6fd2d400df22e345fc8bb
F20101108_AAACTP mallikaratchy_p_Page_102.tif
5096e87d6a3f9988251b266bfe2c6c39
5b5689bd48336a26b9ca7ef3590215b669ca31c7
F20101108_AAACUE mallikaratchy_p_Page_126.tif
4a146859297b0b0dc1a83d9b740490c4
840fe2a24f1d2d532e53ccb35fcaf127151bbc42
F20101108_AAACTQ mallikaratchy_p_Page_103.tif
71eebde94621a5c312736cf6772fc8c5
68f6b5a08a9a5bb6daa062b996ebbe50ff77b243
F20101108_AAACUF mallikaratchy_p_Page_127.tif
171497b1f2f041cbb052ea775f7f66da
7ada6849dc968798a2387b6276a7f424ea951847
F20101108_AAACTR mallikaratchy_p_Page_106.tif
67d5d6cd5449969b71b485bab8fdbe59
e05607491c089ad54faba81014e011b954add7b8
1676 F20101108_AAADAA mallikaratchy_p_Page_088.txt
d815da1023fc711165c8e6c496625844
e75783736a0dc2b29d5670a794fc8f1f956e30f9
F20101108_AAACUG mallikaratchy_p_Page_128.tif
5e780245b74f451390affa4610d514a0
35435c9b89b5f4ed82175fea820102d384d3041b
F20101108_AAACTS mallikaratchy_p_Page_107.tif
6bceaa08c738360ee3471c307fc84591
a776a6974fc5a28dfd9fe9465eace387fe7e26dc
1619 F20101108_AAADAB mallikaratchy_p_Page_090.txt
501f1f2a16f601c3619bcbe3cbcc5ad4
6b6058bf199d87f77ae29db192bbb43355f0f684
F20101108_AAACUH mallikaratchy_p_Page_130.tif
efe5e4fb9bac053d74dd6e2d8ab5ea67
9763288f5495454f531a2f9f9ad50154167a685d
F20101108_AAACTT mallikaratchy_p_Page_109.tif
306ee9596723e8f2f55acbc8f45249c9
da1e9a1d1cffb7314dcea4629b781ddfdf90ff9a
1551 F20101108_AAADAC mallikaratchy_p_Page_091.txt
37bc5ad355c42020cdcc5ae8e31ec832
16ef40e54cc702ddbc32342c86b53db1c0ae5dc0
F20101108_AAACUI mallikaratchy_p_Page_131.tif
f9084c2bcf990526d4c9be7ab2f62649
aef1a529ec184c1ceefc7397da9fe6d89b112213
F20101108_AAACTU mallikaratchy_p_Page_111.tif
f184d1df3a721b8bd9ae0241dfc79414
eed75ef9060ddff82b3340373b2fbb5998261d9d
1988 F20101108_AAADAD mallikaratchy_p_Page_092.txt
607fee20fe72bb8b869942179e8a8b49
4da7ff0585853dd0551f98d1afdcd6926207c5b8
F20101108_AAACUJ mallikaratchy_p_Page_135.tif
8fb6453ddf2a77fb43927663d234cc56
7798b4b9c3d06fb81ee0690ff40c958968a3d1d1
F20101108_AAACTV mallikaratchy_p_Page_113.tif
95bce0d488f46ddb79d6495c88eb1c27
24cce5fea6dde62e7994516bda57e4f2f94a1d62
1705 F20101108_AAADAE mallikaratchy_p_Page_093.txt
e2b24c71b3811a650b206b8786bde4b3
8440c6e0655d2905fbb217c5d1b0eb300317e846
F20101108_AAACUK mallikaratchy_p_Page_136.tif
a10277f29c8c59ddf5179ac13c7140fc
14786ea202d8d97f6379b40bd693cf5a7a63f3b8
F20101108_AAACTW mallikaratchy_p_Page_116.tif
6350b0d5f6f8961f4fa4a9a6b0597deb
7bf59fc3074123d885768fe055df7f181577f103
1496 F20101108_AAADAF mallikaratchy_p_Page_094.txt
30e154aaf9b7237d077f2aa868fd2fe8
c91ec0fa358d4c10073a1202830a22ac700090d8
F20101108_AAACUL mallikaratchy_p_Page_137.tif
63b2a5396756e8a1478728356c169d27
1bcd012e6c27153fd5bb1a34df8774fced6efb18
F20101108_AAACTX mallikaratchy_p_Page_117.tif
76ebee211017ff4c031b7bbd43c5dfd8
d9b30e006e3ce8e0d3913cffbcd64d0c77007f72
2291 F20101108_AAADAG mallikaratchy_p_Page_095.txt
5069b065d0931b35dd1ff3606a743489
bf4db83b0012c9161cd1c37952ef4b4f4aab2f2f
8669 F20101108_AAACUM mallikaratchy_p_Page_001.pro
0d012a7e64cccf53692d4828e8deb788
66360c8b9c455c0ff8ceef9ff8f067e61b65cae1
F20101108_AAACTY mallikaratchy_p_Page_118.tif
db9e3b89c78782c56fe9f5b3a9f14f30
bacd077ea296af09bf7385901ee91e3725cbb685
1264 F20101108_AAADAH mallikaratchy_p_Page_098.txt
773446281459c44ea970ce4e56d8587d
e11071143a55f3800266aea0cee4987cee7d74cd
56209 F20101108_AAACVA mallikaratchy_p_Page_024.pro
110223f9e25083fb0b7d16fcf4f525a9
aa0076ab67a6ca7cc006ac0ae4700b0211b0a1aa
1097 F20101108_AAACUN mallikaratchy_p_Page_002.pro
63050ad948fa6ab2c78dede3d357922a
1f2e871997492133e873c1aca8c981a7795456b7
F20101108_AAACTZ mallikaratchy_p_Page_120.tif
b7dc303a8488e2cf857226ba61d73fa6
ca1f7c314d880b90a4595af89230ad885d1fb14e
1945 F20101108_AAADAI mallikaratchy_p_Page_099.txt
9ab4f31e86917a1b1610037193509fdb
503e381fccdc0e9caf20f84310cfdb185cc87e08
52650 F20101108_AAACVB mallikaratchy_p_Page_025.pro
cd03e852b5e6652aef29cde35bfa64b9
97688142867c5905daeddaaeb42e228d27876044
44291 F20101108_AAACUO mallikaratchy_p_Page_004.pro
832472a242cb201d74ee7a32dd36c812
0719dbbee41deff1f67b0fe0b2103d42dd7c88ad
33141 F20101108_AAACVC mallikaratchy_p_Page_027.pro
5754acbebad9ee6deac29ddce45e73d1
b37b825b7394931dd304ede43f76e15a85582290
78122 F20101108_AAACUP mallikaratchy_p_Page_005.pro
08696ea7f1738194dc27617f08d7ade6
06b669dcadb7611af5971a465254df63a94d3467
2052 F20101108_AAADAJ mallikaratchy_p_Page_100.txt
907f1b58b6027ccb92bdbefc28371f09
703d0c280d3e5042a6ce27fc65f5540af0740411
54081 F20101108_AAACVD mallikaratchy_p_Page_029.pro
f231d8f1fbd3f1a5fb15b76cafda6a60
5fba769a59bafd94163ba9289629983fa8f08964
57330 F20101108_AAACUQ mallikaratchy_p_Page_007.pro
4cb5bb2b015a884646039435f9df8bab
ef9e82c2bb80af63f11f582fabe44af31dd0b4ab
850 F20101108_AAADAK mallikaratchy_p_Page_101.txt
e0f22b15b9e4cf56c1f0e2e399fb5db6
de14c6a80bf53cbc18d3505dda04699a7758ce02
52612 F20101108_AAACVE mallikaratchy_p_Page_030.pro
7082cd97c8902ce93edfde9cf97d1fc2
44a62a1a37a253d3c572be5974745a897a04dcb6
64452 F20101108_AAACUR mallikaratchy_p_Page_010.pro
891ae2f527cd07ece24301e051885c92
38ffc68b3f56170d07e624353e977f3be70bda53
2593 F20101108_AAADBA mallikaratchy_p_Page_126.txt
00a71bbe6613800b7f2356f4bebd1b8d
2aae2d62785159751f923905c91f9f40b97ca3a3
1665 F20101108_AAADAL mallikaratchy_p_Page_102.txt
6efb2a339120bf2f3bd8686a96b1e399
f231c5097c177514a9bf1a5d444e58f30ff8fa35
53740 F20101108_AAACVF mallikaratchy_p_Page_032.pro
8bc54f0e56de19708141ee7e7f4b46d3
12f5635e1f4e358f6ca3fb50df41d8f1bdb5cc3a
45509 F20101108_AAACUS mallikaratchy_p_Page_012.pro
4bfbda0d33919222bf892f0cc88c8cdb
2eda8a5ffcd232e25b2fb6ef5a3c7b0f9540a2ae
2544 F20101108_AAADBB mallikaratchy_p_Page_129.txt
381d5c61fd919d8551ddcff3ecc81e52
71890ca869a20267173ccb3265525f096054672b
1018 F20101108_AAADAM mallikaratchy_p_Page_106.txt
91fcdf7a3ee701b5edd46f108031ad8a
e0e36be44926923b95d27a9eb1d8ffa2ef396726
39522 F20101108_AAACVG mallikaratchy_p_Page_033.pro
4741c214b180fa08dd752ab02ea0b7b0
00cdd53b5ea2a743e4130a311dbed26f05953b03
37229 F20101108_AAACUT mallikaratchy_p_Page_013.pro
d13c12d1a6944539e240f89c45dca4c4
e2e14fa9b45ed1c5f810d988a9bed51685b93e4a
2700 F20101108_AAADBC mallikaratchy_p_Page_132.txt
b5342883b2f8a255dcc53781aa53a362
5c28c3e8aafd7c7bca8e00ef712b28e59fe2f9c7
1546 F20101108_AAADAN mallikaratchy_p_Page_107.txt
58d478df2abd35406e137b3938a64a2e
7a0c5c7b4242318f7dff8ccda34672fca904a504
24401 F20101108_AAACVH mallikaratchy_p_Page_034.pro
2c795d819b16e2dc49d50e1c146b5844
bc3847e0918893114f0e24b7ecc53c62249b8f9d
52218 F20101108_AAACUU mallikaratchy_p_Page_016.pro
cc27cabc8e8cafefe63a62b8d76e6ee1
bd2c4ae1f07c7b86db69eb412eadb8bd1fc00cb6
2611 F20101108_AAADBD mallikaratchy_p_Page_133.txt
c38fa07f55789ec3dddf52efa20d28bc
dfb56025f8f37768463482e57aeee7cfd6816d75
845 F20101108_AAADAO mallikaratchy_p_Page_108.txt
9a0630240a6fdfce2b76fe6794ab22a2
067570a2bd01ed27459f3e7d925dc7db021914c1
14837 F20101108_AAACVI mallikaratchy_p_Page_035.pro
c231fac504bf7595c4cd1ce4dec915fd
a3202f44f0f36454ba57bfe970c7c386cd576f31
51515 F20101108_AAACUV mallikaratchy_p_Page_018.pro
96d68283be580c66c815b66faec70dc3
3bd9dda9389c1b3c69454fbb4f41ec113350070c
2672 F20101108_AAADBE mallikaratchy_p_Page_134.txt
4b7b605ba4fe1c1382233c5c2ba6a999
84a43e8993b7a1565a50b829ce920855a032ad1d
1933 F20101108_AAADAP mallikaratchy_p_Page_110.txt
82549a074c6d25b7dd6befd1a89a2b73
875397e087bdcce7223a597ad0ee015144dfaab5
49207 F20101108_AAACVJ mallikaratchy_p_Page_036.pro
d95cb91f15b42befe487d061e0936dc3
597f7cee502ae3986ea5e629c9480e47fb7bc8e6
1682 F20101108_AAADBF mallikaratchy_p_Page_136.txt
68e9c1702009032a3047282647c23008
b353133084eb68bec511a8663d9f3f09e30f7b4d
31436 F20101108_AAACUW mallikaratchy_p_Page_019.pro
ecdbbed96fd135d9a855dc32fadd3629
6c54818205254fb2b6b7b8ef9a92ef99e0b18bfc
2239 F20101108_AAADAQ mallikaratchy_p_Page_111.txt
60db16c09593a75d82c1d4aace4fc4fc
6b2e5ba539e6e95ec32d294bffd2edd792519f64
53579 F20101108_AAACVK mallikaratchy_p_Page_037.pro
62000940c9ac55d92a90428cdc020df8
3731f0862157825d2cb14bb068f1fb74bd86c333
927 F20101108_AAADBG mallikaratchy_p_Page_137.txt
ef19123413c20f17b9b501f86a1b837e
3757c94d1fc218afd66a5cf389902ba12b30ceac
51920 F20101108_AAACUX mallikaratchy_p_Page_021.pro
e8f286803076f544da0eb86c43449862
3c17d81fb3f87f0b8a4a313c98a11ee0786e5196
2231 F20101108_AAADAR mallikaratchy_p_Page_112.txt
08f66498e3d517107340e4a7132b3b69
c292a53e2fa739e63ab2f14e4e40ba625c1a4151
42643 F20101108_AAACVL mallikaratchy_p_Page_038.pro
b8d95c85b4108a355de898eabea1db51
d3cc57056570821542619b995a6d1cfec4ee4959
2508 F20101108_AAADBH mallikaratchy_p_Page_001thm.jpg
6c04fa5565abe4a8a7a8dfafcd8d77d7
e4ff39d3bf524d61836c0b711173825646d7b32c
51910 F20101108_AAACUY mallikaratchy_p_Page_022.pro
0ef4b1c7393dc3c3ed892f6597a3feb4
cbb30d94486d34c5fe9e9f7761669d0d2185ee21
29561 F20101108_AAACWA mallikaratchy_p_Page_059.pro
8f1c70530cb4a4b815624f27955f9b24
2b8bd95ac41052fbd4da5d0b0eb7277eebaabffc
2193 F20101108_AAADAS mallikaratchy_p_Page_114.txt
b44096db612f6429c2275f4182ee21e0
5b3115d487ebd20899ee2cf117671b7712c79c70
47113 F20101108_AAACVM mallikaratchy_p_Page_039.pro
723721aac84860a5557ca76a09edc9df
a99d2e827123cf38cb33272aa0eee647bb756c09
2326262 F20101108_AAADBI mallikaratchy_p.pdf
06e8f8781dc00479a69be4cdc7d79a33
6cac4848a118154e7d92f0de353a6babc1f78a66
37471 F20101108_AAACUZ mallikaratchy_p_Page_023.pro
d85c632da47f2d55e04026f3fdc2730c
033d11e2e9d791a27ca65e532397e245a75f7c67
45551 F20101108_AAACWB mallikaratchy_p_Page_060.pro
3fdce1683ce524214a58d7860a715eea
c7a7eb5952f5cdca879a88a800ba37e1e5397733
448 F20101108_AAADAT mallikaratchy_p_Page_115.txt
09ffd2ea1114e4371bbc0a948cfaee07
68f9c5f1fec1c602e26ccbb68f05bf13c84cf92f
35202 F20101108_AAACVN mallikaratchy_p_Page_041.pro
5b4c5222c29e2ae4428a392392578cb4
44c71f5ce7027f856dc5600afcc0baa6a6714a9b
3527 F20101108_AAADBJ mallikaratchy_p_Page_104thm.jpg
5545e88ff47d5ba8b37fce99af8d8107
bb0ff57b6f344b903be8594fbe44699829d2b81e
36237 F20101108_AAACWC mallikaratchy_p_Page_061.pro
45c950dad2fe5b9c194335e9fd6fa3e7
050b5cf5870ee4753d274b16ec404375c1db0497
191 F20101108_AAADAU mallikaratchy_p_Page_116.txt
137ebf27a76100929799f34c623f9319
3645c2a7d62fcd78a66ffd121453a7d6e66a8c17
53400 F20101108_AAACVO mallikaratchy_p_Page_043.pro
affee05c8d8d3ad1cd2edb4d86bcd675
7f3e0245dbee240dcdbdc136f7a37cfb2afb4a42
50967 F20101108_AAACWD mallikaratchy_p_Page_062.pro
5bc89c3d4489022e09473f2d9fa29ca2
28588b7b7f3e1082277a5b039e96fa4e02fd1b9f
816 F20101108_AAADAV mallikaratchy_p_Page_120.txt
f2062824e5ef2f9d2a220bf1e8226988
bc7e6b82609ff14f5bb3d9717177256298373e23
36418 F20101108_AAACVP mallikaratchy_p_Page_047.pro
89e21c3e7c287f68ee1fd858fbfb0f72
fd87c9f9ebaae2f848a96d4f70f046b37ece7050
6255 F20101108_AAADBK mallikaratchy_p_Page_072thm.jpg
7d0b80e262ced30175a88a055e3e94c0
ae970dc349e58996179ab58e5fe53ce2729b2ce9
45632 F20101108_AAACWE mallikaratchy_p_Page_063.pro
37a6ed960753a1eed57ded4cb8d8878f
f7f255b0fa1a10555bfe26fbefd8ca049dfe4209
620 F20101108_AAADAW mallikaratchy_p_Page_121.txt
2fffbdfae16c7fc12af415389f474ded
007b4b838c0b87de4cb9715bed3cf86e2c4529a8
25584 F20101108_AAACVQ mallikaratchy_p_Page_048.pro
afa026c406e2e36ddd676b71b6d711c3
1883333264ebe7773915a14bfce533b712301888
3405 F20101108_AAADCA mallikaratchy_p_Page_002.QC.jpg
4e9ac70f8f20801692dc890cdbdfcd1c
75ad58f562a5c0eeb3f056c8fe8329bc356dc8ea
23656 F20101108_AAADBL mallikaratchy_p_Page_070.QC.jpg
ccecee6bf3cf79584eb3d2774139eb6a
cb7b1bddd26ade7e2afec03d70e5fded57419503
50284 F20101108_AAACWF mallikaratchy_p_Page_064.pro
9815891b119d8cab480b7aeb65edda81
ecd1af010d30e43b34914ed26f7bd797a65b1b18
2524 F20101108_AAADAX mallikaratchy_p_Page_122.txt
1479afa9c9fb2fa2d086d75159da5e87
aca513bbeb1446d16c53cdf9cf115d55951809d3
49771 F20101108_AAACVR mallikaratchy_p_Page_049.pro
e6f09f15ba2c145a4744d63e5fb7fb38
09d04f9c3b9c7ceaedbe79dadc32929f60445336
31303 F20101108_AAADCB mallikaratchy_p_Page_124.QC.jpg
2422ed05d2fdf8e9a46c547b2e343447
cfa21c76f36e56d40023d847d4d187503ef0f91b
6522 F20101108_AAADBM mallikaratchy_p_Page_038thm.jpg
3ef0b7ad011e6519752c31bfa4b6a2bc
1e6752c06440be65e33e4c5aaa974a932b7aaa5d
50876 F20101108_AAACWG mallikaratchy_p_Page_065.pro
6024c8f25b12c2018738f54cfb8668db
f075df7cc92ca9d20b238d34ed0d66c9b51ebb21
2981 F20101108_AAADAY mallikaratchy_p_Page_123.txt
fb58358247f9a773c3b6e4e2d0aba139
85a2a764b0d3e32674d93463c40f1e35c227f912
28858 F20101108_AAACVS mallikaratchy_p_Page_050.pro
78723247c50ed4e540306c83ec9b405c
ba9c967b0b9f0c9ed1685ef4d85198863244e765
22563 F20101108_AAADCC mallikaratchy_p_Page_071.QC.jpg
7cfd04f7b49281fb22df7cb52012cbe0
4b9db81e15e0a589b02c3b25ac3b3db1ceaf6728
5216 F20101108_AAADBN mallikaratchy_p_Page_087thm.jpg
1f1e10894398ebee32c3996f2a288d31
18a8a86214c8cad0d827740990227d8f70d767e7
49166 F20101108_AAACWH mallikaratchy_p_Page_066.pro
352983ba036832716834345a383c01e1
ebbea6933d887021df908557aa44b40715ffc851
3150 F20101108_AAADAZ mallikaratchy_p_Page_124.txt
e18e6fdbef1aab7db519b1f8ff579026
6cc1da9ef34bf8b727b1990ae5f5a492631f7c4c
36486 F20101108_AAACVT mallikaratchy_p_Page_051.pro
0437b82fdcd92958aa5cae77eef22235
bda9c45b0e3fda8040486c66e67dabc1dcaf8b11
6453 F20101108_AAADCD mallikaratchy_p_Page_070thm.jpg
b1f4d7d053ea98db1c93dd35cec4c58c
13c6688891c8dc76996d130bb7b9e0b2b7c8fdb8
5087 F20101108_AAADBO mallikaratchy_p_Page_136thm.jpg
899436ab868756f8eeeae77ce521e333
1c146eb38ba792787b8f68bc1c5c2b632b777181
53974 F20101108_AAACWI mallikaratchy_p_Page_067.pro
15fc3960332eebed575022876badd402
12967ea571154181a7ceddb8fc6064f982ff2f49
35806 F20101108_AAACVU mallikaratchy_p_Page_052.pro
abf356ab62076e75d0344633be74aedf
58713b6965087ae661a001c36db1e0e91b70812e
7251 F20101108_AAADCE mallikaratchy_p_Page_080.QC.jpg
b9fab2049846fcc7e8157d14527cd007
0ae758c116c0529d6721b2f6cc590774ef7df056
4033 F20101108_AAADBP mallikaratchy_p_Page_068thm.jpg
0c22c26676686eb24ed48728b3ffca99
5c6b6631b4571517666215f422f208f7ef927cbe
15968 F20101108_AAACWJ mallikaratchy_p_Page_068.pro
b66ca43f0464b75d6705920d4e590ddd
68bc5ef4cf28f40cd30bb182d36e02a10a2836fd
36474 F20101108_AAACVV mallikaratchy_p_Page_053.pro
c18b4c1a8e8a662518d956947fd38343
ca369d1265103bf25fe5582c592b16548279f3ee
7319 F20101108_AAADCF mallikaratchy_p_Page_037thm.jpg
e0d65fbf631edb0625ff877cb2640c2d
230846fe65e714e40ccf1ab3115410b83879136b
7042 F20101108_AAADBQ mallikaratchy_p_Page_074thm.jpg
163bc11233819cbf084d418190fe894f
e56eb24c3afba25b5668771d3e7bcf59d0f530a3
39316 F20101108_AAACWK mallikaratchy_p_Page_069.pro
e485a98a7ee4a54586e54938b7f340d4
7e20c1d9c14bdc0376bd2c24938c0de1475f50aa
38526 F20101108_AAACVW mallikaratchy_p_Page_054.pro
fbd72b3eaf395fd136f074fcbcff6a33
d80ff81726c87e396104abeb32e87a056033c7fd
24758 F20101108_AAADCG mallikaratchy_p_Page_074.QC.jpg
1c03dbe57c4d5853eb40ef7edf71adb6
07f9ec5fba0cec80368d2c8fa467dfb4e05a0d1a
16936 F20101108_AAADBR mallikaratchy_p_Page_075.QC.jpg
35ba2116a15f11380ff35e84c7bd1d13
783159fb414bf2b12f954efa2af19f243aac6aba
42905 F20101108_AAACXA mallikaratchy_p_Page_096.pro
f43eb55c6eff64a393cd2da1703723d1
3e1fd4886f954e547a00ef2f6c4856a80b4028c1
44756 F20101108_AAACWL mallikaratchy_p_Page_070.pro
5943c29573855ac85be446bffa979f4f
7793b655a84b4a8db983b3a258d3a748aaaef59c
23862 F20101108_AAACVX mallikaratchy_p_Page_055.pro
8e80bae7cdcf708d415b0b92a5c6f260
4db5e4701d3cbea117577b15ac6ccbca05581bbd
25505 F20101108_AAADCH mallikaratchy_p_Page_047.QC.jpg
15eebbbacf35dbe58008dacc9be86ec8
f6f871937d6018388a0365fbdc441e025d0ade2d
26332 F20101108_AAADBS mallikaratchy_p_Page_024.QC.jpg
4f5232014273c086a077d423536a8bfc
52b1c3c68525dbcdc2947b76bce56a27dbbe4e17
47104 F20101108_AAACWM mallikaratchy_p_Page_071.pro
fcfd5e16df0078effa76c4f8001217fa
6b91a624ea00d17667dc117cc1a706d0a94145e1
50754 F20101108_AAACVY mallikaratchy_p_Page_056.pro
b6e77afca6ccd474f6a00455cd888b46
5409c74a77f077014c9d2cfc9b354c0ed67aad04
23347 F20101108_AAADCI mallikaratchy_p_Page_085.QC.jpg
1069e51586d584393a8473849ad3ba14
1ac8e3bc31c1922cb42ebacea985201770d50bc7
23319 F20101108_AAADBT mallikaratchy_p_Page_044.QC.jpg
8951ae510766db76a836f9aa0ce7955a
66365e9c1aa46aff116a44a340ab91c828355100
51285 F20101108_AAACXB mallikaratchy_p_Page_097.pro
9c0120c82629b3d0a660f2cf24f6eff6
c1ebd9358ceb35b0600a9d294ed7d37e6894318e
37949 F20101108_AAACWN mallikaratchy_p_Page_073.pro
e2e8d12f4f15b71a6eb2d25003c9daa7
8f0f672e21d7d292e9d9f21dcf36bb9d46904dce
47869 F20101108_AAACVZ mallikaratchy_p_Page_058.pro
72b44cb76acb84eea9017bd0014a2302
ae3eb73c7bb497abf2e31f92edb542429fb2ce05
7562 F20101108_AAADCJ mallikaratchy_p_Page_134thm.jpg
4a36492c21708ac908322d6902e93ac2
8da3559ca5ec826ecb771a1cf87061ebb852c06d
5867 F20101108_AAADBU mallikaratchy_p_Page_050thm.jpg
40ad986c4d2f7c5016e705aea8aeef97
58ae31b5919229402f957084aa3769d987d5161b
30330 F20101108_AAACXC mallikaratchy_p_Page_098.pro
5b3c29ea93e33ea1cad110825e883d28
1ea06416643ec836d951fcd2504e57998a9ee18a
49215 F20101108_AAACWO mallikaratchy_p_Page_074.pro
9f43b119bbe0b1cf15921ed79a74d790
c95fbc6f6f7ee027f142c77cc7ddf5b53a53f9f9
19095 F20101108_AAADCK mallikaratchy_p_Page_118.QC.jpg
e2b9e30d230a4b74e056e9037ab464a8
b2a542fdcc862c4e027b7010ca47e6d06ad654fc
7449 F20101108_AAADBV mallikaratchy_p_Page_022thm.jpg
6796231f2d71db938c0c7b7d105ae192
2f5ae977f23d19be36bcbe927244e8d4688f7744
49358 F20101108_AAACXD mallikaratchy_p_Page_099.pro
f3a3dad871c13f0f7c8c8b897804fc50
540dc2a0928aa1f955036a3c7cfa38b02623b0b3
24977 F20101108_AAACWP mallikaratchy_p_Page_076.pro
99c08a505fda887acf2d6182ee0cba9c
ecc0d7c966c2b0ec3a49200c35824ff9abf40118
6659 F20101108_AAADBW mallikaratchy_p_Page_082thm.jpg
077ba1db693395d0cad83b2bd2ce98a4
afdd2b822433a3369d5dc8d9e26f7e0abd6c7529
38841 F20101108_AAACXE mallikaratchy_p_Page_102.pro
9b6ab63aa22354d0e58bd7faffb039b2
2a657f2e2ac438c4f1ab7239f153c0561555cb6f
56190 F20101108_AAACWQ mallikaratchy_p_Page_077.pro
e8458c5638917ab6b9271200fd1dc080
0088205c65263aa3e723308319b340ca1bac082e
7271 F20101108_AAADDA mallikaratchy_p_Page_097thm.jpg
2fc9f6c672e1c371520c46cfe6ceae38
e796a3a6ed3635695feb0db9ada0f25e37e9e153
27307 F20101108_AAADCL mallikaratchy_p_Page_031.QC.jpg
c975f8af97c98aee2701053a574a540a
d35108d526d9de72ea6c01a67e06bed227316b39
7973 F20101108_AAADBX mallikaratchy_p_Page_124thm.jpg
b66d4fb23ad6fbb02b7520337bb70cd8
e663a3ee4648f8159f2b7db64fd4b23bf9f5dff2
28003 F20101108_AAACXF mallikaratchy_p_Page_103.pro
80510886458fec38bde35427b1c683e1
aedfda72c09d694a781e89e09eac2ac967555ef4
55276 F20101108_AAACWR mallikaratchy_p_Page_079.pro
64fbb7796ac78dd31fa916668d2f86fc
486bdfa68fd21c3ea21e95be55476574156af617
25937 F20101108_AAADDB mallikaratchy_p_Page_018.QC.jpg
ff469f6c645fdf6c6fa4c6ac01a3724e
c574f22987b927118136eaf7e76384b5fd32d4a3
22022 F20101108_AAADCM mallikaratchy_p_Page_072.QC.jpg
105d9a18e499bcd6d07875ccff530395
4226d85bf54e1a4b37856d3f73af12c15a635b12
19388 F20101108_AAADBY mallikaratchy_p_Page_086.QC.jpg
6658c61902807a8914b2373387021cb8
6dcd6bb03c7ee325006fdc03b1635464eec968bc
9660 F20101108_AAACXG mallikaratchy_p_Page_104.pro
638f8fa0076b9475fea3a42d4ab5c972
8130fef6adfbc645c164cffe4a46ae0feaf6bfff
49572 F20101108_AAACWS mallikaratchy_p_Page_081.pro
f2f30655ddbae278313c7aa1bc364f4e
011901467b4411ec6ca7b07a72e985aa9567a5d8
28213 F20101108_AAADDC mallikaratchy_p_Page_077.QC.jpg
6da014c9f448d23f66eb98c45045fcec
016b22081b16388cc0d7dd428f89dc5921e42761
7380 F20101108_AAADCN mallikaratchy_p_Page_025thm.jpg
c556e8d59a1a0daf747bcb4031c9fa9d
5b810ed2cc5944ece7833f6cb61483453a1f126b
7244 F20101108_AAADBZ mallikaratchy_p_Page_065thm.jpg
b3b0be60d3c1f4ca3cff0a922c6f653f
75f5a30b7a9ea847294a6b4e42c27f2d71bed722
53118 F20101108_AAACXH mallikaratchy_p_Page_105.pro
9dba198a99918925958f5e58ba42ce7d
a4d8842d4cdc69c811cf6ba64ed211e24ad7192c
42689 F20101108_AAACWT mallikaratchy_p_Page_082.pro
845dddefb2c2dc55a0cb102844bf39e9
5071a72b874a8295c87694b2127c8cb961629e79
F20101108_AAACAA mallikaratchy_p_Page_083.tif
4ec0c080a70391a8c0849e1ef3687464
8fca38e046d5fc8513fa5b0d3e359af1a9da48a7
26696 F20101108_AAADDD mallikaratchy_p_Page_040.QC.jpg
e8ac52968723b92ae64534ce28d4d45d
872b22417821d1c659fffd71aa23142996f134ac
7862 F20101108_AAADCO mallikaratchy_p_Page_001.QC.jpg
6af3221dc2325d9d80769a83fa165a31
227e5e834dbf7b3ad9fbb0a348da2fd166ac30c8
23624 F20101108_AAACXI mallikaratchy_p_Page_106.pro
8da4df128a165a403858076d4cf2d5e4
85a360b660c8872b2c3885449d3f7e60d7ca07bf
49986 F20101108_AAACWU mallikaratchy_p_Page_084.pro
7ab8946e6bbd0a0602b53339d5474c64
8391da0c219c0da311447e4d17ca9c2b0feda86b
26478 F20101108_AAACAB mallikaratchy_p_Page_083.QC.jpg
7a65dae54fc53e7727e4edd6ada624f4
63521115ed357c51fd5ed05078a45d83d27fb63e
27112 F20101108_AAADDE mallikaratchy_p_Page_130.QC.jpg
936f98bef8b28d987c20a6d89918e217
a2e370b7b0773f7f5c492f76f54adcede95d031d
5903 F20101108_AAADCP mallikaratchy_p_Page_088thm.jpg
9d99f9e393298638761db3914605dd65
cfdace6f44945e5cbf6a8efda3d3f49540e855f2
11010 F20101108_AAACXJ mallikaratchy_p_Page_109.pro
6ca780b9ae656d9a6d14f4b48a201861
b8cca790a8bd8bbe13b1bc23b9c7e4dd448ee61a
46404 F20101108_AAACWV mallikaratchy_p_Page_085.pro
6851d6ccaf8df52a0ac1ca2ee099657e
6d24d9bba3a601456919b8d6b38628ad58aaf2e2
1051951 F20101108_AAACAC mallikaratchy_p_Page_127.jp2
ea20b5501b17264cf2955043a1d2ce1c
6f17c6bfdc97759a36f2358cdc4fab757241b7c2
7260 F20101108_AAADDF mallikaratchy_p_Page_060thm.jpg
9607faba82c78764031292875f745535
b378252520efc08940883817ca445027be757e73
21889 F20101108_AAADCQ mallikaratchy_p_Page_050.QC.jpg
007c609b21ef6c89d244ad07007728dc
657cc25aeb18f45700399a8d711d110867de0059
17938 F20101108_AAACXK mallikaratchy_p_Page_117.pro
9ed5b2f739587e3d95774a7417e6e79f
2885975adad8bda6e1af967a7f45ce9e7027fc85
36168 F20101108_AAACWW mallikaratchy_p_Page_088.pro
621bd5b40e967ed135d9c6d84017c9bb
6d10b3f8c1495cd73e226043d26739185ab648b9
28450 F20101108_AAACAD mallikaratchy_p_Page_126.QC.jpg
a245e818fb3611cc5b9d035a756c0f30
8ae2467568cffdd93adbeb8ea86999f2d5c06853
14294 F20101108_AAADDG mallikaratchy_p_Page_106.QC.jpg
db3647e345ae2c2e561ace5ee6f12f84
abb0d20ff9e8865b1526997ec43ff7a49b2f056b
13430 F20101108_AAADCR mallikaratchy_p_Page_137.QC.jpg
d1d64a2d9a6b1a547748ad0c5139bf54
3b6817a2c4ee5226c1825f52e4c0b6abb4aaa92d
44926 F20101108_AAACWX mallikaratchy_p_Page_089.pro
eec856e34d8177c0cbaa4541ac8f2ed1
ddb3d2a82a3945711c5e4aecaab5378663a3c287
F20101108_AAACAE mallikaratchy_p_Page_036.tif
f86c2400bdcac996807622ceeded0a19
4922303ba7b754e327ca3509e2f1e6c6eb636fca
1805 F20101108_AAACYA mallikaratchy_p_Page_004.txt
a513db5582a576b8a5f2ba04a0fed470
7fa1cb8872a5972e19b88d07ced533ac7a1a22bb
53439 F20101108_AAACXL mallikaratchy_p_Page_119.pro
2612e6b5374a6c6f7a3e923921f70af6
100211bd7b9c49cdbc4ef4a27408a9d810d02783
7068 F20101108_AAADDH mallikaratchy_p_Page_083thm.jpg
0d473fdb722dc33d349a9fddf5d31e7c
a2b8cee658130e45c0d2a6d133931b6eaf2dcb48
5677 F20101108_AAADCS mallikaratchy_p_Page_019thm.jpg
24adc76800658743fc3a87ee60d39291
b0098b5b934bca2009c630445b9259c46e4d801b
37676 F20101108_AAACWY mallikaratchy_p_Page_091.pro
1bc5eb10513f6b2845ee8e77801063e9
d848daa71eba5eee1d18f0a4e0d19a6df321570d
F20101108_AAACAF mallikaratchy_p_Page_114.tif
e9bb027fa12e3c6eab77b2669913f1f9
ce6e0f432cff01131d66a407e176ecfc3fa61478
4017 F20101108_AAACYB mallikaratchy_p_Page_006.txt
a2b0f617500584ad79026fa65b4f7c53
6e304cac7d1742bc0af0def58b4ef71da86c86bb
18420 F20101108_AAACXM mallikaratchy_p_Page_120.pro
08485582c869f521372b8c4be8f6faf5
f0861ea5ed22079056173dceba8166ad2370c157
21382 F20101108_AAADDI mallikaratchy_p_Page_033.QC.jpg
bafbce430d345f046918687c785e3f7e
d989f9d4c7d06f20ebb8053e4d5c4339b6c9ed18
27479 F20101108_AAADCT mallikaratchy_p_Page_105.QC.jpg
b1d8cf54c3f8f0f4e860c8576bf5ef8f
c3147b6d4fd19b1145a36d5651cdeee9f151b063
35736 F20101108_AAACWZ mallikaratchy_p_Page_094.pro
59a8725ce5a44c75b3447394b1452f32
b36a0c640306263876cfa12c29d5d0ec3b692277
F20101108_AAACAG mallikaratchy_p_Page_122.jp2
53a653ce846e8a4bdb84322f900027ab
ea456b14e46bdb2591b6292a3856ce4d912b77b7
12797 F20101108_AAACXN mallikaratchy_p_Page_121.pro
0f4e0b19bbbbf3e66d659e8a139704c2
7ab311341aa0d7583ff8046a81b6074857959697
7287 F20101108_AAADDJ mallikaratchy_p_Page_062thm.jpg
d0ac3fd4f1888abcf0b49dd0f34189d6
cba0a81a3e62d2f379cf62443f7bf950b9171af9
16881 F20101108_AAADCU mallikaratchy_p_Page_034.QC.jpg
95265b0442e8185b5d06468467808231
de2d7b933a69e85467db073c1bf48f73161e3142
24352 F20101108_AAACAH mallikaratchy_p_Page_082.QC.jpg
81f8ee144a441230b2a05e850bc1122e
38f8f568cbce880d1fa1334b300a1ccf30c9227a
F20101108_AAACYC mallikaratchy_p_Page_011.txt
53d5eaf1ea6841de165788d3735bafdf
f42f09d1ab640b28226fe730df3bafc18e8fcfda
61882 F20101108_AAACXO mallikaratchy_p_Page_122.pro
0c289cf746d94b6825d71ccf8ee3029c
3727f9c450ddf01fdce50d86c7f81448f301f98f
19584 F20101108_AAADDK mallikaratchy_p_Page_013.QC.jpg
2cf4a2497c3acd4169a3ebfaaec15f65
5761914e3f6d5e5b665f1b9f6b10eac9dfccc8c1
7192 F20101108_AAADCV mallikaratchy_p_Page_057thm.jpg
3ddd67ec6e2c27f8698ad7899ed8222e
03321cc10b10d08cb098eb924c316363fe992509
49402 F20101108_AAACAI mallikaratchy_p_Page_040.pro
a33083cd1758ebb85667814b281264ba
84af162eff9ff506a1e3cc2003cbf00eaeb5ac42
1991 F20101108_AAACYD mallikaratchy_p_Page_012.txt
da36c851b8c0f5fd3623f188b9bd5bfe
5ddc41953eb3198fc5d28f988e58e7ea8ff8feba
72997 F20101108_AAACXP mallikaratchy_p_Page_123.pro
36872724af8f0842a6370214841a44d8
940c861f56ac86f96e24554591b6185aaa7c63c9
7479 F20101108_AAADDL mallikaratchy_p_Page_112thm.jpg
8bb07601a3625048f6b90c1ac012c0cb
8af50f047ab0728f6ba64c0a297d2c52fe5b7a5b
23945 F20101108_AAADCW mallikaratchy_p_Page_058.QC.jpg
ec8f04a37a7a64c4d902d2298c62cfd3
387bafa417d27cd198508197a9a02d65fbb3d443
38083 F20101108_AAACAJ mallikaratchy_p_Page_011.pro
86a112a1f851b4fa980e9fffcf92e841
2e0d66ed1fee5bc4ace63491da445b2fe61d79be
2153 F20101108_AAACYE mallikaratchy_p_Page_014.txt
cf9405da0a4c9399bf8de05978b26f8e
1e779befe4d132cedb0b6949c45dc8829299067e
77123 F20101108_AAACXQ mallikaratchy_p_Page_124.pro
1e8203580c0c9a37c78ae77051733719
6a509a8e79dc5eb002237b2b0d392e863dad84b0
7038 F20101108_AAADEA mallikaratchy_p_Page_047thm.jpg
7692407b25376df5fcb6e24253bde94c
eea304727767c2faf02b0a8f597ecb65e2ce4eef
25498 F20101108_AAADCX mallikaratchy_p_Page_110.QC.jpg
b54289f47c7fc5dd529452b1dcf0130f
1cdde5452633c07323bd787d8198c8ab966f2995
2091 F20101108_AAACYF mallikaratchy_p_Page_015.txt
8d5253ec6eb5ab67e74d6c503b46c17d
9b72245f1b7a0d15071c85268d2bdad9067c58c5
62296 F20101108_AAACXR mallikaratchy_p_Page_125.pro
1426a0ccb86108d398cbf4dc6b425e7d
384f42a736c2fa77938a9382862c71b0bc36e4ea
6795 F20101108_AAADEB mallikaratchy_p_Page_092thm.jpg
5431bc36cc60564f4e4028bfb9c1a916
1cddd845c5e7058149769b7ad58efc169719e89d
3834 F20101108_AAADDM mallikaratchy_p_Page_137thm.jpg
69a9c2807d7a1f5a662b70e0343d337a
00fd7d040db7e34cabe9ecf3f4f0f2b7f083c7d8
7455 F20101108_AAADCY mallikaratchy_p_Page_111thm.jpg
b3d0fad8190223bf4a3d3ae782bd5e90
9e19947957aed21a8a093496e367d2fc37ac66f4
21385 F20101108_AAACAK mallikaratchy_p_Page_107.QC.jpg
e58b4889c0a3a0b345b6aa10f195a7bf
58b5a45dae973cef79466fb6835fead6635cfaf1
2192 F20101108_AAACYG mallikaratchy_p_Page_017.txt
89e047aa42c9574acd3fc79472581781
8add111c031fc2f2c67ce9187eafeaa99d3ec857
63312 F20101108_AAACXS mallikaratchy_p_Page_126.pro
0365328e049fa2f713299bfb05e37562
4776f9a9d942dbe14c7307a05ff199a94c8f124b
2521 F20101108_AAADEC mallikaratchy_p_Page_109thm.jpg
09a7e52c256b509f585d36858bfa7d89
366353df978fa327ffc0821b1568c65527199a8e
27596 F20101108_AAADDN mallikaratchy_p_Page_125.QC.jpg
22a2be157c7a5421ed9e18faff689b08
9c63007bfcc22101b975a3207fa3a53646a3629d
25456 F20101108_AAADCZ mallikaratchy_p_Page_036.QC.jpg
51cf1fab01c70d8b9eea66cab5bafa1e
f5270cf73c4df558788d5f3de7c8c1e767a9c44a
47080 F20101108_AAACAL mallikaratchy_p_Page_083.pro
57567645ee0ab9126b8aee9897ce95d0
deedea1ad2ffaebf98095960863157b1b4fe8661
2070 F20101108_AAACYH mallikaratchy_p_Page_018.txt
97409b2adcfa130e38fdba76119197a7
1f9d9f29277d3399b4cfbcdf463807371b4f9d3a
65257 F20101108_AAACXT mallikaratchy_p_Page_130.pro
314bd98c805f08cb195545f7da616426
59ad695ae865f7752fdf0de1d55028b7dff161a0
838505 F20101108_AAACBA mallikaratchy_p_Page_052.jp2
9a16230ab18d0ee8017f4936a18b134c
814c639986d4b9905ce03144adec2eb0c5f698d7
27986 F20101108_AAADED mallikaratchy_p_Page_037.QC.jpg
ea6f6230021666b0cf19af27059b8662
8e013e87bfbcb74cff3fa1d6c0ad6bcb41ae990d
7609 F20101108_AAADDO mallikaratchy_p_Page_077thm.jpg
3dcbaf718a8cc0aa6e2fc10729bcf7e1
bd3f46c8f126d8a166edf94bab2ec43c264a237c
22522 F20101108_AAACAM mallikaratchy_p_Page_008.pro
06f60537a207410ffe978f087d4e96d6
efa1c94c44989d40f202b91c48d3c8358ecd6e1d
1537 F20101108_AAACYI mallikaratchy_p_Page_020.txt
872196dc5f77b8b95156d73e950d92ba
6c722f39df90047ebbf12060eae667de632a0052
63265 F20101108_AAACXU mallikaratchy_p_Page_133.pro
7f3b59cb108e7a04efa303b425262a18
c6d7bc3e364427454e3bb316576048bea16ca292
1051971 F20101108_AAACBB mallikaratchy_p_Page_114.jp2
cd01895b0e34d13e28ed4fa264ef41b8
7c6a062bbd30de2a0f8b86a7a7eb810c0af15491
22546 F20101108_AAADEE mallikaratchy_p_Page_009.QC.jpg
8456df2bb7dc0d5cde59c54f7d404261
3bd0ec034fa5c15fe175294c5a38c91943f4682f
4855 F20101108_AAADDP mallikaratchy_p_Page_048thm.jpg
d863c022ff9da5a7ed48e5102c5ba99c
4a974d17076445a80654dfe0ab1977be58cc1b9e
7320 F20101108_AAACAN mallikaratchy_p_Page_017thm.jpg
35d519dba4fe9cdfef876df266147e1c
07fef98641c7f484ecaaaabfc868dc8518525910
2073 F20101108_AAACYJ mallikaratchy_p_Page_021.txt
faf1ba4e199ae9e17868988482fc05fd
4418f9227be16cbe1890da66801af2cd4d86195f
65309 F20101108_AAACXV mallikaratchy_p_Page_134.pro
8e84bd1f4c2e5853b2be2b9016a5abaf
b1336e0dfb25df40ecb12b1250b6679704cd3085
5994 F20101108_AAACBC mallikaratchy_p_Page_054thm.jpg
d3e0a5ed8f1c2f3c51b86a90085c11be
d26414a0404b527cf9146224eb61789af625c8b9
212066 F20101108_AAADEF UFE0021612_00001.xml
be21a47165f9cb8558c83c06f9e64aa0
a4b1b0377fb91246ca2f5fa8d90c43bcb6b80b13
25591 F20101108_AAADDQ mallikaratchy_p_Page_063.QC.jpg
ff8c35b850845ca9b33fc0f46025118e
419ad85bcb269547a3694b5df4d4da66eac51af2
F20101108_AAACAO mallikaratchy_p_Page_036.jp2
f8c5e407fb885ee6bc5985d5a5fe5346
df571c9dbfa1dded994c090ed85862561fbe7078
2061 F20101108_AAACYK mallikaratchy_p_Page_022.txt
ae7866aa9ec41d944c99a8b2c5cd06ec
713777d969861233b5ec7040e5903f9fa0bbc894
40525 F20101108_AAACXW mallikaratchy_p_Page_136.pro
1f3c27745de5f51394e5acfd4c17eefe
018cbe742d7db57319a4fccbfe5cfe7469c0a486
26053 F20101108_AAACBD mallikaratchy_p_Page_016.QC.jpg
3751a3e8dd8c5fe02e85a75401b648f4
05016ffb2e0e8531a67a3b95dc67114fc981bffb
1290 F20101108_AAADEG mallikaratchy_p_Page_003thm.jpg
af708e0fc084b4b16c45d6da467aee2c
49e7d17ed833a731ac2c81f6e1645fe529290e0a
25389 F20101108_AAADDR mallikaratchy_p_Page_051.QC.jpg
555d74c3028cfb1ca3351e1fc438eb22
074adc20ca66d5daa149e8a453ed2f5158ea7420
68626 F20101108_AAACAP mallikaratchy_p_Page_041.jpg
88b902f254f198d54005fd4ad4934874
9afebbaf8692834f8e6f5f0a898881c28ea53403
1952 F20101108_AAACZA mallikaratchy_p_Page_044.txt
227bfcb8b49d1e7385550e80f4463558
f95e33739ee408e895bad1c5746a0d7c7b896480
1742 F20101108_AAACYL mallikaratchy_p_Page_023.txt
c7a76caead23b9defc5b96e9fc0ca7fb
44cc169f1d04421380a2c8b55f8faf13b46498f7
22448 F20101108_AAACXX mallikaratchy_p_Page_137.pro
41e50785de519ba0ad01b4036de978be
de18363f3661e79278aab809269fc38c7930a3d3
F20101108_AAACBE mallikaratchy_p_Page_075.tif
457e68eb26c13816e4ec59bde840a584
07efb9f0bd1257d8740a6e9e22a506c4dd5bfcae
23562 F20101108_AAADEH mallikaratchy_p_Page_004.QC.jpg
89ad11c7de05d7e6bece037e2ea3d296
f1661d25d06ba54686936b56ee0058d0d6551536
6325 F20101108_AAADDS mallikaratchy_p_Page_041thm.jpg
eb019bc80b44ad4190bec2fcad2ff89c
d9f20248879c8aa2e959107d24476e84762924f3
7497 F20101108_AAACAQ mallikaratchy_p_Page_032thm.jpg
1fd3f8d0199cd5e22ba5ac2da648c0fe
8f781e40b8a35bb6907aba6d49d0ebd3538c2157
1588 F20101108_AAACZB mallikaratchy_p_Page_045.txt
628591880142c5d22b9b671567e53125
70e70d1efd8cd2be6a9acc953939bc45a3a91228
2295 F20101108_AAACYM mallikaratchy_p_Page_024.txt
62d999832352402d4add279fde307a93
a12c794c31d36ce35b99149b9869ec026f01cc91
98 F20101108_AAACXY mallikaratchy_p_Page_002.txt
6fc65dad61bb226cda944d0a1a9b21dd
fca869f6c400b6bbe24a0e1c91444698d3ee111a
17869 F20101108_AAACBF mallikaratchy_p_Page_103.QC.jpg
4d2a6cb48828e6268e24441c6fa245e3
bed3eadf5f8cb387618bbc91309c0a296076c529
5854 F20101108_AAADEI mallikaratchy_p_Page_005thm.jpg
a556b7a418ee3bcef5aea44dfc14c3ea
e20edbbc4f18f7dbd890ccb825277ee593eade27
6836 F20101108_AAADDT mallikaratchy_p_Page_110thm.jpg
44dcb4fea883bf6cd2bf0331b3c89e28
17aaf37e009c2a7e020cc80cc43d2760f81043fd
72631 F20101108_AAACAR mallikaratchy_p_Page_070.jpg
2591548a5d12f52870d6c731e530c90a
c2db06fd473ee1cc726c3718be2dbd5c0bf21517
1087 F20101108_AAACZC mallikaratchy_p_Page_048.txt
3a1bd5f568922939c0e4e494b009a829
fdf1430103021cedf80b636dca6029d7aac736a1
2030 F20101108_AAACYN mallikaratchy_p_Page_026.txt
3c59d6cbd08ca37e8a68fbd9437d6526
dcaa29355132d9e12c1b6661ef9ba0962ee18c4b
77 F20101108_AAACXZ mallikaratchy_p_Page_003.txt
c0fa3df3a92f681eb090f61ce2d4b584
69f9b7770cbb58247e5aa83212e07ac0fc26d502
15961 F20101108_AAACBG mallikaratchy_p_Page_076.QC.jpg
8956dfc220519c04852a5bb21820095c
428d8aada33fc667fdb589c10721df3eee5c4815
28769 F20101108_AAADEJ mallikaratchy_p_Page_006.QC.jpg
123b57fc08104a203bf9692ef12162fb
85ec9e52b310c65b7afb656b4b7e52816692980c
23511 F20101108_AAADDU mallikaratchy_p_Page_038.QC.jpg
17551857b509a3053abcc8389cabda9b
5a6ccdfdd60a6c747d3a1cf97f6f9379173f2fe1
5328 F20101108_AAACAS mallikaratchy_p_Page_013thm.jpg
4927218b43657fe238a8efd2b08c1481
0fea2da2220a056380dcfddbe0d0df9a63165846
1443 F20101108_AAACYO mallikaratchy_p_Page_027.txt
2d9ac936670fb7f281f2df1b12ea8c79
64a7fef0a171d4c192f194f139e9b3e500afc9ea
864210 F20101108_AAACBH mallikaratchy_p_Page_106.jp2
299bc09011c45ff9eb8ac92a2fe36a9a
18e8bac07762b60465ccb2bfa3f32edd80886b45
7040 F20101108_AAADEK mallikaratchy_p_Page_006thm.jpg
326acf971b31b3dd29d811176d127664
20b6218a734d571dec3ca5b34db0aec3681669a4
6546 F20101108_AAADDV mallikaratchy_p_Page_093thm.jpg
278b6894ab2ca64dd1ab056caac65fda
37823512572a24c34a3178c55a66a0564a2a576b
26982 F20101108_AAACAT mallikaratchy_p_Page_122.QC.jpg
4196665655b7da2232e5617fc5b6ccfc
d0397d1c655b94f597554afa03bc5ec61e4e1f9d
1341 F20101108_AAACZD mallikaratchy_p_Page_050.txt
6768310748576245413f0277bc2c41d0
6cf9d99971482d937049d43ca1a1eb2ebd4f762e
2263 F20101108_AAACYP mallikaratchy_p_Page_028.txt
f25ce067ac1c16231b71deaffadd8675
bacc75133e304fa039d84440686373966c405d1a
F20101108_AAACBI mallikaratchy_p_Page_132.jp2
e5303fd31faf3450f72ef89fe877ff25
4665f12dafc6ee2866436a90dc401c111a75b9db
11367 F20101108_AAADEL mallikaratchy_p_Page_008.QC.jpg
3d5f433d4b26741a49fc87caa42199c8
ed902d93d9cf56e34c98a98a76ec856bf35257c2
16067 F20101108_AAADDW mallikaratchy_p_Page_048.QC.jpg
3ec85204a2a326ad29241564f10fddaa
c12b7d1bb04640077e09e5dd21836a7f76a277cb
2294 F20101108_AAACAU mallikaratchy_p_Page_113.txt
d21f612c9f876fe47cab2457cdcc14f5
0f3f1cf45591a0f263480be0ab5071f919c4552d
1550 F20101108_AAACZE mallikaratchy_p_Page_052.txt
cf53b8bbc56b26bcaf8c53b5fb531fb5
174e829780543bd4f8900f5a5602eec329e2c862
2200 F20101108_AAACYQ mallikaratchy_p_Page_031.txt
771c848d4b5a5db354e0362ea4b6bc7e
3400758d048c2cad1ff51eb14ff17767e76c087b
29312 F20101108_AAACBJ mallikaratchy_p_Page_132.QC.jpg
96a31a227f92e7ab7dd4241004fe8b4f
3cf2057726bffb5729708244d3140e305b54356d
7431 F20101108_AAADFA mallikaratchy_p_Page_026thm.jpg
95f93a7d2d43e7f4b58ad6dec26afb77
3f326c42ddbab7bc923a5122c8677bf4c9a046e4
3252 F20101108_AAADEM mallikaratchy_p_Page_008thm.jpg
2960e7191a6fb450ec809136540bb108
86992aad6ac9710fe44be34ca47d03036336ff35
4490 F20101108_AAADDX mallikaratchy_p_Page_108thm.jpg
0268494e1645b206487e06cefbfcf179
e0c200b3fc9b1e4992127a3b6768e205a7430348
F20101108_AAACAV mallikaratchy_p_Page_078.tif
306fa9554854ea33b482acb0649a326c
2b9feaaa7cfcf57b0abec0467aebf1a5c49fbbc0
1567 F20101108_AAACZF mallikaratchy_p_Page_053.txt
d3fcec966eaa19910db4355689983b26
15eaf5327cad5b919009f32d261848066da30cd6
2120 F20101108_AAACYR mallikaratchy_p_Page_032.txt
12124707aa1a120458e51963286e29bf
70d5dc57782c4fd9d42cd4fb61a7d00f42a2a462
65167 F20101108_AAACBK mallikaratchy_p_Page_088.jpg
c562777c32aa3cf6aaf9e9813b3d7841
b68e1ab85b9d88004a351c7786a06af2dec0437b
7212 F20101108_AAADFB mallikaratchy_p_Page_028thm.jpg
0744e242b5e7efc0f65b83c3c2cad7cb
f09ce64b746fd4bdf10b036bda8aeda84641b70a
22758 F20101108_AAADDY mallikaratchy_p_Page_102.QC.jpg
095ebe183651db40a4f72ddc9daac1eb
b6c36d8bf12033aee800b8c4be70f1ca9f0f9409
5711 F20101108_AAACAW mallikaratchy_p_Page_027thm.jpg
14dea371a5ae015d66ac5f296d5730ce
a361dffeb3afa3ee5e0c4fc9cb8bbd5f7b9ff5de
957 F20101108_AAACZG mallikaratchy_p_Page_055.txt
3c85791bb8608e7d552b5898da27f684
541cb3642ea2d5b6ec3a28e43608a063e5bf1531
1704 F20101108_AAACYS mallikaratchy_p_Page_033.txt
e41211d27656c4116352a33febd921ee
8d00becf16ed87700b33e65eb463c2b7760dc3ad
27289 F20101108_AAADFC mallikaratchy_p_Page_029.QC.jpg
2d47463b052abab342ef2675bac5bd35
aed9d4156630385763ad6f272821b4f806cb0af2
26275 F20101108_AAADEN mallikaratchy_p_Page_010.QC.jpg
219c4d86c719b2cfe14c3f293dd3c3e7
225148907971c8dd252d3b7f5fcf098dffaba45a
7128 F20101108_AAADDZ mallikaratchy_p_Page_021thm.jpg
19724a2762d6d05784adc0b4c3c6d05f
f6ec6e6a653cf0565ead7deb618d2340e50c1472
27508 F20101108_AAACAX mallikaratchy_p_Page_043.QC.jpg
f6cb65fa688b79bf9afe648830c4ed17
0efd6ecc022f68988d2342e74700782b30582ede
2009 F20101108_AAACZH mallikaratchy_p_Page_058.txt
43e08b14dc0f1f1da0c17ea18159d9ce
a5aba8756adfa39f22173fa79be4493800612d6a
1240 F20101108_AAACYT mallikaratchy_p_Page_034.txt
205134ef04b91b960c7573b7db8f65ea
8f0a89be3cd50ae938e98584ea72a15614976661
35943 F20101108_AAACCA mallikaratchy_p_Page_107.pro
28f222c367a0780d9f1a338a7bf8834a
40d63b4c9bd13dc84b15ff4e6f9020531e2cb26d
7645 F20101108_AAACBL mallikaratchy_p_Page_132thm.jpg
e489aa7f10eaa069bf3743053204f0f5
2c9f9e38d881b6a8527521c79e4ed673c63ecbb6
7511 F20101108_AAADFD mallikaratchy_p_Page_029thm.jpg
818b2ff8c5971ad885f0f37214db8c75
d6ad7902f01f092972e98d7cee87187f711abb48
6853 F20101108_AAADEO mallikaratchy_p_Page_010thm.jpg
b87e92600b8fa65850c3f8f4b58aa7bc
ffd4ab1b3beb1424a30dd5c593955c564c44955f
F20101108_AAACAY mallikaratchy_p_Page_046.jp2
b3ca0c06d37e9c158c602a7515503493
015c5a68ffbbea854c153fe96616f568effd5cfe
F20101108_AAACZI mallikaratchy_p_Page_059.txt
a5e47db220bc3b3f92527009a4a4b2a5
e6fcf9ec363fc4635791c970cc785f5b9fb04b22
627 F20101108_AAACYU mallikaratchy_p_Page_035.txt
d5b16e8ff6def5940a57b44f0d8f90a6
c226dfa87e85b6d6c8177b813a4da1e485b14ba5
5199 F20101108_AAACCB mallikaratchy_p_Page_075thm.jpg
b50eb9a89c8d103eb2e549591f1a6681
97efc0856d679f7e080a5ba9e8359232a74d6871
7134 F20101108_AAACBM mallikaratchy_p_Page_024thm.jpg
ef12a934162a6c874a19b6b839b93e32
fc1925137eb6772b276e595ea1dc802b7fc592be
27492 F20101108_AAADFE mallikaratchy_p_Page_030.QC.jpg
f0f3011f44374d019d427849d457a6fa
1c4c867d11b01657de0f01b6375c755abb4bf8d9
22795 F20101108_AAADEP mallikaratchy_p_Page_012.QC.jpg
462dddedd3baeac610231ead0f4f1e18
32cc2bd9ee38c41ebc20905f7afba528c2b01936
5830 F20101108_AAACAZ mallikaratchy_p_Page_052thm.jpg
0b0603af7cb84e665592ea66bb2a7ed6
f52cc4d7a2cebd790c8fdd977f12a36c649f38db
1845 F20101108_AAACZJ mallikaratchy_p_Page_060.txt
b36a33818d167e1bbe1f17fd55db3991
b757eade6bcb49192b6cbe9f05747a558d9ae0e6
F20101108_AAACYV mallikaratchy_p_Page_036.txt
5b4fc105c07bcd653d655e2452cc9e67
de2a76148c7864aab810e1c84afbf4b5ebb5e7b7
F20101108_AAACCC mallikaratchy_p_Page_055.tif
831a1c3e2749a1fbffd5a4a3185b5445
60c1de52b949fac1913428cb02cf03681b30bf5e
942223 F20101108_AAACBN mallikaratchy_p_Page_008.jp2
d58b6efe929413ec62b89f333905e541
43b972b88d094ed91f0b63757fb88b488960e277
7350 F20101108_AAADFF mallikaratchy_p_Page_030thm.jpg
acf974d73178f30d0967c9720e8844ce
2863868eb2bed559781249127aee40793a38828f
26917 F20101108_AAADEQ mallikaratchy_p_Page_015.QC.jpg
a54004cc92c9dd2260644a2e24da745c
4f3f2f0bfa6d9426a19bb836636ff1e41187c749
1813 F20101108_AAACZK mallikaratchy_p_Page_063.txt
222677f84fd14eb15289bb2f6bfb4006
a5f2e570376026bd2ff41abad7add024414521b7
2111 F20101108_AAACYW mallikaratchy_p_Page_037.txt
0da1c5239e710735396ebfaf4def191a
36f6e05f1779f58596d7b78cba07f500fe97b51c
2165 F20101108_AAACCD mallikaratchy_p_Page_078.txt
58184a970f940d00a010940fddd7cc04
ddb37fbc0d331fdc6efcd2c4314d238c2ec784a6
52637 F20101108_AAACBO mallikaratchy_p_Page_048.jpg
ed41e38aef7ecfe37f9aa17f00505409
7c7cf89216ee3c0d4fe1c0637fc7722b0e61b50d
F20101108_AAADFG mallikaratchy_p_Page_033thm.jpg
b8399f4520b9a7f09f8dcd5366c66469
8bc524cafd0b79c4bb1d19ed5d526054500341ef
7315 F20101108_AAADER mallikaratchy_p_Page_015thm.jpg
d4b44f5d8f32f4398649a8bcb92d3744
61f347e6ad16188e96da2243903c0c3423b6946c
1979 F20101108_AAACZL mallikaratchy_p_Page_064.txt
e4896c94a4257123f1031b8cfc64fe56
3ea32995a22dbd5036c2bd27d959fd5286bb1aae
1867 F20101108_AAACYX mallikaratchy_p_Page_039.txt
74c99bf736d8ef1afad2d8e09da4fe45
dba2bde78f82ff8339a39db83d01a359bb9634ef
22648 F20101108_AAACCE mallikaratchy_p_Page_094.QC.jpg
e8e75cbcc68675f233916c5b1657f06c
8e8e11ab1a974ae51347349e2aa5a627025f5f02
5792 F20101108_AAACBP mallikaratchy_p_Page_116.QC.jpg
3fbfe96472f822112b2df9e7101a9d1e
5d09b3d47b7496a71cbfc48dcea3bb0d21834412
4951 F20101108_AAADFH mallikaratchy_p_Page_034thm.jpg
504f0c2aa25059b97b455355a2e3fb28
be502ffba107629b53092aae9d098ee7406dea45
7279 F20101108_AAADES mallikaratchy_p_Page_016thm.jpg
d4cb54a6605e52ad1500538f6dfaf95a
dbba691e5a4f609e4cfe2c06a637bcc999e29112
F20101108_AAACZM mallikaratchy_p_Page_065.txt
c564e052df85800b4f678b24ce762792
f9257938f248bd971fb0cc5201c72a2c1d577268
1859 F20101108_AAACYY mallikaratchy_p_Page_042.txt
ebe619590405fd3ac581657185e6f628
20f1ab657fcfd4af9c2e1ed7002dd31132afd186
42821 F20101108_AAACCF mallikaratchy_p_Page_055.jpg
3a01c7a2300f360b9cdc2a8c23ea999c
5cb93423eb05d552a116c7d0c493b86cb5e78ca7
7239 F20101108_AAACBQ mallikaratchy_p_Page_119thm.jpg
c8807bd382a2dd89cb1b52d3cbe6f696
1f221a9c4c19b49ed579da260a106749bf1246bb
9784 F20101108_AAADFI mallikaratchy_p_Page_035.QC.jpg
59d48f486250ac6b4229f5a563b8b4ce
6684653f7c1a0991bb9841185ba48fb3404ca1e6
7189 F20101108_AAADET mallikaratchy_p_Page_018thm.jpg
5309e16da38361de8682617c3d67ddd8
b97be01e8a1413574695ea05e5a022346f6249b3
672 F20101108_AAACZN mallikaratchy_p_Page_068.txt
438145090c750d188508d2c1a8e2af0b
a3ce0aa15714db3e15d8e029d17c417b3bdfd926
2104 F20101108_AAACYZ mallikaratchy_p_Page_043.txt
0a8fc472d494db39ad5a6beaf8d93939
0a342ce79e79c6cb7b1ad42115107bfbcb634c4f
1825 F20101108_AAACCG mallikaratchy_p_Page_070.txt
cff38e94c4717305d3ef3c96dea70970
338711abcc9ab43ed3777eabc2941b54057533e6
61872 F20101108_AAABXA mallikaratchy_p_Page_129.pro
14abff921ddb33dec8ff6e44d5ede183
ce8403939be4db90db9d16873c976d1cfdd40811
6016 F20101108_AAACBR mallikaratchy_p_Page_009thm.jpg
1c2a4d0a4dfa8386c13c3773be34d8a4
881c6bd3605061f5e6fec0c509dce1799f6eb989
7100 F20101108_AAADFJ mallikaratchy_p_Page_036thm.jpg
78873441cf2c451af75efb41df6370bc
c159d3515e152c371a60ebdbf1dcebc641479853
22183 F20101108_AAADEU mallikaratchy_p_Page_020.QC.jpg
ec25b12d90b0f460ba3f5cd26c44c559
bb6f8e8204697730975cc1cb523ace05222ac6eb
1701 F20101108_AAACZO mallikaratchy_p_Page_069.txt
17a87444842679039f5664a14d73ecac
bb796d004fa288dc6d39e6da93501a8055115b80
603 F20101108_AAACCH mallikaratchy_p_Page_003.pro
98e30570998b9c814dab3fcfb782f365
dd235d4b71c33ac95a0a8cc6566646da004cc086
19491 F20101108_AAABXB mallikaratchy_p_Page_108.pro
d7614404de36f6228fed90b56398590d
36c281665315dc89f4492ebb4293205573a2cc59
F20101108_AAACBS mallikaratchy_p_Page_113thm.jpg
a72fd3222874306acd70d5ab4bb5fef3
1cc388ff3cfa8b21d618c1f5f8085074d385ae4e
25730 F20101108_AAADFK mallikaratchy_p_Page_039.QC.jpg
9b0a9796981a8dbafc82cc4c627107ac
3295f5cbacac485c09b5ed73ec889d202752ffeb
26464 F20101108_AAADEV mallikaratchy_p_Page_021.QC.jpg
cf33d49fb78e77fb97725d4f5542bd96
626302fe251aca80267b48d54bb6113c8a3e0374
1695 F20101108_AAACZP mallikaratchy_p_Page_073.txt
b540249c46d57257f3b27dd996d2c884
742fa55ccad618efa3fa15abb70f79e8cb5e184e
47786 F20101108_AAACCI mallikaratchy_p_Page_044.pro
eac67d41c4d26d0821f74acf6fcb439d
ff25394755348cfe4bcc2d99288a9959c24a3303
F20101108_AAACBT mallikaratchy_p_Page_094.tif
f7ccc7ba5db352dbb2bc80a035109f9e
b0fc23cb55e4be9b94d7c78fa7b87341fc357ee4
6965 F20101108_AAADFL mallikaratchy_p_Page_039thm.jpg
20564cd5823a856ad3a8f13173018aa8
8314700b398d26aaed0fbfc0d6e9bce2bd7341a7
26436 F20101108_AAADEW mallikaratchy_p_Page_022.QC.jpg
1b3d32148978a2ec76427151363c6cd9
8523c427102a01eae76b26f8db05d44e4901bed1
2094 F20101108_AAACZQ mallikaratchy_p_Page_074.txt
daf44c49213bfa9b9b4cdf11c0e6f6d3
5a3c190aa2bea6e18afc51ca7be6d48dfc1e8859
F20101108_AAACCJ mallikaratchy_p_Page_090.tif
2bfaf145e0d75cb23aaa1d133362712d
cdd6194e8dff2e8b89c8ede6235335918f1b9300
F20101108_AAABXC mallikaratchy_p_Page_028.tif
af85766ea8c0172ecbf20ac0d737685b
e228eab25c35aaa694db555800c4ec0b54d17d6e
F20101108_AAACBU mallikaratchy_p_Page_115.tif
8470d7acea231bb035be56b196a193ce
715d99c9576205e32e44cd5bfdbe3f30f5fc639c
26860 F20101108_AAADGA mallikaratchy_p_Page_057.QC.jpg
08928ec0cfca6abb9d13876366708f70
109b27a3112c13859b9c8a3ce7ad108901384090
7123 F20101108_AAADFM mallikaratchy_p_Page_040thm.jpg
df9be2f1340a16cfc78621badcd9e554
403053dfcfcd620ff1dfbae0e040ca42938e41d6
22494 F20101108_AAADEX mallikaratchy_p_Page_023.QC.jpg
e2de509929da57f9675ea18c2d5ed14c
c055445a261b6c366cb223344fff05daf7f50f04
941 F20101108_AAACZR mallikaratchy_p_Page_075.txt
22714d8d7ed6002a68e449563846d83d
900c5038b0b6bef9f8a24814d3ae0d247f63bb65
88189 F20101108_AAACCK mallikaratchy_p_Page_112.jpg
f2a718010b52dad4078544ef8e786097
003dda131d23061021aa4871106ddb64e58b68d2
1983 F20101108_AAABXD mallikaratchy_p_Page_066.txt
768bd299e100c4c05be94dcf57aee5d3
f2d693235cbe059f3bac5c208905cb65d7a68f02
25430 F20101108_AAACBV mallikaratchy_p_Page_131.QC.jpg
0c4562f2be563efb323d79abe088a495
cb30f104027efcbd32baf14f2ad32457b5fa869d
6579 F20101108_AAADGB mallikaratchy_p_Page_058thm.jpg
2b5b0f380d9e33486e28317840f0dbd1
aefc6e604942e8504f53776132cd81270ecffa61
24706 F20101108_AAADFN mallikaratchy_p_Page_042.QC.jpg
def0ecf361d512ce54f83163a11ddea1
372c5149b89cf560346188315bab4c5164f43ad1
6125 F20101108_AAADEY mallikaratchy_p_Page_023thm.jpg
493380b0b62e59332bb03415a20a1721
fcc2942c4421572b1f829b86febdc7251bd31247
1206 F20101108_AAACZS mallikaratchy_p_Page_076.txt
fab77f3fac85ddf10cd150ffdb5c74b6
65f332199a595598885272f0d9e742273b57971c
266781 F20101108_AAACCL mallikaratchy_p_Page_001.jp2
ac0f1ba67c8d81bfe2dfee26ea4b6313
9f7848ca677c15e08a7e154282c7827970fd3019
1976 F20101108_AAABXE mallikaratchy_p_Page_049.txt
5337925d05c8312cac3b7b37d1f315a5
4bd6c3783c10ce9277b656dcf5a7b17598c31b9b
18111 F20101108_AAACBW mallikaratchy_p_Page_098.QC.jpg
dc651438d128fe353f401b2cce38b22a
71ebfa0e20fedb57149901e36cdaa54582c3c673
20411 F20101108_AAADGC mallikaratchy_p_Page_059.QC.jpg
40b2cb1038e14aacca19b56488bdf1a4
259a4156781682b67ed02a042b11eda0622438b8
25977 F20101108_AAADEZ mallikaratchy_p_Page_026.QC.jpg
fa78534e1a403c80dc5c0343f30db1dd
fb9075bc90b4718ed9f7a6d9a9ebfb8e42da8f66
2209 F20101108_AAACZT mallikaratchy_p_Page_077.txt
222b6273b0a11b034cf71286b3a0b294
e85e54616767ab7a76a530d5375e476a82112ed5
27847 F20101108_AAACDA mallikaratchy_p_Page_067.QC.jpg
843989aa8df93b773ac94769f76cbb96
fc539ebb90cd0bcc47cc87af934a0d2c03b62d96
45869 F20101108_AAABXF mallikaratchy_p_Page_110.pro
e45c0b11a9a1aff45f00f336e0aff408
193cabf2539ca49fbbcebc945424b802e339111a
F20101108_AAACBX mallikaratchy_p_Page_072.txt
ad9ba09f1bf519abf7cd2e81f166eb65
abfd757cef05f262a3eed956b0458b643820f41b
6484 F20101108_AAADGD mallikaratchy_p_Page_059thm.jpg
5c38dece7f8b1aa704e5df7245a56d93
4d964e5982c5735732750a9bd4bc067acefd4a6a
7370 F20101108_AAADFO mallikaratchy_p_Page_043thm.jpg
7af24a05220252fb8be40d3418db75c8
72f96a1f10fd90c76858ee4e1172734e58619ef9
2170 F20101108_AAACZU mallikaratchy_p_Page_079.txt
de98ddc23652c09fabaf2aa433a6527f
bc6fd46441b1f1488da4eb15eac0fdcaed1dd30f
52693 F20101108_AAACDB mallikaratchy_p_Page_113.pro
264fa8a483e64e77b6740f1efc43da7d
d4fe1f10c9b49f46469c06b0d9bd452dd8aa3f94
7528 F20101108_AAACCM mallikaratchy_p_Page_031thm.jpg
e6f7b4f7ba57539f0b70857a8b5b3b79
ed12a000eeb51a9eeddb145a02b762ce2d95b175
21042 F20101108_AAABXG mallikaratchy_p_Page_075.pro
3108c5f4502b5dbf88dd868489408ba7
cfa232bcf3adc0d0ea218e60f9c801a992085b2a
28298 F20101108_AAACBY mallikaratchy_p_Page_112.QC.jpg
1046bc3e51def5853fe9c5016a07be80
3a0df85277fdbe8ecb990cc695dc4d0b2a7792ee
25920 F20101108_AAADGE mallikaratchy_p_Page_060.QC.jpg
9a3426f41ecee11ec2398ea7072c12dd
7983488af435df701464ca2b4f5ff30506ae393d
20526 F20101108_AAADFP mallikaratchy_p_Page_045.QC.jpg
87c5ef35a458a1a3e360b4e8473216ab
da411226743f71bb1c0379f4a23001060066b406
399 F20101108_AAACZV mallikaratchy_p_Page_080.txt
d8c2b0fd4b8b82052dec02cb2aa64947
83b5f439471a7b73c6525187019ae3f9410ef1e1
F20101108_AAACDC mallikaratchy_p_Page_031.tif
ac6d39aa169bd98efdb949cf483b160a
bffda2cf005d0d273a1d87d75400b7cd0fc19d55
55120 F20101108_AAACCN mallikaratchy_p_Page_078.pro
519918a45f27cd25e866c4716d00d355
8bfa299676e3633b10e511d11bb4aabaf77fbd9e
72901 F20101108_AAABXH mallikaratchy_p_Page_053.jpg
34836584ffecd1923d473f96c6d50bb3
ab6a23720a21dffd8fbbd6d89450b43db90bb734
F20101108_AAACBZ mallikaratchy_p_Page_056.jp2
f5be1371ff779b9ecc5159e309cc77d3
427cc311755b86b1386ecf5dfe3434d9a6c433dc
5714 F20101108_AAADGF mallikaratchy_p_Page_061thm.jpg
cd51af70db51de9a904818f689088aa9
00c8549945ed24da88d5904a6f26a84610360a01
6023 F20101108_AAADFQ mallikaratchy_p_Page_045thm.jpg
8a9052c648bd76d930918cc7dae99190
dee031730c7c23723c6628773fa1daf38cda00df
2058 F20101108_AAACZW mallikaratchy_p_Page_081.txt
3081a72e50bc34c2baee20e37e7cc059
cb806d1b9d0b7c7efd180330b7c67a1faf39bcc8
F20101108_AAACDD mallikaratchy_p_Page_104.tif
cedb7317612705f487107943027995e7
7a0fc9730d09ea30d78a04994d76bc5abff6de8e
2015 F20101108_AAACCO mallikaratchy_p_Page_062.txt
60dbb2499eafb99e932e0b61c155a441
9e16f0b4fe02db0df683cd441cc3ca41e65b2bbd
6289 F20101108_AAABXI mallikaratchy_p_Page_044thm.jpg
3d9dcfadd106bdfeafcacadade6287c5
1152c8c7630272cff771659eca4a0321f2973748
6887 F20101108_AAADGG mallikaratchy_p_Page_063thm.jpg
43a85829d727a00eaaf7ab7a06d4f0d6
5fb61457707e1d82eeb6d34ff15678ab5a250081
26963 F20101108_AAADFR mallikaratchy_p_Page_046.QC.jpg
c27f3587a8430d53ac576d2c756dda8c
56febf1157af517012effa67cf6186b6918de160
1740 F20101108_AAACZX mallikaratchy_p_Page_082.txt
1b44b4af4d64deb7753c3bfac853e05b
c5aef0a3556ec60b5ad758fef58655a5314f8f21
2973 F20101108_AAACDE mallikaratchy_p_Page_003.QC.jpg
5efef35f7a9def41eb2f0ff059c67d59
8a949cafd3533a7108d9e5bfc1d117444e6004ce
6752 F20101108_AAACCP mallikaratchy_p_Page_012thm.jpg
41c25f161d628850d4c44f19edef4ce4
7ff6f7672ed15b7e962b8d9bbfcd52944eb5b11f
2083 F20101108_AAABXJ mallikaratchy_p_Page_105.txt
1717235a964dc7416004ff89137c114e
406f54e9ef4ac7ef77200d75b7b29ebda371ef15
26324 F20101108_AAADGH mallikaratchy_p_Page_064.QC.jpg
fd9add25a3d167cf60e6022b5e00faf6
6602dcc3d340afb9ad052d6f1089b2e1bc3b3244
6972 F20101108_AAADFS mallikaratchy_p_Page_049thm.jpg
f68d4171a9913469ed174da51549b667
ef4f589429796f1038fa0f7af8b8bb137597e072
1887 F20101108_AAACZY mallikaratchy_p_Page_083.txt
c46b74c5360cff1426cc18419c0ee19e
102ded6dc66b4ee7f9dd4b99f905917df081469f
F20101108_AAACDF mallikaratchy_p_Page_123.jp2
c0802b433305887141a19f5b9a171653
bd59b0bddfb385b2cc87f406c65efd602b07d444
2408 F20101108_AAACCQ mallikaratchy_p_Page_009.txt
95c231335620749f805d0ae61ed6473e
7d883b26e1c845a46155a3b1efdb5b2bf73cdb26
7215 F20101108_AAABXK mallikaratchy_p_Page_100thm.jpg
da6386c74fd39fb1bc89cd9ea8411140
26190a1256613aec3d3027fa09e48987cde7cb40
F20101108_AAADGI mallikaratchy_p_Page_064thm.jpg
72bb3d434e36ac0181616f8a5d89e2ef
335a4aaf129cfe0389a3fcafa45de57f23e8020c
19066 F20101108_AAADFT mallikaratchy_p_Page_052.QC.jpg
24c8b552d82a1b50cfda7977ccd9876b
082ff8d2e60d9977637bde84cc059c3da2028e42
947 F20101108_AAACZZ mallikaratchy_p_Page_087.txt
a155503b1685d351e165166d538efd9e
5f607fd9c6cbb9da340911f1cd23b212767e7253
95763 F20101108_AAACDG mallikaratchy_p_Page_130.jpg
acbafa21726758d9df5a4f530a7c7e68
0a75f943685bd835349c515bdd3c6ad87a932bb7
2079 F20101108_AAABYA mallikaratchy_p_Page_030.txt
3befb324fcc2935b97c2af58d3f01e26
a7d284a7e55f605e765fbce7da051658d7e7240d
24129 F20101108_AAACCR mallikaratchy_p_Page_005.QC.jpg
be5952967e5ee492de7892dee8c5e821
c43621c7f84db0f8d46237008048b8681f549c65
1488 F20101108_AAABXL mallikaratchy_p_Page_061.txt
a28223c2d7c39fcf8d6d8b35c1dfdc7d
3bdfeb27874b1f273d9296f25802717761ed2ed9
26304 F20101108_AAADGJ mallikaratchy_p_Page_066.QC.jpg
6461c261cd4a8e5474beec4c47886f09
5c6560bf5c692b540bdf743757b4fc174a617f6e
22015 F20101108_AAADFU mallikaratchy_p_Page_053.QC.jpg
f6d6d91dab4235193e60f57c762f64bb
b8f9e7e5737ef6c6d66dae41732cc8f1b279923f
8024 F20101108_AAACDH mallikaratchy_p_Page_123thm.jpg
e0cae10bd591d64f8a148524c30f30ec
d60062d86f34b11428e7b2b5c0b1d0caf90cb46d
69512 F20101108_AAABYB mallikaratchy_p_Page_023.jpg
dca2d7333ad94d1ec8ff8df21f37215e
dfac0503e908bc4e70177fe49cd421cc53d93c16
2124 F20101108_AAACCS mallikaratchy_p_Page_067.txt
17d0d6e4bdbc33af3d57059a08889f9d
c05aca2d543305346300da4e44ecd450360f1412
F20101108_AAABXM mallikaratchy_p_Page_098.tif
b65b7156c230f4cb12979a7b1becd266
4814a137378918f9b56d69498023a67e2db650ca
7056 F20101108_AAADGK mallikaratchy_p_Page_066thm.jpg
a8ee27d3785228e0fdc6ed00d768602d
6cf6d60d8f80071dd2956e99b6b43e23e9601fdb
6221 F20101108_AAADFV mallikaratchy_p_Page_053thm.jpg
fecf6d5fb27834b7c8724dabc271a8e0
7f045acf2fbad8133efb7320a289cdc34f9fc778
1949 F20101108_AAACDI mallikaratchy_p_Page_040.txt
965ab31407a2e1c2555849cf08db7798
39516b223cb29ae5c5a04e8710c1390c79637701
F20101108_AAABYC mallikaratchy_p_Page_012.tif
25838ad3f6255079220411f568c4ebe5
4b552cb6be0949d50f2097d39b545be1e5e6710e
2655 F20101108_AAACCT mallikaratchy_p_Page_130.txt
850c4ff088142d63a10ad1b22cc0ff93
d5da819452b0790ecb093db69d1942c519fa9b91
105659 F20101108_AAABXN mallikaratchy_p_Page_134.jpg
08de24164cb46b712c947601734923ea
0b52a5e17976c80ac52c260b21d4f7093641ad8a
7680 F20101108_AAABWZ mallikaratchy_p_Page_135thm.jpg
36e40239f098f483545d2f81a9772e9a
14c714ee949af61a16e8a10e14400bf5bea8c5fa
7675 F20101108_AAADGL mallikaratchy_p_Page_067thm.jpg
8cf085cf9ced91c6780ebc9a3b250714
41c359a280b8cb2fe33dc89421b28df366530166
21718 F20101108_AAADFW mallikaratchy_p_Page_054.QC.jpg
336e4f2536d47898286b2a59c5a91527
587e201a5af400ac2e1c08d131d3c7c48fcf3011
345338 F20101108_AAACDJ mallikaratchy_p_Page_035.jp2
c44a3ee46e24683677c3acf5acc1617b
c7a27bdfcab71d3eba435c540cdeca6878855ac2
2074 F20101108_AAACCU mallikaratchy_p_Page_016.txt
1d17c55e53740fb8c2c71fa89f55faa8
b0055321bcf137c9dd3800e947c769de9d254084
464 F20101108_AAABXO mallikaratchy_p_Page_104.txt
d58dce60509490f342c83fd6dcad76ae
05d3518d9dcecff7bbeafab4e24eec675ac288c7
5375 F20101108_AAADHA mallikaratchy_p_Page_098thm.jpg
2feb31ab6d53f8394442529bd41b6c6a
bea533f8090688cf0a6386ae552c774ae73e736f
12508 F20101108_AAADGM mallikaratchy_p_Page_068.QC.jpg
c8c63d2123a6307b0aaa2277f2215ab3
28005e4267d47142b3ea561e5e4bda47c087639b
4318 F20101108_AAADFX mallikaratchy_p_Page_055thm.jpg
8585678ca551910cc1903b03d83ac70e
3ec1be7f5aae75bf858cd4d177f618125bd9d467
F20101108_AAACDK mallikaratchy_p_Page_072.tif
840f90775c9f559823a5f9e5fc8db210
d5885d41a75f6502e866202e6a448c441e7d692a
1051943 F20101108_AAABYD mallikaratchy_p_Page_134.jp2
b42c284d8547c463bcb4e6626b3806c6
c615c845062582247f70620abc9e076043bdb89f
1051957 F20101108_AAACCV mallikaratchy_p_Page_083.jp2
526a675ca24523f254f390c67e590b67
56fbf93592ead3bc7423f2d0b4b1cb9ed9fcaa3f
6183 F20101108_AAABXP mallikaratchy_p_Page_020thm.jpg
42f0667571aa9c1ad1fd24506b4f5237
55e301656b0ea4b34fe7b97f3764c8800df2c19e
26314 F20101108_AAADHB mallikaratchy_p_Page_099.QC.jpg
b169f865f1e066f2685e559f09f418b6
fe3a7c9ae7aecc105b293f24425a97452a656ce1
21806 F20101108_AAADGN mallikaratchy_p_Page_069.QC.jpg
3c5ddee3639a99bd1f04d6bc16a3fad8
102cd8916c92df71a84e110c30206fa633d28075
26620 F20101108_AAADFY mallikaratchy_p_Page_056.QC.jpg
48c9116aaccd174eff25ff71027b5f87
e0ea9a2179d6f1f6d02b505589d7703a6ad57663
F20101108_AAACDL mallikaratchy_p_Page_020.tif
7e2c85c2f3610e16c8669acef6518512
4a0ee9d4b24cf0a1a0a0d66c42a4bc2e99cb7b3b
F20101108_AAABYE mallikaratchy_p_Page_048.tif
66ec8e8adcacd93db6925a9a576d1d77
3fb6018c7310c6e28c2ec3b89a55da066d0eecd2
26042 F20101108_AAACCW mallikaratchy_p_Page_049.QC.jpg
1b01e628429688b0131642d3cc78c075
e24f6846ce1d5cef97fb585756232fb1b4ef1552
50758 F20101108_AAABXQ mallikaratchy_p_Page_026.pro
b9d685d1557cf99a368ab17b1dc4420f
af7630596583054b59f1a6095b92105bff46438b
7138 F20101108_AAADHC mallikaratchy_p_Page_099thm.jpg
0ef33b482d8a1031d6708263d7ce7d4d
bc2c282f6d59290e3f4ba6fd9855aca1f92125ba
6095 F20101108_AAADGO mallikaratchy_p_Page_071thm.jpg
fb6027978adff15a681d017a924c0d8d
3000eb12efa28e53c0ec9831843344d9866445a5
7190 F20101108_AAADFZ mallikaratchy_p_Page_056thm.jpg
680682f4ba8f8525604495d1b951cbff
1f70b7885a237ad17ef7db8ebe49187bccd072f6
1306 F20101108_AAACDM mallikaratchy_p_Page_019.txt
fcd5b8fb2f527cf9edc6eb9f7272ad3e
d66b64ed8d6b9724add211a4adb71305f2cea6b2
19757 F20101108_AAABYF mallikaratchy_p_Page_007.QC.jpg
febf8b0b094093b8e856ed8418a41a86
dea0e14f94dfd4bca3e7c88d7d7c87e3a0174d58
2075 F20101108_AAACCX mallikaratchy_p_Page_025.txt
8200ca4308b17f05439dac61ff720148
abf7bc32aa76cdd56abbfdc4142592420b8a3fa5
28938 F20101108_AAABXR mallikaratchy_p_Page_095.QC.jpg
f576fa4aa4c8559f7649969ab8ee0122
0095391d276c92c0184a77bc719816016ed7aa21
5311 F20101108_AAACEA mallikaratchy_p_Page_103thm.jpg
4e013bedf53c3f8f48dda31fa3d75fa0
9855611ce25a38d7318ea0c1b9dd17b8c9ca6853
26635 F20101108_AAADHD mallikaratchy_p_Page_100.QC.jpg
ea2c8beb59356fe88c41b34ea6bd28ec
72ba99c49d271c2fd677ee7052a8fbb55690fc2d
537637 F20101108_AAABYG mallikaratchy_p_Page_101.jp2
9022eb1cc0b6725897eac0fd8b816d31
87cf633ccc19ecc9c3b38202c0a6fc2138806e3e
2318 F20101108_AAACCY mallikaratchy_p_Page_131.txt
5d4772f0d15c844387d04148e89a8cc8
1c11a3eff66f7a97523465bf2131ec03a83dfe5e
5680 F20101108_AAABXS mallikaratchy_p_Page_118thm.jpg
0dc13963fb1b7c8e1dfb8abc1c18b31e
8fe4ac4bfb97e668a6fcc5d461c28ce0b94c0250
56317 F20101108_AAACEB mallikaratchy_p_Page_111.pro
26b894aca402dae8c067dde7f93792bc
98c0243292dc48d2e8c9a9697da85bf012ac3153
10992 F20101108_AAADHE mallikaratchy_p_Page_104.QC.jpg
9eb2bc797a4eb17e43d63bad307bf7aa
16a54c6f812b56fdc1597cb5f446cda74117b6ea
21551 F20101108_AAADGP mallikaratchy_p_Page_073.QC.jpg
5befdedf47b27d950853467dcfaef20c
1a53cf63ded594be53ea4ac3fe098e30f149b65d
F20101108_AAACDN mallikaratchy_p_Page_067.tif
07ff1f4c403e145310d9c61ae40ae163
32d4e5d684246bde55b2b5d715c8cf0ab9c65082
7398 F20101108_AAABYH mallikaratchy_p_Page_125thm.jpg
245633b8b1f652f56c488689526744b8
7ba569f785bbe15ac45ca9b8075d54189c6be4ce
2772 F20101108_AAACCZ mallikaratchy_p_Page_116.pro
86c520d782a7393f0a937a1cb5cffd40
9a5bcb35f62c60a277a18f7a88f838de8976b88a
22326 F20101108_AAABXT mallikaratchy_p_Page_041.QC.jpg
1458e9344d5c1171d0ea218b167f08b7
a61fc6493c72982ade89c335df628b1af6290cef
14115 F20101108_AAACEC mallikaratchy_p_Page_055.QC.jpg
2be3c0ba9fa58c422c587427ae8dc9ad
2404ef73d8e1e5005c93545e9764a7cf5882ec4e
7297 F20101108_AAADHF mallikaratchy_p_Page_105thm.jpg
5632379171deec50815da565dadfd59f
97736c040c778a8355de45f9780f6f7ac57189c7
5666 F20101108_AAADGQ mallikaratchy_p_Page_073thm.jpg
42fdd22a4a1add884238d4d38767d86a
f99361c9eca8e534d650a4da9158b14bfbe5bd24
51507 F20101108_AAACDO mallikaratchy_p_Page_046.pro
cde035846af2abf6b143febcb719f6de
af9c0e024286604e03b3a2bda4ba2dd60d5c6554
3840 F20101108_AAABYI mallikaratchy_p_Page_101thm.jpg
ecd2b2ac1dbf8858673f53ff4923f970
89d97202903ddc6b77ee39ad4eddc58addebffec
F20101108_AAABXU mallikaratchy_p_Page_058.tif
e9d98196e0e3aa1f17ebcd70f18749c7
efeeebb181bffe832c62df98f0904cfd6f2d6d5d
26808 F20101108_AAACED mallikaratchy_p_Page_032.QC.jpg
5d8ad646d4c8d00fd20293ec339faef4
4fa01b9167685a797e9631f3d291dd43ef396939
6086 F20101108_AAADHG mallikaratchy_p_Page_107thm.jpg
66b01fb43c494639cb43208ad908d96d
364942c309e0852797aea5acab4f3fe8b5bdb678
4934 F20101108_AAADGR mallikaratchy_p_Page_076thm.jpg
af9bfc2f453f552ab350fac603686e62
8dab897b12ed8935a5055bcd2e193e3196054020
4688 F20101108_AAACDP mallikaratchy_p_Page_011thm.jpg
9d957264883e9d739b885cb68a8a7bdf
731cfa981e15afce9773585a7dfad6e0438d9d36
22375 F20101108_AAABYJ mallikaratchy_p_Page_093.QC.jpg
9f7daf6fd270900dabf836fe266e0479
7831d83b7353cef8d0e5c6e54d5dfd7bdb23b1bb
98615 F20101108_AAABXV mallikaratchy_p_Page_135.jpg
fbd4de7d803e71f795440f3936d7048f
472e39ad63dc251802f501ddd42ccf133a605c01
F20101108_AAACEE mallikaratchy_p_Page_079.jp2
4677fd97deed1a5fe7118d7bcccadc56
2a638069459066b1cf0fb72acb9455f695d5a940
14604 F20101108_AAADHH mallikaratchy_p_Page_108.QC.jpg
64ba8c16890f409eec515bc4e97027f2
5ab1cb34a77bc82732e488afb5bf2e619d621ea7
27950 F20101108_AAADGS mallikaratchy_p_Page_079.QC.jpg
e872619cfce6c7fb2553c1825aba1332
0435a7b65cf1919d571bdb51943ba03715368a0a
1965 F20101108_AAACDQ mallikaratchy_p_Page_084.txt
e44f865d9be101c409eb3ab62fbdcaaf
4f6a22b2a51043bb4303db89693294214105d3d2
70175 F20101108_AAABYK mallikaratchy_p_Page_093.jpg
cd5f782ef371331ffd71516a661a5b23
467b327f1d377561560d541e00e4e5b8bcec5a35
2891 F20101108_AAABXW mallikaratchy_p_Page_035thm.jpg
6b9366dddfdc5aff5a84076b1d92fffb
020d69765044aab32a59e7ffd45538e2134f7c75
6488 F20101108_AAACEF mallikaratchy_p_Page_096thm.jpg
72a32482e60edb69b3483ef2372993d1
b8e161193de61a27e3ce754c078ce4dea82abe1e
28011 F20101108_AAADHI mallikaratchy_p_Page_111.QC.jpg
367fe22ad055ce927bba9358eeb1f7ae
933356fa47aad913bf123951528f1daf02390e56
2464 F20101108_AAADGT mallikaratchy_p_Page_080thm.jpg
4455da222cfeebc593f6a04d34d824cb
1314cfbeb3bc3672125125ce3344f3b426ffdf7b
1548 F20101108_AAACDR mallikaratchy_p_Page_047.txt
b2c76bd59c0fd5d705c20cd62ef8eaed
51e83120e62bfc94af0dd80168802ab1a24a6a0b
1412 F20101108_AAABYL mallikaratchy_p_Page_041.txt
57d01e5b7e3bcf890c6bef0f2f05197c
0f13964c3499b5e139e9ee39e03401cfaf4dfd06
F20101108_AAABXX mallikaratchy_p_Page_053.jp2
5336773159edacf597ce210b93e8bdd1
0913049cf3f699befe2f7af1859272c5c3c85a4c
6928 F20101108_AAACEG mallikaratchy_p_Page_042thm.jpg
7d3b4aa3c1557727bf1ab5aeefa36541
9870967af31da4489070188ebc1fbf2967db5a2b
10034 F20101108_AAABZA mallikaratchy_p_Page_080.pro
84809cf464faf52cdf533950a4433f04
73124d0da47e2e396df0a367bcf51a72e1326711
28271 F20101108_AAADHJ mallikaratchy_p_Page_114.QC.jpg
591143f55a1cb63bd7f813203a59b212
8f82fdb12e2c6e8cc9a50e5d98eafc84168c0b0b
7267 F20101108_AAADGU mallikaratchy_p_Page_084thm.jpg
68722bfafa2247dbad99a20e65c525a6
9447f9ddfbb0c8b2da83252f11e13ea75198040e
26672 F20101108_AAACDS mallikaratchy_p_Page_097.QC.jpg
e0f1fb65269297968ecf8983f754ce74
09999ed7175ae2d043d10b47669b5f5144634f86
55893 F20101108_AAABYM mallikaratchy_p_Page_112.pro
a9f59ff822f07737a16b2cc40194726a
565045747de59a889ebae0e1f47678c95ae7e004
76215 F20101108_AAABXY mallikaratchy_p_Page_012.jpg
910c456060133b200aff56f593a8dc90
eddde1fd20d55fad56cf8b95712e9ca92c15319f
F20101108_AAACEH mallikaratchy_p_Page_089.tif
9b30b747f0f81be60e1c1a1356e46852
08565ee0549990344ff44f68b91c2692b5950b38
39746 F20101108_AAABZB mallikaratchy_p_Page_093.pro
fcef99e8b4c4b7b3236e98c83064902e
cc8ae1ffb96d374f1fcb7f49c6e89a7871c0b34a
7655 F20101108_AAADHK mallikaratchy_p_Page_114thm.jpg
418d57ec1a30ed751f5b886b73ef65ae
a3324d72bf707568f75284f11bdda1819013e9ca
20412 F20101108_AAADGV mallikaratchy_p_Page_088.QC.jpg
4123156c41660e27e3841c29e016ed22
0436a8e4d69b113ae99d656b5e81cb46c15e038f
F20101108_AAACDT mallikaratchy_p_Page_112.jp2
4068795367cdeb95f61767581521d70f
dd3be5e6d43647f742e2dfa7270849fe25c3e9a3
51756 F20101108_AAABYN mallikaratchy_p_Page_014.pro
64d001a8e4da0e1c5ae0f11fefab70c1
c443fa0e201e736d355cb9eff4c1c0d9ec9ebc44
F20101108_AAABXZ mallikaratchy_p_Page_129.tif
3a352ae822c6ecad19dc6c674a210619
4391492b4d45771e00b820a6c37a2fde11dc2eb8
1051924 F20101108_AAACEI mallikaratchy_p_Page_084.jp2
fe471e733acd31ab230e24e4be5511e5
bceb1a580e3bf4c47500e1a2c8b1b490c2b3e1e2
19129 F20101108_AAABZC mallikaratchy_p_Page_101.pro
b2e673fba924dbc07a7be71a512b2198
6822340405088289916634a9fdce952ba8b8416f
7849 F20101108_AAADHL mallikaratchy_p_Page_115.QC.jpg
25f48e3a3f51178ff32cddaee3f1ac8e
60416973ac12fbeda272dff73c522f0dd885b7e5
21437 F20101108_AAADGW mallikaratchy_p_Page_091.QC.jpg
faf24ad605065f96be00183bff09aab9
a646031795a6aae916416ebd80cfd0162ae212cd
19742 F20101108_AAACDU mallikaratchy_p_Page_027.QC.jpg
a2d9ebd696b90ba411c96481c3c4d483
6f6f5cb71176f52bb6baa9259b314ce284c0d5fe
29395 F20101108_AAABYO mallikaratchy_p_Page_128.QC.jpg
f453f7027fbdb0a7740c7cf5d810b403
0e4054bc9c5270e26ddbb500cc3331e2294f3450
2764 F20101108_AAACEJ mallikaratchy_p_Page_135.txt
7b918eb272e31a6a38dc306db7af035c
1254e3c64fbadf8d4286ec6904321641b8dddef2
F20101108_AAABZD mallikaratchy_p_Page_125.jp2
ea915f3c744926d7fcbb7d6248842350
87eff589139bdee1f4a048e3e0abbbb1fa43d08f
18331 F20101108_AAADIA mallikaratchy_p_Page_136.QC.jpg
4639f6b5e94e46a6a5e762ea523eb4a0
f52475d517bf395eb57830fbdbe4268a1e5bfee1
2475 F20101108_AAADHM mallikaratchy_p_Page_115thm.jpg
c742743565ff5b74eebd5e0dcee56aae
91af8b810d8c244aea0c804ad01f5cff6d3ee90e
23985 F20101108_AAADGX mallikaratchy_p_Page_092.QC.jpg
80da3e3a15e03818be2541a4993af175
9c436e7056c2ba8ee7a1338a3c587dc717a7fe2c
6729 F20101108_AAACDV mallikaratchy_p_Page_051thm.jpg
e394ac20b829de0a500426418f34f45f
cd6f456987e04b313a169eddd434404f1607af35
27553 F20101108_AAABYP mallikaratchy_p_Page_062.QC.jpg
3f8d13246ac80326ce0f07a1e1f758e4
0f6d1ee4c708b8c1132192d1492a444ce2c19dd3
6564 F20101108_AAACEK mallikaratchy_p_Page_085thm.jpg
c411c7cdbbf4d181e8d64c0715b7c1c2
22c2f8b1dc44ebbe97f6d320b0ccabd0b9ff6377
3737 F20101108_AAADHN mallikaratchy_p_Page_120thm.jpg
06de2be43d4672be8f281508e8525111
334572b6af96e1feda8180b1d16d4c62e9bcc52f
7627 F20101108_AAADGY mallikaratchy_p_Page_095thm.jpg
53c94f7d6b4faa37847e9284b4157a37
a6ae3293ef5b3b4b67792c3416ff30b622cb7638
62758 F20101108_AAABYQ mallikaratchy_p_Page_013.jpg
6eeb0518048ec2972fd143af7c846574
3366f83bdce3891b2856f1647585474baf79cbd6
6472 F20101108_AAACEL mallikaratchy_p_Page_004thm.jpg
768c3dc207dbba3fb379d0e12fe153ae
7f19fb468fbdf36b92d02c89f5a659e58f0101bc
92256 F20101108_AAABZE mallikaratchy_p_Page_127.jpg
5dfda374aa058ede5102307ca3b6a093
1b47d2d885393f98f9b2e74ce079a663f04d8be3
28145 F20101108_AAACDW mallikaratchy_p_Page_017.QC.jpg
c9779b8efa87024383c84661b410bf10
6764fa8e5189b9b1fb9968c1e6284c2d3d25abc8
11535 F20101108_AAADHO mallikaratchy_p_Page_121.QC.jpg
2417a536e4081736280cc844d7a5a05d
089ce1403e0054d40968239dac6d53ee7a9de48a
23128 F20101108_AAADGZ mallikaratchy_p_Page_096.QC.jpg
b89884e7e0c1c293e38a9d8fb772db7d
47ff8338b2d3fca5041ef1ee3014a856f1a52adc
19977 F20101108_AAABYR mallikaratchy_p_Page_019.QC.jpg
b9e7144761bf8efc026ea5c36605acf0
eeb8b1f9c38b24d6691bd026fa48ccd9310ccd01
26030 F20101108_AAACFA mallikaratchy_p_Page_081.QC.jpg
95b0f755e74d2691f82735a9bdace87f
bfd67df310b42d132dba985ad6b9a341c9219280
492 F20101108_AAACEM mallikaratchy_p_Page_001.txt
f7a9e01d4369ccd5a3e4409d01d11429
8a13beb9ee4bf6a97812b20b51b5f2154e98c8b7
F20101108_AAABZF mallikaratchy_p_Page_089.jp2
2c09f31a1b223b228893b4967be96d38
bdf1ac70aa976c6ce3aa2039ffad243ddc107d8e
84116 F20101108_AAACDX mallikaratchy_p_Page_015.jpg
8399422000a7788c06f31605a5214f27
b4cf15953b2fa3cefb1fd7dc19352c5ba1ffb100
F20101108_AAADHP mallikaratchy_p_Page_122thm.jpg
ae95f980f343e8bc1c4c651b6d906215
7c576e03cf507815b68bdf4c6e6e5c7a82771c5a
F20101108_AAABYS mallikaratchy_p_Page_009.tif
454685a9b5c298cc44e7b338db8bd5a0
a707ce0cee7e5f82d8ee0a9ca553a90e81bd86e9
2089 F20101108_AAACFB mallikaratchy_p_Page_097.txt
a47d27094d5651ca84dff7262e4006e6
a07e3af59c4438b1a10e6e1253775a90640a0fbf
F20101108_AAACEN mallikaratchy_p_Page_057.jp2
a897bd40cca053f4b2a0eee70f9f1a19
d85f14472069192edb0c6b2f4d852e2266b8b4f3
F20101108_AAABZG mallikaratchy_p_Page_033.tif
e5d82bd4160082541b92848a3648d3d1
c425e90022fdf1c3f2d399afbc4e9bf05a1af8df
F20101108_AAACDY mallikaratchy_p_Page_042.jp2
3f26637393231df72dde820916418c76
baa474dcf2f6db56950a6e23635e453e77f52be2
12691 F20101108_AAABYT mallikaratchy_p_Page_101.QC.jpg
50967c0c6988f529b60a0d2fa59e6751
2d891e2a09cf2a8377dffd72a86b9a3ae110abdb
1051938 F20101108_AAACFC mallikaratchy_p_Page_037.jp2
a6bf8eb26b2a083a75b9d7bed0d056d6
0158fed0d18c4c62250358f091a722514f7d9aa9
26923 F20101108_AAABZH mallikaratchy_p_Page_113.QC.jpg
b6d2c8bbf83ea684529653218b927a7a
0532d240be480abdfe4093a7c86d17ef34e79879
53265 F20101108_AAACDZ mallikaratchy_p_Page_015.pro
2b6bd265ad7c54ab474c59e807f74781
7a780a70764989d014fbb9b47c905ea5c32e7033
29821 F20101108_AAADHQ mallikaratchy_p_Page_123.QC.jpg
6c53cdf77737eba57765b30719c6c599
1eb990236706e4bd431b4a7be4703ab82ba01dc8
26524 F20101108_AAABYU mallikaratchy_p_Page_025.QC.jpg
b7587f8fe9f88eb3bbe945fe9df175fa
a41ac43f571fc9f10a86602510a681991ef59801
1051908 F20101108_AAACFD mallikaratchy_p_Page_111.jp2
f36ad49ed847c74bcce6eaa6515d0115
d1d2335c75b1fd9e2c92d65f458237fd5077abd0
1499 F20101108_AAACEO mallikaratchy_p_Page_051.txt
293e16c114c47bac26aeb88b7ed46d4d
6b7ad5415dd468becc4e700dbc7e602576b1a433
47183 F20101108_AAABZI mallikaratchy_p_Page_108.jpg
61273e47f15cf4d4bfa4a5c84b0d7297
01d43e90be01d02cfd27cc21d9bf361780be765c
7685 F20101108_AAADHR mallikaratchy_p_Page_126thm.jpg
9a991fc87cd14746685ca4415308172b
080abd849e6fe2ec4d7b7d9cf48accc141e6b7d3
2798 F20101108_AAABYV mallikaratchy_p_Page_128.txt
ec6561335276c21e96433bbaa79b6c7e
a208598958237423971c35a0ed03d769b08fbb6e
F20101108_AAACFE mallikaratchy_p_Page_073.tif
aa41345d8a633e9eff734fdc48c75116
e8db40937b85d8b2b95436310ee5b690ed6bb031
43088 F20101108_AAACEP mallikaratchy_p_Page_092.pro
91ad64d611f08c1d23872c8c3d9ad8ad
14aa97e566944c01f7df5fe36031de5781c0101c
F20101108_AAABZJ mallikaratchy_p_Page_044.jp2
f1baf0e7531524fda03cfb37fedc36cb
c2d8d2e351f89b25ff1ee54c60661e08ae232897
7087 F20101108_AAADHS mallikaratchy_p_Page_127thm.jpg
be50279dfbf7a80e3e5d1e9a4152e841
8e30a27ed0b5206447d17a14bc3d0a7c4bea4625
11240 F20101108_AAABYW mallikaratchy_p_Page_115.pro
facdfd1df067ed8f838880d8f541226b
e4cff6adb62186c35abf806321c5c98acbaa6876
F20101108_AAACFF mallikaratchy_p_Page_119.tif
e3694d84efde909f5391b9789e77ec56
900e0c49171abd9a6e4e1f14f588c94f918d59df
F20101108_AAACEQ mallikaratchy_p_Page_022.tif
8444f936363fed4253f92922382b0bfc
ecb5da1a513131f8f681642311056a4382054e84
F20101108_AAABZK mallikaratchy_p_Page_132.tif
d97bfa51b972993ab23193d42866862c
2a3b7804816406b65a76c5086afba851d034abd9
7865 F20101108_AAADHT mallikaratchy_p_Page_128thm.jpg
3f70422ec4830e3993ca0c894caee22a
86f6637a67e7514297a1edafafbb972342cac924
4555 F20101108_AAABYX mallikaratchy_p_Page_106thm.jpg
999c514b3af885b0b6da20fc44cba8f8
707cc1c170e98618104fa9851b8bc3aa53cb9254
2152 F20101108_AAACFG mallikaratchy_p_Page_029.txt
7ad3312552f36d5fef5c9d8426d602e9
abeaa6ab94840278ba2d463ed9e2e53ba9f5a8b5
F20101108_AAACER mallikaratchy_p_Page_068.tif
23f285545a4d15204354c7cd307b9ab4
b5ae8b65eafdb49745db5b6cf1adfae208beef35
17119 F20101108_AAABZL mallikaratchy_p_Page_087.QC.jpg
88ea9995393ca8b5fd4d7ce545859f51
47e970d1d065fe6683a7435b970ca9fe43b035e1
7576 F20101108_AAADHU mallikaratchy_p_Page_129thm.jpg
dc47f58a1098fc4b5edc471641f1f1db
539561b7365fe69fdaee212dc10a85816d609c71
F20101108_AAABYY mallikaratchy_p_Page_088.tif
db3be6cf337781c44d56770670418c46
109466d06fccfc44896aa32a4ee8443cbfe2ce5c
446 F20101108_AAACFH mallikaratchy_p_Page_109.txt
330a0bd293ec1852cb3e3be34fc9a08c
2b4782573a82b4d45520691637a3bd724c4fccd7
56740 F20101108_AAACES mallikaratchy_p_Page_131.pro
bceb52cb58bf17f592ff52463934a939
4b93cdcfaf6e1c1e0b534dd18f7a7b4a148e5d97
1051955 F20101108_AAABZM mallikaratchy_p_Page_069.jp2
cf6d3e665bc8528c3db77f4d1f662979
72a0edf09beffcf6bbd24c948e266e772bd3981e
7741 F20101108_AAADHV mallikaratchy_p_Page_130thm.jpg
85b445ae3ae5b7f2dba10410d802369d
26cc41a8233030c94efcf46cf5624fd46cd334af
2016 F20101108_AAABYZ mallikaratchy_p_Page_089.txt
87475165a77ffd416d6f7c29819ed6fa
cdedb3bd6e7f63331ca09cf15ebaaf9428c0bf55
53628 F20101108_AAACFI mallikaratchy_p_Page_028.pro
17c7fd2c3f8b86281b67f2199e4922b8
9d557c144853a8d0fca78e59b29dfa7a3295b82b
F20101108_AAACET mallikaratchy_p_Page_082.tif
b58c137b1c901ebc8a02ef46b83bb68d
ccfd091695dbf53f7d497a584a6541c4857845b5
27149 F20101108_AAABZN mallikaratchy_p_Page_065.QC.jpg
848c44bea6a798b70ce711975f485b33
f60b4e96b97c0f0b17e87148a0c9b35d4e69b50c
7055 F20101108_AAADHW mallikaratchy_p_Page_131thm.jpg
18001041fa064a527a67145594fc1ccb
2b5dc00fb714c4bb75571246595254413b6c4990
7205 F20101108_AAACFJ mallikaratchy_p_Page_014thm.jpg
8ee34bd8b964f4e39bd01bb20a5136dc
d853d2e09fa7c629bbd6ff1e58072da92734bf81
1493 F20101108_AAACEU mallikaratchy_p_Page_013.txt
ff708adbb5e64de80c2d6182aca79ffc
e4f1783f844441de51d1ebb447e5db001231273a
7187 F20101108_AAABZO mallikaratchy_p_Page_078thm.jpg
58eb47900297dcfcfa0294bc8a91eac4
c93994690c78e85db0b6e1e9d6ab72062b5f9e1d
7448 F20101108_AAADHX mallikaratchy_p_Page_133thm.jpg
df240ed3a334c93bf4d2562fbc37eb91
700bd27008d242ee871abd6b9d6df6dfc9d17c44
2025 F20101108_AAACFK mallikaratchy_p_Page_046.txt
4f99dbb457004e299ea0c457371b17d3
7d4bf2f06b15a6f0b58e2c9ad0d2aaeca15c067c
25959 F20101108_AAACEV mallikaratchy_p_Page_028.QC.jpg
0b1f2cda7eafaadf9af5da72f7b9d920
83c8344a2d4ceaee0efb4d73044e308c8554a749
26695 F20101108_AAABZP mallikaratchy_p_Page_133.QC.jpg
be85a441035c010840e8f8089447d062
bbe6f5095e3a0b935bdf09c0fd213711e834f2ec
27976 F20101108_AAADHY mallikaratchy_p_Page_134.QC.jpg
72248bf0b758606b872d8b55c5cf7b85
7a354b5bc69f52a4e17a866e7ee99ed5d27a8c39
2122 F20101108_AAACFL mallikaratchy_p_Page_057.txt
cd8db6cfae7c7f2527cb29d18f078cc5
cafde7a20487e1c43c2a546d1cab8cfa2616998e
94297 F20101108_AAACEW mallikaratchy_p_Page_006.pro
cb361350192b620fb9ba13481ceedd42
be7e1850e2c4244e8261028f59e1baf8e598afc4
F20101108_AAABZQ mallikaratchy_p_Page_023.tif
c39c96b4d8722cc0472ffeb94eb6efba
3024b27c07254760fcd0c92040dd9782ee0a6135
28929 F20101108_AAADHZ mallikaratchy_p_Page_135.QC.jpg
1dea1b13d96f23d1a72c5210d70ae3cd
3ba25cacf90bd2489d8f7d52437edba26f3be0b1
74572 F20101108_AAACFM mallikaratchy_p_Page_091.jpg
f8abe15fe0c7a94143c815ce72d00543
dec470a56bcc32d751230818a7c327a7a7e5f02c
54380 F20101108_AAACEX mallikaratchy_p_Page_031.pro
4097d84863c3ea3289f43695aab2ef8d
0caaee82fd636a9f497565a935b496db6ecbabb0
1001760 F20101108_AAABZR mallikaratchy_p_Page_004.jp2
7a325626c5355ddef81326058f75e712
4a91bf8b54436a04261931316c71c79f04624ee2
27013 F20101108_AAACGA mallikaratchy_p_Page_084.QC.jpg
a71617a9fbb9ec47cc880ed287344d89
133199e1bff914d9d521d9567e3ae4944743945b
521039 F20101108_AAACFN mallikaratchy_p_Page_137.jp2
1b2981a46cbc94368468e18774d51e09
81af094e082e6c63546dda8c01eb6d754e543000
6694 F20101108_AAACEY mallikaratchy_p_Page_094thm.jpg
327a5094660a28eaa45bba6d7da0516a
89fafecd7c0f1f75cd53ba166fcdf2f096a9790f
4586 F20101108_AAABZS mallikaratchy_p_Page_117thm.jpg
8cb9fd96bb5ed9f038bb98e62682a53c
91c76f683fb90af6647ec1fd0dd107793300796f
739 F20101108_AAACGB mallikaratchy_p_Page_117.txt
98d8b397fb6f6199c756cb3517ece8b0
91a25649ef93dd4a4a8c24b45e02dc9b6dce7cbe
1051921 F20101108_AAACFO mallikaratchy_p_Page_031.jp2
451e5324e77d91ccf3524fdf15cfad62
16284b7645b47216b6f32d9133f6b455c48f94c1
1051885 F20101108_AAACEZ mallikaratchy_p_Page_040.jp2
e548a8f5e8d72dc98b25a5ff57bfcf2c
0b52c345e438594a27540fa0b6b09a840d65f5c7
1073 F20101108_AAABZT mallikaratchy_p_Page_118.txt
e98a093672a1dfada51ab6c748a4c9f0
5fcc267d7ef1e10298f27ea6e283027364a92c23
5550 F20101108_AAACGC mallikaratchy_p_Page_086thm.jpg
25d6adf581806c1f5db0151e99aefe16
8f63781b2ce786ec3b77b045e2d05daa895952dd
106424 F20101108_AAABZU mallikaratchy_p_Page_128.jpg
5d48af28076bfe36761db1b6d4560e7a
632b15642ec94c534c6dc7361bb513d2bd4f5e88
84694 F20101108_AAACGD mallikaratchy_p_Page_065.jpg
f747d0c4d95a0de9f667d2b48fa11c4c
2a5160012072fbd87c45c8174dd08e1ae6168ff5
F20101108_AAACFP mallikaratchy_p_Page_126.jp2
1ee6c97a91b7b74001dc435879f9f93f
d4f90ccf105c1fe1a6039e623d465fd522de5512
83109 F20101108_AAABZV mallikaratchy_p_Page_119.jpg
cd5965ef08f7d0d604298ffce07eb3b3
84d8ee7cef03434a1b298a5216e0271532aa3d6c
3450 F20101108_AAACGE mallikaratchy_p_Page_005.txt
1e2213f01ba33336f73807601448bba4
ddea608b94ceaa3f1ad5e1546011a66c5a1a6910
F20101108_AAACFQ mallikaratchy_p_Page_025.tif
f696c795b5518ab8f0822be91d5bb2e5
bde40cc4986705f873f2a517edd4bc2371699f3d
F20101108_AAABZW mallikaratchy_p_Page_070.tif
dc070d9681dbedf62a9c9d9dc89479e2
b9a3ceb0b6f33e0325bcbf73b8987b9aef543c4a
F20101108_AAACGF mallikaratchy_p_Page_052.tif
874cdb95da5d2e2c38fc8ce2fad0e02a
8f784348c800dae6d23a3cf91e77259a8120537e
80163 F20101108_AAACFR mallikaratchy_p_Page_026.jpg
942ef515014178605bb3f4281d411378
ec52a9d5102e262b51318c64008ffc1a62e1607a
55821 F20101108_AAABZX mallikaratchy_p_Page_114.pro
ca50755ccf847f607f991e9be0f02ffb
90b5a13e31a67e5a3a232096ea3923527fc8f343
547427 F20101108_AAACGG mallikaratchy_p_Page_068.jp2
d757b4293df12eb714464d0f5b2a4a80
6b5a9f3ae0752a0e231e244f4e82b72e9ac3d703
6464 F20101108_AAACFS mallikaratchy_p_Page_089thm.jpg
a9bdd554abb45d4cf63c03c0f006cc74
adc16c46811a61f3bff80703bb36f287da773d1c
26585 F20101108_AAABZY mallikaratchy_p_Page_129.QC.jpg
8e9b0d73814e99316826e8df8db38f44
2edd9ac8d12b60b854b54981b0ef1c7217bf17f2
F20101108_AAACGH mallikaratchy_p_Page_081.tif
8413e7b0c37615da38b5d30dfc359f26
312864f869ef08f7858e30f809a71cef5c693ba6
67376 F20101108_AAACFT mallikaratchy_p_Page_094.jpg
8a1b14fde64c7e90b5db3b8176372a4b
bad168366b163b9bb1b1aae293f7237ca724bc5d
F20101108_AAABZZ mallikaratchy_p_Page_105.tif
665314661cf252c894b87f175fec2eb1
b2a22eda4edac4c25628576630069683bee3f7db
2137 F20101108_AAACGI mallikaratchy_p_Page_119.txt
11be265c0faf8a7fd6732b46eaf79f93
f98c77616ff9726a5fc85aecae3ed8e498702a8f
F20101108_AAACFU mallikaratchy_p_Page_096.tif
97cf9be3ff93ffcef394ae394e0a948b
363a24076ecde39b443b48e52244f8eb95765556
26225 F20101108_AAACGJ mallikaratchy_p_Page_127.QC.jpg
4957b86d2189232252a928635dc0507c
3b4b1288d7d7c20274079f271cd13baebe01dfe2
7103 F20101108_AAACFV mallikaratchy_p_Page_081thm.jpg
91a6c6b70a39b0d58774d513605e3cb1
716c67fcfe6e707f28fa84e432b2e759f6fe4aef
6284 F20101108_AAACGK mallikaratchy_p_Page_102thm.jpg
d6d464ddcc5eb0b120afc2e362cce668
253819a13bc2859e6bbfc5d734bde32568e763b2
F20101108_AAACFW mallikaratchy_p_Page_039.jp2
2205627833d2230ebff337d5060bd8f9
72da724b44a9deda4400141c00e48e530150386d
6087 F20101108_AAACGL mallikaratchy_p_Page_091thm.jpg
d59eb0e888a52e793ec18cb731d02102
61c5c66abc1d95b4ec14d36e4bc826cf0ed9734c
14473 F20101108_AAACFX mallikaratchy_p_Page_117.QC.jpg
dc6d485ba7113b99e394e173c2dc856d
093319065d4e4fa3e69d076d35c153b2f04690cc
20512 F20101108_AAACHA mallikaratchy_p_Page_090.QC.jpg
bde0d9add140d9faab7bfaba81bc67ef
b184a588c8d83d9c976dc496a03353572927c301
687787 F20101108_AAACGM mallikaratchy_p_Page_048.jp2
464e808e529fc372b5073af409a5c75e
96853d4f5b2407a9d060b28ea85f981d0a5168f7
1783 F20101108_AAACFY mallikaratchy_p_Page_096.txt
09f5309dca62fbd8ec8d6a1735a32a98
0f3d75675f57683b86134e3e65b403d9e254b4df
F20101108_AAACHB mallikaratchy_p_Page_073.jp2
04184e3cb689de5abf87303b8358569e
3b2baef342e052f0dd047fc5f9dba167bbe6b78f
F20101108_AAACGN mallikaratchy_p_Page_006.jp2
f0dfb16ce81b62c86676f26d8c4cbf5c
7d0097fb27fe3ffaf849b0ff32d60694f833c257
1843 F20101108_AAACFZ mallikaratchy_p_Page_085.txt
6c0a99cb64e5ca9f8f81db83fca33ab2
0002b3457a39fc33078e98b3f4839be09c629350
256967 F20101108_AAACHC mallikaratchy_p_Page_109.jp2
efc697da3b221a2bda26e4852229d89f
6908e9ccac59e74c70de758260d076f3bdca7b46
68234 F20101108_AAACGO mallikaratchy_p_Page_135.pro
d1452c99caf8969b7686d62aee39220d
d2b6e99b45aeaf95e507a3863141dda0c9d0c87d
F20101108_AAACHD mallikaratchy_p_Page_133.tif
c94552b9fcf79a121a4b0b9ed16e7508
034218fb27e2bc95425aa3b137c8eda82ed0cdbd
938 F20101108_AAACGP mallikaratchy_p_Page_008.txt
17dae350ad18f932813fc6aecbe614ec
1d99c3e768cd54fb73fe40d9ed82edbb0db15414
1903 F20101108_AAACHE mallikaratchy_p_Page_071.txt
bb538fc5d4c90c742052947f640df3aa
1e25e90103d71765e82a71c3ce71474e6c226c4a
F20101108_AAACHF mallikaratchy_p_Page_001.tif
2218a1f7a03d22e8adda686d9f648638
9beefde7d3b373a4076b073b74d32929c7bec390
31004 F20101108_AAACGQ mallikaratchy_p_Page_086.pro
9d40020f60a604f7a3b57511e1e95ffb
6f080b7faef2e5b7336181f78ea329ac8732ee0b
F20101108_AAACHG mallikaratchy_p_Page_079thm.jpg
7783ce88cdd772f90af1077580330e5a
2fb6b91d579fcd934e6e0d85df11fe96fe9683eb
60052 F20101108_AAACGR mallikaratchy_p_Page_127.pro
1330dd629ec629d1af2c549c6aa54fcb
9cd41c441252f80569f07b255d93b25da7458e28
697157 F20101108_AAACHH mallikaratchy_p_Page_034.jp2
2caea5fb2eb330add4e3d45921b06e1f
dd7e8170234917c97eb589092826e62928ad9081
48878 F20101108_AAACGS mallikaratchy_p_Page_100.pro
1eb37e8c55468ff255e31c935ae36dbf
1fa16f84ee325ddf6e8cfcdb246dbcf193a6580f
67423 F20101108_AAACHI mallikaratchy_p_Page_054.jpg
a6d4fe0ea57dbade692721b56c8a9d39
919ca9333da1570653c64b988dc8ff8e0567d6a4
25679 F20101108_AAACGT mallikaratchy_p_Page_014.QC.jpg
5b90fc7bfe6caf8061e502dda8532b01
275f0e16a14fbf76c3d7f0661cae93e1edb0b85b
F20101108_AAACHJ mallikaratchy_p_Page_049.tif
4b448357fd4d08ec2b2a48d10c4ab60a
2df2f7299da04ec043f7d38b49e585f7f6840f64
1359 F20101108_AAACGU mallikaratchy_p_Page_103.txt
16ff8b128876465ec19901aeefc7d257
5d6619a70e6f37885c8f3dc22417923559469bc3
7893 F20101108_AAACHK mallikaratchy_p_Page_109.QC.jpg
7d50bc81520cc9682126325f326d62d9
567769d58b1c23a60cc37d8d58822ff630baaf1a
66192 F20101108_AAACGV mallikaratchy_p_Page_132.pro
11f92506afaa761ffabc880bf94d3f40
f7ac89ffd80ef7638c3e462736128329f8a5e215
83374 F20101108_AAACHL mallikaratchy_p_Page_021.jpg
50be446c9b37654c19f9858a80327289
39ce80b2fc1eea1e2738d0d1e3ed8b825f5c3225
F20101108_AAACGW mallikaratchy_p_Page_112.tif
e37b5dc8f44162aceddfc0597c9aed27
ebe19e38857e72b6673e9fe26c27da1ea2b88d43
86811 F20101108_AAACIA mallikaratchy_p_Page_043.jpg
46eefc0284c570f9516705ecb8fbfaca
96af7cf228cfed48a0f851f7f1485afe9792210d
37535 F20101108_AAACHM mallikaratchy_p_Page_020.pro
a6930b76aca1a5edaaa9ebcc56929e9d
7225e53932ea04380a09da0c1416fa81d3444457
36616 F20101108_AAACGX mallikaratchy_p_Page_045.pro
59f78b46bbc62169499c05ba7220fb46
0673434da5ff1bdb9e24fd46db0208f209af7993
2488 F20101108_AAACIB mallikaratchy_p_Page_007.txt
e506e9bd49393eef2e23a22743f93eda
22932e535bd057cf45dba47324246add5946f055
85512 F20101108_AAACHN mallikaratchy_p_Page_113.jpg
ca2d8de7f120ea753be4d705d93a151d
c4a0196049c584bf3e10a81fa8f4a9720d2607bb
F20101108_AAACGY mallikaratchy_p_Page_015.jp2
35aef5663b0f1d2e62538d5572e47d42
a40a8830a141aeea386bc03a7c1ca62cf16d0b86
1381 F20101108_AAACIC mallikaratchy_p_Page_002thm.jpg
379088e3ec8348c5b0f08bcd531678d5
1ddcf57c0aec563e401d22a6246b790777f69f19
83658 F20101108_AAACHO mallikaratchy_p_Page_040.jpg
fe55b28dbd51b477001cca8e9e32c460
089f9d5d5a7c7b752e549d8fb65da7890a24557d
2462 F20101108_AAACGZ mallikaratchy_p_Page_127.txt
5c0985ffb8a6d2219b72618185b4341e
d30618a144a769309a9aa3ea4cfa249fe14510e0
12219 F20101108_AAACID mallikaratchy_p_Page_120.QC.jpg
8a6251d28eb5817101bffff37a84bec4
00821d34b6779d407b689053555ab7d90423f36b
2046 F20101108_AAACHP mallikaratchy_p_Page_056.txt
0eaec863525e2a10c6f2195fad1c8b92
605f907064443ad25a711255b7d6fdfe03a18c1d
7069 F20101108_AAACIE mallikaratchy_p_Page_046thm.jpg
ec9fbe509b88b2e0497de1b8728b51a3
b302500622d98cf302ec6f3ed92b77c4525919db
F20101108_AAACHQ mallikaratchy_p_Page_021.tif
981a7cbb040b3587957f828962015c49
522ee517c80895a3b6aaf88d62ba9c929f5547e5
27098 F20101108_AAACIF mallikaratchy_p_Page_078.QC.jpg
5a75097d9adc53e8783179866b4f56d2
06aa12f373e0d1f4ee603ee8be2b04cd5d23d598
1444 F20101108_AAACIG mallikaratchy_p_Page_086.txt
4f13a7607fc5fead87654fea9f2b7f8f
950dc9508bed010bb76eba8aaf4d4b1ca47c6bf0
2678 F20101108_AAACHR mallikaratchy_p_Page_010.txt
6eb343898da6ff4f38b3debb8d4d876c
3869195adf8c1aa02b2270e734a79555c5e25f35
1602 F20101108_AAACIH mallikaratchy_p_Page_054.txt
1a858be62c3323cf89fd2df751a4ef6a
5f4700d3d657ec3e7341b554e20a0a2fe9c133b8
55778 F20101108_AAACHS mallikaratchy_p_Page_017.pro
c69d50e533c0125788036fa32676bc77
e45f2fd49403b079dfd0789e847c4064de77d063







