<%BANNER%>

Katanin, a Microtuble Severing Protein, Is Required for Normal Trichome Morphogenesis

Permanent Link: http://ufdc.ufl.edu/UFE0021488/00001

Material Information

Title: Katanin, a Microtuble Severing Protein, Is Required for Normal Trichome Morphogenesis
Physical Description: 1 online resource (56 p.)
Language: english
Creator: Jeffries, Stacey Renae
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2007

Subjects

Subjects / Keywords: Botany -- Dissertations, Academic -- UF
Genre: Botany thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Cell shape is determined by the coordinated actions of the microtubule cytoskeleton and the cell wall in plants. It is suspected that the microtubule cytoskeleton and cell wall fibers called cellulose microfibrils, interact during morphogenesis. Several lines of evidence support this hypothesis. One line of evidence is the coalignment of cellulose microfibrils and microtubules during morphogenesis. Secondly, mutations in either microtubule or cellulose encoding genes result in abnormal cell shape. Additionally, microtubule destabilizing drugs disrupt cellulose microfibrils of the cell wall. However, direct evidence of an interaction between microtubules and cellulose microfibrils has been lacking. To discover new genes involved in cell morphogenesis, the FURCA2 gene was cloned. FRC2 encodes a katanin protein that has recently been shown to be required for normal cell wall biosynthesis. Katanins are microtubule severing proteins. Katanin involvement in cell wall biosynthesis, demonstrates a genetic link between the cell wall and microtubules during morphogenesis. Katanin expression was observed throughout plant morphogenesis. Katanin transcripts were expressed in shoot apical meristem, floral meristem, leaf primordial, developing and mature trichomes, and during ovule development. Furthermore, katanin also interacts with, Zwichel, a novel kinesin, during cell morphogenesis. We propose that katanin and Zwichel interact to generate severed, bundled microtubules. These microtubules are then transported to areas of cell expansion where they interact with and stabilize cellulose synthesizing complexes.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Stacey Renae Jeffries.
Thesis: Thesis (M.S.)--University of Florida, 2007.
Local: Adviser: Oppenheimer, David.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2017-08-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2007
System ID: UFE0021488:00001

Permanent Link: http://ufdc.ufl.edu/UFE0021488/00001

Material Information

Title: Katanin, a Microtuble Severing Protein, Is Required for Normal Trichome Morphogenesis
Physical Description: 1 online resource (56 p.)
Language: english
Creator: Jeffries, Stacey Renae
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2007

Subjects

Subjects / Keywords: Botany -- Dissertations, Academic -- UF
Genre: Botany thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Cell shape is determined by the coordinated actions of the microtubule cytoskeleton and the cell wall in plants. It is suspected that the microtubule cytoskeleton and cell wall fibers called cellulose microfibrils, interact during morphogenesis. Several lines of evidence support this hypothesis. One line of evidence is the coalignment of cellulose microfibrils and microtubules during morphogenesis. Secondly, mutations in either microtubule or cellulose encoding genes result in abnormal cell shape. Additionally, microtubule destabilizing drugs disrupt cellulose microfibrils of the cell wall. However, direct evidence of an interaction between microtubules and cellulose microfibrils has been lacking. To discover new genes involved in cell morphogenesis, the FURCA2 gene was cloned. FRC2 encodes a katanin protein that has recently been shown to be required for normal cell wall biosynthesis. Katanins are microtubule severing proteins. Katanin involvement in cell wall biosynthesis, demonstrates a genetic link between the cell wall and microtubules during morphogenesis. Katanin expression was observed throughout plant morphogenesis. Katanin transcripts were expressed in shoot apical meristem, floral meristem, leaf primordial, developing and mature trichomes, and during ovule development. Furthermore, katanin also interacts with, Zwichel, a novel kinesin, during cell morphogenesis. We propose that katanin and Zwichel interact to generate severed, bundled microtubules. These microtubules are then transported to areas of cell expansion where they interact with and stabilize cellulose synthesizing complexes.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Stacey Renae Jeffries.
Thesis: Thesis (M.S.)--University of Florida, 2007.
Local: Adviser: Oppenheimer, David.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2017-08-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2007
System ID: UFE0021488:00001


This item has the following downloads:


Full Text

PAGE 1

1 KATANIN, A MICROTUBULE SEVERING PR OTEIN, IS REQUIRED FOR NORMAL TRICHOME MORPHOGENESIS By STACEY JEFFRIES A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2007

PAGE 2

2 2007 Stacey Jeffries

PAGE 3

3 This document is dedicated to my family.

PAGE 4

4 ACKNOWLEDGMENTS First, I would like to tha nk my advisor, Dr. David Oppenheimer, for his patience throughout this project. I would al so like to give a special thanks to my committee members, Dr. Alice Harmon and Dr. Bernard Hauser, for their support and advice. I w ould like to thank the members of the Oppenheimer lab, Dr. Xiaoquo Zhang, Dr. Zhengui Zheng, Meredith Sullivan, and Paris Grey, for their support a nd friendship. Finally, I would to give a special thanks to my parents and husband, without whose encourag ement I would have given up long ago.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS...............................................................................................................4 LIST OF FIGURES................................................................................................................ .........7 ABSTRACT....................................................................................................................... ..............8 CHAPTER 1 GENERAL INTRODUCTION..............................................................................................10 Microtubule Structure and Dynamics.....................................................................................10 The Microtubule Cytoskeleton in Animals.............................................................................11 The Microtubule Cytoskeleton in Plants................................................................................13 Microtubule Stabilizers in Animals........................................................................................15 Microtubule Stabilizers in Plants............................................................................................19 Microtubule TIP Stabilizers in Animals.................................................................................20 Microtubule TIP Stabilizers in Plants.....................................................................................20 Microtubule Destabilizers...................................................................................................... .21 Mutation of Microtubule Regulators......................................................................................24 Hypothesis and Organization of This Thesis..........................................................................26 2 CLONING OF FRC2, A GENE INVOL VED IN TRICHOME MORPHOGENESIS..........27 Abstract....................................................................................................................... ............27 Introduction................................................................................................................... ..........27 Methods and Materials.......................................................................................................... .30 Results........................................................................................................................ .............31 Discussion..................................................................................................................... ..........32 3 KATANIN EXPRESSION DURING DEVELOPMENT......................................................34 Abstract....................................................................................................................... ............34 Introduction................................................................................................................... ..........34 Methods and Material........................................................................................................... ..35 Results........................................................................................................................ .............36 Discussion..................................................................................................................... ..........36 4 ARABIDOPSIS KATANIN PR OTEIN BINDS ZWICHEL, A NOVEL KINESIN.............39 Abstract....................................................................................................................... ............39 Introduction................................................................................................................... ..........39 Method and Materials........................................................................................................... ..40 Results........................................................................................................................ .............41 Discussion..................................................................................................................... ..........42

PAGE 6

6 5 CONCLUSION AND FUTURE WORK...............................................................................44 LIST OF REFERENCES............................................................................................................. ..45 BIOGRAPHICAL SKETCH.........................................................................................................56

PAGE 7

7 LIST OF FIGURES Figure page 1-1 Microtubules radiate throughout the cytoplasm during interphase...................................13 1-2 Microtubules are arranged into a mitotic sp indle that align chromosomes in the middle of the cell during metaphase..................................................................................13 2-1 Schematic of Positional Cloning of FRC2 .........................................................................32 3-1 Katanin Expression During Development in Arabidopsis thaliana ..................................36 4-1 Yeast Two Hybrid Assay of Katanin and Zwichel............................................................41

PAGE 8

8 Abstract of Thesis Presen ted to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Master of Science KATANIN, A MICROTUBULE SEVERING PR OTEIN, IS REQUIRED FOR NORMAL TRICHOME MORPHOGENESIS By Stacey Jeffries August 2007 Chair: David Oppenheimer Major: Botany Cell shape is determined by the coordinated actions of the microt ubule cytoskeleton and the cell wall in plants. It is suspected that the microtubule cytoskel eton and cell wall fibers called cellulose microfibrils, in teract during morphogene sis. Several lines of evidence support this hypothesis. One line of evidence is th e coalignment of cellulose microfibrils and microtubules during morphogenesis. Secondly, mutations in eith er microtubule or cellulose encoding genes result in abnormal cell shape. Additionally, microtubule destabilizing drugs disrupt cellulose microfibrils of the cell wall. However, direct evidence of an interaction between microtubules and cellulose microfibrils has been lacking. To discover new genes involve d in cell morphogenesis, the FURCA2 gene was cloned. FRC2 encodes a katanin protein that has recently been shown to be required for normal cell wall biosynthesis. Katanins are microtubule severi ng proteins. Katanin i nvolvement in cell wall biosynthesis, demonstrates a genetic link between the cell wall a nd microtubules during morphogenesis. Katanin expr ession was observed throughout pl ant morphogenesis. Katanin transcripts were expressed in shoot apical meristem, floral merist em, leaf primordial, developing and mature trichomes, and during ovule development. Furthermore, katanin also interacts with, Zwichel, a novel kinesin, dur ing cell morphogenesis. We pr opose that katanin and Zwichel

PAGE 9

9 interact to generate severed, bundled microtubules. These microt ubules are then transported to areas of cell expansion where they interact with and stabilize cellulose synthesizing complexes.

PAGE 10

10 CHAPTER 1 GENERAL INTRODUCTION Microtubule Structure and Dynamics Microtubules are essential components of eukaryo tic cells. As their name suggest, they are small tubular structures, only about 25 nm in diameter (Desau and Mitchison, 1998). These tubular structures are composed of and tubulin heterodimers. They are nucleated within the cell at specific sites known as microtubule or ganizing centers (MTOC). In animal cells, centrosomes function as MTOC. In plants, which lack centrosomes, there is evidence that both the nucleus, and the cell membrane function as MTOC (Liu et al., 1994 ; Erhardt et al., 2002; Hasezawa et al., 2000; Seltzer et al ., 2003; Pastuglia et al., 2006). -Tubulins are located within the MTOC. -tubulins act as primers of microtubule nucleation ((Job et al ., 2003).). Thirteen tubulin are believed to assemble in a corkskew -like formation, and facilitate the addition of tubulin heterodimers into protof ilaments by interacting with the subunits (Zheng et al ., 1995). Growth of the protofilaments onl y occurs by the addition of the -subunit of the heterodimer to the subunit of another heterodimer. Each micr otubule is created by the lateral and longitudinal association of thirteen protofilament s. Therefore, the interaction of -tubulin and the -subunit of the heterodimer, produces an intrinsic polarity to microtubules. -Tubulins are usually associated within the MTOC with microtubule end capping proteins that restrict addition of heterodimers to the end of the microtubule with which they are associated (Zheng et al, 1995). As a result, heterodimers are more readily added to one end than the other. This end is called the growing end or the plus end. The opposite end is known as the minus end, and addition of heterodimers occur at a much slower rate at minus end.

