![]() ![]() |
![]() |
UFDC Home | myUFDC Home | Help |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Full Text | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
xml version 1.0 encoding UTF-8 REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd INGEST IEID E20101118_AAAABW INGEST_TIME 2010-11-18T16:35:14Z PACKAGE UFE0021537_00001 AGREEMENT_INFO ACCOUNT UF PROJECT UFDC FILES FILE SIZE 1995 DFID F20101118_AABGOP ORIGIN DEPOSITOR PATH kevany_b_Page_33.txt GLOBAL false PRESERVATION BIT MESSAGE_DIGEST ALGORITHM MD5 f23027e4a6e36ca65c4e53a02c2353dd SHA-1 2811928f5819b61792c8150118358a3c7179ae59 659 F20101118_AABGPD kevany_b_Page_49.txt 3b087ffdbfc2b76030dbb3e7bc83c78e 0a5c8f961b2daefde53fef6ad4bb194080cb962c 2180 F20101118_AABGOQ kevany_b_Page_34.txt 800dd2708309424ddffea42aaad415ca 6b8439b95f4c260123d27ab44294061b55086578 2214 F20101118_AABGPE kevany_b_Page_50.txt 45f9cd4fef8ad06481d0c0aee38c7731 0920c6bb184e6fbe3b8a9329cba9af5e7e87be5f 2293 F20101118_AABGOR kevany_b_Page_35.txt 63a52510871f211f8d7f9f4617acf5e6 ac032fcd2f6dbdf62a3dd6e841f3500643223129 2159 F20101118_AABGPF kevany_b_Page_51.txt a408647069f845d8cbf8cdbbae250677 66951c5396efc6ad37e3a4bcd2ed9a136a92e68b 2213 F20101118_AABGOS kevany_b_Page_37.txt 40d81746a2964e8d74369865386ebd4a 122e40cb3468f80f800301936a9cc4b6e28afe7b 2168 F20101118_AABGPG kevany_b_Page_52.txt 109f57c75e03c1b014c0926bba373dab c3b517b7af96c428e7c5599713b47fa2f3783d29 2249 F20101118_AABGOT kevany_b_Page_38.txt 1e056f256f98b381ff235fdb64bdedf3 36fc3e65975646bc269c0b2170b13607e7fe3a37 2101 F20101118_AABGPH kevany_b_Page_53.txt 4716ac79084be3de3ce8766279f9cd1d c94cc7c882730c00973015d903d4341ad7de91fb 2155 F20101118_AABGPI kevany_b_Page_54.txt aa43a3182c03c7eb55056f9b1d280eb5 18fca82c13199b2579ac56e7f9383b972163d217 2185 F20101118_AABGOU kevany_b_Page_39.txt 9c5c9aa35f38524bd40f90b1b686488c 35d995af9dcfc3d12138aaa5cb0892097bbd4de0 1297 F20101118_AABGPJ kevany_b_Page_55.txt 0a182b1e5aa6cca0f1ad739490123db6 a6219675b2dded88c13f03e654eea0b328bc2fb9 1620 F20101118_AABGOV kevany_b_Page_40.txt 9c84ad177a139b4bd92515773ed1a979 2c7be2b78691cd7f8c2406eebc2b1828047292fd 457 F20101118_AABGPK kevany_b_Page_56.txt 82746c5ecc65242cbb354cf54a8f99a7 9e9b973c5f1ae9d6e2373880dc7e2cdab12ad1e4 513 F20101118_AABGOW kevany_b_Page_41.txt aa4b7d8c75531b8ef111572fa0ba2079 d5d73d43405a15ca3b7969af2100a3e24141fff4 748 F20101118_AABGPL kevany_b_Page_58.txt aec1634e1d0db38a5dd9129ee6cab792 41a1410add2ddcdb6e975e31410fb3b838418c85 276 F20101118_AABGOX kevany_b_Page_43.txt 47f3c6ace14ef25ddd726eb4a2a16991 63fd247d55ee3d8a53fc351c8c4ab52f5f14f9e5 819 F20101118_AABGQA kevany_b_Page_75.txt d1ea6bbaafeddce786c4fa239d70b79d 50a7d0312e061d7917ac2995a0e56f368e16cc4e 2652 F20101118_AABGPM kevany_b_Page_59.txt 28225547ed1aaad3fc5dda6c2d8d3f37 5f70b17fc1761bd35ff5348dd1a0b394743fb97c 1188 F20101118_AABGOY kevany_b_Page_44.txt eadf876d899690a54436547016fc9cfc 531d6b8e0cb43dc9ec21549bf6a6fc9dd3ca23d3 540 F20101118_AABGQB kevany_b_Page_76.txt 92611fba0a7f13a5d83a3f67dcbe0bf8 514752dfee25cc80ba427d2ee4a99c15c127bf22 1480 F20101118_AABGPN kevany_b_Page_60.txt 38eee608b9746f9463ccb6cf5dac065a fac72ebe6d2c440d9915c7f5c1cc6da970c06f89 715 F20101118_AABGOZ kevany_b_Page_45.txt 17d5e66aabf16259ab40dedae0d13ca9 5f2df801eca42dc1d90ed002cd704d98d9c41082 404 F20101118_AABGQC kevany_b_Page_78.txt a6d4e95c0aebfe79b45d945331a9df82 6b1226ffb1246b79e143da4f46af54feb1fc423e 2133 F20101118_AABGPO kevany_b_Page_62.txt fe82382e453081f61402736c4673c810 ab793a64eb731ba0301a2d174458605e6b426463 424 F20101118_AABGQD kevany_b_Page_79.txt efb3b006f6c651f2fd74f8ca122b43ff 54a023878da4e2b3043c1a881f85e7695de179b7 2280 F20101118_AABGPP kevany_b_Page_63.txt 470251a3e0f17c40be9786d35d804322 a28f596c6e188d8937380a937ac1a5dbf55b33b0 F20101118_AABGQE kevany_b_Page_80.txt 36ebf5475f7ca68abea171a14da407de 0e7986c6b28cb51842426ccabb0eba484e02232d 2198 F20101118_AABGPQ kevany_b_Page_64.txt 1171b7884fbcf720f62077273b5154c6 b18640280140f8483ce5e5ac535b0d5c65461b76 2286 F20101118_AABGQF kevany_b_Page_81.txt f66b560b960bbc3b807e8dfd852e5ece 617060fe24a5ab5c75285634cb2b8b8d1e612171 2255 F20101118_AABGPR kevany_b_Page_65.txt 19f4f89d51b3cd51fe8fc5ca05ac3383 f0bb3b4b53ec853e2fba4376a83096c31b2ae58b 1969 F20101118_AABGQG kevany_b_Page_82.txt 0027d6a8357cb41304ec3ac1515aada5 91a86e5377933446d914205d855fca360a9a3079 2162 F20101118_AABGPS kevany_b_Page_66.txt 089d1e1d0a4b639c6a8664612b9ee854 884ddac6c7f20eec47709988d8c784cc4561cc2b 1996 F20101118_AABGQH kevany_b_Page_83.txt 7df91f03daa25c63acbdac60a0a89748 6b7f3025e6c9409db54f06398428cf02a2ad2225 2270 F20101118_AABGPT kevany_b_Page_67.txt 0739cb7e8f2e9f3f58db7aa3b6e6f952 e000f4e62e849b9a4b9ea50e12241da5d2a36343 2075 F20101118_AABGQI kevany_b_Page_84.txt 3136fc3e81918084851fdb8c59d98739 d38a32a874b3f8fee85a9876ab9913c105974d69 444 F20101118_AABGPU kevany_b_Page_69.txt b4e43564de2576de1d3968cac96a88a4 651191a27e33ff7a1d774f541a8bbb7e105a02b7 1963 F20101118_AABGQJ kevany_b_Page_85.txt 06c33a48144ced850139abc73243743f 03ec3fc6510198aacde0af40c4e5674e712306bf 2104 F20101118_AABGQK kevany_b_Page_86.txt a380c8c380bf8d2779c7a3d3295f383e add874f9bafa8b9167f967a3addcf189bf9bd1a7 351 F20101118_AABGPV kevany_b_Page_70.txt e3ae4d743a243e03b02258b96cbbb657 4023fd76c03ff00fbba1245963ddcef5aaafc536 1399 F20101118_AABGQL kevany_b_Page_87.txt 88fcaa1b3228ba50775d45e764fd4057 2b681d5f971a8e376138baf8eda28828b23aa8fb 544 F20101118_AABGPW kevany_b_Page_71.txt ca1458d9d985b1cdd6d0415b5476d77f 72829113b699aab5b81e77389a47a5fd58766c5a 989 F20101118_AABGRA kevany_b_Page_03thm.jpg cdc022416ae3e380a3fb9e1567604ada ed06512acbd07edf01ef48b33121d2587b915c66 1266 F20101118_AABGQM kevany_b_Page_88.txt 8c1396a28aaa7ab6f54e166172b9330c 3a829471da90cfb4d0be29af634eca743aa0e694 511 F20101118_AABGPX kevany_b_Page_72.txt 86cb7cbf083dc86e0f12a183fa92d078 27106e7f7d9bde9be5b677ddf866ce5abfc97d2f 8989 F20101118_AABGRB kevany_b_Page_04thm.jpg af154062adfca34a669b5a4f10857315 8cce39e5e9ff450b5b7b4a943fc00d6c68bb170b 2654 F20101118_AABGQN kevany_b_Page_89.txt 1b71002571be915bd146b4abb6efbaed ec5d050bad195af2a808057548b2d2c07500ae9a 1221 F20101118_AABGPY kevany_b_Page_73.txt fcec90173b210805622003712352c8e9 4ee352b0b29b1ad8c603643dc7459ce1236ec435 1293 F20101118_AABGRC kevany_b_Page_05thm.jpg 18c2e45dfab44af86ac92cf529b2f269 113eb427f5ff356005451893b49447c6bafbb029 2535 F20101118_AABGQO kevany_b_Page_91.txt 45373de7ed2ff2e3d08167b1bc58ffc5 2a4887b3607ee45a6f5ebfa04be1fa8ca995ad75 450 F20101118_AABGPZ kevany_b_Page_74.txt 637758b32bee187239edb3afb00fbaa1 3d09dfa66da49f3f8315a468ee82e6bcbd688756 5106 F20101118_AABGRD kevany_b_Page_05.QC.jpg e8d5dd0801ec19b8b036fcd5ca50655e c583291b3a17cd18d811d3279f5056b79ae4fcc8 2561 F20101118_AABGQP kevany_b_Page_92.txt c4dc3f44e417784fe21994db996ea6d2 4c7063dafec1ef22d91f4308ee00ef2b0f27ef2b 7449 F20101118_AABGRE kevany_b_Page_06thm.jpg 37896a58e9388e74076e52bbc267c528 a19377fe27daa1c2bef5db32acd8c64551c00f56 F20101118_AABGQQ kevany_b_Page_93.txt abb196d841a4ea61652cd96794183a78 9731336bf18daaa9b119c83357767051d54e60b1 31675 F20101118_AABGRF kevany_b_Page_06.QC.jpg 74c7d0015c7cd09ca25bdcbdb1dfae8f 4fdc69ff82316c87170d32a432b801159c4ad9dd 2690 F20101118_AABGQR kevany_b_Page_94.txt dffee0d7f97ee235f3fb2746141d5e01 093fb451edb6e09a3897b32253cfd6be37a72ce2 4000 F20101118_AABGRG kevany_b_Page_07thm.jpg 24fbf8b9c81999c40443ba50f6e03600 144cde85a533809d98c340792e7369bb384dfde5 2773 F20101118_AABGQS kevany_b_Page_96.txt 2ce1827d7a7062d01585dde59ec47c63 b80b77b872fa7328d5fcda74f622f5c4108cbb53 16622 F20101118_AABGRH kevany_b_Page_07.QC.jpg 183a57b608c125ac62b74147bd89b616 8a0c00cd70911d6367f95883803838cc1fdb57cb 162 F20101118_AABGQT kevany_b_Page_97.txt f178e93824600fc165932cd842b60a5f 3f88270416f428bafd6df64b899beba0fd7fd02e 3247 F20101118_AABGRI kevany_b_Page_08thm.jpg 3f7a2313c2d3c71dd7935088d9db0657 0024f1fd8192d91a39c0f2a7dfca01fb8a6e241e 1517 F20101118_AABGQU kevany_b_Page_98.txt 8f2ffec2096e6c1cd09f5e58c8694cb1 99423802947e15edecfe2fdd13a7e3655c1cb5bc 12701 F20101118_AABGRJ kevany_b_Page_08.QC.jpg db9af2b22aca03c901c8a601a7380b8d 3c3d0b6b3d002875b03161330921dea5564b8834 1322186 F20101118_AABGQV kevany_b.pdf 9d3e79109a2a1cb757b7104d2d3cafe5 317b69a8344cd85ed119ea7ccef67a42523260e3 36478 F20101118_AABGRK kevany_b_Page_09.QC.jpg 7cc665ab47b4a77e6a9d8e5c49c989a3 3229dfea15828610cfa39a9bd04ac972c3522933 1126 F20101118_AABGRL kevany_b_Page_10thm.jpg 33454b7fc1fc40e39228aaefe50b5f24 79c90866f72774b486543d2efd46fe8361b28373 2157 F20101118_AABGQW kevany_b_Page_01thm.jpg 291b0ae5c2b5e9d8bd4b781cca60aacb 909a193d38ab203943c78afb44b97ad56cb33528 3516 F20101118_AABGRM kevany_b_Page_10.QC.jpg 7b7bf25220cd9e30747a8eff6535fbdf 54c787092d6729a2c14769d5b45ff5ed8fa69898 8202 F20101118_AABGQX kevany_b_Page_01.QC.jpg 96e96187932132df069e58abe366b80c e8b8991eb24fbcc372f99bcf5ccf780e8fee4fe5 8376 F20101118_AABGSA kevany_b_Page_18thm.jpg aef23be7128dca28971bd1984003da19 af4f767e58e095f79a326a1745edde3878503ca3 8067 F20101118_AABGRN kevany_b_Page_11thm.jpg 2580b4b49acc004affb933e7aa1a2bea 78977b93c5317cf83b37279c5954b8b3ce04e84d F20101118_AABGQY kevany_b_Page_02thm.jpg d2dba398b0a0669355f07bd9fd36beb4 d92a7cdf9f6bf6366e4b83232e5c720b7dd8e2da 34803 F20101118_AABGSB kevany_b_Page_18.QC.jpg 9bf321cacfca1016f253086700239c84 8e739955e07e392dc14027aa38a1a75cc75b1015 32443 F20101118_AABGRO kevany_b_Page_11.QC.jpg 29739a6beae371ad673f050f8888472c 46a6bb2f6055d3def214f575c6074eafcfeee176 1271 F20101118_AABGQZ kevany_b_Page_02.QC.jpg 3c76b695625680660290cc6cabb9f489 f91241a6aadb1f7df818285c2e690cdcf9fa38cb 8776 F20101118_AABGSC kevany_b_Page_19thm.jpg b8bd37f8ede309e431d39e55196ac5d0 05a44b5ccf4477805538b37985c43922f277f998 3072 F20101118_AABGRP kevany_b_Page_12thm.jpg b1839744a39a5b3fdb2719d6a7ae51d4 78698a43955ed5e477c8e96a470eb317164b2772 36382 F20101118_AABGSD kevany_b_Page_19.QC.jpg 7ed5f1053f5e134f5dc589a1ca183e14 bf00207bcb2ceb063af8aa4c1e913f86f0852dc5 12645 F20101118_AABGRQ kevany_b_Page_12.QC.jpg e6483404463006b68417fb22a2859217 cd641ade7374ec98249ff31ce108389874c7c00a 9150 F20101118_AABGSE kevany_b_Page_20thm.jpg a950dd0fd9c41128cbbafa522889cb32 448fcb1c729a54ae55ee491c51b00590922476f3 36538 F20101118_AABGSF kevany_b_Page_20.QC.jpg 1abc1b441f4a434e8b06690e57a3a76f 5a2a706d1eb1b097c88990e280bcc3f90cbde36a 8677 F20101118_AABGRR kevany_b_Page_13thm.jpg acd59ffd68a3bc8877442b4e1cae4349 e07fedaba959f75fe5c02ebf50fd87ac12a9ba3b 9184 F20101118_AABGSG kevany_b_Page_21thm.jpg f1769b68364a6a08300aba76238f1328 af5a17cecc09402bbb3e5b421449868c4712a7b6 35666 F20101118_AABGRS kevany_b_Page_13.QC.jpg fc2294ca61797f412465a564d23fafd4 45f6922b635156512902800c8342db66453ea43a 37503 F20101118_AABGSH kevany_b_Page_21.QC.jpg 1a7b0625be1e3dd447c896d1507e70ce 7c6318409f6e8f23ed6189432cc204c988fd3d61 8795 F20101118_AABGRT kevany_b_Page_14thm.jpg c2221e3956551e6a754b9deadb94f113 71357f143a640fa67890ef1bc5f69297b508028a 8840 F20101118_AABGSI kevany_b_Page_22thm.jpg 036f75397b9cc89083321f4e404b9c12 681f804c74036ff78c6a3ee7ef8a46afad48b8d8 35237 F20101118_AABGRU kevany_b_Page_14.QC.jpg 28fc5b2e8d04892d982f9418b08dda00 2fb2deddeb4a7c068d1967e6a27dcdb9633b6844 35985 F20101118_AABGSJ kevany_b_Page_22.QC.jpg dd84e3063ad744f9883cc9c0811fac13 49017d5fe11c458fa9da4079f12f37bed8770399 34600 F20101118_AABGRV kevany_b_Page_15.QC.jpg 994b1ef48359650a2e45d9be1da5595c 5d6c3149806b0718f8e7195b9cce3b57af696749 9170 F20101118_AABGSK kevany_b_Page_23thm.jpg ce30a47e7948739454212183071c5cb8 3101fee7275d0ea145c749848f43e56aed9a6c0f 9062 F20101118_AABGRW kevany_b_Page_16thm.jpg a7904b11845d03db62f73f542e660f22 80d73bcd6df4386ad3386db9e3d19bc43bcb10b6 36984 F20101118_AABGSL kevany_b_Page_23.QC.jpg 65ef4959258b58ebb1f1e7ff84a01fa6 7fefd080da11483928b2ec3450efb5973fc2f294 37772 F20101118_AABGTA kevany_b_Page_32.QC.jpg cb703333c8c233304e63dac93dfe4461 9a6830da83a7c14dc48b4519f9d0e15aa85500a9 8763 F20101118_AABGSM kevany_b_Page_24thm.jpg 3d5969d178c1f5b424bbb29395db4a78 78f23e13d93e476317817177918e26869ad6a807 37269 F20101118_AABGRX kevany_b_Page_16.QC.jpg 25f41f1af714151ea6d1f5f8623b6d78 f72d6fbd2c84c1cc4fc58cc8ab8e6189316dee92 8241 F20101118_AABGTB kevany_b_Page_33thm.jpg 95655d8fc8b60af5f161e0e25024493c ef90ebd3f1cf046a1b4286eea2e4cb28c737840c 38519 F20101118_AABGSN kevany_b_Page_25.QC.jpg b676ed594409f57a166813422436277f 8367c08d0574782684361f9d9b2c31b632f2cd24 8971 F20101118_AABGRY kevany_b_Page_17thm.jpg 5786939140e7b39c17e7cedd63779471 d190f84e1f967c999eabc368c52a1e5f87ee337f 33038 F20101118_AABGTC kevany_b_Page_33.QC.jpg b7924116b3790215eb9204e692f5489f 27770530d7534e219432cb6cf8a4721991a2c480 9130 F20101118_AABGSO kevany_b_Page_26thm.jpg f3ba04587a83d0e894401ebdde074445 f55463a769cec302fd97a9add6ffd9a6b0c6778e 37858 F20101118_AABGRZ kevany_b_Page_17.QC.jpg 2d7981ae90d041421ebb8089f692e151 e1f931ea820808c8e5c802c1ea1a4568bb3f11da 37303 F20101118_AABGTD kevany_b_Page_34.QC.jpg 794d77d2f3ad6eec427d7340db8c13ed f14c34c842f5fb32116e70e2251f51d08012bcac 37779 F20101118_AABGSP kevany_b_Page_26.QC.jpg 37917b012d192c245d534cf0ee915af7 5c8945c313a5de8cdf649d29004aba049214bbf8 9336 F20101118_AABGTE kevany_b_Page_35thm.jpg 9ece439720714b0b6992881a40605e16 d4a0da17d08da0f8e8a24a864eef7d52f440bccd 8839 F20101118_AABGSQ kevany_b_Page_27thm.jpg a06869cc4f42eb5b9ef1f0dcbdbfce97 5892ad3313f7338b1bcabb4c5ae5cb1e3605e571 38772 F20101118_AABGTF kevany_b_Page_35.QC.jpg 67503d5f1d89a3a4aac88cc5a9dd831a 5b20bce5854f48ac5d4ad1f6026a4247340d8421 35743 F20101118_AABGSR kevany_b_Page_27.QC.jpg b9eab7b58445071b7e7f11ac782f8b68 e9ce81defa43eb3afd8b50362eeb380a62fb79be 9109 F20101118_AABGTG kevany_b_Page_36thm.jpg 1a3a61526ef058136b58eda8853f7eac d350b7b0366ac310c344ec4ba962196d8347bb1a 8409 F20101118_AABGSS kevany_b_Page_28thm.jpg 062ad46880ab33e03d098d03e863b931 067e0a9c7291f229fa4fabdbaef34d9d300e4761 36473 F20101118_AABGTH kevany_b_Page_36.QC.jpg 9f32ad23f9cabdfea862cec839ec5ae6 0c4bdc5f49e52364d617c7dd6c29bfd03fde1967 7047 F20101118_AABGST kevany_b_Page_29thm.jpg 688a90ef731a8f7e8adf672f3a64c53a 0bc7d594cb82d39254aee64e92fa31922686f50e 8815 F20101118_AABGTI kevany_b_Page_37thm.jpg 54f62fa0b26eeaf015f0cc813725968c 149a197ca046fface8467de4ad4d58932e583058 28726 F20101118_AABGSU kevany_b_Page_29.QC.jpg bd74cab96e4d0513155f8319b5f3ee7f 84e87a9e1de45e9585c8557d54a1790992d06db4 36896 F20101118_AABGTJ kevany_b_Page_37.QC.jpg 489cbb67f694558ef767fee82d2ea423 7ca4e1926ad72dd05f2210e8679912f2d194bdcf 4230 F20101118_AABGSV kevany_b_Page_30thm.jpg d4c833dacc76e07d203fd7d514910521 a52a4b829459bb1e2a568352bc04a5f230770b50 9140 F20101118_AABGTK kevany_b_Page_38thm.jpg f925207d5d513ff4cb1930ad7ef4f4cc 8b632d0f3896da05b6c27d9038228ff4d80975cf 12809 F20101118_AABGSW kevany_b_Page_30.QC.jpg 0e5598000038adfe2d812f4641d16559 82ab6777006b40e3c8d6723aa49e9818a741a52b 37472 F20101118_AABGTL kevany_b_Page_38.QC.jpg 67a459a52d0fdc74a70394b0f75228a9 c0d3982c67ee65143ceed10c39cc4f821213c0e1 8724 F20101118_AABGSX kevany_b_Page_31thm.jpg a5a902f1ea900923f402679967a34c15 835cb7615ea66319d32f147b5399e38cf53831b8 9051 F20101118_AABGTM kevany_b_Page_39thm.jpg f4f74e98ce96515aef354d5d14e63291 3dc78a030fd04c9900675a3427c8d0ddd8239a2f 14227 F20101118_AABGUA kevany_b_Page_47.QC.jpg 300618d4414df89e8a06c151a978bc9d 3517ff392f8cb92039965db35f75af0fab3ffdda 37135 F20101118_AABGTN kevany_b_Page_39.QC.jpg eed246ea1d735d4cfcbdb9a45e9fe6dd b6c6878a21c8c4576bfdb916abff9549f43968a4 36871 F20101118_AABGSY kevany_b_Page_31.QC.jpg e4a857d9b32b62c8ed00337348740860 a2116ce9d76ed389819e7e5b9e7d2d66eecf71d5 2841 F20101118_AABGUB kevany_b_Page_48thm.jpg b36e7b604604f8bf27c07afc86f74c04 6e9367e2498e6137c2eb49fb851f1c495c9394e6 6805 F20101118_AABGTO kevany_b_Page_40thm.jpg 471d43c68e3b4a471614586cab8d28cd 7ae6eb364736c84653f120e528b28ddc66ef65e2 9218 F20101118_AABGSZ kevany_b_Page_32thm.jpg 15f37919ff6895ced41a95bf8583c102 aa3cbbd55d2fd08c634e106092acffc8676ff28b 9788 F20101118_AABGUC kevany_b_Page_48.QC.jpg fdff7473b4f88019ff38486eb79cd1a0 21989bd77734d10669a78a5c29aa977fd1c8d2f7 28015 F20101118_AABGTP kevany_b_Page_40.QC.jpg 705caba788779b7e42e3c25c3e894a3d da23038ddcf54b2367b925686d67a16264bb0731 2831 F20101118_AABGUD kevany_b_Page_49thm.jpg 721cefb10285a96d2903be73d4feb22d 6ede23daf349d2708aa777812a584667d9bcc6bd 4295 F20101118_AABGTQ kevany_b_Page_41thm.jpg 12ec4a6de33277257a41aeb9bc0f75af 0516f27801f96612e861b9861c733852f011083c 10943 F20101118_AABGUE kevany_b_Page_49.QC.jpg 68ca230c70157c41bbd898f9ed262f7b f0d19b00f76c525713acfa7d785e3431361bf9cc 14517 F20101118_AABGTR kevany_b_Page_41.QC.jpg c81e3587e6f55f91e901b802df288e79 7f7d7f1045b216634123adbbd8cf08fa081ae1a5 8893 F20101118_AABGUF kevany_b_Page_50thm.jpg 26d6b9c9e7de2e72b03d15d09f388f93 69d73caca1bf44f58182b16a76433c32c6ac445c 3330 F20101118_AABGTS kevany_b_Page_42thm.jpg 1c2c9f5c36220e9ecea162e68e73c0f7 173a73fd534862cdcd786be253833b6e30b4599b 37152 F20101118_AABGUG kevany_b_Page_50.QC.jpg 7c2313413b807b9afec6ae886265c0ea 60829349ef161d212cea3401e2c91fcf61eb12b6 10116 F20101118_AABGTT kevany_b_Page_42.QC.jpg 46a6392a341e514a9740a8024bf3b9b8 45a09e71023eca42a43ff9d9458323fbcb12b6c3 8838 F20101118_AABGUH kevany_b_Page_51thm.jpg 14d05c33b6c774a33b8b09ba524391d6 cfed9d7d05227f62e82a45dbef47b9fd75e64603 6108 F20101118_AABGTU kevany_b_Page_44thm.jpg b82f8b5267e1390dc00c5a1e2bb21a88 56cc17a0012b68a9cefde0a4340d69d2204e980c 36093 F20101118_AABGUI kevany_b_Page_51.QC.jpg 10962b8033e73a05ec50dc2400986530 1d2b000a760daf7077e90954e8982a180005e46b 20668 F20101118_AABGTV kevany_b_Page_44.QC.jpg 744711b1a40d35781c4c40f2ecf7b1ec 806852d9d934ea2a78a80fd5c48b455e678aa290 8871 F20101118_AABGUJ kevany_b_Page_52thm.jpg f5634ca4b6a87e44cb24758f999883cf b2a77feb784888329d606f861d890c09e04acfd7 5759 F20101118_AABGTW kevany_b_Page_45thm.jpg fc06999daf8a3e98c8bb30de497e6c50 cae5f117933f9ffe6a9721c9d7aa8532b5f3d2d5 36333 F20101118_AABGUK kevany_b_Page_52.QC.jpg f5017bde2bf01fdf50b8450470da92bb 6f9d9696e52a9d6e986f5f066fcfe19ee15af1da 18377 F20101118_AABGTX kevany_b_Page_45.QC.jpg adb035773f74ebe5dd85ee9f8b3139bf ce1368b9eafdd1fdf9287ef62d2a9ccf587cd6d3 8874 F20101118_AABGUL kevany_b_Page_53thm.jpg 2ada897c331b1d402de9cb66dca0634d 1947c8755a6c7593169212a9cce618f9a15436b3 6484 F20101118_AABGTY kevany_b_Page_46thm.jpg 4a685ee20d181ed295b1a53792ff1b9d 38509efa59eb812a2b23cee04d182f2fa1e699fb 8876 F20101118_AABGVA kevany_b_Page_63thm.jpg 10daa6ebe7c1b11dd50d48eb43a49fce 140807e8bd13bbc546a9ec71ca3e385b6e69c4fe 34205 F20101118_AABGUM kevany_b_Page_53.QC.jpg e677f0e86236f2357b2875a242d1705a 5faf53f612652df6837418c038810c846e44ecea 38561 F20101118_AABGVB kevany_b_Page_63.QC.jpg 2ce076d342658b79e6c22044db20a42d 63907441077941b6670aa2a30f4fb3570e396351 8827 F20101118_AABGUN kevany_b_Page_54thm.jpg 34940d3b13dd623e1421e69e13bb94d5 03632b98d7d75f83fb0055982ef3a2f8b4fc719d 4350 F20101118_AABGTZ kevany_b_Page_47thm.jpg d2c92fc5a71316c7ced201e07ccaac71 2062fdf271b5c03f04c011e1d93e1c69a4cf0417 9126 F20101118_AABGVC kevany_b_Page_64thm.jpg 4d4991b1f910095301b3c50fe87ef4fb bd4a0aa7f7dd7f72a7acfb1ac2221ebfac7a08c5 36347 F20101118_AABGUO kevany_b_Page_54.QC.jpg afacf638a21792e2807cb62dc8b4d788 3b30a815b9a8d0e251e700bf702a344f0b6f4985 36344 F20101118_AABGVD kevany_b_Page_64.QC.jpg 7750d5e470ab192a4595e3a8d02c145f 8987041c085eabedd5dcd2d794ae230562697434 6244 F20101118_AABGUP kevany_b_Page_56thm.jpg 9ba090241ff00735d9a9bdb15f92250d 40fdae79e50d66c214adbefe2ebb7af6bf97a817 9201 F20101118_AABGVE kevany_b_Page_65thm.jpg 08df61f2526ad7fdaa435029f2efe8f2 98528337f608a54e9131005f1087c6ccecfd4272 4920 F20101118_AABGUQ kevany_b_Page_57thm.jpg cf2ee4af74ed4cd2973384b698abda24 19ec841aff2b33b8bf77ce152d77b8d79a4884ab 37631 F20101118_AABGVF kevany_b_Page_65.QC.jpg fe08a348c0b20e448f841468604e7773 f413140a6ab55f0789aeb43f88828f0dc6d9b6af 4750 F20101118_AABGUR kevany_b_Page_58thm.jpg 27a4d833c18eb6ad2446ee33684a1955 3da251178299dac093a8ceeed60b721d21964576 8634 F20101118_AABGVG kevany_b_Page_66thm.jpg b7228907b4c18bf425fb924c6a4f3a81 cfd2b14833ba9055cdd927c19db0cdea6e9c7c75 16472 F20101118_AABGUS kevany_b_Page_58.QC.jpg d8808f896e35f7b49cc7993248c7703d db2d9470647564d8ca1c0dd20c4be8bf442e118a 35894 F20101118_AABGVH kevany_b_Page_66.QC.jpg 6c31de9dfcaf954e075ff7a91d8629bd fa7973b57a1a67582227e9edf1baa8b2e828b2ba 6928 F20101118_AABGUT kevany_b_Page_59thm.jpg 7eeec7658746353251c3f1c2ac01d239 8443ba0385580079e8b0d3bd86a9b715e4843a04 9128 F20101118_AABGVI kevany_b_Page_67thm.jpg 39971ebda051850afb95ac4191ef7e44 001c81da721338d025fbc4438208b97b58c71d9a 29207 F20101118_AABGUU kevany_b_Page_59.QC.jpg c50d7bfdd7c11977e20b7452261973ea d30ff80362d45afc12941865230193477c720d3d 37421 F20101118_AABGVJ kevany_b_Page_67.QC.jpg 9b0bec3b7e1293e07fb2325d60d52753 ec68a4499ae32ddbd69edeedd172dccc4124c81b 3622 F20101118_AABGUV kevany_b_Page_60thm.jpg 312a2bbfbc7839fe69fba217a4b1689c f112429b8e86c2888682c435891ade201288ada6 3106 F20101118_AABGVK kevany_b_Page_68thm.jpg 89537b348dadc5ae386559bc78a99a22 c2bb33d8e4e499394deea380be13aee55af80dd8 8766 F20101118_AABGUW kevany_b_Page_61thm.jpg e79bff5d51872c2f644de94fc19a91b1 5bcffca0f776102bcdd601a2c1940d5e3609eae8 12070 F20101118_AABGVL kevany_b_Page_68.QC.jpg b47df9471839e98ff54ebb29929efd10 032bdcf4b3985877825234fba6223915b45ed7a8 36978 F20101118_AABGUX kevany_b_Page_61.QC.jpg 721890405f14d3e15dbb7e40a1349c70 efe1b7c0be1726d0081959c5fa9066f09af0173c 7654 F20101118_AABGWA kevany_b_Page_77thm.jpg 30e62ef1e3d26b0d539965327e300f4d 72226fecd8b76d93ada3a0087b4523bbd9d7ee05 3896 F20101118_AABGVM kevany_b_Page_69thm.jpg 762c83943be1d920eacd38dbb6af7b44 bd0d9bbfe9c635c753ba325c4647a7d26aeea854 8702 F20101118_AABGUY kevany_b_Page_62thm.jpg b71fe09c2d5777138d2b6db61f2b1489 abf1ee870a4f2e5a14e0b79829d374e5ac262be8 37818 F20101118_AABGWB kevany_b_Page_77.QC.jpg cd3be2ada2569d9e071232235ade4b07 9e8c8f9ae365fde55014f14ace2d44cb23a1178d 11348 F20101118_AABGVN kevany_b_Page_69.QC.jpg ab533e63eb40004bae702c85c86ea2b4 3c639951cab5718114835ce0f9726274c2a6f731 34789 F20101118_AABGUZ kevany_b_Page_62.QC.jpg ce674f3f07b0c0c3a4f764aefc358ace 756b9edce0a283918ffef1ac2dcd14f6d9177f29 3546 F20101118_AABGWC kevany_b_Page_78thm.jpg 7fb4a59d29f9fdd24e9193fc5e87a9f3 76be4cb0155d5140e6e4ac0e078ab02dc7f3b22a 4532 F20101118_AABGVO kevany_b_Page_70thm.jpg 8cbcd19972b71c1e58bd094e1c1dd838 483656820efff0e51ffe01ace19f35c59d76790e 10774 F20101118_AABGWD kevany_b_Page_78.QC.jpg e3fae1b1ed7463de418acb2be8a68ab2 d58914b9e1312c7ffba8c227b3bafe9e7ac9b841 12907 F20101118_AABGVP kevany_b_Page_70.QC.jpg ecf17def6383595876eab85bcfba2c41 933da20dfcc2ec0356dfa9105674306a41d60a5c 3494 F20101118_AABGWE kevany_b_Page_79thm.jpg 6e98eb42bd9a943ba35c08a072640147 b5950392d162504459392e7820fe6dcfd08f43bd 4311 F20101118_AABGVQ kevany_b_Page_71thm.jpg 073e7bbbc7309134376affba78858f5d cdd0fbc1e92bd3eb1cad5e929f1ebb3f0440b51c 9805 F20101118_AABGWF kevany_b_Page_79.QC.jpg 6377402482f6dd82b6bc602f81d79826 48e36a1111816e957ef0b091bcbcb4b76d196a84 13233 F20101118_AABGVR kevany_b_Page_71.QC.jpg 2fe50fd460227ba66732b3b232b6cc06 b1ac099bd290871d209cb9e11f8dbb074c137279 8868 F20101118_AABGWG kevany_b_Page_80thm.jpg dcb1f0f0652b4970556e4d6a43757ea4 ff8d801d43229fcb98912ba6420b47067c7d3f8c 4432 F20101118_AABGVS kevany_b_Page_72thm.jpg cf02ef0d3d60829479756856fcaef575 4b3d2e6940050911a311ce16e298379421516259 35631 F20101118_AABGWH kevany_b_Page_80.QC.jpg e64bc397941bc7617e7fe193af08be85 c0e655b631cdac154c0e01f069a193051d11ab48 13728 F20101118_AABGVT kevany_b_Page_72.QC.jpg c6285c663261a45ceeabde2441552e91 80368bc12179ac3fa33e7a23478c98a19dd51201 9241 F20101118_AABGWI kevany_b_Page_81thm.jpg 1b31ed3de95c0e6e0199d4af901d328c 34edf0b3dea134400e0735dd6039e57ac48ae521 19473 F20101118_AABGVU kevany_b_Page_73.QC.jpg 5a4c58d9be1f503c432f1d013017cff0 f9b0b117db8acf7a59ed2030241f26341c5667a1 38098 F20101118_AABGWJ kevany_b_Page_81.QC.jpg 4a2df1359ea74b6a76164ef0e3d84d53 b1bc720092940a810793d584b32a4213e258e493 4024 F20101118_AABGVV kevany_b_Page_74thm.jpg fe96a280f75126cdbee0faa74563a8b8 092e3106182c43aae78e3b31f7d87ea438ddf934 7926 F20101118_AABGWK kevany_b_Page_82thm.jpg fbc40cdce9b99f3afa9e4f759e0fe546 871e47f7b22eaf3cb126da52f0b68c37c1d87b84 3604 F20101118_AABGVW kevany_b_Page_75thm.jpg edab57387d40dd7e22da9e62c5ec45a4 00a125a954d99ea4ecc890fbf81435a51e3d887f 32923 F20101118_AABGWL kevany_b_Page_82.QC.jpg 6c2c1191498302f7fe66bb83291fe819 2d59009f684d87e4e6e6674956493a19153ed944 12671 F20101118_AABGVX kevany_b_Page_75.QC.jpg 4c56e9cfb2795e104d47b7fb0ddbb212 a29b2f7001165929214e5193dfd96dd3c9ce1298 8400 F20101118_AABGWM kevany_b_Page_83thm.jpg b4d9f6373f39a0f629dcb7aa392c0734 f1f93424aee15565a6657b0067f9d1b78d84ced2 4208 F20101118_AABGVY kevany_b_Page_76thm.jpg b8e993bca63c15b9f6515a180d5a5be0 611eb5f8b623023b52a2262d29d7138f69535deb 9207 F20101118_AABGXA kevany_b_Page_91thm.jpg e9629479171b31124d253a90e3ee500e 31294bd569b13ac20d48f3e395af402ec5cb1abf 34662 F20101118_AABGWN kevany_b_Page_83.QC.jpg eaf558a2282b5bbd7e0020d760a41a06 d7b058820ec1dcd1c66f7177f317ffea1e871afe 12932 F20101118_AABGVZ kevany_b_Page_76.QC.jpg 719ecb67b1d822d30e4a3e34d3f65dc9 4a76fafc4e920172d772c076eb78251d1d6e81c4 36952 F20101118_AABGXB kevany_b_Page_91.QC.jpg ac7f9dbf297fac656050cd818460390f 73e1c92050f4b0459d15f3d5c38aae84d37d815f 9346 F20101118_AABGXC kevany_b_Page_92thm.jpg e2165fdf117aa302b86de09d5bb7b410 391063f11fdd0ea38f876cb990e85e8263e3fde2 8975 F20101118_AABGWO kevany_b_Page_84thm.jpg 91b8ec86142d4baf807342c71abacaa7 4675310f03571fee808109ddbe9e740618107215 38294 F20101118_AABGXD kevany_b_Page_92.QC.jpg 9561f2538f6bc5e6cd8f9e7199bb189c 6108ebbecaf99d01f2688f897d1e9665f1d69520 37021 F20101118_AABGWP kevany_b_Page_84.QC.jpg d581ea7c34f7741150874ab3faa1b000 5563df3f038a05a350e3cf18bfec6e5917d02917 9562 F20101118_AABGXE kevany_b_Page_93thm.jpg 40f1451e915864d10ae3fe3f1fb10725 d19b8ada9f4fff039d5308172ad7e310187468f9 F20101118_AABGWQ kevany_b_Page_85thm.jpg d81800153ca97f76d3553dc26516441a 2024dd2a368e6c4dc7cc6487f538f3a6205a2cd7 9878 F20101118_AABGXF kevany_b_Page_94thm.jpg 372f098460174a5a47ca7a59227c13ab 77692f3d8432a66e789f5da6d26deb4d64822a41 9138 F20101118_AABGWR kevany_b_Page_86thm.jpg 49c70ff203da7674de1b4a582696a77b f4c9e2ac16527a432aefaf5e0252f573c0461bd4 38771 F20101118_AABGXG kevany_b_Page_94.QC.jpg 0b076e67c187c0569021559b3628e80b c7fb4597ffe5fb4e744a5ecf038d0bf7e73bc65d 36484 F20101118_AABGWS kevany_b_Page_86.QC.jpg 4bd67a9fe8d872d61dddf6615cdc9799 e00777feb11082cc1dc7fdddce9dd0bf8238450a 22920 F20101118_AABGAA kevany_b_Page_46.pro 371aacf88aab9625460dc59ef3fec351 19e438fad440fd993d7f234a8136d27b97de8fee 9782 F20101118_AABGXH kevany_b_Page_95thm.jpg 7c04a90d8637fad6047c112600247658 41e1c55d30492669d41d3de8ab85b6c2bc817642 6235 F20101118_AABGWT kevany_b_Page_87thm.jpg dbe6ca12904d89593fc96a48baa287c4 6884ff1319e8a623cd6dbed3b1e72f9a81377000 40646 F20101118_AABGXI kevany_b_Page_95.QC.jpg 5c2c10eee779431d561ae9b6c1aed173 e38685dc51d40c7fc19298e5d6b425254bbe4f2f 25333 F20101118_AABGWU kevany_b_Page_87.QC.jpg 1474e4066e2c9d4d1a7cfcd5548ced1f 84dc11809d57302e748de2da89aaf65af2b53923 2158 F20101118_AABGAB kevany_b_Page_36.txt bdd2a20d278f829212cc7d3ec0d123fc fb6b7a78978354817e83066c077d50e62633210b 9967 F20101118_AABGXJ kevany_b_Page_96thm.jpg f3826be0d6a5c942fa0d9f0aa6419195 17c70cd0a20997b1d630871786a0be116fde24ca 5263 F20101118_AABGWV kevany_b_Page_88thm.jpg 4b92d3761cc0d0b698fdc677e6337c9d cfdf05c90bf4d058c89c3ea3b3b49267b7510be7 147295 F20101118_AABGAC UFE0021537_00001.xml FULL baec65d6ec68e6fc2e5bad0aad78528b 1cb27db03eafa026b803b3bcc02169e6814d8470 40257 F20101118_AABGXK kevany_b_Page_96.QC.jpg e212ec0f5ed124ef5bd1069726f47429 2f905af5657b0fad7f2dab8cc661b0f9c6931e4f 23789 F20101118_AABGWW kevany_b_Page_88.QC.jpg 3a52de8f379b977324f7df2e5f123b6f 4bba8e35759f6a41bfd7dfcd36d10a04f134b5f5 F20101118_AABGXL kevany_b_Page_97thm.jpg 25d07c98712faef77aca7bf86f39949b 1bb0be9e1d44ce729e291468fcbc15423aa94834 39633 F20101118_AABGWX kevany_b_Page_89.QC.jpg 548673cf6d7cacaef511169134e9b3ec a36102c1df72b53e90d697994e5481ca6f9fefe6 3969 F20101118_AABGXM kevany_b_Page_97.QC.jpg 5d2c6ec0ebebaf34b6e1a80c72f68121 b1d053183c1ce7527423c98936b3d33140e6f6fd 9581 F20101118_AABGWY kevany_b_Page_90thm.jpg 21ca68042d690fde31d5b38138379e08 958ad04f6d504121688ce7fa91ff09853527d666 26683 F20101118_AABGAF kevany_b_Page_01.jpg a4795ec3c43dd0b70a7fef47cbcc63dd c6e57f6eb1470052defa294dd1e4403e3a9b3044 6465 F20101118_AABGXN kevany_b_Page_98thm.jpg b44ad117f4b3ab2170a1fd0397d812b5 c8691b6889c27b356a7d9c29bdc079049a4330a3 40245 F20101118_AABGWZ kevany_b_Page_90.QC.jpg 82d47efc605d81604fcd38a1111841b2 e0574f90bdb5e3e899dbb616f0ee80eec1bd5b1e 26144 F20101118_AABGXO kevany_b_Page_98.QC.jpg 387c1fc1f50a88b33b26c4bc2f84181c c102315b6420b5a3df95ff6b35c30fe3e2120b97 4318 F20101118_AABGAG kevany_b_Page_02.jpg add82b19ca99d9e6a99851ae8f6788c9 a056f0d08a0fe944ebd4062d522dd896c7537449 113775 F20101118_AABGXP UFE0021537_00001.mets bbf6de12571e65122bf9e4a4c38beac0 3d17f416af0b7680f073af7e17cdae326e92209a 9186 F20101118_AABGAH kevany_b_Page_03.jpg dc998f1d8494ad90667b5cf44f4fdb28 deff40b3c61bd69d6ab3b69531a4f050303d732e 110257 F20101118_AABGAI kevany_b_Page_04.jpg da1118a467dc7ce0d69821cb35f30e92 8475bba3e54019d36309ba35211f930c6b13908b 13533 F20101118_AABGAJ kevany_b_Page_05.jpg 0799d07150df321a3e69196d3da9f622 6be6f1d413648b825510b0d52d05fb1dd679dfc4 128667 F20101118_AABGAK kevany_b_Page_06.jpg 2b7d4bb22cd1e5f701402da413421b4f a475ce926970e11c3383de57a95bf098da70d40d 113000 F20101118_AABGBA kevany_b_Page_23.jpg c54d69106f148739f17249668cdde1c5 6e23179be2d3b5e9f9bba43c4b2e413709cdd9e8 69144 F20101118_AABGAL kevany_b_Page_07.jpg 1eb68fb786c88c77d98ad5078e4ff286 5ee53f769195b03b678458e268c4f75a6216a7b2 108236 F20101118_AABGBB kevany_b_Page_24.jpg 738b9380276eec30b48cb9b48640ffbe 5aa800d7e0da0513a92c1268995368fbd625e336 43113 F20101118_AABGAM kevany_b_Page_08.jpg f1986bf258e90ce7d5f44b4d7453410a 3504fb05b7a4e0fd1469fb3669d4d5ccbd32fe2a 118334 F20101118_AABGBC kevany_b_Page_25.jpg 0165bca7d8ca34e6716be8becf88c83d 44e9f13aa8f95fd50c4086cfeccd89afd97a9deb 128274 F20101118_AABGAN kevany_b_Page_09.jpg 2004c7939b075ac46cb992f176437592 6dfd17e20270efba8e4e58c01e6c0e4df33fec48 115080 F20101118_AABGBD kevany_b_Page_26.jpg ad7982d76a5c8337e44f9901b89b0550 7e58ce08074b60e5ec74b9f6a9c45c1a0aab83df 10189 F20101118_AABGAO kevany_b_Page_10.jpg adfc200726929d3382feb1a3664a9e49 e4b372639f0bcca949c0bb1b504c0e47bbbbee71 104300 F20101118_AABGBE kevany_b_Page_28.jpg 15b0e8b56536ec5585bc43d3d6f6ecc5 872bbbd0e6a6f5e9d47221a544fb48052704e94c 105085 F20101118_AABGAP kevany_b_Page_11.jpg 71fbae130ef0eadb1fd131200e0272f8 6f4432e4b6f201aa1b9227ee853df4669217038e 89350 F20101118_AABGBF kevany_b_Page_29.jpg 5a22ddf069d6facfd83d174dc5a8ff6a bb25e4e200a3ed7568cf30aa66a41e133ae31c94 36959 F20101118_AABGAQ kevany_b_Page_12.jpg 172843f69f9b9574c933ecc8aa0bdfa5 af30538f1bcddc3edef1019e87e72eb1bb735f8d 38482 F20101118_AABGBG kevany_b_Page_30.jpg 93b02acff03ce18bff870e8726ec96d7 8353c0f34bdf6a3ba4a3033e44a1130441f67019 110029 F20101118_AABGAR kevany_b_Page_14.jpg 03164380e0a0007f55f45c574616507c a11ba865be6ee0fc140bc9ee89321ba2e1988477 108980 F20101118_AABGAS kevany_b_Page_15.jpg 98d7f75a036b9fdf7fdc4e59c79adcd2 964ad640acb9284cdc988f584d07fe030d479041 111518 F20101118_AABGBH kevany_b_Page_31.jpg 70a99551f45d5c4aea8b9ede8bd15b0b a3bad3ee61954c559bee6b7100a7a3746b972ab7 114382 F20101118_AABGAT kevany_b_Page_16.jpg 9dfbaf36a63844ebb5d2b42497f0bb91 2608115159721aa9fe5a010024f2d62fe7f38564 115947 F20101118_AABGBI kevany_b_Page_32.jpg c887d0d9eb2f6e7b5f728a504a855ccf 47194e8c611b70db57d9cfa97d6c256e79598def 115079 F20101118_AABGAU kevany_b_Page_17.jpg 8909cf0b6c66287af2b57a65fe2efea6 c999436ff9df5ff5da9a5aee567b18ba4219410e 101287 F20101118_AABGBJ kevany_b_Page_33.jpg 66cad0dc01684cb21066405401f740e1 da6c5d762149260c82a246c4e4aab5a9ec396fe4 107023 F20101118_AABGAV kevany_b_Page_18.jpg c7ee937e5d2e505a65e6902dca14797e 15e88a0f8e1ab9725be97430b148289a1d4ead6a 114209 F20101118_AABGBK kevany_b_Page_34.jpg b0b097bb935b76e7b756fde1efa2ddaa 656656fd5fdc98a8848dfbf14f2ac8307ecb0d75 110335 F20101118_AABGAW kevany_b_Page_19.jpg 8262df2cf781a9c0323d23c7a069da04 24e9099987b76c46455e27cb0a73704c9cfe0887 111713 F20101118_AABGCA kevany_b_Page_52.jpg 834a47e9dd7a54abef8f4b850477ca7c 0f10aa35ad236ae8ba719bff5b9fb65aaacc37ab 118507 F20101118_AABGBL kevany_b_Page_35.jpg 7d13923d2b341fa9f3a9388a0b1cd567 e79667d534d86fe904095875c0d4bf021c8b0e52 111973 F20101118_AABGAX kevany_b_Page_20.jpg a349ac5799f02285e8899de16c876ca5 4a06b78f259f3ac9381fad66ca01c7af1369f3d1 68341 F20101118_AABGCB kevany_b_Page_55.jpg 0f7cf67bb0b6e0368a20f80e5f4ae096 c78727fd751dbf409b224640f9802e7eebda9d06 113027 F20101118_AABGBM kevany_b_Page_36.jpg c184c69ba85783bb92cd66ade9ff0fee d896700a45b025b97c5690e7555ddee3cd8d83ec 115758 F20101118_AABGAY kevany_b_Page_21.jpg c28ffe88f78212f1cf2f12d61211ecf6 92eefbd69af5ef82612b1ae017cdad6e10002b9b 54973 F20101118_AABGCC kevany_b_Page_56.jpg 9508e6e396549d7152c419a44f049510 06e8776df6a2d77f279918807e37ab7f09708611 112189 F20101118_AABGBN kevany_b_Page_37.jpg f3247ee5c027d7efc913ae36441abe67 0a8b2c4d4a3df25d52f77026f0da2a056fb2f09e 111349 F20101118_AABGAZ kevany_b_Page_22.jpg 8760017f07ed58079d2eaf0756f54b15 93e4689a0f643f3c4edfc4100e5a0b2664fe8fd4 49391 F20101118_AABGCD kevany_b_Page_57.jpg cf4e48911904701c25bbf57bba861647 8eff7dd076d51283ababe3c2d4e7e08fd4c31695 115201 F20101118_AABGBO kevany_b_Page_38.jpg 2f98addc677e8b1689b3d779b9ec587a 34e4f9799a6671415e57fb0a9043131daedd867c 54242 F20101118_AABGCE kevany_b_Page_58.jpg 3a2600c6d4062251170fe76d1c761081 9af795587e70d57755a10a7a4087e32a1fe468c8 114681 F20101118_AABGBP kevany_b_Page_39.jpg 57f078a4f7fb493d423c66f724596ecd 7bccd3d3eb266b0cbf65bab4881741d8c6e95bea 105178 F20101118_AABGCF kevany_b_Page_59.jpg 2b8ca9730b705fd71b6c709cc154460e 16ee7748d73433a11a615465385819cfebaab1f0 83971 F20101118_AABGBQ kevany_b_Page_40.jpg 21dab508886377bc5d6840d49002235d e51e30d4abbea1d0d59f80c98bdd650f383d6dec 111711 F20101118_AABGCG kevany_b_Page_61.jpg 0e8a1d9e482e20f3f08c93b5d28a7d5d 74d13c6f77ed33e37960c3d9354ad2f2399ab417 49893 F20101118_AABGBR kevany_b_Page_41.jpg ff7af2eb8ae5ad3830731e9120221376 dd7f4acaec4c27988ce7c373dceacdcecf606aa1 109359 F20101118_AABGCH kevany_b_Page_62.jpg b1d984918dfe16ea62cf87cd1b9e8c6f 52071caead4702049cf23166694e355ca4c7a767 29632 F20101118_AABGBS kevany_b_Page_42.jpg 0161c8664491b80c60d1446ebf37c224 7836ee8d5c65c48162c827198eedf80e703b050d 608 F20101118_AABFXB kevany_b_Page_30.txt 9bd59585e5a324cb93ea7ee715e77a27 1518b65479fd4bfcff8a7767aca9ea04aa40a399 46446 F20101118_AABGBT kevany_b_Page_43.jpg 889ceb03aa9d1e8d6714d83a9f97a3d8 5fa16b6f612428db51ba75786104109fdd40b28b 115273 F20101118_AABGCI kevany_b_Page_63.jpg ff2b8ebe6734bef706178da68ce0e042 e91985cdf0b6cad2d9264a862f879a103cab006c 2672 F20101118_AABFXC kevany_b_Page_95.txt 62ed622e146d9ccbedaf3e9578c25dd9 d8fe4c53419a294604b92f4a7513c77eb08c61a8 70056 F20101118_AABGBU kevany_b_Page_44.jpg 0f91c4154e9135f3f736f6bb64365850 3e43547eb6ea67e17adbbd6f2cbab34b4cb2eb26 112708 F20101118_AABGCJ kevany_b_Page_64.jpg ce18a7c44799223f911885fc99034b62 3569e781bc42a7fc83da533a0769f60a25115559 25271604 F20101118_AABFXD kevany_b_Page_81.tif b6514bad5f137d41009fb89729df7c73 ada54c16027719ad89345cf6752d941dab67dbbd 67227 F20101118_AABGBV kevany_b_Page_46.jpg 6b3f523f8fc614b60d396a106cac83a1 e4ca37bec0692f6ea60fb09c5b70eb6050e70eea 115058 F20101118_AABGCK kevany_b_Page_65.jpg 67f58edf42a10b715b9764db07a9b778 aa1a005dc4c9b8d209ee4de8e904a48c0e70b305 35150 F20101118_AABFXE kevany_b_Page_24.QC.jpg 889a7c7a6c399e31491ae2b3db2240d8 7e63367f5d1589127695256dfa49c10970efb4c3 43977 F20101118_AABGBW kevany_b_Page_47.jpg ccc8622c93c476f8db8bed7fc80c0b8f 08c0db53cc99600ddaad3a05224b34e8bccd2bfa 115662 F20101118_AABGCL kevany_b_Page_67.jpg c43b07ace08b7d07b7a11054539a8fa8 7a8645ae40e844a6cc4de25afd9031f7dc0d8797 F20101118_AABFXF kevany_b_Page_61.tif b2b4e3439993cbae6b18d77b1935e7b0 135f70dc9f227002c9765e85abccc28157cc6166 28289 F20101118_AABGBX kevany_b_Page_48.jpg 14ba0516b459f10480af69bc0caab42c a9f4f84d7612355ba6cd230494d3855665c5c68e 113079 F20101118_AABGDA kevany_b_Page_86.jpg d06135fd3237b98ec1259235207d2483 784c07d96eab87732ce243c04b76e159112a293e 35698 F20101118_AABGCM kevany_b_Page_68.jpg 76e431faed50eb2fbc64f5931af62a56 84fe53c105c0c2266ea0fd9c47911b83bb1ac04c 1051970 F20101118_AABFXG kevany_b_Page_22.jp2 52bc46a121a8c920c6e0583cd27f0d3a 58501928fa2cd2cdde43f44cab021c7bf6ddcc8f 36519 F20101118_AABGBY kevany_b_Page_49.jpg 8cd0269953e2624c8e7df431ad546fdf f2f275313d33be19dbf7cb4a8a76b371586c8847 74512 F20101118_AABGDB kevany_b_Page_87.jpg f347c12b5d0ea21e51502146a5748e5c 6d406e75b9faa76220122099b5adb0a8808bd380 44795 F20101118_AABGCN kevany_b_Page_69.jpg 5fb7a7c341fde588a334b03c357b16c5 710bad31abd23f5a38c20b738991ab4800bfc19f 469621 F20101118_AABFXH kevany_b_Page_75.jp2 69c8e0c080833e45cab8ad5e77ddf686 16986113b0cd751c214640f51710768117e46503 109991 F20101118_AABGBZ kevany_b_Page_50.jpg f610d321655ba20316a7703f5fb5d9e2 c8c62ed492fa4235822a4ed6810ef3ea60058616 87801 F20101118_AABGDC kevany_b_Page_88.jpg ac7e73789f41eef4fc50b09ccee028ef 8857b62cb6b9148b47e3e982f71b1a341ef1e768 42231 F20101118_AABGCO kevany_b_Page_70.jpg 3ad4c91699e3da2c26173250b688ed67 182365f2b568c55bb244114ddec04cfbfec4fa58 F20101118_AABFXI kevany_b_Page_09.tif cc5cc06a1d2d1e611ea1646f4c11fdd2 e8f21dda2ce0b854ffb0c2a0c9d97d4e5586d539 135141 F20101118_AABGDD kevany_b_Page_89.jpg 92370d33c61980c28f651def999b66f1 5ede5a5cec938f8f73c8b0cbdd815424c30a2d15 41416 F20101118_AABGCP kevany_b_Page_71.jpg 92ca29014d5ded0cf85f39f4d72fb0a7 648fa6708339015af7c9c42a8a78caad9911a714 6317 F20101118_AABFXJ kevany_b_Page_43.pro 3c7ce80d813f2c9bcae7a51bb72434a1 1ce31e0f063a9dee933f57203326a137a1d64a30 141133 F20101118_AABGDE kevany_b_Page_90.jpg 87a6129c1de293098a1d9bb5d08abe1d fc8fb7d5d2970ee292a606c506450bd46d5202bd 60797 F20101118_AABGCQ kevany_b_Page_73.jpg a19c493fbbfbd442bebf2b134fedb3fb 74953fa9549686c661b36907f308b530d7e0560d F20101118_AABFXK kevany_b_Page_37.tif b30d68e85ce109e69bf84c4b8f142183 1d6d5b07d4198e590a9e3e88ecb6887caf61a601 126126 F20101118_AABGDF kevany_b_Page_91.jpg 41fbd37b22aede1bc8aa8fd189c1e240 8ffce702a28d80cd763d6be4424ed9fb316df06b 38474 F20101118_AABGCR kevany_b_Page_74.jpg 356f12e5ab2e345fdf2ffdd5d45d8479 59e0811d75513aba69ed624ecc24e84f7badd064 F20101118_AABFXL kevany_b_Page_71.tif 089dfdbc6797dca90fb427177273ca73 36e093271b931e98a134ec3722a410bf79a1b1e6 129159 F20101118_AABGDG kevany_b_Page_92.jpg 6c03f13351489afcf1cb0228218c4fab 7c174665fb863106f5a7392d5b9a5ff926bae69d 39807 F20101118_AABGCS kevany_b_Page_75.jpg 4b06ab8313c9ffebd230f3dc554350f9 5972c35ad6d52092a32e61ffb3d633111b42af55 15125 F20101118_AABFXM kevany_b_Page_57.QC.jpg cae5205d7d1c77fbe8aa1889c699a7ac 6d3cf76f1b8f4d389afce2560a333ef62b4df9ea 132338 F20101118_AABGDH kevany_b_Page_93.jpg 1cb882b41556e3054b0cd9b82e2310b3 4c09c03ee17690bc2dcc95ffa2863491555778fe 38909 F20101118_AABFYA kevany_b_Page_93.QC.jpg aad9c4559a3a4734228366428ee071e8 9196b670424d39ac7983989b6842bbbdbdaf0edc 131351 F20101118_AABGCT kevany_b_Page_77.jpg 0ea940a8d705e62458a89da622685110 f353e6e7be44627fdc01a6f0d82f8ed551170fb1 8771 F20101118_AABFXN kevany_b_Page_15thm.jpg c70867e38ed4f50966a7d27f20ea3960 69a59708d01e0f5ebe7a77260df7a10978774637 136461 F20101118_AABGDI kevany_b_Page_94.jpg 74127852d942d73574dd366d1fbb677f 812c82a654c489ededfd35993ea71788f54b1e4d 51560 F20101118_AABFYB kevany_b_Page_18.pro dc1f0b1e9d278aacac0901d0042d3a04 27ceaac23ea2e1759abc54ef0c9d6630bdf50158 34725 F20101118_AABGCU kevany_b_Page_78.jpg 69c9dc5b1a95f13dd8de58fc4b90acf8 8ff32277441d29a0b3ee4aa9d8530cba47ed12be 109843 F20101118_AABFXO kevany_b_Page_66.jpg 5d358236cebc68bf47d807dd3d1243f5 bfa009b05cac916d5fcd451a66f75dbbc48b8ae4 F20101118_AABFYC kevany_b_Page_40.tif 1ede003fda4eba0eab4f12f111ce12bf 0801923d4fc8c56d74c28aba8ece122b095c82d6 39892 F20101118_AABGCV kevany_b_Page_79.jpg c38747ec9c3c51be020b88a8537746cb c90eb9f5a56f0ac6d46ffd5b22e563de7eab13d8 1051907 F20101118_AABFXP kevany_b_Page_86.jp2 258e43f67470a17b94a835ffc5ffc1da 201a2935397dee5b0ff6decb51ea5ce26f0028c0 141384 F20101118_AABGDJ kevany_b_Page_95.jpg 086fc5a5018c2b9d65ec14a7dfe441d9 583d003fd11ff272d201afda96ef842599c1ffa1 343 F20101118_AABFYD kevany_b_Page_42.txt 93c03c6901307b7a8dd3c6a5cfa95284 9d6631691af7f51d53b09b723bf6ddb146bad1f7 111266 F20101118_AABGCW kevany_b_Page_80.jpg 68152a1a5757e78b2531207d6d0b0645 8d422fbc5de08bd7f23e32fd736a22332139f308 44906 F20101118_AABFXQ kevany_b_Page_72.jpg cedf953bbc660edbf97ffda9495d0d17 c3fb6bb8fbcff3bf4795b0c8dc4e51bbe1640e16 142360 F20101118_AABGDK kevany_b_Page_96.jpg ea4eb248d9edba9e8b25c3ed88b276c9 b286f2db630183dc6b20842706f9975de633574d 49231 F20101118_AABFYE kevany_b_Page_33.pro 30209635018b4258708b37e9504693e8 7cb9293f3e0b3e1c62d55e1428a2e6bcc38c5ca6 116685 F20101118_AABGCX kevany_b_Page_81.jpg a67851b88bc56b56ecd2fcd0324c3aa5 f69418e78369af9b9f555f3b28f193faaf261bd2 2223 F20101118_AABFXR kevany_b_Page_61.txt f2e80c3090c81e0ad2a30d7848de0cc9 7cb9948380269b122da1b2da4cdac0d007295ab3 1051951 F20101118_AABGEA kevany_b_Page_14.jp2 6f395bb7e1333251e687a697b361beda 28183ff962b39eaa78e1fbc1ef5492c782b8e3e8 11223 F20101118_AABGDL kevany_b_Page_97.jpg be7d072cdc36e73a176ae93308a28025 cab934fcb8242740194301ef896464de6ebadcb8 53220 F20101118_AABFYF kevany_b_Page_53.pro 40109b194002b3da11f129d6bd302c97 6be642ec536a81220ff93ae7be0c36047e632372 103527 F20101118_AABGCY kevany_b_Page_83.jpg c82ce0ac699555a64cfade414a226182 78eece7314f96f43ea46ba740c2c1b5389009681 643 F20101118_AABFXS kevany_b_Page_68.txt 8b6d98c09c33809ad99e398fcc2c1272 c4ae275654a5a8ff8a1d458d8ed3efeb95569f72 1051965 F20101118_AABGEB kevany_b_Page_15.jp2 b86a33459b37f565e216d29c8a023a92 8b80c2453a25b158f2629f9404392e591f7af510 81051 F20101118_AABGDM kevany_b_Page_98.jpg 3621e64db147418044496c1447d95fa4 43e503dd0db87d5c54209682137312f0bcc08c31 53235 F20101118_AABFYG kevany_b_Page_60.jpg ac6501ab6f6f55b3327b9efb79197394 40a304a3a31e3bd63a2ccb03019273f99f883416 1054 F20101118_AABFXT kevany_b_Page_77.txt 3139493562cc265d73846739c328869a 9f1da9d79ef82cda139ae58cda90b41eae858328 1051981 F20101118_AABGEC kevany_b_Page_17.jp2 29418d0b061c745ef4c70d03bbdd2c5c 1087b5c0dce954c7df19804d12099dd7bb7e7bc4 259531 F20101118_AABGDN kevany_b_Page_01.jp2 9d22d42bfa2935bf1b746cfe50354a24 501fb4d549d2fdf8bd804d31f331c7ea1ee3c416 F20101118_AABFYH kevany_b_Page_47.tif cc218254d2766bfb975dc61574ac77e6 584ef121f9893044411ae83dd58e009806d0fbba 110409 F20101118_AABGCZ kevany_b_Page_84.jpg 2e7b1d8ebc652de4980baf187cd652fc 859ee1fc3856277c31dac1507d0f3347e789a8c5 2717 F20101118_AABFXU kevany_b_Page_90.txt e2f9cb3b68a82a41079929337b8493d1 328968586493192672bee901a95af1efa2519848 1051922 F20101118_AABGED kevany_b_Page_18.jp2 66dfd95152cd1960e4cf65e564554006 bb50fe1376ac1846d960b3f3d6f99f5ece2e5de0 29428 F20101118_AABGDO kevany_b_Page_02.jp2 1674478806a32d43ace9c43d15f85f00 b43094096229a94e7e5ec4b10ba18527cc5dfbbc 60838 F20101118_AABFYI kevany_b_Page_45.jpg 5aeddc5a62ff91f0b6a483d130628a10 6ebdf70437ff9145bb7aee6e94af09f5c7a94794 22099 F20101118_AABFXV kevany_b_Page_55.QC.jpg 3e13dea50663229765effee0a044b687 388280e5940e85b99116146be39104b6ab33c381 1051935 F20101118_AABGEE kevany_b_Page_19.jp2 b9dad225f5152ffdfc8bb30480c88e4f 7765d5693745db7919267b9a24a8e572c9c4c880 73198 F20101118_AABGDP kevany_b_Page_03.jp2 a88f9fcc41be0aea49fe82cf46600547 b2de492075c49a89207b6ee6c7e52a36ccb44dd0 101407 F20101118_AABFYJ kevany_b_Page_82.jpg 6a9d86c149da3650ac4ee28e225518c9 70705aa221652d49a0726b25b2f51ae983e14353 F20101118_AABFXW kevany_b_Page_87.tif 2036c2bf1b9ccd8176c1a615913e4f33 a099c7ce6800e4af0395a18919d080f5ead4c5ad 1051948 F20101118_AABGEF kevany_b_Page_20.jp2 78cc606869e0f4fdbf2a1c2fcd77b693 9b009b9f9395dd2d7e9661df3f3c7e92b2b00508 F20101118_AABGDQ kevany_b_Page_04.jp2 f1c3830538baacaff52aab7f2c1d373e 18e9ed23111a9ec74f5ad904c8a13d30dae60c3d 784 F20101118_AABFYK kevany_b_Page_57.txt 02a24216c2ec11f7b81272c9b3e7ca54 62ef85b31340fe4ef3fd80aff216b23f8810e2a6 62166 F20101118_AABFXX kevany_b_Page_59.pro 8c61207f761694fb8bc491604d6feff2 8c0d31e3719270a4a45472c43ea1c4794f8acc17 1051936 F20101118_AABGEG kevany_b_Page_21.jp2 36c0dfe5e7420db4bb85eb287703bf8a c4abba2ec701d7c1d7bafe1723c5b3c9139de4d0 118151 F20101118_AABGDR kevany_b_Page_05.jp2 9c1527b9cc72298d129d9e195dedcfb2 255016d347e5641380102eb2cbb5da3ba988f321 110749 F20101118_AABFYL kevany_b_Page_27.jpg 4d33fda2c3f832a3dfb16d1b15708a91 bfccd23085df6add36d6e824218eacbe720455dc 34792 F20101118_AABFXY kevany_b_Page_85.QC.jpg 94e26496ae2860ca132260034543e849 43c166176f8f29a2ab70ee4ee6c9d7c7d5b96884 1051955 F20101118_AABGEH kevany_b_Page_23.jp2 dd7cc216cf8005f312c5e7ddbef2d3d4 b62db077f3322ac883d8dc86064b3bd130f6f413 106471 F20101118_AABFZA kevany_b_Page_85.jpg aebc5c8178a21bc140b1c63c55a05b6a 3cba07b081fe24d975a366d744231547267d8f00 1051980 F20101118_AABGDS kevany_b_Page_06.jp2 2fe991e1e44c39499b98ac6724725fa8 964e9b158ae406c911a669bad6c2890f512a5499 33379 F20101118_AABFYM kevany_b_Page_28.QC.jpg 70f4bb9adca9f0a1c15c95a1cef3d86d aa95bfa997616f5b4d7d5a18682918292bb96a04 107410 F20101118_AABFXZ kevany_b_Page_13.jpg 71bb2e0758af44baedff7c1e9445fffd 1bf95747b8ee405b4132e5c29686c10d8549c7ac 1051979 F20101118_AABGEI kevany_b_Page_24.jp2 0463aad73c651004e6005425905cd045 c37a2e4c28b1bf7e3b8e9056ddbd5da58bb164c9 18912 F20101118_AABFZB kevany_b_Page_56.QC.jpg 5f233d00fdc2605f995c7257cffae90d f3b0633a2f229236d1f3cc238f760b76d7213c1e F20101118_AABGDT kevany_b_Page_07.jp2 9effdc80d543aa907e2587024f327bed decbbba586faa01776e11239dff56664d78c52d6 9374 F20101118_AABFYN kevany_b_Page_25thm.jpg ac5a8068347ee5d22360725df22ec51a 539b027a6ac0f6fdc64a087b076477ca2b8c325b 1051961 F20101118_AABGEJ kevany_b_Page_25.jp2 b68972c7f648ad47f7578cc2491a88e5 2333589355c203bab9fa0e30823b947375d8bf84 F20101118_AABFZC kevany_b_Page_22.tif 4b2de365ae2eae561a5e22a9e7a8bee3 28fa4a13603a26fefb1ff5f41ff409e7ebf3d83c 767766 F20101118_AABGDU kevany_b_Page_08.jp2 75fda08a04ab0bb430090f5fca4e250a 25aa7c25cbaff077dd7b01dc302d0f6c450eb74b 53767 F20101118_AABFYO kevany_b_Page_54.pro 061ddb970067f96215a6e41559f1bba4 d07b1f81a11a1251227a9bbfd6380867ea9e02d3 4156 F20101118_AABFZD kevany_b_Page_43thm.jpg fc25fa6c5176ce3a28f69e8a3f3667a9 0527e6f34d4d8abade7db6d70fd2b3f190347e5a 1051974 F20101118_AABGDV kevany_b_Page_09.jp2 751c61e6cae4c3e8d95574936ecbe4ab ade7eec789878bef77476b484a352e1546205d1a 2337 F20101118_AABFYP kevany_b_Page_03.QC.jpg a348c7591a747fa8c098bc4345d16550 545435527c4ea55828cdce0a0c2c02cebff9ffdf 1051986 F20101118_AABGEK kevany_b_Page_27.jp2 cc1f91906d424b36dfe2bc19c63af43c 29fe909c179bc18ad996df6cefc35e6e4d34be4d 55823 F20101118_AABFZE kevany_b_Page_39.pro f6fb95ea1b4fa2065d56df9daefe8f2e 7e196265b0e7682f5cc37c6917307fe09dcd0cac 134889 F20101118_AABGDW kevany_b_Page_10.jp2 ab62953329ab6c3050c122daaec6455e da550a25de6f5ceea9370683b3f6a08b64686521 F20101118_AABFYQ kevany_b_Page_07.tif 