Site-Directed Mutagenesis of a PAQR Family Protein in Saccharomyces cerevisiae

Permanent Link: http://ufdc.ufl.edu/UFE0021519/00001

Material Information

Title: Site-Directed Mutagenesis of a PAQR Family Protein in Saccharomyces cerevisiae
Physical Description: 1 online resource (54 p.)
Language: english
Creator: Kendall, Elizabeth A
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2007


Subjects / Keywords: active, adipor1, adipor2, alkaline, amidohydrolase, analysis, beta, binding, ceramidases, ceramide, conserved, directed, extension, function, galactosidase, hemolysins, izh2, izh2p, lacz, metal, metalloprotease, motifs, mutagenesis, osmor, overlap, paqr, protease, quickchange, receptor, sequence, serine, site, structure
Chemistry -- Dissertations, Academic -- UF
Genre: Chemistry thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation


Abstract: Understanding distant relationships in conserved motifs of the protein, Izh2p, in S. cerevisiae may lead to a better understanding about the function of related steroid receptor (PAQR) proteins in humans. Hence, the overall goal of this study is to gain more insight on the function and behavior of these membrane proteins and how the structural differences of the various genotypes affect their activity. A potential metal-binding domain, HxxxH, of a conserved motif of a plasma membrane protein Izh2p, has been studied to investigate the structure-function relationship of this protein. Two other conserved motifs also under investigation in the Izh2p protein are: ExxNxxxH, and SxxxHxnD, We propose that these conserved regions function as active sites, specifically as amidohydrolases. Point mutations are being generated using site-directed mutagenesis of several conserved amino acids in this protein that may be involved in receptor activity or metal-binding. The amino acids are histidine (H), asparagine (N), aspartic acid (D), glutamic acid (E) and serine (S). These amino acids are being changed from these functional amino acids to alanines since alanine has a non-functional methyl side group. These motifs are conserved in related proteins in species ranging from bacteria to humans; therefore they may have an important function in the activity of the proteins in prokaryotic as well as eukaryotic organisms. We have observed their activity using a pFET3-lacZ reporter as FET3 is known to be repressed by the overexpression of IZH2, driven by a galactose-inducible promoter (pGAL1-IZH2). Three of the histidines of these motifs have been mutated by site-directed mutagenesis. H86A, of the ExxNxxxH motif, has been mutated to alanine, as well as the two histidines of the HxxxH motif: H282A and H286A. A double mutant of the HxxxH motif, H282A/H286A, has also been generated. The double HxxxH mutant exhibits a high loss of activity. The ExxNxxxH histidine mutant, H86A, also has a high loss of activity. The single mutants of the HxxxH have some loss of activity. Still under investigation in terms of sequencing are the following Izh2p mutants: E79A, N82A, S132A, H136A, and D153A. Although the last set of mutants has not been confirmed by sequence analysis, we still have some interesting data with their repression on pFET3-lacZ reporter.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Elizabeth A Kendall.
Thesis: Thesis (M.S.)--University of Florida, 2007.
Local: Adviser: Lyons, Thomas J.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2007
System ID: UFE0021519:00001

Permanent Link: http://ufdc.ufl.edu/UFE0021519/00001

Material Information

Title: Site-Directed Mutagenesis of a PAQR Family Protein in Saccharomyces cerevisiae
Physical Description: 1 online resource (54 p.)
Language: english
Creator: Kendall, Elizabeth A
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2007


Subjects / Keywords: active, adipor1, adipor2, alkaline, amidohydrolase, analysis, beta, binding, ceramidases, ceramide, conserved, directed, extension, function, galactosidase, hemolysins, izh2, izh2p, lacz, metal, metalloprotease, motifs, mutagenesis, osmor, overlap, paqr, protease, quickchange, receptor, sequence, serine, site, structure
Chemistry -- Dissertations, Academic -- UF
Genre: Chemistry thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation


Abstract: Understanding distant relationships in conserved motifs of the protein, Izh2p, in S. cerevisiae may lead to a better understanding about the function of related steroid receptor (PAQR) proteins in humans. Hence, the overall goal of this study is to gain more insight on the function and behavior of these membrane proteins and how the structural differences of the various genotypes affect their activity. A potential metal-binding domain, HxxxH, of a conserved motif of a plasma membrane protein Izh2p, has been studied to investigate the structure-function relationship of this protein. Two other conserved motifs also under investigation in the Izh2p protein are: ExxNxxxH, and SxxxHxnD, We propose that these conserved regions function as active sites, specifically as amidohydrolases. Point mutations are being generated using site-directed mutagenesis of several conserved amino acids in this protein that may be involved in receptor activity or metal-binding. The amino acids are histidine (H), asparagine (N), aspartic acid (D), glutamic acid (E) and serine (S). These amino acids are being changed from these functional amino acids to alanines since alanine has a non-functional methyl side group. These motifs are conserved in related proteins in species ranging from bacteria to humans; therefore they may have an important function in the activity of the proteins in prokaryotic as well as eukaryotic organisms. We have observed their activity using a pFET3-lacZ reporter as FET3 is known to be repressed by the overexpression of IZH2, driven by a galactose-inducible promoter (pGAL1-IZH2). Three of the histidines of these motifs have been mutated by site-directed mutagenesis. H86A, of the ExxNxxxH motif, has been mutated to alanine, as well as the two histidines of the HxxxH motif: H282A and H286A. A double mutant of the HxxxH motif, H282A/H286A, has also been generated. The double HxxxH mutant exhibits a high loss of activity. The ExxNxxxH histidine mutant, H86A, also has a high loss of activity. The single mutants of the HxxxH have some loss of activity. Still under investigation in terms of sequencing are the following Izh2p mutants: E79A, N82A, S132A, H136A, and D153A. Although the last set of mutants has not been confirmed by sequence analysis, we still have some interesting data with their repression on pFET3-lacZ reporter.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Elizabeth A Kendall.
Thesis: Thesis (M.S.)--University of Florida, 2007.
Local: Adviser: Lyons, Thomas J.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2007
System ID: UFE0021519:00001

This item has the following downloads:

Full Text
xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E20101114_AAAACX INGEST_TIME 2010-11-14T10:42:34Z PACKAGE UFE0021519_00001
114641 F20101114_AAAZKL kendall_e_Page_52.jpg
612 F20101114_AAAZUF kendall_e_Page_07.txt
112783 F20101114_AAAZPJ kendall_e_Page_14.jpg
51865 F20101114_AAAZKM kendall_e_Page_33.pro
2598 F20101114_AAAZUG kendall_e_Page_08.txt
108132 F20101114_AAAZPK kendall_e_Page_15.jpg
1058 F20101114_AAAZKN kendall_e_Page_03thm.jpg
811 F20101114_AAAZUH kendall_e_Page_11.txt
104736 F20101114_AAAZPL kendall_e_Page_16.jpg
56024 F20101114_AAAZKO kendall_e_Page_51.pro
2054 F20101114_AAAZUI kendall_e_Page_12.txt
50014 F20101114_AAAZPM kendall_e_Page_19.jpg
9122 F20101114_AAAZKP kendall_e_Page_52thm.jpg
2155 F20101114_AAAZUJ kendall_e_Page_14.txt
64188 F20101114_AAAZPN kendall_e_Page_20.jpg
6662 F20101114_AAAZKQ kendall_e_Page_18thm.jpg
2091 F20101114_AAAZUK kendall_e_Page_15.txt
107572 F20101114_AAAZPO kendall_e_Page_23.jpg
131281 F20101114_AAAZKR kendall_e_Page_30.jp2
1885 F20101114_AAAZUL kendall_e_Page_16.txt
99720 F20101114_AAAZPP kendall_e_Page_24.jpg
106152 F20101114_AAAZKS kendall_e_Page_24.jp2
367 F20101114_AAAZUM kendall_e_Page_18.txt
75112 F20101114_AAAZPQ kendall_e_Page_31.jpg
37143 F20101114_AAAZKT kendall_e_Page_08.QC.jpg
677 F20101114_AAAZUN kendall_e_Page_19.txt
109397 F20101114_AAAZPR kendall_e_Page_33.jpg
54027 F20101114_AAAZKU kendall_e_Page_27.jpg
556 F20101114_AAAZUO kendall_e_Page_20.txt
103944 F20101114_AAAZPS kendall_e_Page_34.jpg
1053954 F20101114_AAAZKV kendall_e_Page_30.tif
F20101114_AAAZUP kendall_e_Page_23.txt
105584 F20101114_AAAZPT kendall_e_Page_35.jpg
114746 F20101114_AAAZKW kendall_e_Page_15.jp2
1846 F20101114_AAAZUQ kendall_e_Page_24.txt
90782 F20101114_AAAZPU kendall_e_Page_37.jpg
2561 F20101114_AAAZKX kendall_e_Page_03.QC.jpg
1535 F20101114_AAAZUR kendall_e_Page_26.txt
118317 F20101114_AAAZPV kendall_e_Page_38.jpg
899 F20101114_AAAZUS kendall_e_Page_27.txt
132281 F20101114_AAAZPW kendall_e_Page_39.jpg
50755 F20101114_AAAZKY kendall_e_Page_35.pro
1096 F20101114_AAAZUT kendall_e_Page_28.txt
62371 F20101114_AAAZPX kendall_e_Page_40.jpg
117167 F20101114_AAAZKZ kendall_e_Page_13.jp2
2932 F20101114_AAAZUU kendall_e_Page_30.txt
78817 F20101114_AAAZPY kendall_e_Page_42.jpg
1481 F20101114_AAAZUV kendall_e_Page_31.txt
111976 F20101114_AAAZPZ kendall_e_Page_45.jpg
1811 F20101114_AAAZUW kendall_e_Page_32.txt
123964 F20101114_AAAZNA kendall_e_Page_05.jpg
1952 F20101114_AAAZUX kendall_e_Page_34.txt
F20101114_AAAZNB kendall_e_Page_04.tif
2026 F20101114_AAAZUY kendall_e_Page_35.txt
110312 F20101114_AAAZNC kendall_e_Page_10.jp2
F20101114_AAAZSA kendall_e_Page_25.tif
2144 F20101114_AAAZUZ kendall_e_Page_36.txt
36905 F20101114_AAAZND kendall_e_Page_42.pro
25271604 F20101114_AAAZSB kendall_e_Page_27.tif
616 F20101114_AAAZNE kendall_e_Page_22.txt
6403 F20101114_AAAZXA kendall_e_Page_31thm.jpg
F20101114_AAAZSC kendall_e_Page_28.tif
5428 F20101114_AAAZNF kendall_e_Page_45thm.jpg
24135 F20101114_AAAZXB kendall_e_Page_31.QC.jpg
F20101114_AAAZSD kendall_e_Page_29.tif
40283 F20101114_AAAZNG kendall_e_Page_29.jpg
F20101114_AAAZSE kendall_e_Page_33.tif
34919 F20101114_AAAZNH kendall_e_Page_16.QC.jpg
7520 F20101114_AAAZXC kendall_e_Page_32thm.jpg
F20101114_AAAZSF kendall_e_Page_35.tif
1051969 F20101114_AAAZNI kendall_e_Page_50.jp2
35840 F20101114_AAAZXD kendall_e_Page_33.QC.jpg
F20101114_AAAZSG kendall_e_Page_36.tif
3509 F20101114_AAAZNJ kendall_e_Page_05.txt
8413 F20101114_AAAZXE kendall_e_Page_34thm.jpg
F20101114_AAAZSH kendall_e_Page_38.tif
1051925 F20101114_AAAZNK kendall_e_Page_45.jp2
F20101114_AAAZSI kendall_e_Page_40.tif
50071 F20101114_AAAZNL kendall_e_Page_23.pro
34490 F20101114_AAAZXF kendall_e_Page_34.QC.jpg
F20101114_AAAZSJ kendall_e_Page_41.tif
1051954 F20101114_AAAZNM kendall_e_Page_47.jp2
38202 F20101114_AAAZXG kendall_e_Page_36.QC.jpg
F20101114_AAAZSK kendall_e_Page_42.tif
8172 F20101114_AAAZNN kendall_e_Page_10thm.jpg
7893 F20101114_AAAZXH kendall_e_Page_37thm.jpg
F20101114_AAAZSL kendall_e_Page_43.tif
25362 F20101114_AAAZNO kendall_e_Page_38.QC.jpg
28056 F20101114_AAAZXI kendall_e_Page_37.QC.jpg
F20101114_AAAZSM kendall_e_Page_45.tif
5399 F20101114_AAAZNP kendall_e_Page_43thm.jpg
6231 F20101114_AAAZXJ kendall_e_Page_38thm.jpg
F20101114_AAAZSN kendall_e_Page_46.tif
1823 F20101114_AAAZNQ kendall_e_Page_41.txt
5280 F20101114_AAAZXK kendall_e_Page_40thm.jpg
F20101114_AAAZSO kendall_e_Page_47.tif
48838 F20101114_AAAZNR kendall_e_Page_34.pro
7391 F20101114_AAAZXL kendall_e_Page_41thm.jpg
F20101114_AAAZSP kendall_e_Page_48.tif
20349 F20101114_AAAZNS kendall_e_Page_11.pro
31014 F20101114_AAAZXM kendall_e_Page_41.QC.jpg
F20101114_AAAZSQ kendall_e_Page_49.tif
F20101114_AAAZNT kendall_e_Page_54.tif
6521 F20101114_AAAZXN kendall_e_Page_42thm.jpg
F20101114_AAAZSR kendall_e_Page_50.tif
393283 F20101114_AAAZNU kendall_e_Page_22.jp2
26270 F20101114_AAAZXO kendall_e_Page_42.QC.jpg
F20101114_AAAZSS kendall_e_Page_52.tif
F20101114_AAAZNV kendall_e_Page_39.tif
25155 F20101114_AAAZXP kendall_e_Page_43.QC.jpg
8013 F20101114_AAAZST kendall_e_Page_01.pro
40372 F20101114_AAAZNW kendall_e_Page_22.jpg
5545 F20101114_AAAZXQ kendall_e_Page_44thm.jpg
1012 F20101114_AAAZSU kendall_e_Page_02.pro
71769 F20101114_AAAZNX kendall_e_Page_54.jpg
27026 F20101114_AAAZXR kendall_e_Page_44.QC.jpg
3211 F20101114_AAAZSV kendall_e_Page_03.pro
75628 F20101114_AAAZNY kendall_e_Page_50.pro
25694 F20101114_AAAZXS kendall_e_Page_45.QC.jpg
36805 F20101114_AAAZSW kendall_e_Page_04.pro
19786 F20101114_AAAZLA kendall_e_Page_18.QC.jpg
3267 F20101114_AAAZNZ kendall_e_Page_50.txt
6634 F20101114_AAAZXT kendall_e_Page_47thm.jpg
78768 F20101114_AAAZSX kendall_e_Page_05.pro
F20101114_AAAZLB kendall_e_Page_44.tif
30350 F20101114_AAAZXU kendall_e_Page_47.QC.jpg
30967 F20101114_AAAZSY kendall_e_Page_06.pro
1327 F20101114_AAAZLC kendall_e_Page_06.txt
30500 F20101114_AAAZXV kendall_e_Page_48.QC.jpg
14405 F20101114_AAAZSZ kendall_e_Page_07.pro
121244 F20101114_AAAZLD kendall_e_Page_30.jpg
6603 F20101114_AAAZXW kendall_e_Page_49thm.jpg
114067 F20101114_AAAZQA kendall_e_Page_46.jpg
9720 F20101114_AAAZLE kendall_e_Page_07.QC.jpg
6399 F20101114_AAAZXX kendall_e_Page_50thm.jpg
116807 F20101114_AAAZQB kendall_e_Page_48.jpg
46482 F20101114_AAAZLF kendall_e_Page_11.jpg
1455 F20101114_AAAZVA kendall_e_Page_37.txt
8872 F20101114_AAAZXY kendall_e_Page_51thm.jpg
114579 F20101114_AAAZQC kendall_e_Page_49.jpg
1051978 F20101114_AAAZLG kendall_e_Page_39.jp2
979 F20101114_AAAZVB kendall_e_Page_39.txt
33811 F20101114_AAAZXZ kendall_e_Page_51.QC.jpg
112875 F20101114_AAAZQD kendall_e_Page_50.jpg
101871 F20101114_AAAZLH kendall_e_Page_32.jp2
1837 F20101114_AAAZVC kendall_e_Page_40.txt
110893 F20101114_AAAZQE kendall_e_Page_51.jpg
4988 F20101114_AAAZLI kendall_e_Page_19thm.jpg
79416 F20101114_AAAZQF kendall_e_Page_53.jpg
53535 F20101114_AAAZLJ kendall_e_Page_25.pro
1518 F20101114_AAAZVD kendall_e_Page_42.txt
24606 F20101114_AAAZQG kendall_e_Page_01.jp2
32666 F20101114_AAAZLK kendall_e_Page_38.pro
2957 F20101114_AAAZVE kendall_e_Page_44.txt
5694 F20101114_AAAZQH kendall_e_Page_02.jp2
1051899 F20101114_AAAZLL kendall_e_Page_43.jp2
2876 F20101114_AAAZVF kendall_e_Page_45.txt
10668 F20101114_AAAZQI kendall_e_Page_03.jp2
5487 F20101114_AAAZLM kendall_e_Page_46thm.jpg
2338 F20101114_AAAZVG kendall_e_Page_46.txt
81601 F20101114_AAAZQJ kendall_e_Page_04.jp2
43228 F20101114_AAAZLN kendall_e_Page_41.pro
2262 F20101114_AAAZVH kendall_e_Page_51.txt
1051911 F20101114_AAAZQK kendall_e_Page_05.jp2
101609 F20101114_AAAZLO kendall_e_Page_12.jpg
1543 F20101114_AAAZVI kendall_e_Page_53.txt
971006 F20101114_AAAZQL kendall_e_Page_06.jp2
2070 F20101114_AAAZLP kendall_e_Page_13.txt
1348 F20101114_AAAZVJ kendall_e_Page_54.txt
607688 F20101114_AAAZQM kendall_e_Page_07.jp2
24271 F20101114_AAAZLQ kendall_e_Page_01.jpg
2013 F20101114_AAAZVK kendall_e_Page_01thm.jpg
1051959 F20101114_AAAZQN kendall_e_Page_08.jp2
1788465 F20101114_AAAZVL kendall_e.pdf
468693 F20101114_AAAZQO kendall_e_Page_09.jp2
2245 F20101114_AAAZLR kendall_e_Page_52.txt
7149 F20101114_AAAZVM kendall_e_Page_48thm.jpg
118948 F20101114_AAAZQP kendall_e_Page_14.jp2
1903 F20101114_AAAZLS kendall_e_Page_17.txt
26430 F20101114_AAAZVN kendall_e_Page_46.QC.jpg
103224 F20101114_AAAZQQ kendall_e_Page_17.jp2
698485 F20101114_AAAZLT kendall_e_Page_20.jp2
5360 F20101114_AAAZVO kendall_e_Page_28thm.jpg
787365 F20101114_AAAZQR kendall_e_Page_18.jp2
77348 F20101114_AAAZLU kendall_e_Page_26.jpg
542 F20101114_AAAZVP kendall_e_Page_02thm.jpg
1051780 F20101114_AAAZQS kendall_e_Page_21.jp2
609917 F20101114_AAAZLV kendall_e_Page_19.jp2
6227 F20101114_AAAZVQ kendall_e_Page_53thm.jpg
119141 F20101114_AAAZQT kendall_e_Page_25.jp2
33073 F20101114_AAAZLW kendall_e_Page_54.pro
34518 F20101114_AAAZVR kendall_e_Page_35.QC.jpg
840651 F20101114_AAAZQU kendall_e_Page_26.jp2
111602 F20101114_AAAZLX kendall_e_Page_35.jp2
29820 F20101114_AAAZVS kendall_e_Page_49.QC.jpg
734724 F20101114_AAAZQV kendall_e_Page_27.jp2
13005 F20101114_AAAZLY kendall_e_Page_06.QC.jpg
29330 F20101114_AAAZVT kendall_e_Page_39.QC.jpg
409099 F20101114_AAAZQW kendall_e_Page_29.jp2
2222 F20101114_AAAZVU kendall_e_Page_09thm.jpg
79974 F20101114_AAAZQX kendall_e_Page_31.jp2
74363 F20101114_AAAZLZ kendall_e_Page_47.pro
83923 F20101114_AAAZVV UFE0021519_00001.xml FULL
1051963 F20101114_AAAZQY kendall_e_Page_37.jp2
25387 F20101114_AAAZVW kendall_e_Page_04.QC.jpg
96760 F20101114_AAAZOA kendall_e_Page_17.jpg
1051804 F20101114_AAAZQZ kendall_e_Page_38.jp2
27805 F20101114_AAAZVX kendall_e_Page_05.QC.jpg
117512 F20101114_AAAZOB kendall_e_Page_44.jpg
3403 F20101114_AAAZVY kendall_e_Page_06thm.jpg
3108 F20101114_AAAZOC kendall_e_Page_43.txt
11586 F20101114_AAAZTA kendall_e_Page_09.pro
2741 F20101114_AAAZVZ kendall_e_Page_07thm.jpg
7752 F20101114_AAAZOD kendall_e_Page_30thm.jpg
2045 F20101114_AAAZOE kendall_e_Page_33.txt
50998 F20101114_AAAZTB kendall_e_Page_10.pro
46651 F20101114_AAAZOF kendall_e_Page_24.pro
24267 F20101114_AAAZYA kendall_e_Page_53.QC.jpg
49419 F20101114_AAAZTC kendall_e_Page_12.pro
7155 F20101114_AAAZOG kendall_e_Page_39thm.jpg
5750 F20101114_AAAZYB kendall_e_Page_54thm.jpg
8699 F20101114_AAAZJJ kendall_e_Page_35thm.jpg
52706 F20101114_AAAZTD kendall_e_Page_13.pro
22945 F20101114_AAAZOH kendall_e_Page_39.pro
8585 F20101114_AAAZJK kendall_e_Page_33thm.jpg
54368 F20101114_AAAZTE kendall_e_Page_14.pro
113310 F20101114_AAAZOI kendall_e_Page_23.jp2
109415 F20101114_AAAZJL kendall_e_Page_43.jpg
53118 F20101114_AAAZTF kendall_e_Page_15.pro
8658 F20101114_AAAZOJ kendall_e_Page_36thm.jpg
26764 F20101114_AAAZJM kendall_e_Page_26.pro
47530 F20101114_AAAZTG kendall_e_Page_16.pro
F20101114_AAAZOK kendall_e_Page_15.tif
114189 F20101114_AAAZJN kendall_e_Page_36.jpg
46798 F20101114_AAAZTH kendall_e_Page_17.pro
1051974 F20101114_AAAZOL kendall_e_Page_46.jp2
3674 F20101114_AAAZJO kendall_e_Page_21.txt
10276 F20101114_AAAZTI kendall_e_Page_20.pro
95310 F20101114_AAAZOM kendall_e_Page_32.jpg
8845 F20101114_AAAZJP kendall_e_Page_14thm.jpg
81939 F20101114_AAAZTJ kendall_e_Page_21.pro
111005 F20101114_AAAZJQ kendall_e_Page_13.jpg
12941 F20101114_AAAZTK kendall_e_Page_22.pro
F20101114_AAAZON kendall_e_Page_53.tif
3220 F20101114_AAAZJR kendall_e_Page_49.txt
19504 F20101114_AAAZTL kendall_e_Page_27.pro
35871 F20101114_AAAZOO kendall_e_Page_52.QC.jpg
F20101114_AAAZJS kendall_e_Page_34.tif
24666 F20101114_AAAZTM kendall_e_Page_28.pro
109587 F20101114_AAAZOP kendall_e_Page_34.jp2
F20101114_AAAZJT kendall_e_Page_10.tif
15457 F20101114_AAAZTN kendall_e_Page_29.pro
6242 F20101114_AAAZOQ kendall_e_Page_04thm.jpg
7681 F20101114_AAAZJU kendall_e_Page_01.QC.jpg
66776 F20101114_AAAZTO kendall_e_Page_30.pro
113207 F20101114_AAAZOR kendall_e_Page_47.jpg
59309 F20101114_AAAZJV kendall_e_Page_18.jpg
34012 F20101114_AAAZTP kendall_e_Page_31.pro
1263 F20101114_AAAZOS kendall_e_Page_02.QC.jpg
5466 F20101114_AAAZJW kendall_e_Page_27thm.jpg
44593 F20101114_AAAZTQ kendall_e_Page_32.pro
8548 F20101114_AAAZOT kendall_e_Page_15thm.jpg
53482 F20101114_AAAZTR kendall_e_Page_36.pro
18287 F20101114_AAAZOU kendall_e_Page_40.QC.jpg
110126 F20101114_AAAZJX kendall_e_Page_16.jp2
31983 F20101114_AAAZTS kendall_e_Page_37.pro
27852 F20101114_AAAZOV kendall_e_Page_09.jpg
113629 F20101114_AAAZJY kendall_e_Page_25.jpg
38612 F20101114_AAAZTT kendall_e_Page_40.pro
4321 F20101114_AAAZOW kendall_e_Page_02.jpg
107925 F20101114_AAAZJZ kendall_e_Page_12.jp2
72453 F20101114_AAAZTU kendall_e_Page_43.pro
23199 F20101114_AAAZOX kendall_e_Page_54.QC.jpg
69565 F20101114_AAAZTV kendall_e_Page_44.pro
F20101114_AAAZOY kendall_e_Page_31.tif
68804 F20101114_AAAZTW kendall_e_Page_45.pro
F20101114_AAAZMA kendall_e_Page_02.tif
480 F20101114_AAAZOZ kendall_e_Page_09.txt
53199 F20101114_AAAZTX kendall_e_Page_46.pro
F20101114_AAAZMB kendall_e_Page_32.tif
74676 F20101114_AAAZTY kendall_e_Page_48.pro
35974 F20101114_AAAZMC kendall_e_Page_25.QC.jpg
77094 F20101114_AAAZRA kendall_e_Page_40.jp2
75453 F20101114_AAAZTZ kendall_e_Page_49.pro
9939 F20101114_AAAZMD kendall_e_Page_03.jpg
95859 F20101114_AAAZRB kendall_e_Page_41.jp2
8341 F20101114_AAAZME kendall_e_Page_09.QC.jpg
84375 F20101114_AAAZRC kendall_e_Page_42.jp2
36550 F20101114_AAAZMF kendall_e_Page_13.QC.jpg
8967 F20101114_AAAZWA kendall_e_Page_08thm.jpg
1051985 F20101114_AAAZRD kendall_e_Page_48.jp2
F20101114_AAAZMG kendall_e_Page_37.tif
33717 F20101114_AAAZWB kendall_e_Page_10.QC.jpg
1051957 F20101114_AAAZRE kendall_e_Page_49.jp2
6475 F20101114_AAAZMH kendall_e_Page_21thm.jpg
3796 F20101114_AAAZWC kendall_e_Page_11thm.jpg
111952 F20101114_AAAZRF kendall_e_Page_51.jp2
F20101114_AAAZMI kendall_e_Page_01.tif
15211 F20101114_AAAZWD kendall_e_Page_11.QC.jpg
114317 F20101114_AAAZRG kendall_e_Page_52.jp2
6922 F20101114_AAAZMJ kendall_e_Page_05thm.jpg
81947 F20101114_AAAZRH kendall_e_Page_53.jp2
698 F20101114_AAAZMK kendall_e_Page_29.txt
8342 F20101114_AAAZWE kendall_e_Page_12thm.jpg
74934 F20101114_AAAZRI kendall_e_Page_54.jp2
3215 F20101114_AAAZML kendall_e_Page_48.txt
33166 F20101114_AAAZWF kendall_e_Page_12.QC.jpg
2742 F20101114_AAAZMM kendall_e_Page_38.txt
8740 F20101114_AAAZWG kendall_e_Page_13thm.jpg
F20101114_AAAZRJ kendall_e_Page_03.tif
706847 F20101114_AAAZMN kendall_e_Page_28.jp2
37096 F20101114_AAAZWH kendall_e_Page_14.QC.jpg
F20101114_AAAZRK kendall_e_Page_05.tif
F20101114_AAAZMO kendall_e_Page_09.tif
35927 F20101114_AAAZWI kendall_e_Page_15.QC.jpg
F20101114_AAAZRL kendall_e_Page_06.tif
F20101114_AAAZMP kendall_e_Page_19.tif
7587 F20101114_AAAZWJ kendall_e_Page_17thm.jpg
F20101114_AAAZRM kendall_e_Page_07.tif
1051790 F20101114_AAAZMQ kendall_e_Page_44.jp2
32039 F20101114_AAAZWK kendall_e_Page_17.QC.jpg
F20101114_AAAZRN kendall_e_Page_08.tif
8675 F20101114_AAAZMR kendall_e_Page_16thm.jpg
16330 F20101114_AAAZWL kendall_e_Page_19.QC.jpg
F20101114_AAAZRO kendall_e_Page_11.tif
25851 F20101114_AAAZMS kendall_e_Page_21.QC.jpg
7020 F20101114_AAAZWM kendall_e_Page_20thm.jpg
F20101114_AAAZRP kendall_e_Page_12.tif
8834 F20101114_AAAZMT kendall_e_Page_25thm.jpg
22283 F20101114_AAAZWN kendall_e_Page_20.QC.jpg
F20101114_AAAZRQ kendall_e_Page_13.tif
14287 F20101114_AAAZMU kendall_e_Page_19.pro
4323 F20101114_AAAZWO kendall_e_Page_22thm.jpg
F20101114_AAAZRR kendall_e_Page_14.tif
114999 F20101114_AAAZMV kendall_e_Page_33.jp2
12453 F20101114_AAAZWP kendall_e_Page_22.QC.jpg
F20101114_AAAZRS kendall_e_Page_16.tif
63484 F20101114_AAAZMW kendall_e_Page_08.pro
8284 F20101114_AAAZWQ kendall_e_Page_23thm.jpg
F20101114_AAAZRT kendall_e_Page_17.tif
8671 F20101114_AAAZMX kendall_e_Page_18.pro
35584 F20101114_AAAZWR kendall_e_Page_23.QC.jpg
F20101114_AAAZRU kendall_e_Page_18.tif
F20101114_AAAZMY kendall_e_Page_47.txt
8297 F20101114_AAAZWS kendall_e_Page_24thm.jpg
F20101114_AAAZRV kendall_e_Page_20.tif
92211 F20101114_AAAZMZ kendall_e_Page_41.jpg
7485 F20101114_AAAZWT kendall_e_Page_26thm.jpg
F20101114_AAAZRW kendall_e_Page_21.tif
29476 F20101114_AAAZKA kendall_e_Page_50.QC.jpg
26028 F20101114_AAAZWU kendall_e_Page_26.QC.jpg
F20101114_AAAZRX kendall_e_Page_22.tif
60605 F20101114_AAAZKB kendall_e_Page_28.jpg
16806 F20101114_AAAZWV kendall_e_Page_27.QC.jpg
F20101114_AAAZRY kendall_e_Page_23.tif
563 F20101114_AAAZKC kendall_e_Page_01.txt
17270 F20101114_AAAZWW kendall_e_Page_28.QC.jpg
32010 F20101114_AAAZPA kendall_e_Page_32.QC.jpg
F20101114_AAAZRZ kendall_e_Page_24.tif
33942 F20101114_AAAZKD kendall_e_Page_07.jpg
3456 F20101114_AAAZWX kendall_e_Page_29thm.jpg
F20101114_AAAZPB kendall_e_Page_51.tif
116399 F20101114_AAAZKE kendall_e_Page_36.jp2
55640 F20101114_AAAZUA kendall_e_Page_52.pro
12029 F20101114_AAAZWY kendall_e_Page_29.QC.jpg
65199 F20101114_AAAZPC UFE0021519_00001.mets
F20101114_AAAZKF kendall_e_Page_26.tif
37513 F20101114_AAAZUB kendall_e_Page_53.pro
31883 F20101114_AAAZWZ kendall_e_Page_30.QC.jpg
32752 F20101114_AAAZKG kendall_e_Page_24.QC.jpg
2101 F20101114_AAAZKH kendall_e_Page_25.txt
97 F20101114_AAAZUC kendall_e_Page_02.txt
78365 F20101114_AAAZPF kendall_e_Page_04.jpg
2218 F20101114_AAAZKI kendall_e_Page_10.txt
210 F20101114_AAAZUD kendall_e_Page_03.txt
55653 F20101114_AAAZPG kendall_e_Page_06.jpg
47608 F20101114_AAAZKJ kendall_e_Page_11.jp2
1495 F20101114_AAAZUE kendall_e_Page_04.txt
134110 F20101114_AAAZPH kendall_e_Page_08.jpg
102183 F20101114_AAAZKK kendall_e_Page_21.jpg







