The Rice XA21-Binding Protein 25 Is an Ankyrin Repeat-Containing Protein and Required for XA21-Mediated Disease Resistance

Permanent Link: http://ufdc.ufl.edu/UFE0021358/00001

Material Information

Title: The Rice XA21-Binding Protein 25 Is an Ankyrin Repeat-Containing Protein and Required for XA21-Mediated Disease Resistance
Physical Description: 1 online resource (136 p.)
Language: english
Creator: Jiang, Yingnan
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2007


Subjects / Keywords: ankyrin, rice, xa21
Plant Molecular and Cellular Biology -- Dissertations, Academic -- UF
Genre: Plant Molecular and Cellular Biology thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation


Abstract: The rice (Oryza sativa) gene XA21 encodes a receptor-like kinase and confers resistance to specific races of the causal agent of bacterial blight disease, Xanthomonas oryzae pv. oryzae (Xoo). By using yeast two-hybrid screenings, the XA21 binding protein 25 (XB25), containing an ankyrin repeat domain, was identified. XB25 harbors a PEST motif located in the center of the protein and four ankyrin repeats located in the C-terminus. It belongs to a plant-specific-ankyrin-repeat (PANK) family whose members are involved in plant defense/disease resistance pathways. The interaction between XB25 and the truncated version of XA21 spanning the transmembrane domain and the kinase domain (XA21KTM) has been shown in yeast and in vitro, and the association between XB25 and XA21 was further confirmed in planta. Silencing of XB25 in rice results in reduced levels of XA21 and affects XA21-mediated disease resistance, leading to an enhanced susceptibility to the avirulent race of Xoo. In addition, evidentce showed that XB25 was phosphorylated by XA21KTM in vitro. Finally, a yeast two-hybrid library screening identified one XB25-binding protein, PEX19 that is involved in the biosynthesis of peroxisomes. These results indicate that XB25 is required for XA21-mediated disease resistance and provide a link between the PANK family and R gene-mediated disease resistance.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Yingnan Jiang.
Thesis: Thesis (Ph.D.)--University of Florida, 2007.
Local: Adviser: Song, Wen-Yuan.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2007
System ID: UFE0021358:00001

Permanent Link: http://ufdc.ufl.edu/UFE0021358/00001

Material Information

Title: The Rice XA21-Binding Protein 25 Is an Ankyrin Repeat-Containing Protein and Required for XA21-Mediated Disease Resistance
Physical Description: 1 online resource (136 p.)
Language: english
Creator: Jiang, Yingnan
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2007


Subjects / Keywords: ankyrin, rice, xa21
Plant Molecular and Cellular Biology -- Dissertations, Academic -- UF
Genre: Plant Molecular and Cellular Biology thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation


Abstract: The rice (Oryza sativa) gene XA21 encodes a receptor-like kinase and confers resistance to specific races of the causal agent of bacterial blight disease, Xanthomonas oryzae pv. oryzae (Xoo). By using yeast two-hybrid screenings, the XA21 binding protein 25 (XB25), containing an ankyrin repeat domain, was identified. XB25 harbors a PEST motif located in the center of the protein and four ankyrin repeats located in the C-terminus. It belongs to a plant-specific-ankyrin-repeat (PANK) family whose members are involved in plant defense/disease resistance pathways. The interaction between XB25 and the truncated version of XA21 spanning the transmembrane domain and the kinase domain (XA21KTM) has been shown in yeast and in vitro, and the association between XB25 and XA21 was further confirmed in planta. Silencing of XB25 in rice results in reduced levels of XA21 and affects XA21-mediated disease resistance, leading to an enhanced susceptibility to the avirulent race of Xoo. In addition, evidentce showed that XB25 was phosphorylated by XA21KTM in vitro. Finally, a yeast two-hybrid library screening identified one XB25-binding protein, PEX19 that is involved in the biosynthesis of peroxisomes. These results indicate that XB25 is required for XA21-mediated disease resistance and provide a link between the PANK family and R gene-mediated disease resistance.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Yingnan Jiang.
Thesis: Thesis (Ph.D.)--University of Florida, 2007.
Local: Adviser: Song, Wen-Yuan.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2007
System ID: UFE0021358:00001

This item has the following downloads:

Full Text
xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E20101204_AAAABJ INGEST_TIME 2010-12-04T13:35:41Z PACKAGE UFE0021358_00001
88715 F20101204_AABAOK jiang_y_Page_105.jpg
88558 F20101204_AABAOL jiang_y_Page_107.jpg
467999 F20101204_AABAPA jiang_y_Page_023.jp2
78497 F20101204_AABANX jiang_y_Page_060.jpg
84366 F20101204_AABAOM jiang_y_Page_110.jpg
468073 F20101204_AABAPB jiang_y_Page_026.jp2
92877 F20101204_AABANY jiang_y_Page_062.jpg
90917 F20101204_AABAON jiang_y_Page_111.jpg
F20101204_AABAPC jiang_y_Page_027.jp2
88022 F20101204_AABANZ jiang_y_Page_063.jpg
53834 F20101204_AABAOO jiang_y_Page_114.jpg
468070 F20101204_AABAPD jiang_y_Page_029.jp2
41254 F20101204_AABAOP jiang_y_Page_115.jpg
468085 F20101204_AABAPE jiang_y_Page_034.jp2
55289 F20101204_AABAOQ jiang_y_Page_116.jpg
468081 F20101204_AABAPF jiang_y_Page_039.jp2
32554 F20101204_AABAOR jiang_y_Page_117.jpg
94729 F20101204_AABAPG jiang_y_Page_042.jp2
86928 F20101204_AABAOS jiang_y_Page_119.jpg
F20101204_AABAPH jiang_y_Page_047.jp2
40954 F20101204_AABAOT jiang_y_Page_120.jpg
468068 F20101204_AABAPI jiang_y_Page_049.jp2
100674 F20101204_AABAOU jiang_y_Page_125.jpg
467989 F20101204_AABAPJ jiang_y_Page_050.jp2
103417 F20101204_AABAOV jiang_y_Page_128.jpg
468083 F20101204_AABAPK jiang_y_Page_064.jp2
112436 F20101204_AABAOW jiang_y_Page_134.jpg
F20101204_AABAPL jiang_y_Page_066.jp2
165686 F20101204_AABAOX jiang_y_Page_001.jp2
468067 F20101204_AABAQA jiang_y_Page_129.jp2
126130 F20101204_AABAPM jiang_y_Page_075.jp2
468064 F20101204_AABAQB jiang_y_Page_133.jp2
203481 F20101204_AABAPN jiang_y_Page_076.jp2
468087 F20101204_AABAOY jiang_y_Page_009.jp2
277772 F20101204_AABAQC jiang_y_Page_002.tif
467853 F20101204_AABAPO jiang_y_Page_079.jp2
468094 F20101204_AABAOZ jiang_y_Page_010.jp2
353494 F20101204_AABAQD jiang_y_Page_004.tif
263051 F20101204_AABAPP jiang_y_Page_084.jp2
330676 F20101204_AABAQE jiang_y_Page_010.tif
468074 F20101204_AABAPQ jiang_y_Page_095.jp2
281690 F20101204_AABAQF jiang_y_Page_012.tif
351090 F20101204_AABAPR jiang_y_Page_096.jp2
368818 F20101204_AABAQG jiang_y_Page_023.tif
334035 F20101204_AABAPS jiang_y_Page_102.jp2
371032 F20101204_AABAQH jiang_y_Page_028.tif
F20101204_AABAPT jiang_y_Page_111.jp2
373354 F20101204_AABAQI jiang_y_Page_029.tif
F20101204_AABAPU jiang_y_Page_113.jp2
367152 F20101204_AABAQJ jiang_y_Page_032.tif
392803 F20101204_AABAPV jiang_y_Page_114.jp2
369218 F20101204_AABAQK jiang_y_Page_037.tif
228863 F20101204_AABAPW jiang_y_Page_115.jp2
360212 F20101204_AABAQL jiang_y_Page_038.tif
262888 F20101204_AABAPX jiang_y_Page_116.jp2
368238 F20101204_AABARA jiang_y_Page_105.tif
315374 F20101204_AABAQM jiang_y_Page_041.tif
468028 F20101204_AABAPY jiang_y_Page_121.jp2
364722 F20101204_AABARB jiang_y_Page_108.tif
284416 F20101204_AABAQN jiang_y_Page_045.tif
361846 F20101204_AABARC jiang_y_Page_115.tif
371914 F20101204_AABAQO jiang_y_Page_049.tif
F20101204_AABAPZ jiang_y_Page_122.jp2
846458 F20101204_AABARD jiang_y_Page_118.tif
363024 F20101204_AABAQP jiang_y_Page_058.tif
394720 F20101204_AABARE jiang_y_Page_128.tif
373864 F20101204_AABAQQ jiang_y_Page_064.tif
391050 F20101204_AABARF jiang_y_Page_131.tif
372602 F20101204_AABAQR jiang_y_Page_065.tif
298792 F20101204_AABARG jiang_y_Page_136.tif
369070 F20101204_AABAQS jiang_y_Page_066.tif
20496 F20101204_AABARH jiang_y_Page_007.pro
337246 F20101204_AABAQT jiang_y_Page_069.tif
57062 F20101204_AABARI jiang_y_Page_020.pro
171468 F20101204_AABAQU jiang_y_Page_070.tif
53581 F20101204_AABARJ jiang_y_Page_024.pro
112828 F20101204_AABAQV jiang_y_Page_077.tif
54363 F20101204_AABARK jiang_y_Page_025.pro
1989030 F20101204_AABAQW jiang_y_Page_083.tif
55920 F20101204_AABARL jiang_y_Page_030.pro
368502 F20101204_AABAQX jiang_y_Page_085.tif
11629 F20101204_AAAZLA jiang_y_Page_136.QC.jpg
48560 F20101204_AABASA jiang_y_Page_107.pro
53760 F20101204_AABARM jiang_y_Page_031.pro
365012 F20101204_AABAQY jiang_y_Page_092.tif
392328 F20101204_AAAZLB jiang_y_Page_133.tif
51807 F20101204_AABASB jiang_y_Page_108.pro
54693 F20101204_AABARN jiang_y_Page_035.pro
518082 F20101204_AABAQZ jiang_y_Page_100.tif
43798 F20101204_AAAZLC jiang_y_Page_004.pro
49628 F20101204_AABASC jiang_y_Page_109.pro
11164 F20101204_AABARO jiang_y_Page_042.pro
369120 F20101204_AAAZLD jiang_y_Page_057.tif
54166 F20101204_AABASD jiang_y_Page_112.pro
48495 F20101204_AABARP jiang_y_Page_052.pro
726 F20101204_AAAZLE jiang_y_Page_068.txt
10221 F20101204_AABASE jiang_y_Page_115.pro
48431 F20101204_AABARQ jiang_y_Page_053.pro
468066 F20101204_AAAZLF jiang_y_Page_128.jp2
13936 F20101204_AABASF jiang_y_Page_117.pro
56854 F20101204_AABARR jiang_y_Page_065.pro
284570 F20101204_AAAZLG jiang_y_Page_008.tif
F20101204_AAAZKS jiang_y_Page_054.jp2
63677 F20101204_AABASG jiang_y_Page_129.pro
13789 F20101204_AABARS jiang_y_Page_071.pro
374724 F20101204_AAAZLH jiang_y_Page_020.tif
8830 F20101204_AAAZKT jiang_y_Page_079thm.jpg
69717 F20101204_AABASH jiang_y_Page_134.pro
18921 F20101204_AABART jiang_y_Page_080.pro
88684 F20101204_AAAZLI jiang_y_Page_035.jpg
444248 F20101204_AAAZKU jiang_y_Page_074.tif
12659 F20101204_AABASI jiang_y_Page_136.pro
19361 F20101204_AABARU jiang_y_Page_083.pro
108864 F20101204_AAAZLJ jiang_y_Page_127.jpg
11244 F20101204_AAAZKV jiang_y_Page_082.pro
510 F20101204_AABASJ jiang_y_Page_001.txt
17286 F20101204_AABARV jiang_y_Page_084.pro
5562 F20101204_AAAZLK jiang_y_Page_007thm.jpg
2936 F20101204_AAAZKW jiang_y_Page_100.pro
833 F20101204_AABASK jiang_y_Page_007.txt
52813 F20101204_AABARW jiang_y_Page_087.pro
43183 F20101204_AAAZLL jiang_y_Page_012.jp2
30761 F20101204_AAAZKX jiang_y_Page_051.QC.jpg
402 F20101204_AABASL jiang_y_Page_008.txt
46145 F20101204_AABARX jiang_y_Page_088.pro
1529310 F20101204_AAAZMA jiang_y_Page_103.tif
40909 F20101204_AAAZLM jiang_y_Page_089.pro
191032 F20101204_AAAZKY jiang_y_Page_097.jp2
2063 F20101204_AABATA jiang_y_Page_086.txt
132 F20101204_AABASM jiang_y_Page_012.txt
53721 F20101204_AABARY jiang_y_Page_091.pro
10521 F20101204_AAAZMB jiang_y_Page_018thm.jpg
2597662 F20101204_AAAZLN jiang_y.pdf
14461 F20101204_AAAZKZ jiang_y_Page_072.pro
2115 F20101204_AABATB jiang_y_Page_091.txt
2022 F20101204_AABASN jiang_y_Page_013.txt
54630 F20101204_AABARZ jiang_y_Page_106.pro
54644 F20101204_AAAZMC jiang_y_Page_034.pro
511 F20101204_AAAZLO jiang_y_Page_073.txt
2065 F20101204_AABATC jiang_y_Page_093.txt
2232 F20101204_AABASO jiang_y_Page_020.txt
2068 F20101204_AAAZMD jiang_y_Page_095.txt
89144 F20101204_AAAZLP jiang_y_Page_040.jpg
1059 F20101204_AABATD jiang_y_Page_096.txt
2116 F20101204_AABASP jiang_y_Page_021.txt
71713 F20101204_AAAZME jiang_y_Page_009.pro
2150 F20101204_AAAZLQ jiang_y_Page_017.txt
781 F20101204_AABATE jiang_y_Page_098.txt
2136 F20101204_AABASQ jiang_y_Page_023.txt
21830 F20101204_AAAZMF jiang_y_Page_120.pro
371186 F20101204_AAAZLR jiang_y_Page_009.tif
729 F20101204_AABATF jiang_y_Page_102.txt
2191 F20101204_AABASR jiang_y_Page_026.txt
F20101204_AAAZMG jiang_y_Page_049.txt
54364 F20101204_AAAZLS jiang_y_Page_111.pro
2109 F20101204_AABATG jiang_y_Page_113.txt
2164 F20101204_AABASS jiang_y_Page_029.txt
32625 F20101204_AAAZMH jiang_y_Page_128.QC.jpg
51191 F20101204_AAAZLT jiang_y_Page_014.pro
455 F20101204_AABATH jiang_y_Page_115.txt
2140 F20101204_AABAST jiang_y_Page_035.txt
387888 F20101204_AAAZMI jiang_y_Page_129.tif
7781 F20101204_AAAZLU jiang_y_Page_077thm.jpg
2713 F20101204_AABATI jiang_y_Page_128.txt
2236 F20101204_AABASU jiang_y_Page_039.txt
92494 F20101204_AAAZMJ jiang_y_Page_039.jpg
10583 F20101204_AAAZLV jiang_y_Page_017thm.jpg
2512 F20101204_AABATJ jiang_y_Page_130.txt
702 F20101204_AABASV jiang_y_Page_043.txt
4480 F20101204_AAAZMK jiang_y_Page_002thm.jpg
369758 F20101204_AAAZLW jiang_y_Page_087.tif
2677 F20101204_AABATK jiang_y_Page_131.txt
500 F20101204_AABASW jiang_y_Page_045.txt
82576 F20101204_AAAZML jiang_y_Page_109.jpg
8068 F20101204_AAAZLX jiang_y_Page_100thm.jpg
15931 F20101204_AABATL jiang_y_Page_102.QC.jpg
1993 F20101204_AABASX jiang_y_Page_054.txt
7739 F20101204_AAAZMM jiang_y_Page_010thm.jpg
7177 F20101204_AAAZLY jiang_y_Page_103thm.jpg
10618 F20101204_AAAZNA jiang_y_Page_065thm.jpg
6259 F20101204_AABAUA jiang_y_Page_003.QC.jpg
10497 F20101204_AABATM jiang_y_Page_023thm.jpg
1839 F20101204_AABASY jiang_y_Page_060.txt
85163 F20101204_AAAZMN jiang_y_Page_024.jpg
1876 F20101204_AAAZLZ jiang_y_Page_059.txt
2146 F20101204_AAAZNB jiang_y_Page_019.txt
27345 F20101204_AABAUB jiang_y_Page_005.QC.jpg
14413 F20101204_AABATN jiang_y_Page_075.QC.jpg
776 F20101204_AABASZ jiang_y_Page_069.txt
30402 F20101204_AAAZNC jiang_y_Page_090.QC.jpg
2095 F20101204_AAAZMO jiang_y_Page_032.txt
21012 F20101204_AABAUC jiang_y_Page_010.QC.jpg
10762 F20101204_AABATO jiang_y_Page_020thm.jpg
70911 F20101204_AAAZND jiang_y_Page_122.pro
F20101204_AAAZMP jiang_y_Page_055.jp2
10550 F20101204_AABAUD jiang_y_Page_016thm.jpg
10457 F20101204_AABATP jiang_y_Page_106thm.jpg
468096 F20101204_AAAZNE jiang_y_Page_092.jp2
10392 F20101204_AAAZMQ jiang_y_Page_105thm.jpg
30284 F20101204_AABAUE jiang_y_Page_017.QC.jpg
29870 F20101204_AABATQ jiang_y_Page_018.QC.jpg
367056 F20101204_AAAZNF jiang_y_Page_094.tif
50436 F20101204_AAAZMR jiang_y_Page_054.pro
30836 F20101204_AABAUF jiang_y_Page_021.QC.jpg
10268 F20101204_AABATR jiang_y_Page_086thm.jpg
2882 F20101204_AAAZNG jiang_y_Page_009.txt
2077 F20101204_AAAZMS jiang_y_Page_087.txt
10417 F20101204_AABAUG jiang_y_Page_021thm.jpg
30492 F20101204_AABATS jiang_y_Page_055.QC.jpg
14336 F20101204_AAAZNH jiang_y_Page_097.QC.jpg
30358 F20101204_AAAZMT jiang_y_Page_007.jpg
31632 F20101204_AABAUH jiang_y_Page_022.QC.jpg
19647 F20101204_AABATT jiang_y_Page_077.QC.jpg
26593 F20101204_AAAZNI jiang_y_Page_096.pro
309248 F20101204_AAAZMU jiang_y_Page_011.jp2
10434 F20101204_AABAUI jiang_y_Page_027thm.jpg
31957 F20101204_AABATU jiang_y_Page_111.QC.jpg
368548 F20101204_AAAZNJ jiang_y_Page_018.tif
49054 F20101204_AAAZMV jiang_y_Page_096.jpg
10657 F20101204_AABAUJ jiang_y_Page_028thm.jpg
24963 F20101204_AABATV jiang_y_Page_089.QC.jpg
46385 F20101204_AAAZNK jiang_y_Page_101.jpg
1645 F20101204_AAAZMW jiang_y_Page_010.txt
10539 F20101204_AABAUK jiang_y_Page_031thm.jpg
29253 F20101204_AABATW jiang_y_Page_113.QC.jpg
468052 F20101204_AAAZNL jiang_y_Page_091.jp2
362332 F20101204_AAAZMX jiang_y_Page_053.tif
10498 F20101204_AABAUL jiang_y_Page_034thm.jpg
10219 F20101204_AABATX jiang_y_Page_014thm.jpg
233915 F20101204_AAAZOA jiang_y_Page_100.jp2
468060 F20101204_AAAZNM jiang_y_Page_056.jp2
47315 F20101204_AAAZMY jiang_y_Page_072.jpg
7545 F20101204_AABAVA jiang_y_Page_098thm.jpg
20539 F20101204_AABAUM jiang_y_Page_044.QC.jpg
202708 F20101204_AABATY UFE0021358_00001.xml FULL
17823 F20101204_AAAZOB jiang_y_Page_100.QC.jpg
31778 F20101204_AAAZNN jiang_y_Page_020.QC.jpg
5952 F20101204_AAAZMZ jiang_y_Page_099thm.jpg
30622 F20101204_AABAVB jiang_y_Page_105.QC.jpg
31798 F20101204_AABAUN jiang_y_Page_049.QC.jpg
6217 F20101204_AABATZ jiang_y_Page_002.QC.jpg
13857 F20101204_AAAZOC jiang_y_Page_068.pro
46256 F20101204_AAAZNO jiang_y_Page_060.pro
30465 F20101204_AABAVC jiang_y_Page_107.QC.jpg
10361 F20101204_AABAUO jiang_y_Page_051thm.jpg
7264 F20101204_AAAZOD jiang_y_Page_102thm.jpg
56925 F20101204_AAAZNP jiang_y_Page_022.pro
28881 F20101204_AABAVD jiang_y_Page_109.QC.jpg
10069 F20101204_AABAUP jiang_y_Page_058thm.jpg
10356 F20101204_AAAZOE jiang_y_Page_113thm.jpg
14419 F20101204_AAAZNQ jiang_y_Page_083.QC.jpg
10509 F20101204_AABAVE jiang_y_Page_109thm.jpg
31400 F20101204_AABAUQ jiang_y_Page_062.QC.jpg
24291 F20101204_AAAZOF jiang_y_Page_074.QC.jpg
9833 F20101204_AAAZNR jiang_y_Page_081thm.jpg
10808 F20101204_AABAVF jiang_y_Page_111thm.jpg
10759 F20101204_AABAUR jiang_y_Page_064thm.jpg
15483 F20101204_AAAZOG jiang_y_Page_103.QC.jpg
2762 F20101204_AAAZNS jiang_y_Page_127.txt
5904 F20101204_AABAVG jiang_y_Page_117thm.jpg
8935 F20101204_AABAUS jiang_y_Page_067thm.jpg
2222 F20101204_AAAZOH jiang_y_Page_016.txt
468061 F20101204_AAAZNT jiang_y_Page_085.jp2
32104 F20101204_AABAVH jiang_y_Page_123.QC.jpg
23193 F20101204_AABAUT jiang_y_Page_069.QC.jpg
2183 F20101204_AAAZOI jiang_y_Page_040.txt
354915 F20101204_AAAZNU jiang_y_Page_135.jp2
32432 F20101204_AABAVI jiang_y_Page_126.QC.jpg
14833 F20101204_AABAUU jiang_y_Page_071.QC.jpg
7197 F20101204_AAAZOJ jiang_y_Page_045thm.jpg
468062 F20101204_AAAZNV jiang_y_Page_052.jp2
33679 F20101204_AABAVJ jiang_y_Page_133.QC.jpg
7342 F20101204_AABAUV jiang_y_Page_073thm.jpg
4851 F20101204_AAAZOK jiang_y_Page_081.txt
65503 F20101204_AAAZNW jiang_y_Page_067.jpg
11221 F20101204_AABAVK jiang_y_Page_133thm.jpg
23346 F20101204_AABAUW jiang_y_Page_084.QC.jpg
468082 F20101204_AAAZOL jiang_y_Page_061.jp2
108519 F20101204_AAAZNX jiang_y_Page_123.jpg
11092 F20101204_AABAVL jiang_y_Page_134thm.jpg
29794 F20101204_AABAUX jiang_y_Page_086.QC.jpg
7028 F20101204_AAAZOM jiang_y_Page_041thm.jpg
368474 F20101204_AAAZNY jiang_y_Page_033.tif
2129 F20101204_AAAZPA jiang_y_Page_033.txt
17076 F20101204_AABAVM jiang_y_Page_135.QC.jpg
28350 F20101204_AABAUY jiang_y_Page_088.QC.jpg
30789 F20101204_AAAZON jiang_y_Page_136.jpg
468088 F20101204_AAAZNZ jiang_y_Page_038.jp2
370048 F20101204_AAAZPB jiang_y_Page_027.tif
17168 F20101204_AABAUZ jiang_y_Page_098.QC.jpg
74 F20101204_AAAZOO jiang_y_Page_003.txt
86193 F20101204_AAAZPC jiang_y_Page_036.jpg
181554 F20101204_AAAZOP jiang_y_Page_117.jp2
10425 F20101204_AAAZPD jiang_y_Page_107thm.jpg
8856 F20101204_AAAZOQ jiang_y_Page_074thm.jpg
367834 F20101204_AAAZPE jiang_y_Page_047.tif
30390 F20101204_AAAZOR jiang_y_Page_124.QC.jpg
29452 F20101204_AAAZPF jiang_y_Page_119.QC.jpg
768 F20101204_AAAZOS jiang_y_Page_084.txt
414 F20101204_AAAZPG jiang_y_Page_103.txt
468076 F20101204_AAAZOT jiang_y_Page_046.jp2
50181 F20101204_AAAZPH jiang_y_Page_058.pro
325 F20101204_AAAZOU jiang_y_Page_099.txt
618 F20101204_AAAZPI jiang_y_Page_071.txt
899 F20101204_AAAZOV jiang_y_Page_080.txt
9235 F20101204_AAAZPJ jiang_y_Page_084thm.jpg
366732 F20101204_AAAZOW jiang_y_Page_119.tif
124326 F20101204_AAAZPK jiang_y_Page_075.tif
468091 F20101204_AAAZOX jiang_y_Page_020.jp2
468093 F20101204_AAAZPL jiang_y_Page_063.jp2
368638 F20101204_AAAZOY jiang_y_Page_090.tif
10807 F20101204_AAAZQA jiang_y_Page_125thm.jpg
7332 F20101204_AAAZPM jiang_y_Page_011thm.jpg
30637 F20101204_AAAZOZ jiang_y_Page_056.QC.jpg
1969 F20101204_AAAZQB jiang_y_Page_109.txt
29218 F20101204_AAAZPN jiang_y_Page_110.QC.jpg
366302 F20101204_AAAZQC jiang_y_Page_015.tif
10534 F20101204_AAAZPO jiang_y_Page_087thm.jpg
468040 F20101204_AAAZQD jiang_y_Page_132.jp2
9118 F20101204_AAAZPP jiang_y_Page_073.pro
52061 F20101204_AAAZQE jiang_y_Page_119.pro
367986 F20101204_AAAZPQ jiang_y_Page_061.tif
F20101204_AAAZQF jiang_y_Page_085.QC.jpg
30333 F20101204_AAAZPR jiang_y_Page_129.QC.jpg
2132 F20101204_AAAZQG jiang_y_Page_062.txt
396280 F20101204_AAAZPS jiang_y_Page_132.tif
363472 F20101204_AAAZQH jiang_y_Page_052.tif
370934 F20101204_AAAZPT jiang_y_Page_111.tif
53010 F20101204_AAAZQI jiang_y_Page_047.pro
118213 F20101204_AABAAA jiang_y_Page_006.pro
368442 F20101204_AAAZPU jiang_y_Page_017.tif
358196 F20101204_AAAZQJ jiang_y_Page_060.tif
54212 F20101204_AABAAB jiang_y_Page_062.pro
30102 F20101204_AAAZPV jiang_y_Page_066.QC.jpg
27780 F20101204_AAAZQK jiang_y_Page_038.QC.jpg
2265 F20101204_AABAAC jiang_y_Page_065.txt
10573 F20101204_AAAZPW jiang_y_Page_066thm.jpg
10282 F20101204_AAAZRA jiang_y_Page_037thm.jpg
17054 F20101204_AAAZQL jiang_y_Page_011.QC.jpg
1979 F20101204_AABAAD jiang_y_Page_092.txt
577052 F20101204_AAAZPX jiang_y_Page_116.tif
468072 F20101204_AAAZQM jiang_y_Page_030.jp2
29926 F20101204_AABAAE jiang_y_Page_037.QC.jpg
83196 F20101204_AAAZPY jiang_y_Page_058.jpg
13998 F20101204_AAAZRB jiang_y_Page_002.jp2
10585 F20101204_AAAZQN jiang_y_Page_056thm.jpg
F20101204_AABAAF jiang_y_Page_046.tif
1054110 F20101204_AAAZPZ jiang_y_Page_083.jp2
395760 F20101204_AAAZRC jiang_y_Page_127.tif
9991 F20101204_AAAZQO jiang_y_Page_045.pro
2470 F20101204_AABAAG jiang_y_Page_121.txt
22626 F20101204_AAAZRD jiang_y_Page_041.pro
2131 F20101204_AAAZQP jiang_y_Page_112.txt
49809 F20101204_AABAAH jiang_y_Page_048.pro
12831 F20101204_AAAZRE jiang_y_Page_116.pro
327368 F20101204_AAAZQQ jiang_y_Page_114.tif
29379 F20101204_AABAAI jiang_y_Page_054.QC.jpg
10464 F20101204_AAAZRF jiang_y_Page_024thm.jpg
9380 F20101204_AAAZQR jiang_y_Page_089thm.jpg
229672 F20101204_AABAAJ jiang_y_Page_071.jp2
67726 F20101204_AAAZRG jiang_y_Page_133.pro
5775 F20101204_AAAZQS jiang_y_Page_136thm.jpg
15643 F20101204_AAAZRH jiang_y_Page_082.QC.jpg
383784 F20101204_AAAZQT jiang_y_Page_125.tif
398848 F20101204_AABAAK jiang_y_Page_122.tif
468059 F20101204_AAAZRI jiang_y_Page_031.jp2
4490 F20101204_AABABA jiang_y_Page_003thm.jpg
53769 F20101204_AAAZQU jiang_y_Page_021.pro
10551 F20101204_AABAAL jiang_y_Page_070thm.jpg
13073 F20101204_AAAZRJ jiang_y_Page_002.jpg
2092 F20101204_AABABB jiang_y_Page_015.txt
54388 F20101204_AAAZQV jiang_y_Page_066.pro
137335 F20101204_AABAAM jiang_y_Page_078.jp2
56095 F20101204_AAAZRK jiang_y_Page_028.pro
88098 F20101204_AABABC jiang_y_Page_034.jpg
28668 F20101204_AAAZQW jiang_y_Page_014.QC.jpg
23196 F20101204_AABAAN jiang_y_Page_067.QC.jpg
104700 F20101204_AABABD jiang_y_Page_131.jpg
F20101204_AAAZQX jiang_y_Page_057.txt
10504 F20101204_AABAAO jiang_y_Page_095thm.jpg
7334 F20101204_AAAZSA jiang_y_Page_096thm.jpg
26993 F20101204_AAAZRL jiang_y_Page_013.QC.jpg
1914 F20101204_AABABE jiang_y_Page_053.txt
F20101204_AAAZQY jiang_y_Page_057.jp2
F20101204_AABAAP jiang_y_Page_090.txt
F20101204_AAAZSB jiang_y_Page_089.jp2
167 F20101204_AAAZRM jiang_y_Page_100.txt
8413 F20101204_AABABF jiang_y_Page_008.pro
10734 F20101204_AAAZQZ jiang_y_Page_039thm.jpg
53509 F20101204_AABAAQ jiang_y_Page_036.pro
100288 F20101204_AAAZRN jiang_y_Page_005.pro
10788 F20101204_AABABG jiang_y_Page_040thm.jpg
47485 F20101204_AABAAR jiang_y_Page_059.pro
383864 F20101204_AAAZSC jiang_y_Page_130.tif
60488 F20101204_AAAZRO jiang_y_Page_121.pro
10529 F20101204_AABABH jiang_y_Page_110thm.jpg
91672 F20101204_AABAAS jiang_y_Page_049.jpg
16276 F20101204_AAAZSD jiang_y_Page_041.QC.jpg
F20101204_AAAZRP jiang_y_Page_031.txt
50651 F20101204_AABABI jiang_y_Page_038.pro
31298 F20101204_AABAAT jiang_y_Page_029.QC.jpg
F20101204_AAAZSE jiang_y_Page_063.QC.jpg
54853 F20101204_AAAZRQ jiang_y_Page_016.pro
285729 F20101204_AABABJ jiang_y_Page_120.jp2
369190 F20101204_AABAAU jiang_y_Page_005.tif
10587 F20101204_AAAZSF jiang_y_Page_046thm.jpg
1909 F20101204_AAAZRR jiang_y_Page_052.txt
89010 F20101204_AABABK jiang_y_Page_046.jpg
10510 F20101204_AABAAV jiang_y_Page_054thm.jpg
10350 F20101204_AAAZSG jiang_y_Page_085thm.jpg
15761 F20101204_AAAZRS jiang_y_Page_012.jpg
11921 F20101204_AABAAW jiang_y_Page_117.QC.jpg
101047 F20101204_AAAZSH jiang_y_Page_081.jpg
808 F20101204_AAAZRT jiang_y_Page_002.pro
2105 F20101204_AABABL jiang_y_Page_024.txt
173940 F20101204_AABAAX jiang_y_Page_136.jp2
321730 F20101204_AAAZSI jiang_y_Page_011.tif
10152 F20101204_AABACA jiang_y_Page_093thm.jpg
4777 F20101204_AAAZRU jiang_y_Page_006.txt
30717 F20101204_AABABM jiang_y_Page_027.QC.jpg
331104 F20101204_AABAAY jiang_y_Page_007.jp2
49236 F20101204_AAAZSJ jiang_y_Page_092.pro
342524 F20101204_AABACB jiang_y_Page_067.tif
4908 F20101204_AAAZRV jiang_y_Page_008thm.jpg
89945 F20101204_AABABN jiang_y_Page_065.jpg
9744 F20101204_AABAAZ jiang_y_Page_060thm.jpg
89314 F20101204_AAAZSK jiang_y_Page_057.jpg
10181 F20101204_AABACC jiang_y_Page_059thm.jpg
107695 F20101204_AAAZRW jiang_y_Page_081.pro
61165 F20101204_AABABO jiang_y_Page_130.pro
52018 F20101204_AAAZTA jiang_y_Page_042.jpg
F20101204_AAAZSL jiang_y_Page_014.txt
15868 F20101204_AABACD jiang_y_Page_115.QC.jpg
52546 F20101204_AAAZRX jiang_y_Page_093.pro
369086 F20101204_AABABP jiang_y_Page_035.tif
10346 F20101204_AAAZTB jiang_y_Page_119thm.jpg
30447 F20101204_AAAZSM jiang_y_Page_026.QC.jpg
68886 F20101204_AABACE jiang_y_Page_084.jpg
468034 F20101204_AAAZRY jiang_y_Page_051.jp2
10513 F20101204_AABABQ jiang_y_Page_108thm.jpg
374152 F20101204_AAAZTC jiang_y_Page_062.tif
52687 F20101204_AAAZSN jiang_y_Page_095.pro
5337 F20101204_AABACF jiang_y_Page_043.pro
366722 F20101204_AAAZRZ jiang_y_Page_056.tif
2171 F20101204_AABABR jiang_y_Page_046.txt
468004 F20101204_AAAZSO jiang_y_Page_005.jp2
19035 F20101204_AABACG jiang_y_Page_042.QC.jpg
51919 F20101204_AABABS jiang_y_Page_061.pro
369020 F20101204_AAAZTD jiang_y_Page_016.tif
F20101204_AAAZSP jiang_y_Page_037.jp2
1784 F20101204_AABACH jiang_y_Page_004.txt
11047 F20101204_AABABT jiang_y_Page_122thm.jpg
9704 F20101204_AAAZTE jiang_y_Page_013thm.jpg
468035 F20101204_AAAZSQ jiang_y_Page_017.jp2
468075 F20101204_AABACI jiang_y_Page_065.jp2
F20101204_AABABU jiang_y_Page_090thm.jpg
29509 F20101204_AAAZTF jiang_y_Page_058.QC.jpg
43493 F20101204_AAAZSR jiang_y_Page_103.jpg
55754 F20101204_AABACJ jiang_y_Page_026.pro
87731 F20101204_AABABV jiang_y_Page_021.jpg
10352 F20101204_AAAZTG jiang_y_Page_078.QC.jpg
10376 F20101204_AAAZSS jiang_y_Page_048thm.jpg
F20101204_AABACK jiang_y_Page_109.jp2
8236 F20101204_AABABW jiang_y_Page_008.QC.jpg
31149 F20101204_AAAZTH jiang_y_Page_091.QC.jpg
F20101204_AAAZST jiang_y_Page_094.jp2
468080 F20101204_AABACL jiang_y_Page_015.jp2
30619 F20101204_AABABX jiang_y_Page_019.QC.jpg
17998 F20101204_AAAZTI jiang_y_Page_118.pro
10411 F20101204_AABADA jiang_y_Page_063thm.jpg
19880 F20101204_AAAZSU jiang_y_Page_116.QC.jpg
507 F20101204_AABABY jiang_y_Page_076.txt
9260 F20101204_AAAZTJ jiang_y_Page_001.pro
15488 F20101204_AABADB jiang_y_Page_045.QC.jpg
1933 F20101204_AAAZSV jiang_y_Page_051.txt
29499 F20101204_AABACM jiang_y_Page_094.QC.jpg
175578 F20101204_AABABZ jiang_y_Page_081.jp2
263024 F20101204_AAAZTK jiang_y_Page_045.jp2
842 F20101204_AABADC jiang_y_Page_118.txt
10022 F20101204_AAAZSW jiang_y_Page_088thm.jpg
22416 F20101204_AABACN jiang_y_Page_011.pro
468098 F20101204_AAAZTL jiang_y_Page_106.jp2
53309 F20101204_AABADD jiang_y_Page_015.pro
302834 F20101204_AAAZSX jiang_y_Page_117.tif
34441 F20101204_AABACO jiang_y_Page_076.jpg
33112 F20101204_AAAZUA jiang_y_Page_122.QC.jpg
230146 F20101204_AAAZTM jiang_y_Page_073.jp2
413802 F20101204_AABADE jiang_y_Page_044.tif
367260 F20101204_AAAZSY jiang_y_Page_024.tif
61862 F20101204_AABACP jiang_y_Page_125.pro
27771 F20101204_AAAZUB jiang_y_Page_135.pro
369462 F20101204_AAAZTN jiang_y_Page_026.tif
7754 F20101204_AABADF jiang_y_Page_115thm.jpg
1650 F20101204_AAAZSZ jiang_y_Page_074.txt
F20101204_AABACQ jiang_y_Page_090.jp2
41300 F20101204_AAAZUC jiang_y_Page_010.pro
40857 F20101204_AAAZTO jiang_y_Page_045.jpg
52551 F20101204_AABADG jiang_y_Page_113.pro
366558 F20101204_AABACR jiang_y_Page_107.tif
623 F20101204_AAAZUD jiang_y_Page_042.txt
66645 F20101204_AAAZTP jiang_y_Page_128.pro
10733 F20101204_AABADH jiang_y_Page_121thm.jpg
81919 F20101204_AABACS jiang_y_Page_013.jpg
468092 F20101204_AAAZTQ jiang_y_Page_035.jp2
F20101204_AABADI jiang_y_Page_040.jp2
11102 F20101204_AABACT jiang_y_Page_128thm.jpg
365466 F20101204_AAAZUE jiang_y_Page_031.tif
363018 F20101204_AAAZTR jiang_y_Page_109.tif
11134 F20101204_AABADJ jiang_y_Page_123thm.jpg
2057 F20101204_AABACU jiang_y_Page_094.txt
7061 F20101204_AAAZUF jiang_y_Page_104thm.jpg
367910 F20101204_AAAZTS jiang_y_Page_063.tif
468071 F20101204_AABADK jiang_y_Page_028.jp2
263078 F20101204_AABACV jiang_y_Page_074.jp2
F20101204_AAAZUG jiang_y_Page_014.jp2
36846 F20101204_AAAZTT jiang_y_Page_097.jpg
286563 F20101204_AABADL jiang_y_Page_044.jp2
87085 F20101204_AABACW jiang_y_Page_033.jpg
29782 F20101204_AAAZUH jiang_y_Page_036.QC.jpg
359590 F20101204_AABAEA jiang_y_Page_088.tif
9809 F20101204_AAAZTU jiang_y_Page_009thm.jpg
53167 F20101204_AABADM jiang_y_Page_046.pro
23571 F20101204_AABACX jiang_y_Page_101.pro
39733 F20101204_AAAZUI jiang_y_Page_075.jpg
29869 F20101204_AABAEB jiang_y_Page_092.QC.jpg
372142 F20101204_AAAZTV jiang_y_Page_040.tif
98609 F20101204_AABACY jiang_y_Page_129.jpg
10845 F20101204_AAAZUJ jiang_y_Page_130thm.jpg
38442 F20101204_AABAEC jiang_y_Page_104.jpg
263362 F20101204_AAAZTW jiang_y_Page_097.tif
17268 F20101204_AABADN jiang_y_Page_101.tif
10338 F20101204_AABACZ jiang_y_Page_032thm.jpg
87403 F20101204_AAAZUK jiang_y_Page_037.jpg
11017 F20101204_AABAED jiang_y_Page_050thm.jpg
467993 F20101204_AAAZTX jiang_y_Page_036.jp2
51402 F20101204_AABADO jiang_y_Page_135.jpg
228082 F20101204_AAAZVA jiang_y_Page_104.jp2
329798 F20101204_AAAZUL jiang_y_Page_102.tif
7045 F20101204_AABAEE jiang_y_Page_103.pro
8010 F20101204_AAAZTY jiang_y_Page_042thm.jpg
468047 F20101204_AABADP jiang_y_Page_004.jp2
10154 F20101204_AAAZVB jiang_y_Page_052thm.jpg
322496 F20101204_AAAZUM jiang_y_Page_096.tif
11105 F20101204_AABAEF jiang_y_Page_131thm.jpg
30066 F20101204_AAAZTZ jiang_y_Page_114.pro
701 F20101204_AABADQ jiang_y_Page_117.txt
87653 F20101204_AAAZVC jiang_y_Page_019.jpg
2618 F20101204_AAAZUN jiang_y_Page_129.txt
53644 F20101204_AABAEG jiang_y_Page_018.pro
29417 F20101204_AABADR jiang_y_Page_047.QC.jpg
31209 F20101204_AAAZVD jiang_y_Page_030.QC.jpg
364695 F20101204_AAAZUO jiang_y_Page_118.jp2
27237 F20101204_AABAEH jiang_y_Page_060.QC.jpg
468079 F20101204_AABADS jiang_y_Page_021.jp2
13436 F20101204_AAAZVE jiang_y_Page_097.pro
F20101204_AAAZUP jiang_y_Page_048.jp2
50223 F20101204_AABAEI jiang_y_Page_055.pro
370708 F20101204_AABADT jiang_y_Page_106.tif
84711 F20101204_AAAZUQ jiang_y_Page_032.jpg
29556 F20101204_AABAEJ jiang_y_Page_009.QC.jpg
13224 F20101204_AABADU jiang_y_Page_068.QC.jpg
7999 F20101204_AAAZVF jiang_y_Page_083thm.jpg
50199 F20101204_AAAZUR jiang_y_Page_110.pro
366554 F20101204_AABAEK jiang_y_Page_093.tif
7152 F20101204_AABADV jiang_y_Page_012.QC.jpg
6504 F20101204_AAAZVG jiang_y_Page_043thm.jpg
2002 F20101204_AAAZUS jiang_y_Page_038.txt
393686 F20101204_AABAEL jiang_y_Page_126.tif
10251 F20101204_AABADW jiang_y_Page_061thm.jpg
367812 F20101204_AAAZVH jiang_y_Page_113.tif
31790 F20101204_AAAZUT jiang_y_Page_065.QC.jpg
372266 F20101204_AABAEM jiang_y_Page_030.tif
54515 F20101204_AABADX jiang_y_Page_017.pro
F20101204_AAAZVI jiang_y_Page_126thm.jpg
75939 F20101204_AABAFA jiang_y_Page_074.jpg
81261 F20101204_AAAZUU jiang_y_Page_088.jpg
7688 F20101204_AABAEN jiang_y_Page_099.pro
11002 F20101204_AABADY jiang_y_Page_076.pro
10395 F20101204_AAAZVJ jiang_y_Page_015thm.jpg
57268 F20101204_AABAFB jiang_y_Page_039.pro
54386 F20101204_AAAZUV jiang_y_Page_037.pro
86010 F20101204_AABADZ jiang_y_Page_017.jpg
468037 F20101204_AAAZVK jiang_y_Page_124.jp2
10576 F20101204_AABAFC jiang_y_Page_025thm.jpg
53237 F20101204_AAAZUW jiang_y_Page_105.pro
298558 F20101204_AAAZWA jiang_y_Page_099.tif
10354 F20101204_AAAZVL jiang_y_Page_026thm.jpg
102578 F20101204_AABAFD jiang_y_Page_098.tif
722 F20101204_AAAZUX jiang_y_Page_116.txt
2197 F20101204_AABAEO jiang_y_Page_028.txt
468033 F20101204_AAAZWB jiang_y_Page_131.jp2
10476 F20101204_AAAZVM jiang_y_Page_094thm.jpg
11263 F20101204_AABAFE jiang_y_Page_099.QC.jpg
468095 F20101204_AAAZUY jiang_y_Page_060.jp2
105396 F20101204_AABAEP jiang_y_Page_133.jpg
365150 F20101204_AAAZWC jiang_y_Page_110.tif
14251 F20101204_AAAZVN jiang_y_Page_104.pro
53124 F20101204_AABAFF jiang_y_Page_032.pro
86582 F20101204_AAAZUZ jiang_y_Page_056.jpg
10697 F20101204_AABAEQ jiang_y_Page_129thm.jpg
29313 F20101204_AAAZWD jiang_y_Page_024.QC.jpg
85159 F20101204_AAAZVO jiang_y_Page_092.jpg
88468 F20101204_AABAFG jiang_y_Page_027.jpg
7117 F20101204_AABAER jiang_y_Page_135thm.jpg
42965 F20101204_AAAZWE jiang_y_Page_102.jpg
389082 F20101204_AAAZVP jiang_y_Page_123.tif
89063 F20101204_AABAFH jiang_y_Page_055.jpg
195866 F20101204_AABAES jiang_y_Page_068.jp2
2763 F20101204_AAAZWF jiang_y_Page_133.txt
10819 F20101204_AAAZVQ jiang_y_Page_049thm.jpg
65442 F20101204_AABAFI jiang_y_Page_123.pro
2102 F20101204_AABAET jiang_y_Page_036.txt
368064 F20101204_AAAZVR jiang_y_Page_104.tif
968 F20101204_AABAFJ jiang_y_Page_083.txt
30295 F20101204_AABAEU jiang_y_Page_035.QC.jpg
1980 F20101204_AAAZWG jiang_y_Page_058.txt
10446 F20101204_AAAZVS jiang_y_Page_057thm.jpg
719 F20101204_AABAFK jiang_y_Page_104.txt
2045 F20101204_AABAEV jiang_y_Page_061.txt
2047 F20101204_AAAZWH jiang_y_Page_108.txt
9420 F20101204_AAAZVT jiang_y_Page_004thm.jpg
F20101204_AABAFL jiang_y_Page_134.jp2
26360 F20101204_AABAEW jiang_y_Page_044.pro
F20101204_AABAGA jiang_y_Page_006.jp2
52124 F20101204_AAAZVU jiang_y_Page_063.pro
26221 F20101204_AABAFM jiang_y_Page_078.jpg
11086 F20101204_AABAEX jiang_y_Page_001.QC.jpg
367444 F20101204_AAAZWI jiang_y_Page_095.tif
1152 F20101204_AABAGB jiang_y_Page_101.txt
30778 F20101204_AAAZVV jiang_y_Page_112.QC.jpg
2904 F20101204_AABAFN jiang_y_Page_122.txt
7350 F20101204_AABAEY jiang_y_Page_075thm.jpg
370706 F20101204_AAAZWJ jiang_y_Page_025.tif
53341 F20101204_AABAGC jiang_y_Page_057.pro
29480 F20101204_AAAZVW jiang_y_Page_031.QC.jpg
12732 F20101204_AABAFO jiang_y_Page_003.jpg
10903 F20101204_AABAEZ jiang_y_Page_022thm.jpg
367578 F20101204_AAAZWK jiang_y_Page_086.tif
15626 F20101204_AABAGD jiang_y_Page_120.QC.jpg
55412 F20101204_AAAZVX jiang_y_Page_040.pro
54415 F20101204_AAAZXA jiang_y_Page_023.pro
18223 F20101204_AAAZWL jiang_y_Page_072.QC.jpg
F20101204_AABAGE jiang_y_Page_019.jp2
2135 F20101204_AAAZVY jiang_y_Page_025.txt
64195 F20101204_AABAFP jiang_y_Page_077.jpg
17348 F20101204_AAAZXB jiang_y_Page_098.pro
86207 F20101204_AAAZWM jiang_y_Page_093.jpg
F20101204_AABAGF jiang_y_Page_027.txt
28785 F20101204_AAAZVZ jiang_y_Page_081.QC.jpg
10341 F20101204_AABAFQ jiang_y_Page_036thm.jpg
F20101204_AAAZXC jiang_y_Page_086.jp2
85930 F20101204_AAAZWN jiang_y_Page_047.jpg
314562 F20101204_AABAGG jiang_y_Page_071.tif
468021 F20101204_AABAFR jiang_y_Page_053.jp2
30649 F20101204_AAAZXD jiang_y_Page_125.QC.jpg
541 F20101204_AAAZWO jiang_y_Page_136.txt
2111 F20101204_AABAGH jiang_y_Page_119.txt
365758 F20101204_AABAFS jiang_y_Page_054.tif
87753 F20101204_AAAZXE jiang_y_Page_026.jpg
991 F20101204_AAAZWP jiang_y_Page_011.txt
99058 F20101204_AABAGI jiang_y_Page_121.jpg
47684 F20101204_AABAFT jiang_y_Page_079.pro
728 F20101204_AAAZXF jiang_y_Page_003.pro
370266 F20101204_AAAZWQ jiang_y_Page_034.tif
2192 F20101204_AABAGJ jiang_y_Page_050.txt
10658 F20101204_AABAFU jiang_y_Page_029thm.jpg
468039 F20101204_AAAZXG jiang_y_Page_123.jp2
85658 F20101204_AAAZWR jiang_y_Page_113.jpg
F20101204_AABAGK jiang_y_Page_110.jp2
1045718 F20101204_AABAFV jiang_y_Page_082.tif
84539 F20101204_AAAZWS jiang_y_Page_079.jpg
898 F20101204_AABAGL jiang_y_Page_041.txt
18018 F20101204_AABAFW jiang_y_Page_080.QC.jpg
468065 F20101204_AAAZXH jiang_y_Page_032.jp2
25672 F20101204_AAAZWT jiang_y_Page_004.QC.jpg
F20101204_AABAGM jiang_y_Page_016.jp2
13785 F20101204_AABAFX jiang_y_Page_101.QC.jpg
1944 F20101204_AAAZXI jiang_y_Page_107.txt
468089 F20101204_AABAHA jiang_y_Page_059.jp2
100773 F20101204_AAAZWU jiang_y_Page_130.jpg
1971 F20101204_AABAGN jiang_y_Page_055.txt
30174 F20101204_AABAFY jiang_y_Page_034.QC.jpg
82722 F20101204_AAAZXJ jiang_y_Page_053.jpg
33730 F20101204_AABAHB jiang_y_Page_132.QC.jpg
29087 F20101204_AAAZWV jiang_y_Page_053.QC.jpg
F20101204_AABAGO jiang_y_Page_106.txt
389056 F20101204_AABAFZ jiang_y_Page_078.tif
99916 F20101204_AAAZXK jiang_y_Page_005.jpg
69735 F20101204_AABAHC jiang_y_Page_132.pro
67810 F20101204_AAAZWW jiang_y_Page_127.pro
19537 F20101204_AABAGP jiang_y_Page_114.QC.jpg
7762 F20101204_AAAZYA jiang_y_Page_114thm.jpg
F20101204_AAAZXL jiang_y_Page_055thm.jpg
29802 F20101204_AABAHD jiang_y_Page_059.QC.jpg
52709 F20101204_AAAZWX jiang_y_Page_085.pro
2840 F20101204_AAAZYB jiang_y_Page_132.txt
28608 F20101204_AAAZXM jiang_y_Page_052.QC.jpg
367428 F20101204_AABAHE jiang_y_Page_051.tif
468058 F20101204_AAAZWY jiang_y_Page_067.jp2
360504 F20101204_AABAGQ jiang_y_Page_013.tif
388666 F20101204_AAAZYC jiang_y_Page_006.tif
315471 F20101204_AAAZXN jiang_y_Page_082.jp2
113227 F20101204_AABAHF jiang_y_Page_132.jpg
125065 F20101204_AAAZWZ jiang_y_Page_070.pro
2204 F20101204_AABAGR jiang_y_Page_064.txt
1498 F20101204_AAAZYD jiang_y_Page_067.txt
9987 F20101204_AAAZXO jiang_y_Page_006thm.jpg
126982 F20101204_AABAHG jiang_y_Page_077.jp2
51707 F20101204_AABAGS jiang_y_Page_086.pro
15210 F20101204_AAAZYE jiang_y_Page_104.QC.jpg
468057 F20101204_AAAZXP jiang_y_Page_058.jp2
368708 F20101204_AABAHH jiang_y_Page_036.tif
8379 F20101204_AABAGT jiang_y_Page_118thm.jpg
7638 F20101204_AAAZYF jiang_y_Page_072thm.jpg
10358 F20101204_AAAZXQ jiang_y_Page_019thm.jpg
52077 F20101204_AABAHI jiang_y_Page_094.pro
1637 F20101204_AABAGU jiang_y_Page_089.txt
37629 F20101204_AAAZYG jiang_y_Page_067.pro
374508 F20101204_AAAZXR jiang_y_Page_050.tif
55984 F20101204_AABAHJ jiang_y_Page_064.pro
F20101204_AABAGV jiang_y_Page_087.jp2
86535 F20101204_AAAZYH jiang_y_Page_061.jpg
40232 F20101204_AAAZXS jiang_y_Page_071.jpg
F20101204_AABAHK jiang_y_Page_105.jp2
88348 F20101204_AABAGW jiang_y_Page_025.jpg
31579 F20101204_AAAZXT jiang_y_Page_040.QC.jpg
10459 F20101204_AABAHL jiang_y_Page_047thm.jpg
385772 F20101204_AABAGX jiang_y_Page_124.tif
15927 F20101204_AAAZYI jiang_y_Page_073.QC.jpg
1989 F20101204_AABAIA jiang_y_Page_056.txt
2053 F20101204_AAAZXU jiang_y_Page_063.txt
488 F20101204_AABAHM jiang_y_Page_078.txt
85927 F20101204_AABAGY jiang_y_Page_108.jpg
369554 F20101204_AAAZYJ jiang_y_Page_091.tif
262922 F20101204_AABAIB jiang_y_Page_103.jp2
53687 F20101204_AAAZXV jiang_y_Page_090.pro
89136 F20101204_AABAHN jiang_y_Page_051.jpg
4219 F20101204_AABAGZ jiang_y_Page_101thm.jpg
277660 F20101204_AAAZYK jiang_y_Page_003.tif
29836 F20101204_AABAIC jiang_y_Page_023.QC.jpg
10450 F20101204_AAAZXW jiang_y_Page_035thm.jpg
10514 F20101204_AABAHO jiang_y_Page_112thm.jpg
68167 F20101204_AAAZYL jiang_y_Page_126.pro
50569 F20101204_AABAID jiang_y_Page_056.pro
2789 F20101204_AAAZXX jiang_y_Page_126.txt
4808 F20101204_AABAHP jiang_y_Page_012thm.jpg
F20101204_AAAZZA jiang_y_Page_033.jp2
90588 F20101204_AAAZYM jiang_y_Page_112.jpg
55286 F20101204_AABAIE jiang_y_Page_029.pro
F20101204_AAAZXY jiang_y_Page_088.jp2
46779 F20101204_AABAHQ jiang_y_Page_013.pro
2081 F20101204_AAAZZB jiang_y_Page_047.txt
150950 F20101204_AAAZYN jiang_y_Page_099.jp2
30326 F20101204_AABAIF jiang_y_Page_108.QC.jpg
70296 F20101204_AAAZXZ jiang_y_Page_077.pro
31289 F20101204_AAAZZC jiang_y_Page_028.QC.jpg
F20101204_AAAZYO jiang_y_Page_126.jp2
65225 F20101204_AABAIG jiang_y_Page_131.pro
9092 F20101204_AABAHR jiang_y_Page_005thm.jpg
315934 F20101204_AAAZZD jiang_y_Page_068.tif
18211 F20101204_AAAZYP jiang_y_Page_096.QC.jpg
9784 F20101204_AABAIH jiang_y_Page_075.pro
29530 F20101204_AABAHS jiang_y_Page_095.QC.jpg
1195 F20101204_AAAZZE jiang_y_Page_114.txt
1158 F20101204_AAAZYQ jiang_y_Page_135.txt
10314 F20101204_AABAII jiang_y_Page_033thm.jpg
32966 F20101204_AABAHT jiang_y_Page_050.QC.jpg
F20101204_AAAZZF jiang_y_Page_018.jp2
8812 F20101204_AAAZYR jiang_y_Page_044thm.jpg
2145 F20101204_AABAIJ jiang_y_Page_034.txt
19727 F20101204_AABAHU jiang_y_Page_008.jpg
10842 F20101204_AAAZZG jiang_y_Page_091thm.jpg
54324 F20101204_AAAZYS jiang_y_Page_033.pro
31273 F20101204_AABAIK jiang_y_Page_043.jpg
2230 F20101204_AABAHV jiang_y_Page_022.txt
F20101204_AAAZZH jiang_y_Page_127.jp2
F20101204_AAAZYT jiang_y_Page_112.jp2
4158 F20101204_AABAIL jiang_y_Page_005.txt
54302 F20101204_AABAHW jiang_y_Page_049.pro
30564 F20101204_AAAZZI jiang_y_Page_106.QC.jpg
2188 F20101204_AABAJA jiang_y_Page_030.txt
86004 F20101204_AAAZYU jiang_y_Page_031.jpg
82397 F20101204_AABAIM jiang_y_Page_014.jpg
2531 F20101204_AABAHX jiang_y_Page_125.txt
91 F20101204_AABAJB jiang_y_Page_002.txt
11283 F20101204_AAAZYV jiang_y_Page_127thm.jpg
374298 F20101204_AABAIN jiang_y_Page_022.tif
87370 F20101204_AABAHY jiang_y_Page_066.jpg
1389 F20101204_AAAZZJ jiang_y_Page_044.txt
252090 F20101204_AABAJC jiang_y_Page_043.tif
6370 F20101204_AAAZYW jiang_y_Page_076thm.jpg
25153 F20101204_AABAIO jiang_y_Page_079.QC.jpg
2006 F20101204_AABAHZ jiang_y_Page_048.txt
394956 F20101204_AAAZZK jiang_y_Page_134.tif
2176 F20101204_AABAJD jiang_y_Page_105.txt
2139 F20101204_AAAZYX jiang_y_Page_111.txt
10934 F20101204_AABAIP jiang_y_Page_007.QC.jpg
32282 F20101204_AAAZZL jiang_y_Page_131.QC.jpg
31876 F20101204_AABAJE jiang_y_Page_006.QC.jpg
324368 F20101204_AAAZYY jiang_y_Page_135.tif
31114 F20101204_AABAIQ jiang_y_Page_130.QC.jpg
6317 F20101204_AAAZZM jiang_y_Page_068thm.jpg
55578 F20101204_AABAJF jiang_y_Page_050.pro
54639 F20101204_AAAZYZ jiang_y_Page_019.pro
8126 F20101204_AABAIR jiang_y_Page_078.pro
628 F20101204_AAAZZN jiang_y_Page_082.txt
7597 F20101204_AABAJG jiang_y_Page_082thm.jpg
30330 F20101204_AAAZZO jiang_y_Page_087.QC.jpg
97237 F20101204_AABAJH jiang_y_Page_050.jpg
29225 F20101204_AABAIS jiang_y_Page_032.QC.jpg
84461 F20101204_AAAZZP jiang_y_Page_094.jpg
369948 F20101204_AABAJI jiang_y_Page_112.tif
2107 F20101204_AABAIT jiang_y_Page_018.txt
10820 F20101204_AAAZZQ jiang_y_Page_062thm.jpg
10738 F20101204_AABAJJ jiang_y_Page_124thm.jpg
149413 F20101204_AABAIU jiang_y_Page_070.jp2
384246 F20101204_AAAZZR jiang_y_Page_079.tif
375222 F20101204_AABAJK jiang_y_Page_039.tif
160756 F20101204_AABAIV jiang_y_Page_081.tif
30814 F20101204_AAAZZS jiang_y_Page_121.QC.jpg
33503 F20101204_AABAJL jiang_y_Page_134.QC.jpg
29951 F20101204_AABAIW jiang_y_Page_016.QC.jpg
39667 F20101204_AAAZZT jiang_y_Page_073.jpg
7011 F20101204_AABAIX jiang_y_Page_097thm.jpg
29719 F20101204_AABAKA jiang_y_Page_048.QC.jpg
51304 F20101204_AAAZZU jiang_y_Page_118.jpg
F20101204_AABAJM jiang_y_Page_013.jp2
29975 F20101204_AABAIY jiang_y_Page_033.QC.jpg
294840 F20101204_AABAKB jiang_y_Page_007.tif
368718 F20101204_AAAZZV jiang_y_Page_055.tif
1823 F20101204_AABAJN jiang_y_Page_088.txt
2601 F20101204_AABAIZ jiang_y_Page_124.txt
13003 F20101204_AABAKC jiang_y_Page_076.QC.jpg
7852 F20101204_AAAZZW jiang_y_Page_080thm.jpg
468053 F20101204_AABAJO jiang_y_Page_108.jp2
11306 F20101204_AABAKD jiang_y_Page_132thm.jpg
364038 F20101204_AAAZZX jiang_y_Page_014.tif
89979 F20101204_AABAJP jiang_y_Page_090.jpg
2174 F20101204_AABAKE jiang_y_Page_085.txt
362662 F20101204_AAAZZY jiang_y_Page_059.tif
413508 F20101204_AABAJQ jiang_y_Page_080.jp2
133579 F20101204_AABAKF jiang_y_Page_098.jp2
5471 F20101204_AAAZZZ jiang_y_Page_001thm.jpg
3331 F20101204_AABAJR jiang_y_Page_077.txt
201804 F20101204_AABAKG jiang_y_Page_042.tif
313496 F20101204_AABAJS jiang_y_Page_120.tif
382948 F20101204_AABAKH jiang_y_Page_121.tif
468050 F20101204_AABAKI jiang_y_Page_022.jp2
2033 F20101204_AABAJT jiang_y_Page_110.txt
70673 F20101204_AABAKJ jiang_y_Page_089.jpg
347596 F20101204_AABAJU jiang_y_Page_089.tif
31351 F20101204_AABAKK jiang_y_Page_064.QC.jpg
F20101204_AABAJV jiang_y_Page_062.jp2
13118 F20101204_AABAKL jiang_y_Page_003.jp2
34419 F20101204_AABAJW jiang_y_Page_070.QC.jpg
370152 F20101204_AABALA jiang_y_Page_021.tif
86921 F20101204_AABAKM jiang_y_Page_023.jpg
468097 F20101204_AABAJX jiang_y_Page_024.jp2
301057 F20101204_AABALB jiang_y_Page_041.jp2
63023 F20101204_AABAKN jiang_y_Page_124.pro
103616 F20101204_AABAJY jiang_y_Page_124.jpg
6940 F20101204_AABALC jiang_y_Page_071thm.jpg
467983 F20101204_AABAKO jiang_y_Page_093.jp2
871 F20101204_AABAJZ jiang_y_Page_120.txt
31486 F20101204_AABALD jiang_y_Page_039.QC.jpg
297690 F20101204_AABAKP jiang_y_Page_001.tif
F20101204_AABALE jiang_y_Page_119.jp2
43237 F20101204_AABAKQ jiang_y_Page_041.jpg
88797 F20101204_AABALF jiang_y_Page_085.jpg
317840 F20101204_AABAKR jiang_y_Page_073.tif
5742 F20101204_AABALG jiang_y_Page_078thm.jpg
10089 F20101204_AABAKS jiang_y_Page_053thm.jpg
368912 F20101204_AABALH jiang_y_Page_048.tif
F20101204_AABAKT jiang_y_Page_025.jp2
30907 F20101204_AABALI jiang_y_Page_057.QC.jpg
84613 F20101204_AABALJ jiang_y_Page_054.jpg
9997 F20101204_AABAKU jiang_y_Page_038thm.jpg
18895 F20101204_AABALK jiang_y_Page_118.QC.jpg
688 F20101204_AABAKV jiang_y_Page_072.txt
318664 F20101204_AABALL jiang_y_Page_076.tif
90591 F20101204_AABAKW jiang_y_Page_091.jpg
247656 F20101204_AABALM jiang_y_Page_072.jp2
5687 F20101204_AABAKX jiang_y_Page_070.txt
114060 F20101204_AABAMA jiang_y_Page_122.jpg
41154 F20101204_AABALN jiang_y_Page_082.jpg
106653 F20101204_AABAKY jiang_y_Page_126.jpg
34059 F20101204_AABAMB jiang_y_Page_127.QC.jpg
35757 F20101204_AABALO jiang_y_Page_074.pro
29149 F20101204_AABAKZ jiang_y_Page_015.QC.jpg
8727 F20101204_AABAMC jiang_y_Page_069thm.jpg
F20101204_AABALP jiang_y_Page_125.jp2
97316 F20101204_AABAMD jiang_y_Page_009.jpg
47397 F20101204_AABALQ jiang_y_Page_100.jpg
6903 F20101204_AABAME jiang_y_Page_120thm.jpg
49101 F20101204_AABALR jiang_y_Page_051.pro
1949 F20101204_AABAMF jiang_y_Page_079.txt
89441 F20101204_AABALS jiang_y_Page_106.jpg
404 F20101204_AABAMG jiang_y_Page_075.txt
8448 F20101204_AABALT jiang_y_Page_116thm.jpg
10689 F20101204_AABAMH jiang_y_Page_030thm.jpg
F20101204_AABALU jiang_y_Page_069.jp2
364596 F20101204_AABAMI jiang_y_Page_080.tif
54380 F20101204_AABAMJ jiang_y_Page_027.pro
30989 F20101204_AABALV jiang_y_Page_046.QC.jpg
468090 F20101204_AABAMK jiang_y_Page_107.jp2
105745 F20101204_AABALW jiang_y_Page_043.jp2
2839 F20101204_AABAML jiang_y_Page_134.txt
63029 F20101204_AABALX jiang_y_Page_010.jpg
369638 F20101204_AABANA jiang_y_Page_019.tif
129583 F20101204_AABAMM jiang_y_Page_008.jp2
87921 F20101204_AABALY jiang_y_Page_087.jpg
37311 F20101204_AABANB jiang_y_Page_101.jp2
2134 F20101204_AABAMN jiang_y_Page_066.txt
1089714 F20101204_AABALZ jiang_y_Page_084.tif
F20101204_AABANC jiang_y_Page_037.txt
12411 F20101204_AABAMO jiang_y_Page_043.QC.jpg
318584 F20101204_AABAND jiang_y_Page_072.tif
29447 F20101204_AABAMP jiang_y_Page_061.QC.jpg
602 F20101204_AABANE jiang_y_Page_097.txt
13520 F20101204_AABAMQ jiang_y_Page_102.pro
156537 F20101204_AABANF UFE0021358_00001.mets
F20101204_AABAMR jiang_y_Page_130.jp2
74688 F20101204_AABAMS jiang_y_Page_004.jpg
118554 F20101204_AABAMT jiang_y_Page_006.jpg
30163 F20101204_AABANI jiang_y_Page_001.jpg
10323 F20101204_AABAMU jiang_y_Page_092thm.jpg
44805 F20101204_AABANJ jiang_y_Page_011.jpg
29347 F20101204_AABAMV jiang_y_Page_093.QC.jpg
84272 F20101204_AABANK jiang_y_Page_015.jpg
86350 F20101204_AABANL jiang_y_Page_016.jpg
2683 F20101204_AABAMW jiang_y_Page_123.txt
91472 F20101204_AABAOA jiang_y_Page_064.jpg
87005 F20101204_AABANM jiang_y_Page_018.jpg
17902 F20101204_AABAMX jiang_y_Page_069.pro
35372 F20101204_AABAOB jiang_y_Page_068.jpg
91658 F20101204_AABANN jiang_y_Page_020.jpg
2920 F20101204_AABAMY jiang_y_Page_012.pro
66014 F20101204_AABAOC jiang_y_Page_069.jpg
91003 F20101204_AABANO jiang_y_Page_022.jpg
30309 F20101204_AABAMZ jiang_y_Page_025.QC.jpg
128624 F20101204_AABAOD jiang_y_Page_070.jpg
88214 F20101204_AABANP jiang_y_Page_028.jpg
51595 F20101204_AABAOE jiang_y_Page_080.jpg
91483 F20101204_AABANQ jiang_y_Page_029.jpg
40527 F20101204_AABAOF jiang_y_Page_083.jpg
90532 F20101204_AABANR jiang_y_Page_030.jpg
85151 F20101204_AABAOG jiang_y_Page_086.jpg
80684 F20101204_AABANS jiang_y_Page_038.jpg
85574 F20101204_AABAOH jiang_y_Page_095.jpg
59375 F20101204_AABANT jiang_y_Page_044.jpg
48761 F20101204_AABAOI jiang_y_Page_098.jpg
85699 F20101204_AABANU jiang_y_Page_048.jpg
83869 F20101204_AABANV jiang_y_Page_052.jpg
28695 F20101204_AABAOJ jiang_y_Page_099.jpg







2007 Yingnan Jiang

To my Mom and Dad


I would like to acknowledge all the people that ever helped me during my doctoral study. I

would like to give special thanks to my supervisory committee chair Dr. Wen-Yuan Song for his

commitment. During my doctoral work, he never stopped encouraging me to develop

independent thinking and research skills, and helped me with scientific writing.

