<%BANNER%>

Tight Control of Recombinant Adeno-Associated Viral Vector-Mediated Striatal Glial Cell Line-Derived Neurotrophic Factor...

Permanent Link: http://ufdc.ufl.edu/UFE0021547/00001

Material Information

Title: Tight Control of Recombinant Adeno-Associated Viral Vector-Mediated Striatal Glial Cell Line-Derived Neurotrophic Factor Expression in Vivo via a Tetracycline-off Regulatable Promoter System
Physical Description: 1 online resource (50 p.)
Language: english
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2008

Subjects

Subjects / Keywords: aav, disease, gdnf, parkinson, regulation, system, tetracycline
Medicine -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: For Parkinson disease, Glial cell line-derived neurotrophic factor (GDNF) expression has been shown to be neuroprotective and neurorestorative in dopaminergic neurons. However it has been proven that high levels of GDNF expression results in decreased expression of tyrosine hydroxylase (TH). This will then induce a negative feedback loop that will diminish the rate of tyrosine to L-dopa conversion. Thus, tight control of GDNF expression is crucial. Three experiments were performed in an attempt to develop a tight doxycycline modulated transgene system. The most successful attempt (pTight-hGDNF/pTRUF20-tTA2) utilized the tet-off transactivator (tTA) in recombinant adeno-associated viral vector to express GDNF. In vivo, the level of GDNF expression in the doxycycline-treated versus untreated animals was significantly different. Also, the level of GDNF expression in the uninjected side was significantly different than the injected side of the brain. In conclusion, the pTight-hGDNF and pTRUF20-tTA2 vectors, express successfully a basal level of GDNF undistinguishable from the endogenous striatal level when induced and biologically relevant levels when uninduced, as measured by quantitative ELISA assay. Those vectors may be useful for gene therapy applications where tight transgene expression is required.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Thesis: Thesis (M.S.)--University of Florida, 2008.
Local: Adviser: Mandel, Ronald J.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2008-11-30

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2008
System ID: UFE0021547:00001

Permanent Link: http://ufdc.ufl.edu/UFE0021547/00001

Material Information

Title: Tight Control of Recombinant Adeno-Associated Viral Vector-Mediated Striatal Glial Cell Line-Derived Neurotrophic Factor Expression in Vivo via a Tetracycline-off Regulatable Promoter System
Physical Description: 1 online resource (50 p.)
Language: english
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2008

Subjects

Subjects / Keywords: aav, disease, gdnf, parkinson, regulation, system, tetracycline
Medicine -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: For Parkinson disease, Glial cell line-derived neurotrophic factor (GDNF) expression has been shown to be neuroprotective and neurorestorative in dopaminergic neurons. However it has been proven that high levels of GDNF expression results in decreased expression of tyrosine hydroxylase (TH). This will then induce a negative feedback loop that will diminish the rate of tyrosine to L-dopa conversion. Thus, tight control of GDNF expression is crucial. Three experiments were performed in an attempt to develop a tight doxycycline modulated transgene system. The most successful attempt (pTight-hGDNF/pTRUF20-tTA2) utilized the tet-off transactivator (tTA) in recombinant adeno-associated viral vector to express GDNF. In vivo, the level of GDNF expression in the doxycycline-treated versus untreated animals was significantly different. Also, the level of GDNF expression in the uninjected side was significantly different than the injected side of the brain. In conclusion, the pTight-hGDNF and pTRUF20-tTA2 vectors, express successfully a basal level of GDNF undistinguishable from the endogenous striatal level when induced and biologically relevant levels when uninduced, as measured by quantitative ELISA assay. Those vectors may be useful for gene therapy applications where tight transgene expression is required.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Thesis: Thesis (M.S.)--University of Florida, 2008.
Local: Adviser: Mandel, Ronald J.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2008-11-30

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2008
System ID: UFE0021547:00001


This item has the following downloads:


Full Text

PAGE 1

1 TIGHT CONTROL OF RECOMBI NANT ADENO-ASSOCIATED VIRAL VECTOR-MEDIATED STRIATAL GLIAL CELL LINE-DERIVED NEUROTROPHIC FACTOR EXPRESSION IN VIVO VIA A TETRACYCLINE-OFF REGULATABLE PROMOTER SYSTEM By JULIA LEI CHIEH HUANG A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2008

PAGE 2

2 2008 Julia Lei Chieh Huang

PAGE 3

3 To my family and friends. Without th em, this would not have been possible.

PAGE 4

4 ACKNOWLEDGMENTS I thank Ronald Mandel for his guidance and sup port throughout the pursu it of this project. I thank Nicholas Muzyczka and Gregory Schultz for serving on m y supervisory committee. I thank Layla Sullivan for providing all the vectors used in this study. I thank Kevin Foust for sharing and teaching his ELISA expertise. I thank Fredric Manfredsson for his surgical expertise. I thank the rest of Mandel lab for technical aid and general help.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS...............................................................................................................4LIST OF FIGURES.........................................................................................................................6ABSTRACT.....................................................................................................................................7 CHAP TER 1 INTRODUCTION....................................................................................................................92 BACKGROUND.................................................................................................................... 11Parkinson Disease.............................................................................................................. .....11Dopamine................................................................................................................................11Glial Cell Line-derived Ne urotrophic Factor (GDNF)........................................................... 12Adeno-Associated Vectors for Transgene Delivery............................................................... 14Tetracycline Regulation System............................................................................................. 163 MATERIAL and METHODS.................................................................................................22Vector and Virus Preparation................................................................................................. 22Intracerebral Injection of AAV Vectors................................................................................. 23Experimental Design............................................................................................................ ..24Perfusion and Tissue Processing............................................................................................24Recovery of Fresh Tissue for ELISA.....................................................................................25Immunohistochemistry........................................................................................................... 25Enzyme-Linked ImmunoSorbent Assay................................................................................. 26Statistical Analysis........................................................................................................... .......264 RESULTS...............................................................................................................................29Experiment 1................................................................................................................... ........29Experiment 2................................................................................................................... ........30Experiment 3................................................................................................................... ........305 DISCUSSION.........................................................................................................................36LIST OF REFERENCES...............................................................................................................41BIOGRAPHICAL SKETCH.........................................................................................................50

PAGE 6

6 LIST OF FIGURES Figure page 2-1 Biosynthetic pathway of Dopamine from Tyrosine........................................................... 20 2-2 Tetracycline regulated system............................................................................................21 3-1 Vector constructs for tetracy cline regulated GDNF expression. .......................................27 3-2 Overview of Experiment 3................................................................................................. 28 4-1 The GDNF immunostaining for Experiment 1.................................................................. 33 4-2 Average protein level by ELISA for Experim ent 1........................................................... 33 4-3 The VP16 immunostaining.for Experiment 2.................................................................... 34 4-4 Timeline and results of Experiment 3................................................................................ 35

PAGE 7

7 Abstract of Thesis Presen ted to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Master of Science TIGHT CONTROL OF RECOMBI NANT ADENO-ASSOCIATED VIRAL VECTOR-MEDIATED STRIATAL GLIAL CELL LINE-DERIVED NEUROTROPHIC FACTOR EXPRESSION IN VIVO VIA A TETRACYCLINE-OFF REGULATABLE PROMOTER SYSTEM By Julia Lei Chieh Huang May 2008 Chair: Ronald J. Mandel Major: Medical Sciences For Parkinson disease, Glial cell line-derived neurotrophic factor ( GDNF) expression has been shown to be neuroprotectiv e and neurorestorative in dopaminergic neurons. However it has been proven that high levels of GDNF expression results in decreased expression of tyrosine hydroxylase (TH). This will then induce a negative feedback loop that will diminish the rate of tyrosine to L-dopa conversion. Thus, tight c ontrol of GDNF expression is crucial. Three experiments were performed in an attempt to develop a tight doxycyclin e modulated transgene system. The most successful attempt (pTi ght-hGDNF/pTRUF20-tTA2) utilized the tet-off transactivator (tTA) in reco mbinant adeno-associated viral vector to express GDNF. In vivo, the level of GDNF expression in the doxycycline-treated vers us untreated animals was significantly different. Also, the level of GDNF expression in the uninjected side was significantly different than the injected side of the brain. In conclusion, the pTight-hGDNF and pTRUF2 0-tTA2 vectors, express successfully a basal level of GDNF undistinguishable from th e endogenous striatal level when induced and

PAGE 8

8 biologically relevant levels when uninduced, as measured by quantitative ELISA assay. Those vectors may be useful for gene therapy applica tions where tight transgen e expression is required.

PAGE 9

9 CHAPTER 1 INTRODUCTION Parkinson disease (PD) is a neurodegenerative movement disorder that mainly affects the elderly. The hallmark characteristic of PD is the degeneration of dopamine-producing nerve cells in the brain, specifically in the substantia nigra (SN) [1]. Dopamine (DA) is the chemical messenger responsible for transmitting signals between the substantia nigra and corpus striatum to produce normal, balanced movements [1, 2]. Loss of dopamine results in abnormal nerve firing patterns in the brain, causing impaired mo vement [3]. The cardi nal symptoms of PD include, but not limited to: tremor, rigidity, brad ykinesia, and akinesia. Symptoms of PD may appear at any age, but the average age of onset is 60 years old [4, 5]. Unfortunately, onset of symptoms appears when 70 to 80% of dopaminergic neurons are lost [2]. With the loss of the majoring of the dopaminergic neurons, the sympto ms usually worsen after onset and eventually lead to severe immobility if not treated. The current conventional therapies aim at replacing the dopamine in the striatum in order to provide a symptomatic treatment. However, since it is a neurodegenerative disease, these cu rrent treatments, such as oral L-dopa, looses efficacy after an average of 6 years [6, 7]. Complications of efficacy begin with a wearing-off phenomenon in which the duration of the beneficial effect from each L-dopa treatment begins to shorten [7]. As a result, patients have to take L-dopa more fre quently in order to accommodate the effect. Thus, prevention of degeneration of further dopamine neurons is essential. Glial cell line-derived neurotroph ic factor (GDNF) is the most promising of neurotrophic factors. GDNF have shown to have neuroprotectiv e and neurorestorative e ffects in a variety of animal models of PD [8-13]. The purpose of th is study is to propose a novel, tight regulated gene therapy system. This mixed vector expressi on system that utilizes the tet-off transactivator shows high promises due to the minimal basa l expression expressed when uninduced. This

PAGE 10

10 novel system delivers GDNF expression and is precisely controlled through the presence or absence of inducing agents.