INT VITRO SELECTION AND DEVELOPMENT OF APTAMERS FOR BIOMARKER
DISCOVERY AND TARGETED THERAPY




















By

PRABODHIKA MALLIKARATCHY


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA

2008


































O 2008 Prabodhika Mallikaratchy

































To my family









ACKNOWLEDGMENTS

I wish to express my sincere appreciation and gratitude to my maj or research advisor, Dr.

Weihong Tan, for his guidance through out my graduate school and his understanding. I am

indebted to him forever for his valued assistance during the period of my research work.

My profound gratitude and appreciation is also extended to Dr. Jorg Bungert, Dr. Kirk

Schanze, Dr. Nigel Richards and Dr. Thomas Lyons for serving on my committee and for their

helpful suggestions and advice during my research proj ects.

I thank the support staff at the Department of Chemistry, University of Florida, for their

silent contribution during my research work. My special thanks go to Ms. Julie McGrath, Ms.

Tina Williams, Ms. Lori Clark and Ms. Jeanne Karably for each of their continuing help with

numerous tasks.

My special thanks go to Ms. Hui Lin and Dr. Arup Sen for their assistance with DNA

synthesis for each of the proj ects.

It has been a great j oy over the years I spent at Tan group. I thank Dr. Lin Wang, Dr.

Steven Suljak, Dr. James Yang, Dr. Colin Medley, Dr. Dihua Shangguan, Dr. Marie Carmen

Estevez, Karen Martinez, Hui Lin, Dr. Zehui Cao, Dr. Marie C. Vice~ns, Huaizhi Kang, Dr. Josh

E. Smith, Dr. Alina Munteanu, Yanrong Wu, Youngmi Sohn, Dosung Sohn, Kwame Sefah, Zhi

Zhu, Hui Chen, Yan Chen, Ling Meng, Dr. Jilin Yan, Jennifer Martin, Pinpin Sheng and Zeyu

Xiao for their kindness and help.

Last but not least my deepest love and appreciation is extended to my dear family for their

constant support and love through out my research work. I can not achieve anything in my life

with out the constant encouragement I got from every one of them.











TABLE OF CONTENTS


page

ACKNOWLEDGMENT S .............. .................... 4


LIST OF TABLES ................ ..............8.. ......... ....


LIST OF FIGURES .............. ....................9


AB STRAC T ................ .............. 12

CHAPTER


1 INTRODUCTION ................. ................. 14.............


Role of Proteins in Cancer ................. .... ......... ................. 14..
Molecular Probing of Cancer for Biomarker Discovery ................. ......... ................ 16
Transcription Profiing Based Molecular Marker identification .................. .............. 16
Protein Profiing Based Molecular Marker Identification ................ ............ ........ 17
Aptamers ................. ............ ................ 18....
Aptamer-Protein Interactions................. ... .... ......... ........ 18
Systematic Evolution of Ligands by EXponential enrichment (SELEX) .................... 19
Separation Methods in SELEX ................. ........... ................ 21...
Conventional SELEX Separation Techniques ................. ................. .......... ..21
Novel SELEX Separation Strategies .............. ....... ... ................ 22
Aptamer Signaling as Molecular Probes in Cancer Protein Analysis............... ............... 22
Multiple Aptamer Probes Targeting Whole Living Cells............... ................. 24
Whole Cell-SELEX Strategy ................. ................. 26......... ....
Applications of Aptamers in Cancer. ................ ................. ......... .............. 29
Aptamers and Antibodies............... .............. 3 1
Photodynamic Therapy ............. ........ ............. 3 1....
Mechanisms of Photosensitizing Action ............ ......__....._ ............3
Biological Damage of Singlet Oxygen ....._____ ...... .. .___ .....___..........3
Current Delivery Systems in Photodynamic Treatment. ................. ................ 32
Overview of Dissertation Research ................. ................. 35............


2 SELECTION OF HIGH AFFINITY DNA LIGANDS FOR PROTEIN KINASE C-6........ 36


Introduction............... ................... 36
Protein Kinase C Family of Proteins ................. ................. 36...........
Materials and Methods............... ................ 38
Instrumentation ............ ..... .._ .............. 38...
Initial Library Design ............... ................... 38
PKCS Expression and Purifieation ............ .....___ .............. 39..
PCR Optimization..................... .......... 39
Combinatorial Selection of Aptamer ....__ ......_____ .......___ ............4
Aptamer Labeling with AT32P ............_ .......__ .............. 40..











Electrophoretic Mobility Shift As say (EMSA) .............. .................... 41
Cloning and DNA Sequencing ................. ................. 42............
Fluorescence Anisotropy Measurements ................. ................. 42......... ....
Results and Discussions ................. ................. 43......... ....
The SELEX Process ............... .......... ......... .. ...... ........... 43
Analysis of Consensus Secondary Structure of High-Affinity DNA Ligands ............... 49
Analysis of Binding Sequences for PKCS ...._.__.....__.___ .......____ ...........4
Specificity of Aptamer PB 9............... ................... 54
Conclusion ........._.. ..... ._ ._ .............._ 55...

3 APTAMER DIRECTLY EVOLVED FROM LIVE CELLS RECOGNIZES
MEMBRANE BOUND IMMUNOGLOBIN HEAVY MU CHAIN IN BURKITT' S
LY MPHOMA CELLS ........._.._.. ...._... ............... 56...


Burkitt' sLymphoma ................. ............... ........... ............. ....................... 57
Principle of Photocrosslinking of DNA with Proteins ......___ ..... ....__ ............__.. 58
Aptamer TD05 Recognize Proteins on the Membrane ....._____ ..... ... .............._. 60
M ethods and M aterials............................. ... .............61
Competition Assays with the Modified Aptamer Probes .............. .................... 62
Aptamer Labeling with AT32P ............ ..... .._ ..............63...
Protein-Nucleic Acid Photo-Crosslinking ............__......___....._ ............6
Cell Lysis and Protein-Aptamer Extraction. ......___ .......____ ....___ ...........6
Release of Captured Complex and Protein Gel Electrophoresis .................. .............. 65
Partial Digestion of Membrane Proteins Using Trypsin ................. ........... .......... 65
Characterization of Aptamer Binding Protein on Ramos Cells ................ ................ 66
Fluorescence Imaging ................. ..............66. ...............
Results and Discussion ........................ ............... ...... .... .. ......... 66
Probe Modification and the Effect of Modification on Aptamer Affinity and
Specificity ............... ...... .. .. ..... ... ...... .... .. .......66
Separation of Captured Complex From the Crude Cell Lysate and MS Analysis of
Captured Protein ..................... .. .. .. .. .. ............ .............. 67
Confirmation of the Protein IGHM as the Binding Target for Aptamer TD05 ............. 72
Discussion............... .............. 77

4 APTAMERS EVOLVED FROM WHOLE CELL SELECTION AS SELECTIVE
ANTI-TUMOR PHOTODYNAMIC AGENTS ................ ................. 81......... ....


Introduction to Photosensitizers............... ........... 81
Methods and Materials............... ............... 83
Synthesis of the Conjugate ................ ......... ......... ......... ................ 83
Cell Lines and Binding Buffer............... ................ 84
Characterization of the Conjugates ................. ................. 84.............
Fluorescence Imaging ................. ................. 85..............
Flow Cytometry ................. ................. 85.............
In Vitro Photolysis ................ ................. 85......... ....
Results and Discussion .................... ... .............. .............. 86
Conjugation of Ce6 with Amine Modified Aptamer TD05................... .............. 87












Characterization of Aptamer TD05-Ce6 Conjugates ........._._........__. ............... 88
Investigation of Toxicity of Aptamer TD05-Ce6 Conjugates ........._..... ........._.__.... 90

5 APTAMER EVOLVED FROM CELL-SELEX AS AN EFFECTIVE PLATFORM
FOR DRUG RELEASE ........._._ ...... .... .............. 95...


DNA Directed Functional Group Transfer Reactions .............. .................... 96
Methods and Materials.................. ............. 98
DNA Synthesis and Purification............... ............. 98
Fluorescence Measurements ........._._ ...... .... .............. 99...
Cell line and Reaction Conditions ........._._.. ...... .............. 99.
Results and Discussion .............. ... ....................... 100
Probe Design and Mechanism of Activation .........._........ ....._......... ......_........... 0
Investigation of Quencher Release Using Aptamer Sgc8tem-C3-DTT on the CEM
C ells .............. .................... 102


6 SUMMARY AND FUTURE WORK .............. .................... 110


Summary oflIn vitro Selection of Aptamer Targeting PKCS .......___ .... ......_......... 1 10
Biomarker Discovery ............... ... ............ ................. 110...
Summary of Targeted Therapy Study ................. ................. 111........ ...
Future W ork............. ................. .............. 112
Aptamers with Increased Nuclease Stability .............. .................... 112
Aptamers as Targeting Moiety in Gene Therapy .............. ................... 113
Additional Structural Studies of Aptamer Site Recognition............_.._ .........._ ... 1 14

APPENDIX FLOW CYTROMETRIC ANALYSIS OF BINDING OF FLUOROPHORE
LABELED APTAMER WITH CELLS .............. .................... 118


Instrumentation ............ ...... .............. 118...
Data Interpretation ............ _...... ._ .............. 119...

