<%BANNER%>

Nitric Oxide Deficiency in Chronic Kidney Disease

Permanent Link: http://ufdc.ufl.edu/UFE0021590/00001

Material Information

Title: Nitric Oxide Deficiency in Chronic Kidney Disease Links among Neuronal Nitric Oxide Synthase, Oxidative Stress, and Asymmetric Dimethylarginine (ADMA)
Physical Description: 1 online resource (144 p.)
Language: english
Creator: Tain, You-Lin
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2007

Subjects

Subjects / Keywords: adma, allograft, antioxidant, arginine, citrulline, ckd, crf, ddah, gender, isograft, kidney, nephrectomy, nnos, no, nos, nos1, prmt, rat, renal, ros, superoxide, tocopherol, transplant
Physiology and Pharmacology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Nitric oxide (NO) deficiency is a cause and a consequence of chronic kidney disease (CKD). We focused on three possible causes of NO deficiency in this dissertation: decreased abundance and /or changes in activity of nitric oxide synthase (NOS) enzymes, increased endogenous NOS inhibitors (e.g., asymmetric dimethylarginine (ADMA)), and increased NO inactivation by oxidative stress. We found reduced renal cortical nNOS abundance as well as NOS activity in various CKD models. Therefore, we evaluated whether oxidative stress and ADMA inhibited nNOS expression in different CKD models. We found that 2 nNOS isoforms expressing in the kidney and that renal cortical nNOS? and nNOS? isoform expression differentially in various CKD models. In mild CKD, nNOS? abundance can be maintained or compensated by nNOS? to preserve renal function, while decreased nNOS? abundance results in CKD progression despite increased nNOS? expression in severe CKD. Both oxidative stress and ADMA may inhibit nNOS expression. The inhibition by oxidative stress can be partially prevented by antioxidant vitamin E; however, vitamin E cannot prevent the elevation of ADMA. In 5/6 nephrectomized rats, we found the increase of ADMA may be due to increased ADMA synthesis by increased protein arginine methyltransferase (PRMT) expression and decreased ADMA breakdown by decreased dimethylarginine dimethylaminohydrolase (DDAH) activity. In 5/6 ablation/infarction (A/I) model, vulnerable male A/I rats displayed higher oxidative stress but lower nNOS? abundance than resistant female A/I rats, demonstrating decreased nNOS? and increased oxidative stress contribute to CKD progression. We concluded that decreased cortical nNOS? abundance, increased oxidative stress, and increased ADMA contribute to CKD progression. Targeting on increasing renal nNOS expression, reducing oxidative stress, and lowering ADMA levels to preserve NO bioavailability may be specific therapeutic interventions to prevent CKD progression.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by You-Lin Tain.
Thesis: Thesis (Ph.D.)--University of Florida, 2007.
Local: Adviser: Baylis, Christine.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2007
System ID: UFE0021590:00001

Permanent Link: http://ufdc.ufl.edu/UFE0021590/00001

Material Information

Title: Nitric Oxide Deficiency in Chronic Kidney Disease Links among Neuronal Nitric Oxide Synthase, Oxidative Stress, and Asymmetric Dimethylarginine (ADMA)
Physical Description: 1 online resource (144 p.)
Language: english
Creator: Tain, You-Lin
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2007

Subjects

Subjects / Keywords: adma, allograft, antioxidant, arginine, citrulline, ckd, crf, ddah, gender, isograft, kidney, nephrectomy, nnos, no, nos, nos1, prmt, rat, renal, ros, superoxide, tocopherol, transplant
Physiology and Pharmacology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Nitric oxide (NO) deficiency is a cause and a consequence of chronic kidney disease (CKD). We focused on three possible causes of NO deficiency in this dissertation: decreased abundance and /or changes in activity of nitric oxide synthase (NOS) enzymes, increased endogenous NOS inhibitors (e.g., asymmetric dimethylarginine (ADMA)), and increased NO inactivation by oxidative stress. We found reduced renal cortical nNOS abundance as well as NOS activity in various CKD models. Therefore, we evaluated whether oxidative stress and ADMA inhibited nNOS expression in different CKD models. We found that 2 nNOS isoforms expressing in the kidney and that renal cortical nNOS? and nNOS? isoform expression differentially in various CKD models. In mild CKD, nNOS? abundance can be maintained or compensated by nNOS? to preserve renal function, while decreased nNOS? abundance results in CKD progression despite increased nNOS? expression in severe CKD. Both oxidative stress and ADMA may inhibit nNOS expression. The inhibition by oxidative stress can be partially prevented by antioxidant vitamin E; however, vitamin E cannot prevent the elevation of ADMA. In 5/6 nephrectomized rats, we found the increase of ADMA may be due to increased ADMA synthesis by increased protein arginine methyltransferase (PRMT) expression and decreased ADMA breakdown by decreased dimethylarginine dimethylaminohydrolase (DDAH) activity. In 5/6 ablation/infarction (A/I) model, vulnerable male A/I rats displayed higher oxidative stress but lower nNOS? abundance than resistant female A/I rats, demonstrating decreased nNOS? and increased oxidative stress contribute to CKD progression. We concluded that decreased cortical nNOS? abundance, increased oxidative stress, and increased ADMA contribute to CKD progression. Targeting on increasing renal nNOS expression, reducing oxidative stress, and lowering ADMA levels to preserve NO bioavailability may be specific therapeutic interventions to prevent CKD progression.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by You-Lin Tain.
Thesis: Thesis (Ph.D.)--University of Florida, 2007.
Local: Adviser: Baylis, Christine.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2007
System ID: UFE0021590:00001


This item has the following downloads:


Full Text
xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E20101114_AAAAFY INGEST_TIME 2010-11-14T17:21:30Z PACKAGE UFE0021590_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES
FILE SIZE 104772 DFID F20101114_AACCTH ORIGIN DEPOSITOR PATH tain_y_Page_065.jp2 GLOBAL false PRESERVATION BIT MESSAGE_DIGEST ALGORITHM MD5
75260b992d17e0d5ad578ca6ed6ba3b0
SHA-1
6e4232409e0947a6d5b050ef7df308a422344084
116476 F20101114_AACCST tain_y_Page_044.jp2
df1aa8e7a6744c64078f05978ff23c23
dadad50a32f330a4f408b9ac39c9f5646550fa83
103979 F20101114_AACCTI tain_y_Page_066.jp2
90afb88c0e15221e8bdb77d8bc57aa2b
feefe0628a9997d117962c121dc3ccee25a03ba9
116477 F20101114_AACCSU tain_y_Page_045.jp2
6d6d0a3b84efc5eb9357e4c72cd93d47
825c338bacaff4d450c27b78f33884f21c2bd0b8
107116 F20101114_AACCTJ tain_y_Page_067.jp2
8f993dc6c9f5defd8d6e421e0cc1ffe0
89408c5e6940e8190d0ef3a8746027bfd104acd6
114495 F20101114_AACCSV tain_y_Page_046.jp2
054b13054892d5c27495a7f5fca51c25
209eec8840fca663a07e7af9be1fd0f11943f568
31523 F20101114_AACCTK tain_y_Page_069.jp2
930eee9498ebd7cabfc0d81efb4a7888
89dee505b98a8839fe8d0d1833e247403d81a81f
115887 F20101114_AACCSW tain_y_Page_049.jp2
7304bb5bfc884b243a9c1dfb595fe520
0582e893fe2a6f0501fd9e354c9ceab5031f3a61
1051958 F20101114_AACCTL tain_y_Page_070.jp2
e4aa4931d83282250919817eed6bc89c
0610e4eba5022a06c50a9ddaacbeaac24e6a7eb6
37696 F20101114_AACCSX tain_y_Page_052.jp2
7db3f41a19903027947ebcef0257145a
b1f87da670ef4f5f8a495ff740c3c5558d46a88d
67107 F20101114_AACCTM tain_y_Page_071.jp2
328b2577729cdf23c1a609e607c9ae8c
269f61c915be9f0879b51c5962da3be1657354e7
201815 F20101114_AACCSY tain_y_Page_054.jp2
b8372fe1e31558834169465c42087ba5
195b76b4941dc8465a0405425eb1abdcc7ddceda
38295 F20101114_AACCUA tain_y_Page_087.jp2
06da19ed1257213f0627c538bbd5a8b1
361b803bb1751f932bbfa8a07b70d35265f7627c
31893 F20101114_AACCTN tain_y_Page_072.jp2
953e044f52d6c6e527c8a4085c877182
c5937340ac521273d1c136446936405736084681
37383 F20101114_AACCUB tain_y_Page_088.jp2
ac9ef47d733dc27cab301ee9abd07cee
8a7a6760afd4bd798729b0655e8d873e3a4a1302
35574 F20101114_AACCTO tain_y_Page_073.jp2
38dd4b253b09980a9e18517cb037d41a
6ba08ba9627187139b852daaa6aa03342017a62c
492467 F20101114_AACCSZ tain_y_Page_055.jp2
b732dac5466a5773fc7835c92cd4387c
7e87de968561251eda119209de8e44142d9461a0
302963 F20101114_AACCUC tain_y_Page_089.jp2
d60983cc7913aca354f8a388bc2d641a
78d148ef67d347d0b69ede947ccbfaaa4f28cd85
32969 F20101114_AACCTP tain_y_Page_074.jp2
8d3c41d8251d64c3777f4cc85af36568
2a53fdec25de7b5891ca25879a125e3d87d55874
194664 F20101114_AACCUD tain_y_Page_090.jp2
7ed1f35a18ed29a4a04528b277ef559b
a195c568056b1456677a35f030761c8d22d9bbc8
35487 F20101114_AACCTQ tain_y_Page_075.jp2
a850df11418b4f99e12335881d3c6f42
5b80205431ffc587a6e851178520b337fcdecca6
365206 F20101114_AACCUE tain_y_Page_092.jp2
ad0c87f12ef90c110178e32e7669d600
b26fb15be310043c5534625afc9ead9bc6911287
291693 F20101114_AACCTR tain_y_Page_077.jp2
11156a557d9c214c459885a173b55c33
49d2306a3ed452482d3f64e230d04e6032c348ec
53843 F20101114_AACDAA tain_y_Page_028.pro
4df5d0cd953cdb4286c8477ad3a1b0eb
df2b0706c5a94d2c446fe8fb8be53faa8c2e0cd7
280194 F20101114_AACCUF tain_y_Page_093.jp2
02ff9d353b6848ca5ab4334816d7bd58
031dd5c6268bce222f7312263ac2947a22649578
116828 F20101114_AACCTS tain_y_Page_078.jp2
26cda962a36c14258c9a2ec6327c6473
92e15298447347ca1152acb8f530f743c5f93063
52355 F20101114_AACDAB tain_y_Page_029.pro
9a7fe792a4f996ed5e23ca2c2725824d
fb3fa533f91ea7855c6af406df5e17c5d4380d93
505373 F20101114_AACCUG tain_y_Page_094.jp2
7fdba15ab9410e28405e08228283726e
f791ba837f6fcc107dfb85e0b952a4d91e3062ae
118258 F20101114_AACCTT tain_y_Page_079.jp2
14d0874017f829446697d088805c5aa2
d2b6248f1b12a55205feababb94e7fb8cb6daaff
44917 F20101114_AACDAC tain_y_Page_031.pro
e22373120cbd428ab8cb80877dd404ed
33fcac4f7035c7db55cb9359abd1d12ce8eb606b
349294 F20101114_AACCUH tain_y_Page_095.jp2
ef75048364e7ce16c9ebc419ba9955a4
fde0bed1e09b661b032865a4ddebef77e44ad94d
114696 F20101114_AACCTU tain_y_Page_081.jp2
9055db489da392978f3b00f455af5d74
bd27dbb7c2a8b27ce540cee027a27e75e4671cd5
53348 F20101114_AACDAD tain_y_Page_032.pro
532876d3695c1936a1d45d6992e4c27a
2b5f50e09031a669aa50b3fd46b97f1a940d329d
118778 F20101114_AACCUI tain_y_Page_096.jp2
541e548c87062a4a93699e73143d967f
62a8113e66ceff0766cb52dfd505e74f3f428fc7
115803 F20101114_AACCTV tain_y_Page_082.jp2
8a98e5a90b273bc27c8bf95d9a7048ae
d6f3944828c13011ce7e5fd7524ea26154f1d435
52029 F20101114_AACDAE tain_y_Page_036.pro
68e796bd71eb8cd2f43a1cf1962327e2
20102223c3e26041c40c711796c718ccae0f8a50
123402 F20101114_AACCUJ tain_y_Page_097.jp2
4b6072510d9a219892abcdeeb22adee5
456d39ecdf7ec46fcfadf1720ea4ed34c21d19ba
118098 F20101114_AACCTW tain_y_Page_083.jp2
fe8aacf19c2a09900eeb2f05f2c87338
767956ebae965c4a43d6e95fdc9c562f2fba03f2
51640 F20101114_AACDAF tain_y_Page_037.pro
0b0285ab6de7f3d4a07e38933c32ba10
ea5fc03fac4546386bd0fe4f52521d28495977ff
116288 F20101114_AACCUK tain_y_Page_102.jp2
0e009d13cb8925e3a8a04afa03d198bc
4d7c78a105df81ee04e883c7094374b725b33044
117169 F20101114_AACCTX tain_y_Page_084.jp2
74cbc0ba8493af89335f4f53f7cb640c
a933a5b8af6cdc676df8542c5800ee1ad21c6694
113635 F20101114_AACCUL tain_y_Page_104.jp2
d0a8991babf39b9ea92b408c6ec848ce
774370253911de7a53ac80ba78cf119db0c727dd
113213 F20101114_AACCTY tain_y_Page_085.jp2
157545852a1118be3b0565aa9eeaf117
7da2e1fdf323ae79676236741987b2cf84385389
52763 F20101114_AACDAG tain_y_Page_038.pro
35898099fd4d9e23e647139d50693b7b
985ca10151a80bab91e6d2ff775b598c4fa6a6e3
113765 F20101114_AACCVA tain_y_Page_125.jp2
3444ac6f5b5ef1791c3fa59ca959cb4d
453ac3081537e2fda0f3270df0fee5016311a83a
48068 F20101114_AACCUM tain_y_Page_107.jp2
bf677694b535001bccb3489040c07db9
de6337caeda84ea7269c83a885513fc62c9a1040
96709 F20101114_AACCTZ tain_y_Page_086.jp2
92cee4352d8b5f65327891f8c06e21aa
4b161f54c71d5748361247452e534ed80937b807
8947 F20101114_AACDAH tain_y_Page_041.pro
2b20d27c017d01d331798c2709b3ffa9
886bfbf54805d5cb63caae68078857c7b68f55ef
34657 F20101114_AACCVB tain_y_Page_128.jp2
c05b26748fa9a31a5a40daa9291a6b67
c776f5d5d45b7335700380695887f1f23643a9d8
797127 F20101114_AACCUN tain_y_Page_108.jp2
7cf575658a0dd97af073f7001dd5e629
65716cde252b0c745c0aa79218b22e63cce978b4
11154 F20101114_AACDAI tain_y_Page_042.pro
a11ce2c82d13ed56eb85ff36bfc7b478
31ab409ce7d8300b5a90d5c581530a2cc3a76ec0
473473 F20101114_AACCVC tain_y_Page_130.jp2
b3bd390c0d3090ff8ee0c20174704e5d
8f123f3b3fba503b5563231c9531f9dbbd30913f
37064 F20101114_AACCUO tain_y_Page_109.jp2
d4ac897eddda34f689259d6472dfae0a
69b2549190b82b13a3e03dbab07e2f9e9c0591fa
20910 F20101114_AACDAJ tain_y_Page_043.pro
6d1d7ad0b6b4f364c2241cdc6a2607a6
db069b64968b1dc6cb4d0a223a96e4f28423ea9d
134723 F20101114_AACCVD tain_y_Page_131.jp2
cbdc9b468e96f94e8603a3d06fa3b7f1
bb88082e1730ad0fef54585c175eea667bf89554
17522 F20101114_AACCUP tain_y_Page_111.jp2
84a0befc49b88d0f92a3808b1296549a
20f58b47dfbe9217346d5d0343f67c1ba6725f5b
52275 F20101114_AACDAK tain_y_Page_044.pro
d7de6eebbbe9e2da745fb07b90da9e55
9984b14020cc3df80d6d6853209873cd3fd40860
144062 F20101114_AACCVE tain_y_Page_133.jp2
ab1ba503aaf229105416b06f01607c67
e1629bf94088bb153d20a35467943e225f961826
516439 F20101114_AACCUQ tain_y_Page_112.jp2
84feb1f12c52c3d494588159e6155a4d
974760fb7ec8fbe28581b9d666c505ac4558e4ba
53739 F20101114_AACDAL tain_y_Page_045.pro
a44facfff1c1a504a288aa787af3931c
77fd54b5f7b03b53baf91cbaffb455556b9e8a51
135141 F20101114_AACCVF tain_y_Page_135.jp2
d371bada65076925058636d0c215d51b
eeb388a483d7bfb38561759847293660256e5eb8
250605 F20101114_AACCUR tain_y_Page_114.jp2
cc8a24f960f914ad9f5d0e07e211a68b
f31ea166b4dc1f45b56d68498c1ccafe087aa1e5
10525 F20101114_AACDBA tain_y_Page_073.pro
71d277214d41cd05b3ef182e5acef3d6
1d96a2df6cae21f73229d450dd428ee8e9087367
53446 F20101114_AACDAM tain_y_Page_047.pro
d30179d5702d167a333fbea8fc172305
c8d5c72940bbb6f7e0ef1eae405aa400a0528596
146601 F20101114_AACCVG tain_y_Page_136.jp2
393a911547f76f19bd07504bdf1ccb86
2526f7b38d24896969983536fd5419388fa6cd87
23855 F20101114_AACCUS tain_y_Page_115.jp2
3133b19ee7d7978c327ab836da629997
de39d05e1a85e91f424f3ad00ccd458c7a2083fb
10843 F20101114_AACDBB tain_y_Page_074.pro
1e500f3165ab7244bc43594336b5f4ae
dd6262b70512a269d16d7972002fa67717f6f1cd
49873 F20101114_AACDAN tain_y_Page_048.pro
9f7361cc4e9c7adac2fb566d0d8f3e5a
740e00ea2c7934fd6bfc7667ee3d2ac29f9b2e01
142924 F20101114_AACCVH tain_y_Page_137.jp2
d0dd50de557549191d5f1ba4ce73e166
7136c379d4669a7c3094152a300f42d58fc9dea5
119832 F20101114_AACCUT tain_y_Page_117.jp2
130e03d6a8f3c9828dc4f6aafcd19326
59168be446247aca77e36cffa8f73397cb54e8c9
7902 F20101114_AACDBC tain_y_Page_075.pro
611f6bf49755d98c0e071ee96ec162b5
dcac9e2055b090acbbe1ab6d305c6faf49a713c6
52326 F20101114_AACDAO tain_y_Page_049.pro
0c36c258b0723e84ba41430628992e38
5f163c8a4f10e23abd3d2a98c18667334f6f70eb
145589 F20101114_AACCVI tain_y_Page_138.jp2
07099af43577819257f86fbdba2e0633
f1b7bb043e51e5119c912a071864ded16b93e2f3
117792 F20101114_AACCUU tain_y_Page_118.jp2
b47478aee03806f7ac90f0fbe0a4d534
f02a96c46f765d11dbeb43ed0c4a51e5d5610305
10832 F20101114_AACDBD tain_y_Page_077.pro
32ce7e1035654346fd12ee1deaa2c81e
ae2f1795161098b4d923e2e25bf5c093c6b51a44
51754 F20101114_AACDAP tain_y_Page_050.pro
9fc57aafaca917e4535b95da56d40a17
24aeb57c1cb59fb24300e061f249beaa6d0694f4
140852 F20101114_AACCVJ tain_y_Page_139.jp2
3a3f5a8278342e96c7a19fa9f5bcabb6
fd2f2b20d75e8cf9f8344e4cda05571b928da80b
115447 F20101114_AACCUV tain_y_Page_119.jp2
ece6efe137dc37fd268b0e93a3f38d68
e3b168b1ddcdecb0b3e788597095c7b50cae3e8a
51798 F20101114_AACDBE tain_y_Page_078.pro
95bf5dc32e13cf7e3ac2dcbbe35591ff
e2cf6ad243de2626c38a28860a420dbffaa9281a
50632 F20101114_AACDAQ tain_y_Page_051.pro
8be256a1b6c674fed14a7b67e0af5928
09d257195e6f685314958551a4b79fe5728ccec2
139323 F20101114_AACCVK tain_y_Page_140.jp2
e5670d1f22966dceed7e5434bec6fbe8
bc1b32951f38878af781020d4f8b033704637cf8
113973 F20101114_AACCUW tain_y_Page_121.jp2
93aa9d061acdbd0b1beb7719e7b0f2e7
a633c1f780d9c2fbfbd2f6bf21b5e993adf97799
52233 F20101114_AACDBF tain_y_Page_081.pro
d8513f52792dff7610c72f2b56811dfd
f1345d57b62d2706dfac335adfa35cc76d1c43aa
15558 F20101114_AACDAR tain_y_Page_052.pro
9473489e698748a8d600c4bfb365eeb7
574148e29357f9027a7079537bfe6e062c9f2c8f
144843 F20101114_AACCVL tain_y_Page_142.jp2
926fe291e9a2af057d5a49e1f979d9c9
c23206a238f6b4b6941055cd9aad5f095837255d
118214 F20101114_AACCUX tain_y_Page_122.jp2
6224b725247448a35d11479596ce78b8
be7c29d9f0904b23fa7f9ecac235a7e201922738
53292 F20101114_AACDBG tain_y_Page_082.pro
7a28b6199e3c87ea8b8e3aa6a55d62b1
9603d94fbe27ad7ae0e699ed0928630423b35534
1053954 F20101114_AACCWA tain_y_Page_020.tif
684bb9436f9f290ce9b896c5baf69876
2d871d975c4d0432810ce7e3ca9d2f283c28034a
5450 F20101114_AACDAS tain_y_Page_054.pro
decbb0394d66fa63e82f957f396a23cc
bf41f7d4a184a3f8a8f20aa6b0cbf61b9cac4ae5
87876 F20101114_AACCVM tain_y_Page_144.jp2
08d0b6d6cc75b9a86fc0bb3755fb3b0a
4cfb25336c039291963a56fca11ab46d85cdfac8
126966 F20101114_AACCUY tain_y_Page_123.jp2
a840ef48031030bf3603c1ef4ac5c15f
1535cc300474f0dbf356a120cd2ca4a62165b2a3
F20101114_AACCWB tain_y_Page_022.tif
524a36faebcd8879e44c3f7b6b274d36
c32fa6a9376442dd5ddfb201d38dc16a6f8eceb8
10077 F20101114_AACDAT tain_y_Page_056.pro
8bc198c022c2dc4469c28bc4d5eccac2
fb7d6c9e620146382df10fcd52ca8498beef9b17
F20101114_AACCVN tain_y_Page_001.tif
a4bd45410cafb56631b9142b42b5cc67
7f05b1630501ac1bcfa9ad67484085946ad859be
116769 F20101114_AACCUZ tain_y_Page_124.jp2
785ac5aabab2cc9dfff3db08e229b12a
acb49ea3cb87a515e42008a3a2b64fa2f36b7d8f
54935 F20101114_AACDBH tain_y_Page_083.pro
4a04b4721b56332f642952f34efda11b
287c31c5374e461d7df8a77980197099769e053d
25271604 F20101114_AACCWC tain_y_Page_023.tif
6054dadfa5ec98e01094e8e89b84e29a
c53e7f6e2e69519e046d818a547cf1865a162926
14499 F20101114_AACDAU tain_y_Page_057.pro
278d73a785d4704172508e8a55458ff4
03029b732a75dd5adc0d8c9876f3515d84b1f487
F20101114_AACCVO tain_y_Page_002.tif
4b6ccb28c791c6bf599ce63d30143ebf
7004052af12a208cdf5ca8f70bdaeac177890767
53472 F20101114_AACDBI tain_y_Page_084.pro
f539d79d6531cb682f8a48d977496cd1
abb465417f89a7a69a560260d1fdc537cc50db42
F20101114_AACCWD tain_y_Page_024.tif
f222525eabefdfd6c37bafe964a191fd
09f2b1b415341203b7f223ee660f1380a4b92c1c
8883 F20101114_AACDAV tain_y_Page_059.pro
54f7378f70a1fa27894395f158eec3d5
dbc22d0c3c0e9efaabadb2fd646dd4e32f25074f
F20101114_AACCVP tain_y_Page_003.tif
5a077148aea3101d61a2684f23ccd2c4
c90708ffca266cd56a4d94724f2f288f799b4a1b
52904 F20101114_AACDBJ tain_y_Page_085.pro
0428faa6982e234ea83a40842479930b
495a42fd7e64292008387039ec7b0d4036b9c46a
F20101114_AACCWE tain_y_Page_026.tif
02a220ec51a79e0fc82b88fc13dcc030
ffd988fff9cbf72bbfff4e12c323ff3d32ee24c5
48118 F20101114_AACDAW tain_y_Page_064.pro
dcf00b3973c3ed3cd0fa0323441c9dc2
b4afe60b95131a70a9d411a40182bd2476d4782b
F20101114_AACCVQ tain_y_Page_004.tif
2c08e09094581d0346adba29ff1cab77
9dcc68a1825f6759ee5f32286f62c3864ebefe44
42302 F20101114_AACDBK tain_y_Page_086.pro
530a8ab2a227f3035f8ba2c2b015af6b
6817daf40dd394a17b62f77a547b554f1cb3a39d
F20101114_AACCWF tain_y_Page_027.tif
b009fab2ae848117364a62cc0a79d814
e77589febe22c3fc165f67991db42faa4a0cdea4
47601 F20101114_AACDAX tain_y_Page_065.pro
cfb59fa35f1741fa4b1d8a7d3bde307b
ee1251ed846d27f4e4e36e4b31c2c23f610cf626
F20101114_AACCVR tain_y_Page_005.tif
75417f08215406b2954edfe1dd1ae744
5c5cb909aad5a4b031e8625743a0260ea48ea78c
42780 F20101114_AACDCA tain_y_Page_105.pro
59331f23af0e43733596989b5d5a8272
a71dee210d2929f2fcd88215bb70a3da329bd44d
15450 F20101114_AACDBL tain_y_Page_087.pro
53964c7e3e3b43c294147f2ff2022b29
37e95e73c9072bec0b7a99c817e606de38a5e6a3
F20101114_AACCWG tain_y_Page_028.tif
b00885f8037b892b4693727612940073
afdac32ea86aaa9cd326ea41998cac7cddc3f4a1
49356 F20101114_AACDAY tain_y_Page_067.pro
708697667d522bbee3b9b75f45b888e2
f7e7fa557d274d4ec5c36a7f8b55afb014863732
F20101114_AACCVS tain_y_Page_009.tif
7a68ab28230264be3f77eccd203ef24d
ac0b2f718f48c1f78e5d0fa0ea7577c95ed33b4e
25546 F20101114_AACDCB tain_y_Page_106.pro
5f1f11e83346b9d4ebb5a01d2738662c
82e4a38a87cecf3c3443a242a097d9661e3f0d6f
10434 F20101114_AACDBM tain_y_Page_089.pro
f81e8d498d5bf14661aed2e5b2e771bd
42ada1d8dbb5ffe98c5a4c7477547154082c368e
F20101114_AACCWH tain_y_Page_030.tif
b548c1e4b89f02623a9dfe697aad503f
acb8fe5b10fb23452ce5b5ddbe60c14e3061b2ff
47723 F20101114_AACDAZ tain_y_Page_070.pro
2d5b8a18349234a71bd08b486b137ed9
431770cb7c2344cc018ace0c2e18ffec588c40cd
F20101114_AACCVT tain_y_Page_012.tif
7283bfbba5a09c6579168f106373e88e
6a5f236e7592c2b6a844c50e0e8d8cde165762bc
7802 F20101114_AACDCC tain_y_Page_109.pro
3973d5c1769feca06d93369c291091a1
6f9736d02d5b826c0c3a4d236a00ab84638068dc
6435 F20101114_AACDBN tain_y_Page_090.pro
6c9d8123dccd0fb210e2c8ff51ae5ea0
88482ead036c3f3269993b3cf7863b31b26f3173
F20101114_AACCWI tain_y_Page_032.tif
d246e0631ac831e6761e98d74edc5415
e6d29ccfc6516f36b943c6999192ef2e45cc296f
F20101114_AACCVU tain_y_Page_013.tif
a620a03f0d490d19e8d0d0e951d37220
ff9264f698a037d1569425bf7830739ad03a7426
16453 F20101114_AACDCD tain_y_Page_110.pro
f5726686f13c51eaf907fe5458e19487
602cb659cc211dc5c3bc515d01ea5aadf56e9adb
11167 F20101114_AACDBO tain_y_Page_091.pro
45131188da9ae5e1fc15014294f26f48
b501468deae2e91bef83ed325f4b2650a4297f3a
F20101114_AACCVV tain_y_Page_015.tif
b30df0f8607e505d52b105f5c89eac81
67fda7769c3ae52ece0e035440453341a81858b8
5710 F20101114_AACDCE tain_y_Page_111.pro
ca6882ec790212b491a19f04303d176d
0dfa5a335db51978ebb3f9d119afc5a19bd346de
13249 F20101114_AACDBP tain_y_Page_092.pro
a43c1b017ffa2aa5e91d80947989e6a6
b5157db09c1f3bec73276e8b73d4904df10fde9e
F20101114_AACCWJ tain_y_Page_035.tif
21ab88771c59494e17bc8d7353099fc8
bc6210d68f307e5c59cacab97fe343acea68a47a
F20101114_AACCVW tain_y_Page_016.tif
133c06ca1a5c48370e8b5431d6c0b77e
f1a4435f7d75f73b0a7848837b4325981a4d6410
20190 F20101114_AACDCF tain_y_Page_112.pro
52a1a12d4708cac69540bf2a6590a1ca
985799433c863190547b88fabf59cf8268d452b8
5579 F20101114_AACDBQ tain_y_Page_093.pro
0a289d1db398c082d02d9188e62c23bf
061d7baf49d93711a29aaff0d55c23b49ee69abc
F20101114_AACCWK tain_y_Page_037.tif
469b123930d5de594c93edbe971a0ea8
f0a5f9d10f38e9e10cabda7946493d4ce7493a89
F20101114_AACCVX tain_y_Page_017.tif
50b169ec0ff0070642014e7a62f37a8d
eb91828988fcb4db363d581298f84edd08853bd6
4583 F20101114_AACDCG tain_y_Page_113.pro
bd2001913984540bc29de7cada0ae3b1
40a7f417f27124b391fef541e7cac241787eef4a
16825 F20101114_AACDBR tain_y_Page_094.pro
85b42282990304e6a7fc6e6c98a763da
075f2a96a1660b0f20384d4305ac81f69bf8f170
F20101114_AACCWL tain_y_Page_039.tif
4d58107ffb38398e0f68ac8f471e44fc
9beab1ed6588d2a1ded9dfdcbcf5e8ad6821e98d
F20101114_AACCVY tain_y_Page_018.tif
3aa89dd2a742558d7f538e7401a07411
c60173cef91414d9b46e183cbb4cc5bc60ae66eb
7879 F20101114_AACDCH tain_y_Page_114.pro
bb2c37e0c22fbe9b9565f2d980b12cfd
45c0185653167ad32de39c2fb4bc9176d6695c89
8423998 F20101114_AACCXA tain_y_Page_059.tif
844fd8902d07a8fe7301847db5db6f15
26249dc99c9505d197dd938bc3ef1e1898e97339
9532 F20101114_AACDBS tain_y_Page_095.pro
c7ec801afcc48af313bd970d0f6defc5
c9a2464acf047ff1125fde7a3e1cf14119a90e98
F20101114_AACCWM tain_y_Page_041.tif
25c5b18d4d116297e7d540574aa226cf
65aa4790a0828de1de5845b76a09f3bd3216aecb
F20101114_AACCVZ tain_y_Page_019.tif
71d5253931671a44e3c122e1b4610929
bc74f4827f79ff1fa64468efb3669fa4d6b03687
F20101114_AACCXB tain_y_Page_060.tif
7f29d4b5a14424863a3c80858246e86c
63a7ef8edd3efbc81aac8de82dd68dcde6d2bc27
52926 F20101114_AACDBT tain_y_Page_096.pro
b54907db6e4797ce461a295e0b5806ba
59a3a71a7a64b26175c3fcfc3ec5975eeab24718
F20101114_AACCWN tain_y_Page_042.tif
86bba4916424a1be04278de8aa460320
0a690f5146bbb9951e6bc3fbf3f8b1ee52dd9611
6989 F20101114_AACDCI tain_y_Page_115.pro
699f2f2226486365294172787f522852
c26885fa3c986794f4cf128a3c43c7ad36cb3896
F20101114_AACCXC tain_y_Page_061.tif
59045f8d7a7189f79e78f38adc4b5388
49eb15b4d01d7509b35c8750e85cb6da5a1a095a
50313 F20101114_AACDBU tain_y_Page_098.pro
69dcd54ff5af7666d5b35c7124414934
638765a458eea7ed6e1cc05dc4e10780ec65b595
F20101114_AACCWO tain_y_Page_043.tif
516c39d201b0cc24ebee667433fcbb28
da3921527d20b48477ecd56581bf39e00fa7e74a
47579 F20101114_AACDCJ tain_y_Page_116.pro
b50c76923750f6fa34060c2fca66ff9d
9e75d4bca572d1a6758dc10c34624d05280cd24f
F20101114_AACCXD tain_y_Page_062.tif
ad9c5fe34846374ecee8dbdc625d9ecb
48a83a4beb010b33d4ff85f4391e330dbe021987
51520 F20101114_AACDBV tain_y_Page_099.pro
5ce852ea77cc5c8d1a6fe12b2d2efbeb
90f4e7a497ba659d01a43114fcfd97c6a955ed3c
F20101114_AACCWP tain_y_Page_046.tif
7721ad941fac11fbcefe29bb8c43c1ac
05e034559b12d4a219b7f62bdbcd5fbb5f5cb88b
53598 F20101114_AACDCK tain_y_Page_118.pro
bbee9e4eecd18304c022814bad8743bb
073df33d3febcbec41cecb0eae7ec5ac315c706a
F20101114_AACCXE tain_y_Page_065.tif
46090ad3a688be3ea0c1b177058c9ab5
eb6468313ba5ac9a97203fb08560f2d33241aa2a
46963 F20101114_AACDBW tain_y_Page_100.pro
17a383edab6542763a1ae159928cee9f
42132783633b0dd19800394ed78f8d6d3ad516e4
F20101114_AACCWQ tain_y_Page_048.tif
cebac9fad4a5e7c3e948aec14cb3b87a
41738a6f33121d2d1eb7f364939299b4393d9780
38678 F20101114_AACDDA tain_y_Page_144.pro
82dfc931d48807b708c837720b4341d9
0eb948ad6018e0639a58a4695df12e53715bc90c
51505 F20101114_AACDCL tain_y_Page_120.pro
ae9ba82459dcbbc7228e60dbe2ed506b
39013f0d56bc5731656ac43cc0d91c3bfd9c7228
F20101114_AACCXF tain_y_Page_067.tif
3c8617cbcf5b46e5ddca39c8c22f8beb
8eedd3d9a1ae14e6c7a5488a0ebce86c7ccedc16
54215 F20101114_AACDBX tain_y_Page_101.pro
91426f93e05eb347c322d7d3bf4cc93f
2da30db3ffe741bb9e5332a9fcf4cf75b6ab117b
F20101114_AACCWR tain_y_Page_049.tif
8e461bf3026e979ca958794ce054b168
e74a4f8c2f82468b4f569b843c8399e7d3fb5d9e
561 F20101114_AACDDB tain_y_Page_001.txt
0cd13071783a823e20db3106db82a9df
8adf84e0743543ec1bf86e05c947202d5b59d29a
51254 F20101114_AACDCM tain_y_Page_121.pro
0b1a57451129b2e7712b4ca26d706434
3dc3a7826e72f3b9154733c710ce114c720b1675
F20101114_AACCXG tain_y_Page_068.tif
f666cd554fab5ee7df8966c721ee3d6e
4b2f569186e4fe3ae398c1787856365c398fc327
52918 F20101114_AACDBY tain_y_Page_102.pro
8f0f1ecac65dff81d6f2cdffd3399f6d
d84e635f28e3b7955b41740539a069e3b457e958
F20101114_AACCWS tain_y_Page_050.tif
679994574865018b275aa885f7d21309
82438c479240ecba765354dbdebabcce22b7baaa
3067 F20101114_AACDDC tain_y_Page_005.txt
2831a9b3216172e9711ccda9549d27f6
fd297011a306f9e954128f4a24766669f3a3cef0
52941 F20101114_AACDCN tain_y_Page_124.pro
1cbe6bf657a6a273b2d698f38fe072eb
03352d6987b08e4a0fe876ebce42bda8d0c911ac
F20101114_AACCXH tain_y_Page_070.tif
5fb3c06592ce60c1a60f89ad39562015
51fdc689adf6c2ed734eb509cc5b4e44dc4eb1d4
56444 F20101114_AACDBZ tain_y_Page_103.pro
6056056b3cb2ef91c9e529c82f25130d
dad14a0824b321723d7f1f9b67b2d45aecdd1350
F20101114_AACCWT tain_y_Page_051.tif
c3130a7ed94354fc810706a94c92fe5e
a7df75c0720d3320f1e5cb599183604230c6ce9a
3148 F20101114_AACDDD tain_y_Page_006.txt
7f44a1a6aa21c1ae66b7e70b432cf5db
dd9b13e5eda6da5cfd48fc440ccf1e0f2f7caa4b
55021 F20101114_AACDCO tain_y_Page_126.pro
80f09a8ed7febe8d81f0412525cc9926
0319a087f917a995e393ef699da2a77505836d93
F20101114_AACCXI tain_y_Page_071.tif
85b87a9d16261b0cf46f514d72a4af85
166fccd039defc07f807fe0a5cc844fce7ce3408
F20101114_AACCWU tain_y_Page_052.tif
c5ef83a27cf9899b9de823c662f0591c
1536a710ec7dc5eb82b73b7d06d21c9a35232454
2627 F20101114_AACDDE tain_y_Page_007.txt
a8a976b177707f99c25c551e2f91a2f5
3d8cc5917e3be66b7a09a07e4ecf7fda6acc55dd
22411 F20101114_AACDCP tain_y_Page_127.pro
a300a1ebd51c63a6094d8993f0955d37
889caac303ae57c71fb8ba8dde53e798f8753df4
F20101114_AACCXJ tain_y_Page_073.tif
4b30adb06832514fbe0a158d33c125fe
f75283486cb45bc7918ae016a412e50e78636ceb
F20101114_AACCWV tain_y_Page_053.tif
e5577fe8edfe730a3289843768dcc9dc
10b753d26af465109bede6dcc0eb410aa0f67d1f
1343 F20101114_AACDDF tain_y_Page_008.txt
94b8dafad12c8903ee8450c6d4c1227a
99af834e60690a3ab0960bf9f624873641f423b9
12831 F20101114_AACDCQ tain_y_Page_128.pro
63d4a29e8b95c53fe36c476ffcb2225d
8aa5acbfd2e342cb63a8ce8c57e70e5ce2f96f7a
F20101114_AACCXK tain_y_Page_074.tif
40789ec35e17b694baa1176103e860fc
e8d0dadff9b148aac3c4505f4e0f73004a57a019
F20101114_AACCWW tain_y_Page_054.tif
067296ec084f41dce7b871c30c23d06f
68280c7ebef3c61c273d94533725019aa81f0515
2259 F20101114_AACDDG tain_y_Page_010.txt
d407f53beeaf216af0a9702de2f54874
d1738c1ff87e0ac549268a6e41eb05fbe8576ff0
64016 F20101114_AACDCR tain_y_Page_131.pro
39c1ababdd73f22da0b8d0759a2195fa
cff3b6168aa3b63b10445f45b6bc967028666b23
F20101114_AACCXL tain_y_Page_076.tif
abf4ac5f99d3e6adcaaa25d28ecf5f2a
45f79b6b37b47ca7fc817564857adcc74e1e9d8d
F20101114_AACCWX tain_y_Page_055.tif
fba1fd751a887cf383967fd162e0e6f8
b53e199f442511c2616f1a2a7175bc053f6c387d
F20101114_AACCYA tain_y_Page_098.tif
0ec39d1b06d423193fde2613101d7e4b
81691b26ab064efc79cb53193093a231aae2b26d
67923 F20101114_AACDCS tain_y_Page_132.pro
3c0e2fa4cfa73323f648083884136f39
d3053382f12a24439224787615f5e4d065474953
F20101114_AACCXM tain_y_Page_077.tif
c2ec36d8d722e6117154508d37140e16
ee683f72dbc0cfdf2ef7c46f08da4d5865c2ff5f
F20101114_AACCWY tain_y_Page_056.tif
882af0a65eaea62fc2c52b3a8a5a33ad
f330e9a070a5bc320778083f1d5e4abecd7bc37f
1979 F20101114_AACDDH tain_y_Page_012.txt
23fc6c0c687b2f716d23d713a01c7d71
ad707909817f2625ffb86f355347b4dd49621646
F20101114_AACCYB tain_y_Page_099.tif
0b687b4c5a7ad6487edbae8cda73d2be
a0cca754d819ecc0fd3f66d7afc9043c2332084e
65211 F20101114_AACDCT tain_y_Page_134.pro
f4323edf846385430250e023cd0b9ca7
5b0501e3ac0afbc053a072d1c8c151e1337f9744
F20101114_AACCXN tain_y_Page_078.tif
5bbb054fe784509980d903b34c55d0f2
618bb8f318844341c1334a5da6b5d14a146ecbb8
F20101114_AACCWZ tain_y_Page_057.tif
05ebce31a95df23e9611b352f2927d5b
a3ab09ebeb2dd5c709e46758640903fc7bd834d1
778 F20101114_AACDDI tain_y_Page_013.txt
decbda035a50aa3a802d2df124c68a5e
4e192f1b4beb279892135ba6553d446719c8dc45
F20101114_AACCYC tain_y_Page_100.tif
10575002a66f54e53f30db799f6fa701
470bbdb5ccad921e99bab9d1a3fa3050e09041d5
63416 F20101114_AACDCU tain_y_Page_135.pro
4e0b4c7aa5920464d63c6a41e779310b
84f6b182554ff2187e4516c6c505feb8e103907a
F20101114_AACCXO tain_y_Page_079.tif
4655bfe2fc8a2535a858f5fc9166d4e7
43ede7bf1d8e95a7578cb028e1a3f7cf8ddd658c
F20101114_AACCYD tain_y_Page_101.tif
3982b672d51c889b40ae6ad34ae6404d
af7d550af434afc94fd515ca2e92d1df1b2b8f2c
67391 F20101114_AACDCV tain_y_Page_136.pro
512b70ca8686dd3b2ab0defc3e43dba7
c4e0f47e7926464c261551af6bc74a7e6ede39cf
F20101114_AACCXP tain_y_Page_083.tif
24899dee877a497f0b89c9062b80395b
97d50337d6cf31914e318b452a008d7bf7e889a3
1988 F20101114_AACDDJ tain_y_Page_014.txt
0eb2f2c21987cb0be656ef05d411505c
d05987949b5ef157eee4a5bad91a8a91520e8e1f
F20101114_AACCYE tain_y_Page_104.tif
3b397d56a221389530bfe459fc2ebf2d
270a2fdf30c9685f64f3c7ba8430d3bc871b6134
66621 F20101114_AACDCW tain_y_Page_137.pro
f05cd67867d14761a2ea308c14aaded1
95074da0072c6b56dbcb8de7cc8d9c783ab00c8b
F20101114_AACCXQ tain_y_Page_084.tif
c6342324478890810fc81470c3a826f6
24419c1b67dab63fd33ac03603dff9fe1c2ed93a
2017 F20101114_AACDDK tain_y_Page_015.txt
4aefd62ba0d4a5ae9b58793bdaff1d2b
4bb14dfea24576f729ca22261d11b4dc15328f1d
F20101114_AACCYF tain_y_Page_105.tif
32cfde41496eae9fe6a53dbc0c8a6bbe
6cc3ae75b55f91a97ebab61eae572c7acf4ef677
65776 F20101114_AACDCX tain_y_Page_140.pro
4968f53b17a138685727fe640d2765a1
f904ba3b6d6f58bf5fcccadf2fa519da1ac11333
F20101114_AACCXR tain_y_Page_086.tif
d0bbaea7a1dba02d261d42a8318ca370
9e1b6361894a5b6380dc339f9779eb30c6961516
2089 F20101114_AACDEA tain_y_Page_036.txt
82e13880944998a241c8d75b3b01ca8e
07664ee45809bf17feec0c5b9ba75f37b2d5a2b7
2197 F20101114_AACDDL tain_y_Page_016.txt
6d2456be0bf8a2ef7cf5312fcde24d56
04785d9acfc85cec9ce844386457828d03f81baa
F20101114_AACCYG tain_y_Page_106.tif
408b3412edcf1ac83929f1f957ec75b3
1513cec3e6a15132b3b5bd7eef242f104b521254
67114 F20101114_AACDCY tain_y_Page_141.pro
bd829fdd04f3458d49b699daab5d88fc
53a821ef8dc84cc4970ba35c652d63a304c1b659
F20101114_AACCXS tain_y_Page_087.tif
73f4793d32058bfdca14f3c92196df3a
810efc377915657289b9736d92f5cb1fb118621b
394 F20101114_AACDEB tain_y_Page_041.txt
1bedbee62ee0a3c6ba8c055d2f25a9ed
369549b1b9cbbe7b48f44eab07051963fe284962
2188 F20101114_AACDDM tain_y_Page_017.txt
56af52c7390f21ed39d90100cf80f5b4
9bd6b9560b1424cc93dbb8d7a922857c266c8969
F20101114_AACCYH tain_y_Page_107.tif
3eecb89cca72ce35778d6ded7a5d7023
8d386bc459b18126041aac7aaf254ac6790eac50
67744 F20101114_AACDCZ tain_y_Page_142.pro
00387c9e9126500bf3f3f439b77f8dc8
62864c88364e17621500e69d1683983263f96518
F20101114_AACCXT tain_y_Page_088.tif
97a02665d2acfcabe0313a44580021ce
66f6e55b472475a595b2149cc7f8374721ef913d
2157 F20101114_AACCBA tain_y_Page_083.txt
87fbfc1e4e21fd909c6a469f70dcb96f
f50791244e4b7b0e4314a412c2f75f8bfb4078dd
948 F20101114_AACDEC tain_y_Page_043.txt
4ca5ca4be09653d882dfa6d9af506a24
b0b77106040597e619e6c5e400c6ae6a9ebe92fb
2138 F20101114_AACDDN tain_y_Page_018.txt
43943f214c3de5de5fae6b963775f842
7f3e72e811e33eb4b283ce8789dcf7b2cc2cd262
F20101114_AACCYI tain_y_Page_108.tif
6cb8f249e7f8b4a512c2362fb4082232
d22e607e827fa8c6f2acaacbba6fa458e18ae970
F20101114_AACCXU tain_y_Page_090.tif
93955d47c2b9e35f41767144ad612ae5
d79bd97d3a706627b048c96fee8ec92d7ea13994
2074 F20101114_AACCBB tain_y_Page_038.txt
6ed72d3f9f6de6ddc4aa686f3f5d90e1
04f31364fab80be433ac12fd8b6a810e9472e2f8
2128 F20101114_AACDED tain_y_Page_044.txt
69d75b8a6febcaad79c8e1f04a4e5a7d
e448f63870df113ea0242d6462f2e1db6b18d17d
1967 F20101114_AACDDO tain_y_Page_019.txt
9f8004749e6ee41c1ada9c945ca0a674
2fff59f1ebb29ee238fc095483914111bc58283a
F20101114_AACCYJ tain_y_Page_109.tif
ccc239c40016a5f79c73f05cb5d4c3a1
2eaf3b2acdb249d66584404caf6a09e904daf0ac
F20101114_AACCXV tain_y_Page_091.tif
8d8e2fd1e4bde8aa2accb2d080494fb0
bf71b311fbdcfe62f605e7fd944494cb9e408976
23081 F20101114_AACCBC tain_y_Page_076.jpg
344542265521f1fe87cde87417c8c548
311958abb1d6c3f2fe1c84ba6348450f6a2b6fc0
2047 F20101114_AACDEE tain_y_Page_046.txt
7aeaf86808e5786cc82cf0cb6ceca0f9
64dea132db2d6e9393371e8061142e116b7cbd62
2573 F20101114_AACDDP tain_y_Page_021.txt
22c15dea62b68fed542063246775934e
3c80826eb40d28bdfa69db1f68e2b8d3cc2e48b0
F20101114_AACCYK tain_y_Page_110.tif
2b63465548eea876526847d77115b563
d637e241011300d41cd218baa84c7de39abff896
F20101114_AACCXW tain_y_Page_092.tif
ca0af42c03c3583355249de75a6c0355
ff985ba4aaf1bd31092fa75558f56b76c6de8529
69428 F20101114_AACCBD tain_y_Page_005.pro
f8d17d8bfef6266b2d6bd65ac95759e0
8960a424dd899d4ac52502cbb10d86f328445de3
1970 F20101114_AACDEF tain_y_Page_048.txt
719e456569e845516ed4b1e0b4fa0ccd
991a9d502f88c3cbb06c94ea435eacf5bd0f035a
753 F20101114_AACDDQ tain_y_Page_022.txt
35cc82b83b3a19de1991871871934624
5e7e301e97f7ea428b96670d033830c919ff9d11
F20101114_AACCYL tain_y_Page_111.tif
8661e94f778e69d3285472dea4569049
20bf9b8fca5b6843bc4e0b8fb9809a754548817a
F20101114_AACCXX tain_y_Page_093.tif
ce0f46b4f1196a8b4ebdc78f858a6481
4fbe93f79de2c03f26387f62a3c4f554091798bf
88887 F20101114_AACCBE tain_y_Page_049.jpg
5b4f5f52ddaf6b191c787f2167f8e0e8
18e3ca6244e427fffd0a6b5af38614d0a321b570
863 F20101114_AACDEG tain_y_Page_053.txt
13accb3d76374f127a772fcfbb37653b
43f86dc3ef0cd33b3dc5ba20070f6752c4f3a835
1352 F20101114_AACDDR tain_y_Page_023.txt
cb76bbfe6cadf8869fcaa2180cf2a31f
be810c94d0b623a47117e4894a38c773b7df6c99
F20101114_AACCYM tain_y_Page_112.tif
ed4c7faabd5021469bf8ce2924d5faea
0696a290c3dcf2ca5fcf9a736a00434534f0e653
F20101114_AACCXY tain_y_Page_095.tif
0c6c10a1c7dbbb9494aeb7b3e1e390ac
ffdb486502a14d82094994de3e7aff6f57a5c911
122654 F20101114_AACCBF tain_y_Page_017.jp2
0e92aea798b3635c7dfc8c2854c4c575
5f64db9ccc5dbccba9bf8107e36db5ea8526270e
262 F20101114_AACDEH tain_y_Page_054.txt
8aa614613cc7153b3ae3bc40213272a5
9267c25eca957d370a3dfe6fafdc2af711e588e0
F20101114_AACCZA tain_y_Page_135.tif
c78f03ab1e364034439ae7eb9c55eab2
8a0aa68030516d2211a58b2cb36c62a162f8e73f
494 F20101114_AACDDS tain_y_Page_024.txt
0c33cf962564d82a712dafad40e9574c
5b45ba0af1b8f1e35aba4eb7461e7049c8cb4f97
F20101114_AACCYN tain_y_Page_114.tif
9199258c809c7bf26036498f845f14db
61065dada0787137e7666738b910cf7a1f30234f
F20101114_AACCXZ tain_y_Page_096.tif
fdf55b0f37bc0263228e19f4bd212c4e
8b9dc3ec6f01964dc8fa07b90317a1f16f23d848
2927 F20101114_AACCBG tain_y_Page_088thm.jpg
cbd99f6ce27b9c6c1b4bba48f660c60e
85c461e8e890b5ef29ef21eb63b346f3a549db89
892 F20101114_AACDEI tain_y_Page_055.txt
5d8bed7aebb79f65e346a1ffaabe1082
421218eacc8fa96c0de2069aa5ced296cbb76eee
F20101114_AACCZB tain_y_Page_137.tif
57d6a42a008d72030a9c0d1d33d389e0
369837512acf58da80549e69f5d4d409c8c7c863
1778 F20101114_AACDDT tain_y_Page_025.txt
272cf40cf8c0cfcb508b3894502a096b
78afe75b1fe713f0a08459217f81065142a3827a
F20101114_AACCYO tain_y_Page_115.tif
2fc0166f722a55cd141e2569d509bb93
02e5e72dc8ce35f2989e59ae4307cdf9a732f112
F20101114_AACCBH tain_y_Page_130.tif
2528769bf6c1d3a727246dad8a057d7c
b5819128427d5cf7e81c121c88155964b3478267
490 F20101114_AACDEJ tain_y_Page_056.txt
9eb7b486f83be434f3dd9371d660ac4f
a4bc0acf945704b8a2450e8e0f697087d92a023f
F20101114_AACCZC tain_y_Page_139.tif
8bef14222d79b38e76adf10149af641e
fc69309209df81a5601a5fdde0e2446adf49e12c
2053 F20101114_AACDDU tain_y_Page_027.txt
a1869499d797c406b8fc7254c7f5ffb2
dc66cd3c899d4ca5bcf49071a29ea231646db146
F20101114_AACCYP tain_y_Page_117.tif
7fb466ded7c80f66ef397dfc7a6c53e5
25b5c7c6cd6d43b4fec3b249ba82e03fb5911b9f
F20101114_AACCZD tain_y_Page_140.tif
d9f3093822a562fae3befe9487e6a68a
f6ba613d5d920c4e6c9f19a90e2e8f8b2195549e
2109 F20101114_AACDDV tain_y_Page_028.txt
c6263d952fdb00eac95fe5e6d47b2685
7fbad7f14f7fea833373a958f2f0ef3b12eb85a3
F20101114_AACCYQ tain_y_Page_120.tif
426b01424f8e2442059c79f3ba4d74be
f8062d8dde9ea36aa37436254a1d0df70166c09d
F20101114_AACCBI tain_y_Page_102.tif
5406462663df202bb069a36a5074b122
a9df31bf4ff366c55f54c9d6d68387e63d526e90
438 F20101114_AACDEK tain_y_Page_059.txt
cb2d516246e092a3f63b2bce9d405194
29f8bfad4000edc02672f749c48666cf6e4d742c
F20101114_AACCZE tain_y_Page_142.tif
3c6cfb21689f9c5f75b819e8778b2dc1
a948c66ec4787135e485cbd27eeb719ab012b759
1748 F20101114_AACDDW tain_y_Page_030.txt
cd034dd5ac3b3189383e8fdc4369c638
eb13f52133a2b92d00016038bfb74fd2a9a3bc0c
F20101114_AACCYR tain_y_Page_121.tif
e85bc046c503554cdcd656f5032b54e0
e081ac1fd7de303517156898effcdf7203f562a2
638 F20101114_AACDFA tain_y_Page_087.txt
654357ca0474b29125995cbd64afedbf
decc5bd95981e4fcd33240135aaa564efdbad836
1709 F20101114_AACCBJ tain_y_Page_105.txt
8c4d8951209bee06eee440bfd8a331e1
752b5c5fac985b247102ba5159c88831cd3867ce
2118 F20101114_AACDEL tain_y_Page_062.txt
9706351b37f19c96eca8ea487ee0a74d
03d80fc9234258657fbd76256e712ef1e292ec20
F20101114_AACCZF tain_y_Page_143.tif
41b9728776875436bca1839530f7dbc7
a35dbaadfeb575f6684282a615e0bab015e3f5e3
1934 F20101114_AACDDX tain_y_Page_031.txt
d0998b17c7a16d4247c76c08d4386926
e702458bd3dadc837051e7d2d5265236d58ca454
F20101114_AACCYS tain_y_Page_124.tif
9a6359a593a5aa76e3eb0d7f5a458c2b
9b852d14d2c39bacae69238fa138d0b731ba98d6
623 F20101114_AACDFB tain_y_Page_088.txt
314f65b07e7fb97263a071bdb8e63862
f5147c16b375db978578582ca0be582e4aafa074
2107 F20101114_AACCBK tain_y_Page_115thm.jpg
54b87cdf5e6ca0d3a59a371edcabcee0
701001a3d993318e124816747e04274380e500dc
2016 F20101114_AACDEM tain_y_Page_063.txt
23bb0140e0f0465c95e7724840522c6a
53fc574a93043fd6b85c31b5ef1b17a54411c038
F20101114_AACCZG tain_y_Page_144.tif
d39fe0266fddc44cb8736a4d96bd6a17
c3bb4ce482c577259bad254fb465671eb92badae
2102 F20101114_AACDDY tain_y_Page_032.txt
dcbc03d0922c9726b3360913bc3cf92d
31f80be79a54532343b6d17aec8f6cae2d6dc320
F20101114_AACCYT tain_y_Page_125.tif
7b9de1c0b82d6baf72956bcd71ca47b0
663aff98c20d7c8450f7f5a8b1e317c6ca672cd3
51154 F20101114_AACCCA tain_y_Page_063.pro
50252c92d4e89e07e210f12c0affc0b3
7c023b962fd8e810fd4dd6bd40d01c2f61d5fb04
384 F20101114_AACDFC tain_y_Page_090.txt
ab74ea4cbf16d0a7463f61a3f9146d00
0baac2fa7490b5293a501fda298946a4bffad458
9029 F20101114_AACCBL tain_y_Page_087.QC.jpg
6016d7b4f6a3f59354186aeb07adef4b
990dee96b293cac613cde9c905b0ed9b036f831e
1911 F20101114_AACDEN tain_y_Page_064.txt
efb5c1fa29a65e8e364c598e47aa9492
9e5c7b5af3e1f57032f503c998a167b37d3b4c9f
9859 F20101114_AACCZH tain_y_Page_001.pro
d009e4fd4e4431b56545a959e0efc62b
2cf777c4e2fdf35b101b4c45a5cabab76273636e
1878 F20101114_AACDDZ tain_y_Page_035.txt
4d9a5a323d88bafe844d8266e2e0cabf
2b2cd378574b54db8258ce9035fedeb7e358fc13
F20101114_AACCYU tain_y_Page_126.tif
48a594b202fef2464907d2f4ae1b94f9
4177c0c6f2551215667e5385977ace40fdb627ce
27766 F20101114_AACCCB tain_y_Page_108.pro
bde90dc28eed15d563e776276958fafa
5c0c6f58bdea5fb537719eb071c5a49c9447ab37
665 F20101114_AACDFD tain_y_Page_091.txt
39cab8b9b951be03708142b7a1ea69cb
7770b10e46b592d7813c71d8762385256e5e0e17
113955 F20101114_AACCBM tain_y_Page_138.jpg
c4faa520772928705ab55e1784ea329d
29b9508159c6130ebe50d14a1463a595cc01c59b
1927 F20101114_AACDEO tain_y_Page_065.txt
e8973b0c2b0e03c621f875e1c9921b06
0911a4c51c5bafe6258f51522237a82628ad4153
776 F20101114_AACCZI tain_y_Page_002.pro
e6c3196517d98722eea39ba041473859
52ade0a51dc7aed407de3ebaca5f20a62403073e
F20101114_AACCYV tain_y_Page_128.tif
92bf376d264dfec3b32bf39a459bbb1a
5fe5957137bff2f7a07c94b82e45773cf96888d9
108213 F20101114_AACCCC tain_y_Page_131.jpg
65c2187e41ab77df102580dcfe232db1
fb9b432a7a799b87d618b742b68fb95f6f4d12ed
592 F20101114_AACDFE tain_y_Page_092.txt
0ecf4ac58725cde6091a4d7ae8603c31
e056d4c9727ed85b970bd675fcb0c48271da9ebc
6915 F20101114_AACCBN tain_y_Page_101thm.jpg
2380162a213e1e2900238f2eaaa0a3fe
e8cbf8fdfaefdc11d9f0bf5740d21db960463ae3
1923 F20101114_AACDEP tain_y_Page_066.txt
e71c55c714238f0914d84bf12ea7c0ef
df8d7ced32b852576f1b47f563527251d47ade57
35558 F20101114_AACCZJ tain_y_Page_004.pro
c615ccacfdd3c3033ad6bfb02981f198
fb89eaf80f4cb84fadeb61e54cfd6de6061ae80b
F20101114_AACCYW tain_y_Page_129.tif
799888ed2fd39c10d4f02181e540353a
d2d9234aef0c4e9bbb354018ef273f0d0c16f9f9
2050 F20101114_AACCCD tain_y_Page_003.pro
edea6d19bc2616b33fe6ddb1b89da3ca
4891469bd410d5fbe9c9d6471ddc46a25b1ab3b1
288 F20101114_AACDFF tain_y_Page_093.txt
30f70c233d51aafcb20bea63485a14cd
815e92eb4327feb3ff945b2acb245c52c1fe352f
90312 F20101114_AACCBO tain_y_Page_079.jpg
83b0cd3508cc1c48b5ed274320759378
5029be40f1eebf887c7fd933476ec589f67e68e3
1956 F20101114_AACDEQ tain_y_Page_067.txt
d78bf59577ecc014cfc718378375db53
aed8e5a255061b3f9bd4b032a31a35559a67dff7
74578 F20101114_AACCZK tain_y_Page_006.pro
488a9b2c6b93ca55531e40eeb1dd73bc
b59667620dc045a893fa1d0de7edbde44e74423a
2206 F20101114_AACDFG tain_y_Page_097.txt
154d20daeb8668a9e79094f2f392e56f
2769d08e130336591bc95cc188fa321ffbf6c498
F20101114_AACCYX tain_y_Page_131.tif
e69705fd9e600c791cc81b6d153a28b5
9f4a14c13d599e87897132b5fcc7b012b5a3e80b
94813 F20101114_AACCCE tain_y_Page_062.jpg
979b8f4e4bb024ddfcfef59faf674c51
62b5e03d715e9253d1672241b83a1399da6e4bea
30607 F20101114_AACCBP tain_y_Page_097.QC.jpg
4732bdd9f8e435173711529856dde02f
3a4bc8d0271f2ed114e70e7d349e43477a3b9b4c
1515 F20101114_AACDER tain_y_Page_068.txt
238bb2ac6bf9c56f80fdca121fcbd6fe
e4e472338738ed5f1fa246ef9c9b8b8ae97261ca
61656 F20101114_AACCZL tain_y_Page_007.pro
875b89e1ca85ce59ed3d6a4418b0db33
22d18a6ed2a75652698712bc682865260a5c1e68
2067 F20101114_AACDFH tain_y_Page_099.txt
d53246210b63156745df555149970c31
dd966083d8394271f2fd66861ba51b35c1ada749
F20101114_AACCYY tain_y_Page_132.tif
8c34c2e83e9c3557e72adf54978daec8
cb1c860843fb3e04e6490d809a367d4d0bb14aa8
88369 F20101114_AACCCF tain_y_Page_121.jpg
8fa320f531b8bdb14e002d56cd0031f5
d56a2a0507baed014928aa8ef88b448b5ce34e46
16494 F20101114_AACCBQ tain_y_Page_108.QC.jpg
151e96cc11017f32fc129beb19aea876
eaf310482860e8d30047ec692cbfa059fb95b8ee
1909 F20101114_AACDES tain_y_Page_070.txt
c8d889ffa8030361cb7e2256ae4a1d4d
10bce08404c3fb2c467595faaeefdbc01bee36d1
31418 F20101114_AACCZM tain_y_Page_008.pro
eb10896713e6809a53b0507d4b537077
ab24bf8abcf7b00252c3bdb1689d09d09d3e7d8e
1864 F20101114_AACDFI tain_y_Page_100.txt
31af652eaec59ec8891e77eb69058fc6
8572aea7916fa03c9ba058549e47341d49cb4203
F20101114_AACCYZ tain_y_Page_133.tif
116f7080b384bd5a48787cfe57c20285
8c15e43027a5703d6dca0fe43355e9e9432ad03d
424 F20101114_AACCCG tain_y_Page_095.txt
0ebb834245bc5d1afea4f2ad557365e4
f4173caff0d1871897e077eb8938737eccf440ec
2104 F20101114_AACCBR tain_y_Page_049.txt
38f1446a8bac9a269d4a87901b83190e
e15244378df6eda191ba79aadc252069d1521a1a
1321 F20101114_AACDET tain_y_Page_071.txt
42a22fd79497ec2be8b1ba8580167fa7
ead998f35a1e7c4f336cf0b797b267cacb77e7fd
55662 F20101114_AACCZN tain_y_Page_010.pro
3b6082d987d6dc9b8ff39074ccc4a01f
31e57a8bd750584e0d7f2d33d3b23dbaf7f5ea10
2127 F20101114_AACDFJ tain_y_Page_101.txt
f63fc7fb64d2d8f79c1ec8f721fa4b92
c38eec6aab2379fd1266089cba6c9af6cc03f6d2
11701 F20101114_AACCCH tain_y_Page_110.QC.jpg
3548993f8c8b44be4945390175d344bc
3483c3d029c23939fd119e7ee4c0a2faddd09ac5
53462 F20101114_AACCBS tain_y_Page_080.pro
cce726a723493edcfe9bc66781703916
256b2c86b53aab8803519f281daa319929f77462
600 F20101114_AACDEU tain_y_Page_072.txt
d5d62b8dc03f727750dede618fc3dc14
d5e6e5c4029888674cc38072e8e1c9b42eb8f085
45223 F20101114_AACCZO tain_y_Page_012.pro
1261469f55efbe11b8df5a57ef6d9de9
0b143a6131d8d3ae5da85dafa637a412ee383110
F20101114_AACDFK tain_y_Page_102.txt
bca7ea334bdafb1783b3d66f1fb484e4
762de60d7b6c89594c5088043fca11b02331b1d8
26034 F20101114_AACCCI tain_y_Page_116.QC.jpg
2d2f6644ba1a96c91a9f04a7777049e9
4c8c724bfc051d07cbc15cae8687f7fa29d7e294
2279 F20101114_AACCBT tain_y_Page_022thm.jpg
49cf6e7ee1661dc2fcbc2d112dcb1070
47080bed26b6eaf65bc18eb4f2f23699663b246c
607 F20101114_AACDEV tain_y_Page_073.txt
b6c83b841eace3401c029b155300d29e
fceaf635d2f793c8eb3a276972ec42e2c5b92140
19428 F20101114_AACCZP tain_y_Page_013.pro
6833f7118fbc8cb9b3c81d88f1435f26
8f46c2dd435f78be4452c72644fdc577190aa002
6701 F20101114_AACCBU tain_y_Page_115.QC.jpg
26c34108e7656101a6a8a4d97dc9a949
4e33eb3b3678ae35c15806b4cd0e08d44688d1be
595 F20101114_AACDEW tain_y_Page_074.txt
1c736958e71effe26c9c47074339af15
465ba82d63edf8c94060210f63e9781157ef0a57
47297 F20101114_AACCZQ tain_y_Page_014.pro
49891364b0690eeb967383a4a9b1ff05
8f3b0d9ba0a4f8060efe44527950e26e683869bb
566 F20101114_AACDGA tain_y_Page_128.txt
0605730f4d2aa070de2d342a963098c0
99fbc13bf616528cf92b965a78bc1e2a0730c191
1065 F20101114_AACDFL tain_y_Page_106.txt
30dfe419e43c9413fd7bbf7d2945488e
08abc2e9a7e87dd7ec6155bde70e06edeeacad81
32115 F20101114_AACCCJ tain_y_Page_052.jpg
19357726820340348415414b8f8674d0
599ba3d32d040b90de37726c02dcade38f9f3b1e
31307 F20101114_AACCBV tain_y_Page_071.pro
57b5ff0ff4553e5544ba06f08d3c5abc
b6d3c9e84256871b759f08956f6c83dd22e65502
2144 F20101114_AACDEX tain_y_Page_078.txt
42edf6a7094278156b05ed720b6825bc
11c321d432079fa9702258c96864120a1943a516
50471 F20101114_AACCZR tain_y_Page_015.pro
cc0be15709939d9130b9a852e33d3144
6b0185e9a3decde3d1139515926fcd185b40a12a
418 F20101114_AACDGB tain_y_Page_129.txt
f2a7df3af8ac303f883d758bc9042a47
176831c861ea9f25eb49385c22d2dcbe413b778a
903 F20101114_AACDFM tain_y_Page_107.txt
4dbf6bbcaec10212355a4e9aa6427c5f
0423b16f5aad2ed365f59225bfd45e192da37028
137530 F20101114_AACCCK tain_y_Page_134.jp2
c3e0e18449b9dc069d4d9d8be17cacc8
c334077c3cc7be5cf54381275ed7ae27450310e2
F20101114_AACCBW tain_y_Page_036.tif
07bb2f32fc540f742a434d626810439e
0beb3be80e44e5b8f83950ce281cd1460622a4b4
2063 F20101114_AACDEY tain_y_Page_081.txt
95dcea1272a1c7a96566d4958df64f52
e7edbeb31ee233b5921a0c10feb3bb13bd3ded54
56171 F20101114_AACCZS tain_y_Page_016.pro
d086e3d846c280c8ad99a2816746579a
729da62bbb933a870fdfb278de41fd562d30ce54
705 F20101114_AACDGC tain_y_Page_130.txt
0b1c42ab8704b6ee5756c48cbd4036aa
5e90de58f1611af01ca285653d63dd0de70f792d
923 F20101114_AACDFN tain_y_Page_110.txt
841ea648884ba3c2ee094773d15a9d24
16eedddee1b7cc3d2ffce7a624b7dfdbfcc6ce56
F20101114_AACCCL tain_y_Page_075.tif
959c30b36896e3109efe2da9385abdcd
a36b4b09fec746f10598b14a6398ad5fb2bddf4b
F20101114_AACCBX tain_y_Page_008.tif
8ec2a79987bbdd44604c84b56c2a8e3f
672cbbca68b847e2f4a316474cb748a3b6d7415d
F20101114_AACDEZ tain_y_Page_082.txt
cc3559c2d15248f864e2642bd83ae9bb
bc9e21e944318886cfeefdbc09c3cdd4f6bd80d1
55865 F20101114_AACCZT tain_y_Page_017.pro
30788f0e1d0d03894518f3a9325b0f87
6d8e75d963d20217dc3c4d6c953bffb268177dcc
111442 F20101114_AACCDA tain_y_Page_048.jp2
f57e688272bac8e33dc8d29c97321329
c59fc0d165587ca0725e09b69f747e7b81150e3c
F20101114_AACDGD tain_y_Page_133.txt
1eefede227bce9a2ab1b066cd1b1302e
dd3ba1f3f86aab929d89bc7e6d2874be6d7c6880
353 F20101114_AACDFO tain_y_Page_111.txt
8bfe728f970cc0619ba73e074aabd178
abf3318224edfc61758d14b407eaa2a5702cc0d6
3356 F20101114_AACCCM tain_y_Page_055thm.jpg
6e78296cb9482d619b339fe6ea98c07d
db3d01b58506b6d124b9d0ca6c5409630fcededd
2242 F20101114_AACCBY tain_y_Page_087thm.jpg
d86704cc134803408384a0d5163c009b
a6880776814f1ac83ed78437c2818d1b2c4e4f8f
49888 F20101114_AACCZU tain_y_Page_019.pro
772113ee5c897946ce187d5bba65cbf4
684963fc5f0aa0c969fd6b8de7738e7c408d91e4
1437316 F20101114_AACCDB tain_y.pdf
06917abca8edfa22515ce220ca74c6c0
d5a3f5eb646eff9082c0847a23b268aac7fc9f3f
2459 F20101114_AACDGE tain_y_Page_135.txt
3938306459d61ed39722394a5d538ce1
547c05dd15216552fec83f8ab4a7a9110c9b4108
1108 F20101114_AACDFP tain_y_Page_112.txt
ccd6ffc71c66d88bcc61b9761551bfee
7634d67905bfd0a90e6bdb19b256fb7df3f95a50
F20101114_AACCCN tain_y_Page_007.tif
0301f533206e00a58a9993ecb1b05812
30b762f1354439d2c8fe7d1acd6dae83de305ca8
13574 F20101114_AACCBZ tain_y_Page_127.QC.jpg
23fe4b45ec47a23d06239fffb69ba5c4
96e20070d965e1606dba491f466ce800f384f20a
52614 F20101114_AACCZV tain_y_Page_020.pro
27f5dfafa507a05971ab369a52807e1c
ce2089269254c2536b977d19441b751d11d83256
2577 F20101114_AACCDC tain_y_Page_054thm.jpg
8230c42e972c5e4dbfe7502024a08917
68a72d74fcc60e7c2447ca60833933c9ef349fef
2607 F20101114_AACDGF tain_y_Page_136.txt
9bbd86dd7912b17d9ab20b867a579b14
d3f23dfe25aaca804e13fc461d572f40e754f20b
389 F20101114_AACDFQ tain_y_Page_114.txt
3c2cd62b9174692f65b2eb475979486d
2e0b7baaa154dde244c813003775234fe97faa0c
F20101114_AACCCO tain_y_Page_118.tif
73a807066b79d8ce8a6da37cc2efcb7a
3fa6572a7db08016f2dbf3e11b2d4410319f0f41
65481 F20101114_AACCZW tain_y_Page_021.pro
62da52f069fb1a0c285a2f3bfae9bb1a
a08f875d26fb46c555d3c734bddd7a85ca595782
20349 F20101114_AACCDD tain_y_Page_107.pro
9a7d5b289f1efbcb600093a403570d43
bb4a5fd58c7e2bfbe189ebee9a17cf540aa6ac84
2578 F20101114_AACDGG tain_y_Page_137.txt
defab37c632f1a27ce9e9420a4877d79
c7382999c99b502d03bebcbd90ab4332ca3f9d7f
369 F20101114_AACDFR tain_y_Page_115.txt
3c1544639844f393754c4fca17120dd0
256d120f7cc78c21f02d45fa43d809bdf9029963
3190 F20101114_AACCCP tain_y_Page_129thm.jpg
4950b635ce0205b52aa4964b79af8250
eaadd104b4e1e06d5527ef8af5e6044b99cace95
18310 F20101114_AACCZX tain_y_Page_022.pro
c772d1e4e7bc00c337a56302d9dcec17
9429233f4bf46ca1ae8ed79638edd08b399c47f1
51444 F20101114_AACCDE tain_y_Page_104.pro
01199137d8ec0676a15b630684957486
1f709ab9ae2cd337c7e86c6a22ed3d6bda4baa56
2641 F20101114_AACDGH tain_y_Page_138.txt
2f89095c9641b2a5209a738281b9cadd
79a65240308b321cf4c848e3f3bc3f6c555f6f2c
1982 F20101114_AACDFS tain_y_Page_116.txt
76232b144c2f6ec7004b2ae577c09d72
9e7778b1cc9e8e394c3a740bdf64791eda7df713
F20101114_AACCCQ tain_y_Page_064.tif
ac3df4a2fabb0cf73a7f5f55984d61da
7a096b1a8e154f15db1a906b3f775259cb5cd381
49619 F20101114_AACCZY tain_y_Page_026.pro
e70ba0e6830a301969e83f14b51116ec
e77a02f9e4ae5d3af38211038de51bfcde462a82
90006 F20101114_AACCDF tain_y_Page_102.jpg
3b4f338090767c067e166d25c2c6e250
f0eae4520c57bf4a2739c7c39895cc5c22fe1678
2570 F20101114_AACDGI tain_y_Page_139.txt
659eec0101e7e041339c3789347d6666
70a3649d3db22d38c7b80afd1a9ba30f50c354ce
2132 F20101114_AACDFT tain_y_Page_117.txt
f9f30fee6cf09524ee2b1a8748243741
da1fc257309b1c8320cfefa7bb860c268dba0b0b
1999 F20101114_AACCCR tain_y_Page_051.txt
3fa39fd027cef4126c487968aab65e63
4f8dc2428315196cc0f23f04f6f1c1114cd0bc60
52224 F20101114_AACCZZ tain_y_Page_027.pro
583582bcc9a2fcce581748e69a96cde2
3a14999a27e9475d3b8fbe28d737d2993549fafd
118887 F20101114_AACCDG tain_y_Page_143.jp2
b0de41b42e274ddad11ed18c444f1fab
95151dfedc0fe2e998d2c7b0ef117db027c71105
2617 F20101114_AACDGJ tain_y_Page_142.txt
79056cec57c52c55f62f1d1e4996f22a
679ed6241489d2bf0e8b17942276f2c363b8d47f
2092 F20101114_AACDFU tain_y_Page_119.txt
1e3703ec4f78b5dcd24ff80f84f5f4aa
55743a4e7b7fe990fe9b369298e02352b5f3145f
28488 F20101114_AACCCS tain_y_Page_033.QC.jpg
b92d097d013937da5955adcbb1bb932f
7f8fd5077e65716a846a704245d1f01eaa82184e
87702 F20101114_AACCDH tain_y_Page_120.jpg
1cbc9850d9c14f1a00864c7456fb6b22
c2650e1ae4f1410f9c55278f336a9ced9ad74fbc
F20101114_AACDGK tain_y_Page_143.txt
a16337af8a9e68d773c3660faccf3b51
ec644b448e645dccdcc9995575623d4ab4bfb36a
2064 F20101114_AACDFV tain_y_Page_120.txt
f4f9560192976b2c47e74c08ddd8d592
58b55a2872f1420b79762b3b4441f476bb8c9f53
26196 F20101114_AACCCT tain_y_Page_026.QC.jpg
6f4896cd431e40e8bc33f7266b19d827
e2e310ac164c785b567dc96759d241270d288e16
4977 F20101114_AACCDI tain_y_Page_108thm.jpg
fd0b972ff9c32ef4eafc116357bdb564
26b6cfe15e7f733287054160b7baae118a0df787
1575 F20101114_AACDGL tain_y_Page_144.txt
9f79b4e957c4f644ceeb60e44665dd9a
541bf238c11f5b9c10dd0b56cf14e44287a7f240
2273 F20101114_AACDFW tain_y_Page_123.txt
97f32af37d56400470779d7538750620
311587e23f709267246d593666b4645fb62b6689
5391 F20101114_AACCDJ tain_y_Page_086thm.jpg
2db069ec688b1e7790e7171b390a3311
2e5f243f865fff17b59472295fd1be1650fdd5b0
F20101114_AACCCU tain_y_Page_021.tif
075b56eaafe531aa825d15cc4300f827
ac15bc4f0d7e9595c1f1bb3c441ce50b81794420
12993 F20101114_AACDHA tain_y_Page_011.QC.jpg
185aea4a400fbe8c435aebb7a365a583
99096a8b679cc56dd444dc474f4d8c380d962d55
2114 F20101114_AACDFX tain_y_Page_124.txt
169b617fa2e97de7646af542dbcc7810
694c6b961184bb2eb3aa8015fd6cf68da9fb0303
112926 F20101114_AACCCV tain_y_Page_098.jp2
d18479e46f28c5bf6cd85d54c089816c
07c3e064faf56667d9064e5fd8a392b851419fec
5759 F20101114_AACDHB tain_y_Page_012thm.jpg
ba8cb63abc74b3cc36432ef9ba12c1e6
befa8a92dd6678f08a172e47df98a56302767cba
7866 F20101114_AACDGM tain_y_Page_001.QC.jpg
836a6ae65f3ba2f0dbaffc1eb88a0312
2a00dbc4aca8f00f46d804cd10e46bb5f756752e
2028 F20101114_AACDFY tain_y_Page_125.txt
3af0ed36b6c7f432510f6c81c1cfa311
c0ca3f30b71445f9ad6fbe3d1f429c012eee6ef2
2031 F20101114_AACCDK tain_y_Page_037.txt
d1f366f69aa43b8f9bb2786bafc4fddd
ff49299708ecd17a6756316f3405c5bc28449d73
7560 F20101114_AACCCW tain_y_Page_141thm.jpg
bde0e1f21020683fac6a069366fd9134
dafe86e76df7cd1b477899a786012b60db42f89d
24277 F20101114_AACDHC tain_y_Page_012.QC.jpg
20fc063821929d0c78eb182f82e80186
5b3b786ccf1018a9fea4bd83836d18e98142ac11
1021 F20101114_AACDGN tain_y_Page_002.QC.jpg
dd31317a8c107c17dfc440f3a0c465a4
e9e4c14ae60c5473d9117851c9c908f0a224378a
895 F20101114_AACDFZ tain_y_Page_127.txt
71f30753958c9505708bcea6d1941475
77e48d5b49785e4c50237c752dc562da65668cf0
532 F20101114_AACCEA tain_y_Page_069.txt
68f928cf54b7ffc8407efeaaf4f3e076
68b7cb011b9f4c9c53e0d8cfe2493147511276ac
41406 F20101114_AACCDL tain_y_Page_127.jpg
95d97bda9f9e3bda7e8ce08387318a4e
98ba6527dd17319f3e881ae86fb72a40f9a57edc
66262 F20101114_AACCCX tain_y_Page_139.pro
05f39bd82669b3a494e3d9fd9d502ad0
ca874127febee700f9e2e57df68d80fe10d545aa
2859 F20101114_AACDHD tain_y_Page_013thm.jpg
7e3887243766fd4ac9570668c984061e
fd90ca9176c1a244240ab0b0c94a1fe9d19099bd
605 F20101114_AACDGO tain_y_Page_003thm.jpg
5efe99c90d1ed2f0c6f366a24db1030e
f14fb018d6def636a6e090e12209866022522ce5
1924 F20101114_AACCEB tain_y_Page_061.txt
cba4bd69aa9e31efe55e1a7d2388bedf
5d757b2082ed2ce94bfa0229b7e9f95b8a76b750
123601 F20101114_AACCDM tain_y_Page_103.jp2
4a1ae24ff6d54d80203594e86079030d
e487507ffd844e77a808df63449b77550b973db8
2559 F20101114_AACCCY tain_y_Page_053thm.jpg
12c528643cd0297025363f67606e9dac
cbda10efaebd31a73cf6989f9ae4657508c15a88
5855 F20101114_AACDHE tain_y_Page_014thm.jpg
be01407107c8233bb000b18fff76412a
42f2bbf44841669f4f9c54d46d3611de10641d74
1490 F20101114_AACDGP tain_y_Page_003.QC.jpg
4d3f10566ef60b494a0f19332d6b5e18
684e6805b52cc9db6a6c8262e6f8307d2961501d
F20101114_AACCEC tain_y_Page_034.tif
f850288a8f33a6b67254c86ce72e54de
e977e2483d6b839305be2b9202f3fc26709a200e
68391 F20101114_AACCDN tain_y_Page_138.pro
925d054b31ff5af8df4798b5dbe6419d
055e441fd8c4e9bb2843ae59c87d081c52fee303
6525 F20101114_AACCCZ tain_y_Page_085thm.jpg
cb60fca7e5f0abf55ac41f7383e246eb
268c7ba88a843a6ffffeb40ddb807bd7e4873aa1
25466 F20101114_AACDHF tain_y_Page_014.QC.jpg
a6e6e96bbe956b2f2afdc8d01db8ce25
6cc2b69b2b798e538ce4a83c2361aa3b46a5cc49
19820 F20101114_AACDGQ tain_y_Page_004.QC.jpg
43dbef8fb6b9153a8871718bd560488f
ec9ee6ed3cc67d5420df54e7c5c9d2abb0470c5c
90296 F20101114_AACCED tain_y_Page_033.jpg
cbc5eacf8fec3cd8f3ebb8bba57af6a5
8dc6bdd056d7c043a03ba1697551f1a483381dbf
7170 F20101114_AACCDO tain_y_Page_024.QC.jpg
6e0f5cbb0f235309f6e99525fa095b60
d781003ae96b358aba5c56a8eb0a183d18596662
27658 F20101114_AACDHG tain_y_Page_015.QC.jpg
a18d25653924faed27f054eb68529049
e16116a1640fb50f59e3755f0bbc54867dbf081f
4738 F20101114_AACDGR tain_y_Page_005thm.jpg
2cc32f87eceb386258d0aa51cdde6155
33a0fa4eb4250cde9ca5dccde6285c554a271458
58920 F20101114_AACCEE tain_y_Page_023.jpg
ef94bc21c33358cd47db2292686808ea
132da4b3a188599f99c8ad76e3a72fc28b5dd306
113183 F20101114_AACCDP tain_y_Page_063.jp2
3dae47bc1264eab89cde40d2a44eb117
8384843017218a7b2ee66ad208969d2ddf85377f
7045 F20101114_AACDHH tain_y_Page_016thm.jpg
5b415d52a0aa28fb0a47ae286a0a399b
ae9187eaab1464cf77e9de3dca2256d9539b54f3
19295 F20101114_AACDGS tain_y_Page_005.QC.jpg
ad61ef8103e4b4222e80af8b4c78c779
d51a2a3b7e98e1c8e9d83b444a613534a4061017
28864 F20101114_AACCEF tain_y_Page_045.QC.jpg
5f8f7a670104e343324eebcedb01516c
69cbcb9c9882d20b6e916d35fb3d9562eda6cd11
114258 F20101114_AACCDQ tain_y_Page_050.jp2
d8628d9b0a491cde12e768befec55ea2
210f95f9639e5ac6be43c8f7871a5d6a97908f97
30891 F20101114_AACDHI tain_y_Page_016.QC.jpg
3a371ece1e092a806632a551ccc7a060
ee84aed03bee4ca27a063d0bbf6aeadaf41fea76
5636 F20101114_AACDGT tain_y_Page_006thm.jpg
3ff6f4531b064902f8cd32cd5a552719
26f5df355ad494389088a0a0002452280c0fda08
F20101114_AACCEG tain_y_Page_085.tif
e1ced476b12d994899f150a3e58328c1
34712f9f53a042e429dab98901ea04b2a6985e01
25274 F20101114_AACCDR tain_y_Page_031.QC.jpg
4300c5e0831b527ba2b92bcd6c9a815b
1b5d5778dfd1c52316b9ef909a6751950c8a78f0
30101 F20101114_AACDHJ tain_y_Page_017.QC.jpg
7aad0d1a40f1b37359b69bad3ca82440
53e66d26bd36dad44a2466d3086e25e68ed6c15d
4757 F20101114_AACDGU tain_y_Page_007thm.jpg
a87ab9a01b9d40d2eebbe5d522a7ee35
69afa7bde73de0c6d402d558c91fceb3b7ccdffb
28676 F20101114_AACCEH tain_y_Page_102.QC.jpg
2411e89965044dd28b7bb54fed8cad05
6197998df5973168472f132e8c3f03a1e047a97a
2062 F20101114_AACCDS tain_y_Page_029.txt
e275d5ca4a02c25feca0de9c727e0d94
9d0c9aa391399d78e726c636c163bbbce7792a3d
6547 F20101114_AACDHK tain_y_Page_018thm.jpg
f34bb33d9bee87eeede7f7cad8f8bf24
8e30476d5f863b4bfae70be749f6411adc7eb0d1
21370 F20101114_AACDGV tain_y_Page_007.QC.jpg
6da46ab975c77748fddd7fb8cbd759f5
676dd2432dd72f64c03f4581a9fd2e0e9c91ad58
113609 F20101114_AACCEI tain_y_Page_015.jp2
166401f00b92c17fc8f549b247fa185f
856844eca8ea4c86cce5e0d9e81a53aa0b011aaa
53381 F20101114_AACCDT tain_y_Page_127.jp2
d81b70bd0316ba9784e99af7b081bf30
2f36f4e5fb19def29c77f4dd24ca62dd39a795eb
29396 F20101114_AACDHL tain_y_Page_018.QC.jpg
20038379aad9d4cf47842eafe5684d45
ff8d096102eeee7f29eae1aed5bec59522b411a7
3727 F20101114_AACDGW tain_y_Page_008thm.jpg
e6da5c77f44ac9dbd6583aea5432e43a
a147fdf647fd8afa888c2fd5aec8e43c87d9dd37
26660 F20101114_AACCEJ tain_y_Page_099.QC.jpg
7039f55ce5731917c11dfacc7bfaf2d0
2f88b40564bd321166b938d5aff4c6f8d809afe0
F20101114_AACCDU tain_y_Page_044.tif
6cfe38beb9e0a1c58140e188b161a2f1
03a49805f1ea6d8329e52fa9eb93321549f01f69
29042 F20101114_AACDIA tain_y_Page_029.QC.jpg
b6d235d2fb7abb4daa2c1f3631d9aac6
44e43e8bb2bcbb6ae4beef8cf21deefd3f4e13fa
6480 F20101114_AACDHM tain_y_Page_019thm.jpg
c2aaf7cf422013903c55a705c63ee16e
e944482f868309f422a741b907ae72a022eef101
6731 F20101114_AACDGX tain_y_Page_009thm.jpg
2fbeeb24bd46b28832db3ae68b784699
d12edaf376c7e7b8d5bece880945596042aa10a3
795 F20101114_AACCEK tain_y_Page_011.txt
7630d9ff7cfb019cc959eebaf302517c
e4aebc76654217a251a49bc8d73ff62122ef78c6
3266 F20101114_AACCDV tain_y_Page_127thm.jpg
2916bac50c47a755963bf20ba7848826
a98c9b05908a1aaf2d65978ae0c90a0c0814eb4f
5641 F20101114_AACDIB tain_y_Page_030thm.jpg
8c89bfc13598cc9ba72d555b905d3cfe
1a5f3d73f35aaf76536b5cfe1213e9780efdb3e4
28018 F20101114_AACDGY tain_y_Page_009.QC.jpg
f760c7478fcfab99f4aa1f1ef39d5d5e
f7314ab022b62f108cf3877c2c34474e03c01beb
10371 F20101114_AACCDW tain_y_Page_075.QC.jpg
3789727e312d4de37aa785d910dedc7e
58df4ac3092d0137e9a2387703c867a617475feb
6128 F20101114_AACDIC tain_y_Page_031thm.jpg
8e31de31680ef82e22a8660c25e87a79
1ab3d5e843c7a5c1c7e7376e309cc8b5201489d3
27789 F20101114_AACDHN tain_y_Page_019.QC.jpg
ff4ba141a5c08d2bb49f3e626a33018c
da3a4657f27c1fc23945659c8cea4dc48e7bb972
26468 F20101114_AACDGZ tain_y_Page_010.QC.jpg
cd0f00811f210ea9118103e28c41546c
068d7c7aa5af27cf52c345161ec50889000ffbd0
51029 F20101114_AACCEL tain_y_Page_034.pro
4e4c0fbb93eab46dff7e17ec24c90492
558b71e8e670b769e90373d8dbb3f45682c9e820
41902 F20101114_AACCDX tain_y_Page_025.pro
8db058678cbec328973a37af4b59211a
2da44d12e635c0bd6cb7ebaf5264c173da0fa66a
65963 F20101114_AACCFA tain_y_Page_009.pro
9692d74df4efb325eecd9699fb4e1622
92e12a1f3213afb3716196dd1b62506861c1c1fc
6785 F20101114_AACDID tain_y_Page_032thm.jpg
bd1e1a0b4b682277a8a8de9383594ddf
d32ba7b6d9ed0303e0071019cefbcd83fdb96378
28936 F20101114_AACDHO tain_y_Page_020.QC.jpg
aec3e8b947d4141c097e2c0d627a644e
04517ce79ec2487ba927473d1e88266143a4bb59
F20101114_AACCEM tain_y_Page_116.tif
86ad78f0cfd716fbaeaeeea5ee88d7c5
821b29651c1c825e8cbabd9aca6eb9f68d6be125
F20101114_AACCDY tain_y_Page_089.tif
2f78b34826d49e61de5c779d0fa975bc
d2c1539529b4110df5e9b2ecd042a93271e6cb85
2705 F20101114_AACCFB tain_y_Page_074thm.jpg
341291c55f26f01355792d37873c350f
eeda6f52cf9a88a909125b90284073077afa9c00
29194 F20101114_AACDIE tain_y_Page_032.QC.jpg
565de26f1cbb26fb34f449338b26fb98
99709f5bd73c44ea276c38a447c37d20cead89f1
7221 F20101114_AACDHP tain_y_Page_021thm.jpg
83bc957a6a2b5c4c710d46a4af86705b
abdaf781764bf9e38da14a365a909a20a240b97c
32366 F20101114_AACCEN tain_y_Page_021.QC.jpg
42f95d6072e3a5611b738134c7258e2c
9e0a8b563d1929d24c3e4affd4f965162c933e3c
82196 F20101114_AACCDZ tain_y_Page_066.jpg
2c4049dbe7e6383a27fbd77cfd67315a
566a6bbd55424a237caa8f427ba761fec2db37c5
57707 F20101114_AACCFC tain_y_Page_123.pro
c2af41746f172701c38761e3031b76b8
478440395d017f06f99feceae2a3a9a083e1095e
6895 F20101114_AACDIF tain_y_Page_033thm.jpg
c7d77c7a10b6ca542298e2c98b46be05
2c0910131a3b1aa4dea31d434c866f7304683989
9066 F20101114_AACDHQ tain_y_Page_022.QC.jpg
9d84ce66229420ec80f0c8d9e1fe179f
149870b3b68aaa6105c330987c5cdcf6bb2a57f7
567 F20101114_AACCEO tain_y_Page_076.txt
4d0583b6be6353cc747656bd91341004
36d4dee3c35261aa4d4bab5e8521782f61f5a693
55440 F20101114_AACCFD tain_y_Page_097.pro
db2caa6385caa61af474f12ab67c1921
b98584bcf5dbc23166f4f43168d23439a0312ddb
6515 F20101114_AACDIG tain_y_Page_034thm.jpg
b61719c9e6b8103c0f1958229c39aec5
f42831632067712ff155b2bd37fdd716a07b3b70
4325 F20101114_AACDHR tain_y_Page_023thm.jpg
d7eb6ffcf9de572869926f8f272c18d4
2e5357ffadc15757b952ab0ebbc91992444ba39f
F20101114_AACCEP tain_y_Page_082.tif
85f54a5510f3c5fdc4830f9de36cf720
6ed8e8b85154a441f926d9f1520761e37581b80e
237644 F20101114_AACCFE tain_y_Page_076.jp2
ce1e3f01a5081b0d533cb7497f250f0c
b0be19d37ef0ff8ea019ec1a10223ddd1000e436
28639 F20101114_AACDIH tain_y_Page_034.QC.jpg
48042fc8a0495379df64f8e95f2481d6
d4451130e685d88e4b3aef69fe82114be6bfcbc3
16452 F20101114_AACDHS tain_y_Page_023.QC.jpg
2356d1cc8eb624e3bdb34e717e0d49db
41ec4b64370e188fb11db6bd46b24815837d74c3
F20101114_AACCEQ tain_y_Page_029.tif
1a26200e79ac42cde03466d074919f91
f896bdd2864b932b32b04b37556183996ec283c3
1790 F20101114_AACCFF tain_y_Page_001thm.jpg
fb99f5951bc1d569de39774a0b714687
ee3a5c6bf49d3029db744379be5656206650d7c1
6176 F20101114_AACDII tain_y_Page_035thm.jpg
0c8f92ae00f97bcfea41679cfa5d06ec
256c29428ef44448ef5a486d8118be866e34755e
1917 F20101114_AACDHT tain_y_Page_024thm.jpg
50efb3432d80fb834ab257b2eff8d93b
504c52a34e595440ea5c372be7dd46f11db97dd4
6169 F20101114_AACCER tain_y_Page_067thm.jpg
3e6be0f4568ca88206a88635fe9e4183
94b5ad855c48dd1c2c1aba10b5c2dbced4bb71d6
115563 F20101114_AACCFG tain_y_Page_120.jp2
2b88e8971bee64a4187fed40c9499c64
72905629238915ac1025ebd0d018cc1935a8dc35
F20101114_AACDIJ tain_y_Page_035.QC.jpg
4c66d5a2bf5bb25d951739839c3c7e0f
3ba2e8892c403ff295a5317f21413ffa2c7e708f
5493 F20101114_AACDHU tain_y_Page_025thm.jpg
f830322d53a7e08e387b21b68a2adb62
c708a2feb9925ca878433f3acc27a24f415af9c7
30895 F20101114_AACCES tain_y_Page_134.QC.jpg
77b0a7cce2cc7e35140499bbe06c26fa
0b03fc03b023ed372eb15eece96ea8d37a3010f5
38905 F20101114_AACCFH tain_y_Page_057.jpg
ac5f1b1052fea836da50d391eaa8587a
c3e8861491c6124101e19bc4539e0feb59a4fcd7
27672 F20101114_AACDIK tain_y_Page_036.QC.jpg
3183e36b574bb4adc89be5b9b33238f7
0231517785c7486196485a81118bb7c5f05409f2
22618 F20101114_AACDHV tain_y_Page_025.QC.jpg
f569f822d1e2de7d0a63d07e95c4cc16
9e2a2fae7f36d62ae148637d03b5545b6b665a00
12268 F20101114_AACCET tain_y_Page_069.pro
c263e2c353c4957717700e1955c2d626
70872050baa690c80fc512f312e0920518765b3b
53909 F20101114_AACCFI tain_y_Page_018.pro
6062028bf0298a3fd8641edf9a5aec03
fa99028008df27e07a1c40e4388950eb9d56ac1f
6948 F20101114_AACDIL tain_y_Page_038thm.jpg
79cb6ea5d469ac50237617c2772423d4
5fb79c799e25926f24dfc8868fcdb0ed4448939c
27670 F20101114_AACDHW tain_y_Page_027.QC.jpg
fb57282e6bc6b81575f07e5e7872623a
ae34159f7b06067a6c91a3dd3f8f7432383df2a2
32050 F20101114_AACCEU tain_y_Page_138.QC.jpg
87940cc14aed638984e3c4f7f5ecbdc3
bc4025b2f88febb983a6bdf241ee81d12e00d1f5
2171 F20101114_AACCFJ tain_y_Page_096.txt
219d8c8e81faacec5bdf64d089c11400
e6f0f3ffe6154ae565fd1113e822a87e29d4e510
28972 F20101114_AACDJA tain_y_Page_047.QC.jpg
af29b3257be296a367632cd92a99a61e
2ed7a842ecde45efa9cd8a1de33f442e24a93d53
28645 F20101114_AACDIM tain_y_Page_038.QC.jpg
41582076f0db222a29301f1383217d18
0c0f112f479f79d6e750bf69309728d82dbbe6ce
6749 F20101114_AACDHX tain_y_Page_028thm.jpg
90efae8236ad2ecf5a5d24d822fdbcbd
dee3a7cd25a132cb72407a76c14982a32b5e8401
1292 F20101114_AACCEV tain_y_Page_039.txt
09742888c9d6a33cb92cfb56d6214cf0
dc2711b891a1c3c8bfdff7a79c2584aac0d48ae7
113184 F20101114_AACCFK tain_y_Page_019.jp2
5a51f4dd22dca5d33179280c6d588a40
92cbb2a24f12c1f597d11bc9ac3aaf16f8c0d6f3
6472 F20101114_AACDJB tain_y_Page_048thm.jpg
3ed70ebd5df97d8e04684bceb1d83fa7
eb4a0a4b1b01c16d83aed6cdc8ec6f321d2f5eb9
4349 F20101114_AACDIN tain_y_Page_039thm.jpg
9b726ccf6701228f0e037c51b808bd9d
182edecef055d3c70c36fc4c5e2ef8880859f59d
29090 F20101114_AACDHY tain_y_Page_028.QC.jpg
976b40662c3b3f26e13a6f16d4634f6c
b8054b85ba033652b015aee922a9fcef3948338b
20533 F20101114_AACCEW tain_y_Page_090.jpg
a3a89d761e4304706327dc7990de28b1
23dce3c7943c41b666cb627eb0c337433c141316
6316 F20101114_AACCFL tain_y_Page_027thm.jpg
9f55fed468f537f9d36a621f42f5dbff
001509329d933be10a82ae78a11c7628915dc092
27609 F20101114_AACDJC tain_y_Page_048.QC.jpg
51c71484a6e6ed77a6787682c9e4bcec
4f519fe7f9c7176d746f22a3d5525560930121ea
6670 F20101114_AACDHZ tain_y_Page_029thm.jpg
ea02c0268b247253f758a2eb9c2aba1d
605e684d3fae201e9dcab586efb219c091b3362a
10369 F20101114_AACCEX tain_y_Page_088.pro
141dea9b59960eb83a5d153e8402cf27
c9f786ba1cc976d7a866c44b7272bec2379f8c7a
2119 F20101114_AACCGA tain_y_Page_020.txt
30766b430d7946b52a929ba28e9a2ac5
7037299f5e51f488044b1f2dc9b18719afc12f18
27998 F20101114_AACDJD tain_y_Page_049.QC.jpg
af8f64d6da12ef7e83c4ed830b7c2c67
0d6a4386c22a637c462f856b8b04f3dfe36e11ba
18108 F20101114_AACDIO tain_y_Page_039.QC.jpg
070ed86329406d1850c7c7f1ca8b8150
6893607728ce075a4e30a16d62c7a11e4d033bbc
6384 F20101114_AACCEY tain_y_Page_049thm.jpg
4d0d2cebdfa442e6a960d8d57f28b23c
efe997a20a230a1dcd3084dab0bb5838eb372f8c
F20101114_AACCGB tain_y_Page_077.txt
757e35ae1b50fa8e32c19fa777bfaffb
e20812223f1bf0a3bcb16dc78faed10c93758030
386266 F20101114_AACCFM tain_y_Page_041.jp2
ee54feb9859b403a54a6fa540f460d98
73d1b546d780f561eb9979ac0d8863ea3c2e60df
6614 F20101114_AACDJE tain_y_Page_050thm.jpg
e42d0bf57d84c822129cdfc640dc76f5
c8fe39a35ca1c67c546cd82bbb7dc1401b6d8d71
4818 F20101114_AACDIP tain_y_Page_040thm.jpg
73c13cbba4a09875322601b5bab64a9f
4d5afb724c9d01dbedf6864fdc9b9006786dedba
1472 F20101114_AACCEZ tain_y_Page_004.txt
ad8706113a33bfe127dac297ed35a3ad
a9314bb0ed107a7405150138cb3790cea82ee099
6388 F20101114_AACCGC tain_y_Page_098thm.jpg
73493fd08801260ecd6a2f4001f7e060
923a8f2ab328d9f2cdace4bbcf840a36323b5121
2149 F20101114_AACCFN tain_y_Page_047.txt
55b60d370b9ddc58c7dd3883a9f6b31d
0c0a5442bdbd65a36bf5a52cd9e6670f080f3c34
28138 F20101114_AACDJF tain_y_Page_050.QC.jpg
fcd73f03a0a7ab40ea5afb672f03eed0
f573c829fbc73017c3499502a054c32b7bf724b7
19234 F20101114_AACDIQ tain_y_Page_040.QC.jpg
6ccd63a35a562e035343d3b6d78c2e38
ee879a7c909a170193783426bb023e8b8e22b7e0
74647 F20101114_AACCGD tain_y_Page_105.jpg
ebcb03b1973a01a068e16a0cac9a288f
d7fd672c0042a985c68bba50b8cf915e5fe8860e
143554 F20101114_AACCFO tain_y_Page_141.jp2
3a71a86412bd997a660d0256fc7ce1bb
5565b6a4f99e3d367bd54b946a8a0308df5d5b5f
27189 F20101114_AACDJG tain_y_Page_051.QC.jpg
0a8dc619152f7ff9c916c80e6eeb0dfb
934a9bc0d069dab92d3d9ff33d0791458c697c85
3381 F20101114_AACDIR tain_y_Page_042thm.jpg
d2b43471681a1cc49529a9115a4a160e
78c206e3c466864bf3edcc2f8694c66044c1412a
7729 F20101114_AACCGE tain_y_Page_133thm.jpg
cf7e812e304eefdd5266ee2797f50f99
2158aab2edfa0241360cc8737c22fb3857f37851
53733 F20101114_AACCFP tain_y_Page_122.pro
427919715a7b67dcaa41b5b0da317d9e
0cbfb18a0c9f8bc050234a3dd71a8b9663a5d2f4
8803 F20101114_AACDJH tain_y_Page_052.QC.jpg
6ece16e7918016ef46662bc9f16048d7
02a744c73d4b6f800913fc044f0f3992acc3a317
11505 F20101114_AACDIS tain_y_Page_042.QC.jpg
a2e5144375425f8a5cf7c2a4ec4d4c1c
e0ccc59e58dd982096f874effe192c4c01647f6c
51387 F20101114_AACCGF tain_y_Page_125.pro
630bdbc2c63b7917a716c951ee514000
2d85d91317670153ba5a58b3c8811807699f7dd9
54275 F20101114_AACCFQ tain_y_Page_117.pro
71fb02c3cfca1b4d91b8b842c594ed25
5793a497b7892e38a26c40a03c241f9262e65e9c
11164 F20101114_AACDJI tain_y_Page_053.QC.jpg
f4b97dbe57bf20c10d99592a9b2024f9
bf894af9f9a3ddffc127336d8b73f35b0c8978b5
3208 F20101114_AACDIT tain_y_Page_043thm.jpg
f96dc99c0d35cfbf55ee00185a9ba6de
1c773da84d975130e9a2fca037b57b1034b3a518
F20101114_AACCGG tain_y_Page_136.tif
d843b626efc788c7091e9e970102719d
5ee61ed84265cd0130a7b4a0f837a05e7726a19e
1820 F20101114_AACCFR tain_y_Page_040.txt
19a152b18f0a088e9415e7c04a3a16a6
e61060deeaf643f2e80c7c337cff21e0f15185fa
11605 F20101114_AACDJJ tain_y_Page_055.QC.jpg
39845c538b36d5fb87c0d07d67b14ba2
4d8f0d256978b1cf4541bf982754dc145384404a
12281 F20101114_AACDIU tain_y_Page_043.QC.jpg
cd95699732e5b18e2fb6016602192971
ff747f89850fd2ee7c08d23f69bd7ae061c8210c
F20101114_AACCGH tain_y_Page_031.tif
889514ad086547cdd6d1191e89894b30
a3350cf229aa25559d0c2a04b4405b9f4f68b7ba
6442 F20101114_AACCFS tain_y_Page_078thm.jpg
569b14b3731c1a6ee1f42eab4c3d3caa
64fec2a02e0d155c1d9f0fe44c5560d507380720
3546 F20101114_AACDJK tain_y_Page_057thm.jpg
1fbb46f1680661f9871d1028717905dc
ec4b01a79781ab7d45197e1deabf01fdbd093993
6544 F20101114_AACDIV tain_y_Page_044thm.jpg
c7ba83c82159b65236c1ea8be27a4edf
332f80a73fa65774871de792710d3cc6f082c1ee
5776 F20101114_AACCGI tain_y_Page_061thm.jpg
fbfa24f43373b06fa8ad58b57c613cd2
d6ae4bc97d008426669217802a04b665181a6668
9026 F20101114_AACCFT tain_y_Page_060.QC.jpg
02bdffe0e2f602693a30c43e730fa705
b7c4923626e62585eafbd606eb2ab66bba76e349
11916 F20101114_AACDJL tain_y_Page_057.QC.jpg
c3eb27f29e3aacd2f8d4fccd086b6dd3
896299e749b51a03a99e1926c19f1032d2987269
28978 F20101114_AACDIW tain_y_Page_044.QC.jpg
cb0d51eaa078b35334477967927cce20
62534a99eb6c4734ad9c4a3460fcb275c384b297
30714 F20101114_AACCGJ tain_y_Page_131.QC.jpg
9be8ca77bcf6f4017d2df19b8efc4e4b
928ca6bf817ef9129d98fe9ce95132d4d2356df2
82085 F20101114_AACCFU tain_y_Page_065.jpg
2b41d29da41884adc394fb05cae1424f
450388f81ecb5a7d939df977bb0c3f213f120e0d
26354 F20101114_AACDKA tain_y_Page_067.QC.jpg
9d3aa1c081c2a97bdb883193a0ae4f1a
7b3049d9ddffbcb83981e92082abce6826488e18
2663 F20101114_AACDJM tain_y_Page_058thm.jpg
7cc56d7f3c5cb03e2113d01fe500189b
ce3ba1671e9d5e073b4dbe4eea61d9e7e49c861b
6686 F20101114_AACDIX tain_y_Page_045thm.jpg
6817192a143042c57fc377a70d539aa1
920924f6cf604891926e1c713317689fd543e88a
11407 F20101114_AACCGK tain_y_Page_013.QC.jpg
88a35ea547a10bf1de7a9c05d37680d3
bb8cda5e976bbe2216eafb48accf81142ec18f97
374 F20101114_AACCFV tain_y_Page_075.txt
2e4b1edd45c50a16e970bf0db465cf8d
e46f6ebbe4e8f6308234047c1e10fd8eb1d61c60
4910 F20101114_AACDKB tain_y_Page_068thm.jpg
847aa5b3be747cedf641d1b01cec498b
0b50cbe17151db8318a5cf35f214ec511fec1ab9
7837 F20101114_AACDJN tain_y_Page_058.QC.jpg
82a5ecd2ef866a838823ad1d36bd737e
69ffa4555e97f82b76690a10ff19bdd425e1654e
27615 F20101114_AACDIY tain_y_Page_046.QC.jpg
000386b5e10513b0022b38acd46958cb
40f39aba95720bdbe019c30307128301f3775221
120763 F20101114_AACCGL tain_y_Page_126.jp2
3df891a5695535ee071d8a3b0e474dba
a65b7390d61fb683adb2a5d0d93d9ffcebbde7d9
2048 F20101114_AACCFW tain_y_Page_034.txt
d4897ebc778e45640064d9d31ebd105d
facb97a72886bab7d98ac250ba544a8572f96f43
20848 F20101114_AACDKC tain_y_Page_068.QC.jpg
b06ee0e5b47e24fe9d1556d6ace70db9
b60f541f9b7e0fd61a05d6213a14dffd72a773d1
2314 F20101114_AACDJO tain_y_Page_059thm.jpg
80dfb3af20bff0484f597ced9f3663dc
d5bf927dab83b691db40b386a7ab3dbf3ffe851c
6690 F20101114_AACDIZ tain_y_Page_047thm.jpg
27e7a9dfeee7ca041785fa372a6a60e3
a9f6df4a3f026846d34d19ddb7532e102fc884da
3135 F20101114_AACCHA tain_y_Page_106thm.jpg
5fefda645e3ac5e0be757192f264bc3b
c6d60b69da1760e69193525863a439a88fc39e7c
29593 F20101114_AACCGM tain_y_Page_062.QC.jpg
d4df3ef91440053862d520aed7451e62
2122122cbb2ba2f9c299d052305b0731d8453689
F20101114_AACCFX tain_y_Page_134.tif
2d569759abbe0ee195dee355bf8d647b
57b56a442ee56e40218277c08646790161cfee95
6967 F20101114_AACDKD tain_y_Page_069.QC.jpg
98f57d0771aabf6798f665a8d3081879
7f15ceafd24575e6cfe1e36bbb128353622f9fae
9794 F20101114_AACCHB tain_y_Page_072.pro
00e6f3a871d250d2a6da9d347533babf
e0f24e53ffaa9dfce7ceb415a3c569ec21eccf3e
120104 F20101114_AACCFY tain_y_Page_062.jp2
93717da724835d260d2b1acd94e367ec
4e68678200308f04d65d191d511936fedc5d71db
5165 F20101114_AACDKE tain_y_Page_070thm.jpg
8a827576141b73ef81733563816ec706
f5e3635440cf41c2f643b0899e5d9ef58a4d1cb9
7764 F20101114_AACDJP tain_y_Page_059.QC.jpg
cd310faabb95a77fecd96d174c7314c6
41325d071bc4f9390cce41a877c58ff6a1641a03
9092 F20101114_AACCHC tain_y_Page_073.QC.jpg
91c24ff2785890db626ae61f0955a71c
cd7f59f4280ef729a3352a00774c6dba1266c7c1
6398 F20101114_AACCGN tain_y_Page_120thm.jpg
c0fc6fb334bb966f0e183e2cc4ea23e8
7492054297d21a96babba9faace673805e0ef228
2549 F20101114_AACCFZ tain_y_Page_140.txt
bddd5dd4bef57d78d533061c9a9d8708
e932c8271aff8145024ea5d0235f2f4ddd489397
22766 F20101114_AACDKF tain_y_Page_070.QC.jpg
2490cbe02a0cd8940beecef2eeabfa44
89d3078d6e67d346ffe2169110c2afb79091d5cd
3079 F20101114_AACDJQ tain_y_Page_060thm.jpg
160d576714c6938cc4867b75251e0b76
232b2560c10429d39fe9eea33ea8f23c06950451
47377 F20101114_AACCHD tain_y_Page_066.pro
9cdb9cc1182a7dc7c9d48f03ec613c39
7b8e94b704dc144710ac83423de811f743c61782
F20101114_AACCGO tain_y_Page_045.txt
33b015361d05be6a350884e46384c74d
23d9f25ddc058e7b87a87356392304be29022b99
2569 F20101114_AACDKG tain_y_Page_072thm.jpg
00b3eb92286ca8452fcfaede440eb654
4b2a80a17830301a61f7e127f1bf6fc19cfe228f
25612 F20101114_AACDJR tain_y_Page_061.QC.jpg
a359bb3dd4a5d7535a16b18beff9bc99
18bd9202bbab27e38d887842d29f8f54bd46bd06
21740 F20101114_AACCHE tain_y_Page_058.jpg
a4cf0b6b61f2a850b73ebc9e0f24c5d7
dd9110a35f878a459e4c481f5c3743a11b7f170d
6224 F20101114_AACCGP tain_y_Page_010thm.jpg
e40d435679eb69a5fbef8fc4aecb7a8a
785e02be8b6ad0524252ac271dadb54667eb33b9
8366 F20101114_AACDKH tain_y_Page_072.QC.jpg
4b8f5a2b285e41ea0249de5d49e85876
a817666c7f99e4b59eab0d85689738b7dff775a0
6747 F20101114_AACDJS tain_y_Page_062thm.jpg
9aa26e5a0abb39c9a79106bc64ff7592
337b85d0852a56dad032531aa028eefa42802fa6
F20101114_AACCHF tain_y_Page_010.tif
e0a594f48f9121a0c8fd2c4c296d867d
aa8afbb5dc26ae6f5275c3f7604d7211ef4216ef
F20101114_AACCGQ tain_y_Page_014.tif
5d3ffa206becdba7e13da70ace02e03c
9db19d8d813e81ac87a034aed481d576c99e444f
2674 F20101114_AACDKI tain_y_Page_073thm.jpg
43907f51048cfc6df7709f04fd8fa76d
a931aa2029cc5332f876dc5ac8d7031356a17465
6422 F20101114_AACDJT tain_y_Page_063thm.jpg
f4ab7e83c95d03e82f15066a237759fd
3a49bef351553ce063f35c052bafe40982a7fba6
27586 F20101114_AACCHG tain_y_Page_023.pro
6161316bf6639ef111df1e8a33228c34
c10125918f5403bb74fe0b170182b716a3dc6b2f
109126 F20101114_AACCGR tain_y_Page_035.jp2
2dc830c5ab3aae63749c5017a0c46d34
532c17ca2b87cb4171f9a4c6f06d2f3d5293a626
9076 F20101114_AACDKJ tain_y_Page_074.QC.jpg
65bdddae4b0614415c14cbb9ad6e45df
172d642b1187308a4f10c2ab9c64f10289a3d61c
28043 F20101114_AACDJU tain_y_Page_063.QC.jpg
af4a9d7ae51b055484186cb5accfa133
45e63b6cec46e4169076fbe82ae8172adfe09faf
2143 F20101114_AACCHH tain_y_Page_079.txt
dcc870f3f16c1bf5f2f17b43a12a1cef
98f7807a4f11f78b7c6b72dbe6bb48a0f3e633e1
74710 F20101114_AACCGS tain_y_Page_086.jpg
ebc6f379fe6b44192e3ed394cefddcb4
ad8ab5a0aaad134eac1d6b37927bd30f82d6be02
3010 F20101114_AACDKK tain_y_Page_075thm.jpg
92fa5ce1084cbd84cffea79713204734
141a6dbeb1313c2cdecfce3d32d25382c615fe98
6406 F20101114_AACDJV tain_y_Page_064thm.jpg
e4050ba1047dba3bba2fe75eca51eecf
7049cd46f3020226f55de39620c214c958a239f4
118801 F20101114_AACCHI tain_y_Page_047.jp2
32ddaea748a14d5f581e26d7ca9912f7
188ff2c228bcbc893b71fd3d7f5b91f4a802799e
F20101114_AACCGT tain_y_Page_025.tif
ba653c7fd91a963e72cb65bca6e2d872
761f01610ac483f6102a58d24ee34c38e89d10dc
2287 F20101114_AACDKL tain_y_Page_076thm.jpg
7f206ff67a7e9a11ded074c90be0d18a
5d2b8781d2d264d2e2172cc95085376d3b710095
26452 F20101114_AACDJW tain_y_Page_064.QC.jpg
43ff525da123a4dd02ecd91f099315af
61d284fa7cfbfa45fb6d9dfe1e3757d22bdcd172
103746 F20101114_AACCHJ tain_y_Page_100.jp2
f6d1ad4cdddf9caa9c1d4bb46b3d9545
605a1e2b5b58a55c8ec690f06aebcc1039083560
95626 F20101114_AACCGU tain_y_Page_105.jp2
df928e2b8d91876f0ef5723c38e0a60b
c0c5509a2a569ce89a8dd6e263d5392c9e149b1a
23521 F20101114_AACDLA tain_y_Page_086.QC.jpg
0cdceed8fe0aa114fbe5d05b9c850730
5306e2de9f342daff30876291415d6f9e142c182
7337 F20101114_AACDKM tain_y_Page_076.QC.jpg
6c0746a38410eaaa7a49dac1883344e2
302a3d26a2ed94c473af25189de9c20edda10ae7
26159 F20101114_AACDJX tain_y_Page_065.QC.jpg
23164305226bf5b03de3b6041b87a7e6
2154e058931c44ec15752b432cc39b87cf2f4a1b
F20101114_AACCHK tain_y_Page_122.tif
be65dc4fdb5388f62f74d5a49003a1c4
b825dd4fb23f36c93052111b114da748a0eee9cd
530 F20101114_AACCGV tain_y_Page_060.txt
04c58b5cd963ed5ed62ff393051044aa
2067a7821fe04b6c02fcf08c4c4c76e06a939589
10050 F20101114_AACDLB tain_y_Page_088.QC.jpg
122a033994421200fbd8bbdbd39de58f
9873d1656b55bda29ece93ceca6567532c50889d
2534 F20101114_AACDKN tain_y_Page_077thm.jpg
b074e8cde8854943f9f7210708355059
267d3aed1543f459fc50d73ce1c281cf4d4008b9
5843 F20101114_AACDJY tain_y_Page_066thm.jpg
a63143968ff44b6b558be89433261da0
858170c9e7470494275f82f0d2ef2a19159c05b6
27373 F20101114_AACCHL tain_y_Page_095.jpg
758b3e9ce2804d399d4a54e0ff37211f
b72cd5aad93970f4c69ae372629158ae31874ee2
2044 F20101114_AACCGW tain_y_Page_050.txt
42f69d91616f107dfbc7caf7ab594d04
ce88f3e7211cefaaf4981cce2b76129cd497b0c4
2906 F20101114_AACDLC tain_y_Page_089thm.jpg
716d82fee0232530bd41da0bc57b9ef9
3a1d39a4790e8b0a7cf142e2138f44763fad5058
8437 F20101114_AACDKO tain_y_Page_077.QC.jpg
9abd62a7181fdb84cc97b15f2b590570
7b3f39e3ad3cf2841bd13d3a27b5cd8458879ed4
25881 F20101114_AACDJZ tain_y_Page_066.QC.jpg
b1919d912ae7ac9b0741ec9e172d7f56
470a74a1c13d52e5d3bff38ef4bca36e85c029c5
90930 F20101114_AACCHM tain_y_Page_083.jpg
212a448ff76605e1337811a617941b98
9d3747f2550d323fe94cded0f186ca472e32589d
6682 F20101114_AACCGX tain_y_Page_121thm.jpg
e0c4ad343320e6f7baaab881fd2f0d87
ac54a8e493ce2da9101e0ef7ca7748cb886cefa7
82702 F20101114_AACCIA tain_y_Page_067.jpg
e7da8517ec61c725d8ea86c1b5a51d81
9928036b4b3062fc1d946af45afc7e37828bcc29
9187 F20101114_AACDLD tain_y_Page_089.QC.jpg
bec991691e8c32d6e13916e8fbfc176b
413f5a18043857c46fe9240b4ee76228802054f1
28541 F20101114_AACDKP tain_y_Page_079.QC.jpg
cbd07119abc6376db033b2a11fc30d7a
2a09a0353667021251501d1a7ecfe7f4070e6c96
8828 F20101114_AACCHN tain_y_Page_056.QC.jpg
e818397513a469d0ca068ecde2e55b2b
684ea0ce10dc3e7fdc24c1ffae0c58d7432d2131
44963 F20101114_AACCGY tain_y_Page_061.pro
88a3de91e568884461eca4e485c80000
a3db3be8ff42920be9d1ddc227d68713d8d1c64b
51667 F20101114_AACCIB tain_y_Page_046.pro
28f59b06ce5f2933b296f342fb00b6ec
1a71dde4e4af93a442b656b4b2ac7a95dabb470c
2207 F20101114_AACDLE tain_y_Page_090thm.jpg
583b59e9b3deab0046042c524609f32e
805d94971a03fa1e778dd41b5707e614ace6e4ea
107115 F20101114_AACCGZ tain_y_Page_134.jpg
08679561e8a66b40ffdba67f2c5e3b70
0a06634d98d3a7b9f87a9f9664cac96e792c38e0
30402 F20101114_AACCIC tain_y_Page_109.jpg
19cd7542605fd0321b5138f84271a54c
3362fdeff9b7c975da28740592ecf64bcb2b3b9b
7031 F20101114_AACDLF tain_y_Page_090.QC.jpg
50d5d425fcf29bf4bfbf6efbd29b0f87
b04365a93c1968e8298ee6177371817250c1749d
6639 F20101114_AACDKQ tain_y_Page_080thm.jpg
eeb5a73779cdb67f260057fe32133b88
be2c07c16a6b30b8cb3692806df43cb846f58db5
31610 F20101114_AACCHO tain_y_Page_133.QC.jpg
12e7ac4dc4b4391811ccd286e708101f
7a242c291e1648a12d13ac41805d397aabd6f94e
F20101114_AACCID tain_y_Page_045.tif
d871e5a1eaebd2baa7da2d203c5a31fc
db38d1d57d769bd3b879fc19283b0e6e06ccee85
2685 F20101114_AACDLG tain_y_Page_091thm.jpg
3872568d9828faa183db403076da1b19
0d74aae8ee1fc08625d52d9f23f2ada4e893bed6
29083 F20101114_AACDKR tain_y_Page_080.QC.jpg
089f60015f333632b5b416c594b36b2b
457eeb15770cfd801b0e6ecea2ddd21d0baa7c09
4721 F20101114_AACCHP tain_y_Page_004thm.jpg
e849eeb95c4bfaf59da6a3cb05af7bc9
2f889da54e4e14373c89104b87dd185b0690257a
F20101114_AACCIE tain_y_Page_072.tif
4b54bd48060ca25b9d06e3c34ec84f33
a77bb1665606511a7f6ed5ccb25e77774c529036
9182 F20101114_AACDLH tain_y_Page_091.QC.jpg
16ff208d4b75ce931c6d659ac7b5cd90
477b834032de55f87184cc359fcae337af343b0d
F20101114_AACDKS tain_y_Page_081thm.jpg
751ccacf6493f9113d08bc91bb4d3ef3
935aa6c588986749e8d7232e16eac463cd49f50e
100527 F20101114_AACCHQ tain_y_Page_031.jp2
b84666e18b5f79e598ed48e1587d32ff
18107a84d630b3b96e5f5e0b51a3c22c168d778a
F20101114_AACCIF tain_y_Page_104.txt
04d118dffcf7193fa669f06428d6bbfc
c7181e50fa0a66de2a0f06d07fa541a0ad98d534
9599 F20101114_AACDLI tain_y_Page_092.QC.jpg
bac3a2966efb6b00322c005564fb559a
6cbbb488f8433b35132ea7c4a76b07980d402076
28300 F20101114_AACDKT tain_y_Page_081.QC.jpg
fd915d8ef2c49dc661e64f465a0a0425
7ba5a0de619e15a2f1531a143abbab29f1af8281
90886 F20101114_AACCIG tain_y_Page_124.jpg
f796db521010cf54f0b047b9a57b26d6
270ed910441e6c83d1227a30f0d5a51ad420e1d8
F20101114_AACCHR tain_y_Page_092thm.jpg
6a9aaf4d89d0934ad4bb274d0173e29c
d4d36c65ec4026e619ed7c58779bb8e1c988e5ac
2375 F20101114_AACDLJ tain_y_Page_093thm.jpg
2489e16575b2899efa21c07091652a7f
ed8177d1bbbf3cd2b26e7dcea076efa2bac5fa87
6640 F20101114_AACDKU tain_y_Page_082thm.jpg
c198881ceb1bbbe7420c09a693dac23e
edbb683bb6f8bfeeedc76159198d2166119dedc8
109052 F20101114_AACCIH tain_y_Page_026.jp2
a9d9dbdf2c625d3c9322ced4b22d908f
9524334efe8dee9457c81956a7fbec7923e13ac6
F20101114_AACCHS tain_y_Page_033.tif
0b1871aa4051bd60aa2271f67171d4e9
4fbd21f21e730d4fd82c185b18c829f95c930a09
7736 F20101114_AACDLK tain_y_Page_093.QC.jpg
85bf31502aa67ca4020623b8b604ce92
82e9e1996ecb8dbb9b91f366e4281292d4f51eb5
6781 F20101114_AACDKV tain_y_Page_083thm.jpg
a661f949bada6b687abec7473ffc19b3
d9f6a7c75557e212557dc323ec3cf814d2680f7a
2082 F20101114_AACCII tain_y_Page_033.txt
7935ca26a2dc08a1229c402fe6f2bac2
79482c0f1c0ee2b32d976fcb866014fc0b538214
107144 F20101114_AACCHT tain_y_Page_116.jp2
0c81b65f104151e411857521f608f05c
797bf9f31d03fae9b13fa0c39a977b79ecb03efb
3957 F20101114_AACDLL tain_y_Page_094thm.jpg
7b216f14cc9466b347a68b9b803e49fb
db6cb475847588caf9a17ca513bfd0b614d4977c
28196 F20101114_AACDKW tain_y_Page_083.QC.jpg
4ba2957ed001a544191ec1a1acb6e979
d542981f41f140e1ba21db992a75027f504f1e13
26568 F20101114_AACCIJ tain_y_Page_114.jpg
65ddfebed25732f6e19c1f72d01ff1d4
ba24054d8a6e60bfce1242862c52ecb8e225036d
28638 F20101114_AACCHU tain_y_Page_037.QC.jpg
78167736d6bb90f620b170315b9e04f5
27ce65c266dae181456be41b8ccdaf74624159b3
13005 F20101114_AACDMA tain_y_Page_106.QC.jpg
ef91303966c1246c4b9adc74f2e0619c
6387bff946ae98d520bc216305ea4013cef6b407
F20101114_AACDLM tain_y_Page_095thm.jpg
5b771452440ba2c91b6b6c80c67e268b
9fa500612281e0724228650f6708fe2076c919c9
6490 F20101114_AACDKX tain_y_Page_084thm.jpg
5785f6a7f849592a7a22e800ab46378e
851c4995005208f8535ea983336d5851987025b6
2101 F20101114_AACCIK tain_y_Page_084.txt
d6bcc34a5d6c41043974a4c9c9d727d5
e0928e52583e31e94065d6acb6f0e02d857d1ef7
6604 F20101114_AACCHV tain_y_Page_036thm.jpg
7c9b6f28811a09594bfdd495fc5e86a0
36ca9339b1208af6d6991fe41484e3f2156db771
2818 F20101114_AACDMB tain_y_Page_107thm.jpg
e51607a43892537854ac0e07c18d156c
e1fa607f932009d973bda6a90a31fb0772d1dff9
9053 F20101114_AACDLN tain_y_Page_095.QC.jpg
fe52ba09b1d3d72a5848e141fb98cc80
7bef4ea1a0ca43515a60318f17bb4097f0b4d915
27928 F20101114_AACDKY tain_y_Page_084.QC.jpg
8d6f37d2afe1b601c66f8d5d054af415
8f8b505c972400bb3d7651e909ead9c1f02dc200
100835 F20101114_AACCIL tain_y_Page_030.jp2
8e1cad15838ef50f1f3c8547be0d98cf
a32c7d53a81453792f31ede6162f6a2a86320664
423580 F20101114_AACCHW tain_y_Page_110.jp2
5481ce10afe5f331355d16b55381f7e8
6678b16adef03c9631e60aefe67e3b64c1ec3acf
2984 F20101114_AACDMC tain_y_Page_109thm.jpg
3755c73f4d953cead25963b06767d2cf
bad1397e6e4f86cee670cc7113ec008724816900
6784 F20101114_AACDLO tain_y_Page_096thm.jpg
5b19f86d0a0a105ad4d091ade9a6d131
c670c0283a610ce3b0bc960ad4ca352bc5733821
27923 F20101114_AACDKZ tain_y_Page_085.QC.jpg
dff816fa9c175c2f78cd58a208dfdfc8
28b1e540ef2c60f922a0216cec524223d602ff0d
F20101114_AACCJA tain_y_Page_058.tif
6e224e7260513d55bd70baa4eea29b4a
4b3e06891fa7c5e89f17c0d2dd5d52d274c1bcea
7157 F20101114_AACCIM tain_y_Page_054.QC.jpg
f6a3a554b967ed793b004eb4f521f60e
3891ec3cc2d2b029f32c8d6d7cfb60a551ba8e46
14628 F20101114_AACCHX tain_y_Page_130.pro
c1ddc1d7f6ff8cbcfb4a02132705d3c4
34af3e1f73977a63e1d78b2f25900b0d3291ebcd
9652 F20101114_AACDMD tain_y_Page_109.QC.jpg
dc8fd699885becacf88580353b5da9b1
c10c5450cac1b8303c8e6af1a3c54268a66c8f67
28874 F20101114_AACDLP tain_y_Page_096.QC.jpg
6b2c14dc0ecb023d9a030bb4484648b3
c1631dbe6310380420d8a332dba6353473110f9d
549 F20101114_AACCJB tain_y_Page_042.txt
27312f55cbc7cdef72d3cfbb5a3ae29f
926216714cd1ae81b43c9969a0eceb055727aa28
33980 F20101114_AACCIN tain_y_Page_130.jpg
0aff74f586d5afb766ecbbe0750e4781
368b355c19d8cc6321317f71b652294ce7fa10bf
F20101114_AACCHY tain_y_Page_038.tif
938e20a7880259c296888960fdb93cce
17cc41f01b01d0de12b787cea8c674caedaa2ed6
1700 F20101114_AACDME tain_y_Page_111thm.jpg
a625fce1e6564486255d65ebcf85892b
4071d50ae782aa71eddcfcbe37eef5a16aa03e44
6418 F20101114_AACDLQ tain_y_Page_099thm.jpg
086e5bde31c784650a2e501d7d4fbddb
5eda059caf4d4b4d71b137f58cee029984c45b04
6746 F20101114_AACCJC tain_y_Page_102thm.jpg
ce02b84e7813dd99dacb0d8bd90ae085
e97c108475f3668fee1fb4a3a7b41bd455863350
1444 F20101114_AACCIO tain_y_Page_108.txt
20161ab65a88a0882c1687fb2e8795cc
5df0bd9551b72d12a4205896d84f3f97b8c50919
86779 F20101114_AACCHZ tain_y_Page_048.jpg
866ede6baa9de922f15134542e3457cc
25b7fff52c7cad7b9decc3b32a9acd0dd9065443
5178 F20101114_AACDMF tain_y_Page_111.QC.jpg
cb470f763822b404cffd6b14e1218594
c077552d358349d362780ff90fc606a0180c7565
2099 F20101114_AACCJD tain_y_Page_118.txt
6c10f7aec6e362bc6d907c97eed99a22
a859ce57213ded146dd43753fd979a173dcfd235
5152 F20101114_AACDMG tain_y_Page_112thm.jpg
b5bc86ed7102dcf9f21eda074d364c60
8e7b18fccfc7b3fb8d4dcabf21ddf4bab6891a6d
6175 F20101114_AACDLR tain_y_Page_100thm.jpg
f86299fe757baf3e02f7c9b390ba5730
60ada6f738c90a03e7be176d3b9a9cf40d6ff0f1
24579 F20101114_AACCJE tain_y_Page_030.QC.jpg
2fc69c80dd4615e1cabec393177173a8
178eb0b5745e8b87b8ec761c6e3c84e9acc6cd27
2522 F20101114_AACCIP tain_y_Page_134.txt
ee4e5e183275a307a87fd3c538de0306
060f8289d70fa14365994b38bd55536c4b8156f1
15206 F20101114_AACDMH tain_y_Page_112.QC.jpg
f930e15fa50f50814840029787a5055e
7d3cc26c99754c3c04df855ab3637384c8de2a34
26150 F20101114_AACDLS tain_y_Page_100.QC.jpg
a5a388e0774e4a9e453ca165fb4db213
545ef80f77378174a337caaef7c0087b7f026d2c
90428 F20101114_AACCJF tain_y_Page_082.jpg
8405d9cec9cebe1c6e24b721fd623ba7
fb6a32a98e1132baed43feac39119b142a0d18f9
31259 F20101114_AACCIQ tain_y_Page_140.QC.jpg
199e38f58cd1736a3611f20ed33b393e
b469879985b9cf548ff4941c5ca00f7454c91972
1767 F20101114_AACDMI tain_y_Page_113thm.jpg
aa888a1ef2ee7e5455b50f53022efc5d
16a55d006efcd2c5c96ba0835c2fca0333ef64ce
29668 F20101114_AACDLT tain_y_Page_101.QC.jpg
c879712bfcc3e53bcbe04a858f5c3cc2
438b920345eaf0b92b6f5b6da17fe55fa586727d
90100 F20101114_AACCJG tain_y_Page_084.jpg
91e2229068da36aa07b0bbede77f3d64
9a9c84848d3861f125ba64e501180564239a8253
2714 F20101114_AACCIR tain_y_Page_009.txt
ea78bc6ab12a5064ea7c704da1fb3b7e
3d7251147795268c4d846cff343ec1278c89c06c
4990 F20101114_AACDMJ tain_y_Page_113.QC.jpg
3138fdb478489b2a6e24088f3a2f84d5
17e9611d7a644088be47b453eaef614ae9aecb26
6920 F20101114_AACDLU tain_y_Page_103thm.jpg
ef87dd2e37d1660178630162b6d3e044
95a897eabf11fbce12fbeff637a34427a5adb575
88305 F20101114_AACCJH tain_y_Page_046.jpg
2960d2a84e1c5dcf8265ca483b47fc0a
24d7f327023eff1056d4f0017cfddefb946f59af
2085 F20101114_AACCIS tain_y_Page_085.txt
0d7589923eb84d8f222f9ad43c91d45a
c0b4709cb5a5ff932b0a4a9869a44dcf1f4935ad
3540 F20101114_AACDMK tain_y_Page_114thm.jpg
1fdab8f0935ff5dfb3383b60f59c501a
53e3ee883232b7a2c27cfee97821d1bdd236a02f
29401 F20101114_AACDLV tain_y_Page_103.QC.jpg
7918b1d73857738cf1e6ca808f5c286d
278eb88bba3036004eccc3b0d37be4b761463a3a
116515 F20101114_AACCJI tain_y_Page_033.jp2
4b4c687a01c153536e5dfd943da36e7b
f849c1344768c2ce40be40565661f5c1fdef12f6
78656 F20101114_AACCIT tain_y_Page_061.jpg
9a4e92b6d8c3bde0a2bf08d591a4bb80
e72b3cbd8a4ba885275b73271cf041ea511835c4
9103 F20101114_AACDML tain_y_Page_114.QC.jpg
810f561c59a767a50ee1ec480ad19c85
7c2ccfa3230422427956bc28d4e85600a416bda0
6763 F20101114_AACDLW tain_y_Page_104thm.jpg
7dee822c7c193d27b3ae7e3174b43b56
3321769cbcad580ddbf172015b342fd674ee9c71
116627 F20101114_AACCJJ tain_y_Page_101.jp2
2a95ae199bcaf6112e78ba1138b3e0b2
25b2a57bea74c6c82ff6f6b0ddc75c755e050433
12761 F20101114_AACCIU tain_y_Page_094.QC.jpg
4359bcf23f5d265b637b083da2ac5d62
21f1f6e5645c9b42bf3e07cf15d06d12e186f038
27426 F20101114_AACDNA tain_y_Page_125.QC.jpg
4d35b842bbe6b14c21fe7027bf68653e
c5d89ba427f6b4daff1e65c3ee3067bd89cccd4b
6939 F20101114_AACDMM tain_y_Page_117thm.jpg
38a17691015f8961f5d51b4090784546
beb9900d5d8496d1a8e0a72f1127e12326526cf7
27894 F20101114_AACDLX tain_y_Page_104.QC.jpg
f815560fb0c6892fafbf250377cb5016
1f8caf239d4565258472c45b017e964d60b1edc5
54700 F20101114_AACCJK tain_y_Page_143.pro
8fef8f6bab60d9bce8325a82cdb91979
4fdfc7488341a7b78b1be5ebdb49423e64568734
F20101114_AACCIV tain_y_Page_123.tif
af141caed79a84dc59d9518b2df7a2c7
98cb2b11b22543041d0dd0acf7f2aa05cb9dc51f
6851 F20101114_AACDNB tain_y_Page_126thm.jpg
c902af28cf9cf1ed96bb69c2d3417dca
2e30e11c467dd2f3845e69893de0599482378180
29152 F20101114_AACDMN tain_y_Page_117.QC.jpg
d0e499a8fa137cd14a025d00f1e9a3f2
11c641212076919cebe94a3cc448397a409b1845
5451 F20101114_AACDLY tain_y_Page_105thm.jpg
a154ee6b638b08f901565c48a332e61f
9f41c122e01bbc66d6c57e1ac1062421f2027d8e
117821 F20101114_AACCJL tain_y_Page_038.jp2
50b026f09933ee593877aa96bf7fc4c8
98dd9c89be05e2a109aa02f7ba4d44764a5173d3
83492 F20101114_AACCIW tain_y_Page_068.jp2
a4a33be39d078b1ede28f21bed9c8ff8
8ca07b6d893497ced9d275f33e7f2cd4464f6b6c
29865 F20101114_AACDNC tain_y_Page_126.QC.jpg
0956ef4c11d454962f7b7544b59d8daf
c6d8aee083f0034a8ad25cc51a98eeb79212fc28
6824 F20101114_AACDMO tain_y_Page_118thm.jpg
099cc4b4f3c889c637e1a3b62cc9df2e
73e7028d6a5b6a53f838d9020335e894bbcd3e6d
23578 F20101114_AACDLZ tain_y_Page_105.QC.jpg
3b84839f8cc6ebddedc50a2767383f94
96ae5380494e093b2a1a87fac350b81c9312823d
90 F20101114_AACCJM tain_y_Page_002.txt
275f6ed300a6c2157d569cef53e85ff6
c5ee4806efef81cb53aef35b345408cc351c22cb
19684 F20101114_AACCIX tain_y_Page_055.pro
365fe1d1a1ececd17d7aec09e645b9f9
8d7a5299c56c107e87f8c664a9bf50dcba4f8cc6
92030 F20101114_AACCKA tain_y_Page_101.jpg
3f70d5b0e802d2225bc4ecfd5ed04e82
4570b37406529426ab65312586e24422efbf8490
9602 F20101114_AACDND tain_y_Page_128.QC.jpg
d3dc73a4e18b77f5779484e903dbdbf7
7ba3a080207fc63688393fc35deadb9651c684fd
28664 F20101114_AACDMP tain_y_Page_118.QC.jpg
6d45cc991bafb25914326f97c8b657cd
fce0c0e6c0d336338eaef35e5c5e0fde20531294
3508 F20101114_AACCJN tain_y_Page_110thm.jpg
c7334efedbc89ccf3ab14293e528528f
6dd2ccb60462690e457fe5780176ea320698342b
F20101114_AACCIY tain_y_Page_097.tif
cbc897686a6521c58fd1b75b0f78bda7
01ee55906dd6db912f04cf1e32bdc7ab006ac08d
36334 F20101114_AACCKB tain_y_Page_091.jp2
bc743645f9caa8c604ad23540e45380d
1bd3c333599b89358d1ac3004e124786bc91426a
11444 F20101114_AACDNE tain_y_Page_129.QC.jpg
649350aca92a7e6dba728a518ce23ff2
3b2c33560d6f2cc1c91d52abdf91520e243c4d48
6346 F20101114_AACDMQ tain_y_Page_119thm.jpg
2c2726d8967ac21252474d53a70873a6
1f48b478f2523d4a34e6d3d66a989c67b7257220
29201 F20101114_AACCJO tain_y_Page_082.QC.jpg
e714dc386eba0d4b1cd95627780fd692
2d96530c08806d9660e3c6020435c7090964428c
6270 F20101114_AACCIZ tain_y_Page_065thm.jpg
d824ba14bd81abd02396de24513012a0
830631732ca77b557791fa26a7aee37542bf981a
F20101114_AACCKC tain_y_Page_069.tif
6fed6c2e0869debfb46fe37d03445aef
3d230f59f7febc20f1c1a58a77f9592f902e6389
9848 F20101114_AACDNF tain_y_Page_130.QC.jpg
acc9f3aa07f6d48dc2018aa186a422f0
f40f9f4ddc7af38dac2706e0f2725fb60e8211cc
28286 F20101114_AACDMR tain_y_Page_119.QC.jpg
5b77bf6d651a323732e0ba881a4e6221
18f10bf5d12bb5f392664ee4d7189c303cd03c1c
59645 F20101114_AACCJP tain_y_Page_106.jp2
9e6053df85e02252ef7437cb8e3a22c0
cd4834d45be838ce8f77795e35b64b91bd6a5ef5
52544 F20101114_AACCKD tain_y_Page_119.pro
9f90795420c23d52ae7c0c974bf6ecfa
bd4a1cc1f9a8a6c890c55ad2f4344cf3bc9dbe25
7160 F20101114_AACDNG tain_y_Page_131thm.jpg
e8c0187ee164fcf5a09b1a9fe7a426de
0cde4a7a2ab9a5727904ec501035065396640b55
650 F20101114_AACCKE tain_y_Page_089.txt
cbd3725ae0e42fb0ab1fcdaf9831cbf0
e11b85d90d51fc5230cd30d2288697fbf4530e40
7236 F20101114_AACDNH tain_y_Page_132thm.jpg
0234df70e08cb0f4823ab61700a6a23e
0417d57ed325b2795a459e6ebaa2255b8779f3c1
28346 F20101114_AACDMS tain_y_Page_120.QC.jpg
f9f1a4e6034945eb6aad7fffccb8f531
5254a01ee16c4b379fad6f773c278c9a7f2c5309
21354 F20101114_AACCJQ tain_y_Page_053.pro
1b7eae05b3688b65a8da9aaf1566d72e
0b19a8a61e24346f0dc9ac9a538057628a046a85
48747 F20101114_AACCKF tain_y_Page_053.jp2
52c4d6ce5bc925571feefc992330e164
b03579fe6747945da07aa2bca23de419c6dcb9b6
32639 F20101114_AACDNI tain_y_Page_132.QC.jpg
a12c5241a30415b0bffd2dc36e0d9cd7
d17b43e22094c708b9257b38d3d82e0fff47634c
27799 F20101114_AACDMT tain_y_Page_121.QC.jpg
198273afec463dbb4839efbb7e78a7e1
2f85f2752d891bf5a5d566a353179a7a378fddea
6741 F20101114_AACCJR tain_y_Page_079thm.jpg
30d9b805847646f879ca64f595807bc4
e9f5237e0a7efdd11e2f7e17db3962c0cca5df67
6549 F20101114_AACCKG tain_y_Page_046thm.jpg
635736bfb42c9ea0a55fc7b8ed0f5499
b221b345d891119c10cfc6013f3c390b2dcbde03
7223 F20101114_AACDNJ tain_y_Page_135thm.jpg
812a250cb818d584bf3ad048973bc00a
3a5f816d713ec98c1836b29b85dd2344aa363fa0
6838 F20101114_AACDMU tain_y_Page_122thm.jpg
77738f3d6d845bbfdaff4538599a8d32
f96c670608b85e16118b95418062d235bee39194
9363 F20101114_AACCJS tain_y_Page_129.pro
21278f6cd07a6f9cadf230cdd9229ae1
52bd1266072e47fb223135a0dccc68f0e9c03216
68766 F20101114_AACCKH tain_y_Page_144.jpg
8916ec946ceec9a0316b11850b4eb212
1d7260a3be089104534f03ba765ce4a5cfce1ebd
30642 F20101114_AACDNK tain_y_Page_135.QC.jpg
7ac9e511859f4cc7dfd91787ff28abc3
b65c17a8c708e16d92ffa5f0a147a9b721697828
28804 F20101114_AACDMV tain_y_Page_122.QC.jpg
70992621a685d232907b1fd8d7db3ac3
566e1148335fd52afd406f7e6a1da62594e16ff3
53816 F20101114_AACCJT tain_y_Page_079.pro
64f09e84c2f5c39835599235d369be14
c1de9eb543f7b35bced7cb0d3227b52267dd7463
F20101114_AACCKI tain_y_Page_138.tif
5570aa7494c7f644784b741d5f9de203
27f96bc9b57e455d06fca353252c96ef66f23176
7755 F20101114_AACDNL tain_y_Page_136thm.jpg
3be5204ec41a42bf888810e607ff4f09
a69f593304c0288b1c2a8f88764c0be95a58081f
6950 F20101114_AACDMW tain_y_Page_123thm.jpg
3df3c35af71e40137a8d1b67450cf02f
4538b1c1377ee97f8d357520ac9995116f8a0c79
14602 F20101114_AACCJU tain_y_Page_008.QC.jpg
b35133bf17cdd2a0c2e5651858abb2b6
4fee0cc1092312e36f27af7e52574a15cf1b93fc
2024 F20101114_AACCKJ tain_y_Page_121.txt
6a587e32a62c5c3c887cec0ca89d119c
7b1f869bff396377da665a4f2fbdf866d6c557c1
32730 F20101114_AACDNM tain_y_Page_136.QC.jpg
b7be945ccf5a9eccc83faffec166382e
fe9c6c6927c25307889ff620b4933f302f5cae2b
31935 F20101114_AACDMX tain_y_Page_123.QC.jpg
572cbaebe5c94df4976369a4aa2129b2
141d6f2eaf19589d0a3dc5100222f72a05fbeca0
135 F20101114_AACCJV tain_y_Page_003.txt
20c0573bc820bf9c46077ffe4dd37e10
663783f7b1d453a50dca48e8f0747618deb4a6fa
F20101114_AACCKK tain_y_Page_141.tif
aee6510419b4179ef756a66f343cb13b
443701f37f29b21a541f495b31c846745c0ed047
7726 F20101114_AACDNN tain_y_Page_137thm.jpg
b7eb5ac8078af22984f81888d8bb4605
b7314589a295a2f94b6de239d4ef553437bdd617
6710 F20101114_AACDMY tain_y_Page_124thm.jpg
5a003618cb5129da6bd20f02c5529cf6
c9433b2b78ce385036c0763661686c6358f70de7
2604 F20101114_AACCJW tain_y_Page_128thm.jpg
12068dd735d103b421e2d03fea139068
daa96d338c7ffbc8c6fbd014c78133ab87d48506
118916 F20101114_AACCKL tain_y_Page_080.jp2
16226ef9d39376a1c4395eef3c158d1d
b2db30c20f7a3bc5c22ffd1764476ee0d7c9b501
32539 F20101114_AACDNO tain_y_Page_137.QC.jpg
61fed112cd3039e03e0502fadfc52870
c7f37ccabadf35f2dfc98ef60daab0afbf8f2cfe
6347 F20101114_AACDMZ tain_y_Page_125thm.jpg
98177069edf2d6bd37ed84c244308c62
632cb35fbb8328edaf6c8ebd1116e3720a54b2b6
F20101114_AACCJX tain_y_Page_040.tif
216ecab82198795209c653f7e60cf17e
9c51d1696aa3140acf7fd9d36fbc7b2eb29842a9
F20101114_AACCLA tain_y_Page_047.tif
69c959b054daecc7f2faea91204d9f36
60387274e9a19136626f53d0a1c04daa6b9d90bc
F20101114_AACCKM tain_y_Page_066.tif
834b0256bc04d542174a3b507569d4df
45606b75af1c63f92fc0595230db89dbf9d7efda
7839 F20101114_AACDNP tain_y_Page_138thm.jpg
93dbc51eb16a53bf22cd6ea9f6540124
11c6c132ad7e1efd6c128f835ef1696c5dc7b34f
84436 F20101114_AACCJY tain_y_Page_035.jpg
f11a4c65db829e071b8080e3e5645c1d
b5f94fa849a7a800de001c9e22e50354f647a4a9
31536 F20101114_AACCLB tain_y_Page_087.jpg
fbc1c8688f7b2f88edc7a3b79f4c5a77
d6e83d1b6898e95b0f22335d0368c489091f4263
2626 F20101114_AACCKN tain_y_Page_132.txt
3d7bc28127325b8f61f1a683d18163fa
922db0bb24ad2ef62f7fe0443428e3dcc00a701d
32179 F20101114_AACDNQ tain_y_Page_139.QC.jpg
24c0eb3631862037c985dcb2ee71cc0d
230706883604a3233e438e0f7197f93804911d79
6443 F20101114_AACCJZ tain_y_Page_020thm.jpg
e161de46e1557da138e2d5ff3d500308
a002a2e61ffbff259be5b2f66c0758afb078eeaa
7125 F20101114_AACCLC tain_y_Page_139thm.jpg
43bef66d9568bb67e51333a4e8e19a5c
dbdbe7221027a3c820a2c94713401fbc7cbefe19
1051983 F20101114_AACCKO tain_y_Page_007.jp2
d665501297d0048dd3edbae3895b298f
b74fd1caa09d06c6921a8787c9f3bb0341e7c4dd
7458 F20101114_AACDNR tain_y_Page_140thm.jpg
d48ef618b7d94b7df2d357f2a906aff5
35eb5c492ff8bbacf2ab422c3ce7aef1e1dd3e38
24053 F20101114_AACCLD tain_y_Page_006.QC.jpg
6a111fc7aedb38898beb704ae435ca94
b88a2ca73c5058c093ba0ea85119abd60d73c012
7459 F20101114_AACCKP tain_y_Page_058.pro
2d5885ad46b80f6300043c4360b7ac7f
27fc62dd957f69f9d85b833031a695aa3221b8d3
31607 F20101114_AACDNS tain_y_Page_141.QC.jpg
77f4c6a182a7add2c03e895feb3ab544
3893b469fe1ec412bf683901c4b076b842912483
1051952 F20101114_AACCLE tain_y_Page_009.jp2
1870610b7e21c2b761be653f74e5669f
f75d5a5bd5fa7b99c8c769d0f852ac42bb1f2a5f
32318 F20101114_AACCKQ tain_y_Page_088.jpg
e3ed225c509c811dbebe8902eac22a74
0d485dd0d28b8b4f55c7fb618735efeebaa60c92
1810 F20101114_AACCLF tain_y_Page_069thm.jpg
828694b2128d6981d7b453af1e78677f
d828c5a45f04c0d24e234974103347e2414e1f65
7733 F20101114_AACDNT tain_y_Page_142thm.jpg
b21512426d043ab0b7637ad05207b906
47f30b83530d2f8fc0fd6811f183db513bf92d42
112216 F20101114_AACCLG tain_y_Page_099.jp2
e2296bfc0397957562eda9fe7c9b63c1
c8e5b15315493e60a46ba8dfdc6b19dba9ee3283
249 F20101114_AACCKR tain_y_Page_113.txt
53ae985f496f21911fa5d097b9b2471a
c49683a396194842f9c9ef7434ec37af848c9c54
31284 F20101114_AACDNU tain_y_Page_142.QC.jpg
32805bd5527fac1045e63d7c752a21ee
6b8e2bf09f22068830a14e332b0d767291cf18e0
2481 F20101114_AACCLH tain_y_Page_131.txt
4170387a066d53376b9dbb4e8202ce93
a4b0abdec20682fd699d7eb3923f1e6d7c1e06da
89158 F20101114_AACCKS tain_y_Page_019.jpg
c477af2080ba310df4f153a26a3877f8
905ec103c895761ddc16669efe0e772b5a812fb4
6432 F20101114_AACDNV tain_y_Page_143thm.jpg
284673d0d4842257c2225341fd459f86
e32583685cffe331b2cf7b6973819fa29ffdf068
33805 F20101114_AACCLI tain_y_Page_022.jpg
702f02e0dcd5df0d4d6133d18a0a0d6f
78656d601182295379e6ba06ba083d34dd946b60
91834 F20101114_AACCKT tain_y_Page_080.jpg
dd3f412340f71e6dc6be50374a907d1a
3209cdbcfc2cb066a8419d37d005e918a7e8b5ec
5007 F20101114_AACDNW tain_y_Page_144thm.jpg
88a4e7786ddb728ffd1d06c271cc4823
7a6f241155aadae1e682e5647f548fa8b46efdb6
F20101114_AACCLJ tain_y_Page_119.tif
1152b52590dbacfea8599ca01d49e0c1
8d4f846900d5975909c810d9931d3edd62693bfe
27499 F20101114_AACCKU tain_y_Page_098.QC.jpg
d5c8f5c0775a1ac5ecff58ce17fb4323
75b83b34a96cfe71da36e2bbbf9dc98203280793
21125 F20101114_AACDNX tain_y_Page_144.QC.jpg
4852719b2dcf9a1e534488384f0585bb
a84b39c716f01267e9c57cfa1f3d899593c4f619
3259 F20101114_AACCLK tain_y_Page_011thm.jpg
af90184836cfa278f0588600f3acb185
c7416eab72ea10c362db3a629c073ccab3f26376
8293 F20101114_AACCKV tain_y_Page_076.pro
f98858e2cf4b6fea0b732c21c29e16e1
895b6c514ac0834f829e31b387efcfb073dd1119
165034 F20101114_AACDNY UFE0021590_00001.mets FULL
91d571507ef7f76dbe945d9be0166da8
6cf82f79e659847cde64b7ddfc9456a55ae15d36
67988 F20101114_AACCLL tain_y_Page_133.pro
f369898af0f869dfd8c1c5e50d5c8a99
fb0dd271c15ac4621dc1e540bcdedb80a759031d
F20101114_AACCKW tain_y_Page_011.tif
a391998ca2f736080831a544afe462cb
1c231c3ad437332c0171afe4b7c918a12f64641b
8886 F20101114_AACCMA tain_y_Page_041.QC.jpg
2898e3205becba76f1e8604a9defd2c1
66bd7ac0e946528c695fd4c4f4d020af923b3cbf
F20101114_AACCLM tain_y_Page_094.tif
59cb4671c42c6e04ae9931f87ebdf8fc
e9c6351cb8bebc598a236f942bc867a518283fce
40625 F20101114_AACCKX tain_y_Page_107.jpg
725d646c479c0ad34fac59213c5161ee
8240536330785c54a535aa20128e282f51fd6b89
F20101114_AACCMB tain_y_Page_134thm.jpg
0bc81fa89682a053aef5a85569bf4546
ec4debd8f1e52f018d64ae9526361c5e1754a09d
1687 F20101114_AACCLN tain_y_Page_086.txt
099c76d8614a185d3f53cb19fc85b497
0e1d8403fc0e5b9ffebae31ea9fb6e696a463526
2142 F20101114_AACCKY tain_y_Page_080.txt
ddbff5ccbb7c3d411bd1bc41acecacf6
04de5843f7f4f86d564689fe870273ab2b36aec3
450 F20101114_AACCMC tain_y_Page_109.txt
e3f3cdbf1b46f74b3807fb07b5298163
409f37a33d0099e18a0c3d2e7f08fcd8c5497a68
843 F20101114_AACCLO tain_y_Page_094.txt
27c7d53d39d14fa7384a6cfa10670ab7
53610bea2986febab7eba3eeb756436a036b2fab
11595 F20101114_AACCKZ tain_y_Page_107.QC.jpg
f1a727f0506d326caf66a037eb94ab10
ad93e6812e2d31b6d4135a34de1ed2fe5cd267f6
F20101114_AACCMD tain_y_Page_006.tif
b55b018dbce89bc4c51b3c381eb3e4a9
01d86158172b8cc2ef545ad792d3d99ccaee49af
F20101114_AACCLP tain_y_Page_089.jpg
a475ab724c54cfe4ec974502c5582062
83fc5b57e5acd9c275f3fd2bfcc0169ae205e5ec
32291 F20101114_AACCME tain_y_Page_039.pro
686fdbfbcdb8664aa31669760a7d6da5
9a4ef12f81827c7d3e5353cd23d8c81e3cc9d618
11615 F20101114_AACCLQ tain_y_Page_060.pro
b1c744e706b904f9cf95161df8465030
68b24139c61abf95399c146a3e114c9b0ee0329e
6451 F20101114_AACCMF tain_y_Page_051thm.jpg
2b17bc3ac2d28bc2e090c99f6e30173b
43b7f0a020b71048ba6a2fcec08fca9e499d310d
2124 F20101114_AACCLR tain_y_Page_052thm.jpg
808a64e9c660a48a0b32a94323034496
cdf9547126a172be9e37f96843ada188cc6d4dd4
419644 F20101114_AACCMG tain_y_Page_129.jp2
85baf4f64dceda9dc58490867a9e5d37
18c65a7b779c676246578b38a30e7ef2b92bb1bb
F20101114_AACCMH tain_y_Page_103.tif
c7b2e0771ba740a49dd59974ac91f1e6
ccd9a73a8a8b6293d50c6c857dc6384d183aee3a
41723 F20101114_AACCLS tain_y_Page_022.jp2
353000a6dd4be824155980cd8cdb332b
1107b3fd40cf6ce14541f8fe7435a07c1b1009b8
F20101114_AACCMI tain_y_Page_026.txt
fcb9ad46012b8dc64f4ca7d23f19daa5
b58bce966d0e26385551f58acf580255787f2402
765 F20101114_AACCLT tain_y_Page_057.txt
e5d63b292f82f686d92aeb2aa2b4e396
e94002be051933227e9ea6bbe9c375e527291a6f
F20101114_AACCMJ tain_y_Page_081.tif
8c86b34fa5d263c01d7199dd3479679f
ef2bd94e15a291017368b1b582814fd4c8ab2695
F20101114_AACCLU tain_y_Page_098.txt
94d156c964db82cdff3dbf7357acb06a
5d28c2d6f43dab194fb5a3360faf01a6739490c4
F20101114_AACCMK tain_y_Page_122.txt
97e8605a04ca598eca8ed506ae1f8766
c3d28a4719698a5b7f0820903a7d007293c03475
F20101114_AACCLV tain_y_Page_080.tif
37feb7876907f1fc3b2aaf5769d2d739
9334ed66aad34fbd7fa8e17380b52a386be90e86
53900 F20101114_AACCML tain_y_Page_062.pro
6e9f9820b0f215b252ff2b4d65edc934
9f9baa8f8200e6ee3ea993abbd80c0450afb066d
F20101114_AACCLW tain_y_Page_063.tif
7f4341c71bde6934ccbb18c9a031bd09
ef5cdd56a4a791a47c9c6a3216afb752528d6024
37751 F20101114_AACCMM tain_y_Page_068.pro
d3e5d8b07fec53af9c306577b9d3b0e3
df894759a0eb291f7ebb06cc530e359df0abc436
109576 F20101114_AACCLX tain_y_Page_051.jp2
87f8441d9ac208255a103bc58ece7bc9
399880894bda0d40ef32eab1491e4010feded0e1
6235 F20101114_AACCNA tain_y_Page_026thm.jpg
eac4c8eb9ce0eea08875bf3e3efc6a57
2248da730618598a3cf0d7101c2b6fa5ff450da8
6921 F20101114_AACCMN tain_y_Page_097thm.jpg
176dc9fbc0703397839b053f1b506c6a
4af89dea639b884dd297166fd6fad15b6b5ae726
6430 F20101114_AACCLY tain_y_Page_015thm.jpg
344d55c09a7609f3f5d7af6c57700252
eab25ec740b4e97bc354eef13507d230e810dcd5
2630 F20101114_AACCNB tain_y_Page_041thm.jpg
e758637ba36a42d1ed5da490d345b04c
806187d9289c1dfd8b05af51e977c5bd6486e067
14550 F20101114_AACCMO tain_y_Page_071.QC.jpg
a2849ea2a52acdbe1b31142d46afe9f9
eab069e131feb23e3dfdb644a7999ef3b8d8cc5d
40949 F20101114_AACCLZ tain_y_Page_040.pro
34473f061a92fbe2da24e241043e6e09
17db1ad20dbf894eefd2494724027afa54892a8c
649 F20101114_AACCNC tain_y_Page_052.txt
74a99b86ac710e15ac9744cc1b834d14
97bdd19c247617daa3727689e5bc54696d14a963
2210 F20101114_AACCND tain_y_Page_103.txt
048bc337f0abecba3f963eaa09628510
a2c6e1b2bcc37cd4697bc405b97e393ecc17c597
2911 F20101114_AACCMP tain_y_Page_056thm.jpg
ecdf87973a79d83815c031f3e37ba620
b8817b20b8c977c9302344354b7d01210e05273a
47284 F20101114_AACCNE tain_y_Page_035.pro
dd54316675990a4583d744a81ea9a1c9
0427d370a64a083785ef7be5b9f5af005868c758
6712 F20101114_AACCMQ tain_y_Page_037thm.jpg
27996653a04744d62cdd0cec644d7f65
163d86283f467de33600c0d0e1fe876180b16b73
2600 F20101114_AACCNF tain_y_Page_141.txt
c0d57df5ef8c3560675797db15ac4ba7
ec7c4ca5abd02bbb20cf02e289d0856e17c2b391
2628 F20101114_AACCMR tain_y_Page_130thm.jpg
cf03afd5a7d95097447a55b4940d6e4a
b2b016d9e3263837b8506a1722243639ad984168
3366 F20101114_AACCNG tain_y_Page_071thm.jpg
6cefb6bfa5ec8115c87d8d2fc3e25d45
35737c70ec76d1433b17a95aeafcd4908d67f910
437 F20101114_AACCMS tain_y_Page_002thm.jpg
076a6a9780bc2965d72e59388f6795af
c0fd33f5d599d5e25b0138b4111dbba8df13e9b9
2165 F20101114_AACCNH tain_y_Page_126.txt
297d3c09fc088e7a39952d09d41d44f6
64665417d4408004a528e9881d05f8a0888ef7bd
6500 F20101114_AACCNI tain_y_Page_116thm.jpg
602f38860551a19c6125a4f16d63c569
0f24670d8ad9bcc5620406f4d9a263d6f085bd2c
599594 F20101114_AACCMT tain_y_Page_043.jp2
53d3f9f3386d5ce169e16f83154c5b4f
cad3c0c6349cac6c6e9154aec1c433c63474ffd2
6726 F20101114_AACCNJ tain_y_Page_017thm.jpg
44c1a305b98c152ecb41225e25caa2f0
a2e1c75bcbead3a9ac42c22189438253244668d0
26760 F20101114_AACCMU tain_y_Page_143.QC.jpg
dd28af0bebd8ee1e6562e3299befe5f5
242603d29b97b4a018b249263c2af5545ec912f5
F20101114_AACCNK tain_y_Page_113.tif
d3708c37d222e3ce10ece7a1db108255
7fd8dad051f4bc84061de80a3a7c43a7f10e5d93
29261 F20101114_AACCMV tain_y_Page_124.QC.jpg
ad7a9e31f864f1825386d8d8b807e78e
19179181897413c27045b1c305687435298a5815
53016 F20101114_AACCNL tain_y_Page_033.pro
76fde80c63cf91102136b15f0b2143fc
ec0c89ad6302c31ba5073ec51bcdb58af3f2601e
160709 F20101114_AACCMW tain_y_Page_113.jp2
6ac536699546a314734b49478e11ca85
6626f3fe827b6cd72739fb7fed6cab91ccfddc1f
88170 F20101114_AACCOA tain_y_Page_005.jpg
5ef55877d6abd58a61a55b0176f5797d
6832389e0589b24aaf3a65a91f0fbd91c3d44861
92787 F20101114_AACCNM tain_y_Page_025.jp2
7e3ef38f4eaa5559073b22b4b56c71b2
9b4121504baa4512ea5ba6d471dca46b2529c9bc
142855 F20101114_AACCMX tain_y_Page_132.jp2
664e50968baafedc8f1056cc3e931768
060036589821cb9b193a29d0a6451ee0f8af4e49
106590 F20101114_AACCOB tain_y_Page_006.jpg
40cb3e53cba8220b9910097616533266
05210f85fca584203b5048693e4b787120f1ed9e
28658 F20101114_AACCNN tain_y_Page_078.QC.jpg
1b2ce18d9493086a57285b9afa0313f4
29aa4afc873bb2e333b118710eba8b8a68ef8255
109138 F20101114_AACCMY tain_y_Page_021.jpg
7f3ee568eaab0569d917fcb68becd66a
32e10bc094d9283e5fa8be0684c46aee7bf410e6
91586 F20101114_AACCOC tain_y_Page_007.jpg
6b1ca4e054c79cc1f3c07941200be1be
3f4d58aa05a0750cb4428dbf244d0392091845ab
F20101114_AACCNO tain_y_Page_127.tif
8a6f06adabc449e8a3540324b00168d1
c692b3c1e3450d3991af365454e64c7938adfeeb
44145 F20101114_AACCMZ tain_y_Page_030.pro
19044764f4b5edd346d26c0940e79694
c092e88d6d06a75f11e9bb37bd79df8c1af05796
52147 F20101114_AACCOD tain_y_Page_008.jpg
f736d24ec19f2d3c5ab36af04c386fee
7825204c48c3d925e73b10c61d8777a5be55674e
18473 F20101114_AACCNP tain_y_Page_011.pro
5a99e2884767356009d0fe63fb70a2ca
5076b45edbb6b1eda00870db624665c6895514f9
103478 F20101114_AACCOE tain_y_Page_009.jpg
78deedfe08e6485e20fe184e1f35413d
2525ff189d3175856c4aba42f52196531e965720
572 F20101114_AACCNQ tain_y_Page_058.txt
e5180b9f0bb8128f84825426a9391b86
7089b3d96b7260a41ca675688e0923fda5123f17
95848 F20101114_AACCOF tain_y_Page_010.jpg
f5da053d7e6b21942d3862843e278f51
a49b698c6ff3d5ee1654cc387316abe8f7c1bcae
9425 F20101114_AACCNR tain_y_Page_024.pro
9a92429123a263cd47259788fe9e6cf2
98cda5bd7eb567add0e50dc18764498acdec27d9
36873 F20101114_AACCOG tain_y_Page_011.jpg
9dbb5d3866fab4d9dc7055070f89c7df
4726b192df89b508e9e803f441d1e61b4efad7c8
111578 F20101114_AACCNS tain_y_Page_140.jpg
bbecdc666afb92f8454e3bc554aad7d3
b8755156e3305d5dc86180fe9f6b5ddc8de1bf84
83122 F20101114_AACCOH tain_y_Page_012.jpg
cd867e921345c69789c70f04bae44bfa
62bcf6d7bc314caa81d4f7b8fcbff3163b1b1411
213487 F20101114_AACCNT UFE0021590_00001.xml
b6301b5ccda3fc26ecbee67199aaffd8
55b064df0723721ed83b930b14dbe77db1584fa2
36898 F20101114_AACCOI tain_y_Page_013.jpg
cd43b15d55dde74b9e4f06583eb65273
03bca775c88ade6ae9fb2fe17813bdac138ccac7
82115 F20101114_AACCOJ tain_y_Page_014.jpg
ccdbbeb1662a831af813dab7d5f142ac
8f6a11b0fb41181b0807d5c4d6af21f330960cd1
86807 F20101114_AACCOK tain_y_Page_015.jpg
e2e39074746830d766b0ae5fad6ca2cf
cc0ffc0a63a932aa7e60767ef1ef77cf1144ccd2
95692 F20101114_AACCOL tain_y_Page_016.jpg
e0bfcabc473bd43674847d2ef5fffd2a
4ed5baf981de07a0ab8db88c98b5324d3b1ee99c
26870 F20101114_AACCNW tain_y_Page_001.jpg
0d929ab7c69b33c8e666855ea6ae3702
c78aba08ec9d89d037e763e048188662c464cba0
94818 F20101114_AACCOM tain_y_Page_017.jpg
4f08c08c925e517fd850720111599bcd
7126fbae0e24b0035ad0752e048109abd53fbb76
3468 F20101114_AACCNX tain_y_Page_002.jpg
3076c4d1d4a7983c19026529ee240838
cd22c9874a572f32ce6d083f2ea5815e7de10a6b
89468 F20101114_AACCPA tain_y_Page_037.jpg
7aec60c67c97ad67e6dd0714dfd37b74
fee33164cead39bf127e0a0ba2f09885b6bc5813
92622 F20101114_AACCON tain_y_Page_018.jpg
aecad56f38918004a2dc5d7751953ce4
ac915d3a828e00042c2e180142ca3d9852c59540
5790 F20101114_AACCNY tain_y_Page_003.jpg
72bdcbc3441b254ccaf3e4225a00590c
28bd51cd5668fb2c273665570d04f4109d8007f2
91609 F20101114_AACCPB tain_y_Page_038.jpg
468cc695358e224eef2116b113427d56
1c445351b4fbcc7685f89fac04fa828ba3a41458
91303 F20101114_AACCOO tain_y_Page_020.jpg
0aa0e2896ffe475cff1d86ab05f219be
8b433fb2dd03b6bc46fb69cc618563ba753c7caf
62657 F20101114_AACCNZ tain_y_Page_004.jpg
1d115f54123d65c66a846acd3666ef99
8849b36dfd97da6ead2452e51a7594849601ca7c
57675 F20101114_AACCPC tain_y_Page_039.jpg
8db457b9bc670c5e3a282c7353da9713
a8fd3cc0071d4edab32647e49450440c5ed3a3de
21898 F20101114_AACCOP tain_y_Page_024.jpg
c2d2f7da6abeb0daffd85c6de0064bfe
bdcd6ed4fe12e7fb1bd919097f81a728d764437c
72127 F20101114_AACCPD tain_y_Page_040.jpg
f16ae02936de36b97c79de9cc3ca96e3
9fd35e8cffd57b6f2cad05383279605dc651866a
72123 F20101114_AACCOQ tain_y_Page_025.jpg
694a0ea81c386a5b4be35a29dd609cbe
83f7eddc8a5bb882baae5d3746770b0d89060836
28617 F20101114_AACCPE tain_y_Page_041.jpg
fe795b136956aa5606734e4316e334e9
c4a50958c35a48bc8c0026f02cc247da3fba39c6
84091 F20101114_AACCOR tain_y_Page_026.jpg
b416df4c4dea30aff8d638d94183d69d
a41d2ae4330b5f3e7ce41550fb06377e0a0272b5
36553 F20101114_AACCPF tain_y_Page_042.jpg
4540e5ff714c0635e19fa4bc37c3660e
fd8e522256426b5efb41ad02f1079cdf3cc16ea5
89336 F20101114_AACCOS tain_y_Page_027.jpg
93cda55077f4432081a285c42e6a7d4c
25d0099f0835e54346d87b8216e4938502de694e
43421 F20101114_AACCPG tain_y_Page_043.jpg
7329bb988936e9f192ee1494ab125067
aa3a64c9deef685c747a7a9003566ed098cd8616
91208 F20101114_AACCOT tain_y_Page_028.jpg
9e0abcb47b312c4c30be327797be8e7f
c55e9c1bd75379c81695fd6ec8ac411c4a379bbb
91442 F20101114_AACCPH tain_y_Page_044.jpg
4d6e1d339208d61b80b495c8ce0f6d24
41d41d4f9f3837c8125524cb9ed9ba100e7e0d6d
90825 F20101114_AACCOU tain_y_Page_029.jpg
7112671764a97dac3ba936bdd3cbac01
dd1976b22cd69f54daf95f913d72165777366d5e
90136 F20101114_AACCPI tain_y_Page_045.jpg
3d1ca8174ed8c145130344a1c50988ae
31fde351173affc72b38b6e06adcae9e6471557e
90587 F20101114_AACCPJ tain_y_Page_047.jpg
19138f40d9f0732d6d1714931962dfa8
55bade69d89621ae984e834af1c86af9a482b020
77792 F20101114_AACCOV tain_y_Page_030.jpg
69d2b529a3b03afe14585d5e36e57a6d
b036479ac682c509f2f90b04ade1aff0399f79f3
88367 F20101114_AACCPK tain_y_Page_050.jpg
4e25d86e03a71570f2bd9950c6d78cdd
3499bf85cae30ab52b447924b02e00322a0e219f
77410 F20101114_AACCOW tain_y_Page_031.jpg
59b67fe079008950e253e3edbc52b831
bf8e84afafc71dce31545b890ca3374438c1e5d7
85827 F20101114_AACCPL tain_y_Page_051.jpg
af31b3326c3585b4ef7cb68b374b8095
5d174bbec4fa98415f1e5ca80a5cedf14e2d112e
91841 F20101114_AACCOX tain_y_Page_032.jpg
5ff8f622ac7823f6a44c88cca42017c6
99d3fbe67e623a80104b33cb08a342b770f92edf
29132 F20101114_AACCQA tain_y_Page_074.jpg
578c0e6ff18777b6fd0a6d575420d7a2
9e0d79cd81644b43b38b30d0d8ad7a8288eb8e53
39423 F20101114_AACCPM tain_y_Page_053.jpg
8adcc54175f878cd80f8b171f6f70c98
28245e061cf5afa2d0b753372b3d2a35cb4294ff
87816 F20101114_AACCOY tain_y_Page_034.jpg
d5f18e48d42830f51e39d43d94ed785d
667e028defc87edfb971aea52b6a89c5ea5811f4
30298 F20101114_AACCQB tain_y_Page_075.jpg
5dd3fc79dc6ffe9b95ed78013ad654a5
20bc87292d0ac1eab5dee5986ea5f38f572f91d6
22056 F20101114_AACCPN tain_y_Page_054.jpg
8edc0095e6e80e7e17852cd489adb347
a41da627f3d9c0d64475acc89243ff09b524fecb
88653 F20101114_AACCOZ tain_y_Page_036.jpg
cc82bb476d6f827610a9e9e23eb698fe
0a9413789f6ff9820699a0caa642b4be8bb9e423
27020 F20101114_AACCQC tain_y_Page_077.jpg
a376d1a49b856b3320e92bbbf6330c02
f748a098cacb0070761190b5837fc69659a54050
40127 F20101114_AACCPO tain_y_Page_055.jpg
2a5c8442245b4d4178ceaafbaf51c7d4
a6e23433dcbb1a3d31ba86ea82776d8cf96359ce
90858 F20101114_AACCQD tain_y_Page_078.jpg
f9e1f165280ac0234776aa4824ddc907
4315c11fafc1134408606760f751103d47d94553
25637 F20101114_AACCPP tain_y_Page_056.jpg
3c71ae40ba1128513582df0d459286e5
198bc53752147141de718c4edcabfcd021ff705c
89312 F20101114_AACCQE tain_y_Page_081.jpg
3fc8aabfda403315d228914237658933
15fa010981c179128b87bf7fffac9e3fbf2d6590
23761 F20101114_AACCPQ tain_y_Page_059.jpg
5f4c5ed85a3d18c88d0c0f80a1d86958
38c5dfe631c6f34fa62f28185220ad3a4e752776
88048 F20101114_AACCQF tain_y_Page_085.jpg
67f828d93601407ba4fa8a225f2fff63
532a11d173fa751d05519197978a77ae6282bb27
28895 F20101114_AACCPR tain_y_Page_060.jpg
0ab91cba98854e42f44f56d5860d8f7d
13ffcd0ed61860ccb6fb0db340c9a20309b3b73f
30807 F20101114_AACCQG tain_y_Page_091.jpg
cd52d95badf42f93855ef3671e801fb7
ec1a6f07010c48175c1bf2e1e616be3960c824f4
87280 F20101114_AACCPS tain_y_Page_063.jpg
00d413f71105047c1968f93b1257ea52
1c711312b1bdd2fa4358e7afa94ae33291dfc37b
30012 F20101114_AACCQH tain_y_Page_092.jpg
db26db9999870751fa64109269ef51d9
707bfa978ee38d8d6ddc557d89532a98a9124306
83240 F20101114_AACCPT tain_y_Page_064.jpg
81be4fd5a801fb12e0ff1b01e7b4fbfe
9cea9eb4100fda4768a68f8b0b7410e4e3dadcb3
24907 F20101114_AACCQI tain_y_Page_093.jpg
442c5fc93bcb897ab81a803ac5b36cca
b0bbbc723c22321e66cfb9b96f0f2af7b3875d50
64548 F20101114_AACCPU tain_y_Page_068.jpg
a6d23dd8fc5dd48e90ccce8d784f9ade
0d172508269ddab6dbebb893bf63f2a4af496593
39100 F20101114_AACCQJ tain_y_Page_094.jpg
ec8b3b23d3bcca7ccab57510980ac27f
e9d57521f4626fae0bd8713e654feae612c5e089
24804 F20101114_AACCPV tain_y_Page_069.jpg
e3771d40e8159a41d7cc2ce9bdd84dd0
43f2f63ce695afc72b64aad0f20e6aca874f33a3
92176 F20101114_AACCQK tain_y_Page_096.jpg
cccd5bcb88b68d37cdb2b95c0d6ffeac
8b8b2845f936119074f332e43e0e15d4a409b0fd
95573 F20101114_AACCQL tain_y_Page_097.jpg
d6be31a66f55fa68a17d6cb52af8a832
4c555e9bcdfddbb175b36a08ed2c5fcd0b9da04e
83022 F20101114_AACCPW tain_y_Page_070.jpg
71d9642f1d00f8b7f337bfaad6ae3893
b3ced48c57708558b6e8811df1c1cc5115d299a7
91350 F20101114_AACCRA tain_y_Page_118.jpg
1d063649746c57d3f7815e3243286b23
0559bd5ade87c7355160ca4e31cecbdce1d22dea
87994 F20101114_AACCQM tain_y_Page_098.jpg
66e4679729809f5461b669cb6f6f7548
3d33d3d1709beeb6b9ba4b0b06d38e72db1aa965
54046 F20101114_AACCPX tain_y_Page_071.jpg
d56d696f2c2a9c5081131864db6818e8
a0d5b47af79891c83b4f19bc367155847efe9fcb
89663 F20101114_AACCRB tain_y_Page_119.jpg
7080d4acc776f00e9436d5c7e75b2557
6d5f2644d99f2fdcf8aed6602f81439a436d3a01
86676 F20101114_AACCQN tain_y_Page_099.jpg
4212712e438f1938c8b0e1a087eeda46
77a5eadd9f30692eb857b9d0f36d7dddc8a0a32c
25271 F20101114_AACCPY tain_y_Page_072.jpg
2824def8f47264288b28e128c5fddc96
66590c108fe55ee845b2cd7d4312cbc826e6517a
91457 F20101114_AACCRC tain_y_Page_122.jpg
96da974e866ae6e24fc75c632dc1fda6
67adfb7e65d8f173f617e87806d41cd7e2999a3c
80386 F20101114_AACCQO tain_y_Page_100.jpg
8be8787e627d378431ca1612486c532d
e4a496183529bea2b09b3a433332b1d615288a22
29572 F20101114_AACCPZ tain_y_Page_073.jpg
d5b4327c746eacec8bf305110cb05ea5
df5dd6af9985cd83f1b5abe4706aee7311984dba
99850 F20101114_AACCRD tain_y_Page_123.jpg
a1728e3b678f33399e3bd292c86ed3d6
66908656d9c4dd06ac4e27ea2bb0b361b6584636
94112 F20101114_AACCQP tain_y_Page_103.jpg
2cc9a52e2b4fdaab07d2aa360f3b80ce
8fc7338f132e3a74177f482aa3f6bac4d0c1388c
87351 F20101114_AACCRE tain_y_Page_125.jpg
8eb82bfff173510a60cf2853c51a6369
fde71e7b3f8b329773f8aded8fc7353412f19977
89699 F20101114_AACCQQ tain_y_Page_104.jpg
6664a13b2e563fca84bda820f9b5129b
451e33330d82e6f319cb4af2d92e7e0a74961d98
93845 F20101114_AACCRF tain_y_Page_126.jpg
eb4f36e51098d51a816dc66fdb10bb5e
35794e22bac04e0eb82c79c3f5388ed68ac9a7a5
47749 F20101114_AACCQR tain_y_Page_106.jpg
210da3286718e72e124693c793a7028c
a0ebd3430365f96f0d49ac149db38ef93139a4cb
28737 F20101114_AACCRG tain_y_Page_128.jpg
635274d8c8b62c82d22971d80a39e6d9
473deda67ae1eaa7a9db1c34ab9d2aefa90b4b62
54465 F20101114_AACCQS tain_y_Page_108.jpg
9aa7d491b3e93aa86106c5656071c16e
875c48858a6195dcfed33dc44f8162ae563a0813
34230 F20101114_AACCRH tain_y_Page_129.jpg
d4218bd28347f5cf423127eef55ea0d9
81330ba2f40d94d5adab7068389845be177eb475
34988 F20101114_AACCQT tain_y_Page_110.jpg
22e3ddb00a29a1af4b8ccd27a8a82574
3fed6d8b043fdd2d934ac09025032877c9228261
115594 F20101114_AACCRI tain_y_Page_132.jpg
2008ac0c0bf34bcaab07b8ec773bb96a
a767e6358ce8f5c139773e724fceec4e9abdfdce
14512 F20101114_AACCQU tain_y_Page_111.jpg
ee638c588db4c007b38d6a1fd503e3f3
580eeea6fd6f377958d6ace0a569354baba8b6e8
113595 F20101114_AACCRJ tain_y_Page_133.jpg
7f7b44960fbe94b176485eff806e2c4e
a5f35436b0b4cf4157d9fb4f6f9115eeabf19549
46059 F20101114_AACCQV tain_y_Page_112.jpg
757f9c82fe8d068866f6885991e97fb3
446c1449d708db4257644c500925bba98a3ac462
107625 F20101114_AACCRK tain_y_Page_135.jpg
347f73c7e2e8ff1efc63a8954b0ccbdf
1d668e5d4703c9017e7b919bfab2fcdf0e5823b5
14032 F20101114_AACCQW tain_y_Page_113.jpg
0d75e778c74efd033d2e737a5690b624
a8da9f2b1cbcbc50f9f386cf242435ff5a678160
116867 F20101114_AACCRL tain_y_Page_136.jpg
027c7f43e1073f4ce5180400b87b8ead
37ea83f4891756bd41f021167d2152910d06f654
21386 F20101114_AACCQX tain_y_Page_115.jpg
0a9a01ea26b8a6f75f0f3f507fcf9e51
c4e70a22c2463cae1d3a9be27cb64d016d47c39c
104434 F20101114_AACCSA tain_y_Page_012.jp2
37722097eee16769f54d997f96fa36b2
35e16eb31f2534f861b507f7f35bcab7a49b3233
116260 F20101114_AACCRM tain_y_Page_137.jpg
6b61023a40386480b89a2a18692fc4eb
1e4ae81345dd23594be9b9dbc36762c274ced902
82234 F20101114_AACCQY tain_y_Page_116.jpg
ab2829c7a9f9b9f24bdf2520b55e614d
c37a2193479e1d199700364704de1bef6f56106b
47896 F20101114_AACCSB tain_y_Page_013.jp2
8cf2115c7f44e2f83200bc72b137e1a4
acd62c9c3411c8ae563d17e1cbaca65b4c4de770
116297 F20101114_AACCRN tain_y_Page_139.jpg
bab8ff628ab0d5d95947de9b06ff7d81
b1cbe82f55d8c68a46ae31269a49c7e5d6d46127
92676 F20101114_AACCQZ tain_y_Page_117.jpg
89c990ded66c1076b03dd031d10bfaf0
ade1f10b91c18717939508b799092a511f77d450
104132 F20101114_AACCSC tain_y_Page_014.jp2
1406f5084a7377b0846e9ea21f920f2d
794c539ebb22156c2bdff43296dace847f2f308e
112000 F20101114_AACCRO tain_y_Page_141.jpg
07c5a44a06de483c148b5073dc1f1508
a16126c3ad670aa83b86257d404b216c3b8ee9e4
122324 F20101114_AACCSD tain_y_Page_016.jp2
5e9d0cafcbd3d3f9dc42cd2b4f3c5dfb
3429c639b8a5be2abf70f7c015d0e82529bbee2e
111720 F20101114_AACCRP tain_y_Page_142.jpg
b6a8b40553700fe0b5cc704bd44cb8c1
bd3003ff13606f2f709567c90591f72618572d6f
120539 F20101114_AACCSE tain_y_Page_018.jp2
6bc5d244f19d8be821211a2db67cd82e
b4a5e936a6f01ee55b8ee2b84803754b24c85328
94539 F20101114_AACCRQ tain_y_Page_143.jpg
e76d288f447b25f0737293f7e41e9647
6d50ea9289054201ffee6719cf03898bdeb57460
116803 F20101114_AACCSF tain_y_Page_020.jp2
79bbcb01c3e7e5f8afa24ca43cd2f88c
a45952fa7debbd77407a15ecbe8addc4c0b591e7
28923 F20101114_AACCRR tain_y_Page_001.jp2
a6541b8e5aaf94ae3788e954216b1a2b
242b6a1de505d73fa37276488028f1840496a623
139073 F20101114_AACCSG tain_y_Page_021.jp2
489614a929c259a5325454d08cac0838
835736bc883aa8438236abf9108a2a79a439f4d7
4775 F20101114_AACCRS tain_y_Page_002.jp2
1b645c29188838dff84ef65c0e796b6d
a13a10b5f18b786e751b84a657fdb862f7b31548
747815 F20101114_AACCSH tain_y_Page_023.jp2
364f98437ca260a0fa9c1635a677a71c
114a4773c45bbbdfc3b8fc812ff38074c4c35892
7584 F20101114_AACCRT tain_y_Page_003.jp2
eae49f2f3d8468cb7380eec39d20169e
8b47d2e213f3c9e0dd883b66e3dbfb4b7fca877d
26795 F20101114_AACCSI tain_y_Page_024.jp2
c3849211f4c986703006388b9f038f00
db0e59fb9237c0e41d9ca2880ab4f25a4467a8ef
80713 F20101114_AACCRU tain_y_Page_004.jp2
5a831be8107ad12b84b18ff75551f461
cda4a0bbb4a07e414671181aacca1e05c21c48bb
115993 F20101114_AACCSJ tain_y_Page_027.jp2
47535fc360ad6c1a87aeb0bd38a4c279
d69f62284afe9edafc46d5ec9e18ce00f68a33c3
1051974 F20101114_AACCRV tain_y_Page_005.jp2
e67ac2f08111a3aac1b800f89f3f1501
85899226d69c169e1a7d123a1f8afff24950847c
118609 F20101114_AACCSK tain_y_Page_028.jp2
35f8b3577731272130646b3560b79d30
a5a035476a4da3a690415326bebb5d86245f03a6
1051978 F20101114_AACCRW tain_y_Page_006.jp2
3ef15c2eba6faae606d6ef1eb720dbb2
439851700d3a10a6ba6e59cc01a93e5fcc283715
117045 F20101114_AACCSL tain_y_Page_029.jp2
2fe3e04ab1ce3977e381f3e459457e0f
e883bf92056cea51eb0962f968d12df59f4c4b4d
1051960 F20101114_AACCRX tain_y_Page_008.jp2
5cf2d2701ee9f2b39dfa3d79d16fd5af
c8ab3afdd888ca1622ac501d2d6ca22dcb33937d
268004 F20101114_AACCTA tain_y_Page_056.jp2
66f149e28287afe58e51b1bf7529f5c8
f17572c5e5c574bc6f3b487064a0b2662424c7f0
117366 F20101114_AACCSM tain_y_Page_032.jp2
bd189106478240df8837200ccf596c68
ab0aa2f6779c4fa3bb1b9cd080d76d92146cf687
583095 F20101114_AACCTB tain_y_Page_057.jp2
206fba0375b5ba637141856c1699fe00
59db1b80a243cc920dc1fbf383aeb2916296d6bd
114513 F20101114_AACCSN tain_y_Page_034.jp2
3789be397fc8f7f5a3a89b5c625a5bb8
5088f628ddd1bb6f426db43bb46d2b215775e21d
1051984 F20101114_AACCRY tain_y_Page_010.jp2
38f5e98d86b5a51021d325d1d899fdf4
70ba578051c6a8e9796913f6252de6560bc864fa
221309 F20101114_AACCTC tain_y_Page_058.jp2
69f9b7a57380a1a8d85ad4e3795f46c9
2d74a202d6a585af8b7d7921c0ab56ce0f76e881
113630 F20101114_AACCSO tain_y_Page_036.jp2
4cde26fed963aa6a326f1a2d508e4317
5f43f6faae44cf8db8712afe7d99655c37ddde23
47836 F20101114_AACCRZ tain_y_Page_011.jp2
606a19440f6e0c7590c1ef17d97ab671
24b7d6f28bc7663ad1c636a8cc5075ee2d0794f3
262693 F20101114_AACCTD tain_y_Page_059.jp2
cfe978a55ed7287a4e5516971670d647
5c7755e726671f76d7014931bf0c27f194d32e82
115440 F20101114_AACCSP tain_y_Page_037.jp2
4d96d82421672e7a73cb6c2cf63d5020
8ee8e9c2536b2b6e9034cdb9ce5cc546337b20d6
32909 F20101114_AACCTE tain_y_Page_060.jp2
f22517526e9d7f611e9822e16f37a5d7
b475f2a99016fc1deaa052243f4f492e3ecdce6f
73845 F20101114_AACCSQ tain_y_Page_039.jp2
b010e316d611121e99ff74e6c3a97b4c
31e0cb3e7b5b4fb50c6c8153dca64a8e6b97535d
101920 F20101114_AACCTF tain_y_Page_061.jp2
36333888f71ee2f8625a1606390f40bb
d85ea9b84ea6299682fd20fb77124f7f5f6db704
93102 F20101114_AACCSR tain_y_Page_040.jp2
b10c6f73c8e42dc56c2f3e1cd0d8261c
716dfd148f58678d42a51e431f0496c39b66f8b0
107886 F20101114_AACCTG tain_y_Page_064.jp2
541f0c0346cf0e80a77e1fcc4a105a05
64bd6402a87a0f8cbec50bfc3a2849fa2fb032c5
624474 F20101114_AACCSS tain_y_Page_042.jp2
ebe17334739838c38a9c806a888dcf9e
d60cbb7e0f43227ace3141df79f051249b062401