PAGE 11

11 CHAPTER 2 BACKGROUND Parkinson Disease Parkinson disease (PD) is the second mo st common neurodegenerative disorder in the United States. It has a prevalence of 0.2 to 0.3% in the population of Europe and North America [14, 15]. PD is progressive and involves the degeneration of dopamine producing neurons in the substantia nigra (SN); eventually becoming a seve re, end-stage disease. There are two types of PD: familial and sporadic. Familial cases are due to inherited mutations of the parkin gene [16]. These familial cases are exceedingly rare as most in cidents of PD are sporadic. Past research has suggested that the pathogenesis of the diseas e may be related to ex cessive oxidative stress, lack of free radical scavenging products, or abnormalities of mitochondrial energy production [17, 18]. For both types of PD, the current therapy is to utilize L-dopa to enhance striatal dopamine levels. Dopamine L-Dopa is the precursor of dopa mine. L-dopa is synthesized from the dietary amino acid tyrosine in dopaminergic neurons (Figure 2-1). This step involves the actions of the enzyme tyrosine hydroxylase (TH). TH requires the pterin cofactor, tetrahydrobiopterin (BH4). TH is the rate limiting enzyme in the conversion of ty rosine to L-dopa. L-dopa readily crosses the blood-brain barrier and is, presum ably, taken up by all cells that express L-aromatic amino acid decarboxylase (L-AADC). L-AADC then converts L-dopa to DA [19]. Oral L-dopa is currently the most commonly prescribed tr eatment for PD in humans [20]. Other non-oral L-dopa pretreatme nts have been shown to reduce behavior symptoms in animal models of PD. However, even though da ily L-dopa administration has been shown to rescue DA deficient mice in feeding behavior. It is effective fo r approximately 6 hours but then

PAGE 12

12 the DA concentration declines and the mice stop drinking and eating [21]. Thus, daily administrations are essential to keeping the mice alive. In humans, similar conditions occur within 4 years, as more dopaminergic neurons degenerate, increased concentrations and frequency of administration of L-dopa must occu r to control the disease [22]. Unfortunately, L-dopa treatments do not stop the natural progression of PD. Ultimately, there is a necessity for treatment that affects the progression of the disease rather than just the symptoms. Glial Cell Line-derived Neurotrophic Factor (GDNF) GDNF is a disulfide-linked hom odimeric neurot rophic factor that is a member of the transforming growth factorsuperfamily of proteins [23]. GDNF signals through a multicomponent receptor system, composed of a member receptor RET and glycosylphophatidyl-inosito l-linked protein (GFR) receptor. The complex then induces receptor tyrosine autophosphorylation [24] and activation of a signaling cascade which finally leads to inhibition of apoptosis [25]. Using th e animal model of PD, G DNF has been shown to improve conditions such as br adykinesia, rigidity, and postural instability [8, 26-29]. GDNF and Neuroprotection: In 1993, Lin et al [23] first purified and cloned GDNF and noted its ability in midbrain culture to enhance the survival and morphological differentiation of dopaminergic neurons. This began a series of experiments that utilized GDNF in various delivery systems to explore its ability to neur oprotect and neurorestore dopaminergic neurons. Those experiments can be categorized by the choice of protein delivery system for GDNF. The earliest experiments utilized intracerebral GDNF protein injections. In 1995, Tomac et al [30] injected GDNF into either the substantia nigra (S N) or into the striatum 24 hours before 1-methyl 4-phenyl 1,2,3,6-tetrahydropyridine (MPTP) injection. MPTP is a char acterized neurotoxin that leads to long-term loss of dopamine de pletion in striatum [31]. Tomac et al [32-35] showed that GDNF administrations can protect ef fectively against damages induced by neurotoxin if injected

PAGE 13

13 at the site of damage. In 1996, Gash et al [28] studied the effect s of infused GDNF for two months via programmable subcutaneous pumps. Dopa mine levels were observed to be twice as high in infused GDNF model versus the vehicl e treated control. In 1997, to examine the protective nature of GDNF in other mammals, Clarkson et al [36] expanded the examination of GDNF protein administration into primary ventral mesencephalic cultures from human embryo to bonnet monkey embryos. This study concluded that GDNF promotes the in vitro survival of embryonic dopamine neuron across three species: rats, humans, and monkeys. After GDNF protein injections, alternative delivery systems emerged due to the problems associated with programmable infusion devices [37]. This guide d the researchers to s eek long-term delivery methods for GDNF such as adenovirus [9, 10], le ntivirus [38, 39], and adeno-associated (rAAV) [41, 42] delivery systems. In 1997, Choi-Lundberg et al [9] used an adenoviral delivery system to demonstrate that biosynthesized GDNF protects the majority of DA neurons from degeneration after exposure to 6-OHDA. Similarly, Bilang-Bleuel et al [10] found that the pret reatment of GDNF to both dopamine cell bodies and dopamine nerve terminal s prevented dopamine cell death and striatal denervation. Additionally, th e authors reported an improveme nt in behavior deficits. The lentiviral GDNF delivery system was used by Kordower et al [38] in the striatum and SN of aged monkeys and monkeys subjected to an MPTP lesion 1 week before GDNF vector injection. They found that overexpression of GD NF induced an increase in TH positive fiber density and overall up-regulation in dopamine levels in the st riatum. All MPTP lesioned monkeys that were subjected to lentiviral GDNF vector injecti on eventually recovered over the three month observation period. In c ontrast, a later study by Georgievska et al [39], who also used lentiviral GDNF vectors to overexpress GDNF in 6-OHDA lesioned rats, the animals in this

PAGE 14

14 study remained functionally impaired throughout th e observational period. One must point out that in the Georgievska et al [39] study there was extensive sprouting of the TH positive fibers in the SN accompanied by deplet ion of TH from the striatal terminals. The level of GDNF expression was five to ten tim es higher in the Georgievska et al [39] study than those seen in Kordower et al [38] study. This suggest that aberrant TH fiber sprouting in the downstream striatal targets (SN as compared to striatum) and depletion of TH induced by high levels local GDNF is unfavorable toward functional re covery in lesioned models [40]. In the rAAV-GDNF studies, Mandel et al [41, 42] demonstrated that rAAV can deliver functional levels of GDNF expression in lesioned animals. Eslamboli et al [11] proceeded to inject GDNF into marmoset monkeys as a pret reatment of neurotoxin. Again the authors concluded that GDNF was able to protect SN cells. Wang et al [13] and Kozlowski et al [43] examined similar issues of GDNF neuroprotec tion under extend period of time and found similar results. In conclusion, these i nvestigations have observed that GDNF can protect neurons from different neurotoxins and in multiple species. GDNF, in all three different delivery systems, has shown to be neuroprotective, and able to induce an up-regulation of dopamine in intact and lesioned dopa minergic neurons. In the GDNF protein administration experiments, GDNF needed to be delivered con tinuously over long-term to sustain therapeutic effects. Howe ver, as demonstrated by Georgivska et al [39, 44], regulation of the GDNF delivery system is nece ssary to avoid overexpression of GDNF that would result in decrease expression of TH as well as aberrant fiber sprouting in the SN. Adeno-Associated Vectors for Transgene Delivery W ild type adeno-associated vector (AAV) is a nonpathoge nic parvovirus whose genome is encapsulated as a single-str anded DNA molecule [45]. AAV is not capable of autonomous replication and spread. For a su ccessful replication, a helper virus, such as adenovirus, that

PAGE 15

15 provides the proteins necessary for AAV replication must be transduced alongside AAV [46, 47]. Without helper virus, AAV can establish a latent infecti on in which its chromosome is integrated into the cellular genome [48]. In order to utilize AAV as the vehicle for gene transfer, 96% of the parental genome is deleted such th at only the terminal repeats remain. Terminal repeats are necessary for recognition signals fo r DNA replication and packaging. The helper virus with deleted replication and packaging si gnals provides the AAV st ructural proteins and foreign genes in a plasmid in trans by coinfection [45, 49, 50]. Th e construction of this unique AAV vector eliminates any po ssible viral pathogenicity. Long-term expression of a therapeutic gene can be safely and stably transduced by AAV in adult rat brain [51]. Expressi on of therapeutic genes have been shown to exist for time periods of up to the lifetime of animal observed by di fferent researchers [47, 52-54]. However, a disadvantage of AAV is the cassette limit of 4.7 kb that can be packaged [47]. Recently, AAV serotypes have been studied to maximize the ability to control and widely distribute transgene expression. There are drama tic differences in the transduction efficiency and cell specificity of AAV of different serotype s. AAV2 serotype has been the most commonly used in the past, but currently, since the de velopment of pseudotyping AAV vectors have been developed, AAV1 and AAV5 are now a part of the inve stigation of gene tran sfer vehicles [55]. Pseudotyped vectors are vectors th at are derived from the invert ed terminal repeats and Rep proteins of AAV2 serotype virus and the capsid protein of another [56]. Burger et al [57, 58] characterized the sero types of AAV1, AAV2, and AAV5 quantitatively for transgene expression in the nervous system. They found that AAV1 and AAV5 distribute transgene expression over longer distances and transduce more viral genomes than with AAV2. In the striatum, AAV1 and AAV5 transduced approximately 8to 10fold

