<%BANNER%>

The Role of the Wnt Family of Secreted Proteins in Oval & #34;Stem & #34; Cell Based Liver Regeneration

Permanent Link: http://ufdc.ufl.edu/UFE0021298/00001

Material Information

Title: The Role of the Wnt Family of Secreted Proteins in Oval & #34;Stem & #34; Cell Based Liver Regeneration
Physical Description: 1 online resource (122 p.)
Language: english
Creator: Williams, Jennifer M
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2007

Subjects

Subjects / Keywords: 2aaf, hepatectomy, in, liver, oval, partial, shrna, stem, vivo, wnt1
Molecular Cell Biology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: The Wnt/beta-catenin pathway has been shown to be essential in embryogenesis and has been implicated in carcinogenesis. The current study reports novel findings in the Wnt pathway during the rat liver oval 'stem' cell induction protocol of 2-acetylaminofluorene (2AAF) and 70% partial hepatectomy (PHx). Western blot analyses, rt-PCR, RT-PCR, and immunohistochemistry (IHC) were utilized to analyze the involvement of the Wnt family in liver injury and oval cell activation. It was found that Wnt-1, Wnt3, Wnt5a, Frizzled Related Protein 1, Frizzled 5 and Frizzled 7 proteins were predominantly localized in pericentral hepatocytes. Following oval cell proliferation, an increase in Wnt proteins in concordance with the increase in oval cell number was observed. Wnt1 levels message levels peaked during the peak in oval cell numbers, and Wnt1 protein levels as well as beta-catenin protein levels peaked after the increase in oval cell numbers. IHC analysis of beta-catenin demonstrated oval cells with nuclear translocation of beta-catenin throughout the 2AAF/PHx protocol. Hepatic stem cells responded to Wnt3a in culture by exhibiting the same ?-catenin translocation visualized by IHC. Subsequent in vivo exposure to an shRNA construct directed toward Wnt1, inhibited the oval cell based liver regeneration. Without the Wnt1 signal oval cells were unable to differentiate into hepatocytes, lost AFP expression, and underwent atypical ductular hyperplasia that exhibited epithelial metaplasia and mucin production. It is hypothesized that changes in the Wnt pathway during oval cell induction control liver stem cell differentiation through regulation of ?-catenin levels, which is known to induce cell proliferation and target gene expression. Furthermore, changes in Wnt1 levels are required for the efficient regeneration of the liver by oval cells during massive hepatic injury.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Jennifer M Williams.
Thesis: Thesis (Ph.D.)--University of Florida, 2007.
Local: Adviser: Petersen, Bryon E.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2007
System ID: UFE0021298:00001

Permanent Link: http://ufdc.ufl.edu/UFE0021298/00001

Material Information

Title: The Role of the Wnt Family of Secreted Proteins in Oval & #34;Stem & #34; Cell Based Liver Regeneration
Physical Description: 1 online resource (122 p.)
Language: english
Creator: Williams, Jennifer M
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2007

Subjects

Subjects / Keywords: 2aaf, hepatectomy, in, liver, oval, partial, shrna, stem, vivo, wnt1
Molecular Cell Biology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: The Wnt/beta-catenin pathway has been shown to be essential in embryogenesis and has been implicated in carcinogenesis. The current study reports novel findings in the Wnt pathway during the rat liver oval 'stem' cell induction protocol of 2-acetylaminofluorene (2AAF) and 70% partial hepatectomy (PHx). Western blot analyses, rt-PCR, RT-PCR, and immunohistochemistry (IHC) were utilized to analyze the involvement of the Wnt family in liver injury and oval cell activation. It was found that Wnt-1, Wnt3, Wnt5a, Frizzled Related Protein 1, Frizzled 5 and Frizzled 7 proteins were predominantly localized in pericentral hepatocytes. Following oval cell proliferation, an increase in Wnt proteins in concordance with the increase in oval cell number was observed. Wnt1 levels message levels peaked during the peak in oval cell numbers, and Wnt1 protein levels as well as beta-catenin protein levels peaked after the increase in oval cell numbers. IHC analysis of beta-catenin demonstrated oval cells with nuclear translocation of beta-catenin throughout the 2AAF/PHx protocol. Hepatic stem cells responded to Wnt3a in culture by exhibiting the same ?-catenin translocation visualized by IHC. Subsequent in vivo exposure to an shRNA construct directed toward Wnt1, inhibited the oval cell based liver regeneration. Without the Wnt1 signal oval cells were unable to differentiate into hepatocytes, lost AFP expression, and underwent atypical ductular hyperplasia that exhibited epithelial metaplasia and mucin production. It is hypothesized that changes in the Wnt pathway during oval cell induction control liver stem cell differentiation through regulation of ?-catenin levels, which is known to induce cell proliferation and target gene expression. Furthermore, changes in Wnt1 levels are required for the efficient regeneration of the liver by oval cells during massive hepatic injury.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Jennifer M Williams.
Thesis: Thesis (Ph.D.)--University of Florida, 2007.
Local: Adviser: Petersen, Bryon E.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2007
System ID: UFE0021298:00001


This item has the following downloads:


Full Text
xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E20101114_AAAAKZ INGEST_TIME 2010-11-15T03:49:27Z PACKAGE UFE0021298_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES
FILE SIZE 25271604 DFID F20101114_AADQWE ORIGIN DEPOSITOR PATH williams_j_Page_020.tif GLOBAL false PRESERVATION BIT MESSAGE_DIGEST ALGORITHM MD5
ebfa8e8976b6921ebe3974a6eb278d0c
SHA-1
602abcf786e84f47c3f7c6a58003b4fcdbbd6d70
31795 F20101114_AADRAW williams_j_Page_024.pro
f1ee683df735ce8ae0dd5d9cb9ea4e25
404d2617545a24439a707d6e280e7a1a4ee39b80
F20101114_AADQVP williams_j_Page_005.tif
a4c43eea4c2a3dc4bc4eed58419c6c4e
2f33950691f0d18dc633dc4730c171f3a608e5a6
35593 F20101114_AADRBK williams_j_Page_038.pro
e294289abcbc8c3e66579bc514034fdd
52469a619162e6028da9f10d4de4819cb543c826
F20101114_AADQWF williams_j_Page_021.tif
98d8b3d6f95fababef094521d5d4fca8
33e6f30e4edcc8308cae09b2e622397cdeb16140
41447 F20101114_AADRAX williams_j_Page_025.pro
fca4d7aa7076f168dd77e049eb866200
1859492b87315f772cd2c0b47f0e5671aff0d790
F20101114_AADQVQ williams_j_Page_006.tif
0162ccb3f07508a95bca24bda0756dad
75e60e1a5a8a6748d5caf008f56223e48650802f
28088 F20101114_AADRBL williams_j_Page_039.pro
b4d280727a8481f7d8d660c704f2e3cd
5c96fc3bd71192c22d9a4bf9dc494c4034141c59
1053954 F20101114_AADQWG williams_j_Page_022.tif
58e8018dc78a564d79a677ce808f19b5
87bc90c4a55fdd2801bada1bb8d16d298f832c91
51185 F20101114_AADRAY williams_j_Page_026.pro
b05a5372784dcf793f22721171788cbd
833f8c905b97a5ac9dd6756bac20c47f697ae5b4
F20101114_AADQVR williams_j_Page_007.tif
fcce0646a0f3b32581fdfa8f17ea9b6d
ffbec7a1f11f030e71be29be827c5f0f9c98b272
48080 F20101114_AADRCA williams_j_Page_054.pro
82180ec16d63a326ff6a2169d1ed18eb
91440f68e79abadf30d027b498588a68dbaa7d00
53812 F20101114_AADRBM williams_j_Page_040.pro
01f9d1a6dd3331dd12d66f331e6fc762
8281331dabb7dc76eef69db74591b1947dacedba
F20101114_AADQWH williams_j_Page_023.tif
d7530f0cc079ec5d9749a57aa870885a
68a56b882d3023b01ff4eddf8e28215eb9fa1694
F20101114_AADQVS williams_j_Page_008.tif
53ae50082daec3078c82c3e449fabb04
2e809762237a7a89ecddb906357420e5096324a6
52546 F20101114_AADRCB williams_j_Page_055.pro
6f3a89d252581d8521e1dda133905818
bd24e6b0cfba4e28b383099397cdda6e06532377
50325 F20101114_AADRBN williams_j_Page_041.pro
63473a7ff0c49351bfa24728a1b7c074