NITRIC OXIDE DEFICIENCY IN CHRONIC KIDNEY DISEASE: LINTKS AMONG
NEURONAL NITRIC OXIDE SYNTHASE, OXIDATIVE STRESS, AND ASYMMETRIC
DIMETHYLARGININE (ADMA)




















By

YOU-LINT TAIN


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA

2007




































O 2007 You-Lin Tain


































This dissertation is dedication to my family for their constant love









ACKNOWLEDGMENTS

This dissertation would not have been possible without the support of many people. Many

thanks go to my adviser: Dr. Chris Baylis gave me the chance to work on many proj ects and also

gave me numerous valuable comments for my manuscripts.

I would like to thank my committee members for their guidance and valuable comments:

Dr. Richard Johnson, Dr. Mohan Raizada, and Dr. Mark Segal. I thanks also go to the Chang

Gung Memorial Hospital for awarding me a fellowship, providing me with the financial means

to complete this dissertation.

I am grateful to many persons who shared their technical assistance and experience,

especially Dr. Verlander and Dr. Chang (University of Florida), Dr. Muller and Dr. Szabo

(Semmelweis University, Hungary), Dr. Griendling and Dr. Dikalova (Emory University), and

Dr. Merchant and Dr. Klein (University of Louisville).

Next, I would like to thank all of the members of Dr. Baylis lab, both past and present,

with whom I have been fortunate enough to work: Dr. Aaron Erdely, Gerry Freshour, Kevin

Engels, Lennie Samsell, Dr. Sarah Knight, Dr. Cheryl Smith, Dr. Jenny Sasser, Harold Snellen,

Bruce Cunningham, Gin-Fu Chen, and Natasha Moningka. I will miss all of them.

Finally, thanks go to my wife, CN, and numerous friends who endured this long process

with me, always offering support and love.












TABLE OF CONTENTS


page

ACKNOWLEDGMENTS .............. ...............4.....


LIST OF TABLES ................ ...............8............ ....


LIST OF FIGURES .............. ...............9.....


AB S TRAC T ............._. .......... ..............._ 12...


CHAPTER


1 INTRODUCTION ................. ...............14.......... ......


O verview ................. .... ........ ........... ......... ............1
Chronic Kidney Disease Is a Global Challenge ................... ...... ............1
Nitric Oxide Deficiency Is a Common Mechanism of CKD Progression....................... 14
Neuronal Nitric Oxide Synthase .................. ... ....... .... ... ......... ....... ........1
Role of Renal Cortical Neuronal Nitric Oxide Synthase in Chronic Kidney Disease
Progres si on.................. ... ... ....... ........... ................1
Neuronal Nitric Oxide Synthase Isoforms in the Kidney ................. .......................16
Regulation of Neuronal Nitric Oxide Synthase Expression .........._..._.. ....._...... ........17
Oxidative Stress and Asymmetric Dimethylarginine .............. ...............18....
Role of Oxidative Stress in Chronic Kidney Disease ................. .......... ...............18
Role of Asymmetric Dimethylarginine in Chronic Kidney Disease ............. ..............18
Obj ective ................. ...............20___ .......

2 GENERAL METHODS .............. ...............25....


Animal Model s ....................... ...............25
Abl ation/infarction Model .............. ...............25....
5/6 Nephrectomy Model ........._._ ...... .... ...............25...
Renal Transplantation Model .............. ...............25....
Tissue Harvest ........._._ ...... .__ ...............26....
Biochemical Analysis ........._.._.. ...._... ...............26....
Nitric Oxide Assay .................. ...............26..
Nitric Oxide Synthase Activity .............. ...............27....
Pathology ................. ...............27.......... ......
Western Blot............... ...............28..
Electronic Spin Resonance ................. ... ......... ...............29......
Reverse Transcription Polymerase Chain Reaction .............. ...............29....












3 IDENTIFICATION OF NEURONAL NITRIC OXIDE SYNTHASE ISOFORMS IN
THE KIDNEY ................. ...............31.......... .....


Introducti on ................. ...............3.. 1..............
Material s and Method s .............. ...............3 1....
Re sults ................ ...............34.................
Discussion ................. ...............36.................


4 RENAL CORTEX NEURONAL NITRIC OXIDE SYNTHASE IN KIDNEY
TRANSPLANT S .............. ...............44....


Introducti on ................. ...............44.................
Materials and Methods .............. ...............45....
Re sults ................ ...............47.................
Discussion ................. ...............49.................


5 DETERMINATION OF DIMETHYLARGININE DIMETHYLAMINOHYDROLA SE
ACTIVITY IN THE KIDNEY ................. ...............61.......... ....


Introducti on ................. ...............61.................
Materials and Methods .............. .. ........... ............6

Optimization of Homogenization Buffers ................. ...............62................
Optimization of Deproteinization .............. ............__ .. ......__. ...........6
Tests for Other Pathways That Could Alter Citrulline Concentration ............................63
Comparison of Citrulline Assay and Asymmetric Dimethylarginine Degradation by
High Performance Liquid Chromatography .............. ...............64....
Statistical Analysis .............. ...............65....
R e sults........._...... .. .. ....._.._. ....... .............6

Optimization of Citrulline Assay............... ...............65.
Effect of Urea on Citrulline Assay .............. ... ............. ....... .... ...... ...........6
Comparison of Dimethylarginine Dimethylaminohydrolase Activity Measured by
Citrulline Accumulation with Asymmetric Dimethylarginine Consumption............._.66
Tests for Other Pathways That Could Alter Citrulline Concentration ............................66
Discussion ............ ..... .._ ...............66...


6 VITAMIN E REDUCES GLOMERULOCLEROSIS, RESTORES RENAL
NEURONAL NITRIC OXIDE SYNTHASE, AND SUPPRESSES OXIDATIVE
STRESS IN THE 5/6 NEPHRECTOMIZED RAT ......____ ..... ... .__ ........_........7


Introducti on ............ ....... __ ...............78...
Materials and Methods .............. ...............79....
Re sults............ ......_ ...............80....
Discussion ............ ..... ._ ...............82....











7 SEX DIFFERENCES IN NITRIC OXIDE, OXIDATIVE STRESS, AND
ASYMMETRIC DIMETHYLARGININE IN 5/6 ABLATION/INFARCTION RATS .......96

Introducti on ................. ...............96.................
M materials and M ethods .............. ...............97....
Re sults............... .. ............. .. ....... .... .. ..........9
Data of Renal Outcome and Clinical Parameters ................ ............... ......... ...99
Renal Neuronal Nitric Oxide Synthase Isoform Expression ................. ........._._... ...100
Reactive Oxygen Species Metabolism ................ ...............100...............
L-Arginine and Dimethylarginines ................. ...............101................
Asymmetric Dimethylarginine Related Enzymes .............. ...............101....
Discussion ............ ..... .._ ...............102...

8 CONCLUSION AND IMPLICATIONS ....__ ......_____ .......___ ...........16


Renal Neuronal Nitric Oxide Synthase-a and -P Isoforms Expression in Chronic Kidney
D disease .............. ..... ........... .. .......... ............11
Oxidative Stress in Chronic Kidney Disease ................. ...............119..............
Oxidative Stress and Neuronal Nitric Oxide Synthase ................. ................. ........ 120
Asymmetric Dimethylarginine in Chronic Kidney Disease ....._____ ..... ... .._............120
Oxidative Stress and Asymmetric Dimethylarginine ............... .... ...............123
Target on Nitric Oxide Pathway to Prevent Chronic Kidney Disease Progression and
Cardiovascular Complications .............. ..... ...............124......... ......
Neuronal Nitric Oxide Synthase Gene Therapy ................... .............. ................ ...125
Prevention of Chronic Kidney Disease Progression by Antioxidants ........._................126
Prevention of Chronic Kidney Disease Progression by Lowering Asymmetric
Dimethylarginine .............. .. ...___ .. ....___ .... ...... ..........2
Multifaceted Therapeutic Approaches in Preventing Chronic Kidney Disease
Progres si on............ ..... .._ ...............127..

LI ST OF REFERENCE S ............_ ..... ..__ ...............1 1...

BIOGRAPHICAL SKETCH ............_...... .__ ...............144...










LIST OF TABLES


Table page

3-1 Proteins identified by MALDI-TOF MS/MS-MS .............. ...............40....

4-1 Functional parameters in Tx and control groups 22 weeks after transplantation ..............52

4-2 Weight and renal function measures at 22 wk after kidney transplantation or similar
tim e in control .............. ...............53....

5-1 Effect of deproteinization reagents on absorbance of blank ......____ ... ... .....__.........69

5-2 Effect of buffers and additives on the L-citrulline assay in the presence of 25CLM L-
citrulline ........._ ...... .. ...............70....

5-3 Recommend assay procedures/conditions for the measurement of renal cortical
DDAH activity ........... ..... .._ ...............71...

6-1 Measurements at 15 wk after surgery .............. ...............87....

7-1 Renal outcome and clinical parameters .............. ...............106....

7-2 L-arginine and dimethylarginine levels in plasma and kidney cortex ...........................107

8-1 The nNOSa and -P isoform expression in different chronic kidney disease models......128










LIST OF FIGURES


Figure page

1-1 Illustration of nNOS isoforms. ................ ................ .................. ..........23

1-2 Three maj or mechanisms of NO deficiency in chronic kidney disease studied in this
dissertation ................. ...............24.................

3-1 Immunoblots of male and female kidney cortex (KC), kidney medulla (KM), and
control cerebellar lysate (Cer) ................. ...............41................

3-2 Immunoblots of female kidney cortex (KC), kidney medulla (KC), and control
cerebellar lysate (Cer) with ABR C-terminal nNOS antibody .............. ....................4

3-3 End-point RT-PCR of nNOS transcripts in various male tissues ................. ................. 43

4-1 Renal outcome in ALLO grafts at 22 weeks after Tx............... ...............54...

4-2 Renal cortical nNOSa protein abundance in CsA and RAPA ALLO rats.........................55

4-3 Renal cortical nNOSa and nNOSP mRNA abundance in CsA and RAPA treated
ALLO male rats and controls............... ...............56

4-4 Renal cortical nNOSP protein abundance in CsA and RAPA treated male rats and
controls ................ ...............57..._..._ ......

4-5 Renal pathology at 22 wk after kidney transplantation .............. ...............58....

4-6 NADPH-dependent superoxide production of ISO-UN, ISO-EP, and acutely
rej ecting allografts and the control kidneys ................ ...............59........... ..

4-7 NOS protein abundance and activity in ISO-UN and ISO-EP rats ................. ................60

5-1 Time course of the urea effect on color formation without substrate (ADMA) in the
ab sence and presence of urease ................. ...............72...............

5-2 Time course of DDAH activity in different rat tissues ......____ ........._ ..............73

5-3 Time course of color formation in citrulline equivalents in the presence of the DDAH
substrate (ADMA) in the absence and presence of urease ................. .......................74

5-4 Correlation of L-citrulline formation as a measure of DDAH activity with the rate of
ADMA consumption............... ..............7

5-5 The effect of arginase on the L -citrulline assay to detect renal DDAH activity...............76

5-6 The effect of NO and superoxide on the L-citrulline assay to detect renal DDAH
activity ........... ..... .._ ...............77...










6-1 Urinary protein excretion at baseline (week 0) and during the 15 wk period after
surgery in shams, 5/6 NX and 5/6 NX + Vit E ........._.._ .....__. ....._... ......8

6-2 Summary of the % and severity of glomerulosclerosis on the 1+-4+ scale 15 weeks
after surgery in shams, 5/6 NX and 5/6 NX + Vit E............... ...............89...

6-3 Renal cortex NADPH-dependent superoxide production at 15 wk after surgery .............90

6-4 Total urinary NOx (NO3- +NO2-) excretion at baseline (week 0) and during the 15 wk
period after surgery in shams, 5/6 NX and 5/6 NX + Vit E............... ....................9

6-5 NOS protein expression in sham and 5/6 NX rats at 15 wk after surgery ................... ......92

6-6 Densitometry showing abundance of nNOSa and nNOSP in renal cortex of sham and
5/6 NX rats studied 15 wks after surgery............... ...............93

6-7 ADMA-related enzyme expression in renal cortex at 15 wk after surgery .......................94

6-8 Immunoblots of rat kidney cortex (KC) and kidney medulla (KM) with DDAH2
antibody............... ...............95

7-1 NOS isoforms expression in renal cortex .............. ...............108....

7-2 Correlation between glomerular damage and nNOS isoform abundance ................... .....109

7-3 Biomarkers of oxidative stress in sham and A/I rats at 7 wk after surgery ................... ..1 10

7-4 Correlation between L-arginine to ADMA ratio and plasma NOx levels ................... ....111

7-5 ADMA-related enzyme abundance in sham and A/I rats at 7 wk after surgery ..............112

7-6 In vitro DDAH activity at 7 wk after surgery ..........._ ..... ..__ ... ..___.......14

7-7 Correlation between renal DDAH activity and RBC DDAH activity ...........................115

8-1 Various progression rates to end-stage renal disease in different chronic kidney
disease (CKD) models .............. ...............129....

8-2 Target nitric oxide (NO) pathways in preventing chronic kidney disease (CKD)
progression and cardiovascular (CV) complications ................ ......... ................1 30









LIST OF ABBREVIATIONS

ADMA Asymmetric dimethylarginine

A/I Ablation/infarction

ALLO Allograft

BP Blood pressure

CCr 24hr clearance of creatinine

CKD Chronic kidney disease

CsA Cyclosporine A

CVD Cardiovascular disease

DDAH Dimethylarginine dimethylaminohydrolase

eNOS Endothelial nitric oxide synthase

5/6 NX 5/6 nephrectomy

ISO Isograft

nNOS Neuronal nitric oxide synthase

NO Nitric oxide

PNOx Plasma nitrite plus nitrate levels

PRMT Protein arginine methyltransferase

RAPA Rapamycin

ROS Reactive oxygen species

SD Sprague-Dawley

SDMA Symmetric dimethylarginine

Tx Transplant

UNOxV 24hr urinary nitrite plus nitrate levels

UproV 24hr urinary protein excretion

WF Wistar Furth









Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

NITRIC OXIDE DEFICIENCY IN CHRONIC KIDNEY DISEASE: LINTKS AMONG
NEURONAL NITRIC OXIDE SYNTHASE, OXIDATIVE STRESS, AND ASYMMETRIC
DIMETHYLARGININE (ADMA)

By

You-Lin Tain

December 2007

Chair: Chris Baylis
Major: Medical Sciences--Physiology and Pharmacology

Nitric oxide (NO) deficiency is a cause and a consequence of chronic kidney disease

(CKD). We focused on three possible causes of NO deficiency in this dissertation: decreased

abundance and /or changes in activity of nitric oxide synthase (NOS) enzymes, increased

endogenous NOS inhibitors (e.g., asymmetric dimethylarginine (ADMA)), and increased NO

inactivation by oxidative stress.

We found reduced renal cortical nNOS abundance as well as NOS activity in various

CKD models. Therefore, we evaluated whether oxidative stress and ADMA inhibited nNOS

expression in different CKD models. We found that 2 nNOS isoforms expressing in the kidney

and that renal cortical nNOSa and nNOSP isoform expression differentially in various CKD

models. In mild CKD, nNOSa abundance can be maintained or compensated by nNOSP to

preserve renal function, while decreased nNOSa abundance results in CKD progression despite

increased nNOSP expression in severe CKD. Both oxidative stress and ADMA may inhibit

nNOS expression. The inhibition by oxidative stress can be partially prevented by antioxidant

vitamin E; however, vitamin E cannot prevent the elevation of ADMA. In 5/6 nephrectomized

rats, we found the increase of ADMA may be due to increased ADMA synthesis by increased









protein arginine methyltransferase (PRMT) expression and decreased ADMA breakdown by

decreased dimethylarginine dimethylaminohydrolase (DDAH) activity. In 5/6 ablation/infarction

(A/I) model, vulnerable male A/I rats displayed higher oxidative stress but lower nNOSa

abundance than resistant female A/I rats, demonstrating decreased nNOSa and increased

oxidative stress contribute to CKD progression.

We concluded that decreased cortical nNOSa abundance, increased oxidative stress, and

increased ADMA contribute to CKD progression. Targeting on increasing renal nNOS

expression, reducing oxidative stress, and lowering ADMA levels to preserve NO bioavailability

may be specific therapeutic interventions to prevent CKD progression.









CHAPTER 1
INTTRODUCTION

Overview

Chronic Kidney Disease Is a Global Challenge

Increasing numbers of patients with chronic kidney disease (CKD) and consequent end-

stage renal disease (ESRD) is becoming a global challenge (34). Cardiovascular disease (CVD)

is a major cause of morbidity and mortality in CKD. The therapeutic goal in CKD is not only

retarding CKD progression but also preventing adverse cardiovascular complications. Several

common pathways of CKD progression have been uncovered, such as activation of renin-

angiotensin system, glomerular hypertension, oxidative stress, proteinuria, and inflammation.

They are all interrelated and they all interact with the nitric oxide (NO) pathway. Indeed, there is

substantial evidence that NO deficiency occurs in CKD in humans and animals and may cause

progressive functional deterioration, structural damage and cardiovascular side effects (10, 149).

NO is not only a vasodilator but also has anti-inflammatory, anti-proliferative, and anti-oxidant

properties (74).

Nitric Oxide Deficiency Is a Common Mechanism of CKD Progression

In clinical studies, patients with CKD develop NO deficiency (120). Animal studies also

show that NO deficiency results from CKD and since experimentally induced chronic nitric

oxide synthase (NOS) inhibition results in progressive renal injury (164), the development of NO

deficiency during CKD is likely to cause progression. In addition, reduced NO bioavailability

appears to be a maj or factor involved in CKD-induced endothelial dysfunction, which is the

initial mechanism in atherosclerosis (119).

Nitric oxide deficiency could occur due to reduced substrate (L-arginine) availability,

reduced cofactor (e.g., tetrahydrobioterin, BH4) availability, decreased abundance and /or









changes in activity of NOS enzymes, increased endogenous NOS inhibitors (e.g., asymmetric

dimethylarginine (ADMA)), and increased NO inactivation by oxidative stress (10). In clinical

studies, both oxidative stress and ADMA have been shown related to the progression of CKD

(16) and endothelial dysfunction (161). Thus, both of these causes of NO deficiency affect both

renal outcome and CV complications. Oxidative stress can result in both increased ADMA

generation and decreased breakdown (128), conversely, ADMA can induce uncoupling NOS

causing oxidative stress (23).

Nitric oxide is produced from L-arginine by three nitric oxide synthase (NOS) families:

neuronal NOS (nNOS), endothelial NOS (eNOS), and inducible NOS (iNOS). Since there is

little iNOS expression in normal kidney (145), we have focused on evaluating eNOS and nNOS

in CKD. We have found reduced cortical nNOS abundance as well as in vitro soluble NOS

activity (mainly nNOS activity) in various CKD models (10, 36-41, 130, 153). In contrast the

eNOS abundance is variable in different CKD models. These findings suggest that nNOS may be

involved causally in CKD.

Neuronal Nitric Oxide Synthase

Role of Renal Cortical Neuronal Nitric Oxide Synthase in Chronic Kidney Disease
Progression

Nitric oxide derived from nNOS in MD can dilate afferent arterioles, regulate

tubuloglomerular feedback, and may also prevent mesangial cell and matrix proliferation (74,

139). Reduction of cortical nNOS may therefore cause renal vasoconstriction, decrease GFR,

enhance tubular sodium reabsorption, result in mesangial proliferation and hence hasten

progression of CKD. Indeed, cortical nNOS expression was shown to be positively correlated

with afferent arteriolar diameter (139) and afferent arteriolar vasoconstriction was considered to

participate in the pathogenesis of CKD progression (21, 97). In addition, nNOS in MD has an









essential role for renin production (139) and activation of renin-angiotensin contributes to CKD

progression. Although the greatest density of renal cortical nNOS is in the MD, there may also

be nNOS in proximal tubular epithelium and in nitrergic nerves that supply tubular and vascular

structures in cortex (9, 74).

Neuronal Nitric Oxide Synthase Isoforms in the Kidney

The three NOS isoenzymes share a common structural organization: central calmodulin-

binding motif links an oxygenase (N-terminal) and a reductase (C-terminal) domain. The

oxygenase domain consists of an arginine, a heme, and a BH4 binding site. The reductase domain

contains binding sites for FAD, FMN, and NADPH (3). Unlike eNOS and iNOS, the 160kDa

isoform, nNOSa possesses a unique ~300 aa segment at the N-terminal including a PDZ domain

as well as a site for protein binding to allow protein protein interactions. The protein inhibitor

of nNOS (PIN) binds here (63) and was shown to be upregulated in 5/6 nephrectomy (NX) rats

(113). At least 1 1 tissue- or development-specific transcripts of nNOS gene have been reported

in rat (102), arising from different promoters or alternative splicing. nNOSa is the most

commonly expressed in neural tissues and muscle, and until now, only nNOSa has been reported

in rat kidney. As shown in Figure 1-1, the maj or nNOS isoforms that have been detected in

extrarenal tissues, in addition to nNOSa are nNOSP, nNOSy, nNOSCL, and nNOS-2. nNOSP and

nNOSy have part of the N-terminal deleted and consist of aa 236-1433 and 336-1433 of nNOSa,

respectively. The nNOSCL (165kDa) is full length and includes an additional 34 aa insert in FMN

binding domain, and is mainly located in skeletal muscle. Unlike nNOSa which is exhibited in

both soluble and membrane fractions, nNOSP and nNOS y are only located in the soluble

fraction (no PDZ domain). In nNOS exon 2 knockout mice, nNOSP and nNOSy were detected in

the brain by Western blot, and nNOSP has similar functional activity to nNOSa (35). In vitro,

NOSP has ~80% the activity of nNOSa (20), although in vivo the absence of the PDZ and PIN









domains could lead to greater activity (due to resistance to PIN) or decreased activity (due to

decreased stability of dimers). In wild type mice, nNOSP is located in many brain areas and in

nNOSa knockout (lacking exon 2), nNOSP abundance increases (35). In nNOSa knockout mice,

nNOSP was able to maintain normal penile erection, suggesting that there may be an

upregulation of nNOSP when nNOSa-derived NO is deficient (59). Thus, it is likely that nNOSP

may compensate in states of reduced nNOSa to maintain total nNOS activity.

Most of our previous studies used a polyclonal antibody recognizing N-terminal aa 1-231

of nNOS, thus specifically detecting nNOSa in kidney (80). Lately we have also used a C-

terminal nNOS antibody (aa #1409-1424, Affinity Bioreagents, Golden, CO, USA), giving bands

at both the nNOSa and -P molecular weights. Using a proteomic approach, we have confirmed

abundant expression of nNOSP in rat kidney. In this dissertation I describe studies to

characterize the renal nNOSa and -P and determine if they are involved in CKD and their

relative expression in different CKD models.

Regulation of Neuronal Nitric Oxide Synthase Expression

Although nNOS is constitutively expressed, its expression is under complex regulation.

nNOS mRNA can be upregulated by stress, injury, neurotransmitters, steroid hormones and

downregulated by cytokines (17). Most regulatory mechanisms have been studied on extrarenal

tissues and relatively little is known about the regulation of the nNOS isoforms in the kidney. In

kidney, nNOS in MD can be up- or downregulated by renal perfusion, systemic volume status,

distal tubular fluid flow, and NaCl transporter (108). We have evidence that downregulation of

nNOSa protein occurs in CKD, which is the subj ect of this dissertation. In addition to nNOS

expression, nNOS activity can be regulated by various mechanisms: dimer stability, post-

translational modifications (e.g., phosphorylation), endogenous NOS inhibitors (e.g., ADMA),

substrate and cofactor deficiency (L-arginine and BH4), interacting proteins, and oxidative stress.









Increases in both oxidative stress and ADMA have been implicated in the progression of renal

disease in clinical trials (16) and nNOS activity is inhibited by oxidative stress and ADMA in

vitro (23), suggesting both factors contribute to CKD progression possibly via modulating

nNOS. Therefore we focus on 3 major causes of NO deficiency, decreased nNOS protein

abundance and increased oxidative stress and ADMA, to understand whether they regulate

nNOS expression/activity in CKD.

Oxidative Stress and Asymmetric Dimethylarginine

Role of Oxidative Stress in Chronic Kidney Disease

Oxidative stress is characterized by the increase of reactive oxygen species (ROS) which

cannot be counterbalanced by the antioxidant system (43). In CKD, increased oxidative stress is

considered to contribute to the progression as well as CV complications (47, 148). Superoxide

(02-) and NO have counterbalancing actions and reciprocally reduce each other's bioavailability,

thus a reduction in NO may shift the kidney toward a state of Oz- dominance causing renal

vasoconstriction, enhanced tubular sodium reabsorption, excessive proliferation and extracellular

matrix expansion leading to fibrosis and thus CKD progression (95). In kidney, Ozl is mainly

generated by NADPH oxidase (44) and increased p22phox, a maj or subunit of NADPH oxidase,

enhances ROS generation and its expression correlates to NADPH oxidase activity (44). As part

of the antioxidant defense, Oz- can be converted to H202 by the superoxide dismutases (SOD)

which prevents 02~ fTOm interacting with NO to generate peroxynitrite (ONOO-), an important

mediator of lipid peroxidation. Therefore, NOS and NO bioavailability can be inhibited by 02~

and its metabolites. The activity of nNOS is highly sensitive to changes in oxidative stress (23).

Role of Asymmetric Dimethylarginine in Chronic Kidney Disease

Another important regulator of NOS activity is the endogenous NOS inhibitor, ADMA.

Arginine is methylated by protein arginine N-methyltransferase (PRMT) to form









methylarginines: Nw-monomethyl-L-arginine (L-NMMA), asymmetric dimethylarginine

(ADMA), and symmetric dimethylarginine (SDMA) (146). L-NMMA and ADMA, but not

SDMA are competitive inhibitors of NOS isoenzymes and both are metabolized by

dimethylarginine dimethylaminohydrolase (DDAH). Currently, nine PRMT isoenzymes have

been identified and are classified as either type I or type II PRMT (12, 105). Both types PRMTs

catalyze the formation of L-NMMA as an intermediate, and type I PRMTs lead to the formation

of ADMA, whereas type II PRMTs produce SDMA. Since PRMT 1 is a predominant type I

PRMT and PRMT1 gene expression was increased in 5/6 NX rats (90), it is possible that

increased PRMT1 expression may contribute to increased ADMA synthesis in CKD.

Further, DDAH metabolizes ADMA to citrulline and dimethylamine and decreased DDAH

activity increased ADMA and diminished L-arginine/ADMA ratio and leading to a decrease of

NO production. We have found reduced L-arginine/ADMA ratio in human CKD and ESRD

patients and in a rat chronic glomerulonephritis CKD model (153, 159). Elevated ADMA level

has also been reported in the presence of various CKD models and is a risk factor for various

cardiovascular disorders with endothelial dysfunction (146).

Dimethylarginine dimethylaminohydrolase has been identified in two isoforms, DDAH1

and DDAH2, which have 62% similarity. Rat and human DDAH protein are 95% identical (68).

Both DDAHs have distinct tissue distributions but seemingly similar activity. DDAH1 is mainly

located in nNOS predominant tissues (neural and epithelial), while DDAH2 is found in tissues

with high eNOS expression (84). However, both DDAHs are widely expressed and not confined

to NOS-expressing cells. So far, there is little data available on DDAH1/2 expression in kidney

because good commercial antibodies have only just become available (138, 140).









Dimethylarginine dimethylaminohydrolase expression and/or activity can be inhibited by

tumor necrosis factor a (61), I-1P (143), homocysteine (126), glycated bovine serum albumin

(162), erythropoietin (1 18), and ox-LDL (13 5). All of the above pathways provoke oxidative

stress and these effects could be prevented by antioxidants (118, 126, 162), suggesting DDAH

may be downregulated by oxidative stress (71). On the other hand, DDAH1 and DDAH2 gene

expression are induced by farnesoid X receptor agonist (55) and all-trans-Retinoic acid (1),

respectively. DDAH activity can also be induced by 17P-estradiol (54). Further, in vitro studies

suggest that both DDAH1 and DDAH2 are inhibited by NO via S-nitrosylation on cystiene

residues (72, 82). However, little is known about the regulation of DDAH in CKD.

Dimethylarginine dimethylaminohydrolase inhibition decreases NO production in

endothelial cells (87). DDAH1 overexpression reduces plasma and tissue ADMA levels and

enhances tissue NOS activity both in vitro and in vivo (30, 62) and ADMA levels were

attenuated in DDAH2 overexpressing transgenic mice (52). These findings suggest that lowering

ADMA levels by increasing DDAH may be a relevant area of intervention. We intended to

characterize DDAH1/2 expression in different CKD models by Western blot and determine

DDAH activity. This has been determined by measurement of substrate consumption (HPLC

measurent of the rate of ADMA consumption or conversion of radiolabeled L -NMMA

converted to L -citrulline, however, both methods are time consuming and costly. We have also

developed a simple colorimetric method to measure renal DDAH activity that measures rate of

citrulline accumulation.

Objective

Nitric oxide deficiency is both a cause and a consequence of CKD. We have found that

renal nNOSa expression decreases markedly with injury in the SD rats and is correlated to

decreased NOS activity in various rat CKD models. However, WF rats that are protected from









renal injury still show some decrease in nNOSa abundance but maintained NOS activity (39).

We intended to test the hypotheses that other nNOS isoforms exist in kidney; that they may

compensate for loss of nNOSa in CKD and that this is associated with protection from

progression of CKD in different stages of CKD by evaluating different CKD rat models. In this

dissertation, four CKD models were studied to elucidate whether nNOS isoform expression

differentially in different stages of CKD. There are two transplant (Tx)-indued mild CKD

models, ischemia/reperfusion (I/R) isografts (ISO I/R model) and rapamycin-treated allografts

(ALLO RAPA model); the other two severe CKD models are 5/6 nephrectomy- (NX model) and

ablation/infarction models (A/I model). Also, CKD is a state of oxidative stress, known to inhibit

NO generation as well as DDAH activity, leading to increased ADMA. We manipulated the level

of oxidative stress with antioxidants to investigate the impact on nNOS isoform and DDAH

expression/activities. The nNOS activity may be regulated by ADMA and the kidney is a maj or

site of catabolism of ADMA by DDAH. We therefore investigated whether changes in the local

ADMA level (due to changes in renal DDAH activity) will also influence renal NOS activity.

This dissertation is divided into 5 concurrent studies to determine the impact of nNOS, oxidative

stress, and ADMA in CKD (Figure 1-2):

* Identification of renal nNOS a/P expression in rat kidney: We compared an N-terminal
nNOS antibody to a C-terminal nNOS antibody, to investigate the possibility that different
nNOS isoform proteins exist in the rat kidney. nNOS isoforms were identified in rat kidney
by a proteomic approach and the presence of the relevant transcripts was also confirmed by
RT-PCR.

* Characterization of renal nNOS a/P expression in transplant-induced CKD models:
We analyzed kidney samples from two renal transplant-induced CKD models; transplanted
F344 isografts treated with antioxidants/anti-inflammatory agents and F344 to Lewis
allografts treated with rapamycin (RAPA) to elucidate the impact of nNOS expression.

* Optimization of a colorimetric assay to measure renal DDAH activity: We established
the optimal conditions for use of the Prescott-Jones method (109) of L-citrulline
determination to measure kidney tissue DDAH activity. We compared this modified L-
citrulline assay to the direct HPLC method measuring rate of ADMA breakdown.










* Characterization of the renoprotective effects of vitamin E on renal nNOS, oxidative
stress, and ADMA in a 5/6 NX CKD model: We investigated the impact of the 5/6
nephrectomy- model on renal nNOS abundance, oxidative stress, and ADMA-related
enzymes and also whether the protective effects of vitamin E therapy are associated with
preservation of these pathways.

* Investigation of sex differences on CKD progression in the 5/6 A/I model by
regulating renal nNOS, oxidative stress, and ADMA pathways: We investigated
whether L-arginine/ADMA is correlated to renal nNOS abundance, oxidative stress, and
renal outcome in A/I rat model and whether there is sex difference in these pathways.










nNOSa (160 kDa)


SnNOS-2 (144k6)a) 504-608 deletion
nNOSCL (165kDa) 34 aa insertion

PIN binding site 228-244
NH2 -D HA G/H AE M/BH4 FMN FAD HNADPH COOH
1 221 724 757 949 980 1433

336 nNOSy (125 kDa)

*I I
236 nNOSP (136 kDa)

N-terminal Ab C-terminal Ab


Figure 1-1. Illustration of nNOS isoforms. nNOS isoforms are showed by arrowed lines as
follows: black, nNOSa aa #1-1433; red, nNOSP aa #236-1433; grey, nNOSy aa #336-
1433; blue, nNOSCL aa#1-1433 with a 34 amino acids insertion; and dark blue,
nNOS-2 aa 1-1433 with a deletion of aa #504-608. Consensus binding sites for PSD-
95 discs large/ZO-1 homology domain (PDZ), protein inhibiter of nNOS (PIN), L-
arginine (ARG), heme (HAEM), tetrahydrobiopterin (BH4), CalmOdulin (CaM), flavin
mononucleotide (FMN), flavin adenine dinucleotide (FAD), and NADPH are
indicated. Dimer interfaces are shown by blue dashed line. N-terminal (black) and C-
terminal (red) antibodies used in this dissertation recognizing different amino acids
sequence are indicated. Based on refs (3, 35, 156).








OOxidative stress?


L-arginine NO J
UnNOSoc 1

T
OADMA T
Figure 1-2. Three maj or mechanisms of NO deficiency in chronic kidney disease studied in this
dissertation: (1) Decreased renal cortical neuronal nitric oxide synthase (nNOS)
abundance, (2) Increased oxidative stress, and (3) Increased asymmetric
dimethylarginine (ADMA).









CHAPTER 2
GENERAL METHODS

Animal Models

Ablation/infarction Model

Ablation/infarction (A/I) model was performed as follows: Renal mass was removed

under isoflurane general anesthesia using full sterile technique. By retroperitoneal approach, the

right kidney was removed and upper and lower thirds of the left kidney was infarcted by ligation

of branches of the renal artery.

5/6 Nephrectomy Model

5/6 nephrectomy (NX) model was performed as follows: By retroperitoneal approach, 2

poles of the left kidney were removed and then one week later the right kidney was removed.

Renal Transplantation Model

Renal transplantation (Tx) model was performed as follows: Rats were anesthetized by

intraperitoneal pentobarbital sodium (32.5 mg/kg; Sigma, St. Louis, MO) and methohexital

sodium (25 mg/kg; Brevital sodium, Eli Lilly and Co, Indianapolis, INT). After median

laparatomy the left kidney was removed. In the donor the abdominal aorta and vena cava were

clamped, a cannula placed into the left renal artery and the kidney flushed with cold (4oC)

solution, removed with the artery, vein and ureter and placed into cold solution for 10 min.

Donor and recipient renal artery and vein were then anastomized with 10-0 prolene sutures and

after a warm ischemia time of 35 min (total ischemia time 45 min), vascular clamps were

removed and the ureter was anastomized end to end near to the hilus. To avoid infections, rats

received 10 mg/kg/day rocephin (Ceftriaxone sodium, Roche, Nutley, NJ) for 10 days then rats

were again anesthetized and the right native kidney removed.









Tissue Harvest

Tissue harvest was performed as follows: Tissue harvesting was done in isoflurane

anesthetized rats. Initially a 20G butterfly was inserted into the abdominal aorta at the bifurcation

and clamped in place. BP was measured then a blood sample withdrawn, then the vasculature

was perfused with 60ml ice-cold PBS at 25ml/min and the vena cava vented. For frozen tissue

harvesting for WB etc, tissues were harvested on to dry ice and snap frozen in liquid nitrogen

and then stored in -80oC freezer until analysis. For immunohistochemistry and histology the

perfusate was switched to 2% paraformaldehyde-lysine-periodate (PLP) and perfused for 5

minutes, then removed, sliced longitudinally, then stored in the same fixative overnight at 4oC.

At the end of experiments, rats were euthanized with isoflurane overdose.

Metabolic cage studies/general chemical analyses: Rats were placed in metabolic cages for

collection of 24 h urines. In all studies where NOx (NO2- + NO3 ) Output was measured, rats

were maintained on a low NOx diet (ICN, AIN 76, MP Biomedicals, Solon, OH, USA) for 24h

before and during the measurements. Measurements were made of total urinary protein by the

Bradford assay; plasma and urine creatinine by a HPLC method previously described by us

(130).

Biochemical Analysis

Nitric Oxide Assay

Urine and plasma NOx (NO2- + NO3 ) aSsay was performed as follows: The NOx levels

were measured with Griess reaction according to Stuehr et al. (125) using the nitrate reductase

enzyme which reduced NO3- to NO2-. Briefly, 125Cl of samples plus 100Cl of

HEPES/ammonium format (1:1) were mixed with 25Cl of nitrate reductase, incubated for 60

minutes at 37oC. After the incubation, samples were centrifuged (2000rpm for 15min) and 100Cl1

of supernatant was transferred into a 96-well plate. Griess reagent was made by 1:1 (V/V) mixed









1% sulfanilamide with 0. 1% naphthylethylene diamine. 150Cl of Griess reagent was added into

each well. Samples were incubated for 15 minutes at room temperature. Absorbance was

determined at a wavelength of 543 nm spectrophotometrically. All chemicals for NOx assay

were from Sigma (St Louis, MO, USA). A standard curve was constructed ranged from 0-

400CLM. Details of this method have been published by us previously (130).

Nitric Oxide Synthase Activity

In vitro NOS activity was determined as the following procedures: NOS activity was

measured from the conversion of L-[3H]-arginine to L-[3H]-citrulline in the kidney cortex as

described by us previously (39). Briefly, tissues were homogenized in iced homogenization

buffer, ultracentrifuged, and both supernatant (soluble) and membrane fractions assayed; the

soluble fraction contains predominantly nNOS (and iNOS when stimulated), whereas the

membrane fraction contains mostly eNOS. Endogenous arginine was removed from the

supernatant using Dowex while the pellet was reconstituted in homogenization buffer, then

ultracentrifuged and resuspended. Samples were run at baseline and in the presence of

nonselective NOS inhibitor cocktails: 2mM trifluoperazine, 5 mM NG-methyl-L-arginine (L-

NMA), and 10 mM Nw-nitro-L-arginine methyl ester (L-NAME, Sigma-Aldrich, St. Louis, MO,

USA). Data were expressed as pmol citrulline/min/mg protein minus any activity not inhibited

by the NOS inhibitor cocktail and adjusted for background.

Pathology

Pathology was determined as follows: Pathology was performed on 5 micron sections of

formalin-fixed kidney, blocked in paraffin wax, stained with PAS (Periodic acid-schiff staining

system, Sigma-Aldrich, St. Louis, MO, USA). The level of renal injury was assessed on a

blinded basis by determining the sclerotic damage to glomeruli using the 0 to 4+ scale, where 1+

injury involved less that 25% damage to the glomerulus, 2+ = 25 50% injury, 3+ = 51-75%









damage and 4+ = 76 100% damage. Data were represented as % of damaged glomeruli

(N=100) showing any level of injury (scale 1+ to 4+). The total numbers of damaged glomeruli

including all levels of injury were also measured and represented as total % of damaged

glomeruli (N=100).

Western Blot

Western blot was performed as follows: Samples were loaded to 7.5-12% polyacrylamide

gels, in aliquots of 50-300Cpg total protein with concentration adjusted to give fixed volume =

50Cl1. MW markers were run in one lane and positive control was also run. The proteins were

separated by electrophoresis (200 V, 1h5min-2.5hr), transferred onto nitrocellulose membranes

(1hr 45 min, 0. 18Amps). We stained each membrane with Ponceau red to correct variations

during protein loading and transfer. Then the membranes were incubated in 5% non-fat milk

with TBS-T blocking solution for 60 min and washed in TBS-T (0.05%-0.5%) then incubated in

the appropriate dilution of the primary then secondary antibody. The nNOSa was detected with 2

N-terminal antibodies: a rabbit polyclonal antibody (76) (1:10,000 dilution, 1 hr incubation)

followed by a secondary goat anti-rabbit IgG-HRP antibody (Bio-Rad; 1:3,000 dilution, 1 hr

incubation), or a mouse monoclonal antibody (Santa Cruz, 1:200 dilution, overnight incubation)

followed by a goat anti-mouse IgG-HRP secondary antibody (Bio-Rad, 1:2000 dilution, 1-hour

incubation). For nNOSP detection we used a C-terminal rabbit polyclonal antibody (Affinity

BioReagents, 1:250 dilution, overnight incubation), followed by a goat anti-rabbit IgG-HRP

secondary antibody. Membranes were stripped and reprobed for eNOS using a mouse

monoclonal antibody (Transduction Laboratories 1:250 dilution, 1-hour incubation), followed by

a goat anti-mouse IgG-HRP secondary antibody. For PRMT1 we used a rabbit anti-PRMT1

antibody (Upstate, 1:2000 dilution, overnight incubation) and a goat anti-rabbit antibody. For

DDAH we used a goat anti-rat DDAH1 antibody (Santa Cruz, 1:500 dilution, overnight









incubation) or a goat anti-rat DDAH2 antibody (Santa Cruz, 1:100 dilution, overnight

incubation), followed by a secondary donkey anti-goat antibody (Santa Cruz, 1:2000 dilution, 1h

incubation). For p22phox we used a goat anti-rat antibody (Santa Cruz, 1:200 dilution, overnight

incubation), followed by a secondary donkey anti-goat antibody. Bands of interest were

visualized using SuperSignal West Pico reagent (Pierce, Rockford, IL) and quantified by

densitometry, as integrated optical density (IOD) after subtraction of background. The IOD was

factored for Ponceau red staining to correct for any variations in total protein loading and for an

internal standard (rat cerebellum for nNOS, endothelial cell lysate for eNOS, rat kidney cortex

for PRMT 1 & DDAH1/2, rat heart for p22phox). The protein abundance was represented as

IOD/Ponceau Red/Std. We used Ponceau red method for standardization because in some

situations p-actin may change.

