<%BANNER%>

Effects of Maggot Mass on Decomposition and Post Mortem Interval Calculations

Permanent Link: http://ufdc.ufl.edu/UFE0021393/00001

Material Information

Title: Effects of Maggot Mass on Decomposition and Post Mortem Interval Calculations
Physical Description: 1 online resource (282 p.)
Language: english
Creator: Swiger, Sonja L
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2007

Subjects

Subjects / Keywords: calliphoridae, chrysomya, diptera, entomology, forensic, ursus
Entomology and Nematology -- Dissertations, Academic -- UF
Genre: Entomology and Nematology thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: I assessed carcass decomposition in the field by observing species composition and distribution and recording maggot mass location and temperature. The species information observed in the field led to the development of a laboratory controlled maggot mass to observe the behavior of the developing larvae. Subsequently Chrysomya rufifacies and Chrysomya megacephala were colonized so that larvae growth rates could be compared. Anterior gut contents were dissected from larvae collected from bear carcasses for DNA typing to determine if the medium (i.e., host) used for larvae development could be identified. Chrysomya megacephala and Chrysomya rufifacies colonies were established to provide insight into the protein needs of adult Chrysomya rufifacies and developmental rates of the ensuing larvae. The Chrysomya megacephala and Chrysomya rufifacies laboratory colonies were reared for five and six generations, respectively. Chrysomya megacephala developed in 24.5 d. First instar larvae were present 1 d after oviposition. Second instar larvae developed 2.5 d after oviposition. The third stadium occurred 6.3 d after oviposition with the onset of pupation 12 d after oviposition. Chrysomya rufifacies developed in 22.7 d. After oviposition first instar larvae were present within the next day, second instar larvae developed 2.3 d later and the third stadium commenced 5.7 d later. The larvae pupated 10 d after oviposition. My study demonstrated that maggot masses formed within a carcass maintain temperatures above ambient throughout larval development. The maggot mass for Bear 3: July 2004 recorded a maximum temperature of 40.59 degrees C which was 11 degrees C higher than the recorded ambient temperature. The maggot mass for Bear 4: September 2004 recorded a maximum temperature of 49.56 degrees C which was 19 degrees C higher than the ambient temperature. The high temperature recorded within a maggot mass suggests the larvae are in fact regulating their developmental rates as opposed to the ambient temperature. The laboratory maggot mass showed minimal behavior changes to the second and early third instar stages from the artificially increased temperatures from the heating element. The larvae developed normally despite the temperature of the element heater but did not feed above the heater when the temperature was excess of 50 degrees C. The larvae preferred to congregate in areas of the medium that recorded temperatures between 32 degrees C and 39 degrees C. The late third instar larvae congregated in smaller masses within the medium (i.e., chicken thighs) above the element heater until reaching the postfeeding-wandering stage. The movement of the larvae within the maggot mass was found to be unpredictable. The larvae are in constant motion within the medium while feeding and while located on the surface of the mass. The mitochondrial DNA sequence data was obtained from the anterior gut contents of Chrysomya rufifacies larvae that had fed on bear tissue. DNA was extracted from the bear tissue and larval gut contents. All bear tissue samples and several of the larvae gut samples were amplified for the cytochrome oxidase subunit I (COI) and cytochrome b gene. The COI sequence identified the specimens DNA but could not identify the host's DNA; therefore the cytochrome b gene was sequenced. The DNA extracted from the larval gut was identified as bear, enabling host identification.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Sonja L Swiger.
Thesis: Thesis (Ph.D.)--University of Florida, 2007.
Local: Adviser: Hogsette, Jerome A.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2009-12-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2007
System ID: UFE0021393:00001

Permanent Link: http://ufdc.ufl.edu/UFE0021393/00001

Material Information

Title: Effects of Maggot Mass on Decomposition and Post Mortem Interval Calculations
Physical Description: 1 online resource (282 p.)
Language: english
Creator: Swiger, Sonja L
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2007

Subjects

Subjects / Keywords: calliphoridae, chrysomya, diptera, entomology, forensic, ursus
Entomology and Nematology -- Dissertations, Academic -- UF
Genre: Entomology and Nematology thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: I assessed carcass decomposition in the field by observing species composition and distribution and recording maggot mass location and temperature. The species information observed in the field led to the development of a laboratory controlled maggot mass to observe the behavior of the developing larvae. Subsequently Chrysomya rufifacies and Chrysomya megacephala were colonized so that larvae growth rates could be compared. Anterior gut contents were dissected from larvae collected from bear carcasses for DNA typing to determine if the medium (i.e., host) used for larvae development could be identified. Chrysomya megacephala and Chrysomya rufifacies colonies were established to provide insight into the protein needs of adult Chrysomya rufifacies and developmental rates of the ensuing larvae. The Chrysomya megacephala and Chrysomya rufifacies laboratory colonies were reared for five and six generations, respectively. Chrysomya megacephala developed in 24.5 d. First instar larvae were present 1 d after oviposition. Second instar larvae developed 2.5 d after oviposition. The third stadium occurred 6.3 d after oviposition with the onset of pupation 12 d after oviposition. Chrysomya rufifacies developed in 22.7 d. After oviposition first instar larvae were present within the next day, second instar larvae developed 2.3 d later and the third stadium commenced 5.7 d later. The larvae pupated 10 d after oviposition. My study demonstrated that maggot masses formed within a carcass maintain temperatures above ambient throughout larval development. The maggot mass for Bear 3: July 2004 recorded a maximum temperature of 40.59 degrees C which was 11 degrees C higher than the recorded ambient temperature. The maggot mass for Bear 4: September 2004 recorded a maximum temperature of 49.56 degrees C which was 19 degrees C higher than the ambient temperature. The high temperature recorded within a maggot mass suggests the larvae are in fact regulating their developmental rates as opposed to the ambient temperature. The laboratory maggot mass showed minimal behavior changes to the second and early third instar stages from the artificially increased temperatures from the heating element. The larvae developed normally despite the temperature of the element heater but did not feed above the heater when the temperature was excess of 50 degrees C. The larvae preferred to congregate in areas of the medium that recorded temperatures between 32 degrees C and 39 degrees C. The late third instar larvae congregated in smaller masses within the medium (i.e., chicken thighs) above the element heater until reaching the postfeeding-wandering stage. The movement of the larvae within the maggot mass was found to be unpredictable. The larvae are in constant motion within the medium while feeding and while located on the surface of the mass. The mitochondrial DNA sequence data was obtained from the anterior gut contents of Chrysomya rufifacies larvae that had fed on bear tissue. DNA was extracted from the bear tissue and larval gut contents. All bear tissue samples and several of the larvae gut samples were amplified for the cytochrome oxidase subunit I (COI) and cytochrome b gene. The COI sequence identified the specimens DNA but could not identify the host's DNA; therefore the cytochrome b gene was sequenced. The DNA extracted from the larval gut was identified as bear, enabling host identification.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Sonja L Swiger.
Thesis: Thesis (Ph.D.)--University of Florida, 2007.
Local: Adviser: Hogsette, Jerome A.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2009-12-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2007
System ID: UFE0021393:00001


This item has the following downloads:


Full Text

PAGE 1

EFFECTS OF MAGGOT MASS ON DECOMPOS ITION AND POST MORTEM INTERVAL CALCULATIONS By SONJA LISE SWIGER A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2007

PAGE 2

2007 Sonja Lise Swiger 2

PAGE 3

To my mother and father, who s acrificed so much for my education and for whose support I am deeply grateful. I also dedicate this work to my beautiful so n and husband who have given such meaning to my life. 3

PAGE 4

ACKNOWLEDGMENTS I extend my deepest gratitude to my supervisory chairman, Dr. Jerry A. Hogsette, for his guidance, assistance and dedication in this research. Dr. Hogsette had graciously provided me with the equipment, location and resources necessary to complete this project. I also extend my gratitude to Dr. J. F. Butler for his direction, insight and expertise in this research. Appreciation is expressed to Dr. J. E. Maruniak, Dr. C. R. R. Connelly, and Dr. A. Fa lsetti for serving on my supervisory committee and contributing to the completion of this dissertation. A special thanks to the staff of the Ento mology and Nematology department for their assistance, guidance and support over the years. 4

PAGE 5

TABLE OF CONTENTS page ACKNOWLEDGMENTS...............................................................................................................4 LIST OF TABLES................................................................................................................. ..........8 LIST OF FIGURES.......................................................................................................................10 ABSTRACT...................................................................................................................................19 CHAPTER 1 FORENSIC ENTOMOLOGY LITERATURE REVIEW......................................................21 Introduction to Forensic Entomology.....................................................................................21 Definition of Forensic Entomology.................................................................................21 Historical Uses of Forensic Entomology.........................................................................21 Uses of Forensic Entomology.................................................................................................24 Post Mortem Interval (PMI) Determination....................................................................25 Definition of PMI.....................................................................................................25 PMI based on succession pattern.............................................................................26 Age determination of larvae for PMI.......................................................................27 PMI altering circumstances......................................................................................27 Succession Patterns.........................................................................................................30 Definition of succession patterns.............................................................................30 Stages of decay.........................................................................................................32 Succession altering circumstances...........................................................................33 Thermal Energy...............................................................................................................35 Importance of temperature.......................................................................................35 Formulas and diagrams............................................................................................37 Circumstances altering temperature.........................................................................38 Maggot Mass Temperature..............................................................................................39 Definition of a maggot mass....................................................................................39 Using maggot mass temperature to calculate PMI...................................................40 Use of Aquatic Insects.....................................................................................................42 Unconventional Uses of Arthropods...............................................................................42 Preservation Techniques..................................................................................................44 Chrysomya rufifacies ..............................................................................................................44 History and Background..................................................................................................44 Arrival and Proliferation throughout the United States...................................................45 Behavior..........................................................................................................................46 Taxonomy........................................................................................................................47 DNA............................................................................................................................ ............53 Benefits of DNA in Forensic Science.....................................................................................54 Importance of DNA in Forensic Entomology.................................................................56 5

PAGE 6

DNA Typing of Gut or Blood Meal Contents.................................................................60 Microsatellite DNA.........................................................................................................63 Bear Microsatellite DNA Research.................................................................................63 2 DEVELOPING Chrysomya BLOWFLY COLONIES...........................................................66 Introduction................................................................................................................... ..........66 Methods and Materials...........................................................................................................67 Results.....................................................................................................................................69 Discussion...............................................................................................................................71 3 FIELD STUDIES................................................................................................................ ....78 Introduction................................................................................................................... ..........78 Methods and Materials...........................................................................................................80 Bear 1 May 2003..........................................................................................................83 Bear 2 December 2003.................................................................................................83 Bear 3 July 2004...........................................................................................................84 Bear 4 September 2004................................................................................................84 Repeated Species Composition on a Single Host............................................................84 Statistics...........................................................................................................................85 Results.....................................................................................................................................85 Field Maggot Mass..........................................................................................................85 Bear 3 July 2004...........................................................................................................85 Bear 4 September 2004................................................................................................86 Species Composition.......................................................................................................87 Weather Data...................................................................................................................92 Repeated Species Composition on a Single Host............................................................93 Discussion...............................................................................................................................95 Field Maggot Mass..........................................................................................................95 Species Composition.......................................................................................................97 Repeated Species Composition on a Single Host..........................................................101 4 EXAMINING THE MAGGOT MASS................................................................................136 Introduction................................................................................................................... ........136 Methods and Materials.........................................................................................................137 Hanging Meat Maggot Mass Studies............................................................................137 Laboratory Maggot Mass Studies..................................................................................138 Maggot Mass Behavior in Re ference to Temperature...................................................140 Maggot Mass Movement in Reference to Temperature................................................141 Statistics.........................................................................................................................143 Results...................................................................................................................................143 Hanging Meat Maggot Mass Studies............................................................................143 Maggot Mass Behavior in Re ference to Temperature...................................................144 Maggot Mass Movement in Reference to Temperature................................................152 Discussion.............................................................................................................................154 6

PAGE 7

7 Hanging Meat Maggot Mass Studies............................................................................154 Maggot Mass Behavior in Re ference to Temperature...................................................156 Maggot Mass Movement in Reference to Temperature................................................159 5 IDENTIFICATION OF BEAR DNA SEQUE NCES IN CARCASSES AND MAGGOT GUTS....................................................................................................................................192 Introduction................................................................................................................... ........192 Methods and Materials.........................................................................................................193 Results...................................................................................................................................197 Discussion.............................................................................................................................198 6 SUMMATION OF RESEARCH..........................................................................................213 Developing Chrysomya Blow Fly Colonies.........................................................................213 Field Studies.........................................................................................................................214 Examining the Maggot Mass................................................................................................217 Host DNA Extracted from the Maggot Gut..........................................................................219 APPENDIX A DAILY TEMPERATURE READINGS FO R MAGGOT MASS BE HAVIOR STUDY...221 B ISOLATION OF TOTAL DNA FROM BEAR TISSUE AND DIPTERAN LARVAE.....256 C GENOMIC DNA ISOLATION OF LARV AE GUT USING DNAzol REAGENT.........257 D CHROMOSOMAL DNA EXTRACTION FROM TISSUE................................................258 E PCR PROTOCOL................................................................................................................. 259 F AGAROSE GEL PROTOCOL.............................................................................................261 G QIAquick GEL EXTRACTION KIT PROTOCOL.............................................................263 H DNA CYCLE SEQUENCING.............................................................................................264 LIST OF REFERENCES.............................................................................................................266 BIOGRAPHICAL SKETCH.......................................................................................................282

PAGE 8

LIST OF TABLES Table page 2-1 The recorded time (days) after adult emergence required for Chrysomya megacephala to reach different developmental stages......................................................76 2-2 Eclosion rates of Chrysomya megacephala and Chrysomya rufifacies eggs and pupae stages to determine survivability within a laboratory colony............................................76 2-3 The recorded time (days) after adult emergence required for Chrysomya rufifacies to reach different developmental stages.................................................................................77 3-1 Descriptive statistics of temperatures (C) recorded for Bear 3 July 2004 throughout decomposition...............................................................................................104 3-2 Daily mean temperatures (C) recorded for Bear 3 July 2004 analyzed with Duncans test to show significance..................................................................................104 3-3 Descriptive statistics of temperatures (C) recorded for Bear 4 September 2004 throughout decomposition...............................................................................................105 3-4 Daily mean temperatures (C) recorded for Bear 4 September 2004 analyzed with Duncans test to show significance..................................................................................106 3-5 Overview of adult Diptera and Cole optera collected during decomposition...................108 3-6 Catalog of adult Diptera collected during decomposition of Bear 1 May 2003...........109 3-7 Catalog of adult Diptera collected during decomposition of Bear 2 December 2003..109 3-8 Catalog of adult Diptera collected during decomposition of Bear 3 July 2004.............110 3-9 Catalog of adult Dipter a collected during decompositi on of Bear 4 September 2004..................................................................................................................................110 3-10 Overview of dipteran larvae collected throughout decomposition..................................111 3-11 Daily minimum, mean and maximum ambient temperatures (C) recorded by FAWN throughout decomposition of Bear 1 May 2003...........................................................116 3-12 Daily minimum, mean and maximum ambient temperatures (C) recorded by FAWN throughout decomposition of Bear 2 December 2003..................................................116 3-13 Daily mean ambient and maggot mass te mperatures (C) recorded for Bear 5 August 2002 throughout decomposition..........................................................................135 4-1 Mean daily temperatures (C) recorded throughout decomposition of hanging chicken meat mass...........................................................................................................170 8

PAGE 9

9 4-2 Developmental time (days) for Chrysomya rufifacies larvae reared within laboratory maggot mass experiment at va rying heater temperatures................................................173 4-3 Evaluation of temperature data r ecorded throughout maggot mass behavior experiments conducted at 40C, 45C, 50C, 55C, 60C, 65C and control.................181 5-1 PCR microsatellite primers used with bear tissue DNA templates to distinguish identity.............................................................................................................................205 E-1 Order of addition of reagents in a reaction mix (for 25 l reactions)..............................259 E-2 To prepare a master mix for 5 reactions to amplify the cytochrome oxidase I (COI) gene of mitochondrial DNA (considering that the DNA template will be diluted as necessary in 1 l).............................................................................................................259 E-3 Amounts needed to prepare a master mix fo r 5 reactions to amplify the cytochrome b gene of mitochondrial DNA (considering that the DNA template will be diluted as necessary in 1 l).............................................................................................................260

PAGE 10

LIST OF FIGURES Figure page 1-1 Chrysomya megacephala adult female reared in th e laboratory colony, top view............50 1-2 Chrysomya megacephala female reared in the labor atory colony, side view....................50 1-3 Complete life cycle (eggs, 1st instar, 2nd instar, 3rd instar, post-feeding 3rd instar, pupa, and male adult) of Chrysomya megacephala...........................................................51 1-4 Female Chrysomya rufifacies adult reared in the labor atory colony, from above.............51 1-5 Chrysomya rufifacies adult female reared in the laboratory colony, side view.................52 1-6 Complete life cycle (eggs, 1st instar, 2nd instar, early 3rd instar, 3rd instar, post-feeding 3rd instar, pupa, and adult) of Chrysomya rufifacies ..........................................................52 2-1 The Ziploc container used to rear developing Chrysomya megacephala and Chrysomya rufifacies larvae from egg to wandering larvae stage.....................................75 2-2 Fly colony insect rearing cage for adult maintenance with water, sugar and powdered milk....................................................................................................................................75 2-3 Newly laid eggs mass and devel oping early first instar larvae..........................................77 3-1 Daily temperature means plotted against time for Bear 3 July 2004............................103 3-2 Mean growth rate of Chrysomya rufifacies and mean maggot mass temperature for Bear 3 July 2004...........................................................................................................103 3-3 Mean growth rate of Chrysomya rufifacies and mean maggot mass temperature for Bear 4 September 2004.................................................................................................105 3-4 Daily temperature means plotted against time for Bear 4 September 2004.................107 3-5 Composition of larvae collected during decomposition from Bear 1 May 2003..........112 3-6 Composition of larvae collected during decomposition from Bear 2 December 2003..................................................................................................................................113 3-7 Composition of larvae collected during decomposition from Bear 3 July 2004...........114 3-8 Composition of larvae collected during decomposition from Bear 4 September 2004..................................................................................................................................115 10

PAGE 11

3-9 First observation of Bear 2 December 2003 made on December 12, 2003 around 5:00 PM............................................................................................................................117 3-10 Bear 2 December 2003 ten days after de ath, because of the cooler temperatures very little decomposition has occurred............................................................................117 3-11 Thirteen days post mortem, very little decomposition is visible on the surface of the bear...................................................................................................................................118 3-12 Larvae are seen feeding beneath the head of Bear 2 December 2003 in the body fluids................................................................................................................................118 3-13 Day 15, surface of the bear is still int act with only one visible hole containing developing dipteran larvae...............................................................................................119 3-14 Close up of developing maggot mass located in the abdominal cavity...........................119 3-15 Several large maggot masses are now visi ble on the surface of Bear 2 December 2003..................................................................................................................................120 3-16 Close up of maggot mass containing Chrysomya rufifacies larvae.................................120 3-17 Eighteen days post mortem, the lower jaw bones are becoming visible because of larval feeding...................................................................................................................121 3-18 Bear 2 December 2003 34 days after de ath, the bear has completed decomposition although fur is still present in some regions....................................................................121 3-19 Arrival of Bear 3 July 2004 at study s ite, the onset of bloat is already present............122 3-20 Second day post mortem, the fur has begun to slough from the abdominal and posterior leg regions.........................................................................................................1 22 3-21 Nicrophorus orbicollis observed inspecting the carcass for developing dipteran larvae................................................................................................................................123 3-22 Fur has begun to slough off the sides of the bear carcass................................................123 3-23 Day 5 post mortem, the skin is now fully exposed and begun to dry from the warm weather........................................................................................................................ .....124 3-24 Close up of a large maggot mass of Chrysomya rufifacies along with several Coleoptera larvae feeding upon the ar m of the Bear 3 July 2004.................................124 3-25 Chrysomya rufifacies maggot mass feeding off of the carcass within the seeping fluids................................................................................................................................125 3-26 Bear 3 July 2004 six days post mortem........................................................................125 11

PAGE 12

3-27 Observation of dipteran larvae (to the right of the picture) developing along side coleopteran larvae (to the left of the picture on the abdomen)........................................126 3-28 Close up of the abdominal cavity with se veral hundred feeding coleopteran larvae present........................................................................................................................ ......126 3-29 Late third instar Chrysomya rufifacies larval mass located to the right of the picture, mingling with Coleoptera larvae......................................................................................127 3-30 Twelve days post mortem, larval activity has ceased as well as adult activity. The ground surrounding the carcass is satu rated with seeping fluids.....................................127 3-31 First observation of Bear 4 Septembe r 2004 made two days post mortem, bloat has already occurred...............................................................................................................128 3-32 The front arm and rear leg are located o ff the ground because of bloating within the abdominal cavity..............................................................................................................1 28 3-33 Several egg masses are located on the side of the bears face al ong with adult flies......129 3-34 Adult flies are congregating at an area of injury made in the skin just above the right leg because of the swelling of the body cavity...............................................................129 3-35 A small mass of dipteran larvae is located on the ground bene ath the snout of the bear were blood and body fluids have accumulated........................................................130 3-36 Five days post mortem, the surface of the carcass has undergone several biological changes such as fur sloughing and drying of the skin.....................................................130 3-37 A large maggot mass of Chrysomya rufifacies is located next to carcass; it extends beneath the dried skin for protection...............................................................................131 3-38 The heat has rendered the skin inhabi table to the developing larvae, which are located beneath the carca ss within the body cavity.........................................................131 3-39 Day 7, the carcass has become withered because of dipteran larval feeding.................132 3-40 Chrysomya rufifacies third instar larvae are presen t feeding beneath the head and mouth of the carcass amongst the fur for pr otection from predators and the weather.....132 3-41 A maggot mass composed of Chrysomya rufifacies larvae is located between the arm and neck of the carcass....................................................................................................133 3-42 Composition of larvae collected during decomposition from Bear 5 August 2002.....134 4-1 Hanging Meat Maggot Mass suspended from steel pole five feet and six inches (1.68 m) above the ground........................................................................................................163 12

PAGE 13

4-2 HOBO temperature probes placed amongst the chicken of the Hanging Meat Maggot Mass, to record variations of te mperature throughout decomposition............................163 4-3 Laboratory maggot mass experime nt set up with the Fisherbrand Traceable Digital Temperature Controller....................................................................................................164 4-4 Overhead view of developing larvae lo cated in the aquarium for laboratory maggot mass experiment...............................................................................................................1 64 4-5 View of laboratory maggot mass experime nt from beneath reflected by the mirror.......165 4-6 Laboratory maggot mass experiment view from the top, several hundred larvae are present in distinct maggot masses....................................................................................165 4-7 RTD/Thermocouple precise temperature co ntroller; front display shows temperature the thermocouple is reading (i n red numbers) and the set temperature for the element heater (green numbers)....................................................................................................166 4-8 Laboratory maggot mass experiment se t up with new thermocouple, temperature controller and new element heater...................................................................................167 4-9 Top view of second instar larvae placed into the aquarium with element heater for experiment at 40C..........................................................................................................167 4-10 Locations in meat/maggot mass from whic h daily temperature readings were taken throughout decomposition while conducting Ma ggot Mass Behavior in Reference to Temperature experiment..................................................................................................168 4-11 Larvae feeding at the base of the hangi ng meat mass adjacent to the two inch section of steel pole......................................................................................................................169 4-12 Post-feeding sarcophagid larvae located on the surface of the chicken and mesh bag after development has been completed............................................................................169 4-13 Mean daily temperatures recorded for hanging meat mass throughout decomposition..170 4-14 Surface plot representing the temperature recorded daily are the 42 data sites for the maggot mass behavior control experiment......................................................................171 4-15 The nine zones used to associate larval maggot masses movement throughout development amongst the decaying chicken in association with the single element heater and 21 points at whic h temperature was collected................................................172 4-16 Maggot mass orientation within decaying chicken throughout development in the control experiment; the colored regions i ndicate actually location of larvae..................173 4-17 Daily diagrams showing maggot mass de velopment occurred in Zone 1 (directly above the single element heater) throughout development at 40C................................174 13

PAGE 14

4-18 Surface plot representing temperature measurements taking throughout development for maggot mass behavior 40C experiment....................................................................174 4-19 Surface plot graph of daily temperat ure readings taken throughout larval development for the maggot mass behavior 45C experiment........................................175 4-20 Location of the maggot mass while devel oping in decaying chicken with the single element heater set at 45C...............................................................................................175 4-21 Daily temperature measurements reco rded throughout the maggot mass behavior 50C experiment..............................................................................................................176 4-22 Movement of the maggot mass while the single element heater is set at 50C...............176 4-23 Surface plot graph of daily temperat ure readings throughout the maggot mass behavior 55C experiment...............................................................................................177 4-24 The various locations of the maggot mass as the larvae develop at 55C.......................177 4-25 Maggot mass movement in regards to th e single element heater set at 60C..................178 4-26 Surface plot representing temperature measurements taking throughout development for maggot mass behavior 60C experiment....................................................................178 4-27 Orientation of the devel oping maggot mass within decaying chicken in regards to 65C.................................................................................................................................179 4-28 Daily temperature measurements reco rded throughout the maggot mass behavior 65C experiment..............................................................................................................179 4-29 Overall look at growth rates am ong larvae developing within maggot mass experiment at Control, 40C, 45 C, 50C, 55C, 60C, and 65C..................................180 4-30 Taken after horizon blue Day-Glo fluorescent powder has been applied to the maggot mass for the preliminary expe riment on maggot mass movement.....................182 4-31 One minute after application of horiz on blue Day-Glo fluorescent powder; the horizon blue powder has already expanded to other areas of the mass not originally dusted...............................................................................................................................182 4-32 After rocket red Day-Glo fluorescent powder has been a pplied to the base of the maggot mass larvae have already begun to move about the mass...................................183 4-33 One minute after application of the rock et red powder; notice the larvae completely coated in pink powder moving across the top of the maggot mass (larvae is circled)....183 4-34 The rocket red Day-Glo powder shows di stinct paths of movement throughout the maggot mass.................................................................................................................... .184 14

PAGE 15

4-35 Maggot mass taken five minutes after application of the rocket red Day-Glo fluorescent powder; several larvae covered in pink powder are now visible on the surface of the maggot mass..............................................................................................184 4-36 Larva coated in chartreuse yellow fluorescent pigment placed upon maggot mass; notice the transfer of the powder to the other larvae and the pa th of yellow powder down underneath the mass...............................................................................................185 4-37 Two minutes after larva was placed on th e maggot mass; many larvae are covered with the powder preventing obser vation of the original larva.........................................185 4-38 Maggot mass observed three minutes after pl acement of the larva, the original larva is unrecognizable.............................................................................................................186 4-39 Another attempt at placing a larva coated with chartreuse yellow fluorescent pigment amongst the maggot mass................................................................................................186 4-40 Two minutes after placing larva coated with chartreuse yellow pigment upon the maggot mass; the entire area is colored ye llow and the larva is no longer visible..........187 4-41 Chartreuse yellow fluorescent pigment applied to larvae located above the element heater and rocket red Day-Glo applied to larvae on the outer edge of maggot mass......187 4-42 Ten minutes after the ap plication of chartreuse yellow fluorescent pigment and rocket red Day-Glo powder to the maggot mass, no larvae are visible with yellow powder but a few of the larvae with pink pow der are seen above the element heater.....188 4-43 Seventeen minutes after the original application of fluorescent powders and reapplication of char treuse yellow pigment, a larv a from the rocket red group has moved into the yellow group...........................................................................................189 4-44 Hanging Meat Maggot Mass Study, one m onth after commencement; no larval or adult activity is present and the chicken has become hard and inhabitable for larvae....189 4-45 Larva coated in rocket red Day-Gl o fluorescent powder is placed upon the maggot mass, notice the amount of powder tr ansferred to the other larvae.................................190 4-46 The original larva coated with rocket red powder is unrecognizable because of powder transfer and moving beneath the surface of the maggot mass............................190 4-47 A larva is placed amongst the maggot mass after being coated with orange Day-Glo fluorescent powder...........................................................................................................19 1 4-48 The larva coated with orange powder ha s traveled straight down into the maggot mass beneath the surface direct observation of its movement.........................................191 5-2 DNA extraction of tissue samples T2, T3, T4, T5, T6, T7, T8 with phenol/chloroform method, run in a 1% agarose gel.......................................................206 15

PAGE 16

5-3 DNA extraction of tissue samples T1, T2, T4, T6, T7, T8, and larva with Qiagen DNeasy columns. DNA concentration levels are low.................................................206 5-4 DNA extractions of six diffe rent larval gut contents with Qiagen DNeasy columns run in a 1% agarose gel....................................................................................................207 5-5 The mitochondrial DNA sequence of the cytochrome oxidase subunit one (COI) gene, from the gut contents of Chrysomya rufifacies larvae...........................................207 5-6 The nucleotide identity between GenBank Chrysomya rufifacies COI sequence (accession number AY842624) matched in BLAST with the mtDNA sequence of gene COI from the gut of Chrysomya rufifacies larvae...................................................208 5-7 The mitochondrial DNA sequence of the cytochrome oxidase subunit one (COI) gene from the tissues samples of Ursus americanus floridanus ......................................208 5-8 The nucleotide identity between GenBank Ursus americanus COI sequence (accession number AF303109) matched in BLAST with the mtDNA sequence of gene COI from the tissue samples of Ursus americanus floridanus...............................209 5-9 PCR amplification using mammalian prim ers for cytochrome b gene on DNA from bear tissue samples and larvae fed upon bear tissue samples..........................................210 5-10 The mitochondrial DNA sequence of a porti on of the cytochrome b gene, from the tissue samples of Ursus americanus floridanus ...............................................................210 5-11 The nucleotide identity between GenBank Ursus americanus cytochrome b (accession number AF268262) matched in BLAST with the mtDNA sequence from the tissue samples of Ursus americanus floridanus .........................................................211 5-12 The mitochondrial DNA sequence of the cytochrome b gene, from the gut contents of Chrysomya rufifacies larvae collected off Ursus americanus floridanus carcasses...211 5-13 The nucleotide identity between GenBank Ursus americanus cytochrome b gene (accession number AF268262) matched in BLAST with the gut contents of the Chrysomya rufifacies larvae that fed on Ursus americanus floridanus ...........................212 A-1 Temperature readings recorded on July 12, 2007 for control experiment.......................221 A-2 Temperature readings recorded on July 13, 2007 for control experiment.......................222 A-3 Temperature readings recorded on July 14, 2007 for control experiment.......................223 A-4 Temperature readings recorded on July 16, 2007 for control experiment.......................224 A-5 Temperature readings recorded on July 17, 2007 for control experiment.......................225 A-6 Temperature readings recorded on July 6, 2007 for 40C experiment............................226 16

PAGE 17

A-7 Temperature readings recorded on July 7, 2007 for 40C experiment............................227 A-8 Temperature readings recorded on July 8, 2007 for 40C experiment............................228 A-9 Temperature readings recorded on July 9, 2007 for 40C experiment............................229 A-10 Temperature readings recorded on July 10, 2007 for 40C experiment..........................230 A-11 Temperature readings recorded on July 11, 2007 for 40C experiment..........................231 A-12 Temperature readings recorded on July 12, 2007 for 40C experiment..........................232 A-13 Temperature readings recorded on July 12, 2007 for 45C experiment..........................233 A-14 Temperature readings recorded on July 13, 2007 for 45C experiment..........................234 A-15 Temperature readings recorded on July 14, 2007 for 45C experiment..........................235 A-16 Temperature readings recorded on July 19, 2007 for 50C experiment..........................236 A-17 Temperature readings recorded on July 20, 2007 for 50C experiment..........................237 A-18 Temperature readings recorded on July 21, 2007 for 50C experiment..........................238 A-19 Temperature readings recorded on July 22, 2007 for 50C experiment..........................239 A-20 Temperature readings recorded on July 23, 2007 for 50C experiment..........................240 A-21 Temperature readings recorded on July 24, 2007 for 50C experiment..........................241 A-22 Temperature readings recorded on July 26, 2007 for 55C experiment..........................242 A-23 Temperature readings recorded on July 27, 2007 for 55C experiment..........................243 A-24 Temperature readings recorded on July 28, 2007 for 55C experiment..........................244 A-25 Temperature readings recorded on July 29, 2007 for 55C experiment..........................245 A-26 Temperature readings recorded on July 30, 2007 for 55C experiment..........................246 A-27 Temperature readings recorded on July 31, 2007 for 60C experiment..........................247 A-28 Temperature readings recorded on August 1, 2007 for 60C experiment.......................248 A-29 Temperature readings recorded on August 2, 2007 for 60C experiment.......................249 A-30 Temperature readings recorded on August 3, 2007 for 60C experiment.......................250 A-31 Temperature readings recorded on August 4, 2007 for 60C experiment.......................251 17

PAGE 18

18 A-32 Temperature readings recorded on August 5, 2007 for 65C experiment.......................252 A-33 Temperature readings recorded on August 6, 2007 for 65C experiment.......................253 A-34 Temperature readings recorded on August 7, 2007 for 65C experiment.......................254 A-35 Temperature readings recorded on August 8, 2007 for 65C experiment.......................255

PAGE 19

Abstract of Dissertation Pres ented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy EFFECTS OF MAGGOT MASS ON DECOMPOS ITION AND POST MORTEM INTERVAL CALCULATIONS By Sonja Lise Swiger December 2007 Chair: Jerome A. Hogsette Major: Entomology and Nematology I assessed carcass decomposition in the field by observing species composition and distribution and recording maggot mass location and temperature. The species information observed in the field led to the development of a laboratory controlled maggot mass to observe the behavior of the developing larvae. Subsequently Chrysomya rufifacies and Chrysomya megacephala were colonized so that larvae growth rates could be compared. Anterior gut contents were dissected from larvae collected from bear carcasses for DNA typing to determine if the medium (i.e. host) used for la rvae development could be identified. Chrysomya megacephala and Chrysomya rufifacies colonies were established to provide insight into the prot ein needs of adult Chrysomya rufifacies and developmental rates of the ensuing larvae. The Chrysomya megacephala and Chrysomya rufifacies laboratory colonies were reared for five and si x generations, respectively. Chrysomya megacephala developed in 24.5 d. First instar larvae were present 1 d afte r oviposition. Second inst ar larvae developed 2.5 d after oviposition. The third stadium occurred 6.3 d after oviposition with the onset of pupation 12 d after oviposition. Chrysomya rufifacies developed in 22.7 d. Afte r oviposition first instar larvae were present within the next day, second instar larvae developed 2. 3 d later and the third stadium commenced 5.7 d later. The larvae pupated 10 d after oviposition. 19

PAGE 20

20 My study demonstrated that maggot masses form ed within a carcass maintain temperatures above ambient throughout larval development. The maggot mass for Bear 3 July 2004 recorded a maximum temperature of 40.59C which was 11C higher than the recorded ambient temperature. The maggot mass for Bear 4 September 2004 recorded a maximum temperature of 49.56C which was 19C higher than the ambi ent temperature. The high temperature recorded within a maggot mass suggests the larvae are in fact regulati ng their developmental rates as opposed to the ambient temperature. The laboratory maggot mass showed minimal be havior changes to the second and early third instar stages from the arti ficially increased temperatures from the heating element. The larvae developed normally despite the temperature of the element heater but did not feed above the heater when the temperature was excess of 50 C. The larvae preferred to congregate in areas of the medium that recorded temperatures betwee n 32C and 39C. The late third instar larvae congregated in smaller masses within the medium (i.e. chicken thighs) above the element heater until reaching the postfeeding-wandering stage. Th e movement of the larvae within the maggot mass was found to be unpredictable. The larvae are in constant motion w ithin the medium while feeding and while located on the surface of the mass. The mitochondrial DNA sequence data was obtaine d from the anterior gut contents of Chrysomya rufifacies larvae that had fed on bear tissue. DNA was extracted from the bear tissue and larval gut contents. All bear tissue samples and several of the larvae gut samples were amplified for the cytochrome oxidase subunit I (COI) and cytochrome b gene. The COI sequence identified the specimens DNA but could not identify the hosts DNA; therefore the cytochrome b gene was sequenced. The DNA extr acted from the larval gut was identified as bear, enabling host identification.

PAGE 21

CHAPTER 1 FORENSIC ENTOMOLOGY LITERATURE REVIEW Introduction to Forensic Entomology Definition of Forensic Entomology Forensic entomology is the use of insect s (or other arthropods) in the medicolegal community to assist in solving a crime based on entomological developmental and behavioral knowledge. The insects collected form a crime s cene can provide valuable information about the circumstances in which a crime was committe d (Amendt et al. 2006). Numerous arthropod species, primarily Diptera (flies) and Coleopt era (beetles), feed, liv e and breed on corpses (Benecke 2001). As stated by Wol ff et al. (2001), forensic Entomology is related to the fields of medical entomology, taxonomy, and forensic pathol ogy, and is mainly used to estimate the time of death or postmortem interval (PMI) base d on the developmental rates and the successional ecology of specific insects th at feed on carcasses. Historical Uses of Forensic Entomology The first documented use of forensic entomology can be dated to 13th century China in the text book His Yuan Chi Lu (translated The Washing Away of Wrongs) in which a leading criminologist, Tzu Sung, was able to solve a mysterious murder-by-slashing that involved a sickle (Hall 2001). With his knowle dge of flies, Sung Tzu was able to determine which of the villagers had committed the crime by inspecting their sickles for fly activity. From then on, the field of forensic entomology progressed slowly un til the mid 1800s when it became of interest to Bergeret in Europe. Bergeret wa s the first in Europe to use insects as forensic indicators by constructing a developmental timeline for pupa ria found on a mummified baby (Greenberg and Kunich 2002). In the late 1800s, J.P. Megnin wa s credited with focusing forensic entomology studies in the west (Hall 2001). Megnin identified eight stages in the decomposition of a human 21

PAGE 22

body in air and identified the ins ects associated with each stag e (Greenberg 1991). Since that time, entomological evidence has been used sporad ically in several murder cases in Britain and, more frequently, on the North Am erican continent (Smith 1986). Although forensic entomology dates back to th e 13th century, it did not become a popular forensic technique in North America until the late 1970s. Currently, many new studies are being conducted with groundbreaking results that alter th e field techniques and beliefs laid down by the original researchers of forensic entomology. Before forensic entomology became a well known discipline, thanks in part to the many current crime scene and law enforcement shows on prime time television, many researchers were conducting mu ltiple research projects to make the field more creditable in a court of law. As early as 1940, research was conducted by Deonier (1940) testing the relationship that de veloped between carcass temper atures and winter blow fly populations and activity. The results were notew orthy but may have been overlooked by several of the forensic entomologists of that time. In 1944, Davidson saw the importance of temperature but relegated it to the relationshi p it played on development for si x different species of Diptera: Drosophila melanogaster (Meigen) Musca domestica (Linnaeus) Cochliomyia macellaria (Fabricius), Phormia regina (Meigen) Lucilia sericata (Meigen) and Ephestia kuehniella (Zeller) (Davidson 1944). Because of its importan ce, and the variations in species and locations, this type of experiment would be continually rep eated and improved upon for th e next 60+ years. The next thirty years did not produce much lite rature in the field of forensic entomology, but by 1975 insect developmental temperatures we re being explored and compared again (Ash and Greenberg 1975). Next, larval growth patterns as a factor of temperature were examined in calliphorid (blow flies) and sarcophagid (flesh flies) Diptera to help determine time elapsed since death (Levot et al. 1979). 22

PAGE 23

By the mid 1980s, papers were published on su ccession patterns and post mortem interval (PMI) estimations experimentally determined in various locations throughout the United States (Rodriguez and Bass 1983, Goddard and Lago 1985, Goff et al. 1986, Goff and Odom 1987, Schoenly and Reid 1987, Goff et al. 1988). Th e first decomposition study was conducted in 1983 at the Anthropology Research Facility (ARF) located at th e University of Tennessee in Knoxville, Tennessee. This was the first docume nted use of human cadavers in the US for a decomposition study examining insect activity and its relationship to decay rates (Rodriguez and Bass 1983). The results are still referenced by many today. Blow fly succession patterns were first noted on carrion in northern Mississ ippi in 1985 (Goddard and Lago, 1985). An increasing amount of data originated from Hawaii from 1986 until early 2000. The research was conducted by Dr. M. Lee Goff and hi s staff and students throughout the islands of Hawaii with the Forensic Laboratory and in conn ection with the medical examiner (Goff et al. 1986, Goff and Odom 1987, Goff et al. 1988, Goff et al. 1989, Goff 1991, Goff and Flynn 1991, Goff et al. 1991a, Goff et al. 1991b, Goff 1992, Goff 1993, Goff and Lord 1994, Goff and Win 1997, Goff et al. 1997, Goff 2000). Dr. Goff was cal led upon by the medical examiner in several cases to help determine time of death. As a re sult, he conducted several research studies support up his estimations, while at the same time establ ishing a computer databank where he recorded his findings (Goff et al. 1986, Goff and Odom 19 87, Goff et al. 1988). Over the years papers have been published on multiple case studies, PMI estimations, succession patterns and the influence of drugs on larval development (G off et al. 1986, Goff and Odom 1987, Goff et al. 1988, Goff et al. 1989, Goff 1991, Goff and Flynn 1991, Goff et al. 1991b, Goff 1992, Goff 1993, Goff and Win 1997). 23

PAGE 24

In 1987, Schoenly and Reid researched the dynami cs of carrion succession to determine if discrete changes of arthropod fauna were associat ed with the different stages of decomposition as listed by Payne and Rodriguez an d Bass. Haskell et al. (1989) published early uses of aquatic insects as possible indicators fo r determining submersion post mortem intervals. Publications from the 1980 commenced with immature stages of forensically important flies being researched to provide more reliable identification processe s and to further understand the flies importance in decomposition (Liu and Greenberg 1989). In the 1990s, forensic entomology began to develop, with new research being published severa l times a year from all over the United States, Canada, Europe, Australia, Asia and South Ameri ca. Today it is a continually developing field, with more and more prosecutors and law enforc ement officers calling on fo rensic entomologists to interpret evidence and help determine time elapsed since death. Entomologists are used increasingly in crim inal investigations to assist in postmortem interval determinations, the av ailability of accurate developm ental and successional data on sarcophagous insects is of primary importance, By rd and Butler (1997). Synanthropic flies, calliphorids in general, are in itiators of decomposition and ar e the most accurate forensic entomology indicators of time of death. Greenberg referred to calliphorids as dipterous vultures with the keen ability to locate resources in a large landscape (1991). Uses of Forensic Entomology Arthropods, Diptera and Coleoptera in general, are very useful in estimating post mortem interval (PMI) (Benecke 1998a). Along with estimating the PMI, insects are helpful in linking suspects to the scene of a crime. For example a suspect may be linked to a scene of a crime by an arthropod bite specific to the vicinity. In addition, late colonizing insects provide information in the analysis of badly decom posed or skeletonized remains. Some insects are restricted to specific geographical areas, and when found on a co rpse in a location outside of their reported 24

PAGE 25

range, can indicate the body was moved after death. Fly larvae and adults found in clean, empty or occupied rooms can be used to link the entomo logical findings to known death cases. Insects can also assist in determining if a body was moved outdoors at ni ght or during the day and if it happened to be raining or dry at the time removal (Benecke 1998a). Post Mortem Interval (PMI) Determination Definition of PMI Insects from crime scenes must be identifie d to species and developmental time must be determined to calculate the post mortem in terval (Rodriguez and Bass 1983, Goff and Odom 1987, Goff 2000, Amendt et al. 2006). PMI is determ ined by using larval de velopmental rates in correlation with the measured ambient temperature recovered from the closest weather station for the days in question (Archer 2004). The mature larvae are used to calculate the minimum PMI because they have been present on a carcass the longest amount of time, meaning they were laid shortly after the onset of d eath (Goff et al. 1991b). A PMI determination is useful in cases of homicide, suicide and accidental or unattended death because of natural causes (Goff et al. 1986). As stated by Dr. M. L. Goff, Exposed remains are a temporary and progressively cha nging habitat and food source for many organisms such as bacteria, fungi, vertebrates and arthropods (Goff et al. 1986). The PMI calculation is crucial for identifying the decedents remains which will then hopefully lead to the identification of the victim and the perpetrato r (Megyesi et al. 2005). Gros s appearance differences of the remains could lead to inaccurate determinati ons of the PMI without the analysis of the entomological evidence (Goff et al. 1988). As Mann et al. (1990) noted, Forensic en tomology requires continual and intensive research. Mann and his group at the University of Tennessee conducted research with human corpses to analyze the impact insect activity, am bient temperature, and rainfall, clothing, burial 25

PAGE 26

and depth, carnivores, bodily trauma, body we ight, and the surface had on decomposition patterns and the post mortem interval (Mann et al 1990). In addition other researchers have also studied the effects of sunlight versus shade (Shean et al. 1993 Joy et al. 2002, 2006) and burial depth associated with corpse access (Campobasso et al. 2001). PMI based on succession pattern To determine PMI, the succession pattern mu st be documented from an area (Rodriguez and Bass 1983, Goff and Odom 1987, Goff and Flynn 1991, Schoenly et al. 1992, Goff 1993, Shean et al. 1993, Anderson 2000, Campobasso et al. 2001, Marchenko 2001). The succession pattern is based on the arrival, development and departure of Calliphoridae and Sarcophagidae adults and larvae during the early stages of decomposition. In th e later stages of decomposition Coleoptera adults and larvae, along with ot her Diptera (Stratio myidae, Muscidae and Piophilidae) adults and larvae, are used in additio n to the early colonizers to develop a lower and an upper limit of time since death (Goff a nd Odom 1987, Goff and Flynn 1991, Schoenly et al. 1992, Goff 1993). Primarily, Callip horidae and Sarcophagidae are used to determine PMI, but in rare instances other families and species have been used as well. These species include the black soldier fly, Hermetia illucens (Linnaeus) (Diptera: Stratiomyidae) (Lord et al. 1994), and even Anoplolepsis longipes (Jerdon) (Hymenoptera: Formicidae) (Go ff and Win 1997). The expected arrival time of a species and developmental times must be known to determine PMI (Goff and Odom 1987, Goff and Flynn 1991, Schoenly et al. 1992, Goff 1993, Hall and Doisy 1993, Anderson 1997, Anderson 2000, Goff 2000, Campobasso et al. 2001, Marchenko 2001, Arnaldos et al. 2005, Disney 2005). Flies are known to lay their eggs in the natural orifices (eyes, nose, and ears) upon arrival unless a woun d is present. The presence of a wound must be determined immediately and prior to making PMI calculatio ns because the decomposition pattern of the corpse will be alte red (Anderson 1997). 26

PAGE 27

Age determination of larvae for PMI When determining PMI, the length and age of the oldest maggots recovered from a body often provide the most accurate estimate. Re search has shown that the method by which the larvae are killed and preserved ha s a profound effect on th e measured length of the larvae. If a larva is not preserved properly or placed directly into ethanol or formalin, the larvae will shrink significantly (Tantawi and Greenbe rg 1993). Length of the larvae is crucial in determining PMI and can lead to an underage er ror and incorrect PMI (Tantawi and Greenberg 1993). A project was conducted in 2003 to examine the effects ethanol and formalin has on the length of the larvae placed directly into the solutions. It was again found that the larvae will shrink in the solutions if they are not boiled fi rst and that the longer the specime ns remain in the solutions the more they shrink (Adams and Hall 2003). Different techniques other than taking larval and pupal measurements for determining the exact age for more accurate PMI estimates have been researched. These techniques include weight comparisons of the three different larval stages for significant variations between life stages (Wells and LaMotte 1995). Another method involves studying th e steroidogenesis in pupae for differences that would correlate with the age (Gaudry et al. 2006). PMI altering circumstances Concealment. Many times corpses are wrapped, burie d, hidden, or placed in the trunk of automobiles or freezers/refrigera tors that prevent exposure to arthropods (Goff and Odom 1987, Mann et al. 1990, Goff 1992, Anderson 1997, Goff 2000, Campobasso et al. 2001). It is common for victims to be placed in a container or wrapped up after they have been murdered, usually because the assailant is attempting to clean up or conceal what has happened until the remains are discarded (Goff 2000). Concealment of a corpse can lead to incorrect PMI calculations. A case published by Goff in 1992 deals with the wrapped remains of a female. The 27