781b3c427a4b8b73a16e5cc8fec25afa 4f7dcad8389019f4baf0ee66f989abae4102629e 1051917 F20101118_AABGEL kevany_b_Page_28.jp2 bf40795cb57d50b123e1722986f7a12c f063ec67a4437a5d32bf82c0b0f1d048b3711549 F20101118_AABFZF kevany_b_Page_65.tif e1585d324d61651b16db158db0f45f83 d3378b4452b53bf5379d0cfda1cedc4298a65e59 1051977 F20101118_AABGDX kevany_b_Page_11.jp2 d25a7172b74c7adb8f3dba52d0539b84 98a308ac7e1c3e8f6f7a635cd871021bbcdd33c0 5585 F20101118_AABFYR kevany_b_Page_73thm.jpg d2b977f0025704f290829d8a716c900f d569242df089b85db153cbdba0457d27e3c1a54d 706329 F20101118_AABGFA kevany_b_Page_43.jp2 b2d518cf255f4de42136c2b15e8b625d 9071c9101ddca3fc2501df45cf4a379579ec5443 975786 F20101118_AABGEM kevany_b_Page_29.jp2 0c9b24ce16a7ab50cfe6779bc4961355 c1d771a62d7ce17ceb42519cc70a39e26c1d2396 F20101118_AABFZG kevany_b_Page_23.tif f27e9ddfb2a0545893bd884e05ea0369 9e7534988048312774db8d3d589699eeca10acad 386201 F20101118_AABGDY kevany_b_Page_12.jp2 079aa82b862088b90c26445983855fba 8511162d46cae806d00e9483ec61a926295bf9bc 20883 F20101118_AABFYS kevany_b_Page_46.QC.jpg 7c44f2034f65f900272785da899fcec1 56352edc0808b9f5476af025e6999292bdec38bb 818124 F20101118_AABGFB kevany_b_Page_44.jp2 d60fc75549ad2abf66b22abfc16635f3 ea7bac8b700ce7b9a595f9b83588fb804580f587 380422 F20101118_AABGEN kevany_b_Page_30.jp2 5f5c9a0f22b7767494a5ef5d2d6e6d32 69197e60c88fa3ced24386b19bf1a2e941fc820f F20101118_AABFZH kevany_b_Page_52.tif d46847a72523d68c730f86280d7acee4 4e578637aba0398e631c33b010a5d889e1b59f49 1051968 F20101118_AABGDZ kevany_b_Page_13.jp2 4edffa988ee3679dd9048f6287a6dabf c67d74a82a06a53a2ac5b7e0208d58622551bd2a 66798 F20101118_AABFYT kevany_b_Page_06.pro ae5cafbd29ff47e34f45f54817ff52e9 9da31bc854f8921300c16acca6b872355d640288 897290 F20101118_AABGFC kevany_b_Page_45.jp2 8a72dbae902d5254013f0f9cc61f3b36 a0f1ccd17257cb4b95530195fa6141b590d7d5d0 1051929 F20101118_AABGEO kevany_b_Page_31.jp2 fe6d9ee3c71de18393e6dc1b2b5f504b 47335f2002b966f55e281337becde9d866dfbd75 584935 F20101118_AABFZI kevany_b_Page_73.jp2 0d296d1037663be16d9eb1ea78662049 2e727092ef5947c0644016ab54b28f7a4fb79eda 1051960 F20101118_AABFYU kevany_b_Page_93.jp2 2a05891ea252b0391a5499cec3f8f4b9 8f1a93df4dac9e7ff3ea49d0f95e164cfa726815 976215 F20101118_AABGFD kevany_b_Page_46.jp2 bf73abee365ec1d07bb404db5d310988 cb131fd43e03ba06fd70fce699931e15f141909b F20101118_AABGEP kevany_b_Page_32.jp2 5cd6cfa3a9a45ed02465a06660fbdf6c 003fecbe144835f48865ded697477a2f4a7fd428 1051962 F20101118_AABFZJ kevany_b_Page_61.jp2 c9d0b6cc3ddd022fac6391fe2b0f6889 5a049d44781f76f80eb8d10ef67823b7e2e90165 5404 F20101118_AABFYV kevany_b_Page_55thm.jpg 4681fdb700a43a715f27ca3c9201a4ba 92bb6febe0d7b65ba9dfaf5435b3e5a7f1d7165c 489372 F20101118_AABGFE kevany_b_Page_47.jp2 84b1bb8da12e4da7df3a0af30f1ae57a 33585542172852d54013524dd77a087e76c6c106 1051953 F20101118_AABGEQ kevany_b_Page_33.jp2 576cf24bac04ff84226e2094ed148184 a25191af4666a19c2eda4c7288687180807ede8e 35205 F20101118_AABFZK kevany_b_Page_04.QC.jpg ba4149ba8f6a72903912dbfc9206a219 208ad7dd464bc4fdc606c87cde77c095ade69a97 9660 F20101118_AABFYW kevany_b_Page_89thm.jpg e615900b031fe250d2fed05e0ffe0304 38d763f2ef1aadcfbe01b35972498534af4ba759 324256 F20101118_AABGFF kevany_b_Page_48.jp2 006e94dcf12fa4cf66835599395c7d89 97ec3bfd7f097e8a1820e33fc1f8a46283ce3754 1051983 F20101118_AABGER kevany_b_Page_34.jp2 816105c810052c8d0c272c9ea7fa1f71 def67b05b6b6c633670dc32d211508479a0a830b 9194 F20101118_AABFZL kevany_b_Page_34thm.jpg c7dbd50619f9f0d2c1b31a276c26287d d8b95b3dafbada5cca0caf78e0974dff26141e46 1051975 F20101118_AABFYX kevany_b_Page_16.jp2 1f7f131c9c765fc4c20c6ae0ffee07f2 dac4eb671a6ec94ef2da455221490f94f031ca8c 359974 F20101118_AABGFG kevany_b_Page_49.jp2 bde5acff5882087966f320f2148b49bc ac6bdef414ee93b9afb05d464f3850e96ecc33c3 1051957 F20101118_AABGES kevany_b_Page_35.jp2 210ee543f69a010d204d8d8c318fbcc7 2b4e0a4b430a29073dc048fa3bd89ac0599f48ee F20101118_AABFZM kevany_b_Page_92.tif 5eb5e396418c843da1781899ab8a55bc 0e74eabad0822c2fc5ab63d3dd524a15a8aa6bed 49844 F20101118_AABFYY kevany_b_Page_85.pro 10ea524a55c1c8022b5a9af5da6377dc f06e3f4f0e737e6b82fdb80077461dd11dc53d65 1051938 F20101118_AABGFH kevany_b_Page_50.jp2 0f1118904da26fd0b2656d0f7b1f75a2 5252bfd69e359f0818910d92376ae6388908d63c F20101118_AABGET kevany_b_Page_36.jp2 5c0888e0c702298dcccfcce472c7378a 931547fc8145dbef88d5a37958a73b03a3f21df6 64568 F20101118_AABFZN kevany_b_Page_09.pro 4cc5a69e05b394ea8e02d15881762186 1e777c5721af7700f694ff778ab087a6caa9ed52 1051963 F20101118_AABFYZ kevany_b_Page_26.jp2 ce202d82e1a0f484fdd4141477dd0493 78badce894c120b114494fd9de818819e06c2165 1051946 F20101118_AABGFI kevany_b_Page_51.jp2 e6b89236130f63bf3925fd77ef3af322 f8a0f25d6101eb4e54bb02ceafc463701e3098e6 1051964 F20101118_AABGEU kevany_b_Page_37.jp2 df88d62e7ccff007e41a2b7d3ee2326e 056bd94a9e4095fd0f0d98ef5498517d31f37c7c 42639 F20101118_AABFZO kevany_b_Page_76.jpg 58a10fe4248cc644466b482add4310fa d6f58425bee7f9fd302c0710645bd3f6f8063a3c F20101118_AABGFJ kevany_b_Page_53.jp2 638463bb66e45992a24adb846f52bc85 1f1fd078af557a9e74b316ab5d608d2d4bab2de7 1051920 F20101118_AABGEV kevany_b_Page_38.jp2 f4d9b15fabb0fd4ff089b0d9b3470528 48b2b0b7f5e4a64db70af543d4a3a74d01142e80 14638 F20101118_AABFZP kevany_b_Page_60.QC.jpg 5ed1f70acd49ab71b6d8e2c9a65b20ec d4522b1582fe8bd36f6d93da0d39665013ac9393 F20101118_AABGFK kevany_b_Page_54.jp2 2c1eb0326ff01c3658700abd3e82706c 137af3bfe47dc02d7750175ffde2699051176114 1051985 F20101118_AABGEW kevany_b_Page_39.jp2 6ed8570b08165e358bf0de80bba89ee7 b871aed588ae1335a7582163f2c033e344598e63 F20101118_AABFZQ kevany_b_Page_94.tif 019063705ab5ca456d615eb31f9c45ef 2b402d0e507d4d3acb55b86823d014e766328875 923834 F20101118_AABGEX kevany_b_Page_40.jp2 4957ec0e500469d4a5c7af0e18e6dec5 d57147e1ca9025b40d33862b59330adbc5de25a0 109626 F20101118_AABFZR kevany_b_Page_51.jpg 70406459c79f123c1defa31b83af0aa3 773f40ac9e4e120a5309a3cc387ec2a763ae5009 512253 F20101118_AABGGA kevany_b_Page_72.jp2 b0c92248f24907718a692fc319b7099f 076333ff31ddc4cccb6be2dfda55effec3450af6 894941 F20101118_AABGFL kevany_b_Page_56.jp2 b3668e63a18e2e345b0bf7dee1491d9b eb2fe104bf64cf797f9d0845f29d0f63db6a0118 675660 F20101118_AABGEY kevany_b_Page_41.jp2 3791a43d9af5e17526d7b68fb12609ad ad3f9e711111fb0ad5c2f1702036c53963b69665 109848 F20101118_AABFZS kevany_b_Page_54.jpg d17c9b23c5d38ae4346311409ba0fffb 3093158d6347d3a4909f1cb4ca9cd5fc95b93717 375921 F20101118_AABGGB kevany_b_Page_74.jp2 7f84c7a7ab4a53390d8c736fdd4376a2 ded1439bd7b94dbb9b603dc4269c56319d6def79 597156 F20101118_AABGFM kevany_b_Page_57.jp2 771167fefc89749fa99eaf8279e13785 cb73bce77a3c50390fbb697154ac54fcb2d5f81f 323175 F20101118_AABGEZ kevany_b_Page_42.jp2 5263a676cbeb622a8f0414a3f60c9672 ad8839e918cc5ad61383edb1f3f413950ccaa90e F20101118_AABFZT kevany_b_Page_52.jp2 9bfe94a67ba45c3fec3f9715e367d41f 25eae14421512994fa723de1b27438f05b7207ef 436732 F20101118_AABGGC kevany_b_Page_76.jp2 f8f32cc87154ab721a01d921b3813412 cf4bb7646e361b72b1822308c082f94aaa862299 773854 F20101118_AABGFN kevany_b_Page_58.jp2 e89b29a94c81e2e77e52650c199386f7 32163db20072a71a2788d206f01359c48c2ef911 13123 F20101118_AABFZU kevany_b_Page_74.QC.jpg 05116ce9c43c06a08c21834e8153f0fd f2bbcc672e06bf9c430e61011e3c7fe246ded823 F20101118_AABGGD kevany_b_Page_77.jp2 c4c6153958712122af95346bc3e1ce81 178d7b9a99766f97c527d6f2903ef63b13d61fdf 1051982 F20101118_AABGFO kevany_b_Page_59.jp2 cbd1465d24b097ecb209ce93c1d534ee 805335c86a85ad399a1e93b67beaba761de59ff7 746149 F20101118_AABFZV kevany_b_Page_55.jp2 ec459b0f95638310eebc27fc9188ab14 1a3942bff660175fe73dfac87191561277d4d7d3 433137 F20101118_AABGGE kevany_b_Page_78.jp2 ff612393cd06f5a984e839faae9753d1 6f2beaca99429811dec9951115ff65b49d8aa75b 594869 F20101118_AABGFP kevany_b_Page_60.jp2 24fc7cb5167a43585fee87443e8b107f 131f48b0effc3787e48736fe75ac358c39349e66 14069 F20101118_AABFZW kevany_b_Page_43.QC.jpg 1bbb95290a37d665f3834ef4438eb763 4a75e632184703c4939204002628123a263e7200 515414 F20101118_AABGGF kevany_b_Page_79.jp2 109a8eac0bd035c779e145b4fc21d242 c7605c31fbd7cb044d17b6273564b08f9986ce8b 1051973 F20101118_AABGFQ kevany_b_Page_62.jp2 83d14718c1eecf2cc31f9da3049c0bfe 9dc54d603d4d8a2d745ad1bee0f0f42e352b0102 106857 F20101118_AABFZX kevany_b_Page_53.jpg c4db0bfdebea2bbb48008c53f32496cb e23e1e2f44e423d452a787fcc9fd438370080e0e F20101118_AABGGG kevany_b_Page_80.jp2 50bc8dc020cb6aa2ef6d55bad95ca79a b2ad86c99d250b931e54c76affb29914d2c0da59 F20101118_AABGFR kevany_b_Page_63.jp2 608d770321586f4ec1ccefc6cf045cd4 e2f363f302b64a2e7fb2c7adfe3be4969148135f 8654 F20101118_AABFZY kevany_b_Page_09thm.jpg 77a84358217cf92f89e333c501ac0955 c3af89726e2efa4e586d65092f33e76a0f8793f3 1051984 F20101118_AABGGH kevany_b_Page_81.jp2 72bf682291b2666361fffad610a1adbe 832cc892651de9108bfb3892256abe9b6cbb1da7 F20101118_AABGFS kevany_b_Page_64.jp2 58544f2e4a9d6a0ddba600fa8932c946 0de69d5756d4ba7b643bb722003f18d55110dbc8 55307 F20101118_AABFZZ kevany_b_Page_52.pro ff6a1f0352d5c08b9d70872f2270ec5c 6e5a826cad67323c29e185c74b21b86a4ab82eb2 F20101118_AABGGI kevany_b_Page_82.jp2 9e44b606386badb0566d30d26ea67a92 40e44d10d86a75ee2c4b27f68738ec65f9238563 F20101118_AABGFT kevany_b_Page_65.jp2 40d885ffafc9acf288dccc3f7b7168a5 02ef196392fd55f2d3b5c384c5323d3250e716ec F20101118_AABGGJ kevany_b_Page_83.jp2 09a9ddd0c48205686494314ce65a5c4c 37da57d79feb429331a3fda66172699f3f5a0de4 F20101118_AABGFU kevany_b_Page_66.jp2 1e4b06c2167c572e40c2ebf8ea02cadd 656128f35bc8067b67ce818bc998d558c7dc05ac F20101118_AABGGK kevany_b_Page_84.jp2 e450186409a7b697c627ec116421708f 7614e637b315fe25deb8bc4cec110a4ff945b002 1051954 F20101118_AABGFV kevany_b_Page_67.jp2 23ba4d158a622960a7707b19565624d8 095e18848abb4dc42319098df792796a9610a200 F20101118_AABGGL kevany_b_Page_85.jp2 07b279a44c85fd60b566f2a90095e503 a2d9ce68e0d72a93db815d9376e31329e5abe92a 374975 F20101118_AABGFW kevany_b_Page_68.jp2 76a9c4e1f0203be5dff29e2a5296776a 8c3ff4662db5ef8edc689afcae1f64b7d2e46920 F20101118_AABGHA kevany_b_Page_04.tif c8a780ff62cd1ad3ade8b562f9538889 88708d33f5a32b2fd5f52b74fa2a9b9b96060a19 572807 F20101118_AABGFX kevany_b_Page_69.jp2 700a985fc13c2d51ea6921f9d12ed087 3962fe3ebf6996446ead230aba495b71f6f525ca F20101118_AABGHB kevany_b_Page_05.tif 5256193a3476cb1f2c48f3dc3bf3d176 4ad41068b31c3577d87394f3dc1a59181ff506ea 795546 F20101118_AABGGM kevany_b_Page_87.jp2 3b4e9ac8d5fd8952d2331662fb263017 e10c06190e77ff5734eb49e979a512ccf1de6ae4 470738 F20101118_AABGFY kevany_b_Page_70.jp2 99a9fceab134b5ffb4406918b7160fb8 997c1910f8f5f81c87614d70059b3eca5bec13ee F20101118_AABGHC kevany_b_Page_06.tif dbab6ccb9026619c310105ea32d50df2 e1b5e9d094def0e0aebaecef60eb0ed6d3b5df03 942323 F20101118_AABGGN kevany_b_Page_88.jp2 6a61f17ce4bd215642e9ec827a4ad299 4eb84fae3211c67a42486463dca737136b4a18f7 492979 F20101118_AABGFZ kevany_b_Page_71.jp2 e5dbf928e89ac0ff18255d31868ebcc4 5c9e7f3d67d68847d784d743f2956ff194f82757 F20101118_AABGHD kevany_b_Page_08.tif 7931630901aa07bdf29361a98eb25cc5 8ee6baec47f4e291f8d00a55931c31296c7a400e 1051945 F20101118_AABGGO kevany_b_Page_89.jp2 700eb9d24e87ab6725022b616f61eb1e e22fd49025887c451571f449e8ee6332a09da89f F20101118_AABGHE kevany_b_Page_10.tif 1a68386d8510d8b562877b742060723a df71b1300454fcba6c861cd0ea9c950b26647f19 1051971 F20101118_AABGGP kevany_b_Page_90.jp2 ab02add0dd3b388d39d0a026e57cab37 7e2359f420438bcd2d4e774298b8f11838f76d62 F20101118_AABGHF kevany_b_Page_11.tif 716dbfb53aaf24214d6153836dd3f47c 554b9dc72955bc2216a952087731b26398f1e30b F20101118_AABGGQ kevany_b_Page_91.jp2 b548d4e8afbfd6df34ed75d04e7e2f88 1a5ecfcb862cb0bc66e58321293ba6342213a53a F20101118_AABGHG kevany_b_Page_12.tif ff0f75d6adfebc63ebd57e1d2ce77d61 7558499e2df81b7fec4310b2d3b9b0e4a7348eb9 F20101118_AABGGR kevany_b_Page_92.jp2 f7578d7aea35d412c5cadf38eef52c39 63ae5cdabb6b37617c53306b5814937c533c5366 F20101118_AABGHH kevany_b_Page_13.tif 3e465666aaa99b7ecd3508a40cea1f09 13568ab08d6696051bce5dba8445ef5cd7e12a34 F20101118_AABGGS kevany_b_Page_94.jp2 2a046377a393b76a8565f3391a4aee63 f76365536dc8cf184c16b79d809d86f04abf6b69 F20101118_AABGHI kevany_b_Page_14.tif bb88d78bbcb6e0ea997d5229bf8e88a7 9d198f2b18c3e8a566b681643912f1766cf9f82b 1051898 F20101118_AABGGT kevany_b_Page_95.jp2 daa0fae287d3236302bb7cfc753372d3 f6705d2dfd8e37b1f9ec5afffc1a7964268d0c77 F20101118_AABGHJ kevany_b_Page_15.tif 8f7c2402b832286436d1d5619ee00650 bcaf1e283c68f2176f9c512bac6045ea7c35e8e0 F20101118_AABGGU kevany_b_Page_96.jp2 713499601e59aa1949000bd56ebdbf9d bf6584b477bb0e0be13d1356352e4a6c2f9e9719 F20101118_AABGHK kevany_b_Page_16.tif 0ae6391ff1db031d16291fe601a2724d 6e04f78d07b29af28f10f31087f9ff7607206149 95736 F20101118_AABGGV kevany_b_Page_97.jp2 04d59714ec911e008182bff9359321da 4c735372928861b859d534245f061238fa70835b F20101118_AABGHL kevany_b_Page_17.tif 13365aa77ab7dde6910ac99441653842 f47eec4dce3914d99674047cf2c641f508b48b0b 858393 F20101118_AABGGW kevany_b_Page_98.jp2 55ceb4a079b0f4d1187ceaa4b8463eb2 8a4f532e1fc055f0ca4068ec8eb03354d4026cc1 F20101118_AABGHM kevany_b_Page_18.tif 9fd668f1067120af205c1989726702ae bb26717fe0d067a58866ba5e12b4e857cf14e00f F20101118_AABGGX kevany_b_Page_01.tif e5abf0bc02fecdd78a806b90f366a111 7002b9d8f1122332d2bff878738417161243c5b5 F20101118_AABGIA kevany_b_Page_34.tif 8ecacdb4ab11b34c6bfe78d2e42ec72c fcd346d3643c4c60f13462d9b0ef0486e89e8938 F20101118_AABGGY kevany_b_Page_02.tif beb933f8da98398df6dfaf0537d179bc 406c473c84b570d38eaa26719b29f4b627bfcc80 F20101118_AABGIB kevany_b_Page_35.tif edc595471bc03763d8a5c6f1a4791e4b 6fbe12f1507fbb3db07952c0215f3f8670bd3c21 F20101118_AABGHN kevany_b_Page_19.tif 7eee3c2d8e9916139d4eb40307c51765 34adada00f6a0eb351805d2d49c113c826b7eb3b F20101118_AABGGZ kevany_b_Page_03.tif b7bc00adaa348c37748b19244ae539bf e4e4c367d3d8231d5b4aec9e309b0737656942b4 F20101118_AABGIC kevany_b_Page_36.tif 1b29d7797695e6fdf09bc5cd229a5b74 842a01a620244c5598a380d4fb9ff4c6c750ff39 F20101118_AABGHO kevany_b_Page_20.tif 93dc746ccb06e8c812e73a8323b40b49 71d8ed3c80f6eb3a03b2196af3119b85c75bb0c9 F20101118_AABGID kevany_b_Page_38.tif 7c4d4d5633499f5c15ade7d08d99e641 2ec29871d3eb8f0ee63f7dfb43cffd8123e9833d F20101118_AABGHP kevany_b_Page_21.tif d77756bdcc356695c4d33143ca2d70db 7c70ccea64ca28fbd3e6aa6408f2b710e7be3498 F20101118_AABGIE kevany_b_Page_39.tif 2311bd721d4bdf20e053b86823596518 2f9940cf3513a692d6ac0674ec8ca5e0841d2adf F20101118_AABGHQ kevany_b_Page_24.tif 9b2ef4af1bd17328aed2550815d4b0c3 1bba3c9d0212908c054a664762882028c0f187bf F20101118_AABGIF kevany_b_Page_41.tif b4aa778846b74f0868bb6b89a492065b 5c55d82593d62d7be8aeac2e994efb7e50619ae2 F20101118_AABGHR kevany_b_Page_25.tif 5323bc106af8fc5a8e105a7091a9a5bb 16f0457c51a838dee91048632845ef68a3ed8c80 F20101118_AABGIG kevany_b_Page_42.tif b242da94718041f1dbb99cff2c3a6429 67729255961ccd6b98edb6a1438edad29b9a14cb F20101118_AABGHS kevany_b_Page_26.tif 3b45133854c21cbd0a7353f4989d8ef9 d9056e539bff84ebdbeda1c6ebe0f4f8a7d86ece F20101118_AABGIH kevany_b_Page_43.tif 58e826f7cf10a07978d5ef6421b1894a afab94496245955b13a7fcfe1055feef1636af6a F20101118_AABGHT kevany_b_Page_27.tif 912eb1d7faf593cba1902f9a7cdd1605 6d2dbbdc482b6cfff6b9bd3253b96c9d2637baff F20101118_AABGII kevany_b_Page_44.tif d8927bf9f50e4ed2c09407e5ca776d7c a368eb59787bfe06eeb459bfb272d8fb6256ca25 F20101118_AABGHU kevany_b_Page_28.tif dee223f558af9839db76b871d8e28ebf e26cd29e96446a46c35a14cf73afb5465e183c5d F20101118_AABGIJ kevany_b_Page_45.tif 740e82e1f04f74aa577acce54de9d8ef 5f98f50ff4d96e2f30c793776d395842583a5c89 F20101118_AABGHV kevany_b_Page_29.tif cb07cdd2e52fa9e652f5878200952c6a 13636095a3acb7ccebb1e1a2fb7b3a9ad5f0b559 F20101118_AABGIK kevany_b_Page_46.tif ea057d20db2c314568f28f787406b424 0dbff4638c30a8c915f13b09cd8299279af7e0e5 F20101118_AABGIL kevany_b_Page_48.tif ba3292b03f4116fdecd6f64bd7d1c067 b483ffcc6c40ce7c55e1e72cddd2f87375eeacb9 F20101118_AABGHW kevany_b_Page_30.tif d5e489509e1c3ae2782a472177f1acea abd90510d80793b17b9aa29a44e93ec6452dc255 F20101118_AABGJA kevany_b_Page_66.tif 1dfb109ea1086e40e12b8bf6a45c79cc 8af27964ee301435b5bb62e55f74e45525d9084f F20101118_AABGIM kevany_b_Page_49.tif 353f0d7a2ebdea85f2a791df5c205b43 12990d3658ba77d973fd8e84b54142913c9a53ea F20101118_AABGHX kevany_b_Page_31.tif 6561d8a3c6459956898a9d62067f3138 1b0054fc29aa4899a3f3f4490669cde08a8e725b F20101118_AABGJB kevany_b_Page_67.tif 352c02ae59a0b63ca67a8d34274e3f9d ae6c9334e8324f1797deb99c8a8ccc4e861ed30d F20101118_AABGIN kevany_b_Page_50.tif 4c015507b05d84bc165b5de3177733b6 082bdba8e8e3fd7de63c53c3001e9136ff5e3680 F20101118_AABGHY kevany_b_Page_32.tif e7d105bd191b49dbba2efd916218b8f3 928cbca0bb43960039ce9c2d87890de73effa005 F20101118_AABGJC kevany_b_Page_68.tif 59c4e7502dc54372915d42398d20ace9 bd357dd92cd42b0d4842b6ad6a28184243f6c435 F20101118_AABGHZ kevany_b_Page_33.tif f56c25b4e62543987773ae3ba57e6b44 1310a86c6b5bdd023be82bf2ebba26e16f622081 F20101118_AABGJD kevany_b_Page_69.tif deb041f9e9229b41a29ffad1dcd0a2db 76bd00e8809b047134e6653d2f520bea487a70b8 F20101118_AABGIO kevany_b_Page_51.tif 87c3964e2799ed0bd3dc93eaa67cb4ad 2632b810592cb3ab4fe6c324db0f06671b7fc25a F20101118_AABGJE kevany_b_Page_70.tif 0448705d579be5997e0a6ae8ef4dc80d 3eb67c530b045de93cca05222a7dff1c40332839 F20101118_AABGIP kevany_b_Page_53.tif 5d5afb1bc7f1acb27e5d5d8251681cb3 c1652cf24b22d230e1cfafe6b7ad767075d77f36 F20101118_AABGJF kevany_b_Page_72.tif 2f3de490ae8698023ccd2efd33869db9 255fad09493ac5354fd3006aa5f72e8ee16bcf77 F20101118_AABGIQ kevany_b_Page_54.tif b40f1c7c8c906af63f15a66b1386a5e0 732aacb82e17f05cc2a5d16629e0b34e306a3480 F20101118_AABGJG kevany_b_Page_73.tif 427dac67e457d8593e5fe14231dfcd72 04e0819f66f4c8e19624cca21dc18034f843c198 F20101118_AABGIR kevany_b_Page_55.tif ef8b27b33d2f4993af6e7ab99fd03c9a c84e410965d8d439063df9f98d173d0c53681e1d F20101118_AABGJH kevany_b_Page_74.tif 7dafad6aaeff00fe90d4ff66997695af 6b6735f32be336863e469afc75138ed371a69a92 F20101118_AABGIS kevany_b_Page_56.tif e3bf6668c963d94b977a793c5ddd9355 b912674f3a05ee10f97dc377b9c1fd3fe211c199 F20101118_AABGJI kevany_b_Page_75.tif b21b81bfb66893c7a369aec0b526471b 4896b7c5997535bbb1a8f9cf0c63f5d9e70c70db F20101118_AABGIT kevany_b_Page_57.tif d0229ea318a8b1e4cdf40307f5bd219b 30b89b8c3aef7c552dc342ade3f1132e3be9264e F20101118_AABGJJ kevany_b_Page_76.tif c7fdab486cd45433e05138271cb590f5 59d253d690500e4f52d84ded6ebb5f0e83d4ded7 F20101118_AABGIU kevany_b_Page_58.tif 81e1c38a4d5790eb4a4eaca68d8f66d8 ac1453a6b5ee2da73eaedb29f1cbfe227a8b5793 F20101118_AABGJK kevany_b_Page_77.tif b95be25bddb3eaabdbc222aa90cfacf9 a3e0cdb0f3998584127bf90cf9bf8f960562e251 F20101118_AABGIV kevany_b_Page_59.tif 192bef66ad2913a1ccd909e7b1e47073 b3f50686fa5677a1b8340caac3bd583ee1f60d7f F20101118_AABGJL kevany_b_Page_78.tif 964ab3dfaa2048106c7223e63d28cc86 b47b94514f8e44be6015f33ae9c22dbd564b53a7 F20101118_AABGIW kevany_b_Page_60.tif 03351b588f2cc0042d722bc6171ff296 523e740d5d7f02cf9cc451de93d2f56990ec2ef2 F20101118_AABGJM kevany_b_Page_79.tif f2b1d5a5fb5264bb3297b76b2cd9a7bd 53e57e674dce605991746233bf6dd5e324550797 F20101118_AABGIX kevany_b_Page_62.tif 1673d7e1d262e5cd610aeca6d51b835c 1decbe959e528f79e155998a379804e14e1a0caa F20101118_AABGKA kevany_b_Page_97.tif b17576a5797ba6d2cc6df9369e785c23 c6a5b192266d625564a757fa5ef0e231e0455d49 F20101118_AABGJN kevany_b_Page_80.tif b9c1dbc540ca1612d87b15bfdefaf04c daacb0de05947447a5de0e37c5097fc0dbf9ac42 F20101118_AABGIY kevany_b_Page_63.tif b31f138deceaafcc876f5bbfde185275 6dc8505ff9fd46efc2e5c6e5aabb198ed8a2e7a0 F20101118_AABGKB kevany_b_Page_98.tif 7da81a1c6e19f05a14c755840471b336 ceb988597e16320061fd6af5a3a1b09e29f7056c F20101118_AABGJO kevany_b_Page_82.tif 147dc55f8a414d265552c959a74353bf bdcad1c86552b545a02f1daf5e5b476d36ef5a1a F20101118_AABGIZ kevany_b_Page_64.tif 1738c13a5fb1ee6e8b86a4214834a938 44ae1ca0844a0149867c234d53a703b3f7d3e4bc 8657 F20101118_AABGKC kevany_b_Page_01.pro fd7ccf3929949895e27e6dc1f6dc1edd 21e91e023cc1e8b3aa0d7ad17fe0077717e1c88e 985 F20101118_AABGKD kevany_b_Page_02.pro 42034c0d5ab883f4cc319cadb2174252 2e9790f3a9c2e44dc2ffbfb974e3537ef0a2ce3a F20101118_AABGJP kevany_b_Page_83.tif d81fbd780a5c6477efaf26734236bb80 a91b4872b07cdd54eceb01d9cd19dae45c37e033 3002 F20101118_AABGKE kevany_b_Page_03.pro 3e49ac1ef7f4eed6540922f553c2b506 47e7bee5c791abcfcb9d3d17810542c822cc6dfb F20101118_AABGJQ kevany_b_Page_84.tif d00c9623e10d126d0e70185eeac8a66f 816febf56c05f827de3fef181c434a02af7a1cc6 53359 F20101118_AABGKF kevany_b_Page_04.pro e153529f686b784e8d717ea31b8bdf95 02230e68c971f2769ecf88d8822fd521f1395ff1 F20101118_AABGJR kevany_b_Page_85.tif b734dedb5fee04aef8909e69d40978f0 e1d8d85ae36d9ea982a26cb090fda16f9b2633a1 5056 F20101118_AABGKG kevany_b_Page_05.pro 0912b187f9b68129a3eec99716d83b1d 3945315a4a6e539b320eda9519871fbb65dae74c F20101118_AABGJS kevany_b_Page_86.tif 3a37080a915785f63cbed56c9bca845d 7e75af2aac5492bef316eaa6aa02ffdeb457b328 35078 F20101118_AABGKH kevany_b_Page_07.pro 354bf39e7654e1fcd9979189f2391449 4101839383386d4d64df776982ced2d6af19c853 F20101118_AABGJT kevany_b_Page_88.tif 632a6364ff811ff7a3913f225cba83d2 e7797be5b2f33c61b02c68fa7e9ed9f02773ec95 19130 F20101118_AABGKI kevany_b_Page_08.pro 9b8169804bd205d7e76a758cc3264e8c 41677653518bfd7febf466f1fcfffa66f741fda8 F20101118_AABGJU kevany_b_Page_89.tif 8e9522f9affba1b60e72763f3dfdf381 4f7b9ec0dcc82c91d8063964eb363c42ccedcb01 2830 F20101118_AABGKJ kevany_b_Page_10.pro a2667ab8527b9d8fa1c5bb76b414465b 5deb38418cb3eeebbc51ac955f26d476cab69703 F20101118_AABGJV kevany_b_Page_90.tif 84c7a46fd966ae086194421c2dc6664f 0a8b5467f211046906cfe834f236057ded719329 49727 F20101118_AABGKK kevany_b_Page_11.pro 9513ab0cd965ffe112c18e466aebf390 c95e782b62b755e9f1d90d3dbe39c1ab17d892ca F20101118_AABGJW kevany_b_Page_91.tif a8519727724d0f7de8e9a4e1f857b0ef 3c57200dd1dee903fe2c25350025ffc62e5972b7 16701 F20101118_AABGKL kevany_b_Page_12.pro 71026acc4eb9bf329057598284fc66fb 7893f927d2af6e1ee034be51f5ae0bea13e30680 F20101118_AABGJX kevany_b_Page_93.tif 8ab2129738b882d74435b360c7cc144f a07ee5676a4251161eb64a85f89833cc201eeee7 50820 F20101118_AABGLA kevany_b_Page_28.pro e1076fd879e24e9585ace0fbcaac3791 78d8cc3224d6d1c9912f11acbb3e0fc8a6ff5bf5 52517 F20101118_AABGKM kevany_b_Page_13.pro 94f32a1fed6d7cb13aa5b8c9ef88f590 8131840349f4ea8ff1a3b176a1e3a5a73168b84d F20101118_AABGJY kevany_b_Page_95.tif a3c76af960eaeb093df86c60db601fdd 056f65a51efdb3264df6a40943676a15a3353422 43101 F20101118_AABGLB kevany_b_Page_29.pro 69da2e5a5c7ec32ba2923bde66342fc7 92bd1f8fd51875b70f1ec995b6ed7967ca415579 53499 F20101118_AABGKN kevany_b_Page_14.pro 77d15352e6503eb58d39b971d6a8d912 78687d636c82574e66bd535d38584fcfe5761629 F20101118_AABGJZ kevany_b_Page_96.tif 59afacb69011072299dddc784c36833b 21c521969339fbb482c083f7f1407f6ed17e39ee 13254 F20101118_AABGLC kevany_b_Page_30.pro 68b6fffbed35d6be14017be54b31ef4a d0dcb19151fbef7147b50289841f7c8ea88b8037 53854 F20101118_AABGKO kevany_b_Page_15.pro ab42d27d462b9f5a24a182d0da730759 279e488fdfe9d4722861469cba6068052c18cffd 54169 F20101118_AABGLD kevany_b_Page_31.pro d56e4c06ab4579e091dc08903cf0c58c 0ca8e0aeb92e225f8b26460f5400b43932b914da 56970 F20101118_AABGKP kevany_b_Page_16.pro 5b90aa8fdc24a78e8db631f74acc6f71 51411e8fa72eb859060fcf6d1c37911277239915 57028 F20101118_AABGLE kevany_b_Page_32.pro 5093cbb82cae55e485a6eecb272689dc e4e34cf8d686740d73b8b7395a85d8895769d3da 55444 F20101118_AABGLF kevany_b_Page_34.pro 41ffebcd79bbe7f99b4ac4c3f5e1a8c2 e51f880e2cec69b43874dbf719da8ba2a49823f7 56093 F20101118_AABGKQ kevany_b_Page_17.pro 256b722c2d74c8283523750d42a0cfa4 6f7655cdcf5a73975c1a1efc2b776581690fcca9 58336 F20101118_AABGLG kevany_b_Page_35.pro dec7a7200de3714a46839941e6d5de97 c8a52c729d2311c7eb7cbd5f02a1bb342ad4ed55 54012 F20101118_AABGKR kevany_b_Page_19.pro a4cd543c42921e01f26b42ba7156b7db de2b10bc5e9717d2cf52a88d31f6961bac77bfdf 55101 F20101118_AABGLH kevany_b_Page_36.pro a060fb017f2c4b0f17dc25339e6cec83 78b96fc9c47461ce7ce3330f12acbe7ae6aeb939 55506 F20101118_AABGKS kevany_b_Page_20.pro 33a9ef6c126a517f86295346af337ef0 8e0d3b4a7ab0ab438b7ceee6be8ef33fb867b4d4 55432 F20101118_AABGLI kevany_b_Page_37.pro 23b8633925ba6607577f5991f15f7d53 210c9886e4aa8436a5b31095ca26c4717ae19194 56961 F20101118_AABGKT kevany_b_Page_21.pro adf53f0adca6e647259e516fc281e878 470a2c2be4a347891878fe0a2a5ce01187584a04 57479 F20101118_AABGLJ kevany_b_Page_38.pro 15c8e59213f21548a947e02273b99342 66b9a1f8caa0c44415fb3478c78f0edbec7299dd 55473 F20101118_AABGKU kevany_b_Page_22.pro a9f22247951292810a920b3b3850b616 ccd36748898a3592e9720ab9b9cb8bb66485a0bb 40716 F20101118_AABGLK kevany_b_Page_40.pro 3084e0e1ffe9af2ce8b3bceeccb22360 3b2e6d3349beec31c2ca076ab7edadaca75ee2fd 56833 F20101118_AABGKV kevany_b_Page_23.pro 6ec2d81f7cfb3af67e924ddd76741e57 ea5f9530fac829706e781afcd752f6f982ddefcf 12984 F20101118_AABGLL kevany_b_Page_41.pro abae76b0fb3dee17e97e1de6aad26cf6 0b463dbeaa8accdf39223b562e493a1b2dd18c23 53240 F20101118_AABGKW kevany_b_Page_24.pro d19b7b719fb131406a400df5d6164906 32e7bd651bb5c79b2ed1bdcddf9ce7b15e3d5aef 54091 F20101118_AABGMA kevany_b_Page_62.pro f99980ea9201a21606cfbcb26f082a5a 83e8ed5cffaf40646830554f56c6a57a7b7fc3b1 8215 F20101118_AABGLM kevany_b_Page_42.pro 1e831a31f7ca79ec9d09be4c31f62158 393c8f23d3aba4f120af4bcd88cd67fe370b734e 57603 F20101118_AABGKX kevany_b_Page_25.pro 4a2217b3b176f69068119d0a3ff7ee79 b3f6bc88e0d4375567c0c3d0f69de6b536487898 57279 F20101118_AABGMB kevany_b_Page_63.pro 595162d6a29cc6283518dc82d6768890 d4cc6bce17fb2349b8947db3610fb3354d17669b 28808 F20101118_AABGLN kevany_b_Page_44.pro 86e2ff2927f21f332951e901455b0dbb 10cd499ea54b1a83b08821ae573d8529f36e124d 56463 F20101118_AABGKY kevany_b_Page_26.pro 1c327f804dbbb7b790c77bb7d2330d45 c9f7064a3e3bb7b4575ed806f65dbf32100a9e12 55999 F20101118_AABGMC kevany_b_Page_64.pro cf89f03a8507aa3bdb633c56061ea2e8 4754073b51e8bca582d67dde3f7e51c0d92d9613 17588 F20101118_AABGLO kevany_b_Page_45.pro a9da78fce2c4b7be9c1ef57a605b23a2 1ee461dc2dde5c2420b2e6c787e032e36b57edfd 54017 F20101118_AABGKZ kevany_b_Page_27.pro 7220798384dc2dcad265c5bd578badbc b6d6732dd1d7e461ea9fa31967c96c715f75f23d 57587 F20101118_AABGMD kevany_b_Page_65.pro 9110621396327171ee93dd492f8bae05 1f73dcfc00496053c245b7e14ffd3d40c6a06ab9 16160 F20101118_AABGLP kevany_b_Page_47.pro 19f2649352b76b6b17055f3371f0ec5f 36cf2bfea22786d42ee424cf8f9528dc36db0ff2 53928 F20101118_AABGME kevany_b_Page_66.pro 0277919758693a3bf620eebb7672bbaf dde51c4ae7659c5ab533884c8d6b65ba1c2d4c41 10388 F20101118_AABGLQ kevany_b_Page_48.pro aed1cc4b1a1e6aa281868e40e3963e22 df6357fb12b7a24f867ca27bce97f72814cb3116 57867 F20101118_AABGMF kevany_b_Page_67.pro 6266df9705ad28acbbaf544f19bfbd0a f1e09684be27b8a6ec9138bad3a5f7144132fc79 15987 F20101118_AABGMG kevany_b_Page_68.pro 652aa64e2ba4b2c20977e5db74ee7524 99378b59da1973ed652276c27647474c47a6acbe 16365 F20101118_AABGLR kevany_b_Page_49.pro ee189063d460900b4829bac5767e37b3 c7e6ab77276146345133bd89ffde5a1937bb51bd 10607 F20101118_AABGMH kevany_b_Page_69.pro e1f1199acd347b0a8e63c7cf944157b2 b47f1c786e8363689570885b59a4907b74ffa560 53780 F20101118_AABGLS kevany_b_Page_50.pro fdbdb0621571eedb9968184153291ba3 8b76e55a55b0ed91e9ec7f447ebf260e7239fced 7186 F20101118_AABGMI kevany_b_Page_70.pro 1238d84b2b2a70aed16553d877296396 f2157d5757500351c5656f484a0939efa52d16c7 53911 F20101118_AABGLT kevany_b_Page_51.pro b7ef5d08ced161bf4aa1e1caa297fc7a 2572a6efc18d3ad63dc6d75595ce9bc523ca6942 12981 F20101118_AABGMJ kevany_b_Page_71.pro 87c2b83ef2952123486966ceff1a69c4 63ca938886b77ba429815a30af50c27a43e8f4aa 32589 F20101118_AABGLU kevany_b_Page_55.pro 92b992ca890f8c740ab65473080019e1 68da2474875e4976686e97ccbfe8f00ef9c3e954 11047 F20101118_AABGMK kevany_b_Page_72.pro bd56459325c5803e97ff9d36762b9a8d 85bf236b48dada9f30cfa079e7c5e6d7192db57b 10627 F20101118_AABGLV kevany_b_Page_56.pro e8e848ec330265525f4dead41d0b72fc e5fadcb0c61fdde52a0c2d0f285ff8265fad9974 27049 F20101118_AABGML kevany_b_Page_73.pro 776c28342b64c77acec1e78ccbd4207b 1487e0681ac8ebe34131a35de9b87dbcfcc4cc92 13891 F20101118_AABGLW kevany_b_Page_57.pro 224f7650614ab99c3979dfdfc6461fba ed0a8643a8170369ca46126d7e615cb4c985111a 9467 F20101118_AABGMM kevany_b_Page_74.pro cddb128fbfc503bacd161413f49e203e 7952d7f5f601c5645ebbda19c96843e77a4f96ed 15959 F20101118_AABGLX kevany_b_Page_58.pro d0eb6d10e1e271367e313b8941a7256f 6e8a2a637e29558bf6509fc4bf0312005365d7ab 66089 F20101118_AABGNA kevany_b_Page_89.pro 1b7ac9838f41df6eefbc3b55c961780e 431e92d9a8f5885f31dfd9e369a6553454632a2f 11949 F20101118_AABGMN kevany_b_Page_75.pro 7baf6a0d63411bba118ae17edec38f51 26047a374a49a8e1e7099ec4ba6a87044f30a8b7 32211 F20101118_AABGLY kevany_b_Page_60.pro 11b7c5d1ceda97457d32ea2c68241803 e34a9dd1e11060c25a9089ca03c0e0b23a5e3d2b 67509 F20101118_AABGNB kevany_b_Page_90.pro a75e98d272bb73c4e5f70482eb7676ba 804f5078c64743fb382c07da3a759874dbe56b4d 11876 F20101118_AABGMO kevany_b_Page_76.pro 740c16f04616a789214ef04b28939ed9 ce60be6343eef3a642a2fa70194537beedf5095d 54180 F20101118_AABGLZ kevany_b_Page_61.pro ba2b7dff891af510cc727f52f17cee12 9e43bf49916ea0a4fd2f87e7cfad3f1d3edb2f43 62522 F20101118_AABGNC kevany_b_Page_91.pro 97ff5ec2321cb1624f78b1c5d3bb2372 80ee009245040d15f9512e32f3c2d76b876ee144 23761 F20101118_AABGMP kevany_b_Page_77.pro 02942aaeb3ec67b4c1500ddeab463135 6a1e43c6b4b33028580aec4be98607f50cb69144 63468 F20101118_AABGND kevany_b_Page_92.pro 6e4bc91c9ecd4299bde7ba3a292db217 8fd508eee1b34a8d87cd3e2dd0253c46067f48c8 8637 F20101118_AABGMQ kevany_b_Page_78.pro ca0bbdaf6a40ebb59ad03cce28fd96e7 d21ddd305f32580c5e9d0bb7c494299f50ff2af9 63479 F20101118_AABGNE kevany_b_Page_93.pro 9d38d257303dbf8001f62c1c4facf093 cc6bddc24d45c6a64ac39519b76db284e6fe80ea 9360 F20101118_AABGMR kevany_b_Page_79.pro 7ca4085d970178eb781045d276d91a9a 53872cde18565a198a2d079c931cad6f3b3ea890 66678 F20101118_AABGNF kevany_b_Page_94.pro 0a5680cf55871d1f4a65f4798d5f643e f0c330991c90e3feb81018152d66c28c1097f27d 66293 F20101118_AABGNG kevany_b_Page_95.pro 410c622d4d163b2adeb5e1d0c45e900d 8687c54696d94d25e4182145ce035a45fb4fd592 54426 F20101118_AABGMS kevany_b_Page_80.pro 6f5674df4d913cb2878c96c598888a7a e2e6679f9b7394b366bc8eeac0b25e21606ea2e8 68725 F20101118_AABGNH kevany_b_Page_96.pro b76d4ae7872d11ae7d167f50c6bc42dd c22aba0124f062b3a1b64dacd6b3be85a72cab48 3860 F20101118_AABGNI kevany_b_Page_97.pro 9710c9879ae5ffc374245b591a55db0a c56f67174cd3a959b560c1a53a8c1bc824ed28a4 58464 F20101118_AABGMT kevany_b_Page_81.pro a953d76b2e4d61ce46e559a50da60747 e1762b7dc4c29adc0981a09b8a18d0cdeffa9648 37288 F20101118_AABGNJ kevany_b_Page_98.pro 220189439f040352aa023aefddcd364b 49aa934c9a50a1176288792ab2812ba445122cd1 49706 F20101118_AABGMU kevany_b_Page_82.pro 07eed04c03e492750509998d20e06d16 86e3af669a49b0511641ed0f4e4cafbd25320310 491 F20101118_AABGNK kevany_b_Page_01.txt e3446f61e07e7150515bdf84c7e10fde 4ca4d0cd21b394688338936fd3e16d5938a4eebf 48891 F20101118_AABGMV kevany_b_Page_83.pro 2330a6066cb46d61ec9f0ff931fed31a 13e87ce9c58b5bfaf4bf13dc11175e6581985ca1 92 F20101118_AABGNL kevany_b_Page_02.txt 4dc6b7eb6a4a8db200df6c23975e289e 4afcf48a844837fa4f72178a37d51a4485e518cf 52850 F20101118_AABGMW kevany_b_Page_84.pro bd0143a2a9af2427c6f38d786713081e 2c20d4d33480a4729672bf7dd2238d2c611ebdd8 F20101118_AABGOA kevany_b_Page_17.txt 856a69bf5e97557de10dabe4083f1460 cddf4008bae8d0de0dce4189111fa65a09f7e4ec 210 F20101118_AABGNM kevany_b_Page_03.txt 5f3c26bd6c46c26fcd6b2eecca240c8c 4f91ae1330df90153a529548528e54efb2b27af1 53664 F20101118_AABGMX kevany_b_Page_86.pro 3988480689d83caced94f1a03e90ee50 7e69b1765ffc968b46229fbc3c85ec6d5ac16bb1 2036 F20101118_AABGOB kevany_b_Page_18.txt 377a428b983adffba8ba2a1fc4f5aa72 efaa22e015b941a0c488e11e9c5fbe7bff7005e5 2136 F20101118_AABGNN kevany_b_Page_04.txt ee2fbc0aeff813bccefe879f1c510a8b 5b786ef58d95f28c168faafe061085c5249faa97 35088 F20101118_AABGMY kevany_b_Page_87.pro 12c3cc796a8e1ba957782a0d2958f969 f06a3a26ba50564362cd8497ce4fe29acd4aad78 2129 F20101118_AABGOC kevany_b_Page_19.txt ca727c70517dcee530932b11eed298c1 63d4fe2c50e759cf1ca5930d8d0843580b49c3bd 203 F20101118_AABGNO kevany_b_Page_05.txt 7db57aabb31b10e91c3caa690baf3cc8 298fa33e7c3e40d2427fb46f09ef59ba3391b956 31801 F20101118_AABGMZ kevany_b_Page_88.pro 7f91377e9e77cb01cc5b49e1830fd48a a0a01cbd83c8c86e7b5bddb60d5151ae461e2916 2179 F20101118_AABGOD kevany_b_Page_20.txt 0f50f1b53bb43bb3328a9acbd099986f ca075e6cd166d843c580c8d8becd46e48423dc63 2969 F20101118_AABGNP kevany_b_Page_06.txt c283acc4bf5c5a2f589423bac1d79b9d 1ff26f06e4566a533b0e897ec9359bd5912ba61b 2229 F20101118_AABGOE kevany_b_Page_21.txt c9a05a1a35058783243c7c68049ebf56 34e611a270a61435b11760aa119e92961987d754 1475 F20101118_AABGNQ kevany_b_Page_07.txt 845988533391f6b5f5d868c034b999f6 222d4b3a4234e932cffc6b0c66aebf076930cd76 2174 F20101118_AABGOF kevany_b_Page_22.txt d064eeb5ed291d912d37c2e36b76cab7 f9f71a2eb0dfa4da9f028a5b027e9e8aee229467 763 F20101118_AABGNR kevany_b_Page_08.txt b5c1c9674ac38aa64ae5b85397a0c67a 1168ce526c5eaf278175876631617736f9ccb5fc 2225 F20101118_AABGOG kevany_b_Page_23.txt 682d4364422c9df34f9c067eb97bbfef 5d1d4e8ff3f94fc6df624c6874c9fec1b15ad69e 2538 F20101118_AABGNS kevany_b_Page_09.txt 091298b742ed0957485870484cd5dd1e 3e4a143e133140a227df56fbd059096b08fc424b 2116 F20101118_AABGOH kevany_b_Page_24.txt 5a30ef761f7db37155c76c26d97074d3 f6b2d6a372d71da3bda28bb8211156f07cad2666 2253 F20101118_AABGOI kevany_b_Page_25.txt c6d0a1cab31aed6894ec998f7517bfab d71622e77d686da9eafe312b208701ddfe607ef1 117 F20101118_AABGNT kevany_b_Page_10.txt 4ea495cd7130fca1c342e026485ecb48 b47e224d6c96b30cb9e40cd6c526cb8356f1fc22 2210 F20101118_AABGOJ kevany_b_Page_26.txt 51c6ebc0f4abdb24728320ed116f72e4 b215f8edfee183722dbe1b3c4259d1537cf0a321 2152 F20101118_AABGNU kevany_b_Page_11.txt 6beb5baae978e06ded07bad2cee917df bf3f8ff4c856fe19cc4049e003f9e7dd8787a9b5 2126 F20101118_AABGOK kevany_b_Page_27.txt 71b9ba0f89c3313b225d898c664ca706 1512695e8b293371854df41742deed7214181e97 663 F20101118_AABGNV kevany_b_Page_12.txt 9582848c21c87882e34c497ae4d94318 f1071874c8aafd72e531edc2f9f20201e12cfc4a 2006 F20101118_AABGOL kevany_b_Page_28.txt a42521dff1cbaa21e4c1f332d98c0ec8 a7586899a5dd867226f691b4b5d3daa44922b35a 2166 F20101118_AABGNW kevany_b_Page_13.txt 37beab193b30574406b729698473d6ed 757ff4f03ecfd983e2833227b4d84a582b016a89 1720 F20101118_AABGOM kevany_b_Page_29.txt bd4fe2cf0a450c10d5a2175d577384d2 bf03fb41e5e7d1006cb11925715020cb4f79c101 2109 F20101118_AABGNX kevany_b_Page_14.txt 433fe8bd88bf0a1edcd691b203832193 b15e1a88d3e2be1aea0f2b658f6144d01d816fbb 1093 F20101118_AABGPA kevany_b_Page_46.txt 7a0b82a64689b9dae9d1f315ca118b6f 0bcc05185a4f796ff321eb3a2c40a0c5d7b75007 F20101118_AABGON kevany_b_Page_31.txt ac59d2194396945babd8717390ce2bef 002a9d223f90589b683b6128d8a247862c10e4ae 2122 F20101118_AABGNY kevany_b_Page_15.txt c5c625c116402b4a8762b73ae27501be 819ae58f9074fa61377766471c67cb835cc906fe 741 F20101118_AABGPB kevany_b_Page_47.txt 72beac99848acfd5666ce635167a2871 b074fbe49a662d59598ee2c8ca4df334d118f3f0 2231 F20101118_AABGOO kevany_b_Page_32.txt 64730c4586e0d4918611ad1fe09e1418 66abced3fab4e77f19072ae09c4f71f058d889c4 F20101118_AABGNZ kevany_b_Page_16.txt 25283de17ccd0cb7c51400ab4642d5b7 e308027439d632273cfc9a4ca5dbffbd54ee501c 517 F20101118_AABGPC kevany_b_Page_48.txt b45bc119faf65121fb52a8a85535de73 5a9c25b58c0c6723aefebdd59639da6115c61766 ROLE OF MEMBERS OF THE TOMATO ETHYLENE RECEPTOR FAMILY IN DETERMINING THE TIMING OF RIPENING By BRIAN MICHAEL KEVANY A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2007 O 2007 Brian Michael Kevany To my parents, who have supported every decision I have ever made and given everything to their children ACKNOWLEDGMENTS Thanks to my entire committee for their patience and constructive criticism throughout this process. I would like to especially thank my advisor, Dr. Harry Klee, for guiding me through my Ph.D. and not only teaching me how to be a scientist but how to present myself and my science. I thank the entire Klee lab for all their help throughout the years. Thanks to my bench-mate Michelle Zeigler whose attention to detail has helped me to become a better scientist. I thank Denise Tieman for sharing her knowledge in the lab and Mark Taylor for generating all the transgenic plants used in my experiments. Thanks to Peter Bliss for taking care of my plants in the greenhouse and doing just about everything around the Klee lab. I thank Valeriano Dal Cin for all of this help on the mapping proj ect. Thanks to everyone in the lab of Dr. Andrew Hanson for all their help and great friendship. I would especially like to thank Dr. Gilles Basset and Dr. Sebastian Klaus for teaching me everything they know about protein expression. Additionally I thank Dr. Gale Bozzo, Dr. Rocio Diaz de la Garza, Dr. Giuseppe Orsomando, Dr. Aymeric Goyer, and Tariq Ahktar for being there when I needed a break and to have some fun. Thanks to the lab of Dr. David Clark for allowing me to come over and do my RNA extractions in their hood and also to bother them when I needed a break. I thank Carol Dabney-Smith for teaching me all she knows about custom antibodies, without this help I would not have been able to finish all my work. Most importantly, thank you to my family for always being there for me when I needed them. Also for understanding that moving from Ohio to Florida was what was best for my career even though it was so far. I also thank all of my friends back in Ohio and Michigan for staying in touch and giving me plenty of fun times outside of Gainesville. Lastly, thanks to Stephanie Violi from the bottom of my heart for being the person I have leaned on for the past three years. She has made me laugh when I needed it and always put things in perspective. Even though we haven't been together she has remained the driving force in my life and is the love of my life. TABLE OF CONTENTS page ACKNOWLEDGMENT S ................. ...............4.......... ...... LIST OF TABLES ................ ...............8............ .... LI ST OF FIGURE S .............. ...............9..... AB S TRAC T ........._. ............ ..............._ 1 1... CHAPTER 1 LITERATURE REVIEW .............. ...............13.... Ethylene in Plant Biology .........._..._ ......... .. .... ......_. ...........1 The Ethylene Receptor Family Arabidopsis and Tomato............... ...............17. Protein Degradation Through the 26S Proteasome .............. ...............24.... 2 ETHYLENE RECEPTOR DEGRADATION CONTROLS THE TIMING OF RIPENING INT TOMATO .............. ...............3 1.... Introduction............... .............3 R e sults.................... ... ........ ... ...... ..... ..... ........ .........3 A Subset of the Receptor Family Shows Ripening-associated Expression and Is Ethylene-inducible in Fruit ................ .. ......... .. ........ .... ..................3 LeETR6 Antisense Lines Show Phenotypes Consistent with a Constitutive Ethylene R response .............. .. .... ..... ..... ... .... ......................3 Receptor Protein Levels Are Distinctly Different From Transcript Levels During Fruit Developm ent .............. .... ............... .. ... .......3 Treatment of Leaf and Fruit Tissue with Ethylene Causes a Rapid Degradation of Receptor Proteins That Likely Occurs Through a Proteasome-dependent Pathway ...35 Receptor Levels in Developing Fruit Determine the Timing of Ripening ................... ...3 7 Discussion............... ...............3 3 FRUIT-SPECIFIC SUPPRESSION OF THE ETHYLENE RECEPTOR LEETR4 RESULTS INT EARLY RIPENING FRUIT .............. ...............50.... Introduction............... ..............5 R e sults................... .. ......... .......... ..... .. .. ..... .............5 LeETR4 RNAi Transgenic Plants Produce Early Ripening Fruit ................. ................51 Early Ripening Lines Show Altered Ripening Coordination .................. ....... ........... ....52 Transgenic Fruits are Indistinguishable from Wild Type Fruits in Horticultural Traits .............. ...............53.... Discussion............... ...............5 4 IDENTIFICATION OF QTLS THAT MODIFY TIME TO RIPENING AND RIPENING-AS SSOCIATED ETHYLENE PRODUCTION. ........._.. ...... ._._._...........61 Introduction............... ..............6 Re sults........._..... ...._... ...............63..... Discussion............... ...............6 5 C ONCLU SION ........._..... ...._... ...............80... 6 MATERIALS AND METHODS............... ...............83 Plant Materials and Growth Conditions .............. ...............83.... Development of Transgenic Plants ........._.. ...._._..... ...............83... Pharmacological Treatments ............................... ................8 Recombinant Protein Expression and Antibody Production.........._.._.._ ......_.._.. .....84 RNA Expression Analysis................. ...........................8 Microsomal Membrane Isolation and Protein Blot Analysis .............. .....................8 Acid and Soluble Solids Analysis .............. ...............86.... Vol atil e Analy si s .............. ...............87.... LIST OF REFERENCES ................. ...............89................ BIOGRAPHICAL SKETCH .............. ...............98.... LIST OF TABLES Table page 2-1 Days from anthesis to breaker of LeETR6 antisense lines............... ...............49. 2-2 Days from anthesis to breaker of ethylene treated Microtom fruit............. .. ........._._ ...49 3-1 Weight, yield, brix, citric acid and malic acid from field grown fruits ................ ................59 3 -2 Weight, yield, brix, citric acid and malic acid from greenhouse grown fruits ................... .....59 3-3 Volatile organic compounds from field grown fruits ................. ....._._ .............. ...5 3-4 Volatile organic compounds from greenhouse grown fruits .............. .....................6 6-1 Oligonucleotide primers and probes............... ...............88. LIST OF FIGURES Figure page 1-1 Schematic representation of tomato ethylene receptor family ................ ................ ...._30 2-1 Ethylene receptor family mRNA levels during fruit development............... ..............4 2-2 Ethylene-inducibility of each receptor mRNA in immature fruit tissue. ............. ................42 2-3 Constitutive ethylene response phenotypes of LeETR6 anti sense lines ................ ...............43 2-4 Receptor gene expression and protein levels show distinct differences during fruit development ................. ...............44................. 2-5 Ethylene binding induces degradation of receptors in detached immature fruits .................. .45 2-6 Ethylene binding induces degradation of receptor proteins in vegetative tissue. .................. .46 2-7 Ethylene treatment induces turnover of receptor leading to early ripening fruit. .................. .47 2-8 Ethylene treatment induces expression of receptor mRNAs in attached fruit ................... .....48 3-1 Fruit-specific ETR4 RNAi transgenic lines produce early ripening fruit ............... .... ...........56 3 -2 Suppression of LeETR4 is Fruit-specific ................. ...............57........... .. 3-3 ETR4-RNAi transgenic plants have altered ripening coordination .............. ...................58 4-1 Ethylene emissions of fully ripe fruit from L. hirsutum IL 3945 ..........._..._ .........._._.......69 4-2 Days from anthesis to breaker of tagged fruits from L. hirsutum I~s ........._..... ........._.....70 4-3 Ethylene emissions of breaker fruit from L. hirsutum I~s .............. ...............71.... 4-4 Ethylene emissions of fully ripe fruit from L. hirsutum I~s. .........__........ _.. ........._...72 4-5 Genomic map showing locations of introgressed regions that contain putative ripening- associated QTLs................ ...............73. 4-6 Days from anthesis to breaker of tagged fruits from L. hirsutum I~s ........._..... ........._.....74 4-7 Ethylene emissions of fruits from field-grown L. hirsutum ILs ................ ............. .......75 4-8 Ethylene emissions of leaves from L. hirsutum ILs .............. ...............76.... 4-9 Nucleotide alignment of ETR4 genomic sequence ........__............_ ........