O 2007 Elizabeth Ann Kendall

To my mother: Gayla Ann Kendall and to my whole family for support and always encouraging
me to follow my dreams


I thank all the professors at the University of Florida who have spent their quality time

teaching me the ropes of biochemistry and the interface of chemistry and biology. In particular, I

thank: Dr. Thomas Lyons for his idea behind the research that has made up this thesis and the

support and encouragement he has given to me for my success in continuing this research; Dr.

Nicole Horenstein for her support in writing the thesis overall; Dr. Gail Fanucci for her

encouragement over the last couple years to work towards the goal of finishing this thesis so I

can move on; Dr. Harrison for reading the first rough draft of this thesis and giving the

encouragement to Einish; and especially Dr. Ben Smith and the Chemistry Department for giving

me the chance to focus on research with the support of the University of Florida Alumni

Fellowship. I thank my colleagues in the Lyons Group who have contributed so much to my

success in this research and specifically training of basic lab protocols needed to work out the

kinks of the research and Eric Greeley for reading through my thesis several times. My biggest

acknowledgment is to all my wonderful friends and family at home in Utah, New Mexico,

California, Hawaii and the rest of the globe. Without my friends and family, who are my entire

support group, I would never have the courage and endurance to keep living my dreams.


ACKNOWLEDGMENT S .............. ...............4.....

LI ST OF T ABLE S ................. ...............7................

LI ST OF FIGURE S .............. ...............8.....

AB S TRAC T ............._. .......... ..............._ 10...


1 INTRODUCTION ................. ...............12.......... ......

Introduction to the Izh2p protein ................. ...............12.......... ....
Izh2p and Metalloregulation. ........._..__..... ._._ ...............12....
Izh2p and M etals .................. .. ........ ..... ...............1
Effect of pGAL1-IZH2 expression plasmid on pFET3-lacZ reporter.............._._._...........13
Progestin and Adipo Q (PAQR) receptors and Izh proteins ......___ ..... ...._ ..............14
Structure-function of Izh2p ........... ....__ ....__ ......_ ...............15
Highly conserved motifs of Izh2p ................. .. ........ ...............15.....
Site-directed mutations of Izh2p conserved motifs ................. ....__ ..................16
Classes of PAQR-like proteins with these conserved motifs ................ ............... ....16
PAQR proteins share conserved motifs with Alkaline Ceramidases .............. ................17
Goal of this study ................. ...............17.......... .....

2 MATERIALS AND METHODS .............. ...............23....

Materials and Methods Overview (Figure 2-1) .............. ...............23....
Strain and growth conditions:. ...23...........
Site Directed Mutagenesis ................. ...............24........... ....
Sequence Analy si s............... ...............24
Tran sform ati on s................. ......... .... .. ......... ... .........2
Mutants H282A and H2806A were obtained by overlap extension ................... ...............25

3 RE SULT S ................. ...............3.. 1......... ...

Sequence data ................ ........... .... ...............31.....
FASTA Format (Appendix A)............... ...............31...
Blasted sequence data............... ...............31..
H 28 2A ................. ...............3.. 1..............
H 286A ................. ...............3.. 1..............
H282A/H286A .............. ...............32....
H 86A .........._.. .. ... ......_._.. ...............32.....

Empty vector or wildtype IZH2 gene .............. ...............32....
Lac-Z D ata ........................ ....... ....... .. .........3
Overlap-Extension Site-Directed Mutagenesi s Results: ....._ ....__ ...... 3 4

GreenTaq Polymerase .............. ...............34....
PFU Polymerase ............ ... ....._ ....._ .............3
Suggestions for future researchers on thi s proj ect ....._._.__ ..... ..__... ......_._........3
Future Studies: ...36................

4 DI SCUS SSION ........._...... ...............4 1....___. ...

IZH genes and the function of Izh2p ............__......__ ....__ ...._ ..............41
IZH2 gene .............. ...............41....
Izh2p Protein ................... ...............41..
Conserved Motifs of Izh2p ........._._ ...... .... ...............41..
Conclusion ........._._ ...... .__ ...............42....


A SEQUENCING RESULTS .............. ...............43....

B ALIGNMENT OF SEQUENCES .............. ...............47....

LIST OF REFERENCES ................. ...............51........... ....

BIOGRAPHICAL SKETCH .............. ...............54....


Table page

2-1 Mutants depicting sites mutated and the 5'-3'sequences of the reverse and forward
primers. Tm (oC) and Hairpin Propensity (AG) kcal-moll. ............ ......................3

3-1 P-Galactosidase Activity (%) of Samples grown in LIM (1CIM Fe3+). .............. ..... ..........37

3-2 A summary of the mutants, the attempts to mutate the IZH2 gene using the
corresponding primers, if the mutant is done, needs to be repeated and latest
progress. .............. ...............40....


figure page

1-1 An overall view of the Izh2p protein in the plasma membrane. ................. ......._........18

1-2 The current model our research is based upon. ....._._._ ............ .......___.......1

1-3 Predicted Izh protein topology showing the potential active sites and metal-binding
residues .............. ...............20....

1-4 A sequence alignment showing distantly related conserved motifs.. ............... ...............21

1-5 The catalytic triad: SxxxHxnD. ............. ...............22.....

1-6 The metabolism of sphingosine and fatty acid from ceramide, and vice versa, from
the enzymes ceramidase and ceramide synthase, respectively .............. ....................2

2-1 An overall scheme of the protocols carried out in this experiment .............. ..............26

2-2 Expression vector pRS316 with IZH2 (GAll-IZH2) or hlarlZH2 (GAL1-hzzelZH2)
inserted............... ...............27

2-3 Yeast episomal reporter plasmid pFET3-lacZ. ...._._._._ ..... ... .___ .. ...._.. .........2

2-4 Site directed mutagenesis using overlap extension PCR. PCR#1 shows each PCR
using the Mut-For + 5'-IZH2 primers and the Mut-Rev + 3'-IZH2 primers .....................28

2-5 Orthonitrophenyl pyrano-galactoside (ONPG) is hydrolyzed by the P-galactosidase
enzyme activity to produce the yellow compound orthonitrophenol (ONP) commonly
used as a sub state to assay P-galactosidase activity in vitro ................. .....................29

3-1 P-Galactosidase Activity (%) of Samples grown in LIM (1CIM Fe3+). All samples
were co-transformed into BY4742 wild-type yeast with pFET3-lacZ reporter. ........._......37

3-2 PCR fragments (5 CIL PCR reaction) obtained using GreenTaq Polymerase (Sigma)......38

3-3 pRS316 plasmid cut with SacI and BBBBBBBBBBBBBBBBBaml restriction enzymes to insert the IZH2
mutated gene into this site............... ...............39..

3-4 Samples of the pRS3 16 plasmid with the inserted IZH2 mutated gene (5 CL)
obtained via overlap extension (pGAL-hzzelZH2) .............. ...............39....

3-5 PCR fragments (5 CIL PCR reaction) obtained using PFU-Polymerase (Promega). .........39

A-1 DNA Sequence for H282A ................. ...............43........... ...

A-2 DNA Sequence for H286A. .............. ...............44....

A-3 DNA Sequence for H282A/H286 Double mutant ........ ................ ........_._... ....45

A-4 DNA Sequence for H86A. .............. ...............46....