6c928aabab5096124e2838903e7d2c64153e933b
F20101114_AADQWI williams_j_Page_024.tif
42bb65f6a5c021021126a409c9c2b819
42d8b82e3991cd79dabe2933672dcf925c380aaf
54049 F20101114_AADRAZ williams_j_Page_027.pro
09b1ede77d02af73b097aefe949e3f03
ece2780efd5e76c5dab9691325b7654fd9a6df61
F20101114_AADQVT williams_j_Page_009.tif
3ba8590b33adf7ec437dc7003f7e2999
e3ecbf1bdb4b620f142f2d4ee68ae8b7867423cb
51239 F20101114_AADRCC williams_j_Page_056.pro
0009dcbdc3763e781cdd1cef6c6b310c
74b86a7743f9074d3ef0ec35dc7e709a5a3635fb
53291 F20101114_AADRBO williams_j_Page_042.pro
048a5b0400b454d4251c41ddbb96bac1
6fd7404fe52dbdd1a29d26953d097952e942084f
F20101114_AADQWJ williams_j_Page_025.tif
daae2ffd1efafc6b62301839ae05ddb6
d20e8c30feba5c1fca2cd97190007841f16d28c4
F20101114_AADQVU williams_j_Page_010.tif
491dcea38e2eca001356241bce278fcc
9edaaddd1e194a8c2257b1653a84f0fa67ca60a8
50828 F20101114_AADRCD williams_j_Page_057.pro
e225b4f0b85cda3712363ffb31179319
043b3427d782f0c3f1b66499328ec31f0ab4362b
53769 F20101114_AADRBP williams_j_Page_043.pro
69b8112c7c058099badedfcf7fdb50fe
4465a113507fd49ddbf39e72e5edb730101a0813
F20101114_AADQWK williams_j_Page_026.tif
63ebecef12c72a108c5eed68ecd05291
9c8e5b62640da452c213a583d3cc5182f8041b09
F20101114_AADQVV williams_j_Page_011.tif
22638316da8bc1e88a98380b2ac266b7
22546483b43ef6c5d2d151a154a028a8a27fdf2d
50173 F20101114_AADRCE williams_j_Page_058.pro
c40701cd60d1a0f9d81c666584222900
4fe50a0d95f807d7355dc2b0a4404bb45c9fb6f6
56999 F20101114_AADRBQ williams_j_Page_044.pro
a132b34bd60641f127334c024b486735
9e3037bb9add9fad2ef5c495e74f6affa4f6bc49
F20101114_AADQWL williams_j_Page_027.tif
8a6a046dcabdc77989dad0b967766299
b0b8b89a6dcfb92a0e7dc4a7641c4bd6e2cd7424
F20101114_AADQVW williams_j_Page_012.tif
d79398744c509a1d91823558863743c5
ec058d11beadf463eceb4e94edb30663621526f9
48377 F20101114_AADRCF williams_j_Page_059.pro
8efda955ebc77489922aca64ebf7732a
d2281b8f40836ab4274bd84622660dfa12ef2225
53569 F20101114_AADRBR williams_j_Page_045.pro
a2bc5a2e281e8ef1007ea47f686a7b37
c398dc22d01e39d549ede65cf815a16d20070fa4
F20101114_AADQWM williams_j_Page_028.tif
85afbda09858dd06671ce048aa82a957
64154de13c53d283533870f0ba93858e1dd1f1bc
F20101114_AADQVX williams_j_Page_013.tif
fe8b7257a5b1ffe1567393ce54c6b6ee
53ae6140936e6b277860473fd893b20848d38bdc
56105 F20101114_AADRCG williams_j_Page_060.pro
1dd067c75c01330d76c9181dbca77278
6f506152a3f9ee8e0e439a5e22e1aab68efd19ff
F20101114_AADQXA williams_j_Page_043.tif
90311ac617b5f96f13afd63460a6853a
302376fadd4eeedc32a213966c77cf6d7eab52a0
55448 F20101114_AADRBS williams_j_Page_046.pro
fcafccaf0cb20f1fa9c8b2cfa7f9a318
6d70343a6c91138c945120b0a7929f4282641481
F20101114_AADQWN williams_j_Page_029.tif
a4a2459d8626cbeec99948666b2f410a
dcc8daa1d2cd75dde13dd6ee8c0bd46f668f6426
F20101114_AADQVY williams_j_Page_014.tif
c20b4e598eee975b0846275aa52b396f
a85dda9810f924a48f499027af42fc0674744194
53430 F20101114_AADRCH williams_j_Page_061.pro
3d18f2342585eca27d96acb89030d976
d56bd86cfdcc8c3f1133996c6d6f6a26e3ce38e2
F20101114_AADQXB williams_j_Page_044.tif
44aef96b213756ccb870b2a5ebd969dc
7047ac0e58c0da507c054a0a100be1913f85eb37
47517 F20101114_AADRBT williams_j_Page_047.pro
7d54cd3621f47dd06f71a5f3ab416385
28981dc998b8c66d739cdf9ba8d9ff945eed13f7
F20101114_AADQWO williams_j_Page_030.tif
4fcf1ad65ff4dcbed5c559e79664efe8
cf94550aa3f0bebe8615ca06338afa070e475a2c
F20101114_AADQVZ williams_j_Page_015.tif
7498e94099ba60ddfafb76b9c99592a6
5b15f79374d1668dfdd541960a3d284613fa1a14
50403 F20101114_AADRCI williams_j_Page_062.pro
afb10edad445cd84385eacfebc8764dc
b87f77882d6523ec1bda6688207afcc2d481f96c
F20101114_AADQXC williams_j_Page_045.tif
294128945363ab6809b786be5a536142
af8ac625edae4fa952c6648372fab4a5fe572da9
56217 F20101114_AADRBU williams_j_Page_048.pro
3a8d2b5d5aebeb632ed26a08e9ccf14a
aec315e1cf10570c4e04ac04036b72d6793f7f25
F20101114_AADQWP williams_j_Page_032.tif
ebbce0992d561502e8ab2f3cb72af661
e716d90e7ac371ce9c5c5ee4815a4901a9df07b1
45346 F20101114_AADRCJ williams_j_Page_063.pro
93706272e057760e31b822645e238586
dd15567665d29b74aff9877848cf25b52a185a88
F20101114_AADQXD williams_j_Page_046.tif
36b0915eccae134ab8329de8a9eb69cd
d3f07e61321316e2f0f9892cb9ad30b792e4ac11
55082 F20101114_AADRBV williams_j_Page_049.pro
f442d9213b97d2f174a5f0d408facae5
1282f35f064cb67bf527820e05bb3a490d4c98fa
52816 F20101114_AADRCK williams_j_Page_064.pro
935327d3b1ea7c600c7e44c235b7da7f
544d5ea9b9e6d5b22663cd1c61655a9ebbbf883a
F20101114_AADQXE williams_j_Page_047.tif
0d8b701eb18c8d1973c9478847c851cd
b5bfa21afbe52ad3f9512f6aab6ad95c4da0a01d
45147 F20101114_AADRBW williams_j_Page_050.pro
1723c7aee4dd1482dc83f8195a3949ac
533415efb75c14fb9f2e1fafc6a6e05e0de47bf0
F20101114_AADQWQ williams_j_Page_033.tif
d4ce4c72a49ab26f61a97286aa1ee656
37fb0d56406d640afa5622e5ec1fea698a3a2303
26566 F20101114_AADRCL williams_j_Page_065.pro
f6a35a8b051c164fed930417e894c421
7f47643c5486a86fa775c48aaf0b0c4fcec46a23
F20101114_AADQXF williams_j_Page_048.tif
36e938206506de4df07671a06be9d207
6c1adff975bfb0d8c94524853a0cb777795a0bb6
50553 F20101114_AADRBX williams_j_Page_051.pro
6494303f30d02f2f3d6a0821be378ce6
eb8ed3904ace361dd14ee8afd6455422cb1439c2
F20101114_AADQWR williams_j_Page_034.tif
e9dd90a5c201c53f23deeab2ec013f4c
7c5cf4f2c551b138915769071bb791081cf75621
44416 F20101114_AADRDA williams_j_Page_080.pro
edaadb18a37bcdf7e54eeae5e44042e0
877557d3c2311052e8a5450e7a6a8eeb71419d6d
37970 F20101114_AADRCM williams_j_Page_066.pro
27a5ef97ad50d8fb53bee324cb3568c9
3c3b6b5c2a6530adc5ccdc4543b2641dfccce593
F20101114_AADQXG williams_j_Page_049.tif
76237109a3a5496f72938323c4b8ea28
3c9c3ce229d9d3eebbc48f90db479271677d0eb1
54916 F20101114_AADRBY williams_j_Page_052.pro
405648a1ce4acacee9f9ca1a487e300b
1b889fea9e10bdb90a8448e36e766b5192ab80d2
F20101114_AADQWS williams_j_Page_035.tif
c97b63b58d65716cb2319377976d79a6
d97a3e547fd8d168db350ced4c8a46b42ad59932
22424 F20101114_AADRDB williams_j_Page_081.pro
ad2e9f978de8d83e0e91cf55a0b5245e
9ec379fd4de0045e38192ebf3b44672153027f08
52255 F20101114_AADRCN williams_j_Page_067.pro
61e776371871e5e7e66efa585cfff4c7
02454bc2e59e114146ebd6d5c0680ed8838eb787
F20101114_AADQXH williams_j_Page_050.tif
ffb5fbf7a14800d983812955888670a8
f61a161bf55d161d3c1d8b624bbbbb7c38e4b966
9795 F20101114_AADRBZ williams_j_Page_053.pro
0a8f7823fe742ca3c2b57007a89ff2d8
8fd4d97fd855cf844df07d5c80fa843d2d37b722
F20101114_AADQWT williams_j_Page_036.tif
d21f1b2005b64b2a5522a76fd196a23f
7cee62cdfb915982d9d2793da2f39ac9bff22cb9
14612 F20101114_AADRDC williams_j_Page_082.pro
3277090d75ae9cc4c28e68fad53d7ee4
fb2b4894732bd2baa4aec01549f3fe67dc7c01d6
42059 F20101114_AADRCO williams_j_Page_068.pro
6cad38660764922afc31543ac36418de
4de933e8f6d5de797f49a3da51ec00f1b42d5701
F20101114_AADQXI williams_j_Page_051.tif
ceaef444b6c4f58938d3e8924025e9a5
bd423200ea40832ccbe6c8d98b5bc751ae8f3a68
F20101114_AADQWU williams_j_Page_037.tif
a0922965ad4faf0f3ddba4149377e0f7
17aaaf9e8bb9595c3f75d6d583cda7bf61c3b1e5
31769 F20101114_AADRDD williams_j_Page_083.pro
2312655a420f1b4eaedcebceb82ead21
48b520b9ea79771bfb86a0c058fe5c3ea12c4dc7
38440 F20101114_AADRCP williams_j_Page_069.pro
90d7f15130681fe6a8c5ae401ff9d8b8
b8daf634c5c58bfa97c7372bb39e53002ef5e667
F20101114_AADQXJ williams_j_Page_052.tif
38a06e66eeb81bec22d13f340346e625
dee443d8793d0de5cd97c8eb2c641e5e2aa97652
F20101114_AADQWV williams_j_Page_038.tif
195cb35cdf40cbb9164d5045aae0b76a
c13e32796a623d7c94ec40977a672fa205fabd80
24581 F20101114_AADRDE williams_j_Page_084.pro
72166d5e0dab0e4f3e2e282edcff43ec
1d7c7cdda0f5eb90e65f6378cff137c5d90c4c6a
52118 F20101114_AADRCQ williams_j_Page_070.pro
ba7c8d1d0dacdca03cc5e026ba9da9f9
54e9dec25157eb5c5ce17cb6b185b6deb2d727ba
F20101114_AADQXK williams_j_Page_053.tif
c0f6c870e55fbc987679b99fdfddf853
38b698f85bf712c53c224c0d3ffb61fec417076d
F20101114_AADQWW williams_j_Page_039.tif