_._.........77 4-10 mRNA expression of LeETR4 in WT and the L. hirsutum IL 3945 .................. ...............78 4-11 mRNA expression of LeETR4 in seedlings of WT, L. hirsutum and IL 3945......................79 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy ROLE OF MEMBERS OF THE TOMATO ETHYLENE RECEPTOR FAMILY IN DETERMINING THE TIMING OF RIPENING By Brian Michael Kevany December 2007 Chair: Harry John Klee Maj or: Plant Molecular and Cellular Biology Tomatoes are an economically important crop and a significant dietary source of important phytochemicals, such as carotenoids and flavonoids. While it has been known for many years that the plant hormone ethylene is essential for ripening of climacteric fruits, its role in fruit growth and maturation is much less understood. In an attempt to better understand tomato fruit ripening we utilized both biotechnology and traditional breeding strategies. The multigene ethylene receptor family has been shown to negatively regulate ethylene signal transduction and suppress ethylene responses. Here, we demonstrate that a reduction in the levels of either of two family members, LeETR4 or LeETR6, causes an early ripening phenotype. We provide evidence that the receptors are rapidly degraded in the presence of ethylene and that degradation likely occurs through the 26S proteasome-dependent pathway. Ethylene exposure of immature fruits causes a reduction in the amount of receptor protein and earlier ripening. Fruit-specific suppression of the ethylene receptor LeETR4 causes early ripening while fruit size, yield and flavor-related chemical composition are largely unchanged. These results demonstrate that ethylene receptors likely act as biological clocks regulating the onset of tomato fruit ripening. In order to better understand the mechanism controlling the timing of ripening we screened a Lycopersicon hirsutum introgression population for QTLs responsible for reduced time from anthesis to breaker and/or increased ripening-associated ethylene biosynthesis. The L. hirsutum population was chosen because of unusual ripening characteristics and significantly higher levels of ethylene biosynthesis at maturity of L. hirsutum. A number of lines were identified that showed statistically significant differences from the control for both phenotypes. These lines are currently being refined for possible map-based cloning of loci controlling these phenotypes. These results demonstrate the power of using both molecular biology and traditional breeding for gene isolation/characterization and crop improvement. CHAPTER 1 LITERATURE REVIEW Ethylene in Plant Biology The phytohormone ethylene is an important signaling molecule that is involved in many plant processes including but not limited to abscission, leaf and flower senescence, germination, sex determination and fruit ripening (Abeles et al., 1992). Ethylene also functions in both biotic and abiotic stress responses. Exposure to environmental stresses like flooding, wounding, herbivory, chilling or pathogen attack can enhance ethylene production (Boller, T. 1991; Abeles et al., 1992). This ethylene then slows growth until the stress is removed. Interest in ethylene' s importance as a plant hormone has resulted in thousands of peer-reviewed publications in the last 100 years and has laid the foundation for a real understanding of ethylene' s involvement in plant growth and development. Ethylene is a small, gaseous, two-carbon molecule that has the ability to diffuse through hydrophilic and hydrophobic environments. This property allows it to pass into any compartment in the plant cell. The ability of ethylene to alter plant development has been known for centuries, with farmers from many cultures using smoke and wounding to induce flowering and ripening (Abeles et al., 1992). Damage to city and greenhouse plants in the late 19th and early 20th centuries was found to be caused by leaking illuminating gas that was used at the time for lighting. Work done by Dimitry Neljuboy in 1901 proved that ethylene was in fact the active component in illuminating gas that resulted in the plant damage (Abeles et al., 1992). Subsequent work showed that ethylene was clearly important for fruit ripening but many scientists at the time believed that the other phenotypes of endogenously produced ethylene were a by-product of the ripening process (Abeles et al., 1992). Work done in the 1960s by the Burgs provided definitive proof that ethylene is important for plant development beyond its involvement in fruit ripening (Burg and Burg, 1962; Burg 1962). Their work was instrumental in classifying ethylene as a plant hormone. Early feeding experiments suggested that the amino acid methionine is a precursor of ethylene (Lieberman et al., 1966; Burg and Clagett, 1967). Later work provided evidence that oxygen is necessary for the production of ethylene. It was then hypothesized that if fruit tissue was held in an anaerobic environment the precursor should build up and provide enough compound to allow identification. This work led to the subsequent isolation of 1- aminocyclopropane-1 -carboxylic acid (ACC), the immediate precursor of endogenous ethylene (Adams and Yang, 1979). ACC is synthesized from S-adenosyl methionine (SAM) by a pyridoxal phosphate-requiring enzyme termed ACC synthase (ACS). The conversion of ACC to ethylene is subsequently performed by the oxygen-requiring enzyme ACC oxidase (ACO). The conversion of ACC by ACO results in the production of CO2 and HCN in addition to ethylene. Most tissues synthesize low levels of ethylene. Synthesis can be stimulated by a number of means, including wounding, submergence, chilling and pathogen attack. Synthesis of ACC is considered to be the rate limiting step in ethylene production. Thus, increased ethylene production requires modulation of ACS expression and/or activity. While ethylene is often characterized as the ripening hormone, not all fruit require ethylene to complete the ripening process. Species are often characterized by the presence or absence of a large increase in ethylene production concomitant with increased respiration at the onset of ripening. Species whose fruit exhibit these increases are termed climactericc" while those that do not are referred to as "non-climacteric." Climacteric species include apple, avocado, banana, peach and tomato while non-climacteric species include strawberry, grape, cherry and citrus. The increase in ethylene production associated with climacteric ripening is essential for ripening. Blockage of either ethylene biosynthesis or perception results in an inability of the fruit to complete its ripening program. Tomato is an excellent model for the study of ethylene' s involvement in fleshy fruit development because of a relatively short life cycle, ease of genetic manipulation and a wealth of genetic resources. In addition, the tomato genome is being sequenced, which will be a tremendous resource to those working on this species. Ethylene's involvement in ripening, fruit softening, volatile production and lycopene accumulation has been well documented. Ethylene biosynthesis during tomato fruit development generally goes through three distinct stages. There is a slight burst of synthesis after successful pollination that then falls to low levels until the onset of climacteric ethylene production at the onset of ripening. Ethylene production during immature fruit development has been termed system I and is characterized as low level production which cannot be stimulated by treatment with exogenous ethylene (Yang, 1987). Ethylene biosynthesis in mature fruit, referred to as system II, is autocatalytic, meaning it can induce its own synthesis (Yang, 1987). The induction of ethylene synthesis at the onset of ripening is believed to be due to developmental induction of an ethylene-inducible ACS (Barry et al., 2000; Nakatsuka et al., 1998). Although immature tomato fruit do not produce significant levels of ethylene they do respond to ethylene, but in a different manner to that of ripening fruit. This response manifests as a change in gene expression but to a smaller set of genes to that of ripening fruits (Alba et al., 2005). This difference in response suggests that there is developmental control of gene expression in addition to that of ethylene. The developmental control of ethylene regulated genes has been best characterized by research done on the E4 and E8 genes found in tomato. Expression ofE4 is ethylene inducible throughout fruit development while E8 is only ethylene inducible in ripening fruit (Lincoln et al. 1987, Wilkinson et al., 1995). Treatment of immature fruit with ethylene induces a set of genes, proving a response to the hormone, but it does not induce immediate ripening. However, that ethylene exposure does hasten the onset of ripening as compared to untreated fruit of similar age, suggesting that the fruit can measure cumulative ethylene exposure (Burg and Burg, 1962; Lyons and Pratt, 1964; McGlasson et al., 1975; Yang, 1987). Treatment of immature green tomato fruit with ethylene, or its analog propylene, could reduce the time from anthesis to breaker by half that seen in non-treated controls (Lyons and Pratt, 1964; McGlasson et al., 1975). The way fruits measure this ethylene exposure is unknown. Along with temporal control of fruit ripening there is also a spatial aspect of control. Fruit do not ripen evenly across the entire fruit, they begin to ripen at the basal end of the fruit and proceed towards the calyx. Since ethylene is diffusible throughout the fruit, and accumulates to high levels within the fruit, there appears to be a developmental control within individual fruit that controls the spatial ripening of the fruit. In addition to ethylene's role in fruit development it also plays an important part in seedling emergence (Clark et al., 1999). During germination seedlings must be able to force their way through any soil between them and a light source. When a seedling encounters a barrier in the soil it often becomes slightly wounded which can induce ethylene production. Dark grown seedlings, like those found underground, are often tall and spindly in the presence of air alone. Upon exposure to ethylene its growth habit changes and exhibits growth that is referred to as the "triple response." This response manifests as a shortening of both the hypocotyl and root, radial thickening of the hypocotyl and an exaggeration of the apical hook. These changes allow the seedling to push through any barriers without damaging the meristem. While this mechanism has evolutionary importance, the ability to exploit this response has revolutionized the ethylene biology field by allowing researchers to screen for mutants in ethylene biosynthesis and signaling. The Ethylene Receptor Family Arabidopsis and Tomato Much of the initial ethylene perception and signal transduction research was done in Arabidopsis thaliana and thus we have exploited the Arabidopsis system to identify the orthologous genes in tomato. The Arabidopsis ethylene receptor ETR1 was the first phytohormone receptor cloned in plants and was isolated from a mutagenized population that was screened for plants deficient in the triple response (Bleecker et al. 1988; Guzman and Ecker 1990). Ethylene insensitive mutants grow tall and spindly even in the presence of ethylene while constitutive ethylene response mutants will show a triple response in the absence of ethylene. etrl-1 was isolated as an ethylene insensitive mutant in one of these screens and was later cloned and shown to encode an ethylene receptor with homology to bacterial two-component sensors (Chang et al. 1993). In subsequent work a total of five receptors were cloned from Arabidopsis. The ethylene signal transduction pathway in Arabidopsis is believed to be relatively linear but we are unsure if all of the elements have been identified. Epistatic analysis has allowed researchers to putatively order the components starting with the receptors. The next component is the Raf-like Ser/Thr protein kinase, CTR1, which has been shown to physically interact with the receptors (Clark et al., 1998; Gao et al., 2003; Huang et al., 2003). CTR1 has significant homology to MAPKKKs and although no MAPKK or MAPK have been found to be involved in ethylene signal transduction, their involvement in this pathway cannot be ruled out. EIN2, a protein showing homology to Nramp metal transporters, is the next member of the pathway. The role and activity of this protein in the pathway is unknown but it is absolutely necessary since knockouts show complete ethylene insensitivity in every assay tested. The end of the ethylene signal transduction pathway is composed of the transcription factors EIN3 and ERF l. EIN3 loss- of-function (LOF) mutants show partial ethylene insensitivity, which is probably due to redundancy within a gene family containing at least three members (Chao et al., 1997). In the absence of ethylene the EIN3 protein is targeted for degradation in the 26S proteasome by a pair of F-box proteins, EIN3-binding factors 1/2 (EBF l/2). Upon ethylene binding this repression is released and EIN3 binds to the promoter of ERF 1 activating its transcription and ERF 1 is involved in regulating the transcription of ethylene responsive genes. ERF 1 over-expressors show a slight constitutive ethylene response suggesting that there are other important players in the transcriptional control of ethylene responsive genes (Berrocal-Lobo et al. 2002). ETR1 was not only the first phytohormone receptor to be cloned in plants but was also the first eukaryotic protein with homology to a histidine kinase (Chang et al. 1993). These receptors are endoplasmic reticulum-localized proteins that have copper-mediated ethylene binding and are present in vivo as dimers (Chen et al., 2002; Ma et al., 2006; Schaller and Bleecker 1995; Schaller et al. 1995). The Arabidopsis receptor proteins (ETR1, ETR2, ERS1, ERS2 and EIN4) can be separated into three structurally different regions. The sensor domain is composed of three putative transmembrane (TM) sequences in ETR1 and ERS1 and four domains in ETR2, ERS2 and EIN4, with the first TM sequence representing a cleavable ER-targeting peptide. These transmembrane sequences are where the copper- mediated ethylene binding takes place. This region also contains all of the known mutations that cause ethylene insensitivity, likely due to an inability to bind ethylene or transmit the signal through a conformational change. The amino acids necessary for dimerization are present in this region and homodimerization has been proven in vivo but heterodimerization has not been demonstrated (Schaller et al. 1995). The next domain present in this family is a region that shows homology to histidine kinases (Dutta et al., 1999). Histidine kinase domains contain five highly conserved sub- domains, N, G1, F, G2 and the histidine (H) that is autophosphorylated. The ETR1 and ERS 1 proteins contain all five of these sub-domains while the other three members lack at least one sub-domain. The ETR1 protein is the only member of the family that exhibits HK activity in vitro, but the conserved histidine is not necessary for protein function based on the ability for a mutant lacking this residue to rescue a receptor mutant (Gamble et al. 1998; Gamble et al. 2002, Wang et al. 2003). The other family members all exhibit Ser/Thr kinase activity based on in vitro kinase assays (Moussatche and Klee, 2005). This lack of histidine kinase activity in these family members fits well with the finding that most of the other family members do not contain all of the conserved regions in the histidine domain. All kinase assays completed so far have been done in vitro and there has been no kinase activity directly linked to ethylene signal transduction in vivo. The third and final domain found in these proteins is the receiver, located at the C-terminus of the protein. This region shows homology to the output domains from bacterial two-component sensors and contains an aspartate that is active in phosphorelay in these bacterial pathways. The ERS 1 and ERS2 proteins lack this domain while the other family members contain it, suggesting that it may play a role in some family member-specific functions. Using sequence and exon/intron organization comparisons, ETR1 and ERS 1 have been classified as Subfamily 1 receptors while ETR2, ERS2 and EIN4 have been classified Subfamily 2 receptors. Considering the degree of divergence within the family, there may be specific functions for each of the family members. The evidence suggests that the receptors may not be completely redundant, although most genetic evidence suggests functional overlap. Mutant analysis of the Arabidopsis ethylene receptor family has allowed a better understanding of the receptor' s role in transducing the ethylene signal. All of the initial receptor mutants cloned were semidominant, insensitive mutants. Single gene LOF mutants have no obvious phenotypes which is most likely due to functional redundancy within the family. Based on all of the genetic data available the receptors appear to function as negative regulators of the ethylene response (Hua and Meyerowitz 1998). The default state of the receptor is one in which the receptor actively suppresses ethylene responses in the absence of the hormone and ethylene binding removes this suppression. The double mutant etrl ers1 and triple or quadruple mutants show constitutive ethylene responses even in the absence of increased ethylene biosynthesis (Wang et al., 2003), presumably because basal ethylene levels are able to inactivate the remaining receptors. This model suggests that a decrease in receptor content will increase ethylene responsiveness while an increase in receptor levels will decrease tissue responsiveness. This simplified model does not appear to tell the entire story because it presumes that all of the receptors contribute equally to the signal and recent work has suggested this may not be true. Overexpression of a Subfamily 2 member was unable to rescue the constitutive ethylene response phenotype of the double Subfamily 1 mutant, suggesting some family member-specific functions (Wang et al., 2003). Work done in our lab has found that the system in tomato may be quite different from that of Arabidopsis. The tomato ethylene receptor family is composed of six members, LeETR1-6 with LeETR3 corresponding to the NR gene (Fig. 1, Zhou et al. 1996a; Zhou et al. 1996b; Lashbrook et al. 1998; Tieman and Klee 1999). All receptor family members have been shown to bind ethylene with the exception of LeETR6 because it was not available at the time of analysis (O'Malley et al., 2005). The first of the tomato ethylene receptor genes to be cloned was NR. This gene was isolated from a mutant that shows semidominant ethylene insensitivity which prevents floral wilting and abscission, alters leaf senescence and prevents fruit ripening (Wilkinson et al. 1995). The basic structures of the receptors are similar to those of the Arabidopsis family but within the tomato family the sequences are quite divergent with less than 50% identity at the extremes (Figure 1). The transmembrane domains show the highest levels of sequence similarity owing to the importance of this domain in the transmission of the signal. LeETR1, 2 and NR have three putative transmembrane domains while LeETR4, 5 and 6 have four putative transmembrane domains. The NR protein is the only member of this family that lacks the C-terminal receiver domain (Figure 1). LeETR4, 5 and 6 resemble the Subfamily 2 receptors found in Arabidopsis in that they are missing at least one of the conserved sub-domains in the HK domain and contain the fourth transmembrane sequence (Figure 1-1). Each of the receptors has a distinct expression pattern throughout fruit development, with NR, ETR4 and ETR6 being ethylene inducible (current work). NR and ETR4 are both pathogen inducible, with the increase in expression being a function of the increase in ethylene production found during a disease response (Ciardi et al., 2000). An increase in receptor expression is likely an important factor in reducing the amount of damage that occurs as a result of this increase in ethylene production. The basic model for ethylene response states that the receptors act as negative regulators of ethylene response and that higher receptor expression reduces sensitivity and lower expression increases sensitivity. This model explains why multiple gene knockouts in Arabidopsis show a constitutive response. While much of the available data fit this model it does not address the importance of ethylene dissociation from the receptor or protein turnover. The Kd of ethylene dissociation was measured in yeast-expressed AtETR1 and was found to be approximately 12 hours. This is likely to be an underestimate since it did not factor in protein turnover (Schaller and Bleeker, 1995). There is no evidence to suggest that ethylene is able to dissociate from the receptor, suggesting this association may be permanent. Isoform-specific antibodies have been generated for a number of the Arabidopsis receptors and the tomato NR protein but no work has been done to study in vivo turnover rates or ethylene's effect on receptor turnover. This type of evidence will be necessary to draw any conclusions about the receptor' s importance in a plant' s response to ethylene. The current model suggests that the only way that a plant can reduce its response to ethylene is by synthesis of new receptors. Less receptor leads to more sensitive tissue and more receptor leads to less sensitive tissue. Previous work has shown that the current data do fit the receptor model. Plants overexpressing NR have been found to be less sensitive to ethylene in triple response assays and pathogen studies (Ciardi et al. 2000). LeETR4 antisense lines with significantly reduced expression show phenotypes consistent with a constitutive ethylene response. Phenotypes of these lines include epinastic growth, premature flower senescence and abscission and for fruit, a reduction in the time from anthesis to breaker and from breaker to red ripe (Tieman et al 2000). The effect on time from anthesis to breaker is quite significant with a decrease of as much as 11 days compared to WT controls. LeETR4 antisense lines also have an altered response to pathogen infection because an increase in ETR4 expression is one way in which the plant reduces the amount of tissue damage. These lines display an accelerated hypersensitive response in response to infection with an incompatible pathogen with greater ethylene production and hastened expression of pathogenesis-related genes (Ciardi et al. 2000). Antisense suppression of LeETR1, 2 and NR have no observable phenotype but this result is likely due to redundancy within the system. The NR antisense lines show an unusual phenotype in that with the reduction of NR expression levels there is a concomitant increase in ETR4 expression and this may explain why the NR antisense lines do not show any constitutive ethylene response phenotypes. This phenomenon has been termed functional compensation and appears to be a built-in system that allows the increase in expression of one family member when another has been reduced (Tieman et al 2000). The expression level of each of the tomato receptors has been monitored in response to multiple ethylene-related phenomenons and at least one receptor is up-regulated in each of the responses. On the other hand, a reduction in receptor expression has never been seen even though it would increase the tissue's responsiveness to ethylene. So it seems that as soon as a plant starts producing ethylene more receptor is produced thus attenuating the response. While this may seem counterproductive it is not uncommon for a phytohormone in plants to be attenuated as soon as it' s induced (Rashotte et al., 2003). Increased response to ethylene can be very detrimental to plant tissues and since ethylene slows the growth of a plant, it could have long term effects. The expression levels of all the receptors remain low throughout immature fruit development and show a sharp increase at the onset of ripening, the time at which ethylene production is at its highest. So it seems that at the point when ethylene is having its greatest effect on plant development, receptor levels are at their very highest. It has been known for some time that ethylene is intimately involved in the timing of fruit ripening and our research seeks a better understanding of its role. Based on our previous research and that of others we believe that if ethylene production rates during fruit development exceed the level of receptor synthesis then there would be a de-repression of the system that would lead to an increase in sensitivity to the hormone. At some point in development, when the fruit are ripening competent, sensitivity to ethylene would rise past a threshold level where ripening could be initiated. Based on this model the reduction of receptor levels in transgenic plants should reduce time to ripening and based on our previous results this is true, ETR4 antisense plants ripen faster than controls (Tieman et al 2000). Protein Degradation Through the 26S Proteasome Protein degradation is an important regulatory mechanism that has been adopted by many organisms. It has emerged as a mechanism of control as important as gene expression in controlling cellular processes. Protein degradation has been implicated in the control of signaling cascades, defense against viral infection, breakdown of cellular regulators and arguably its most important role is the removal of abnormal proteins (Jabben et al. 1989, Glotzer et al. 1991, Scheffner et al. 1993). The degradation of proteins generally falls into two classes: (1) relocation of proteins to degradative organelles such as the lysosome or vacuole and (2) targeting the proteins for degradation by the 26S proteasome. These two pathways are the principal modes of degradation for both soluble and membrane bound proteins, albeit less is known about how membrane-bound proteins are degraded. While relocation to degradative organelles is an important type of protein degradation the focus of this review will be on the role of the 26S proteasome in protein degradation. The 26S proteasome is one of the most important proteolytic systems in plants and our understanding of this system has grown considerably in the past decade. This system utilizes the 76-amino acid protein ubiquitin (Ub) as a reusable tag to target specific proteins to the multi- subunit 26S proteasome for proteolysis. The attachment of Ub occurs at lysine residues on the target protein and often occurs as a polyubiquitin chain of Ub monomers. Upon proteolysis in the proteasome the Ub monomers are released to be used in another round of targeting. Ubiquitination of target proteins occurs in a three-step conjugation cascade and can occur on proteins in the cytoplasm, nucleus, integral membrane proteins and ER resident proteins that are retro-translocated across the ER membrane. The ubiquitin attachment cascade occurs in a three-step process designated El, E2 and E3. The El component of the cascade is an ubiquitin-activating enzyme that binds ubiquitin at a conserved cysteine. This enzyme is constitutively expressed and has little impact on target specificity. The Arabidopsis genome encodes two El isoforms (Hatfield et al., 1997). The E2, or ubiquitin-conjugating enzyme, is encoded by at least 37 family members in Arabidopsis (Vierstra, 1996). This enzyme shuttles the ubiquitin moiety between the El and E3 proteins (Pickart, 2001). The size of this family suggests that different E2s may be involved in regulating specific pathways, although no specific functions have been assigned to any plant E2s. The specificity of individual E2s likely occurs through their interaction with specific E3s. In addition, the E2s are not all specific to ubiquitin but are also used for conjugating ubiquitin-like proteins including NEDD, RUB and SUMO (Li et al., 2006). The E3, or ubiquitin-protein ligases, is the component of the cascade that specifically recognizes proteins for ubiquitination. Because of the specificity of this protein/complex it is encoded by several large families of genes, with more than 1300 members in Arabidopsis (Vierstra, 2003). Four different types of E3 ligases have been identified in plants: HECT, RING/U-box, SCF and APC (Smalle and Vierstra, 2004). HECT E3 ligases are composed of a large single polypeptide (often >100kDa), with seven family members present in the Arabidopsis genome (Downes et al., 2003). Little is known of the functions of plant HECTs, although one is known to be important for trichome development. Like the HECT family, each RING/U-box family member is a single polypeptide that acts to bring together the E2-Ub and target substrate. This group of proteins is each encoded by a large family of proteins with 480 RING finger-containing and 64 U-box containing proteins, respectively, in Arabidopsis (Azevedo et al., 2001; Kosarev et al., 2002). This type of E3 ligase has been implicated in a diverse number of cellular processes in plants, including, auxin signaling, photomorphogenesis, self incompatibility and removal of abnormal proteins (Smalle and Vierstra, 2004). The SCF type of E3 ligases are composed of a complex of four different polypeptides. This type of E3 ligase acts in a similar manner to that of RING/U-box proteins in that they bring together the E2- Ub and the target substrate. Plants have the ability to synthesize a vast number of SCF type E3 ligases. The Arabidopsis genome contains two RBX1 subunits, five cullin subunits, 21 SKP-like proteins and almost 700 F-box proteins (Farras et al., 2001; Gagne et al., 2002; Shen et al., 2002) .The F-box proteins provide the target specificity for this complex and constitute one the largest gene superfamilies in the Arabidopsis genome. The APC type of E3 ligases is the most complex type of E3, being composed of eleven subunits. Most of these subunits are encoded by single genes in Arabidopsis and thus it is likely that they only form a small number of APC type E3s (Capron et al., 2003). The APC was first identified as being important for the regulation of mitosis through degradation of mitotic cyclins in yeast; it has been subsequently shown to have a similar function in plant cells (Blilou et al., 2002). The 26S proteasome is an ATP-dependent proteolytic complex that is composed of 31 subunits organized in two maj or subcomplexes. The 20S core protease (CP) is the portion of the complex that houses the proteolytic activity, alone it is an ATP- and Ub-independent protease. The CP has hydrolyzing, trypsin-like and chymotrypsin-like activity allowing it to degrade a broad range of peptide bonds (Voges et al., 1999). The 19S regulatory particle (RP) can bind to both ends of the CP and is the portion of the complex that recognizes the Ubs attached to targeted proteins (Voges et al., 1999). The RP performs a number of additional functions including unfolding the target protein, Ub removal, opening the gate to the CP core and directing the target protein into the CP lumen (Smalle and Vierstra, 2004). Regulation of the activity and specificity of the proteasome is thought to be affected by a number of factors including association with additional proteins and substitutions or modifications to complex subunits. The Arabidopsis genome encodes two isoforms of nearly all proteasome subunits. Transcriptional control of the complex subunits in yeast is facilitated by a single transcription factor, Rpn4, that is negatively regulated at the protein level by the 26S proteasome itself. The role of the 26S proteasome in regulating many signal transduction pathways has been confirmed in plants. The proteasome has been implicated in the action of all plant hormones. In addition, it is important for a plant's response to both abiotic and biotic stimuli. Its role in auxin and ethylene signaling are arguably the best characterized roles in hormone signaling. The auxin signal transduction pathway is negatively regulated by a family of proteins (AUX/IAAs) that bind and inhibit the functions of a family of transcription factors, the auxin response factors (ARFs). Upon auxin binding the AUX/IAAs are targeted for degradation, thus releasing the transcription factors to initiate expression of auxin responsive genes. The use of mutants and proteasome inhibitors has confirmed this pathway and has facilitated the identification of the auxin receptor as the F-Box protein, TIR1. TIR1, and TIR1-like proteins, specifically target the AUX/IAAs for polyubiquitination and is an interesting example of the importance of the 26S proteasome in regulating hormone pathways (Dharmasiri et al., 2005). The ethylene signal transduction pathway is also regulated by the proteasome, which modulates transcription factor activity/abundance. The F-Box proteins EBF l/2 target the EIN3, and EIN3-like, transcription factors for degradation in the absence of ethylene. Upon ethylene binding, this repression is removed and the transcription factor is able to activate transcription of primary ethylene responsive genes. In the case of EBFl1/2, each has a different role in response to ethylene, with EBF 1 being more important during early ethylene response and EBF2 more important later during the response and in the resumption of growth after ethylene removal (Binder et al., 2007). The importance of the proteasome in response to abiotic stimuli is best characterized by its role in regulating light signaling. PhyA, a red/far red absorbing photoreceptor, is rapidly ubiquitinated and turned over following photoconversion to the Pfr form. In addition to the regulation of photoreceptor protein levels, regulation of transcription factors is also performed by the proteasome. In the absence of a light source the RING-E3 COP1 is present in the nucleus where it targets a number of transcription factors for degradation. Upon illumination COP 1 is removed from the nucleus and the transcription of light responsive genes occurs. These examples represent an extremely small percentage of the pathways in which the proteasome has been implicated and there are many more that have not been characterized. While much is known about the degradation of soluble proteins by the proteasome, relatively little is known about integral membrane protein degradation, especially in plants. What is known about this pathway has been elucidated in yeast and to a lesser extent in humans. A maj or regulatory and house keeping pathway that involves degradation of proteins in the endoplasmic reticulum (ER) or integrated into the ER membrane and has been termed ER- associated degradation (ERAD) has been uncovered. ERAD is responsible for targeting misfolded ER proteins that are retro-translocated back across the ER membrane and also targeting misfolded integral membrane proteins that are subsequently extracted from the membrane and degraded by the proteasome (Meusser et al., 2005). It has been hypothesized that different targeting complexes may be present in cells that target membrane proteins with misfolded cytosolic domains, internal membrane domains or ER luminal domains (Carvalho et al., 2006). These complexes contain a number of different subunits but each contains a membrane-bound E3 ligase that attaches the ubiquitin monomers to the substrate. A number of membrane-bound ERAD substrates have been identified but an interesting example is that of the inositol 1,4,5-triphosphate (IP3) receptor. Activation of a G protein- coupled receptor (GPCR) increases phospholipase C activity that generates diacylglycerol and the second messenger IP3. IP3 mOves through the cytoplasm to IP3 receptors located in the ER membrane, which activate channels that mobilize internal reserves of Ca2+. A persistent activation of GPCRs leads to a down-regulation of IP3 receptors in order to prevent any deleterious effects of continually elevated cytosolic Ca2+. This down regulation requires the 26S proteasome and it has been shown that IP3 binding induces ubiquitination of the IP3 receptor, leading to degradation (Zhu and Woj cikiewicz, 2000). In addition, a binding-defective mutant receptor was shown to be resistant to ubiquitination and this resistance is not caused by the removal of potential ubiquitination sites. It was hypothesized that ligand binding causes a conformational change that exposes a signal leading to ubiquitination (Zhu and Woj cikiewicz, 2000). The 26S proteasome has emerged as an essential part of a cell's repertoire for maintaining cellular integrity and regulating a myriad of different pathways. Its involvement in both plant development and responses to environmental stimuli implies an important evolutionary advantage allowing these sessile organisms to flourish in many different environments. The Tomato ETR Ftamily H N GI F G2 D II~r~~r~-I~ II:::l~::::::::: Response regulator GAF LeETRI LeETR2 L~eETR4 LeETR5 LeETR6 rl Senior Histidine kinase Figure 1-1. Schematic representation of tomato ethylene receptor family. Black bars in sensor domain represent putative transmembrane domains. Black boxes in histidine kinase domain represent conserved sub-domains while black box in response regulator represents conserved aspartate involved in phosphorelay. (Klee, 2004) CHAPTER 2 ETHYLENE RECEPTOR DEGRADATION CONTROLS THE TIMING OF RIPENING IN TOMATO Introduction The plant hormone ethylene is a gaseous molecule that regulates multiple processes including germination, organ senescence, stress responses and fruit ripening (Abeles et al., 1992). The role of ethylene in fruit ripening has been intensively studied in a number of species, but most notably tomato, which has emerged as an important model for the study of fleshy fruit development. Ethylene plays a critical role in determining the timing of ripening and thus provides an attractive point to control fruit ripening through genetic modification. Climacteric fruits such as tomato are characterized by an increase in respiration and a concomitant increase in ethylene biosynthesis just prior to the initiation of ripening. Ethylene is essential for normal fruit ripening in these species and blockage of either ethylene production or perception leads to improper ripening. In tomato fruits, ethylene has profoundly different effects depending on the stage of development. There is a distinct developmental switch that occurs upon fruit maturation (Giovannoni, 2001). Although applied ethylene does not initiate ripening in immature fruits, it does significantly hasten the onset of subsequent ripening (Yang, 1987); the more ethylene to which an immature fruit is exposed, the earlier it ripens. Similar effects have been observed in banana where Burg and Burg (1962) demonstrated that treatment of immature green banana fruits shortened the time to ripening relative to untreated controls. The mechanism by which fruits measure cumulative ethylene exposure is unknown. Genetic analysis in tomato and Arabidopsis has shown that ethylene receptors act as negative regulators of the ethylene response pathway (Hua and Meyerowitz, 1998; Tieman et al., 2000). In the absence of the hormone, receptors actively suppress ethylene responses. Upon ethylene binding, that suppression is removed and the response occurs. In tomato there are six known ethylene receptors (LeETR1,2, 4-6 and NR) (Wilkinson et al, 1995; Zhou et al., 1996; Lashbrook et al., 1998; Tieman and Klee, 1999). Functional analyses have indicated that some Arabidopsis family members have a more important role in ethylene signaling than others. Further, no single loss-of-function mutation has a maj or effect on ethylene responses, indicating a degree of functional redundancy. However a completely different picture emerges in tomato where loss of a single subfamily II receptor, LeETR4, results in increased ethylene sensitivity. Antisense LeETR4 plants show phenotypes consistent with a constitutive ethylene response including significantly earlier fruit ripening (Tieman et al., 2000). This mutant phenotype can be restored to wild type by over-expression of the Subfamily I receptor, NR. No ethylene-associated developmental effects have been observed in lines with reduced expression ofNR (Tieman et al., 2000), LeETR1, LeETR2 or LeETR5 (Tieman and Klee, unpublished results). The receptor signaling model states that the receptors are acting as negative regulators of ethylene response. Experimentally it has been shown that reduction of receptor content increases ethylene sensitivity (Hua and Meyerowitz, 1998; Tieman et al., 2000; Cancel and Larsen, 2002; Hall and Bleecker, 2003) while increased receptor content has the opposite effect (Ciardi et al., 2000). We have previously shown that NR and LeETR4 transcripts are up-regulated in ripening fruits (Wilkinson et al., 1995; Tieman et al., 2000). Since fruit ripening is dependent upon ethylene action, it seems illogical to increase receptor content and thus decrease ethylene responses. To better understand the role of the tomato ethylene receptor family during fruit development we have characterized the behavior of both the receptor RNAs and proteins during fruit development. Contrary to the RNA data, protein blot analysis showed that receptor protein levels are at their highest during immature fruit development and significantly decline at the onset of ripening. This paradox is explained by observations that ethylene treatment induces a rapid degradation of receptor proteins. Here, we present data indicating an important role for LeETR4 and LeETR6 in modulating the timing of ripening. Reduced levels of these receptors mediated by either antisense RNA or protein degradation results in earlier fruit ripening. Results A Subset of the Receptor Family Shows Ripening-associated Expression and Is Ethylene- inducible in Fruit Expression of all six ethylene receptor genes was assayed throughout fruit development to assess stage-specific expression. Quantitative RT-PCR (qRT-PCR) analysis of each receptor transcript showed low expression of all receptors throughout immature fruit development but upon maturation there was a significant increase in NR, ETR4 and ETR6 transcripts (Fig. 2-1). This ripening-associated increase in expression constituted a 10-fold increase in total receptor mRNA content by the breaker stage. Since the receptors are negative regulators of ethylene responses, the observed increases in mRNA levels during an ethylene-dependent process seems counter-intuitive as an increase in receptors would make the fruit less sensitive to ethylene. Ripening-associated gene expression can be the consequence of increased ethylene production. Previous analysis has shown that ETR4 and NR are in fact ethylene-inducible in leaf tissue (Ciardi et al., 2000). To determine if the receptor gene family is regulated by ethylene in fruit tissue, individual fruits were treated with 50 ppm ethylene for 15 h. Expression analysis of each receptor showed a 9-, 10- and 7-fold increase in NR, ETR4 and ETR6, respectively (Fig. 2- 2). Expression of ETR1, ETR2 and ETR5 changed little in response to the ethylene treatment. Based on this analysis it appears that expression of NR, ETR4 and ETR6 is the consequence of the climacteric increase in ethylene production at the onset of ripening. LeETR6 Antisense Lines Show Phenotypes Consistent with a Constitutive Ethylene Response Single gene knockouts of ethylene receptors in Arabidopsis show no obvious phenotypes and only the subfamily I double mutant (Hall and Bleecker, 2003; Qu et al., 2007) or triple and quadruple mutants (Hua and Meyerowitz, 1998) show any ethylene-related phenotypes. As previously shown by Tieman et al. (2000) this is not the situation in tomato as lines having significantly reduced LeETR4 expression show ethylene hypersensitive phenotypes. When LeETR6 antisense lines were generated, we found similar phenotypes to those seen in LeETR4 antisense lines, including a reduction of time to ripening by as much as seven days (Table 2-1). Additional ethylene-related phenotypes include epinastic leaf growth and premature flower senescence (Fig. 2-3). These results indicate gene-specific reductions in expression of either LeETR4 or LeETR6 but not the other four receptors (data not shown) results in a hypersensitivity to ethylene, including premature fruit maturation and ripening. Receptor Protein Levels Are Distinctly Different From Transcript Levels During Fruit Development A wealth of recent work has demonstrated that post-translational control is an important component of hormone pathway regulation. In order to uncover any potential post-translational regulation of ethylene receptors, antibodies against NR, ETR4 and ETR6 were produced. Tissues were collected for a comprehensive study of mRNA and protein expression during fruit development. Measurement of receptor mRNA expression showed an increase in transcript levels at the onset of ripening and these levels often remained high until fruits were completely red (Fig. 2-4A). Microsomal membranes were isolated to enrich for the receptor proteins and were used for protein quantification. Analysis of protein levels throughout fruit development revealed an unexpected result; levels were highest during immature fruit development and significantly declined at the onset of ripening (Fig. 2-4B). Data from cy. Flora-Dade are presented, although identical results were obtained in the Pearson and Micro-Tom cultivars. This reduction in protein occurred despite increased RNA content (Fig. 2-4C). The results indicate that RNA levels are not predictive of receptor protein content nor the signaling state of the tissue. Rather, there must be an additional level of control of ethylene perception. Because the drop in receptor content coincided with the onset of autocatalytic ethylene synthesis, we subsequently examined whether ethylene binding induces receptor turnover. Treatment of Leaf and Fruit Tissue with Ethylene Causes a Rapid Degradation of Receptor Proteins That Likely Occurs Through a Proteasome-dependent Pathway To determine whether ethylene binding induces receptor degradation, immature fruits and vegetative tissues were exposed to exogenous ethylene. Ethylene treatment of fruits resulted in 4, 5 and 8-fold increases in NR, ETR4 and ETR6 mRNA, respectively (Fig. 2-5A). Concomitant with this increase in transcripts there were reductions of 60%, 60% and 40% in NR, ETR4 and ETR6 proteins, respectively, within 2 h and this reduction was sustained throughout the treatment (Fig. 2-5B). Removal of ethylene after 8 h of treatment lowered transcripts to pre- treatment levels but receptor proteins remained lower even 24 h after treatment ceased (Fig. 2- 5A). Ethylene-mediated receptor degradation was also observed in vegetative tissues. Treatment of seedlings with 50 ppm ethylene for 2 h resulted in 10-, 5- and 13-fold increases in NR, ETR4 and ETR6 mRNA, respectively. Similar to the data collected from immature fruit there was 60%, 40% and 50% reduction in NR, ETR4 and ETR6 protein levels, respectively (Fig. 2-6B). Taken together, the results indicate that ethylene exposure in both vegetative and reproductive tissues results in an immediate drop in receptor protein levels that is independent of transcript levels. The 26S proteasome-dependent degradation pathway has emerged as a key point of regulation in many phytohormone signaling pathways (Guo and Ecker, 2003; Dill et al., 2004; Gagne et al., 2004; Dharmasiri et. al., 2005; Kepinski and Leyser, 2005). To determine if this pathway is responsible for the turnover of ethylene receptors, seedlings were treated with the proteasome inhibitor MGl32 prior to ethylene treatment. Following ethylene treatment, levels of each protein actually increased, likely because of ethylene-induced increases in transcription/translation (Fig. 2-6B). Very little is known about mechanisms of ER-associated protein degradation in any system (Meusser et al., 2006). Presumably ubiquitinated proteins are rapidly extracted from the membrane and degraded by the cytoplasmic 26S proteasome complex. We did not observe larger ubiquitinated forms of immuno-reactive receptors in the microsomal membrane fractions. Even after several-fold concentration, no receptors could be detected in the soluble fraction (data not shown). Nonetheless, the MGl32 results are consistent with a ubiquitin-mediated receptor degradation. In order to demonstrate that ethylene binding is necessary for degradation, seedlings were pre-treated with the ethylene action inhibitor 1 -methylcyclopropene (1-MCP) prior to ethylene treatment. 