REFERENCES .............. .................... 122


BIOGRAPHICAL SKETCH .............. .................... 137










LIST OF TABLES


Table page

1-1 Screening of aptamers selected using Cell-SELEX. ........................... .......28

2-1. Evolved family of sequences with percentage of population ................. .................... 51

3-1. Recognition patterns of aptamers TD05 and TE13 with different leukemia cell lines..... 58

3-2. Identified proteins and their IPI values based on European Protein Data Bank using
MASCOT database search. ........................... .......71

3-3. Binding patterns of aptamer TD05 and anti-IGHM with different cell lines ................... 74

5-1. Sequences of DTS reactions .............. .................... 100

6-1. Different types of chemical modifications, for stabilization of aptamers and for
enhancing pharmacokinetics, immobilization and labeling ..........._... .......__....... 113










LIST OF FIGURES


Figure page

1-1 Thrombin aptamer and thrombin protein interaction. ...................... ............. 19

1-2 The SELEX process.. .................................. 20

1-3 The CE-SELEX process ................. ................. 23.............

1-4 The cell-SELEX aptamer selection process developed by the Tan group. ................... .... 27

1-5 Enrichment of the pool with the desired sequences for target cells. .............. ............. 27

1-6 Extended Jabonski diagram.. ............ ..................... 33

1-7 Reactions of singlet oxygen with biomolecules ................. ................. 34......... ..

2-1 Home made CE set-up used in SELEX experiments.. ..................... ............. 41

2-2 PCR Optimization.. .................................. 44

2-3 Electropherogram of 2mM DNA library ................. .......... ......................... 45

2-4 Electropherograms of the unbound DNA observed during SELEX rounds 2, 4, 6, and
8............... ................... 47

2-5 Affinity of enriched DNA pool from 8th round ................. ................. 48......... .

2-6 Affinity of starting DNA pool ................. ................. 48............

2-7 Sequences obtained from high throughput sequencing of pool of round 9. .................. .... 50

2-8 Affinity of 32P labeled aptamer PB 9 to PKCS.................. ................. 52..........

2-9 Affinity of TMR labeled PB-9 to PKCG.. ............ ..................... 53

2-10 Specificity of aptamer PB9 towards PKCS ................ ................. 54......... ..

3-1 Protocol for the identification of IGHM protein on Ramos cells. ................ ................ 59

3-2 Partial digestion of exracellular membrane proteins using trypsin and proteinase K
(indicated by scissors). ........._.__...... ._ __ ..............60....

3-3 Binding of aptamer TD05 with Ramos cells after treatment with proteinase K at
different time intervals. .......................... .......61

3-4 Modified aptamer with photoactive 5-dUI, linked to biotin via a disulfide bond............. 68











3-5 Binding of modified aptamer with 5-dUI and biotin linker with Ramos cells.............._._ 69

3-6 Phospho images for 10% tris-bis PAGE analysis of the captured complex.. .........._....... 70

3-7 Phospho images for control TEO2 Sequence .............. .................... 71

3-8 Aptamer TD05-FITC and Alexa Flour 488 -anti-IGHM binding analysis with
Ramos, CCRF-CEM and Toledo cells............... .................72

3-9 Aptamer TD05-FITC and anti-IGHM antibody binding with surface IgM positive
CA46 ........... ......__ ............. 73....

3-10 Competition of aptamer TD05-FITC and anti-IGHM antibody for the target protein...... 75

3-11 Binding of Alexa fluor 488 labeled anti-IGHM antibody and TMR labeled TD05
aptamer with Ramos cells .............. ....................75

3-12 Flow cytometric results for the anti-IGHM binding with Ramos cells after Trypsin
di gestion. .............. .................... 76

4-1 Chemical structures of photosensitizers ................. ................. 82......... ...

4-2 Aptamer TD05-FITC binding to different leukemia cells.. ............ ..................... 86

4-3 Reaction of chlorin e6 with an amine modified TD05 aptamer probe..........._...._ ............ 87

4-4 UV-Vis absorption of Ce6 conjugated with DNA. ...................... ............. 88

4-5 Singlet oxygen generation ability of free Ce6 dye and Ce6 conjugated to aptamer
TD 05. ............. .................... 89

4-6 Binding of aptamer TD05-Ce6 conjugate.. .......................... .......90

4-7 Fluorescence confocal images.. ............ ..................... 91

4-8 Cell toxicity of aptamer TD05-Ce6 treated cells.. ............ ..................... 92

4-9 Cell viability observed for CEM and Ramos cells with no irradiation of light. .............. 93

4-10 Observed cell viability for HL-60, NB-4, K562, CEM and Ramos cells with Ce6
attached to a random DNA sequence. ................................... 94

5-1 DNA Template based Functional Group Transfer Reactions.. ............ ..................... 96

5-2 Aptamer-based DTGTR as a tool for drug release............... ................ 98

5-3 Mechanism of fluorescence restoration of the hypothetical pro-drug upon reduction
of di sulfide linker ................. ................. 101........ ....










5-4 Verification of de-quenching effect upon reduction of disulfide link. ................... ......... 102

5-5 Restored fluorescence upon addition of PB-C3 -DTT to PBF SSD .. .............. .............. 103

5-6 Aptamer -platform and hypothetical prodrug. ................. ...._._ ........___........ 0

5-7 Binding of Sgc8tem with CEM cells.. ............ ..................... 106

5-8 Flow cytometric results for DTT treated PBFSSD on CCRF-CEM cells....................... 106

5-9 Reduction abilities of free DTT and DTT attached to DNA aptamer template. ............ 107

5-10 Disulfide bond reduction of PBF SSD using DTT bound to aptamer platform and free
DTT ................. ................. 108........ .....

5-11 Specificity of disulfide bond reduction by DTT attached to Sgc8-tem-c3DTT ............ 108

6-1 Structure of 5-iodo deoxy uridine. (*) position refers to the 13C On the base. ................ 116

6-2 The proposed method for determination of aptamer binding site on IGHM. ................. 1 17

A-1 Typical flow cytometer setup............... ................. 118

A-2 Histogram obtained from the flow cytometer ................. .......__ ....__ ........ 120

A-3 Histogram obtained to find out the binding of fluorescence tagged aptamer probe.. ..... 120

A-4 Fluorescence tagged aptamer binding with different cells. ............ ..................... 121









Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

IN Y7TRO SELECTION AND DEVELOPMENT OF APTAMERS FOR BIOMARKER
DISCOVERY AND TARGETED THERAPY

By

Prabodhika R. Mallikaratchy

May 2008

Chair: Weihong Tan
Major: Chemistry

Increasing emphasis on molecular level understanding of cellular processes has allowed

certain diseases to be redefined in terms of underlying molecular level abnormalities rather than

pathological differences. In an attempt to understand some of these molecular level

characteristics, this research was undertaken to utilize aptamers as molecular probes in cancer

studies. Aptamers are short DNA/RNA strands that show a preferential binding with variety of

molecules, and are generated by a process called Systematic Evolution of Ligands by

Exponential enrichment (SELEX).

First, in an attempt to develop sensitive probes for intracellular proteins, DNA aptamers

were selected utilizing Capillary Electrophoresis based SELEX (CE-SELEX) targeting Protein

Kinase C delta (PKCS). PKCS is an important signal transduction protein that plays a significant

role in tumor initiation. The selected aptamer was later labeled with a fluorophore and

developed into a fluorescent probe for protein detection studies.

Second, a novel strategy to identify over-expressed proteins on the cell membranes

utilizing aptamers has been implemented. Here, an aptamer selected using Cell based SELEX

(Cell-SELEX) has been utilized as a tool for biomarker identification. The aptamer TD05

selected against a Burkitt' s lymphoma (BL) cell line was chemically modified to covalently










crosslink with its target and to capture and to enrich the target receptors using streptavidin coated

magnetic beads. The separated target protein was identified using mass spectrometry. Using this

method, we were able to identify membrane bound Immunoglobin Heavy mu chain (IGHM)

which is an established marker protein as the target for aptamer TD05. This study demonstrates

aptamers selected against whole cells can be effectively utilized to identify cancer related marker

proteins.

Third, since the identified biomarker is expressed only on the target BL cells, this

selectivity was exploited to demonstrate that the aptamer can be used as a drug carrier. Aptamer-

photosensitizer conjugates were engineered to effectively target cancer cells that express

identified biomarker. Introduction of the aptamer-photosensitizer conjugates followed by

irradiation with light has selectively destroyed target cancer cells utilizing induced singlet

oxygen.

Finally, to avoid undesirable side effects associated with photosensitizers, as a proof-of-

concept a FRET principle based "prodrug" and an aptamer based drug delivery platform were

engineered. The engineered hypothetical "prodrug" was effectively activated upon reaching

aptamer platform aided by DNA Template based functional Group Transfer Reactions (DTGTR).

The developed strategy further demonstrates that aptamers can be used as drug delivery

platforms.









CHAPTER 1
INTRODUCTION

Fundamental understanding of biological processes has been greatly influenced by the

completion of the human genome project. Today, the National Center for Biotechnology

database consists of completed genome data for more than 800 different organisms.l This vast

pool of information has resulted in a revolution in the biological sciences. Increasing emphasis

on molecular level understanding of bio-organisms has allowed certain diseases to be re-defined

in terms of underlying molecular level abnormalities rather than pathological differences.

In an attempt to understand some of these molecular level characteristics, this research

was undertaken to utilize aptamers as probes to target tumor-promoting proteins and to

investigate the feasibility of developing aptamers into fluorescent probes. We have focused on

the identification of biomarker proteins utilizing aptamers evolved from cell-SELEX

methodology and have been able to demonstrate that the identified biomarker protein can be

applied in therapeutic applications.

In order to set the foundation for these obj ectives, this chapter explores the role of proteins

in diseases, with particular emphasis on cancer, and how understanding these roles can lead the

development of diagnostic and therapeutic approaches and can stimulate further basic research.

Role of Proteins in Cancer

Cancer ranks as the second maj or cause of death in the United States. 2 The origin of

cancer cannot be correlated to a single genetic or proteomic alteration. Since all living cells rely

on proteins for their survival and growth, slight modifications of proteins can result in different

cellular mechanisms. The alteration of proteins can be in their levels of expression,3 Of in

changes to post-translational modifications (glycosylation, phenylation, formylation, acetylation)

4 Or by mutations at the genetic level.5 Such changes can induce uncontrolled cell growth









leading to cancer, particularly, when receptor proteins are involved. Therefore, detection of

alterations of cell receptor protein expression levels and evaluation of their involvement in

cancer initiation is important. Furthermore, these discoveries can lead to the invention of novel

diagnostic approaches and targeted therapy strategies.

Most of the key proteins discovered so far are associated with membrane receptors. For

example, overexpression of the number of a serum marker proteins, such as ot-fetoprotein, 6

carcino-embryonic antigen (CEA) for colon cancer' and prostate specific antigen (PSA) for

prostate cancers are well established markers strongly related to tumor initiation and growth.

Also, several growth factor proteins, such as epidermal growth factor receptor 2 (EGFR2),9

vascular enhanced growth factors (VEGF),1o platelet-derived growth factor (PDGF)"1 and

insulin-like growth factors (IGF)12 are classic tumor related proteins that play key roles in tumor

initiation. Overexpression of these proteins is most likely due to activation and/or mutations of

the encoding gene.13 For example, the EGFR2 gene encoding the EGFR2 receptor protein is

activated in various cancers.14 These receptors are responsible for cell-cell or cell-stromal

communication through signal transduction with intracellular growth factors or ligands. This

signaling activates the transcription of various genes through phosphorylation or

dephosphorylation, and ultimately the induced signaling cascade triggers enhanced cell growth.

According to a reported clinical study, it has been shown that approximately 85% of breast

cancer patients have significantly elevated levels of EGFR2 protein and this elevation is strongly

correlated with disease recurrence, metastasis or shortened survival.15-3 These studies have all

shown that the identification of molecular basis of diseases can lead to a more in-depth

understanding of cancer. Molecular profiling in diseased cells using various probes is important









in this process, and should eventually lead to the identification of new biomarkers that can help

in early diagnosis.

Molecular Probing of Cancer for Biomarker Discovery

Transcription Profiling Based Molecular Marker identification

The approach termed "molecular profiling" is the investigation of abnormalities of many

genes or proteins on a common platform.35 The identified unique molecular signatures are

correlated with tumors to identify subsets of patients and to tailor treatment regimes to achieve

more personalized medical therapies. Detection of these molecular signatures can also lead to

methodologies for early detection of cancer.

Currently, molecular profiling studies rely largely on the analysis of genetic mutations

using DNA micro-arrays.36 For example, a recent genetic analysis of diffuse B- cell large

lymphoma (DBCL) using DNA micro-array techniques enabled the re-classification of two

molecularly distinct forms of DBCL with different proliferation rates, host responses, and tumor

differentiation rates.37 The results showed that the two subsets have significantly different

survival rates, demonstrating that, even within a common category of lymphoma, there are

subsets that can be further divided into subcategories. There are also many studies currently

being reported using DNA micro-arrays to identify different disease subcategories based on

genetic level differences. 35

Although DNA/RNA arrays are effective in analyzing millions of genes in a common

platform, a disadvantage of DNA/RNA array analysis is sample preparation, because RNA is

extremely labile and easily degradable. 38 The lack of stability of mRNA can also be responsible

for false negative results, especially if unknown subpopulations of cells do not express high

levels of mRNA. This low expression level can be lost by contamination from higher abundance

mRNAs .39 In addition, mRNA expression may not necessarily correlate with protein expression









patterns in a given cell. The information generated from array-based methods may not reflect the

related protein expression levels in cancer, because proteins can also be mutated and /or altered

in post-translational processing stages that can initiate the cancer formation.40 In addition to

micro-array based methods, genetic analysis using a polymerase chain reaction (PCR) based

method is considered to be more sensitive. However, amplification of gene products has been

reported to have variable sensitivities, which can lead to false positive or false negative results.41

Protein Profiling Based Molecular Marker Identification

Instead of detecting the mRNA corresponding to a given protein, the protein itself can be

identified by various methods. Currently, the maj or method of disease related protein

identification utilizes mass spectrometry (MS), including both electrospray ionization (ESI)42

and matrix-assisted laser desorption ionization (MALDI).43 In addition, a number of novel

techniques have been developed. For example, surface-enhanced laser desorption time of flight

MS (SELDI-MS),44 prOximity ligation,45 cell-based bioactivity analysis, and immunological

assays such as enzyme linked immunoabsorbant assays (ELISA)46 have been used to identify

biological molecules. However, due to the poor limits of detection, and sensitivities as well as

sample loss during the tedious sample preparation, the identification of biologically important

molecules in disease origination has been hindered. Therefore, currently the focus is on more

systematic approaches to identify biomarker proteins related to disease origination.

One way of addressing this issue is the generation of molecular probes that specifically

recognize different expression patterns of proteins on the cancer cell membrane. In this regard,

aptamers show potential in identifying such molecular differences. Since aptamers can be

selected without having to introduce a specific epitope, use of these molecules can help the

identification of the molecular targets that are overexpressed in specific cells. The new









information generated by aptamer-based molecular analysis has led to re-exploration of diseases

based on underlying molecular abnormalities.

Aptamers

Aptamers are small oligonucleotides that specifically bind to a wide range of target

molecules, such as drugs, proteins, or other inorganic or organic molecules, with high affinity

and specificity.47-50 The concept of aptamers is based on the ability of small oligonucleotides

(typically 80-100mers) to fold into unique three-dimensional structures that can interact with a

specific target with high specificity and affinity. Aptamers are made ofRNA,S1 modified

RNA,52 DNA, 53 Or modified DNA54 and some peptide aptamers have also been reported.5

Aptamers have been selected for a variety of targets, including ions,56 Small molecules,5

peptides,5 single proteins,59 Organelles,60 VITUSCS,61 entire cells62 and tissue samples.63 In the

case of more complex samples, such as tissues or cells, the aptamers primarily recognize the

most abundant proteins.

Aptamer-Protein Interactions

Naturally, some proteins are known to interact specifically with DNA and/or RNA. For

example, most of the transcription factors and nuclear proteins are known to interact with

DNA/RNA through non-covalent binding to mediate various cellular events. Binding of these

nucleicc acids of prey" for their associated "protein baits" is relatively weak. Despite the low

affinities, these interactions are specific, selective, and functional.

The interaction of a DNA/RNA aptamer with its target molecules does not necessarily

involve a DNA or RNA recognition capability. In fact, most of the DNA or RNA aptamers have

been selected for common plasma or membrane proteins that do not possess a nucleic acid

recognition capability.64 Interaction of an aptamer with its target molecule is a combination of

non-covalent and electrostatic interactions, and it also depends on the ability of nucleic acids to









fold into a unique three-dimensional secondary structure which can fit into a binding pocket in

the protein. This compact folding of nucleic acids is the key to enhanced "trapping" of the

aptamer in the protein pocket, especially for RNA aptamers, which have an extra hydroxyl group

at the 2' position of the sugar ring. Figure 1-1, shows the anti-thrombin DNA aptamer binding

via electrostatic interactions with thrombin protein. The affinities of these types of interactions

are in the picomolar to sub-nanomolar range.























Figure 1-1. Thrombin aptamer and thrombin protein interaction. Ribbon diagram of thrombin
protein interacting with thrombin aptamer predicted by x-ray Crystallography.
Aptamer binds with thrombin via a strong electrostatic interaction. Reprinted by
permission from Journal of2\~olecular Biology.65

Systematic Evolution of Ligands by EXponential enrichment (SELEX)

The process by which aptamers are selected is called Systematic Evolution of Ligands by

EXponential enrichment (SELEX), which was introduced by two independent laboratories in

1990.66, 67 Typically, the SELEX process is a combination of in vitro evolution and

combinatorial chemistry.










Protein ta rget of interest


Library


cj~ CCI Incubate with specific

r0 protein target


Separation of bound sequences
from unbound sequences


PCR Amplification


Figure 1-2. The SELEX process. The library containing DNA or RNA molecules is incubated
with the protein target of interest. The DNA/RNA bound to the target is separated
from the unbound sequences. Separated high affinity sequences are amplified by
Polymerase Chain Reaction (PCR), and this process is repeated until the library is
enriched with the potential aptamer sequences.

The first step involves the chemical synthesis of a DNA library with completely random base

sequences flanked by pre-defined primer binding sites. The initial library of the SELEX process

is incredibly complex with at least 1015 different DNA molecules. The immense complexity of

the generated pool justifies the hypothesis that the library will contain a few molecules with

unique three-dimensional structural characteristics to facilitate specific interactions with the

target molecule. As exemplified in Figure 1-2, a typical selection process involves successive

incubation and separation of high affinity binders, followed by PCR amplification. Finally, the

evolved DNA library is cloned and sequenced to obtain the potential aptamers. However, the

high complexity of the library leads to difficulties in the separation of the few desired sequences









from the rest of the library. Thus, a well controlled and effective partitioning process is the key

step in increasing the efficiency of aptamer selection.

Separation Methods in SELEX

Conventional SELEX Separation Techniques

Nitrocellulose filters and affinity chromatography are established methods for separating

protein bound sequences 68, 69 In nitrocellulose filtration, the DNA or RNA library is incubated

with the protein target and filtered through a nitrocellulose film. Since nitrocellulose is sticky

only to the protein molecules, the protein-nucleic acid complex is retained on the film, while the

free nucleic acids are removed. Denaturing reagent is introduced to dissociate the bound nucleic

acid sequences from the complex prior to the PCR amplification step. While the nitrocellulose

filter binding method is most common, several studies have demonstrated that the unbound

DNA/RNA sequences interact nonspecifically with the nitrocellulose membrane and interfere

with the separation efficiency of the selection process.70 This non-specific interaction of DNA

with the membrane often results in the enrichment of sequences that have a high affinity towards

the membrane instead of the proteins, resulting in a high background with false positive

sequences. The problem can be partially counteracted by introducing a high-salt washing to

remove the non-specifically bound sequences.

In using affinity columns, the target protein is immobilized on a solid support. The

SELEX library is passed through the column, and the sequences with high affinity towards the

target protein are retained. The bound sequences are subsequently removed and used for PCR

amplification. A maj or limitation of affinity columns is the need to immobilize the protein

target, thereby hindering access its potential binding pocket. Thus, use of both nitrocellulose

filters and affinity columns can limit the selection of aptamers. For this reason, there has









recently been increased effort to introduce cost-effective, simple, and efficient techniques for the

separation of aptamer sequences from the library.

Novel SELEX Separation Strategies

Target-immobilized magnetic beads" and capillary electrophoresis (CE)72-75, are newer

methods for SELEX separations. The magnetic bead method is rapid and easy, and it requires a

relatively low sample volume, but it suffers from the same flaws as affinity columns; i.e.

potential loss of the binding site due to immobilization of the target on to the magnetic beads.

Non-specific interactions of magnetic beads with the DNA library can also hinder the selection

efficiency.

Capillary electrophoresis offers several advantages for SELEX separations. This method

provides high separation efficiency, and the selection occurs in free solution so there is little non-

specific binding observed. A schematic of the method is shown in the Figure 1-3. DNA library

containing protein-bound and unbound sequences is injected into the capillary and a high electric

filed is applied. Because of their relatively small sizes the unbound sequences migrate rapidly

and leave the capillary first. The bound sequences migrate more slowly and are collected as they

elute. Subsequently, the high affinity sequences are further amplified using PCR. The process is

repeated until the library is enriched with aptamer candidates.

Aptamer Signaling as Molecular Probes in Cancer Protein Analysis

Specific signaling aptamers, which combine binding specificity and signal transduction

capability, are promising probes for real-time detection of nucleic acids and proteins both in vivo

and in vitro. Recent studies from our group have shown that signaling aptamers can recognize

Platelet-Derived Growth Factor (PDGF) and thrombin in a complex biological mixture.76-7

However, one of the maj or limitations in using aptamers in vivo is their susceptibility towards

nuclease degradation.









With the advancement of fluorescent based techniques, many research groups have focused

on developing signaling aptamers (aptamer beacons) that may have potential as in vitro

diagnostic tools.79


.r .RR. CE separation u


Library of randorn
DNA sequences







PCR amplification *
;b:scie Bound sequences




Unbound sequences
eluted off the capillary


Figure 1-3. The CE-SELEX process. After incubation with the protein target the library is
inj ected into the capillary. Upon application of the electric field, free DNA sequences
migrate faster (peak highlighted in blue) than the DNA sequences bound to the
protein target (peak highlighted in red). The separated bound DNA sequences are
amplified and proceed to subsequent rounds of selection.

Signaling aptamers are types of molecular beacons, in which an aptamer is incorporated into

fluorescence based signaling mechanisms. As a result, selection methods that incorporate

Fluorescence Resonance Energy Transfer (FRET) based mechanismsso have been introduced

usually as a FRET pair, into the starting library. However, one of the challenges in using

fluorescence based signaling aptamers as a diagnostic tool is the high background signal of the

biological fluids. One report addressed this problem by engineering a structure switching

excimer aptamer probe targeting Platelet Derived Growth Factor.81 This excimer aptamer probe










represents the first study demonstrating the potential uses of aptamers as in vitro diagnostic

probes for cancer markers.

Despite the demonstrated success in selecting aptamers against single proteins, the

application in real systems is still a challenge, because the aptamers are selected in artificial

buffer systems where only the target protein is present. Non-specific interactions with nuclear

proteins commonly present in real biological samples are known to interfere with the specific

recognition. 82' 83 Another limitation is the rapid nuclease degradation. In order to prevent

nuclease degradation, several reports have successfully used modified aptamers, with -OCH3, -

NH2, -F substituents at the 2' position of the sugar ring. 82, 83 Also, use of locked nucleic acids

have shown an increase in nuclease resistance82' 83

Multiple Aptamer Probes Targeting Whole Living Cells

For cancer diagnosis and study, there has been increasing interest in identifying aptamers

for more complex targets such as cells. Use of living cells as the targets for aptamer selection

will enable the generation of a panel of aptamers capable of binding to native cell membrane

proteins. The use of whole cells as targets to select aptamers offers several advantages:84, 85

A panel of aptamers can be selected to target multiple proteins for the cancer study. This
can be achieved without prior knowledge of up/down regulated genes related to the
proteins.

Aptamers selected against whole cells can lead to the discovery of novel biomarkers
even when the expression of distinct protein candidates is not known in advance.

By chemical modification of aptamers, the aptamers can be converted into specific
transporters of drugs in therapeutic approaches.

Aptamers selected against whole cells can be used as in vivo imaging agents.

Use of subtractive SELEX strategy can reveal protein expression profiles, which can
effectively distinguish the transformed cells from healthy cells at a molecular level.

Finally, the aptamers are selected against the native state of the proteins in the cellular
environment.









For the above mentioned reasons, cell-based aptamer selection is a promising scheme for the

creation of molecular probes for proofing and imaging of cancer.

The first example of cell-based aptamer selection was a whole cell selection for anti-

Prostate Specific Membrane Antigen aptamer (PSMA).86 PSMA is a tumor marker for prostate

cancer, and its expression is primarily prostate specific. In this study, Lupold et al.86 Selected

RNA aptamers for targeting the extra-cellular domain of the PSMA fusion protein. To increase

the nuclease stability of the aptamers in the serum, 2'-fluoropyrimidines were incorporated. The

resulting aptamer was able to recognize PSMA expressed by prostate cancer cells, and

demonstrated the feasibility of specifically selecting aptamers for known protein targets on a

cellular membrane.

Following this approach, the selection of an aptamer targeting U251 glioblastoma cells was

reported."' Glioblastoma is one of the most common brain malignancies. The aggressive nature

of the glioblastoma cells is considered to originate from hyper-vascularity, focal necrosis, and

rapid cellular proliferation. Out of the aptamers selected, authors reported that the target of the

aptamer GBI-10 was tenascin-C, an integral membrane protein considered to be a stromal marker

for epithelial malignancy.

Two other studies reported the selection of aptamers with functional capability towards cell

targets. Guo et al. demonstrated the feasibility of the selection of aptamers that promote cell

adhesion using osteoblasts from human osteosarcoma cells.88 The author selected aptamers to

act as osteoblast capturing probes in order to create artificial tissue engineering platforms.

Another intriguing study showed aptamer selection against mutated human Receptor Tyrosine

Kinase-REarranged during Transfection (RTK-RET) using RET-expressing cells as targets.89

This work led to the selection of an aptamer that can recognize the extra-cellular domain of the









RET receptor. One of the identified aptamers was shown to inhibit the dimerization of the RET

receptor and blocked the downstream RET-dependent intracellular signaling pathways,

demonstrating that the selected aptamers could be used as potential therapeutic agents for the

RET receptor.

Whole Cell-SELEX Strategy

The selection strategies described above have all been designed to target a protein

previously known to be present in the cell membrane. However, a recent study from our group

demonstrated a universal strategy to select a panel of aptamers for whole cellular targets.84, 85

The newly developed cell-based aptamer selection method, called cell-SELEX, is illustrated in

Figure 1-4.

Using this approach, several aptamers were selected targeting a cultured leukemia cell line:

a CCRF-CEM, which is a cultured precursor T cell acute lymphoblastic leukemia (ALL) cell

line, and a B-cell line from the human Burkitt' s lymphoma Ramos cell line as the control.

Introduction a counter selection strategy excluded the selection of the most popular receptors on

all cell membrane surfaces, and minimized non-specific membrane interactions. The cell-

SELEX method generates highly specific molecular probes able to recognize one type of cancer

cell line.

In cell-SELEX, the initial library is incubated with the target cell line. Following

incubation, the cells are washed to remove unbound DNA, and the bound sequences are

dissociated by heating. The resulting sequences are incubated with a counter cell line to ensure

the subtraction of common binders. Introduction of the counter selection step eliminates the

possibility of selecting aptamers for common membrane proteins and enhances the probability of

recognizing protein candidates exclusively expressed in the cell line. The supernatant now

enriched with sequences that do not bind to the control cells, is collected and PCR amplified.





















Remo e
unIoriDN


unaouria DNA


Remove
liousld DNiA


Counisr
sele'TIon


Figure 1-4. The cell-SELEX aptamer selection process developed by the Tan group. A ssDNA
pool is incubated with target cells. After washing, the bound DNAs are eluted by
heating to 950C. The eluted DNAs are then incubated with negative cells for counter-
selection. After centrifugation, the supernatant is collected and the selected DNA is
amplified by PCR. The PCR products are separated into ssDNA for the next round of
selection. Finally the enriched library with aptamer sequences is cloned and
sequenced to obtain aptamer candidates. s


Target Cells


Control Cells


Un sFeletr ed Llb
3d Pool
6th Pool
- 16tlapool


Unse~lected Llb
-3rd pool
6th~ pool
-16th pool


Fluorescence intensity


Fluorscnce intensity


Figure 1-5. Enrichment of the pool with the desired sequences for target cells. (a) The green
curve represents the background binding of the starting DNA library. An increase in
fluorescence intensity with the number of cycles is indicative of enrichment of the
affinity towards the target cells. (b) Little change is observed for the control cells.8
(For information on flow cytometry, see Appendix A)


arget cells









The progress of the selection is monitored by flow cytometry using fluorescence-labeled DNA

libraries and aptamer probes, as shown Figure 1-5. This process is continued for about 20

rounds, and the resulting enriched library is cloned and sequenced. The sequences are collected

and aptamers are identified.

Table 1-1. Screening of aptamers selected using Cell-SELEX. Each aptamer was screened with
different types of leukemia cells to identify common receptor profiles. 85,90
Cell line Aptamer Aptamer Aptamer Aptamer Aptamer
Sgc8a Sgc3b Sgc4" Sgd2d Sgd3e
Cultured Molt-4 (T cell-ALL) ++++ +++ ++++ ++++ ++++
cell lines
Sup-T1 (T cell-ALL) ++++ + ++++ ++++ ++
Jurkat (T cell-ALL) ++++ +++ ++++ ++++ ++++
SUP-Bl15 (B cell-ALL) + 0 ++ + 0
U266 (B-cell myeloma) 0 0 0 0 0
Toledo (B-cell 0 0 ++++ ++++ +
lymphoma)
Mo2058 (B-cell 0 ++ ++ 0 +
lymphoma)
NB-4 (AML, APL) 0 0 +++ ++++ 0
Cells from
patients TALL ++ +++ +++ +++ +++
Large B-cell lymphoma 0 0 0 0 0
See appendix A for an explanation of used for binding tendency (i.e. ++++, +++, etc...) AML:
acute myeloid leukemia; ALL: acute lymphoblastic leukemia, APL: acute promyelocytic
leukemia. a-e: Aptamers Sgc8, Sgc3, Sgc4, Sgd2, sgd3 selected against T-cell acute lymphoma
cell line: CCRF-CEM respectively (see reference 85 and 90). For more information on flow
cytometer analysis see Appendix A.

The aptamers selected in the previous study84, 85 were also tested to determine their

feasibility as molecular probes for recognition and targeting. Since one aptamer interacts with

protein targets on the cell membrane, the probes were tested with different leukemia cell lines to

investigate common protein profiles as shown in Table 1-1.90 Several of the aptamers selected

against the T-cell leukemia cell line also showed binding with other categories of leukemia cells.

For example, aptamer Sgc3 primarily recognizes T cell acute lymphoblastic leukemia cells,

while aptamer Sgc8 recognizes both B-cells and T cell acute lymphoblastic leukemia cells. The









results summarized in Table 1-1 indicate that a panel of aptamers specific for each cell type is

useful in revealing over- or under-expressed specific protein signatures, thus eliminating the

need for detailed knowledge of distinct expression patterns of membrane proteins prior to

selection.

Applications of Aptamers in Cancer

Biomarker identification has enabled the development of therapeutic applications that can

precisely target elevated levels of proteins or genes. Such approaches anticipate that targeted

imaging of elevated levels of cellular molecules may be used as a tool in diagnosis and or

therapy.

Currently, a number of techniques have been used to image tumors. For example, one

study exploited the increased glycolysis in cancer by observing the increased uptake of IF-

labeled fluorodeoxyglucose by positron emission tomography (PET).91 In addition to PET, there

are many other imaging techniques available, such as magnetic resonance imaging (MRI),92

computed tomography (CT),93 ultrasound methods and optical technologies.94 These methods

for whole-body imaging provide primarily anatomical information or functional information at a

macroscopic level. Recent research has focused on cellular-level recognition using specific binding

by molecular probes, which can produce or alter signals that are detected by imaging devices such as

PET. However, a major limitation is inadequate availability of tumor specific imaging probes.

This lack results in low sensitivity and reduced specificity, as well as poor spatial localization in

clinical applications of molecular imaging. In this regard, aptamers can be effective candidates for

new probes for both biomarker identification and therapeutic targeting of tumor cells.90 95-99 For

example, labeling oligonucleotides with gamma or P-positron emitters for in vivo imaging has

been already demonstrated. 100, 101 In particular, the labeling of a phosphodiester oligonucleotide

with IsF showed potential for in vivo imaging in a primate PET study.100, 101









Use of aptamers as molecular imaging probes in combination with PET will greatly

increase the specificity of current imaging techniques. A recent study demonstrated that an

aptamer specifically selected against tenascin-C (aptamer TTAl) and modified with 99mTc could

be used as an imaging probe to specifically recognize tenascin abundant cell surfaceS.102

Aptamer TTAl was chemically modified with 2'-F-pyrimidines and 2'-OMe-purines to increase

the nuclease resistance in vivo. It has been modified with a 3'-3' linkage to increase the stability,

and the 5' end was modified with diethylenetriaminepentaacetic acid (DTPA) via a polyethylene

glycol (PEG) linker. The DTPA chealates with 99mTc for imaging aptamer localization. This

study demonstrated the potential applicability of aptamers in xenografted human tumor imaging.

Results from our laboratory have also demonstrated the wide-range of feasibility of aptamer-

based cell profiling and imaging using a cocktail of labeled aptamer probes to target specific cell

types.848

Aptamers can also be chemically modified for drug delivery. Recently, two studies were

published describing aptamer conjugated to a chemotherapeutic drug doxyrubicin95 and a toxin.96

Because most of the chemotherapeutic agents are DNA intercalating reagents, DNA/RNA

aptamers themselves can carry packed chemotherapeutic agents, but toxins must be conjugated

to the aptamer. For example, anti PSMA (Prostate Specific Membrane Antigen) aptamers were

conjugated to recombinant gelonin an N-glycosidase protein. Gelonin causes cell death by

cleaving a specific glycosidic bond in rRNA, thus disrupting protein synthesis. The aptamer-

toxin conjugates showed IC50 (Inhibition Concentration) of 27nM for cells which express

PSMA compared to non-PSMA expressing cells.

Also, two independent studies have demonstrated the feasibility of using aptamers for gene

therapy using SiRNA.97,103 Since the aptamers can readily be chemically modified to conjugate









biomolecules with different functionalities, aptamer-SiRNA complexes were designed for release

after internalization into the endosome.

Aptamers and Antibodies

The interaction of an antibody with its epitope is analogous to binding of an aptamer with

its target. Even though antibodies have been known for more than three decades, aptamers show

inherent advantages that merit their application in biomedical and analytical sciences, as well as

in basic molecular biology.104 Unlike antibodies, which need tedious procedures involving

animals for production, generations of aptamers can be prepared by a simple automated chemical

reaction. Since aptamers are short DNA/RNA strands, they have much longer shelf lives than

antibodies. Aptamers are stable and chemically robust, and are able to regain activity after

exposure to heat and denaturants. Also, the selection process can be manipulated to obtain

aptamers with desired properties for binding to specific regions of the target proteins. In

biomedical applications, use of antibodies is limited by their large size and their inability to

penetrate large solid tumors.'os However, aptamers are smaller in size, and they show higher

penetration and higher clearance rates compared to antibodies. Affinities of aptamers are

comparable with antibodies, with KD ranging typically from 0.3 to 500nM. 53' 106-110

Photodynamic Therapy

While use of SiRNA and other chemotherapeutic agents are successful in treating cancer,

these drugs must be co-localized in a specific cellular compartment in order to produce their

therapeutic effects.ll Photodynamic therapy (PDT) is an alternative method which cleverly

exploits the ability of a photosensitizer (PS) to be excited into the excited state by UV, visible, or

near infra-red light (h = 200nm-700nm). The excited PS reacts with dioxygen in the surrounding

tissue to produce singlet oxygen which subsequently reacts with unsaturated double bonds to

disrupt cell membranes and protein structure. The lifetimes of singlet oxygen in biological









systems is typically around 0.04 microseconds, and, as a consequence, the radius of action of

photo damage is considered to be 0.02 micrometers.112 Thus, PDTs with predetermined

localizations are considered to be among the most effective treatment modalities for cancer. This

technique was introduced in the 1890's by Finsen who treated the skin condition lupus vulgaris

using a heat -filtered light from a carbon arc lamp.113 The Nobel Prize was awarded to Finsen in

1903 for his investigations of the use of light to cure diseased cells.

Mechanisms of Photosensitizing Action

The PDT process is summarized in the extended Jablonski diagram shown in Figure 1-6.

When the porphyrin moiety of PS absorbs light of the correct wavelength, it is excited to the first

excited singlet state, S1. The S1 state can return to the ground state by fluorescence or

radiationless decay, or it can undergo intersystem crossing to a triplet state, T1, which is longer

lived and chemically more reactive than S1. For this reason, most of the biological reactions are

mediated by PS in the triplet state, which can interact with the triplet ground state of 02 to

generate the excited singlet state of oxygen and return PS to its ground state. This excited

oxygen can induce photo-oxidative reactions with various biomolecules.

Biological Damage of Singlet Oxygen

The generated singlet oxygen can react with unsaturated lipids and amino acid residues

(Figure 1-7).114 Since unsaturated lipids and proteins are commonly present in biological

membranes, the maj or cause of cell death is damage to the cell membrane. This leads to vascular

shutdown and necrosis. Photo damage to the membrane activates the immune system, which is

triggered to recognize, track down and destroy the remaining tumor cells.

Current Delivery Systems in Photodynamic Treatment.

Efficiency of PDT is determined by successful localization of the PS in diseased tissue.

Unlike other chemotherapeutic or toxin agents, the PS does not need to be released from the









delivery agent. As long as the delivery agent shows preferential selectivity for the target tissue,

the improved photo-destruction will take place.


^"200kJ S r 0-






Energy Ab~sorptionFloecneSgetxyn
Of S, 94kJ
State


Chemical reactions (type II)






So -- T Ground state dioxygen

Figure 1-6. Extended Jabonski diagram. The generation of excited porphyrin states and reactive
dioxygen species is illustrated. State energies: blue porphyrin sensitizer, green
dioxygen. Upon irradiation of light the porphyrin is excited into excited states which
then react with ground state triplet oxygen in the surrounding tissues.

For this reason, an improved delivery system for PSs will preferentially increase the

concentration of the PS at the diseased cells and increase PDT effectiveness. A number of PS

delivery systems have been introduced. Photoimmuno conjugates comprise the most common

approach." The idea is that new antigens specific for diseased cells are present in the tumor

cells, and it is possible to exploit the specific recognition of a monoclonal antibody (MAb) for its

antigen. However, a limitation of this procedure is the need to conjugate the PSs to the antibody.

After the conjugation of molecules to MAbs, the antibodies can lose their affinities toward

their antigens. Besides, due to their large sizes, the tissue penetration efficiency of PS/Mab

conjugates is poor. For this reason, alternative approaches have been introduced. For example,










PSs have been conjugated to serum proteins such as bovine serum albumin (BSA), 116 l0W

density lipoproteins (LDL)11 annexins""s, steroids119 and transferrin.120



unsturated lipid ene addition H







Cholesterol 5-ahydroxyperoxide







Methionine sulfoxide


O o ~CNHR






Tryptophan




N2 102N O

Guanine

Figure 1-7. Reactions of singlet oxygen with biomolecules. Singlet oxygen react with molecules
containing unsaturated bonds and co-amino acid residues, resulting in damage to
membranes and proteins

However, these delivery systems have shown non-specific localization into different sites,

difficulties in conjugation chemistries, and the loss of specificity, and affinity after conjugation,

thus decreasing their targeting ability and effectiveness as delivery agents. Alternatively,

conjugation of a PS with an aptamer may provide a more effective way to deliver the PS to the

target site.










Overview of Dissertation Research

The scope of the research work presented here is to investigate the applicability of

aptamers as probes in cancer studies. First, CE-SELEX methodology was used to select an

aptamer targeting a tumor promoting protein. In a second proj ect, aptamer selected using cell-

SELEX method was used to identify a cancer-cell specific biomarker. The aptamer binds to

biomarker was subsequently used for therapeutic targeting of tumor cells. Finally, a fourth

proj ect demonstrates proof-of-concept of aptamer-based pro-drug design.









CHAPTER 2
SELECTION OF HIGH AFFINITY DNA LIGANDS FOR PROTEIN KINASE C-6

Introduction

Development of fluorescent proteins, such as green fluorescent protein (GFP), that co-

express with a protein of interest has been widely applied and can be considered as the most

successful way to monitor molecular events in real timel21 However, co-expression, in particular

for protein kinase C-delta (PKCS), has been shown to affect its biological function. One way to

address this problem is the development of PKCS specific probes that can track the translocation

of the protein in vivo. Recent studies from our group demonstrated that fluorescently labeled

aptamers can be used as tools to study protein-protein interactions.122 The focus of this chapter

is, therefore, to select DNA aptamers and to develop DNA based fluorescent probes targeting

PKCS .

Protein Kinase C Family of Proteins

Protein Kinase C is a family of serine and threonine kinases that mediate a wide variety of

cellular signaling processes such as cell growth, differentiation, apoptosis and tumor

development.123-125 Also, PKC is known as the maj or receptor for tumor-promoting phorbal

esters in the cell. To date, eleven isoforms of PKCs have been identified. Based on the structural

composition of the regulatory moiety, three major sub families are known: 1) conventional PKCs

with four homologous domains, whose activation depends on calcium and responds to diacyl

glycerol (DAG) or 1 2-O-tetradeconoylphorbal- 13-actate (TPA), 2) novel PKCs activated by

DAG, or TPA, which are calcium independent, and 3) atypical PKCs, whose activation

mechanism does not depend on DAG, TPA, or calcium.126

We are interested in PKC isoform 6 (PKCS), which is ubiquitously distributed in a variety

of cells and belongs to the novel PKC (group 2) sub family. Changes of the cellular processes









observed with/without treatment of cells with TPA are assumed to be mediated by PKCS.

Extensive biochemical studies have established that PKCS is mainly implicated in regulation and

programmed cell death in non-cardiac cell types.127 Furthermore, unlike closely related isoforms

PKCP and PKCs, PKCS slows proliferation, induces cell cycle arrest, and enhances the

differentiation of the various undifferentiated cell lines.128 Also, PKCS activates NFK B (nuclear

factor K B), which is a ubiquitous transcription factor that plays a key role in regulating the

immune and inflammatory responses.129, 130

The interaction of binding and anchoring proteins specific for PKC plays a significant role

in co-localization and interaction with specific substrates.131 The mechanism ofPKCS signaling

is frequently studied by producing stable cell clones that over-express PKCS with a fluorescent

reporter using corresponding expression vectors and/or by using fluorescently labeled protein

specific antibodies.132 Apart from using antibodies, recent work has shown that fluorescence

resonance energy transfer (FRET) based reporters for kinase activities are viable probes for

phosphorylation in live cells. 133 However, several studies indicate that the over-expression is

not always physiologically relevant. For example, several groups reported that over-expressed

PKC iso-enzyme overwhelmed the endogenous enzyme, causing non-specific localization and

substrate phosphorylation in CHO cells,134 Smooth muscle cells,135 NIH 3T3 fibroblast cells,136

human gliloma cells,137 and capillary endothelial cells.138 For these reasons, development of a

new methodology for specific fluorescence labeling of endogenous proteins including PKCs

would be very useful.

In this regard, use of aptamers as reporter molecules to track PKC translocation can be

promising. One way to obtain protein-specific DNA aptamers is by capillary electrophoresis

based systematic evolution of ligands by exponential enrichment (CE-SELEX).72, 73, 75 This









method has shown significant advantages over conventional SELEX techniques. For example,

the first study on CE-SELEX was reported to obtain aptamers with low-nanomolar dissociation

constants in only four rounds of CE-SELEX. 73' 75 In this work, we have used CE-SELEX to

identify DNA sequences which specifically bind to PKCS, with the obj ective of producing

fluorescent probes for in vitro studies.

Materials and Methods

Instrumentation

PCR was performed using a Bio-Rad thermocycler. The CE instrument that was used is a

home-made CE system (see Figure 2-1). Radiation quantification was done using a Bio-Rad

personal phospho-imager. Fluorescence measurements were made on a JOBIN YVON-SPEX

Industries Fluorolog-3 Model FL3-22 spectrofluorometer.

Initial Library Design

The aim of the SELEX experiment was to identify DNA sequences that specifically bind to

PKCS and to develop fluorescent probes targeting PKCG. The SELEX process was initiated by

preparation of an initial library, consisting of a pool of oligonucleotides with a continuous stretch

of 30 randomized nucleotides. The random sequences were flanked on both sides by fixed

sequences used for the hybridization of PCR primers during subsequent rounds of amplification.

SELEX library: 5'-GCCAGGGGTTC CAC TAC GTAGA (N)30 AC CAGGGGGCAGAGAGAAG
GGC-3'
Reverse Primer: 3'-CGGTCCCCAAGGTTGAGCATCA-5'

All oligonucleotides, including PCR primers, were synthesized using standard phosphoramidite

chemistry and purified by denaturing Poly Acrylamide Gel Electrophoresis (PAGE) to remove

truncated DNA fragments produced in the chemical synthesis.









PKCG Expression and Purification

Human recombinant PKCS was a gift from the laboratory of Dr W. Cho, University of

Illinois at Chicago, and was over-expressed from E. Coli stain BL21 (DE3) and purified using Ni

beads .

PCR Optimization

Once the library was synthesized, the next step was PCR optimization of the DNA library.

PCR is one of the maj or steps in the SELEX process, and it is necessary to optimize the

conditions (melting temperature, number of cycles) for PCR to obtain the highest yield without

any nonspecific amplifications. The final optimized conditions for the PCR reaction were: 23 ng

of forward primer, 23 ng of biotin-reverse primer, 0.4 mM each of DNTP and 10 mM Tris-HCI

(pH = 9.2) with 3.5 mM MgCl2, and 75 mM KCl buffer in 50uL reaction volumes. A total of 15

cycles of denaturation (30 s, 95oC), annealing (30 s, 57.5oC), and extension (20 s, 72oC) were

performed followed by final extension for 5 minutes at 72oC.

The PCR products were verified by analyzing aliquots on 2.5% agarose gel stained with

ethidium bromide. In order to obtain a single stranded DNA library of the PCR amplified

product, a second PCR amplification was carried out using 3'-biotin-attached reversed primer.

Amplified DNA was made single stranded using streptavidin sepharose (Amersham Biosciences,

Upsala, Sweden). Double stranded DNA from the PCR reaction was added to the equilibrated

streptavidin column, which was washed with PBS buffer. The dsDNA, which was retained in

the column, was eluted with 200 mM NaOH. The eluted DNA fraction was de-salted using

SephadexTM G-25 DNA grade NAP columns (Amersham Biosciences, Upsala, Sweden).

Recovered DNA was quantified by measuring the absorbance at 254 nm and was used in the

following/subsequent round of selections.









Combinatorial Selection of Aptamer

A 2mM solution of the library was prepared in the binding buffer (10 mM HEPES, 0. 1M

NaC1, ImM DTT, 8.1mM Na2HPO4, 1.1mM KH2PO4, ImM MgCl2) at a pH of 8.05. Before

selection, the 2mM DNA library was denatured at 95oC for 5 minutes and then cooled at 4oC.

Human recombinant PKCS was diluted in the binding buffer and added to the DNA library to

give a final PKCS concentration of 50nM. The mixture was kept at room temperature for 15

minutes to allow complete binding. The CE selections were performed on a home-made CE

system, shown in Figure 2-1. A high-voltage power supply (Gamma High Voltage Research

Inc., Ormond Beach, FL) provided the electric field. DNA was detected using a UV/Vis detector

(CE-Thermo Capillary Electrophoresis, CRYSTAL 110). A 50Clm x 36cm- long (26 cm to

detector), poly(vinyl alcohol)-coated capillary (Agilent Technologies, Palo Alto, CA) was used

for separations. Each day, capillaries were initially flushed with CE separation buffer (8.1mM

Na2HPO4, 1.1mM KH2PO2, ImM MgCl2, 2.7mM KC1, 40mM NaC1, pH 8.08) for 30 minutes.

An initial potential of 12.5kV was applied during separations. However, after the 4th round, the

applied voltage was reduced to 7.5kV to prevent base line interference due to Joule heating. For

CE-SELEX selections, samples were inj ected onto the capillary hydrodynamically (Ah= 5cm,

10s), and absorbance at 254nm was monitored. After non-binding sequences migrated through

the capillary, CE fractions containing high affinity DNA sequences were collected into a sample

vial by applying pressure.

Aptamer Labeling with AT32p

Samples containing oligonucleotide (3.74nmole) and [y-32P] ATP (8.3pmole) were

incubated overnight at room temperature with 50 units of polynucleotide kinase (Promega).

Unincorporated ATP was removed using a G-25 column (Amersham Biosciences).












UV detector +


Bu~ffe resevoir

Figure 2-1. Home made CE set-up used in SELEX experiments. Samples were introduced
hydrodynamically. Protein-DNA complexes were collected by applying pressure to push
the samples out of the capillary.

Electrophoretic Mobility Shift Assay (EMSA)

Binding of aptamers to the human recombinant PKCS was investigated by EMSA. Native

4% polyacrylamide (16cm x 20cm x 1.5mm) gels were prepared using stock solutions of 40%

acrylamide, 2.6% bisacrylamide, 10X TB, pH 8.5 95% glycerol, and 10% ammonium persulfate.

The gels were equilibrated at 4oC and 20mA for 30 minutes prior to sample loading. The

proteins and the DNA were serially diluted in 30% glycerol and binding buffer, respectively.

Aptamers (8nM final concentration) were incubated for 30 minutes with increasing amounts of

PKCS (0-2uM) in 2X binding buffer with 200Clg/uL BSA in a final volume of 25C1L. At the end

of the incubation, samples were loaded while the current was running. Electrophoresis was

continued at 30mA constant current for three hours. A quantitative analysis of the relative

amounts of the radioactivity present in the different bands was obtained from direct counting of

the gel on a Bio-Rad instant phosphor imager system. Despite the enrichment achieved in the 8th


Hig vboltag
power supply









round, we introduced an additional gel retardation step to eliminate the low affinity sequences

from the pool. A separate preparative EMSA assay was performed after the 8th CE-SELEX

round using 8nM of PKCS and 100nM of DNA library from the 8th pOOl. In order to avoid to the

non-specific interactions, the DNA concentration was increased by a factor of 10 by adding

sheared salmon-sperm DNA to the binding buffer. DNA sequences bound to protein were

extracted using the crush and soak method in which the band corresponded to the DNA-Protein

complex was excised from the gel and crushed followed by soaking in the elution buffer to elute

bound DNA. 139 The DNA bound to the protein was recovered by phenol extraction followed by

ethanol precipitation.

Cloning and DNA Sequencing

The resulting pool from the 9th round was PCR amplified, cloned using the TOPO-TA

cloning kit (InVitrogen, Carlsbad, CA), ligated into the TA cloning vector and transformed into

Escherichia coli. White colonies were isolated and sequenced using a 96-well format

MegaBACE 1000 capillary sequencer (GE Healthcare) at the ICBR sequencing facility. The

resulted sequences were analyzed with the program Sequencing Analysis Clustlaw 6.0 software.

Fluorescence Anisotropy Measurements

Fluorescence measurements were performed on a Fluorolog-Tau-3 spectrofluorometer

(Jobin Yvon, Inc., Edison, NJ). All experiments were carried out at room temperature using a

100C1L cuvette.

The fluorescence intensity of the aptamer was monitored by exciting the sample (TAMRA

label) at 555nm and measuring the emission at 585nm. Bandwidths for both the excitation and

the emission monochromators were set at 10nm. Corrections were also made for potential

dilution factors in the titration experiments.









Results and Discussions


The SELEX Process

The need for effective separation methods in SELEX experiments is described in Chapter

1. The SELEX process is a versatile method for identifying nucleic acids that bind to proteins

with affinities and specifieities comparable to antibodies. The aim of the SELEX experiment

described in this chapter is to identify DNA sequences that specifically bind to PKCS, with the

obj ective of developing fluorescent probes. One of the advantages of CE-SELEX is its high

separation efficiency, which reduces the number of selection rounds required to achieve an

enrichment of the library. For example, the first study by Bowser group on CE-SELEX was

reported to obtain aptamers in the sub-nanomolar affinity with only four rounds of selection. 72

After the synthesis of the DNA library, PCR conditions were optimized. As shown in

Figure 2-2, after 15 PCR cycles the amplification was sufficient to proceed with the selection.

The positive control sequence with identical primer sites was also amplified correctly, while the

negative control with no template sequences was not amplified indicating that no primer-dimer

formed or non-specific amplification of contaminant had taken place.

One difference of CE-SELEX compared to conventional SELEX techniques, is the smaller

sample volumes. Usually, the conventional SELEX experiments are performed using a larger

volume of very diverse DNA library, because having a large number of independent sequences

increases the probability of finding high affinity sequences. So, scaling the volume of a DNA

library down to dimensions typical for CE can hinder the selection of the best aptamers. For

example, synthesis of DNA strands composed of 30 random bases produce 1014 to 1015

independent nucleic acid sequences. During the first round of selection, it is necessary to

introduce all independent sequences to capture the best aptamer. In CE-SELEX, the introduction

of large number of DNA sequences can be done in two ways:

























Figure 2-2. PCR Optimization. Lane 1: 25bp ladder, Lane 2: negative control (without template
sequence), Lane 3: positive control ( DNA template with identical primer sites) Lane 4:
amplified DNA library. The positive control and the DNA library were amplified in 15
PCR cycles. The negative control does not show any bands, indicating that no primer-
dimer formation or non-specific amplification had taken place. The Einal optimized
conditions for the PCR reaction were: 23 ng of forward primer, 23 ng of biotin/-reverse
primer, 0.4mM each of DNTP and 10 mM Tris-HCI buffer (pH = 9.2) with 3.5 mM
MgCl2 and 75 mM KCl in 50uL volumes. A total of 15 cycles of denaturation (30 s,
95oC), annealing (30 s, 57.5 oC), and extension (20 s, 72oC) were performed followed by
final extension for 5 minutes at 72oC. The PCR products were verified by analyzing
aliquots on 2.5% agarose gel stained with ethidium bromide.

(1) Use of large injection volumes (still much smaller than conventional SELEX volumes) to

increase the number of molecules used in CE-SELEX, and (2) use of high concentration of DNA

library, thereby increasing the number of potential binders in the starting pool. Since the

inj section volumes can not be significantly manipulated, we initiated the SELEX process by

employing a high concentration of DNA library (2mM), which provides 1013 DNA molecules

with an inj section volume in the nano-liter range.

The disadvantage of using a high concentration of DNA is that the peaks observed in the

CE are relatively broad and can interfere with the separation efficiency (see Figure 2-3). Also,

these large peaks can be mis-shaped due to the high ionic concentrations employed in the

experiments. Both high concentration of ions and analytes can lead to de-stacking of the flow of










ions giving broad peaks. This is the maj or drawback in using CE as the separation method in

SELEX experiments.



3.5 i











-0.5


0 100D 200 300 400
Time lsconds)


Figure 2-3. Electropherogram of 2mM DNA library. Observed electropherogram of 2mM DNA
library with retention time of 129 seconds. The peak width observed for the DNA library
is 30 seconds, which is much larger than typical CE peak widths. CE conditions: Binding
buffer with 10mM HEPES,1mM MgCl2, 16mM KCl pH 8.05, 12.5kV at room
temperature, UV detection at 254nm

Therefore prior to the actual selection, we estimated the migration time of the free library

by observing the absorbance of DNA at 254nm (see Figure 2-3). This allowed us to estimate the

collection time of the protein-DNA complexes which migrate more slowly than the free DNA.

Prior to the SELEX experiments, the initial DNA library was denatured and then slowly

cooled to room temperature to allow the formation of stable secondary structures. During the

first 2 rounds of selection, PKCS was kept at 100nM concentration and incubated with the 2mM

DNA library at room temperature for 15 minutes to allow complete binding. Typically, in

SELEX experiments, the selection process starts with a low ratio of DNA to protein to allow all

the binding species to be captured and amplified. However, as the selection progresses, the ratio









of DNA to protein is increased to make the selection more stringent. This way, only the best

binders will be retained, and the poor binders will be removed. Therefore, in our SELEX

experiments, after the 2nd round of the SELEX process, the DNA-to-protein ratio was increased.

Also, the pH of the buffer was adjusted to 8.05 to match the pl of the protein. When the free

protein is at its pl, it carries no charge and does not migrate with the electrophoretic flow.

Protein bound to DNA carries the negative charge of the DNA molecule and migrates ahead,

with the electrophoretic flow, but because of the greater size of the protein-DNA complex, it

migrates much more slowly than the free DNA. After the free DNA eluted to the waste

reservoir, the voltage was applied for another Hyve minutes. The outlet of the capillary was then

placed into a collection vial and pressure was applied to push the DNA-PKCS complex out of the

capillary. Captured fractions were PCR amplified using 50C1L reaction volumes. A second PCR

step was employed with a biotinylated reverse primer and dsDNA was converted in to ssDNA

using a streptavidin column.

Even though CE shows high separation efficiencies, we did not achieve enrichment with

a low number of SELEX rounds (fewer than 4 rounds). The initial paper 73 introducing the CE-

SELEX method, used human recombinant IgE as the target. The molecular weight of IgE is

115kDa. In comparison, the molecular weight of PKCS is 70kDa, significantly less than IgE.

Since the mobility shift depends on the differences of the molecular weights of the protein-DNA

complexes and the free DNA, the mobility shift of PKC-DNA is considerably less. Due to this

smaller difference, the free and bound DNAs are not separated well, increasing the probability of

collecting non-specifieally interacting sequences. This effect of size difference on the separation

using CE-SELEX can limit the versatility of CE-SELEX method.










The peak shape is also a potential limitation of the CE-SELEX technique, because low

affinity sequences migrate in different rates, resulting in broad peaks. Figure 2-4 exemplifies the

observed absorbance at 254nm of the libraries corresponding to pools from 2, 4 5 and 8. As

shown in Figure 2-4, even with 100uM DNA, the peaks observed in rounds 2, 4, 6 and 8 are

significantly broad. Since only a few DNA sequences binding with PKCS, the peak

corresponding to bound DNA sequences cannot be seen in Figure 2-4 because it is below the

limit of detection.





o snsososo o u o
Tim (sc 20 Ron ih10u N n 0n K-d -Rod6(0 MDAad20n
Roun 4 wih10u N n 0 MPCd -Ron 10u N n 0 MPi-

Fiur 2-4 Elcrpeorm fteubudD AobevdurnSE Xruds24,6
an DAsmlsfo h rvosrudwr nuae ihPC n






roud. he rogres of wthe10u seecin wasd5 mnitored u ingEetroa M~oblt Shif D Assay (EMSA)TJ
asdesribed nd th metho10 Mds and matrils The result foru the o 8th pOl and the intallbry are

shw nFigure s 2-5. Eetoh gand26,rspciey Bycmprn the binndDAobev d uing cuEXrveorrspndin to4,6

the nitil liraryd (Fingur 2-6) a nd enicepool from roundia 8xp (Figr e 2-5),we. obered a60

enrichmnt of hg afntysqences.fo ol However,sic the enrichmen was relue o75V atiely poor, we

introd cdan additional gel extraction sep tcapue h eqecs ihth ihetafiiy





0 500 1000 1500


2000


[P KC-8]/nM


Figure 2-5. Affinity of enriched DNA pool from 8th round. A 3nM of 32P labeled DNA pool was
incubated with 4, 8, 16, 32, 64, 128, 250, 500, 1000, 2000nM PKCS and analyzed by
EMSA image (4% PAGE). Fraction bound was plotted as a function of protein
concentration. As the concentration of PKCS increases, there is an increase in the bound
fraction, indicating that the DNA pool has been enriched with specific binders.


0.8


0.6


0.4


0.2


1000
[PKC -8]lnM


1500


2000


Figure 2-6. Affinity of starting DNA pool. 32P labeled starting library (3nM) was incubated with
4, 8, 16, 32, 64, 128, 250, 500, 1000, 2000nM of PKCS and analyzed by EMSA.
Fraction of bound DNA plotted was as a function of PKCS concentration. Despite the
increase in protein concentration, the fraction of bound DNA remains less than 20%,
suggesting the starting librarycontained a low concentration of specific binders.










Analysis of Consensus Secondary Structure of High-Affinity DNA Ligands

The sequencing data for clones were analyzed using Sequencing Analysis Clustal W 6.0

software. As shown in the Figure 2-7, these were 53 sequences, of which 11 unique ligands can

be grouped into 11 sub-families based on their sequence similarities.

Typically, the classification of sequences is based on the fragments of sequences conserved

during the selection due to evolution (color coded in Figure 2-7). Inspection of the evolved

sequences for the group of ligands shown in Figure 2-7 shows short segments of conserved

primary sequences, disrupted by less conserved sequence regions of different lengths. By

observing the patterns of these conserved fragments, the individual sequences can be pooled into

a single subfamily. The number on the right hand side of the Figure 2-7 corresponds to the

random region of the starting library retained during the selection.

Analysis of Binding Sequences for PKCG

According to CE-SELEX experiment, highly repeated sequences should be the best

aptamer candidates. As shown in Table 2-1 sequence PB 9 represents a higher population in the

library, while the population for sequence PB 12 smaller. This indicates that sequence PB 9 is a

higher affinity sequence, while sequence PB 12 is a non-specifically enriched sequence.

Therefore, sequence PB 9 was chosen for further investigation with PB 12 as the control

sequence.

The binding analysis of aptamer sequence PB 9 and sequence PB 12 was performed using

EMSA. Each sequence was labeled with 32P and the resulting sequences were analyzed for

fraction of binding with PKCS using EMSA with a fixed protein concentration at 400nM. As

expected, aptamer sequence PB 9 from the maj or class showed higher affinity towards the

protein, i.e. higher fraction of bound sequence for a given concentration of PKCS.

















(PIB 1)






(PB3)




(PB4)



(PB5)



(PB 6)






(PB7)






(PB 8)


Aptamer PB4-G08 (PB 9) ------------ACACGACGGGAATACTGACTCCCCCCCAT------3
Aptamer PB4-E12 -------------TGCCCCGGCCATTTGTCCTACACCCCCTC------3
Aptamer PB4-FO6 -------------TGCCACCCCCACAGACCTTTCCCCCCCTG-----3
Aptamer PB4-G10 -----------CAGGCAGCTCCGAAAGACGGGACCCCCCC--------9
Aptamer PB4-Gl2 ----------TGA-GTCCCCGCACCAGCGACCCTCCCCCCT------3
Aptamer PB4-G11 ----------------GAGCGGCGAAGCTCACAGCCCCCCCAA----3
Aptamer PB4-BO6.b ----------CGGGGCGGTAGTAATTCCCTCCAGATCGGT-------3
Aptamer PB4-EO7 (P:B 10) -------------CCCTAGTGTTACTCTACCACATAATGCAC-----3
Aptamer PB4-AO7 -------------GACCACCGCTGTTCACCCCGGTACTACTC-----3


Figure 2-7. Sequences obtained from high throughput sequencing of pool of round 9. The same
color indicates the conserved similar sequence fragments captured during the
evolution. The dash lines correspond to the fixed primer regions. Short fragment of
sequences of the same color correspond to sequences evolved during the selection
process. According to sequence homology, 11 subfamilies were identified.


CILI~- C GG C


























Figure 2-7. Continued


Table 2-1. Evolved family of sequences with percentage of population. Higher percentages are
indicative of sequences with preferential binding. with PKCS with high affinity
Family Sequence Percentage of Population
PB9 ACACGACGGGAATACTGACTCTCCCCCATGT 32%
PBl2 T GGTGAAC GGAATGC CGGGGC TT CCAC TAC GCAGA 4%
PB11 C ATGC TGC CAGGGGTT CCAC TAC GTAGAGGCAA 24%
PB2 C CAGGGGGCAGAGAGAAGGGCATGGT GT G 1 1 %
PB3 GTAAAGGGCCAAAGACTGTATGAATACCAT 9%
PB1 AGC CGAGTGCTCGCAACGGTTTAGC CCCAT 4%
PB4 CAACGAGAGTAGAACGAGGGGATGTCTGCA 4%
PB6 GGACGGGCAAAGAAAGAGGGAAGAGAACAG 4%
PB5 GC CAAGAGC AAC GAGGAAGCAGGATAGGGC 3%
PB7 CATACGTGGTCATGCATACCCGTAACCGTT 2%
PB8 AC AAAAGAAGGAGAGGGAGAAGGGATAGGT 2%

As exemplified in Figure 2-8, compared with sequence PB 12, aptamer sequence PB 9 shows

approximately Hyve times higher binding with the given concentration of PKCG. After the

demonstrating the affinity for PKCS, the feasibility of modifying the aptamer probe with a

fluorescent label was investigated. Since the Einal goal of this study was to use the aptamer for

fluorescent based assays, the binding constant of the labeled aptamer was determined by

observing the change of fluorescent anisotropy of aptamer PB 9 labeled TMR

(Tetramethylrhodamine) at the 5' end.


(PB 11)


(PB 12


GCAC(
:GA ictA;G

:k 1C( IC(:ACCA(
:AAGG-------------------
;TAGTGGAACCTG(










1.2-








0.2

0,




PB9 PB12

Figure 2-8. Affinity of 32P labeled aptamer PB 9 to PKCG. 32P labeled aptamer PB 9 (14nM) was
incubated with 400nM PKCS in the binding buffer and analyzed by EMSA. Similarly,
14nM of 32P labeled PBl12 incubated with PKC-6 (400nM) was analyzed. Fraction of
bound PB9 with PKCS was normalized to 1. Binding of aptamer was PB 9 with is
approximately 5 times higher than binding with PB 12, demonstrating the higher affinity
of aptamer PB 9 towards PKCS.

Fluorescence anisotropy is the measurement of the change in the rotational motion of a

small molecule interacting with large molecule. Since aptamers are small molecules, binding to a

large protein molecule significantly increase their molecular weights and decrease the rotational

motion. This results in a detectable variation of the initial anisotropy. The fluorescence

anisotropy r, is calculated by the equation:

r = (Ivy G-IVH) /(lvy + 2G IVH) (2-1)

Subscripts V and H refer to the orientation (vertical or horizontal) of the polarizers for the

intensity measurements, with the first subscript to corresponding to the position of the excitation

polarizer and the second sub script to the emission polarizer. The term G refers to the G-factor,

which is the ratio of sensitivities of the detection system for vertically and horizontally polarized

light.










Figure 2-9 shows the binding curve generated by monitoring the change in fluorescence

anisotropy of aptamer PB 9 upon addition of PKCG. The increase fluorescence anisotropy upon

addition of aliquots of PKCS indicates a change in the rotational motion of TMR labeled aptamer

PB 9 when it binds with PKCS. Since TMR-labeled aptamer PB 9 is small, when it is free in

solution, the rotational motion of TMR is high, resulting in low anisotropy. On the other hand,

when aptamer PB 9 is bound to PKCS, the size increases significantly, thus, decreasing the

rotational motion and increasing the anisotropy.



0.025


S0.020 -









0.005 -[ K -|n





Change offluorescee urscence aniisotrop~y wi~tlhTMPR labeed rapandom seqen


Figure 2-9. Affinity of TMR labeled PB-9 to PKCG. Change of anisotropy of 5'-TMR labeled
aptamer PB 9 observed upon addition of PKCG. As aliquots of PKCS are added the
fluorescence anisotropy increases, because of the much larger size of the TMR
labeled aptamer PB 9 bound to PKCS. On the other hand, control random sequence
does not change its anisotropy with increase in concentration of PKCS, indicating that
the random sequence does not bind to PKCG.

The dissociation constant of the PB9-PKCS was calculated from the fluorescence

anisotropy data to be 122 nM. A control experiment with a TMR labeled random DNA sequence










showed no significant change of fluorescence anisotropy when PKCS was added, thus

demonstrating that the fluorescently labeled aptamer probe PB 9 can bind with

PKCS specifically.

Specificity of Aptamer PB 9

Since aptamer PB 9 showed high affinity towards the target PKCS, we wanted to assess the

specificity of binding. Therefore, the specificity of binding of the aptamer PB 9 with human

PKCS was investigated by EMSA, using a similar protocol that was used for the binding assays

indicated above. It has been reported in the literature that, high affinity of an aptamers towards

one particular target does not necessarily mean that the binding is preferential for one target

protein. For example, an aptamer selected against coenzyme A recognizes AMP, and an aptamer

selected for xanthine also recognizes guanine.140, 141 Since the target protein PKCS belongs to a

closely related family of isoforms, the specificity of this aptamer towards PKCS was assessed by

measuring its affinities for PKCS and closely for related PKCa and PKC$.