PAGE 11

11 Microtubules are very dynamic structures. Th ey have potential for both rapid growth and shrinkage. Two factors affect th e stability of microtubules. The first is the concentration of tubulin within the cell. High tubulin concentr ations favor microtubule stability and growth, while low concentration favors rapid depolymeriza tion or catastrophe. A second factor affecting microtubule stability is the GTP state of the microtubule. The and subunits have GTP binding sites. The GTP binding site is located on the interior of the protein while the GTP binding site is located on the outer surface of the protein. Only the subunit bound GTP is hydrolysable. GTP is hydrolyzed with the addition of each new heterodimer. However, when addition of heterodimers is fast er than GTP is hydrolyzed a GTPcap is formed. GTP-caps are very stable structures that prevent catastrophes and promote stability and growth of the microtubule. If, however, hydrolysis of GTP is faster than polym erization the microtubule will loose its GTP-cap and catastrophe will occur. Microtubules can be rescued from catastrophe by rapid addition of heterodimers to the plus end. Another state that also oc curs within the cell is the simultaneous loss of heterodimers at the minus end and addition at the pl us end. This state is known as treadmilling (Howard and Hyman, 2003). The ability of microtubules to switch between any of these states is called dynamic instability. Mi crotubules dynamic instability allows the cell to rapidly rear range the microtubule cytoskeleton. The Microtubule Cytoskeleton in Animals The microtubule cytoskeleton is an essentia l component of all eukaryotic cells. The evolution of microtubules has been instrumental in generating highly e fficient cells. During interphase in animals, relatively stable microtubules radiate throughout the cell from centrosomes, the microtubule organizing cente r (MTOC) of the cell (Figure 1-1). The microtubule network acts as a corridor, conne cting the organelle wh ere the proteins are

PAGE 12

12 constructed and/or processed to the organelles where they ar e needed. These vesicle bound proteins are transported along mi crotubules to their destination by microtubule motor proteins such as kinesins and dyenins. In addition, thes e stable microtubules are believed to play a role in cellular scaffolding and metabolic channeling in the cell to ensure efficient and controlled enzymatic reactions. Tubulin affinity chromatography has revealed numerous enzymes in the same pathways that interact with the micr otubule cytoskeleton supporting this theory (Chuong et al ., 2004). This provides the cell with a met hod of generating microcompartments where enzymatic reactions can take place in an effi cient and controlled fashion. Interphase microtubules also function in cel l elongation, thereby influencing the final shape of the cell. In contrast to microtubule dynamics duing interphase, microtubule cytoskeleton behaves quite differently during the mitotic phase of the cell cycle. In contrast to the stable microtubules of interphase, these microtubules are characte rized as much more unstable. This dynamic instability allows for the rapid depolymerization of micr otubules in one area of the cell and rapid polymerization in a different area in the cell. Th is distinctive trait is a crucial part of the rearrangement of the interphase microt ubule cytoskeleton into polymerization

PAGE 13

13 Figure 1-1. Microtubules radiate throughout the cytoplasm du ring interphase.( Reprinted with permission from Michael Davidson webs ite:http://www. micros copy.fsu.edu/cells/ fluorescence mitosis/interphaselarge.html) Figure 1-2. Microtubules are arranged into a m itotic spindle that align chromosomes in the middle of the cell during metaphase. (Rep rinted with permission from Michael Davidson website http://www.microscopy.fs u.edu/cells/ fluorescencemitosis/ meta phasesmall.html) into the mitotic spindle. The mito tic spindle is responsible for th e alignment of newly replicated chromosomal pairs along the center of the cell during metaphase (Figure 1-2). Moreover, the rapid depolymerization of the microtubules atta ched to the chromosomes generates the force needed toseperate chromatis and pull them to wards the opposing poles of the newly forming daughter cells during anaphase. During mitosis, microtubules ensure that two copies of each chromosome reside in each of the new daughter cells. Occurrences of changes in chromosome number in humans lead to conditions such as Down, Patau, Edward, and Turner Syndromes. Most changes in chromosomal number are probably embryonic lethal. The Microtubule Cytoskeleton in Plants The evolutionary acquirement and loss of cellular components has necessitated the development of several novel differences between the plant and animal kingdoms, especially where the microtubule organizati on is concerned. Animal cells have a prominent MTOC,

PAGE 14

14 generated by centrosomes, while plants lack centrosomes. During interphase in plants, microtubules emanate from the nuclear membrane towards the cell cortex, suggesting that the nucleus may be a MTOC in plants (Hasezawa et al ., 2000). Soon after this stage, microtubules can no longer be seen radiating from the nucleus but are found in abundanc e at the cell cortex. Plant cells also have two main components, chlor oplasts and the cell wall, which animals do not. In plants, the cell wall limits grow th and cell shape. Therefore, cell growth and shape, must be coordinated with localized change s in cell wall properties. Cortical microtubules play an integral role in cell wall formation in growing cells po ssibly by the transport a nd placement of cell wall components to areas of growth (Burk et al ., 2001; Webb et al ., 2002). They also direct the positioning of cellulose microfib rils within the primary cell wall (Green 1962; Ledbetter and Porter, 1963). The cellulose microf ibrils in turn, restrict the di rection in which a cell can grow controlling cell growth and el ongation. However, the underlying mechanisms of how microtubules and microfibrils are invo lved in this process are unclear. The differences between the animal and plan t microtubule cytoskeleton are not limited to just interphase. This is reflected in the fact th at two microtubule arrays in plants that have no animal counterpart; the pre-prophase band and th e phragmoplast. The subset of microtubules localized at the cell cortex during interpha se begins to rapidly depolymerize at the interphase/mitosis transition. These microtubules reform beneath the cel l cortex surrounding the nucleus, forming the preprophase band. This pr e-prophase band accurately predicts the future site of cell plate synthesis. Th e localization of golgi with this pre-prophase band may imply that they are producing cell wall modifi ers that prepare this area for cell plate formation (Mineyuki, 1999). During prophase, cytoplasmic microtubul es depolymerize and aggregate in two populations on either side of the nucleus to be gin forming a prophase spindle which will later

PAGE 15

15 assemble and organize the microtubules. The pr eprophase band begins depolymerizing with the onset of prophase and joins th e two pools of microtubules formi ng the mitotic spindle. The microtubules of the mitotic spindle functions in pl ant cells the same as in animal cells, ensuring the appropriate number of chromosomes are placed into both daughter cells. Towards the end of anaphase, the mitotic spindle disperses and begins pol ymerizing at the site of the future cell wall. This collection of microtubules is called the phragmoplast and they ar e responsible for the transport of ER and vesicles to the site. This complex of microtubules and ER generates the cell plate, a wall-like structure that separates the daughter cells, and later matures to become the cell wall effectively dividing the daught er cells (Taiz and Zeiger, 2002). Microtubule Stabilizers in Animals Since microtubules are involved in several pro cesses that are essentia l to eukaryotic cells, it is understandable that eukaryotic cells also have methods of regulating them. Both animal and plant cells regulate their microt ubules at several structural le vels. One method of regulating microtubules is by controlling the rate at whic h the subunits are polymerized. The pathway controlling this process is well understood in mamma lian systems. After translation, chaperonins belonging to the GroEL/Hsp60 family are i nvolved in the corr ect folding of the and subunits (Rommelaere et al ., 1993; Kubota et al ., 1994). After the subunits are properly folded, they enter the TFC pathway. In the first step in this pathway, TFCB binds to the subunit, while TFCA binds to the subunit. TFCB is subsequently tr aded for TFCE and TFCA is replaced with TFCD. These two complexes interact fo rming a quaternary structure that generates tubulin heterodimer. The heterodimers are released from this complex by TFCC (Lewis et al ., 1997). This pathway is not only important for producing heterodimers, but also for regulating the concentration of free and concentration. The importance of this was

PAGE 16

16 demonstrated in yeast by overexpressing and TFCC. In yeast, overexpressing tubulin concentration is toxic to the cell and eventually leads to cell death. However, this toxicity can be counter balanced by simultaneously overexpressi ng TCAA, suggesting that it buffers the cell from toxicity by it interactions. Moreove r, if TCAA is overexpressed alone, the subunits of the cell are degraded suggesting the and populations are maintained in a stoichiometric fashion. This TCF pathway of maintaining the tubulin population has been conserved in plants. TCFs A, B, D and E homo logs have been identified in Arabidopsis thialana Mutations of any of these lead to severe cell division defects during endosperm and embryo development that are embryo leathal (Steinborn et al ., 2002; Tzafrir et al ., 2002; Liu and Meinke, 1998; McElver et al ., 2000). In yeast, the microtubule associating protein (MAP) Stu2p, binds free tubulin heterodimers in the cytoplasm (Al-Bassam et al ., 2006). Stu2p is a member of the Dis1/XMAP215 family of microt ubule stabilizers. Members of this family contain TOG domains, consisting of 2-5 degenerate HEAT (H untingtin protein, E longation factor 3, A lpha regulatory unit of protein phosphata se 2A, and yeast PI3-Kinase T OrI) repeats, thought to be interaction domains (Ohkur et al ., 2001; Usui et al ., 2003; van Bruegal, 2003; Holmfeldt et al ., 2004; and Shirasu-Hiza et al ., 2003). Stu2p contains two TOG domains, designated TOG1 and TOG2. Truncated versions of Stu2p that lack the TOG1 domain resulted in a decrease of microtubule length. Yeast producing a GFP-tagge d version of this truncated protein still associate with microtubule plus ends. The data suggests the TOG1 domain interacts with the tubulin heterodimer, while the TOG2 domain func tions in localizing and facilitating the addition of heterodimers to the plus end of the growing microtubule (Al-Bassam et al ., 2006). A Dis1/XMAP215 homolog is present as a single copy gene in all sequenced eukaryotic genomes

PAGE 17

17 implying this pathway of adding heterodimers to the plus end of microtubules has also been conserved. However, the Dis/XMAP215 family is known for its microtubule stabilizing functions and not tubulin dimer bindi ng. It is possible that this polymerization function is unique to yeast. Once the heterodimers have polymerized in to a microtubule, the cell produces proteins that regulate microtubule stability. Tight regulation of microtubules is important during interphase to ensure their constancy and duri ng mitosis to influence the rapid growth and shrinkage (catastrophe) needed throughout cell division. Therefore, eukaryotic cells have acquired microtubule associated proteins (MAPs) to stabilize microtubule dimensions depending on its current position in the cell cycle. Several MAPs that st abilize microtubules have been discovered and well characterized in mammalian model systems. These have been placed into two classes, neuronal and non-ne uronal, depending on location of expression. Neuronal MAPs are expressed within brain tissu e and include MAP1, MAP2, and ta u, but not all are found in the same cells. MAP1 is found in bot h neuronal and glia l cells (Bloom et al ., 1984). MAP2 localizes to the soma and dendrites of the neur on, while tau is expresse d in the axon (Bernhardt and Matus, 1984; Binder et al ., 1985; and Caceres et al ., 1983). MAP4 is expressed ubiquitously. Structural analysis of these four proteins reveals that MAP2, MAP4, and tau are structurally similar, but that MAP1 is struct urally unique. MAP2, MAP 4, and tau all contain a N-terminal projection domain, as well as a C-terminal microt ubule binding domain (Vallee and Borisy, 1977; Aizawa et al ., 1988). Binding of MAPs to micr otubules are thought to protect vulnerable sites on the microtubule lattice from microtubule dest abilizing proteins. MAP interactions with microtubules ar e regulated by phosphorylation. Phosphorylation of the C-terminal binding domains of conventio nal MAP 2, MAP4, and ta u disrupt their binding

PAGE 18

18 to microtubules leaving them vulnerable to destabilizing proteins (Illenberger et al. 1996). Several variations on this theme have been identified in animal model systems. In Xenopus the plus-ends microtubule stabilizi ng protein, XMAP215, provide an example of an elaboration of this theme. XMAP215 is a member of the Di s1/XMAP215 family of MAPs that function in stabilizing microtubules. XMAP21 5 is a 215 kDa protein whose Cterminal domain contains a conserverved domain that is t hought to direct centrosome/spindl e localization. The N-terminal domain contains 5 TOG domains which are impo rtant for binding to tubulin heterodimers (Cassmismeris et al ., 2001; Popov et al ., 2001; Graef et al ., 2000). XMAP215 also interacts with KCM1, a Kin1 kinesin-like protein, which has microtubule destabilizing abilities (Desai et al ., 1999). Overexpressing the N-terminus and Cterminus fragments of XMAP215 suggest that the C-terminal region localizes the protein to the microtubules while the N-terminus interacts with KCM1, preventing it from destabilizing th e microtubule. Sequence analysis of XMAP215 reveals two potential CDK1 phos phorylation sites. Cell cycl e dependent phosphorylation of XMAP215 is believed to disrupt this interact ion, allowing XKCM1 to destabilize microtubules during mitosis (Vasquez et al ., 1999; Holmfeldt et al ., 2004). A slightly different twist on this theme occurs with the human Dis1/XMAP215 homolog, TOGp. Unlike XMAP215, the TOGp N-terminus is responsible for microtubule bindin g. Interestingly, the Cterminal portion of the protein has been shown to bind tubulin heter odimers. This ability has been shown by Stu2p, another member of the Dis/XMAP215 famil y. Also in contrast with XMAP215, TOGp regulation seems to be needed dur ing mitosis rather than interpha se. RNAi depletion of TOGp has no affect on interphase microtubules stability but drastically alters spindle formation. Furthermore, labeling both microtubules and NuMA, a minus-end microtubule marker, demonstrated that the microtubules of these diso rganized spindles were destabilized at their

PAGE 19

19 minus-ends, but had still chromosomes attached to their plus-ends. Therefore, it is thought that the centrosomely localized TOGp protects the mi nus end of microtubules from the destabilizing effects of MCAK, a kinesin-like destabilizer during spindle formation. Phosphorylation of TOGp regulates its interaction with MCAK. Microtubule Stabilizers in Plants Identification of plant MAPs has lagged signi ficantly behind identification of animal MAPs. This is due, in large part, to the fact th at neuronal cells of anim al model systems contain high concentrations of microtubules. Additiona lly, cytoplasm volume in plants is very low bescause vacuoles occupy a large po rtion of mature cells. As a result, microtubule concentration is substantially lower in plants. The first plant MAPs were isolated by pu rifying taxol stabilized microtubules from BY2 cells and el uting microtubule binding protei ns. A family of novel MAPs was identified that were about 65 kDa and therefore named MAP65. The MAP65 family of proteins has been shown to have microtubule stabilizing abilities, as well as, microtubule bundling abilities (Chang-Ji e and Sonobe, 1993; Chan et al ., 1996; Smertenko et al ., 2000). Similar experiments identified MAP190, which interacts with both microtubules and actin (Igarishi et al ., 2000). These types of biochemical expe riments have also identified other proteins with the ability to bi nd microtubules but probably have other functions. These include EF1 alpha, eIf4A, and heat shock protein 90. Recently, mutant analysis revealed an Arabidopsis thaniana temperature sensitive microtubule mutant called MOR1. MOR1 encodes the only Dis/XMAP215 homolog in Arabidopsis MOR1 is the first plant MAP that has animal homologs. It will be interesting to discover if MOR1 stabilizes microtubules by a mechanism similar to either XMAP215 or TOGp. The fact that the Arabidopsis genome does contain a Kin1 kinesin-like family of proteins, suggests a similar mechanism of microtubule stabililization may be present in plants.