957dd2d71f0097cb0df4b459878ceeb4
9b6814e1f3a77a4cabfe9b56ab9a52d27d152d4a
28336 F20101114_AADRDF williams_j_Page_085.pro
88664b3c459a0681d64c6f3f717f062c
fa1126c9f7084757befebadd76eb005340c13e8e
49561 F20101114_AADRCR williams_j_Page_071.pro
25b8cc414216b4062562b5b378abb2d1
d4c7a6941bce3abd1dfde8bb20d36770d99d961d
F20101114_AADQXL williams_j_Page_054.tif
9959079d0062e25a13348d7843ea2eae
2f3acd30429bc5144222d735ac0da040273eb418
F20101114_AADQWX williams_j_Page_040.tif
ff00f3a0343d62967d4b1ba39c70a275
93df6437a0a27443814674bcafbd5f973c30118a
29559 F20101114_AADRDG williams_j_Page_086.pro
0ecbfbd038312ede52bafd955d493574
a1633ba41c0e538d36e089626c59e07f5e5aa866
F20101114_AADQYA williams_j_Page_070.tif
518b776c8eacc24b6f89a4ccab38c798
d1f82f8374bd6a2c9c361109200c401a55f5a15f
49970 F20101114_AADRCS williams_j_Page_072.pro
6da51d4e9a8342aa39efd020240c9dd1
547da262fd8cba66619d384fa3dcc8fd50849053
F20101114_AADQXM williams_j_Page_055.tif
a275bee55f6fb1aacc7494d31b54c636
5634f858e45de668bfe4aa49dba1c367dd4c6ecd
F20101114_AADQWY williams_j_Page_041.tif
c15726d00307a23a3de0fffc9d89247d
49c9fabc496084cd31e22fc858cabaa31c9a1f0d
39354 F20101114_AADRDH williams_j_Page_087.pro
37a89d3419428ca181127ff36b5355d5
011455369a4af1c6c9dea3bb8c5ff540f4f17b1a
F20101114_AADQYB williams_j_Page_071.tif
773def8c350e791d92264187925ccc01
4107222d4426655f1928f3037595143ff2b3d9cf
48022 F20101114_AADRCT williams_j_Page_073.pro
4d62e0eabb1b8b228c6851b82c8a5d2a
22d6d5fb2d9570127057ebb27fb54cfbfde7c23f
F20101114_AADQXN williams_j_Page_056.tif
edebc3f86282a180b4944c6b2821eb9d
cff52f6a72e82c081d873374163c472bed50e997
F20101114_AADQWZ williams_j_Page_042.tif
799cf942337479ef703318c277a98c86
f15e27d190dc0f4ae4f9ec634cd711f07c0e5862
42581 F20101114_AADRDI williams_j_Page_088.pro
c1acf05f9d443e34b3647af50aad34c6
052096fd4b8ed45711cd1ae49d2db43429f87e9c
F20101114_AADQYC williams_j_Page_072.tif
6ecd3793bef45bf2b43d3e2db7e7b64c
6e3447ca60f5cdcbcd3f57d572883962294fd8b9
46504 F20101114_AADRCU williams_j_Page_074.pro
6ad8577a086d99f1c6b51d62b66349d1
79e3e321da67508033d570c9abb277a8da6ecc34
F20101114_AADQXO williams_j_Page_057.tif
50b11eb7836788577b996ebd3896dac6
80adcac5395f0733665a37c0054d4c2bbeb375ac
37528 F20101114_AADRDJ williams_j_Page_089.pro
d03943f335c164dd0b016db306d0c13e
5187e62159fe57eacf9d48b81ac6c5a81ca2e3ad
F20101114_AADQYD williams_j_Page_073.tif
974f06e9a0d616198475e86b96a7792f
37fa62806b43b29813adc99f6a68e96c222b912f
48154 F20101114_AADRCV williams_j_Page_075.pro
67c1cf0dbe6bd55f6e8381d3a68f78c2
7eedfaae72f8a74013ac74473fd531259c4097b6
F20101114_AADQXP williams_j_Page_058.tif
682b4002bf4403c649c07e059d7a2f74
ee24bf73fd6e93fd290269dd3eaa08d84e693eb4
22472 F20101114_AADRDK williams_j_Page_090.pro
79bd2e34cc75532745eae5440cf9c4c9
531bf82ffe7dc61c905438cecaade52b3c2061e4
F20101114_AADQYE williams_j_Page_074.tif
2bbd1d4fc37a69b9b8937538ad10524c
06ee312f6bcbf80e4f37e9a6152a1e17bbd864b0
40540 F20101114_AADRCW williams_j_Page_076.pro
6dde046e6f569728963fadd6438b1c55
586fac288df443d11b70c32d5de1520a531c496b
F20101114_AADQXQ williams_j_Page_059.tif
a67bde106c759faee83f161383ac04a8
dbacccb2f3e1f783cca3fb48c887d32282546bae
22864 F20101114_AADRDL williams_j_Page_091.pro
8d8ae43aa6e3cc2cf80cff7448ec48c9
acaa059890b14599e648f9bcacb66db6532573eb
F20101114_AADQYF williams_j_Page_075.tif
cac350fecb10801d81904ebac0141cea
f5c205e276ea2e3cf08852a6ca2270818c798f04
48798 F20101114_AADRCX williams_j_Page_077.pro
8b71f3edcd68a5f5e618fa33d4b978c9
77124db1dd0d5c7dc4d754206262f0fcdca35899
37542 F20101114_AADRDM williams_j_Page_092.pro
5f09c008badaa3aea983a2fcce17abe8
eda702fa57aac8ecf69556adf4fc3eb5bf7e0361
F20101114_AADQYG williams_j_Page_076.tif
c4b04829a2517149d03d841a39274619
847ee2b0393c52f32d874f69a98ea26a1cb77347
41986 F20101114_AADRCY williams_j_Page_078.pro
b99cfa1f5d07162441e14fa96fa8a5cf
1c29b2999838ab81eb96f25dcaae2194c491a9d4
F20101114_AADQXR williams_j_Page_060.tif
1b407800607723d4117d2bdb872655ba
6736cb1840177184e47a42b9598bda9fe7e193b1
51721 F20101114_AADREA williams_j_Page_106.pro
9d8d20edd292ac437b16ae64ad3f26f8
d5969bf822c43053eb2ae128673e99d8334ba9eb
30342 F20101114_AADRDN williams_j_Page_093.pro
ea22d0b79f350c0562e73ae67db5220e
986750176c8be53c6158c759236cbe09e7e99fc8
F20101114_AADQYH williams_j_Page_077.tif
9358abb7cc9fc020f018f660745ed8dc
86327ea234f8f0a7a00e6b664907ecfdcff73ef6
45003 F20101114_AADRCZ williams_j_Page_079.pro
bde3a732f82ca1a848279613fa3f5573
7a7aaf76584e38ff022360fd3d3cd502e28098b1
F20101114_AADQXS williams_j_Page_061.tif
dbbdc7262c806edb035c375c36403f4c
c35380f97eeadfb215308896735f2134b1cd4602
F20101114_AADREB williams_j_Page_107.pro
92db868ea9ef48c4d2d3c33c3a5fa1c9
1971f71aac26fe12779afee52d64e006bdc781e7
33822 F20101114_AADRDO williams_j_Page_094.pro
04934ff4c8cfdd230f248be87c709fb4
6c6a1b787b5bdbe5e18ecd38c61c34b42f4fcfea
F20101114_AADQYI williams_j_Page_078.tif
6d185e45216dc13d526fdf23292a8dd3
73a9e4026376cc36b8bc87ea24bbc30e87bce7cd
F20101114_AADQXT williams_j_Page_062.tif
80a6cb7b95a4f9c6160969844b5b28b9
f77f0531dacd2d6d0a1dfe98724c4d56316f9391
9275 F20101114_AADREC williams_j_Page_108.pro
06cf08325b5506e0c33d0a5fa070b6c2
c37ab2939b3b37c1ea278c5604585178f3f556f3
48699 F20101114_AADRDP williams_j_Page_095.pro
83b7b0e494e6cf29506bda4df176dec4
2fcc8b3318d5d4c4348e360fc838e3ef64682b0d
F20101114_AADQYJ williams_j_Page_079.tif
11da0415b7b2fb257c39b748425ee81c
6ec31404f21b154d58de7301779ec9696ba8541b
F20101114_AADQXU williams_j_Page_063.tif
85301edd0b5be3b411bfda4a9f504e0c
9e546a33a17c07d646fe7578fe78a74adaa6f82e
61347 F20101114_AADRED williams_j_Page_109.pro
e26685921f8332fe0ded74c97db6512c
d96c39ba4c3ae348dc419200898dc077654d3cc4
46478 F20101114_AADRDQ williams_j_Page_096.pro
862ae13689c93172f6d14e4d31ca95a8
bece437e1580a2a3820e1618a84e3dc862121767
F20101114_AADQYK williams_j_Page_080.tif
5989bb19d43a836aa9785396ca3af9f5
a5dfa1028eaed5cba64d099af647672e35c9cc12
F20101114_AADQXV williams_j_Page_064.tif
e7b47990d8eed24eaf95a6400f5c1545
208af564b9b0cc28e82b999cb238babf5f9b3dd7
61066 F20101114_AADREE williams_j_Page_110.pro
5490e179d8ff1d6238b7ff06f4a50d1d
f291cde25c99b5a2a6d37cec7ac19ce76aee5839
30620 F20101114_AADRDR williams_j_Page_097.pro
44cc6436e6322ca62539cae7da9efae2
479a9f3cbdee57aa310617740c45d651a44d5b6a
F20101114_AADQYL williams_j_Page_081.tif
c22fc18b9b99c9e5b42520bb89a0f121
b9c576e5e83baa384b9df62dea78d705e82d26cc
F20101114_AADQXW williams_j_Page_065.tif
e69862db3d41e761fe4cab8642aad801
86c356a1f006564feb570852f79d67f2a5cc4e72
63448 F20101114_AADREF williams_j_Page_111.pro
b2c239f701d02b84a25cd201e35e2a62
6c7224f5e2cae531a84abf32b23dbf0a1f177772
F20101114_AADQZA williams_j_Page_096.tif
66306dbc19cbb18c3b13f333096680ef
80ec083feec49a1a7bc28f0c40e22d11122bbd80
41931 F20101114_AADRDS williams_j_Page_098.pro
4b2726a87f7067f4a1d9e8f717230b2c
079d4afab8505cff52de446e5893daca3266ff09
F20101114_AADQYM williams_j_Page_082.tif
9d07403f89fca8a6665e800071c04d29
3ba0e41c0af945dde0a28f3557c6d7f24647dee0
F20101114_AADQXX williams_j_Page_066.tif
6b95c89d7a88588945243cd6db7a3645
06ee99f904a2343cbdd4ce4bfc1cd8ef22db3910
66396 F20101114_AADREG williams_j_Page_112.pro
a4db399bfa90868ab8736079fdc9c4b1
97af26d5fc67c6b1803b1c36a6ab9c706c6c245f
F20101114_AADQZB williams_j_Page_097.tif
30c9a1082f2ad81aa4421f7bdc9baeb3
b8d056c808dd2aa7ef70657ba3a5a15b2bebdec5
6659 F20101114_AADRDT williams_j_Page_099.pro
a0d0821120706ee6c9ae3f4bd161c983
3dad5d66ff45bfe70e271f2f2c616b58a14c7be2
F20101114_AADQYN williams_j_Page_083.tif
74ef664b47196b285ceddf29ebaded16
49f02fbe4ee107fa2bd21c6378eeb5982bfe6d78
F20101114_AADQXY williams_j_Page_067.tif
9d8bfed8cc84ee0930c83770c31f34be
27475d8dc1815b3da1bf05f477739383b6e2513e
57794 F20101114_AADREH williams_j_Page_113.pro
7b697200d52dcfc1beacd4e6ab8739b2
4a4385aa3a2839cea9c7c0bbc1a4f575689299bf
F20101114_AADQZC williams_j_Page_098.tif