Electronic Spin Resonance

NADPH oxidase-dependent superoxide was detected by electronic spin resonance (ESR)

as follows: For this we collaborated with Dr. Griendling, Emory University to measure

superoxide production by ESR with spin trapping. Membrane samples from kidneys were

prepared as described previously (33, 51). 10Cpg of protein was added to 1 mM CPH, 200 CLM

NADPH, and 0. 1 mM diethylenetriaminepentaacetic acid in a total volume of 100 Cl~ of Chelex-

treated PBS. In duplicate samples, NADPH was omitted. Samples were placed in 50 Cl1 glass

capillaries (Coming, New York, NY, USA). The ESR spectra were recorded using an EMX ESR

spectrometer (Bruker) and a super-high-Q microwave cavity. Superoxide formation was assayed

as NADPH-dependent, SOD-inhibitable formation of 3-carboxyproxyl.

Reverse Transcription Polymerase Chain Reaction

Reverse transcription polymerase chain reaction (RT-PCR) was performed as follows:

End-point RT-PCR was used for semi-quantitative analysis of mRNA. RNA was isolated from









tissue using TRI Reagent (Sigma, St.Louis, MO, USA) and treated with DNase I (Ambion,

Austin TX, USA). RNA (1 Gig) was reversed transcribed (RT; SuperScriptTM II RNase H-

Reverse Transcriptase, Invitrogen, Bethesda, MD, USA) with random primers (Invitrogen,

Bethesda, MD, USA) in a total volume of 20 CIl. Primers were designed using GeneTool

Software (Biotools Incorporated, Edmonton, Alberta, Canada) with annealing temperatures at

58-610C. Ribosomal 18S (rl8S; Ambion, Austin, TX, USA) was used as an internal reference

since rl8S expression remained constant throughout. For nNOSa and nNOSP, a forward primer

targeting Exon la, a 5' untranslated region (5'UTR), was made according to Lee et al. and

reverse primers targeting exon 2 (R2:5' tecgcagcacctcctcgaatc 3') and exon 6 (R6: 5'

gcgccatagatgagctcggtg 3') were designed from rat-specific sequences (NM_052799). For each

primer set, the cDNA from all samples was amplified simultaneously using aliquots from the

same PCR mixture. PCR was carried out using 1-0.5 Clg of cDNA, 50ng of each primer, 250 CIM

deoxyribonucleotide triphosphates, 1 x PCR Buffer, and 2 units Taq DNA Polymerase (Sigma,

St. Louis, MO, USA) in a 50 Cl1 final volume. Following amplification, 20 Cl1 of each reaction

was electrophoresed on 1.7% agarose gels. Gels were stained with ethidium bromide, images

were captured and the signals were quantified in arbitrary units (AU) as optical density x band

area using a VersaDoc Image Analysis System and Quantity One, v.4.6 software (Bio-rad,

Hercules, CA, USA). PCR signals were normalized to the rl8S signal of the corresponding RT

product to provide a semi-quantitative estimate of gene expression.









CHAPTER 3
IDENTIFICATION OF NEURONAL NITRIC OXIDE SYNTHASE ISOFORMS IN THE
KIDNEY

Introduction

The vulnerable Sprague-Dawley (SD) rats develop decreased nNOSa abundance as well as

NOS activity and structural damage; however, the protected Wistar-Furth (WF) rats showed

some decrease in nNOSa abundance but maintained NOS activity (39). These findings suggest

the possibility that other nNOS isoforms, lacking the unique N-terminal of the nNOSa, might

exist in the kidney and be influenced by injury which prompted our current investigation on

identification of nNOS isoforms in the SD kidney.

In this study we compared an N-terminal antibody (that recognizes the unique PDZ-PIN

region of the full length nNOSa), to a C-terminal antibody (that theoretically recognizes all

nNOS variants), to investigate the possibility that structurally and functionally different nNOS

proteins exist in the rat kidney. A targeted proteomics approach was used to determine if

different nNOS proteins were present in the rat kidney and the presence of the relevant

transcripts was also investigated using RT-PCR.

Materials and Methods

Tissue was harvested under isofluorane anesthesia from male (n=4) and female (n=3)

Sprague Dawley (Harlan, Indianapolis, IN) rats (200-250g). The aorta was perfused with ice-

cold PBS, the kidneys removed, separated into cortex and medulla, flash frozen in liquid

nitrogen and stored at -800C for analysis. Other tissues were collected similarly (skeletal muscle,

heart, lung, liver, aorta, small intestine, testis, and cerebellum). Supplies were from Sigma, St

Louis MO, unless otherwise specified. For Western blot, analysis was performed as described in

chapter 2.









Peptide competition was performed by Western blot on two identical membranes, run as

described above, on which were loaded 200 Clg of kidney cortex, 100 Clg of kidney medulla, and

5 Clg of cerebellum. For peptide competition 150 Clg of neutralizing peptide (ABR PEP-190) was

incubated with 3.75 Clg of the C-terminal nNOS antibody (ABR PAl-033) overnight at 4 OC,

centrifuged and supernatant diluted in blocking solution (1:4000) and used for nNOS detection.

The control membrane was probed with the ABR PAl-033 alone. Both membranes were then

probed with a secondary goat anti-rabbit IgG-HRP antibody (BioRad, Hercules, CA; 1:60,000

dilution, 1 hr incubation).

Immunoprecipitation was carried out on kidney cortex (KC), kidney medulla (KM), and

cerebellum (Cer) and tissues were homogenized with lysis buffer (20 mM Tris-HC1, 150 mM

NaC1, 1% Triton X-100, 0.5% Nonidet P-40, 1 mM EDTA, 1 mM EGTA, 20 mM sodium

orthovanadate, 20 mM NaF, 5 mM phenylmethylsulfonyl fluoride, 21 Clg/ml aprotinin, and 5

Clg/ml leupeptin) and after centrifugation the supernatant (KC = 1.5 ml, 26 Clg protein /CIl; KM =

1 ml, 25 Clg /CIl; Cer = 1 ml, 11.5 Clg /CIl) was incubated with 20-80C1l of C-terminal nNOS

antibody (ABR PAl-03 3) overnight at 40C with continuous rotation. Protein A-Sepharose beads

(30-50 CIl, Amersham Biosciences, Piscataway, NJ) were added, continuously rotated for 2 h at 4

OC, washed, resuspended in 50 Cll of 2x Laemmli buffer, boiled for 3 min and loaded onto 7.5%

SDS polyacrylamide gels. Proteins were separated by SDS-PAGE (200 V, 2.5 hr), gels were

stained overnight with Coomassie blue (Sigma, St. Louis, MO) and the bands of interest excised

from the gel under fully sterile conditions and analyzed by proteomics.

For proteomic analysis we collaborated with Dr. Klein, University of Louisville. Protein

digestion, peptide mass fingerprinting and sequence tagging was conducted on individual bands

excised as 1-3 mm3 plugs from the 1D-SDS PAGE gels, conditioned and de-stained with 20 CIL









0.1 M NH4HCO3 for 15 minutes followed with 30 CIL 99.9% acetonitrile. The gel pieces were

dried, re-hydrated with 20 pIL of 0.02 M dithiothreitol in 0. 1 M NH4HCO3 and heated at 56oC for

45 minutes for reduction of disulphide bonds. The solution was replaced with 0.055 M

iodoacetamide in 0. 1 M NH4HCO3 for alkylation of reduced thiols (30 minutes in the dark). The

alkylation solution was removed, the gel plug conditioned for 15 minutes with 200 CIL 0.05 M

NH4HCO3, then gel plugs were dehydrated with 200 CIL 99.9% acetonitrile. After 15 minutes

the solution was removed, gel plugs were dried by vacuum centrifuge and re-hydrated with 3 CLL

of 20 ng/pIL modified trypsin (Promega, Madison, WIA) in 0.05 M NH4HCO3. Re-hydrated gel

pieces were covered with 5-6 CIL 0.05 M NH4HCO3 and incubated overnight at 37oC. The

samples were cooled and the trypsinization reaction was stopped by the addition of 1 pIL 0.1%

trifluoroacetic acid (TFA).

MALDI matrix used throughout the analysis was a-cyano-4-hydroxycinnamic acid (a-CN)

containing 10 mM NH4H2PO4. Samples were a) spotted as 1:1 (v/v) samples of protein digest:

a-CN (or b) desalted sample aliquots (0.7 CLL 1.0 pIL, 4 mg/mL a-CN, 50% acetonitrile, 0.1%

TFA) spotted directly onto MALDI sample targets using C18 Zip Tips@ (Millipore, Salem,

MA). Samples were air-dried in the dark and cleared of particulate matter with compressed gas

prior to sample plate loading into the mass spectrometer.

Positive ion MALDI -TOF mass spectra were acquired using an Applied Biosystems

(Foster City, CA) AB4700 protein analyzer operating in reflectron mode and with ion source

pressure ~0.5 CLTorr. After a 400 ns time-delayed ion extraction period, the ions were accelerated

to 20 kV for TOF mass spectrometric analysis. A total of 600 to 1000 laser shots (355 nm

Nd:YAG solid state laser operating at 200 Hz) were acquired and signal averaged. Individual

sample plates were calibrated and plate modeling performed using a six peptide calibration









standard with 1) des-Argl-Bradykinin, 2) angiotensin I, 3) Glul-Fibrinopeptide B, 4) ACTH

(1-17), 5) ACTH (18-39), and 6) ACTH (7-38). Data was analyzed using Mascot (version 1.9)

against the 20051115 or 20061212 Swiss Protein database (all taxonomy) assuming: a.)

monoisotopic peptide masses, b.) cysteine carbamidomethylation, c.) variable oxidation of

methionine, d.) no missed trypsin cleavage sites, e.) a MS mass accuracy of greater than 50 ppm

and f.) a MSMS mass accuracy of greater than 0.3 Da. Limitation of the original protein mass

was not employed within the Mascot search. A Mascot score of 2 65 was considered to be

statistically significant (p<0.05).

Maj or ion peaks and suspect modified peptides were subj ected to MALDI TOF-TOF

analysis by collision induced fragmentation (CID) using 1 KeV collision energy and atmospheric

gases (medium pressure). Mascot search of the MALDI TOF-TOF data proceeded with search

parameters listed above with the inclusion of a mass accuracy of 0.3 Da for peptide fragment

masses. MALDI TOF-TOF spectra were used for combined analysis using Applied Biosystems

Global Protein Server software and Mascot.

End-point RT-PCR was used for qualitative analysis to differentially detect nNOS mRNA.

RNA as described in chapter 2.

Results

Homogenates of male and female kidney cortex and medulla were immunoblotted using

both N-terminal and C-terminal polyclonal nNOS antibodies. Figure 3-1A shows a representative

western blot using the antibody targeting the N-terminal of rat nNOS (AA#1-231) (80). This

antibody detects a single band at ~160 kDa in the kidney cortex, kidney medulla and cerebellum

which corresponds to the nNOSa isoform. Figure 3-1B shows the same samples probed with the

ABR nNOS antibody, which detects a conserved region within the C-terminal of nNOS

(AA#1409-1424) and should detect all the potential nNOS isoforms within the kidney. Multiple









bands are shown including those marked by arrows at~-160 kDa (putative nNOSa), ~140 kDa

(putative nNOSP), and ~125 kDa (putative nNOSy).

Homogenates of female kidney cortex, medulla and cerebellum were immunoblotted onto

2 identical membranes which were probed with the C-terminal ABR antibody in the absence and

presence of neutralizing peptide (x40). As shown in Figure 3-2, the bands at~-160 kDa (putative

nNOSa), ~140 kDa (putative nNOSP), and ~125 kDa (putative nNOSy) were faded or abolished

when incubated with the neutralizing peptide.

Next, homogenates from male kidney cortex, kidney medulla and cerebellum were

immunoprecipitated with the C-terminal ABR nNOS antibody and electrophoresed by 1D-SDS

PAGE. MALDI-TOF MS and MS/MS data were acquired. Mascot analysis used a combination

of peptide mass fingerprinting (PMF) and tandem MS fragmentation data. We identified nNOS

in both the ~170 kDa and ~160 kDa band of cerebellar lysate control (C3, C4, Table 3-1). The

observed peptide coverage for cerebellar nNOS (C4) spans the nNOS protein sequence from

amino acid residue 36 to 1407, consistent with nNOSa. Although nNOS was also detected in the

~170 kDa band (C3, Table 3-1), we were unable to determine if this slightly larger isoform was

nNOS-CI since the tryptic peptide mass/fragments associated with the 34 AA insert (starting at

AA# 83 9, K -> KYPEPLRFFPRKGPSL SHVD SEAHSLVAARD SQHR) were not ob served.

In kidney medulla nNOS was identified in both the ~160 kDa and ~140 kDa bands (KM 4

and 5). Band KM4 contained peptide ions mapping to the rat nNOSa sequence from amino acids

36 1400. Multiple analyses of the nNOS in KM band 5 identified only peptides spanning

amino acids 360 through 1400, consistent with the identification of the KM5 as nNOS-P (Table

3-1).









Due to relatively low abundance we were unable to detect any nNOS protein in the kidney

cortex by MS analysis (Table 3-1) instead observing myosin-6, spectrin-a-chain, clathrin heavy

chain and a-S1-casein in the putative bands of interest (KC3-5). The clathrin heavy chain and

myosin-6 were also seen in the same fractions in which the ABR antibody was omitted. To

further evaluate the presence of nNOS variants in the kidney medulla, RT-PCR was performed

on the same tissue sample used for proteomic analysis using various untranslated regions of exon

1.4 Two bands were detected with Exon la-Exon 5 primer pairing indicating the presence of

nNOSa (~1365bp) and nNOSP (~3 10bp) mRNA expression. To test for the presence of the

nNOSy transcript, Exon la-Exon 6 primer pairing was performed. Following PCR, only two

bands were detected indicating the presence of nNOSa (~1603bp) and nNOSP (~548bp), but no

nNOSy mRNA expression.

As shown in Figure 3-3 nNOSa and/or nNOSP mRNA was present in various rat tissues

including kidney cortex, medulla, skeletal muscle, liver, small intestine, lung, testis, and

cerebellum.

Discussion

The novel finding in this study is that both the nNOSa and nNOSP proteins are present in

the normal SD rat kidney. In addition, we have confirmed the presence of two nNOS mRNA

transcripts (nNOSa, nNOSP) arising from the same 5' untranslated region (UTR).

It was the presence of residual NOS activity in the brain of the nNOSa knockout mouse

(generated by an exon 2 deletion), that led to the identification of the nNOSP isoform (57). Since

then, a number of nNOS isoforms have been identified that arise from the alternative splicing of

nNOS pre-mRNAs. The greatest diversity of nNOS transcripts occur in the 5' UTR (Exon 1). In

human tissues nine different first exons have been identified (117, 160) whereas in rat four first

exons are known (58, 81, 102). Lee et al. identified three nNOS mRNA each with distinct 5'









untranslated first exons which all splice to Exon 2 while Oberbaumer et al. identified different

nNOS mRNA splice variants in rat (81, 102). In rat kidney, a novel first exon was identified with

five nNOS mRNA variants, four of which encoded for nNOSa (Exon 2) and one which encoded

for nNOSP (Exon 3) (102).

Most renal researchers use commercially available C-terminal antibodies to detect renal

nNOS but we have used an N-terminal antibody synthesized by Lau et al. (80) that is highly

selective for nNOSa. We selected the ABR C-terminal nNOS antibody (#PA1033; polyclonal

rabbit anti rat) since the neutralizing peptide was also available for competition assays. Using

this C-terminal antibody in Western blots we observed bands in normal kidney cortex and

medulla at the molecular weights of nNOS-a (~160 kDa), nNOS-P (~140 kDa) and nNOS-y

(~125 kDa). These were all competed when incubated with the neutralizing peptide, suggesting

that they were either nNOS isoforms or other proteins with structural homogeneity in the AA

#1409-1424 region of the C-terminal.

We then immunoprecipitated these proteins with the ABR nNOS C-terminal antibody,

separated the proteins by 1D-PAGE and performed proteomic analysis on the bands of interest

(4). Repeated MALDI-TOF MS analysis demonstrated that the cerebellum and kidney medulla

contained peptide ions mapping to the rodent nNOS sequence (NCBI Accession #P29476) from

amino acids 36 1400 thereby identifying the ~160 kDa protein band as nNOSa. In the ~140

kDa protein band, peptide ions mapping to the rodent nNOS sequence from amino acids 359 -

1400 were observed. Of note, we did not identify the R.VSKPPVIISDLIR.G, the R.

GIASETHVVLELR.G or the R.GPEGFTTHLETTFTGDGTPK.T tryptic peptides, predicted to

be present within amino acids 1 through 3 58 of the nNOSa, consistent with the identification of

the ~140 kDa band as nNOSP. To verify the existence of transcripts coding for nNOSa and









nNOSP in rat kidney we used RT-PCR using three forward primers for Exon 1 as previously

published by Lee et al. (81) and two reverse primers designed to target Exon 5 (aa. #318-326)

and Exon 6 (aa. #398-405). Two bands were detected with Exon la-Exon 5 (1365bp, 310bp) and

Exon la-Exon 6 (1603bp, 548bp) primer pairing indicating the presence of both nNOSa and

nNOSP transcripts in both renal cortex and medulla.

Although an immunoreactive protein band at~-125 kDa (nNOSy) was detected with the

ABR nNOS C-terminal antibody by Western blot analysis, we were unable to confirm the

presence of nNOSy by proteomic analysis. While this absence could simply be due to low

protein abundance, the fact that we could not detect any nNOSy mRNA suggests that nNOSy is

not present in normal rat kidney. We speculate that this~-125 kDa band (which was competed by

neutralizing peptide), may contain a novel nNOS variant.

Despite detecting both nNOSa and nNOSP transcripts in the rat kidney cortex, we could

not confirm the presence of any nNOS protein in the kidney cortex by proteomic analysis. This

presumably resulted from a relatively low abundance of nNOS in the kidney cortex. Given the

large body of literature demonstrating that nNOS is present in very high concentrations in the

macula densa, we hypothesize that the abundance of nNO S in the macula densa relative to total

cortex is beneath the level that can be detected by the MS methods we have used (3). In the

kidney cortex five proteins were identified by MS in the MW bands that should contain nNOS:

clathrin heavy chain (CLH), spectrin-a chain brain (SPTA2), myosin-6 (MYO6) and

aminopeptidase N (AMPN). There is no homology between CLH, SPTA2, MYO6 and AMPN

and the immunogen of the COOH-terminal ABR antibody or the nNOS. In addition, CLH,

SPTA2, and MYO6 were identified in the absence of ABR antibody control suggesting protein-

protein interactions and/or non-specific binding to Protein A. AMPN was identified by MALDI-









TOF MS/MS-MS in only one immunoprecipitation and not in repeated studies, suggesting

contamination rather than a lack of ABR nNOS antibody specificity (85).

Based on the present findings we suggest that nNOSP is present in the normal rat kidney.

Unlike full-length nNOSa, nNOSP lacks amino acids 1-236, which contains the PDZ- and PIN-

domains. The PDZ-domain is important in targeting nNOSa to the membrane, thus nNOSP

would only occur in the cytosol as shown by Huber et al. (58) in the rat intestine. The PIN-

domain contains a binding site for protein-inhibitor of NOS which may inhibit the dimerization

and activity of nNOSa (63). Since nNOSP does not contain a PIN-domain, nNOSP can not be

inhibited by PIN or influenced by any protein-protein interaction. Heterologous transfection

assays have shown the nNOSP to be catalytically active (~80% of the activity of nNOSa) (3 5),

thus the renal nNOSP is likely to be a functional enzyme.

In wild type mice, nNOSP is located in many brain areas and with nNOSa knockout,

nNOSP abundance increases (35). In nNOSa knockout mice, nNOSP was able to maintain

normal penile erection (59), suggesting that there may be an upregulation of nNOSP when

nNOSa-derived NO is deficient.











Table 3-1. Proteins identified by MALDI-TOF MS/MS-MS
Protein MASCOT Sequence Number of Estimated Calculated
matching
Band Protein ID Accession Score Coverage Non- MW (kDa) MW (kDa)
Number (%) redundant
peptides


20
19


nNOS
Clathrin
heavy
chain
nNOS
a-S1-
Casein
Clathrin
heavy
chain
nNOS
nNOS
Clathrin
heavy
chain
Spectrin-a-
chain brain
Myosin-6
Amninopept
idase N


P29476 169
P11442 141


P29476 600
BAA00313 115*

P11442 251


161.8
193.2


161.8
24.6

193.2


161.8
161.8
193.2


168

150
109.6


C4
C4

KM3


KM4
KM5
KC3


KC4

KC4
KC5


P29476
P29476
P11442


Pl6546

Q9UM54
PI5684


Peptide masses were searched against the Swiss Protein data (20051115) and all taxa (197228
sequences and 71581181 residues) assuming complete alkylation of Cys with iodoacetamide,
partial oxidation of Met, no missed cleavages by trypsin, and a MS mass tolerance of 50ppm &
MSMS mass tolerance of 0.3Da. The Mascot Score is the absolute probability that the observed
match is a random event. The Mascot Score is reported as -10 x Logl0 (P), where P is the
absolute probability; therefore the lower the probability that an observed match is a random
event the higher the score. In this study, a score of >65 was considered significant. The sequence
coverage is the number of amino acids (AA) identified by peptide sequence tagging compared to
the parent protein (AA identified/total AA in parent protein). *Protein identification significance
achieved by peptide sequence tagging of one peptide. C, cerebellum; KM, kidney medulla; KC,
kidney cortex.









A
2 47 -


1 2 3 4 5


+160kDa


-+125kDa


1 27 -


Figure 3-1. Immunoblots of male and female kidney cortex (KC), kidney medulla (KM), and
control cerebellar lysate (Cer). A) with N-terminal nNOS antibody. B) with ABR C-
terminal nNOS antibody. Lanes: 1 = male KC, 2 = male KM, 3 = female KC, 4 =
female KM, 5 = Cer.


12 3 45










247-
1


I)-160kDa


127 -


83-







247 -




B 127 -




83-~


-140k~a


Figure 3-2. Immunoblots of female kidney cortex (KC), kidney medulla (KC), and control
cerebellar lysate (Cer) with ABR C-terminal nNOS antibody. A) In the absence of
neutralizing peptide. B) In the presence of neutralizing peptide. KC (lanes 1-3) and
KM (lanes 4-6) samples were from three separate females. Lanes: 1-3 = KC, 4-6 =
KM, 7 = Cer.














500bp


"


500bp
500bp


Figure 3-3. End-point RT-PCR of nNOS transcripts in various male tissues: kidney cortex (KC),
kidney medulla (KM), cerebellum (Cer), testis (T), lung (Lu), aorta (A), liver (Li),
small intestine (SI), heart (H), and skeletal muscle (M). nNOSa transcript was
detected using a forward primer targeting exon la and a reverse primer targeting exon
2. nNOSP transcript was detected using a forward primer targeting exon la and a
reverse primer targeting exon 6. Ribosomal 18S was used as an internal control. The
KC and KM samples used for end-point RT-PCR were the same tissue samples used
in generating the KC and KM proteomic data. DNA ladders are shown on the left and
right.


KC KM Cer T Lu A Li SI H M


nN OSu


nNOSri i-xe -



rl 8S -- -









CHAPTER 4
RENAL CORTEX NEURONAL NITRIC OXIDE SYNTHASE IN KIDNEY TRANSPLANTS

Introduction

Nitric oxide (NO) derived from iNOS has been implicated as damaging in kidney

transplants while NO derived from constitutive NOS might protect the allograft (152). We

previously reported that decreased renal nNOS abundance was associated with renal injury in a

wide variety of CKD models (10), including the 5/6 ablation/infarction (A/I) (130), chronic

glomerulonephritis (153), puromycin aminonucleoside-induced CKD (PAN) model (38), normal

aging (40), chronic NOS inhibition model (36), Zucker obese rat which develops type 2 diabetes

(37), and DOCA/NaCl-induced CKD model (39). Renal transplantation-induced injury could be

due to high iNOS-derived NO which could compromise constitutive NOS availability via

substrate limitation (65, 152). It is also possible that decreased renal nNOS abundance might

occur in the transplanted kidney and contribute to injury. We intended to elucidate the nNOS

expression in two kidney transplant (Tx) models: a rapamycin-treated allograft model (RAPA)

and an I/R injury model using renal isografts (ISO).

Although calcineurin inhibitors (CNIs) have improved 1-year survival rates for kidney

grafts, long-term graft failure still occurs (92), perhaps reflecting ischemia/reperfusion (I/R)

injury and CNI-related nephropathy. In the first series we investigated the long-term (22w)

outcome (structural/functional) of renal Tx and renal nNOS expression using 2 different short-

term (10d) immunosuppressive regimens (Cyclosporine vs. rapamycin) to prevent acute

rej section. Rapamycin (RAPA), a mammalian target of rapamycin (mTOR) inhibitor, is used as a

substitute for, or given in combination with CNIs to prevent rej section and reduce nephrotoxicity.

In male rats, a wide therapeutic dosage of RAPA between 0.3-6 mg/kg/day was effective for

prolongation of allograft survival (32) although RAPA at 6.5mg/kg/day resulted in acute










nephrotoxicity in a male rat isograft model with I/R(101). In this study, the dose sufficient to

suppress the initial acute rej section of rapamycin (1.6mg/kg/day) and Cyclosporine (3mg/kg/day)

were used.

In the second series, we investigated whether perioperative (10 day) anti-inflammatory/

antioxidant treatment designed to give endothelial protection (EP) and preserve NO would

prevent long-term graft injury using a Tx-induced (isograft) I/R injury model. Although many

antioxidants and anti-inflammatory agents have been tested to prevent I/R injury and ameliorate

short-term graft dysfunction, it is unclear whether these acute effects may affect the long-term

graft function (29, 107). Tempol (4-hydroxy-tempo), a membrane permeable, superoxide

dismutase (SOD) mimetic that removes superoxide (Oz-) and facilitates hydrogen peroxide

(H202) dismutation, was reported to prevent renal I/R injury at the dose of 30mg/kg/hr for 6hr

(25). Deferoxamine (DFO), an iron chelator, has been included in preservation solutions (for

18hr) and reduces renal I/R injury at 9 days after Tx (56). L-arginine is a substrate for nitric

oxide synthase (NOS) and reduces renal I/R injury when administered once before I/R (24).

Glucocorticoids are anti-inflammatory agents and also prevent the induction of the damaging

iNOS. The individual strategies above were combined in this study to prevent I/R injury in the

10 day period immediately before and after Tx.

Materials and Methods

Orthotopic renal Tx was performed as described in chapter 2. Male Fisher 344 (F344,

RT1v1, from Harlan Indianapolis, USA) served as donors. Lewis (LEW, RT1, from Harlan,

Indianapolis, USA) male rats were used as recipients in the ALLO groups (n=14), while F344

male rats were used in the ISO groups (n=12). In addition to ALLO and ISO rats, 2-kidney age-

matched male rats (n=7) of both Lewis and F344 stains were used as age control. All rats were

aged 9-14 weeks and maintained with free access to standard rat chow and water ad libitum.









In the RAPA series Tx recipients were treated for the first 10 days after surgery with

rapamycin derivative sirolimus (n=7) (1.6 mg/kg/day; Rapamune, Wyeth Laboratories,

Philadelphia, PA) by gavage or with 3 mg/kg/day cyclosporin s.c. (n=7) (CsA, Sandimmune,

Novartis, Basle, Switzerland). Rats also received the antibiotic ceftriaxone sodium, 10

mg/kg/day (Rocephin, Roche, Nutley, NJ) i.m. for 10 days.

In the I/R series, ISO rats were separated into 2 groups: untreated group, ISO-UN (n=6) in

which lactated Ringers was used to flush the donor kidney at the time of Tx. A second group

(n=6) were given treatments to provide endothelial protection, ISO-EP. The donors received 10

mg/kg dexamethasone, iv (APP, Los Angeles, CA, USA) 30 minutes before kidney removal. The

donor kidney was flushed with 2 ml/g kidney weight cold lactated Ringers solution containing 1

mM deferoxamine mesylate (Sigma-Aldrich, St. Louis, MO, USA) and 3 mM 4-hydroxy-tempo

(Sigma-Aldrich, St. Louis, MO, USA) removed and placed in the same cooled solution for 10

minutes. Recipients were treated with 1% L-arginine (Fresenius Kabi Clayton, Clayton, NC,

USA) and 1 mM 4-hydroxy-tempo in the drinking water one day before Tx and for 10 days

thereafter to provide overall EP.

We used additional tissue solely as positive control for the NADPH oxidase-dependent

superoxide production assay. Female Lewis recipients received renal grafts from female Fisher

donors (30 min ischemia time) and were treated with cyclosporine (Novartis, Basel, Switzerland)

at 1.5 mg/kg/day for 10 days. The contralateral donor Fisher kidney was harvested at Tx and the

allograft was harvested at week 7 because of severe rej section; these provided normal control and

severely inflamed samples, respectively.

Urine samples were collected in metabolic cages at 22 wks after Tx for determination of

urinary NOx and total protein excretion. Just prior to sacrifice, blood pressure (BP) was









measured, under general anesthesia and a blood sample taken for analysis of plasma creatinine.

Kidneys were then perfused until blood-free, decapsulated, removed and weighed. A thin section

of kidney including cortex and medulla was fixed for histology and the remaining cortex and

medulla was separated, flash frozen in liquid nitrogen and stored at -800C for later analysis.

Kidney sections were fixed in 10% buffered formalin, blocked in paraffin and 5 Cpm sections

were stained with PAS. Glomerular sclerosis, interstitial, tubular, and vascular lesions were

graded according the Banff classification. Renal nNOS and eNOS abundance were determined

by Western blot. In addition, cerebellum (5 Cpg) and skeletal muscle (150 Cpg) were also used for

detection of nNOSa in this study. End-point RT-PCR was used for semi-quantitative analysis of

mRNA. In I/R series, NADPH-dependent superoxide production in kidney cortex was measured

by Electron Spin Resonance (ESR) spectroscopy with hydroxylamine spin probe 1-hydroxy-3-

carboxypyrrolidine (CPH). All analyses were performed as described in chapter 2.

Results are presented as mean+SEM. Parametric data was analysed by t-test and ANOVA.

Nonparametric data was analysed by the Mann-Whitney test. P<0.05 was considered significant.

Results

All ALLO rats survived to 22 weeks post Tx. As shown in Table 4-1 both CsA and RAPA

groups had higher urine NOx excretion than control. Both CsA and RAPA groups developed

renal failure represented as increased plasma Cr, BUN, and decreased clearance of Cr. BP was

lower in both ALLO vs. control possibly reflecting a lower BP in the Lewis ALLO recipients.

Both ALLO groups had greater kidney weight vs. control presumably due to compensatory

hypertrophy.

We found RAPA group exhibited significantly more sclerotic glomeruli than CsA group

and their respective control (Figure 4-1). Banff score summarizing glomerular, tubular,

interstitial and vascular changes demonstrated more severe injury in RAPA group compared to









CsA group. CsA group displayed lower urine protein excretion than control, while there was no

difference between RAPA group and control. Using the N-terminal antibody, cortical nNOSa

protein was nearly undetectable in RAPA group (Figure 4-2). In contrast, there was no difference

in nNOSa abundance in skeletal muscle (0.0076 & 0.0005 vs. 0.0084 & 0.0005 IOD/Int Std/Ponc)

and cerebellum (0.0064 & 0.0024 vs. 0.0088 & 0.0006 IOD/Int Std/Ponc) between CsA and

RAPA groups. As shown in Fig 4-3, nNOSa mRNA significantly increased in CsA group

compared to controls (Fig 4-3A), whereas nNOSP mRNA significantly increased in RAPA group

(Fig 4-3B). Using the C-terminal nNOS antibody, nNOSP protein (~140kDa) was significantly

higher in the cortex of RAPA group compared to CsA and normal 2 kidney controls (Fig 4-4).

In I/R series, ISO-UN and ISO-EP groups had similar body weights (BW), kidney weights

and the ratio of KW/BW, which was higher than in controls due to compensatory hypertrophy

(Table 4-2). Ccr, plasma Cr and BUN were similar in both groups of ISO and lower vs. normal

controls (Table 4-2).

Mild proteinuria developed in the ISO-UN rats (Table 4-2) while the ISO-EP group

showed no change from baseline or from controls at week 22. By histology, the ISO-EP and

ISO-UN rats, developed moderate and similar glomerulosclerosis and tubulointerstitial injury vs.

controls (Figure 4-5). Despite the lack of proteinuria the EP group was not protected from

structural damage compared to the UN rats.

The EP protocol should provide protection against inflammation and oxidative stress pre-

and for the 10 days post Tx; the period where I/R injury would likely be developing. However,

as shown in Figure 4-6, by 22 weeks post Tx there was no difference in renal NADPH-dependent

Ol~ prOduction in ISO-EP and ISO-UN kidney cortex. This assay is able to detect oxidative stress









since we observed increased renal NADPH-dependent Ozl prOduction in female Lewis allograft

recipients undergoing severe graft rej section compared to normal kidney (Fig 4-6).

By Western blot, ISO-EP rats showed lower nNOS and eNOS protein abundance in renal

cortex vs. ISO-UN (Figure 4-7A) but the in vitro NOS activity in both soluble (main location of

the nNOS) and membrane (main location of the eNOS) fractions were similar between the 2

groups (Figure 4-7B).

Discussion

The novel finding of this study is that short-term RAPA treatment (10d) had a long-term

(22w) effect to reduce the renal cortical nNOSa protein abundance, but with increases in the

nNOSP abundance. This may explain why the almost total loss of nNOSa seen in RAPA group

was associated with same degree of renal dysfunction as that in CsA group.

In the renal mass reduction model there is a linear inverse relationship between increasing

glomerular injury and decreasing renal cortical nNOSa abundance, once glomerular injury

exceeds ~20 % (130). Consistent with this finding, CsA-treated allografts developed ~20% of

glomerulosclerosis and their nNOSa abundance was maintained. However, the RAPA treated

allograft showed marked reduction (near zero) in nNOSa in renal cortex. Based on our 5/6 A/I

studies in the SD rat (130) we would expect this to result in massive renal damage and yet the

F344 to Lewis RAPA treated allograft showed only ~30% of glomerular injury, suggestive of

compensatory changes, perhaps by another nNOS isoform.

Of note, there was no difference in abundance of nNOSa in either skeletal muscle or

cerebellum in RAPA compared to CsA treated ALLO rats. Why RAPA specifically inhibits

nNOSa protein expression only in renal cortex but not other nNOS abundant tissues is unclear.

One possibility is that tubular reabsorption and concentration of RAPA leads to elevated tissue

concentrations compared to e.g., skeletal muscle (99) and that the nNOSa isoform may be









particularly sensitive to RAPA. There is no data available on the impact of RAPA on nNOS

expression although RAPA induced increases in aortic eNOS protein expression have been

reported in Apo E knock out mice (98).

We have identified mRNA and protein of nNOSa and -P in rat kidney as described in

chapter 3. Here we demonstrated that ALLO male rats given RAPA showed increases in both

nNOSP mRNA and protein abundance vs. CsA treated male rats. Since NOSP has ~80% the

activity of nNOSa in vitro (20), this suggests that the increased nNOSP may compensate for the

decreased nNOSa activity in response to RAPA. With regard to renal Tx, experimental NOS

inhibition worsens injury, while L-arginine supplementation decreases renal damage suggesting

that NO plays a protective role (2, 124). Although the RAPA group displayed a moderately

higher degree of glomerulosclerosis than CsA group, both groups had similar reduction of renal

function. It suggests that the increased nNOSP compensates for the decreased nNOSa activity to

maintain similar renal function in RAPA group vs. CsA group.

In the 2nd SerieS we found that short-term (10 day) intensive endothelial protection (EP)

with combined antioxidant and anti-inflammatory treatment at the time of Tx (ISO) has no long-

term benefit in terms of structure or function. While much of the chronic renal Tx damage is

antigen-dependent, non-immunological mechanisms also contribute (92). Because

uninephrectomized Fisher kidneys are functionally, morphologically and immunologically

identical to two-kidney controls (6), the injury must come from Tx-induced I/R injury. Not all

strains show susceptibility to I/R-injury since ISO kidneys in Brown Norway rats showed normal

function and structure at 1 year after Tx (76).

We also found that there was no structure/function protection with EP therapy nor was the

long-term increase in renal NADPH-dependent Ozl prOduction prevented. This contrasts to









studies in ALLO (Fisher to Lewis) where function/structure is improved by short term

immunosuppres sive/anti -inflammatory treatment to the donor (1 12). Short term L-Arginine has

functional benefit to human ALLO recipients (121). Although the individual agents that we used

in this study have been shown to provide short-term renoprotection (1 hr to 9 days) against I/R

injury, their long-term effects are unclear. Thus, our Eindings suggest that the "optimal" donor

kidney, in the absence of alloreactivity, does not benefit from EP therapy. There is likely to be

benefit from treatment of ALLO in man, particularly where "expanded donor criteria" are used.

Despite similar structural damage there was a lower renal cortex nNOS and eNOS protein

abundance in the treated ISO-EP vs. ISO-UN kidneys. Of note, however, the in vitro NOS

activity of both soluble and membrane fractions of renal cortex were similar in ISO-EP and ISO-

UN. This highlights the complexity of the regulation of NOS enzyme activity which is

influenced by many posttranslational modifications as well as by protein abundance. Although

the oxidative state is a maj or regulator of nNOS protein abundance and activity, there was no

difference in the amount of 02- generated by NADPH oxidase between untreated and treated

groups. These Eindings suggest that EP therapy partially restores NO synthesis and endothelial

function so that lower abundance of nNOS and eNOS are required in ISO-EP rat. However, the

net renal NOS activity is not improved.

In summary, nNOSa abundance can be maintained in mild Tx-induced CKD in the CsA

ALLO and although the RAPA ALLO rats showed almost no nNOSa, increased nNOSP

compensated to limit injury and preserve renal function. In the ISO studies, short term combined

antioxidant therapy did not prevent the chronic Tx-induced I/R injury in donor kidneys that were

optimally harvested from living donors.









Table 4-1. Functional parameters in Tx and control groups 22 weeks after transplantation
BW UprotV UNOxV PCr BUN CCr BP TX weight
(g) (mg/day) (CLM/day/100g (mg/dl) (mg/dl) (ml/min/ (mmHg) (g)
B W) Kg BW)
CsA 451f12 16f2* 1.29f0.10* 0.4510.04* 30~11* 5.410.3* 6313** 2.1810.10*
RAPA 436f9 37f17 1.45f0.17* 0.4910.03* 2611* 5.010.3* 7915* 2.2110.12*
Control 456f8 36f4 0.81f0.03 0.3 0f0.02 1 8f2 7.3f0.5 113f3 1 .84f0. 14
Values are represented as mean & SEM. UproV, 24hr urine protein; CCr, 24hr clearance of
creatinine; TX, transplanted kidney. *p<0.05 vs control, #p<0.05 vs. RAPA.










Table 4-2. Weight and renal function measures at 22 wk after kidney transplantation or similar
time in control


ISO-UN
408115*
2.2010.14
5.3610.02*
23~11*
0.5010.02*
4.310.4*
51+9


ISO-EP
396113*
2.3610.16
5.9610.36*
21~11
0.4410.02*
4.610.1*
31+4'


CON
45618
1.8410.14
4.0710.35
1811
0.3010.02
7.310.5
3614


Body weight (g)
Kidney weight (g)
Kidney weight/body weight x1,000
Blood urea nitrogen (mg/dl)
Plasma creatinine (mg/dl)
CCr/BW (ml/min/kg BW)
UprotV (mg/24hr)


Values are represented as mean & SE; abbreviations are: ISO-UN, isograft without therapy; ISO-
EP isograft with endothelial protection; CON, time control; CCr, 24hr clearance of creatinine;
UproV, 24hr urine protein; *p<0.05 vs. CON; #p < 0.05 vs. ISO-UN. Reprinted with permission
from S. Karger AG, Basel (134).










B7


6


J 4


0 1 0
Figure 4-1. Renal outcome in ALLO grafts at 22 weeks after Tx. A) % of Glomerulosclerois. B)
Banff score. *p<0.05 vs. control, #p<0.05 vs. CsA.


I CsA















Ponc 162 162 163 164 162 162 163 164 162 162
IOD x106


PC CsA


Rapa


Co ntrolI


0.016

0.014

0 0.012
o
a. 0.010


:- 0.006


0.002



0.000


ND


CsA


Rapa


Figure 4-2. Renal cortical nNOSa protein abundance in CsA and RAPA ALLO rats. The
molecular weight marker is in the first line. PC represents positive control. The bands
were analyzed and represented as integrated optical density (IOD). The Ponc IOD
represents total protein loading detected by Ponceau red staining, which shows equal
loading in all lanes. The nNOSa protein abundance was factored for Pone to correct
for any variations in total protein loading and for an internal standard (Int Std). ND
represents not detectable. *p<0.05 CsA vs. RAPA.


Control












B
1.o .






o
0.5


nNOSa


2.0-
-

a)1.5-

S1.0-
o
10.5-

0.0-


-r


CsA RAPA


CsA RAPA


rl 8S


Control CsA RAPA

Figure 4-3. Renal cortical nNOSa and nNOSP mRNA abundance in CsA and RAPA treated
ALLO male rats and controls (n=5 in each group). A) nNOSa. B) nNOSP. C) The
rl8S was used as an internal standard. *p<0.05 vs. control.


nNOSl3


I
Control


I I
Control













Con CsA RAPA Con CsA RAPA RAPA KM Cere


+nnNOSa

pos FIegula alon agl sae nNOSP




30-r~lli)LL_ L*) C~IIII~- -

Co r.L












Control CsA RAPA

Figure 4-4. Renal cortical nNOSP protein abundance in CsA and RAPA treated male rats and
controls. A) Representative western blot whole membranes show nNOSa band (~160
kDa) and nNOSP band (~140 kDa). Cere represents cerebellum used as positive
control for nNOSa. KM represents kidney medulla used as positive control for
nNOSP. B) Densitometry (n=5 in each group). *p<0.05 vs. control.














4U
A


(n 30-








2 0





CON ISO-EP ISO-UN



6

B
5-


4-

0



2-


1-


0
CON ISO-EP ISO-UN



Figure 4-5. Renal pathology at 22 wk after kidney transplantation. A) % of glomerulosclerosis.
B) Banff score (0-12). *p < 0.05 vs. CON. Reprinted with permission from S. Karger
AG, Basel (134).















o 200-



g 150-


OR 100-



-cE 50-

00


Normal Donor RK ISO-EP ISO-UN Severe Rej LK



Figure 4-6. NADPH-dependent superoxide production of ISO-UN, ISO-EP, and acutely rej ecting
allografts and the control kidneys. *P < 0.05 vs. normal donor RK; "P <0.05 vs.
severe rej section LK. Reprinted with permission from S. Karger AG, Basel (134).














0.5 -


MM ISO-UN
SISO-EP


0.0 '


nNOS eNOS


'20.4




0.2


0.0 '


Mem


Figure 4-7. NOS protein abundance and activity in ISO-UN and ISO-EP rats. A) Relative
abundance of renal cortex neuronal (nNOS) and endothelial nitric oxide synthase
(eNOS). B) In vitro NOS activity in the soluble (Sol) and membrane fraction (Mem)
of cortical homogenates. *P < 0.05 vs. ISO-UN. Reprinted with permission from S.
Karger AG, Basel (134).









CHAPTER 5
DETERMINATION OF DIMETHYLARGININE DIMETHYLAMINOHYDROLASE
ACTIVITY IN THE KIDNEY

Introduction

Dimethylarginine dimethylaminohydrolase (DDAH) metabolizes the methylarginines

asymmetric dimethylarginine (ADMA) and Nw-monomethyl-L-arginine (L-NMMA), to generate

L-citrulline, and is highly expressed in the kidney (84). ADMA is elevated in many systemic

diseases, including renal failure, possibly due to impaired renal DDAH activity.

Dimethylarginine dimethylaminohydrolase activity can be measured by rate of substrate

(e.g., ADMA) consumption but these assays are time consuming and costly (61, 87). A

colorimetric method that detects L-citrulline production can also be used providing that 1). Other

pathways that generate or remove L-citrulline are inactivated and 2). Interfering compounds have

been removed.

Here, we have optimized the Prescott-Jones method (109) using diacetyl monoxime

(DAMO) derivatization of the ureido group in L-citrulline to form color that has been adapted to

a 96-well format (73). Particular attention was paid to nonspecific color generation by urea (46).

Furthermore, we compared this modified L-citrulline assay to the direct HPLC method

measuring rate of ADMA consumption.

Materials and Methods

Male Sprague Dawley rats from Harlan (Indianapolis, IN, USA) were used. Tissues were

collected after perfusion with cold PBS and stored at -800C. Protein concentration was

determined by Bradford assay. Tissue homogenate was adjusted to the concentration of

20mg/ml. Several pilot studies were conducted to optimize the assay including evaluation of

homogenization buffer, deproteinization reagents and other pathways if citrulline metabolism.









Optimization of Homogenization Buffers

We tested 4 different homogenization buffers: HE l, pH=6.8 which contained 20 mM Tris,

1% Triton X-100, 5 mM EDTA, 10 mM EGTA, 2mM DTT, 1 mM sodium orthovanadate, 0.1

mg/ml phenylmethylsulfonyl fluoride, and 10 Clg/ml leupeptin and aprotinin; HB2 contained

0.1M sodium phosphate, pH=6.5 containing 2mM 2-mercaptoethanl; HB3 contained 0.1M

sodium phosphate, pH=6.5; and HB4 was RIPA buffer (Santa Cruz Biotechnology, Santa Cruz,

CA, USA), which contained 20 mM Tris, pH=7.6, 137mM sodium chloride, 0.2% Nonidet P-40,

0.1% sodium deoxycholate, 0.02% SDS, 0.0008% sodium azide, and protease inhibitor cocktail.

L-citrulline, sulfosalicylic acid, trichloroacetic acid, sulfuric acid, antipyrine, sodium nitrite

and urease were purchased from Sigma. ADMA and diethylamine NONOate (DEA NONOate)

were purchased from Cayman, 2,3-Dimethoxy-1 ,4-naphthoquinone (DMNQ) was from AG

Scientific Inc., Nw-Hydroxy-nor-L-arginine (nor-NOHA) was from Calbiochem. Diacetyl

monoxime was from Fisher. The 96-well polystyrene plate and thermo resistant sealing tape

were from Costar Corning Inc.

In pilot studies, in the presence of 25CLM L-citrulline, we tested the effect on background

color of 4 different homogenization buffers (HBl1-4) and the following common additives: 0. 1M

sodium phosphate buffer (pH=6.5), 1% Triton X-100, IM HEPES, 0.3M sucrose, 100nM urea,

0.9% NaC1, 0.1M DTT, 1% 2-mercaptoethanol, 0.5% Tween, 1% SDS, 0.5M EDTA, and 0.2M

EGTA. 0.1M sodium phosphate buffer, pH=6.5 containing protease inhibitors (0.1 mg/ml

phenylmethylsulfonyl fluoride, and 10 Clg/ml leupeptin and aprotinin) was examined for the

effect of protease inhibitors on color formation. We also determined whether protease inhibitors

were required for stability of DDAH in this assay. We found that protease inhibitors were not

required and that the simple HB3 gave optimal color. Other reagents, ImM ADMA and 4%

sulfosalicylic acid, used in this assay were also examined for their impact on color formation.









The effect of protein content was tested by using B SA and kidney homogenate at the

concentrations of 1 and 2 mg/ml. Serial diluted L-citrulline standards (0-100 CLM) were prepared

in distilled water. All samples were analyzed in triplicate. The contribution of buffer/additive to

color formation was represented as percent of mean absorbance of each sample compared to

25CLM L-citrulline (=100%). The findings from these pilot studies were used to optimize the

assay for kidney tissue.

Optimization of Deproteinization

One mM ADMA in sodium phosphate buffer 0. 1M, pH=6.5 were prepared for use as

substrate. 4-20% sulfosalicylic acid, 4% sulfuric acid, and 1N hydrochloric acid were prepared as

deproteinization solutions. As shown in Table 5-1, in the absence of deproteinization the

absorbance was very high (due to detection of protein-bound L-citrulline and increased turbidity)

and the optimum deproteinization solution (giving the minimal absorbance was 4% sulfosalicylic

acid). L-citrulline standard solution was made by adding 17.5mg of L-citrulline to 1000ml

sodium phosphate buffer to make 100CLM standard, used as stock solution. Oxime reagent (0.8%)

was made by adding 0.8g of diacetyl monoxime in 100ml of 5% (v/v) acetic acid. This solution

was stored in the dark at 40C. Antipyrine/H2SO4 reagent (0.5%) was made by adding 0.5g

antipyrine in 100ml of 50% (v/v) sulfuric acid. ImM and 0.1ImM DMNQ was prepared as

superoxide donor; 1mM and 0.1mM sodium nitrite and DEA NON~ate were used as NO donors;

0.01mM, 0.1ImM, and 0.5mM nor-NOHA was prepared for inhibition of arginase.

Tests for Other Pathways That Could Alter Citrulline Concentration

It is theoretically possible that citrulline could be simultaneously consumed by the

ASS/ASL enzymes that are abundant in kidney. We incubated kidney homogenate with excess

citrulline (200CLM) in the absence of ADMA (n=4). At incubation time was 0 and 90min, 0.5ml









of 4% sulfosalicylic acid was added for deproteinization and assayed. We found citrolline

formation at t=0 and 90 min were similar, suggesting no citrulline consumption.

The activity of the NOS enzymes (which can also generate citrulline) was automatically

inhibited by the presence of a high concentration of ADMA, as well as the lack of essential

cofactors (NADPH, FMN, FAD, BH4 etc). When the assay had been optimized for kidney we

also investigated the impact of NO and superoxide (using DEA NONOate, nitrate, and DMNQ)

on DDAH activity. Kidney homogenate was pre-incubated with urease at 37oC for 15min, then

400ul of mixture of ADMA and drugs were added to the homogenate and incubated at 37oC for

45min.

To determine the inter- and intra-assay variability we ran supernatant of kidney cortex

(which after deproteinization could be stored at -80oC and remained stable after 1 freeze/thaw

cycle) in 12 different assays and 9 times in one assay.

Recommended assay procedures are summarized in Table 5-2. A time course study was

conducted with pre-incubation of urease with homogenates of rat kidney cortex, liver,

cerebellum, and aorta, then incubation with 1mM ADMA from 0 to 120min. We also

investigated the impact of NO and superoxide (diethylamine NONOate, sodium nitrate, and 2,3-

Dimethoxy-1 ,4-naphthoquinone, DMNQ) on DDAH activity.

Comparison of Citrulline Assay and Asymmetric Dimethylarginine Degradation by High
Performance Liquid Chromatography

We compared the rate of L-citrulline production by DDAH with the rate of ADMA

degradation at t=0, 30, 45, 90 and 120min. In this study 400 Cl1 of 1mM ADMA was mixed with

the 100Cl of kidney homogenate (20mg/ml) and 100Cpl of the mixture was collected for HPLC

analysis of ADMA at the various times, given above. ADMA (and L-arginine) levels were









measured in tissue homogenate using reverse-phase HPLC with the Waters AccQ-Fluor

fluorescent reagent kit as described in chapter 2.

Statistical Analysis

Data are presented as mean + SEM. The effects of arginase inhibitor, NO and superoxide

were compared by unpaired t test. The correlation between L-citrulline formation and ADMA

consumption was analyzed by Pearson correlation coefficient.

Results

Optimization of Citrulline Assay

The enzyme is saturated at between 100 CLM and 1 mM substrate (ADMA) and we

therefore use ImM ADMA in all studies. We compared 4 different homogenization buffers and

found sodium phosphate buffer, pH=6.5, was without effect on color formation (Table 5-3).

Without deproteinization both BSA and the kidney homogenate caused turbidity. 4%

sulfosalicylic acid gave the lowest blank absorbance and was used for deproteinization (Table 5-

1). With deproteinization, there was no background color with BSA although the kidney

homogenate still had high color, suggesting the presence of interfering factors.

Effect of Urea on Citrulline Assay

As shown in Figure 5-1, the high background color seen in the deproteinized kidney

homogenate was reduced by >95% at t=15min after incubation with urease. Added urea: 1, 5, 10,

50, and 100 mM gave color equivalent to ~21, 49, 106, 195, and 221 CLM L-citrulline,

respectively but gave no background color at t=0 when pre-incubated with urease for 15 min.

After pre-incubation with urease, citrulline production in kidney and other tissue

homogenates incubated with 1mM ADMA was linear from 0 to 120 min (Figure 5-2). Without

urease treatment, the high background color due to urea obscures DDAH-dependent L -citrulline

formation until ~ t=45min (Figure 5-3). We used a 45min incubation in subsequent studies.










Comparison of Dimethylarginine Dimethylaminohydrolase Activity Measured by
Citrulline Accumulation with Asymmetric Dimethylarginine Consumption

In kidney cortex the rate of production of L-citrulline = 0.3976CLM / g protein/min and the

corresponding rate of consumption of ADMA =0.4378CLM /g protein/min are similar (Figure 5-

4), suggesting that this assay gives a faithful measurement of DDAH activity.

Tests for Other Pathways That Could Alter Citrulline Concentration

Further, when we measured the rate of ADMA degradation under the same assay

conditions, we found that at t=0, 30, 45, 90 and 120min the L-arginine concentration was stable

(89, 85, 87, 85, and 91 CLM respectively), suggesting no net synthesis of arginine. This constancy

of L-arginine also suggested that arginase activity was not active under the conditions of this

assay, a Einding confirmed by the lack of effect of the arginase inhibitor (nor-NOHA; 0.01 -

0.5mM) when incubated with urease treated kidney homogenate for 45min (Figure 5-5). The

renal cortex and medulla DDAH activity was 0.3910.01 (n=15) and 0.3010.01 (n=3) CLM/g

protein/min, respectively. Inter- and intra-assay coefficient of variation are 5.6110.28 % (n=12)

and 4.8210.19 (n=9). The NO donors and superoxide donor inhibited DDAH activity (Figure 5-

6).

Discussion

We have used the Prescott-Jones method to measure kidney DDAH activity from rate of

L-citrulline production and found: Urea markedly raises background and must be removed;

deproteinization is essential and the choice of deproteinization method influences background

color; the modified method correlates well with rate of ADMA consumption, and both

superoxide and NO, known to inhibit DDAH activity, produce declines in rate of L-citrulline

formation in kidney homogenates.










Knipp and Vasak (73) adapted the Prescott-Jones assay to a 96-well plate method for

measurement of activity of the purified DDAH enzyme. However, in complex tissues there may

be agents that reduce or increase color development and alter L-citrulline metabolism. Of

particular note, the development of color is not specific for L-citrulline but also occurs with urea

(46) and there is a urea concentration gradient in kidney (~4mM in cortex and ~20mM in inner

medulla) (114). Even in renal cortex, urea accounts for more than 90% of baseline absorbance,

and therefore obscures DDAH-induced changes in color due to citrulline formation. In the

presence of urease, the effect of urea (up to 100mM) can be completely removed from kidney

cortex and medulla. Kulhanek et al. (78) reported that urease treatment was not required for

citrulline assay in liver and brain. Our results, however, demonstrate that where urea

concentration is measurable, urease should be used. Although the urea effect can be prevented by

initial ion-exchange chromatography (103), this is more costly and time consuming compared to

urease.

Another difficulty is that the DAMO reagent can detect protein-bound L-citrulline as well

as free L-citrulline. Although no separate protein-removing step was required in the purified

enzyme system (73), in tissues, protein precipitation is mandatory. We found that 4%

sulfosalicylic acid gave lowest background.

Buffer/additives also influence color development, for example 2-mercaptoethanol (in

HB2) reduces color formation which might explain our observation of a higher renal DDAH

activity than a previous study using HB2 (68). Without urease treatment, the high background

color due to urea obscures DDAH-dependent L -citrulline formation until ~ t=45min, which

might also explain the longer incubation time used previously (26, 126, 162).









In addition to DDAH, ornithine carbamoyltransferase (OCT) and NOS generate L-

citrulline. In this assay, activity of both enzymes can be ignored since OCT is not detectable in

kidney and ImM ADMA used as substrate is a potent NOS inhibitor. On the other hand, L-

citrulline can be converted to L-arginine by argininosuccinate synthase (ASS) and lyase (ASL).

However, in tissue homogenate citrulline consumption by ASS & ASL requires added aspartate

(1 10) and ATP and we found no citrolline consumption under the conditions of our assay.

Furthermore, arginases, which might indirectly increase L-citrulline consumption by increasing

rate of L-arginine utilization (28), are not active since arginase inhibition did not affect L-

citrulline formation and there was no L-arginine consumption.

Both oxidative and nitrosative stress have been reported to inhibit DDAH activity (71, 82)

and in this study we show that both superoxide and NO donors have an acute inhibitory action on

renal cortex DDAH activity, measured from L-citrulline production.

In conclusion, this colorimetric assay of L-citrulline accumulation is a simple and

inexpensive method optimized for detection of renal tissue DDAH activity in vitro, which agrees

well with the more costly and time consuming method of measuring ADMA consumption. This

can also be adapted for other tissues, even with low activity such as cerebellum, but should be

optimized prior to use.










Table 5-1. Effect of deproteinization reagents on absorbance of blank
Ab sorbance
2mg/ml kidney homogenate without 1.11410.275
deproteinization
Sulfosalicylic acid
4% 0.22710.006
10% 0.25410.023
Trichloroacetic acid
10% 0.79010.016a
20% 1.33210.085a
Sulfuric acid 4% 0.35510.022
Hydrochloric acid IN 0.35710.011
All measurements were analyzed in triplicate.
a The supernatant was opalescent.
Reprinted with permission from Nature Publishing Group (132).










Table 5-2. Effect of buffers and additives on the L-citrulline assay in the presence of 25CLM L-
citrulline
L-citrulline CLM Color as % of control
Homogenization buffer
HB 1 17.010.8 68
HB2 HB3 24.910.6 100
HB4 >1000 464
Buffer base
1% Triton 13.010.9 52
IM HEPES 27.510.4 110
0.3M sucrose >100 500
0.9% normal saline 24.610.6 98
0.1M sodium phosphate 24.910.6 100
100mM urea >100 1419
Additives
0. 1M DTT >100 384
1% 2-mercaptoethanol 0.5% Tween 22.211.0 89
1% SDS 22.313.7 89
0.5M EDTA 25.6+3.0 102
0.2M EGTA 33.610.6 134
1mM ADMA 22.210.8 89
Protease inhibitorSb 23.210.3 95
4% sulfosalicylic acid 28.211.0 113
Protein
1 mg/ml BSA 33.612.80 134
2 mg/ml BSA 43.317.80 173
1 mg/ml kideny homogenate 76.312.1" 305
2 mg/ml kidney homogenate >1000 415
Protein with deproteinization
1 mg/ml BSA 26.110.8 107
2 mg/ml BSA 25.710.8 103
1 mg/ml kidney homogenate 63.411.1 253
2 mg/ml kidney homogenate 82.611.2 330
The values reflect effect of an additive on the color generated by a 25CLM L-citrulline standard
(taken as 100%).
aHBl, pH=6.8 contained 20 mM Tris, 1% Triton X-100, 5 mM EDTA, 10 mM EGTA, 2mM
DTT, 1 mM sodium orthovanadate, 0.1 mg/ml phenylmethylsulfonyl fluoride, 10 Clg/ml
leupeptin and aprotinin; HB2 contained 0.1M sodium phosphate, pH=6.5 containing 2mM 2-
mercaptoethanl (66); HB3 contained 0.1M sodium phosphate, pH=6.5; and HB4 was RIPA
buffer (Santa Cruz), containing 20 mM Tris, pH=7.6, 137mM sodium chloride, 0.2% Nonidet P-
40, 0.1% sodium deoxycholate, 0.02% SDS, 0.0008% sodium azide, and protease inhibitors.
b Protease inhibitors: 0.1 mg/ml phenylmethylsulfonyl fluoride, 10 Clg/ml leupeptin and
aprotinin. The supernatant was opalescent.
Reprinted with permission from Nature Publishing Group (132).









Table 5-3. Recommend assay procedures/conditions for the measurement of renal cortical
DDAH activity
1. Homogenize tissue with 5X sodium phosphate buffer, pH=6.5
2. Adjust protein concentration to 20mg/ml
3. Pre-incubate urease (100U/ml homogenate) with tissue homogenate in 370C
water bath for 15min
4. Add 100pl sample to 400Cl 1mM ADMA in sodium phosphate buffer
respective blank is sample omitting ADMA
5. Incubate mixture in 370C water bath for 45min
6. Stop reaction by addition of 0.5 ml of 4% sulfosalicylic acid
7. Vortex and centrifuge at 3,000g for 10min
8. Add 100pl supernatant into a 96-well plate in triplicate
9. Serially dilute 100CLM L-citrulline standard to 0, 3.125, 6.25, 12.5, 25, 50, and
100pLM
10. Add 100pl of standard into the 96-well plate in triplicate
11. Mix one part of oxime reagent with 2 parts of antipyrine/ H2SO4 reagent to
make the "color mixture"
12. Add 100pl of color mixture into the wells
13. Cover the plate with a sealing tape
14. Shake on a plate shaker for 1min
15. Incubate the plate in 600C water bath for 110 min in the dark
16. Cool the plate in an ice bath for 10min
Reprinted with permission from Nature Publishing Group (132).













100

r

E 80



-* Without urease
5 60- 0 With urease



-- 40 -



O







Incubation time, min


Figure 5-1. Time course of the urea effect on color formation without substrate (ADMA) in the
absence (solid circle) and presence of urease (open circle). Each time point
determined in triplicate. Reprinted with permission from Nature Publishing Group
(132).















*Kidney cortex
O Liver
r Cerebellum
30 A Aorta





20-
O




Or





0 20 40 60 80 100 120

Incubation time, min


Figure 5-2. Time course of DDAH activity in different rat tissues: kidney cortex (solid circle),
liver (open circle), cerebellum (inverted solid triangle), and aorta (open triangle).
Each time point determined in triplicate. Reprinted with permission from Nature
Publishing Group (132).













80
o

E -* Without urease .0
-0O With urease
S60-




40 -0


OO


E 20- O0


O



0 20 40 60 80 100

Incubation time, min

Figure 5-3. Time course of color formation in citrulline equivalents in the presence of the DDAH
substrate (ADMA) in the absence (solid circle) and presence of urease (open circle).
Each time point was determined in triplicate. Reprinted with permission from Nature
Publishing Group (132).












60








40





30


0 20 40 60 80 100 120


Incubation time, min


Figure 5-4. Correlation of L-citrulline formation as a measure of DDAH activity (solid circle,
solid line) with the rate of ADMA consumption (open circle, dashed line). Reprinted
with permission from Nature Publishing Group (132).














0.4-

I 0 .01mM

I 0.5mM



o


8 0.2-




S0.1-





0.0
Control Nor-NOHA



Figure 5-5. The effect of arginase on the L -citrulline assay to detect renal DDAH activity. Nor-
NOHA was used as arginase inhibitor. All measurements were analyzed in triplicate.
Reprinted with permission from Nature Publishing Group (132).













0.4~~M 1 ~mM



S0.3-




S0.2-









0.0
Control NONOate Nitrite DMNQ


Figure 5-6. The effect of NO and superoxide on the L-citrulline assay to detect renal DDAH
activity. DEA NONOate and nitrite were used as NO donors; and DMNQ was used as
superoxide donor. All measurements were in triplicate. *p<0.05 vs. control; #p<0.05
0.1ImM vs. ImM. Reprinted with permission from Nature Publishing Group (132).









CHAPTER 6
VITAMIN E REDUCES GLOMERULOCLEROSIS, RESTORES RENAL NEURONAL
NITRIC OXIDE SYNTHASE, AND SUPPRESSES OXIDATIVE STRESS IN THE 5/6
NEPHRECTOMIZED RAT

Introduction

Chronic kidney disease (CKD) is accompanied by oxidative stress and nitric oxide (NO)

deficiency (10, 95). In CKD, oxidative stress results from increased production of reactive

oxygen species (ROS) as well as decreased antioxidant enzyme capacity. The maj or ROS is

superoxide and in kidney this is said to be mainly generated by NADPH oxidase (44). NO

deficiency in CKD has many causes including inactivation of NO by oxidative stress; inhibition

of NOS enzyme activity by increased levels of endogenous inhibitors and in kidney there is

reduced neuronal nitric oxide synthase-a (nNOSa) enzyme abundance/activity (10, 95, 150).

Because superoxide (Ol-) and NO have counterbalancing actions and reciprocally reduce each

other' s bioavailability, an imbalance of NO and superoxide may shift the kidney toward a state

of Ol- dominance causing renal vasoconstriction, enhanced tubular sodium reabsorption,

increased cell and extracellular matrix proliferation and CKD progression (95). Therefore,

antioxidants have been considered for prevention of CKD progression by reducing oxidative

stress and/or preserving NO bioavailability.

Vitamin E is a potent, naturally occurring lipid-soluble antioxidant that scavenges ROS

and lipid peroxyl radicals. The most active and predominant form of vitamin E is a-tocopherol

and this has been used therapeutically in many conditions although the impact of vitamin E on

CKD progression is controversial (5, 19, 22, 45, 50, 69, 111, 147). In this study we investigate

the impact of the 5/6 renal ablation model on renal nNOS isoform abundance and also whether

the protective effects of vitamin E therapy are associated with preservation of renal nNOSa

abundance and reduction in NADPH-dependent superoxide generation. The endogenous NOS









inhibitor asymmetric dimethylarginine (ADMA), generated by type I protein arginine

methyltran sferase (PRMT) and metab ol sized by di methyl argi ni ne dim ethyl ami nohy drol ase

(DDAH), is increased in CKD (10). In this study we also determined the impact of vitamin E

treatment on the circulating level of ADMA and on PRMT 1 abundance as well as abundance and

activity of DDAH.

Materials and Methods

Studies were conducted on 17 male Sprague Dawley rats (12 week-old) purchased from

Harlan (Indianapolis, IN, USA). Rats were kept under standard conditions and fed rat chow and

water ad libitum. All rats had baseline metabolic cage measurements and were subjected to either

sham surgery or 5/6 NX. 5/6 NX was performed under isoflurane general anesthesia using full

sterile technique. By retroperitoneal approach, 2 poles of the left kidney were removed and then

one week later the right kidney was removed. All rats were assigned to the following groups at

the time of the first surgery: Group 1 (sham, n=6), sham-operated rats kept on regular rat chow

(powdered) and tap water; Group 2 (5/6 NX, n=6), 5/6 NX rats maintained on regular rat chow

and tap water; and Group 3 (5/6NX + VitE, n=5), 5/6 NX rats treated with vitamin E

supplementation (Sigma Diagnostics, St. Louis, MO, USA) of regular rat chow containing a-

tocopherol 5000 IU/kg of chow, begun at the polectomy surgery.

In all rats, 24h urine was collected in metabolic cage for measurement of protein by

Bradford method and total NO production (from NOx =NO3- +NO2-) by Greiss reaction every

other week after surgery. Rats were followed for 15 weeks after surgery and then sacrificed. At

sacrifice, blood pressure was measured via abdominal aorta then an aortic blood sample was

collected for measurement of plasma creatinine, ADMA, and NOx levels. The left kidney

remnant was perfused blood free with cold PBS, removed and a section placed in 10% buffered

formalin for pathology and the remainder separated into cortex and medulla, flash frozen in










liquid nitrogen and stored at -800C for analysis of NOS protein and superoxide. Plasma and

urine creatinine levels were measured by HPLC as described in chapter 2.

eNOS, nNOSa, nNOSP, PRMT1, DDAH1, and DDAH2 protein abundances were detected

by Western blot. ADMA levels were measured in plasma using reverse-phase HPLC with the

Waters AccQ-Fluor fluorescent reagent kit as described in chapter 2. Renal DDAH activity was

measured by a colorimetric assay measuring the rate of citrulline production, as optimized by us

in chapter 5 (132). NADPH-dependent Ozl prOduction was measured by Electron Spin

Resonance (ESR) spectroscopy with hydroxylamine spin probe 1 -hydroxy-3-carboxypyrrolidine

(CPH) as described in chapter 2. Pathology was performed on 5 micron sections of formalin-

fixed kidney, blocked in paraffin wax, stained with PAS.

Statistical analysis: Results are presented as mean & SEM. Parametric data was analyzed

by unpaired t test and 1-way ANOVA. Histologic (non-parametric) data were analyzed by Mann-

Whitney U test. P<0.05 was considered statistically significant.

Results

As shown in Table 6-1, 5/6 NX + Vit E group had higher body weight (similar to shams)

vs. 5/6 NX group at 15th weeks after renal mass reduction, whereas the BWs were similar

between all 3 groups prior to surgery (Sham: 429113g; 5/6 NX: 43 5110g; 5/6 NX + Vit E:

44915g). Left kidney weights and the ratio of KW/BW were higher in 5/6 NX rats than in shams

due to compensatory hypertrophy, while values were intermediate in 5/6 NX + Vit E group and

were not different from sham. Rats with 5/6 NX remained normotensive and blood pressure was

similar in all groups. Plasma creatinine and urine protein excretion were increased similarly, and

CCr was similarly reduced, in both 5/6 NX groups compared to sham (Table 6-1). As shown in

Figure 6-1, however, the appearance of the proteinuria was delayed by ~2 weeks in the 5/6 NX

+Vit E group (week 6) compared to the 5/6 NX rats (week 4). The total number of damaged









glomeruli (all levels of injury) was 1012 % in shams, which is normal for this strain and age (3 8,

130), and greater in both 5/6 NX groups (5/6 NX: 4013 %, p<0.01; 5/6 Nx + VitE: 2412 %,

p<0.01). The total injury was also greater in the untreated 5/6 NX group vs the 5/6 NX + vit E

(p=0.01). As shown in Figure 6-2, there were more damaged glomeruli at 1+, 2+, and 4+ levels

of severity in the 5/6 NX group vs. sham, while only the 2+ injury severity was greater in 5/6 NX

+ VitE group vs. sham. In general the severity of injury was intermediate in the 5/6 NX + VitE

between shams and 5/6 NX but was significantly less (p<0.05) compared to 5/6NX at the 4+

level. The 5/6 NX group also showed increased renal cortex NADPH-dependent Ozl prOduction

vs. sham (Figure 6-3) which was completely prevented by vitamin E therapy.

As shown in Figure 6-4, the 24h UNOxV fell in all groups with time and at 14 weeks after

surgery there was a greater reduction in both 5/6 NX groups vs. shams, suggesting that CKD

contributed to the reduced total NO independent of the age effect. This was supported by the

lower plasma NOx in both NX groups (expressed as a ratio factored for creatinine to eliminate an

effect of reduced renal clearance) of 0. 1210.02, 5/6 NX & 0. 1 10.01, 5/6 NX + Vit E vs.

0.3110.06 for shams (both p=0.01 vs sham).

By Western blot we found no difference in eNOS abundance in renal cortex and medulla

among 3 groups (Figure 6-5A). Further, there was no difference in nNOSa abundance in renal

medulla, however, renal cortex nNOSa abundance was lower in the 5/6 NX group than sham,

and this reduction was prevented by vitamin E therapy (Figure 6-5B). Using the C-terminal

antibody we found that nNOSa is decreased while there is an increased nNOSP abundance

following injury (Figure 6-6)

Both 5/6 NX groups showed similar increases in plasma ADMA concentration (5/6 NX:

0.3510.06 and 5/6 NX +Vit E: 0.2810.05 CLM, respectively) vs. sham (0.1710.02 CLM, both









p<0.05). Renal cortex PRMT 1 abundance was higher in both 5/6 NX group vs. sham (Figure 6-

7A). We found no difference in DDAH1 and DDAH2 abundance in renal cortex among 3

groups (Figure 6-7B &C), but in contrast, renal cortex DDAH activity was lower in both 5/6 NX

groups than sham (both p<0.05) and was not influenced by vitamin E treatment (sham:

0.4110.01; 5/6 NX: 0.3410.02; and 5/6 NX +Vit E: 0.3610.02 CLM citrulline formation/g

protein/min). For the DDAH2 Western blot many non-specific bands were detected. In the

presence of neutralizing peptide, however, only the DDAH2 band (~30 kDa) was competed

(Figure 6-8).

Discussion

The novel finding in this study is that long-term vitamin E administration prevents the

increased NADPH-dependent superoxide generation and reduction in renal cortical nNOS

abundance, in the 5/6 NX model of CKD. Since both reduced renal nNOS and increased renal

superoxide are viewed as pathogenic in progression of CKD, this likely accounts for the

protection against structural damage seen with vitamin E supplementation.

This is the first time we have used the 5/6 NX model of CKD. In this model the right

kidney is removed and the 2 poles of the left kidney are cut off leaving a true 1/6 remnant. With

5/6 NX the rat remains relatively normotensive, whereas in the 5/6 A/I model (which involves

infarction of 2/3rds of the left kidney, leaving large amounts of scar tissue) BP increases rapidly

and exacerbates the CKD due, at least in part, to greater activity of the renin, angiotensin,

aldosterone system (60). In the present study we found no difference in BP between shams or 5/6

NX groups although we only obtained a terminal BP, under anesthesia which may not reflect the

awake values. However, Griffin et al. (48) used telemetry for conscious BP measurement and

also reported that rats with 5/6 NX remained normotensive over 15 wk (48). Another factor that

could contribute to the lack of hypertension in the 5/6 NX model, vs. the 5/6 A/I is that









medullary nNOS is unchanged with NX, but fell with A/I (130). There is considerable evidence

to suggest that loss of medullary NO can lead to salt sensitive hypertension (13 1).

The abundance of eNOS in renal cortex was unchanged by 5/6 NX vs. control. In other

CKD models renal eNOS abundance is increased, reduced and unchanged depending on the

primary insult which suggests that the eNOS varies secondary to the injury (10). In contrast, we

observe that the renal cortex nNOS abundance decreased in 5/6 NX induced CKD as we

previously reported in 5/6 A/I (130), accelerated 5/6th A/I (high sodium and protein intake),

chronic glomerulonephritis (153), chronic puromycin aminonucleoside- induced nephrosis

(PAN) (3 8), diabetic nephropathy (37), and aging (40). This reinforces our hypothesis that renal

cortex nNOS abundance is a primary marker of renal injury (130).

The treatment arm of this study involved antioxidant therapy with Vitamin E (a-

tocopherol) given in the diet (5000 IU/kg chow). In previous studies this dose has been shown to

significantly increase plasma a-tocopherol levels in 5/6 NX rats at 6 weeks and in the aging rat

after 9 months of treatment (1 11, 15 1). We observed that the treatment with vitamin E

significantly reduced the degree of kidney structural damage in the 5/6 NX rats. This is in

agreement with earlier studies that showed a reduction in glomerulosclerosis with vitamin E

therapy in 5/6 NX rats (50, 151). However, there was no improvement in renal function, as

assessed by 24h CCr and this also agrees with other observations where vitamin E did not

improve renal function in the renal mass reduction models after 2-3 weeks (22, 48). Although

slightly delayed in appearance, the proteinuria was not reduced by vitamin E despite the

concurrent reduction in severity and extent of glomeruluosclerosis. This perhaps reflects the

relatively mild protective effect of vitamin E at this time point. Nevertheless, prevention of

structural damage is of benefit and long term (9 months) high dose vitamin E supplements were









able to improve structure, decrease proteinuria, and improve function (111). Importantly, this

was achieved without increased mortality. It should be noted, however, that a meta-analysis of

136,000 subjects in 19 clinical trials suggested that high-dosage (> 400 IU/d) vitamin E

supplements increased all-cause mortality in man (94); limiting the utility of this therapy in man.

Our rationale for use of vitamin E therapy was based on its known antioxidant properties

and the protective effects on CKD progression are presumably by decreasing oxidative stress.