1.2









PKCS PKCo*- PKC#r






Figure 2-10. Specificity of aptamer PB9 towards PKCG. A 32P labeled PB9 (14nM) was added
to a fixed concentrations (400nM) ofPKCS, PKCu, and PKC) and analyzed by
EMSA. Fraction of bound aptamer PB9 with PKCS was normalized and compared
with other isoforms. The affinity of aptamer PB9 for PKCS is approximately 5-times
the affinity for PKCa and 2.5 times the affinity for PKC)










Specifieity was measured using 32P labeled aptamer PB 9 and observing the fraction of bound

DNA at a Eixed concentration of each protein. As shown in Figure 2-10, the affinity of aptamer

PB 9 towards PKCS is approximately 5 times the affinity for PKCoc and approximately 2.5 times

the affinity for PKC), thus demonstrating the specifieity of aptamer PB 9 towards PKCG.

Conclusion

We have selected DNA aptamers capable of in vitro PKCS monitoring using CE-SELEX.

This aptamer will enable us to apply fluorescently labeled aptamers to study protein-protein

interactions in signal transduction leading to tumor promotion. In this work we have

demonstrated that fluorescently tagged aptamer PB9 can specifically recognize PKCS with a KD

of 122 nM under in vitro conditions. This work shows that, by using CE-SELEX, molecular

probes can be generated for studying intracellular proteins and their functions.









CHAPTER 3
APTAMER DIRECTLY EVOLVED FROM LIVE CELLS RECOGNIZES MEMBRANE
BOUND IMMU7NOGLOBIN HEAVY MU CHAIN IN BURKITT' S LYMPHOMA CELLS

Previous chapter demonstrated the importance of generating molecular probes that allow

the detection of important signal transduction proteins. Aptamers for PKCS were selected, and

subsequently one of the aptamer probes was tagged with fluorophore for the detection of

PKCS in vitro.142 While intracellular proteins are important in a variety of biological

mechanisms, membrane proteins are equally or more important in detection of cancer.

Detection of cancer when the cells are in a pre-malignant state can provide a higher

probability of increasing the cure rate with current treatment strategies. One way of approaching

the issue of early cancer diagnosis is finding new biomarkers. By definition, biomarkers involve

quantitative measurements of biological species which are "abnormal" in their levels compared

to reference "normal" levels. In cancer they often act as key molecules in transforming healthy

cells into malignant cells. Because of their importance, recently much interest has been focused

on the identification of membrane marker proteins.14 In particular, proteomic approaches, in

particular, have emerged as established tools. 144, 145 These include the analysis of complex

protein samples using two-dimensional gel electrophoresis,146 as well as shotgun methods that

employ different membrane solubilization strategies, such as isotope-coded affinity tagging,147

multidimensional protein identification technologyl48 and surface-enhanced-l aser-desorpti on-

ionization combined with time-of-flight mass analysis of complex biological mixtures.149

Although these approaches are effective in identifying a large number of proteins in their

expression patterns, identifying specific protein markers that strongly correlate with cancer

remains a big challenge.









In this regard, there is growing interest in using monoclonal antibodies to target cell

surface proteins that are significantly expressed on diseased cells or tissues. In particular,

magnetic beads conjugated to monoclonal antibodies have been used to isolate membrane

proteins and plasma proteins using whole cellular lysates.lso, 151 However, the maj or problem

with antibodies is the difficulty in generating cell specific antibodies for the detection of the

expression levels in a single type of cell for unknown epitopes.

In order to address this issue, we have developed an effective method to generate aptamer-

based molecular probes for the specific recognition of cancer cells. 84,85 Using the Cell-SELEX

method described in the Chapter 1, we have generated aptamer TD05 which only recognizes

Ramos cells, from a Burkitt' s Lymphoma (BL) cell line (described below).84, 85 For example, as

shown in Table 3-1, aptamer TE13, which was selected against this cell line, shows different

levels of binding with different leukemia/1ymphoma cell lines. On the other hand, aptamer TD05

shows preferential binding to the target Ramos cell line. Based on the observed selectivity of

aptamer TD05, we hypothesized that this aptamer might be recognizing a protein related

primarily to BL cells but not to other cells.

Burkitt's Lymphoma

Burkitt' s non-Hodgkin' s lymphoma (BL) is a heterogeneous collection of highly

aggressive malignant B-Cells. BL was first reported as an endemic in equatorial Africa and in

New Guinea, and it also is commonly found in HIV-infected patients.15 At the molecular level,

BL is associated with deregulation of the expression of c-myc, a gene that encodes a basic helix-

loop-helix transcription factor that specifically binds to DNA sequence. The gene c-myc plays

an important role in the transcriptional regulation of downstream genes that control a number of

cellular processes, such as cell cycle progression and programmed cell death.153, 154 These tumor









cells usually express B-cell-specific tumor markers such as CD19, CD20 immunoglobin and Ig it

and h light chains. 5-7

Table 3-1. Recognition patterns of aptamers TD05 and TE13 with different leukemia cell lines,
Aptamer TD05 exclusively recognizes Ramos cells, indicating that TD05 might be
interacting with BL specific protein, while aptamer TE13 interacting with a wide
range of cells (for information tamer TD05, see reference 84)
Cell Line Aptamer TD05 Aptamer
TE13
Ramos (Burkitts' Lymphoma) ++++ ++++
CCRF CEM (T cell line, human Acute Lymphoblastic -0- ++++
Leukemia)
MO2058 (Mantle lymphoma cell line) -0- +
Jurkat, (human acute T cell leukemia) -0- +++
Toledo (Human Diffuse large cell Lymphoma) -0- +++
HL69 (small cell lung cancer) -0- -0-
NB-4 (acute promyelocytic leukemia) -0- +++
HL-60 (acute promyelocytic leukemia) -0- +++
This data were obtained from partly unpublished work. The experiments were performed by Dr
Zhiwen Tang. An explanation of the symbols used to evaluate cell binding (i.e. +++, ++++...) is
given in appendix A

Principle of Photocrosslinking of DNA with Proteins

Interaction site of proteins and nucleic acids, in particular the crosslinking of proteins with

nucleic acids, have been studied for decades. For example, UV-crosslinking combined with

immunoprecipitation (UV-X-ChlP) assays has been used in mapping protein DNA

interactions. "" Similarly, there have been several attempts made to map interactions between

aptamers and proteins using photo-aptamers containing photo-active bases that can induce

formation of highly reactive radicals upon irradiation with light. 159 For example, the interaction

of single-stranded DNA aptamers with basic fibroblast growth factor has been studied by

photochemically crosslinking the protein with the aptamer. 159, 160































~tBiotin S-S Disulfide bond =Covalent bond Y Receptor molecule


Manei beads. with immobilizedI stepa idi oto-active TDO5


Figure 3-1. Protocol for the identification of IGHM protein on Ramos cells. (1) Incubation of
biotinylated photoactive aptamer TD05 with the cells. (2) Irradiation of photoactive
aptamer TD05 to initiate crosslinks to the membrane protein (3) Cell lysis and
extraction with steptavidin-labeled magnetic beads (4) Release of protein-aptamer
complexes from the beads (5) Gel electrophoresis (6) MS analysis

A multi-step process was used to identify the target protein of aptamer TD05 on the

Ramos membrane, as shown schematically in Figure 3-1. First, the aptamer probe was

chemically modified with a photoactive uracil derivative at selected sites and linked to biotin via

S-S-bomd. After incubation with Ramos cells, the target protein was separated by lysing and

extraction with streptavidin linked to magnetic beads. The beads were removed by reduction of

the -S-S- link. The crosslinked proteins were separated by gel electrophoresis and analyzed by









mass spectroscopy (MS) and by a database search. Last, the identity of the target protein was

confirmed using an existing antibody and the selected aptamer. Detailed description about each

step is discussed in the later sections.

Aptamer TD05 Recognize Proteins on the Membrane

Since aptamers are known to interact with different molecules such as sugars, peptides, and

small organic molecules, it was necessary to confirm that selected probes interact selectively

with membrane proteins. In order to determine this, we adapted a previously described

procedure, based on the ability of certain proteases to selectively cleave amide bonds on

membrane proteins. 144 By employing the protease of choice, one can selectively "shave" off the

extracellular domain of the proteins (Figure 3-2). Since the "shaved"cells no longer contain most

of the extracellular portion of a membrane proteins, the resulting decrease in the binding of

aptamer TD05 gives an idea of the identity of the binding site.












Figure 3-2. Partial digestion of exracellular membrane proteins using trypsin and proteinase K
(indicated by scissors). 144 Trypsin cleaves carboxy terminal Lys and Arg residues of the
proteins, and is thus more selective than protenase K, which cleaves peptide bonds
adj acent to carboxylic groups of aromatic and aliphatic amino acids.144

Therefore, using this method, we carried out experiments by partially digesting cell surface

proteins with proteinase K to confirm that aptamer TD05 binds with cell surface proteins.

Protienase K acts on the cell membrane and cleaves peptide bonds adj acent to carboxylic groups

of aromatic and aliphatic amino acids. After treatment with proteinase K, flow cytometric










analysis of binding of FITC labeled aptamer TD05 showed no binding with Ramos cells,

suggesting that its target protein has been cleaved from the membrane (Figure 3-3).


- With out digestion
-Proteinese K 2.5 min
-Proteinase K 10 min


100* 102 1 103 104
Fluorescence Intensity


Figure 3-3. Binding of aptamer TD05 with Ramos cells after treatment with proteinase K at
different time intervals.84 The fluorescence signal resulting from binding of FITC labeled
aptamer TD05 with Ramos cells shifts to a lower value with increase in time of protease
digestion, indicating that membrane proteins are being digested and binding of aptamer
TD05 is lost. (For information on flow cytometric analysis see appendix A.)

Methods and Materials

A panel of aptamers targeting Burkitt' s lymphoma cells was selected by using cell-based

SELEX. As shown in Table 3-1, aptamer TD05 showed significant and specific binding with

Ramos cells. The aptamer sequence TD05 was modified with photo-active 5-iodo deoxyuridine

(5-dUI) nucleotides.

The original FITC labeled aptamer TD05 is 5' FITC- 5'-
ACC GGGAGGATAGTTC GGTGGCTGTTCAGGGTCTCC TCC CGGTG-3 '

The modified aptamer TD05 with 5dUI disulfide link and biotin
5 '-AC CGGGAGGAUAGTUCGGTGGC TGTTCAGGGUC TC CUCC CGGTG- S- S-T-PEG-(3) -
Biotin
Control TEO2 seauence with 5-dUI disulfide link and biotin









5 'fluorescene-ATCUAACTGCUGCGCCGCCGGGAAAATACGA GT G-S-P -
(3)-biotin

All DNA synthesis reagents were obtained from Glen Research. Biotin controlled pore

glass beads (Biotin-CPG) were used for all the biotin labeled aptamer synthesis. All

oligonucleotide sequences were synthesized using standard phosophoamidite chemistry using an

ABI3400 DNA synthesizer. Three poly ethylene glycol (PEG) units were introduced between

the aptamer and the biotin to avoid the interference of biotin with the spatial folding of the

aptamer. Mild deprotection conditions were used to avoid reduction of the disulfide bond.

Following precipitation with ethanol, the precipitated DNA was purified using high-pressure

liquid chromatography (HPLC), on a ProStar HPLC station (Varian, CA) equipped with a

photodiode array detector, using a C-18 reversed phase column (Alltech, C18, 5uM, 250 x

4.6mm).

The conditions of disulfide bond reduction using Tris(2-carboxyethyl)phosphine (TCEP)

were optimized by passing a 500nM biotinylated aptamer probe was passed through a mini

column packed with streptavidin sepharose labeled magnetic beads (Amersham Biosciences,

Upsala, Sweden) three times. After washing with PBS, the beads were placed into a micro-

centrifuge tube, treated with 50-100mM TCEP, and heated for 10, 20, or 30 min at 75oC to

cleave the disulfide bond linking the aptamer and the biotin. The supernatant and the beads were

analyzed by 2.5% agarose gel electrophoresis stained with ethidium bromide.

Competition Assays with the Modified Aptamer Probes

Following cell lines were obtained from American Type Culture Collection CCRF-CEM

(CCL-119, T cell line, human Acute Lymphoblastic Leukemia), Ramos (CRL-1596, B-cell line,

human Burkitt' s lymphoma), CA46 (CRL 1648, B-Cell line, Human Burkitt' s lymphoma),

Jurkat (TIB-152, human acute T cell leukemia), Toledo (CRL-2631, B-cell line, human diffuse









large-cell lymphoma), K562 (CCL-243, chronic myelogenous leukemia, CML), NB-4 and HL-

60 (CCL-240, acute promyelocytic leukemia).

All of the cells were cultured in RPMI medium 1640 (American Type Culture Collection)

supplemented with 10% FBS (heat-inactivated; GIBCO) and 100 units/mL penicillin-

streptomycin (Cellgro). Cells were washed before and after incubation with wash buffer (4.5g/L

glucose and 5mM MgCl2 in Dulbecco's PBS with calcium chloride and magnesium chloride;

Sigma). Binding buffer used for selection was prepared by adding yeast tRNA (0.1mg/mL;

Sigma) and Img/mL sheared salmon sperm DNA to the wash buffer to reduce non-specific

binding.

The effect of replacement of thymine (T) with 5-dUI was investigated by conducting

competition assays. Briefly, 1CIM aptamer TD05 was mixed with 10CIM in 500 CIL of the

modified aptamer probe were incubated with 1 x 106 CellS for 30 min at 4o C in the binding

buffer. After washing with the wash buffer, the cells were analyzed by observing the decrease in

the fluorescence of FITC-labeled aptamer TD05 using a FACScan cytometer (BD

Immunocytometry Systems) by counting 30,000 events. A FITC-labeled unselected ssDNA

library was used as a negative control.

Aptamer Labeling with AT32p

Samples containing oligonucleotide (3.74 nmole) and [y-32P] ATP (8.3pmole) were

incubated overnight at room temperature with 50units of polynucleotide kinase (Promega).

Unincorporated ATP was removed using a G-25 column (Amersham Biosciences).

Protein-Nucleic Acid Photo-Crosslinking

A 0.023 CCi aliquot of (Counts Per Minutes of 5 x 104) Of 5'-32P labeled aptamers was

added to 400 x 106 CellS in the binding buffer. The cells and the aptamers were incubated at 4oC









for 30 minutes to allow for complete binding. A control with the TEO2 aptamer sequence was

performed in parallel. The unbound aptamers were washed until no radioactivity was detected in

the wash buffer. Cells and bound aptamer were re-suspended in the wash buffer in a cuvette

with a 10cm path length. To initiate crosslinkage, the sample was irradiated with 55pulses of

308nm light from a Lambda Physik, model LPX240 XeCl excimer laser operating at 16.065mJ

per pulse for 20 seconds. During the irradiation, the cell suspension was constantly stirred to

allow the maximum crosslinking.

Cell Lysis and Protein-Aptamer Extraction.

The cells were suspended in lysis buffer containing a protease inhibitor cocktail (Sigma),

Img/mL salmon sperm DNA (Eppendroff), 1mg/mL tRNA (Fisher), 50mM HEPES, and ImM

EGTA, and the suspension was homogenized using a Dounce homogenizer at 75 strokes per

minute. The crude mixture was centrifuged at 4000 rpm for 30 min at 4oC. Water-soluble

protein extracts were separated from the crude membrane by centrifugation at 4000 rpm for 30

min. The pelleted crude membrane was solubilized in buffer containing PBS (Fisher), 0.5% NP-

40 (Sigma), 1.25% Cholesteryl-hemi succinate (CHS; Tris-HCI salt, Sigma), and 2.5% n-

dodecyl-P-D-maltoside (DDM, Sigma) with gentle agitation at 4oC. The solubilized membrane

proteins were separated from cell debris by centrifuging at 3000 rpm for 30 minutes at 4oC.

Crude cell lysate was stirred with 2mg/mL of streptavidine labeled magnetic beads (Invitrogen)

at 4oC for 2.5 hours. Captured probes were magnetically separated and washed with 3 different

solutions (15 minutes each): with PBS containing 1% NP-40; 10mM EDTA containing 1%NP-

40; and 0.05% SDS solutions by stirring for 15 minutes at 4oC. Harsh washing steps were

employed to ensure that only crosslinked proteins remained and to minimize the non-specific

binding.









Release of Captured Complex and Protein Gel Electrophoresis

Complexes captured on magnetic beads were heated at 75oC for 30 minutes with 10mM

TCEP and a sample loading buffer. The solution was loaded on to 10%-bis-Tris PAGE and

200V was applied for 55 minutes. Protein bands were visualized using Bio-Rad gel-code blue

staining reagents according to the manufacture's instructions. The gel was subsequently exposed

to Bio-Rad personal phosphor imager screens overnight and visualized by Bio-Rad phosphor

personal phosphoimager. The single band appeared in the gel was excised, digested, and

analyzed by a QSTAR LC-MS/MS, equipped with a MASCOT@ database at the Protein

Chemistry Core Facility, University of Florida. The conditions used in the MS analysis were as

follows: Capillary rpHPLC separation of protein digests was performed on a 15cm x 75um i.d.

PepMap C18 column (LC Packings, San Francisco, CA) in combination with an Ultimate

Capillary HPLC System (LC Packings, San Francisco, CA) operated at a flow rate of

200nL/min. Online tandem mass spectrometric analysis was accomplished by a hybrid

quadrupole time-of-flight instrument (QSTAR, Applied Biosystems, Foster City, CA) equipped

with a nanoelectrospray source.

Tandem mass spectrometric data were searched against the IPI human protein database

using the Mascot search algorithm. In general, probability-based MOWSE scores that exceeded

the value corresponding to p<0.05 were considered for protein identification.

Partial Digestion of Membrane Proteins Using Trypsin

A sample containing 5 x106 CCRF-CEM cells was washed with 2ml PB S, and incubated at

37oC with 1mL of 0.05% Trypsin/0.53mM EDTA in HBSS or 0.1Img/ml trypsin in PBS either

for 2 min or 10 min. Fetal Bovine Serum was then added to quench the proteinase action. After

washing with 2 ml binding buffer, the treated cells were used for aptamer binding assay using

flow cytometry.









Characterization of Aptamer Binding Protein on Ramos Cells

Alexa Fluor 488 labeled Anti-IgM heavy chain (2mg/mL Molecular probes, Invitrogen)

was used to further confirm the protein target. Competition experiments were carried out by first

incubating with 0.5uM TD05-FITC with 1 x 106 Ramos, Toledo, and CEM cells at 4oC for 15

min. After wash off the excess TD05-FITC, labeled anti-IgM heavy chain (2Clg/mL) was

incubated with the samples at 4oC for 15 minutes and washed off the excess probe and decrease

of the binding of FITC-TD05 was analyzed by flow cytometry.

Trypsin digestion experiments were conducted as described above using 2Clg/mL of Alexa

Fluor 488 labeled anti-IGHM antibody. Briefly, cells were partially digested with trypsin at

37oC for 2 min and 10 min. Cells were then washed and incubated either with Alexa Fluor 488

labeled antibody or FITC labeled aptamerTD05. After washing to remove unbound sequences,

binding was analyzed using flow cytometry.

Fluorescence Imaging.

All cellular fluorescent images were collected using a confocal microscope consisting of an

Olympus IX-81 automated fluorescence microscope with a Fluoview 500 confocal scanning unit.

The dye conjugates were excited at 488 and 543nm. Images were acquired after five to ten

second delays, during which the instrument was focused to yield the highest intensity from the

fluorescence channels. The images were assigned color representations which were not

indicative of the actual emission wavelengths. Bright spots in the images are corresponding to

dead cells.

Results and Discussion

Probe Modification and the Effect of Modification on Aptamer Affinity and Specificity

Modification of aptamer TD05 with photoactive 5-dUI facilitates its covalent crosslinking

with the target protein on the cell membrane, so that only the crosslinked target protein is









extracted. First, in order to achieve high crosslinking efficiency, the position of the photoactive

nucleotide 5-dUI in the aptamer TD05 was optimized. Since 5-dUI and deoxythymidine have

similar covalent radius, we initially hypothesized that the modification would not affect the

aptamer binding with Ramos cells. However, when all of the deoxythymidine were replaced

with dUI, the aptamer no longer recognized Ramos cells. To avoid problems with aptamer

folding, 5-dUI was introduced only in alternating positions at the first two and final two

deoxythymidine bases (Figure 3-4). Next, biotin was linked through a disulfide bridge at the 3'

end of the aptamer. The purpose of the biotin was to complex with streptavidin-coated magnetic

beads to help efficient release of the aptamer-protein target from the beads.

Binding of modified aptamer TD05 with the target cells was analyzed through a

competition assay with unmodified FITC-labeled aptamer using flow cytometry. In the presence

of modified aptamerTD05 (no FITC label), the fluorescence corresponding to unmodified

aptamer TD05 with FITC label shifts to a lower value, indicating that modified aptamer binds

with Ramos cells and displaces the FITC labeled unmodified aptamer. (Figure 3-5).

Finally, the conditions pertaining to concentration, temperature and time were optimized to

achieve effective release of captured aptamer probe from the magnetic beads using Tris(2-

carboxyethyl)phosphine (TCEP).

Separation of Captured Complex From the Crude Cell Lysate and MS Analysis of
Captured Protein

In order to trace the aptamer-protein complex during the isolation process, we labeled the

aptamer TD05 with 32P at the 5' end. The resulting 32P labeled photoactive aptamer TD05 bound

to Ramos cells were irradiated with nanosecond pulses of a XeCl excimer laser to initiate the

crosslinking of the aptamer with the cell surface protein. Chemical crosslinking of aptamer

TD05 with its target protein was introduced to maximize the specificity of the extraction and to











minimize contamination caused by nuclear proteins. In addition to covalent crosslinking, the


non-specific interactions were further minimized by using a cocktail of sheared salmon-sperm


DNA and RNA in the cell lysis buffer.


1
r
I
I






O


O


Figure 3-4. Modified aptamer with photoactive 5-dUI, linked to biotin via a disulfide bond. 5-
dUI facilitated covalent crosslinking and the disulfide bridge allowed efficient release of
the captured complex from the magnetic beads. The photoactive bases are shown by the
squares. The structure is predicted by the m-fold program.












rr -N-hon-binding sequences
N ~With modified TD05
-TDD5-FITC










100 101 102 103 10"
Fluocrescence Intens~it

Figure 3-5. Binding of modified aptamer with 5-dUI and biotin linker with Ramos cells. In the
presence of modified aptamer TD05, the fluorescence of the FITC labeled unmodified
aptamer TD05 was shifted to a lower fluorescence value, indicating that the modified
aptamer TD05 competes with the unmodified aptamer TD05.

To avoid contamination caused by plasma proteins, water soluble proteins were removed by

lysing the cells in a high salt aqueous buffer (without any detergents added). Since cell-

membrane and membrane proteins contain hydrophobic regions, these proteins are not soluble in

high salt aqueous buffer. Once the soluble proteins were removed, the crude membrane was

solubilized in membrane solubilization buffer containing a number of cationic and neutral

detergents to aid in removing membrane proteins from the cell membrane.

The mixture of membrane proteins was incubated with streptavidin-coated magnetic beads

to extract aptamer sequences that bear biotin at the 3' end, along with the covalently bound target

protein. The extraction was repeated 3 times until approximately 90% of the complex was

extracted onto the beads. Since the aptamer TD05 was labeled with 32P, we detected the

efficiency of the extraction was determined by measuring the radioactivity on the beads

compared to cell extract using a Geiger counter.










One of the challenges in isolating protein from cell lysates is the interference of nuclear

and other non-specific proteins with the aptamer. Insufficient washings of the complex led to

contamination with nuclear proteins resulting in a smeared band after gel electrophoresis.

Therefore, harsh washing conditions varying from PBS to 0.05% SDS were introduced to ensure

the efficient removal of non-specific nuclear proteins absorbed onto the magnetic beads.

Crosslinking of the protein target to the aptamer made it possible to use harsh washing

conditions without losing the target protein.

The aptamer TD05-protein complexes were subsequently removed from the beads by

reduction of the S-S bridge between the aptamer and biotin. Following the release of the aptamer

TD05-protein complex, the high sensitivity of 32P enabled us to recognize the protein-aptamer

complex using gel electrophoresis and a standard phosphor imager. As shown in Figure 3-6, the

band corresponding to the cross-linked aptamer TD05 with protein was retarded compared to the

free aptamer TD05, which is smaller in size. Figure 3-7, shows the image for the TEO2 control

sequence, which was not retarded, indicating that aptamer TD05 is selective for the target

protein.


Lane 1 2








Figure 3-6. Phospho images for 10% tris-bis PAGE analysis of the captured complex. The
shifted band in lane 2 corresponds to the cross-linked aptamer-TD05-Protein complex.
Lane 1. cell lysate Lane 2. aptamer TD05-protein complex.

Despite the harsh washing conditions employed during the sample preparation process, the

results still indicated a significant amount of nuclear proteins. However, four candidates were





isolated based on their molecular weights and the nature of membrane proteins, and these are

marked in the Table 3-2, which shows the candidates identified by the MASCOT library

search.

L~ae 1 2









Figure 3-7. Phospho images for control TEO2 Sequence: Lane 1 Cell lysate; Lane 2. With
modified TEO2 extraction. TEO2 is a control sequence. No shifted band is seen in either
lane.

Table 3-2. Identified proteins and their IPI values based on European Protein Data Bank using
MASCOT database search. These candidates could potentially be the target for
aptamer TD05


Protein Candidate


IPI Value


Nucleolar protein Nop56
Heterogeneous nuclear ribonucleoprotein L isoform a
NONO protein
Splice Isoform 1 of Myelin expression factor 2
Heterogeneous nuclear ribonucleoprotein M isoform a
Lamin Bl
Paraspeckle protein 1 alpha isoform
Keratin, type II cytoskeletal 2 epidermal
L-plastin
Splice Isoform Short of RNA-binding protein FUS
IGHM protein*
60 kDa heat shock protein, mitochondrial precursor
SYT interacting protein SIP
HNRPR protein
Keratin 9
Keratin, type I cytoskeletal 10
Splice Isoform 1 of Heterogeneous nuclear ribonucleoprotein K

Keratin 1
Probable RNA-dependent helicase p68
Large neutral amino acids transporter small subunit 1*
Splice Isoform 1 of Development and differentiati on-enhancing
factor 2*
Splice Isoform 4 of Potassium voltage-gated channel subfamily
KQT member 2*


IPIOO411937
IPI00027834
IPIOO304596
IPI00555833
IPIOO0171903
IPIOO217975
IPIOO0103 525,IPI003 95775
IPI00021304
IPI00010471
IPIOO2213 54,IPIOO260715
IPIOO477090
IPIOO472102
IPI00013 174,IPI005 50920
IPI00012074
IPI00019359
IPI00009865,IPI00295684
IPIOO216049,IPIOO216746,
IPI00514561
IPI00556624
IPI00017617
IPI00008986
IPI00022058

IPIOO328286










Of the four candidates we determined the protein candidate IGHM to be the most probable match

because (1) IGHM protein was known to be expressed in B-cells; (2) its molecular weight

corresponded to the molecular weight of the protein excluding the molecular weight of the

aptamer; (3) it is a membrane protein; (4) the other three protein candidates are commonly

expressed in all types of cells. Following the MS analysis, further experiments were performed

to confirm the identification, as described in the next section.

Confirmation of the Protein IGHM as the Binding Target for Aptamer TD05




A B

NI~ Ramos NI------ Ramo~s
-CCRF-CEM -------CCRF-CEM
-Toledo -Tol ~edo












15 0' 102 10" 104 10o 10l 10L 10' 104

Fluorrese~nce: Intensity Fluorescence Intensity


Figure 3-8. Aptamer TD05-FITC and Alexa Flour 488 -anti-IGHM binding analysis with
Ramos, CCRF-CEM and Toledo cells (A) Aptamer TD05-FITC binding with Ramos
cells. Higher fluorescence intensity observed for Ramos cells indicates that FITC- TD05
recognizes Ramos cells but not CEM or Toledo cells. (B) Binding patterns of Alexa Fluor
488 labeled anti-IGHM antibody with Ramos cells, CEM and Toledo cells correlated
with binding pattern on FITC-TD05 i.e. higher fluorescence signal for Ramos cells while
background fluorescence signal for other cell lines. (For information on flow cytometric
analyses see Appendix A)










With the MS results suggesting that IGHM is the target for aptamer TD05, we first

investigated the binding of Alexa Fluor 488 labeled anti-IGHM antibody with Ramos, CCRF

CEM, and Toledo cells. As shown previously in Table 3-1, the aptamer TD05 exclusively

recognizes Ramos cells but not control cell lines. Figure 3-8 shows the flow cytometric data for

Ramos, CCRF-CEM and Toledo cells after incubation with (A) FITC-TD05 and (B) Alexa Fluor

488 labeled anti-IGHM antibody. The much greater fluorescence intensities for the Ramos cells,

as well as the very similar patterns of the peaks, indicates that IGHM is very likely the target

protein.

Aptamer TD05 and anti-IGHM antibody were further assayed with another Burkitt' s

lymphoma cell line that is known to express surface IGHM (CA-46 cell line, see Figure 3-9). As

expected, aptamer TD05 and anti-IGHM antibody showed binding with the CA-46 cell line,

further indicating that IGHM could be the target protein.



eI Library
TDO5-FITC
Alexa flaur 488 Iabeled anti-IGHM antibody











1 101 102 103 104
Flnorescence Intensity

Figure 3-9. Aptamer TD05-FITC and anti-IGHM antibody binding with surface IgM positive
CA46, a B-lymphocyte Burkitt's lymphoma cell line. Shifted fluorescence intensity of
both aptamer TD05-FITC and Alexa Fluor 488 labeled antibody is indicative of binding
with CA-46 cells. (For information on flow cytometric analysis see Appendix A)










Several leukemia cell lines that are not related to B-cells were also tested to further analyze the

binding of FITC-TD05 and anti-IGHM antibody. As shown in Table 3-3, neither the aptamer nor

the antibody showed any binding towards cell lines other than cell lines originated from B cell

non-Hodgkin's lymphoma.

Table 3-3. Binding patterns of aptamer TD05 and anti-IGHM with different cell lines. Aptamer
TD05 does not show binding with tested cell lines except for Ramos and CA-46.
Similarly, anti-IGHM anti body does not bind to other tested cell lines
Type of Leukemia Cell line Aptamer TD05 IGHM antibd
B-cell non-Hodgkin's Ramos ++++ ++++
lymphoma Toledo -0- -0-
CA-46 +++ +++
T-Cell lymphoblast CEM-CCRF -0- -0-
leukemia Jurkat -0- -0-
HL-60 -0- -0-
Promyelocytic leukemia NB-4 -0- -0-
K562 -0- -0-
Explanation of the symbols used to evaluate cell binding is given in the Appendix A.

If both aptamer TD05 and anti-IGHM antibody bind to similar epitopes or epitopes close

to each other on the IGHM protein, we should observe a competition between the two in binding

should be observed. We investigated the effect of aptamer TD05 binding with Ramos cells upon

addition of anti-IGHM antibody. Interestingly, aptamer TD05 did not affect the anti-IGHM

binding with Ramos cells. However, anti-IGHM antibody reduced the interaction between

aptamer TD05 with Ramos cells, as shown in Figure 3-10. These results suggest that aptamer

TD05 and anti-IGHM both bind to the same site, but the affinity for anti-IGHM binding is much

greater than that for aptamer TD05.

In addition, the co-localization of the Alexa Fluor 488 labeled anti-IGHM antibody and

tetramethylrhodamine-labeled TD05 aptamer was monitored using confocal microscopy. As

shown in Figure 3-1 1, both probes heavily stain the cell periphery of the corresponding target

Ramos cells.











-Library


- TDO5-FITC wit hout anti-IGH M
TDO5-FITC in the presence ofi anti-IGHIV


liF~
N




e
a









loo


101 1010 104


Fluorpescene Intensi~ty

Figure 3-10. Competition of aptamer TD05-FITC and anti-IGHM antibody for the target
protein. After addition of the antibody, the fluorescence corresponding to FITC
labeled TD05 decreases, compared to FITC- TD05 binding in the absence of anti-
IGHM antibody. (For more information on flow cytometric analysis see Appendix


B C:


Figure 3-11. Binding of Alexa fluor 488 labeled anti-IGHM antibody and TMR labeled TD05
aptamer with Ramos cells. Both aptamer and antibody stains the cell membrane
periphery. (A) Ramos cells and Anti-IGHM, (B) Ramos Cells and TMR labeled aptamer
TD05, (C) optical Image of the cells



















































100 101 102 103 10

Flu~oresce~n~ce Inten~sky


--- Library
TD05-FITC
-Alexa flour 488 labeled anti-IGHM antibody













101 102 103 10a
Fluorescence Intensity
A


VI
N





e
csr


2 mina tryrps~in t reat meat

- 10 mnin t rypsina t reat ment


-2 min trypsin treatment

10 min trypsin treatment










100 101 102 103 104

Fluore~scence? Intenskty


Figure 3-12. Flow cytometric results for the anti-IGHM binding with Ramos cells after Trypsin
digestion. (A) Control experiments with FITC labeled TD05, and Alexa Fluor 488
labeled anti-IGHM antibody. Higher fluorescence intensity observed for both aptamer
and antibody indicates that both probes bind with Ramos cells before the trypsin
digestion. Analysis of Binding of (B) TD05-FITC (C) Alexa Fluor 488 labeled anti-
IGHM with Trypsin digested cells. Both show that there is no effect on binding (either
with the aptamer or the antibody) after trypsin treatment









The study of the effect of the treatment of the cells with trypsin also provides support for

the assignment of IGHM as the target protein. Figure 3-12 shows flow cytometric results prior to

and after trypsin digestion. Interestingly, we observed neither aptamer TD05 binding nor anti-

IGHM binding was lost by partial digestion with trypsin. These results contrasts with the results

from experiments using proteinase K (see Figure 3-3). In that study, binding of aptamer TD05 to

Ramos cells was lost after proteinase K digestion. This may be explained by the lower

specificity of proteinase K compared to trypsin. Evidently, the binding site for aptamer TD05

and anti-IGHM is cleaved by proteinase K but not by trypsin.

Discussion

Here, we have presented a simple strategy for identifying differentially expressed proteins

by employing aptamer probes selected against target tumor cells. This method integrates the

selection of molecular probes targeting specific cells and the use of cell specific aptamers for

effective identification of target proteins. Our group's previous work with aptamer selection and

screening against cancer cells has established that aptamer binding signatures pertaining to each

cell type can indicate expression patterns of protein candidates and that each aptamer candidate

has its own identity when recognizing target proteins in complex biological specimens.84, 85, 90

Furthermore, we have shown that it is feasible to recognize up-regulated proteins that may have a

role in transforming unhealthy cells into diseased cells.161

We also have exploited the remarkable versatility for chemical modification of DNA

aptamers by incorporating different functionalities to improve their performance as molecular

probes. These modifications improved two important features: probe stability and collection

efficiency. Enhanced stability of the aptamer-protein complex through incorporation of 5-dUI

allowed the complex to sustain harsh washing conditions in extraction, which was important in

purification and enrichment of the targeted proteins from a cell lysate sample. Enhanced









efficiency of the biotin aptamer removal from the streptavidin support occurred through

introduction of a readily cleavable disulfide bond.

The typical approach for solubilizing membrane proteins from the cell membrane is to use

carefully optimized ratios of the detergents that mimic the membrane in an artificial

environment. However, poor optimization of detergent compositions can result in misfolding of

the receptor and/or irreversible denaturation of the receptor molecule, because the native

conformation of the receptor molecule depends on the hydrophobic lipid bilayer of the cell

membrane. Poor optimization of the detergents may also lead to possible disruption of the

aptamer-protein when the target protein mis-folds or denatures. This protein alteration, caused

by changes in the lipid composition of buffers, is one of the maj or concerns in identification of

membrane proteins using protein specific aptamers and can possibly be one of the limitations

when using these probes in identifying molecular markers. We have addressed this issue by

modifying the aptamer with photoactive 5-dUI to facilitate covalent crosslinking of the probe

with the target protein, which increases the stability of the complex.

Conjugations using biotin-strepavidin have been exploited for many applications in

immunology, affinity chromatography and other separation applications. 162-164 However, one of

the maj or disadvantages of such interactions is that such affinity requires harsh conditions to

elute the biotin bearing-ligand from of the streptavidin-coated solid support, resulting in either

damage to the protein-ligand complex or the need for larger sample volumes to allow pre-

concentration prior to SDS-PAGE analysis.146 In this study, the aptamer was modified with a

disulfide functional group prior to the biotin at the 3' end. Typically, disulfide linkage can be

easily hydrolyzed by treatment with commonly used reducing agents prior to gel electrophoresis.

This modification allows the biotin bearing aptamer along with its protein to dissociate from the









beads more efficiently with sample volumes compatible for gel electrophoresis. Also, this

approach can dramatically reduce potential sample loss during the sample preparation process.

The discovery of IGHM on the Ramos cells supports the initial expectations of this study,

because binding of aptamer TD05 with Ramos cells correlated with reported IGHM expression

patterns of these cells compared to other cell lines and in real bone marrow samples. IGHM

protein is one of the maj or components of the B-cell receptor complex expressed in mature

Burkitt' s lymphoma cells, 165 and it is known that IGHM expression on premature B-lymphocytes

is closely related to Burkitt' s lymphoma developmentl66 and is a marker for this form of cancer.

Also, several literature references emphasize the active role of IGHM in Burkitt' s lymphoma cell

proliferation and survival.166-16 Accordingly, these findings demonstrate the adaptability of this

approach in identifying cell membrane receptors that have altered expression levels in tumor

cells.

In conclusion, we have shown that cancer-cell-specific aptamers provide an effective tool

in identifying target proteins that show increased expression levels in a chosen pool of diseased

cells. The ease in chemical modification of the DNA aptamer probe has lent needed binding

stability and strength for the effective capture, enrichment, and identification of corresponding

target receptors on the cell membrane surface. In addition, findings of this approach show that

the generation of aptamers using Cell-SELEX followed by identification of the binding entity for

each aptamer can be useful in discovering disease-specific marker proteins in a given cell type.

In contrast to conventional methods, such as phage display antibody production targeting a

previously known specific protein, the novelty of cell-SELEX based protein discovery is rooted

in its focus on finding cell surface membrane markers with no prior knowledge of the molecular

contents of the cell surface. Also, owing to the easy chemical manipulation and reproducible









generation of DNA aptamers by automated synthesis, this method is more universal and

technically feasible. Finally, apart from the ability to identify disease markers that may play key

roles in cancer progression, this method can also be useful in early diagnosis, targeted therapy, as

well as a molecular tool for the recognition and mechanistic studies of diseased cells.









CHAPTER 4
APTAMERS EVOLVED FROM WHOLE CELL SELECTION AS SELECTIVE ANTI-
TUMOR PHOTODYNAMIC AGENTS

In the previous chapter, we described a systematic approach to identify a protein marker

specific for Burkitt's lymphoma (BL) cells.161 In doing so, aptamer TD05 selected using cell-

SELEX method was used to capture membrane bound IGHM protein from BL cells. Membrane

bound IgM is known to express uniquely in BL cells and is known as a marker protein for BL.

Since aptamer TD05 exclusively binds to this BL marker, we hypothesized that aptamer TD05

can be used for drug delivery. Therefore, the focus of this chapter is to demonstrate that aptamer

TD05 can be used as a drug delivery agent to selectively kill BL cells. In order to demonstrate

the targeting ability of aptamer TD05, a photosensitizer (PS) was used as the drug candidate.

Pages 31 to 34 in the introduction described photodynamic therapy, in which a localized PS

creates a toxic environment when it is irradiated.

Introduction to Photosensitizers

The mechanism of PSs and their biological applications in treating cancer cells are

described in Chapter 1. In this section, the chemical structures of PSs and their structural

properties are described.

The maj ority of photosensitizers commonly known as phorphyrins, contain a tetrapyrrole

aromatic nucleus similar to that in many naturally occurring ring structures, such as heme,

chlorophyll, and bacteriochlorophyll. The PS used in this study belongs to a category of PSs

called "second generation photosensitizers", which were developed to increase the hydrophilic

nature by introducing polar substituents on the ring structures. 169 Figure 4-1 shows two

examples of the first and second generation PSs.

One of the most commonly used photosensitizers is Chlorin e6, with a main absorption

band at 643nm attributed to the extended pi system.

























R' = R" -CH(OH)CH3 R" = -CH(OH)CH3 R' = R" -CH(OAc)CH3
R' = -CH(OH)CH, R7'= R" -CH=CH2
Figure 4-1. Chemical structures of photosensitizers. First generation photosensitizers(left) and
Chlorin e6 (right), a second generation photosensitizer. Chlorin e6 contains additional
carboxyl groups to increase the water solubility.

The visible to IR-wavelength absorption makes Ce6 molecules desirable candidates for

photodynamic therapy, because use of wavelengths shorter than 600nm would result in

substantial light losses due to absorption by chromophores present in the tissues. 170

The biggest challenge in using PS in photo-therapeutic treatment of cancer is the

nonspecific targeting of healthy cells that leads to severe side effects.170 To address this issue, a

number of strategies were introduced, as described on pages 31-33. While these approaches are

effective in therapeutic targeting of tumor cells, there still is a need for improvement in

selectivity. For example, even if immunoconjugates are successful in targeting the cancer cells,

they have been shown to induce immune responses and to cross react with shared antigens in the

normal tissue. In addition, conjugation of drugs is tedious especially with proteins.l7

Owing to their many significant advantages, including small size, easy chemical synthesis

with high reproducibility, easy chemical manipulation, low immunogenity and high blood

clearance rates, aptamers can be readily applicable in cancer therapy.172 Therefore, we have

combined the high selectivity of the aptamer TD05 with easy chemical manipulation of DNA to









develop a highly selective aptamer-photosensitizer (PS) conjugate to destroy aptamer specific

cancer cells.

Methods and Materials

Synthesis of the Conjugate

Amine modified aptamer TD05 and non-specific control DNA were synthesized in house

using an ABI3400 DNA/RNA synthesizer (Applied Biosystems, Foster City, CA and the probes

were purified using reversed phase HPLC (Varian, Walnut Creek, CA) with a C18 column

(Econosil, Su, 250 x 4.6 mm) from Alltech (Deerfield, IL). A Cary Bio-300 UV spectrometer

(Varian, Walnut Creek, CA) was used to measure absorbances to quantify the manufactured

sequences. All oligonucleotides were synthesized by solid-state phosphoramidite chemistry at a

1 Clmol scale. The completed sequences were then deprotected in concentrated ammonium

hydroxide at 40 oC overnight and further purified twice with reversed phase high-pressure liquid

chromatography (HPLC) on a C-18 column.

TD05-NH2 5' -NH2-ACCGGGAGGATAGTTCGGTGGCTGTTCAGGGTCTCC CGT-

Control Sequence: 5'NH2- CACCTGGGGGAGTATTGCGGAGGAAGGTAGTCTGATTGGC

Photodynamic ligand Chlorin e6 (Ce6) (Frontier Scientific, Logan, UT) was conjugated to

amine modified DNA using N-hydroxysuccinimide ester (NHS) of Ce6 and dicyclohexyl

carbodiimide (DCC) as a coupling agent. Equimolar amounts of NHS and Ce6 and DCC were

dissolved in anhydrous DIVF in the dark for 30 min. The activated Ce6 was then added to excess

amine-modified TD05 in NaHCO3 at pH=7 by vigorously stirring overnight in the dark. The un-

conjugated Ce6 in the supernatant was removed by ethanol precipitation of DNA 5 times. The

resulting crude mixture was separated by reversed phase HPLC. The conjugated DNA and Ce6

were quantified by measuring the absorbance at 260nm, where DNA absorbs, and at the two









absorption maxima for Ce6, 404 nm and 643nm, using a Varian UV/Vis spectrometer. The

calculated SDNA SCe6 WAS approximately 1.

Cell Lines and Binding Buffer

The following cell lines were obtained from American Type Culture Collection CCRF-

CEM (CCL-119, T cell line, human_ALL), Ramos (CRL-1596, B-cell line, human Burkitt' s

lymphoma), K562 (CCL-243, chronic myelogenous leukemia, CML), HL-60 (CCL-240, acute

promyelocytic leukemia), and Jurkat (TIB-152, human acute T cell leukemia). NB-4 (acute

promyelocytic leukemia) was a gift from the Department of Pathology, University of Florida.

All of the cells were cultured in RPMI medium 1640 (American Type Culture Collection)

supplemented with 10% Fetal Bovine Serum (FBS, heat-inactivated; GIBCO) and 100 units/mL

penicillin-streptomycin (Cellgro). Cells were washed before and after incubation with wash

buffer (4.5g/L glucose and 5mM MgCl2 in Dulbecco's PBS with calcium chloride and

magnesium chloride; Sigma). Binding buffer used for selection was prepared by adding yeast

tRNA (0.1mg/mL; Sigma) and Img/mL sheared salmon sperm DNA into wash buffer to reduce

non-specific binding.

Characterization of the Conjugates

After observing the UVn/Vis absorbance, the conjugates were further assayed for binding to

target Ramos cells using competition assays. All cell lines were washed with binding buffer

prior to competition assays, and were then incubated with 250nM of FITC-labeled TD05 at 4 C

for 20 minutes. After incubation, the cells were washed to remove the unbound probe. Binding of

FITC-TD05 was analyzed by flow cytometry to obtain the maximum binding. For competition

assay, cells were incubated with equimolor mixtures of FITC-TD05 and Ce6-TD05 for 20

minutes at 4 C. After equilibration, cells were washed to remove the unbound probe and

analyzed for the binding with flow cytometry counting 10000 events.









Detection of singlet oxygen generation was done by using a commercially available singlet

oxygen sensor green reagent (Invtirogen). Fluorescent measurements were made using

excitation/emission 488/525 nm. A solution of 1CIM of sensor green reagent was irradiated for 20

sec, and a 10 CIM of either free Ce6 or TD05-Ce6 was added and increase in the fluorescence

intensity was monitored as a function of time.

Fluorescence Imaging.

All cellular fluorescent images were collected using a confocal microscope setup

consisting of an Olympus IX-81 automated fluorescence microscope with a Fluoview 500

confocal scanning unit. The Ce6 dye conjugates were excited at 633nm and the emission was

collected at 660nm. Images were taken after a five to ten second period during which the

instrument was focused to yield the highest intensity from the fluorescence channel. Bright spots

observed in the images of the control and the target cells are corresponding to the dead cells.

Images were taken using the same gain however; image processing software was adjusted to

obtain the maximum fluorescent intensity for the control cells.

Flow Cytometry

Fluorescence measurements were also made using a FACScan cytometer (Becton

Dickinson Immunocytometry Systems, San Jose, CA) counting 10000 events. Cell experiments

were performed using a final volume of 300 CLL.

In2 Vitro Photolysis

Ramos cells (50,000) and equal number of control cell lines were washed with the cold

binding buffer in 500C1L and subsequently incubated with 250nM of TD05-Ce6 probe at 4oC for

20 min, cells were then washed with 1 mL of wash buffer by centrifuging at 950rpm, exposed to

white fluorescent light (fluence rate = 2.8Jminl ) for 4 hours, and then re-cultured in RPMI-










1640 for 36 hours. The cell viability was determined by propidium iodide incorporation

(Invitrogen). Experiments were repeated three times, each time in triplicate.

Results and Discussion

Results presented in previous chapters show that the aptamer TD05 binds selectively to

Ramos cells. Subsequently, we found that aptamer TD05 binds with membrane bound IGHM, a

known marker for Burkitt' s lymphoma cells. As shown in Figure 4-2, FITC-labeled TD05

aptamer selectively binds to Ramos cells, but not with other leukemia cells.




Ramos


SHL-60















Flor~esence Intensityr

Figure 4-2. Aptamer TD05-FITC binding to different leukemia cells. Higher fluorescence
intensity observed for Ramos cells is an indication that aptamer FITC-TD05 selectively
binds to Ramos cells.

Therefore, we hypothesized that aptamer TD05 could be used for selective destruction of

Ramos cells by conjugating to a photosensitizer followed by illumination of light. Use of

aptamers in selective targeting of one specific tumor will effectively localize the PS on the cell

membrane prior to illumination of light, thus increasing the therapeutic efficacy and selectivity

of the PS.










Conjugation of DNA with the photosensitizer Ce6 solves several problems associated with
PSs.

Conjugation of negatively charged DNA with Ce6 increases the aqueous
solubility of Ce6, and makes it more useful for in vivo applications.

The DNA aptamer has the targeting ability to localize the photosensitizer on the
tumor membrane.

Since PS absorbs near in the IR, these probes can also be used as imaging agents.

Conjugation of Ce6 with Amine Modified Aptamer TD05

First, amine-modified TD05 aptamer was chemically conjugated to Ce6 by reaction with the

N-hydroxysuccinamide ester (NHS) of Ce6, using dicyclohexyl carbodiimide (DCC) as a

coupling agent as shown is Figure 4-3.


Figure 4-3. Reaction of conjugation of chlorin e6 with an amine modified TD05 aptamer probe.


U-HydroxrySUccinamide


Dicyclohexyl Carbadilmirde










Characterization of Aptamer TD05-Ce6 Conjugates

Since Ce6 molecules show characteristic absorption bands at 404nm and 643nm,

Ce6/DNA conjugates should show an absorbance maximum corresponding to Ce6 as well as

DNA. Therefore, to confirm the conjugation of TD05 with Ce6, the purified aptamer TD05-Ce6

conjugate was characterized by observing the absorbance at 260 nm for DNA, and at 404nm, and

643nm for Ce6. As shown in Figure 4-4, the conjugates indeed show absorbance at the expected

wavelengths, suggesting that the Ce6 has been conjugated with amine modified DNA. After

verifying the conjugation of Ce6 with DNA, we next investigated whether Ce6 can still act as an

efficient reactive singlet oxygen generator. This was necessary because interactions between the

electronic states of the dye chromophores and nucleic acids bases can lead to fluorescence

quenching.



0.0 TD05-Ce6 Conjugate
Free Ce6 Dye


0.20-






0.00 -
300 400 500 600 700
Wavelength (nrn)




Figure 4-4. UV-Vis absorption of Ce6 conjugated with DNA. The observed absorbance at
260nm is characteristic for DNA and absorbance at 404 nm and 643 nm are characteristic
of Ce6 molecules.

Since Ce6 is a near-IR dye, it could possibly be Ce6 could be quenched by DNA bases

making the Ce6 less efficient as a photosensitizer. Therefore, the effectiveness of Ce6 was










evaluated using a commercially available singlet oxygen detection kit, which contains a reduced

version of FITC dye. The dye shows no fluorescence until it is oxidized by singlet oxygen.

Therefore, in the presence of reduced sensor dye, the increase in the fluorescence signal with

irradiation of Ce6 dye is proportional to the amount of singlet oxygen generated in solution.

Figure 4-5 compares the results for free Ce6 with TD05-Ce6 conjugates. Conjugation with

aptamer TD05 did not result in significant decrease in the sensor fluorescence, indicating that the

photosensitizing properties of Ce6 were not lost. The observed slight decrease in the

fluorescence signal with dye could be explained in terms photo bleaching effect with prolong

irradiation. Next, it was necessary to evaluate whether conjugation has affected the specific

binding of TD05 aptamer to Ramos cells. Since Ce6 is extremely hydrophobic, it can non-

specifically accumulate on the membrane, thus decreasing the specificity.

4150000-
tTD5-Ce6



100000 -

5 00000 -I



-500DD0 5 0 50 20 2 0 5


Time (Sec)

Figure 4-5. Singlet oxygen generation ability of free Ce6 dye and Ce6 conjugated to aptamer
TD05.The singlet oxygen generation was measured using fluorescence enhancement of
sensor green, which is a reduced form of the FITC dye.

Figure 4-6 shows the flow cytometric results for an in vitro binding study using FITC

labeled TD05 by itself and an equimolar mixture of FITC-TD05 and Ce6-TD05. When Ce6-

TD05 is present the fluorescence due to FITC-TD05 decreases to about 50% of its original value,

showing that TD05-Ce6 recognizes Ramos cells with selectivities similar to that of FITC-TD05.










Binding of TD05-Ce6 to Ramos cells was also visualized using confocal microscopy. As

shown in Figure 4-7 fluorescence from Ce6 was significantly higher in the presence of Ramos

cells as compared to control CEM-CCRF cells, indicating that the TD05-Ce6 conjugates retain

the selectivity for Ramos cells.

Investigation of Toxicity of Aptamer TD05-Ce6 Conjugates

We next evaluated whether TD05-Ce6 can selectively kill Ramos cells upon illumination

of light. Ramos cells were used as the target cells, with CEM, K562, HL-60, and NB-4, which

do not express IGHM, as the control cells. All the experiments were conducted in the dark to

minimize the photo-bleaching of the PSs. Cells were incubated with 250nM of TD05-Ce6

conjugate in the dark at 4oC for 30 min. Since the KD for TD05 is 75nM,84 Slightly more than

75nM TD05-Ce6 was used to ensure the cells with IGHM were properly stained. A washing

step prior to illumination ensured the removal of unbound probe to decrease the non-specific

killing and to mimic higher clearance of unbound molecules from the body in the background

tissues.



N Control Sequence
-- 1TDOSflTC : 1 TDO5-Ce6
TDO5-FITC












100 b 10' 1 1963 10P
Floorescence latensity
Figure 4-6. Binding of aptamer TD05-Ce6 conjugate. Competitive binding of aptamer TD05
with Ramos cells before and after Ce 6 conjugation.




























Figure 4-7. Fluorescence confocal images. (A) TD05-Ce6 bound to the cell membranes of
target Ramos cells. (B) Control CEM cells which do not show binding. Higher
fluorescence signal observed on the membrane periphery is an indication of aptamer
TD05-Ce6 conjugates binding to Ramos cells. On the other hand, CEM cells showed
only a background fluorescence intensity suggesting that TD05-Ce6 conjugates do not
bind.

Since Ce6 molecules absorb long-wavelength of radiation, a commercially available

fluorescence bulb was used (fluence rate = 2.8 mJ/min, and for 4 hours). Because the toxicity

induced by PSs leads to slow killing of the cells, the exposed cells were re-cultured in the fresh

media.

Cell viability was determined 36 hours after illumination by propidium iodide

incorporation using flow cytometry counting 10,000 events. Propidium iodide (PI) is a DNA-

intercalating dye, which cannot pass through the healthy cell membrane. When the cell

membrane is damaged by reactive oxygen species, the dye is able to diffuse into the nucleus and

intercalate into the genomic DNA, resulting in increased fluorescence. Therefore, by monitoring

the fluorescence of the PI treated cells, the toxicity can be assayed.

The results of the toxicity study are shown in Figure 4-8. The heights of the bars gave the

percent cell viability with 100% corresponding to cells without any added aptamer or free Ce6.










Thus, the efficacy of the treatment is indicated by a decrease in bar height. Clearly, the TD05-

Ce6 conjugates markedly decreased cell viability (71.3% + 6.9% decrease) as shown in Figure 4-

8. The toxicities observed in control CEM (35.8% + 7.4), K562 (30% + 3. 37), NB4 (36.4 &

7.09), and HL60 (<1%) cells are over 50% less than toxicity for the targeted cell lines. This

suggests that the specific interaction of TD05-Ce6 on the cell membrane can induce selective cell

death. The slight toxicity of aptamer photosenstizer conjugate toward the CCRF-CEM, K-562,

and NB-4 could be due to non-specific interactions with the cell membrane. While unconjugated

Ce6 is insoluble in aqueous media, the conjugation of the DNA aptamer with Ce6 dramatically

increases its aqueous solubility, resulting in an increased interaction of the hydrophobic portion

of Ce6 with the cell membrane.


140

120 Cellsonly
SAptamrer
T H Aptarner-Ce5
100 Free Ce5









40


Ramos CEM K-562 NB-4 HL-60

Figure 4-8. Cell toxicity of aptamer TD05-Ce6 treated cells. Ramos cells after 30 min
incubation at 4oC. After removing the unbound probes, each sample was irradiated with
light for 4 hours, and subsequently grown in fresh media for 36 hours. After 36 hours,
cells were analyzed by monitoring the fluorescence enhancement resulted from PI
incorporation into the genomic DNA of the dead cells.

Referring to Figure 4-8, the free aptamer without Ce6 and the free Ce6 samples did not

show significant toxicities. The toxicity clearly demonstrates the feasibility of aptamer-PS










conjugates in effectively destroying cells that interact selectively with TD05-Ce6. Removal of

the unbound TD05-Ce6 after incubation prevents the aptamer conjugates or free drug conjugates

from entering into the cells, and it removes any nonspecifie binding. Taken together it is

suggestive that the interaction of TD05-Ce6 on the cell membrane is specific and can induce

selective cell death.

We next investigated the possibility of toxic effects could be due to the interaction of

aptamer TD05-Ce6 conjugates with its target protein but not due to toxicity generated by

irradiation of the PS. Figure 4-9 shows percentage cells viability without irradiation. As

anticipated, the un-irradiated samples did not show any significant decrease in viability,

indicating aptamer TD05-Ce6 conjugate is not toxic in the absence of light. To further

demonstrate the specifieity of the method, separate control experiments using a random DNA

sequence attached to the Ce6 dye were performed. Because a random sequence does not bind to

Ramos cells, the irradiated random DNA sequence attached to Ce6 dye should not lead to any

toxicity towards Ramos cells.


120

100 -l Cells only
I I IA Aptsamer-Ce5
so Frlee Ce6






20
CEIV Rams

Figure 4-9. Cell viability observed for CEM and Ramos cells with no irradiation of light. Cells
were incubated with APS conjugate and free Ce6 in the dark. Following the washing
step, cells were grown for 36 hours prior to toxicity analysis using PI incorporation.










As shown in Figure 4-10, the random DNA labeled with Ce6 did not show any toxicity

towards Ramos cells, however, 26% + 2.15% decrease in cell viability was observed for CEM

cells. This could be due to non-specific interaction of DNA attached to Ce6 with the CEM cell

membrane.


12o 5Cell~only a Ran~domsequence-Ce6





2o-




20

NB-4 HL-60 K562 CEIV Ramas



Figure 4-10. Observed cell viability for HL-60, NB-4, K562, CEM and Ramos cells with Ce6
attached to a random DNA sequence.

Photoactive therapy has great potential in cancer treatment, but administration of

photoactive drugs for extended periods is usually not feasible. For this reason, conjugation of a

photosensitizer with a probe that can be localized at the tumor site will enhance the therapeutic

effectiveness. Here, we have exploited the specific recognition capability of DNA aptamers

evolved using live cells along with ability of chemical manipulation of DNA to effectively target

one type of cells. Covalent attachment of PS to aptamer provides stability in the cellular

environment. The small size of the aptamer -PS conjugate facilitates tissue penetration for

treatment of solid tumors. Problems with the stability of aptamers could be addressed by

incorporating unnatural nucleic acids at the pre-defined sites in the aptamer to increase resistance

to nuclease degradation.









CHAPTER 5
APTAMER EVOLVED FROM CELL-SELEX AS AN EFFECTIVE PLATFORM FOR DRUG
RELEASE

The previous chapter showed that aptamers can be used as carriers to deliver type II PSs to

the tumor surface.173 However, a further increase in selectivity is still necessary to prevent the

damage to the surrounding tissues caused by singlet oxygen. Patients who go through PDT

treatments are often required to avoid sunlight for several weeks to months following the

treatments due to the accumulation of the photosensitizer (PS) in the surrounding tissues.171' 174

One way to address this issue is by exploiting the photochemical and photophysical

properties of PSs themselves. For example, it has been shown that the photosensitizing ability

and the fluorescence emission of a PS can be successfully quenched by utilizing FRET

(Fluorescence Energy Resonance Transfer) with fluorescence quenchers." Zheng et.al. and

others demonstrated this principle by engineering a photodynamic molecular beacon, in which a

quencher carefully positioned close to a PS using a polypeptide linker to effectively quenches

ROS generation and fluorescence.175, 176 The FRET quenching mechanism depends strongly on

the proximity of the PS and the quencher. When the PS-peptide-quencher conjugate reaches the

tumor environment, tumor specific proteases cleave the peptide and release the quencher from

close proximity to the PS. The PS remains in contact with the tumor and upon irradiation at the

appropriate wavelength the PS produces fluorescence and cytotoxic singlet oxygen. Choi et al.

177 later demonstrated the feasibility of quenching of the photosensitizing ability of the PSs in

xenografted tumor models using polylysine conjugates, followed by protease cleavage to restore

toxicity. While the idea of specific peptides targeted by proteases secreted at the tumor

environment is attractive, this method suffers from lack specifieity of the peptide. In addition,

peptide and small molecule conjugation chemistry is not straight forward and the structural

rigidity required for efficient quenching of PS and quenchers is limited in peptides.









In the following sections, we introduce an aptamer-based prodrug therapy which takes

advantage of the ability of aptamers to selectively target tumor cells. The pro-drug utilizes a

FRET-based PS quenching mechanism, and a DNA template-assisted disulfide bond reduction

has been introduced to activate the pro-drug.

DNA Directed Functional Group Transfer Reactions

Liu et al. m7 introduced DNA Template based functional Group Transfer Reactions

(DTGTR) in 2000. These reactions have proven to be effective in generating precise, well

controlled reaction products.

a) Reactant for DTS

oligonucleotide ratv r



b) Hybridization bri ngs reacta nts A a nd B i nto close proxi mity


H ~i~lllll il10 -------+ Illlllllllllll4

Figure 5-1. DNA Template based Functional Group Transfer Reactions. (a). Oligonucleotide is
linked to a reactive group through a linker. (b). Hybridization of complementary
oligonucleotides brings A and B closer together with their most favorable orientations
and for higher rates of reaction.

Figure 5-1 shows one type of DTGTR scheme. The reactants are linked to two

complementary DNA strands. Hybridization of the two complementary DNA templates brings

the reactants close together and orients them properly for reaction, resulting in higher reaction

rates at low concentrations. These orientations also increase the probability of generating the

desired product with minimal side product formation. Therefore, we hypothesized that the

targeting ability of aptamers and the kinetic advantages of DTGTR could be combined to create

a platform that triggers drug release.









Utilization of DTGTR as a drug delivery method has already been demonstrated. For

example, Ma and Taylor's nucleicc acids-triggered catalytic drug release" took advantage of

positioning two reactants in close proximity.17 This study focused mainly on targeting mRNA

expression to trigger drug release. The authors linked an imidazole to a DNA nucleotide and a p-

nitrophenol group to a complementary DNA strand via an ester bond. Hybridization of the DNA

strands brought the ester group close to the imidazole, facilitating base hydrolysis of the ester to

generate free p-nitrophenol. Iso

Alternatively, DNA aptamers can be attractive agents in applying drug delivery platforms

via DTGTR. Apart from clinical advantages of DNA aptamers, one of the inherent properties of

DNA is its structural rigidity, which can be manipulated to engineer PS/quencher pairs with

increased quenching efficiency, as well as higher rates in release of the quencher by DTGTR.

By combining suppression of the photosensitizing effect by the quencher, selective bond

breakage by DTGTR and tumor recognition ability by the aptamer, we have designed a DTGTR

based-aptamer complex to trigger the release of drug candidates at the tumor surface. Since

aptamer Sgc8 evolved from cell-SELEX shows preferential binding to T cell lymphoma CEM

cells,85,90 we hypothesized that the aptamers can be used as a platform to deliver drug candidates

to the CEM cells.

As shown in Figure 5-2, the newly designed aptamer template has three characteristics:

1. Tumor recognition ability from the aptamer

2. DNA platform for prodrug hybridization

3. Activator to release the drug by DTGTR.

The "prodrug" is composed of a DNA sequence complementary to an aptamer platform having

closely positioned fluorophore and quencher. Until the prodrug reaches the tumor environment

and hybridizes with the platform, fluorescence is quenched. Hybridization of the pro-drug with








platform allows the activator to react with the pro-drug to release the quencher and restore
fluorescence .


i-~
iC: 7


? Activator
SQuenched fluorophore / PS

~rAptamer recognition element


I Quencher



j Platform


Figure 5-2. Aptamer-based DTGTR as a tool for drug release. The prodrug contains a
fluorophore, which is quenched due to FRET. Upon hybridization with the platform,
activator (DTT molecule) cleaves the disulfide linker between the quencher and the
fluorophore, and the fluorescence is restored.
Methods and Materials
DNA Synthesis and Purification
Aptamer Sgc8 modified with reaction template and non-specific control DNA was
synthesized at the lumole scale using standard phosphoimidite chemistry and was purified using
reversed phase HPLC. An ABI3400 DNA/RNA synthesizer (Applied Biosystems, Foster City,
CA) was used for the synthesis of all DNA sequences. Table 5-1 shows all the sequences used in
this study. For internal labeling either FITC-dT or 5-NH2-dT was used. For 3' end labeling
either dabsyl-Controlled Pore Glass (CPG) or black-hole quencher 2 CPG (BHQ2-CPG) was


I)
C- 3


I
L









used. Dithiol phosphoamidite (DTPA) was used at the 5' end as the activator. A ProStar HPLC

(Varian, Walnut Creek, CA) with a C18 column (Econosil, Su, 250 x 4.6 mm) from Alltech

(Deerfield, IL) was used to purify all fabricated DNA. A Cary Bio-300 UV spectrometer

(Varian, Walnut Creek, CA) was used to measure the absorbance to quantify the manufactured

sequences. The completed sequences were then deprotected in concentrated ammonium

hydroxide at 650 C overnight and further purified with reverse phase high-pressure liquid

chromatography (HPLC) on a C-18 column.

Fluorescence Measurements

Fluorescence measurements were performed on a Fluorolog-Tau-3 spectrofluorometer

(Jobin Yvon, Inc., Edison, NJ) (37 + 0.1) oC using a 100-11L cuvette. After adding the cDNA-

DTT probe, the resulting fluorescence intensity of the PBFSSD was monitored by exciting the

sample (FAM label) at 488 nm and measuring the emission at 505 nm. Bandwidth for both the

excitation and the emission were set at 10 nm. Corrections were also made for potential dilution

factors in the titration experiments.

Cell line and Reaction Conditions

CRF-CEM (CCL-119, T cell line, human_ALL) cells were obtained from American Type

Culture Collection. The optimum reaction buffer was 0. 1M Na3PO4 at pH=8.01. All reactions

were performed at 37oC for 2 hours. Briefly, probe and the prodrug in appropriate ratios was

incubated with 50,000 cells for 2 hours. Upon completion of the reactions, the mixture was

immediately cooled to 4oC and 350C1L of cell binding buffer (4.5 g/L glucose and 5 mM MgCl2

in Dulbecco's PBS with calcium chloride and magnesium chloride; Sigma), yeast tRNA 0. 1

mg/ml; (Sigma) and Img/mL sheared salmon sperm DNA was added prior to flow cytometric

analysis. The data were analyzed by obtaining the mean fluorescence signal of the histogram for

each sample.









Table 5-1. Sequence of DTS reactions. DTT refers to DTPA D refers to DabsyldT, F refers to
FITCdT, 6 refers disulfide phosphoamidite, C3 refers to carbon-3 spacer
phosphoamidite, N refers to Dabsyl-CPG.
Name Sequence
PBC3DTT DTT-C3-GA TGG TGC GGA GCC
PBF SSD GGC TCC GCA CCA F C6 TN
Sgc8Tem-C3DTT DTT-C3-GAT GGT GCG GAG CCA TCT AAC TGC TGC GCC
GCC GGG AAA ATA CTG TAC GGT TAG A
Sgc8RTem-C3DTT DTT-C3-NNN NNN NNN NNN NNA TCT AAC TGC TGC GCC
GCC GGG AAA ATA CTG TAC GGT TAG A
Sgc8Random NNN NNN NNN NNN NNA TCT AAC TGC TGC GCC GCC GGG
AAA ATA CTG TAC GGT TAG A
Sgc8Tem GAT GGT GCG GAG CCA TCT AAC TGC TGC GCC GCC GGG
AAA ATA CTG TAC GGT TAG A

Results and Discussion

Probe Design and Mechanism of Activation

Aptamer Sgc8 was chosen for this study because of its high affinity for CEM-CCRF

cells."' A platform sequence consisting of 14 DNA bases was linked to dithiol phosphoamidite

at the 5'end. Reduction of dithiol phosphoamidite generates dithiothreitol (Cleavlan's reagents,

DTT) to act as the DTGTR activator. For the DNA based prodrug a quencher and either a

fluorophore or a photosensitizer were linked via a S-S linkage to the DNA that is complementary

to the platform sequence. The basic hypothesis is that, upon hybridization of the prodrug with

the cDNA platform, the DTT group aligns with the disulfide group and cleaves the disulfide

linker to the quencher, thus restoring fluorescence. The mechanism of DTT mediated disulfide

cleavage is outlined in Figure 5-3. The FRET probe was aided in proving the concept of

DTGTR. A 14 mer sequence was aligned incorporating a FRET pair to monitor the reduction of

the disulfide linker between a Dabsyl quencher and an FITC fluorophore as shown in Figure 5-3.