I feel so lucky to have an exceptional doctoral committee and wish to thank Dr. Alice

Harmon, Dr. Harry Klee, and Dr. Shouguang Jin for their guidance, support, and encouragement

over years.

I also thank all the members of the Song lab, past and present: Dr. Xiaodong Ding who

taught me everything he knows about yeast two-hybrid analyses, Dr. Yongsheng Wang who

helped me with the techniques for co-immunoprecipitation assays, Dr. Weihui Xu who gave me

many suggestions about trans-phosphorylation assays, and Dr. Xiuhua Chen who helped me to

generate transgenic plants. Last but not least, I thank Terry Davoli for her support during my

research and the time she spent in revising my dissertation.

I thank Dr. Mark Settles and Dr. Ken Cline for providing me a chance to do rotations in

their labs. I also want to take this opportunity to thank all the professors who taught me classes

and all people in PMCB who helped me in the past four years.

Finally, I would like to thank my parents and my elder sister. Although they are 6000 miles

away and know nothing about what I am studying, their endless love and support are always the

driving force for me to complete my goal. My thanks always go out for my girlfriend Rui Zhang

who always found a way to cheer me up during the dumpy times.



A C K N O W L ED G M EN T S ...................................................................... ............................ 4

L IST O F T A B L E S ......... ....... ....... ... ..... .............. ............................. ....................8

L IS T O F F IG U R E S .............. ......... ..... ....................................... ..................... ............ ........ ... ...

LIST O F A BBR EV IA TIO N S ......... ................. .............................................. .................... 11

A B S T R A C T ......... ...................... ... ... ..... ....... ............................................. ...13


1 L IT E R A T U R E R E V IE W ......... ...................... ......... ...................................................14

Introduction ........................... .................................................................................. .... ..........14
H ow Plant Pathogens C cause D isease.................................................................. ....................16
P lant D efen se Sy stem s........................................................... ............................................16
PA M P-triggered Im m unity (PTI)................................ .... ........................... ............17
Strategies That Pathogens Employ to Overcome PTI......................................... 22
Effector-triggered Im m unity (ETI).................................................. .................... 26
R proteins in plants .................................. ....... ..... ........ ........... ............ ........ 26
The molecular basis of gene-for-gene interactions ....................................... 28
Downstream signaling components of PTI and ETI..............................................33
B acterial B light D disease of R ice.................................................................. ....................37
X A 21-m ediated disease resistance .................................................. .................... 39
RLK family in plant disease resistance ........................................................40

PRO TEIN X B25 .......... ........ .......... ................... ....... ...... .................. 46

M materials and M methods ........................................................................... ..........................48
Phylogenetic and Sequence Analyses ............................. ..............................48
M olecular Cloning of XBOS25-1 ..................................... ...... ........ ..........49
Construction of BD-XA21KTM, BD-XA21KTM 736E, BD-
XA21KTMS686A/T688A/S689A, BD-Pi-d2KTM, BD-XA21K, AD-XB25, AD-XB25N,
AD-X B25C, and AD-XBOS25-1 ................................................................................50
Preparation of Y east Com petent Cells .................................................. ... ......................52
Co-transformation of Bait and Prey Constructs into Yeast Cells....................................53
Bacterial Expression and Purification of Fusion Proteins.............................................53
Generation and Purification of Antibodies against XB25.............................................55
Creation of the RNAiXB25 Construct .. ...............................56
Generation of Rice RNAiXB25 Transgenic Lines..............................................57
In V itro B in ding A ssay s ........................................ .....................................................58

RN A G eL B lots A ssays................................................................... .................... 59
Im m unodetection of X B 25 .................................................................. ................... 60
R e su lts ................................................................................................................................ 6 1
X B25 is A M em ber of the PAN K Fam ily......................................... .............................61
The N-terminal Region of XB25 is Sufficient for the Interaction with XA21KTM
in Y east ........................................ ........ ............ ....... .................................. 6 2
Physical Interaction between XB25 and XA21KTM in Vitro.........................................62
G generation of Antibodies against X B25 ...................................................................... 63
Down-regulation of XB25 in Transgenic Plants ...........................................................63
Characterization of RNAiXB25 Lines.. .......... ................................... 64

IN XA21-MEDIATED DISEASE RESISTANCE ................................... ....................85

Intro du action .................................................. ........................................... 85
M materials and M methods ............................................... .................................................. 86
Immunodetection of XA21 in Rice ................................... ........ ....................86
C o-im m unoprecipitation ......................................................................... ....................87
Transphosphorylation Assays.................................. ........................... 88
Semi-quantitative RT-PCR.............................. ... .. ..........................88
Generation of Crosses between RNAiXB25 Transgenic Lines and 4021-3 (c-Myc-
X A 2 1/c-M y c-X A 2 1)................................................................................ ....................89
M easurem ent of Bacterial Growth Curve ....................................................................89
Statistical A n aly sis .............. ...... ..................................... .................. .. .................89
R esu lts .................................................................... .......................... 90
XA21 is Associated With XB25 n Planta..............................................................90
XB25 Contributes to the Accumulation of XA21 ..........................................................90
The Resistance to Xoo PR6 is Compromised in Progeny of RNAiXB25/4021-3 with
Reduced Levels of X A 21 and X B25 ..........................................................................91
XB25 is Phosphorylated by XA21KTM in Vitro ........................................................92

SCREENINGS ........................ ......... ............................105

Introduction............ ..................... ......... ....................... 105
M materials and M methods ............................................................................ .................... 107
Construction of BD-XB25, BD-XB25N, and BD-XB25C .......................................... 107
Auto-activation Assays of the HIS3 Reporter Gene.....................................................107
Screening of a Rice Yeast Two-hybrid cDNA Library................................................108
R recovery of Prey Plasm ids................................................................................. .. 109
Transformation of Isolated Prey Plasmids into Escherichia coh ..................................109
V erification of Candidate Interactors ......................................................................... 110
R e su lts ...................................... ................... .. .. ................................. .................... 1 10
Construction of BD-XB25, BD-XB25N, and BD-XB25C bait ................................... 110

Identification ofXB25N and XB25C Interactors Using Yeast Two-Hybrid
S screen in gs ................................. .... .. ... ............. .............. ..................... 111
Verification of Candidate XB25C Interactors in Yeast ...............................................112
D iscu ssion ................................................................................................ 1 13

5 CONCLUSIONS AND FUTURE PERSPECTIVES..........................................................119

LIST O F R EFER EN C E S .................................................... ...............................................121

B IO G R A PH IC A L SK ETC H ............................. .................. ...................................................136


Table page

2-1. Amino acid sequence comparisons of XB25 and related proteins......................................72

4-1. C candidate X B 25C interactors .......................................... ......... ...................................... 117


Figure page

1-1. Main components of the signal transduction pathways in 'innate immunity' in insects
(Drosophila), mammals and plants (Arabidopsis).................. ....................42

1-2. C lasses of R resistance Proteins................................................. ................................... 43

1-3. Plant immune system activation by pathogen effectors .....................................44

1-4. Overview of the local signaling networks controlling activation of local defense
responses.............................. .....................45

2-1. Structure of genomic region of XB25................... ................................................. 68

2-2. Predicted amino acid sequence of XB25 ................................................ ........ ............ 69

2-3. Sequence alignments of XB25 and related proteins from rice (XB25, XBOS-1 and
XBOS-2), Arabidopsis thahana (AKR2 and AtPhos3) and tobacco (TIP1, TIP2 and
TIP3)..... ............... .. .............................. ....................70

2-4. Phylogenetic tree based on the predicted amino acid sequences of XB25 and related
proteins from rice (XB25, XBOS-1 and XBOS-2), Arabidopsis thalana (AKR2 and
AtPhos43) and tobacco (TIP 1, TIP2 and TIP3) .............................. ...... ........................71

2-5. XB25 interacts with XA21KTM in yeast cells.................................................73

2-6. Bacterial expression and purification of different XA21 and XB25 fusion proteins ...........75

2-7. In vitro interaction between XA21KTM and XB25 ................................... .......................76

2-8. Sequence alignments of XB25 and related proteins in rice..................................................77

2-9. Immunodetection of FLAG-XB25 expressed in bacteria by anti-XB25M ..........................78

2-10. Sequence alignments of a region of XB25 used to create RNAiXB25 construct and its
corresponding regions of XBOS25-1 and XBOS25-2............................. .......................79

2-11. Schematic representation of the rice transformation vector used to generate
RN A iXB 25 transgenic lines.. .............................................. ................................... 80

2-12. Schematic representation and alignments of a probe from N-terminus of XB25 used for
N northern blot........................................... ............... ..... .................................. 81

2-13. Identification of RNAiXB25 transgenic lines with reduced XB25 transcripts by
Northern Blot using a probe against eitherXB25 (upper) or GUS-loop (lower). ..............82

2-14. Both transcripts and protein levels of XB25 were reduced in RNAiXB25 transgenic
lines................... .................... .................................... ...................... 83

2-15. RNAiXB25 lines showed no morphological difference with TP309 and both of them
showed comparable amount of susceptibility to Xoo PR6.....................................84

3-1. Immunodetction of ProA-XA21 (A) or c-Myc-XA21 (B).. ........................ .........................97

3-2. XA21 is associated with XB25 in rice.................................... .................... 98

3-3. Schematic representation of the strategy to generate crosses of RNAiXB25 and 4021-3 .....99

3-4. XB25 contributes to the accumulation of XA21 and is involved in XA21-mediated
disease resistance ................ ..... ........................................ 100

3-5. Growth of Xoo PR6 in S34/4021-3-6 and control lines. .......................... ....................102

3-6. Photograph of plants showing lesion development after two week inoculated with Xoo
PR6....................... ............... ................ 103

3-7. XB25 is phosphorylated by XA21KTM in vitro....................................... 104

4-1. Schematic representation of bait constructs used for yeast two-bybrid screening.............15

4-2. Assays for auto-activation of the HIS3 gene .................. ................................................ 116

4-3. Verification of interactions between XB25 and candidate binding proteins........................118

AD domain:

Avr protein:

BD domain:














PR gene:


Pst DC300:




R protein:



activation domain

avirulent protein

DNA binding domain

elongation factor-Tu

effector-triggered immunity

glutathione S-transferase

hypersensitive response



maltose binding protein

nucleotide binding

pathogen-associated molecular patterns


a motif rich of proline, glutamic acid, serine and threonine

peroxisomal biogenesis factor 19

peroxisomal membrane proteins

pathogenicity-related gene

PMAP-triggered immunity

Pseudomonas syrngae pv. tomato DC3000

RPM1-interacting protein 4

receptor-like kinase

reactive oxygen species

resistant protein

type I secretion system




type III secretion system

XA21 cleavage site 1

Xanthomonas oryzae pv. oryzae

Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy



Yingnan Jiang

August 2007

Chair: Wen-Yuan Song
Major: Plant Molecular and Cellular Biology

The rice (Oryza sativa) gene XA21 encodes a receptor-like kinase and confers resistance

to specific races of the causal agent of bacterial blight disease, Xanthomonas oryzae pv. oryzae

(Xoo). By using yeast two-hybrid screenings, the XA21 binding protein 25 (XB25), containing

an ankyrin repeat domain, was identified. XB25 harbors a PEST motif located in the center of

the protein and four ankyrin repeats located in the C-terminus. It belongs to a plant-specific-

ankyrin-repeat (PANK) family whose members are involved in plant defense/disease resistance

pathways. The interaction between XB25 and the truncated version of XA21 spanning the

transmembrane domain and the kinase domain (XA21KTM) has been shown in yeast and in vitro,

and the association between XB25 and XA21 was further confirmed in plant. Silencing of

XB25 in rice results in reduced levels of XA21 and affects XA21-mediated disease resistance,

leading to an enhanced susceptibility to the avirulent race ofXoo. In addition, evidence showed

that XB25 was phosphorylated by XA21KTM in vitro. Finally, a yeast two-hybrid library

screening identified one XB25-binding protein, PEX19 that is involved in the biosynthesis of

peroxisomes. These results indicate that XB25 is required for XA21-mediated disease resistance

and provide a link between the PANK family and R gene-mediated disease resistance.



There are a variety of biotic agents, including viruses, bacteria, fungi, protozoa, and

nematodes, that can impact the health of plants. Some of them can cause plant diseases. Plant

disease is defined as a series of visible or invisible harmful changes in the form, function, and

integrity of healthy plants when they are exposed under favorable conditions to a primary

pathogen (Agrios, 1997). These visible changes in the plant including rots, specks, spots, blights,

wilts, galls, rusts, and cankers make up the symptoms of the disease, and can subsequently result

in host-cell death in roots, leaves, flowers, fruits, and stems.

Plant disease can cause heavy economic losses, which in turn greatly impact human

society. For example, the Irish potato famine of the 1840s, caused by Phytophthora infestans,

resulted in the death of more than one million Irish (Baker et al., 1997). The European grape,

Vitis vinzfera, which has been widely used to produce high quality wines, cannot grow in the

Southeastern United States because of Pierce's disease caused by xylem-inhabiting bacteria.

Recent estimates indicate that plant diseases reduce the worldwide food supply by 10% each year

(Strange and Scott, 2005). With the increase in the world's population and the concomitant

decrease of land available for agriculture, it becomes more important to improve crop production

by protecting crops against plant pathogens.

A number of methods have been developed to defend plants against pathogens. Because of

the great diversity of pathogens, hosts, and the interactions between them, the methods of plant

disease control vary considerably. Based on the technique employed, the methods can be

classified into four categories: regulatory control, chemical control, cultural control, and

biological control (Agrios, 1997). The intent of regulatory control is to keep pathogens away

from a host or a certain geographic area to prevent infections from occurring and potentially

becoming established in this area. It includes inspection of imported plant species, utilizing

pathogen-free propagating materials, and avoidance of pathogen-containing seeds. Chemical

control is used to protect plants that are already, or likely to become, infected by pathogens. It

depends largely on the application of pesticides. Pesticides are efficient in preventing and

controlling the development of some diseases, but are expensive and labor-intensive, and can

cause pesticide-resistant pathogens and environmental contamination. Cultural control aims to

reduce the pathogens that already exist in a plant or in an area where plants are grown, and is

dependent on measures that a grower takes, such as removal of infected plants, crop rotation,

sanitation, and creating conditions unfavorable to pathogens. Biological control relies on

antagonizing pathogens with other organisms. For example, several fungi, such as Trichoderma

harzzanum, are not pathogenic to plants, but do parasitize the mycelia of some plant pathogenic

fungi and inhibit their growth.

All the conventional methods listed above are widely used by growers. However, none of

them is completely effective and most of them are time- and labor-intensive. In recent years,

plant pathologists have focused on the development of less costly and more effective disease

control methods. Genetic engineering of disease-resistant plants is one promising approach. It is

based on the isolation of host genes regulating defense responses from resistant plants and then

transferring such genes into susceptible plants, thereby making them disease resistant. In

combination with conventional methods, this host genetic-based approach is expected to become

one of the most effective and efficient tools to control plant diseases. Hence, studies on plant

disease resistance will help us to understand the fundamental aspects of microbial pathogenesis

and associated host responses, and provide information to plant pathologists who aim to engineer

a greater variety of disease-resistant plants.

How Plant Pathogens Cause Disease

Plant pathogens utilize diverse strategies to colonize their hosts (Chisholm et al., 2006;

Jones and Dangl, 2006). In order to establish disease, most microbes must penetrate the plant's

surface. Viruses and protozoa are delivered directly into plant cells through wounding by such

vectors as thrips or other insects. Pathogenic bacteria enter the plant's intercellular space through

wounds, or through natural openings such as stomata or water pores (hydathodes). Nematodes

and aphids insert their stylets directly into a plant's cells. Fungi penetrate plants either by directly

entering through wounds or by the extension of hyphae on the plant's surface with subsequent

breaching of the cell wall by mechanical force. Once the microbes penetrate the plant's surface,

they invade their hosts in different ways. Viruses and protozoa invade tissue by moving from cell

to cell. Most bacteria invade their host tissue from the intercellular space. Some nematodes

invade hosts intercellularly, while others do not actually invade their hosts at all, but siphon off

nutrition from host cells using their stylets. Most fungi invade cells by extending their hyphae

directly through or between the cells. After invasion, viruses, bacteria, and protozoa colonize

their hosts by reproducing at high rates at the sites of infection. Progeny move to new cells or

tissues through the plasmodesmata (viruses), the phloem (bacteria and protozoa), or xylem (some

bacteria) until the spread of infection is halted or the plant dies. Fungi colonize their hosts by

continuing to branch out within the infected host tissue so that the original fungal pathogen can

spread and infect new tissues.

Plant Defense Systems

Plants protect themselves against pathogens by using a combination of defense systems

based on two elements: (1) structural characteristics that function as physical barriers to prevent

pathogens from penetrating their hosts, and (2) biochemical reactions that produce toxic

chemicals in cells that inhibit the growth of a pathogen. According to whether they exist before

or are triggered after pathogen infection, plant defense systems fall into two groups: pre-existing

structural and chemical defenses, and plant-induced structural and biochemical defenses (Agrios,


Pre-existing structural and chemical defenses consist of structures and chemicals that are

present in plant cells even before the plant is exposed to a pathogen. They include the amount

and quality of wax and cuticle that covers the epidermal cells, the structure of the plant's cell

walls, the size and number of stomata and hydathodes, and some chemical inhibitors that are

continuously produced. Pre-existing structural and chemical defenses act as the first line of

defense to protect a plant against pathogens and exist virtually in all plant species.

Induced structural and chemical defenses are a more important defense system because

they determine the specificity of defense responses. These defenses are initiated by the

recognition of such pathogen-derived elicitors as carbohydrates, fatty acids, and peptides.

Various pathogens, especially bacteria and fungi, release a variety of elicitors, and once plants

recognize them, a series of structural changes and biochemical reactions are activated to defend

the plant against these pathogens. According to the elicitors they recognize, the plant induced

defense systems can be classified into two branches: one is triggered through recognition of

conserved pathogen-derived elicitors, termed pathogen-associated molecular patterns (PAMPs),

the other is activated by the recognition of specific pathogen-derived elicitors, usually referred to

as effectors (Jones and Dangl, 2006).

PAMP-triggered Immunity (PTI)

PAMPs are a heterogeneous set of molecules that are common to many different microbial

species and are indispensable parts of the microbe's lifecycle (Lee et al., 2006). They differ only

slightly from one pathogen to another. Examples of PAMPs include flagellin (a component of

bacterial flagella), peptidoglycan (a complex polymeric material in the walls of gram-positive

bacteria), lipopolysaccharide, cold-shock protein, single-strand RNA, and oomycete

transglutaminase (Dow et al., 2000; Gomez-Gomez and Boller, 2002; Felix and Boller, 2003;

Lee et al., 2006). PAMPs are recognized through host membrane-located receptors and this

recognition initiates a plant PAMP-triggered immunity (PTI). PTI is activated within several

minutes from when plant cells are challenged by microbes and often stops the infection process

before disease can occur (Abramovitch et al., 2006). PTI is also known as basal defense (Kim et

al., 2005).

PTI responses exist in both plants and animals. In plants, the outcome of PTI includes a

series of defense responses, such as the production of reactive oxygen species (ROS) and

ethylene, the increased expression of pathogenesis-related (PR) genes, and the deposition of

callose in the plant's cell walls (Gomez-Gomez et al., 1999). The parallel response of PTI in

animals is regulated by the innate immunity system. Animal innate immunity is also induced by

the recognition of such PAMPs as bacterial lipopolysaccharides and fungal mannans (Kopp et al.,

1999). This recognition triggers inflammatory or pro-inflammatory responses including those of

increased ROS and anti-microbial proteins, and further enables another immune system, referred

to as adaptive immunity. Nevertheless, animal innate immunity cannot prevent the proliferation

of invading bacteria per se (Underhill and Ozinsky, 2000).

Most knowledge about PTI in plants is from the characterization of flagellin, a marker for

the presence of bacteria, and its receptor inArabidopsis thaliana (Felix et al., 1999; G6mez-

G6mez and Boller, 2000). Flagellin is a structural component of bacterial flagella and is

important for bacterial mobility. The N and C termini of flagellin are highly conserved across

eubacteria, which makes it possible for host cells to monitor the presence of bacteria by

recognition of flagellin. Bacterial flagellin represents an ideal PAMP, and indeed is recognized

by various plant species (Felix et al., 1999), Drosophila (Lemaitre et al., 1997), and by mammals

(Sierro et al., 2001). In Arabidopsis, a synthetic peptide corresponding to the most conserved N-

terminus of flagellin, referred to as flg22, was found to be even more active than flagellin in

inducing PTI responses. Thus, it has been used in many studies (Felix et al., 1999; G6mez-

G6mez and Boller, 2002).

To identify the receptors involved in the recognition of flagellin, two approaches, each

based on flg22-induced growth inhibition in Arabidopsis seedlings, have been used. The first

approach was developed from the natural genetic variation found in Arabidopsis. All ecotypes of

Arabidopsis except Ws-0 are sensitive to flg22. This natural genetic variation led G6mez-G6mez

and his co-workers to analyze the F2 progeny derived from crosses of Ws-0 with Col-0 and La-er.

A dominant locus (termed FLS1) conferring sensitivity to flg22 was identified on chromosome V

(G6mez-G6mez et al., 1999). The second approach was to screen ethylmethanesulfonate (EMS)

mutagenized La-er Arabidopsis seedlings to identify mutants that showed no growth inhibition

after treatment with flg22. Several mutants were obtained. All of them were mapped to the same

region as FLS1 located in chromosome V, and were characterized as alleles of a single locus

referred to as FLS2 (G6mez-G6mez and Boller, 2000). Molecular cloning of FLS1 and FLS2 led

to the realization that they are the same gene, which was named FLS2.

FLS2 encodes a receptor-like kinase (RLK). This RLK includes an extracellular leucine-

rich-repeat (LRR) domain that is often involved in protein-protein interactions, a transmembrane

domain, and a cytoplasmic kinase domain (G6mez-G6mez and Boller, 2000). FLS2 is involved

in the recognition of flg22. When Pseudomonas syrmngae pv. tomato DC3000 (Pst DC3000) was

inoculated by spraying directly on the leaves rather than by injecting into the apoplast, the fls2

mutant showed a susceptibility to this pathogenic strain, suggesting that FLS2 probably functions

at an early stage to restrict bacterial invasion (Zipfel et al., 2004). The physical interaction

between flg22 and FLS2 has been demonstrated by immunoprecipitation and chemical cross-

linking, suggesting that FLS2 is a receptor of flg22 (Chinchilla et al., 2005). In addition, tomato

cells heterologously expressing FLS2 gain a recognition system with characteristics of that of

Arabidopsis, supporting the conclusion that FLS2 determines the specificity of the recognition of

flagellin (Chinchilla et al., 2005). Taken together, these data indicate FLS2 is responsible for the

recognition of bacteria flagellin and the activation of PTI.

The FLS2 signaling pathway is well regulated. When studying the localization of an FLS2

fusion protein tagged with a green fluorescence protein (GFP), Boller and colleagues found

FLS2 present in all tissues, accumulating particularly in leaf epidermal cells and stomatal guard

cells, which are primary points of bacterial entry into plant cells. When treated with flg22, FLS2

undergoes internalization (Robatzek et al., 2006). This ligand-induced FLS2 internalization

depends on cytoskeleton and proteasome activity, suggesting that FLS2 is likely targeted for

degradation after flg22-induced internalization. In addition, a transgenic plant carrying the

FLS2T867v mutant protein in which a phosphorylated threonine residue was mutated to valine

exhibits reduced FLS2 67internalization when treated with flg22. Since autophosphorylation of

FLS2 plays an important role in the FLS2-mediated signaling pathway (Gomez-Gomez et al.,

2001), these results suggest that the pathways of FLS2 signaling and FLS2 endocytosis may be

connected. Another critical question, how signals are transduced downstream of FLS2, has been

studied in an examination of the signaling components required to trigger flg22-induced defense

responses in Arabidopsis protoplasts (Asai et al., 2002). In that study, a complete MAP kinase

cascade (MEKK1, MKK4/MKK5, and MPK3/MPK6) and WRKY22/WRKY29 transcription

factors have been shown to function downstream of the FLS2-mediated signaling pathway. In

addition, activation of this MAP kinase cascade enhances resistance to bacteria, supporting the

role of a MAP kinase cascade in plant defense systems. Recent studies of mutant alleles,

however, indicate that MPK4 rather than MPK3/MPK6 is activated by MEKK1 when induced by

flg22 (Ichimura et al., 2006; Suarez-Rodriguez et al., 2006). This discrepancy could be due to

the use of a truncated version of MEKK1 in Asai et al's work. Overexpression of this truncated

protein may inaccurately activate MPK3 and MPK6 in protoplasts.

Another plant PAMP that has been studied is elongation factor-Tu (EF-Tu), the most

abundant protein present in bacterial cells. EF-Tu is highly conserved among all bacteria, and the

first 18 amino acid region, which is N-acetylated (elfl8), is sufficient to induce FLS2-like

defense responses in Arabidopsis (Kunze et al., 2004). By screening an Arabidopsis homozygous

T-DNA-tagged mutant collection for induced LRR-RLKs, a gene encoding an EF-Tu receptor

has been identified and is referred to as EFR (Zipfel et al., 2006). EFR also encodes an RLK and

is responsible for the recognition of elfl8. EFR induces a basal defense response when it is

expressed in Nicotlana benthamiana that is usually not responsive to EF-Tu, suggesting a role of

EFR in the recognition of EF-Tu and activation of PTI. Furthermore, the activation of EFR-

mediated defense responses restricts Agrobacterium transformation. This may lead to a way of

utilizing PAMP receptors to increase the efficiency ofAgrobacternum-based genetic engineering

of certain crops (Abramovitch et al., 2006).

The molecular forms of PTI in plants, Drosophila, and mammals share some common

features (Figure 1-1). In Drosophila, Toll is a gene originally identified in regulating the

establishment of dorsoventral polarity in early embryogenesis, and is also required for the

recognition of microbes and the induction of the innate immunity system (Hashimoto et al.,

1988). The Toll protein consists of an extracellular LRR domain, a transmembrane domain, and

a short intracellular domain. This intracellular domain shares sequence similarity with the

corresponding region of the human interlecukin-1 (IL-1) receptor and is referred to as the

Toll/IL-1R (TIR) domain (Belvin and Anderson, 1996). The TIR domain interacts with pelle

kinase through a protein complex (Hoffmann et al., 2002). In mammals, Toll-like receptors have

also evolved in innate immunity. TLR5, one of the well-studied Toll-like receptors, binds to

bacterial flagellin and mediates innate immunity (Smith et al., 2003). Like Toll, the intracellular

TIR domain of TLR5 interacts with IRAK kinase through a protein adaptor, MyD88 (Hayashi et

al., 2001). The signaling via Toll in Drosophila, and by Toll-like receptors in mammals involves

the dimerization of receptors and proceeds through adaptors to activate downstream kinase

cascades (G6mez-G6mez and Boller, 2002). Once the kinase cascades are activated, Cactus and

IkB (inhibitors of downstream transcript factors Dif and NF- kB in Drosophila and in mammals,

respectively), are degraded, leading to the release of Dif and NF- kB. These are then transported

to the nucleus and initiate expression of related genes (Underhill et al., 2002). FLS2 is an RLK

which is equivalent to the Toll and TLR5 receptor/kinase complexes in both Drosophila and

mammals. This similarity suggests functional and structural parallels between plant PTI and

animal innate immunity. In addition, a MAP kinase cascade is also involved in the signal

amplification in FLS2 pathway, suggesting that a conserved mechanism exists in these pathways.

Well-characterized Toll and Toll-like signaling components will provide a way of identifying the

proteins involved in plant PTI pathways.

Strategies That Pathogens Employ to Overcome PTI

Driven by natural selection, for a microbe to be potentially pathogenic, strategies have

been evolved that enable pathogens to evade PTI. As mentioned previously, PTI is triggered by

the recognition of PAMPs. Avoidance of PAMPs would be a potential strategy for pathogens to

colonize and successfully infect plant tissues. However, most PAMPs have turned out to be

highly conserved and indispensable for pathogen growth and survival. So elimination of these

beneficial agents is not an effective way of evading PTI. Recent studies have shown, however,

that pathogen-secreted effectors play an important role in this process.

Gram-negative bacteria utilize four protein secretion systems to deliver proteins required

for various parts of their lifecycle, such as organelle biogenesis, nutrient acquisition, and

expression of pathogenic effectors (Thanassi et al., 2000). Among these secretion systems, type I

and type III are known to deliver pathogenic effectors. The type I secretion system (TOSS), also

known as an ATP-binding cassette (ABC) protein exporter, consists of three proteins: an inner-

membrane ABC exporter, an inner-membrane fusion protein (MFP) that spans the periplasm, and

an outer-membrane protein (OMP). The MFP works with both the ABC exporter and the OMP to

secrete proteins across membranes to the exterior of bacterial cells. The details of how the

interactions among MFB, ABC exporter and the OMP regulate the protein secretion have not

been elucidated.

The type III secretion system (TTSS) is the best characterized bacterial secretion system.

A number of bacterial pathogens of animals and plants depend on TTSS to deliver pathogenic

effectors into the host cell's cytosol. In plant pathogenic bacteria, the genes encoding TTSS are

termed hypersensitive response and pathogenicity (hrp) genes because these genes were

originally identified in mutants that lost their pathogenicities and were unable to elicit a

hypersensitive response (HR) (Lindgren et al., 1986). HR is a form of cell death localized at the

infected sites that halts the growth and spread of the invading pathogen. The hrp-encoded TTSS

assembles a flagella-based molecular syringe, consisting of two rings that interact with the

cytoplasmic membrane, two rings that interact with the outer membrane, and an extracellular

pilus-like extension (He et al., 2004). The TTSS enables plant pathogens to inject a large number

of effectors directly into the host's cells. A thorough examination of bacterial TTSS effectors

reveals that Pst DC3000 strains deliver more than 20 effectors into host cells by the TTSS

(Chang et al., 2005).

Recent studies have demonstrated that suppression of PTI is one of the major functions of

TTSS effectors. Pst DC3000 strains that are incapable of delivering type III effectors are

nonpathogenic, suggesting that type III effectors help bacteria to become pathogenic, probably

through inhibition of PTI (Lindgren et al., 1986). Furthermore, effectors delivered by the TTSS

ofXanthomonas campestns suppress plant defense responses induced by bacterial

lipopolysaccharide (Keshavarzi et al., 2004), suggesting that bacterial TTSS effectors are critical

in repressing PAMPs-induced defense responses. To date, a large number of type III effectors

that inhibit PTI responses have been identified. For instance, in a screen for Pst DC3000

effectors that inhibit the expression of the flg22-induced NHO1 gene, nine type III effectors have

been found (Li et al., 2005).

TTSS effectors inhibit PTI responses by mimicking or inhibiting some host cellular

activities involved in PTI (Jones and Dangl, 2006). A number of studies have provided insight

into host proteins and signal pathways targeted by type III effectors. AvrPto from Pst DC3000 is

a bacterial type III effector that is delivered to the cytosol of host cells. Overexpression of

AvrPto in Arabidopsis inhibits the expression of cell wall-related genes and suppresses callose

deposition (Hauck et al., 2003). Callose deposition is a PTI-associated response and is induced

by flg22 in a FLS2-dependent manner, so the inhibition of callose deposition in transgenic plants

carrying AvrPto suggests that AvrPto and possibly other type III effectors promote their

pathogenicity by inhibiting PTI. Furthermore, Sheen and her colleagues (2006) demonstrate that

AvrPto suppresses the induction of PAMP-mediated early defense responses, including the

expression of PTI marker-genes and activation of a MAPK signaling pathway (He et al., 2006).

PAMP-mediated early defense responses are quickly induced by both non-pathogenic and

pathogenic bacteria in Arabidopsis. However, these responses are subsequently repressed by Pst

DC3000 carrying AvrPto, suggesting that AvrPto is involved in the inhibition of these defense

responses. In contrast with previous studies, which demonstrate the inhibition of PTI by type III

effectors by measuring of the outcomes in PTI responses, this work provides the first molecular

evidence in support of the notion that suggests early PTI signaling pathways are suppressed by

type III effectors.

AvrRpml and AvrRpt2 are also two type III effectors ofPst DC3000. Both are able to

inhibit PTI responses. Transgenic plants carrying either AvrRpml or AvrRpt2 show enhanced

bacterial growth when infected by a TTSS-deficientPst DC3000 strain (Kim et al., 2005b).

Since this TTSS-deficient strain still contains PAMPs and is able to induce PTI, enhanced

bacterial growth in the AvrRpml or AvrRpt2-carrying plants suggests that these two effectors

contribute to the virulence by inhibiting PTI. In addition, AvrRpml and AvrRpt2 suppress FLS2-

induced callose deposition (Kim et al., 2005b). AvrRpt2 also blocks the accumulation ofPR1,

which is a typical PR gene induced by the treatment of flg22 in Arabidopsis. These results

suggest that both AvrRpml and AvrRpt2 are involved in the suppression of host PTI responses.

To increase their pathogenicity, bacterial type III effectors have also been implicated in the

manipulation of the transcription of host genes. Members of the Xanthomonas AvrBs3 effector

family (such as AvrBs3, AvrXalO, and AvrXa27) share a similar structure with a C-terminal

nucleus localization signal (NLS) and an acidic transcriptional activation domain (AAD).

Removing the AAD domain in AvrXalO or AvrXA27 eliminates the effector's pathogenicity

(Gu et al., 2006). Furthermore, the AAD domain of AvrXalO is capable of activating the

transcription of reporter genes in Arabidopsis and in yeast (Zhu et al., 1998). These findings

imply that members of the AvrBs3 effector family are likely to alter host defense responses by

down-regulating the transcription of host defense-related genes.

Effector-triggered Immunity (ETI)

The evolution of effectors delivered by plant pathogens has led plants to evolve another

sophisticated system of defense. This system is triggered by the direct or indirect recognition of

pathogen race-specific effectors through a class of host proteins, resulting in the activation of a

strong host defense response, referred to as effector-triggered immunity (ETI). The host proteins

that recognize the pathogen effectors are usually referred to as resistance (R) proteins, and the

cognate pathogen-encoded effectors are referred to as avirulant (Avr) proteins.

R proteins in plants

The genes encoding R and Avr proteins were originally identified through genetics studies,

and the pairwise relationship between host R genes and pathogen Avr genes was described as a

gene-for-gene theory (Flor, 1971). It states that "for each gene determining resistance in the host,

there is a corresponding gene for avirulence in the parasite with which it specifically interacts" .

In the presence of R and cognate Avr gene, ETI is triggered, leading to disease resistance.

Conversely, in the absence of either R or Avr gene, the pathogen is able to cause disease.

To date, over 40 R genes have been cloned from a wide range of species. Despite the broad

range of disease resistance conferred by the R genes, most gene products can be classified into

four groups based on their structures (Figure 1-2). The first group includes Pto, which encodes

an intracellular serine/threonine kinase. Pto confers resistance to Pst DC3000 carrying AvrPto

(Martin et al., 1993). The second group of R genes encodes cytoplasmic receptor-like proteins.

The proteins in this group carry a LRR domain and a nucleotide binding (NB) motif (Baker et al.,

1997). The LRR domain consists of 20 to 30 amino acids that are rich of leucine and is often

involved in protein-protein interactions. The NB motif shares sequence similarity with such

corresponding regions of apoptosis regulators such as CED4 from Caenorhabditis elegans and

Apaf-1 from humans (Dangl and Jones, 2001). The members of this group include RPS2, RPM1,

and RPS5 in Arabidopsis, which confers resistance to bacterial pathogen Pst DC3000 carrying

AvrRpt2, AvrRpml, and AvrPphB, respectively; and RPP5 in Arabidopsis, which confers

resistance to the fungus Peronospora parasitica (Noco2) (Baker et al., 1997). This NB-LRR

group forms the largest family of R proteins that has been identified to date. According to their

N-terminal sequences, this group can further be classified into coiled-coil (CC)-NB-LRR and

TIR-NB-LRR subgroups. The TIR domain of TIR-NB-LRR proteins shares sequence similarity

with that of Toll in Drosophila and IL-1R in mammals, suggesting a common origin of plant R

proteins and the proteins in the animal innate immunity. And the third group comprises the

members of the Cffamily, such as Cf-2 and Cf-9 in tomato. These genes encode receptor-like

proteins, including an extracellular LRR domain, a putative transmembrane domain, and a short

intracellular tail. Cfgenes confer resistance to various races of Cladospornumfulvum that cause

leaf mold (Jones et al., 1994; Dixon et al., 1996). The fourth and last group is composed of genes

encoding RLKs that share similar structural features with FLS2. A representative example of this

group is the rice Xa21 gene conferring resistance to Xanthomonas oryzae pv. oryzae (Xoo) (Song

et al., 1995).

Even though the majority of R proteins fall into these four groups, a few additional R gene

products with novel structures have been cloned. For instance, RRS1-R in Arabidopsis confers

resistance to bacterial wilt and encodes a TIR-NB-LRR with a carboxy-terminal nuclear

localization signal and a WRKY transcriptional activation domain (Deslandes et al., 2003). The

resistance gene in rice, Xa27, confers resistance to Xoo and encodes a protein that does not

belong to any of the four above-mentioned groups (Gu et al., 2005).

The molecular basis of gene-for-gene interactions

Two models have been proposed to explain how plant R proteins recognize pathogen Avr

proteins. The first model is known as the ligand-receptor model. This model proposes that R

proteins are directly bound to Avr proteins to trigger downstream defense responses. Three

studies provide experimental evidence to support this model. The first study demonstrates that

the tomato Pto kinase interacts with the corresponding AvrPto in a yeast two-hybrid system

(Tang et al., 1996). The second study proves that the rice resistance protein Pi-ta interacts with

the cognate Avrpita protein in yeast and in vitro (Jia et al., 2000). The third study shows that

RRS1-R interacts with a cognate Avr protein, PopP2, in a yeast split-ubiquitin two-hybrid

system, and both are co-localized in the nucleus (Deslandes et al., 2003). However, attempts to

find more evidence to support the ligand-receptor model have failed despite considerable efforts

by various investigators. The lack of additional evidence to support the receptor-ligand model,

especially in vivo evidence, tends to lend more support to an alternative model that is known as

the guard model.

The guard model hypothesizes that, instead of direct binding, the R gene product functions

as a sensor to detect the interactions between Avr proteins and their host targets (guardees). Once

the host targets are manipulated by the pathogen Avr proteins, the R proteins can "guard" the

change in status of the host targets and activate the defense responses. The first experimental

evidence supporting the indirect R-Avr association comes from the work of Mackey and his

colleagues (2002). In this study, an Arabidopsis protein named RPM1 interacting protein 4

(RIN4) was found to be required for RPM1-mediated disease resistance. RIN4 is a 211-amino-

acid acylated and plasma-membrane-associated protein. Overexpression of RIN4 in Arabidopsis

reduces flg22-induced callose depositon and enhances the growth of TTSS-deficient bacteria,

indicating that RIN4 plays a negative role in PTI. RIN4 is phosphorylated in the presence of

AvrB or AvrRpml (Mackey et al., 2002), suggesting that AvrB or AvrRpml may increase their

virulence by enhancing the activity of RIN4 as a negative regulator of PTI through

phosphorylation. RIN4 interacts with both RPM1 and AvrB or AvrRpml inplanta, and

contributes to the accumulation of RPM 1. It is hypothesized that RPM1 guards the

phosphorylation of RIN4 caused by AvrB or AvrRpml, and activates the downstream defense

pathway. This phosphorylation may act as a switch to turn on RPM1-mediated disease resistance.

Two other independent studies have demonstrated that RIN4 also regulates another NB-

LRR resistance protein, RPS2, that confers resistance to Pst DC3000 carrying AvrRpt2 (Axtell et

al., 2003; Mackey et al., 2003). Overexpression of RIN4 compromises RPS2-mediated HR

response and subsequent disease resistance, suggesting that RIN4 plays a negative role in RPS2-

mediated disease resistance. RIN4 associates with RPS2 in plant. The C-terminal, plasma

membrane-associated domain of RIN4 is required for the association of RIN4 with RPS2 and is

involved in the negative regulation of RPS2-mediated signaling (Day et al., 2005; Kim et al.,

2005a). RIN4 is degraded when plants are infected by Pst DC3000 carrying AvrRpt2 (Mackey et

al., 2003). The degradation of RIN4 is believed to be processed through AvrRpt2, a cysteine

protease that cleaves a conserved peptide sequence VPxFGxW and its protease activity is

essential for virulence. AvrRpt2 is delivered to the plant cell as an inactive precursor, and is

processed into an active enzyme by eukaryotic cyclophilins (Coaker et al., 2005). RIN4

possesses two regions that share homology with the AvrRpt2 cleavage motif, and both of them

have been shown to be cleaved by AvrRpt2, indicating that RIN4 is a direct substrate of AvrRpt2

protease. Thus, it is possible that the activation of RPS2-mediated disease resistance is carried

out through perception of the disappearance of RIN4 by RPS2. In the absence of RPS2, AvrRps2

targets RIN4 or possibly other components to suppress PTI. However, in the presence of RPS2,

the perturbation of RIN4 is guarded by RPS2 and the disease-resistance pathway is then

activated. This research suggests that RIN4 appears to be a central molecular switch that

regulates at least two independent R protein-mediated disease-resistance pathways and PTI-

signaling pathways in Arabidopsis. The activation of ETI occurs when there is a perceived

change in the state of RIN4 by RPM1 or RPS2. In contrast, AvrRPM1 and AvrRpt2 promote

their virulence by manipulating RIN4 in the absence of cognate R proteins, which further results

in the inhibition of PTI. Due to the fact that the virulence of these two effectors is not abolished

in the rzn4 rpml rpt2 triple mutant, there must be host proteins other than RIN4 targeted by

AvrRPM1 or AvrRps2 (Belkhadir et al., 2004). Further studies of new host proteins targeted by

AvrRPM1 and AvrRps2 will help us understand the molecular activities of type III effectors and

the mechanisms of related host responses (Figure 1-3a and b).

The second piece of evidence to support the guard model comes from a study of the

association of AvrPphB with RPS5 (Shao et al., 2003). Like AvrRpt2, AvrPphB is a cysteine

protease and targets a host kinase, PBS 1, which is required for RPS5-mediated disease resistance.

PBS1 interacts with AvrPphB in plant. Conserved AvrPphB cleavage sites have been identified

in both PBS1 and AvrPphB. In vitro assays show that PBS1 is a substrate of AvrPphB and is

cleaved into two fragments. This cleavage is required for RPS5-mediated disease resistance. In

addition, the kinase activity of PBS1 is indispensable for RPS5-mediated disease resistance. The

study suggests that RPS5 guards PBS1 to regulate the disease resistance pathway. Once PBS 1 is

cleaved by AvrPphB, this cleaved product may be autophosphorylated and then recognized by

RPS5 to activate downstream defense responses (Figure 1-3c). The manner of recognition of

AvrPph5 by RPS5 suggests that some type III effectors are detected indirectly via their

enzymatic activities.

The third piece of evidence bearing on the guard model comes from a study of the Pto

gene in tomato. Recognition of AvrPto by Pto requires another NB-LRR protein, Prf (Salmeron

et al., 1996). Prfis tightly linked to Pto and both of them serve in the same signal transduction

pathway (Salmeron et al., 1994). Pto associates with Prf in a large protein complex and both of

them contribute to the specific recognition of AvrPto (Mucyn et al., 2006). However, the direct

interaction was only observed between AvrPto and Pto (Tang et al., 1996), but not between

AvrPto and Prf. In addition, the amino acids of AvrPto required for the interaction with Pto have

been proven indispensable to the suppression of PTI responses, suggesting that AvrPto may

increase its virulence by manipulating Pto or its homologues (Wufl et al., 2004). Furthermore,

since Pto interacts with two unrelated Pst type III effectors, AvrPto and AvrPtoB, through an

overlapping region (Pedley and Martin, 2003), this suggests that it likely to be a host target for

different bacterial effectors. These data prompt the hypothesis that Pto may serves as a guardee,

and the function of Prf is likely to guard Pto, so it can activate the defense responses (Jones and

Dangl, 2006) (Figure 1-3d). However, Prf is not a typical guard protein because it is present in

both susceptible and resistant tomato cultivars, whereas Pto is the determinant of resistance and

is therefore not present in susceptible cultivars. Thus, an alternative explanation is that AvrPto

inhibits PTI by interfering with the interface of Prf and Pto (Mucyn et al., 2006). In this scenario,

instead of acting as a guard, Prf serves as a signal transmitter. AvrPto and AvrPtoB constitutively

bind to a Prf-complex and inhibit the complex in susceptible plants. In the presence of Pto, the

binding is disrupted, and Prfis activated to transduce strong signals to activate the downstream

signaling pathway.

The last example of the guard model comes from a study of Cf-2-dependent disease

resistance in tomato (Rooney et al., 2005). Cf-2 is a resistant protein conferring resistance to

Cladosponumfulvum carrying Avr2. Avr2 is a protease inhibitor that targets Rcr3, a host

extracellular cycteine protease. Rcr3 is specifically required for the disease resistance pathway

mediated by Cf-2 (Dixon et al., 2000). Avr2 has been shown to bind to Rcr3 and to block the

cycteine protease activity of Rcr3. The inhibition of Rcr3 by Avr2 is thought to induce the

conformational change of Rcr3. This study suggests that Cf-2 guards the conformation of Rcr3

and activates the disease resistance pathway (Figure 1-3e).

Studying how cognate R proteins recognize Avr effectors enhances our understanding of

the molecular and cellular events associated with pathogen recognition and subsequent activation

of disease plant defense responses. However, these findings provide only a partial explanation of

the mechanisms involved in plant disease resistance. The structural similarity between some

PAMP receptors and R proteins are blurring the distinctions between PTI and ETI. For example,

both FLS2 and XA21 are RLKs with an extracellular LRR domain and an intracellular kinase

domain. However, FLS2 and XA21 recognize a PAMP (flagellin) and an effector (AvrXA21),

respectively, and trigger PTI and ETI responses. If we consider XA21 a PAMP receptor, in some

cases PAMP receptors could activate a strong defense that looks like an R protein-mediated

disease resistance (Abramovitch et al., 2006). The difference between PTI and ETI is likely to be

dependent upon timing and the strength of the same defense responses.

A zigzag model has been proposed to explain the outcome of plant defense responses

(Jones and Dangl, 2006). In this model, the plant defense responses consist of four phases. First,

pathogen-derived PAMPs are recognized by plant receptors, resulting in the activation of PTI;

second, some pathogens deliver virulent effectors to inhibit PTI, leading to effector-triggered

susceptibility (ETS); third, plants evolve R proteins that recognize these effectors by guarding

some host proteins involved in PTI, and trigger ETI; finally, some pathogens employ new

effectors which can suppress ETI, causing disease in plants. The zigzag model suggests that the

major difference between PTI and ETI exists at the stage of pathogen recognition, and there is

some cross-talk between PTI and ETI. Since the evolution of pathogens is much faster than that

of plants, it is not efficient for plants to generate a completely novel system to respond to new

elicitors of pathogens. Thus, there must be some conserved components shared by both PTI and

ETI. With the characterization of more virulent effectors, PAMPs, PAMP receptors and R

proteins, the contribution of PTI and ETI to promote plant disease resistance will eventually be


Downstream signaling components of PTI and ETI

Although the recognition of pathogen Avr proteins by plant R proteins have been studied,

the downstream events of plant defense/disease resistance remain to be fully understood. By

using genetic approaches, a number of components that are involved in the disease resistance

have been identified. A local signaling network of plant disease resistance pathway has been

reviewed by Parker (Kim and Parker, 2003, Figure 1-3), and some of the key components are

summarized below.

RAR1 (required for Mla-dependent resistance 1) and SGT1 (a suppressor of the G2 allele

of SKP1) are two central regulators required for several R gene-mediated disease resistance in a

variety of species, including Arabidopsis, barley, and tobacco (Freialdenhoven et al., 1994;

Azevedo et al., 2002; Liu et al., 2002b; Liu et al., 2002c; Muskett et al., 2002). RAR1 was

identified by screening mutants for inhibitors of Mall2-mediated resistance in barley to the

powdery mildew fungus Blumeria gramims f. sp. hordes. It encodes a 25 kD zinc-binding protein

and functions in both CC- and TIR-NB-LRR-type R gene-mediated disease resistance pathways

(Shirasu et al., 1999). rarl mutants failed to initiate an HR response at early time points when

infected by pathogens. However, at later points after inoculation, a strong HR response occurred

in rarl plants (Muskett et al., 2002). These results suggest that RAR1 acts at an early stage of R

gene-mediated defense response.

SGT1 was originally identified as a regulator of the cell cycle in yeast and was involved in

the SCF (Skpl/Cullin/F-box protein) E3 ubiquitin ligase complex (Kitagawal et al., 1999).

SGT1 is conserved in all eukaryotic cells. In plants, mutant screening found SGT1 was required

for RPP5-mediated disease resistance (Austin et al., 2002). Furthermore, down-regulation of

SGT1 in tobacco impaired N gene-mediated disease resistance (Liu et al., 2002b). SGT1

associates with RAR1 and SKP1 that is a highly conserved component of SCF E3 ubiquitin

ligase complex (Azevedo et al., 2002; Liu et al., 2002b). Both SGT1 and RAR1 interact with

two subunits of the CO9 signalosome, a proteasome lid complex. These observations suggest a

regulatory role for the ubiquitin-proteasome pathway in plant disease resistance.

In Arabidopsis, there are two functional orthologs of yeast SGT1, AtSGT1a and AtSGTIb.

Both of them are highly conserved and can complement cell cycle arrest in yeast sgtl mutants.

However, only AtSGTlb is involved in disease resistance. Analyses of the phenotype of the

double mutant rarl sgtl b suggest that RAR1 and AtSGTl b contribute additively to RPP5-

mediated disease resistance (Austin et al., 2002). However, in another independent study, it was

found that AtSGTlb antagonized RAR1 to regulate RPS5-mediated disease (Holt et al., 2006).

One major known function of RAR1 is to regulate the accumulation of R proteins (Tornero et al.,

2004). It was found that more RPS5 protein was accumulated in rarlsgtl plants than in rarl

plants, suggesting that RAR1 and AtSGTlb function antagonistically to control R protein levels

and the outcome of defense responses depends on their balanced protein levels. The inconsistent

conclusions from Austin et al and Holt et al's work suggest that AtSGTlb may play two roles in

plant disease resistance: one in the regulation of HR in a RAR1-independent manner, and the

other to act as an antagonist to RAR1 to regulate the levels of R proteins. The phenotype of

rarlsgtlb mutant when it is infected by a pathogen is dependent on either HR or R protein

accumulation is dominant to inhibit the spread of the pathogen. In the case of HR being more

important for plant disease resistance, partial HR occurring in the double mutant rarlsgtlb will

result in increased pathogen growth, which leads to the conclusion that RAR1 and AtSGTlb are

additively required for some R gene-mediated disease resistance. However, if the R protein

accumulation is more critical for plant disease resistance, more R protein will accumulate in the

double mutant rarlsgtlb compared to that in the rarl mutant, which results in decreased

pathogen growth and leads to an opposite conclusion that AtRAR1 and SGT1 act against each


EDS1 (Enhanced disease susceptibility 1) and PAD1 (Phytoalexin deficient 1) are two

positive regulators in PTI and are also required for TIR-NB-LRR-type R gene-mediated disease

resistance. EDS1 was identified by screening mutants for suppression ofR gene-mediated

resistance to the oomycete pathogen, Peronospora parasitica (Parker et al., 1996). PAD1, an in

vivo EDS1 interactor, was first identified when mutants were screened for enhanced disease

susceptibility to Pseudomonas syrzngae pv. macuhcola, and is required for resistance conferred

by RPP2, RPP4, and RPP5 (Glazebrook et al., 1996; Glazebrook et al., 1997; Jirage et al., 1999).

Both EDS1 and PAD1 encode lipase-like proteins and confer resistance governed by the same set

of R genes as RPP2, RPP4, and RPP5 (Falk et al. 1999; Jirage et al., 1999). EDS1 is essential for

the action of an HR response, and this HR is PAD1-dependent. In addition, while the expression

of both EDS1 and PAD1 is induced when plants are infected by pathogens, EDS1 is required for

pathogen-induced mRNA accumulation of PAD1, but the induced expression of EDS1 is only

partially affected in the pad] mutant. This suggests that there are two pools of EDS 1 in plants:

one that functions upstream of the HR in a PADl-dependent mode, and the other that acts

independently of PAD 1.