B-1 DNA Sequence Alignment for H282A ....__ ......_____ .......___ ...........4

B-2 DNA Sequence Alignment for H286A ....__ ......_____ .......___ ...........4

B-3 DNA Sequence Alignment for H282A/H286A Double mutant ................ ..........._.... ..49

Abstract of Thesis Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Master of Science



Elizabeth Ann Kendall

December 2007

Chair: Thomas Lyons
Major: Chemistry

Understanding distant relationships in conserved motifs of the protein, Izh2p, in S.

cerevisiae may lead to a better understanding about the function of related steroid receptor

(PAQR) proteins in humans. Hence, the overall goal of this study is to gain more insight on the

function and behavior of these membrane proteins and how the structural differences of the

various genotypes affect their activity. A potential metal-binding domain, HxxxH, of a conserved

motif of a plasma membrane protein Izh2p, has been studied to investigate the structure-function

relationship of this protein. Two other conserved motifs also under investigation in the Izh2p

protein are: ExxNxxxH, and SxxxHxnD, We propose that these conserved regions function as

active sites, specifically as amidohydrolases. Point mutations are being generated using site-

directed mutagenesis of several conserved amino acids in this protein that may be involved in

receptor activity or metal-binding. The amino acids are histidine (H), asparagine (N), aspartic

acid (D), glutamic acid (E) and serine (S). These amino acids are being changed from these

functional amino acids to alanines since alanine has a non-functional methyl side group. These

motifs are conserved in related proteins in species ranging from bacteria to humans; therefore

they may have an important function in the activity of the proteins in prokaryotic as well as

eukaryotic organisms. We have observed their activity using a pFET3-lacZ reporter as FET3 is

known to be repressed by the overexpression of IZH2, driven by a galactose-inducible promoter

(pGAL1-IZH2). Three of the histidines of these motifs have been mutated by site-directed

mutagenesis. H86A, of the ExxNxxxH motif, has been mutated to alanine, as well as the two

histidines of the HxxxH motif: H282A and H286A. A double mutant of the HxxxH motif,

H282A/H286A, has also been generated. The double HxxxH mutant exhibits a high loss of

activity. The ExxNxxxH histidine mutant, H86A, also has a high loss of activity. The single

mutants of the HxxxH have some loss of activity. Still under investigation in terms of sequencing

are the following Izh2p mutants: E79A, N82A, S132A, H136A, and D153A. Although the last

set of mutants has not been confirmed by sequence analysis, we still have some interesting data

with their repression on pFET3-lacZ reporter.


Introduction to the Izh2p protein

The Izh proteins are a group of 4 proteins in Saccharonyces cerevisiae which were

discovered to be upregulated by varying zinc concentrations (1, 2). Izh proteins share sequence

similarity to the PAQR (3) family of receptor proteins whose function is still under investigation.

Izh and PAQR proteins share highly conserved motifs (2, 3), and are homologous to known

amidohydrolases. We are interested in what the Izh2 protein function is, so we are mutating it via

site-directed mutagenesis and will compare the mutants to the wildtype Izh2p protein using a

functional assay (2). We compare changes of functional amino acids in the Izh2p that are

changed to non-functional alanines by the expression of a reporter plasmid (pFET3-lacZ). This

plasmid is known to be repressed in yeast by IZH2 when inserted into a galactose-driven

expression plasmid (pGAL-IZH2).

Izh2p and Metalloregulation

Metals play a vital role in biological processes (4). Ancient families of proteins involved in

metal homeostasis have evolved which span across all phylogenetic levels (4). Zinc, for example,

is an integral component of hundreds of different enzymes; it stabilizes protein structures, plays a

role in gene expression and catalysis, participates in transport, and preserves subcellular

organelle integrity (5). Under zinc deficiency, a large number of genes are expressed, indicating

an effect of zinc on metabolic processes (1).

YOLOO2c is a gene in Salcharonyces cerevisiae that is upregulated by both zinc deficiency

and in the presence of myristic acid, an exogenous fatty acid (1, 6). The YOLOO2c gene is

regulated by the transcription factor Zaplp (Zinc-responsive Activator Protein) (Figure 1-1) (1).

Zaplp is a metalloregulatory protein involved in zinc-responsive gene transcription (7). Zaplp

regulates expression of zinc transporter genes important for yeast zinc homeostasis by binding to

the promoters of zinc transporter genes (8-10) on sites known as ZREs (Zinc-Responsive

Elements) (1, 8). YOLOO2c was renamed IZH2 (Implicated in Zinc Homeostasis 2) because it is

expressed in low zinc conditions (1). IZH2 is a gene that encodes a membrane protein, Izh2p,

which affects zinc homeostasis (2).

Izh2p and Metals

Izh2p has been overexpressed in our lab using a pGAL1-IZH2 plasmid and was found to

repress the Zinc Regulated Transporter 1 (ZRT1) in vivo (the high affinity zinc transporter) in

Low Zinc Media (LZM) (9). Because Izh2p overexpression repressed ZRT1, we also wanted to

test if Izh2p overexpression would have an effect on the high affinity iron transporter. The

Ferrous Transporter 3_ (FET3) is a ferroxidase involved in the high-affinity uptake of iron (9-11).

It is also repressed in Low Iron Media (LIM) when Izh2p is overexpressed (12-13). The FET3

promoter is fused to the lacZ gene (pFET3-lacZ), which is the reporter assay we use to monitor

the activity of these receptors (12). In this study we compare the 8-galactosidase activity (pFET3-

lacZ) of the Wild-Type BY4742 S. cerevisiae carrying the empty vector (pRS316L) control,

Izh2p overexpression (pGAL1-IZH2) and overexpression of the mutated Izh2p proteins (pGAL1-

uralZH2) (2, 12).

Effect of pGAL1-IZH2 expression plasmid on pFET3-lacZ reporter

The pFET3-lacZ reporter has allowed us to probe the signal transduction mechanism of the

Izh receptors (12, 13). Our data show that the Izh2p receptor acts through the Pkhl and Pkh2

sphingosine dependent kinases (Figure 1-2) (12, 13). Izh2p was found to require cAMP-

dependent protein kinase (PKA) and AMPK to repress the FET3 activity (Figure 1-2) (12).

Evidence further shows that IZH2 overexpression affects transcriptional repressors (Nrgl and

Nrg2) and activators (Msn1 and Msn2) (Figure 1-2) (12, 13). These repressors and activators

play a role in the FET3 repression (pFET3-lacZ) of the IZH2 expression plasmid (pGAL1-IZH2)


Progestin and Adipo Q (PAQR) receptors and Izh proteins

Data in our lab has also confirmed that PAQR receptors also negatively regulate the high

affinity iron-uptake transporter, FET3 (12). Izh2p shares sequence similarity with a large and

ubiquitous protein family (2) called Progestin Adipo Q Receptors (PAQR) (3). PAQR proteins

are found in eukaryotes as well as prokaryotes (3). Izh and PAQR proteins are predicted to have

seven or more transmembrane domains (TMs) (Figure 1-3) and their predicted topology suggests

extracellular C-terminus and cytoplasmic N-terminus (2, 3). The PAQR proteins also possess

highly conserved motifs that may function as active sites (Figure 1-3): ExxNxxxH (Figure 1-3

blue), SxxxHxnD (Figure 1-3 purple) and HxxxH (Figure 1-3) (2, 3).

The PAQR family includes progesterone receptors and adiponectin receptors (14, 15).

Adiponectin is a hormone that is secreted by adipocytes, fat storage cells (16). Adiponectin

regulates glucose, energy homeostasis and lipid metabolism and has been shown to increase the

oxidation of fatty-acids in mice, reducing triglyceride (TG) content in type 2 diabetic and obese

mice increasing insulin resistance (15-18). Studying Izh2p may therefore be relevant to scientific

research of fatty acid metabolism and diabetes in humans.

Izh proteins have sequence similarity not only to hormone receptors, but also to

hemolysins and to alkaline ceramidases (Figure 1-4) (2). Hemolysins are used by bacteria as a

way to obtain nutrients from host cells by causing pores in the cell wall (such as red blood cells)

thereby killing the cell (apoptosis), which allows pathogenic bacteria to obtain limiting nutrients

(such as iron in the form of Heme in red blood cells) (19). Ceramidases are enzymes that

hydrolyze ceramides to form fatty acids and sphingosines (Figure 1-5) (20, 21). Izh2p protein

may have amidohydrolase activity as part of its function by hydrolyzing ceramides.

Izh2p as a receptor: Izh2p is known to be a receptor for osmotin (22). Osmotin is an

antifungal protein that belongs to the Pathogenesis-Related (PR-5) family of proteins (22).

Osmotin induces apoptosis, by inactivating cellular stress responses via the RAS2/cAMP

pathway (22). The PAQR proteins activate AMP kinase via their adiponectin receptors (22).

Izh2p activates the same signaling responses as the Adiponectin receptors and has recently been

demonstrated to require both cAMP dependent kinase and AMP kinase in S. cerevisiae to repress

the reporter pFET3-lacZ (12).

Structure-function of Izh2p

Structure-function analysis of gene families implies the conservation of function in

families of genes that have a conservation of sequence (23). In fact, the evolution of gene

families is one of the areas where evolutionary approaches can be particularly relevant in the

understanding of gene function in eukaryotic genomes (23). The structure-function of the

conserved motifs in the Izh2p protein is being studied to see if specific amino acids of the

conserved motifs are needed for Izh2p function.

Highly conserved motifs of Izh2p

There are three motifs identified in these proteins that are of significance to this structure-

function study, ExxNxxxH, SxxxHxnD, and HxxxH. The first motif ExxNxxxH (Figure 1-3 blue)

may have an active site of unknown function. The second motif SxxxHxnD (Figure 1-4 purple)

may be an active site similar to the family of proteases called the serine proteases (24). Proteases

are known to catalyze the hydrolysis of the covalent bonds of peptides (5, 24). The active motif

of a serine protease is called the catalytic triad and is made up of an aspartate, a hisitidine and a

serine (Figure 1-5), where the serine is deprotonated by the histidine and nucleophilic serine

alkoxide attacks the carbonyl carbon of a peptide (24). The third motif HxxxH (Figure 1-4)

resembles a known amidohydrolase motif (5). This motif is characteristic of a family of

proteases known as zinc proteases, also known as metalloproteases (5, 24). The HxxxH site in

metalloproteases carries out amidohydrolase activity by binding Zn2+ (5, 24).

Site-directed mutations of Izh2p conserved motifs

ExxNxxxH (Figure 1-3 blue), located at the edge of the first TM (Figure 1-3 blue), is being

mutated to ExxAxxxH (N82A), ExxNxxxA (H86A), ExxAxxxA (N82A/H86A) and to

AxxAxxxA (E79A/N82A/H86A). SxxxHxnD (Figure 1-3 purple), located at the edge of the

second and third TMs (Figure 1-3 purple), is being mutated to AxxxHxnD (S132A) SxxxAxnD

(H136A) and AxxxAxnD (S132A/H136A) and SxxxHxnA (D153A). HxxxH (Figure 1-3 red),

located at the edge of the seventh TM7 (Figure 1-4 red), is being mutated to AxxxH (H282A),

HxxxA (H286) and AxxxA (H282A/H286A).

Two histidines being mutated by site-directed mutagenesis in this study, H282A and

H286A are the two histidines in the HxxxH motif. The mutated Izh2p proteins have been

inserted into the galactose driven pRS~316 vector (pGAL1-M~utlZH2) (2). This expression vector

is being used as a readout for receptor activity using the promoter of the gene FET3 fused to lacZ

inserted into the YEP353 vector (pFET3-lacZ) as a reporter because it responds to Izh2p activity

Classes of PAQR-like proteins with these conserved motifs

There are different classes of the PAQR-like proteins (Figure 1-4) (2, 3). Class I includes

OsmoR (Izh p), Osmotin Rec ptor (2, 22) and Adi oR1 & 2 (Adi onectin Rec ptors), and

PA R3 & 4 (F ure 1-4 Class I) (. Class II contains the mPRs (Membrane Pr gesterone

Receptor) (Figure 1-4 Class II). Class III is composed of hemolysin-like family members (HLY3

and MMD proteins) (Figure 1-4 Class III). The bottom of Figure 1-4 shows the sequence

alignment of the alkaline ceramidases (Figure 1-4 Alk Cer).

PAQR proteins share conserved motifs with Alkaline Ceramidases

Ceramide is a core sphingolipid intermediate and a building block for complex

sphingolipids (25). It is a modulator of cellular events, such as stress response, differentiation,

senescence, cell cycle arrest and apoptosis (25). Ceramidases are enzymes that are responsible

for breaking down ceramide into sphingoid bases and fatty acids (Figure 1-6) (20). In

Saccharomyces cerevisiae the YPC1 gene encodes an alkaline ceramidase (25). This ceramidase

has dual activity of catalyzing both the hydrolysis and synthesis of ceramide in yeast (26).

Sphingolipid metabolism comprises a set of highly regulated pathways that serve to control

the levels of individual molecules, their interconversions, and their function (27). Ceramides

serve as the precursor of all maj or sphingolipids (28). Izh2p may affect zinc and iron

homeostasis directly or indirectly by altering sphingolipid metabolism (13).

Goal of this study

The main goal of this study is to identify if there is an effect on the pFET3-lacZ reporter by

mutating the conserved residues of Izh2p via site-directed mutagenesis. We are therefore

attempting to uncover the significance of highly conserved amino acids identified in one of the

yeast PAQRs (the Izh2p protein) (2, 3). We are particularly interested in the function of the

Izh2p protein, especially since it has been shown to be a receptor for osmotin (2, 12, and 22).

These proteins could be related to alkaline ceramidases, which our lab has evidence that there are

alterations in sphingolipid concentrations when these proteins are overexpressed (13). Due to

structural similarity based on the conserved motifs (2, 3) we hypothesize that these proteins act

as amidohydrolases (ceramidases).

Izh2p protei n integ rated i nto the
yeast cell's plaa ma membrane.

Figure 1-1. An overall view of the Izh2p protein in the plasma membrane. The IZH2 gene inside
the nucleus of the cell (purple). In our LacZ assays IZH2 is driven by GAL1. FET3
expression is repressed, indicated by the (1) when Izh2p is overexpressed.



M sn214 n~


Figure 1-2. The current model our research is based upon. The receptor Izh2p may be an
amidohydrolase producing sphingoid bases, which stimulate Pkhl and Pkh2. Pkhl
and Pkh2 stimulates PKA and cytosolic AMPK and represses nuclear AMPK. The
PKA and cytosolic AMPK repress Msn2/4 and the nuclear AMPK represses Nrgl/2.
The Msn2/4 stimulates the FET3 and the Nrgl/2 represses the FET3.

Re cepto r




~' (HxxxH)
/; I S132A
*~ *~ H36A H282A
D153A H286A
H86A ICytoplasml

Figure 1-3. Predicted Izh protein topology showing the potential active sites and metal-binding
residues: ExxNxxxH (blue), SxxxHxnD (purple), and HxxxH (Red). Adapted from
Smith, J. L., Garitaonandia, I., Kupchak, B. R., Maina, A. S., Regalla, L. M., and
Lyons, T. J. (2007) Manuscript in preparation.




Alk lr men
Cgy Hs CRGL1
Ms 11ASA3

waSaunRcPY v-kT3ar Yev gn vws::ra

BEsg rmBI

ITLOYR-- --- --YQ]



Figure 1-4. A sequence alignment showing distantly related conserved motifs. The trans-

membranes are depicted with an arrow at the top and gaps in the sequences are left as

a blank space. Classes are separated by a solid line: Highlighted areas of the chart are

the highly conserved motifs to be mutated: ExxNxxH (blue), SxxxHxnD (purple), and

HxxxH (red). Adapted from Smith, J. L., Garitaonandia, I., Kupchak, B. R., Maina,

A. S., Regalla, L. M., and Lyons, T. J. (2007) Manuscript in preparation.




ELGMITT LA n run.=14mmonwan-m.


_1___ _~L


I ____ _I'"""" '"" m"l'"" _Y _




rYn EW 1..>





OsrnoR wo2 rcrnnrHE-PFPAPEPTH




Be n~TE
Be one i




re 81y3-1
Vv Bly3

C aSS I soe ygfa
M Be Hly3-2




,--H -0

, H



Figure 1-5. The catalytic triad: SxxxHxnD. This sequence is a highly conserved motif in Izh2p
and the PAQR family.





Ceramide synthase


Fatty Acid

Figure 1-6. The metabolism of sphingosine and fatty acid from ceramide, and vice versa, from
the enzymes ceramidase and ceramide synthase, respectively. Adapted from
Kolesnick, R. (2002) J. Clin. Invest. 110, 3-8.



Materials and Methods Overview (Figure 2-1)

Izh2p mutants (pGAL1-hMelZH2), from the IZH2 gene with the changed functional amino

acid to alanine, were generated via site-directed mutagenesis (Figure 2-1 Step 1). pGAL-IZH2

(2) and pGAL1-hMelZH2 (Figure 2-2) were individually co-transformed (29) into the yeast strain

with a vector containing a FET3 promoter fused to a lacZ reporter (pFET3-lacZ) (Figure 2-3) (1,

2,) in order to monitor P-galactosidase activity (30, 31). pRS316-LEU2 is a cloning vector used

as a tool in molecular analysis to overexpress genes in yeast by using a galactose inducible

promoter (GAL1) (32). The pRS316 plasmid cloning vector (32, 33) was used in this study for

several reasons. One reason is that it can shuttle DNA readily between yeast and bacteria (33),

which is necessary for obtaining large enough quantities of the plasmid carrying the IZH2 gene

(pGAL1-IZH2) and the IZH2 mutants (pGAL1-hMelZH2) to carry out sequencing. Second, it

carries the LEU2 selection marker so we can co-transform it with our lacZ reporter fusions, an

episomal plasmid carrying the selection marker GRA3 with a FET3 promoter fused to the lacZ

reporter (Figure 2-3) (2, 12).

Strain and growth conditions:

BY4742 (Genotype: MATahis3 leu2 lys2 ura3) yeast strain was obtained by Euroscarf

(http:://web .uni-frankfurt. de/fb l5/mikro/euroscarf/) (2). Yeast strain cells were grown in YPD

(1% yeast extract, 2% peptone and 2% glucose) or SD (synthetic defined medium with 2%

glucose carbon source supplemented to a 0.01% concentration of the amino acids) (34, 3 5)

Auxotrophic amino acids added to the SD were L-Histidine, and L-Lysine (SD-L,U media) for

the co-transformations (double transformations with the Control pRS316 empty vector+pFET3-

lacZ (Figure 2-3); and pGAL-IZH2 (2) + pFET3-lacZ and pGAL1-hMu,IZH2+pFET3-laccZ (Figure

2-2) (12). The pRS316 empty vector, pGAL-IZH2 and pGAL1-hsIH2 are driven by galactose

(2, 30).

Site Directed Mutagenesis

IZH2 mutants were obtained by site-directed mutagenesis using QuickChange@

(Stratagene, La Jolla, California) or by overlap extension (Figure 2-4) (36, 37). Primers used for

the mutations are in Table 2-1. Overlap extension was carried out following a three step

Polymerase Chain Reaction (PCR) method (Figure 2-4) (37, 38). The overlap extension

fragments were obtained by PCR and were purified from the agarose gel (Prep-A-Gene, BioRad)

(Figure 2-2). The mutated gene was also cut out of the agarose gel and gel purified (Prep-A-

Gene, BioRad) (Figure 2-2). The mutated gene was cloned back into the pRS~316 plasmid using

gap repair (39). Gap repair consists of the co-transformation of the PCR product, in this case the

IZH2 mutant gene, with the gapped plasmid that contains homologous ends to the PCR product,

in this case the SacI and Bamnl ends of the pRS316 plasmid (39). The IZH2 mutants were

sequenced (University of Florida) in order to verify mutation(s). Primers in Table 2-1 reflect the

selected designed amino acid changes.

Sequence Analysis

The DNA sequences obtained were Blasted against the Izh2p protein using the Blastx

function at the following web site: (http://www.ncbi. nlm. nih.gov/sites/entrez/) Blastx allows you

to search the protein database (Saccharomyces cerevisiae) using a translated nucleotide query, in

this case the IZH2 gene. Blast programs are tools that are widely used for searching the DNA and

protein databases to find sequence similarities (40). For the FASTA and BLAST results for each

of the mutants generated (H282A, H286A, H282A/H286A, and H82A) see appendix A and B,

respectively .