PAGE 16

16 more neurons than AAV2. Also, it was found th at AAV2 was limited by cell tropism, with regards to transduction, while AAV1 and AAV5 had a much more diverse span. To eliminate any outside factors that might in fluence transduction properties be tween the serotypes, identical transgene cassettes with AAV2 term inal repeats was packaged in different capsids [57]. This assures any differences observed in transduction efficiency or tropism are as a result of different viral capsid protein, their recept or tropism, and their intracellular trafficking following cell entry [57, 59-61]. The intention of this study is to devel op and characterize a no vel, tight doxycycline modulated AAV2/5 vector for controlled GDNF expression. This study will illustrate a controllable system without residua l activity over different periods of time. In the future, we anticipate examination of this system over extended periods of time and its potential use in future human Parkinson Disease clinical trials. Tetracycline Regulation System Gossen and Bujard [62] first described th e tetracycline regulation system for gene expression in 1992. The system is a modification of the Tn10-specified tetracy cline-resistance operon of E. Coli. In the Tet-OFF version, when tetracy cline or its derivative, doxycycline (dox) is present; the interaction between tetracycline repressor ( tet R) and tetracycline operator ( tet O) is prevented. Dox causes a conformational change in the tetR moiety and tet R loses affinity for tetO. Without tet R bound to tet O, gene transcription does not occur. Normally, the target gene is under transcriptional control of a tetracycline-responsive promoter element (TRE), a seven tetO moiety placed upstream of the human cytomegalovirus (hCMV) promoter. However, by fusing tetR with the C-terminal domain of VP16 from herpes simplex virus (HSV), a hybrid transactivator (tTA) was formed (F igure 2-2). In comparison to the original repressor, the tTA is a superior stimulator for minimal promoters th at are fused to the te tracycline operator ( tet O)

PAGE 17

17 sequences. Expression of the transgene can be regulated both reversibly, expression is turned back on again when tetracycline has cleared out of the system, and quantitatively by exposing the system to varying concentrations of tetracycline or dox [62]. Four amino acids substitution in the tet R led to reverse tet R. Reverse tet R was found to have a mutuated phenotype and only binds to tet O in the presence of tetracycline. This version of tetracycline regulation is known as Tet-ON. A reverse transactivator (rtTA) is completed when the reverse tet R is fused with the C-terminal domain of VP16. Transcription of transgene expression is now regulated by rtTA and only av ailable when tetracycline is administered (Figure 2-2) [63, 64]. Novel Tetracycline Regulation Systems: As is the case with any transgene, minimal basal activity is desirable when uninduced because of the possibility of unexamined long-term side effects. However, when induced, the optimal situation is to have the regulation system be as sensitive as possible to the substrate and to have high levels of transgene expression. Since the tet transactivators have been engineered, novel modifications of the transactivators have been manuf actured to strive for minimal basal activity and increased sensitivity to the inducer, tetr acycline or dox. In 2000, Urlinger et al [65] engineered a mutated rtTA called rtTA2s-M2 by five amino aci d exchanges in the tet R. The advantages to rtTAs-M2 were that it had a lower background expression a nd ten-fold higher sensiti vity to dox induction. According to Urlinger et al [65] full activation was achieve d with 0.1 g/ml of dox in rtTAs-M2 in comparison with the 1g/ml of dox needed with rtTA in HeLa cells. Lamartina et al [66] tested the rtTA2s-M2 in vivo in mice and found similar result s when testing dox sensitivity. Lamartina et al [66] also tested dox modulation for an extended time, 10 months, and found tight control. However, when examining basal activity, the rtTA2s-M2 displayed a basal activity

PAGE 18

18 2to 3-fold higher than the other mutant, rtTA2s-S2. Again, high basal level is undesirable because of possible unknown side effects of the transgene. In 2003, Koponen et al [67] used lentiviral vector sy stem consisting of two HIV-1-based self-inactivating viruse s and examined rtTA2s-M2 in combination with rtTA responsible promoter. The vectors were first transduced in vitro and then tested in vivo in rat brain. Koponen et al [67] concluded rtTA2s-M2 eliminated background expression since expression was at or under detection levels. Chtarto et al [68] demonstrated sim ilar tight regulation and higher transgene product resu lts but using adeno-associated virus. Chtarto et al [69] examined rtTA2s-M2 along with introducing a woodchuck hepati tis virus posttranscriptional regulatory element (WPRE) downstream to the rtTA2s-M2 coding sequence (rtTA2s-M2-WPRE) using AAV. The rtTA2s-M2 vector packaged in AAV provide d a similar induced but a lower uninduced level of transgene expression in co mparison to rtTA. In comparison, the rtTA2s-M2WPRE significantly increased th e induced level of transgene expression, but when uninduced, there was also a significant increase in level of transgene expression. Chtarto et al [69] suggested that this phenomenon was due to the addition of the WPRE sequence, since WPRE increased rtTA2s-M2 intracellular concentration, this resulted in increased non-specific binding to the tetO sites. Moreover, the enhancer sequences present in the WPRE sequence transactivate the tetracycline-responsive promoter at dist ance, independently of doxycyline-mediated activation. All the modifications to date have show n a higher sensitivity to doxycycline, and a significant increase in level of transgene expression. However, all modifications are also exemplifying the undesirable higher basal activity in the uninduced state. The ideal regulation

PAGE 19

19 system must meet all three characteristic in order to prevent any fu ture excess transgene problems.

PAGE 20

20 Figure 2-1. Biosynthetic pathway of Dopamine from Tyrosi ne. Tyrosine hydroxylase is the necessary enzyme to convert tyrosine to L-Dopa and then L-aromatic amino acid decarboxylase converts L-dopa to dopamine

PAGE 21

21 Figure 2-2. Tetracycline regulated system. A) In the tet-off system, in the absence of dox (yellow stars), the transactivator (tTS, green oval) binds to tet ope rator (tetO) of the tetracycline responsive promoter and i nduces transcription of the downstream transgene. B) In the tet-off system, in the presence of dox, tTS is unable to bind to tetO due to conformational change caused by dox and no transcription occurs. C) In the tet-on system, in the tet-ON system, in the absence of dox, reverse transactivator (rtTA, orange oval) is unable to bind to tetO and transcription does not occur. D) In the tet-on system, in the presence of dox, rtTA can now bind to tetO and induce transcription.

PAGE 22

22 CHAPTER 3 MATERIAL AND METHODS Vector and Virus Preparation Four AAV v ectors total were constructed to regulate GDNF transgen e expression (Figure 3-1). For Experiment 1, two vectors were c onstructed. Vector one was pTight-hGDNF. The coding sequence for GDNF was obtained with Xho I ends, and then recut with 3 Not I site from pTRE-Tight: hGDNF (Corinna Burger, University of Florida). The backbone, pTight (BD Bioscience, San Jose, CA), was taken from pTR5:tetM2-GDNF+polyA (Corinna Burger, University of Florida) by SphI and Not I site. The backbone and the GDNF fragment were both gel purified and the backbone were blunted a nd then Klenow filled to accommodate GDNF fragment XhoI site. The backbone and GDNF fragment was ligated. The resulting plasmid contained the GDNF fragments, the TR5, th e SV40 polyadenylation sequence, and the tetracycline-response element all under a minimal cytomegalovirus (CMV) promoter. The second vector, pTR-rtTA/tTS (UF vect or core), contains a chicken -actin promoter (CBA) with the CMV promoter driving expression of tetracy cline-trans-suppressor (tTS) (Clontech, Palo Alto, CA) and reverse tetracycline transactivator (rtTA) (Clontech). Th e tTS and the rtTA are separated by an internal ribosome entry site (IRES). This allows GDNF expression to be actively regulated in the presen ce or absence of doxycycline. For Experiment 2, pTR2: M2rTA/tTS was cons tructed. This regulat ory vector contains the mutated reverse transactivator (M2rTA) and the suppressor (tTS). For Experiment 3, pTight-hGDNF and pTRUF20-tTA2 were used. The GDNF containing vector is identical to the vector used in experiment 1. To generate pTRUF20-tTA2, pTRUF20-TH (UF Vector Co re) was digested with ClaI and HindIII to form the backbone. The pTRUF20-TH backbone contains ITRs, SV40 poly adenylation sequences, TRE, and a CBA with

PAGE 23

23 CMV enhancer. For the transactivator the forward PCR primer contains a HindIII restriction site followed by a Kozak sequence. The reve rse primer contains the stop codon followed by a ClaI restriction site. Oli gonucleotides for PCR were CGATGAAGCTTCCACCATGTCTAGATTAGATAAAAGTAAAGTGATTAACAG and GATCCATCGATTTATCATGTCTGGA TCCTTACTTAGTTACC. The PCR product was then digested with HindIII and ClaI. The fragment and the backbone were then ligated to form the 6153 bp vector. For all the vectors, the rAAV2/5 viruses were produced by protocols previously described [55, 70]. Vector titers were de termined by dot blot assay [71] and was 1.73 x 1013 genome copies/ml (gc/ml) for pTight-hGDNF; 2.86 x 1012 gc/ml for pTR-rtTA/tTS; 3.97 x 1012 gc/ml for pTR2: M2rtTA/TS; 1.57 x 1013 gc/ml for pTRUF20-tTA2. Intracerebral Injection of AAV Vectors All stereotaxic surgeries were performed in UF Brain Animal Faci lity and in accordance with the university and federal guidelines for the care and use of animals. Female Sprague Dawley rats obtained from Ha rlan Sprague Dawley (Indianap olis, IN), approximately 200-220g, were subjected to standard aseptic techniques und er isofluorane inhalational anesthesia. Animals then received marcaine at the incision site and were placed in a stereotaxic frame (Kopf Instrument, Tunjunga, CA, USA). Throughout surg ery isofluorane inhalational anesthesia was given continuously. A 10 l Hamilton syringe fitte d with a glass micropipette needle was used for injections. Injection flow ra te was controlled via a syringe pu mp (Razel Scientific Instrument Inc., Stamford, CT). The coordinates for inje ction were anterior/pos terior 0.0mm, lateral 3.0mm, dorsal/ventral -4.0mm for both experiments. Two l of vect or was injected at a rate of 0.5l per minute. The micropipette was paused for one minute following injection, and then the