Vitamin E acts as a scavenger of ROS/RNS and lipid peroxyl radicals and most studies on CKD

have measured lipid peroxidation products or antioxidant enzymes (48, 111, 147). Lipid

peroxidation is certainly a marker of redox imbalance due to excess superoxide but could be

associated with either decreased or increased NO bioavailability. Measurement of antioxidant

enzyme activity/abundance can be misleading since both decreased (presumably primary) and

elevated (presumably secondary, compensatory) changes have been correlated to oxidative stress

in CKD (106). Because NADPH oxidase is the maj or source of ROS in kidney (44), we used

NADPH-dependent superoxide production as a marker of oxidative stress. A previous study

reported that renal NADPH oxidase expression increased in 5/6 NX rats (151) and our data

confirm this. The novel finding in the present study is that vitamin E treatment completely

prevents this increased kidney cortex NADPH oxidase-dependent superoxide production in 5/6

NX rats. While conventional wisdom holds that vitamin E exerts its antioxidant effects by

scavenging harmful radicals, it also inhibits protein kinase C dependent events, which include

NADPH oxidase assembly (7, 22). As pointed out by Vaziri (150) the best strategy for

prevention of oxidative stress is to identify and inhibit the source of the ROS. Thus, in situations

where increased NADPH oxidase is the source of damaging ROS, vitamin E is likely to be










highly effective. It is also worth pointing out that the deleterious effects of high dose vitamin E

in clinical studies probably relate to its non radical scavenging actions (150).

In addition to reducing NADPH oxidase dependent superoxide production, vitamin E also

reverses the decline in renal nNOS abundance. We have repeatedly found that development of

renal structural injury in diverse models of CKD is associated with decreases in the renal cortex

nNOS abundance (10). Here we again see an association between injury and renal cortex nNOS

abundance, in yet another model of CKD, reinforcing our earlier suggestion that cortex nNOS

abundance is a marker of renal injury (130) and that decreased nNOS abundance is also a

potential mediator of injury. Since in this study vitamin E not only reduces renal cortex

superoxide production but also preserves nNOS abundance (and presumably activity), vitamin E

helps to restore the local balance between NO and superoxide in kidney. We cannot tell whether

vitamin E has a direct action on the nNOS or whether this is a consequence of the injury-

prevention.

We used plasma and urine NOx levels as indices of total NO production, and vitamin E did

not reverse the reduction in total NO production due to 5/6 NX. In contrast to vitamin E, tempol

increased total NO production in this model (151) which may be due to tempol- induced

inactivation of superoxide which cannot be directly achieved by vitamin E. Despite the lack of

vitamin E effect on total NO production, renal cortical nNOS was restored. It is important to

note, however, that renal NO production represents just a small fraction of total NO and we have

several times observed dissociation between total and renal NO production in different forms of

CKD (37, 38, 41). In fact it is likely that a persistent decline in overall NO generation will occur

despite vitamin E therapy since the elevation in plasma ADMA concentration seen in 5/6 NX

rats was not prevented by vitamin E.









The lack of reduction of plasma ADMA by vitamin E was unexpected since decreasing

ROS should boost DDAH activity and thus lower ADMA (10, 61). Vitamin E was reported to

lower ADMA levels in CKD patients (115). However, the renal DDAH enzymes play an

important role in ADMA degradation and in this 5/6 NX model it is possible that such severe

reduction in renal mass irreversibly impaired ADMA breakdown. Indeed, our data suggest

increased ADMA production (secondary to increased PRMT1 abundance) and decreased ADMA

degradation (secondary to decreased DDAH activity), which was not prevented by vitamin E

therapy. Matsuguma and colleagues have recently reported increased renal PRMT1 gene

expression at 12 weeks after 5/6 NX although they also reported decreased DDAH1 and 2

protein expression (90). In contrast to our finding that DDAH1 and 2 protein abundance was

unaltered in 5/6 NX rats; however, we do observe decreased renal DDAH activity.

In conclusion, long-term vitamin E therapy reduces structural damage in rats subj ected to

5/6 NX and protection is associated with a direct action to inhibit NADPH oxidase-dependant

superoxide production. As with other models renal cortex nNOSa abundance was reduced with

injury in 5/6 NX rats, and was preserved by vitamin E therapy. However, increased nNOSP

abundance in 5/6 NX rats suggests the upregulation of nNOSP in response to renal injury. The

renoprotective effect of vitamin E is likely via both reducing superoxide production and

preserving renal NO generation. However, vitamin E had no effect on plasma ADMA levels and

renal ADMA related enzymes.









Table 6-1. Measurements at 15 wk after surgery
Sham 5/6NX 5/6NX + Vit E
Body weight (g) 533112 492115 53518'
Kidney weight (g) 1.50+0.07 2.4010.14* 2.1210.43
Kidney weight/body weight (%) 2.8210. 18 4.9410.40* 3.9910.86
Blood pressure (mmHg) 9113 8218 8115
Plasma creatinine (mg/dl) 0.3 810.02 2. 1010.62* 1.8010.41*
CCr/BW (ml/min/kg BW) 6.510.4 1.510.3* 1.510.2*
Proteinuria (mg/24hr) 3817 7215* 100+19*
Values are means & SE; CCr, 24hr clearance of creatinine;
*, p<0.05 vs. Sham; #, p<0.05 vs. 5/6NX.
Reprinted with permission from the American Physiological Society (133).













180

160 ha
-0 5/6 NX
-7 5/6 NX+ Vit E
140-

S120-

E 100-






80





0 2 4 6 8 10 12 14 16

Week


Figure 6-1. Urinary protein excretion at baseline (week 0) and during the 15 wk period after
surgery in shams (solid circles), 5/6 NX (open circles) and 5/6 NX + Vit E (closed
inverted triangles). *p<0.05 vs. Sham. Reprinted with permission from the American
Physiological Society (133).















16-
I 5/6 NX
M 5/6 NX + VitE
14-




o 10-












1+ 2+ 3+ 4+
Degree of damage


Figure 6-2. Summary of the % and severity of glomerulosclerosis on the 1+-4+ scale 15 weeks
after surgery in shams (black column), 5/6 NX (gray column) and 5/6 NX + Vit E
(dark gray column). *p<0.05 vs. Sham; # p<0.05 5/6 NX vs. 5/6 NX + Vit E.
Reprinted with permission from the American Physiological Society (133).















140-

P<0.001 P<0.001
120-


-,100-


E 80


o


40-



20



Sham 5/6 NX 5/6 NX+Vit E
Figure 6-3. Renal cortex NADPH-dependent superoxide production at 15 wk after surgery.
Reprinted with permission from the American Physiological Society (133).













1.4


1.2 -1 -0- 5/6 NX
s 5/6 NX+ Vit E








X 0.6-
O
Z

0.4 -1


0.2
0 2 4 6 8 10 12 14 16
Week
Figure 6-4. Total urinary NOx (NO3- +NO2-) excretion at baseline (week 0) and during the 15 wk
period after surgery in shams (solid circles), 5/6 NX (open circles) and 5/6 NX + Vit
E (closed inverted triangles). *p<0.05 vs. Sham. Reprinted with permission from the
American Physiological Society (133).











Cortex


Sham 5/6 NX 5/6NX+ VitE


Cortex


Sham 5/6 NX 5/6NX+ VitE


Medulla


P=0.02


P=0.017


Sham 5/6 NX 5/6NX+ VitE


Sham 5/6 NX 5/6NX+ VitE


Figure 6-5. NOS protein expression in sham and 5/6 NX rats at 15 wk after surgery. A) Relative
abundance of renal cortex and medulla endothelial nitric oxide synthase (eNOS). B)
Relative abundance of renal cortex and medulla neuronal nitric oxide synthase
(nNOS). Reprinted with permission from the American Physiological Society (133).


Medulla











A nNOSa( B nNOSP





6e-7 2e-61.






S e-7



4e-7 2e6N

3iue -7 .Dnioer hwn lbndne6o N~ n NS nrnlcre fsa n
5/ 2e-7 tde 5 k fe ugr. )nOauigth -emnlnO


Shmiam 5/6NXdy Sham.0 5/6NXam













Sham 5/6 NX 5/6NX+ VitE


PRMT1 abundance


kDa

50 -

40

30 -


~42kDa


Sham 5/6NX 5/6NX+ VitE



DDAH1 abundance


B Sham 5/6 NX 5/6NX+ VitE


kDa



50


37
DDAH1
~34kDa
25 -


Sham 5/6NX 5/6NX+ VitE


DDAH2 abundance


Sham 5/6 NX 5/6NX+ VitE


75-


DDAH2
~30kna


25-- ilillllllllili Sham 5/6NX 5/6NX+ VitE




Figure 6-7. ADMA-related enzyme expression in renal cortex at 15 wk after surgery. A)
PRMT1. B) DDAH1. C) DDAH2. Representative western blots of whole membranes
show PRMT1 (~42kDa), DDAH1 (~34 kDa), and DDAH2 bands (~30 kDa). *p<0.05
vs. sham. Reprinted with permission from the American Physiological Society (133).











DDAH2


B DDAH2 + 20X peptide
KC KM KC


KC KM KC


kDa

100
75

50

37

25 -


SDDAH2
~30kDa


Figure 6-8. Immunoblots of rat kidney cortex (KC) and kidney medulla (KM) with DDAH2
antibody. A) In the absence of neutralizing peptide. B) In the presence of neutralizing
peptide. Reprinted with permission from the American Physiological Society (133).









CHAPTER 7
SEX DIFFERENCES IN NITRIC OXIDE, OXIDATIVE STRESS, AND ASYMMETRIC
DIMETHYLARGININE IN 5/6 ABLATION/INFARCTION RATS

Introduction

As discussed in previous chapters, nitric oxide (NO) deficiency occurs in humans and

animals with chronic kidney disease (CKD) and may contribute to the progression (10). A higher

constitutive nitric oxide synthase (NOS) expression was noted in young female rat kidney than

that in male and a decrease in NO production in aging male rat but not in aging female (11, 100).

This suggests that the ability to preserve renal NO might contribute to the relative protection of

females against progression of renal damage.

Possible mechanisms of NO deficiency in CKD include decline in NOS expression,

inactivation of NO and NOS by oxidative stress, and inhibition by endogenous NOS inhibitors,

such as asymmetric dimethylarginine (ADMA). We found that renal cortical neuronal nitric

oxide synthase-a (nNOSa) expression decreased markedly with injury and correlated to

decreased NOS activity in various rat CKD models (10), such as the renal mass reduction model,

5/6 ablation infarction (A/I) (130). We have also found that another nNOS isoform, nNOSP,

increases in response to loss of nNOSa in the transplanted kidney and that this may be associated

with protection from progression of CKD (chapter 4). In this study we investigated the renal

nNOS isoforms, nNOSa and -P in the 5/6 A/I model to determine whether sex-dependent

differences in isoform abundance might correlate with the severity of renal injury.

Oxidative stress, another mechanism causing NO deficiency, is associated with the

progression of CKD (148). We have shown that vitamin E prevents the increased NADPH

oxidase-dependent superoxide (02 ) prOduction and reduction of renal nNOS abundance in a 5/6

nephrectomy (NX) model in Chapter 6 (133). Because p22phox iS a maj or regulatory subunit of

NADPH oxidase and its expression is correlated to NADPH activity (44), because Ozl is









converted to hydrogen peroxide by superoxide dismutase (SOD), and because increased ROS

causes lipid peroxidation and tissue injury, we have evaluated renal p22phox, plasma

malondialdehyde (MDA), and urine hydrogen peroxide levels to elucidate the impact of sex on

the regulation of reactive oxygen species (ROS) metabolism and NO.

In addition to oxidative stress renal NOS activity can be inhibited by ADMA. Both ADMA

and symmetric dimethylarginine (SDMA) are dimethylarginines generated by protein arginine

methyltransferases (PRMTs) and PRMT1 is specific for ADMA production. Only ADMA (not

SDMA) is metabolized by dimethylarginine dimethylamino-hydrolase (DDAH) in the kidney,

liver etc (27). We have previously shown that increased PRMT1 expression and decreased renal

DDAH activity were associated with the accumulation of ADMA in 5/6 NX rats (133). Here we

investigated the impact of sex on dimethylarginine metabolism in this A/I model.

Materials and Methods

Studies were conducted on 16 male and 15 female Sprague-Dawley (SD) rats from Harlan

(Indianapolis, IN, USA) at age 10 to 12 weeks. Rats were allowed ad libitum access to tap water

and standard rat chow. A/I surgery was performed by removal of the right kidney and infarction

of 2/3 of the left kidney by ligation of branches of the left renal artery. Rats were assigned to the

following groups: male sham (N = 6); male A/I (N=10); female sham (N=5), and female A/I

(N=10). Rats were sacrificed 7 weeks after surgery. All surgical procedure was done using full

sterile technique. Twenty-four-hour urine was collected in metabolic cages for measurement of

protein by Bradford method before surgery and every other week after surgery. Total NO

production (from 24h urine NOx =NO3- +NO2 ) WAS measured by Greiss reaction before and 7

weeks after surgery. When rats were sacrificed, blood pressure was measured via abdominal

aorta and a blood sample was taken for plasma creatinine, L-arginine and dimethylarginines, and

NOx levels. A thin section of cortex was fixed in 10% formalin for pathology and the reminder









separated into cortex and medulla and stored at -800C for later analysis. Plasma and urine

creatinine levels were measured by HPLC. Plasma MDA levels were determined by a modified

fluorometric method for measuring thiobarbituric acid-reactive substances (TBARS) (157).

Urine hydrogen peroxide levels were measured by Amplex Red Hydrogen Peroxide/Peroxidase

Assay Kit (Molecular Probes, Eugene, OR). Plasma L-Arginine and dimethylarginine levels

were measured using reverse-phase HPLC with the Waters AccQ-Fluor fluorescent reagent kit.

More detailed descriptions of these analyses were described in chapter 2.

Western blot was used to analyze nNOSa, nNOSP, eNOS, PRMT1, DDAH1, DDAH2, and

p22phox abundance in kidney and/or other tissues. DDAH activity was measured by a

colorimetric assay measuring the rate of citrulline production, as described in chapter 5 (132).

Whole blood was centrifuged at 2,000 rpm for 8min and after removal of plasma and buffy coat,

RBC was washed by 2ml of normal saline, then lyzed by sonication (Fisher, dismembrator model

100, setting=8) for 3 cycles (10 second sonication and 10 second rest). RBC lysate was

centrifuged at 15,000 rpm for 10min at 4oC, the RBC supernatant was collected and stored in -

80oC freezer until analysis. Tissue was homogenized in sodium phosphate buffer, pre-incubated

with urease for 15 min, then 100Cl (2mg for kidney cortex and liver; 6mg for RBC) of

homogenate was incubated with 1mM ADMA for 45 min (kidney cortex) or 60min (for RBC

and liver) at 37oC. After deproteinization, supernatant was incubated with color mixture at 60oC

for 110 min. The absorbance was measured by spectrophotometry at 466 nm. The DDAH

activity was represented as CLM citrulline formation/g protein/min at 37oC. Histology was

performed on kidneys and stained with periodic acid-Schiff kit (PAS, Sigma, St. Louis, MO) and

examined for level of renal injury.










Statistics: Results were presented as meanfSEM. Data were analyzed by general linear

univariate model using gender (Male vs. female) and injury (Sham vs. A/I) as fixed factors,

followed by LSD post-hoc test for multiple comparisons. The Kruskal-Wallis and Pearson tests

were for correlation, followed by the regression analysis. Gender effect on the reduction of CCr

and plasma NOx levels were analyzed by nested ANOVA. p< 0.05 was considered statistically

significant.

Results

Data of Renal Outcome and Clinical Parameters

As shown in Table 7-1, 7 weeks after A/I males had lower body weight (BW) vs. sham,

whereas the BWs were similar in female sham and A/I rats and always lower that the males. Left

kidney weight increased in the A/I groups and the left kidney weight to BW ratios were higher in

both male and female A/I rats than shams, reflecting compensatory renal hypertrophy. In male

A/I rats terminal BP was similar to shams whereas BP was low in sham females and increased in

females with A/I. The 24-hour urine protein excretion was not different at baseline (before

surgery) between sham and A/I groups within each sex, although males had a greater baseline

urine protein excretion than females (male vs. female: 25f2 vs. 3f1 mg/day, p<0.05). Urine

protein excretion increased in male A/I vs sham as early as the 2nd wk (41f9 vs. 16f2 mg/day,

p<0.05) and female A/I rats also developed proteinuria which became statistically significant at

6th wk (Table 7-1). The 24h urinary NOx excretion (factored for BW) was lower in females than

males in both sham and A/I groups and did not fall significantly with A/I in either group. Plasma

NOx (factored for creatinine to correct for differences in renal function) levels were lower in

sham females vs males, decreased in both sexes with A/I with a greater reduction in males (63f4

% vs. 54f6 % reduction. p<0.001). Plasma creatinine levels increased in both A/I groups, but









less in females. The clearance of Cr (CCr) was lower in sham females than males, was reduced

by A/I in both sexes with a greater % fall in males (90f2 % vs. 71f6 %, p<0.001) (Table 7-1).

The % of damaged glomeruli was significantly increased in both A/I groups, to a lesser extent in

female.

Renal Neuronal Nitric Oxide Synthase Isoform Expression

As shown in Figure 7-1A, the nNOSa abundance in cortex was higher in sham females

than males and fell significantly in male A/I rats, whereas female A/I rats maintained their

nNOSa abundance. To confirm this finding we ran 2 identical membranes probed with two

different N-terminal anti-nNOS antibodies (Fig 7-1A, upper panel, Ab from Dr. Kim Lau (76)

vs. lower panel, Santa Cruz Ab) and the results were comparable. In contrast, nNOSP abundance

in cortex was very variable in male A/I, tending to increase but only rose significantly in females

(Fig 7-1B). The cortical eNOS protein abundance was not different between 4 groups (Figure 7-

1 C).

Since the rate of progression in the A/I model is quite variable (depending on exact amount

of infarct), we looked at the regression relationship between renal nNOS isoform abundance and

glomerular damage. As shown in Figure 7-2, the more severe the glomerular sclerosis, the

greater the decline in cortical nNOSa abundance (r = -0.554, p=0.001), but the greater the

increase in nNOSP abundance (r = 0.408, p<0.05). We found the same general trends when

comparing plasma creatinine and nNOS isoforms but the relationships were not so robust (data

not shown).

Reactive Oxygen Species Metabolism

As shown in Fig 7-3A, there was no sex difference in renal cortical p22phox in shams and

the abundance increased with A/I only in males. Both plasma MDA levels (a marker of lipid









peroxidation) and urine hydrogen peroxide levels were similar in shams of both sexes and

increased significantly in male A/I rats but not in females (Fig 7-3B &C).

L-Arginine and Dimethylarginines

As shown in Table 7-2, plasma L-arginine levels were similar in shams and fell

significantly in female A/I rats but not in males. There were no sex differences in baseline

(sham) values of plasma ADMA and SDMA and the only response to A/I was an increase of

SDMA in males. However, the L-arginine to ADMA ratio, a determinant of systemic NO

metabolism (13, 15), was significantly decreased in both sexes with A/I and the L-arginine to

ADMA ratio correlated directly with plasma NOx levels (Fig 7-4). In kidney cortex, L-arginine

and SDMA levels were similar in shams but females had higher baseline ADMA levels vs.

males. In response to A/I the L-arginine and ADMA levels in kidney cortex rose significantly in

female A/I rats but did not change in males. There was no effect of A/I on renal cortical SDMA

levels in either sex. The L-arginine to ADMA ratio in kidney cortex was lower than that in the

plasma in all groups. As shown in Table 7-2, the ratio significantly decreased in both sexes in

response to A/I injury with a greater reduction in male A/I rats.

Asymmetric Dimethylarginine Related Enzymes

Renal cortex PRMT1 abundance was similar in shams and increased similarly with A/I in

both sexes (Figure 7-5A). We also measured PRMT1 expression in the liver and found that

female shams had higher abundance than males, and that liver PRMT1 increased in males but not

females in response to renal injury (Figure 7-5B). There was no difference in DDAH1 abundance

in renal cortex among 4 groups (Fig 7-5C), whereas DDAH2 expression was similar in both

sham groups and fell similarly with A/I in both sexes (Figure 7-5D). Despite the similar falls in

renal DDAH2 abundance, renal cortex DDAH activity was decreased only in male A/I rats

however, absolute renal cortex DDAH activity was similar between the sexes after A/I (Fig 7-










6A). DDAH activity in RBC and liver was lower in female sham than male sham (Fig 7-6B &C),

however, female A/I rats maintained DDAH activity, which was significantly decreased in male

A/I groups. The RBC DDAH activity was correlated to renal DDAH activity (r = 0.557, p< 0.05)

(Figure 7-7).

Discussion

The novel finding in this study is that decreased nNOSa and increased oxidative stress are

associated with the worse renal outcome in male vs. female A/I rats. These sex differences

possibly contribute to greater renoprotection of female rats against A/I injury due to preserved

renal NO bioavailability.

Sex differences in NOS have previously been observed in rats. Normal male rats displayed

lower renal nNOS expression than females (18, 155). In the present study we specifically address

the possible sexual dimorphism of the different nNOS isoforms in renal disease. Under baseline

(sham) conditions we Eind that the male rat has lower renal nNOSa abundance than females. This

observation is similar to our previous finding in aged female SDs at 20 months of age who show

little renal structural damage and preserved nNOSa abundance whereas male SDs have severe

injury and marked falls in renal nNOSa (40). In addition, male Wistar Furth (WF) rats are

resistant to renal injury induced by A/I and PAN (38, 41), relative to male SD rats and show

elevated baseline and only small falls in renal nNOSa abundance in both models of CKD. Also,

despite moderate falls in nNOSa abundance, the WF actually also showed maintained or

increased NOS activity in the soluble fraction of kidney cortex (38, 39, 41), suggesting that other

nNOS isoforms may exist and be recruited in the kidney. At the time these studies were

conducted we had not characterized the presence of nNOSa and nNOSP proteins in the rat

kidney and do not have data in the WF on the presence of nNOSP. However, we have now

shown that these 2 isoforms exist in the normal SD kidney cortex (chapter 3) and also in the









transplanted F344 kidney, where we found upregulation of renal cortical nNOSP with CKD-

induced reduction in nNOSa which seemed to be protective (chapter 4). In the transplant study,

we demonstrated that nNOSP is positively correlated with renal injury in contrast to nNOSa. In

the present study a strong negative correlation between nNOSa and nNOSP suggests that an

upregulation of renal cortical nNOSP occurs with A/I-induced reduction in nNOSa.

We also examined several markers of oxidative stress and found that there were no

differences between male and female shams although the male A/I rats did exhibit enhanced

oxidative stress in response to A/I injury, detected by several measures (renal cortical p22phox

abundance, plasma MDA levels, and urine hydrogen peroxide levels) while female A/I rats were

resistant to ROS. Several studies have reported that the male SHR produces more systemic ROS

compared to the female, that this is testosterone -dependent and contributes to the higher BP in

males (42, 127). Whether other strains/species also exhibit a sexual dimorphism in oxidative

stress is not certain, although both pro-oxidant actions of testosterone and antioxidant actions of

estrogen have been implicated in the cardiovascular protection seen in pre-menopausal women

(93, 116). Our study also suggests that there is a sex difference in renal oxidative stress, females

protected since p22phox abundance is less in female rat kidney cortex after A/I. A similar

finding has been reported in the renal wrap model where there is estrogen-dependent protection

of kidney damage associated with decreased NAPDH oxidase activity and decreased renal

p22phox (64). Males kidneys are also at increased risk of injury due to oxidative stress in

ischemia/reperfusion injury (67), polycystic kidney disease (89) and toxicity due to potassium

bromate exposure (144). Our data suggest that increased oxidative stress seen in the males with

A/I is associated with decreased nNOSa and that may predict the poor renal outcome in males.

This is consistent with our previous study in the male showing increased NADPH oxidase-









dependent Ozl prOduction and reduction of renal nNOSa abundance in a 5/6 NX model,

reversible with antioxidant therapy (133).

Protein turnover results in the release of free ADMA from protein-incoporated ADMA,

and two counterbalancing pathways, type I PRMT and DDAH, control free plasma and tissue

ADMA levels (146). Regarding ADMA and sex differences, clinical data suggests that in young

adult males and females plasma ADMA concentration is similar and that levels increase with age

in both sexes but are delayed in the female (122). Otherwise, little is known about sex

differences in abundance of ADMA and its' regulating enzymes. In the present study we found

no sex difference in sham plasma ADMA levels in young adults although the in vitro red blood

cell and liver DDAH activity was lower in females than males. Female shams also had higher

PRMT1 expression in liver which would tend to promote increased ADMA formation. Thus,

there was no obvious correlation between organ PRMT level/ DDAH levels/activity and plasma

ADMA. Similarly, although sham females had higher renal cortical ADMA levels than males,

renal PRMT1 and DDAH1 and 2 protein abundance, as well as DDAH activity were similar in

sham males and females. Thus, neither renal PRMT nor DDAH expression/activity can predict

plasma or kidney ADMA levels.

There is a report that plasma ADMA may be controlled by DDAH activity of the whole

blood (13) and DDAH1 expression has been detected in human RBCs (66). We were able to

detect DDAH activity in rat RBC and found that it correlates with renal DDAH activity. This

may provide a useful tool as a surrogate measure of renal DDAH activity in patients with CKD.

After A/I there was no increase in plasma ADMA level in either sex, which was

unexpected given the findings of increased plasma ADMA in end stage renal failure in man,

although plasma ADMA is very variable in CKD (10). There was no change in renal ADMA









levels in males with A/I but an increase was seen in females. As in the sham rats, there was no

obvious correlation with the abundance of the ADMA regulatory enzymes since renal PRMT 1

increased similarly, renal DDAH1 was unchanged and DDAH2 fell similarly in both sexes with

A/I and liver PRMT1 increased only in males. It was unexpected that the tissue ADMA level

was higher in the "protected" female kidney vs. the male and that the renal and plasma L-

arginine/ADMA ratios were similar after A/I in both sexes. Of note, the changes in the L-

arginine: ADMA ratio in plasma and kidney in both sexes post A/I reflected both changes in L-

arginine as well as ADMA levels.

There is no sex difference in baseline plasma and renal SDMA levels although male A/I

rats displayed higher plasma SDMA levels, which were correlated to greater loss of renal

function. Our finding is supported by previous studies showing that SDMA is a marker of renal

function, which is predictable given that SDMA is excreted unmetabolised in the urine (14).

Although SDMA is not a NOS inhibitor, it may compete with L-arginine to enter the cells and

cause a decreased NO production (14).

In conclusion, male A/I rats displayed a more rapid CKD progression associated with

reduced renal nNOSa abundance and increased oxidative stress. The decreased nNOSa

abundance was correlated to increased oxidative stress markers suggesting that oxidative stress

may inhibit nNOSa expression in the kidney. Sex differences exist in nNOS expression,

oxidative stress, and ADMA metabolism, reinforcing the notion that sex specific treatment may

be needed in CKD.










Table 7-1. Renal outcome and clinical parameters
Male sham Male A/I
N= 6 N= 10
Body weight (g) 431112 38817*
Left kidney weight (g)/100g 0.4310.03 0.5810.03*
BW


Female
sham N= 5
25015
0.4910.05


Female A/I
N= 10
24116
0.6110.03*


p-value

<0.001
0.002


Mean arterial pressure 123110 10814 8814" 11116* 0.01
(mmHg)
UprotV (mg/day) 54125 80129 414 69116 0.166
UNOxV (CLM/24h/100g BW) 0.66f0.10 0.47f0.08 0.24f0.08# 0.07f0.05# <0.001
PNOx/Cr 0.9110.05 0.3410.04* 0.7410.08# 0.3410.04* <0.001
Plasma creatinine (mg/dl) 0.3410.01 1.1810. 14* 0.3 010.03 0.87f0.08*"# <0.001
CCr/BW (ml/min/100g BW) 1.25+0.25 0.1310.03* 0.6810.19# 0.20f0.04* <0.001
GS % 6.8311.34 38.8213.24* 4.0011.83 31.18f3.79*'" <0.001
Values are means & SEM; UprotV, total urine protein excretion; PNOx, plasma nitrite plus
nitrate levels; PCr, plasma creatinine level; CCr, 24hr clearance of creatinine; GS%, total % of
damaged glomeruli. *p<0.05 vs. sham, #p<0.05 vs. respective male.










Table 7-2. L-arginine and dimethylarginine levels in plasma and kidney cortex
Plasma N L-Arginine ADMA SDMA L-Arginine/
(pLM) (gLM) (pLM) ADMA


Male sham
Male A/I
Female sham
Female A/I
Kidney cortex


6 117.6116.6


0.3710.07
0.4810.06
0.5410.13
0.4610.08
ADMA
(nM/mg
protein)
0.0910.02
0.1310.01
0. 1710.02'
0.2710.02*


0.2610.04
0.5310.07*
0.3510.04
0.4110.05
SDMA
(nM/mg
protein)
0.0510.00
0.0710.03
0.0610.01
0.0710.00


328.2f39.5
223.3f22.0*
322.1f83.4
202.1f18.2*
L-Arginine/
ADMA

44.1f7.05
29.9f4.79*
22.9f1.63#
19.0f0.76*


S101.1+14.2
150.4119.5
S82.416.3*
L-Arginine
(nM/mg
protein)
3.6710.20
3.6110.34
3.9010.26
5.1410.15**
vs. respective male.


Male sham 5
Male A/I 5
Female sham 5
Female A/I 5
*p<0.05 vs. sham, "p<0.05
























































Male Female
Sham AI Sham NIl


Male Female
Sham A/I Sham A/I

C~---- -


200-
140 -

100


kDa

20 -


00004


I Sham
]~ All


-nNOSa 00003






nNOSa


100 1


Male


Female


Male Female

Sham A/I Sham A/I

kDa

200 k ~


140 '


2e-6



2e-6



Sle-6
'nNOSP 3


MM Sham
[~ ] N


MM Sham
C~ ] N


kDa
200~


2e-6



Sle-6



se-7



0
Male


1-00""L L IMIMM LI""eNOS


100,


Female


Figure 7-1. NOS isoforms expression in renal cortex. A) Relative abundance of renal cortex
neuronal nitric oxide synthase a (nNOSa) by an N-terminal anti-nNOS Antibody

(Kim Lau). Representative whole membranes show the nNOSa (~160 kDa) band by 2
different N-terminal nNOS antibodies: Kim Lau antibody (upper panel) vs. SC nNOS

antibody (lower panel). B) Relative abundance of renal cortex neuronal nitric oxide

synthasep (nNOSP). C) endothelial nitric oxide synthase (eNOS). Representative
membranes show nNOSP (~140 kDa) and eNOS bands (~150 kDa). *p<0.05 vs.

sham; #p<0.05 vs. respective male.


Male Female
















A Male sham
a o Male A/I
e o.ooos -1 v Female sham
a ^ Female A/I







S0.0000
0 0 2 0 4 06











()o
le6

0 0 2 0 4 0 6
Glomerloscleosis
Fiue -.Corltinbtwe loeuardmgeadnN Siofr budne.A eltv
abndnc o oricl euo al ircoiesnhsa(Na;r 054 =.0)
B) nNa (r .0,p00)


0.0010


I













Male Female

Sham All Sham All











""


A



kDa

40 -

30

20


2se-a -


[ ] All


-k



_I


2 0e-6 -
-


1 5e-6


S1 0e-6 -

Sp22phox
~22kDa 50e-7 -


00


Male


Female




















Female


B

1 6

12

1 0

08

06

04

02

00


2500
-

'2000 1
-





~L100:1
-

50:*
-


MM Sam


Male


Male


Female


Figure 7-3. Biomarkers of oxidative stress in sham and A/I rats at 7 wk after surgery. A) Relative
abundance of renal cortical p22phox.Representative western blot shows p22phox bands

(~22 kDa). B) Plasma MDA levels (a marker of lipid peroxydation). C) Urine
hydrogen peroxide levels. *p<0.05 vs. sham; #p<0.05 vs. respective male.


T
















600 -


500 -
O

400 -
-


S300



S200 -


100 -
0-


aa



a nvo
O a
) OO
aO


00 02 04 06 08 10 12

Plasma NOx/Cr



Figure 7-4. Correlation between L-arginine to ADMA ratio and plasma NOx levels (r- 0.574,

p=0.001).





























Male Female
Sham A/I Sham A/I


I


Male Female
A
Sham NIl Sham NI


MM Sham
E 1 All


S3e-7

SPRMIT1 2-
~42kDa a

O





le-6


8e-7


SPRMIT1 6e-7
~42kDa
S4e-7
o
2e-7


kDa

50

40

30 -





B

kDa

50 -

40

30


-- -- gu..womaagou


Male


Female


Male Female


C Male Female
Sham NIl Sham NIl


S3e-6

~2e-6-


kDa

40 -

30

20 -


DDAH1
~34kDa


le-6


I


Male Female

Figure 7-5. ADMA-related enzyme abundance in sham and A/I rats at 7 wk after surgery. A)
Relative abundance of PRMT1 in renal cortex. B) PRMT1 in the liver. C) DDAH1 in
renal cortex. D) DDAH2 in renal cortex. Representative western blots of whole
membranes show PRMT1 (~42 kDa), DDAH1 (~34 kDa), and DDAH2 bands (~30
kDa). *p<0.05 vs. sham; #p<0.05 vs. respective male.





Male Female
D
Sham NIl Sham NI


H Sham
0 All


r, ~ --,If ,.


k-

40
30-

20


.-DDAH2
~30kDa
o
0


0 0000


Male


Female


Figure 7-5. Continued













05-



S04-



S03-





E


001


Male


Female


Male Female


0 20 -









E


T


0 00 -


Female


Figure 7-6. In vitro DDAH activity at 7 wk after surgery. A) In kidney cortex. B) In RBC. C) In
liver. *p<0.05 vs. sham. #p<0.05 vs. respective male.


O All


I Shaml


I Shaml













.0 20

5 Male sham
o o Male A/I
0. 15 -I v Female sham
? ^ Female A/I


C 10-O




I 5-
O o



0.0 0.1 0.2 0.3 0.4 0.5

Renal DDAH activity microMI Cit/g protein/min

Figure 7-7. Correlation between renal DDAH activity and RBC DDAH activity (r- 0.587,
p<0.05).









CHAPTER 8
CONCLUSION AND IMPLICATIONS

In this dissertation I describe five different but complementary sets of experiments

intended to advance our understanding of renal NO deficiency in CKD. We have investigated the

renal NOS proteins, renal and systemic oxidative stress and the renal and systemic control of

ADMA.

Renal Neuronal Nitric Oxide Synthase-a and -P Isoforms Expression in Chronic Kidney
Disease

In previous studies from our laboratory we have reported that in different rat CKD models,

there is a fall in abundance of the renal cortical nNOSa expression that correlates with the

severity of the injury. Our maj or findings include: (1) nNOSa expression decreases in severe

CKD (e.g., 5/6 A/I, chronic GN and PAN models) (38, 130, 153); (2) Strain differences exist in

nNOSa expression with rats resistant to progression of CKD (e.g., WF) showing maintained

nNOSa compared to the CKD-vulnerable SD rats. This was seen in the 5/6 A/I, chronic PAN

and DOCA/NaCl CKD models (38, 39, 41); and (3) Sex differences occur in the aging SD rats

that correlate with susceptibility to CKD. The aged female shows maintained renal nNOSa and

little age-dependent injury whereas the male shows early and progressive falls in nNOSa as

CKD develops (40).

In my dissertation work I have demonstrated that (4) there exists of two isoforms of nNOS

(splice variants) in the normal rat kidney; (5) while nNOSa decreases profoundly, nNOSP

expression increases in a RAPA Tx model. This increase in nNOSP appears to be a

compensatory response that helps to preserve kidney function; (6) in both 5/6 NX and A/I

models where nNOSa falls, nNOSP abundance increases in parallel with increasing glomerular

damage. In these situations where the injury is more severe it seems that the increased nNOSP









has been inadequate to prevent progression of the injury; and (7) the female rats show less

structural damage, smaller falls in nNOSa and increases in nNOSP than males with 5/6 A/I.

As shown in Figure 8-1, we compare four CKD models in this dissertation. There are two

Tx-induced mild CKD models, ISO I/R and ALLO RAPA models which show slow progression

of injury; the other two severe CKD models are 5/6 NX and A/I models and here the rate of

progression was much faster. As shown in Table 8-1, nNOSa abundance is maintained in the

ISO Tx I/R model, which displays better renal outcome compared to other CKD models. In the

RAPA Tx model (another mild CKD model) there was a surprising absence of nNOSa yet a

relatively good outcome. There was a significant upregulation of nNOSP which could be viewed

as compensatory, to maintain ~60% of renal function and relative preservation of structure.

However, in severe progressive CKD, functional deterioration and structural damage still

developed despite the upregulation of nNOSP (e.g., 5/6 NX and A/I model) and in these models

there was still significant residual nNOSa. In addition, nNOSP abundance positively correlates to

the increase of glomerular damage in 5/6 A/I model. While maintained renal cortical nNOSa is

clearly critical to prevent CKD progression, the increased nNOSP may not be adequate to

prevent injury in severe progressive CKD, and could even be viewed as potentially harmful,

given the positive correlation with the structural damage.

Exactly how nNOSP influences renal function /structure is unknown. Its location is

considered to be purely cytosolic (no PDZ domain) and might have similar or even higher NOS

activity (no PINT binding site) vs. nNOSa in vivo (36). One hypothesis is that when nNOSa-

derived NO decreases, nNOSP expression increases and can potentially replace decreased NO

production to maintain function and prevent CKD progression. However, different N-terminal

truncated nNOS proteins (e.g., nNOSP) have been shown to heterodimerize with nNOSa and









decrease NOS activity (158). Thus, an alternate possibility is that the increased nNOSP

heterodimerizes with residual nNOSa and further decreases nNOSa-derived NO production.

Perhaps the positive actions of nNOSP can only be expressed when all the nNOSa is gone,

exactly as occurred in the RAPA Tx model (chapter 4). The relationship between nNOSa and -P

is likely to be complex since although nNOSP is entirely cytosolic, the "in vitro" soluble NOS

activity is decreased in various severe CKD models (10, 36-41, 130, 153), showing that

increased nNOSP does not increase total nNOS activity in this setting. This could explain why

increased nNOSP in 5/6 NX and male A/I rats was not beneficial in preventing CKD

progression.

Although some stimuli have been reported to up- or downregulate nNOS mRNA

expression in several rat tissues (75, 156), the regulation of the nNOSP transcript is unknown.

Our data shows that renal cortical nNOSP is upregulated in different CKD models, although the

precise signals) remain unknown. Also, the localization of nNOSP in kidney cortex is unknown.

Bachmann et al. (9) used both N- and C-terminal anti-nNOS antibodies to recognize the same

structure by immunohistochemistry and concluded that the nNOS variant of the MD is nNOSa.

However, this finding does not exclude the possibility that both are present and/or that nNOSP

may exist in MD in response to renal injury. It is known that low levels of nNOS are expressed

in proximal tubules, cortical collecting ducts, and perivascular nerves in kidney cortex (8)

although the specific isoform is unknown. Whether the increased nNOSP expression in different

CKD models is located in MD or other segments of nephron is also unknown. Since the C-

terminal Ab detects all alternatively spliced forms of nNOS, we are unable to use it to detect the

localization of nNO SP by immunohi stochemi stry. Although Langnaese et al. (79) developed a

"specific" nNOSP Ab to detect nNOSP in nNOSP overexpressing cells, their data suggests that









this Ab may cross react with other nNOS isoforms. Therefore, the location of the renal nNOS

isoforms deserves further evaluation.

There have been a number of studies in the nNOSa-knockout (KO) mice (deleted exon 2)

(104). However, expression of alternatively spliced variants are still detected in these mice with

residual nNOS activity. Mice with complete ablation of nNOS (deleted exon 6) are viable

although infertile (49) and little is known about renal control in nNOS exon 6 KO mice.

Although in this dissertation we focus on nNOS expression in the kidney cortex, further study is

needed to elucidate its pathophysiological role in the kidney medulla in renal disease. Future

challenges to understand their relative function includes the comparison between nNOSa and full

nNOS KO mice, the generation of inducible nephron site-specific knockout models, and gene

silencing models targeting specific nNOS isoform to assess the physiological roles of different

nNOS isoforms.

Oxidative Stress in Chronic Kidney Disease

Oxidative stress is present in CKD patients and in experimental CKD models (53, 123,

147). Superoxide (Oz-) and hydrogen peroxide (H202) are important ROS, both of which can be

made by many oxidative enzymes. On the other hand, many antioxidant enzymes counteract

ROS to maintain redox balance. The complexity of the interplay between the pro-oxidants and

antioxidant systems and their impact on systemic vs. renal oxidative stress makes the

interpretation of in vivo studies very complicated.

Two maj or sources of vascular ROS are cytochrome P450 and NADPH oxidase (47). In

the kidney cortex, there is a wide distribution of various NADPH oxidase complexes, thus

serving as the predominant source of 02- generation (44). A previous study reported that renal

NADPH oxidase expression increased in 5/6 NX rats (151) and our data confirms this since we

observed that renal cortical NADPH oxidase-dependent Ozl prOduction increased in 5/6 NX rats









(133). We investigated several markers of oxidative stress in the A/I model and found that the

Ol- generating system is upregulated in male A/I rats represented by increased renal cortical

p22phox abundance, urinary H202, and plasma MDA levels. These data suggest that NADPH

oxidase may be the maj or source of ROS in the kidney.

Oxidative Stress and Neuronal Nitric Oxide Synthase

Our data suggests that oxidative stress is associated with loss of renal nNOSa and

subsequent development of injury. We showed that 5/6 NX rats develop increased NADPH-

dependent Ol~ prOduction and decreased nNOSa expression in the kidney cortex (chapter 6). In

the presence of the antioxidant vitamin E, both development of injury and loss of nNOSa are

attenuated. In the 5/6 A/I model sex difference study, renal cortical nNOSa abundance was

decreased in males, together with evidence of increased systemic and renal oxidative stress. In

contrast, female A/I rats tended to maintain nNOSa abundance and without evidence of

increased oxidative stress.

Little is known about whether oxidative stress can regulate nNOS expression in the kidney.

Angiotesin II infusion decreases nNOSa but increases NADPH oxidase expression, while

angiotensinogen and angiotensin 1 receptor knockout mice display increased nNOSa expression

(139). These findings suggest angiotensin II may induce NADPH oxidase to downregulate

nNOSa expression. It is supported by our finding in the 5/6 NX model that oxidative stress may

downregulate nNOSa expression in the kidney.

Asymmetric Dimethylarginine in Chronic Kidney Disease

Elevated ADMA level has been reported in various men with ESRD and CKD, CKD

models and is a risk factor for many cardiovascular disorders (146). Free plasma and tissue

ADMA levels are controlled by protein turnover rate and two counterbalancing pathways, type I

PRMT and DDAH. (146). Both methylation and breakdown of protein are highly regulated









processes (105, 137), however, their regulation of the formation of ADMA is not well

characterized. On the other hand, ADMA is metabolized by DDAH and the kidney plays a maj or

role for breakdown of excess ADMA (137, 146). In CKD, defective renal clearance of ADMA

may cause its accumulation in the blood and/or in tissue.

We found that plasma ADMA levels are increased in 5/6 NX model (133). Our data

suggest that the accumulation of ADMA is due to increased ADMA production (secondary to

increased PRMT1 abundance) and decreased ADMA degradation (secondary to decreased renal

DDAH activity). Matsuguma and colleagues have reported increased renal PRMT1 gene

expression although they also reported decreased DDAH1 and 2 protein expression in 5/6 NX

rats (90). This was contrast to our finding that DDAH1 and 2 protein abundance was unaltered in

5/6 NX rats; however, we found decreased renal DDAH activity.

Nevertheless, when we used the 5/6 A/I model there was no increase in plasma ADMA

level in either sex, which was unexpected since we used the same strain of rat and since the 5/6

A/I model produces more severe injury that the 5/6 NX. The renal PRMT1 increased similarly,

renal DDAH1 abundance was unchanged and DDAH2 fell similarly in both sexes with A/I.

However, while there was no change in renal ADMA levels in males with A/I an increase was

seen in females. In female A/I rats, an increased renal L-arginine levels also occurred which

should reduce the impact of the increased renal ADMA. Interestingly, the renal L-

arginine/ADMA ratios were reduced similarly after A/I in both sexes although the precise

mechanism of the reduction differed.

This sex difference study has highlighted the complexity of the regulation of plasma and

tissue ADMA levels since neither renal PRMT nor DDAH expression/activity can predict plasma

or kidney ADMA levels in shams or 5/6 A/I. Furthermore, plasma ADMA levels do not always









predict local ADMA levels because there is likely to be interorgan regulation to control its

homeostasis, i.e., ADMA formed in the heart might end up in the liver or kidney for breakdown.

Also, local formation will vary and the increased renal PRMT1 might mean that net renal

ADMA generation is increased in CKD. Of note, patients with normal plasma ADMA level may

actually already be at risk since ADMA may accumulate in other organs (e.g., endothelium),

consequently impairing their function (e.g., endothelial dysfunction). Therefore, plasma ADMA

levels may not accurately reflect ADMA-associated cardiovascular risk. Other markers are

needed to predict tissue ADMA levels seem important for future development of specific

ADMA-lowering agents.

Another unexpected finding was that renal ADMA levels were not invariably correlated to

renal DDAH activity. This again reinforces the complexity of ADMA regulation with different

tissues contributing to synthesis and breakdown. However, decreased tissue DDAH activity is

associated with poor renal outcome in male A/I rats, suggesting DDAH activity may be a marker

in predicting outcome. We were able to detect DDAH activity in rat RBC and found that it

correlates with renal DDAH activity. This may provide a useful tool as a surrogate measure of

renal DDAH activity in patients with CKD and clinical studies are planned to address this.

The distinct tissue distribution of the two DDAH isoforms suggests that there may be an

isoform-specific regulation of ADMA concentration and NO production (142). Wang et al. (154)

recently reported that blood ADMA level was regulated by DDAH1, which was mainly

expressed in kidney cortex and liver, whereas vascular NO production was primarily regulated

by DDAH2, which was expressed in blood vessels. However, this is inconsistent with previous

studies showing that loss of DDAH1 activity causes accumulation of ADMA as well as reduction

in NO (83) and decreased DDAH2 expression in vessels was associated with elevated plasma









ADMA levels in 5/6 NX rats (136). This seems an oversimplification because both ADMA and

NO are highly regulated by complicated processes, as supported by our findings. In summary, 1).

We found renal cortical DDAH1 expression was unchanged in 5/6 NX and A/I models regardless

to the plasma ADMA levels; 2). Plasma ADMA level cannot be predicted by individual organ

PRMT1 expression, DDAH1/2 expression, and DDAH activity; 3). Renal DDAH2 expression

was unaltered in 5/6 NX rats but decreased in 5/6 A/I rats; however, they all displayed decreased

NO production; 4). NO production was correlated to L-aginine/ADMA ratio but not to the

individual L-arginine or ADMA levels. These data points out the complexity of regulation on

ADMA and NO production and indicate the need for further studies deserve to study the specific

functions of DDAH isoforms. We have constructed lentiviral vectors carrying human DDAH1 or

DDAH2 cDNA and we are currently studying their renoprotective effects in a chronic PAN CKD

model. Hopefully, this study will give insight into the specific functions of two DDAH isoforms.

Oxidative Stress and Asymmetric Dimethylarginine

Although the link between oxidative stress and ADMA in cardiovascular disease has been

reviewed (128), their relationship in renal disease is unclear. Oxidative stress is considered to

increase the activity of PRMT and decrease the expression/activity of DDAH, which leads to the

increase in ADMA concentrations (128). Interestingly, we found increased ADMA production

(secondary to increased PRMT1 abundance) and decreased ADMA degradation (secondary to

decreased DDAH activity) in 5/6 NX rats, which was associated with increased renal NADPH

oxidase-dependent Ozl prOduction. According to the current literature, it is well established that

the presence of a reactive cysteine residue in the active site of DDAH1/2 makes their activity

susceptible to inhibition by S-nitrosylation as well as oxidation by ROS (72, 82, 128). In our

studies, we also reported that renal DDAH activity was inhibited by either Ozl Or NO donor in

vitro (132). However, in the 5/6 NX study, vitamin E reduced NADPH oxidase-dependent Oz









production, protected the kidney structure, preserved nNOSa but had no impact on the elevated

plasma ADMA levels in 5/6 NX rats (133). In addition, there was no reversal of the decreased

DDAH activity in the kidney. This data was unexpected since Wilcox et al. (44) suggests that

NADPH oxidase is the primary renal oxidase and yet normalization with vitamin E did not

reduce ADMA or restore renal DDAH activity. This could mean that Ol frOm other oxidative

enzymes or other sources of ROS becomes important in generation of ROS in CKD.

Alternatively it could mean that PRMT 1 expression/DDAH activity is not invariably regulated

by increased ROS.

Our subsequent studies in the 5/6 A/I model support this possibility since the Ozl

generating system is upregulated in male A/I rats (increased renal cortical p22phox abundance,

urinary H202, and plasma MDA levels), tissue DDAH activity (in kidney, liver, and RBC) fell

but there was no increase in either plasma or renal ADMA levels. In contrast, the female A/I rats

displayed increased renal ADMA levels with no evidence of increased ROS and similar absolute

DDAH activity in tissues. Whether oxidative stress can induce the accumulation of ADMA in

the kidney via regulation of PRMT/DDAH needs further evaluation, as does the impact of

different types of oxidative stress on the system.

Target on Nitric Oxide Pathway to Prevent Chronic Kidney Disease Progression and
Cardiovascular Complications

At present, treatment aiming to retard CKD progression is limited to aggressive blood

pressure control and blockade of renin-angiotensin system, with few therapies targeting the NO

pathway. Because many common mechanisms of CKD progression share NO deficiency which

is causally involved in both CKD progression and endothelial dysfunction, preservation of NO

bioavailability becomes a therapeutic target in CKD patients. The administration of L-arginine

was the most common treatment targeted to improve the NO pathway in both CKD and CVD.









Although L-arginine had a beneficial effect in experimental CKD animals (70), the data from

human trials are still inconclusive (10, 15, 31).

We demonstrated that NO production is decreased in CKD and this is likely due to

decreased renal nNOS abundance, increased oxidative stress, and accumulation of ADMA.

Instead of L-arginine supplementation, the data presented above allows us to prevent NO

deficiency in CKD patients with therapeutic approaches to (1) improve decreased renal cortical

nNOSa abundance, (2) effectively suppress oxidative stress by targeting appropriate source of

ROS, and (3) correct elevated ADMA levels (Figure 8-2).

Neuronal Nitric Oxide Synthase Gene Therapy

The cortical nNOSa is of critical importance in the pathogenesis of CKD progression as

we demonstrated that its expression correlate to renal outcome in every CKD model studies.

Although targeting nNOS with gene transfer have been used to modulate cardiac function (96),

portal hypertension (163), and erectile dysfunction (88), kidney transfection is difficult due to its

functional heterogeneity (141). Furthermore, since cortical nNOSa is uniquely located in MD,

overexpressing nNOSa in the kidney cortex is difficult since MD-specific promoter is

unavailable. Gene therapy to preserve renal nNOS is still at an early stage of development.

However, nNOS in MD could be enhanced by salt restriction, diuretics, ACE inhibitors, and

NaHCO3 (139). Whether above interventions can preserve nNOS/NO in CKD patients deserves

further evaluation.

Next, nNOS can also produce Ozl inStead of NO in the presence of deficiency of L-arginine

or cofactor BH4. Without correction of increased oxidative stress and ADMA, nNOS gene

therapy could serve more harm that good, due to nNOS uncoupling. Therefore, in addition to

preserving renal cortical nNOS abundance, relieving the inhibition on nNOS by manipulating

oxidative stress and ADMA are essential.









Prevention of Chronic Kidney Disease Progression by Antioxidants

Traditionally, the treatment of oxidative stress is with the administration of antioxidants.

We found a lack of renoprotection using short-term combined antioxidants in I/R injury although

vitamin E prevents CKD progression in 5/6 NX rats. We also found female A/I rats displayed

renal failure without induction of oxidative stress. As pointed out by Vaziri (148), it is clear that

identification of the source of ROS and control of ROS production is a better strategy than non-

selective use of antioxidants to treat different kinds of CKD. As ideal antioxidants for clinical

use have not yet been discovered, a mechanism-based approach is required to gain understanding

of the relative importance of the different contributors to oxidative stress in CKD. This may then

lead to use of specific antioxidants to prevent the progression of CKD with different insults.

Prevention of Chronic Kidney Disease Progression by Lowering Asymmetric
Dimethylarginine

Although ACE inhibitors, ARBs, hypoglycemic agents, and hormone replacement therapy

(HRT) have been shown to reduce ADMA levels, specific ADMA-lowering therapy is not yet

available (86). Treatment aimed at reducing oxidative stress was unable to lower plasma ADMA

levels (129). Given the facts that accumulation of ADMA is associated with increased PRMT

expression and decreased DDAH expression/activity, lowering ADMA levels could be

approached by PRMT inhibitors or DDAH agonists. Several PRMT isoforms have been

identified, each of which has its own distinct function in regulation of cellular physiology.

Selective PRMT inhibitors are unavailable and anyway their inhibition may cause unwanted side

effects (77). On the other hand, DDAH is emerging as a prime target for therapeutic

interventions to lower ADMA. Although promising insights come from the DDAH-transgenic

mice (52), selective DDAH agonist and DDAH gene therapy still awaits confirmation.

Preliminary animal work showed DDAH1 gene therapy can prevent the progression in a 5/6 NX









rat model (91). A site-specific and sustained expression DDAH gene therapy for CKD patients

requires further development.

Multifaceted Therapeutic Approaches in Preventing Chronic Kidney Disease Progression

As our understanding of the mechanisms of CKD continues to expand, additional targets

for intervention will be identified, and it is likely that a multifaceted therapeutic approach will be

required to slow the CKD progression and reduce CV complications. Chronic L-arginine therapy

alone has no impact on progression of patients with mild CKD (31), indicating that the

preservation of NO bioavailability may need multifaceted therapeutic approaches. Of course,

such approaches as gene therapy (e.g., nNOS or DDAH), specific antioxidants, and specific

ADMA-lowering agents may become viable options for CKD patients marked by NO deficiency.









Table 8-1. The nNOSa and -P isoform expression in different chronic kidney disease models
Model Rat Sex Follow %CCr % GS nNOSa nNOSP OS ADMA
stream -up
I/R ISO F344 M 22wk ~60% 25% t, ND ND

RAPA F344 M 22wk ~70% 30% ND ND
ALLO
Lewi s
5/6 NX SD M 15wk ~20% 40%

5/6 NX SD M 15wk ~20% 25% t, 1 e
+Vit E
A/I SD M 7wk ~10% 40%
A/I SD F 7wk ~3 0% 30% e 1e
OS=0xidative stress; ?= increase; l=decrease; ta=no change; ND= not detected.













100
90
80
70
60
50
40
30
20
10
0


---------*------------------------
End-stage renal dis ease


Figure 8-1. Various progression rates to end-stage renal disease in different chronic kidney
disease (CKD) models. The steeper the slope, the more rapid the rate of progression
and the more severe the injury.


Time after renal injury, week








0 Oxidative stress 1

Specific antioxidants -

Gene therapy NO 1`
nNOS UOnNOSa 1
DDAH

Specific ADMA DDAH T
-lowering agents A M
Figure 8-2. Target nitric oxide (NO) pathways in preventing chronic kidney disease (CKD)
progression and cardiovascular complications. NO bioavailability can be preserved by
(1) Increased renal cortical neuronal nitric oxide synthase (nNOS) abundance, (2)
Decreased oxidative stress, and (3) Decreased asymmetric dimethylarginine (ADMA)
by activation of dimethylarginine dimethylaminohydrolase (DDAH).









LIST OF REFERENCES


1. Achan V, Tran CT, Arrigoni F, Whitley GS, Leiper JM and Vallance P. all-trans-Retinoic
acid increases nitric oxide synthesis by endothelial cells: a role for the induction of
dimethylarginine dimethylaminohydrolase. Circ Res 90: 764-769, 2002.

2. Albrecht EW, van Goor H, Smit-van Oosten A and Stegeman CA. Long-term dietary L-
arginine supplementation attenuates proteinuria and focal glomerulosclerosis in experimental
chronic renal transplant failure. Nitric Oxide 8: 53-58, 2003.

3. Alderton WK, Cooper CE and Knowles RG. Nitric oxide synthases: structure, function and
inhibition. Biochem J3 57: 593-615, 2001.

4. Arthur JM, Thongboonkerd V, Scherzer JA, Cai J, Pierce WM and Klein JB. Differential
expression of proteins in renal cortex and medulla: a proteomic approach. Kidney Int 62: 13 14-
1321, 2002.

5. Attia DM, Verhagen AM, Stroes ES, van Faassen EE, Grone HJ, De Kimpe SJ, Koomans
HA, Braam B and Joles JA. Vitamin E alleviates renal injury, but not hypertension, during
chronic nitric oxide synthase inhibition in rats. JAm Soc Nephrol 12: 2585-2593, 2001.

6. Azuma H, Nadeau K, Takada M, Mackenzie HS and Tilney NL. Cellular and molecular
predictors of chronic renal dysfunction after initial ischemia/reperfusion injury of a single
kidney. Transplantation 64: 190-197, 1997.

7. Azzi A, Ricciarelli R and Zingg JM. Non-antioxidant molecular functions of alpha-
tocopherol (vitamin E). FEBS Lett 519: 8-10, 2002.

8. Bachmann S, Bosse HM and Mundel P. Topography of nitric oxide synthesis by localizing
constitutive NO synthases in mammalian kidney. Am JPhysiol 268: F885-98, 1995.

9. Bachmann S and Theilig F. Juxtaglomerular apparatus, nitric oxide, and macula densa
signaling. Adv Nephrol Necker Hosp 30: 95-107, 2000.

10. Baylis C. Arginine, arginine analogs and nitric oxide production in chronic kidney disease.
Nat Clin Pract Nephrol 2: 209-220, 2006.

11. Baylis C. Changes in renal hemodynamics and structure in the aging kidney; sexual
dimorphism and the nitric oxide system. Exp Gerontol 40: 271-278, 2005.

12. Bedford MT and Richard S. Arginine methylation an emerging regulator of protein
function. Mol1 Cell 18: 263-272, 2005.

13. Billecke SS, Kitzmiller LA, Northrup JJ, Whitesall SE, Kimoto M, Hinz AV and
D'Alecy LG. Contribution of whole blood to the control of plasma asymmetrical
dimethylarginine. Am JPhysiolHeart Circ Physiol 291: H1788-96, 2006.










14. Bode-Boger SM, Scalera F, Kielstein JT, Martens-Lobenhoffer J, Breithardt G, Fobker
M and Reinecke H. Symmetrical dimethylarginine: a new combined parameter for renal
function and extent of coronary artery disease. JAm Soc Nephrol 17: 1 128-1 134, 2006.

15. Boger RH. The pharmacodynamics of L-arginine. JNutr 137: 1650S-1655S, 2007.

16. Boger RH, Schwedhelm E, Maas R, Quispe-Bravo S and Skamira C. ADMA and
oxidative stress may relate to the progression of renal disease: rationale and design of the
VIVALDI study. Vasc M~ed 10 Suppl 1: S97-102, 2005.

17. Boissel JP, Schwarz PM and Forstermann U. Neuronal-type NO synthase: transcript
diversity and expressional regulation. Nitric Oxide 2: 337-349, 1998.

18. Brandes RP and Mugge A. Gender differences in the generation of superoxide anions in the
rat aorta. Life Sci 60: 391-396, 1997.

19. Braunlich H, Marx F, Fleck C and Stein G. Kidney function in rats after 5/6 nephrectomy
(5/6 NX); effort of treatment with vitamin E. Exp Toxicol Pathol 49: 13 5-139, 1997.

20. Brenman JE, Chao DS, Gee SH, McGee AW, Craven SE, Santillano DR, Wu Z, Huang
F, Xia H, Peters MF, Froehner SC and Bredt DS. Interaction of nitric oxide synthase with the
postsynaptic density protein PSD-95 and alphal-syntrophin mediated by PDZ domains. Cell 84:
757-767, 1996.

21. Brenner BM. Remission of renal disease: recounting the challenge, acquiring the goal. J
Clin Invest 110: 1753-1758, 2002.

22. Brigelius-Flohe R, Kelly FJ, Salonen JT, Neuzil J, Zingg JM and Azzi A. The European
perspective on vitamin E: current knowledge and future research. Am J Clin Nutr 76: 703-716,
2002.

23. Cardounel AJ, Xia Y and Zweier JL. Endogenous methylarginines modulate superoxide as
well as nitric oxide generation from neuronal nitric-oxide synthase: differences in the effects of
monomethyl- and dimethylarginines in the presence and absence of tetrahydrobiopterin. JBiol
Chem 280: 7540-7549, 2005.

24. Chander V and Chopra K. Renal protective effect of molsidomine and L-arginine in
ischemia-reperfusion induced injury in rats. JSurgRes 128: 132-139, 2005.

25. Chatterjee PK, Cuzzocrea S, Brown PA, Zacharowski K, Stewart KN, Mota-Filipe H
and Thiemermann C. Tempol, a membrane-permeable radical scavenger, reduces oxidant
stress-mediated renal dysfunction and injury in the rat. Kidney Int 58: 658-673, 2000.

26. Chen Y, Li Y, Zhang P, Traverse JH, Hou M, Xu X, Kimoto M and Bache RJ.
Dimethylarginine dimethylaminohydrolase and endothelial dysfunction in failing hearts. Am J
Physiol Heart Circ Physiol 289: H12212-9, 2005.










27. Cooke JP. Does ADMA cause endothelial dysfunction? Arterioscler 7hromb Vasc Biol 20:
2032-2037, 2000.

28. Curis E, Nicolis I, Moinard C, Osowska S, Zerrouk N, Benazeth S and Cynober L.
Almost all about citrulline in mammals. Amino Acids 29: 177-205, 2005.

29. Cuzzocrea S, Riley DP, Caputi AP and Salvemini D. Antioxidant therapy: a new
pharmacological approach in shock, inflammation, and ischemia/reperfusion injury. Pharmacol
Rev 53: 135-159, 2001.

30. Dayoub H, Achan V, Adimoolam S, Jacobi J, Stuehlinger MC, Wang BY, Tsno PS,
Kimoto M, Vallance P, Patterson AJ and Cooke JP. Dimethylarginine
dimethylaminohydrolase regulates nitric oxide synthesis: genetic and physiological evidence.
Circulation 108: 3042-3047, 2003.

31. De Nicola L, Bellizzi V, Minutolo R, Andreucci M, Capuano A, Garibotto G, Corso G,
Andreucci VE and Cianciaruso B. Randomized, double-blind, placebo-controlled study of
arginine supplementation in chronic renal failure. Kidney Int 56: 674-684, 1999.

32. DiJoseph JF, Fluhler E, Armstrong J, Sharr M and Sehgal SN. Therapeutic blood levels
of sirolimus (rapamycin) in the allografted rat. Transplantation 62: 1109-1112, 1996.

33. Dikalov SI, Dikalova AE and Mason RP. Noninvasive diagnostic tool for inflammation-
induced oxidative stress using electron spin resonance spectroscopy and an extracellular cyclic
hydroxylamine. Arch Biochem Biophys 402: 218-226, 2002.

34. El Nahas M. The global challenge of chronic kidney disease. Kidney Int 68: 2918-2929,
2005.

35. Eliasson MJ, Blackshaw S, Schell MJ and Snyder SH. Neuronal nitric oxide synthase
alternatively spliced forms: prominent functional localizations in the brain. Proc Natl Acad Sci U
SA 94: 3396-3401, 1997.

36. Erdely A, Freshour G and Baylis C. Resistance to renal damage by chronic nitric oxide
synthase inhibition in the Wistar-Furth rat. Am JPhysiol Regul Integr Comp Physiol 290: R66-
72, 2006.

37. Erdely A, Freshour G, Maddox DA, Olson JL, Samsell L and Baylis C. Renal disease in
rats with type 2 diabetes is associated with decreased renal nitric oxide production. Diabetologia
47: 1672-1676, 2004.

38. Erdely A, Freshour G, Smith C, Engels K, Olson JL and Baylis C. Protection against
puromycin aminonucleoside-induced chronic renal disease in the Wistar-Furth rat. Am JPhysiol
Renal Physiol 287: F81-9, 2004.

39. Erdely A, Freshour G, Tain YL, Engels K and Baylis C. DOCA/NaCl-induced chronic
kidney disease: a comparison of renal nitric oxide production in resistant and susceptible rat
strains. Am JPhysiol Renal Physiol 292: F 192-6, 2007.










40. Erdely A, Greenfeld Z, Wagner L and Baylis C. Sexual dimorphism in the aging kidney:
Effects on injury and nitric oxide system. Kidney Int 63: 1021-1026, 2003.

41. Erdely A, Wagner L, Muller V, Szabo A and Baylis C. Protection of wistar fourth rats from
chronic renal disease is associated with maintained renal nitric oxide synthase. JAm Soc Nephrol
14: 2526-2533, 2003.

42. Fortepiani LA and Reckelhoff JF. Role of oxidative stress in the sex differences in blood
pressure in spontaneously hypertensive rats. JHypertens 23: 801-805, 2005.

43. Frein D, Schildknecht S, Bachschmid M and Ullrich V. Redox regulation: a new
challenge for pharmacology. Biochem Pharmacol 70: 811-823, 2005.

44. Gill PS and Wilcox CS. NADPH oxidases in the kidney. AntioxidRedox Signal 8: 1597-
1607, 2006.

45. Gordon CA and Himmelfarb J. Antioxidant therapy in uremia: evidence-based medicine?
Semin Dial 17: 327-332, 2004.

46. Gornall AG and Hunter A. A colorimetric method for the determination of citrulline.
Biochem J35: 650-658, 1941.

47. Griendling KK and FitzGerald GA. Oxidative stress and cardiovascular injury: Part I:
basic mechanisms and in vivo monitoring of ROS. Circulation 108: 1912-1916, 2003.

48. Griffin KA, Picken MM and Bidani AK. Blood pressure liability and glomerulosclerosis
after normotensive 5/6 renal mass reduction in the rat. Kidney Int 65: 209-218, 2004.

49. Gyurko R, Leupen S and Huang PL. Deletion of exon 6 of the neuronal nitric oxide
synthase gene in mice results in hypogonadism and infertility. Endocrinology 143: 2767-2774,
2002.

50. Hahn S, Krieg RJ,Jr, Hisano S, Chan W, Kuemmerle NB, Saborio P and Chan JC.
Vitamin E suppresses oxidative stress and glomerulosclerosis in rat remnant kidney. Pediatr
Nephrol 13: 195-198, 1999.

51. Hanna IR, Hilenski LL, Dikalova A, Taniyama Y, Dikalov S, Lyle A, Quinn MT,
Lassegue B and Griendling KK. Functional association of nox1 with p22phox in vascular
smooth muscle cells. Free RadiRRR~~~~~RRRRR~~~~c Biol2~ed 37: 1542-1549, 2004.

52. Hasegawa K, Wakino S, Tatematsu S, Yoshioka K, Homma K, Sugano N, Kimoto M,
Hayashi K and Itoh H. Role of asymmetric dimethylarginine in vascular injury in transgenic
mice overexpressing dimethylarginie dimethylaminohydrolase 2. Circ Res 101: e2-10, 2007.

53. Himmelfarb J, Stenvinkel P, Ikizler TA and Hakim RM. The elephant in uremia: oxidant
stress as a unifying concept of cardiovascular disease in uremia. Kidney Int 62: 1524-153 8, 2002.










54. Holden DP, Cartwright JE, Nussey SS and Whitley GS. Estrogen stimulates
dimethylarginine dimethylaminohydrolase activity and the metabolism of asymmetric
dimethylarginine. Circulation 108: 1575-1580, 2003.

55. Hu T, Chouinard M, Cox AL, Sipes P, Marcelo M, Ficorilli J, Li S, Gao H, Ryan TP,
Michael MD and Michael LF. Farnesoid X receptor agonist reduces serum asymmetric
dimethylarginine levels through hepatic dimethylarginine dimethylaminohydrolase- 1 gene
regulation. JBiol Chem 281: 39831-39838, 2006.

56. Huang H, He Z, Roberts LJ,2nd and Salahudeen AK. Deferoxamine reduces cold-
ischemic renal injury in a syngeneic kidney transplant model. Am J Transplan2t 3: 1531-1537,
2003.

57. Huang PL, Dawson TM, Bredt DS, Snyder SH and Fishman MC. Targeted disruption of
the neuronal nitric oxide synthase gene. Cell 75: 1273-1286, 1993.

58. Huber A, Saur D, Kurjak M, Schusdziarra V and Allescher HD. Characterization and
splice variants of neuronal nitric oxide synthase in rat small intestine. Am JPhysiol 275: G1 146-
56, 1998.

59. Hurt KJ, Sezen SF, Champion HC, Crone JK, Palese MA, Huang PL, Sawa A, Luo X,
Musicki B, Snyder SH and Burnett AL. Alternatively spliced neuronal nitric oxide synthase
mediates penile erection. Proc NatlAcad Sci U SA 103: 3440-3443, 2006.

60. Ibrahim HN and Hostetter TH. The renin-aldosterone axis in two models of reduced renal
mass in the rat. JAm Soc Nephrol 9: 72-76, 1998.

61. Ito A, Tsno PS, Adimoolam S, Kimoto M, Ogawa T and Cooke JP. Novel mechanism for
endothelial dysfunction: dysregulation of dimethylarginine dimethylaminohydrolase. Circulation
99: 3092-3095, 1999.

62. Jacobi J, Sydow K, von Degenfeld G, Zhang Y, Dayoub H, Wang B, Patterson AJ,
Kimoto M, Blau HM and Cooke JP. Overexpression of dimethylarginine
dimethylaminohydrolase reduces tissue asymmetric dimethylarginine levels and enhances
angiogenesis. Circulation 111: 1431-1438, 2005.

63. Jaffrey SR and Snyder SH. PIN: an associated protein inhibitor of neuronal nitric oxide
synthase. Science 274: 774-777, 1996.

64. Ji H, Zheng W, Menini S, Pesce C, Kim J, Wu X, Mulroney SE and Sandberg K.
Female protection in progressive renal disease is associated with estradiol attenuation of
superoxide production. Gend2~ed 4: 56-71, 2007.

65. Joles JA, Vos IH, Grone HJ and Rabelink TJ. Inducible nitric oxide synthase in renal
transplantation. Kidney Int 61: 872-875, 2002.










66. Kang ES, Cates TB, Harper DN, Chiang TM, Myers LK, Acchiardo SR and Kimoto M.
An enzyme hydrolyzing methylated inhibitors of nitric oxide synthase is present in circulating
human red blood cells. Free Radic Res 35: 693-707, 2001.

67. Kim J, Kil IS, Seok YM, Yang ES, Kim DK, Lim DG, Park JW, Bonventre JV and
Park KM. Orchiectomy attenuates post-ischemic oxidative stress and ischemia/reperfusion
injury in mice. A role for manganese superoxide dismutase. JBiol Chem 281: 20349-203 56,
2006.

68. Kimoto M, Miyatake S, Sasagawa T, Yamashita H, Okita M, Oka T, Ogawa T and
Tsuji H. Purifieation, cDNA cloning and expression of human NG,NG-dimethylarginine
dimethylaminohydrolase. Eur JBiochem 258: 863-868, 1998.

69. Kir HM, Dillioglugil MO, Tugay M, Eraldemir C and Ozdogan HK. Effects of vitamins
E, A and D on MDA, GSH, NO levels and SOD activities in 5/6 nephrectomized rats. Am J
Nephrol 25: 441-446, 2005.

70. Klahr S and Morrissey J. L-arginine as a therapeutic tool in kidney disease. Semin Nephrol
24: 389-394, 2004.

71. Knipp M. How to control NO production in cells: N(omega),N(omega)-dimethyl-L-arginine
dimethylaminohydrolase as a novel drug target. Chembiochem 7: 879-889, 2006.

72. Knipp M, Braun O, Gehrig PM, Sack R and Vasak M. Zn(II)-free dimethylargininase- 1
(DDAH-1) is inhibited upon specific Cys-S-nitrosylation. JBiol Chem 278: 3410-3416, 2003.

73. Knipp M and Vasak M. A colorimetric 96-well microtiter plate assay for the determination
of enzymatically formed citrulline. Anal Biochem 286: 257-264, 2000.

74. Kone BC. Nitric oxide synthesis in the kidney: isoforms, biosynthesis, and functions in
health. Semin Nephrol 24: 299-315, 2004.

75. Kone BC. Localization and regulation of nitric oxide synthase isoforms in the kidney. Semin
Nephrol 19: 230-241, 1999.

76. Kouwenhoven EA, de Bruin RW, Heemann U, Marquet RL and IJzermans JN. Does
cold ischemia induce chronic kidney transplant dysfunction? Transplant Proc 3 1: 988-989, 1999.

77. Krause CD, Yang ZH, Kim YS, Lee JH, Cook JR and Pestka S. Protein arginine
methyltransferases: evolution and assessment of their pharmacological and therapeutic potential.
Pharmacol Ther 113: 50-87, 2007.

78. Kulhanek V, Maderova V, Sindelarova K and Vojtiskova V. Modified Determination of
Ornithine-Carbamyl-Transferase Activity in Biological Material. Clin Chim Acta 8: 579-585,
1963.

79. Langnaese K, Richter K, Smalla KH, Krauss M, Thomas U, Wolf G and Laube G.
Splice-isoform specific immunolocalization of neuronal nitric oxide synthase in mouse and rat









brain reveals that the PDZ-complex-building nNOSalpha beta-finger is largely exposed to
antibodies. Dev Neurobiol 67: 422-437, 2007.

80. Lau KS, Grange RW, Isotani E, Sarelius IH, Kamm KE, Huang PL and Stull JT. nNOS
and eNOS modulate cGMP formation and vascular response in contracting fast-twitch skeletal
muscle. Physiol Genomics 2: 21-27, 2000.

81. Lee MA, Cai L, Hubner N, Lee YA and Lindpaintner K Tissue- and development-
specific expression of multiple alternatively spliced transcripts of rat neuronal nitric oxide
synthase. JClin Invest 100: 1507-1512, 1997.

82. Leiper J, Murray-Rust J, McDonald N and Vallance P. S-nitrosylation of
dimethylarginine dimethylaminohydrolase regulates enzyme activity: further interactions
between nitric oxide synthase and dimethylarginine dimethylaminohydrolase. Proc NatlAcad
Sci USA 99: 13527-13532, 2002.

83. Leiper J, Nandi M, Torondel B, Murray-Rust J, Malaki M, O'Hara B, Rossiter S,
Anthony S, Madhani M, Selwood D, Smith C, Wojciak-Stothard B, Rudiger A, Stidwill R,
McDonald NQ and Vallance P. Disruption of methylarginine metabolism impairs vascular
homeostasis. Nat Med 13: 198-203, 2007.

84. Leiper JM, Santa Maria J, Chubb A, MacAllister RJ, Charles IG, Whitley GS and
Valance P. Identification of two human dimethylarginine dimethylaminohydrolases with
distinct tissue distributions and homology with microbial arginine deiminases. Biochem J343 Pt
1: 209-214, 1999.

85. Lin Z, Crockett DK, Lim MS and Elenitoba-Johnson KS. High-throughput analysis of
protein/peptide complexes by immunoprecipitation and automated LC-MS/MS. JBiomol Tech
14: 149-155, 2003.

86. Maas R. Pharmacotherapies and their influence on asymmetric dimethylargine (ADMA).
Varsc Med 10 Suppl 1: S49-57, 2005.

87. MacAllister RJ, Parry H, Kimoto M, Ogawa T, Russell RJ, Hodson H, Whitley GS and
Valance P. Regulation of nitric oxide synthesis by dimethylarginine dimethylaminohydrolase.
Br JPharmacol 119: 1533-1540, 1996.

88. Magee TR, Ferrini M, Garban HJ, Vernet D, Mitani K, Rajfer J and Gonzalez-Cadavid
NF. Gene therapy of erectile dysfunction in the rat with penile neuronal nitric oxide synthase.
BiolReprod 67: 1033-1041, 2002.

89. Maser RL, Vassmer D, Magenheimer BS and Calvet JP. Oxidant stress and reduced
antioxidant enzyme protection in polycystic kidney disease. JAm Soc Nephrol 13: 991-999,
2002.

90. Matsuguma K, Ueda S, Yamagishi S, Matsumoto Y, Kaneyuki U, Shibata R, Fujimura
T, Matsuoka H, Kimoto M, Kato S, Imaizumi T and Okuda S. Molecular mechanism for









elevation of asymmetric dimethylarginine and its role for hypertension in chronic kidney disease.
JAm Soc Nephrol 17: 2176-2183, 2006.

91. Matsumoto Y, Ueda S, Yamagishi S, Matsuguma K, Shibata R, Fukami K, Matsuoka
Hi, Imaizumi T and Okuda S. Dimethylarginine dimethylaminohydrolase prevents progression
of renal dysfunction by inhibiting loss of peritubular capillaries and tubulointerstitial fibrosis in a
rat model of chronic kidney disease. JAm Soc Nephrol 18: 1525-1533, 2007.

92. Meier-Kriesche HU, Schold JD and Kaplan B. Long-term renal allograft survival: have we
made significant progress or is it time to rethink our analytic and therapeutic strategies? Am J
Transplan2t 4: 1289-1295, 2004.

93. Miller AA, De Silva TM, Jackman KA and Sobey CG. Effect of gender and sex hormones
on vascular oxidative stress. Clin Exp Pharmacol Physiol 34: 103 7-1043, 2007.