Mutants H282A and H2806A were obtained by overlap extension. BY4742 Wild Type S.

cerevisiae was transformed using the Li-acetate method (29) with 2 CIL digested (Sacl & BBBBBBBBBBBBBBBBaml

pPRS~316 plasmid (32, 33) and 10 CIL of the recombined PRC mutated IZH2 gene (anzrZH2). The

transformed S. cerevisiae were grown on SD -L plates to select for yeast containing the mutated

IZH2 gene (azerZH2) inserted into the plasmid. Several colonies grown on the SD -L plates were

transferred to, and grown in, SD -L media (SD with the auxotrophs L-Histidine, L-Lysine and L-

Uridine) and the plasmid DNA was purified from the yeast (41). The plasmid was transformed

into E. coli and grown on Amp selective plates to select for the bacteria carrying the plasmid

with the IZH2 mutant insert (pGAL1-hzzelZH2) (Figure 2-1). Double transformations of the

following were carried out:

* Negative Control: Wildtype (BY4742) + pRS316 vector + pFET3-lacZ;
* IZH2 Sample: Wildtype (BY4742) + pGAL1-IZH2 vector + pFET3-lacZ
* Mutant IZH2 Sample: Wildtype (BY4742) + pGAL1-hzzelZH2 + pFET3-lacZ

P-Galactosidase Assays: Izh2p represses FET3 in low iron environments (Figure 1-1) (2,

12). Co-transformed yeast cells that were used for the P-galactosidase assays were grown in SD-

U-L overnight then 100pL (OD=0. 1) was transferred to Low Iron Media (LIM), 1pM Fe3+ (40).

LIM was prepared according to standard procedures (42) with FeCl3 added back to the LIM

(1CIM, or 1mM). Our P-galactosidase assays are driven by a FET3 promoter fused to the Lac-Z

reporter (Figure 2-3). Izh2p activity is measured by the repression of FET3 when our Izh2p

protein is overexpressed by adding 2% Galactose to LIM (40). The LIM is supplemented with

nitrogen base, Citrate (pH=4.2) (43) and EDTA to control iron availability by chelating iron (42).

P-Galactosidase assays were carried out following standard procedures previously described

(30). Orthonitrophenyl pyrano-galactoside (ONPG) is hydrolyzed by the P-galactosidase enzyme

IP- Galactosidase Assays

0 Galactosidase Assays to compare
the FE TS repression of the Control,

Izh2p and Izh2p mutants

activity to produce the yellow compound orthonitrophenol (ONP) (Figure 2-3). The P-

galactosidase activity was calculated in Miller Units as previously described: (dA4420 x 1,000)/

(min x ml of culture used x culture A600) (44).

IGap Repai
Site-Dircted MIutagenesis
) Mutated gene Put into
Mutate IZH2 gene Plasmid vba Cap RePair (this
via Site-Directed step skipped with
QuickChange method since
Mutagenesis gene is mutated and copied
while still in plasmid)

SpGAZ 1-3a~dH2


Negative Contmol- Wildtype (BY4'742) + pRS316 + pFET3-lacZ

IZH2 Sample: WildtyPe (BY4'742) +pCA1-MarlZH+ pFET3-lacZ

Mutant JZHI2 Sample: WildtyPe (BY4742) + p C8ll-MarlZH + pFE T3-lacZ

Figure 2-1. An overall scheme of the protocols carried out in this experiment: Site-Directed
Mutagenesis, Gap Repair, Co-transformation and P-Galactosidase Assays.

~GL- imilli

Yeast Episomal Shuttle Plasmid-l
Used for Expressing lZH2



GAll-13/ or !All-ma0/V2
overexpressed by growing in
Galactose media

Figure 2-2. Expression vector pRS316 with lZH2 (GAll-IZH2) or userlZH2 (GAL1-s,,alZH2)
inserted. Adapted from Sikorski, R.S. and Hieter, P. (1989) Genetics. 122, 19-27 and
Liu, H., Krizek, J. and Bretscher, A. (1992) Genetics. 132, 665-673.

Yeast Episomal
Reporter Plasmid

1// IR43 -Auxotro phicl
' Selection Marker

locZ~ Reporter-


ITS -Gene 31T
repressed when

Figure 2-3. Yeast episomal reporter plasmid pFET3-lacZ.

for Plasmid


- in vitro

Site Directed Mutagenesis
using Overlap Extension PCR

I *








av~rlap srrsnsEan

Figure 2-4. Site directed mutagenesis using overlap extension PCR. PCR#1 shows each PCR
using the Mut-For + 5'-IZH2 primers and the Mut-Rev + 3'-IZH2 primers. PCR#2
shows the recombination of each fragment generated in PCR#1, which yields the
mutated gene as the end result. Adapted from Sherman, F., Fink, G. R., and Hicks, J.
B. (1986) Methods in Yeast Genetics, Cold Springs Harbor Laboratory, Cold Spring
Harbor, N. Y: Cold Spring Harbor Laboratory Press and Vallejo, A. N., Pogulis, R. J.,
and Pease, L. R. ( 1995) M~utagenesis and synthesis of novel recombinant genes using
PCR. In PCR Primer: a Laboratory Manual. Cold Spring Harbor, NY: Cold Spring
Harbor Laboratory Press.

musi.n y

Yutated Ge~
IU~LedGerr I


mH20H ND2

O -


ortho- nitrophenol (ONP)
is yellowh (Amax, = 420 nrn)


Ortho-n itrophenyl-P-D-galactopyranoside (ONPG)

Figure 2-5. Orthonitrophenyl pyrano-galactoside (ONPG) is hydrolyzed by the P-galactosidase
enzyme activity to produce the yellow compound orthonitrophenol (ONP) commonly
used as a substrate to assay P-galactosidase activity in vitro. Adapted from Guarente,
L. (1983) M~ethods Enzymol. 101, 181-191 and Miller, J. H. (1972) Experiments in
Molecular Genetics. Cold Spring Harbor, N. Y.: Cold Spring Harbor Laboratory

Table 2-1. Mutants depicting sites mutated and the 5'-3'sequences of the reverse and forward
primers. Tm (oC) and Hairpin Propensity (AG) kcal-mor~ calculated using the IDT

Primer Name


IZH2-Double-S1 32A;

IZH2-Double-S1 32A;

IZH2-Double- N82A;

IZH2-Double- N102A;


IZH2-Triple- E79A;
N102A; H86A -For


http://www.idtdna. com/. The underlined codon is that for the amino acid








Tm Hairpin
(oC) Propensity
60.9 -2.92, -2.44
61.1 -1.70
57.8 -2.43
57.3 -2.66

5'-3' Sequence



See: H282A & H286A Primers.

See: H282A & H286A Primers.

54.8 -1.29, -0.78
54.8 -1.44, -0.84
56.4 -1.67, -1.57
56.4 -0.85, -0.5
59.2 -0.53
59.2 -0.19
60.9 -2.22, -1.56
60.9 -2.11, -1.79
59.4 -1.16, -1.01
59.4 -1.34, -1.26, -
0.95, -0.79,-
59.4 -1.64, -1.07, -

59.4 -1.85, -1.82, -

58.9 -0.96, -0.85, -
0.77, -0.69

58.9 -1.12, -0.97, -

62.5 -3.99, -3.98, -
2.95, -2.79, -
2.33, -2.32
62.5 -4.21, -3.19, -
2.45, -2.14

67.8 -4.17

69.6 -5.83, -5.70, -
5.34, -5.22, -
5.12, -5.01,-
3.69, -3.07














Sequence data

FASTA Format (Appendix A)

The samples sequence data are represented in the FASTA format (Appendix A). For each

of the Izh2p mutants that worked there is a forward sequence that was sequenced using the T7

primer and there is a reverse sequence that was sequenced using the pRS~316 primer. Although all

the sets of primers were attempted for both overlap extension and the QuickChange@ method

(Chapter 2), only four of the mutants were generated. The mutants generated were H282A,

H286A, H282A/H286A (double HxxxH motif) and H86A. The blasted sequence data for each of

the sequence reactions can be observed in Appendix B and is discussed below.

Blasted sequence data


The H282A Izh2p mutant was generated via the overlap extension method described in

chapter 2. By looking at the blasted sequence alignment in Appendix B the H282A amino acid

changed is indicated in red. Both the forward and the reverse sequences show this change (Figure

B-la and b).


The H286A Izh2p mutant was generated via the overlap extension method described in

chapter 2. By looking at the blasted sequence alignment in Appendix B the H286A amino acid

changed is indicated in red. Both the forward and the reverse sequences show this change (Figure

B-2a and b).


The H282A/H286A double HxxxH mutant was obtained using both of the site-directed

mutagenesis methods (overlap extension for the H286A first, then this was used as the template

and the primers for the H282A mutant were added to the PCR cocktail using the QuickChange@

method to generate the H282A/H286A double mutant). The blasted sequence alignment in

Appendix B for the H282A/H286A double mutant show that both of the histidines are changed

to alanines and are indicated in red (Figure B-3a and b).


The H86A Izh2p mutant was generated via the overlap extension method described in

chapter 2. By looking at the blasted sequence alignment in Appendix B the H86A amino acid

changed is indicated in red. Both the forward and the reverse sequences show this change (Figure

B-4a and b).

Empty vector or wildtype IZH2 gene

There were several samples with the overlap extension method that appeared to be the

empty vector. Furthermore, there were several samples that contained the wildtype IZH2 gene,

with both the overlap extension and the QuickChange@ method. The QuickChange@ protocol

involves digesting the PCR sample with the DPN1 enzyme to get rid of the template strand by

chopping up methylated parent IZH2 strand (36) so this step must not have worked for this


Lac-Z Data

It has been shown that overexpressing Izh2p by co-transforming the expression vector

pGAL1-IZH2 with the pFET3-lacZ reporter into BY4742 represses the pFET3-lacZ activity (2,

12). The lacZ data generated of the pRS~316 wildtype empty vector co-transformed with pFET3-

lacZ reporter into the yeast BY4742 has a higher activity in 1pM than the yeast overexpressed

pGAL1-IZH2 (2). Izh2p was seen to repress pFET3-lacZ activity as previously reported (2).

Using the co-transformation approach we have ran P-Galactosidase Assays on each of the

mutants generated and have determined that there is partial deactivation of the usual pFET3-lacZ

repression when Izh2p (pGAL-IZH2) is overexpressed. The IZH2 mutants (pGAL1-hualZH2):

H282A, H286A, H282A/H286A, H86A were compared to Izh2p, with respect to pFET3-lacZ

repression in 1pM LIM (Figure 3-1 and Table 3-1).

The four Izh2p mutants verified by sequence analysis PSI Blast all show less of a

repression on the pFET3-lacZ P-galactosidase activity than the Izh2p protein when grown in

LIM (1pM). This demonstrates that there is an effect of these amino acids being mutated to non-

functional alanines. There is an effect on the function of HxxxH and it loses its repressive control

over pFET3-lacZ. The repression of pFET3-lacZ activity of the H282A/H286A (AxxxA) and

H86A (NxxxA) mutants is comparable to the pRS316 wildtype vector control grown in 1 pM

LIM (Figure 3-1).

The partial deactivation seen with all the Izh2p mutants tells us that there is still some

enzyme activity and that these amino acids are important, but perhaps not essential for full Izh2p

function. The single histidine mutants: H282A (AxxxH), H286A (HxxxA), show less of a loss of

the pFET3-lacZ repression so they may be less important for Izh2p function. H86A and the

HxxxH (H282A/H286A) double histidine mutants show more of a loss of the pFET3-lacZ

repression so they may be more important for Izh2p function.

Conclusion of lac-Z Data: The Izh2p plasma-membrane protein may be of further use for

studying animal energy (glucose homeostasis), metal homeostasis and metabolism to gain further

information on better ways to control processes such as diabetes and diseases linked to metal

deficiencies. The overall trend of the pFET3-lacZ driven P-galactosidase activity is that the Izh2p

overexpressed yeast cells (pGAL1-IZH2) repress the FET3 activity as compared to the empty

pRS316 vector co-transformed yeast cells (12, 13). The mutants generated of the Izh2p (pGAL1-

MuIZH2) have less of a repression of FET3 activity than the wildtype Izh2p (Figure 2-1 and

Table 2-1).

Overlap-Extension Site-Directed Mutagenesis Results:

GreenTaq Polymerase

There were several problems that were observed with the overlap-extension site-directed

mutagenesis procedure. The first problem encountered was that the PFU polymerase would not

copy the gene fragments as expected. Thus I tried using a free sample of the GreenTaq (Sigma)

polymerase, which copied the gene fragments on the first PCR protocol carried out (Figure 3-2).

Thus, the overlap extension originally was successfully carried out with the GreenTaq

polymerase, and the procedure was carried through. Figure 3-3 shows the first time I was able to

cut the pRS316 plasmid with the SacI and Bamnl restriction enzymes (the cut plasmid is shorter in

length on the gel than the uncut pRS~316 plasmid).

The mutated IZH2 gene was then inserted into this site by gap repair (described in Chapter

2). The final recombined product was visualized on an agarose gel (Figure 3-4) and sent in for

sequencing. These samples had many random mutations and not what we were looking for in

terms of the site-directed mutagenesis. In conclusion, the samples obtained using the GreenTaq

polymerase using the overlap extension PCR method were sequenced and yielded a very

randomly mutated IZH2 gene.

PFU Polymerase

PFU polymerase is the optimal polymerase to use in this protocol because it has a lower

rate of random mutations than the GreenTaq polymerase, however working with this polymerase

was problematic copying the fragments with the mutated amino acid. For instance, in Figure 3-5

the smaller fragments were copied with the PFU polymerase, whereas, the larger fragments were

repeatedly not fully extended using PFU polymerase. There may have been such a low quantity

that it was impossible to visualize on a gel, which is a problem when excising the fragments from

the gel in order to gel purify and move on to the next step.

Thus, there were problems using the PFU polymerase with the quantity of PCR product

obtained to gel purify the DNA. The DNA fragments may have been lost because there was so

little of it to begin with, or the fragment did not extend correctly. In addition, the whole mutant

gene was not replicated correctly so when it was sequenced there were extra mutations. There

were three steps in the procedure of overlap extension to perform gel purification where DNA

may have been lost: 1. On each of the individual fragments: Mut-For+5'-IZH2 and Mut-Rev+3'-

IZH2 and 2. after recombination of the fragments to yield the mutant 1ZH2 gene. Another

problem area was getting the purified xistlZH2 gene back into the pRS~316 vector. The protocol of

getting the inserted xistlZH2 gene that was taken up into the pRS~316 vector into the E. coli to

clone more for sequencing and transformations was also a problem area using the overlap

extension method.

The overlap extension did work with H282A and H286A. The QuickChange@ method

copies the whole gene starting at the primer site with the desired mutation while it is still in the

plasmid (36). The H282A/H286A and the H86A mutants were generated using the

QuickChange@ method.

Suggestions for future researchers on this project

Overlap extension suggestions: use maximum amount of PFU polymerase (1CIL per 50C1L

total reaction), and two to three times the extension time for the larger fragment and the

recombining PCR step (step 2 Figure 2-1). 50ng DNA worked best for me for both types of Site-

Directed Mutagenesis.

The QuickChange@ method should be used as described in the manual (36). This method

proved to be less time consuming and messy and overall my preferred method of Site-directed

Mutagenesis. Other suggestions using this method are to use the recommended Tm for each of

the primers and to run the PCR reactions one at a time for each of the mutants based on these

Tms. In my experience I followed the recommended temperatures for the PCR reaction in the

manual, however, some worked and some didn't. This may be one of the reasons. So keep the

temperature for the primer exactly as that recommended by the primer manufacturer. Also, there

may need to be a longer extension time as recommended in the troubleshooting section of the

manual. I attempted to carry this out, but have run out of time to follow through with the

complete procedure. The next person to finish this proj ect may wish to follow up on this. Lastly,

if there are no colonies growing on the plate, the troubleshooting section recommends using 5 pL

of the sample when transforming into E. coli to grow on the LB/Amp plates (3 6).

Future Studies:

Site-directed mutagenesis of the IZH2 gene: Table 3-2 lists which of the mutants have

been completed, which mutants have been attempted, and their latest progress. H282A mutant

should be repeated since several additional sites were randomly mutated (Figure B-la and b).

H286A, H282A/H286A, and H86A are done. The following mutants are still being mutated:

N82A, N102A/H106A, S132A, H136A, S132A/H136A, D153A, and E79A/E82A/H86A.

Double and triple point mutations may require additional PCR cycles as recommended in the

QuickChange@ manual (36).

HA (Haemaglutanin) and GFP (Green Fluorescent Protein Tagging: Future Studies:

Future studies should include HA-tagging and GFP-tagging of the Izh2p mutants with the

conserved amino acids of interest mutated to alanine. This will confirm expression of the

mutants and prove that they have not been degraded in S. cerevisiae due to the mutated amino

acids being essential for function. If any of the mutants are degraded this assay will tell us which

specific amino acids are essential to carry out the function of the Izh2p protein. This may apply

to the proteins of the PAQR family as a whole since the amino acids mutated are highly

conserved among the whole family (2, 3). GFP-tagging will confirm the proper localization of

the proteins.

pFE T3-lacGZ


60 O pET3-lacZ in7
iii LIM (1pM Fe +)
o 40 -


Samples grown in Low Iron Media
(1p IM Fe ')

Figure 3-1. P-Galactosidase Activity (%) of Samples grown in LIM (1CIM Fe3+). All samples
were co-transformed into BY4742 wild-type yeast with pFET3-lacZ reporter. pRS316
serves as the empty vector control, Izh2p is the protein of interest (pGAL1-IZH2) and
the Izh2p mutants (pGAL1-M~utlZH2): H282A, H286A, H282A/H286A, and H86A.

Table 3-1. P-Galactosidase Activity (%) of Samples grown in LIM (1CIM Fe3+). LacZ activity
presented is that of samples grown in 1 CM Fe3+ LIM and shown as a percentage with
pRS316 wildtype as the control.

P-Galactosidase Activity

Samples grown in LVIM(1pM Fe3+)
pRS316 Empty Vector CONTROL
Izh2p H282A
Izh2p H286A
Izh2p H282A/H286A
Izh2p H86A

: : 8
::.....~... r~~i,~ ~P
i~i .~ i
ii ...
.. .: ... r
"'' ~~; '
: ;? i~~;;;;3 r ~. ; ~~
r- :.llj.i .. ..srl. ""*u. :52
Gn in -Tag :i8;:i...
.. 'RI ~: ;ii I. ''' i~~
"' "~6~~
''' ::;~ .:Y ''''''"' rr
i''''' :-''''''
--.- Pollmerase
~X i''''''~"'~''"
.~.1.. -. --- -----------
~:i~i : ': r.. ~;
$~.::::r :u :;rr
i '. -~;~ :-.r.
I--~~ .~~X' s.-- r.
r: ~R:lx''~ '..
--.-'- .- ;U~-
''". .' ~; '
.i~ ~i: iiii;7:i:i :: ~~G' ..'
~: r. .- ,
.......... 6.~;3;;P
:~. xV

: -;.;

..I ~
i'lj r: i
:x ~ : ~~i~ olymerasl
ii I

Figure 3-2. PCR fragments (5 CIL PCR reaction) obtained using C;reenT~q Polymerase (Sigma).
From left to right: Top part of gel, 5C1L Ikb DNA Ladder (Sigma-Aldrich),: 1 and 5)
5'-Rev-IZH2 (H282A), 2 and 6) 3'-For IZH2 (H302A), 3 and 7) 5'-Rev-IZH2
(H306A), and 4 and 8) 3'-For IZH2 (H286A) Bottom part of gel, 5C1L Ikb DNA
Ladder (Sigma-Aldrich), PCR fragments obtained using PFU-Polymerase (Promega):
1> 5'-Rev-IZH2 (H282A), 2) 3'-For IZH2 (H282A), 3) 5'-Rev-IZH2 (H286A), and 4)
3'-For IZH2 (H286A).

?:::': I I:::::::i I:.:C":::' ~"' ':; ;rq

Figure 3-3. pRS~316 plasmid cut with Sacl and BBBBBBBBBBBBBBBBBamI restriction enzymes to insert the IZH2
mutated gene into this site.. From left to right: 5C1L 1kb DNA Ladder (Sigma-
Aldrich), 1) pRS316 plasmid cut with Sacl and BBBBBBBBBBBBBBBBBaml and 2) uncut pRS316 plasmid.