PAGE 20

20 Microtubule TIP Stabilizers in Animals The plus ends or tips of microtubules are crucial to their dynamic nature. The cells ability to maintain microtubules as stable struct ures during interphase, or to rapidly reorganize the microtubule cytoskeleton duri ng mitosis, is largely due to MAPs that regulate microtubule tips. These tip binding MAPs (TIP) associate wi th the plus ends of the growing microtubule ends to regulate their dynamic st ate and their interactions with the diverse intracellular targets, including organelles and kinetochores. Cytoplas mic linker 1 (CLIP 170) was the first member of the plus-end family of MAPs identified. It was originally identified as a linker between endocytic vesicles and microtubules (Rickard and Kreis, 1990; Pierre et al. 1992). The Nterminus contains a microtubule binding domain and the C-terminus contains an organelle binding domain. The N-terminal domain, as well as the full length CLIP-170 protein, localize to growing microtubule plus ends (Pierre et al ., 1994; Scheel et al ., 1999; Perez et al ., 1999). Furthermore, CLIP 170 N-terminal domain is capa ble of increasing growth rate and rescue of microtubule catastrophe (Arnel et al ., 2004). Since CLIP 170 discovery, numerous unrelated plus-end tip binding (+TIPS) MAPs belonging to several families ha ve been identified. This +TIP family includes CLIP, CLIP-associating prot eins (CLASPs), end binding (EB) family of proteins lissencephally (LIS 1) dynactin, navigator-1, actin cro sslinking family 7 (ACF7), and adenomatous polyposis coli tumor suppressor prot ein (APC). The numerous + TIP may suggest multiple pathways of tip regulation depending on the cell cycle. Alternatively, these proteins might work as a complex to generate tip stability. Microtubule TIP Stabilizers in Plants + TIPs have only recently begun to be identifi ed in plants. Spiril 1 (SPR1) was identified due to the fact that mutations at this locus re sult in roots and hypocotyls with a right handed twist due to abnormalities in cell expansion (Furutani et al. 2000). SPR1:GFP fu sion localizes to

PAGE 21

21 growing microtubule plus ends id entifying it as a +TIP (Sedbrook et al. 2004). Unexpectingly, sequence homology searches to animal +TIP sequ ences, have revealed similarity to only one family of known + TIPs in the Arabidopsis thaliana genome. Three EB homologs have been found in the Arabidopsis genome. Two of these three genes have been localized to microtubule plus ends (Chan et al ., 2003; Mathur et al ., 2003). Domain prediction programs have also identified several proteins with a similar domain structure to the LIS 1 gene. To date, only one of these genes has been shown to affect microtub ules. This gene is Tonneau 1 (Ton1). ton1 mutants have been shown to have a disorgani zed cortical microtubule array during interphase and lack a preprophase ba nd during mitosis (Traas et al ., 1995). However, Ton1 has not yet been shown to localize to microt ubule plus ends. Sequence homo logy searches have revealed no CLIP family members in the Arabidopsis genom e. Surprisingly, expression of mammalian CLIP 170 in Arabidopsis retains the ab ility to interact with the mi crotubule plus ends (Dhonukshe and Godella, 2003). Additionally, sequ ence anaylsis has revealed the presence of the CLASP family of +TIPs (Bisgrove et al. 2004). Taken together, this suggest s that the CLIP/CLASP pathway of microtubule plus end stabilization has been conserved in plants. It is possible that plants have retained this pathway but evolve d functionally equivalent CLIP pr oteins that have no sequence similarities. Alternatively, it mi ght suggest that plants only ut ilize CLASPs in the microtubule plus end stabilization. However, more studie s are needed to eval uate this hypothesis. Microtubule Destabilizers Microtubule destabilization is essential to the dynamics for which microtubules are known. Two groups of destabilizers have been di scovered; those that destabilize microtubule ends and those that sever along their lengths. On e of the first groups of destabilizers identified were the kin1 kinesin-like family of proteins. Members of this family show sequence similarity to kinesins but have been shown to have no mo tor activity. Instead, members of this family

PAGE 22

22 localize predominantly to plus ends, and to a le sser degree, to the minus ends of microtubules (Dasai et al. 1999). This implies that kin1 kinesin-like family promotes microtubule destabilization at both ends of microtubules. Although, expr ession at the minus end of microtubules could be an artifact of overexpr ession. However, the Ki n1 kinesin-like human family member, MCAK, has been shown to be a minus end destabilizers (Hunter et al ., 2003). A second microtubule destabiliz er is stathmin/ Op18. Stathmin was originally identified because of its upregulation in rapidly dividing cells and neurons. It is a 19 kDa protein. The Cterminal domain contains an -helical region that is essen tial for tubulin binding. The Nterminal domain contains four phosphorylation s ites that are critical for stathmins effects on microtubule destabilization promoti ng function. One or more of these four sites have been shown to be phosphorylated by cyclin-dependent kinases (cdks), mitogen-activated protein (MAP) kinase, protein kinase A, (PKA), and Ca 2+/calmodulin-dependent kinase-Gr (CAMK IV/Gr). Phosphorylation combinations at these sites dramatically affect stathmin activity. Stathmin has been shown to destabilize micr otubule plus ends duri ng interphase. This destabilization is down-regulated during the interphase to mitosis transition due to phosphorylation of all four N-terminal sites (Marklund et al. 1993; Larson et al ., 1997; Anderson et al ., 1997 ). Until recently, there was controversy over whether or not stathmin/Op18 was directly involved in microtubule destabilization. Stathmin has been shown to bind tubulin dimers (Belmont and Mitchison, 1996; Carmi et al. 1997, Jourdain et al. 1997). Therefore, it was questionable whether the destabili zation was a result of the lower concentration of available tubulin. Recently, two lines of evidence suggest th at stathmin/0p18 is directly involved in microtubule plus end destabilization. First, purifi ed stathmin/Op18 is unable to depolymerize microtubules capped with guanylyl -methylene diphosphate, a slowly

PAGE 23

23 hydrolzable GTP analog. Secondly, a mutation that disrupted the ability of stathmin/Op18 to bind tubulin dimers retained the ability to pr oduce catastrophe at the plus end of microtubule (Howell et al. 1999). Taken together, this suggest s that stathmin/Op18 in microtubule destabilization is direct. Three closely related proteins make up th e third group of microt ubule destabilizers. Unlike the previous two groups th at destabilize microtubule ends, th ese three proteins have the ability to sever along the lengt h of the microtubules. These proteins belong to the A TPases A ssociated with various cellular A ctivities (AAA) family of protei ns. The most characterized of these three is katanin. Katanin is a heterodimer consisting of a 60 kDa (p60) and a 80 kDa (p80) subunit. In animal model systems, the 80 kDa s ubunit is required to localize the protein to the centrosome, while the 60 kDa portion contains the microtubule severing activity (Hartman et al ., 1998; McNally et al ., 2000). In animals, katanin has been shown to sever centrosomal microtubules that are then thought to be bundled and transported to sites of spindle formation at the onset of mitosis. Transport of short microt ubules has been observed in both epithelial cells and neurons (Abal et al. 2002). These short microtubules coul d serve as templates or seeds for the addition of tubulin heterodimers in the form ation of spindles. Thereby increasing the number and density of microtubules in the spindle than would be produced by -tubulin alone. In some cell types, this process may occu r during interphase. Spastin and Fridgetin are closely related to katanin, and both have microt ubule severing activity (Frickey and Lupas, 2004; Evans et al ., 2005;Roll-Mecak and Val, 2005). A recent study using Drosophila melangaster revealed that these two proteins both localize to mitotic cen trosomes and the spindle microtubules. These proteins are thought to releas e minus end microtubules from -tubulin nucleating complex and induce the poleward flux utili zed during metaphase to pull chromosomes to the poles. In

PAGE 24

24 addition to being targeted to centrosomes, in this system, katanin is also highly abundant at the kinetechores of chromosomes. Therefore, a model in which spastin/fridgetin severs microtubules from the stable -TURC cap allowing the destabilizing affect of a destabilizing kinesin has been proposed. Meanwhile, katanin severing at the plus end of the microtubule eliminates the GTP cap and allows the destabiliz ing of the plus end to drag the chromosome poleward. However, Drosophila and Caenorhabditis elegans are the only systems in which katanins chromosomal localizati on have been observed (Zhang et al ., 2007). Mutation of Microtubule Regulators The importance of MAPs is perhaps, best illustrated by observing individuals in which they are not functioning properly. Neuronal tissue is highly enrich ed in microtubules, therefore, phenotypes of mutant MAP is very likely to manife st as neurological disorders. One of the most researched neurological disorders is Alzheimers Di sorder (AD). Physical manifestations of this disorder are characterized by progr essive memory loss, a loss of the ability to learn, reason and inability carry out day to day activities. At th e cellular level, AD is characterized by selective loss of neurons and the formation of amyloidal pl aques and neurofrillary tangles (NFTs). These NFTs are composed of hyperphosporylate tau, a MAP involved in microtubule stabilization. A major source of controversy has been whether or not the NFTs were responsible for memory lose. Using a repressibly expresse d, mutant form of tau, Santa Cruz et al. (2005) showed that the mutant tau caused memory loss. Repressing expr ession of the mutated form of tau, even after NFTs formed, led to memory restoration. These encouraging findings suggest that tau may be a possible drug target in the treatment of AD. Alterations of spastin can manifest as a ne urological disorder known as Hereditay Spastic Paraplegia (HSP) in humans. HSP is a term used to encompass numerous neurodegerative

PAGE 25

25 disorders characterized by progressive lower limb spasticity and weakness due to the degeneration of neurons in the corticospinal tracts and dorsal tracts (McDermott et al. 2000). The spastin gene in humans contains a N-term inal microtubule binding domain, C-terminal AAA domain, an endosomal trafficking domain, as well as nuclear loca lization signal and a transmembrane domain (Ciccarelli et al ., 2003; Beetz et al ., 2004). Mutations at the spastin gene locus make up to 40% of all HSP cases. The majo rity of the cases are due to mutations within the AAA domain of spastin (Hazan et al ., 1999). Evaluation of a mutation in the AAA domain of spastin revealed that the mu tant protein binds microtubules a bnormally and is unable to sever them. This abnormal microtubule interaction bl ocks organelle transport, including mitochondria and peroxisomes (McDermott et al ., 2003). Interestingly, this HSP cellular phenotype is very similar to what is seen in KIF5A mutants. No treatments exist to cure or delay HSP progression. However, some of the symptoms can be relieved with antispastic drugs such as Badofen, which bind GABA receptors reducing the excitability transmission and spastic movement. Mutations affecting microtubule associated mo tor proteins and their interactions with their cargo can also cause in dis ease states in humans. Microtubul e associated motor proteins are responsible for the transport of vesicle-bound cargo and organe lles along microtubules. These motor proteins fall into two categories; kinesins and dyneins. Huntington is an example of a human disease whose underlying cause is a mutati on that affects the binding of dynein to its cargo. In this case, the cargo is the vesicle bound brain-derived neurot rophic factor (BDNF), which supports the survival of neurons and prom otes growth and differe ntiation of new neurons and synapses. The Huntington gene (Ht) enco des a subunit that intera cts forming a complex with dynactin. The complex mediates the attachme nt of vesicles to dynein. Huntington Disease (HD) is caused by mutations that result in an increase the length of polyglutamine (poly Q)