PAGE 28

entomological evidence indicated a PMI of 10.5 d, but an experiment was conducted to determine what effect the wrappings had on the PMI. It was found that the blankets caused a delay of fly oviposition by 2.5 d. Adding the 2.5 d to the original PMI estimate gave a final number of 13 d, a time consistent with when th e victim was last seen alive, 14 d prior (Goff 1992). Sometimes blow flies are unable to gain access to a corpse and the only colonizers are smaller flies, many from the family Phoridae. The developmental threshold for this family has not yet been establis hed (Disney 2005). Toxicology. Goff and Lord (1994) found that ins ects serve as reliable alternate specimens for toxicological analyses when tissues and fluids are absent. Entomotoxicology is a new branch of forensic entomology that uses insects for detecting drugs and toxins in decomposing tissues (Goff et al. 1989, Goff 1991, Goff et al. 1997, Carvalho et al. 2001, Introna et al. 2001). Deaths caused by drug-overdose generally are not discovered for a period of several days at which point a PMI estimate is calculat ed using dipteran larvae developmental rates and succession patterns (Goff et al. 1989). Because of the importance of larvae in determining PMI it is essential to know th e adverse effects of drugs on larval development (Goff et al. 1989). Work was conducted by Goff et al. in 1989, after several drug overdose related deaths occurred where the ensuing corpses contained larg e overgrown larvae in a short period of time (Goff et al. 1989). The research showed most dr ugs caused the larvae to develop at an increased rate, therefore making them much larger in si ze than would be expected given the time since death (Goff et al. 1989, Goff et al. 1991a). The amount of cocaine consumed was found to be a significant factor for the PMI. When <35 mg of cocaine were measurable, no developmental differences were encountered. When more cocaine was present, larvae developed more rapidly and altered the PMI by as much as 24 h (Goff et al. 1989). The difference observed with cocaine 28

PAGE 29

was sufficient enough to alter estimates on larval development by up to 29 h and estimates based on pupal development by 18 to 38 h (Goff et al. 1991a). This could give a wrong post mortem interval unless it was obvious that the victim had taken drugs that would expedite larval development. Studies were conducted to observe the eff ects of heroin and diazepam on developing larvae; larval development increased, but pupati on time was significantly greater (Goff et al. 1991a, Carvalho et al. 2001). The drug 3, 4-Me thylenedioxymethamphetamine, was detected within developing sarcophagid larv ae and in the empty puparial case s. Extractions were directly related to the drug quantities ad ministered to the host and the drug increased the developmental rate of the larvae (Goff et al. 1997). Studies with methylened ioxymethamphetamine showed an increase in larval development when the amount s were 67 mg or more (Goff et al. 1997). Drug quantities in the larvae and empty pupa cases were used to determine a relationship with drug quantities administered to test subjects that were fed upon by the larvae (Goff et al. 1997). The first documentation of organophosphates, mala thion specifically, in calliphorid larvae that had fed upon poisoned remains was published in 1989 by Gunatilake and Goff. The level of malathion from within the pooled larvae was substantially higher th an the established LD50 for adult flies of that species (G unatilake and Goff 1989). The su ccession pattern was altered, and only two species of Diptera were collected, Chrysomya rufifacies (Macquart) and Chrysomya megacephala (Fabricius). Overdose or poisoning deaths are detected by analyzing body fluids and tissues for toxic agents, but problems can arise when dealing with remains in an advanced stage of decomposition (Gunatilake and Goff 1989, Introna et al. 2001). To prevent PMI miscalculations, toxicology screening should be conducted in a timely ma nner on the larvae and the deceased individual. 29

PAGE 30

Larvae excrete the consumed drug during the post-feeding stage, making detection more difficult in the larvae; however a quantity was located in the cuticle of the puparium (Bourel et al. 2001, Sadler et al. 1995). Nocturnal Oviposition. It has been stated that blow flies are inactive at night despite ambient temperature suitable for flight (Nuorteva 1977, Smith 1986). However, it was reported in 1990 that blow flies do indeed demonstrate nocturnal oviposition behavior (Greenberg 1990). This was corroborated by another group of re searchers in India (Singh and Bharti 2001). Phaenicia (= Lucilia ) sericata, Phormia regina and Calliphora vicina Robineau-Desvoidy were observed ovipositing on thawed rat carcasses at night during the summers of 1988 and 1989. The oviposition occurred both in the darkest hou rs of the night under extremely low lighting from an alley light and in the deep shade of a bush (Greenberg 1990). At times the number of eggs was very small, but a forensic entomologist must be willing to acknowledge the possibility of nocturnal oviposition when calcu lating post mortem interval. Succession Patterns Definition of succession patterns The decay rate of human bodies or carcasses ha s a direct relationshi p to the successional pattern of carrion frequenting insects. The knowledge of Calliphoridae and Sarcophagidae succession patterns is a useful tool in the ar ea of forensic entomology (Payne 1965, Lord and Burger 1983, Rodriguez and Bass 1983, Goddard and Lago 1985, Early and Goff 1986, Schoenly and Reid 1987, Goff et al. 1988, Haskell et al. 1989, Goff 1991, Osvaldo Moura et al. 1997, Davies 1999, Carvalho et al. 2000, Davis and Go ff 2000, Martinez-Sanchez et al. 2000, Shalaby et al. 2000, Carvalho and Linhares 2001, Wolff et al. 2001, Joy et al. 2002, Archer and Elgar 2003a, 2003b; Shahid et al. 2003, Watson and Ca rlton 2003, Schoenly et al. 2005, Grassberger and Frank 2004, Perez et al. 2005, Tabor et al 2005a, 2005b; Tomberlin et al. 2005, Watson and 30

PAGE 31

Carlton 2005, Jong and Hoback 2006, Joy et al. 2006, Martinez et al. 2006). In addition, the application of succession patterns can provide forensic scientists with a defined criterion for determining the time interval since death (R odriguez and Bass 1983, Goddard and Lago 1985). Schoenly and Reid (1987) refer to the carrion arthropod community develops primarily as a continuum of gradual changes. Calliphoridae, Sarcophagidae, and Muscidae, al l families within the order Diptera, have been found to arrive first on carrion (Rodr iguez and Bass 1983, Goddard and Lago 1985, Early and Goff 1986, Goff 1991, Osval do Moura et al. 1997, Davis and Goff 2000, Shalaby et al. 2000, Carvalho and Linhares 2001, Wolff et al. 2001, Joy et al. 2002, Archer and Elgar 2003a, 2003b; Peters 2003, Watson and Carlton 2003, Grassber ger and Frank 2004, Perez et al. 2005, Tabor et al. 2005a, 2005b; Tomberlin et al. 2005, Martinez et al. 2006). Arrival occu rs within minutes of carrion being exposed to the elements but can take longer if the weather is unsuitable for oviposition or flying. For example, the author has observed Calliphorids ovipositing and feeding on a carcass in the rain. Concealme nt of a corpse can further prohi bit Diptera contact within the first 24 h after death. The next to arriver are families within the or der Coleoptera: Staphylinidae, Silphidae, and Histeridae. These families are dipteran larval predators that will lay their eggs in the soil surrounding the carcass (Rodriguez and Bass 1983, Early and Goff 1986, Davis and Goff 2000, Shalaby et al. 2000, Carvalho and Linhares 2001, Wolff et al. 2001, Ar cher and Elgar 2003a, Peters 2003, Watson and Carlton 2003, Grassberger and Frank 2004, Tabor et al. 2005a, 2005b; Watson and Carlton 2005, Martinez et al. 2006). The final Coleopter a visitors of a carcass are Dermestidae, Cleridae and Scarabaeidae, along with the families Trogidae and Nutilidae. These beetles are known to arrive in the drier stages of decay and feed off of the hide, skin, hair and 31

PAGE 32

bones (Rodriguez and Bass 1983, Early and Goff 1986, Shalaby et al. 2000, Carvalho and Linhares 2001, Wolff et al. 2001, Archer and Elgar 2003a, Peters 2003, Watson and Carlton 2003, Grassberger and Frank 2004, Perez et al. 20 05, Tabor et al. 2005a, 2 005b; Martinez et al. 2006). Calliphoridae are the most common insects obs erved in abundance around carcasses which serve as oviposition sites and larval food sources (Goddard a nd Lago 1985). Goff et al. (1988) compared three individual case studies from three different climatic regions of Hawaii. Each had a similar post mortem interval of 4 to 5 d, but the gross physical a ppearance of the victims gave the impression of a different post mortem in terval. The three individuals were all in the decay stage; one was early decay, the next was furt her into decay while the last was in the final stage of decay. The individuals had been missi ng for the same amount of time but differed in gross appearance. Therefore using tissue d ecomposition would have given incorrect post mortem intervals (Goff et al. 1988). Stages of decay Research conducted by Payne (1965) lead to the description of si x distinct stages of decay: fresh, bloated, active decay, advanced decay, dry, and remains. Payne stated that there was a definite succession pattern among the carrion fauna, and each stage of decay was characterized by groups of arthropods occupying pa rticular niches. Most entomologists use these stages of decay as reference for decomposition but have limited it to only four stages: fresh, bloated, decay and dry (Rodriguez and Bass 1983, Goddard a nd Lago 1985, Davis and Goff 2000, Grassberger and Frank 2004), or five stages: fresh, bloate d, decay, dry (or post-decay) and remains (or skeletal) (Early and Goff 1986, Goff et al. 1988, Osvaldo Moura et al 1997, Davis and Goff 2000, Shalaby et al. 2000, Carvalho and Linha res 2001, Wolff et al. 2001, Perez et al. 2005, Martinez et al. 2006). 32

PAGE 33

Some researchers have expressed concern in the inadequacies of these decay stages and cautioned against using the stages to summari ze patterns of faunal su ccession in carrion arthropod investigations (Sc hoenly and Reid 1987, Grassberger and Frank 2004). Although the decay stages are extremely helpful in succession studies, there is no clear cut division among the stages (Schoenly and Reid 1987, Grassberger an d Frank 2004). Decomposition is a continuous process that lacks distinctive separations between stages, Go ddard and Lago (1985). A review conducted by Schoenly and Reid (1987) showed that only a minority of succession studies published over the last 45 years exhibited distinct stage boundari es in connection with faunal change. Using arrival and departure times as a guideline for decomposition patterns can impede a study (Greenberg 1991). Succession altering circumstances Succession pattern differences occur when ther e are uncontrollable variables associated with a carcass such as it being disposed of by hanging or bein g located in the sun or shade. Shalaby et al. (2000) documented succession va riations during decomposition of a hanging carcass. The hanging carcass showed delayed progression through the ph ysical stages of decomposition. The ambient air temperature had si gnificant influence on coo ling the carcass. It was generally impossible for a maggot mass to fo rm and stay on the carcass (Shalaby et al. 2000). Carcasses in sun and shade presented di fferent succession pattern results. There was more larval and adult activity in a carcass in the sunlight and also larger third instars (Joy et al. 2002). Succession patterns and insect populations also vary by carcass. Succession patterns differed in regards to species of the carcass. Mammalian carcasses attract more species of arthropods and for a longer period of time than reptilian carcasses (Watson and Carlton 2003). Decomposition of carcasses occurs more rapi dly during the spring and summer throughout the world. In addition, succession pattern and species composition variations occur according to 33

PAGE 34

location, climate and geographical regions (Rodriguez and Bass 1983, Goddard and Lago 1985, Early and Goff 1986, Greenberg 1991, Osval do Moura et al. 1997, Davis and Goff 2000, Shalaby et al. 2000, Carvalho and Linhares 2001, Wolff et al. 2001, Joy et al. 2002, Archer and Elgar 2003a, Peters 2003,Shahid et al. 2003, Watson and Carlton 2003, Grassberger and Frank 2004, Hwang and Turner 2005, Perez et al. 2005, Schoenly et al. 2005, Tabor et al. 2005a, 2005b; Tomberlin et al. 2005, Joy et al. 2006, Martinez et al. 2006). This rapid decomposition is related to the increased ambient temperatures and extensive insect activity during spring and summer months that is not evident during the fall and winter. This suggest s that insects are the major factors of decomposition. Some species show seasonal and site preference, providing another way to identify the probable place and se ason where death occurred (Osvaldo Moura et al. 1997, Archer and Elgar 2003a, Watson and Ca rlton 2003, Grassberger and Frank 2004, Tabor et al. 2005a). Researchers encounter different sp ecies in the spring and summer than in fall and winter (Osvaldo Moura et al. 1997, Davies 1999, Martinez-Sanchez et al. 2000, Archer and Elgar 2003a, Watson and Carlton 2003, Hwang and Turner 2005, Tabor et al. 2005a, 2005b). Carcass size also plays a part in decomposition; some sp ecies of blow flies are only present on large carcasses while others are found feeding on sm all carcasses (Davis 1999, Swiger unpublished data). As mentioned before, insect species can provi de information to the removal of a body after death because of habitat locality (Benecke 1998a, Wolff et al. 2001). Some species of insects are more likely to occur on corpses located outdoors while others are found on corpses indoors (Goff 1991). Certain insects frequent human dwellings and readily breed within these dwellings while others rarely enter human dwellings (Mullen an d Durden 2002). Knowing an insects habitat and breeding sites can provide evidence that an individual was murdered or harmed in a location 34

PAGE 35

other than where the body was discovered. Insect s collected can provide clues that the murder did not occur where the body was found. A field research location saturated with sarcosaprophagous arthropods was thought to increase decomposition time and alter post mortem interval determinations (Shahid et al. 2003, Schoenly et al. 2005). However, Shahid et al. in 2003 demonstrated that carcass enrichment does not alter decay rates or the arthropod community. The project was conducted during the summer at the ARF in Knoxville, Tennessee. At this site intensive research had been conducted and there was, therefore, satura tion. Three other sites, not considered to be saturated, were chosen to conduct simultaneous studies. The resu lts indicated that the AR F site did not contain more sarcosaprophagous arthropods than the othe r locations, thus dismissing claims of over saturation (Shahid et al. 2003). More non-forensically importa nt predaceous and parasitic arthropods were collected from three external sites than from ARF (Schoenly et al. 2005). Thermal Energy Importance of temperature Precedence is necessary in court and referenc ing published data to support a discovery is imperative, but many times there is no supporting data for the location in question. Dipteran larval growth rates vary with location, different ambient temperatures and species composition, making developmental experiments imperative in diverse climatic regions (Goff and Odom 1987, Byrd and Butler 1996, 1997, 1998, Anderson 2000, Byrd and Allen 2001, Grassberger and Reiter 2002a, 2002b, Donovan et al. 2006, Nabity et al. 2006). Forensic entomologists conduct developmental rate studies with native fly species at selected temperatures similar to local ambient temperatures to establish reference values (Introna et al. 1989, Byrd and Butler 1996, 1997, 1998, Anderson 2000, Byrd and Allen 2001, Donovan et al. 2006, Nabity et al. 2006). 35

PAGE 36

Entomologists have long been interested in forecasting insect events which rely on temperature, such as predicting seasonal occurrences for census samples and control tactics, Wagner et al. (1984). Many researchers have studied insect developmenta l ranges by altering the ambient temperature. In forensic entomology it is important to know the exact temperature range at which an insect can grow and the time needed to complete development (Deonier 1940, Davidson 1944, Ash and Greenberg 1975, Logan et al. 1976, Levot et al 1979, Wagner et al. 1984, Williams and Richardson 1984, Goff and Odom 1987, Hagstrum and Milliken 1991, Wells and Kurahashi 1994, Byrd and Butler 1996, Queiroz 1996, Byrd and Butler 1997, 1998; Anderson 2000, Byrd and Allen 2001, Grassberger and Reiter 2001, Grassberger and Reiter 2002a, 2002b; Grassberger and Frank 2003, Clark et al. 2006, Donovan et al. 2006, Nabity et al. 2006). Researchers have conducted experiments to determine the low temperature threshold and present results for different phase s of larval development at ambi ent temperatures. Monitoring a species in the laboratory and c ontrolling the ambient temperature are suitable methods for finding the best rearing conditi ons (Levot et al. 1979, Byrd and Butler 1996, Queiroz 1996, Byrd and Butler 1997, 1998; Grassberger and Reiter 2 002a, 2002b; Donovan et al. 2006, Nabity et al. 2006). Two sibling species, Phaenicia sericata (Meigen) and Phaenicia pallescens (Shannon) were studied at three constant temperatures, 19 C, 27C, and 35C, to better understand their distribution within the United Stat es. At the time of the study P. pallescens was found in the southeastern U.S. while P. sericata could be found nearly ever ywhere, including southern Canada. Results indicated that P. pallescens has a faster developmental rate than P. sericata at all three temperatures (A sh and Greenberg 1975). P. pallescens is unable to diapause, requiring 36

PAGE 37

it to be in the stenothermal and subtropical regions of the United States; P. sericata is able to diapause and can grow in all locat ions (Ash and Greenberg 1975). Three experiments were conducted by By rd and Butler (1996, 1997, and 1998) on three forensically important dipteran species, Cochliomyia macellaria, Chrysomya rufifacies, and Sarcophaga haemorrhoidalis (Fallen) respectively. The growth chambers were held at a constant temperature and a growth pattern was developed by taking length measurements daily and plotting them against time. This process showed a clear diagram of when the larvae grew the fastest and when growth began to dwindle. Next, the larvae were placed on a temperature gradient set up with a heat sour ce at one end and a cooling mech anism at the other. The larvae were placed on this gradient to feed while be ing observed; the prefer red temperature location was documented daily. For all thr ee species the young larvae preferre d to cluster together at the higher temperatures, but as the larvae became larg er, they moved down the gradient to the cooler temperatures (Byrd and Butler 1996, 1997, 1998). Four different necrophagous fly species ( Lucilia cuprina (Wiedemann) Calliphora stygia (Fabricius), Calliphora vicina and Calliphora hilli (Patton)) growth characteristics were measured to assess their competitiveness at temp eratures between 10C and 45C in Tasmania. Results showed that Lucilia cuprina although an introduced species, was the best suited for all temperature ranges, therefore enhancing its ability to exploit large carcasses (Williams and Richardson 1984). Formulas and diagrams Mathematical formulations have been deve loped to express the relationship between temperature and speed of development in insects (Davidson 1944, Ash and Greenberg 1975, Logan et al. 1976, Wagner et al. 1984). Formulas can be us ed to assist in estimating the appropriate peak temperatures for development, a nd data can be plotted in a logistic curve which 37

PAGE 38

expresses the growth and de velopmental pattern (Davidson 1944, Ash and Greenberg 1975, Logan et al. 1976, Wagner et al. 1984). Developmental peak temperatures separate growth patterns between species. It is important to know a species development peak to accurately calculate the post mortem interval with am bient temperature based on development time (Hagstrum and Milliken 1991, Wells and Kurahashi 1994, Byrd and Butler 1996, 1997, 1998; Anderson 2000, Byrd and Allen 2001, Grassberger and Reiter 2002a, 2002b; Archer 2004, Donovan et al. 2006, Nabity et al. 2006). To solve inconsistencies in development data, an isomegalen-diagram and an isomorphendiagram are constructed. The diagrams are desi gned to provide more precise estimates of the post mortem interval (Grassberge r and Reiter 2001). The isomegalen-diagram is designed to match the recorded temperature with larval length to determine the expect ed age of the maggots. The isomorphen-diagram, used when migratory larvae or pupae or puparia are recovered from the scene, shows the expected growth pattern that larvae would ha ve taken at varying temperatures (Grassberger and Reiter 2001). Circumstances altering temperature Temperature variations occur because of long itudinal and latitudinal locations and prevent data correlation with research conducted in different regions of the world (Rodriguez and Bass 1983, Mann et al. 1990, Goff 1992, Goff 1993, Hall a nd Doisy 1993, Lord et al. 1994, Anderson 1997, Anderson 2000, Marchenko, 2001, Nabity et al 2006). Gradual warming has led to changes in faunal communities over the last fe w years (Turchetto and Vanin 2004). Climatic warming has been found to influence a broad range of organisms in Italy. Southern distributed species have moved northward with the increased temperatures, displacing the northern species that are now confined to cooler temperatures or extinction (Turch etto and Vanin 2004). It should 38

PAGE 39

also be noted that global warming could change the validity of published data, rendering it inadequate as references for future generations. Researchers have questioned whether the type of meat larvae feed on could affect growth rates, thus leading to miscalculated post mo rtem intervals. Generally, lab colonies are maintained on and developmental studies are conducted with animal liver, e.g. bovine. The developmental size and rate for Phaenicia sericata was found to be significantly higher on pig tissues than on cow. Insects were visibly larger and developed at a faster rate on heart and lung tissue (Clark et al. 2006 ). This could explain the varying sizes of larvae encountered on a carcass during the first wave of succession. Maggot Mass Temperature Definition of a maggot mass Calliphorid larvae grow more effectively when together in large species-segregated groups known as maggot masses (Cianci and Sheldon 1990, Mann et al. 1990, Greenberg 1991, Byrd and Butler 1996, 1997, 1998; Davis and Goff 2000, Goff 2000, Joy et al. 2002, Peters 2003). The maggot masses form to provide heat for th e larvae and liquefy the tissue being consumed (Deonier 1940, Anderson 1997, Greenberg 1991, Davis and Goff 2000, Goff 2000). Deonier (1940) believed that blow fly larvae devel opment depends more on the temperature of the breeding medium than the ambient air temperature. The developing dipteran larvae congregate in large masses to feed. They lacerate the tissue of the corpse with their mouth hooks, inject salivary enzymes that predigest the food and consume the semi-liquid material. A mass of maggots is more efficient than individual maggots at breaking down the decomposing tissue for consumption (Goff 2000). The maggot masses remain intact and move throughout the carcass as a unit. Metabolic ch anges initiated by the larvae and anaerobic bacteria cause the internal te mperatures of the carcass to rise, Goff (2000). 39

PAGE 40

The maggot mass is a three dimensional arrangement with varying depth, width and number of larvae. There is a correlation between the number of larvae in a mass, size of the mass and volume of the mass and the temperatures produced (Slone and Gruner 2007). In theory, the activity is heavie st in the center of the mass wh ere peak temperature readings are recorded. The larvae within a maggot mass are continually moving, allowing the larvae to grow and feed at their optimal temperature by movi ng into the heated center and then back out to cooler areas. This circular motion is thought to prevent the la rvae from overheating as they choose the best region of the mass for optimal growth. Using maggot mass temperature to calculate PMI Using laboratory generated data or the num ber of accumulated degree days (ADD) to determine PMI can give an incorrect outcome whic h could be costly and detrimental in the court of law. Experiments have shown that devel opmental data collected when temperatures are constant give poor predictions of larval develo pmental times recorded when temperatures are allowed to fluctuate (Hagstrum and Milliken 1991). Insects grow faster at temperatures above 25C and slower at temperatures below this range than at fl uctuating temperatures with similar temperature means, Hagstrum and Mil liken (1991). Introna et al. (1989) used a specialized growth chamber to recreate exact microclimates which produced the same temperature and developmental results as the fiel d. Diptera are poikilother mic and their rate of development is governed by ambient temperature; larvae develop faster at 30C than at 22C (Ames and Turner 2003). It is important to observe the effect increasing maggot mass temperatures have on developmental rates (Joy et al 2002, Peters 2003). Maggots within the body cavities such as the head, chest, abdomen and vagina will feed a nd develop even in freezing weather because they produce their own heat (Mann et al. 1990, Davis and Goff 2000). Masses of blow fly larvae 40

PAGE 41

generate considerable heat that furnishes favor able conditions for larval development during any weather (Deonier 1940). Insects are thought to develop as a func tion of ambient temperature but the teeming, writhing mass of maggots produces significantly elevated temp eratures (Greenberg 1991, Joy et al. 2002, Peters 2003). The elevated temperatures produced by a maggot mass have rarely been examined to further understand the effects on larval development and determining post mortem interval (Cianci and Sheldon 1990, Mann et al. 1990, Greenberg 1991, Hewadikaram and Goff 1991, Byrd and Butler 1996, Anderson 1997, Byrd and Butler 1997, 1998; Davis and Goff 2000, Goff 2000, Campobasso et al. 2001, Greenberg and Kunich 2002). In 1940, Deonier published work on the temperature fluctuations because of the activity of developi ng dipteran larvae in southwestern Texas. It was noted that even in the winter, when eggs had been laid, the larvae were able to develop at maggot mass generated temperatures of 10 to 20 degrees (Fahrenheit) higher than the atmospheric temperature. Duri ng peak development the difference was 50 to 70 degrees F higher than ambient (Deonier 1940). The initial heat from a maggot mass comes from the atmosphere until the larvae begin to develop and feed rapidly theref ore increasing the maggot mass temperature despite the ambient temperature (Deonier 1940, Peters 2003). In 1990, Cianci and Sheldon examined the thermal influence of the maggot mass on the decomposition of four pigs. The temperature dynamics of the maggots we re studied to determin e the thermal influence of the three larval instars, th e magnitude of the temperature ri se and the degree to which the elevated temperature remains independent of am bient temperature (Cianci and Sheldon 1990). It was noted that a peak in maggot mass temperature occurred with the onset of third instar larvae and continued until the maggots left the carcass. 41

PAGE 42

Use of Aquatic Insects Succession studies are generally conducted with terrestrial in sects with emphasis placed on the family Calliphoridae, but many corpses have been found in aquatic environments (Haskell et al. 1989, Davis and Goff 2000). The first published study conducted on corpses in an aquatic setting was done in 1989 by Haskell et al. The researchers studied insects other than blow flies to learn which aquatic species would inhabit a corpse and under what conditions. The main aquatic insects of importance were chironomid midges (Diptera: Chironom idae) and caddisflies (Trichoptera), both capable of colonizing immersed bodies. This knowledge allows for time intervals of submersion to be dete rmined (Haskell et al. 1989). Unconventional Uses of Arthropods Arthropods are useful in solvi ng crimes or murders because of their distinct bite patterns (Prichard et al. 1986). In first documented case, Trombiculiidae mite bites helped solve a rape homicide case and led to the convi ction of the perpetrato r (Prichard et al. 1986). Detectives were bitten by the chigger mites while processing the crime scene and the main suspect was found to have bites on his body. A correct identifica tion of the mites was completed along with examination of the lesions left by the chiggers, thus leading to the conviction and sentencing of the suspect (Prichard et al. 1986). Insect evidence can also lead to false accusati ons or convictions when forensic pathologists and law enforcement officers do not recognize insect feeding wounds on a victim (Denic et al. 1997). This commonly occurs in the accidental deat h of a child; insects such as cockroaches and ants may have fed on the body before its discove ry, leaving behind highly noticeable injuries (Denic et al. 1997). Injuries by animal and insect inva ders should be considered in situations where the organisms are present. Denic et al. (19 87) noted that insect fe eding inflicts markings similar to skin ulcers, burns, or abrasions. 42

PAGE 43

Blow fly larvae and pupae found in clothing or wounds can suggest neglect in children or the elderly prior to death and provide a time line for the abuse (Ben ecke and Lessig 2001). Benecke and Lessig (2001) showed the importance of using insects to determine time of death in addition to the length of neglect. In one instance, young child was f ound dead in a sealed flat in Germany. The anal-genital region of the child was infested with Muscina stabulans (Fallen) and Fannia canicularis (Linnaeus) while Calliphora vomitoria (Linnaeus) were recovered from the face. Knowing the behavior of the larvae encoun tered, the entomologist established a PMI of 68 d; but concluded that the child had not been given a clean diaper for about 14 days, therefore showing neglect had occurred prior to death (B enecke and Lessig 2001). Elderly neglect is an increasing social and criminal c oncern. Forensic entomology can be useful in determining if elderly neglect has occurred wh ile the individual was under the care of someone else. When larvae are present at a crime scene involving an elderly neglected indi vidual, it must be determined if the larvae were present before or after death. The entomologist must also be able to calculate if the larvae are fr esh or have been present for se veral weeks indicating neglect and establishing if the care giver is at fault or not (Ben ecke et al. 2004). Diptera can cause crime scene evidence to app ear as if sexual assault or excessive blood splatter has occurred. Komar and Beattie (1998) showed with pig carcasses that maggot masses, along with natural decompositiona l changes, gave the appearance that sexual assault had occurred. Advanced decompositi on sexual assault cases are more complicated to interpret and can lead to inaccurate conclusions because of maggot behavior (Komar and Beattie 1998). Crime scene investigators are us ually untrained in entomological blood transfer which leads to misinterpreted blood splatter patterns. Knowle dge of insect behavior is necessary when 43

PAGE 44

examining blood splatter patterns. Diptera adults touch many surf aces at a scene while the larvae leave streak patterns af ter wandering away from a corpse (Benecke and Barksdale 2003). Preservation Techniques In 1983, the first paper on prope r collecting and preservation of forensically important entomological materials was published (Lord and Burger 1983). The authors discussed proper and improper methods to collect insects, how to store them prior to being submitted to a forensic entomologist, and how to rear larvae using raw meat. Insects and other invertebrates colonizing corpses during decomposition provide valuable information concerning the time and manner of death. To ensure accurate determinations, spec imens must be properly collected and preserved (Lord and Burger 1983). Many law enforcement agencies are unaware even today of the importance insects can play in homicide, suicid e and accidental death cases. Many do not collect the proper number of specimens, and some agencies do not know the proper method to preserve the insects they do collect. Entomological ev idence has to be discarded at times because improper collection and preservation techniques were used. Research ers have stressed the importance of proper collection a nd have developed helpful protoc ols that describe equipment and techniques for sampling, preserving, packaging, shipping and rearing forensically important insects (Lord and Burger 1983). Chrysomya rufifacies History and Background Chrysomya rufifacies the hairy maggot blow fly, was first recognized and named in 1843 by Macquart in the Nouvelle-Hollande region of Australia. Its distribution was then observed to occur in parts of Asia: China and Japan; Oriental and Australian Regions (Soos and Papp 1986). It was first reported in Hawaii in the early 1900s and in Japan in 1958 (Baumgartner 1993). Chrysomya rufifacies are necrophagous and belong to the order Diptera, family 44

PAGE 45

Calliphoridae and in the subfamily Chrysomyinae (calliphorid larvae with an incomplete peritreme) (Williams and Richardson 1984). The genus Chrysomya comprises about 12 species native to all parts of the Old World tropics and subtropics, with a few species found in the southern Palearctic region (Gagne 1981). Chrysomya is analogous to the genus Cochliomyia found in the New World; each contain one species that is an obligatory parasite attracted to wounds of warm-blooded animals Chrysomya bezziana (Villeneuve) and Cochliomyia hominivorax (Coquerel) (Gagne 1981). All other species of these genera feed on carrion, but many are implicated in mammalian myiasis and as facultative parasites (Gagne 1981). Until the 1970s Ch. rufifacies has confined to the Old World where it was one of the most abundant and economically important blow flies (Baumgartner and Greenberg 1984). Chrysomya rufifacies was the first member of this genus to become established in the continental United States (Wells and Greenberg 1992a). Chrysomya rufifacies is known to attack necrotic tissue therefore making it a major contributor to forensic entomology worldwide. Some have reported Ch. rufifacies as causing myiasis (Sukontason et al. 2005). A male corpse infested with third instar Ch. rufifacies larvae, one day postmortem, indicated that myiasi s had occurred (Sukontason et al. 2005). Arrival and Proliferation throughout the United States Chrysomya rufifacies exact mode of arrival to the New World is unknown but is presumed to have come in via a Pacifi c port or by air (Gagne 1981). In 1985, Ch. rufifacies was collected in Arizona (Baumgartn er 1986). At that time, the impact it would have on the United States was unknown (Baumgartner 1986). In 1990 it was reported in Florida and has since moved throughout the southwes tern and southeastern United States (Butler, Personal communication; Shahid et al. 2000). It is currently known to occu r in several regions of the New World such as Texas (where it was first discover ed), California, Arizona, Louisiana, Florida, 45

PAGE 46

Mexico, Guatemala and Costa Rica (Bau mgartner 1986, Byrd and Butler 1997). Chrysomya rufifacies has since moved north through the Midwestern states and become established in the vicinity of Knoxville, Tennessee (Shahid et al. 2000). The species has become the dominate blow fly on human cadavers in north and central Florida and second most common in south Florida to Chrysomya megacephala (Fabricius) (Byrd and Butler 1997, Peters 2003) The distribution of Ch. rufifacies throughout the United States will factor them into medicolegal cases and decrease their utility as a geographical indicator in post mortem movement of remains. Chrysomya species are strong fliers with considerable autonomous dispersal ability ( Chrysomya rufifacies 6.4 km/day); they can mover phoretically and are synanthropic (Baumgartner and Greenberg 1984). Chrysomya rufifacies have dispersed at a rapid rate since its entry at Boca Parismina, Costa Rica in January, 1978 (Baumgartner and Greenberg 1984). The hairy maggot blow fly has not shown any signs of slowing its invasion. Behavior Over the last 25 years, Chrysomya rufifacies has impacted the United States by displacing the native blow fly species, such as C ochliomyia macellaria (Fabricius), with their predatory nature (Baumgartner and Greenberg 1984, Goodbrod and Goff 1990, Wells and Greenberg 1992a, 1992b; Byrd and Butler 1997, Wells and Sp erling 1999, del Bianco Faria et al. 1999, Shahid et al. 2000, Peters 2003). Chrysomya rufifacies are both necropha gous and facultative predators of other larvae which give them an advantage over C o. macellaria and other dipteran species (Williams and Richardson 1984, Goodbrod and Goff 1990). In their native Australia, Lucilia cuprina s poor performance can be attributed to the presence of Ch. rufifacies which tolerates higher temperatures and is predatory on small larvae (Williams and Richardson 1984). Chrysomya rufifacies behavior invokes the larvae to compete with or prey upon native species and reduce the su rvival rates of the latter (Goodbrod and Goff 46

PAGE 47

1990, Wells and Greenberg 1992a, 1992b, del Bianco Faria et al. 1999). Laboratory work conducted with Ch. rufifacies and Co. macellaria competition provides evidence that the native species may one day become extinct (Goodbrod and Goff 1990, Wells and Greenberg 1992a). Interactions have been observed in field and laboratory experiments that show the superior competitiveness of Ch. rufifacies and the reduction in the number of Co macellaria (Goodbrod and Goff 1990, Wells and Greenberg 1992a, 1992b). Many have observed the pr edacious nature of Ch. rufifacies in the larval stage (Goodbrod and Goff 1990, Wells and Greenberg 1992a 1992b, Baumgartner 1993, Butler, personal communication, Goff, personal communication, Peters 2003). In 1990, Goodbrod and Goff observed the predatory nature of Ch. rufifacies on Ch. megacephala When the two species were mixed together in laboratory cultu res, the larval mortality of Ch. rufifacies remained relatively stable but that of Ch. megacephala decreased directly with population density. Similar results were found by Wells and Gr eenberg (1992a) between Chrysomya rufifacies and Cochliomyia macellaria. The third-instar Ch. rufifacies larvae are equipped w ith saw-toothed mouthhooks which enable this type of feeding be havior (Sukontason et al. 2001). Chrysomya rufifacies is both a primary and secondary colonizer of carrion (OFlynn and Moorhouse 1979). Chrysomya rufifacies arrive to a carcass soon after death and oviposition may occur in the early stages of d ecomposition before bloat, therefor e rendering it a primary fly. But at times the adult females wait until putrificatio n before ovipositing and do not colonize until 2448 h after other species have oviposited (Peters 2003). Taxonomy Chrysomya rufifacies is a member of the family Calli phoridae, which includes the blue bottle and green bottle flies, or blow flies (James 1947). According to James (1947), the members of the genus Chrysomya are rather small to medium sized flies. They are brilliant 47

PAGE 48

metallic green to blue or purple with the narrow apices of the abdominal segments opaque black. The eyes are broadly separated in the females and narrow or contiguous in the males. The epistoma projects downward and forward while the palpi are well developed and somewhat thickened apically. The posterior coxae are ba re from behind and the lower squamae are bare from above (James 1947). The key provided by James (1947) describes Chrysomya rufifacies with vibrissae well above the oral margin; 8 mm or more in length; wings entirely hyaline; mesothoracic spiracle white; stigmatic bristle present; mesonotum in from of the suture wholly green; parafacials and facials extensively reddish; parafrontals of male with numerous pale hairs, in several rows, in addition to the very weak bristles. Chrysomya megacephala are similar according to James (1947) with vibrissae well above the oral marg in; 8 mm or more in length; wings entirely hyaline but then the two species begin to differ. Instead of a white mesothoracic spiracle, Ch. megacephala has a brown mesothoracic spiracle along with squamae yellowish to dirty gray; front and frontalia of female bulging in the middl e, not parallel-sided; eyes of male with a definite area of smaller facets below; frontalia of female dark brown to black, the parafrontals and parafacials dark grayish, James (1947). There were several visual diffe rences observed by the author between the adult and larval stages Chrysomya megacephala and Ch. rufifacies. Chrysomya megacephala are larger more robust adult flies with bigger eyes that are aligne d straight across (Figures 2-13 and 2-14). Both species has adults have a silver stripe behind the eyes. The Ch. rufifacies eyes are aligned curving toward the back of the body (Figures 2-16 and 2-17). The Ch. rufifacies adult has a green and blue thorax with a blue abdomen in which the segments are separated with dark blue/black horizontal lines. The Ch. megacephala adults are deep blue in coloration throughout 48

PAGE 49

49 the body and have more setae than Ch. rufifacies. The thorax of Ch. megacephala is more robust with visible indentations giving it a muscular appearance. The Ch. rufifacies thorax lacks the indentations but contains a point ed scutellum. There is a notic eable difference between the adult flies in the face; Ch. rufifacies have an orangey/pale colored face while Ch. megacephala has a gray/dingy coloration. The larvae of the two species exhibit even more variations then that of the adult flies. The integument Chrysomya megacephala larvae are wrinkled with no protuberances; a few small protuberances encircle the posterior spiracle region (Figure 2-15). The Chrysomya rufifacies larvae are commonly known as the hairy ma ggot blow fly because of numerous fleshy protuberances present on each body segment and en circling the posterior sp iracle region (Figure 2-18). The Ch. rufifacies larvae are larger than the Ch. megacephala larvae. Chrysomya rufifacies larvae have well-defined and highly visible mouthhooks. Chrysomya megacephala larvae are smaller in size but the pupae are larger than Ch. rufifacies pupae.

PAGE 50

Figure 1-1. Chrysomya megacephala adult female reared in the laboratory colony, top view. Figure 1-2. Chrysomya megacephala female reared in the la boratory colony, side view. 50

PAGE 51

Figure 1-3. Complete life cycle (eggs, 1st instar, 2nd instar, 3rd instar, post-feeding 3rd instar, pupa, and male adult) of Chrysomya megacephala. Figure 1-4. Female Chrysomya rufifacies adult reared in the labor atory colony, from above. 51

PAGE 52

Figure 1-5. Chrysomya rufifacies adult female reared in the laboratory colony, side view. Figure 1-6. Complete life cycle (eggs, 1st instar, 2nd instar, early 3rd instar, 3rd instar, postfeeding 3rd instar, pupa, and adult) of Chrysomya rufifacies 52

PAGE 53

DNA All humans carry similar sets of DNA except for minor variations making every person individually distinguishable by a DNA fingerprint. With the exception of identical twins, this makes DNA a useful tool in forensic scienc e. Since only a small portion of the DNA can actually be examined, a DNA sample can narrow down the number of possible suspects in a criminal case (Griffiths et al. 1996). The earliest DNA fingerprint ing technique performed by Sir Alec Jeffreys and his colleagues consisted of using the multi-locus probe (MLP) that used restriction enzymes to cleave DNA into fragment s (Lynch 2003). The MLP technique illustrates selected sequences of single-stranded DNA and compares the sizes. The MLP technique was quickly replaced by the single-locus probe (SLP) in the late 1980s. This involved the isolation and marking of a limited number (4, 6, 8 and sometimes more) of noncoding DNA regions known as variable number of tandem repeat (VNTR) sequences (Lynch 2003). The selected VNTR sequences were shown to be hypervariable within the human population and were marked by radioactive probes. This method was eventu ally scrutinized by the court systems and in scientific literature leading to a new system for analyzing DNA. By the mid-1990s, criminal justice systems in the United Kingdom, the European Union and the United States converged on a new system, the multiplex short tandem repeat (STR) system. This system uses hypervariable DNA sequences of relatively short length. STR involves the use of the polymeras e chain reaction (PCR) to amplif y the amount of analyzable genetic material in a sample (Lynch 2003). With STR, generally 13 or so markers are chosen to profile and are illuminated by means of laser scans. The human mitochondrial DNA circular genome is much smaller than human nuclear DNA. Mitochondrial DNA (mtDNA) has become impor tant in anthropological and evolutionary research along with its forensic science appl ications (Butler and Le vin 1998). Mitochondrial 53

PAGE 54

DNA comes from the egg of an individuals mother with contribution from the father. Nuclear DNA is a combination from both parents; ther efore, it goes through recombination with generations. The mtDNA represen ts only the maternal ancestry of an individual (Butler and Levin 1998). Benefits of DNA in Forensic Science The acceptance of DNA profiling as a cer tain, error-proof method of personal identification has influenced the amount of trus t invested in it (Lynch 2003). DNA profiling is referred to as the new gold standard in forensic science. Over the past 20 years, DNA analysis has revolutionized forensic investigations. Any biological material associ ated with a legal case contains information about its source (Jobling and Gill 2004). Since the 1980s, DNA testing has been shown to be an extremely accurate and a reliable way of linking suspects to crimes. The polymorphic nature and maternal inheritance are ch aracteristics that have enabled investigators to identify missing persons, war casualties and individuals involved in mass disasters and criminal cases (Butler and Levin 1998). Th e use of human mitochondrial DNA has become a useful tool in forensic investig ations; it is utilized primarily in cases in which the nuclear DNA is too degraded or cannot be r ecovered in sufficient quantities (Butler and Levin 1998). The development of DNA fingerprinting has provided a wa y to link suspects to crime scenes or one crime scene to another. Mitochondrial DNA can be amplified from skin, blood, semen, and saliva as well as teeth, hair shafts, bone frag ments, and even human feces (Jobling and Gill 2004, Butler and Levin 1998). Jobling and Gill (2004) provided the following timeline for the development of forensic genetics: 1900: first genetic polymorphism, hum an ABO blood groups discovered by Lansteiner. 54

PAGE 55

1915: first antibody test for blood group (ABO ) introduced and used by Lattes. 1920: Locard lays down principle that e very contact leaves a trace. 1920ss: discovery and use of other blood groups and serum proteins (e.g. MNSs system, Rhesus, Lewis, Kell, haptoglogin). 1960ss: multilocus DNA fingerprinting de veloped by Jeffreys; followed by single-locus profiling (SLP). 1984: the discovery and use of electrophoretic variants of red blood cell enzymes (e.g. phosphoglucomutase gl yoxylase) occurred. 1986: New York vs. Castro judgment on admissibility of DNA evidence led to strict quality control. 1988: the first commercial forensic PCR kit used for detecting SNPs at the polymorphic HLA-DQA1 locus by dot blot and oligonucleotid e hybridization was developed. 1991: first useful polymorphic human STRs characterized. 1992: first commercial forens ic STR profiling kits developed. The first Y-STR was described and used in casework in Germa ny for the acquittal of rape. First use of mtDNA in casework in the UK and the publication of National Research Council report DNA Technology in Forensic Science. 1993: first mass disaster case (Waco, Texas). 1995: UK National DNA Database becomes established (STR profiles). 1996: publication of National Research Counc il report The Evaluation of Forensic DNA Evidence. 1997: DNA profiling from touched objects a nd single cells is demonstrated. Human forensic casework is done now us ing commercially developed autosomal STR multiplexes (single-tube PCR reac tions that amplify multiple loci). Many cases have been solved because of DNA testing and ma ny wrongly-convicted prisoners have had their convicti ons overturned as a result of retrospective DNA analysis of old evidence (Henderson 2002). Unsolved cold cas es involving sexual assault can be solved 55

PAGE 56

decades later by analyzing degraded DNA on stored swabs or microscope slides (Jobling and Gill 2004). DNA profiling techniques include identifying specific ch aracteristics, or genotypes, in evidence obtained from a crime scene and comparing those to the suspects sample (Henderson 2002). Despite how powerful DNA analys is can be, it must be considered within the framework of other evidence. The geneticist is not to presume guilty or innocent but to provide unbiased information to a judge and jury in a manner that all can unde rstand (Jobling and Gill 2004). DNA databases were established to apprehend suspects of a crime. DNA from a crime scene is matched with known suspects, but matching recovered DNA from a crime scene to a database of offender DNA profiles allows for unknown suspects to be investigated (Jobling and Gill 2004). Large databases with permissive entry cr iteria can be a powerful tool but that raises many ethical questions into the way DNA is collected (Jobling and Gill 2004). Non-human DNA is commonly used in forensic genetics. Analysis of animal DNA has been used both when animal materials (usually pet hairs) are found at crime scenes and in investigations of th e illegal trade in endangered species (Jobling and Gill 2004). Importance of DNA in Forensic Entomology The use of entomology in forensic science is based on determining the time of death, referred to as the post mortem interval (PMI). A crucial aspect of calculating the PMI is the correct and prompt identification of the Diptera collected from a crime scene (Sperling et al. 1994, Azeredo-Espin and Madeira 1996, Roehrdanz and Johnson 1996, Benecke 1998b, Malgorn and Coquoz 1999, Lessinger and Azeredo-Espin 2000, Vincent et al. 2000, Litjens et al. 2001, Wallman and Adams 2001, Wallman and Donnella n 2001, Wells and Sperling 2001, Wells et al. 2001a, Otranto et al. 2003, Ratcliffe et al. 2003, Harvey et al. 2003a, 2003b, Chen et al. 2004, Linville et al. 2004, Zehner et al 2004, Harvey 2005, Thyssen et al. 2005). To determine PMI 56

PAGE 57

one must know the species behavior and develo pmental times. Currently the most common way to identify Diptera to its speci es is by examining the adult stage under a compound microscope site identification. This require s that the larvae collected from a crime scene be reared until development is complete. This may take at least a week. The Diptera can be identified in the larval form, but if the critical characteristics are small or vary ever so slightly, misidentification is possible (Sperling et al. 1994, Wells and Sperling 1999, Litjens et al. 2001, Wallman and Adams 2001, Wallman and Donnellan 2001, Wells and Sperling 2001, Wells et al. 2001a, 2001b; Harvey et al. 2003a, 2003b; Linville et al. 2004, Zehner et al. 2004, Thyssen et al. 2005, Wells and Williams 2007). Morphological identification is difficult within the order Diptera, which consists of many species and has few id entification experts (B enecke 1998b). A more precise method is to identify the Diptera gene tically by encoding the collected DNA sequence at mitochondrial cytochrome oxidase gene sub unit I (COI), cytochrome oxidase gene sub unit II (COII) and tRNA-leucine genes (Sperling et al. 1994). In 1994, Sperling et al. showed differences between Phormia regina, Phaenicia sericata, and Lucilia illustris at mitochondrial COI, COII and tRNAleucine genes that would clearly distinguish the species. DNA typi ng allowed the PMI to be calculated within days instead of weeks. Restriction analysis of mtDNA was used to examine the population genetics of Phaenicia eximia (Robineau-Desvoidy) in a case of prim ary myiasis in a dog in Brazil (AzeredoEspin and Madeira 1996). The end results show ed that two evolutio nary populations had occurred genetically, one that caused primary myiasis, and the other secondary myiasis, most likely for survival purposes (Azer edo-Espin and Madeira 1996). This was not evident by sight identification and would not have been discove red if it were not for DNA examination. In 1996, a Cochliomyia macellaria (Fabricius) mitochondrial DNA restrict ion site map was constructed to 57

PAGE 58

compare with that of Cochliomyia hominivorax (Coquerel). Only slight differences between the two species were found, therefor e showing how close they were genetically as well in appearance. DNA typing provides a nother way to correctly identify the two species (Roehrdanz and Johnson 1996). The first use of random amplified polym orphic DNA (RAPD) typing of necrophagous insects was reported in 1998 by Benecke (1998b). Th is method allows for quick identification of arthropods dipteran larv ae in particular which were collect ed at the morgue from within a body bag, outside the bag and from pupae found on th e floor under the corpse. The researcher wanted to determine in a timely and cost effectiv e manner if all specimens collected were of the same species of Diptera. RAPD typing has drawbacks and probably should only be used when there are time constraints; th e standard mtDNA typing is more accurate (Benecke 1998b). In 1999, Wells and Sperling analyzed the mitochondrial DNA of two Chrysomya species, Ch. rufifacies (Macquart) and Ch. albiceps (Weidemann). The first species recently invaded the continental United States and was out competing the native calliphorids; the latter had not been identified in the States. Both species of Chrysomya were almost identical in appearance in the larval form with few identification keys of the species available to most entomologists, thus DNA typing was a more efficient and reliable mean s of identification (Wells and Sperling 1999). At the same time, two popular species of Calliphorids, Lucilia and Calliphora vicina found throughout France, were DNA typed for identification purposes because the larvae were also very close in characteristics (Malgorn and Coquoz 1999). The two species of interest are both screwworms but have different growth rates and life cycles making it very important to know which species is present. 58