Figure 3-4. Samples of the pRS3 16 plasmid with the inserted IZH2 mutated gene (5 CL)
obtained via overlap extension (pGAL-hrtelZH2). From left to right: 3 pg Hind h
ladder. Lanes 1-3 are H282Aand lanes 4-6 are H286A obtained via overlap extension.

Figure 3-5. PCR fragments (5 CIL PCR reaction) obtained using PFU-Polymerase (Promega).
From left to right: 5C1L 1kb DNA Ladder (Sigma-Aldrich), 1 and 5) 5'-Rey-IZH2
(H282A), 2 and 6) 3'-For IZH2 (H282A), 3 and 7) 5'-Rey-IZH2 (H286A), and 4 and
8) 3'-For IZH2 (H286A).

Table 3-2. A summary of the mutants, the attempts to mutate the IZH2 gene using the
corresponding primers, if the mutant is done, needs to be repeated and latest progress.
Mutants Attempts to Mutate Done Needs to be Repeated Latest Progress
(viN) (viN)
H282A Overlap Extension Y Y QuickChange@ didn't

Overlap Extension
Overlap Extension and
Overlap Extension and

Overlap Extension and
Overlap Extension and

Overlap Extension and

Overlap Extension and

Overlap Extension and

Overlap Extension and









Sequenced as IZH2
wildtype with
QuickChange@ Kit.
Overlap Reverse
Fragment didn't

Gap Repair didn't
QuickChange@ sample
didn't appear to have
IZH2 gene when cut
with Sacl/Sall.
Sequence wasn't
correct (non-specific
primer binding during
PCR) with
Overlap Reverse
Fragment didn't
method appeared to
work, didn't sequence
(non-specific primer
binding during PCR).
Overlap Reverse
Fragment didn't
Gap Repair didn't
QuickChange@ sample
didn't sequence.
QuickChange@ sample
didn't appear to have
IZH2 gene when cut
with Sacl/Sall.
Overlap Reverse
Fragment didn't extend

Primers may not have
worked. Colonies
appeared, lac-Z
seemed to work,
sequence not correct.

DI 53A

E79A/N82A/H86A QuickChange@


IZH genes and the function of Izh2p

IZH2 gene

The IZH2 gene, discovered during a DNA microarray analysis of gene transcription during

low zinc conditions (1), shares sequence similarity with a superfamily of proteins (PAQRs) that

are homologous to membrane steroid receptors and adiponectin receptors (3). This superfamily

of proteins is distantly related to bacterial hemolysins and alkaline ceramidases (2). IZH gene

expression is regulated by Zaplp, which regulates expression of zinc transporter genes important

for yeast zinc homeostasis (1). IZH2 is also regulated by the exogenous fatty acid myristic acid,

thus it may play a role in lipid metabolism (2, 6).

Izh2p Protein

The membrane protein Izh2p is involved in iron and zinc metalloregulation. It has highly

conserved motifs (2). Izh2p may serve to function as an amidohydrolase. This idea is based on

the similar structure of alkaline ceramidases to the IZHs.

Conserved Motifs of Izh2p

ExxNxxxH, SxxxHxnD, and HxxxH are the specific motifs of interest in this study. They

are located in the highly conserved regions of Izh2p (Figure 1-3) (2, 3). Our long-term goal is to

determine if these motifs are important for the function of Izh2p. We are investigating several of

the amino acids in these motifs by changing them to alanines by site-directed mutagenesis. This

study reports the findings on the histidines of two of these conserved motifs: ExxNxxxH, H86A,

showed a loss of pFET3-lacZ activity repression (Figure 3-1 and Table 3-1) and of the HxxxH

motif, single mutants (H282A and H286A) showed a slight loss of pFET3-lacZ activity

repression (Figure 3-1 and Table 3-1). The double HxxxH mutant (H282A/H286A) showed the

most loss of pFET3-lacZ activity repression (Figure 3-1 and Table 3-1).


Izh2p is involved in metalloregulation (2), although the exact mechanism by which this

protein performs its function is still unclear. Izh2p and PAQR proteins, possess the highly

conserved motifs ExxNxxxH, SxxxHxnE, and HxxxH (Figure 1-4) (2, 3). The conserved amino

acid sequences of Izh2p may be important for the function of receptor signaling. The histidines

of HxxxH motif may be important to the function of these proteins.

These proteins share sequence homology with an ancient family that spans across species

(2, 3). There is also a distant homology to alkaline ceramidases and hemolysins. The fact that

they share highly conserved residues on the inside of the cellular membrane may be because they

share similar signaling pathways. Further research into this query is needed. Research in our lab

has shown that these receptors increase endogenous sphingosine (13). Sphingosines are the

product of ceramidases because ceramidases hydrolyse ceramide into fatty acid and sphingosine

(Figure 1-5). Since Izh and the PAQR proteins share such significant structural similarity with

the alkaline ceramidases this suggests that they may behave as ligand-activated enzymes that

produce secondary messenger sphingoid bases (13).












Figure A-1. DNA Sequence for H282A. (a) Forward; (b) Reverse

>Mul-2 -T7

G~i24333""C AGTAATACO-"






974 f"HEf"K: 9629

Figure A-2. DNA Sequence for H286A. (a) Forward; (b) Reverse







401 AGIAGCl202
951 TTGT40A
1001 A2ATICAfX



Figure A-3. DNA Sequence for H282A/H286 Double mutant. (a) Forward; (b) Reverse

Afui 5-2-T7
51 AGA~ITTTAAT AAO22* AGTG92*21- TGcCG21TA~a 222A






T TG3T~k311







C11103CCCC I;E









801 ~4CAiZaAI 951 O~=;TCITTTAT





Figure A-4. DNA Sequence for H86A. (a) Forward; (b) Reverse

> rEfINP 014641.2| Ihp[achrmcs eeiie

3p 912442 12H2 YEAST A ~DIPOR-like recmptor 12H2 [Ph.mphase etabalism
protcin 26]l

Boare = 610 bits (157a]), Erpct == 2c-179
Identiities = 299/204 (B$), Positives = 901/904 (499), Ga~ps = 0/20 (0%)
E'rame +2






Queryr 915 GIVB 926

Shjet aid GIFB a17(?

> rcEfNP 014641.2| si Bccamras reiim

3p 91244212H2 YERST ADlPOR-likee reemptor 1252 (Phamphae metabalism
prtatein 26)

BEOarm= 610 bits (1572), Espe~ct= 2c-79
Identities = 299/2a04 (9BS), Positives = 201/204 (999), Gaps = 0/204 (GB)
Crrame= -1






Query 21 GIVB 10
Shint 214 GIVB 217 (b)

Figure B-1. DNA Sequence Alignment for H282A (a) Forward; (b) Reverse.



> re-f NP 0146141 2 Ihp[a1aage eeiie

splg124421ZE2a YEABT O DIPO-like re~ceptor 1232 [Emasphse meanha~lism

Lcngth=2 17

inaore = 627 bits (1642), Expe~ct = 0.0
Identities = a14/215 (99t$), Positives. = 214/215 (99t$), Gaps = O/215 (Gt$)
Frame = +1






Que~ry 901 SYELVETEMENGIV5 945

> reflNP 014441.21 Ihp[acaaye eeiie

spiln2442|12K2 YEAST. A DIPOR-nik~e re~cepsa 1252 [I~usagans metabalism

Ltngth=2 17

Boa~rc = 640 bits (1652), Erpect = 0.0
Ident~itie = 216/21~ (99%), Positives = 216/21~ (99%), Gaps = 0/217 ([O$)
rrame = -a






Que~ry 59 LNBE15E1KMENGIV9 9
Shjct 201 LaaanBYe15EKMNGIV9 217 (b)

Figure B-2. DNA Sequence Alignment for H286A (a) Forward; (b) Reverse.

> ref INP 014641.2 :1 Bchrmye eeiie

3pligl4dd2|lH2 YEAST AD~IIPOR-likt e re~cptor 1252 (Phamphase metabalism
protein 26)
Length=2 17

Bou~re = 62a5 bits (1627), Erpect = 0.0
Idecntities = 214/217 (99th Positive. = 214/217 (99%], G~ps = 0/217 [Ot)
Frame = --2







SjEt~ 201 44 LNYT.VIMNGV 1

.plgl244~2 I2H2 YEAST A ~DIPOR-like recept~ar 12H2 [Phum~phas met~ablism
protein 26)
Lenrgth=2 17

Boatrc= = 62 bits (1622)l, Exrpect = 0.0
Identities~ = 212/21 (99t),, Posiivtive = 212/215 (9t), Gp=oaps =/5(08)
Crame = +c2






Queryr 914 BYEF..VIMFPGIVB 95B
Shjct 202 BYEF..VHEME"NGIVB 217 (b)

Figure B-3. DNA Sequence Alignment for H282A/H286A Double mutant (a) Forward; (b)

> reflNP 014641.2 Ihp[achrmcsuneiim

.p 912442 II2H2 YEAST AD~IIPOR-like reasynaor 12H2 [ibazaphase meanhralism
proteinr 26)
Lcngth= 1 7

Bca~rc = 629 bits (1147), Kapact = 0.0
Identities = 215/117 (99%), Pan.itives = 215/2117 (99$, Gps = 0/217 (Gt)
Frme = -2






Sbjet~ 201 LNdELBYKPldHiIVMNGV 21i (a)

> rcEflNP 014641.2| Ihp[achrm;s reiie

3p 912442|1252 YEAST A ~DIPOR-like reasynap~r 1252 (Mansphase meanhalism
protcin 26)

Boa~re = 62? bits [1642], Expcat = 0.0
Identities = 214/215 (99%], Panitiven~ = 214/215 (99%), Gaps = 0/215 [Gt)
Er~ame = +1






Qiueryr 901 9YELVHIibEKMNIVB 945

Shjot 202 suELVHIKE~nGIVB 217 (b)

Figure B-4. DNA Sequence Alignment for H86A mutant (a) Forward; (b) Reverse.


1. Lyons, T. J., Gasch, A. P. Gaither, L. A., Botstein, D, Brown, P. O., and Eide, D. J. (2000)
Proc. Natl. Acad. Sci. 97 (14), 7957-7962.

2. Lyons, T. J, Villa, N. Y., Regalla, L. M., Kupchak, B. R., Vagstad, A., and Eide, D. J.
(2004) Proc. Natl. Acad. Sci. 101 (15), 5506-11

3. Tang, Y. T., Hu, T., Arterburn, M., Boyle, B., Bright, J. M., Emtage, P. C., and Funk, W.
D. (2005) J. Mol1. Evol. 61, 372-380.

4. Gaither, L. A., and Eide, D. J. (2001) Bionetals 14, 251-270.

5. Vallee, B. L., and Auld, D. S. (1990) Biochemistry. 87, 220-224.

6. Karpichev, I. V., Cornivelli, L., and Small, G. M. (2002) J. Biol. Chent. 277 (22), 19609-

7. Zhao, H., and Eide, D. J. (1997)Mol1. CellBiol. 17 (9), 5044-52.

8. Eide, D. J. (2003) J. Nutr. 133, 1532S-1535S.

9. Zhao, H., and Eide, D. (1996) Proc. Natl. Acad. Sci. 93, 2454-2458.

10. Zhao, H., and Eide, D. (1996) J. Biol. Chent. 271, 23203-23210.

11. Dix, D., Bridgham, J., Broderius, M., and Eide, D. (1997) J. Biol. Chent. 272 (18),

12. Kupchak, B. R., Garitaonandia, I., Villa, N. Y., Mullen, M. B., Weaver, M. G., Regalla,
L. M., Kendall, E. A., and Lyons, T. J. (2007) Biochina. Biophys. Acta. 1773 (7),

13. Kupchak, B. R. Regalla, L., Villa, N., Appin, C., Vagstad, A., Wolford, C., Cowart, A.,
Hannun, Y., and Lyons, T. (2006) Yea~st Genetics M~eeting. Abstract # 48.

14. Zhu, Y., Bond, J,. and Thomas, P. (2003) Proc. Natl. Acad. Sci. 100, 2237-2242.

15. Yamauchi, T., Kamon, J., Ito, Y., Tsuchida, A., Yokomizo, T., Kita, S., Sugiyama, T.,
Miyagishi, M., Kara, K., Tsunoda, M., Murakami, K., Ohteki, T., Uchida, S.,
Takekawa, S., Waki, H., Tsuno, N.H., Shibata, Y., Terauchi, Y., Froguel, P., Tobe,
K., Koyasu, S., Taira, K., Kitamura, T., Shimizu, T., Nagai, R., and Kadowaki, T.
(2003) Nature 423, 762-769.

16. Yamauchi, T., Kamon, J., Minokoshi, Y., Ito, Y., Waki, H., Uchida,, S., Yamashita, S.,
Noda, M., Kita, S., Ueki, K., Eto, K., Akanuma, Y., Froguel, P., Foufelle, F., Ferre.,
P., Carling., D., Kimura, S., Nagai, R., Kahn, B.B., and Kadowaki, T. (2002) Nature
M~ed. 8, 1288-1295.

17. Fruebis, J., Tsao, T. S., Javorshi, S., Ebbets-Reed, D., Erickson, M. R., Yen, F. T.,
Binnain, B. E., and Lodish, H. F. (2001) Proc. Natl. Acad. Sci. 98, 2005-2010.

18. Yamauchi, T., Kamon, J., Waki, H., Terauchi, Y., Kubota, N., Hara, K., Mori, Y., Ide,
T., Murakami, K., Tsuboyami-Kasaoka, N., Ezaki, O., Akanuma, Y., Gavrilova, O.,
Vinson, C., Reitman, M. L., Kagechika, H., Shudo, K., Yoda, M., Nakano, Y., Tobe,
K., Nagai, R., Kimura, S., Tomita, M., Froguel, P., and Kadowaki, T. (2001) Nature
M~ed. 7, 941-946.,

19. Sritharan, M. (2006) Indian J2~ed2icrobiol. 24, 163-164

20. Kolesnick, R. (2002) J. Clin. Invest. 110, 3-8.

21. Mao, C., Zu, R., Szulc, Z. M., Bielawski, J., Becker, K. P., Bielawska, A., Galadari, S.
H., Hu, W., and Obeid, L. M. (2003) J. Biol. Chem. 33, 31184-31191.

22. Narashiman, M. L., Coca, M. A., Jin, J., Yamauchi, T., Ito, Y., Kadowaki, T., Kim, K.
K., Pardo, J. M., Damsz, B., Hasegawa, P. M., Yun, D-J., and Bressan, R. A. (2005)
Molecular Cell. 17, 171-180.

23. Charlesworth, D., Charlesworth, B., and McVean, G. A. (2001) Trends Ecol. Evol. 16
(5), 235-242..

24. Coleman, J. E. (1995) Annu. Rev. Biochem. 61, 897-946.

25. Mao, C., Xu, R., Bielawska, A., Szulc, M., and Obeid, L. M. (2000) J. Biol. Chem. 275
(40), 31369-31378.

26. Mao, C., Xu, R., Bielawska, A., and Obeid, L. M. (2000) J. Biol. Chem. 275, 6876-6884

27. Hannun, Y. A., and Obeid, L. M. (2002) J. Biol. Chem. 277 (29), 25847-25850.

28. Merrill, A. H., Jr., Sullards, M. C., Wang, E., Voss, K. A., and Riley, R. T. (2001)
Environ. Health Perspect. 109 (2), 283-289.

29. Gietz, R. D., Schiestl, R. H., Willems, A. R., and Woods, R. A. (1995) Yeast 11 (4), 355-

30. Guarente, L. (1983) Methods Enzymol. 101, 181-191.

31. Griffith, K. L., and Wolf, Jr., R. E. (2002) Biochem. Biophys. Res. Comm. 290, 397-402.

32. Sikorski, R.S., and Hieter, P. (1989) Genetics. 122, 19-27.

33. Liu, H., Krizek, J., and Bretscher, A. (1992) Genetics. 132, 665-673.

34. Shiflett, S. L., Ward, D. M., Huynh, D., Vaughn, M. B., Simmons, J. C. and Kaplan, J.
(2004) J. Biol. Chem. 279, 10982-10990.

35. Rose, M., and Botstein, D. (1983) Methods Enzymol. 101, 167-180.

36. Weiner, M. P., Gackstetter, T., Costa, G. L., Bauer, J. C., and Kretz, K. A. (1995)
Molecular Biology: Current Innovations and Future Trends. Eds. A. M. Griffin and
H. G. Griffin. Horizon Scientific Press. QuickChange@@ Site-Directed Mutagenesis

37. Sherman, F., Fink, G. R., and Hicks, J. B. (1986) M~ethods in Yeast Genetics. Cold
Spring Harbor, NY: Cold Spring Harbor Laboratory Press.

38. Vallejo, A. N., Pogulis, R. J., and Pease, L. R. (1995)M~utagenesis and spubes~i\ of novel
recombinant genes using PCR. In PCR Primer: a Laboratory Manual. 603-612. Cold
Spring Harbor, NY: Cold Spring Harbor Laboratory Press.

39. Muhlrad, D., Hunter, R., and Parker, R. (1992) Yeast. 8, 79-82.

40. Altschul, S. F., Madden, T. L., Schaffler, A. A., Zhang, J., Zhang, Z., Miller, W., and
Lipman. (1997) Nucleic Acids Res. 25, 33 89-3402.

41. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989). Molecular Cloning: A Laboratory
Manual. Cold Spring Harbor, N. Y.: Cold Spring Harbor Laboratory Press.

42. Eide, D., and Guarente, L. (1992) J. Gen. M~icrobiol. 138, 347-354.

43. Wickerham, L. J. (1946) J. Bacteriol. 52, 293-301.

44. Miller, J. H. (1972) Experiments in M~olecular Genetics. Cold Spring Harbor, N. Y.:
Cold Spring Harbor Laboratory Press.

45. Obradors, N., Cabiscol, E., Aguilar, J., and Ros, J. (1998). Eur. J. Biochem. 258, 207-


Elizabeth Ann Kendall was born and raised in Salt Lake City, Utah. She was the youngest

of seven in an LDS family. Her bachelor of science was received in 1992 where she specialized

in ecology and evolution, with a minor in chemistry. After graduation in June 1992 she attended

the first summer course on biological rhythms at the University of Virginia, Charlottesville

(summer 1992). In 1996 she received her Master of Science in Marine Biology at the University

of Groningen, the Netherlands. From 1997 to 2003 she worked as a marine biologist in

Washington, California, Alaska and Hawaii. Her different marine positions were: shellfish

intern, marine mammal and fisheries observer, program coordinator for marine education

programs such as Adopt-a-Dolphin and Whale, science lecturer for chemistry, geography, and

math at the Maui Community College, then as a naturalist at the Maui Ocean Center. She

returned back to Utah to take a position as lab manager investigating spontaneous deleterious

mutations, and lab specialist investigating proteins involved in macular degeneration at the

University of Utah. In 2004 she j oined the University of Florida Chemistry Department working

towards her Master of Science in Biochemistry.




2 2007 Elizabeth Ann Kendall


3 To my mother: Gayla Ann Kendall and to my whole family for support and always encouraging me to follow my dreams


4 ACKNOWLEDGMENTS I thank all the professors at the University of Florida who have sp ent their quality time teaching me the ropes of biochemistry and the in terface of chemistry and biology. In particular, I thank: Dr. Thomas Lyons for his idea behind the research that has made up this thesis and the support and encouragement he has given to me fo r my success in continuing this research; Dr. Nicole Horenstein for her support in writing the thesis overall; Dr. Gail Fanucci for her encouragement over the last couple years to work towards the goal of finishing this thesis so I can move on; Dr. Harrison for reading the firs t rough draft of this thesis and giving the encouragement to finish; and especially Dr. Be n Smith and the Chemistry Department for giving me the chance to focus on research with the support of the Univers ity of Florida Alumni Fellowship. I thank my colleagues in the Lyons Group who have contributed so much to my success in this research and speci fically training of basic lab prot ocols needed to work out the kinks of the research and Eric Greeley for read ing through my thesis several times. My biggest acknowledgment is to all my w onderful friends and family at home in Utah, New Mexico, California, Hawaii and the rest of the globe. W ithout my friends and family, who are my entire support group, I would never have the courage and endurance to keep living my dreams.