94. Miller ER,3rd, Pastor-Barriuso R, Dalal D, Riemersma RA, Appel LJ and Guallar E.
Meta-analysis: high-dosage vitamin E supplementation may increase all-cause mortality. Ann
Intern M~ed 142: 37-46, 2005.

95. Modlinger PS, Wilcox CS and Aslam S. Nitric oxide, oxidative stress, and progression of
chronic renal failure. Semin Nephrol 24: 354-365, 2004.

96. Mohan RM, Golding S, Heaton DA, Danson EJ and Paterson DJ. Targeting neuronal
nitric oxide synthase with gene transfer to modulate cardiac autonomic function. Prog Biophys
M~olBiol 84: 321-344, 2004.

97. Nakagawa T, Kang DH, Ohashi R, Suga S, Herrera-Acosta J, Rodriguez-Iturbe B and
Johnson RJ. Tubulointerstitial disease: role of ischemia and microvascular disease. Curr Opin
Nephrol Hypertens 12: 233-241, 2003.

98. Naoum JJ, Woodside KJ, Zhang S, Rychahou PG and Hunter GC. Effects of rapamycin
on the arterial inflammatory response in atherosclerotic plaques in Apo-E knockout mice.
Transplan2tProc 37: 1880-1884, 2005.

99. Napoli KL, Wang ME, Stepkowski SM and Kahan BD. Distribution of sirolimus in rat
tissue. Clin Biochem 30: 135-142, 1997.

100. Neugarten J, Ding Q, Friedman A, Lei J and Silbiger S. Sex hormones and renal nitric
oxide synthases. JAm Soc Nephrol 8: 1240-1246, 1997.

101. Ninova D, Covarrubias M, Rea DJ, Park WD, Grande JP and Stegall MD. Acute
nephrotoxicity of tacrolimus and sirolimus in renal isografts: differential intragraft expression of
transforming growth factor-betal and alpha-smooth muscle actin. Transplantation 78: 338-344,
2004.

102. Oberbaumer I, Moser D and Bachmann S. Nitric oxide synthase 1 mRNA: tissue-
specific variants from rat with alternative first exons. Biol Chem 379: 913-919, 1998.










103. Ogawa T, Kimoto M and Sassoka K. Purification and properties of a new enzyme,
NG,NG-dimethylarginine dimethylaminohydrolase, from rat kidney. JBiol Chent 264: 10205-
10209, 1989.

104. Ortiz PA and Garvin JL. Cardiovascular and renal control in NOS-deficient mouse
model s. Am JPhysiol Regul hItegr Comp Physiol 284: R628-3 8, 2003.

105. Pahlich S, Zakaryan RP and Gehring H. Protein arginine methylation: Cellular functions
and methods of analysis. Biochint Biophys Acta 1764: 1890-1903, 2006.

106. Pawlak K, Pawlak D and Mysliwiec M. Cu/Zn superoxide dismutase plasma levels as a
new useful clinical biomarker of oxidative stress in patients with end-stage renal disease. Clin
Biochent 38: 700-705, 2005.

107. Perico N, Cattaneo D, Sayegh MH and Remuzzi G. Delayed graft function in kidney
transplantation. Lancet 364: 1814-1827, 2004.

108. Persson AE and Bachmann S. Constitutive nitric oxide synthesis in the kidney--functions
at the juxtaglomerular apparatus. Acta Physiol Scand' 169: 3 17-324, 2000.

109. Prescott LM and Jones ME. Modified methods for the determination of carbamyl
aspartate. Anal Biochent 32: 408-419, 1969.

1 10. Ratner S and Petrack B. Biosynthesis of urea. IV. Further studies on condensation in
arginine synthesis from citrulline. JBiol Chent 200: 161-174, 1953.

1 11. Reckelhoff JF, Kanji V, Racusen LC, Schmidt AM, Yan SD, Marrow J, Roberts
LJ,2nd and Salahudeen AK. Vitamin E ameliorates enhanced renal lipid peroxidation and
accumulation of F2-isoprostanes in aging kidneys. Am JPhysiol 274: R767-74, 1998.

112. Reutzel-Selke A, Zschockelt T, Denecke C, Bachmann U, Jurisch A, Pratschke J,
Schmidbauer G, Volk HD, Neuhaus P and Tullius SG. Short-term immunosuppressive
treatment of the donor ameliorates consequences of ischemia/ reperfusion injury and long-term
graft function in renal allografts from older donors. Transplantation 75: 1786-1792, 2003.

1 13. Roczniak A, Levine DZ and Burns KD. Localization of protein inhibitor of neuronal
nitric oxide synthase in rat kidney. Am JPhysiol Renal Physiol 278: F702-7, 2000.

114. Safirstein R, Miller P and Kahn T. Cortical and papillary absorptive defects in gentamicin
nephrotoxicity. Kidney it 24: 526-533, 1983.

115. Saran R, Novak JE, Desai A, Abdulhayoglu E, Warren JS, Bustami R, Handelman
GJ, Barbato D, Weitzel W, D'Alecy LG and Rajagopalan S. Impact of vitamin E on plasma
asymmetric dimethylarginine (ADMA) in chronic kidney disease (CKD): a pilot study. Nephrol
Dial Transplant 18: 2415-2420, 2003.









116. Sartori-Valinotti JC, Iliescu R, Fortepiani LA, Yanes LL and Reckelhoff JF. Sex
differences in oxidative stress and the impact on blood pressure control and cardiovascular
disease. Clin Exp Pharmacol Physiol 34: 93 8-945, 2007.

117. Saur D, Paehge H, Schusdziarra V and Allescher HD. Distinct expression of splice
variants of neuronal nitric oxide synthase in the human gastrointestinal tract. Gastroenterology
118: 849-858, 2000.

118. Scalera F, Kielstein JT, Martens-Lobenhoffer J, Postel SC, Tager M and Bode-Boger
SM. Erythropoietin increases asymmetric dimethylarginine in endothelial cells: role of
dimethylarginine dimethylaminohydrolase. JAm Soc Nephrol 16: 892-898, 2005.

119. Schiffrin EL, Lipman ML and Mann JF. Chronic kidney disease: effects on the
cardiovascular system. Circulation 116: 85-97, 2007.

120. Schmidt RJ and Baylis C. Total nitric oxide production is low in patients with chronic
renal disease. Kidney Int 58: 1261-1266, 2000.

121. Schramm L, La M, Heidbreder E, Hecker M, Beckman JS, Lopau K, Zimmermann J,
Rendl J, Reiners C, Winderl S, Wanner C and Schmidt HH. L-arginine deficiency and
supplementation in experimental acute renal failure and in human kidney transplantation. Kidney
Int 61: 1423-1432, 2002.

122. Schulze F, Maas R, Freese R, Schwedhelm E, Silberhorn E and Boger RH.
Determination of a reference value for N(G), N(G)-dimethyl-L-arginine in 500 subj ects. Eur J
Clin Invest 35: 622-626, 2005.

123. Shah SV, Baliga R, Rajapurkar M and Fonseca VA. Oxidants in chronic kidney disease.
JAm Soc Nephrol 18: 16-28, 2007.

124. Stojanovic T, Grone HJ, Gieseler RK, Klanke B, Schlemminger R, Tsikas D and
Grone EF. Enhanced renal allograft rejection by inhibitors of nitric oxide synthase: a
nonimmunologic influence on alloreactivity. Lab Invest 74: 496-512, 1996.

125. Stuehr DJ and Marletta 1MA. Mammalian nitrate biosynthesis: mouse macrophages
produce nitrite and nitrate in response to Escherichia coli lipopolysaccharide. Proc Natl Acad Sci
USA 82: 7738-7742, 1985.

126. Stuhlinger MC, Tsno PS, Her JH, Kimoto M, Balint RF and Cooke JP. Homocysteine
impairs the nitric oxide synthase pathway: role of asymmetric dimethylarginine. Circulation 104:
2569-2575, 2001.

127. Sullivan JC, Sasser JM and Pollock JS. Sexual dimorphism in oxidant status in
spontaneously hypertensive rats. Am JPhysiolRegullIntegr Comp Physiol 292: R764-8, 2007.

128. Sydow K and Munzel T. ADMA and oxidative stress. Atheinl, \ 1/er Suppl 4: 41-51, 2003.










129. Sydow K, Schwedhelm E, Arakawa N, Bode-Boger SM, Tsikas D, Hornig B, Frolich
JC and Boger RH. ADMA and oxidative stress are responsible for endothelial dysfunction in
hyperhomocyst(e)inemia: effects of L-arginine and B vitamins. Cardiova~sc Res 57: 244-252,
2003.

130. Szabo AJ, Wagner L, Erdely A, Lau K and Baylis C. Renal neuronal nitric oxide
synthase protein expression as a marker of renal injury. Kidney Int 64: 1765-1771, 2003.

131. Szentivanyi M,Jr, Zou AP, Mattson DL, Soares P, Moreno C, Roman RJ and Cowley
AW,Jr. Renal medullary nitric oxide deficit ofDahl S rats enhances hypertensive actions of
angiotensin II. Am JPhysiol Regul Integr Comp Physiol 283: R266-72, 2002.

132. Tain YL and Baylis C. Determination of dimethylarginine dimethylaminohydrolase
activity in the kidney. Kidney Int 72: 886-9, 2007.

133. Tain YL, Freshour G, Dikalova A, Griendling K and Baylis C. Vitamin E reduces
glomerulosclerosis, restores renal neuronal NOS, and suppresses oxidative stress in the 5/6
nephrectomized rat. Am JPhysiol Renal Physiol 292: Fl404-10, 2007.

134. Tain YL, Muller V, Szabo A, Dikalova A, Griendling K and Baylis C. Lack of long-
term protective effect of antioxidant/anti-inflammatory therapy in transplant-induced
ischemia/reperfusion injury. Am JNephrol 26: 213-217, 2006.

135. Tan B, Jiang DJ, Huang H, Jia SJ, Jiang JL, Hu CP and Li YJ. Taurine protects against
low-density lipoprotein-induced endothelial dysfunction by the DDAH/ADMA pathway. Vascul
Pharmacol 46: 338-345, 2007.

136. Tatematsu S, Wakino S, Kanda T, Homma K, Yoshioka K, Hasegawa K, Sugano N,
Kimoto M, Saruta T and Hayashi K. Role of nitric oxide-producing and -degrading pathways
in coronary endothelial dysfunction in chronic kidney disease. JAm Soc Nephrol 18: 741-749,
2007.

137. Teerlink T. ADMA metabolism and clearance. Vasc M~ed 10 Suppl 1: S73-81, 2005.

138. Tojo A, Kimoto M and Wilcox CS. Renal expression of constitutive NOS and DDAH:
separate effects of salt intake and angiotensin. Kidney Int 58: 2075-2083, 2000.

139. Tojo A, Onozato ML and Fujita T. Role of macula densa neuronal nitric oxide synthase
in renal diseases. M~ed~ol2~orphol 39: 2-7, 2006.

140. Tojo A, Welch WJ, Bremer V, Kimoto M, Kimura K, Omata M, Ogawa T, Vallance P
and Wilcox CS. Colocalization of demethylating enzymes and NOS and functional effects of
methylarginines in rat kidney. Kidney Int 52: 1593-1601, 1997.

141. Tomasoni S and Benigni A. Gene therapy: how to target the kidney. Promises and pitfalls.
Curr Gene Ther 4: 115-122, 2004.










142. Tran CT, Fox MF, Vallance P and Leiper JM. Chromosomal localization, gene structure,
and expression pattern of DDAH1 : comparison with DDAH2 and implications for evolutionary
origins. Genomics 68: 101-105, 2000.

143. Ueda S, Kato S, Matsuoka H, Kimoto M, Okuda S, Morimatsu M and Imaizumi T.
Regulation of cytokine-induced nitric oxide synthesis by asymmetric dimethylarginine: role of
dimethylarginine dimethylaminohydrolase. Circ Res 92: 226-233, 2003.

144. Umemura T, Kitamura Y, Kanki K, Maruyama S, Okazaki K, Imazawa T, Nishimura
T, Hasegawa R, Nishikawa A and Hirose M. Dose-related changes of oxidative stress and cell
proliferation in kidneys of male and female F344 rats exposed to potassium bromate. Cancer Sci
95: 393-398, 2004.

145. Valdivielso JM, Crespo C, Alonso JR, Martinez-Salgado C, Eleno N, Arevalo M,
Perez-Barriocanal F and Lopez-Novon JM. Renal ischemia in the rat stimulates glomerular
nitric oxide synthesis. Am JPhysiolRegullntegr Comp Physiol 280: R771-9, 2001.

146. Valance P and Leiper J. Cardiovascular biology of the asymmetric
dimethylarginine:dimethylarginine dimethylaminohydrolase pathway. Arterioscler 7Jhromb Vasc
Biol 24: 1023-1030, 2004.

147. Vaziri ND. Oxidative stress in uremia: nature, mechanisms, and potential consequences.
Semin Nephrol 24: 469-473, 2004.

148. Vaziri ND. Roles of oxidative stress and antioxidant therapy in chronic kidney disease and
hypertension. Curr Opin Nephrol Hypertens 13: 93-99, 2004.

149. Vaziri ND. Effect of chronic renal failure on nitric oxide metabolism. Am JKidney Dis 38:
S74-9, 2001.

150. Vaziri ND, Dicus M, Ho ND, Boroujerdi-Rad L and Sindhu RK. Oxidative stress and
dysregulation of superoxide dismutase and NADPH oxidase in renal insufficiency. Kidney Int
63: 179-185, 2003.

151. Vaziri ND, Ni Z, Oveisi F, Liang K and Pandian R. Enhanced nitric oxide inactivation
and protein nitration by reactive oxygen species in renal insufficiency. Hypertension 39: 135-
141, 2002.

152. Vos IH, Joles JA and Rabelink TJ. The role of nitric oxide in renal transplantation. Semin
Nephrol 24: 379-388, 2004.

153. Wagner L, Riggleman A, Erdely A, Couser W and Baylis C. Reduced nitric oxide
synthase activity in rats with chronic renal disease due to glomerulonephritis. Kidney Int 62: 532-
536, 2002.

154. Wang D, Gill PS, Chabrashvili T, Onozato ML, Raggio J, Mendonca M, Dennehy K,
Li M, Modlinger P, Leiper J, Vallance P, Adler O, Leone A, Tojo A, Welch WJ and Wilcox
CS. Isoform-specific regulation by N(G),N(G)-dimethylarginine dimethylaminohydrolase of rat










serum asymmetric dimethylarginine and vascular endothelium-derived relaxing factor/NO. Circ
Res 101: 627-635, 2007.

155. Wang X, Desai K, Juurlink BH, de Champlain J and Wu L. Gender-related differences
in advanced glycation endproducts, oxidative stress markers and nitric oxide synthases in rats.
Kidney Int 69: 281-287, 2006.

156. Wang Y, Newton DC and Marsden PA. Neuronal NOS: gene structure, mRNA diversity,
and functional relevance. Crit Rev Neurobiol 13: 21-43, 1999.

157. Wasowicz W, Neve J and Peretz A. Optimized steps in fluorometric determination of
thiobarbituric acid-reactive substances in serum: importance of extraction pH and influence of
sample preservation and storage. Clin Chem 39: 2522-2526, 1993.

158. Watanabe Y, Nishio M, Hamaji S and Hidaka H. Inter-isoformal regulation of nitric
oxide synthase through heteromeric dimerization. Biochim Biophys Acta 1388: 199-208, 1998.

159. Xiao S, Wagner L, Schmidt RJ and Baylis C. Circulating endothelial nitric oxide
synthase inhibitory factor in some patients with chronic renal disease. Kidney Int 59: 1466-1472,
2001.

160. Xie J, Roddy P, Rife TK, Murad F and Young AP. Two closely linked but separable
promoters for human neuronal nitric oxide synthase gene transcription. Proc Natl Acad Sci U S A
92: 1242-1246, 1995.

161. Yilmaz MI, Saglam M, Caglar K, Cakir E, Sonmez A, Ozgurtas T, Aydin A, Eyileten
T, Ozcan O, Acikel C, Tasar M, Genctoy G, Erbil K, Vural A and Zoccali C. The
determinants of endothelial dysfunction in CKD: oxidative stress and asymmetric
dimethylarginine. Am JKidney Dis 47: 42-50, 2006.

162. Yin QF and Xiong Y. Pravastatin restores DDAH activity and endothelium-dependent
relaxation of rat aorta after exposure to glycated protein. J Cardiova~sc Pharmacol 45: 525-532,
2005.

163. Yu Q, Shao R, Qian HS, George SE and Rockey DC. Gene transfer of the neuronal NO
synthase isoform to cirrhotic rat liver ameliorates portal hypertension. J Clin Invest 105: 741-
748, 2000.

164. Zatz R and Baylis C. Chronic nitric oxide inhibition model six years on. Hypertension 32:
958-964, 1998.









BIOGRAPHICAL SKETCH

Mr. Tain was born in 1967, in Tainan, Taiwan. In June 1992, Mr. Tain graduated from

China Medical College, Taiwan with an M.D. degree. He later received his residency training in

pediatrics and fellow training in pediatric nephrology at Chang Gung Memorial Hospital

(CGMH), Taiwan. From 1999 to 2002, Mr. Tain worked as an attending pediatrician at CGMH

at Kaohsiung, Taiwan. At the same time, he started his research as a graduate student in

Graduate Institute of Clinical Medicine at the Chang Gung University and attained a master' s

degree in biomedicine in December 2002.

To expand his academic horizons, Mr. Tain came to the U.S. with a pre-doctoral

fellowship award from his hospital. He was accepted into a Ph.D. graduate program in the

Department of Physiology and Pharmacology, West Virginia University, in January 2003. There

he worked in the laboratory of Dr. Chris Baylis, studying the progression of renal disease. In

summer 2004, he moved with Dr. Baylis to the University of Florida. There, he worked as a

graduate student studying nitric oxide in chronic kidney disease. He received a Bronze Medal

Finalist in Medical Guild Graduate Student Research, a Graduate Fellowship for Outstanding

Research Award, and an Outstanding International Student Academic Award in 2007. Mr. Tain

will attain a Ph.D. in biomedical science in December 2007, and plans to return to Taiwan to

work at Chang Gung Memorial Hospital in Kaohsiung, Taiwan.





PAGE 1

1 NITRIC OXIDE DEFICIENCY IN CHR ONIC KIDNEY DISEAS E: LINKS AMONG NEURONAL NITRIC OXIDE SYNTHASE OXIDATIVE STRESS, AND ASYMMETRIC DIMETHYLARGININE (ADMA) By YOU-LIN TAIN A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2007

PAGE 2

2 2007 You-Lin Tain

PAGE 3

3 This dissertation is dedication to my family for their constant love

PAGE 4

4 ACKNOWLEDGMENTS This dissertation would not have been possibl e without the support of many people. Many thanks go to my adviser: Dr. Chris Baylis gave me the chance to work on many projects and also gave me numerous valuable comments for my manuscripts. I would like to thank my committee members for their guidance and valuable comments: Dr. Richard Johnson, Dr. Mohan Raizada, and Dr. Mark Segal. I thanks also go to the Chang Gung Memorial Hospital for awarding me a fello wship, providing me with the financial means to complete this dissertation. I am grateful to many persons who shared their technical assistance and experience, especially Dr. Verlander and Dr. Chang (Unive rsity of Florida), Dr. Muller and Dr. Szabo (Semmelweis University, Hungary), Dr. Griendli ng and Dr. Dikalova (Emory University), and Dr. Merchant and Dr. Klein (University of Louisville). Next, I would like to thank a ll of the members of Dr. Baylis lab, both past and present, with whom I have been fortunate enough to work: Dr. Aaron Erdel y, Gerry Freshour, Kevin Engels, Lennie Samsell, Dr. Sarah Knight, Dr. Cheryl Smith, Dr. Jenny Sasser, Harold Snellen, Bruce Cunningham, Gin-Fu Chen, and Natasha Moningka. I will miss all of them. Finally, thanks go to my wife CN, and numerous friends w ho endured this long process with me, always offering support and love.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS...............................................................................................................4 LIST OF TABLES................................................................................................................. ..........8 LIST OF FIGURES................................................................................................................ .........9 ABSTRACT....................................................................................................................... ............12 CHAPTER 1 INTRODUCTION..................................................................................................................14 Overview....................................................................................................................... ..........14 Chronic Kidney Disease Is a Global Challenge..............................................................14 Nitric Oxide Deficiency Is a Co mmon Mechanism of CKD Progression.......................14 Neuronal Nitric Oxide Synthase.............................................................................................15 Role of Renal Cortical Neuronal Nitric Ox ide Synthase in Chronic Kidney Disease Progression...................................................................................................................15 Neuronal Nitric Oxide Synthase Isoforms in the Kidney................................................16 Regulation of Neuronal Nitric Oxide Synthase Expression............................................17 Oxidative Stress and Asymmetric Dimethylarginine.............................................................18 Role of Oxidative Stress in Chronic Kidney Disease......................................................18 Role of Asymmetric Dimethylargi nine in Chronic Kidney Disease...............................18 Objective...................................................................................................................... ...........20 2 GENERAL METHODS.........................................................................................................25 Animal Models.................................................................................................................. .....25 Ablation/infarction Model...............................................................................................25 5/6 Nephrectomy Model..................................................................................................25 Renal Transplantation Model..........................................................................................25 Tissue Harvest.................................................................................................................26 Biochemical Analysis........................................................................................................... ..26 Nitric Oxide Assay..........................................................................................................26 Nitric Oxide Synthase Activity.......................................................................................27 Pathology...................................................................................................................... ...27 Western Blot................................................................................................................... .28 Electronic Spin Resonance..............................................................................................29 Reverse Transcription Polymerase Chain Reaction........................................................29

PAGE 6

6 3 IDENTIFICATION OF NEURONAL NITRIC OXIDE SYNTHASE ISOFORMS IN THE KIDNEY..................................................................................................................... ...31 Introduction................................................................................................................... ..........31 Materials and Methods.......................................................................................................... .31 Results........................................................................................................................ .............34 Discussion..................................................................................................................... ..........36 4 RENAL CORTEX NEURONAL NITRIC OXIDE SYNTHASE IN KIDNEY TRANSPLANTS....................................................................................................................44 Introduction................................................................................................................... ..........44 Materials and Methods.......................................................................................................... .45 Results........................................................................................................................ .............47 Discussion..................................................................................................................... ..........49 5 DETERMINATION OF DIMETHYLARGI NINE DIMETHYL AMINOHYDROLASE ACTIVITY IN THE KIDNEY...............................................................................................61 Introduction................................................................................................................... ..........61 Materials and Methods.......................................................................................................... .61 Optimization of Homogenization Buffers.......................................................................62 Optimization of Deproteinization....................................................................................63 Tests for Other Pathways That Coul d Alter Citrulline Concentration............................63 Comparison of Citrulline Assay and Asym metric Dimethylarginine Degradation by High Performance Liquid Chromatography................................................................64 Statistical Analysis..........................................................................................................65 Results........................................................................................................................ .............65 Optimization of Citrulline Assay.....................................................................................65 Effect of Urea on Citrulline Assay..................................................................................65 Comparison of Dimethylarginine Dime thylaminohydrolase Activity Measured by Citrulline Accumulation with Asymmetr ic Dimethylarginine Consumption..............66 Tests for Other Pathways That Coul d Alter Citrulline Concentration............................66 Discussion..................................................................................................................... ..........66 6 VITAMIN E REDUCES GLOMERULOCLEROSIS, RESTORES RENAL NEURONAL NITRIC OXIDE SYNTHASE, AND SUPPRESSES OXIDATIVE STRESS IN THE 5/6 NE PHRECTOMIZED RAT................................................................78 Introduction................................................................................................................... ..........78 Materials and Methods.......................................................................................................... .79 Results........................................................................................................................ .............80 Discussion..................................................................................................................... ..........82

PAGE 7

7 7 SEX DIFFERENCES IN NITRIC OXIDE, OXIDATIVE STRESS, AND ASYMMETRIC DIMETHYLARGININE IN 5/6 ABLATION/INFARCTION RATS.......96 Introduction................................................................................................................... ..........96 Materials and Methods.......................................................................................................... .97 Results........................................................................................................................ .............99 Data of Renal Outcome and Clinical Parameters............................................................99 Renal Neuronal Nitric Oxide Synthase Isoform Expression.........................................100 Reactive Oxygen Species Metabolism..........................................................................100 L-Arginine and Di methylarginines................................................................................101 Asymmetric Dimethylarginine Related Enzymes.........................................................101 Discussion..................................................................................................................... ........102 8 CONCLUSION AND IMPLICATIONS..............................................................................116 Renal Neuronal Nitric Oxide Synthaseand Isoforms Expression in Chronic Kidney Disease........................................................................................................................ ......116 Oxidative Stress in Chronic Kidney Disease........................................................................119 Oxidative Stress and Neuronal Nitric Oxide Synthase.........................................................120 Asymmetric Dimethylarginine in Chronic Kidney Disease.................................................120 Oxidative Stress and Asymmetric Dimethylarginine...........................................................123 Target on Nitric Oxide Pathway to Prevent Chronic Kidney Disease Progression and Cardiovascular Complications..........................................................................................124 Neuronal Nitric Oxide Synthase Gene Therapy............................................................125 Prevention of Chronic Kidney Dis ease Progression by Antioxidants...........................126 Prevention of Chronic Kidney Disease Progression by Lowering Asymmetric Dimethylarginine.......................................................................................................126 Multifaceted Therapeutic Approaches in Preventing Chronic Kidney Disease Progression.................................................................................................................127 LIST OF REFERENCES.............................................................................................................131 BIOGRAPHICAL SKETCH.......................................................................................................144

PAGE 8

8 LIST OF TABLES Table page 3-1 Proteins identified by MALDI-TOF MS/MS-MS.............................................................40 4-1 Functional parameters in Tx and cont rol groups 22 weeks after transplantation..............52 4-2 Weight and renal function measures at 22 wk after kidne y transplantation or similar time in control................................................................................................................ ....53 5-1 Effect of deproteinization r eagents on absorbance of blank..............................................69 5-2 Effect of buffers and additives on the L-citrulline assay in the presence of 25 M Lcitrulline..................................................................................................................... ........70 5-3 Recommend assay procedures/conditions for the measurement of renal cortical DDAH activity.................................................................................................................. .71 6-1 Measurements at 15 wk after surgery................................................................................87 7-1 Renal outcome and clinical parameters...........................................................................106 7-2 L-arginine and dime thylarginine levels in plasma and kidney cortex.............................107 8-1 The nNOS and isoform expression in different chronic kidney disease models......128

PAGE 9

9 LIST OF FIGURES Figure page 1-1 Illustration of nNOS isoforms............................................................................................23 1-2 Three major mechanisms of NO deficiency in chronic kidney dis ease studied in this dissertation................................................................................................................... ......24 3-1 Immunoblots of male and female kidne y cortex (KC), kidney medulla (KM), and control cerebellar lysate (Cer)............................................................................................41 3-2 Immunoblots of female kidney cortex (KC), kidney medulla (KC), and control cerebellar lysate (C er) with ABR C-terminal nNOS antibody..........................................42 3-3 End-point RT-PCR of nNOS tran scripts in various male tissues......................................43 4-1 Renal outcome in ALLO gr afts at 22 weeks after Tx........................................................54 4-2 Renal cortical nNOS protein abundance in CsA and RAPA ALLO rats.........................55 4-3 Renal cortical nNOS and nNOS mRNA abundance in CsA and RAPA treated ALLO male rats and controls.............................................................................................56 4-4 Renal cortical nNOS protein abundance in CsA and RAPA treated male rats and controls....................................................................................................................... ........57 4-5 Renal pathology at 22 wk after kidney transplantation.....................................................58 4-6 NADPH-dependent superoxide prod uction of ISO-UN, ISO-EP, and acutely rejecting allografts a nd the control kidneys.......................................................................59 4-7 NOS protein abundance and activ ity in ISO-UN and ISO-EP rats....................................60 5-1 Time course of the urea effect on colo r formation without substrate (ADMA) in the absence and presence of urease..........................................................................................72 5-2 Time course of DDAH activ ity in different rat tissues......................................................73 5-3 Time course of color formation in citr ulline equivalents in the presence of the DDAH substrate (ADMA) in the absence and presence of urease................................................74 5-4 Correlation of L-citrulline formation as a measure of DD AH activity with the rate of ADMA consumption..........................................................................................................75 5-5 The effect of arginase on the L -c itrulline assay to detect renal DDAH activity...............76 5-6 The effect of NO and superoxide on th e L-citrulline assay to detect renal DDAH activity....................................................................................................................... .........77

PAGE 10

10 6-1 Urinary protein excretion at baseline (week 0) and during th e 15 wk period after surgery in shams, 5/6 NX and 5/6 NX + Vit E..................................................................88 6-2 Summary of the % and severity of gl omerulosclerosis on the 1+-4+ scale 15 weeks after surgery in shams, 5/6 NX and 5/6 NX + Vit E..........................................................89 6-3 Renal cortex NADPH-dependent super oxide production at 15 wk after surgery..............90 6-4 Total urinary NOx (NO3 +NO2 -) excretion at baseline (week 0) and during the 15 wk period after surgery in shams, 5/6 NX and 5/6 NX + Vit E...............................................91 6-5 NOS protein expression in sham a nd 5/6 NX rats at 15 wk after surgery.........................92 6-6 Densitometry showing abundance of nNOS and nNOS in renal cortex of sham and 5/6 NX rats studied 15 wks after surgery...........................................................................93 6-7 ADMA-related enzyme expression in renal cortex at 15 wk after surgery.......................94 6-8 Immunoblots of rat kidney cortex (K C) and kidney medulla (KM) with DDAH2 antibody....................................................................................................................... .......95 7-1 NOS isoforms expression in renal cortex........................................................................108 7-2 Correlation between glomerular damage and nNOS isoform abundance........................109 7-3 Biomarkers of oxidative stress in sh am and A/I rats at 7 wk after surgery.....................110 7-4 Correlation between L-arginine to ADMA ratio and plasma NOx levels.......................111 7-5 ADMA-related enzyme abundance in sham and A/I rats at 7 wk after surgery..............112 7-6 In vitro DDAH activity at 7 wk after surgery..................................................................114 7-7 Correlation between renal DDAH activity and RBC DDAH activity.............................115 8-1 Various progression rates to end-stage renal disease in different chronic kidney disease (CKD) models.....................................................................................................129 8-2 Target nitric oxide (NO) pathways in preventing chronic kidney disease (CKD) progression and cardiovascu lar (CV) complications.......................................................130

PAGE 11

11 LIST OF ABBREVIATIONS ADMA Asymmetric dimethylarginine A/I Ablation/infarction ALLO Allograft BP Blood pressure CCr 24hr clearance of creatinine CKD Chronic kidney disease CsA Cyclosporine A CVD Cardiovascular disease DDAH Dimethylarginine dimethylaminohydrolase eNOS Endothelial nitr ic oxide synthase 5/6 NX 5/6 nephrectomy ISO Isograft nNOS Neuronal nitric oxide synthase NO Nitric oxide PNOx Plasma nitrite plus nitrate levels PRMT Protein arginine methyltransferase RAPA Rapamycin ROS Reactive oxygen species SD Sprague-Dawley SDMA Symmetric dimethylarginine Tx Transplant UNOxV 24hr urinary nitrite plus nitrate levels UproV 24hr urinary protein excretion WF Wistar Furth

PAGE 12

12 Abstract of Dissertation Pres ented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy NITRIC OXIDE DEFICIENCY IN CHR ONIC KIDNEY DISEAS E: LINKS AMONG NEURONAL NITRIC OXIDE SYNTHASE OXIDATIVE STRESS, AND ASYMMETRIC DIMETHYLARGININE (ADMA) By You-Lin Tain December 2007 Chair: Chris Baylis Major: Medical Sciences--Physiology and Pharmacology Nitric oxide (NO) deficiency is a cause and a consequence of chronic kidney disease (CKD). We focused on three possible causes of NO deficiency in this dissertation: decreased abundance and /or changes in ac tivity of nitric oxide syntha se (NOS) enzymes, increased endogenous NOS inhibitors (e.g., asymmetric dimethylarginine (ADMA)), and increased NO inactivation by oxidative stress. We found reduced renal cortical nNOS abunda nce as well as NOS activity in various CKD models. Therefore, we evaluated whethe r oxidative stress and ADMA inhibited nNOS expression in different CKD mode ls. We found that 2 nNOS isof orms expressing in the kidney and that renal cortical nNOS and nNOS isoform expression differentially in various CKD models. In mild CKD, nNOS abundance can be maintained or compensated by nNOS to preserve renal functi on, while decreased nNOS abundance results in CKD progression despite increased nNOS expression in severe CKD. Both oxidative stress and ADMA may inhibit nNOS expression. The inhibition by oxidative stress can be part ially prevented by antioxidant vitamin E; however, vitamin E cannot prevent th e elevation of ADMA. In 5/6 nephrectomized rats, we found the increase of ADMA may be due to increased ADMA synthesis by increased

PAGE 13

13 protein arginine methyltran sferase (PRMT) expression a nd decreased ADMA breakdown by decreased dimethylarginine dimethylaminohydrol ase (DDAH) activity. In 5/6 ablation/infarction (A/I) model, vulnerable male A/I rats disp layed higher oxidative stress but lower nNOS abundance than resistant female A/I rats, demonstrating decreased nNOS and increased oxidative stress contribute to CKD progression. We concluded that decreased cortical nNOS abundance, increased oxidative stress, and increased ADMA contribute to CKD progressi on. Targeting on increasing renal nNOS expression, reducing oxidative stress, and lowering ADMA levels to preserve NO bioavailability may be specific therapeutic interven tions to prevent CKD progression.

PAGE 14

14 CHAPTER 1 INTRODUCTION Overview Chronic Kidney Disease Is a Global Challenge Increasing numbers of patients with chronic kidney diseas e (CKD) and consequent endstage renal disease (ESRD) is becoming a global challenge (34). Cardiovascular disease (CVD) is a major cause of morbidity and mortality in CKD. The therapeutic goal in CKD is not only retarding CKD progression but al so preventing adverse cardiova scular complications. Several common pathways of CKD progression have been uncovered, such as activation of reninangiotensin system, glomerular hypertension, oxidative stress, proteinuria, and inflammation. They are all interrelated and they all interact with the nitric oxid e (NO) pathway. Indeed, there is substantial evidence that NO deficiency occurs in CKD in humans and animals and may cause progressive functional deteriora tion, structural damage and cardi ovascular side effects (10, 149). NO is not only a vasodilator but also has anti-inf lammatory, antiprolifera tive, and anti-oxidant properties (74). Nitric Oxide Deficiency Is a Common Mechanism of CKD Progression In clinical studies, patients with CKD devel op NO deficiency (120). Animal studies also show that NO deficiency result s from CKD and since experimentally induced chronic nitric oxide synthase (NOS) inhibition re sults in progressive renal injury (164), the development of NO deficiency during CKD is likely to cause pr ogression. In addition, reduced NO bioavailability appears to be a major factor involved in C KD-induced endothelial dysfunction, which is the initial mechanism in atherosclerosis (119). Nitric oxide deficiency could occur due to reduced substrate (L-arg inine) availability, reduced cofactor (e.g., tetrahydrobioterin, BH4) availability, decreased abundance and /or

PAGE 15

15 changes in activity of NOS enzymes, increa sed endogenous NOS inhibitors (e.g., asymmetric dimethylarginine (ADMA)), and increased NO inac tivation by oxidative stre ss (10). In clinical studies, both oxidative stress and ADMA have b een shown related to the progression of CKD (16) and endothelial dysfunction (161). Thus, bot h of these causes of NO deficiency affect both renal outcome and CV complications. Oxidative stress can result in both increased ADMA generation and decreased breakdown (128), co nversely, ADMA can induce uncoupling NOS causing oxidative stress (23). Nitric oxide is produced from L-arginine by three nitric oxide synthase (NOS) families: neuronal NOS (nNOS), endothelial NOS (eNOS), and inducible NOS (iNOS). Since there is little iNOS expression in norma l kidney (145), we have focused on evaluating eNOS and nNOS in CKD. We have found reduced cortical nNOS abundance as well as in vitro soluble NOS activity (mainly nNOS activity) in various CKD models (10, 36-41, 130, 153). In contrast the eNOS abundance is variable in different CKD models. These findings suggest that nNOS may be involved causally in CKD. Neuronal Nitric Oxide Synthase Role of Renal Cortical Neur onal Nitric Oxide Synthase in Chronic Kidney Disease Progression Nitric oxide derived from nNOS in MD can dilate afferent arterioles, regulate tubuloglomerular feedback, and ma y also prevent mesangial cell and matrix proliferation (74, 139). Reduction of cortical nNOS may therefor e cause renal vasoconstriction, decrease GFR, enhance tubular sodium reabsorption, result in mesangial prolifera tion and hence hasten progression of CKD. Indeed, cortical nNOS e xpression was shown to be positively correlated with afferent arteriolar diameter (139) and afferent arteriolar va soconstriction was considered to participate in the pathogenesis of CKD progres sion (21, 97). In addition, nNOS in MD has an

PAGE 16

16 essential role for renin production (139) and acti vation of renin-angioten sin contributes to CKD progression. Although the greatest de nsity of renal cortical nNOS is in the MD, there may also be nNOS in proximal tubular epithelium and in n itrergic nerves that supply tubular and vascular structures in cortex (9, 74). Neuronal Nitric Oxide Synt hase Isoforms in the Kidney The three NOS isoenzymes share a common st ructural organization: central calmodulinbinding motif links an oxygenase (N-terminal) and a reductase (C-terminal) domain. The oxygenase domain consists of an arginine, a heme, and a BH4 binding site. The reductase domain contains binding sites for FAD, FMN, and NADPH (3). Unlike eNOS and iNOS, the 160kDa isoform, nNOS possesses a unique ~300 aa segment at th e N-terminal including a PDZ domain as well as a site for protein bindi ng to allow protein protein inte ractions. The protein inhibitor of nNOS (PIN) binds here (63) and was shown to be upregulated in 5/6 nephrectomy (NX) rats (113). At least 11 tissueor development-specifi c transcripts of nNOS gene have been reported in rat (102), arising from different promoters or altern ative splicing. nNOS is the most commonly expressed in neural tissues and muscle, and until now, only nNOS has been reported in rat kidney. As shown in Figure 1-1, the majo r nNOS isoforms that have been detected in extrarenal tissues, in addition to nNOS are nNOS nNOS nNOS and nNOS-2. nNOS and nNOS have part of the N-terminal deleted and consist of aa 236-1433 and 336-1433 of nNOS respectively. The nNOS (165kDa) is full length and includes an additional 34 aa insert in FMN binding domain, and is mainly located in skeletal muscle. Unlike nNOS which is exhibited in both soluble and membrane fractions, nNOS and nNOS are only located in the soluble fraction (no PDZ domain). In nNOS exon 2 knockout mice, nNOS and nNOS were detected in the brain by Western blot, and nNOS has similar functional activity to nNOS (35). In vitro, NOS has ~80% the activity of nNOS (20), although in vivo the absence of the PDZ and PIN

PAGE 17

17 domains could lead to greater activ ity (due to resistance to PIN) or decreased activity (due to decreased stability of dimers ). In wild type mice, nNOS is located in many brain areas and in nNOS knockout (lacking exon 2), nNOS abundance increases (35). In nNOS knockout mice, nNOS was able to maintain normal penile erection, suggesting that there may be an upregulation of nNOS when nNOS -derived NO is deficient (59). Thus, it is likely that nNOS may compensate in states of reduced nNOS to maintain total nNOS activity. Most of our previous studies used a pol yclonal antibody recognizi ng N-terminal aa 1-231 of nNOS, thus specifically detecting nNOS in kidney (80). Lately we have also used a Cterminal nNOS antibody (aa #1409-1424, Affinity Bioreagents, Golden, CO USA), giving bands at both the nNOS and molecular weights. Using a proteo mic approach, we have confirmed abundant expression of nNOS in rat kidney. In this disser tation I describe studies to characterize the renal nNOS and and determine if they are involved in CKD and their relative expression in different CKD models. Regulation of Neuronal Nitric Oxide Synthase Expression Although nNOS is constitutively expressed, its expression is under complex regulation. nNOS mRNA can be upregulated by stress, injury, neurotransmitters, steroid hormones and downregulated by cytokines (17). Most regulatory mechanisms have been studied on extrarenal tissues and relatively little is known about the regulation of the nNOS isoforms in the kidney. In kidney, nNOS in MD can be upor downregulat ed by renal perfusion, systemic volume status, distal tubular fluid flow, and Na Cl transporter (108). We have evidence that downregulation of nNOS protein occurs in CKD, whic h is the subject of this dissertation. In addition to nNOS expression, nNOS activity can be regulated by various mechanisms: dimer stability, posttranslational modifications (e.g., phosphorylation), endogenous NOS inhibitors (e.g., ADMA), substrate and cofactor deficiency (L-arginine and BH4), interacting proteins, and oxidative stress.

PAGE 18

18 Increases in both oxidative stre ss and ADMA have been implicated in the progression of renal disease in clinical trials (16) and nNOS activ ity is inhibited by oxida tive stress and ADMA in vitro (23), suggesting both f actors contribute to CKD progr ession possibly via modulating nNOS. Therefore we focus on 3 major causes of NO deficiency, decr eased nNOS protein abundance and increased oxidative stress and ADMA, to understand whether they regulate nNOS expression/activity in CKD. Oxidative Stress and Asymme tric Dimethylarginine Role of Oxidative Stress in Chronic Kidney Disease Oxidative stress is characterized by the incr ease of reactive oxygen species (ROS) which cannot be counterbalanced by the antioxidant syst em (43). In CKD, increased oxidative stress is considered to contribute to the progression as well as CV complications (47, 148). Superoxide (O2-) and NO have counterbalancing actions and reci procally reduce each ot hers bioavailability, thus a reduction in NO may shift the kidney toward a state of O2 dominance causing renal vasoconstriction, enhanced tubular sodium reabso rption, excessive prolifer ation and extracellular matrix expansion leading to fibrosis a nd thus CKD progression (95). In kidney, O2 is mainly generated by NADPH oxidase (44) and increased p22phox, a major subunit of NADPH oxidase, enhances ROS generation and its expression correlates to NADPH oxidase activity (44). As part of the antioxidant defense, O2 can be converted to H2O2 by the superoxide dismutases (SOD) which prevents O2 from interacting with NO to generate peroxynitrite (ONOO-), an important mediator of lipid peroxidation. Therefore, NOS and NO bioavailability can be inhibited by O2 and its metabolites. The activity of nNOS is highly sensitive to ch anges in oxidative stress (23). Role of Asymmetric Dimethylargi nine in Chronic Kidney Disease Another important regulator of NOS activity is the endoge nous NOS inhibitor, ADMA. Arginine is methylated by protein arginine N-methyltr ansferase (PRMT) to form

PAGE 19

19 methylarginines: NW-monomethyl-L-arginine (L-NMMA), asymmetric dimethylarginine (ADMA), and symmetric dimet hylarginine (SDMA) (146). L-NMMA and ADMA, but not SDMA are competitive inhibitors of NOS isoenzymes and both are metabolized by dimethylarginine dimethylam inohydrolase (DDAH). Currently, nine PRMT isoenzymes have been identified and are classified as either type I or type II PRMT (12, 105). Both types PRMTs catalyze the formation of L-NMMA as an intermed iate, and type I PRMTs lead to the formation of ADMA, whereas type II PRMTs produce SDMA Since PRMT1 is a predominant type I PRMT and PRMT1 gene expression was increased in 5/6 NX rats (90), it is possible that increased PRMT1 expression may contribute to increased ADMA synthesis in CKD. Further, DDAH metabolizes ADMA to citrul line and dimethylamine and decreased DDAH activity increased ADMA and diminished L-argini ne/ADMA ratio and leading to a decrease of NO production. We have found reduced L-argini ne/ADMA ratio in human CKD and ESRD patients and in a rat chronic glomerulonephri tis CKD model (153, 159). Elevated ADMA level has also been reported in the presence of various CKD models and is a ri sk factor for various cardiovascular disorders with endothelial dysfunction (146). Dimethylarginine dimethylaminohydrolase has been identified in two isoforms, DDAH1 and DDAH2, which have 62% similarity. Rat and human DDAH protein are 95% identical (68). Both DDAHs have distinct tissue distributions but seemingly similar activity. DDAH1 is mainly located in nNOS predominant tissues (neural an d epithelial), while DDAH2 is found in tissues with high eNOS expression (84). However, both DDAHs are widely expressed and not confined to NOS-expressing cells. So far, th ere is little data available on DDAH1/2 expression in kidney because good commercial antibodies have onl y just become available (138, 140).

PAGE 20

20 Dimethylarginine dimethylam inohydrolase expression and/or activity can be inhibited by tumor necrosis factor (61), IL-1 (143), homocysteine (126), gl ycated bovine serum albumin (162), erythropoietin (118), and ox-LDL (135). All of the above pathways provoke oxidative stress and these effects could be preven ted by antioxidants (118, 126, 162), suggesting DDAH may be downregulated by oxidative stress ( 71). On the other hand, DDAH1 and DDAH2 gene expression are induced by farnesoid X receptor agonist (55) and all-tr ans-Retinoic acid (1), respectively. DDAH activity can also be induced by 17 -estradiol (54). Furthe r, in vitro studies suggest that both DDAH1 and DDA H2 are inhibited by NO via Snitrosylation on cystiene residues (72, 82). However, little is known about the regulation of DDAH in CKD. Dimethylarginine dimethylaminohydrolas e inhibition decreases NO production in endothelial cells (87). DDAH1 overexpression reduces plasma and tissue ADMA levels and enhances tissue NOS activity bo th in vitro and in vivo ( 30, 62) and ADMA levels were attenuated in DDAH2 overexpressing transgenic mice (52). These finding s suggest that lowering ADMA levels by increasing DDAH may be a releva nt area of intervention. We intended to characterize DDAH1/2 expression in different CKD models by Western blot and determine DDAH activity. This has been determined by m easurement of substrate consumption (HPLC measurent of the rate of ADMA consumpti on or conversion of radiolabeled L -NMMA converted to L citrulline, howev er, both methods are time consum ing and costly. We have also developed a simple colorimetric method to meas ure renal DDAH activity that measures rate of citrulline accumulation. Objective Nitric oxide deficiency is both a cause and a consequence of CKD. We have found that renal nNOS expression decreases markedly with injury in the SD rats and is correlated to decreased NOS activity in various rat CKD models However, WF rats that are protected from

PAGE 21

21 renal injury still show some decrease in nNOS abundance but maintained NOS activity (39). We intended to test the hypotheses that other n NOS isoforms exist in kidney; that they may compensate for loss of nNOS in CKD and that this is associated with protection from progression of CKD in different st ages of CKD by evaluating diffe rent CKD rat models. In this dissertation, four CKD models were studied to elucidate wh ether nNOS isoform expression differentially in different stages of CKD. There are two transplant (Tx)-indued mild CKD models, ischemia/reperfusion (I/R) isografts (ISO I/R model) and rapamycin-treated allografts (ALLO RAPA model); the other two severe CKD models are 5/6 nephrectomy (NX model) and ablation/infarction models (A/I model). Also, CKD is a state of oxidative stress, known to inhibit NO generation as well as DDAH activity, leading to increased ADMA. We manipulated the level of oxidative stress with anti oxidants to investigate the im pact on nNOS isoform and DDAH expression/activities. The nNOS activity may be regulated by ADMA and the kidney is a major site of catabolism of ADMA by DDAH. We therefore investigated whether changes in the local ADMA level (due to changes in renal DDAH activity) will also influence renal NOS activity. This dissertation is divided into 5 concurrent st udies to determine the impact of nNOS, oxidative stress, and ADMA in CKD (Figure 1-2): Identification of renal nNOS / expression in rat kidney: We compared an N-terminal nNOS antibody to a C-terminal nNOS antibody, to investigate the possib ility that different nNOS isoform proteins exist in the rat kidney. nNOS isoforms were identified in rat kidney by a proteomic approach and the presence of th e relevant transcripts was also confirmed by RT-PCR. Characterization of renal nNOS / expression in transplant-induced CKD models: We analyzed kidney samples from two renal transplant-induced CKD models; transplanted F344 isografts treated with an tioxidants/anti-inflammatory agents and F344 to Lewis allografts treated with rapamycin (RAPA) to elucidate the impact of nNOS expression. Optimization of a colorimetric a ssay to measure renal DDAH activity: We established the optimal conditions for use of the Pres cott-Jones method (109) of L-citrulline determination to measure kidney tissue DDAH activity. We compared this modified Lcitrulline assay to the direct HPLC method measuring rate of ADMA breakdown.

PAGE 22

22 Characterization of the renoprotective effe cts of vitamin E on renal nNOS, oxidative stress, and ADMA in a 5/6 NX CKD model: We investigated the impact of the 5/6 nephrectomy model on renal nNOS abundan ce, oxidative stress, and ADMA-related enzymes and also whether the protective effect s of vitamin E therapy are associated with preservation of these pathways. Investigation of sex differences on CKD progression in the 5/6 A/I model by regulating renal nNOS, oxidative stress, and ADMA pathways: We investigated whether L-arginine/ADMA is correlated to renal nNOS abundance, oxidative stress, and renal outcome in A/I rat model and whether there is sex difference in these pathways.

PAGE 23

23 NH2COOH PDZ ARG/HAEM/BH4 FMN FAD NADPH1 221 724 757 949 980 1433 nNOS (160 kDa) nNOS-2 (144kDa) 504-608 deletion nNOS (165kDa) 34 aainsertion nNOS (136 kDa)236 336 nNOS (125 kDa) CaM PIN binding site 228-244 N-terminal Ab C-terminal Ab Figure 1-1. Illustration of nNOS isoforms. nNOS isoforms are showed by arrowed lines as follows: black, nNOS aa #1-1433; red, nNOS aa #236-1433; grey, nNOS aa #3361433; blue, nNOS aa#1-1433 with a 34 amino acids insertion; and dark blue, nNOS-2 aa 1-1433 with a deletion of aa #504-608. Consensus binding sites for PSD95 discs large/ZO-1 homology domain (PDZ), protein inhibiter of nNOS (PIN), Larginine (ARG), heme (HAEM), tetrahydrobiopterin (BH4), calmodulin (CaM), flavin mononucleotide (FMN), flavin adenin e dinucleotide (FAD), and NADPH are indicated. Dimer interfaces are shown by blue dashed line. N-terminal (black) and Cterminal (red) antibodies used in this di ssertation recognizing different amino acids sequence are indicated. Based on refs (3, 35, 156).

PAGE 24

24 NO nNOS Oxidative stress ADMA L-arginine Figure 1-2. Three major mechanisms of NO deficien cy in chronic kidney di sease studied in this dissertation: (1) Decreased renal cortical neuronal nitric ox ide synthase (nNOS) abundance, (2) Increased oxidative st ress, and (3) Increased asymmetric dimethylarginine (ADMA).

PAGE 25

25 CHAPTER 2 GENERAL METHODS Animal Models Ablation/infarction Model Ablation/infarction (A/I) model was performed as follows: Renal mass was removed under isoflurane general anesthesia using full ster ile technique. By retrop eritoneal approach, the right kidney was removed and upper and lower thirds of the left kidney was infarcted by ligation of branches of the renal artery. 5/6 Nephrectomy Model 5/6 nephrectomy (NX) model was perfored as follows: By retroperitoneal approach, 2 poles of the left kidney were removed and then one week later the right kidney was removed. Renal Transplantation Model Renal transplantation (Tx) m odel was performed as follows: Rats were anesthetized by intraperitoneal pentobar bital sodium (32.5 mg/kg; Sigma, St. Louis, MO) and methohexital sodium (25 mg/kg; Brevital sodium, Eli Lill y and Co, Indianapolis, IN). After median laparatomy the left kidney was removed. In the donor the abdominal aorta and vena cava were clamped, a cannula placed into the left renal artery and the kidn ey flushed with cold (4C) solution, removed with the arter y, vein and ureter and placed in to cold solution for 10 min. Donor and recipient renal artery and vein were then anastomized with 10-0 prolene sutures and after a warm ischemia time of 35 min (total ischemia time 45 min), vascular clamps were removed and the ureter was anastomized end to end near to the hilus. To avoid infections, rats received 10 mg/kg/day rocephin (Ceftriaxone sodi um, Roche, Nutley, NJ) for 10 days then rats were again anesthetized and th e right native kidney removed.

PAGE 26

26 Tissue Harvest Tissue harvest was performed as follows: Tissue harvesting was done in isoflurane anesthetized rats. In itially a 20G butterfly was inserted into the abdominal aorta at the bifurcation and clamped in place. BP was measured then a blood sample withdrawn, then the vasculature was perfused with 60ml ice-cold PBS at 25ml/mi n and the vena cava vented. For frozen tissue harvesting for WB etc, tissues were harvested on to dry ice and snap frozen in liquid nitrogen and then stored in -80C freezer until analysis For immunohistochemistry and histology the perfusate was switched to 2% paraformaldehyde -lysine-periodate (PLP) and perfused for 5 minutes, then removed, sliced longitudinally, then stored in the same fixative overnight at 4C. At the end of experiments, rats were euthanized with isof lurane overdose. Metabolic cage studies/general chemical analys es: Rats were placed in metabolic cages for collection of 24 h urines. In all studies where NOX (NO2 + NO3 -) output was measured, rats were maintained on a low NOX diet (ICN, AIN 76, MP Biomed icals, Solon, OH, USA) for 24h before and during the measurements. Measurements were made of total urinary protein by the Bradford assay; plasma and urine creatinine by a HPLC method previ ously described by us (130). Biochemical Analysis Nitric Oxide Assay Urine and plasma NOx (NO2 + NO3 -) assay was perfored as follows: The NOx levels were measured with Griess reacti on according to Stuehr et al. ( 125) using the nitrate reductase enzyme which reduced NO3 to NO2 -. Briefly, 125 l of samples plus 100 l of HEPES/ammonium formate (1:1) were mixed with 25 l of nitrate reductase, incubated for 60 minutes at 37C. After the incubation, sample s were centrifuged (2000rpm for 15min) and 100 l of supernatant was transferred into a 96-well plate. Griess reagent was made by 1:1 (V/V) mixed

PAGE 27

27 1% sulfanilamide with 0.1% naphthylethylene diamine. 150 l of Griess reagent was added into each well. Samples were incubated for 15 minut es at room temperature. Absorbance was determined at a wavelength of 543 nm spectr ophotometrically. All chemicals for NOx assay were from Sigma (St Louis, MO, USA). A st andard curve was constructed ranged from 0400 M. Details of this method have b een published by us previously (130). Nitric Oxide Synthase Activity In vitro NOS activity was determined as the following procedures: NOS activity was measured from the conversion of L-[3H]-arginine to L-[3H]-citrulline in the kidney cortex as described by us previously (39). Briefly, tis sues were homogenized in iced homogenization buffer, ultracentrifuged, and both supernatant (s oluble) and membrane fractions assayed; the soluble fraction contai ns predominantly nNOS (and iNOS when stimulated), whereas the membrane fraction contains mostly eNOS. Endogenous arginine was removed from the supernatant using Dowex while the pellet was re constituted in homogenization buffer, then ultracentrifuged and resuspended. Samples were run at baseline and in the presence of nonselective NOS inhibitor cocktails: 2mM trif luoperazine, 5 mM NG-methyl-L-arginine (LNMA), and 10 mM Nw-nitro-L-argi nine methyl ester (L-NAME, Sigma-Aldrich, St. Louis, MO, USA). Data were expressed as pmol citrulline /min/mg protein minus a ny activity not inhibited by the NOS inhibitor cocktail and adjusted for background. Pathology Pathology was determined as follows: Pathol ogy was performed on 5 micron sections of formalin-fixed kidney, blocked in paraffin wax, st ained with PAS (Periodi c acid-schiff staining system, Sigma-Aldrich, St. Louis, MO, USA). The level of renal in jury was assessed on a blinded basis by determining the sclerotic damage to glomeruli using the 0 to 4+ scale, where 1+ injury involved less that 25% damage to the glomerulus, 2+ = 25 50% injury, 3+ = 51-75%

PAGE 28

28 damage and 4+ = 76 100% damage. Data were represented as % of damaged glomeruli (N=100) showing any level of inju ry (scale 1+ to 4+). The tota l numbers of damaged glomeruli including all levels of injury were also m easured and represented as total % of damaged glomeruli (N=100). Western Blot Western blot was performed as follows: Samp les were loaded to 7.5-12% polyacrylamide gels, in aliquots of 50 g total protein with concentration adjusted to give fixed volume = 50 l. MW markers were run in one lane and positive control was also run. The proteins were separated by electrophoresis ( 200 V, 1h5min-2.5hr), transferred onto nitrocellulose membranes (1hr 45 min, 0.18Amps). We stained each membrane with Ponceau red to correct variations during protein loading and transfer. Then the membranes were incubated in 5% non-fat milk with TBS-T blocking solution for 60 min and wash ed in TBS-T (0.05%-0.5%) then incubated in the appropriate dilution of the primary then secondary antibody. The nNOS was detected with 2 N-terminal antibodies: a rabbit polyclonal antibod y (76) (1:10,000 dilution, 1 hr incubation) followed by a secondary goat anti-rabbit IgGHRP antibody (Bio-Rad; 1:3,000 dilution, 1 hr incubation), or a mouse monoclonal antibody (Santa Cruz, 1:200 dilution, overnight incubation) followed by a goat anti-mouse IgG-HRP seconda ry antibody (Bio-Rad, 1:2000 dilution, 1-hour incubation). For nNOS detection we used a C-terminal rabbit polyclonal antibody (Affinity BioReagents, 1:250 dilution, overn ight incubation), followed by a goat anti-rabbit IgG-HRP secondary antibody. Membranes were strippe d and reprobed for eNOS using a mouse monoclonal antibody (Transduction Laboratories 1:250 dilution, 1-hour incubation), followed by a goat anti-mouse IgG-HRP secondary antibody. For PRMT1 we used a rabbit anti-PRMT1 antibody (Upstate, 1:2000 dilution, overnight in cubation) and a goat anti-rabbit antibody. For DDAH we used a goat anti-rat DDAH1 anti body (Santa Cruz, 1:500 dilution, overnight

PAGE 29

29 incubation) or a goat anti-rat DDAH2 anti body (Santa Cruz, 1:100 dilution, overnight incubation), followed by a secondary donkey anti -goat antibody (Santa Cruz, 1:2000 dilution, 1h incubation). For p22phox we used a goat anti-rat antibody (Santa Cruz, 1:200 dilution, overnight incubation), followed by a secondary donkey anti -goat antibody. Bands of interest were visualized using SuperSignal West Pico reag ent (Pierce, Rockfor d, IL) and quantified by densitometry, as integrated optical density (I OD) after subtraction of background. The IOD was factored for Ponceau red staining to correct for any variations in total protein loading and for an internal standard (rat cerebellum for nNOS, endoth elial cell lysate for eNOS, rat kidney cortex for PRMT1 & DDAH1/2, rat heart for p22phox). Th e protein abundance was represented as IOD/Ponceau Red/Std. We used Ponceau red me thod for standardization because in some situations -actin may change. Electronic Spin Resonance NADPH oxidase-dependent superoxide was de tected by electronic spin resonance (ESR) as follows: For this we collaborated with Dr. Griendling, Emory University to measure superoxide production by ESR with spin tra pping. Membrane samples from kidneys were prepared as described previously (33, 51). 10 g of protein was added to 1 mM CPH, 200 M NADPH, and 0.1 mM diethylen etriaminepentaacetic acid in a total volume of 100 l of Chelextreated PBS. In duplicate samples, NADP H was omitted. Samples were placed in 50 l glass capillaries (Corning, New York, NY, USA). The ESR spectra were recorded using an EMX ESR spectrometer (Bruker) and a super-high-Q microw ave cavity. Superoxide formation was assayed as NADPH-dependent, S OD-inhibitable formation of 3-carboxyproxyl. Reverse Transcription Polymerase Chain Reaction Reverse transcription polymerase chain re action (RT-PCR) was performed as follows: End-point RT-PCR was used for semi-quantitativ e analysis of mRNA. RNA was isolated from

PAGE 30

30 tissue using TRI Reagent (Sigma, St.Louis, MO USA) and treated with DNase I (Ambion, Austin TX, USA). RNA (1 g) was reversed transcribed (RT; SuperScriptTM II RNase HReverse Transcriptase, Invitrogen, Bethesda MD, USA) with random primers (Invitrogen, Bethesda, MD, USA) in a total volume of 20 l. Primers were designed using GeneTool Software (Biotools Incorporate d, Edmonton, Alberta, Canada) with annealing temperatures at 58-61C. Ribosomal 18S (r18S; Ambion, Austin, TX, USA) was used as an internal reference since r18S expression remained constant throughout. For nNOS and nNOS a forward primer targeting Exon 1a, a 5 untranslated region (5 UTR), was made according to Lee et al. and reverse primers targeting e xon 2 (R2:5' tccgcagcacctcctcgaatc 3') and exon 6 (R6: 5' gcgccatagatgagctcggtg 3') were designed from rat-specific sequences (NM_052799). For each primer set, the cDNA from all samples was amplified simultaneously using aliquots from the same PCR mixture. PCR was carri ed out using 1-0.5 g of cDNA, 50ng of each primer, 250 M deoxyribonucleotide triphosphates, 1 x PCR Buffer, and 2 units Taq DNA Polymerase (Sigma, St. Louis, MO, USA) in a 50 l final volume. Following amplification, 20 l of each reaction was electrophoresed on 1.7% agarose gels. Gels were stained with ethidium bromide, images were captured and the signals were quantified in arbitrary units (AU) as optical density x band area using a VersaDoc Image Analysis Syst em and Quantity One, v.4.6 software (Bio-rad, Hercules, CA, USA). PCR signals were normalized to the r18S signal of the corresponding RT product to provide a semi-quantita tive estimate of gene expression.

PAGE 31

31 CHAPTER 3 IDENTIFICATION OF NEURONAL NITRIC OXIDE SYNTHASE ISOFORMS IN THE KIDNEY Introduction The vulnerable Sprague-Dawley (SD) rats develop decreased nNOS abundance as well as NOS activity and structural damage; however, th e protected Wistar-Furth (WF) rats showed some decrease in nNOS abundance but maintained NOS activ ity (39). These findings suggest the possibility that other nNOS isoforms, lacking the unique N-terminal of the nNOS might exist in the kidney and be influenced by injury which prompted our cu rrent investigation on identification of nNOS isoforms in the SD kidney. In this study we compared an N-terminal antibody (that recogni zes the unique PDZ-PIN region of the full length nNOS ), to a C-terminal antibody (tha t theoretically recognizes all nNOS variants), to investigate the possibility th at structurally and functionally different nNOS proteins exist in the rat kidney. A targeted pr oteomics approach was used to determine if different nNOS proteins were present in the rat kidney and the presence of the relevant transcripts was also inve stigated using RT-PCR. Materials and Methods Tissue was harvested under isofluorane anesth esia from male (n=4) and female (n=3) Sprague Dawley (Harlan, Indianapolis, IN) rats (200-250g). The aorta was perfused with icecold PBS, the kidneys removed, separated into cortex and medulla, flash frozen in liquid nitrogen and stored at C for analysis. Other tissues were collected similarly (skeletal muscle, heart, lung, liver, aorta, small intestine, testis, and cerebellum) Supplies were from Sigma, St Louis MO, unless otherwise specified. For Western blot, analysis was performed as described in chapter 2.

PAGE 32

32 Peptide competition was performed by Wester n blot on two identical membranes, run as described above, on which were loaded 200 g of kidney cortex, 100 g of kidney medulla, and 5 g of cerebellum. For peptide competition 15 0 g of neutralizing peptide (ABR PEP-190) was incubated with 3.75 g of the C-terminal nN OS antibody (ABR PA1-033) overnight at 4 C, centrifuged and supernatant diluted in blocking so lution (1:4000) and used for nNOS detection. The control membrane was probed with the A BR PA1-033 alone. Both membranes were then probed with a secondary goat anti-rabbit IgG-HRP antibody (BioRad, Hercules, CA; 1:60,000 dilution, 1 hr incubation). Immunoprecipitation was carried out on kidney cortex (KC), kidney medulla (KM), and cerebellum (Cer) and tissues were homogenized with lysis buffer (20 mM Tris-HCl, 150 mM NaCl, 1% Triton X-100, 0.5% Nonidet P-40, 1 mM EDTA, 1 mM EGTA, 20 mM sodium orthovanadate, 20 mM NaF, 5 mM phenylmethyl sulfonyl fluoride, 21 g/ml aprotinin, and 5 g/ml leupeptin) and after centrif ugation the supernatant (KC = 1.5 ml, 26 g protein /l; KM = 1 ml, 25 g /l; Cer = 1 ml, 11.5 g /l) was incubated with 20-80l of C-terminal nNOS antibody (ABR PA1-033) overnight at 4C with continuous rotation. Protein A-Sepharose beads (30-50 l, Amersham Biosciences, Piscataway, NJ) were added, con tinuously rotated for 2 h at 4 C, washed, resuspended in 50 l of 2 Laemml i buffer, boiled for 3 min and loaded onto 7.5% SDS polyacrylamide gels. Proteins were separa ted by SDS-PAGE (200 V, 2.5 hr), gels were stained overnight with Coomassie blue (Sigma, St Louis, MO) and the bands of interest excised from the gel under fully sterile condi tions and analyzed by proteomics. For proteomic analysis we collaborated with Dr. Klein, University of Louisville. Protein digestion, peptide mass fingerprinting and seque nce tagging was conducted on individual bands excised as 1-3 mm3 plugs from the 1D-SDS PAGE gels, conditioned and de-stained with 20 L

PAGE 33

33 0.1 M NH4HCO3 for 15 minutes followed with 30 L 99.9% acetonitrile. The gel pieces were dried, re-hydrated with 20 L of 0.02 M dithiothreitol in 0.1 M NH4HCO3 and heated at 56C for 45 minutes for reduction of disulphide bonds The solution was replaced with 0.055 M iodoacetamide in 0.1 M NH4HCO3 for alkylation of reduced thiols (30 minutes in the dark). The alkylation solution was removed, the gel plug conditioned for 15 minutes with 200 L 0.05 M NH4HCO3, then gel plugs were dehydrated with 200 L 99.9% acetonitrile. After 15 minutes the solution was removed, gel plugs were dried by vacuum centri fuge and re-hydrated with 3 L of 20 ng/ L modified trypsin (Promega Madison, WIA) in 0.05 M NH4HCO3. Re-hydrated gel pieces were covered with 5-6 L 0.05 M NH4HCO3 and incubated overni ght at 37C. The samples were cooled and the trypsinizati on reaction was stopped by the addition of 1 L 0.1% trifluoroacetic acid (TFA). MALDI matrix used throughout the analysis was -cyano-4-hydroxycinnamic acid ( -CN) containing 10 mM NH4H2PO4. Samples were a) spotted as 1: 1 (v/v) samples of protein digest: -CN (or b) desalted sample aliquots (0.7 L 1.0 L, 4 mg/mL -CN, 50% acetonitrile, 0.1% TFA) spotted directly onto MA LDI sample targets using C18 Zip Tips (Millipore, Salem, MA). Samples were air-dried in the dark and cleared of particulate matter with compressed gas prior to sample plate loading into the mass spectrometer. Positive ion MALDI -TOF mass spectra were acquired using an Applied Biosystems (Foster City, CA) AB4700 protein analyzer opera ting in reflectron mode and with ion source pressure ~0.5 Torr. After a 400 ns time-delayed ion extr action period, the ions were accelerated to 20 kV for TOF mass spectrometric analysis A total of 600 to 1000 laser shots (355 nm Nd:YAG solid state laser operating at 200 Hz) we re acquired and signal averaged. Individual sample plates were calibrated and plate mode ling performed using a six peptide calibration

PAGE 34

34 standard with 1) des-Arg1-Br adykinin, 2) angiotensin I, 3) Glu1-Fibrinopeptide B, 4) ACTH (1-17), 5) ACTH (18-39), and 6) ACTH (7-38). Data was analyzed us ing Mascot (version 1.9) against the 20051115 or 20061212 Swiss Protein da tabase (all taxonomy) assuming: a.) monoisotopic peptide masses, b.) cysteine carbamidomethylati on, c.) variable oxidation of methionine, d.) no missed trypsin cleavage sites, e.) a MS mass accuracy of greater than 50 ppm and f.) a MSMS mass accuracy of greater than 0. 3 Da. Limitation of the original protein mass was not employed within the Mascot search. A Mascot score of 65 was considered to be statistically significant (p<0.05). Major ion peaks and suspect modified pep tides were subjected to MALDI TOF-TOF analysis by collision induced fragmentation (C ID) using 1 KeV collision energy and atmospheric gases (medium pressure). Mascot search of the MALDI TOF-TOF data proceeded with search parameters listed above with the inclusion of a mass accuracy of 0.3 Da for peptide fragment masses. MALDI TOF-TOF spectra were used for combined analysis using Applied Biosystems Global Protein Server so ftware and Mascot. End-point RT-PCR was used for qualitative anal ysis to differentially detect nNOS mRNA. RNA as described in chapter 2. Results Homogenates of male and female kidney cort ex and medulla were immunoblotted using both N-terminal and C-terminal polyclonal nNOS antibodies. Figure 3-1A shows a representative western blot using the antibody targeting the Nterminal of rat nNOS (AA#1-231) (80). This antibody detects a single band at ~160 kDa in th e kidney cortex, kidney medulla and cerebellum which corresponds to the nNOS isoform. Figure 3-1B shows the same samples probed with the ABR nNOS antibody, which detects a conserved region within the C-terminal of nNOS (AA#1409-1424) and should detect all the potential nNOS isoforms within the kidney. Multiple

PAGE 35

35 bands are shown including those marked by arrows at ~160 kDa (putative nNOS ), ~140 kDa (putative nNOS ), and ~125 kDa (putative nNOS ). Homogenates of female kidney cortex, medu lla and cerebellum were immunoblotted onto 2 identical membranes which were probed with the C-terminal ABR antibody in the absence and presence of neutralizing peptide (x40). As shown in Figure 3-2, the bands at ~160 kDa (putative nNOS ), ~140 kDa (putative nNOS ), and ~125 kDa (putative nNOS ) were faded or abolished when incubated with th e neutralizing peptide. Next, homogenates from male kidney cort ex, kidney medulla and cerebellum were immunoprecipitated with the C-terminal ABR nNOS antibody and electr ophoresed by 1D-SDS PAGE. MALDI-TOF MS and MS/MS data were ac quired. Mascot analysis used a combination of peptide mass fingerprinting (PMF) and tandem MS fragmentation data. We identified nNOS in both the ~170 kDa and ~160 kD a band of cerebellar lysate c ontrol (C3, C4, Table 3-1). The observed peptide coverage for cerebellar nNOS (C4) spans the nNOS protein sequence from amino acid residue 36 to 1407, consistent with nNOS Although nNOS was also detected in the ~170 kDa band (C3, Table 3-1), we we re unable to determine if this slightly larger isoform was nNOSsince the tryptic peptide mass/fragments associated with the 34 AA insert (starting at AA# 839, K -> KYPEPLRFFPRK GPSLSHVDSEAHSLVAARDSQHR) were not observed. In kidney medulla nNOS was identified in both the ~160 kDa and ~140 kDa bands (KM 4 and 5). Band KM4 contained pep tide ions mapping to the rat nNOS sequence from amino acids 36 1400. Multiple analyses of the nNOS in KM band 5 identified only peptides spanning amino acids 360 through 1400, consistent with the identification of the KM5 as nNOS(Table 3-1).

PAGE 36

36 Due to relatively low abundance we were unable to detect any nNOS protein in the kidney cortex by MS analysis (Table 3-1) instead observing myosin-6, spectrin-chain, clathrin heavy chain and -S1-casein in the putative bands of interest (KC3-5). The clathrin heavy chain and myosin-6 were also seen in the same fracti ons in which the ABR antibody was omitted. To further evaluate the presence of nNOS variants in the kidne y medulla, RT-PCR was performed on the same tissue sample used for proteomic anal ysis using various untranslated regions of exon 1.4 Two bands were detected with Exon 1a-Exon 5 primer pairing indicating the presence of nNOS (~1365bp) and nNOS (~310bp) mRNA expression. To test for the presence of the nNOS transcript, Exon 1a-Exon 6 primer pairin g was performed. Following PCR, only two bands were detected indicat ing the presence of nNOS (~1603bp) and nNOS (~548bp), but no nNOS mRNA expression. As shown in Figure 3-3 nNOS and/or nNOS mRNA was present in various rat tissues including kidney cortex, medulla skeletal muscle, liver, sma ll intestine, l ung, testis, and cerebellum. Discussion The novel finding in this st udy is that both the nNOS and nNOS proteins are present in the normal SD rat kidney. In addition, we ha ve confirmed the presen ce of two nNOS mRNA transcripts (nNOS nNOS ) arising from the same 5 untranslated region (UTR). It was the presence of residual NOS activity in the brain of the nNOS knockout mouse (generated by an exon 2 deletion), that led to the identification of the nNOS isoform (57). Since then, a number of nNOS isoforms have been identif ied that arise from the alternative splicing of nNOS pre-mRNAs. The greatest diversity of nNOS transcripts occur in the 5 UTR (Exon 1). In human tissues nine different firs t exons have been identified ( 117, 160) whereas in rat four first exons are known (58, 81, 102). Lee et al. identified three nNOS mRNA each with distinct 5

PAGE 37

37 untranslated first exons which a ll splice to Exon 2 while Oberbaum er et al. identified different nNOS mRNA splice variants in rat (81, 102). In rat kidney, a novel first exon was identified with five nNOS mRNA variants, four of which encoded for nNOS (Exon 2) and one which encoded for nNOS (Exon 3) (102). Most renal researchers use commercially available C-terminal antibodies to detect renal nNOS but we have used an N-terminal antibody s ynthesized by Lau et al. (80) that is highly selective for nNOS We selected the ABR C-terminal nNOS antibody (#PA1033; polyclonal rabbit anti rat) since th e neutralizing peptide was also ava ilable for competition assays. Using this C-terminal antibody in Western blots we observed bands in normal kidney cortex and medulla at the molecular weights of nNOS(~160 kDa), nNOS(~140 kDa) and nNOS(~125 kDa). These were all competed when inc ubated with the neutralizing peptide, suggesting that they were either nNOS isoforms or other proteins with structural homogeneity in the AA #1409-1424 region of the C-terminal. We then immunoprecipitated these proteins with the ABR nNOS C-terminal antibody, separated the proteins by 1D-PAGE and performe d proteomic analysis on the bands of interest (4). Repeated MALDI-TOF MS analysis demons trated that the cerebe llum and kidney medulla contained peptide ions mapping to the rodent nNOS sequence (NCBI Accession #P29476) from amino acids 36 1400 thereby identifying the ~160 kDa protein band as nNOS In the ~140 kDa protein band, peptide ions mapping to the rodent nNOS sequence from amino acids 359 1400 were observed. Of note, we did not identify the R.VSKPPVIISDLIR.G, the R. GIASETHVVLILR.G or the R.GPEGFTTHLETTFTG DGTPK.T tryptic peptides, predicted to be present within amino aci ds 1 through 358 of the nNOS consistent with th e identification of the ~140 kDa band as nNOS To verify the existence of transcripts coding for nNOS and

PAGE 38

38 nNOS in rat kidney we used RT-PCR using three forward primers for Exon 1 as previously published by Lee et al. (81) and two reverse primers designed to targ et Exon 5 (aa. #318-326) and Exon 6 (aa. #398-405). Two bands were detected with Exon 1a-Exon 5 (1365bp, 310bp) and Exon 1a-Exon 6 (1603bp, 548bp) primer pairing indicating the pres ence of both nNOS and nNOS transcripts in both renal cortex and medulla. Although an immunoreactive protein band at ~125 kDa (nNOS ) was detected with the ABR nNOS C-terminal antibody by Western blot analysis, we were unable to confirm the presence of nNOS by proteomic analysis. While this absence could simply be due to low protein abundance, the fact that we could not detect any nNOS mRNA suggests that nNOS is not present in normal rat kidney. We speculate that this ~125 kDa band (which was competed by neutralizing peptide), may c ontain a novel nNOS variant. Despite detecting both nNOS and nNOS transcripts in the rat kidney cortex, we could not confirm the presence of any nNOS protein in the kidney cort ex by proteomic analysis. This presumably resulted from a relatively low abunda nce of nNOS in the kidney cortex. Given the large body of literature demonstrating that nNOS is present in very high concentrations in the macula densa, we hypothesize that the abundance of nNOS in the macula densa relative to total cortex is beneath the level that can be detected by the MS methods we have used (3). In the kidney cortex five proteins were identified by MS in the MW bands that should contain nNOS: clathrin heavy chain (CLH), spectrinchain brain (SPTA2), myosin-6 (MYO6) and aminopeptidase N (AMPN). There is no homo logy between CLH, SPTA2, MYO6 and AMPN and the immunogen of the COOH-terminal AB R antibody or the nNOS. In addition, CLH, SPTA2, and MYO6 were identified in the abse nce of ABR antibody control suggesting proteinprotein interactions and/or non-sp ecific binding to Protein A. AMPN was identified by MALDI-

PAGE 39

39 TOF MS/MS-MS in only one im munoprecipitation and not in repeated studies, suggesting contamination rather than a lack of ABR nNOS antibody sp ecificity (85). Based on the present findi ngs we suggest that nNOS is present in the normal rat kidney. Unlike full-length nNOS nNOS lacks amino acids 1-236, which contains the PDZand PINdomains. The PDZ-domain is important in targeting nNOS to the membrane, thus nNOS would only occur in the cytosol as shown by Huber et al. (58) in the rat intestine. The PINdomain contains a binding site for protein-inhi bitor of NOS which may inhibit the dimerization and activity of nNOS (63). Since nNOS does not contain a PIN-domain, nNOS can not be inhibited by PIN or influenced by any protein-protein intera ction. Heterologous transfection assays have shown the nNOS to be catalytically active (~80% of the activity of nNOS ) (35), thus the renal nNOS is likely to be a functional enzyme. In wild type mice, nNOS is located in many br ain areas and with nNOS knockout, nNOS abundance increases (35). In nNOS knockout mice, nNOS was able to maintain normal penile erection (59), suggesting that there may be an upregulation of nNOS when nNOS -derived NO is deficient.