Initially, the fluorescence restoration was investigated using large excess of free DTT, and

fluorescence signal was monitored.















GAT OGT GCG GAG A 3~
CTA CCA CGC CTCT S


GAT GGT GCG GAG C _/-1
CT CA GCCT T

"""""~~-H


'


CITA TCCA COC ~CTC g


SDabcyl


Quenched FAM


Unquenched F TC


Figure 5-3. Mechanism of fluorescence restoration of the hypothetical pro-drug upon reduction
of disulfide linker. The prodrug contains a 14 mer DNA sequence modified with a
FITC fluorophore and linked to a Dabsyl quencher through a disulfide bridge. The
activator platform contains a 14 mer complementary sequence attached to a DTT
molecule. Upon hybridization of prodrug with the platform, the DTT group comes
into the close proximity of the disulfide linker. DTT molecule cleaves the disulfide
linker, releasing the quencher and restoring fluorescence.









As shown is Figure 5-4, upon addition of free DTT, the fluorescence signal increased

within 1 hour reaction time, confirming the positioning of the FITC and Dabsyl. Following the

confirmation of the synthetic product of PBF SSD, we investigated whether DTT bonded to the

platform can also rapidly reduce the disulfide bond. The fluorescence signal enhancement was

monitored by adding equal amounts of PB-C3DTT and free DTT respectively, to two prodrug

samples. As shown in Figure 5-5, when PB-C3DTT was used, the increased local concentration

of DTT due to DNA hybridization enhanced the rates of fluorescence restoration compared to

free DTT.







II 250nM PBFSSDI + Buffer

12 250nM PBFSSD + 5mM free D;TT








Figure 5-4. Verification of de-quenching effect upon reduction of disulfide link. Increase in
fluorescence signal with free DTT indicates that fluorescence can be restored by
cleaving disulfide link to remove the quencher.

Investigation of Quencher Release Using Aptamer Sgc8tem-C3-DTT on the CEM Cells

Following the preliminary work with a short DNA sequence, the feasibility of applying the

same prodrug on a cell membrane was investigated. In doing so, Sgc8 aptamer targeted to CEM-

CCRF cells was modified with DTT via the platform and a 3-carbon spacer as shown in Figure

5-6. Introduction of the 3-carbon spacer increased the flexibility and free rotation, thus,

minimized steric effects caused by the large fluorophore and quencher pairs.














-- 250nMA PBFSSD + 250nM PBC3DTT
250nM PBFSSD + 250nM free DTT
1.2 -1 ---*---- 250nM PBFSSD












S0.8-


0.7-



0 1000 2000 3000 4000 5000 6000
time (see)



Figure 5-5. Restored fluorescence upon addition of PB-C3-DTT to PBFSSD. When PB-tem-
c3DTT was added at 1200s, the fluorescence signal increased, confirming the
reduction of the disulfide bond due increased local concentration. When an equal total
concentration of free DTT was added, the fluorescence did not increase.

Since the aptamer and target cell interaction depends on the unique three dimensional

folding of the aptamer, it is possible that the aptamer binding would be affected by introducing

additional bases at the 3' or 5' end. The secondary structure predicted by m-fold for Sgc8

aptamer is a hair pin, as shown in Figure 5-6-A. Theoretically, addition of 14 additional bases at

the 5' end and subsequent hybridization to the pro-drug should further stabilize the hair-pin

structure. However, it is also arguable that the DNA aptamer can refold when the extra bases are

added.































I


O-=


HS~p


N


Figure 5-6. Aptamer -platform and hypothetical prodrug. Aptamer consists of three key
elements: (A) Tumor recognition element, (B) Reaction platform, (C) Activator
molecule (DTT). (D) The hypothetical prodrug consists of cDNA to hybridize with
the platform. The mechanism of cleavage of the disulfide linker is shown in Figure 5-









Therefore, in order to investigate specific binding of the aptamer when modified, a competition

assay was performed by introducing excess modified aptamer to cells bound to the unmodified

aptamer Sgc8 labeled with FITC. As shown in Figure 5-7, the fluorescence intensity of FITC-

Sgc8 decreased, indicating that FITC-Sgc8 was displaced from the cell membranes by the

modified Sgc8 and verifying that the modified-Sgc8 retains its binding ability. We next

investigated whether the restored fluorescence on the cell membrane upon disulfide reduction

can be detected using flow cytometry. A 250nM sample of PBFSSD along with aptamer

Sgc8tem was incubated with 3000 fold excess of free DTT to allow complete reduction of the

disulfide bond. Upon completion of the reaction, the reduced probe was incubated with CEM

cells and the restored fluorescence on CEM cells was analyzed using the flow cytometry. As

shown Figure 5-8, the fluorescence intensity for the cells with DTT treated probe was increased

compared to the cells with untreated probe, indicating that fluorescence restoration can be

detected on the cell membrane.

Next, we investigated whether Sgc8tem-C3-DTT probe can also reduce the disulfide bond

on the cell membrane. The CEM cells were incubated with (1) 30-fold excess of Sgc8tem-C3-

DTT and PBFSSD, (2) the positive control (3000-fold excess of free DTT), and (3) the negative

control (nothing but the PBFSSD, Sgc8temC3) to investigate the reaction. After 2 hours of

reaction at 37oC, the restored FITC fluorescence on the cell membrane was monitored using flow

cytometry. The heights of the bars give the mean fluorescence intensity observed in the

histogram for each reaction. All reactions were done in triplicate. As shown in Figure 5-9, a 30-

fold excess of aptamer Sgc8tem-C3-DTT reduces the disulfide linker, whereas a 3000-fold

excess of free DTT is needed to achieve the same fluorescence enhancement, demonstrating the

effective cleavage by increased local concentration.












-- 250nMN Random sequence-FITC;
-- 2501nMA SgeB-PI"TC
250ZSnMU SgeI-FITC : Excess of Sgc8Tem
-~ 250)nM 5gcB-FITC : Excess of agce-Random


11? 102 1(P 10
Flnorescence In~tensityF


Figure 5-7. Binding of Sgc8tem with CEM cells. The fluorescence intensity of aptamer Sgc8-
FITC decreases in the presence of a 10-fold excess of Sgc8tem and Sgc8-Random
indicating that Sgc8 binding is retained after attachment of additional bases at the 5'
end.


-250 nM PB;FSSD + 250B nM SgeSCSTem
-250 nMn PBFSSD [with excess DTT) + 250 nM SgaSCSTem


Fluores~cernce Intensityj

Figure 5-8. Flow cytometric results for DTT treated PBFSSD on CCRF-CEM cells. The cells
were treated with equal concentrations of PBFSSD and Sgc8tem with and without
excess DTT at 37oC. The increase in the fluorescence indicates that PBFSSD was
cleaved by excess DTT.


100 101 102 10* 104













25~










Backrground 1:3000X 1:30X

111111250nM PBF~SSD + 7.5uM Sgc8-Te~m

II 250nI FPBF%5D + 7.5uM lS~cgc-Temn + 7.5 mMu free DTT
2 50 nM PB FSD + 7.5 uMN 5g~c-Te m-C3-DTT


Figure 5-9. Reduction abilities of free DTT and DTT attached to DNA aptamer template. Each
probe was incubated in the reaction buffer with CEM-CCRF cells. After 2 hours, the
restored fluorescence was analyzed using flow cytometry.

Next, ratios of Sgc8Tem-C3DTT to PBFSSD (250nM) were varied 5, 10 and 30 to

determine the minimum ratio of Sgc8Tem-C3DTT needed to achieve the highest fluorescence

restoration. Addition of excess template shifts the equilibrium to the bound state allowing the

entire PBFSSD to be hybridized with Sgc8Tem-C3DTT template. According to the Figure 5-10,

free DTT fails to reduce the disulfide linker at any of these ratios, but as the concentration of

Sgc8Tem-C3DTT increases the amount of sulfide reduction increases by the same factor.

Then the specificity of disulfide cleavage was investigated using a random template

bound to DTT via a 3-carbon linker. As shown in Figure 5-11, the Sgc8-Random-tem-C3DTT,

does not increase the fluorescence intensity, indicating that the disulfide linkage is not cleaved

without DNA hybridization and that the template mediated disulfide reduction using DTT

attached to the aptamer platform is specific.


























With agc8Tem-C3 DTT


With free DTT


S0.


SB~ackground
1:10


Figure 5-10. Disulfide bond reduction ofPBFSSD using DTT bound to aptamer platform and
free DTT. Respective ratios of Sgc8c3tem/DTT incubated with 250nM PBFSSD in
binding buffer and with CEM-CCRF cells for 2 hours at 37oC. Following 2 hours
incubations, restored fluorescence was detected using flow cytometry.


1:10


1:20


m 50nMu PBFSSD + SgcBTemn+ Free D'YF
m 250nMr PBFSSD+ Sge8-R-Temr-C3D'YF
250nM PBFSSD + SgcBTem-C3 D'Y


Figure 5-11. Specificity of disulfide bond reduction by DTT attached to Sgc8-tem-c3DTT.
Sgc8-sequence with random DNA template linked to DTT (Sgc8-R-Tem-C3DTT)
failed to reduce the disulfide bond.


S1:20
1:30









In conclusion, a new model of drug delivery utilizing DTGTR has been demonstrated.

Based on the observed results using FITC-Dabsyl pair, we have shown a proof-of-concept for

PS/quencher based pro-drugs. The ability of aptamer to specifically recognize a target cell line,

followed by the drug activation mechanism could be utilized in precise control and delivery of

PS based prodrugs in exact tumor locations.









CHAPTER 6
SUMMARY AND FUTURE WORK

Summary of Inz vitro Selection of Aptamer Targeting PKC5

This dissertation demonstrated the versatility of aptamers for variety applications: selective

binding to a predetermined protein, recognition of a biomarker on tumor cell membranes,

localization of a photosensitizer for photodynamic therapy, and localization of a prodrug for

controlled PDT.

The initial phase of the research (Chapter two) focused on the selection of an aptamer for a

single protein using CE-SELEX. The selected aptamer was modified with a fluorophore to

detect PKCG. The aptamer showed reasonable specificity for PKCS compared to PKCoc and

PKCop. While CE-SELEX showed high separation efficiencies when a larger protein (IgE,

115kDa) was used73, the separation efficiency was low for the much smaller PKCS (90 kDa).

This is mainly because of the overlap of the broad free-DNA peaks and the small difference in

electrophoretic mobility when the aptamer binds to a single protein. Therefore, the maj or

drawback of CE-SELEX for small target proteins leads to the selection of aptamers with poor

affinities. To address this problem, the combination of gel electrophoresis or other conventional

SELEX procedure along with CE may be useful.

Biomarker Discovery

The work described in Chapter 3 involved the identification of a biomarker using

aptamers generated against Ramos cells. This was accomplished by taking advantage of the

ability of easy chemical modification of DNA. Discovery of the biomarker demonstrated the

capability of aptamers selected using cell-SELEX to recognize Ramos cell specific protein

(IGHM) and to systematic identification of proteins that are significantly expressed in a cancer

cell.









Recent advances including the results of this work in aptamer selection and the ability to

target whole cells have led to investigation of applicability of aptamers as molecular probes in

disease recognition and therapy. Based on these examples, the feasibility and the promise in

cancer therapy using aptamers are becoming much more realistic and significant. As described

in this research, an important advantage of this approach is that, aptamer selection is done with

no prior knowledge of the protein expression patterns of a given cell. Subsequent identification

of interacting proteins on these cell membranes can lead to the discovery of new biomarkers,

thus forming a solid molecular foundation for molecular medicine. However, the current

approach of aptamer selection needs to be more refined in terms of selection efficiency as well as

methods of protein identification. With the advances in the Hields of molecular probe

engineering, nanotechnology, imaging instrumentation aptamers can be highly efficient

molecular probes for cancer and other significant diseases. In summary, using aptamers as

molecular probes can enable highly effective molecular imaging and proofing of diseases.

Summary of Targeted Therapy Study

Chapter 4, we demonstrated that aptamers selected for specific recognition of a marker

protein can be used as a drug carrier, in particular a photosensitizer for the destruction of Ramos

cells. This demonstrated ability of aptamers to target tumors with high selectivity makes

targeted therapy possible in a number of "pretargeting" strategies. Moreover, aptamers do not

induce immunogenic reactions, and are effective in penetrating the solid tumors. Due to the easy

chemical manipulation, aptamers can readily be modified with functional groups making them

attractive in bio-conjugations. For example, we have demonstrated the feasibility of conjugation

of an aptamer for Ramos cells with photosensitizers. Despite the many advantages of aptamer,

their broader use in animal models needs to be investigated and potential problems in in vivo

applications needs to be addressed.ls









The investigation of aptamers-based drug carriers was extended in Chapter 5. To avoid

undesirable effects associated with photosensitizers, as a proof-of-concept we demonstrated PS

can be delivered to CCRF-CEM cells in an inactive form using the FRET principle to a nearby

quencher. After localization on the cell membrane, the PS was activated by a template-based

bond cleavage reaction to remove the quencher and restore fluorescence. This pro-drug design

clearly demonstrated that targeted therapies can be controlled for optimum drug release.

Future Work

Aptamers with Increased Nuclease Stability

This work has demonstrated some of the advantages of aptamers as therapeutic carriers,

but challenges of applying aptamers in vivo studies are their instability in the serum. Since they

consist of nucleic acids, aptamers can readily be digested by nucleases and cleared from the

body. For example, unmodified antisense oligonucleotide has a half life in serum of less than a

minute; 182 and, an unmodified aptamer against thrombin has shown significantly low half-

lives.182 For this reason, the future of aptamers as therapeutic carriers relies mainly on the

introduction chemical functionalities that can resist the nuclease degradation. Modification of

the DNA backbone, as well as introduction of non-natural bases into the DNA sequence, have

been demonstrated to be effective in this regard.183 For example, substitution of 2'-hydroxy

group of the ribose moiety of an RNA aptamer by a fluorine or amino group increased the

stability of the aptamer by several orders of magnitudel84. Another strategy exploited

phosphorothioate-modified aptamers for targeting at an immune receptor on T cells in vitro and

in vivo.183 Floege, J. et al. substituted the 2' position of the sugar ring of a PDGF aptamer with

O-methyl- or fluoro- groups and replaced the non-binding portions of the aptamer sequence with

hexaethylene glycol spacers. They observed a much longer half-life in serum and the binding

affinity of the aptamer for PDGF was not significantly altered.' External labels have also been









evaluated for increased nuclease-resistance of aptamers.18 It was found that aptamers linked to a

biotin label at the 3'-end showed increased stability in vitro, while a biotin-streptavidin group at

the 3'-end protected the aptamer from nucleases even in vivo. Besides the efforts in post-SELEX

modifications for enhanced aptamer stability, some studies have turned direct use of modified

DNA or RNA bases in the SELEX process.ls Aptamers isolated in this way can have the built-

in ability to resist nuclease digestion.

The first aptamer based FDA approved drug against VEGF-A is currently on market. s

In this aptamer the pyrimidines were modifies at the 2'NH2 position with long poly ethylene

glycol chains to prevent nuclease degradations, and to increase the blood residence-time. s

Table 6-1 summarizes the modifications of unconventional nucleic acid bases that have shown to

demonstrate prolonged lifetimes in real biological samples.

Table 6-1. Different types of chemical modifications, for stabilization of aptamers and for
enhancing pharmacokinetics, immobilization and labeling. s
Functional Gru Position Purps
2'-F or 2'-NH2 HUClCOtides Pyrimidines Protection against endonucleases
.Protection against minor
2'-OMe-nucleotides Pyrimidines and purines noulae

dT-Cap 3'-end Protection against exonucleases

Polyethyleneglycol (PEG) 5'-end Rdcdpam laac
Diacyl glycerol 5'-end Reduced plasma clearance
Biotin 5'-end, 3'-end, other
For Immobilization solid supports or
Primary Amines (-NH2) defined positions attachment to other SA-conjugates
5'-ed ad 3'endNHS-EDC chemistry, introduction of
drug conjugae


Aptamers as Targeting Moiety in Gene Therapy

Apart from PDT, aptamers have a potential as a targeting agents in gene therapy, which

was introduced as a treatment modality for genetic diseases. However, with the developments of

in bio-technology and increased variability of viral vectors, this modality is increasingly popular









in cancer therapy.189 One of the most used vectors in gene therapy is Adeno Associate Virus

vectors (AAV), which is a single stranded DNA parvovirus with a genome of 4700 nucleotides.

189 In the case of cancer treatment AAV was shown to be effective in delivering suicide genes

into the cancer cells. So far, the incorporation of saporin into the virus vectors has been

demonstrated to be effective in inducing cell death in Bl6 melanoma cells.190 A possible

extension of the present work would involve linkage of aptamer Sgc8 to AAV for delivery into

CEM cells. Infection can be monitored using a GFP fused gene along with the suicide gene and

by monitoring the expression of the tag.

Additional Structural Studies of Aptamer Site Recognition

In Chapter 3 we demonstrated a method to identify the protein that in interacting with

aptamer TD05 by covalent crosslinking of the probe, thereby generating a "frozen" aptamer

protein complex. By introducing 13C isotope at the C5 position of the 5-dUI additional

information could be obtained. By observing the location of the isotope covalently crosslinked

with the protein epitope, the interaction site of the protein can be determined. Stable isotope

labeling with deuterium, IO, or 13C, having known ratios with their non-labeled counter parts

allows MS detection of products from the enzymatic digestion based solely on their distinctive

patterns of the isotope peaks. The identification of the epitope of the protein interacting with the

aptamer help scientists to understand the nature of the binding of the aptamer with its protein,

and to modify the aptamer for use as a drug carrier. Figure 6-1 exemplifies the structure of the 5-

iodo deoxy uracil with 13C inCOrporated at the C5 position. When cross-linked with a 13C

labeled base, each amino acid in the corresponding to the peptide fragment will have a higher

m/z based on the degree of crosslinking.

The proposed scheme for the characterization of the binding site of the epitope of the IgM

protein using 13C labeled aptamer is shown below (Figure 6-2). Aptamers containing 13C-labeled









5-iodouridine will be incubated with target cell line. After washing off the unbound aptamers,

aptamer-cell complex can be irradiated with a 308nm excimer laser to induce covalent

crosslinking. After crosslinking, the extra-cellular membrane will be removed using trypsin and

protienase K and subsequently analyzed by LC-MS/MS. By detecting the presence of 5-dUI*

with 13C, the epitope of the protein can be determined.




























OH H

Figure 6-1. Structure of 5-iodo deoxy uridine. (*) position refers to the 13C On the base.





3


m/2


Modified aptamer with 5-iodo uridine with C13


Cross-liked aptamer and protein fragments


1- Binding of aptamer with Ramos cells
2- Photocrosslinking aptamer with membrane
3-Trypticlprotenase K digestion



Figure 6-2. The proposed method for determination of aptamer binding site on IGHM. The
modified aptamer with isotope encoded aptamer probe is cross-linked with the protein.
The extracted tryptic digested peptides will be characterized by LC/MS/MS. By
observing the presence of an isotope on the peptide fragment, the amino acids of the
protein that are bound to the aptamer can be characterized.


2


MSd of th ecroslilnked










APPENDIX
FLOW CYTROMETRIC ANALYSIS OF BINDING OF FLUOROPHORE LABELED
APTAMER WITH CELLS

Chapter 3 5 described the utilization of flow cytometry to evaluate the binding of

fluorophore labeled aptamer with the corresponding cell line. Modern flow cytometers are

capable of analyzing thousands of cells per second by simultaneously obtaining multiple

parameters including front and side scattering as well as signals from one or more fluorophores.

A flow cytometer is similar to a microscope, instead of producing an image of the cell; flow


cytometer offers binding events in a form of a histogram.

Instrumentation



Sheath Fluid
O Detectors






Dichroic Mirrors
Filters
















dataset.









Flow cytometers use the principle of hydrodynamic focusing of cells by a laser (or any

other light excitation source). Figure A-1 illustrates the schematic representation of a flow

cytometer. A suspension of cells is inj ected into a flow cytometer hydrodynamically. The

combined sheath flow is reduced in diameter, forcing each the cell into the center of the stream.

Therefore, flow cytometer detects one cell at a time. As the cells intercept the light source, they

scatter light based on the sizes and shapes. If the cells are stained with a probe tagged with a

fluorophore, the fluoresced light will indicate which cells contain the probe. The scattered or

emitted light from each cell is converted into electric pulses through the photo-multiplier tube

(PMT) detectors.

Data Interpretation

A histogram displays the cell count plotted on the Y-axis (Events) as function of relative

fluorescence intensity of cells on the X axis in log scale. Figure A-2 illustrates a typical

histogram obtained for Ramos cells with no fluorescent tag (average intensity = 7.33) with a

FITC molecule. Binding of FITC-tagged aptamer TD05 shifts the average intensity to 54.4, but

incubation with a labeled random DNA sequence does not cause a signal increase (see Figure A-

3). Using the data for fluorescence tagged aptamer binding and the non-specific DNA sequence;

a threshold value can be introduced. Based on the threshold value and the fluorescence intensity

observed for each binding, a percentage of the cells with fluorescence above the set threshold can

be estimated: 0: <10% +: 10-35%, ++: 35-60%, +++: 60-85%, ++++ : >85%. For example as

illustrated in Figure A-4, point A corresponds to no binding of the probe i.e. fluorescence

detected on the cells are in the background level hence, cells detected below the threshold A are

considered unbound, and equals to <10% of the fluorescence of the aptamer bound cells. The

binding observed for each cell lines above the point A is calculated by the equation A-1.





























Fluorescence Intensity


Figure A-2. Histogram obtained from the flow cytometer. Y axis indicates number of cells
detected in the given experiment, and the X axis indicates the relative fluorescence
intensity detected in each cell. The mean fluorescence intensity for this histogram is
7.33.


1100 101 102 103 104

Fluorescence Intensity


Figure A-3. Histogram obtained to find out the binding of fluorescence tagged aptamer probe.
Red curve shows higher fluorescence intensity with a mean fluorescence value of
54.37. The blue curve obtained for the same cell line with a fluorescence tagged
random DNA indicates that the sequence does not bind with the cell line.





A B


CDI




10 0' 12 gg 0
Floecne nest


FigreA-. lurececetagedapamr inin wthdifeentcels Te iges vlu o
fluresene idicte byB crrlats o mxim m indngi~. psitveconro
(++++). Point A and below corrsodt<0%hectisorlastobkgun

sinl Tehstgas nbtee ontAad orlae o + ++ t.


Mean fluorescence of
te signal
Mean fluorescence of
the positive control


-Mean fluorescence of the background signal
x 100 (A-1)
_ Mean fluorescence of the background signal


Binding percentage










REFERENCES


1. www ncbi nlm nih 9ov/. Lat accessed January 2, 2008

2. http ://www.cancer.org,/docroot/home/index.asp Last accessed January 2, 2008

3. Jensen, O.N. Modification-specific proteomics: characterization of post-translational
modifications by mass spectrometry. Curr Opin Chem Biol 8, 33-41 (2004).

4. Mann, M. & Jensen, O.N. Proteomic analysis of post-translational modifications. Nat
Biotechnol 21, 255-261 (2003).

5. Hancock, W., Apffel, A., Chakel, J., Hahnenberger, K., Choudhary, G., Traina, J.A. &
Pungor, E. Integrated genomic/proteomic analysis. Anal Chem 71, 742A-748A (1999).

6. Hardcastle, J., Kurozumi, K., Chiocca, E.A. & Kaur, B. Oncolytic viruses driven by
tumor-specific promoters. Curr Cancer Drug TargtsTTTTTTTTTTTTTTTTTT 7, 181-189 (2007).

7. Hammarstrom, S. The carcinoembryonic antigen (CEA) family: structures, suggested
functions and expression in normal and malignant tissues. Semin Cancer Biol 9, 67-81
(1999).

8. Tasch, J., Gong, M., Sadelain, M. & Heston, W.D. A unique folate hydrolase, prostate-
specific membrane antigen (PSMA): a target for immunotherapy? Crit Rev Immunol 21,
249-261 (2001).

9. Osborne, C.K., Hamilton, B., Titus, G. & Livingston, R.B. Epidermal growth factor
stimulation of human breast cancer cells in culture. Cancer Res 40, 23 61-23 66 (1980).

10. Olsson, A.K., Dimberg, A., Kreuger, J. & Claesson-Welsh, L. VEGF receptor signalling -
in control of vascular function. Nat Rev Mol1 Cell Biol 7, 3 59-371 (2006).

11. Ariad, S., Seymour, L. & Bezwoda, W.R. Platelet-derived growth factor (PDGF) in
plasma of breast cancer patients: correlation with stage and rate of progression. Breast
Cancer Res Treat 20, 11-17 (1991).

12. Chan, J.M., Stampfer, M.J., Giovannucci, E., Gann, P.H., Ma, J., Wilkinson, P.,
Hennekens, C.H. & Pollak, M. Plasma insulin-like growth factor-I and prostate cancer
risk: a prospective study. Science 279, 563-566 (1998).

13. Hursting, S.D., Lashinger, L.M., Colbert, L.H., Rogers, C.J., Wheatley, K.W., Nunez,
N.P., Mahabir, S., Barrett, J.C., Forman, M.R. & Perkin, S.N. Energy balance and
carcinogenesis: underlying pathways and targets for intervention. Curr Cancer Drug
Targets 7, 484-491 (2007 ).

14. Nahta, R. & Esteva, F.J. HER-2-targeted therapy: lessons learned and future directions.
Clin Cancer Res 9, 5078-5084 (2003).










15. Halatsch, M.E., Schmidt, U., Behnke-Mursch, J., Unterberg, A. & Wirtz, C.R. Epidermal
growth factor receptor inhibition for the treatment of glioblastoma multiforme and other
malignant brain tumours. Cancer Treat Rev 32, 74-89 (2006).

16. Isola, J.J., Holli, K., Oksa, H., Teramoto, Y. & Kallioniemi, O.P. Elevated erbB-2
oncoprotein levels in preoperative and follow-up serum samples define an aggressive
disease course in patients with breast cancer. Cancer 73, 652-658 (1994).

17. Andersen, T.I., Paus, E., Nesland, J.M., McKenzie, S.J. & Borresen, A.L. Detection of c-
erbB-2 related protein in sera from breast cancer patients. Relationship to ERBB2 gene
amplification and c-erbB-2 protein overexpression in tumour. Acta Oncol 34, 499-504
(1995).

18. Willsher, P.C., Beaver, J., Pinder, S., Bell, J.A., Ellis, I.O., Blamey, R.W. & Robertson,
J.F. Prognostic significance of serum c-erbB-2 protein in breast cancer patients. Breast
Cancer Res Treat 40, 251-255 (1996).

19. Fehm, T., Maimonis, P., Weitz, S., Teramoto, Y., Katalinic, A. & Jager, W. Influence of
circulating c-erbB-2 serum protein on response to adjuvant chemotherapy in node-
positive breast cancer patients. Breast Cancer Res Treat 43, 87-95 (1997).

20. Mansour, O.A., Zekri, A.R., Harvey, J., Teramoto, Y. & el-Ahmady, O. Tissue and serum
c-erbB-2 and tissue EGFR in breast carcinoma: three years follow-up. Anticancer Res 17,
3101-3106 (1997).

21. Disis, M.L., Pupa, S.M., Gralow, J.R., Dittadi, R., Menard, S. & Cheever, M.A. High-
titer HER-2/neu protein-specific antibody can be detected in patients with early-stage
breast cancer. J Clin Oncol 15, 3363-3367 (1997).

22. Krainer, M., Brodowicz, T., Zeillinger, R., Wiltschke, C., Scholten, C., Seifert, M.,
Kubista, E. & Zielinski, C.C. Tissue expression and serum levels of HER-2/neu in
patients with breast cancer. Oncology 54, 475-481 (1997).

23. Burke, H.B., Hoang, A., Iglehart, J.D. & Marks, J.R. Predicting response to adjuvant and
radiation therapy in patients with early stage breast carcinoma. Cancer 82, 874-877
(1998).

24. Fehm, T., Maimonis, P., Katalinic, A. & Jager, W.H. The prognostic significance of c-
erbB-2 serum protein in metastatic breast cancer. Oncology 55, 33-38 (1998).

25. Mehta, R.R., McDermott, J.H., Hieken, T.J., Marler, K.C., Patel, M.K., Wild, L.D. & Das
Gupta, T.K. Plasma c-erbB-2 levels in breast cancer patients: prognostic significance in
predicting response to chemotherapy. J Clin Oncol l6, 2409-2416 (1998).

26. Colomer, R., Montero, S., Lluch, A., Oj eda, B., Barnadas, A., Casado, A., Massuti, B.,
Cortes-Funes, H. & Lloveras, B. Circulating HER2 extracellular domain and resistance to
chemotherapy in advanced breast cancer. Clin Cancer Res 6, 2356-2362 (2000).










27. Bewick, M., Conlon, M., Gerard, S., Lee, H., Parissenti, A.M., Zhang, L., Gluck, S. &
Lafrenie, R.M. HER-2 expression is a prognostic factor in patients with metastatic breast
cancer treated with a combination of high-dose cyclophosphamide, mitoxantrone,
paclitaxel and autologous blood stem cell support. Bone Marrow Transplan2t 27, 847-853
(2001).

28. Harris, L.N., Liotcheva, V., Broadwater, G., Ramirez, M.J., Maimonis, P., Anderson, S.,
Everett, T., Harpole, D., Moore, M.B., Berry, D.A., Rizzeri, D., Vredenburgh, J.J. &
Bentley, R.C. Comparison of methods of measuring HER-2 in metastatic breast cancer
patients treated with high-dose chemotherapy. J Clin Oncol 19, 1698-1706 (2001).

29. Ali, S.M., Leitzel, K., Chinchilli, V.M., Engle, L., Demers, L., Harvey, H.A., Carney, W.,
Allard, J.W. & Lipton, A. Relationship of serum HER-2/neu and serum CA 15-3 in
patients with metastatic breast cancer. Clin Chent 48, 1314-1320 (2002).

30. Classen, S., Kopp, R., Possinger, K., Weidenhagen, R., Eiermann, W. & Wilmanns, W.
Clinical relevance of soluble c-erbB-2 for patients with metastatic breast cancer
predicting the response to second-line hormone or chemotherapy. Tumour Biol 23, 70-75
(2002).

31. Lipton, A., Ali, S.M., Leitzel, K., Demers, L., Chinchilli, V., Engle, L., Harvey, H.A.,
Brady, C., Nalin, C.M., Dugan, M., Carney, W. & Allard, J. Elevated serum Her-2/neu
level predicts decreased response to hormone therapy in metastatic breast cancer. J Clin
Oncol 20, 1467-1472 (2002).

32. Kandl, H., Seymour, L. & Bezwoda, W.R. Soluble c-erbB-2 fragment in serum correlates
with disease stage and predicts for shortened survival in patients with early-stage and
advanced breast cancer. Br J Cancer 70, 739-742 (1994).

33. Volas, G.H., Leitzel, K., Teramoto, Y., Grossberg, H., Demers, L. & Lipton, A. Serial
serum c-erbB-2 levels in patients with breast carcinoma. Cancer 78, 267-272 (1996).

34. Carney, W.P., Neumann, R., Lipton, A., Leitzel, K., Ali, S. & Price, C.P. Potential
clinical utility of serum HER-2/neu oncoprotein concentrations in patients with breast
cancer. Clin Chem 49, 1579-1598 (2003).

35. Liotta, L. & Petricoin, E. Molecular profiling of human cancer. Nat Rev Genet 1, 48-56
(2000).

36. Lipshutz, R.J., Fodor, S.P., Gingeras, T.R. & Lockhart, D.J. High density synthetic
oligonucleotide arrays. Nat Genet 21, 20-24 (1999).

37. Alizadeh, A.A., Eisen, M.B., Davis, R.E., Ma, C., Lossos, I.S., Rosenwald, A., Boldrick,
J.C., Sabet, H., Tran, T., Yu, X., Powell, J.I., Yang, L., Marti, G.E., Moore, T., Hudson,
J., Jr., Lu, L., Lewis, D.B., Tibshirani, R., Sherlock, G., Chan, W.C., Greiner, T.C.,
Weisenburger, D.D., Armitage, J.O., Warnke, R., Levy, R., Wilson, W., Grever, M.R.,
Byrd, J.C., Botstein, D., Brown, P.O. & Staudt, L.M. Distinct types of diffuse large B-
cell lymphoma identified by gene expression profiling. Nature 403, 503-511 (2000).










38. Humphery-Smith, I., Cordwell, S.J. & Blackstock, W.P. Proteome research:
complementarity and limitations with respect to the RNA and DNA worlds.
Electrophoresis 18, 1217-1242 (1997).

39. Goldsworthy, S.M., Stockton, P.S., Trempus, C.S., Foley, J.F. & Maronpot, R.R. Effects
of fixation on RNA extraction and amplification from laser capture microdissected tissue.
M~ol Carcinog 25, 86-91 (1999).

40. Golub, T.R., Slonim, D.K., Tamayo, P., Huard, C., Gaasenbeek, M., Mesirov, J.P.,
Cooler, H., Loh, M.L., Downing, J.R., Caligiuri, M.A., Bloomfield, C.D. & Lander, E.S.
Molecular classification of cancer: class discovery and class prediction by gene
expression monitoring. Science 286, 531-537 (1999).

41. Sgroi, D.C., Teng, S., Robinson, G., LeVangie, R., Hudson, J.R., Jr. & Elkahloun, A.G.
In vivo gene expression profile analysis of human breast cancer progression. Cancer Res
59, 5656-5661 (1999).

42. Barber, M., Bordoli, R.S., Sedgwick, R.D., Tyler, A.N. & Bycroft, B.W. Fast atom
bombardment mass spectrometry of bleomycin A2 and B2 and their metal complexes.
Biochent Biophys Res Conanun 101, 632-638 (1981).

43. Morris, H.R., Panico, M., Barber, M., Bordoli, R.S., Sedgwick, R.D. & Tyler, A. Fast
atom bombardment: a new mass spectrometric method for peptide sequence analysis.
Biochent Biophys Res Conanun 101, 623-631 (1981).

44. Tang, N. & Tornatore, P.W., S. R. Current developments in SELDI affinity technology.
M~ass Spectronzetry Reviews 23, 34-44 (2003).

45. Gullberg, M., Fredriksson, S., Taussig, M., Jarvius, J., Gustafsdottir, S. & Landegren, U.
A sense of closeness: protein detection by proximity ligation. Curr Opin Biotechnol 14,
82-86 (2003).

46. Engvall, E. & Perlman, P. Enzyme-linked immunosorbent assay (ELISA). Quantitative
assay of immunoglobulin G. Inanunochentistry 8, 871-874 (1971).

47. Famulok, M., Mayer, G. & Blind, M. Nucleic acid aptamers-from selection in vitro to
applications in vivo. Acc Chent Res 33, 591-599 (2000).

48. Jayasena, S.D. Aptamers: an emerging class of molecules that rival antibodies in
diagnostics. Clin Chent 45, 1628-1650 (1999).

49. Raj endran, M. & Ellington, A.D. In vitro selection of molecular beacons. Nucleic Acids
Res 31, 5700-5713 (2003).

50. Nutiu, R. & Li, Y. In vitro selection of structure-switching signaling aptamers. Angew
Chent Int EdEngl 44, 1061-1065 (2005).










51. Hermann, T. & Patel, D.J. Adaptive recognition by nucleic acid aptamers. Science 287,
820-825 (2000).

52. Di Primo, C., Rudloff, I., Reigadas, S., Arzumanov, A.A., Gait, M.J. & Toulme, J.J.
Systematic screening of LNA/2'-O-methyl chimeric derivatives of a TAR RNA aptamer.
FEBS Lett 581, 771-774 (2007).

53. Green, L.S., Jellinek, D., Jenison, R., Ostman, A., Heldin, C.H. & Janjic, N. Inhibitory
DNA ligands to platelet-derived growth factor B-chain. Biochemistry 35, 14413-14424
(1996).

54. Schmidt, K.S., Borkowski, S., Kurreck, J., Stephens, A.W., Bald, R., Hecht, M., Friebe,
M., Dinkelborg, L. & Erdmann, V.A. Application of locked nucleic acids to improve
aptamer in vivo stability and targeting function. Nucleic Acids Res 32, 5757-5765 (2004).

55. Crawford, M., Woodman, R. & Ko Ferrigno, P. Peptide aptamers: tools for biology and
drug discovery. BriefFunct Genomic Proteomic 2, 72-79 (2003).

56. Ciesiolka, J. & Yarus, M. Small RNA-divalent domains. RNA 2, 785-793 (1996).

57. Sullenger, B.A. & Gilboa, E. Emerging clinical applications of RNA. Nature 418, 252-
258 (2002).

58. Nieuwlandt, D., Wecker, M. & Gold, L. In vitro selection of RNA ligands to substance P.
Biochemistry 34, 5651-5659 (1995).

59. Malina, A., Khan, S., Carlson, C.B., Svitkin, Y., Harvey, I., Sonenberg, N., Beal, P.A. &
Pelletier, J. Inhibitory properties of nucleic acid-binding ligands on protein synthesis.
FEBS Lett 579, 79-89 (2005).

60. Ringquist, S., Jones, T., Snyder, E.E., Gibson, T., Boni, I. & Gold, L. High-affinity RNA
ligands to Escherichia coli ribosomes and ribosomal protein Sl: comparison of natural
and unnatural binding sites. Biochemistry 34, 3640-3648 (1995).

61. Pan, W., Craven, R.C., Qiu, Q., Wilson, C.B., Wills, J.W., Golovine, S. & Wang, J.F.
Isolation of virus-neutralizing RNAs from a large pool of random sequences. Proc Natl
AcadSci USA 92, 11509-11513 (1995).

62. Morris, K.N., Jensen, K.B., Julin, C.M., Weil, M. & Gold, L. High affinity ligands from
in vitro selection: complex targets. Proc Natl Acad Sci US A 95, 2902-2907 (1998).

63. Noma, T., Ikebukuro, K., Sode, K., Ohkubo, T., Sakasegawa, Y., Hachiya, N. & Kaneko,
K. Screening of DNA aptamers against multiple proteins in tissue. Nucleic Acids Symp
Ser (Oxf), 357-358 (2005).

64. Wilson, D.S. & Szostak, J.W. In vitro selection of functional nucleic acids. Annu Rev
Biochem 68, 611-647 (1999).










65. Tasset, D.M., Kubik, M.F. & Steiner, W. Oligonucleotide inhibitors of human thrombin
that bind distinct epitopes. J2~olBiol 272, 688-698 (1997).

66. Tuerk, C. & Gold, L. Systematic evolution of ligands by exponential enrichment: RNA
ligands to bacteriophage T4 DNA polymerase. Science 249, 505-510 (1990).

67. Ellington, A.D. & Szostak, J.W. In vitro selection of RNA molecules that bind specific
ligands. Nature 346, 818-822 (1990).

68. Fitzwater, T. & Polisky, B. A SELEX primer. Methods Enzymol 267, 275-301 (1996).

69. Sassanfar, M. & Szostak, J.W. An RNA motif that binds ATP. Nature 364, 550-553
(1993).

70. Pileur, F., Andreola, M.L., Dausse, E., Michel, J., Moreau, S., Yamada, H., Gaidamakov,
S.A., Crouch, R.J., Toulme, J.J. & Cazenave, C. Selective inhibitory DNA aptamers of
the human RNase H1. Nucleic Acids Res 31, 5776-5788 (2003).

71. Bruno, J.G. & Kiel, J.L. Use of magnetic beads in selection and detection of biotoxin
aptamers by electrochemiluminescence and enzymatic methods. Biotechniques 32, 178-
180, 182-173 (2002).

72. Mendonsa, S.D. & Bowser, M.T. In vitro evolution of functional DNA using capillary
electrophoresis. JAm Chem Soc 126, 20-21 (2004).

73. Mendonsa, S.D. & Bowser, M.T. In vitro selection of high-affinity DNA ligands for
human IgE using capillary electrophoresis. Anal Chem 76, 5387-5392 (2004).

74. Berezovski, M., Drabovich, A., Krylova, S.M., Musheev, M., Okhonin, V., Petrov, A. &
Krylov, S.N. Nonequilibrium capillary electrophoresis of equilibrium mixtures: a
universal tool for development of aptamers. JAm Chem Soc 127, 3165-3171 (2005).

75. Mendonsa, S.D. & Bowser, M.T. In vitro selection of aptamers with affinity for
neuropeptide Y using capillary electrophoresis. JAm Chem Soc 127, 9382-9383 (2005).

76. Fang, X., Cao, Z., Beck, T. & Tan, W. Molecular aptamer for real-time oncoprotein
platelet-derived growth factor monitoring by fluorescence anisotropy. Anal Chem 73,
5752-5757 (2001).

77. Sulj ak, S.W., Cao, Z. & Tan, W. Recent Research Developments in Chemistry. Research
Signpost 1, 59-77 (2003).

78. Vicens, M.C., Sen, A., Vanderlaan, A., Drake, T.J. & Tan, W. Investigation of molecular
beacon aptamer-based bioassay for platelet-derived growth factor detection.
Chembiochem 6, 900-907 (2005).










79. Li, J.J., Fang, X. & Tan, W. Molecular aptamer beacons for real-time protein recognition.
Biochem Biophys Res Commun 292, 31-40 (2002), Li, J. & Tan, W. A single DNA nano
motor, Nano Letters 2, 315 (2002).

80. Jhaveri S, Raj endran M, Ellington A D., In vitro selection of signaling aptamers, Nat.
Biotechnology, 18, 1293 1297 (2000)

81. Yang, C.J., Jockusch, S., Vicens, M., Turro, N.J. & Tan, W. Light-switching excimer
probes for rapid protein monitoring in complex biological fluids. Proc Natl Acad Sci U S
A 102, 17278-17283 (2005).

82. Petersen, M. & Wengel, J. LNA: a versatile tool for therapeutics and genomics. Trends
Biotechnol 21, 74-81 (2003).

83. Eaton, B. E., Gold, L., Hicke, B.J., Janjic, N., Jucker, F. M., Sebesta, D. P., Tarasow,
T.M., Willis, M.C., and Zichi, D. A. Post-SELEX Combinatorial optimization of
aptamers, Biorgan2ic & M~ed. Chem. 5 1087-1096 (1997)

84. Tang, Z., Shangguan, D., Wang, K., Shi, H., Sefah, K., Mallikratchy, P., Chen, H.W., Li,
Y. & Tan, W. Selection of aptamers for molecular recognition and characterization of
cancer cells. Anal Chem 79, 4900-4907 (2007).

85. Shangguan, D., Li, Y., Tang, Z., Cao, Z.C., Chen, H.W., Mallikaratchy, P., Sefah, K.,
Yang, C.J. & Tan, W. Aptamers evolved from live cells as effective molecular probes for
cancer study. Proc Natl Acad Sci U SA 103, 1 183 8-1 1843 (2006).

86. Lupold, S.E., Hicke, B.J., Lin, Y. & Coffey, D.S. Identification and characterization of
nuclease-stabilized RNA molecules that bind human prostate cancer cells via the
prostate-specific membrane antigen. Cancer Res 62, 4029-4033 (2002).

87. Daniels, D.A., Chen, H., Hicke, B.J., Swiderek, K.M. & Gold, L. A tenascin-C aptamer
identified by tumor cell SELEX: systematic evolution ofligands by exponential
enrichment. Proc NatlAcadSci USA 100, 15416-15421 (2003).

88. Guo, K., Wendel, H.P., Scheideler, L., Ziemer, G. & Scheule, A.M. Aptamer-based
capture molecules as a novel coating strategy to promote cell adhesion. J Cell2~ol2~ed 9,
731-736 (2005).

89. Cerchia, L., Duconge, F., Pestourie, C., Boulay, J., Aissouni, Y., Gombert, K., Tavitian,
B., de Franciscis, V. & Libri, D. Neutralizing aptamers from whole-cell SELEX inhibit
the RET receptor tyrosine kinase. PLoS Biol 3, el23 (2005).

90. Shangguan, D., Cao, Z.C., Li, Y. & Tan, W. Aptamers evolved from cultured cancer cells
reveal molecular differences of cancer cells in patient samples. Clin Chem 53, 1 153-1 155
(2007).

91. Quon, A. & Gambhir, S.S. FDG-PET and beyond: molecular breast cancer imaging. J
Clin Oncol 23, 1664-1673 (2005).










92. Sullivan, D.C. & Kelloff, G. Seeing into cells. The promise of in vivo molecular imaging
in oncology. E IBO Rep 6, 292-296 (2005).

93. Weissleder, R. Molecular imaging in cancer. Science 312, 1168-1171 (2006).

94. Halpern, E.J. Contrast-enhanced ultrasound imaging of prostate cancer. Rev Grol 8 Suppl
1, S29-37 (2006).

95. Bagalkot, V., Farokhzad, O.C., Langer, R. & Jon, S. An aptamer-doxorubicin physical
conjugate as a novel targeted drug-delivery platform. Angew Chent Int EdEngl 45, 8149-
8152 (2006).

96. Chu, T.C., Marks, J.W., 3rd, Lavery, L.A., Faulkner, S., Rosenblum, M.G., Ellington,
A.D. & Levy, M. Aptamer:toxin conjugates that specifically target prostate tumor cells.
Cancer Res 66, 5989-5992 (2006).

97. Chu, T.C., Twu, K.Y., Ellington, A.D. & Levy, M. Aptamer mediated siRNA delivery.
Nucleic Acids Res 34, e73 (2006).

98. Dolle, F., Hinnen,F., Vaufrey,F., Tavitian, B., Crouzel, C. A general method for labeling
oligodeoxynucleotides with 1sF for in vivo PET imaging J. of: Labelled compounds and
radiopharnaceuticals, 39, 319-326 (1997)

99. Farokhzad, O.C., Jon, S., Khademhosseini, A., Tran, T.N., Lavan, D.A. & Langer, R.
Nanoparticle-aptamer bioconjugates: a new approach for targeting prostate cancer cells.
Cancer Res 64, 7668-7672 (2004).

100. Tavitian, B., Terrazzino, S., Kuhnast, B., Marzabal, S., Stettler, O., Dolle, F., Deverre,
J.R., Jobert, A., Hinnen, F., Bendriem, B., Crouzel, C. & Di Giamberardino, L. In vivo
imaging of oligonucleotides with positron emission tomography. Nat M~ed 4, 467-471
(1998).

101. Jerusalem, G., Hustinx, R., Beguin, Y. & Fillet, G. PET scan imaging in oncology. Eur J
Cancer 39, 1525-1534 (2003).

102. Hicke, B.J., Stephens, A.W., Gould, T., Chang, Y.F., Lynott, C.K., Heil, J., Borkowski,
S., Hilger, C.S., Cook, G., Warren, S. & Schmidt, P.G. Tumor targeting by an aptamer. J
Nucl2~ed 47, 668-678 (2006).

103. McNamara, J.O., 2nd, Andrechek, E.R., Wang, Y., Viles, K.D., Rempel, R.E., Gilboa, E.,
Sullenger, B.A. & Giangrande, P.H. Cell type-specific delivery of siRNAs with aptamer-
siRNA chimeras. Nat Biotechnol 24, 1005-1015 (2006).

104. James, W. Encyclopedia of Analytical Chemistry. (John Wiley & Sons Ltd, Chichester;
2000).

105. Boyle, F.T. & Costello, G.F. Cancer Therapy: move to the molecular level, Chent Soc.
Rev 27, 251-261 (1998).










106. Ulrich, H., Ippolito, J.E., Pagan, O.R., Eterovic, V.A., Hann, R.M., Shi, H., Lis, J.T.,
Eldefrawi, M.E. & Hess, G.P. In vitro selection of RNA molecules that displace cocaine
from the membrane-bound nicotinic acetylcholine receptor. Proc NatlAcad Sci US A 95,
14051-14056 (1998).

107. Green, L.S., Jellinek, D., Bell, C., Beebe, L.A., Feistner, B.D., Gill, S.C., Jucker, F.M. &
Janjic, N. Nuclease-resistant nucleic acid ligands to vascular permeability factor/vascular
endothelial growth factor. Chem Biol 2, 683-695 (1995).

108. Kimoto, M., Shirouzu, M., Mizutani, S., Koide, H., Kaziro, Y., Hirao, I. & Yokoyama, S.
Anti-(Raf-1) RNA aptamers that inhibit Ras-induced Raf-1 activation. Eur JBiochem
269, 697-704 (2002).

109. O'Connell, D., Koenig, A., Jennings, S., Hicke, B., Han, H.L., Fitzwater, T., Chang, Y.F.,
Varki, N., Parma, D. & Varki, A. Calcium-dependent oligonucleotide antagonists specific
for L-selectin. Proc Natl AcadSci U SA 93, 5 883 -5 887 (1996).

110. Pagratis, N.C., Bell, C., Chang, Y.F., Jennings, S., Fitzwater, T., Jellinek, D. & Dang, C.
Potent 2'-amino-, and 2'-fluoro-2'-deoxyribonucleotide RNA inhibitors of keratinocyte
growth factor. Nat Biotechnol 15, 68-73 (1997).

111. Dolmans, D.E., Fukumura, D. & Jain, R.K. Photodynamic therapy for cancer. Nat Rev
Cancer 3, 380-387 (2003).

112. Castano, A.P., Mroz, P. & Hamblin, M.R. Photodynamic therapy and anti-tumour
immunity. Nat Rev Cancer 6, 535-545 (2006).

113. Bonnett, R., Photosensitizers of the porphyrin and phthalocyanine series for
photodynamic therapy, Chem. Soc. Rev. 24, 19-31 (1995).

114. Dougherty, T.J., Gomer, C.J., Henderson, B.W., Jori, G., Kessel, D., Korbelik, M., Moan,
J. & Peng, Q. Photodynamic therapy. JNatl Cancer Inst 90, 889-905 (1998).

115. Strong, L., Yarmush, D.M. & Yarmush, M.L. Antibody-targeted photolysis.
Photophysical, biochemical, and pharmacokinetic properties of antibacterial conjugates.
Ann N YAcad Sci 745, 297-320 (1994).

116. Kragh-Hansen, U. Structure and ligand binding properties of human serum albumin. Dan
M~ed Bull 37, 57-84 (1990).

117. de Smidt, P.C., Versluis, A.J. & van Berkel, T.J. Properties of incorporation,
redistribution, and integrity of porphyrin-low-density lipoprotein complexes.
Biochemistry 32, 2916-2922 (1993).

118. Seaton, B.A. & Dedman, J.R. Annexins. Biometals 11, 399-404 (1998).

119. Ali, H. & van Lier, J.E. Metal complexes as photo- and radiosensitizers. Chem Rev 99,
2379-2450 (1999).









120. Conrad, M.E. & Umbreit, J.N. Iron absorption and transport-an update. Am JHentatol 64,
287-298 (2000).

121. Tsein, R. Imaging imaging' s future Nature Reviews M~olecular Cell Biology 4, 16-21
(2003).

122. Cao, Z. & Tan, W. Molecular aptamers for real-time protein-protein interaction study.
Chentistry 11, 4502-4508 (2005).

123. Newton, A.C. Protein kinase C: structural and spatial regulation by phosphorylation,
cofactors, and macromolecular interactions. Chent Rev 101, 23 53-2364 (2001).

124. Newton, A.C. The ins and outs of protein kinase C. Methods 2olBiol 233, 3-7 (2003).

125. Gschwendt, M. Protein kinase C delta. Eur JBiochent 259, 555-564 (1999).

126. Miyamoto, A., Nakayama, K., Imaki, H., Hirose, S., Jiang, Y., Abe, M., Tsukiyama, T.,
Nagahama, H., Ohno, S., Hatakeyama, S. & Nakayama, K.I. Increased proliferation of B
cells and auto-immunity in mice lacking protein kinase Cdelta. Nature 416, 865-869
(2002).

127. Ashton, A.W., Watanabe, G., Albanese, C., Harrington, E.O., Ware, J.A. & Pestell, R.G.
Protein kinase Cdelta inhibition of S-phase transition in capillary endothelial cells
involves the cyclin-dependent kinase inhibitor p27(Kipl1). JBiol Chent 274, 20805-20811
(1999).

128. Wang, Q., Wang, X. & Evers, B.M. Induction of clAP-2 in human colon cancer cells
through PKC delta/NF-kappa B. JBiol Chent 278, 51091-51099 (2003).

129. Steinberg, S.F. Distinctive activation mechanisms and functions for protein kinase
Cdelta. Biochent J 384, 449-459 (2004).

130. Yoshida, K., Miki, Y. & Kufe, D. Activation of SAPK/JNK signaling by protein kinase
Cdelta in response to DNA damage. JBiol Chent 277, 48372-48378 (2002).

131. Yang, C. & Kazanietz, M.G. Divergence and complexities in DAG signaling: looking
beyond PKC. Trends Pharnzacol Sci 24, 602-608 (2003).

132. Poole, A.W., Pula, G., Hers, I., Crosby, D. & Jones, M.L. PKC-interacting proteins: from
function to pharmacology. Trends Pharnzacol Sci 25, 528-535 (2004).

133. Violin, J.D., Zhang, J., Tsien, R.Y. & Newton, A.C. A genetically encoded fluorescent
reporter reveals oscillatory phosphorylation by protein kinase C. J Cell Biol 161, 899-909
(2003).










134. Watanabe, T., Ono, Y., Taniyama, Y., Hazama, K., Igarashi, K., Ogita, K., Kikkawa, U.
& Nishizuka, Y. Cell division arrest induced by phorbol ester in CHO cells
overexpressing protein kinase C-delta subspecies. Proc NatlAcad Sci USA 89, 10159-
10163 (1992).

135. Fukumoto, S., Nishizawa, Y., Hosoi, M., Koyama, H., Yamakawa, K., Ohno, S. & Morii,
H. Protein kinase C delta inhibits the proliferation of vascular smooth muscle cells by
suppressing G1 cyclin expression. JBiol Chem 272, 13816-13822 (1997).

136. Mischak, H., Goodnight, J.A., Kolch, W., Martiny-Baron, G., Schaechtle, C., Kazanietz,
M.G., Blumberg, P.M., Pierce, J.H. & Mushinski, J.F. Overexpression of protein kinase
C-delta and -epsilon in NIH 3T3 cells induces opposite effects on growth, morphology,
anchorage dependence, and tumorigenicity. JBiol Chem 268, 6090-6096 (1993).

137. Mishima, K., Ohno, S., Shitara, N., Yamaoka, K. & Suzuki, K. Opposite effects of the
overexpression of protein kinase C gamma and delta on the growth properties of human
glioma cell line U251 MG. Biochem Biophys Res Commun 201, 363-372 (1994).

138. Harrington, E.O., Loffler, J., Nelson, P.R., Kent, K.C., Simons, M. & Ware, J.A.
Enhancement of migration by protein kinase Calpha and inhibition of proliferation and
cell cycle progression by protein kinase Cdelta in capillary endothelial cells. JBiol Chem
272, 7390-7397 (1997).

139. Sambrook, J. & Russell, W. Molecular Biology, Vol. 1 7.9-7. 10 (CSHL Press, 2001).

140. Kiga, D., Futamura, Y., Sakamoto, K. & Yokoyama, S. An RNA aptamer to the
xanthine/guanine base with a distinctive mode of purine recognition. Nucleic Acids Res
26, 1755-1760 (1998).

141. Saran, D., Frank, J. & Burke, D.H. The tyranny of adenosine recognition among RNA
aptamers to coenzyme A. BM~C Evol Biol 3, 26 (2003).

142. Mallikaratchy, P., Stahelin, R.V., Cao, Z., Cho, W. & Tan, W. Selection of DNA ligands
for protein kinase C-delta. Chem Commun (Camb), 3229-3231 (2006).

143. Dalton, W.S. & Friend, S.H. Cancer biomarkers--an invitation to the table. Science 312,
1165-1168 (2006).

144. Bledi, Y., Inberg, A. & Linial, M. PROCEED: A proteomic method for analysing plasma
membrane proteins in living mammalian cells. BriefFunct Genomic Proteomic 2, 254-
265 (2003).

145. Oh, P., Li, Y., Yu, J., Durr, E., Krasinska, K.M., Carver, L.A., Testa, J.E. & Schnitzer,
J.E. Subtractive proteomic mapping of the endothelial surface in lung and solid tumours
for tissue-specific therapy. Nature 429, 629-63 5 (2004).










146. Shin, B.K., Wang, H., Yim, A.M., Le Naour, F., Brichory, F., Jang, J.H., Zhao, R.,
Purays, E., Tra, J., Michael, C.W., Misek, D.E. & Hanash, S.M. Global profiling of the
cell surface proteome of cancer cells uncovers an abundance of proteins with chaperone
function. JBiol Chem 278, 7607-7616 (2003).

147. Gygi, S.P., Rist, B., Gerber, S.A., Turecek, F., Gelb, M.H. & Aebersold, R. Quantitative
analysis of complex protein mixtures using isotope-coded affinity tags. Nat Biotechnol
17, 994-999 (1999).

148. Washburn, M.P., Wolters, D. & Yates, J.R., 3rd Large-scale analysis of the yeast
proteome by multidimensional protein identification technology. Nat Biotechnol 19, 242-
247 (2001).

149. Roboz, J. Mass spectrometry in diagnostic oncoproteomics. Cancer Invest 23, 465-478
(2005).

150. Lawson, E.L., Clifton, J.G., Huang, F., Li, X., Hixson, D.C. & Josic, D. Use of magnetic
beads with immobilized monoclonal antibodies for isolation of highly pure plasma
membranes. Electrophoresis 27, 2747-2758 (2006).

151. Chang, P.S., Absood, A., Linderman, J.J. & Omann, G.M. Magnetic bead isolation of
neutrophil plasma membranes and quantification of membrane-associated guanine
nucleotide binding proteins. AnalBiochem 325, 175-184 (2004).

152. Thomas, M.D., Srivastava, B. & Allman, D. Regulation of peripheral B cell maturation.
Cell Immunol 239, 92-102 (2006).

153. Cambier, J.C. & Campbell, K.S. Membrane immunoglobulin and its accomplices: new
lessons from an old receptor. FASEB J 6, 3207-3217 (1992).

154. Trujillo, M.A., Jiang, S.W., Tarara, J.E. & Eberhardt, N.L. Clustering of the B cell
receptor is not required for the apoptotic response. DNA Cell Biol 22, 513-523 (2003).

155. Joseph, L.F., Ezhevsky, S. & Scott, D.W. Lymphoma models for B-cell activation and
tolerance: anti-immunoglobulin M treatment induces growth arrest by preventing the
formation of an active kinase complex which phosphorylates retinoblastoma gene product
in Gl. Cell G; 1,n thr Differ 6, 51-57 (1995).

156. Carey, G.B., Donj erkovic, D., Mueller, C.M., Liu, S., Hinshaw, J.A., Tonnetti, L.,
Davidson, W. & Scott, D.W. B-cell receptor and Fas-mediated signals for life and death.
ImmunolRev 176, 105-115 (2000).

157. Cragg, M. S., Zhang, L., French, R.R. & Glennie, M.J. Analysis of the interaction of
monoclonal antibodies with surface IgM on neoplastic B-cells. Br J Cancer 79, 850-857
(1999).










158. Kang, S.H., Vieira, K. & Bungert, J. Combining chromatin immunoprecipitation and
DNA footprinting: a novel method to analyze protein-DNA interactions in vivo. Nucleic
Acids Res 30, e44 (2002).

159. Smith, D., Collins, B.D., Heil, J. & Koch, T.H. Sensitivity and specificity of
photoaptamer probes. Mol1 CellProteomics 2, 11-18 (2003).

160. Golden, M.C., Resing, K.A., Collins, B.D., Willis, M.C. & Koch, T.H. Mass spectral
characterization of a protein-nucleic acid photocrosslink. Protein Sci 8, 2806-2812
(1999).

161. Mallikaratchy, P., Tang, Z., Meng, L., Shangguan, D., Kwame, S. & Tan, W. Aptamer
directly evolved from live cells recognizes membrane bound immunoglobin heavy mu
chain in Burkitt's lymphoma cells. Mol1 Cell Proteomics 6, 223 0-223 8 (2007).

162. Wilbur, D.S., Pathare, P.M., Hamlin, D.K., Stayton, P.S., To, R., Klumb, L.A., Buhler,
K.R. & Vessella, R.L. Development of new biotin/streptavidin reagents for pretargeting.
BiomolEng 16, 113-118 (1999).

163. Wilchek, M. & Bayer, E.A. Foreword and introduction to the book (strept)avidin-biotin
system. BiomolEng 16, 1-4 (1999).

164. Diamandis, E.P. & Christopoulos, T.K. The biotin-(strept)avidin system: principles and
applications in biotechnology. Clin Chem 37, 625-636 (1991).

165. Sieverts, H., Alabaster, O., Goldschmidts, W. & Magrath, I. Expression of surface
antigens during the cell cycle in different growth phases of American and African
Burkitt's lymphoma cell lines. Cancer Res 46, 1182-1188 (1986).

166. Kaptein, J.S., Lin, C.K., Wang, C.L., Nguyen, T.T., Kalunta, C.I., Park, E., Chen, F.S. &
Lad, P.M. Anti-IgM-mediated regulation of c-myc and its possible relationship to
apoptosis. JBiol Chem 271, 18875-18884 (1996).

167. Cutrona, G., Carpaneto, E.M., Ponzanelli, A., Ulivi, M., Millo, E., Scarfi, S., Roncella,
S., Benatti, U., Boffa, L.C. & Ferrarini, M. Inhibition of the translocated c-myc in
Burkitt's lymphoma by a PNA complementary to the E mu enhancer. Cancer Res 63,
6144-6148 (2003).

168. Mongini, P.K., Liu, Q., Vilensky, M.A., Highet, P.F. & Inman, J.K. Evidence for an
upper affinity threshold for anti-IgM-induced apoptosis in a human B-cell lymphoma.
Blood 92, 3756-3771 (1998).

169. Gurinovich, G.P., Zorina, T.E., Melnov, S.B., Melnova, N.I., Gurinovich, I.F., Grubina,
L.A., Sarzhevskaya, M.V. & Cherenkevich, S.N. Photodynamic activity of chlorin e6 and
chlorin e6 ethylenediamide in vitro and in vivo. JPhotochem PhotobiolB 13, 51-57
(1992).










170. Dalla Via, L. & Marciani Magno, S. Photochemotherapy- in the treatment of cancer. Curr
M~ed Chent 8, 1405-1418 (2001).

171. Sharman, W.M., van Lier, J.E. & Allen, C.M. Targeted photodynamic therapy via
receptor mediated delivery systems. Adv Drug Deliv Rev 56, 53-76 (2004).

172. Klussmann, S. The Aptamer Handbook:Functional Oligonucleotides and Their
Applications. (Wiley-VCH, Weinheim, Germany; 2006).

173. Mallikaratchy, P., Tang, Z. & Tan, W. Cell Specific Aptamer Photosensitizer Conjugates
as a Molecular Tool in Photodynamic Therapy. ChenM2edChent, accepted (2007).

174. Choi, Y., Weissleder, R. & Tung, C.H. Protease-mediated phototoxicity of a polylysine-
chlorin(E6) conjugate. ChenM2edChent 1, 698-701 (2006).

175. Chen, J., Stefflova, K., Niedre, M.J., Wilson, B.C., Chance, B., Glickson, J.D. & Zheng,
G. Protease-triggered photosensitizing beacon based on singlet oxygen quenching and
activation. JAnz Chent Soc 126, 11450-11451 (2004).

176. Zheng, G., Chen, J., Stefflova, K., Jarvi, M., Li, H. & Wilson, B.C. Photodynamic
molecular beacon as an activatable photosensitizer based on protease-controlled singlet
oxygen quenching and activation. Proc Natl AcadSci U SA 104, 8989-8994 (2007).

177. Choi, Y., Weissleder, R. & Tung, C.H. Selective antitumor effect of novel protease-
mediated photodynamic agent. Cancer Res 66, 7225-7229 (2006).

178. Li, X. & Liu, D.R. DNA-templated organic synthesis: nature's strategy for controlling
chemical reactivity applied to synthetic molecules. Angew Chent Int EdEngl 43, 4848-
4870 (2004).

179. Ma, Z. & Taylor, J. S. Nucleic acid-triggered catalytic drug release. Proc NatlAcad Sci U
SA 97, 11159-11163 (2000).

180. Silverman, A.P. & Kool, E.T. Detecting RNA and DNA with templated chemical
reactions. Chent Rev 106, 3775-3789 (2006).

181. Ng, E.W., Shima, D.T., Calias, P., Cunningham, E.T., Jr., Guyer, D.R. & Adamis, A.P.
Pegaptanib, a targeted anti-VEGF aptamer for ocular vascular disease. Nat Rev Drug
Discov 5, 123-132 (2006).

182. Griffin, L.C., Tidmarsh, G.F., Bock, L.C., Toole, J.J. & Leung, L.L. In vivo anticoagulant
properties of a novel nucleotide-based thrombin inhibitor and demonstration of regional
anticoagulation in extracorporeal circuits. Blood 81, 3271-3276 (1993).

183. Tam, R.C., Wu-Pong, S., Pai, B., Lim, C., Chan, A., Thomas, D.F., Milovanovic, T.,
Bard, J. & Middleton, P.J. Increased potency of an aptameric G-rich oligonucleotide is
associated with novel functional properties of phosphorothioate linkages. Antisense
Nucleic Acid Drug Dev 9, 289-300 (1999).










184. Pieken, W.A., Olsen, D.B., Benseler, F., Aurup, H. & Eckstein, F. Kinetic
characterization of ribonuclease-resistant 2'-modified hammerhead ribozymes. Science
253, 314-317 (1991).

185. Floege, J., Ostendorf, T., Janssen, U., Burg, M., Radeke, H.H., Vargeese, C., Gill, S.C.,
Green, L.S. & Janjic, N. Novel approach to specific growth factor inhibition in vivo:
antagonism of platelet-derived growth factor in glomerulonephritis by aptamers. Am J
Pathol 154, 169-179 (1999).

186. Dougan, H., Lyster, D.M., Vo, C.V., Stafford, A., Weitz, J.I. & Hobbs, J.B. Extending
the lifetime of anticoagulant oligodeoxynucleotide aptamers in blood. Nucl2~edBiol 27,
289-297 (2000).

187. Ruckman, J., Green, L.S., Beeson, J., Waugh, S., Gillette, W.L., Henninger, D.D.,
Claesson-Welsh, L. & Janjic, N. 2'-Fluoropyrimidine RNA-based aptamers to the 165-
amino acid form of vascular endothelial growth factor (VEGFl165). Inhibition of receptor
binding and VEGF-induced vascular permeability through interactions requiring the exon
7-encoded domain. JBiol Chem 273, 20556-20567 (1998).

188. Blank, M. & Blind, M. Aptamers as tools for target validation. Curr Opin Chem Biol 9,
336-342 (2005).

189. Buning, H., Ried, M.U., Perabo, L., Gerner, F.M., Huttner, N.A., Enssle, J. & Hallek, M.
Receptor targeting of adeno-associated virus vectors. Gene Ther 10, 1 142-1 151 (2003).

190. Li, C., Bowles, D.E., van Dyke, T. & Samulski, R.J. Adeno-associated virus vectors:
potential applications for cancer gene therapy. Cancer Gene 7Jher 12, 913-925 (2005).