PAGE 24

24 needle was raised 1mm and followed by an additi onal 4 minute pause. The incision was closed by using 7.5mm wound clips (Michel, Germany). Experimental Design Three separate experim ents were performed with different regul atory delivery systems. In Experiment 1, 20 female rats were injected with 1:1 mix ratio of pTight-hGDNF and pTR-rtTA/tTS. Six animals were injected with pT ight-hGDNF alone to serve as positive control. Five weeks after surgery, 10 random animals from the mix and 3 random animals from the positive controls groups were switched to doxycycline pellets diet (3 g/kg) (Bioserv Corporation, San Diego, CA). All were euthanized at six w eeks following the start of doxycycline diet (Six animals were perfused). In Experiment 2, 5 female rats were injected unilaterally with pTR2: M2rtTA/tTS to test the leakiness of the vector. Two weeks later, all five anim als were perfused. Experiment 3 consisted of a total of 40 female rats with two different time ranges (Figure 3-2). All animals receive the same 1:1 ratio of mix vectors, pTight-hGDNF and pTRUF20tTA2. Ten out of 20 total short-term random animals were switched onto the doxycycline diet one week after injection. The doxycycline diet wa s fed continuously for two weeks. After this period, all animals were euthanized (4 animals we re perfused). The design for the long-term animals was identical except for an extended time frame. The ten random animals were put on doxycycline diet two weeks after inj ection for three weeks. Five w eeks after vector injection, all 20 long-term animals were euthanized (Four animals were perfused). Perfusion and Tissue Processing After the experiment, six animals from Experi ment 1; 5 animals from Experiment 2; and eight animals from Experiment 3 were anesthetized with pentobarbital. They were transcardially perfused with sterile Tyrodes solution followed by 350 ml of co ld 4% paraformaldehyde (PFA)

PAGE 25

25 in 0.01 M phosphate buffered saline (PBS). The brains were rapidly removed, placed in PFA for 3 to 12 hours, and then placed into 30% sucrose solution in 0.01 M PBS. Brains were frozen using dry ice and sliced into 40 m intervals using a sliding microtome. Recovery of Fresh Tissue for ELISA After the period of feeding, the animals were lethally anestheti zed using pentobarbital and decapitated. The brains were removed from the skull and immediately placed on a cold block. The brains were then se ctioned coronally at the level of the cereb ral peduncles. The region that was not sectioned, cont aining the midbrain, was quickly placed into a solution of cold 4% PFA in PBS and post-fixed for 24 hours. Af ter post-fixation, the samples were transferred into a 30% sucrose solution (w/v 0.01 M PBS). The tissue was sectioned using a freezing stage sliding microtome at 40 m intervals. Additionall y, the left and right stri ata were dissected from the hemispheres and homogenized individually [34] Each striatum was placed into previously weighed tubes and reweighed. Tissue sample wei ght, as a difference in the two weights, was recorded. The tissue was dropped into liquid nitrogen and stored at -80 C for future use. Immunohistochemistry Immunohistochemistry was performed after th e general procedure described previously [72]. All steps were performed at room temperat ure. Brain sections we re first washed 3 times with 0.01 M PBS and then incubated for 15 minutes in 0.5% H2O2 + 10% methanol in 0.01 M PBS. To stain the sections with GDNF, the s ections were washed 3 times in 0.01 M PBS and incubated in 3% normal donkey serum (NDS) + 0.1% Triton X-100 in 0.01 M PBS for one hour. Brain sections were then tran sferred into primary Anti-GDNF a ffinity purified goat IgG antibody (R&D Systems, Minneapolis, MN) in 1% NDS + 0.1% Trition X-100 in 0.01 M PBS for overnight incubation. After primary antibody inc ubation, the sections were washed 3 times in 0.01M PBS and transferred into secondary biotin-conj ugated anti-goat IgG antibody (Santa Cruz

PAGE 26

26 Biotechniology, Santa Cruz, CA) in 1% NDS + 0.1% Triton X-100 in 0.01 M PBS. Secondary antibody incubation was for two hours. For visu alization, the tissue wa s incubated using an avidin-biotin peroxidase complex (Vector Laboratories, Burlingame, CA) and NovaRED substrate (Vector Laboratories, Burlingame, CA). Similarly, VP16 staini ng consists of tissues incubated in 5% normal goat serum (NGS) + 0.1% Triton X-100 in 0.01 M PBS for one hour and followed by similar procedure except it was pe rformed with VP16 primary polyclonal antibody raised in rabbit (Abcam, Cambridge, MA) and se condary biotinylated anti-rabbit IgG (Vector Laboratories, Burlingame, CA) antibody in 1% NGS + 0.1% Triton X-100 in 0.01 M PBS. Sections were mounted on slides, and prepared for photography. Photogra phs were taken using Olympus BX60 microscope and Olympus DPII digi tal camera (Olympus Optical Co., Japan). Enzyme-Linked ImmunoSorbent Assay Enzym e-Linked ImmunoSorbent Assay (ELISA) of striatal tissues was performed using GDNF EmaxTM ImmunoAssay System (Promega, Madison, WI) as per manufacturers instructions. Striatal lysates were measured at an absorbance of 450 nm using a Benchmark Microplate Reader (Bio-Rad La boratories, Hercules, CA). Ly sates from Experiment 1 were sampled at 1:10 and 1:100 dilutions. Lysates from Experiment 3 were sampled at 1:8000 dilutions. Benchmark Microplate Manager 4.0 So ftware (Bio-Rad Laboratories, Hercules, CA) was used to analyze the absorbance data. The resulting concentrati on of GDNF protein was adjusted for dilution factor and replicates were averaged to obtain the final concentration of GDNF protein per mg of striatal tissue sample. Statistical Analysis To determ ine significance between the contro l and the experimental animals, one-way repeated measure analysis of variance (ANOVA) was used.

PAGE 27

27 Figure 3-1. Vector constructs for tetracycline regulated GDNF expression. In Experiment 1, a two-vector system was used. In one vect or, the GDNF transgene is downstream from the tight tetracycline-inducible promoter (p Tight). In the sec ond vector, the reverse transactivator (rtTA) and suppressor (tTS) is driven by a chicken -actin promoter/CMV and separated by internal ribos ome entry site (IRES). In Experiment 2, the vector was identical to the regulato ry vector in Experiment 1 except for the replacement of the mutated transactivator tr ansgene. Experiment 2 was a one vector experiment. In Experiment 3, the GDNF v ector remained identical to the one in Experiment one. However, a new regul atory vector containing the tet-off transactivator (tTA), is a new addition to tight regulation of GDNF. Each construct have SV40 polyadenylation signals (SV40 poly A) and was flanked by inverted terminal repeats (TRs) for AAV packaging and replication.

PAGE 28

28 Figure 3-2. Overview of Experiment 3 Experiment 2 Surgery Short term animals Start dox Lon g -termanimals Start dox Short term animals euthanized Long-term animals euthanized 0 012345 6

PAGE 29

29 CHAPTER 4 RESULTS Experiment 1 The design of Experiment one consisted of using a two-vector system pTight-hGDNF and pTR-rtTA/tTS to deliver GDNF into the striatum the rats. A two-vector system is necessary for Experiment one because one vector (p Tight-hGDNF) contained the GDNF transgene necessary for therapeutic uses and the other (pTR-rtTA/tTS) provided the Tet-ON regulatory reverse transactivator. Twenty animals received bilateral intracerebral injections of the mix vector at 1:1 ratio. Six animal s received bilateral intracerebral injections of the pTight-hGDNF vector alone to serve as control. Half of each group of animals received dox for six weeks after the vector injection and all animal s were euthanized after 6 weeks. Immunostaining of fixed brain slices revealed expression of secreted GDNF protein in the striatia for induced pTight-hGDNF / pTR-rtTA/tTS mixed injections (Fig. 4-1). In comparison, uninjected control striata showed no GDNF staining (Fig. 4.-). Moreover, the positive control, pTight-hGDNF, injected alone into the striata showed GDNF expression (Fig. 4-1). Results seen in the immunostaining of Experime nt one was expected because it demonstrated the efficacy of the Tet-ON regulatory system when dox treate d animals injected with 1:1 mix vector pTight-hGDNF/pTR-rtTA/tTs showed GDNF expression. To further determine the efficacy of the two-vector system in Experiment one, one must quantitatively determine the protein levels in the animal tissue. To determine protein levels, uninjected striata se rved as negative control. According to the levels of GDNF by ELISA, in the 1:1 mi x vector pTight-hGDNF/pTR-rtTA/tTs injected animals showed no significant difference in the st riatal GDNF protein leve ls with or without dox (Fig 4-2). Furthermore, there was no significant difference in the levels of GDNF expression in