PAGE 59

Researchers in Brazil have extracted cytoch rome oxydase subunit I (COI) and the A + T rich/12S region from Cochliomyia macellaria and Co. hominivorax using polymerase chain reaction restriction fragment length polymor phism, PCR-RFLP, of mitochondrial DNA for the purpose of unambiguous identification (Litjens et al. 2001). The results confirm the conservation of COI restriction sites previously reported and also demonstrate the usefulness of the control region sequence as e fficient identification markers (L itjens et al. 2001). The PCRRFLP method proved to be an accep table means of DNA typing of Hemilucilia segmentaria (Fabricius) and H. semidiaphana (Rondani), two species th at are morphologically and behaviorally similar, but with differences in growth and maturation rates (Thyssen et al. 2005). PCR-RFLP was conducted on members of Musc idae, Sarcophagidae and Calliphoridae in Illinois, providing varying amplification product s demonstrating PCR-RFLP a useful method in identifying forensically important insects (Ratcliffe et al. 2003). DNA typing in the field of forensic ento mology focuses on the family Calliphoridae, which is the most prominent family of insects found on a corpse. Anothe r family of importance is Sarcophagidae; in general, they are much hard er to separate in species by sight identification, thus increasing the importance of DNA. Many have forgone using Sarcophagidae as a forensic indicator because of the inabi lity to recognize the species (We lls et al. 2001a). A mtDNA sequence database was developed to identify a ll sarcophagid species found on a corpse and those known to feed on feces or live ma mmalian tissue. DNA databases where set up for forensic and myiasis important flies to facilitate in identification of flies collected from a crime scene. The databases were set up to rule out myiasis before death and, as a result, ove restimation of the post mortem interval (Wells et al. 2001a). 59

PAGE 60

Molecular characterization of the mtDNA cont rol region was conducted on five dipteran species which cause myiasis (Lessinger a nd Azeredo-Espin 2000). Advancements in DNA typing and technology have led to th e DNA analysis of several forensically important insects that are difficult to sight identify. In particular, myiasis-causing species have been DNA sequenced to establish a molecular database to match sequences for correct identification. Mitochondrial DNA typing of Ca lliphoridae has been very succe ssful at providing several sequence databases for comparison of larvae and adults collected from crime scene (Wallman and Donnellan 2001, Wells and Sperling 2001, Ha rvey et al. 2003a, 2003b; Chen et al. 2004, Wells and Williams 2007). DNA can be extracted from an insect despite preservation methods or age. Mitochondrial DNA has been sequenced from museum specimens (Junqueira et al. 2002). This has opened the door to DNA extractions of insects collected years ago in criminal cases and reduces the incidences of evidence being lost becaus e of poorly preserved larvae collected from a case. Whatman FTA cards are suitable for storing and transporting calliphorid DNA templates and provide a simple and efficient method of extraction that allows for storage and transportation without refrigeration (Harvey 2005). These advancements have lead forensic entomology in a new direction by lowering the un ambiguous identification of blow fly species. Continual DNA typing is necessary for a complete database of all forensically important insects making identification easier and post mortem interval calculation more efficient. DNA Typing of Gut or Blood Meal Contents DNA from an insect has the potential to be useful in more ways than just species identification. It can also identify the last f ood source of the insect (Boakye et al. 1999, ChowShaffer et al. 2000, Wells et al. 2001b, DiZinno et al. 2002, Ngo and Kramer 2003, Pichon et al. 2003, Linville et al. 2004, Zehner et al. 2004, Mumcuoglu et al. 2004, Gill et al. 2004). The DNA from the crops of dipteran larvae, or stomac h, have been extracted and analyzed with PCR 60

PAGE 61

to determine what they fed upon. In forensic entomology, DNA typing of gut contents provides evidence that a carrion-fly maggot developed on a particular victim (Wells et al. 2001b). DNA typing of the gut contents of a maggot collected from a crime s cene confirms that the maggot being used for post mortem interval actually developed on the victim (Wells et al. 2001b, Linville et al. 2004, Zehne r et al. 2004). Zehner et al. (2004) demonstrat ed the possibility of analyz ing human microsatellite DNA within the digestive tr act of necrophagous larvae for the first time. Proving larvae-corpse association in a homicide case is crucial evidence Bodies are dumped in garbage ridden areas where larvae grow naturally, and using these larv ae to calculate PMI can ca use errors (Zehner et al. 2004). Factors that could lead to complications in solving a cas e are 1) investigators discover maggots but no corpse, 2) maggots are not found di rectly on a corpse and an alternate food source is nearby, and 3) maggots are found on a corpse but may have come from somewhere else (Wells et al. 2001b). DNA typing of the gut conten ts would distinguish th e corpse as the food source ensuring the larvae as useful fo r determining post mortem interval. The proper way of collecting and preserving larvae from a crime scene for DNA typing is important. Most crime scenes are handled by la w enforcement personnel without formal training on proper collecting methods of larvae; many do not even collect the larvae as evidence. Even when law enforcement personnel are trained in the proper techniques for collecting larvae problems can still occur with preservation. Many techniques have b een used to preserve dipteran larvae upon collection. Some methods de grade the DNA within the maggots making DNA typing harder or entirely impossi ble (Linville et al. 2004). The us ual methods of preservation are no fluid at -70C, no fluid at 4C, no fluid at 24C, 70% ethanol at 4C, 70% ethanol at 24C, 95% ethanol at 24C, Kahles solution at 24C and formaldehyde at 24C (Linville et al. 2004). 61

PAGE 62

DNA was successfully amplified fr om all specimens stored with and without ethanol; without fluid at -70C gave the best results and the fo rmalin-containing preservation solutions reduced the amount of DNA recovered (Linville et al. 2004). The ability to isolate, amplify and sequence human DNA from within the gut of dipteran larvae is a huge step forward for forensic ento mology. One dipteran larvas gut contents can be typed to the host as well as to the insect species. In addition to larval gut contents being used for DNA typing, several scientists have extracted human DNA from hematophagous (blood feeding) and necrophagous (carrion feeding) arthropods with th e use of polymerase chain reaction (PCR) DNA sequencing methodologies (B oakye et al. 1999, Chow-Shaffe r et al. 2000, DiZinno et al. 2002, Ngo and Kramer 2003, Pichon et al. 2003, Mumcuoglu et al. 2004, Gill et al. 2004). DNA assay for bloodmeal identification in haematophagous Diptera, black fly Simulium damnosum s.l. (Theobald) and tsetse fly Glossina palpalis (Wiedemann) was accomplished using PCR of the cytochrome b gene sequences. The bloodmeals were able to be identified several days postingestion, distinguishing between mammalian host sa mples to render this technique reliable for host identification (B oakye et al. 1999). Beetle larvae, Omosita spp. collected from human skeletal remains were analy zed using mtDNA sequencing with success (DiZinno et al. 2002). Host blood meals from mosquitoes were identifie d with the use of PCR with primers for the cytochrome b gene that distinguished betw een mammalian and avian blood; detection was possible up to three days after feeding (Ngo a nd Kramer 2003). Remnant blood meals in the tick gut, Ixodes ricinus Linnaeus, analyzed for the detection of pathogens and host identification has been accomplished (Pichon et al. 2003). Pool ed bloodmeals of head and body lice have been collected, amplified and matched to the hosts DNA, therefore, indicating louse bloodmeals as 62

PAGE 63

evidence in a criminal case where close proxi mity occurred between assailant and victim (Mumcuoglu et al. 2004). Microsatellite DNA Microsatellites, also referred to as simple sequence repeats (SSRs), are tandemly repeated motifs of 1 6 bases found in al l prokaryotic and eukaryotic ge nomes. They are present in coding and noncoding regions and usually ch aracterized by a high degree of length polymorphism (Zane et al. 2002). Microsatellit es are highly variab le, thus making them powerful genetic markers and, in turn, extremel y valuable tools for genome mapping. They provide codominant genotypic data on individual distinguishable loci and are more multiallelic and polymorphic, thus being more informative (Palo et al. 1995). A major drawback to microsatellites is that they need to be isolated de novo from most species being examined for the first time, since they are found in the noncoding re gions where the nucleotid e substitution rate is higher than in coding regions (Zane et al. 2002). Isolation of microsatellite regions is achieved by means of Southern hybridization of RAPD profiles with repeat-conta ining probes. This is follow ed by the selec tive cloning of positive bands or through the cloning of all the RADP products and the screening of arrayed clones (Zane et al. 2002). Microsatellites are widely used in human genetics and in genomic studies of other vertebrates; very small sample sizes make them more user friendly for the animal of interest, but they are labor intensive (Palo et al. 1995). Bear Microsatellite DNA Research Wildlife specialists have researched the gene tic makeup of various bear species for many years to understand their behavi or, lifestyles and migration pa tterns (Paetkau and Strobeck 1994, Paetkau et al. 1995, 1997; Wasser et al. 1997, Mas uda et al. 1998, Paetkau et al. 1998, 1999; Waits et al. 2000, Ruiz-Garcia 2003 Roon et al. 2005, Dixon et al. 2006 ). A leader in the field 63

PAGE 64

of bear DNA research and the developer of micr osatellite PCR techniques, Paetkau, has dedicated his life to bear DNA wor k. A suite of eight microsatelli tes has been used extensively to study the population and ecological genetics of th e three species of bear s that occur in North America; the black bear ( Ursus americanus), brown bear ( U. arctos ) and polar bear ( U. maritimus ) (Paetkau and Strobeck 1994, Craighead et al. 1995, Paetkau et al. 1995, 1997, 1998, 1999; Ruiz-Garcia 2003, Dixon 2006). The basis of most bear research is for cons ervation purposes, especia lly in locations where the populations are being depleted by hunting or road kill faster than they can repopulate (Masuda et al. 1998, Ruiz-Garcia 2003). Masuda et al. conducted a study in 1998 that partially sequenced the mtDNA control regi on of some Asian brown bears and compared it with European brown bears to further determine evolutionary orig in. The results of this study showed that the Asian brown bears are genetically closer to the European brown bear lineage than in location (Masuda et al. 1998). Another ap plication included the evalua tion of Ursid fecal DNA as an alternative to extracting and am plifying an individuals tissue or blood, which is obviously a more invasive procedure. Fecal samples are easie r to acquire and with a simple drying agent are preserved effectively, making them easy and safe to transport from the field (Wasser et al. 1997). The use of feces eliminates the trouble of havi ng an adequate sample si ze of tissue or blood to conduct molecular studies. Feces are abundant, and a single gram of feces contains large quantities of the hosts DNA from sloughed intestin al mucosal cells (Wasser et al. 1997). The objective of the experiment reported here is to examine the role the maggot mass has in decomposition and temperatur e production. The purpose of this experiment is to better understand the behavior, function and purpose of the maggot mass, observe the temperature produced by it, determine how this affects the growth rate of the maggots, and determine any 64

PAGE 65

65 effects this will have on the cu rrent ways of calculating the post mortem interval. In addition, the DNA contents of a maggot gut and bear tissu e samples will be anal yzed with the eight microsatellites referenced above, suggested by Paetkau, to identify a specific bears DNA for individual identification. The contents extracted from the gut of the dipteran larvae have the potential to be DNA typed back to the host upon which the larvae fed.

PAGE 66

CHAPTER 2 DEVELOPING Chrysomya BLOWFLY COLONIES Introduction Forensic entomologists typically use labor atory colonies when conducting research experiments (Ash and Greenberg 1975, Levot et al. 1979, Williams and Richardson 1984, Liu and Greenberg 1989, Goff et al. 1991a, Hagstrum and Milliken 1991, Wells and Greenberg 1992a, Wells and Kurahashi 1994, Greenberg and Singh 1995, Wells and LaMotte 1995, Byrd and Butler 1996, dAlmeida and Barbosa Salv iano 1996, Queiroz 1996, Roehrdanz and Johnson 1996, Byrd and Butler 1997, 1998; del Bianco Fari a et al. 1999, dos Reis et al. 1999, Malgron and Coquoz 1999, Wells and Sperling 1999, Vin cent et al. 2000, Byrd and Allen 2001, Grassberger and Reiter 2001, Wallman and Adams 2001, Wells and Sperling 2001, Grassberger and Reiter 2002a, 2002b; Harvey et al. 2003a, 2 003b; Ratcliffe et al. 2003, Sukontason et al. 2003, Chen et al. 2004, Mumcuoglu et al. 2004, Gomes and von Zuben 2005, Sukontason et al. 2005, Donovan et al. 2006). Developing and ma intaining a colony of flies have many advantages. Colonies allow the researcher to control experime nt start times, life stage, and number of larvae or adult flies used. When conducting studies out doors, a research site is not contained and has many variables that affect development. E xperiments conducted in this study were done with wild insects wh en carcasses were available an d with laboratory colonies developed to run laboratory maggot mass behavioral studies. Two species were chosen for the laboratory colonies: Chrysomya rufifacies and Chrysomya megacephala. Both species are very important in North Central Florida in decomposition studies and thus laboratory trials because of their ability to detect and utilize a carcass. Chrysomya rufifacies are primary colonizers that ov iposit after othe r calliphorids oviposit and the Ch. rufifacies larvae are predatory on other ca lliphorid larvae (Goff et al. 1988, 66

PAGE 67

Goodbrod and Goff 1990, Butler, personal communication). Chrysomya rufifacies is an immigrant species, that is slowly moving nor th through the continental United States. Chrysomya megacephala is also an immigrant species making its way throughout the United States. Because of their presence in forens ic cases and on carcasses found throughout the state of Florida, both species were reared in the laboratory to obtain more information on developmental rates and behavior. The objectives of starting and maintain ing a fly colony are 1) to show that Chrysomya rufifacies and Chrysomya megacephala can be reared in the lab for sequential generations and 2) to provide Chrysomya rufifacies larvae of the same age for the la boratory maggot mass studies. Methods and Materials At approximately 10:00 AM on 10 May 2007 a dona ted dead pig was placed in the Natural Area forest located in Gainesville, Florida, acro ss from the University of Florida Entomology and Nematology Department. The pig was pl aced beneath a piece of 19 gauge multi-purpose mesh wire (36 x 5 91.4 cm x 153.7 cm) to protect against scavengers. The pig had a weight of 10.4 kg. On 11 May 2007 more than 100 1st instar Chrysomya megacephala larvae were collected from the pig carcass. They we re then taken to a rearing chamber at USDA CMAVE, Gainesville, Florid a occupied by a colony of Hydrotaea aenescens. On 14 May 2007 > 200 2nd and 3rd instar Chrysomya rufifacies larvae were collected from the same pig carcass and brought to the same rearing chamber at CM AVE. The rearing chamber temperature was set at 28C with a humidity of 56%. The fluorescent light was on 24 hours a day along with a UV insect light trap. All larvae were reared on stor e purchased spoiled ch icken thighs (wt. 16 8. 3 g 5 g) in a large rectangle Ziploc container (76 FL OZ, 2.25L; 28 cm x 17.7 cm) for 2 or more days prior to use (Figure 2-1). Next the wandering 3rd instar larvae were placed into another large size 67

PAGE 68

Ziploc container, same size as above, with 5.08 cm of All Purpose Sand leveling sand (Gravelscape, Sanford, Florida) and allowed to pupate. Pupae were removed from the sand by hand and placed in a plastic squat cup (4 cm high x 11.5 cm wide) within rearing cages (18 in x 18 in x 12 in; 45 cm x 45 cm x 30 cm) constructed of mesh screening sides with aluminum support structures (Figure 2-2). Each cage of in sects was given water, sugar and powdered milk ad libitum. Moistened blood meal was also provided ad libitum for Chrysomya rufifacies adults upon emergence to promote oviposition. Three to six days after emergence, Chrysomya megacephala and Chrysomya rufifacies adults were given a piece of spoiled chicken in a squat cup to encourage mating and promote oviposition. The piece of chicken and the cup were removed from the adult cage after 1 d and placed in large Ziploc containers, same size as above, for eggs to hatch and larvae to develop. Two additional pieces of chicken were provided for larval rearing. The Ziploc container was placed in a Hefty EZ Foil Cake Pan (1/4 sheet cake size, 12 in. x 8 in. x 1 in., 311mm x 209mm x 31mm) to contain any wandering larvae. The number of eggs collected from Chrysomya megacephala and Chrysomya rufifacies after oviposition was estimated at 200-300 eggs per chicken thigh. The eggs were counted out to verify estimation. Actual numbers of eggs versus estimated number of eggs were found to be within 10; therefore estimations were used throughout development. In addition, egg and pupae eclosion studies we re conducted to determ ine survivability. Ten freshly laid eggs were placed in a folded, moist paper towel (28 cm x 23 cm) within a Petri dish (8.8 cm in diameter). The Petri dish wa s covered and placed inside the rearing chamber overnight. The next morning the number of la rvae present was counted and recorded. Four replications of 10 eggs were c onducted to determine an overall survival percentage. The pupal 68

PAGE 69

eclosion rate was also determined; 10 pupae were counted out and placed within a small Styrofoam cup (6 cm high x 8.6 cm wide) covered with a Petri dish. The cups of pupae were held within the rearing chamber until eclosion (4-7 d). Four replications of 10 pupae were conducted to determine overall survival percenta ge. The number and ratio of female to male adults were recorded after a dults were killed by freezing. Results The Chrysomya megacephala adults resulting from the larvae collected from the pig emerged in the rearing chamber 5-9 d after pupa tion. Mating began 2 d after emergence and oviposition occurred at 3-4 d of age (Table 2-1) The egg eclosion rate was 55% (Table 2-2). Egg masses, like those shown in Figure 2-3, cont ained 200 300 eggs laid individually. Eggs held at 28C hatched in 1 d. Chrysomya megacephala larvae grew well at densities of 200 300 larvae per 2 pieces of chicken (wt. 168.3 5 g). Second instars were pr esent 48 h after hatching, becoming 3rd instars 48 h later. The thir d instar larval stage lasted 4-6 d with pupation occurring earlier for some. Chrysomya megacephala larvae never consumed more than three pieces of chicken. Mean Ch. megacephala adult emergence rate was 37.5% (Table 2-2). Females accounted for 35.5% of the adult flies. Four generations of Chrysomya megacephala were reared. Mean development from the time of oviposition to pupation was 12.0 d. The first generation reared completely in the laboratory (F2) took 14.5 d to pupate after oviposition (Table 2-1). Eggs were present on the first and second days of oviposition. On day two 1st instar larvae were present until day three; at which point the larvae molted into 2nd instars. On day five, 3rd instar larvae were present with pupation starting on day eleven. All larvae had pupated by the fourteenth day after oviposition. The F3 generation had eggs present on th e first and second days with 1st instar larvae appearing on day three after oviposition (Table 2-1). First instar larvae we re present on days three and 69

PAGE 70

four; on day four the larvae developed into 2nd instars. Third instar larvae were present on day five but pupation did not begin until 12 d after oviposition. Unlike the other generations of Ch. megacephala, the F3 larvae did not pupate completely until 20 d after oviposition. The Chrysomya megacephala F4 generation grew very quickly after oviposition, taking one day for each life stage (Table 2-1). By day three, 3rd instar larvae were present with the onset of pupation occurring 9 d to 12 d after oviposition. The final generation (F5), took a total of 15 d to reach pupation after oviposition (Table 2-1). The eggs were present on days one and two with 1st instar larvae present on the third day. Second instar larvae present on the 4th and 5th d molted into 3rd instar larvae 6 d after oviposi tion. Pupation occurred on the f ourteenth and fifteenth days after oviposition. Chrysomya rufifacies adults resulting from reared larvae collected from the pig emerged in the rearing chamber 4-5 d after pupation. Mating was observed 4 d after emergence with oviposition occurring at 6 d of age (Table 2-3) One to two eggs masses were deposited on a single piece of chicken; each mass contained 20 0-300 individual eggs. The egg eclosion rate was 68% (Table 2-2). Within 1 d of eggs being deposited 1st and sometimes 2nd instar larvae were present. The larvae grew best at dens ities of 200 300 larvae pe r 4 pieces of chicken. Third instar larvae were first obser ved 2 d after egg emergence. The Ch. rufifacies 3rd instar larval stage lasted 7-9 d with pupation first occu rring at 7 d. All provide d chicken was consumed by the larvae throughout development and sometimes another piece had to be added to the container. Adult emergence rate was 80.0% (Table 2-2) with females accounting for 78.0% of the adults. The Chrysomya rufifacies laboratory colony was reared for a total of five generations. Larval development, from oviposition to pupation, took 11 to 15 d. The first laboratory 70

PAGE 71

generation of Ch. rufifacies (F2), took a total of 12 d to reac h pupation after oviposition (Table 23). The larvae developed into 3rd instars within 3 d. On the tenth day following oviposition, the larvae started to pupate. The next ge neration maintained in the laboratory (F3) became 1st instar larvae 3 d after oviposition, on day four 2nd instars were present, and on day five the larvae had developed into 3rd instars (Table 2-3). The first day of pupation occurred 13 d after oviposition. The F4 generation 1st instar larvae were not present until 4 d after oviposition (Table 2-3). On the fifth day, 2nd instars were present until da y six when they molted into 3rd instar larvae. Pupation of the F4 larvae took place on days twelve a nd thirteen post-oviposition. Chrysomya rufifacies F5 generation exhibited a new staring generation (egg, 1st instar, 2nd instar, and 3rd instar) every 24 hours after ovi position (Table 2-3). The 3rd instar stage was present from day four to day nine when the larvae pupated. The final generation (F6) had developing 1st instar larvae the second da y after oviposition (Table 2-3). On the 3 and 4 d, 2nd instar larvae were collected with 3rd instars developing from day five to day eight. Larvae pupation began on the ninth day and continued to the eleventh day post-oviposition. Discussion The laboratory colonies came about with th e collection of second instar larvae removed from the decomposing remains of a pig. Chrysomya megacephala larvae were collected within the 48 hours from the mouth and snout of the pig, while Chrysomya rufifacies were not collected until 72 hours after death from the pigs abdomen. Several earlier attempts were made to collect larvae with store purchased calf liver and chicken thighs with no success. Chrysomya rufifacies was observed to be a frequent visitor of fres h mammalian carcasses but c ould not be collected with store purchased meat sources (e .g. chicken thighs, liver). Chrysomya rufifacies adults were found to be very se nsitive to ambient temperature variations of the rearing chamber. Chrysomya rufifacies is considered a warm weather species 71

PAGE 72

and the larvae prefer high temperatures (Williams and Richardson 1984). The temperature of the rearing chamber during the development of the wild collected larvae, adult F2 and larvae from F2 adults was 28C, because of problems with the fan within the chamber. At this temperature the adults oviposited several times and did not suffer from premature mortality but the Hydrotaea aenescens (Wiedemann) adults within the chamber did. Hydrotaea aenescens are very sensitive to high temperatures, even a slight increase of three degrees (Hogsette and Washington 1995). The rearing chamber fan was repaired which mainta ins the temperature at 25C; this temperature appeared to be unsuitable for Ch. rufifacies Mating occurred but oviposition did not. Two cages of adults were present at this temperature, and all the adults in the second cage died prematurely. Even with the increased ambien t temperature of the rearing chamber, only two batches of eggs were produced by the adult F3 Ch. rufifacies adults over a two week period. Therefore moistened blood meal was provided to the remaining adults after two weeks. Oviposition then occurred in vast numbers for several days. The competitive nature of Chrysomya rufifacies is seen in the fast pupation time, early emergence, and delayed oviposition. The larvae from the colony were able to complete development without feeding on another larval species. Chrysomya rufifacies are known obligatory predators as larvae, but previous colo nization attempts without inclusion of other fly larvae for them to feed on have been unsuccessf ul (Butler, Personal Communication). Details in the literature are scant of other laboratory colonies being rear ed with or without addition larvae as a food source or protein supplements. However, the colony was reared on decaying chicken alone, with a protein source added to the adul t diet for egg production. Moistened blood meal was presented to the adult Ch. rufifacies every day upon emergence to promote oviposition. 72

PAGE 73

Chrysomya megacephala have been reared in laboratory colonies for research purposes. The most notable projects were conducted by Wells and Greenberg (1992a, 1992b) and Wells and Kurahashi (1994). The laboratory colony re ported in Wells and Kurahashi (1994), was reared under light conditions of 16L : 8D at 27C. The growth rate s of the larvae were recorded daily. In comparison to the data collected by We lls and Kurahashi (1994), the growth rates of my colony were very similar. Egg hatch was reco rded at 18 h (0.75 d) by Wells and Kurahashi, while my colony was recorded at 1 d (24 h). Second instar larvae were recorded 30 h (1.25 d) after the first instars by Wells a nd Kurahashi. Second instar larv ae from my colony were present 1 d (24 h) after the first instars. Wells and Ku rahashi documented third in star larvae 72 h (3 d) after the second instar larvae fo llowed by pupae 144 h (6 d) later. My colony developed into third instar larvae 4 d (96 h) after second instars and began to pupate 5.5 d (132 h) later. Literature on Chrysomya rufifacies growth rates is scant. My colony data was compared to that recorded by Byrd (1995) for Ch. rufifacies reared at 26.7C. Overall development for Ch. rufifacies recorded by Byrd was a day longer than my colony. Byrd (1995) recorded egg hatch 14 h (0.58 d) after oviposition, second instar larvae 32 h (1.3 d) later, thir d instar larvae 56 h (2 d) after the second instars and pupation 134 h (5.6 d) after the third instars. My colony developed at an average of 1 d (24 h) for e gg hatch after oviposition, 1 d (24 h) later second instar larvae were present, followed by third instar larvae 3 d (72 h) later and then pupation occurred 4 d (96 h) afte r the third instars. Chrysomya megacephala larvae developed under the set laboratory conditions needed to maintain the Chrysomya rufifacies colony but this does not ap pear to be their optimal temperature. Wells and Kurahash i (1994) indicate 27C as the temperature used previously by other researchers for rearing of Ch. megacephala but it is possible 28C was to hot. Larvae 73

PAGE 74

74 developed normally in my colony under these cond itions but there was high mortality of pupae. A pupal eclosion rate of 37.5% indicates r earing conditions were not optimal for Ch. megacephala Chrysomya rufifacies are one of the first ar rivers of carrion in the wild but did not oviposit until 24 hours after death. The adults have been observed by the author resting on nearby trees and vines during the first 24 hours. It appears th e adult flies are arriving early to a carcass to feed on the blood protein for egg production and oviposition. With the discovery that Ch. rufifacies colony adults need blood meal to produce a nd lay eggs, provides insight into their adult behavior. The necessity for blood meal in dicates that the adult females require a higher source of protein for oviposition. The chicken provi ded is sufficient for larvae development but does not supply the adults with need nutrients. Other dipteran adults, Hydrotaea aenescens in particular, need additional protein sources to oviposit and develop properly (Hogsette and Washington 1995).

PAGE 75

Figure 2-1. The Ziploc contai ner used to rear developing Chrysomya megacephala and Chrysomya rufifacies larvae from egg to wandering larvae stage. Figure 2-2. Fly colony insect rearing cage fo r adult maintenance with water, sugar and powdered milk. 75

PAGE 76

Table 2-1. The recorded time (days) after adult emergence required for Chrysomya megacephala to reach different developmental stages. Development Stage F2 F3 F4 F5 Mean ( SE) Adult Mating 2.0 3.5 2.5 2.5 2.6 ( 0.31) Oviposition 3.5 4.5 4.0 4.5 4.1 ( 0.24) First instars 4.5 6.5 5.0 6.0 5.5 ( 0.46) Second instars 5.5 7.5 6.0 7.5 6.6 ( 0.52) Third instars 9.5 11.0 8.5 12.5 10.4 ( 0.88) Pupation 14.5 19.0 13.5 17.5 16.1 ( 1.28) Adult emergence 24.5 24.5 23.5 25.5 24.5 ( 0.41) Table 2-2. Eclosion rates of Chrysomya megacephala and Chrysomya rufifacies eggs and pupae stages to determine survivability within a laboratory colony. Species Mean Number Mean Egg Mean Number Mean Pupae of Eggs (n=4) Eclosion (%) of Pupae (n=4) Eclosion (%) Ch. megacephala 10 (10/5.5) 55.0 10 (10/3.75) 37.5 Ch. rufifacies 10 (10/6.75) 68.0 10 (10/8.0) 80.0 76

PAGE 77

77 Figure 2-3. Newly laid eggs mass and deve loping early first instar larvae. Table 2-3. The recorded time (days) after adult emergence required for Chrysomya rufifacies to reach different developmental stages. Development Stage F2 F3 F4 F5 F6 Mean ( SE) Adult Mating 4.0 4.0 2.5 4.5 4.5 3.9 ( 0.37) Oviposition 6.0 5.5 8.0 6.0 7.0 6.5 ( 0.45) First instars 7.0 6.0 10.0 7.0 8.0 7.6 ( 0.68) Second instars 7.5 7.5 11.0 8.5 9.5 8.8 ( 0.66) Third instars 11.0 11.5 14.5 12.5 11.5 12.2 ( 0.62) Pupation 16.0 17.0 18.5 16.5 15.0 16.6 ( 0.58) Adult emergence 20.5 23.5 22.5 24.0 23.0 22.7 ( 0.60)

PAGE 78

CHAPTER 3 FIELD STUDIES Introduction Forensic entomologist have conducted experiments on succession and decomposition patterns for many decades (Payne 1965, Lord and Burger 1983, Rodriguez and Bass 1983, Goddard and Lago 1985, Early and Goff 1986, Schoenly and Reid 1987, Goff et al. 1988, Haskell et al. 1989, Goff 1991, Osvaldo Moura et al. 1997, Davies 1999, Carvalho et al. 2000, Davis and Goff 2000, Martinez-Sanchez et al. 20 00, Shalaby et al. 2000, Carvalho and Linhares 2001, Wolff et al. 2001, Joy et al. 2002, Archer and Elgar 2003a, 2003b; Shahid et al. 2003, Watson and Carlton 2003, Schoenl y et al. 2005, Grassberger and Frank 2004, Perez et al. 2005, Tabor et al. 2005a, 2005b; Tomberlin et al. 2005 Watson and Carlton 2005, Jong and Hoback 2006, Joy et al. 2006, Martinez et al 2006). Researchers have i nvestigated all aspects of decomposition including the stages of decompos ition, stage commencement, species interaction, and effect temperature has on decompositi on (Payne 1965, Rodriguez and Bass 1983, Goddard and Lago 1985, Davis and Goff 2000, Grassberger and Frank 2004, Ea rly and Goff 1986). Thermal energy is produced by the collective ma ssing of dipteran larv ae developing in a carcass. The author and other researchers have observed that thermal energy is influenced by ambient temperature during the init ial 24 hours of larval developmen t, but when larvae are in the second and third instars, the thermal energy b ecomes a product of the maggot mass independent from the ambient temperature (Greenberg 1991, Joy et al. 2002, Peters 2003). Post mortem interval is determined by assessing the developmen tal stage and species of larvae collected from a crime scene and coordinating this data with the ambient temperature (Mann et al. 1990, Goff and Flynn 1991, Goff 1992, Schoenly et al. 1992, Goff 1993, Hall and Doisy 1993, Lord et al. 1994, Anderson 1997, Anderson 2000, Goff 2000, Marchenko 2001, Arnaldos et al. 2005, 78

PAGE 79

Nabity et al. 2006). Research indicates that the incorrect number of accumulated degree days could be calculated when not referencing the heat produced by the la rvae within a maggot mass (Peters 2003, Slone and Gruner 2007). The incr eased maggot mass temperatures are the main factors controlling development of 2nd and 3rd instar larvae. Arthropod succession has been explored by more people than any other topic in forensic entomology because of the extreme importance it has in determining post mortem interval and the variations that occur in different parts of the world (Rodriguez and Bass 1983, Goddard and Lago 1985, Early and Goff 1986, Davis and Goff 2000, Shalaby et al. 2000, Carvalho and Linhares 2001, Wolff et al. 2001, Joy et al. 2002, Archer and Elgar 2003a, 2003b; Peters 2003, Shahid et al. 2003, Watson and Carlton 2003, Gr assberger and Frank 2004, Perez et al. 2005, Schoenly et al. 2005, Tabor et al 2005a, 2005b; Tomberlin et al 2005, Joy et al. 2006, Martinez et al. 2006). The succession pattern is a simple gui deline to the order of arrival and departure for arthropods and the species present in a particular area. The successional pattern can tell a lot about a crime scene such as post mortem interval movement of corpse af ter death, or obstruction of corpse initially afte r death. Succession patterns assist in determining victim identification, sexual assault before or after death, mutilation before or after death, wound infliction before or after death and confirming or refuting a suspects alibi. A typical succession pattern cons ists of a wave of insects; the first inhabitants are Calliphoridae and Sarcophagidae followed by various Coleoptera families and then Muscidae, Piophilidae and Stratiomyidae (Rodriguez a nd Bass 1983, Goddard and Lago 1985, Early and Goff 1986, Goff 1991, Osvaldo Mour a et al. 1997, Davis and Go ff 2000, Shalaby et al. 2000, Carvalho and Linhares 2001, Wolff et al. 2001, Joy et al. 2002, Archer and Elgar 2003a, 2003b, Peters 2003, Watson and Carlton 2003, Grassber ger and Frank 2004, Perez et al. 2005, Tabor et 79

PAGE 80

al. 2005a, 2005b, Tomberlin et al. 2005, Martinez et al. 2006). The flie s oviposit on the carcass providing media for the larvae to grow and then the adult beetles arrive to feed on the larvae and lay eggs. Upon completion of development, the larvae leave the carcass to pupate. The carcass is typically in the final stages of decompos ition when arthropod activity has ceased. Although the use of Coleoptera alone is challenging, using them in addition to the Diptera provides a calculation to the number of hours or days a victim has been dead. Research conducted from 2001 to 2002 indicates that the maggot mass temperature is more reliable for determining developmental rates of larvae than the ambient temperature (Peters 2003). The objectives of the field studies were to 1) document the maggot mass temperature, 2) present data on the formation of the maggot ma ss, 3) relate the maggot mass to post mortem interval calculations, 4) make uns ystematic collections of adult and larval forms of forensically important insects observed feeding at or on the bear carcasses to show the species composition present in north central Florida. It is hypot hesized that the maggot mass will produce higher temperatures than ambient temperature and wi ll have more impact in controlling larval development than the ambient temperature. Presented here is a case of two successi onal waves occurring on one bear carcass throughout decomposition. The exact same species of insects developed twice on a carcass before it became completely skeletonized. This phenomenon has never before been reported in the literature to the know ledge of the author. Methods and Materials Florida black bear Ursus americanus floridanus (Merriam) carcasses were provided for this experiment by the Florida Fish and W ildlife Conservation Commission located in Gainesville, Florida; all were victims of vehicular accidents. The black bears proved to be acceptable for decomposition research even though they are not an exact match for humans. 80

PAGE 81

Insects are attracted to a dead animal much in the same way that they are attr acted to a dead human. Succession patterns on bear carcasses are similar to that observed on pig carcasses, the usual model for human decomposition (Dillon and Anderson 1996, Dillon 1997, Dillon and Anderson 1997, Anderson 1999). Bears were placed in a clearing in a semi-woode d area in heavy shade with barely visible sky. Much of the site was over grown with brus h. The vegetation consisted of large pine and oak trees along with smaller oaks and vines. Bears were placed within a wooden fenced area surrounded by a chain-link fence that enclosed the entire facility. Th e bears were not moved after being placed at the study site. Only one bear was present at a time; a total of four bears were used throughout the entire experiment. Each experiment occurred in a different month of the year. Bears were first observed within four hours of their arriva l at the study site. Maggot mass temperatures were recorded dail y from the center of th e largest dipteran larval mass present on the carcass. A HOBO ex ternal logger (Onset Computer Corporation, Bourne, MA, 1995) was placed at the carcass site and set to record four different temperatures. The HOBO external logger was pr eprogrammed in the lab to take temperature readings every 15 minutes throughout the entire decomposition process. The base of the HOBO external logger was tied to the wooden fence and one of the probes was placed about 3 inches (7.62 cm) beneath the bear in the soil. The ne xt probe was set out above ground out of direct sunlight. The third probe was moved daily to th e center of the largest maggot mass. The third probe was placed within the mouth of the bear until a maggot mass developed on the surface of the animal. The forth probe collected ambient temp erature, taking care to also be placed out of direct sunlight. 81

PAGE 82

Collections of larvae and adult in sects were made at each visit to the site for a comparative study. Adult and developing immature insects were collected daily with a sweep net, forceps and gloved hands at approximately 4:30 PM from day one continuing until carcass decomposition was complete. Adult flies were collected upon arrival by waving a sweep net above the carcass 5-7 times. Larval collections were made from th e three largest maggot masse s. Before the daily samples were collected, observations were made to document larval sp atial distri bution and intra-species interactions. Adult beetles and flies were killed in an ethyl acetate kill jar. Fly larvae were placed initially in empty small si ze vials and returned to the lab for further processing. Photographs of the growing maggot masses and carcass decomposition were made with a Kodak EasyShare CX4230 zoom digital camera. After examination of the carcass, collections of the adult and immature insects were taken to the lab. The adults were removed from the kill jar, pinned and attached to date labels. Adults were then identified to species using James (1947), Smith (1986), and Catts and Haskell (1990) sight identification keys and properly labeled. The larvae we re boiled for approximately 10 seconds in water to fix their internal proteins, then placed into vials of 70% ethyl alcohol for preservation and labeled. The larvae were iden tified by instar and species at a later date using Stojanovich et al. (1962) and Wells et al. (1999) sight identification keys. The first and second instar larvae were unable to be identified to speci es; therefore all larvae identified to species in the subsequent figures are thir d instars. One exception is Chrysomya rufifacies larvae which are able to be identified at any stage because of the fleshy protuberances on each body segments. Chrysomya rufifacies larvae from each vial were chosen at random and measured to estimate the growth rate of the larvae against time and temperature of the maggot mass. 82

PAGE 83

After decomposition was complete, the HOBO external logger was removed from the site and returned to the lab. The temper ature data were downloaded from the HOBO external logger onto a computer. This pro cess stops the logger from recordi ng and resets it for use at the next carcass. The data were stored in th e BoxCar HOBO computer program until analyzed further in the statistical pr ograms of Microsoft Excel 97 SR -2 (Copyright 1985 1997, Microsoft Corporation) and SAS (Windows NT Vers ion 5.0 2195, 1999 by SAS Institute Inc, Cary, NC). Bear 1 May 2003 The first experiment began on 13 May 2003. A female bear, 150 lbs (68.04 kg), was placed at the study location around 2:00 PM approximately 10 h after death. The first visit to the bear occurred at 4:36 PM on 13 May 2003, at which time fly eggs and adults were collected. There was extensive bleeding around the head and so me cuts on the chest. Adult fly activity was prominent, and the carcass was beginning to bl oat. On the final day of observation, 23 May 2002, the bones of the chest and neck were visible, third instar Chrysomya rufifacies and beetle larvae were present. Throughout decompositi on, there was a consider able amount of rain resulting in less adult fl y activity than expected. Bear 2 December 2003 On 19 December 2003, the second bear was rece ived at the study site 13 to 17 h after death. The 170 lbs (77.11 kg) female was very cold upon arrival because of the colder temperatures throughout the night and following day. The first visit occurred on 19 December 2003 at 5:45 PM. There were no visible wounds and very little adult insect activity. Eggs were collected from inside the mouth, but two days later the first instar fly larvae had yet to emerge. On final day of observation, 8 January 2004, the bears surface was very cool, the maggot masses 83

PAGE 84

had ceased and several unfortunate larvae had succumbed to the harsh winter weather. One mass of Hydrotaea leucostoma larvae were located under the neck. Bear 3 July 2004 The third bear, a 90 lbs (40.82 kg) male arrived on 1 July 2004 very late in the evening, approximately 18 h after death on 30 June 2004. When the HOBO external logger was set up on 3 July 2004, adult fly and beetle activity was pr evalent, along with first and second instar fly larvae. On 8 July 2004, the bear was inhabited mostly by Chrysomya rufifacies and beetle larvae with a few muscoid fly larvae found under the legs. Bear 4 September 2004 Bear four was a 260 lbs (117.93 kg) male received at 12:00 PM on 15 September 2004, after being killed sometime during the previous night. First visit was made on 16 September 2004 at 1:00 PM. Adult flies were active and mating and a small maggot mass was located under the head. Hurricane Ivan was in Alabama at the time causing cloudy and breezy weather, but no rain. On the final day of collection before Hurricane Ivan hit land, 22 September 2004, the entire carcass had been consumed by Chrysomya rufifacies larvae. The fur had sloughed off and the bones of the extremities were visible. On 25, 26, and 27 September 2004 Hurricane Jeanne came through Gainesville, and all inse ct activity ceased before decomposition was complete. Repeated Species Composition on a Single Host On 30 August 2002, a female bear, referred to as Bear 5 Augus t 2002, weighing 195 lb (88.45 kg) was placed at the study site. A car hi t the bear at approximately 8:00 AM that morning; the first visit occurred at 7:10 PM that evening. The HOBO external logger was set up and the temperature probes were put in their appropriate locatio ns. Insects were collected, and pictures were taken every other day. The la st day of data collection occurred on 22 October 84

PAGE 85

2002. On this date, the bear was completely skeletonized and only Stra tiomyidae larvae were present. Statistics The temperature data recorded for Bear 3 July 2004 and Bear 4 September 2004 were stored in the BoxCar HOBO computer program (Onset Comp uter Corporation, Bourne, MA, 1995-1999) until analyzed further in the statisti cal program of Microsoft Office Excel 2003 (11.8146.8132) SP2 Part of Microsoft Office Pr ofessional Edition 2003 (Copyright 1985 2003, Microsoft Corporation) and SAS (Window s NT Version 5.0 2195, 1999-2000 by SAS Institute Inc, Cary, NC). Results Field Maggot Mass Technical difficulties occurred upon retrieval of the temper ature data from the HOBO external logger that was used for Bear 1 May 2003 and Bear 2 December 2003. The data from Bear 1 May 2003 were irretrievable because of a dead battery; no spares were available. The data from Bear 2 December 2003 were retrieved from the HOBO external logger, but the HOBO external logger had been programmed to co llect temperature readings every five seconds instead of every 15 minutes. The data from Bear 3 July 2004 and Bear 4 September 2004 were able to be analyzed and compared with th e data collected for my masters thesis. Bear 3 July 2004 The maggot mass temperatures were recorded above the ambient temperatures throughout decomposition until the larvae wandered away from the skeletonized carcass 12 d after death (Figure 3-1). The underground temperature was higher than the maggot mass temperature until 4 d after death (Figure 3-1) because the second instar larvae molted into third instars (Figure 3-2). The mean maggot mass temperature was recorded at 29.91 C, the minimum was 21.71 C and the 85

PAGE 86

maximum was recorded to be 40.59 C (Table 3-1). A one-way ANOVA and Duncans test (Table 3-2) were preformed on daily mean temper atures of Bear 3 July 2004 finding the data to be significant with a P value of <0.0001 and F value 2.61. The increasing maggot mass temperature can be observed in the following graphs that depict the temperatures recorded. Data re corded for ambient temperatures, maggot mass temperature and underground temperature duri ng decomposition show the increasing maggot mass temperature during the first 4 d after death (Figure 3-1). The significance of the mean maggot mass temperature (C) in reference to the underground and ambient temperatures is presented in Table 3-2. The maggot mass temperatures were recorded from monoculture masses of Chrysomya rufifacies ; the mean growth rate of the larvae was then plotted for comparison with the mean maggot mass temperatures (C) in relation to hours after d eath (Figure 3-2). Two separate peaks occur in the maggot mass temperature data: one at 1 d (35.02 C) and the other at 3 d (34.94C). The peaks represent the growth of 1st instars into 2nd instars and 2nd instars into 3rd instar larvae. As larval growth begins to finalize, the maggot mass temperature gradually decreases until reaching ambient temperature. Bear 4 September 2004 During the first day, the maggot mass te mperature was recorded well above the underground, ambient and second ambient temperatur es (Figure 3-3). Between 2 and 4 d after death, the maggot mass temperature dropped dramatica lly. The larvae collected at this time were mostly second instars. The larvae molted to second instars around 4 d at which point the maggot mass temperature jumped from a 25.99 C mean temperature recorded on the previous day to a 31.41C mean temperature (Figure 3-3). At 5 d the 2nd instar larvae molted into third instar larvae, therefore increasing the maggot mass te mperature even more until 10 d after death 86

PAGE 87

(Figure 3-3). The mean maggot mass temperature was recorded at 31.06 C with a minimum temperature of 18.28 C (Table 3-3). The maximum ma ggot mass temperature reached 49.56 C during decomposition, which was 19C higher than the recorded ambient temperature at that time (Table 3-3). A one-way ANOVA and Duncans test (Table 3-4) were preformed on daily mean temperatures of Bear 4 September 2004 findi ng the data to be significant with a P value of <0.0001 and F value 2.61. The increasing maggot mass temperature can be observed in Figure 3-4 which shows the daily mean temperatures analyzed with Duncan s test (Table 3-4). The mean maggot mass temperature (C) increased afte r the fourth day of decompos ition when second instar larvae began to molt into third instar larvae, then gr adually declined when th e larvae wandered away from the carcass (Figures 3-3 and 3-4). The mean growth rate of the species Chrysomya rufifacies is plotted against the recorded mean maggot mass temperatures to show life stage development in reference to heat production wi thin the maggot mass (Figure 3-3). The maggot mass temperature data shows two peaks, one at 8 d to 37.99 C, and the other at 14 d to 36.14 C. The occurrence of the first peak represents the prime growing and feeding period for the 3rd instar larvae. The second peak occurred af ter Hurricane Ivan made land fall and adult fly activity had ceased. Species Composition Adults of 18 different species within the or ders Diptera and Coleoptera were collected from the four bear carcasses: Chrysomya rufifacies (Macquart), Cochliomyia macellaria (Fabricius), Chrysomya megacephala (Fabricius) Lucilia (=Phaenicia) sericata (Meigen) Lucilia spp., Hermetia illucens (Linnaeus) Synthesiomyia nudiseta (Wulp), Hydrotaea leucostoma, Necrophila Americana (Linnaeus) Nicrophorus orbicollis (Say) Nicrophorus 87

PAGE 88

carolinus (Linnaeus), Necrodes surinamensis (Fabricius), Creophilus maxillosus (Linnaeus), Dermestes ater (De Geer) Dermestes caninus (Germar) Dermestes maculates (De Geer), Trox suberosus (Fabricius) Hister spp., and Saprinus pennsylvanicus (Paykull) (Table 3-5). Adult Sarcophagidae and Muscidae were collected from the bear carcasses as well as miscellaneous Diptera not identified to family (Table 3-5). The adults collected were an arbitrary overview of the class Insecta present at the bear carcasses, not a detailed collection of the insects inhabiting a carcass. The adults collected from Bear 1 May 2003 (Table 3-6) represented a total of seven Diptera species and seven Coleoptera species. Diptera were collected from the families Calliphoridae, Muscidae, Stratiomyid ae and Sarcophagidae. The species Chrysomya rufifacies, Cochliomyia macellaria, Lucilia sericata, Hermetia illucens, Synthesiomyia nudiseta and Hydrotaea leucostoma were collected and preserved th roughout decomposition, along with miscellaneous Diptera not identified. Seven species of Coleoptera, Necrophila americana, Nicrophorus orbicollis, Necrodes surinamensis, Cr eophilus maxillosus, Dermestes caninus, Trox suberosus, and Hister spp., were collected throughout d ecomposition from five different families: Silphidae, Staphylinidae, Dermestidae, Trogidae, and Histeridae. The number of adults collected from Bear 2 December 2003 was considerable less than from Bear 1 May 2003; only two Diptera species, Cochliomyia macellaria and Hydrotaea leucostoma along with miscellaneous Diptera that we re not identified (T able 3-7). Five different species of Co leoptera were collected: Nicrophorus orbicollis, Necrodes surinamensis, Creophilus maxillosus, Dermestes ater and Hister spp. (Table 3-7). Bear 3 July 2004 collections (Table 3-8) consisted of five species of dipteran adults, Chrysomya rufifacies, Co. macellaria, Ch. megacephala, Lucilia sericata, and Hydrotaea leucostoma along with members 88