1-MCP is a competitive inhibitor of ethylene and its attachment to the receptor is essentially irreversible (Sisler, 2006). If ethylene binding is essential for the degradation of the receptor, 1-MCP should stabilize the protein. Pretreatment of tomato seedlings with 1-MCP prevented the ethylene-induced receptor degradation (Fig. 2-6B) as well as the ethylene-induced increase in mRNA (Fig. 2-6A), indicating that ethylene binding is essential for receptor degradation. To further confirm that ethylene binding is necessary for protein degradation we utilized the semi-dominant Nr mutant that has a greatly reduced ethylene response. The mutant Nr protein is unable to bind ethylene when heterologously expressed in yeast (Klee and Bleecker, unpublished data). Treatment of Nr seedlings with 50 ppm ethylene for 2 h caused a 50% and 62% decrease in ETR4 and ETR6 proteins (Fig. 2-6B), respectively, but caused significantly less change in the level ofNR protein. Taken together, the results are consistent with enhanced receptor degradation following ethylene binding. However, we cannot completely exclude the existence of an ethylene-induced receptor degradation machinery. Receptor Levels in Developing Fruit Determine the Timing of Ripening To determine whether ethylene-induced receptor depletion is the cause of the early ripening phenotype seen in ethylene treated fruit, immature fruits were exposed to ethylene while still attached to the plant and then allowed to ripen. Protein and mRNA samples were collected throughout the duration of the experiment to correlate lower protein levels with reduced time to ripening. Treated fruits ripened on average three days prior to untreated fruits (Table 2-2). Receptor protein levels were lowered upon treatment with ethylene at 15 days post anthesis (DPA) and remained lower than untreated controls throughout fruit development, indicating that lower receptor levels correlate with earlier ripening (Fig. 2-7). Transcript data show that the fruits responded to the ethylene treatment and upon removal of the ethylene, transcripts returned to pre-treatment levels (Fig. 2-8). Discussion Upon maturation, tomato fruits undergo a developmental transition that is defined by their response to ethylene (Lincoln et al., 1987). A number of system 1 and/or system 2-associated genes have been identified in fruits. The E4 and E8 genes are excellent examples with E4 being ethylene inducible throughout fruit development (both in response to system 1 and system 2 ethylene) and E8 only being ethylene-inducible in mature fruit (system 2 specific). While much is known concerning the role of ethylene during ripening its function during the immature phase of fruit development is less well understood. When mature fruits are exposed to ethylene, a ripening program is initiated. While treatment of immature fruits does not initiate ripening it does hasten the onset of ripening; the more the fruit is exposed to ethylene, the earlier it ripens (Burg and Burg, 1962; Yang, 1987). How the fruit measures cumulative ethylene exposure is not known. We have provided evidence indicating a specialized role for two receptors, ETR4 and ETR6, in modulating ethylene responses, including fruit maturation. Reduced level of these receptors mediated by either antisense RNA or ethylene-mediated protein degradation results in earlier fruit ripening. Ethylene exposure also resulted in a parallel depletion of the other ethylene-inducible receptor protein, NR. Our results are consistent with a model in which ethylene receptor content is a maj or determinant of when fruits initiate the ripening program. Since the receptors are negative regulators of ethylene signaling, depletion would lead to a progressive increase in hormone sensitivity. When a particular threshold sensitivity is reached, ripening would commence. Alternatively, receptors may act as a brake on ripening initiation. It must be noted that there are other elements independent of ethylene that also must be in place for ripening to initiate; most notably the RIN transcription factor (Vrebalov et al., 2002). Receptor gene expression is low and constitutive throughout immature fruit development with little difference between any of the family members (Fig. 1). At the onset of ripening there is an increase in expression of NR, ETR4 and ETR6 that results in a 10-fold increase in total receptor mRNA content. In contrast to mRNA expression, protein levels are at their highest in immature fruits and show a significant decrease at the onset of ripening and remain low (Fig. 2- 4B) as a consequence of ethylene exposure. Ethylene binding likely causes a conformational change in the receptors that makes them susceptible to degradation. In this context it is interesting to note the model of Arabidopsis receptor signaling presented by Wang et al. (2006). These authors provide genetic evidence supportive of a transitional state in which a receptor continues to actively suppress downstream ethylene responses after ethylene is bound. This intermediate state subsequently transitions to a receptor-inactive state. Our results suggest that the "transmitter-off' state may actually be receptor degradation. It would be most interesting to determine whether the mutations that define this transition state stabilize the protein. This receptor degradation is dependent upon the action of the 26S proteasome. At least in some cases, ubiquitination is associated with phosphorylation state (Hochstrasser, 1996). Although the ethylene receptors are considered to be ancestral histidine kinases, many do not possess histidine kinase activity (Moussatche and Klee, 2004). However, all of the receptors are functional kinases; those that do not have histidine kinase activity are serine kinases. In light of the degradation of receptors following ethylene binding, it is possible that the phosphorylation state of the receptor may mediate ubiquitin binding. Although ligand-induced receptor degradation has not been reported for plant hormones, it has been observed in animals where growth hormone (GH) signaling is mediated by receptor levels (Flores-Morales et al. 2006). The GH receptor, like ethylene receptors, is a membrane-associated protein in which hormone binding also increases ubiquitin-mediated turnover (Govers et al. 1999). The ethylene receptor family in tomato, like Arabidopsis, is split into two groups with LeETR1, LeETR2 and NR belonging to subfamily I and LeETR4-6 belonging to subfamily II. The Arabidopsis results indicate that there is a distinct difference between subfamily I and II members. With the exception of a subfamily I double mutant (etrlersl), single and double gene knockouts in Arabidopsis show no obvious phenotypes. This is likely due to functional redundancy within the gene family. Over-expression of a subfamily II member in an etrlers1 double mutant cannot rescue the ethylene-hypersensitive phenotype (Wang et al. 2003). In a reciprocal experiment over-expression of a subfamily I member in a subfamily II triple mutant was sufficient to rescue the ethylene response phenotype. Together these data indicate that the subfamily I receptors are more important than the subfamily II receptors in determining competency to respond to ethylene. The Arabidopsis paradigm does not hold for tomato (Fig. 2- 3, Tieman et al. 2000). Plants with reduced expression of either LeETR4 or LeETR6, both subfamily II members, show phenotypes that are consistent with an exaggerated ethylene response, including epinastic growth, premature flower senescence and early fruit ripening. Over-expression of NR in a LeETR4 antisense line is able to rescue the ethylene response phenotype, indicating functional redundancy between subfamily I and II members (Tieman et al. 2000). Apparently there is a large degree of plasticity within the ethylene signaling pathway and different plants have adapted the signaling components as appropriate for their situation. Plant hormones are involved in most developmental processes and are critical for abiotic and biotic stress responses. Plants can regulate hormone action through synthesis, catabolism or perception. We have shown that a significant part of the regulation of ethylene responses involves ligand-mediated receptor degradation. Frequently ethylene responses, particularly those related to stresses, are transitory. In order to shut down an ethylene response, synthesis of new receptors is essential. Our results with ethylene exposure to immature fruits indicate that receptor degradation is apparently an important level of developmental control. Our results also indicate that conclusions concerning receptor functions based on RNA levels must be interpreted cautiously. Whether ethylene-mediated receptor turnover and replenishment are important for other ethylene-mediated processes remains to be determined. HETR1 o ET2 2 NR o ET4 o ETR5 5 ETR6 5.0 4C.5 4.0 3.5 3.0 2.5 2.0 1.5 1.0 0.5 10 DPA 20 DPA 30 DPA MG Breaker Turning Re~d Figure 2-1 Ethylene receptor family mRNA levels during fruit development. qRT-PCR analysis of each receptor transcript in fruit tissue from different stages of fruit development. DPA, days post anthesis; MG, mature green; Breaker, first external color change; Turning, ~30% red color. Expression levels are presented as percentage of total RNA. O Control II 1ppm Ethyle~ne 2.5 - a 2.0 - ETR5 ETR6 ETR1 ETR2 ETR4 Figure 2-2 Ethylene-inducibility of each receptor mRNA in 20 days post anthesis, immature fruit. qRT-PCR analysis of expression of each receptor in response to 10ppm ethylene as a percentage of total RNA (+SE). .I Figure 2-3 Constitutive ethylene response phenotypes of LeETR6 antisense lines. Epinastic leaf growth (A) and early flower senescence (B) of LeETR6 antisense lines. Equivalent aged wild type flowers are shown for comparison (C). LeETRfi 1 0 1.04 0.18 0.27 0.41 0.17 1_ m LeETR4 WWTT WT WT IMG Broaker Tuming Red 4AS-1 4AS-2 IMG IMS Figure 2-4 Receptor gene expression and protein levels show distinct differences during fruit development. qRT-PCR analysis of gene expression expressed as percentage of total RNA (a SE) (A) and protein blot analysis (B) throughout fruit development in L. esculentum cy. Flora-Dade (WT). Levels of RNA and protein are also shown for independent LeETR4 (4AS-1, 4AS-2) and LeETR6 (6AS-1, 6AS-2) antisense lines. Values below each receptor protein blot represent the amount of protein in each lane relative to the IMG stage. BiP antibody was used as a loading control and used to normalize protein values. C. Ratio of protein to mRNA. IMG: Immature green stage. Protein quantification was determined by densitometric analysis of Western blots using the NCBI software ImageJ. A 301 2NR a NR ...E TH4 10 0.25 042 0 .47 1 0 0.17 0.11 0.05 0 1 0D.DH a-BIP" -BIP ._. WT WT WT WT SAS-1 6AS-2 IMG BrunKer Turnlug Red NO IMD WT WT WT WT IMG Breaker Turning Red HOh Zh 0 8h B 32h T a-NR a-ETR4 a-ETR6 1.00 0.76 Figure 2-5 Ethylene binding induces degradation of receptors in detached immature fruits. Fruits were exposed to 10 ppm ethylene for 8 h. 32h time point represents fruit that were treated for 8 h and left in air for a further 24 h. qRT-PCR analysis of gene expression (A) and protein blot analysis (B) of ethylene-treated immature fruits. Values below protein blots represent the amount of protein in each lane relative to the 0 h time point. BiP antibody was used as a loading control and used to normalize protein values. Data represent the results of two independent experiments (+SE). A o Control H Ethylene MG 132 + Ethylene a MCP + Ethylene O Nr Control 0 Nr + Ethylene 1.6 S1.2 " 0.6 LeETR4 LeETR6G T a r ar a E er w fi g + w fl o w o + a u L L Z a ---- a.-NR u-ETR4 o.-ETR6 1.00 0.73 1.28 0.94 1.00 0.89 1.00 0.64 1.45 1.07 1.00 0.50 1.00 0.62 1.93 0.94 1.00 0.38 Figure 2-6 Ethylene binding induces degradation of receptor proteins in vegetative tissue. qRT- PCR analysis of gene expression (A) and protein blot analysis (B) of L. esculentum cy. Micro-Tom and Never-ripe (Nr) seedlings after treatment with 50 ppm ethylene for 2 h. Data represent the results of two independent experiments (+SE). Values below protein blots represent the amount of protein in each lane relative to the 0 h time point. BiP antibody was used as a loading control and used to normalize protein values. -*-ontol -0- 50ppm Ethylene 2.0 5 O x15- YI .E B P10 g a 0.5 - 2.5 20 e o r x15 LU .C d P 1.0 J B : as C [7- LeETR4 9 '----d LeETR6 C O ~i O x 1,5 YI c B P 1,0 g ~ 1Y rr 10 Figure 2-7 30 Days Post Anthesis Ethylene treatment induces turnover of receptor leading to early ripening fruit. 15 days post anthesis (DPA) fruit were treated with 50 ppm ethylene while attached to the plant. Relative protein expression of NR, ETR4 and ETR6 normalized to an internal control, BiP. Values are plotted relative to the pretreatment protein level. ] Control 550ppmEthylene ] Control a 50ppm Ethyine 0 Control 150Dpm Ethiene NR ETR4 ETR6 S20 15 DPA 25 DPA 35 DPA Breaker 15 DPA 25 DPA 35 DPA Breaker 15 DPA 25 DPA 35 DPA Breaker Figure 2-8 Ethylene treatment induces expression of receptor mRNAs in attached fruit. qRT- PCR analysis of expression of NR, ETR4 and ETR6 in response to 50ppm ethylene as a percentage of total RNA (+SE). Table 2-1 Days from anthesis to breaker of LeETR6 antisense lines Line Days % Reduction LeETR6 mRNA WT 43.33 f 0.71 LeETR6AS-1 38.42 f 0.90* 85.1 f 2.4 LeETR6AS-2 37.00 & 1.46* 75.6 f 6.4 LeETR6AS-3 35.83 f 0.78* 72.8 &5.8 Values represent mean of at least fifteen fruit for each line. *p-value<0.001 based on Student's t-test. Table 2-2 Days from anthesis to breaker of ethylene treated Microtom fruit Treatment Days -Ethylene 45.33 f1.41 + Ethylene 41.20 f 0.80* Values represent mean of at least ten fruit for each treatment. Experiment repeated with similar results. *p-value<0.05 based on Student's t-test. CHAPTER 3 FRUIT-SPECIFIC SUPPRESSION OF THE ETHYLENE RECEPTOR LEETR4 RESULTS IN EARLY RIPENING FRUIT Introduction Tomato is the most economically important vegetable crop grown in the USA. Worldwide, ~70 million metric tons are produced each year. Short growing seasons in higher latitudes often reduce the number of cultivars a grower can use in outdoor cultivation. One mechanism to circumvent climate-related limitations is to grow early-maturing varieties. This offers a distinct advantage to growers, because the first fruit to market in a season can garner a higher price. As our knowledge of the molecular control of fruit ripening expands, biotechnology can provide useful tools for generating early ripening cultivars. While much effort has focused on delayed ripening, particularly as it relates to the ripening hormone ethylene, opportunities to hasten fruit development have been relatively neglected. We have developed a tissue-specific approach to enhance ethylene responses in tomato fruits by depletion of an ethylene receptor. Transgenic fruits mature 5-7 days earlier than controls with no deleterious effects on yield, fruit size or quality. This technology should be applicable to any fruit whose ripening is dependent on ethylene. Ethylene is a phytohormone that controls or influences many aspects of plant growth and development (Abeles, 1992). Many of the developmental processes controlled by ethylene such as senescence, organ abscission and fruit ripening are critically important to agriculture. For example, climacteric fruits, such as tomato, banana and apple, require an increase in ethylene biosynthesis at maturity in order to ripen. Transgenic plants that are reduced in either synthesis or perception of ethylene exhibit delayed ripening (Oeller et al., 1991; Klee et al., 1991; Wilkinson et al., 1995; Hamilton et al., 1990). Conversely, it should be possible to speed up fruit maturation by increasing synthesis or perception of ethylene. Indeed, it has been known for many years that ethylene application to immature tomato fruits does cause earlier onset of ripening (Yang, 1987). Because of the pleiotropic negative effects of excessive ethylene exposure on plant growth, simply increasing ethylene synthesis is not practical. Here, we describe an approach involving tissue specific depletion of an ethylene receptor resulting in early ripening fruit. Receptors function as negative regulators of the ethylene response pathway (Hua and Meyerowitz, 1998; Tieman et al., 2000). In the absence of the hormone the receptor actively suppresses ethylene responses and ethylene binding removes this suppression. In practical terms, this means that ethylene sensitivity is inversely correlated with receptor levels; depletion of receptors effectively increases ethylene sensitivity because there are fewer receptors to inactivate. Recent work on the tomato ethylene receptor family has demonstrated that receptor levels during fruit development determine the timing of ripening (Kevany et al., 2007). Protein levels are at their highest during immature fruit development and significantly drop at the onset of ripening, facilitating ethylene-mediated ripening processes. Ethylene treatment of immature fruits causes receptor degradation and earlier fruit ripening (Kevany et al., 2007). Results LeETR4 RNAi Transgenic Plants Produce Early Ripening Fruit Antisense-mediated reduction in either of two tomato ethylene receptors, LeETR4 or LeETR6, results in premature ripening (Tieman et al., 2000; Kevany et al., 2007). However, these plants are severely affected in many aspects of growth and it is not clear that the early ripening is a direct effect of transgene expression. We postulated that fruit-specific suppression of the LeETR4 receptor would result in early ripening without undesirable ethylene-related effects. In order to test the hypothesis a strategy was developed to specifically reduce LeETR4 expression throughout fruit development. To achieve this goal we generated a construct consisting of an LeETR4 RNAi inverted repeat sequence fused to the promoter of Tfmn7, a gene that is expressed specifically in immature fruits (Santino et al., 1997). Transgenic plants were generated by Agrobacterium-mediated transformation into the tomato cultivar Flora-Dade, a large fruited variety developed for Florida fresh tomato production. Transgenic lines that showed no vegetative expression of the silencing construct were identified and assayed in a greenhouse for time from anthesis to breaker stage (the first visible signs of ripening) in two successive seasons. Three lines that exhibited both a reduction in time from anthesis to breaker and a reduction of LeETR4 transcript throughout fruit development were chosen for further characterization. Transgenic lines began ripening between 5 and 7 days earlier than controls (Figure 3-1). No significant effects were observed on time from breaker to fully ripe nor were there differences in color of ripe fruits (data not shown). As expected, LeETR4 transcript levels were reduced by as much as 73% in immature fruit and 95% in ripening fruit (Figure 3-2A). While Tfm~n7 expression has been reported to be immature fruit-specific the RNAi effect persisted into ripening fruit (Figure 3-2A). This gene-specific reduction in expression was not seen in non- target tissues such as leaves (Figure 3-2A). Expression analysis of the other family members showed no decrease in transcript levels in transgenic plants (Figure 3-3). Protein blot analysis confirmed that ETR4 protein levels were correspondingly reduced at all stages of fruit development relative to non-transgenic control fruit (Figure 3-2B). Early Ripening Lines Show Altered Ripening Coordination Performance of the transgenic plants was also assessed in the field using standard commercial practices. Harvests were conducted on a weekly basis in which all fruit that had begun to show external color development were picked and staged for their degree of ripeness. Transgenic plants had more ripening fruit in the first harvest than the control plants and transgenic lines were stripped of between 77% and 86% of their fruit within the first two harvests (Figure 3-4). Transgenic Fruits are Indistinguishable from Wild Type Fruits in Horticultural Traits Early maturing varieties of fruits frequently lack the quality of slower ripening varieties. To achieve maximum value it would be advantageous if early ripening fruits maintain the size, yield and flavor qualities of later ripening cultivars. Altering the time to maturation could potentially impact synthesis of sugars, acids and volatile compounds associated with flavor. In addition, fruit size and yield could potentially be negatively affected by earlier maturation and harvest. To address these questions, tests were performed to assess quality and yield attributes. Analyses of yield and fruit size were conducted in both greenhouse and field- grown plants. To assess yield, fruits were harvested at the onset of ripening and individually weighed. Average fruit size for two of the transgenic lines was slightly lower than control fruit but this difference was not statistically significant (Table 3-1 and Table 3-2). Total yield and the number of fruit per plant were not affected by the presence of the transgene (Table 3-1 and data not shown). Tomato flavor is the sum of a complex interaction between taste and olfaction. Sugars and organic acids stimulate taste receptors while a set of volatile organic compounds (VOCs) stimulate olfactory receptors (Buttery et al., 1993; Buttery and Ling, 1993). In order to assess potential effects on flavor, total soluble solids, citric acid, malic acid and the 16 most important VOCs were measured (Table 3-1, Table 3-3 and Table 3-4). Similar results were obtained on both field-grown and greenhouse-grown materials. Although a very few statistically significant differences in citric acid and some VOCs were observed, they were not repeatable from season to season. All of these differences are well within the range of observed season-to-season variations. Therefore, we concluded that the transgenic and control fruits are essentially equivalent. Discussion While the essential role of ethylene in mediating climacteric fruit ripening has been known for many years, its role during immature fruit development is only now being elucidated. Previous work has shown that ethylene treatment of immature tomatoes or bananas quantitatively reduces the time to the onset of ripening (Burg and Burg, 1962; Lyons and Pratt, 1964; McGlasson et al., 1975; Yang, 1987) but the mechanism by which fruits measure cumulative ethylene exposure has remained unknown until now. We have identified a potential mechanism by which plants use ethylene receptor levels to measure cumulative ethylene exposure (Kevany et al., 2007). Ethylene binding triggers a ubiquitin-dependent receptor protein degradation. If receptors are not replaced after ethylene-mediated degradation, as occurs in immature fruit (Kevany et al., 2007), the fruit will become more sensitive to subsequent ethylene exposure and ripen earlier. The precise, fruit specific targeting ofLeETR4, described here, validates the model. These results define a critical role for LeETR4 in mediating ethylene responses. The special importance of this and another subfamily 2 receptor, LeETR6, to ethylene responses (Kevany et al., 2007) contrasts markedly with what is known about ethylene perception in Arabidopsis. In Arabidopsis, no single loss-of-function receptor mutant has an obvious effect on ethylene responses and the subfamily 1 receptors seem to have a more important role in ethylene signal transduction (Wang et al., 2003). These results taken together with results described in Kevany et al. (2007) more broadly demonstrate that plants have the capacity to regulate hormone responses by modulating receptor levels. Tissue-specific modulation of ethylene sensitivity in transgenic plants has resulted in fruits with altered ripening without an agronomic penalty. A similar approach to precisely separate an advantageous trait from pleitropic negative effects was employed by Davuluri et al., (2005) who used fruit-specific suppression ofDET1, a photomorphogenesis regulatory gene, to increase both carotenoid and flavonoid content in transgenic tomatoes. Previous work on DET1 had reported increases in these phytochemicals in loss-of-function mutants but global suppression of DET1 led to a number of serious developmental defects that would prevent these plants from being used commercially. We present here a crop improvement that should provide significant value to producers. Early season harvests of tomatoes and many other horticultural crops usually constitute a substantial percentage of a season's profits. The first fruit picked can be sold at a premium because supply is generally low and demand is high. We have generated transgenic lines in an elite background that ripen up to a week earlier than their control (Figure 3-1). These lines have none of the developmental defects associated with global receptor suppression (Tieman et al., 2000; Kevany et al., 2007) because of fruit-specific suppression of the gene (Figure 3-2A). This approach for engineering early ripening should be applicable to any climacteric fruit species. 55 - 50 - u,40 - 35 - E T4-RNAi ETR4-RNA i-2 ETR4-RNAi-3 Cont ro-l Figure 3-1 Fruit-specific ETR4 RNAi Transgenic Lines Produce Early Ripening Fruit. (A) Days from anthesis to breaker were measured by tagging open flowers and recording the number of days until the first signs of color development. (B) Fruit from transgenic lines are similar in shape and color to control fruit. A 1.6 1.4 -1 a INtl4-KNAl-1I 0 ET4-RNAi-2 m 1.2 IIIET4-RNAi-3 X 0.6 ;j 0.4- 0.2- Leaf IMG Breaker Tuming Red ETR4-RNi-1~ E TR4-R NAi-2 ITlilllj E TR4-RNAi-3 ~IIII Figure 3-2 Suppression of LeETR4 is Fruit-specific. (A) qRT-PCR analysis of ETR4 transcript levels in leaf tissue and throughout fruit development in control and RNAi transgenic lines. (B) Protein blot analysis of ETR4 protein levels in control and transgenic lines. IMG, immature green; Breaker, first external color change; Turning, ~30% red color. ETR4-RNAi Transgenic Plants Have Altered Ripening Coordination. Fruits showing visible color development were harvested on a weekly basis. Values represent the percent of total fruit harvested each week +SE. CoGantro~l --eET4-RNAi-1 TE4-RNAi-2 + TEW4-NAl-3 80%~' 70% 50%~ 40%,' 30% 20%O~ 10%~ Week 1 W~ee~k 2 We~ek 3 W~eek 4 Cumulative Harvest as % of Total Line Wreek 1 Control 7.,8% ETR4-RZNAi-1 18.1% o ETR4-RNAi-2 18.3% ETR4-RN~Ai-3 22.3% Week 2 49. 1.% 78 9~' 77.0% ' 86..4% Week 3 77.4'% 95.2% 95.8% 99.0% Wi5eek 4 100.0% 100.0% 100.0% 100.0% Figure 3-3 Table 3-1 Weight, yield, brix, citric acid and malic acid from field grown fruits Weight Yield/Plant Citric Acid Malic Acid Line (g) (n) (kg) (n) oBrix (n) (mg/gfw) (n) (mg/gfw) (n) Control 135.513.1 218 4.5110.4 9 4.110.2 10 2.7610.04 5 0.2210.02 5 RNAi-1 130.713.9 185 4.5310.6 8 3.910.1 10 2.6310.06 5 0.2310.03 5 RNAi-2 131.413.1 262 4.4910.4 12 3.810.1 10 2.6910.14 5 0.2310.02 5 RNAi-3 142.914.1 137 4.5610.3 10 4.010.1 10 2.5710.16 5 0.2110.03 5 Table displays mean iSE. n=number of fruit examined, or plants in case of yield study. Table 3-2 Weight, yield, brix, citric acid and malic acid from greenhouse grown fruits Weight Yield/Plant Citric Acid Malic Acid Line (g) (n) (kg) (n) oBrix (n) (mg/gfw) (n) (mg/gfw) (n) Control 115.414.4 98 3.6810.2 3 4.210.1 10 3.1010.03 15 0.5010.03 15 RNAi-1 103.713.3 64 3.5810.5 2 4.210.1 10 2.9210.10 15 0.5210.04 15 RNAi-2 106.913.2 70 4.1310.2 2 3.810.1* 10 3.0110.04 15 0.4810.03 15 RNAi-3 118.914.4 142 4.6910.4 3 4.010.0 10 3.2410.03* 15 0.4810.03 15 Table displays mean iSE. n=number of fruit examined, or plants in case of yield study. *Statistically significant p-value<0.05 based on Student's t-test Table 3-3 Volatile organic compounds from field grown fruits Compound cis-3 -Hexenal B-lonone Hexanal B-Damascenone 1-Peneten-3 -one 3 -Methylbutanal trans-2-Hexenal 2-Isobutylthiazole 1-Nitro-2-phenylethane trans-2-Heptenal Phenylacetaldehyde 5-Methyl-5-hepten-2-one cis-3 -Hexenol 2-Phenylethanol 3 -Methylbutanol Methyl salicylate Control 37.4816.48 0.05+0.01 83.38122.22 0.0210.00 0.4610.09 4.25+0.47 1.0610.17 4.8211.16 1.6010.33 0.1510.03 0.4510.06 3.4010.87 50.6218.52 1.8610.39 20.1613.27 0.1310.01 RNAi-1 50.7017.99 0.07+0.01 116.06119.78 0.0310.01 0.4810.07 4.1910.42 1.2710.29 5.7410.99 1.2010.43 0.1710.03 0.5010.1 3.8110.80 64.7813.63 1.8910.55 18.16+4.05 0.1910.05 RNAi-2 66.6914.76* 0.0610.01 166.23118.54* 0.0210.00 0.4410.02 4.4910.44 1.6310.06* 5.6610.65 1.9210.37 0.2010.04 0.5110.15 4.5710.86 69.1918.37 2.6110.67 17.1914.05 0.1710.05 RNAi-3 34.7615.53 0.0410.01 59.5114.08 0.0210.00 0.4010.04 4.6210.63 0.8610.08 3.7910.42 1.1210.40 0.1310.02 0.3710.01 3.0210.29 41.6014.54 1.4910.04 16.5613.40 0.1410.04 Values are ng g FW h and table displays mean iSE with n=6. * Statistically significant p-value<0.05 based on Student's t test. Table 3-4 Volatile organic compounds from greenhouse grown fruits Compound cis-3 -Hexenal B-lonone Hexanal B-Damascenone 1-Peneten-3 -one 3 -Metlwlbutanal trans-2-Hexenal 2-Isobutvlthiazole 1-Nitro-2-phenylethane trans-2-Heptenal Phendlacetaldelwde 5-Metlwl-5-hepten-2-one cis-3 -Hexenol 2-Phem lethanol 3 -Metlwlbutanol Methyl salievlate Control 105.01126.92 0.07+0.01 97.50115.17 0.0210.01 0.4710.02 7.5111.00 2.1510.53 2.5510.54 0.07+0.01 0.25+0.07 0.2710.02 3.6610.63 53.7016.73 1.0410.29 47.15+3.01 0.17+0.06 RNAi-1 105.41129.49 0.08+0.03 131.17130.44 0.0210.01 0.5310.22 7.721.11 2.4410.67 2.3810.65 0.10+0.00 0.3610.13 0.2310.06 5.071.64 57.12111.99 1.2010.03 48.20+11.74 0.2310.07 RNAi-2 115.46119.79 0.1010.02 118.18123.15 0.0310.01 0.5910.15 8.0110.81 2.2610.50 2.3310.40 0.07+0.00 0.3310.06 0.3010.03 3.5110.49 50.5316.44 1.3210.19 43.5518.62 0.1110.03 RNAi-3 122.32150.31 0.0810.00 183.49111.45* 0.0210.00 0.3710.05 5.8210.43 2.6310.76 2.7010.57 0.10+0.01 0.2910.06 0.4210.04* 4.3411.48 59.9911.47 1.6710.03* 46.35111.81 0.3410.14 Values are ng g' FW 10 and table displays mean iSE with n=4. * Statistically significant p-value<0.05 based on Student's t test. CHAPTER 4 IDENTIFICATION OF QTLS THAT MODIFY TIME TO RIPENING AND RIPENING- ASSOCIATED ETHYLENE PRODUCTION Introduction The use of wild germplasm has become an important method for crop improvement by today's plant breeders. Genetic diversity in today's domesticated varieties is narrow and land races that could provide traits necessary for crop improvement are being lost every year. The development of introgression lines (ILs) that each contain a single chromosome segment introgressed into an otherwise uniform background has allowed for the identification of many monogenic traits and quantitative trait loci (QTLs) (Frary et al 2003; Doganlar and Tanksley 2000; Fridman et al 2002). In tomato, a number of introgression lines have been developed from crosses with wild relatives, including L. pennellii (Eshed and Zamir 1995), L. hirsutum; Monforte and Tanksley 2000), and L. peruvianum. These libraries are useful in identifying QTLs because any phenotypic variation can be associated with the introgressed segment. The entire library can be screened for a particular phenotype and individual lines can be isolated. Once these lines are identified the introgressed segment can be further reduced into sub-ILs by subsequent back crossing. This permits further refinement of the QTL location and potentially, map-based cloning. ILs have been used to identify QTLs responsible for changes in yield, quality and stress responses (Fridman et al 2004; Zamir 2001). Tomato is the most economically important vegetable crop grown worldwide, providing significant incentive for crop improvement research. Short growing seasons in higher latitudes often reduce the number of varieties a grower can use or can force them to use greenhouses that require a significant investment. Identification of loci that control the time it takes a fruit to reach maturity could offer a tremendous opportunity for breeders. Early ripening loci could be selectively bred into elite varieties that would be otherwise impossible to grow at higher latitudes. In addition to traditional breeding transgenic approaches are being developed to provide options for growers but here I will focus on the traditional method. Regulation of ethylene biosynthesis at the molecular level is a poorly understood process. Work done in Arabidopsis led to the identification of proteins that regulate the activity of the key biosynthetic enzyme ACC synthase (ACS). The ETO1 and ETO-like proteins posttranslationally regulate the stability of ACS by targeting it to the 26S proteasome. Loss-of-function and dominant gain-of-functions mutants were isolated by screening mutagenized populations for plants exhibiting a triple response in the absence of exogenous ethylene. Where ctrl mutants exhibit this phenotype because of loss of signaling capability in the absence of ethylene, eto mutants produce significantly more ethylene than controls because of enhanced ACS stability. An obvious difference between Arabidopsis and tomato is that tomato fruit go through a developmental switch that results in a significant increase in ethylene production. While we understand that a developmental switch occurs that triggers the expression of particular ACS and ACO isoforms an understanding of the regulation of the expression and activity of these enzymes is lacking in tomato. While we will assess early ripening and increased ethylene biosynthesis separately, there is a significant possibility that a locus that leads to increased ethylene production could also lead to early ripening. While increased ethylene production leading to early ripening could prove to be easier to understand it could prove less useful in terms of breeding early ripening lines because excessive ethylene production could lead to undesirable effects. In an effort to identify QTLs associated with ripening modification and ethylene production, a screen was performed on a set of ILs derived from the L. hirsutum genome. L. hirsutum was chosen to conduct this experiment because it is an unusual relative of the cultivated tomato. L. hirsutum produces small green fruit that never show any signs of ripening such as softening, carotenoid accumulation or volatile production. Maturity can only be assayed by the measurement of ethylene production rates and fruit do not reach maturity until approximately 70 days post-anthesis (Grumet et al, 1981). Once fruit reach maturity, there is a sharp increase in ethylene production that peaks at between 2000-4000 uL kg-l day- roughly ten times that of cultivated tomato varieties. These unusual phenotypes suggest the presence of loci that may influence ripening and ethylene synthesis in unusual ways. Results In a preliminary experiment ethylene emissions of fruit grown in the field were measured and a line (LA 3945) that produces up to four times the amount of ethylene produced by the control at the red stage was identified. This phenotype was confirmed with greenhouse-grown fruit (Figure 4-1). In an effort to conduct a more comprehensive analysis, 35 different lines, each containing a different segment of the L. hirsutum genome, along with both isogenic parents were grown in triplicate in the greenhouse. A randomized complete block design was utilized as an experimental design in order to control for variation within the greenhouse. Flowers of each line were tagged at anthesis to determine the number of days from anthesis to breaker (Figure 4-2). Statistical analysis using Dunnett' s test identified three lines (3935, 3958 and 3968) that had reduced time to ripening with a p-value<0.05. Fruit from the same plants were collected at the breaker and red ripe stages to measure ethylene emission rates (Figure 4-3 & 4-4). Statistical analysis using Dunnett' s t test identified four (3922, 393 5, 3944 and 4005) and three lines (3922, 3934 and 3969) with increased ethylene emission in breaker and red fruit, respectively. In addition to the lines identified by statistical analysis we included a few lines for each trait assayed that were close to the p-value<0.05 cut-off. Figure 4-5 is a representation of the approximate locations of each introgressed segment in the tomato genome. This map was used as a guide to develop a library of markers from the sequence information available in the SOL Genomics Network database. A postdoctoral researcher in our lab has taken over this project and will use the markers to fine map the exact locations of these pieces. The map also contains the locations of all known ethylene receptors and ACC-synthase (ACS) isoforms because they are possible candidates for these QTLs. In order to replicate the results of the first experiment we grew the identified lines in a greenhouse to assess the ripening trait and in the field to assess ethylene emission. Again, each line was grown in triplicate along with both isogenic parents. In addition to the selected lines additional lines from the collection that overlap the introgressed L. hirsutum segments were included in the analysis to better map the location of each QTL. Greenhouse data for the ripening lines is presented in Figure 4-6. Of the original lines selected, only those that had previously showed a statistically significant change in ripening (3935, 3958 and 3968) repeated a reduction that was again statistically significant. The other lines (3921, 3955 and 3964) were assayed again because they were close to making our cutoff of 0.05. The fact that these lines did not show a significant reduction in the following season strongly supports our confidence in the statistical analysis of the data from the first season. Interestingly line 3921 did not itself show a reduction in the second season but three overlapping lines 3922, 3923 and 3924 were found to be significantly lower than the control. Due to the labor intensive nature of measuring ripening time, only lines 3935, 3958 and 3968 will be further characterized. In order to gain a better understanding of the increase in ethylene emission, field grown fluit were harvested at four stages and ethylene emissions were measured. Figure 4-7 shows the complexity of the trait, with some lines being statistically higher at some stages and not at others. IL 3922 and two overlapping IEs had a higher level of ethylene emission during early ripening (i.e. breaker) but returned to WT levels by the red stage. IL 3935 and its overlapping lines were low early in ripening but statistically higher at the pink and red stages. In accordance with early studies, line 3945 had the highest ethylene emissions of any of the lines tested, with more than 2- fold higher rates at the pink stage. Additional lines overlapping 3945 had higher ethylene emission at each ripening stage tested. IL 3969 had higher emission rates at the breaker and pink stages but returned to WT levels by the red stage. The complex nature of this phenotype has made analysis more difficult. While we were principally interested in ethylene emissions in fruit we were interested to determine if the increases were limited to the fruit. Ethylene emissions of young leaves were assayed (Figure 4-8). No statistically significant differences were seen for any of the lines suggesting that the increases were confined to ripening fruit tissue. Interestingly the L. hirsutunt isogenic parent (1777) showed the lowest leaf ethylene emissions and this was confirmed by repeating this experiment. Due to the fact that many of the introgressed pieces were quite large, backcrosses were made to the isogenic L. esculentunt parent for all lines that repeated in the second season. All of the data displayed from the second season (Figures 4-6 and Figure 4-7) were collected and analyzed by Dr. Valeriano Dal Cin, a postdoctoral researcher in our lab. He has also isolated homozygous recombinants from the backcrosses performed during the second season and is currently analyzing the progeny of those recombinants. Due to our interest in receptor function we were intrigued to see that the IL that consistently emitted more ethylene (3945) contains a chromosomal segment that potentially encodes the L. hirsutunt ortholog of LeETR4. In order to determine which allele is present in 3945, the intron of this gene from the 3945 line was cloned and compared to both the L. esculentunt and L. hirsutunt sequences (Figure 4-9). The IL was confirmed to contain the L. hirsutunt allele. In order to understand whether this allele showed any differential expression I performed qRT-PCR on RNA collected from vegetative and reproductive tissues (Figure 4-10). While there are some differences at particular stages the basic trend of expression is similar between the control and IL. In addition to an analysis of developmental expression both parents and 3945 seedlings were exposed to ethylene in order to determine if the ethylene inducibility of the L. hirsutum allele was altered (Figure 4-11). No significant difference was observed between any of the genotypes. An additional time to ripening experiment showed no statistical difference between the L. esculentum parent and 3945. Subsequent marker analysis of the introgression region at 3945 found that both 3944 and 4005 overlap 3945 and all three have increased ethylene emission. This region of the introgressed segment is not the area that contains LhETR4. These additional data suggest that the L. hirsutum allele of LeETR4 is likely not the cause of the increased ethylene phenotype. Discussion Marker assisted breeding is an important technique used to address fundamental problems in plant biology and crop improvement. It is particularly important with the current public attitudes toward genetically modified organisms. Breeders are increasingly going to require the identification of markers that are linked to agronomically important traits. A close relationship between researchers and breeders will allow for efficient introduction of newly identified traits into existing varieties. While a number of different resources are available for mapping traits of interest in tomato, the development of introgression populations using different wild relatives has greatly enhanced this process. These populations facilitate sorting an entire genome down to a small, known segment that can be assayed for a particular phenotype. In addition, once the tomato genome sequencing proj ect is complete it will be relatively straightforward to screen a population and then search a particular genomic location for candidate genes. While a great deal of research has been done on the ethylene biosynthetic pathway the only proteins that have been identified that act to modulate this pathway are the ETO proteins. This modulation is accomplished by inhibiting activity of the ACS protein and targeting it for degradation via the 26S proteasome. Identification of additional regulators of ethylene synthesis will broaden our understanding of the factors affecting synthesis, whether they be positive or negative. We present here a strategy to identify QTLs that control ripening-associated ethylene production by screening L. hirsutum IEs. The choice of the L. hirsutum introgression population was originally made because of the unusual ability of this species to produce high levels of ethylene during ripening (Grumet et al., 1981). We have identified six introgression lines that produce significantly more ethylene during at least one stage of fruit ripening (Figures 4-3, 4-4 and 4-7). This increased ethylene emission is restricted to ripening fruit as no difference was seen in leaf ethylene biosynthesis rates in selected introgression lines (Figure 4-8). A significant amount of research surrounding fruit ripening has been completed in the past century but we still do not understand how fruits regulate ripening at the molecular level. In climacteric fruits it is clear that there are two important levels of regulation, developmental cues and ethylene synthesis. Work done on tomato in the past five years has begun to unravel this phenomenon at both levels with the identification of the RIN and NOR genes as well as the ethylene receptor family (Vrebalov et al., 2002; Kevany et al., 2007). While these findings are important steps, fruit development is a complex and there are likely many additional regulators of this process. Due to the unusual nature of ripening, or lack of ripening, in the wild tomato species L. hirsutum, we hypothesized it may allow for the identification of some additional factors regulating fruit development and specifically the onset of ripening. In addition to the ILs with increased ethylene emission our screen identified three lines that showed significantly reduced time from anthesis to breaker that was confirmed in two experiments (Figures 4-2 and 4- 6). Future work will involve finer mapping of the L. hirsutum QTLs. Backcrosses have been performed for each ripening and ethylene line and recombinants are being identified by a post- doctoral researcher in our lab. A library of cleaved amplified polymorphic sequence (CAPS) markers has been generated to precisely map each introgressed segment. Eventually these loci will be cloned by a map-based approach or by use of the tomato genome sequence and will increase our knowledge of both these processes. H Control( B 3945 30 - 25 - 20 - 15- 15 - 5- 3rd Exp~eriment 1 st Experiment 2nd Experim~ent Figure 4-1 Ethylene emissions of fully ripe fruit from L. hirsutum IL 3945. Red fruit were sealed in 500 mL jars for ~1 h and ethylene emission was measured by gas chromatography. Values represent mean +SE. *Statistically significant values p- value<0.05 based on Dunnett' s t test. 55 50 S45 40 35 O Figure 4-2 Days from anthesis to breaker of tagged fruits from L. hirsutum IEs. Open flowers were tagged at anthesis and the number of days to breaker were recorded. *Statistically significant values p-value<0.05 based on Student' s t test. IIIII I I I I I I I I I II III I 1 111111 11 I IIII I m(o N~~~ ~~~~~m~~~~Nm~~m N~~~~~~~~~ ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~000 NN~~Nmmmmmmbbbbb~~~~~~~~~~~~~000 mmmmommmmmmmomommmmmmommmmmmmom~~~ 30.0 S25.0 S20.0 E 15.0 5.0 13r Figure 4-3 Ethylene emissions of breaker fruit from L. hirsutum I~s. Breaker fruit were sealed in 500 mL jars for ~1 h and ethylene emission was measured by gas chromatography. *Statistically significant values p-value<0.05 based on Dunnett's t test. - .t~N~~m ~ ~m~~N~ ~ ~ ~ ~N m m~t t t~~~~~~~0 -~~~~~~~~~~~~~~~~0 -mmm m m m o m m m m m m m m m~ 40.0 E 35.0 r= 30.0 r=25.0 *u 20.0 E o 15.0 Figure 4-4 Ethylene emissions of fully ripe fruit from L. hirsutum ILs. Red fruit were sealed in 500 mL jars for ~1 h and ethylene emission was measured by gas chromatography. *Statistically significant values p-value<0.05 based on Dunnett' s t test. 1 2 3 4 5 - TG178 - TG590 - ETR4 STG153 - TG33 - ACS7A~B - CT140 TG353 LA3022(E) TG620 - TG564 - ACS8 - CT171 - TG379 - ACS4 - TG318 - ACS5 - CT118A STG59 - ACS2 STGB3 LA3034(E) LA3035(E+R) STG176 - ACS6 C T187A - CT265 - ACS1A~B - TG480 - TG180 LA3688(R) - CT211 SETR1 STG3BO LA3000(E) - TG296 - TG350 - TG252 SETR2 STG202 Figure 4-5 Genomic map showing locations of introgressed regions that contain putative ripening-associated QTLs. Black regions represent locations of QTLs controlling ripening phenotype. White regions represent locations of QTLs controlling increased ethylene emission phenotype. Dark grey regions represent portions of introgressed pieces that are ambiguous based on original mapping done with population. Map also contains locations of all known ethylene receptors and ACC synthase isoforms. LA3045(E) STG164 S- TG292 SLA4005(E) LA3844(E) -TG557 - ETR5 - TG651 LA3058(R) - TG286 -TG390 SETR6 - CT198 LA3058(R) - CT112 LA3845(E) STG241 - TG233 45- 40- a1 35- 30- 25- Figure 4-6 CT 3921 3922 3923 3924 3934 3935 3936 3937 3955 3958 396 968 Days from anthesis to breaker of tagged fruits from L. hirsutum IEs. Open flowers were tagged at anthesis and the number of days to breaker were recorded. *Statistically significant values p-value<0.05 based on Student's t test. CT, control. -a Control -a- 3944 -a-3945 -- 3946 --4005 -* Control -= 3969 Green Breaker Pink Red 30 S25 20 :15 30 S25 20 15 -*-Contro -e 3934 - 3935 -c 3937 Green Breaker Pink Red Figure 4-7 Ethylene emissions of fruits from field-grown L. hirsutum ILs. Fruit at indicated stages were sealed in 500 mL for ~1 h and ethylene emission was measured by gas chromatography. Breaker, first external signs of ripening; pink, ~70% color development. E~3.5- S3.0- 2.0- 0.5- Figure 4-8 CT 3921 3922 3923 3924 3934 3935 3936 3937 3944 3945 3946 3955 3958 3964 3968 4005 1777 Ethylene emissions of leaves from L. hirsutum IEs. Young leaves were harvested and immediately placed in 5 mL plastic tubes, but were left uncapped for ~1/2 h to permit release of wound-induced ethylene. After sealing, tubes were left for ~ 3 h and then ethylene emission was analyzed by gas chromatography. CT, control. L.esoulentum IL3945 L.hirsutum L.esoulentum IL3945 L.hirsutum L.esoulentum IL3945 L.hirsutum L.esoulentum IL3945 L.hirsutum L.esculentum IL3945 L.hirsutum L.esoulentum IL3945 L.hirsutum L.esculentum IL3945 L.hirsutum L.esoulentum IL3945 L.hirsutum L.esculentum IL3945 L.hirsutum L.esoulentum IL3945 L.hirsutum L.esoulentum IL3945 L.hirsutum L.esoulentum IL3945 L.hirsutum L.esculentum IL3945 L.hirsutum L.esoulentum IL3945 L.hirsutum L.esculentum IL3945 L.hirsutum Figure 4-9 ~ 899 F.bJ.bib 899 e.Y.;iY NTucleotide alignment of ETR4 genomic sequence. Sequence isolated from L. esculentum, L. hirsutum and IL 3945. Alignment was done using ClustalW and presented using Shade Box software. ~i~i~mf~ ~i~E~m~s~ ~l~f3~W"I~E~S~ ~S~S~ ~,~i~Siiii~ii~i~i~~ ~I~Si~Tii~~ ~S~iffS~i~SiiJi~i~ ~5iZl~tS~S~S~ ~j~i;il~Sj~j~~ ~5i~.