PAGE 30

30 the uninduced pTight-hGDNF alone and the mixed v ectors. The lack of difference in protein levels between the induced and uninduced animals injected with the mixed vector demonstrated leakiness and lack of ability to regulate GDNF expression via this system with dox in this experiment. Experiment 2 In Experiment 2, a mutant version of th e Tet-ON transactivator pTR2: M2rTA/tTS was constructed. This regulatory v ector contains the mutated revers e transactivator (M2rTA) and the suppressor (tTS). Ideally, this version is supposed to have highe r sensitivity to the inducer and lower basal activity when unindu ced. The purpose of this experiment was to confirm the leakiness in Experiment one due to the lack of function of the transactivator by examining whether the transactivator was pr operly constructed. The trans activator in Experiment one and the mutated transactivator is composed similarly of the tet repressor being fused to the VP16 domain of the Herpes Simplex Virus. Ther efore, a simple imm unostaing for VP16 should confirm the proper construction of the vector. Five animals received b ilateral injections of pTR2: M2rTA/tTS into the striatum. Two weeks after injection, all anim als were euthanized. The VP16 antibody was used to dete ct the VP16 activation domain of the intraceullar rtTA. The VP16 immunostaining showed expression in striat a injected with pTR2: M2rtTA/tTS alone and the uninjected control striata (Fig. 4-3). This result was confirmed that the transactivator was properly constructed and the regu latory vector was indeed not functional. Unfortunately, the Tet-On regulatory vector in Experiment one was leaky and ha d high basal activity. Experiment 3 Design of Experiment 3 consisted of u tilizing a two-vector system under Tet-OFF regulation to deliver GDNF into the striatum. As in Experime nt 1, a two-vector system is necessary because one vector contained the GDNF transgene and the other vector contained the

PAGE 31

31 regulatory transactivator. All 40 animals r eceive the same 1:1 ratio of mix vectors, pTight-hGDNF and pTRUF20-tTA2 b ilaterally. Twenty animals were placed into the short-term group and the other twenty into the long-term. Ten out of 20 total short-term random animals were switched onto the doxycycline diet one week after injection. The d oxycycline diet was fed continuously for two weeks. After this period, a ll animals were euthaniz ed. For the long-term group, ten random animals were put on doxycycline diet two weeks after injection for three weeks. Five weeks after vector injection, all 20 long-term animal s were euthanized (Fig. 4-4). Immunostaining of fixed brain tissue reve aled positive GDNF expression for the uninduced unilaterally injected pT ight-hGDNF and pTRUF20-tTA2 mix 1:1 vector in the striata (Fig. 4-4). This was evident for both the shortterm and long-term animals. In comparison, no GDNF staining was seen in the induced unilaterally injected pTight-hGDNF and pTRUF20-tTA2 mix 1:1 vector striata as well as th e uninjected control (Fig. 4-4). This lack of expression for the induced mixed v ector is true for both shorta nd long-time periods. This result is encouraging because it showed tight regulation of the tet-off mix vector system that produced relative biological GDNF activity when uninduced. To further demonstrate the ability of regulation, protein levels were examined. Uninjected striata served as negative control. In this ca se, the injected control wa s found to be significantly different than uninjected (p= 0.0015). Unfortuna tely, there was no significant different of expression levels between the shortand long-term animals (Fig. 4-4). For the tet-off regulation vectors, the average GDNF protein levels de termined by ELISA for the uninduced animals injected with pTight-hGDNF and pTRUF20-tTA2 mix 1:1 vector was si gnificantly different from the induced animals injected with the mixed vector (Fig. 4-4). In the presence of dox, the level of GDNF expression was significantly (p<0.0001) reduced compared to in the absence of

PAGE 32

32 dox. The minimal basal activity expressed in th e induced in comparison to the uninduced mixed vector injected animals show s the successful regulation of the tet-off vector system.

PAGE 33

33 Figure 4-1. The GDNF immunostaining for Experiment 1. From the left: pTight-hGDNF control; Induced pTight-hGDNF/pTR-rtTA/tTS mix vector; and Uninjected control. Scale bars correspond to 500 m. Figure 4-2. Average protein level by ELISA for Experiment 1. The pTight-hGDNF/pTRrtTA/tTS mix 1:1 injected vector treated animals on the left and the pTight-hGDNF alone animals on the right. Doxycycline trea ted animals are represented by black bars and untreated are white bars.

PAGE 34

34 Figure 4-3. The VP16 immunostaining.for Experi ment 2. VP16 immunostaining on uninjected control striata on the left and pTR2: M2 rtTA/tTS vector injected on the right. Enlargement of striatal area designated by rectangular box. Scale bars correspond to 500 m.

PAGE 35

35 Figure 4-4. Timeline and results of Experiment 3. A. Timeline of the short and long-term animals. B. Immunostaining of unilatera lly injected pTight-hGDNF/pTRUF20-tTA2 1:1 mix vector in the nigra. Negative GDNF expression was predicted and seen in doxycycline induced vectors in both short and long time periods. Similarly, positive GDNF expression was also predicted and s een uninduced vectors in both short and long time periods. Scale bars correspond to 500 m. C. Average protein levels by ELISA for Experiment 3. All animals ar e injected with pTight-hGDNF/pTRUF20tTA2 mix vector on the right striata. There is no significance in the expression between the shortand longterm animals. represent the significance of expression found in the dox+ and doxanimals. repr esent the significance of expression found between the left and right striata of the animals.

PAGE 36

36 CHAPTER 5 DISCUSSION A major limitation of the tetracycline-regulated system has been the high basal activity of transgene expression in the uninduced state. For GDNF, it has been demonstrated that uncontrolled GDNF levels result in down-regulation of TH expression. Since TH is the rate limiting enzyme of dopamine biosynthesis, down-re gulation of TH would result in a negative feedback loop and result in less conversion of tyro sine to L-dopa [39, 40]. With this in mind, the present study describes a novel, tight doxycycli ne modulated transgene GDNF system with minimal basal activity. In these experiments, this was accomplished with a two-vector construct containing GDNF cDNA under control of a tet-off regulatory system. However, the generation of this construct was not trivial. Various tests on the tet-on re gulation system and the tet-off regulation system demonstrate that the te t-off system is more tightly regulated. In Experiment 1, using a tet-on regulation system, pTight-hGDNF and pTR-rtTA/tTS 1:1 mix vector was injected into the striatum. This resulted in no signifi cant difference of GDNF protein expression in the induced or uninduced state. The high levels of GDNF expression in both the induced and uninduced state may be attribut ed to the leakiness of the transactivator. This may originate from rtTAs residual affinity towards tetO [65, 73]. This experiment also showed no significant difference in GDNF expr ession between uninduced pTight-hGDNF alone and pTight-hGDNF/pTR-rtTA/tTS mix vectors. This result, is again, attributed to the leakiness of the transactivator. In this experiment, the leakiness of the transac tivator displayed a GDNF basal activity that was not significantly different than those animals injected with pTight-hGDNF vector alone. Therefore, an at tempt was made to address this issue in Experiment 2. Through examining the construction of the mutated transa ctivator, a novel version of rtTA, M2rtTA, one

PAGE 37

37 can confirm the properly constructio n of the transactivator used and verify that the leakiness in Experiment one was indeed due to the Tet-on regulatory vector. In Experiment 2, stereotaxic injections of pT R2: M2rtTA/tTS vector into the striatum was used for immunostaining of VP16 antibody. Ev en though this novel tran sactivator carries different mutations as compared with rtTA, it was supposed to retain the dox dependency and display a considerably lower basal level of activity when uninduced [65]. Based on the similarity of the construction of the mutated tran sactivator and the transactivator in Experiment one, one can utilized the mutated transactivator for determining whether the vector is properly constructed in Experiment one. The VP16 immunostaining seen in the mutated transactivator confirms the proper construction of the transactivator and validates the leakiness of the tet-on regulatory vector in Experiment one. I believe the high level of basal expression that was observed in immunostaining of Experiment one might originate from one or more of three sources: transcription initiated in the ITRs [74, 75], basal transcription of the transgene from the minimal CMV promoter [76], and/or unspecific bi nding of M2rtTA to tetr acycline operator sites [65]. These three possibilit ies are in agreement with previous wo rk reported by Charto et al [69]. In an attempt to minimalize basal GDNF expr ession, it was decided to utilize the tet-off regulation system, in Experiment three. In Experiment 3, the tet-off regulation system was used. The tet-off as compared to tet-on regulation system has a distinct disadvantage: induction is dependent on the elimination of dox and, thus, induction tends to be slower [63, 64]. However, the tet-on system exhibits a much lower level of regulation of transgene expression than tet-off system. Additionally, the tet-on systems usually produce a higher basal expression in the absence of an in ducer than the tet-off systems [77]. Utilizing tTA, we demonstr ated the efficacy of the pTight-hGDNF and

PAGE 38

38 pTRUF20-tTA2 vector regulation system to cont rol the expression of GDNF in the presence of dox. Based on immunostaining, the GDNF expressi on found in treated animals injected with mixed pTight-hGDNF/pTRUF20-tTA2 was no di fferent than endogenous GDNF expression. This is an exciting observation because high basal activity when uninduced has been a lasting problem for tetracycline regulated system in the past. By observing minimal basal GDNF activity, this showed that the tet-off vector system can be efficiently modulated by doxycycline. Utilizing uninjected striata as negative contro l, we determined injected striata had significantly different level of GDNF protein expression (p=0.0015) This demonstrated the principle of the vectors. Then, to confirm th e ability to efficiently modulate the vector, our results showed a significance between the induced and uninduced animals (p<0.0001). To ensure that the level of GDNF protein expression is at biological rele vant levels throughout extended periods, we observed the level of GDNF protein expression for bot h untreated short-term (three weeks) and untreated long-term (5 weeks). However, there was no significant difference in expression at this point. The l ack of protein difference in time periods may be attributed to an earlier transgene expression mediated by AAV as characterized recently by Reimsnider et al [50]. This recent paper documente d that two to four weeks post transduction is the time period for AAV mediated transgene e xpression to reach asymptotic levels. This time period, unfortunately, was the only time period studied by us. However, the auth ors also report that there was a small but significant increase at 9 months post-treatment as compared to those of 28 days post-treatment. An extended study up to 9 m onths post-treatment would be an interesting comparison to those studies of 2 to 4 weeks post-treatment. By extending the post-treatment time scale one would be able to determine the ti me course of transgene expression and extended period of gene system regulation.