PAGE 89

from the family Sarcophagidae that were not iden tified to species and mi scellaneous unidentified Diptera. Nine species of coleopteran adu lts were present throughout decomposition including Necrophila americana, Nicrophorus carolinus, Nicr ophorus orbicollis, N ecrodes surinamensis, Creophilus maxillosus, Dermestes ater, Trox suberosus, Saprinus pennsylvanicus and Hister spp. Adult Diptera collected from Bear 4 Sept ember 2004, shown in Table 3-9, consisted of Chrysomya rufifacies, Cochliomyia macella ria, Ch. megacephala, Hydrotaea leucostoma, Sarcophagidae and miscellaneous unidentified Dipt era. The number of different Coleoptera species present totaled nine: Necrophila americana, Necrodes surinamensis, Creophilus maxillosus, Dermestes caninus, D. maculatus, D. ater, Trox suberosus, Saprinus pennsylvanicus, and Hister spp. (Table 3-9). All four bear carcasse s consisted of similar species compositions with species diversity that varied because of season and climatic factors. Only one species of Diptera, Synthesiomyia nudiseta was collected that had never been collected before (Peters 2003) or since the time of collect ion from Bear 1 May 2003. Dipteran larvae were collected from each of the bear carcasses throughout decomposition. Each was identified as 1st, 2nd and 3rd instars; the 3rd instars were identified to species and the hour at which they were present on the carcasses. The larval species co llected varied depending on month, which is a reflection of the season. Bear 2 December 2003 and Bear 4 September 2004 had more species diversity than Bear 1 May 2003 and Bear 3 July 2004, but differences in species collected. Bear 1 May 2003 and Bear 3 July 2004 had the least amount of collected specimens (Table 3-10). For Bear 1 May 2003 (Figure 3-5) eggs were collected from 0 h and 24 h. At 24 h, 1st instar larvae (unide ntifiable to species) were collected until 48 h. In addition, 2nd instar larvae were collected at 24 h after death and were present up to 72 h after death. At 48 h 1st instar 89

PAGE 90

Chrysomya rufifacies larvae were present until 72 h when they molted into 2nd instar larvae that were present through 120 h after death. Thir d instar larvae of an unknown species were collected 48 h following death of the bear; their identity could not be confirmed because of preservation problems. At 48 h, 2nd instar Sarcophagidae larvae were present and late 2nd, early 3rd instar Cochliomyia macellaria were collected. Third instar Ch. rufifacies were first collected 96 h following the death of the bear and remained present until decomposition was completed at 240 h after death. Bear 2 December 2003 had greater diversit y of dipteran larvae present throughout decomposition than the other three b ear carcasses, (Figure 3-6). A total of nine dipteran larval species were collected at va rious intervals throughout decomposition. Egg batches were collected from 0 to 72 h while fi rst instar larvae were present from 168 h to 240 h after death. Second instar larvae of unknown identity were colle cted at 240 h after death and were still present at 408 h after death. The first identifiab le third instar larvae were collected 240 h after death. Cochliomyia macellaria was present until 480 h after death, Lucilia caeruleiviridis (Macquart) and L. sericata were present from 240 h to 432 h after death, and Wohlfahrtia spp. was present from 240 h to 312 h after death. At this time (240 h) 1st instar Chrysomya rufifacies were collected from the carcass until 312 h at which point the larvae molted into 2nd instars. Second instar Ch. rufifacies were collected from 312 h until 408 h, then 3rd instars was present at 408 h after death until decomposition wa s completed at 480 h after death. Chrysomya megacephala, Phormia regina (Meigen) and Sarcophaga bullata (Parker) were collected at 408 h until 456 h after death. Hydrotaea leucostoma was the last species of Diptera to colonize the carcass from 456 h after death until decomposition was complete at 480 h. 90

PAGE 91

The first evidence of fly activ ity for Bear 3 July 2004 is represented by egg masses collected in the first 24 h; 1st instar larvae emerged from the eggs 24 h after death and were present until 48 h (Figure 3-7). At 48 h, 2nd instar larvae unidentifiable to species were collected along with 1st instar Chrysomya rufifacies until 72 h after death. At the 72 h mark 2nd instar Ch. rufifacies were developing on the carcass until 96 h after death. Three different 3rd instar species were collected from the carcass 96 h after death. The first species, Ch. rufifacies, was present until decomposition was complete at 240 h. The second species, Ch. megacephala was available until 120 h after death. Hydrotaea leucostoma, the final species collected at 96 h after death, was present until the comple tion of decomposition at 240 h. Dipteran activity first appeared on Bear 4 September 2004 with the onset of egg masses from 0 to 48 h after death (Figure 3-8). First instar larvae were collecte d 24 h after death until 48 h at which point they molted into unidentifiable 2nd instar larvae that developed on the carcass until 96 h after death. At 24 h 1st instar Chrysomya rufifacies were collected until 96 h after death; 2nd instars were collected 48 h after death until 120 h after death. Although there were 2nd instar larvae present until the 96th h that could not be id entified to species, 3rd instar Lucilia caeruleiviridis larvae were collected from the carcass at 48 h after death until 120 h after death. At 120 h after death, three different species of 3rd instar larvae were collected from the carcass: Ch. rufifacies, Cochliomyia macellaria, and Ch. megacephala. Cochliomyia macellaria and Ch. megacephala were present until 168 h after death, while Ch. rufifacies was found on the carcass until decomposition was completed at 336 h. The last group of larvae collected from the carcass was Hydrotaea leucostoma ; they were collected 168 h after death and remained on the carcass until decomposition was completed at 336 h after death. 91

PAGE 92

Weather Data The ambient temperature recorded duri ng decomposition of Bear 1 May 2003 was collected by FAWN: Florida Automated Weathe r Network to compensate for the HOBO external logger battery problems. The maxi mum temperature recorded during decomposition was 34.81C at 5 d after death. The lowest temp erature of 11.91C was recorded on the first 1 d of death. The daily minimum, mean and maxi mum temperatures throughout decomposition are reported in Table 3-11. The tota l amount of rainfall for the 10 d of decomposition was 0.46 cm (0.18 inches), 0.15 cm (0.06 inches) at 5 d, 2.51 cm (0.99 inches) at 6 d, 0.03 cm (0.01 inches) at 7 d, 1.40 cm (0.55 inches) at 9 d, and 0.89 cm (0.35 inches) at 10 d. The ambient temperature recorded during decomposition of Bear 2 December 2003 was collected by FAWN to compensate for the HOB O external logger problems. Table 3-12 shows the minimum, mean and maximum temper atures recorded throughout decomposition. A minimum temperature of -6.46C was recorded 3 d after death with a maximum temperature of 27.29C at 16 d after death. Only 0.03 cm (0.01 inches) of rain fell throughout decomposition with 0.38 cm (0.15 inches) occurr ing 5 d after death and 0.10 cm (0.04 inches) on the 18 d. The cold temperatures encountered throughout the latter part of December 2003 and beginning of January 2004 lead to a slow d ecomposition rate (Figures 3-9 to 3-18). Generally decomposition is complete within two weeks in North Central Florida (Peters 2003), but the cold temperatures minimize adult and larval dipteran activity. The daily ambient and maggot mass temperatur es were recorded for Bear 3 July 2004 with a HOBO external logger (Table 3-2) A high ambient temperature of 33.59C was reached at 11 d after death and a low temperat ure of 18.66C occurred 5 d after death. A low maggot mass temperature of 21.71C was recorded within the first 1 d. A high maggot mass temperature of 40.59C was reached 4 d after death. The average recorded rainfall by FAWN 92

PAGE 93

was 1.14 cm (0.45 inches) throughout decomposition. Rain fell during the first 1 d (3.53 cm, 1.39 inches), at 2 d (0.30 cm, 0.12 inches), at 6 d (3.84 cm, 1.51 inches), at 7 d (0.38 cm, 0.15 inches), at 8 d (0.03 cm, 0.01 inches), and 4.62 cm (1.82 inches) 10 d after death. The warm temperatures prevalent during the early weeks of July enabled decomposition to finish twelve days after death (Figures 3-19 to 3-30). For Bear 4 September 2004, a high ambient temperature of 31.93C was reached at 11 d after death and a low temperature of 18.28C occu rred 2 d after death (Table 3-4). The daily ambient and maggot mass temperatures were re corded with a HOBO external logger every 15 min. A low maggot mass temperature of 18.28C wa s recorded at 11 d after death after larvae dispersal. A high maggot mass temperature of 49.56C was reached at 14 d after death. During the 19 d of decomposition an average of 0.79 cm (0.31 inches) of rainfall was recorded by FAWN. No rainfall information is record ed from September 15, 2004 through September 19, 2004 by FAWN. During the first da y Hurricane Ivan had made landfall in Alabama affecting the weather in Gainesville. At 6 d, the first da y FAWN has rainfall data recorded during the decomposition of Bear 4, 0.53 cm (0.21 inches) of rain fell. Rain fell 0.03 cm (0.01 inches) the next day, 0.15 cm (0.06 inches) at 10 d, and 0.13 cm (0.05 inches) 12 d after death. At 11 d after death a large amount of rain was recorded, 11.79 cm (4.64 inches), which was the day Hurricane Jeanne passed through Gainesville. The high temperatures recorded throughout September decreased carcass decomposition (Figures 3-31 to 3-41). Repeated Species Composition on a Single Host Upon completion of decomposition, the insect composition was scrutinized, at which point it was discovered that a repeating succession had occurred. During decomposition, arthropods began to arrive immediately af ter the Bear 5 August 2002 was pl aced at the Florida Fish and Wildlife facility on 30 August 2002; this continued until the 288 h after death (Figure 3-42). At 93

PAGE 94

this point all of the original colonizers of th e carcass had completed development and left to pupate. The first identifiable thir d instar dipteran larvae were collected 48 h after death were Cochliomyia macellaria, Chrysomya megacephala, Lucilia caeruleiviridis, Phormia regina (Meigen) Wohlfahrtia spp. L. sericata and Sarcophagidae. Chrysomya rufifacies were also present at this time, but only as second instars. The original Diptera had departed from the carcass by 120 h while Ch. rufifacies left the carcass at 288 h. At the 336 h after death new egg masses were co llected on the bear ca rcass; within 24 h these eggs hatched and many first instar larvae were present. At the 408 h after death, many larvae were present on the carcass: 2nd instar larvae of unknown species, 3rd instar larvae from the species of Cochliomyia macellaria, Chrysomya me gacephala, Lucilia caeruleiviridis, Phormia regina, Wohlfahrtia spp. L. sericata and Sarcophagidae, as well as 1st instar Ch. rufifacies larvae. The many calliphori d species were present in larval form through the 480th h. Around the 456 h, Hermetia illucens various Muscidae and miscella neous dipteran species were collected on the carcass; these were present un til the completion of decomposition at the 648 h. At 480 h the Ch. rufifacies 2nd instar larvae became 3rd instars; these larv ae fed on other species of larvae present at the time of molting and on the carcass until the 580 h after death. The daily ambient and maggot mass temperatur es were recorded with a HOBO external logger throughout decomposition of the carcass (Table 3-13). A high ambient temperature of 35.27C was reached at 10d after death and a lo w temperature of 20.95C occurred 12 d after death. A low maggot mass temperature of 22.48C was recorded within the first day before larvae development. The maggot mass temper ature never fell below 25C after developing larvae were present on the car cass. A high maggot mass temper ature of 54.13C was reached at 10 d, which was 18.86C higher than the recorded am bient temperature. The average rainfall, 94

PAGE 95

recorded by FAWN, during decomposition was 0. 64 cm (0.25 inches) with a high of 4.65 cm (1.83 inches) on day one. Discussion Field Maggot Mass Determining the post mortem interval requires the use of ambient temperature to calculate the amount of time required for the larvae to re ach a particular life stage (Goff et al. 1991b, Schoenly et al. 1992, Archer 2004). Data presented here and by others (Peters 2003, Slone and Gruner 2007) show that the ambient temperature may not be the best source for determining PMI. The maggot mass is capable of producing heat which contributes to larval development. The temperature is significantly higher than that of the ambien t throughout larval development (Deonier 1940, Greenberg 1991, Campobasso et al. 2001, Peters 2003, Slone and Gruner 2007). Bear 3 July 2004 and Bear 4 September 2004 both yielded maggot mass temperatures 12C and 20C higher than the ambient, respectively. This phenomenon has been observed by others, with elevated maggot mass temperatures of 50F, 20C, 18C, 22C, 21C (Deonier 1940, Cianci and Sheldon 1990, Greenberg 1991, Shean et al. 1993, Joy et al. 2002). Joy et al. (2002), found the maggot mass temperatures to be similar with ambient temperatures until 69 h after death at which point the maggot mass temperatures we re consistently elevated over ambient temperatures. Bear 3 July 2004 and Bear 4 September 2004 show an increase in maggot mass temperature sooner, at around 24 h after death. The faster increase in maggot mass temperature could be because of geographical or seasonality differences in study locations. For Bear 3 July 2004 two very distinct peaks in temperature occur during decomposition (Figure 3-1). The first peak occurs in the maggot mass and underground temperatures at 24 h and is representative of 2nd instar larval activity for Chrysomya rufifacies. A substantially sized maggot mass can lead to increased temperatures The second peak reco rded 72 h after death 95

PAGE 96

coincides with the molting of 2nd instar larvae into 3rd instar larvae. The same was observed for all pig carcasses studied by Cianci and Sheldon (1990), where at day six the maggot mass temperature peaked with the onset of third instar larvae. Ma ggot mass temperature does not increase from the molting action of the larvae from 2nd to 3rd instars, but with the increased appetite the 3rd instar larvae have as opposed to 2nd instars. Researchers in Thailand examined Ch. rufifacies larvae under a scanning elec tron microscope and discovered 3rd instar larvae are equipped for ravenous eating of dead flesh and live larvae (Sukontas on et al. 2001, Sukontason et al. 2003). At 5 d the maggot mass temperatures fell dramatically, when the Chrysomya rufifacies larvae were late 3rd instars (post-feed ing) still located at th e carcass, but were not feeding or massing. Previous studies conducted from 2001 2002 showed increased underground temperatures during the first 24 h before a sizable maggot mass was present (Peters 2003). The reason for the increased underground temperature for Bear 3 July 2004 is unknown; it is possible a maggot mass could have formed directly above the temper ature probe resulting in excessive heat. With the onset of decomposition the core temperature of a carcass will rise and then decrease to a temperature similar to the ambi ent. Bacteria are thought to be a major contributor during decomposition and lead to increased temperatures; confirming this was not in the scope of the experiment. The maggot mass temperature reco rded for Bear 4 September 2004 is more characteristic of heat patterns presented in previous studies (Cianci and Sheldon 1990, Mann et al. 1990, Greenberg 1991, Hewadikaram and Goff 1991, Byrd and Butler 1996, Anderson 1997, Byrd and Butler 1997, 1998; Davis and Goff 2000, Goff 20 00, Campobasso et al. 2001, Greenberg and Kunich 2002). The maggot mass temperature is dependent on the ambient temperature for the 96

PAGE 97

first 48 h when larval feeding behavior of the 2nd and 3rd instar larvae increases heat production within the mass. The dip in the maggot mass temperature between 48 h and 96 h is possible because of the lack of larval activity in the area of the temperature probe. The temperature probe could have been displaced or the larvae could have moved to a more suitable feeding location, prompting a temperature reading sim ilar to ambient. From 72 h, 2nd instar Chrysomya rufifacies larvae were present until 120 h when 3rd instar larvae appear. As di scussed above, an increase in maggot mass temperature transp ires with the onset of 3rd instar larvae and continues until the larvae enter the post-feeding stage. A second peak occurred late in decomposition around 312 hours. The source of the extensive heat is unknown since larval feeding and adult activity had ceased with the arrival of Hurri cane Jeanne. It is possible that fly activity could have commenced after Hurricane Jeanne passed throug h Gainesville, although this was not observed to occur. The final day of observation yielded similar daily means of temperature from all four probes in Bear 3 July 2004 and Bear 4 September 2004, further supporting the hypothesis that elevated temperatures recorded are connected with larval activity. Calliphoridae larvae are unable to survive at temperatures above 50C individually, but larvae within a mass avoid death by moving to a more favorable environment (Deonier 1940). Cianci and Sheldon (1990) sugge st a possible reason for the fo rmation of an endothermic environment may be to alleviate stress on individual maggots and allow each to function at its maximum efficiency within the mass. Without formation of a reliable maggot mass, the larvae generally are unable to complete development, breakdown the medium or reach their maximum girth. Species Composition In comparison with successional data collect ed from throughout the world, north central Florida has relatively low numb ers (<18) of forensically important insects. Adults were 97

PAGE 98

collected from two different or ders, Diptera and Coleoptera, a nd 9 families: Calliphoridae, Sarcophagidae, Muscidae, Stratiomyidae, Silphid ae, Staphylinidae, Dermestidae, Trogidae, and Histeridae. The majority of insects collected and observed during decomposition were members of the Calliphoridae family, commonly referred to as blow flies. These adult insects are generally metallic in appearance and are green to blue in coloration (Mullen and Durden 2002). The number of insect families collected in north central Florida is less than other succession studies conducted throughout the world. In Tennessee 10 families were represented in a succession study (Rodriguez and Bass 1983); 12, 82 and 24 families were collected in Hawaii during different experiments (Go ff 1991, Davis and Goff 2000, Shalaby et al. 2000); 27 different families were collected in Curitiba (Osvaldo Moura 1997); 36 from Brazil on two separate occasions (Carvalho et al. 2000, Carvalho and Linhares 2001); 12 and 29 different families were collected in Colombia during tw o different experiments (Wolff et al. 2001, Perez et al. 2005); 46 families were collected from wildlife carcasses in Louisiana (Watson and Carlton 2003); 16 from Austria (Grassberger and Frank 2004); and 11 fam ilies were represented in Colorado (Jong and Hoback 2006). Species composition varied by month, July havi ng the greatest diversity of adult insects with 17, followed by May and September with 1 6, and then December with 9, see Table 3-1. Bear 1 May 2003 had the largest diversity of Diptera (9) collected throughout decomposition. A unique species encountered from Bear 1 May 2003 was Synthesiomyia nudiseta (Muscidae); this was the first and only time the species was encountered since research began in 2001. Bear 1 May 2003, Bear 2 July 2004, and Bear 4 September 2004 had very similar species compositions. Chrysomya megacephala was not collected for Bear 1, Hermetia illucens was not collected from Bear 3 or Bear 4, and Phaenicia sericata was not collected from Bear 4; 98

PAGE 99

otherwise species diversity was the same (Tables 3-1 thru 3-5). Bear 2 December 2003 adults were only represented by Chrysomya rufifacies, Hydrotaea leucostoma Muscidae and miscellaneous Diptera; this could be attributed to the cooler temp eratures thus causing the adults to be less active at the ti me of daily collection. Coleoptera collections also showed some diffe rences for each bear, there were only three species, Necrodes surinamensis, Trox suberosus and Hister spp., which were collected from all four carcasses (Tables 3-1 to 3-5). Although Table 3-1 indicates that Creophilus maxillosus was not found on Bear 2, it is highly pos sible that the species was pr esent but not recovered during carcass visitation. Nicrophorus carolinus was only present during July ; the species is believed to be seasonal (Peters 2003). Dermestes maculatus was only recovered from Bear 4 September 2004 with D. ater and D. caninus. Larval collections provided 9 different sp ecies of forensically important Diptera throughout decomposition of the fo ur bear carcasses. The spec ies composition collected from each bear varied, with Chrysomya rufifacies being the only species collected from all four of the bears. Two of the larval species collected, Lucilia caeruleiviridis and Phormia regina, were not caught as adults during decomposition. Cochliomyia macellaria the native calliphorid that was once the dominant species in North America on carrion, was collected from Bear 1 May 2003, Bear 2 December 2003 and Bear 4 September 2004 but in small numbers. Bear 2 December 2003 had the greatest composition of larv al species collected contrasting with the number of adult Diptera collect ed during decomposition. Nine dipteran species were collected from Bear 2 December 2003: Ch. rufifacies, Co. macellaria, Ch. megacephala, L. caeruleiviridis, L. serica ta, P. regina, Wohlfahrtia spp., Sarcophaga bullata, Hydrotaea 99

PAGE 100

leucostoma Bear 4 September 2004 was represen tative of five different species, Ch. rufifacies, Co. macellaria, Ch. megacephala, L. caeruleiviridis, and Hydrotaea leucostoma Bear 2 December 2003, arrived just prior to th e holidays. On the first day eggs were present, but larvae did not emerge until 48 h later. Visits were made to the carcass every other day but only adult insects were collected during the first 168 h afte r death. Identifiable third instar larvae were not collected from the car cass until 240 h after death, at which point there was a wide variety of dipteran larval spec ies present on the carcass including 2nd instars of unidentifiable species, 1st and 2nd instar Chrysomya rufifacies 3rd instar Cochliomyia macellaria, Lucilia caeruleiviridis, L. sericata, and Wohlfahrtia spp. The gap between adult and larval collections is attributed to the holidays and de parture of the researcher from the area to visit family. Another contributing factor to the delay of larval devel opment and discovery is credited to scavengers (e.g. vultures) that had discovered the carcass and displaced some of the appendages. The cool temperat ures also slowed decomposition since decomposition is faster on warm days (Goddard and Lago 1985, Os valdo Moura et al. 1997). The dominant larval species fo r all four bear carcasses was Chrysomya rufifacies The larvae are very recognizable by the fleshy prot uberances that encompass the midline of their body segments from the 1st to the 3rd instar (James 1947). Chrysomya rufifacies are among the first calliphorid adults to arrive at a carcass but will perch on nearby tree limbs and vines for the first 24 hours before ovipositing (personal observatio n). The adults are either waiting for the carcass to decompose some more or for other specie s of flies to deposit their eggs first so that food is available for the developing larvae (W illiams and Richardson 1984, Goff et al. 1988). Results of the lab colony suggest the adult flies are present with in the first 24 hours to feed on blood protein needed for egg production and ovi position. A closely related species of Ch. 100

PAGE 101

rufifacies, Ch. albiceps has been shown to wait three days after placement of a cadaver before ovipositing and the 2nd and 3rd instar larvae almost monopoli ze the cadaver (Grassberger and Frank 2004). I believe that the other larval species are out competed, eaten or driven away from the food source by Ch. rufifacies before pupation. Repeated Species Composition on a Single Host The early succession pattern observed for the Bear 5 August 2002 bear coincided with the results that forensic entomologists have recorded over the years; with Calliphoridae and Sarcophagidae developing quickly before the carcass becomes dry and desiccated (Rodriguez and Bass 1983, Goddard and Lago 1985, Early and Go ff 1986, Goff 1991, Os valdo Moura et al. 1997, Davis and Goff 2000, Shala by et al. 2000, Carvalho and Li nhares 2001, Wolff et al. 2001, Joy et al. 2002, Archer and Elgar 2003a, 2003b; Peters 2003, Watson and Carlton 2003, Grassberger and Frank 2004, Perez et al. 2005, Tabor et al. 2005a, 2005b; Tomberlin et al. 2005, Martinez et al. 2006). After Diptera have co mpleted development on a carcass, Coleoptera arrive at the carcass to assist in finishing the decomposition pro cess until the skeleton, dried skin and hair remains (Rodriguez and Bass 1983, Earl y and Goff 1986, Shalaby et al. 2000, Carvalho and Linhares 2001, Wolff et al. 2001, Archer and Elgar 2003a, Peters 2003, Watson and Carlton 2003, Grassberger and Frank 2004, Perez et al. 20 05, Tabor et al. 2005a, 2 005b; Martinez et al. 2006). The arrival and departure of Diptera and Cole optera in a sequential wave was observed to occur in all the bears used for this research proj ect and the bears from previous research, except for Bear 5 August 2002. At 336 h after death, new egg masses were found on the carcass. A second serious of egg masses had been encountered before with the June 2002 bear, but the eggs were not viable (Peters 2003). The second wave of calliphorids and Sarcophagidae, excluding 101

PAGE 102

Ch. rufifacies, were no longer present at 480 h after deat h, most likely because of the predatory behavior Ch. rufifacies The phenomenon of repeated species succession is very rare and to the authors knowledge has never been reported before by any another researcher It is not known exactly as to how or why a repeated species succession occurs. One theo ry is the size of the bear combined with the high temperatures allowed for the original wave of Diptera to develop quickly therefore leaving an extremely large amount of flesh on the carca ss. The large amount of flesh remaining on the carcass provided an amble source of food for a new wave of Diptera to oviposit before the beetle larvae became the dominant inhabitants of th e carcass. The occurrence of two successional waves made up of the same Diptera species is extremely important in forensic entomology when it comes to determining the post mortem interval. As mentioned, the PMI is determined by collecting the largest larv ae present, determining their species and age. Then the days or hours are counted back with the use of the ambient temperature to pinpoint a time at which the eggs were oviposited. When two waves of the same dipt eran species occurs, the post mortem interval could be easily miscalculated if the stages co llected were from the second wave. One would assume that eggs collected on a body will have lead to a PMI within the last 24 hours (Perez et al. 2005). Previous researchers have been unaware that a duplicate succession can occur on a carcass. Typical succession patterns are well documente d. The data reported herein indicate that succession might not always follow a clear cut patte rn and that another wave of dipteran larvae may arrive before the discovery of a corpse. 102

PAGE 103

0 5 10 15 20 25 30 35 40 45 12345678910111213 Days After DeathTemperature (C) Ambient Underground Maggot Mass Second Ambient Figure 3-1. Daily temperature means plot ted against time for Bear 3 July 2004. 0 2 4 6 8 10 12 14 16 18 20 123456789101112 Days After DeathMean Length (mm)0 5 10 15 20 25 30 35 40Temperature (C) First Instar Second Instar Third Instar Maggot Mass Mean Figure 3-2. Mean growth rate of Chrysomya rufifacies and mean maggot mass temperature for Bear 3 July 2004. 103

PAGE 104

Table 3-1. Descriptive statistics of temperatures (C) recorded for Bear 3 July 2004 throughout decomposition. Ambient Underground Maggot Mass Second Ambient Mean temperaturea 25.31C 31.36A 29.91B 25.38C Standard error 0.095 0.119 0.095 0.079 Minimum temperature 18.66 21.33 21.71 19.42 Maximum temperature 33.59 44.89 40.59 33.59 Confidence level 0.19 0.23 0.187 0.16 aMeans in the same row followed by the same le tter are not significantly different (P=0.05; Duncans multiple range test [SAS Institute 2003] Table 3-2. Daily mean temperatures (C) reco rded for Bear 3 July 2004 analyzed with Duncans test to show significance. Day Ambient Underground Maggot Mass Second Ambient 1 24.26C 35.74A 29.17B 24.50C 2 23.97C 40.40A 35.02B 24.06C 3 25.16C 34.60A 31.25B 25.13C 4 25.89C 33.31B 34.94A 25.96C 5 23.54B 31.69A 32.04A 23.77B 6 22.77C 29.57A 28.31B 23.27C 7 25.73C 29.57A 28.83B 25.63C 8 26.20C 30.20A 29.37B 26.17C 9 24.30C 28.99A 27.45B 24.46C 10 24.25C 28.26A 27.17B 24.28C 11 24.82C 28.04A 27.56B 24.68C 12 29.26A 28.78B 29.14AB 29.25AB 13 28.75A 28.45A 28.64A 28.79A 104

PAGE 105

0 2 4 6 8 10 12 14 16 18 20 12345678910111213141516171819 Days After DeathMean Length (mm)0 5 10 15 20 25 30 35 40Temperature (C) Second Instar Third Instar Maggot Mass Mean 31 Figure 3-3. Mean growth rate of Chrysomya rufifacies and mean maggot mass temperature for Bear 4 September 2004. Table 3-3. Descriptive statisti cs of temperatures (C) reco rded for Bear 4 September 2004 throughout decomposition. Ambient Underground Maggot Mass Second Ambient Mean temperaturea 24.25C 32.17A 31.06B 24.29C Standard error 0.07 0.07 0.12 0.07 Minimum temperature 18.28 19.04 18.28 18.28 Maximum temperature 31.93 36.57 49.56 32.76 Confidence level 0.144 0.137 0.229 0.131 aMeans in the same row followed by the same le tter are not significantly different (P=0.05; Duncans multiple range test [SAS Institute 2003]) 105

PAGE 106

Table 3-4. Daily mean temperatures (C) reco rded for Bear 4 September 2004 analyzed with Duncans test to show significance. Day Ambient Underground Maggot Mass Second Ambient 1 26.61B 26.62B 32.26A 26.46B 2 25.62C 29.68B 31.99A 25.52C 3 24.33C 31.20A 29.52B 24.46C 4 22.49C 31.66A 25.99B 22.59C 5 21.43B 31.37A 31.41A 21.55B 6 22.71C 30.74B 32.70A 22.81C 7 24.10C 30.83B 36.61A 24.17C 8 23.34C 32.04B 37.99A 23.54C 9 24.57C 34.12B 36.92A 24.65C 10 23.90C 35.66A 33.87B 24.04C 11 23.18C 31.47A 27.48B 23.31C 12 24.85C 33.11A 30.17B 24.70C 13 24.62C 35.28A 31.95B 24.58C 14 24.06B 35.65A 36.14A 24.13B 15 24.97C 35.13A 28.48B 24.98C 16 24.73C 34.21A 27.59B 24.96C 17 26.31C 33.65A 27.72B 26.30C 18 24.38B 32.77A 25.26B 24.53B 19 24.59A 25.43A 25.36A 24.34A 106

PAGE 107

107 0 5 10 15 20 25 30 35 40 12345678910111213141516171819 Days After DeathTemperature (C) Ambient Underground Maggot Mass Second Ambient Figure 3-4. Daily temperature means plotte d against time for Bear 4 September 2004.

PAGE 108

Table 3-5. Overview of adult Diptera and Coleoptera collected during decomposition. Bear 1 May 2003 Bear 2 Dec. 2003 Bear 3 July 2004 Bear 4Sept. 2004 Species Adults Chrysomya rufifacies + + Cochliomyia macellaria + + + + Chrysomya megacephala + + Lucilia sericata + + Sarcophagidaea + + + Hermetia illucens + Synthesiomyia nudiseta + Hydrotaea leucostoma + + + + Muscidaea + + + + Misc. Dipteraa + + + + Necrophila americana Nicrophorus orbicollis Nicrophorus carolinus 108Necrodes surinamensis * Creophilus maxillosus Dermestes ater Dermestes caninus Dermestes maculatus Trox suberosus * Hister spp. * Saprinus pennsylvanicus aDiptera not identified to genus + denotes adult flies collected du ring the period of decomposition. denotes adult beetles collected during the period of decomposition.

PAGE 109

Table 3-6. Catalog of adult Diptera collected during deco mposition of Bear 1 May 2003. Adults Hours 0 24 48 72 96 120 144 168 192 216 240 Chrysomya rufifacies 1 1 Cochliomyia macellaria 7 24 11 4 2 Lucilia sericata 1 Sarcophagidaea 2 1 Hermetia illucens 2 1 Synthesiomyia nudiseta 1 Hydrotaea leucostoma 1 4 3 7 Misc. Dipteraa 8 3 5 7 1 Necrophila americana 2 Nicrophorus orbicollis 1 Necrodes surinamensis 2 4 1 Creophilus maxillosus 2 2 3 3 3 Dermestes caninus 1 3 Trox suberosus 2 4 5 4 Hister spp. 1 7 9 3 aDiptera not identified to genus Table 3-7. Catalog of adult Di ptera collected during decompositi on of Bear 2 December 2003. Adults Hours 0 24 48 72 96 120 144 168 Cochliomyia macellaria 3 1 Hydrotaea leucostoma 1 2 Misc. Dipteraa 4 5 1 Nicrophorus orbicollis 1 Necrodes surinamensis 1 Creophilus maxillosus 3 3 Dermestes ater 1 Hister spp. 4 aDiptera not identified to genus 109

PAGE 110

Table 3-8. Catalog of adult Diptera collected during decom position of Bear 3 July 2004. Adults Hours 0 24 48 72 96 120 144 168 Chrysomya rufifacies 1 Cochliomyia macellaria 3 1 1 1 1 Chrysomya megacephala 1 1 Lucilia sericata 4 Sarcophagidaea 2 1 1 Hydrotaea leucostoma 1 1 1 Misc. Dipteraa 5 4 3 2 6 Necrophila americana 1 Nicrophorus carolinus 2 Nicrophorus orbicollis 1 2 1 1 Necrodes surinamensis 1 3 1 1 1 Creophilus maxillosus 1 2 2 1 3 Dermestes ater 3 1 Trox suberosus 2 Hister spp. 5 5 2 4 Saprinus pennsylvanicus 1 aDiptera not identified to genus Table 3-9. Catalog of adult Dipt era collected during decomposition of Bear 4 September 2004. Adults Hours 0 24 48 72 96 120 144 168 Chrysomya rufifacies 1 Cochliomyia macellaria 1 2 Chrysomya megacephala 2 Sarcophagidaea 1 Hydrotaea leucostoma 10 7 Misc. Dipteraa 4 2 Necrophila americana 1 Necrodes surinamensis 1 Creophilus maxillosus 2 Dermestes caninus 1 Dermestes maculatus 1 1 Dermestes ater 2 Trox suberosus 3 2 Hister spp. 2 Saprinus pennsylvanicus 2 aDiptera not identified to genus 110

PAGE 111

Table 3-10. Overview of dipteran larvae collected throughout decomposition. Species Bear 1 May 2003 Bear 2 Dec. 2003 Bear 3 July 2004 Bear 4Sept. 2004 Chrysomya rufifacies + + + + Cochliomyia macellaria + + + Chrysomya megacephala + + + Lucilia caeruleiviridis + + Lucilia sericata + Phormia regina + Wohlfahrtia spp. + Sarcophaga bullata + Sarcophagidaea + Hydrotaea leucostoma + + + 111 aLarvae not identified to genus + denotes larvae collected during the period of decomposition.

PAGE 112

Species Hours 0 24 48 72 96 120 144 168 192 216 240 Eggsa ------------1st Instara ------------2nd Instara -----------------------Chrysomya rufifacies 1st instar ------------Ch. rufifacies 2nd instar ----------------------Ch. rufifacies 3rd instar ----------------------------------------------------------------------Cochliomyia macellaria ---------------------------------112Sarcophagidaeb ---------------------------------Unidentifiable 3rd instar ----------------------------------aUnidentified Dipteran life stages b Unidentified to genus Figure 3-5. Composition of larvae collected dur ing decomposition from Bear 1 May 2003.

PAGE 113

Species Hours 0 24 48 72 96 120 144 168 192 216 240 264 288 312 336 360 384 408 432 456 480 Eggsa -------------1st Instara -------------------2nd Instara --------------------------------------------Chrysomya rufifacies 1st instar -------------------Ch. rufifacies 2nd instar -------------------------Ch. rufifacies 3rd instar ----------------Cochliomyia macellaria ---------------------------------------------------------------Chrysomya megacephala ----------------Lucilia caeruleiviridis ---------------------------------------------------113Lucilia sericata ---------------------------------------------------Phormia regina -----------Wohlfahrtia spp. ---------------------Sarcophaga bullata -----------Hydrotaea leucostoma ---aUnidentified Dipteran life stages Figure 3-6. Composition of larvae collected duri ng decomposition from Bear 2 December 2003.

PAGE 114

Species Hours 0 24 48 72 96 120 144 168 192 216 240 Eggsa ----------1st Instara ----------2nd Instara ---------Chrysomya rufifacies 1st instar ---------Ch. rufifacies 2nd instar ---------Ch. rufifacies 3rd instar ------------------------------------------------------114Chrysomya megacephala ----------Hydrotaea leucostoma ----------------------------------------------------aUnidentified Dipteran life stages Figure 3-7. Composition of larvae collected dur ing decomposition from Bear 3 July 2004.

PAGE 115

Species Hours 0 24 48 72 96 120 144 168 192 216 240 264 288 312 336 Eggsa --------------1st Instara --------2nd Instara -------------Chrysomya rufifacies 1st instar ------------------Ch. rufifacies 2nd instar --------------------Ch. rufifacies 3rd instar --------------------------------------------------------------------------------Cochliomyia macellaria ----------------Chrysomya megacephala ----------------115Lucilia caeruleiviridis ---------------------Hydrotaea leucostoma ---------------------------------------------------------------aUnidentified Dipteran life stages Figure 3-8. Composition of larvae collected duri ng decomposition from Bear 4 September 2004.

PAGE 116

Table 3-11. Daily minimum, m ean and maximum ambient temp eratures (C) recorded by FAWN throughout decomposition of Bear 1 May 2003. Day Minimum Mean Maximum 1 11.91 20.88 31.87 2 14.46 23.87 33.79 3 14.09 22.10 30.09 4 14.54 24.16 32.74 5 17.10 26.31 34.81 6 19.52 24.32 33.40 7 17.42 23.67 34.36 8 19.02 22.96 28.50 9 18.17 24.03 30.39 10 18.67 21.80 26.48 11 19.14 22.79 29.08 Table 3-12. Daily minimum, m ean and maximum ambient temp eratures (C) recorded by FAWN throughout decomposition of Bear 2 December 2003. Day Minimum Mean Maximum 1 -0.35 7.20 15.03 2 -3.68 3.73 11.81 3 -6.46 3.29 14.77 4 -1.00 8.78 20.89 5 5.49 13.57 23.29 6 6.64 15.48 21.78 7 0.66 6.32 13.97 8 -1.75 6.99 19.09 9 -1.84 7.83 20.57 10 0.03 10.69 19.63 11 5.00 13.87 24.10 12 9.96 16.04 20.26 13 8.94 13.85 20.36 14 7.39 13.46 23.47 15 6.66 15.31 26.11 16 9.61 17.05 27.29 17 11.61 18.50 26.88 18 15.68 20.23 25.74 19 6.10 13.58 18.07 20 -3.51 4.12 11.00 21 -2.94 8.25 19.84 116

PAGE 117

Figure 3-9. First observation of Bear 2 December 2003 made on December 12, 2003 around 5:00 PM. Figure 3-10. Bear 2 December 2003 ten days afte r death, because of the cooler temperatures very little decomposition has occurred. 117

PAGE 118

Figure 3-11. Thirteen days post mortem, very litt le decomposition is visi ble on the surface of the bear. Figure 3-12. Larvae are seen feeding beneath the head of Bear 2 December 2003 in the body fluids. 118

PAGE 119

Figure 3-13. Day 15, surface of the bear is still intact with only one visible hole containing developing dipteran larvae. Figure 3-14. Close up of developing maggot mass located in the abdominal cavity. 119

PAGE 120

Figure 3-15. Several large maggot masses are now visible on the surface of Bear 2 December 2003. Figure 3-16. Close up of maggot mass containing Chrysomya rufifacies larvae. 120

PAGE 121

Figure 3-17. Eighteen days post mortem, the lo wer jaw bones are becoming visible because of larval feeding. Figure 3-18. Bear 2 December 2003 34 days after death, the bear has completed decomposition although fur is still present in some regions. 121

PAGE 122

Figure 3-19. Arrival of Bear 3 July 2004 at st udy site, the onset of bloat is already present. Figure 3-20. Second day post mortem, the fur has begun to slough from the abdominal and posterior leg regions. 122

PAGE 123

Figure 3-21. Nicrophorus orbicollis observed inspecting the carca ss for developing dipteran larvae. Figure 3-22. Fur has begun to slough off the sides of the bear carcass. 123

PAGE 124

Figure 3-23. Day 5 post mortem, the skin is now fully exposed and begun to dry from the warm weather. Figure 3-24. Close up of a large maggot mass of Chrysomya rufifacies along with several Coleoptera larvae feeding upon the ar m of the Bear 3 July 2004. 124

PAGE 125

Figure 3-25. Chrysomya rufifacies maggot mass feeding off of the carcass within the seeping fluids. Figure 3-26. Bear 3 July 2004 six days post mortem. 125

PAGE 126

Figure 3-27. Observation of dipt eran larvae (to the ri ght of the picture) developing along side coleopteran larvae (to the left of the picture on the abdomen). Figure 3-28. Close up of the abdominal cavity w ith several hundred feed ing coleopteran larvae present. 126

PAGE 127

Figure 3-29. Late third instar Chrysomya rufifacies larval mass located to the right of the picture, mingling with Coleoptera larvae. Figure 3-30. Twelve days post mortem, larval activ ity has ceased as well as adult activity. The ground surrounding the carcass is satu rated with seeping fluids. 127

PAGE 128

Figure 3-31. First observation of Bear 4 Se ptember 2004 made two days post mortem, bloat has already occurred. Figure 3-32. The front arm and rear leg are lo cated off the ground because of bloating within the abdominal cavity. 128

PAGE 129

Figure 3-33. Several egg masses are located on the side of the bears face along with adult flies. Figure 3-34. Adult flies are cong regating at an area of injury ma de in the skin just above the right leg because of the swelling of the body cavity. 129

PAGE 130

Figure 3-35. A small mass of dipteran larvae is located on the ground be neath the snout of the bear were blood and body fluids have accumulated. Figure 3-36. Five days post mortem, the surf ace of the carcass has undergone several biological changes such as fur sloughing and drying of the skin. 130

PAGE 131

Figure 3-37. A large maggot mass of Chrysomya rufifacies is located next to carcass; it extends beneath the dried skin for protection. Figure 3-38. The heat has rendered the skin in habitable to the developing larvae, which are located beneath the carcass within the body cavity. 131

PAGE 132

Figure 3-39. Day 7, the carcass has become with ered because of dipteran larval feeding. Figure 3-40. Chrysomya rufifacies third instar larvae are presen t feeding beneath the head and mouth of the carcass amongst the fur for pr otection from predators and the weather. 132

PAGE 133

133 Figure 3-41. A maggot mass composed of Chrysomya rufifacies larvae is located between the arm and neck of the carcass.

PAGE 134

Species Hours 0 24 48 72 96 120 144 168 192 216 240 264 288 312 336 360 384 408 432 456 480 504 538 552 576 600 624 648 Eggsa -------------1st Instara ------------------------------2nd Instara ----------------------Chrysomya rufifacies 1st instar ---------------Ch. rufifacies 2nd instar ----------------------Ch. rufifacies 3rd instar --------------------------------------------------------Cochliomyia macellaria ---------------------------Chrysomya megacephala ---------------------------Phaenicia caeruleiviridis ---------------------------Phaenicia sericata ---------------------------Phormia regina ---------------------------Wohlfahrtia spp. --------------------------Sarcophagidaeb --------------------------134Hermetia illucens --------------------------Muscidaeb --------------------------Misc.b -------------------------------aUnidentified Dipteran life stages bDiptera not identified to genus Figure 3-42. Composition of larvae collected during decomposition from Bear 5 August 2002.