0f3063e06adfaba52c591a6c0fca28e9
e9e354e46ced99b8850b30276b11cf6c9324830b
54443 F20101114_AADRDU williams_j_Page_100.pro
a51b2d24b29fb9bd91f040632631e9eb
424bb8cf395893c54761ac0f3e82592d15a1f6ba
F20101114_AADQYO williams_j_Page_084.tif
6e1b101912b9f1c75b02b6b62579da8a
345946beeb7ebf9f1cd9256cd16033c140d28550
F20101114_AADQXZ williams_j_Page_069.tif
14d3cdc7307f091eac0f680a8ea48e21
f34ec7e40fbf01d97c0d0ae107c0847c2532bd88
64855 F20101114_AADREI williams_j_Page_114.pro
603aeea38f97453e0f25419d2f8f0290
ea0e749d1688c5dcddab84b00cbb9cacb5992806
F20101114_AADQZD williams_j_Page_099.tif
95c03ee9e010777efc6e7a86e575b771
be5cfe000a2c781282252698899b190b1295319d
48006 F20101114_AADRDV williams_j_Page_101.pro
4865d07cb88190b3aa116bd08a959d15
cf7874b0f865c56b90023cb5ee1c7959783bba3f
F20101114_AADQYP williams_j_Page_085.tif
ca830ea269085431be4cdcd7678e319e
b81a16382b5bbf53c9381bc9bf3157a3f4088a53
65550 F20101114_AADREJ williams_j_Page_115.pro
90d24a106ada00652a004c3d50c2be04
f7a1603f06bb2378835be205af59f6738f10886a
F20101114_AADQZE williams_j_Page_100.tif
b6b62af5d00c78f1a595c3b6b3da45aa
41e64f122fa449e7a1f294a71f28c27a872540b4
50125 F20101114_AADRDW williams_j_Page_102.pro
f0104ff5d64bd5d698d0774d2da8f4a0
e6cc5ea22a33aa363a18acb35bfcd85f32fc2ec5
F20101114_AADQYQ williams_j_Page_086.tif
ae90ada30adb9b78ac421161537531d2
19f9ce829c09e92673e3064ec50add729d6ba65c
62671 F20101114_AADREK williams_j_Page_117.pro
8ddc75c7195e28d87ce1629621407bc9
1be5f82fe807663f58efbbb5ca1657d6d61ea039
56475 F20101114_AADRDX williams_j_Page_103.pro
566e7d11bc590d554dd3312c6a1cfd62
c21922758ffc999be7d1d14b682ae50dc89faa19
F20101114_AADQYR williams_j_Page_087.tif
564523d987cbf109db8cc4effb111df7
b84bcfded6bb61fa5613ed6e5285e9743fb2998f
59481 F20101114_AADREL williams_j_Page_118.pro
e0647cba9976f425625609a13e80e87d
a19b0b13056e8aaa21d287c3c667795fb9d18b09
F20101114_AADQZF williams_j_Page_101.tif
6de0c1f93d2711e3e337992ef05714fd
f1ede2a29f53ce01deae71deab3e2c716529da95
53177 F20101114_AADRDY williams_j_Page_104.pro
b6e257b45341473113442a3159d3096f
59497ae50f0d3448626be60fd836dd66decef931
1112 F20101114_AADRFA williams_j_Page_011.txt
c21c1952c1f58924696c234e7061c7a6
4c7e0e9928a53b8b60c97357b06eeaa0ce0f587b
64579 F20101114_AADREM williams_j_Page_119.pro
4781f338eeb41b2147ea7164c9d86e8a
079ea70304bfe81690cdc3150d69cd7b2ec658ee
F20101114_AADQZG williams_j_Page_102.tif
af4ffe820cad4b90668edcfae3750e80
cfdd0e2eaf338a6fa8438761382b4d67cdb3e1cb
56821 F20101114_AADRDZ williams_j_Page_105.pro
f7319f446b101f130356e844fdbc62f1
0ff6f0750d3b2fd79aff5c17b4aaf5091cf3919a
F20101114_AADQYS williams_j_Page_088.tif
a109af75cd9aadc6dfc761c3cc85937d
1afb1ba8bc3f50044a1cfb32042f424e7485e158
681 F20101114_AADRFB williams_j_Page_012.txt
98134e7632451b390a492550a78e2208
ba8314c9dc2de55b3b1bee7a21ac53d0667802d3
54429 F20101114_AADREN williams_j_Page_120.pro
956a1b4d83a44df50807d69cc8b79dcd
285f049e4e037b6677e6908a1c1a297256f24080
F20101114_AADQZH williams_j_Page_103.tif
2c3e0a2354937753aa1dc180bf7b2aed
95e935dddec2d9acb7de8a0a42251af4b7440d40
F20101114_AADQYT williams_j_Page_089.tif
554cdfcbe715d3fdd45f738a6f7c9310
00bbb10d30d5341ec4394d117ce334dd9caa5376
429 F20101114_AADRFC williams_j_Page_013.txt
80c1639d381ee44638ccad89411f4ad4
5ade09744d4834676fab4e8892a2a818bba2ac73
50138 F20101114_AADREO williams_j_Page_121.pro
4dd46a677fd8ba92c99752d229f89afc
867f0f25f8e47c86fc1f119ebae4f528eeccd910
F20101114_AADQZI williams_j_Page_104.tif
50122064fa2bd57fddbb8fac55b66a90
94b29cbb0437bdea4443770fbfd6fd61c19dbbaf
F20101114_AADQYU williams_j_Page_090.tif
0a0fb0decdf06b6fce6165476e38fddc
5bef17e7e9667e00aaa52bc7db85be9455ec9096
2034 F20101114_AADRFD williams_j_Page_014.txt
f7d3958c2ecd44c0179a092b8046f099
af4df6c77dea5c616467f2902cf21c3bd39bcc1f
20569 F20101114_AADREP williams_j_Page_122.pro
f43e7d6e1861573baae4c9408103f2ab
b18388f05fb2c8f9c7d2707339057194eb337ccf
F20101114_AADQZJ williams_j_Page_105.tif
93e805a1b3f581cf23b6e93986c8ffa7
c624a1acceb7b5c41f3c05142bb0d190e9c696c1
F20101114_AADQYV williams_j_Page_091.tif
028ac352f576ca584545c91f93189eb5
c2a31f4ed12b860e6fca8c615911091d8e2cb748
542 F20101114_AADRFE williams_j_Page_015.txt
d8a10d65612a271b8f93ffada0244d4e
dd6f888b54f25f66e9c7dda893712b0fc0d800d6
470 F20101114_AADREQ williams_j_Page_001.txt
26c5ce940efd393f01a5174cdb33e0c1
2a23b60e7cd39559b12274420d3df66762334ac5
F20101114_AADQZK williams_j_Page_106.tif
3a3c05cf36dd841cfa1a606388985441
383bcad4472e9767620115ec15b3eb5693c09dd1
F20101114_AADQYW williams_j_Page_092.tif
c28f3ac62d55611344f2a9b2bb5ed2af
96c8c627df4f0d61e425b311464336cb089441a6
2227 F20101114_AADRFF williams_j_Page_016.txt
0cb7fbf5effa932aa41b0be2eff71bb9
eff249639372ae1f35b17b65e33665182ea154f7
100 F20101114_AADRER williams_j_Page_002.txt
efe777d8ba695cfc52dd045723f6cb24
c7afd5b25e0a42bb4805941981eb026eab6520f4
F20101114_AADQZL williams_j_Page_107.tif
7086787e15bb78b9a24d1da30337d4cc
dbe838ffb00e68b870482e18f94eed29f391e72a
F20101114_AADQYX williams_j_Page_093.tif
b2cf6cf95391a4f7c2e9b3b717f8cf2c
85142b4fb1c19a0b2880c843b996144d4d8e450a
2063 F20101114_AADRFG williams_j_Page_017.txt
bb4412e785411f07579c1c5d93719f6e
a0ecb516ade3127a193ed673edbc7aa0ff914933
104 F20101114_AADRES williams_j_Page_003.txt
9362b45b7a90eb1dd0a8f58da2f612a8
a8cd4de7c964ea718fe3ec69e1779e3f1a299954
F20101114_AADQZM williams_j_Page_108.tif
60a36a36bd06cde2e067eebdd2abab7d
58bd3bd97139f49a6864642d96b3ddc7a1931b83
F20101114_AADQYY williams_j_Page_094.tif
cecf7fd8fcb8eb71ceb1dd2f0299d64a
6dfe128175ac1277ceb94147a07185b4667816ef
1042 F20101114_AADRFH williams_j_Page_018.txt
6b38e6501bd183a5119244827f2a3467
117a5f8bb262970b55986d4cc96525fc85998cba
1519 F20101114_AADRET williams_j_Page_004.txt
6302148019b41680e09609c502dacbef
10e5e2989577bfb9df0839759142564a14b014b5
F20101114_AADQZN williams_j_Page_109.tif
a83451d5b1c97cfa7a391d9ac3ce0e3f
9f25a41f1f3f1ec923d3f7eaa0729dfad0477a10
F20101114_AADQYZ williams_j_Page_095.tif
7e58ddbf5c06512ec721fec496cf617c
f04a4d774f874a8a5efe744d5a5bf6b4ae897e1c
893 F20101114_AADRFI williams_j_Page_019.txt
6208c13c20c72644db7cb01be15fbe1a
73bd49cd3caec12833c465c8eb76ea3da7ae284a
3763 F20101114_AADREU williams_j_Page_005.txt
7fdc70d4926036bf387d76bb579a2871
eb6e23ca20529fa596255e26a43f17d40005b34b
F20101114_AADQZO williams_j_Page_110.tif
30602fe641da10bf6f089fb7529376ac
06c380bc2561684ab9dcc11b15f95c01681c141b
2204 F20101114_AADRFJ williams_j_Page_020.txt
1fbaa17313df15f847d5bc435f6a0c2c
fd8baaf718f3f164c5db89af1d3d187226bd752f
4363 F20101114_AADREV williams_j_Page_006.txt
c992d654ed08030d021f43eb216ac374
fc27530c37a88d1e8fcdc083e5aeea4b0bf7cec8
F20101114_AADQZP williams_j_Page_111.tif
e34233c0a3e0500b136659992f6c03e3
bf56cc6acbd2f125a6dd2729cd71e195c99c29b5
1905 F20101114_AADRFK williams_j_Page_021.txt
93d0b9b61beb50d8a57505efb3d67c5b
4bff54f6f12749dccc19e5c1afcf1a5838baaba7
4255 F20101114_AADREW williams_j_Page_007.txt
27ba4e89ba151c026b01528aed9db499
711fa544317be37ab852937b8780b8eb93b9b6c6
F20101114_AADQZQ williams_j_Page_112.tif
83f9eb86304f15f4dc8a6092e3e8bf37
9cc62dfb88e52fbd45ad7acc3b0d17b88b731b1f
2086 F20101114_AADRFL williams_j_Page_022.txt
3a7e48c5be349131c6a801aaaa945e37
38789921018259fc5b336a62770a6b379b8f1b81
863 F20101114_AADREX williams_j_Page_008.txt
7fcfb61dc530d3447d844a03a4143d51
1451800f315fe7496d897278b2396234ee624c2c
F20101114_AADQZR williams_j_Page_113.tif
e3634d41f8d88a2418ed59f07d95f398
f0e82a49457c3d09dd0e295d0f6bf4d590923e89
1502 F20101114_AADRGA williams_j_Page_037.txt
6503fdbbc966f1d7e599f12cdf854336
cabf4fef8fdbca9496429e276884936e66004ea8
1966 F20101114_AADRFM williams_j_Page_023.txt
5acbd752b2aeee39e45702d571bde7bb
4dd69bc140e5aedcb74d801d66ed858710a40e21
445 F20101114_AADREY williams_j_Page_009.txt
eecaaea77563342db75c0e17c7ae51c1
02a1a762a03dd72c170016d91d90db52a4fdb633