PAGE 26

26 repeat. This poly Q extended Ht protein is cleaved by numerous prot eases creating short Nterminal poly Q fragments. In addition to the blocking transport of BDNF, these poly Q fragments are extremely toxic to the cell (Wellington et al. 2000; Gafni et al ., 2004). In the disease state, the proteosome is impaired a nd the poly Q fragments fo rm aggregate. The combination of BDNF deficiency and toxic aggregates results in the expression of HD symptoms. The indicative symptoms are invo luntary movements, personality changes, and dementia. There are currently no treatments that cure or delay HD progression. However, there are some promising new potential theurapeutic areas. Recent studies show that phosphorylated Arfaptin two inhibits poly Q toxicity by rescui ng the proteosome impairment in neuronal cell cultures (Rangone et al. 2005; Peters et al. 2002). Additionally, Coufal et al (2007) developed a novel high-throughput assay to iden tify small molecules that could be selectively targeted to the toxic poly Q fragments in cell culture. Several compounds were id entified. The lead compound, described only as A31, was identified that selectively targeted the mutant polyQ but not normal Ht and could rescue the cel ls from mutant poly Q toxicity. Hypothesis and Organization of This Thesis Regulation of the plant microtubule cytoskeleton is not well understood. Only recently has significant progress been made in identifying MAPs that function in stabilizing microtubules in plants. Of the MAPs identified so far, most ar e unique to plants, implying novel mechanisms of microtubule regulation. In this pr oject we have three goals. The first goal was to identify loci involved in cell shape, a microt ubule regulated process. The second goal was to examine its expression patterns. Lastly, we wanted to identif y new interaction partners that were involved in generating cell shape in plants

PAGE 27

27 CHAPTER 2 CLONING OF FRC2, A GENE INVOLVED IN TRICHOME MORPHOGENESIS Abstract It has long been suspected that the cell wall and the mi crotubule cytoskeleton, two major contributors to cell shape, are in timately connected. Cell wall fibe rs called cellulose microfibrils coalign with microtubules. Treatme nt of plant cells with microt ubule destabilizing drugs results in disorganized. However, direct genetic evid ence of this connection has been lacking. Several microtubule mutants have been identified with normal cell walls. Likewise, numerous cell wall mutants have been identified with normal microtubul e cytoskeleton. This is probably due to redundant gene function. Using Arabidopsis trichomes as a model system, we identified the furca2 ( frc2 ) mutation, which results in a change in trichome shape. Here we describe the cloning of the FRC2 gene. FRC2 encodes a katanin-like protein, and is allelic to FRA2, BOT1, ERH3, and LEU1 Katanins are mictotubule severing pr oteins. Katanin mutants have been shown to have an altered microtubule cytosk eleton, abnormal cell wa lls, and several other mutant phenotypes. Introduction A central objective in plant biology is unde rstanding the underlying mechanisms of cell shape. Plant cells are limited in the shapes they can obtain due to the physical properties of the cell wall. Therefore, plants must coordinate areas of cell expansion with localized alterations in cell wall structural components such as cellulose hemicellulose, and ligni ns. Cellulose is the primary structural component of the cell wall. It gives the cell wall its characteristic rigidity and inflexibility. Hemicellulose is instrumental in providing the cell wall with flexibility. Hemicellulose function as crosslinke rs that bundle the cellulose fibe rs together. Several proteins have now been identified with th e ability to alter the interactions of these structural proteins,

PAGE 28

28 thereby, influencing the direction of cell expansion. One such fam ily of proteins is expansin. Sequence analysis has revealed thirty-six expans ins or expansin-like proteins in the sequenced Arabidopsis genome (Li et al ., 2002). Expansins are believed to induce a pH dependent, cell wall loosening by interfering with the noncovalent interactions of cellulose microfibrils with each other, with hemicellulose, and perhaps, with other cell wall materials (Sampedro and Cosgrove, 2005; McQueen-Mason and Cosgrove 1994; McQueen-Mason and Cosgrove, 1995). A second protein involved in ce ll wall loosening is xyloglucan endotransglycosylase (XET). XETs are members of the glycoside hydrolase fa mily of proteins. Unlike expansins, XETs generate cell wall loosenings due to enzymatic activity. XETs break the covalent bonds of xyloglucan; a hemicellulose, allowing the cell wa ll to expand. After ce ll expansion, the bond is transferred by XET to a sugar molecule rec onstituting the rigid cell wall (Smith and Fry, 1991; Xu et al ., 1995; Purugganan et al ., 1997; Campbell and Braam, 1999). The cell wall also contains other families of proteins whose functions are critical to cell wall assemblage and remodeling. These include protease, per oxidases, esterases, and glycosidases. Cellulose microfibrils are the structural load -bearers of the cell wall, consequently they are major factors in cell shap e. Therefore, understanding ho w cellulose microfibrils are manufactured is fundamental to deciphering the mechanisms involved in morphogenesis. Ten genes have been identified in Arabidopsis that af fect the quantitiy and/or quality of cellulose microfibrils. They belong to the cellulose synthase (CesA) superfamily of proteins in Arabidopsis and are named AtCesA1-10. (Arioli et al ., 1998; Peng et al ., 2000; Fagard et al ., 2000; Tayler et al ., 1999; Burn et al ., 2002). These genes encode gl ycosyltransferases. Rosettelike terminal complexes, also knows as cellulose synthase, existing within the cell membranes of plants are correlated with cellulose synthesis. These complexes are composed of six catalytic

PAGE 29

29 subunits (Tsekos et al ., 1999; Doblin et al ., 2002). Mutations in At CesA1 (root swelling 1 or rsw1 ) disrupt this rosettelike structure suggesting that Atces1 may be a cataly tic sunit (Arioli et al. 1998; Peng et al ., 2000). At the very least it is an integral component of the rosette structure. In addition, the coordinated transc ription of three CesA genes in several plant species, as well as, yeast two-hybrid data showing th at CesA genes form homo and heterodimers, suggesting that CesA genes interact to form the rosette termin al complexes within the cell membrane (Tanaka et al ., 2003; Burton et al. 2004). Korrigan ( KOR1 ), a -4 endoglucanse, is thought to process the newly formed cellulose microfibrils, after it s synthesis by the rosette terminal complex, but before it has been deposited into the cell wall (Peng et al ., 2002). KOR1 is also thought to associate with the rosette terminal complex or located within the cells outer membrane face where it can process the newly formed microfibrils (Peng et al ., 2002). However, convincing data supporting this hypothesis is lacking. Microtubules are fundamental in generating cell shape in plants. Several lines of evidence suggest that microtubules are able to influence cells shap e by directing the placement of the rosette terminal complexes within the cell membrane. Cellulose microfibrils and microtubules are both oriented pa rallel to the axis of elongatio n (Ledbetter and Porter, 1963). Treatment of plant cell with the microtubule de stabilizing drugs results in disorganized microfibrils (Green 1962; Giddings a nd Staehelin, 1991; Baskin, 2001; Debolt et al ., 2007). Recently, Paradez et al (2006), demonstrated by co-expressi ng YFP fused CesA6 (YFP:CesA6) and CFP fused Tau (CFP:TAU), that the microt ubule array influences the positioning rosette terminal complex within the cell membrane in live cells. Their study, as well as cellulose and microtubule mutant characterization, suggests the rosette terminal complex position in the membrane can be uncoupled from microtubule positioning (Sugimoto et al ., 2003). To gain a

PAGE 30

30 clearer understanding of the relationship that exists between microtubules and rosette terminal complexes, more genes involved in this pathway need to be identified. Using the single-celled trichomes of Arabidopsis as a model system, the furca 2 mutation was identified in a mutant screen to identify genes involved in tric home morphogenesis (Luo and Oppenheimer, 1999). The frc2 mutation results in a reduced number of trichome branches, and therefore affects the shape of the cell. Additionall y, mutant plants exhibit global defects including fragile stems, ectopic root hairs, and partially sterility. Here we de scribe the cloning of FRC2 The FRC2 gene encodes the p60 subunit of the Arabidopsis katanin-like protein and is allelic to FRA2 BOT1 ERH3 and LEU1 ( Burk et al ., 2001; Bichet et al ., 2001; Webb et al ., 2002; Bouquin et al ., 2003). The katanin-like protein is im plicated in several cellular processes including cell wall biosynthesis (Burk et al ., 2001). Methods and Materials Plant Strains and Growth Conditions The F2 family used in this study was generated by crossing a frc2-1 homozygote in Columbia background to wild-type Landsberg er ecta (Luo and Oppenheimer, 1999). Plants were grown under constant illuminati on as previously described (K rishnakumar and Oppenheimer, 1999) and fertilized twice with a complete nutrient solution (Pollock and Oppenheimer, 1999). Genetic Mapping The FRC2 gene was cloned using a map-base d cloning strategy. The rough map position was obtained by Luo and Oppenheimer (1999). For fine mapping, DNA polymorphisms Cereon Genomics database was used to generate SSLP markers. The following primers were used for fine mapping: Nga 280, F-CTGATCTCACGGACAATAGTGC, RGGCTCCATAAAAAGTGCACC; AthATPas e, F-CTGGGAACGGTTCGATTCGAGC, RGTTCACAGAGAGACTCAT AAACAA; SNP142, F-TTC GTTCTGCTTCCGAGCTT

PAGE 31

31 A, R-CCTGAAGCATCGTCACATTT; SNP 253, F-GAATCATCTGTCCACGA, R-AC ACATACATATGCACGGCAAG, F23A5, R-TACCGGAAGTGGTAAGAGATGA, F-ATGGGAACCTAACTCTGG CTTA. DNA from 202 F2 frc2-1 plants was isolated from leaves using DNA isolation kits (Sigma XNAPS) and analyzed. Sequencing FRC2 and Sequence Anaylsis To identify the frc2-1 mutation, the FRC2 coding sequence was amplified from frc2-1 mutants using Pfu polymerase (S tatagene 600153). Primers were designed based on Columbia wildtype sequence. The amplification condi tions were as follows: 1 minute at 94 C, followed by 35 cycles of 45 seconds at 94C, 45 seconds at 54C, 1 minute at 72C, then a final extension at 72C for 10 minutes. PCR products were cleaned using a PCR pur ification kit (Qiagen 28106). Sequencing was performed by Aubur n Sequencing Center. The Blast search program was used for sequence analysis and comparison in th e GenBank, EMBL, and SwissPort databases. Results The FRC2 gene was isolated using a map-ba sed cloning strategy. The F2 mapping population was created by crossing frc2-1 homozygotes, in the Columbia background, to wildtype Landsberg erecta Luo and Oppenheimer (1999) roughly mapped the frc2-1 mutation approximately 12cM south of classical marker cer5, and south of SSLP marker on chromosome 1. Fine mapping with additional SSLPs placed the mutation on BAC F5I6 (Figure 2-1). The katanin-like protein was a strong candidate gene and therefore sequence from the frc2-1 mutant. frc2-1 was found to contain a mutation that resulted in G to A transition re sulting in a threonine (T) changing to an isoleucine (I).

PAGE 32

32 FRC2 g ene identified b y positional cloning NGA 280 (83.83) ATPASE (117.6)SNP 253 (120.41)124 125.8 127.5F23A5 (132.5) 40 recomb/400 10cM 14/400 3.5cM FRC2 F23A5 F5I6 Figure 2-1. Schematic of Positional Cloning of FRC2 Discussion The frc2 mutation was identified in a screen to for loci that affect trichome morphogenesis. Wild-type trichomes are single-celled with approx imately 80% composed of three branches and 20% four branched tricomes. In frc2-1 mutants there are 60% two branched trichomes and 40% three branched trichomes (Luo and Oppenheimer, 1999) Here we report the identification of the katanin-like protein, and is allele to FRA, BOT1, ERH3, and LEU1 Like erh3 and leu1 mutant alleles, the frc2 mutation is located within the ATP binding domain of the protein. The fra2 mutation results in an early stop codon 37 amin o acids downstream of the ATP binding domain and may affect the ATP binding domain. The ka tanin-like protein has been shown to be involved in cell wall biosynthesis, as well as, other cellular processes in Arabidopsis (Burk et al ., 2001; Bichet et al ., 2001; Webb et al ., 2002; Bouquin et al ., 2003). Microtubules, and the cellulose microfibrils of the cell wall, cooperate to influence th e final shape of cells in plants. However, little is known about the underlying m echanisms, nor the proteins involved in this

PAGE 33

33 process. The identification of katanin, a microtubule severing protein, that al so has a role in cell wall biosynthesis, could provide insi ghts into the mechanistic side of this interaction. Plants lack distinct MTOC similar to the cen trosomes found in animal cells. However, there is evidence that the nuclear envelope and the cell cortex serve as microtubule orga nizing centers (Liu et al., 1994; Erhardt et al., 2002; Hasezawa et al., 2000; Selt zer et al., 2003; Pastuglia et al., 2006). Wasteneys (2002) postulated that katanin severs th e minus ends of microt ubule in the cell cortex providing short microtubules that can be bundled and transported to areas of rapid growth and serve as seeds for microtubule polymerization. These newly polymerized microtubules then are predicted to participate in cell wall biogenesis by guiding the cellulose rosette terminal complex within the cell membrane. Alte rnatively, these katanin generated, bundled microtubules, themselves may play an important ro le in positioning of th e rosette structure and cellulose synthesis and stabiliza tion. Overexpression of katanin, leads to an increase in bundling of microtubule supporting both hypothe sis (Stoppin-Mellet et al., 2006). However, the cellulose synthase complex has recently been shown in living cells to pre dominantly associate with these bundled microtubules, suggesting their stability may be necessary for cellulose production. Katanin is the only microtubule severing pr otein discovered in pl ants to date. Its discovery has provided new insights into the relationship that exists between cellulose microfibrils and microtubules. Furthermore, it has generated new hypotheses concerning the underlying mechanisms of how plant cells gene rate shapes. Furthe r, studies identifying expression patterns and identifying interaction part ners of katanin may provide a clearer picture of the mechanisms.