BIOGRAPHICAL SKETCH

Prabodhika Mallikaratchy is from Gampola, Sri Lanka. In 1996, after finishing her

General Certificate Examination Advanced Level, she enrolled in Institute of Chemistry Ceylon,

to major in Physical Chemistry. As an undergraduate student, she studied the effect of dye

sensitization of CdS semiconductors to implement efficient solar cells under Dr. O.A. Illeperuma

at his Inorganic Research Laboratory. After completing her undergraduate studies with honors,

in August 2001 she traveled to University of Louisiana at Monroe to pursue a Master of Science

in organo-metallic chemistry under the supervision of Dr Thomas Junk. At ULM she studied

and characterized three novel organo- metallic compounds. After successfully completing her

M. Sc. degree in 2003 June, she j oined Dr. Weihong Tan' s lab to pursue a PhD in Chemistry.





PAGE 1

1 IN VITRO SELECTION AND DEVELOPMENT OF APTAMERS FOR BIOMARKER DISCOVERY AND TARGETED THERAPY By PRABODHIKA MALLIKARATCHY A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2008

PAGE 2

2 2008 Prabodhika Mallikaratchy

PAGE 3

3 To my family

PAGE 4

4 ACKNOWLEDGMENTS I wish to express my sincere appreciation and gratitude to my major research advisor, Dr. Weihong Tan, for his guidance through out my graduate school and his understanding. I am indebted to him forever for his valued assistance during the period of my research work. My profound gratitude and appreciation is also extended to Dr. Jorg Bungert, Dr. Kirk Schanze, Dr. Nigel Richards and Dr. Thomas Lyons for serving on my committee and for their helpful suggestions and advice during my research projects. I thank the support staff at the Department of Chemistry, University of Florida, for their silent contribution during my research work. My special thanks go to Ms. Julie McGrath, Ms. Tina Williams, Ms. Lori Clark and Ms. Jeanne Karably for each of their continuing help with numerous tasks. My special thanks go to Ms. Hui Lin and Dr. Arup Sen for their assistance with DNA synthesis for each of the projects. It has been a great joy over the years I spent at Tan group. I thank Dr. Lin Wang, Dr. Steven Suljak, Dr. James Yang, Dr. Colin Medley, Dr. Dihua Shangguan, Dr. Marie Carmen Estevez, Karen Martinez, Hui Lin, Dr. Zehui Cao, Dr. Marie C. Vic ns, Huaizhi Kang, Dr. Josh E. Smith, Dr. Alina Munteanu, Yanrong Wu, Youngmi Sohn, Dosung Sohn, Kwame Sefah, Zhi Zhu, Hui Chen, Yan Chen, Ling Meng, Dr. Jilin Yan, Jennifer Martin, Pinpin Sheng and Zeyu Xiao for their kindness and help. Last but not least my deepest love and appreciation is extended to my dear family for their constant support and love through out my research work. I can not achieve anything in my life with out the constant encouragement I got from every one of them.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS.............................................................................................................. 4 LIST OF TABLES................................................................................................................. ......... 8 LIST OF FIGURES................................................................................................................ ........ 9 ABSTRACT.................................................................................................................................. 12 CHAPTER 1 INTRODUCTION................................................................................................................. 14 Role of Proteins in Cancer..................................................................................................... 14 Molecular Probing of Cancer for Biomarker Discovery........................................................ 16 Transcription Profiling Based Molecular Marker identification.................................... 16 Protein Profiling Based Molecular Marker Identification.............................................. 17 Aptamers................................................................................................................................ 18 Aptamer-Protein Interactions.......................................................................................... 18 Systematic Evolution of Ligands by EXponential enrichment (SELEX)....................... 19 Separation Methods in SELEX.............................................................................................. 21 Conventional SELEX Separation Techniques................................................................ 21 Novel SELEX Separation Strategies.............................................................................. 22 Aptamer Signaling as Molecular Probes in Cancer Protein Analysis.................................... 22 Multiple Aptamer Probes Targeting Whole Living Cells...................................................... 24 Whole Cell-SELEX Strategy................................................................................................. 26 Applications of Aptamers in Cancer...................................................................................... 29 Aptamers and Antibodies....................................................................................................... 31 Photodynamic Therapy.......................................................................................................... 31 Mechanisms of Photosensitizing Action........................................................................ 32 Biological Damage of Singlet Oxygen........................................................................... 32 Current Delivery Systems in Photodynamic Treatment................................................. 32 Overview of Dissertation Research....................................................................................... 35 2 SELECTION OF HIGH AFFINITY DNA LIGANDS FOR PROTEIN KINASE C........ 36 Introduction............................................................................................................................ 36 Protein Kinase C Family of Proteins..................................................................................... 36 Materials and Methods.......................................................................................................... 38 Instrumentation............................................................................................................... 38 Initial Library Design..................................................................................................... 38 PKC Expression and Purification ................................................................................. 39 PCR Optimization........................................................................................................... 39 Combinatorial Selection of Aptamer.............................................................................. 40 Aptamer Labeling with AT32P........................................................................................ 40

PAGE 6

6 Electrophoretic Mobility Shift Assay (EMSA).............................................................. 41 Cloning and DNA Sequencing....................................................................................... 42 Fluorescence Anisotropy Measurements........................................................................ 42 Results and Discussions........................................................................................................ 43 The SELEX Process....................................................................................................... 43 Analysis of Consensus Secondary Structure of High-Affinity DNA Ligands............... 49 Analysis of Binding Sequences for PKC ...................................................................... 49 Specificity of Aptamer PB 9........................................................................................... 54 Conclusion..................................................................................................................... 55 3 APTAMER DIRECTLY EVOLVED FROM LIVE CELLS RECOGNIZES MEMBRANE BOUND IMMUNOGLOBIN HEAVY MU CHAIN IN BURKITTS LYMPHOMA CELLS ........................................................................................................... 56 Burkitts Lymphoma............................................................................................................. 57 Principle of Photocrosslinking of DNA with Proteins........................................................... 58 Aptamer TD05 Recognize Proteins on the Membrane.......................................................... 60 Methods and Materials.......................................................................................................... 61 Competition Assays with the Modified Aptamer Probes............................................... 62 Aptamer Labeling with AT32P........................................................................................ 63 Protein-Nucleic Acid Photo-Crosslinking...................................................................... 63 Cell Lysis and ProteinAptamer Extraction. ................................................................... 64 Release of Captured Complex and Protein Gel Electrophoresis.................................... 65 Partial Digestion of Membrane Proteins Using Trypsin................................................. 65 Characterization of Aptamer Binding Protein on Ramos Cells...................................... 66 Fluorescence Imaging..................................................................................................... 66 Results and Discussion......................................................................................................... 66 Probe Modification and the Effect of Modification on Aptamer Affinity and Specificity ................................................................................................................... 66 Separation of Captured Complex From the Crude Cell Lysate and MS Analysis of Captured Protein ......................................................................................................... 67 Confirmation of the Protein IGHM as the Binding Target for Aptamer TD05.............. 72 Discussion....................................................................................................................... 77 4 APTAMERS EVOLVED FROM WHOLE CELL SELECTION AS SELECTIVE ANTI-TUMOR PHOTODYNAMIC AGENTS .................................................................... 81 Introduction to Photosensitizers............................................................................................. 81 Methods and Materials.......................................................................................................... 83 Synthesis of the Conjugate............................................................................................. 83 Cell Lines and Binding Buffer........................................................................................ 84 Characterization of the Conjugates................................................................................. 84 Fluorescence Imaging..................................................................................................... 85 Flow Cytometry.............................................................................................................. 85 In Vitro Photolysis .......................................................................................................... 85 Results and Discussion......................................................................................................... 86 Conjugation of Ce6 with Amine Modified Aptamer TD05............................................ 87

PAGE 7

7 Characterization of Aptamer TD05-Ce6 Conjugates..................................................... 88 Investigation of Toxicity of Aptamer TD05-Ce6 Conjugates........................................ 90 5 APTAMER EVOLVED FROM CELL-SELEX AS AN EFFECTIVE PLATFORM FOR DRUG RELEASE ......................................................................................................... 95 DNA Directed Functional Group Transfer Reactions........................................................... 96 Methods and Materials.......................................................................................................... 98 DNA Synthesis and Purification..................................................................................... 98 Fluorescence Measurements........................................................................................... 99 Cell line and Reaction Conditions.................................................................................. 99 Results and Discussion........................................................................................................ 100 Probe Design and Mechanism of Activation................................................................ 100 Investigation of Quencher Release Using Aptamer Sgc8tem-C3-DTT on the CEM Cells .......................................................................................................................... 102 6 SUMMARY AND FUTURE WORK................................................................................. 110 Summary of In vitro Selection of Aptamer Targeting PKC .............................................. 110 Biomarker Discovery........................................................................................................... 110 Summary of Targeted Therapy Study.................................................................................. 111 Future Work.................................................................................................................... ..... 112 Aptamers with Increased Nuclease Stability................................................................ 112 Aptamers as Targeting Moiety in Gene Therapy......................................................... 113 Additional Structural Studies of Aptamer Site Recognition......................................... 114 APPENDIX FLOW CYTROMETRIC ANALYSIS OF BINDING OF FLUOROPHORE LABELED APTAMER WITH CELLS .............................................................................. 118 Instrumentation.................................................................................................................... 118 Data Interpretation............................................................................................................ ... 119 REFERENCES........................................................................................................................... 122 BIOGRAPHICAL SKETCH...................................................................................................... 137

PAGE 8

8 LIST OF TABLES Table page 1-1 Screening of aptamers selected using Cell-SELEX.......................................................... 28 2-1. Evolved family of sequences with percentage of population............................................ 51 3-1. Recognition patterns of aptamers TD05 and TE13 with different leukemia cell lines..... 58 3-2. Identified proteins and their IPI values based on European Protein Data Bank using MASCOT database search. ............................................................................................... 71 3-3. Binding patterns of aptamer TD05 and anti-IGHM with different cell lines.................... 74 5-1. Sequences of DTS reactions........................................................................................... 100 6-1. Different types of chemical modifications, for stabilization of aptamers and for enhancing pharmacokinetics, immobilization and labeling ............................................ 113

PAGE 9

9 LIST OF FIGURES Figure page 1-1 Thrombin aptamer and thrombin protein interaction........................................................ 19 1-2 The SELEX process......................................................................................................... 20 1-3 The CE-SELEX process.................................................................................................... 23 1-4 The cell-SELEX aptamer selection process developed by the Tan group........................ 27 1-5 Enrichment of the pool with the desired sequences for target cells.................................. 27 1-6 Extended Jabonski diagram.............................................................................................. 33 1-7 Reactions of singlet oxygen with biomolecules................................................................ 34 2-1 Home made CE set-up used in SELEX experiments........................................................ 41 2-2 PCR Optimization.......................................................................................................... ... 44 2-3 Electropherogram of 2mM DNA library........................................................................... 45 2-4 Electropherograms of the unbound DNA observed during SELEX rounds 2, 4, 6, and 8.. ....................................................................................................................................... 47 2-5 Affinity of enriched DNA pool from 8th round................................................................. 48 2-6 Affinity of starting DNA pool........................................................................................... 48 2-7 Sequences obtained from high throughput sequencing of pool of round 9....................... 50 2-8 Affinity of 32P labeled aptamer PB 9 to PKC ................................................................. 52 2-9 Affinity of TMR labeled PB-9 to PKC .. ......................................................................... 53 2-10 Specificity of aptamer PB9 towards PKC ...................................................................... 54 3-1 Protocol for the identification of IGHM protein on Ramos cells...................................... 59 3-2 Partial digestion of exracellular membrane proteins using trypsin and proteinase K (indicated by scissors). ...................................................................................................... 60 3-3 Binding of aptamer TD05 with Ramos cells after treatment with proteinase K at different time intervals. ..................................................................................................... 61 3-4 Modified aptamer with photoactive 5-dU I, linked to biotin via a disulfide bond.. ........... 68

PAGE 10

10 3-5 Binding of modified aptamer with 5-dUI and biotin linker with Ramos cells.................. 69 3-6 Phospho images for 10% tris-bis PAGE analysis of the captured complex..................... 70 3-7 Phospho images fo r control TE02 Sequence .................................................................... 71 3-8 Aptamer TD05-FITC and Alexa Flour 488 -anti-IGHM binding analysis with Ramos, CCRF-CEM and Toledo cells .............................................................................. 72 3-9 Aptamer TD05-FITC and anti-IGHM antibody binding with surface IgM positive CA46 ................................................................................................................................. 73 3-10 Competition of aptamer TD05-FITC and anti-IGHM antibody for the target protein...... 75 3-11 Binding of Alexa fluor 488 labeled anti-IGHM antibody and TMR labeled TD05 aptamer with Ramos cells ................................................................................................. 75 3-12 Flow cytometric results for the anti-IGHM binding with Ramos cells after Trypsin digestion. ........................................................................................................................... 76 4-1 Chemical structures of photosensitizers............................................................................ 82 4-2 Aptamer TD05-FITC binding to different leukemia cells................................................ 86 4-3 Reaction of chlorin e6 with an amine modified TD05 aptamer probe.............................. 87 4-4 UV-Vis absorption of Ce6 conjugated with DNA............................................................ 88 4-5 Singlet oxygen generation ability of free Ce6 dye and Ce6 conjugated to aptamer TD05. ................................................................................................................................ 89 4-6 Binding of aptamer TD05-Ce6 conjugate......................................................................... 90 4-7 Fluorescence confocal images.......................................................................................... 91 4-8 Cell toxicity of aptamer TD05-Ce6 treated cells.............................................................. 92 4-9 Cell viability observed for CEM and Ramos cells with no irradiation of light................ 93 4-10 Observed cell viability for HL-60, NB-4, K562, CEM and Ramos cells with Ce6 attached to a random DNA sequence. ............................................................................... 94 5-1 DNA Template based Functional Group Transfer Reactions........................................... 96 5-2 Aptamer-based DTGTR as a tool for drug release............................................................ 98 5-3 Mechanism of fluorescence restoration of the hypothetical pro-drug upon reduction of disulfide linker.. .......................................................................................................... 101

PAGE 11

11 5-4 Verification of de-quenching effect upon reduction of disulfide link............................. 102 5-5 Restored fluorescence upon addition of PB-C3-DTT to PBFSSD.................................103 5-6 Aptamer platform and hypothetical prodrug................................................................. 104 5-7 Binding of Sgc8tem with CEM cells.............................................................................. 106 5-8 Flow cytometric results for DTT treated PBFSSD on CCRF-CEM cells....................... 106 5-9 Reduction abilities of free DTT and DTT attached to DNA aptamer template.............. 107 5-10 Disulfide bond reduction of PBFSSD using DTT bound to aptamer platform and free DTT. ................................................................................................................................ 108 5-11 Specificity of disulfide bond reduction by DTT attached to Sgc8-tem-c3DTT.............. 108 6-1 Structure of 5-iodo deoxy uridine. (*) position refers to the 13C on the base................. 116 6-2 The proposed method for determination of aptamer binding site on IGHM.................. 117 A-1 Typical flow cytometer setup.......................................................................................... 118 A-2 Histogram obtained from the flow cytometer................................................................. 120 A-3 Histogram obtained to find out the binding of fluorescence tagged aptamer probe....... 120 A-4 Fluorescence tagged aptamer binding with different cells. ........................................ 121

PAGE 12

12 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy IN VITRO SELECTION AND DEVELOPMENT OF APTAMERS FOR BIOMARKER DISCOVERY AND TARGETED THERAPY By Prabodhika R. Mallikaratchy May 2008 Chair: Weihong Tan Major: Chemistry Increasing emphasis on molecular level understanding of cellular processes has allowed certain diseases to be redefined in terms of underlying molecular level abnormalities rather than pathological differences. In an attempt to understand some of these molecular level characteristics, this research was undertaken to utilize aptamers as molecular probes in cancer studies. Aptamers are short DNA/RNA strands that show a preferential binding with variety of molecules, and are generated by a process called Systematic Evolution of Ligands by Exponential enrichment (SELEX). First, in an attempt to develop sensitive probes for intracellular proteins, DNA aptamers were selected utilizing Capillary Electrophoresis based SELEX (CE-SELEX) targeting Protein Kinase C delta (PKC ). PKC is an important signal transduction protein that plays a significant role in tumor initiation. The selected aptamer was later labeled with a fluorophore and developed into a fluorescent probe for protein detection studies. Second, a novel strategy to identify over-expressed proteins on the cell membranes utilizing aptamers has been implemented. Here, an aptamer selected using Cell based SELEX (Cell-SELEX) has been utilized as a tool for biomarker identification. The aptamer TD05 selected against a Burkitts lymphoma (BL) cell line was chemically modified to covalently

PAGE 13

13 crosslink with its target and to capture and to enri ch the target receptors using streptavidin coated magnetic beads. The separated target protein wa s identified using mass spectrometry. Using this method, we were able to identify membrane bound Immunoglobin Heavy mu chain (IGHM) which is an established marker protein as the target for aptamer TD05. This study demonstrates aptamers selected against whole cells can be effectively utilized to identify cancer related marker proteins. Third, since the identified biomarker is expressed only on the target BL cells, this selectivity was exploited to demonstrate that the aptamer can be used as a drug carrier. Aptamerphotosensitizer conjugates were engineered to effectively target cancer cells that express identified biomarker. Introduction of the aptamer-photosensitizer conjugates followed by irradiation with light has selectively destroyed target cancer cells utilizing induced singlet oxygen. Finally, to avoid undesirable side effects associated with photosensitizers, as a proof-ofconcept a FRET principle based prodrug and an aptamer based drug delivery platform were engineered. The engineered hypothetical prodrug was effectively activated upon reaching aptamer platform aided by DNA Template based functional Group Transfer Reactions (DTGTR). The developed strategy further demonstrates that aptamers can be used as drug delivery platforms. .

PAGE 14

14 CHAPTER 1 INTRODUCTION Fundamental understanding of biological processes has been greatly influenced by the completion of the human genome project. Today, the National Center for Biotechnology database consists of completed genome data for more than 800 different organisms.1 This vast pool of information has resulted in a revolution in the biological sciences. Increasing emphasis on molecular level understanding of bio-organisms has allowed certain diseases to be re-defined in terms of underlying molecular level abnormalities rather than pathological differences. In an attempt to understand some of these molecular level characteristics, this research was undertaken to utilize aptamers as probes to target tumor-promoting proteins and to investigate the feasibility of developing aptamers into fluorescent probes. We have focused on the identification of biomarker proteins utilizing aptamers evolved from cell-SELEX methodology and have been able to demonstrate that the identified biomarker protein can be applied in therapeutic applications. In order to set the foundation for these objectives, this chapter explores the role of proteins in diseases, with particular emphasis on cancer, and how understanding these roles can lead the development of diagnostic and therapeutic approaches and can stimulate further basic research. Role of Proteins in Cancer Cancer ranks as the second major cause of death in the United States. 2 The origin of cancer cannot be correlated to a single genetic or proteomic alteration. Since all living cells rely on proteins for their survival and growth, slight modifications of proteins can result in different cellular mechanisms. The alteration of proteins can be in their levels of expression,3 or in changes to post-translational modifications (glycosylation, phenylation, formylation, acetylation) 4 or by mutations at the genetic level.5 Such changes can induce uncontrolled cell growth

PAGE 15

15 leading to cancer, particularly, when receptor proteins are involved. Therefore, detection of alterations of cell receptor protein expression levels and evaluation of their involvement in cancer initiation is important. Furthermore, these discoveries can lead to the invention of novel diagnostic approaches and targeted therapy strategies. Most of the key proteins discovered so far are associated with membrane receptors. For example, overexpression of the number of a serum marker proteins, such as -fetoprotein, 6 carcino-embryonic antigen (CEA) for colon cancer7 and prostate specific antigen (PSA) for prostate cancer8 are well established markers strongly related to tumor initiation and growth. Also, several growth factor proteins, such as epidermal growth factor receptor 2 (EGFR2),9 vascular enhanced growth factors (VEGF),10 platelet-derived growth factor (PDGF)11 and insulin-like growth factors (IGF)12 are classic tumor related proteins that play key roles in tumor initiation. Overexpression of these proteins is most likely due to activation and/or mutations of the encoding gene.13 For example, the EGFR2 gene encoding the EGFR2 receptor protein is activated in various cancers.14 These receptors are responsible for cell-cell or cell-stromal communication through signal transduction with intracellular growth factors or ligands. This signaling activates the transcription of various genes through phosphorylation or dephosphorylation, and ultimately the induced signaling cascade triggers enhanced cell growth. According to a reported clinical study, it ha s been shown that approximately 85% of breast cancer patients have significantly elevated levels of EGFR2 protein and this elevation is strongly correlated with disease recurrence, metastasis or shortened survival.15-34 These studies have all shown that the identification of molecular basis of diseases can lead to a more in-depth understanding of cancer. Molecular profiling in diseased cells using various probes is important

PAGE 16

16 in this process, and should eventually lead to the identification of new biomarkers that can help in early diagnosis. Molecular Probing of Cancer for Biomarker Discovery Transcription Profiling Based Molecular Marker identification The approach termed molecular profiling is the investigation of abnormalities of many genes or proteins on a common platform.35 The identified unique molecular signatures are correlated with tumors to identify subsets of patients and to tailor treatment regimes to achieve more personalized medical therapies. Detection of these molecular signatures can also lead to methodologies for early detection of cancer. Currently, molecular profiling studies rely largely on the analysis of genetic mutations using DNA micro-arrays.36 For example, a recent genetic analysis of diffuse Bcell large lymphoma (DBCL) using DNA micro-array techniques enabled the re-classification of two molecularly distinct forms of DBCL with different proliferation rates, host responses, and tumor differentiation rates.37 The results showed that the two subsets have significantly different survival rates, demonstrating that, even within a common category of lymphoma, there are subsets that can be further divided into subcategories. There are also many studies currently being reported using DNA micro-arrays to identify different disease subcategories based on genetic level differences. 35 Although DNA/RNA arrays are effective in analyzing millions of genes in a common platform, a disadvantage of DNA/RNA array analysis is sample preparation, because RNA is extremely labile and easily degradable. 38 The lack of stability of mRNA can also be responsible for false negative results, especially if unknown subpopulations of cells do not express high levels of mRNA. This low expression level can be lost by contamination from higher abundance mRNAs .39 In addition, mRNA expression may not n ecessarily correlate with protein expression

PAGE 17

17 patterns in a given cell. The information generated from array-based methods may not reflect the related protein expression levels in cancer, because proteins can also be mutated and /or altered in post-translational processing stages that can initiate the cancer formation.40 In addition to micro-array based methods, genetic analysis using a polymerase chain reaction (PCR) based method is considered to be more sensitive. However, amplification of gene products has been reported to have variable sensitivities, which can lead to false positive or false negative results.41 Protein Profiling Based Molecular Marker Identification Instead of detecting the mRNA corresponding to a given protein, the protein itself can be identified by various methods. Currently, the major method of disease related protein identification utilizes mass spectrometry (MS), including both electrospray ionization (ESI)42 and matrix-assisted laser desorption ionization (MALDI).43 In addition, a number of novel techniques have been developed. For example, surface-enhanced laser desorption time of flight MS (SELDI-MS),44 proximity ligation,45 cell-based bioactivity analysis, and immunological assays such as enzyme linked immunoabsorbant assays (ELISA)46 have been used to identify biological molecules. However, due to the poor limits of detection, and sensitivities as well as sample loss during the tedious sample preparation, the identification of biologically important molecules in disease origination has been hindered. Therefore, currently the focus is on more systematic approaches to identify biomarker proteins related to disease origination. One way of addressing this issue is the generation of molecular probes that specifically recognize different expression patterns of proteins on the cancer cell membrane. In this regard, aptamers show potential in identifying such molecular differences. Since aptamers can be selected without having to introduce a specific epitope, use of these molecules can help the identification of the molecular targets that are overexpressed in specific cells. The new

PAGE 18

18 information generated by aptamer-based molecular analysis has led to re-exploration of diseases based on underlying molecular abnormalities. Aptamers Aptamers are small oligonucleotides that specifically bind to a wide range of target molecules, such as drugs, proteins, or other inorganic or organic molecules, with high affinity and specificity.47-50 The concept of aptamers is based on the ability of small oligonucleotides (typically 80-100mers) to fold into unique three-dimensional structures that can interact with a specific target with high specificity and affinity. Aptamers are made of RNA,51 modified RNA,52 DNA, 53 or modified DNA54 and some peptide aptamers have also been reported.55 Aptamers have been selected for a variety of targets, including ions,56 small molecules,57 peptides,58 single proteins,59 organelles,60 viruses,61 entire cells62 and tissue samples.63 In the case of more complex samples, such as tissues or cells, the aptamers primarily recognize the most abundant proteins. Aptamer-Protein Interactions Naturally, some proteins are known to interact specifically with DNA and/or RNA. For example, most of the transcription factors and nuclear proteins are known to interact with DNA/RNA through non-covalent binding to mediate various cellular events. Binding of these nucleic acids of prey for their associated protein baits is relatively weak. Despite the low affinities, these interactions are specific, selective, and functional. The interaction of a DNA/RNA aptamer with its target molecules does not necessarily involve a DNA or RNA recognition capability. In fact, most of the DNA or RNA aptamers have been selected for common plasma or membrane proteins that do not possess a nucleic acid recognition capability.64 Interaction of an aptamer with its target molecule is a combination of non-covalent and electrostatic interactions, and it also depends on the ability of nucleic acids to

PAGE 19

19 fold into a unique three-dimensional secondary st ructure which can fit into a binding pocket in the protein. This compact folding of nucleic acids is the key to enhanced trapping of the aptamer in the protein pocket, especially for RNA aptamers, which have an extra hydroxyl group at the 2 position of the sugar ring. Figure 1-1, shows the anti-thrombin DNA aptamer binding via electrostatic interactions with thrombin protein. The affinities of these types of interactions are in the picomolar to sub-nanomolar range. Figure 1-1. Thrombin aptamer and thrombin protein interaction. Ribbon diagram of thrombin protein interacting with thrombin aptamer predicted by x-ray Crystallography. Aptamer binds with thrombin via a strong electrostatic interaction. Reprinted by permission from Journal of Molecular Biology .65 Systematic Evolution of Ligands by EXponential enrichment (SELEX) The process by which aptamers are selected is called Systematic Evolution of Ligands by EXponential enrichment (SELEX), which was introduced by two independent laboratories in 1990.66, 67 Typically, the SELEX process is a combination of in vitro evolution and combinatorial chemistry.

PAGE 20

20 Figure 1-2. The SELEX process. The library containing DNA or RNA molecules is incubated with the protein target of interest. The DNA/RNA bound to the target is separated from the unbound sequences. Separated high affinity sequences are amplified by Polymerase Chain Reaction (PCR), and this process is repeated until the library is enriched with the potential aptamer sequences. The first step involves the chemical synthesis of a DNA library with completely random base sequences flanked by pre-defined primer binding sites. The initial library of the SELEX process is incredibly complex with at least 1015 different DNA molecules. The immense complexity of the generated pool justifies the hypothesis that the library will contain a few molecules with unique three-dimensional structural characteristics to facilitate specific interactions with the target molecule. As exemplified in Figure 1-2, a typical selection process involves successive incubation and separation of high affinity binders, followed by PCR amplification. Finally, the evolved DNA library is cloned and sequenced to obtain the potential aptamers. However, the high complexity of the library leads to difficulties in the separation of the few desired sequences

PAGE 21

21 from the rest of the library. Thus, a well controlled and effective partitioning process is the key step in increasing the efficiency of aptamer selection. Separation Methods in SELEX Conventional SELEX Separation Techniques Nitrocellulose filters and affinity chromatography are established methods for separating protein bound sequences 68, 69 In nitrocellulose filtration, the DNA or RNA library is incubated with the protein target and filtered through a nitrocellulose film. Since nitrocellulose is sticky only to the protein molecules, the protein-nucleic acid complex is retained on the film, while the free nucleic acids are removed. Denaturing reagent is introduced to dissociate the bound nucleic acid sequences from the complex prior to the PCR amplification step. While the nitrocellulose filter binding method is most common, several studies have demonstrated that the unbound DNA/RNA sequences interact nonspecifically with the nitrocellulose membrane and interfere with the separation efficiency of the selection process.70 This non-specific interaction of DNA with the membrane often results in the enrichment of sequences that have a high affinity towards the membrane instead of the proteins, resulting in a high background with false positive sequences. The problem can be partially counteracted by introducing a high-salt washing to remove the non-specifically bound sequences. In using affinity columns, the target protein is immobilized on a solid support. The SELEX library is passed through the column, and the sequences with high affinity towards the target protein are retained. The bound sequences are subsequently removed and used for PCR amplification. A major limitation of affinity columns is the need to immobilize the protein target, thereby hindering access its potential binding pocket. Thus, use of both nitrocellulose filters and affinity columns can limit the selection of aptamers. For this reason, there has

PAGE 22

22 recently been increased effort to introduce cost-effective, simple, and efficient techniques for the separation of aptamer sequences from the library. Novel SELEX Separation Strategies Target-immobilized magnetic beads71 and capillary electrophoresis (CE)72-75, are newer methods for SELEX separations. The magnetic bead method is rapid and easy, and it requires a relatively low sample volume, but it suffers from the same flaws as affinity columns; i.e. potential loss of the binding site due to immobili zation of the target on to the magnetic beads. Non-specific interactions of magnetic beads with the DNA library can also hinder the selection efficiency. Capillary electrophoresis offers several advantages for SELEX separations. This method provides high separation efficiency, and the selection occurs in free solution so there is little nonspecific binding observed. A schematic of the method is shown in the Figure 1-3. DNA library containing protein-bound and unbound sequences is injected into the capillary and a high electric filed is applied. Because of their relatively small sizes the unbound sequences migrate rapidly and leave the capillary first. The bound sequences migrate more slowly and are collected as they elute. Subsequently, the high affinity sequences are further amplified using PCR. The process is repeated until the library is enriched with aptamer candidates. Aptamer Signaling as Molecular Probes in Cancer Protein Analysis Specific signaling aptamers, which combine binding specificity and signal transduction capability, are promising probes for real-time detection of nucleic acids and proteins both in vivo and in vitro Recent studies from our group have shown that signaling aptamers can recognize Platelet-Derived Growth Factor (PDGF) and thrombin in a complex biological mixture.76-78 However, one of the major limitations in using aptamers in vivo is their susceptibility towards nuclease degradation.

PAGE 23

23 With the advancement of fluorescent based techniques, many research groups have focused on developing signaling aptamers (aptamer beacons) that may have potential as in vitro diagnostic tools.79 Figure 1-3. The CE-SELEX process. After incubation with the protein target the library is injected into the capillary. Upon application of the electric field, free DNA sequences migrate faster (peak highlighted in blue) than the DNA sequences bound to the protein target (peak highlighted in red). The separated bound DNA sequences are amplified and proceed to subsequent rounds of selection. Signaling aptamers are types of molecular beacons, in which an aptamer is incorporated into fluorescence based signaling mechanisms. As a result, selection methods that incorporate Fluorescence Resonance Energy Transfer (FRET) based mechanisms80 have been introduced usually as a FRET pair, into the starting library. However, one of the challenges in using fluorescence based signaling aptamers as a diagnostic tool is the high background signal of the biological fluids. One report addressed this problem by engineering a structure switching excimer aptamer probe targeting Platelet Derived Growth Factor.81 This excimer aptamer probe

PAGE 24

24 represents the first study demonstrating the potential uses of aptamers as in vitro diagnostic probes for cancer markers. Despite the demonstrated success in selecting aptamers against single proteins, the application in real systems is still a challenge, because the aptamers are selected in artificial buffer systems where only the target protein is present. Non-specific interactions with nuclear proteins commonly present in real biological samples are known to interfere with the specific recognition. 82, 83 Another limitation is the rapid nuclease degradation. In order to prevent nuclease degradation, several reports have successfully used modified aptamers, with -OCH3, NH2, -F substituents at the 2 position of the sugar ring. 82, 83 Also, use of locked nucleic acids have shown an increase in nuclease resistance82, 83. Multiple Aptamer Probes Targeting Whole Living Cells For cancer diagnosis and study, there has been increasing interest in identifying aptamers for more complex targets such as cells. Use of living cells as the targets for aptamer selection will enable the generation of a panel of aptamers capable of binding to native cell membrane proteins. The use of whole cells as targets to select aptamers offers several advantages:84, 85 A panel of aptamers can be selected to target multiple proteins for the cancer study. This can be achieved without prior knowledge of up/down regulated genes related to the proteins. Aptamers selected against whole cells can lead to the discovery of novel biomarkers even when the expression of distinct protein candidates is not known in advance. By chemical modification of aptamers, the aptamers can be converted into specific transporters of drugs in therapeutic approaches. Aptamers selected against whole cells can be used as in vivo imaging agents. Use of subtractive SELEX strategy can reveal protein expression profiles, which can effectively distinguish the transformed cells from healthy cells at a molecular level. Finally, the aptamers are selected against the native state of the proteins in the cellular environment.

PAGE 25

25 For the above mentioned reasons, cell-based aptamer selection is a promising scheme for the creation of molecular probes for profiling and imaging of cancer. The first example of cell-based aptamer selection was a whole cell selection for antiProstate Specific Membrane Antigen aptamer (PSMA).86 PSMA is a tumor marker for prostate cancer, and its expression is primarily prostate specific. In this study, Lupold et al.86 selected RNA aptamers for targeting the extra-cellular domain of the PSMA fusion protein. To increase the nuclease stability of the aptamers in the serum, 2-fluoropyrimidines were incorporated. The resulting aptamer was able to recognize PSMA expressed by prostate cancer cells, and demonstrated the feasibility of specifically selecting aptamers for known protein targets on a cellular membrane. Following this approach, the selection of an aptamer targeting U251 glioblastoma cells was reported.87 Glioblastoma is one of the most common brain malignancies. The aggressive nature of the glioblastoma cells is considered to originate from hyper-vascularity, focal necrosis, and rapid cellular proliferation. Out of the aptamers selected, authors reported that the target of the aptamer GBI-10 was tenascin-C, an integral membrane protein considered to be a stromal marker for epithelial malignancy. Two other studies reported the selection of aptamers with functional capability towards cell targets. Guo et al. demonstrated the feasibility of the selection of aptamers that promote cell adhesion using osteoblasts from human osteosarcoma cells.88 The author selected aptamers to act as osteoblast capturing probes in order to create artificial tissue engineering platforms. Another intriguing study showed aptamer selection against mutated human Receptor Tyrosine KinaseREarranged during Transfection (RTK-RET) using RET-expressing cells as targets.89 This work led to the selection of an aptamer that can recognize the extra-cellular domain of the

PAGE 26

26 RET receptor. One of the identified aptamers was shown to inhibit the dimerization of the RET receptor and blocked the downstream RET-dependent intracellular signaling pathways, demonstrating that the selected aptamers could be used as potential therapeutic agents for the RET receptor. Whole Cell-SELEX Strategy The selection strategies described above have all been designed to target a protein previously known to be present in the cell membrane. However, a recent study from our group demonstrated a universal strategy to select a panel of aptamers for whole cellular targets.84, 85 The newly developed cell-based aptamer selection method, called cell-SELEX, is illustrated in Figure 1-4. Using this approach, several aptamers were selected targeting a cultured leukemia cell line: a CCRF-CEM, which is a cultured precursor T cell acute lymphoblastic leukemia (ALL) cell line, and a B-cell line from the human Burkitts lymphoma Ramos cell line as the control. Introduction a counter selection strategy excluded the selection of the most popular receptors on all cell membrane surfaces, and minimized non-specific membrane interactions. The cellSELEX method generates highly specific molecular probes able to recognize one type of cancer cell line. In cell-SELEX, the initial library is incubated with the target cell line. Following incubation, the cells are washed to remove unbound DNA, and the bound sequences are dissociated by heating. The resulting sequences are incubated with a counter cell line to ensure the subtraction of common binders. Introduction of the counter selection step eliminates the possibility of selecting aptamers for common membrane proteins and enhances the probability of recognizing protein candidates exclusively expressed in the cell line. The supernatant now enriched with sequences that do not bind to the control cells, is collected and PCR amplified.

PAGE 27

27 Figure 1-4. The cell-SELEX aptamer selection process developed by the Tan group. A ssDNA pool is incubated with target cells. After washing, the bound DNAs are eluted by heating to 95C. The eluted DNAs are then incubated with negative cells for counterselection. After centrifugation, the supernatant is collected and the selected DNA is amplified by PCR. The PCR products are separated into ssDNA for the next round of selection. Finally the enriched library with aptamer sequences is cloned and sequenced to obtain aptamer candidates. 85 Figure 1-5. Enrichment of the pool with the desired sequences for target cells. (a) The green curve represents the background binding of the starting DNA library. An increase in fluorescence intensity with the number of cycles is indicative of enrichment of the affinity towards the target cells. (b) Little change is observed for the control cells.85 (For information on flow cytometry, see Appendix A) a b

PAGE 28

28 The progress of the selection is monitored by flow cytometry using fluorescence-labeled DNA libraries and aptamer probes, as shown Figure 1-5. This process is continued for about 20 rounds, and the resulting enriched library is cl oned and sequenced. The sequences are collected and aptamers are identified. Table 1-1. Screening of aptamers selected using Cell-SELEX. Each aptamer was screened with different types of leukemia cells to identify common receptor profiles. 85,90 Cell line Aptamer Sgc8a Aptamer Sgc3b Aptamer Sgc4c Aptamer Sgd2d Aptamer Sgd3e Cultured cell lines Molt-4 (T cell-ALL) ++++ +++ ++++ ++++ ++++ Sup-T1 (T cell-ALL) ++++ + ++++ ++++ ++ Jurkat (T cell-ALL) ++++ +++ ++++ ++++ ++++ SUP-B15 (B cell-ALL) + 0 ++ + 0 U266 (B-cell myeloma) 0 0 0 0 0 Toledo (B-cell lymphoma) 0 0 ++++ ++++ + Mo2058 (B-cell lymphoma) 0 ++ ++ 0 + NB-4 (AML, APL) 0 0 +++ ++++ 0 Cells from patients TALL Large B-cell lymphoma ++ 0 +++ 0 +++ 0 +++ 0 +++ 0 See appendix A for an explanation of used for binding tendency (i.e. ++++, +++, etc) AML: acute myeloid leukemia; ALL: acute lymphoblastic leukemia, APL: acute promyelocytic leukemia. a-e: Aptamers Sgc8, Sgc3, Sgc4, Sgd2, sgd3 selected against T-cell acute lymphoma cell line: CCRF-CEM respectively (see reference 85 and 90). For more information on flow cytometer analysis see Appendix A. The aptamers selected in the previous study84, 85 were also tested to determine their feasibility as molecular probes for recognition and targeting. Since one aptamer interacts with protein targets on the cell membrane, the probes were tested with different leukemia cell lines to investigate common protein profiles as shown in Table 1-1.90 Several of the aptamers selected against the T-cell leukemia cell line also showed binding with other categories of leukemia cells. For example, aptamer Sgc3 primarily recognizes T cell acute lymphoblastic leukemia cells, while aptamer Sgc8 recognizes both B-cells and T cell acute lymphoblastic leukemia cells. The

PAGE 29

29 results summarized in Table 1-1 indicate that a panel of aptamers specific for each cell type is useful in revealing overor under-expressed sp ecific protein signatures, thus eliminating the need for detailed knowledge of distinct expression patterns of membrane proteins prior to selection. Applications of Aptamers in Cancer Biomarker identification has enabled the development of therapeutic applications that can precisely target elevated levels of proteins or genes. Such approaches anticipate that targeted imaging of elevated levels of cellular molecules may be used as a tool in diagnosis and or therapy. Currently, a number of techniques have been used to image tumors. For example, one study exploited the increased glycolysis in cancer by observing the increased uptake of 18Flabeled fluorodeoxyglucose by positron emission tomography (PET).91 In addition to PET, there are many other imaging techniques available, such as magnetic resonance imaging (MRI),92 computed tomography (CT),93 ultrasound methods and optical technologies.94 These methods for whole-body imaging provide primarily anatomical information or functional information at a macroscopic level. Recent research has focused on cellular-level recognition using specific binding by molecular probes, which can produce or alter signa ls that are detected by imaging devices such as PET. However, a major limitation is inadequate availability of tumor specific imaging probes. This lack results in low sensitivity and reduced specificity, as well as poor spatial localization in clinical applications of molecular imaging. In this regard, aptamers can be effective candidates for new probes for both biomarker identification and therapeutic targeting of tumor cells.90, 95-99 For example, labeling oligonucleotides with gamma or positron emitters for in vivo imaging has been already demonstrated. 100, 101 In particular, the labeling of a phosphodiester oligonucleotide with 18F showed potential for in vivo imaging in a primate PET study.100, 101

PAGE 30

30 Use of aptamers as molecular imaging probes in combination with PET will greatly increase the specificity of current imaging techniques. A recent study demonstrated that an aptamer specifically selected against tenascin-C (aptamer TTA1) and modified with 99mTc could be used as an imaging probe to specifically recognize tenascin abundant cell surfaces.102 Aptamer TTA1 was chemically modified with 2'-F-pyrimidines and 2'-OMe-purines to increase the nuclease resistance in vivo It has been modified with a 3-3 linkage to increase the stability, and the 5 end was modified with diethylenetriaminepentaacetic acid (DTPA) via a polyethylene glycol (PEG) linker. The DTPA chealates with 99mTc for imaging aptamer localization. This study demonstrated the potential applicability of aptamers in xenografted human tumor imaging. Results from our laboratory have also demonstrated the wide-range of feasibility of aptamerbased cell profiling and imaging using a cocktail of labeled aptamer probes to target specific cell types.84,85 Aptamers can also be chemically modified for drug delivery. Recently, two studies were published describing aptamer conjugated to a chemotherapeutic drug doxyrubicin95 and a toxin.96 Because most of the chemotherapeutic agents are DNA intercalating reagents, DNA/RNA aptamers themselves can carry packed chemotherapeutic agents, but toxins must be conjugated to the aptamer. For example, anti PSMA (Prostate Specific Membrane Antigen) aptamers were conjugated to recombinant gelonin an N-glycosidase protein. Gelonin causes cell death by cleaving a specific glycosidic bond in rRNA, thus disrupting protein synthesis. The aptamertoxin conjugates showed IC50 (Inhibition Concentration) of 27nM for cells which express PSMA compared to non-PSMA expressing cells. Also, two independent studies have demonstrated the feasibility of using aptamers for gene therapy using SiRNA.97,103 Since the aptamers can readily be chemically modified to conjugate

PAGE 31

31 biomolecules with different functionalities, aptamer-SiRNA complexes were designed for release after internalization into the endosome. Aptamers and Antibodies The interaction of an antibody with its epitope is analogous to binding of an aptamer with its target. Even though antibodies have been known for more than three decades, aptamers show inherent advantages that merit their application in biomedical and analytical sciences, as well as in basic molecular biology.104 Unlike antibodies, which need tedious procedures involving animals for production, generations of aptamers can be prepared by a simple automated chemical reaction. Since aptamers are short DNA/RNA strands, they have much longer shelf lives than antibodies. Aptamers are stable and chemically robust, and are able to regain activity after exposure to heat and denaturants. Also, the selection process can be manipulated to obtain aptamers with desired properties for binding to specific regions of the target proteins. In biomedical applications, use of antibodies is limited by their large size and their inability to penetrate large solid tumors.105 However, aptamers are smaller in size, and they show higher penetration and higher clearance rates compared to antibodies. Affinities of aptamers are comparable with antibodies, with KD ranging typically from 0.3 to 500nM. 53, 106-110 Photodynamic Therapy While use of SiRNA and other chemotherapeutic agents are successful in treating cancer, these drugs must be co-localized in a specific cellular compartment in order to produce their therapeutic effects.111 Photodynamic therapy (PDT) is an alternative method which cleverly exploits the ability of a photosensitizer (PS) to be excited into the excited state by UV, visible, or near infra-red light ( = 200nm-700nm). The excited PS reacts with dioxygen in the surrounding tissue to produce singlet oxygen which subsequently reacts with unsaturated double bonds to disrupt cell membranes and protein structure. The lifetimes of singlet oxygen in biological

PAGE 32

32 systems is typically around 0.04 microseconds, and, as a consequence, the radius of action of photo damage is considered to be 0.02 micrometers.112 Thus, PDTs with predetermined localizations are considered to be among the most effective treatment modalities for cancer. This technique was introduced in the 1890s by Finsen who treated the skin condition lupus vulgaris using a heat filtered light from a carbon arc lamp.113 The Nobel Prize was awarded to Finsen in 1903 for his investigations of the use of light to cure diseased cells. Mechanisms of Photosensitizing Action The PDT process is summarized in the extended Jablonski diagram shown in Figure 1-6. When the porphyrin moiety of PS absorbs light of the correct wavelength, it is excited to the first excited singlet state, S1. The S1 state can return to the ground state by fluorescence or radiationless decay, or it can undergo intersystem crossing to a triplet state, T1, which is longer lived and chemically more reactive than S1. For this reason, most of the biological reactions are mediated by PS in the triplet state, which can interact with the triplet ground state of O2 to generate the excited singlet state of oxygen and return PS to its ground state. This excited oxygen can induce photo-oxidative reactions with various biomolecules. Biological Damage of Singlet Oxygen The generated singlet oxygen can react with unsaturated lipids and amino acid residues (Figure 1-7).114 Since unsaturated lipids and proteins are commonly present in biological membranes, the major cause of cell death is damage to the cell membrane. This leads to vascular shutdown and necrosis. Photo damage to the membrane activates the immune system, which is triggered to recognize, track down and destroy the remaining tumor cells. Current Delivery Systems in Photodynamic Treatment. Efficiency of PDT is determined by successful localization of the PS in diseased tissue. Unlike other chemotherapeutic or toxin agents, the PS does not need to be released from the

PAGE 33

33 delivery agent. As long as the delivery agent sh ows preferential selectivity for the target tissue, the improved photo-destruction will take place. Figure 1-6. Extended Jabonski diagram. The generation of excited porphyrin states and reactive dioxygen species is illustrated. State energies: blue porphyrin sensitizer, green dioxygen. Upon irradiation of light the porphyrin is excited into excited states which then react with ground state triplet oxygen in the surrounding tissues. For this reason, an improved delivery system for PSs will preferentially increase the concentration of the PS at the diseased cells and increase PDT effectiveness. A number of PS delivery systems have been introduced. Phot oimmuno conjugates comprise the most common approach.115 The idea is that new antigens specific for diseased cells are present in the tumor cells, and it is possible to exploit the specific recognition of a monoclonal antibody (MAb) for its antigen. However, a limitation of this procedure is the need to conjugate the PSs to the antibody. After the conjugation of molecules to MAbs, the antibodies can lose their affinities toward their antigens. Besides, due to their large sizes, the tissue penetration efficiency of PS/Mab conjugates is poor. For this reason, alternative approaches have been introduced. For example,

PAGE 34

34 PSs have been conjugated to serum proteins such as bovine serum albumin (BSA), 116 low density lipoproteins (LDL)117, annexins118, steroids119 and transferrin.120 Figure 1-7. Reactions of singlet oxygen with biomolecules. Singlet oxygen react with molecules containing unsaturated bonds and amino acid residues,resulting in damage to membranes and proteins However, these delivery systems have shown non-specific localization into different sites, difficulties in conjugation chemistries, and the loss of specificity, and affinity after conjugation, thus decreasing their targeting ability and effectiveness as delivery agents. Alternatively, conjugation of a PS with an aptamer may provide a more effective way to deliver the PS to the target site.

PAGE 35

35 Overview of Dissertation Research The scope of the research work presented here is to investigate the applicability of aptamers as probes in cancer studies. First, CE-SELEX methodology was used to select an aptamer targeting a tumor promoting protein. In a second project, aptamer selected using cellSELEX method was used to identify a cancer-cell specific biomarker. The aptamer binds to biomarker was subsequently used for therapeutic targeting of tumor cells. Finally, a fourth project demonstrates proof-of-concept of aptamer-based pro-drug design.

PAGE 36

36 CHAPTER 2 SELECTION OF HIGH AFFINITY DNA LIGANDS FOR PROTEIN KINASE CIntroduction Development of fluorescent proteins, such as green fluorescent protein (GFP), that coexpress with a protein of interest has been widely applied and can be considered as the most successful way to monitor molecular events in real time121 However, co-expression, in particular for protein kinase C-delta (PKC has been shown to affect its biological function. One way to address this problem is the development of PKC specific probes that can track the translocation of the protein in vivo Recent studies from our group demonstrated that fluorescently labeled aptamers can be used as tools to study protein-protein interactions.122 The focus of this chapter is, therefore, to select DNA aptamers and to develop DNA based fluorescent probes targeting PKC Protein Kinase C Family of Proteins Protein Kinase C is a family of serine and threonine kinases that mediate a wide variety of cellular signaling processes such as cell growth, differentiation, apoptosis and tumor development.123-125 Also, PKC is known as the major receptor for tumor-promoting phorbal esters in the cell. To date, eleven isoforms of PKCs have been identified. Based on the structural composition of the regulatory moiety, three major sub families are known: 1) conventional PKCs with four homologous domains, whose activation depends on calcium and responds to diacyl glycerol (DAG) or 12-Otetradeconoylphorbal-13-actate (TPA), 2) novel PKCs activated by DAG, or TPA, which are calcium independent, and 3) atypical PKCs, whose activation mechanism does not depend on DAG, TPA, or calcium.126 We are interested in PKC isoform (PKC ), which is ubiquitously distributed in a variety of cells and belongs to the novel PKC (group 2) sub family. Changes of the cellular processes

PAGE 37

37 observed with/without treatment of cells with TPA are assumed to be mediated by PKC Extensive biochemical studies have established that PKC is mainly implicated in regulation and programmed cell death in non-cardiac cell types.127 Furthermore, unlike closely related isoforms PKC and PKC PKC slows proliferation, induces cell cycle arrest, and enhances the differentiation of the various undifferentiated cell lines.128 Also, PKC activates NF B (nuclear factor B), which is a ubiquitous transcription factor that plays a key role in regulating the immune and inflammatory responses.129, 130 The interaction of binding and anchoring proteins specific for PKC plays a significant role in co-localization and interaction with specific substrates.131 The mechanism of PKC signaling is frequently studied by producing stable cell clones that over-express PKC with a fluorescent reporter using corresponding expression vectors and/or by using fluorescently labeled protein specific antibodies.132 Apart from using antibodies, recent work has shown that fluorescence resonance energy transfer (FRET) based reporters for kinase activities are viable probes for phosphorylation in live cells. 133 However, several studies indicate that the over-expression is not always physiologically relevant. For example, several groups reported that over-expressed PKC iso-enzyme overwhelmed the endogenous enzyme, causing non-specific localization and substrate phosphorylation in CHO cells,134 smooth muscle cells,135 NIH 3T3 fibroblast cells,136 human gliloma cells,137 and capillary endothelial cells.138 For these reasons, development of a new methodology for specific fluorescence labeling of endogenous proteins including PKCs would be very useful. In this regard, use of aptamers as reporter molecules to track PKC translocation can be promising. One way to obtain protein-specific DNA aptamers is by capillary electrophoresis based systematic evolution of ligands by exponential enrichment (CE-SELEX).72, 73, 75 This

PAGE 38

38 method has shown significant advantages over conventional SELEX techniques. For example, the first study on CE-SELEX was reported to ob tain aptamers with low-nanomolar dissociation constants in only four rounds of CE-SELEX. 73, 75 In this work, we have used CE-SELEX to identify DNA sequences which specifically bind to PKC with the objective of producing fluorescent probes for in vitro studies. Materials and Methods Instrumentation PCR was performed using a Bio-Rad thermocycler. The CE instrument that was used is a home-made CE system (see Figure 2-1). Radi ation quantification was done using a Bio-Rad personal phospho-imager. Fluorescence measurements were made on a JOBIN YVON-SPEX Industries Fluorolog-3 Model FL3-22 spectrofluorometer. Initial Library Design The aim of the SELEX experiment was to identify DNA sequences that specifically bind to PKC and to develop fluorescent probes targeting PKC The SELEX process was initiated by preparation of an initial library, consisting of a pool of oligonucleotides with a continuous stretch of 30 randomized nucleotides. The random sequences were flanked on both sides by fixed sequences used for the hybridization of PCR primers during subsequent rounds of amplification. SELEX library: 5-GCCAGGGGTTCCACTACGTAGA (N)30 ACCAGGGGGCAGAGAGAAG GGC-3 Reverse Primer: 3-CGGTCCCCAAGGTTGAGCATCA-5 All oligonucleotides, including PCR primers, were synthesized using standard phosphoramidite chemistry and purified by denaturing Poly Acrylamide Gel Electrophoresis (PAGE) to remove truncated DNA fragments produced in the chemical synthesis.

PAGE 39

39 PKC Expression and Purification Human recombinant PKC was a gift from the laboratory of Dr W. Cho, University of Illinois at Chicago, and was over-expressed from E. Coli stain BL21 (DE3) and purified using Ni beads PCR Optimization Once the library was synthesized, the next step was PCR optimization of the DNA library. PCR is one of the major steps in the SELEX process, and it is necessary to optimize the conditions (melting temperature, number of cycles) for PCR to obtain the highest yield without any nonspecific amplifications. The final optimized conditions for the PCR reaction were: 23 ng of forward primer, 23 ng of biotin-reverse primer, 0.4 mM each of DNTP and 10 mM Tris-HCl (pH = 9.2) with 3.5 mM MgCl2, and 75 mM KCl buffer in 50uL reaction volumes. A total of 15 cycles of denaturation (30 s, 95C), annealing (3 0 s, 57.5C), and extension (20 s, 72C) were performed followed by final extension for 5 minutes at 72C. The PCR products were verified by analyzing aliquots on 2.5% agarose gel stained with ethidium bromide. In order to obtain a single stranded DNA library of the PCR amplified product, a second PCR amplification was carried out using 3-biotin-attached reversed primer. Amplified DNA was made single stranded using streptavidin sepharose (Amersham Biosciences, Upsala, Sweden). Double stranded DNA from the PCR reaction was added to the equilibrated streptavidin column, which was washed with PBS buffer. The dsDNA, which was retained in the column, was eluted with 200 mM NaOH. The eluted DNA fraction was de-salted using SephadexTM G-25 DNA grade NAP columns (Amersham Biosciences, Upsala, Sweden). Recovered DNA was quantified by measuring the absorbance at 254 nm and was used in the following/subsequent round of selections.

PAGE 40

40 Combinatorial Selection of Aptamer A 2mM solution of the library was prepared in the binding buffer (10 mM HEPES, 0.1M NaCl, 1mM DTT, 8.1mM Na2HPO4, 1.1mM KH2PO4, 1mM MgCl2) at a pH of 8.05. Before selection, the 2mM DNA library was denatured at 95C for 5 minutes and then cooled at 4C. Human recombinant PKC was diluted in the binding buffer and added to the DNA library to give a final PKC concentration of 50nM. The mixture was kept at room temperature for 15 minutes to allow complete binding. The CE selections were performed on a home-made CE system, shown in Figure 2-1. A high-voltage power supply (Gamma High Voltage Research Inc., Ormond Beach, FL) provided the electric field. DNA was detected using a UV/Vis detector (CE-Thermo Capillary Electrophoresis, CRYSTAL 110). A m 36cmlong (26 cm to detector), poly(vinyl alcohol)-coated capillary (Agilent Technologies, Palo Alto, CA) was used for separations. Each day, capillaries were initially flushed with CE separation buffer (8.1mM Na2HPO4, 1.1mM KH2PO2, 1mM MgCl2, 2.7mM KCl, 40mM NaCl, pH 8.08) for 30 minutes. An initial potential of 12.5kV was applied during separations. However, after the 4th round, the applied voltage was reduced to 7.5kV to prevent base line interferences due to Joule heating. For CE-SELEX selections, samples were injected onto the capillary hydrodynamically ( h= 5cm, 10s), and absorbance at 254nm was monitored. After non-binding sequences migrated through the capillary, CE fractions containing high affinity DNA sequences were collected into a sample vial by applying pressure. Aptamer Labeling with AT32P Samples containing oligonucleotide (3.74nmole) and [-32P] ATP (8.3pmole) were incubated overnight at room temperature with 50 units of polynucleotide kinase (Promega). Unincorporated ATP was removed using a G-25 column (Amersham Biosciences).

PAGE 41

41 Figure 2-1. Home made CE set-up used in SELEX experiments. Samples were introduced hydrodynamically. Protein-DNA complexes were collected by applying pressure to push the samples out of the capillary. Electrophoretic Mobility Shift Assay (EMSA) Binding of aptamers to the human recombinant PKC was investigated by EMSA. Native 4% polyacrylamide (16cm 20cm 1.5mm) gels were prepared using stock solutions of 40% acrylamide, 2.6% bisacrylamide, 10X TB, pH 8.5 95% glycerol, and 10% ammonium persulfate. The gels were equilibrated at 4C and 20mA for 30 minutes prior to sample loading. The proteins and the DNA were serially diluted in 30% glycerol and binding buffer, respectively. Aptamers (8nM final concentration) were incubated for 30 minutes with increasing amounts of PKC (0-2uM) in 2X binding buffer with 200g/uL BSA in a final volume of 25 L. At the end of the incubation, samples were loaded while the current was running. Electrophoresis was continued at 30mA constant current for three hours. A quantitative analysis of the relative amounts of the radioactivity present in the different bands was obtained from direct counting of the gel on a Bio-Rad instant phosphor imager system. Despite the enrichment achieved in the 8th

PAGE 42

42 round, we introduced an additional gel retardation step to eliminate the low affinity sequences from the pool. A separate preparative EMSA assay was performed after the 8th CE-SELEX round using 8nM of PKC and 100nM of DNA library from the 8th pool. In order to avoid to the non-specific interactions, the DNA concentration was increased by a factor of 10 by adding sheared salmon-sperm DNA to the binding buffer. DNA sequences bound to protein were extracted using the crush and soak method in wh ich the band corresponded to the DNA-Protein complexs was excised from the gel and crushed followed by soaking in the elution buffer to elute bound DNA. 139 The DNA bound to the protein was recovered by phenol extraction followed by ethanol precipitation. Cloning and DNA Sequencing The resulting pool from the 9th round was PCR amplified, cloned using the TOPO-TA cloning kit (InVitrogen, Carlsbad, CA), ligated into the TA cloning vector and transformed into Escherichia coli. White colonies were isolated and sequenced using a 96-well format MegaBACE 1000 capillary sequencer (GE Healthcare) at the ICBR sequencing facility. The resulted sequences were analyzed with the program Sequencing Analysis Clustlaw 6.0 software. Fluorescence Anisotropy Measurements Fluorescence measurements were performed on a Fluorolog-Tau-3 spectrofluorometer (Jobin Yvon, Inc., Edison, NJ). All experiments were carried out at room temperature using a 100 L cuvette. The fluorescence intensity of the aptamer was monitored by exciting the sample (TAMRA label) at 555nm and measuring the emission at 585nm. Bandwidths for both the excitation and the emission monochromators were set at 10nm. Corrections were also made for potential dilution factors in the titration experiments.

PAGE 43

43 Results and Discussions The SELEX Process The need for effective separation methods in SELEX experiments is described in Chapter 1. The SELEX process is a versatile method for identifying nucleic acids that bind to proteins with affinities and specificities comparable to antibodies. The aim of the SELEX experiment described in this chapter is to identify DNA sequences that specifically bind to PKC with the objective of developing fluorescent probes. One of the advantages of CE-SELEX is its high separation efficiency, which reduces the number of selection rounds required to achieve an enrichment of the library. For example, the first study by Bowser group on CE-SELEX was reported to obtain aptamers in the sub-nanomolar affinity with only four rounds of selection. 72 After the synthesis of the DNA library, PCR conditions were optimized. As shown in Figure 2-2, after 15 PCR cycles the amplification was sufficient to proceed with the selection. The positive control sequence with identical primer sites was also amplified correctly, while the negative control with no template sequences was not amplified indicating that no primer-dimer formed or non-specific amplification of contaminant had taken place. One difference of CE-SELEX compared to conventional SELEX techniques, is the smaller sample volumes. Usually, the conventional SELEX experiments are performed using a larger volume of very diverse DNA library, because having a large number of independent sequences increases the probability of finding high affinity sequences. So, scaling the volume of a DNA library down to dimensions typical for CE can hinder the selection of the best aptamers. For example, synthesis of DNA strands composed of 30 random bases produce 1014 to 1015 independent nucleic acid sequences. During the first round of selection, it is necessary to introduce all independent sequences to capture the best aptamer. In CE-SELEX, the introduction of large number of DNA sequences can be done in two ways:

PAGE 44

44 Figure 2-2. PCR Optimization. Lane 1: 25bp ladder, Lane 2: negative control (without template sequence), Lane 3: positive control ( DNA template with identical primer sites) Lane 4: amplified DNA library. The positive control and the DNA library were amplified in 15 PCR cycles. The negative control does not show any bands, indicating that no primerdimer formation or non-specific amplification had taken place. The final optimized conditions for the PCR reaction were: 23 ng of forward primer, 23 ng of biotin/-reverse primer, 0.4mM each of DNTP and 10 mM Tris-HCl buffer (pH = 9.2) with 3.5 mM MgCl2 and 75 mM KCl in 50uL volumes. A total of 15 cycles of denaturation (30 s, 95C), annealing (30 s, 57.5 C), and extension (20 s, 72C) were performed followed by final extension for 5 minutes at 72C. The PCR products were verified by analyzing aliquots on 2.5% agarose gel stained with ethidium bromide. (1) Use of large injection volumes (still much smaller than conventional SELEX volumes) to increase the number of molecules used in CE-SELEX, and (2) use of high concentration of DNA library, thereby increasing the number of potential binders in the starting pool. Since the injection volumes can not be significantly manipulated, we initiated the SELEX process by employing a high concentration of DNA library (2mM), which provides 1013 DNA molecules with an injection volume in the nano-liter range. The disadvantage of using a high concentration of DNA is that the peaks observed in the CE are relatively broad and can interfere with the separation efficiency (see Figure 2-3). Also, these large peaks can be mis-shaped due to the high ionic concentrations employed in the experiments. Both high concentration of ions and analytes can lead to de-stacking of the flow of

PAGE 45

45 ions giving broad peaks. This is the major drawback in using CE as the separation method in SELEX experiments. Figure 2-3. Electropherogram of 2mM DNA library. Observed electropherogram of 2mM DNA library with retention time of 129 seconds. The peak width observed for the DNA library is 30 seconds, which is much larger than typical CE peak widths. CE conditions: Binding buffer with 10mM HEPES,1mM MgCl2, 16mM KCl pH 8.05, 12.5kV at room temperature, UV detection at 254nm Therefore prior to the actual selection, we estimated the migration time of the free library by observing the absorbance of DNA at 254nm (see Figure 2-3). This allowed us to estimate the collection time of the protein-DNA complexes which migrate more slowly than the free DNA. Prior to the SELEX experiments, the initial DNA library was denatured and then slowly cooled to room temperature to allow the formation of stable secondary structures. During the first 2 rounds of selection, PKC was kept at 100nM concentration and incubated with the 2mM DNA library at room temperature for 15 minutes to allow complete binding. Typically, in SELEX experiments, the selection process starts with a low ratio of DNA to protein to allow all the binding species to be captured and amplified. However, as the selection progresses, the ratio

PAGE 46

46 of DNA to protein is increased to make the selection more stringent. This way, only the best binders will be retained, and the poor binders will be removed. Therefore, in our SELEX experiments, after the 2nd round of the SELEX process, the DNA-to-protein ratio was increased. Also, the pH of the buffer was adjusted to 8.05 to match the pI of the protein. When the free protein is at its pI, it carries no charge and does not migrate with the electrophoretic flow. Protein bound to DNA carries the negative charge of the DNA molecule and migrates ahead, with the electrophoretic flow, but because of the greater size of the protein-DNA complex, it migrates much more slowly than the free DNA. After the free DNA eluted to the waste reservoir, the voltage was applied for another five minutes. The outlet of the capillary was then placed into a collection vial and pressure was applied to push the DNA-PKC complex out of the capillary. Captured fractions were PCR amplified using 50 L reaction volumes. A second PCR step was employed with a biotinylated reverse primer and dsDNA was converted in to ssDNA using a streptavidin column. Even though CE shows high separation efficiencies, we did not achieve enrichment with a low number of SELEX rounds (fewer than 4 rounds). The initial paper 73 introducing the CESELEX method, used human recombinant IgE as the target. The molecular weight of IgE is 115kDa. In comparison, the molecular weight of PKC is 70kDa, significantly less than IgE. Since the mobility shift depends on the differences of the molecular weights of the protein-DNA complexes and the free DNA, the mobility shift of PKC D is considerably less. Due to this smaller difference, the free and bound DNAs are not separated well, increasing the probability of collecting non-specifically interacting sequences. This effect of size difference on the separation using CE-SELEX can limit the versatility of CE-SELEX method.

PAGE 47

47 The peak shape is also a potential limitation of the CE-SELEX technique, because low affinity sequences migrate in different rates, resulting in broad peaks. Figure 2-4 exemplifies the observed absorbance at 254nm of the libraries corresponding to pools from 2, 4 5 and 8. As shown in Figure 2-4, even with 100uM DNA, th e peaks observed in rounds 2, 4, 6 and 8 are significantly broad. Since only a few DNA sequences binding with PKC the peak corresponding to bound DNA sequences cannot be seen in Figure 2-4 because it is below the limit of detection. Figure 2-4. Electropherograms of the unbound DNA observed during SELEX rounds 2, 4, 6, and 8. DNA samples from the previous round were incubated with PKC and separated using CE. CE conditions are identical except for the voltage. Due to interferences from joule heating, the voltage was reduced to 7.5kV after round 2. Despite the number of the round, the peak corresponding to free DNA is broad which can decrease the separation efficiency. Despite these challenges, we achieved a significant enrichment of the library at the 8th round. The progress of the selection was monitored using Electro Mobility Shift Assay (EMSA) as described in the methods and materials. The results for the 8th pool and the initial library are shown in Figures 2-5 and 2-6, respectively. By comparing the binding curves corresponding to the initial library (Figure 2-6) and enriched pool from round 8 (Figure 2-5), we observed a 60% enrichment of high affinity sequences. Howeve r, since the enrichment was relatively poor, we introduced an additional gel extraction step to capture the sequences with the highest affinity.

PAGE 48

48 Figure 2-5. Affinity of enriched DNA pool from 8th round. A 3nM of 32P labeled DNA pool was incubated with 4, 8, 16, 32, 64, 128, 250, 500, 1000, 2000nM PKC and analyzed by EMSA image (4% PAGE). Fraction bound was plotted as a function of protein concentration. As the concentration of PKC increases, there is an increase in the bound fraction, indicating that the DNA pool has been enriched with specific binders. Figure 2-6. Affinity of starting DNA pool. 32P labeled starting library (3nM) was incubated with 4, 8, 16, 32, 64, 128, 250, 500, 1000, 2000nM of PKC and analyzed by EMSA. Fraction of bound DNA plotted was as a function of PKC concentration. Despite the increase in protein concentration, the fraction of bound DNA remains less than 20%, suggesting the starting librarycontained a low concentration of specific binders.

PAGE 49

49 Analysis of Consensus Secondary Structure of High-Affinity DNA Ligands The sequencing data for clones were analyzed using Sequencing Analysis Clustal W 6.0 software. As shown in the Figure 2-7, these were 53 sequences, of which 11 unique ligands can be grouped into 11 sub-families based on their sequence similarities. Typically, the classification of sequences is based on the fragments of sequences conserved during the selection due to evolution (color coded in Figure 2-7). Inspection of the evolved sequences for the group of ligands shown in Figure 2-7 shows short segments of conserved primary sequences, disrupted by less conserved sequence regions of different lengths. By observing the patterns of these conserved fragments, the individual sequences can be pooled into a single subfamily. The number on the right hand side of the Figure 2-7 corresponds to the random region of the starting library retained during the selection. Analysis of Binding Sequences for PKC According to CE-SELEX experiment, highly repeated sequences should be the best aptamer candidates. As shown in Table 2-1 sequence PB 9 represents a higher population in the library, while the population for sequence PB 12 smaller. This indicates that sequence PB 9 is a higher affinity sequence, while sequence PB 12 is a non-specifically enriched sequence. Therefore, sequence PB 9 was chosen for furt her investigation with PB 12 as the control sequence. The binding analysis of aptamer sequence PB 9 and sequence PB 12 was performed using EMSA. Each sequence was labeled with 32P and the resulting sequences were analyzed for fraction of binding with PKC using EMSA with a fixed protein concentration at 400nM. As expected, aptamer sequence PB 9 from the major class showed higher affinity towards the protein, i.e. higher fraction of bound sequence for a given concentration of PKC

PAGE 50

50 Aptamer_PB4-A06 --------G A TCCGGA CGC A CGGTGGG A TGG A C AA C -----------------28 Aptamer_PB4-G09 (PB 1) ------------CCG A CCAA CCGCGGGGGGC A C A CCTC ---------------26 Aptamer_PB4-F12 --------------A CGC AAA CCGTG A GTGGTGG AA GG A TC A TG ----------30 Aptamer_PB4-H03 -----CG AAC A GC A TCCGG A GG A CG AATCGGGTT A ------------------30 Aptamer_PB4-H05 ------G A CC A C A GCCG A GGCC --GG A C A TG A GCGTA C A --------------31 Aptamer_PB4-F09 --------GGA G A TC A GC AA CGTT A GG AAA C A C A GCT A ----------------30 Aptamer_PB4-C07 ( PB3) --------CGTG A GGCTG A G A CC A TGG A T A TT A GGGCC ----------------30 Aptamer_PB4-H12 -----CGC AAC A C A C A CGGG A CC A TC AAC A GT A C A -------------------30 Aptamer_PB4-E11 --------------TCGCG A CCT AA GGG A GC A CGTTCTGTCTCC A --------31 Aptamer_PB4-H08 --------GGT A GC A GG AAT A G A G A CGTG A GGCGT AAA ---------------30 Aptamer_PB4-B03 (PB4) --------CG AAGG AA GGG T A GCGG A TCG A G A GGGGG A --------------30 Aptamer_PB4-G01 ---------GC A GC AA GGC T A G AAA G A G A GG A C A GCGGT -------------30 Aptamer_PB4-F01 -----------GGC AA GGG A T A GGG AAAA GGGCGGGT AAA G ------------30 Aptamer_PB4-H07 ( PB5) --T A C AAA C A G A CC A GGTGGC A G A G A G AA GGGC--------------------31 Aptamer_PB4-F07 ------------CC A GCGGGC A G A G A G AA GGGCA CGGTGTG ------------29 Aptamer_PB4-D11 ---------G A GGC A GT AAA CGGGA G GGG A C AAA GGGCT--------------30 Aptamer_PB4-D06 (PB 6) ----------C A GCTGAA CGGCA GGCGTGG A C AA-GG A G A T ------------30 Aptamer_PB4-B10 -----------G A C A GGTGGA GGA GCG AAC AAGCGG A T --------------27 Aptamer_PB4-C08 --------G A G AAA G A G AA GGA GTG A G A CGC A G A C AAA ---------------30 Aptamer_PB4-F04 ---------A G A G A TGGTG A C A G A GG A TTGTG A TCTC A C --------------30 Aptamer_PB4-A10 ------TTGGG A GCCTTGGGTCCGGG AA C A C AAGGGC ----------------31 Aptamer_PB4-B12 (PB7) --------GGA GGA GCCG A GGGTCCC A G AA G AA GGG A -----------------29 Aptamer_PB4-D02 --------GTG-A CC A G AA GGTCC A-G A CTGGA GGCCGCC ------------30 Aptamer_PB4-B11 --------TGT A T A GCTCCC A TTC A TGGCGCTGGT A C -----------------29 Aptamer_PB4-E08 -----------GCA C A CCCC A CTG AA GGCTCCGGTGCGGT A -------------30 Aptamer_PB4-G06 -----------G A GGGGG A CG A GGTGAA TGC A C A CGGG A TT ------------30 Aptamer_PB4-F11 ( PB 8) ----------GGGTGGTG A CG A A TGGGTTGC A T A CCCG A T -------------30 Aptamer_PB4-H06 ---------GGTCT A TGTCG A T A TCGGTTGT A TCCGGGG --------------30 Aptamer_PB4-C10 --------GTGG AAA GG AA GTCCTCG A GGGT A TGCGGT ---------------30 Aptamer_PB4-A09 -----------C A GCCCTG A GC A TGCGT A CTCCCCCCTG A CCCC ---------33 Aptamer_PB4-G08 (PB 9) -----------A C A CG A CGGGAA T A CTG A CTCCCCCCC A TGT -----------31 Aptamer_PB4-E12 ------------TGCCCCGGCC A TTTGTCCT A C A CCCCCCTC -----------30 Aptamer_PB4-F06 ------------TGCC A CCCCC A C A G A CCTTTCCCCCCCT A G -----------30 Aptamer_PB4-G10 -----------C A GGC A GCTCCG AAA G A CGGG A CCCCCCC --------------29 Aptamer_PB4-G12 ---------TG AGTCCCCGC A CCA GCG A CCCTCCCCCCT -------------30 Aptamer_PB4-G11 ---------------G A GCGGCG AA GCTC A C A GCCCCCCC A C A C A --------30 Aptamer_PB4-B06.b ---------CGGGGCGGT A GTAA TTCCCTCC A G A TCGGT--------------30 Aptamer_PB4-E07 ( PB 10) ------------CCCT A GTGTT A CTCTA CCA C A T AATGC A TC-----------30 Aptamer_PB4-A07 ------------G A CC A CCGCTGTTC A CCCCGGT A CT A CTTC-----------30 Figure 2-7. Sequences obtained from high throughput sequencing of pool of round 9. The same color indicates the conserved similar sequence fragments captured during the evolution. The dash lines correspond to the fixed primer regions. Short fragment of sequences of the same color correspond to sequences evolved during the selection process. According to sequence homology, 11 subfamilies were identified.