F20101114_AADQZS williams_j_Page_114.tif
44c91abe8d5be1391d0fcd960036904b
f46b97bf9ffe9551abb02486edc6ad53cce620d7
1490 F20101114_AADRGB williams_j_Page_038.txt
ba82ee7e8c91ec54d8c2edf306e48d6b
4b68a7d5d3763e388e9a366ef36ed19673891b5e
1335 F20101114_AADRFN williams_j_Page_024.txt
8d9c254ec627fb406308496c46fb9d8c
cfbd8b265302d834f2d5256293af903d2d6e7d07
2449 F20101114_AADREZ williams_j_Page_010.txt
96b92c6615540b61ffd2e9f290189089
07242f8f2dfa6e790c6d5307bf0eb97a577da6db
1851 F20101114_AADRFO williams_j_Page_025.txt
a781b5cdc4bbd1aa762365d5021023a9
12fb8a3fae3d75282b50bdb28312a3e185a707ab
F20101114_AADQZT williams_j_Page_115.tif
662add9311ba863a2c3159942dc00e71
f469aebb5453b91e59c094389a0f4ba9bd7bdc8c
1270 F20101114_AADRGC williams_j_Page_039.txt
2dc9283cf5d6ff20387b8a35516a0f29
96fbacf6ed669a3edea54d975075931f217c8c3a
2021 F20101114_AADRFP williams_j_Page_026.txt
39ac7c01898b7a1f3258ce090a345bfd
50f80c362c700642cbf31871f2c3c24ec44e9418
F20101114_AADQZU williams_j_Page_116.tif
bd2cd2f4b69f9a0c2b3f3eaf8378addf
263eed5e9f0127a4900f0695cb4a01866e80ce7c
2124 F20101114_AADRGD williams_j_Page_040.txt
81365945bab118e198e82441606744a1
da2781fe96605e86206b01eed02a553abfd2f8ef
2132 F20101114_AADRFQ williams_j_Page_027.txt
9619c20c77b584214a8a0ef822daca2d
e35f3cd9a891ca4aee30bd4c2cb92f1b1d0cfa82
F20101114_AADQZV williams_j_Page_117.tif
65fd4782a7a8680cccf37ad258136ae0
12dd12ee58091eebd3af52155c6163c2377669b6
2017 F20101114_AADRGE williams_j_Page_041.txt
8985fb4a66b70fe21fb09284adf0c0d4
1cc042bbf88f8f1bc2fc4a409aaa37ef47aebc6d
2233 F20101114_AADRFR williams_j_Page_028.txt
7f88fb026893dd625e501a72a5fcdae3
ba034617244d8f56966cb010545b448c248b8444
F20101114_AADQZW williams_j_Page_118.tif
38048e3fb1b65a46059c867103d0719b
669413ca7dedb7c42a2667835586e4ce61dad6ab
2102 F20101114_AADRGF williams_j_Page_042.txt
49bf357e9d0b807c12b38a1f077574fd
349f3834cf5003a01f16e8aeef9c4b9a7bc8aa24
2212 F20101114_AADRFS williams_j_Page_029.txt
5c2925f0fa30cc596ee866b69f513ebb
ec06a0165e7bca82b8c42b08e2139f7f4576420b
F20101114_AADQZX williams_j_Page_119.tif
a7bb4594a9529aa881c624d3320db090
d80ca2f58871336103bcbe7c1ab02cbbcadb6460
2118 F20101114_AADRGG williams_j_Page_043.txt
5cd5f3bf10f6c9f26f1b23b72e1aee05
ad211aa32715596103e01cf744b7f9f8582711e7
2209 F20101114_AADRFT williams_j_Page_030.txt
bba360fc2bfa63878a98e18a58609bbf
1264bd8d8dcad25dcaa3cc5d1442d66a4991aae6
F20101114_AADQZY williams_j_Page_120.tif
90fb5d0a54d03ea289e23e98af2f9557
f8bf4c6f156690079c9773ac418acce7ebdf9e59
F20101114_AADRGH williams_j_Page_044.txt
e5ac1f4afb7ae8a411dc7855bc29ed98
209d00d6ee05427ee729bd547d75c467d43e212a
2107 F20101114_AADRFU williams_j_Page_031.txt
e037f093d6f6e09a0a2e19c3c530c407
1f42cbc09ce53cfb8867919374f224d4d5e9e55f
F20101114_AADQZZ williams_j_Page_121.tif
dbe131292d51d600d410ab5f32bcad45
74d13660ef6d72868bf3f99f26bb24e729e45d08
2106 F20101114_AADRGI williams_j_Page_045.txt
fa65e2ed83138abb046199f2fced0118
5f6d183efbe1c4656e871e9a0a8e2ff1c9e861b5
2142 F20101114_AADRFV williams_j_Page_032.txt
d739ffd090d3375556d3f8e309b344ac
a4a85a59a63aecad83a59360cb786d284435551a
2181 F20101114_AADRGJ williams_j_Page_046.txt
780653ebb04f675553eb34319fa904ef
64b8fcd9131443112203b399a079b6fac32cc5a6
2153 F20101114_AADRFW williams_j_Page_033.txt
74a6efcefd63ac0d891757a553042763
16dc2113268cad44316e9d29f6ecaaa8c97857ef
1909 F20101114_AADRGK williams_j_Page_047.txt
acf476414100d88ca715e275b946a20e
e28da4a56b46b882fc4ec577c6394832c4a2519d
2184 F20101114_AADRFX williams_j_Page_034.txt
1a36af6549edb883e71c490ed905ad7a
520aab3bda9634aaf6c0bc8eaf793fd56d8f5399
2220 F20101114_AADRGL williams_j_Page_048.txt
ba588d284a521bbcd9f7df1da33a6ee4
7407b76fc5b97064f3b5ead5afda43abb305a10b
2119 F20101114_AADRFY williams_j_Page_035.txt
6f6c50f4f4a2a9622b5840ffc40f140d
69b3c5e2ec8263773efd925eb7d11cd255ece82d
2165 F20101114_AADRHA williams_j_Page_064.txt
2c094e77aef0a9ea98ab26006fd120d9
3ee0000c2932d8356d7d72661ae3e4dc42ede35d
2164 F20101114_AADRGM williams_j_Page_049.txt
31cb6e5925674b9f24c056e134e5796a
c6163c876fb890e4cebf4e3695ebf29c7be4c9e7
2281 F20101114_AADRFZ williams_j_Page_036.txt
e76df07c19582a34e48411e7e6a9c864
c2b4462b71cfedbef3bf89e368053c6f5538a30e
1164 F20101114_AADRHB williams_j_Page_065.txt
18f3140144ce9f11dcb4603543e82df6
53c61d8bdd4465900d7d34ed1f35afa0292d0638
1992 F20101114_AADRGN williams_j_Page_051.txt
209d63d4a25fcd0f57f8630171e6ae9f
9daef1c5436bc8f585b23fc624979923186fcc8f
2112 F20101114_AADRHC williams_j_Page_066.txt
1fdb04a50b1cf795cf6deb69b7259795
b224311e9a0d029536813752b073febe57705b3e
2154 F20101114_AADRGO williams_j_Page_052.txt
1d83e101b9814f18a7abb08b86c78537
f65ae2424ddef33c7e2631928232cabc9bf1ad3a
2064 F20101114_AADRHD williams_j_Page_067.txt
496937975a9d9de5f2671eb65914db3d
97d3a7936a1dcb0509563e1a32384bda218e1741
392 F20101114_AADRGP williams_j_Page_053.txt
33c64ab01b4d8f30d7f7210bfef917c7
5c64b04e9bb36d2bed52ed3a555e36866e24f019
1799 F20101114_AADRHE williams_j_Page_068.txt
d9b6c7087a6e5bb68b0d669a847d64bc
decb5fb3ee8cfe9d763e8f6702db4ce0a138cde9
1989 F20101114_AADRGQ williams_j_Page_054.txt
a0f076f73d39259bf84c8860a16790b9
2e3e1142c7bef88246e0f5ea0630560fa6bced32
1744 F20101114_AADRHF williams_j_Page_069.txt
c992673c0276edbc99c8876e9021911e
6623cdf62d31df585d3267002e7bb2fc489d1ad2
2077 F20101114_AADRGR williams_j_Page_055.txt
5ec355ea860a1de777efbfc1fb8e732e
a12281e6176486f6171181fff6df388403a9232a
2047 F20101114_AADRHG williams_j_Page_070.txt
d21cecba5138335c92754b273556f8db
49b6c6f2a076d1c035ccd130b6fde37f15f6173a
2032 F20101114_AADRGS williams_j_Page_056.txt
a78e51ef1c77bb28ef5793a0c5335dbb
1c65fa391de86c9b5966cba5ead84539b0014358
1957 F20101114_AADRHH williams_j_Page_071.txt
6ed0477a6e1115c6c874ab2d5a53150e
6dba0fc485efe32cd82703a5751def9681d347f3
2103 F20101114_AADRGT williams_j_Page_057.txt
ff0a29d4b49be96c750edae882f48874
97cae1f41a473332dd84400793aae15013165782
1990 F20101114_AADRHI williams_j_Page_072.txt
4cee38ba0b8687e5f0be726737c3a6da
b0cb1066410d2baf7c05434c5abfc8e116e95b2d
1985 F20101114_AADRGU williams_j_Page_058.txt
9983645bd18a824180718ea59938b24f
8d81d083896748ccbebbb9b91b16de9bf1964425
2000 F20101114_AADRHJ williams_j_Page_073.txt
4bf6c04cfd401d45e9f83aa0685adc76
dfa0d6d8aa0f1ec933b642540164f7344e1f1378
2012 F20101114_AADRGV williams_j_Page_059.txt
765b956a233fce0c3dbcbbb1b0a8459f
2aac943548089f79db32c13d9cf28f3c2f354e66
1899 F20101114_AADRHK williams_j_Page_074.txt
523c95f751ce67558ffcbe95a2ba9e91
1c0eb867def1861505740c511c49cba7de6cb9b8
2201 F20101114_AADRGW williams_j_Page_060.txt
c3dcb9746c7bb0f75eca7de6da57a9e5
2dfd58d3ad4d8a1dd8924b6ab07e8df667fdd491
996 F20101114_AADRIA williams_j_Page_090.txt
2705adab65fbe35d73392452135835e0
9d6e4b53f9715a70c38681d207a8755a50e3b56d
1906 F20101114_AADRHL williams_j_Page_075.txt
96ef0b44b18d59db2621017db13ff9e6
f2035f0d00a2fa1e9795eb4b3c930677f8911bdf
2105 F20101114_AADRGX williams_j_Page_061.txt
569a945c8413386be782a7ebca9bef51
844f7b0da5af60f79a42a3053ba34347d47f7bc7
1696 F20101114_AADRHM williams_j_Page_076.txt
371693fc09a1677faa26b174bf2ad245
dd96cae63adba4bdb54622157d2d0a355500f169
2020 F20101114_AADRGY williams_j_Page_062.txt
5ecb02f4db1f3f92decbf594515eb76d
49d64bdde4dfb7b449d88f2de37c9a73ab5fb066
1124 F20101114_AADRIB williams_j_Page_091.txt
ee3364a1875b781d66c16fb4e6e82ef4
6c878684420ce7b458412995fb5ef5356273b76c
1934 F20101114_AADRHN williams_j_Page_077.txt
5afa35dba1b895036d6625eca2845c6b
8defa84eea0d50cd69c1f00de469578048792afc
1828 F20101114_AADRGZ williams_j_Page_063.txt
a9ef83f7a427a407f85cfa9bbdb5a138
7d93d66921ab857b951b9bc2461e56f4799b2a38
1638 F20101114_AADRIC williams_j_Page_092.txt
500b194cf32ed8ac77d3946ecdf239a3
39e0534b638df837d9c214f7879796582a304acd
1758 F20101114_AADRHO williams_j_Page_078.txt
9c87aa0885507da2d52095ab8c4a8107
a1a1653c150c79c05c63aabd973128255c7c4214