~ii~~ ~S~l~i~Si~J~ Eii~IJi~i~ F~i~E~ I~iii~E~E~i~ SControl a LA3945 1.2 S0.8- 2 0.4- E0.2- Le Figure 4-10 Red MG Breaker Tuming mRNA expression of LeETR4 in WT and the L. hirsutum IL 3945. qRT-PCR analysis of transcript levels in leaf and reproductive tissues. Values represent mean +SE and presented as % of total RNA. af Bud Flowner 10 Day 20 Day 30 Day Ig Control n 10ppm Ethylene ,c 1.8 O 1.6- ~1 .4- 1 <( 0.4- ce 0.2- Figure 4-11 I L. eisculentum 3945 L. hAirsutum mRNA expression of LeETR4 in seedlings of WT, L. hirsutum and IL 3945. qRT- PCR analysis of transcript levels in leaf tissue treated with 10ppm ethylene. Values represent mean +SE and presented as % of total RNA. CHAPTER 5 CONCLUSION The solanaceous species Lycopersicon esculentum, tomato, has emerged as the model for studying fleshy fruit development. Because tomato is a climacteric species it is also the species of choice for studying ethylene's involvement in fruit development. Ethylene is essential for normal fruit ripening in these species and blockage of either ethylene production or perception leads to improper ripening. In tomato fruits, ethylene has profoundly different effects depending on the stage of development with a distinct developmental switch that occurs upon fruit maturation. Treatment of mature fruits results in the initiation of a ripening program. While treatment of immature fruits does not initiate ripening, it does significantly hasten the onset of subsequent ripening (Yang, 1987). Our understanding of how fruits measure this ethylene exposure has not been previously determined. The primary obj ective of this proj ect was to identify the mechanism controlling this phenomenon and to gain a better understanding of the factors that control ripening in general. Previous work in our lab showed that reduced accumulation of a single receptor, LeETR4, resulted in fruits that ripen significantly earlier than control fruits (Tieman et al., 2000). In this study LeETR6 reduced expression lines exhibited similar effects to those of LeETR4 (Table 2-1; Kevany et al., 2007). While these results are consistent with the model that the receptors act as negative regulators of ethylene signaling, they do not address the question of how fruits measure cumulative ethylene exposure. Analysis of receptor mRNA expression during fruit development indicated a significant increase in receptor mRNAs at the onset of ripening coincident with the increase in ethylene biosynthesis (Figure 2-1, Figure 2-2). Contrary to the mRNA expression data, protein blot analysis of NR, ETR4 and ETR6 showed receptor protein levels highest in immature fruit with a significant decrease at the onset of ripening (Figure 2-4). While these data are contradictory to the mRNA expression data, they are consistent with a model in which ethylene binding affects receptor protein stability. In an attempt to validate this hypothesis, we exposed fruit and vegetative tissues to ethylene and observed that receptor proteins are rapidly degraded in response to ethylene and that this likely occurs through the 26S proteasome- dependent pathway (Figure 2-5, Figure 2-6). While ligand binding-induced degradation of receptors has been described in mammalian and yeast systems, this work is the first example in plants. These results led to a hypothesis that reduced levels of receptor proteins, due to ethylene exposure, control the early ripening in ethylene treated immature fruit. To test this hypothesis, we treated immature fruits, while still attached to the plant, with ethylene and measured protein levels throughout fruit development. Treated fruits had reduced receptor protein levels after ethylene treatment and these fruits ripened earlier than untreated controls (Table 2-2, Figure 2-7). Together these data are consistent with our model that ethylene exposure leads to a degradation of receptor proteins and that ethylene receptor levels modulate the timing of ripening. While reduction of receptor levels results in early ripening fruit, systemic reduction also causes severe developmental effects that would prevent the use of this method for crop improvement (Figure 2-3). A technique to reduce the time from fruit set to the onset of ripening could allow for an increase in the number of varieties available to farmers in higher latitudes. To generate early ripening lines, we developed a fruit-specific RNAi construct to reduce LeETR4 levels only in the fruit. Fruit-specific suppression of LeETR4 resulted in fruits that ripened up to 7 days early (Figure 3-1). While early ripening fruit would be advantageous they must also retain the same quality as traditional varieties. To test fruit quality I measured average fruit size, yield, soluble solids, malic and citric acid content as well as the most important tomato flavor volatile organic compounds. There was little or no difference between transgenic and control fruits. In addition to providing a unique method of crop improvement these data also validate our model that receptor levels in the fruit control the timing of ripening. While biotechnology has provided us with many tools for gene discovery and crop improvement, current public concerns have limited the marketing of transgenic foods. In an effort to identify additional factors that regulate the timing of ripening we undertook a genetic approach. A screen of a L. hirsutum introgression population was conducted because of the unusual ripening characteristics and high ethylene biosynthesis levels of this species. Individual lines were screened for reduced time from anthesis to breaker and for increased ripening- associated ethylene synthesis. Three lines with a reduction of time to breaker were identified and the results were repeatable across seasons. Seven lines that had increased ethylene emissions at the breaker or red stages were identified. Due to the large segments of the L. hirsutum genome that are found in these lines they had to be backcrossed to the L. esculentum parent to better map the loci controlling ethylene emissions. Recombinants that may provide material for a map-based cloning approach for gene discovery have been identified. The work presented here has significantly increased our understanding of how ethylene regulates ripening in climacteric fruits. While ethylene is not required for the ripening of non- climacteric fruits, it can have significant effects on fruit development in these species. Ethylene can cause damage to the fruits of many different species and our understanding of receptor function could greatly enhance our ability to limit these losses. Ethylene-related losses in underdeveloped countries often account for a significant proportion of the postharvest losses and are an opportunity for our research to have a serious impact. CHAPTER 6 MATERIALS AND METHODS Plant Materials and Growth Conditions L. hirsutunt cy. Flora-Dade, LeETR4-AS, LeETR6-AS and TFM7-ETR4-RNAi lines were grown in a greenhouse set at approximately 27oC. Individual plants were grown in 3 gal pots that were watered twice a day and supplemented with slow release fertilizer. Time to ripening data was collected by tagging open flowers and recording the number of days from anthesis to breaker. L. hirsutunt cy. Micro-Tom and Nr plants were grown in a growth chamber under standard conditions (16 h day/8 h night). Field plants were grown in randomized, replicated plots in Live Oak, FL. Plants were grown using standard commercial practices in raised plastic mulched beds. Development of Transgenic Plants LeETR4-AS and LeETR6-AS lines were generated by cloning the full-length LeETR4 or LeETR6 coding region into a vector in the antisense orientation under the control of the Figwort Mosaic Virus 35S promoter (Richins et al., 1987) and followed by the Agrobacteriunt tunrefaciens nopaline synthase (nos) 3' terminator. The transgene was introduced into cy. Flora- Dade by the method of McCormick et al. (1986), with kanamycin resistance as a selectable marker. Transgenic lines with a reduction of >70% ofLeETR6 transcript were identified (Table 1). The specificity of the transgene was determined by quantification of every receptor mRNA from leaf tissue. In each case there was no effect on RNA levels of any other receptor. LeETR4 fruit-specific RNAi lines were generated using method outlined by Dexter et al. (2006). Briefly, two overlapping fragments of coding region were PCR amplified from tomato fruit cDNAs, one 400 bp and 200 bp in length, primer sequences found in Table 6-1. The two PCR products were ligated end to end and subsequently ligated into an EcoRI site in the pMON999 vector that contained the TFM7 fruit specific promoter. The cassette containing the promoter, RNAi fragment and nos terminator were excised from the vector and ligated into the pHK plant expression vector. The transgene was introduced into cy. Flora-Dade by Agrobacterium-mediated transformation according to McCormick et al. (1986), with kanamyacin resistance as a selectable marker. Pharmacological Treatments Ethylene treatments of plant material were done in sealed 38 L tanks. Treatments were performed using either 10 or 50 ppm, as indicated, concentrations in tanks was monitored by gas chromatography. These levels are both within the linear response range for NR and LeETR4 ethylene inducibility (Ciardi et al. 2000). Proteasome inhibitor studies were performed by spraying seedlings with an 80 CIM MGl32 solution (8% DMSO) 4 h prior to 2 h ethylene treatment. Control seedlings were sprayed with an 8% DMSO solution. 1-MCP treatment of seedlings was performed at 1 ppm in a sealed 38 L tank for 16 h prior to 2 h ethylene treatment. Control seedlings were sealed in identical tanks for the same duration of time. All microsomal membrane preparations were performed immediately after treatment ended. Recombinant Protein Expression and Antibody Production Coding regions ofLeETR4 (a.a. 532-684) and LeETR6 (a.a. 522-688) were amplified with primer pairs ETR4-PF, ETR4-PR, ETR6-PF and ETR6-FR (Table 6-1) from fruit cDNAs generated with the Clontech One-step cDNA Synthesis kit. PCR products were digested with BamHI and BglII and cloned into the Invitrogen pTrcXHisA vector and subsequently transformed into the BL21(DE3) (Invitrogen) E. coli strain for recombinant protein expression. 100 mL cultures were grown at 30oC and induced with 1 mM IPTG for 4 h. Cells were spun down at 8,000 x g, resuspended in 10mL of lysis buffer (8 M urea) and pulse sonicated for 1 min. Lysate was spun down at 8,000 x g and supernatant was purified with Ni-NTA affinity column as directed. Recombinant protein was submitted to Cocalico Biologicals (Reamstown, PA) for antibody production in rabbits using their standard protocol. Antiserum was received and used to probe both antigens to determine antiserum specificity for its respective antigen. RNA Expression Analysis Total RNA extractions were performed using the Qiagen RNeasy Mini Kit with subsequent DNase treatment to remove any contaminating DNA. RNA was quantified by spectroscopy and visually analyzed on ethidium bromide-stained gels to assure equal concentrations of all RNAs. Quantitative RT-PCR assays were performed using the Applied Biosystems Taqman One-step RT-PCR kit in an Applied Biosystems GeneAmp 5700 Sequence Detection System as described (Tieman et al. 2001). PCR conditions were as follows, Step 1: 48oC for 30 min, Step 2: 95oC for 10 min and Step 3: 95oC 15 sec and 60oC for 1 min (40X). Primer and probe pairs for each gene assayed can be found in Table 6-1. Levels ofLeETR RNAs were quantified using RNAs synthesized by in vitro transcription from plasmids containing the coding region of each gene using a Maxiscript in vitro transcription kit (Ambion, Austin TX USA). Total Clg of in vitro-transcribed RNA were determined and the in vitro transcription product used for a standard curve in real-time RT-PCR analysis. Results are reported as % LeETR RNA in total RNA. Microsomal Membrane Isolation and Protein Blot Analysis Microsomal membrane fractions were isolated from fruit or seedlings with a homogenization buffer containing 30 mM Tris (pH 8.2), 150 mM NaC1, 10 mM EDTA, and 20% (v/v) glycerol with protease inhibitors (1 mM PMSF, 10 Clg/mL aprotinin, 1 Clg/mL leupeptin, and 1 Clg/mL chymostatin) as described (Schaller et al., 1995). Tissue was homogenized at 4oC using a polytron and then centrifuged at 8,500 x g for 15 min at 4oC. The supernatant was strained through cheesecloth then centrifuged at 100,000 x g for 30 min at 4oC and the subsequent membrane pellet was resuspended in 10 mM Tris (pH 7.5), 5 mM EDTA, and 10% (w/w) sucrose with protease inhibitors and stored at -80 oC. Protein concentrations were determined using the Bio-Rad Protein Assay reagent with BSA used for a standard curve. 20 Clg of total protein was run out for each sample on a 12% Tris-HCI gel and proteins were transferred to a nitrocellulose membrane using the Bio-Rad Mini Trans-Blot cell. Membranes were blocked overnight in 10% Carnation milk/Tris Buffered Saline-Tween (TBST) at 4oC. Membranes were washed 2x5 min in TBST and then incubated with primary anti-ETR4 (1:2000) or anti-ETR6 (1:5000) antibody diluted in 5% Carnation milk/TBST for 1 h. Membranes were subsequently washed 3x10 min in TBST and then incubated with peroxidase conjugated goat anti-rabbit (1:5000) secondary antibody (Kirkegaard & Perry Laboratories, Gaithersburg, Maryland) diluted in 5% Carnation milk/TB ST for 45 min. Membranes were finally washed 3x10 min in TB ST. Visualization of signal was performed using the Amersham ECL Detection reagents before being exposed to film. Quantification of bands was accomplished by using the NCBI imaging software ImageJ (http://rsb .info.nih.gov/ij/). Values were normalized to an anti-BiP endoplasmicc reticulum immunoglobulin binding protein) antibody (generously provided by Alan Bennett, Univ. of California, Davis) which was used as an ER-localized loading control. Acid and Soluble Solids Analysis Individual tomato fruit were homogenized in a blender for 30 s and frozen at -80 OC until acid analysis. Samples were thawed, centrifuged at 16 000 g for 5 min. The supernatant was analyzed for citric and malic acid content using citric acid and malic acid analysis kits (R- Biopharm, Marshall, MI) according to the manufacturer's instructions. Soluble solids are expressed as oBrix which is a measurement of the mass ratio of dissolved sucrose to water in a liquid. Individual fruit were homogenized in a blender for 30 s. 1 mL of the homogenate was centrifuged at 16,000 x g for 2 min. ~75 uL of supernatant was applied to a handheld refractometer. Volatile Analysis Ripe tomato fruit from each line and its corresponding control collected from the field were harvested and volatiles from pooled fruits were collected on the day after harvest. Fruits collected from plants grown in the greenhouse were analyzed for fruit volatiles immediately after harvest. Tomato fruit volatiles were collected from chopped fruit with nonyl acetate as an internal standard as described by Schmelz et al. (2003). Chopped fruit was enclosed in glass tubes, air filtered through a hydrocarbon trap (Agilent, Palo Alto, CA) flowed through the tubes for 1 h with collection of the volatile compounds on a Super Q column. Volatiles collected on the Super Q column were eluted with methylene chloride after the addition of nonyl acetate as an internal standard. Volatiles were separated on an Agilent (Palo Alto, CA) DB-5 column and analysed on an Agilent 6890N gas chromatograph with retention times compared to known standards (Sigma Aldrich, St Louis, MO). Volatile levels were calculated as ng gl FW hl collection. Identities of volatile peaks were confirmed by GCMS as described by Schmelz et al. (2001). Table 6-1 Oligonucleotide Primers and Probes ETR4-PF ETR4-PR ETR6-PF ETR6-PR ETR4-RNAi-F 1 ETR4-RNAi-R1 ETR4-RNAi-F2 ETR4-RNAi-R2 ETR1-TaqF ETR1-TaqR ETR1-Probe ETR2-TaqF ETR2-TaqR ETR2-Probe NR-TaqF NR-TaqR NR-Probe ETR4-TaqF ETR4-TaqR ETR4-Probe ETR5-TaqF ETR5-TaqR ETR5-Probe ETR6-TaqF ETR6-TaqR ETR6-Probe CCGGATCCCGTGATAACGCCTATATCAGG CCAGATCTGACGATTTGGAATGAGGATAC CCGGATCCCCGAGATCAAACTCATCCAATG CCAGATCTGCCATCTAAATCAGGCAGATG GGAGATCTGGCATTCCTGAATATGGGG CCGGCGCGCCGAGGATACAGCAGGGCTAAG CCGGATCCGGCATTCCTGAATATGGGG GGGGCGCGCCCATCATTCTACTTCCCCGTAGC TTCAAGGATTAAAGGTHTTGGTGAT ATCACATCCAAGGTGTGTAAGCA FAM-ATGAGAATGGTGTTAGCAGGATGGTAACCAAA- BHQ GCCGTCAGTGTACATGAGAAATTT AGTTTTCTTTTGTCACTTGGTCAGTGT FAM-AGAGGC CACTTATTGTGGCACTAACTGGG-BHQ AGGGAACCACTGTCACGTTTG CTCTGGGAGGCATAGGTAGCA FAM-AGTGAAACTCGGAATCTGTCACCATCCAA-BHQ GGTAATCCCAAATCCAGAAGGTTT CAATTGATGGCCGCAGTTG FAM-AAAGCATGGCTGTCGTTCTTGGGCT-BHQ AGTCATCTTHTAGGAAACGCATGTT AGGAGTACATGAAGGCCTCTGAA FAM-AATACAGAAATCCTTTGGAGCAACCG-BHQ ATTCCAAAGGCAGCCGTTAA GGATGTGGATATGTGGGATTAGAAG FAM-CTCCACATAHTCGGACATGCCTAAGGGA-TAMRA BamHI BglII BamHI BglII BglII AscI BamHI AscI * Nucleotides in bold face represent restriction sites LIST OF REFERENCES Abeles, F.B., Morgan, P.W. and Saltveit, M.E. (1992) Ethylene in Planzt Biology, Ed 2. Academic Press, San Diego. Adams, D.O. and Yang, S.F. (1979) Ethylene biosynthesis: Identification of 1- aminocyclopropane-1 -carboxylic acid as an intermediate in the conversion of methionine to ethylene. PNAS, 76, 170-174. Alba R., Payton P., Fei Z., McQuinn R., Debbie P., Martin G.B., Tanksley S.D. and Giovannoni J.J. (2005) Transcriptome and selected metabolite analyses reveal multiple points of ethylene control during tomato fruit development. Plant Cell, 17, 2954-2965. Alonso, J.M., Hirayama, T., Roman, G., Nourizadeh, S. and Ecker, J.R. (1999) EIN2, a bifunctional transducer of ethylene and stress responses in Arabidopsis. Science, 284, 2148-2152. Azevedo, C., Santo-Rosa, M.J. and Shirasu, K. (2001) The U-Box protein family in plants. Trends Planzt Sci. 6, 3 54-3 58. Barry, C.S., Llop-Tous, M.I. and Grierson, D. (2000) The regulation of 1 -aminocyclopropane- 1-carboxylic acid synthase gene expression during the transition from System-1 and System-2 ethylene synthesis in tomato. PlanztPhys. 123, 979-986. Berrocal-Lobo, M., Molina, A., and Solano, R. (2002) Constitutive expression of ETHYLENE-RESPONSIVE-FACTOR1 in Arabidopsis confers resistance to several necrotrophic fungi. Plant J. 29, 23-32. Binder, B.M., Walker, J.M., Gagne, J.M., Emborg, T.J., Hemmann, G., Bleecker, A.B., Vierstra, R.D. (2007) The Arabidopsis EINT3 binding F-Box proteins EBF1 and EBF2 have distinct but overlapping roles in ethylene signaling. Plant Cell, 19, 509-523. Bleecker, A.B., Estelle, M., Somerville, C. and Kende, H. (1988) Insensitivity to ethylene conferred by a dominant mutation in Arabidopsis thaliana. Science, 241, 1086-1089. Blilou, I., Fruigier, F., Folmer, S., Serralbo, O., Willemsen, V., et al. (2002) The Arabidopsis HOBBIT gene encodes a CDC27 homolog that links the plant cell cycle to progression of cell differentiation. Genes Dev. 16, 2566-2575. Boiler, T. (1991). Ethylene in pathogenesis and disease resistance. In: Mattoo AK, Suttle, JC, eds. The plant hormone ethylene. Boca Raton, FL: CRC Press: 293-3 14. Burg S.P. and Burg E.A. (1962) Role of ethylene in fruit ripening. Plant Phys. 37, 179-189. Burg. S.P. (1962) The physiology of ethylene formation. Ann. Rev. Plant Phys. 13, 265-302. Burg S.P. and Clagett, C.O. (1967) Conversion of methionine to ethylene in vegetative tissue and fruits. Biochens. Biophys. Res. Conan. 27, 125-130. Buttery, R.G. Quantitative and sensory aspects of flavour of tomato and other vegetables and fruits. In: Acree TE, Teranishsi R, eds. Flavor science: sensible principles and techniques. Washington, DC: American Chemical Society, 259-286 (1993). Buttery, R.G. and Ling, L.C. (1993) Volatile components of tomato fruit and plant parts: relationship and biogenesis. ACS Synaposiunt Series 525, 23-34. Cancel, J.D. & Larsen, P.B. (2002) Loss-of-function mutations in the ethylene receptor ETR1 cause enhanced sensitivity and exaggerated response to ethylene in Arabidopsis. Plant Physiol. 129, 1557-1567. Capron, A., Okresz, L., and Genschik, P. (2003) First glance at the plant ACP/C, a highly conserved ubiquitin-protein ligase. Trends Planzt Sci. 8, 83-89. Carvalho, P., Goder, V. and Rapoport, T.A. (2006) Distinct ubiquitin-ligase complexes define convergent pathways for the degradation of ER proteins. Cell, 126,361-373. Chang, C., Kwok, S.F., Bleecker, A.B. and Meyerowitz, E.M. (1993) Arabidopsis ethylene- responsive gene ETR1: similarity of products to two-component regulators. Science, 262, 539-544. Chao, Q., Rothenberg, M., Solano, R., Roman, G., Terzaghi, W. and Ecker, J.R. (1997) Activation of the ethylene gas response pathway in Arabidopsis by the nuclear protein ETHYLENE-INSENSITIVE3 and related proteins. Cell, 89, 1133-1144. Chen, Y.F., Randlett, M.D., Findell, J.L. and Schaller, G.E. (2002) Localization of the ethylene receptor ETR1 to the endoplasmic reticulum of Arabidopsis. J. Biol. Chent. 277, 19861-19866. Ciardi, J.A., Tieman, D.M., Lund, S.T., Jones, J.B., Stall, R.E. and Klee, H.J. (2000) Response to Xanthonzona~s canspestris py. Vesicatoria in tomato involves regulation of ethylene receptor gene expression. PlanztPhys. 123, 81-92. Clark, D.G., Gubrium, E.K., Barrett, J.E., Nell, T.A. and Klee, H.J. (1999) Root formation in ethylene insensitive plants. Plant Physiol. 121, 53-60. Clark, K.L., Larsen, P.B., Xiaoxia, W. and Chang, C. (1998) Association of the Arabidopsis CTR1 Raf-like kinase with the ETR1 and ERS ethylene receptors. PNAS, 95, 5401-5406. Dharmasiri, N., Dharmasiri, S. and Estelle, M. (2005) The F-box protein TIR1 is an auxin receptor. Nature, 435, 441-445. Davuluri, G.R., van Tuinen, A., Fraser, P.D., Manfredonia, A., Newman, R., Burgess, D., Brummell, D.A., King, S.R., Palys, J., Uhlig, J., Bramley, P.M., Pennings, H.M. and Bowler, C. (2005) Fruit-specific RNAi-mediated suppression ofDET1 enhances carotenoid and flavonoid content in tomatoes. Nat. Biotechnol. 23, 890-895. Deveaux, Y., Peaucelle, A., Roberts, G.R., Coen, E., Simon, R., Mizukami, Y., Traas, J., Murray, J.A., Doonan, J.H. and Laufs, P. (2003) The ethanol switch: a tool for tissue- specific gene induction during plant development. Plant J. 36, 918-930. Dexter, R., Qualley, A., Kish, C.M., Ma, C.J., Koeduka, T., Nagegowda, D.A., Duderava, N., Pichersky, E. and Clark, D. (2007) Characterization of a petunia acetyltransferase involved in the biosynthesis of the floral volatile isoeugenol. Plant J. 49, 265-275. Dharmasiri, N., Dharmasiri, S. & Estelle, M. (2005) The F-box protein TIR1 is an auxin receptor. Nature 435, 441-445. Dill, A., Thomas, S.G., Hu, J., Steber, C.M. and Sun, T. (2004) The Arabidopsis F-Box protein SLEEPY1 targets gibberellin signaling repressors for gibberellin-induced degradation. Plant Cell, 16, 1392-1405. Doganlar, S. Tanksley, S.D. and Mutschler, M.A. (2000) Identification and molecular mapping of loci controlling fruit ripening time in tomato. Theor. Appl. Genet. 100, 249-255. Downes, B.P., Stupar, R.M., Gingerich, D.J. and Vierstra, R.D. (2003) The HECT ubiquitin- protein ligase (UPL) family in Arabidopsis: UPL3 has a specific role in trichome development. Plant J. 35, 729-742. Dutta, R., Qin, L. and Inouye, M. (1999) Histidine kinases: diversity of domain organization. Mol. M~icro. 34, 633-640. Farras, R., Ferrando, A., Jasik, J., Kleinow, T., Okresz, L. et al. (2001) SKPl-SnRK protein kinase interactions mediate proteasome binding of a plant SCF ubiquitin ligase. EM~BO J. 20, 2742-2756. Flores-Morales, A., Greenhalgh, C., Norstedt, G. & Rico-Bautista, E. (2006) Negative regulation of growth hormone receptor signaling. M~olec. Endocrinology, 20, 241-253. Frary, A., Doganlar, S., Frampton, A., Fulton, T., Uhlig, J., Yates, H. and Tanksley, S. (2003) Fine mapping of quantitative trait loci for improved fruit characteristics from Lycopersicon chmielewski chromosome 1. Genome, 46, 23 5-243. Fridman, E., Carrari, F., Liu, Y.S., Fernie, A.R. and Zamir, D. (2004) Zooming in on a quantitative trait for tomato yield using interspecific introgressions. Science, 305, 1786-1789. Fridman, E., Liu, Y.S., Carmel-Goren, L., Gur, A., Shoresh, M., Pleban, T., Eshed, Y. and Zamir, D. (2002) Two tightly linked QTLs modify tomato sugar content via different physiological pathways. Mol1. Genet. Genomics, 266, 821-826. Gagne, J.M., Smalle, J., Gingerich, D.J., Walker, J.M., Yoo, S.D., Yanagisawa, S. and Vierstra, R.D. (2004) Arabidopsis EIN3-binding F-box 1 and 2 form ubiquitin-protein ligases that repress ethylene action and promote growth by directing EINT3 degradation. PNAS, 101, 6803-6808. Gamble, R., Coonfield, M. and Schaller, G.E. (1998) Histidine kinase activity of the ETR1 ethylene receptor from Arabidopsis. PNAS, 95, 7825-7829. Gamble, R., Qu, X. and Schaller, G.E. (2002) Mutational analysis of the ethylene receptor ETR1. Role of the histidine kinase domain in dominant ethylene insensitivity. Plant Phys. 128, 1428-1439. Gao, Z., Chen, Y.F., Randlett, M.D., Zhao, X.C., Findell, J.L., Kieber, J.J. and Schaller, G.E. (2003) Localization of the Raf-like kinase CTR1 to the endoplasmic reticulum of Arabidopsis through participation in ethylene receptor signaling complexes. J. Bio. Chem. 278, 34725-34732. Garoosi, G.A., Salter, M.G., Caddick, M.X. and Tomsett, A.B. (2005) Characterization of the ethanol-inducible alc gene expression system in tomato. J. Ex. Botan, 56, 1635-1642. Giovannoni, J. (2001) Molecular biology of fruit maturation and ripening. Annu. Rev. Plant Phys, 52, 725-749. Glotzer, M., Murray, A.W. and Kirschner, M.W. (1991) Cyclin is degraded by the ubiquitin pathway. Nature, 349, 132-138. Govers, R., ten Broeke, T., van Kerkhof, P., Schwartz, A.L. & Strous G.J. (1999) Identification of a novel ubiquitin conjugation motif, required for ligand-induced internalization of the growth hormone receptor. EM~BO J. 18, 28-36. Grumet, R., Fobes, J.F. and Herner, R.C. (1981) Ripening behavior of wild tomato species. Plant Phys. 68, 1428-1432. Guo, H. and Ecker, J. (2003) Plant responses to ethylene gas are mediated by SCFEBFl/EBF2 dependent proteolysis of EIN3 transcription factor. Cell, 115, 667-677. Guzman, P. and Ecker, J. (1990) Exploiting the triple response of Arabidopsis to identify ethylene-related mutants. Plant Cell, 2, 513-523. Hamilton, A.J. Lycett, G.W., Grierson, D. (1990) Antisense gene that inhibits synthesis of the hormone ethylene in transgenic plants. Nature, 346, 284-287. Hatfield, P.M., Gosink, M.M., Carpenter, T.B. and Vierstra, R.D. (1997) The ubiquitin- activating enzyme (El) gene family in Arabidopsis thaliana. Plant J. 11, 213-226. Hochstrasser, M. (1996) Ubiquitin-dependent protein degradation. Annu. Rev. Gen. 30, 405-439. Hua, J. and Meyerowitz, E.M. (1998) Ethylene responses are negatively regulated by a receptor gene family in Arabidopsis thaliana. Cell. 94,261-271. Huang, Y., Li, H., Hutchinson, C.E., Laskey, J. and Kieber, J.J. (2003) Biochemical and functional analysis of CTR1, a protein kinase that negatively regulates ethylene signaling in Arabidopsis. Plant J. 33, 221-233. Jabben, M., Shanklin, J. and Vierstra, R.D. (1989) Red light-induced accumulation of ubiquitin-phytochrome conjugates in both monocots and dicots. Plant Physiol. 90, 380-384. Kepinski, S. & Leyser, O. (2005) The Arabidopsis F-box protein TIR1 is an auxin receptor. Nature, 435, 446-451. Kevany, B.M., Tieman, D.M., Taylor, M.G., Dal Cin, V. and Klee, H.J. (2007) Ethylene receptor degradation controls the timing of ripening in tomato fruit. Plant J. 51, 458-467. Klee, H.J. (2002) Control of ethylene-mediated processes in tomato at the level of receptors. J. Ex. Botan. 53, 2057-2063. Klee, H.J. (2004) Ethylene signal transduction. Moving beyond Arabidopsis. Plant Phys. 135, 660-667. Klee, H.J., Hayfor, M.B., Kretzmer, KA., Barry, G.F. & Kishmore G.M. (1991) Control of ethylene synthesis by expression of a bacterial enzyme in transgenic tomato plants. Plant Cell, 3, 1187-1193. Koo, J.C., Asurmendi, S., Bick J., Woodford-Thomas, T. and Beachy R.N. (2004) Ecdysone agonist-inducible expression of a coat protein gene from tobacco mosaic virus confers viral resistance in transgenic Arabidopsis. Plant J. 37, 439-448. Kosarev, P., Mayer, K.F. and Hardtke, C.S. (2002) Evaluation and Classification of RING- finger domains encoded by the Arabidopsis genome. Genome Biol. 3, 1-12. Lashbrook, C.C., Tieman, D.M. and Klee, H.J. (1998) Differential regulation of the tomato ETR gene family throughout plant development. Plant J. 15, 243-252. Li, T., Santockyte, R., Shen, R.F., Tekle, E., Wang, G., Yang, D.C. and Chock, P.B. (2006) A general approach for investigating enzymatic pathways and substrates for ubiquitin-like modifiers. Arch. Biochem. Biophys. 453, 70-74. Lieberman, M., Kunishi, A., Mapson L.W. and Wardale, D.A. (1966) Stimulation of ethylene production in apple tissue slices by methionine. Plant Phys. 41, 376-3 82. Lincoln, J.E., Cordes, S., Read, E. and Fischer, R.L. (1987) Regulation of gene expression by ethylene during Lycopersicon esculentum (tomato) fruit development. PNAS, 84, 2793-2797. Lyons, J.M. and Pratt, H.K. (1964) Effect of stage of maturity and ethylene treatment on respiration and ripening of tomato fruits. Proc. Amer. Soc. Hort. Sci. 84, 491-500. Ma, B., Cui, M.L., Sun, H.J., Takada, K~, Mori, H., Kamada, H. and Ezura, H. (2006) Subcellular localization and membrane topology of the melon ethylene receptor CmERS1i. Plan2tPhys. 141, 587-597. McCormick, S., Neidermeyer, J., Fry, J., Barnason, A., Horsch, R. and Fraley, R. (1986) Leaf disc transformation of cultivated tomato (L. esculentum) using Agrobacterium tumefaciens. Plant Cell Rep. 5, 81-84. McGlasson, W.B., Dostal, H.C. and Tigehelaar, E.C. (1975) Comparison of propylene- induced responses of immature fruit of normal and rin mutant tomatoes. Plant Phys. 55, 218-222. Meusser, B., Hirsch, C., Jarosch, E. & Sommer, T. (2005) ERAD: the long road to destruction. Nature Cell Bio. 7, 766-772. Monforte, A.J. and Tanksley, S.D. (2000) Development of a set of near isogenic and backcross recombinant inbred lines containing most of the Lycopersicon hirsutum genome in a L. esculentum genetic background: A tool for gene mapping and gene discovery. Genome, 43, 803-813. Moussatche, P. and Klee, H.J. (2004) Autophosphorylation activity of the Arabidopsis ethylene receptor multigene family. J. Biol. Chem. 279, 48734-48741. Meusser, B., Hirsch, C., Jarosch, E. and Sommer, T. (2005) ERAD: the long road to destruction. Nat. CellBiol. 7, 766-772. Nakatsuka, A., Murachi, S., Okunishi, H., Shiomi, S., Nakano, R., Kubo, Y. and Inaba, Y. (1998) Differential expression and internal feedback regulation of 1 -aminocyclopropane- 1- carboxylate synthase, 1 -aminocyclopropane-1l-carboxylate oxidase, and ethylene receptor genes in tomato fruit during development and ripening. Plant Phys. 118, 1295-1305. O'Donnell, P.J., Calvert, C., Atzorn, R., Wasternack, C., Leyser, H.M.O. and Bowles, D.J. (1996) Ethylene as a signal mediating the wound response of tomato plants. Science, 274, 1914-1917. Oeller, P.W., Lu, M.W., Taylor, L.P., Pike, D.A. & Theologis, A. (1991) Reversible inhibition of tomato fruit senescence by antisense RNA. Science, 254, 437-439. O,Malley, R.C., Rodriguez, F.I., Esch, J.J., Binder, B.M., O'Donnell, P., Klee, H.J. and Bleecker, A.B. (2005) Ethylene-binding activity, gene expression levels, and receptor system output for ethylene receptor family members from Arabidopsis and tomato. Plant J. 41, 651-659. Pickart, C.M. (2001) Mechanisms underlying ubiquitination. Annu. Rev. Biochem. 70, 503-533. Potuschak, T., Lechner, E., Parmentier, Y., Yanagisawa, S., Grava, S., Koncz, C. and Gensheik, C. (2003) EINT3-dependent regulation of plant ethylene hormone signaling by two Arabidopsis F box proteins: EBF 1 and EBF2. Cell, 115, 679-689. Qu, X. and Schaller, G.E. (2004) Requirement of the histidine kinase domain for signal transduction by the ethylene receptor ETR1. Plant Phys. 136, 2961:2970. Qu, X., Hall, B.P., Gao, Z. & Schaller, G.E. (2007) A strong constitutive ethylene-response phenotype conferred on Arabidopsis plants containing null mutations in the ethylene receptors ETR1 and ERS1i. BM~CPlanzt Biol. 7, 3. Richins, R.D., Scholthof, H.B. and Shepard, R.J. (1987) Sequence of figwort mosaic virus DNA (caulimovirus group). Nucleic Acids Res. 15, 8451-8466. Rashotte, A.M., Carson, S.D., To, J.P. and Kieber, J.J. (2003) Expression profiling of cytokinin action in Arabidopsis. PlanztPhysiol. 132, 1998-2011i. Roslan, H.A., Salter, M.G., Wood, C.D., White, M.R.H., Croft, K.P., Robson, F., Coupland, G., Doonan, J., Laufs, P., Tomsett, A.B. and Caddick, M.X. (2001) Characterization of the ethanol-inducible alc gene-expression system in Arabidopsis thaliana. Plant J. 28, 225- 235. Santino, C.G., Stanford, G.L. and Conner, T.W. (1997) Development and transgenic analysis of two tomato fruit enhanced genes. Plant Mol1. Biol. 33, 405-416. Schaller, G.E. and Bleecker, A.B. (1995) Ethylene-binding sites generated in yeast expressing the Arabidopsis ETR1 gene. Science, 270, 1809-18 11. Schaller, G.E., Ladd, A.N., Lanahan, M.B., Spanbauer, J.M. and Bleecker, A.B. (1995) The ethylene response mediator ETR1 from Arabidopsis forms a disulfide-linked dimer. J Biol. Chem. 270, 12526-12530. Scheffner, M., Huibregste, J.M., Vierstra, R.D., Howley, P.M. (1993) The HPV-16 E6 and E6-AP complex functions as a ubiquitin-protein ligase in the ubiquitination of p53. Cell, 75, 495-505. Shen, W.H., Parmentier, Y., Hellmann, H., Lechner, E., Dong, A. et al. (2002) Null mutation of AtCUL1 causes arrest in early embryogenesis in Arabidopsis. Mol1. Biol. Cell. 13, 1916-1928. Sisler, E.C. (2006) The discovery and development of compounds counteracting ethylene at the receptor level. Biotechnol. Adv. 24, 357-367. Smalle, J. and Vierstra, R.D. (2004) The ubiquitin 26S proteasome proteolytic pathway. Annu. Rev. Plan2tBiol. 55, 555-590. Tieman, D.M. and Klee, H.J. (1999) Differential expression of two novel members of the tomato ethylene-receptor family. Plant Phys. 120, 165-172. Tieman, D.M., Taylor, M.G., Ciardi, J.A. and Klee, H.J. (2000) The tomato ethylene receptors NR and LeETR4 are negative regulators of ethylene response and exhibit functional compensation within a multigene family. PNAS, 97, 5663-5668. Tieman, D.M. Zeigler, M., Schmelz, E.A., Taylor, M.G., Bliss, P., Kirst M. and Klee, H.J. (2006) Identification of loci affecting flavour volatile emissions in tomato fruits. J. Exp. Bot. 57, 887-896. Underwood, B.A., Tieman, D.M., Shibuya, K., Dexter, R.J., Loucas, H.M., Simkin, A..J., Sims, C.A. Schmelz, E.A., Klee, H.J. and Clark D.G. (2005) Ethylene-regulated floral volatile synthesis in petunia corollas. Plant Phys. 138, 255-266. Vierstra, R.D. (1996) Proteolysis in plants: mechanisms and functions. Planzt2ol. Biol. 32, 275-302. Vierstra, R.D. (2003) The ubiquitin/26S proteasome pathway, the complex last chapter in the life of many plant proteins. Trends Planzt Sci. 8, 135-142. Voges, D., Zwicki, P., Baumeister, W. (1999) The 26S preteasome: a molecular machine designed for controlled proteolytic. Annu. Rev. Biochem. 68, 1015-1068. Wang, W., Hall, A.E., O'Malley, R. and Bleecker, A.B. (2003) Canonical histidine kinase activity of the transmitter domain of the ETR1 ethylene receptor from Arabidopsis is not required for signal transmission. PNAS, 100, 352-357. Wilkinson, J.Q., Lanahan, M.B., Yen, H.C., Giovannoni, J.J. and Klee H.J. (1995) An ethylene-inducible component of signal transduction encoded by Never-ripe. Science, 270, 1807-1809. Yang, G.X., Jan, A., Shen, S.H., Yazaki, J., Ishikawa, M., Shimatani, Z., Kishimoto, N., Kikuchi, S., Matsumoto, H. and Komatsu, S. (2004) Microarray analysis of brassinosteroids- and gibberellin-regulated gene expression in rice seedlings. Mol1. Gen. Genomics, 271, 468-478. Yang, S.F. (1987) The role of ethylene and ethylene synthesis in fruit ripening. In W Thompson, E Nothnagel, R Huffaker, eds. Plant Senescence: Its Biochemistry and Physiology. The American Society of Plant Physiologists, Rockville, MD, pp 156-165. Yen, H.C., Lee, S., Tanksley, S.D., Lanahan, M.B., Klee, H.J. and Giovannoni, J.J. (1995) The tomato Never-ripe locus regulates ethylene-inducible gene expression and is linked to a homolog of the Arabidopsis ETR1 gene. Plant Phys. 107, 1343-1353. Zamir, D. (2001) Improving plant breeding with exotic genetic libraries. Nature Rev Genetics, 2, 983-989. Zhou D., Kalaitzis, P., Mattoo, A. and Tucker, M. (1996a) The mRNA for an ETR1 homologue in tomato is constitutively expressed in vegetative and reproductive tissues. Planzt2ol. Biology, 30, 1331-1338. Zhou, D., Mattoo, A. and Tucker, M. (1996b) Molecular cloning of a tomato cDNA encoding and ethylene receptor. Plan2tPhys. 110, 1435-143. BIOGRAPHICAL SKETCH Brian Michael Kevany was born in Cleveland, Ohio on September 28, 1980. When he was one he and his mother, father and older brother Thomas moved to North Olmsted, Ohio where his younger brother Daniel was born and where Brian spent his entire childhood. As a young boy Brian enjoyed discovering things in his backyard and playing golf, baseball and hockey, with hockey being a sport he played year round. When he was in high school he got a j ob at a local nursery and really enjoyed learning about plants. After high school Brian attended Michigan State University where he maj ored in horticulture specializing in biotechnology. While at MSU he worked as an undergraduate researcher in the Postharvest Physiology lab of Dr. David Dilley under the tutelage of Dr. John Golding. Dr. Golding allowed Brian to become intimately involved in the proj ects in the lab and fostered a great interest in plant research. After graduation, Brian j oined the Plant Molecular and Cellular Biology Ph.D. program at the University of Florida as a pre-doctoral Alumni Fellow. While at UF he worked in the lab of Dr. Harry Klee studying the importance of the tomato ethylene receptor family during tomato fruit development. Upon completion of his Ph.D. degree, Brian will enter the lab of Dr. Michael Thomas in the Department of Bacteriology at the University of Wisconsin-Madison as a postdoctoral researcher. PAGE 1 ROLE OF MEMBERS OF THE TOMATO ETHYLENE RECEPTOR FAMILY IN DETERMINING THE TIMI NG OF RIPENING By BRIAN MICHAEL KEVANY A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2007 1 PAGE 2 2007 Brian Michael Kevany 2 PAGE 3 To my parents, who have supported every decisi on I have ever made and given everything to their children 3 PAGE 4 ACKNOWLEDGMENTS Thanks to my entire committee for their patie nce and constructive cr iticism throughout this process. I would like to especia lly thank my advisor, Dr. Harry Klee, for guiding me through my Ph.D. and not only teaching me how to be a scientis t but how to present myself and my science. I thank the entire Klee lab for all their help throughout the years. Thanks to my bench-mate Michelle Zeigler whose attention to detail has he lped me to become a better scientist. I thank Denise Tieman for sharing her knowledge in th e lab and Mark Taylor for generating all the transgenic plants used in my e xperiments. Thanks to Peter Bliss for taking care of my plants in the greenhouse and doing just about everythi ng around the Klee lab. I th ank Valeriano Dal Cin for all of this help on the mapping project. Thanks to everyone in the lab of Dr. A ndrew Hanson for all their help and great friendship. I would especially like to thank Dr. Gilles Basset and Dr. Sebastian Klaus for teaching me everything they know about protei n expression. Additionally I thank Dr. Gale Bozzo, Dr. Rocio Diaz de la Ga rza, Dr. Giuseppe Orsomando, Dr. Aymeric Goyer, and Tariq Ahktar for being there when I needed a break a nd to have some fun. Thanks to the lab of Dr. David Clark for allowing me to come over and do my RNA extractions in their hood and also to bother them when I needed a break. I thank Ca rol Dabney-Smith for te aching me all she knows about custom antibodies, without th is help I would not have been able to finish all my work. Most importantly, thank you to my family fo r always being there for me when I needed them. Also for understanding that moving from Ohio to Florida was what was best for my career even though it was so far. I also thank all of my friends back in Ohio and Michigan for staying in touch and giving me plenty of fun times outside of Gainesville. Lastly, thanks to Stephanie Violi from the bottom of my heart for being the person I have leaned on for the past three years. She 4 PAGE 5 5 has made me laugh when I needed it and always put things in perspe ctive. Even though we havent been together she has remained the drivi ng force in my life and is the love of my life. PAGE 6 TABLE OF CONTENTS page ACKNOWLEDGMENTS ...............................................................................................................4 LIST OF TABLES ...........................................................................................................................8 LIST OF FIGURES .........................................................................................................................9 ABSTRACT ...................................................................................................................................11 CHAPTER 1 LITERATURE REVIEW .......................................................................................................13 Ethylene in Plant Biology .......................................................................................................13 The Ethylene Receptor Family Arabidopsis and Tomato ..................................................17 Protein Degradation Through the 26S Proteasome ................................................................24 2 ETHYLENE RECEPTOR DEGRADATION CONTROLS THE TIMING OF RIPENING IN TOMATO ......................................................................................................31 Introduction .............................................................................................................................31 Results .....................................................................................................................................33 A Subset of the Receptor Family Shows Ripening-associated Expression and Is Ethylene-inducible in Fruit ..........................................................................................33 LeETR6 Antisense Lines Show Phenotypes Consistent with a Constitutive Ethylene Response ......................................................................................................................34 Receptor Protein Levels Are Distinctly Di fferent From Transcript Levels During Fruit Development .......................................................................................................34 Treatment of Leaf and Fruit Tissue with Ethylene Causes a Rapid Degradation of Receptor Proteins That Likely Occurs Through a Proteasome-dependent Pathway ...35 Receptor Levels in Developing Fru it Determine the Timing of Ripening ......................37 Discussion ...............................................................................................................................37 3 FRUIT-SPECIFIC SUPPRESSION OF THE ETHYLENE RECEPTOR LEETR4 RESULTS IN EARLY RIPENING FRUIT ...........................................................................50 Introduction .............................................................................................................................50 Results .....................................................................................................................................51 LeETR4 RNAi Transgenic Plants Produce Early Ripening Fruit ....................................51 Early Ripening Lines Show A ltered Ripening Coordination ..........................................52 Transgenic Fruits are Indistinguishable fr om Wild Type Fruits in Horticultural