PAGE 51

51 Aptamer_PB4-C11 (PB 11) ----C A TGC -TGCCA GGGGTTCC A CTA CGT A G A GGC AAT -------------34 Aptamer_PB4-E06 ------TGCC TGCCA GGG --TTC A CTA CGT A G A GGT A ---------------29 Aptamer_PB4-G04 --------CCGTGCC A GGGGTTCC A CTA CGT A G --------------------25 Aptamer_PB4-D12( PB 12 )TGGGG AACGG AA TGCCA GGGGTTCC A CTA CGT A G A -------------------35 Aptamer_PB4-D08 TTCGC A GTGCC A GGGGTTCC A CT A CGT A G A GTTGCTTC A TCCGCTC A T A TGC A CG 55 Aptamer_PB4-F02 C A GCGTGCC A GGGGTTCC A CT A CGT A G A GCG A TGTGGCTTGGGG A GGGTGCGT 53 Aptamer_PB4E1 TGCCA C -TGCC A GGTGTTCC A CT A CGT A G A T --GGG A CGGC AA GGTGG A C A GC A G 52 Aptamer_PB4-H10 ---G A C AA GGTGCC A GG GTTCC A CT A CGT A G A CCCGC AA CGGGGA C A CGCGC A CC A C 54 Aptamer_PB4-B02 (PB 13)---C A CGGGTCTCGTTGTCG AA TGCGTGC AA GG--------------------30 Aptamer_PB4-C03 -----TCTTCTCCTCTCCTTCTTT A CTA GTTGCG A T A CGT A GTGGAA CCTGGC 48 Aptamer_PB4-E03 --------GCTGCCTGTCC A TGTGA CTGG A TGTGCT A ----------------29 Aptamer_PB4-D01 -----------GCG A TTTCGTGTC AA CTGTTGTGTCGCCTC ------------30 Aptamer_PB4-H04 -----G A GCG A G A GTT AAGT-CTTTGGTTCGTGC AA-----------------30 Aptamer_PB4-D10 --TC A C A G AAA GGG A CTCC A TCTCC A CGGGC A ---------------------30 Figure 2-7. Continued Table 2-1. Evolved family of sequences with percentage of population. Higher percentages are indicative of sequences with preferential binding with PKC with high affinity. Family Sequence Percentage of Po pulation PB9 PB12 PB11 PB2 PB3 PB1 PB4 PB6 PB5 PB7 PB8 ACACGACGGGAATACTGACTCTCCCCCATGT TGGTGAACGGAATGCCGGGGCTTCCACTACGCAGA CATGCTGCCAGGGGTTCCACTACGTAGAGGCAA CCAGGGGGCAGAGAGAAGGGCATGGTGTG GTAAAGGGCCAAAGACTGTATGAATACCAT AGCCGAGTGCTCGCAACGGTTTAGCCCCAT CAACGAGAGTAGAACGAGGGGATGTCTGCA GGACGGGCAAAGAAAGAGGGAAGAGAACAG GCCAAGAGCAACGAGGAAGCAGGATAGGGC CATACGTGGTCATGCATACCCGTAACCGTT ACAAAAGAAGGAGAGGGAGAAGGGATAGGT 32% 4% 24% 11 % 9% 4% 4% 4% 3% 2% 2% As exemplified in Figure 2-8, compared with sequence PB 12, aptamer sequence PB 9 shows approximately five times higher binding with the given concentration of PKC After the demonstrating the affinity for PKC the feasibility of modifying the aptamer probe with a fluorescent label was investigated. Since the final goal of this study was to use the aptamer for fluorescent based assays, the binding constant of the labeled aptamer was determined by observing the change of fluorescent anisotropy of aptamer PB 9 labeled TMR (Tetramethylrhodamine) at the 5 end.

PAGE 52

52 Figure 2-8. Affinity of 32P labeled aptamer PB 9 to PKC 32P labeled aptamer PB 9 (14nM) was incubated with 400nM PKC in the binding buffer and analyzed by EMSA. Similarly, 14nM of 32P labeled PB12 incubated with PKC(400nM) was analyzed. Fraction of bound PB9 with PKC was normalized to 1. Binding of aptamer was PB 9 with is approximately 5 times higher than binding with PB 12, demonstrating the higher affinity of aptamer PB 9 towards PKC Fluorescence anisotropy is the measurement of the change in the rotational motion of a small molecule interacting with large molecule. Since aptamers are small molecules, binding to a large protein molecule significantly increase their molecular weights and decrease the rotational motion. This results in a detectable variation of the initial anisotropy. The fluorescence anisotropy r, is calculated by the equation: r = (IVV G IVH) / (IVV + 2G IVH) (2-1) Subscripts V and H refer to the orientation (vertical or horizontal) of the polarizers for the intensity measurements, with the first subscript to corresponding to the position of the excitation polarizer and the second subscript to the emission polarizer. The term G refers to the G-factor, which is the ratio of sensitivities of the detection system for vertically and horizontally polarized light.

PAGE 53

53 Figure 2-9 shows the binding curve generated by monitoring the change in fluorescence anisotropy of aptamer PB 9 upon addition of PKC The increase fluorescence anisotropy upon addition of aliquots of PKC indicates a change in the rotational motion of TMR labeled aptamer PB 9 when it binds with PKC Since TMR-labeled aptamer PB 9 is small, when it is free in solution, the rotational motion of TMR is high, resulting in low anisotropy. On the other hand, when aptamer PB 9 is bound to PKC the size increases significantly, thus, decreasing the rotational motion and increasing the anisotropy. Figure 2-9. Affinity of TMR labeled PB-9 to PKC Change of anisotropy of 5-TMR labeled aptamer PB 9 observed upon addition of PKC s aliquots of PKC are added the fluorescence anisotropy increases, because of the much larger size of the TMR labeled aptamer PB 9 bound to PKC On the other hand, control random sequence does not change its anisotropy with increase in concentration of PKC indicating that the random sequence does not bind to PKC The dissociation constant of the PB9-PKC was calculated from the fluorescence anisotropy data to be 122 nM. A control experiment with a TMR labeled random DNA sequence

PAGE 54

54 showed no significant change of fluorescence anisotropy when PKC was added, thus demonstrating that the fluorescently labeled aptamer probe PB 9 can bind with PKC specifically. Specificity of Aptamer PB 9 Since aptamer PB 9 showed high affinity towards the target PKC we wanted to assess the specificity of binding. Therefore, the specificity of binding of the aptamer PB 9 with human PKC was investigated by EMSA, using a similar protocol that was used for the binding assays indicated above. It has been reported in the literature that, high affinity of an aptamers towards one particular target does not necessarily mean that the binding is preferential for one target protein. For example, an aptamer selected against coenzyme A recognizes AMP, and an aptamer selected for xanthine also recognizes guanine.140, 141 Since the target protein PKC belongs to a closely related family of isoforms, the specificity of this aptamer towards PKC was assessed by measuring its affinities for PKC and closely for related PKC and PKC Figure 2-10. Specificity of aptamer PB9 towards PKC A 32P labeled PB9 (14nM) was added to a fixed concentrations nM) of PKC PKC and PKC and analyzed by EMSA. Fraction of bound aptamer PB9 with PKC was normalized and compared with other isoforms The affinity of aptamer PB9 for PKC is approximately 5-times the affinity for PKC and 2.5 times the affinity for PKC

PAGE 55

55 Specificity was measured using 32P labeled aptamer PB 9 and observing the fraction of bound DNA at a fixed concentration of each protein. As shown in Figure 2-10, the affinity of aptamer PB 9 towards PKC is approximately 5 times the affinity for PKC and approximately 2.5 times the affinity for PKC thus demonstrating the specificity of aptamer PB 9 towards PKC Conclusion We have selected DNA aptamers capable of in vitro PKC monitoring using CE-SELEX. This aptamer will enable us to apply fluorescently labeled aptamers to study protein-protein interactions in signal transduction leading to tumor promotion. In this work we have demonstrated that fluorescently tagged aptamer PB9 can specifically recognize PKC with aD of 122 nM under in vitro conditions. This work shows that, by using CE-SELEX, molecular probes can be generated for studying intracellular proteins and their functions.

PAGE 56

56 CHAPTER 3 APTAMER DIRECTLY EVOLVED FROM LIVE CELLS RECOGNIZES MEMBRANE BOUND IMMUNOGLOBIN HEAVY MU CHAIN IN BURKITTS LYMPHOMA CELLS Previous chapter demonstrated the importance of generating molecular probes that allow the detection of important signal transduction proteins. Aptamers for PKC were selected and subsequently one of the aptamer probes was tagged with fluorophore for the detection of PKC in vitro .142 While intracellular proteins are important in a variety of biological mechanisms, membrane proteins are equally or more important in detection of cancer. Detection of cancer when the cells are in a pre-malignant state can provide a higher probability of increasing the cure rate with current treatment strategies. One way of approaching the issue of early cancer diagnosis is finding new biomarkers. By definition, biomarkers involve quantitative measurements of biological species which are abnormal in their levels compared to reference normal levels. In cancer they often act as key molecules in transforming healthy cells into malignant cells. Because of their importance, recently much interest has been focused on the identification of membrane marker proteins.143 In particular, proteomic approaches, in particular, have emerged as established tools. 144, 145 These include the analysis of complex protein samples using two-dimensional gel electrophoresis,146 as well as shotgun methods that employ different membrane solubilization strategies, such as isotope-coded affinity tagging,147 multidimensional protein identification technology148 and surface-enhanced-laser-desorptionionization combined with time-of-flight mass analysis of complex biological mixtures.149 Although these approaches are effective in identifying a large number of proteins in their expression patterns, identifying specific protein markers that strongly correlate with cancer remains a big challenge.

PAGE 57

57 In this regard, there is growing interest in using monoclonal antibodies to target cell surface proteins that are significantly expressed on diseased cells or tissues. In particular, magnetic beads conjugated to monoclonal antibodies have been used to isolate membrane proteins and plasma proteins using whole cellular lysates.150, 151 However, the major problem with antibodies is the difficulty in generating cell specific antibodies for the detection of the expression levels in a single type of cell for unknown epitopes. In order to address this issue, we have developed an effective method to generate aptamerbased molecular probes for the specific recognition of cancer cells. 84,85 Using the Cell-SELEX method described in the Chapter 1, we have generated aptamer TD05 which only recognizes Ramos cells, from a Burkitts Lymphoma (BL) cell line (described below).84, 85 For example, as shown in Table 3-1, aptamer TE13, which was selected against this cell line, shows different levels of binding with different leukemia/lymphoma cell lines. On the other hand, aptamer TD05 shows preferential binding to the target Ramos cell line. Based on the observed selectivity of aptamer TD05, we hypothesized that this aptamer might be recognizing a protein related primarily to BL cells but not to other cells. Burkitts Lymphoma Burkitts non-Hodgkins lymphoma (BL) is a heterogeneous collection of highly aggressive malignant B-Cells. BL was first reported as an endemic in equatorial Africa and in New Guinea, and it also is commonly found in HIV-infected patients.152 At the molecular level, BL is associated with deregulation of the expression of c-myc, a gene that encodes a basic helixloop-helix transcription factor that specifically binds to DNA sequence. The gene c-myc plays an important role in the transcriptional regulation of downstream genes that control a number of cellular processes, such as cell cycle progression and programmed cell death.153, 154 These tumor

PAGE 58

58 cells usually express B-cell-specific tumor markers such as CD19, CD20 immunoglobin and Ig and light chains. 155-157 Table 3-1. Recognition patterns of aptamers TD05 and TE13 with different leukemia cell lines, Aptamer TD05 exclusively recognizes Ramos cells, indicating that TD05 might be interacting with BL specific protein, while aptamer TE13 interacting with a wide range of cells (for information aptamer TD05, see reference 84) Cell Line Aptamer TD05 Aptamer TE13 Ramos (Burkitts Lymphoma) ++++ ++++ CCRF CEM (T cell line, human Acute Lymphoblastic Leukemia) -0++++ MO2058 (Mantle lymphoma cell line ) -0+ Jurkat, (human acute T cell leukemia) -0+++ Toledo (Human Diffuse large cell Lymphoma) -0+++ HL69 (small cell lung cancer) -0-0NB-4 (acute promyelocytic leukemia) -0+++ HL-60 (acute promyelocytic leukemia) -0+++ This data were obtained from partly unpublished work. The experiments were performed by Dr Zhiwen Tang. An explanation of the symbols used to evaluate cell binding (i.e. +++, ++++) is given in appendix A Principle of Photocrosslinking of DNA with Proteins Interaction site of proteins and nucleic acids, in particular the crosslinking of proteins with nucleic acids, have been studied for decades. For example, UV-crosslinking combined with immunoprecipitation (UV-X-ChIP) assays has been used in mapping protein DNA interactions.158 Similarly, there have been several attempts made to map interactions between aptamers and proteins using photo-aptamers containing photo-active bases that can induce formation of highly reactive radicals upon irradiation with light. 159 For example, the interaction of single-stranded DNA aptamers with basic fibroblast growth factor has been studied by photochemically crosslinking the protein with the aptamer. 159, 160

PAGE 59

59 Figure 3-1. Protocol for the identification of IGHM protein on Ramos cells. (1) Incubation of biotinylated photoactive aptamer TD05 with the cells. (2) Irradiation of photoactive aptamer TD05 to initiate crosslinks to the membrane protein (3) Cell lysis and extraction with steptavidin-labeled magnetic beads (4) Release of protein-aptamer complexes from the beads (5) Gel electrophoresis (6) MS analysis A multi-step process was used to identify the target protein of aptamer TD05 on the Ramos membrane, as shown schematically in Figure 3-1. First, the aptamer probe was chemically modified with a photoactive uracil derivative at selected sites and linked to biotin via S-S-bomd. After incubation with Ramos cells, the target protein was separated by lysing and extraction with streptavidin linked to magnetic beads. The beads were removed by reduction of the S-Slink. The crosslinked proteins were separated by gel electrophoresis and analyzed by

PAGE 60

60 mass spectroscopy (MS) and by a database search. Last, the identity of the target protein was confirmed using an existing antibody and the sel ected aptamer. Detailed description about each step is discussed in the later sections. Aptamer TD05 Recognize Proteins on the Membrane Since aptamers are known to interact with different molecules such as sugars, peptides, and small organic molecules, it was necessary to confirm that selected probes interact selectively with membrane proteins. In order to determine this, we adapted a previously described procedure, based on the ability of certain proteases to selectively cleave amide bonds on membrane proteins. 144 By employing the protease of choice, one can selectively shave off the extracellular domain of the proteins (Figure 3-2). Since the shavedcells no longer contain most of the extracellular portion of a membrane proteins, the resulting decrease in the binding of aptamer TD05 gives an idea of the identity of the binding site. Figure 3-2. Partial digestion of exracellular membrane proteins using trypsin and proteinase K (indicated by scissors). 144 Trypsin cleaves carboxy terminal Lys and Arg residues of the proteins, and is thus more selective than protenase K, which cleaves peptide bonds adjacent to carboxylic groups of aromatic and aliphatic amino acids.144 Therefore, using this method, we carried out experiments by partially digesting cell surface proteins with proteinase K to confirm that aptamer TD05 binds with cell surface proteins. Protienase K acts on the cell membrane and cleaves peptide bonds adjacent to carboxylic groups of aromatic and aliphatic amino acids. After treatment with proteinase K, flow cytometric

PAGE 61

61 analysis of binding of FITC labeled aptame r TD05 showed no binding with Ramos cells, suggesting that its target protein has been cleaved from the membrane (Figure 3-3). Figure 3-3. Binding of aptamer TD05 with Ramos cells after treatment with proteinase K at different time intervals.84 The fluorescence signal resulting from binding of FITC labeled aptamer TD05 with Ramos cells shifts to a lower value with increase in time of protease digestion, indicating that membrane proteins are being digested and binding of aptamer TD05 is lost. (For information on flow cytometric analysis see appendix A.) Methods and Materials A panel of aptamers targeting Burkitts lymphoma cells was selected by using cell-based SELEX. As shown in Table 3-1, aptamer TD05 showed significant and specific binding with Ramos cells. The aptamer sequence TD05 was modified with photo-active 5-iodo deoxyuridine (5-dUI) nucleotides. The original FITC labeled aptamer TD05 is 5 FITC5ACCGGGAGGATAGTTCGGTGGCTGTTCAGGGTCTCCTCCCGGTG-3 The modified aptamer TD05 with 5dUI disulfide link and biotin 5-ACCGGGAGGA U AGTU CGGTGGCTGTTCAGGG U CTCC U CCCGGTG-S-S-T-PEG-(3) Biotin Control TE02 sequence with 5-dUI disulfide link and biotin

PAGE 62

62 5fluorescene-ATC U AACTGCU GCGCCGCCGGGAAAATACTGTACGGTTAGA-S-S-PEG(3)-biotin All DNA synthesis reagents were obtained from Glen Research. Biotin controlled pore glass beads (Biotin-CPG) were used for all the biotin labeled aptamer synthesis. All oligonucleotide sequences were synthesized using standard phosophoamidite chemistry using an ABI3400 DNA synthesizer. Three poly ethylene glycol (PEG) units were introduced between the aptamer and the biotin to avoid the interference of biotin with the spatial folding of the aptamer. Mild deprotection conditions were used to avoid reduction of the disulfide bond. Following precipitation with ethanol, the precipitated DNA was purified using high-pressure liquid chromatography (HPLC), on a ProStar HPLC station (Varian, CA) equipped with a photodiode array detector, using a C-18 reversed phase column (Alltech, C18, 5uM, 250 4.6mm). The conditions of disulfide bond reduction using Tris(2-carboxyethyl)phosphine (TCEP) were optimized by passing a 500nM biotinylated aptamer probe was passed through a mini column packed with streptavidin sepharose labeled magnetic beads (Amersham Biosciences, Upsala, Sweden) three times. After washing with PBS, the beads were placed into a microcentrifuge tube, treated with 50-100mM TCEP, and heated for 10, 20, or 30 min at 75C to cleave the disulfide bond linking the aptamer and the biotin. The supernatant and the beads were analyzed by 2.5% agarose gel electrophoresis stained with ethidium bromide. Competition Assays with the Modified Aptamer Probes Following cell lines were obtained from American Type Culture Collection CCRF-CEM (CCL-119, T cell line, human Acute Lymphoblastic Leukemia), Ramos (CRL-1596, B-cell line, human Burkitts lymphoma), CA46 (CRL 1648, B-Cell line, Human Burkitts lymphoma), Jurkat (TIB-152, human acute T cell leukemia), Toledo (CRL-2631, B-cell line, human diffuse

PAGE 63

63 large-cell lymphoma), K562 (CCL-243, chronic myelogenous leukemia, CML), NB-4 and HL60 (CCL-240, acute promyelocytic leukemia). All of the cells were cultured in RPMI medium 1640 (American Type Culture Collection) supplemented with 10% FBS (heat-inactivated; GIBCO) and 100 units/mL penicillin streptomycin (Cellgro). Cells were washed before and after incubation with wash buffer (4.5g/L glucose and 5mM MgCl2 in Dulbeccos PBS with calcium chloride and magnesium chloride; Sigma). Binding buffer used for selection was prepared by adding yeast tRNA (0.1mg/mL; Sigma) and 1mg/mL sheared salmon sperm DNA to the wash buffer to reduce non-specific binding. The effect of replacement of thymine (T) with 5-dUI was investigated by conducting competition assays. Briefly, 1M aptamer TD05 was mixed with 10M in 500 L of the modified aptamer probe were incubated with 1 106 cells for 30 min at 4 C in the binding buffer. After washing with the wash buffer, the cells were analyzed by observing the decrease in the fluorescence of FITC-labeled aptamer TD05 using a FACScan cytometer (BD Immunocytometry Systems) by counting 30,000 events. A FITC-labeled unselected ssDNA library was used as a negative control. Aptamer Labeling with AT32P Samples containing oligonucleotide (3.74 nmole) and [ -32P] ATP (8.3pmole) were incubated overnight at room temperature with 50units of polynucleotide kinase (Promega). Unincorporated ATP was removed using a G-25 column (Amersham Biosciences). Protein-Nucleic Acid Photo-Crosslinking A 0.023 Ci aliquot of (Counts Per Minutes of 5 104) of 5-32P labeled aptamers was added to 400 106 cells in the binding buffer. The cells and the aptamers were incubated at 4C

PAGE 64

64 for 30 minutes to allow for complete binding. A control with the TE02 aptamer sequence was performed in parallel. The unbound aptamers were washed until no radioactivity was detected in the wash buffer. Cells and bound aptamer were re-suspended in the wash buffer in a cuvette with a 10cm path length. To initiate crosslinkage, the sample was irradiated with 55pulses of 308nm light from a Lambda Physik, model LPX240 XeCl excimer laser operating at 16.065mJ per pulse for 20 seconds. During the irradiation, the cell suspension was constantly stirred to allow the maximum crosslinking. Cell Lysis and Protein-Aptamer Extraction. The cells were suspended in lysis buffer containing a protease inhibitor cocktail (Sigma), 1mg/mL salmon sperm DNA (Eppendroff), 1mg/mL tRNA (Fisher), 50mM HEPES, and 1mM EGTA, and the suspension was homogenized using a Dounce homogenizer at 75 strokes per minute. The crude mixture was centrifuged at 4000 rpm for 30 min at 4C. Water-soluble protein extracts were separated from the crude membrane by centrifugation at 4000 rpm for 30 min. The pelleted crude membrane was solubilized in buffer containing PBS (Fisher), 0.5% NP40 (Sigma), 1.25% Cholesteryl-hemisuccinate (CHS; Tris-HCl salt, Sigma), and 2.5% n dodecyl--D-maltoside (DDM, Sigma) with gentle agitation at 4C. The solubilized membrane proteins were separated from cell debris by centrifuging at 3000 rpm for 30 minutes at 4C. Crude cell lysate was stirred with 2mg/mL of streptavidine labeled magnetic beads (Invitrogen) at 4C for 2.5 hours. Captured probes were magnetically separated and washed with 3 different solutions (15 minutes each): with PBS containing 1% NP-40; 10mM EDTA containing 1%NP40; and 0.05% SDS solutions by stirring for 15 minutes at 4C. Harsh washing steps were employed to ensure that only crosslinked proteins remained and to minimize the non-specific binding.

PAGE 65

65 Release of Captured Complex and Protein Gel Electrophoresis Complexes captured on magnetic beads were heated at 75C for 30 minutes with 10mM TCEP and a sample loading buffer. The solution was loaded on to 10%-bis-Tris PAGE and 200V was applied for 55 minutes. Protein bands were visualized using Bio-Rad gel-code blue staining reagents according to the manufactures instructions. The gel was subsequently exposed to Bio-Rad personal phosphor imager screens overnight and visualized by Bio-Rad phosphor personal phosphoimager. The single band appeared in the gel was excised, digested, and analyzed by a QSTAR LC-MS/MS, equipped with a MASCOT database at the Protein Chemistry Core Facility, University of Florida. The conditions used in the MS analysis were as follows: Capillary rpHPLC separation of protein digests was performed on a 15cm x 75um i.d. PepMap C18 column (LC Packings, San Francisco, CA) in combination with an Ultimate Capillary HPLC System (LC Packings, San Francisco, CA) operated at a flow rate of 200nL/min. Online tandem mass spectrometric analysis was accomplished by a hybrid quadrupole time-of-flight instrument (QSTAR, Applied Biosystems, Foster City, CA) equipped with a nanoelectrospray source. Tandem mass spectrometric data were searched against the IPI human protein database using the Mascot search algorithm. In general, probability-based MOWSE scores that exceeded the value corresponding to p<0.05 were considered for protein identification. Partial Digestion of Membrane Proteins Using Trypsin A sample containing 5 106 CCRF-CEM cells was washed with 2ml PBS, and incubated at 37C with 1mL of 0.05% Trypsin/0.53mM EDTA in HBSS or 0.1mg/ml trypsin in PBS either for 2 min or 10 min. Fetal Bovine Serum was then added to quench the proteinase action. After washing with 2 ml binding buffer, the treated ce lls were used for aptamer binding assay using flow cytometry.

PAGE 66

66 Characterization of Aptamer Binding Protein on Ramos Cells Alexa Fluor 488 labeled Anti-IgM heavy chain (2mg/mL Molecular probes, Invitrogen) was used to further confirm the protein target. Competition experiments were carried out by first incubating with 0.5uM TD05-FITC with 1 106 Ramos, Toledo, and CEM cells at 4C for 15 min. After wash off the excess TD05-FITC, labeled anti-IgM heavy chain (2g/mL) was incubated with the samples at 4C for 15 minutes and washed off the excess probe and decrease of the binding of FITC-TD05 was analyzed by flow cytometry. Trypsin digestion experiments were conducted as described above using 2g/mL of Alexa Fluor 488 labeled anti-IGHM antibody. Briefly, cells were partially digested with trypsin at 37C for 2 min and 10 min. Cells were then washed and incubated either with Alexa Fluor 488 labeled antibody or FITC labeled aptamerTD05. After washing to remove unbound sequences, binding was analyzed using flow cytometry. Fluorescence Imaging. All cellular fluorescent images were collected using a confocal microscope consisting of an Olympus IX-81 automated fluorescence microscope with a Fluoview 500 confocal scanning unit. The dye conjugates were excited at 488 and 543nm. Images were acquired after five to ten second delays, during which the instrument was focused to yield the highest intensity from the fluorescence channels. The images were assigned color representations which were not indicative of the actual emission wavelengths. Bright spots in the images are corresponding to dead cells. Results and Discussion Probe Modification and the Effect of Modification on Aptamer Affinity and Specificity Modification of aptamer TD05 with photoactive 5-dUI facilitates its covalent crosslinking with the target protein on the cell membrane, so that only the crosslinked target protein is

PAGE 67

67 extracted. First, in order to achieve high crosslinking efficiency, the position of the photoactive nucleotide 5-dUI in the aptamer TD05 was optimized. Since 5-dUI and deoxythymidine have similar covalent radius, we initially hypothesized that the modification would not affect the aptamer binding with Ramos cells. However, when all of the deoxythymidine were replaced with dUI, the aptamer no longer recognized Ramos cells. To avoid problems with aptamer folding, 5-dUI was introduced only in alternating positions at the first two and final two deoxythymidine bases (Figure 3-4). Next, biotin was linked through a disulfide bridge at the 3 end of the aptamer. The purpose of the biotin was to complex with streptavidin-coated magnetic beads to help efficient release of the aptamer-protein target from the beads. Binding of modified aptamer TD05 with the target cells was analyzed through a competition assay with unmodified FITC-labeled aptamer using flow cytometry. In the presence of modified aptamerTD05 (no FITC label), the fluorescence corresponding to unmodified aptamer TD05 with FITC label shifts to a lower value, indicating that modified aptamer binds with Ramos cells and displaces the FITC labeled unmodified aptamer. (Figure 3-5). Finally, the conditions pertaining to concentration, temperature and time were optimized to achieve effective release of captured aptamer probe from the magnetic beads using Tris(2carboxyethyl)phosphine (TCEP). Separation of Captured Complex From the Crude Cell Lysate and MS Analysis of Captured Protein In order to trace the aptamer-protein complex during the isolation process, we labeled the aptamer TD05 with 32P at the 5 end. The resulting 32P labeled photoactive aptamer TD05 bound to Ramos cells were irradiated with nanosecond pulses of a XeCl excimer laser to initiate the crosslinking of the aptamer with the cell surface protein. Chemical crosslinking of aptamer TD05 with its target protein was introduced to maximize the specificity of the extraction and to

PAGE 68

68 minimize contamination caused by nuclear proteins. In addition to covalent crosslinking, the non-specific interactions were further minimized by using a cocktail of sheared salmon-sperm DNA and RNA in the cell lysis buffer. Figure 3-4. Modified aptamer with photoactive 5-dUI, linked to biotin via a disulfide bond. 5dUI facilitated covalent crosslinking and the disulfide bridge allowed efficient release of the captured complex from the magnetic beads. The photoactive bases are shown by the squares. The structure is predicted by the m-fold program.

PAGE 69

69 Figure 3-5. Binding of modified aptamer with 5-dUI and biotin linker with Ramos cells. In the presence of modified aptamer TD05, the fluorescence of the FITC labeled unmodified aptamer TD05 was shifted to a lower fluorescence value, indicating that the modified aptamer TD05 competes with the unmodified aptamer TD05. To avoid contamination caused by plasma proteins, water soluble proteins were removed by lysing the cells in a high salt aqueous buffer (without any detergents added). Since cellmembrane and membrane proteins contain hydrophobic regions, these proteins are not soluble in high salt aqueous buffer. Once the soluble prot eins were removed, the crude membrane was solubilized in membrane solubilization buffer containing a number of cationic and neutral detergents to aid in removing membrane proteins from the cell membrane. The mixture of membrane proteins was incubated with streptavidin-coated magnetic beads to extract aptamer sequences that bear biotin at the 3 end, along with the covalently bound target protein. The extraction was repeated 3 times until approximately 90% of the complex was extracted onto the beads. Since the aptamer TD05 was labeled with 32P, we detected the efficiency of the extraction was determined by measuring the radioactivity on the beads compared to cell extract using a Geiger counter.

PAGE 70

70 One of the challenges in isolating protein from cell lysates is the interference of nuclear and other non-specific proteins with the aptamer. Insufficient washings of the complex led to contamination with nuclear proteins resulting in a smeared band after gel electrophoresis. Therefore, harsh washing conditions varying from PBS to 0.05% SDS were introduced to ensure the efficient removal of non-specific nuclear proteins absorbed onto the magnetic beads. Crosslinking of the protein target to the aptamer made it possible to use harsh washing conditions without losing the target protein. The aptamer TD05-protein complexes were subsequently removed from the beads by reduction of the S-S bridge between the aptamer and biotin. Following the release of the aptamer TD05-protein complex, the high sensitivity of 32P enabled us to recognize the protein-aptamer complex using gel electrophoresis and a standard phosphor imager. As shown in Figure 3-6, the band corresponding to the cross-linked aptamer TD05 with protein was retarded compared to the free aptamer TD05, which is smaller in size. Fi gure 3-7, shows the image for the TE02 control sequence, which was not retarded, indicating that aptamer TD05 is selective for the target protein. Figure 3-6. Phospho images for 10% tris-bis PAGE analysis of the captured complex. The shifted band in lane 2 corresponds to the cross-linked aptamer-TD05-Protein complex. Lane 1. cell lysate Lane 2. aptamer TD05-protein complex. Despite the harsh washing conditions employed during the sample preparation process, the results still indicated a significant amount of nuclear proteins. However, four candidates were

PAGE 71

71 isolated based on their molecular weights and the nature of membrane proteins, and these are marked in the Table 3-2, which shows the candidates identified by the MASCOT library search. Figure 3-7. Phospho images for control TE02 Sequence: Lane 1 Cell lysate; Lane 2. With modified TE02 extraction. TE02 is a control sequence. No shifted band is seen in either lane. Table 3-2. Identified proteins and their IPI values based on European Protein Data Bank using MASCOT database search. These candidates could potentially be the target for aptamer TD05 Protein Candidate IPI Value Nucleolar protein Nop56 IPI00411937 Heterogeneous nuclear ribonucleoprotein L isoform a IPI00027834 NONO protein IPI00304596 Splice Isoform 1 of Myelin expression factor 2 IPI00555833 Heterogeneous nuclear ribonucleoprotein M isoform a IPI00171903 Lamin B1 IPI00217975 Paraspeckle protein 1 alpha isoform IPI00103525,IPI00395775 Keratin, type II cytoskeletal 2 epidermal IPI00021304 L-plastin IPI00010471 Splice Isoform Short of RNA-binding protein FUS IPI00221354,IPI00260715 IGHM protein IPI00477090 60 kDa heat shock protein, mitochondrial precursor IPI00472102 SYT interacting protein SIP IPI00013174,IPI00550920 HNRPR protein IPI00012074 Keratin 9 IPI00019359 Keratin, type I cytoskeletal 10 IPI00009865,IPI00295684 Splice Isoform 1 of Heterogeneous nuclear ribonucleoprotein K IPI00216049,IPI00216746, IPI00514561 Keratin 1 IPI00556624 Probable RNA-dependent helicase p68 IPI00017617 Large neutral amino acids transporter small subunit 1 IPI00008986 Splice Isoform 1 of Development and differentiation-enhancing factor 2 IPI00022058 Splice Isoform 4 of Potassium voltage-gated channel subfamily KQT member 2 IPI00328286

PAGE 72

72 Of the four candidates we determined the protein candidate IGHM to be the most probable match because (1) IGHM protein was known to be expressed in B-cells; (2) its molecular weight corresponded to the molecular weight of the protein excluding the molecular weight of the aptamer; (3) it is a membrane protein; (4) the other three protein candidates are commonly expressed in all types of cells. Following the MS analysis, further experiments were performed to confirm the identification, as described in the next section. Confirmation of the Protein IGHM as the Binding Target for Aptamer TD05 Figure 3-8. Aptamer TD05-FITC and Alexa Flour 488 -anti-IGHM binding analysis with Ramos, CCRF-CEM and Toledo cells (A) Aptamer TD05-FITC binding with Ramos cells. Higher fluorescence intensity observed for Ramos cells indicates that FITCTD05 recognizes Ramos cells but not CEM or Toledo cells. (B) Binding patterns of Alexa Fluor 488 labeled anti-IGHM antibody with Ramos cells, CEM and Toledo cells correlated with binding pattern on FITC-TD05 i.e. higher fluorescence signal for Ramos cells while background fluorescence signal for other cell lines. (For information on flow cytometric analyses see Appendix A)

PAGE 73

73 With the MS results suggesting that IGHM is the target for aptamer TD05, we first investigated the binding of Alexa Fluor 488 labeled anti-IGHM antibody with Ramos, CCRF CEM, and Toledo cells. As shown previously in Table 3-1, the aptamer TD05 exclusively recognizes Ramos cells but not control cell lines. Figure 3-8 shows the flow cytometric data for Ramos, CCRF-CEM and Toledo cells after incubation with (A) FITC-TD05 and (B) Alexa Fluor 488 labeled anti-IGHM antibody. The much greater fluorescence intensities for the Ramos cells, as well as the very similar patterns of the peaks, indicates that IGHM is very likely the target protein. Aptamer TD05 and anti-IGHM antibody were further assayed with another Burkitts lymphoma cell line that is known to express surface IGHM (CA-46 cell line, see Figure 3-9). As expected, aptamer TD05 and anti-IGHM antibod y showed binding with the CA-46 cell line, further indicating that IGHM could be the target protein. Figure 3-9. Aptamer TD05-FITC and anti-IGHM antibody binding with surface IgM positive CA46, a B-lymphocyte Burkitts lymphoma cell line. Shifted fluorescence intensity of both aptamer TD05-FITC and Alexa Fluor 488 labeled antibody is indicative of binding with CA-46 cells. (For information on flow cytometric analysis see Appendix A)

PAGE 74

74 Several leukemia cell lines that are not related to B-cells were also tested to further analyze the binding of FITC-TD05 and anti-IGHM antibody. As shown in Table 3-3, neither the aptamer nor the antibody showed any binding towards cell lines other than cell lines originated from B cell non-Hodgkins lymphoma. Table 3-3. Binding patterns of aptamer TD05 and anti-IGHM with different cell lines. Aptamer TD05 does not show binding with tested cell lines except for Ramos and CA-46. Similarly, anti-IGHM anti body does not bind to other tested cell lines Type of Leukemia Cell line Aptamer TD05 IGHM antibody B-cell non-Hodgkins lymphoma Ramos Toledo CA-46 ++++ -0+++ ++++ -0+++ T-Cell lymphoblast leukemia Promyelocytic leukemia CEM-CCRF Jurkat HL-60 NB-4 K562 -0-0-0-0-0-0-0-0-0-0Explanation of the symbols used to evaluate cell binding is given in the Appendix A. If both aptamer TD05 and anti-IGHM antibody bind to similar epitopes or epitopes close to each other on the IGHM protein, we should observe a competition between the two in binding should be observed. We investigated the effect of aptamer TD05 binding with Ramos cells upon addition of anti-IGHM antibody. Interestingly, aptamer TD05 did not affect the anti-IGHM binding with Ramos cells. However, anti-IGHM antibody reduced the interaction between aptamer TD05 with Ramos cells, as shown in Figure 3-10. These results suggest that aptamer TD05 and anti-IGHM both bind to the same site, but the affinity for anti-IGHM binding is much greater than that for aptamer TD05. In addition, the co-localization of the Alexa Fluor 488 labeled anti-IGHM antibody and tetramethylrhodamine-labeled TD05 aptamer was monitored using confocal microscopy. As shown in Figure 3-11, both probes heavily stain the cell periphery of the corresponding target Ramos cells.

PAGE 75

75 Figure 3-10. Competition of aptamer TD05-FITC and anti-IGHM antibody for the target protein. After addition of the antibody, the fluorescence corresponding to FITC labeled TD05 decreases, compared to FITCTD05 binding in the absence of antiIGHM antibody. (For more information on flow cytometric analysis see Appendix A). Figure 3-11. Binding of Alexa fluor 488 labeled anti-IGHM antibody and TMR labeled TD05 aptamer with Ramos cells. Both aptamer and antibody stains the cell membrane periphery. (A) Ramos cells and Anti-IGHM, (B) Ramos Cells and TMR labeled aptamer TD05, (C) optical Image of the cells

PAGE 76

76 A B C Figure 3-12. Flow cytometric results for the anti-IGHM binding with Ramos cells after Trypsin digestion. (A ) Control experiments with FITC labeled TD05, and Alexa Fluor 488 labeled anti-IGHM antibody. Higher fluorescence intensity observed for both aptamer and antibody indicates that both probes bind with Ramos cells before the trypsin digestion. Analysis of Binding of (B) TD05-FITC (C) Alexa Fluor 488 labeled antiIGHM with Trypsin digested cells. Both show that there is no effect on binding (either with the aptamer or the antibody) after trypsin treatment

PAGE 77

77 The study of the effect of the treatment of the cells with trypsin also provides support for the assignment of IGHM as the target protein. Figure 3-12 shows flow cytometric results prior to and after trypsin digestion. Interestingly, we observed neither aptamer TD05 binding nor antiIGHM binding was lost by partial digestion with trypsin. These results contrasts with the results from experiments using proteinase K (see Figure 3-3) In that study, binding of aptamer TD05 to Ramos cells was lost after proteinase K digestion. This may be explained by the lower specificity of proteinase K compared to trypsin. Evidently, the binding site for aptamer TD05 and anti-IGHM is cleaved by proteinase K but not by trypsin. Discussion Here, we have presented a simple strategy for identifying differentially expressed proteins by employing aptamer probes selected against target tumor cells. This method integrates the selection of molecular probes targeting specific cells and the use of cell specific aptamers for effective identification of target proteins. Our groups previous work with aptamer selection and screening against cancer cells has established that aptamer binding signatures pertaining to each cell type can indicate expression patterns of prot ein candidates and that each aptamer candidate has its own identity when recognizing target proteins in complex biological specimens.84, 85, 90 Furthermore, we have shown that it is feasible to recognize up-regulated proteins that may have a role in transforming unhealthy cells into diseased cells.161 We also have exploited the remarkable versatility for chemical modification of DNA aptamers by incorporating different functionalities to improve their performance as molecular probes. These modifications improved two important features: probe stability and collection efficiency. Enhanced stability of the aptamer-protein complex through incorporation of 5-dUI allowed the complex to sustain harsh washing conditions in extraction, which was important in purification and enrichment of the targeted proteins from a cell lysate sample. Enhanced

PAGE 78

78 efficiency of the biotin aptamer removal from the streptavidin support occurred through introduction of a readily cleavable disulfide bond. The typical approach for solubilizing membrane proteins from the cell membrane is to use carefully optimized ratios of the detergents that mimic the membrane in an artificial environment. However, poor optimization of detergent compositions can result in misfolding of the receptor and/or irreversible denaturation of the receptor molecule, because the native conformation of the receptor molecule depends on the hydrophobic lipid bilayer of the cell membrane. Poor optimization of the detergents may also lead to possible disruption of the aptamer-protein when the target protein mis-folds or denatures. This protein alteration, caused by changes in the lipid composition of buffers, is one of the major concerns in identification of membrane proteins using protein specific aptamers and can possibly be one of the limitations when using these probes in identifying molecula r markers. We have addressed this issue by modifying the aptamer with photoactive 5-dUI to facilitate covalent crosslinking of the probe with the target protein, which increases the stability of the complex. Conjugations using biotin-strepavidin have been exploited for many applications in immunology, affinity chromatography and other separation applications.162-164 However, one of the major disadvantages of such interactions is that such affinity requires harsh conditions to elute the biotin bearing-ligand from of the streptavidin-coated solid support, resulting in either damage to the protein-ligand complex or the need for larger sample volumes to allow preconcentration prior to SDS-PAGE analysis.146 In this study, the aptamer was modified with a disulfide functional group prior to the biotin at the 3 end. Typically, disulfide linkage can be easily hydrolyzed by treatment with commonly used reducing agents prior to gel electrophoresis. This modification allows the biotin bearing aptamer along with its protein to dissociate from the

PAGE 79

79 beads more efficiently with sample volumes compatible for gel electrophoresis. Also, this approach can dramatically reduce potential sample loss during the sample preparation process. The discovery of IGHM on the Ramos cells supports the initial expectations of this study, because binding of aptamer TD05 with Ramos cells correlated with reported IGHM expression patterns of these cells compared to other cell lines and in real bone marrow samples. IGHM protein is one of the major components of the B-cell receptor complex expressed in mature Burkitts lymphoma cells, 165 and it is known that IGHM expression on premature B-lymphocytes is closely related to Burkitts lymphoma development166 and is a marker for this form of cancer. Also, several literature references emphasize the active role of IGHM in Burkitts lymphoma cell proliferation and survival.166-168 Accordingly, these findings demonstrate the adaptability of this approach in identifying cell membrane receptors that have altered expression levels in tumor cells. In conclusion, we have shown that cancer-cell-specific aptamers provide an effective tool in identifying target proteins that show increased expression levels in a chosen pool of diseased cells. The ease in chemical modification of the DNA aptamer probe has lent needed binding stability and strength for the effective capture, enrichment, and identification of corresponding target receptors on the cell membrane surface. In addition, findings of this approach show that the generation of aptamers using Cell-SELEX followed by identification of the binding entity for each aptamer can be useful in discovering diseasespecific marker proteins in a given cell type. In contrast to conventional methods, such as phage display antibody production targeting a previously known specific protein, the novelty of cell-SELEX based protein discovery is rooted in its focus on finding cell surface membrane markers with no prior knowledge of the molecular contents of the cell surface. Also, owing to the easy chemical manipulation and reproducible

PAGE 80

80 generation of DNA aptamers by automated synthesis, this method is more universal and technically feasible. Finally, apart from the ability to identify disease markers that may play key roles in cancer progression, this method can also be useful in early diagnosis, targeted therapy, as well as a molecular tool for the recognition and mechanistic studies of diseased cells.

PAGE 81

81 CHAPTER 4 APTAMERS EVOLVED FROM WHOLE CELL SELECTION AS SELECTIVE ANTITUMOR PHOTODYNAMIC AGENTS In the previous chapter, we described a systematic approach to identify a protein marker specific for Burkitts lymphoma (BL) cells.161 In doing so, aptamer TD05 selected using cellSELEX method was used to capture membrane bound IGHM protein from BL cells. Membrane bound IgM is known to express uniquely in BL cells and is known as a marker protein for BL. Since aptamer TD05 exclusively binds to this BL marker, we hypothesized that aptamer TD05 can be used for drug delivery. Therefore, the focu s of this chapter is to demonstrate that aptamer TD05 can be used as a drug delivery agent to selectively kill BL cells. In order to demonstrate the targeting ability of aptamer TD05, a photosensitizer (PS) was used as the drug candidate. Pages 31 to 34 in the introduction described photodynamic therapy, in which a localized PS creates a toxic environment when it is irradiated. Introduction to Photosensitizers The mechanism of PSs and their biological applications in treating cancer cells are described in Chapter 1. In this section, the chemical structures of PSs and their structural properties are described. The majority of photosensitizers commonly known as phorphyrins, contain a tetrapyrrole aromatic nucleus similar to that in many naturally occurring ring structures, such as heme, chlorophyll, and bacteriochlorophyll. The PS used in this study belongs to a category of PSs called second generation photosensitizers, which were developed to increase the hydrophilic nature by introducing polar substituents on the ring structures. 169 Figure 4-1 shows two examples of the first and second generation PSs. One of the most commonly used photosensitizers is Chlorin e6, with a main absorption band at 643nm attributed to the extended pi system.

PAGE 82

82 Figure 4-1. Chemical structures of photosensitizers. First generation photosensitizers(left) and Chlorin e6 (right), a second generation photosensitizer. Chlorin e6 contains additional carboxyl groups to increase the water solubility. The visible to IR-wavelength absorption makes Ce6 molecules desirable candidates for photodynamic therapy, because use of wavelengths shorter than 600nm would result in substantial light losses due to absorption by chromophores present in the tissues. 170 The biggest challenge in using PS in photo-therapeutic treatment of cancer is the nonspecific targeting of healthy cells that leads to severe side effects.170 To address this issue, a number of strategies were introduced, as described on pages 31-33. While these approaches are effective in therapeutic targeting of tumor cells, there still is a need for improvement in selectivity. For example, even if immunoconjugates are successful in targeting the cancer cells, they have been shown to induce immune responses and to cross react with shared antigens in the normal tissue. In addition, conjugation of drugs is tedious especially with proteins.171 Owing to their many significant advantages, including small size, easy chemical synthesis with high reproducibility, easy chemical manipulation, low immunogenity and high blood clearance rates, aptamers can be readily applicable in cancer therapy.172 Therefore, we have combined the high selectivity of the aptamer TD05 with easy chemical manipulation of DNA to

PAGE 83

83 develop a highly selective aptamer-photosensitizer (PS) conjugate to destroy aptamer specific cancer cells. Methods and Materials Synthesis of the Conjugate Amine modified aptamer TD05 and non-specific control DNA were synthesized in house using an ABI3400 DNA/RNA synthesizer (Applied Biosystems, Foster City, CA and the probes were purified using reversed phase HPLC (Varian, Walnut Creek, CA) with a C18 column (Econosil, 5u, 250 4.6 mm) from Alltech (Deerfield, IL). A Cary Bio-300 UV spectrometer (Varian, Walnut Creek, CA) was used to measure absorbances to quantify the manufactured sequences. All oligonucleotides were synthesized by solid-state phosphoramidite chemistry at a 1 mol scale. The completed sequences were then deprotected in concentrated ammonium hydroxide at 40 C overnight and further purified twice with reversed phase high-pressure liquid chromatography (HPLC) on a C-18 column. TD05-NH2 5-NH2-ACCGGGAGGATAGTTCGGTGGCTGTTCAGGGTCTCCTCCCGGTG3 Control Sequence: 5NH2CACCTGGGGGAGTATTGCGGAGGAAGGTAGTCTGATTGGC Photodynamic ligand Chlorin e6 (Ce6) (Frontier Scientific, Logan, UT) was conjugated to amine modified DNA using N-hydroxysuccinimide ester (NHS) of Ce6 and dicyclohexyl carbodiimide (DCC) as a coupling agent. Equimolar amounts of NHS and Ce6 and DCC were dissolved in anhydrous DMF in the dark for 30 min. The activated Ce6 was then added to excess amine-modified TD05 in NaHCO3 at pH=7 by vigorously stirring overnight in the dark. The unconjugated Ce6 in the supernatant was removed by ethanol precipitation of DNA 5 times. The resulting crude mixture was separated by reversed phase HPLC. The conjugated DNA and Ce6 were quantified by measuring the absorbance at 260nm, where DNA absorbs, and at the two

PAGE 84

84 absorption maxima for Ce6, 404 nm and 643nm, using a Varian UV/Vis spectrometer. The calculated DNA/ Ce6 was approximately 1. Cell Lines and Binding Buffer The following cell lines were obtained from American Type Culture Collection CCRFCEM (CCL-119, T cell line, human ALL), Ramos (CRL-1596, B-cell line, human Burkitts lymphoma), K562 (CCL-243, chronic myelogenous leukemia, CML), HL-60 (CCL-240, acute promyelocytic leukemia), and Jurkat (TIB-152, human acute T cell leukemia). NB-4 (acute promyelocytic leukemia) was a gift from the Department of Pathology, University of Florida. All of the cells were cultured in RPMI medium 1640 (American Type Culture Collection) supplemented with 10% Fetal Bovine Serum (FBS, heat-inactivated; GIBCO) and 100 units/mL penicillinstreptomycin (Cellgro). Cells were washed before and after incubation with wash buffer (4.5g/L glucose and 5mM MgCl2 in Dulbeccos PBS with calcium chloride and magnesium chloride; Sigma). Binding buffer used for selection was prepared by adding yeast tRNA (0.1mg/mL; Sigma) and 1mg/mL sheared salmon sperm DNA into wash buffer to reduce non-specific binding. Characterization of the Conjugates After observing the UV/Vis absorbance, the conjugates were further assayed for binding to target Ramos cells using competition assays. All cell lines were washed with binding buffer prior to competition assays, and were then incubated with 250nM of FITC-labeled TD05 at 4C for 20 minutes. After incubation, the cells were washed to remove the unbound probe. Binding of FITC-TD05 was analyzed by flow cytometry to obtain the maximum binding. For competition assay, cells were incubated with equimolor mixtures of FITC-TD05 and Ce6-TD05 for 20 minutes at 4C. After equilibration, cells were washed to remove the unbound probe and analyzed for the binding with flow cytometry counting 10000 events.

PAGE 85

85 Detection of singlet oxygen generation was done by using a commercially available singlet oxygen sensor green reagent (Invtirogen). Fluorescent measurements were made using excitation/emission 488/525 nm. A solution of 1 M of sensor green reagent was irradiated for 20 sec, and a 10 M of either free Ce6 or TD05-Ce6 was added and increase in the fluorescence intensity was monitored as a function of time. Fluorescence Imaging. All cellular fluorescent images were collected using a confocal microscope setup consisting of an Olympus IX-81 automated fluorescence microscope with a Fluoview 500 confocal scanning unit. The Ce6 dye conjugates were excited at 633nm and the emission was collected at 660nm. Images were taken after a five to ten second period during which the instrument was focused to yield the highest intens ity from the fluorescence channel. Bright spots observed in the images of the control and the target cells are corresponding to the dead cells. Images were taken using the same gain however; image processing software was adjusted to obtain the maximum fluorescent intensity for the control cells. Flow Cytometry Fluorescence measurements were also made using a FACScan cytometer (Becton Dickinson Immunocytometry Systems, San Jose, CA) counting 10000 events. Cell experiments were performed using a final volume of 300 L. In Vitro Photolysis Ramos cells (50,000) and equal number of control cell lines were washed with the cold binding buffer in 500 L and subsequently incubated with 250nM of TD05-Ce6 probe at 4C for 20 min, cells were then washed with 1 mL of wash buffer by centrifuging at 950rpm, exposed to white fluorescent light (fluence rate = 2.8Jmin-1 ) for 4 hours, and then re-cultured in RPMI-

PAGE 86

86 1640 for 36 hours. The cell viability was determined by propidium iodide incorporation (Invitrogen). Experiments were repeated three times, each time in triplicate. Results and Discussion Results presented in previous chapters show that the aptamer TD05 binds selectively to Ramos cells. Subsequently, we found that aptamer TD05 binds with membrane bound IGHM, a known marker for Burkitts lymphoma cells. As shown in Figure 4-2, FITC-labeled TD05 aptamer selectively binds to Ramos cells, but not with other leukemia cells. Figure 4-2. Aptamer TD05-FITC binding to different leukemia cells. Higher fluorescence intensity observed for Ramos cells is an indication that aptamer FITC-TD05 selectively binds to Ramos cells. Therefore, we hypothesized that aptamer TD05 could be used for selective destruction of Ramos cells by conjugating to a photosensitizer followed by illumination of light. Use of aptamers in selective targeting of one specific tumor will effectively localize the PS on the cell membrane prior to illumination of light, thus increasing the therapeutic efficacy and selectivity of the PS.

PAGE 87

87 Conjugation of DNA with the photosensitizer Ce6 solves several problems associated with PSs. Conjugation of negatively charged DNA with Ce6 increases the aqueous solubility of Ce6, and makes it more useful for in vivo applications. The DNA aptamer has the targeting ability to localize the photosensitizer on the tumor membrane. Since PS absorbs near in the IR, these probes can also be used as imaging agents. Conjugation of Ce6 with Amine Modified Aptamer TD05 First, amine-modified TD05 aptamer was chemically conjugated to Ce6 by reaction with the N-hydroxysuccinamide ester (NHS) of Ce6, using dicyclohexyl carbodiimide (DCC) as a coupling agent as shown is Figure 4-3. Figure 4-3. Reaction of conjugation of chlorin e6 with an amine modified TD05 aptamer probe.

PAGE 88

88 Characterization of Aptamer TD05-Ce6 Conjugates Since Ce6 molecules show characteristic absorption bands at 404nm and 643nm, Ce6/DNA conjugates should show an absorbance maximum corresponding to Ce6 as well as DNA. Therefore, to confirm the conjugation of TD05 with Ce6, the purified aptamer TD05-Ce6 conjugate was characterized by observing the absorbance at 260 nm for DNA, and at 404nm, and 643nm for Ce6. As shown in Figure 4-4, the conj ugates indeed show absorbance at the expected wavelengths, suggesting that the Ce6 has been conjugated with amine modified DNA. After verifying the conjugation of Ce6 with DNA, we next investigated whether Ce6 can still act as an efficient reactive singlet oxygen generator. This was necessary because interactions between the electronic states of the dye chromophores and nucleic acids bases can lead to fluorescence quenching. Figure 4-4. UV-Vis absorption of Ce6 conjugated with DNA. The observed absorbance at 260nm is characteristic for DNA and absorbance at 404 nm and 643 nm are characteristic of Ce6 molecules. Since Ce6 is a near-IR dye, it could possibly be Ce6 could be quenched by DNA bases making the Ce6 less efficient as a photosensitizer. Therefore, the effectiveness of Ce6 was

PAGE 89

89 evaluated using a commercially available singlet oxygen detection kit, which contains a reduced version of FITC dye. The dye shows no fluores cence until it is oxidized by singlet oxygen. Therefore, in the presence of reduced sensor dye, the increase in the fluorescence signal with irradiation of Ce6 dye is proportional to the amount of singlet oxygen generated in solution. Figure 4-5 compares the results for free Ce6 with TD05-Ce6 conjugates. Conjugation with aptamer TD05 did not result in significant decrease in the sensor fluorescence, indicating that the photosensitizing properties of Ce6 were not lost. The observed slight decrease in the fluorescence signal with dye could be explained in terms photo bleaching effect with prolong irradiation. Next, it was necessary to evaluate whether conjugation has affected the specific binding of TD05 aptamer to Ramos cells. Since Ce6 is extremely hydrophobic, it can nonspecifically accumulate on the membrane, thus decreasing the specificity. Figure 4-5. Singlet oxygen generation ability of free Ce6 dye and Ce6 conjugated to aptamer TD05.The singlet oxygen generation was measured using fluorescence enhancement of sensor green, which is a reduced form of the FITC dye. Figure 4-6 shows the flow cytometric results for an in vitro binding study using FITC labeled TD05 by itself and an equimolar mixture of FITC-TD05 and Ce6-TD05. When Ce6TD05 is present the fluorescence due to FITC-TD05 decreases to about 50% of its original value, showing that TD05-Ce6 recognizes Ramos cells with selectivities similar to that of FITC-TD05.

PAGE 90

90 Binding of TD05-Ce6 to Ramos cells was also visualized using confocal microscopy. As shown in Figure 4-7 fluorescence from Ce6 was significantly higher in the presence of Ramos cells as compared to control CEM-CCRF cells, indicating that the TD05-Ce6 conjugates retain the selectivity for Ramos cells. Investigation of Toxicity of Aptamer TD05-Ce6 Conjugates We next evaluated whether TD05-Ce6 can selectively kill Ramos cells upon illumination of light. Ramos cells were used as the target cells, with CEM, K562, HL-60, and NB-4, which do not express IGHM, as the control cells. All the experiments were conducted in the dark to minimize the photo-bleaching of the PSs. Cells were incubated with 250nM of TD05-Ce6 conjugate in the dark at 4C for 30 min. Since the KD for TD05 is 75nM,84 slightly more than 75nM TD05-Ce6 was used to ensure the cells with IGHM were properly stained. A washing step prior to illumination ensured the removal of unbound probe to decrease the non-specific killing and to mimic higher clearance of unbound molecules from the body in the background tissues. Figure 4-6. Binding of aptamer TD05-Ce6 conjugate. Competitive binding of aptamer TD05 with Ramos cells before and after Ce 6 conjugation.

PAGE 91

91 Figure 4-7. Fluorescence confocal images. (A) TD05-Ce6 bound to the cell membranes of target Ramos cells. (B) Control CEM cells which do not show binding. Higher fluorescence signal observed on the membrane periphery is an indication of aptamer TD05-Ce6 conjugates binding to Ramos cells. On the other hand, CEM cells showed only a background fluorescence intensity suggesting that TD05-Ce6 conjugates do not bind. Since Ce6 molecules absorb long-wavelength of radiation, a commercially available fluorescence bulb was used (fluence rate = 2.8 mJ/min, and for 4 hours). Because the toxicity induced by PSs leads to slow killing of the cells, the exposed cells were re-cultured in the fresh media. Cell viability was determined 36 hours after illumination by propidium iodide incorporation using flow cytometry counting 10,000 events. Propidium iodide (PI) is a DNAintercalating dye, which cannot pass through the healthy cell membrane. When the cell membrane is damaged by reactive oxygen species, the dye is able to diffuse into the nucleus and intercalate into the genomic DNA, resulting in increased fluorescence. Therefore, by monitoring the fluorescence of the PI treated cells, the toxicity can be assayed. The results of the toxicity study are shown in Figure 4-8. The heights of the bars gave the percent cell viability with 100% corresponding to cells without any added aptamer or free Ce6. A B

PAGE 92

92 Thus, the efficacy of the treatment is indicated by a decrease in bar height. Clearly, the TD05Ce6 conjugates markedly decreased cell viability (7 1.3% 6.9% decrease) as shown in Figure 48. The toxicities observed in control CEM (35.8% 7.4), K562 (30% 3. 37), NB4 (36.4 7.09), and HL60 (<1%) cells are over 50% less th an toxicity for the targeted cell lines. This suggests that the specific interaction of TD05-Ce6 on the cell membrane can induce selective cell death. The slight toxicity of aptamer photosenstizer conjugate toward the CCRF-CEM, K-562, and NB-4 could be due to non-specific interactions with the cell membrane. While unconjugated Ce6 is insoluble in aqueous media, the conjugation of the DNA aptamer with Ce6 dramatically increases its aqueous solubility, resulting in an increased interaction of the hydrophobic portion of Ce6 with the cell membrane. Figure 4-8. Cell toxicity of aptamer TD05-Ce6 treated cells. Ramos cells after 30 min incubation at 4C. After removing the unbound probes, each sample was irradiated with light for 4 hours, and subsequently grown in fresh media for 36 hours. After 36 hours, cells were analyzed by monitoring the fluorescence enhancement resulted from PI incorporation into the genomic DNA of the dead cells. Referring to Figure 4-8, the free aptamer without Ce6 and the free Ce6 samples did not show significant toxicities. The toxicity clearly demonstrates the feasibility of aptamer-PS

PAGE 93

93 conjugates in effectively destroying cells that interact selectively with TD05-Ce6. Removal of the unbound TD05-Ce6 after incubation prevents the aptamer conjugates or free drug conjugates from entering into the cells, and it removes any nonspecific binding. Taken together it is suggestive that the interaction of TD05-Ce6 on the cell membrane is specific and can induce selective cell death. We next investigated the possibility of toxic effects could be due to the interaction of aptamer TD05-Ce6 conjugates with its target protein but not due to toxicity generated by irradiation of the PS. Figure 4-9 shows percentage cells viability without irradiation. As anticipated, the un-irradiated samples did not show any significant decrease in viability, indicating aptamer TD05-Ce6 conjugate is not toxic in the absence of light. To further demonstrate the specificity of the method, separate control experiments using a random DNA sequence attached to the Ce6 dye were performed. Because a random sequence does not bind to Ramos cells, the irradiated random DNA sequence attached to Ce6 dye should not lead to any toxicity towards Ramos cells. Figure 4-9. Cell viability observed for CEM and Ramos cells with no irradiation of light. Cells were incubated with APS conjugate and free Ce6 in the dark. Following the washing step, cells were grown for 36 hours prior to toxicity analysis using PI incorporation.

PAGE 94

94 As shown in Figure 4-10, the random DNA labeled with Ce6 did not show any toxicity towards Ramos cells, however, 26% 2.15% decrease in cell viability was observed for CEM cells. This could be due to non-specific interaction of DNA attached to Ce6 with the CEM cell membrane. Figure 4-10. Observed cell viability for HL-60, NB-4, K562, CEM and Ramos cells with Ce6 attached to a random DNA sequence. Photoactive therapy has great potential in cancer treatment, but administration of photoactive drugs for extended periods is usually not feasible. For this reason, conjugation of a photosensitizer with a probe that can be localized at the tumor site will enhance the therapeutic effectiveness. Here, we have exploited the specific recognition capability of DNA aptamers evolved using live cells along with ability of chemical manipulation of DNA to effectively target one type of cells. Covalent attachment of PS to aptamer provides stability in the cellular environment. The small size of the aptamer PS conjugate facilitates tissue penetration for treatment of solid tumors. Problems with the stability of aptamers could be addressed by incorporating unnatural nucleic acids at the pre-defined sites in the aptamer to increase resistance to nuclease degradation.

PAGE 95

95 CHAPTER 5 APTAMER EVOLVED FROM CELL-SELEX AS AN EFFECTIVE PLATFORM FOR DRUG RELEASE The previous chapter showed that aptamers can be used as carriers to deliver type II PSs to the tumor surface.173 However, a further increase in selectivity is still necessary to prevent the damage to the surrounding tissues caused by singlet oxygen. Patients who go through PDT treatments are often required to avoid sunlight for several weeks to months following the treatments due to the accumulation of the photosensitizer (PS) in the surrounding tissues.171, 174 One way to address this issue is by exploiting the photochemical and photophysical properties of PSs themselves. For example, it has been shown that the photosensitizing ability and the fluorescence emission of a PS can be successfully quenched by utilizing FRET (Fluorescence Energy Resonance Transfer) with fluorescence quenchers.175 Zheng et.al. and others demonstrated this principle by engineering a photodynamic molecular beacon, in which a quencher carefully positioned close to a PS using a polypeptide linker to effectively quenches ROS generation and fluorescence.175, 176 The FRET quenching mechanism depends strongly on the proximity of the PS and the quencher. When the PS-peptide-quencher conjugate reaches the tumor environment, tumor specific proteases cleave the peptide and release the quencher from close proximity to the PS. The PS remains in contact with the tumor and upon irradiation at the appropriate wavelength the PS produces fluorescence and cytotoxic singlet oxygen. Choi et al. 177 later demonstrated the feasibility of quenching of the photosensitizing ability of the PSs in xenografted tumor models using polylysine conjugates, followed by protease cleavage to restore toxicity. While the idea of specific peptides targeted by proteases secreted at the tumor environment is attractive, this method suffers from lack specificity of the peptide. In addition, peptide and small molecule conjugation chemistry is not straight forward and the structural rigidity required for efficient quenching of PS and quenchers is limited in peptides.

PAGE 96

96 In the following sections, we introduce an aptamer-based prodrug therapy which takes advantage of the ability of aptamers to selectively target tumor cells. The pro-drug utilizes a FRET-based PS quenching mechanism, and a DNA template-assisted disulfide bond reduction has been introduced to activate the pro-drug. DNA Directed Functional Group Transfer Reactions Liu et al. 178 introduced DNA Template based functional Group Transfer Reactions (DTGTR) in 2000. These reactions have proven to be effective in generating precise, well controlled reaction products. Figure 5-1. DNA Template based Functional Group Transfer Reactions. (a). Oligonucleotide is linked to a reactive group through a linker. (b). Hybridization of complementary oligonucleotides brings A and B closer together with their most favorable orientations and for higher rates of reaction. Figure 5-1 shows one type of DTGTR scheme. The reactants are linked to two complementary DNA strands. Hybridization of the two complementary DNA templates brings the reactants close together and orients them properly for reaction, resulting in higher reaction rates at low concentrations. These orientations also increase the probability of generating the desired product with minimal side product formation. Therefore, we hypothesized that the targeting ability of aptamers and the kinetic advantages of DTGTR could be combined to create a platform that triggers drug release.