1211 F20101114_AADRID williams_j_Page_093.txt
28ce4f9bb9b92cd030d9d415352bfda7
518f4721dfe09c8565e12b3659bf4935db6c4764
2001 F20101114_AADRHP williams_j_Page_079.txt
50fb6bf141e45336bc1fb79d148b6044
d2cbff883c13d3f75c85c035f649d94e4494f58d
1456 F20101114_AADRIE williams_j_Page_094.txt
c65cdd055b6df56c17309972d6c04d29
5664c9b3ceb42b8e5d634768f06c4355e3b8e02e
1853 F20101114_AADRHQ williams_j_Page_080.txt
efca85d5351dece5fa3bf9a786062b8f
010634070c2ef19d32c1b86c55a42be6af0e7068
2026 F20101114_AADRIF williams_j_Page_095.txt
4dc9e70bc2db765b483f0a23f50c094d
061b47077931e3ef358ffa000c93509b097ec325
1152 F20101114_AADRHR williams_j_Page_081.txt
785cfd8d2a79ccc3c5f8f343f450af37
808effcf8c111ada0f07a8c8a6562b4f869c5b1b
1944 F20101114_AADRIG williams_j_Page_096.txt
28726733fee6cd0855cd277d2a17c0f1
df6b555ff0446d8c10c78fd1aedb603720b34d8d
725 F20101114_AADRHS williams_j_Page_082.txt
367af75ccfc5aad0cdbde0705d9a0987
7fc6206343c08382463e311e34831718a227056a
1370 F20101114_AADRIH williams_j_Page_097.txt
ba859e4f156cb7fdf96bc41193745423
79c5ac9ac43a8dc99971c0b6fb19bac0b6ffc0df
1474 F20101114_AADRHT williams_j_Page_083.txt
53574cd3762e000008da53ed57981bc5
7139780d37e3c1a99e754b324d2de0511fa41035
1762 F20101114_AADRII williams_j_Page_098.txt
180b1abd1d48ac9ca102897b984f50b6
a624035458e646a2e62d3ddff6dbff784784e092
982 F20101114_AADRHU williams_j_Page_084.txt
deb7392cac05977120f8d62ac0efc66c
2aaec0e56623395ae6db336711c9aa06375bf5d3
267 F20101114_AADRIJ williams_j_Page_099.txt
6dee14fc93dd012dbe1d380bb8d4cd16
33a00dbe6e61d89f26f9a8c467e889f1e7346f75
1130 F20101114_AADRHV williams_j_Page_085.txt
aaf3b4362895e38f3b92e724f17270d2
f94112cc3afb3862d349dfc5fee0aed885b4b9e4
2242 F20101114_AADRIK williams_j_Page_100.txt
b9437c3cd05dcbc1bf03a931edf0e03a
4d90c07cc19af0c837c204507da97427e6ebda4f
1426 F20101114_AADRHW williams_j_Page_086.txt
7a7f303b2baa461e6ad778e581162d31
eb082d7edad65c394de4a9da20ecb8b5b06e746b
1927 F20101114_AADRIL williams_j_Page_101.txt
28e9c82910c8d142816d8a11f38d7612
5573a1435e532a8e80e4f57d53316b25b91501a9
1810 F20101114_AADRHX williams_j_Page_087.txt
61efe589ce1ead713af3fac89f553f2b
c88a8128db364badb8fdc756e500444404c0b5f4
2401 F20101114_AADRJA williams_j_Page_118.txt
dfdc739bd7e87d78e772fd772e2d105f
0a33b3d6faeda1ecda799f089d15d45a633cefad
1991 F20101114_AADRIM williams_j_Page_102.txt
52ab911d4e93fc6640619acde79aa1c2
ef8de90a81e1cfbc7e71d6fc8ce0e220083a72a8
1791 F20101114_AADRHY williams_j_Page_088.txt
765b362adad6a245dfbd05f0652516cc
42926c4d37281b1e71e8bd4a4e7ce74574d153b0
2596 F20101114_AADRJB williams_j_Page_119.txt
810ddbd16601ebd35d254ae20156a327
7b7fb4e795cef82f9a4daa1a398f81319413fe1d
2219 F20101114_AADRIN williams_j_Page_103.txt
4676b9ad93a95e1e68b15e561d6b438e
af6d991a8a71ed344cbfbe7c1b6954de16efded0
1735 F20101114_AADRHZ williams_j_Page_089.txt
41660d775dfbd3586af28661013d355b
292379280f25a06c14987c735f8f2db6631eb915
2096 F20101114_AADRIO williams_j_Page_104.txt
7fba3c4fc562b16138d0eb92293fbd92
fcf0249115e66e827c259ccae40ac891be9ee43b
2009 F20101114_AADRJC williams_j_Page_121.txt
aa51ae5bc32c12f0df83e2284a88bb4f
be653ffb5d684576fba9c67a9ad2278d06ec547b
F20101114_AADRIP williams_j_Page_105.txt
1a49c29105931637afe6b68230fdc275
76c0bf5fd9026fdd6ede15458532c7e17a8a9377
831 F20101114_AADRJD williams_j_Page_122.txt
97afd27ad25a27c33afd33641d8916de
5bfe74f0cc48982c04188c5d2d69fbad6ca60691
2072 F20101114_AADRIQ williams_j_Page_106.txt
8cb76454fa74f003dcf928f33826b7ab
b185f9c865c3e778e9dfe957bc86acdd8998f251
3697442 F20101114_AADRJE williams_j.pdf
0c8b692a1f51becaf5236c42c90068bf
f98a177a581d8b2762b9a330a1fc56e14398f7a4
F20101114_AADRIR williams_j_Page_107.txt
2f76256b668d3486b2569a94c20bd391
611992df468df6d002ce53cb298a32e7c31db904
1594 F20101114_AADRJF williams_j_Page_001thm.jpg
c0ecf18e35ed008ce3069038ddaedf43
5ad17846ca67cdd403f77e13848b23a5fa8d4959
370 F20101114_AADRIS williams_j_Page_108.txt
34a494d65a7852b17beff30c62cbf58f
fd0ddcef2524b9c9c6043c922b3a9fddbf9c5d05
6566 F20101114_AADRJG williams_j_Page_001.QC.jpg
ff095629809e4f824ca1a742abd74675
8604226e98d65f3178a0ed7d63aed79699ec9054
2443 F20101114_AADRIT williams_j_Page_109.txt
e5a21b444e47ec897deab71f7cd9840a
dfba37c8846ca995df35c85c0699175751b5a19f
463 F20101114_AADRJH williams_j_Page_002thm.jpg
8798a1c561ff82204efe88656e1d4d89
88410065910b1afae1a0e45830f94894cce53ff6
2451 F20101114_AADRIU williams_j_Page_110.txt
a4b5a0a6a2d21c3b1e193e9066d8d911
ad7d8da48d531bab4fa7e0ece4444665984a9939
1100 F20101114_AADRJI williams_j_Page_002.QC.jpg
619b493e2c0c3a2a413caae4bee61090
af0f8d8b82f50fa6b0d3124e940448be70529752
2545 F20101114_AADRIV williams_j_Page_111.txt
bf5b70e26647cf221fdf04c3ecef35a8
5849d6ad682b25d9c97b38cbc20b11288d8faa03
1364 F20101114_AADRJJ williams_j_Page_003.QC.jpg
ba05c4f04933172c1ff6f67f4b6a9d52
aa66f3a0cc4df8a9e05b5af698d8a1a29e6b2809
2331 F20101114_AADRIW williams_j_Page_113.txt
0d8f21dce14260ccffd15d82d8cce3f5
ae1aa78dc2bd20d79e38c75be315e7e84558f20a
4945 F20101114_AADRJK williams_j_Page_004thm.jpg
319cc0e7dafba6586f5e671f003df630
f2ebc08d6c51a72156c50823d46a2e1d0fa3a153
2599 F20101114_AADRIX williams_j_Page_114.txt
25b959722e01c7553b274989fceccbc2
466e562090214e5416679f3cf9761a66d1316a47
2914 F20101114_AADRKA williams_j_Page_012thm.jpg
047a96f4391fda1cc5fbf5c3c812f4d6
1fe636f2378c17bd3c8b3cb1a6b35b37c0e6a861
19374 F20101114_AADRJL williams_j_Page_004.QC.jpg
bf2a6dc8055460af2a649e5e9fac3675
e22f54b6d7bf66fdaa23ae2a73a368bc2cf7888f
2571 F20101114_AADRIY williams_j_Page_116.txt
0e5a7053b3c8c7f1753ee1b04f54f389
399e0dfa5abe3b326a140f97332ba52e556fe5c7
10843 F20101114_AADRKB williams_j_Page_012.QC.jpg
78e2a53bba3c5920bc6d6303f7ab5f04
e9b435d702fd45f1b055daf62c9c3a7d8b24bd3a
4998 F20101114_AADRJM williams_j_Page_005thm.jpg
39fe7f7a9b32ae4425f6a51fd4ea59aa
282020f86f5a550520860cdc3df9008e66e64d5c
2531 F20101114_AADRIZ williams_j_Page_117.txt
de66ef1af7a900fe2dfddcb12cbdb5a5
ab48c69cf5dcdcbf3cb7ecd69168a9477133c0cf
2082 F20101114_AADRKC williams_j_Page_013thm.jpg
4659e092f11dd41e2047fd4a81c04439
3b41a41857ed0445cf4d7455aa5ca19a44e60b53
22363 F20101114_AADRJN williams_j_Page_005.QC.jpg
16fafbc25ffca802d093d3e5ea8baa90
4d922ee3b3a4087ee1fa53712ebbafd4b8bfbea0
5951 F20101114_AADRJO williams_j_Page_006thm.jpg
1c899f61e6ea768c1f6f672b9691c76d
a63e5a6910d4b91be21a6787a64955c14bac8542
7191 F20101114_AADRKD williams_j_Page_013.QC.jpg
39b71045d71371fc921f04bfa0ad242b
aef9c93025f7cd3387bf2d0acd17e45a808785bb
26400 F20101114_AADRJP williams_j_Page_006.QC.jpg
0235a2f737513f5e04d83380a949b15e
fee1debbe533893a56b7a93429322c4eb534ade2
5985 F20101114_AADRKE williams_j_Page_014thm.jpg
44f6ce78cdc3ed4694431e6d6b0e1f1a
5d58154a0dceae7f4297813dfbba564d05ea16c8
6053 F20101114_AADRJQ williams_j_Page_007thm.jpg
727c8bffbac2099042f8fd7d880d1a6c
46ac94d6002b98383a282651999db3360f7b6e14
24116 F20101114_AADRKF williams_j_Page_014.QC.jpg
f69e149a319de0e5ae36267754dc0d5c
e6b748945a103d0d830cd8e137fb81e4c1fbeb04
27600 F20101114_AADRJR williams_j_Page_007.QC.jpg
fe3c4bb39281818eb48c672a61f1e2bb
e1933d5a4e9b6373eda272d680ecd093c1112c9a
1921 F20101114_AADRKG williams_j_Page_015thm.jpg
b93e410b3beccf48075e1026011436c8
4d7e1f423ba8c990d30ce41e623f6f112cd577aa
F20101114_AADRJS williams_j_Page_008thm.jpg
cd64537e777703168349b43505a9add1
366ce30eca8975012be4577bf64ac696b18ae900
8205 F20101114_AADRKH williams_j_Page_015.QC.jpg
99f2af2b80c014ff4bf64e11d8c512f5
57003df0e696a82ebb7702551dc619fb53a087b7
7176 F20101114_AADRJT williams_j_Page_008.QC.jpg
6ede8b4985df4abbb9bfc91a86a20f21
c30a3b0b5bd310c648cba08a811673181dfbbbfe
6710 F20101114_AADRKI williams_j_Page_016thm.jpg
5d003242c446876304a74abed6a4d8fe
480dceec769d33b4a31e1899d8e101e61ebe131f
1800 F20101114_AADRJU williams_j_Page_009thm.jpg
7a3fcb7c889fe3dee8a3f714a543daf5
9d277b15a5965d40045529402c4925afc54a4c91
27496 F20101114_AADRKJ williams_j_Page_016.QC.jpg