PAGE 40

40 Table 3-1. Proteins identifie d by MALDI-TOF MS/MS-MS Protein MASCOT Sequence Number of matching Estimated Calculated Band Protein ID Accession Number Score Coverage (%) Nonredundant peptides MW (kDa) MW (kDa) C3 nNOS P29476 169 15 20 190 161.8 C3 Clathrin heavy chain P11442 141 13 19 190 193.2 C4 nNOS P29476 600 33 37 160 161.8 C4 -S1Casein BAA00313 115* 20 3 160 24.6 KM3 Clathrin heavy chain P11442 251 23 28 190 193.2 KM4 nNOS P29476 138 18 19 160 161.8 KM5 nNOS P29476 187 17 21 150 161.8 KC3 Clathrin heavy chain P11442 458 32 42 190 193.2 KC4 Spectrinchain brain P16546 136 15 18 160 168 KC4 Myosin-6 Q9UM54 78 11 14 160 150 KC5 Aminopept idase N P15684 76 12 9 150 109.6 Peptide masses were searched against the Sw iss Protein data (20051115) and all taxa (197228 sequences and 71581181 residues) assuming complete alkylation of Cys with iodoacetamide, partial oxidation of Met, no missed cleavages by trypsin, and a MS mass tolerance of 50ppm & MSMS mass tolerance of 0.3Da. The Mascot Score is the absolute probab ility that the observed match is a random event. The Mascot Score is reported as -10 x Log10 (P), where P is the absolute probability; therefore the lower the pr obability that an obser ved match is a random event the higher the score. In this study, a score of 65 was considered significant. The sequence coverage is the number of amino acids (AA) id entified by peptide sequence tagging compared to the parent protein (AA identified/total AA in pare nt protein). *Protein id entification significance achieved by peptide sequence tagg ing of one peptide. C, cerebellum; KM, kidney medulla; KC, kidney cortex.

PAGE 41

41 B A Figure 3-1. Immunoblots of male and female ki dney cortex (KC), kidney medulla (KM), and control cerebellar lysate (C er). A) with N-terminal nNOS antibody. B) with ABR Cterminal nNOS antibody. Lanes: 1 = male KC, 2 = male KM, 3 = female KC, 4 = female KM, 5 = Cer.

PAGE 42

42 127 83 247 160kDa 140kDa 125kDa 1 2 3 4 5 6 7 247 83 127 160kDa 140kDa 125kDa 1 2 3 4 5 6 7A B Figure 3-2. Immunoblots of female kidney cort ex (KC), kidney medulla (KC), and control cerebellar lysate (Ce r) with ABR C-terminal nNOS antibody. A) In the absence of neutralizing peptide. B) In the presence of neutralizing pe ptide. KC (lanes 1-3) and KM (lanes 4-6) samples were from three separate females. La nes: 1-3 = KC, 4-6 = KM, 7 = Cer.

PAGE 43

43 r18S nNOS nNOSKC KM CerT Lu A Li SI H M500bp 500bp 500bp Figure 3-3. End-point RT-PCR of n NOS transcripts in various male tissues: kidney cortex (KC), kidney medulla (KM), cerebellum (Cer), testis (T), lung (Lu), aorta (A), liver (Li), small intestine (SI), heart (H), and skeletal muscle (M). nNOS transcript was detected using a forward primer targeting e xon 1a and a reverse primer targeting exon 2. nNOS transcript was detected using a fo rward primer targeting exon 1a and a reverse primer target ing exon 6. Ribosomal 18S was used as an internal control. The KC and KM samples used for end-point RT-PCR were the same tissue samples used in generating the KC and KM proteomic da ta. DNA ladders are shown on the left and right.

PAGE 44

44 CHAPTER 4 RENAL CORTEX NEURONAL NITRIC OXIDE SYNTHASE IN KIDNEY TRANSPLANTS Introduction Nitric oxide (NO) derived from iNOS ha s been implicated as damaging in kidney transplants while NO derived from constitutive NOS might protect the allograft (152). We previously reported that decrease d renal nNOS abundance was associ ated with renal injury in a wide variety of CKD models (1 0), including the 5/6 ablation/in farction (A/I) (130), chronic glomerulonephritis (153), puromycin aminonucle oside-induced CKD (PAN) model (38), normal aging (40), chronic NOS inhibition model (36), Zucker obese rat wh ich develops type 2 diabetes (37), and DOCA/NaCl-induced CKD model (39). Re nal transplantation-induced injury could be due to high iNOS-derived NO which could comp romise constitutive NOS availability via substrate limitation (65, 152). It is also possible that decr eased renal nNOS abundance might occur in the transplanted kidney and contribute to injury. We intended to elucidate the nNOS expression in two kidney transplant (Tx) models : a rapamycin-treated allograft model (RAPA) and an I/R injury model using renal isografts (ISO). Although calcineurin inhibitors (CNIs) have improved 1-year survival rates for kidney grafts, long-term graft failure still occurs (92) perhaps reflecting ischemia/reperfusion (I/R) injury and CNI-related nephropathy. In the first series we investigated the long-term (22w) outcome (structural/functional) of renal Tx and renal nNOS expression using 2 different shortterm (10d) immunosuppressive regimens (Cyclo sporine vs. rapamycin) to prevent acute rejection. Rapamycin (RAPA), a mammalian target of rapamycin (mTOR) inhibitor, is used as a substitute for, or given in combination with CN Is to prevent rejection and reduce nephrotoxicity. In male rats, a wide therapeutic dosage of RA PA between 0.3-6 mg/kg/day was effective for prolongation of allograft survival (32) alt hough RAPA at 6.5mg/kg/day resulted in acute

PAGE 45

45 nephrotoxicity in a male rat is ograft model with I/R (101). In this study, the dose sufficient to suppress the initial acute rejec tion of rapamycin (1.6mg/kg/day) and Cyclosporine (3mg/kg/day) were used. In the second series, we investigated whet her perioperative (10 day) anti-inflammatory/ antioxidant treatment designed to give endothelial protection (EP) and preserve NO would prevent long-term graft injury using a Tx-induced (isograft) I/R injury model. Although many antioxidants and anti-inflammatory agents have been tested to prevent I/R injury and ameliorate short-term graft dysfunction, it is unclear whethe r these acute effects may affect the long-term graft function (29, 107). Tempol (4-hydroxy-tem po), a membrane permeable, superoxide dismutase (SOD) mimetic that removes superoxide (O2 -) and facilitates hydrogen peroxide (H2O2) dismutation, was reported to prevent renal I/ R injury at the dose of 30mg/kg/hr for 6hr (25). Deferoxamine (DFO), an iron chelator, ha s been included in preservation solutions (for 18hr) and reduces renal I/R injury at 9 days after Tx (56). L-arginine is a substrate for nitric oxide synthase (NOS) and reduces renal I/R inju ry when administered once before I/R (24). Glucocorticoids are anti-inflammatory agents and also prevent the i nduction of the damaging iNOS. The individual strategies above were combin ed in this study to prevent I/R injury in the 10 day period immediately before and after Tx. Materials and Methods Orthotopic renal Tx was performed as desc ribed in chapter 2. Male Fisher 344 (F344, RT1v1, from Harlan Indianapolis, USA) served as donors. Lewis (LEW, RT1, from Harlan, Indianapolis, USA) male rats we re used as recipients in th e ALLO groups (n=14), while F344 male rats were used in the ISO groups (n=12). In addition to ALLO a nd ISO rats, 2-kidney agematched male rats (n=7) of both Lewis and F344 stai ns were used as age c ontrol. All rats were aged 9-14 weeks and maintained with free access to standard rat chow and water ad libitum.

PAGE 46

46 In the RAPA series Tx recipients were trea ted for the first 10 da ys after surgery with rapamycin derivative sirolimus (n=7) (1.6 mg /kg/day; Rapamune, Wyeth Laboratories, Philadelphia, PA) by gavage or with 3 mg/kg/ day cyclosporin s.c. (n=7) (CsA, Sandimmune, Novartis, Basle, Switzerland). Rats also r eceived the antibiotic ceftriaxone sodium, 10 mg/kg/day (Rocephin, Roche, Nutley, NJ) i.m. for 10 days. In the I/R series, ISO rats were separated into 2 groups: untreated group, ISO-UN (n=6) in which lactated Ringers was used to flush th e donor kidney at the time of Tx. A second group (n=6) were given treatments to provide endothe lial protection, ISO-EP. The donors received 10 mg/kg dexamethasone, iv (APP, Los Angeles, CA USA) 30 minutes before kidney removal. The donor kidney was flushed with 2 ml/g kidney weight cold lactated Ringers solution containing 1 mM deferoxamine mesylate (Sigma-Aldrich, St Louis, MO, USA) and 3 mM 4-hydroxy-tempo (Sigma-Aldrich, St. Louis, MO, USA) removed and placed in the same cooled solution for 10 minutes. Recipients were treated with 1% L-ar ginine (Fresenius Kabi Clayton, Clayton, NC, USA) and 1 mM 4-hydroxy-tempo in the drinki ng water one day before Tx and for 10 days thereafter to provide overall EP. We used additional tissue solely as positiv e control for the NADPH oxidase-dependent superoxide production assay. Female Lewis recipients received rena l grafts from female Fisher donors (30 min ischemia time) and were treated w ith cyclosporine (Novarti s, Basel, Switzerland) at 1.5 mg/kg/day for 10 days. The contralateral d onor Fisher kidney was ha rvested at Tx and the allograft was harvested at week 7 because of severe rejection; these provided normal control and severely inflamed samples, respectively. Urine samples were collected in metabolic cag es at 22 wks after Tx for determination of urinary NOx and total protein ex cretion. Just prior to sacrifice, blood pressure (BP) was

PAGE 47

47 measured, under general anesthesia and a blood samp le taken for analysis of plasma creatinine. Kidneys were then perfused until blood-free, de capsulated, removed and weighed. A thin section of kidney including cortex and medulla was fixe d for histology and the remaining cortex and medulla was separated, flash frozen in liquid ni trogen and stored at C for later analysis. Kidney sections were fixed in 10% buffe red formalin, blocked in paraffin and 5 m sections were stained with PAS. Glomerular sclerosis, in terstitial, tubular, and vascular lesions were graded according the Banff classification. Rena l nNOS and eNOS abundance were determined by Western blot. In a ddition, cerebellum (5 g) and skeletal muscle (150 g) were also used for detection of nNOS in this study. End-point RT-PCR was used for semi-quantitative analysis of mRNA. In I/R series, NADPH-dependent superoxide production in kidney cortex was measured by Electron Spin Resonance (ESR) spectroscopy with hydroxylamine spin probe 1-hydroxy-3carboxypyrrolidine (CPH). All analyses were performed as described in chapter 2. Results are presented as meanSEM. Parametr ic data was analysed by t-test and ANOVA. Nonparametric data was analysed by the Mann-Wh itney test. P<0.05 was considered significant. Results All ALLO rats survived to 22 weeks post Tx. As shown in Table 4-1 both CsA and RAPA groups had higher urine NOx excretion than c ontrol. Both CsA and RAPA groups developed renal failure represented as increased plasma Cr BUN, and decreased clearance of Cr. BP was lower in both ALLO vs. control possibly reflec ting a lower BP in the Lewis ALLO recipients. Both ALLO groups had greater kidney weight vs. control presumably due to compensatory hypertrophy. We found RAPA group exhibited significantly more scleroti c glomeruli than CsA group and their respective control (Figure 4-1). Ba nff score summarizing glomerular, tubular, interstitial and vascular change s demonstrated more severe inju ry in RAPA group compared to

PAGE 48

48 CsA group. CsA group displayed lower urine protein excretion than control, while there was no dofference between RAPA group and control. Us ing the N-terminal antibody, cortical nNOS protein was nearly undetectable in RAPA group (Figure 4-2). In c ontrast, there was no difference in nNOS abundance in skeletal muscle ( 0.0076 0.0005 vs. 0.0084 0.0005 IOD/Int Std/Ponc) and cerebellum (0.0064 0.0024 vs. 0.0088 0.0006 I OD/Int Std/Ponc) between CsA and RAPA groups. As shown in Fig 4-3, nNOS mRNA significantly in creased in CsA group compared to controls (Fig 4-3A), whereas nNOS mRNA significantly increased in RAPA group (Fig 4-3B). Using the C-terminal nNOS antibody, nNOS protein (~140kDa) was significantly higher in the cortex of RAPA group compared to CsA and normal 2 kidney controls (Fig 4-4). In I/R series, ISO-UN and ISO-EP groups ha d similar body weights (BW), kidney weights and the ratio of KW/BW, which was higher than in controls due to compensatory hypertrophy (Table 4-2). Ccr, plasma Cr and BUN were sim ilar in both groups of ISO and lower vs. normal controls (Table 4-2). Mild proteinuria developed in the ISO-UN rats (Table 4-2) while the ISO-EP group showed no change from baseline or from cont rols at week 22. By histology, the ISO-EP and ISO-UN rats, developed moderate and similar glomer ulosclerosis and tubulointerstitial injury vs. controls (Figure 4-5). Despite the lack of proteinuria the EP group was not protected from structural damage compared to the UN rats. The EP protocol should provide protection against inflamma tion and oxidative stress preand for the 10 days post Tx; the period where I/R injury would likely be developing. However, as shown in Figure 4-6, by 22 weeks post Tx th ere was no difference in renal NADPH-dependent O2 production in ISO-EP and ISO-UN kidney cortex. Th is assay is able to detect oxidative stress

PAGE 49

49 since we observed increased renal NADPH-dependent O2 production in female Lewis allograft recipients undergoing severe graft rejecti on compared to normal kidney (Fig 4-6). By Western blot, ISO-EP rats showed lowe r nNOS and eNOS protein abundance in renal cortex vs. ISO-UN (Figure 4-7A) but the in vitr o NOS activity in both so luble (main location of the nNOS) and membrane (main location of the eNOS) fractions were similar between the 2 groups (Figure 4-7B). Discussion The novel finding of this study is that shortterm RAPA treatment (10d) had a long-term (22w) effect to reduce the renal cortical nNOS protein abundance, but with increases in the nNOS abundance. This may explain w hy the almost total loss of nNOS seen in RAPA group was associated with same degree of re nal dysfunction as that in CsA group. In the renal mass reduction model there is a li near inverse relationship between increasing glomerular injury and decr easing renal cortical nNOS abundance, once glomerular injury exceeds ~20 % (130). Consistent with this findin g, CsA-treated allografts developed ~20% of glomerulosclerosis and their nNOS abundance was maintained. However, the RAPA treated allograft showed marked re duction (near zero) in nNOS in renal cortex. Based on our 5/6 A/I studies in the SD rat (130) we would expect this to result in massive renal damage and yet the F344 to Lewis RAPA treated allograft showed onl y ~30% of glomerular injury, suggestive of compensatory changes, perhaps by another nNOS isoform. Of note, there was no difference in abundance of nNOS in either skeletal muscle or cerebellum in RAPA compared to CsA treated ALLO rats. Why RAPA specifically inhibits nNOS protein expression only in renal cortex but not other nNOS abundant tissues is unclear. One possibility is that tubular reabsorption and concen tration of RAPA leads to elevated tissue concentrations compared to e.g., skel etal muscle (99) and that the nNOS isoform may be

PAGE 50

50 particularly sensitive to RAPA. There is no da ta available on the impact of RAPA on nNOS expression although RAPA induced increases in aortic eNOS protein expression have been reported in Apo E knock out mice (98). We have identified mRNA and protein of nNOS and in rat kidney as described in chapter 3. Here we demonstrated that ALLO male rats given RAPA showed increases in both nNOS mRNA and protein abundance vs. Cs A treated male rats. Since NOS has ~80% the activity of nNOS in vitro (20), this sugge sts that the increased nNOS may compensate for the decreased nNOS activity in response to RAPA. With re gard to renal Tx, experimental NOS inhibition worsens injury, while L-arginine supp lementation decreases renal damage suggesting that NO plays a protective role (2, 124). Although the RAPA group displayed a moderately higher degree of glomerulosclerosis than CsA group, both groups had similar reduction of renal function. It suggests th at the increased nNOS compensates for the decreased nNOS activity to maintain similar renal function in RAPA group vs. CsA group. In the 2nd series we found that short-term (10 da y) intensive endothelial protection (EP) with combined antioxidant and anti-inflammatory treatment at the time of Tx (ISO) has no longterm benefit in terms of structure or function. While much of the chronic renal Tx damage is antigen-dependent, non-immunological mechanisms also contribute (92). Because uninephrectomized Fisher kidne ys are functionally, morphol ogically and immunologically identical to two-kidney controls (6), the injury must come from Tx-induced I/R injury. Not all strains show susceptibility to I/R-injury since ISO kidneys in Brown Norway rats showed normal function and structure at 1 year after Tx (76). We also found that there was no structure/function protection with EP therapy nor was the long-term increase in renal NADPH-dependent O2 production prevented. This contrasts to

PAGE 51

51 studies in ALLO (Fisher to Lewis) where function/structure is improved by short term immunosuppressive/anti-inflammatory treatment to the donor (112). Short term L-Arginine has functional benefit to human ALLO recipients (121). Although the indi vidual agents that we used in this study have been shown to provide short-term renoprotecti on (1 hr to 9 days) against I/R injury, their long-term effects are unclear. Thus, our findings suggest that the optimal donor kidney, in the absence of alloreac tivity, does not benefit from EP therapy. There is likely to be benefit from treatment of ALLO in man, particularly where e xpanded donor criteria are used. Despite similar structural damage there was a lower renal cortex nNOS and eNOS protein abundance in the treated ISO-EP vs. ISO-UN ki dneys. Of note, however, the in vitro NOS activity of both soluble and membrane fractions of renal cortex were similar in ISO-EP and ISOUN. This highlights the complexity of the regulation of NOS enzyme activity which is influenced by many posttranslational modifica tions as well as by protein abundance. Although the oxidative state is a major re gulator of nNOS protein abu ndance and activity, there was no difference in the amount of O2 generated by NADPH oxidase between untreated and treated groups. These findings suggest that EP therapy partially restores NO synthesis and endothelial function so that lower abundance of nNOS and e NOS are required in ISO-EP rat. However, the net renal NOS activity is not improved. In summary, nNOS abundance can be maintained in mild Tx-induced CKD in the CsA ALLO and although the RAPA ALLO rats showed almost no nNOS increased nNOS compensated to limit injury and preserve renal fu nction. In the ISO studies, short term combined antioxidant therapy did not prevent the chronic Tx -induced I/R injury in do nor kidneys that were optimally harvested from living donors.

PAGE 52

52 Table 4-1. Functional parameters in Tx and c ontrol groups 22 weeks after transplantation BW (g) UprotV (mg/day) UNOxV ( M/day/100g BW) PCr (mg/dl) BUN (mg/dl) CCr (ml/min/ Kg BW) BP (mmHg) TX weight (g) CsA 451 12 16 2* 1.29 0.10* 0.45.04*30*# 5.4.3* 63*# 2.18.10* RAPA 436 9 37 17 1.45 0.17* 0.49.03*26* 5.0.3* 79* 2.21.12* Control 456 8 36 4 0.81 0.03 0.30 0.02 18 2 7.3 0.5 113 3 1.84 0.14 Values are represented as mean SEM. Upro V, 24hr urine protein; CCr, 24hr clearance of creatinine; TX, transplanted kidney. *p<0.05 vs control, #p<0.05 vs. RAPA.

PAGE 53

53 Table 4-2. Weight and renal functi on measures at 22 wk after ki dney transplantation or similar time in control ISO-UN ISO-EP CON Body weight (g) 408* 396* 456 Kidney weight (g) 2.20.14 2.36.16 1.84.14 Kidney weight/body weight x1,000 5.36.02* 5.96.36* 4.07.35 Blood urea nitrogen (mg/dl) 23* 21 18 Plasma creatinine (mg/dl) 0.50.02* 0.44.02* 0.30.02 CCr/BW (ml/min/kg BW) 4.3.4* 4.6.1* 7.3.5 UprotV (mg/24hr) 51 31# 36 Values are represented as mean SE; abbreviati ons are: ISO-UN, isograf t without therapy; ISOEP isograft with endothelial prot ection; CON, time control; CCr, 24hr clearance of creatinine; UproV, 24hr urine protein; *p<0.05 vs. CON; #p < 0.05 vs. ISO-UN. Reprinted with permission from S. Karger AG, Basel (134).

PAGE 54

54 % of glomerulosclerosis 0 10 20 30 40 Control CsA RAPA Banff score (0-12) 0 1 2 3 4 5 6 7 ND* *# #AB Figure 4-1. Renal outcome in ALLO grafts at 22 weeks after Tx. A) % of Glomerulosclerois. B) Banff score. *p<0.05 vs. control, #p<0.05 vs. CsA.

PAGE 55

55 CsA Rapa Control IOD/Int Std/Ponc 0.000 0.002 0.004 0.006 0.008 0.010 0.012 0.014 0.016 PC CsARapa ControlND*Ponc IOD x106 1.62 1.62 1.64 1.63 1.62 1.62 1.64 1.63 1.62 1.62 Figure 4-2. Renal cortical nNOS protein abundance in CsA and RAPA ALLO rats. The molecular weight marker is in the first line. PC represents positive control. The bands were analyzed and represented as integr ated optical density (IOD). The Ponc IOD represents total protein loading detected by Ponceau red staining, which shows equal loading in all lanes. The nNOS protein abundance was factored for Ponc to correct for any variations in total pr otein loading and for an inte rnal standard (Int Std). ND represents not detectab le. *p<0.05 CsA vs. RAPA.

PAGE 56

56 Control CsA RAPA 0.0 0.5 1.0 1.5 2.0AU (ODxArea/r18S) ControlCsARAPA 0 2 4 6AU (OD x Area) Control CsA RAPA 0.00 0.25 0.50 0.75 1.00AU (ODxArea/r18S)r18S nNOS nNOS AB C Figure 4-3. Renal cortical nNOS and nNOS mRNA abundance in CsA and RAPA treated ALLO male rats and controls (n=5 in each group). A) nNOS B) nNOS C) The r18S was used as an internal standard. *p<0.05 vs. control.

PAGE 57

57 Control CsA RAPA 0 10 20 30IOD/Int Std/Ponc Con CsARAPA Con CsARAPA RAPAKM CerenNOS nNOS Figure 4-4. Renal cortical nNOS protein abundance in CsA and RAPA treated male rats and controls. A) Representative wester n blot whole membranes show nNOS band (~160 kDa) and nNOS band (~140 kDa). Cere represents cerebellum used as positive control for nNOS KM represents kidney medulla used as positive control for nNOS B) Densitometry (n=5 in each group). *p<0.05 vs. control.

PAGE 58

58 CON ISO-EP ISO-UN % of glomerulosclerosis 0 10 20 30 40 CON ISO-EP ISO-UN Banff score 0 1 2 3 4 5 6 *A B Figure 4-5. Renal pathology at 22 wk after kidney transplantation. A) % of glomerulosclerosis. B) Banff score (0-12). *p < 0.05 vs. CON. Re printed with permission from S. Karger AG, Basel (134).

PAGE 59

59 Figure 4-6. NADPH-dependent supe roxide production of ISO-UN, ISO-EP, and acutely rejecting allografts and the control kidneys. P < 0.05 vs. normal donor RK; #P <0.05 vs. severe rejection LK. Reprinted with perm ission from S. Karger AG, Basel (134). Normal Donor RK ISO-EP ISO-UN Severe Rej LK NADPH-dependent superoxide production (pmol/mg protein/min) 0 50 100 150 200 250 *##

PAGE 60

60 nNOS eNOS IOD/Int Std/Ponsc 0.0 0.1 0.2 0.3 0.4 0.5 ISO-UN ISO-EP Sol Mem pmol Cit/min/mg pt 0.0 0.2 0.4 0.6 0.8 1.0 1.2 1.4 A B Figure 4-7. NOS protein abundance and activity in ISO-UN and ISO-EP rats. A) Relative abundance of renal cortex neuronal (nNOS) and endothelial nitr ic oxide synthase (eNOS). B) In vitro NOS activity in the soluble (Sol) and membrane fraction (Mem) of cortical homogenates. P < 0.05 vs. ISO-UN. Reprinted with permission from S. Karger AG, Basel (134).

PAGE 61

61 CHAPTER 5 DETERMINATION OF DIMETHYLARGI NINE DIMETHYL AMINOHYDROLASE ACTIVITY IN THE KIDNEY Introduction Dimethylarginine dimethylaminohydrolase (DDAH) metabolizes the methylarginines asymmetric dimethylarginine (ADMA) and NW-monomethyl-L-arginine (L -NMMA), to generate Lcitrulline, and is highly e xpressed in the kidney (84). ADMA is elevated in many systemic diseases, including renal failure, possibly due to impaired renal DDAH activity. Dimethylarginine dimethylaminohydrolase activit y can be measured by rate of substrate (e.g., ADMA) consumption but th ese assays are time consumi ng and costly (61, 87). A colorimetric method that detects L-citrulline prod uction can also be used providing that 1). Other pathways that generate or remove L-citrulline are inactivated and 2). Interfering compounds have been removed. Here, we have optimized the Prescott-Jo nes method (109) usi ng diacetyl monoxime (DAMO) derivatization of the ureido group in L-citrulline to form color that has been adapted to a 96-well format (73). Particular attention was pa id to nonspecific color generation by urea (46). Furthermore, we compared this modified Lcitrulline assay to the direct HPLC method measuring rate of ADMA consumption. Materials and Methods Male Sprague Dawley rats from Harlan (Indi anapolis, IN, USA) were used. Tissues were collected after perfusion with cold PBS and stored at C. Prot ein concentration was determined by Bradford assay. Tissue homogenate was adjusted to the concentration of 20mg/ml. Several pilot studies were conducted to optimize the assay including evaluation of homogenization buffer, deproteiniza tion reagents and other pathways if citrulline metabolism.

PAGE 62

62 Optimization of Homogenization Buffers We tested 4 different hom ogenization buffers: HB1, pH=6.8 which contained 20 mM Tris, 1% Triton X-100, 5 mM EDTA, 10 mM EGTA, 2mM DTT, 1 mM sodium orthovanadate, 0.1 mg/ml phenylmethylsulfonyl fluoride, and 10 g /ml leupeptin and aprotinin; HB2 contained 0.1M sodium phosphate, pH=6.5 containing 2m M 2-mercaptoethanl; HB3 contained 0.1M sodium phosphate, pH=6.5; and HB4 was RIPA buffer (Santa Cruz Biotechnology, Santa Cruz, CA, USA), which contained 20 mM Tris, pH=7. 6, 137mM sodium chloride, 0.2% Nonidet P-40, 0.1% sodium deoxycholate, 0.02% SD S, 0.0008% sodium azide, and pr otease inhibitor cocktail. L-citrulline, sulfosalicylic acid, trichloroacetic acid, sulfuric ac id, antipyrine, sodium nitrite and urease were purchased from Sigma. ADM A and diethylamine NO NOate (DEA NONOate) were purchased from Cayman, 2,3-Dimet hoxy-1,4-naphthoquinone (DMNQ) was from AG Scientific Inc., NW-Hydroxy-nor-L-arginine (nor-NOHA) was from Calbiochem. Diacetyl monoxime was from Fisher. The 96-well polystyr ene plate and thermo re sistant sealing tape were from Costar Corning Inc. In pilot studies, in the presence of 25 M L-citrulline, we tested the effect on background color of 4 different homogenization buffers (H B1-4) and the following common additives: 0.1M sodium phosphate buffer (pH=6.5), 1% Triton X-100, 1M HEPES, 0.3M sucrose, 100nM urea, 0.9% NaCl, 0.1M DTT, 1% 2-mercaptoethanol, 0.5% Tween, 1% SDS, 0.5M EDTA, and 0.2M EGTA. 0.1M sodium phosphate buffer, pH=6.5 containing protease in hibitors (0.1 mg/ml phenylmethylsulfonyl fluoride, and 10 g/ml leupe ptin and aprotinin) was examined for the effect of protease inhibitors on color formation. We also determ ined whether protease inhibitors were required for stability of DDAH in this a ssay. We found that protease inhibitors were not required and that the simple HB3 gave optim al color. Other reagents, 1mM ADMA and 4% sulfosalicylic acid, used in this assay were also examined for their impact on color formation.

PAGE 63

63 The effect of protein content was tested by using BSA and kidney homogenate at the concentrations of 1 and 2 mg/ml. Seri al diluted L-citrul line standards (0-100 M) were prepared in distilled water. All samples we re analyzed in triplicate. The contribution of buffer/additive to color formation was represented as percent of mean absorbance of each sample compared to 25 M L-citrulline (=100%). The findings from these pilot studies were used to optimize the assay for kidney tissue. Optimization of Deproteinization One mM ADMA in sodium phosphate buffer 0.1M, pH=6.5 were prepared for use as substrate. 4-20% sulfosalicylic acid, 4% sulfuric acid, and 1N hydr ochloric acid were prepared as deproteinization solutions. As shown in Table 5-1, in the absence of deproteinization the absorbance was very high (due to detection of protein-bound L-citrulline and increased turbidity) and the optimum deproteinization so lution (giving the minimal absorb ance was 4% sulfosalicylic acid). L-citrulline standard solution was made by adding 17.5mg of L-citrulline to 1000ml sodium phosphate buffer to make 100 M standard, used as stock solution. Oxime reagent (0.8%) was made by adding 0.8g of diacetyl monoxime in 100ml of 5% (v/v) acetic acid. This solution was stored in the dark at 4C. Antipyrine/H2SO4 reagent (0.5%) was made by adding 0.5g antipyrine in 100ml of 50% (v/v) sulfuric acid. 1mM and 0.1mM DMNQ was prepared as superoxide donor; 1mM and 0.1mM sodium nitrit e and DEA NONOate were used as NO donors; 0.01mM, 0.1mM, and 0.5mM nor-NOHA was prep ared for inhibition of arginase. Tests for Other Pathways That Coul d Alter Citrulline Concentration It is theoretically possible that citrulli ne could be simultaneously consumed by the ASS/ASL enzymes that are abundant in kidney. We incubated kidney homogenate with excess citrulline (200 M) in the absence of ADMA (n=4). At incubation time was 0 and 90min, 0.5ml

PAGE 64

64 of 4% sulfosalicylic acid was added for depr oteinization and assayed. We found citrulline formation at t=0 and 90 min were similar, suggesting no citrulline consumption. The activity of the NOS enzymes (which can al so generate citrulline) was automatically inhibited by the presence of a high concentration of ADMA, as well as the lack of essential cofactors (NADPH, FMN, FAD, BH4 etc). When the assay had been optimized for kidney we also investigated the impact of NO and supe roxide (using DEA NONOate, nitrate, and DMNQ) on DDAH activity. Kidney homogenate was pre-inc ubated with urease at 37C for 15min, then 400ul of mixture of ADMA and drugs were added to the homogenate and in cubated at 37C for 45min. To determine the interand intra-assay variab ility we ran supernatant of kidney cortex (which after deproteinization coul d be stored at -80 C and remained stable after 1 freeze/thaw cycle) in 12 different assays and 9 times in one assay. Recommended assay procedures are summari zed in Table 5-2. A time course study was conducted with pre-incubation of urease with homogenates of rat kidney cortex, liver, cerebellum, and aorta, then incubation w ith 1mM ADMA from 0 to 120min. We also investigated the impact of NO and superoxide (diethylamine NON Oate, sodium nitrate, and 2,3Dimethoxy-1,4-naphthoquinone, DMNQ) on DDAH activity. Comparison of Citrulline Assay and Asymmetr ic Dimethylarginine Degradation by High Performance Liquid Chromatography We compared the rate of L-citrulline production by DDAH with the rate of ADMA degradation at t=0, 30, 45, 90 and 120min. In this study 400 l of 1mM ADMA was mixed with the 100 l of kidney homogenate (20mg/ml) and 100 l of the mixture was collected for HPLC analysis of ADMA at the various times, gi ven above. ADMA (and L-arginine) levels were

PAGE 65

65 measured in tissue homogenate using reversephase HPLC with the Waters AccQ-Fluor fluorescent reagent kit as described in chapter 2. Statistical Analysis Data are presented as mean SEM. The effect s of arginase inhibitor, NO and superoxide were compared by unpaired t test. The correla tion between L-citrulline formation and ADMA consumption was analyzed by Pearson correlation coefficient. Results Optimization of Citrulline Assay The enzyme is saturated at between 100 M and 1 mM substrate (ADMA) and we therefore use 1mM ADMA in all studies. We co mpared 4 different homogenization buffers and found sodium phosphate buffer, pH=6.5, was without effect on color formation (Table 5-3). Without deproteinization both BSA and the kidney homogenate caused turbidity. 4% sulfosalicylic acid gave the lowest blank absorb ance and was used for deproteinization (Table 51). With deproteinization, there was no background color with BSA although the kidney homogenate still had high color, suggesting th e presence of interfering factors. Effect of Urea on Citrulline Assay As shown in Figure 5-1, the high background color seen in the deproteinized kidney homogenate was reduced by >95% at t=15min afte r incubation with urease. Added urea: 1, 5, 10, 50, and 100 mM gave color equivalent to ~21, 49, 106, 195, and 221 M L-citrulline, respectively but gave no background color at t=0 when pre-incubated with urease for 15 min. After pre-incubation with ur ease, citrulline production in kidney and other tissue homogenates incubated with 1mM ADMA was linea r from 0 to 120 min (Figure 5-2). Without urease treatment, the high background color due to urea obscures DDAH-dependent L -citrulline formation until ~ t=45min (Figure 5-3). We used a 45min incubation in subsequent studies.

PAGE 66

66 Comparison of Dimethylarginine Dimeth ylaminohydrolase Activity Measured by Citrulline Accumulation with Asymme tric Dimethylarginine Consumption In kidney cortex the rate of production of L-citrulline = 0.3976 M / g protein/min and the corresponding rate of consumption of ADMA =0.4378 M /g protein/min are similar (Figure 54), suggesting that this assay gives a faithful measurement of DDAH activity. Tests for Other Pathways That Coul d Alter Citrulline Concentration Further, when we measured the rate of ADMA degradation under the same assay conditions, we found that at t=0, 30, 45, 90 and 120min the L-argini ne concentration was stable (89, 85, 87, 85, and 91 M respectively), suggesti ng no net synthesis of arginine. This constancy of L-arginine also suggested th at arginase activity was not ac tive under the conditions of this assay, a finding confirmed by the lack of eff ect of the arginase inhibitor (nor-NOHA; 0.01 0.5mM) when incubated with ur ease treated kidney homogenate for 45min (Figure 5-5). The renal cortex and medulla DDAH activity was 0.39.01 (n=15) and 0.30.01 (n=3) M/g protein/min, respectively. Interand intra-assa y coefficient of varia tion are 5.61.28 % (n=12) and 4.82.19 (n=9). The NO donors and superoxi de donor inhibited DDAH activity (Figure 56). Discussion We have used the Prescott-Jones method to measure kidney DDAH activity from rate of Lcitrulline production and found: Urea markedly raises background and must be removed; deproteinization is essential and the choice of deproteiniza tion method influences background color; the modified method correlates well with rate of ADMA consumption, and both superoxide and NO, known to i nhibit DDAH activity, produce declin es in rate of Lcitrulline formation in kidney homogenates.

PAGE 67

67 Knipp and Vasak (73) adapted the Prescott -Jones assay to a 96-well plate method for measurement of activity of the purified DDAH enzy me. However, in complex tissues there may be agents that reduce or increase color devel opment and alter Lcitrulline metabolism. Of particular note, the development of color is not sp ecific for L-citrulline but also occurs with urea (46) and there is a urea concentration gradient in kidney (~4mM in cortex and ~20mM in inner medulla) (114). Even in renal cortex, urea accounts for more th an 90% of baseline absorbance, and therefore obscures DDAH-induced changes in color due to citrul line formation. In the presence of urease, the effect of urea (up to 100mM) can be completely removed from kidney cortex and medulla. Kulhanek et al. (78) reported that urease treatment was not required for citrulline assay in liver and brain. Our re sults, however, demons trate that where urea concentration is measurable, urease should be us ed. Although the urea effect can be prevented by initial ion-exchange chromatograp hy (103), this is more costly and time consuming compared to urease. Another difficulty is that the DAMO reagent can detect protein-bound L-citrulline as well as free L-citrulline. Although no separate protei n-removing step was requi red in the purified enzyme system (73), in tissues, protein prec ipitation is mandatory. We found that 4% sulfosalicylic acid gave lowest background. Buffer/additives also influence color devel opment, for example 2-mercaptoethanol (in HB2) reduces color formation which might e xplain our observation of a higher renal DDAH activity than a previous study using HB2 (68). Without ureas e treatment, the high background color due to urea obscures DDAH-dependent L -citrulline formation until ~ t=45min, which might also explain the longer incubation time used previously (26, 126, 162).

PAGE 68

68 In addition to DDAH, ornithine carbamoy ltransferase (OCT) and NOS generate Lcitrulline. In this assay, activity of both enzymes can be ignored since OCT is not detectable in kidney and 1mM ADMA used as substrate is a potent NOS inhibitor. On the other hand, Lcitrulline can be converted to L-arginine by argininosuccinate s ynthase (ASS) and lyase (ASL). However, in tissue homogenate citrulline cons umption by ASS & ASL requires added aspartate (110) and ATP and we found no citrulline consumption under the conditions of our assay. Furthermore, arginases, which might indirectly increase L-citrulline consumption by increasing rate of Larginine utilization (28), are not active since arginase inhibition did not affect Lcitrulline formation and there was no L-arginine consumption. Both oxidative and nitrosative stress have b een reported to inhibit DDAH activity (71, 82) and in this study we show that both superoxide and NO donors have an ac ute inhibitory action on renal cortex DDAH activity, measured from Lcitrulline production. In conclusion, this colorimetric assay of L-citrulline accumulation is a simple and inexpensive method optimized for detection of re nal tissue DDAH activity in vitro, which agrees well with the more costly and time consumi ng method of measuring ADMA consumption. This can also be adapted for other ti ssues, even with low activity such as cerebellum, but should be optimized prior to use.

PAGE 69

69 Table 5-1. Effect of deproteinization reagents on absorbance of blank Absorbance 2mg/ml kidney homogenate without deproteinization 1.114.275 Sulfosalicylic acid 4% 0.227.006 10% 0.254.023 Trichloroacetic acid 10% 0.790.016a 20% 1.332.085a Sulfuric acid 4% 0.355.022 Hydrochloric acid 1N 0.357.011 All measurements were analyzed in triplicate. a The supernatant was opalescent. Reprinted with permission from Nature Publishing Group (132).

PAGE 70

70 Table 5-2. Effect of buffers and additives on the L-citrulline assay in the presence of 25 M Lcitrulline L-citrulline M Color as % of control Homogenization buffera HB1 17.0.8 68 HB2 100c 464 Buffer base 1% Triton 13.0.9 52 1M HEPES 27.5.4 110 0.3M sucrose >100 500 0.9% normal saline 24.6.6 98 0.1M sodium phosphate 24.9.6 100 100mM urea >100 1419 Additives 0.1M DTT >100 384 1% 2-mercaptoethanol 100c 415 Protein with deproteinization 1 mg/ml BSA 26.1.8 107 2 mg/ml BSA 25.7.8 103 1 mg/ml kidney homogenate 63.4.1 253 2 mg/ml kidney homogenate 82.6.2 330 The values reflect effect of an additive on the color generated by a 25 M L-citrulline standard (taken as 100%). a HB1, pH=6.8 contained 20 mM Tris, 1% Tr iton X-100, 5 mM EDTA 10 mM EGTA, 2mM DTT, 1 mM sodium orthovanadate, 0.1 mg /ml phenylmethylsulfonyl fluoride, 10 g/ml leupeptin and aprotinin; HB2 contained 0.1M sodium phosphate, pH =6.5 containing 2mM 2mercaptoethanl (66); HB3 contained 0.1M s odium phosphate, pH=6.5; and HB4 was RIPA buffer (Santa Cruz), containing 20 mM Tris, pH=7.6, 137mM sodium chloride, 0.2% Nonidet P40, 0.1% sodium deoxycholate, 0.02% SDS, 0.0008% sodium azide, and pr otease inhibitors. b Protease inhibitors: 0.1 mg/ml phenylmethyl sulfonyl fluoride, 10 g/ml leupeptin and aprotinin. c The supernatant was opalescent. Reprinted with permission from Nature Publishing Group (132).

PAGE 71

71 Table 5-3. Recommend assay procedures/conditi ons for the measurement of renal cortical DDAH activity 1. Homogenize tissue with 5X sodium phosphate buffer, pH=6.5 2. Adjust protein concentration to 20mg/ml 3. Pre-incubate urease (100U/ml homogena te) with tissue ho mogenate in 37C water bath for 15min 4. Add 100 l sample to 400 l 1mM ADMA in sodium phosphate buffer respective blank is sample omitting ADMA 5. Incubate mixture in 37C water bath for 45min 6. Stop reaction by addition of 0.5 ml of 4% sulfosalicylic acid 7. Vortex and centrifuge at 3,000g for 10min 8. Add 100 l supernatant into a 96-well plate in triplicate 9. Serially dilute 100 M L-citrulline standard to 0, 3.125, 6.25, 12.5, 25, 50, and 100 M 10. Add 100 l of standard into the 96-well plate in triplicate 11. Mix one part of oxime reagent with 2 parts of antipyrine/ H2SO4 reagent to make the color mixture 12. Add 100 l of color mixture into the wells 13. Cover the plate with a sealing tape 14. Shake on a plate shaker for 1min 15. Incubate the plate in 60C wate r bath for 110 min in the dark 16. Cool the plate in an ice bath for 10min Reprinted with permission from Nature Publishing Group (132).

PAGE 72

72 Incubation time, min 020406080100 Color formation in cit equivalents, microM 0 20 40 60 80 100 Without urease With urease Figure 5-1. Time course of the urea effect on color formation w ithout substrate (ADMA) in the absence (solid circle) and presence of urease (open circle). Each time point determined in triplicate. Reprinted with permission from Nature Publishing Group (132).

PAGE 73

73 Incubation time, min 020406080100120microM Cit/g protein 0 10 20 30 40 Kidney cortex Liver Cerebellum Aorta Figure 5-2. Time course of DDAH ac tivity in different rat tissues: kidney cortex (solid circle), liver (open circle), cerebellum (inverted solid triangle), and ao rta (open triangle). Each time point determined in triplicate Reprinted with permission from Nature Publishing Group (132).

PAGE 74

74 Incubation time, min 020406080100 Color formation in cit equivalents, microM 0 20 40 60 80 Without urease With urease Figure 5-3. Time course of color formation in ci trulline equivalents in the presence of the DDAH substrate (ADMA) in the absence (solid circ le) and presence of ur ease (open circle). Each time point was determined in triplica te. Reprinted with permission from Nature Publishing Group (132).

PAGE 75

75 Incubation time, min 020406080100120140 Cit formation microM/g protein 0 10 20 30 40 50 60ADMA consumption microM/g protein 0 10 20 30 40 50 60 Cit formation ADMA consumption Figure 5-4. Correlation of L-citru lline formation as a measure of DDAH activity (solid circle, solid line) with the rate of ADMA consump tion (open circle, dashed line). Reprinted with permission from Nature Publishing Group (132).

PAGE 76

76 ControlNor-NOHADDAH activity micro M/g protein/min 0.0 0.1 0.2 0.3 0.4 Control 0.01mM 0.1mM 0.5mM Figure 5-5. The effect of arginase on the L -c itrulline assay to detect renal DDAH activity. NorNOHA was used as arginase inhibitor. All m easurements were analyzed in triplicate. Reprinted with permission from Nature Publishing Group (132).

PAGE 77

77 ControlNONOateNitriteDMNQDDAH activity microM Cit/g protein/min 0.0 0.1 0.2 0.3 0.4 Control 0.1mM 1mM * *# # # Figure 5-6. The effect of NO a nd superoxide on the L-citrullin e assay to detect renal DDAH activity. DEA NONOate and nitrite were us ed as NO donors; and DMNQ was used as superoxide donor. All measurements were in triplicate. *p<0.05 vs. control; #p<0.05 0.1mM vs. 1mM. Reprinted with permissi on from Nature Publishing Group (132).

PAGE 78

78 CHAPTER 6 VITAMIN E REDUCES GLOMERULOCLEROSIS, RESTORES RENAL NEURONAL NITRIC OXIDE SYNTHASE, AND SUPPRE SSES OXIDATIVE STRESS IN THE 5/6 NEPHRECTOMIZED RAT Introduction Chronic kidney disease (CKD) is accompanied by oxidative stress and nitric oxide (NO) deficiency (10, 95). In CKD, oxidative stress results from increased production of reactive oxygen species (ROS) as well as decreased antioxidant enzyme capacity. The major ROS is superoxide and in kidney this is said to be mainly generated by NADPH oxidase (44). NO deficiency in CKD has many causes including in activation of NO by oxida tive stress; inhibition of NOS enzyme activity by increased levels of endogenous inhibitors and in kidney there is reduced neuronal nitric oxide synthase(nNOS ) enzyme abundance/activity (10, 95, 150). Because superoxide (O2 -) and NO have counterbalancing acti ons and reciprocally reduce each others bioavailability, an imbalance of NO and superoxide may shift the kidney toward a state of O2 dominance causing renal vasoconstrictio n, enhanced tubular sodium reabsorption, increased cell and extracellular matrix prolifer ation and CKD progression (95). Therefore, antioxidants have been considered for prev ention of CKD progressi on by reducing oxidative stress and/or preservi ng NO bioavailability. Vitamin E is a potent, naturally occurring li pid-soluble antioxidant that scavenges ROS and lipid peroxyl radicals. The most activ e and predominant form of vitamin E is -tocopherol and this has been used therapeutically in ma ny conditions although the impact of vitamin E on CKD progression is controvers ial (5, 19, 22, 45, 50, 69, 111, 147). In this study we investigate the impact of the 5/6 renal ablation model on re nal nNOS isoform abundance and also whether the protective effects of vitamin E therapy ar e associated with preservation of renal nNOS abundance and reduction in NADPH-dependent superoxide generation. The endogenous NOS

PAGE 79

79 inhibitor asymmetric dimethyl arginine (ADMA), generated by type I protein arginine methyltransferase (PRMT) and metabolized by dimethylarginine dimethylaminohydrolase (DDAH), is increased in CKD (10). In this st udy we also determined the impact of vitamin E treatment on the circulating le vel of ADMA and on PRMT1 abunda nce as well as abundance and activity of DDAH. Materials and Methods Studies were conducted on 17 male Sprague Da wley rats (12 week-old) purchased from Harlan (Indianapolis, IN, USA). Rats were kept under standard conditions and fed rat chow and water ad libitum. All rats had baseline metabolic cage measurements and were subjected to either sham surgery or 5/6 NX. 5/6 NX was performed under isoflurane general anesthesia using full sterile technique. By retroperiton eal approach, 2 poles of the left kidney were removed and then one week later the right kidney was removed. All rats were assi gned to the following groups at the time of the first surgery: Group 1 (sham, n= 6), sham-operated rats kept on regular rat chow (powdered) and tap water; Group 2 (5/6 NX, n=6) 5/6 NX rats maintained on regular rat chow and tap water; and Group 3 (5/6NX + VitE, n=5), 5/6 NX rats treated with vitamin E supplementation (Sigma Diagnostics, St. Louis, MO, USA) of regular rat chow containing tocopherol 5000 IU/kg of chow, be gun at the polectomy surgery. In all rats, 24h urine was collected in me tabolic cage for measurement of protein by Bradford method and total NO production (from NOx =NO3 +NO2 -) by Greiss reaction every other week after surgery. Rats were followed fo r 15 weeks after surgery and then sacrificed. At sacrifice, blood pressure was measured via abdo minal aorta then an aortic blood sample was collected for measurement of plasma creatinin e, ADMA, and NOx levels. The left kidney remnant was perfused blood free with cold PBS, removed and a section placed in 10% buffered formalin for pathology and the remainder separate d into cortex and medulla, flash frozen in

PAGE 80

80 liquid nitrogen and stored at C for analysis of NOS protein and superoxide. Plasma and urine creatinine levels were measured by HPLC as described in chapter 2. eNOS, nNOS nNOS PRMT1, DDAH1, and DDAH2 protei n abundances were detected by Western blot. ADMA levels were measured in plasma using reverse-phase HPLC with the Waters AccQ-Fluor fluorescent reagent kit as desc ribed in chapter 2. Renal DDAH activity was measured by a colorimetric assay measuring the ra te of citrulline production, as optimized by us in chapter 5 (132). NADPH-dependent O2 production was measured by Electron Spin Resonance (ESR) spectroscopy with hydroxylamin e spin probe 1-hydroxy-3-carboxypyrrolidine (CPH) as described in chapter 2. Pathology was performed on 5 micron sections of formalinfixed kidney, blocked in para ffin wax, stained with PAS. Statistical analysis: Results are presented as mean SEM. Parametric data was analyzed by unpaired t test and 1-way ANOVA. Histologic (non-parametric) data were analyzed by MannWhitney U test. P<0.05 was consider ed statistically significant. Results As shown in Table 6-1, 5/6 NX + Vit E group had higher body weight (similar to shams) vs. 5/6 NX group at 15th weeks after renal mass reduction, whereas the BWs were similar between all 3 groups prior to surgery (Sha m: 429g; 5/6 NX: 435g; 5/6 NX + Vit E: 449g). Left kidney weights and the ratio of KW/BW were higher in 5/6 NX rats than in shams due to compensatory hypertrophy, while values were intermediate in 5/6 NX + Vit E group and were not different from sham. Rats with 5/6 NX remained normotensive and blood pressure was similar in all groups. Plasma creatinine and urine protein excretion were increased similarly, and CCr was similarly reduced, in both 5/6 NX groups co mpared to sham (Table 6-1). As shown in Figure 6-1, however, the appearance of the prot einuria was delayed by ~2 weeks in the 5/6 NX +Vit E group (week 6) compared to the 5/6 NX rats (week 4). The total number of damaged

PAGE 81

81 glomeruli (all levels of injury) was 10 % in sh ams, which is normal for this strain and age (38, 130), and greater in both 5/6 NX groups (5/6 NX: 40 %, p<0.01; 5/6 Nx + VitE: 24 %, p<0.01). The total injury was also greater in the untreated 5/6 NX group vs the 5/6 NX + vit E (p=0.01). As shown in Figure 6-2, there were more damaged glomeruli at 1+, 2+, and 4+ levels of severity in the 5/6 NX group vs. sham, while onl y the 2+ injury severity was greater in 5/6 NX + VitE group vs. sham. In genera l the severity of injury was intermediate in the 5/6 NX + VitE between shams and 5/6 NX but was significantly le ss (p<0.05) compared to 5/6NX at the 4+ level. The 5/6 NX group also showed incr eased renal cortex NADPH-dependent O2 production vs. sham (Figure 6-3) which was completely prevented by vitamin E therapy. As shown in Figure 6-4, the 24h UNOxV fell in a ll groups with time and at 14 weeks after surgery there was a greater reduction in both 5/6 NX groups vs. shams, suggesting that CKD contributed to the reduced total NO independent of the age effect. This was supported by the lower plasma NOx in both NX groups (expressed as a ratio factored for crea tinine to eliminate an effect of reduced renal clearance) of 0.12.02, 5/6 NX & 0.11.01, 5/6 NX + Vit E vs. 0.31.06 for shams (both p=0.01 vs sham). By Western blot we found no difference in e NOS abundance in renal cortex and medulla among 3 groups (Figure 6-5A). Furthe r, there was no difference in nNOS abundance in renal medulla, however, renal cortex nNOS abundance was lower in the 5/6 NX group than sham, and this reduction was prevented by vitamin E therapy (Figure 6-5B). Using the C-terminal antibody we found that nNOS is decreased while there is an increased nNOS abundance following injury (Figure 6-6) Both 5/6 NX groups showed similar increases in plasma ADMA concentration (5/6 NX: 0.35.06 and 5/6 NX +Vit E: 0.28.05 M, respectively) vs. sham (0.17.02 M, both

PAGE 82

82 p<0.05). Renal cortex PRMT1 abundance was highe r in both 5/6 NX group vs. sham (Figure 67A). We found no difference in DDAH1 and DDAH2 abundance in renal cortex among 3 groups (Figure 6-7B &C), but in contrast, re nal cortex DDAH activity wa s lower in both 5/6 NX groups than sham (both p<0.05) and was not influenced by vitamin E treatment (sham: 0.41.01; 5/6 NX: 0.34.02; and 5/6 NX +Vit E: 0.36.02 M citrulline formation/g protein/min). For the DDAH2 Western blot ma ny non-specific bands were detected. In the presence of neutralizing pep tide, however, only the DDAH2 band (~30 kDa) was competed (Figure 6-8). Discussion The novel finding in this study is that long-te rm vitamin E administration prevents the increased NADPH-dependent supe roxide generation and reducti on in renal cortical nNOS abundance, in the 5/6 NX model of CKD. Sin ce both reduced renal nNOS and increased renal superoxide are viewed as pat hogenic in progression of CKD, this likely accounts for the protection against structural damage seen with vitamin E supplementation. This is the first time we have used the 5/ 6 NX model of CKD. In this model the right kidney is removed and the 2 poles of the left kidn ey are cut off leaving a true 1/6 remnant. With 5/6 NX the rat remains relatively normotensive, whereas in the 5/6 A/I model (which involves infarction of 2/3rds of the left kidney, leaving large amounts of scar tissue) BP increases rapidly and exacerbates the CKD due, at least in part, to greater activity of the renin, angiotensin, aldosterone system (60). In the present study we found no difference in BP between shams or 5/6 NX groups although we only obtained a terminal BP, under anesthesia which may not reflect the awake values. However, Griffin et al. (48) us ed telemetry for conscious BP measurement and also reported that rats with 5/6 NX remained nor motensive over 15 wk (48). Another factor that could contribute to the lack of hypertension in the 5/6 NX mode l, vs. the 5/6 A/I is that

PAGE 83

83 medullary nNOS is unchanged with NX, but fell with A/I (130). There is considerable evidence to suggest that loss of medullary NO can l ead to salt sensitive hypertension (131). The abundance of eNOS in rena l cortex was unchanged by 5/6 NX vs. control. In other CKD models renal eNOS abundance is incr eased, reduced and unchanged depending on the primary insult which suggests that the eNOS varies secondary to th e injury (10). In contrast, we observe that the renal cortex nNOS abundan ce decreased in 5/6 NX induced CKD as we previously reported in 5/6 A/I (130), accelerated 5/6th A/I (high sodium and protein intake), chronic glomerulonephritis (153), chronic purom ycin aminonucleosideinduced nephrosis (PAN) (38), diabetic nephropathy (37), and aging (40). This rein forces our hypothesis that renal cortex nNOS abundance is a primary marker of renal injury (130). The treatment arm of this study involved antioxidant therapy with Vitamin E ( tocopherol) given in the diet (5000 IU/kg chow). In previous studi es this dose has been shown to significantly increase plasma -tocopherol levels in 5/6 NX rats at 6 weeks and in the aging rat after 9 months of treatment (111, 151). We observed that the treatment with vitamin E significantly reduced the degree of kidney structural damage in the 5/6 NX rats. This is in agreement with earlier studies th at showed a reduction in glomer ulosclerosis with vitamin E therapy in 5/6 NX rats (50, 151). However, ther e was no improvement in renal function, as assessed by 24h CCr and this also agrees with other observations where vitamin E did not improve renal function in the renal mass reduc tion models after 2-3 weeks (22, 48). Although slightly delayed in appearance, the proteinu ria was not reduced by vitamin E despite the concurrent reduction in severity and extent of glomeruluoscleros is. This perhaps reflects the relatively mild protective effect of vitamin E at this time point. Neve rtheless, prevention of structural damage is of benefit and long term (9 months) high dose vitamin E supplements were

PAGE 84

84 able to improve structure, decr ease proteinuria, and improve function (111). Importantly, this was achieved without increased mortality. It shou ld be noted, however, that a meta-analysis of 136,000 subjects in 19 clinical trials suggested that high-dosage (> 400 IU/d) vitamin E supplements increased all-cause mortality in man (94); limiting the utility of this therapy in man. Our rationale for use of vitamin E therapy was based on its known antioxidant properties and the protective effects on CKD progression ar e presumably by decreasing oxidative stress. Vitamin E acts as a scavenger of ROS/RNS and lip id peroxyl radicals a nd most studies on CKD have measured lipid peroxidation products or antioxidant enzymes (48, 111, 147). Lipid peroxidation is certainly a mark er of redox imbalance due to ex cess superoxide but could be associated with either decreased or increased NO bioavailability. Meas urement of antioxidant enzyme activity/abundance can be misleading sin ce both decreased (presumably primary) and elevated (presumably secondary, compensatory) ch anges have been correlated to oxidative stress in CKD (106). Because NADPH oxi dase is the major source of ROS in kidney (44), we used NADPH-dependent superoxide pr oduction as a marker of oxid ative stress. A previous study reported that renal NADPH oxidase expression in creased in 5/6 NX rats (151) and our data confirm this. The novel finding in the present st udy is that vitamin E treatment completely prevents this increased kidney cortex NADPH oxidase-dependent superoxide production in 5/6 NX rats. While conventional wisdom holds that vitamin E exerts its antioxidant effects by scavenging harmful radicals, it also inhibits pr otein kinase C dependent events, which include NADPH oxidase assembly (7, 22). As pointed out by Vaziri (150) the best strategy for prevention of oxidative stress is to identify and inhibit the source of the ROS. Thus, in situations where increased NADPH oxidase is the source of damaging ROS, vitamin E is likely to be

PAGE 85

85 highly effective. It is also worth pointing out th at the deleterious effects of high dose vitamin E in clinical studies probably relate to its non radical scavenging actions (150). In addition to reducing NADPH oxidase depend ent superoxide production, vitamin E also reverses the decline in renal nNOS abundance. We have re peatedly found that development of renal structural injury in divers e models of CKD is associated w ith decreases in the renal cortex nNOS abundance (10). Here we ag ain see an association between injury and renal cortex nNOS abundance, in yet another model of CKD, reinfo rcing our earlier sugges tion that cortex nNOS abundance is a marker of renal injury (130) and that decreased nNOS abundance is also a potential mediator of injury. Since in this study vitamin E not only reduces renal cortex superoxide production but also preserves nNOS abundance (and presumably activity), vitamin E helps to restore the local balance between NO an d superoxide in kidney. We cannot tell whether vitamin E has a direct action on the nNOS or wh ether this is a consequence of the injuryprevention. We used plasma and urine NOx levels as in dices of total NO production, and vitamin E did not reverse the reduction in total NO production due to 5/6 NX. In contrast to vitamin E, tempol increased total NO production in this model ( 151) which may be due to tempolinduced inactivation of superoxide which cannot be directly achieved by v itamin E. Despite the lack of vitamin E effect on total NO produc tion, renal cortical nNOS was re stored. It is important to note, however, that renal NO production represents just a small fraction of total NO and we have several times observed dissociation between tota l and renal NO production in different forms of CKD (37, 38, 41). In fact it is likely that a pers istent decline in overall NO generation will occur despite vitamin E therapy since the elevation in plasma ADMA concentration seen in 5/6 NX rats was not prevented by vitamin E.

PAGE 86

86 The lack of reduction of plasma ADMA by vitamin E was unexpected since decreasing ROS should boost DDAH activity and thus lowe r ADMA (10, 61). Vitamin E was reported to lower ADMA levels in CKD patients (115). However, the renal DDAH enzymes play an important role in ADMA degradation and in this 5/6 NX model it is possible that such severe reduction in renal mass irreversibly impaire d ADMA breakdown. Indeed, our data suggest increased ADMA production (secondary to incr eased PRMT1 abundance) and decreased ADMA degradation (secondary to decreased DDAH activ ity), which was not prevented by vitamin E therapy. Matsuguma and colleagues have recen tly reported increased renal PRMT1 gene expression at 12 weeks after 5/6 NX although th ey also reported decreased DDAH1 and 2 protein expression (90). In cont rast to our finding that DDAH1 and 2 protein abundance was unaltered in 5/6 NX rats; however, we do observe decreased renal DDAH activity. In conclusion, long-term vitamin E therapy redu ces structural damage in rats subjected to 5/6 NX and protection is associat ed with a direct action to inhibit NADPH oxidase-dependant superoxide production. As with ot her models renal cortex nNOS abundance was reduced with injury in 5/6 NX rats, and was preserved by vitamin E therapy. However, increased nNOS abundance in 5/6 NX rats sugge sts the upregul ation of nNOS in response to renal injury. The renoprotective effect of vitamin E is likely via both reducing supe roxide production and preserving renal NO generation. However, vitamin E had no effect on plasma ADMA levels and renal ADMA related enzymes.

PAGE 87

87 Table 6-1. Measurements at 15 wk after surgery Sham 5/6NX 5/6NX + Vit E Body weight (g) 533 492 535# Kidney weight (g) 1.50.07 2.40.14* 2.12.43 Kidney weight/body weight (%) 2.82.18 4.94.40* 3.99.86 Blood pressure (mmHg) 91 82 81 Plasma creatinine (mg/dl) 0.38.02 2.10.62* 1.80.41* CCr/BW (ml/min/kg BW) 6.5.4 1.5.3* 1.5.2* Proteinuria (mg/24hr) 38 72* 100* Values are means SE; CCr, 24hr clearance of creatinine; *, p<0.05 vs. Sham; #, p<0.05 vs. 5/6NX. Reprinted with permission from the Am erican Physiological Society (133).

PAGE 88

88 Week 0246810121416 Proteinuria (mg/24hr) 0 20 40 60 80 100 120 140 160 180 Sham 5/6 NX 5/6 NX+ Vit E * * * Figure 6-1. Urinary protein excret ion at baseline (week 0) and during the 15 wk period after surgery in shams (solid circles), 5/6 NX (open circles) and 5/6 NX + Vit E (closed inverted triangles). *p<0.05 vs. Sham. Repr inted with permission from the American Physiological Society (133).

PAGE 89

89 Sclerosis severity (+1)(+2)(+3)(+4) % of glomerular sclerosis 0 2 4 6 8 10 12 14 16 18 Sham 5/6 NX 5/6 NX + VitE 1+ 2+ 3+ 4+ Degree of damage % Damaged Glomeruli*#* Figure 6-2. Summary of the % and severity of glomerulosclerosis on the 1+-4+ scale 15 weeks after surgery in shams (black column), 5/6 NX (gray column) and 5/6 NX + Vit E (dark gray column). *p<0.05 vs. Sham; # p<0.05 5/6 NX vs. 5/6 NX + Vit E. Reprinted with permission from the Am erican Physiological Society (133).

PAGE 90

90 Sham 5/6 NX 5/6 NX+Vit E superoxide pmol/mg/min 0 20 40 60 80 100 120 140 P<0.001P<0.001 Figure 6-3. Renal cortex NADPH-d ependent superoxide produc tion at 15 wk after surgery. Reprinted with permission from the Am erican Physiological Society (133).

PAGE 91

91 Week 0246810121416 UNOXV (uM/24hr/100g BW) 0.2 0.4 0.6 0.8 1.0 1.2 1.4 Sham 5/6 NX 5/6 NX+ Vit E * Figure 6-4. Total urinary NOx (NO3 +NO2 -) excretion at baseline (week 0) and during the 15 wk period after surgery in shams (solid circles), 5/6 NX (ope n circles) and 5/6 NX + Vit E (closed inverted triangle s). *p<0.05 vs. Sham. Reprinted with permission from the American Physiological Society (133).

PAGE 92

92 IOD/Ponceau Red/Std 0 5e-6 1e-5 2e-5 2e-5 Cortex IOD/Ponceau Red/Std 0 1e-5 2e-5 3e-5 4e-5 5e-5 MedullaSham 5/6 NX 5/6NX+ VitESham 5/6 NX 5/6NX+ VitE CortexMedullaSham 5/6 NX 5/6NX+ VitESham 5/6 NX 5/6NX+ VitE IOD/Ponceau Red/Std 0 2e-6 4e-6 6e-6 8e-6 1e-5 IOD/Ponceau Red/Std 0 1e-5 2e-5 3e-5 4e-5 5e-5 P=0.02 P=0.017A B Figure 6-5. NOS protein expression in sham and 5/6 NX rats at 15 wk after surgery. A) Relative abundance of renal cortex and medulla endothe lial nitric oxide s ynthase (eNOS). B) Relative abundance of renal cortex and medulla neurona l nitric oxide synthase (nNOS). Reprinted with permission from th e American Physiological Society (133).

PAGE 93

93 Sham5/6NXIOD/Ponceau Red/Std 0 5e-7 1e-6 2e-6 2e-6 *nNOS nNOS Sham5/6NXIOD/Ponceau Red/Std 0 1e-7 2e-7 3e-7 4e-7 5e-7 6e-7 *AB C Sham5/6NXIOD/Ponceau Red/Std 0 2e-6 4e-6 6e-6 8e-6 1e-5 *nNOS Figure 6-6. Densitometry showing abundance of nNOS and nNOS in renal cortex of sham and 5/6 NX rats studied 15 wks after surgery. A) nNOS using the C-terminal nNOS antibody. B) nNOS using the C-terminal nNOS antibody. C) nNOS using the Nterminal antibody. *p<0.05 vs. sham.

PAGE 94

94 A Sham 5/6 NX 5/6NX+ VitE PRMT1 ~42kDa PRMT1 abundance Sham5/6NX5/6NX + VitEIOD/Ponceau Red/Std 0.0 2.0e-6 4.0e-6 6.0e-6 8.0e-6 1.0e-5 1.2e-5 kDa 50 40 30 B DDAH1 abundance Sham5/6NX5/6NX + VitEIOD/Ponceau Red/Std 0 2e-7 4e-7 6e-7 8e-7 1e-6 Sham 5/6 NX 5/6NX+ VitE kDa 50 37 25 DDAH1 ~34kDa C DDAH2 abundance Sham5/6NX5/6NX + VitEIOD/Ponceau Red/Std 0.0 2.0e-7 4.0e-7 6.0e-7 8.0e-7 1.0e-6 1.2e-6 Sham 5/6 NX 5/6NX+ VitE kDa 75 50 37 25 DDAH2 ~30kDa Figure 6-7. ADMA-related enzyme expression in renal cortex at 15 wk after surgery. A) PRMT1. B) DDAH1. C) DDAH2. Representati ve western blots of whole membranes show PRMT1 (~42kDa), DDAH1 (~34 kDa) and DDAH2 bands (~30 kDa). *p<0.05 vs. sham. Reprinted with permission from the American Physiological Society (133).

PAGE 95

95 kDa 100 75 50 37 25DDAH2 ~30kDa DDAH2 DDAH2 + 20X peptideKC KM KCKC KM KCAB Figure 6-8. Immunoblots of rat kidney cortex (KC) and kidney medulla (KM) with DDAH2 antibody. A) In the absence of neutralizing pep tide. B) In the pres ence of neutralizing peptide. Reprinted with permission from the American Physiol ogical Society (133).

PAGE 96

96 CHAPTER 7 SEX DIFFERENCES IN NITRIC OXIDE, OXIDATIVE STRESS, AND ASYMMETRIC DIMETHYLARGININE IN 5/6 ABLATION/INFARCTION RATS Introduction As discussed in previous chap ters, nitric oxide (NO) defici ency occurs in humans and animals with chronic kidney disease (CKD) and may contribute to the pr ogression (10). A higher constitutive nitric oxide synt hase (NOS) expression was noted in young female rat kidney than that in male and a decrease in NO production in aging male rat but not in aging female (11, 100). This suggests that the ability to preserve renal NO might contribut e to the relative protection of females against progression of renal damage. Possible mechanisms of NO deficiency in CKD include decline in NOS expression, inactivation of NO and NOS by oxidative stress and inhibition by endogenous NOS inhibitors, such as asymmetric dimethylarginine (ADMA). We found that renal cortical neuronal nitric oxide synthase(nNOS ) expression decreased markedly with injury and correlated to decreased NOS activity in various rat CKD models (10), such as the renal mass reduction model, 5/6 ablation infarction (A/I) ( 130). We have also found that another nNOS isoform, nNOS increases in response to loss of nNOS in the transplanted kidney and that this may be associated with protection from progression of CKD (chapter 4). In this study we investigated the renal nNOS isoforms, nNOS and in the 5/6 A/I model to determine whether sex-dependent differences in isoform abundance might correl ate with the severity of renal injury. Oxidative stress, another mechanism causing NO deficiency, is associated with the progression of CKD (148). We have shown th at vitamin E prevents the increased NADPH oxidase-dependent superoxide (O2 -) production and reduction of renal nNOS abundance in a 5/6 nephrectomy (NX) model in Chapter 6 (133). Because p22phox is a major regulatory subunit of NADPH oxidase and its expression is corre lated to NADPH activity (44), because O2 is

PAGE 97

97 converted to hydrogen peroxide by superoxide dismutase (SOD), and because increased ROS causes lipid peroxidation and tissue in jury, we have evaluated renal p22phox, plasma malondialdehyde (MDA), and urine hydrogen peroxide levels to elucidate the impact of sex on the regulation of reactive oxygen sp ecies (ROS) metabolism and NO. In addition to oxidative stress renal NOS ac tivity can be inhibited by ADMA. Both ADMA and symmetric dimethylarginine (SDMA) are di methylarginines generate d by protein arginine methyltransferases (PRMTs) and PRMT1 is specific for ADMA production. Only ADMA (not SDMA) is metabolized by dimethylarginine di methylamino-hydrolase (DDAH) in the kidney, liver etc (27). We have previously shown that increased PRMT1 expression and decreased renal DDAH activity were associated with the accumula tion of ADMA in 5/6 NX rats (133). Here we investigated the impact of sex on dimethyl arginine metabolism in this A/I model. Materials and Methods Studies were conducted on 16 male and 15 female Sprague-Dawley (SD) rats from Harlan (Indianapolis, IN, USA) at age 10 to 12 weeks. Rats were allowed ad libitum access to tap water and standard rat chow. A/I surg ery was performed by removal of the right kidney and infarction of 2/3 of the left kidney by ligation of branches of the left renal artery. Rats were assigned to the following groups: male sham (N = 6); male A/I (N=10); female sham (N=5), and female A/I (N=10). Rats were sacrificed 7 weeks after su rgery. All surgical pro cedure was done using full sterile technique. Twenty-fourhour urine was collected in metabol ic cages for measurement of protein by Bradford method before surgery a nd every other week af ter surgery. Total NO production (from 24h urine NOx =NO3 +NO2 -) was measured by Greiss reaction before and 7 weeks after surgery. When rats were sacrificed, blood pressure was measured via abdominal aorta and a blood sample was taken for plasma creat inine, L-arginine and dimethylarginines, and NOx levels. A thin section of cortex was fixe d in 10% formalin for pathology and the reminder

PAGE 98

98 separated into cortex and medulla and stored at -80C for later analysis. Plasma and urine creatinine levels were measured by HPLC. Plasma MDA levels were determined by a modified fluorometric method for measuring thiobarbitu ric acid-reactive substances (TBARS) (157). Urine hydrogen peroxide levels were measured by Amplex Red Hydrogen Peroxide/Peroxidase Assay Kit (Molecular Probes, Eugene, OR). Plas ma L-Arginine and dimethylarginine levels were measured using reverse-phase HPLC with th e Waters AccQ-Fluor fluorescent reagent kit. More detailed descriptions of these an alyses were described in chapter 2. Western blot was used to analyze nNOS nNOS eNOS, PRMT1, DDAH1, DDAH2, and p22phox abundance in kidney and/or other ti ssues. DDAH activity was measured by a colorimetric assay measuring the rate of citru lline production, as described in chapter 5 (132). Whole blood was centrifuged at 2,000 rpm for 8min a nd after removal of plasma and buffy coat, RBC was washed by 2ml of normal saline, then ly zed by sonication (Fisher, dismembrator model 100, setting=8) for 3 cycles (10 second soni cation and 10 second rest). RBC lysate was centrifuged at 15,000 rpm for 10min at 4C, the RBC supernatant was collected and stored in 80C freezer until analysis. Tissue was homogenized in sodium phosphate buffer, pre-incubated with urease for 15 min, then 100 l (2mg for kidney cortex and liver; 6mg for RBC) of homogenate was incubated with 1mM ADMA fo r 45 min (kidney cortex) or 60min (for RBC and liver) at 37C. After deproteinization, supernat ant was incubated with color mixture at 60C for 110 min. The absorbance was measured by spectrophotometry at 466 nm. The DDAH activity was represented as M citrulline formation/g protei n/min at 37C. Histology was performed on kidneys and stained with periodic acid-Schiff kit (PAS, Sigma, St. Louis, MO) and examined for level of renal injury.