PAGE 135

Table 3-13. Daily mean ambient and maggot mass temperatures (C) recorded for Bear 5 August 2002 throughout decomposition. Day Ambient Maggot mass 1 24.27 26.62 2 25.50 28.47 3 26.14 36.72 4 25.97 38.78 5 25.68 41.69 6 25.46 34.44 7 24.63 34.11 8 25.30 37.60 9 25.50 34.50 10 25.89 33.63 11 25.32 33.79 12 25.66 34.03 13 24.20 31.07 14 24.10 30.92 15 24.79 35.90 16 24.23 28.45 17 25.37 30.79 18 26.00 33.61 19 25.81 35.68 20 25.96 35.39 21 26.06 35.56 22 25.30 32.48 23 24.72 35.76 24 24.49 41.90 25 25.03 40.01 26 24.87 31.69 27 25.31 29.92 28 25.72 29.53 135

PAGE 136

CHAPTER 4 EXAMINING THE MAGGOT MASS Introduction Developing calliphorid larvae feed collectively in groups referred to as maggot masses. A mass of maggots is more efficient than indi vidual maggots at breaking down the decomposing tissue for consumption (Goff 2000). Lacerating th e tissue of the corpse with multiple mouth hooks and injecting salivary enzymes from thousa nds of larvae that predigest the food and consume the semi-liquid material enables prof icient tissue consumption. The maggot masses remain intact and move throughout the carcass as a unit. Within the maggot mass, larvae are believed to be in constant motion. Metabolic changes initiated by the larvae and anaerobic bacteria caus e the internal temperatur es of the carcass to rise (Goff 2000). This internal temperature (maggot mass temperature) is capable of reaching unbearably high levels of heat that few orga nisms can withstand (Deonier 1940, Mann et al. 1990, Greenberg 1991, Davis and Goff 2000, Goff 2000, Joy et al. 2002, Peters 2003, Slone and Gruner 2007). Many entomologists have observed the maggot massing phenomenon in their research but none have studied the movement and behavior of the larvae involved (Greenberg 1991, Hewadikaram and Goff 1991, Byrd and Butler 1996, 1997, 1998; Goff 2000, Campobasso et al. 2001, Greenberg and Kunich 2002, Joy et al. 2002). As stated by Greenberg (1991), Unfortunately, none of these outdoor studies indicates how many larvae constitute a maggot mass or the thermal contribution of each instar. A laboratory maggot mass was set up to furthe r understand the behavi or of the larvae and the function of heat production within the mass. It was hypothe sized that the larvae are in constant motion within the mass moving from the i nner most section of the mass, where the most 136

PAGE 137

heat is generated, to the outer edges of the mass to cool down. The objectives of this study are to create a maggot mass of Chrysomya rufifacies Macquart larvae in the laboratory that can be observed with videography and to analyze the behavior these la rvae exhibit in reaction to artificially elevated temperature regimes produced by an electric heating element. The heating element, set at high temperatures (40C, 45 C, 50C, 55C and 60C), was placed amongst the larval mass feeding on a meat source (chicken) to observe larval behavi or such as: larval attraction or aversion to the heat, length of time larvae spend near or away from the heat source, larval death because of heat, affect of heat on larvae feeding, changes in larval developmental rates, or no affect to the larvae. Other objectives were to obs erve the distribution of heat throughout the meat or maggot mass, larval location in relation to temperature, and developmental rates in relation to the temperatur e maintained by the element heater. The results of the laboratory maggot mass experiment should he lp explain larval development rates and the function and benefits of forming a maggot mass. Methods and Materials Hanging Meat Maggot Mass Studies A preliminary maggot mass study was conducte d outdoors to observe the decomposition process and changes in chicken. The study wa s dependent upon oviposition by wild flies. Twenty-five pounds of chicken purchased at a su permarket were placed in a cloth mesh hanging sack (Figure 4-1). The sack was suspended fr om a steel pole approximately 5 feet (1.68 m) above the ground. The sack was completely free hanging except for a sec tion 2 inches (5.08 cm) wide in the back that touched the steel pole. The sack was closed at the top and a HOBO external logger was attached to the pole. The lo gger contained four temperature probes that were placed in various locations throughout the chicken (Figure 4-2). One probe was left out of the meat and out of direct sunlight to record ambi ent air temperature; one probe was placed in the 137

PAGE 138

bottom of the chicken; one was inserted in the center of the chicken, and the last probe was placed in the top portion of the chicken. The different locations were chosen to record the varying temperatures found thr oughout the chicken meat and ma ggot masses that developed. The experimental design was changed halfway through decomposition by providing a solid surface below the meat mass. A piece of clear Pl exiglas was bent at a 90 angle and placed in contact on the side and the bottom of the hanging meat mass. Laboratory Maggot Mass Studies Chrysomya rufifacies larvae used in the studies were fr om the colonized strain in Chapter 2. All larvae were reared on store purchased spoiled chicken thighs (wt. 168. 3 g 5 g). Three to six days after emergence, Chrysomya rufifacies adults were given a piec e of spoiled chicken in a squat cup (4 cm high x 11.5 cm wide) to enc ourage mating and promote oviposition. The piece of chicken and the cup were removed from the adult cage after 1 d. The eggs and piece of chicken were placed in the aquarium with two ad ditional pieces of chicken for larval rearing. Experiments were conducted 3 4 d after egg hatch. Wandering larvae and the chicken thighs were removed from the aquarium and placed in a large rectangle Ziploc container (76 FL OZ, 2.25L; 28 cm x 17.7 cm). Upon pupation, they were placed into another large size Ziploc container, same size as above, with 5.08 cm of All Purpose Sand leveling sand (Gravelscape, Sanford, Florida). Pupae were removed from th e sand by hand and placed in a plastic squat cup within rearing cages (18 in x 18 in x 12 in; 45 cm x 45 cm x 30 cm) constructed of mesh screening sides with aluminum support structures. The newly emerged adults were incorporated back into the colony discussed in Chapter 2. E ach cage of insects was given water, sugar and powdered milk ad libitum. Moistened blood meal was also provided ad libitum for Chrysomya rufifacies adults upon emergence to promote oviposition. 138

PAGE 139

Materials needed for the laboratory contro lled maggot mass consisted of a 10 gallon aquarium with class sides and bottom, a mirror attached to a slan ted shelf, a sloped metal stand for the aquarium to set upon, Plexiglas, sc reen top, RTD/Thermocouple PID Temperature Controller Type J 115V (Cole-Parmer, Vernon Hi lls, Illinois), thermocoupl e probe type J 1/8 NPT 12L (Cole-Parmer, Vernon Hills, Illinois), single element heater encased in 326 stainless steel (Cole-Parmer, Vernon Hills, Illinois), a waterproof T-Bar digital multi-stem thermometer (Mannix Testing and Measurement), Canon ZR85 digital video camera (Canon Inc, Jamesburg, New Jersey), Sony Cyber-shot 7.2 digital camera (Sony Corp, Japan) and an Olympus OM-4T with macro lens (Olympus Optical Co., Ltd., Japan). The 10 gallon aquarium was placed on the metal stand, constructed of (1.27 cm) angle iron, with one end of the stand lowered 2 cm to provide a slope for liquid drainage (Figures 4-3 to 4-9). The stand was constructed at a height which provided room for the mirror attached to a slanted shelf to fit beneath the aquarium to vi ew the larval mass from below. Within the aquarium, a piece of Plexiglas (28.5cm tall, 0.5 cm thick, and 31 cm long) was placed horizontally across the aquarium bent in the cen ter with an angle of 95 positioned to prevent spreading of the larvae (axis runn ing vertically). This ensured that the mass stayed tight and confined to one region of the aquarium. The Plex iglas was cut to fit snuggly inside the aquarium but not flush on the sides and at the base. The single element heater (Figure 4-8) was pl aced facing down the sl ope of the aquarium in the meat and developing larvae to prevent liquid from entering the power cord region of the heater. Two stands constructed of silicone calk were placed under the heating element, one at each end, to prevent the element heater from touc hing the base of the glass aquarium. The single element heater was plugged into the RTD/Thermocouple PID temperature controller; the device 139

PAGE 140

could be set at selected temper atures and observations made visu ally and with video and digital cameras. To record and control the temper ature produced by the element heater, the thermocouple was wrapped directly to the heater with stainless sa fety wire. A waterproof T-Bar digital multi-stem thermometer (with a measurem ent range of -50 C ~ +300 C or -58 F ~ +572 F) was also placed into the maggot mass to provide instantaneous temperature readings. A screen top was placed over the aquarium to pr event contamination from other flies and to prevent the escape of research flies. Three pieces of decomposing chicken were plac ed in the aquarium on the 85 side of the Plexiglas. Chicken thighs with bone and skin, decomposing for three days, were used for each experiment. One of the pieces contained the newly deposited eggs from the Chrysomya rufifacies adults in colony. Typically 200-300 larvae were present at a time. Experiments were conducted individually because only one temperatur e controller was available. No larvae were added or removed from the aquarium after expe riments began. After larval development was complete, the meat and larvae were removed and placed in a large rectangular Ziploc container where pupation occurred. Maggot Mass Behavior in Reference to Temperature In the original design for evaluating maggot mass behavior, a Fisherbrand Traceable Digital Temperature Controller was selected to regulate the single element heater. Because the controller could not manage th e narrow temperature ranges required for the experiment, a different temperature controller was purchased. Experiments conducted with the Fisherbrand Traceable Digital Temperature Controller we re unproductive and not analyzed. The RTD/Thermocouple PID temperature controller w ith thermocouple probe allowed for precise temperature regulation from the single element heater ; therefore, evaluation of the larval reaction to the heater was possible. 140

PAGE 141

Two to three hundred first instar larvae were pl aced in the aquarium with three pieces of decomposing chicken on top of the single elem ent heater. The heater was set at desired temperature. Daily temperature readings were taken with the T-Bar digital thermometer from twenty-one different locations (Figure 4-10) on the surface of the meat or maggot mass and twenty-one different locations at the interface between the aquarium and the meat or maggot mass. The temperatures were recorded fo r each site (looking down upon the aquarium) and scrutinized. Location of the larval mass was reco rded in reference to zones (Figure 4-15) which was designated and aligned with the 21 positions marked out for temperature collection sites in Figure 4-10. The stadium of the larvae was record ed daily to determine developmental rates for comparison to growth rates from the control experi ment (28C). This process was repeated with the single element heater set at each of th e following temperatures: 40C, 45C, 50C, 55C, 60C and 65C. The developing larvae remained within the aquarium until the end of the third stadium at which time they began to wander away fr om the meat source. At this point they were placed manually within another large rectangular Ziploc container to pupate. Maggot Mass Movement in Reference to Temperature Three pieces of decaying chicken were placed in the aquarium on top of the single element heater; one piece of chicken cont ained 200-300 newly laid eggs. Th e element heater was set to 45C. To gauge maggot mass movement a prel iminary experiment was conducted by dusting horizon blue Day-Glo fluorescent powder (Day-Glo Color Corp, Cleveland, OH) to the top the layer of comprising the mass. Then a minute later 1 cc of rocket red Day-Glo fluorescent powder was applied to the interface of the aquarium and the maggot mass. The maggot mass was then observed under ultravio let (UV) light (Archer, Tan dy Corp, Fort Worth, TX). The first experiment was conducted by taking a larva from the maggot mass and coating it with Day-Glo fluorescent powder. To coat the larva, Day-Glo powder was placed into a small 141

PAGE 142

dish and the larva was placed into the powder. The larva was moved through the powder until all sides of the body was covered with powder. The larva was placed back amongst the developing maggot mass and observed for 10 min unde r ultraviolet (UV) light. The distance the larva moved was recorded in centimeters ev ery minute by plotting the larva movement and photographed. Four different repl ications were conducted using f our different larvae from a maggot mass with the heater set at 45C as in the preliminary experiment above. Upon completion of the four replications the process wa s repeated at temperatures of 50C, 55C, 60C and 65C. A second experiment was conducted to observe la rval affinity to the heat provided by the element heater. The experiment consisted of placing chartreuse yellow fluorescent pigment (Radiant Fluorescent Pigment, Richmond, CA) to the group of larvae located above the element heater and rocket red Day-Glo fluorescent powde r to the group of larvae located on the surface along the outer-edge of the developing ma ggot mass away from the element heater. Reapplication of the chartreuse yellow fluorescent powder was made because of larval movement. The heater was set at 45C; photog raphs were taken every 10 min for 30 min to observe movement under UV light The heater was increased 5C every 30 min until a final temperature of 65C was reached. To observe larval interacti on within the maggot mass, a third experiment was conducted. Three different fluorescent powders (chartreuse yellow, rocket red and horizon blue) were placed at the interface of the maggot mass and the aquarium surface, in th ree different locations (front, center and rear). Larv al movement was observed by inspec ting the surface of the aquarium every 10 min for 30 min. Photographs were ta ken under UV light. The heater was increased 5C every 30 min until a final temperature of 65C was reached on the element heater. 142

PAGE 143

Statistics The temperature readings collected from th e maggot mass behavior experiments were organized by larval mass locations (e.g. zones). The temperature r eadings recorded in the zone location of the larvae were averaged to show pref erred temperature for development. Data were the subjected to Surface Plots through Micros oft Office Excel 2003 (11.8146.8132) SP2 Part of Microsoft Office Professional Edition 2003 (Copyr ight 1985 2003, Microsoft Corporation). Results Hanging Meat Maggot Mass Studies On the hanging meat mass experiment, the la rval interaction needed to breakdown and decomposes the chicken was lacking. Without the developing larvae, the center of the meat was not impacted. Instead, the chicken rotted into a hard mass of non-consumable meat. A small number of larvae developed on the top outer su rface of the meat mass, and some were found feeding between the steel pole and the hanging ma ss (Figure 4-11). Some portions of the meat mass had Sarcophagidae larvae developing to full size, but no other spec ies were encountered (Figure 4-12). The addition of the Plexiglas to the experimental design improved the project marginally. The maggots were provided a solid su rface to keep them close to the food source and from falling to the ground. Several maggots then began growing on the Plexiglas, but because of the late decay stage of the meat, a maggot mass was not formed. The four probes recorded similar temperat ures throughout decomposition (Table 4-1and Figure 4-13); indicating that without dipteran larval development carcass temperature is based on the ambient temperature The daily mean temperatures for the meat mass are presented in Table 4-1; the temperatur e high was 28.5C and the low, 15.4C. 143

PAGE 144

Maggot Mass Behavior in Reference to Temperature A control experiment was conducted inside the rearing chamber within a 10 gallon aquarium without an element heater. The daily temperature readings were collected (Appendix A) and graphed to show temperature variations throughout development (F igure 4-14). Location of the developing maggot mass was recorded in reference to zones (Fi gure 4-15) which were designated and aligned with the 21 positions mark ed out for temperature collection sites in Figure 4-10. In the control experiment, the larvae grew within zone 1, zone 2, and zone 3 throughout development (Figure 4-16). On the first day of development a minimum temperature of 26.2C and a maximum temperature of 28.7C were reco rded. The minimum temperature was recorded on the outer-most edge of zone 7; while the maxi mum temperature was reco rded directly in the center of zone 1 where the larvae were located. On the second day of development a minimum of 22.3 C and maximum of 24.1C we re recorded, again from the same locations as on day one. The maggot mass temperature was recorded at 23.8C on day two. Day three exhibited a minimum temperature of 23.5C recorded within zone 7 and a maximum of 25.6C from zone 4. The maggot mass temperature was recorded at 26 .2C. Daily recorded temperatures were typically within one degree of ambient (28C) until the fourth and fifth days of development. On day four a maximum temperature of 31.1C was r eached in zone 6 and on day five a maximum temperature of 30.5C was recorded in zone 1. The minimum temperatures were 26.3C and 26.4C for days four and five, respectively, both te mperatures were recorded in the outer-most edge of zone 6. The recorded maggot ma ss temperature for day five was 29C. The rates of development were recorded and tabulated together for each different temperature experiment to compare the effects of heat on larval growth (Table 4-2). The growth rate from the control experiment was the slowes t and larvae took a total of 10 d to reach pupation 144

PAGE 145

from the egg stage (Table 4-2). Eggs were present on day one, followed by 1st instar larvae on day two. On days three and four 2nd instar larvae were observed. Third instar larvae were found 4 to 7 d after oviposition. The larvae wandere d away from the meat source on day eight and pupation began on day ten. The 40C experiment was conducted over se ven days throughout which the larvae developed within zone 1 directly above the element heater (Figure 4-17). The daily temperature readings were collected (Appendi x B) and graphed to show temperature variations throughout development (Figure 4-18). The developing la rvae did not form a maggot mass on the surface; therefore, maggot mass temperature was not reco rded. On the first day of development the minimum temperature was recorded at 26.6C in the outer-most edge of zones 6, 7, 8, and 9. A maximum temperature of 33.9C was recorded in zone 7 above the element heater. On day two the larvae were found developing in zone 1 at temperatures of 30.4 C and 33.7C, while the maximum temperature was recorded at 34.8C in zone 3. The minimum temperature was recorded in zone 9 at 22.1C. The temperatures recorded on day three at the site of larval development were 30.8C and 33.3C. The minimu m temperature was recorded at 28.9C in zone 9 while the maximum temperature was 35.5 in zone 7 directly above the element heater. On the fourth day, the larvae were still located in zone 1 where temperature readings were taken at 31.5C and 33.5C. The maximum temperat ure (37C) recorded for the day occurred at the tip of the element heater at the perimeter of zone 7. The minimum temperature for day four was recorded in zone 9 at 28.3C. The minimum and maximum temperatures recorded on day five were 29.5C and 35.4C, respectively; they we re recorded in the same locations as the day before. The larvae were located in the same region at temperatures of 30.5C and 33.6C. On day six, the minimum and maximum temperatures were again reco rded in zone 9 and on the 145

PAGE 146

perimeter of zone 7 at 29.8C and 37.2C. The site of the developing larvae exhibited temperature readings of 30.4C and 33.3C. On th e final day of development, the temperature recorded near the la rvae had increased s lightly to 30.7C and 33.8C. The maximum temperature was again recorded on the perimeter of zone 7 at 39.8C. A minimum temperature of 29.5C was documented within zone 7. The developmental rate for the larvae growing with the element heater set at 40C grew at the same rate as the larvae in the control experiment but pupated one day earlier (Table 4-2). The eggs were present on day one, eclosing within 24 hours (Table 4-2). On days three and four, 2nd instar larvae were present within the a quarium. From day four to day seven 3rd instar larvae were prevalent amongst the meat source. On da y eight the larvae wandered away from the meat source and pupated on day nine. The daily temperature readings (Appendix C) recorded for maggot mass behavior 45C experiment are presented in a surface plot in Fi gure 4-19. The larvae began development in zone 1 at temperatures of 28.5C and 31.5C. The minimum temperature of 27.5C was recorded in zone 2 while the maximum (45.1C) was recorded at the tip of the element heater on the perimeter of zone 7. By the second day the larvae had spread into zone 3 and zone 7 but were still present in zone 1 (Figure 4-20). Temperatures were recorded from zone 1 at 36.3C and 38.8C; zone 3 at 31.9C and 36.6C; and zone 7 at 30.6C and 37.5C. The maggot mass temperature was recorded at 37.9C. The maxi mum temperature recorded was 38.8C from zone 1, with a minimum temperature of 25C from zone 9. On day three the larvae were still located in zones 1 and 3. The temperatures recorded from zone 1 were 36.3C and 38.8C. The temperature readings from zone 3 were 37.1C and 42.3C, which was also the maximum 146

PAGE 147

temperature recorded for the day. The maggot mass temperature was recorded at 38.9C, while the minimum temperature was recorded on the outer-edge of zone 9 at 26.5C. Larval development at 45C was complete 7 d after oviposition (Table 4-2). The larvae developed from egg to 3rd instar in three days, at which poi nt the larvae began to wander within the aquarium. The larvae were removed from th e aquarium and placed in a Ziploc container where they continued to develop. Pupation occurred seven days after oviposition. The 50C maggot mass behavior experiment was conducted over a six day time period. Throughout this time the maximum temperatures were recorded in zone 7 at the element heater, the recorded temperatures (listed chronologi cally by day) were 50.4C, 48.7C, 50C, 57.6C, 52.7C and 49.2C. The minimum temperature readings ranged from 25.2C (on day one in zone 5) to 28.8C (on day two in the outer-edge of zones 7 and 9). On day three a minimum temperature of 27.2C was recorded in the outer-edge of zones 6 and 9. The last three days of development minimum temperatures of 26.1C, 28.5C, and 27.4C, respectively, were recorded in the outer edge of zone 6. Maggot mass temp eratures were recorded at 37C on 2 d, 39.6C on 3 d, 32.2C on 4 d and 31.3C on 5 d. The data points recorded (Appendix D) daily during the experiment are depicted in a surf ace plot graph (Figure 4-21). Throughout development at 50C, the larvae moved frequently between the zones, starting in zone 1 at 25.9C and 30.8C (Figure 4-22). Th e larvae quickly move to zone 4 the following day where the temperature was recorded to be 32.6C and 44.8C. On day three, the larvae maintained their location in zone 4 at 32.3C and 45.4C. The larvae moved to zone 3 (34.9C and 46.8C) and zone 5 (32.0C and 36.1C) on the fourth day. On day five the larvae had shifted again to occupy zones 1, 3 and 4. Temp erature readings in zone 1 were 33.0C and 43.0C. The temperatures recorded in zone 3 were 34.3C and 46.1C, while the temperatures of 147

PAGE 148

zone 4 were 33.5C and 46.7C. By the sixth day of development the larvae were documented at temperatures of 33.1C and 44.3C in zone 2 an d 33.3C and 34.3C in zone 5. At 50C, the larvae developed quickly from eggs to 3rd instar larvae in only three days (Table 4-2). Larvae remained in the 3rd instar from 3 to 6 d and the wandering phase started on 7 d. The larvae began to pupate 8 d after oviposition. Daily temperature readings were documented (Appendix E) and plotted (Figure 4-23) for maggot mass behavior 55C experiment; the temper ature readings were then analyzed in regards to location of the larvae and the element heater. During the first day of experiment 55C, first instar larvae were located in zone 1 at 29.3C and 33.0C (Figure 4-24); the minimum temperature was recorded at 24.7C outside zone 6, while the maximum temperature was recorded at 51.4C in zone 7. The maximum te mperatures documented throughout development were all from the same location in zone 7: 61.2C on 2 d, 57.4C on 3 d, 55.5C on 4 d and 55.1C on 5 d. On the second day larvae were pres ent in zone 1 (32.7C and 45.1C) and zone 2 (31.8C and 37.1C); the maggot mass temperatur e was recorded at 36.8C. The minimum temperature reading was take n in zone 3 at 27.3C. Day three temperature data for experiment 55C showed a minimum temperature of 28.3C in the outer-edge of zone 7. The developi ng larvae were still located in zones 1 and 2 on day three; the recorded temp eratures for zone 1 were 32.7C and 43.3C and for zone 2, 31.3C and 37.9C. The maggot mass was documented to have a temperature of 37.5C. The minimum temperature for day four was recorded in the outer-edge of zone 8 at 28.5C, while the maggot mass temperature was 31.1C. The larvae were located in zone 2 (33.0C and 44.2C), zone 6 (33.8C and 37.4C), and zone 9 (30.5C, 32.0C, 30.7C, and 31.1C). On the final day of experiment 55C a minimum temper ature of 28.3C was recorded in the outer-edge of zones 6 148

PAGE 149

and 8. The larvae were still located within zone s 2, 6, and 9; temperatur es were documented at 32.3C and 39.4C, 33.8C and 37.4C, and 31.1C, 31.6C, 30.8C, and 31.0C, respectively. The developing larvae within the maggot mass be havior 55C experiment grew at a similar rate to the larvae in the 50C experiment (Table 4-2). On the second day following oviposition, 1st instar larvae were present. By day three, the larvae had developed into 2nd instars. Third instar larvae were present from 4 d to 6 d after oviposition; the larvae began to wander on day seven and pupate on day eight. The larvae from the maggot mass behavior 60 C experiment developed in five days. The larvae were located in zone 3 on the first day of development; the temperatures at this site were recorded at 30.5C and 36.5C (Fi gure 4-25). On day two the larvae had relocated to zone 1 where the temperature was recorded at 35.4C an d 45.4C and zone 2 with temperature readings of 36.7C and 41.6C. Slowly the developing larvae moved further from of the element heaters hottest point (located in zone 7). The larvae were now (day 3) located in zone 1 (38.3C and 42.2C), zone 2 (34.8C and 37.0C), zone 3 ( 32.0C and 47.4C), zone 4 (33.8C and 38.3C) and zone 6 (31.2C and 38.0). On the fourth day, the larvae were still located in zones 1, 2, 3, and 4 but had also moved into zones 5 and 8. Temperature readings for zone 1 were documented at 34.7C and 41.7C, temperatures in zone 2 were 38.8C and 40.4C, while 38.8C and 40.4C were recorded in zone 3, and 33.8C and 39.0C we re documented in zone 4. The larvae within zone 5 were recorded at temper atures of 33.3C and 34.9C, while the temperature readings form zone eight were 33.2C, 33.7C, 32.7C, and 34.3C. On the final day of the experiment larvae were located in zone 7 (31.8C, 33.0C, 39.0C, 45.2C, 31.5C, and 34.4C) and zone 8 at the temperatures of 31.7C, 33.3C, 29.5C and 33.8C. Daily temperatures were collected from 42 149

PAGE 150

locations depicted in Figure 4-10, documented (Appendix F) and graphed based on location and day (Figure 4-26). The maximum temperatures were recorded at the perimeter of zone 7 at the tip of the element heater throughout development. On th e first day the temperat e reading was 64.1C, on day two it was recorded at 61.8C, 62.0C was reco rded on day three, on the fourth day it was 64.9C and 60.2C on day five. Maggot mass temperatures were only documented for days two (37.5C), three (37.4C) and four (36C) becau se a mass was not prominently formed on the surface of the meat the other days. The minimum temperatures ranged from 26.3C on day one to 29.0C on day five. On the first day the mini mum temperature was recorded at 26.3C from zone 9. The next day, the minimum temperature was recorded in the outer-edge of zone 8 at 26.5C. On days three, four and five the mini mum temperatures were documented in the outeredge of zone 6 at 26.4C, 27.7C, and 29.0C, respectively. Larval development took a total of eight days to reach pupation (Table 4-2). The eggs were present on day one followed by 1st instar larvae on day 2 (Table 4-2). Some of the larvae developed into 2nd instars by the second day while the rest of the larvae molted on day three. Third instar larvae were present from 3 d to 6 d at which point the larvae began to wander. The onset of pupation occurred eight days after oviposition. The larvae developing in the maggot mass beha vior experiment at 65C frequently moved around the designated zones (Figure 4-27). The daily temperature read ings were documented (Appendix G), analyzed and graphe d (Figure 4-28). The larvae we re first located in zone 1 (28.8C and 31.0C), zone 3 (29.4C and 31.4C) and zone 7 (26.7C, 27.6C, 35.1C, 60.5C, and 28.4C) on the first day of development. By the second day some of the larvae had shifted into zone 4 where the temperatures were 35.3 C and 41.7C and zone 6 with temperatures of 150

PAGE 151

38.7C and 41.3C. Many of the larvae were still located in zone 7 at 30.7C, 32.6C, 42.5C, 59.0C, 32.6C, and 33.7C. On the third day th e larvae had begun to move about the meat source even more, now occupying zones 2, 5, 6, 7, and 9. The temperatures ranged from 31.3C to 61.3C between these zones. On the final day of development, larvae could be found in zone 3 where the temperatures were 41.7C and 54.1C, zone 5 at 34.5C and 37.6C, zone 7 (32.5C, 33.6C, 38.5C, 57.4C, 31.6C, and 35.7C) and in z one 9 with temperature readings of 33.0C, 34.3C, and 33.2C. The minimum temperatures were recorded fr om the outer-edges of the zones beginning with 26.2 C on day one, to 29.5C, 28.8C and ending with 28.6C on day four. The maximum temperature was again recorded from the tip of the element heater at the edge of zone 7; the first reading was 66.5C, followed by 73C, then 64.4 C and finally 65.6C. A well defined maggot mass could be observed each day and the temp erature was documented at 29.2C on 1 d, 35.0C on 2 d, 39.6C on 3 d, and 37.3C on 4 d. With the increased temperature produced by the element heater, the larvae grew very quickly passing through a la rval stage every day (Table 42). The 3rd instar stage started on 4 d and the larvae wandered away from the food source on day six. Pupation began seven days after oviposition. The temperature produced by the element h eater during the maggot mass experiments influenced the growth rate of the developi ng larvae. At ambien t temperature (Control experiment), the amount of time needed to reach pupation was 10 d but the external heat source increased the over growth rate (Figure 4-29). Da ily temperatures were collected and examined for possible patterns between the growth rate and recorded temperatures (Table 4-3). After studying the data a distinct pattern was unrecogn izable, except on Day 3. On Day 3 the maggot mass temperature was higher than that of the aver age temperature for the location of the mass for 151

PAGE 152

each experiment, meaning that on Day 3, despit e the surrounding temperature, the maggot mass temperature would increase beyond that of the medium. The larvae appear to prefer the warmth of the medium as opposed to the outer-edges of the meat source that were recorded at or below ambient. The developing larvae within the 50 C, 60C, and 65C experiments were located in areas where the temperature was 39C. A maggo t mass temperature from experiments 50C and 65C were documented at 39C. The larvae appear to have a preference for warm temperatures but they were not seen feeding in the areas of the medium with ex treme temperatures. The larvae were not inconvenienced by the increasing temperatures produced by the element heater. The increased heat did accelerate larvae growth. The larvae moved to the most suitable location amongst the meat source to ensure surv ival. As the temperature went up with each experiment the larvae moved to zones further away from the element heater. Larvae were not typically observed feeding at the tip of the element heater where the maximum temperatures were recorded. Maggot Mass Movement in Reference to Temperature The results of the preliminary study provided vi sual and video insight into the movement of the maggot mass. It demonstrated that the larvae within a mass are constantly moving at all times. The larvae do not move in unison or in any particular directi on. The horizon blue DayGlo fluorescent powder was applie d to the top of the maggot mass (Figures 4-30 and 4-31) at the beginning of the experiment, then a minute later, rocket red Day-Glo fl uorescent powder was applied to the base of the maggot mass (below the larvae) (Figure 4-32). The majority of observed larvae were covered in horizon blue powd er but some larvae covered in the rocket red powder surfaced (Figure 4-33). A minute or two af ter application of the powders, more larvae begin to appear on the surface of the maggot mass that are covered in the rocket red powder (Figure 4-34). The larvae from the bottom of the maggot mass move to the top portion of the 152

PAGE 153

mass quickly (Figure 4-35). Larvae covered with horizon blue powder may have also moved to the base of the maggot mass but this was not obse rvable. The amount of time needed for larval movement varied by larvae, some larvae traveled quickly while others did not move in location but moved in place, as if undulating. The prel iminary study provided insight into maggot mass movement but did not provide quantitative da ta; therefore three other experiments were conducted. The first experiment was conducted to collect quantitative data from the movement of the maggot mass. A single larva was coated in fluorescent powder and placed amongst the other larvae in the maggot mass. The path of the larva was unable to be documented because of powder-transfer and the larva disappearing into the maggot mass (Figures 4-36 to 4-40). The original larva was unable to be followed for 10 min and measuring its distance traveled was impractical. To follow the path of the larva wh en it travels straight down into the maggot mass, the mass must be disturbed. The disruption of the maggot mass causes the larvae to disperse; therefore, ruining the maggot mass. Also upon searching within the mass it is not always possible to find the original larva. For the second experiment chartreuse yellow fluorescent pigment was applied to the group of larvae located above the element heater while rocket red Day-Glo fluorescent powder was applied to a group of larvae lo cated on the outer-edge of the maggot mass (Figure 4-41). Seventeen minutes after application, the gr oup covered with yellow powder had moved so rapidly and frequently yellow powder was no longer visible on the surface (Figure 4-42). There were no larvae observed moving from the chartreuse yellow group to the rocket red group within this time period. However, several larvae c overed with rocket red powder were observed moving atop the group previously covered with chartreuse yellow powder. A reapplication of 153

PAGE 154

chartreuse yellow powder 10 minutes later was ma de to the larvae located above the element heater. The reapplication intens ified the larvae above the heater therefore showing many larvae from the rocket red group had moved closer to the heat source (Figure 4-43). Because of the frequent movement within the chartreuse yellow group no quantitative data could be collected. Larval affinity was noted visually and by vi deo with the larvae moving on or towards the element heater. The amount of time needed for th e powder to disappear or for larvae to move throughout the maggot mass was obse rved, but a standard experime nt of documenting length of movement for thirty minutes was not possible with the methods of choice. A single larva or a few larvae could not be designated for observation or used to measure distance moved within a time period. Plus the powder faded or mixed within the maggot mass very quickly preventing the observation of larvae that originated from the top or bottom of the mass. The final experiment consisted of placing three different fluorescent powders at the base of the aquarium beneath the maggot mass. The powd ers were placed in three different locations (front, center, and rear) and then the larvae were allowed to move so the mixing of the powders could be observed. Unfortunately the project was not feasible. To observe the mixing of the powder every ten minutes, as designated by th e design, larvae had to be moved thereby disrupting the maggot mass. Upon disruption of the larvae, the maggot mass was no longer formed; therefore, preventing any further obse rvation. In addition, the larvae moved very erratically which caused the powder to mix or fade rapidly. Discussion Hanging Meat Maggot Mass Studies The hanging maggot mass experiment showed th at dipteran larvae pref er a surface to grow on when feeding. Most larvae grow on the ar ea of a carcass lying on the ground, where they grow larger and faster than the larvae found w ondering the top surface of the carcass. This can 154

PAGE 155

be attributed to the protection they receive from the environmen tal elements and predators when they are on the ground. The hanging meat mass did not provide covering or surface area for the larvae to develop. Very few eggs or first inst ar larvae were observed on the decaying meat. The lack of oviposition concurs with Campobasso et al. (2001), that female adults are able to recognize the dehydrated skin as an inhospitable substrate for thei r larvae to grow. The meat was exposed for three weeks but without larval ac tivity it became hard and unsuitable for further larvae consumption (Figure 4-44). Without the formation of a maggot mass, the chicken remained at ambient temperature throughout de composition. The hanging chicken recorded similar temperatures in all 4 probes, agreeing with other studies on carcasses showing that dipteran larvae must be present on a carcass to produce excessive temperatures during the decay process. Morton and Lord (2006) discussed how a d ecomposing hanging pig lingered for several months because of skin desiccation which created a hard shell. Another problem concluded from the hanging meat was the inability of the larvae to colonize because they would fall from the mass while moving about (Shalaby et al. 2000, Morton and Lord 2006). Shalaby et al. 2000 conducted a study where the decomposition time of a hanging carcass was compared simultaneous with one on the ground. The abdominal temperatures for the hanging carcass were similar to ambient air temperatures thr oughout the study, indicating its decomposition was regulated by ambient temperatures instead of the maggot mass temperature (Davis and Goff 2000, Shalaby et al. 2000, Peters 2003). In agreem ent with Shalaby et al. (2000), data presented here supports the hypothesis that larval deve lopment rates are dependent on temperature produced by the maggot mass. 155

PAGE 156

Maggot Mass Behavior in Reference to Temperature Larvae within a maggot mass are capable of su rviving at intense temperatures whether being produced by the mass or from an external source. It is known that high temperatures are harmful but the larvae move to the most favorab le environment within a carcass (Deonier 1940, Goff 2002). It is observed with this study that the larv ae are aware of their surrounding temperatures and will move to the best locati on within a maggot mass and within the medium. Cianci and Sheldon (1990) express an interest in finding the lethal temperature of a larval species and how closely associated this temperature is wi th the optimal temperature. One aspect of my project was to close the gap between the leth al and optimal temperature by observing larval behavior associated with high temperatures. The temperatures being produced by the extern al heat source were influential to the developing larvae in many ways. The larvae were not bothered by the increased temperatures of the element heater nor did they die. The maggot masses have the ability to find the most optimal temperature within the medium (with the heater at any temperature) that allows for efficient development. The maggot masses would move am ong the medium to feed at the most suitable temperature. Larval movement within the maggot mass did not appear to be influenced by the increased temperatures from the element heater. Increased rates of movement by the developing larvae were not observed in any of the experime nts. The continuous larval movement in the maggot masses for each experiment can be attrib uted to the larvae feeding in regions of the medium with the most optimal temperatures. Cianci and Sheldon (1990) discuss the possibility that larvae are pushing their upper development tole rance threshold on a daily basis. This could very well be true given the adaptability of the developing larvae. Goodbrod and Goff (1990) stated that behavior of the maggots during feeding may be yet another factor influencing rate of development; maggots placed into medium tend to aggregate in 156

PAGE 157

a single mass and burrow in, feeding continuousl y. In my study larval behavior contributed heavily to development and medium consumpti on. The control and 40C experiments exhibited longer developmental times along with minimal maggot mass activity. The constant massing behavior observed in the experiments is necessa ry for the larvae to flourish at their fullest potential. Large maggot masses in addition to me dium temperature increase larval movement and development. Increased movement and faster development provide a relationship that better distributes the heat so the highe r temperatures can be tolerated. Slone and Gruner (2007) state that the larvae mo ve about the maggot mass in an attempt to escape from the hot center to cool; therefore, the average temperature experienced by the larvae would be less than the hottest temperatures of the aggregation. My study intended to verify or dispute this theory but upon completion it appear s that some of the larvae are capable of surviving at higher temperatures than others. Th ere is no distinct pattern that each larva takes indicating that all move from the high to low temperatures of a ma ggot mass. Some of the larvae were not observed moving about the maggot mass a nd others preferred to remain on the surface where the temperatures are cooler. It was also observed that the larvae in each experiment grew in the medium at average temperatures the same as or higher than the maggot mass temperatures. The average temperatures were typically lower than the high temperatures recorded but they were notably higher than the ambient (28). Larv ae flourished in the medium at temperatures of 32C to 39C, preferring the higher temperatures. The constant ambient temperature for all of the experiments was 28C and many re gions of the medium were reco rded at or below this level but the larvae preferred the higher areas of the medium throughout decomposition. On Day 3 of larval development in all of the experiments, a maggot mass temperature was recorded higher than the temperature of the medium. Day 3 for each experiment was the onset of 157

PAGE 158

third instar larvae. As mentioned in Chapter 3 with regards to maggot mass temperature, an increase always occurs when the larvae develop into the 3rd instar. The sharp increase in maggot mass temperature occurred in the field studies and was seen on Day 3 of the laboratory studies. The phenomenon was also observed and disc ussed by Cianci and Sheldon (1990). The growth rate data presented for the diffe rent temperature experiments agrees with Deonier (1940) that larval deve lopment is dependent on the temper ature of the breeding medium. As the temperature of the element heater increased, the length of time necessary to complete larval development decreased. Campobasso et al. (2001) express the importance temperature has in decomposition; temperature interferes with insect activity and the rate of insect development. The growth rates of this study were influenced more by the temperature being produced by the element heater and developing than the ambient te mperature. As stated by Campobasso et al. (2001), elevated temperatures and the activity of a dense maggot mass are thus, the main elements responsible for the rapid decay of organic matter. Deonier (1940) points out that the high temperatures of a carcass do not occu r until larval deve lopment begins. The larvae within the experiment at 45C grew at a faster rate than larvae from the other experiments. The faster developm ental rate is attributed to the greater number of larvae within the experiment, also noted to be a factor by Slone and Gruner (2007). Lord et al. (1986) stated that temperatures from inside the maggot mass will be significantly hi gher than the ambient temperatures. In agreement with Lord et al. (1986) the results presente d here show that maggot mass generated temperature is asso ciated with the number of larv ae more so than the ambient temperature. Some researchers have observed high temperat ures inhibiting Dipteran growth for certain species. With the species Calliphora vicina, temperatures constantly above 30C altered the life158

PAGE 159

cycle and produced stunted larval forms whic h failed to pupate (Campobasso et al. 2001). Greenberg (1991) documented Lucilia sericata entering diapause at 35C and a delay in pupation. The Chrysomya rufifacies larvae used in the experiments presented here, did not face uncertainty and were able to complete their life-cycles and pupate on time. The increased temperatures from the element heater caused larval devel opmental rates to increase. It should be noted that even with the element heater at temperatures above 65C, the larvae had the ability to move to a more suitable location within the medium. Maggot Mass Movement in Reference to Temperature Observation of larval movement amongst the maggot mass in relation with temperature has never before been explored. It is noted by many that the larvae are in constant motion within a maggot mass but the factors that drive the move ment have not been researched (Deonier 1940, Mann et al. 1990, Greenberg 1991, Hewadikara m and Goff 1991, Byrd and Butler 1996, 1997, 1998; Davis and Goff 2000, Goff 2000, Campobasso et al. 2001, Greenberg and Kunich 2002, Joy et al. 2002, 2006; Peters 2003, Slone and Gruner 2007). My project was designed to evaluate the movement of the larvae within a maggot mass and determine the driving force behind the movement. Upon conducting the proposed experiments with Day-Glo fluorescent powder it was obvious that the chosen methods were not a cceptable for achieving the proposed goals. The powder was unsuitable for marking larvae for prolonged observation. The powder would transfer to other larvae amongs t the maggot mass covering al l the larvae and preventing documentation of the distance traveled. At the onset of an experiment the powder provided a vivid outline of the path taken by a larva. But because of powder-transfer, many paths were soon seen, thus preventing the tracking of the original larva. Tracking the larva within a maggot mass proved cumbersome. Enhanced methods and resources would enable proper tracking of larvae to 159

PAGE 160

record their movement throughout the entire maggot mass, even beneath the surface (e.g. radioactive marking, GPS). Several problems were encountered while at tempting to observe the larva. The most notable problem occurred with placing the larva back into the maggot mass the powder would transfer to the other larvae. Maggot masses are three dimensional allowing for the larvae to move from side to side, north to south and in to and out of the mass which prevents visual observation. The larvae traveled straight down into the maggot ma ss at the site of placement and did not return to the surface. Or the larv a would lose the powder coating and become unrecognizable amongst the other larv ae (Figures 4-45 to 4-48). Another issue encountered upon repetition of the fi rst experiment is that every larva takes a different path. Four larvae were placed amongs t the maggot mass at the same time and each went a different way. One larva circled the maggot mass, one larva traveled down the side of the mass to the bottom, another larva went straight into the mass and the other larva just moved about the mass nonchalantly. The larvae do not appear to have a reason to their movement or a particular destination. The larvae are constantly moving about the maggot mass unsystematically. Thus acquiring quantitative data by coating a singl e larva with Day-Glo fluorescent powder to measure dist ance traveled in a particular time period was not possible. These observations indicated th at the larvae were in consta nt motion within the maggot mass but that the movement was variable. Th e developing larvae move about the maggot mass at different rates, on different paths. Goff (2002) describes th e larvae as circulating throughout the mass, moving from the inside of the mass wher e the temperature is highe st to the outside of the mass where the temperature is cooler. This circular movement could be observed in regards to the mixing of the powders but the larvae did no t always follow the same routes. Some of the 160

PAGE 161

larvae were moving on the surface of the mass for an extensive amount of time while other larvae traveled within the mass and did not re-s urface. Many larvae were observed undulating, moving in place but not location. Maggot mass movement provides larvae the ability to grow at their optimal temperature, cool down from the intensive heat being produced from the center of the mass, and regulate their growth rates (Cianci and Sheldon 1990, Goff 2002) The larval movement varies with the individual larva; most follow the circulating pa ttern described by Goff (2002) but this is not always the case. The Day-Glo powder studies provi ded insight into the various patterns in which larvae choose to move about a maggot mass but further research is needed. Larval feeding has been the understood purpose of forming a maggot mass (Deonier 1940, Cianci and Sheldon, Goodbrod and Goff 1990, Goff 2000, Campobasso et al. 2001, Slone and Gruner 2007) but observations from my study suggest it is a function of la rval behavior. After observing larval movement within a maggot mass it appears that much of the movement on the outer surface is not instigated by a necessity to consume food. Many times the maggot masses are elevated above the medium preventing access of the larvae to the food. This raises the question as to why they are still massi ng when no food is being consumed. The massing behavior might also play a larg er role in body temperature regulation than previously thought. As seen with my study, the maggot masses produced heat above ambient at all times and the larvae were comfortable with th e higher temperatures. The later instars and the outer areas of the maggot mass are continually moving and produce high te mperatures but do not appear to be consuming food. Describing the larvae within a maggot mass as moving continuously from the center to the surface in a circular manne r is not accurate. A better description would be that the larvae enter the ce nter of a maggot mass to consume the medium. 161

PAGE 162

162 The larvae then resurface to rest after food c onsumption for the purpose of digesting their food more so than to cool. At the surface they are st ill in constant motion and the temperature is still relatively high. More research is ne eded to further substantiate this. The larvae did not exhibit beha vioral cues to suggest that movement patterns were prearranged or planned out ahead of time. As Go ff (200) suggests, the movement of a maggot mass is important to the developing larvae for food co nsumption. It enhances growth rates of the larvae and increases the amount of food able to be consumed in a short amount of time. The larvae have the ability to find the most optim al temperatures for development within the medium. Determining the driving force behind larval movement will take more time and consideration, but may not be f ound. Suggesting that the larvae ha ve carefully planned out their every move would mean regarding them as intelligent. Insects are capable of some extraordinary feats but portraying maggots as cogent creatures would take some convincing.

PAGE 163

Figure 4-1. Hanging Meat Maggot Ma ss suspended from steel pole five feet and six inches (1.68 m) above the ground. Probe 2 Probe 3 Probe 1 Probe 4 Figure 4-2. HOBO temperatur e probes placed amongst the chicken of the Hanging Meat Maggot Mass, to record variations of temperature throughout decomposition. 163

PAGE 164

Figure 4-3. Laboratory maggot mass experiment set up with the Fisherbrand Traceable Digital Temperature Controller. A q uarium Mirror Metal stan d Plexiglas Figure 4-4. Overhead view of developing larvae located in the aquarium for laboratory maggot mass experiment. 164

PAGE 165

165 Figure 4-5. View of laboratory maggot mass experiment from ben eath reflected by the mirror. Figure 4-6. Laboratory ma ggot mass experiment view from the top, several hundred larvae are present in distinct maggot masses.

PAGE 166

Figure 4-7. RTD/Thermocouple prec ise temperature controller; fr ont display shows temperature the thermocouple is reading (i n red numbers) and the set temperature for the element heater (green numbers). 166

PAGE 167

Thermocouple Silicon e s ta nd Silicon e s ta nd Element Heate r Figure 4-8. Laboratory maggot mass experiment set up with new thermocouple, temperature controller and new element heater. The h eater is facing down slope on two silicone stands with silicone wrapped around the plug cord. The thermocouple is wrapped directly to the element heater with stainless safety wire. Figure 4-9. Top view of second instar larvae pla ced into the aquarium with element heater for experiment at 40C. 167

PAGE 168

168 Heater 4A & 4B 2A & 2B 6A & 6B 9A & 9B 3A & 3B 1A & 1B 5A & 5B 7A & 7B 8A & 8B 12A & 12B 11A & 11B 10A & 10B 14A &14B 21A & 21B 13A & 13B 17A & 17B 16A & 16B 18A & 18B 15A & 15B 19A & 19B 20A & 20B Heater 4A & 4B 2A & 2B 6A & 6B 9A & 9B 3A & 3B 1A & 1B 5A & 5B 7A & 7B 8A & 8B 12A & 12B 11A & 11B 10A & 10B 14A &14B 21A & 21B 13A & 13B 17A & 17B 16A & 16B 18A & 18B 15A & 15B 19A & 19B 20A & 20B Figure 4-10. Locations in meat/maggot mass from which daily temperature readings were taken throughout decomposition while conducting Ma ggot Mass Behavior in Reference to Temperature experiment.

PAGE 169

Figure 4-11. Larvae feeding at the base of the hanging meat mass adjacent to the two inch section of steel pole. Figure 4-12. Post-feeding sarcophagid larvae loca ted on the surface of the chicken and mesh bag after development has been completed. 169

PAGE 170

Table 4-1. Mean daily temperatures (C) reco rded throughout decomposition of hanging chicken meat mass. Days Probe 1 (Ambient) Probe 2 (In meat) Probe 3 (In meat) Probe 4 (In meat) 1 20.22 16.11 16.73 18.44 2 15.91 15.44 15.58 16.59 3 19.12 18.85 18.88 19.39 4 22.31 21.80 21.95 22.54 5 23.83 24.37 24.18 24.67 6 25.23 26.13 26.04 26.67 7 25.70 26.70 26.31 27.20 8 24.19 25.90 25.59 28.48 9 24.64 25.78 25.96 28.41 10 21.11 23.16 23.27 24.71 0 5 10 15 20 25 30 12345678910 DaysTemperature (C) Probe 1 Probe 2 Probe 3 Probe 4 Figure 4-13. Mean daily temperatures recorded for hanging meat mass throughout decomposition. 170

PAGE 171

1A 2A 3A 4A 5A 6A 7A 8A 9A 10A 11A 12A 13A 14A 15A 16A 17A 18A 19A 20A 21A 7 1 2 0 7 7 1 4 0 7 7 1 7 0 7 0 5 10 15 20 25 30 35Temperature (C)Temperature Collection SitesD ay s 30-35 25-30 20-25 15-20 10-15 5-10 0-5 Figure 4-14. Surface plot representing the temper ature recorded daily are the 42 data sites for the maggot mass behavior control experiment. 171

PAGE 172

172 Zone Zone Zone Zone Zone Zone Zone Zone Zone Heat er 4A & 4B 2A & 2B 6A & 6B 9A & 9B 3A & 3B 1A & 1B 5A & 5B 7A & 7B 8A & 8B 12A & 12B 11A & 11B 10A & 10B 14A &14B 21A & 21B 13A & 13B 17A & 17B 16A & 16B 18A & 18B 15A & 15B 19A & 19B 20A & 20B Figure 4-15. The nine zones used to asso ciate larval maggot masses movement throughout development amongst the decaying chicken in association with the single element heater and 21 points at whic h temperature was collected.

PAGE 173

7-12-2007 7-13-2007 7-14-2007 7-15-2007 7-16-2007 Zone 9 Zone 8 Zone 7 Zone 6 Zone 5 Zone 4 X X X X X Zone 3 X X X X X Zone 2 X X X X X Zone 1 7-17-2007 7-16-2007 7-14-2007 7-13-2007 7-12-2007 Control Figure 4-16. Maggot mass orientation within decaying chicken throughout development in the control experiment; the colored regions i ndicate actually location of larvae. Table 4-2. Developmental time (days) for Chrysomya rufifacies larvae reared within laboratory maggot mass experiment at va rying heater temperatures. Temperature Stage Controla 40C 45C 50C 55C 60C 65C Stage Controla 40C 45C 50C 55C 60C 65C Eggs 1 1 1 1 1 1 1 Eggs 1 1 1 1 1 1 1 1st Instar 2 2 2 2 2 2 2 2nd Instar 3-4 3-4 2-3 3 3 2-3 3 3rd Instar 4-7 4-7 3-5 3-6 4-6 3-6 4-5 Wandering 8-9 8 5-6 7-8 7-8 7 6 Pupation 10 9 7 8 8 8 7 aControl experiment was conducted within a 10 gallon aquarium without an element heater within the rearing chamber at 28C ambient temperature. 173

PAGE 174

Z o n e 9 Z o n e 8 Z o n e 7 Z o n e 6 Z o n e 5 Z o n e 4 Z o n e 3 Z o n e 2 X X X X X X X Z o n e 1 7-12-2007 7-11-2007 7-10-2007 7-09-2007 7-08-2007 7-07-2007 7-06-2007 40C 7-06-2007 7-07-2007 7-09-2007 7-08-2007 7-10-2007 7-11-2007 7-12-2007 Figure 4-17. Daily diagrams showing maggot mass development occurred in Zone 1 (directly above the single element heater) th roughout development at 40C. 1A 2A 3A 4A 5A 6A 7A 8A 9A 10A 11A 12A 13A 14A 15A 16A 17A 18A 19A 20A 21A 7 6 0 7 7 8 0 7 7 1 0 0 7 7 1 2 0 7 0 5 10 15 20 25 30 35 40Temperature (C)Points of Temperature Measurements Days 35-40 30-35 25-30 20-25 15-20 10-15 5-10 0-5 Figure 4-18. Surface plot representing temperature measurements taking throughout development for maggot mass behavior 40C experiment. 174

PAGE 175

1A 2A 3A 4A 5A 6A 7A 8A 9A 10A 11A 12B 13B 15A 16B 17B 19A 21A 7 1 2 0 7 7 1 3 0 7 7 1 4 0 7 0 5 10 15 20 25 30 35 40 45 50Temperature (C)Points of Temperature MeasurementsD a y s 45-50 40-45 35-40 30-35 25-30 20-25 15-20 10-15 5-10 0-5 Figure 4-19. Surface plot graph of daily temperature readings taken throughout larval development for the maggot mass behavior 45C experiment. 7-12-2007 7-13-2007 7-14-2007 Zone 9 Zone 8 X Zone 7 Zone 6 Zone 5 Zone 4 X X Zone 3 Zone 2 X X X Zone 1 7-14-2007 7-13-2007 7-12-2007 45C Figure 4-20. Location of the maggot mass while de veloping in decaying chicken with the single element heater set at 45C. 175

PAGE 176

1A 2A 3A 4A 5A 6A 7A 8A 9A 10A 11A 12A 13A 14A 15A 17A 18A 20A 21B 7 1 9 0 7 7 2 1 0 7 7 2 3 0 7 0 5 10 15 20 25 30 35 40 45 50 55 60Temperature (C)Points of Temperature MeasurementsD a y s 55-60 50-55 45-50 40-45 35-40 30-35 25-30 20-25 15-20 10-15 5-10 0-5 Figure 4-21. Daily temperature measurements recorded throughout the maggot mass behavior 50C experiment. 7-19-2007 7-20-2007 7-24-2007 7-23-2007 7-22-2007 7-21-2007 Zone 9 Zone 8 Zone 7 Zone 6 X X Zone 5 X X X Zone 4 X X Zone 3 X Zone 2 X X Zone 1 7-24-2007 7-23-2007 7-22-2007 7-21-2007 7-20-2007 7-19-2007 50C Figure 4-22. Movement of the maggot mass while the single element heater is set at 50C. 176

PAGE 177

1A 2A 3A 4A 5A 6A 7A 8A 9A 10A 11B 12B 13B 14B 15B 17A 18A 19B 20B 21B 7 2 6 -0 7 7 -2 8 -0 7 7 3 0 0 7 0 5 10 15 20 25 30 35 40 45 50 55 60 65Temperature (C)Points of Temperature MeasurementsD a y s 60-65 55-60 50-55 45-50 40-45 35-40 30-35 25-30 20-25 15-20 10-15 5-10 0-5 Figure 4-23. Surface plot graph of daily temperature readings throughout the maggot mass behavior 55C experiment. 7-26-2007 7-30-2007 7-29-2007 7-28-2007 7-27-2007 X X Zone 9 Zone 8 Zone 7 X X Zone 6 Zone 5 Zone 4 Zone 3 X X X X Zone 2 X X X Zone 1 7-30-2007 7-29-2007 7-28-2007 7-27-2007 7-26-2007 55C Figure 4-24. The various locations of the maggot mass as the larvae develop at 55C. 177

PAGE 178

7-31-2007 8-04-2007 8-03-2007 8-02-2007 8-01-2007 Zone 9 X X Zone 8 X Zone 7 X Zone 6 X Zone 5 X X Zone 4 X X X Zone 3 X X X Zone 2 X X X Zone 1 8-04-2007 8-03-2007 8-02-2007 8-01-2007 7-31-2007 60C Figure 4-25. Maggot mass movement in regards to the single element heater set at 60C. 1A 2B 4A 5B 7A 8B 10A 11B 13A 14B 16A 18A 20A 21B 7 3 1 0 7 8 2 0 7 8 4 0 7 0 5 10 15 20 25 30 35 40 45 50 55 60 65Temperature (C)Points of Temperature MeasurementsD a y s 60-65 55-60 50-55 45-50 40-45 35-40 30-35 25-30 20-25 15-20 10-15 5-10 0-5 Figure 4-26. Surface plot representing temperature measurements taking throughout development for maggot mass behavior 60C experiment. 178

PAGE 179

8-05-2007 8-08-2007 8-07-2007 8-06-2007 X X Zone 9 Zone 8 X X X X Zone 7 X X Zone 6 X X Zone 5 X Z o n e 4 X X Zone 3 X Zone 2 X Zone 1 8-08-2007 8-07-2007 8-06-2007 8-05-2007 65C Figure 4-27. Orientation of the developing magg ot mass within decaying chicken in regards to 65C. 1A 2A 3A 4A 5A 6A 7A 8A 9A 10A 11A 12A 13A 14A 15A 16A 17A 18A 19B 20B 21B 8 5 0 7 8 6 0 7 8 7 0 7 8 8 0 7 0 5 10 15 20 25 30 35 40 45 50 55 60 65 70 75Temperature (C)Points of Temperature Measurements Days 70-75 65-70 60-65 55-60 50-55 45-50 40-45 35-40 30-35 25-30 20-25 15-20 10-15 5-10 0-5 Figure 4-28. Daily temperature measurements recorded throughout the maggot mass behavior 65C experiment. 179

PAGE 180

180 0 2 4 6 8 10 12egg 1st 2nd 3rd wandering pupa egg 1st 2nd 3rd wandering pupa egg 1st 2nd 3rd wandering pupa egg 1st 2nd 3rd wandering pupa egg 1st 2nd 3rd wandering pupa egg 1st 2nd 3rd wandering pupa egg 1st 2nd 3rd wandering pupa Control40C45C50C55C60C65C ExperimentsDays Figure 4-29. Overall look at growth rate s among larvae developi ng within maggot mass experiment at Control, 40C, 45 C, 50C, 55C, 60C, and 65C.