5 TABLE OF CONTENTS page ACKNOWLEDGMENTS...............................................................................................................4 LIST OF TABLES................................................................................................................. ..........7 LIST OF FIGURES................................................................................................................ .........8 ABSTRACT....................................................................................................................... ............10 CHAPTER 1 INTRODUCTION..................................................................................................................12 Introduction to the Izh2p protein............................................................................................12 Izh2p and Metalloregulation............................................................................................12 Izh2p and Metals.............................................................................................................13 Effect of pGAL1-IZH2 expression plasmid on pFET3-lacZ reporter..............................13 Progestin and Adipo Q (PAQR) receptors and Izh proteins...................................................14 Structure-function of Izh2p.............................................................................................15 Highly conserved motifs of Izh2p...................................................................................15 Site-directed mutations of Izh2p conserved motifs.........................................................16 Classes of PAQR-like proteins with these conserved motifs..........................................16 PAQR proteins share conserved mo tifs with Alkaline Ceramidases..............................17 Goal of this study............................................................................................................. .......17 2 MATERIALS AND METHODS...........................................................................................23 Materials and Methods Ov erview (Figure 2-1)......................................................................23 Strain and growth conditions:..........................................................................................23 Site Directed Mutagenesis...............................................................................................24 Sequence Analysis...........................................................................................................24 Transformations...............................................................................................................25 Mutants H282A and H2806A were obtained by overlap extension.......................................25 3 RESULTS........................................................................................................................ .......31 Sequence data.................................................................................................................. .......31 FASTA Format (Appendix A).........................................................................................31 Blasted sequence data......................................................................................................31 H282A......................................................................................................................31 H286A......................................................................................................................31 H282A/H286A.........................................................................................................32 H86A........................................................................................................................32 Empty vector or wildtype IZH2 gene..............................................................................32 Lac-Z Data.......................................................................................................................... ....32 Overlap-Extension Site-Direct ed Mutagenesis Results:.........................................................34


6 GreenTaq Polymerase.....................................................................................................34 PFU Polymerase..............................................................................................................34 Suggestions for future res earchers on this project..................................................................35 Future Studies:................................................................................................................ ........36 4 DISCUSSION..................................................................................................................... ....41 IZH genes and the function of Izh2p......................................................................................41 IZH2 gene........................................................................................................................41 Izh2p Protein.................................................................................................................. .41 Conserved Motifs of Izh2p..............................................................................................41 Conclusion..................................................................................................................... .........42 APPENDIX A SEQUENCING RESULTS....................................................................................................43 B ALIGNMENT OF SEQUENCES..........................................................................................47 LIST OF REFERENCES............................................................................................................. ..51 BIOGRAPHICAL SKETCH.........................................................................................................54


7 LIST OF TABLES Table page 2-1 Mutants depicting sites mutated and the 5-3sequences of th e reverse and forward primers. Tm (C) and Hairpin Propensity ( G) kcalmol-1.................................................30 3-1 -Galactosidase Activity (%) of Samples grown in LIM (1M Fe3+)...............................37 3-2 A summary of the mutants, the attempts to mutate the IZH2 gene using the corresponding primers, if the mutant is done, needs to be repeated and latest progress....................................................................................................................... .......40


8 LIST OF FIGURES Figure page 1-1 An overall view of the Izh2p pr otein in the plasma membrane.........................................18 1-2 The current model our research is based upon...................................................................19 1-3 Predicted Izh protein topology showing the potential active sites and metal-binding residues....................................................................................................................... .......20 1-4 A sequence alignment showing di stantly related conserved motifs. ................................21 1-5 The catalytic triad: SxxxHxnD...........................................................................................22 1-6 The metabolism of sphingosine and fatty acid from ceramide, and vice versa, from the enzymes ceramidase and ceram ide synthase, respectively..........................................22 2-1 An overall scheme of the protocol s carried out in this experiment...................................26 2-2 Expression vector pRS316 with IZH2 (GAl1-IZH2) or MutIZH2 ( GAL1-MutIZH2) inserted....................................................................................................................... ........27 2-3 Yeast episomal reporter plasmid pFET3-lacZ ...................................................................27 2-4 Site directed mutagenesis using overl ap extension PCR. PCR#1 shows each PCR using the Mut-For + 5IZH2 primers and the Mut-Rev + 3IZH2 primers.....................28 2-5 Orthonitrophenyl pyrano-galactos ide (ONPG) is hydrolyzed by the -galactosidase enzyme activity to produce the yellow compound orthonitrophe nol (ONP) commonly used as a substrate to assay -galactosidase activity in vitro.............................................29 3-1 -Galactosidase Activity (%) of Samples grown in LIM (1M Fe3+). All samples were co-transformed into BY4742 wild-type yeast with pFET3-lacZ reporter.................37 3-2 PCR fragments (5 L P CR reaction) obtained using GreenTaq Polymerase (Sigma)......38 3-3 pRS316 plasmid cut with SacI and BamI restriction enzymes to insert the IZH2 mutated gene into this site..................................................................................................39 3-4 Samples of the pRS316 plasmid with th e inserted IZH2 mutated gene (5 L) obtained via overlap extension (pGAL-MutIZH2) ...............................................................39 3-5 PCR fragments (5 L P CR reaction) obtained using PFU -Polymerase (Promega)..........39 A-1 DNA Sequence for H282A................................................................................................43 A-2 DNA Sequence for H286A................................................................................................44


9 A-3 DNA Sequence for H282A/H286 Double mutant.............................................................45 A-4 DNA Sequence for H86A..................................................................................................46 B-1 DNA Sequence Alignment for H282A..............................................................................47 B-2 DNA Sequence Alignment for H286A..............................................................................48 B-3 DNA Sequence Alignment for H282A/H286A Double mutant........................................49


10 Abstract of Thesis Presen ted to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Master of Science SITE-DIRECTED MUTAGENESIS OF A PAQR FAMILY PROTEIN IN Saccharomyces cerevisiae By Elizabeth Ann Kendall December 2007 Chair: Thomas Lyons Major: Chemistry Understanding distant relationships in conserved motifs of the protein, Izh2p, in S. cerevisiae may lead to a better understanding about th e function of related steroid receptor (PAQR) proteins in humans. Hence, the overall goal of this study is to gain more insight on the function and behavior of these membrane proteins and how the structural differences of the various genotypes affect their activity. A potenti al metal-binding domain, HxxxH, of a conserved motif of a plasma membrane protein Izh2p, has been studied to investigate the structure-function relationship of this protein. Tw o other conserved motifs also under investigation in the Izh2p protein are: ExxNxxxH, and SxxxHxnD, We propose that these conserved regions function as active sites, specifically as amidohydrolases. Po int mutations are being generated using sitedirected mutagenesis of several conserved amino aci ds in this protein that may be involved in receptor activity or metal-binding. The amino acids are histidine (H), aspa ragine (N), aspartic acid (D), glutamic acid (E) and serine (S). These amino acids are being changed from these functional amino acids to alanines since alanin e has a non-functional methyl side group. These motifs are conserved in related proteins in spec ies ranging from bacteria to humans; therefore they may have an important function in the activ ity of the proteins in prokaryotic as well as eukaryotic organisms. We have observed their activity using a pFET3-lacZ reporter as FET3 is known to be repressed by the overexpression of IZH2, driven by a galactose-inducible promoter


11 ( pGAL1-IZH2 ). Three of the histidines of these mo tifs have been mutated by site-directed mutagenesis. H86A, of the ExxNxxxH motif, has b een mutated to alanine, as well as the two histidines of the HxxxH motif: H282A and H286A. A double mutant of the HxxxH motif, H282A/H286A, has also been generated. The dou ble HxxxH mutant exhibits a high loss of activity. The ExxNxxxH histidine mutant, H86A, also has a high loss of activity. The single mutants of the HxxxH have some loss of activity. Still under investigation in terms of sequencing are the following Izh2p mutants: E79A, N82A, S132A, H136A, and D153A. Although the last set of mutants has not been confirmed by sequence analysis, we still have some interesting data with their repression on pFET3-lacZ reporter.


12 CHAPTER 1 INTRODUCTION Introduction to the Izh2p protein The Izh proteins are a group of 4 proteins in Saccharomyces cerevisiae which were discovered to be upregulated by va rying zinc concentrations (1, 2). Izh proteins share sequence similarity to the PAQR (3) fam ily of receptor proteins whose f unction is still under investigation. Izh and PAQR proteins share highly conser ved motifs (2, 3), and are homologous to known amidohydrolases. We are interested in what the Iz h2 protein function is, so we are mutating it via site-directed mutagenesis and w ill compare the mutants to the wildtype Izh2p protein using a functional assay (2). We compare changes of functional amino acids in the Izh2p that are changed to non-functional alanines by the expressi on of a reporter plasmid ( pFET3-lacZ ). This plasmid is known to be repressed in yeast by IZH2 when inserted into a galactose-driven expression plasmid ( pGAL1-IZH2 ). Izh2p and Metalloregulation Metals play a vital role in bi ological processes (4). Ancient fa milies of proteins involved in metal homeostasis have evolved which span across all phylogenetic levels (4 ). Zinc, for example, is an integral component of hundreds of different enzymes; it stabilizes pr otein structures, plays a role in gene expression and cat alysis, participates in trans port, and preserves subcellular organelle integrity (5). Under zinc deficiency, a large number of genes are expressed, indicating an effect of zinc on metabolic processes (1). YOL002c is a gene in Sacharomyces cerevisiae that is upregulated by both zinc deficiency and in the presence of myristic aci d, an exogenous fatty acid (1, 6). The YOL002c gene is regulated by the transcription factor Zap1p (Z inc-responsive A ctivator P rotein) (Figure 1-1) (1). Zap1p is a metalloregulatory protei n involved in zinc-responsive gene transcription (7). Zap1p


13 regulates expression of zinc tran sporter genes important for yeas t zinc homeostasis by binding to the promoters of zinc transporter ge nes (8-10) on sites known as ZREs (Z inc-R esponsive E lements) (1, 8). YOL002c was renamed IZH2 (I mplicated in Z inc H omeostasis 2 ) because it is expressed in low zi nc conditions (1). IZH2 is a gene that encodes a membrane protein, Izh2p, which affects zinc homeostasis (2). Izh2p and Metals Izh2p has been overexpresse d in our lab using a pGAL1-IZH2 plasmid and was found to repress the Z inc R egulated T ransporter 1 ( ZRT1) in vivo (the high affinity zi nc transporter) in L ow Z inc M edia (LZM) (9). Because Izh2p overexpression repressed ZRT1, we also wanted to test if Izh2p overexpression would have an eff ect on the high affinity iron transporter. The Fe rrous T ransporter 3 ( FET3) is a ferroxidase involved in the high-affinity uptake of iron (9-11). It is also repressed in L ow I ron M edia (LIM) when Izh2p is overexpressed (12-13). The FET3 promoter is fused to the lacZ gene (pFET3-lacZ), which is the reporter assay we use to monitor the activity of these receptors (12). In this study we compare the -galactosidase activity ( pFET3lacZ ) of the Wild-Type BY4742 S. cerevisiae carrying the empty vector ( pRS316L ) control, Izh2p overexpression ( pGAL1-IZH2 ) and overexpression of the mutated Izh2p proteins ( pGAL1-MutIZH2 ) (2, 12). Effect of pGAL1-IZH2 expression plasmid on pFET3-lacZ reporter The pFET3-lacZ reporter has allowed us to probe th e signal transduction mechanism of the Izh receptors (12, 13). Our data show that th e Izh2p receptor acts through the Pkh1 and Pkh2 sphingosine dependent kinases (Figure 1-2) (12, 13). Izh2p was found to require cAMPdependent protein kinase (PKA) and AMPK to repress the FET3 activity (Figure 1-2) (12). Evidence further shows that IZH2 overexpression affects transcri ptional repressors (Nrg1 and Nrg2) and activators (Msn1 and Msn2) (Figure 12) (12, 13). These repressors and activators


14 play a role in the FET3 repression ( pFET3-lacZ) of the IZH2 expression plasmid ( pGAL1-IZH2 ) (12). Progestin and Adipo Q (PAQR) receptors and Izh proteins Data in our lab has also conf irmed that PAQR receptors al so negatively regulate the high affinity iron-uptake transporter, FET3 (12). Izh2p shares sequence similarity with a large and ubiquitous protein family (2) called P rogestin A dipo Q R eceptors (PAQR) (3). PAQR proteins are found in eukaryotes as well as prokaryotes (3). Izh and PAQR proteins are predicted to have seven or more transmembrane domains (TMs) (Fi gure 1-3) and their pred icted topology suggests extracellular C-terminus and cytoplasmic N-term inus (2, 3). The PAQR proteins also possess highly conserved motifs that may function as active sites (Figure 1-3): ExxNxxxH (Figure 1-3 blue), SxxxHxnD (Figure 1-3 purple) and HxxxH (Figure 1-3) (2, 3). The PAQR family includes progesterone r eceptors and adiponectin receptors (14, 15). Adiponectin is a hormone that is secreted by adipocytes, fat storage cells (16). Adiponectin regulates glucose, energy home ostasis and lipid metabolism and has been shown to increase the oxidation of fatty-acids in mice, reducing triglyceride (T G) content in type 2 diabetic and obese mice increasing insulin resistance (15-18). Studying Izh2p may therefor e be relevant to scientific research of fatty acid metabolism and diabetes in humans. Izh proteins have sequence si milarity not only to hormone receptors, but also to hemolysins and to alkaline ceramidases (Figure 14) (2). Hemolysins are used by bacteria as a way to obtain nutrients from host cells by causing pores in the cell wall (s uch as red blood cells) thereby killing the cell (apoptosis), which allows pathogenic bacteria to obtain limiting nutrients (such as iron in the form of Heme in red blood cells) (19). Ceramidases are enzymes that hydrolyze ceramides to form fatty acids and sp hingosines (Figure 1-5) (20, 21). Izh2p protein may have amidohydrolase activity as part of its function by hydrolyzing ceramides.


15 Izh2p as a receptor: Izh2p is known to be a receptor for osmotin (22). Osmotin is an antifungal protein that belongs to the P athogenesis-R elated (PR-5) family of proteins (22). Osmotin induces apoptosis, by inactivating ce llular stress responses via the RAS2/cAMP pathway (22). The PAQR proteins activate AMP kinase via their adipone ctin receptors (22). Izh2p activates the same signaling responses as th e Adiponectin receptors and has recently been demonstrated to require both cAMP de pendent kinase and AMP kinase in S. cerevisiae to repress the reporter pFET3-lacZ (12). Structure-function of Izh2p Structure-function analysis of gene families implies the conservation of function in families of genes that have a conservation of sequence (23). In fact, the evolution of gene families is one of the areas where evolutionary approaches can be particularly relevant in the understanding of gene function in eukaryotic genomes (23). The structure-function of the conserved motifs in the Izh2p protein is being st udied to see if specific amino acids of the conserved motifs are needed for Izh2p function. Highly conserved motifs of Izh2p There are three motifs identified in these proteins that are of significance to this structurefunction study, ExxNxxxH, SxxxHxnD, and HxxxH. The first motif ExxNxxxH (Figure 1-3 blue) may have an active site of unknow n function. The second motif SxxxHxnD (Figure 1-4 purple) may be an active site similar to the family of pr oteases called the serine proteases (24). Proteases are known to catalyze the hydrolysis of th e covalent bonds of peptides (5, 24). The active motif of a serine protease is called the catalytic triad and is made up of an aspartate, a hisitidine and a serine (Figure 1-5), where the serine is depr otonated by the histidin e and nucleophilic serine alkoxide attacks the carbonyl carbo n of a peptide (24). The thir d motif HxxxH (Figure 1-4) resembles a known amidohydrolase motif (5). This motif is characteristic of a family of


16 proteases known as zinc proteas es, also known as metalloproteases (5, 24). The HxxxH site in metalloproteases carries out am idohydrolase activity by binding Zn2+ (5, 24). Site-directed mutations of Izh2p conserved motifs ExxNxxxH (Figure 1-3 blue), located at the edge of the first TM (Figure 1-3 blue), is being mutated to ExxAxxxH (N82A), ExxNxxxA (H86A), ExxAxxxA (N82A/H86A) and to AxxAxxxA (E79A/N82A /H86A). SxxxHxnD (Figure 1-3 purple), loca ted at the edge of the second and third TMs (Figure 1-3 purp le), is being mu tated to AxxxHxnD (S132A) SxxxAxnD (H136A) and AxxxAxnD (S132A/H136A) and SxxxHxnA (D153A). HxxxH (Figure 1-3 red), located at the edge of the seventh TM7 (Figure 1-4 red), is being mutated to AxxxH (H282A), HxxxA (H286) and AxxxA (H282A/H286A). Two histidines being mutated by site-direc ted mutagenesis in this study, H282A and H286A are the two histidines in the HxxxH motif. The muta ted Izh2p proteins have been inserted into the galactose driven pRS316 vector ( pGAL1-MutIZH2 ) (2). This expression vector is being used as a readout for receptor activity using the promoter of the gene FET3 fused to lacZ inserted into the YEP353 vector ( pFET3-lacZ ) as a reporter because it responds to Izh2p activity (12, 13). Classes of PAQR-like proteins with these conserved motifs There are different classes of the PAQR-like pr oteins (Figure 1-4) ( 2, 3). Class I includes OsmoR (Izh2p), Osmo tin R eceptor (2, 22) and AdipoR1 & 2 (A diponectin R eceptors), and PAQR3 & 4 (Figure 1-4 Class I) (3). Class II contains the mPRs (M embrane P rogesterone R eceptor) (Figure 1-4 Class II). Class III is com posed of hemolysin-like family members (HLY3 and MMD proteins) (Figure 1-4 Class III). Th e bottom of Figure 1-4 shows the sequence alignment of the alkaline ceramidases (Figure 1-4 Alk Cer).


17 PAQR proteins share conserved motifs with Alkaline Ceramidases Ceramide is a core sphingolipid interm ediate and a building block for complex sphingolipids (25). It is a modulator of cellular events, su ch as stress response, differentiation, senescence, cell cycle arrest and apoptosis (25). Ceramidases are enzymes that are responsible for breaking down ceramide into sphingoid base s and fatty acids (Figure 1-6) (20). In Saccharomyces cerevisiae the YPC1 gene encodes an alkaline ceramidase (25). This ceramidase has dual activity of catalyzing both the hydrolys is and synthesis of ceramide in yeast (26). Sphingolipid metabolism comprises a set of highly regulated pathways th at serve to control the levels of individual molecules, their inte rconversions, and their function (27). Ceramides serve as the precursor of all major sphingo lipids (28). Izh2p may affect zinc and iron homeostasis directly or indirectly by altering sphingolipid metabolism (13). Goal of this study The main goal of this study is to identify if there is an effect on the pFET3-lacZ reporter by mutating the conserved residues of Izh2p via si te-directed mutagenesis. We are therefore attempting to uncover the significance of highly c onserved amino acids identified in one of the yeast PAQRs (the Izh2p protein) ( 2, 3). We are particularly inte rested in the function of the Izh2p protein, especially since it has been show n to be a receptor for osmotin (2, 12, and 22). These proteins could be related to alkaline ceramidases, which our lab has evidence that there are alterations in sphingolipid con centrations when these proteins are overexpressed (13). Due to structural similarity based on the conserved motif s (2, 3) we hypothesize th at these proteins act as amidohydrolases (ceramidases).


18 Figure 1-1. An overall view of the Izh2p protein in the plasma membrane. The IZH2 gene inside the nucleus of the ce ll (purple). In our LacZ assays IZH2 is driven by GAL1 FET3 expression is repressed, indicated by the ( ) when Izh2p is overexpressed.


19 Figure 1-2. The current model our research is based upon. The receptor Izh2p may be an amidohydrolase producing sphingoid bases, which stimulate Pkh1 and Pkh2. Pkh1 and Pkh2 stimulates PKA and cytosolic AMPK and represses nuclear AMPK. The PKA and cytosolic AMPK repress Msn2/4 and the nuclear AMPK represses Nrg1/2. The Msn2/4 stimulates the FET3 and the Nrg1/2 represses the FET3


20 Figure 1-3. Predicted Izh prot ein topology showing the potential active sites and metal-binding residues: ExxNxxxH (blue), SxxxHxnD (purple), and HxxxH (Red). Adapted from Smith, J. L., Garitaonandia, I., Kupchak, B. R., Maina, A. S., Regalla, L. M., and Lyons, T. J. (2007) Manuscript in preparation.