PAGE 34

34 CHAPTER 3 KATANIN EXPRESSION DU RING DEVELOPMENT Abstract Katanins are microtubule severi ng proteins. In plants they are involved in microtubule regulation, cell wall biosynthesis, cell differentiation, and gibberi llic acid signaling. Katanins involvement in these processes is not well unde rstood. To gain a bett er understanding of katanins role during cell mor phogenesis and plant development, we examined its expression during development. We found that FRC2 the Arabidopsis katanin, is expressed in meristematic tissues and leaf primodia, suggesting a role in rapidly dividing cells. In addition, we also saw high expression in the growing tips of developi ng trichomes and througho ut the cytoplasm of mature trichomes, consistant with the frc2 mutant trichome phenotype Furthermore, we saw katanin expression in vascular tissue and developing ovules, implyi ng its role in vascular and ovule development. Introduction Katanins are microtubule se vering proteins (McNally and Vale, 1993). They are heterodimeric proteins, composed of 60 kDa a nd 80 kDa subunits. In animal model systems, they are involved in mitosis-dependent microtubul e severing. In contrast, katanins activity does not appear to be critical in the regul ation of microtubules during mitosis in Arabidopsis a plant model system (Burk et al. 2001). Instead, in plants they ar e involved in cell wall biosynthesis and consequently cell shape (Burk et al ., 2001, 2002; Paradez et al ., 2006a; Paradez et al., 2006b). Mutant analyses have also shown that katanin is involved in the gibberillic acid pathway and in cell identity in roots (Webb et al. 2001). However, its role in both these pathways is not clear.

PAGE 35

35 We identified the katanin gene as part of a mu tant screen to identify genes with roles in trichomes morphogenesis. Trichomes usually ha ve 3-4 branched tric homes. Mutations in FRC2 the only katanin gene locus in Arabidopsis, resulted in reduction in trichome branch number. Katanin has been shown to be e xpressed in all major organs of Arabidopsis by RT-PCR and mutation in this gene has global effects (Burk et al ., 2001; Webb et al ., 2002). To better understand katanins role in trichome development and morphogenesis, we are interested in its expression in developing trichomes. We are usi ng in situ hybridization to observe katanins expression. Methods and Material in situ RNA hybridization was performed according to Vielle-Calzada et al (1999) with a few modifications. Katanins co ding sequence was used as a temp late to generate the probe. The primers used were: F-TTTTTCAG CCCTTGGATGAGTATC, R-TAATAC GACTCACTATAGGGGTCCCTCATACAATCC. The T7 RNA polymerase initiation sequence was placed in front of the reverse primer s, allowing direct synthesis of digoxigeninlabeled probe from the PCR product. The template for the sense probe was amplified using TAATACGACTCACTATAGGGTTTTTCAGCCCTTGGATGAGTA TC and TCCCTCATACAATCC. R NA probes were synthesized using the Dig-labeling kit (Roche Applied Science). The 334-bp cRNA pr oducts were synthesized and added to the hybridization solution, so the fi nal concentration was 500 ng/mL. Sections were generated using a Leica RM 2255 microtome and slides were hybridized at 45C and washed at 50C. 1mM levamisole (Sigma) was added to Western Blue s ubstrate (Promega) for color detection. Slides were observed under bright-field and DIC optic s and images were captured as previously describe.

PAGE 36

36 Results We performed in situ hybridization on developing trichom es to gain insight into katanins expression during development. Katanin is highly expressed throughout trichome development and in mature trichomes (Figure 3-1C). It is ex pressed at high levels within vascular tissues (Figure 3-1B). Furthermore, we found that it is expressed to a lesser degree in th e shoot apical meristem and floral meristem (Figure 3-1B, 3-1F ). Interestingly, katani n levels are up-regulated in the in the integuments and funiculus (Figure 3-1E). Figure 3-1. A. Sense control. B. RNA hybrid ization of katanin in seedlings. C. RNA hybridization of katanin in developing tr ichomes. D. Sense Control. E. RNA hybridization of katanin in developing ovul es. F. RNA hybridization of katanin in floral meristem. Discussion Microtubules are fundamental to the generation of properly shaped cells in plants. As a result, microtubule regulators are also important in cell morphogene sis. Katanins are microtubule severing proteins and, in plants, they have been shown to be im portant in generating microtubule bundles (Stoppin-Mellet et al ., 2006). Katanins have been sh own to be expressed in leaves,

PAGE 37

37 roots, stems, and flowers (Burk et al., 2001; Webb et al., 2002). To gain greater insight into katanins regulation of microtubul es and its role in cell shape, we wanted to observe its expression in developing trichomes and tissues. We found that kata nin is highly expressed in the growing tips of developing trichomes and throughout the cytoplasm of matu re trichomes. This result supports published data that describes microtubule behavior during trichome development (Mathur and Chua, 2000). Katanin was also ex pressed the shoot apic al meristem, floral meristem, and developing leaves demonstrating its importance in cell expansion in developing tissues. The frc2 mutant phenotype supports this data. Katanin mutants are dwarfs demonstrating that this locus has effects through out development. In addition, its expression in meristems, areas of rapidly divi ding cells, is consistent with it s regulation of microtubules during mitosis. Burk et al (2001) showed that microtubule ar rays behave normally throughout mitosis in somatic plant cells. However, Webb et al (2002) demonstrated th at katanin mutants had misaligned cell files in the root implying its requir ement for proper cell plate formation in roots. In a separate study immunolocalizations showed that katanin localized to spindle poles during mitosis, in a separa te study (McClinton et al ., 2001). It may be that plants have an alternate method of microtubule severing or destabilization that compensa tes for absence of katanin activity in some tissues. This would explain the normal microtubule arra y in one study during mitosis, as well as, the malformed cell files in root s. Additionally, katani n is highly expressed in integuments and funiculus but not the nucellus. Th is may account for the partial sterility seen in katanin mutants. Lastly, we found that katani n was highly expressed in vascular tissue. Recently, rice containing a mutation in the kata nin gene showed altered properties within the vascular tissue. However, the vascular tissue of Arabidopsis katanin mutants has not yet been

PAGE 38

38 evaluated. Its expression in vascular tissues, su ggest that a similar mutant phenotype is probably present in Arabidopsis, also.

PAGE 39

39 CHAPTER 4 ARABIDOPSIS KATANIN PROTEIN BI NDS ZWICHEL, A NOVEL KINESIN Abstract The katanin in Arabidopsis thalian is involved in trichome ce ll morphogenesis. Although it has been shown that katani n regulates or affects microt ubule dynamics and cell wall biosynthesis, the underlying mechanism of how it aff ects cell shape is not clea r. To gain greater insight into this process, we attempted to iden tify katanin interaction pr oteins. Genetic crosses between katanin mutants and other trichome mutant s, revealed an allele specific interaction between Zwichel and katanin. To test whether ka tanin and Zwichel interact we used a yeast two hybrid approach. We found that katanin and Zwichel interact in yeast. Ba sed on this interaction, a number of possible functions are discussed. Introduction Microtubule motors are major components of intracellular movement. They are involved in various aspects of mitosis, organelle and vesicle transport, micr otubule dynamics, and signal transduction (Hirokawa, 1998; Heald, 2000; K line-Smith and Walczak, 2002; Nichihama et al ., 2002). There are two types of mi crotubule motors; dyneins and kinesi ns. Over 60 kinesins have been identified in the Arabidopsi s genome, however, sequence anal ysis has not revealed any dynein homologs (Lee and Liu, 2004; Lawrence et al ., 2004). Conventional kinesins are heterotetramers composed of two heavy chains and two light chains (Bloom et al ., 1988; Kuznetsove et al ., 1988). The heavy chain contains a microtubule binding domain, while the light chain is required for vesicl e interaction (Yang et al., 1990; Cyr et al., 1991; Steinion and Brady, 1997). Although Arabidopsis contains conventional kinesins it also contains numerous plant-specific kinesins. The presence of plant specific kinesins are maybe related to the unique microtubule arrays and organelles that have evolved in plants. Similar to microtubule mutants,

PAGE 40

40 kinesin mutants can also affect mo rphogenesis in plants. The loss of the activity of a kinesin that is involved in the transport of cell wall protei ns could potentially l ead to inappropriate localization of the proteins, or the absence of proteins essentia l for normal cell wall biosynthesis. The Zwichel ( ZWI ) gene was identified in a screen to identify genes involved in trichome morphogenesis in Arabidopsis (Oppenheimer et al., 1997). The ZWI gene loci encodes a kinesin-like calcium/calm odulin binding protein ( KCBP ). In addition to a calmodulin binding domain, ZWI/KCBP also has a MyTH4 and a talin-like domain, domains found in actin binding proteins, suggesting that the prot ein may be involved in actin a nd microtubule crosstalk. Genetic crosses between zwi and furca 2 ( frc2 ) mutants reveal an allele specific phenotype, suggesting interaction. To test whether ZWI/KCBP and FRC2 gene products interact we are using a yeast two hybrid approach. Method and Materials Yeast two hybrid assay. Full length kata nin and ZWI coding sequence were fused to either yeast GAL4 DNA activation domain (AD) in plasmids pGAD-C (x) or Gal4 DNA binding domain (BD) in plasmids pGBD-C(x) (James et al ., 1996). The yeast strain PJ69-4A (MATa trp1-190 leu2-3,112 ura3-52 his3-200 gal4 ga l80 LYS2::GAL2-ADE2 met2::Gal7-lacZ) was used for yeast two hybrid assays (James et al ., 1996). Plasmids were introduced into PJ69-4A using a lithium acetate transformation method pr eviously described by James et al., 1996 or using yeast transformation kit (Sigma). To test potential protei n-protein interaction, transformants were screened for growth on medium lacking histidine were screened for growth on medium lacking histidine but in the presen ce of 5 mM-3 aminotriazol (3-AT), or lacking adenine or for -galactosidase activity in the presen ce of X-Gal (5-bromo-4-chloro-3-idolyl-Dgalatopyranoside).

PAGE 41

41 Results We utilized the yeast two hybrid assay to test whether there is an interaction between Arabidopsis katanin and ZWI We found that yeast co-transformed with katanin fused to the Activation Domain (AD) of the GAL4 protein, and ZWI fused to the DNA Binding Domain (BD) of the GAL4 protein, grew on selective media and had -GAL activity (Figure 4-1). We got the same results when katanin was fused to BD and ZWI was fused to AD (data not shown). As a control, yeast colonies were co-transformed with vectors that contained katanin fused to the AD and an empty DNA BD vector, or ZWI fused to the DNA BD and an empty AD vector Yeast were selected for the presence of both vectors, then grown on interact ion selective media and tested for X-GAL activity. No colonies grew on the interaction sele ctive media (data not shown), and there was no X-GAL activity (Figure4-1A; Figure4-1B). Figure 4-1. Yeast Two Hybrid Assay of Katanin and Zwichel Note: 1. Control #1. X-GAL Test of 5 randomly picked colonies that were co-transformed with AD-Katanin and BD vector only. 2. Control #2. X-GAL Test of 5 randomly picked colonies that were co-transformed with BD-ZWI and AD vector only. 3. Experiment. X-GAL Test of 5 randomly picked colonies that were co-transformed with AD-Katanin and BD-ZWI.