PAGE 181

Table 4-3. Evaluation of temperature data recorded throughout maggot mass behavior experiments conducted at 40C, 45C, 50C, 55C, 60C, 65C and control. Control 40C 45C 50C 55C 60C 65C Day 1 Day 1 Day 1 Day 1 Day 1 Day 1 Day 1 Minimuma 26.2 26.6 27.5 25.2 24.7 26.3 26.2 Maximumb 28.7 33.9 45.1 50.4 51.4 64.0 66.5 Averagec 27.8 30.0 28.4 31.2 33.5 32.7 Maggot Massd 29.2 Day 2 Day 2 Day 2 Day 2 Day 2 Day 2 Day 2 Minimuma 22.3 22.1 25.0 28.8 27.3 26.5 29.5 Maximumb 24.1 34.8 38.8 48.7 61.2 61.8 73.0 Averagec 23.8 32.1 35.3 38.7 36.7 39.8 38.8 Maggot Massd 23.8 37.9 37.0 36.8 37.5 35.0 Day 3 Day 3 Day 3 Day 3 Day 3 Day 3 Day 3 Minimuma 23.5 28.9 26.5 27.2 28.3 26.4 28.8 Maximumb 25.6 35.5 42.3 50.0 57.4 62.0 64.4 Averagec 24.8 32.1 38.6 38.9 36.3 37.3 37.2 Maggot Massd 26.2 38.9 39.6 37.5 37.4 39.6 Day 4 Day 4 Day 4 Day 4 Day 4 Day 4 Day 4 Minimuma 26.3 28.3 26.1 28.5 27.7 28.6 Maximumb 31.1 37.0 57.6 55.5 64.9 65.6 Averagec 28.6 32.5 37.5 34.0 36.9 37.9 Maggot Massd 29.0 32.2 36.0 37.3 Day 5 Day 5 Day 5 Day 5 Day 5 Day 5 Day 5 Minimuma 26.4 29.5 28.5 28.3 29.0 Maximumb 30.5 35.4 52.7 55.1 60.2 Averagec 28.4 32.1 39.4 33.4 34.3 Maggot Massd 31.3 Day 6 Day 6 Day 6 Day 6 Day 6 Day 6 Day 6 Minimuma 29.8 27.4 Maximumb 37.2 49.2 Averagec 31.9 36.3 Maggot Massd Day 7 Day 7 Day 7 Day 7 Day 7 Day 7 Day 7 Minimuma 29.5 Maximumb 29.8 Averagec 32.3 Maggot Massd a Represents minimum temperature recorded at time of collection. b Represents maximum temperature recorded at time of collection. c Represents average temperature recorded at the site of developing larvae at time of collection. d Represents temperature of maggot mass present at time of collection. 181

PAGE 182

Figure 4-30. Taken after horizon blue Day-Glo fluorescent powd er has been applied to the maggot mass for the preliminary experiment on maggot mass movement. Figure 4-31. One minute after application of horizon blue Day-Glo fluorescent powder; the horizon blue powder has already expanded to other areas of the mass not originally dusted. 182

PAGE 183

Figure 4-32. After rocket red Day-Glo fluorescen t powder has been applied to the base of the maggot mass larvae have already begun to move about the mass. Figure 4-33. One minute after application of the rocket red powder; notic e the larvae completely coated in pink powder moving across the top of the maggot mass (larvae is circled). 183

PAGE 184

184 Figure 4-34. The rocket red Day-Glo powder s hows distinct paths of movement throughout the maggot mass. Figure 4-35. Maggot mass taken five minutes af ter application of th e rocket red Day-Glo fluorescent powder; several larvae covered in pink powder are now visible on the surface of the maggot mass.

PAGE 185

Figure 4-36. Larva coated in chartreuse ye llow fluorescent pigment placed upon maggot mass; notice the transfer of the powder to the other larvae and the pa th of yellow powder down underneath the mass. Figure 4-37. Two minutes after larva was placed on the maggot mass; many larvae are covered with the powder preventing observation of the original larva. 185

PAGE 186

Figure 4-38. Maggot mass observed three minutes afte r placement of the larv a, the original larva is unrecognizable. Figure 4-39. Another attempt at placing a la rva coated with chartreuse yellow fluorescent pigment amongst the maggot mass. 186

PAGE 187

Figure 4-40. Two minutes after placing larva co ated with chartreuse yellow pigment upon the maggot mass; the entire area is colored ye llow and the larva is no longer visible. Figure 4-41. Chartreuse yellow fluorescent pigment applied to la rvae located above the element heater and rocket red Day-Glo applied to la rvae on the outer edge of maggot mass. 187

PAGE 188

188 Figure 4-42. Ten minutes after the application of chartreuse yellow fluorescent pigment and rocket red Day-Glo powder to the maggot mass, no larvae are visible with yellow powder but a few of the larvae with pink powder are seen above the element heater.

PAGE 189

Figure 4-43. Seventeen minutes after the original application of fl uorescent powders and reapplication of char treuse yellow pigment, a larv a from the rocket red group has moved into the yellow group. Figure 4-44. Hanging Meat Maggot Mass Study, one month after commencement; no larval or adult activity is present and the chicken has become hard and inhabitable for larvae. 189

PAGE 190

Figure 4-45. Larva coated in rocket red Da y-Glo fluorescent powder is placed upon the maggot mass, notice the amount of powder transferred to the other larvae. Figure 4-46. The original larva coated with rocket red powde r is unrecognizable because of powder transfer and moving beneath th e surface of the maggot mass. 190

PAGE 191

191 Figure 4-47. A larva is placed amongst the maggot mass after being coated with orange Day-Glo fluorescent powder. Figure 4-48. The larva coated with orange powde r has traveled straight down into the maggot mass beneath the surface direct observation of its movement.

PAGE 192

CHAPTER 5 IDENTIFICATION OF BEAR DNA SEQUENCES IN CARCASSES AND MAGGOT GUTS Introduction The forensic science field, over the last few years, has begun to utilize DNA extractions from biological material collected from a crime scene. DNA analysis began with saliva, semen, blood, tissue, and hair and fingern ail samples. DNA analysis ha s since extended into extracting DNA from arthropod specimens that are collected from a crime scene (Jobling and Gill 2004, Butler and Levin 1998). Arthropod specimens are now DNA typed for identification to species and the host DNA which shows the last meal of the larvae (Sperling et al. 1994, Azeredo-Espin and Madeira 1996, Roehrdanz and Johnson 1996, Benecke 1998b, Malgorn and Coquoz 1999, Vincent et al. 2000, Lessinger and Azeredo-Espi n 2000, Litjens et al. 2001, Wallman and Adams 2001, Wallman and Donnellan 2001, Wells and Sperling 2001, Wells et al. 2001a, 2001b; Otranto et al. 2003, Ratcliffe et al. 2003, Harvey et al. 2003a, 2003b; Chen et al. 2004, Linville et al. 2001, Zehner et al. 2004, Harvey 2005). DNA typing of larva gut contents has the poten tial to provide more precise post mortem interval (PMI) calculations and lead to the identif ication of a victim. Also, one might in theory be able to collect a random dipt eran larva and DNA type the gut contents to identify the larvas last meal possibly assisting in locating a victim. DNA typing the crop for host DNA is possible because it is not the primary site of digestion. Proteolytic enzymes are not secreted into this area of the foregut allowing the crop to act as a food container. Some enzymes are present in the saliva and incorporated into the crop, allowing some degradation of DNA (Zehner et al. 2004). The objectives of this project were to 1) DNA type the gut contents of Chrysomya rufifacies (Macquart) larvae, 2) use micr osatellite primers to match DNA in the larval gut to the host DNA, and 3) identify exactly which host (bear) was consumed by the larvae based on 192

PAGE 193

sequencing information. It is hypo thesized that larval gut contents will am plify and sequence the hosts DNA. The host in this case is the Florida black bear, Ursus americanus floridanus (Merriam). Methods and Materials Tissue samples were collected from bear ca rcasses obtained by the Florida Fish and Wildlife Conservation Commission (FFWCC) offi cer, Mr. Walter McCown, in Gainesville, Florida. A total of eight bear s over a period of four years were retrieved by Mr. McCown after accidental vehicular death within a two hour radius of Gainesville, Florida. The bears were placed in a semi-wooded location at the FFWCC un it where they could decompose undisturbed. Within three days after death (except for Beat 1) a tissue sample was collected from the inner thigh of one of the back legs of each bear (I ACUC Protocol # E072). The sample was then placed in a small vial and stor ed in a freezer (-4C or -20C) until the DNA extraction could be preformed. Chrysomya rufifacies larvae were collected in the thir d instar from each bear, placed in a small vial and stored in the freezer (-4C or -20C) for DNA extraction. The larvae were thawed prior to dissection. Th e anterior portion of the gut containing the crop was removed. Bear 1, June 2002 T1. The first bear arrived on 3 J une 2002; it was a female bear, approximately 75.6 kg (160 lb), killed the previous night. The first visit to the carcass occurred at 4:45 PM on 3 June 2002 at which time insect collections were begun. A tissue sample from the inner thigh of the bear wa s collected on 8 June 2002. Bear 2, June 2002 T2. A second bear arrived on 12 June 2002; a tissue sample was collected from the inner thigh within 48 hours of death. No information was provided on the cause of death, sex or weight of the bear. Th e bear appeared to be a 158.76 kg (350 lb) female that had been cut open from pelvis to sternum. 193

PAGE 194

Bear 3, August 2002 T3. On 30 August 2002, the third bear, an 88.5 kg (195 lb) female, was placed at the study site. The bear was kill ed at approximately 8:00 AM that morning, and the first visit occurred at 7:10 PM that eveni ng. A tissue sample was obtained from the inner thigh within the first 24 hours of decomposition. Bear 4, November 2002 T4. The fourth bear, which arrived on the morning of 1 November 2002, was a male cub weighing approximat ely 17.2 kg (38 lb). The first visit to the bear occurred at 12:30 PM that af ternoon. Insect collections were done daily and a tissue sample was obtained on 4 November 2002. Bear 5, May 2003 T5. A female, approximately 68.04 kg (150 lb), was hit accidentally by a car at night on State Road 46. On 13 May 2003, the bear was placed at the study location around 2:00 PM; the first visit to the bear occurred at 4:36 PM on 13 May 2003. A tissue sample was removed from the inner thigh of the bear at this initial visit. Bear 6, July 2004 T6. The sixth bear for the experiment arrived on 1 July 2004 very late in the evening. It was a 40.82 kg (90 lb) male that was hit on 30 June 2004. The first visit to the bear occurred at 9:00 AM on 2 July 2004. On 3 July 2004 a tissue sample was collected from the inner thigh of the bear carcass. Bear 7, September 2004 T7. Bear seven was a 117.93 kg (260 lb) male that was received at 12:00 PM on 15 September 2004. The bear had been hit by a car the night before. The first visit to the bear ca rcass was made on 16 September 2004 at 1:00 PM. A tissue sample was extracted from the inner thigh of the bear with in 48 hours of its arrival to the study site. Bear 8, August 2005 T8. The final bear was received at 4:20 PM on 1 August 2005. It was a female bear 68.04 kg (150 lb) that had hit by a car during the earl y morning hours. The 194

PAGE 195

first visit to the carcass was made on 1 August 2005 at 6:30 PM. A tissue sample was collected from the inner thigh of the b ear with 48 hours of it arrival. The DNA for identification on each Chrysomya rufifacies third instar larvae anterior gut (Figure 5-1) and its contents was extracted using DNeasy co lumns (Qiagen, Valencia, CA) following the manufacturers tissue protocol. Br iefly, 25 mg of sample was mixed with 180 l of ATL Lysis solution and 20 l Proteinase K, an d incubated at 55C overnight. The sample was then mixed with 10 l RNAse and 200 l AL buffer; then the sample was incubated at 70C for 10 min. After the addition of 200 l 95% ethanol and two washes in the spin columns, the DNA was eluted with 100 l of prewarmed AE buffer (Appendix H). Another method used to extract the larvae gut DNA was DNAzol Reagent (Molecula r Research Center, Inc, Cincinnati, OH) following the manufacturers tissue protocol. A 25 mg sample was triturated in 200 l DNAzol BD and stored at room temperature for 5 min. The sample was then mixed with 20 l Proteinase K and incubated at 70C for 10 min. Next the supe rnatant was mixed with 3 l Polyacryl Carrier mix and washed twice with cold ethanol. Th e DNA was then dissolved in 100 l 1 X TE buffer (Appendix I). The tissue specimens were similarl y processed using the DNeasy tissue protocol from Qiagen and the phenol-chloroform extrac tion method (Appendix J). to prevent any possibility of contamination of crop extracts by the tissue samples, the former were processed after all laboratory analysis of the latter were complete. Each DNA extract was used as template fo r two mitochondria PCR reactions using the Qiagen PCR core kit (Appendix K). A 25 l reaction mixture contai ning 1X buffer, 0.05 mM deoxynucleotide triphosphates (d NTPs), 2.0 mM or 2.5 mM MgCl2, 1.0 l primers of 5 pmol/l, and 0.2 l of Taq polymerase was used. A region of cytochrome oxidase subunit one (COI) was amplified using primers Tonya (GAA GTT TAT ATT TTA ATT TTA CCG GG) and Hobbes 195

PAGE 196

(AAA TGT TGN GGR AAA AAT GTT A) (Monteiro and Pierce 2001), and a region of the cytochrome b gene was amplified using mammalian primers in Ngo and Kramer (2003) (Forward 5 CGAAGCTTGATATGAAA AACCATCGTTG 3; Reverse 5 TGTAGTTRTCWGGGTCHCCTA 3). The thermal cycling conditions for COI consisted of 30 cycles at 94C for 1 min, 48C for 1 min, and 72 C for 1 min, followed by a final elongation at 72C for 5 min. The thermal cycling conditions fo r cytochrome b consisted of 46 cycles at 94C for 30 s, 48C for 30 s, and 72C for 1.5 min, follo wed by a final elongation at 72C for 3 min. Ten l samples of PCR products were analyzed using a 1% agarose gel in Tris Acetate EDTA (Appendix L) and visualized on a UV light box after ethidium bromide staining. PCR product was cleaned using Qiagens PCR Purification Kit (Val encia, CA) (Appendix M). Cycle sequencing was performed with th e forward and reverse mammal primers using Applied Biosystems BigDye Terminator cycle sequencing kit (Appendix N). Sequences were viewed with Sequencher 4.1.2 Accelerated for Power MacIntosh ( 2000, Gene Codes Corporation, Ann Arbor, MI). Tissue DNA extract was also used as template for PCR reactions with microsatellite primers G1A, G1D, G10B, G10C, G10L, G10M, G 10P, and G10X (Paetkau et al. 1998) (Table 5-1). The microsatellite loci were amplified using the Qiagen PCR core kit. A 25 l reaction mix containing 1X buffer, 0.05 mM dNTPs, amount of primers in nM varied for each pair (Table 5-1), 2.0 mM MgCl2, and 0.2 l (5U/L) of Taq polymerase was used. The thermal cycling conditions consisted of 32 cycles at 94C for 1 min, 48C for 1 min, and 72C for 1 min, followed by a final elongation at 72C for 5 mi n. Ten l samples of PCR products were analyzed using a 3% agarose gel in Tris Acet ate EDTA buffer and visu alized on a UV light box after ethidium bromide staining. 196

PAGE 197

Sequence data were obtained fr om the bear tissue samples and Chrysomya rufifacies larval gut contents and quickly compared to the huge co llection of identified, or type, sequences in GenBank accessible using the online BLAST search engine of the National Center for Biotechnology Information ( http://www.ncbi.nlm.nih.gov/BLAST/ ). BLAST 2.0 (Basic Local Alignment Search Tool) provides a way to compare novel sequences with previously characterized genes (Altschul et al. 1990). A match with one speci es represented by a particular sequence (i.e. COI, cytochrome b) in the databa se will reveal the species of the specimen. Results DNA extractions were successful on all eight bear tissue samp les with various extraction methods. Each sample had varying DNA concentr ation yields. Tissue samples three and five yielded a concentration >250 ng of DNA with the phenol/chlorof orm extraction method (Figure 5-2). Tissue samples one, two, four, six, seve n and eight yielded considerably less DNA (<50 ng) with either extraction method used (Figur es 5-2 and 5-3). The DNA concentration amounts obtained from the Chrysomya rufifacies larval gut contents were similar to that of the latter tissue samples, with <50 ng of DNA per most samples (Figure 5-4). A fragment of COI was successfully amplified from 16 of 34 larval anterior gut contents and sequences were obtained from the primers. The COI primer failed to amplify DNA from the bear tissue sample. The consensus sequence for the Chrysomya rufifacies larvae was matched in GenBank to that of Ch. rufifacies (accession number AY842624) at 98% identity match, (Figures 5-5 and 5-6). A fragment of COI was successfully amplified from seven of the eight bear tissue samples. The DNA sequence of the amplicons yielded a consensus sequence corresponding in GenBank to that of Ursus americanus (accession number AF303109) at 96% identity match (Figures 5-7 and 5-8). 197

PAGE 198

A fragment of cytochrome b gene was successfully amplified from seven of the eight bear tissue samples. The cytochrome b gene was succe ssfully amplified from 19 of 34 larval anterior gut contents with the mammalian primer. As ex pected, the mammalian primers failed to amplify DNA from the reference Ch. rufifacies larval cuticle (Figure 5-9, lane 18). The PCR product was 550 base-pairs (bp) in a 1% agarose gel (F igure 5-9). The sequen ced PCR product returned useful data, but it did not include the whole cyto chrome b gene sequence because of the primer used. The primer sequence was not visible in the bear cytochrome b DNA sequence. The consensus sequence was 433 bases that matched in GenBank to Ursus americanus (accession numbers AF268262, AF268260, AF268258, AF268261, AF268259) at an identity percentage of 98% with cytochrome b gene for bear tissue DNA ex tracts (Figures 5-10 and 5-11). A consensus sequence from dipteran larvae gut contents matched in GenBank to U. americanus (accession number AF268262) at an identity percentage of 97% (Figures 5-12 and 5-13). It is clear that larvae anterior gut contents, the crop in pa rticular, can be a suitable source of DNA for identification of both the insect and its host to species. The eight bear tissue samples were typed at eigh t microsatellite loci. Primer set G10B was ineffective in yielding amplification from all samples. Tissue samples T3 and T5 yielded amplicons with the seven other microsatellite primers. The remaining six samples did not amplify with the seven microsatellite primers. Chrysomya rufifacies larval gut contents from bear T3 and bear T5 did not amplify with the seven microsatellite primers. DNA extracts from the larvae anterior gut contents were not suitable for individual identification of black bears by amplification of mi crosatellite DNA. Discussion To further investigate the uses of DNA fr om within the gut co ntents of a maggot, I conducted research with tissue samples from eight different bear carca sses and the larvae that 198

PAGE 199

had developed on the carcasses. My study was de signed to show whether specific host identity was possible with DNA typing of the maggot gut c ontents. Several months of research and experiments were dedicated to using individual specific bear microsatellite primers. Reasons as to why two of the bear tissue sa mples yielded results and the other six did not are unknown. Collection and preservation techni ques were preformed the same throughout the three years. Because of inefficient microsatelli te amplification of the nuclear DNA (at the loci G1A, G1D, G10B, G10C, G10L, G10M, G10P, and G10X) from the bear tissue samples, most larvae were not tested with the microsatellite pr imers. Some of the larvae collected from bear three were tested but did not yield amplification. Alternative methods were therefore, conducted using mtDNA cytochrome b gene of the tissue sa mples and larval gut contents as described above. DNA extraction methods were varied (Q iagen DNeasy tissue extraction, phenolchloroform, DNAzol BD) throughout the experiment to find the most efficient method for the tissue and larval samples. Very little DNA was extracted from tissu e samples of Bear 1, Bear 2, Bear 4, Bear 6, Bear 7, and Bear 8. The DNA c oncentration was very low for the larval gut contents of all larvae as well. Low DNA c oncentrations can prev ent the detection and amplification of nuclear DNA. Nuclear DNA has fewer copies within an organism making it harder to detect at lower concentrations and when degradation has occurred. The low DNA concentration yields from the T1, T2, T4, T6, T7, T8 and the larval gut contents proved noteworthy to the lack of nuc lear DNA amplification with the microsatellite primers. Mitochondrial DNA was still pres ent in the DNA extrac tions and provided amplification. Mitochondrial DNA has been found to be typically easier to achieve and amplify small quantities of DNA (0.06 ng/L) (Linville et al. 2004). Results from Linville et al. (2004) 199

PAGE 200

indicate samples preservation is a major factor in recovering ample amounts of DNA from the gut contents of a maggot. The la rvae collected from the bear ca rcasses were all preserved the same and as third instars, but some were collected later in developmen t. It is unclear at this time why some DNA from larvae gut contents was amp lifiable and others were not; this was also observed to occur in the experi ment of Zehner et al. (2004). Tissue samples three and five confirm th e necessity for high DNA concentration for microsatellite amplification. Tissue degradation is an issue of concern when amplifying nuclear DNA. The bear tissue samples used for this project did not yield profiles with the microsatellite primers except for tissue samples from bears thr ee and five. The subseque nt larvae did not yield any genotype data with the micros atellite primers, making host specific identification impossible. Zehner et al. (2004) obtained ma tches between gut contents a nd the corresponding corpse with STR typing. Individual identification between corpse and larvae was accomplished by Zehner et al. (2004) but some larvae did not yield a product with the microsatellit es or HVR region of mtDNA. Research conducted by Zehner and others re gard degraded DNA or too low amounts of target molecules as the reason microsatellite re gions were not amplified (Zehner et al. 2004). The same thing is possible for the DNA samples used in my experiment. It is clear by the results that mtDNA was present and amplifiable and ca pable of surviving degradation. Nuclear DNA could not be detected for loci G1A, G1D, G10B, G10C, G10L, G10M, G10P, and G10X by PCR amplification for six of the eight bear sample s and was not amplified from the larval gut contents. Samples were too degraded for nuc lear DNA amplification but fresh samples would provide amplification (personal communication Dr. Paetkau). In reference to Linville et al. (2004), samples stored at 4C for 6 months or longer exhibited poor results when analyzing the 200

PAGE 201

DNA, dropping the recovery to less than half. As stated in the liter ature review, human mtDNA is a useful tool for forensic investigators when nuclear DNA is too degraded (Butler and Levin 1998). Nuclear DNA was amplified with the micros atellite primers developed by Paetkau and Strobeck (1994) and Paetkau et al (1995). Previous researchers have used various samples for DNA extractions including hair snares with follicle from live specimens (Dixon et al. 2006). Collections were made from drug-immobilized br own bears of muscle, skin disks from ear punches, blood or hair samples (Paetkau et al 1998). Blood, tissue skin disks and bone disks were used for polar bear samples; the bone samples yielded insufficient DNA to produce complete genotypes (Paetkau et al. 1999). In South America, bear DNA was extracted from blood preserved in EDTA, hairs with roots, bones, teeth and pieces of skin from wild and killed animals (Ruiz-Garcia 2003). DNA collected fr om blood or tissue samples between 1986 and 1993 was obtained by various methods including whole blood preserved in EDTA, along with collecting blood clots and skin di sks from ear tagging (Paetkau and Strobeck 1994, Paetkau et al. 1995). All samples mentioned above yielded amp lification with the mi crosatellite primers except for the bone samples from polar bears. Sa mples were collected from live or fresh killed bears as opposed to my study in which tissue sa mples were collected w ithin 72 h after death (except for Bear 1). For my study, samples were collected from the inner thigh muscle. Tissue samples collected by other researchers were fr om ear punches which has a different muscle composition than the inner thigh muscle. The DNA extracts from seven bears and 19 larv al gut contents generated PCR amplicons with the mammalian primer around 550 bp. Some of the DNA samples isolated from larvae cut contents did not amplify with the mammalian primers; this is possibly because of the 201

PAGE 202

preservation techniques that we re used not being suitable for long term storage. The consensus sequence for the bear tissue and the larvae was ed ited to 433 bases before matching in GenBank. The primer sequences could not be found within the DNA sequences. The mammalian primer is designed to amplify mammal DNA from the cyto chrome b gene (Ngo and Kramer 2003). The primer binding location revealed that bear DNA has two possible locations for binding with the forward and reverse primers, leading to a 550 bp PCR amplif ication instead of the 772 bp suggested by the developers of the mammal primer. This could be because of the length that was read by the DNA sequencer. The mammal primer was successful at DNA typing gut contents with a maggot but did not always provide a fu ll sequence of the cytochrome b gene. A bear specific primer for the cytochrome b gene coul d have displayed a bett er sequence but would have prevented the detection of a host other than bear. The crop of Chrysomya rufifacies has been reported to gradually empty, limiting the amount of host DNA within (Greenberg 1991). Collection times and preservation techniques have been shown to affect DNA degradation or the efficiency of DNA extrac tions (Linville et al. 2004, Zehner et al. 2004). In my study, collectio n time appears to be the reason for poor DNA extractions of the gut contents and tissue samples. The two samples (T3 and T5) that yielded the highest concentration of DNA and we re amplified with the microsat ellite markers were collected within the first 24 h after death. Samples from the other bears were collected 5 d post mortem for T1, 2 d post mortem for T2, 3 d post mortem for T4, 2 d post mortem for T6, 3 d post mortem for T7 and 2 d post mortem for T8. All samp les were preserved according to laboratory protocols and were rarely handled until DNA extractions were preformed. The putrefied state of the bear tissue and late instar stage of so me of the larvae may ha ve contributed to poor concentrations of DNA from the extractions. 202

PAGE 203

203 More research is necessary to observe the ti me constraints maggot gut contents have for providing efficient DNA extractions for the host. Collecting younger larvae as opposed to postfeeding larvae could provide higher levels of DNA concentrations. Bear muscle tissue varies from that of humans, possibly leading to faster breakdown and degradation to the DNA molecules within and making them unsuitable fo r DNA research after deat h. Previous studies have shown positive results from within the ma ggot gut and human tissue samples for nuclear and mitochondrial DNA typing (Z ehner et al. 2004).

PAGE 204

Figure 5-1. Digestive tract of th ird instar larva at peak of feeding. Note engorged crop and midgut with contents extruded within the pe ritrophic membrane. (Source: Greenberg, B., and J. C. Kunich. 2002. Entomology and Law: Flies as Forensic Indicators Cambridge University Press, Cambridge, UK). 204

PAGE 205

Table 5-1. PCR microsatellite prim ers used with bear tissue DNA temp lates to distinguish identity. Locus 5 primer 3 primer primer concentration (nM) G1A ACCCTGCATACTCTCCTCTGATG GCACTGTCCTTGCGTAGAAGTGAC 227 GID ACAGATCTGTGGGT TTATAGGTTACA CTACTCTTCCTACTCTTTAAGAG 320 G10B GCCTTTTAATGTTC TGTTGAATTTG GACAAATCA CAGAAACCTCCATCC 240 G10C AAAGCAGAAGGCCTTGATTTCCTG GGGGACATAAACACCGAGACAGC 160 G10L GTACTGATTTAATTCACATTTCCC GAAGATACAGAAAC CTACCCATGC 227 G10M TTCCCCTCATCGTAGGTTGTA AATAATTTAAGTGCATCCCAGG 320 G10P ATCATAGTTTTACAT AGGAGGAAGAAA TCATGTG GGGAAATACTCTGAA 207 G10X CCACCTTCTTCCAATTCTC TCAGTTATCTGTGAAATCAAAA 160 205

PAGE 206

Figure 5-2. DNA extraction of tissue samples T2, T 3, T4, T5, T6, T7, T8 with phenol/chloroform method, run in a 1% agarose gel. Note th e high concentrations of DNA present in wells 3 and 5 from corresponding samples T3 and T5. 1 Kb T2 T3 T4 T5 T6 T7 T8 1 Kb T1 T2 T4 T6 T7 T8 Larva Gut Figure 5-3. DNA extraction of tissue samples T1, T2, T4, T6, T7, T8, and larva with Qiagen DNeasy columns. DNA concentration levels are low. 206

PAGE 207

207 1 Kb L1T3 L2T3 L1T5 L2T5 L1T7 L2T7 Figure 5-4. DNA extractions of six different larval gut contents with Qiagen DNeasy columns run in a 1% agarose gel. CTCTATCTTAGTCAGAAAAAGGAAAAAAGGAAACCTTTGGATCTTTAGGAATAATTTATGCAATATTAGCTATTGGA TTATTAGGATTTATTGTATGAGCTCATCATATATTCACTGTAGGAATGGATGTAGATACTCGAGCATATTTCACTTC AGCTACAATAATTATTGCTGTACCAACTGGAATTAAAATTTTTAGTTGATTAGCAACTCTTTATGGAACTCAATTAA ATTATTCTCCAGCTACTTTATGAGCCTTAGGATTTGTATTCTTATTTACTGTAGGAGGATTAACTGGAGTAGTTTTA GCTAATTCATCTATTGATATTATTTTACATGACACATACTATGTAGTAGCTCACTTCCATTATGTTCTTTCAATAGG AGCTGTATTTGCTATTATAGCAGGATTTGTACATTGATTCCCATTATTTACTGGATTAACCTTAAATAATAAAATAC TAAAAAGTCAATTTGCTATTATATTTATTGGAGTAAATTTAACATTTTTCCCMCAACATTTA Figure 5-5. The mitochondrial DNA sequence of the cytochrome oxida se subunit one (COI) gene, from the gut contents of Chrysomya rufifacies larvae.

PAGE 208

Larva 1 CTC-TATC-TTAGTC-AG aaaaaggaaaaaaggaaa CCTTTGGATCTTTAGGAATAATTT 57 ||| |||| |||||| |||| |||||||||||||||||||||||||||||||||||||| Sbjct 41 CTCATATCATTAGTCAAGAATCAGGAAAAAAGGAAACCTTTGGATCTTTAGGAATAATTT 100 Larva 58 ATGCAATATTAGCTATTGGATTATTAGGATTTATTGTATGAGCTCATCATATATTCACTG 117 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 101 ATGCAATATTAGCTATTGGATTATTAGGATTTATTGTATGAGCTCATCATATATTCACTG 160 Larva 118 TAGGAATGGATGTAGATACTCGAGCATATTTCACTTCAGCTACAATAATTATTGCTGTAC 177 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 161 TAGGAATGGATGTAGATACTCGAGCATATTTCACTTCAGCTACAATAATTATTGCTGTAC 220 Larva 178 CAACTGGAATTAAAATTTTTAGTTGATTAGCAACTCTTTATGGAACTCAATTAAATTATT 237 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 221 CAACTGGAATTAAAATTTTTAGTTGATTAGCAACTCTTTATGGAACTCAATTAAATTATT 280 Larva 238 CTCCAGCTACTTTATGAGCCTTAGGATTTGTATTCTTATTTACTGTAGGAGGATTAACTG 297 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 281 CTCCAGCTACTTTATGAGCCTTAGGATTTGTATTCTTATTTACTGTAGGAGGATTAACTG 340 Larva 298 GAGTAGTTTTAGCTAATTCATCTATTGATATTATTTTACATGACACATACTATGTAGTAG 357 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 341 GAGTAGTTTTAGCTAATTCATCTATTGATATTATTTTACATGACACATACTATGTAGTAG 400 Larva 358 CTCACTTCCATTATGTTCTTTCAATAGGAGCTGTATTTGCTATTATAGCAGGATTTGTAC 417 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 401 CTCACTTCCATTATGTTCTTTCAATAGGAGCTGTATTTGCTATTATAGCAGGATTTGTAC 460 Larva 418 ATTGATTCCCATTATTTACTGGATTAACCTTAAATAATAAAATACTAAAAAGTCAATTTG 477 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 461 ATTGATTCCCATTATTTACTGGATTAACCTTAAATAATAAAATACTAAAAAGTCAATTTG 520 Larva 478 CTATTATATTTATTGGAGTAAATTTAACATTTTTCCCMCAACATTT 523 ||||||||||||||||||||||||||||||| ||||| |||||||| Sbjct 521 CTATTATATTTATTGGAGTAAATTTAACATTCTTCCCTCAACATTT 566 Figure 5-6. The nucleotide identity between GenBank Chrysomya rufifacies COI sequence (accession number AY842624) matched in BLAST with the mtDNA sequence of gene COI from the gut of Chrysomya rufifacies larvae. GAAAAAAAGAGCCTTTTGGCTATATGGGAATAGWCTGAGCGATAATGTCTATTGGATTCTTAGGATTCATTGTGTGA GCTCACCATATGTTTACCGTAGGTATAGATGTCGACACACGAGCTTACTTCACTTCAGCCACCATAATTATTGCAAT CCCAACAGGGGTTAAAGTATTTAGCTGATTAGCCACTCTGCACGGGGGGAATATTAAATGATCTCCCGCTATAATAT GAGCCCTAGGCTTTATTTTCCTGTTTACAGTGGGAGGCCTTACAGGAATTGTCCTAGCTAATTCATCTCTAGACATT GTTCTTCATGATACATACTATGTGGTAGCTCATTTCCACTATGTGTTATCAATGGGGGCTGTCTTTGCCATTATAGG GGGATTTGTGCATTGATTCCCACTGTTTTCAGGCTATACACTTAATAATACATGAGCAAAAATTCACTTCATAATTA TGTTCGTTGGGGTCAATATAACATTTTTCCCCCAACATTTA Figure 5-7. The mitochondrial DNA sequence of the cytochrome oxida se subunit one (COI) gene from the tissues samples of Ursus americanus floridanus 208

PAGE 209

Bears 1 G aaaaaaa GAGCCTTTTGGCTATATGGGAATAGWCTGAGCGATAATGTCTATTGGATTCT 60 |||||||||||||||| |||||||| ||||||| |||||||||||||||||||||||||| Sbjct 7078 GAAAAAAAGAGCCTTTCGGCTATATAGGAATAGTCTGAGCGATAATGTCTATTGGATTCT 7137 Bears 61 TAGGATTCATTGTGTGAGCTCACCATATGTTTACCGTAGGTATAGATGTCGACACACGAG 120 ||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 7138 TAGGATTTATCGTGTGAGCTCACCATATGTTTACCGTAGGTATAGATGTCGACACACGAG 7197 Bears 121 CTTACTTCACTTCAGCCACCATAATTATTGCAATCCCAACAGGGGTTAAAGTATTTAGCT 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 7198 CTTACTTCACTTCAGCCACCATAATTATTGCAATCCCAACAGGGGTTAAAGTATTTAGCT 7257 Bears 181 GATTAGCCACTCTGCACGGGGGGAATATTAAATGATCTCCCGCTATAATATGAGCCCTAG 240 |||||||||| || ||||| |||||||||||||||||||||||||||||||||||||||| Sbjct 7258 GATTAGCCACCCTACACGGAGGGAATATTAAATGATCTCCCGCTATAATATGAGCCCTAG 7317 Bears 241 GCTTTATTTTCCTGTTTACAGTGGGAGGCCTTACAGGAATTGTCCTAGCTAATTCATCTC 300 ||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||| Sbjct 7318 GCTTTATTTTCCTGTTTACAGTGGGGGGCCTTACAGGAATTGTCCTAGCTAACTCATCTC 7377 Bears 301 TAGACATTGTTCTTCATGATACATACTATGTGGTAGCTCATTTCCACTATGTGTTATCAA 360 |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 7378 TAGATATTGTTCTTCATGATACATACTATGTGGTAGCTCATTTCCACTATGTGTTATCAA 7437 Bears 361 TGGGGGCTGTCTTTGCCATTATAGGGGGATTTGTGCATTGATTCCCACTGTTTTCAGGCT 420 |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| Sbjct 7438 TGGGGGCTGTCTTTGCCATTATGGGGGGATTTGTGCATTGATTCCCACTGTTTTCAGGCT 7497 Bears 421 ATACACTTAATAATACATGAGCAAAAATTCACTTCATAATTATGTTCGTTGGGGTCAATA 480 |||| ||||||||||||||||||||||||||||||||||| |||||||| ||||| |||| Sbjct 7498 ATACGCTTAATAATACATGAGCAAAAATTCACTTCATAATCATGTTCGTAGGGGTTAATA 7557 Bears 481 TAACATT-TTTCCCCCAACATTT 502 | ||||| ||||||| | ||||| Sbjct 7558 TGACATTCTTTCCCC-AGCATTT 7579 Figure 5-8. The nucleotide identity between GenBank Ursus americanus COI sequence (accession number AF303109) matched in BLAST with the mtDNA sequence of gene COI from the tissue samples of Ursus americanus floridanus. 209

PAGE 210

Lane 1 1 Kb ladder Lane 2 L3T1 Lane 3 T2 Lane 4 L2T2 Lane 5 T3 Lane 6 T3 Lane 7 L1 T3 Lane 8 T4 Lane 9 L2 T4 Lane 10 T5 Lane 11L3T5 Lane 12 T6 Lane 13 L3T6 Lane 14 T7 Lane 15 T8 Lane 16 L3T8 Lane 17 Larvae gut fed on pig Lane 18 Larvae cuticle Lane 19 Blank Lane 20 100 bp ladder Figure 5-9. PCR amplification using mammalian primers for cytochrome b gene on DNA from bear tissue samples and larvae fed upon bear tissue samples. T1, T2, T3, T4, T5, T6, T7 and T8 represent the eight different bear tissue samples, while L indicates a larva that has fed upon a particular sample. CTAGTCCTAGCAGCTCTAGTCCTATTCTCGCCTGACCTACTAGGAGACCCCGACAACTACACCC CCGCAAACCCACTGAGCACTCCACCCCACATCAAACCTGAGTGATATTTTCTATTTGCCTACGC TATCCTACGGTCCATCCCCAACAAACTAGGAGGAGTACTAGCACTAATTTTCTCCATCCTAATC CTAGCTATTATCCCCCTTCTACACACATCCAAACAACGAGGAATAATGTTCCGACCCCTAAGCC AATGCCTATTCTGACTCCTAGCAGCAGACCTACTAACACTAACATGAATCGGAGGACAACCAGT AGAACACCCCTTTATCATTATCGGACAGCTGGCCTCTGTCCTCTACTTCACAATCCTCCTAGTG CTCATGCCCATCGCTGGGATCATTGAAAATAACCTCTCAAAATGAAGAG Figure 5-10. The mitochondrial DNA sequence of a portion of the cytochrome b gene, from the tissue samples of Ursus americanus floridanus 210

PAGE 211

Bears 1 CTAGTCCTAGCAGCTCTAGTCCTATTCTCGCCTGACCTACTAGGAGACCCCGACAACTAC 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 709 CTAGTCCTAGCAGCTCTAGTCCTATTCTCGCCTGACCTACTAGGAGACCCCGACAACTAC 768 Bears 61 ACCCCCGCAAACCCACTGAGCACTCCACCCCACATCAAACCTGAGTGATATTTTCTATTT 120 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 769 ATCCCCGCAAACCCACTGAGCACTCCACCCCACATCAAACCTGAGTGATATTTTCTATTT 828 Bears 121 GCCTACGCTATCCTACGGTCCATCCCCAACAAACTAGGAGGAGTACTAGCACTAATTTTC 180 ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| Sbjct 829 GCCTACGCTATCCTACGGTCCATCCCCAACAAACTAGGAGGGGTACTAGCACTAATTTTC 888 Bears 181 TCCATCCTAATCCTAGCTATTATCCCCCTTCTACACACATCCAAACAACGAGGAATAATG 240 || ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Sbjct 889 TCTATCCTAATCCTAGCTATTATCCCCCTTCTACACACATCCAAGCAACGAGGAATAATG 948 Bears 241 TTCCGACCCCTAAGCCAATGCCTATTCTGACTCCTAGCAGCAGACCTACTAACACTAACA 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 949 TTCCGACCCCTAAGCCAATGCCTATTCTGACTCCTAGCAGCAGACCTACTAACACTAACA 1008 Bears 301 TGAATCGGAGGACAACCAGTAGAACACCCCTTTATCATTATCGGACAGCTGGCCTCTGTC 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| Sbjct 1009 TGAATCGGAGGACAACCAGTAGAACACCCCTTTATCATTATCGGACAGCTGGCCTCCGTC 1068 Bears 361 CTCTACTTCACAATCCTCCTAGTGCTCATGCCCATCGCTGGGATCATTGAAAATAACCTC 420 ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| Sbjct 1069 CTCTACTTCACAATCCTCCTAGTGCTCATGCCCATCGCTGGGATCATTGAAAACAACCTC 1128 Bears 421 TCAAAATGAAGA 432 |||||||||||| Sbjct 1129 TCAAAATGAAGA 1140 Figure 5-11. The nucleotide identity between GenBank Ursus americanus cytochrome b (accession number AF268262) matched in BLAST with the mtDNA sequence from the tissue samples of Ursus americanus floridanus GTAGAACACCCCTTTATCATTATCGGACAGCTGCCTCTTCCTTTACTTCACAATCCTCCTAGTGCTCATGCCCATCG CTGGGATCATTAAAATAACCTCTCAAAATAAGATCTTTGTAGTATAGTAATTTCCTTGACTGTGACAAAATCCCGTT CCATCCATACTATACAATCAAAGACGCCCTAGGCGCCCTASAACTCATCCTAGTCCTAGCAGCTCTAGTCCTATTCW CGCCTGACCTACTAGGAGACCCCGACAACTACACCCCCGCAAACCCACTGAGCACTCCACCCCACATCAAACCTGAG TGATATTTTCTATTTGCCTACGCTATCCTACGGTCCATCCCCAACAAACTAGGAGGAGTACTAGCACTAATTTTCTC CATCCTAATCCTAGCTATTATCCCCCTTCTACACACATCCAAACAACGAGGAATAATGTTCCGACCCCTAAGCCAAT GCCTATTCTGACTCCTAGCAGCAGACCTACTAACACTAACATGAATCGGAGGACAACCAGTAGAACACCCCTTTATC ATTATCGGACAGCTGGCCTCTGTCCTCTACTTCACAATCCTCCTAGTGCTCATGCCCATCGCTGGGATCATTGAAAA TAACCTCTCAAAATGAAGAGTCTTTGTAGTATAGTAATTACCTTGGTCTTGTAAACCTAAGATGAAASACCARRAGG TAATTACTATACTACAAAGACTCTTCATTTTGAGAGGTTATTTTAATGATCCAGCGATGGGCATGAGCACTAGGAGG ATTGTGAAGTAGAGGAAGAGGCAGCTGTCCGATAATGATAAAGGGGTGTTCTACTGGTTGTCTCGATTCATGTTAGT GTTAGTAGGTCTGC Figure 5-12. The mitochondrial DNA sequence of th e cytochrome b gene, from the gut contents of Chrysomya rufifacies larvae collected off Ursus americanus floridanus carcasses. 211

PAGE 212

212 Larva 149 TGACTGTGACAAAATCCCGTTCCATCCATACTATACAATCAAAGACGCCCTAGGCGCCCT 208 ||||| ||||||||||| || ||||||||||||||||| |||||||||||||||||||| Sbjct 639 TGACTCAGACAAAATCCCATTTCATCCATACTATACAATTAAAGACGCCCTAGGCGCCCT 698 Larva 209 ASAACTCATCCTAGTCCTAGCAGCTCTAGTCCTATTCWCGCCTGACCTACTAGGAGACCC 268 | ||||||||||||||||||||||||||||||||| |||||||||||||||||||||| Sbjct 699 ACTTCTCATCCTAGTCCTAGCAGCTCTAGTCCTATTCTCGCCTGACCTACTAGGAGACCC 758 Larva 269 CGACAACTACACCCCCGCAAACCCACTGAGCACTCCACCCCACATCAAACCTGAGTGATA 328 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 759 CGACAACTACATCCCCGCAAACCCACTGAGCACTCCACCCCACATCAAACCTGAGTGATA 818 Larva 329 TTTTCTATTTGCCTACGCTATCCTACGGTCCATCCCCAACAAACTAGGAGGAGTACTAGC 388 ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| Sbjct 819 TTTTCTATTTGCCTACGCTATCCTACGGTCCATCCCCAACAAACTAGGAGGGGTACTAGC 878 Larva 389 ACTAATTTTCTCCATCCTAATCCTAGCTATTATCCCCCTTCTACACACATCCAAACAACG 448 |||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||| Sbjct 879 ACTAATTTTCTCTATCCTAATCCTAGCTATTATCCCCCTTCTACACACATCCAAGCAACG 938 Larva 449 AGGAATAATGTTCCGACCCCTAAGCCAATGCCTATTCTGACTCCTAGCAGCAGACCTACT 508 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 939 AGGAATAATGTTCCGACCCCTAAGCCAATGCCTATTCTGACTCCTAGCAGCAGACCTACT 998 Larva 509 AACACTAACATGAATCGGAGGACAACCAGTAGAACACCCCTTTATCATTATCGGACAGCT 568 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 999 AACACTAACATGAATCGGAGGACAACCAGTAGAACACCCCTTTATCATTATCGGACAGCT 1058 Larva 569 GGCCTCTGTCCTCTACTTCACAATCCTCCTAGTGCTCATGCCCATCGCTGGGATCATTGA 628 |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1059 GGCCTCCGTCCTCTACTTCACAATCCTCCTAGTGCTCATGCCCATCGCTGGGATCATTGA 1118 Larva 629 AAATAACCTCTCAAAATGAAGA 650 ||| |||||||||||||||||| Sbjct 1119 AAACAACCTCTCAAAATGAAGA 1140 Larva 730 TCTTCATTTTGAGAGGTTATTTT-AATGAT-CCAGCGATGGGCATGAGCACTAGGAGGAT 787 |||||||||||||||||| |||| |||||| ||||||||||||||||||||||||||||| Sbjct 1140 TCTTCATTTTGAGAGGTTGTTTTCAATGATCCCAGCGATGGGCATGAGCACTAGGAGGAT 1081 Larva 788 TGTGAAGTAGAGGAAG-AGGC-AGCTGTCCGATAATGATAAAGGGGTGTTCTACTGGTTG 845 |||||||||||||| | |||| |||||||||||||||||||||||||||||||||||||| Sbjct 1080 TGTGAAGTAGAGGACGGAGGCCAGCTGTCCGATAATGATAAAGGGGTGTTCTACTGGTTG 1021 Larva 846 TC-TC-GATTCATGTTAGTGTTAGTAGGTCTGC 876 || || ||||||||||||||||||||||||||| Sbjct 1020 TCCTCCGATTCATGTTAGTGTTAGTAGGTCTGC 988 Larva 16 GTAGAACACCCCTTTATCATTATCGGACAGCT-GCCT-CTTCCTTTACTTCACAATCCTC 73 |||||||||||||||||||||||||||||||| |||| | |||| ||||||||||||||| Sbjct 1027 GTAGAACACCCCTTTATCATTATCGGACAGCTGGCCTCCGTCCTCTACTTCACAATCCTC 1086 Larva 74 CTAGTGCTCATGCCCATCGCTGGGATCATT-AAAATAACCTCTCAAAAT-AAGA 125 |||||||||||||||||||||||||||||| |||| ||||||||||||| |||| Sbjct 1087 CTAGTGCTCATGCCCATCGCTGGGATCATTGAAAACAACCTCTCAAAATGAAGA 1140 Figure 5-13. The nucleotide identity between GenBank Ursus americanus cytochrome b gene (accession number AF268262) matched in BLAST with the gut contents of the Chrysomya rufifacies larvae that fed on Ursus americanus floridanus