PAGE 97

97 Utilization of DTGTR as a drug delivery method has already been demonstrated. For example, Ma and Taylors nucleic acids-triggered catalytic drug release took advantage of positioning two reactants in close proximity.179 This study focused mainly on targeting mRNA expression to trigger drug release. The authors linked an imidazole to a DNA nucleotide and a p nitrophenol group to a complementary DNA strand via an ester bond. Hybridization of the DNA strands brought the ester group close to the imidazole, facilitating base hydrolysis of the ester to generate free p -nitrophenol. 180 Alternatively, DNA aptamers can be attractive agents in applying drug delivery platforms via DTGTR. Apart from clinical advantages of DNA aptamers, one of the inherent properties of DNA is its structural rigidity, which can be manipulated to engineer PS/quencher pairs with increased quenching efficiency, as well as higher rates in release of the quencher by DTGTR. By combining suppression of the photosensitizing effect by the quencher, selective bond breakage by DTGTR and tumor recognition ability by the aptamer, we have designed a DTGTR based-aptamer complex to trigger the release of drug candidates at the tumor surface. Since aptamer Sgc8 evolved from cell-SELEX shows preferential binding to T cell lymphoma CEM cells,85,90 we hypothesized that the aptamers can be used as a platform to deliver drug candidates to the CEM cells. As shown in Figure 5-2, the newly designed aptamer template has three characteristics: 1. Tumor recognition ability from the aptamer 2. DNA platform for prodrug hybridization 3. Activator to release the drug by DTGTR. The prodrug is composed of a DNA sequence complementary to an aptamer platform having closely positioned fluorophore and quencher. Until the prodrug reaches the tumor environment and hybridizes with the platform, fluorescence is quenched. Hybridization of the pro-drug with

PAGE 98

98 platform allows the activator to react with the pro-drug to release the quencher and restore fluorescence. Figure 5-2. Aptamer-based DTGTR as a tool for drug release. The prodrug contains a fluorophore, which is quenched due to FRET. Upon hybridization with the platform, activator (DTT molecule) cleaves the disulfide linker between the quencher and the fluorophore, and the fluorescence is restored. Methods and Materials DNA Synthesis and Purification Aptamer Sgc8 modified with reaction template and non-specific control DNA was synthesized at the 1umole scale using standard phosphoimidite chemistry and was purified using reversed phase HPLC. An ABI3400 DNA/RNA synthesizer (Applied Biosystems, Foster City, CA) was used for the synthesis of all DNA sequenc es. Table 5-1 shows all the sequences used in this study. For internal labeling either FITC-dT or 5-NH2-dT was used. For 3 end labeling either dabsyl-Controlled Pore Glass (CPG) or black-hole quencher 2 CPG (BHQ2-CPG) was

PAGE 99

99 used. Dithiol phosphoamidite (DTPA) was used at the 5 end as the activator. A ProStar HPLC (Varian, Walnut Creek, CA) with a C18 column (Econosil, 5u, 250 4.6 mm) from Alltech (Deerfield, IL) was used to purify all fabricated DNA. A Cary Bio-300 UV spectrometer (Varian, Walnut Creek, CA) was used to measure the absorbance to quantify the manufactured sequences. The completed sequences were then deprotected in concentrated ammonium hydroxide at 65 C overnight and further purified with reverse phase high-pressure liquid chromatography (HPLC) on a C-18 column. Fluorescence Measurements Fluorescence measurements were performed on a Fluorolog-Tau-3 spectrofluorometer (Jobin Yvon, Inc., Edison, NJ) (37 0.1) C using a 100L cuvette. After adding the cDNADTT probe, the resulting fluorescence intensity of the PBFSSD was monitored by exciting the sample (FAM label) at 488 nm and measuring the emission at 505 nm. Bandwidth for both the excitation and the emission were set at 10 nm. Corrections were also made for potential dilution factors in the titration experiments. Cell line and Reaction Conditions CRF-CEM (CCL-119, T cell line, human ALL) cells were obtained from American Type Culture Collection. The optimum reaction buffer was 0.1M Na3PO4 at pH=8.01. All reactions were performed at 37C for 2 hours. Briefly, probe and the prodrug in appropriate ratios was incubated with 50,000 cells for 2 hours. Upon completion of the reactions, the mixture was immediately cooled to 4C and 350 L of cell binding buffer (4.5 g/L glucose and 5 mM MgCl2 in Dulbeccos PBS with calcium chloride and magnesium chloride; Sigma), yeast tRNA 0.1 mg/ml; (Sigma) and 1mg/mL sheared salmon sperm DNA was added prior to flow cytometric analysis. The data were analyzed by obtaining the mean fluorescence signal of the histogram for each sample.

PAGE 100

100 Table 5-1. Sequence of DTS reactions. DTT refers to DTPA D refers to DabsyldT, F refers to FITCdT, 6 refers disulfide phosphoamidite, C3 refers to carbon-3 spacer phosphoamidite, N refers to Dabsyl-CPG. Name Sequence PBC3DTT PBFSSD Sgc8Tem-C3DTT DTT-C3-GA TGG TGC GGA GCC GGC TCC GCA CCA F C6 TN DTT-C3-GAT GGT GCG GAG CCA TCT AAC TGC TGC GCC GCC GGG AAA ATA CTG TAC GGT TAG A Sgc8RTem-C3DTT DTT-C3-NNN NNN NNN NNN NNA TCT AAC TGC TGC GCC GCC GGG AAA ATA CTG TAC GGT TAG A Sgc8Random NNN NNN NNN NNN NNA TCT AAC TGC TGC GCC GCC GGG AAA ATA CTG TAC GGT TAG A Sgc8Tem GAT GGT GCG GAG CCA TCT AAC TGC TGC GCC GCC GGG AAA ATA CTG TAC GGT TAG A Results and Discussion Probe Design and Mechanism of Activation Aptamer Sgc8 was chosen for this study because of its high affinity for CEM-CCRF cells.85 A platform sequence consisting of 14 DNA bases was linked to dithiol phosphoamidite at the 5end. Reduction of dithiol phosphoamidite generates dithiothreitol (Cleavlans reagents, DTT) to act as the DTGTR activator. For the DNA based prodrug a quencher and either a fluorophore or a photosensitizer were linked via a S-S linkage to the DNA that is complementary to the platform sequence. The basic hypothesis is that, upon hybridization of the prodrug with the cDNA platform, the DTT group aligns with the disulfide group and cleaves the disulfide linker to the quencher, thus restoring fluorescence. The mechanism of DTT mediated disulfide cleavage is outlined in Figure 5-3. The FRET probe was aided in proving the concept of DTGTR. A 14 mer sequence was aligned incorporating a FRET pair to monitor the reduction of the disulfide linker between a Dabsyl quencher and an FITC fluorophore as shown in Figure 5-3. Initially, the fluorescence restoration was investigated using large excess of free DTT, and fluorescence signal was monitored.

PAGE 101

101 Figure 5-3. Mechanism of fluorescence restoration of the hypothetical pro-drug upon reduction of disulfide linker. The prodrug contains a 14 mer DNA sequence modified with a FITC fluorophore and linked to a Dabsyl quencher through a disulfide bridge. The activator platform contains a 14 mer complementary sequence attached to a DTT molecule. Upon hybridization of prodrug with the platform, the DTT group comes into the close proximity of the disulfide linker. DTT molecule cleaves the disulfide linker, releasing the quencher and restoring fluorescence.

PAGE 102

102 As shown is Figure 5-4, upon addition of free DTT, the fluorescence signal increased within 1 hour reaction time, confirming the positioning of the FITC and Dabsyl. Following the confirmation of the synthetic product of PBFSSD, we investigated whether DTT bonded to the platform can also rapidly reduce the disulfide bond. The fluorescence signal enhancement was monitored by adding equal amounts of PB-C3DTT and free DTT respectively, to two prodrug samples. As shown in Figure 5-5, when PB-C3DTT was used, the increased local concentration of DTT due to DNA hybridization enhanced the rates of fluorescence restoration compared to free DTT. Figure 5-4. Verification of de-quenching effect upon reduction of disulfide link. Increase in fluorescence signal with free DTT indicates that fluorescence can be restored by cleaving disulfide link to remove the quencher. Investigation of Quencher Release Using Aptamer Sgc8tem-C3-DTT on the CEM Cells Following the preliminary work with a short DNA sequence, the feasibility of applying the same prodrug on a cell membrane was investigated. In doing so, Sgc8 aptamer targeted to CEMCCRF cells was modified with DTT via the platform and a 3-carbon spacer as shown in Figure 5-6. Introduction of the 3-carbon spacer increased the flexibility and free rotation, thus, minimized steric effects caused by the large fluorophore and quencher pairs.

PAGE 103

103 Figure 5-5. Restored fluorescence upon addition of PB-C3-DTT to PBFSSD. When PB-temc3DTT was added at 1200s, the fluorescence signal increased, confirming the reduction of the disulfide bond due increased local concentration. When an equal total concentration of free DTT was added, the fluorescence did not increase. Since the aptamer and target cell interaction depends on the unique three dimensional folding of the aptamer, it is possible that the aptamer binding would be affected by introducing additional bases at the 3 or 5 end. The secondary structure predicted by m-fold for Sgc8 aptamer is a hair pin, as shown in Figure 5-6-A. Theoretically, addition of 14 additional bases at the 5 end and subsequent hybridization to the pro-drug should further stabilize the hair-pin structure. However, it is also arguable that th e DNA aptamer can refold when the extra bases are added.

PAGE 104

104 Figure 5-6. Aptamer platform and hypothetical prodrug. Aptamer consists of three key elements: (A) Tumor recognition element, (B) Reaction platform, (C) Activator molecule (DTT). (D) The hypothetical prodrug consists of cDNA to hybridize with the platform. The mechanism of cleavage of the disulfide linker is shown in Figure 53.

PAGE 105

105 Therefore, in order to investigate specific binding of the aptamer when modified, a competition assay was performed by introducing excess modified aptamer to cells bound to the unmodified aptamer Sgc8 labeled with FITC. As shown in Figure 5-7, the fluorescence intensity of FITCSgc8 decreased, indicating that FITC-Sgc8 was displaced from the cell membranes by the modified Sgc8 and verifying that the modified-Sgc8 retains its binding ability. We next investigated whether the restored fluorescence on the cell membrane upon disulfide reduction can be detected using flow cytometry. A 250nM sample of PBFSSD along with aptamer Sgc8tem was incubated with 3000 fold excess of free DTT to allow complete reduction of the disulfide bond. Upon completion of the reaction, the reduced probe was incubated with CEM cells and the restored fluorescence on CEM cells was analyzed using the flow cytometry. As shown Figure 5-8, the fluorescence intensity fo r the cells with DTT treated probe was increased compared to the cells with untreated probe, indicating that fluorescence restoration can be detected on the cell membrane. Next, we investigated whether Sgc8tem-C3-DTT probe can also reduce the disulfide bond on the cell membrane. The CEM cells were incubated with (1) 30-fold excess of Sgc8tem-C3DTT and PBFSSD, (2) the positive control (3000-fo ld excess of free DTT), and (3) the negative control (nothing but the PBFSSD, Sgc8temC3) to investigate the reaction. After 2 hours of reaction at 37C, the restored FITC fluorescence on the cell membrane was monitored using flow cytometry. The heights of the bars give the mean fluorescence intensity observed in the histogram for each reaction. All reactions were done in triplicate. As shown in Figure 5-9, a 30fold excess of aptamer Sgc8tem-C3-DTT reduces the disulfide linker, whereas a 3000-fold excess of free DTT is needed to achieve the same fluorescence enhancement, demonstrating the effective cleavage by increased local concentration.

PAGE 106

106 Figure 5-7. Binding of Sgc8tem with CEM cells. The fluorescence intensity of aptamer Sgc8FITC decreases in the presence of a 10-fold excess of Sgc8tem and Sgc8-Random indicating that Sgc8 binding is retained after attachment of additional bases at the 5 end. Figure 5-8. Flow cytometric results for DTT treated PBFSSD on CCRF-CEM cells. The cells were treated with equal concentrations of PBFSSD and Sgc8tem with and without excess DTT at 37C. The increase in the fluorescence indicates that PBFSSD was cleaved by excess DTT.

PAGE 107

107 Figure 5-9. Reduction abilities of free DTT and DTT attached to DNA aptamer template. Each probe was incubated in the reaction buffer with CEM-CCRF cells. After 2 hours, the restored fluorescence was analyzed using flow cytometry. Next, ratios of Sgc8Tem-C3DTT to PBFSSD (250nM) were varied 5, 10 and 30 to determine the minimum ratio of Sgc8Tem-C3DTT needed to achieve the highest fluorescence restoration. Addition of excess template shifts the equilibrium to the bound state allowing the entire PBFSSD to be hybridized with Sgc8Tem-C3DTT template. According to the Figure 5-10, free DTT fails to reduce the disulfide linker at any of these ratios, but as the concentration of Sgc8Tem-C3DTT increases the amount of sulfide reduction increases by the same factor. Then the specificity of disulfide cleavage was investigated using a random template bound to DTT via a 3-carbon linker. As shown in Figure 5-11, the Sgc8-Random-tem-C3DTT, does not increase the fluorescence intensity, indicating that the disulfide linkage is not cleaved without DNA hybridization and that the template mediated disulfide reduction using DTT attached to the aptamer platform is specific.

PAGE 108

108 Figure 5-10. Disulfide bond reduction of PBFSSD using DTT bound to aptamer platform and free DTT. Respective ratios of Sgc8c3tem/DTT incubated with 250nM PBFSSD in binding buffer and with CEM-CCRF cells for 2 hours at 37C. Following 2 hours incubations, restored fluorescence was detected using flow cytometry. Figure 5-11. Specificity of disulfide bond reduction by DTT attached to Sgc8-tem-c3DTT. Sgc8-sequence with random DNA template linked to DTT (Sgc8-R-Tem-C3DTT) failed to reduce the disulfide bond.

PAGE 109

109 In conclusion, a new model of drug delivery utilizing DTGTR has been demonstrated. Based on the observed results using FITC-Dabsyl pair, we have shown a proof-of-concept for PS/quencher based pro-drugs. The ability of aptamer to specifically recognize a target cell line, followed by the drug activation mechanism could be utilized in precise control and delivery of PS based prodrugs in exact tumor locations.

PAGE 110

110 CHAPTER 6 SUMMARY AND FUTURE WORK Summary of In vitro Selection of Aptamer Targeting PKC This dissertation demonstrated the versatility of aptamers for variety applications: selective binding to a predetermined protein, recognition of a biomarker on tumor cell membranes, localization of a photosensitizer for photodynamic therapy, and localization of a prodrug for controlled PDT. The initial phase of the research (Chapter two) focused on the selection of an aptamer for a single protein using CE-SELEX. The selected aptamer was modified with a fluorophore to detect PKC The aptamer showed reasonable specificity for PKC compared to PKC and PKC While CE-SELEX showed high separation efficiencies when a larger protein (IgE, 115kDa) was used73, the separation efficiency was low for the much smaller PKC (90 kDa). This is mainly because of the overlap of the broad free-DNA peaks and the small difference in electrophoretic mobility when the aptamer binds to a single protein. Therefore, the major drawback of CE-SELEX for small target proteins leads to the selection of aptamers with poor affinities. To address this problem, the combination of gel electrophoresis or other conventional SELEX procedure along with CE may be useful. Biomarker Discovery The work described in Chapter 3 involved the identification of a biomarker using aptamers generated against Ramos cells. This was accomplished by taking advantage of the ability of easy chemical modification of DNA. Discovery of the biomarker demonstrated the capability of aptamers selected using cell-SELEX to recognize Ramos cell specific protein (IGHM) and to systematic identification of proteins that are significantly expressed in a cancer cell.

PAGE 111

111 Recent advances including the results of this work in aptamer selection and the ability to target whole cells have led to investigation of applicability of aptamers as molecular probes in disease recognition and therapy. Based on these examples, the feasibility and the promise in cancer therapy using aptamers are becoming much more realistic and significant. As described in this research, an important advantage of this approach is that, aptamer selection is done with no prior knowledge of the protein expression patterns of a given cell. Subsequent identification of interacting proteins on these cell membranes can lead to the discovery of new biomarkers, thus forming a solid molecular foundation for molecular medicine. However, the current approach of aptamer selection needs to be more refined in terms of selection efficiency as well as methods of protein identification. With the advances in the fields of molecular probe engineering, nanotechnology, imaging instrumentation aptamers can be highly efficient molecular probes for cancer and other significant diseases. In summary, using aptamers as molecular probes can enable highly effective molecular imaging and profiling of diseases. Summary of Targeted Therapy Study Chapter 4, we demonstrated that aptamers selected for specific recognition of a marker protein can be used as a drug carrier, in particular a photosensitizer for the destruction of Ramos cells. This demonstrated ability of aptamers to target tumors with high selectivity makes targeted therapy possible in a number of pretargeting strategies. Moreover, aptamers do not induce immunogenic reactions, and are effective in penetrating the solid tumors. Due to the easy chemical manipulation, aptamers can readily be modified with functional groups making them attractive in bio-conjugations. For example, we have demonstrated the feasibility of conjugation of an aptamer for Ramos cells with photosensitizers. Despite the many advantages of aptamer, their broader use in animal models needs to be investigated and potential problems in in vivo applications needs to be addressed.181

PAGE 112

112 The investigation of aptamers-based drug carriers was extended in Chapter 5. To avoid undesirable effects associated with photosensitizers, as a proof-of-concept we demonstrated PS can be delivered to CCRF-CEM cells in an inactive form using the FRET principle to a nearby quencher. After localization on the cell membrane, the PS was activated by a template-based bond cleavage reaction to remove the quencher and restore fluorescence. This pro-drug design clearly demonstrated that targeted therapies can be controlled for optimum drug release. Future Work Aptamers with Increased Nuclease Stability This work has demonstrated some of the advantages of aptamers as therapeutic carriers, but challenges of applying aptamers in vivo studies are their instability in the serum. Since they consist of nucleic acids, aptamers can readily be digested by nucleases and cleared from the body. For example, unmodified antisense oligonucleotide has a half life in serum of less than a minute; 182 and, an unmodified aptamer against thrombin has shown significantly low halflives.182 For this reason, the future of aptamers as therapeutic carriers relies mainly on the introduction chemical functionalities that can resist the nuclease degradation. Modification of the DNA backbone, as well as introduction of non-natural bases into the DNA sequence, have been demonstrated to be effective in this regard.183 For example, substitution of 2-hydroxy group of the ribose moiety of an RNA aptamer by a fluorine or amino group increased the stability of the aptamer by several orders of magnitude184. Another strategy exploited phosphorothioate-modified aptamers for targeting at an immune receptor on T cells in vitro and in vivo .183 Floege, J. et al. substituted the 2 position of the sugar ring of a PDGF aptamer with O -methylor fluorogroups and replaced the non-binding portions of the aptamer sequence with hexaethylene glycol spacers. They observed a much longer half-life in serum and the binding affinity of the aptamer for PDGF was not significantly altered.185 External labels have also been

PAGE 113

113 evaluated for increased nuclease-resistance of aptamers.186 It was found that aptamers linked to a biotin label at the 3-end showed increased stability in vitro while a biotin-streptavidin group at the 3-end protected the aptamer from nucleases even in vivo Besides the efforts in post-SELEX modifications for enhanced aptamer stability, some studies have turned direct use of modified DNA or RNA bases in the SELEX process.187 Aptamers isolated in this way can have the builtin ability to resist nuclease digestion. The first aptamer based FDA approved drug against VEGF-A is currently on market. 181 In this aptamer the pyrimidines were modifies at the 2NH2 position with long poly ethylene glycol chains to prevent nuclease degradations, and to increase the blood residence-time. 181 Table 6-1 summarizes the modifications of unconventional nucleic acid bases that have shown to demonstrate prolonged lifetimes in real biological samples. Table 6-1. Different types of chemical modifications, for stabilization of aptamers and for enhancing pharmacokinetics, immobilization and labeling. 188 Functional Group Position Purpose 2-F or 2-NH2 nucleotides 2-OMe-nucleotides dT-Cap Polyethyleneglycol (PEG) Diacyl glycerol Biotin Primary Amines (-NH2) Pyrimidines Pyrimidines and purines 3-end 5-end 5-end 5-end, 3-end, other defined positions 5-end and 3-end Protection against endonucleases Protection against minor endonucleases Protection against exonucleases Reduced plasma clearance Reduced plasma clearance For Immobilization solid supports or attachment to other SA-conjugates NHS-EDC chemistry, introduction of drug conjugates Aptamers as Targeting Moiety in Gene Therapy Apart from PDT, aptamers have a potential as a targeting agents in gene therapy, which was introduced as a treatment modality for genetic diseases. However, with the developments of in bio-technology and increased variability of viral vectors, this modality is increasingly popular

PAGE 114

114 in cancer therapy.189 One of the most used vectors in gene therapy is Adeno Associate Virus vectors (AAV), which is a single stranded DNA parvovirus with a genome of 4700 nucleotides. 189 In the case of cancer treatment AAV was shown to be effective in delivering suicide genes into the cancer cells. So far, the incorporation of saporin into the virus vectors has been demonstrated to be effective in inducing cell death in B16 melanoma cells.190 A possible extension of the present work would involve linkage of aptamer Sgc8 to AAV for delivery into CEM cells. Infection can be monitored using a GFP fused gene along with the suicide gene and by monitoring the expression of the tag. Additional Structural Studies of Aptamer Site Recognition In Chapter 3 we demonstrated a method to identify the protein that in interacting with aptamer TD05 by covalent crosslinking of the probe, thereby generating a frozen aptamer protein complex. By introducing 13C isotope at the C5 position of the 5-dUI additional information could be obtained. By observing the location of the isotope covalently crosslinked with the protein epitope, the interaction site of the protein can be determined. Stable isotope labeling with deuterium, 18O, or 13C, having known ratios with their non-labeled counter parts allows MS detection of products from the enzymatic digestion based solely on their distinctive patterns of the isotope peaks. The identification of the epitope of the protein interacting with the aptamer help scientists to understand the nature of the binding of the aptamer with its protein, and to modify the aptamer for use as a drug carrier. Figure 6-1 exemplifies the structure of the 5iodo deoxy uracil with 13C incorporated at the C5 position. When cross-linked with a 13Clabeled base, each amino acid in the corresponding to the peptide fragment will have a higher m/z based on the degree of crosslinking. The proposed scheme for the characterization of the binding site of the epitope of the IgM protein using 13C labeled aptamer is shown below (Figure 6-2). Aptamers containing 13C-labeled

PAGE 115

115 5-iodouridine will be incubated with target cell line. After washing off the unbound aptamers, aptamer-cell complex can be irradiated with a 308nm excimer laser to induce covalent crosslinking. After crosslinking, the extra-cellular membrane will be removed using trypsin and protienase K and subsequently analyzed by LC-MS/MS. By detecting the presence of 5-dUI* with 13C, the epitope of the protein can be determined.

PAGE 116

116 O H OH H H H H HO N NH O O I Figure 6-1. Structure of 5-iodo deoxy uridine. (*) position refers to the 13C on the base.

PAGE 117

117 Figure 6-2. The proposed method for determination of aptamer binding site on IGHM. The modified aptamer with isotope encoded aptamer probe is cross-linked with the protein. The extracted tryptic digested peptides will be characterized by LC/MS/MS. By observing the presence of an isotope on the peptide fragment, the amino acids of the protein that are bound to the aptamer can be characterized.

PAGE 118

118 APPENDIX FLOW CYTROMETRIC ANALYSIS OF BINDING OF FLUOROPHORE LABELED APTAMER WITH CELLS Chapter 3 5 described the utilization of flow cytometry to evaluate the binding of fluorophore labeled aptamer with the corresponding cell line. Modern flow cytometers are capable of analyzing thousands of cells per second by simultaneously obtaining multiple parameters including front and side scattering as well as signals from one or more fluorophores. A flow cytometer is similar to a microscope, instead of producing an image of the cell; flow cytometer offers binding events in a form of a histogram. Instrumentation Figure A-1. Typical flow cytometer setup. Cells are hydrodynamically injected and with the aid of the sheath flow one cell at a time pushed into the optical path. As the cells intercept the laser, scattered light is collected. If the cells are stained with a fluorescence tags, the emitted fluorescence is collected and converted into a digital data set.

PAGE 119

119 Flow cytometers use the principle of hydrodynamic focusing of cells by a laser (or any other light excitation source). Figure A-1 illustrates the schematic representation of a flow cytometer. A suspension of cells is injected into a flow cytometer hydrodynamically. The combined sheath flow is reduced in diameter, forcing each the cell into the center of the stream. Therefore, flow cytometer detects one cell at a time. As the cells intercept the light source, they scatter light based on the sizes and shapes. If the cells are stained with a probe tagged with a fluorophore, the fluoresced light will indicate which cells contain the probe. The scattered or emitted light from each cell is converted into electric pulses through the photo-multiplier tube (PMT) detectors. Data Interpretation A histogram displays the cell count plotted on the Y-axis (Events) as function of relative fluorescence intensity of cells on the X axis in log scale. Figure A-2 illustrates a typical histogram obtained for Ramos cells with no fluorescent tag (average intensity = 7.33) with a FITC molecule. Binding of FITC-tagged aptamer TD05 shifts the average intensity to 54.4, but incubation with a labeled random DNA sequence does not cause a signal increase (see Figure A3). Using the data for fluorescence tagged aptamer binding and the non-specific DNA sequence; a threshold value can be introduced. Based on the threshold value and the fluorescence intensity observed for each binding, a percentage of the cells with fluorescence above the set threshold can be estimated: 0: <10% +: 10-35%, ++: 35-60%, +++: 60-85%, ++++ : >85%. For example as illustrated in Figure A-4, point A corresponds to no binding of the probe i.e. fluorescence detected on the cells are in the background leve l hence, cells detected below the threshold A are considered unbound, and equals to <10% of the fluorescence of the aptamer bound cells. The binding observed for each cell lines above the point A is calculated by the equation A-1.

PAGE 120

120 Figure A-2. Histogram obtained from the flow cytometer. Y axis indicates number of cells detected in the given experiment, and the X axis indicates the relative fluorescence intensity detected in each cell. The mean fluorescence intensity for this histogram is 7.33. Figure A-3. Histogram obtained to find out the binding of fluorescence tagged aptamer probe. Red curve shows higher fluorescence intensity with a mean fluorescence value of 54.37. The blue curve obtained for the same cell line with a fluorescence tagged random DNA indicates that the sequence does not bind with the cell line.

PAGE 121

121 Figure A-4. Fluorescence tagged aptamer binding with different cells. The highest value of fluorescence indicated by B correlates to maximum binding, i.e. positive control (++++). Point A and below correspond to <10%, hence this correlates to background signal. The histograms in between point A and B correlates to ++, +++, etc Binding percentage = Mean fluorescence of the background signal Mean fluorescence of the signalMean fluorescence of the positive control Mean fluorescence of the background signal-00 (A-1)

PAGE 122

122 REFERENCES 1. www.ncbi.nlm.nih.gov/ Lat accessed January 2, 2008 2. http://www.cancer.org/docroot/home/index.asp Last accessed January 2, 2008 3. Jensen, O.N. Modification-specific proteomics: characterization of post-translational modifications by mass spectrometry. Curr Opin Chem Biol 8 33-41 (2004). 4. Mann, M. & Jensen, O.N. Proteomic analysis of post-translational modifications. Nat Biotechnol 21 255-261 (2003). 5. Hancock, W., Apffel, A., Chakel, J., Hahnenberger, K., Choudhary, G., Traina, J.A. & Pungor, E. Integrated genomic/proteomic analysis. Anal Chem 71 742A-748A (1999). 6. Hardcastle, J., Kurozumi, K., Chiocca, E.A. & Kaur, B. Oncolytic viruses driven by tumor-specific promoters. Curr Cancer Drug Targets 7 181-189 (2007). 7. Hammarstrom, S. The carcinoembryonic antigen (CEA) family: structures, suggested functions and expression in normal and malignant tissues. Semin Cancer Biol 9 67-81 (1999). 8. Tasch, J., Gong, M., Sadelain, M. & Heston, W.D. A unique folate hydrolase, prostatespecific membrane antigen (PSMA): a target for immunotherapy? Crit Rev Immunol 21 249-261 (2001). 9. Osborne, C.K., Hamilton, B., Titus, G. & Livingston, R.B. Epidermal growth factor stimulation of human breast cancer cells in culture. Cancer Res 40 2361-2366 (1980). 10. Olsson, A.K., Dimberg, A., Kreuger, J. & Claesson-Welsh, L. VEGF receptor signalling in control of vascular function. Nat Rev Mol Cell Biol 7 359-371 (2006). 11. Ariad, S., Seymour, L. & Bezwoda, W.R. Platelet-derived growth factor (PDGF) in plasma of breast cancer patients: correlation with stage and rate of progression. Breast Cancer Res Treat 20 11-17 (1991). 12. Chan, J.M., Stampfer, M.J., Giovannucci, E., Gann, P.H., Ma, J., Wilkinson, P., Hennekens, C.H. & Pollak, M. Plasma insulin-like growth factor-I and prostate cancer risk: a prospective study. Science 279 563-566 (1998). 13. Hursting, S.D., Lashinger, L.M., Colbert, L.H., Rogers, C.J., Wheatley, K.W., Nunez, N.P., Mahabir, S., Barrett, J.C., Forman, M.R. & Perkin, S.N. Energy balance and carcinogenesis: underlying pathways and targets for intervention. Curr Cancer Drug Targets 7 484-491 (2007 ). 14. Nahta, R. & Esteva, F.J. HER-2-targeted therapy: lessons learned and future directions. Clin Cancer Res 9 5078-5084 (2003).

PAGE 123

123 15. Halatsch, M.E., Schmidt, U., Behnke-Mursch, J., Unterberg, A. & Wirtz, C.R. Epidermal growth factor receptor inhibition for the treatment of glioblastoma multiforme and other malignant brain tumours. Cancer Treat Rev 32 74-89 (2006). 16. Isola, J.J., Holli, K., Oksa, H., Teramoto, Y. & Kallioniemi, O.P. Elevated erbB-2 oncoprotein levels in preoperative and follow-up serum samples define an aggressive disease course in patients with breast cancer. Cancer 73 652-658 (1994). 17. Andersen, T.I., Paus, E., Nesland, J.M., McKenzie, S.J. & Borresen, A.L. Detection of cerbB-2 related protein in sera from breast cancer patients. Relationship to ERBB2 gene amplification and c-erbB-2 protein overexpression in tumour. Acta Oncol 34 499-504 (1995). 18. Willsher, P.C., Beaver, J., Pinder, S., Bell, J.A., Ellis, I.O., Blamey, R.W. & Robertson, J.F. Prognostic significance of serum c-erbB-2 protein in breast cancer patients. Breast Cancer Res Treat 40 251-255 (1996). 19. Fehm, T., Maimonis, P., Weitz, S., Teramoto, Y., Katalinic, A. & Jager, W. Influence of circulating c-erbB-2 serum protein on response to adjuvant chemotherapy in nodepositive breast cancer patients. Breast Cancer Res Treat 43 87-95 (1997). 20. Mansour, O.A., Zekri, A.R., Harvey, J., Teramoto, Y. & el-Ahmady, O. Tissue and serum c-erbB-2 and tissue EGFR in breast carcinoma: three years follow-up. Anticancer Res 17 3101-3106 (1997). 21. Disis, M.L., Pupa, S.M., Gralow, J.R., Dittadi, R., Menard, S. & Cheever, M.A. Hightiter HER-2/neu protein-specific antibody can be detected in patients with early-stage breast cancer. J Clin Oncol 15 3363-3367 (1997). 22. Krainer, M., Brodowicz, T., Zeillinger, R., Wiltschke, C., Scholten, C., Seifert, M., Kubista, E. & Zielinski, C.C. Tissue expression and serum levels of HER-2/neu in patients with breast cancer. Oncology 54 475-481 (1997). 23. Burke, H.B., Hoang, A., Iglehart, J.D. & Marks, J.R. Predicting response to adjuvant and radiation therapy in patients with early stage breast carcinoma. Cancer 82 874-877 (1998). 24. Fehm, T., Maimonis, P., Katalinic, A. & Ja ger, W.H. The prognostic significance of cerbB-2 serum protein in metastatic breast cancer. Oncology 55 33-38 (1998). 25. Mehta, R.R., McDermott, J.H., Hieken, T.J., Marler, K.C., Patel, M.K., Wild, L.D. & Das Gupta, T.K. Plasma c-erbB-2 levels in breast cancer patients: prognostic significance in predicting response to chemotherapy. J Clin Oncol 16 2409-2416 (1998). 26. Colomer, R., Montero, S., Lluch, A., Ojeda, B., Barnadas, A., Casado, A., Massuti, B., Cortes-Funes, H. & Lloveras, B. Circulating HER2 extracellular domain and resistance to chemotherapy in advanced breast cancer. Clin Cancer Res 6 2356-2362 (2000).

PAGE 124

124 27. Bewick, M., Conlon, M., Gerard, S., Lee, H., Parissenti, A.M., Zhang, L., Gluck, S. & Lafrenie, R.M. HER-2 expression is a prognostic factor in patients with metastatic breast cancer treated with a combination of high-dose cyclophosphamide, mitoxantrone, paclitaxel and autologous blood stem cell support. Bone Marrow Transplant 27 847-853 (2001). 28. Harris, L.N., Liotcheva, V., Broadwater, G., Ramirez, M.J., Maimonis, P., Anderson, S., Everett, T., Harpole, D., Moore, M.B., Berry, D.A., Rizzeri, D., Vredenburgh, J.J. & Bentley, R.C. Comparison of methods of measuring HER-2 in metastatic breast cancer patients treated with high-dose chemotherapy. J Clin Oncol 19 1698-1706 (2001). 29. Ali, S.M., Leitzel, K., Chinchilli, V.M., Engle, L., Demers, L., Harvey, H.A., Carney, W., Allard, J.W. & Lipton, A. Relationship of serum HER-2/neu and serum CA 15-3 in patients with metastatic breast cancer. Clin Chem 48 1314-1320 (2002). 30. Classen, S., Kopp, R., Possinger, K., Weidenhagen, R., Eiermann, W. & Wilmanns, W. Clinical relevance of soluble c-erbB-2 for patients with metastatic breast cancer predicting the response to second-line hormone or chemotherapy. Tumour Biol 23 70-75 (2002). 31. Lipton, A., Ali, S.M., Leitzel, K., Demers, L., Chinchilli, V., Engle, L., Harvey, H.A., Brady, C., Nalin, C.M., Dugan, M., Carney, W. & Allard, J. Elevated serum Her-2/neu level predicts decreased response to hormone therapy in metastatic breast cancer. J Clin Oncol 20 1467-1472 (2002). 32. Kandl, H., Seymour, L. & Bezwoda, W.R. So luble c-erbB-2 fragment in serum correlates with disease stage and predicts for shortened survival in patients with early-stage and advanced breast cancer. Br J Cancer 70 739-742 (1994). 33. Volas, G.H., Leitzel, K., Teramoto, Y., Grossberg, H., Demers, L. & Lipton, A. Serial serum c-erbB-2 levels in patients with breast carcinoma. Cancer 78 267-272 (1996). 34. Carney, W.P., Neumann, R., Lipton, A., Leitzel, K., Ali, S. & Price, C.P. Potential clinical utility of serum HER-2/neu oncoprotein concentrations in patients with breast cancer. Clin Chem 49 1579-1598 (2003). 35. Liotta, L. & Petricoin, E. Molecular profiling of human cancer. Nat Rev Genet 1 48-56 (2000). 36. Lipshutz, R.J., Fodor, S.P., Gingeras, T.R. & Lockhart, D.J. High density synthetic oligonucleotide arrays. Nat Genet 21 20-24 (1999). 37. Alizadeh, A.A., Eisen, M.B., Davis, R.E., Ma, C., Lossos, I.S., Rosenwald, A., Boldrick, J.C., Sabet, H., Tran, T., Yu, X., Powell, J.I., Yang, L., Marti, G.E., Moore, T., Hudson, J., Jr., Lu, L., Lewis, D.B., Tibshirani, R., Sherlock, G., Chan, W.C., Greiner, T.C., Weisenburger, D.D., Armitage, J.O., Warnke, R., Levy, R., Wilson, W., Grever, M.R., Byrd, J.C., Botstein, D., Brown, P.O. & Staudt, L.M. Distinct types of diffuse large Bcell lymphoma identified by gene expression profiling. Nature 403 503-511 (2000).

PAGE 125

125 38. Humphery-Smith, I., Cordwell, S.J. & Blackstock, W.P. Proteome research: complementarity and limitations with respect to the RNA and DNA worlds. Electrophoresis 18 1217-1242 (1997). 39. Goldsworthy, S.M., Stockton, P.S., Trempus, C.S., Foley, J.F. & Maronpot, R.R. Effects of fixation on RNA extraction and amplification from laser capture microdissected tissue. Mol Carcinog 25 86-91 (1999). 40. Golub, T.R., Slonim, D.K., Tamayo, P., Huard, C., Gaasenbeek, M., Mesirov, J.P., Coller, H., Loh, M.L., Downing, J.R., Caligiuri, M.A., Bloomfield, C.D. & Lander, E.S. Molecular classification of cancer: class discovery and class prediction by gene expression monitoring. Science 286 531-537 (1999). 41. Sgroi, D.C., Teng, S., Robinson, G., LeVangie, R., Hudson, J.R., Jr. & Elkahloun, A.G. In vivo gene expression profile analysis of human breast cancer progression. Cancer Res 59 5656-5661 (1999). 42. Barber, M., Bordoli, R.S., Sedgwick, R.D., Tyler, A.N. & Bycroft, B.W. Fast atom bombardment mass spectrometry of bleomycin A2 and B2 and their metal complexes. Biochem Biophys Res Commun 101, 632-638 (1981). 43. Morris, H.R., Panico, M., Barber, M., Bordoli, R.S., Sedgwick, R.D. & Tyler, A. Fast atom bombardment: a new mass spectrometric method for peptide sequence analysis. Biochem Biophys Res Commun 101, 623-631 (1981). 44. Tang, N. & Tornatore, P.W., S. R. Current developments in SELDI affinity technology. Mass Spectrometry Reviews 23 34-44 (2003). 45. Gullberg, M., Fredriksson, S., Taussig, M., Jarvius, J., Gustafsdottir, S. & Landegren, U. A sense of closeness: protein detection by proximity ligation. Curr Opin Biotechnol 14 82-86 (2003). 46. Engvall, E. & Perlman, P. Enzyme-linked immunosorbent assay (ELISA). Quantitative assay of immunoglobulin G. Immunochemistry 8 871-874 (1971). 47. Famulok, M., Mayer, G. & Blind, M. Nucleic acid aptamers-from selection in vitro to applications in vivo. Acc Chem Res 33 591-599 (2000). 48. Jayasena, S.D. Aptamers: an emerging class of molecules that rival antibodies in diagnostics. Clin Chem 45 1628-1650 (1999). 49. Rajendran, M. & Ellington, A.D. In vitro selection of molecular beacons. Nucleic Acids Res 31 5700-5713 (2003). 50. Nutiu, R. & Li, Y. In vitro selection of structure-switching signaling aptamers. Angew Chem Int Ed Engl 44 1061-1065 (2005).

PAGE 126

126 51. Hermann, T. & Patel, D.J. Adaptive recognition by nucleic acid aptamers. Science 287 820-825 (2000). 52. Di Primo, C., Rudloff, I., Reigadas, S., Arzumanov, A.A., Gait, M.J. & Toulme, J.J. Systematic screening of LNA/2'-O-methyl chimeric derivatives of a TAR RNA aptamer. FEBS Lett 581 771-774 (2007). 53. Green, L.S., Jellinek, D., Jenison, R., Ostman, A., Heldin, C.H. & Janjic, N. Inhibitory DNA ligands to platelet-derived growth factor B-chain. Biochemistry 35 14413-14424 (1996). 54. Schmidt, K.S., Borkowski, S., Kurreck, J., Stephens, A.W., Bald, R., Hecht, M., Friebe, M., Dinkelborg, L. & Erdmann, V.A. Application of locked nucleic acids to improve aptamer in vivo stability and targeting function. Nucleic Acids Res 32 5757-5765 (2004). 55. Crawford, M., Woodman, R. & Ko Ferrigno, P. Peptide aptamers: tools for biology and drug discovery. Brief Funct Genomic Proteomic 2 72-79 (2003). 56. Ciesiolka, J. & Yarus, M. Small RNA-divalent domains. RNA 2 785-793 (1996). 57. Sullenger, B.A. & Gilboa, E. Emerging clinical applications of RNA. Nature 418 252258 (2002). 58. Nieuwlandt, D., Wecker, M. & Gold, L. In vitro selection of RNA ligands to substance P. Biochemistry 34 5651-5659 (1995). 59. Malina, A., Khan, S., Carlson, C.B., Svitkin, Y., Harvey, I., Sonenberg, N., Beal, P.A. & Pelletier, J. Inhibitory properties of nucleic acid-binding ligands on protein synthesis. FEBS Lett 579 79-89 (2005). 60. Ringquist, S., Jones, T., Snyder, E.E., Gibson, T., Boni, I. & Gold, L. High-affinity RNA ligands to Escherichia coli ribosomes and ribosomal protein S1: comparison of natural and unnatural binding sites. Biochemistry 34 3640-3648 (1995). 61. Pan, W., Craven, R.C., Qiu, Q., Wilson, C.B., Wills, J.W., Golovine, S. & Wang, J.F. Isolation of virus-neutralizing RNAs from a large pool of random sequences. Proc Natl Acad Sci U S A 92 11509-11513 (1995). 62. Morris, K.N., Jensen, K.B., Julin, C.M., Weil, M. & Gold, L. High affinity ligands from in vitro selection: complex targets. Proc Natl Acad Sci U S A 95 2902-2907 (1998). 63. Noma, T., Ikebukuro, K., Sode, K., Ohkubo, T., Sakasegawa, Y., Hachiya, N. & Kaneko, K. Screening of DNA aptamers against multiple proteins in tissue. Nucleic Acids Symp Ser (Oxf) 357-358 (2005). 64. Wilson, D.S. & Szostak, J.W. In vitro selection of functional nucleic acids. Annu Rev Biochem 68 611-647 (1999).

PAGE 127

127 65. Tasset, D.M., Kubik, M.F. & Steiner, W. Oligonucleotide inhibitors of human thrombin that bind distinct epitopes. J Mol Biol 272 688-698 (1997). 66. Tuerk, C. & Gold, L. Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase. Science 249 505-510 (1990). 67. Ellington, A.D. & Szostak, J.W. In vitro selection of RNA molecules that bind specific ligands. Nature 346 818-822 (1990). 68. Fitzwater, T. & Polisky, B. A SELEX primer. Methods Enzymol 267 275-301 (1996). 69. Sassanfar, M. & Szostak, J.W. An RNA motif that binds ATP. Nature 364 550-553 (1993). 70. Pileur, F., Andreola, M.L., Dausse, E., Michel, J., Moreau, S., Yamada, H., Gaidamakov, S.A., Crouch, R.J., Toulme, J.J. & Cazenave, C. Selective inhibitory DNA aptamers of the human RNase H1. Nucleic Acids Res 31 5776-5788 (2003). 71. Bruno, J.G. & Kiel, J.L. Use of magnetic beads in selection and detection of biotoxin aptamers by electrochemiluminescence and enzymatic methods. Biotechniques 32 178180, 182-173 (2002). 72. Mendonsa, S.D. & Bowser, M.T. In vitro evolution of functional DNA using capillary electrophoresis. J Am Chem Soc 126 20-21 (2004). 73. Mendonsa, S.D. & Bowser, M.T. In vitro selection of high-affinity DNA ligands for human IgE using capillary electrophoresis. Anal Chem 76 5387-5392 (2004). 74. Berezovski, M., Drabovich, A., Krylova, S.M., Musheev, M., Okhonin, V., Petrov, A. & Krylov, S.N. Nonequilibrium capillary electrophoresis of equilibrium mixtures: a universal tool for development of aptamers. J Am Chem Soc 127 3165-3171 (2005). 75. Mendonsa, S.D. & Bowser, M.T. In vitro selection of aptamers with affinity for neuropeptide Y using capillary electrophoresis. J Am Chem Soc 127 9382-9383 (2005). 76. Fang, X., Cao, Z., Beck, T. & Tan, W. Molecular aptamer for real-time oncoprotein platelet-derived growth factor monitoring by fluorescence anisotropy. Anal Chem 73 5752-5757 (2001). 77. Suljak, S.W., Cao, Z. & Tan, W. Recent Research Developments in Chemistry. Research Signpost 1 59-77 (2003). 78. Vicens, M.C., Sen, A., Vanderlaan, A., Drake, T.J. & Tan, W. Investigation of molecular beacon aptamer-based bioassay for platelet-derived growth factor detection. Chembiochem 6 900-907 (2005).

PAGE 128

128 79. Li, J.J., Fang, X. & Tan, W. Molecular aptamer beacons for real-time protein recognition. Biochem Biophys Res Commun 292, 31-40 (2002), Li, J. & Tan, W. A single DNA nano motor, Nano Letters 2 315 (2002). 80. Jhaveri S, Rajendran M, Ellington A D., In vitro selection of signaling aptamers, Nat. Biotechnology, 18 1293 1297 (2000) 81. Yang, C.J., Jockusch, S., Vicens, M., Turro, N.J. & Tan, W. Light-switching excimer probes for rapid protein monitoring in complex biological fluids. Proc Natl Acad Sci U S A 102 17278-17283 (2005). 82. Petersen, M. & Wengel, J. LNA: a versatile tool for therapeutics and genomics. Trends Biotechnol 21 74-81 (2003). 83. Eaton, B. E., Gold, L., Hicke, B.J., Janjic, N., Jucker, F. M., Sebesta, D. P., Tarasow, T.M., Willis, M.C., and Zichi, D. A. Post-SELEX Combinatorial optimization of aptamers, Biorganic & Med. Chem 5 1087-1096 (1997) 84. Tang, Z., Shangguan, D., Wang, K., Shi, H., Sefah, K., Mallikratchy, P., Chen, H.W., Li, Y. & Tan, W. Selection of aptamers for molecular recognition and characterization of cancer cells. Anal Chem 79 4900-4907 (2007). 85. Shangguan, D., Li, Y., Tang, Z., Cao, Z.C., Chen, H.W., Mallikaratchy, P., Sefah, K., Yang, C.J. & Tan, W. Aptamers evolved from live cells as effective molecular probes for cancer study. Proc Natl Acad Sci U S A 103 11838-11843 (2006). 86. Lupold, S.E., Hicke, B.J., Lin, Y. & Coffey, D.S. Identification and characterization of nuclease-stabilized RNA molecules that bind human prostate cancer cells via the prostate-specific membrane antigen. Cancer Res 62 4029-4033 (2002). 87. Daniels, D.A., Chen, H., Hicke, B.J., Swiderek, K.M. & Gold, L. A tenascin-C aptamer identified by tumor cell SELEX: systematic evolution of ligands by exponential enrichment. Proc Natl Acad Sci U S A 100 15416-15421 (2003). 88. Guo, K., Wendel, H.P., Scheideler, L., Ziemer, G. & Scheule, A.M. Aptamer-based capture molecules as a novel coating strategy to promote cell adhesion. J Cell Mol Med 9 731-736 (2005). 89. Cerchia, L., Duconge, F., Pestourie, C., Boulay, J., Aissouni, Y., Gombert, K., Tavitian, B., de Franciscis, V. & Libri, D. Neutralizing aptamers from whole-cell SELEX inhibit the RET receptor tyrosine kinase. PLoS Biol 3 e123 (2005). 90. Shangguan, D., Cao, Z.C., Li, Y. & Tan, W. Aptamers evolved from cultured cancer cells reveal molecular differences of cancer cells in patient samples. Clin Chem 53 1153-1155 (2007). 91. Quon, A. & Gambhir, S.S. FDG-PET and beyond: molecular breast cancer imaging. J Clin Oncol 23 1664-1673 (2005).

PAGE 129

129 92. Sullivan, D.C. & Kelloff, G. Seeing into cells. The promise of in vivo molecular imaging in oncology. EMBO Rep 6 292-296 (2005). 93. Weissleder, R. Molecular imaging in cancer. Science 312 1168-1171 (2006). 94. Halpern, E.J. Contrast-enhanced ultrasound imaging of prostate cancer. Rev Urol 8 Suppl 1 S29-37 (2006). 95. Bagalkot, V., Farokhzad, O.C., Langer, R. & Jon, S. An aptamer-doxorubicin physical conjugate as a novel targeted drug-delivery platform. Angew Chem Int Ed Engl 45 81498152 (2006). 96. Chu, T.C., Marks, J.W., 3rd, Lavery, L.A., Faulkner, S., Rosenblum, M.G., Ellington, A.D. & Levy, M. Aptamer:toxin conjugates that specifically target prostate tumor cells. Cancer Res 66 5989-5992 (2006). 97. Chu, T.C., Twu, K.Y., Ellington, A.D. & Levy, M. Aptamer mediated siRNA delivery. Nucleic Acids Res 34 e73 (2006). 98. Dolle, F., Hinnen,F., Vaufrey,F., Tavitian, B., Crouzel, C. A general method for labeling oligodeoxynucleotides with 18F for in vivo PET imaging J. of. Labelled compounds and radiopharmaceuticals, 39, 319-326 (1997) 99. Farokhzad, O.C., Jon, S., Khademhosseini, A., Tran, T.N., Lavan, D.A. & Langer, R. Nanoparticle-aptamer bioconjugates: a new approach for targeting prostate cancer cells. Cancer Res 64 7668-7672 (2004). 100. Tavitian, B., Terrazzino, S., Kuhnast, B., Marzabal, S., Stettler, O., Dolle, F., Deverre, J.R., Jobert, A., Hinnen, F., Bendriem, B., Crouzel, C. & Di Giamberardino, L. In vivo imaging of oligonucleotides with positron emission tomography. Nat Med 4 467-471 (1998). 101. Jerusalem, G., Hustinx, R., Beguin, Y. & Fillet, G. PET scan imaging in oncology. Eur J Cancer 39 1525-1534 (2003). 102. Hicke, B.J., Stephens, A.W., Gould, T., Chang, Y.F., Lynott, C.K., Heil, J., Borkowski, S., Hilger, C.S., Cook, G., Warren, S. & Schmidt, P.G. Tumor targeting by an aptamer. J Nucl Med 47 668-678 (2006). 103. McNamara, J.O., 2nd, Andrechek, E.R., Wang, Y., Viles, K.D., Rempel, R.E., Gilboa, E., Sullenger, B.A. & Giangrande, P.H. Cell type-specific delivery of siRNAs with aptamersiRNA chimeras. Nat Biotechnol 24 1005-1015 (2006). 104. James, W. Encyclopedia of Analytical Chemistry. (John Wiley & Sons Ltd, Chichester; 2000). 105. Boyle, F.T. & Costello, G.F. Cancer Therapy: move to the molecular level, Chem Soc. Rev 27 251-261 (1998).

PAGE 130

130 106. Ulrich, H., Ippolito, J.E., Pagan, O.R., Et erovic, V.A., Hann, R.M., Shi, H., Lis, J.T., Eldefrawi, M.E. & Hess, G.P. In vitro selection of RNA molecules that displace cocaine from the membrane-bound nicotinic acetylcholine receptor. Proc Natl Acad Sci U S A 95 14051-14056 (1998). 107. Green, L.S., Jellinek, D., Bell, C., Beebe, L.A., Feistner, B.D., Gill, S.C., Jucker, F.M. & Janjic, N. Nuclease-resistant nucleic acid ligands to vascular permeability factor/vascular endothelial growth factor. Chem Biol 2 683-695 (1995). 108. Kimoto, M., Shirouzu, M., Mizutani, S., Koide, H., Kaziro, Y., Hirao, I. & Yokoyama, S. Anti-(Raf-1) RNA aptamers that inhibit Ras-induced Raf-1 activation. Eur J Biochem 269 697-704 (2002). 109. O'Connell, D., Koenig, A., Jennings, S., Hicke, B., Han, H.L., Fitzwater, T., Chang, Y.F., Varki, N., Parma, D. & Varki, A. Calcium-dependent oligonucleotide antagonists specific for L-selectin. Proc Natl Acad Sci U S A 93 5883-5887 (1996). 110. Pagratis, N.C., Bell, C., Chang, Y.F., Jennings, S., Fitzwater, T., Jellinek, D. & Dang, C. Potent 2'-amino-, and 2'-fluoro-2'-deoxyribonucleotide RNA inhibitors of keratinocyte growth factor. Nat Biotechnol 15 68-73 (1997). 111. Dolmans, D.E., Fukumura, D. & Jain, R.K. Photodynamic therapy for cancer. Nat Rev Cancer 3 380-387 (2003). 112. Castano, A.P., Mroz, P. & Hamblin, M.R. Photodynamic therapy and anti-tumour immunity. Nat Rev Cancer 6 535-545 (2006). 113. Bonnett, R., Photosensitizers of the porphyrin and phthalocyanine series for photodynamic therapy, Chem. Soc. Rev. 24, 19-31 (1995). 114. Dougherty, T.J., Gomer, C.J., Henderson, B.W., Jori, G., Kessel, D., Korbelik, M., Moan, J. & Peng, Q. Photodynamic therapy. J Natl Cancer Inst 90 889-905 (1998). 115. Strong, L., Yarmush, D.M. & Yarmush, M.L. Antibody-targeted photolysis. Photophysical, biochemical, and pharmacokinetic properties of antibacterial conjugates. Ann N Y Acad Sci 745 297-320 (1994). 116. Kragh-Hansen, U. Structure and ligand binding properties of human serum albumin. Dan Med Bull 37 57-84 (1990). 117. de Smidt, P.C., Versluis, A.J. & van Berkel, T.J. Properties of incorporation, redistribution, and integrity of porphyrin-low-density lipoprotein complexes. Biochemistry 32 2916-2922 (1993). 118. Seaton, B.A. & Dedman, J.R. Annexins. Biometals 11 399-404 (1998). 119. Ali, H. & van Lier, J.E. Metal complexes as photoand radiosensitizers. Chem Rev 99 2379-2450 (1999).

PAGE 131

131 120. Conrad, M.E. & Umbreit, J.N. Iron absorption and transport-an update. Am J Hematol 64 287-298 (2000). 121. Tsein, R. Imaging imagings future Nature Reviews Molecular Cell Biology 4 16-21 (2003). 122. Cao, Z. & Tan, W. Molecular aptamers for real-time protein-protein interaction study. Chemistry 11 4502-4508 (2005). 123. Newton, A.C. Protein kinase C: structural and spatial regulation by phosphorylation, cofactors, and macromolecular interactions. Chem Rev 101 2353-2364 (2001). 124. Newton, A.C. The ins and outs of protein kinase C. Methods Mol Biol 233 3-7 (2003). 125. Gschwendt, M. Protein kinase C delta. Eur J Biochem 259, 555-564 (1999). 126. Miyamoto, A., Nakayama, K., Imaki, H., Hirose, S., Jiang, Y., Abe, M., Tsukiyama, T., Nagahama, H., Ohno, S., Hatakeyama, S. & Nakayama, K.I. Increased proliferation of B cells and auto-immunity in mice lacking protein kinase Cdelta. Nature 416 865-869 (2002). 127. Ashton, A.W., Watanabe, G., Albanese, C., Harrington, E.O., Ware, J.A. & Pestell, R.G. Protein kinase Cdelta inhibition of S-phase transition in capillary endothelial cells involves the cyclin-dependent kinase inhibitor p27(Kip1). J Biol Chem 274 20805-20811 (1999). 128. Wang, Q., Wang, X. & Evers, B.M. Induction of cIAP-2 in human colon cancer cells through PKC delta/NF-kappa B. J Biol Chem 278 51091-51099 (2003). 129. Steinberg, S.F. Distinctive activation mechanisms and functions for protein kinase Cdelta. Biochem J 384 449-459 (2004). 130. Yoshida, K., Miki, Y. & Kufe, D. Activation of SAPK/JNK signaling by protein kinase Cdelta in response to DNA damage. J Biol Chem 277 48372-48378 (2002). 131. Yang, C. & Kazanietz, M.G. Divergence and complexities in DAG signaling: looking beyond PKC. Trends Pharmacol Sci 24 602-608 (2003). 132. Poole, A.W., Pula, G., Hers, I., Crosby, D. & Jones, M.L. PKC-interacting proteins: from function to pharmacology. Trends Pharmacol Sci 25 528-535 (2004). 133. Violin, J.D., Zhang, J., Tsien, R.Y. & Newton, A.C. A genetically encoded fluorescent reporter reveals oscillatory phosphorylation by protein kinase C. J Cell Biol 161, 899-909 (2003).

PAGE 132

132 134. Watanabe, T., Ono, Y., Taniyama, Y., Hazama, K., Igarashi, K., Ogita, K., Kikkawa, U. & Nishizuka, Y. Cell division arrest induced by phorbol ester in CHO cells overexpressing protein kinase C-delta subspecies. Proc Natl Acad Sci U S A 89 1015910163 (1992). 135. Fukumoto, S., Nishizawa, Y., Hosoi, M., Koyama, H., Yamakawa, K., Ohno, S. & Morii, H. Protein kinase C delta inhibits the proliferation of vascular smooth muscle cells by suppressing G1 cyclin expression. J Biol Chem 272 13816-13822 (1997). 136. Mischak, H., Goodnight, J.A., Kolch, W., Martiny-Baron, G., Schaechtle, C., Kazanietz, M.G., Blumberg, P.M., Pierce, J.H. & Mushinski, J.F. Overexpression of protein kinase C-delta and -epsilon in NIH 3T3 cells induces opposite effects on growth, morphology, anchorage dependence, and tumorigenicity. J Biol Chem 268 6090-6096 (1993). 137. Mishima, K., Ohno, S., Shitara, N., Yamaoka, K. & Suzuki, K. Opposite effects of the overexpression of protein kinase C gamma and delta on the growth properties of human glioma cell line U251 MG. Biochem Biophys Res Commun 201 363-372 (1994). 138. Harrington, E.O., Loffler, J., Nelson, P.R., Kent, K.C., Simons, M. & Ware, J.A. Enhancement of migration by protein kinase Calpha and inhibition of proliferation and cell cycle progression by protein kinase Cdelta in capillary endothelial cells. J Biol Chem 272 7390-7397 (1997). 139. Sambrook, J. & Russell, W. Molecular Biology, Vol. 1 7.9-7.10 (CSHL Press, 2001). 140. Kiga, D., Futamura, Y., Sakamoto, K. & Yokoyama, S. An RNA aptamer to the xanthine/guanine base with a distinctive mode of purine recognition. Nucleic Acids Res 26 1755-1760 (1998). 141. Saran, D., Frank, J. & Burke, D.H. The tyranny of adenosine recognition among RNA aptamers to coenzyme A. BMC Evol Biol 3 26 (2003). 142. Mallikaratchy, P., Stahelin, R.V., Cao, Z., Cho, W. & Tan, W. Selection of DNA ligands for protein kinase C-delta. Chem Commun (Camb) 3229-3231 (2006). 143. Dalton, W.S. & Friend, S.H. Cancer biomarkers--an invitation to the table. Science 312 1165-1168 (2006). 144. Bledi, Y., Inberg, A. & Linial, M. PROCEED: A proteomic method for analysing plasma membrane proteins in living mammalian cells. Brief Funct Genomic Proteomic 2 254265 (2003). 145. Oh, P., Li, Y., Yu, J., Durr, E., Krasinska, K.M., Carver, L.A., Testa, J.E. & Schnitzer, J.E. Subtractive proteomic mapping of the endothelial surface in lung and solid tumours for tissue-specific therapy. Nature 429 629-635 (2004).

PAGE 133

133 146. Shin, B.K., Wang, H., Yim, A.M., Le Na our, F., Brichory, F., Jang, J.H., Zhao, R., Puravs, E., Tra, J., Michael, C.W., Misek, D.E. & Hanash, S.M. Global profiling of the cell surface proteome of cancer cells uncovers an abundance of proteins with chaperone function. J Biol Chem 278, 7607-7616 (2003). 147. Gygi, S.P., Rist, B., Gerber, S.A., Turecek, F., Gelb, M.H. & Aebersold, R. Quantitative analysis of complex protein mixtures using isotope-coded affinity tags. Nat Biotechnol 17 994-999 (1999). 148. Washburn, M.P., Wolters, D. & Yates, J.R., 3rd Large-scale analysis of the yeast proteome by multidimensional protein identification technology. Nat Biotechnol 19 242247 (2001). 149. Roboz, J. Mass spectrometry in diagnostic oncoproteomics. Cancer Invest 23 465-478 (2005). 150. Lawson, E.L., Clifton, J.G., Huang, F., Li, X., Hixson, D.C. & Josic, D. Use of magnetic beads with immobilized monoclonal antibodies for isolation of highly pure plasma membranes. Electrophoresis 27 2747-2758 (2006). 151. Chang, P.S., Absood, A., Linderman, J.J. & Omann, G.M. Magnetic bead isolation of neutrophil plasma membranes and quantification of membrane-associated guanine nucleotide binding proteins. Anal Biochem 325 175-184 (2004). 152. Thomas, M.D., Srivastava, B. & Allman, D. Regulation of peripheral B cell maturation. Cell Immunol 239 92-102 (2006). 153. Cambier, J.C. & Campbell, K.S. Membrane immunoglobulin and its accomplices: new lessons from an old receptor. FASEB J 6 3207-3217 (1992). 154. Trujillo, M.A., Jiang, S.W., Tarara, J.E. & Eberhardt, N.L. Clustering of the B cell receptor is not required for the apoptotic response. DNA Cell Biol 22 513-523 (2003). 155. Joseph, L.F., Ezhevsky, S. & Scott, D.W. Lymphoma models for B-cell activation and tolerance: anti-immunoglobulin M treatment induces growth arrest by preventing the formation of an active kinase complex which phosphorylates retinoblastoma gene product in G1. Cell Growth Differ 6 51-57 (1995). 156. Carey, G.B., Donjerkovic, D., Mueller, C.M., Liu, S., Hinshaw, J.A., Tonnetti, L., Davidson, W. & Scott, D.W. B-cell receptor and Fas-mediated signals for life and death. Immunol Rev 176 105-115 (2000). 157. Cragg, M.S., Zhang, L., French, R.R. & Glennie, M.J. Analysis of the interaction of monoclonal antibodies with surface IgM on neoplastic B-cells. Br J Cancer 79 850-857 (1999).

PAGE 134

134 158. Kang, S.H., Vieira, K. & Bungert, J. Combining chromatin immunoprecipitation and DNA footprinting: a novel method to analyze protein-DNA interactions in vivo. Nucleic Acids Res 30 e44 (2002). 159. Smith, D., Collins, B.D., Heil, J. & Koch, T.H. Sensitivity and specificity of photoaptamer probes. Mol Cell Proteomics 2 11-18 (2003). 160. Golden, M.C., Resing, K.A., Collins, B.D., Willis, M.C. & Koch, T.H. Mass spectral characterization of a protein-nucleic acid photocrosslink. Protein Sci 8 2806-2812 (1999). 161. Mallikaratchy, P., Tang, Z., Meng, L., Shangguan, D., Kwame, S. & Tan, W. Aptamer directly evolved from live cells recognizes membrane bound immunoglobin heavy mu chain in Burkitt's lymphoma cells. Mol Cell Proteomics 6 2230-2238 (2007). 162. Wilbur, D.S., Pathare, P.M., Hamlin, D.K., Stayton, P.S., To, R., Klumb, L.A., Buhler, K.R. & Vessella, R.L. Development of new biotin/streptavidin reagents for pretargeting. Biomol Eng 16 113-118 (1999). 163. Wilchek, M. & Bayer, E.A. Foreword and introduction to the book (strept)avidin-biotin system. Biomol Eng 16 1-4 (1999). 164. Diamandis, E.P. & Christopoulos, T.K. The biotin-(strept)avidin system: principles and applications in biotechnology. Clin Chem 37 625-636 (1991). 165. Sieverts, H., Alabaster, O., Goldschmidts, W. & Magrath, I. Expression of surface antigens during the cell cycle in different growth phases of American and African Burkitt's lymphoma cell lines. Cancer Res 46 1182-1188 (1986). 166. Kaptein, J.S., Lin, C.K., Wang, C.L., Nguyen, T.T., Kalunta, C.I., Park, E., Chen, F.S. & Lad, P.M. Anti-IgM-mediated regulation of c-myc and its possible relationship to apoptosis. J Biol Chem 271 18875-18884 (1996). 167. Cutrona, G., Carpaneto, E.M., Ponzanelli, A., Ulivi, M., Millo, E., Scarfi, S., Roncella, S., Benatti, U., Boffa, L.C. & Ferrarini, M. Inhibition of the translocated c-myc in Burkitt's lymphoma by a PNA complementary to the E mu enhancer. Cancer Res 63 6144-6148 (2003). 168. Mongini, P.K., Liu, Q., Vilensky, M.A., Highet, P.F. & Inman, J.K. Evidence for an upper affinity threshold for anti-IgM-induced apoptosis in a human B-cell lymphoma. Blood 92 3756-3771 (1998). 169. Gurinovich, G.P., Zorina, T.E., Melnov, S.B., Melnova, N.I., Gurinovich, I.F., Grubina, L.A., Sarzhevskaya, M.V. & Cherenkevich, S.N. Photodynamic activity of chlorin e6 and chlorin e6 ethylenediamide in vitro and in vivo. J Photochem Photobiol B 13 51-57 (1992).

PAGE 135

135 170. Dalla Via, L. & Marciani Magno, S. Photochemotherapy in the treatment of cancer. Curr Med Chem 8 1405-1418 (2001). 171. Sharman, W.M., van Lier, J.E. & Allen, C.M. Targeted photodynamic therapy via receptor mediated delivery systems. Adv Drug Deliv Rev 56 53-76 (2004). 172. Klussmann, S. The Aptamer Handbook:Functional Oligonucleotides and Their Applications. (Wiley-VCH, Weinheim, Germany; 2006). 173. Mallikaratchy, P., Tang, Z. & Tan, W. Cell Specific Aptamer Photosensitizer Conjugates as a Molecular Tool in Photodynamic Therapy. ChemMedChem, accepted (2007). 174. Choi, Y., Weissleder, R. & Tung, C.H. Pr otease-mediated phototoxicity of a polylysinechlorin(E6) conjugate. ChemMedChem 1 698-701 (2006). 175. Chen, J., Stefflova, K., Niedre, M.J., Wilson, B.C., Chance, B., Glickson, J.D. & Zheng, G. Protease-triggered photosensitizing beacon based on singlet oxygen quenching and activation. J Am Chem Soc 126 11450-11451 (2004). 176. Zheng, G., Chen, J., Stefflova, K., Jarvi, M., Li, H. & Wilson, B.C. Photodynamic molecular beacon as an activatable photosensitizer based on protease-controlled singlet oxygen quenching and activation. Proc Natl Acad Sci U S A 104 8989-8994 (2007). 177. Choi, Y., Weissleder, R. & Tung, C.H. Selective antitumor effect of novel proteasemediated photodynamic agent. Cancer Res 66 7225-7229 (2006). 178. Li, X. & Liu, D.R. DNA-templated organic synthesis: nature's strategy for controlling chemical reactivity applied to synthetic molecules. Angew Chem Int Ed Engl 43 48484870 (2004). 179. Ma, Z. & Taylor, J.S. Nucleic acid-triggered catalytic drug release. Proc Natl Acad Sci U S A 97 11159-11163 (2000). 180. Silverman, A.P. & Kool, E.T. Detecting RNA and DNA with templated chemical reactions. Chem Rev 106 3775-3789 (2006). 181. Ng, E.W., Shima, D.T., Calias, P., Cunningham, E.T., Jr., Guyer, D.R. & Adamis, A.P. Pegaptanib, a targeted anti-VEGF aptamer for ocular vascular disease. Nat Rev Drug Discov 5 123-132 (2006). 182. Griffin, L.C., Tidmarsh, G.F., Bock, L.C., Toole, J.J. & Leung, L.L. In vivo anticoagulant properties of a novel nucleotide-based thrombin inhibitor and demonstration of regional anticoagulation in extracorporeal circuits. Blood 81 3271-3276 (1993). 183. Tam, R.C., Wu-Pong, S., Pai, B., Lim, C., Chan, A., Thomas, D.F., Milovanovic, T., Bard, J. & Middleton, P.J. Increased potency of an aptameric G-rich oligonucleotide is associated with novel functional properties of phosphorothioate linkages. Antisense Nucleic Acid Drug Dev 9 289-300 (1999).

PAGE 136

136 184. Pieken, W.A., Olsen, D.B., Benseler, F., Aurup, H. & Eckstein, F. Kinetic characterization of ribonuclease-resistant 2'-modified hammerhead ribozymes. Science 253 314-317 (1991). 185. Floege, J., Ostendorf, T., Janssen, U., Burg, M., Radeke, H.H., Vargeese, C., Gill, S.C., Green, L.S. & Janjic, N. Novel approach to specific growth factor inhibition in vivo: antagonism of platelet-derived growth factor in glomerulonephritis by aptamers. Am J Pathol 154 169-179 (1999). 186. Dougan, H., Lyster, D.M., Vo, C.V., Stafford, A., Weitz, J.I. & Hobbs, J.B. Extending the lifetime of anticoagulant oligodeoxynucleotide aptamers in blood. Nucl Med Biol 27 289-297 (2000). 187. Ruckman, J., Green, L.S., Beeson, J., Wa ugh, S., Gillette, W.L., Henninger, D.D., Claesson-Welsh, L. & Janjic, N. 2'-Fluoropyrimidine RNA-based aptamers to the 165amino acid form of vascular endothelial growth factor (VEGF165). Inhibition of receptor binding and VEGF-induced vascular permeability through interactions requiring the exon 7-encoded domain. J Biol Chem 273 20556-20567 (1998). 188. Blank, M. & Blind, M. Aptamers as tools for target validation. Curr Opin Chem Biol 9 336-342 (2005). 189. Buning, H., Ried, M.U., Perabo, L., Gerner, F.M., Huttner, N.A., Enssle, J. & Hallek, M. Receptor targeting of adeno-associated virus vectors. Gene Ther 10 1142-1151 (2003). 190. Li, C., Bowles, D.E., van Dyke, T. & Samulski, R.J. Adeno-associated virus vectors: potential applications for cancer gene therapy. Cancer Gene Ther 12 913-925 (2005).

PAGE 137

137 BIOGRAPHICAL SKETCH Prabodhika Mallikaratchy is from Gampola, Sri Lanka. In 1996, after finishing her General Certificate Examination Advanced Level, she enrolled in Institute of Chemistry Ceylon, to major in Physical Chemistry. As an undergraduate student, she studied the effect of dye sensitization of CdS semiconductors to implement efficient solar cells under Dr. O.A. Illeperuma at his Inorganic Research Laboratory. After completing her undergraduate studies with honors, in August 2001 she traveled to University of Louisiana at Monroe to pursue a Master of Science in organo-metallic chemistry under the supervision of Dr Thomas Junk. At ULM she studied and characterized three novel organometallic compounds. After successfully completing her M.Sc. degree in 2003 June, she joined Dr. Weihong Tans lab to pursue a PhD in Chemistry.