Traits ............................................................................................................................53 Discussion ...............................................................................................................................54 6 PAGE 7 7 4 IDENTIFICATION OF QTLS THAT MODIFY TIME TO RIPENING AND RIPENING-ASSSOCIATED ETHYLENE PRODUCTION .................................................61 Introduction .............................................................................................................................61 Results .....................................................................................................................................63 Discussion ...............................................................................................................................66 5 CONCLUSION .......................................................................................................................80 6 MATERIALS AND METHODS ............................................................................................83 Plant Materials and Growth Conditions ..........................................................................83 Development of Transgenic Plants ..................................................................................83 Pharmacological Treatments ...........................................................................................84 Recombinant Protein Expr ession and Antibody Production ...........................................84 RNA Expression Analysis ...............................................................................................85 Microsomal Membrane Isolati on and Protein Blot Analysis ..........................................85 Acid and Soluble Solids Analysis ...................................................................................86 Volatile Analysis .............................................................................................................87 LIST OF REFERENCES ...............................................................................................................89 BIOGRAPHICAL SKETCH .........................................................................................................98 PAGE 8 LIST OF TABLES Table page 2-1 Days from anthesis to breaker of LeETR6 antisense lines .......................................................49 2-2 Days from anthesis to breaker of ethylene treated Microtom fruit ..........................................49 3-1 Weight, yield, brix, citric acid an d malic acid from field grown fruits ...................................59 3-2 Weight, yield, brix, citric acid an d malic acid from greenhouse grown fruits ........................59 3-3 Volatile organic compounds from field grown fruits ..............................................................59 3-4 Volatile organic compounds from greenhouse grown fruits ...................................................60 6-1 Oligonucleotide primers and probes ........................................................................................88 8 PAGE 9 LIST OF FIGURES Figure page 1-1 Schematic representation of tomato ethylene receptor family ...............................................30 2-1 Ethylene receptor family mRNA levels during fruit development. ........................................41 2-2 Ethylene-inducibility of each recep tor mRNA in immature fruit tissue. ...............................42 2-3 Constitutive ethylene response phenotypes of LeETR6 antisense lines .................................43 2-4 Receptor gene expression and protein leve ls show distinct differences during fruit development .......................................................................................................................44 2-5 Ethylene binding induces degradation of receptors in detached immature fruits ...................45 2-6 Ethylene binding induces de gradation of receptor prot eins in vegetative tissue ....................46 2-7 Ethylene treatment induces turnover of receptor leading to early ripening fruit ....................47 2-8 Ethylene treatment induces expression of receptor mRNAs in attached fruit ........................48 3-1 Fruit-specific ETR4 RNAi transgenic lines produce early ripening fruit ...............................56 3-2 Suppression of LeETR4 is Fruit-specific ................................................................................57 3-3 ETR4 -RNAi transgenic plants have altered ripening coordination ........................................58 4-1 Ethylene emissions of fully ripe fruit from L. hirsutum IL 3945 ...........................................69 4-2 Days from anthesis to breaker of tagged fruits from L. hirsutum ILs ....................................70 4-3 Ethylene emissions of breaker fruit from L. hirsutum ILs .....................................................71 4-4 Ethylene emissions of fully ripe fruit from L. hirsutum ILs ...................................................72 4-5 Genomic map showing locations of introgr essed regions that c ontain putative ripeningassociated QTLs .................................................................................................................73 4-6 Days from anthesis to breaker of tagged fruits from L. hirsutum ILs ....................................74 4-7 Ethylene emissions of fruits from field-grown L. hirsutum ILs .............................................75 4-8 Ethylene emissions of leaves from L. hirsutum ILs ...............................................................76 4-9 Nucleotide alignment of ETR4 genomic sequence ................................................................77 4-10 mRNA expression of LeETR4 in WT and the L. hirsutum IL 3945 .....................................78 9 PAGE 10 10 4-11 mRNA expression of LeETR4 in seedlings of WT, L. hirsutum and IL 3945......................79 PAGE 11 Abstract of Dissertation Pres ented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy ROLE OF MEMBERS OF THE TOMATO ETHYLENE RECEPTOR FAMILY IN DETERMINING THE TIMING OF RIPENING By Brian Michael Kevany December 2007 Chair: Harry John Klee Major: Plant Molecular and Cellular Biology Tomatoes are an economically important crop and a significant dietary source of important phytochemicals, such as carote noids and flavonoids. While it ha s been known for many years that the plant hormone ethylene is essential for ri pening of climacteric fru its, its role in fruit growth and maturation is much less understood. In an attempt to better un derstand tomato fruit ripening we utilized both biotechnology and traditional breeding strategies. The multigene ethylene receptor family has been shown to nega tively regulate ethylene signal transduction and suppress ethylene responses. Here, we demonstrate th at a reduction in the levels of either of two family members, LeETR4 or LeETR6 causes an early ripening phe notype. We provide evidence that the receptors are rapidly degraded in the presence of ethylene and that degradation likely occurs through the 26S proteasome-dependent pa thway. Ethylene exposure of immature fruits causes a reduction in the amount of receptor protein and earlier ri pening. Fruit-specific suppression of the ethylene receptor LeETR4 causes early ripening while fruit size, yield and flavor-related chemical com position are largely unchanged. Th ese results demonstrate that ethylene receptors likely act as biological clocks regulating the onset of tomato fruit ripening. In order to better understand the mechanism cont rolling the timing of ripening we screened a Lycopersicon hirsutum introgression population for QTLs responsible fo r reduced time from 11 PAGE 12 12 anthesis to breaker and/or increased ripening-associated ethyle ne biosynthesis. The L. hirsutum population was chosen because of unusual ripening characteristics and significantly higher levels of ethylene biosynthesi s at maturity of L. hirsutum A number of lines were identified that showed statistically significant di fferences from the control for both phenotypes. These lines are currently being refined for possible map-based cloning of loci controlling these phenotypes. These results demonstrate the power of using both molecular biology and traditional breeding for gene isolation/characteri zation and crop improvement. PAGE 13 CHAPTER 1 LITERATURE REVIEW Ethylene in Plant Biology The phytohormone ethylene is an important signaling molecule that is involved in many plant processes including but not limited to abscission, leaf and flower senescence, germination, sex determination and fruit ripening (Abeles et al., 1992). Ethylene also functions in both biotic and abiotic stress responses. Exposure to environmental stresses like flooding, wounding, herbivory, chilling or pathogen attack can enhance ethylene production (Boller, T. 1991; Abeles et al., 1992). This ethylene then slows growth until the stress is removed. Interest in ethylenes importance as a plant hormone has resulted in thousands of peer-r eviewed publications in the last 100 years and has laid the foundation for a real un derstanding of ethylene s involvement in plant growth and development. Ethylene is a small, gaseous, two-carbon molecu le that has the ability to diffuse through hydrophilic and hydrophobic environments. This propert y allows it to pass into any compartment in the plant cell. The ability of ethylene to alter plant development has been known for centuries, with farmers from many culture s using smoke and wounding to induce flowering and ripening (Abeles et al., 1992). Damage to city and greenhouse plants in the late 19th and early 20th centuries was found to be cause d by leaking illuminating gas th at was used at the time for lighting. Work done by Dimitry Neljubov in 1901 pr oved that ethylene was in fact the active component in illuminating gas that resulted in th e plant damage (Abeles et al., 1992). Subsequent work showed that ethylene was clearly important for fruit ripening but many scientists at the time believed that the other phenotypes of endogenous ly produced ethylene were a by-product of the ripening process (Abeles et al., 1992). Work done in the 1960s by the Burgs provided definitive proof that ethylene is important for plant development beyond its involvement in fruit 13 PAGE 14 ripening (Burg and Burg, 1962; Burg 1962). Their wo rk was instrumental in classifying ethylene as a plant hormone. Early feeding experiments suggested that th e amino acid methionine is a precursor of ethylene (Lieberman et al., 1966; Burg and Claget t, 1967). Later work provided evidence that oxygen is necessary for the production of ethylene. It was then hypothesized that if fruit tissue was held in an anaerobic environment the precursor should build up and provide enough compound to allow identification. This work led to the subsequent isolation of 1aminocyclopropane-1-carboxylic acid (ACC), the immediate precursor of endogenous ethylene (Adams and Yang, 1979). ACC is synthesized from S-adenosyl methionine (SAM) by a pyridoxal phosphate-requiring enzy me termed ACC synthase (ACS ). The conversion of ACC to ethylene is subsequently perf ormed by the oxygen-requiring enzyme ACC oxidase (ACO). The conversion of ACC by ACO results in the production of CO2 and HCN in addition to ethylene. Most tissues synthesize low levels of ethylene. Synthesis can be stimulated by a number of means, including wounding, submergence, chilling and pathogen attack. Synthesis of ACC is considered to be the rate limiting step in ethylene production. Thus, increased ethylene production requires modulation of AC S expression and/or activity. While ethylene is often charac terized as the ripening hormone, not all fruit require ethylene to complete the ripening process. Species are ofte n characterized by the presence or absence of a large increase in ethyle ne production concomitant with increas ed respiration at the onset of ripening. Species whose fruit exhi bit these increases are termed climacteric while those that do not are referred to as non-cli macteric. Climacteric species include apple, avocado, banana, peach and tomato while non-climacteric species incl ude strawberry, grape, cherry and citrus. The increase in ethylene production associated with climacteric ri pening is essential for ripening. 14 PAGE 15 Blockage of either ethylene bi osynthesis or perception results in an inability of the fruit to complete its ripening program. Tomato is an excellent model for the study of ethylenes involvement in fleshy fruit development because of a relatively short life cycl e, ease of genetic manipulation and a wealth of genetic resources. In addition, the tomato genome is being sequenced, which will be a tremendous resource to those working on this species. Ethylenes involvement in ripening, fruit softening, volatile production and lycopene accumulation has been well documented. Ethylene bi osynthesis during tomato fruit development generally goes through three distin ct stages. There is a slight bur st of synthesis after successful pollination that then falls to low levels until the onset of climacteric ethylene production at the onset of ripening. Ethylene production during i mmature fruit development has been termed system I and is characterized as low level pr oduction which cannot be stimulated by treatment with exogenous ethylene (Yang, 1987). Ethylene bios ynthesis in mature fruit, referred to as system II, is autocatalytic, meaning it can induce its own s ynthesis (Yang, 1987). The induction of ethylene synthesis at the onset of ripening is believed to be due to developmental induction of an ethylene-inducible ACS (Barry et al., 2000; Nakats uka et al., 1998). Although immature tomato fruit do not produ ce significant levels of ethylene they do respond to ethylene, but in a different manner to th at of ripening fruit. This response manifests as a change in gene expression but to a smaller set of genes to that of ripening fruits (Alba et al., 2005). This difference in respons e suggests that there is developmental control of gene expression in addition to that of ethylene. The developmental control of ethylene regulated genes has been best characterized by research done on the E4 and E8 genes found in tomato. Expression of E4 is ethylene inducible thr oughout fruit development while E8 is only ethylene 15 PAGE 16 inducible in ripening fruit (Lin coln et al. 1987, Wilkinson et al ., 1995). Treatment of immature fruit with ethylene induces a set of genes, proving a response to the hormone, but it does not induce immediate ripening. However, that ethylene exposure does hasten th e onset of ripening as compared to untreated fruit of similar age, s uggesting that the fruit can measure cumulative ethylene exposure (Burg and Burg, 1962; Lyons and Pratt, 1964; McGlasson et al., 1975; Yang, 1987). Treatment of immature green tomato fruit with ethylene, or its analog propylene, could reduce the time from anthesis to breaker by half that seen in non-treate d controls (Lyons and Pratt, 1964; McGlasson et al., 1975). The way fruits measure this ethylene exposure is unknown. Along with temporal control of fru it ripening there is also a spatial aspect of control. Fruit do not ripen evenly across the entire fruit, they begin to ripen at the basal end of the fruit and proceed towards the calyx. Since ethylene is diffusible throughout the fru it, and accumulates to high levels within the fruit, there appears to be a de velopmental control within individual fruit that controls the spatial ripening of the fruit. In addition to ethylenes role in fruit deve lopment it also plays an important part in seedling emergence (Clark et al., 1999). During germ ination seedlings must be able to force their way through any soil between them and a light so urce. When a seedling encounters a barrier in the soil it often becomes slightly wounded which can induce ethylene production. Dark grown seedlings, like those found underground, are often tall and spindly in the pr esence of air alone. Upon exposure to ethylene its growth habit changes a nd exhibits growth that is referred to as the triple response. This response manifests as a shortening of both the hypoc otyl and root, radial thickening of the hypocotyl and an exaggerati on of the apical hook. These changes allow the seedling to push through any barriers without da maging the meristem. While this mechanism has evolutionary importance, the ability to exploit this response has revolutionized the ethylene 16 PAGE 17 biology field by allowing researchers to scr een for mutants in ethylene biosynthesis and signaling. The Ethylene Receptor Family Arabidopsis and Tomato Much of the initial ethylene perception and signal transduction research was done in Arabidopsis thaliana and thus we have exploited the Ar abidopsis system to identify the orthologous genes in tomato. The Arabidopsis ethylene receptor ETR1 was the first phytohormone receptor cloned in plants and was isolated from a mutagenized population that was screened for plants deficient in the triple response (Bleecker et al. 1988; Guzman and Ecker 1990). Ethylene insensitive mutants grow tall and spindly even in the presence of ethylene while constitutive ethylene response mutants will show a triple response in the absence of ethylene. etr1-1 was isolated as an ethylene insensitive mutant in one of these screens and was later cloned and shown to encode an ethylene receptor with homology to bacterial two-component sensors (Chang et al. 1993). In subsequent work a total of five receptors were cloned from Arabidopsis. The ethylene signal transduction pathway in Arab idopsis is believed to be relatively linear but we are unsure if all of the elements have been identified. Epista tic analysis has allowed researchers to putatively order the components star ting with the receptors. The next component is the Raf-like Ser/Thr protein kinase, CTR1, which ha s been shown to physica lly interact with the receptors (Clark et al., 1998; Gao et al., 2003; Huang et al., 2003). CTR1 has significant homology to MAPKKKs and although no MAPKK or MAPK have been found to be involved in ethylene signal transduction, thei r involvement in this pathway cannot be ruled out. EIN2, a protein showing homology to Nramp metal transporters, is the next member of the pathway. The role and activity of this protein in the pathwa y is unknown but it is absolutely necessary since knockouts show complete ethylene insensitivity in every assay tested. The end of the ethylene signal transduction pa thway is composed of the transcript ion factors EIN3 and ERF1. EIN3 loss17 PAGE 18 of-function (LOF) mutants show partial ethylene insensitivit y, which is probably due to redundancy within a gene family containing at le ast three members (Chao et al., 1997). In the absence of ethylene the EIN3 prot ein is targeted for degradation in the 26S proteasome by a pair of F-box proteins, EIN3-binding factors 1/2 (EBF 1/2). Upon ethylene bindi ng this repression is released and EIN3 binds to the promoter of ERF1 activating its tran scription and ERF1 is involved in regulating the tran scription of ethylene responsiv e genes. ERF1 over-expressors show a slight constitutive ethylen e response suggesting that there are other important players in the transcriptional c ontrol of ethylene responsive ge nes (Berrocal-Lobo et al. 2002). ETR1 was not only the first phytohormone receptor to be cloned in plants but was also the first eukaryotic protein with homology to a histid ine kinase (Chang et al. 1993). These receptors are endoplasmic reticulum-localized proteins that have copper-me diated ethylene binding and are present in vivo as dimers (Chen et al., 2002; Ma et al., 2006; Schaller and Bleecker 1995; Schaller et al. 1995). The Arab idopsis receptor proteins (E TR1, ETR2, ERS1, ERS2 and EIN4) can be separated into three st ructurally different regions. The sensor domain is composed of three put ative transmembrane (TM) sequences in ETR1 and ERS1 and four domains in ETR2, ERS2 and EIN4, with the first TM sequence representing a cleavable ER-targeting peptide. These tr ansmembrane sequences are where the coppermediated ethylene binding takes place. This regi on also contains all of the known mutations that cause ethylene insensitivity, likely due to an inability to bind ethylene or transmit the signal through a conformational change. The amino acids necessary for dimerization are present in this region and homodimerization has been proven in vivo but heterodimerization has not been demonstrated (Schaller et al. 1995). 18 PAGE 19 The next domain present in this family is a region that shows homology to histidine kinases (Dutta et al., 1999). Histidine kinase domains cont ain five highly conserved subdomains, N, G1, F, G2 and the histidine (H) that is au tophosphorylated. The ETR1 and ERS1 proteins contain all five of th ese sub-domains while the other th ree members lack at least one sub-domain. The ETR1 protein is the only member of the family that exhibits HK activity in vitro, but the conserved histidine is not necessary for protein function based on the ability for a mutant lacking this residue to rescue a recepto r mutant (Gamble et al. 1998; Gamble et al. 2002, Wang et al. 2003). The other family members all exhibit Ser/Thr ki nase activity based on in vitro kinase assays (Moussatche a nd Klee, 2005). This lack of his tidine kinase activity in these family members fits well with the finding that most of the other family members do not contain all of the conserved regions in the histidine domain. All kinase assays completed so far have been done in vitro and there has been no ki nase activity directly linked to ethylene signal transduction in vivo. The third and final domain found in these proteins is the receiver, located at the C-terminus of the protein. This region shows homology to th e output domains from bacterial two-component sensors and contains an aspartat e that is active in phosphorelay in these bacterial pathways. The ERS1 and ERS2 proteins lack this domain while the other family members contain it, suggesting that it may play a role in some family member-specific functions. Using sequence and exon/intron organization comparisons, ETR1 and ERS1 have been classified as Subfamily 1 receptors while ETR2, ER S2 and EIN4 have been classified Subfamily 2 receptors. Considering the degr ee of divergence within the family, there may be specific functions for each of the family members. The ev idence suggests that the receptors may not be completely redundant, although most geneti c evidence suggests functional overlap. 19 PAGE 20 Mutant analysis of the Arabidopsis ethyl ene receptor family has allowed a better understanding of the receptors role in transducin g the ethylene signal. Al l of the initial receptor mutants cloned were semidominant, insensitiv e mutants. Single gene LOF mutants have no obvious phenotypes which is most likely due to functional redundancy within the family. Based on all of the genetic data available the receptors appear to function as ne gative regulators of the ethylene response (Hua and Meyerowitz 1998). The de fault state of the receptor is one in which the receptor actively supp resses ethylene responses in the ab sence of the hormone and ethylene binding removes this suppression. The double mutant etr1/ers1 and triple or quadruple mutants show constitutive ethylene responses even in th e absence of increased ethylene biosynthesis (Wang et al., 2003), presumably because basal et hylene levels are able to inactivate the remaining receptors. This model suggests that a decrease in receptor content will increase ethylene responsiveness while an increase in rece ptor levels will decrease tissue responsiveness. This simplified model does not appear to tell the entire story because it pr esumes that all of the receptors contribute equally to the signal and re cent work has suggested this may not be true. Overexpression of a Subfamily 2 member was unable to rescue the constitutive ethylene response phenotype of the double Subfamily 1 mutant, suggesting some family member-specific functions (Wang et al., 2003). Work done in our lab has found that the system in tomato may be quite different from that of Arabidopsis. The tomato ethylene receptor family is composed of six members, LeETR1-6 with LeETR3 corresponding to the NR gene (Fig. 1, Zhou et al. 1996a; Zhou et al. 1996b; Lashbrook et al. 1998;Tieman and Klee 1999). All receptor family members have been shown to bind ethylene with the exception of LeETR6 because it was not available at the time of analysis (OMalley et al ., 2005). The first of the tomato ethylene receptor genes to be cloned was NR This gene was 20 PAGE 21 isolated from a mutant that s hows semidominant ethylene insens itivity which prevents floral wilting and abscission, alte rs leaf senescence and prevents fruit ripening (Wilkinson et al. 1995). The basic structures of the receptors are similar to those of the Arabidopsis family but within the tomato family the sequences are quite divergent with less than 50% identity at the extremes (Figure 1). The transmembrane domai ns show the highest levels of sequence similarity owing to the importance of this domain in the transmi ssion of the signal. LeETR1, 2 and NR have three putative transmembrane domains while LeETR4, 5 and 6 have four putative transmembrane domains. The NR protein is the on ly member of this family that lacks the C-terminal receiver domain (Figure 1). LeETR4, 5 and 6 resemble the Subfamily 2 receptors found in Arabidopsis in that they are missing at least one of the cons erved sub-domains in the HK domain and contain the fourth transmembrane sequence (Figure 1-1). E ach of the receptors has a distinct expression pattern throughout fruit development, with NR ETR4 and ETR6 being ethylene inducible (current work). NR and ETR4 are both pathogen inducible, with the increase in expression being a function of the increase in ethylene producti on found during a disease re sponse (Ciardi et al., 2000). An increase in receptor expr ession is likely an important f actor in reducing the amount of damage that occurs as a result of th is increase in et hylene production. The basic model for ethylene response states th at the receptors act as negative regulators of ethylene response and that higher receptor expr ession reduces sensitivit y and lower expression increases sensitivity. This model explains why multiple gene knockouts in Arabidopsis show a constitutive response. While much of the availa ble data fit this model it does not address the importance of ethylene dissociation from th e receptor or protein turnover. The Kd of ethylene dissociation was measured in yeast-expressed AtETR1 and was found to be approximately 12 hours. This is likely to be an underestimate sin ce it did not factor in protein turnover (Schaller 21 PAGE 22 and Bleeker, 1995). There is no evidence to suggest that ethylene is able to dissociate from the receptor, suggesting this association may be pe rmanent. Isoform-specific antibodies have been generated for a number of the Arabidopsis receptors and the tomato NR protein but no work has been done to study in vivo turnover rates or ethyle nes effect on receptor turnover. This type of evidence will be necessary to draw any conclusi ons about the receptors importance in a plants response to ethylene. The current model suggests that the only wa y that a plant can re duce its response to ethylene is by synthesis of new receptors. Less receptor leads to more sensitive tissue and more receptor leads to less sensitive tissue. Previous work has shown that the current data do fit the receptor model. Plants overexpressing NR have been found to be less sensitive to ethylene in triple response assays and pat hogen studies (Ciardi et al. 2000). LeETR4 antisense lines with significantly reduced expression show phenotypes consistent with a constitutive ethylene response. Phenotypes of these lin es include epinastic growth, pr emature flower senescence and abscission and for fruit, a reduction in the time fr om anthesis to breaker and from breaker to red ripe (Tieman et al 2000). The effect on time from anthesis to breaker is quite significant with a decrease of as much as 11 days compared to WT controls. LeETR4 antisense lines also have an altered response to pathogen infection because an increase in ETR4 expression is one way in which the plant reduces the amount of tissue damage. These lines display an accelerated hypersensitive response in response to infection with an incompatible pathogen with greater ethylene production and hastened expression of pathogenesis-relate d genes (Ciardi et al. 2000). Antisense suppression of LeETR1 2 and NR have no observable phenotype but this result is likely due to redundancy within the system. The NR antisense lines show an unusual phenotype in that with the reduction of NR expression levels there is a concomitant increase in ETR4 22 PAGE 23 expression and this may explain why the NR antisense lines do not show any constitutive ethylene response phenotypes. This phenomenon has been termed functional compensation and appears to be a built-in system that allows the increase in expression of one family member when another has been reduced (Tieman et al 2000). The expression level of each of the tomato receptors has been monitored in response to multiple ethylene-related phenomenons and at least one receptor is up-regulated in each of the responses. On the other hand, a reduction in r eceptor expression has never been seen even though it would increase the tissues responsiveness to ethylene. So it seems that as soon as a plant starts producing ethylene more receptor is produced thus attenuating the response. While this may seem counterproductive it is not unco mmon for a phytohormone in plants to be attenuated as soon as its induced (Rashotte et al., 2003). Increased response to ethylene can be very detrimental to plant tissues and since ethyl ene slows the growth of a plant, it could have long term effects. The expressi on levels of all th e receptors remain low throughout immature fruit development and show a shar p increase at the onset of ri pening, the time at which ethylene production is at its highest. So it seems that at the point when ethylene is having its greatest effect on plant development, receptor levels are at their very highest. It has been known for some time that ethylene is intimately involved in the timing of fruit ripening and our research seeks a better understanding of its role. Based on our previous research and that of others we believe that if ethylene production rates during fruit developmen t exceed the level of receptor synthesis then there would be a de-repression of the system that would lead to an increas e in sensitivity to the hormone. At some point in development, when th e fruit are ripening competent, sensitivity to ethylene would rise past a thresh old level where ripening could be initiated. Based on this model the reduction of receptor levels in transgenic plants should reduce time to ripening and based on 23 PAGE 24 our previous results this is true, ETR4 antisense plants ripen faster than controls (Tieman et al 2000). Protein Degradation Through the 26S Proteasome Protein degradation is an important regulat ory mechanism that has been adopted by many organisms. It has emerged as a mechanism of control as important as gene expression in controlling cellular processes. Prot ein degradation has been implicat ed in the control of signaling cascades, defense against viral infection, breakdown of cellular regulators and arguably its most important role is the removal of abnormal pr oteins (Jabben et al. 1989, Glotzer et al. 1991, Scheffner et al. 1993). The degradation of proteins generally falls into two classes: (1) relocation of proteins to degradative orga nelles such as the lysosome or vacuole and (2) targeting the proteins for degradation by the 26S proteasome. These two pathways are the principal modes of degradation for both soluble and membrane bound proteins, albeit less is known about how membrane-bound proteins are degraded. While re location to degradative organelles is an important type of protein degradation the focus of this review will be on the role of the 26S proteasome in protein degradation. The 26S proteasome is one of the most importa nt proteolytic systems in plants and our understanding of this system has gr own considerably in the past de cade. This system utilizes the 76-amino acid protein ubiquitin (Ub) as a reusable tag to target specific proteins to the multisubunit 26S proteasome for proteolysi s. The attachment of Ub occu rs at lysine residues on the target protein and often occurs as a polyubiquitin chain of Ub m onomers. Upon proteolysis in the proteasome the Ub monomers are released to be used in another round of targeting. Ubiquitination of target proteins occurs in a three-step conjugation cascade and can occur on proteins in the cytoplasm, nucleus integral membrane proteins and ER resident proteins that are retro-translocated across the ER membrane. 24 PAGE 25 The ubiquitin attachment cascade occurs in a th ree-step process designated E1, E2 and E3. The E1 component of the cascade is an ubiquitin-activating enzyme that binds ubiquitin at a conserved cysteine. This enzyme is constitutivel y expressed and has little impact on target specificity. The Arabidopsis genome encodes two E1 isoforms (Hatfield et al., 1997). The E2, or ubiquitin-conjugating enzyme, is encoded by at least 37 family members in Arabidopsis (Vierstra, 1996). This enzyme shuttles the ubiquitin moiety between the E1 and E3 proteins (Pickart, 2001). The size of this family suggests that different E2s may be involved in regulating specific pathways, although no specific functions have been assigned to any plant E2s. The specificity of individual E2s likel y occurs through their interaction with specific E3s. In addition, the E2s are not all specific to ubiquitin but are also used for conjugating ubiquitin-like proteins including NEDD, RUB and SUMO (L i et al., 2006). The E3, or ubiquitin-protein ligases, is the component of the cascade that specifically recogn izes proteins for ubiquitination. Because of the specificity of this protein/complex it is encoded by several large families of genes, with more than 1300 members in Arabidopsis (Vierstra, 2003). Four different types of E3 ligases have been identified in plants: HECT, RING/U-box, SCF an d APC (Smalle and Vierstra, 2004). HECT E3 ligases are composed of a large single polypeptide (often >100kD a), with seven family members present in the Arabidopsis genom e (Downes et al., 2003). Little is known of the functions of plant HECTs, although one is known to be important for trichome development. Like the HECT family, each RING/U-box family member is a single polypeptide that acts to bring together the E2-Ub and target substrate. This group of protei ns is each encoded by a large family of proteins with 480 RING finger-containing and 64 U-box contai ning proteins, respectiv ely, in Arabidopsis (Azevedo et al., 2001; Kosarev et al ., 2002). This type of E3 liga se has been implicated in a diverse number of cellular proc esses in plants, including, auxi n signaling, photomorphogenesis, 25 PAGE 26 self incompatibility and rem oval of abnormal proteins (Sma lle and Vierstra, 2004). The SCF type of E3 ligases are composed of a complex of four different polypeptid es. This type of E3 ligase acts in a similar manner to that of RING/U-box proteins in that they bring together the E2Ub and the target substrate. Plants have the abil ity to synthesize a vast number of SCF type E3 ligases. The Arabidopsis genome contains two RBX 1 subunits, five cullin subunits, 21 SKP-like proteins and almost 700 F-box proteins (Farras et al., 2001; Gagne et al., 2002; Shen et al., 2002) The F-box proteins provide the target specificity for this complex and constitute one the largest gene superfamilies in the Arabidopsis genome. The APC type of E3 ligases is the most complex type of E3, being composed of eleven subunits Most of these subunits are encoded by single genes in Arabidopsis and thus it is likely that they only form a small number of APC type E3s (Capron et al., 2003). The APC wa s first identified as being im portant for the regulation of mitosis through degradation of mito tic cyclins in yeast; it has been subsequently shown to have a similar function in plant cel ls (Blilou et al., 2002). The 26S proteasome is an ATP-dependent prot eolytic complex that is composed of 31 subunits organized in two major subcomplexes. The 20S core protease (CP) is the portion of the complex that houses the proteoly tic activity, alone it is an ATPand Ub-independent protease. The CP has hydrolyzing, trypsin -like and chymotrypsin-like ac tivity allowing it to degrade a broad range of peptide bonds (V oges et al., 1999). The 19S regulatory particle (RP) can bind to both ends of the CP and is th e portion of the complex that recognizes the Ubs attached to targeted proteins (Voges et al., 1999). The RP performs a number of additional functions including unfolding the target protein, Ub remova l, opening the gate to th e CP core and directing the target protein into the CP lumen (Smalle a nd Vierstra, 2004). Regulation of the activity and specificity of the proteasome is thought to be affected by a number of factors including 26 PAGE 27 association with additional protei ns and substitutions or modifi cations to complex subunits. The Arabidopsis genome encodes two isoforms of ne arly all proteasome s ubunits. Transcriptional control of the complex subunits in yeast is facilitated by a single transcription factor, Rpn4, that is negatively regulated at the protei n level by the 26S proteasome itself. The role of the 26S proteasome in regulati ng many signal transduction pathways has been confirmed in plants. The proteasome has been imp licated in the action of all plant hormones. In addition, it is important for a plant s response to both abiotic and bi otic stimuli. Its role in auxin and ethylene signaling are arguably the best charact erized roles in hormone signaling. The auxin signal transduction pa thway is negatively regulated by a fa mily of proteins (AUX/IAAs) that bind and inhibit the functions of a family of tr anscription factors, the auxin response factors (ARFs). Upon auxin binding the AUX/IAAs are targeted for degradation, thus releasing the transcription factors to initiate expression of auxin responsive genes. The use of mutants and proteasome inhibitors has confirmed this pathwa y and has facilitated the identification of the auxin receptor as the F-Box protein, TIR1. TIR1, and TIR1-like proteins, specifically target the AUX/IAAs for polyubiquitination and is an intere sting example of the importance of the 26S proteasome in regulating hormone pathways (Dharmasiri et al., 2005). The ethylene signal transduction pathway is also regulated by the proteasome, which modulates transcription factor activity/abundance. The F-Box proteins EBF1/2 target the EIN3, and EIN3-like, transcription factors for degrad ation in the absence of ethylene. Upon ethylene binding, this repression is removed and the transcript ion factor is able to activate transcription of primary ethylene responsive genes. In the case of EBF1/2, each has a differe nt role in response to ethylene, with EBF1 being mo re important during early ethyl ene response and EBF2 more 27 PAGE 28 important later during the res ponse and in the resumption of growth after ethylene removal (Binder et al., 2007). The importance of the proteasome in response to abiotic stimuli is best characterized by its role in regulating light signa ling. PhyA, a red/far red absorb ing photoreceptor, is rapidly ubiquitinated and turned over following photoconve rsion to the Pfr form. In addition to the regulation of photoreceptor protein levels, regulation of transcription factors is also performed by the proteasome. In the absence of a light sour ce the RING-E3 COP1 is present in the nucleus where it targets a number of tran scription factors for degradat ion. Upon illumination COP1 is removed from the nucleus and the transcription of light responsive genes occurs. These examples represent an extremely small percentage of th e pathways in which the proteasome has been implicated and there are many more that have not been characterized. While much is known about the degradation of soluble proteins by the proteasome, relatively little is known about in tegral membrane protein degradat ion, especially in plants. What is known about this pathway has been elucidated in yeast and to a lesse r extent in humans. A major regulatory and house keeping pathway that involves degradation of proteins in the endoplasmic reticulum (ER) or integrated into the ER membrane and has been termed ERassociated degradation (ERAD) has been uncovered. ERAD is responsible for targeting misfolded ER proteins that ar e retro-translocated back across the ER membrane and also targeting misfolded integral membrane proteins that are subsequently extracted from the membrane and degraded by the proteasome (Meusse r et al., 2005). It has been hypothesized that different targeting complexes may be present in cells that target me mbrane proteins with misfolded cytosolic domains, internal membrane domains or ER luminal domains (Carvalho et 28 PAGE 29 al., 2006). These complexes contain a number of different subunits but each contains a membrane-bound E3 ligase that attaches the ubiquitin monomers to the substrate. A number of membrane-bound ERAD substrates have been identified but an interesting example is that of the inositol 1,4,5-triphosphate (IP3) receptor. Activation of a G proteincoupled receptor (GPCR) increases phospholipas e C activity that genera tes diacylglycerol and the second messenger IP3. IP3 moves through the cytoplasm to IP3 receptors located in the ER membrane, which activate channels that mobilize internal reserves of Ca2+. A persistent activation of GPCRs leads to a down-regulation of IP3 receptors in order to prevent any deleterious effects of continually elevated cytosolic Ca2+. This down regulation requires the 26S proteasome and it has been shown that IP3 binding induces ubi quitination of the IP3 receptor, leading to degradation (Zhu and Wojcikiewicz, 2000). In addition, a binding-defective mutant receptor was shown to be resistant to ubiquitina tion and this resistance is not caused by the removal of potential ubiquitination sites. It was hypothesized that ligand binding causes a conformational change that expos es a signal leading to ubiquitination (Zhu and Wojcikiewicz, 2000). The 26S proteasome has emerged as an essential part of a cells repertoire for maintaining cellular integrity and regulating a myriad of different pathways Its involvement in both plant development and responses to environmental stimuli implies an impor tant evolutionary advantage allowing these sessile organisms to flourish in many different environments. 29 PAGE 30 30 Figure 1-1. Schematic representati on of tomato ethylene receptor family. Black bars in sensor domain represent putative transmembrane domains. Black boxes in histidine kinase domain represent conserved sub-domain s while black box in response regulator represents conserved aspartate invo lved in phosphorelay. (Klee, 2004) PAGE 31 CHAPTER 2 ETHYLENE RECEPTOR DEGRADATION CONT ROLS THE TIMING OF RIPENING IN TOMATO Introduction The plant hormone ethylene is a gaseous molecule that regulates multiple processes including germination, organ senescence, stress responses and fruit ripening (Abeles et al., 1992). The role of ethylene in fruit ripening has b een intensively studied in a number of species, but most notably tomato, which has emerged as an important model for the study of fleshy fruit development. Ethylene plays a critical role in determining the timing of ripening and thus provides an attractive point to control fruit ripening th rough genetic modification. Climacteric fruits such as tomato are charac terized by an increase in respiration and a concomitant increase in ethylene biosynthesis just prior to the in itiation of ripening. Ethylene is essential for normal fruit ripening in these specie s and blockage of either ethylene production or perception leads to improper ripening. In tomato fruits, ethylene has pr ofoundly different effects depending on the stage of development. There is a distinct developmen tal switch that occurs upon fruit maturation (Giovannoni, 2 001). Although applied ethylene does not initiate ripening in immature fruits, it does significantly hasten the onset of subsequent ripening (Yang, 1987); the more ethylene to which an immature fruit is expo sed, the earlier it ripens Similar effects have been observed in banana where Burg and Burg (1 962) demonstrated that treatment of immature green banana fruits shortened the time to ripeni ng relative to untreated controls. The mechanism by which fruits measure cumulativ e ethylene exposure is unknown. Genetic analysis in tomato and Arabidopsis has shown that ethylene receptors act as negative regulators of the ethyl ene response pathway (Hua and Meyerowitz, 1998; Tieman et al., 2000). In the absence of the hormone, receptors actively suppress ethylene responses. Upon ethylene binding, that suppression is removed and the response occurs. In tomato there are six 31 PAGE 32 known ethylene receptors ( LeETR1,2,4-6 and NR ) (Wilkinson et al, 1995; Zhou et al., 1996; Lashbrook et al., 1998; Tieman a nd Klee, 1999). Functional analyses have indicated that some Arabidopsis family members have a more impor tant role in ethylene signaling than others. Further, no single loss-of-function mutation has a major effect on ethylene responses, indicating a degree of functional redundancy. However a comple tely different picture emerges in tomato where loss of a single subfamily II receptor, LeETR4, results in increased ethylene sensitivity. Antisense LeETR4 plants show phenotypes consistent wi th a constitutive ethylene response including significantly earlier fruit ripening (Tie man et al., 2000). This mutant phenotype can be restored to wild type by over-expre ssion of the Subfamily I receptor, NR No ethylene-associated developmental effects have been observed in lines with reduced expression of NR (Tieman et al., 2000), LeETR1, LeETR2 or LeETR5 (Tieman and Klee, unpublished results). The receptor signaling model states that the r eceptors are acting as negative regulators of ethylene response. Experimentally it has been shown that reduction of receptor content increases ethylene sensitivity (Hua and Meyerowitz, 1998; Tieman et al., 2000; Cancel and Larsen, 2002; Hall and Bleecker, 2003) while increased receptor content has the opposite effect (Ciardi et al., 2000). We have previously shown that NR and LeETR4 transcripts are up-r egulated in ripening fruits (Wilkinson et al., 1995; Tieman et al ., 2000). Since fruit ripening is dependent upon ethylene action, it seems illogical to increase receptor content and thus decrease ethylene responses. To better understand the role of th e tomato ethylene receptor family during fruit development we have characterized the behavior of both the receptor RNAs and proteins during fruit development. Contrary to the RNA data, prot ein blot analysis showed that receptor protein levels are at their highest during immature fruit development and significantly decline at the onset of ripening. This paradox is explained by observations that ethylene treatment induces a 32 PAGE 33 rapid degradation of receptor prot eins. Here, we present data i ndicating an important role for LeETR4 and LeETR6 in modulating the timing of ripening. Reduced levels of these receptors mediated by either antisense RNA or protein de gradation results in ear lier fruit ripening. Results A Subset of the Receptor Family Shows Ripening-associated Expression and Is Ethyleneinducible in Fruit Expression of all six ethylene receptor ge nes was assayed throughout fruit development to assess stage-specific expression. Quantitati ve RT-PCR (qRT-PCR) anal ysis of each receptor transcript showed low expre ssion of all receptors throughout immature fruit development but upon maturation there was a significant increase in NR ETR4 and ETR6 transcripts (Fig. 2-1). This ripening-associated increase in expression constituted a 10-fold increase in total receptor mRNA content by the breaker stage. Since the re ceptors are negative regulators of ethylene responses, the observed increases in mRNA leve ls during an ethylene-dependent process seems counter-intuitive as an increase in receptors w ould make the fruit less sensitive to ethylene. Ripening-associated gene e xpression can be the conse quence of increased ethylene production. Previous analysis has shown that ETR4 and NR are in fact ethyle ne-inducible in leaf tissue (Ciardi et al ., 2000). To determine if th e receptor gene family is regulated by ethylene in fruit tissue, individual fruits were treated with 50 ppm ethylene for 15 h. Expression analysis of each receptor showed a 9-, 10and 7-fold increase in NR ETR4 and ETR6 respectively (Fig. 22). Expression of ETR1, ETR2 and ETR5 changed little in response to the ethylene treatment. Based on this analysis it appears that expression of NR ETR4 and ETR6 is the consequence of the climacteric increase in ethylene production at the ons et of ripening. 