f82dc822e6d9edfbe7bc1a0cf32caee1
120ec96f6f606e0a7367a2caee2a6a75df7520b4
5856 F20101114_AADRJV williams_j_Page_009.QC.jpg
9ce1d68d349c0a2a4752330e99a124d6
148aab4cc7a4e2cf418503d2fecd92b5b0b80a43
6489 F20101114_AADRKK williams_j_Page_017thm.jpg
0f329ba6bef87392ebb94bfdfed85e07
3a22920b0c8a1c9809f40ab8445cf16f298f3029
6038 F20101114_AADRJW williams_j_Page_010thm.jpg
5ef69e2225f7623873759918cb4f16a3
b9c58a99fa07dc13ba67e197f3e75e3b3fc297d8
26206 F20101114_AADRKL williams_j_Page_017.QC.jpg
85ba47c10d2213da4d7b967606ecd94b
2e098fdf355662fb3c3dd6983781f118ab67c332
24058 F20101114_AADRJX williams_j_Page_010.QC.jpg
165e4c966c754c24d06e17937c4b48ba
116930b79a6cdbac2e0d0792a560065cc5b82305
27402 F20101114_AADRLA williams_j_Page_025.QC.jpg
e5ee632c410952c13b20816a502fe51e
265b5d52fe93999230b0fdf6b3a05b1d3c1041cc
3296 F20101114_AADRKM williams_j_Page_018thm.jpg
09a0241246c8c8ef5f298d912b55b6ca
004cde2cfe8dbcf56e0fbb55e72481a3a8bd2731
3367 F20101114_AADRJY williams_j_Page_011thm.jpg
12eb0e8c0e5b362462b221c2d5ec5094
fba496ca9ad3d1ba8604ccb66c0e33e72c81ccce
6474 F20101114_AADRLB williams_j_Page_026thm.jpg
27841b62765f9d65d94901042a409d42
17779855c47d3db8b0b6ba607ab1651b73d86765
13915 F20101114_AADRKN williams_j_Page_018.QC.jpg
478b40b8ac03f5f31ab2248c0106b190
4f21c9502702801a7cda3bd74c6a6cb68315ed0a
13210 F20101114_AADRJZ williams_j_Page_011.QC.jpg
b6b1fc63e1436435347e4b7a32c54779
65ea6be7aa1f704339e1055d2c198aec3b08abbf
26390 F20101114_AADRLC williams_j_Page_026.QC.jpg
d20f0f35c3b53363c151f3595da1e191
06321453a4066ee379e1fca38a9ec56b3c7916f1
6890 F20101114_AADRKO williams_j_Page_019thm.jpg
90ae623b7759fd6d8331a6c533285b09
3897dc0e4e3770d39ac997e2b07938b7bbb52a82
6494 F20101114_AADRLD williams_j_Page_027thm.jpg
4d85044a2c8806bff0dbf3568a52a17e
a633d9f84f216f58ce62a6e29591b14690926875
26042 F20101114_AADRKP williams_j_Page_019.QC.jpg
c8e7fdfdfd8d5bb528d059bfb498c86c
39c253524ab69411ea3a9636cbfe3a0930893cf0
7381 F20101114_AADRKQ williams_j_Page_020thm.jpg
41d3734c17f54141925dc3b6db18d72c
c36b46fb4f7813f224eb7a38ea4d1d2197efecfa
27419 F20101114_AADRLE williams_j_Page_027.QC.jpg
05794f744e1e74ed7c37cab3d2c44af2
37cd47d51a8b13bfc548ef4252ed00bf3e50a354
28679 F20101114_AADRKR williams_j_Page_020.QC.jpg
969004004ca782abaa8fb48fe5b9f063
931d7c7de8197e6f9412636ea96be7002b8cf7c4
6663 F20101114_AADRLF williams_j_Page_028thm.jpg
625a8e752072345ef343f6420a371606
59fffebbf657368ac7be7bf391c87bba820c0b12
6724 F20101114_AADRKS williams_j_Page_021thm.jpg
0a5f9d586d9ce7bd679af48a3eb5044f
558cc706cacc87e8e58d15aaeb6bef795891763c
28331 F20101114_AADRLG williams_j_Page_028.QC.jpg
c7f7b9d15f31d8c06d6a6740d728771c
4711529d1c795284016cfc8ed51f48da9ff15dbf
25687 F20101114_AADRKT williams_j_Page_021.QC.jpg
3e6cafac82a3d1a902638e55bc065760
1eff8278e03f3ef904a225d675dddfb880365760
6589 F20101114_AADRLH williams_j_Page_029thm.jpg
8d6f444e839785b91b2e1288e20aff17
8e19b7f36dcdf978f9359ae92bd63bf0b7ab9f48
6431 F20101114_AADRKU williams_j_Page_022thm.jpg
7acba5ddce921098739275f4e4b7e1b5
e3cecfc2b3c6461e6dbfe0903d018561f86d440d
29361 F20101114_AADRLI williams_j_Page_029.QC.jpg
121202b219901bad8e4f93bf4aa56ca4
c9406cba535037dbfe39a37da600f57ae70a6726
27892 F20101114_AADRKV williams_j_Page_022.QC.jpg
f98422c21c7af6e77c0890b2c539050f
bd0309d3f4cc09a832743db759d22d01ffa35d4b
6861 F20101114_AADRLJ williams_j_Page_030thm.jpg
2a505e995e3adf51d620a82ce082fa60
4e0c1f01fa46b8f6a6df5b085486afb5d1c16fd2
6101 F20101114_AADRKW williams_j_Page_023thm.jpg
c855c89b877c486d5776a8396e7e97bf
3480813979728d27b7435867f8c21af2dd2eb899
29372 F20101114_AADRLK williams_j_Page_030.QC.jpg
607cea91b800b5467d6873ba718f0310
437e0f98330528ff35384481668ac591fa346cd8
25740 F20101114_AADRKX williams_j_Page_023.QC.jpg
21f4f57e47af68994d37f81a68a9eafc
f93a37701bd70a4df01c6984a760930f85917155
26035 F20101114_AADRMA williams_j_Page_038.QC.jpg
64c6893c8800e9a83984068b8b8f08e0
ec4189853d1758bee35a513a7cb9c2fbd7c3a811
6483 F20101114_AADRLL williams_j_Page_031thm.jpg
4eab76233ea859a31b1f830fe269d3d7
10b125c6e4201a7ba8e4b31b6760fd7b69e26873
25913 F20101114_AADRKY williams_j_Page_024.QC.jpg
eabb17bdf42f99d7175869f4c71d0c90
e9a0b849a54cdae3c4a1b7da563e1f414b6cabb9
7018 F20101114_AADRMB williams_j_Page_039thm.jpg
04abe51730b31691f7382cf47a1576a5
92f7e388686d7e7d606e19eaa1f52b846af5b5d0
27116 F20101114_AADRLM williams_j_Page_031.QC.jpg
50a2899a28bb4b0ce531043126863799
6aa4c4c8c1736fac633dddb821c338e00f35fcd2
6853 F20101114_AADRKZ williams_j_Page_025thm.jpg
92fe827a2dd58c0d5ee85f4cf906f751
169c71a1f7768d42aac27e35076ad2a698605400
23862 F20101114_AADRMC williams_j_Page_039.QC.jpg
f06248460a638ce633a55e6873fbcf36
f0cc4b4b378cb4a6bfe72726b416f75297d35242
6347 F20101114_AADRLN williams_j_Page_032thm.jpg
85a1e0523ec7174e23543683ae3b1693
897ce933c85508fecb1e4be00ee986c1af9d09c8
6439 F20101114_AADRMD williams_j_Page_040thm.jpg
36bbf24adb86d2527bc58e973b4f8479
86c34fb0f20e83ca034f601759323e341707d2bf
27975 F20101114_AADRLO williams_j_Page_032.QC.jpg
3b94620db998f2dba6780da93136818d
aceb80494176fecdba3349fb2800eefb786afabd
27380 F20101114_AADRME williams_j_Page_040.QC.jpg
c2ec0483feedc93957c14c33b4c1854e
a48985247f8db32b534df859758fb51e10937ef8
6327 F20101114_AADRLP williams_j_Page_033thm.jpg
f2d0ca8b7e7ae1dd46c7328a7dfe7b8f
4a7609e4043b4d01df14312cc4cd039ceb0a6a9f
28148 F20101114_AADRLQ williams_j_Page_033.QC.jpg
cb37074b263e42947cf05ac9e0aa035d
b1218c08248a76ea0d6e4cd7712e2d0974699c82
6018 F20101114_AADRMF williams_j_Page_041thm.jpg
11cf869000331830aea68bbd518b1c6b
b720893599ff56cbe295861a1a907280950e85b0
6606 F20101114_AADRLR williams_j_Page_034thm.jpg
c400f5cfd454311d38c48ec4d14daaad
296f8ae2e310f170f09d3f44620bb19964711c45
25419 F20101114_AADRMG williams_j_Page_041.QC.jpg
a87614a8173dd52cdb9019beefd5d7b7
d619172773ce81ec30a44f901b26c41483ca0a9c
27932 F20101114_AADRLS williams_j_Page_034.QC.jpg
730fbb8528589a5bc6ce2e1a26c122ec
208c7364ef25cd2c6d3adbb4108a99ce07786c3d
6391 F20101114_AADRMH williams_j_Page_042thm.jpg
d2be4a75d2fbd060e203b76ae99bb18a
f6b6d483f45b556417412781774cb1727ab69f65
6374 F20101114_AADRLT williams_j_Page_035thm.jpg
1ee4bb041f7e22b33c50ae67d1ea4110
ec89c5432d735fa6569a283ebeccfe5b6a66952f
27597 F20101114_AADRMI williams_j_Page_042.QC.jpg
bebb1d768548f91131a7a204c1bf90e4
e4ae94bfc490640040cbfc1dd43b1a957fbc55c6
27819 F20101114_AADRLU williams_j_Page_035.QC.jpg
739dd3a878a67041030b6bdd7d39ee5d
fb7cb50581412872a2344abc8d83419d4657e4b6
6498 F20101114_AADRMJ williams_j_Page_043thm.jpg
30e1a054dcf8ac45447fe8bb12621493
c00788c3832b4d983cd9fa7ae4affa42bcd5cb97
6858 F20101114_AADRLV williams_j_Page_036thm.jpg
aa89215a7fd5490a6d03e11addbed2dc
cfd3ab2073c92cad87dcff8a0cd2df8ac3435a20
27420 F20101114_AADRMK williams_j_Page_043.QC.jpg
c5f02a9fe4b8e4b1724590547a818665
34e174303bc7e36593b9b2219f2b50829c8581ae
29031 F20101114_AADRLW williams_j_Page_036.QC.jpg
bc2188c6d1baad3a4fb70b4673d3558b
9f3a4a50424a0960ee846f4ea3d8b5d6dfd3ccdb
26763 F20101114_AADRNA williams_j_Page_051.QC.jpg
4046d897dddbfad1c1d89f296fe8aaf1
7549a4eea682c5e32148bea8e738cf8c7a583780
6718 F20101114_AADRML williams_j_Page_044thm.jpg
fbfbadae57d1e2e9f55552ad8433b32a
919377a015198173b21195e62e4769b7ff275a4e
6701 F20101114_AADRLX williams_j_Page_037thm.jpg
c7cba881eb7a80d30e69f9574ea8044c
b3d2f6905ad65d14c49c46e5842d40979886a077
6636 F20101114_AADRNB williams_j_Page_052thm.jpg
1d65c0a04384f52a67a0c81baca80e66
73033f2d62488e6c2cc2ce4dd63cd122c07a329b
29607 F20101114_AADRMM williams_j_Page_044.QC.jpg
3388fdeb850531dcefff3b0e9bbcba5d
57b9176f300df53fc68bee1d1d549e44bea796f1
26304 F20101114_AADRLY williams_j_Page_037.QC.jpg
6d5e077ac83c8d89a9c63f74c63adea3
93f9db3aa5b75637442aa4b39b5cbf41953e61ae
28567 F20101114_AADRNC williams_j_Page_052.QC.jpg
f45c42474e67c2a4418e426cf70faece
9d2cac9ea1f8d022b16aa7b77f8fd00051470cf3