PAGE 213

CHAPTER 6 SUMMATION OF RESEARCH Developing Chrysomya Blow Fly Colonies Blow flies from the genus Chrysomya are important forensic indicators of time of death calculations (PMI). The genus is found througho ut Australia and Asia, but two species have made their way into the United Stat es. In the state of Florida, Chrysomya rufifacies and Chrysomya megacephala have become dominate species on carrion. The development of laboratory colonies provided insight into growth rates, length of larval stages, adult and larval behavior. Chrysomya megacephala mean growth rates from oviposition to adult emergence with an ambient temperatur e of 28C 24.5 d. Mating occurred 2.6 d after emergence. The first oviposition from the females occurred 4 d after emergence. First instar larvae were present 5.5 d after adult emergence and second instars were encountered 6.6 d after emergence. The third stadium began 10.4 d after emergence. Pupation was observed 16 d after adult emergence. The first instar larval stag e was observed to occur 1 d after oviposition. Two and half days after oviposition, s econd instar larvae were present. The third instar stage began 6.3 d after oviposition and pupation started 12 d after oviposition. Chrysomya megacephala were easy to rear for sequential generati ons but had a lower eclosion rate than Ch. rufifacies. The egg eclosion rate was calculated at 55% while pupae eclosion rate was 37.5% with more males than females emerging. The low eclosion rates observed for Ch. megacephala indicate suboptimal rearing conditions. The growth rate of Chrysomya rufifacies was 22.7 d from oviposition to adult emergence at an ambient temperature of 28C. Mating occurred 3.9 d after emergence with oviposition occurring 6.5 d after emergence. First instar larvae were present 7.6 d after adult emergence, followed by second instars 8.8 d post adult emergence. The third stadium typically occurred 213

PAGE 214

12.2 d and pupation 16.6 d after emergence. Th e larval stages developed quickly after oviposition; first instars were pr esent a day later, second instars 2 d later and third instars 5.7 d after oviposition. The third instar stage lasted an average of 5 d before pupation occurred 10.1 d after oviposition. Rates of egg and pupal eclosion were of 68% and 80%, respectively. The majority of the emerging adults were found to be females. Chrysomya rufifacies larvae have been documented as be ing predacious on other larval species (Williams and Richardson 1984, Goodbr od and Goff 1990, Wells and Greenberg 1992a, 1992b; Byrd and Butler 1997, Butler personal comm unication) and even cannibalistic (Goodbrod and Goff 1990, Wells and Greenberg 1992a, 1992b). Th e laboratory colony I started was able to develop through the larval stages without feeding on larvae of other fly species which was thought to be crucial to Ch. rufifacies larval development. I found, however, that the females that emerged from these none-predatory larvae we re unable to oviposit. An extra protein source of moistened blood meal had to be supplied to the adult females be fore oviposition would occur. This provides insight into the pred acious behavior of the larvae, suggesting that larval predation in the wild supplies extra protein ne eded in the adult stage. It ha s also been observed in the field studies by the author that Ch. rufifacies adults are one of the first sp ecies to arrive to a carcass but wait 24 hr before ovipositing. This may be a ttributed to the adults feeding on the fluids of the carcass to promote egg production which was supplanted for by supplying females with blood meal. Field Studies The influence of maggot mass temperatures on developmental rates of larvae and post mortem interval (PMI) calculations were examin ed. The maggot mass temperatures from within decomposing bear carcasses were recorded and re lated to the current method for determining the post mortem interval. In additi on, unsystematic collections were made of adult and larval forms 214

PAGE 215

of insects to obtain an overview of the forensically important species located in north central Florida. The maggot mass was reported to pr oduce temperatures higher than the recorded ambient temperatures for the majority of the decomposition time. The higher maggot mass temperatures began with the onset of second instar larvae and remained hi gher than ambient until the third instar larvae begin to wander away from the carcass. The maggot mass temperatures appear to have more impact in controlling larval development than the ambient temperature. The maggot masses and insect co llections indicated that Chrysomya rufifacies and Chrysomya megacephala are the two dominant species of blow flies encounter in north central Florida; thus leading to the laboratory colonies. The maggot mass temperatures recorded for Bear 3 July 2004 were generally higher than ambient. The mean temperature of the maggot mass was recorded at 29.91C and the minimum temperature was 21.71C. The maximum temperatur e was recorded at 40.59C with the onset of the third instar larvae stage. It has been observed by the author and others (Cianci and Sheldon 1990, Joy et al. 2002) that a high spike in temper ature occurs within the maggot mass at the beginning of the third instar stage. At this ti me many second instar larv ae are still present as well as early third instar larvae, and their veracious habit may be the reason behind the temperature spike. The maximum maggot mass temperature was 12C higher than the recorded ambient temperature at that time, stressing the importance that maggot mass temperature has on larval development. Other researchers have observed a significant difference between the ambient and maggot mass temperatures (De onier 1940, Cianci and Sheldon 1990, Greenberg 1991, Shean et al. 1993, Joy et al. 2002). Raising th e temperature just 5C in a rearing chamber can increase larval development by a day or two (Byrd and Butler 1996, 1997, 1998). An 215

PAGE 216

increase of 12C is very signifi cant; it could alter developmenta l rates even more and change estimated post mortem intervals (PMI). Maggot mass temperatures for Bear 4 Se ptember 2004 were found to be 20C higher than the recoded ambient temperature. A ma ggot mass temperature 20C higher than ambient would allow for the larvae to continually develo p at their own rate with disregard to the surrounding temperatures. Low ambient temperat ures would have no effect on developmental rates of larvae growing within a maggot mass te mperature. The mean maggot mass temperature recorded was 31.06C, minimal was 18.28C, and the maximum temperature was 49.59C. The maximum temperature is noteworthy in that an in dividual larva is unable to survive at 50C but as a collective group the larvae continue to exist. The maggot mass temperatures thrive in regard to the feeding and movement of the larvae despite ambient temperatures. This provides evid ence that the larvae grow at rates consistent with maggot mass temperatures and not the ambient. The current method for determining the post mortem interval is to corre late the collected larval stage with the ambient temperature and count backwards the number of days necessary at th e temperature to reach the larval stage. With the influence of the maggot mass temperature these calculations could, in fact, be incorrect. An incorrect PMI could be crucial to a case. A total of 18 species of adult insects were unsystematically collected from the decomposing bear carcasses: Chrysomya rufifacies (Macquart), Cochliomyia macellaria (Fabricius), Chrysomya megacephala (Fabricius) Lucilia (=Phaenicia) sericata (Meigen) Lucilia spp., Hermetia illucens (Linnaeus) Synthesiomyia nudiseta (Wulp), Hydrotaea leucostoma, Necrophila Americana (Linnaeus) Nicrophorus orbicollis (Say) Nicrophorus carolinus (Linnaeus), Necrodes surinamensis (Fabricius), Creophilus maxillosus (Linnaeus), 216

PAGE 217

Dermestes ater (De Geer) Dermestes caninus (Germar) Dermestes maculates (De Geer), Trox suberosus (Fabricius) Hister spp., and Saprinus pennsylvanicus (Paykull). In addition to this, several species of Sarcophagid ae and some miscellaneous Diptera were also collected. A total of 9 different species of dipteran la rvae were collected from the bear carcasses throughout the study: Chrysomya rufifacies, Cochliomyia macellaria, Chrysomya megacephala, Lucilia sericata, Lucilia caeruleivi ridis, Phormia regina, Wohlfahrtia spp., Sarcophaga bullata, and Hydrotaea leucostoma. In addition, some larvae from the family Sarcophagidae were collected but could not be identified to species The dipteran larval collections are more important than the adult collections when res earching maggot mass temperatures because the maggot mass temperatures could vary by species The data presented here are from maggot masses consisting entirely of Chrysomya rufifacies larvae. Chrysomya rufifacies arrive 24 hr after the other species of blow flies but the larvae quickly become the dominant species on a carcass. The larvae typically develop in the regi ons of the carcass closest to the ground but as they reach the third instar stage they take over areas of the carcass that were inhabited by other species. As mentioned before, the larvae are predacious; therefore, the larvae will feed on the other species as well as consume the carrion faster and cause the larvae to migrate away from the carcass early. Examining the Maggot Mass The movement, behavior, and function of the maggot mass and the larvae comprising the maggot mass was examined in a laboratory setting. Based on the high maggot mass temperatures discovered in the fiel d studies, I wanted to learn more about the individual larva in terms of heat association and movement. A ma ggot mass was formed within the laboratory and exposed to selected temperatures (40C, 45 C, 50C, 55C, 60C, and 65C) provided by an element heater. Temperature readings were ta ken from the maggot mass and the larval medium 217

PAGE 218

throughout decomposition. The locations of the larvae in the medium and growth rates were noted as well as in relation to the temperature setting of the element heater. In addition, the maggot mass were dusted with fluorescent powder a nd observed with ultravio let (UV) light in an attempt to determine patterns of movement by the larvae and amount of time spent within the high temperatures of the maggot mass. The temperatures recorded for the experiments did not show a distinct pattern between the element heater and the maggot mass or medium temperatures. The 50C and 65C experiments recorded the same maggot mass maximum temperat ure. It appears the larvae are capable of finding the most optimal temperature for developm ent, despite the temperature of the element heater. The average temperature recorded for maggot mass locations were relatively similar for all the experiments ranging from 32C to 39C. As the element heater temperature increased the larvae moved about the medium to locations that had average temperatures favorable for development. The larvae appeared not to enda nger themselves by feeding near the heater at extreme temperatures, but they also did not leav e the food source completely. The larvae also had the ability to feed on the outer-edges of the meat where te mperatures were at or below ambient but choose not to. The growth rates of the larvae were affected by the element heater. The higher temperatures of the element heater provided faster larval development rates. On a control (28C) experiment, pupation occurred 10 d af ter oviposition. This decreased to 9 d when the heater was set at 40C. A total of 8 d were needed for the larvae to develop from egg to pupae at 50C, 55C, and 60C. When the element heater was set at 65C development was completed in 7 d. The experiment conducted at 45C also had a devel opmental time of 7 d. The decreased time is contributed to the large number of larvae develo ping within the maggot ma ss in that experiment; 218

PAGE 219

which can also increase development (Deonier 1940, Lord et al. 1986, Slone and Gruner 2007). Maggot masses observed in the field studies have temperatures above that of the ambient which I believe is necessary for rapid larv al development and food consumption. My study intended to detail the moving acti on of the maggot mass and the larvae that compose the mass but the chosen methodology was not effective. Obse rvation of larval movement under the UV light showed that larvae are in constant motion while in the maggot mass. The larvae exhibited unique characteristic s in their movement. Larval movement is inconsistent and spontaneous. Some of the larvae moved about in a circulate fashion as described by Goff (2002), some larvae moved ab out on surface of the maggot mass and others stayed in the same location for extended periods of time but continued to move as if undulating. The function of the maggot mass is believed to assist in food consumption. The feeding and movement of the larvae causes the increased maggot mass temperatures. It was observed in this study that the larvae on the surface of the maggot mass do not appear to be feeding and are positioned too far away from the food source to f eed. These exterior larvae still remained in constant motion; this has also been observed in the field studies. Possibl y the larvae continued to move to maintain the elevated temperatures. Th e larvae within the center of the mass appeared to be feeding in respect to the fact that they did not move as frequently. Future research and advanced resources are necessary to track a larva throughout a maggot mass and observe the actions of the larvae within the center of the maggot mass. Host DNA Extracted from the Maggot Gut Dipteran larvae are powerhouse feeders. The larvae feed veracious throughout the three stadiums to consume enough food for growth and metamorphosis. Becaus e food travels through the crop of the larvae upon consum ption, the crop can be analyzed to determine host information 219

PAGE 220

(Wells et al. 2001a). DNA evidence from larvae can be matched effortlessly with that of the host because of the continual contact and m ovement of the larvae with a carcass. DNA was extracted from all eight of the bear tissue samples and several of the larval samples. Each DNA extract was used as a te mplate for two mitochondrial DNA PCR reactions: cytochrome oxidase subunit I (C OI) and cytochrome b gene. The COI site was useful for confirming identification of the bear samples as bear and the larval samples as Chrysomya rufifacies COI was not specific enough to identify the bear tissue contained within the maggot gut. Cytochrome b gene has been listed as a useful site for disti nguishing mammal DNA (Ngo and Kramer 2003). The cytochrome b gene was th en analyzed and sequenced for the bear tissue samples and the larval samples. The cytochrome b gene was amplified from materials within the maggot gut and found to match that of bear. This provides a way to DNA-type maggot gut contents back to the host. Because cytochrome b is designed for mammals it can be used with an array of mammalian hosts. The cytochrome b gene cannot be used to match the DNA to the exact host; although it can be used to identify the species of a host, it cannot distinguish between host A and host B if both hosts are of the same species. I attempted to match DNA from the maggot gut to the exact bear it was collected from, because of unforeseen problems, this could not be accomplished. Microsatellite markers of the nuclear DNA were chosen as th e best technique for matching specific individual hosts to th eir DNA (Paetkau personal communica tion). Unfortunately, only two of the bear samples amplified with the microsat ellite markers, and none of the larval samples amplified. It is believed that preservation techniques might have prevented the amplification of nuclear DNA. There are less copies of the nuc lear DNA within an organism making it more difficult to amplify, especially in degraded samples. 220

PAGE 221

221 APPENDIX A DAILY TEMPERATURE READINGS FOR MAGGOT MASS BEHAVIOR STUDY Heater 4A 27.5 4B 27.9 2A 27.3 2B 27.6 6A 26.6 6B 27.5 9A 27.3 9B 27.5 3A 26.9 3B 27.5 1A 27.5 1B 27.8 5A 27.2 5B 27.5 7 27.3 8A 27.1 8B 27.4 12A 26.8 12B 27.7 11 26.8 10A 27.1 10B 27.4 14 27.0 13A 27.2 13B 27.3 17A 27.4 17B 27.9 16 26.2 18 26.7 15 26.3 19 26.8 20 27.2 21A 28.7 21B 28.1 Figure A-1. Temperature readings record ed on July 12, 2007 for control experiment.

PAGE 222

222 Heater 4A 23.5 4B 23.6 2A 23.7 2B 23.8 6A 23.5 6B 23.8 9A 23.1 9B 23.5 3A 23.5 3B 23.6 1A 23.8 1B 23.9 5A 23.3 5B 23.7 7 23.6 8A 23.2 8B 23.5 12A 23.3 12B 23.7 11 23.4 10A 23.4 10B 23.6 14A .6 14B 23.7 13A 23.4 13B 23.7 17A 23.5 17B 24.0 1 18 23.0 15 22.6 19 22.8 20 22.7 21A 24.1 21B 24.1Maggot Mass Temp. 23.8C Figure A-2. Temperature readings record ed on July 13, 2007 for control experiment.

PAGE 223

223 Heater 4A 24.9 4B 25.6 2A 24.7 2B 24.6 6A 24.4 6B 24.6 9A 23.5 9B 24.0 3A 24.2 3B 24.3 1A 24.7 1B 25.1 5A 24.4 5B 24.8 7 23.8 8A 23.7 8B 24.1 12A 24.0 12B 24.8 11 23.8 10A 24.0 10B 24.1 14A 24.4 14B 24.7 13A 24.6 13B 24.7 17A 24.2 17B 24.4 16A 23.8 16B 24.2 18 24.2 15 24.0 19 24.0 20 23.9 21A 25.3 21B 25.2Maggot Mass Temp. 26.2C Figure A-3. Temperature readings record ed on July 14, 2007 for control experiment.

PAGE 224

224 Heater 4A 27.9 4B 28.4 2A 28.6 2B 28.6 6A 28.0 6B 29.4 9A 26.8 9B 26.9 3A 27.7 3B 27.8 1A 28.3 1B 30.3 5A 28.1 5B 31.1 7 27.3 8A 26.4 8B 27.1 12A 26.3 12B 28.1 11 26.6 10A 26.7 10B 26.7 14A 29.8 14B 30.5 13A 28.0 13B 30.4 17A 26.7 17B 27.1 16A 27.6 16B 27.4 18 26.7 15 26.7 19 26.5 20 26.3 21A 28.6 21B 28.6Maggot Mass Temp. 29.0C Figure A-4. Temperature readings record ed on July 16, 2007 for control experiment.

PAGE 225

225 Heater 4A 27.0 4B 27.3 2A 28.2 2B 28.5 6A 28.3 6B 30.2 9A 26.6 9B 26.7 3A 27.5 3B 27.3 1A 28.4 1B 30.5 5A 27.3 5B 30.5 7 27.3 8A 26.8 8B 26.8 12A 27.1 12B 28.7 11 26.5 10A 26.6 10B 26.6 14A 27.6 14B 28.5 13A 27.4 13B 28.0 17A 26.9 17B 26.9 16A 27.2 16B 27.1 18 26.8 15 27.3 19 26.6 20 26.4 21A 27.5 21B 28.9Figure A-5. Temperature readings record ed on July 17, 2007 for control experiment.

PAGE 226

226 Heater 4A 28.4 4B 29.8 2A 28.7 2B 29.2 6A 26.6 6B 27.2 9A 30.6 9B 33.9 3A 28.7 3B 33.5 1A 29.5 1B 31.3 5A 27.5 5B 29.2 7A 26.9 7B 27.0 8A 26.6 8B 27.8 12A 26.8 12B 26.8 11A 28.1 11B 28.1 10A 29.2 10B 29.4 14 26.6 13A 27.1 13B 26.7 17A 31.3 17B 29.2 16 26.6 18 26.6 15 26.6 19 26.6 20 26.6 Figure A-6. Temperature readings reco rded on July 6, 2007 for 40C experiment.

PAGE 227

227 Heater 4A 31.2 4B 32.2 2A 28.8 2B 29.3 6A 24.6 6B 24.4 9A 29.5 9B 30.5 3A 30.2 3B 34.8 1A 29.1 1B 32.6 5A 29.3 5B 30.1 7A 22.1 7B 22.1 8A 24.2 8B 25.5 12A 28.3 12B 28.3 11A 29.4 11B 30.0 10A 27.4 10B 29.5 14 29.9 13A 30.1 13B 29.4 17A 34.1 17B 32.3 16 24.0 18 31.3 19 31.0 20 30.8 21A 30.4 21B 33.7 15 24.0 Figure A-7. Temperature readings reco rded on July 7, 2007 for 40C experiment.

PAGE 228

228 Heater 4A 31.7 4B 31.8 2A 30.8 2B 32.3 6A 29.2 6B 29.2 9A 30.2 9B 35.5 3A 31.2 3B 33.5 1A 30.2 1B 32.8 5A 30.1 5B 30.1 7A 29.0 7B 29.3 8A 28.9 8B 30.3 12A 29.3 12B 29.3 11A 30.7 11B 30.7 10A 31.8 10B 31.4 14 29.2 13A 29.2 13B 29.9 17A 34.5 17B 33.5 16 29.3 18 29.0 15 29.2 19 29.0 20 29.0 21A 30.8 21B 33.3Figure A-8. Temperature readings reco rded on July 8, 2007 for 40C experiment.

PAGE 229

229 Heater 4A 30.6 4B 31.1 2A 32.2 2B 32.4 6A 29.4 6B 29.2 9A 31.7 9B 35.6 3A 31.9 3B 34.1 1A 31.4 1B 32.6 5A 30.7 5B 31.0 7A 28.3 7B 28.5 8A 30.0 8B 31.8 12A 30.0 12B 30.0 11A 31.0 11B 30.7 10A 32.4 10B 31.7 14 30.7 13A 30.7 13B 30.7 17A 37.0 17B 35.6 16 30.5 18 30.5 15 30.6 19 30.5 20 30.4 21A 31.5 21B 33.5Figure A-9. Temperature readings reco rded on July 9, 2007 for 40C experiment.

PAGE 230

230 Heater 4A 31.6 4B 31.7 2A 32.5 2B 33.2 6A 30.7 6B 30.3 9A 32.0 9B 33.6 3A 32.0 3B 35.4 1A 31.2 1B 33.1 5A 30.8 5B 31.1 7A 29.5 7B 29.8 8A 30.5 8B 32.1 12A 30.8 12B 30.8 11A 31.3 11B 31.0 10A 32.2 10B 31.8 14 30.6 13A 30.8 13B 30.8 17A 35.4 17B 34.6 16 30.4 18 31.2 15 30.5 19 31.1 20 31.0 21A 30.5 21B 33.6Figure A-10. Temperature readings reco rded on July 10, 2007 for 40C experiment.

PAGE 231

231 He ater 4A 32.1 4B 32.1 2A 32.5 2B 33.3 6A 31.0 6B 30.7 9A 32.0 9B 37.0 3A 31.4 3B 34.5 1A 32.3 1B 32.9 5A 31.5 5B 31.5 7A 29.8 7B 29.9 8A 30.3 8B 32.0 12A 31.1 12B 31.1 11A 31.4 11B 31.4 10A 32.7 10B 32.4 14 31.2 13A 31.5 13B 31.4 17A 37.2 17B 34.6 16 31.0 18 30.9 15 31.1 19 30.9 20 30.8 21A 30.4 21B 33.3Figure A-11. Temperature readings reco rded on July 11, 2007 for 40C experiment.

PAGE 232

232 Heater 4A 32.3 4B 32.1 2A 32.5 2B 32.3 6A 31.0 6B 30.6 9A 31.7 9B 38.2 3A 31.4 3B 34.6 1A 32.4 1B 33.2 5A 31.3 5B 31.7 7A 30.2 7B 30.0 8A 29.5 8B 31.5 12A 31.2 12B 31.2 11A 31.7 11B 31.4 10A 32.5 10B 32.2 14 30.8 13A 31.2 13B 31.0 17A 39.2 17B 39.3 16 30.6 18 30.3 15 30.7 19 30.3 20 30.3 21A 30.7 21B 33.8Figure A-12. Temperature readings reco rded on July 12, 2007 for 40C experiment.

PAGE 233

233 Heater 4A 28.1 4B 28.6 2A 31.4 2B 31.6 6A 28.6 6B 29.0 9A 30.6 9B 38.7 3A 28.6 3B 32.3 1A 27.5 1B 31.7 5A 27.7 5B 28.8 7A 28.9 7B 28.8 8A 30.1 8B 32.3 12A 28.2 12B 28.3 11 27.6 10A 30.1 10B 30.5 14 27.8 13A 29.1 13B 29.3 17A 45.1 17B 41.4 16 30.6 18 30.5 15 28.8 19 28.5 20 28.0 21A 28.5 21B 31.5Figure A-13. Temperature readings reco rded on July 12, 2007 for 45C experiment.

PAGE 234

234 Heater 4A 26.5 4B 31.2 2A 28.7 2B 31.5 6A 26.7 6B 27.3 9A 30.6 9B 37.5 3A 31.9 3B 36.6 1A 29.1 1B 32.2 5A 28.0 5B 30.5 7A 25.0 7B 25.2 8A 29.2 8B 31.1 12A 26.6 12B 27.6 11 26.8 10A 29.7 10B 30.3 14 25.6 13A 27.3 13B 26.6 17A 37.8 17B 35.4 16 25.1 18 28.3 15 25.5 19 26.8 20 26.7 21A 30.6 21B 33.0Maggot Mass Temp. 37.9C Figure A-14. Temperature readings reco rded on July 13, 2007 for 45C experiment.

PAGE 235

235 Heater 4A 33.2 4B 34.9 2A 29.5 2B 31.0 6A 28.2 6B 9A 34.3 9B 41.8 3A 37.1 3B 42.3 1A 32.5 1B 34.0 5A 28.9 5B 30.8 7A 27.3 7B 27.4 8A 27.2 8B 27.7 12A 30.8 12B 30.6 11 27.7 10A 32.8 10B 34.1 14 28.6 13A 30.5 13B 30.1 17A 37.8 17B 41.8 16 27.7 18 26.9 15 26.5 19 26.8 20 26.7 21A 36.3 21B 38.8Maggot Mass Temp. 38.9C Figure A-15. Temperature readings reco rded on July 14, 2007 for 45C experiment.

PAGE 236

236 Heater 4A 35.0 4B 34.8 2A 25.2 2B 26.1 6A 27.5 6B 28.3 9A 32.8 9B 49.2 3A 32.2 3B 48.6 1A 25.4 1B 30.3 5A 30.0 5B 30.5 7A 26.9 7B 27.4 8A 27.2 8B 28.3 12A 28.9 12B 28.9 11A 29.2 11B 29.4 10A 35.2 10B 34.7 14A 27.3 14B 26.9 13A 30.6 13B 30.0 17A 50.4 17B 45.5 16 26.6 18 26.7 15 26.5 19 26.7 20 26.8 21A 25.9 21B 30.8Figure A-16. Temperature readings reco rded on July 19, 2007 for 50C experiment.

PAGE 237

237 Heater 4A 32.6 4B 44.8 2A 31.9 2B 34.2 6A 31.0 6B 30.3 9A 32.0 9B 48.7 3A 33.1 3B 45.4 1A 32.3 1B 37.0 5A 32.4 5B 33.8 7A 29.0 7B 29.0 8A 28.6 8B 31.4 12A 30.8 12B 32.5 11A 31.8 11B 32.4 10A 34.7 10B 35.5 14A 29.6 14B 29.1 13A 32.8 13B 32.1 17A 48.0 17B 46.5 16 28.8 18 29.0 15 28.8 19 29.1 20 29.2 21A 31.4 21B 42.2Maggot Mass Temp. 37.0C Figure A-17. Temperature readings reco rded on July 20, 2007 for 50C experiment.

PAGE 238

238 Heater 4A 32.3 4B 45.4 2A 32.6 2B 35.0 6A 29.7 6B 30.1 9A 34.2 9B 50.0 3A 33.1 3B 45.5 1A 33.5 1B 37.7 5A 31.5 5B 35.4 7A 28.3 7B 29.3 8A 28.3 8B 32.3 12A 31.7 12B 32.6 11A 33.7 11B 33.0 10A 36.8 10B 35.9 14A 30.6 14B 29.2 13A 32.3 13B 31.7 17A 49.6 17B 46.8 16 27.6 18 27.4 15 27.2 19 27.4 20 27.2 21A 32.4 21B 43.0Maggot Mass Temp. 39.6C Figure A-18. Temperature readings reco rded on July 21, 2007 for 50C experiment.

PAGE 239

239 Heater 4A 34.6 4B 47.3 2A 32.0 2B 36.1 6A 30.9 6B 31.2 9A 35.1 9B 47.3 3A 34.9 3B 46.8 1A 33.5 1B 39.4 5A 33.1 5B 34.4 7A 28.4 7B 29.7 8A 30.6 8B 33.8 12A 32.6 12B 32.8 11A 33.2 11B 33.6 10A 35.8 10B 35.7 14A 31.1 14B 29.7 13A 33.4 13B 32.6 17A 57.6 17B 49.7 16 26.7 18 26.4 15 26.6 19 26.2 20 26.1 21A 32.9 21B 43.2Maggot Mass Temp. 32.2C Figure A-19. Temperature readings reco rded on July 22, 2007 for 50C experiment.

PAGE 240

240 Heater 4A 33.5 4B 46.7 2A 32.5 2B 35.3 6A 31.6 6B 31.4 9A 36.6 9B 50.5 3A 34.3 3B 46.1 1A 31.4 1B 38.6 5A 35.8 5B 34.7 7A 29.4 7B 29.4 8A 30.7 8B 33.3 12A 31.6 12B 32.6 11A 30.9 11B 32.1 10A 34.5 10B 34.6 14A 30.4 14B 30.4 13A 33.4 13B 32.5 17A 52.7 17B 47.0 16 28.6 18 28.6 15 28.6 19 28.6 20 28.5 21A 33.0 21B 43.0Maggot Mass Temp. 31.3C Figure A-20. Temperature readings reco rded on July 23, 2007 for 50C experiment.

PAGE 241

241 Heater 4A 33.6 4B 42.0 2A 33.3 2B 34.3 6A 30.3 6B 31.0 9A 33.8 9B 48.1 3A 33.4 3B 45.4 1A 33.1 1B 44.3 5A 35.6 5B 34.7 7A 28.0 7B 29.0 8A 29.7 8B 32.0 12A 32.4 12B 32.7 11A 32.6 11B 33.0 10A 31.1 10B 33.7 14A 31.0 14B 30.6 13A 33.4 13B 32.6 17A 49.2 17B 45.2 16 27.6 18 27.6 15 27.7 19 27.5 20 27.4 21A 32.1 21B 42.2Figure A-21. Temperature readings reco rded on July 24, 2007 for 50C experiment.

PAGE 242

242 Heater 4A 28.1 4B 32.0 2A 26.7 2B 28.8 6A 26.7 6B 27.8 9A 33.4 9B 49.0 3A 27.2 3B 35.0 1A 28.6 1B 33.1 5A 27.6 5B 30.0 7A 26.8 7B 27.0 8A 26.6 8B 27.9 12A 25.8 12B 26.8 11A 27.5 11B 27.4 10 31.6 14A 27.4 14B 26.8 13A 30.8 13B 29.6 17A 51.4 17B 50.6 16 25.3 18 29.5 15A 26.0 15B 26.1 19A 26.2 19B 26.3 20A 24.7 20B 25.2 21A 29.3 21B 33.0Figure A-22. Temperature readings reco rded on July 26, 2007 for 55C experiment.

PAGE 243

Heater 4A 33.4 4B 37.9 2A 30.7 2B 33.1 6A 31.7 6B 31.5 9A 33.8 9B 52.4 3A 27.3 3B 45.3 1A 31.8 1B 37.1 5A 35.6 5B 35.4 7A 29.0 7B 29.4 8A 30.1 8B 33.0 12A 30.6 12B 32.5 11A 31.0 11B 30.9 10 31.5 14A 30.6 14B 29.6 13A 32.8 13B 31.1 17A 61.2 17B 53.1 16 28.6 18 29.9 15A 28.7 15B 28.9 19A 28.9 19B 28.9 20A 28.9 20B 29.5 21A 32.7 21B 45.1Maggot Mass Temp. 36.8C Figure A-23. Temperature readings reco rded on July 27, 2007 for 55C experiment. 243

PAGE 244

244 Heater 4A 35.3 4B 37.4 2A 31.1 2B 34.2 6A 31.8 6B 31.9 9A 35.0 9B 54.4 3A 32.0 3B 43.8 1A 31.3 1B 37.9 5A 35.4 5B 38.5 7A 31.0 7B 31.1 8A 30.9 8B 32.7 12A 29.6 12B 32.5 11A 30.4 11B 30.8 10 31.3 14A 31.0 14B 30.8 13A 32.8 13B 32.4 17A 57.4 17B 50.1 16 28.3 18 30.5 15A 29.2 15B 29.2 19A 29.1 19B 29.3 20A 29.8 20B 29.5 21A 32.7 21B 43.3Maggot Mass Temp. 37.5C Figure A-24. Temperature readings reco rded on July 28, 2007 for 55C experiment.

PAGE 245

245 Heater 4A 33.8 4B 36.1 2A 31.5 2B 35.3 6A 30.5 6B 32.0 9A 33.7 9B 53.0 3A 33.0 3B 45.1 1A 33.0 1B 44.2 5A 34.0 5B 36.4 7A 30.7 7B 31.1 8A 30.6 8B 32.6 12A 29.6 12B 32.3 11A 30.1 11B 30.7 10 31.0 14A 31.4 14B 30.6 13A 32.6 13B 31.8 17A 55.5 17B 47.1 16 28.6 18 29.9 15A 29.9 15B 29.3 19A 28.5 19B 29.0 20A 28.8 20B 28.8 21A 33.3 21B 43.0Figure A-25. Temperature readings reco rded on July 29, 2007 for 55C experiment.

PAGE 246

246 Heater 4A 34.2 4B 36.1 2A 34.2 2B 34.6 6A 31.1 6B 31.6 9A 34.2 9B 51.4 3A 32.8 3B 43.9 1A 32.3 1B 39.4 5A 33.8 5B 37.4 7A 30.8 7B 31.0 8A 30.7 8B 32.9 12A 29.4 12B 32.0 11A 30.3 11B 30.6 10 30.7 14A 30.6 14B 30.3 13A 31.1 13B 30.7 17A 55.1 17B 49.4 16 28.4 18 30.0 15A 29.4 15B 29.1 19A 28.3 19B 28.9 20A 28.3 20B 28.7 21A 34.4 21B 42.0Figure A-26. Temperature readings reco rded on July 30, 2007 for 55C experiment.

PAGE 247

247 Heater 4A 29.5 4B 29.4 2A 27.9 2B 28.4 6A 28.0 6B 27.7 9A 29.4 9B 50.9 3A 30.5 3B 36.5 1A 29.4 1B 30.3 5A 28.9 5B 30.8 7A 26.3 7B 26.8 8A 27.2 8B 29.5 12A 26.6 12B 26.6 11A 28.5 11B 28.2 10A 32.4 10B 32.2 14A 27.2 14B 26.9 13A 31.5 13B 30.8 17A 64.0 17B 53.1 16 26.7 18 27.4 15A 26.6 15B 26.6 19A 27.0 19B 27.0 20A 28.8 20B 28.1 21A 28.1 21B 32.6Figure A-27. Temperature readings reco rded on July 31, 2007 for 60C experiment.

PAGE 248

248 Heater 4A 32.6 4B 37.1 2A 31.8 2B 33.2 6A 31.3 6B 31.6 9A 36.6 9B 47.0 3A 35.0 3B 47.5 1A 36.7 1B 41.6 5A 34.1 5B 37.0 7A 29.5 7B 30.2 8A 31.8 8B 34.9 12A 27.9 12B 31.5 11A 27.8 11B 31.3 10A 32.4 10B 35.0 14A 29.8 14B 29.3 13A 34.6 13B 33.9 17A 61.8 17B 56.5 16 28.6 18 29.4 15A 28.5 15B 28.6 19A 26.5 19B 29.3 20A 28.3 20B 28.9 21A 35.4 21B 45.4Maggot Mass Temp. 37.5C Figure A-28. Temperature readings reco rded on August 1, 2007 for 60C experiment.

PAGE 249

249 Heater 4A 33.8 4B 38.3 2A 31.8 2B 33.4 6A 31.5 6B 32.0 9A 35.5 9B 45.3 3A 32.0 3B 47.4 1A 34.8 1B 37.0 5A 31.2 5B 38.0 7A 29.8 7B 30.5 8A 29.5 8B 32.0 12A 29.7 12B 31.9 11A 31.4 11B 32.0 10A 31.8 10B 34.4 14A 26.4 14B 29.1 13A 34.6 13B 34.7 17A 62.0 17B 56.1 16 29.3 18 29.8 15A 28.2 15B 28.7 19A 28.3 19B 29.8 20A 28.5 20B 29.2 21A 38.3 21B 42.2Maggot Mass Temp. 37.4C Figure A-29. Temperature readings reco rded on August 2, 2007 for 60C experiment.

PAGE 250

250 Heater 4A 33.8 4B 39.0 2A 33.3 2B 34.9 6A 31.8 6B 32.6 9A 34.6 9B 45.1 3A 37.8 3B 48.1 1A 38.8 1B 40.4 5A 30.0 5B 37.4 7A 31.4 7B 31.9 8A 29.7 8B 32.5 12A 32.7 12B 34.3 11A 33.2 11B 33.7 10A 32.0 10B 34.3 14A 27.7 14B 29.8 13A 34.6 13B 36.1 17A 64.9 17B 43.1 16 29.6 18 30.0 15A 27.7 15B 28.6 19A 28.9 19B 30.8 20A 28.3 20B 29.4 21A 34.7 21B 41.7Maggot Mass Temp. 36.0C Figure A-30. Temperature readings reco rded on August 3, 2007 for 60C experiment.

PAGE 251

251 Heater 4A 34.6 4B 38.5 2A 32.4 2B 34.2 6A 29.0 6B 31.7 9A 39.0 9B 45.2 3A 35.1 3B 49.2 1A 42.4 1B 42.4 5A 35.5 5B 39.3 7A 31.5 7B 31.7 8A 31.8 8B 33.0 12A 29.5 12B 33.8 11A 31.7 11B 33.3 10A 31.5 10B 34.4 14A 29.0 14B 29.5 13A 35.0 13B 34.9 17A 60.2 17B 52.1 16 29.2 18 29.3 15A 29.4 15B 29.6 19A 30.6 19B 30.8 20A 29.6 20B 29.8 21A 35.4 21B 41.6Figure A-31. Temperature readings reco rded on August 4, 2007 for 60C experiment.

PAGE 252

252 Heater 4A 33.1 4B 36.2 2A 28.2 2B 28.3 6A 27.2 6B 27.4 9A 35.1 9B 60.5 3A 29.4 3B 31.4 1A 29.8 1B 31.6 5A 29.8 5B 30.0 7A 26.9 7B 26.8 8A 26.7 8B 27.6 12A 27.5 12B 27.8 11A 27.2 11B 27.7 10A 28.4 10B 28.4 14A 27.7 14B 27.5 13A 30.9 13B 30.1 17A 66.5 17B 53.2 16A 26.3 16B 27.3 18 27.2 15A 26.8 15B 26.9 19A 26.5 19B 26.3 20A 26.2 20B 26.6 21A 28.8 21B 31.0Maggot Mass Temp. 29.2C Figure A-32. Temperature readings reco rded on August 5, 2007 for 65C experiment.

PAGE 253

253 Heater 4A 35.3 4B 41.7 2A 33.0 2B 33.8 6A 30.0 6B 31.2 9A 42.5 9B 59.0 3A 43.6 3B 52.2 1A 35.2 1B 44.0 5A 38.7 5B 41.3 7A 31.5 7B 31.4 8A 30.7 8B 32.6 12A 30.6 12B 32.4 11A 32.6 11B 34.1 10A 32.6 10B 33.7 14A 30.0 14B 29.8 13A 36.9 13B 34.5 17A 73.0 17B 58.6 16A 29.5 16B 30.0 18 32.4 15A 29.8 15B 29.8 19A 30.7 19B 30.6 20A 29.5 20B 30.6 21A 34.6 21B 49.0Maggot Mass Temp. 35.0C Figure A-33. Temperature readings reco rded on August 6, 2007 for 65C experiment.

PAGE 254

254 Heater 4A 39.1 4B 44.8 2A 35.4 2B 36.5 6A 36.0 6B 36.7 9A 33.8 9B 61.3 3A 37.1 3B 52.6 1A 36.0 1B 44.6 5A 35.4 5B 41.6 7A 32.5 7B 32.6 8A 31.3 8B 32.6 12A 29.4 12B 32.5 11A 32.2 11B 32.7 10A 32.8 10B 35.4 14A 28.8 14B 30.9 13A 38.3 13B 35.0 17A 64.4 17B 53.8 16A 28.9 16B 30.5 18 30.5 15A 29.0 15B 29.2 19A 30.2 19B 30.2 20A 29.8 20B 30.6 21A 37.6 21B 51.1Maggot Mass Temp. 39.6C Figure A-34. Temperature readings reco rded on August 7, 2007 for 65C experiment.

PAGE 255

255 Heater 4A 37.7 4B 43.3 2A 34.5 2B 37.6 6A 33.0 6B 34.3 9A 38.5 9B 57.4 3A 41.7 3B 54.1 1A 40.3 1B 44.2 5A 39.8 5B 41.3 7A 33.0 7B 33.2 8A 32.5 8B 33.6 12A 30.6 12B 32.1 11A 32.8 11B 34.1 10A 31.6 10B 35.7 14A 28.9 14B 29.0 13A 33.6 13B 31.8 17A 65.6 17B 54.1 16A 30.8 16B 31.7 18 31.0 15A 28.6 15B 29.5 19A 30.5 19B 30.0 20A 29.6 20B 30.5 21A 38.9 21B 50.9Maggot Mass Temp. 37.3C Figure A-35. Temperature readings reco rded on August 8, 2007 for 65C experiment.

PAGE 256

APPENDIX B ISOLATION OF TOTAL DNA FROM BEAR TISSUE AND DIPTERAN LARVAE Note: Protocol modified fr om DNeasy QIAGEN tissue handbook Cell Lysis 1. Homogenize individual larvae, larvae gut minus the cuticle or a piece of tissue (up to 25 mg) in 180 l of ATL Lysis Solution Note: Homogenization is done us ing a microtube pestle. 2. Add 20 l Proteinase K solution (20 mg/ml) to the ly sate. Mix by inverting 25 times and incubate at 55C overnight. 3. Centrifuge for 15 min at full speed. Transfer supernatant to a new 1.5 ml microfuge tube. 4. Add 10 l RNAse A solution (20 mg/ml) to the cell lysate. Mix sample by inverting 25 times and incubate at room temperature for 10 min. 5. Add 200 l of AL buffer, mix and incubate at 70C/10 min. 6. Add 200 l of 95% ethanol and mix. 7. Transfer mix to columns (inside the collect or tube already) th en centrifuge at mid speed (8,000 rpm) for 1 min. 8. Put column in a new collector tube and wash column with 500 l AW1 buffer (make sure it has ethanol added to it !). Centrifuge at 8.000 rpm for 1 min. 9. Discard the flow-through and add 500 l of AW2 buffer (make sure it has ethanol added to it) and centrifuge for 2 min ( 8,000 rpm). Discard the flow-through and repeat this step to ensure there is no AW2 buffer left in the column. 10. Put the column in a labele d 1.5 ml microfuge tube and let column dry for 5 min. 11. Elute DNA with 100 l of pre-warmed (70 C) AE buffer. Incubate at room temperature for 2 min and centrifuge for 1 min at 8,000 rpm. 256

PAGE 257

APPENDIX C GENOMIC DNA ISOLATION OF LARV AE GUT USING DNAZOL REAGENT (From DNAzol Protocol) Lysis / Homogenization 1. Homogenize the anterior (crop) portion of gut contents (c ut away larva cuticle) in 200 l of DNAzol BD by applying a few st rokes with a microtube pestle. Store the homogenate for 5-10 min at room temperature 2. Add 20 l of proteinase K, mix and incubate at 70C for 10 min. Centrifugation 3. Sediment the homogenate for 10 min at 13,000 g. 4. Following centrifugation, tran sfer the resulting viscous supernatant to a new 1.5 ml microfuge tube. 5. Add 3 l of Polyacryl Carrier, mix and in cubate for 2 min at room temperature. DNA Precipitation 6. Precipitate DNA from the lysate/homogena te by the addition of 100 l of 100% ethanol or isopropanol. Mix samples by i nverting tubes 5-8 times and store at room temperature for 3 min. Note: Make sure that DNAzol and ethanol mix well to form a homogenous solution. DNA should quickly become visible as a cloudy precipitate. 7. Sediment the precipitate for 5 min at 4500 rpm. 8. Discard supernatant and save the pellet. DNA Wash 9. Wash the DNA precipitate with a 0.7 ml DNAzol and 0.3 ml 75% ethanol. Suspend DNA by inverting the tubes 3-6 times. 10. Pellet the DNA by centrifugi ng at 3,000 rpm for 2 min. 11. Remove DNAzol/ethanol solution from tube being careful not to disturb the pellet. 12. Wash DNA precipitate with 0.9 ml of 75% ethanol. 13. Sediment DNA pellet at 3,000 rpm for 2 min. 14. Remove ethanol from tube being ca reful not to disturb the pellet. DNA Solubilization 15. Remove any remaining alcohol from the bot tom of the tube using a pipette and let it dry for a maximum of 3 min at room temperature. 16. Dissolve DNA in 100 l of 1 x TE buffer. 17. Incubate at 65C min with periodic tapping. 257

PAGE 258

APPENDIX D CHROMOSOMAL DNA EXTRACTION FROM TISSUE (Protocol obtained from Dr James Maruniaks lab) Note: Keep all solutions on i ce with the exception of SDS DAY 1: 1. Homogenize the tissue (20 mg/ tube) in microf uge tube with 0.5 ml of STM buffer plus 0.1ml of 0.5 M EDTA. After homoge nization, add 0.5 ml more of STM. STM buffer: (for 1 liter) 0.32 M Sucrose 109.54 g sucrose 50 mM Tris pH 7.25 50 ml 1 M Tris 10 mM MgCl2 2.033 g MgCl2 0.5% NP 40 detergent 5 ml NP 40 detergent Bring volume to 1 liter with dd water. Filter sterilize. 2. Centrifuge at low speed (6000 rpm) for 4 min. 3. Discard supernatant 4. Resuspend pellet in 0.25 ml STE buffer: STE buffer: (for 500 ml) 75 mM NaCl 37.5 ml 1 M NaCl 25 mM EDTA 25 ml 0.5 M EDTA 10 mM Tris pH 7.8 5 ml 1 M Tris 432.5 ml dd water. Autoclave. 5. Add: 15 l 0.5 M EDTA, 15 l 20% SDS and 8 l Proteinase K (20 mg/ml). 6. Incubate at 55C overnight. DAY 2: 1. Centrifuge samples at full speed for 10 min. 2. Transfer supernatant to a clean tube. 3. Add 20 l RNAse (5 mg/ml). Incubate at 37C for 1 h. 4. Add 150 l of phenol and 150 l chloroform. 5. Mix for 5 min by inverting the tubes by hand. 6. Centrifuge for 10 min and transfer upper aqueous phase to a new tube. 7. Add 300 l chloroform and mix for 5 min. 8. Centrifuge for 5 min and transfer th e upper aqueous phase to clean tube. 9. Add 600 l of cold 95% ethanol, mix gently by inverting the tubes, and incubate at -20C overnight. Note: The incubation could be on ice for 10 min to continue with the next step. DAY 3: 1. Centrifuge for 15 min. 2. Remove supernatant and let pellet air dry (15 min). 3. Resuspend the chromosomal DNA with 50 l 10 mM Tris. 258

PAGE 259

APPENDIX E PCR PROTOCOL (Protocol obtained from Dr James Maruniaks lab) Table E-1. Order of additi on of reagents in a reacti on mix (for 25 l reactions) Component Addition Order Volume (l) Final concentration Sterile Distilled H2O 1 To volume of 25 10X Reaction Buffer 2 2.5 1X dNTPs (10 mM each) 3 0.5 200 M/ nucleotide 50 mM MgCl2 4 ? Variable Primer # 1 5 ? Variable Primer #2 5 ? Variable Taq Polymerase 6 0.2 1 unit/reaction DNA template 7 1.0 Variable Final Volume 25.0 Table E-2. To prepare a master mix for 5 reactio ns to amplify the cyto chrome oxidase I (COI) gene of mitochondrial DNA (considering that the DNA template will be diluted as necessary in 1 l). Components For 1 reaction For 5 reactions (l) (l) S.D. H2O 17.5 87.5 10X Reaction Buffer 2.5 12.5 dNTPs (10 mM each) 0.5 2.5 MgCl2 (50 mM) 1.3 6.5 Tonya (10 pmoles/l) 1.0 5.0 Hobbes (10 pmoles/l) 1.0 5.0 Taq polymerase 0.2 1.0 DNA template 1.0 Final Volume 25.0 Temperature Program for mitochondria COI region: Step 1: 95C 3 min Step 2: 94C 1 min (Denaturation) Step 3: 48C 1 min (Annealing) Step 4: 72C 1 min (Extension) Step 5: 29 times to step #2 Step 6: 72C 5 min Step 7: 15C Indefinite Step 8: End 259

PAGE 260

260 Table E-3. Amounts needed to prepare a master mi x for 5 reactions to amplify the cytochrome b gene of mitochondrial DNA (considering that the DNA template will be diluted as necessary in 1 l). Components For 1 reaction For 5 reactions (l) (l) S.D. H2O 16.8 184.3 10X Reaction Buffer 2.5 27.5 dNTPs (10 mM each) 0.5 5.5 MgCl2 (50 mM) 1.0 11.0 Mammal Primer 1 (5 pmol/l) 1.0 11.0 Mammal Primer 2 (5 pmol/l) 1.0 11.0 Taq polymerase 0.25 2.8 DNA template 1.0 Final Volume 25.0 Temperature Program for mitochondria cytochrome b: Step 1: 93C 5 min Step 2: 94C 30 sec Step 3: 48C 30 sec Step 4: 72C 1:30 min Step 5: 45 times to step 2 Step 6: 72C 3 min Step 7: 6C indefinite Step 8: End Dilution of Primers When primers are bought, they usually are sent as powder. They need to be dissolved and diluted to the needed worki ng concentration. To do that there are several calculations that can be done. Here we explain wh at the Insect Virology Lab does. With primers comes a list with the concentration of the primers one of them is the amount of nmol (nano moles). We use this informa tion to make our stock solution by diluting the primers to a concentration of 500 pmol/l. Example: Primer A: 120.7 nmol 120.7 nmol = 120,700 pmol If we want 500 pmol/l, how much 10 mM Tris pH 8.0 do we need to add? 500 pmol ---1 l 120,700 pmol ---X X=120,700/500 = 214.4 l So use 214.4 l of 10 mM Tris to dissolve the prim er. Then do serial dilutions to the working concentration that for us is 5 pmol/l.