Both EDS1 and PAD1 are required for the accumulation of salicylic acid (SA), a defense

signal molecule in plants. Conversely, as a part of a positive feedback loop, SA itself also

contributes to the expression of EDS1 and PAD1. The data suggest that the EDS1-PAD1

complex may amplify the defense signals by regulating the level of SA (Feys et al., 2001;

Wiermer et al., 2005). EDS1 and PAD1 are also involved in modulating signal antagonism

between SA and jasmonic acid/ethylene (JA/ET). SA is thought to induce an HR response, which

is generally considered as program cell death. This cell death restricts the growth ofbiotroph

pathogens, such as bacteria, viruses, and some fungi that establish a colonizing relationship with

living host cells. JA/ET functions in the necrotroph resistance pathway that acts to defend against

necrotroph pathogens, including a wide range of insect herbivores that feed and live in dead

tissues (Kim and Parker, 2003). MAP kinase 4 (MAP4) inhibits the accumulation of SA and

enhances the level of JA/ET. This suppression of SA accumulation is antagonized by EDS 1 and

PAD1 (Petersen et al., 2000; Wiermer et al., 2005).

NDR1 (Non-race-specific disease resistance 1) was originally identified in a screen for

Arabidopsis mutants exhibiting impaired resistance to Pst DC3000 carrying AvrB (Century et al.,

1995). This gene encodes a plasma membrane, glycophosphatidyl-inositol (GPI)-anchored

protein. NDR1 is required for the activation of disease resistance mediated by various R proteins,

suggesting that it might be a common regulator of multiple disease resistance pathways

(Coppinger et al., 2004). Day and Staskawicz (2006) demonstrated that NDR1 interacts with

RIN4 through its N-terminal-18-amino acid region (Day et al., 2006). This finding provides an

insight into the function of NDR1. RIN4 has been shown to regulate at least two R gene-

mediated disease resistance. The amount of free RIN4 in cytosol is critical to the activation of R

proteins. NDR1 may act as a RIN4 interactor to regulate the pool size of free RIN4, and NDR1-

RIN4 serves as another layer to modulate plant disease resistance (Day et al., 2006)

Studies of the key components involved in plant disease resistance pathways help us

elucidate the molecular mechanism underlying those pathways. However, to completely

understand the entire signaling pathway, additional downstream components will need to be

cloned and characterized. Furthermore, studies of how these components are regulated and

modified when challenged by pathogens could have a more significant impact on our

understanding of the signal transduction pathway of plant disease resistance.

Bacterial Blight Disease of Rice

Rice is one of the world's most important food sources and is a diet staple for more than

half the world's population. Bacterial blight caused by Xoo is one of the primary diseases of rice

and can have devastating effects on rice production. In severely infected fields, yield losses can

be as high as 50% (Mew et al., 1993). Like other bacterial pathogens, Xoo penetrates rice leaves

through wounds or hydathodes. After invading the plant's intercellular space, Xoo proliferates in

the epitheme, the tissue that connects the hydathodes and the xylem, and then moves into the

xylem vessels. Once in the vascular system, Xoo continues to multiply until the xylem vessels

are clogged by bacterial cells and polysaccharides (EPS or xathan), a sticky substance that is

secreted by Xoo. If the infection occurs at the seeding or early tillering stage, rice leaves will

become wilted. If the infection occurs at a later stage, the leaves turn gradually from green to

grayish-green to chlorotic (Shen and Ronald, 2002).

To control this disease, nearly 30 genetic loci for resistance to bacterial blight have been

identified in rice, and five of them have been cloned (Song et al., 1995; Yoshimura et al., 1998;

Lyer et al., 2004; Sun et al., 2004; Gu et al., 2005).

According to their gene product structures, these five genes belong to three different

groups. Xal that encodes an NB-LRR protein represents the first group (Yoshimura et al., 1998).

This gene confers resistance to the Japanese Race 1 of Xoo, and its expression is induced by

pathogen infection. Xa21 and Xa26/Xa3, which encode RLKs, make up the second group (Song

et al., 2005; Sun et al., 2004). Both of them confer resistance to multiple races of Xoo. However,

transgenic plants carrying Xa21 show resistance to Xoo only at the adult stage, whereas Xa26

confers resistance to Xoo at both the seedling stage and the adult stage. The last group contains

xa5 and Xa27 that encode proteins showing no structural similarity with any known R protein

(Iyer et al., 2004; Jiang et al., 2006; Gu et al., 2007). The xa5 gene is recessive and encodes a

gamma subunit of a general transcription factor, IIA (TFIIA). xa5 is an important race-specific

gene because it confers resistance to a broad spectrum of Xoo strains. Xa27 is the only rice

resistance gene with a known cognate Avr gene, AvrXa27 (Gu et al., 2005). Xa27 confers

resistance to diverse stains of Xoo. Like Xal, the expression ofXa27 is induced in response to

Xoo. However, Xa2 7 is only induced by Xoo carrying AvrXa2 7, while Xal is induced by all the

strains. Given that the Xa27 constitutive expression line shows resistance to all the strains, with

or without AvrXa27, this indicates that the expression level of Xa2 7 is critical for disease


XA21-mediated disease resistance

The cloning ofXa21, along with other resistance genes, represents a breakthrough in our

understanding of the molecular basis of resistance to Xoo in rice (Lee et al., 2006). XA21-

mediated resistance develops progressively from susceptibility at the seedling stage to full

resistance at the adult stage (Century et al., 1999). Since the expression ofXa21 is comparable

among plants with different developmental stages and even when infected with Xoo, the post-

transcriptional regulation of XA21 may play a role in the signaling pathway. Bioinformatic

analyses have led to the identification of a region, RS686RT68sS689MKG, in the juxtamembrane

domain of XA21. This region shares a sequence similarity with a proteolytic cleavage motif

(P/GX5-7P/G) that was originally identified in animal epidermal growth factor receptor (EGFR)

(Yuan et al., 2003). It was therefore named XA21CS 1. Two similar motifs have been identified

inside the kinase domain, and were named XA21CS2 and XA21CS3 (G. Cory and W.-Y Song,

unpublished data). Biochemical studies have revealed that XA21 is a serine/threonine specific

kinase and can be autophosphorylated on multiple serine and threonine residues including S686,

T688, and S689 located in XA21CS 1 (Liu et al., 2003, Xu et al., 2006). A dead kinase mutant

XA21K736E accumulated to a much lower level in rice compared to wildtype XA21. These data

suggest that XA21 may be regulated by an unknown protease at the protein level and

autophosphorylation may contribute to this process. Indeed, when immunoblotted, a 100 kD

band that was derived from XA21 and XA21K736E was detected (Xu et al, 2006). The molecular

weight of this band is consistent with that of a XA21-cleaved product, supporting the hypothesis

that XA21 may be targeted by a protease. Furthermore, substitution of S686, T688, and S689

residues with alanine (XA21s686A/T68sA/s689A) reduced the steady-state levels of XA21 and

resulted in a much higher level of the 100 kD-cleaved product. These results suggest that

autophosphorylation of these three residues is critical to protect XA21 from cleavage. In addition,

both XA21 and XA21s6s6A/T6sA/S6s9A accumulated to a higher level in the seedling plants than in

the adult plants, suggesting that the accumulation of XA21 is developmentally regulated and the

putative protease that cleaves XA21 may function only at the adult stage.

XA21-mediated disease resistance is activated by the recognition of AvrXa21. Even

though the molecular identification of AvrXa21 is still unknown, a number of Xoo genes

required for AvrXa21 activity have been identified (Lee et al., 2006). Three genes encoding

components of a TOSS are required for AvrXa21 activity (Lee et al., 2006), suggesting that

AvrXa21 is delivered by a TOSS. In addition, the core AvrXa21 molecule is conserved between

two Xanthomonas species, Xoo and X. campestris pv. campestris (Xcc). Conservation between

different species is a major characteristic of PAMPs (Lee et al., 2006). Taken together with the

genetic data that show the recognition of AvrXA21 triggers a typical R protein-mediated disease

resistance, AvrXa21 shares features of both PAMPs and Avrs.

Even though Xa21 has been cloned for ten years, the signaling pathway mediated by this

gene is still poorly understood. One gene that is involved in XA21-mediated resistance signaling

is NRR, which encodes a protein that interacts with a NPR1 homologl (NH1) protein in rice

(Chern et al., 2005). Overexpression of NRR compromises the XA21-mediated disease resistance,

suggesting that the gene negatively regulates XA21-mediated disease resistance. Another gene

that is involved in XA21-mediated disease resistance is XB3 (Wang et al., 2006). This gene

encodes an E3 ubiquitin ligase and positively regulates XA21-mediated disease resistance. The

details about this gene will be discussed in the following chapters.

RLK family in plant disease resistance

XA21 is a member of RLK family. Members of this family play a fundamental role in the

transduction of various developmental and environmental signals in plants (Yuriko et al., 2005).

For example, BR1 serves as a brassinosteroid receptor in Arabidopsis (Wang et al., 2001),

CLAVATA1 modulates meristem proliferation (Clark et al., 1997), and FLS2 confers resistance

induced by bacterial flagellin (G6mez-G6mez et al., 2001). RLKs comprise the largest family of

receptors in plants, with about 600 members in Arabidopsis and over 1100 members in rice (Shiu

et al., 2004). The greater number of RLKs in rice is thought to result from lineage-specific

expansion of resistance/defense-related kinase (LSEKs) (Shiu et al., 2004). Three cloned rice

resistance genes, Xa21, Xa26 and Pi-d2, all belong to thr LSEK family. In another higher plant,

poplar, that has been sequenced, a larger RLK family is observed, suggesting the expansion of

RLKs may occur in other higher plant species. Thus, the XA21-mediated disease resistance

pathway can be an attractive model to study LSEKs-mediated disease in rice and other higher

plant species.

dMyD8S F



Plasma mer
FLS2 kinase



se AK6/3


Genep NLICres
Gene expresson 7

TRENDS r Plat Sc

Figure 1Main components ofthe sgnal transduct on pathways in nnate mmunity in
insects (Drosophsa), mammals, and plants (Arabidopsis) [Gomez-Gomez et al,
2002 Trendsin Plant Science7 251-2561


SYTOr cc Kinase f C



Figure 1-2 Casses ofresistance proteins [Chisholm e al, 2006 Cell 124 803-814]


Pseudomonas syngae

Susceptible NDR1

rpmi plants)
Increased virulence owing
to AvrRpml activity on
RIN4 and other targets

NoRPS2A .----
Ips2 plants)
Increased virulence owng
to AvrRpt2 actiity on
RIN4 and other targets



host ..

(ips5 plants)
Increased virulence owing

to AvrPto a ctndAvroty
dnow rge
host .. L

rd orpto plants)
Increased virulence owing
to AvrPto ard AvrtoB activity
on unknown targets

\ NDRI Resistant


Less pathogen grcth

Less pathogen growth

Less pathogen growth



Less pathogen growth



Inhibition of Rcr3 protease
activity by the Avr protease
inhibitor contbutes to disease

Activation of f-2-dependent
defence response

Figure 1-3 Plant imune system activation by pathogen effectors [Jones and Dangl, 2006
Nature 444 323-329]

(c) (d) (e)
TIR-NB-LRR RPW8 Pathogen detection


Defence against botrophs
DfI a
Defence against biotrophs

Defence against necrotrophs

Figure 1-4 Overview of the local signaling networks controlling activation of local defense
responses [Hammond-Kosack and Parker, 2003 Current Opinion in Biotechnology
14 177-193]




Plant induced defense systems consist of two parts. The first is triggered by recognition of

general pathogen-associated molecule patterns (PAMPs) through host receptors leading to

PAMP-triggered immunity (PTI) (Lee et al., 2006). The second is activated by recognition of

specific pathogen-encoded avirulent molecules (Avr) through plant resistance (R) proteins. This

response is known as effector-triggered immunity (ETI) (Jones and Dangl, 2006).

Plant resistance proteins are one of the major determinants of ETI. To date, more than 40

host R genes have been cloned and characterized. One of them, Xa21, encodes an RLK (XA21)

and confers resistance to a broad range ofXathomonas oryzae pv. oryzae (Xoo) strains (Song et

al., 1995). To analyze the components involved in XA21-mediated disease resistance, yeast two-

hybrid rice cDNA libraries were screened and more than ten proteins that associate with the

kinase domain ofXA21 (XA21K) have been identified (L.-Y. Pi, X. Dong and W.-Y. Song,

unpublished data). Among them, XB3 has been characterized in detail (Wang et al., 2006). XB3

encodes a protein containing an N-terminal ankyrin repeat domain and a C-terminal RING

(really interesting new gene) finger motif. Ankyrin repeats are often involved in protein-protein

interactions, whereas RING finger motifs are usually present in E3 ubiquitin ligases. Yeast two-

hybrid analyses show that XB3 specifically interacts with XA21K in yeast. In addition, the

ankyrin domain of XB3 is sufficient for the interaction with XA21K in vitro.

Members of the plant-specific-ankvrin-repeat (PANK) family are characterized by a

conserved ankyrin repeat domain at their C-terminus (Wirdnam et al., 2005). Eight members of

PANK have been identified in Arabidopsis thahana, rice and tobacco. Seven of them carry at

least one signature sequence for the glycosyl hydrolase (GH) family that is implicated in various

important physiological processes, including responses to abiotic and biotic stresses, activation

ofphytohormones, and cell wall remodeling (Opassiri et al., 2006). Five of the eight PANK

members contain a motif that is characterized by the presence of a region rich in proline (P),

glutamic acid (E), serine (S), and threonine (T) (PEST). PEST sequences are thought to target

eukaryotic proteins for phosphorylation and/or degradation (Decatur et al., 2000). The presence

of a PEST motif is a signal of short-lived proteins.

Members of PANK have been implicated in both carbohydrate metabolism and plant

defense/disease resistance pathways (Peck et al., 2001; Yan et al., 2002; Kuhlmann et al. 2003;

Wirdnam et al., 2005). In tobacco, up-regulation of GBP1/TIP2 induces curling of young leaves,

which is associated with reduced starch and sucrose accumulation, suggesting that CBP1/TIP2 is

involved in carbohydrate allocation. CBP1/TIP2 interacts with PR-like proteins, beta-1,3-

glucanase (GLU1), and chitinase (CHN1). The increased expression of CBP1/TIP2 is associated

with the formation of HR-like necrotic lesions in tobacco leaves. These results suggest that

CBP1/TIP2 may play a role in plant defense responses. Another member of the PANK family in

tobacco, ANK1/TIP1/HBP1, interacts with a bZIP transcription factor, BZI-1 that is involved in

auxin-mediated growth responses and in the induction of plant defense responses.

ANK1/TIP1/HBP1 is transiently down-regulated after a pathogen attacks, suggesting a role in

plant defense responses. In Arabidopsis, down-regulation of the PANK protein AKR2 results in

an increase in the resistance to bacterial pathogens and in the levels of reactive oxygen species

(ROS). These results suggest that AKR2 plays a negative role in plant disease resistance. In

addition, the Arabidopsis protein AtPhos43 is structurally related to AKR2 and is rapidly

phosphorylated with the treatment of the bacterial flagellin 22 peptide (flg22). This flagellin-

induced phosphorylation of AtPhos43 is dependent on the presence of the RLK protein, FLS2,

indicating that AtPhos43 is involved in the FLS2-mediated PTI pathway.

A few members of PANK have been shown to be involved in plant defense responses,

however there is no physical link between a PANK member and known R protein. In this study,

an ankyrin repeat-containing protein, XA21-binding protein 25 (XB25), was identified by yeast

two-hybrid screening using a truncated version of XA21 spanning the transmembrane domain

and the kinase domain (XA21KTM) as bait. XB25 interacted with XA21KTM in yeast.

Sequence analyses indicate that XB25 belongs to the PANK family. XB25 also interacted with

XA21KTM in vitro. Transgenic plants with down-regulated levels of XB25 proteins show

neither morphological differences nor altered resistance to Xoo compared to the recipient plants

carrying no Xa21 gene. The results link the PANK protein XB25 to the R protein XA21.

Materials and Methods

Phylogenetic and Sequence Analyses

Phylogenetic analyses were carried out based on the deduced amino acid sequences of the

rice proteins (XB25, XBOS25-1, and XBOS25-2), the Arabidopsis proteins (AKR2 and

AtPhos43), and the tobacco proteins (TIP1, TIP2, and TIP3) using the ClustalW program from

EMBL-EBI (http://www.ebi.ac.uk/clustalw). Multiple sequence alignments were performed by

using the software of MultAlin (http://bioinfo.genopole-toulouse.prd.fr/multalin), developed by

Florence Corpet (1998). The identity and similarity among proteins were calculated using the

"GAP" tool within the Wisconsin Sequence Analysis Package from the Genetics Computer

Group (Madison, WI).

The rice gene accession numbers in the TIGR database

(http://www.tigr.org/tdb/e2kl/osal/) for XB25, XBOS25-1, and XBOS25-2 are Os09g33810

(XB25), Os03g63480 (XBOS25-1), Os08g42690 (XBOS25-2). The GenBank accession

numbers for the rest of the proteins described above are At2g17390 (AtPhos43), At4g35450

(AKR2), AF352797 (TIP1), AY258007 (TIP2), and AA091862 (TIP3).

Molecular Cloning ofXBOS25-1

To clone XBOS25-1, RT-PCR was performed. Total RNA from rice was extracted by the

following procedure: 0.5 g of rice leaves was ground using a mortar and pestle in an adequate

volume of liquid nitrogen. Then transferred to a 50 mL centrifuge tube. 1 mL of RNA-bee (Tel-

Test, Friendswood, TA) was mixed with the powdered leaf material; 200 gl of chloroform was

added and the tube was shaken vigorously for 30 seconds on a vortex shaker. The homogenate

was centrifuged at 12,000 g for 15 min at 4 OC; The upper aqueous phase was transferred into a

new tube and mixed with 0.5 mL of isopropanol; The RNA precipitates were collected after

centrifugation at 12,000 g for 15 min and then washed with 75% ethanol; The RNA pellet was

briefly dried in vacuum and dissolved in water pre-treated with diethyl pyrocarbonate (DEPC).

Rice cDNA was synthesized from the isolated RNA using the SuperScrip First-Strand

Synthesis System (Invitrogen, Carlsbad, CA). A solution of 10 pl of RNA/Primer mixture

containing 5 gg of total RNA, 1 pl of dNTP (10 mM), 1 pl of Oligo(dT)12-18 (0.5 pg/pl), and 3

gl of DEPC-treated water was incubated at 65 OC for 5 min, and the sample was placed on ice for

at least 1 minute. A volume of 9 gl of a reaction mixture containing 2 gl of 10x RT buffer, 4 gl

of 25 mM MgCl2, 2 pl of 0.1 M DTT, and 1 gl of RNaseOUTM Recombinant RNase Inhibitor

was added to the RNA/Primer mixture and incubated at 42 'C for 10 min. 1 pl (50 units) of

SuperScriptT II RT was added to the reaction mixture and incubated at 42 'C for an additional

50 min. The reaction was stopped by incubating at 70 OC for 15 min and the RNA template was

removed by adding 1 pl of RNase H and incubating at 37 OC for 1 hour.

XBOS25-1 was amplified using primers P1 (5'-ATGGCTTCTCAAGAAGAGAAGACG-

3') and P2 (5'-T TCTATACGAAGGCGTGCT TCTCGAGCA-3'), designed according to the

reported cDNA sequence (Os03g63480). PCR was performed using the following procedure:

denaturation (99 OC for 10 min), five extension cycles (94 OC for 30 sec, 45 OC for 30 sec, 72 OC

for 1 min), twenty-five extension cycles (94 OC for 30 sec, 56 OC for 30 sec, 72 OC for 1 min) and

one extension cycle (72 OC for 10 min). The amplified products were resolved in a 1% agarose

gel and cloned into the pGEM-T Easy vector (Promega, Madison, WI). The cloned XBOS25-1

was confirmed by DNA sequencing at the University of Florida's DNA Sequencing Core.

Construction of BD-XA21KTM, BD-XA21KTMK736E, BD-XA21KTMs686A/T688ssA689A, BD-
Pi-d2KTM, BD-XA21K, AD-XB25, AD-XB25N, AD-XB25C, and AD-XBOS25-1

Yeast two-hybrid vectors, pPC97 that carries a GAL4 DNA binding domain (BD) and

pPC86 that carries a GAL4 activation domain (AD), were used here (Chevray and Nathans,

1992). The BD-XA21KTM, BD-Pi-d2KTM, BD-XA21K, and AD-XB25 constructs were kindly

provided by Dr. X. Ding. To make other BD constructs, XA21KTM was subcloned into the

pGTK vector, which was modified from pGTK-2T (Amersham Bioscience, Piscataway, NJ). The

resulting construct was designated as GST-XA21KTM. Site-directed mutagenesis was used to

make the BD-XA21KTMK736E construct. Primers P3 (5'-GGACTTGGTTGAATACTCACCAG-

3') and P4 (5'-AAGCTTTAGTACCTCCACTGCAACA-3') were designed to specifically

mutate Lys736 of XA21 to glutamic acid (Stratagene, La Jolla, CA). GST-XA21KTM was used

as template for the following PCR reaction: step 1, 99 oC for 10 min; step 2, 94 oC for 1 min; step

3, 50 C for 1 min, step 4, 68 C for 16 min (repeat steps 2 through 4 four times), step 5, 94 C

for 1 minute; step 6, 56 C for 1 minute; step 7, 68 C for 16 min (repeat steps 5 through 7 fifteen

times); step 8, 72 C for 10 min. To remove the methylated template DNA, 1 pl of DpnI was

added to 20 pl of PCR reaction mixture and incubated at 37 C overnight. The digested PCR

products were transformed into E. coh DH5c competent cells. Candidate GST-XA21KTMK736E

constructs were purified by using the QIAprep Spin Miniprep Kit (QIAGEN Sciences,

Germantown, MD) and confirmed by DNA sequencing. BD-XA21KTMK736E was generated by

subcloning XA21KTMK736E from GST-XA21KTMK736E into the corresponding sites of pPC97.

Similar strategies were used to create BD-XA21KTMs686A/T688A/s689A except the primers P5



Ser686, Thr688, and Ser689 of XA21 to alanines.

By utilizing a yeast recombination-based strategy (Chen et al., 2005), pPC86-XB25N was

generated. XB25N was amplified using the primers P7 (5'-



GCAGTATGATGGACAATGGA-3') in a 50 pL mixture containing 50 ng of pPC86-XB25, 20

mM Tris-HCl (pH 8.4), 50 mM KC1, 3 mM MgCl2, 0.4 aM of each primer, dNTPs at 0.2 mM

each, 10% DMSO, and 1 unit of Taq DNA polymerase. The PCR reaction was carried out with

the following cycling parameters: step 1, 99 OC for 10 mins; step 2, 94 OC for 30 sec; step 3, 56

OC for 30 sec; step 4, 72 OC for 30 sec (repeat steps 2 through 4 thirty-five times); step 5, 72 OC

for 10 min. The PCR products were fragmented in a 1% agarose gel and purified using the

QIAquick Gel Extraction Kit (QIAGEN Sciences). The vector was prepared by digesting pPC86

with restriction enzymes Sall and NotI (New England Biolabs, Beverly, MD). The linearized

pPC86 and purified XB25N were co-transformed into the yeast strain CG1945 (Mata, ura3-52,

his3-200, lys2-801, ade2-101, trpl-901, leu2-3, 112, gal4-542, gal80-538, cyhr2, LYS

2::GAL1UAS-GAL1TATA-HIS3, URA3::GAL4 17-mers(x3)-CyclTATA-lacZ). Transformants

were grown on SD/-Trp solid medium [6.7 g/L yeast nitrogen base without amino acids (Becton,

Dickinson, Sparks, MD), 0.74 g/L SD/-Trp DO supplement (Clontech, Palo Alto, CA), 2%

glucose, 20 g/L argar, and adjust the pH to 5.8] at 30 OC for 2-4 days. Single yeast colonies

grown on SD/-Trp plates were inoculated into 2 mL of liquid SD/-Trp medium and incubated at

30 OC for 16 hours with shaking at 250 rpm. Plasmids in yeast were then isolated by using the

Zymoprep Yeast Plasmid Minipreparation Kit (Zymoprep, Orange, CA) and subjected to PCR

analysis and bacterial transformation.

XB25C was amplified using the primers P9 (5'-



was carried out with the following cycling parameters: step 1, 99 OC for 10 mins; step 2, 94 OC

for 30 sec; step 3, 54 OC for 30 sec; step 4, 72 OC for 30 sec (repeat steps 2 through 4 thirty-five

times); step 5, 72 OC for 10 min. The PCR products were fragmented in a 1% agarose gel, and

purified using the QIAquick Gel Extraction Kit (QIAGEN Science). The purified product was

digested with Sall/NotI, and was cloned into corresponding sites ofpPC86 to make an in-frame

translational fusion with GAL4 AD domain.

XBOS25-1 was amplified using the primers P11 (5'-


TCTATACGAAGGCGTGCT TCTCGAGCA-3'). Similar procedures as described above were

followed to clone XBOS25-1 into the pPC86 vector.

Preparation of Yeast Competent Cells

The yeast strain CG1945 was streaked on a fresh yeast extract/peptone/dextrose (YPD)

plate containing 2% peptone, 1% yeast extract, 2% glucose, and 1.5% bacterial agar. The

competent cells were prepared by using the Zymoprep frozen-EZ yeast transformation II kit

(Zymoprep). Single yeast colonies were inoculated into 1 mL of YPD medium and incubated

overnight at 30 OC with shaking at 250 rpm. The culture was diluted ten-fold with liquid YPD

medium and continued to grow until an OD600 reading of 0.8 to 1.0 was reached. The cells were

harvested by centrifugation at 500 g for 5 min at room temperature. The pellet was resuspended

in 10 mL of EZ yeast transformation solution 1. Cells were collected again by repeating the

centrifugation process, and resuspended in 1 mL of EZ yeast transformation solution 2. Cells

were then aliquoted and stored in 80 oC freezers for future use.

Co-transformation of Bait and Prey Constructs into Yeast Cells

Co-transformation was performed using the Zymoprep Frozen-EZ Yeast Transformation II

kit (Zymoprep). The transformation reaction mixture contains 0.2 gg of bait and prey constructs,

50 p1 of competent cells, and 500 gl of EZ yeast transformation solution 3. The mixture was

incubated at 30 OC for one hour and vortexed every 15 min. 150 gl of the mixture was spread on

SD/-Trp-Leu medium (6.7 g/L yeast nitrogen base without amino acids, 0.67 g/L SD-Trp-Leu

DO supplement, 20 g/L bacterial agar, and 2% glucose). To test the interactions between bait and

prey proteins, the colonies on SD/-Trp-Leu were picked, and replicated on SD/-Trp-Leu-His

medium and incubated for 2-3 days at 30 OC.

Bacterial Expression and Purification of Fusion Proteins

To express XB25 as a maltose-binding protein (MBP) fusion protein, the pMAL-XB25

construct was generated. XB25 was amplified by primers P13 (5'-



using the QIAquick Gel Extraction Kit (QIAGEN Sciences). The purified PCR products were

cloned into the corresponding sites of the pMAL vector, modified from pMAL-c2X expression

vector (New England Biolabs). The pMAL-XB25 construct was then transformed into E. coh

strain ER2566 (New England Biolabs).

To express MBP-XB25 in bacteria, a single colony was inoculated into 5 mL of LB

medium containing 50 gg/mL ampicillin (LBAp) supplemented with 0.2% glucose. The culture

was incubated at 37 OC overnight with shaking at 250 rpm, then 500 pl of the culture solution

was diluted 100-fold into 50 mL of LBAp 50 jg/mL supplemented with 0.2% glucose, then

grown at 370 C until an OD600 of 0.5-0.6 was reached. To induce the expression of MBP-XB25,

isopropyl- 1-thio-P-D-galactopyranoside (IPTG) was added to the culture to obtain a 0.4 mM

final concentration. The culture was then incubated for an additional 2 hours with shaking at 250

rpm. Cells from the culture were harvested by centrifugation at 4,000 g for 10 min and

resuspended in 500 gl of column buffer solution [20 mM Tris-HCL (pH 7.4), 200 mM NaC1,

1mM EDTA, 1mM Dithiothreitol (DTT)]. The cell suspension was transferred into a pre-chilled

1.5 mLtube and sonicated on ice for a total time of 1.5 min (15 seconds sonication and 15

seconds in ice, repeated two times) using a Microson Ultrasonic Cell Disruptor (Misonix

Incorporated, Farmingdale, NY). The supernantant was collected by centrifugation at 12,000 g

for 1 minute at 4 C and incubated with 50 gl of pre-washed amylose resin (New England

Biolabs) at 4 oC for 1 hour. After incubation, the resin was washed with column buffer 5 times

and the fusion protein was eluted with column buffer containing 3.6 mg/mL maltose. The sample

was resolved by an 8% SDS-PAGE gel.

Similar protocols were used to express XB25 as a glutathione S-transferase (GST) fusion

protein (GST-XB25) or a FLAG-tagged fusion protein (FLAG-XB25) with the following

changes: (1) GST buffer (50 mM HEPES (pH 7.4), 150 mM NaC1, 10 mM EDTA, 1 mM

dithiothreitol) and glutathione-agarose beads (Sigma-Aldrich, St.Louis, MO) were used for

purification of GST-XB25; (2) FLAG buffer [20 mM Tris-HCL (pH 7.6), 13 mM NaC1, 1mM

dithiothreitol] and Anti-FLAG-M2 agarose (Sigma-Aldrich) were used for the purification of


To express XA21KTM as a His-tagged fusion protein (His-XA21KTM), XA21KTM was



products were cloned into the corresponding sites of pET86 expression vector (Invitrogen). His-

XA21KTM was expressed by the protocols described above and purified using a Ni-NTA His-

Bind Resin and Buffer kit (Novagen, San Diego, CA). Bacterial cells grown in 50 mL of LB mp

were collected and re-suspended in 500 gl of Ni-NTA binding buffer. After sonication, the cell

debris was discarded, and 20 gl of 50% slurry of Ni-NTA His-Bind resin was added to the

supernatant. The mixture was incubated at 4 oC for 30 min and the resin was pelleted by

centrifugation at 12,000 g for 1 min. The resin was then washed with 2x 100 gl of lx Ni-NTA

washing buffer and the fusion proteins were eluted with 30 gl of Ni-NTA elution buffer.

Generation and Purification of Antibodies against XB25

A region in the middle part of XB25 (XB25M) was used to develop antibodies against

XB25. XB25M was amplified using primers P19 (5'-



XB25M and GST-XB25M, were created by cloning the PCR fragment into pMal and pGTK

vectors, respectively. MBP-XB25M and GST-XB25M was expressed and purified by the

procedure described above. MBP-XB25M protein was resolved by an 8% SDS-PAGE gel and

visualized by staining with coomassie blue solution [ 0.1% (w/v) coomassie blue R350, 20% (v/v)

methanol, and 10% (v/v) acetic acid] and destined with destain buffer [50% (v/v) methanol in

water with 10% (v/v) acetic acid]. The band corresponding to MBP-XB25 in the SDS-PAGE gel

was cut out and 400 gg of MBP-XB25M protein was used to immunize a rabbit (Cocalico

Biologicals, Reamstown, PA).

After immunization, antisera were collected and subjected to affinity purification.200 gg

of GST-XB25M protein was resolved by an 8% SDS-PAGE gel and transferred to a PVDF

membrane (MILLIPORE, Billerica, MA) using a semi-dry transfer cell (BioRad, Hercules, CA)

at 25 volts for 15 min. The protein blots were visualized by staining with Ponceau S solution

[(0.2% Ponceau S (Sigma-Aldrich), 0.3% trichloroacetic acid (TCA)] for 10 min and then

detained with several rinses of distilled water until the bands were visible. The band of GST-

XB25M was cut out using a clean single-edge razor blade and the remaining Ponceau S stain was

removed by washing with several rinses of phosphate-buffered saline (PBS) [8 g/L NaC1, 0.2 g/L

KC1, 1.44 g/L Na2HPO4 and 0.24 g/L KH2PO4, pH 7.4]. The strip was incubated in 10 mL of

blotting buffer (5% nonfat dry milk in PBS) for 1 hour and washed 3 times with 10 mL of PBS

for 5 min per wash. The strip was then placed on a piece of Parafilm and 1 mL of crude

antiserum was applied to the surface of the strip. After 2 hours of incubation with gentle shaking,

the "depleted fraction" was removed and the strip was washed 3 times with PBS. Finally, the

purified antibody was eluted using 200 gl of low-pH buffer (0.2 M glycine, 1 mM EGTA, pH


Creation of the RNAiXB25 Construct

A region from the 3'-terminal untranslated end of XB25 was selected to generate an

RNAiXB25 construct. This region was PCR amplified in both sense and antisense orientations

using primer sets P21 (5'- GCGCTCTAGAAGAAACCAATGCCAAATCTC-3')/P22 (5'-



respectively. The sense fragment was digested by restriction enzymes Xbal/BamHI, and the

antisense fragment was digested by restriction enzymes Bglll/EcoRV (New England Biolabs).

These two digested fragments were ligated to a GUS loop (a 979 bp sequence from the bacterial

uldA gene). Then the construct was sub-cloned into pCMHU-1, an overexpression vector derived

from pBHU-1, for rice transformation (Wang et al., 2006).

Generation of Rice RNAiXB25 Transgenic Lines

RNAiXB25 transgenic lines were generated by a standard rice transformation protocol (X.

Chen, unpublished). Immature seeds (15-20 days after flowering) were dehusked and sterilized

in 75% ethanol for 2-5 minutes, followed by 50% bleach for 2 hours. Sterilized seeds were rinsed

3-5 times with sterile water. Embryos were removed, placed on calli induction medium [(N6BD2)

(macro N6, micro Fe-EDTA, B-5 vitamin, 30 g/L sucrose, 0.5 g/L L-Proline, 0.5 g/L L-

Glutamine, 0.3 g/L casein hydrolysate 2 mg/L 2,4-D(2,4-dichlorophenoxyacetic acid), 2.5 g/L

phytagel, pH 5.8)], and grown in the dark at 25 OC for 5-7 days.

Agrobacterum strain EHA105 was cultured in 3 mL of YM (0.4 g/L yeast extract, 10 g/L

Mannitol, 0.1 g/L NaC1, 0.2 g/L MgSO4.7H20, 0.5 g/L K2HPO4.3H20, pH 7.0) at 28-30 OC for

16 hours and then diluted 50-fold to 50 mL of liquid AB medium to grow an additional 16 hours.

Cells were collected and suspended in liquid AAM (macro AA, micro Fe-EDTA, AA vitamin,

68.5 g/L sucrose, 36 g/L glucose, 0.5 g/L casine hydrolysate, pH 5.2) containing 200 mM/L

acetosyringone to an OD600 of 0.5. Calli were inoculated with a suspension ofAgrobacterum for

30 min with occasional shaking by hands. After inoculation, calli were then dried on sterilized

Whatman filter paper and transferred to N6BD2C (N6BD2, 10 g/L glucose, pH 5.2) containing

200 mM/L acetosyringone to co-cultivate for 3 days. Calli were transferred to selection medium

(N6BD2, 25 gg/L hygromycin, 600 pg/L Cf) and cultured in the dark at 25 OC for 2 weeks. Calli

were transferred to a different selection medium (N6BD2, 50 pg/L hygromycin, 300 jg/L Cf),

and continued to grow for 2 more weeks, at which time they were transferred to fresh medium

for a final 2 weeks growing period.

After growing on selection medium for a full six weeks, calli were transferred to pre-

regeneration medium (macro N6, micro N6+Fe-EDTA, B-5 vitamin, 30 g/L sucrose, 0.5g/L L-

Proline, 0.5g/L L Glutamine, 0.3g/L Casine hydrolysate, 3.0g/L phytagel, pH 5.8) and cultured

in the dark at 25 OC for 7-10 days to generate root systems.

The calli were next transferred to regeneration medium (30g/L sucrose, 0.3 g/L casine

hydrolysate, 2 mg/L 6-BA, 0.2 mg/L NAA, 0.2 mg/L ZT, 0.5 mg/L KT and 2.5 g/L phytagel, pH

5.8), and cultured in a light/dark cycle (16 hours light/8 hours dark) at 25 OC, and after 2-4 weeks,

transgenic shoots measuring to 2-3 cm were transferred to rooting medium (1/2 Ms) to ensure

development of a strong root system.

In Vitro Binding Assays

His-XA21KTM and FLAG-XB25 were expressed as described previously. FLAG-XB25

was purified using anti-FLAG M2 agarose. Next, 1 gg of purified FLAG-XB25 protein was

mixed with 500 gl of bacterial crude extract expressing His-XA21KTM or empty vector and

placed on a rocker platform shaker at 40C for 30 min, then 50 gl slurry of Ni-NTA was added to

the mixture and rocked at 4 OC for an additional 30 min. His-Bind Resin (Novagen) was pulled

down by centrifugation and washed 5 times with 1 mL of 1 x Ni-NTA washing buffer (Novagen).

The proteins were eluted using 30 gl of elution buffer and resolved by an 8% SDS-PAGE gel.

After electrophoresis, proteins were transferred to a PVDF membrane pre-soaked with 100%

methanol by a semi-dry transfer cell (BioRad) at 25 volts for 15 min. The membrane was blotted

in 10 mL of blotting buffer [5% nonfat milk in TTBS (0.14 mM NaC1, 50 mM Tris-HC1, 0.1%

Tween 20, pH 7.6)] for 1 hour, and incubated in 10 mL of blotting buffer containing 3 gl of anti-

FLAG M2 antibody (1:3000) at 4 OC overnight. After three washes with TTBS, the blot was

developed using an ECL Plus Western Blotting Detection kit (Amersham Biosciences).

RNA GeL Blots Assays

Rice RNA was extracted as described above. The sample was prepared in a 35 gl mixture

containing 17.5 gl of deionized formamide, 6.0 gl of 37% formaldehyde, 3.5 gl of 5x MOPS

buffer and 7 gl of RNA. The mixture was incubated at 60 OC for 15 min and placed on ice for an

additional 15 min. Total RNA was resolved by a 1% agarose gel [1% agarose, 0.66 M

formaldehyde, and lx MOPS buffer (40 mM morpholinopropanesulfonic acid, 10 mM sodium

acetate, and 1 mM EDTA)]. After electrophoresis, RNA was transferred to a nylon transfer

membrane [pre-soaked with 500 mL of distilled water and 500 mL of 10x SSC (1.5 M NaCl and

0.15 M sodium citrate dehydrate). After transfer, the membrane was briefly rinsed in 2x SSPE

(300 mM NaC1, 20 mM NaH2PO4, and 2 mM EDTA) and the RNA was fixed to the membrane

using a UV cross-linker.

A region from the N-terminus of XB25 was selected to make a specific probe against XB25.

The fragment was amplified by primers P25 (5'-



using the Primer-It II Random Primer Labeling Kit (Stratagene). 50 pl of reaction mixture was

prepared with 50 ng DNA, 10 pl of 5x primer buffer, 5 pl of [a-32P]dATP, and 1 pl Exo (-)

Klenow enzyme. The reaction was carried out at room temperature for 1 hour.

The nylon membrane containing the RNA samples was pre-hybridized in a minimum

volume of pre-hybridization solution (5x SSPE, 50% deionized formamide, 5x Denhard's

solution, 1% SDS, 10% dextran sulphate, and 10 gg/mL denatured salmon sperm DNA) at 42 OC

for 4 hours. 32P-labeled probe was added to the hybridization buffer and the membrane was

incubated at 42 OC for 24 hours on a platform rocker set at a low speed.

After hybridization, the membrane was washed as following procedure: twice in 200 mL

of 2x SSPE at room temperature for 15 min, twice in 400 mL of 2x SSPE at 65 OC for 45 min,

and twice in 200 mL of 0.1x SSPE at room temperature for 15 min. After washing, the

membrane was exposed on X-ray films.

Immunodetection of XB25

Total rice protein extracts were isolated by grinding 1 gram of leaf tissue with a mortar

and pestle in liquid nitrogen and thawing the tissue in an equal volume of extract buffer [50 mM

Tris-HCl (pH 7.5), 150 mM NaC1, 1 mM EDTA, 0.1% Triton X-100, 5% (v/v) 3-

mercaptoethanol, 1 mM 4-(2-aminoethyl)-benzenesulfonyl fluoride (Sigma-Aldrich), 2 gg/mL

Antipain (Sigma-Aldrich), 2 gg/mL Leupeptin (Sigma-Aldrich), 2 gg/mL Aprotinin (Sigma-

Aldrich)]. Cell debris was removed by centrifugation at 12,000 g for 10 min at 4 OC. The

concentration of protein was then measured using the Bio-Rad protein assays.

To immunodetect XB25, total rice proteins were resolved by an 8% SDS-PAGE gel and

transferred to a PVDF membrane. After blocking for 1 hour in 5% nonfat milk in TTBS, the

membrane was incubated in 10 mL of 5% nonfat milk in TTBS containing 2 pl of primary

antibodies (1:5000) at 4 OC overnight with gentle shaking. After washing three times with TTBS,

the membrane was incubated in 10 mL of 5% nonfat milk in TTBS containing 2 pl of secondary

antibodies (1:5000) (Santa Cruz Biotechnology, Santa Cruz, CA) for 1 hour at room temperature

with shaking. After washing three times in TTBS, the blot was developed using an ECL Plus kit

(Amersham Biosciences).


XB25 is A Member of the PANK Family

XA21KTM was used to screen a yeast two-hybrid rice cDNA library. Eleven proteins that

associate with XA21KTM were identified (X. Ding, unpublished data). One of them is encoded

by the cDNA 25-1 containing a complete open reading frame (ORF) and 69 bp 5' untranslated

region. This ORF is named XB25 (Os09g33810). The genomic sequence of XB25 contains nine

exons and eight introns (Figure 2-1). The predict product ofXB25 (XB25) has 329 amino acids

with a predicted molecular weight of 35 kD (Figure 2-2). Amino acids 172-209 carry a PEST

motif (http://www.at.embnet.org/embnet/tools/bio/). PEST motifs are often present in proteins

that are targeted for degradation; therefore XB25 is likely to be an unstable protein. Following

the PEST domain, amino acids 205-329 contain four ankyrin repeats that are implicated in

protein-protein interactions (Sedgwick and Smerdon, 1999).

Eight XB25 and related proteins were identified by searching the protein database from

National Center for Biotechnology Information (NCBI). They are XB25, XBOS25-1 and

XBOS25-2 in rice, AKR2 and AtPhos43 in Arabidopsis, and TIP1, TIP2, and TIP3 in tobacco.

These proteins share a high sequence similarity (> 60%) and identity (>55%) (Table 2-1). The

ankyrin repeat regions display the greatest conservation among these proteins (E<8e-45),

suggesting that XB25 belongs to the PANK family (Figure 2-3).

Phylogenic analyses showed rice XB25, XBOS25-1, and XBOS25-2 consist of one group

(Figure 2-4) and they share an over 70% sequence similarity and a 60% sequence identity with

each other. The greatest variation among them occurs in the N-termini that share less than a 40%

sequence similarity and a 30% sequence identity, while their C-termini share an 85% sequence

similarity and an over 75% sequence identity. XBOS25-1 is the closest homologue of XB25 and

shares a 74% sequence similarity and a 68% sequence identity.

The N-terminal Region of XB25 is Sufficient for the Interaction with XA21KTM in Yeast

To demonstrate specific interaction between XB25 and XA21KTM, eight constructs were

made. XB25N contains amino acids (1-214) located upstream of the ankyrin repeat domain,

while XB25C (195-329) spans the entire ankyrin repeat domain. XA21K is a truncated XA21

containing only the kinase domain. XA21KTMS686AT6ssA/69A is an autophosphorylation

deficient mutant of XA21KTM in which three phosphorylated serine and threonine residues,

located in the juxtamembrane (JM) domain, were mutated to alanines (Xu et al., 2006).

XA21KTM736E is a dead kinase mutant in which the highly conserved Lys736 was mutated to a

glutamic acid. Pi-d2 is a rice RLK conferring resistance to the fungal pathogen Magnaporthe

gnsea (Chen et al., 2006). Yeast two-hybrid analyses showed that XB25 and XB25N interacted

with XA21KTM, indicating that the N-terminal part of XB25 is sufficient for binding to

XA21KTM (Figure 2-5). In addition, both XB25 and XB25N interacted with the

autophosphorylation mutant XA21KTMS66AT688A/S689A, indicating that these three

autophosphorylated residues are not required for the binding of XB25 in yeast. In contrast,

neither XB25 nor XB25N interacted with XA21K, suggesting the transmembrane domain of

XA21 is required for the interactions. XA21KTMK736E failed to interact with XB25, suggesting

that kinase activity may be required for the XA21KTM-XB25 interaction. Furthermore, Pi-

d2KTM did not interact with XB25, suggesting that the bacterial disease resistance pathway and

fungal disease resistance pathway may have different signaling components. Finally, the closest

rice homologue of XB25, XBOS25-1, displayed the same XA21-interacting pattern as XB25,

suggesting that XBOS-1 and XB25 may act redundantly.

Physical Interaction between XB25 and XA21KTM in Vitro

To confirm the XB25-XA21KTM interaction, XA21KTM and XB25 were expressed and

purified as FLAG- and His-tag fusion proteins, respectively (Figure 2-6). The predicted size of

FLAG-XB25 is 36 kD, however, the observed molecular weight of this fusion protein is about 45

kD. This discrepancy might be due to some post-translational modifications or an abnormal

migration of this protein in the SDS-PAGE gel.

To perform in vitro binding assays, equal amounts of bacterial extracts expressing either

His-XA21KTM or the empty vector were mixed with bacterial extracts expressing FLAG-XB25.

Ni-NTA His-Bind resin was added to pull down His-XA21KTM and its binding proteins. After

extensive washing, the precipitates were subjected to Western Blot analyses. As shown in Figure

2-7, FLAG-XB25 can be detected by the anti-FLAG M2 antibody in the precipitates from the

mixture containing His-XA21KTM and FLAG-XB25. In contrast, no product of the same size

was present in the precipitates from the mixture of empty vector and FLAG-XB25. These results

indicate that XB25 interacts with XA21KTM in vitro.

Generation of Antibodies against XB25

To detect XB25 in plant extracts, a region in the middle part of XB25 (XB25M) was used

to develop antibodies against XB25 (Figure 2-8). This region shares 65% and 66% sequence

similarity with the corresponding regions ofXBOS- 1 and XBOS-2, respectively. Purified anti-

XB25M detected a strong 45 kD band in the bacterial protein extracts expressing FLAG-XB25,

but not in the extracts expressing the empty FLAG-tag vector, indicating that anti-XB25M can

recognize bacterial expressed XB25 (Figure 2-9).

Down-regulation of XB25 in Transgenic Plants

XB25 was down-regulated by RNA interference (RNAi). A 336 bp sequence derived from

a 3' untranslated region of XB25 was used as the gene-specific probe. This region shares less

than 50% sequence identity with the corresponding regions ofXBOS25-1 and XBOS25-2. No

sequence stretch of more than 18 bp is identical among XB25, XBOS25-1, and XBOS25-2,

suggesting that this probe is likely to specifically down-regulate XB25 (Figure 2-10). To stabilize

the RNAi construct, a 979 bp fragment from the bacterial uldA gene (GUS loop) was inserted

between the inverted probes. The RNAiXB25 construct was transformed into the cultivar

Taipei309 (TP309) (Figure 2-11), and more than 60 transgenic lines were generated. As shown in

Figures 2-13 and 2-14A, the levels of XB25 transcripts were dramatically reduced in most of the

RNAiXB25 lines when compared to the recipient lines TP309. Conversely, strong signals were

detected in RNAiXB25 lines when a probe against GUS loop was used in Northern Blot analysis

for the same blot, indicating that the RNAi construct was properly expressed. The consistency of

reduced XB25 RNA transcripts with enhanced GUS loop expression implies that XB25 has been

successfully down-regulated in the RNAiXB25 transgenic lines. Three independent transgenic

lines with lower levels of XB25 (S34, S41, and S42) were chosen for further characterization.

Anti-XB25M detected two major bands (42 kD and 48 kD) in the total protein extracts of

TP309. The quantity of the 42 kD band was significantly less in the RNAiXB25 transgenic lines

compared to the recipient line TP309, indicating this 42 kD polypeptide is XB25 (Figure 2-14B).

Characterization of RNAiXB25 Lines

RNAiXB25 transgenic lines showed no apparent morphological differences compared to

TP309 at both the seedling stage and the adult stage (Figure 2-15A). The seeds of both

RNAiXB25 lines and TP309 lines were germinated after incubation at 37 C for three days. After

germination, both undergo vegetative development at a similar pace. In approximately three

months, both lines entered the reproductive stage, flowering. After flowering, both RNAiXB25

lines and TP309 produced about 50 healthy seeds in each panicle.

Since it has been demonstrated that AKR2, one of the XB25-related proteins in

Arabidopsis, plays a negative role in the plant disease resistance pathway (Yan et al., 2002), we

asked if XB25 plays a similar role in resistance responses. To test this hypothesis, both

RNAiXB25 and TP309 were inoculated with eitherXoo Philippine Race 6 (Xoo PR6) orXoo

Korea Race 1 (Xoo KR1) strains. Xoo PR6 is an avirulent strain carrying AvrXa21 while Xoo

KR1 is a virulent strain containing no AvrXa21. Rice plants carrying the XA21 gene displayed

full resistance to Xoo PR6, but were susceptible to Xoo KR 1. As the results show in Figure 2-

15B, at two weeks post inoculation, all transgenic lines were fully susceptible to both avirulent

and virulent strains of Xoo (data not shown), and there was no statistically significant difference

in lesion length between RNAiXB25 and TP309. These results indicate, in the absence of XA21,

down-regulation of XB25 does not show clear effects in plant disease resistance.


To isolate components involved in the XA21-mediated signaling pathway, yeast two-

hybrid screenings were performed using XA21KTM as bait. An ankyrin repeat-containing

protein, referred to as XB25, was identified. XB25 contains four ankyrin repeats in its C-terminal

part and one PEST motif in the middle. Seven XB25-related proteins were identified in rice,

Arabidopsis, and tobacco. The N-termini of these proteins are variable whereas the C-terminal

ankyrin repeat domains are highly conserved. Ankyrin repeats are usually involved in protein-

protein interactions and can interact with diverse partners. The high homology of ankyrin repeat

domains shared by these proteins suggests that they may interact with some similar proteins.

In yeast, XB25 specifically interacted with XA21KTM, however, it did not interact with

XA21K containing no transmembrane domain. Atransmembane domain has been found to be

critical to maintain the function of some resistance proteins. For instance, a single amino acid

mutation in the transmembrane domain of Pi-d2 abolishes the normal function of this resistance

protein; rice carrying this mutated gene displays full susceptibility (Chen et al., 2006). The

requirement of a transmembrane domain for the interaction between XB25 and XA21 suggests

that XB25 may bind to a region of XA21 that contains all or part of the transmembrane domain.

An alternative explanation for this phenomenon is that the transmembrane domain of XA21 is

required for proper protein folding, which is necessary for the interaction. Another XA21-

binding protein, XB3, interacts with XA21K instead of XA21KTM, suggesting that different

XA21-binding proteins interact with different regions of XA21.

The ankyrin repeat region of XB3 is sufficient for interactions with XA21 (Wang et al.,

2006). However, rather than the C-terminal ankyrin domain, the N-terminal part of XB25 is

sufficient for the interaction with XA21. No obvious protein-protein interaction domain was

identified in the N-terminal region of XB25, and the results suggest that this region can also

serve as a protein-protein interaction domain. Thus, XB25 carries two domains involved in

protein-protein interactions and therefore may function as a protein adaptor to link XA21 with

other defense-related proteins.

XB25 and its related proteins belong to the PANK family (Wirdnam et al., 2004). Studies

have demonstrated that members of PANK are involved in plant disease resistance. A working

model for the PANK family proposes that they may serve as transcriptional suppressors much

like the animal IkB protein (Kuhlmann et al., 2002; Yan et al., 2002). IkB harbors an ankyrin

repeat motif and a PEST domain, which are present in most members of PANK. The function of

IkB is to retard transcriptional factor NFkB in cytosol. Once the pathway is activated, IkB is

phosphorylated by IkB kinases and subsequently degraded by the proteasome. NFkB is then

released and transported to the nucleus to activate the expression of related genes (Schreck et al.,

1991). In the PANK family, three members have been shown to interact with transcriptional

factors, negatively regulate plant defense responses, or undergo phosphorylation when treated by

bacterial elicitors. TIP 1 interacts with a bZIP transcriptional factor and is down-regulated when

challenged by pathogens (Kuhlmann et al., 2002). AKR2 plays a negative role in plant resistance

responses, including the induction of PR-1 and the increase in the levels of ROS (Yan et al.,

2002). AtPhos43 is rapidly phosphorylated when treated with bacterial flagellin (Scott et al.,

2001). These results are consistent with the IkB working model. However, some questions such

as how the members of PANK retain transcriptional factors in the cytosol, if they are degraded

when attacked by pathogens, and which kinases are involved in the regulation of those proteins,

still need to be addressed.

Several members of PANK are likely involved in the PTI pathway. For instance, the rapid

phosphorylation of AtPho43 is FLS2-dependent (Scott et al., 2002). In addition, proteins related

to AtPhos43 in rice and in tomato undergo phosphorylation after the treatment with conserved

pathogen elicitors. However, transgenic plants with down-regulated XB25 transcripts

(RNAiXB25) showed similar susceptibility to Xoo compared to wild-type TP309, while down-

regulation ofAKR2 leads to reduced bacterial growth. A possible explanation for the failure to

observe reduced bacterial growth in RNAiXB25 lines is that XB25 and its homologues may be

functional redundancy. Alternatively, XB25 may be involved in PTI-mediated plant defense

responses. Nevertheless, the Xoo strains used here are highly virulent, down-regulation of XB25

may not be sufficient to counteract their virulence. Further studies of RNAiXB25 plants

inoculated with less aggressive, virulent Xoo strains will help us understand the role which XB25

plays in PTI.

150 bp

Figure 2-1. Schematic representation of the genomic region of XB25 (derived from the rice gene
accession number Os09g33810 in TIGR database). The genomic region ofXB25
consists of nine exons (closed black boxes) and eight introns (lines between every
two closed black boxes). The exon-intron boundaries are based on the comparison
between cDNA sequence and rice genomic sequence. The start codon and stop codon
are indicated as ATG and TGA. The bar indicates the scale.




Figure 2-2. Predicted amino acid sequence ofXB25. The underlined region (aa204-240) indicates
the predicted PEST domain. Four ankyrin repeats were identified in XB25 (aa236-
329). The conserved residues of the ankyrin repeats are indicated in red.

I ---------------------------------------------------------------------------- I
Consensus ................e.........ks...... ....GNpFDFs.n..ILNDPS'kE.R#QIRkDP

81 90 100 110 120 130 140 150 160
Consensus aFL#$REQlqk .................... Pa.DpqqYTHqqvqnPqF. HRErLG.aLnqDP.HSsnLe.InP.h

161 170 180 190 200 210 220 230 240
Consensus keq.eeRnarnK#DPslKpI$dEi#.GgPaR$nkYMNDp#vl.K.g.RHg....g..a......g.#e.eE.g......e

241 250 260 270 280 290 300 310 320

321 330 340 350 360 365
I -------------------------------------------
Consensus eCV.LLL.nGRRVT.#N$DgKtpI#VRkLNnQ.#VlklLEkdRFI

Figure 2-3 Sequence alignments of XB25 andits relatedproteins innce (XB25, XBOS25-1 and
XBOS25-2), Arabidopsis thaana (AKR2 and AtPhos43), and tobacco (TIP1, TIP2
and TIP3) The amino acid sequences of these proteins were aligned by MultAln
Amino acid residues showing high consensus value (>90%) are indcated in red
Amino acid residues showing low consensus value (more than 50% but less than 90%)
are indicated in blue









Figure 2-4. Phylogenetic tree derived from a ClustalX alignment based on the predicted amino
acid sequences of XB25 and related proteins in rice (XBOS25-1 and XBOS25-2),
Arabidopsis thahana (AKR2 and AtPhos43) and tobacco (TIP1, TIP2, and TIP3). The
gene accession numbers for these proteins are Os09g33810 (XB25), Os03g63480
(XBOS25-1), Os08g42690 (XBOS25-2), At2g17390 (AtPhos43), At4g35450 (AKR2),
AF352797 (TIP1), AY258007 (TIP2), and AA091862 (TIP3).

Table 2-1. Amino acid sequence comparisons of XB25 and related proteins. In each cell, the
numbers on left show the percentage of similarity and the numbers on right indicate
the percentage of identity.

XB25 XBOS25-1 XBOS25-2 AtPho43 AKR2 TIP1 TIP2

XBOS25-1 74,68

XBOS25-2 73,67 69,62

AtPhos43 73,65 63,56 70,62

AKR2 72,65 71,62 72,66 87,83

TIP1 72,63 68,55 73,65 71,60 68, 60

TIP2 73.64 67,63 72,64 72,58 70,65 75,68

TIP3 70, 62 65, 58 70, 63 70, 63 72, 64 74, 65 76, 64


c-MycProA JM

LRR I Kinase (1-1025)

DraIII K736












kyrin repeats

















Figure 2-5 XB25 mteracted with XA21KTM in yeast A) Schematic representations of XA21
and its derivatives Domains are as descnbed by Song et al (1995) The
transmembrane domain is in black The juxtamembrane (JM) domain is represented
by the dotted box with its sequence shown above The underlined residues are
XA21CS1 in the JM domain The autophosphorylated residues within this region are
lughlighted inred The conserved Lys736 (K736) is shown XA21KTM that was
used in the yeast two-hybrid hbrary screening, and XA21K without the
transmembrane domain are indicated below Pi-d2, a nce resistance protein
conferring resistance to a fungal pathogen, is also shown B) Schematic
representation of XB25 and its truncated versions XB25N spans N-termnal ammo
acids located upstream of the ankynn repeat domain XB25C contains the complete
ankynn repeat domain C) Interactions between XB25 and XA21KTM in yeast
Indicated constructs were co-transformed into yeast cells Cells growing up on the
double deficient medium (SD/-Trp-Leu) were replicated to the triple deficient
medium (SD/-Trp-Leu-His) Cells capable of growing on this medium indicate that
the interactions occur between bait and prey proteins

i N
7 7


0 C', a ID 0




Figure 2-6 Bactenal expression and punfication of different XA21

andXB25 fusion proteins

FLAG-XB25 (A), MBP-XB25M (B), His-XA21KTM (C), and GST-XB25M (D) A
these fusion proteins are expressed in E coh strain ER2566 and punfied Proteins
were visualized by Coomasse blue staining, and the purifiedproducts are indicated
by arows



l 1-- FLAG-XB25

Figure 2-7. In vitro interaction between XA21KTM and XB25. His-XA21KTM and FLAG-
XB25 were expressed inE.coh strain ER2566. Purified FLAG-XB25 was mixed with
bacterial crude extracts containing either His-XA21KTM or empty vector. His-
XA21KTM was pulled down using Ni-NTA His-binding resin and the precipitates
were immunodetected by anti-FLAG M2 antibody.


1 10 20 30 40 50 GO 70 80
I---------- ---------------------------------------------- --------------------I
Consensus ...e...s.......d.kk..kP#gss...rg..P... pa..NpFDFs...nLLNDPSiKEnR#QIRkDPaFT#HREQl

81 90 100 110 120 130 140 150 160
Consensus qk.........aa...geqg.P1RDP..Y.eThqq.H#nPqF..HRERLG.aLnqDPaMSS$Le.LTsP.Hke.1EeR.s

161 170 180 190 200 210 220 230 240
Consensus RnK#DPslK.I$DEiE.GgPaRf.KYMNDPE.lqKigqRg....g#....g.eg.E..e... E#Gey#DESiiHHTHS

241 250 260 270 280 290 300 310 320

321 330 340 350 355
I------------------- --------- ----I
Consensus HRVLt..ndgktaidvaklnnq.evi.llek.af.

Figure 2- Sequence alignments of XB25 and related proteins in rice (XBOS25-1 and XBOS25-
2) The ammo acid sequences ofthese proteins were aligned by MultAlm Amino acid
residues showing high consensus value (>90%) are indicated in red Amino acid
residues showing low consensus value (more than 50% but less than 90% ) are
indicated in blue The underlined region is used to develop anti-XB25M antibodies


4 4


Figure 2-9. Immunodetection of FLAG-XB25 expressed in E. colt strain ER2566 by anti-
XB25M. A 45 kD band was detected in bacterial crude extracts containing FLAG-
XB25, while no band at the same position was detected in bacterial crude extract
containing empty vector.

I -......... .---. .---------4-- -+-- I

81 90 100 110 120 130 140 150 160

161 170

180 190 200 210 220 225

I---- ------------------------------ -- I
cc.a.ttat.ttcTITttcaCttLg...ctag..Tac..c.c..cLttLLt.ttC TgTaTTCaT

Figure 2-10. Sequence alignments of the region of XB25 used to create the RNAiXB25 construct
and the corresponding regions ofXBOS25-1 and XBOS25-2. The nucleotide
sequences were aligned by MultAlin. Nucleotide sequences showing high consensus
value (>90%) are indicated in red. Nucleotide sequences showing low consensus
value (more than 50% but less than 90%) are indicated in blue.