21 Figure 1-4. A sequence alignmen t showing distantly related conserved motifs. The transmembranes are depicted with an arrow at the top and gaps in the se quences are left as a blank space. Classes are separated by a solid line: Highlighted areas of the chart are the highly conserved motifs to be mutated: ExxNxxH (blue), SxxxHxnD (purple), and HxxxH (red). Adapted from Smith, J. L., Ga ritaonandia, I., Kupchak, B. R., Maina, A. S., Regalla, L. M., and Lyons, T. J. (2007) Manuscript in preparation.


22 Figure 1-5. The catalytic triad: SxxxHxnD. This sequence is a highly conserved motif in Izh2p and the PAQR family. HN O OH OH (CH2)12CH3 (CH2)NCH3 Ceramidase CeramidesynthaseHO NH3 + OH (CH2)12CH3 Ceramide Sphingosine FattyAcidO (CH2)NCH3 +OH Figure 1-6. The metabolism of sphingosine and fatty acid from ceramide, and vice versa, from the enzymes ceramidase and ceramide s ynthase, respectively. Adapted from Kolesnick, R. (2002) J. Clin. Invest 110, 3-8.


23 CHAPTER 2 MATERIALS AND METHODS Materials and Methods Overview (Figure 2-1) Izh2p mutants ( pGAL1-MutIZH2), from the IZH2 gene with the changed functional amino acid to alanine, were generated via site-d irected mutagenesis (Figure 2-1 Step 1). pGAL1-IZH2 (2) and pGAL1-MutIZH2 (Figure 2-2) were indivi dually co-transformed (29) into the yeast strain with a vector containing a FET3 promoter fused to a lacZ reporter ( pFET3-lacZ ) (Figure 2-3) (1, 2,) in order to monitor -galactosidase activity (30, 31). pRS316-LEU2 is a cloning vector used as a tool in molecular analysis to overexpre ss genes in yeast by using a galactose inducible promoter ( GAL1 ) (32). The pRS316 plasmid cloning vector (32, 33) was used in this study for several reasons. One reason is that it can shut tle DNA readily between yeast and bacteria (33), which is necessary for obtaining large e nough quantities of the plasmid carrying the IZH2 gene ( pGAL1-IZH2) and the IZH2 mutants ( pGAL1-MutIZH2) to carry out sequencing. Second, it carries the LEU2 selection marker so we can co-transform it with our lacZ reporter fusions, an episomal plasmid carrying the selection marker URA3 with a FET3 promoter fused to the lacZ reporter (Figure 2-3) (2, 12). Strain and growth conditions: BY4742 (Genotype: MAT his3 leu2 lys2 ura3) yeast st rain was obtained by Euroscarf (http:://web.uni-frankf urt.de/fb15/mikro/euroscarf/) (2). Yeas t strain cells were grown in YPD (1% yeast extract, 2% peptone and 2% glucose) or SD (synthetic defined medium with 2% glucose carbon source supplemented to a 0.01% c oncentration of the amino acids) (34, 35) Auxotrophic amino acids added to the SD were LHistidine, and L-Lysine (SD-L,U media) for the co-transformations (double tr ansformations with the Control pRS316 empty vector+ pFET3lacZ (Figure 2-3 ) ; and pGAL1-IZH2 (2) + pFET3-lacZ and pGAL1-MutIZH2 + pFET3-lacZ (Figure


24 2-2) (12). The pRS316 empty vector, pGAL1-IZH2 and pGAL1-MutIZH2 are driven by galactose (2, 30). Site Directed Mutagenesis IZH2 mutants were obtained by site-direc ted mutagenesis using QuickChange (Stratagene, La Jolla, California) or by overlap extension (Figure 2-4) ( 36, 37). Primers used for the mutations are in Table 2-1. Overlap extension was carried out following a three step P olymerase C hain R eaction (PCR) method (Figure 2-4) (37, 38). The overlap extension fragments were obtained by PCR and were purifie d from the agarose gel (Prep-A-Gene, BioRad) (Figure 2-2). The mutated gene was also cut out of the agarose gel and gel purified (Prep-AGene, BioRad) (Figure 2-2). The muta ted gene was cloned back into the pRS316 plasmid using gap repair (39). Gap repair consists of the co-t ransformation of the PCR product, in this case the IZH2 mutant gene, with the gapped plasmid that contains homologous ends to the PCR product, in this case the SacI and BamI ends of the pRS316 plasmid (39). The IZH2 mutants were sequenced (University of Florida) in order to verify mutation(s). Primers in Table 2-1 reflect the selected designed amino acid changes. Sequence Analysis The DNA sequences obtained were Blasted agai nst the Izh2p protein using the Blastx function at the following website: (http://www.ncbi.nlm.nih.gov/sites/ entrez/). Blastx allows you to search the protein database ( Saccharomyces cerevisiae ) using a translated nucleotide query, in this case the IZH2 gene. Blast programs are tools that ar e widely used for searching the DNA and protein databases to find sequence similarities (40). For the FASTA and BLAST results for each of the mutants generated (H282A, H286A, H282 A/H286A, and H82A) see appendix A and B, respectively.


25 Transformations Mutants H282A and H2806A were obtained by overlap extension BY4742 Wild Type S. cerevisiae was transformed using th e Li-acetate method (29) with 2 L digested ( SacI & BamI ) pPRS316 plasmid (32, 33) and 10 L of the recombined PRC mutated IZH2 gene (MutIZH2 ). The transformed S. cerevisiae were grown on SD L plates to se lect for yeast containing the mutated IZH2 gene (MutIZH2 ) inserted into the plasmid. Several colo nies grown on the SD L plates were transferred to, and grown in, SD L media (SD w ith the auxotrophs L-Histidine, L-Lysine and LUridine) and the plasmid DNA wa s purified from the yeast (41) The plasmid was transformed into E. coli and grown on Amp selective plates to sele ct for the bacteria carrying the plasmid with the IZH2 mutant insert ( pGAL1-MutIZH2) (Figure 2-1). Double transformations of the following were carried out: Negative Control : Wildtype (BY4742) + pRS316 vector + pFET3-lacZ ; IZH2 Sample : Wildtype (BY4742) + pGAL1-IZH2 vector + pFET3-lacZ Mutant IZH2 Sample : Wildtype (BY4742) + pGAL1-MutIZH2 + pFET3-lacZ -Galactosidase Assays: Izh2p represses FET3 in low iron environments (Figure 1-1) (2, 12). Co-transformed yeast cells that were used for the -galactosidase assays were grown in SDU-L overnight then 100 L (OD=0.1) was transferred to L ow I ron M edia (LIM), 1 M Fe3+ (40). LIM was prepared according to stan dard procedures (42) with FeCl3 added back to the LIM (1M, or 1mM). Our -galactosidase assays are driven by a FET3 promoter fused to the Lac-Z reporter (Figure 2-3). Iz h2p activity is measured by the repression of FET3 when our Izh2p protein is overexpressed by addi ng 2% Galactose to LIM (40). The LIM is supplemented with nitrogen base, Citrate (pH=4.2) ( 43) and EDTA to control iron av ailability by chelating iron (42). -Galactosidase assays were carried out followi ng standard procedures previously described (30). Orthonitrophenyl pyrano-galact oside (ONPG) is hydrolyzed by the -galactosidase enzyme


26 activity to produce the yellow compound or thonitrophenol (ONP) (Figure 2-3). The galactosidase activity was calculated in Miller Units as previously described: ( A420 1,000)/ (min ml of culture used culture A600) (44). Figure 2-1. An overall scheme of the protocols carried out in th is experiment: Site-Directed Mutagenesis, Gap Repair, Co-transformation and -Galactosidase Assays.


27 Figure 2-2. Expression vector pRS316 with IZH2 (GAl1-IZH2) or MutIZH2 ( GAL1-MutIZH2) inserted. Adapted from Sikorski, R.S. and Hieter, P. (1989) Genetics 122, 19-27 and Liu, H., Krizek, J. and Bretscher, A. (1992) Genetics. 132, 665-673. Figure 2-3. Yeast episomal reporter plasmid pFET3-lacZ


28 Figure 2-4. Site directed mutagenesis using overlap extension PCR. PCR#1 shows each PCR using the Mut-For + 5IZH2 primers and the Mut-Rev + 3IZH2 primers. PCR#2 shows the recombination of each fragment generated in PCR#1, which yields the mutated gene as the end result. Adapted fr om Sherman, F., Fink, G. R., and Hicks, J. B. (1986) Methods in Yeast Genetics, Cold Springs Harbor Laboratory Cold Spring Harbor, N. Y: Cold Spring Harbor Laborator y Press and Vallejo, A. N., Pogulis, R. J., and Pease, L. R. (1995) Mutagenesis and synthesis of nov el recombinant genes using PCR. In PCR Primer: a Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.


29 Figure 2-5. Orthonitrophenyl pyrano-galactoside (ONP G) is hydrolyzed by the -galactosidase enzyme activity to produce the yellow compound orthonitrophe nol (ONP) commonly used as a substrate to assay -galactosidase activity in vi tro. Adapted from Guarente, L. (1983) Methods Enzymol 101, 181-191 and Miller, J. H. (1972) Experiments in Molecular Genetics Cold Spring Harbor, N. Y.: Cold Spring Harbor Laboratory Press.


30 Table 2-1. Mutants depicting si tes mutated and the 5-3sequen ces of the reverse and forward primers. Tm (C) and Hairpin Propensity ( G) kcalmol-1 calculated using the IDT analyzer: http://www.idtdna.com/. The underlined codon is that for the amino acid mutated. Primer Name Site mutated Tm (C) Hairpin Propensity ( G) kcalmol-1 5-3 Sequence IZH2 -H282A-REV H282A 60.9 -2.92, -2.44 5GGAAAAGTTGGGC AGAATGACCCCAAA TAT3 IZH2 -H282A-FOR H282A 61.1 -1.70 5GGGTCATTCTGCC CAACTTTTCCATTTTCT3 IZH2 -H286A-REV H286A 57.8 -2.43 5CAACTAGAAAAGC GAAAAGTTGGTGAGAAT3 IZH2 -H286A-FOR H286A 57.3 -2.66 5CCAACTTTTCGCT TTTCTAGTTGTTATTGC3 IZH2 -Double-H282A; H286A-REV H282A; H286A See: H282A & H286A Primers. IZH2 -Double-H282A; H286A-FOR H282A; H286A See: H282A & H286A Primers. IZH2 -N82A-REV N82A 54.8 -1.29, -0.78 5TAAATGTGAATAAATAGC GACACTTTCATTATG3 IZH2 -N82A-FOR N82A 54.8 -1.44, -0.84 5CATAATGAAAGTGTCGCT ATTTATTCACATTTA3 IZH2 -H86AREV H86A 56.4 -1.67, -1.57 5GAGAGCAGGAATTAAAGC TGAATAAATATTGAC3 IZH2 -H86A-FOR H86A 56.4 -0.85, -0.5 5GTCAATATTTATTCAGCT TTAATTCCTGCTCTC3 IZH2 -S132AREV S132A 59.2 -0.53 5ACAATGAAAGGAGCTAGC CAATATTAAACATGC3 IZH2 -S132A-FOR S132A 59.2 -0.19 5GCATGTTTAATATTGGCT AGCTCCTTTCATTGT3 IZH2 -H136AREV H136A 60.9 -2.22, -1.56 5GTGACTCTTTAGACAAGC AAAGGAGCTACTCAA3 IZH2 -H136A-FOR H136A 60.9 -2.11, -1.79 5TTGAGTAGCTCCTTTGCT TGTCTAAAGAGTCAC3 IZH2 -D153AREV D153A 59.4 -1.16, -1.01 5ACAAATACCAAGGTAGGC CAACTTATTTCCTAA3 IZH2 -D153A-FOR D153A 59.4 -1.34, -1.26, 0.95, -0.79, 0.71 5TTAGGAAATAAGTTGGCC TACCTTGGTATTTGT3 IZH2 -Double-S132A; H136A-REV S132A; H136A 59.4 -1.64, -1.07, 0.96 5TCTTTAGACAAGC AAAGGAGCTAGC CAATATTAAA3 IZH2 -Double-S132A; H136A-FOR S132A; H136A 59.4 -1.85, -1.82, 1.51 5TTTAATATTGGCT AGCTCCTTTGCT TGTCTAAAGA3 IZH2 -DoubleN82A; H86A-REV N82A; H86A 58.9 -0.96, -0.85, 0.77, -0.69 5CAGGAATTAAAGC TGAATAAATAGC GACACTTTCA3 IZH2 -DoubleN102A; H106A-FOR N102A; H106A 58.9 -1.12, -0.97, 0.54 5TGAAAGTGTCGCT ATTTATTCAGCT TTAATTCCTG3 IZH2 -TripleE79A/N82A/H86A-Rev E79A; N82A; H86A 62.5 -3.99, -3.98, 2.95, -2.79, 2.33, -2.32 5CAGGAATTAAAGC TGAATAAATAGC GACACTTGC AT TATGCAAA3 IZH2 -TripleE79A; N102A; H86A -For E79A; N82A; H86A 62.5 -4.21, -3.19, 2.45, -2.14 5TTTGCATAATGCA AGTGTCGCT ATTTATTCAGCT TTA ATTCCTG3 IZH2 -Gal-5 67.8 -4.17 5TACTTCTTA TTCCTCTACCGGATCCCGCTCGAGGTCG ACATGTCAATCTTATTAGAAAGG3 IZH2 -Gal-3 69.6 -5.83, -5.70, 5.34, -5.22, 5.12, -5.01, 3.69, -3.07 5TGAGCGCGCGTAATACGA CTCACTATAGGGCGAATT GGAGCTCCAAATATCTAGGAG ACAAT3


31 CHAPTER 3 RESULTS Sequence data FASTA Format (Appendix A) The samples sequence data are represented in the FASTA format (Appendix A). For each of the Izh2p mutants that worked there is a forward sequence that was sequenced using the T7 primer and there is a reverse sequence that was sequenced using the pRS316 primer. Although all the sets of primers were attempted for both overlap extension and the QuickChange method (Chapter 2), only four of the mutants were generated. The mutants generated were H282A, H286A, H282A/H286A (double HxxxH motif) and H86A. The blasted sequence data for each of the sequence reactions can be observed in Appendix B and is discussed below. Blasted sequence data H282A The H282A Izh2p mutant was generated via th e overlap extension method described in chapter 2. By looking at the blasted sequence a lignment in Appendix B the H282A amino acid changed is indicated in red. Both the forward and the reverse sequences show this change (Figure B-1a and b). H286A The H286A Izh2p mutant was generated via th e overlap extension method described in chapter 2. By looking at the blasted sequence alignment in Appendix B the H286A amino acid changed is indicated in red. Both the forward and the reverse sequences show this change (Figure B-2a and b).


32 H282A/H286A The H282A/H286A double HxxxH mutant was obt ained using both of the site-directed mutagenesis methods (overlap exte nsion for the H286A first, then this was used as the template and the primers for the H282A mutant were a dded to the PCR cocktail using the QuickChange method to generate the H282A/H286A double mu tant). The blasted sequence alignment in Appendix B for the H282A/H286A double mutant show that both of the histidines are changed to alanines and are indicated in red (Figure B-3a and b). H86A The H86A Izh2p mutant was generated via th e overlap extension method described in chapter 2. By looking at the blasted sequence alignment in Appendix B the H86A amino acid changed is indicated in red. Both the forward and the reverse sequences show this change (Figure B-4a and b). Empty vector or wildtype IZH2 gene There were several samples with the overlap extension method that appeared to be the empty vector. Furthermore, there were seve ral samples that contained the wildtype IZH2 gene, with both the overlap extension and the Qu ickChange method. The QuickChange protocol involves digesting the PCR sample with the DPN1 enzyme to get rid of the template strand by chopping up methylated parent IZH2 strand (36) so this step mu st not have worked for this reaction. Lac-Z Data It has been shown that overexpressing Iz h2p by co-transforming the expression vector pGAL1 IZH2 with the pFET3-lacZ reporter into BY4742 represses the pFET3-lacZ activity (2, 12). The lacZ data generated of the pRS316 wildtype empty vector co-transformed with pFET3lacZ reporter into the yeast BY 4742 has a higher activity in 1 M than the yeast overexpressed


33 pGAL1-IZH2 (2). Izh2p was seen to repress pFET3-lacZ activity as previously reported (2). Using the co-transformation approach we have ran -Galactosidase Assays on each of the mutants generated and have determined that there is partial deactivation of the usual pFET3-lacZ repression when Izh2p ( pGAL1-IZH2) is overexpressed. The IZH2 mutants ( pGAL1-MutIZH2) : H282A, H286A, H282A/H286A, H86A were compared to Izh2p, with respect to pFET3-lacZ repression in 1 M LIM (Figure 3-1 and Table 3-1). The four Izh2p mutants verified by sequen ce analysis PSI Blast all show less of a repression on the pFET3-lacZ -galactosidase activity than the Izh2p protein when grown in LIM (1 M). This demonstrates that th ere is an effect of these amino acids being mutated to nonfunctional alanines. There is an effect on the func tion of HxxxH and it loses its repressive control over pFET3-lacZ The repression of pFET3-lacZ activity of the H 282A/H286A (AxxxA) and H86A (NxxxA) mutants is comparable to the pRS316 wildtype vector control grown in 1 M LIM (Figure 3-1). The partial deactivation seen w ith all the Izh2p mutants tells us that there is still some enzyme activity and that these amino acids are important, but perhaps not essential for full Izh2p function. The single histidine mutants: H282A (A xxxH), H286A (HxxxA), show less of a loss of the pFET3-lacZ repression so they may be less impor tant for Izh2p function. H86A and the HxxxH (H282A/H286A) double histidine muta nts show more of a loss of the pFET3-lacZ repression so they may be more important for Izh2p function. Conclusion of lac-Z Data: The Izh2p plasma-membrane protein may be of further use for studying animal energy (glucose homeostasis), meta l homeostasis and metabolism to gain further information on better ways to control processes su ch as diabetes and diseases linked to metal deficiencies. The overall trend of the pFET3-lacZ driven -galactosidase activity is that the Izh2p


34 overexpressed yeast cells ( pGAL1 IZH2) repress the FET3 activity as compared to the empty pRS316 vector co-transformed yeast cells (12, 13 ). The mutants generated of the Izh2p ( pGAL1-MutIZH2) have less of a repression of FET3 activity than the wildtype Izh2p (Figure 2-1 and Table 2-1). Overlap-Extension Site-Direc ted Mutagenesis Results: GreenTaq Polymerase There were several problems that were obser ved with the overlap-e xtension site-directed mutagenesis procedure. The first problem encountered was that the PFU polymerase would not copy the gene fragments as expected. Thus I tried using a free sample of the GreenTaq (Sigma) polymerase, which copied the gene fragments on th e first PCR protocol carried out (Figure 3-2). Thus, the overlap extensi on originally was successfu lly carried out with the GreenTaq polymerase, and the procedure was carried through. Figure 3-3 shows the first time I was able to cut the pRS316 plasmid with the SacI and BamI restriction enzymes (the cut plasmid is shorter in length on the gel than the uncut pRS316 plasmid). The mutated IZH2 gene was then inserted into this s ite by gap repair (described in Chapter 2). The final recombined product was visualized on an agarose gel (Figure 3-4) and sent in for sequencing. These samples had many random mutati ons and not what we were looking for in terms of the site-dir ected mutagenesis. In conclusi on, the samples obtained using the GreenTaq polymerase using the overlap extension PCR method were sequenced and yielded a very randomly mutated IZH2 gene. PFU Polymerase PFU polymerase is the optimal polymerase to us e in this protocol because it has a lower rate of random mutations than the GreenTaq polymerase, however working with this polymerase was problematic copying the fragments with the mutated amino acid. For instance, in Figure 3-5


35 the smaller fragments were copied with the PFU polymerase, whereas, the larger fragments were repeatedly not fully extended using PFU polymerase. There may have been such a low quantity that it was impossible to visuali ze on a gel, which is a problem when excising the fragments from the gel in order to gel purify and move on to the next step. Thus, there were problems using the PFU polymerase with the quantity of PCR product obtained to gel purify the DNA. The DNA fragments may have been lost because there was so little of it to begin with, or the fragment did not extend correc tly. In addition, the whole mutant gene was not replicated correctly so when it was sequenced there were extra mutations. There were three steps in the procedure of overlap extension to perform gel purification where DNA may have been lost: 1. On each of th e individual fragments: Mut-For+5IZH2 and Mut-Rev+3IZH2 and 2. after recombination of th e fragments to yield the mutant IZH2 gene. Another problem area was getting the purified MutIZH2 gene back into the pRS316 vector. The protocol of getting the inserted MutIZH2 gene that was taken up into the pRS316 vector into the E.coli to clone more for sequencing and transformations was also a problem area using the overlap extension method. The overlap extension did work with H 282A and H286A. The QuickChange method copies the whole gene starting at the primer site with the desired mutation while it is still in the plasmid (36). The H282A/H286A and the H 86A mutants were generated using the QuickChange method. Suggestions for future researchers on this project Overlap extension suggesti ons: use maximum amount of PFU polymerase (1L per 50L total reaction), and two to three times the extension time for the larger fragment and the recombining PCR step (step 2 Fi gure 2-1). 50ng DNA worked best fo r me for both types of SiteDirected Mutagenesis.