PAGE 42

42 Discussion The katanin protein has been shown to be invo lved in cell shape in plants (Burk et al., 2001). To gain greater insight into its role in cell morphogenesis, geneti c crosses we performed with katanin mutants and other cell shape mutants. An allele specific interaction was observed between the two proteins. We tested this possi ble interaction using th e yeast two hybrid assay and found that katanin and ZWI interact in yeast. ZWI is a plant specific kinesin i nvolved in trichome morphogenesis in Arabidopsis (Oppenheimer et al., 1997). The ZWI protei n has several notable domains including a calcium/calmodulin binding domain, MyTH4 domain, talin-like domain, and two microtubule binding domains. Calcium and calmodulin are importa nt signaling molecules. The presence of a calcium/calmodulin binding domain suggest ZWI activity is regulated in a signal dependant manner. The MyTH4 and talin-like domains are both domains found in myosin, perhaps indicating actin/microtubule inte ractions (Mathur 2006; Fu Y et al., 2005). During trichome development in Arabidopsis, both actin filaments and microtubules localize to the growing area. Actin and microtubule mutants result in change s in trichome morphogenesis. Similarily, pharmological treatment that disr upts actin or microtubule dynam ics cause changes in trichome shape (Mathur et al., 2000; Szymanski et al., 1999) Therefore, it is hi ghly probable that two networks, that are both involved in the same process provides a means of communication. Bundling assays demonstrated that ZWI bundles microtubules in vitro (Lao et al., 2000). Interestingly, overexpression of katanin al so results in microtubule bundling (Paradez et al ., 2006a, 2006b). It is conceivable that the katanin and ZWI interact to form a complex or as part of a multiprotein complex, in which katanin severs microtubule and ZWI immediately binds and bundles the severed microtubules. These bundled mi crotubules, due to thei r interactions with each other while bundled, are more stable. Furthe rmore, the rosette terminal structures within

PAGE 43

43 the plasma membrane that produce cellular mi crofibrils have been shown to interact predominantly with bundled microtubules (Parad ez et al, 2006a, 2006b). This interaction is thought to be important in the positioning of the cellulose synthase rosset te complex within the membrane and/or for stability of newly formed ce llulose fibers. Mutations at either the ZWI or katanin loci could decrease or eliminate bundl ed microtubules and affect the production of a normal cell wall, therefore affecting cell shape in trichomes. To test whether the katanin and ZWI interaction is needed for microtubule bundling, microtubules could be fluorescently labeled in both mutant backgrounds and observed for cha nges in bundling rates. Alternatively, ZWI may be responsible for proper localization of kata nin along microtubules before severing. In this scenario, mutation in either katanin or ZWI w ould both lead to altera tions of the microtubule cytoskeleton. This is seen with both muta nts. Analysis of ka tanin localization in zwi may help determine whether ZWI is responsible for katani ns localization. Additionally, coexpression of fluorescently labeled katanin and ZWI could dete rmine whether ZWI interacts with katanin to localize it along microtubules.

PAGE 44

44 CHAPTER 5 CONCLUSION AND FUTURE WORK We identified the FRC2 mutation in a screen for mutations that affect trichome morphogenesis in Arabidopsis Here we describe the cloning of FRC2 and revealed that it encodes a katanin, a microtubule severing protein, that has been shown to be involved in multiple cellular processes including cell wall biosynt hesis. Analysis of the expression patterns of katanin revealed a requirement for its activity in meristematic tissues, leaf primordial, vascular development, ovule development, and trichome mo rphogenesis. We also show that katanin interacts with Zwichel, a novel kinesin, that has been shown to be involved in trichome morphogenesis. There are several areas in wh ich to expand our knowledge of katanins function in plants. We showed here that katanin is highly expressed in the vascular tissue. Mutant analysis of rice katanin revealed a vascular phenotype. Examination of Arabidopsis katanin mutants may reveal a similar phenotype. A second area in which to expand knowledge of katanins function in the future is to verify katanin and ZWI interac tion using co-immunoprecip itation. A third area of future work is to identify other potential partne rs of katanin. There are two techniques available to achieve this goal. One method would be to screen Arabidopsis libraries in a yeast two hybrid assay using katanin as the bait. Another met hod would be to utilize a method of trichome isolation described by Zhang et al (2005) and isolate all trichome proteins from wild-type and katanin mutant. Protein profiles could be ge nerated using mass spectrometry of mutant and wild-type. Analysis of these pr ofiles could potentially identify interaction partners and/or reveal pathways in which katanin is involved.

PAGE 45

45 LIST OF REFERENCES Abal, M., Piel, M., Boukson-Castaing, V., M ogensen, M., Sibarita, J.B. and Bomens, M. (2002). Microtubules release from the centr osome in migrating cells. J. Cell Biol. 159, 73137. Aizawa, H., Kawasaki, H., Murofushi, H., Kotari, S., Suzuki, K., and Sakai, H. (1988). Microtubule-binding domain of tau proteins. J. Biol. Chem. 263, 7703-07. Al-Bassam, J., van Breugel, M., Harrison, S.C., and Hyman, A. (2006). Stu2 binds tubulin and undergoes and open-to-closed confor mational change. J. Cell Science 172, 1009-22. Andersen, S.S., Ashford, A.J., Toumebize, R ., Gavet, O., Sobel, A., Hyman, A.A. and Karsenti, E. (1997). Mitotic chromatin regulat es phosphorylation of Stathmin/Op18. Nature 389, 640-43. Arioli, T., Peng, L., Betzner, A.S., Burn, J., Wittke, W., Herth, W., Ca milleri, C., Hofte, H., Plazinski, J., Birch, R., Cork, A., Glover, J., Redmond, J. and Williamson, R.E. ( 1998). Molecular analysis of cellulose biosynthesis in Arabidopsis Science 279, 717-20. Arnal, I., Heichette, C., Diaman topoulos, G.S. and Chretien, D. (2004). CLIP-170/Tubulincurved oligomers coassemble at microtubul e ends and promote rescues. Curr. Biol. 14, 2086-2095. Baskin, T.I. (2001). On the alignment of cellulose mi crofibrils by cortic al microtubules: A review and a model. Protoplasma 215, 150-171. Beettz, C., Brodhun, M., Moutzouris, K., Kiehntopf, M., Berndt, A, Lehnert, D., Bastmeyer, M. and Schickel, J. (2004). Identification of nu clear localization in spastin (SPG4) using a novel Tetra-GFP reporter system. Biochem. Biophys. Res. Commun. 381, 1079-84. Belmont, L.D. and Mitchison, T.J. (1996). Identification of a protei n that interacts with tubulin dimers and increases the catastr ophe rate of microtubules. Cell 84, 623-31. Bernhardt, R. and Matus, A. (1984). Light and electron micros copic studies of the distribution of microtubule-associated protei n 2 in rat brain: a differenc e between dendritic and axonal cytoskeletons. J. Comp. Neuro. 226, 203-221. Binder, L.I., Frankfurter, A. and Rebhun, L.I. (1985). The distribution of tau in the mammalian central nervous system. J. Cell Biol. 101, 1371-78. Bisgrove, S.R., Hable, W.E. and Kropf, D.L. (2004). + TIPs and microtubule regulation. The beginning of the plus end in plants. Plant Physiol. 136, 3855-63. Bhonukshe, P. and Gadells, T.W. Jr. (2003). Alteration of micr otubule dynamic instability during preprophase band formation reveal ed by yellow fluorescent protein-CLIP-170 microtubule plus-end labeling. Plant Cell 15, 597-611.

PAGE 46

46 Bichet, A., Desnos, T., Turner, S., Grandjean, O. and Hofte, H. (2001). Botero1 is required for normal orientation of cortical microt ubules and anisotropic cell expansion in Arabidopsis Plant J. 25, 137-48. Bloom, G.S., Luca, F.C., and Vallee, R.B. (1984). Widespread cellular distribution of microtubule-associated protein 1A in the mitotic spindle and on interphase microtubules. J. Cell Biol. 98, 331-340. Bloom, G.S., Wagner. M.C., Pfister, K.K. and Brady, S.T. (1988). Native structure and physical properties of bovine brain kinesin and identificati on of the ATP-binding subunit polypeptide. Biochem 2 7, 3409-16. Bouquin, T., Mattsson, O., Naeste d, H., Foster, R. and Mundy, J. (2003). The Aradidopsis lue1 mutant defines a katanin p60 ortholog i nvolved in hormonal control of microtubules orientation during cell growth. J. Cell Science 116, 791-01. Burk, D.H., Liu, B., Zhong, R., Morrison, W.H., and Ye, Z.H. (2001). A katanin-like protein regulates normal cell wall bi osynthesis and cell elongation. Plant Cell biosynthesis and cell elongation. Plant Cell 13, 807-27. Burn, J.E., Hocart, C.H., Birch, R.J., Cork, A.C. and Williamson, R.E (2002). Functional analysis of the cellulose synthase genes Ce sA1, CesA2, and CesaA3 in Arabidopsis. Plant Physiol. 129, 797-807. Burton, R.A., Wilson, S.M., Hrmova, M., Harv ey, A.J., Shirley, N.J., Medhurst, A., Stone, B.A., Newbigin, E.J., Bacic, A. and Fincher, G.B. (2006). Cellulose synthase-like CSIF genes mediate the synthesis of cel l wall (1,3;1,4)-B-D-glucans. Science 311, 1940-1942. Caceres, A., Payne, M.R., Binder, L.I. and Steward, O. (1983). Immunocytochemical localization of actin and microt ubule-associated protein MAP2 in dendritic spines. Proc. Natl. Acad. Sci. (USA) 80, 1738-42. Campbell, P. and Braam, J (1999). Xyloglucan endotransglyc osylases: Diversity of gene, enzymes and potential wall-modifyi ng functions. Trends Plant Sci. 4, 361-366. Cassimismeris, L. Gard, D., Tran, P.T. and Erickson, H.P. (2001). XMAP215 is long thin molecule that does not increase microtubule stiffness. J. Cell Sci. 114, 3025-33. Chan, J., Calder, G.M., Doonan, J.H. and Lloyd, C.W (2003). EB1 reveals mobile microtubule nucleation sites in Arabidopsis Nat. Cell Biol. 5, 967-71. Chang-Jie, J. and Sonobe, S. (1993). Identification and prelim inary characterization of 65kDa higher-plant microtubule-associ ated protein. J. Cell Sci. 105, 891-901. Chan, J. Rutten, T. and Lloyd, C. (2005). Isolation of microtubul e-associated proteins from carrot cytoskeletons: a 120 kDa map decorates all four microtubule arrays and the nucleus. Plant J. 10, 251-259.

PAGE 47

47 Chuong, S.D., Good, A.G., Taylor, G.J., Free man, M.C., Moorhead, G.B., and Muench, D.G. (2004). Large-scale identification of t ubulin-binding proteins provides insight on subcellular trafficking, metabolic channeling, and signaling in plant cells. Mol. Cell. Proteomics. 3, 970-83. Ciccarelli, F.D., Proukakis, C., Patel, H., Cross, H., Azam, S ., Patton, M.A., Bork, P. and Crosby, A.H. (2003). The identification of a conser ved domain in both spartin and spastin, mutated in hereditary spastic paraplegia. Genomics 81, 437-41. Coufal, M., Maxwell, M.M., Russel, D.E., Am ore, A.M., Altmann, S.M., Hollingsworth, Z.R., Young, A.B., Housman, D.E. and Kazantsev, A.G. (2007). Discovery of a novel small-molecule targeting selec tive clearance of mutant hunting tin fragments. J. Biomol. Screen 12, 351-60. Curmi, P.A., Andersen, S.S., Lachkar, S., Gave t, O., Karsenti, E., Knossow, M. and Sobel, A. (1997). The statmin/tubulin intera ction in vitro. J. Biol. Chem. 372, 25029-36. Cyr, J.L., Pfister, K.K., Bloom, G.S ., Slaughter, C.A. and Brady S.T. (1991). Molecular genetics of kinesin light chai ns: generation of isoforms by al ternative splicing. Proc. Natl. Acad. Sci. (USA) 88, 1011-18. Debolt, S., Gutierrez, R., Ehrhardt, D.W., Melo C. V., Ross, L., Cutler, S.R., Somerville, C. and Bonetta, D. (2007). Morlin, an inhibitor of cortical microtubule dynamics and cellulose synthase movement. Proc. Natl. Acad. Sci. (USA) 104, 5854-59. Desai, A. and Mitchison, T.J. (1998). Microtubule polymerization dynamics. Annu. Rev. Cell Dev. Biol. 13 :83-117. Desai, A., Verma, S., Mitchison, T.J. and Walczak, C.E. (1999). Kin1 kinesins are microtubule-destabilizing enzymes. Cell 96, 69-78. Doblin, M.S., Kurek, I., Jacob-Wilk, D. and Delmer, D.P. (2002). Cellulose biosynthesis in plants: from gene to rose ttes. Plant Cell Physiol. 43, 1407-20. Evans, K.K, Gomes, E.R., Reisenweber, S.M., Gundersen, G.G. and Lauring, B.P. (2005). Linking axonal degeneration to microtubule remodeling by Spastin-mediated microtubule severing. J. Cell Biol. 168, 599-606. Erhardt, M., Stoppin-Mellet, V., Campagn e, S., Canaday, J., Mutterer, J., Fabian, T., Sauter, M., Muller, T., Peter, C ., Lambert, A.M. and Schmit, A.C. (2002). The Spc98p homologue colocalizes with gamma-tubulin at microtubule nucleation sites and is required for microtubule nucleation. J. Cell Science 115, 2423-31. Fagard, M., Desnos, T., Desprez, T., Goubet, F., Refregier, G., McCann, M., Rayon, C., Vemhettes, S. and Hofte, H. (2000). PROCUSTE1 encodes a cel lulose synthase required for normal cell elongation specifically in roots and dark-grown hypocotyls of Arabidopsis Plant Cell 12, 2409-2424.