1 10 20

30 40 50 60

70 80

maize ubiquitin promoter

SpeI (10870) f
HirdIII (10570)
HirdIII (9490) I
XB25 -
Nos terminator
CaMV35S promoter

hygromycin (R) '
CaMV35S polyA/

1III (2)
T-Border (right)


12901 bp

pVS1 rep

pBR322 bom
S pBR322 ori
kanamycin (R)

T-Border (left)

Figure 2-11. Diagram of the expression construct pCMHUdsXB25 used to generate RNAiXB25
transgenic lines. The dsXB25 fragment was cloned into the Spel sites flanking by the
maize ubiquitin promoter and the nopaline synthase (Nos) terminator. The
hygromycin gene was used as a selection maker for transgenic lines. The kanamycin
resistant gene was used as a selection marker for bacterial transformation.

150 bp



1 10 20 30 40 50 60 70 80
I--------------------------------+---------- ---------I
XRP9 RTrGRn--nr nnnrrnnGnnGRRT rA rrGRGGifriTrTTrTii
Consensus ............. gcttLL........ g.ag.cga.Gg.Ra.ga.gGaRgaaaa.LLCaaaacCagRgGggtCatCca.

81 90 100 110 120 130 140 150 160
Consensus .cLtCRa... gagTCcgCCgge. cGagc..gCCt C..ccRRtcCtTTtGHfTTttCtL.c.Tga.cRaCTTGC

161 170 180 190 200 210 220 230 240
I--------.---------.---------.-------------------.- ------------------.--------- I

241 250 260 270 280 290 300 310 320
XBOS25-1 TGGRRGGCG--------------GGRGCGGGCTG--------------------CCTGCHRTRGRCCCT----
Consensus aaGR.gGcgc... g.c....... cGGgGaaCaGgGcagg....................CCtGCa.TgGRcCC.... a

321 330 340 350 360 370 380 390 400
I--------.---------.---------.-------------------.- ------------------.--------- I
Consensus gTRCaTggaaRCaRTGcaacRg.TcRTGcRaRaCCC.CHRTTc.Tg.CaRTGGCaGRgCGtCTtGGgaatgCtCTtaTGc

401 410 420 430 440 450 460 470 480
I--------.---------.----------------------------.--------------------.--------- I
Consensus RGGfCCLGcaRTGTCcagtaTGCT.Ga.agetTgRCtRgtCC..c.CRLtRRgagcaGcT.GRaGagCG.aT.tCcCGL

481 490 500 510 520 530533
Consensus RTgRRgGRaGHtCCcLCc.TgARfg.c.RTtcT.GHtGGaTaGRGR.tLggg.

Fgure 2-12 Schematic representation and alignments of probe from the N-termmus ofXB25
used forNorthern Blot A) Schematic representation ofXB25 genomic region The
blue sold underlined region was used to synthesize the probe and the red underlined
region was used to generate RNAi B25 transgenic lines, B) Sequence alignm ents of
the region ofXB25 used to synthesize the probe and the corresponding regions of
XOS25-1 and YXOS25-2

TP 4 5 14 15 18 19 20 24 26 29 30 3134 35 37 4142 44 46 47 48 49 TP

Probe: XB25

Probe: GUS-loop

Figure 2-13. Identification of RNAiXB25 transgenic lines with reduced XB25 transcripts by
Northern Blot using a probe against eitherXB25 (upper) or GUS-loop (lower). TP:
wild-type TP309; Lanes 4-49: individual independent transgenic line. Three
transgenic lines (highlight in red) were chosen for further characterization.

TP309 S34

S41 S42

Total RNA



10 -XB25

S" mu u Ponceau S

Figure 2-14, Both RNA transcript and protein levels of XB25 are reduced in RNAiB25
transgenic lines, A) Northern Blot analyses show the RNA transcript ofTB25 is
reduced in three RNAiB25 transgenic lines (upper), Total RNA showed that
comparable amounts of RNA were loaded in each lane (lower). B) Western Blot
shows one 42 kD band was immunodetected by anti-XB25M in TP309 and was
significantly reduced in three transgenic lines (upper), Ponseau S-stained same blot
shows that comparable amounts of total protein extracts were loaded in each lane


One-month-old Three-month-old

TP309 RNAiXB25

TP309 RNAiXB25

TP39 S34 S4N1

nlanl lies

Figure 2-15 RNAXB25 lines show no morphological difference compared to TP309 and all of
them show comparable degrees of susceptibility toXoo PR6 A) Photograph of
plants showing phenotypes of RNAiXB25 and TP309 at the seedling stage (left) and
at the adult stage (nght) B) Photograph of nce leaves showing lesion development
two weeks after inoculation withXoo PR6 (left), and the lesion length of indicated
lines night ) S34, S41, and S42 are three independent RNAiXB25 transgemc lines

TP309 S34 S41 S42



Plant effector-triggered immunity (ETI) is governed by a host resistant (R) gene and a

corresponding pathogen race-specific avirulent (Avr) gene. The associated interaction of an R

gene and a cognate Avr gene is described as the gene-for-gene model (Flor, 1971), which states

that for each R gene in the host, there is a cognate Avr gene in the pathogen. Plant disease

resistance is determined by the interaction between the host R gene product (R protein) and the

corresponding Avr gene product (Avr protein). However, in the absence of either R or Avr,

pathogens evade ETI and colonize plants, which results in a susceptible phenotype.

Most R proteins are constitutively expressed even in the absence of pathogens. However, a

number of studies have shown that the steady-state levels of R proteins are well regulated. For

example, the accumulation of the Arabidopsis NB-LRR protein RPM1 is regulated by three

proteins, RIN4, AtRAR, and HSP90 (Mackey et al., 2002; Holt et al., 2005). In barley, RAR1 is

required for the accumulation of two NB-LRR resistance proteins, MLA1 and MLA6 (Bieri et al.,

2004). The tomato Pto kinase and the NB-LRR protein Prf interact with each other and

contribute reciprocally to the accumulation of each other (Mucyn et al., 2006). Therefore, many

plant resistance proteins may function in protein complexes and the levels of R proteins may

depend on their binding partners.

Xa21 confers resistance toXathomonas oryzae pv. oryzae (Xoo) carrying AvrXA21.

Xa21 encodes an RLK that is capable of autophosphorylating multiple serine/threonine residues

including S686, T688, and S689 located in the juxtamembrane (JM) domain (Xu et al., 2006).

Like several other R proteins, the accumulation of XA21 is regulated by one of its binding

proteins, XB3. As discussed in Chapter 2, XB3 was originally identified as a protein that

interacts with the kinase domain of XA21. Further studies showed that XB3 interacts with XA21

n plant (Wang et al., 2006). In addition, the steady accumulation ofXA21 is significantly

reduced in transgenic plants with reduced Xb3 transcripts, indicating that XB3 regulates the

steady-state level of XA21. Moreover, XA21-mediated resistance is also compromised when

Xb3 is down-regulated. These facts suggest that an XA21-mediated disease resistance pathway

may be regulated through the modulation of accumulation of XA21, and that the XA21 binding

proteins may contribute to this process.

In this chapter, a second XA21-binding protein, XB25, is characterized in vivo. Similar to

XB3, XB25 interacts with XA21 inplanta. Furthermore, XB25 contributes to the accumulation

of XA21 and XA21-mediated disease resistance. Finally, evidence is provided to show that

XB25 is weakly phosphorylated by XA21. These results suggest that XB25 is involved in XA21-

mediated disease resistance.

Materials and Methods

Immunodetection of XA21 in Rice

c-Myc tagged Xa21 transgenic lines (c-Myc-XA21) driven by a native Xa21 promoter

were kindly provided by Dr. Pam C. Ronald at the University of California, Davis. Total proteins

were extracted by the following protocol: 500 mg of rice leaf tissue was ground in liquid

nitrogen and mixed with an equal volume of extraction buffer [50 mM Tris-HCl (pH 7.5), 150

mM NaC1, 1 mM EDTA, 0.1% Triton X-100, 5% (v/v) P-mercaptoethanol, 1 mM 4-(2-

aminoethyl)-benzenesulfonyl fluoride (Sigma-Aldrich, St.Louis, MO), 2 gg/ml antipain (Sigma-

Aldrich), 2 gg/ml leupeptin (Sigma-Aldrich), 2 gg/ml aprotinin (Sigma-Aldrich)]. The mixture

was placed on a rocker-shaker at 4 OC for 30 min and cell debris was removed by centrifugation

at 12,000 g for 15 min. The concentration of proteins in the supernatants was measured using

Bio-Rad protein assays, and the protein samples were mixed with SDS-PAGE loading buffer

[31.25 mM Tris-HCl (pH 6.8), 5% glycerol, 1% SDS. 2.5% beta-mercaptoethonal, 0.05%

bromophenol blue].

Proteins were resolved by a 6.5 % SDS-PAGE gel at 150 volts for 3.5 h and transferred to

a pre-soaked PVDF membrane using a Mini Trans-Blot Cell (Bio-Rad, Hercules, CA) at 100

volts for 1 hour in the transfer tank containing 1 L of transfer buffer (20% methanol, 25 mM Tris,

188 mM glycine). After transfer, the membrane was incubated in 5% nonfat milk for 1 hour with

shaking, and then incubated in 10 mL of 3% bovineserum albumine (Sigma) in TTBS containing

15 pl of anti-c-myc antiserum (1:700) overnight. After washing three times with TTBS, the

membrane was incubated in 10 mL of 5% nonfat milk in TTBS containing 3 gl of secondary

anti-mouse antibodies (1: 3000) for 1 hour at room temperature with shaking. The blot was then

washed and developed using an ECL Plus kit (Amersham Biosciences, Piscataway, NJ).

Protein Atagged Xa21 transgenic lines (ProA-XA21) were described by Wang et al.

(2006). A similar procedure was followed to detect ProA-XA21 except that the peroxidase-anti-

peroxidase (PAP) (Sigma-Aldrich) was used as the primary antibody.


Total proteins were extracted from 5 g of rice leaf tissue in 25 ml of ice-cold extraction

buffer [20 mM Tris-HCl (pH8.0), 150 mM NaC1, 0.1% Triton X-100, 2.5 mM EDTA, 2mM

benzamidine (Sigma-Aldrich), 10 mM P-mercaptoethanol, 20 mM NaF, 1 mM

phenylmethanesulfonyfluoride (PMSF), 1% Protease Cocktail (Sigma-Aldrich), 10 PM leupeptin,

10% glycerol]. The mixture was placed on a rocker-shaker at 4 OC for 30 min and filtered

through double layers of Miracloth (Calbiochem, San Diego, CA). Cell debris was removed by

centrifugation twice at 8,000 g for 10 min at 40C. The supernatant was mixed with 400 Pl of IgG

Sepharose beads (Amersham Biosciences) and incubated at 4 OC for 30 min on a rocker-shaker.

The mixture was placed in a poly chromatography column (Bio-Rad) and the beads were washed

4 times with 1 mL of extraction buffer, followed by two washes with 0.4 mL of 5 mM

ammonium acetate (pH 5.0). The proteins were then eluted from beads using 2 mL of 0.5 M

HOAC (pH 3.4), neutralized with 1/10 volume of 1 M Tris-HCl (pH.8.0) and mixed with 8.8 mL

of acetone at -200C overnight to precipitate proteins. The precipitate was collected by

centrifugation at 8,000 g for 15 min and the precipitate was air-dried for 2 min. Proteins were

resuspended in 100 gl of extraction buffer.

Transphosphorylation Assays

Bacterial expression and affinity purification of the MBP-XA21KTM, MBP-

XB21KTMK736E, FLAG-XB25, FLAG-XBOS25-1 and FLAG-XB3 fusion proteins were

performed as described in Chapter 2.

Transphosphorylation assays were carried out in a mixture containing 1 gg of XA21

kinase or its derivatives, 5 gg of substrate, lx reaction buffer [50 mM HEPES (pH 7.4), 10 mM

MgCl2, 10 mM MnCl2, 1 mM dithiothreito]], and 20 gCi of [y-32P]ATP (3000 Ci/mmol)

(Amersham Biosciences). The mixture was incubated at 370C for 1 hour and resolved by an 8%

SDS-PAGE gel. After staining with coomassie brilliant, the gel was dried and exposed on X-ray


Semi-quantitative RT-PCR

Rice cDNA was prepared according to the procedure described in Chapter 2. Semi-

quantitative RT-PCR analyses were performed with primer sets P27 (5'-


GAGCCC-3') for Xa21 transcripts and P29 (5'-TGGCGCCCGAGGAGCACC-3')/P30 (5'-

GTAACCCCTCTCAGTCAG-3') for actm transcripts. The following procedure was used to

amplify Xa21: 95 OC for 5 min, followed by 20, 25 or 30 amplification cycles (940 C for 1 min,

54 OC for 1 min and 72 OC for lmin), 72 OC for 10 min. Actm was amplified by using the

following procedure: 95 OC for 5 min, 20, 25 or 30 amplification cycles (94 OC for 1 min, 50 C

for 1 min and 72 OC for lmin), 72 OC for 10 min. All PCR products were resolved by a 1%

agarose gel.

Generation of Crosses between RNAiXB25 Transgenic Lines and 4021-3 (c-Myc-XA21/c-

RNAiXB25 transgenic lines 34, 41 and 42 were used as pollen recipient parents to cross

with pollen donor 4021-3. Pollen grains were collected from 4021-3 and applied to the stigma of

RNAiXB25 lines in which stamen previously were removed by forceps. About ten seeds were

recovered from each crossed line.

Measurement of Bacterial Growth Curve

Xoo PR6 was streaked on PSA solid medium (10 g/L peptone, 10 g/L sucrose, 1 g/L

glutamic acid monosodium salt, 100 mg/L cycloheximide, 0.1 mM 5-Azacytidine) and incubated

at 28 OC for 3 days. The bacteria were diluted in water to a final OD600 of 1.0 Rice leaves were

inoculated with bacteria by cutting the leaf tips with scissors pre-dipped in the bacterial solution.

Three of the inoculated leaves were collected 0, 2, 4, 6, 8, 10, 12 and 14 days post-inoculation

and the leaves were ground thoroughly with a mortor and pestle containing 5 mg of sand and 1

ml of sterilized water. After dilution, the bacteria were placed on PSA medium and incubated at

28 OC for three days. Bacterial populations were calculated by counting the number of colonies

on the PSA plates.

Statistical Analysis

Statistical analysis of bacterial growth was performed using T-test, with P<0.05 denoting

as statistical significance.


XA21 is Associated With XB25 in Planta

To confirm that XA21 is associated with XB25 in vivo, co-immunoprecipitation assays

were performed using the ProA-tagged XA21 line 716-1 (Wang et al., 2006). Western Blot

analyses detected a 150 kD product by the PAP antibody in the Pro-XA21 transgenic lines, but

not in the recipient line TP309 (Figure 3-1), indicating that the 150 kD polypeptide is ProA-

XA21. Because IgG has a high affinity for the ProA tag, ProA-XA21 should be efficiently pulled

down by IgG beads. Indeed, ProA-XA21 was detected by the PAP antibody in the precipitates

prepared from the 716-1 lines (Figure 3-2). The 110 kD band detected by the same antibody is

likely due to the degradation of ProA-XA21 (Wang et al., 2006). No band was detected by PAP

antibody in the precipitates from the recipient line TP309, indicating the bands detected in 716-1

lines are ProA-XA21 and its degraded product. To detect the presence of XB25 in the same

precipitates, Western Blot analyses were performed using anti-XB25M. As expected, a 42 kD

band, which is identical to the size of XB25, was only found in the precipitates from the 716-1

line, but not in the precipitates from the TP309 line. To rule out the possibility that XB25 may

bind to the 128-aa ProA tag, an A6 transgenic line that expresses a TAP-tagged kinase

(Os8g37800) was used as a negative control. Os8g37800 was a randomly chosen kinase and has

no apparent connection to XA21. A similar ProA tag was placed at the N-terminus of this kinase.

No 42 kD product was detected from A6 precipitates by anti-XB25M, indicating ProA tag alone

is not sufficient to pull down XB25. A similar amount of XB25 is present in the supernatants of

all three lines. Taken together, these results indicate that XB25 is associated with XA21 in plant.

XB25 Contributes to the Accumulation of XA21

To test the role of XB25 in XA21-mediated disease resistance, c-Myc-tagged Xa2

transgenic lines (4021-3) were used to generate crosses of RNAiXB25 and 4021-3

(RNAiXB25/4021-3). A 140 kD band was specifically detected in protein extract from the 4021-

3 lines, but not in TP309, indicating that this 140 kD band is c-Myc-XA21 (Figure 3-1).

RNAiXB25 lines 34, 41 and 42 were chosen as pollen recipient lines in crosses with 4021-3,

which served as the pollen donor (Figure 3-3). A similar strategy was used to generate a cross of

TP309 and 4021-3 (TP309/4021-3).

All the F1 progeny tested contain Xa21, as showed by RT-PCR and was also confirmed by

Western Blot analyses (Figure 3-4D and 3-4B, results from 7 representative F1 plants). Two

genotypes of F1 progeny were obtained from RNAiXB25/4021-3: one contains an RNAiXB25

construct and the other does not. This segregation was confirmed by Western Blot analyses

(Figure 3-4A). The levels of XB25 were significantly reduced in 5 out of 7 of the F1 progeny,

indicating these lines contain functional RNAiXB25 constructs. Since the steady-state level of

XA21 is developmentally regulated and XB3 contributes to the stability of XA21 at the adult

stage (Xu et al, 2006; Wang et al., 2006), the levels of XA21 in these F1 progeny were then

determined at both the seeding (one-month-old) and the adult stage (four-month-old). As shown

in Figure 3-4, the levels of XA21 were comparable in all of the F1 progeny at the seedling stage

(Figure 3-4B). In contrast, at the adult stage, the levels of XA21 were dramatically reduced in the

progeny containing an RNAiXB25 construct (Figure 3-4C). These results indicate that XB25

contributes to the accumulation of XA21 only at the adult stage.

The Resistance to Xoo PR6 is Compromised in Progeny of RNAiXB25/4021-3 with Reduced
Levels of XA21 and XB25

The F1 progeny of RNAiXB25/4021-3 were inoculated with Xoo PR6. All of the plants

with reduced levels of XA21 and XB25 showed longer lesions compared to those of

TP309/4021-3, indicating that XA21-mediated disease resistance was compromised in these

lines (Figure 3-4E). An F1 progeny of RNAiXB25/4021-3 with reduced levels of XA21 and

XB25 (34/4021-3-6) was used to measure the bacterial growth. The results confirmed that

increased Xoo PR6 growth was observed in the 34/4021-3-6 line compared to that in

TP309/4021-3 (P<0.05) (Figure 3-5). These results indicate that XB25 contributes to the XA21-

mediated disease resistance.

XB25 is Phosphorylated by XA21KTM in Vitro

XA21 is an active serine/threonine kinase (Liu et al., 2002). The in vitro and in vivo

interactions between XB25 and XA21 suggest that XB25 may be a substrate of XA21KTM. To

test this hypothesis, FLAG-XB25 and MBP-XA21KTM were purified and mixed with [y-

32P]ATP. As shown in Figure 3-7, XA21KTM was capable of autophosphorylation, confirming

that XA21KTM is an active kinase. In addition, XA21KTM phosphorylated FLAG-XB25.

Because there are no serine or threonine residues present in the FLAG tag, the band observed

here should come from the phosphorylation of XB25. A dead kinase mutant MBP-

XA21KTM 736Ewas used here as a negative control. No phosphorylation was observed when

FLAG-XB25 was mixed with this mutant, indicating that XA21KTM kinase activity is required

for the phosphorylation of XB25. XBOS25-1, a highly related homologue, was also

phosphorylated by XA21KTM, supporting the conclusion that this protein plays a redundant role

as does XB25. XB3 has been shown to be phosphorylated by the kinase domain of XA21 (Wang

et al., 2006). Compared to XB3, the extent of phosphorylation of XB25 was much less,

indicating that XB25 is weakly phosphorylated by XA21KTM. This may be due to fewer

phosphorylated sites in Xb25.


XB25 was characterized for its role in XA21-mediated disease resistance. XB25 interacts

with XA21 in plant and contributes to the accumulation of XA21. In addition, XB25 was

weakly phosphorylated by XA21 in vitro. These results indicate that XB25 is a component of the

XA21 protein complex and provide a link between PANK family and R protein-mediated disease


Co-immunoprecipitation confirms that XB25 is associated with XA21 in plant. XB25

physically interacts with XA21 in vitro (Chapter 2), so it is likely that a direct interaction occurs

between XB25 and XA21 inplanta. The association of XB25 with XA21 in uninoculated plants

supports that XA21 forms a constitutive protein complex with its binding proteins. Over ten

XA21-interactors (XBs) have been identified in yeast, and XB3 and XB25 have been confirmed

to be associated with XA21 in plant. XB3 is an active E3 ubiquitin ligase, and its enzyme

activities are believed to have a role in the XA21-mediated disease resistance pathway (Wang et

al., 2006). In contrast, there is no obvious sequence information supporting the supposition that

XB25 functions as an enzyme. But XB25 does have protein-protein interaction surfaces at both

the N and C termini. These structural characteristics suggest that XB25 may work as a protein

adaptor to help to recruit more proteins into the XA21 protein complex or to facilitate XA21 into

other protein complexes.

Owing to the presence of three putative proteolytic cleavage motifs in the intracellular

domain of XA21 (XA21CS1, XA21CS2, and XA21CS3), and to the fact that XA21 can be

degraded by a developmentally regulated proteolytic activity, this rice R protein may be

intrinsically unstable. Two mechanisms, auto-phosphorylation and protein-protein interactions,

have been proposed to contribute to the accumulation of XA21 (Xu et al., 2006; Wang et al.,

2006). Autophosphorylation of XA21 may stabilize XA21. Wild-type XA21 accumulates to a

much higher level than dead kinase mutant XA21736E in rice, suggesting that the kinase activity

of XA21 is required for its accumulation. Furthermore, three serine/threonine residues (Ser686,

Thr688, and Ser689), located in XA21CS1, can be phosphorylated by the intracellular domain of

XA21. Mutation of these three residues (XA21 S6A/T688A/689A) results in the destabilization of

XA21 at the adult stage, suggesting that autophosphorylation of these residues directly or

indirectly protects XA21 from being cleaved by the putative protease.

The second mechanism by which XA21 is stabilized may be through its binding proteins.

An XA21-binding protein, XB3, has been shown to contribute to the accumulation of XA21 at

the adult stage (Wang et al., 2006). Reduction of XB25 leads to a significant decrease of XA21.

This observation reinforces the hypothesis that protein-protein interactions contribute to the

stability of XA21. There are more than ten XA21-binding proteins identified by yeast two-hybrid

screening (X. Dong, unpublished data). XA21 stability may be a useful assay to characterize

these proteins

In mammals, many receptor kinases undergo autophosphorylation to activate the

downstream signaling pathway. In addition, some of the autophosphorylated residues serve as

docking sites to recruit downstream substrates (Schlessinger, 1993; Massague, 1998). Since

XA21 can be stabilized by both autophosphorylation and protein-protein interactions, there may

be a link between these two mechanisms. It is hypothesized that the autophosphorylation of some

residues in XA21CSs may be required for the recruitment of XA21-binding proteins that

subsequently protect XA21 from being cleaved. However, the mutations of Ser686, Thr688, and

Ser689 in XA21CS1 have no effect on the interactions of XA21 with XB25 or XB3 in yeast,

suggesting that these residues may not function as binding sites for XB3 and XB25. However, it

cannot be excluded that these two XBs may interact with other autophosphorylation sites of

XA21 and therefore protect XA21 from cleavage.

Protein phosphorylation may play an important role in the regulation of plant defense

response/disease resistance. A point mutation located in the kinase domain of FLS2 eliminates

the kinase activity of FLS2 and impairs bacterial flagellin binding (G6mez-G6mez and Boiler,

2001). An invariant lysine residue, lys736, located in the kinase domain of XA21 totally

abolishes the kinase activity of XA21 and transgenic plants carrying this mutant are susceptible

to Xoo (Xu et al., 2006). Biochemical data demonstrate that the pattern of phosphoproteins

changes quickly when cells are treated with bacterial elicitors (Scott et al., 2001), which suggests

that numerous phosphoproteins are involved in the plant defense pathway. However, even

though kinases represent a maj or group of identified R gene products, very few proteins have

been shown to be phosphorylated by an R protein. Examples that do include the tomato Ptil and

Pti4 proteins that can be phosphorylated by Pto kinase and the rice XB3 protein that can be

phosphorylated by XA21 (Zhou et al., 1995; Gu et al, 2000; Wang et al., 2006). XB25 is the

second protein that acts as a substrate of XA21 in vitro. Compared to XB3, XB25 is weakly

phosphorylated by XA21. This may be due to more phosphorylated sites on XB3 than that on

XB25. Even though neither XB3 nor XB25 has been demonstrated to be phosphorylated in vivo,

the in vitro phosphorylation of XB25 by the kinase domain of XA21 provides a basis to address

this question.

XA21-mediated resistance is dosage dependent and XA21 levels are one of the

determinants for full resistance (Wang et al., 2006). Consistent with previous observations, half

of the RNAiXB25/4021-3 plants showed reduced levels of XA21 and a compromised resistance

to Xoo PR6. It should be noted that the XB25 levels in these plants were also dramatically

decreased. Therefore, it cannot be excluded that the compromised resistance may be partially

attributed to the reduction in XB25. In this case, XB25 may initiate a disease resistance signaling

pathway, and down-regulation of XB25 would suppress this pathway, leading to a compromised

XA21-mediated disease resistance.

Plant immunity systems consist of PTI and ETI, and each of them triggers different plant

defense responses. However, the mechanisms underlying these two responses may share some

common elements. It has been hypothesized that plant immunity systems act as a continuum

(Lee et al., 2006). AtPhos43, a member of PANK, is phosphorylated by the treatment with

bacterial flagellin. The kinase that phosphorylates AtPhos43 has yet to be identified. However,

experimental data have demonstrated that the phosphorylation of AtPhos43 is FLS2-dependant.

Furthermore, proteins in rice and tomato that cross-react with anti-AtPhos43 antibodies are also

phosphorylated when cells are treated by chitin and flg22. Even though the molecular

identification of these rice and tomato proteins is still under investigation, they are likely to be

members of PANK. These observations, together with the fact that XB25 is involved in XA21-

mediated disease resistance, suggest that XB25 may be a convergence point of PTI and ETI.


kD 4




4" aqW


- ProA-XA21



- c-Myc-XA21

Figure 3-1 Immunodetection of ProA-XA21 and c-MVyc-XA21 A) Schematic representation of
the ProA-XA21 construct (left) and immunodetection of ProA-XA21 by PAP
antibody (right) B) Schematic representation of the c-Mlyc-XA21 construct (left) and
immunodetection of c-Myc-XA21 by anti-myc antibody (right) n s stands for non-
specific products ProA-XA21 and c-Mlyc-XA21 were indicated by arrows





Figure 3-2 Co-immunoprecipitation assays to show that XA21 is associated with XB25 in rice
protein extracts Rice total protein extracts from 5 gram of leaf tissue ofTP309, 716-1,
and A6 (TAP- Os06g48590) were immunoprecipitated with IgG beads One-fifth of
the precipitates were detected by Western Blot using PAP (upper) or anti-XB25M
(lower) Three microliters of total protein extract from these three lines were loaded
as a control ProA-XA21, TAP-Os06g48590, and XB25 are indicated by arrows The
asterisk shows a degraded product of ProA-XA2I, the dots show non-specific



x 4021-3 (Myc-XA21/Myc-XA21)



Figure 3-3. Schematic representation of the strategy to generate crosses of RNAiXB25 and 4021-
3. RNAiXB25 serves as a pollen receiver and the homozygous Myc-XA21 line 4021-
3 serves as a pollen donor.


- XB25

- -- +* r

- Myc-XA21

Ponceau S


Ponceau S


Xr- !Actin



I 8
a 6

Q 4

0-- r-i rI. rui EI

Plant lines

Figure 3-4. XB25 contributes to the accumulation ofXA21 and is involved in XA21-mediated
disease resistance. A) The levels of XB25 in TP309, RNAiXB25/4021-3, and
TP309/4021-3 at the adult stage were immunodetected by anti-XB25M antibody. B
and C) The levels of XA21 in the indicated lines at four-month-old stage (B) and one-
month-old stage (C) were immunodetected by anti-c-Myc antibody, lower parts show
ponceau S stained same blots as loading controls. D) Semiquantitative RT-PCR
analyses of Xa21 transcripts in the indicated lines. Total RNA was used to amplify an
Xa21 region (upper) and the actin gene as a control (lower). E) Lesion length of
corresponding lines two weeks post inoculation with Xoo PR6. Each data point
represents three replications. The standard deviations are indicated.

-,- TP309
10 o TP309/4021-3

4 II



W 6

0 2 4 6 8 10 12 14

Days after inoculation
Figure 3-5. Growth ofXoo PR6 in S34/4021-3-6 and control lines. Triangles, TP309; open
circles, S34/4021-3-6; open squares, TP309/4021-3. Each point represents three
independent replications and standard deviations are indicated. The points labeled
with asterisks show a statistically significant difference among TP309, S34/4021-3-6,
and TP309/4021-3 (P<0.05).

A I IllN lI
1 2 3
Figure 3-6 Photograph of rice leaves showing lesion development two weeks after inoculation
withXoo PR6 Leaves 1, TP309/4021-3 expressmgXa21, leaves 2, TP309, leaves 3,
34/4021-3-6 with reduced XA21 and XB25









--+ ++ +

+ + -+-



- +


Figure 3-7 XB25 is phosphorylated by XA21KTM in vitro Indicated proteins were expressed
and purified, respectively XA21 kinase or its variant mutant was mixed with
indicated substrates and [y-32P]ATP Autoradiography (left) and Coomassle blue
staining (right) of the same gel are shown The position of each protein is indicated by
an arrow n s non-specific products



A large number of proteins accomplish their cellular biological functions through protein-

protein interactions. Various tools have been developed to detect protein-protein interactions, and

the yeast two-hybrid system is a simple but powerful approach to analyze protein associations.

This system was first invented by Fields and Song in 1989, and is based on the molecular

properties of a naturally occurring transcription factor, such as the yeast GAL4 protein (Baleja et

al., 1997). Atranscription factor consists of two parts, a DNA binding domain (BD), which can

directly bind a promoter DNA sequence, and an activation domain (AD), which facilitates the

assembly of a general transcription complex. Successful activation of transcription requires a

physical, but not necessarily a covalent, association of these two domains. In the yeast two-

hybrid system, AD and BD fuse independently to two proteins, referred to as bait and prey, and

both of these fusion proteins are co-transformed into yeast cells. If the bait and prey can interact

with each other, a functional transcription factor may reconstitute that in turn activates the

downstream reporter genes. Two reporter genes, HIS3 and lacZ, are widely used in the yeast two-

hybrid systems. HIS3 encodes an imidazoleglycerol-phosphate dehydratase that catalyzes the

biosynthesis of the amino acid histidine. The activation of HIS3 enables yeast cells to grow on

histidine-deficient medium. The lacZ gene encodes a P-galactosidase enzyme that cleaves the

colorless substrate 5-bromo-4-chloro-3-indolyl-b-galactopyranoside (X-gal) into galactose and

an insoluble blue product. Thus, if the lacZ gene is activated, the yeast cells will become blue on

X-gal-containing medium.

Yeast two-hybrid has been widely used to dissect various plant signal transduction

pathways, including plant-specific-ankyrin-proteins (PANKs)-mediated plant defense signaling.

GLU1, a class I beta-1,3-glucanase, was found to interact with the PANK protein GBP1/TIP2 in

tobacco (Wirdnam et al., 2004). GLU1 is a PR-like protein and is involved in the degradation of

beta-1,3-glucan callose (Bucher et al., 2001). Callose deposition is atypical defense response

involved in PAMPs-triggered immunity (PTI). Transgenic tobacco that displayed a reduced

expression of GLU1 showed an enhanced resistance to virus infection (Bucher et al., 2001). Thus,

GBP1/TIP2 may regulate the basal defense responses through interacting with GLU1, resulting

in a subsequent change of callose deposition. The bZIP transcription factor, BZI-1, interacted

with the tobacco ANK /TIP1/HBP1 protein that belongs to the PANK family and was required

for the initiation of plant defense responses (Kuhlmann et al., 2002). These interactions suggest

that ANK1/TIP1/HBP1 might be involved in plant defense responses by regulating these

transcription factors. Another protein that was identified by yeast two-hybrid analyses is the

ascorbate peroxidase 3 (APX3) that interacted with the PANK protein, AKR2 (Yan et al, 2002).

APX3 is one of the major enzymes involved in the degradation of such reactive oxygen species

(ROS) as H202. ROS are important second messagers in triggering plant defense responses

including the induction of the expression of defense-related genes and an HR response (Levin et

al, 1994; Jabs et al., 1996). The interaction between APX3 and AKR2 suggests that AKR2 may

regulate plant defense responses by modulating the levels of ROS. Collectively, these results

suggest that members of PANK interact with diverse proteins and may be involved in various

plant defense responses.

XB25 is the only known PANK that is involved in R gene-mediated disease resistance.

Therefore, identification of XB25 interactors will provide useful information to help us to

elucidate the functions of PANKs. Here, a rice yeast two-hybrid cDNA library was screened by

using two truncated versions of XB25 (XB25N and XB25C) as bait, and the two XB25-binding

proteins isolated are the focus of this chapter.

Materials and Methods

Construction of BD-XB25, BD-XB25N, and BD-XB25C

To make an in-frame translational fusion with a GAL4 BD, XB25, XB25N, and XB25C

were cloned into the plasmid pDBLeu that carries a GAL4 BD (Ding et al., 2004). BD-XB25

was created by sub-cloning the XB25 fragment from pPC86-XB25 into the corresponding sites of

pDBLeu vector. XB25N (aal-214) contains the amino acids located upstream of the ankyrin

repeat domain of XB25, and XB25C (aa195-329) covers the entire ankyrin repeat domain of

XB25. The fragments encoding XB25N and XB25C were amplified by the primers sets P31 (5'-




GCTAGGAAAGCGTCCATCTCGAG-3'), respectively. The PCR products were digested with

SalI/NotI and sub-cloned into the corresponding sites of the pDBLeu vector.

Auto-activation Assays of the HIS3 Reporter Gene

The bait constructs (pDBLeu-XB25, pDBLeu-XB25N, and pDBLeu-XB25C) were

transformed into the yeast strain CG1945 (MATa ura3-52 his3-200 lys2-801 trpl-901 ade2-101

leu2-3,112 gal4-542 gal80-538 LYS2::GAL1-HIS3 cyhr2 URA3::[GAL4 17-mers]3-CYC1-lacZ)

using the procedure described previously (Chapter 2). The transformants containing one of the

above constructs were mated with the yeast strain MaV203 yeast strain (MAT e leu2-3,112 trpl-

901 his3A200 ade2-101 cyh2r canf gal4A gal80A GAL: :lacZ HIS3UASGAl: :HIS3@LYS2

SPAL10 OASGALI:: URA3) carrying the empty prey vector pPC86. To perform the mating reactions,

the yeast cultures of both genotypes were incubated at 30 oC overnight with shaking at 250 rpm

and diluted to an OD600 of 0.2 and continued to grow until reaching an OD600 of 0.8. The cells

were harvested by centrifugation at 3,000 g for 2 min at room temperature. The cells were

resuspended in 500 gl of YCM medium (1% bactopeptone, 1% yeast extract and 2% glucose, pH

3.5). Bait and prey-carrying cells were then mixed in a 1:1 ratio and continued to grow for 1 hour.

The cells were then harvested after centrifugation under the same conditions and re-suspended in

200 gl of TE buffer [10 mM Tris-HCl (pH 7.5) and 1 mM EDTA]. This mating mixture was

plated on SD/-Leu-Trp medium and incubated at 30 oC for 3-4 days.

To test the auto-activation of the HIS3 reporter gene, co-transformants carrying a bait

construct (pDBLeu-XB25, pDBLeu-XB25N, or pDBLeu-XB25C) and a prey construct (pPC86)

were streaked on SD/-Leu-Trp-His medium supplemented with 0 mM or 5 mM of 3-amino-1, 2,

4-trizole (3-AT, Sigma-Aldrich) and incubated at 30 oC for 3-4 days.

Screening of a Rice Yeast Two-hybrid cDNA Library

A yeast two-hybrid screening was performed according to the procedure described by Ding

et al (2006). The yeast strain CG1945 carrying a bait construct was streaked onto SD/-Leu plates

and grown at 30 C for 3-4 days. Two colonies, 2-3 mm in diameter, were inoculated into 1 mL

of SD/-Leu medium and incubated at 30 oC with shaking at 250 rpm for about 18 hours. The cell

culture was diluted to an OD600 of 0.2 in 20 mL of SD/-Leu medium and allowed to grow until

an OD600 of 0.8.

The u-mating type MaV203 yeast cells containing a rice cDNA library constructed in the

pPC86 vector were thawed at room temperature for 10-15 min after removal from storage in a -

80 C freezer. Approximately 8 mL of the yeast cell culture (~1.6 x 108 yeast cells) carrying the

bait construct was mixed with the thawed cDNA library cells containing ~7 x 10 viable cells to

a ratio of 2.3:1. The cells were harvested after centrifugation at 3,000 g for 2 min at room

temperature. The collected cells were re-suspended in 2.3 mL of YCM medium (pH 3.5) to

obtain a cell destiny of 10 cells/mL and allowed to grow at 30 oC for 105 min. The cells were

diluted 100-fold in sterilized water, and vortexed at maximum speed for 1 minute to disperse the

cells. The cells were harvested on a 47 mm water membrane with 0.45 gm pore size

(MILLIPORE, Billerica, MA). The membrane was transferred to solid YCM medium (pH 4.5)

and incubated at 30 oC for 4.5 hours.

The cells on the membrane were washed into 10 mL of 1 M sorbitol solution by vortexing

vigorously for 1 minute. After centrifugation at 3,000 g for 2 min at room temperature, the

harvested cells were re-suspended in 2 mL of TE buffer, spread onto bioassay dishes containing

SD/-Leu-Trp-His medium supplemented with 0 mM or 5 mM of 3-AT (Sigma-Aldrich, St.Louis,

MO), and then grown at 30 oC for 6-10 days.

The mating efficiency was determined by spreading 0.1 pl of the cell suspension onto SD/-

Trp, SD/-Leu, and SD/-Leu-Trp media. The number of colonies on each plate was counted 3-4

days after incubation at 30 oC. The mating efficiency was calculated by the following equation:

total number of colonies on SD/-Leu-Trp plate/the sum of total number of colonies on SD/-Leu

and SD/-Trp plate.

Recovery of Prey Plasmids

Single colonies capable of growing on the SD/-Leu-Trp-His medium were inoculated into

2 mL of SD/-Leu-Trp-His medium supplemented with 0 mM or 5 mM of 3-AT, and incubated at

30 C with shaking at 250 rpm for 3 days. The plasmids in the yeast cells were extracted using

the Zymoprep Yeast Plasmid Miniprep Kit (ZYMO Research, Orange, CA), according to the

procedure described previously(Chapter 2).

Transformation of Isolated Prey Plasmids into Escherichia coli

The isolated plasmids were transformed into E. coh in a 96-well chimney plate. The plate,

containing 20 pl ofXL2-Blue Ultracompetent Cells (Stratagene, La Jolla, CA) and 0.03 ng of

plasmids in each well, was heat shocked at 42 C for 30 seconds, and placed on ice for 2 min.

Cells were then transferred to 300 gl of NZY+ medium (10 g/L NZ amine, 5 g/L yeast extract, 5

g/L NaC1, 12.5 mM of MgCl2, 12.5 mM of MgSO4, and 0.4% glucose), and incubated at 37 C

for 1 hour. 300 gl of LB containing 50 gg/mL ampicillin (LBAp) was added to each well of the

plate and the cell culture continued to grow at 30 oC overnight. The transformants were streaked

on LBAp medium for single colonies.

For DNA sequencing of the inserts in the prey plasmids, single colonies were inoculated

into 5 mL of LBAp, and grown at 37 C overnight with shaking at 250 rpm. The plasmids were

extracted using the Wizard Plus SV Minipreps DNA Purification System (Promega, Madison,

WI). The inserts in prey plasmids were sequenced by the DNA Sequence Core at the University

of Florida using a primer based on the sequence of the GAL4 DNA activation domain present in

the pDBLeu vector (SS020: 5'-AGGGATGTTTAATACCACTAC-3'). The sequences were

analyzed using the software Sequencher v 4.0.5 (Gene Codes Corporation, Ann Arbor, MI). The

insert sequences were used as a query to identify rice full length coding sequences by searching

TIGR rice genome database (http://www.tigr.org/tdb/e2kl/osal/).

Verification of Candidate Interactors

Both bait and prey plasmids were co-transformed into yeast competent cells CG1945 using

the procedure described previously (Chapter 2). The transformants were grown on SD/-Trp-Leu

medium at 30 C for 3 days. The colonies grown on the SD/-Trp-Leu medium were then

replicated onto SD/-Trp-Leu-His medium and grown at 30 oC for 3-4 days.


Construction of BD-XB25, BD-XB25N, and BD-XB25C bait

To identify proteins that interact with XB25, full length XB25 and two derivatives

(XB25N and XB25C) were in-frame fused to the C-terminus of GAL4 BD in the bait vector

pDBLeu. XB25N spans the N-terminal half of XB25 (aa 1-214), whereas XB25C encompasses

a C-terminal region (aa 196-329) containing the four ankyrin repeat of XB25 (Figure 4-1).

To test whether the bait constructs can activate the HIS3 reporter gene in the absence of a

prey protein, BD-XB25, BD-XB25N, and BD-XB25C were transformed into yeast cells CG1945,

respectively. The cells carrying each of the bait constructs were mated with yeast cells MaV203

containing the empty AD vector. As shown in Figure 4-2A, the mating was successful because

all the yeast cells grew on SD/-Leu-Trp medium. When streaked on SD/-Trp-Leu-His medium,

yeast cells containing the BD-XB25C and the AD vector did not grow, indicating that XB25C

cannot auto-activate the HIS3 reporter gene. However, yeast cells carrying either BD-XB25N or

BD-XB25 grew on the SD/-Leu-Trp-His medium, indicating that HIS3 auto-activation occurs in

the presence of XB25N or XB25 (Figure 4-2B). As shown in Figure 4-2C, yeast cells containing

BD-XB25N and AD vector did not grow on SD/-Leu-Trp-His medium supplemented with 5 mM

3-AT that can suppress the leaky expression of HIS3 gene, demonstrating that under these

stringent conditions, HIS3 auto-activation of XB25N was abolished. Therefore, 5 mM 3-AT was

added to the medium for yeast two-hybrid screening when BD-XB25N was used as the bait. BD-

Xb25 caused the auto-activation of HIS3 gene even when 5 mM 3-AT was added to the SD/-

Leu-Trp-His medium, indicating that BD-XB25 is inappropriate for the yeast two-hybrid


Identification of XB25N and XB25C Interactors Using Yeast Two-Hybrid Screenings

Both BD-XB25N and BD-XB25C were used as bait to perform yeast two-hybrid

screenings. For each screening, more than 2.5 million transformants were obtained.

No obvious colony was identified on the SD/-Trp-Leu-His + 5 mM 3-AT medium

following the original screening for BD-XB25N. In contrast, seventeen clones were selected

following the original screening for XB25C. The bait and prey plasmids were extracted and co-

transformed into E.coll. Only prey-carrying colonies are capable of growing on LB p medium.

Therefore seventeen prey plasmids were recovered and the corresponding inserts were identified

by sequencing. Nine inserts that were in-frame fused to the GAL4 BD domain and their

corresponding rice full length coding sequences were acquired and summarized in Table 4-1.

These nine prey inserts correspond to three rice genes. The first gene (Os02g44220)

encodes a putative rice peroxisomal biogenesis factor 19 (PEX19) with 260 amino acids. The

second gene (Os06gl2230) encodes a rice TCP domain-containing transcription factor. The TCP

domain is a short sequence motif that was originally identified in the cycloidea (cyc) and teosinte

branched 1 (tbl) genes (Carpenter & Coen, 1990; Doebley et al., 1997), and later was also found

in two rice genes, PCF-1 and PCF-2 (Kosugi and Ohashi, 1997). This domain contains a region

that forms a conserved basic-helix-loop-helix (bHLH) structure which is often involved in DNA-

binding and dimerization (Cubas et al., 1999). The third gene (Os06g13680) encodes a B12D-

like protein that is involved in the embryo development of barley seed (Aalen et al., 1994)

Verification of Candidate XB25C Interactors in Yeast

To verify the interactions between XB25C and candidate interactors, both bait and prey

plasmids were re-transformed into fresh yeast competent cells. As is shown in Figure 4-3, the

interaction between XB25C and PEX19 can be reproduced. Moreover, PEX19 failed to interact

with XA21KTM, indicating that PEX19 specifically interacts with XB25C (Figure 4-3A). The

TCP protein Os06g12230 can auto-activate the HIS3 reporter gene on SD/-Leu-Trp-His medium

(data not shown). This auto-activation can be abolished by supplementation with 1 mM 3-AT

(Figure 4-3B). Similar to PEX19, the TCP protein interacted with XB25C, but not with

XA21KTM (Figure 4-3B). The third XB25C interactor candidate, XB25C-8, failed to interact

with XB25C, indicating that this protein is a false positive interactor.


The identification of XB25 interactors will expand the XA21-XB25 defense network.

Using yeast two-hybrid screenings, two XB25-binding proteins have been identified. One is a

peroxisomal biosynthesis factor (PEX19), the other is a TCP transcription factor.

PEX19 is a member of the PEX family that is involved in the regulation of peroxisomal

biogenesis and maintains the normal function of peroxisomes (Kazumasa et al, 2007).

Peroxisomes are single lipid bi-layer membrane-bound organelles found in all eukaryotic

organisms. Unlike chloroplasts and mitochondria, which are autonomous organelles that multiply

by growth and division (Lazarow and Fujiki, 1985), peroxisomes are derived from the

endoplasmic reticulum (ER) (Geuze et al., 2003; Tabak et al., 2003). In Arabidopsis, at least 22

PEX genes have been identified, and PEX19 was found to be important for maintaining normal

peroxisomal morphology (Kazumasa et al., 2007). In yeast and mammals, PEX19 is mainly

present in the cytosol and acts as a chaperone-like protein for the assembly of peroxisomal

membrane proteins (PMPs) (Jones et al., 2007). This suggests that the protein may interact with

a wide range of proteins.

A recent study suggested that peroxisomes may be involved in the plant defense responses

(Lipka et al., 2005). When Arabidopsis plants were infected with a fugal pathogen, Blumeria

graminis f sp. hordes (Bgh), the accumulation of peroxisomes was observed at the pathogen

entry sites. This result suggests that peroxisomes may function in the inducible preinvasion

resistance pathway. Peroxisomes are also one of the major sources of production and scavenging

of reactive oxygen species (ROS) that are active signal molecules involved in plant

defense/disease resistance (Brown et al., 1998; Mittler et al., 2002). Therefore the interaction

between XB25 and PEX19 suggests a role of peroxisomes in XA21-mediated disease resistance

and points a direction for further research.

The interaction between XB25C and the TCP transcription factor implies that XB25 may

regulate plant defense/disease resistance through modulating gene transcripts. The TCP family is

involved in the processes related to cell proliferation (Doebley et al., 1995). For instance, PCFs

have been found to bind to the promoter region of the rice proliferating cell nuclear antigen

(PCNA) gene. PCNA participates in a variety of cell activities, including DNA replication, DNA

repair, and cell cycle control. Therefore, TCP family may regulate cell proliferation by activating

the transcription of cell cycle regulators. As discussed in Chapter 2, PANK proteins may

function in a similar manner as the animal IkB protein, which serves as a negative regulator of

transcription factors. Therefore, the interaction between XB25C and the TCP transcription factor

supports this hypothesis. To date, however, no data have shown that TCP transcription factors

are involved in plant defense/disease resistance pathways. Consequently, further studies on the

function of this XB25-binding TCP transcription factor will help us to better justify this model.







Figure 4-1. Schematic representation of bait constructs used for yeast two-hybrid screenings.
XB25N (aal-214) contains the amino acids located upstream of the ankyrin repeat
domain. XB25C (aa195-329) spans the ankyrin repeat region. The blue box indicates
the PEST motif.The red boxes represent the ankyrin repeat domain of XB25.

S. w SD/-Leu-Trp

t* .*. ..

*:. N: W*.. "

SD/-Leu-Trp-His SD/-Leu-Trp-His + 5
mM 3-AT

Figure 4-2 Assays for auto-activation of the HIS3 gene Yeast cells containing indicated bait and
prey proteins were streaked on SD/-Leu-Trp or SD/-Leu-Trp-His medium
supplementing with 0 or 5 mM 3-AT The growth of cells on the histidine-deficient
medium indicates that auto-activation of HIS3 gene occurs

Table 4-1: Candidate XB25C interactors

Prey Gene ID Gene function Verification
XB25C-1 (aal-250)
XB25C-2 (aal-214)
XB25C-3 (aal5-204) Peroxisomal
XB25C-4 (aal-214) Os02g44220 biosynthesis factor 19 YES
XB25C-5 (aa25-260) (PEX19)
XB25C-6 (aal5-260)
XB25C-7 (aal-214)
XB25C-8 (aal-282) Os06g12230 TCP-containing YES
_____ _______________ transcription factor
XB25C-9 (aal-89) Os06gl3680 B12D-like protein NO





SD/-Leu-Trp SD/-Leu-Trp





+ 1 mM 3-AT


Figure 4-3. Verification of interactions between XB25C and candidate binding proteins. Isolated
prey plasmids from original screening were co-transformed into yeast cells with BD-
XB25C, BD-XA21KTM, or BD vector. The transformants were grown on SD/-Leu-
Trp medium (upper), and then were replicated onto SD/-Leu-Trp-His medium
supplementing with 0 mM or 1 mM 3-AT (lower). The growth of cells on the
histidine-deficient medium indicates the interactions between bait and prey occur.





In this study, an ankyrin repeat-containing protein, XB25, was characterized. XB25

belongs to a plant-specific-ankyrin-repeat (PANK) family. It specifically interacts with a rice

resistant protein XA21 in yeast and inplanta. As an XA21-binding protein, XB25 contributes to

the stability of XA21 at the adult stage and is required for the full XA21-mediated disease

resistance. In addition, XB25 is phosphorylated by XA21 in vitro. Finally, using yeast two-

hybrid screening, a peroxisomal biosynthesis factor 19 (PEX19) was identified as an XB25-

binding protein. These results indicate that XB25 is involved in XA21-mediated disease


The study of XB25 provides a link between the PANK family and a resistance protein.

However, the function of XB25 is still far away from being fully understood. Several interesting

questions need to be answered. First, XB25 was shown to be phosphorylated by XA21 in vitro,

but it is not known if XB25 is phosphorylated in plant, and if so, is the phosphorylation

dependent on XA21? This question could be addressed by immunoprecipitating XB25 from 32P

labeled plants. Nevertheless, attempts to pull down XB25 protein from rice by anti-XB25M

antiserum were failed (data not shown). This may be due to that the antigens used to generate

anti-XB25M antibodies were denatured and the anti-XB25M antibodies therefore cannot

recognize and immunoprecipitate the native XB25 protein in rice. Thus, further generation of

new anti-XB25 antibodies using native antigens may help to elucidate the question.

The second question that is worth to be studied is that since XB25 is present in both

susceptible and resistant plants, what roles does it play in the absence of XA21? Even though

down-regulation of XB25 does not have an effect on the resistance to Xoo, it can not exclude the

possibility that XB25 may be involved in the plant basal defense as do some other PANK

members. One possible explanation for the failure to observe the change of resistance to Xoo

when XB25 is down-regulated is that the Xoo strains used in this study are highly virulent and

they are able to suppress the plant basal defense response. Therefore, further analyses of the

phenotypes of plants inoculated with less virulence strains will help to answer the question.

The interaction between XB25 and PEX19 links peroxisomes to XA21-mediated disease

resistance. It is interesting to study how peroxisomes are involved in XA21-mediated disease

resistance. It was observed that peroxisomes were accumulated at the sites of entry when plants

are infected by a fungal pathogen (Lipka et al., 2005, Science), so further studies could be

focused on the changes of peroxisomal localization when plants are infected by Xoo.


Aalen RB, Opsahl-Ferstad HG, Linnestad C, Olsen OA. (1994). Transcripts encoding an
oleosin and a dormancy-related protein are present in both the aleurone layer and the
embryo of developing barley (Hordeum vulgare L.) seeds. Plant J. 5, 385-96.

Abramovitch RB, Anderson JC, Martin GB. (2006). Bacterial elicitation and evasion of plant
innate immunity. Nat Rev Mol Cell Biol. 7, 601-11.

Agrios, G.N. (1997). Plant Pathology. 4h edition, Academic Press, San Diego.

Aist. J. R. B., W.R.B. (1991). The Fungal Spore and Disease Initiation in Plants and Animals.
(New York: Plenum).

Asai T, Tena G, Plotnikova J, Willmann MR, Chin WL, Gomez-Gomez L, Boiler T,
Ausubel FM, Sheen J. (2004). MAP kinase signalling cascade in Arabidopsis innate
immunity. Nature 415, 977-983.

Axtell, M.J., and Staskawicz, B.J. (2003). Initiation of RPS2-specified disease resistance in
Arabidopsis is coupled to the AvrRpt2-directed elimination of RIN4. Cell 112, 369-377.

Axtell, M.J., Chisholm, S.T., Dahlbeck, D., and Staskawicz, B.J. (2003). Genetic and
molecular evidence that the Pseudomonas syringae type III effector protein AvrRpt2 is a
cysteine protease. Molecular microbiology 49, 1537-1546.

Axtell, M.J.a.S., B.J. (2003). Initiation of RPS2-specified disease resistance in Arabidopsis is
coupled to the AvrRpt2-directed elimination of RIN4. Cell 112, 369-377.

Azevedo, C., Sadanandom, A., Kitagawa, K., Freialdenhoven, A., Shirasu, K., and Schulze-
Lefert, P. (2002). The RAR1 interactor SGT1, an essential component of R gene-
triggered disease resistance. Science 295, 2073-2076.

Baker, B., Zambryski, P., Staskawicz, B., and Dinesh-Kumar, S.P. (1997). Signaling in
plant-microbe interactions. Science 276, 726-733.

Baleja, J. D., Thanabal, V., Wagner, G..(1997). Refined Solution Structure of the DNA-
Binding Domain of GAL4 and Use of the 3J (113Cd, 1H) in Structure Determination. J.
Biomol. NMR 10, 397.

Beffa, R., and Meins, F., Jr. (1996). Pathogenesis-related functions of plant beta-1,3-glucanases
investigated by antisense transformation--a review. Gene 179, 97-103.

Belkhadir, Y., Subramaniam, R., and Dangl, J.L. (2004a). Plant disease resistance protein
signaling: NBS-LRR proteins and their partners. Current opinion in plant biology 7, 391-

Belkhadir, Y., Nimchuk, Z., Hubert, D.A., Mackey, D., and Dangl, J.L. (2004b). Arabidopsis
RIN4 negatively regulates disease resistance mediated by RPS2 and RPM1 downstream
or independent of the NDR1 signal modulator and is not required for the virulence
functions of bacterial type III effectors AvrRpt2 or AvrRpml. The Plant Cell 16, 2822-

Belvin, M.P., and Anderson, K.V. (1996). A conserved signaling pathway: the Drosophila toll-
dorsal pathway. Annual review of cell and developmental biology 12, 393-416.

Bieri, S., Mauch, S., Shen, Q.H., Peart, J., Devoto, A., Casais, C., Ceron, F., Schulze, S.,
Steinbiss, H.H., Shirasu, K., and Schulze-Lefert, P. (2004). RAR1 positively controls
steady state levels of barley MLA resistance proteins and enables sufficient MLA6
accumulation for effective resistance. The Plant Cell 16, 3480-3495.

Bonas, U., and Lahaye, T. (2002). Plant disease resistance triggered by pathogen-derived
molecules: refined models of specific recognition. Current opinion in microbiology 5, 44-

Brown I, Trethowan J, Kerry M, Mansfi eld J and Bolwell G P.(1998). Localization of
components of the oxidative cross-linking of glycoproteins and of callose synthesis in
papillae formed during the interaction between non-pathogenic strains of Xanthomonas
campestris and French bean mesophyll cells; Plant J. 15, 333-343.

Bucher, G.L., Tarina, C., Heinlein, M., Di Serio, F., Meins, F., Jr., and Iglesias, V.A. (2001).
Local expression of enzymatically active class I beta-1, 3-glucanase enhances symptoms
of TMV infection in tobacco. Plant J 28, 361-369.

Cao, H., Bowling, S.A., Gordon, A.S., and Dong, X. (1994). Characterization of an
Arabidopsis Mutant That Is Nonresponsive to Inducers of Systemic Acquired Resistance.
The Plant Cell 6, 1583-1592.

Cao, H., Glazebrook, J., Clarke, J.D., Volko, S., and Dong, X. (1997). The Arabidopsis NPR1
gene that controls systemic acquired resistance encodes a novel protein containing
ankyrin repeats. Cell 88, 57-63.

Carpenter, R. & Coen, E.S. (1990). Floral homeotic mutations produced by transposon-
mutagenesis in Antirrhinum majus. Genes Dev. 4, 1483-1493.

Century, K.S., Lagman, R.A., Adkisson, M., Morlan, J., Tobias, R., Schwartz, K., Smith, A.,
Love, J., Ronald, P.C., and Whalen, M.C. (1999). Short communication:
developmental control of Xa21-mediated disease resistance in rice. Plant J 20, 231-236.

Century, K.S., Holub, E.B., and Staskawicz, B.J. (1995). NDR1, a locus of Arabidopsis
thahana that is required for disease resistance to both a bacterial and a fungal pathogen.
Proceedings of the National Academy of Sciences of the United States of America 92,

Century, K.S., Shapiro, A.D., Repetti, P.P., Dahlbeck, D., Holub, E., and Staskawicz, B.J.
(1997). NDR1, a pathogen-induced component required for Arabidopsis disease
resistance. Science 278, 1963-1965.

Chang, J.H., Urbach, J.M., Law, T.F., Arnold, L.W., Hu, A., Gombar, S., Grant, S.R.,
Ausubel, F.M., and Dangl, J.L. (2005). A high-throughput, near-saturating screen for
type III effector genes from Pseudomonas syringae. Proceedings of the National
Academy of Sciences of the United States of America 102, 2549-2554.

Chen, X., Shang, J., Chen, D., Lei, C., Zou, Y., Zhai, W., Liu, G., Xu, J., Ling, Z., Cao, G.,
Ma, B., Wang, Y., Zhao, X., Li, S., and Zhu, L. (2006). A B-lectin receptor kinase gene
conferring rice blast resistance. Plant J 46, 794-804.

Chern, M., Canlas, P.E., Fitzgerald, H.A., and Ronald, P.C. (2005). Rice NRR, a negative
regulator of disease resistance, interacts with Arabidopsis NPR1 and rice NH1. Plant J 43,

Chevray, P.M., and Nathans, D. (1992). Protein interaction cloning in yeast: identification of
mammalian proteins that react with the leucine zipper of Jun. Proceedings of the National
Academy of Sciences of the United States of America 89, 5789-5793.

Chinchilla, D., Bauer, Z., Regenass, M., Boiler, T., and Felix, G. (2005). The Arabidopsis
receptor kinase FLS2 binds flg22 and determines the specificity of flagellin perception.
The Plant Cell 18, 465-476.

Chisholm, S.T., Dahlbeck, D., Krishnamurthy, N., Day, B., Sjolander, K., and Staskawicz,
B.J. (2005). Molecular characterization ofproteolytic cleavage sites of the Pseudomonas
syringae effector AvrRpt2. Proceedings of the National Academy of Sciences of the
United States of America 102, 2087-2092.

Clark, S.E., Williams, R.W., and Meyerowitz, E.M. (1997). The CLAVATA1 gene encodes a
putative receptor kinase that controls shoot and floral meristem size in Arabidopsis. Cell
89, 575-585.

Coaker, G., Falick, A., and Staskawicz, B. (2005). Activation of a phytopathogenic bacterial
effector protein by a eukaryotic cyclophilin. Science 308, 548-550.

Coppinger, P., Repetti, P.P., Day, B., Dahlbeck, D., Mehlert, A., and Staskawicz, B.J. (2004).
Overexpression of the plasma membrane-localized NDR1 protein results in enhanced
bacterial disease resistance in Arabidopsis thaliana. Plant J 40, 225-237.

Cubas P, Lauter N, Doebley J, Coen E. (1999). The TCP domain: a motif found in proteins
regulating plant growth and development. Plant J 18, 215-222.

Corpas J. Francisco, Juan B. Barrosob and Luis A. del Rio. (2001). Peroxisomes as a source
of reactive oxygen species and nitric oxide signal molecules in plant cells. Trend in Plant
Sci. 6, 145-150.