36 The QuickChange method should be used as described in the manual (36). This method proved to be less time consuming and messy and overall my preferred method of Site-directed Mutagenesis. Other suggestions using this met hod are to use the recommended Tm for each of the primers and to run the PCR reactions one at a time for each of the mutants based on these Tms. In my experience I followed the recommen ded temperatures for the PCR reaction in the manual, however, some worked and some didnt. This may be one of the reasons. So keep the temperature for the primer exactly as that r ecommended by the primer manufacturer. Also, there may need to be a longer extension time as r ecommended in the trouble shooting section of the manual. I attempted to carry this out, but ha ve run out of time to follow through with the complete procedure. The next person to finish this project may wish to follow up on this. Lastly, if there are no colonies growing on the plat e, the troubleshooting section recommends using 5 L of the sample when transforming into E.coli to grow on the LB/Amp plates (36). Future Studies: Site-directed mutagenesis of the IZH2 gene: Table 3-2 lists which of the mutants have been completed, which mutants have been attemp ted, and their latest pr ogress. H282A mutant should be repeated since several additional site s were randomly mutated (Figure B-1a and b). H286A, H282A/H286A, and H86A ar e done. The following mutants are still being mutated: N82A, N102A/H106A, S132A, H136A, S 132A/H136A, D153A, and E79A/E82A/H86A. Double and triple point mutations may require additional PCR cycles as recommended in the QuickChange manual (36). HA (Haemaglutanin) and GFP (Green Fluo rescent Protein Tagging: Future Studies: Future studies should include HA-tagging and GFP-tagging of the Izh2p mutants with the conserved amino acids of interest mutated to alanine. This will confirm expression of the mutants and prove that they have not been degraded in S. cerevisiae due to the mutated amino


37 acids being essential for function. If any of the mutants are degraded this assay will tell us which specific amino acids are essential to carry out the function of the Izh2p protein. This may apply to the proteins of the PAQR family as a whole since the amino acids mutated are highly conserved among the whole family (2, 3). GFP-tagging will confirm th e proper localization of the proteins. Figure 3-1. -Galactosidase Activity (%) of Samples grown in LIM (1M Fe3+). All samples were co-transformed into BY4742 wild-type yeast with pFET3-lacZ reporter. pRS316 serves as the empty vector control, Izh2p is the protein of interest ( pGAL1-IZH2 ) and the Izh2p mutants ( pGAL1-MutIZH2 ): H282A, H286A, H282A/H286A, and H86A. Table 3-1. -Galactosidase Activity (%) of Samples grown in LIM (1M Fe3+). LacZ activity presented is that of samples grown in 1M Fe3+ LIM and shown as a percentage with pRS316 wildtype as the control. Samples grown in LIM (1 M Fe3+) -Galactosidase Activity (%) pRS316 Empty Vector CONTROL 100 Izh2p 52 Izh2p H282A 62 Izh2p H286A 59 Izh2p H282A/H286A 93 Izh2p H86A 80


38 Figure 3-2. PCR fragments (5 L PCR reaction) obtained using GreenTaq Polymerase (Sigma). From left to right: Top part of gel, 5L 1kb DNA Ladder (Sigma-Aldrich),: 1 and 5) 5-RevIZH2 (H282A), 2 and 6) 3-For IZH2 (H302A), 3 and 7) 5-RevIZH2 (H306A), and 4 and 8) 3-For IZH2 (H286A) Bottom part of gel, 5L 1kb DNA Ladder (Sigma-Aldrich), P CR fragments obtained using PFU -Polymerase (Promega): 1) 5-RevIZH2 (H282A), 2) 3-For IZH2 (H282A), 3) 5-RevIZH2 (H286A), and 4) 3-For IZH2 (H286A).


39 Figure 3-3. pRS316 plasmid cut with SacI and BamI restriction enzymes to insert the IZH2 mutated gene into this site.. From left to right: 5L 1kb DNA Ladder (SigmaAldrich), 1) pRS316 plasmid cut with SacI and BamI and 2) uncut pRS316 plasmid. Figure 3-4. Samples of the pRS316 plasmid with the inserted IZH2 mutated gene (5 L) obtained via overlap extension (pGAL-MutIZH2). From left to right: 3 g Hind ladder. Lanes 1-3 are H282Aand lanes 4-6 ar e H286A obtained via overlap extension. Figure 3-5. PCR fragments (5 L PCR reaction) obtained using PFU -Polymerase (Promega). From left to right: 5L 1kb DNA Ladder (Sigma-Aldrich), 1 and 5) 5-RevIZH2 (H282A), 2 and 6) 3-For IZH2 (H282A), 3 and 7) 5-RevIZH2 (H286A), and 4 and 8) 3-For IZH2 (H286A).


40 Table 3-2. A summary of the mutants, the attempts to mutate the IZH2 gene using the corresponding primers, if the mutant is done, ne eds to be repeated and latest progress. Mutants Attempts to Mutate Done (Y/N) Needs to be Repeated (Y/N) Latest Progress H282A Overlap Extension Y Y QuickChange didnt succeed. H286A Overlap Extension Y N Done H282A/H286A Overlap Extension and QuickChange Y N Done N82A Overlap Extension and QuickChange N Y Sequenced as IZH2 wildtype with QuickChange Kit. Overlap Reverse Fragment didnt extend. H86A Overlap Extension and QuickChange Y N Done N82A/H86A Overlap Extension and QuickChange N Y Gap Repair didnt succeed. QuickChange sample didnt appear to have IZH2 gene when cut with SacI/SalI. S132A Overlap Extension and QuickChange N Y Sequence wasnt correct (non-specific primer binding during PCR) with QuickChange method. Overlap Reverse Fragment didnt extend. H136A Overlap Extension and QuickChange N Y QuickChange method appeared to work, didnt sequence (non-specific primer binding during PCR). Overlap Reverse Fragment didnt extend. S132A/H136A Overlap Extension and QuickChange N Y Gap Repair didnt succeed. QuickChange sample didnt sequence. D153A Overlap Extension and QuickChange N Y QuickChange sample didnt appear to have IZH2 gene when cut with SacI/SalI. Overlap Reverse Fragment didnt extend E79A/N82A/H86A QuickChange N Y Primers may not have worked. Colonies appeared, lac-Z seemed to work, sequence not correct.


41 CHAPTER 4 DISCUSSION IZH genes and the function of Izh2p IZH2 gene The IZH2 gene, discovered during a DNA microarray analysis of gene transcription during low zinc conditions (1), shares sequence similarity with a superfamily of proteins (PAQRs) that are homologous to membrane steroid receptors and adiponectin receptors (3). This superfamily of proteins is distantly rela ted to bacterial hemolysins and alkaline ceramidases (2). IZH gene expression is regulated by Zap1p, which regulates expression of zi nc transporter genes important for yeast zinc homeostasis (1). IZH2 is also regulated by the exoge nous fatty acid myristic acid, thus it may play a role in lipid metabolism (2, 6). Izh2p Protein The membrane protein Izh2p is involved in ir on and zinc metalloregulation. It has highly conserved motifs (2). Izh2p may serve to functio n as an amidohydrolase. This idea is based on the similar structure of alkaline ceramidases to the IZHs Conserved Motifs of Izh2p ExxNxxxH, SxxxHxnD, and HxxxH are the sp ecific motifs of intere st in this study. They are located in the highly conserve d regions of Izh2p (Figure 1-3) (2, 3). Our long-term goal is to determine if these motifs are important for the f unction of Izh2p. We are in vestigating several of the amino acids in these motifs by changing them to alanines by site-directed mutagenesis. This study reports the findings on the histidines of two of these conserved motifs: ExxNxxxH, H86A, showed a loss of pFET3-lacZ activity repression (F igure 3-1 and Table 3-1) and of the HxxxH motif, single mutants (H282A and H 286A) showed a slight loss of pFET3-lacZ activity


42 repression (Figure 3-1 and Table 3-1). The double HxxxH mutant (H 282A/H286A) showed the most loss of pFET3-lacZ activity repression (Figure 3-1 and Table 3-1). Conclusion Izh2p is involved in metallore gulation (2), although the ex act mechanism by which this protein performs its function is still unclear Izh2p and PAQR prot eins, possess the highly conserved motifs ExxNxxxH, SxxxHxnE, and HxxxH (Figure 1-4) (2, 3). The conserved amino acid sequences of Izh2p may be important for th e function of receptor signaling. The histidines of HxxxH motif may be important to the function of these proteins. These proteins share sequence homology with an ancient family that spans across species (2, 3). There is also a distant homology to alka line ceramidases and hemolysins. The fact that they share highly conserved residues on the inside of the cellular membrane may be because they share similar signaling pathways. Further research in to this query is needed. Research in our lab has shown that these receptors increase endoge nous sphingosine (13). Sphingosines are the product of ceramidases because ceramidases hydrol yse ceramide into fatty acid and sphingosine (Figure 1-5). Since Izh and the P AQR proteins share such significan t structural similarity with the alkaline ceramidases this s uggests that they may behave as ligand-activated enzymes that produce secondary messenger sphingoid bases (13).


43 APPENDIX A SEQUENCING RESULTS (a) (b) Figure A-1. DNA Sequence for H282A. (a) Forward; (b) Reverse


44 (a) (b) Figure A-2. DNA Sequence for H286A. (a) Forward; (b) Reverse


45 (a) (b) Figure A-3. DNA Sequence for H282A/H286 Doubl e mutant. (a) Forward; (b) Reverse


46 (a) (b) Figure A-4. DNA Sequence for H86A. (a) Forward; (b) Reverse


47 APPENDIX B ALIGNMENT OF SEQUENCES (a) (b) Figure B-1. DNA Sequence Alignment for H282A (a) Forward; (b) Reverse.


48 (a) (b) Figure B-2. DNA Sequence Alignment for H286A (a) Forward; (b) Reverse.


49 (a) (b) Figure B-3. DNA Sequence Alignment for H282A /H286A Double mutant (a) Forward; (b) Reverse.


50 (a) (b) Figure B-4. DNA Sequence Alignment for H86A mutant (a) Forward; (b) Reverse.


51 LIST OF REFERENCES 1. Lyons, T. J., Gasch, A. P. Gaither, L. A., Bo tstein, D, Brown, P. O., and Eide, D. J. (2000) Proc. Natl. Acad. Sci. 97 (14), 7957-7962. 2. Lyons, T. J, Villa, N. Y., Regalla, L. M., Kupchak, B. R., Vagstad, A., and Eide, D. J. (2004) Proc. Natl. Acad. Sci. 101 (15), 5506-11 3. Tang, Y. T., Hu, T., Arterburn, M., Boyle, B ., Bright, J. M., Emtage, P. C., and Funk, W. D. (2005) J. Mol. Evol 61, 372-380. 4. Gaither, L. A., and Eide, D. J. (2001) Biometals 14, 251-270. 5. Vallee, B. L., and Auld, D. S. (1990) Biochemistry 87 220-224. 6. Karpichev, I. V., Cornivelli, L., and Small, G. M. (2002) J. Biol. Chem 277 (22), 1960919617. 7. Zhao, H., and Eide, D. J. (1997) Mol. Cell Biol 17 (9), 5044-52. 8. Eide, D. J. (2003) J. Nutr 133, 1532S-1535S. 9. Zhao, H., and Eide, D. (1996) Proc. Natl. Acad. Sci 93, 2454-2458. 10. Zhao, H., and Eide, D. (1996) J. Biol. Chem 271, 23203-23210. 11. Dix, D., Bridgham, J., Broderi us, M., and Eide, D. (1997) J. Biol. Chem 272 (18), 11770-7. 12. Kupchak, B. R., Garitaonandia, I., Villa, N. Y., Mullen, M. B., Weaver, M. G., Regalla, L. M., Kendall, E. A., and Lyons, T. J. (2007) Biochim. Biophys. Acta 1773 (7), 1124-32. 13. Kupchak, B. R. Regalla, L., Villa, N., Appi n, C., Vagstad, A., Wolford, C., Cowart, A., Hannun, Y., and Lyons, T. (2006) Yeast Genetics Meeting Abstract # 48 14. Zhu, Y., Bond, J,. and Thomas, P. (2003) Proc. Natl. Acad. Sci 100, 2237-2242. 15. Yamauchi, T., Kamon, J., Ito, Y., Tsuchida, A., Yokomizo, T., Kita, S., Sugiyama, T., Miyagishi, M., Kara, K., Tsunoda, M., Murakami, K., Ohteki, T., Uchida, S., Takekawa, S., Waki, H., Tsuno, N.H., Shibata, Y., Terauchi Y., Froguel, P., Tobe, K., Koyasu, S., Taira, K., Kitamura, T., Shimizu, T., Nagai, R., and Kadowaki, T. (2003) Nature 423, 762-769. 16. Yamauchi, T., Kamon, J., Minokoshi, Y., Ito, Y., Waki, H., Uchida,, S., Yamashita, S., Noda, M., Kita, S., Ueki, K., Eto, K., Akanum a, Y., Froguel, P., Foufelle, F., Ferre., P., Carling., D., Kimura, S., Nagai, R., Kahn, B.B., and Kadowaki, T. (2002) Nature Med 8, 1288-1295.


52 17. Fruebis, J., Tsao, T. S., Javorshi, S., Ebbets-Reed, D., Erickson, M. R., Yen, F. T., Binnain, B. E., and Lodish, H. F. (2001) Proc. Natl. Acad. Sci 98 2005-2010. 18. Yamauchi, T., Kamon, J., Waki, H., Terauchi Y., Kubota, N., Hara, K., Mori, Y., Ide, T., Murakami, K., Tsuboyami-Kasaoka, N., Ezaki, O., Akanuma, Y., Gavrilova, O., Vinson, C., Reitman, M. L., Kagechika, H., Shudo, K., Yoda, M., Nakano, Y., Tobe, K., Nagai, R., Kimura, S., Tomita, M ., Froguel, P., and Kadowaki, T. (2001) Nature Med 7, 941-946., 19. Sritharan, M. (2006) Indian J Med Microbiol 24, 163-164 20. Kolesnick, R. (2002) J. Clin. Invest 110, 3-8. 21. Mao, C., Zu, R., Szulc, Z. M., Bielawski, J ., Becker, K. P., Bielawska, A., Galadari, S. H., Hu, W., and Obeid, L. M. (2003) J. Biol. Chem 33, 31184-31191. 22. Narashiman, M. L., Coca, M. A., Jin, J., Yamauchi, T., Ito, Y., Kadowaki, T., Kim, K. K., Pardo, J. M., Damsz, B., Hasegawa, P. M., Yun, D-J., and Bressan, R. A. (2005) Molecular Cell 17 171-180. 23. Charlesworth, D., Charlesworth, B., and McVean, G. A. (2001) Trends Ecol. Evol 16 (5), 235-242.. 24. Coleman, J. E. (1995) Annu. Rev. Biochem 61, 897-946. 25. Mao, C., Xu, R., Bielawska, A., Szulc, M., and Obeid, L. M. (2000) J. Biol. Chem 275 (40), 31369-31378. 26. Mao, C., Xu, R., Bielawska, A., and Obeid, L. M. (2000) J. Biol. Chem 275, 6876-6884 27. Hannun, Y. A., and Obeid, L. M. (2002) J. Biol. Chem 277 (29), 25847-25850. 28. Merrill, A. H., Jr., Sullard s, M. C., Wang, E., Voss, K. A., and Riley, R. T. (2001) Environ. Health Perspect 109 (2), 283-289. 29. Gietz, R. D., Schiestl, R. H., Wi llems, A. R., and Woods, R. A. (1995) Yeast 11 (4), 35560. 30. Guarente, L. (1983) Methods Enzymol 101, 181-191. 31. Griffith, K. L., and Wolf, Jr., R. E. (2002) Biochem. Biophys. Res. Comm 290, 397-402. 32. Sikorski, R.S., and Hieter, P. (1989) Genetics 122, 19-27. 33. Liu, H., Krizek, J., and Bretscher, A. (1992) Genetics 132, 665-673. 34. Shiflett, S. L., Ward, D. M., Huynh, D., Vaughn, M. B., Simmons, J. C. and Kaplan, J. (2004) J. Biol. Chem 279, 10982-10990.


53 35. Rose, M., and Botstein, D. (1983) Methods Enzymol 101, 167-180. 36. Weiner, M. P., Gackstetter, T., Costa, G. L., Bauer, J. C., and Kretz, K. A. (1995) Molecular Biology: Current I nnovations and Future Trends Eds. A. M. Griffin and H. G. Griffin. Horizon Scientific Press. QuickChange Site-Directed Mutagenesis Kit. 37. Sherman, F., Fink, G. R ., and Hicks, J. B. (1986) Methods in Yeast Genetics. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press. 38. Vallejo, A. N., Pogulis, R. J., and Pease, L. R. (1995) Mutagenesis and synthesis of novel recombinant genes using PCR. In PCR Primer: a Laboratory Manual. 603-612. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press. 39. Muhlrad, D., Hunter, R., and Parker, R. (1992) Yeast 8, 79-82. 40. Altschul, S. F., Madden, T. L., Schaffler, A. A., Zhang, J., Zhang, Z., Miller, W., and Lipman. (1997) Nucleic Acids Res 25, 3389-3402. 41. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, N. Y.: Cold Spring Harbor Laboratory Press. 42. Eide, D., and Guarente, L. (1992) J. Gen. Microbiol 138, 347-354. 43. Wickerham, L. J. (1946) J. Bacteriol 52, 293-301. 44. Miller, J. H. (1972) Experiments in Molecular Genetics Cold Spring Harbor, N. Y.: Cold Spring Harbor Laboratory Press. 45. Obradors, N., Cabiscol, E., Ag uilar, J., and Ros, J. (1998). Eur. J. Biochem 258, 207213.


54 BIOGRAPHICAL SKETCH Elizabeth Ann Kendall was born and raised in Salt Lake City, Utah. She was the youngest of seven in an LDS family. Her bachelor of sc ience was received in 1992 where she specialized in ecology and evolution, with a minor in chem istry. After graduation in June 1992 she attended the first summer course on biological rhythms at the University of Virginia, Charlottesville (summer 1992). In 1996 she received her Master of Science in Marine Biology at the University of Groningen, the Netherlands. From 1997 to 2003 she worked as a marine biologist in Washington, California, Alaska and Hawaii. Her different mari ne positions were: shellfish intern, marine mammal and fisheries observer, program coordinator for marine education programs such as Adopt-a-Dolphin and Whale, science lecturer for chemistry, geography, and math at the Maui Community College, then as a naturalist at the Ma ui Ocean Center. She returned back to Utah to take a position as lab manager investigating spontaneous deleterious mutations, and lab specialist inve stigating proteins involved in macular degeneration at the University of Utah. In 2004 she joined the Univer sity of Florida Chemistry Department working towards her Master of Science in Biochemistry.