PAGE 261

APPENDIX F AGAROSE GEL PROTOCOL (Protocol obtained from Dr James Maruniaks lab) How to prepare: 1. Level gel tray. 2. Seal tray with tape or with tray holder. 3. Set well comb in the apparatus (a s many wells as you have samples). 4. Weigh agarose into an Erlenmey er flask, add deionized water. 5. Heat at one-minute intervals on high in microwave. 6. After agarose is melted, let it cool until it can be held with you hands (you can speed this process by running cold tap water on the outside of the Erlenmeyer flask). 7. Add 50 X TAE buffer and ethidium bromide. 8. Mix thoroughly but avoiding making bubbles. 9. Pour in gel tray and allow to hard en completely (approximately 30 min). 10. After gel solidifies, pour a li ttle buffer around the comb and gently remove it from gel. 11. Place gel tray in electrophoresis unit a nd pour buffer over (gel surface must be covered). 12. Add 1.0 l of 10 X stop buffer to the samples. Always add a molecular weight standard in one of the wells (e.g. 1 kb ladder, 100 bp ladder or -Hind III digest). 13. Start loading the samples (volume usually load ed is 10 20 l), place pipette tip into the submerged well (careful not to push it in to the gel itself). Gently pipette each sample into the wells (use a clean tip for each sample). 14. Begin electrophoresis. Make sure to place the ge l such that the wells are closest to the black dot on the unit. Plug in the wires so that the black one connects to the black outlets or both the unit and the power supply. Do the same with the red wire. The DNA is negatively charged and will migrate towards the cathode (symbolized as red). A) Big Gel BioRad Sub Cell 1. 200 ml agarose (0.7%) 1.4 g Agarose 4.0 ml 50 X TAE buffer 10.0 l of 5 mg/ml Ethidium bromide (EtBr) 196.0 ml deionized water 2. 1,500 ml buffer 30.0 ml of 50 X TAE buffer 75 l EtBr 1,470 ml of deionized water B) Medium Gel 1. 100 ml agarose (0.7%0 0.7 g Agarose 2.0 ml 50 X TAE buffer 5 l EtBr (5 mg/ml) 98 ml deionized water 261

PAGE 262

262 2. 700 ml buffer 14 ml 50 X TAE buffer 35 l EtBr 686 ml deionized water C) Mini Gel 1. USA Scientific Unit 2. Bio Rad Unit 30 ml agarose (0.7%) 40 ml agarose (0.7%) 0.21 g Agarose 0.29 g Agarose 0.6 ml 50 X TAE buffer 0.8 ml 50 X TAE buffer 1.5 l EtBr (5 mg/ml) 2. 0 l EtBr (5 mg/ml) 29.4 ml deionized water 39.2 ml deionized water 300 ml buffer 250 ml buffer 6.0 ml 50 X TAE buffer 5.0 ml 50 X TAE buffer 15.0 l EtBr 12.5 l EtBr 294.0 ml deionized water 245.0 ml deionized water

PAGE 263

APPENDIX G QIAquick GEL EXTRACTION KIT PROTOCOL Note: Protocol modified from QIAQU ICK GEL EXTRACTION handbook. It is designed to extract and purif y DNA of 70 bp to 10 kb from standard of low-melt agarose gels in TAE or TBE buffer us ing a microcentrifuge tube. Procedure 1. Excise the DNA fragment from the agarose gel with a clean, sharp scalpel. 2. Weigh the gel slice in a colorless tube. Add 3 volumes of Buffer QG to 1 volume of gel (100 mg ~ 100 l). For example, add 300 l of Buffer QG to each 100 mg of gel. For agarose gels greater than 2% add 6 volumes of Buffer QG. 3. Incubate at 50C for 10 min (or until gel sl ice has completely dissolved). To help dissolve gel, mix by vortexing the tube every 2-3 min during the incubation. 4. After the gel slice has dissolved completel y, check that the color of the mixture is yellow, if not see QIAquick Spin Handbook. 5. Add 1 gel volume of isopropanol to the sample and mix. 6. Place a QIAquick spin column in a provided 2 ml collection tube. 7. To bind DNA, apply the sample to the QI Aquick column, and centrifuge for 1 min. 8. Discard flow-through and place QIAquick colu mn back in the same collection tube. 9. Recommended: Add 0.5 ml of Buffer QG to QI Aquick column and centrifuge for 1 min, for removal of a ll traces of agarose. 10. To wash, add 0.75 ml of Buffer PE to QI Aquick column and centrifuge for 1 min (make sure it has ethanol added to it!) Note: If the DNA will be used for salt-sensitiv e applications, such as blunt-end ligation and direct sequencing, let the column stand 25 min after addition of Buffer PE, before centrifuging. 11. Discard the flow-through and centrifuge the QIAquick column for an additional 1 min at 13,000 rpm. IMPORTANT: Residual ethanol from Buffer PE will not be completely removed unless the flow-through is discarded befo re this additional centrifugation. 12. Place QIAquick column into a cl ean 1.5 ml microcentrifuge tube. 13. To elute DNA, add 30 l of Buffer EB (10mM Tris-Cl, pH 8.5) to the center of the QIAquick membrane, let the column stand for 1 min, and then centrifuge for 1 min. 263

PAGE 264

APPENDIX H DNA CYCLE SEQUENCING (Protocol obtained from Dr James Maruniaks lab) Note: Thaw and keep all reagents on ice until you place then in the thermocycler. DAY 1 Cycle Sequencing: 1. Turn on the thermocycler 2. Dilute templates to recommended concentration. Place on ice. 3. Dilute primers to 3.2 pM/l. Place on ice. 4. Remove Big Dye Terminator Mix from freezer and ICBR mix. Thaw them and keep them on ice. 5. For each reaction, mix the following reag ents in a 0.5 ml microfuge tube: Reagent Quantity Terminator Ready Reaction Mix 2.0 l ICBR nucleotide mix 2.0 l Template ___ l Single-stranded DNA (50-100 ng) Double-stranded DNA (300-500 ng) PCR products (30-90 ng) Primer (3.2 pM/l) 1.0 l Deionized Water bri ng final volume to 10.0 l Final Reaction Volume 10.0 l 6. Place the microfuge tubes in the thermocycler. 7. Use program HAZ1 (PTC-100). When temper ature is over 70C place tubes from ice to thermocycler. HAZ1 Program: 1. Ramp to 96C and hold for 30 seconds (denaturation) Ramp to 50C and hold for 15 seconds (primer annealing) Ramp to 60C and hold for 4 minutes (product extension) 2. Repeat step 1 for 25 cycles 3. Ramp to 4C and hold DAY 2 Purifying Extension Products: 1. For each reaction, prepare a 1.5 ml microfuge tube by adding: 1.0 l 3 M Sodium acetate, pH 4.6 30.0 l 95% cold ethanol 2. Transfer the reaction mix to the ethanol solution. 3. Mix and place on ice for 10 minutes. 4. Centrifuge for 15 minutes. 5. Carefully remove ethanol solution. Be careful not to disturb the pellet. 6. Rinse the pellet with 250 l of 70% ethanol. 264

PAGE 265

265 7. Centrifuge for 3 minutes to make sure the pellet is fixed to the tube. 8. Carefully remove the 70% ethanol. Use a Kimwipe to remove excess ethanol from the sides of the tube. Be very careful not to disturb pellet. 9. Dry the DNA under vacuum for 10 minutes. 10. Store in dark freezer until samples are taken to the sequencing lab.

PAGE 266

LIST OF REFERENCES Adams, A. J. O., and M. J. R. Hall. 2003. Methods used for the killing and preservation of blow fly larvae and their effect on post-mortem larval length. Forens ic. Sci. Int. 138:50 61. Altschul, S.F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990. Basic local alignment search tool. J. Mol. Biol. 215: 403. Ames, C., and B. Turner. 2003. Low temperature episodes in development of blowflies implications for postmortem interval estimation. Med. Vet. Entomol. 17:178. Amendt, J., C. P. Campobasso, E. Gaudry, C. Re iter, H. N. LeBlanc, and M. J. R. Hall. 2006. Best practice in forensic entomology-stan dards and guidelines. Int. J. Legal Med. 121: 90. Anderson, G. S. 1997. The use of insects to determine time of decapitation: A case study from British Columbia. J. Forensic Sci. 42: 947. Anderson, G. S. 1999. Wildlife forensic entomology: Dete rmining time of death in two illegally killed black bear cubs. J. Forensic Sci. 44: 856. Anderson, G. S. 2000. Minimum and maximum developmen t rates of some forensically important Calliphoridae (Diptera). J. Forensic Sci. 45: 824. Archer, M. S. 2004. The effect of time after body discove ry on the accuracy of retrospective weather station ambient temperature corrections in forensic entomology. J. Forensic Sci. 49: 1. Archer, M. S., and M. A. Elgar. 2003a. Yearly activity patterns in southern Victoria (Australia) of seasonally ac tive carrion insects. Fore nsic Sci. Int. 132: 173. Archer, M. S., and M. A. Elgar. 2003b. Effects of decomposition on carcass attendance in a guild of carrion-breeding flies. Med. Vet. Entomol. 17: 263. Arnaldos, M. I., M. D. Garcia, E. Romera, J. J. Presa, and A. Luna. 2005. Estimation of postmortem interval in real cases based on experimenta lly obtained entomological evidence. Forensic Sci. Int. 149: 57. Ash, N., and B. Greenberg. 1975. Developmental temperature response of the sibling species Phaenicia sericata and Phaenicia pallescens Ann. Entomol. Soc. Am. 68: 197. Azeredo-Espin, A. M. L. and N. G. Madeira. 1996. Primary myiasis in dog caused by Phaenicia eximia (Diptera: Calliphorid ae) and preliminary mito chondrial DNA analysis of the species in Brazil. J. Med. Entomol. 33: 839. 266

PAGE 267

Baumgartner, D. L. 1986. The hairy maggot blow fly Chrysomya rufifacies (Macquart) confirmed in Arizona. J. Entomol. Sci. 21: 130. Baumgartner, D. L. 1993. Review of Chrysomya rufifacies (Diptera: Calliphoridae). J. Med. Entomol. 30: 338. Baumgartner, D. L., and B. Greenberg. 1984. The genus Chrysomya (Diptera: Calliphoridae) in the new world. J. Med. Entomol. 21: 105. Benecke, M. 1998a. Six forensic entomology cases: Descri ption and commentary. J. Forensic Sci. 43: 797. Benecke, M. 1998b. Random amplified polymorphic DNA (RAPD) typing of necrophagous insects (Diptera, Coleoptera) in criminal fore nsic studies: validation and use in practice. Forensic Sci. Int. 98: 157. Benecke, M. 2001. A brief history of forensic entomo logy. Forensic Sci. Int. 120: 2. Benecke, M., and L. Barksdale. 2003. Distinction of bloodstain patterns from fly artifacts. Forensic Sci. Int. 137: 152. Benecke, M., and R. Lessig. 2001. Child neglect and forensic en tomology. Forensic Sci. Int. 120: 155. Benecke, M., E. Joseph, and R. Zweihoft. 2004. Neglect of the elderly: forensic entomology cases and considerations. Fo rensic Sci. Int. 146: 195. Boakye, D. A., J. Tang, P. Truc, A. Merriweather, and T. R. Unnasch. 1999. Identification of bloodmeals in haematophagous Diptera by cy tochrome B heteroduplex analysis. Med. Vet. Entomol. 13: 282. Bourel, B., G. Tournel, V. Hedouin, M. Deveaux, M. L. Goff, and D. Gossett. 2001. Morphine extraction in necrophagous insects remains for determining ante-mortem opiate intoxication. Forensic Sci. Int. 120: 127. Butler, J. M., and B. C. Levin. 1998. Forensic applications of mitochondrial DNA. Tritech. April (6): 158. Byrd, J. H. 1995. The effects of temperature on flies of forensic importance in Florida. M. S. Thesis, University of Florida, Gainesville. Byrd, J. H., and J. F. Butler. 1996. Effects of temperature on Cochliomyia macellaria (Diptera: Calliphoridae) developmen t. J. Med. Entomol. 33: 901. Byrd, J. H., and J. F. Butler. 1997. Effects of temperature on Chrysomya rufifacies (Diptera: Calliphoridae) development. J. Med. Entomol. 34: 353. 267

PAGE 268

Byrd, J. H., and J. F. Butler. 1998. Effects of temperature on Sarcophaga haemorrhoidalis (Diptera: Sarcophagidae) development. J. Med. Entomol. 35: 694. Byrd, J. H., and J. C. Allen. 2001. The development of the black blow fly, Phormia regina (Meigen). Forensic Sci. Int. 120: 79. Campobasso, C. P., G. Di Vella, and F. Introna. 2001. Factors affecting decomposition and Diptera colonization. Forensic Sci. Int. 120: 18. Carvalho, L. M. L., and A. X. Linhares. 2001. Seasonality of insect succession and pig carcass decomposition in a natural forest area in s outheastern Brazil. J. Forensic Sci. 46: 604. Carvalho, L. M. L., A. X. Linhares, and J. R. Trigo. 2001. Determination of drug levels and the effect of diazepam on the growth of n ecrophagous flies of forensic importance in southeastern Brazil. Forensic Sci. Int. 120: 140. Carvalho, L. M. L., P. J. Thyssen, A. X Linhares, and F. A. B. Palhares. 2000. A checklist of arthropods associated with pig carrion and human corpse s in southeastern Brazil. Mem. Inst. Oswaldo Cruz. 95: 135. Catts, E. P. and N. H. Haskell. 1990. Entomology and Death a procedural guide. Joyces Print Shop, Clemson, SC. Chen, W. Y., T. H. Hung, and S. F. Shiao. 2004. Molecular identification of forensically important blow fly species (Dip tera: Calliphoridae) in Taiwan. J. Med. Entomol. 41: 47 57. Chow-Shaffer, E., B. Sina, W. A. Hawley, J. De Benedictis, and T. W. Scott. 2000. Laboratory and field evaluation of polymerase chain reaction-based forensic DNA profiling for use in identification of human blood meal sources of A edes aegypti (Diptera: Culicidae). J. Med. Entomol. 37: 492. Cianci, T. J., and J. K. Sheldon. 1990. Endothermic generation by blow fly larvae Phormia regina developing in pig carcasses. Bull. Soc. Vector Ecol. 15: 33. Clark, K., L. Evans, and R. Wall. 2006. Growth rates of the blowfly, Lucilia sericata on different body tissues. Fore nsic Sci. Int. 156: 145. Craighead, L., D. Paetkau, H. V. Reynolds, E. R. Vyse, and C. Strobeck. 1995. Microsatellite analysis of pate rnity and reproduction in Arctic grizzly bears. J. Hered. 86: 255. dAlmeida, J. M. and R. J. Barbosa Salviano. 1996. Feeding preference of the larvae of Chrysomya megacephala (Fabricius) (Diptera : Calliphoridae) and Ravinia belforti (Prado 268

PAGE 269

e Fonseca) (Diptera: Sarcophagidae) concerni ng different diets. Mem. Inst. Oswaldo Cruz. 91: 137. Davidson, J. 1944. On the relationship between temperatur e and rate of development of insects at constant temperatures. J. Anim. Ecol. 13: 26. Davies, L. 1999. Seasonal and spatial changes in blowfly production from small and large carcasses at Durham in lowland northeast England. Med. Vet. Entomol. 13: 245. Davis, J. B., and M. L. Goff. 2000. Decomposition patters in terrestrial and intertidal habitats on Oahu Island and Coconut Island, Hawaii. J. Forensic Sci. 45: 836. del Bianco Faria, L., L. Orsi, L. Apa recida Trinca, and W. A. Conde Godoy. 1999. Larval predation by Chrysomya albiceps on Cochliomyia macellaria, Chrysomya megacephala and Chrysomya putoria. Entomologia Experimentalis et Applicata. 90: 149. Denic, N., D. W. Huyer, S. H. Sinal, P. E. Lantz, C. R. Smith, and M. M. Silver. 1997. Cockroach: The omnivorous scavenger: Po tential misinterpretation of postmortem injuries. Am. J. Forensic Med. Path. 18: 177. Deonier, C. C. 1940. Carcass temperatures and their rela tion to winter bl owfly populations and activity in the sout hwest. J. Econ. Entomol. 33: 166. Dillon, L. C. 1997. Insect succession on carrion in th ree biogeoclimatic zones in British Columbia. Master Thesis, Dept. of Biologi cal Sciences. Simon Fraser University: Burnaby. B. C. Dillon, L. C., and G. S. Anderson. 1996. The use of insects to determine time of death of illegally killed wildlife. Technical report. World Wild life Fund: Toronto, ON. 43. Dillon, L. C., and G. S. Anderson. 1997. Forensic entomology Use of insects towards illegally killed wildlife. T echnical report. World Wildlif e Fund: Toronto, ON. 12. Disney, R. H. L. 2005. Duration of development of two speci es of carrion-bree ding scuttle flies and forensic implications. Med. Vet. Entomol. 19: 229. Dixon, J. D., M. K Oli, M. C. Wooten, T. H. Eason, J. W. McCown, and D. Paetkau. 2006. Effectiveness of a regional corridor in connecting two Florida bl ack bear populations. Cons. Bio. 20: 155. DiZinno, J. A., W. D. Lord, M. B. Collins-Morton, M. R. Wilson, and M. L. Goff. 2002. Mitochondrial DNA sequencing of beetle la rvae (Nitidulidae: Omosita) recovered from human bone. J. Forensic Sci. 47: 1337. 269

PAGE 270

Donovan, S. E., M. J. Hall, B. D. Turner, and C. B. Moncrieff. 2006. Larval growth rates of the blowfly, Calliphora vicina over a range of temperatures. Med. Vet. Entomol. 20: 106. dos Reis, S. F., C. J. von Z uben, and W. A. C. Godoy. 1999. Larval aggregation and competition for food in expe rimental populations of Chrysomya putoria (Weid.) and Cochliomyia macellaria (F.) (Dipt., Calliphoridae). J. Appl. Entomol. 123: 485. Early, M. and M. L. Goff. 1986. Arthropod succession patterns in exposed carrion on the island of Oahu, Hawaiian Islands, USA. J. Med. Entomol. 23: 520. Gagne, R. J. 1981. Chrysomya spp., Old World blow flies (Diptera: Calliphoridae ), recently established in the Americas. ESA Bulletin. 27: 21. Gaudry, E., C. Blais, A. Maria, and C. Dauphin-Villemant. 2006. Study of steroidogenesis in pupae of the forensically important blow fly Protophormia terraenovae (RobineauDesvoidy) (Diptera: Calliphoridae). Forensic Sci. Int. 160: 27. Gill, J. S., W. A. Rowley, P. J. Bush, J. P. Viner, and M. J. R. Gilchrist. 2004. Detection of human blood in the bat tick Carios ( Ornithodoros ) kelleyi (Acari: Argasidae) in Iowa. J. Med. Entomol. 41: 1179. Goddard, J., and P. K. Lago. 1985. Notes on blow fly (Diptera: Calliphoridae) succession on carrion in northern Mississippi. J. Entomol. Sci. 20: 312. Goff, M. L. 1991. Comparison of insect species a ssociated with decomposing remains recovered inside dwellings and outdoors on the island of Oahu, Hawaii. J. Forensic Sci. 36: 748. Goff, M. L. 1992. Problems in estimation of postmortem interval resulting from wrapping of the corpse: A case study from Hawaii. J. Agric. Entomol. 9: 237. Goff, M. L. 1993. Estimation of postmortem interval using arthropod development and successional patterns. Forensic Sci. Rev. 5: 81. Goff, M. L. 2000. A Fly for the Prosecution, Harvard University Press, Cambridge, MA. Goff, M. L., and M. M. Flynn. 1991. Determination of postmortem interval by arthropod succession: A case study from the Hawaiian Islands. J. Forensic Sci. 36: 607. Goff, M. L., and W. D. Lord. 1994. Entomotoxicology. Am. J. Forensic Med. Path. 15: 51 57. Goff, M.L., and C. B. Odom. 1987. Forensic entomology in the Hawaiian Islands: Three case studies. Am. J. Forens ic Med. Path. 8: 45. 270

PAGE 271

Goff, M. L., and B. H. Win. 1997. Estimation of postmortem interval based on colony development time for Anoplolepsis longipes (Hymenoptera: Formicidae). J. Forensic Sci. 42: 1176. Goff, M. L., C. B. Odom, and M. Early. 1986. Estimation of post-mortem interval by entomological techniques: A case study from Oa hu, Hawaii. Bull. Soc. Vector Ecol. 11: 242. Goff, M. L., A. I. Omori, and K. Gunatilake. 1988. Estimation of postmortem interval by arthropod succession: Three case studies from the Hawaiian Islands. Am. J. Forensic Med. Path. 9: 220. Goff, M. L., A. I. Omori, and J. R. Goodbrod. 1989. Effect of cocaine in tissues on the development rate of Boettcherisca peregrine (Diptera: Sarcophagidae). J. Med. Entomol. 26: 91. Goff, M. L., W. A. Brown, K. A. Hewadikaram, and A. I. Omori. 1991a. Effect of heroin in decomposing tissues on the development rate of Boettcherisca peregrine (Diptera, Sarcophagidae) and implications of this e ffect on estimation of postmortem intervals using arthropod development patterns. J. Forensic Sci. 36: 537. Goff, M. L., S. Charbonneau, and W. Sullivan. 1991b. Presence of fecal material in diapers as a potential source of erro r in estimations of postmortem interval using arthropod development rates. J. Forensic Sci. 36: 1603. Goff, M. L., M. L. Miller, J D. Paulson, W. D. Lord, E. Richards, and A. I. Omori. 1997. Effects of 3,4-Methylenedioxymethamphe tamine in decomposing tissues on the development of Parasarcophaga ruficornis (Diptera: Sarcophagidae) and detection of the drug in postmortem blood, liver tissue, larvae, and puparia. J. Forensic Sci. 42: 276 280. Gomes, L., and C. J. von Zuben. 2005. Postfeeding radial dispersal in larvae of Chrysomya albiceps (Diptera: Calliphoridae): implications for forensic entomology. Forensic Sci. Int. 155: 61. Goodbrod, J. R., and M. L. Goff. 1990. Effects of larval popul ation density on rates of development and interactions between two species of Chrysomya (Diptera: Calliphoridae) in laboratory cultur e. J. Med. Entomol. 27: 338. Grassberger, M., and C. Frank. 2003. Temperature-related development of the parasitoid wasp Nasonia vitripennis as forensic indicator. Med. Vet. Entomol. 17: 257. Grassberger, M., and C. Frank. 2004. Initial study of arthropod succession on pig carrion in a central European urban habitat. J. Med. Entomol. 41: 511. Grassberger, M., and C. Reiter. 2001. Effect of temperature on Lucilia sericata (Diptera: Calliphoridae) development w ith special reference to the isomegalenand isomorphendiagram. Forensic Sci. Int. 120: 32. 271

PAGE 272

Grassberger, M., and C. Reiter. 2002a. Effect of temperature on development of Liopygia (= Sarcophaga) argyrostoma (Robineau-Desvoidy) (Dipte ra: Sarcophagidae) and its forensic implications. J. Forensic Sci. 47: 1. Grassberger, M., and C. Reiter. 2002b. Effect of temperature on development of the forensically important holarctic blow fly Protophormia terraenovae (RobineauDesvoidy) (Diptera: Calliphoridae). Forensic Sci. Int. 128: 177. Greenberg, B. 1990. Nocturnal oviposition behavior of blow flies (Diptera: Calliphoridae). J. Med. Entomol. 27: 807. Greenberg, B. 1991. Flies as forensic indicators. J. Med. Entomol. 28: 565. Greenberg, B., and J. C. Kunich. 2002. Entomology and Law: Flies as Forensic Indicators, Cambridge University Press, Cambridge, UK. Greenberg, B., and D. Singh. 1995. Species identification of calliphorid (Diptera) eggs. J. Med. Entomol. 32: 21. Griffiths, A. J. F., J. H. Miller, D. T. Suzuki, R. C. Lewontin, and W. M. Gelbart. 1996. An Introduction to Genetic Analysis, Sixth Ed ition, W. H. Freeman and Company, New York, NY. Gunatilake, K., and M. L. Goff. 1989. Detection of organophosphate poisoning in a putrefying body by analyzing arthropod larv ae. J. Forensic Sci. 34: 714. Hagstrum, D. W., and G. A. Milliken. 1991. Modeling differences in insect development times between constant and fluctuating temp eratures. Ann. Entomol. Soc. Am. 84: 369 379. Hall, R. D. 2001. Introduction: perceptions and status of forensic entomology (1-15), in Forensic Entomology: The Utility of Arth ropods in Legal Investigations J. H Byrd and J. L. Castner, Eds., CRC Press, Boca Raton, FL. Hall, R. D., and K. E. Doisy. 1993. Length of time after deat h: Effect on attraction and oviposition or larviposition of midsummer blow flies (Dipte ra: Calliphoridae) and flesh flies (Diptera: Sarcophagidae) of medicolega l importance in Missouri. Ann. Entomol. Soc. Am. 86: 589. Harvey, M. L. 2005. An alternative for the extraction and storage of DNA from insects in forensic entomology. J. Forensic Sci. 50: 627. Harvey, M. L., I. R. Dado ur and S. Gaudieri. 2003a. Mitochondrial DNA cytochrome oxidase I gene: potential for distinction between immature stages of some forensically important fly species (Diptera) in Western Au stralia. Forensic Sci. Int. 131: 134. 272

PAGE 273

Harvey, M. L., M. W. Mansell, M. H. Villet, and I. R. Dadour. 2003b. Molecular identification of some forensic ally important blowflies of s outhern Africa and Australia. Med. Vet. Entomol. 17: 363. Haskell, N. H., D. G. McShaffrey, D. A. Ha wley, R. E. Williams, and J. E. Pless. 1989. Use of aquatic insects in determining submersi on interval. J. Forensic Sci. 34: 622. Henderson, J. P. 2002. The use of DNA statistics in criminal trials. Forensic Sci. Int. 128: 183. Hewadikaram, K. A., and M. L. Goff. 1991. Effect of carcass size on rate decomposition and arthropod succession patterns. Am. J. Forensic Med. Path. 12: 235. Hogsette, J. A., and F. Washington. 1995. Quantitative mass production of Hydrotaea aenescens (Diptera: Muscidae). J. Econ. Entomol. 88: 1238. Hwang, C., and B. D. Turner. 2005. Spatial and temporal va riability of necrophagous Diptera from urban and rural areas. Med. Vet. Entomol. 19: 379. Introna, Jr, F., B. M. Altamura, A. DellErba, and V. Dattoli. 1989. Time since death definition by experimental reproduction of Lucilia sericata cycles in growth cabinet. J. Forensic Sci. 34: 478. Introna, F., C. P. Campobasso, and M. L. Goff. 2001. Entomotoxicology. Forensic Sci. Int. 120: 42. James, M. T. 1947. The Flies that Cause Myiasis in Man. USDA. Misc. Pub. No. 631. Jobling, M. A., and P. Gill. 2004 Encoded Evidence: DNA in Forensic Analysis. Nature Review, Genetics. 5: 739. Jong, G. D., and W. W. Hoback. 2006. Effect of investigator disturbance in experimental forensic entomology: succession and community composition. Med. Vet. Entomol. 20: 248. Joy, J. E., M. L. Herrell, and P. C. Rogers. 2002. Larval fly activity on sunlit versus shaded raccoon carrion in southwestern West Virginia with special reference to the black blowfly (Diptera: Calliphoridae). J. Med. Entomol. 39: 392. Joy, J. E., N. L. Lisette, and H. L. Harrah. 2006. Carrion fly (Diptera: Calliphoridae) larval colonization of sunlit and shaded pig carcasses in West Virginia, USA. Forensic Sci. Int. 164: 183. Junqueira, A. C. M., A. C. Lessinger, and A. M. Azeredo-Espin. 2002. Methods for the recovery of mitochondrial DNA sequences from museum specimens of myiasis-causing flies. Med. Vet. Entomol. 16: 39. 273

PAGE 274

Komar, D., and O. Beattie. 1998. Postmortem insect activity may mimic perimortem sexual assault clothing patterns. J. Forensic Sci. 43: 792. Lessinger, A. C., and A. M. L. Azeredo-Espin. 2000. Evolution and struct ural organization of mitochondrial DNA control region of myiasis-cau sing flies. Med. Vet. Entomol. 14: 71 80. Levot, G.W., K. R. Brown, and E. Shipp. 1979. Larval growth of some calliphorid and sarcophagid Diptera. Bull. Entomol. Res. 69: 469. Linville, J. G., J. Hayes, and J. D. Wells. 2004. Mitochondrial DNA and STR analyses of maggot crop contents: Effect of specimen preser vation technique. J. Forensic Sci. 49: 1 4. Litjens, P., A. C. Lessinger, and A. M. Lime de Azeredo-Espin. 2001. Characterization of the screwworm flies Cochliomyia hominivorax and Cochliomyia macellaria by PCRRFLP of mitochondrial DNA. Med. Vet. Entomol. 15: 183. Liu, D., and B. Greenberg. 1989. Immature stages of some flies of forensic importance. Ann. Entomol. Soc. Am. 82: 80. Logan, J. A., D. J. Wollkind, S. C. Hoyt, and L. K. Tanigoshi. 1976. An analytical model for description of temperature dependent rate pheno mena in arthropods. Envir. Entomol. 5: 1133. Lord, W. D., and J. F. Burger. 1983. Collection and preservation of forensically important entomological materials. J. Forensic Sci. 28: 936. Lord, W. D., M. L. Goff, T. R. Adkins, and N. H. Haskell. 1994. The black soldier fly Hermetia illucens (Diptera: Stratiomyidae) as a po tential measure of human postmortem interval: Observations and case historie s. J. Forensic Sci. 39: 215. Lynch, M. 2003. Gods signature: DNA profiling, the new gol d standard in forensic science. Endeavour. 27: 93. Malgorn, Y., and R. Coquoz. 1999. DNA typing for identification of some species of Calliphoridae: an interest in forensic entomology. Forensic Sci. Int. 102: 111. Mann, R. W., W. M. Bass, and L. Meadows. 1990. Time since death and decomposition of the human body: Variables and observations in case and experimental field studies. J. Forensic Sci. 35: 103. Marchenko, M. I. 2001. Medicolegal relevanc e of cadaver entomofauna for the determination of the time of death. Forens ic Sci. Int. 120: 89. 274

PAGE 275

Martinez, E., P. Duque, and M. Wolff. 2006. Succession pattern of car rion-feeding insects in Paramo, Colombia. Forensic Sci. Int. 166: 182. Martinez-Sanchez, A., S. Rojo, and M. A. Marcos-Garcia. 2000. Annual and spatial activity of dung flies and carrion in a Mediterranean holm-oak pasture ecosystem. Med. Vet. Entomol. 14: 56. Masuda, R., K. Murata, A. Aiurzaniin, and M. C. Yoshida. 1998. Phylogenetic status of brown bears Ursus arctos of Asia: A preliminary result inferred from mitochondrial DNA control region sequences. Hereditas. 128: 277. Megyesi, M. S., S. P. Nawrocki, and N. H. Haskell. 2005. Using accumulated degree-days to estimate the postmortem interval from decomposed human remains. J. Forensic Sci. 50: 1. Monteiro, A., and N. E. Pierce. 2001. Phylogeny of Bicyclus (Lepidoptera: Nymphalidae) inferred from COI, COII, and EF-1 gene sequences. Mol. Phylo. Evol. 18: 264. Morton, R. J. and W. D. Lord. 2006. Taphonomy of child-sized remains: A study of scattering and scavenging in Virginia USA. J. Forensic Sci. 51: 475. Mullen, G., and L. Durden. 2002. Medical and Veterinary Entomo logy. Elsevier Science, San Diego, CA. Mumcuoglu, K. Y., N. Gallili, A. Re shef, P. Brauner, and H. Grant. 2004. Use of human lice in forensic entomology. J. Med. Entomol. 41: 803. Nabity, P.D., L. G. Higley, and T. M. Heng-Moss. 2006. Effects of temperature on development of Phormia regina (Diptera: Calliphoridae) a nd use of developmental data in determining time intervals in forensic entomology. J. Med. Entomol. 43: 1276. Ngo, K. A., and L. D. Kramer. 2003. Identification of mosquito bloodmeals using polymerase chain reaction (PCR) with order-specific primers. J. Med. Entomol. 40: 215. Nuorteva, P. 1977. Sarcosaprophagous insects as forensic indicators. In Forensic Medicine Ed, C. G. Tedeschi, 3: 1317. Phil adelphia/London/Toronto: Saunder. OFlynn, M. A., and D. E. Morehouse. 1979. Species of Chrysomya as primary flies in carrion. J. Aust. Entomol. Soc. 18: 31. Osvaldo Moura, M., C. J. B. de Carvalho, and E. L. A. Monteiro-Filho. 1997. A preliminary analysis of insects of medico-leg al importance in Curitiba, state of Parana. Mem. Inst. Oswaldo Cruz. 92: 269. Otranto, D., D. Traversa, B. Guida, E. Tarsitano, P. Fiorente, and J. R. Stevens. 2003. Molecular characterization of the mitochondrial cytochrome oxi dase I gene of Oestridae species causing obligate myiasis. Med. Vet. Entomol. 17: 307. 275

PAGE 276

Paetkau, D., and C. Strobeck. 1994. Microsatellite anal ysis of genetic vari ation in black bear populations. Mol. Ecol. 3: 489. Paetkau, D., and Strobeck. 1995. The molecular basis and evolutionary history of a microsatellite null allele in bears. Mol. Ecol. 4: 519. Paetkau, D., W. Calvert, I. Stirling, and C. Strobeck. 1995. Microsatellite analysis of population structure in Canadian pola r bears. Mol. Ecol. 4: 347. Paetkau, D., L. P. Waits, P. L. Clarkson, L. Craighead, and C. Strobeck. 1997. An empirical evaluation of geneti c distance statistics using micr osatellite data from bear (Ursidae) populations. Genetics. 147: 1943. Paetkau, D., L. P. Waits, P. L. Clarkson, L. Cr aighead, E. Vyse, R. Ward, and C. Strobeck. 1998. Variation in genetic dive rsity across the range of Nort h American brown bears. Cons. Bio. 12: 418. Paetkau, D., S. C. Amstrup, E. W. Born, W. Calvert, A. E. Derocher, G. W. Garner, F. Messier, I. Stirling, M. K. Taylor O. Wiig, and C. Strobeck. 1999. Genetic structure of the worlds polar bear populations. Mol. Ecol. 8: 1571. Palo, J., S. L. Varvio, I. Hanski, and R. Vainola. 1995. Developing microsatellite markers for insect population structure: comp lex variation in a checkerspot butterfly. Hereditas. 123: 295. Payne, J. A. 1965. A summer carrion study of the baby pig Sus scrofa Linnaeus. Ecology. 46: 592. Perez, S. P., P. Duque, and M. Wolff. 2005. Successional behavior an d occurrence matrix of carrion-associated arthropods in the urban area of Medellin, Colombia. J. Forensic Sci. 50: 1. Peters, S. L. 2003. The Temperature Variations of Dipt eran Larval Masses Analyzed on Florida Black Bear Carcasses. M. S. Thes is, University of Florida, Gainesville. Pichon, B., D. Egan, M. Rogers, and J. Gray. 2003. Detection and identification of pathogens and host DNA in unfed host-seeking Ixodes ricinus (Acari: Ixodidae). J. Med. Entomol. 40: 723. Prichard, J. G., P. D. Kossoris, R. A. Leibovi tch, L. D. Robertson, and F. W. Lovell. 1986. Implications of Trombiculid mite bites: Repor t of a case and submission of evidence in a murder trial. J. Forensic Sci. 31: 301. 276

PAGE 277

Queiroz, M. M. C. 1996. Temperature requirements of Chrysomya albiceps (Wiedemann, 1819) (Diptera, Calliphoridae) under laborator y conditions. Mem. In st. Oswaldo Cruz. 91: 785. Ratcliffe, S. T., D. W. Webb, R. A. Weinzievr, and H. M. Robertson. 2003. PCR-RFLP identification of Diptera (C alliphoridae, Muscidae, and Sa rcophagidae) A generally applicable method. J. Forensic Sci. 48: 1. Rodriguez, W. C., and W. M. Bass. 1983. Insect activity and its re lationship to decay rates of human cadavers in east Tennessee. J. Forensic Sci. 28: 423. Roehrdanz, R. L., and D. A. Johnson. 1996. Mitochondrial DNA rest riction site map of Cochliomyia macellaria (Diptera: Calliphoridae). J. Med. Entomol. 33: 863. Roon, D. A., M. E. Thomas, K. C. Kendall, and L. P. Waits. 2005. Evaluating mixed samples as a source of error in non-invasive ge netic studies using micr osatellites. Mol. Ecol. 14: 195. Ruiz-Garcia, M. 2003. Molecular population genetic an alysis of the spectacled bear ( Tremarctos ornatus ) in the northern Andean ar ea. Hereditas. 138: 81. Sadler, D. W., C. Fuke, F. Court, and D. J. Pounder. 1995. Drug accumulation and elimination in Calliphora vicina larvae. Forensic Sci. Int. 71: 191. Schoenly, K., and W. Reid. 1987. Dynamics of heterotrophic succession in carrion arthropod assemblages: discrete series or a conti nuum of change? Oeco logia. 73: 192. Schoenly, K., M. L. Goff, and M. Early. 1992. A BASIC algorithm for calculating the postmortem interval from arthropod successiona l data. J. Forensic Sci. 37: 808. Schoenly, K. G., A. S. Shahid, N. H. Haskell, and R. D. Hall. 2005. Does carcass enrichment alter community structure of predaceous and parasitic arthropods? A second test of the arthropod saturation hypothesis at the Anth ropology Research Facility in Knoxville, Tennessee. J. Forensic Sci. 50: 1. Shahid, S. A., R. D. Hall, N. H. Haskell, and R. W. Merritt. 2000. Chrysomya rufifacies (Macquart) (Diptera: Ca lliphoridae) established in the vicinity of Knoxville, Tennessee, USA. J. Forensic Sci. 45: 896. Shahid, S. A., K. Schoenly, N. H. Haskell, R. D. Hall, and W. Zhang. 2003. Carcass enrichment does not alter decay rates or arthropod community structure: A test of the arthropod saturation hypothesis at the Anth ropology Research Facility in Knoxville, Tennessee. J. Med. Entomol. 40: 559. 277

PAGE 278

Shalaby, O. A., L. M. L. deCarvalho, and M. L. Goff. 2000. Comparison of patterns of decomposition in a hanging carcass and a carca ss in contact with soil in a xerophytic habitat on the island of Oahu, Hawaii. J. Forensic Sci. 45: 1267. Shean, B. S., L. Messinger, and M. Papworth. 1993. Observations of differential decomposition on sun exposed v. shaded pig ca rrion in coastal Washington state. J. Forensic Sci. 38: 938. Singh, D., and M. Bharti. 2001. Further observations on the noc turnal oviposition behavior of blow flies (Diptera: Calliphoridae). Forensic Sci. Int. 120: 124. Slone, D. H., and S. V. Gruner. 2007. Thermoregulation in larval aggregations of carrionfeeding blow flies (Diptera: Calliphori dae). J. Med. Entomol. 44: 516523. Smith, K. G. V. 1986. A Manual of Forensic Entomology. Cornell University Press, Ithaca, NY. Soos, A., and L. Papp. 1986. Catalogue of Palaearctic Diptera, vol. 12 Calliphoridae Sarcophagidae. Akademiai Kado. Budapest. Sperling, F. A. H., G. S. Anderson, and D. A. Hickey. 1994. A DNA-based approach to the identification of insect species used for postmortem interval es timation. J. Forensic Sci. 39: 418. Stojanovich, C. J., H. D. Pratt, and E. E. Bennington. 1962. Fly larvae: Key to some species of public health importance, U.S. Department of Health, Education, and Welfare, Public Health Service, Communicable Disease Ce nter, Training Branch, Atlanta, GA. 125 133pp. Sukontason, K. L., K. Sukontason, P. Narong chai, S. Lertthamnongtham, S. Piangjai, and J. K. Olsen. 2001. Chrysomya rufifacies (Macquart) as a forens ically-important fly species in Thailand: A case re port. J. Vect. Eco. 26: 162. Sukontason, K. L., K. Sukontason, S. Lertth amnongtham, B. Kuntalue, N. Thijuk, R. C. Vogtsberger, and J. K. Olson. 2003. Surface ultrastructure of Chrysomya rufifacies (Macquart) larvae (Diptera : Calliphoridae). J. Med. Entomol. 40: 259. Sukontason, K. L., R. C. Vogtsberger, N. Boon chu, T. Chaiwong, D. Sripakdee, R. NgernKlun, S. Piangjal, and K. Sukontason. 2005. Larval morphology of Chrysomya nigripes (Diptera: Calliphoridae), a fly species of forensic importance. J. Med. Entomol. 42: 233. Tabor, K. L., R. D. Fell, and C. C. Brewster. 2005a. Insect fauna visiting carrion in southwest Virginia. Forensic Sci. Int. 150: 73. 278

PAGE 279

Tabor, K. L., R. D. Fell, C. C. Brewster, K. Pelzer, and G. S. Behonick. 2005b. Effects of antemortem ingestion of ethanol on insect successional patterns and development of Phormia regina (Diptera: Calliphoridae). J. Med. Entomol. 42: 481. Tantawi, T. I., and B. Greenberg. 1993. The effect of killing and preservative solutions on estimates of maggot age in forensic cases. J. Forensic Sci. 38: 702. Thyssen, P. J., A. C. Lessinger, A. M. L. Azeredo-Espin, and A. X. Linhares. 2005. The value of PCR-RFLP molecular markers for the differentiation of immature stages of two necrophagous flies (Diptera: Calliphoridae) of potential forensic importance. Neotrop. Entomol. 34: 777. Tomberlin, J. K., D. C. Sheppard, and J. A. Joyce. 2005. Black soldier fly (Diptera: Stratiomyidae) colonization of pig carrion in south Georgia. J. Forensic Sci. 50: 1. Turchetto, M., and S. Vanin. 2004. Forensic entomology and climatic change. Forensic Sci. Int. 146: 207. Vincent, S., J. M. Vian, and M. P. Carlotti. 2000. Partial sequencing of the cytochrome oxydase b subunit gene I: A tool for the identif ication of European sp ecies of blow flies for postmortem interval estimation. J. Forensic Sci. 45: 820. Wagner, T. L., H. Wu, P. J. H. Sharpe, R. M. Schoolfield, and R. N. Coulson. 1984. Modeling insect development rates: A literatu re review and application of a biophysical model. Forum: Ann. Entomol. Soc. Am. 77: 208. Waits, L., P. Taberlet, J. E. Swenson, F. Sandegren, and R. Franzen. 2000. Nuclear DNA microsatellite analysis of genetic diversity a nd gene flow in the Scandinavian brown bear ( Ursus arctos ). Mol. Ecol. 9: 421. Wallman, J. F., and M. Adams. 2001. The forensic application of allozyme electrophoresis to the identification of blowfly larvae (Diptera: Calliphoridae) in Southern Australia. J. Forensic Sci. 46: 681. Wallman, J. F., and S. C. Donnellan. 2001. The utility of mitochondrial DNA sequences for the identification of forens ically important blowflies (Diptera: Call iphoridae) in southeastern Australia. Fo rensic Sci. Int. 120: 60. Wasser, S. K., C. S. Houston, G. M. Koehler, G. G. Cadd, and S. R. Fain. 1997. Techniques for application of faecal DNA methods to fiel d studies of Ursids. Mol. Ecol. 6: 1091 1097. Watson, E. J., and C. E. Carlton. 2003. Spring succession of necrophilous insects on wildlife carcasses in Louisiana. J. Med. Entomol. 40: 338. 279

PAGE 280

Watson, E. J., and C. E. Carlton. 2005. Succession of forensically significant carrion beetle larvae on large carcasses (Coleoptera: Silphid ae). Southeastern Naturalist. 4: 335. Wells, J. D., and B. Greenberg. 1992a. Interaction between Chrysomya rufifacies and Cochliomyia macellaria (Diptera: Calliphoridae): the possible consequences of an invasion. Bull. Entomol. Res. 82: 133. Wells, J. D., and B. Greenberg. 1992b. Laboratory interac tion between introduced Chrysomya rufifacies and native Cochliomyia macellaria (Diptera: Calliphoridae). Environ. Entomol. 21: 640. Wells, J. D., and H. Kurahashi. 1994. Chrysomya megacephala (Fabricius) (Diptera: Calliphoridae) development: Rate, variation and the implications for forensic entomology. Jpn. J. Sanit. Zool. 45: 303. Wells, J. D., and L. R. LaMotte. 1995. Estimating maggot age from weight using inverse prediction. J. Forensic Sci. 40: 585. Wells, J. D., and F. A. H. Sperling. 1999. Molecular phylogeny of Chrysomya albiceps and C. rufifacies (Diptera: Calliphoridae). J. Med. Entomol. 36: 222. Wells, J. D., and F. A. H. Sperling. 2001. DNA-based identification of forensically important Chrysomyinae (Diptera: Ca lliphoridae). Forensic Sci. Int. 120: 110. Wells, J. D., and D. W. Williams. 2007. Validation of a DNA-based method of identifying Chrysomyinae (Diptera: Calliphorida e) used in a death investig ation. Int. J. Legal Med. 121: 1. Wells, J. D., J. H. Byrd, and T. I. Tantawi. 1999. Key to third-instar Chrysomyinae (Diptera: Calliphoridae) from carrion in the continental United States. J. Med. Entomol. 36: 638 641. Wells, J. D., F. Introna, Jr., G. Di Vella, C. P. Campobasso, J. Hayes, and F. A. H. Sperling. 2001a. Human and insect mitochondrial DNA analysis from maggots. J. Forensic Sci. 46: 685. Wells, J. D., T. Pape, and F. A. H. Sperling. 2001b. DNA-based identification and molecular systematics of forensically important Sarcophagi dae (Diptera). J. Forensic Sci. 46: 1098. Williams, H., and A. M. M. Richardson. 1984. Growth energetics in relation to temperature for larvae of four species of necrophagous flies (Diptera: Calliphoridae). Aust. J. Ecol. 9: 141. Wolff, M., A. Uribe, A. Ortiz, and P. Duque. 2001. A preliminary study of forensic entomology in Medellin, Colombia. Forensic Sci. Int. 120: 53. 280

PAGE 281

281 Zane, L., L. Bargelloni, and T. Patarnello. 2002. Strategies of micros atellite isolation: a review. Mol. Ecol. 11: 1. Zehner, R., J. Amendt, and R. Krettek. 2004. STR typing of human D NA from fly larvae fed on decomposing bodies. J. Forensic Sci. 49: 1.

PAGE 282

BIOGRAPHICAL SKETCH Sonja Lise Swiger was born and raised in Lehi gh Acres, located in southwest Florida. She graduated second in her class from Lehigh Senior High School in 1997 and headed to college. Aspiring to be a pediatrician, S onja was soon introduced to the worl d of six legged creatures at Bethany College. Her infatuation with insect s grew during her second year, when she learned about forensic uses of arthropods. Sonja gradua ted with a Bachelor of Science in biology in 2001 and started at the University of Florida En tomology and Nematology department in the fall with a graduate assistantship. She never looked back at medicine after finding her place in forensic entomology. In 2003, Sonja graduated from the University of Florida with a Master of Science in forensic/medical entomology. Upon completion of her MS, Sonja received the Alumni predoctoral fellowship to continue studying for he r doctorate in forensic/medical entomology. 282