Corpet, F. (1988). Multiple sequence alignment with hierarchical clustering. Nucl. Acids Res.
16, 10881-10890

da Silva, F.G., Shen, Y., Dardick, C., Burdman, S., Yadav, R.C., de Leon, A.L., and Ronald,
P.C. (2004). Bacterial genes involved in type I secretion and sulfation are required to
elicit the rice Xa21-mediated innate immune response. Mol Plant Microbe Interact 17,

Dangl, J.L., and Jones, J.D. (2001). Plant pathogens and integrated defence responses to
infection. Nature 411, 826-833.

Day, B., Dahlbeck, D., and Staskawicz, B.J. (2006). NDR1 interaction with RIN4 mediates the
differential activation of multiple disease resistance pathways in Arabidopsis. The Plant
Cell 18, 2782-2791.

Day, B., Dahlbeck, D., Huang, J., Chisholm, S.T., Li, D., and Staskawicz, B.J. (2005).
Molecular basis for the RIN4 negative regulation of RPS2 disease resistance. The Plant
Cell 17, 1292-1305.

Decatur, A.L., and Portnoy, D.A. (2000). A PEST-like sequence in listeriolysin O essential for
Listeria monocytogenes pathogenicity. Science 290, 992-995.

Deslandes, L., Olivier, J., Peeters, N., Feng, D.X., Khounlotham, M., Boucher, C., Somssich,
I., Genin, S., and Marco, Y. (2003). Physical interaction between RRS 1-R, a protein
conferring resistance to bacterial wilt, and PopP2, a type III effector targeted to the plant
nucleus. Proceedings of the National Academy of Sciences of the United States of
America 100, 8024-8029.

Diener AC and Ausubel FM. (2005). RESISTANCE TO FUSARIUM OXYSPORUM 1, a
dominant Arabidopsis resistance gene, is not race specific. Genetics 171, 305-321.

Ding, X., Zhang, Y., and Song, W.-Y. (2006). Use of rolling circle amplification for large-scale
yeast two-hybrid analyses. In Methods in Molecular Biology, Vol. 354: Plant-Pathogen
Interactions: Methods and Protocols, P. C. Ronald, ed. (Totowa, NJ: Humana Press, Inc.),
pp. 85-98.

Dixon, M.S., Golstein, C., Thomas, C.M., van Der Biezen, E.A., and Jones, J.D. (2000).
Genetic complexity of pathogen perception by plants: the example of Rcr3, a tomato gene
required specifically by Cf-2. Proceedings of the National Academy of Sciences of the
United States of America 97, 8807-8814.

Dixon, M.S., Jones, D.A., Keddie, J.S., Thomas, C.M., Harrison, K., and Jones, J.D. (1996).
The tomato Cf-2 disease resistance locus comprises two functional genes encoding
leucine-rich repeat proteins. Cell 84, 451-459.

Doebley J, Stec A, Gustus C. (1995). Teosinte branched and the origin of maize: evidence for
epistasis and the evolution of dominance. Genetics 141, 333-346.

Doebley, J., Stec, A., Hubbard, L. (1997). The evolution of apical dominance in maize. Nature
386, 485 488.

Dow, M., Newman, M.A., and von Roepenack, E. (2000). The induction and modulation of
plant defense responses by bacterial lipopolysaccharides. Annu Rev Phytopathol 38, 241

Durrant, W.E., and Dong, X. (2004). Systemic acquired resistance. Annual review of
phytopathology 42, 185-209.

Felix, G., and Boiler, T. (2003). Molecular sensing of bacteria in plants. The highly conserved
RNA-binding motif RNP-1 of bacterial cold shock proteins is recognized as an elicitor
signal in tobacco. J Biol Chem 278, 6201-208.

Felix, G., Duran, J.D., Volko, S., and Boiler, T. (1999). Plants have a sensitive perception
system for the most conserved domain of bacterial flagellin. Plant J 18, 265-276.

Feys, B.J., Moisan, L.J., Newman, M.A., and Parker, J.E. (2001). Direct interaction between
the Arabidopsis disease resistance signaling proteins, EDS1 and PAD4. The EMBO
journal 20, 5400-5411.

Fields, S., and Song, 0. (1989). A novel genetic system to detect protein-protein interactions.
Nature 340, 245-246.

Flor HH. (1971). Current status of the gene-for-gene concept. Annu. Rev. Phytophatology 9,

Fouts, D.E., Abramovitch, R.B., Alfano, J.R., Baldo, A.M., Buell, C.R., Cartinhour, S.,
Chatterjee, A.K., D'Ascenzo, M., Gwinn, M.L., Lazarowitz, S.G., Lin, N.C., Martin,
G.B., Rehm, A.H., Schneider, D.J., van Dijk, K., Tang, X., and Collmer, A. (2002).
Genomewide identification of Pseudomonas syringae pv. tomato DC3000 promoters
controlled by the HrpL alternative sigma factor. Proceedings of the National Academy of
Sciences of the United States of America 99, 2275-2280.

Freialdenhoven, A., Scherag, B., Hollricher, K., Collinge, D.B., Thordal-Christensen, H.,
and Schulze-Lefert, P. (1994). Nar-1 and Nar-2, two loci required forMlal2-specified
race-specific resistance to powdery mildew in barley. The Plant Cell 6, 983-994.

Fridborg, I., Grainger, J., Page, A., Coleman, M., Findlay, K., and Angel, S. (2003). TIP, a
novel host factor linking callose degradation with the cell-to-cell movement of Potato
virus X. Mol Plant Microbe Interact 16, 132-140.

Fumiko Taguchi, R.S., Yoshishige Inagaki, Kazuhiro Toyoda, Tomonori Shiraishi and
Yuki Ichinose. (2003). Post-translational modification of flagellin determines the
specificity of HR induction. The Plant Cell Physiol. 44, 342-349.

Geuze, H. J., Murk, J. L., Stroobants, A. K., Griffith, J. M., Kleijmeer, M. J., Koster, A. J.,
Verkleij, A. J., Distel, B. and Tabak, H. F. (2003). Involvement of the endoplasmic
reticulum in peroxisome formation. Mol. Biol. Cell 14, 2900-2907.

Glazebrook, J., Rogers, E.E., and Ausubel, F.M. (1996). Isolation of Arabidopsis mutants
with enhanced disease susceptibility by direct screening. Genetics 143, 973-982.

Godiard L, Sauviac L, Torii KU, Grenon O, Mangin B, Grimsley NH, and Marco Y. (2003).
ERECTA, an LRR receptor-like kinase protein controlling development pleiotropically
affects resistance to bacterial wilt. Plant J 36, 353-365.

Gomez-Gomez, L., and Boiler, T. (2000). FLS2: an LRR receptor-like kinase involved in the
perception of the bacterial elicitor flagellin in Arabidopsis. Molecular cell 5, 1003-1011.

Gomez-Gomez, L., Felix, G., and Boiler, T. (1999). A single locus determines sensitivity to
bacterial flagellin in Arabidopsis thaliana. Plant J 18, 277-284.

Gomez-Gomez, L., Bauer, Z., and Boiler, T. (2001). Both the extracellular leucine-rich repeat
domain and the kinase activity of FSL2 are required for flagellin binding and signaling in
Arabidopsis. The Plant Cell 13, 1155-1163.

Gu, K., Yang, B., Tian, D., Wu, L., Wang, D., Sreekala, C., Yang, F., Chu, Z., Wang, G.L.,
White, F.F., and Yin, Z. (2005). R gene expression induced by a type-III effector
triggers disease resistance in rice. Nature 435, 1122-1125.

Gu, Y.-Q., Yang, C., Thara, V.K., Zhou, J., and Martin, G.B. (2000). Pti4 is induced by
ethylene and salicylic acid, and its product is phosphorylated by the Pto kinase. The Plant
Cell 12, 771-786.

Hammond-Kosack, E. Kim and Parker, E. Jane (2003). Deciphering plant-pathogen
communication: fresh perspectives for molecular resistance breeding. Current Opinion in
Biotechnology 14, 177-193.

Hauck, P., Thilmony, R., and He, S.Y. (2003). A Pseudomonas syringae type III effector
suppresses cell wall-based extracellular defense in susceptible Arabidopsis plants.
Proceedings of the National Academy of Sciences of the United States of America 100,

Hashimoto Carl, Kathy L. Hudson and Kathryn V. Anderson (1988). The Toll gene of
drosophila, required for dorsal-ventral embryonic polarity, appears to encode a
transmembrane protein. Cell 52, 269-279.

Hayashi, F., Smith, K.D., Ozinsky, A., Hawn, T.R., Yi, E.C., Goodlett, D.R., Eng, J.K.,
Akira, S., Underhill, D.M., and Aderem, A. (2001). The innate immune response to
bacterial flagellin is mediated by Toll-like receptor 5. Nature 410, 1099-1103.

He, P., Shan, L., Lin, N.-C., Martin, G.B., Kemmerling, B., Nurnberger, T., and Sheen, J.
(2006). Specific Bacterial Suppressors of MAMP Signaling Upstream of MAPKKK in
Arabidopsis Innate Immunity. Cell 125, 563-575.

He Sheng Yang, Kinya Nomuraa and Thomas S. Whittam (2004). Type III protein secretion
mechanism in mammalian and plant pathogens. Biochim Biophys Acta. 11, 181-206.

Hoffmann, J.A., and Reichhart, J.M. (2002). Drosophila innate immunity: an evolutionary
perspective. Nature immunology 3, 121-126.

Holt, B.F., 3rd, Belkhadir, Y., and Dangl, J.L. (2005). Antagonistic control of disease
resistance protein stability in the plant immune system. Science 309, 929-932.

Hubert, D.A., Tornero, P., Belkhadir, Y., Krishna, P., Takahashi, A., Shirasu, K., and
Dangl, J.L. (2003). Cytosolic HSP90 associates with and modulates the Arabidopsis
RPM1 disease resistance protein. The EMBO journal 22, 5679-5689.

Ichimura, K., Casais, C., Peck, S.C., Shinozaki, K., and Shirasu, K. (2006). MEKK1 is
required for MPK4 activation and regulates tissue-specific and temperature-dependent
cell death in Arabidopsis. The Journal of biological chemistry 281, 36969-36976.

Iglesias, V.A., and Meins, F., Jr. (2000). Movement of plant viruses is delayed in a beta- 1,3-
glucanase-deficient mutant showing a reduced plasmodesmatal size exclusion limit and
enhanced callose deposition. Plant J21, 157-166.

Iyer, A.S., and McCouch, S.R. (2004). The rice bacterial blight resistance gene xa5 encodes a
novel form of disease resistance. Mol Plant Microbe Interact 17, 1348-1354.

Jabs T, Dietrich RA, Dangl JL. (1996) Initiation of runaway cell death in an Arabidopsis
mutant by extracellular superoxide. Science 273, 1853-1856.

Jia Yulin, Sean A. McAdams, Gregory T. Bryan, Howard P. Hershey and Barbara Valent
(2000). Direct interaction of resistance gene and avirulence gene products confers rice
blast resistance. The EMBO journal 19, 4004-4014.

Jiang GH, Xia ZH, Zhou YL, Wan J, Li DY, Chen RS, Zhai WX, Zhu LH. (2006).
Testifying the rice bacterial blight resistance gene xa5 by genetic complementation and

further analyzing xa5 (Xa5) in comparison with its homolog TFIIAgammal. Mol Genet
Genomics. 275, 354-66.

Jirage, D., Tootle, T.L., Reuber, T.L., Frost, L.N., Feys, B.J., Parker, J.E., Ausubel, F.M.,
and Glazebrook, J. (1999). Arabidopsis thaliana PAD4 encodes a lipase-like gene that is
important for salicylic acid signaling. Proceedings of the National Academy of Sciences
of the United States of America 96, 13583-13588.

Johal, G.S., and Briggs, S.P. (1992). Reductase activity encoded by the HM1 disease resistance
gene in maize. Science 258, 985-987.

Jones, D.A., Thomas, C.M., Hammond-Kosack, K.E., Balint-Kurti, P.J., and Jones, J.D.
(1994). Isolation of the tomato Cf-9 gene for resistance to Cladosporium fulvum by
transposon tagging. Science 266, 789-793.

Jones, J.D., and Dangl, J.L. (2006). The plant immune system. Nature 444, 323-329.

Jones M. Jacob, Morrell C. James, and Gould J. Stephen. (2007). PEX19 is a predominantly
cytosolic chaperone and import receptor for class 1 peroxisomal membrane proteins.
Journal of Cell Biology 164, 57-67.

Kazumasa Nito, Akane Kamigaki, Maki Kondo, Makoto Hayashi and Mikio Nishimura.
(2007). Functional Classification of Arabidopsis Peroxisome Biogenesis Factors
Proposed from Analyses of Knockdown Mutants. Plant Cell Physiology 48, 763-774.

Keshavarzi, M., Soylu, S., Brown, I., Bonas, U., Nicole, M., Rossiter, J., and Mansfield, J.
(2004). Basal defenses induced in pepper by lipopolysaccharides are suppressed by
Xanthomonas campestris pv. vesicatoria. Mol Plant Microbe Interact 17, 805-815.

Kim, H.S., Desveaux, D., Singer, A.U., Patel, P., Sondek, J., and Dangl, J.L. (2005a). The
Pseudomonas syringae effector AvrRpt2 cleaves its C-terminally acylated target, RIN4,
from Arabidopsis membranes to block RPM1 activation. Proceedings of the National
Academy of Sciences of the United States of America 102, 6496-6501.

Kim, M.G., da Cunha, L., McFall, A.J., Belkhadir, Y., DebRoy, S., Dangl, J.L., and Mackey,
D. (2005b). Two Pseudomonas syringae type III effectors inhibit RIN4-regulated basal
defense in Arabidopsis. Cell 121, 749-759.

Kinkema, M., Fan, W., and Dong, X. (2000). Nuclear localization of NPR1 is required for
activation of PR gene expression. The Plant Cell 12, 2339-2350.

Kitagawal Katsumi, Dorota Skowyra, Stephen J. Elledge, J. Wade Harper and Philip
Hieter. (1999). SGT1 Encodes an Essential Component of the Yeast Kinetochore
Assembly Pathway and a Novel Subunit of the SCF Ubiquitin Ligase Complex.
Molecular Cell 4, 21-33.

Kopp, E.B. and Medzhitov, R. (1999). The Toll-receptor family and control of innate immunity.
Current opinion immunology 11, 13-18.

Kosugi, S. and Ohashi, Y. (1997) PCF1 and PCF2 specifically bind to cis elements in the rice
proliferating cell nuclear antigen gene. The Plant Cell, 9, 1607-1619.

Kuhlmann, M., Horvay, K., Strathmann, A., Heinekamp, T., Fischer, U., Bottner, S., and
Droge-Laser, W. (2003). The alpha-helical D1 domain of the tobacco bZIP transcription
factor BZI-1 interacts with the ankyrin-repeat protein ANK1 and is important for BZI-1
function, both in auxin signaling and pathogen response. The Journal of biological
chemistry 278, 8786-8794.

Kunze, G., Zipfel, C., Robatzek, S., Niehaus, K., Boiler, T., and Felix, G. (2004). The N
terminus of bacterial elongation factor Tu elicits innate immunity in Arabidopsis plants.
The Plant Cell 16, 3496-3507.

Lazarow, P. B. and Fujiki, Y. (1985). Biogenesis of peroxisomes. Annu. Rev. Cell Biol.1, 489-

Lee, S.W., Han, S.W., Bartley, L.E., and Ronald, P.C. (2006). From the Academy:
Colloquium review. Unique characteristics of Xanthomonas oryzae pv. oryzae AvrXa21
and implications for plant innate immunity. Proceedings of the National Academy of
Sciences of the United States of America 103, 18395-18400.

Lemaitre, B., Reichhart, J.M., and Hoffmann, J.A. (1997). Drosophila host defense:
differential induction of antimicrobial peptide genes after infection by various classes of
microorganisms. Proceedings of the National Academy of Sciences of the United States
of America 94, 14614-14619.

Levine A, Tenhaken R, Dixon R, Lamb C. (1994). H202 from the oxidative burst orchestrates
the plant hypersensitive disease resistance response. Cell 79, 583-593.

Li, X., Lin, H., Zhang, W., Zou, Y., Zhang, J., Tang, X., and Zhou, J.M. (2005). Flagellin
induces innate immunity in nonhost interactions that is suppressed by Pseudomonas
syringae effectors. Proceedings of the National Academy of Sciences of the United States
of America 102, 12990-12995.

Lim, M.T., and Kunkel, B.N. (2005). The Pseudomonas syringae avrRpt2 gene contributes to
virulence on tomato. Mol Plant Microbe Interact 18, 626-633.

Lindgren, P.B., Peet, R.C., and Panopoulos, N.J. (1986). Gene cluster of Pseudomonas
syringae pv. "phaseolicola" controls pathogenicity of bean plants and hypersensitivity of
nonhost plants. Journal of bacteriology 168, 512-522.

Liu, G.Z., Pi, L.Y., Walker, J.C., Ronald, P.C., and Song, W.Y. (2002a). Biochemical
characterization of the kinase domain of the rice disease resistance receptor-like kinase
XA21. The Journal of biological chemistry 277, 20264-20269.

Liu, Y., Schiff, M., Serino, G., Deng, X.W., and Dinesh-Kumar, S.P. (2002b). Role of SCF
ubiquitin-ligase and the COP9 signalosome in the N gene-mediated resistance response to
Tobacco mosaic virus. The Plant Cell 14, 1483-1496.

Liu Y, Michael Schiff, Rajendra Marathe and S. P. Dinesh-Kumar. (2002c). Tobacco Rarl,
EDS1 and NPR1/NIM1 like genes are required for N-mediated resistance to tobacco
mosaic virus. Plant J. 30, 415-429.

Liu, Y., Burch-Smith, T., Schiff, M., Feng, S., and Dinesh-Kumar, S.P. (2004). Molecular
chaperone Hsp90 associates with resistance protein N and its signaling proteins SGT1
and Rarl to modulate an innate immune response in plants. The Journal of biological
chemistry 279, 2101-2108.

L6pez-Huertas E, Corpas FJ, Sandalio LM and Del Rio LA. (1999). Characterization of
membrane polypeptides from pea leafperoxisomes involved in superoxide radical
generation. Biochem J. 337, 531-6.

L6pez-Huertas, E., Sandalio, L. M. and del R6!o, L. A. (1995) Plant Physiol. Biochem.33,

Mackey, D., Holt, B.F., 3rd, Wiig, A., and Dangl, J.L. (2002). RIN4 interacts with
Pseudomonas syringae type III effector molecules and is required for RPM1-mediated
resistance in Arabidopsis. Cell 108, 743-754.

Mackey, D., Belkhadir, Y., Alonso, J.M., Ecker, J.R., and Dangl, J.L. (2003). Arabidopsis
RIN4 is a target of the type III virulence effector AvrRpt2 and modulates RPS2-mediated
resistance. Cell 112, 379-389.

Martin, G.B., Brommonschenkel, S.H., Chunwongse, J., Frary, A., Ganal, M.W., Spivey, R.,
Wu, T., Earle, E.D., and Tanksley, S.D. (1993). Map-based cloning of a protein kinase
gene conferring disease resistance in tomato. Science 262, 1432-1436.

Massague, J. (1998). TGF-beta signal transduction. Annu. Rev. Biochem. 67, 753-791.

Mellersh D G, Foulds I V, Higgins V J and Heath C M. (2002) H202 plays different roles in
determining penetration failure in three diverse plant-fungal interactions; Plant J. 29,

Mew, T.W., A. M. Alvarez, J. E. Leach and J. Swings. (1993). Focus on bacterial blight of
rice. Plant Disease 77, 5-12.

Mittler R. (2002) Oxidative stress, antioxidants, and stress tolerance. Trends Plant Sci. 7, 405

Mou, Z., Fan, W., and Dong, X. (2003). Inducers of plant systemic acquired resistance regulate
NPR1 function through redox changes. Cell 113, 935-944.

Mucyn, T.S., Clemente, A., Andriotis, V.M., Balmuth, A.L., Oldroyd, G.E., Staskawicz,
B.J., and Rathjen, J.P. (2006). The tomato NBARC-LRR protein Prf interacts with Pto
kinase in vivo to regulate specific plant immunity. The Plant Cell 18, 2792-2806.

Muskett R. Paul, Katherine Kahn, Austin J. Mark, Lisa J. Moisan, Ari Sadanandom, Ken
Shirasu, Jonathan D. G. Jones and Parker E. Jane. (2002). Arabidopsis RAR1 Exerts
Rate-Limiting Control ofR Gene-Mediated Defenses against Multiple Pathogens. The
Plant Cell 14, 979-922.

Nishimura, M.T., Stein, M., Hou, B.H., Vogel, J.P., Edwards, H., and Somerville, S.C.
(2003). Loss of a callose synthase results in salicylic acid-dependent disease resistance.
Science 301, 969-972.

Opassiri Rodjana, Busarakum Pomthong, Tassanee Onkoksoong, Takashi Akiyama, Asim
Esen and James R Ketudat Cairns (2006). Analysis of rice glycosyl hydrolase family 1
and expression of Os4bglul2 P-glucosidase. BMC Plant Biology 6, 33.

Osakabe, Y., Maruyama, K., Seki, M., Satou, M., Shinozaki, K., and Yamaguchi-Shinozaki,
K. (2005). Leucine-rich repeat receptor-like kinasel is a key membrane-bound regulator
of abscisic acid early signaling in Arabidopsis. The Plant Cell 17, 1105-1119.

Parker, J.E., Holub, E.B., Frost, L.N., Falk, A., Gunn, N.D., and Daniels, M.J. (1996).
Characterization of eds 1, a mutation in Arabidopsis suppressing resistance to
Peronospora parasitica specified by several different RPP genes. The Plant Cell 8, 2033-

Peck, S.C., Nuhse, T.S., Hess, D., Iglesias, A., Meins, F., and Boiler, T. (2001). Directed
proteomics identifies a plant-specific protein rapidly phosphorylated in response to
bacterial and fungal elicitors. The Plant Cell 13, 1467-1475.

Pedley, K.F., and Martin, G.B. (2003). Molecular basis of Pto-mediated resistance to bacterial
speck disease in tomato. Annu. Rev. Phytopathol. 41, 215-243.

Pedley, K.F., and Martin, G.B. (2005). Role of mitogen-activated protein kinases in plant
immunity. Current opinion in plant biology 8, 541-547.

Pratt, W.B., and Toft, D.O. (2003). Regulation of signaling protein function and trafficking by
the hsp90/hsp70-based chaperone machinery. Experimental biology and medicine 228,

Rivas, S., Romeis, T., and Jones, J.D. (2002). The Cf-9 disease resistance protein is present in
an approximately 420-kilodalton heteromultimeric membrane-associated complex at one
molecule per complex. The Plant Cell 14, 689-702.

Robatzek, S., Chinchilla, D., and Boiler, T. (2006). Ligand-induced endocytosis of the pattern
recognition receptor FLS2 in Arabidopsis. Genes & development 20, 537-542.

Rooney, H.C., Van't Klooster, J.W., van der Hoorn, R.A., Joosten, M.H., Jones, J.D., and
de Wit, P.J. (2005). Cladosporium Avr2 inhibits tomato Rcr3 protease required for Cf-2-
dependent disease resistance. Science 308, 1783-1786.

Sacksteder, K.A., J.M. Jones, S.T. South, X. Li, Y. Liu, and S.J. Gould. (2000). PEX19 binds
multiple peroxisomal membrane proteins, is predominantly cytoplasmic, and is required
for peroxisome membrane synthesis. J. Cell Biol. 148, 931-944.

Schlessinger, J. (1993). Trends Biochem. Sci. 18, 273-275.

Schreck, R., Rieber, P., and Baeuerle, P.A. (1991). Reactive oxygen intermediates as
apparently widely used messengers in the activation of the NF-kappa B transcription
factor and HIV-1. The EMBO journal 10, 2247-2258.

Scofield, S.R., Tobias, C.M., Rathjen, J.P., Chang, J.H., Lavelle, D.T., Michehmore, R.W.,
and Staskawicz, B.J. (1996). Molecular Basis of Gene-for-Gene Specificity in Bacterial
Speck Disease of Tomato. Science 274, 2063-2065.

Sedgwick, S.G., and Smerdon, S.J. (1999). The ankyrin repeat: a diversity of interactions on a
common structural framework. Trends in biochemical sciences 24, 311-316.

Shao, F., Golstein, C., Ade, J., Stoutemyer, M., Dixon, J.E., and Innes, R.W. (2003).
Cleavage of Arabidopsis PBS1 by a bacterial type III effector. Science 301, 1230-1233.

Shen, Y., Sharma, P., da Silva, F.G., and Ronald, P. (2002). The Xanthomonas oryzae pv.
lozengeoryzae raxP and raxQ genes encode an ATP sulphurylase and adenosine-5'-
phosphosulphate kinase that are required for AvrXa21 avirulence activity. Molecular
microbiology 44, 37-48.

Shirasu, K., Lahaye, T., Tan, M.W., Zhou, F., Azevedo, C., and Schulze-Lefert, P. (1999). A
novel class of eukaryotic zinc-binding proteins is required for disease resistance signaling
in barley and development in C. elegans. Cell 99, 355-366.

Shiu, S.H., Karlowski, W.M., Pan, R., Tzeng, Y.H., Mayer, K.F., and Li, W.H. (2004).
Comparative analysis of the receptor-like kinase family in Arabidopsis and rice. The
Plant Cell 16, 1220-1234.

Sierro, F., Dubois, B., Coste, A., Kaiserlian, D., Kraehenbuhl, J.P., and Sirard, J.C. (2001).
Flagellin stimulation of intestinal epithelial cells triggers CCL20-mediated migration of

dendritic cells. Proceedings of the National Academy of Sciences of the United States of
America 98, 13722-13727.

Smith, K.D., Andersen-Nissen, E., Hayashi, F., Strobe, K., Bergman, M.A., Barrett, S.L.,
Cookson, B.T., and Aderem, A. (2003). Toll-like receptor 5 recognizes a conserved site
on flagellin required for protofilament formation and bacterial motility. Nature
immunology 4, 1247-1253.

Song, W.Y., Pi, L.Y., Wang, G.L., Gardner, J., Holsten, T., and Ronald, P.C. (1997).
Evolution of the rice Xa21 disease resistance gene family. The Plant Cell 9, 1279-1287.

Song, W.Y., Wang, G.L., Chen, L.L., Kim, H.S., Pi, L.Y., Holsten, T., Gardner, J., Wang,
B., Zhai, W.X., Zhu, L.H., Fauquet, C., and Ronald, P. (1995). A receptor kinase-like
protein encoded by the rice disease resistance gene, Xa21. Science 270, 1804-1806.

Staskawicz, B.J., Mudgett, M.B., Dangl, J.L., and Galan, J.E. (2001). Common and
contrasting themes of plant and animal diseases. Science 292, 2285-2289.

Strange, R.N., and Scott, P.R. (2005). Plant disease: a threat to global food security. Annual
review of phytopathology 43, 83-116.

Suarez-Rodriguez, M.C., Adams-Phillips, L., Liu, Y., Wang, H., Su, S.H., Jester, P.J.,
Zhang, S., Bent, A.F., and Krysan, P.J. (2007). MEKK1 is required for flg22-induced
MPK4 activation in Arabidopsis plants. Plant physiology 143, 661-669.

Sun, X., Cao, Y., Yang, Z., Xu, C., Li, X., Wang, S., and Zhang, Q. (2004). Xa26, a gene
conferring resistance to Xanthomonas oryzae pv. oryzae in rice, encodes an LRR receptor
kinase-like protein. Plant J 37, 517-527.

Tabak, H. F., Murk, J. L., Braakman, I. and Geuze, H. J. (2003). Peroxisomes start their life
in the endoplasmic reticulum. Traffic 4, 512-518.

Takahashi A, Casais C, Ichimura K, Shirasu K (2003). HSP90 interacts with RAR1 and
SGT1, and is essential for RPS2- mediated resistance in Arabidopsis. Proceedings of the
National Academy of Sciences of the United States of America 100: 11777-11782.

Thanassi David G and Hultgren Scott J. (2000). Multiple pathways allow protein secretion
across the bacterial outer membrane. Current Opinion in Cell Biology 12, 420-430.

Tornero, P., Merritt, P., Sadanandom, A., Shirasu, K., Innes, R.W., and Dangl, J.L. (2002).
RAR1 and NDR1 contribute quantitatively to disease resistance in Arabidopsis, and their
relative contributions are dependent on the R gene assayed. The Plant Cell 14, 1005-1015.

Underhill, D.M. and Ozinsky, A. (2002). Toll-like receptors: key mediators of microbe
detection. Currunt opinion immunology 14, 103-110.

Vidalain, P.O., Boxem, M., Ge, H., Li, S., and Vidal, M. (2004). Increasing specificity in high-
throughput yeast two-hybrid experiments. Methods 32, 363-370.

Wang, Y.S., Pi, L.Y., Chen, X., Chakrabarty, P.K., Jiang, J., De Leon, A.L., Liu, G.Z., Li,
L., Benny, U., Oard, J., Ronald, P.C., and Song, W.Y. (2006). Rice XA21 binding
protein 3 is a ubiquitin ligase required for full Xa21-mediated disease resistance. The
Plant Cell 18, 3635-3646.

Wang, Z.Y., Seto, H., Fujioka, S., Yoshida, S., and Chory, J. (2001). BRI1 is a critical
component of a plasma-membrane receptor for plant steroids. Nature 410, 380-383.

Wiermer, M., Feys, B.J., and Parker, J.E. (2005). Plant immunity: the EDS 1 regulatory node.
Current opinion in plant biology 8, 383-389.

Wulf, J., Pascuzzi, P.E., Fahmy, A., Martin, G.B., and Nicholson, L.K. (2004). The solution
structure of type III effector protein AvrPto reveals conformational and dynamic features
important for plant pathogenesis. Structure 12, 1257-1268.

Xiao, S., Brown, S., Patrick, E., Brearley, C. and Turner, J.G. (2003). Enhanced transcription
of the Arabidopsis disease resistance genes RPW8.1 and RPW8.2 via a salicylic acid-
dependent amplification circuit is required for hypersensitive cell death. The Plant Cell
15, 33-45.

Xu, W.H., Wang, Y.S., Lin, G.Z., Chen, X., Tinjuangjun, P., Pi, L.Y., and Song, W.Y.
(2006). The autophosphorylated Ser686, Thr688, and Ser689 residues in the intracellular
juxtamembrane domain of XA21 are implicated in stability control of rice receptor-like
kinase. Plant J 45, 740-751.

Yan, J., Wang, J., and Zhang, H. (2002). An ankyrin repeat-containing protein plays a role in
both disease resistance and antioxidation metabolism. Plant J 29, 193-202.

Yoshimura, S., Yamanouchi, U., Katayose, Y., Toki, S., Wang, Z.X., Kono, I., Kurata, N.,
Yano, M., Iwata, N., and Sasaki, T. (1998). Expression of Xal, a bacterial blight-
resistance gene in rice, is induced by bacterial inoculation. Proceedings of the National
Academy of Sciences of the United States of America 95, 1663-1668.

Yuan, C.X., Lasut, A.L., Wynn, R., Neff, N.T., Hollis, G.F., Ramaker, M.L., Rupar, M.J.,
Lin, P., and Meade, R. (2003). Purification of Her-2 extracellular domain and
identification of its cleavage site. Protein expression and purification 29, 217-222.

Zhang, Y., Fan, W., Kinkema, M., Li, X., and Dong, X. (1999). Interaction of NPR1 with
basic leucine zipper protein transcription factors that bind sequences required for salicylic
acid induction of the PR-1 gene. Proceedings of the National Academy of Sciences of the
United States of America 96, 6523-6528.

Zhang, H., Wang, J., Alien, R.D., Nickel, U. and Goodman, H.M.(1997). Cloning and
expression of an Arabidopsis gene encoding a putative peroxisomal ascorbate peroxidase.
Plant Mol. Biol. 34, 967-971.

Zhou, J., Y., Loh, T., Bressan R.A. and Martin G.B. (1995). The tomato gene Ptil encodes a
serine/threonine kinase that is phosphorylated by Pto and is involved in the
hypersensitive response. Cell 83, 925-935.

Zhu, W., Yang, B., Chittoor, J.M., Johnson, L.B., and White, F.F. (1998). AvrXalO contains
an acidic transcriptional activation domain in the functionally conserved C terminus. Mol
Plant Microbe Interact 11, 824-832.

Zipfel, C., Robatzek, S., Navarro, L., Oakeley, E.J., Jones, J.D., Felix, G., and Boiler, T.
(2004). Bacterial disease resistance in Arabidopsis through flagellin perception. Nature
428, 764-767.

Zipfel, C., Kunze, G., Chinchilla, D., Caniard, A., Jones, J.D., Boiler, T., and Felix, G.
(2006). Perception of the bacterial PAMP EF-Tu by the receptor EFR restricts
Agrobacterium-mediated transformation. Cell 125, 749-760.


Yingnan Jiang was born and raised in Baotou, inner Mongolia, China. After completing his

high school education, he attended Peking University and majored in biology. After receiving his

bachelor's diploma, he attended the Institute of Botany, Chinese Academy of Science where he

majored in cell biology for his master's degree. In 2003, he was accepted into Plant Molecular

and Cellular Biology program at the University of Florida for his Ph.D. degree.




2 2007 Yingnan Jiang


3 To my Mom and Dad


4 ACKNOWLEDGMENTS I would like to acknowledge all the people that ever helped m e during my doctoral study. I would like to give special thanks to my supervisory committee chair Dr. Wen-Yuan Song for his commitment. During my doctoral work, he never stopped encouraging me to develop independent thinking and research skills, and helped me with scientific writing. I feel so lucky to have an exceptional doctoral committee and wish to thank Dr. Alice Harmon, Dr. Harry Klee, and Dr. Shouguang Jin for their guidance, support, and encouragement over years. I also thank all the members of the Song lab, past and present: Dr. Xiaodong Ding who taught me everything he knows about yeast two-hybrid analyses, Dr. Yongsheng Wang who helped me with the techniques for co-immunoprecipitation assays, Dr. Weihui Xu who gave me many suggestions about trans-phosphorylation assa ys, and Dr. Xiuhua Chen who helped me to generate transgenic plants. Last but not least, I thank Terry Davoli for her support during my research and the time she spent in revising my dissertation. I thank Dr. Mark Settles and Dr. Ken Cline for providing me a chance to do rotations in their labs. I also want to take this opportunity to thank all the professors who taught me classes and all people in PMCB who helped me in the past four years. Finally, I would like to thank my parents and my elder sister. Although they are 6000 miles away and know nothing about what I am studying, th eir endless love and support are always the driving force for me to complete my goal. My thanks always go out for my girlfriend Rui Zhang who always found a way to cheer me up during the dumpy times.


5 TABLE OF CONTENTS page ACKNOWLEDGMENTS...............................................................................................................4 LIST OF TABLES................................................................................................................. ..........8 LIST OF FIGURES.........................................................................................................................9 LIST OF ABBREVIATIONS........................................................................................................ 11 ABSTRACT...................................................................................................................................13 CHAPTER 1 LITERATURE REVIEW.......................................................................................................14 Introduction................................................................................................................... ..........14 How Plant Pathogens Cause Disease......................................................................................16 Plant Defense Systems.......................................................................................................... ..16 PAMP-triggered Immunity (PTI).................................................................................... 17 Strategies That Pathogens Employ to Overcome PTI..................................................... 22 Effector-triggered Immunity (ETI)..................................................................................26 R proteins in plants................................................................................................... 26 The molecular basis of ge ne-for-gene interactions..................................................28 Downstream signaling components of PTI and ETI................................................33 Bacterial Blight Disease of Rice...................................................................................... 37 XA21-mediated disease resistance........................................................................... 39 RLK family in plant disease resistance.................................................................... 40 2 IDENTIFICATION AND CHARACTER IZATION OF AN XA21-BINDING PROTEIN, XB25 .................................................................................................................. ..46 Introduction................................................................................................................... ..........46 Materials and Methods...........................................................................................................48 Phylogenetic and Sequence Analyses............................................................................. 48 Molecular Cloning of XBOS25-1 ....................................................................................49 Construction of BD-XA21KTM, BD-XA21KTMK736E, BDXA21KTMS686A/T688A/S689A, BD-Pi-d2KTM, BD-XA21K, AD-XB25, AD-XB25N, AD-XB25C, and AD-XBOS25-1................................................................................50 Preparation of Yeast Competent Cells............................................................................ 52 Co-transformation of Bait and Prey Constructs into Yeast Cells.................................... 53 Bacterial Expression and Puri fication of Fusion Proteins............................................... 53 Generation and Purification of Antibodies against XB25...............................................55 Creation of the RNAi XB25 Construct.............................................................................56 Generation of Rice RNAi XB25 Transgenic Lines........................................................... 57 In Vitro Binding Assays..................................................................................................58


6 RNA GeL Blots Assays................................................................................................... 59 Immunodetection of XB25..............................................................................................60 Results.....................................................................................................................................61 XB25 is A Member of the PANK Family....................................................................... 61 The N-terminal Region of XB25 is Sufficient for the Interaction with XA21KTM in Yeast........................................................................................................................62 Physical Interaction be tween XB25 and XA21KTM in Vitro .........................................62 Generation of Antibodies against XB25.......................................................................... 63 Down-regulation of XB25 in Transgenic Plants.............................................................63 Characterization of RNAi XB25 Lines.............................................................................64 Discussion...............................................................................................................................65 3 XB25 CONTRIBUTES TO THE ACCUMULATION OF XA21 AND IS INVOLVED IN XA21-MEDIATED DISEASE RESISTANCE ................................................................ 85 Introduction................................................................................................................... ..........85 Materials and Methods...........................................................................................................86 Immunodetection of XA21 in Rice.................................................................................86 Co-immunoprecipitation.................................................................................................. 87 Transphosphorylation Assays.......................................................................................... 88 Semi-quantitative RT-PCR..............................................................................................88 Generation of Crosses between RNAi XB25 Transgenic Lines and 4021-3 (c-MycXA21/c-Myc-XA21)....................................................................................................89 Measurement of Bacterial Growth Curve........................................................................ 89 Statistical Analysis.......................................................................................................... 89 Results........................................................................................................................ ............90 XA21 is Associated With XB25 in Planta ......................................................................90 XB25 Contributes to the Accumulation of XA21........................................................... 90 The Resistance to Xoo PR6 is Compromised in Progeny of RNAi XB25/4021-3 with Reduced Levels of XA21 and XB25...........................................................................91 XB25 is Phosphorylated by XA21KTM in Vitro ............................................................92 Discussion...............................................................................................................................92 4 IDENTIFICATION OF XB25-INTERACTORS BY YEAST TWO-HYBRID SCREENINGS ......................................................................................................................105 Introduction................................................................................................................... ........105 Materials and Methods.........................................................................................................107 Construction of BD-XB25, BD-XB25N, and BD-XB25C........................................... 107 Auto-activation Assays of the HIS3 Reporter Gene...................................................... 107 Screening of a Rice Yeast Two-hybrid cDNA Library................................................. 108 Recovery of Prey Plasmids............................................................................................109 Transformation of Isolated Prey Plasmids into Escherichia coli ..................................109 Verification of Candi date Interactors............................................................................ 110 Results...................................................................................................................................110 Construction of BD-XB25, BD-XB25N, and BD-XB25C bait.................................... 110


7 Identification of XB25N and XB25C In teractors Using Yeast Two-Hybrid Screenings .................................................................................................................. 111 Verification of Candidate XB 25C Interactors in Yeast................................................. 112 Discussion.............................................................................................................................113 5 CONCLUSIONS AND FUTURE PERSPECTIVES........................................................... 119 LIST OF REFERENCES.............................................................................................................121 BIOGRAPHICAL SKETCH.......................................................................................................136


8 LIST OF TABLES Table page 2-1. Amino acid sequence comparisons of XB25 and related proteins. .......................................72 4-1. Candidate XB25C interactors...............................................................................................117


9 LIST OF FIGURES Figure page 1-1. Main components of the signal transduction pathways in innate immunity in insects ( Drosophila ), m ammals and plants (Arabidopsis).............................................................42 1-2. Classes of Resi stance Proteins. ...............................................................................................43 1-3. Plant immune system activa tion by pathogen effectors .........................................................44 1-4. Overview of the local signaling networ ks controlling activation of local defense responses.. .................................................................................................................... ......45 2-1. Structure of genomic region of XB25. ....................................................................................68 2-2. Predicted amino acid sequence of XB25................................................................................69 2-3. Sequence alignments of XB25 and related proteins from rice (XB25, XBOS-1 and XBOS-2), Arabidopsis thaliana (AKR2 and AtPhos3) and tobacco (TIP1, TIP2 and TIP3).. ................................................................................................................................70 2-4. Phylogenetic tree based on the predicted amino acid sequences of XB25 and related proteins from rice (XB25, XBOS-1 and XBOS-2), Arabidopsis thaliana (AKR2 and AtPhos43) and tobacco (TIP1, TIP2 and TIP3). ..............................................................71 2-5. XB25 interacts with XA21KTM in yeast cells......................................................................73 2-6. Bacterial expression and purification of dif ferent XA21 and XB25 fusion proteins.............75 2-7. In vitro interaction between XA21KTM and XB25...............................................................76 2-8. Sequence alignments of XB25 a nd related proteins in rice. ...................................................77 2-9. Immunodetection of FLAG-XB25 expressed in bacteria by anti-XB25M. ...........................78 2-10. Sequence alignments of a region of XB25 used to create RNAi XB25 construct and its corresponding regions of XBOS25-1 and XBOS25-2. ......................................................79 2-11. Schematic representation of the rice transformation vector used to generate RNAi XB25 transgenic lines.. .............................................................................................80 2-12. Schematic representation and alignments of a probe from N-terminus of XB25 used for Northern blot.. ....................................................................................................................81 2-13. Identification of RNAi XB25 transgenic lines with reduced XB25 transcripts by Northern Blot using a probe against either XB25 (upper) or GUS-loop (lower). ..............82


10 2-14. Both transcripts and protein levels of XB25 were reduced in RNAi XB25 transgenic lines.. ........................................................................................................................ ..........83 2-15. RNAi XB25 lines showed no m orphological difference with TP309 and both of them showed comparable amount of susceptibility to Xoo PR6.................................................84 3-1. Immunodetction of ProA-XA21 (A) or c-Myc-XA21 (B).....................................................97 3-2. XA21 is associated with XB25 in rice....................................................................................98 3-3. Schematic representation of the strategy to generate crosses of RNAi XB25 and 4021-3.....99 3-4. XB25 contributes to the accumulation of XA21 and is involved in XA21-mediated disease resistance. ............................................................................................................ 100 3-5. Growth of Xoo PR6 in S34/4021-3-6 and control lines. ...................................................102 3-6. Photograph of plants showing lesion developm ent after two week inoculated with Xoo PR6...................................................................................................................................103 3-7. XB25 is phosphorylated by XA21KTM in vitro..................................................................104 4-1. Schematic representation of bait constructs used for yeast two-bybrid screening.. .............115 4-2. Assays for auto-activation of the HIS3 gene .......................................................................116 4-3. Verification of interactions between XB25 and candidate binding proteins. .......................118


11 LIST OF ABBREVIATIONS AD dom ain: activation domain Avr protein: avirulent protein BD domain: DNA binding domain EF-Tu: elongation factor-Tu ETI: effector-triggered immunity GST: glutathione S-transferase HR: hypersensitive response JM: juxtamembrane LRR: leucine-rich-repeat MBP: maltose binding protein NB: nucleotide binding PAMP: pathogen-associated molecular patterns PANK: plant-ankyrin-specific-protein PEST: a motif rich of proline, glutamic acid, serine and threonine PEX19: peroxisomal biogenesis factor 19 PMPs: peroxisomal membrane proteins PR gene: pathogenicity-related gene PTI: PMAP-triggered immunity Pst DC300: Pseudomonas syringae pv. tomato DC3000 RIN4: RPM1-interacting protein 4 RLK: receptor-like kinase ROS: reactive oxygen species R protein: resistant protein TTOS: type I secretion system


12 TTSS: type III secretion system XA21CS1: XA21 cleavage site 1 Xoo: Xanthomonas oryzae pv. oryzae


13 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy THE RICE XA21-BINDING PROTEIN 25 IS AN ANKYRIN REPEAT-CONTAINING PROTEIN AND REQUIRED FOR XA21-ME DIATED DISEASE RESISTANCE By Yingnan Jiang August 2007 Chair: Wen-Yuan Song Major: Plant Molecular and Cellular Biology The rice (Oryza sativa) gene XA21 encodes a receptor-like kinase and confers resistance to specific races of the causal agent of bacterial blight disease, Xanthomonas oryzae pv. oryzae ( Xoo). By using yeast two-hybrid screenings, the XA21 binding protein 25 (XB25), containing an ankyrin repeat domain, was identified. XB25 har bors a PEST motif located in the center of the protein and four ankyrin repeats located in the C-terminus. It belongs to a plant-specificankyrin-repeat (PANK) family whose members are involved in plant defense/disease resistance pathways. The interaction between XB25 and the truncated version of XA21 spanning the transmembrane domain and the kinase domain (XA21KTM) has been shown in yeast and in vitro, and the association between XB25 and XA21 was further confirmed in planta. Silencing of XB25 in rice results in reduced levels of XA21 and affects XA21-mediated disease resistance, leading to an enhanced susceptibility to the avirulent race of Xoo. In addition, evidentce showed that XB25 was phosphorylated by XA21KTM in vitro Finally, a yeast two-hybrid library screening identified one XB25-binding protein, PEX 19 that is involved in the biosynthesis of peroxisomes. These results indicate that XB25 is required for XA21-mediated disease resistance and provide a link between the PANK family and R gene-mediated disease resistance.


14 CHAPTER 1 LITERATURE REVIEW Introduction There are a variety of biotic agents, including viruses, bacteria, fungi, protozoa, and nem atodes, that can impact the health of plants. Some of them can cause plant diseases. Plant disease is defined as a series of visible or i nvisible harmful changes in the form, function, and integrity of healthy plants when they are exposed under favorable conditions to a primary pathogen (Agrios, 1997). These visible changes in the plant including rots, specks, spots, blights, wilts, galls, rusts, and cankers make up the symptoms of the disease, and can subsequently result in host-cell death in roots, leaves, flowers, fruits, and stems. Plant disease can cause heavy economic losses, which in turn greatly impact human society. For example, the Irish potato famine of the 1840s, caused by Phytophthora infestans resulted in the death of more than one million Irish (Baker et al. 1997). The European grape, Vitis vinifera, which has been widely used to produce high quality wines, cannot grow in the Southeastern United States because of Pierces disease caused by xylem-inhabiting bacteria. Recent estimates indicate that plant diseases re duce the worldwide food supply by 10% each year (Strange and Scott, 2005). With the increase in the worlds population and the concomitant decrease of land available for agriculture, it becomes more important to improve crop production by protecting crops against plant pathogens. A number of methods have been developed to defend plants against pathogens. Because of the great diversity of pathogens, hosts, and the interactions between them, the methods of plant disease control vary considerably. Based on the technique employed, the methods can be classified into four categories: regulatory cont rol, chemical control, cultural control, and biological control (Agrios, 1997). The intent of regulatory control is to keep pathogens away


15 from a host or a certain geographic area to prevent infections from occurring and potentially becoming established in this area. It includes inspection of imported plant species, utilizing pathogen-free propagating materials, and avoida nce of pathogen-containing seeds. Chemical control is used to protect plants that are already, or likely to become, infected by pathogens. It depends largely on the application of pesticides. Pesticides are efficient in preventing and controlling the development of some diseases, but are expensive and labor-intensive, and can cause pesticide-resistant pathogens and environmental contamination. Cultural control aims to reduce the pathogens that already exist in a plant or in an area where plants are grown, and is dependent on measures that a grower takes, such as removal of infected plants, crop rotation, sanitation, and creating conditions unfavorable to pathogens. Biological control relies on antagonizing pathogens with other organisms. For example, several fungi, such as Trichoderma harzianum are not pathogenic to plants, but do parasitize the mycelia of some plant pathogenic fungi and inhibit their growth. All the conventional methods listed above are widely used by growers. However, none of them is completely effective and most of them are timeand labor-intensive. In recent years, plant pathologists have focused on the development of less costly and more effective disease control methods. Genetic engineering of disease-resistant plants is one promising approach. It is based on the isolation of host genes regulating defense responses from resistant plants and then transferring such genes into susceptible plants, thereby making them disease resistant. In combination with conventional methods, this host genetic-based approach is expected to become one of the most effective and efficient tools to control plant diseases. Hence, studies on plant disease resistance will help us to understand the fundamental aspects of microbial pathogenesis


16 and associated host responses, and provide informa tion to plant pathologists who aim to engineer a greater variety of disease-resistant plants. How Plant Pathogens Cause Disease Plant pathogens utilize diverse strategies to colonize their hosts (Chisholm et al., 2006; Jones and Dangl, 2006). In order to establish disease, most microbes must penetrate the plants surface. Viruses and protozoa are delivered directly into plant cells through wounding by such vectors as thrips or other insects. Pathogenic bacteria enter the plants intercellular space through wounds, or through natural openings such as stomata or water pores (hydathodes). Nematodes and aphids insert their stylets directly into a plan ts cells. Fungi penetrate plants either by directly entering through wounds or by the extension of hyphae on the plants surface with subsequent breaching of the cell wall by mechanical force. Once the microbes penetrate the plants surface, they invade their hosts in different ways. Viruses and protozoa invade tissue by moving from cell to cell. Most bacteria invade their host tissue from the intercellular space. Some nematodes invade hosts intercellularly, while others do not actually invade their hosts at all, but siphon off nutrition from host cells using their stylets. Most fungi invade cells by extending their hyphae directly through or between the cells. After invasion, viruses, bacteria, and protozoa colonize their hosts by reproducing at high rates at the sites of infection. Progeny move to new cells or tissues through the plasmodesmata (viruses), the phloem (bacteria and protozoa), or xylem (some bacteria) until the spread of infection is halted or the plant dies. Fungi colonize their hosts by continuing to branch out within the infected hos t tissue so that the original fungal pathogen can spread and infect new tissues. Plant Defense Systems Plants protect them selves against pathogens by using a combination of defense systems based on two elements: (1) structural characteristics that function as physical barriers to prevent


17 pathogens from penetrating their hosts, and (2) biochemical reactions that produce toxic chemicals in cells that inhibit the growth of a pathogen. According to whether they exist before or are triggered after pathogen infection, plant defense systems fall into two groups: pre-existing structural and chemical defenses, and plant-induced structural and biochemical defenses (Agrios, 1997). Pre-existing structural and chemical defenses consist of structures and chemicals that are present in plant cells even before the plant is exposed to a pathogen. They include the amount and quality of wax and cuticle that covers the epidermal cells, the structure of the plants cell walls, the size and number of stomata and hydathodes, and some chemical inhibitors that are continuously produced. Pre-existing structural and chemical defenses act as the first line of defense to protect a plant against pathogens and exist virtually in all plant species. Induced structural and chemical defenses are a more important defense system because they determine the specificity of defense responses. These defenses are initiated by the recognition of such pathogen-derived elicitors as carbohydrates, fatty acids, and peptides. Various pathogens, especially bacteria and fungi, release a variety of elicitors, and once plants recognize them, a series of structural changes and biochemical reactions are activated to defend the plant against these pathogens. According to the elicitors they recognize, the plant induced defense systems can be classified into two branches: one is triggered through recognition of conserved pathogen-derived elicitors, termed pathogen-associated molecular patterns (PAMPs), the other is activated by the recognition of specific pathogen-derived elicitors, usually referred to as effectors (Jones and Dangl, 2006). PAMP-triggered Immunity (PTI) PAMPs are a heterogeneous set of m olecules that are common to many different microbial species and are indispensable parts of the microbes lifecycle (Lee et al. 2006). They differ only


18 slightly from one pathogen to another. Examples of PAMPs include flagellin (a component of bacterial flagella), peptidoglycan (a complex polymeric material in the walls of gram-positive bacteria), lipopolysaccharide, cold-shock protein, single-strand RNA, and oomycete transglutaminase (Dow et al ., 2000; Gomez-Gomez and Boller, 2002; Felix and Boller, 2003; Lee et al ., 2006). PAMPs are recognized through host membrane-located receptors and this recognition initiates a plant PAMP-triggered immun ity (PTI). PTI is activated within several minutes from when plant cells are challenged by microbes and often stops the infection process before disease can occur (Abramovitch et al. 2006). PTI is also known as basal defense (Kim et al. 2005). PTI responses exist in both plants and animals. In plants, the outcome of PTI includes a series of defense responses, such as the production of reactive oxygen species (ROS) and ethylene, the increased expression of pathogenesis-related ( PR) genes, and the deposition of callose in the plants cell walls (Gomez-Gomez et al. 1999). The parallel response of PTI in animals is regulated by the innate immunity system. Animal innate immunity is also induced by the recognition of such PAMP s as bacterial lipopolysaccharides and fungal mannans (Kopp et al ., 1999). This recognition triggers inflammatory or pro-inflammatory responses including those of increased ROS and anti-microbial proteins, and further enables another immune system, referred to as adaptive immunity. Nevertheless, animal innate immunity cannot prevent the proliferation of invading bacteria per se (Underhill and Ozinsky, 2000). Most knowledge about PTI in plants is from the characterization of flagellin, a marker for the presence of bacteria, and its receptor in Arabidopsis thaliana (Felix et al. 1999; GmezGmez and Boller, 2000). Flagellin is a structural component of bacterial flagella and is important for bacterial mobility. The N and C termini of flagellin are highly conserved across


19 eubacteria, which makes it possible for host cells to monitor the presence of bacteria by recognition of flagellin. Bacterial flagellin repres ents an ideal PAMP, and indeed is recognized by various plant species (Felix et al. 1999), Drosophila (Lemaitre et al. 1997), and by mammals (Sierro et al. 2001). In Arabidopsis, a synthetic peptide corresponding to the most conserved Nterminus of flagellin, referred to as flg22, was found to be even more active than flagellin in inducing PTI responses. Thus, it has been used in many studies (Felix et al. 1999; GmezGmez and Boller, 2002). To identify the receptors involved in the recognition of flagellin, two approaches, each based on flg22-induced growth inhibition in Arabidopsis seedlings, have been used. The first approach was developed from the natural genetic variation found in Arabidopsis. All ecotypes of Arabidopsis except Ws-0 are sensitive to flg22. This natural genetic variation led Gmez-Gmez and his co-workers to analyze the F2 progeny derived from crosses of Ws-0 with Col-0 and La-er. A dominant locus (termed FLS1) conferring sensitivity to flg22 was identified on chromosome V (Gmez-Gmez et al., 1999). The second approach was to screen ethylmethanesulfonate (EMS) mutagenized La-er Arabidopsis seedlings to identify mutants that showed no growth inhibition after treatment with flg22. Several mutants were obtained. All of them were mapped to the same region as FLS1 located in chromosome V, and were characterized as alleles of a single locus referred to as FLS2 (Gmez-Gmez and Boller, 2000). Molecular cloning of FLS1 and FLS2 led to the realization that they are the same gene, which was named FLS2. FLS2 encodes a receptor-like kinase (RLK). This RLK includes an extracellular leucinerich-repeat (LRR) domain that is often involved in protein-protein interactions, a transmembrane domain, and a cytoplasmic kinase domain (Gmez-Gmez and Boller, 2000). FLS2 is involved in the recognition of flg22. When Pseudomonas syringae pv. tomato DC3000 ( Pst DC3000) was


20 inoculated by spraying directly on the leaves rather than by injecting into the apoplast, the fls2 mutant showed a susceptibility to this pathogenic strain, suggesting that FLS2 probably functions at an early stage to restrict bacterial invasion (Zipfel et al. 2004). The physical interaction between flg22 and FLS2 has been demonstrated by immunoprecipitation and chemical crosslinking, suggesting that FLS2 is a receptor of flg22 (Chinchilla et al. 2005). In addition, tomato cells heterologously expressing FLS2 gain a recognition system with characteristics of that of Arabidopsis, supporting the conclusion that FLS2 determines the specificity of the recognition of flagellin (Chinchilla et al. 2005). Taken together, these data indicate FLS2 is responsible for the recognition of bacteria flagellin and the activation of PTI. The FLS2 signaling pathway is well regulated. When studying the localization of an FLS2 fusion protein tagged with a green fluorescence protein (GFP), Boller and colleagues found FLS2 present in all tissues, accumulating particularly in leaf epidermal cells and stomatal guard cells, which are primary points of bacterial entry into plant cells. When treated with flg22, FLS2 undergoes internalization (Robatzek et al. 2006). This ligand-induced FLS2 internalization depends on cytoskeleton and proteasome activity, suggesting that FLS2 is likely targeted for degradation after flg22-induced internalization. In addition, a transgenic plant carrying the FLS2T867V mutant protein in which a phosphorylated threonine residue was mutated to valine exhibits reduced FLS2T867V internalization when treated with flg22. Since autophosphorylation of FLS2 plays an important role in the FLS2-mediated signaling pathway (Gomez-Gomez et al. 2001), these results suggest that the pathways of FLS2 signaling and FLS2 endocytosis may be connected. Another critical question, how signals are transduced downstream of FLS2, has been studied in an examination of the signaling components required to trigger flg22-induced defense responses in Arabidopsis protoplasts (Asai et al. 2002). In that study, a complete MAP kinase


21 cascade (MEKK1, MKK4/MKK5, and MPK3/MPK6) and WRKY22/WRKY29 transcription factors have been shown to function downstream of the FLS2-mediated signaling pathway. In addition, activation of this MAP kinase cascade enhances resistance to bacteria, supporting the role of a MAP kinase cascade in plant defense systems. Recent studies of mutant alleles, however, indicate that MPK4 rather than MPK3 /MPK6 is activated by MEKK1 when induced by flg22 (Ichimura et al. 2006; Suarez-Rodriguez et al. 2006). This discrepancy could be due to the use of a truncated version of MEKK1 in Asai et als work. Overexpression of this truncated protein may inaccurately activate MPK3 and MPK6 in protoplasts. Another plant PAMP that has been studied is elongation factor-Tu (EF-Tu), the most abundant protein present in bacterial cells. EF-Tu is highly conserved among all bacteria, and the first 18 amino acid region, which is N-acetylated (elf18), is sufficient to induce FLS2-like defense responses in Arabidopsis (Kunze et al. 2004). By screening an Arabidopsis homozygous T-DNA-tagged mutant collection for induced LRR-RLKs, a gene encoding an EF-Tu receptor has been identified and is referred to as EFR (Zipfel et al. 2006). EFR also encodes an RLK and is responsible for the recognition of elf18. EFR induces a basal defense response when it is expressed in Nicotiana benthamiana that is usually not responsive to EF-Tu, suggesting a role of EFR in the recognition of EF-Tu and activation of PTI. Furthermore, the activation of EFRmediated defense responses restricts Agrobacterium transformation. This may lead to a way of utilizing PAMP receptors to increase the efficiency of Agrobacterium -based genetic engineering of certain crops (Abramovitch et al., 2006). The molecular forms of PTI in plants, Drosophila and mammals share some common features (Figure1-1). In Drosophila Toll is a gene originally identified in regulating the establishment of dorsoventral polarity in early embryogenesis, and is also required for the


22 recognition of microbes and the induction of the innate immunity system (Hashimoto et al. 1988). The Toll protein consists of an extracellular LRR domain, a transmembrane domain, and a short intracellular domain. This intracellular domain shares sequence similarity with the corresponding region of the human interlecukin-1 (IL-1) receptor and is referred to as the Toll/IL-1R (TIR) domain (Belvin and Anderson, 1996). The TIR domain interacts with pelle kinase through a protein complex (Hoffmann et al. 2002). In mammals, Toll-like receptors have also evolved in innate immunity. TLR5, one of the well-studied Toll-like receptors, binds to bacterial flagellin and mediates innate immunity (Smith et al., 2003). Like Toll, the intracellular TIR domain of TLR5 interacts with IRAK kinase through a protein adaptor, MyD88 (Hayashi et al. 2001). The signaling via Toll in Drosophila and by Toll-like receptors in mammals involves the dimerization of receptors and proceeds through adaptors to activate downstream kinase cascades (Gmez-Gmez and Boller, 2002). Once the kinase cascades are activated, Cactus and IkB (inhibitors of downstream transcript factors Dif and NFkB in Drosophila and in mammals, respectively), are degraded, leading to the release of Dif and NFkB. These are then transported to the nucleus and initiate expression of related genes (Underhill et al ., 2002). FLS2 is an RLK which is equivalent to the Toll and TLR5 receptor/kinase complexes in both Drosophila and mammals. This similarity suggests functional and structural parallels between plant PTI and animal innate immunity. In addition, a MAP kinase cascade is also involved in the signal amplification in FLS2 pathway, suggesting that a conserved mechanism exists in these pathways. Well-characterized Toll and Toll-like signaling components will provide a way of identifying the proteins involved in plant PTI pathways. Strategies That Pathogens Employ to Overcome PTI Driven by natural selection, for a m icrobe to be potentially pathogenic, strategies have been evolved that enable pathogens to evade PTI. As mentioned previously, PTI is triggered by


23 the recognition of PAMPs. Avoidance of PAMPs would be a potential strategy for pathogens to colonize and successfully infect plant tissues. However, most PAMPs have turned out to be highly conserved and indispensable for pathogen growth and survival. So elimination of these beneficial agents is not an effective way of evading PTI. Recent studies have shown, however, that pathogen-secreted effectors play an important role in this process. Gram-negative bacteria utilize four protein secretion systems to deliver proteins required for various parts of their lifecycle, such as organelle biogenesis, nutrient acquisition, and expression of pathogenic effectors (Thanassi et al ., 2000). Among these secretion systems, type I and type III are known to deliver pathogenic effectors. The type I secretion system (TOSS), also known as an ATP-binding cassette (ABC) protein expor ter, consists of three proteins: an innermembrane ABC exporter, an inner-membrane fusion protein (MFP) that spans the periplasm, and an outer-membrane protein (OMP). The MFP work s with both the ABC exporter and the OMP to secrete proteins across membranes to the exterior of bacterial cells. The details of how the interactions among MFB, ABC exporter and the OMP regulate the protein secretion have not been elucidated. The type III secretion system (TTSS) is the best characterized bacterial secretion system. A number of bacterial pathogens of animals and plants depend on TTSS to deliver pathogenic effectors into the host cells cytosol. In plant pathogenic bacteria, the genes encoding TTSS are termed hypersensitive response and pathogenicity ( hrp) genes because these genes were originally identified in mutants that lost their pathogenicities and were unable to elicit a hypersensitive response (HR) (Lindgren et al. 1986). HR is a form of cell death localized at the infected sites that halts the growth and spread of the invading pathogen. The hrp-encoded TTSS assembles a flagella-based molecular syringe, consisting of two rings that interact with the


24 cytoplasmic membrane, two rings that interact with the outer membrane, and an extracellular pilus-like extension (He et al., 2004). The TTSS enables plant pathogens to inject a large number of effectors directly into the hosts cells. A thorough examination of bacterial TTSS effectors reveals that Pst DC3000 strains deliver more than 20 effectors into host cells by the TTSS (Chang et al. 2005). Recent studies have demonstrated th at suppression of PTI is one of the major functions of TTSS effectors. Pst DC3000 strains that are incapable of delivering type III effectors are nonpathogenic, suggesting that type III effectors he lp bacteria to become pathogenic, probably through inhibition of PTI (Lindgren et al. 1986). Furthermore, effectors delivered by the TTSS of Xanthomonas campestris suppress plant defense responses induced by bacterial lipopolysaccharide (Keshavarzi et al., 2004), suggesting that bacterial TTSS effectors are critical in repressing PAMPs-induced defense responses. To date, a large number of type III effectors that inhibit PTI responses have been identified. For instance, in a screen for Pst DC3000 effectors that inhibit the expression of the flg22-induced NHO1 gene, nine type III effectors have been found (Li et al. 2005). TTSS effectors inhibit PTI responses by mimicking or inhibiting some host cellular activities involved in PTI (Jones and Dangl, 2006). A number of studies have provided insight into host proteins and signal pathways targeted by type III effectors. AvrPto from Pst DC3000 is a bacterial type III effector that is delivered to the cytosol of host cells. Overexpression of AvrPto in Arabidopsis inhibits the expression of cell wall-related genes and suppresses callose deposition (Hauck et al ., 2003) Callose deposition is a PTI-associated response and is induced by flg22 in a FLS2-dependent manner, so the inhibition of callose deposition in transgenic plants carrying AvrPto suggests that AvrPto and possibly other type III effectors promote their


25 pathogenicity by inhibiting PTI. Furthermore, Sh een and her colleagues (2006) demonstrate that AvrPto suppresses the induction of PAMP-mediated early defense responses, including the expression of PTI marker-genes and activation of a MAPK signaling pathway (He et al. 2006). PAMP-mediated early defense responses are quickly induced by both non-pathogenic and pathogenic bacteria in Arabidopsis. However, these responses are subsequently repressed by Pst DC3000 carrying AvrPto, suggesting that AvrPto is involved in the inhibition of these defense responses. In contrast with previous studies, which demonstrate the inhibition of PTI by type III effectors by measuring of the outcomes in PTI responses, this work provides the first molecular evidence in support of the notion that suggests early PTI signaling pathways are suppressed by type III effectors. AvrRpm1 and AvrRpt2 are also two type III effectors of Pst DC3000. Both are able to inhibit PTI responses. Transgenic plants carrying either AvrRpm1 or AvrRpt2 show enhanced bacterial growth when infected by a TTSS-deficient Pst DC3000 strain (Kim et al ., 2005b). Since this TTSS-deficient strain still contains PAMPs and is able to induce PTI, enhanced bacterial growth in the AvrRpm1 or AvrRpt2-carrying plants suggests that these two effectors contribute to the virulence by inhibiting PTI. In addition, AvrRpm1 and AvrRpt2 suppress FLS2induced callose deposition (Kim et al. 2005b). AvrRpt2 also blocks the accumulation of PR1, which is a typical PR gene induced by the treatment of flg22 in Arabidopsis. These results suggest that both AvrRpm1 and AvrRpt2 are invol ved in the suppression of host PTI responses. To increase their pathogenicity, bacterial type III effectors have also been implicated in the manipulation of the transcription of host genes. Members of the Xanthomonas AvrBs3 effector family (such as AvrBs3, AvrXa10, and AvrXa27) share a similar structure with a C-terminal nucleus localization signal (NLS) and an acidic transcriptional activation domain (AAD).