33 PAGE 34 LeETR6 Antisense Lines Show Phenotypes Consis tent with a Constitutive Ethylene Response Single gene knockouts of ethylene receptors in Arabidopsis show no obvious phenotypes and only the subfamily I double mutant (Hall and Bl eecker, 2003; Qu et al., 2007) or triple and quadruple mutants (Hua and Meyerowitz, 1998) show any ethylene-related phenotypes. As previously shown by Tieman et al (2000) this is not the situa tion in tomato as lines having significantly reduced LeETR4 expression show ethylene hyper sensitive phenotypes. When LeETR6 antisense lines were generated, we f ound similar phenotypes to those seen in LeETR4 antisense lines, including a reduc tion of time to ripening by as much as seven days (Table 2-1). Additional ethylene-related phenotypes include ep inastic leaf growth and premature flower senescence (Fig. 2-3). These resu lts indicate gene-specific reduc tions in expression of either LeETR4 or LeETR6 but not the other four receptors (data not shown) results in a hypersensitivity to ethylene, including premature fruit maturation and ripening. Receptor Protein Levels Are Distinctly Differ ent From Transcript Levels During Fruit Development A wealth of recent work has demonstrated that post-translational control is an important component of hormone pathway regulation. In or der to uncover any poten tial post-translational regulation of ethylene receptors, antibodies ag ainst NR, ETR4 and ETR6 were produced. Tissues were collected for a comprehensive study of mRNA and protein expression during fruit development. Measurement of receptor mRNA e xpression showed an increase in transcript levels at the onset of ripening and these levels often remained high until fruits were completely red (Fig. 2-4A). Microsomal memb ranes were isolated to enrich for the receptor proteins and were used for protein quantification. Analysis of protein levels thr oughout fruit development revealed an unexpected result; levels were highest during immature fruit development and significantly declined at the ons et of ripening (Fig. 2-4B). Da ta from cv. Flora-Dade are 34 PAGE 35 presented, although identical results were obtained in the Pearson and Micro-Tom cultivars. This reduction in protein occurred despite increased RNA content (Fig. 2-4C). The results indicate that RNA levels are not predictive of receptor protein content nor the signaling state of the tissue. Rather, there must be an additional level of c ontrol of ethylene perception. Because the drop in receptor content coincided with the onset of auto catalytic ethylene synthesis, we subsequently examined whether ethylene bindi ng induces receptor turnover. Treatment of Leaf and Fruit Tissue with Ethy lene Causes a Rapid Degradation of Receptor Proteins That Likely Occurs Thro ugh a Proteasome-dependent Pathway To determine whether ethylene binding induces receptor degradation, immature fruits and vegetative tissues were exposed to exogenous ethylene. Ethylene treatment of fruits resulted in 4, 5 and 8-fold increases in NR ETR4 and ETR6 mRNA, respectively (Fig. 2-5A). Concomitant with this increase in transcripts there were reductions of 60%, 60% and 40% in NR, ETR4 and ETR6 proteins, respectively, w ithin 2 h and this reduction was sustained throughout the treatment (Fig. 2-5B). Removal of ethylene afte r 8 h of treatment lowered transcripts to pretreatment levels but receptor proteins remained lower even 24 h after treatment ceased (Fig. 25A). Ethylene-mediated receptor degradation was also observed in vegetative tissues. Treatment of seedlings with 50 ppm ethylene for 2 h resu lted in 10-, 5and 13-fold increases in NR ETR4 and ETR6 mRNA, respectively. Similar to the data co llected from immature fruit there was 60%, 40% and 50% reduction in NR, ETR4 and ETR6 prot ein levels, respectively (Fig. 2-6B). Taken together, the results indicate that ethylene e xposure in both vegetative and reproductive tissues results in an immediate drop in re ceptor protein levels that is inde pendent of transcript levels. The 26S proteasome-dependent degradation pathway has emerged as a key point of regulation in many phytohorm one signaling pathways (Guo and Ecker, 2003; Dill et al ., 2004; Gagne et al ., 2004; Dharmasiri et. al ., 2005; Kepinski and Leyser, 2005). To determine if this pathway 35 PAGE 36 is responsible for the turnover of ethylene recep tors, seedlings were treated with the proteasome inhibitor MG132 prior to ethylene treatment. Fo llowing ethylene treatment, levels of each protein actually increased, likely because of ethylen e-induced increases in transcription/transl ation (Fig. 2-6B). Very little is known about mechan isms of ER-associated protein degradation in any system (Meusser et al., 2006). Presumably ubiquitinated proteins are rapidly extracted from the membrane and degr aded by the cytoplasmic 26S proteasome complex. We did not observe larger ubiquitinated forms of immuno-reactive receptors in the microsomal membrane fractions. Even after several-fold concen tration, no receptors could be detected in the soluble fraction (data not shown). Nonethele ss, the MG132 results are consistent with a ubiquitin-mediated receptor degradation. In order to demonstrate that ethylene binding is n ecessary for degradation, seedlings were pre-treated with the ethylene action inhibitor 1-methylcycloprope ne (1-MCP) prior to ethylene treatment. 1-MCP is a competitive inhibitor of ethylene and its attachment to the receptor is essentially irreversible (Sisler, 2006). If ethylene binding is essen tial for the degradation of the receptor, 1-MCP should stabilize the protein. Pr etreatment of tomato seedlings with 1-MCP prevented the ethylene-induced re ceptor degradation (Fig. 2-6B) as well as the ethylene-induced increase in mRNA (Fig. 2-6A), indicating that ethylene bind ing is essential for receptor degradation. To further confirm that ethylene binding is necessa ry for protein degradation we utilized the semi-dominant Nr mutant that has a greatly reduc ed ethylene response. The mutant Nr protein is unable to bind ethylene when heterologously ex pressed in yeast (Klee and Bleecker, unpublished data). Treatment of Nr seedlings with 50 ppm ethylene for 2 h caused a 50% and 62% decrease in ETR4 and ETR6 protei ns (Fig. 2-6B), respectively, but caused significantly less change in the le vel of NR protein. Taken togeth er, the results are consistent 36 PAGE 37 with enhanced receptor degrada tion following ethylene binding. However, we cannot completely exclude the existence of an ethylene-i nduced receptor degr adation machinery. Receptor Levels in Developing Fruit Determine the Timing of Ripening To determine whether ethylene-induced recept or depletion is the cause of the early ripening phenotype seen in ethylene treated fruit, immature fruits were exposed to ethylene while still attached to the plant and then allowed to ripen. Protein and mRNA samples were collected throughout the duration of the experi ment to correlate lower protei n levels with reduced time to ripening. Treated fruits ripened on average three days prior to untreated fruits (Table 2-2). Receptor protein levels were lowered upon treatm ent with ethylene at 15 days post anthesis (DPA) and remained lower than untreated controls throughout fruit development, indicating that lower receptor levels correlate with earlier ripe ning (Fig. 2-7). Transcript data show that the fruits responded to the ethylene treatment and upon removal of the ethylene, transcripts returned to pre-treatment levels (Fig. 2-8). Discussion Upon maturation, tomato fruits undergo a develo pmental transition that is defined by their response to ethylene (Lincoln et al ., 1987). A number of system 1 and/or system 2-associated genes have been identified in fruits. The E4 and E8 genes are excellent examples with E4 being ethylene inducible throughout fruit development (both in response to system 1 and system 2 ethylene) and E8 only being ethy lene-inducible in mature fruit (system 2 specific). While much is known concerning the role of ethylene during ripening its function during the immature phase of fruit development is less well understood. When mature fruits are exposed to ethylene, a ripening program is initiated. While treatment of immature fruits does not initiate ripening it does hasten the onset of ripening; the more the fruit is exposed to ethylene, the earlier it ripens (Burg and Burg, 1962; Yang, 1987). How the fruit m easures cumulative ethylene exposure is not 37 PAGE 38 known. We have provided evidence indicating a specialized role for two receptors, ETR4 and ETR6, in modulating ethylene responses, includi ng fruit maturation. Reduced level of these receptors mediated by either antisense RNA or et hylene-mediated protein degradation results in earlier fruit ripening. Ethylene exposure also resulted in a parallel de pletion of the other ethylene-inducible receptor protein, NR. Our resu lts are consistent with a model in which ethylene receptor content is a major determinant of when fruits initiate the ripening program. Since the receptors are negative regulators of ethylene signali ng, depletion would lead to a progressive increase in hormone sensitivity. When a particular threshold sensitivity is reached, ripening would commence. Alternatively, receptors may act as a brake on ripening initiation. It must be noted that there are othe r elements independent of ethylene that also must be in place for ripening to initiate; most notably the RIN transcription f actor (Vrebalov et al., 2002). Receptor gene expression is low and cons titutive throughout immature fruit development with little difference between any of the family members (Fig. 1). At the onset of ripening there is an increase in expression of NR ETR4 and ETR6 that results in a 10-fold increase in total receptor mRNA content. In contrast to mRNA expr ession, protein levels ar e at their highest in immature fruits and show a significant decrease at the onset of ripening and remain low (Fig. 24B) as a consequence of ethylene exposure. Ethylene binding likely causes a conformational change in the receptors that makes them suscep tible to degradation. In this context it is interesting to note the model of Arabidopsis receptor signaling presen ted by Wang et al. (2006). These authors provide genetic evidence supportive of a transitional state in which a receptor continues to actively suppress downstream ethylene responses after ethylene is bound. This intermediate state subsequently transitions to a receptor-inactive state. Our results suggest that the transmitter-off state may actually be receptor degradation. It would be most interesting to 38 PAGE 39 determine whether the mutations that define th is transition state stab ilize the protein. This receptor degradation is dependent upon the action of the 26S proteasome. At least in some cases, ubiquitination is associated with phosphorylation state ( Hochstrasser 1996). Although the ethylene receptors are considered to be ancestral histidine kinases, ma ny do not possess histidine kinase activity (Moussatche a nd Klee, 2004). However, all of the receptors are functional kinases; those that do not have histidine kinase activity are serine kinases. In light of the degradation of receptors following ethylene bindi ng, it is possible that the phosphorylation state of the receptor may mediate ubiquitin binding. Al though ligand-induced receptor degradation has not been reported for plant hormones, it has b een observed in animals where growth hormone (GH) signaling is mediated by receptor levels (Flores-Morales et al. 2006). The GH receptor, like ethylene receptors, is a membra ne-associated protein in which hormone binding also increases ubiquitin-mediated turnover (Govers et al. 1999). The ethylene receptor family in tomato, like Arabidopsis, is split into two groups with LeETR1 LeETR2 and NR belonging to subfamily I and LeETR4-6 belonging to subfamily II. The Arabidopsis results indicate that there is a distinct difference between subfamily I and II members. With the exception of a subfamily I double mutant ( etr1ers1 ), single and double gene knockouts in Arabidopsis show no obvious phenot ypes. This is likely due to functional redundancy within the gene family. Over-expression of a subfamily II member in an etr1ers1 double mutant cannot rescue the ethylene-hypersensitive phenotype (Wang et al. 2003). In a reciprocal experiment over-expression of a subfam ily I member in a subfamily II triple mutant was sufficient to rescue the ethylene response ph enotype. Together these da ta indicate that the subfamily I receptors are more important than the subfamily II receptors in determining competency to respond to ethylene. The Arabidop sis paradigm does not hold for tomato (Fig. 239 PAGE 40 3, Tieman et al 2000). Plants with reduced expression of either LeETR4 or LeETR6 both subfamily II members, show phenotypes that ar e consistent with an exaggerated ethylene response, including epin astic growth, premature flower se nescence and early fruit ripening. Over-expression of NR in a LeETR4 antisense line is able to rescue the ethylene response phenotype, indicating functional re dundancy between subfamily I a nd II members (Tieman et al. 2000). Apparently there is a large degree of plas ticity within the ethylene signaling pathway and different plants have adapted the signaling co mponents as appropriate for their situation. Plant hormones are involved in most developm ental processes and are critical for abiotic and biotic stress responses. Plants can regulate hormone action through synthesis, catabolism or perception. We have shown that a significant pa rt of the regulation of ethylene responses involves ligand-mediated receptor degradation. Fre quently ethylene responses, particularly those related to stresses, are transitory. In order to shut down an ethylene res ponse, synthesis of new receptors is essential. Ou r results with ethylene e xposure to immature fruits indicate that receptor degradation is apparently an important level of developmental control. Ou r results also indicate that conclusions concerning receptor functions based on RNA levels must be interpreted cautiously. Whether ethylene-med iated receptor turnover and repl enishment are important for other ethylene-mediated processes remains to be determined. 40 PAGE 41 Figure 2-1 Ethylene receptor fa mily mRNA levels during fruit development. qRT-PCR analysis of each receptor transcript in fruit tissue from different stages of fruit development. DPA, days post anthesis; MG, mature green; Breaker, first external color change; Turning, ~30% red color. Expression levels are presented as percentage of total RNA. 41 PAGE 42 Figure 2-2 Ethylene-inducibility of each recepto r mRNA in 20 days post anthesis, immature fruit. qRT-PCR analysis of expressi on of each receptor in response to 10ppm ethylene as a percentage of total RNA (SE). 42 PAGE 43 Figure 2-3 Constitutive ethylene response phenotypes of LeETR6 antisense lines. Epinastic leaf growth (A) and early fl ower senescence (B) of LeETR6 antisense lines. Equivalent aged wild type flowers are shown for comparison (C). 43 PAGE 44 Figure 2-4 Receptor gene expressi on and protein levels show distinct differences during fruit development. qRT-PCR analysis of gene expression expressed as percentage of total RNA (SE) (A) and protein blot analysis (B) throughout fruit development in L. esculentum cv. Flora-Dade (WT). Levels of RNA and protein are also shown for independent LeETR4 (4AS-1, 4AS-2) and LeETR6 (6AS-1, 6AS-2) antisense lines. Values below each receptor protein blot represent the amount of protein in each lane relative to the IMG stage. BiP antibody was used as a loading control and used to normalize protein values. C. Ratio of protein to mRNA. IMG: Immature green stage. Protein quantification was determin ed by densitometric analysis of Western blots using the NCBI software ImageJ. 44 PAGE 45 Figure 2-5 Ethylene binding indu ces degradation of receptors in detached immature fruits. Fruits were exposed to 10 ppm ethylene fo r 8 h. 32h time point represents fruit that were treated for 8 h and left in air for a further 24 h. qRT-PCR analysis of gene expression (A) and protein blot analysis (B) of ethylen e-treated immature fruits. Values below protein blots represent the am ount of protein in each lane relative to the 0 h time point. BiP antibody was used as a loading control and used to normalize protein values. Data represent th e results of two independent experiments (SE). 45 PAGE 46 Figure 2-6 Ethylene binding indu ces degradation of receptor prot eins in vegetative tissue. qRTPCR analysis of gene expression (A) and protein blot analysis (B) of L. esculentum cv. Micro-Tom and Never-ripe (Nr) seedlings after treatment with 50 ppm ethylene for 2 h. Data represent the results of tw o independent experiments (SE). Values below protein blots represent the amount of protein in each lane relative to the 0 h time point. BiP antibody was used as a loading control and used to normalize protein values. 46 PAGE 47 Figure 2-7 Ethylene treatment induces turnover of receptor leading to ear ly ripening fruit. 15 days post anthesis (DPA) fruit were treate d with 50 ppm ethylene while attached to the plant. Relative protein expression of NR, ETR4 and ETR6 normalized to an internal control, BiP. Values are plotted relative to the pretreatment protein level. 47 PAGE 48 Figure 2-8 Ethylene treatment induces expression of receptor mRNAs in attached fruit. qRTPCR analysis of expression of NR, ETR4 and ETR6 in response to 50ppm ethylene as a percentage of total RNA (SE). 48 PAGE 49 49 Table 2-1 Days from anthesis to breaker of LeETR6 antisense lines Line Days % Reduction LeETR6 mRNA WT 43.33 0.71 LeETR6AS-1 38.42 0.90* 85.1 2.4 LeETR6AS-2 37.00 1.46* 75.6 6.4 LeETR6AS-3 35.83 0.78* 72.8 5.8 Values represent mean of at least fifteen fruit for each line. *p-value<0.001 based on Students t-test. Table 2-2 Days from anthesis to brea ker of ethylene treated Microtom fruit Treatment Days Ethylene 45.33 1.41 + Ethylene 41.20 0.80* Values represent mean of at least ten fruit for each tr eatment. Experiment repeated with similar results. *p-value<0.05 based on Students t-test. PAGE 50 CHAPTER 3 FRUIT-SPECIFIC SUPPRESSION OF THE ETHYLENE RECEPTOR LEETR4 RESULTS IN EARLY RIPENING FRUIT Introduction Tomato is the most economically important vegetable crop grown in the USA. Worldwide, ~70 million metric tons are produced each year. S hort growing seasons in higher latitudes often reduce the number of cultivars a grower can use in outdoor cultivation. One mechanism to circumvent climate-related limitations is to grow early-maturing varieties. This offers a distinct advantage to growers, becau se the first fruit to market in a se ason can garner a higher price. As our knowledge of the molecular control of fr uit ripening expands, biotechnology can provide useful tools for generating early ripening cultivars. While much effort has focused on delayed ripening, particularly as it relates to the ripening hormone ethylene, opportunities to hasten fruit development have been relatively neglected. We have developed a tissue-specific approach to enhance ethylene responses in tomato fruits by depletion of an ethylene receptor. Transgenic fruits mature 5-7 days earlier than controls with no deleterious effect s on yield, fruit size or quality. This technology should be applicable to any fruit w hose ripening is dependent on ethylene. Ethylene is a phytohormone that controls or influences many aspects of plant growth and development (Abeles, 1992). Many of the developm ental processes controlled by ethylene such as senescence, organ abscission a nd fruit ripening are critically important to agriculture. For example, climacteric fruits, such as tomato, ba nana and apple, require an increase in ethylene biosynthesis at maturity in order to ripen. Transgenic plants that are reduced in either synthesis or perception of ethylene exhibit delayed ripening (Oeller et al., 1991; Klee et al., 1991; Wilkinson et al., 1995; Hamilton et al., 1990). Conve rsely, it should be possible to speed up fruit maturation by increasing synthesi s or perception of ethylene. Indeed, it has been known for many 50 PAGE 51 years that ethylene application to immature toma to fruits does cause earlier onset of ripening (Yang, 1987). Because of the pleiotropic negativ e effects of excessive ethylene exposure on plant growth, simply increasing ethylene synthe sis is not practical. Here, we describe an approach involving tissue specific depletion of an ethylene receptor resulting in early ripening fruit. Receptors function as negative regulators of the ethylene response pathway (Hua and Meyerowitz, 1998; Tieman et al., 2000). In the absence of the hormone the receptor actively suppresses ethylene responses and ethylene binding removes this suppression. In practical terms, this means that ethylene sensitivity is inversely correlated with receptor levels; depletion of receptors effectively increases ethylene sensi tivity because there are fewer receptors to inactivate. Recent work on the tomato ethylene r eceptor family has demonstrated that receptor levels during fruit development determine the ti ming of ripening (Kevany et al., 2007). Protein levels are at their highest duri ng immature fruit development and significantly drop at the onset of ripening, facilitating ethylenemediated ripening processes. Ethylene treatment of immature fruits causes receptor degradation and earlier fruit ripening (Kevany et al., 2007). Results LeETR4 RNAi Transgenic Plants Pr oduce Early Ripening Fruit Antisense-mediated reduction in either of two tomato ethylene receptors, LeETR4 or LeETR6 results in premature ripening (Tieman et al., 2000; Kevany et al., 2007). However, these plants are severely affect ed in many aspects of growth a nd it is not clear that the early ripening is a direct effect of transgene expression. We postulate d that fruit-specific suppression of the LeETR4 receptor would result in early ripeni ng without undesirable ethylene-related effects. In order to test the hypothesis a strategy was developed to specifically reduce LeETR4 expression throughout fruit development. To achi eve this goal we generated a construct 51 PAGE 52 consisting of an LeETR4 RNAi inverted repeat sequen ce fused to the promoter of Tfm7 a gene that is expressed specif ically in immature fruits (Santino et al., 1997). Transgenic plants were generated by Agrobacterium-mediated transformation into the tomato cultivar Flora-Dade, a large fruited variety developed fo r Florida fresh tomato production. Transgenic lines that showed no vegetative expression of the silencing construct were identif ied and assayed in a greenhouse for time from anthesis to breaker stage (the firs t visible signs of ripeni ng) in two successive seasons. Three lines that exhibi ted both a reduction in time fr om anthesis to breaker and a reduction of LeETR4 transcript throughout fruit deve lopment were chosen for further characterization. Transgenic line s began ripening between 5 and 7 days earlier than controls (Figure 3-1). No significa nt effects were observed on time from breaker to fully ripe nor were there differences in color of ripe fruits (data not shown). As expected, LeETR4 transcript levels were reduced by as much as 73% in immature fruit and 95% in ripeni ng fruit (Figure 3-2A). While Tfm7 expression has been reported to be immature fruit-specific the RNAi effect persisted into ripening fruit (Figure 3-2A). This gene-specific reduction in expres sion was not seen in nontarget tissues such as leaves (Figure 3-2A). Expression analysis of the other family members showed no decrease in transcript levels in transg enic plants (Figure 3-3) Protein blot analysis confirmed that ETR4 protein levels were co rrespondingly reduced at all stages of fruit development relative to non-transgen ic control fruit (Figure 3-2B). Early Ripening Lines Show Altered Ripening Coordination Performance of the transgenic plants was also assessed in the field using standard commercial practices. Harvests were conducted on a weekly basis in which all fruit that had begun to show external color development were picked and staged for their degree of ripeness. Transgenic plants had more ripening fruit in the first harves t than the control plants and 52 PAGE 53 transgenic lines were st ripped of between 77% and 86% of their fruit within the first two harvests (Figure 3-4). Transgenic Fruits are Indistinguishable from Wild Type Fruits in Horticultural Traits Early maturing varieties of fruits frequently lack the quality of slower ripening varieties. To achieve maximum value it would be advantage ous if early ripening fruits maintain the size, yield and flavor qualities of later ripening cultivars. Altering the time to maturation could potentially impact synthesis of sugars, acids a nd volatile compounds associated with flavor. In addition, fruit size and yield could potentially be negatively affected by earlier maturation and harvest. To address these questi ons, tests were performed to asse ss quality and yield attributes. Analyses of yield and fruit size were conducted in both greenhouse and fieldgrown plants. To assess yield, fruits were harvested at the onset of ripening and individually weighed. Average fruit size for two of the transgenic lines was slightly lower than control fruit but this difference was not statistically significant (Table 3-1 and Table 3-2). To tal yield and the number of fruit per plant were not affected by the pres ence of the transgene (Table 3-1 and data not shown). Tomato flavor is the sum of a complex in teraction between taste and olfaction. Sugars and organic acids stimulate tast e receptors while a set of volatile organic compounds (VOCs) stimulate olfactory receptors (Buttery et al ., 1993; Buttery and Ling, 1993). In order to assess potential effects on flavor, total soluble solids, citric acid, malic acid and the 16 most important VOCs were measured (Table 3-1, Table 3-3 and Table 3-4). Similar results were obtained on both field-grown and greenhouse-gr own materials. Although a very few statistically significant differences in citric acid and some VOCs were observed, they were not repeatable from season to season. All of these differences are well w ithin the range of obs erved season-to-season 53 PAGE 54 variations. Therefore, we concluded that the transgenic and control fruits are essentially equivalent. Discussion While the essential role of ethylene in media ting climacteric fruit ri pening has been known for many years, its role during immature fruit development is only now being elucidated. Previous work has shown that ethylene treatment of immature tomatoes or bananas quantitatively reduces the time to the onset of ripening (Burg and Burg, 1962; Lyons and Pratt, 1964; McGlasson et al., 1975; Yang, 1987) but the mech anism by which fruits measure cumulative ethylene exposure has remained unknown until now. We have identified a potential mechanism by which plants use ethylene receptor levels to measure cumulative ethylene exposure (Kevany et al., 2007). Ethylene binding triggers a ubiqui tin-dependent receptor protein degradation. If receptors are not replaced after ethylene-mediate d degradation, as occurs in immature fruit (Kevany et al., 2007), the fruit will become more sensitive to subsequent ethylene exposure and ripen earlier. The precise, fr uit specific targeting of LeETR4 described here, validates the model. These results define a critical role for LeETR4 in mediating ethylene responses. The special importance of this and another subfamily 2 recep tor, LeETR6, to ethylene responses (Kevany et al., 2007) contrasts markedly with what is known about ethylene perception in Arabidopsis. In Arabidopsis, no single loss-of-function receptor mutant has an obvious effect on ethylene responses and the subfamily 1 receptors seem to have a more important role in ethylene signal transduction (Wang et al., 2003). These results taken together with results described in Kevany et al. (2007) more broadly demonstrat e that plants have the capacity to regulate hormone responses by modulating receptor levels. Tissue-specific modulation of ethylen e sensitivity in transgenic plants has resulted in fruits with altered ripening without an agronomic penalty. A similar appro ach to precisely separate an 54 PAGE 55 advantageous trait from pleitr opic negative effects was employed by Davuluri et al., (2005) who used fruit-specific suppression of DET1 a photomorphogenesis regulatory gene, to increase both carotenoid and flavonoid content in transgenic tomatoes. Previous work on DET1 had reported increases in these phytochemicals in lossof-function mutants but global suppression of DET1 led to a number of serious developmental defect s that would prevent these plants from being used commercially. We present here a crop improvement that shou ld provide significant value to producers. Early season harvests of tomatoes and many ot her horticultural crops usually constitute a substantial percentage of a seas ons profits. The first fruit pick ed can be sold at a premium because supply is generally low and demand is hi gh. We have generated transgenic lines in an elite background that ripen up to a week earlier than their control (Figure 3-1). These lines have none of the developmental defects associated wi th global receptor suppression (Tieman et al., 2000; Kevany et al., 2007) because of fruit-specific suppression of the gene (Figure 3-2A). This approach for engineering early ripening should be applicable to any climacteric fruit species. 55 PAGE 56 Figure 3-1 Fruit-specific ETR4 RNAi Transgenic Lines Pr oduce Early Ripening Fruit (A) Days from anthesis to breaker were measured by tagging open flowers and recording the number of days until the first signs of co lor development. (B) Fruit from transgenic lines are similar in shape and color to control fruit. 56 PAGE 57 Figure 3-2 Suppression of LeETR4 is Fruit-specific. (A) qRT-PCR analysis of ETR4 transcript levels in leaf tissue and throughout fr uit development in control and RNAi transgenic lines. (B) Protein blot analys is of ETR4 protein le vels in control and transgenic lines. IMG, immature green; Breaker, first external color change; Turning, ~30% red color. 57 PAGE 58 Figure 3-3 ETR4 -RNAi Transgenic Plants Have Altere d Ripening Coordination. Fruits showing visible color development were harvested on a weekly basis. Values represent the percent of total fruit harv ested each week SE. 58 PAGE 59 Table 3-1 Weight, yield, br ix, citric acid and malic aci d from field grown fruits Weight Yield/Plant Citric Acid Malic Acid Line (g) (n) (kg) (n) oBrix (n) (mg/gfw) (n) (mg/gfw) (n) Control 135.53.1 218 4.51.4 9 4.10.2 10 2.76.04 5 0.220.02 5 RNAi-1 130.73.9 185 4.53.6 8 3.90.1 10 2.63.06 5 0.230.03 5 RNAi-2 131.43.1 262 4.49.4 12 3.80.1 10 2.69.14 5 0.230.02 5 RNAi-3 142.94.1 137 4.56.3 10 4.00.1 10 2.57.16 5 0.210.03 5 Table displays mean SE. n=number of fruit examined, or plants in case of yield study. Table 3-2 Weight, yield, brix, citric acid and malic acid from greenhouse grown fruits Weight Yield/Plant Citric Acid Malic Acid Line (g) (n) (kg) (n) oBrix (n) (mg/gfw) (n) (mg/gfw) (n) Control 115.44.4 98 3.68.2 3 4.20.1 10 3.10.03 15 0.500.03 15 RNAi-1 103.73.3 64 3.58.5 2 4.2.1 10 2.92.10 15 0.520.04 15 RNAi-2 106.93.2 70 4.13.2 2 3.8.1* 10 3.01.04 15 0.480.03 15 RNAi-3 118.94.4 142 4.69.4 3 4.0.0 10 3.24.03 15 0.480.03 15 Table displays mean SE. n=number of fruit examined, or plants in case of yield study. *Statistically significant p-value<0.05 based on Students t-test Table 3-3 Volatile organic com pounds from field grown fruits Compound Control RNAi-1 RNAi-2 RNAi-3 cis -3-Hexenal -Ionone Hexanal -Damascenone 1-Peneten-3-one 3-Methylbutanal trans -2-Hexenal 2-Isobutylthiazole 1-Nitro-2-phenylethane trans -2-Heptenal Phenylacetaldehyde 5-Methyl-5-hepten-2-one cis -3-Hexenol 2-Phenylethanol 3-Methylbutanol Methyl salicylate 37.486.48 0.050.01 83.3822.22 0.020.00 0.460.09 4.250.47 1.060.17 4.821.16 1.600.33 0.150.03 0.450.06 3.400.87 50.628.52 1.860.39 20.163.27 0.130.01 50.707.99 0.070.01 116.0619.78 0.030.01 0.480.07 4.190.42 1.270.29 5.740.99 1.200.43 0.170.03 0.500.1 3.810.80 64.783.63 1.890.55 18.164.05 0.190.05 66.694.76* 0.060.01 166.2318.54* 0.020.00 0.440.02 4.490.44 1.630.06* 5.660.65 1.920.37 0.200.04 0.510.15 4.570.86 69.198.37 2.610.67 17.194.05 0.170.05 34.765.53 0.040.01 59.514.08 0.020.00 0.400.04 4.620.63 0.860.08 3.790.42 1.120.40 0.130.02 0.370.01 3.020.29 41.604.54 1.490.04 16.563.40 0.140.04 Values are ng g-1 FW h-1 and table displays mean SE with n=6. Statistically significant p-value<0.05 based on Students t test. 59 PAGE 60 60 Table 3-4 Volatile organic com pounds from greenhouse grown fruits Compound Control RNAi-1 RNAi-2 RNAi-3 cis -3-Hexenal -Ionone Hexanal -Damascenone 1-Peneten-3-one 3-Methylbutanal trans -2-Hexenal 2-Isobutylthiazole 1-Nitro-2-phenylethane trans -2-Heptenal Phenylacetaldehyde 5-Methyl-5-hepten-2-one cis -3-Hexenol 2-Phenylethanol 3-Methylbutanol Methyl salicylate 105.0126.92 0.070.01 97.5015.17 0.020.01 0.470.02 7.511.00 2.150.53 2.550.54 0.070.01 0.250.07 0.270.02 3.660.63 53.706.73 1.040.29 47.153.01 0.170.06 105.4129.49 0.080.03 131.1730.44 0.020.01 0.530.22 7.721.11 2.440.67 2.380.65 0.100.00 0.360.13 0.230.06 5.071.64 57.1211.99 1.200.03 48.2011.74 0.230.07 115.4619.79 0.100.02 118.1823.15 0.030.01 0.590.15 8.010.81 2.260.50 2.330.40 0.070.00 0.330.06 0.300.03 3.510.49 50.536.44 1.320.19 43.558.62 0.110.03 122.3250.31 0.080.00 183.4911.45* 0.020.00 0.370.05 5.820.43 2.630.76 2.700.57 0.100.01 0.290.06 0.420.04* 4.341.48 59.991.47 1.670.03* 46.3511.81 0.340.14 Values are ng g-1 FW h-1 and table displays mean SE with n=4. Statistically significant p-value<0.05 based on Students t test. PAGE 61 CHAPTER 4 IDENTIFICATION OF QTLS THAT MODI FY TIME TO RIPENING AND RIPENINGASSOCIATED ETHYLENE PRODUCTION Introduction The use of wild germplasm has become an important method for crop improvement by todays plant breeders. Genetic diversity in todays domesticated varieties is narrow and land races that could provide traits necessary for crop improvement are being lost every year. The development of introgression lines (ILs) that each contain a single chromosome segment introgressed into an otherwise uniform backgr ound has allowed for the identification of many monogenic traits and quantitative trait loci (QTLs) (Frary et al 2003; Doganlar and Tanksley 2000; Fridman et al 2002). In tomato, a number of introgression lines have been developed from crosses with wild relatives, including L. pennellii (Eshed and Zamir 1995), L. hirsutum; Monforte and Tanksley 2000), and L. peruvianum These libraries are usef ul in identifying QTLs because any phenotypic variation can be associated with the introgressed segment. The entire library can be screened for a particular phenot ype and individual lines can be isolated. Once these lines are identified the introgressed segm ent can be further reduced into sub-ILs by subsequent back crossing. This permits further refinement of the QTL location and potentially, map-based cloning. ILs have been used to identify QTLs responsible for changes in yield, quality and stress responses (Fridman et al 2004; Zamir 2001). Tomato is the most economically important vegetable crop grown wo rldwide, providing significant incentive for crop improvement researc h. Short growing seasons in higher latitudes often reduce the number of varieties a grower can use or can force them to use greenhouses that require a significant investment. Id entification of loci that control the time it takes a fruit to reach maturity could offer a tremendous opportunity for breeders. Early ripe ning loci could be selectively bred into elite varieties that w ould be otherwise impossi ble to grow at higher 61 PAGE 62 latitudes. In addition to trad itional breeding transgenic approaches are being developed to provide options for growers but here I will focus on the traditional method. Regulation of ethylene biosynthe sis at the molecular level is a poorly understood process. Work done in Arabidopsis led to th e identification of prot eins that regulate th e activity of the key biosynthetic enzyme ACC synthase (ACS). The ETO1 and ETO-like proteins posttranslationally regulate the stability of ACS by targeting it to the 26S pr oteasome. Loss-of-function and dominant gain-of-functions mutants were isol ated by screening mutagenized populations for plants exhibiting a triple response in the absence of exogenous ethylene. Where ctr1 mutants exhibit this phenotype because of loss of signa ling capability in the absence of ethylene, eto mutants produce significantly more ethylene than controls because of enhanced ACS stability. An obvious difference between Arabidopsis and tomato is that tomato fruit go through a developmental switch that resu lts in a significant increase in ethylene production. While we understand that a developmental swit ch occurs that triggers the e xpression of particular ACS and ACO isoforms an understanding of the regulation of the expression and activity of these enzymes is lacking in tomato. While we will assess early ripening and increased ethylene biosynthesis separately, there is a significant possibility that a lo cus that leads to increased ethylene production could also lead to early ripening. While increased ethylene production leading to earl y ripening could prove to be easier to understand it could prove less useful in terms of breed ing early ripening lines because excessive ethylene production could lead to undesirable effects. In an effort to identify QTLs associat ed with ripening modification and ethylene production, a screen was performed on a set of ILs derived from the L. hirsutum genome. L. hirsutum was chosen to conduct this experiment because it is an unusual relativ e of the cultivated 62 PAGE 63 tomato. L. hirsutum produces small green fruit that never show any signs of ripening such as softening, carotenoid accumulati on or volatile production. Matur ity can only be assayed by the measurement of ethylene producti on rates and fruit do not reach maturity until approximately 70 days post-anthesis (Grumet et al, 1981). Once fruit reach maturity, there is a sharp increase in ethylene production that p eaks at between 2000-4000 uL kg-1 day-1, roughly ten times that of cultivated tomato varieties. These unusual pheno types suggest the presen ce of loci that may influence ripening and ethylene sy nthesis in unusual ways. Results In a preliminary experiment ethylene emissions of fruit grown in the field were measured and a line (LA 3945) that produces up to four times the amount of ethylene produced by the control at the red stag e was identified. This phenotype was confirmed with greenhouse-grown fruit (Figure 4-1). In an effort to conduct a mo re comprehensive analysis, 35 different lines, each containing a different segment of the L. hirsutum genome, along with both isogenic parents were grown in triplicate in the gree nhouse. A randomized complete block design was utilized as an experimental design in order to control for vari ation within the greenhouse. Flowers of each line were tagged at anthesis to determine the number of days from anthesis to breaker (Figure 4-2). Statistical analysis using D unnetts test identified three lines (3935, 3958 and 3968) that had reduced time to ripening with a p-value<0.05. Fruit from the same plants were collected at the breaker and red ripe stages to measure ethylen e emission rates (Figure 4-3 & 4-4). Statistical analysis using Dunnetts t test identified four (3922, 3935, 3944 and 4005) and three lines (3922, 3934 and 3969) with increased ethylene emission in breaker and red fruit, respectively. In addition to the lines identified by statistical an alysis we included a few lines for each trait assayed that were close to th e p-value<0.05 cut-off. Figure 45 is a representation of the approximate locations of each introgressed segment in the tomato genome. This map was used as 63 PAGE 64 a guide to develop a library of markers from the sequence information available in the SOL Genomics Network database. A post doctoral researcher in our lab has taken over this project and will use the markers to fine map the exact locatio ns of these pieces. The map also contains the locations of all known ethylene receptors and A CC-synthase (ACS) isoforms because they are possible candidates for these QTLs. In order to replicate the results of the first experiment we grew the identified lines in a greenhouse to assess the ripening trait and in th e field to assess ethyl ene emission. Again, each line was grown in triplicate along wi th both isogenic parents. In addition to the selected lines additional lines from the collecti on that overlap the introgressed L. hirsutum segments were included in the analysis to better map the loca tion of each QTL. Greenhouse data for the ripening lines is presented in Figure 4-6. Of the original lines selected only those that had previously showed a statistically signif icant change in ripening (3935, 3958 and 3968) repeated a reduction that was again statistically si gnificant. The other lines (3921, 3955 and 3964) were assayed again because they were close to making our cutoff of 0.05. The fact that these lines did not show a significant reduction in the following season stro ngly supports our confidence in the statistical analysis of the data from the first season. Inte restingly line 3921 did not itself show a reduction in the second season but three overla pping lines 3922, 3923 and 3924 were found to be significantly lower than the control. Due to the la bor intensive nature of measuring ripening time, only lines 3935, 3958 and 3968 will be further characterized. In order to gain a better understanding of the increase in ethylene emission, field grown fruit were harvested at four stages and ethylen e emissions were measured. Figure 4-7 shows the complexity of the trait, with some lines being statistically higher at some st ages and not at others. IL 3922 and two overlapping ILs had a higher leve l of ethylene emission during early ripening 64 PAGE 65 (i.e. breaker) but returned to WT levels by the red stage. IL 3935 and its overlapping lines were low early in ripening but statisti cally higher at the pink and red stages. In accordance with early studies, line 3945 had the highest ethy lene emissions of any of the lin es tested, with more than 2fold higher rates at the pink stage. Additional lines overlapping 3945 had higher ethylene emission at each ripening stage tested. IL 3969 ha d higher emission rates at the breaker and pink stages but returned to WT leve ls by the red stage. The complex nature of this phenotype has made analysis more difficult. While we were princi pally interested in ethylene emissions in fruit we were interested to determine if the increases were limited to the fruit. Ethylene emissions of young leaves were assayed (Figure 4-8). No statistic ally significant differences were seen for any of the lines suggesting th at the increases were confined to ri pening fruit tissue. Interestingly the L. hirsutum isogenic parent (1777) showed the lowest leaf ethylene emissions and this was confirmed by repeating this experiment. Due to the fact that many of the introgressed pieces were quite large, backcrosses were made to the isogenic L. esculentum parent for all lines that repeated in the second season. All of the data displayed from the second season (Figures 4-6 and Figure 4-7) were collected and analyzed by Dr. Valeriano Dal Cin, a post doctoral researcher in our lab. He has also isolated homozygous recombinants from the backcrosses performed during the second season and is currently analyzing the progeny of those recombinants. Due to our interest in receptor function we were intrigued to see that the IL that consistently emitted more ethylene (3945) cont ains a chromosomal segment that potentially encodes the L. hirsutum ortholog of LeETR4 In order to determine which allele is present in 3945, the intron of this gene from the 3945 line was cloned and compared to both the L. esculentum and L. hirsutum sequences (Figure 4-9). The IL was confirmed to contain the L. hirsutum allele. In order to understand whether this allele showed any diff erential expression I 65 PAGE 66 performed qRT-PCR on RNA collected from vegeta tive and reproductive tissues (Figure 4-10). While there are some differences at particular stages the basic trend of expression is similar between the control and IL. In addition to an an alysis of developmental expression both parents and 3945 seedlings were exposed to ethylene in order to determine if the ethylene inducibility of the L. hirsutum allele was altered (Figure 4-11). No si gnificant difference was observed between any of the genotypes. An additional time to ripe ning experiment showed no statistical difference between the L. esculentum parent and 3945. Subsequent marker analysis of the introgression region at 3945 found that both 3944 and 4005 overlap 3945 and all three have increased ethylene emission. This region of the introgressed segment is not the area that contains LhETR4 These additional data suggest that the L. hirsutum allele of LeETR4 is likely not the cause of the increased ethylene phenotype. Discussion Marker assisted breeding is an importa nt technique used to address fundamental problems in plant biology and crop improvement. It is particularly important with the current public attitudes toward genetically modified organisms. Breeders are increasingly going to require the identification of markers that are lin ked to agronomically important traits. A close relationship between researchers and breeders will allow for efficien t introduction of newly identified traits into existing varieties. While a number of different resources are av ailable for mapping traits of interest in tomato, the development of introgression populations using different wild relatives has greatly enhanced this process. These populations facilitate sorting an entire genome down to a small, known segment that can be assayed for a partic ular phenotype. In a ddition, once the tomato genome sequencing project is complete it will be relatively straightforward to screen a population and then search a particular genomic location for candidate genes. 