PAGE 39

39 In those experiments, the tetracycline regul ation system is modulated by doxycycline, an analog of tetracycline. Doxycycline has been used for many medical conditions but most currently is being used to trea t periodontal diseases [78-80], ro sacea [81, 82], and acne [82, 83]. While the effects of doxycycline improve those conditions, the long-term result of applying doxycycline is doxycyline resistant bacteria. Doxycycline is effective initia lly towards bacteria by prohibiting bacterial protein synthesis [84], however, bacterial resistance may arise through efflux pump [85, 86], ribosome protection m echanism [87-89] and transposons [90]. In 1987, Chemically modified tetracyclines (CMT) were synthesized [91]. Their nonantibiotic properties have been used to st udy the ability to inhibit various matrix metalloproteinase (MMP) [92, 93]. MMPs are essential in the inva sion and prevention of tumor cells [94, 95]. In 2001, Tolomeo et al [96] studied the cytotoxic e ffects of the six CMTs against sensitive and multidrug resistant leukaemia cell li nes. They concluded that CMT-1, CMT-3, and CMT-8 were more active than doxycycline and one of them (CMT-8) was able to induce programmed cell death (PCD), or apoptosis, also in multidrug resistant and apoptosis resistant cell lines. More recently, CMTs ability to inhi bit cytokines [97], peri odontal bone loss [98], and breast cancer cells [99], ar e all being validated. CMTs abilit y to inhibit MMPs, especially in multidrug resistance cell lines, with out any antibiotic effects is exciting. The possibility of utilizing CMTs for modulation of the tetracyclin e regulation system wit hout the possibility of developing bacterial resistance lines would be an exciting advancement for the long-term treatment of Parkinsons Disease. It has been shown that AAV vector constitu tively delivering GDNF in the striatum can provide neuroprotection and neur orestoration of the dopaminergic neurons and behavioral symptoms [14-29]. However, GDNF overexpression or long-ter m unregulated GDNF

PAGE 40

40 expression have been shown to cause downregulation of TH [40]. Therefore, it is of the utmost importance to develop regulatable viral vectors that can modulate GDNF levels. The previously discussed experiments document the developmen t of a novel, tight doxycycline modulated rAAV delivery system that can effectively regulate GDNF expression. Once the appropriate level of GDNF concentration that induces a biological response is determined, this will constitute a valuable tool for gene therapy of Parkinson Disease in the future.

PAGE 41

41 LIST OF REFERENCES 1. Hornykiewicz O: Parkinson's disease: from brain homogenate to treatment Fed Proc 1973, 32(2):183-190. 2. Hornykiewicz O: Dopamine (3-hydroxytyramine) and brain function Pharmacol Rev 1966, 18(2):925-964. 3. Hornykiewicz O, Kish SJ: Biochemical pathophysiology of Parkinson's disease Adv Neurol 1987, 45:19-34. 4. Rajput AH: Epidemiology of Parkinson's disease. Can J Neurol Sci 1984, 11(1 Suppl):156-159. 5. Van Den Eeden SK, Tanner CM, Bernstein AL, Fross RD, Leimpeter A, Bloch DA, Nelson LM: Incidence of Parkinson's disease: variation by age, gender, and race/ethnicity Am J Epidemiol 2003, 157(11):1015-1022. 6. Bravi D, Mouradian MM, Roberts JW, Davis TL, Sohn YH, Chase TN: Wearing-off fluctuations in Parkinson's disease: contribution of postsynaptic mechanisms Ann Neurol 1994, 36(1):27-31. 7. Quinn N, Marsden CD, Parkes JD: Complicated response fluctuations in Parkinson's disease: response to intravenous infusion of levodopa Lancet 1982, 2 (8295):412-415. 8. Bjorklund A, Kirik D, Rosenblad C, Georgievska B, Lundberg C, Mandel RJ: Towards a neuroprotective gene therapy for Parkinso n's disease: use of adenovirus, AAV and lentivirus vectors for gene transfer of G DNF to the nigrostriatal system in the rat Parkinson model Brain Res 2000, 886(1-2):82-98. 9. Choi-Lundberg DL, Lin Q, Chang YN, Chia ng YL, Hay CM, Mohajeri H, Davidson BL, Bohn MC: Dopaminergic neurons protected fr om degeneration by GDNF gene therapy Science 1997, 275 (5301):838-841. 10. Bilang-Bleuel A, Revah F, Colin P, Loc quet I, Robert JJ, Mallet J, Horellou P: Intrastriatal injection of an adenoviral vector expressing glial-cell-line-derived neurotrophic factor prevents dopaminergic neuron degeneration and behavioral impairment in a rat model of Parkinson disease Proc Natl Acad Sci U S A 1997, 94(16):8818-8823. 11. Eslamboli A, Cummings RM, Ridley RM, Baker HF, Muzyczka N, Burger C, Mandel RJ, Kirik D, Annett LE: Recombinant adeno-associated viral vector (rAAV) delivery of GDNF provides protection against 6-OHDA lesion in the common marmoset monkey (Callithrix jacchus) Exp Neurol 2003, 184(1):536-548.

PAGE 42

42 12. Eslamboli A, Georgievska B, Ridley RM, Baker HF, Muzyczka N, Burger C, Mandel RJ, Annett L, Kirik D: Continuous low-level glial cell line-derived neurotrophic factor delivery using recombinant adeno-associated viral vectors provides neuroprotection and induces behavioral recovery in a primate model of Parkinson's disease J Neurosci 2005, 25(4):769-777. 13. Kozlowski DA, Connor B, Tillerson JL, Schallert T, Bohn MC: Delivery of a GDNF gene into the substantia nigra after a progressive 6-OHDA lesion maintains functional nigros triatal connections Exp Neurol 2000, 166 (1):1-15. 14. de Rijk MC, Launer LJ, Berger K, Breteler MM, Da rtigues JF, Balderes chi M, Fratiglioni L, Lobo A, Martinez-Lage J, Trenkwalder C et al : Prevalence of Parkinson's disease in Europe: A collaborative study of populatio n-based cohorts. Neurologic Diseases in the Elderly Research Group Neurology 2000, 54 (11 Suppl 5):S21-23. 15. Elbaz A, Bower JH, Maraganore DM, McDonnell SK, Peterson BJ, Ahlskog JE, Schaid DJ, Rocca WA: Risk tables for parkinsoni sm and Parkinson's disease J Clin Epidemiol 2002, 55(1):25-31. 16. Kitada T, Asakawa S, Hattori N, Matsumin e H, Yamamura Y, Minoshima S, Yokochi M, Mizuno Y, Shimizu N: Mutations in the parkin gene cause autosomal recessive juvenile parkinsonism Nature 1998, 392(6676):605-608. 17. Beal MF: Oxidatively modified protei ns in aging and disease Free Radic Biol Med 2002, 32(9):797-803. 18. Schapira AH, Gu M, Taanman JW, Tabrizi SJ, Seaton T, Cleeter M, Cooper JM: Mitochondria in the etiology and pathogenesis of Parkinson's disease Ann Neurol 1998, 44(3 Suppl 1):S89-98. 19. Nagatsu T, Levitt M, Udenfriend S: Tyrosine Hydroxylase. the Initial Step in Norepinephrine Biosynthesis J Biol Chem 1964, 239:2910-2917. 20. Nutt JG, Holford NH: The response to levodopa in Parkinson's disease: imposing pharmacological law and order Annals of neurology 1996, 39(5):561-573. 21. Szczypka MS, Mandel RJ, Donahue BA, Snyder RO, Leff SE, Palmiter RD: Viral gene delivery selectively restores feeding and prevents lethality of dopamine-deficient mice Neuron 1999, 22(1):167-178. 22. Nutt JG, Carter JH, Woodward WR: Long-duration response to levodopa. Neurology 1995, 45(8):1613-1616. 23. Lin LF, Doherty DH, Lile JD, Bektesh S, Collins F: GDNF: a glial cell line-derived neurotrophic factor for midbr ain dopaminergic neurons Science (New York, NY 1993, 260(5111):1130-1132.