26 Removing the AAD domain in AvrXa10 or AvrXA27 eliminates the effectors pathogenicity (Gu et al. 2006). Furthermore, the AAD domain of AvrXa10 is capable of activating the transcription of reporter genes in Arabidopsis and in yeast (Zhu et al. 1998). These findings imply that members of the AvrBs3 effector family are likely to alter host defense responses by down-regulating the transcription of host defense-related genes. Effector-triggered Immunity (ETI) The evolution of effectors delivered by plant pathogens has led plants to evolve another sophisticated system of defense. This system is triggered by the direct or indirect recognition of pathogen race-specific effectors through a class of host proteins, resulting in the activation of a strong host defense response, referred to as effector-triggered immunity (ETI). The host proteins that recognize the pathogen effectors are usually referred to as resistance (R) proteins, and the cognate pathogen-encoded effectors are referred to as avirulant (Avr) proteins. R proteins in plants The genes encoding R and Avr protei ns were originally identified through genetics studies, and the pairwise relationship between host R genes and pathogen Avr genes was described as a gene-for-gene theory (Flor, 1971). It states that for each gene determ ining resistance in the host, there is a corresponding gene for avirulence in the parasite with which it specifically interacts In the presence of R and cognate Avr gene, ETI is triggered, leading to disease resistance. Conversely, in the absence of either R or Avr gene, the pathogen is able to cause disease. To date, over 40 R genes have been cloned from a wide range of species. Despite the broad range of disease resistance conferred by the R genes, most gene products can be classified into four groups based on their structures (Figure 1-2). The first group includes Pto which encodes an intracellular serine/threonine kinase. Pto confers resistance to Pst DC3000 carrying AvrPto (Martin et al. 1993). The second group of R genes encodes cytoplasmic receptor-like proteins.


27 The proteins in this group carry a LRR domain and a nucleotide bindi ng (NB) motif (Baker et al. 1997). The LRR domain consists of 20 to 30 amino acids that are rich of leucine and is often involved in protein-protein interactions. The NB motif shares sequence similarity with such corresponding regions of apoptosis regulators such as CED4 from Caenorhabditis elegans and Apaf-1 from humans (Dangl and Jones, 2001). The members of this group include RPS2, RPM1, and RPS5 in Arabidopsis, which confers resistance to bacterial pathogen Pst DC3000 carrying AvrRpt2, AvrRpm1, and AvrPphB respectively; and RPP5 in Arabidopsis, which confers resistance to the fungus Peronospora parasitica (Noco2) (Baker et al ., 1997). This NB-LRR group forms the largest family of R proteins that has been identified to date. According to their N-terminal sequences, this group can further be classified into coiled-coil (CC)-NB-LRR and TIR-NB-LRR subgroups. The TIR domain of TIR-NB -LRR proteins shares sequence similarity with that of Toll in Drosophila and IL-1R in mammals, suggesting a common origin of plant R proteins and the proteins in the animal innate immunity. And the third group comprises the members of the Cf family, such as Cf-2 and Cf-9 in tomato. These genes encode receptor-like proteins, including an extracellular LRR domain, a putative transmembrane domain, and a short intracellular tail. Cf genes confer resistance to various races of Cladosporium fulvum that cause leaf mold (Jones et al. 1994; Dixon et al. 1996). The fourth and last group is com posed of genes encoding RLKs that share similar structural featur es with FLS2. A representative example of this group is the rice Xa21 gene conferring resistance to Xanthomonas oryzae pv. oryzae ( Xoo) (Song et al. 1995). Even though the majority of R proteins fall into these four groups, a few additional R gene products with novel structures have been cloned. For instance, RRS1-R in Arabidopsis confers resistance to bacterial wilt and encodes a TIR-NB-LRR with a carboxy-terminal nuclear


28 localization signal and a WRKY transcriptional activation domain (Deslandes et al. 2003). The resistance gene in rice, Xa27, confers resistance to Xoo and encodes a protein that does not belong to any of the four above-mentioned groups (Gu et al. 2005). The molecular basis of gene-for-gene interactions Two m odels have been proposed to explain how plant R proteins recognize pathogen Avr proteins. The first model is known as the ligand-receptor model. This model proposes that R proteins are directly bound to Avr proteins to trigger downstream defense responses. Three studies provide experimental evidence to support this model. The first study demonstrates that the tomato Pto kinase interacts with the corresponding AvrPto in a yeast two-hybrid system (Tang et al. 1996). The second study proves that the rice resistance protein Pi-ta interacts with the cognate Avrpita protein in yeast and in vitro (Jia et al ., 2000). The third study shows that RRS1-R interacts with a cognate Avr protein, PopP2, in a yeast split-ubiquitin two-hybrid system, and both are co-localized in the nucleus (Deslandes et al. 2003). However, attempts to find more evidence to support the ligand-receptor model have failed despite considerable efforts by various investigators. The lack of additional evidence to support the receptor-ligand model, especially in vivo evidence, tends to lend more support to an alternative model that is known as the guard model. The guard model hypothesizes that, instead of direct binding, the R gene product functions as a sensor to detect the interactions between Av r proteins and their host targets (guardees). Once the host targets are manipulated by the pathogen Avr proteins, the R proteins can guard the change in status of the host targets and activate the defense responses. The first experimental evidence supporting the indirect R-Avr association comes from the work of Mackey and his colleagues (2002). In this study, an Arabidopsis protein named RPM1 interacting protein 4 (RIN4) was found to be required for RPM1-mediated disease resistance. RIN4 is a 211-amino-


29 acid acylated and plasma-membrane-associated protein. Overexpression of RIN4 in Arabidopsis reduces flg22-induced callose depositon and enhances the growth of TTSS-deficient bacteria, indicating that RIN4 plays a negative role in PTI. RIN4 is phosphorylated in the presence of AvrB or AvrRpm1 (Mackey et al. 2002), suggesting that AvrB or AvrRpm1 may increase their virulence by enhancing the activity of RIN4 as a negative regulator of PTI through phosphorylation. RIN4 interacts with both RPM1 and AvrB or AvrRpm1 in planta, and contributes to the accumulation of RPM1. It is hypothesized that RPM1 guards the phosphorylation of RIN4 caused by AvrB or AvrRpm1, and activates the downstream defense pathway. This phosphorylation may act as a switch to turn on RPM1-mediated disease resistance. Two other independent studies have demonstrated that RIN4 also regulates another NBLRR resistance protein, RPS2, that confers resistance to Pst DC3000 carrying AvrRpt2 (Axtell et al. 2003; Mackey et al. 2003). Overexpression of RIN4 compromises RPS2-mediated HR response and subsequent disease resistance, suggesting that RIN4 plays a negative role in RPS2mediated disease resistance. RIN4 associates with RPS2 in planta. The C-terminal, plasma membrane-associated domain of RIN4 is required for the association of RIN4 with RPS2 and is involved in the negative regulation of RPS2-mediated signaling (Day et al. 2005; Kim et al. 2005a). RIN4 is degraded when plants are infected by Pst DC3000 carrying AvrRpt2 (Mackey et al. 2003). The degradation of RIN4 is believed to be processed through AvrRpt2, a cysteine protease that cleaves a conserved peptide sequence VPxFGxW and its protease activity is essential for virulence. AvrRpt2 is delivered to the plant cell as an inactive precursor, and is processed into an active enzyme by eukaryotic cyclophilins (Coaker et al. 2005). RIN4 possesses two regions that share homology with the AvrRpt2 cleavage motif, and both of them have been shown to be cleaved by AvrRpt2, indicati ng that RIN4 is a direct substrate of AvrRpt2


30 protease. Thus, it is possible that the activation of RPS2-mediated disease resistance is carried out through perception of the disappearance of RI N4 by RPS2. In the absence of RPS2, AvrRps2 targets RIN4 or possibly other components to suppress PTI. However, in the presence of RPS2, the perturbation of RIN4 is guarded by RPS2 and the disease-resistance pathway is then activated. This research suggests that RIN4 appears to be a central molecular switch that regulates at least two independent R protein-mediated disease-resistance pathways and PTIsignaling pathways in Arabidopsis. The activation of ETI occurs when there is a perceived change in the state of RIN4 by RPM1 or RPS2. In contrast, AvrRPM1 and AvrRpt2 promote their virulence by manipulating RIN4 in the absence of cognate R proteins, which further results in the inhibition of PTI. Due to the fact that th e virulence of these two effectors is not abolished in the rin4 rpm1 rpt2 triple mutant, there must be host proteins other than RIN4 targeted by AvrRPM1 or AvrRps2 (Belkhadir et al. 2004). Further studies of new host proteins targeted by AvrRPM1 and AvrRps2 will help us understand the molecular activities of type III effectors and the mechanisms of related host responses (Figure 1-3a and b). The second piece of evidence to support the guard model comes from a study of the association of AvrPphB with RPS5 (Shao et al. 2003). Like AvrRpt2, AvrPphB is a cysteine protease and targets a host kinase, PBS1, which is required for RPS5-mediated disease resistance. PBS1 interacts with AvrPphB in planta. Conserved AvrPphB cleavage sites have been identified in both PBS1 and AvrPphB. In vitro assays show that PBS1 is a substrate of AvrPphB and is cleaved into two fragments. This cleavage is required for RPS5-mediated disease resistance. In addition, the kinase activity of PBS1 is indispensable for RPS5-mediated disease resistance. The study suggests that RPS5 guards PBS1 to regulate the disease resistance pathway. Once PBS1 is cleaved by AvrPphB, this cleaved product may be autophosphorylated and then recognized by


31 RPS5 to activate downstream defense responses (Figure 1-3c). The manner of recognition of AvrPph5 by RPS5 suggests that some type III e ffectors are detected indirectly via their enzymatic activities. The third piece of evidence bearing on the guard model comes from a study of the Pto gene in tomato. Recognition of AvrPto by Pto requires another NB-LRR protein, Prf (Salmeron et al ., 1996). Prf is tightly linked to Pto and both of them serve in the same signal transduction pathway (Salmeron et al ., 1994). Pto associates with Prf in a large protein complex and both of them contribute to the specific recognition of AvrPto (Mucyn et al. 2006). However, the direct interaction was only observed between AvrPto and Pto (Tang et al. 1996), but not between AvrPto and Prf. In addition, the amino acids of AvrPto required for the interaction with Pto have been proven indispensable to the suppression of PTI responses, suggesting that AvrPto may increase its virulence by manipulating Pto or its homologues (Wufl et al. 2004). Furthermore, since Pto interacts with two unrelated Pst type III effectors, AvrPto and AvrPtoB, through an overlapping region (Pedley and Martin, 2003), this suggests that it likely to be a host target for different bacterial effectors. These data prompt the hypothesis that Pto may serves as a guardee, and the function of Prf is likely to guard Pto, so it can activate the defense responses (Jones and Dangl, 2006) (Figure 1-3d). However, Prf is not a typical guard protein because it is present in both susceptible and resistant tomato cultivars, whereas Pto is the determinant of resistance and is therefore not present in susceptible cultivars. Thus, an alternative explanation is that AvrPto inhibits PTI by interfering with the interface of Prf and Pto (Mucyn et al ., 2006). In this scenario, instead of acting as a guard, Prf serves as a si gnal transmitter. AvrPto and AvrPtoB constitutively bind to a Prf-complex and inhibit the complex in susceptible plants. In the presence of Pto, the


32 binding is disrupted, and Prf is activated to transduce strong signals to activate the downstream signaling pathway. The last example of the guard model comes from a study of Cf-2-dependent disease resistance in tomato (Rooney et al. 2005). Cf-2 is a resistant protein conferring resistance to Cladosporium fulvum carrying Avr2. Avr2 is a protease inhibitor that targets Rcr3, a host extracellular cycteine protease. Rcr3 is specifically required for the disease resistance pathway mediated by Cf-2 (Dixon et al. 2000). Avr2 has been shown to bind to Rcr3 and to block the cycteine protease activity of Rcr3. The inhibition of Rcr3 by Avr2 is thought to induce the conformational change of Rcr3. This study suggests that Cf-2 guards the conformation of Rcr3 and activates the disease resistance pathway (Figure 1-3e). Studying how cognate R proteins recognize Avr effectors enhances our understanding of the molecular and cellular events associated with pathogen recognition and subsequent activation of disease plant defense responses. However, these findings provide only a partial explanation of the mechanisms involved in plant disease resistance. The structural similarity between some PAMP receptors and R proteins are blurring the distinctions between PTI and ETI. For example, both FLS2 and XA21 are RLKs with an extracellular LRR domain and an intracellular kinase domain. However, FLS2 and XA21 recognize a PA MP (flagellin) and an effector (AvrXA21), respectively, and trigger PTI and ETI responses. If we consider XA21 a PAMP receptor, in some cases PAMP receptors could activate a strong defense that looks like an R protein-mediated disease resistance (Abramovitch et al ., 2006). The difference between PTI and ETI is likely to be dependent upon timing and the strength of the same defense responses. A zigzag model has been proposed to explain the outcome of plant defense responses (Jones and Dangl, 2006). In this model, the plant defense responses consist of four phases. First,


33 pathogen-derived PAMPs are recognized by plant receptors, resulting in the activation of PTI; second, some pathogens deliver virulent effectors to inhibit PTI, leading to effector-triggered susceptibility (ETS); third, plants evolve R proteins that recognize these effectors by guarding some host proteins involved in PTI, and trigger ETI; finally, some pathogens employ new effectors which can suppress ETI, causing disease in plants. The zigzag model suggests that the major difference between PTI and ETI exists at the stage of pathogen recognition, and there is some cross-talk between PTI and ETI. Since the evolution of pathogens is much faster than that of plants, it is not efficient for plants to generate a completely novel system to respond to new elicitors of pathogens. Thus, there must be some conserved components shared by both PTI and ETI. With the characterization of more virulent effectors, PAMPs, PAMP receptors and R proteins, the contribution of PTI and ETI to promote plant disease resistance will eventually be elucidated. Downstream signaling components of PTI and ETI Although the recognition of pathogen Av r proteins by plant R proteins have been studied, the downstream events of plant defense/disease resistance remain to be fully understood. By using genetic approaches, a number of components that are involved in the disease resistance have been identified. A local signaling network of plant disease resistance pathway has been reviewed by Parker (Kim and Parker, 2003, Figure 1-3), and some of the key components are summarized below. RAR1 (required for Mla-dependent resi stance 1) and SGT1 (a suppressor of the G2 allele of SKP1) are two central regulators required for several R gene-mediated disease resistance in a variety of species, including Arabidopsis, barley, and tobacco (Freialdenhoven et al. 1994; Azevedo et al. 2002; Liu et al. 2002b; Liu et al. 2002c; Muskett et al. 2002). RAR1 was identified by screening mutants for inhibitors of Mal12 -mediated resistance in barley to the


34 powdery mildew fungus Blumeria graminis f. sp hordei It encodes a 25 kD zinc-binding protein and functions in both CCand TIR-NB-LRR-type R gene-mediated disease resistance pathways (Shirasu et al. 1999). rar1 mutants failed to initiate an HR response at early time points when infected by pathogens. However, at later points after inoculation, a strong HR response occurred in rar1 plants (Muskett et al., 2002). These results suggest that RAR1 acts at an early stage of R gene-mediated defense response. SGT1 was originally identified as a regulator of the cell cycle in yeast and was involved in the SCF (Skp1/Cullin/F-box protein) E3 ubiquitin ligase complex (Kitagawa1 et al. 1999). SGT1 is conserved in all eukaryotic cells. In plants, mutant screening found SGT1 was required for RPP5-mediated disease resistance (Austin et al., 2002). Furthermore, down-regulation of SGT1 in tobacco impaired N gene-mediated disease resistance (Liu et al., 2002b). SGT1 associates with RAR1 and SKP1 that is a highly conserved component of SCF E3 ubiquitin ligase complex (Azevedo et al ., 2002; Liu et al ., 2002b). Both SGT1 and RAR1 interact with two subunits of the CO9 signalosome, a proteasome lid complex. These observations suggest a regulatory role for the ubiquitin-proteasome pathway in plant disease resistance. In Arabidopsis, there are two functional orthologs of yeast SGT1 AtSGT1a and AtSGT1b. Both of them are highly conserved and can complement cell cycle arrest in yeast sgt1 mutants. However, only AtSGT1b is involved in disease resistance. Analyses of the phenotype of the double mutant rar1 sgt1b suggest that RAR1 and AtSGT1b contribute additively to RPP5mediated disease resistance (Austin et al., 2002) However, in another independent study, it was found that AtSGT1b antagonized RAR1 to regulate RPS5-mediated disease (Holt et al. 2006). One major known function of RAR1 is to regulate the accumulation of R proteins (Tornero et al. 2004). It was found that more RPS5 protein was accumulated in rar1sgt1 plants than in rar1


35 plants, suggesting that RAR1 and AtSGT1b functi on antagonistically to control R protein levels and the outcome of defense responses depends on their balanced protein levels. The inconsistent conclusions from Austin et al and Holt et al s work suggest that AtSGT1b may play two roles in plant disease resistance: one in the regulation of HR in a RAR1-independent manner, and the other to act as an antagonist to RAR1 to regulate the levels of R proteins. The phenotype of rar1sgt1b mutant when it is infected by a pathogen is dependent on either HR or R protein accumulation is dominant to inhibit the spread of the pathogen. In the case of HR being more important for plant disease resistance, partial HR occurring in the double mutant rar1sgt1b will result in increased pathogen growth, which leads to the conclusion that RAR1 and AtSGT1b are additively required for some R gene-mediated disease resistance. However, if the R protein accumulation is more critical for plant disease resistance, more R protein will accumulate in the double mutant rar1sgt1b compared to that in the rar1 mutant, which results in decreased pathogen growth and leads to an opposite conclusion that AtRAR1 and SGT1 act against each other. EDS1 (Enhanced disease susceptibility 1) and PAD1 (Phytoalexin deficient 1) are two positive regulators in PTI and are also required for TIR-NB-LRR-type R gene-mediated disease resistance. EDS1 was identified by screening mutants for suppression of R gene-mediated resistance to the oomycete pathogen, Peronospora parasitica ( Parker et al. 1996). PAD1 an in vivo EDS1 interactor, was first identified when m utants were screened for enhanced disease susceptibility to Pseudomonas syringae pv. maculicola and is required for resistance conferred by RPP2, RPP4, and RPP5 ( Glazebrook et al. 1996; Glazebrook et al. 1997; Jirage et al. 1999). Both EDS1 and PAD1 encode lipase-like proteins and confer resistance governed by the sam e set of R genes as RPP2, RPP4, and RPP5 (Falk et al. 1999; Jirage et al. 1999). EDS1 is essential for


36 the action of an HR response, and this HR is PAD1-dependent. In addition, while the expression of both EDS1 and PAD1 is induced when plants are infected by pathogens, EDS1 is required for pathogen-induced mRNA accumulation of PAD1 but the induced expression of EDS1 is only partially affected in the pad1 mutant. This suggests that there are two pools of EDS1 in plants: one that functions upstream of the HR in a PAD1-dependent mode, and the other that acts independently of PAD1. Both EDS1 and PAD1 are required for the accumulation of salicylic acid (SA), a defense signal molecule in plants. Conversely, as a part of a positive feedback loop, SA itself also contributes to the expression of EDS1 and PAD1 The data suggest that the EDS1-PAD1 complex may amplify the defense signals by regulating the level of SA (Feys et al. 2001; Wiermer et al. 2005). EDS1 and PAD1 are also involved in modulating signal antagonism between SA and jasmonic acid/ethylene (JA/ET). SA is thought to induce an HR response, which is generally considered as program cell death. This cell death restricts the growth of biotroph pathogens, such as bacteria, viruses, and some fungi that establish a colonizing relationship with living host cells. JA/ET functions in the necrotr oph resistance pathway that acts to defend against necrotroph pathogens, including a wide range of insect herbivores that feed and live in dead tissues (Kim and Parker, 2003). MAP kinase 4 (MAP4) inhibits the accumulation of SA and enhances the level of JA/ET. This suppression of SA accumulation is antagonized by EDS1 and PAD1 (Petersen et al ., 2000; Wiermer et al. 2005). NDR1 (Non-race-specific disease resistance 1) was originally identified in a screen for Arabidopsis mutants exhibiti ng impaired resistance to Pst DC3000 carrying AvrB (Century et al ., 1995). This gene encodes a plasma membrane, glycophosphatidyl-inositol (GPI)-anchored protein. NDR1 is required for the activation of disease resistance mediated by various R proteins,


37 suggesting that it might be a common regulator of multiple disease resistance pathways (Coppinger et al. 2004). Day and Staskawicz (2006) demonstrated that NDR1 interacts with RIN4 through its N-terminal-18-amino acid region (Day et al. 2006). This finding provides an insight into the function of NDR1. RIN4 has been shown to regulate at least two R genemediated disease resistance. The amount of free RIN4 in cytosol is critical to the activation of R proteins. NDR1 may act as a RIN4 interactor to regulate the pool size of free RIN4, and NDR1RIN4 serves as another layer to modulate plant disease resistance (Day et al. 2006) Studies of the key components involved in plant disease resistance pathways help us elucidate the molecular mechanism underlying those pathways. However, to completely understand the entire signaling pathway, additional downstream components will need to be cloned and characterized. Furthermore, studies of how these components are regulated and modified when challenged by pathogens coul d have a more significant impact on our understanding of the signal transduction pathway of plant disease resistance. Bacterial Blight Disease of Rice Rice is one of the worlds m ost important food sources and is a diet staple for more than half the worlds population. Bacterial blight caused by Xoo is one of the primary diseases of rice and can have devastating effects on rice production. In severely infected fields, yield losses can be as high as 50% (Mew et al. 1993). Like other bacterial pathogens, Xoo penetrates rice leaves through wounds or hydathodes. After invading the plants intercellular space, Xoo proliferates in the epitheme, the tissue that connects the hydathodes and the xylem, and then moves into the xylem vessels. Once in the vascular system, Xoo continues to multiply until the xylem vessels are clogged by bacterial cells and polysaccharides (EPS or xathan), a sticky substance that is secreted by Xoo. If the infection occurs at the seeding or early tillering stage, rice leaves will


38 become wilted. If the infection occurs at a later stage, the leaves turn gradually from green to grayish-green to chlorotic (Shen and Ronald, 2002). To control this disease, nearly 30 genetic loci for resistance to bacterial blight have been identified in rice, and five of them have been cloned (Song et al. 1995; Yoshimura et al. 1998; Lyer et al. 2004; Sun et al., 2004; Gu et al. 2005). According to their gene product structures, these five genes belong to three different groups. Xa1 that encodes an NB-LRR protein represents the first group (Yoshimura et al. 1998). This gene confers resistance to the Japanese Race 1 of Xoo, and its expression is induced by pathogen infection. Xa21 and Xa26/Xa3 which encode RLKs, make up the second group (Song et al., 2005; Sun et al., 2004). Both of them confer resistance to multiple races of Xoo. However, transgenic plants carrying Xa21 show resistance to Xoo only at the adult stage, whereas Xa26 confers resistance to Xoo at both the seedling stage and the adult stage. The last group contains xa5 and Xa27 that encode proteins showing no structural similarity with any known R protein (Iyer et al. 2004; Jiang et al ., 2006; Gu et al ., 2007) The xa5 gene is recessive and encodes a gamma subunit of a general transcription factor, IIA (TFIIA). xa5 is an important race-specific gene because it confers resistance to a broad spectrum of Xoo strains. Xa27 is the only rice resistance gene with a known cognate Avr gene, AvrXa27 (Gu et al. 2005). Xa27 confers resistance to diverse stains of Xoo. Like Xa1, the expression of Xa27 is induced in response to Xoo. However, Xa27 is only induced by Xoo carrying AvrXa27 while Xa1 is induced by all the strains. Given that the Xa27 constitutive expression line shows resistance to all the strains, with or without AvrXa27 this indicates that the expression level of Xa27 is critical for disease resistance.


39 XA21-mediated disease resistance The cloning of Xa21, along with other resistance genes, represents a breakthrough in our understanding of the m olecular basis of resistance to Xoo in rice (Lee et al. 2006). XA21mediated resistance develops progressively from susceptibility at the seedling stage to full resistance at the adult stage (Century et al., 1999). Since the expression of Xa21 is comparable among plants with different developmental stages and even when infected with Xoo, the posttranscriptional regulation of XA21 may play a role in the signaling pathway. Bioinformatic analyses have led to the identification of a region, RS686RT688S689MKG, in the juxtamembrane domain of XA21. This region shares a sequence similarity with a proteolytic cleavage motif (P/GX5-7P/G) that was originally identified in animal epidermal growth factor receptor (EGFR) (Yuan et al. 2003). It was therefore named XA21CS1. Tw o similar motifs have been identified inside the kinase domain, and were named XA21CS2 and XA21CS3 (G. Cory and W.-Y Song, unpublished data). Biochemical studies have revealed that XA21 is a serine/threonine specific kinase and can be autophosphorylated on multiple serine and threonine residues including S686, T688, and S689 located in XA21CS1 (Liu et al ., 2003, Xu et al ., 2006). A dead kinase mutant XA21K736E accumulated to a much lower level in rice compared to wildtype XA21. These data suggest that XA21 may be regulated by an unknown protease at the protein level and autophosphorylation may contribute to this pr ocess. Indeed, when immunoblotted, a 100 kD band that was derived from XA21 and XA21K736E was detected (Xu et al 2006). The molecular weight of this band is consistent with that of a XA21-cleaved product, supporting the hypothesis that XA21 may be targeted by a protease. Furthermore, substitution of S686, T688, and S689 residues with alanine (XA21S686A/T688A/S689A) reduced the steady-state levels of XA21 and resulted in a much higher level of the 100 kD-cleaved product. These results suggest that autophosphorylation of these three residues is critical to protect XA21 from cleavage. In addition,


40 both XA21 and XA21S686A/T688A/S689A accumulated to a higher level in the seedling plants than in the adult plants, suggesting that the accumulation of XA21 is developmentally regulated and the putative protease that cleaves XA21 may function only at the adult stage. XA21-mediated disease resistance is activated by the recognition of AvrXa21. Even though the molecular identification of AvrXa21 is still unknown, a number of Xoo genes required for AvrXa21 activity have been identified (Lee et al. 2006). Three genes encoding components of a TOSS are required for AvrXa21 activity (Lee et al ., 2006), suggesting that AvrXa21 is delivered by a TOSS. In addition, the core AvrXa21 molecule is conserved between two Xanthomonas species, Xoo and X. campestris pv. campestris ( Xcc). Conservation between different species is a major characteristic of PAMPs (Lee et al., 2006). Taken together with the genetic data that show the recognition of AvrXA 21 triggers a typical R protein-mediated disease resistance, AvrXa21 shares features of both PAMPs and Avrs. Even though Xa21 has been cloned for ten years, the signaling pathway mediated by this gene is still poorly understood. One gene that is involved in XA21-mediated resistance signaling is NRR, which encodes a protein that interacts with a NPR1 homolog1 (NH1) protein in rice (Chern et al. 2005). Overexpression of NRR compromises the XA21-mediated disease resistance, suggesting that the gene negatively regulates XA 21-mediated disease resistance. Another gene that is involved in XA21-mediated disease resistance is XB3 (Wang et al. 2006). This gene encodes an E3 ubiquitin ligase and positively regulates XA21-mediated disease resistance. The details about this gene will be discussed in the following chapters. RLK family in plant disease resistance XA21 is a m ember of RLK family. Members of this family play a fundamental role in the transduction of various developmental and environmental signals in plants (Yuriko et al. 2005). For example, BR1 serves as a brassinosteroid receptor in Arabidopsis (Wang et al ., 2001),


41 CLAVATA1 modulates meristem proliferation (Clark et al. 1997), and FLS2 confers resistance induced by bacterial flagellin (Gmez-Gmez et al. 2001). RLKs comprise the largest family of receptors in plants, with about 600 members in Arabidopsis and over 1100 members in rice (Shiu et al. 2004). The greater number of RLKs in rice is thought to result from lineage-specific expansion of resistance/defense-related kinase (LSEKs) (Shiu et al. 2004). Three cloned rice resistance genes, Xa21, Xa26 and Pi-d2 all belong to thr LSEK family. In another higher plant, poplar, that has been sequenced, a larger RLK family is observed, suggesting the expansion of RLKs may occur in other higher plant species. Thus, the XA21-mediated disease resistance pathway can be an attractive model to study LSEKs-mediated disease in rice and other higher plant species.


42 Figure 1-1. Main components of the signal transduction pathways in innate immunity in insects (Drosophila ), mammals, and plants (Arabidopsis). [Gmez-Gmez et al. 2002. Trends in Plant Science 7: 251-256.]


43 Figure 1-2. Classes of resistance proteins [Chisholm et al ., 2006. Cell 124: 803-814.]


44 Figure 1-3. Plant immune system activation by pathogen effectors. [Jones and Dangl, 2006. Nature 444:323-329].


45 Figure 1-4: Overview of the local signaling networks controlling activation of local defense responses. [Hammond-Kosack and Parker, 2003. Current Opinion in Biotechnology 14: 177-193].


46 CHAPTER 2 IDENTIFICATION AND CHARACTERIZATION OF AN XA21-BINDING PROTEIN, XB25 Introduction Plant induced defense system s consist of two parts. The first is triggered by recognition of general pathogen-associated molecule patterns (PAMPs) through host receptors leading to PAMP-triggered immunity (PTI) (Lee et al ., 2006). The second is activated by recognition of specific pathogen-encoded avirulent molecules (Avr) through plant resistance (R) proteins. This response is known as effector-triggered immunity (ETI) (Jones and Dangl, 2006). Plant resistance proteins are one of the major determinants of ETI. To date, more than 40 host R genes have been cloned and characterized. One of them, Xa21, encodes an RLK (XA21) and confers resistance to a broad range of Xathomonas oryzae pv. oryzae ( Xoo) strains (Song et al ., 1995). To analyze the components involved in XA21-mediated disease resistance, yeast twohybrid rice cDNA libraries were screened and more than ten proteins that associate with the kinase domain of XA21 (XA21K) have been id entified (L.-Y. Pi, X. Dong and W.-Y. Song, unpublished data). Among them, XB3 has been characterized in detail (Wang et al ., 2006). XB3 encodes a protein containing an N-terminal ankyrin repeat domain and a C-terminal RING (really interesting new gene) finger motif. Ankyrin repeats are often involved in protein-protein interactions, whereas RING finger motifs are usually present in E3 ubiquitin ligases. Yeast twohybrid analyses show that XB3 specifically interacts with XA21K in yeast. In addition, the ankyrin domain of XB3 is sufficient for the interaction with XA21K in vitro. Members of the p lant-specific-ank yrin-repeat (PANK) family are characterized by a conserved ankyrin repeat domain at their C-terminus (Wirdnam et al ., 2005). Eight members of PANK have been identified in Arabidopsis thaliana rice and tobacco. Seven of them carry at least one signature sequence for the glycosyl hydrolase (GH) family that is implicated in various


47 important physiological processes, including responses to abiotic and biotic stresses, activation of phytohormones, and cell wall remodeling (Opassiri et al., 2006). Five of the eight PANK members contain a motif that is characterized by the presence of a region rich in proline (P), glutamic acid (E), serine (S), and threonine (T) (PEST). PEST sequences are thought to target eukaryotic proteins for phosphorylation and/or degradation (Decatur et al ., 2000). The presence of a PEST motif is a signal of short-lived proteins. Members of PANK have been implicated in both carbohydrate metabolism and plant defense/disease resistance pathways (Peck et al ., 2001; Yan et al ., 2002; Kuhlmann et al 2003; Wirdnam et al ., 2005). In tobacco, up-regulation of GBP1/TIP2 induces curling of young leaves, which is associated with reduced starch and sucrose accumulation, suggesting that CBP1/TIP2 is involved in carbohydrate allocation. CBP1/TIP2 in teracts with PR-like proteins, beta-1,3glucanase (GLU1), and chitinase (CHN1). The increased expression of CBP1/TIP2 is associated with the formation of HR-like necrotic lesions in tobacco leaves. These results suggest that CBP1/TIP2 may play a role in plant defense responses. Another member of the PANK family in tobacco, ANK1/TIP1/HBP1, interacts with a bZIP transcription factor, BZI-1 that is involved in auxin-mediated growth responses and in the induction of plant defense responses. ANK1/TIP1/HBP1 is transiently down-regulated after a pathogen attacks, suggesting a role in plant defense responses. In Arabidopsis, down-re gulation of the PANK protein AKR2 results in an increase in the resistance to bacterial pathogens and in the levels of reactive oxygen species (ROS). These results suggest that AKR2 plays a negative role in plant disease resistance. In addition, the Arabidopsis protein AtPhos43 is structurally related to AKR2 and is rapidly phosphorylated with the treatment of the bacteria l flagellin 22 peptide (flg22). This flagellin-


48 induced phosphorylation of AtPhos43 is dependent on the presence of the RLK protein, FLS2, indicating that AtPhos43 is involved in the FLS2-mediated PTI pathway. A few members of PANK have been shown to be involved in plant defense responses, however there is no physical link between a PANK member and known R protein. In this study, an ankyrin repeat-containing protein, XA21-bindi ng protein 25 (XB25), was identified by yeast two-hybrid screening using a truncated versi on of XA21 spanning the transmembrane domain and the kinase domain (XA21KTM) as bait. XB25 interacted with XA21KTM in yeast. Sequence analyses indicate that XB25 belongs to the PANK family. XB25 also interacted with XA21KTM in vitro. Transgenic plants with down-regulated levels of XB25 proteins show neither morphological differences nor altered resistance to Xoo compared to the recipient plants carrying no Xa21 gene. The results link the PANK protein XB25 to the R protein XA21. Materials and Methods Phylogenetic and Sequence Analyses Phylogenetic analyses were carried out based on the deduced am ino acid sequences of the rice proteins (XB25, XBOS25-1, and XBOS25-2), the Arabidopsis proteins (AKR2 and AtPhos43), and the tobacco proteins (TIP1, TIP 2, and TIP3) using the ClustalW program from EMBL-EBI ( http://www.ebi.ac.uk/clustalw ). Multiple sequence alignm ents were performed by using the software of MultAlin (http://bioinfo.genopole-toulouse.prd.fr/multalin ), developed by Florence Corpet (1998). The identity and sim ilarity among proteins were calculated using the GAP tool within the Wisconsin Sequence Analysis Package from the Genetics Computer Group (Madison, WI). The rice gene accession numbers in the TIGR database ( http://www.tigr.org/tdb/e2k1/osa1/ ) for XB25, XBOS25-1, and XBOS25-2 are Os09g33810 (XB25), Os03g63480 (XBOS25-1), Os08g42690 (XBOS25-2). The GenBank accession


49 numbers for the rest of the proteins described above are At2g17390 (AtPhos43), At4g35450 (AKR2), AF352797 (TIP1), AY258007 (TIP2), and AAO91862 (TIP3). Molecular Cloning of XBOS25-1 T o clone XBOS25-1, RT-PCR was performed. Total RNA from rice was extracted by the following procedure: 0.5 g of rice leaves was ground using a mortar and pestle in an adequate volume of liquid nitrogen. Then transferred to a 50 mL centrifuge tube. 1 mL of RNA-bee (TelTest, Friendswood, TA) was mixed with the powdered leaf material; 200 l of chloroform was added and the tube was shaken vigorously for 30 seconds on a vortex shaker. The homogenate was centrifuged at 12,000 g for 15 min at 4 oC; The upper aqueous phase was transferred into a new tube and mixed with 0.5 mL of isopropanol; The RNA precipitates were collected after centrifugation at 12,000 g for 15 min and then washed with 75% ethanol; The RNA pellet was briefly dried in vacuum and dissolved in wate r pre-treated with diethyl pyrocarbonate (DEPC). Rice cDNA was synthesized from the isolated RNA using the SuperScrip First-Strand Synthesis System (Invitrogen, Carlsbad, CA). A solution of 10 l of RNA/Primer mixture containing 5 g of total RNA, 1 l of dNTP (10 mM), 1 l of Oligo(dT)12-18 (0.5 g/ l), and 3 l of DEPC-treated water was incubated at 65 oC for 5 min, and the sample was placed on ice for at least 1 minute. A volume of 9 l of a reacti on mixture containing 2 l of 10x RT buffer, 4 l of 25 mM MgCl2, 2 l of 0.1 M DTT, and 1 l of RNaseOUTTM Recombinant RNase Inhibitor was added to the RNA/Primer mixture and incubated at 42 C for 10 min. 1 l (50 units) of SuperScriptTM II RT was added to the reaction mixture and incubated at 42 C for an additional 50 min. The reaction was stopped by incubating at 70 oC for 15 min and the RNA template was removed by adding 1 l of RNase H and incubating at 37 oC for 1 hour. XBOS25-1 was amplified using prim ers P1 (5-ATGGCTTCTCAAGAAGAGAAGACG3) and P2 (5-T TCTATACGAAGGCGTGCT TCTCGAGCA-3), designed according to the


50 reported cDNA sequence (Os03g63480). PCR was pe rformed using the following procedure: denaturation (99 oC for 10 min), five extension cycles (94 oC for 30 sec, 45 oC for 30 sec, 72 oC for 1 min), twenty-five extension cycles (94 oC for 30 sec, 56 oC for 30 sec, 72 oC for 1 min) and one extension cycle (72 oC for 10 min). The amplified products were resolved in a 1% agarose gel and cloned into the pGEM-T Easy vector (Promega, Madison, WI). The cloned XBOS25-1 was confirmed by DNA sequencing at the University of Flor idas DNA Sequencing Core. Construction of BD-XA21KTM, BD-XA21KTMK736E, BD-XA21KTMS686A/T688A/S689A, BDPi-d2KTM, BD-XA21K, AD-XB25, AD-XB 25N, AD-XB25C, and AD-XBOS25-1 Yeast two-hybrid vectors, pPC97 that carries a GAL4 DNA binding domain (BD) and pPC86 that carries a GAL4 activation domain (AD), were used here (Chevray and Nathans, 1992). The BD-XA21KTM, BD-Pi-d2KTM, BD-XA 21K, and AD-XB25 constructs were kindly provided by Dr. X. Ding. To make other BD c onstructs, XA21KTM was subcloned into the pGTK vector, which was modified from pGTK-2 T (Amersham Bioscience, Piscataway, NJ). The resulting construct was desigated as GST-XA21KTM. Site-directed mutagenesis was used to make the BD-XA21KTMK736E construct. Primers P3 (5-GGACTTGGTTGAATACTCACCAG3) and P4 (5-AAGCTTTAGTACCTCCACTGCAACA-3) were designed to specifically mutate Lys736 of XA21 to glutamic acid (Stratagene, La Jolla, CA). GST-XA21KTM was used as template for the following PCR reaction: step 1, 99 C for 10 min; step 2, 94 C for 1 min; step 3, 50 C for 1 min, step 4, 68 C for 16 min (repeat steps 2 through 4 four times), step 5, 94 C for 1 minute; step 6, 56 C for 1 minute; step 7, 68 C for 16 min (repeat steps 5 through 7 fifteen times); step 8, 72 C for 10 min. To remove the methylated template DNA, 1 l of Dpn I was added to 20 l of PCR reaction mixture and incubated at 37 C overnight. The digested PCR products were transformed into E. coli DH5 competent cells. Candidate GST-XA21KTMK736E constructs were purified by using the QIAprep Spin Miniprep Kit (QIAGEN Sciences,


51 Germantown, MD) and confirmed by DNA sequencing. BD-XA21KTMK736E was generated by subcloning XA21KTMK736E from GST-XA21KTMK736E into the corresponding sites of pPC97. Similar strategies were used to create BD-XA21KTMS686A/T688A/S689A except the primers P5 (5-CGGGAAGCGGCCTGATGACGATGATTTCAGACCCGATTTG-3) and P6 (5CAAATCGGGTCTGAAATCATCGTCATCAGGCCGCTTCCCG-3) were designed to mutate Ser686, Thr688, and Ser689 of XA21 to alanines. By utilizing a yeast recombination-based strategy (Chen et al ., 2005), pPC86-XB25N was generated. XB25N was amplified using the primers P7 (5AAGATACCCCACCAAACCCAAAAAAAGAGGGTGGGATGGAAGACCAGAAGAAAAAT GC-3) and P8 (5 GTTACTTACTTAGAGCTCGACGTCTTACTTACTTACTG GCAGTATGATGGACAATGGA-3) in a 50 L mixture containing 50 ng of pPC86-XB25, 20 mM Tris-HCl (pH 8.4), 50 mM KCl, 3 mM MgCl2, 0.4 M of each primer, dNTPs at 0.2 mM each, 10% DMSO, and 1 unit of Taq DNA polymerase. The PCR reaction was carried out with the following cycling parameters: step 1, 99 oC for 10 mins; step 2, 94 oC for 30 sec; step 3, 56 oC for 30 sec; step 4, 72 oC for 30 sec (repeat steps 2 through 4 thirty-five times); step 5, 72 oC for 10 min. The PCR products were fragmented in a 1% agarose gel and purified using the QIAquick Gel Extraction Kit (QIAGEN Sciences). The vector was prepared by digesting pPC86 with restriction enzymes Sal I and Not I (New England Biolabs, Beverly, MD). The linearized pPC86 and purified XB25N were co-transformed into the yeast strain CG1945 (Mata, ura3-52, his3-200, lys2-801, ade2-101, trp1-901, le u2-3, 112, gal4-542, gal80-538, cyhr2, LYS 2::GAL1UAS-GAL1TATA-HIS3, URA3::GAL4 17-mers(x3)-Cyc1TATA-lacZ ). Transformants were grown on SD/-Trp solid medium [6.7 g/L y east nitrogen base without amino acids (Becton, Dickinson, Sparks, MD), 0.74 g/L SD/-Trp DO supplement (Clontech, Palo Alto, CA), 2%


52 glucose, 20 g/L argar, and adjust the pH to 5.8] at 30 oC for 2-4 days. Single yeast colonies grown on SD/-Trp plates were inoculated into 2 mL of liquid SD/-Trp medium and incubated at 30 oC for 16 hours with shaking at 250 rpm. Plasmids in yeast were then isolated by using the Zymoprep Yeast Plasmid Minipreparation Kit (Zymoprep, Orange, CA) and subjected to PCR analysis and bacterial transformation. XB25C was amplified using the primers P9 (5GTGTGTCGACTGAAGAAACTGAAGAGGATGGTG-3) and P10 (5GTGTGCGGCCGCTAGGAAAGCGTCCATCTCGAG-3) from pPC-XB25. The PCR reaction was carried out with the following cycling parameters: step 1, 99 oC for 10 mins; step 2, 94 oC for 30 sec; step 3, 54 oC for 30 sec; step 4, 72 oC for 30 sec (repeat steps 2 through 4 thirty-five times); step 5, 72 oC for 10 min. The PCR products were fragmented in a 1% agarose gel, and purified using the QIAquick Gel Extraction K it (QIAGEN Science). The purified product was digested with Sal I/Not I, and was cloned into corresponding sites of pPC86 to make an in-frame translational fusion with GAL4 AD domain. XBOS25-1 was amplified using the primers P11 (5GCGCGTCGACTATGGCTTCTCAAGAAGAGAAGACG-3) and P12 (5-GCGCGGCCGCT TCTATACGAAGGCGTGCT TCTCGAGCA-3). Similar procedures as described above were followed to clone XBOS25-1 into the pPC86 vector. Preparation of Yeast Competent Cells The yeast strain CG1945 was streaked on a fresh yeast extract/peptone/dextrose (YPD) plate containing 2% peptone, 1% yeast extract 2% glucose, and 1.5% bacterial agar. The competent cells were prepared by using the Zymoprep frozen-EZ yeast transformation II kit (Zymoprep). Single yeast colonies were inoculat ed into 1 mL of YPD medium and incubated overnight at 30 oC with shaking at 250 rpm. The culture was diluted ten-fold with liquid YPD


53 medium and continued to grow until an OD600 reading of 0.8 to 1.0 was reached. The cells were harvested by centrifugation at 500 g for 5 min at room temperature. The pellet was resuspended in 10 mL of EZ yeast transformation solution 1. Cells were collected again by repeating the centrifugation process, and resuspended in 1 mL of EZ yeast transformation solution 2. Cells were then aliquoted and stored in oC freezers for future use. Co-transformation of Bait and Prey Constructs into Yeast Cells Co-transform ation was performed using the Zymoprep Frozen-EZ Yeast Transformation II kit (Zymoprep). The transformation reaction mixture contains 0.2 g of bait and prey constructs, 50 l of competent cells, and 500 l of EZ yeast transformation solution 3. The mixture was incubated at 30 oC for one hour and vortexed every 15 min. 150 l of the mixture was spread on SD/-Trp-Leu medium (6.7 g/L yeast nitrogen base without amino acids, 0.67 g/L SD-Trp-Leu DO supplement, 20 g/L bacterial agar, and 2% glucose). To test the interactions between bait and prey proteins, the colonies on SD/-Trp-Leu we re picked, and replicated on SD/-Trp-Leu-His medium and incubated for 2-3 days at 30 oC. Bacterial Expression and Purification of Fusion Pr oteins To express XB25 as a maltose-binding protein (MBP) fusion protein, the pMAL-XB25 construct was generated. XB25 was amplified by primers P13 (5GTGTGTCGACGATGGAAGACCAGAAGAAAAATG-3) and P14 (5GTGTGCGGCCGCTAGGAAAGCGTCCATCTCGAG-3). The PCR products were gel purified using the QIAquick Gel Extraction Kit (QIAGE N Sciences). The purified PCR products were cloned into the corresponding sites of the pMAL vector, modified from pMAL-c2X expression vector (New England Biolabs). The pMAL-X B25 construct was then transformed into E. coli strain ER2566 (New England Biolabs).


54 To express MBP-XB25 in bacteria, a single colony was inoculated into 5 mL of LB medium containing 50 g/mL ampicillin (LBAmp) supplemented with 0.2% glucose. The culture was incubated at 37 oC overnight with shaking at 250 rpm, then 500 l of the culture solution was diluted 100-fold into 50 mL of LBAmp 50 g/mL supplemented with 0.2% glucose, then grown at 37 C until an OD600 of 0.5-0.6 was reached. To induce the expression of MBP-XB25, isopropyl-1-thio-D-galactopyranoside (IPTG) was added to the culture to obtain a 0.4 mM final concentration. The culture was then incubated for an additional 2 hours with shaking at 250 rpm. Cells from the culture were harvested by centrifugation at 4,000 g for 10 min and resuspended in 500 l of column buffer solution [20 mM Tris-HCL (pH 7.4), 200 mM NaCl, 1mM EDTA, 1mM Dithiothreitol (DTT)]. The cell suspension was transferred into a pre-chilled 1.5 mL tube and sonicated on ice for a total time of 1.5 min (15 seconds sonication and 15 seconds in ice, repeated two times) using a Microson Ultrasonic Cell Disruptor (Misonix Incorporated, Farmingdale, NY). The supernantant was collected by centrifugation at 12,000 g for 1 minute at 4 C and incubated with 50 l of pre-washed amylose resin (New England Biolabs) at 4 C for 1 hour. After incubation, the resin was washed with column buffer 5 times and the fusion protein was eluted with column buffer containing 3.6 mg/mL maltose. The sample was resolved by an 8% SDS-PAGE gel. Similar protocols were used to e xpress XB25 as a glutathione S-transferase (GST) fusion protein (GST-XB25) or a FLAG-tagged fusi on protein (FLAG-XB25) with the following changes: (1) GST buffer (50 mM HEPES (pH 7.4), 150 mM NaCl, 10 mM EDTA, 1 mM dithiothreitol) and glutathione-agarose beads (Sigma-Aldrich, St.Louis, MO) were used for purification of GST-XB25; (2) FLAG buffer [20 mM Tris-HCL (pH 7.6), 13 mM NaCl, 1mM


55 dithiothreitol] and Anti-FLAG-M2 agarose (Sigma-Aldrich) were used for the purification of FLAG-XB25. To express XA21KTM as a His-tagged fusion protein (His-XA21KTM), XA21KTM was amplified using primers P17 (5-G TGTGTCGACTTTCCCAGTTCTACCTATTTCTGTTTC-3) and P18 (5GTGTGGCCGCCAGAAGTCGATCTGAAGTGTGGCA-3). The amplified products were cloned into the corresponding sites of pET86 expression vector (Invitrogen). HisXA21KTM was expressed by the protocols descri bed above and purified using a Ni-NTA HisBind Resin and Buffer kit (Novagen, San Diego, CA). Bacterial cells grown in 50 mL of LBAmp were collected and re-suspended in 500 l of Ni-NTA binding buffer. After sonication, the cell debris was discarded, and 20 l of 50% slurry of Ni-NTA His-Bind resin was added to the supernatant. The mixture was incubated at 4 C for 30 min and the resin was pelleted by centrifugation at 12,000 g for 1 min. The resin was then washed with 2x 100 l of 1x Ni-NTA washing buffer and the fusion proteins were elut ed with 30 l of Ni-NTA elution buffer. Generation and Purification of Antibodies against XB25 A region in the middle part of XB25 (XB25M) was used to develop antibodies against XB25. XB25M was amplified using primers P19 (5GTCTGTCGACGGATCCTGGAATGTCCAGTATGCTC-3) and P20 (5GTCTGCGGCCGCTCACGCATCGCCAACACTGGCAGTATG-3). Two constructs, MBPXB25M and GST-XB25M, were created by cloning the PCR fragment into pMal and pGTK vectors, respectively. MBP-XB25M and GST-XB25M was expressed and purified by the procedure described above. MBP-XB25M protein was resolved by an 8% SDS-PAGE gel and visualized by staining with coomassie blue so lution [ 0.1% (w/v) coomassie blue R350, 20% (v/v) methanol, and 10% (v/v) acetic acid] and destained with destain buffer [50% (v/v) methanol in water with 10% (v/v) acetic acid]. The band corresponding to MBP-XB25 in the SDS-PAGE gel


56 was cut out and 400 g of MBP-XB25M protein was used to immunize a rabbit (Cocalico Biologicals, Reamstown, PA). After immunization, antisera were collected and subjected to affinity purification.200 g of GST-XB25M protein was resolved by an 8% SDS-PAGE gel and transferred to a PVDF membrane (MILLIPORE, Billerica, MA) using a semi-dry transfer cell (BioRad, Hercules, CA) at 25 volts for 15 min. The protein blots were visualized by staining with Ponceau S solution [(0.2% Ponceau S (Sigma-Aldrich), 0.3% trichloroacetic acid (TCA)] for 10 min and then detained with several rinses of distilled water until the bands were visible. The band of GSTXB25M was cut out using a clean single-edge razo r blade and the remaining Ponceau S stain was removed by washing with several rinses of phosphate-buffered saline (PBS) [8 g/L NaCl, 0.2 g/L KCl, 1.44 g/L Na2HPO4 and 0.24 g/L KH2PO4 pH 7.4]. The strip was incubated in 10 mL of blotting buffer (5% nonfat dry milk in PBS) for 1 hour and washed 3 times with 10 mL of PBS for 5 min per wash. The strip was then placed on a piece of Parafilm and 1 mL of crude antiserum was applied to the surface of the strip. After 2 hours of incubation with gentle shaking, the depleted fraction was removed and the strip was washed 3 times with PBS. Finally, the purified antibody was eluted using 200 l of lo w-pH buffer (0.2 M glycine, 1 mM EGTA, pH 2.3-2.7). Creation of the RNAi XB25 Construct A region from the 3-terminal untranslated end of XB25 was selected to generate an RNAi XB25 construct. This region was PCR amplified in both sense and antisense orientations using primer sets P21 (5GCGCTCTAGAAGAAACCAATGCCAAATCTC-3)/P22 (5GCGCGGATCCAGGAATACAAAGGATGAAAC-3) and P23 (5-GCGCAGATCTAGA AACCAATGCCAAATCTC-3)/P24 (5-GCGCGATATCAGGAATACAAAGGATGAAAC-3), respectively. The sense fragment was digested by restriction enzymes XbaI/BamHI, and the


57 antisense fragment was digested by restriction enzymes Bgl II/EcoR V (New England Biolabs). These two digested fragments were ligated to a GUS loop (a 979 bp sequence from the bacterial uidA gene). Then the construct was sub-cloned in to pCMHU-1, an overexpression vector derived from pBHU-1, for rice transformation (Wang et al ., 2006). Generation of Rice RNAi XB25 T ransgenic Lines RNAi XB25 transgenic lines were generated by a standard rice transformation protocol (X. Chen, unpublished). Immature seeds (15-20 days af ter flowering) were dehusked and sterilized in 75% ethanol for 2-5 minutes, followed by 50% bl each for 2 hours. Sterilized seeds were rinsed 3-5 times with sterile water. Embryos were removed, placed on calli induction medium [(N6BD2) (macro N6, micro Fe-EDTA, B-5 vitamin, 30 g/L sucrose, 0.5 g/L L-Proline, 0.5 g/L LGlutamine, 0.3 g/L casein hydrolysate 2 mg/L 2,4-D(2,4-dichlorophenoxyacetic acid), 2.5 g/L phytagel, pH 5.8)], and grown in the dark at 25 oC for 5-7 days. Agrobacterium strain EHA105 was cultured in 3 mL of YM (0.4 g/L yeast extract, 10 g/L Mannitol 0.1 g/L NaCl, 0.2 g/L MgSO4.7H2O, 0.5 g/L K2HPO4.3H2O, pH 7.0) at 28-30 oC for 16 hours and then diluted 50-fold to 50 mL of liquid AB medium to grow an additional 16 hours. Cells were collected and suspended in liquid AAM (macro AA, micro Fe-EDTA, AA vitamin, 68.5 g/L sucrose, 36 g/L glucose, 0.5 g/L casine hydrolysate, pH 5.2) containing 200 mM/L acetosyringone to an OD600 of 0.5. Calli were inoculated with a suspension of Agrobacterium for 30 min with occasional shaking by hands. After inoculation, calli were then dried on sterilized Whatman filter paper and transferred to N6BD2C (N6BD2, 10 g/L glucose, pH 5.2) containing 200 mM/L acetosyringone to co-cultivate for 3 days. Calli were transferred to selection medium (N6BD2, 25 g/L hygromycin, 600 g/L Cf ) and cultured in the dark at 25 oC for 2 weeks. Calli were transferred to a different selection medium (N6BD2, 50 g/L hygromycin, 300 g/L Cf),


58 and continued to grow for 2 more weeks, at which time they were transferred to fresh medium for a final 2 weeks growing period. After growing on selection medium for a full six weeks, calli were transferred to preregeneration medium (macro N6, micro N6+Fe-EDTA, B-5 vitamin, 30 g/L sucrose, 0.5g/L LProline, 0.5g/L L Glutamine, 0.3g/L Casine hydrolysate, 3.0g/L phytagel, pH 5.8) and cultured in the dark at 25 oC for 7-10 days to generate root systems. The calli were next transferred to regeneration medium (30g/L sucrose, 0.3 g/L casine hydrolysate, 2 mg/L 6-BA, 0.2 mg/L NAA, 0.2 mg/L ZT, 0.5 mg/L KT and 2.5 g/L phytagel, pH 5.8), and cultured in a light/dark cycl e (16 hours light/8 hours dark) at 25 oC, and after 2-4 weeks, transgenic shoots measuring to 2-3 cm were transferred to rooting medium (1/2 Ms) to ensure development of a strong root system. In Vitro Binding Assays His-XA21KTM and FLAG-XB25 were expressed as described previously. FLAG-XB25 was purified using anti-FLAG M2 agarose. Next, 1 g of purified FLAG-XB25 protein was mixed with 500 l of bacterial crude extract expressing His-XA21KTM or empty vector and placed on a rocker platform shaker at 4oC for 30 min, then 50 l slurry of Ni-NTA was added to the mixture and rocked at 4 oC for an additional 30 min. His-Bind Resin (Novagen) was pulled down by centrifugation and washed 5 times with 1 mL of 1 x Ni-NTA washing buffer (Novagen). The proteins were eluted using 30 l of eluti on buffer and resolved by an 8% SDS-PAGE gel. After electrophoresis, proteins were transferre d to a PVDF membrane pre-soaked with 100% methanol by a semi-dry transfer cell (BioRad) at 25 volts for 15 min. The membrane was blotted in 10 mL of blotting buffer [5% nonfat milk in TTBS (0.14 mM NaCl, 50 mM Tris-HCl, 0.1% Tween 20, pH 7.6)] for 1 hour, and incubated in 10 mL of blotting buffer containing 3 l of anti-


59 FLAG M2 antibody (1:3000) at 4 oC overnight. After three washes with TTBS, the blot was developed using an ECL Plus Western Blotting Detection kit (Amersham Biosciences). RNA GeL Blots Assays Rice RNA was extracted as described above. The sample was prepared in a 35 l mixture containing 17.5 l of deionized formamide, 6.0 l of 37% formaldehyde, 3.5 l of 5x MOPS buffer and 7 l of RNA. The mixture was incubated at 60 oC for 15 min and placed on ice for an additional 15 min. Total RNA was resolved by a 1% agarose gel [1% agarose, 0.66 M formaldehyde, and 1x MOPS buffer (40 mM morpholinopropanesulfonic acid, 10 mM sodium acetate, and 1 mM EDTA)]. After electrophoresis RNA was transferred to a nylon transfer membrane [pre-soaked with 500 mL of distilled water and 500 mL of 10x SSC (1.5 M NaCl and 0.15 M sodium citrate dehydrate). After transfer, the membrane was briefly rinsed in 2x SSPE (300 mM NaCl, 20 mM NaH2PO4, and 2 mM EDTA) and the RNA was fixed to the membrane using a UV cross-linker. A region from the N-terminus of XB25 was selected to make a specific probe against XB25. The fragment was amplified by primers P25 (5GTCTGTCGACGATGGAAGACCAGAAGAAAAATGC-3) and P26 (5GTCTGCGGCCGCCACCACTCTCTATCTCATCAAGAATC-3). The probe was synthesized using the Primer-It II Random Primer Labeling Kit (Stratagene). 50 l of reaction mixture was prepared with 50 ng DNA, 10 l of 5x primer buffer, 5 l of [ -32P]dATP, and 1 l Exo (-) Klenow enzyme. The reaction was carried out at room temperature for 1 hour. The nylon membrane containing the RNA samples was pre-hybridized in a minimum volume of pre-hybridization solution (5x SSPE, 50% deionized formamide, 5x Denhards solution, 1% SDS, 10% dextran sulphate, and 10 g/mL denatured salmon sperm DNA) at 42 oC


60 for 4 hours. 32P-labeled probe was added to the hybridization buffer and the membrane was incubated at 42 oC for 24 hours on a platform rocker set at a low speed. After hybridization, the membrane was washed as following procedure: twice in 200 mL of 2x SSPE at room temperature for 15 min, twice in 400 mL of 2x SSPE at 65 oC for 45 min, and twice in 200 mL of 0.1x SSPE at room temperature for 15 min. After washing, the membrane was exposed on X-ray films. Immunodetection of XB25 Total rice protein extracts were isol ated by grinding 1 gram of leaf tissue with a mortar and pestle in liquid nitrogen and thawing the tissue in an equal volume of extract buffer [50 mM Tris-HCl (pH 7.5), 150 mM NaCl, 1 mM EDTA, 0.1% Triton X-100, 5% (v/v) mercaptoethanol, 1 mM 4-(2-aminoethyl)-benzenesulfonyl fluoride (Sigma-Aldrich), 2 g/mL Antipain (Sigma-Aldrich), 2 g/mL Leupeptin (Sigma-Aldrich), 2 g/mL Aprotinin (SigmaAldrich)]. Cell debris was removed by centrifugation at 12,000 g for 10 min at 4 oC. The concentration of protein was then measured using the Bio-Rad protein assays. To immunodetect XB25, total rice proteins were resolved by an 8% SDS-PAGE gel and transferred to a PVDF membrane. After blocking for 1 hour in 5% nonfat milk in TTBS, the membrane was incubated in 10 mL of 5% nonfat milk in TTBS containing 2 l of primary antibodies (1:5000) at 4 oC overnight with gentle shaking. After washing three times with TTBS, the membrane was incubated in 10 mL of 5% nonfat milk in TTBS containing 2 l of secondary antibodies (1:5000) (Santa Cruz Biotechnology, Santa Cruz, CA) for 1 hour at room temperature with shaking. After washing three times in TTBS, the blot was developed using an ECL Plus kit (Amersham Biosciences).