PAGE 48

48 Frickey, T. and Lupas, A.N. (2004). Phylogenetic anaylsis of AAA proteins. J Struct. Biol. 146, 2-10. Fu., Y., Ying, G., Zhiliang, Z ., Wasteneys, G. and Yang, Z. (2005). Arabidopsis interdigitating cell growth re quires two antagonistic pathwa ys with opposing action on cell Morphogenesis. 120, 687-700. Furutani, I., Watanabe, Y., Prieto, R., Masuka wa, M., Suzuki, K., Naoi, K. Thitamadee, S., Shikanai, T. and Hashimoto, T. (2000). The SPIRAL genes are required for directional control of cell elongation in Arabidopsis thaliana Dev. 127, 4443-53. Gafni, J., Hermel, E., Wellington, C. L., Hayden, M.R. and Ellerby, L.M. (2004). Inhibition of calpain cleavage of huntingtin reduces toxicitiy: accumulation of calpain/caspase fragments in the nucleus. Biol. Chem. 279, 20211-20. Giddings, T.H. and Staehelin, L.A. (1991). Microtubule-mediated control of microfibril deposition: A re-examination of the hypothesis. In the cytoskel etal basis of plant growth and form, C.W. Lloyd, ed (San Di ego:Academic Press), pp. 85-99. Graef, R., Daunderer, C., and Schliwa, M. (2000). Dictyostelium DdCP224 is a microtubuleassociated protein and a permanent centros omal resident involved in centrosome duplication. J Cell Science 113, 1747-1758. Green, P.B. (1962). Mechanism for plant ce llular morphogenesis. Science 138, 1404-1405. Hartmann, J.J., Mann, J., McNally, K., Okawa, K ., Iwamatasu, A., Thomas, S., Heuser, J., Vale, R.D. and McNally, F.J. (1998). Katanin, a microtubulesevering protein, is a novel AAA ATPase that targets to the centrosom e using a WD40-containing subunit. Cell 93, 277-87. Hasezawa, S., Ueda, K., and Kumagai, F. (2000). Time-sequence observations of microtubule dynamics throughout mitosis in living ce ll suspensions of stable transgenic Arabidopsis direct evidence for the origin of cortical mi crotubule at M/G1 inter phase. Plant Cell Phy 41, 244-50. Hazan, J., Fonknechten, N., Mavel, D., Pa temotte, C., Samson, D., Artiguenave, F., Davoine, C.S., Cruaud, C., Durr, A., Wincke r, P., Brottier, P., Cattolico, L., Barbe, V., Burgunder, J.M., Prudhomme, J.F., Bric e, A., Fontaine, B., Heilig, B. and Holmefeldt, P., Stenmark, S. and Gullberg, M. (2004) Differential func tional interplay of TOGp/XMAP215 and the Kin1 kinesin MCAK duri ng interphase and mitosis. EMBO J. 23, 627-37. Heald, R. (2000). A dynamic duo of microtubul e modulators. Nat. Cell Biol. 2, E11-12. Hirokawa, N., Noda, Y. and Okada, Y. (1998). Kinesin and dynein superfamily proteins in organelle transport and cell di vision. Curr. Opin. Cell Biol. 10, 60-73.

PAGE 49

49 Howard, J. and Hyman, A.A. (2007). Microtubule polymerases and dypolymerases. Curr. Opin. Cell Biol. 19, 31-35. Howell, B., Deacon, H. and Cassimeris, L. (1999).Decreasing oncoprot ein 18/statmin levels reduces microtubule catastrophe and increa ses microtubule polymer in vivo. J. Cell Science 112, 3713-22. Hunter, A.W., Caplow, M., Coy, D.L., Hancock, W.O., Diez, S., Wordeman, L. and Howard, J. (2003). The kinesin-related protei n MCAK is a microtubule depolymerase that forms an ATP-hydrolyzing complex at microtubule ends. Mol. Cell. 11 :445-57. Illenberger, S., Drewes, G., Trinczek, B ., Biernat, J., Meyer, H.E., Olmstead, J.B., Mandelkow, E.M. and Mandelkow, E. (1996). Phosphorylation of microtubuleassociated proteins MAP2 and MAP4 by the protein kinase p1110 MARK. Phosphorylation sites and regul ation of microtubule dynamics. 271, 10834-43. Igarishi, H. Orii, H., Mori, H., Shimmen, T. and Sonobe, S. (2000). Isolation of a novel 190 kDa protein from tobacco BY-2 cells: possibl e involvement in the interaction between actin filaments and microtubules. Plant Cell Physiol. 41 : 920-31. James, P., Halladay, J. and Craig, E.A. (1996). Genomic libraries a nd a host stain designed for highly efficient two-hybrid se lection in yeast. Genetics 144, 1425-1436. Job, D. Valiron, O. and Oakley, B. (2003). Microtubule nucleati on. Curr. Opin. Cell Biol. 15, 111-117. Jourdain, L., Curmi, P., Sobel, A., Pantaloni, D. and Carlier, M.F. (1997). Stathmin: a tubulin-sequestering protein which forms a ternary T2S complex with two tubulin molecules. Biochem. 36, 10817-21. Kao, Y.L., Deavours, B.E., Phelps, K. K., Walker, R.A. and Reddy, A.S. (2000). Bundling of microtubules by motor and tail domains of a kinesin-like calmodulin-binding protein from Arabidopsis: regulation by Ca2+/Calmodulin. Biochem. Biophys. Res. Commun. 267, 20117. Kline-Smith, S.L. and Walczak, C.E. (2002). The microtubule-dest abilizing kinesin XKCM1 regulates microtubule dynamic instab ility in cells. Mol. Biol. Cell. 13, 2718-31. Krishnakumar, S. and Oppenheimer, D.G. (1999). Extragenic suppressors of the Arabidopsis zwi-3 mutation identify new gene that functi on in trichome branch formation and pollen tube growth. Development 126, 3079-3088. Kubota, H., Hynes, G., Carne, A., Ashworth, A., and Willison, K. (1994). Indentificationof the GTP-and ATP-specific binding s ites of tubulin. J. Biol. Chem. 269, 3233-3242. Kuznetsov, S.A., Vaisberg, E.A., Shanina, N.A., Magretova, N.N., Chernyak, V.Y. and Gelfand, V.I. (1988). The quaternary structure of bovine brain kinesin. 7, 353-56.

PAGE 50

50 Larsson, N., Segerman, B., Howell, B., Fr idell, K., Cassimeris, L. and Gullberg, M. (1999). Op18/stathmin mediates multiple region-spec ific tubulin and microtubule-regulating activities. J. Cell Biol. 146, 1289-02. Ledbetter, M.C. and Porter, K.R. (1963). A microtubule in plant cell fine structure. J. Cell Biol. 19, 239-250. Lee, Y-R.J. and Liu, B. (2004). Cytoskeletal motors in Arabidopsis. Sixty-one kinesins and seventeen myosins. Plant Physiol. 136, 3877-83. Lewis, S.A., Tian, G., and Cowan, N.J. (1997). The alpha and beta tubulin folding pathways. Trends Cell Biol. 7, 479-485. Li, Y., Darley, C.P., Ongaro, V., Fleming, A., Schipper, O., Baldauf, S.L. and McQueenMason, S.J. (2002). Plant expansins are a complex mulitgene family with an ancient evolutionary origin. Plant Physiol. 128, 854-64. Liu, B., Joshi, H.C., Wilson, T.J., Stilflow, C.D., Palevitz, B.A. and Snustad, D.P. (1994). gamma-Tubulin in Arabidopsis : gene sequence, immunoblot and immunofluorescence studies. Plant Cell 6, 303-14. Liu, C.M., and Meinke, D.W. (1998). The titan mutants of Arabidopsis are disrupted in mitosis and cell cycle control during seed development. Plant J. 16 21-31. Luo, D. and Oppenheimer, D.G. (1999). Genetic control of trichome branch number in Arabidopsis : the roles of the FURCA loci. Development 126, 5547-5557. Lawrence, C.J., Dawe, R.K., Chri stie, K.R., Cleveland, D.W., Daeson, S.C., Endow, S.A., Goldstein, L.S.B., Goodson, H.V., Hirokawa, N., Howard, J., Malmberg, R.L., McIntosh, J.R., Miki, H., Mitchison, T.J., Okada, Y., Reddy, A.S., Saxton, W.M., Schliwa, M., Scholey, J.M., Vale, R.D., Walczak C.E., Wordeman, L. (2004). A standardized kinesin nome nclature. J. Cell Biol. 167, 19-22. Marklund, U., Brattsand, G., Shingler, V. and Gullberg, M. (1993). Serine 25 of oncoprotein 18 is a major cytosolic target for the mitoge n-activated protein ki nase. J. Biol. Chem. 268, 15039-47. Mathur, J. and Chua, N.-H. (2000). Microtubule stabilization leads to growth reorientation in Arabidopsis trichome. Plant Cell 12, 465-77. Mathur, J., Mathur, N., Kemebeck, B ., Srinivas, B.P. and Hulskamp, M. (2003). A novel localization pattern for an EB1-like protei n links microtubule dynamics to endomembrane organization. Curr. Biol. 13, 1991-97. McClinton, R.S., Chandler, J.S. and Callis, J. (2001). cDNA isolation, characterization, and protein intracellular lo calization of a katanin-like p60 subunit from Arabidopsis thaliana Protoplasma 216, 181-90.

PAGE 51

51 McDermott, C.J., Grierson, A.J., Woods, J.D., Bi ngley, M.m Wharton, S.B., Bushby, K.M. and Shaw, P.J. (2003). Hereditary spastic paraparesi s: disrupted intrac ellular transport associated with spastin mutation. Ann. Neurol. 54 748-59. McNally, F. and Vale, R. (1993). Identification of katani n, an ATPase that severs and disassembles stable microtubules. Cell 75, 419-429. McNally, K.P., Bazirgan, O.A. and McNally, F.J. (2000). Two domains of p80 katanin regulate microtubule severing and spindle pole targeting bu p60 katanin. J. Cell Science 113, 1623-33. McQueen-Mason, S. and Cosgrove, D.J. (1994). Disruption of hydrogen bonding between wall polymers by proteins that induce plant wakk exoension. Proc. Natl. Acad. Sci. (USA) 91, 6574-6578. McQueen-Mason, S. and Cosgrove, D.J. (1995). Expansin mode of action on cell walls: analysis of wall hydrolysis, stress re laxation, and binding. Plant Physiol. 107, 87-100. McElver, J., Patton, D., Rumbaugh, M, Liu, C., Yang, L.J., and Meinke, D. (2000). The TITANS gene of Arabidopsis encodes a protein related to ADP ribosylation factor family of GTP binding proteins. Plant Cell 12, 1379-92. Nishihama, R., Soyano, T., Ishikawa, M., Araki, S., Tanaka, H., Asada, T., Irie, K., Ito, M., Terada, M., Banno, H., Yamazaki, Y. and Machida, Y. (2002). Expansion of the cell plate in plant cytokinesis requires a ki nesin-like protein/MAPKKK complex. Cell 109, 8799. Ohkura, H., Garcia, M.A. and Toda, T. (2001). Dis1/TOG universal microtubule adaptor-one MAP for all? J. Cell Science 114, 3805-12. Oppenheimer, D.G., Pollock, M.A., Vacik, J., Sz ymanski, D.B., Erickson, B., Feldmann, K. and Marks, M.D. (1997). Essential role of a kinesin-like protein in Arabidopsis trichome morphogenesis. Proc. Natl. Acad. Sci. (USA) 94, 6261-66. Paradez, A., Wright, A., and Ehrhardt, D.W. (2006a). Microtubule cortical array organization and plant cell morphogenesis. Curr. Opin. Plant Biol. 9, 571-78. Paredez, A., Somerville, C.R. and Ehrhardt, D.W. (2006b). Visualization of cellulose synthase demonstrates functional as sociation with microtubules. Science 312, 1491-1491. Pastuglia, M., Azimzadeh, J., Goussot, M., Cami lleri, C., Belcram, K., Evrard, J.L., Schmit, A.C., Guerche, P. and Bouchez, D. (2006). Gamma-tubulin is essential for microtubule organization and development in Arabidopsis Plant Cell 18, 1412-25. Peng, L., Hocart, C.H., Redmond, J.W. and Williamson, R.E. (2000). Fractionation of carbohydrates in Arabidopsis root cell walls shows that three radial swelling loci are specifically involved in ce llulose production. Planta 211, 406-14.