PAGE 43

43 24. Trupp M, Raynoschek C, Belluardo N, Ibanez CF: Multiple GPI-anchored receptors control GDNF-dependent and independent ac tivation of the c-Ret receptor tyrosine kinase. Mol Cell Neurosci 1998, 11(1-2):47-63. 25. Trupp M, Scott R, Whittemore SR, Ibanez CF: Ret-dependent and -independent mechanisms of glial cell line-derived neurotrophic factor signaling in neuronal cells J Biol Chem 1999, 274(30):20885-20894. 26. Bowenkamp KE, Lapchak PA, Hoffe r BJ, Miller PJ, Bickford PC: Intracerebroventricular glial cell line-d erived neurotrophic factor improves motor function and supports nigrostriatal dopamine neurons in bilaterally 6hydroxydopamine lesioned rats Exp Neurol 1997, 145(1):104-117. 27. Gash DM, Zhang Z, Gerhardt G: Neuroprotective and neurorestorative properties of GDNF Ann Neurol 1998, 44(3 Suppl 1):S121-125. 28. Gash DM, Zhang Z, Ovadia A, Cass WA, Yi A, Simmerman L, Russell D, Martin D, Lapchak PA, Collins F et al : Functional recovery in parkinsonian monkeys treated with GDNF Nature 1996, 380(6571):252-255. 29. Hebert MA, Gerhardt GA: Behavioral and neurochemica l effects of intranigral administration of glial ce ll line-derived neurotrophic factor on aged Fischer 344 rats J Pharmacol Exp Ther 1997, 282(2):760-768. 30. Tomac A, Lindqvist E, Lin LF, Ogren SO, Young D, Hoffer BJ, Olson L: Protection and repair of the nigrostriatal dopa minergic system by GDNF in vivo Nature 1995, 373(6512):335-339. 31. Zigmond MJ, Stricker EM: Animal models of parkinsonism using selective neurotoxins: clinical and basic implications Int Rev Neurobiol 1989, 31 :1-79. 32. Sauer H, Rosenblad C, Bjorklund A: Glial cell line-derived neurotrophic factor but not transforming growth factor beta 3 p revents delayed degeneration of nigral dopaminergic neurons following striatal 6-hydroxydopamine lesion Proceedings of the National Academy of Sciences of the United States of America 1995, 92 (19):89358939. 33. Kearns CM, Cass WA, Smoot K, Kryscio R, Gash DM: GDNF protection against 6OHDA: time dependence and requi rement for protein synthesis J Neurosci 1997, 17(18):7111-7118. 34. Manfredsson FP, Burger C, Sullivan LF, Muzyczka N, Lewin AS, Mandel RJ: rAAVmediated nigral human parkin over-expressi on partially ameliorates motor deficits via enhanced dopamine neurotransmission in a rat model of Parkinson's disease Exp Neurol 2007.

PAGE 44

44 35. Kirik D, Rosenblad C, Bjorklund A: Preservation of a functional nigrostriatal dopamine pathway by GDNF in the intras triatal 6-OHDA lesion model depends on the site of administration of the trophic factor The European journal of neuroscience 2000, 12(11):3871-3882. 36. Clarkson ED, Zawada WM, Freed CR: GDNF improves survival and reduces apoptosis in human embryonic dopaminergic neurons in vitro Cell Tissue Res 1997, 289(2):207-210. 37. Gill SS, Patel NK, Hotton GR, O'Sullivan K, McCarter R, Bunnage M, Brooks DJ, Svendsen CN, Heywood P: Direct brain infusion of glial cell line-derived neurotrophic factor in Parkinson disease Nature medicine 2003, 9(5):589-595. 38. Kordower JH, Emborg ME, Bloch J, Ma SY, Chu Y, Leventhal L, McBride J, Chen EY, Palfi S, Roitberg BZ et al : Neurodegeneration prevented by lentiviral vector delivery of GDNF in primate models of Parkinson's disease. Science (New York, NY 2000, 290(5492):767-773. 39. Georgievska B, Kirik D, Bjorklund A: Aberrant sprouting a nd downregulation of tyrosine hydroxylase in lesioned nigrostr iatal dopamine neurons induced by longlasting overexpression of glial cell line deri ved neurotrophic factor in the striatum by lentiviral gene transfer Exp Neurol 2002, 177 (2):461-474. 40. Georgievska B, Kirik D, Bjorklund A: Overexpression of glial cell line-derived neurotrophic factor using a lentiviral ve ctor induces timeand dose-dependent downregulation of tyrosine hydroxylase in the intact nigrostriatal dopamine system J Neurosci 2004, 24(29):6437-6445. 41. Mandel RJ, Spratt SK, Snyder RO, Leff SE: Midbrain injection of recombinant adenoassociated virus encoding rat glial cell line-derived ne urotrophic factor protects nigral neurons in a progressive 6-hydroxydopamine-induced degeneration model of Parkinson's disease in rats Proceedings of the National Academy of Sciences of the United States of America 1997, 94(25):14083-14088. 42. Kirik D, Rosenblad C, Bjorklund A, Mandel RJ: Long-term rAAV-mediated gene transfer of GDNF in the rat Parkinson's model: intrastriatal but not intranigral transduction promotes functi onal regeneration in the lesioned nigrostriatal system. J Neurosci 2000, 20(12):4686-4700. 43. Wang L, Muramatsu S, Lu Y, Ikeguchi K, Fujimoto K, Okada T, Mizukami H, Hanazono Y, Kume A, Urano F et al : Delayed delivery of AAV-GD NF prevents nigral neurodegeneration and promotes functional recovery in a rat model of Parkinson's disease Gene Ther 2002, 9(6):381-389. 44. Rosenblad C, Georgievska B, Kirik D: Long-term striatal overexpression of GDNF selectively downregulates tyro sine hydroxylase in the inta ct nigrostriatal dopamine system The European journal of neuroscience 2003, 17(2):260-270.

PAGE 45

45 45. Samulski RJ, Chang LS, Shenk T: A recombinant plasmid from which an infectious adeno-associated virus genome can be exci sed in vitro and its use to study viral replication J Virol 1987, 61(10):3096-3101. 46. Berns KI, Hauswirth WW, Fife KH, Lusby E: Adeno-associated virus DNA replication Cold Spring Harb Symp Quant Biol 1979, 43 Pt 2:781-787. 47. Muzyczka N: Use of adeno-associated virus as a general transduction vector for mammalian cells Curr Top Microbiol Immunol 1992, 158:97-129. 48. Cheung AK, Hoggan MD, Ha uswirth WW, Berns KI: Integration of the adenoassociated virus genome into cellular DNA in latently infected human Detroit 6 cells J Virol 1980, 33(2):739-748. 49. Samulski RJ, Chang LS, Shenk T: Helper-free stocks of recomb inant adeno-associated viruses: normal integration does not require viral gene expression J Virol 1989, 63(9):3822-3828. 50. Hauswirth WW, Lewin AS, Zolotukhin S, Muzyczka N: Production and purification of recombinant adeno-associated virus Methods Enzymol 2000, 316:743-761. 51. Kaplitt MG, Leone P, Samulski RJ, Xiao X, Pfaff DW, O'Malley KL, During MJ: Longterm gene expression and phenotypic correction using adeno-associated virus vectors in the mammalian brain Nat Genet 1994, 8(2):148-154. 52. Rendahl KG, Leff SE, Otten GR, Spratt SK, Bohl D, Van Roey M, Donahue BA, Cohen LK, Mandel RJ, Danos O et al : Regulation of gene expression in vivo following transduction by two separate rAAV vectors Nat Biotechnol 1998, 16(8):757-761. 53. Haberman RP, McCown TJ, Samulski RJ: Inducible long-term gene expression in brain with adeno-associated virus gene transfer Gene Ther 1998, 5(12):1604-1611. 54. Flannery JG, Zolotukhin S, Vaquero MI LaVail MM, Muzyczka N, Hauswirth WW: Efficient photoreceptor-targeted gene expression in vivo by recombinant adenoassociated virus. Proc Natl Acad Sci U S A 1997, 94(13):6916-6921. 55. Zolotukhin S, Potter M, Zolotukhin I, Saka i Y, Loiler S, Fraites TJ, Jr., Chiodo VA, Phillipsberg T, Muzyczka N, Hauswirth WW et al : Production and purification of serotype 1, 2, and 5 recombinant adeno-associated viral vectors Methods 2002, 28(2):158-167. 56. Chao H, Liu Y, Rabinowitz J, Li C, Samulski RJ, Walsh CE: Several log increase in therapeutic transgene delivery by distinct adeno-associated viral serotype vectors Mol Ther 2000, 2(6):619-623.

PAGE 46

46 57. Burger C, Gorbatyuk OS, Velardo MJ, Pede n CS, Williams P, Zolotukhin S, Reier PJ, Mandel RJ, Muzyczka N: Recombinant AAV viral vectors pseudotyped with viral capsids from serotypes 1, 2, and 5 display differential efficiency and cell tropism after delivery to different regions of the central nervous system. Mol Ther 2004, 10(2):302-317. 58. Reimsnider S, Manfredsson FP, Muzyczka N, Mandel RJ: Time course of transgene expression after intrastriatal pseudotyped rAAV2/1, rAAV2/2, rAAV2/5, and rAAV2/8 transduction in the rat Mol Ther 2007, 15(8):1504-1511. 59. Mandel RJ, Manfredsson FP, Foust KD, Rising A, Reimsnider S, Nash K, Burger C: Recombinant adeno-associated viral v ectors as therapeutic agents to treat neurological disorders Mol Ther 2006, 13(3):463-483. 60. Sanlioglu S, Monick MM, Luleci G, Hunninghake GW, Engelhardt JF: Rate limiting steps of AAV transduction and imp lications for human gene therapy Curr Gene Ther 2001, 1(2):137-147. 61. Bantel-Schaal U, H ub B, Kartenbeck J: Endocytosis of adeno-associated virus type 5 leads to accumulation of virus particles in the Golgi compartment J Virol 2002, 76(5):2340-2349. 62. Gossen M, Bujard H: Tight control of gene expression in mammalian cells by tetracycline-responsive promoters Proc Natl Acad Sci U S A 1992, 89(12):5547-5551. 63. Gossen M, Freundlieb S, Bender G, Muller G, Hillen W, Bujard H: Transcriptional activation by tetracyclines in mammalian cells Science 1995, 268(5218):1766-1769. 64. Kistner A, Gossen M, Zimmermann F, Jereci c J, Ullmer C, Lubbert H, Bujard H: Doxycycline-mediated quantitative and tissuespecific control of gene expression in transgenic mice Proc Natl Acad Sci U S A 1996, 93(20):10933-10938. 65. Urlinger S, Baron U, Thellmann M, Hasan MT, Bujard H, Hillen W: Exploring the sequence space for tetracycline-dependent transcriptional activators: novel mutations yield expanded range and sensitivity Proc Natl Acad Sci U S A 2000, 97(14):7963-7968. 66. Lamartina S, Roscilli G, Rinaudo CD, Sporeno E, Silvi L, Hillen W, Bujard H, Cortese R, Ciliberto G, Toniatti C: Stringent control of gene expression in vivo by using novel doxycycline-dependent trans-activators Hum Gene Ther 2002, 13(2):199-210. 67. Koponen JK, Kankkonen H, Kannasto J, Wirth T, Hillen W Bujard H, Yla-Herttuala S: Doxycycline-regulated lentiviral vector system with a novel reverse transactivator rtTA2S-M2 shows a tight control of gene expression in vitro and in vivo Gene Ther 2003, 10(6):459-466.