61 Results XB25 is A Member of the PANK Family XA21KTM was used to screen a yeast two-hybrid rice cDNA library. Eleven proteins that associate with XA21KTM were identified (X. Di ng, unpublished data). One of them is encoded by the cDNA 25-1 containing a complete open reading frame (ORF) and 69 bp 5 untranslated region. This ORF is named XB25 (Os09g33810). The genomic sequence of XB25 contains nine exons and eight introns (Figure 2-1). The predict product of XB25 (XB25) has 329 amino acids with a predicted molecular weight of 35 kD (Figure 2-2). Amino acids 172-209 carry a PEST motif (http://www.at.embnet.org/embnet/tools/bio/). PEST motifs are often present in proteins that are targeted for degradation; therefore XB 25 is likely to be an unstable protein. Following the PEST domain, amino acids 205-329 contain four ankyrin repeats that are implicated in protein-protein interactions (Sedgwick and Smerdon, 1999). Eight XB25 and related proteins were identified by searching the protein database from National Center for Biotechnology Informa tion (NCBI). They are XB25, XBOS25-1 and XBOS25-2 in rice, AKR2 and AtPhos43 in Arabi dopsis, and TIP1, TIP2, and TIP3 in tobacco. These proteins share a high sequence similarity (> 60%) and identity (>55%) (Table 2-1). The ankyrin repeat regions display the greatest conservation among these proteins (E<8e-45), suggesting that XB25 belongs to the PANK family (Figure 2-3). Phylogenic analyses showed ri ce XB25, XBOS25-1, and XBOS25-2 consist of one group (Figure 2-4) and they share an over 70% sequence similarity and a 60% sequence identity with each other. The greatest variation among them occurs in the N-termini that share less than a 40% sequence similarity and a 30% sequence identity, while their C-termini share an 85% sequence similarity and an over 75% sequence identity. XBOS25-1 is the closest homologue of XB25 and shares a 74% sequence similarity and a 68% sequence identity.


62 The N-terminal Region of XB25 is Sufficient for the Interaction w ith XA21KTM in Yeast To demonstrate specific interac tion between XB25 and XA21KTM, eight constructs were made. XB25N contains amino acids (1-214) located upstream of the ankyrin repeat domain, while XB25C (195-329) spans the entire ankyrin repeat domain. XA21K is a truncated XA21 containing only the kinase domain. XA21KTMS686A/T688A/S689A is an autophosphorylation deficient mutant of XA21KTM in which three phosphorylated serine and threonine residues, located in the juxtamembrane (JM) domain, were mutated to alanines (Xu et al ., 2006). XA21KTMK736E is a dead kinase mutant in which the highly conserved Lys736 was mutated to a glutamic acid. Pi-d2 is a rice RLK conferring resistance to the fungal pathogen Magnaporthe grisea (Chen et al. 2006). Yeast two-hybrid analyses showed that XB25 and XB25N interacted with XA21KTM, indicating that the N-terminal part of XB25 is sufficient for binding to XA21KTM (Figure 2-5). In addition, both XB25 and XB25N interacted with the autophosphorylation mutant XA21KTMS686A/T688A/S689A, indicating that these three autophosphorylated residues are not required for the binding of XB25 in yeast. In contrast, neither XB25 nor XB25N interacted with XA 21K, suggesting the transmembrane domain of XA21 is required for the interactions. XA21KTMK736E failed to interact with XB25, suggesting that kinase activity may be required for the XA21KTM-XB25 interaction. Furthermore, Pid2KTM did not interact with XB25, suggesting that the bacterial disease resistance pathway and fungal disease resistance pathway may have diffe rent signaling components. Finally, the closest rice homologue of XB25, XBOS25-1, displayed the same XA21-interacting pattern as XB25, suggesting that XBOS-1 and XB25 may act redundantly. Physical Interaction between XB25 and XA21KTM in Vitro To confirm the XB25-XA21KTM interacti on, XA21KTM and XB25 were expressed and purified as FLAGand His-tag fusion proteins, re spectively (Figure 2-6). The predicted size of


63 FLAG-XB25 is 36 kD, however, the observed molecula r weight of this fusion protein is about 45 kD. This discrepancy might be due to some pos t-translational modifications or an abnormal migration of this protein in the SDS-PAGE gel. To perform in vitro binding assays, equal amounts of bacterial extracts expressing either His-XA21KTM or the empty vector were mixe d with bacterial extracts expressing FLAG-XB25. Ni-NTA His-Bind resin was added to pull down His-XA21KTM and its binding proteins. After extensive washing, the precipitates were subjected to Western Blot analyses. As shown in Figure 2-7, FLAG-XB25 can be detected by the anti-FLAG M2 antibody in the precipitates from the mixture containing His-XA21KTM and FLAG-XB25. In contrast, no product of the same size was present in the precipitates from the mixture of empty vector and FLAG-XB25. These results indicate that XB25 interacts with XA21KTM in vitro Generation of Antibodies against XB25 T o detect XB25 in plant extracts, a region in the middle part of XB25 (XB25M) was used to develop antibodies against XB25 (Figure 2-8). This region shares 65% and 66% sequence similarity with the corresponding regions of XB OS-1 and XBOS-2, respectively. Purified antiXB25M detected a strong 45 kD band in the b acterial protein extracts expressing FLAG-XB25, but not in the extracts expressing the empty FL AG-tag vector, indicating that anti-XB25M can recognize bacterial expressed XB25 (Figure 2-9). Down-regulation of XB25 in Transgenic Plants XB25 was down-regulated by RNA interference (RNAi). A 336 bp sequence derived from a 3 untranslated region of XB25 was used as the gene-specific probe. This region shares less than 50% sequence identity with the corresponding regions of XBOS25-1 and XBOS25-2. No sequence stretch of more than 18 bp is identical among XB25, XBOS25-1, and XBOS25-2, suggesting that this probe is likely to specifically down-regulate XB25 (Figure 2-10). To stabilize


64 the RNAi construct, a 979 bp fragment from the bacterial uidA gene (GUS loop) was inserted between the inverted probes. The RNAi XB25 construct was transformed into the cultivar Taipei309 (TP309) (Figure 2-11), and more than 60 transgenic lines were generated. As shown in Figures 2-13 and 2-14A, the levels of XB25 transcripts were dramatically reduced in most of the RNAiXB25 lines when compared to the recipient lines TP309. Conversely, strong signals were detected in RNAi XB25 lines when a probe against GUS loop was used in Northern Blot analysis for the same blot, indicating that the RNAi construct was properly expressed. The consistency of reduced XB25 RNA transcripts with enhanced GUS loop expression implies that XB25 has been successfully down-regulated in the RNAi XB25 transgenic lines. Three independent transgenic lines with lower levels of XB25 (S34, S41, and S42) were chosen for further characterization. Anti-XB25M detected two major bands (42 kD and 48 kD) in the total protein extracts of TP309. The quantity of the 42 kD band was significantly less in the RNAi XB25 transgenic lines compared to the recipient line TP309, indicating this 42 kD polypeptide is XB25 (Figure 2-14B). Characterization of RNAi XB25 Lines RNAi XB25 transgenic lines showed no apparent m orphological differences compared to TP309 at both the seedling stage and the adult stage (Figure 2-15A). The seeds of both RNAiXB25 lines and TP309 lines were germinated after incubation at 37 C for three days. After germination, both undergo vegetative development at a similar pace. In approximately three months, both lines entered the reproductive stage, flowering. After flowering, both RNAiXB25 lines and TP309 produced about 50 healthy seeds in each panicle. Since it has been demonstrated that AKR2, one of the XB25-related proteins in Arabidopsis, plays a negative role in the plant disease resistance pathway (Yan et al. 2002), we asked if XB25 plays a similar role in resistance responses. To test this hypothesis, both RNAi XB25 and TP309 were inoculated with either Xoo Philippine Race 6 ( Xoo PR6) or Xoo


65 Korea Race 1 ( Xoo KR1) strains. Xoo PR6 is an avirulent strain carrying AvrXa21 while Xoo KR1 is a virulent strain containing no AvrXa21. Rice plants carrying the XA21 gene displayed full resistance to Xoo PR6, but were susceptible to Xoo KR 1. As the results show in Figure 215B, at two weeks post inoculation, all transgenic lines were fully susceptible to both avirulent and virulent strains of Xoo (data not shown), and there was no statistically significant difference in lesion length between RNAi XB25 and TP309. These results indicate, in the absence of XA21, down-regulation of XB25 does not show clear effects in plant disease resistance. Discussion To isolate components involved in the XA21-mediated signaling pathway, yeast twohybrid screenings were performed using XA21K TM as bait. An ankyrin repeat-containing protein, referred to as XB25, was identified. XB25 contains four ankyrin repeats in its C-terminal part and one PEST motif in the middle. Seven XB25-related proteins were identified in rice, Arabidopsis, and tobacco. The N-termini of these proteins are variable whereas the C-terminal ankyrin repeat domains are highly conserved. Ankyrin repeats are usually involved in proteinprotein interactions and can interact with dive rse partners. The high homology of ankyrin repeat domains shared by these proteins suggests that they may interact with some similar proteins. In yeast, XB25 specifically interacted with XA21KTM, however, it did not interact with XA21K containing no transmembrane domain. A transmembane domain has been found to be critical to maintain the function of some resistance proteins. For instance, a single amino acid mutation in the transmembrane domain of Pi-d2 abolishes the normal function of this resistance protein; rice carrying this mutated gene displays full susceptibility (Chen et al ., 2006). The requirement of a transmembrane domain for the interaction between XB25 and XA21 suggests that XB25 may bind to a region of XA21 that contains all or part of the transmembrane domain. An alternative explanation for this phenomenon is that the transmembrane domain of XA21 is


66 required for proper protein folding, which is necessary for the interaction. Another XA21binding protein, XB3, interacts with XA21K instead of XA21KTM, suggesting that different XA21-binding proteins interact with different regions of XA21. The ankyrin repeat region of XB3 is sufficient for interactions with XA21 (Wang et al ., 2006). However, rather than the C-terminal ankyrin domain, the N-terminal part of XB25 is sufficient for the interaction with XA21. No obvious protein-protein interaction domain was identified in the N-terminal region of XB25, and the results suggest that this region can also serve as a protein-protein interaction domai n. Thus, XB25 carries two domains involved in protein-protein interactions and therefore may function as a protein adaptor to link XA21 with other defense-related proteins. XB25 and its related proteins belong to the PANK family (Wirdnam et al ., 2004). Studies have demonstrated that members of PANK are i nvolved in plant disease resistance. A working model for the PANK family proposes that they may serve as transcriptional suppressors much like the animal IkB protein (Kuhlmann et al. 2002; Yan et al., 2002). IkB harbors an ankyrin repeat motif and a PEST domain, which are present in most members of PANK. The function of IkB is to retard transcriptional factor NFkB in cytosol. Once the pathway is activated, IkB is phosphorylated by IkB kinases and subsequently degraded by the proteasome. NFkB is then released and transported to the nucleus to activate the expression of related genes (Schreck et al., 1991). In the PANK family, three members have been shown to interact with transcriptional factors, negatively regulate plant defense res ponses, or undergo phosphorylation when treated by bacterial elicitors. TIP1 interacts with a bZIP tr anscriptional factor and is down-regulated when challenged by pathogens (Kuhlmann et al. 2002). AKR2 plays a negative role in plant resistance responses, including the induction of PR1 and the increase in the levels of ROS (Yan et al.


67 2002). AtPhos43 is rapidly phosphorylated when treated with bacterial flagellin (Scott et al. 2001). These results are consistent with the IkB working model. However, some questions such as how the members of PANK retain transcriptional factors in the cytosol, if they are degraded when attacked by pathogens, and which kinases ar e involved in the regulation of those proteins, still need to be addressed. Several members of PANK are likely involved in the PTI pathway. For instance, the rapid phosphorylation of AtPho43 is FLS2-dependent (Scott et al. 2002). In addition, proteins related to AtPhos43 in rice and in tomato undergo phosphorylation after the treatment with conserved pathogen elicitors. However, transgenic plants with down-regulated XB25 transcripts (RNAi XB25) showed similar susceptibility to Xoo compared to wild-type TP309, while downregulation of AKR2 leads to reduced bacterial growth. A possible explanation for the failure to observe reduced bacterial growth in RNAi XB25 lines is that XB25 and its homologues may be functional redundancy. Alternatively, XB25 may be involved in PTI-mediated plant defense responses. Nevertheless, the Xoo strains used here are highly virulent, down-regulation of XB25 may not be sufficient to counteract their virulence. Further studies of RNAi XB25 plants inoculated with less aggressive, virulent Xoo strains will help us understand the role which XB25 plays in PTI.


68 TGA ATG 150 bp TGA ATG 150 bp Figure 2-1. Schematic representation of the genomic region of XB25 (derived from the rice gene accession number Os09g33810 in TIGR database) The genomic region of XB25 consists of nine exons (closed black boxes) and eight introns (lines between every two closed black boxes). The exon-intron boundaries are based on the comparison between cDNA sequence and rice genomic sequence. The start codon and stop codon are indicated as ATG and TGA. The bar indicates the scale.




70 Figure 2-3. Sequence alignments of XB25 and it s related proteins in rice (XB25, XBOS25-1 and XBOS25-2), Arabidopsis thaliana (AKR2 and AtPhos43), a nd tobacco (TIP1, TIP2 and TIP3). The amino acid sequences of th ese proteins were aligned by MultAlin. Amino acid residues showing high consensu s value (>90%) are indicated in red. Amino acid residues showing low consensus value (more than 50% but less than 90%) are indicated in blue.


71 XB25 XBOS25-1 XBOS25-2 AKR2 AtPhos43 TIP1 TIP2 TIP3 XB25 XBOS25-1 XBOS25-2 AKR2 AtPhos43 TIP1 TIP2 TIP3 Figure 2-4. Phylogenetic tree derived from a ClustalX alignment based on the predicted amino acid sequences of XB25 and related proteins in rice (XBOS25-1 and XBOS25-2), Arabidopsis thaliana (AKR2 and AtPhos43) and tobacco (TIP1, TIP2, and TIP3). The gene accession numbers for these proteins are Os09g33810 (XB25), Os03g63480 (XBOS25-1), Os08g42690 (XBOS25-2), At 2g17390 (AtPhos43), At4g35450 (AKR2), AF352797 (TIP1), AY258007 (TIP2), and AAO91862 (TIP3).


72 Table 2-1. Amino acid sequence comparisons of XB25 and related proteins. In each cell, the numbers on left show the percentage of similarity and the numbers on right indicate the percentage of identity. XB25 XBOS25-1 XBOS25-2 AtPho43 AKR2 TIP1 TIP2 XBOS25-1 74,68 XBOS25-2 73,67 69,62 AtPhos43 73,65 63,56 70,62 AKR2 72,65 71,62 72,66 87,83 TIP1 72,63 68,55 73,65 71,60 68, 60 TIP2 73.64 67,63 72, 64 72, 58 70, 65 75, 68 TIP3 70, 62 65, 58 70, 63 70, 63 72, 64 74, 65 76, 64


73 (1-1025) XA21KDra III Kinase LRR Kinase XA21KTM Kinase (677-1025) (651-1025)JMA c-Myc/ProA (651-1025) Kinase XA21KTMS686A/T688A/S689A K736 Kinase Pi-d2KTM (436-825) B (1-329) (1-214) (195-329) XB25 XB25C XB25N Ankyrinrepeats 677H KRTKKGAP S R TS MKG HPLVSYSQLVKATD G707


74 A D X B 2 5A D X B 2 5 N A D X B 2 5 CA DA D X B O S 2 5 1A D X B 2 5A D X B 2 5 N A D X B 2 5 CA DA D X B O S 2 5 1 SD/-Leu-Trp SD/-Leu-Trp-His BD-XA21K690BD-XA21KTMK736EBD BD-PID2KTM BD-XA21KTMS686A/T688A/S689ABD-XA21KTM A D X B 2 5A D X B 2 5 N A D X B 2 5 CA DA D X B O S 2 5 1A D X B 2 5A D X B 2 5 N A D X B 2 5 CA DA D X B O S 2 5 1 SD/-Leu-Trp SD/-Leu-Trp-His BD-XA21K690BD-XA21KTMK736EBD BD-PID2KTM BD-XA21KTMS686A/T688A/S689ABD-XA21KTM Figure 2-5. XB25 interacted with XA21KTM in yeast. A) Schematic representations of XA21 and its derivatives. Domains are as described by Song et al (1995). The transmembrane domain is in black. The juxtamembrane (JM) domain is represented by the dotted box with its sequence shown above. The underlined residues are XA21CS1 in the JM domain. The autophosphorylated residues within this region are highlighted in red. The conserved Lys736 (K736) is shown. XA21KTM that was used in the yeast two-hybrid library screening, and XA21K without the transmembrane domain are indicated below. Pi-d2, a rice resistance protein conferring resistance to a fungal pathogen, is also shown. B) Schematic representation of XB25 and its truncated versions. XB25N spans N-terminal amino acids located upstream of the ankyrin repeat domain. XB25C contains the complete ankyrin repeat domain. C) Interactions between XB25 and XA21KTM in yeast. Indicated constructs were co-transformed into yeast cells. Cells growing up on the double deficient medium (SD/-Trp-Leu) were replicated to the triple deficient medium (SD/-Trp-Leu-His). Cells capable of growing on this medium indicate that the interactions occur between bait and prey proteins. C


75 F L A G v e c t o r kD kD kD kD FLAG-XB25 GST-XA21M MBP-XB25M His-XA21KTM B A CDF L A G X B 2 5 p M A L v e c t o r M B P X B 2 5 H i s X A 2 1 K T M H i s v e c t o r G ST X B 2 5 M G T K v e c t o r 66 45 31 66 45 31 66 45 31 66 45 31 F L A G v e c t o r kD kD kD kD FLAG-XB25 GST-XA21M MBP-XB25M His-XA21KTM B A CDF L A G X B 2 5 p M A L v e c t o r M B P X B 2 5 H i s X A 2 1 K T M H i s v e c t o r G ST X B 2 5 M G T K v e c t o r 66 45 31 66 45 31 66 45 31 66 45 31 Figure 2-6. Bacterial expression and purificati on of different XA21 and XB25 fusion proteins: FLAG-XB25 (A), MBP-XB25M (B), His-XA 21KTM (C), and GST-XB25M (D). All these fusion proteins are expressed in E. coli strain ER2566 and purified. Proteins were visualized by Coomassie blue staining, and the purified products are indicated by arrows.


76 FLAG-XB25 Input Precipitates F L A G -X B2 5 F L A G X B2 5 + H i s t a g F L A G X B 2 5 + H i s X A 2 1 K TMFLAG-XB25 Input Precipitates F L A G -X B2 5 F L A G X B2 5 + H i s t a g F L A G X B 2 5 + H i s X A 2 1 K TM Figure 2-7. In vitro interaction between XA21KTM and XB25. His-XA21KTM and FLAGXB25 were expressed in E.coli strain ER2566. Purified FLAG-XB25 was mixed with bacterial crude extracts containing eith er His-XA21KTM or empty vector. HisXA21KTM was pulled down using Ni-NTA His-binding resin and the precipitates were immunodetected by anti-FLAG M2 antibody.


77 Figure 2-8. Sequence alignments of XB25 and related proteins in rice (XBOS25-1 and XBOS252). The amino acid sequences of these proteins were aligned by MultAlin. Amino acid residues showing high consensus value (>90%) are indicated in red. Amino acid residues showing low consensus value (more than 50% but less than 90%) are indicated in blue. The underlined region is used to develop anti-XB25M antibodies.


78 FLAG-XB25F L A G v e c t o r F L A G X B2 5 FLAG-XB25F L A G v e c t o r F L A G X B2 5 Figure 2-9. Immunodetection of FLAG-XB25 expressed in E. coli strain ER2566 by antiXB25M. A 45 kD band was detected in b acterial crude extracts containing FLAGXB25, while no band at the same position was detected in bacterial crude extract containing empty vector.


79 Figure 2-10. Sequence alignments of the region of XB25 used to create the RNAi XB25 construct and the corresponding regions of XBOS25-1 and XBOS25-2. The nucleotide sequences were aligned by MultAlin. Nucleotide sequences showing high consensus value (>90%) are indicated in red. Nucleotide sequences showing low consensus value (more than 50% but less than 90%) are indicated in blue.


80 pCMHUdsXB25 12901 bp kanamycin(R) hygromycin(R) pBR322 bom pVS1 sta T-Border (right) T-Border (left) maize ubiquitinpromoter Nosterminator CaMV35S polyA CaMV35S promoter pBR322 ori pVS1 rep GUSS XB25 XB25 Spe I (9190) Spe I (10870) Hin dIII(2) Hin dIII(9490) Hin dIII(10570) pCMHUdsXB25 12901 bp kanamycin(R) hygromycin(R) pBR322 bom pVS1 sta T-Border (right) T-Border (left) maize ubiquitinpromoter Nosterminator CaMV35S polyA CaMV35S promoter pBR322 ori pVS1 rep GUSS XB25 XB25 Spe I (9190) Spe I (10870) Hin dIII(2) Hin dIII(9490) Hin dIII(10570) Figure 2-11. Diagram of the expression construct pCMHUdsXB25 used to generate RNAi XB25 transgenic lines. The dsXB25 fragment was cloned into the Spe I sites flanking by the maize ubiquitin promotor and the nopaline synthase (Nos) terminator. The hygromycin gene was used as a selection maker for transgenic lines. The kanamycin resistant gene was used as a selection marker for bacterial transformation.


81 ATG TGA 150 bp A B ATG TGA 150 bp ATG TGA 150 bp A B Fgure 2-12. Schematic representation and alignments of a probe from the N-terminus of XB25 used for Northern Blot. A) Schematic representation of XB25 genomic region. The blue sold underlined region was used to synthesize the probe and the red underlined region was used to generate RNAi XB25 transgenic lines; B) Sequence alignments of the region of XB25 used to synthesize the probe and the corresponding regions of XBOS25-1 and XBOS25-2.


82 TP 4 5 14 15 18 19 20 24 26 29 30 31 34 35 37 4142 44 46 47 48 49 TP Probe: XB25 Probe: GUS -loop TP 4 5 14 15 18 19 20 24 26 29 30 31 34 35 37 4142 44 46 47 48 49 TP Probe: XB25 Probe: GUS -loop Figure 2-13. Identification of RNAi XB25 transgenic lines with reduced XB25 transcripts by Northern Blot using a probe against either XB25 (upper) or GUS-loop (lower). TP: wild-type TP309; Lanes 4-49: individual independent transgenic line. Three transgenic lines (highlight in red) were chosen for further characterization.


83 40 50 TP309 S34 S41 S42 XB25 XB25 Total RNA kD PonceauS Figure 2-14. Both RNA transcript and prot ein levels of XB25 are reduced in RNAi XB25 transgenic lines. A) Northern Blot analyses show the RNA transcript of XB25 is reduced in three RNAi XB25 transgenic lines (upper). Total RNA showed that comparable amounts of RNA were loaded in each lane (lower). B) Western Blot shows one 42 kD band was immunodetected by anti-XB25M in TP309 and was significantly reduced in three transgenic lines (upper). Ponseau S-stained same blot shows that comparable amounts of total protein extracts were loaded in each lane (lower).


84 TP309 S34 S41 S42 TP309 RNAi XB25 TP309 RNAi XB25 One-month-old Three-month-old 0 5 10 15 20 25 TP309S34S41S42Lesion length (cm) A B 25 15 5 10 0 20Lesion length (cm)Plant lines TP309S34S41S42 TP309 S34 S41 S42 TP309 S34 S41 S42 TP309 RNAi XB25 TP309 RNAi XB25 One-month-old Three-month-old 0 5 10 15 20 25 TP309S34S41S42Lesion length (cm) A B 25 15 5 10 0 20Lesion length (cm)Plant lines TP309S34S41S42 Figure 2-15. RNAi XB25 lines show no morphological difference compared to TP309 and all of them show comparable degrees of susceptibility to Xoo PR6. A) Photograph of plants showing phenotypes of RNAi XB25 and TP309 at the seedling stage (left) and at the adult stage (right). B) Photograph of rice leaves showing lesion development two weeks after inoculation with Xoo PR6 (left), and the lesion length of indicated lines (right). S34, S41, and S42 are three independent RNAi XB25 transgenic lines.


85 CHAPTER 3 XB25 CONTRIBUTES TO THE ACCUMULATION OF XA21 AND IS INVOLVED IN XA21-MEDIATED DISEASE RESISTANCE Introduction Plant effector-triggered im munity (ETI) is governed by a host resistant ( R ) gene and a corresponding pathogen race-specific avirulent ( Avr) gene. The associated interaction of an R gene and a cognate Avr gene is described as the gene-for-gene model (Flor, 1971), which states that for each R gene in the host, there is a cognate Avr gene in the pathogen. Plant disease resistance is determined by the interaction between the host R gene product (R protein) and the corresponding Avr gene product (Avr protein). However, in the absence of either R or Avr, pathogens evade ETI and colonize plants, which results in a susceptible phenotype. Most R proteins are constitutively expressed even in the absence of pathogens. However, a number of studies have shown that the steady-state levels of R proteins are well regulated. For example, the accumulation of the Arabidopsis NB-LRR protein RPM1 is regulated by three proteins, RIN4, AtRAR, and HSP90 (Mackey et al. 2002; Holt et al. 2005). In barley, RAR1 is required for the accumulation of two NB-LRR resistance proteins, MLA1 and MLA6 (Bieri et al. 2004). The tomato Pto kinase and the NB-LRR protein Prf interact with each other and contribute reciprocally to the accumulation of each other (Mucyn et al. 2006). Therefore, many plant resistance proteins may function in protein complexes and the levels of R proteins may depend on their binding partners. Xa21 confers resistance to Xathomonas oryzae pv. oryzae ( Xoo) carrying AvrXA21. Xa21 encodes an RLK that is capable of autophosphorylating multiple serine/threonine residues including S686, T688, and S689 located in the juxtamembrane (JM) domain (Xu et al. 2006). Like several other R proteins, the accumulati on of XA21 is regulated by one of its binding proteins, XB3. As discussed in Chapter 2, XB3 was originally identified as a protein that


86 interacts with the kinase domain of XA21. Further studies showed that XB3 interacts with XA21 in planta (Wang et al ., 2006). In addition, the steady accumulation of XA21 is significantly reduced in transgenic plants with reduced Xb3 transcripts, indicating that XB3 regulates the steady-state level of XA21. Moreover, XA21-mediated resistance is also compromised when Xb3 is down-regulated. These facts suggest that an XA21-mediated disease resistance pathway may be regulated through the modulation of accumulation of XA21, and that the XA21 binding proteins may contribute to this process. In this chapter, a second XA21-binding protein, XB25, is characterized in vivo Similar to XB3, XB25 interacts with XA21 in planta. Furthermore, XB25 contributes to the accumulation of XA21 and XA21-mediated disease resistance. Finally, evidence is provided to show that XB25 is weakly phosphorylated by XA21. These results suggest that XB25 is involved in XA21mediated disease resistance. Materials and Methods Immunodetection of XA21 in Rice c-Myc tagged Xa21 transgenic lines (c-Myc-XA21) driven by a native Xa21 prom oter were kindly provided by Dr. Pam C. Ronald at the Un iversity of California, Davis. Total proteins were extracted by the following protocol: 500 mg of rice leaf tissue was ground in liquid nitrogen and mixed with an equal volume of extraction buffer [50 mM Tris-HCl (pH 7.5), 150 mM NaCl, 1 mM EDTA, 0.1% Triton X-100, 5% (v/v) -mercaptoethanol, 1 mM 4-(2aminoethyl)-benzenesulfonyl fluoride (Sigma-Aldri ch, St.Louis, MO), 2 g/ml antipain (SigmaAldrich), 2 g/ml leupeptin (Sigma-Aldrich), 2 g/ml aprotinin (Sigma-Aldrich)]. The mixture was placed on a rocker-shaker at 4 oC for 30 min and cell debris was removed by centrifugation at 12,000 g for 15 min. The concentration of proteins in the supernatants was measured using Bio-Rad protein assays, and the protein sample s were mixed with SDS-PAGE loading buffer


87 [31.25 mM Tris-HCl (pH 6.8), 5% glycerol, 1% SDS. 2.5% beta-mercaptoethonal, 0.05% bromophenol blue]. Proteins were resolved by a 6.5 % SDS-PAGE gel at 150 volts for 3.5 h and transferred to a pre-soaked PVDF membrane using a Mini Trans-Blot Cell (Bio-Rad, Hercules, CA) at 100 volts for 1 hour in the transfer tank containing 1 L of transfer buffer (20% methanol, 25 mM Tris, 188 mM glycine). After transfer, the membrane was incubated in 5% nonfat milk for 1 hour with shaking, and then incubated in 10 mL of 3% bovineserum albumine (Sigma) in TTBS containing 15 l of anti-c-myc antiserum (1:700) overnight. After washing three times with TTBS, the membrane was incubated in 10 mL of 5% nonfat milk in TTBS containing 3 l of secondary anti-mouse antibodies (1: 3000) for 1 hour at room temperature with shaking. The blot was then washed and developed using an ECL Plus kit (Amersham Biosciences, Piscataway, NJ). Protein A tagged Xa21 transgenic lines (ProA-XA21) were described by Wang et al (2006). A similar procedure was followed to detect ProA-XA21 except that the peroxidase-antiperoxidase (PAP) (Sigma-Aldrich) was used as the primary antibody. Co-immunoprecipitation Total proteins were extracted from 5 g of rice leaf tissue in 25 ml of ice-cold extraction buffer [20 mM Tris-HCl (pH8.0), 150 mM NaCl, 0.1% Triton X-100, 2.5 mM EDTA, 2mM benzamidine (Sigma-Aldrich), 10 mM -mercaptoethanol, 20 mM NaF, 1 mM phenylmethanesulfonyfluoride (PMSF), 1% Protease Cocktail (Sigma-Aldrich), 10 M leupeptin, 10% glycerol]. The mixture was placed on a rocker-shaker at 4 oC for 30 min and filtered through double layers of Miracloth (Calbiochem, San Diego, CA). Cell debris was removed by centrifugation twice at 8,000 g for 10 min at 4oC. The supernatant was mixed with 400 l of IgG Sepharose beads (Amersham Biosciences) and incubated at 4 oC for 30 min on a rocker-shaker. The mixture was placed in a poly chromatography column (Bio-Rad) and the beads were washed


88 4 times with 1 mL of extraction buffer, followed by two washes with 0.4 mL of 5 mM ammonium acetate (pH 5.0). The proteins were th en eluted from beads using 2 mL of 0.5 M HOAC (pH 3.4), neutralized with 1/10 volume of 1 M Tris-HCl (pH.8.0) and mixed with 8.8 mL of acetone at -20oC overnight to precipitate proteins. The precipitate was collected by centrifugation at 8,000 g for 15 min and the precipitate was air-dried for 2 min. Proteins were resuspended in 100 l of extraction buffer. Transphosphorylation Assays Bacterial expression and affinity pur ification of the MBP-XA21KTM, MBPXB21KTMK736E, FLAG-XB25, FLAG-XBOS25-1 and FL AG-XB3 fusion proteins were performed as described in Chapter 2. Transphosphorylation assays were carried out in a mixture containing 1 g of XA21 kinase or its derivatives, 5 g of substrate, 1x reaction buffer [50 mM HEPES (pH 7.4), 10 mM MgCl2, 10 mM MnCl2, 1 mM dithiothreito]], and 20 Ci of [ -32P]ATP (3000 Ci/mmol) (Amersham Biosciences). The mixture was incubated at 37oC for 1 hour and resolved by an 8% SDS-PAGE gel. After staining with coomassie brilliant, the gel was dried and exposed on X-ray films. Semi-quantitative RT-PCR Rice cDNA was prepared according to the procedure described in Chapter 2. Sem iquantitative RT-PCR analyses were performed with primer sets P27 (5 CAGAAGTCGATCTGAAGTGTGGCA-3 )/P28 (5 GCACAAGAGAACTAAAAAGG GAGCCC-3 ) for Xa21 transcripts and P29 (5 -TGGCGCCCGAGGAGCACC-3 )/P30 (5 GTAACCCCTCTCAGTCAG-3 ) for actin transcripts. The following procedure was used to amplify Xa21: 95 oC for 5 min, followed by 20, 25 or 30 amplification cycles (94o C for 1 min, 54 oC for 1 min and 72 oC for 1min), 72 oC for 10 min. Actin was amplified by using the


89 following procedure: 95 oC for 5 min, 20, 25 or 30 amplification cycles (94 oC for 1 min, 50 oC for 1 min and 72 oC for 1min), 72 oC for 10 min. All PCR products were resolved by a 1% agarose gel. Generation of Crosses between RNAi XB25 Transgenic Lines and 4021-3 (c-Myc-XA21/cMyc-XA21) RNAi XB25 transgenic lines 34, 41 and 42 were used as pollen recipient parents to cross with pollen donor 4021-3. Pollen grains were collected from 4021-3 and applied to the stigma of RNAi XB25 lines in which stamen previously were removed by forceps. About ten seeds were recovered from each crossed line. Measurement of Bacterial Growth Curve Xoo PR6 was streaked on PSA solid m edium (10 g/L peptone, 10 g/L sucrose, 1 g/L glutamic acid monosodium salt, 100 mg/L cycloheximide, 0.1 mM 5-Azacytidine) and incubated at 28 oC for 3 days. The bacteria were diluted in water to a final OD600 of 1.0. Rice leaves were inoculated with bacteria by cutting the leaf tips w ith scissors pre-dipped in the bacterial solution. Three of the inoculated leaves were collected 0, 2, 4, 6, 8, 10, 12 and 14 days post-inoculation and the leaves were ground thoroughly with a mort or and pestle containing 5 mg of sand and 1 ml of sterilized water. After dilution, the bacteria were placed on PSA medium and incubated at 28 oC for three days. Bacterial populations were calculated by counting the number of colonies on the PSA plates. Statistical Analysis Statistical analysis of bacterial growth wa s perform ed using T-test, with P<0.05 denoting as statistical significance.


90 Results XA21 is Associated With XB25 in Planta To confirm that XA21 is associated with XB25 in vivo co-immunoprecipitation assays were performed using the ProA-tagged XA21 line 716-1 (Wang et al ., 2006). Western Blot analyses detected a 150 kD product by the PAP antibody in the Pro-XA21 transgenic lines, but not in the recipient line TP309 (Figure 3-1), indicating that the 150 kD polypeptide is ProAXA21. Because IgG has a high affinity for the ProA tag, ProA-XA21 should be efficiently pulled down by IgG beads. Indeed, ProA-XA21 was detected by the PAP antibody in the precipitates prepared from the 716-1 lines (Figure 3-2). The 110 kD band detected by the same antibody is likely due to the degradation of ProA-XA21 (Wang et al ., 2006). No band was detected by PAP antibody in the precipitates from the recipient line TP309, indicating the bands detected in 716-1 lines are ProA-XA21 and its degraded product. To detect the presence of XB25 in the same precipitates, Western Blot analyses were pe rformed using anti-XB25M. As expected, a 42 kD band, which is identical to the size of XB25, was only found in the precipitates from the 716-1 line, but not in the precipitates from the TP309 line. To rule out the possibility that XB25 may bind to the 128-aa ProA tag, an A6 transgenic line that expresses a TAP-tagged kinase (Os8g37800) was used as a negative control. Os8g37800 was a randomly chosen kinase and has no apparent connection to XA21. A similar ProA tag was placed at the N-terminus of this kinase. No 42 kD product was detected from A6 precip itates by anti-XB25M, indicating ProA tag alone is not sufficient to pull down XB25. A similar amount of XB25 is present in the supernatants of all three lines. Taken together, these results indicate that XB25 is associated with XA21 in planta XB25 Contributes to the Accumulation of XA21 To test the role of XB25 in XA21-m ediated disease resistance, c-Myc-tagged Xa21 transgenic lines (4021-3) were used to generate crosses of RNAi XB25 and 4021-3


91 (RNAiXB25/4021-3). A 140 kD band was specifically detected in protein extract from the 40213 lines, but not in TP309, indicating that this 140 kD band is c-Myc-XA21 (Figure 3-1). RNAi XB25 lines 34, 41 and 42 were chosen as pollen recipient lines in crosses with 4021-3, which served as the pollen donor (Figure 3-3). A similar strategy was used to generate a cross of TP309 and 4021-3 (TP309/4021-3). All the F1 progeny tested contain Xa21, as showed by RT-PCR and was also confirmed by Western Blot analyses (Figure 3-4D and 3-4B, results from 7 representative F1 plants). Two genotypes of F1 progeny were obtained from RNAiXB25/4021-3: one contains an RNAi XB25 construct and the other does not. This segrega tion was confirmed by Western Blot analyses (Figure 3-4A). The levels of XB25 were significantly reduced in 5 out of 7 of the F1 progeny, indicating these lines contain functional RNAi XB25 constructs. Since the steady-state level of XA21 is developmentally regulated and XB3 contributes to the stability of XA21 at the adult stage (Xu et al 2006; Wang et al. 2006), the levels of XA21 in these F1 progeny were then determined at both the seeding (one-month-old) and the adult stage (four-month-old). As shown in Figure 3-4, the levels of XA21 were comparable in all of the F1 progeny at the seedling stage (Figure 3-4B). In contrast, at the adult stage, th e levels of XA21 were dram atically reduced in the progeny containing an RNAi XB25 construct (Figure 3-4C). These results indicate that XB25 contributes to the accumulation of XA21 only at the adult stage. The Resistance to Xoo PR6 is Compromised in Progeny of RNAi XB25 /4021-3 w ith Reduced Levels of XA21 and XB25 The F1 progeny of RNAiXB25/4021-3 were inoculated with Xoo PR6. All of the plants with reduced levels of XA21 and XB25 showed longer lesions compared to those of TP309/4021-3, indicating that XA21-mediated disease resistance was compromised in these lines (Figure 3-4E). An F1 progeny of RNAi XB25/ 4021-3 with reduced levels of XA21 and


92 XB25 (34/4021-3-6) was used to measure the bacterial growth. The results confirmed that increased Xoo PR6 growth was observed in the 34/4021-3-6 line compared to that in TP309/4021-3 (P<0.05) (Figure 3-5). These results indicate that XB25 contributes to the XA21mediated disease resistance. XB25 is Phosphorylated by XA21KTM in Vitro XA21 is an active serine/threonine kinase (Liu et al. 2002). The in vitro and in vivo interactions between XB25 and XA21 suggest that XB25 m ay be a substrate of XA21KTM. To test this hypothesis, FLAG-XB25 and MBP-XA21KTM were purified and mixed with [ -32P]ATP. As shown in Figure 3-7, XA21KTM wa s capable of autophosphorylation, confirming that XA21KTM is an active kinase. In addition, XA21KTM phosphorylated FLAG-XB25. Because there are no serine or threonine residues present in the FLAG tag, the band observed here should come from the phosphorylation of XB25. A dead kinase mutant MBPXA21KTMK736E was used here as a negative control. No phosphorylation was observed when FLAG-XB25 was mixed with this mutant, indicating that XA21KTM kinase activity is required for the phosphorylation of XB25. XBOS25-1, a highly related homologue, was also phosphorylated by XA21KTM, supporting the conclusion that this protein plays a redundant role as does XB25. XB3 has been shown to be phosphorylated by the kinase domain of XA21 (Wang et al. 2006). Compared to XB3, the extent of phosphorylation of XB25 was much less, indicating that XB25 is weakly phosphorylated by XA21KTM. This may be due to fewer phosphorylated sites in Xb25. Discussion XB25 was characterized for its role in XA21-m ediated disease resistance. XB25 interacts with XA21 in planta and contributes to the accumulation of XA21. In addition, XB25 was weakly phosphorylated by XA21 in vitro. These results indicate that XB25 is a component of the


93 XA21 protein complex and provide a link between PANK family and R protein-mediated disease resistance. Co-immunoprecipitation confirms that XB25 is associated with XA21 in planta. XB25 physically interacts with XA21 in vitro (Chapter 2), so it is likely that a direct interaction occurs between XB25 and XA21 in planta. The association of XB25 with XA21 in uninoculated plants supports that XA21 forms a constitutive protein complex with its binding proteins. Over ten XA21-interactors (XBs) have been identified in yeast, and XB3 and XB25 have been confirmed to be associated with XA21 in planta. XB3 is an active E3 ubiquitin ligase, and its enzyme activities are believed to have a role in the XA21-mediated disease resistance pathway (Wang et al. 2006). In contrast, there is no obvious sequence information supporting the supposition that XB25 functions as an enzyme. But XB25 does have protein-protein interaction surfaces at both the N and C termini. These structural characteristics suggest that XB25 may work as a protein adaptor to help to recruit more proteins into the XA21 protein complex or to facilitate XA21 into other protein complexes. Owing to the presence of three putative proteolytic cleavage motifs in the intracellular domain of XA21 (XA21CS1, XA21CS2, and XA21CS3), and to the fact that XA21 can be degraded by a developmentally regulated proteolytic activity, this rice R protein may be intrinsically unstable. Two mechanisms, autophosphorylation and protein-protein interactions, have been proposed to contribute to the accumulation of XA21 (Xu et al. 2006; Wang et al ., 2006). Autophosphorylation of XA21 may stabilize XA21. Wild-type XA21 accumulates to a much higher level than dead kinase mutant XA21K736E in rice, suggesting that the kinase activity of XA21 is required for its accumulation. Furthermore, three serine/threonine residues (Ser686, Thr688, and Ser689), located in XA21CS1, can be phosphorylated by the intracellular domain of


94 XA21. Mutation of these three residues (XA21S686A/T688A/S689A) results in the destabilization of XA21 at the adult stage, suggesting that autophosphorylation of these residues directly or indirectly protects XA21 from being cleaved by the putative protease. The second mechanism by which XA21 is stabilized may be through its binding proteins. An XA21-binding protein, XB3, has been shown to contribute to the accumulation of XA21 at the adult stage (Wang et al. 2006). Reduction of XB25 leads to a significant decrease of XA21. This observation reinforces the hypothesis that protein-protein interactions contribute to the stability of XA21. There are more than ten XA21-binding proteins identified by yeast two-hybrid screening (X. Dong, unpublished data). XA21 stability may be a useful assay to characterize these proteins In mammals, many receptor kinases undergo autophosphorylation to activate the downstream signaling pathway. In addition, some of the autophosphorylated residues serve as docking sites to recruit downstream substrates (Schlessinger, 1993; Massague, 1998). Since XA21 can be stabilized by both autophosphorylation and protein-protein interactions, there may be a link between these two mechanisms. It is hypothesized that the autophosphorylation of some residues in XA21CSs may be required for the recruitment of XA21-binding proteins that subsequently protect XA21 from being cleaved. However, the mutations of Ser686, Thr688, and Ser689 in XA21CS1 have no effect on the inter actions of XA21 with XB25 or XB3 in yeast, suggesting that these residues may not function as binding sites for XB3 and XB25. However, it cannot be excluded that these two XBs may interact with other autophosphorylation sites of XA21 and therefore protect XA21 from cleavage. Protein phosphorylation may play an important role in the regulation of plant defense response/disease resistance. A point mutation located in the kinase domain of FLS2 eliminates


95 the kinase activity of FLS2 and impairs bacterial flagellin binding (Gmez-Gmez and Boller, 2001). An invariant lysine residue, lys736, located in the kinase domain of XA21 totally abolishes the kinase activity of XA21 and transgenic plants carrying this mutant are susceptible to Xoo (Xu et al ., 2006). Biochemical data demonstrate that the pattern of phosphoproteins changes quickly when cells are treated with bacterial elicitors (Scott et al ., 2001), which suggests that numerous phosphoproteins are involved in the plant defense pathway. However, even though kinases represent a major group of identified R gene products, very few proteins have been shown to be phosphorylated by an R protein. Examples that do include the tomato Pti1 and Pti4 proteins that can be phosphorylated by Pto kinase and the rice XB3 protein that can be phosphorylated by XA21 (Zhou et al ., 1995; Gu et al 2000; Wang et al. 2006). XB25 is the second protein that acts as a substrate of XA21 in vitro. Compared to XB3, XB25 is weakly phosphorylated by XA21. This may be due to more phosphorylated sites on XB3 than that on XB25. Even though neither XB3 nor XB25 has been demonstrated to be phosphorylated in vivo the in vitro phosphorylation of XB25 by the kinase domain of XA21 provides a basis to address this question. XA21-mediated resistance is dosage dependent and XA21 levels are one of the determinants for full resistance (Wang et al ., 2006). Consistent with previous observations, half of the RNAiXB25/4021-3 plants showed reduced levels of XA21 and a compromised resistance to Xoo PR6. It should be noted that the XB25 levels in these plants were also dramatically decreased. Therefore, it cannot be excluded that the compromised resistance may be partially attributed to the reduction in XB25. In this case, XB25 may initiate a disease resistance signaling pathway, and down-regulation of XB25 would suppress this pathway, leading to a compromised XA21-mediated disease resistance.


96 Plant immunity systems consist of PTI and ETI, and each of them triggers different plant defense responses. However, the mechanisms underlying these two responses may share some common elements. It has been hypothesized that plant immunity systems act as a continuum (Lee et al., 2006). AtPhos43, a member of PANK, is phosphorylated by the treatment with bacterial flagellin. The kinase that phosphorylates AtPhos43 has yet to be identified. However, experimental data have demonstrated that th e phosphorylation of AtPhos43 is FLS2-dependant. Furthermore, proteins in rice and tomato that cross-react with anti-AtPhos43 antibodies are also phosphorylated when cells are treated by chitin and flg22. Even though the molecular identification of these rice and tomato proteins is still under investigation, they are likely to be members of PANK. These observations, together with the fact that XB25 is involved in XA21mediated disease resistance, suggest that XB25 may be a convergence point of PTI and ETI.


97 ProA-XA21 LRR ProA LRR c-Myc-XA21 c-Myc B A T P 3 0 9ProA-XA21 n.s.P r o A XA2 1 100 200 kD c-Myc-XA21 kDT P 3 0 9n.s.c M y c XA2 1100 120 Kinase Kinase ProA-XA21 LRR ProA LRR c-Myc-XA21 c-Myc B A T P 3 0 9ProA-XA21 n.s.P r o A XA2 1 100 200 kD c-Myc-XA21 kDT P 3 0 9n.s.c M y c XA2 1100 120 Kinase Kinase Figure 3-1. Immunodetection of ProA-XA21 and c-Myc-XA21. A) Schematic representation of the ProA-XA21 construct (left) and immunodetection of ProA-XA21 by PAP antibody (right). B) Schematic representation of the c-Myc-XA21 construct (left) and immunodetection of c-Myc-XA21 by anti-myc antibody (right). n.s stands for nonspecific products. ProA-XA21 and c-Myc-XA21 were indicated by arrows.


98 TAP-Os06g48590 Supernatant Pellet XB257 1 6 1 T P 3 0 9 A 6 7 16 1 T P 3 0 9 A 6 40 ProA-XA21 kD 120 80 60 50 40 50 TAP-Os06g48590 Supernatant Pellet XB257 1 6 1 T P 3 0 9 A 6 7 16 1 T P 3 0 9 A 6 40 ProA-XA21 kD 120 80 60 50 40 50 Figure 3-2. Co-immunoprecipitation assays to show that XA21 is associated with XB25 in rice protein extracts. Rice total pr otein extracts from 5 gram of leaf tissue of TP309, 716-1, and A6 (TAPOs06g48590) were immunoprecipitated with IgG beads. One-fifth of the precipitates were detected by Western Blot using PAP (upper) or anti-XB25M (lower). Three microliters of total protein extract from these three lines were loaded as a control. ProA-XA21, TAP-Os06g48590, and XB25 are indicated by arrows. The asterisk shows a degraded product of ProA-XA21, the dots show non-specific products


99 4021-3 (Myc-XA21/Myc-XA21) RNAi XB25 x F1 RNAi XB25 /Myc-XA21 XB25 /Myc-XA21 4021-3 (Myc-XA21/Myc-XA21) RNAi XB25 x F1 RNAi XB25 /Myc-XA21 XB25 /Myc-XA21 Figure 3-3. Schematic representation of the strategy to generate crosses of RNAi XB25 and 40213. RNAi XB25 serves as a pollen receiver and the homozygous Myc-XA21 line 40213 serves as a pollen donor.

PAGE 100

100 T P 3 0 9 S 4 1 / 4 0 2 1 3 2 S 4 1 / 4 0 2 1 3 1 S 3 4 / 4 0 2 1 3 6 S 3 4 / 4 0 2 1 3 5 S 3 4 / 4 0 2 1 3 4 S 3 4 / 4 0 2 1 3 2 S 3 4 / 4 0 2 1 3 1 T P 3 0 9 / 4 0 2 1 3 Myc-XA21 XB25 PonceauS Myc-XA21 PonceauS Xa21 Actin A B C DT P 3 0 9 S 4 1 / 4 0 2 1 3 2 S 4 1 / 4 0 2 1 3 1 S 3 4 / 4 0 2 1 3 6 S 3 4 / 4 0 2 1 3 5 S 3 4 / 4 0 2 1 3 4 S 3 4 / 4 0 2 1 3 2 S 3 4 / 4 0 2 1 3 1 T P 3 0 9 / 4 0 2 1 3 Myc-XA21 XB25 PonceauS Myc-XA21 PonceauS Xa21 Actin A B C D

PAGE 101

101 0 2 4 6 8 10 12 14 16 18 20T P 3 09 TP3 0 9/ 4 021 3 S34 / 4021-3-1 S34/4021-32 S 34/40 21 34 S 34/40 21 35 S 3 4 /4 021 36 S 4 1 /4 021 3-1 S41 / 4021-32 Average lesion length (cm)Plant linesE 0 2 4 6 8 10 12 14 16 18 20T P 3 09 TP3 0 9/ 4 021 3 S34 / 4021-3-1 S34/4021-32 S 34/40 21 34 S 34/40 21 35 S 3 4 /4 021 36 S 4 1 /4 021 3-1 S41 / 4021-32 Average lesion length (cm)Plant linesE Figure 3-4. XB25 contributes to the accumulation of XA21 and is involved in XA21-mediated disease resistance. A) The levels of XB25 in TP309, RNAi XB25/4021-3, and TP309/4021-3 at the adult stage were immunodetected by anti-XB25M antibody. B and C) The levels of XA21 in the indicated lines at four-month-old stage (B) and onemonth-old stage (C) were immunodetected by anti-c-Myc antibody, lower parts show ponceau S stained same blots as loading controls. D) Semiquantitative RT-PCR analyses of Xa21 transcripts in the indicated lines. Total RNA was used to amplify an Xa21 region (upper) and the actin gene as a control (lowe r ). E) Lesion length of corresponding lines two weeks post inoculation with Xoo PR6. Each data point represents three replications. The standard deviations are indicated.

PAGE 102

102 Bacteria [log(CFU)/leaf]Days after inoculation 4 5 6 7 8 9 10 11 02468101214 TP309 TP309/4021-3 S34/4021-3-6* *Bacteria [log(CFU)/leaf]Days after inoculation 4 5 6 7 8 9 10 11 02468101214 TP309 TP309/4021-3 S34/4021-3-6* * Figure 3-5. Growth of Xoo PR6 in S34/4021-3-6 and control lines. Triangles, TP309; open circles, S34/4021-3-6; open squares, TP309/4021-3. Each point represents three independent replications and standard de viations are indicated. The points labeled with asterisks show a statistically significant difference among TP309, S34/4021-3-6, and TP309/4021-3 (P<0.05).

PAGE 103

103 1 2 3 1 2 3 Figure 3-6. Photograph of rice leaves showing lesion development two weeks after inoculation with Xoo PR6. Leaves 1, TP309/4021-3 expressing Xa21; leaves 2, TP309; leaves 3, 34/4021-3-6 with reduced XA21 and XB25.

PAGE 104

104 45 97 66 MBP-XA21KTM MBP-XA21KK736ETM FLAG-XB25 FLAG-XBOS251 FLAG-XB3 + + + + + + + + + + + + + + + + + + + + XA21KTM n.s FLAG-XB3 FLAG-XBOS25-1 FLAG-XB25 kD 45 97 66 MBP-XA21KTM MBP-XA21KK736ETM FLAG-XB25 FLAG-XBOS251 FLAG-XB3 + + + + + + + + + + + + + + + + + + + + XA21KTM n.s FLAG-XB3 FLAG-XBOS25-1 FLAG-XB25 kD Figure 3-7. XB25 is phosphorylated by XA21KTM in vitro Indicated proteins were expressed and purified, respectively. XA21 kinase or its variant mutant was mixed with indicated substrates and [ -32P]ATP. Autoradiography (left) and Coomassie blue staining (right) of the same gel are shown. The position of each protein is indicated by an arrow. n.s: non-specific products.

PAGE 105

105 CHAPTER 4 IDENTIFICATION OF XB25-INTERACTORS BY YEAST TWO-HYBRID SCREENINGS Introduction A large number of proteins accomplish their cellular biological functions through proteinprotein interactions. Various tools have been deve loped to detect protein-protein interactions, and the yeast two-hybrid system is a simple but powerful approach to analyze protein associations. This system was first invented by Fields and Song in 1989, and is based on the molecular properties of a naturally occurring transcription factor, such as the yeast GAL4 protein (Baleja et al ., 1997). A transcription factor consists of tw o parts, a DNA binding domain (BD), which can directly bind a promoter DNA sequence, and an activation domain (AD), which facilitates the assembly of a general transcription complex. Successful activation of transcription requires a physical, but not necessarily a covalent, association of these two domains. In the yeast twohybrid system, AD and BD fuse independently to two proteins, referred to as bait and prey, and both of these fusion proteins are co-transformed into yeast cells. If the bait and prey can interact with each other, a functional transcription factor may reconstitute that in turn activates the downstream reporter genes. Two reporter genes, HIS3 and lacZ are widely used in the yeast twohybrid systems. HIS3 encodes an imidazoleglycerol-phosphate dehydratase that catalyzes the biosynthesis of the amino acid histidine. The activation of HIS3 enables yeast cells to grow on histidine-deficient medium. The lacZ gene encodes a -galactosidase enzyme that cleaves the colorless substrate 5-bromo-4-chloro-3-indolyl-b-galactopyranoside (X-gal) into galactose and an insoluble blue product. Thus, if the lacZ gene is activated, the yeast cells will become blue on X-gal-containing medium. Yeast two-hybrid has been widely used to dissect various plant signal transduction pathways, including plant-specific-ankyrin-proteins (PANKs)-mediated plant defense signaling.