PAGE 52

52 Peng, L., Kawagoe, Y., Hogan, P. and Delmer, D. (2002). Sitosterol-beta-glucoside as primer for cellulose synthesi s in plants. Science 29 5, 147-50. Perez, F., Diamantopoulos, G.S.Stalder, R. and Kreis, T.E. (1999). CLIP-170 highlights growing microtubule ends in vivo. Cell 96, 517-27. Peters, P.J., Ning, K., Palacios, F., Bosh ans, R.L., Kazantsev, A., Thompson, L.M., Woodman, B., Bates, G.P. and DSouza-Schorev, C. (2002). Arfaptin 2 regulates the aggregation of mutant huntingt in protein. Nat. Cell Biol. 4, 240-45. Pierre, P., Scheel, J., Richard, J.E., and Kreis, T.E. (1992). CLIP-170 links endocytic vesicles to microtubules. Cell 70, 887-90. Pierre, P., Pepperkok, R. and Kreis, T.E. (1994). Molecular characteriz ation of two functional domains of CLIP-170 in vivo. J. Cell Science 107, 1909-20. Pollock, M.A. and Oppenheimer, D.G. ( 1999). Inexpensive alternative to M&S for selection of Arabidopsis plants in cultures. BioTech. 26, 254-2555. Popov, A.V., Pozniakovsky, A., Arnal, I ., Anthoy, C., Ashford, A.J., Kinoshita, K., Tournebize, R., Hymann, A.A. and Karsenti, E. (2001). XMAP215 regulates microtubule dynamics through two distinct domain. EMBO J. 20, 397-410. Purugganan, M.M., Braam, J. and Fry, S.C. (1997). The Arabidopsis TCH4 xyloglucan endotransglycosylas. Substrate specificity, pH optimum, and cold tolera nce. Plant Physiol. 115, 181-90. Rangone, H., Pardo, R., Colin, E., Girault, J.A., Saudou, F. and Humbert, S (2005). Phosphorylation of arfaptin 2 at Ser60 by Ak t inhibits polyQ-hungti ngtim-induced toxicity by rescuing proteasome impairment. J. Biol. Chem. 280, 22021-28. Rickard, J.E. and Kreis, T.E. (1990). Identification of novel nucleotide-sensitive microtubulebinding protein in Hela cells. J. Cell Biol. 110, 1623-33. Roll-Mecak, A. and Vale, R.D. (2005). The Drosophila homologue of the hereditary spastic paraplegia protein, spastin, severs and disassembles microtubules. Curr. Biol. 15, 650-55. Rommerlaere, H., van Troy, M., Gao, Y., Melki R., Cowan, N.J., Vandekerchove, J., and Ampe, C. (1993). Eukaryotic cytoso lic chaperonin contains t-complex polypeptide 1 and seven related subunits. Proc Natl. Acad. Sci. (USA) 90, 11975-11979. SantaCruz, K., Lewis, J., Spires T., Paulson, J., Kotilinek, L ., Ingelsson, M., Guimaraes, A., DeTure, M., Ramsden, M., McGowan, E ., Forster, C., Yue, M., Orne, J., Janus, C., Mariash, A., Kuskowski, M., Hyman, B., Hutton, M. and Ashe, K.H. (2005). Tau suppression in neurodegenerative mouse model improves memory function. 309, 476-481. Sampedro, J. and Cosgrove D. J. (2005). The expansin superfamily. Genome Biol. 6, 242.

PAGE 53

53 Scheel, J., Pierre, P., Richard, J.E., Diamantopo ulos, G.S., Valetti, C., van der Goot, F.G., Haner, M., Aebi, U. and Kreis, T.E. (1999). Purification and anal ysis of authentic CLIP170 and recombinant fragments. J. Biol. Chem. 274, 25883-91. Sedbrook, J.C., Ehrhardt, D.W., Fisher, S.E., Scheible, W.R. and Somerville, C.R. (2004). The Arabidopsis sku6/spiral1 gene encodes a plus end-localized microtubule-interacting protein involved in directi onal cell expansion. Plant Cell 16, 1506-20. Seltzer, V., Pawlowski, T., Campaqne, S ., Erhardy, M., Evrard, J.L., Herzoq, E. and Schmit, A.C. (2003). Multiple microtubule nucleation s ites in higher plants. Cell Biol. Int. 27, 267-79. Shirasu-Hiza, M., Coughlin, P. and Mitchison, T. (2003). Identification of XMAP215 as a microtubule-destabilizing factor in Xenopus egg extract by biochemical purification. J. Cell Biol. 161, 349-358. Smertenko, A., Saleh, N., Igarashi, H., Mori H., Hauser-Hahnm I., Jiang, C.J., Sonobe, S., Lloyd, C.W. and Hussey, P.J. (2000). A new class of microtubul e-associated proteins in plants. Nat. Cell Biol 2, 750-53. Smith, R.C. and Fry, S.C. (1991). Endotransglycosylation of xyloglucans in plant cell suspensions cultures. Biochem. J. 279, 529-35. Steinborn, K., Maulbetsch, C., Priester, B., Tr autmann, S., Pacher, T., Geiges, B., Kuttner, F., Lepiniec, L., Stierhof, Y.D., Schw arz, H., Jurgens, G., and Mayer, U. (2002). The Arabidopsis PILZ group genes encode tubulin-folding cofactor orthologs required for cell division but not cell growth. Genes Dev. 16, 959-71. Stenoien, D.L. and Brady, S.T. (1997). Immunochemical analysis of kinesin light chain function. Mol. Biol. Cell. 8, 675-89. Stoppin-Mellet, V., Gaillard, J. and Vantard, M. (2006). Katanins se vering activity favors bundling of cortical microtubul es in plants. Plant J. 46, 1009-17. Sugimoto, K., Himmelspach, R., Will iamson, R. and Wasteneys, G. (2003). Mutation or drug-dependent microtubule disruption causes radial swelling wit hout altering parallel cellulose microfibril deposition in Arabidopsis root cells. Plant cell 15, 1414-1429. Szymanski, D.B., Marks, M.D., and Wick, S.M. (1999). Organized F-actin is essential for normal trichome morphogenesis in Arabidopsis Plant Cell 11, 2331-47. Taiz, L. and Zeiger, E (2002). Plant Cells. Funston, J., Emmerson, and Hiebert, S. (eds.), Plant Physiology. p 21-22. Su therland, MA: Sinaer Ass. Tanaka, K., Murata, K., Yamazaki, M., Onosato, K., Miyao, A. and Hirochika, H. (2003). Three distinct rice cellulose synthase cat alytic subunit genes re quired for cellulose synthesis in the secondar y wall. Plant Physiol. 133, 73-83.

PAGE 54

54 Taylor, N.G., Scheible, W.R., Cutler, S., Somerville, C.R. and Turner, S. R. (1999) The irregular xylem3 locus of Arabidopsis encodes a cellulose synthase required for secondary cell wall synthesis. Plant Cell 11, 769-80. Tsekos, I. (1999). The sites of cellulose synthesis in Algae: Diversit y and evolution of cellulosesynthesizing enzyme complexes. J. Phycol. 35, 635-55. Traas, J., Bellini, C., Nacry, P., Kronenberger, J., Bouchez, D. and Caboche, M. (1995). Normal differentiation patterns in plants l acking microtubular preprophase bands. Nature 375, 676-677. Tzafrir, I., McElver, J.A., Liu, C.M., Yang, L.J., Wu, J.Q., Martinez, A., Patton, D.A., and Meinke, D.W. (2002). Diversity of Titan functions in Arabidopsis seed development. Plant Physiol. 128, 38-58. Usui, T., Maekawa, H., Pereira, G., and Sciebel, E. (2003). The XMAP215 homologue Stu2 at yeast spindle pole bodies regulates microt ubule dynamics and anchorage. EMBO J. 15, 4779-93. Vallee, R.B. and Borisy, G.G. (1977). Removal of the projection from cytoplasmic microtubules in vitro by digestion with trypsin. J. Biol. Chem. 252, 377-82. Van Bruegel, M., Drechsel, D., and Hyman, A. (2003). Stu2p, the budding yeast member of the conserved DIS1/XMAP215 family of microt ubule-associated proteins is a plus endbinding microtubule destabi lizer. J. Cell Biol. 161, 359-369. Vasquez, R.J., Gard, D.L., and Cassimeris, L. (1999). Phosphorylation by CDK1 regulates XMAP215 function in vitro. Cell Motil. Cytoskel. 43, 310-21. Vielle-Calzada, J.-P., Thomas, J., Spillane, C. and Grossniklaus, U. (1999). Maintenance of genomic imprinting at the Arabidopsis ME DIA locus requires zygotic DDM1 activity. Genes Dev. 13, 2971-82. Wasteneys, G.O. (2002). Microtubule organization in the green kingdom: chaos or self-order? J. Cell Science 115, 1345-54. Webb, M., Jouannic, S., Foreman, J., Linstead, P., and Dolan, L. (2002). Cell specification in the Arabidopsis root epidermis requires the acti vity of ECOTOPIC TOOT HAIR3-a katanin-p60 protein. Devevelopmrnt 129, 123-31. Weissenbach, J. (1999). Spastin, a new AAA pr otein, is altered in th e most frequent form autosamal dominant spastic paraplegia. Nat. Genet. 23, 296-03. Wellington, C.L., Singaraja, R., Ellerby, L., Savill, J., Roy, S., Leavitt, B., Cattaneo, E., Hackam, A., Sharp, A., Thomberry, N., Nicholsom, D.W., Bredesen, D.E. and Hayden, M.R. (2000). Inhibiting caspase cleavage of huntingtin reduces toxicity and aggregate formation in neuronal a nd nonneuronal cells. J. Biol. Chem. 275, 19831-38.

PAGE 55

55 Xu, W., Puruggannan, M.M., Plisensky, D.H., An tosiewicz, D.M., Fry, S.C. and Braam, J. (1995). Arabidopsis TCH4, regulated by hor mones and the environment, encodes a xyloglucan endotransglycoslase. Plant Cell 7, 1555-67. Yang, J.T., Saxton, W.M., Stewart, R.J., Raff, E.C. and Goldstein, L.S. (1990). Evidence that the head of kinesin is sufficient for fo rce generation and motility in vitro. Science 249, 4247. Zhang, D., Rogers, G.C., Buster, D.W. and Sharp, D.J (2007). Three microtubules severing enzymes contribute to the Pacman-fluz m achinery that moves chromosomes. J. Cell Biol. 177 :231-42. Zhang, X., Grey, P.H., Krichnakumar, S. and Oppenheimer, D.G. (2005). The IRREGULAR TRICHOME BRANCH loci re gulate trichome elongation in Arabidopsis. Plant Cell Physiol. 46, 1549-60. Zheng, Y. Wong, M.L., Alberts, B. and Mitchison, T. (1995). Nucleation of microtubule assembly by a g-tubulin-contatining ring complex. Cell 65, 817-823.

PAGE 56

56 BIOGRAPHICAL SKETCH Stacey Renae Jeffries was born May 23, 1977 in Greensboro, AL. She graduated from Sunshine High School in 1995. After high school, she attended Dekalb Jr. College, in Decatur, GA for two semesters. Stacey then transferred to Stillman College in Tuscaloosa, Alabama where she earned her B.S. in biology in 2000. During 2000, she entered graduate school at the University of Alabama as a student in the Biolog ical Sciences Department. She transferred to the Botany Department of the University of Florida in 2003. The work decribed here was performed in Dr. David Oppenheimers Lab as part of her Master of Science degree. \