PAGE 47

47 68. Chtarto A, Bender HU, Hanemann CO, Kemp T, Lehtonen E, Levivi er M, Brotchi J, Velu T, Tenenbaum L: Tetracycline-inducible transgen e expression mediated by a single AAV vector Gene Ther 2003, 10(1):84-94. 69. Chtarto A, Yang X, Bockstael O, Melas C, Blum D, Lehtonen E, Abeloos L, Jaspar JM, Levivier M, Brotchi J et al : Controlled delivery of glial cell line-derived neurotrophic factor by a single tetr acycline-inducible AAV vector Exp Neurol 2007, 204(1):387399. 70. Zolotukhin S, Byrne BJ, Mason E, Zolotukhi n I, Potter M, Chesnut K, Summerford C, Samulski RJ, Muzyczka N: Recombinant adeno-associated virus purification using novel methods improves infectious titer and yield Gene Ther 1999, 6(6):973-985. 71. Wu P, Xiao W, Conlon T, Hughes J, A gbandje-McKenna M, Ferkol T, Flotte T, Muzyczka N: Mutational analysis of the aden o-associated virus type 2 (AAV2) capsid gene and construction of AAV2 vectors with altered tropism J Virol 2000, 74(18):8635-8647. 72. Sternberger LA, Hardy PH, Jr., Cuculis JJ, Meyer HG: The unlabeled antibody enzyme method of immunohistochemistry: prepar ation and properties of soluble antigenantibody complex (horseradish peroxidase -antihorseradish peroxidase) and its use in identification of spirochetes J Histochem Cytochem 1970, 18(5):315-333. 73. Baron U, Bujard H: Tet repressor-based system for regulated gene expression in eukaryotic cells: principles and advances Methods Enzymol 2000, 327:401-421. 74. Flotte TR, Afione SA, Solow R, Drumm ML, Markakis D, Guggino WB, Zeitlin PL, Carter BJ: Expression of the cystic fibrosis transmembrane conductance regulator from a novel adeno-associated virus promoter J Biol Chem 1993, 268(5):3781-3790. 75. Haberman RP, McCown TJ, Samulski RJ: Novel transcriptional regulatory signals in the adeno-associated virus termin al repeat A/D junction element J Virol 2000, 74(18):8732-8739. 76. Fender P, Jeanson L, Ivanov MA, Colin P, Mallet J, Dedieu JF, Latta-Mahieu M: Controlled transgene expression by E1-E4defective adenovirus vectors harbouring a "tet-on" switch system J Gene Med 2002, 4 (6):668-675. 77. Mizuguchi H, Xu ZL, Sakurai F, Mayum i T, Hayakawa T: Tight positive regulation of transgene expression by a single adenovi rus vector containing the rtTA and tTS expression cassettes in separate genome regions Hum Gene Ther 2003, 14(13):12651277. 78. Lee JY, Lee YM, Shin SY, Seol YJ, Ku Y, Rhyu IC, Chung CP, Han SB: Effect of subantimicrobial dose doxycycline as an effective adjunct to scaling and root planing. J Periodontol 2004, 75(11):1500-1508.

PAGE 48

48 79. Emingil G, Atilla G, Sorsa T, Savolainen P, Baylas H: Effectiveness of adjunctive lowdose doxycycline therapy on clinical parameters and gingival crevicular fluid laminin-5 gamma2 chain levels in chronic periodontitis J Periodontol 2004, 75(10):1387-1396. 80. Preshaw PM, Hefti AF, Novak MJ, Michalowicz BS, Pihlstrom BL, Schoor R, Trummel CL, Dean J, Van Dyke TE, Walker CB et al : Subantimicrobial dose doxycycline enhances the efficacy of scaling and r oot planing in chronic periodontitis: a multicenter trial J Periodontol 2004, 75(8):1068-1076. 81. Berman B, Perez OA, Zell D: Update on rosacea and anti-inflammatory-dose doxycycline Drugs Today (Barc) 2007, 43(1):27-34. 82. Skidmore R, Kovach R, Walker C, Thomas J, Bradshaw M, Leyden J, Powala C, Ashley R: Effects of subantimicrobial-dose doxycycli ne in the treatment of moderate acne Arch Dermatol 2003, 139 (4):459-464. 83. Parish LC, Parish JL, Routh HB, Witkowski JA: The treatment of acne vulgaris with low dosage doxycycline Acta Dermatovenerol Croat 2005, 13(3):156-159. 84. Thong YH, Ferrante A: Effect of tetracycline treatment on immunological responses in mice Clin Exp Immunol 1980, 39(3):728-732. 85. Yamaguchi A: [Bacterial resistance mechanisms for tetracyclines]. Nippon Rinsho 1997, 55(5):1245-1251. 86. Gibreel A, Wetsch NM, Taylor DE: Contribution of the CmeABC efflux pump to macrolide and tetracycline resistance in Campylobacter jejuni Antimicrob Agents Chemother 2007, 51(9):3212-3216. 87. Manavathu EK, Fernandez CL, Cooperman BS, Taylor DE: Molecular studies on the mechanism of tetracycline res istance mediated by Tet(O). Antimicrob Agents Chemother 1990, 34(1):71-77. 88. Grewal J, Manavathu EK, Taylor DE: Effect of mutational alt eration of Asn-128 in the putative GTP-binding domain of tetracyc line resistance determinant Tet(O) from Campylobacter jejuni Antimicrob Agents Chemother 1993, 37(12):2645-2649. 89. Clermont D, Chesneau O, De Cespedes G, Horaud T: New tetracycline resistance determinants coding for ribosomal protection in streptococci and nucleotide sequence of tet(T) isolated from Streptococcus pyogenes A498 Antimic rob Agents Chemother 1997, 41(1):112-116. 90. Warburton PJ, Palmer RM, Munson MA, Wade WG: Demonstration of in vivo transfer of doxycycline resistance mediated by a novel transposon J Antimicrob Chemother 2007, 60(5):973-980.

PAGE 49

49 91. Golub LM, McNamara TF, D'Angelo G, Greenwald RA, Ramamurthy NS: A nonantibacterial chemically-modified tetrac ycline inhibits ma mmalian collagenase activity J Dent Res 1987, 66(8):1310-1314. 92. Hanemaaijer R, Visser H, Koolwijk P, Sorsa T, Salo T, Golub LM, van Hinsbergh VW: Inhibition of MMP synthesis by doxycyclin e and chemically modified tetracyclines (CMTs) in human endothelial cells Adv Dent Res 1998, 12(2):114-118. 93. Ramamurthy NS, McClain SA, Pirila E, Maisi P, Salo T, Kucine A, Sorsa T, Vishram F, Golub LM: Wound healing in aged normal and ovariectomized rats: effects of chemically modified doxycycline (CMT -8) on MMP expression and collagen synthesis Ann N Y Acad Sci 1999, 878 :720-723. 94. Cockett MI, Birch ML, Murphy G, Hart IR, Docherty AJ: Metalloproteinase domain structure, cellular invasion and metastasis Biochem Soc Trans 1994, 22(1):55-57. 95. Kohn EC, Liotta LA: Molecular insights into can cer invasion: strategies for prevention and intervention. Cancer Res 1995, 55(9):1856-1862. 96. Tolomeo M, Grimaudo S, Milano S, La Rosa M, Ferlazzo V, Di Bella G, Barbera C, Simoni D, D'Agostino P, Cillari E: Effects of chemically modified tetracyclines (CMTs) in sensitive, multidrug resistant and apoptosis resistant leukaemia cell lines Br J Pharmacol 2001, 133 (2):306-314. 97. Sandler C, Ekokoski E, Lindstedt KA, Vainio PJ, Finel M, Sorsa T, Kovanen PT, Golub LM, Eklund KK: Chemically modified tetracycli ne (CMT)-3 inhibits histamine release and cytokine production in mast cells: possible involvement of protein kinase C Inflamm Res 2005, 54(7):304-312. 98. Ramamurthy NS, Rifkin BR, Greenwald RA, Xu JW, Liu Y, Turner G, Golub LM, Vernillo AT: Inhibition of matrix metalloproteinase-mediated periodontal bone loss in rats: a comparison of 6 chem ically modified tetracyclines. J Periodontol 2002, 73(7):726-734. 99. Gu Y, Lee HM, Golub LM, Sorsa T, Konttinen YT, Simon SR: Inhibition of breast cancer cell extracellular matr ix degradative activity by chemically modified tetracyclines. Ann Med 2005, 37(6):450-460.

PAGE 50

50 BIOGRAPHICAL SKETCH Julia Huang graduated from University of Flor ida with a Bachelor of Science degree in botany and a Bachelor of Arts in Chinese lite rature. She entered the masters program in biomedical science in the College of Medicine in fall 2005. For the past 2.5 years, she has performed research under the gu idance of Ronald J. Mandel, PhD. Her research focused on regulation of transgene delivery system for glial cell line-derived neurotrophic factor.