66 PAGE 67 While a great deal of res earch has been done on the ethyl ene biosynthetic pathway the only proteins that have been identified that ac t to modulate this pathway are the ETO proteins. This modulation is accomplished by inhibiting ac tivity of the ACS protein and targeting it for degradation via the 26S proteasome. Identification of additional regulators of ethylene synthesis will broaden our understanding of the factors affec ting synthesis, whether they be positive or negative. We present here a strategy to identify QTLs that control ripening-associated ethylene production by screening L. hirsutum ILs. The choice of the L. hirsutum introgression population was originally made because of the unusual abil ity of this species to produce high levels of ethylene during ripening (Grumet et al., 1981). We have identified six in trogression lines that produce significantly more ethylene during at leas t one stage of fruit ripening (Figures 4-3, 4-4 and 4-7). This increased ethylen e emission is restricted to ri pening fruit as no difference was seen in leaf ethylene biosynthe sis rates in selected introg ression lines (Figure 4-8). A significant amount of research surrounding fruit ripening has been completed in the past century but we still do not unders tand how fruits regulate ripeni ng at the molecular level. In climacteric fruits it is clear that there are two important levels of regul ation, developmental cues and ethylene synthesis. Work done on tomato in the past five years has begun to unravel this phenomenon at both levels with the identification of the RIN and NOR genes as well as the ethylene receptor family (Vreba lov et al., 2002; Kevany et al., 2007). While these findings are important steps, fruit development is a comple x and there are likely many additional regulators of this process. Due to the unus ual nature of ripening, or lack of ripening, in the wild tomato species L. hirsutum, we hypothesized it may allow for the identification of some additional factors regulating fruit development and specifically the onset of ripening. In addition to the ILs with increased ethylene emission our screen iden tified three lines that showed significantly 67 PAGE 68 reduced time from anthesis to breaker that was confirmed in two experiments (Figures 4-2 and 46). Future work will involve finer mapping of the L. hirsutum QTLs. Backcrosses have been performed for each ripening and ethylene line and recombinants are being identified by a postdoctoral researcher in our lab. A library of cleaved amplified polymorphic sequence (CAPS) markers has been generated to precisely map each introgressed segment. Eventually these loci will be cloned by a map-based approach or by use of the tomato genome sequence and will increase our knowledge of both these processes. 68 PAGE 69 Figure 4-1 Ethylene emissions of fully ripe fruit from L. hirsutum IL 3945. Red fruit were sealed in 500 mL jars for ~1 h and ethylene emission was measured by gas chromatography. Values represent mean S E. *Statistically significant values pvalue<0.05 based on Dunnetts t test. 69 PAGE 70 Figure 4-2 Days from anthesis to breaker of tagged fruits from L. hirsutum ILs. Open flowers were tagged at anthesis and the number of days to breaker were recorded. *Statistically significant values p-va lue<0.05 based on Students t test. 70 PAGE 71 Figure 4-3 Ethylene emissi ons of breaker fruit from L. hirsutum ILs. Breaker fruit were sealed in 500 mL jars for ~1 h and ethylene emission was measured by gas chromatography. *Statistically significant values p-value<0.05 based on Dunnetts t test. 71 PAGE 72 Figure 4-4 Ethylene emissions of fully ripe fruit from L. hirsutum ILs. Red fruit were sealed in 500 mL jars for ~1 h and ethylene emi ssion was measured by gas chromatography. *Statistically significant values pvalue<0.05 based on Dunnetts t test. 72 PAGE 73 Figure 4-5 Genomic map showing locations of introgressed regions that contain putative ripening-associated QTLs. Black regions re present locations of QTLs controlling ripening phenotype. White re gions represent locations of QTLs controlling increased ethylene emission phenotype. Dark grey regions repres ent portions of introgressed pieces that are ambiguous based on original mapping done with population. Map also contains locations of all known ethylene receptors and ACC synthase isoforms. 73 PAGE 74 Figure 4-6 Days from anthesis to breaker of tagged fruits from L. hirsutum ILs. Open flowers were tagged at anthesis and the number of days to breaker were recorded. *Statistically significant values p-value<0.05 based on Students t test. CT, control. 74 PAGE 75 Figure 4-7 Ethylene emissions of fruits from field-grown L. hirsutum ILs. Fruit at indicated stages were sealed in 500 mL for ~1 h and ethylene emission was measured by gas chromatography. Breaker, first external signs of ripening; pink, ~70% color development. 75 PAGE 76 Figure 4-8 Ethylene emi ssions of leaves from L. hirsutum ILs. Young leaves were harvested and immediately placed in 5 mL plastic tube s, but were left uncapped for ~1/2 h to permit release of wound-induced ethylene. Af ter sealing, tubes were left for ~ 3 h and then ethylene emission was analy zed by gas chromatography. CT, control. 76 PAGE 77 Figure 4-9 Nucleotide ali gnment of ETR4 genomic sequence. Sequence isolated from L. esculentum L. hirsutum and IL 3945. Alignment was done using ClustalW and presented using Shade Box software. 77 PAGE 78 Figure 4-10 mRNA expression of LeETR4 in WT and the L. hirsutum IL 3945. qRT-PCR analysis of transcript levels in leaf and reproductive tissues Values represent mean SE and presented as % of total RNA. 78 PAGE 79 79 Figure 4-11 mRNA expression of LeETR4 in seedlings of WT, L. hirsutum and IL 3945. qRTPCR analysis of transcript levels in leaf tissue treated with 10ppm ethylene. Values represent mean SE and presented as % of total RNA. PAGE 80 CHAPTER 5 CONCLUSION The solanaceous species Lycopersicon esculentum tomato, has emerged as the model for studying fleshy fruit development. Because tomato is a climacteric species it is also the species of choice for studying ethylenes involvement in fruit development. Ethyl ene is essential for normal fruit ripening in these species and blockage of either ethylene production or perception leads to improper ripening. In tomato fruits, et hylene has profoundly diff erent effects depending on the stage of development w ith a distinct developmental switch that occurs upon fruit maturation. Treatment of mature fruits results in the initiation of a ripening program. While treatment of immature fruits doe s not initiate ripening, it does si gnificantly hasten the onset of subsequent ripening (Yang, 1987). Our understanding of how fru its measure this ethylene exposure has not been previously determined. The primary objective of this project was to identify the mechanism controlling this phenome non and to gain a bette r understanding of the factors that control ri pening in general. Previous work in our lab showed that reduced accumulation of a single receptor, LeETR4, resulted in fruits that ripen signi ficantly earlier than control fruits (Tieman et al., 2000). In this study LeETR6 reduced expression lines exhibite d similar effects to those of LeETR4 (Table 2-1; Kevany et al., 2007). While these results are consiste nt with the model that the receptors act as negative regulators of ethylene signaling, they do not a ddress the question of how fruits measure cumulative ethylene exposure. Analysis of r eceptor mRNA expression during fruit development indicated a significant increase in receptor mRNAs at the onset of ripening coincident with the increase in ethylene biosynthesi s (Figure 2-1, Figure 2-2). Cont rary to the mRNA expression data, protein blot analysis of NR, ETR4 and ETR 6 showed receptor protein levels highest in immature fruit with a significant decrease at the onset of ripening (Figure 2-4). While these data 80 PAGE 81 are contradictory to the mRNA expression data, they are consis tent with a model in which ethylene binding affects receptor pr otein stability. In an attempt to validate this hypothesis, we exposed fruit and vegetative tissues to ethylene and observed that recepto r proteins are rapidly degraded in response to ethylene and that th is likely occurs thr ough the 26S proteasomedependent pathway (Figure 2-5, Figure 2-6). While ligand binding-induced degradation of receptors has been described in mammalian and yeast systems, this work is the first example in plants. These results led to a hypothesis that redu ced levels of receptor proteins, due to ethylene exposure, control the early ripeni ng in ethylene treated immature fr uit. To test this hypothesis, we treated immature fruits, while still attached to the plant, with ethyle ne and measured protein levels throughout fruit development. Treated fr uits had reduced receptor protein levels after ethylene treatment and these fruits ripened earlier than untreated controls (T able 2-2, Figure 2-7). Together these data are consiste nt with our model that ethylene exposure leads to a degradation of receptor proteins and that ethylene recep tor levels modulate the timing of ripening. While reduction of receptor levels results in early ripening fruit, systemic reduction also causes severe developmental effects that w ould prevent the use of this method for crop improvement (Figure 2-3). A technique to reduce the time from fruit set to the onset of ripening could allow for an increase in the number of varie ties available to farmers in higher latitudes. To generate early ripening lines, we developed a fruit-specif ic RNAi construct to reduce LeETR4 levels only in the fruit. Fruit-specific suppression of LeETR4 resulted in fruits that ripened up to 7 days early (Figure 3-1). While ear ly ripening fruit would be advant ageous they must also retain the same quality as traditional varieties. To test fruit quality I measured average fruit size, yield, soluble solids, malic and citric acid content as well as the most important tomato flavor volatile organic compounds. There was little or no difference between transgenic and control fruits. In 81 PAGE 82 82 addition to providing a unique me thod of crop improvement these data also validate our model that receptor levels in the fruit control the timing of ripening. While biotechnology has provided us with many tools for gene discovery and crop improvement, current public concerns have limited the marketing of transgenic foods. In an effort to identify additional factors that regu late the timing of ripe ning we undertook a genetic approach. A screen of a L. hirsutum introgression population wa s conducted because of the unusual ripening characteristic s and high ethylene biosynthesis levels of this species. Individual lines were screened for reduced time from an thesis to breaker and for increased ripeningassociated ethylene synthesis. Three lines with a reduction of time to breaker were identified and the results were repeatable across seasons. Seven lines that had increased ethylene emissions at the breaker or red stages were identif ied. Due to the large segments of the L. hirsutum genome that are found in these lines they had to be backcrossed to the L. esculentum parent to better map the loci controlling ethylene emissions. Recombin ants that may provide ma terial for a map-based cloning approach for gene disc overy have been identified. The work presented here has significantly increased our understa nding of how ethylene regulates ripening in climacteric fruits. While ethylene is not required for the ripening of nonclimacteric fruits, it can have significant effect s on fruit development in these species. Ethylene can cause damage to the fruits of many different species and our unde rstanding of receptor function could greatly enhance our ability to limit these losse s. Ethylene-related losses in underdeveloped countries often account for a significant proportion of the postharvest losses and are an opportunity for our research to have a serious impact. PAGE 83 CHAPTER 6 MATERIALS AND METHODS Plant Materials and Growth Conditions L. hirsutum cv. Flora-Dade, LeETR4AS, LeETR6AS and TFM7ETR4 -RNAi lines were grown in a greenhouse set at approximately 27oC. Individual plants were grown in 3 gal pots that were watered twice a day and supplemented with sl ow release fertilizer. Time to ripening data was collected by tagging open flowers and record ing the number of days from anthesis to breaker. L. hirsutum cv. Micro-Tom and Nr plants were grown in a growth chamber under standard conditions (16 h day/8 h night). Field plants were gr own in randomized, replicated plots in Live Oak, FL. Plants were grown using standard commer cial practices in raised plastic mulched beds. Development of Transgenic Plants LeETR4-AS and LeETR6-AS lines were generated by cloning the full-length LeETR4 or LeETR6 coding region into a vector in the antisense orientation under the control of the Figwort Mosaic Virus 35S promoter (Richins et al ., 1987) and followed by the Agrobacterium tumefaciens nopaline synthase ( nos ) 3' terminator. The transgene was introduced into cv. FloraDade by the method of McCormick et al (1986), with kanamycin resistance as a selectable marker. Transgenic lines with a reduction of >70% of LeETR6 transcript were identified (Table 1). The specificity of the transgene was determ ined by quantification of every receptor mRNA from leaf tissue. In each case there was no effect on RNA levels of any other receptor. LeETR4 fruit-specific RNAi lines were genera ted using method outlined by Dexter et al. (2006). Briefly, two overlapping fr agments of coding region were PCR amplified from tomato fruit cDNAs, one 400 bp and 200 bp in length, pr imer sequences found in Table 6-1. The two PCR products were ligated end to end and subse quently ligated into an EcoRI site in the 83 PAGE 84 pMON999 vector that contained the TFM7 fruit specific promot er. The cassette containing the promoter, RNAi fragment and nos terminator were excised from the vector and ligated into the pHK plant expression vector. The transgen e was introduced into cv. Flora-Dade by Agrobacterium-mediated transformation according to McCormick et al. (1986), with kanamyacin resistance as a selectable marker. Pharmacological Treatments Ethylene treatments of plant material were done in sealed 38 L tanks. Treatments were performed using either 10 or 50 ppm, as indicated concentrations in tanks was monitored by gas chromatography. These levels are both w ithin the linear re sponse range for NR and LeETR4 ethylene inducibility (Ciardi et al. 2000). Prot easome inhibitor studies were performed by spraying seedlings with an 80 M MG132 solution (8% DMSO) 4 h prior to 2 h ethylene treatment. Control seedlings were sprayed w ith an 8% DMSO soluti on. 1-MCP treatment of seedlings was performed at 1 ppm in a sealed 38 L tank for 16 h prior to 2 h ethylene treatment. Control seedlings were sealed in identical tank s for the same duration of time. All microsomal membrane preparations were performe d immediately after treatment ended. Recombinant Protein Expression and Antibody Production Coding regions of LeETR4 (a.a. 532-684) and LeETR6 (a.a. 522-688) were amplified with primer pairs ETR4-PF, ETR4-PR, ETR6-PF and ETR6-FR (Table 6-1) from fruit cDNAs generated with the Clontech One-step cDNA Synt hesis kit. PCR products were digested with BamHI and BglII and cloned into the Invitr ogen pTrcXHisA vector and subsequently transformed into the BL21(DE3) (Invitrogen) E. coli strain for recombinant protein expression. 100 mL cultures were grown at 30oC and induced with 1 mM IP TG for 4 h. Cells were spun down at 8,000 x g, resuspended in 10mL of lysis buffer (8 M urea) and pulse sonicated for 1 min. Lysate was spun down at 8,000 x g and supernatant was purified with Ni-NTA affinity column 84 PAGE 85 as directed. Recombinant protein was submitted to Cocalico Biologicals (Reamstown, PA) for antibody production in rabbits using their standard protocol. Antiser um was received and used to probe both antigens to determine antiserum specificity for its respective antigen. RNA Expression Analysis Total RNA extractions were performed us ing the Qiagen RNeasy Mini Kit with subsequent DNase treatment to remove a ny contaminating DNA. RNA was quantified by spectroscopy and visually analyzed on ethidi um bromide-stained gels to assure equal concentrations of all RNAs. Quantitative RT-PCR assays were performed using the Applied Biosystems Taqman One-step RT-PCR kit in an Applied Biosystems GeneAmp 5700 Sequence Detection System as described (Tieman et al. 2001). PCR conditions were as follows, Step 1: 48oC for 30 min, Step 2: 95oC for 10 min and Step 3: 95oC 15 sec and 60oC for 1 min (40X). Primer and probe pairs for each gene assayed can be found in Table 6-1. Levels of LeETR RNAs were quantified using RNAs synthesized by in vitro transcription from plasmids containing the coding region of each gene using a Maxiscript in vitro transcription kit (Ambion, Austin TX USA). Total g of in vitro -transcribed RNA were determined and the in vitro transcription product used for a standard curve in real-tim e RT-PCR analysis. Results are reported as % LeETR RNA in total RNA. Microsomal Membrane Isolation and Protein Blot Analysis Microsomal membrane fractions were is olated from fruit or seedlings with a homogenization buffer containing 30 mM Tris (pH 8.2), 150 mM NaCl, 10 mM EDTA, and 20% (v/v) glycerol with protease inhibitors (1 mM PMSF, 10 g/mL aprotinin, 1 g/mL leupeptin, and 1 g/mL chymostatin) as described (Schaller et al ., 1995). Tissue was homogenized at 4oC using a polytron and then centrif uged at 8,500 x g for 15 min at 4oC. The supernatant was 85 PAGE 86 strained through cheeseclo th then centrifuged at 100,000 x g for 30 min at 4oC and the subsequent membrane pellet was resuspended in 10 mM Tris (pH 7.5), 5 mM EDTA, and 10% (w/w) sucrose with protease inhibitors and stored at -80 oC. Protein concentrations were determined using the Bio-Rad Protein Assay reagent with BSA used for a standard curve. 20 g of total protein was run out for each sample on a 12% Tris-HCl gel and proteins were transferred to a nitrocellulose membrane using the Bio-Rad Mini Trans-Blot cell. Membranes were blocked overnight in 10% Carnation milk/Tris Buffered Saline-Tween (TBST) at 4oC. Membranes were washed 2x5 min in TBST and then incubated with primary anti-ETR4 (1:2000) or anti-ETR6 (1:5000) antibody diluted in 5% Carnation milk /TBST for 1 h. Membranes were subsequently washed 3x10 min in TBST and then incubated with peroxidase conjugated goat anti-rabbit (1:5000) secondary antibody (Kir kegaard & Perry Laboratories, Gaithersburg, Maryland) diluted in 5% Carnation milk/TBST for 45 min. Membra nes were finally washed 3x10 min in TBST. Visualization of signal was perf ormed using the Amersham ECL De tection reagents before being exposed to film. Quantification of bands was acc omplished by using the NCBI imaging software ImageJ (http://rsb.info.nih.gov/ij/). Values were normalized to an anti-BiP (endoplasmic reticulum immunoglobulin bind ing protein) antibody (generously provided by Alan Bennett, Univ. of California, Davis) which was used as an ER-localized loading control. Acid and Soluble Solids Analysis Individual tomato fruit were homog enized in a blender for 30 s and frozen at C until acid analysis. Samples were thawed, centrifuged at 16 000 g for 5 min. The supernatant was analyzed for citric and malic acid content using citric acid and malic acid analysis kits (RBiopharm, Marshall, M I) according to the manufacturer's instructions. Soluble solids are expressed as oBrix which is a measurement of the mass ratio of dissolved sucrose to water in a 86 PAGE 87 liquid. Individual fruit were homoge nized in a blender for 30 s. 1 mL of the homogenate was centrifuged at 16,000 x g for 2 min. ~75 uL of supernatant was applied to a handheld refractometer. Volatile Analysis Ripe tomato fruit from each line and its corresponding control coll ected from the field were harvested and volatiles from pooled fruits were collected on the day after harvest. Fruits collected from plants grown in the greenhouse were analyzed for fruit volatiles immediately after harvest. Tomato fruit volatiles were collected from chopped fruit with nonyl acetate as an internal standard as described by Schmelz et al (2003). Chopped fruit was en closed in glass tubes, air filtered through a hydrocarbon trap (Agilent, Palo Alto, CA) flowed through the tubes for 1 h with collection of the volatile compounds on a Super Q column. Volatiles collected on the Super Q column were eluted with methylene chloride after the addition of nonyl acetate as an internal standard. Volatiles were separated on an Agilent (P alo Alto, CA) DB-5 column and analysed on an Agilent 6890N gas chromatograph with retention times compared to known standards (Sigma Aldrich, St Louis, MO). Volatile levels were calculated as ng g FW h collection. Identities of volatile peaks were confirmed by GCMS as described by Schmelz et al (2001). 87 PAGE 88 88 Table 6-1 Oligonucleotide Primers and Probes ETR4-PF ETR4-PR ETR6-PF ETR6-PR ETR4-RNAi-F1 ETR4-RNAi-R1 ETR4-RNAi-F2 ETR4-RNAi-R2 ETR1-TaqF ETR1-TaqR ETR1-Probe ETR2-TaqF ETR2-TaqR ETR2-Probe NR-TaqF NR-TaqR NR-Probe ETR4-TaqF ETR4-TaqR ETR4-Probe ETR5-TaqF ETR5-TaqR ETR5-Probe ETR6-TaqF ETR6-TaqR ETR6-Probe CCGGATCC CGTGATAACGCCTATATCAGG CCAGATCT GACGATTTGGAATGAGGATAC CCGGATCC CCGAGATCAAACTCATCCAATG CCAGATCT GCCATCTAAATCAGGCAGATG GGAGATCT GGCATTCCTGAATATGGGG CCGGCGCGCCGAGGATACAGCAGGGCTAAG CCGGATCC GGCATTCCTGAATATGGGG GGGGCGCGCCCATCATTCTACTTCCCCGTAGC TTCAAGGATTAAAGGTTTTGGTGAT ATCACATCCAAGGTGTGTAAGCA FAM-ATGAGAATGGTGTTAGCAGGATGGTAACCAAABHQ GCCGTCAGTGTACATGAGAAATTT AGTTTTCTTTTGTCACTTGGTCAGTGT FAM-AGAGGCCACTTATTGTGGCACTAACTGGG-BHQ AGGGAACCACTGTCACGTTTG CTCTGGGAGGCATAGGTAGCA FAM-AGTGAAACTCGGAATCTGTCACCATCCAA-BHQ GGTAATCCCAAATCCAGAAGGTTT CAATTGATGGCCGCAGTTG FAM-AAAGCATGGCTGTCGTTCTTGGGCT-BHQ AGTCATCTTTTAGGAAACGCATGTT AGGAGTACATGAAGGCCTCTGAA FAM-AATACAGAAATCCTTTGGAGCAACCG-BHQ ATTCCAAAGGCAGCCGTTAA GGATGTGGATATGTGGGATTAGAAG FAM-CTCCACATATTCGGACATGCCTAAGGGA-TAMRA BamHI BglII BamHI BglII BglII AscI BamHI AscI Nucleotides in bold face represent restriction sites PAGE 89 LIST OF REFERENCES Abeles, F.B., Morgan, P.W. and Saltveit, M.E. (1992) Ethylene in Plant Biology Ed 2. Academic Press, San Diego. Adams, D.O. and Yang, S.F. (1979) Ethylene biosynthesi s: Identification of 1aminocyclopropane-1-carboxylic ac id as an intermediate in the conversion of methionine to ethylene. PNAS, 76, 170-174. Alba R., Payton P., Fei Z., McQuinn R., De bbie P., Martin G.B., Tanksley S.D. and Giovannoni J.J. (2005) Transcriptome and selected metabolite analyses reveal multiple points of ethylene control duri ng tomato fruit development. Plant Cell, 17, 2954-2965. Alonso, J.M., Hirayama, T., Roman, G., Nourizadeh, S. and Ecker, J.R. (1999) EIN2, a bifunctional transducer of ethylene a nd stress responses in Arabidopsis. Science, 284, 2148-2152. Azevedo, C., Santo-Rosa, M.J. and Shirasu, K. (2001) The U-Box protei n family in plants. Trends Plant Sci. 6, 354-358. Barry, C.S., Llop-Tous, M.I. and Grierson, D. (2000) The regulation of 1-aminocyclopropane1-carboxylic acid synthase gene expression during the transition from System-1 and System-2 ethylene synthesis in tomato. Plant Phys. 123, 979-986. Berrocal-Lobo, M., Molina, A., and Solano, R. (2002) Constitutive expression of ETHYLENE-RESPONSIVE-FACTOR1 in Arabidopsis confers resistance to several necrotrophic fungi. Plant J. 29, 23-32. Binder, B.M., Walker, J.M., Gagne, J.M., Emborg, T.J., Hemmann, G., Bleecker, A.B., Vierstra, R.D. (2007) The Arabidopsis EIN3 bindi ng F-Box proteins EBF1 and EBF2 have distinct but overlapping roles in ethylene signaling. Plant Cell 19, 509-523. Bleecker, A.B., Estelle, M., Somerville, C. and Kende, H. (1988) Insensitivity to ethylene conferred by a dominant mutati on in Arabidopsis thaliana. Science 241, 1086-1089. Blilou, I., Fruigier, F., Folmer, S., Serralbo, O., Willemsen, V., et al. (2002) The Arabidopsis HOBBIT gene encodes a CDC27 homolog that links the plant cell cycle to progression of cell differentiation. Genes Dev. 16, 2566-2575. Boller, T. (1991). Ethylene in pathogenesis and disease resistance. In: Mattoo AK, Suttle, JC, eds. The plant hormone ethylene Boca Raton, FL: CRC Press: 293-314. Burg S.P. and Burg E.A. (1962) Role of ethylene in fruit ripening. Plant Phys. 37, 179-189. Burg. S.P. (1962) The physiology of ethylene formation. Ann. Rev. Plant Phys. 13, 265-302. Burg S.P. and Clagett, C.O. (1967) Conversion of methionine to ethylene in vegetative tissue and fruits. Biochem. Biophys. Res. Comm 27, 125-130. 89 PAGE 90 Buttery, R.G. Quantitative and sensory aspects of fla vour of tomato and other vegetables and fruits. In: Acree TE, Teranishsi R, eds. Flavor science: sensible principles and techniques. Washington, DC: American Chemical Society, 259 (1993). Buttery, R.G. and Ling, L.C. (1993) Volatile components of tomato fruit and plant parts: relationship and biogenesis. ACS Symposium Series 525, 23. Cancel, J.D. & Larsen, P.B. (2002) Loss-of-function mutati ons in the ethylene receptor ETR1 cause enhanced sensitivity and exaggerate d response to ethylene in Arabidopsis. Plant Physiol 129 1557-1567. Capron, A., Okresz, L., and Genschik, P. (2003) First glance at the plant ACP/C, a highly conserved ubiquitin-protein ligase. Trends Plant Sci. 8, 83-89. Carvalho, P., Goder, V. and Rapoport, T.A. (2006) Distinct ubiquitin-ligase complexes define convergent pathways for the de gradation of ER proteins. Cell 126,361-373. Chang, C., Kwok, S.F., Bleecker, A.B. and Meyerowitz, E.M. (1993) Arabidopsis ethyleneresponsive gene ETR1 : similarity of products to two-component regulators. Science, 262 539-544. Chao, Q., Rothenberg, M., Solano, R., Roman, G., Terzaghi, W. and Ecker, J.R. (1997) Activation of the ethylene gas response path way in Arabidopsis by the nuclear protein ETHYLENE-INSENSITIVE3 and related proteins. Cell 89, 1133-1144. Chen, Y.F., Randlett, M.D., Fi ndell, J.L. and Schaller, G.E. (2002) Localization of the ethylene receptor ETR1 to the endop lasmic reticulum of Arabidopsis. J. Biol. Chem 277, 19861-19866. Ciardi, J.A., Tieman, D.M., Lund, S.T., Jones, J.B., Stall, R.E. and Klee, H.J. (2000) Response to Xanthomonas campestris pv. Vesicatoria in tomato involves regulation of ethylene receptor gene expression. Plant Phys 123 81-92. Clark, D.G., Gubrium, E.K., Barre tt, J.E., Nell, T.A. and Klee, H.J. (1999) Root formation in ethylene insensitive plants. Plant Physiol 121 53-60. Clark, K.L., Larsen, P.B., Xiaoxia, W. and Chang, C. (1998) Association of the Arabidopsis CTR1 Raf-like kinase with the ETR1 and ERS ethylene receptors. PNAS, 95, 5401-5406. Dharmasiri, N., Dharmasiri, S. and Estelle, M. (2005) The F-box protei n TIR1 is an auxin receptor. Nature, 435, 441-445. Davuluri, G.R., van Tuinen, A., Fraser, P.D ., Manfredonia, A., Newman, R., Burgess, D., Brummell, D.A., King, S.R., Palys, J., Uhlig, J., Bramley, P.M., Pennings, H.M. and Bowler, C. (2005) Fruit-specific RNAi-mediate d suppression of DET1 enhances carotenoid and flavonoid content in tomatoes. Nat. Biotechnol 23, 890-895. 90 PAGE 91 Deveaux, Y., Peaucelle, A., Roberts, G.R., Coen, E., Simon, R., Mizukami, Y., Traas, J., Murray, J.A., Doonan, J.H. and Laufs, P. (2003) The ethanol switch: a tool for tissuespecific gene induction dur ing plant development. Plant J. 36 918-930. Dexter, R., Qualley, A., Kish, C.M., Ma, C.J., Koeduka, T., Nagegowda, D.A., Duderava, N., Pichersky, E. and Clark, D. (2007) Characterization of a petunia acetyltransferase involved in the biosynthesis of the floral volatile isoeugenol. Plant J. 49, 265-275. Dharmasiri, N., Dharmasiri, S. & Estelle, M. (2005) The F-box protein TIR1 is an auxin receptor. Nature 435, 441-445. Dill, A., Thomas, S.G., Hu, J., Steber, C.M. and Sun, T. (2004) The Arabidopsis F-Box protein SLEEPY1 targets gibberellin signa ling repressors for gibberellin-induced degradation. Plant Cell, 16, 1392-1405. Doganlar, S. Tanksley, S.D. and Mutschler, M.A. (2000) Identification and molecular mapping of loci controlling fruit ripening time in tomato. Theor. Appl. Genet. 100, 249-255. Downes, B.P., Stupar, R.M., Gingerich, D.J. and Vierstra, R.D. (2003) The HECT ubiquitinprotein ligase (UPL) family in Arabidopsis: UPL3 has a specific role in trichome development. Plant J. 35 729-742. Dutta, R., Qin, L. and Inouye, M. (1999) Histidine kinases: dive rsity of domain organization. Mol. Micro. 34, 633-640. Farras, R., Ferrando, A., Jasik, J., Kleinow, T., Okresz, L. et al. (2001) SKP1-SnRK protein kinase interactions mediate proteasome binding of a plant SCF ubiquitin ligase. EMBO J 20, 2742-2756. Flores-Morales, A., Greenhalgh, C., Norstedt, G. & Rico-Bautista, E. (2006) Negative regulation of growth hormone receptor signaling. Molec. Endocrinology, 20, 241-253. Frary, A., Doganlar, S., Frampton, A., Fulton T., Uhlig, J., Yates, H. and Tanksley, S. (2003) Fine mapping of quantitat ive trait loci for improved fruit characteristics from Lycopersicon chmielewski chromosome 1. Genome 46, 235-243. Fridman, E., Carrari, F., Liu, Y.S., Fernie, A.R. and Zamir, D. (2004) Zooming in on a quantitative trait for tomato yield using interspecific introgressions. Science 305, 1786-1789. Fridman, E., Liu, Y.S., Carmel-Goren, L., Gur, A., Shoresh, M., Pleban, T., Eshed, Y. and Zamir, D. (2002) Two tightly linked QTLs modify tomato sugar content via different physiological pathways. Mol. Genet. Genomics 266, 821-826. 91 PAGE 92 Gagne, J.M., Smalle, J., Gingerich, D.J., Wal ker, J.M., Yoo, S.D., Yanagisawa, S. and Vierstra, R.D. (2004) Arabidopsis EIN3-binding F-box 1 and 2 form ubiquitin-protein ligases that repress ethylene action and promote growth by directing EIN3 degradation. PNAS, 101, 6803-6808. Gamble, R., Coonfield, M. and Schaller, G.E. (1998) Histidine kinase activity of the ETR1 ethylene receptor from Arabidopsis. PNAS, 95, 7825-7829. Gamble, R., Qu, X. and Schaller, G.E. (2002) Mutational analysis of the ethylene receptor ETR1. Role of the histidine kinase doma in in dominant ethylene insensitivity. Plant Phys 128, 1428-1439. Gao, Z., Chen, Y.F., Randlett, M.D., Zhao, X.C., Findell, J.L., Kieber, J.J. and Schaller, G.E. (2003) Localization of the Raf-like kinase CTR1 to the endoplasmic reticulum of Arabidopsis through participation in et hylene receptor signaling complexes. J. Bio. Chem 278, 34725-34732. Garoosi, G.A., Salter, M.G., Ca ddick, M.X. and Tomsett, A.B. (2005) Characterization of the ethanol-inducible alc gene expr ession system in tomato. J. Ex. Botany 56, 1635-1642. Giovannoni, J. (2001) Molecular biology of fruit maturation and ripening. Annu. Rev. Plant Phys, 52, 725-749. Glotzer, M., Murray, A.W. and Kirschner, M.W. (1991) Cyclin is degraded by the ubiquitin pathway. Nature, 349, 132-138. Govers, R., ten Broeke, T., van Kerkho f, P., Schwartz, A.L. & Strous G.J. (1999) Identification of a novel ubiquitin conjugation motif, required for ligand-induced internalization of the growth hormone receptor. EMBO J 18, 28-36. Grumet, R., Fobes, J.F. and Herner, R.C. (1981) Ripening behavior of wild tomato species. Plant Phys 68, 1428-1432. Guo, H. and Ecker, J. (2003) Plant responses to et hylene gas are mediated by SCFEBF1/EBF2dependent proteolysis of EI N3 transcription factor. Cell 115, 667-677. Guzman, P. and Ecker, J. (1990) Exploiting the triple response of Arabidopsis to identify ethylene-related mutants. Plant Cell, 2, 513-523. Hamilton, A.J. Lycett, G.W., Grierson, D. (1990) Antisense gene that inhibits synthesis of the hormone ethylene in transgenic plants. Nature, 346 284-287. Hatfield, P.M., Gosink, M.M., Carpenter, T.B. and Vierstra, R.D. (1997) The ubiquitinactivating enzyme (E1) gene family in Arabidopsis thaliana. Plant J 11, 213-226. Hochstrasser, M. (1996) Ubiquitin-dependent protein degradation. Annu. Rev. Gen 30, 405-439. 92 PAGE 93 Hua, J. and Meyerowitz, E.M. (1998) Ethylene responses are negatively regulated by a receptor gene family in Arabidopsis thaliana. Cell 94,261-271. Huang, Y., Li, H., Hutchinson, C.E., Laskey, J. and Kieber, J.J. (2003) Biochemical and functional analysis of CTR1, a protein kinase that negatively regulat es ethylene signaling in Arabidopsis. Plant J 33, 221-233. Jabben, M., Shanklin, J. and Vierstra, R.D. (1989) Red light-induced accumulation of ubiquitin-phytochrome conjugates in both monocots and dicots. Plant Physiol 90, 380-384. Kepinski, S. & Leyser, O. (2005) The Arabidopsis F-box protein TIR1 is an auxin receptor. Nature, 435, 446-451. Kevany, B.M., Tieman, D.M., Taylor, M.G., Dal Cin, V. and Klee, H.J. (2007) Ethylene receptor degradation controls the tim ing of ripening in tomato fruit. Plant J 51, 458-467. Klee, H.J. (2002) Control of ethylene-mediated proce sses in tomato at th e level of receptors. J. Ex. Botany. 53, 2057-2063. Klee, H.J. (2004) Ethylene signal transduc tion. Moving beyond Arabidopsis. Plant Phys. 135, 660-667. Klee, H.J., Hayfor, M.B., Kretzmer, K.A., Barry, G.F. & Kishmore G.M. (1991) Control of ethylene synthesis by expression of a bacterial enzyme in transgenic tomato plants. Plant Cell, 3, 1187-1193. Koo, J.C., Asurmendi, S., Bick J., Woodford-Thomas, T. and Beachy R.N. (2004) Ecdysone agonist-inducible expression of a coat protein gene from tobacco mosaic virus confers viral resistance in transgenic Arabidopsis Plant J. 37, 439-448. Kosarev, P., Mayer, K.F. and Hardtke, C.S. (2002) Evaluation and Classification of RINGfinger domains encoded by the Arabidopsis genome. Genome Biol 3, 1-12. Lashbrook, C.C., Tieman, D.M. and Klee, H.J. (1998) Differential regulation of the tomato ETR gene family throughout plant development. Plant J. 15, 243-252. Li, T., Santockyte, R., Shen, R.F., Tekle, E., Wang, G., Yang, D.C. and Chock, P.B. (2006) A general approach for investigating enzymatic pathways and substrates for ubiquitin-like modifiers. Arch. Biochem. Biophys. 453, 70-74. Lieberman, M., Kunishi, A., Mapson L.W. and Wardale, D.A. (1966) Stimulation of ethylene production in apple tissue slices by methionine. Plant Phys 41, 376-382. Lincoln, J.E., Cordes, S., Read, E. and Fischer, R.L. (1987) Regulation of gene expression by ethylene during Lycopersicon esculentum (tomato) fruit development. PNAS, 84, 2793-2797. 93 PAGE 94 Lyons, J.M. and Pratt, H.K. (1964) Effect of stage of ma turity and ethylene treatment on respiration and ripeni ng of tomato fruits. Proc. Amer. Soc. Hort. Sci 84, 491-500. Ma, B., Cui, M.L., Sun, H.J., Takada, K., Mori, H., Kamada, H. and Ezura, H. (2006) Subcellular localization and membrane topology of the mel on ethylene receptor CmERS1. Plant Phys 141, 587-597. McCormick, S., Neidermeyer, J., Fry, J., Barnason, A., Horsch, R. and Fraley, R. (1986) Leaf disc transformation of cultivated tomato ( L. esculentum ) using Agrobacterium tumefaciens. Plant Cell Rep. 5, 81-84. McGlasson, W.B., Dostal, H.C. and Tigchelaar, E.C. (1975) Comparison of propyleneinduced responses of immature fruit of normal and rin mutant tomatoes. Plant Phys 55 218-222. Meusser, B., Hirsch, C., Jarosch, E. & Sommer, T. (2005) ERAD: the long road to destruction. Nature Cell Bio 7, 766-772. Monforte, A.J. and Tanksley, S.D. (2000) Development of a set of near isogenic and backcross recombinant inbred lines containing most of the Lycopersicon hirsutum genome in a L. esculentum genetic background: A tool for gene mapping and gene discovery. Genome, 43, 803-813. Moussatche, P. and Klee, H.J. (2004) Autophosphoryla tion activity of the Ar abidopsis ethylene receptor multigene family. J. Biol. Chem 279, 48734-48741. Meusser, B., Hirsch, C., Jarosch, E. and Sommer, T. (2005) ERAD: the long road to destruction. Nat. Cell Biol. 7, 766-772. Nakatsuka, A., Murachi, S., Okunishi, H., Shiomi, S., Nakano, R., Kubo, Y. and Inaba, Y. (1998) Differential expression and internal f eedback regulation of 1-aminocyclopropane-1carboxylate synthase, 1-aminocyclopropane-1-c arboxylate oxidase, and ethylene receptor genes in tomato fruit during development and ripening. Plant Phys. 118, 1295-1305. ODonnell, P.J., Calvert, C., Atzorn, R., Wasternack, C., Leyser, H.M.O. and Bowles, D.J. (1996) Ethylene as a signal mediatin g the wound response of tomato plants. Science, 274 1914-1917. Oeller, P.W., Lu, M.W., Taylor, L.P., Pike, D.A. & Theologis, A. (1991) Reversible inhibition of tomato fruit senescence by antisense RNA. Science, 254, 437-439. O,Malley, R.C., Rodriguez, F.I., Esch, J.J., Binder, B.M., ODonnell, P., Klee, H.J. and Bleecker, A.B. (2005) Ethylene-binding activity, gene expression levels, and receptor system output for ethylene receptor family members from Arabidopsis and tomato. Plant J. 41, 651-659. Pickart, C.M. (2001) Mechanisms unde rlying ubiquitination. Annu. Rev. Biochem 70, 503-533. 94 PAGE 95 Potuschak, T., Lechner, E., Parmentier, Y ., Yanagisawa, S., Grava, S., Koncz, C. and Genshcik, C. (2003) EIN3-dependent regulation of plant ethylene hormone signaling by two Arabidopsis F box proteins: EBF1 and EBF2. Cell 115, 679-689. Qu, X. and Schaller, G.E. (2004) Requirement of the histidine kinase domain for signal transduction by the ethylene receptor ETR1. Plant Phys. 136, 2961:2970. Qu, X., Hall, B.P., Gao, Z. & Schaller, G.E. (2007) A strong constitutive ethylene-response phenotype conferred on Arabidopsis plants containing null mutations in the ethylene receptors ETR1 and ERS1. BMC Plant Biol. 7, 3. Richins, R.D., Scholthof, H.B. and Shepard, R.J. (1987) Sequence of figwort mosaic virus DNA (caulimovirus group). Nucleic Acids Res. 15, 8451-8466. Rashotte, A.M., Carson, S.D., To, J.P. and Kieber, J.J. (2003) Expression profiling of cytokinin action in Arabidopsis. Plant Physiol 132 1998-2011. Roslan, H.A., Salter, M.G., Wood, C.D., White, M.R.H., Croft, K.P., Robson, F., Coupland, G., Doonan, J., Laufs, P., Tomsett, A.B. and Caddick, M.X. (2001) Characterization of the ethanol-inducible alc gene-expression system in Arabidopsis thaliana Plant J. 28, 225235. Santino, C.G., Stanford, G.L. and Conner, T.W. (1997) Development and transgenic analysis of two tomato fruit enhanced genes. Plant Mol. Biol 33, 405-416. Schaller, G.E. and Bleecker, A.B. (1995) Ethylene-binding sites generated in yeast expressing the Arabidopsis ETR1 gene. Science 270, 1809-1811. Schaller, G.E., Ladd, A.N., Lanahan, M.B., Spanbauer, J.M. and Bleecker, A.B. (1995) The ethylene response mediator ETR1 from Arabidopsis forms a disulfide-linked dimer. J. Biol. Chem 270, 12526-12530. Scheffner, M., Huibregste, J.M ., Vierstra, R.D., Howley, P.M. (1993) The HPV-16 E6 and E6-AP complex functions as a ubiquitin-protein ligase in the ubiquitination of p53. Cell 75, 495-505. Shen, W.H., Parmentier, Y., Hellmann, H., Lechner, E., Dong, A. et al. (2002) Null mutation of AtCUL1 causes arrest in early embryogenesis in Arabidopsis. Mol. Biol. Cell. 13, 1916-1928. Sisler, E.C. (2006) The discovery and development of co mpounds counteracting ethylene at the receptor level Biotechnol. Adv 24, 357-367. Smalle, J. and Vierstra, R.D. (2004) The ubiquitin 26S proteasome proteolytic pathway. Annu. Rev. Plant Biol. 55, 555-590. Tieman, D.M. and Klee, H.J. (1999) Differential expression of two novel members of the tomato ethylene-receptor family. Plant Phys. 120 165-172. 95 PAGE 96 Tieman, D.M., Taylor, M.G., Ciardi, J.A. and Klee, H.J. (2000) The tomato ethylene receptors NR and LeETR4 are negative regulators of ethylene response and exhibit functional compensation within a multigene family. PNAS, 97 5663-5668. Tieman, D.M. Zeigler, M., Schmelz, E.A., Tayl or, M.G., Bliss, P., Kirst M. and Klee, H.J. (2006) Identification of loci affecting fla vour volatile emissions in tomato fruits. J. Exp. Bot 57, 887-896. Underwood, B.A., Tieman, D.M., Shibuya, K ., Dexter, R.J., Loucas, H.M., Simkin, A..J., Sims, C.A. Schmelz, E.A., Klee, H.J. and Clark D.G. (2005) Ethyleneregulated floral volatile synthesis in petunia corollas. Plant Phys 138, 255-266. Vierstra, R.D. (1996) Proteolysis in plants: mechanisms and functions. Plant Mol. Biol 32, 275-302. Vierstra, R.D. (2003) The ubiquitin/26S proteasome path way, the complex last chapter in the life of many plant proteins. Trends Plant Sci. 8, 135-142. Voges, D., Zwicki, P., Baumeister, W. (1999) The 26S preteasome: a molecular machine designed for controlled proteolytic. Annu. Rev. Biochem. 68, 1015-1068. Wang, W., Hall, A.E., OMalley, R. and Bleecker, A.B. (2003) Canonical histidine kinase activity of the transmitter domain of the ETR1 ethylene receptor from Arabidopsis is not required for signal transmission. PNAS, 100, 352-357. Wilkinson, J.Q., Lanahan, M.B., Ye n, H.C., Giovannoni, J.J. and Klee H.J. (1995) An ethylene-inducible component of signal transduction encoded by Never-ripe Science, 270, 1807-1809. Yang, G.X., Jan, A., Shen, S.H., Yazaki, J., Ishikawa, M., Shimatani, Z., Kishimoto, N., Kikuchi, S., Matsumoto, H. and Komatsu, S. (2004) Microarray analysis of brassinosteroidsand gibberellin-regulated gene expression in rice seedlings. Mol. Gen. Genomics 271, 468-478. Yang, S.F. (1987) The role of ethylene and ethylene synthesis in fruit ripening. In W Thompson, E Nothnagel, R Huffaker, eds. Plant Senescence: Its Bi ochemistry and Physiology The American Society of Plant Physiologists, Rockville, MD, pp 156-165. Yen, H.C., Lee, S., Tanksley, S.D., Lanahan, M.B., Klee, H.J. and Giovannoni, J.J. (1995) The tomato Never-ripe locus regulates ethylene-i nducible gene expression and is linked to a homolog of the Arabidopsis ETR1 gene. Plant Phys. 107, 1343-1353. Zamir, D. (2001) Improving plant breeding w ith exotic genetic libraries. Nature Rev Genetics 2, 983-989. Zhou D., Kalaitzis, P., Mattoo, A. and Tucker, M. (1996a) The mRNA for an ETR1 homologue in tomato is constitutively expr essed in vegetative a nd reproductive tissues. Plant Mol. Biology, 30, 1331-1338. 96 PAGE 97 97 Zhou, D., Mattoo, A. and Tucker, M. (1996b) Molecular cloning of a tomato cDNA encoding and ethylene receptor. Plant Phys 110 1435-143. PAGE 98 BIOGRAPHICAL SKETCH Brian Michael Kevany was born in Cleveland, Ohio on September 28, 1980. When he was one he and his mother, father and older brother Thomas moved to North Olmsted, Ohio where his younger brother Daniel was born and where Brian spent his entire childhood. As a young boy Brian enjoyed discovering things in hi s backyard and playing golf, baseball and hockey, with hockey being a sport he played y ear round. When he was in high school he got a job at a local nursery an d really enjoyed learning about plan ts. After high school Brian attended Michigan State University where he majored in horticulture specializi ng in biotechnology. While at MSU he worked as an undergraduate research er in the Postharvest Physiology lab of Dr. David Dilley under the tutelage of Dr. John Go lding. Dr. Golding allowed Brian to become intimately involved in the projects in the lab and fo stered a great interest in plant research. After graduation, Brian joined the Plant Molecula r and Cellular Biology Ph.D. program at the University of Florida as a pre-do ctoral Alumni Fellow. While at UF he worked in the lab of Dr. Harry Klee studying the importance of the tomato ethylene receptor family during tomato fruit development. Upon completion of his Ph.D. degr ee, Brian will enter the lab of Dr. Michael Thomas in the Department of Bacteriology at the University of Wisconsin-Madison as a postdoctoral researcher. 98 |