PAGE 106

106 GLU1, a class I beta-1,3-glucanase, was found to interact with the PANK protein GBP1/TIP2 in tobacco (Wirdnam et al ., 2004). GLU1 is a PR-like protein and is involved in the degradation of beta-1,3-glucan callose (Bucher et al. 2001). Callose deposition is a typical defense response involved in PAMPs-triggered immunity (PTI). Transgenic tobacco that displayed a reduced expression of GLU1 showed an enhanced resistan ce to virus infection (Bucher et al. 2001). Thus, GBP1/TIP2 may regulate the basal defense responses through interacting with GLU1, resulting in a subsequent change of callose deposition. The bZIP transcription factor, BZI-1, interacted with the tobacco ANK1/TIP1/HBP1 protein that belongs to the PANK family and was required for the initiation of plant defense responses (Kuhlmann et al. 2002). These interactions suggest that ANK1/TIP1/HBP1 might be involved in plant defense responses by regulating these transcription factors. Another protein that was identified by yeast two-hybrid analyses is the ascorbate peroxidase 3 (APX3) that interacted with the PANK protein, AKR2 (Yan et al 2002). APX3 is one of the major enzymes involved in the degradation of such reactive oxygen species (ROS) as H2O2. ROS are important second messagers in triggering plant defense responses including the induction of the expression of defense-related genes and an HR response (Levin et al, 1994; Jabs et al. 1996). The interaction between APX3 and AKR2 suggests that AKR2 may regulate plant defense responses by modulating the levels of ROS. Collectively, these results suggest that members of PANK interact with di verse proteins and may be involved in various plant defense responses. XB25 is the only known PANK that is involved in R gene-mediated disease resistance. Therefore, identification of XB25 interactors will provide useful information to help us to elucidate the functions of PANKs. Here, a rice yeast two-hybrid cDNA library was screened by using two truncated versions of XB25 (XB25N and XB25C) as bait, and the two XB25-binding

PAGE 107

107 proteins isolated are the focus of this chapter. Materials and Methods Construction of BD-XB25, BD-XB25N, and BD-XB25C T o make an in-frame translational fusion with a GAL4 BD, XB25, XB25N and XB25C were cloned into the plasmid pDBLeu that carries a GAL4 BD (Ding et al ., 2004). BD-XB25 was created by sub-cloning the XB25 fragment from pPC86-XB25 into the corresponding sites of pDBLeu vector. XB25N (aa1-214) contains the amino acids located upstream of the ankyrin repeat domain of XB25, and XB25C (aa195-329) covers the entire ankyrin repeat domain of XB25. The fragments encoding XB25N and XB25C were amplified by the primers sets P31 (5GTGTGTCG ACGATGGAAGACCAGAAGAAAAATGC-3) /P32 (5GTGT GCGGCCGC ACTGGCAGTATGATGGACAATGGA-3) and P33 (5GTGTGTCGACTGAAGAAACTGAAGAGGATGGTG-3)/P34 (5-GTGT GC GGCC GCTAGGAAAGCGTCCATCTCGAG-3), respectively. Th e PCR products were digested with Sal I/Not I and sub-cloned into the corresponding sites of the pDBLeu vector. Auto-activation Assays of the HIS3 Reporter Gene The bait constructs (pDBLeu-XB25, pDBL eu-XB25N, and pDBLeu-XB25C) were transform ed into the yeast strain CG1945 ( MAT a ura3-52 his3-200 lys2-801 trp1-901 ade2-101 leu2-3 ,112 gal4-542 gal80-538 LYS2 ::GAL1-HIS3 cyhr2 URA3::[ GAL4 17-mers]3CYC1-lacZ ) using the procedure described previously (Chapter 2). The transformants containing one of the above constructs were mated with the yeast strain MaV203 yeast strain ( MAT leu2 3,112 trp1901 his3 200 ade2101 cyh2r can1r gal4 gal80 GAL1::lacZ HIS3UASGAL1::HIS3@LYS2 SPAL10UASGAL1::URA3 ) carrying the empty prey vector pPC86. To perform the mating reactions, the yeast cultures of both genotypes were incubated at 30 C overnight with shaking at 250 rpm and diluted to an OD600 of 0.2 and continued to grow until reaching an OD600 of 0.8. The cells

PAGE 108

108 were harvested by centrifugation at 3,000 g for 2 min at room temperature. The cells were resuspended in 500 l of YCM medium (1% bactopeptone, 1% yeast extract and 2% glucose, pH 3.5). Bait and prey-carryi ng cells were then mixed in a 1:1 ra tio and continued to grow for 1 hour. The cells were then harvested after centrifugation under the same conditions and re-suspended in 200 l of TE buffer [10 mM Tris-HCl (pH 7.5) and 1 mM EDTA]. This mating mixture was plated on SD/-Leu-Trp medium and incubated at 30 C for 3-4 days. To test the auto-activation of the HIS3 reporter gene, co-transformants carrying a bait construct (pDBLeu-XB25, pDBLeu-XB25N, or pD BLeu-XB25C) and a prey construct (pPC86) were streaked on SD/-Leu-Trp-His medium suppl emented with 0 mM or 5 mM of 3-amino-1, 2, 4-trizole (3-AT, Sigma-Aldrich) and incubated at 30 C for 3-4 days. Screening of a Rice Yeast Two-hybrid cDNA Library A yeast two-hybrid screening was performed according to the procedure described by Ding et al (2006). The yeast strain CG1945 carrying a bait construct was streaked onto SD/-Leu plates and grown at 30 C for 3-4 days. Two colonies, 23 mm in diameter, were inoculated into 1 mL of SD/-Leu medium and incubated at 30 C with shaking at 250 rpm for about 18 hours. The cell culture was diluted to an OD600 of 0.2 in 20 mL of SD/-Leu medium and allowed to grow until an OD600 of 0.8. The -mating type MaV203 yeast cells containing a rice cDNA library constructed in the pPC86 vector were thawed at room temperature for 10-15 min after removal from storage in a 80 C freezer. Approximately 8 mL of the yeast cell culture (~1.6 x 108 yeast cells) carrying the bait construct was mixed with the thawed cDNA library cells containing ~7 x 107 viable cells to a ratio of 2.3:1. The cells were harvested after centrifugation at 3,000 g for 2 min at room temperature. The collected cells were re-suspended in 2.3 mL of YCM medium (pH 3.5) to

PAGE 109

109 obtain a cell destiny of 108 cells/mL and allowed to grow at 30 C for 105 min. The cells were diluted 100-fold in sterilized water, and vortexed at maximum speed for 1 minute to disperse the cells. The cells were harvested on a 47 mm water membrane with 0.45 m pore size (MILLIPORE, Billerica, MA). The membrane was transferred to solid YCM medium (pH 4.5) and incubated at 30 C for 4.5 hours. The cells on the membrane were washed into 10 mL of 1 M sorbitol solution by vortexing vigorously for 1 minute. After centrifugation at 3,000 g for 2 min at room temperature, the harvested cells were re-suspended in 2 mL of TE buffer, spread onto bioassay dishes containing SD/-Leu-Trp-His medium supplemented with 0 mM or 5 mM of 3-AT (Sigma-Aldrich, St.Louis, MO), and then grown at 30 C for 6-10 days. The mating efficiency was determined by spreading 0.1 l of the cell suspension onto SD/Trp, SD/-Leu, and SD/-Leu-Trp media. The numbe r of colonies on each plate was counted 3-4 days after incubation at 30 C. The mating efficiency was calculated by the following equation: total number of colonies on SD/-Leu-Trp plate/the sum of total number of colonies on SD/-Leu and SD/-Trp plate. Recovery of Prey Plasmids Single colonies capable of growing on the SD/-Leu-T rp-His medium were inoculated into 2 mL of SD/-Leu-Trp-His medium supplemented w ith 0 mM or 5 mM of 3-AT, and incubated at 30 C with shaking at 250 rpm for 3 days. The plasmids in the yeast cells were extracted using the Zymoprep Yeast Plasmid Miniprep Kit (ZYMO Research, Orange, CA), according to the procedure described previously(Chapter 2). Transformation of Isolated Prey Plasmids into Escherichia coli The isolated plasm ids were transformed into E. coli in a 96-well chimney plate. The plate, containing 20 l of XL2-Blue Ultracompetent Ce lls (Stratagene, La Jolla, CA) and 0.03 ng of

PAGE 110

110 plasmids in each well, was heat shocked at 42 C for 30 seconds, and placed on ice for 2 min. Cells were then transferred to 300 l of NZY+ medium (10 g/L NZ amine, 5 g/L yeast extract, 5 g/L NaCl, 12.5 mM of MgCl2, 12.5 mM of MgSO4, and 0.4% glucose), and incubated at 37 C for 1 hour. 300 l of LB containing 50 g/mL ampicillin (LBAmp) was added to each well of the plate and the cell culture continued to grow at 30 C overnight. The transformants were streaked on LBAmp medium for single colonies. For DNA sequencing of the inserts in the prey plasmids, single colonies were inoculated into 5 mL of LBAmp, and grown at 37 C overnight with shaking at 250 rpm. The plasmids were extracted using the Wizard Plus SV Miniprep s DNA Purification System (Promega, Madison, WI). The inserts in prey plasmids were sequenced by the DNA Sequence Core at the University of Florida using a primer based on the sequence of the GAL4 DNA activation domain present in the pDBLeu vector (SS020: 5-AGGGATGTTTAATACCACTAC-3). The sequences were analyzed using the software Sequencher v 4.0.5 (Gene Codes Corporation, Ann Arbor, MI). The insert sequences were used as a query to identify rice full length coding sequences by searching TIGR rice genome database (http://www.tigr.org/tdb/e2k1/osa1/). Verification of Candidate Interactors Both bait and prey plasm ids were co-transformed into yeast competent cells CG1945 using the procedure described previousely (Chapter 2) The transformants were grown on SD/-Trp-Leu medium at 30 C for 3 days. The colonies grown on the SD/-Trp-Leu medium were then replicated onto SD/-Trp-Leu-His medium and grown at 30 C for 3-4 days. Results Construction of BD-XB25, BD-XB25N, and BD-XB25C bait To identify proteins that interact with XB25, full length XB25 and two derivatives (XB25N and XB25C) were in-fram e fused to th e C-terminus of GAL4 BD in the bait vector

PAGE 111

111 pDBLeu. XB25N spans the N-terminal half of XB25 (aa 1-214), whereas XB25C encompasses a C-terminal region (aa 196-329) containing the f our ankyrin repeat of XB25 (Figure 4-1). To test whether the bait constructs can activate the HIS3 reporter gene in the absence of a prey protein, BD-XB25, BD-XB25N, and BD-XB 25C were transformed into yeast cells CG1945, respectively. The cells carrying each of the bait constructs were mated with yeast cells MaV203 containing the empty AD vector. As shown in Fi gure 4-2A, the mating was successful because all the yeast cells grew on SD/-Leu-Trp medium. When streaked on SD/-Trp-Leu-His medium, yeast cells containing the BD-XB25C and the AD vector did not grow, indicating that XB25C cannot auto-activate the HIS3 reporter gene. However, yeast cells carrying either BD-XB25N or BD-XB25 grew on the SD/-Leu-Trp-His medium, indicating that HIS3 auto-activation occurs in the presence of XB25N or XB25 (Figure 4-2B). As shown in Figure 4-2C, yeast cells containing BD-XB25N and AD vector did not grow on SD/Leu-Trp-His medium supplemented with 5 mM 3-AT that can suppress the leaky expression of HIS3 gene, demonstrating that under these stringent conditions, HIS3 auto-activation of XB25N was abolished. Therefore, 5 mM 3-AT was added to the medium for yeast two-hybrid screening when BD-XB25N was used as the bait. BDXb25 caused the auto-activation of HIS3 gene even when 5 mM 3-AT was added to the SD/Leu-Trp-His medium, indicating that BD-XB25 is inappropriate for the yeast two-hybrid screening. Identification of XB25N and XB25C Interactors Using Yeast Tw o-Hybrid Screenings Both BD-XB25N and BD-XB25C were used as bait to perform yeast two-hybrid screenings. For each screening, more than 2.5 million transformants were obtained. No obvious colony was identified on the SD/-Trp-Leu-His + 5 mM 3-AT medium following the original screening for BD-XB25N. In contrast, seventeen clones were selected following the original screening for XB25C. The bait and prey plasmids were extracted and co-

PAGE 112

112 transformed into E.coli. Only prey-carrying colonies are capable of growing on LBAmp medium. Therefore seventeen prey plasmids were recovered and the corresponding inserts were identified by sequencing. Nine inserts that were in-frame fused to the GAL4 BD domain and their corresponding rice full length coding sequences were acquired and summarized in Table 4-1. These nine prey inserts correspond to three rice genes. The first gene (Os02g44220) encodes a putative rice peroxisomal biogenesis factor 19 (PEX19) with 260 amino acids. The second gene (Os06g12230) encodes a rice TCP domai n-containing transcription factor. The TCP domain is a short sequence motif that was originally identified in the cycloidea (cyc) and teosinte branched 1 (tb1) genes (Carpenter & Coen, 1990; Doebley et al ., 1997), and later was also found in two rice genes, PCF-1 and PCF-2 (Kosugi a nd Ohashi, 1997). This domain contains a region that forms a conserved basic-helix-loop-helix (b HLH) structure which is often involved in DNAbinding and dimerization (Cubas et al ., 1999). The third gene (Os06g13680) encodes a B12Dlike protein that is involved in the embryo development of barley seed (Aalen et al. 1994) Verification of Candidate XB25C Interactors in Yeast To verify the interactions between XB25C and candidate interactors, both bait and prey plasm ids were re-transformed into fresh yeast competent cells. As is shown in Figure 4-3, the interaction between XB25C and PEX19 can be reproduced. Moreover, PEX19 failed to interact with XA21KTM, indicating that PEX19 specifically interacts with XB25C (Figure 4-3A). The TCP protein Os06g12230 can auto-activate the HIS3 reporter gene on SD/-Leu-Trp-His medium (data not shown). This auto-activation can be abolished by supplementation with 1 mM 3-AT (Figure 4-3B). Similar to PEX19, the TCP pr otein interacted with XB25C, but not with XA21KTM (Figure 4-3B). The third XB25C inter actor candidate, XB25C-8, failed to interact with XB25C, indicating that this protein is a false positive interactor.

PAGE 113

113 Discussion The identif ication of XB25 interactors will expand the XA21-XB25 defense network. Using yeast two-hybrid screenings, two XB25-binding proteins have been identified. One is a peroxisomal biosynthesis factor (PEX19), the other is a TCP transcription factor. PEX19 is a member of the PEX family that is involved in the regulation of peroxisomal biogenesis and maintains the normal function of peroxisomes (Kazumasa et al 2007). Peroxisomes are single lipid bi-layer membrane-bound organelles found in all eukaryotic organisms. Unlike chloroplasts and mitochondria, which are autonomous organelles that multiply by growth and division (Lazarow and Fujiki, 1985), peroxisomes are derived from the endoplasmic reticulum (ER) (Geuze et al., 2003; Tabak et al. 2003). In Arabidopsis, at least 22 PEX genes have been identified, and PEX19 was found to be important for maintaining normal peroxisomal morphology (Kazumasa et al. 2007). In yeast and mammals, PEX19 is mainly present in the cytosol and acts as a chaperone-like protein for the assembly of peroxisomal membrane proteins (PMPs) (Jones et al ., 2007). This suggests that the protein may interact with a wide reange of proteins. A recent study suggested that peroxisomes may be involved in the plant defense responses (Lipka et al. 2005). When Arabidopsis plants were infected with a fugal pathogen, Blumeria graminis f. sp. hordei ( Bgh), the accumulation of peroxisomes was observed at the pathogen entry sites. This result suggests that peroxisomes may function in the inducible preinvasion resistance pathway. Peroxisomes are also one of the major sources of production and scavenging of reactive oxygen species (ROS) that are active signal molecules involved in plant defense/disease resistance (Brown et al ., 1998; Mittler et al ., 2002). Therefore the interaction between XB25 and PEX19 suggests a role of peroxisomes in XA21-mediated disease resistance and points a direction for further research.

PAGE 114

114 The interaction between XB25C and the TCP transcription factor implies that XB25 may regulate plant defense/disease resistance through m odulating gene transcripts. The TCP family is involved in the processes related to cell proliferation (Doebley et al. 1995). For instance, PCFs have been found to bind to the promoter region of the rice proliferating cell nuclear antigen (PCNA) gene. PCNA participates in a variet y of cell activities, including DNA replication, DNA repair, and cell cycle control. Therefore, TCP family may regulate cell proliferation by activating the transcription of cell cycle regulators. As discussed in Chapter 2, PANK proteins may function in a similar manner as the animal IkB protein, which serves as a negative regulator of transcription factors. Therefore, the interacti on between XB25C and the TCP transcription factor supports this hypothesis. To date, however, no data have shown that TCP transcription factors are involved in plant defense/disease resistance pathways. Consequently, further studies on the function of this XB25-binding TCP transcription factor will help us to better justify this model.

PAGE 115

115 XB25 XB25N XB25C (1-329) (1-214) (195-329) XB25 XB25N XB25C (1-329) (1-214) (195-329) Figure 4-1. Schematic representation of bait constructs used for yeast two-hybrid screenings. XB25N (aa1-214) contains the amino acids located upstream of the ankyrin repeat domain. XB25C (aa195-329) spans the ankyrin repeat region. The blue box indicates the PEST motif .The red boxes represent the ankyrin repeat domain of XB25.

PAGE 116

116 SD/-Leu-Trp-His+ 5 mM3-AT SD/-Leu-Trp AD+BD-XB25A D + B D X B 2 5 NA D + B D X B 2 5 CSD/-Leu-Trp-His SD/-Leu-Trp-His+ 5 mM3-AT SD/-Leu-Trp AD+BD-XB25A D + B D X B 2 5 NA D + B D X B 2 5 CSD/-Leu-Trp-His Figure 4-2. Assays for auto-activation of the HIS3 gene. Yeast cells containing indicated bait and prey proteins were streaked on SD/Leu-Trp or SD/-Leu-Trp-His medium supplementing with 0 or 5 mM 3-AT. The growth of cells on the histidine-deficient medium indicates that auto-activation of HIS3 gene occurs.

PAGE 117

117 Table 4-1: Candidate XB25C interactors Prey Gene ID Gene function Verification XB25C-1 (aa1-250) XB25C-2 (aa1-214) XB25C-3 (aa15-204) XB25C-4 (aa1-214) XB25C-5 (aa25-260) XB25C-6 (aa15-260) XB25C-7 (aa1-214) Os02g44220 Peroxisomal biosynthesis factor 19 (PEX19) YES XB25C-8 (aa1-282) Os06g12230 TCP-containing transcription factor YES XB25C-9 (aa1-89) Os06g13680 B12D-like protein NO

PAGE 118

118 BD-XB25C BD-XA21KTM BDA D P E X 1 9 A D A D T C P p r o t e i n A D A D A D B 1 2 D l i k e p r o t e i nBD-XB25C BD-XA21KTM BD SD/-Leu-Trp SD/-Leu-Trp SD/-Leu-Trp SD/-Leu-Trp-His SD/-Leu-Trp-His + 1 mM3-AT SD/-Leu-Trp-His BD-XB25C BD-XA21KTM BDA D P E X 1 9 A D A D T C P p r o t e i n A D A D A D B 1 2 D l i k e p r o t e i nBD-XB25C BD-XA21KTM BD SD/-Leu-Trp SD/-Leu-Trp SD/-Leu-Trp SD/-Leu-Trp-His SD/-Leu-Trp-His + 1 mM3-AT SD/-Leu-Trp-His Figure 4-3. Verification of interactions between XB25C and candidate binding proteins. Isolated prey plasmids from original screening were co-transformed into yeast cells with BDXB25C, BD-XA21KTM, or BD vector. The transformants were grown on SD/-LeuTrp medium (upper), and then were replicated onto SD/-Leu-Trp-His medium supplementing with 0 mM or 1 mM 3-AT (lower). The growth of cells on the histidine-deficient medium indicates the interactions between bait and prey occur.

PAGE 119

119 CHAPTER 5 CONCLUSIONS AND FUTURE PERSPECTIVES In this study, an ankyrin re peat-containing protein, XB25, was characterized. XB25 belongs to a plant-specific-ankyrin-repeat (PANK) fam ily. It specifically interacts with a rice resistant protein XA21 in yeast and in planta. As an XA21-binding protein, XB25 contributes to the stability of XA21 at the adult stage and is required for the full XA21-mediated disease resistance. In addition, XB25 is phosphorylated by XA21 in vitro. Finally, using yeast twohybrid screening, a peroxisomal biosynthesis factor 19 (PEX19) was identified as an XB25binding protein. These results indicate that XB25 is involved in XA21-mediated disease resistance. The study of XB25 provides a link between the PANK family and a resistance protein. However, the function of XB25 is still far away from being fully understood. Several interesting questions need to be answered. First, XB25 was shown to be phosphorylated by XA21 in vitro, but it is not known if XB25 is phosphorylated in planta, and if so, is the phosphorylation dependent on XA21? This question could be addressed by immunoprecipitating XB25 from 32P labeled plants. Nevertheless, attempts to pull down XB25 protein from rice by anti-XB25M antiserum were failed (data not shown). This may be due to that the antigens used to generate anti-XB25M antibodies were denatured and the anti-XB25M antibodies therefore cannot recognize and immunoprecipitate the native XB25 pr otein in rice. Thus, further generation of new anti-XB25 antibodies using native antigens may help to elucidate the question. The second question that is worth to be studied is that since XB25 is present in both susceptible and resistant plants, what roles does it play in the absence of XA21? Even though down-regulation of XB25 does not have an effect on the resistance to Xoo, it can not exclude the possibility that XB25 may be involved in the plant basal defense as do some other PANK

PAGE 120

120 members. One possible explanation for the failure to observe the change of resistance to Xoo when XB25 is down-regulated is that the Xoo strains used in this study are highly virulent and they are able to suppress the plant basal defense response. Therefore, further analyses of the phenotypes of plants inoculated with less virule nce strains will help to answer the question. The interaction between XB25 and PEX19 links peroxisomes to XA21-mediated disease resistance. It is interesting to study how per oxisomes are involved in XA21-mediated disease resistance. It was observed that peroxisomes were accumulated at the sites of entry when plants are infected by a fungal pathogen (Lipka et al., 2005, Science), so further studies could be focused on the changes of peroxisomal localization when plants are infected by Xoo.

PAGE 121

121 LIST OF REFERENCES Aalen RB, Opsahl-Ferstad HG, Linnestad C, Olsen OA. (1994). Transcripts encoding an oleosin and a dorm ancy-related protein are present in both the aleurone layer and the embryo of developing barley (Hordeum vulgare L.) seeds. Plant J. 5, 385-96. Abramovitch RB, Anderson JC, Martin GB (2006). Bacterial elicitation and evasion of plant innate immunity. Nat Rev Mol Cell Biol. 7, 601-11. Agrios, G.N. (1997). Plant Pathology. 4th edition, Academic Press, San Diego. Aist. J. R. B., W.R.B. (1991). The Fungal Spore and Disease Initiation in Plants and Animals. (New York: Plenum). Asai T, Tena G, Plotnikova J, Willmann MR, Chiu WL, Gomez-Gomez L, Boller T, Ausubel FM, Sheen J. (2004). MAP kinase signalling cascade in Arabidopsis innate immunity. Nature 415, 977-983. Axtell, M.J., and Staskawicz, B.J. (2003). Initiation of RPS2-specified disease resistance in Arabidopsis is coupled to the AvrRpt2-directed elimination of RIN4. Cell 112, 369-377. Axtell, M.J., Chisholm, S.T., Dahlbeck, D., and Staskawicz, B.J. (2003). Genetic and molecular evidence that the Pseudomonas syringae type III effector protein AvrRpt2 is a cysteine protease. Molecular microbiology 49, 1537-1546. Axtell, M.J.a.S., B.J. (2003). Initiation of RPS2-specified disease resistance in Arabidopsis is coupled to the AvrRpt2-directed elimination of RIN4. Cell 112, 369-377. Azevedo, C., Sadanandom, A., Kitagawa, K., Freialdenhoven, A., Shirasu, K., and SchulzeLefert, P. (2002). The RAR1 interactor SGT1, an essential component of R genetriggered disease resistance. Science 295, 2073-2076. Baker, B., Zambryski, P., Staskawicz, B., and Dinesh-Kumar, S.P. (1997). Signaling in plant-microbe interactions. Science 276, 726-733. Baleja, J. D., Thanabal, V., Wagner, G. .(1997). Refined Solution Structure of the DNABinding Domain of GAL4 and Use of the 3J (113Cd, 1H) in Structure Determination. J. Biomol. NMR 10, 397. Beffa, R., and Meins, F., Jr. (1996). Pathogenesis-related functions of plant beta-1,3-glucanases investigated by antisense transformation--a review. Gene 179, 97-103. Belkhadir, Y., Subramaniam, R., and Dangl, J.L. (2004a). Plant disease resistance protein signaling: NBS-LRR proteins and their pa rtners. Current opinion in plant biology 7, 391399.

PAGE 122

122 Belkhadir, Y., Nimchuk, Z., Hubert, D.A., Mackey, D., and Dangl, J.L. (2004b). Arabidopsis RIN4 negatively regulates disease resistance mediated by RPS2 and RPM1 downstream or independent of the NDR1 signal modulator and is not required for the virulence functions of bacterial type III effectors AvrRpt2 or AvrRpm1. The Plant Cell 16, 28222835. Belvin, M.P., and Anderson, K.V. (1996). A conserved signaling pathway: the Drosophila tolldorsal pathway. Annual review of cell and developmental biology 12, 393-416. Bieri, S., Mauch, S., Shen, Q.H., Peart, J., Devoto, A., Casais, C., Ceron, F., Schulze, S., Steinbiss, H.H., Shirasu, K., and Schulze-Lefert, P. (2004). RAR1 positively controls steady state levels of barley MLA resistance proteins and enables sufficient MLA6 accumulation for effective resistance. The Plant Cell 16, 3480-3495. Bonas, U., and Lahaye, T. (2002). Plant disease resistance triggered by pathogen-derived molecules: refined models of specific recognition. Current opinion in microbiology 5, 4450. Brown I, Trethowan J, Kerry M, Mansfi eld J and Bolwell G P .(1998). Localization of components of the oxidative cross-linking of glycoproteins and of callose synthesis in papillae formed during the interaction between non-pathogenic strains of Xanthomonas campestris and French bean mesophyll cells; Plant J. 15, 333. Bucher, G.L., Tarina, C., Heinlein, M., Di Serio, F., Meins, F., Jr., and Iglesias, V.A. (2001). Local expression of enzymatically active class I beta-1, 3-glucanase enhances symptoms of TMV infection in tobacco. Plant J 28, 361-369. Cao, H., Bowling, S.A., Gordon, A.S., and Dong, X. (1994). Characterization of an Arabidopsis Mutant That Is Nonresponsive to Inducers of Systemic Acquired Resistance. The Plant Cell 6, 1583-1592. Cao, H., Glazebrook, J., Clarke, J.D., Volko, S., and Dong, X. (1997). The Arabidopsis NPR1 gene that controls systemic acquired resistance encodes a novel protein containing ankyrin repeats. Cell 88, 57-63. Carpenter, R. & Coen, E.S. (1990). Floral homeotic mutations produced by transposonmutagenesis in Antirrhinum majus. Genes Dev. 4, 1483-1493. Century, K.S., Lagman, R.A., Adkisson, M., Morl an, J., Tobias, R., Schwartz, K., Smith, A., Love, J., Ronald, P.C., and Whalen, M.C. (1999). Short communication: developmental control of Xa21-mediated disease resistance in rice. Plant J 20, 231-236. Century, K.S., Holub, E.B., and Staskawicz, B.J. (1995). NDR1, a locus of Arabidopsis thaliana that is required for disease resistance to both a bacterial and a fungal pathogen. Proceedings of the National Academy of Sc iences of the United States of America 92, 6597.

PAGE 123

123 Century, K.S., Shapiro, A.D., Repetti, P.P., Da hlbeck, D., Holub, E., and Staskawicz, B.J. (1997). NDR1, a pathogen-induced component required for Arabidopsis disease resistance. Science 278, 1963-1965. Chang, J.H., Urbach, J.M., Law, T.F., Arnold, L.W., Hu, A., Gombar, S., Grant, S.R., Ausubel, F.M., and Dangl, J.L. (2005). A high-throughput, near-saturating screen for type III effector genes from Pseudomonas syringae. Proceedings of the National Academy of Sciences of the United States of America 102, 2549-2554. Chen, X., Shang, J., Chen, D., Lei, C., Zou, Y., Zhai, W., Liu, G., Xu, J., Ling, Z., Cao, G., Ma, B., Wang, Y., Zhao, X., Li, S., and Zhu, L. (2006). A B-lectin receptor kinase gene conferring rice blast resistance. Plant J 46, 794-804. Chern, M., Canlas, P.E., Fitzgerald, H.A., and Ronald, P.C. (2005). Rice NRR, a negative regulator of disease resistan ce, interacts with Arabidopsis NPR1 and rice NH1. Plant J 43, 623-635. Chevray, P.M., and Nathans, D. (1992). Protein interaction cloning in yeast: identification of mammalian proteins that react with the leucine zipper of Jun. Proceedings of the National Academy of Sciences of the United States of America 89, 5789-5793. Chinchilla, D., Bauer, Z., Regenass, M., Boller, T., and Felix, G. (2005). The Arabidopsis receptor kinase FLS2 binds flg22 and determines the specificity of flagellin perception. The Plant Cell 18, 465-476. Chisholm, S.T., Dahlbeck, D., Krishnamurthy, N., Day, B., Sjolander, K., and Staskawicz, B.J. (2005). Molecular characterization of proteolytic cleavage sites of the Pseudomonas syringae effector AvrRpt2. Proceedings of the National Academy of Sciences of the United States of America 102, 2087-2092. Clark, S.E., Williams, R.W., and Meyerowitz, E.M. (1997). The CLAVATA1 gene encodes a putative receptor kinase that controls shoot and floral meristem size in Arabidopsis. Cell 89, 575-585. Coaker, G., Falick, A., and Staskawicz, B. (2005). Activation of a phytopathogenic bacterial effector protein by a eukaryotic cyclophilin. Science 308, 548-550. Coppinger, P., Repetti, P.P., Day, B., Dahl beck, D., Mehlert, A., and Staskawicz, B.J. (2004). Overexpression of the plasma membrane-localized NDR1 protein results in enhanced bacterial disease resistance in Arabidopsis thaliana. Plant J 40, 225-237. Cubas P, Lauter N, Doebley J, Coen E. (1999). The TCP domain: a motif found in proteins regulating plant growth and development. Plant J 18, 215.

PAGE 124

124 Corpas J. Francisco, Juan B. Barrosob and Luis A. del Ro. (2001). Peroxisomes as a source of reactive oxygen species and nitric oxide signal molecules in plant cells. Trend in Plant Sci. 6, 145-150. Corpet, F. (1988). Multiple sequence alignment with hierarchical clustering. Nucl. Acids Res. 16, 10881-10890 da Silva, F.G., Shen, Y., Dardick, C., Burdman, S., Yadav, R.C., de Leon, A.L., and Ronald, P.C. (2004). Bacterial genes involved in type I secretion and sulfation are required to elicit the rice Xa21-mediated innate immune response. Mol Plant Microbe Interact 17, 593-601. Dangl, J.L., and Jones, J.D. (2001). Plant pathogens and integrated defence responses to infection. Nature 411, 826-833. Day, B., Dahlbeck, D., and Staskawicz, B.J. (2006). NDR1 interaction with RIN4 mediates the differential activation of multiple disease resistance pathways in Arabidopsis. The Plant Cell 18, 2782-2791. Day, B., Dahlbeck, D., Huang, J., Chisholm, S.T., Li, D., and Staskawicz, B.J. (2005). Molecular basis for the RIN4 negative regulation of RPS2 disease resistance. The Plant Cell 17, 1292-1305. Decatur, A.L., and Portnoy, D.A. (2000). A PEST-like sequence in listeriolysin O essential for Listeria monocytogenes pathogenicity. Science 290, 992-995. Deslandes, L., Olivier, J., Peeters, N., Feng, D. X., Khounlotham, M., Boucher, C., Somssich, I., Genin, S., and Marco, Y. (2003). Physical interaction between RRS1-R, a protein conferring resistance to bacterial wilt, and PopP2, a type III effector targeted to the plant nucleus. Proceedings of the National Academ y of Sciences of the United States of America 100, 8024-8029. Diener AC and Ausubel FM. (2005). RESISTANCE TO FUSARIUM OXYSPORUM 1, a dominant Arabidopsis resistance gene, is not race specific. Genetics 171, 305-321. Ding, X., Zhang, Y., and Song, W.-Y. (2006). Use of rolling circle amplification for large-scale yeast two-hybrid analyses. In Methods in Molecular Biology, Vol. 354: PlantPathogen Interactions: Methods and Protocols, P. C. R onald, ed. (Totowa, NJ: Humana Press, Inc.), pp. 85-98. Dixon, M.S., Golstein, C., Thomas, C.M., van Der Biezen, E.A., and Jones, J.D. (2000). Genetic complexity of pathogen perception by pl ants: the example of Rcr3, a tomato gene required specifically by Cf-2. Proceedings of the National Academy of Sciences of the United States of America 97, 8807-8814.

PAGE 125

125 Dixon, M.S., Jones, D.A., Keddie, J.S., Thomas, C.M., Harrison, K., and Jones, J.D. (1996). The tomato Cf-2 disease resistance locus comprises two functional genes encoding leucine-rich repeat proteins. Cell 84, 451-459. Doebley J, Stec A, Gustus C. (1995). Teosinte branched1 and the origin of maize: evidence for epistasis and the evolution of dominance. Genetics 141, 333. Doebley, J., Stec, A., Hubbard, L. (1997). The evolution of apical dominance in maize. Nature 386, 485 488. Dow, M., Newman, M.A., and von Roepenack, E. (2000). The induction and modulation of plant defense responses by bacterial lipopolysaccharides. Annu Rev Phytopathol 38, 241 261. Durrant, W.E., and Dong, X. (2004). Systemic acquired resistance. Annual review of phytopathology 42, 185-209. Felix, G., and Boller, T. (2003). Molecular sensing of bacteria in plants. The highly conserved RNA-binding motif RNP-1 of bacterial cold shock proteins is recognized as an elicitor signal in tobacco. J Biol Chem 278, 6201. Felix, G., Duran, J.D., Volko, S., and Boller, T. (1999). Plants have a sensitive perception system for the most conserved domain of bacterial flagellin. Plant J 18, 265-276. Feys, B.J., Moisan, L.J., Newman, M.A., and Parker, J.E. (2001). Direct interaction between the Arabidopsis disease resistance signali ng proteins, EDS1 and PAD4. The EMBO journal 20, 5400-5411. Fields, S., and Song, O. (1989). A novel genetic system to detect protein-protein interactions. Nature 340, 245-246. Flor HH. (1971). Current status of the gene-for-gene concept. Annu. Rev. Phytophatology 9, 275-296. Fouts, D.E., Abramovitch, R.B., Alfano, J.R., Baldo, A.M., Buell, C.R., Cartinhour, S., Chatterjee, A.K., D'Ascenzo, M., Gwinn, M.L., Lazarowitz, S.G., Lin, N.C., Martin, G.B., Rehm, A.H., Schneider, D.J., van Dijk, K., Tang, X., and Collmer, A. (2002). Genomewide identification of Pseudomonas syringae pv. tomato DC3000 promoters controlled by the HrpL alternative sigma fact or. Proceedings of the National Academy of Sciences of the United States of America 99, 2275-2280. Freialdenhoven, A., Scherag, B., Hollricher, K., Collinge, D.B., Thordal-Christensen, H., and Schulze-Lefert, P. (1994). Nar-1 and Nar-2, two loci required for Mla12-specified race-specific resistance to powdery mildew in barley. The Plant Cell 6, 983.

PAGE 126

126 Fridborg, I., Grainger, J., Page, A., Coleman, M., Findlay, K., and Angell, S. (2003). TIP, a novel host factor linking callose degradation with the cell-to-cell movement of Potato virus X. Mol Plant Microbe Interact 16, 132-140. Fumiko Taguchi, R.S., Yoshishige Inagaki, Kazuhiro Toyoda, Tomonori Shiraishi and Yuki Ichinose. (2003). Post-translational modification of flagellin determines the specificity of HR induction. The Plant Cell Physiol. 44, 342-349. Geuze, H. J., Murk, J. L., Stroobants, A. K., Griffith, J. M., Kleijmeer, M. J., Koster, A. J., Verkleij, A. J., Distel, B. and Tabak, H. F. (2003). Involvement of the endoplasmic reticulum in peroxisome formation. Mol. Biol. Cell 14, 2900-2907. Glazebrook, J., Rogers, E.E., and Ausubel, F.M. (1996). Isolation of Arabidopsis mutants with enhanced disease susceptibility by direct screening. Genetics 143, 973-982. Godiard L, Sauviac L, Torii KU, Grenon O, Mangin B, Grimsley NH, and Marco Y. (2003). ERECTA, an LRR receptor-like kinase protein controlling development pleiotropically affects resistance to bacterial wilt. Plant J 36, 353-365. Gomez-Gomez, L., and Boller, T. (2000). FLS2: an LRR receptor-like kinase involved in the perception of the bacterial elicitor flagellin in Arabidopsis. Molecular cell 5, 1003-1011. Gomez-Gomez, L., Felix, G., and Boller, T. (1999). A single locus determines sensitivity to bacterial flagellin in Arabidopsis thaliana. Plant J 18, 277-284. Gomez-Gomez, L., Bauer, Z., and Boller, T. (2001). Both the extracellular leucine-rich repeat domain and the kinase activity of FSL2 are required for flagellin binding and signaling in Arabidopsis. The Plant Cell 13, 1155-1163. Gu, K., Yang, B., Tian, D., Wu, L., Wang, D., Sreekala, C., Yang, F., Chu, Z., Wang, G.L., White, F.F., and Yin, Z. (2005). R gene expression induced by a type-III effector triggers disease resistance in rice. Nature 435, 1122-1125. Gu, Y.-Q., Yang, C., Thara, V.K., Zhou, J., and Martin, G.B. (2000). Pti4 is induced by ethylene and salicylic acid, and its product is phosphorylated by the Pto kinase. The Plant Cell 12, 771. Hammond-Kosack, E. Kim and Parker, E. Jane (2003). Deciphering plantpathogen communication: fresh perspectives for molecular resistance breeding. Current Opinion in Biotechnology 14, 177-193. Hauck, P., Thilmony, R., and He, S.Y. (2003). A Pseudomonas syringae type III effector suppresses cell wall-based extracellular defense in susceptible Arabidopsis plants. Proceedings of the National Academy of Sc iences of the United States of America 100, 8577-8582.

PAGE 127

127 Hashimoto Carl, Kathy L. Hudson and Kathryn V. Anderson (1988). The Toll gene of drosophila, required for dorsal-ventral embryonic polarity, appears to encode a transmembrane protein Cell 52, 269-279. Hayashi, F., Smith, K.D., Ozinsky, A., Hawn, T.R., Yi, E.C., Goodlett, D.R., Eng, J.K., Akira, S., Underhill, D.M., and Aderem, A. (2001). The innate immune response to bacterial flagellin is mediated by Toll-like receptor 5. Nature 410, 1099-1103. He, P., Shan, L., Lin, N.-C., Martin, G.B., Kemmerling, B., Nurnberger, T., and Sheen, J. (2006). Specific Bacterial Suppressors of MAMP Signaling Upstream of MAPKKK in Arabidopsis Innate Immunity. Cell 125, 563-575. He Sheng Yang, Kinya Nomuraa and Thomas S. Whittam (2004). Type III protein secretion mechanism in mammalian and plant pathogens. Biochim Biophys Acta. 11, 181-206. Hoffmann, J.A., and Reichhart, J.M. (2002). Drosophila innate immunity: an evolutionary perspective. Nature immunology 3, 121-126. Holt, B.F., 3rd, Belkhadir, Y., and Dangl, J.L. (2005). Antagonistic control of disease resistance protein stability in the plant immune system. Science 309, 929-932. Hubert, D.A., Tornero, P., Belkhadir, Y., Krishna, P., Takahashi, A., Shirasu, K., and Dangl, J.L. (2003). Cytosolic HSP90 associates with and modulates the Arabidopsis RPM1 disease resistance protein. The EMBO journal 22, 5679-5689. Ichimura, K., Casais, C., Peck, S.C., Shinozaki, K., and Shirasu, K. (2006). MEKK1 is required for MPK4 activation and regulates tissue-specific and temperature-dependent cell death in Arabidopsis. The Journal of biological chemistry 281, 36969-36976. Iglesias, V.A., and Meins, F., Jr. (2000). Movement of plant viruses is delayed in a beta-1,3glucanase-deficient mutant showing a reduced plasmodesmatal size exclusion limit and enhanced callose deposition. Plant J 21, 157-166. Iyer, A.S., and McCouch, S.R. (2004). The rice bacterial blight resistance gene xa5 encodes a novel form of disease resistance. Mol Plant Microbe Interact 17, 1348-1354. Jabs T, Dietrich RA, Dangl JL. (1996) Initiation of runaway cell death in an Arabidopsis mutant by extracellular superoxide. Science 273, 1853. Jia Yulin Sean A. McAdams, Gregory T. Bryan, Howard P. Hershey and Barbara Valent (2000). Direct interaction of resistance gene and avirulence gene products confers rice blast resistance. The EMBO journal 19, 4004-4014. Jiang GH, Xia ZH, Zhou YL, Wan J, Li DY, Chen RS, Zhai WX, Zhu LH. (2006). Testifying the rice bacterial blight resistance gene xa5 by genetic complementation and

PAGE 128

128 further analyzing xa5 (Xa5) in comparison with its homolog TFIIAgamma1. Mol Genet Genomics. 275, 354-66. Jirage, D., Tootle, T.L., Reuber, T.L., Frost, L.N., Feys, B.J., Parker, J.E., Ausubel, F.M., and Glazebrook, J. (1999). Arabidopsis thaliana PAD4 encodes a lipase-like gene that is important for salicylic acid signaling. Proceedings of the National Academy of Sciences of the United States of America 96, 13583-13588. Johal, G.S., and Briggs, S.P. (1992). Reductase activity encoded by the HM1 disease resistance gene in maize. Science 258, 985-987. Jones, D.A., Thomas, C.M., Hammond-Kosack, K.E., Balint-Kurti, P.J., and Jones, J.D. (1994). Isolation of the tomato Cf-9 gene for resistance to Cladosporium fulvum by transposon tagging. Science 266, 789-793. Jones, J.D., and Dangl, J.L. (2006). The plant immune system. Nature 444, 323-329. Jones M. Jacob, Morrell C. James, and Gould J. Stephen. (2007). PEX19 is a predominantly cytosolic chaperone and import receptor for class 1 peroxisomal membrane proteins. Journal of Cell Biology 164, 57-67. Kazumasa Nito, Akane Kamigaki, Maki Ko ndo, Makoto Hayashi and Mikio Nishimura (2007). Functional Classification of Arabidopsis Peroxisome Biogenesis Factors Proposed from Analyses of Knockdown Mutants. Plant Cell Physiology 48, 763-774. Keshavarzi, M., Soylu, S., Brown, I., Bonas, U., Nicole, M., Rossiter, J., and Mansfield, J. (2004). Basal defenses induced in pepper by lipopolysaccharides are suppressed by Xanthomonas campestris pv. vesicatoria. Mol Plant Microbe Interact 17, 805-815. Kim, H.S., Desveaux, D., Singer, A.U., Patel, P., Sondek, J., and Dangl, J.L. (2005a). The Pseudomonas syringae effector AvrRpt2 cleaves its C-terminally acylated target, RIN4, from Arabidopsis membranes to block RPM1 activation. Proceedings of the National Academy of Sciences of the United States of America 102, 6496-6501. Kim, M.G., da Cunha, L., McFall, A.J., Belkhadi r, Y., DebRoy, S., Dangl, J.L., and Mackey, D. (2005b). Two Pseudomonas syringae type III effectors inhibit RIN4-regulated basal defense in Arabidopsis. Cell 121, 749-759. Kinkema, M., Fan, W., and Dong, X. (2000). Nuclear localization of NPR1 is required for activation of PR gene expression. The Plant Cell 12, 2339-2350. Kitagawa1 Katsumi, Dorota Skowyra, Stephen J. Elledge, J. Wade Harper and Philip Hieter. (1999). SGT1 Encodes an Essential Component of the Yeast Kinetochore Assembly Pathway and a Novel Subunit of the SCF Ubiquitin Ligase Complex. Molecular Cell 4, 21-33.

PAGE 129

129 Kopp, E.B. and Medzhitov, R. (1999). The Toll-receptor family and control of innate immunity. Current opinion immunology 11, 13. Kosugi, S. and Ohashi, Y. (1997) PCF1 and PCF2 specifically bind to cis elements in the rice proliferating cell nuclear antigen gene. The Plant Cell, 9, 1607-1619. Kuhlmann, M., Horvay, K., Strathmann, A., Heinekamp, T., Fischer, U., Bottner, S., and Droge-Laser, W. (2003). The alpha-helical D1 domain of the tobacco bZIP transcription factor BZI-1 interacts with the ankyrin-repeat protein ANK1 and is important for BZI-1 function, both in auxin signaling and pathoge n response. The Journal of biological chemistry 278, 8786-8794. Kunze, G., Zipfel, C., Robatzek, S., Niehaus, K., Boller, T., and Felix, G. (2004). The N terminus of bacterial elongation factor Tu elicits innate immunity in Arabidopsis plants. The Plant Cell 16, 3496-3507. Lazarow, P. B. and Fujiki, Y. (1985). Biogenesis of peroxisomes. Annu. Rev. Cell Biol. 1, 489530. Lee, S.W., Han, S.W., Bartley, L.E., and Ronald, P.C. (2006). From the Academy: Colloquium review. Unique characteristics of Xanthomonas oryzae pv. oryzae AvrXa21 and implications for plant innate immunity. Proceedings of the National Academy of Sciences of the United States of America 103, 18395-18400. Lemaitre, B., Reichhart, J.M., and Hoffmann, J.A. (1997). Drosophila host defense: differential induction of antimicrobial peptide genes after infection by various classes of microorganisms. Proceedings of the National Academy of Sciences of the United States of America 94, 14614-14619. Levine A, Tenhaken R, Dixon R, Lamb C (1994). H2O2 from the oxidative burst orchestrates the plant hypersensitive disease resistance response. Cell 79, 583. Li, X., Lin, H., Zhang, W., Zou, Y., Zhang, J., Tang, X., and Zhou, J.M. (2005). Flagellin induces innate immunity in nonhost interactions that is suppressed by Pseudomonas syringae effectors. Proceedings of the National Academy of Sciences of the United States of America 102, 12990-12995. Lim, M.T., and Kunkel, B.N. (2005). The Pseudomonas syringae avrRpt2 gene contributes to virulence on tomato. Mol Plant Microbe Interact 18, 626-633. Lindgren, P.B., Peet, R.C., and Panopoulos, N.J. (1986). Gene cluster of Pseudomonas syringae pv. "phaseolicola" controls pathogenicity of bean plants and hypersensitivity of nonhost plants. Journal of bacteriology 168, 512-522.

PAGE 130

130 Liu, G.Z., Pi, L.Y., Walker, J.C., Ronald, P.C., and Song, W.Y. (2002a). Biochemical characterization of the kinase domain of the rice disease resistance receptor-like kinase XA21. The Journal of biological chemistry 277, 20264-20269. Liu, Y., Schiff, M., Serino, G., Deng, X.W., and Dinesh-Kumar, S.P. (2002b). Role of SCF ubiquitin-ligase and the COP9 signalosome in the N gene-mediated resistance response to Tobacco mosaic virus. The Plant Cell 14, 1483-1496. Liu Y, Michael Schiff, Rajendra Marathe and S. P. Dinesh-Kumar. (2002c). Tobacco Rar1, EDS1 and NPR1/NIM1 like genes are required for N-mediated resistance to tobacco mosaic virus. Plant J. 30, 415. Liu, Y., Burch-Smith, T., Schiff, M., Feng, S., and Dinesh-Kumar, S.P. (2004). Molecular chaperone Hsp90 associates with resistance protein N and its signaling proteins SGT1 and Rar1 to modulate an innate immune response in plants. The Journal of biological chemistry 279, 2101-2108. Lpez-Huertas E, Corpas FJ, Sandalio LM and Del Ro LA. (1999). Characterization of membrane polypeptides from pea leaf peroxisomes involved in superoxide radical generation. Biochem J. 337, 531-6. Lpez-Huertas, E., Sandalio, L. M. and del R!o, L. A. (1995) Plant Physiol. Biochem. 33, 295-302 Mackey, D., Holt, B.F., 3rd, Wiig, A., and Dangl, J.L. (2002). RIN4 interacts with Pseudomonas syringae type III effector molecules and is required for RPM1-mediated resistance in Arabidopsis. Cell 108, 743-754. Mackey, D., Belkhadir, Y., Alonso, J.M., Ecker, J.R., and Dangl, J.L. (2003). Arabidopsis RIN4 is a target of the type III virulence effector AvrRpt2 and modulates RPS2-mediated resistance. Cell 112, 379-389. Martin, G.B., Brommonschenkel, S.H., Chunwongse, J., Frary, A., Ganal, M.W., Spivey, R., Wu, T., Earle, E.D., and Tanksley, S.D. (1993). Map-based cloning of a protein kinase gene conferring disease resistance in tomato. Science 262, 1432-1436. Massague, J. (1998). TGF-beta signal transduction. Annu. Rev. Biochem. 67, 753. Mellersh D G, Foulds I V, Higgins V J and Heath C M. (2002) H2O2 plays different roles in determining penetration failure in three diverse plant-fungal interactions; Plant J. 29, 257 Mew, T.W., A. M. Alvarez, J. E. Leach and J. Swings. (1993). Focus on bacterial blight of rice. Plant Disease 77, 5-12.

PAGE 131

131 Mittler R (2002) Oxidative stress, antioxidants, and stress tolerance. Trends Plant Sci. 7, 405 410. Mou, Z., Fan, W., and Dong, X. (2003). Inducers of plant systemic acquired resistance regulate NPR1 function through redox changes. Cell 113, 935-944. Mucyn, T.S., Clemente, A., Andriotis, V.M., Balmuth, A.L., Oldroyd, G.E., Staskawicz, B.J., and Rathjen, J.P. (2006). The tomato NBARC-LRR protein Prf interacts with Pto kinase in vivo to regulate specific plant immunity. The Plant Cell 18, 2792-2806. Muskett R. Paul, Katherine Kahn, Austin J. Mark, Lisa J. Moisan, Ari Sadanandom, Ken Shirasu, Jonathan D. G. Jones and Parker E. Jane. (2002). Arabidopsis RAR1 Exerts Rate-Limiting Control of R GeneMediated Defenses against Multiple Pathogens. The Plant Cell 14, 979-922. Nishimura, M.T., Stein, M., Hou, B.H., Vogel, J.P., Edwards, H., and Somerville, S.C. (2003). Loss of a callose synthase results in salicylic acid-dependent disease resistance. Science 301, 969-972. Opassiri Rodjana, Busarakum Pomthong, Ta ssanee Onkoksoong, Takashi Akiyama, Asim Esen and James R Ketudat Cairns (2006). Analysis of rice glycosyl hydrolase family 1 and expression of Os4bglu12 -glucosidase. BMC Plant Biology 6, 33. Osakabe, Y., Maruyama, K., Seki, M., Satou, M., Shinozaki, K., and Yamaguchi-Shinozaki, K. (2005). Leucine-rich repeat receptor-like kinase1 is a key membrane-bound regulator of abscisic acid early signaling in Arabidopsis. The Plant Cell 17, 1105-1119. Parker, J.E., Holub, E.B., Frost, L.N., Falk, A., Gunn, N.D., and Daniels, M.J. (1996). Characterization of eds1, a mutation in Arabidopsis suppressing resistance to Peronospora parasitica specified by several different RPP genes. The Plant Cell 8, 20332046. Peck, S.C., Nuhse, T.S., Hess, D., Iglesias, A., Meins, F., and Boller, T. (2001). Directed proteomics identifies a plant-specific protein rapidly phosphorylated in response to bacterial and fungal elicitors. The Plant Cell 13, 1467-1475. Pedley, K.F., and Martin, G.B. (2003). Molecular basis of Pto-mediated resistance to bacterial speck disease in tomato. Annu. Rev. Phytopathol. 41, 215. Pedley, K.F., and Martin, G.B. (2005). Role of mitogen-activated protein kinases in plant immunity. Current opinion in plant biology 8, 541-547. Pratt, W.B., and Toft, D.O. (2003). Regulation of signaling pr otein function and trafficking by the hsp90/hsp70-based chaperone machinery. Experimental biology and medicine 228, 111-133.

PAGE 132

132 Rivas, S., Romeis, T., and Jones, J.D. (2002). The Cf-9 disease resistance protein is present in an approximately 420-kilodalton heteromultimeric membrane-associated complex at one molecule per complex. The Plant Cell 14, 689-702. Robatzek, S., Chinchilla, D., and Boller, T. (2006). Ligand-induced endocytosis of the pattern recognition receptor FLS2 in Arabidopsis. Genes & development 20, 537-542. Rooney, H.C., Van't Klooster, J.W., van der Hoorn, R.A., Joosten, M.H., Jones, J.D., and de Wit, P.J. (2005). Cladosporium Avr2 inhibits tomato Rcr3 protease required for Cf-2dependent disease resistance. Science 308, 1783-1786. Sacksteder, K.A., J.M. Jones, S.T. South, X. Li, Y. Liu, and S.J. Gould. (2000). PEX19 binds multiple peroxisomal membrane proteins, is predominantly cytoplasmic, and is required for peroxisome membrane synthesis. J. Cell Biol. 148, 931. Schlessinger, J. (1993). Trends Biochem. Sci. 18, 273. Schreck, R., Rieber, P., and Baeuerle, P.A. (1991). Reactive oxygen intermediates as apparently widely used messengers in the activation of the NF-kappa B transcription factor and HIV-1. The EMBO journal 10, 2247-2258. Scofield, S.R., Tobias, C.M., Rathjen, J.P., Chang, J.H., Lavelle, D.T., Michelmore, R.W., and Staskawicz, B.J. (1996). Molecular Basis of Gene-for-Gene Specificity in Bacterial Speck Disease of Tomato. Science 274, 2063-2065. Sedgwick, S.G., and Smerdon, S.J. (1999). The ankyrin repeat: a diversity of interactions on a common structural framework. Trends in biochemical sciences 24, 311-316. Shao, F., Golstein, C., Ade, J., Stoutemyer, M., Dixon, J.E., and Innes, R.W. (2003). Cleavage of Arabidopsis PBS1 by a bacterial type III effector. Science 301, 1230-1233. Shen, Y., Sharma, P., da Silva, F.G., and Ronald, P. (2002). The Xanthomonas oryzae pv. lozengeoryzae raxP and raxQ genes encode an ATP sulphurylase and adenosine-5'phosphosulphate kinase that are required for AvrXa21 avirulence activity. Molecular microbiology 44, 37-48. Shirasu, K., Lahaye, T., Tan, M.W., Zhou, F., Azevedo, C., and Schulze-Lefert, P. (1999). A novel class of eukaryotic zinc-binding proteins is required for disease resistance signaling in barley and development in C. elegans. Cell 99, 355-366. Shiu, S.H., Karlowski, W.M., Pan, R., Tzeng, Y.H., Mayer, K.F., and Li, W.H. (2004). Comparative analysis of the receptor-like kinase family in Arabidopsis and rice. The Plant Cell 16, 1220-1234. Sierro, F., Dubois, B., Coste, A., Kaiserlian, D., Kraehenbuhl, J.P., and Sirard, J.C. (2001). Flagellin stimulation of intestinal epithelial cells triggers CCL20-mediated migration of

PAGE 133

133 dendritic cells. Proceedings of the National Acad emy of Sciences of the United States of America 98, 13722-13727. Smith, K.D., Andersen-Nissen, E., Hayashi, F., Strobe, K., Bergman, M.A., Barrett, S.L., Cookson, B.T., and Aderem, A. (2003). Toll-like receptor 5 recognizes a conserved site on flagellin required for protofilament formation and bacterial motility. Nature immunology 4, 1247-1253. Song, W.Y., Pi, L.Y., Wang, G.L., Gardner, J., Holsten, T., and Ronald, P.C. (1997). Evolution of the rice Xa21 disease resistance gene family. The Plant Cell 9, 1279-1287. Song, W.Y., Wang, G.L., Chen, L.L., Kim, H.S., Pi, L.Y., Holsten, T., Gardner, J., Wang, B., Zhai, W.X., Zhu, L.H., Fauquet, C., and Ronald, P. (1995). A receptor kinase-like protein encoded by the rice disease resistance gene, Xa21. Science 270, 1804-1806. Staskawicz, B.J., Mudgett, M.B., Dangl, J.L., and Galan, J.E. (2001). Common and contrasting themes of plant and animal diseases. Science 292, 2285-2289. Strange, R.N., and Scott, P.R. (2005). Plant disease: a threat to global food security. Annual review of phytopathology 43, 83-116. Suarez-Rodriguez, M.C., Adams-Phillips, L., Liu, Y., Wang, H., Su, S.H., Jester, P.J., Zhang, S., Bent, A.F., and Krysan, P.J. (2007). MEKK1 is required for flg22-induced MPK4 activation in Arabidopsis plants. Plant physiology 143, 661-669. Sun, X., Cao, Y., Yang, Z., Xu, C., Li, X., Wang, S., and Zhang, Q. (2004). Xa26, a gene conferring resistance to Xanthomonas oryzae pv. oryzae in rice, encodes an LRR receptor kinase-like protein. Plant J 37, 517-527. Tabak, H. F., Murk, J. L., Braakman, I. and Geuze, H. J. (2003). Peroxisomes start their life in the endoplasmic reticulum. Traffic 4, 512-518. Takahashi A, Casais C, Ichimura K, Shirasu K (2003). HSP90 interacts with RAR1 and SGT1, and is essential for RPS2mediated resistance in Arabidopsis. Proceedings of the National Academy of Sciences of the United States of America 100: 11777. Thanassi David G and Hultgren Scott J. (2000). Multiple pathways allow protein secretion across the bacterial outer membrane. Current Opinion in Cell Biology 12, 420-430. Tornero, P., Merritt, P., Sadanandom, A., Shirasu, K., Innes, R.W., and Dangl, J.L. (2002). RAR1 and NDR1 contribute quantitatively to disease resistance in Arabidopsis, and their relative contributions are dependent on the R gene assayed. The Plant Cell 14, 1005-1015. Underhill, D.M. and Ozinsky, A. (2002) Toll-like receptors: key mediators of microbe detection. Currunt opinion immunology 14, 103.

PAGE 134

134 Vidalain, P.O., Boxem, M., Ge, H., Li, S., and Vidal, M. (2004). Increasing specificity in highthroughput yeast two-hybrid experiments. Methods 32, 363-370. Wang, Y.S., Pi, L.Y., Chen, X., Chakrabarty, P. K., Jiang, J., De Leon, A.L., Liu, G.Z., Li, L., Benny, U., Oard, J., Ronald, P.C., and Song, W.Y. (2006). Rice XA21 binding protein 3 is a ubiquitin ligase required for full Xa21-mediated disease resistance. The Plant Cell 18, 3635-3646. Wang, Z.Y., Seto, H., Fujioka, S., Yoshida, S., and Chory, J. (2001). BRI1 is a critical component of a plasma-membrane receptor for plant steroids. Nature 410, 380-383. Wiermer, M., Feys, B.J., and Parker, J.E. (2005). Plant immunity: the EDS1 regulatory node. Current opinion in plant biology 8, 383-389. Wulf, J., Pascuzzi, P.E., Fahmy, A., Martin, G.B., and Nicholson, L.K. (2004). The solution structure of type III effector protein AvrPto reveals conformational and dynamic features important for plant pathogenesis. Structure 12, 1257-1268. Xiao, S., Brown, S., Patrick, E., Brearley, C. and Turner, J.G. (2003). Enhanced transcription of the Arabidopsis disease resistance genes RPW8.1 and RPW8.2 via a salicylic aciddependent am plification circuit is required for hypersensitive cell death. The Plant Cell 15, 33-45. Xu, W.H., Wang, Y.S., Liu, G.Z., Chen, X., Tinjuangjun, P., Pi, L.Y., and Song, W.Y. (2006). The autophosphorylated Ser686, Thr688, and Ser689 residues in the intracellular juxtamembrane domain of XA21 are implicated in stability control of rice receptor-like kinase. Plant J 45, 740-751. Yan, J., Wang, J., and Zhang, H. (2002). An ankyrin repeat-containing protein plays a role in both disease resistance and antioxidation metabolism. Plant J 29, 193-202. Yoshimura, S., Yamanouchi, U., Katayose, Y., Toki, S., Wang, Z.X., Kono, I., Kurata, N., Yano, M., Iwata, N., and Sasaki, T. (1998). Expression of Xa1, a bacterial blightresistance gene in rice, is induced by bacterial inoculation. Proceedings of the National Academy of Sciences of the United States of America 95, 1663-1668. Yuan, C.X., Lasut, A.L., Wynn, R., Neff, N.T., Hollis, G.F., Ramaker, M.L., Rupar, M.J., Liu, P., and Meade, R. (2003). Purification of Her-2 extracellular domain and identification of its cleavage site. Protein expression and purification 29, 217-222. Zhang, Y., Fan, W., Kinkema, M., Li, X., and Dong, X. (1999). Interaction of NPR1 with basic leucine zipper protein transcription fact ors that bind sequences required for salicylic acid induction of the PR-1 gene. Proceedings of the National Academy of Sciences of the United States of America 96, 6523-6528.

PAGE 135

135 Zhang, H., Wang, J., Allen, R.D., Nickel, U. and Goodman, H.M. (1997). Cloning and expression of an Arabidopsis gene encoding a putative peroxisomal ascorbate peroxidase. Plant Mol. Biol. 34, 967-971. Zhou, J., Y., Loh, T., Bressan R.A. and Martin G.B. (1995). The tomato gene Pti1 encodes a serine/threonine kinase that is phosphorylated by Pto and is involved in the hypersensitive response. Cell 83, 925. Zhu, W., Yang, B., Chittoor, J.M., Johnson, L.B., and White, F.F. (1998). AvrXa10 contains an acidic transcriptional activation domain in the functionally conserved C terminus. Mol Plant Microbe Interact 11, 824-832. Zipfel, C., Robatzek, S., Navarro, L., Oakeley, E.J., Jones, J.D., Felix, G., and Boller, T. (2004). Bacterial disease resistance in Arabidopsis through flagellin perception. Nature 428, 764-767. Zipfel, C., Kunze, G., Chinchilla, D., Caniard, A., Jones, J.D., Boller, T., and Felix, G. (2006). Perception of the bacterial PAMP EF-Tu by the receptor EFR restricts Agrobacterium-mediated transformation. Cell 125, 749-760.

PAGE 136

136 BIOGRAPHICAL SKETCH Yingnan Jiang was born and raised in Baotou, inner Mongolia, China. After com pleting his high school education, he attended Peking University and majored in biology. After receiving his bachelors diploma, he attended the Institute of Botany, Chinese Academy of Science where he majored in cell biology for his masters degree. In 2003, he was accepted into Plant Molecular and Cellular Biology program at the University of Florida for his Ph.D. degree.