PAGE 99

99 Statistics: Results were presented as mean SEM. Data were analyzed by general linear univariate model using gender (Male vs. female) and injury (Sham vs. A/I) as fixed factors, followed by LSD post-hoc test for multiple comparisons. The Kruskal-Wallis and Pearson tests were for correlation, followed by the regression an alysis. Gender effect on the reduction of CCr and plasma NOx levels were analyzed by nest ed ANOVA. p< 0.05 was cons idered statistically significant. Results Data of Renal Outcome and Clinical Parameters As shown in Table 7-1, 7 weeks after A/I ma les had lower body weight (BW) vs. sham, whereas the BWs were similar in female sham and A/I rats and always lower that the males. Left kidney weight increased in the A/I groups and the left kidney weight to BW ratios were higher in both male and female A/I rats than shams, re flecting compensatory renal hypertrophy. In male A/I rats terminal BP was similar to shams wherea s BP was low in sham females and increased in females with A/I. The 24-hour urine protein excr etion was not different at baseline (before surgery) between sham and A/I groups within each sex, although males had a greater baseline urine protein excretion than females (male vs. female: 25 2 vs. 3 1 mg/day, p<0.05). Urine protein excretion increased in male A/I vs sham as early as the 2nd wk (41 9 vs. 16 2 mg/day, p<0.05) and female A/I rats also developed proteinuria which b ecame statistically significant at 6th wk (Table 7-1). The 24h urinary NOx excretion (factored for BW) was lower in females than males in both sham and A/I groups and did not fall significantly with A/I in either group. Plasma NOx (factored for creatinine to correct for differe nces in renal function) levels were lower in sham females vs males, decreased in both sexes with A/I with a greater reduction in males (63 4 % vs. 54 6 % reduction. p<0.001). Plasma creatinine le vels increased in both A/I groups, but

PAGE 100

100 less in females. The clearance of Cr (CCr) was lower in sham females than males, was reduced by A/I in both sexes with a greater % fall in males (90 2 % vs. 71 6 %, p<0.001) (Table 7-1). The % of damaged glomeruli was significantly increas ed in both A/I groups, to a lesser extent in female. Renal Neuronal Nitric Oxide Synthase Isoform Expression As shown in Figure 7-1A, the nNOS abundance in cortex was higher in sham females than males and fell significantly in male A/I ra ts, whereas female A/I rats maintained their nNOS abundance. To confirm this finding we ran 2 identical membranes probed with two different N-terminal anti-nNOS antibodies (Fig 7-1A, upper panel, Ab from Dr. Kim Lau (76) vs. lower panel, Santa Cruz Ab) and the re sults were comparable. In contrast, nNOS abundance in cortex was very variable in male A/I, tendi ng to increase but only rose significantly in females (Fig 7-1B). The cortical eNOS protein abundanc e was not different between 4 groups (Figure 71C). Since the rate of progression in the A/I model is quite variab le (depending on exact amount of infarct), we looked at the regression relati onship between renal nNOS isoform abundance and glomerular damage. As shown in Figure 7-2, the more severe th e glomerular sclerosis, the greater the decline in cortical nNOS abundance ( r = -0.554, p=0.001), but the greater the increase in nNOS abundance ( r = 0.408, p<0.05). We found the sa me general trends when comparing plasma creatinine and nNOS isoforms but the relationships were not so robust (data not shown). Reactive Oxygen Species Metabolism As shown in Fig 7-3A, there was no sex difference in renal cortical p22phox in shams and the abundance increased with A/I on ly in males. Both plasma MDA levels (a marker of lipid

PAGE 101

101 peroxidation) and urine hydrogen peroxide leve ls were similar in shams of both sexes and increased significantly in male A/I rats but not in females (Fig 7-3B &C). L-Arginine and Di methylarginines As shown in Table 7-2, plasma L-arginine levels were similar in shams and fell significantly in female A/I rats but not in male s. There were no sex differences in baseline (sham) values of plasma ADMA and SDMA and the only response to A/I was an increase of SDMA in males. However, the L-arginine to ADMA ratio, a determinant of systemic NO metabolism (13, 15), was significant ly decreased in both sexes with A/I and the L-arginine to ADMA ratio correlated directly with plasma NOx levels (Fig 7-4). In kidney cortex, L-arginine and SDMA levels were similar in shams but females had higher baseline ADMA levels vs. males. In response to A/I the L-arginine and ADMA levels in kidney cortex rose significantly in female A/I rats but did not change in males. Th ere was no effect of A/I on renal cortical SDMA levels in either sex. The L-arginine to ADMA ratio in kidney cortex was lower than that in the plasma in all groups. As shown in Table 7-2, the ratio significantly decreased in both sexes in response to A/I injury with a great er reduction in male A/I rats. Asymmetric Dimethylarginine Related Enzymes Renal cortex PRMT1 abundance was similar in shams and increased similarly with A/I in both sexes (Figure 7-5A). We also measured PRMT1 expression in the liver and found that female shams had higher abundance than males, a nd that liver PRMT1 increased in males but not females in response to renal injury (Figure 7-5B). There was no difference in DDAH1 abundance in renal cortex among 4 groups (Fig 7-5C), whereas DDAH2 expression was similar in both sham groups and fell similarly with A/I in both se xes (Figure 7-5D). Despite the similar falls in renal DDAH2 abundance, renal cortex DDAH activity was decreased only in male A/I rats however, absolute renal cortex DDAH activity was similar between the sexes after A/I (Fig 7-

PAGE 102

102 6A). DDAH activity in RBC and liver was lower in fe male sham than male sham (Fig 7-6B &C), however, female A/I rats maintained DDAH activit y, which was significantly decreased in male A/I groups. The RBC DDAH activity was co rrelated to renal DDAH activity ( r = 0.557, p< 0.05) (Figure 7-7). Discussion The novel finding in this st udy is that decreased nNOS and increased oxidative stress are associated with the worse renal outcome in ma le vs. female A/I rats. These sex differences possibly contribute to greater re noprotection of female rats agai nst A/I injury due to preserved renal NO bioavailability. Sex differences in NOS have previously been ob served in rats. Normal male rats displayed lower renal nNOS expression than females (18, 155) In the present study we specifically address the possible sexual dimorphism of the different nNOS isoforms in renal disease. Under baseline (sham) conditions we find that the male rat has lower renal nNOS abundance than females. This observation is similar to our prev ious finding in aged female SDs at 20 months of age who show little renal structural da mage and preserved nNOS abundance whereas male SDs have severe injury and marked falls in renal nNOS (40). In addition, male Wistar Furth (WF) rats are resistant to renal injury induced by A/I and P AN (38, 41), relative to male SD rats and show elevated baseline and only small falls in renal nNOS abundance in both models of CKD. Also, despite moderate falls in nNOS abundance, the WF actually also showed maintained or increased NOS activity in the soluble fraction of kidney cortex (38, 39, 41) suggesting that other nNOS isoforms may exist and be recruited in the kidney. At the time these studies were conducted we had not characte rized the presence of nNOS and nNOS proteins in the rat kidney and do not have data in the WF on the presence of nNOS However, we have now shown that these 2 isoforms exist in the normal SD kidney cortex (chapter 3) and also in the

PAGE 103

103 transplanted F344 kidney, where we found upregulation of renal cortical nNOS with CKDinduced reduction in nNOS which seemed to be protective (c hapter 4). In the transplant study, we demonstrated that nNOS is positively correlated with renal injury in contrast to nNOS In the present study a strong negative correlation between nNOS and nNOS suggests that an upregulation of renal cortical nNOS occurs with A/I-induc ed reduction in nNOS We also examined several markers of oxi dative stress and found that there were no differences between male and female shams a lthough the male A/I rats did exhibit enhanced oxidative stress in response to A/I injury, de tected by several measur es (renal cortical p22phox abundance, plasma MDA levels, and urine hydrogen pe roxide levels) while female A/I rats were resistant to ROS. Several studie s have reported that the male SHR produces more systemic ROS compared to the female, that this is testosterone dependent and contributes to the higher BP in males (42, 127). Whether other strains/species al so exhibit a sexual dimorphism in oxidative stress is not certain, although both pro-oxidant actions of testoster one and antioxidant actions of estrogen have been implicated in the cardiovas cular protection seen in pre-menopausal women (93, 116). Our study also suggests that there is a sex difference in renal oxidative stress, females protected since p22phox abundance is less in female rat kidney cortex after A/I. A similar finding has been reported in the renal wrap m odel where there is estr ogen-dependent protection of kidney damage associated with decreased NAPDH oxidase activity and decreased renal p22phox (64). Males kidneys are also at increased risk of injury due to oxidative stress in ischemia/reperfusion injury (67), polycystic kidney dis ease (89) and toxicity due to potassium bromate exposure (144). Our data suggest that in creased oxidative stress se en in the males with A/I is associated with decreased nNOS and that may predict the poor renal outcome in males. This is consistent with our previous study in the male showing increased NADPH oxidase-

PAGE 104

104 dependent O2 production and reduction of renal nNOS abundance in a 5/6 NX model, reversible with antioxi dant therapy (133). Protein turnover results in the release of free ADMA from protein-incoporated ADMA, and two counterbalancing pathways, type I PR MT and DDAH, control free plasma and tissue ADMA levels (146). Regarding ADMA and sex diffe rences, clinical data suggests that in young adult males and females plasma ADMA concentration is similar and that levels increase with age in both sexes but are delayed in the female (122). Otherwise, little is known about sex differences in abundance of ADMA and its regula ting enzymes. In the present study we found no sex difference in sham plasma ADMA levels in young adults although the in vitro red blood cell and liver DDAH activity was lower in females than males. Female shams also had higher PRMT1 expression in liver which would tend to promote increased ADMA formation. Thus, there was no obvious correlation between organ PRMT level/ DDAH levels/activity and plasma ADMA. Similarly, although sham females had higher renal cortical ADMA levels than males, renal PRMT1 and DDAH1 and 2 protein abundance, as well as DDAH activity were similar in sham males and females. Thus, neither rena l PRMT nor DDAH expression/activity can predict plasma or kidney ADMA levels. There is a report that plas ma ADMA may be controlled by DDAH activity of the whole blood (13) and DDAH1 expression has been detected in human RBCs (66). We were able to detect DDAH activity in rat RBC and found that it correlates with renal DDAH activity. This may provide a useful tool as a surrogate measur e of renal DDAH activity in patients with CKD. After A/I there was no increase in plasma ADMA level in either sex, which was unexpected given the findings of increased pl asma ADMA in end stage renal failure in man, although plasma ADMA is very variable in C KD (10). There was no change in renal ADMA

PAGE 105

105 levels in males with A/I but an increase was seen in females. As in the sham rats, there was no obvious correlation with the abundance of the ADMA regulatory enzymes since renal PRMT1 increased similarly, renal DDAH1 was unchanged a nd DDAH2 fell similarly in both sexes with A/I and liver PRMT1 increased only in males. It was unexpected that the tissue ADMA level was higher in the protected female kidney vs the male and that the renal and plasma Larginine/ADMA ratios were similar after A/I in both sexes. Of note, the changes in the Larginine: ADMA ratio in plasma and kidney in both sexes post A/I refl ected both changes in Larginine as well as ADMA levels. There is no sex difference in baseline plasma and renal SDMA levels although male A/I rats displayed higher plasma SDMA levels, whic h were correlated to greater loss of renal function. Our finding is supported by previous studie s showing that SDMA is a marker of renal function, which is predictable given that SDMA is excreted unmetabolised in the urine (14). Although SDMA is not a NOS inhibitor, it may comp ete with L-arginine to enter the cells and cause a decreased NO production (14). In conclusion, male A/I rats displayed a more rapid CKD progression associated with reduced renal nNOS abundance and increased oxidati ve stress. The decreased nNOS abundance was correlated to increased oxidative st ress markers suggesting that oxidative stress may inhibit nNOS expression in the kidney. Sex differe nces exist in nNOS expression, oxidative stress, and ADMA metabolism, reinforc ing the notion that sex specific treatment may be needed in CKD.

PAGE 106

106 Table 7-1. Renal outcome and clinical parameters Male sham N=6 Male A/I N=10 Female sham N=5 Female A/I N=10 p-value Body weight (g) 431 388* 250# 241# <0.001 Left kidney weight (g)/100g BW 0.43.03 0.58.03* 0.49.05 0.61.03* 0.002 Mean arterial pressure (mmHg) 123 108 88# 111* 0.01 UprotV (mg/day) 54 80 4 69 0.166 UNOxV ( M/24h/100g BW) 0.66 0.10 0.47 0.08 0.24 0.08# 0.07 0.05# <0.001 PNOx/Cr 0.91.05 0.34.04* 0.74.08# 0.34.04* <0.001 Plasma creatinine (mg/dl) 0.34.01 1.18.14* 0.30.03 0.87 0.08*,# <0.001 CCr/BW (ml/min/100g BW) 1.25.25 0.13.03* 0.68.19# 0.20 0.04* <0.001 GS % 6.83.34 38.82.24*4.00.83 31.18 3.79*,# <0.001 Values are means SEM; UprotV total urine protein excretion; PNOx, plasma nitrite plus nitrate levels; PCr, plasma crea tinine level; CCr, 24hr clearance of creatinine; GS%, total % of damaged glomeruli. *p<0.05 vs. sham, #p<0.05 vs. respective male.

PAGE 107

107 Table 7-2. L-arginine and dimethylarginine levels in plasma and kidney cortex Plasma N L-Arginine ( M) ADMA ( M) SDMA ( M) L-Arginine/ ADMA Male sham 6 117.6.6 0.37.07 0.26.04 328.2 39.5 Male A/I 10 101.1.2 0.48.06 0.53.07* 223.3 22.0* Female sham 4 150.4.5 0.54.13 0.35.04 322.1 83.4 Female A/I 10 82.4.3* 0.46.08 0.41.05 202.1 18.2* Kidney cortex L-Arginine (nM/mg protein) ADMA (nM/mg protein) SDMA (nM/mg protein) L-Arginine/ ADMA Male sham 5 3.67.20 0.09.02 0.05.00 44.1 7.05 Male A/I 5 3.61.34 0.13.01 0.07.03 29.9 4.79* Female sham 5 3.90.26 0.17.02# 0.06.01 22.9 1.63# Female A/I 5 5.14.15*# 0.27.02*# 0.07.00 19.0 0.76* *p<0.05 vs. sham, #p<0.05 vs. respective male.

PAGE 108

108 Sham A/I Sham A/I nNOS kDa 200 140 100 Male Female kDa 200 140 100 nNOS Male Female IOD/Ponceau Red/Std 0.0000 0.0001 0.0002 0.0003 0.0004 Sham A/I *# # Sham A/I Sham A/I nNOS kDa 200 140 100 Male Female Male Female IOD/Ponceau Red/Std 0 5e-7 1e-6 2e-6 2e-6 Sham A/I Sham A/I Sham A/I kDa 200 140 100 Male Female Male Female IOD/Ponceau Red/Std 0 5e-7 1e-6 2e-6 2e-6 Sham A/I eNOSA B C Figure 7-1. NOS isoforms expression in renal cort ex. A) Relative abundance of renal cortex neuronal nitric oxide synthase (nNOS ) by an N-terminal anti-nNOS Antibody (Kim Lau). Representative whole membranes show the nNOS (~160 kDa) band by 2 different N-terminal nNOS antibodies: Ki m Lau antibody (upper pa nel) vs. SC nNOS antibody (lower panel). B) Relative abundance of renal cortex neuronal nitric oxide synthase (nNOS ). C) endothelial nitric oxide synthase (eNOS). Representative membranes show nNOS (~140 kDa) and eNOS bands (~150 kDa). *p<0.05 vs. sham; #p<0.05 vs. respective male.

PAGE 109

109 Glomerulosclerosis % 0102030405060 nNOS alpha abundance 0.0000 0.0002 0.0004 0.0006 0.0008 0.0010 Male sham Male A/I Female sham Female A/I Glomerulosclerosis % 0102030405060 nNOS beta abundance 0 1e-6 2e-6 3e-6 4e-6 5e-6 6e-6 A B Figure 7-2. Correlation between gl omerular damage and nNOS is oform abundance. A) Relative abundance of cortical neuronal nitric oxide synthase (nNOS ; r= -0.554, p=0.001). B) nNOS (r= 0.408, p<0.05).

PAGE 110

110 Sham A/I Sham A/I kDa 40 30 20 Male Female p22phox ~22kDa Male Female IOD/Ponceau Red/Std 0.0 5.0e-7 1.0e-6 1.5e-6 2.0e-6 2.5e-6 Sham A/I Male Female Plasma MDA level microM 0.0 0.2 0.4 0.6 0.8 1.0 1.2 1.4 1.6 Sham A/I *# Male Female Urine hydrogen peroxide excretion nM/day 0 500 1000 1500 2000 2500 Sham A/I *A BC Figure 7-3. Biomarkers of oxidative stress in sham and A/I rats at 7 wk after surgery. A) Relative abundance of renal cortical p22phox.Representative western blot shows p22phox bands (~22 kDa). B) Plasma MDA levels (a ma rker of lipid peroxydation). C) Urine hydrogen peroxide levels. *p<0.05 vs. sham; #p<0.05 vs. respective male.

PAGE 111

111 Plasma NOx/Cr 0.00.20.40.60.81.01.2 L-Arginine/ADMA ratio 0 100 200 300 400 500 600 Figure 7-4. Correlation between Larginine to ADMA ratio and plasma NOx levels (r= 0.574, p=0.001).

PAGE 112

112 Sham A/I Sham A/I PRMT1 ~42kDa kDa 50 40 30 Male Female Male Female IOD/Ponceau Red/Std 0 1e-7 2e-7 3e-7 4e-7 5e-7 Sham A/I *A Sham A/I Sham A/I PRMT1 ~42kDa kDa 50 40 30 Male Female Male Female IOD/Ponceau Red/Std 0 2e-7 4e-7 6e-7 8e-7 1e-6 Sham A/I *# B Sham A/I Sham A/I kDa 40 30 20 Male Female DDAH1 ~34kDa Male Female IOD/Ponceau Red/Std 0 1e-6 2e-6 3e-6 4e-6 5e-6 6e-6 Sham A/I C Figure 7-5. ADMA-related enzyme abundance in sham and A/I rats at 7 wk after surgery. A) Relative abundance of PRMT1 in renal cortex. B) PRMT1 in the liver. C) DDAH1 in renal cortex. D) DDAH2 in renal cortex. Representative western blots of whole membranes show PRMT1 (~42 kDa), DDAH1 (~34 kDa), and DDAH2 bands (~30 kDa). *p<0.05 vs. sham; #p<0.05 vs. respective male.

PAGE 113

113 Sham A/I Sham A/I kDa 40 30 20 Male Female DDAH2 ~30kDa Male Female IOD/Ponceau Red/Std 0.0000 0.0005 0.0010 0.0015 0.0020 0.0025 0.0030 Sham A/I D Figure 7-5. Continued

PAGE 114

114 Male Female microM Cit formation/g protein/min 0.0 0.1 0.2 0.3 0.4 0.5 Sham A/I Male Female nM Cit formation/g protein/min 0 2 4 6 8 10 12 14 16 18 20 Sham A/I *# Male Female microM Cit formation/g protein/min 0.00 0.05 0.10 0.15 0.20 Sham A/I *# #A B C Figure 7-6. In vitro DDAH activity at 7 wk after surg ery. A) In kidney cortex. B) In RBC. C) In liver. *p<0.05 vs. sham. #p<0.05 vs. respective male.

PAGE 115

115 Renal DDAH activity microM Cit/g protein/min 0.00.10.20.30.40.5 RBC DDAH activity nM Cit/g protein/min 0 5 10 15 20 Male sham Male A/I Female sham Female A/I Figure 7-7. Correlation between renal DDAH activity and RBC DDAH activity (r= 0.587, p<0.05).

PAGE 116

116 CHAPTER 8 CONCLUSION AND IMPLICATIONS In this dissertation I describe five differ ent but complementary sets of experiments intended to advance our understandi ng of renal NO deficiency in C KD. We have investigated the renal NOS proteins, renal and systemic oxidative stress and the renal and systemic control of ADMA. Renal Neuronal Nitric Oxide Synthaseand Isoforms Expression in Chronic Kidney Disease In previous studies from our laboratory we have reported that in different rat CKD models, there is a fall in abundance of the renal cortical nNOS expression that correlates with the severity of the injury. Our major findings include: (1) nNOS expression decreases in severe CKD (e.g., 5/6 A/I, chronic GN and PAN models) (38, 130, 153); (2) Strain differences exist in nNOS expression with rats resistant to progr ession of CKD (e.g., WF) showing maintained nNOS compared to the CKD-vulnera ble SD rats. This was seen in the 5/6 A/I, chronic PAN and DOCA/NaCl CKD models (38, 39, 41); and (3) Sex differences occur in the aging SD rats that correlate with susceptibility to CKD. The aged female shows maintained renal nNOS and little age-dependent injury whereas the male shows early and progressive falls in nNOS as CKD develops (40). In my dissertation work I have demonstrated th at (4) there exists of two isoforms of nNOS (splice variants) in the norm al rat kidney; (5) while nNOS decreases profoundly, nNOS expression increases in a RAPA Tx model. This increase in nNOS appears to be a compensatory response that helps to preserve kidney function; (6) in both 5/6 NX and A/I models where nNOS falls, nNOS abundance increases in parallel with increasing glomerular damage. In these situations where the injury is more severe it seems that the increased nNOS

PAGE 117

117 has been inadequate to prevent progression of the injury; and (7) the female rats show less structural damage, smaller falls in nNOS and increases in nNOS than males with 5/6 A/I. As shown in Figure 8-1, we co mpare four CKD models in th is dissertation. There are two Tx-induced mild CKD models, ISO I/R and ALLO RAPA models which s how slow progression of injury; the other tw o severe CKD models are 5/6 NX and A/I models and here the rate of progression was much faster. As shown in Table 8-1, nNOS abundance is maintained in the ISO Tx I/R model, which displays better renal outcome compared to other CKD models. In the RAPA Tx model (another m ild CKD model) there was a surprising absence of nNOS yet a relatively good outcome. There was a significant upregulation of nNOS which could be viewed as compensatory, to maintain ~60% of renal function and relative pres ervation of structure. However, in severe progressive CKD, functiona l deterioration and structural damage still developed despite the upregulation of nNOS (e.g., 5/6 NX and A/I model) and in these models there was still significant residual nNOS In addition, nNOS abundance positively correlates to the increase of glomerular damage in 5/6 A/I model. While maintained renal cortical nNOS is clearly critical to prevent C KD progression, the increased nNOS may not be adequate to prevent injury in severe progres sive CKD, and could even be vi ewed as potentially harmful, given the positive correlation with the structural damage. Exactly how nNOS influences renal function /struc ture is unknown. Its location is considered to be purely cytosolic (no PDZ domain ) and might have similar or even higher NOS activity (no PIN bindi ng site) vs. nNOS in vivo (36). One hypothe sis is that when nNOS derived NO decreases, nNOS expression increases and can pot entially replace decreased NO production to maintain function and prevent C KD progression. However, different N-terminal truncated nNOS proteins (e.g., nNOS ) have been shown to heterodimerize with nNOS and

PAGE 118

118 decrease NOS activity (158). Thus, an altern ate possibility is that the increased nNOS heterodimerizes with residual nNOS and further decreases nNOS -derived NO production. Perhaps the positive actions of nNOS can only be expressed when all the nNOSa is gone, exactly as occurred in the RAPA Tx model (chapter 4). The relationship between nNOS and is likely to be complex since although nNOS is entirely cytosolic, the in vitro soluble NOS activity is decreased in various severe CKD models (10, 36-41, 130, 153), showing that increased nNOS does not increase total nNOS activity in this setting. This could explain why increased nNOS in 5/6 NX and male A/I rats was not beneficial in preventing CKD progression. Although some stimuli have been reported to upor downregulate nNOS mRNA expression in several rat tissues (75, 156), the regulation of the nNOS transcript is unknown. Our data shows that renal cortical nNOS is upregulated in different CKD models, although the precise signal(s) remain unknown. Also, the localization of nNOS in kidney cortex is unknown. Bachmann et al. (9) used both Nand C-termin al anti-nNOS antibodies to recognize the same structure by immunohistochemistry and concluded that the nNOS variant of the MD is nNOS However, this finding does not exclude the possib ility that both are present and/or that nNOS may exist in MD in response to renal injury. It is known that low levels of nNOS are expressed in proximal tubules, cortical collecting ducts, an d perivascular nerves in kidney cortex (8) although the specific isoform is unkn own. Whether the increased nNOS expression in different CKD models is located in MD or other segm ents of nephron is also unknown. Since the Cterminal Ab detects all alternatively spliced forms of nNOS, we are unable to use it to detect the localization of nNOS by immunohistochemistry. Although La ngnaese et al. (79) developed a specific nNOS Ab to detect nNOS in nNOS overexpressing cells, thei r data suggests that

PAGE 119

119 this Ab may cross react with ot her nNOS isoforms. Therefore, the location of the renal nNOS isoforms deserves further evaluation. There have been a number of studies in the nNOS -knockout (KO) mice (deleted exon 2) (104). However, expression of alternatively spliced variants are still detect ed in these mice with residual nNOS activity. Mice with complete ab lation of nNOS (deleted exon 6) are viable although infertile (49) and little is known about renal cont rol in nNOS exon 6 KO mice. Although in this dissertation we focus on nNOS e xpression in the kidney co rtex, further study is needed to elucidate its pathophysio logical role in the kidney medu lla in renal disease. Future challenges to understand their relative f unction includes the comparison between nNOS and full nNOS KO mice, the generation of inducible ne phron site-specific knockout models, and gene silencing models targeting specific nNOS isofor m to assess the physiological roles of different nNOS isoforms. Oxidative Stress in Chronic Kidney Disease Oxidative stress is present in CKD patients and in experimental CKD models (53, 123, 147). Superoxide (O2 -) and hydrogen peroxide (H2O2) are important ROS, both of which can be made by many oxidative enzymes. On the othe r hand, many antioxidant enzymes counteract ROS to maintain redox balance. The complexity of the interplay between the pro-oxidants and antioxidant systems and their impact on syst emic vs. renal oxidative stress makes the interpretation of in vivo studies very complicated. Two major sources of vascular ROS are cy tochrome P450 and NADPH oxidase (47). In the kidney cortex, there is a wide distribution of various NADPH oxidase complexes, thus serving as the predominant source of O2 generation (44). A previous study reported that renal NADPH oxidase expression increased in 5/6 NX rats (151) and our data c onfirms this since we observed that renal cortical NADPH oxidase-dependent O2 production increased in 5/6 NX rats

PAGE 120

120 (133). We investigated several markers of oxida tive stress in the A/I model and found that the O2 generating system is upregulated in male A/ I rats represented by increased renal cortical p22phox abundance, urinary H2O2, and plasma MDA levels. Thes e data suggest that NADPH oxidase may be the major source of ROS in the kidney. Oxidative Stress and Neuronal Nitric Oxide Synthase Our data suggests that oxidative stress is associated with loss of renal nNOS and subsequent development of injury. We showed that 5/6 NX rats de velop increased NADPHdependent O2 production and decreased nNOS expression in the kidney cortex (chapter 6). In the presence of the antioxidant vitamin E, both development of injury and loss of nNOSa are attenuated. In the 5/6 A/I model se x difference study, renal cortical nNOS abundance was decreased in males, together w ith evidence of increased systemic and renal oxidative stress. In contrast, female A/I rats tended to maintain nNOS abundance and without evidence of increased oxidative stress. Little is known about whethe r oxidative stress can regulate nNOS expression in the kidney. Angiotesin II infusion decreases nNOS but increases NADPH oxidase expression, while angiotensinogen and angiotensin 1 recept or knockout mice display increased nNOS expression (139). These findings suggest angiotensin II may induce NADPH oxidase to downregulate nNOS expression. It is supported by our finding in the 5/6 NX m odel that oxidative stress may downregulate nNOS expression in the kidney. Asymmetric Dimethylarginine in Chronic Kidney Disease Elevated ADMA level has been reported in various men with ESRD and CKD, CKD models and is a risk factor for many cardiova scular disorders (146). Free plasma and tissue ADMA levels are controlled by prot ein turnover rate and two count erbalancing pathways, type I PRMT and DDAH. (146). Both methylation an d breakdown of protein are highly regulated

PAGE 121

121 processes (105, 137), however, th eir regulation of the forma tion of ADMA is not well characterized. On the other hand, ADMA is meta bolized by DDAH and the kidney plays a major role for breakdown of excess ADMA (137, 146). In CKD, defective rena l clearance of ADMA may cause its accumulation in the blood a nd/or in tissue. We found that plasma ADMA levels are in creased in 5/6 NX model (133). Our data suggest that the accumulation of ADMA is due to increased ADMA pro duction (secondary to increased PRMT1 abundance) and decreased ADMA degradation (secondary to decreased renal DDAH activity). Matsuguma and colleagues ha ve reported increased renal PRMT1 gene expression although they also re ported decreased DDAH1 and 2 protein expression in 5/6 NX rats (90). This was contrast to our finding that DDAH1 and 2 pr otein abundance was unaltered in 5/6 NX rats; however, we found decreased renal DDAH activity. Nevertheless, when we used the 5/6 A/I m odel there was no increase in plasma ADMA level in either sex, which was une xpected since we used the same strain of rat and since the 5/6 A/I model produces more severe injury that th e 5/6 NX. The renal PRMT1 increased similarly, renal DDAH1 abundance was unchanged and DDAH2 fe ll similarly in both sexes with A/I. However, while there was no change in renal AD MA levels in males with A/I an increase was seen in females. In female A/I rats, an increa sed renal L-arginine leve ls also occurred which should reduce the impact of the increased renal ADMA. Interestingly, the renal Larginine/ADMA ratios were reduced similarly after A/I in both sexes although the precise mechanism of the reduction differed. This sex difference study has highlighted the complexity of the regu lation of plasma and tissue ADMA levels since neithe r renal PRMT nor DDAH expression /activity can predict plasma or kidney ADMA levels in shams or 5/6 A/I. Furthermore, plasma ADMA levels do not always

PAGE 122

122 predict local ADMA levels because there is likely to be interorgan regulation to control its homeostasis, i.e., ADMA formed in the heart mi ght end up in the liver or kidney for breakdown. Also, local formation will vary and the increased renal PRMT1 might mean that net renal ADMA generation is increased in CKD. Of note, patients with normal plasma ADMA level may actually already be at risk since ADMA may accumulate in other organs (e.g., endothelium), consequently impairing their function (e.g., endo thelial dysfunction). Therefore, plasma ADMA levels may not accurately reflect ADMA-associ ated cardiovascular risk. Other markers are needed to predict tissue ADMA levels seem im portant for future development of specific ADMA-lowering agents. Another unexpected finding was th at renal ADMA levels were not invariably correlated to renal DDAH activity. This again reinforces the co mplexity of ADMA regulation with different tissues contributing to synthe sis and breakdown. However, d ecreased tissue DDAH activity is associated with poor renal outcome in male A/ I rats, suggesting DDAH activity may be a marker in predicting outcome. We were able to det ect DDAH activity in rat RBC and found that it correlates with renal DDAH activity. This may provide a useful tool as a surrogate measure of renal DDAH activity in patients with CKD and clin ical studies are planne d to address this. The distinct tissue distribution of the two DDA H isoforms suggests that there may be an isoform-specific regulation of ADMA concentra tion and NO production (142) Wang et al. (154) recently reported that blood ADMA level wa s regulated by DDAH1, which was mainly expressed in kidney cortex and liver, whereas vascular NO production was primarily regulated by DDAH2, which was expressed in blood vessels. Howe ver, this is inconsistent with previous studies showing that loss of DDAH1 activity cau ses accumulation of ADMA as well as reduction in NO (83) and decreased DDAH2 expression in vessels was associ ated with elevated plasma

PAGE 123

123 ADMA levels in 5/6 NX rats (136). This seem s an oversimplification because both ADMA and NO are highly regulated by complicated processes, as supported by our findings. In summary, 1). We found renal cortical DDAH1 expression was unchanged in 5/6 NX and A/I models regardless to the plasma ADMA levels; 2). Plasma ADMA le vel cannot be predicted by individual organ PRMT1 expression, DDAH1/2 expression, and DDAH activity; 3). Renal DDAH2 expression was unaltered in 5/6 NX rats but decreased in 5/6 A/I rats; however, they all displayed decreased NO production; 4). NO production was correlated to L-aginine/ADMA ratio but not to the individual L-arginine or ADMA levels. These data points ou t the complexity of regulation on ADMA and NO production and indicate the need for further studies deserv e to study the specific functions of DDAH isoforms. We have constructed lentiviral v ectors carrying human DDAH1 or DDAH2 cDNA and we are currently studying their renoprotective e ffects in a chronic PAN CKD model. Hopefully, this study will give insight into th e specific functions of two DDAH isoforms. Oxidative Stress and Asymme tric Dimethylarginine Although the link between oxidative stress a nd ADMA in cardiovascular disease has been reviewed (128), their relationship in renal disease is unclear. Oxidative stress is considered to increase the activity of PRMT and decrease the e xpression/activity of DDAH, which leads to the increase in ADMA concentrations (128). In terestingly, we found increased ADMA production (secondary to increased PRMT1 abundance) a nd decreased ADMA degradation (secondary to decreased DDAH activity) in 5/6 NX rats, which was associated with increased renal NADPH oxidase-dependent O2 production. According to the current lite rature, it is well established that the presence of a reactive cysteine residue in the active site of DDAH1/2 makes their activity susceptible to inhibition by Snitrosylation as well as oxi dation by ROS (72, 82, 128). In our studies, we also reported that renal DDAH activity was inhibited by either O2 or NO donor in vitro (132). However, in the 5/ 6 NX study, vitamin E reduced NADPH oxidase-dependent O2

PAGE 124

124 production, protected the kidney structure, preserved nNOS but had no impact on the elevated plasma ADMA levels in 5/6 NX rats (133). In addition, there was no reve rsal of the decreased DDAH activity in the kidney. This data was unexp ected since Wilcox et al (44) suggests that NADPH oxidase is the primary renal oxidase and yet normalization with vitamin E did not reduce ADMA or restore renal DDAH ac tivity. This could mean that O2 from other oxidative enzymes or other sources of ROS becomes important in generation of ROS in CKD. Alternatively it could mean that PRMT1 expres sion/DDAH activity is not invariably regulated by increased ROS. Our subsequent studies in the 5/6 A/I m odel support this possibility since the O2 generating system is upregulated in male A/I rats (increased renal cortical p22phox abundance, urinary H2O2, and plasma MDA levels), tissue DDAH activity (in kidney, liver, and RBC) fell but there was no increase in either plasma or re nal ADMA levels. In contrast, the female A/I rats displayed increased renal ADMA levels with no ev idence of increased ROS and similar absolute DDAH activity in tissues. Whethe r oxidative stress can induce the accumulation of ADMA in the kidney via regulation of PRMT/DDAH needs further evaluation, as does the impact of different types of oxidative stress on the system. Target on Nitric Oxide Pathway to Prevent Chronic Kidney Disease Progression and Cardiovascular Complications At present, treatment aiming to retard C KD progression is limited to aggressive blood pressure control and blockade of renin-angiotensin system, with few therapies targeting the NO pathway. Because many common mechanisms of CKD progression share NO deficiency which is causally involved in both CKD progression and endothelial dysfunc tion, preservation of NO bioavailability becomes a therapeutic target in CKD patients. The administration of L-arginine was the most common treatment targeted to improve the NO pathway in both CKD and CVD.

PAGE 125

125 Although L-arginine had a benefici al effect in experimental C KD animals (70), the data from human trials are still in conclusive (10, 15, 31). We demonstrated that NO production is decr eased in CKD and this is likely due to decreased renal nNOS abundance, increased oxidative stress, and accumulation of ADMA. Instead of L-arginine supplementation, the data presented above allows us to prevent NO deficiency in CKD patients with therapeutic appr oaches to (1) improve decreased renal cortical nNOS abundance, (2) effectively suppress oxidativ e stress by targeting appropriate source of ROS, and (3) correct elevated ADM A levels (Figure 8-2). Neuronal Nitric Oxide Synthase Gene Therapy The cortical nNOS is of critical importance in th e pathogenesis of CKD progression as we demonstrated that its expr ession correlate to renal outcome in every CKD model studies. Although targeting nNOS with gene transfer have been used to modulate cardiac function (96), portal hypertension (163), a nd erectile dysfunction (88) kidney transfection is difficult due to its functional heterogeneity (141). Fu rthermore, since cortical nNOS is uniquely located in MD, overexpressing nNOS in the kidney cortex is difficu lt since MD-specific promoter is unavailable. Gene therapy to preserve renal nNOS is still at an early stage of development. However, nNOS in MD could be enhanced by sa lt restriction, diuretics, ACE inhibitors, and NaHCO3 (139). Whether above interventions can pr eserve nNOS/NO in CKD patients deserves further evaluation. Next, nNOS can also produce O2 instead of NO in the presence of deficiency of L-arginine or cofactor BH4. Without correction of increased oxi dative stress and ADMA, nNOS gene therapy could serve more harm that good, due to nNOS uncoupling. Therefore, in addition to preserving renal cortical nNOS abundance, relieving the inhibition on nNOS by manipulating oxidative stress and ADMA are essential.

PAGE 126

126 Prevention of Chronic Kidney Dise ase Progression by Antioxidants Traditionally, the treatment of oxidative stre ss is with the administ ration of antioxidants. We found a lack of renoprotecti on using short-term combined antioxidants in I/R injury although vitamin E prevents CKD progression in 5/6 NX ra ts. We also found female A/I rats displayed renal failure without induction of oxidative stress. As pointed out by Vaziri (148), it is clear that identification of the source of ROS and control of ROS production is a better strategy than nonselective use of antioxidants to treat different ki nds of CKD. As ideal antioxidants for clinical use have not yet been discovered, a mechanism-base d approach is required to gain understanding of the relative importance of the di fferent contributors to oxidativ e stress in CKD. This may then lead to use of specific antioxidants to prevent the progression of CKD w ith different insults. Prevention of Chronic Kidney Disease Progression by Lowering Asymmetric Dimethylarginine Although ACE inhibitors, ARBs, hypoglycemic agents, and hormone replacement therapy (HRT) have been shown to reduce ADMA levels specific ADMA-lowering therapy is not yet available (86). Treatment aimed at reducing oxi dative stress was unable to lower plasma ADMA levels (129). Given the facts th at accumulation of ADMA is asso ciated with increased PRMT expression and decreased DDAH expression/a ctivity, lowering ADMA levels could be approached by PRMT inhibitors or DDAH agoni sts. Several PRMT isoforms have been identified, each of which has its own distin ct function in regulati on of cellular physiology. Selective PRMT inhibitors are unavailable and a nyway their inhibition may cause unwanted side effects (77). On the other hand, DDAH is em erging as a prime target for therapeutic interventions to lower ADMA. Although promis ing insights come from the DDAH-transgenic mice (52), selective DDAH agonist and DDAH ge ne therapy still aw aits confirmation. Preliminary animal work showed DDAH1 gene therapy can prevent the progression in a 5/6 NX

PAGE 127

127 rat model (91). A site-specific and sustaine d expression DDAH gene therapy for CKD patients requires further development. Multifaceted Therapeutic Approaches in Prev enting Chronic Kidney Disease Progression As our understanding of the mechanisms of CKD continues to expand, additional targets for intervention will be identified, and it is likely that a multifaceted therap eutic approach will be required to slow the CKD progression and reduce CV complications. Chroni c L-arginine therapy alone has no impact on progression of patient s with mild CKD (31) indicating that the preservation of NO bioavailability may need multifaceted therapeutic approaches. Of course, such approaches as gene therapy (e.g., nNOS or DDAH), specific anti oxidants, and specific ADMA-lowering agents may become viable options for CKD patients marked by NO deficiency.

PAGE 128

128 Table 8-1. The nNOS and isoform expression in different chronic kidney disease models Model Rat strain Sex Follow -up %CCr % GS nNOS nNOS OS ADMA I/R ISO F344 M 22wk ~60% 25% ND ND RAPA ALLO F344 Lewis M 22wk ~70% 30% ND ND 5/6 NX SD M 15wk ~20% 40% 5/6 NX +Vit E SD M 15wk ~20% 25% A/I SD M 7wk ~10% 40% A/I SD F 7wk ~30% 30% OS=Oxidative stress; = increase; =decrease; =no change; ND= not detected.

PAGE 129

129 0 10 20 30 40 50 60 70 80 90 100 0510152025 Time after renal injury, weekRelative renal function, % A/I M vs. F RAPA ALLO I/R ISO End-stage renal disease 5/6 NX Figure 8-1. Various progression ra tes to end-stage renal disease in different chronic kidney disease (CKD) models. The steeper the slope, the more rapid the rate of progression and the more severe the injury.

PAGE 130

130 NO nNOS Oxidative stress ADMA DDAH Specific antioxidants Specific ADMA -lowering agents Gene therapy nNOS DDAH Figure 8-2. Target nitric oxide (NO) pathways in preventi ng chronic kidney disease (CKD) progression and cardiovascular complications. NO bioavailability can be preserved by (1) Increased renal cortical neuronal nitr ic oxide synthase (nNOS) abundance, (2) Decreased oxidative stress, and (3) Decrea sed asymmetric dimethylarginine (ADMA) by activation of dimethylarginine dimethylaminohydrolase (DDAH).

PAGE 131

131 LIST OF REFERENCES 1. Achan V, Tran CT, Arrigoni F, Whit ley GS, Leiper JM and Vallance P. all-trans-Retinoic acid increases nitric oxide synthesis by endothelial cells: a role for the induction of dimethylarginine dimethylaminohydrolase. Circ Res 90: 764-769, 2002. 2. Albrecht EW, van Goor H, Smitvan Oosten A and Stegeman CA. Long-term dietary Larginine supplementation attenuat es proteinuria and fo cal glomerulosclerosis in experimental chronic renal transplant failure. Nitric Oxide 8: 53-58, 2003. 3. Alderton WK, Cooper CE and Knowles RG. Nitric oxide synthases: structure, function and inhibition. Biochem J 357: 593-615, 2001. 4. Arthur JM, Thongboonkerd V, Scherzer JA, Cai J, Pierce WM and Klein JB. Differential expression of proteins in renal cort ex and medulla: a proteomic approach. Kidney Int 62: 13141321, 2002. 5. Attia DM, Verhagen AM, Stroes ES, van Faa ssen EE, Grone HJ, De Kimpe SJ, Koomans HA, Braam B and Joles JA. Vitamin E alleviates renal inju ry, but not hypertension, during chronic nitric oxide synt hase inhibition in rats. J Am Soc Nephrol 12: 2585-2593, 2001. 6. Azuma H, Nadeau K, Takada M, Mackenzie HS and Tilney NL. Cellular and molecular predictors of chronic renal dys function after initial ischemia/reperfusion injury of a single kidney. Transplantation 64: 190-197, 1997. 7. Azzi A, Ricciarelli R and Zingg JM. Non-antioxidant molecular functions of alphatocopherol (vitamin E). FEBS Lett 519: 8-10, 2002. 8. Bachmann S, Bosse HM and Mundel P. Topography of nitric oxide synthesis by localizing constitutive NO synthase s in mammalian kidney. Am J Physiol 268: F885-98, 1995. 9. Bachmann S and Theilig F. Juxtaglomerular apparatus, ni tric oxide, and macula densa signaling. Adv Nephrol Necker Hosp 30: 95-107, 2000. 10. Baylis C. Arginine, arginine analogs and nitric oxide production in chronic kidney disease. Nat Clin Pract Nephrol 2: 209-220, 2006. 11. Baylis C. Changes in renal hemodynamics and stru cture in the aging kidney; sexual dimorphism and the nitric oxide system. Exp Gerontol 40: 271-278, 2005. 12. Bedford MT and Richard S. Arginine methylation an em erging regulator of protein function. Mol Cell 18: 263-272, 2005. 13. Billecke SS, Kitzmiller LA, Northrup JJ, Wh itesall SE, Kimoto M, Hinz AV and D'Alecy LG. Contribution of whole bl ood to the control of plasma asymmetrical dimethylarginine. Am J Physiol Heart Circ Physiol 291: H1788-96, 2006.

PAGE 132

132 14. Bode-Boger SM, Scalera F, Kielstein JT, Martens-Lobenhoffer J, Breithardt G, Fobker M and Reinecke H. Symmetrical dimethylarginine: a ne w combined parameter for renal function and extent of coronary artery disease. J Am Soc Nephrol 17: 1128-1134, 2006. 15. Boger RH. The pharmacodynamics of L-arginine. J Nutr 137: 1650S-1655S, 2007. 16. Boger RH, Schwedhelm E, Maas R, Quispe-Bravo S and Skamira C. ADMA and oxidative stress may relate to the progression of renal disease: rationale and design of the VIVALDI study. Vasc Med 10 Suppl 1: S97-102, 2005. 17. Boissel JP, Schwarz PM and Forstermann U. Neuronal-type NO synthase: transcript diversity and expres sional regulation. Nitric Oxide 2: 337-349, 1998. 18. Brandes RP and Mugge A. Gender differences in the generati on of superoxide anions in the rat aorta. Life Sci 60: 391-396, 1997. 19. Braunlich H, Marx F, Fleck C and Stein G. Kidney function in rats after 5/6 nephrectomy (5/6 NX); effort of treatment with vitamin E. Exp Toxicol Pathol 49: 135-139, 1997. 20. Brenman JE, Chao DS, Gee SH, McGee AW, Cr aven SE, Santillano DR, Wu Z, Huang F, Xia H, Peters MF, Froehner SC and Bredt DS. Interaction of nitric oxi de synthase with the postsynaptic density protein PSD-95 and al pha1-syntrophin mediated by PDZ domains. Cell 84: 757-767, 1996. 21. Brenner BM. Remission of renal disease: recounti ng the challenge, acquiring the goal. J Clin Invest 110: 1753-1758, 2002. 22. Brigelius-Flohe R, Kelly FJ, Salonen JT, Neuzil J, Zingg JM and Azzi A. The European perspective on vitamin E: current knowledge and future research. Am J Clin Nutr 76: 703-716, 2002. 23. Cardounel AJ, Xia Y and Zweier JL. Endogenous methylarginines modulate superoxide as well as nitric oxide generation fr om neuronal nitric-oxide synthase : differences in the effects of monomethyland dimethylargini nes in the presence and abse nce of tetrahydrobiopterin. J Biol Chem 280: 7540-7549, 2005. 24. Chander V and Chopra K. Renal protective effect of mo lsidomine and L-arginine in ischemia-reperfusion induced injury in rats. J Surg Res 128: 132-139, 2005. 25. Chatterjee PK, Cuzzocrea S, Brown PA, Za charowski K, Stewart KN, Mota-Filipe H and Thiemermann C. Tempol, a membrane-permeable radi cal scavenger, reduces oxidant stress-mediated renal dysfunction and injury in the rat. Kidney Int 58: 658-673, 2000. 26. Chen Y, Li Y, Zhang P, Traverse JH, Hou M, Xu X, Kimoto M and Bache RJ. Dimethylarginine dimethylaminohydrolase and endothelial dysfunction in failing hearts. Am J Physiol Heart Circ Physiol 289: H2212-9, 2005.

PAGE 133

133 27. Cooke JP. Does ADMA cause endothelial dysfunction? Arterioscler Thromb Vasc Biol 20: 2032-2037, 2000. 28. Curis E, Nicolis I, Moinard C, Osowska S, Zerrouk N, Benazeth S and Cynober L. Almost all about citrulline in mammals. Amino Acids 29: 177-205, 2005. 29. Cuzzocrea S, Riley DP, Caputi AP and Salvemini D. Antioxidant therapy: a new pharmacological approach in shock, inflam mation, and ischemia/reperfusion injury. Pharmacol Rev 53: 135-159, 2001. 30. Dayoub H, Achan V, Adimoolam S, Jacobi J, Stuehlinger MC, Wang BY, Tsao PS, Kimoto M, Vallance P, Patterson AJ and Cooke JP. Dimethylarginine dimethylaminohydrolase regulates nitric oxide synthesis: gene tic and physiological evidence. Circulation 108: 3042-3047, 2003. 31. De Nicola L, Bellizzi V, Minutolo R, Andreu cci M, Capuano A, Garibotto G, Corso G, Andreucci VE and Cianciaruso B. Randomized, double-blind, placebo-controlled study of arginine supplementation in chronic renal failure. Kidney Int 56: 674-684, 1999. 32. DiJoseph JF, Fluhler E, Armstrong J, Sharr M and Sehgal SN. Therapeutic blood levels of sirolimus (rapamycin) in the allografted rat. Transplantation 62: 1109-1112, 1996. 33. Dikalov SI, Dikalova AE and Mason RP. Noninvasive diagnostic tool for inflammationinduced oxidative stress using el ectron spin resonance spectrosc opy and an extracellular cyclic hydroxylamine. Arch Biochem Biophys 402: 218-226, 2002. 34. El Nahas M. The global challenge of chronic kidney disease. Kidney Int 68: 2918-2929, 2005. 35. Eliasson MJ, Blackshaw S, Schell MJ and Snyder SH. Neuronal nitric oxide synthase alternatively spliced forms: prominent functional localizations in the brain. Proc Natl Acad Sci U S A 94: 3396-3401, 1997. 36. Erdely A, Freshour G and Baylis C. Resistance to renal damage by chronic nitric oxide synthase inhibition in the Wistar-Furth rat. Am J Physiol Regul Integr Comp Physiol 290: R6672, 2006. 37. Erdely A, Freshour G, Maddox DA, Olson JL, Samsell L and Baylis C. Renal disease in rats with type 2 diabetes is associated with decreased renal n itric oxide production. Diabetologia 47: 1672-1676, 2004. 38. Erdely A, Freshour G, Smith C, Engels K, Olson JL and Baylis C. Protection against puromycin aminonucleoside-induced chronic re nal disease in the Wistar-Furth rat. Am J Physiol Renal Physiol 287: F81-9, 2004. 39. Erdely A, Freshour G, Tain YL, Engels K and Baylis C. DOCA/NaCl-induced chronic kidney disease: a comparison of renal nitric oxi de production in resistan t and susceptible rat strains. Am J Physiol Renal Physiol 292: F192-6, 2007.

PAGE 134

134 40. Erdely A, Greenfeld Z, Wagner L and Baylis C. Sexual dimorphism in the aging kidney: Effects on injury and nitric oxide system. Kidney Int 63: 1021-1026, 2003. 41. Erdely A, Wagner L, Muller V, Szabo A and Baylis C. Protection of wistar furth rats from chronic renal disease is asso ciated with maintained renal nitric oxide synthase. J Am Soc Nephrol 14: 2526-2533, 2003. 42. Fortepiani LA and Reckelhoff JF. Role of oxidative stress in the sex differences in blood pressure in spontaneously hypertensive rats. J Hypertens 23: 801-805, 2005. 43. Frein D, Schildknecht S, Ba chschmid M and Ullrich V. Redox regulation: a new challenge for pharmacology. Biochem Pharmacol 70: 811-823, 2005. 44. Gill PS and Wilcox CS. NADPH oxidases in the kidney. Antioxid Redox Signal 8: 15971607, 2006. 45. Gordon CA and Himmelfarb J. Antioxidant therapy in uremia : evidence-based medicine? Semin Dial 17: 327-332, 2004. 46. Gornall AG and Hunter A. A colorimetric method for the determination of citrulline. Biochem J 35: 650-658, 1941. 47. Griendling KK and FitzGerald GA. Oxidative stress and cardiovascular injury: Part I: basic mechanisms and in vivo monitoring of ROS. Circulation 108: 1912-1916, 2003. 48. Griffin KA, Picken MM and Bidani AK. Blood pressure lability and glomerulosclerosis after normotensive 5/6 renal mass reduction in the rat. Kidney Int 65: 209-218, 2004. 49. Gyurko R, Leupen S and Huang PL. Deletion of exon 6 of the neuronal nitric oxide synthase gene in mice results in hypogonadism and infertility. Endocrinology 143: 2767-2774, 2002. 50. Hahn S, Krieg RJ,Jr, Hisano S, Chan W, Kuemmerle NB, Saborio P and Chan JC. Vitamin E suppresses oxidative stress and gl omerulosclerosis in rat remnant kidney. Pediatr Nephrol 13: 195-198, 1999. 51. Hanna IR, Hilenski LL, Dikalova A, Taniyama Y, Dikalov S, Lyle A, Quinn MT, Lassegue B and Griendling KK. Functional association of nox1 with p22phox in vascular smooth muscle cells. Free Radic Biol Med 37: 1542-1549, 2004. 52. Hasegawa K, Wakino S, Tatematsu S, Yosh ioka K, Homma K, Sugano N, Kimoto M, Hayashi K and Itoh H. Role of asymmetric dimethylarginine in vascular injury in transgenic mice overexpressing dimethylarginie dimethylaminohydrolase 2. Circ Res 101: e2-10, 2007. 53. Himmelfarb J, Stenvinkel P, Ikizler TA and Hakim RM. The elephant in uremia: oxidant stress as a unifying concept of cardiovascular disease in uremia. Kidney Int 62: 1524-1538, 2002.

PAGE 135

135 54. Holden DP, Cartwright JE, Nussey SS and Whitley GS. Estrogen stimulates dimethylarginine dimethylaminohydrolase ac tivity and the metabolism of asymmetric dimethylarginine. Circulation 108: 1575-1580, 2003. 55. Hu T, Chouinard M, Cox AL, Sipes P, Marcel o M, Ficorilli J, Li S, Gao H, Ryan TP, Michael MD and Michael LF. Farnesoid X receptor agonist reduces serum asymmetric dimethylarginine levels thr ough hepatic dimethylarginine dimethylaminohydrolase-1 gene regulation. J Biol Chem 281: 39831-39838, 2006. 56. Huang H, He Z, Roberts LJ,2nd and Salahudeen AK. Deferoxamine reduces coldischemic renal injury in a syngeneic kidney transplant model. Am J Transplant 3: 1531-1537, 2003. 57. Huang PL, Dawson TM, Bredt DS, Snyder SH and Fishman MC. Targeted disruption of the neuronal nitric oxide synthase gene. Cell 75: 1273-1286, 1993. 58. Huber A, Saur D, Kurjak M, Schusdziarra V and Allescher HD. Characterization and splice variants of neuronal nitric oxi de synthase in rat small intestine. Am J Physiol 275: G114656, 1998. 59. Hurt KJ, Sezen SF, Champion HC, Crone JK Palese MA, Huang PL, Sawa A, Luo X, Musicki B, Snyder SH and Burnett AL. Alternatively spliced neurona l nitric oxide synthase mediates penile erection. Proc Natl Acad Sci U S A 103: 3440-3443, 2006. 60. Ibrahim HN and Hostetter TH. The renin-aldosterone axis in two models of reduced renal mass in the rat. J Am Soc Nephrol 9: 72-76, 1998. 61. Ito A, Tsao PS, Adimoolam S, Kim oto M, Ogawa T and Cooke JP. Novel mechanism for endothelial dysfunction: dysre gulation of dimethylargini ne dimethylaminohydrolase. Circulation 99: 3092-3095, 1999. 62. Jacobi J, Sydow K, von Degenfeld G, Zhan g Y, Dayoub H, Wang B, Patterson AJ, Kimoto M, Blau HM and Cooke JP. Overexpression of dimethylarginine dimethylaminohydrolase reduces tissue asymmetric dimethylarginine levels and enhances angiogenesis. Circulation 111: 1431-1438, 2005. 63. Jaffrey SR and Snyder SH. PIN: an associated protein inhi bitor of neuronal nitric oxide synthase. Science 274: 774-777, 1996. 64. Ji H, Zheng W, Menini S, Pesce C, Kim J, Wu X, Mulroney SE and Sandberg K. Female protection in progressive renal disease is associated with estradiol attenuation of superoxide production. Gend Med 4: 56-71, 2007. 65. Joles JA, Vos IH, Grone HJ and Rabelink TJ. Inducible nitric oxide synthase in renal transplantation. Kidney Int 61: 872-875, 2002.

PAGE 136

136 66. Kang ES, Cates TB, Harper DN, Chiang TM Myers LK, Acchiardo SR and Kimoto M. An enzyme hydrolyzing methylated inhibitors of nitric oxide synt hase is present in circulating human red blood cells. Free Radic Res 35: 693-707, 2001. 67. Kim J, Kil IS, Seok YM, Yang ES, Kim DK Lim DG, Park JW, Bonventre JV and Park KM. Orchiectomy attenuates post-ischemic oxi dative stress and ischemia/reperfusion injury in mice. A role for manganese superoxide dismutase. J Biol Chem 281: 20349-20356, 2006. 68. Kimoto M, Miyatake S, Sasagawa T, Yamash ita H, Okita M, Oka T, Ogawa T and Tsuji H. Purification, cDNA cloning and expressi on of human NG,NG-dimethylarginine dimethylaminohydrolase. Eur J Biochem 258: 863-868, 1998. 69. Kir HM, Dillioglugil MO, Tugay M, Eraldemir C and Ozdogan HK. Effects of vitamins E, A and D on MDA, GSH, NO levels and SOD activities in 5/6 nephrectomized rats. Am J Nephrol 25: 441-446, 2005. 70. Klahr S and Morrissey J. L-arginine as a therapeuti c tool in kidney disease. Semin Nephrol 24: 389-394, 2004. 71. Knipp M. How to control NO production in cells: N( omega),N(omega)-dimethyl-L-arginine dimethylaminohydrolase as a novel drug target. Chembiochem 7: 879-889, 2006. 72. Knipp M, Braun O, Gehrig PM, Sack R and Vasak M. Zn(II)-free dimethylargininase-1 (DDAH-1) is inhibited upon sp ecific Cys-S-nitrosylation. J Biol Chem 278: 3410-3416, 2003. 73. Knipp M and Vasak M. A colorimetric 96-well microtiter plate assay for the determination of enzymatically formed citrulline. Anal Biochem 286: 257-264, 2000. 74. Kone BC. Nitric oxide synthesis in the kidney: is oforms, biosynthesis, and functions in health. Semin Nephrol 24: 299-315, 2004. 75. Kone BC. Localization and regulation of nitric oxi de synthase isoforms in the kidney. Semin Nephrol 19: 230-241, 1999. 76. Kouwenhoven EA, de Bruin RW, Heeman n U, Marquet RL and IJzermans JN. Does cold ischemia induce chronic kidney transplant dysfunction? Transplant Proc 31: 988-989, 1999. 77. Krause CD, Yang ZH, Kim YS, L ee JH, Cook JR and Pestka S. Protein arginine methyltransferases: evolution and assessment of their pharmacological and therapeutic potential. Pharmacol Ther 113: 50-87, 2007. 78. Kulhanek V, Maderova V, Sindelarova K and Vojtiskova V. Modified Determination of Ornithine-Carbamyl-Transferase Ac tivity in Biological Material. Clin Chim Acta 8: 579-585, 1963. 79. Langnaese K, Richter K, Smalla KH, Krauss M, Thomas U, Wolf G and Laube G. Splice-isoform specific immunolocalization of neur onal nitric oxide synthase in mouse and rat

PAGE 137

137 brain reveals that the PDZ-co mplex-building nNOSalpha beta-f inger is largely exposed to antibodies. Dev Neurobiol 67: 422-437, 2007. 80. Lau KS, Grange RW, Isotani E, Sarelius IH, Kamm KE, Huang PL and Stull JT. nNOS and eNOS modulate cGMP formation and vascular response in contracting fast-twitch skeletal muscle. Physiol Genomics 2: 21-27, 2000. 81. Lee MA, Cai L, Hubner N, Lee YA and Lindpaintner K. Tissueand developmentspecific expression of multiple alternatively spliced transcripts of rat neuronal nitric oxide synthase. J Clin Invest 100: 1507-1512, 1997. 82. Leiper J, Murray-Rust J, McDonald N and Vallance P. S-nitrosylation of dimethylarginine dimethylami nohydrolase regulates enzyme ac tivity: further interactions between nitric oxide synthase and di methylarginine dimethylaminohydrolase. Proc Natl Acad Sci U S A 99: 13527-13532, 2002. 83. Leiper J, Nandi M, Torondel B, Murray-Rust J, Malaki M, O'Hara B, Rossiter S, Anthony S, Madhani M, Selwood D, Smith C, Wojciak-Stothard B, Rudiger A, Stidwill R, McDonald NQ and Vallance P. Disruption of methyl arginine metabolism impairs vascular homeostasis. Nat Med 13: 198-203, 2007. 84. Leiper JM, Santa Maria J, Chubb A, MacAllis ter RJ, Charles IG, Whitley GS and Vallance P. Identification of two human dimethylar ginine dimethylam inohydrolases with distinct tissue dist ributions and homology with microbial arginine deiminases. Biochem J 343 Pt 1: 209-214, 1999. 85. Lin Z, Crockett DK, Lim MS and Elenitoba-Johnson KS. High-throughput analysis of protein/peptide complexes by immunopr ecipitation and automated LC-MS/MS. J Biomol Tech 14: 149-155, 2003. 86. Maas R. Pharmacotherapies and their influence on asymmetric dimethylargine (ADMA). Vasc Med 10 Suppl 1: S49-57, 2005. 87. MacAllister RJ, Parry H, Kimoto M, Ogawa T, Russell RJ, Hodson H, Whitley GS and Vallance P. Regulation of nitric oxide synthesis by dimethylarginine dimethylaminohydrolase. Br J Pharmacol 119: 1533-1540, 1996. 88. Magee TR, Ferrini M, Garban HJ, Vernet D, Mitani K, Rajfer J and Gonzalez-Cadavid NF. Gene therapy of erectile dysfunction in the ra t with penile neuronal nitric oxide synthase. Biol Reprod 67: 1033-1041, 2002. 89. Maser RL, Vassmer D, Magenheimer BS and Calvet JP. Oxidant stress and reduced antioxidant enzyme protection in polycystic kidney disease. J Am Soc Nephrol 13: 991-999, 2002. 90. Matsuguma K, Ueda S, Yamagishi S, Matsum oto Y, Kaneyuki U, Shibata R, Fujimura T, Matsuoka H, Kimoto M, Kato S, Imaizumi T and Okuda S. Molecular mechanism for

PAGE 138

138 elevation of asymmetric dimethylarginine and its role for hypertension in chronic kidney disease. J Am Soc Nephrol 17: 2176-2183, 2006. 91. Matsumoto Y, Ueda S, Yamagishi S, Matsuguma K, Shibata R, Fukami K, Matsuoka H, Imaizumi T and Okuda S. Dimethylarginine dimethylami nohydrolase prevents progression of renal dysfunction by inhibiting loss of peritubular capillaries and tubulointerstitial fibrosis in a rat model of chronic kidney disease. J Am Soc Nephrol 18: 1525-1533, 2007. 92. Meier-Kriesche HU, Schold JD and Kaplan B. Long-term renal allograft survival: have we made significant progress or is it time to re think our analytic and therapeutic strategies? Am J Transplant 4: 1289-1295, 2004. 93. Miller AA, De Silva TM, Jackman KA and Sobey CG. Effect of gender and sex hormones on vascular oxidative stress. Clin Exp Pharmacol Physiol 34: 1037-1043, 2007. 94. Miller ER,3rd, Pastor-Barriuso R, Dalal D, Riemersma RA, Appel LJ and Guallar E. Meta-analysis: high-dosage vi tamin E supplementation may increase all-cause mortality. Ann Intern Med 142: 37-46, 2005. 95. Modlinger PS, Wilcox CS and Aslam S. Nitric oxide, oxidative st ress, and progression of chronic renal failure. Semin Nephrol 24: 354-365, 2004. 96. Mohan RM, Golding S, Heaton DA, Danson EJ and Paterson DJ. Targeting neuronal nitric oxide synthase with gene transf er to modulate cardiac autonomic function. Prog Biophys Mol Biol 84: 321-344, 2004. 97. Nakagawa T, Kang DH, Ohashi R, Suga S, Herrera-Acosta J, Rodriguez-Iturbe B and Johnson RJ. Tubulointerstitial disease: role of ischemia and microvascular disease. Curr Opin Nephrol Hypertens 12: 233-241, 2003. 98. Naoum JJ, Woodside KJ, Zhang S, Rychahou PG and Hunter GC. Effects of rapamycin on the arterial inflammatory response in at herosclerotic plaques in Apo-E knockout mice. Transplant Proc 37: 1880-1884, 2005. 99. Napoli KL, Wang ME, Stepkowski SM and Kahan BD. Distribution of sirolimus in rat tissue. Clin Biochem 30: 135-142, 1997. 100. Neugarten J, Ding Q, Friedman A, Lei J and Silbiger S. Sex hormones and renal nitric oxide synthases. J Am Soc Nephrol 8: 1240-1246, 1997. 101. Ninova D, Covarrubias M, Rea DJ, Park WD, Grande JP and Stegall MD. Acute nephrotoxicity of tacrolimus and sirolimus in renal isografts: differential in tragraft expression of transforming growth factor-beta1 and alpha-smooth muscle actin. Transplantation 78: 338-344, 2004. 102. Oberbaumer I, Moser D and Bachmann S. Nitric oxide syntha se 1 mRNA: tissuespecific variants from rat with alternative first exons. Biol Chem 379: 913-919, 1998.

PAGE 139

139 103. Ogawa T, Kimoto M and Sasaoka K. Purification and properties of a new enzyme, NG,NG-dimethylarginine dimethyl aminohydrolase, from rat kidney. J Biol Chem 264: 1020510209, 1989. 104. Ortiz PA and Garvin JL. Cardiovascular and renal cont rol in NOS-deficient mouse models. Am J Physiol Regul Integr Comp Physiol 284: R628-38, 2003. 105. Pahlich S, Zakaryan RP and Gehring H. Protein arginine methyla tion: Cellular functions and methods of analysis. Biochim Biophys Acta 1764: 1890-1903, 2006. 106. Pawlak K, Pawlak D and Mysliwiec M. Cu/Zn superoxide dismutase plasma levels as a new useful clinical biomarker of oxidative stress in patients with end-stage renal disease. Clin Biochem 38: 700-705, 2005. 107. Perico N, Cattaneo D, Sayegh MH and Remuzzi G. Delayed graft function in kidney transplantation. Lancet 364: 1814-1827, 2004. 108. Persson AE and Bachmann S. Constitutive nitric oxide synthesis in the kidney--functions at the juxtaglomerular apparatus. Acta Physiol Scand 169: 317-324, 2000. 109. Prescott LM and Jones ME. Modified methods for the determination of carbamyl aspartate. Anal Biochem 32: 408-419, 1969. 110. Ratner S and Petrack B. Biosynthesis of urea. IV. Further studies on condensation in arginine synthesis from citrulline. J Biol Chem 200: 161-174, 1953. 111. Reckelhoff JF, Kanji V, Racusen LC, Schmidt AM, Yan SD, Marrow J, Roberts LJ,2nd and Salahudeen AK. Vitamin E ameliorates enhanced renal lipid peroxidation and accumulation of F2-isoprostanes in aging kidneys. Am J Physiol 274: R767-74, 1998. 112. Reutzel-Selke A, Zschockelt T, Denecke C, Bachmann U, Jurisch A, Pratschke J, Schmidbauer G, Volk HD, Neuhaus P and Tullius SG. Short-term immunosuppressive treatment of the donor ameliorate s consequences of ischemia/ re perfusion injury and long-term graft function in renal all ografts from older donors. Transplantation 75: 1786-1792, 2003. 113. Roczniak A, Levine DZ and Burns KD. Localization of protein inhibitor of neuronal nitric oxide synthase in rat kidney. Am J Physiol Renal Physiol 278: F702-7, 2000. 114. Safirstein R, Miller P and Kahn T. Cortical and papillary absorp tive defects in gentamicin nephrotoxicity. Kidney Int 24: 526-533, 1983. 115. Saran R, Novak JE, Desai A, Abdulhayogl u E, Warren JS, Bustami R, Handelman GJ, Barbato D, Weitzel W, D'Alecy LG and Rajagopalan S. Impact of vitamin E on plasma asymmetric dimethylarginine (ADMA) in chronic kidney disease (CKD): a pilot study. Nephrol Dial Transplant 18: 2415-2420, 2003.

PAGE 140

140 116. Sartori-Valinotti JC, Iliescu R, Fort epiani LA, Yanes LL and Reckelhoff JF. Sex differences in oxidative stress and the impact on blood pressure cont rol and cardiovascular disease. Clin Exp Pharmacol Physiol 34: 938-945, 2007. 117. Saur D, Paehge H, Schusdziarra V and Allescher HD. Distinct expression of splice variants of neuronal nitric oxide synthase in the human gastrointestinal tract. Gastroenterology 118: 849-858, 2000. 118. Scalera F, Kielstein JT, Martens-Lobenhoffer J, Postel SC, Tager M and Bode-Boger SM. Erythropoietin increases asymmetric dimet hylarginine in endothe lial cells: role of dimethylarginine dimethylaminohydrolase. J Am Soc Nephrol 16: 892-898, 2005. 119. Schiffrin EL, Lipman ML and Mann JF. Chronic kidney disease: effects on the cardiovascular system. Circulation 116: 85-97, 2007. 120. Schmidt RJ and Baylis C. Total nitric oxide pr oduction is low in patients with chronic renal disease. Kidney Int 58: 1261-1266, 2000. 121. Schramm L, La M, Heidbreder E, Hecker M, Beckman JS, Lopau K, Zimmermann J, Rendl J, Reiners C, Winderl S, Wanner C and Schmidt HH. L-arginine deficiency and supplementation in experimental acute renal failure and in human kidney transplantation. Kidney Int 61: 1423-1432, 2002. 122. Schulze F, Maas R, Freese R, Schwedhelm E, Silberhorn E and Boger RH. Determination of a reference value for N(G) N(G)-dimethyl-L-arginine in 500 subjects. Eur J Clin Invest 35: 622-626, 2005. 123. Shah SV, Baliga R, Rajapurkar M and Fonseca VA. Oxidants in chronic kidney disease. J Am Soc Nephrol 18: 16-28, 2007. 124. Stojanovic T, Grone HJ, Gieseler RK, Klan ke B, Schlemminger R, Tsikas D and Grone EF. Enhanced renal allograft re jection by inhibitors of nitric oxide synthase: a nonimmunologic influence on alloreactivity. Lab Invest 74: 496-512, 1996. 125. Stuehr DJ and Marletta MA. Mammalian nitrate biosynthesis: mouse macrophages produce nitrite and nitrate in response to Escherichia coli lipopolysaccharide. Proc Natl Acad Sci U S A 82: 7738-7742, 1985. 126. Stuhlinger MC, Tsao PS, Her JH, Kimo to M, Balint RF and Cooke JP. Homocysteine impairs the nitric oxide synthase pathway: role of asymmetric dimethylarginine. Circulation 104: 2569-2575, 2001. 127. Sullivan JC, Sasser JM and Pollock JS. Sexual dimorphism in oxidant status in spontaneously hypertensive rats. Am J Physiol Regul Integr Comp Physiol 292: R764-8, 2007. 128. Sydow K and Munzel T. ADMA and oxidative stress. Atheroscler Suppl 4: 41-51, 2003.

PAGE 141

141 129. Sydow K, Schwedhelm E, Ar akawa N, Bode-Boger SM, Tsik as D, Hornig B, Frolich JC and Boger RH. ADMA and oxidative stress are respons ible for endothelial dysfunction in hyperhomocyst(e)inemia: effects of L-arginine and B vitamins. Cardiovasc Res 57: 244-252, 2003. 130. Szabo AJ, Wagner L, Erdely A, Lau K and Baylis C. Renal neuronal nitric oxide synthase protein expression as a marker of renal injury. Kidney Int 64: 1765-1771, 2003. 131. Szentivanyi M,Jr, Zou AP, Mattson DL, Soa res P, Moreno C, Roman RJ and Cowley AW,Jr. Renal medullary nitric oxide deficit of Dahl S rats enhances hypertensive actions of angiotensin II. Am J Physiol Regul Integr Comp Physiol 283: R266-72, 2002. 132. Tain YL and Baylis C. Determination of dimethylar ginine dimethylaminohydrolase activity in the kidney. Kidney Int 72: 886-9, 2007. 133. Tain YL, Freshour G, Dikalova A, Griendling K and Baylis C. Vitamin E reduces glomerulosclerosis, restores renal neuronal NOS, and suppresses oxida tive stress in the 5/6 nephrectomized rat. Am J Physiol Renal Physiol 292: F1404-10, 2007. 134. Tain YL, Muller V, Szabo A, Dikal ova A, Griendling K and Baylis C. Lack of longterm protective effect of antioxidant/antiinflammatory therapy in transplant-induced ischemia/reperfusion injury. Am J Nephrol 26: 213-217, 2006. 135. Tan B, Jiang DJ, Huang H, Jia SJ, Jiang JL, Hu CP and Li YJ. Taurine protects against low-density lipoprotein-induced endothel ial dysfunction by the DDAH/ADMA pathway. Vascul Pharmacol 46: 338-345, 2007. 136. Tatematsu S, Wakino S, Kanda T, Homma K, Yoshioka K, Hasegawa K, Sugano N, Kimoto M, Saruta T and Hayashi K. Role of nitric oxide-produci ng and -degrading pathways in coronary endothelial dysfunc tion in chronic kidney disease. J Am Soc Nephrol 18: 741-749, 2007. 137. Teerlink T. ADMA metabolism and clearance. Vasc Med 10 Suppl 1: S73-81, 2005. 138. Tojo A, Kimoto M and Wilcox CS. Renal expression of constitutive NOS and DDAH: separate effects of salt intake and angiotensin. Kidney Int 58: 2075-2083, 2000. 139. Tojo A, Onozato ML and Fujita T. Role of macula densa neuron al nitric oxide synthase in renal diseases. Med Mol Morphol 39: 2-7, 2006. 140. Tojo A, Welch WJ, Bremer V, Kimoto M, Kimura K, Omata M, Ogawa T, Vallance P and Wilcox CS. Colocalization of demethylating enzyme s and NOS and functional effects of methylarginines in rat kidney. Kidney Int 52: 1593-1601, 1997. 141. Tomasoni S and Benigni A. Gene therapy: how to target th e kidney. Promises and pitfalls. Curr Gene Ther 4: 115-122, 2004.

PAGE 142

142 142. Tran CT, Fox MF, Vallance P and Leiper JM. Chromosomal localization, gene structure, and expression pattern of DDAH1: comparison wi th DDAH2 and implications for evolutionary origins. Genomics 68: 101-105, 2000. 143. Ueda S, Kato S, Matsuoka H, Kimoto M, Okuda S, Morimatsu M and Imaizumi T. Regulation of cytokine-induced ni tric oxide synthesis by asymmetr ic dimethylarginine: role of dimethylarginine dimethylaminohydrolase. Circ Res 92: 226-233, 2003. 144. Umemura T, Kitamura Y, Kanki K, Maruyam a S, Okazaki K, Imazawa T, Nishimura T, Hasegawa R, Nishikawa A and Hirose M. Dose-related changes of oxidative stress and cell proliferation in kidneys of male and female F344 rats exposed to potassium bromate. Cancer Sci 95: 393-398, 2004. 145. Valdivielso JM, Crespo C, Alonso JR, Martinez-Salgado C, Eleno N, Arevalo M, Perez-Barriocanal F and Lopez-Novoa JM. Renal ischemia in the rat stimulates glomerular nitric oxide synthesis. Am J Physiol Regul Integr Comp Physiol 280: R771-9, 2001. 146. Vallance P and Leiper J. Cardiovascular biology of the asymmetric dimethylarginine:dimethylarginine dimethylaminohydrolase pathway. Arterioscler Thromb Vasc Biol 24: 1023-1030, 2004. 147. Vaziri ND. Oxidative stress in uremia: nature, m echanisms, and potential consequences. Semin Nephrol 24: 469-473, 2004. 148. Vaziri ND. Roles of oxidative stress and antioxidant therapy in chronic kidney disease and hypertension. Curr Opin Nephrol Hypertens 13: 93-99, 2004. 149. Vaziri ND. Effect of chronic renal failure on nitric oxide metabolism. Am J Kidney Dis 38: S74-9, 2001. 150. Vaziri ND, Dicus M, Ho ND, Boroujerdi-Rad L and Sindhu RK. Oxidative stress and dysregulation of superoxide dismutase a nd NADPH oxidase in renal insufficiency. Kidney Int 63: 179-185, 2003. 151. Vaziri ND, Ni Z, Oveisi F, Liang K and Pandian R. Enhanced nitric oxide inactivation and protein nitration by reactive oxyge n species in renal insufficiency. Hypertension 39: 135141, 2002. 152. Vos IH, Joles JA and Rabelink TJ. The role of nitric oxide in renal transplantation. Semin Nephrol 24: 379-388, 2004. 153. Wagner L, Riggleman A, Erdely A, Couser W and Baylis C. Reduced nitric oxide synthase activity in rats with chronic renal disease due to glomerulonephritis. Kidney Int 62: 532536, 2002. 154. Wang D, Gill PS, Chabrashvili T, Onozato ML, Raggio J, Mendonca M, Dennehy K, Li M, Modlinger P, Leiper J, Vallance P, Adl er O, Leone A, Tojo A, Welch WJ and Wilcox CS. Isoform-specific regulation by N(G),N(G)-dimet hylarginine dimethylaminohydrolase of rat

PAGE 143

143 serum asymmetric dimethylarginine and vascul ar endothelium-derived relaxing factor/NO. Circ Res 101: 627-635, 2007. 155. Wang X, Desai K, Juurlink BH, de Champlain J and Wu L. Gender-related differences in advanced glycation endproducts, oxidative stre ss markers and nitric oxide synthases in rats. Kidney Int 69: 281-287, 2006. 156. Wang Y, Newton DC and Marsden PA. Neuronal NOS: gene structure, mRNA diversity, and functional relevance. Crit Rev Neurobiol 13: 21-43, 1999. 157. Wasowicz W, Neve J and Peretz A. Optimized steps in fluorometric determination of thiobarbituric acid-reactive substances in serum: importance of extraction pH and influence of sample preservation and storage. Clin Chem 39: 2522-2526, 1993. 158. Watanabe Y, Nishio M, Hamaji S and Hidaka H. Inter-isoformal regulation of nitric oxide synthase through heteromeric dimerization. Biochim Biophys Acta 1388: 199-208, 1998. 159. Xiao S, Wagner L, Schmidt RJ and Baylis C. Circulating endothelial nitric oxide synthase inhibitory factor in some patients with chronic renal disease. Kidney Int 59: 1466-1472, 2001. 160. Xie J, Roddy P, Rife TK, Murad F and Young AP. Two closely linked but separable promoters for human neuronal nitric oxide synthase gene transcription. Proc Natl Acad Sci U S A 92: 1242-1246, 1995. 161. Yilmaz MI, Saglam M, Caglar K, Cakir E, Sonmez A, Ozgurtas T, Aydin A, Eyileten T, Ozcan O, Acikel C, Tasar M, Genctoy G, Erbil K, Vural A and Zoccali C. The determinants of endothelial dysfunction in CKD: oxidative stress and asymmetric dimethylarginine. Am J Kidney Dis 47: 42-50, 2006. 162. Yin QF and Xiong Y. Pravastatin restores DDAH activ ity and endothelium-dependent relaxation of rat aorta after exposure to glycated protein. J Cardiovasc Pharmacol 45: 525-532, 2005. 163. Yu Q, Shao R, Qian HS, George SE and Rockey DC. Gene transfer of the neuronal NO synthase isoform to cirrhotic rat liver ameliorates portal hypertension. J Clin Invest 105: 741748, 2000. 164. Zatz R and Baylis C. Chronic nitric oxide inhibition model six years on. Hypertension 32: 958-964, 1998.

PAGE 144

144 BIOGRAPHICAL SKETCH Mr. Tain was born in 1967, in Tainan, Taiw an. In June 1992, Mr. Tain graduated from China Medical College, Taiwan with an M.D. degr ee. He later received his residency training in pediatrics and fellow training in pediatri c nephrology at Chang Gung Memorial Hospital (CGMH), Taiwan. From 1999 to 2002, Mr. Tain worked as an attending pe diatrician at CGMH at Kaohsiung, Taiwan. At the same time, he st arted his research as a graduate student in Graduate Institute of Clinical Medicine at th e Chang Gung University and attained a masters degree in biomedicine in December 2002. To expand his academic horizons, Mr. Tain came to the U.S. with a pre-doctoral fellowship award from his hospital. He was acce pted into a Ph.D. graduate program in the Department of Physiology and Pharmacology, West Virginia University, in January 2003. There he worked in the laboratory of Dr. Chris Bayl is, studying the progression of renal disease. In summer 2004, he moved with Dr. Baylis to the Univ ersity of Florida. There, he worked as a graduate student studying nitric oxide in chro nic kidney disease. He received a Bronze Medal Finalist in Medical Guild Gradua te Student Research, a Graduate Fellowship for Outstanding Research Award, and an Outstanding Internati onal Student Academic Award in 2007. Mr. Tain will attain a Ph.D. in bi omedical science in December 2007, a nd plans to return to Taiwan to work at Chang Gung Memorial Hospital in Kaohsiung, Taiwan.