6785 F20101114_AADRMN williams_j_Page_045thm.jpg
e9380c2cbc596d18f0a5682c48416740
0c70ae87b2eff6b088853393008e4fb4c0317e6d
6455 F20101114_AADRLZ williams_j_Page_038thm.jpg
9aff91ed38bed70406d5d3fcce12bd55
e0774e2193f28c2a75ef582fa51bc4b95ceaa138
1644 F20101114_AADRND williams_j_Page_053thm.jpg
358ca564dbf7810b5194c51cec1e6dcf
c0c954e313cef3b90cbcc42b804cfdf454a9c851
27572 F20101114_AADRMO williams_j_Page_045.QC.jpg
7a09f6fabedf3c9429ec71f2e90f9113
8ef4e00f42e8348f59cec6370e74cd03064c0fe7
6098 F20101114_AADRNE williams_j_Page_053.QC.jpg
08908a0fada6b3d450860f48a8a841eb
317759f6114ba77003d306fb861120e9a6f43d90
6600 F20101114_AADRMP williams_j_Page_046thm.jpg
bbe52311beb8dbfc98942b491baa28da
1f3ff582b5d545a15c127df53de0c6fa2b421855
5976 F20101114_AADRNF williams_j_Page_054thm.jpg
4e63d90baaf783e20ff80f9e6eaa1f2f
a9e501ec89edfe1f9fd87e0c0ad71e4545b8941f
28351 F20101114_AADRMQ williams_j_Page_046.QC.jpg
9347bacde10b7852e9278809c1aa31a5
34bee1597e5f705ddeada39f0b1a07e2d9926ed8
6042 F20101114_AADRMR williams_j_Page_047thm.jpg
be67e910dcd8d7b9be0a25512ebd20ec
2f785623278996d101a86e0bccb833e12c44aff5
24171 F20101114_AADRNG williams_j_Page_054.QC.jpg
ce339e7f10bd59e9b0608dab3ee0597b
ade707ea149d259266d8035a0737f543eaafe701
25382 F20101114_AADRMS williams_j_Page_047.QC.jpg
e79b2327a9cdb8f054519fd154fa0bd5
af2b4cfc1f612cea85808902131f5953b05438c5
6753 F20101114_AADRNH williams_j_Page_055thm.jpg
791089a0d37bfdd425005103e7f1cd7d
541adae78967b3defbf3193dc4d2bb4a956d9f3f
6827 F20101114_AADRMT williams_j_Page_048thm.jpg
0277632e66909e225d476cf50c82a639
2a1fd38b0e582fe02e7ccf13ff957bbc1942226f
27736 F20101114_AADRNI williams_j_Page_055.QC.jpg
183e588c844e5c481961d3791e197a26
c791cce777470fc83f1a4490118a376622c65a9e
29256 F20101114_AADRMU williams_j_Page_048.QC.jpg
a3d4b95b8fd032eb12150d4aa984030d
d932c5dee26d34c95c5e161fe01e5ca6d2936fe9
6510 F20101114_AADRNJ williams_j_Page_056thm.jpg
67281da5012c098ff9a4018649700d4a
bb1222727809a22062d0135c78239149dc1ea5b5
6516 F20101114_AADRMV williams_j_Page_049thm.jpg
3d7bb01342555d68959386969deb943b
56c138b12014ac91b8c98decf1722f3779d24bf1
27252 F20101114_AADRNK williams_j_Page_056.QC.jpg
8fdf715d51693b198eadeb7dbd17ad39
f9c5c1eda858f75161644ab9e8cb10a336f5bed1
28755 F20101114_AADRMW williams_j_Page_049.QC.jpg
f197933c75e3d6e6103781b267b760f0
86456fa6540c715a490dd2702e9aa08c4ef40b43
6227 F20101114_AADRNL williams_j_Page_057thm.jpg
36b9b5b2d6d15ae44e759bb3136225de
975d989f3dd40dbc3c44a02017de8b1f294c5225
7109 F20101114_AADRMX williams_j_Page_050thm.jpg
41f71da758c5d4e678bc1c020e8a4eae
38778e32fdce864308465f759c72b882ae5fe7b0
5460 F20101114_AADROA williams_j_Page_065thm.jpg
aecf74395c2c11609176f4d6bc61736e
1a7a03394232c55315d7d84457cbbcb32dbcffb8
26770 F20101114_AADRNM williams_j_Page_057.QC.jpg
f914f1f3f426d4298867797a033ec516
7a92a0c1ad7b4c97fe4049c2802c837aee65e647
26862 F20101114_AADRMY williams_j_Page_050.QC.jpg
4f9b14eb453c99a10cc55ba19256a852
b2c0c56ed4b73954f986aff2ce1e2e7790b99b58
19977 F20101114_AADROB williams_j_Page_065.QC.jpg
760755f19adb18b199c254b091a469e5
18fca1566804e5f8b8784e9266c64f257e6bf154
F20101114_AADRNN williams_j_Page_058thm.jpg
e9f5d9db172381d71f714de0f21227bd
846b0ef2dacccf01e96bdd613cc6d04a65cc077b
6281 F20101114_AADRMZ williams_j_Page_051thm.jpg
8419fb3ac5eac35413e6931cff062b1a
248599e6a1fd3e891f9c6f77393f5162b0ec983e
4763 F20101114_AADROC williams_j_Page_066thm.jpg
fee8371bac71f43848622c0eeaba3daf
07ce97b67a0bd9394e2ee3878bd6152f01f8ee7d
27506 F20101114_AADRNO williams_j_Page_058.QC.jpg
4f1d4e21e586de38b273be736b858a77
bbe9a9f122816291a455c6663020c50630ec05e3
23012 F20101114_AADROD williams_j_Page_066.QC.jpg
c0e18a9b97511bc1febd1b7f88a45857
e951803951f9290b5767f1686eef8de6186fe684
6617 F20101114_AADRNP williams_j_Page_059thm.jpg
a93062a145b3c3125e8b222da69095d9
d9b8a2edde62b58713ecb8f765f9c26827108442
6728 F20101114_AADROE williams_j_Page_067thm.jpg
f803bcb4fe14e989a1979d50e837b6cf
736a272ca60ac41a1528f0686f202de8f59fd461
27226 F20101114_AADRNQ williams_j_Page_059.QC.jpg
e81ab1e0b5c235b689806715a00eacba
a53ea803c6287f5d18d925a7e79a9175aad54093
28835 F20101114_AADROF williams_j_Page_067.QC.jpg
160e7101dbab2f7c0b530b246673a3a0
7b8e637eeb45d6d43096d12c255e398134d48317
29438 F20101114_AADRNR williams_j_Page_060.QC.jpg
9700a4961ccfbdf1abb41f72794a5d67
be3e61ee647d47bd1ddf44801724125b4eec5ce6
6478 F20101114_AADROG williams_j_Page_068thm.jpg
8fed216639e7d0eb270e2a08df4b0ba1
7ebc14f671f75dcd90e7ac06fd9b7a0f6238e1d7
6620 F20101114_AADRNS williams_j_Page_061thm.jpg
d6e2481171c34013c4fdd9591ffc03d9
d26aec8733dbf50508b434c1a7214100f7312440
28189 F20101114_AADRNT williams_j_Page_061.QC.jpg
f69aae0772cc32505c2271c6d6b5c4a8
72edb79b6e532e840ee2bc5fc83559db993e1ab8
5221 F20101114_AADROH williams_j_Page_069thm.jpg
3fb981fc07648fbc93df680ea8d1a09f
b5bad4e254afd05c893083e2036d659c693569f0
6271 F20101114_AADRNU williams_j_Page_062thm.jpg
a3643f6c5044943639ffa401d26c4243
03de6619f6e28a4b7e53bbc4a76d612e597b13fa
20514 F20101114_AADROI williams_j_Page_069.QC.jpg
0d7c16657e8da2a3e6220c6f9faa76ab
db7ef98e6cf6cc31eee86daa522232d9803dbbd5
27201 F20101114_AADRNV williams_j_Page_062.QC.jpg
214bba7d6d324cbac2801e48f2130912
bb35216ee8ab7c5fc06ba3aaee1ff62891e2ba46
F20101114_AADROJ williams_j_Page_070thm.jpg
1fdb4a218767f187b0aa3edf49d9a114
3df63ab7e943138df5bbe1ffc70960f41ecc92c1
5956 F20101114_AADRNW williams_j_Page_063thm.jpg
bcac2e3214d33f35c2d59acd0430f4a4
27971e21eb717a3f943a7d886b82a63fb2accb0c
27905 F20101114_AADROK williams_j_Page_070.QC.jpg
6e1642eb32639c1df5d883be8b3f0e83
24fc59b5018e9731e1dc4d08655d33d45d2f9e4f
25388 F20101114_AADRNX williams_j_Page_063.QC.jpg
6498769e98ce2d390eaa0cb59d736315
8a91efff1595281918dfa5647baf285d4a163259
22846 F20101114_AADRPA williams_j_Page_078.QC.jpg
fae0e65c68670214e6ee241183c39279
c8b676e22850cef4f39e8f7b168d7fe9d29a773b
6773 F20101114_AADQLJ williams_j_Page_060thm.jpg
76c9bdc005ba53377f92dceb74efb84a
d3453c7cd3d439244be17ede6b4af2ca29844482
6492 F20101114_AADROL williams_j_Page_071thm.jpg
55614eed1cf9c05d646462bc0788728c
01e7c5960981a87fea322ba3349567281e75784b
5991 F20101114_AADRPB williams_j_Page_079thm.jpg
6417d3b45791187c18eb5311ec31be36
9cc92518f7d71f55c8334c99faac9bd275fbc9e7
988 F20101114_AADQLK williams_j_Page_002.pro
4f01de0cba74e3bcd5d01caae37d203b
15c141857733114e89d633e543a64bd2f04cace6
26881 F20101114_AADROM williams_j_Page_071.QC.jpg
a653cf92f83873682a1c113210a25d9a
f63c0ae5d1679110702cf83f84346587416244ea
6846 F20101114_AADRNY williams_j_Page_064thm.jpg
2d0ab95561bff1b7aa1468d47cbf0243
060d40853d9f7d8c83cb50f6bfc08deac36d1ca6
6924 F20101114_AADQMA williams_j_Page_024thm.jpg
1b3195067c9e4490ab95f4df7e180440
310c1741d20c2c8bac07bfbeddcb72695e210ab4
25865 F20101114_AADRPC williams_j_Page_079.QC.jpg
0ffc8c8443476c354a91d970612415f9
47c13e252303cd1021b4c278973a54fe8370b420
F20101114_AADQLL williams_j_Page_031.tif
bbb2e05f854213c6f714672106f2ad48
0a13d775464e4ae4cff1318745fc175ded378c2c
6638 F20101114_AADRON williams_j_Page_072thm.jpg
17d751c38d9d67818861d61855fb25dd
50467f4ebd82d61212010e7224f57426c10a4f4a
28697 F20101114_AADRNZ williams_j_Page_064.QC.jpg
342415cad419e317bce0dc3411d2e02a
3292c3d2505aa7842654ef70341baea767d604cc
25633 F20101114_AADQMB williams_j_Page_068.QC.jpg
138a564abe02d487ff45eab2e032fe68
4bbd0380d0282ac39bf182fca53b54d953164edb
6103 F20101114_AADRPD williams_j_Page_080thm.jpg
1009cad2ca362b3e9bc6b7a23857348f
7fa469a453c5399952ad7d085fc507766fba1744
6885 F20101114_AADQLM williams_j_Page_112thm.jpg
8a3058b4cdac7374d45477eae7cae67d
0b8e62d6a29b61a2821815bf638037cb7caebe77
27315 F20101114_AADROO williams_j_Page_072.QC.jpg
f0c3ace2369ab066c3f10e3802be2291
39e24e0d4591229caa9e75fd471c679b4cd8e69f
2670 F20101114_AADQMC williams_j_Page_112.txt
cf107df1fe0e9d3978b641b42af454fb
49672c1d8cc495420f9311c19224d35b427f933a
24932 F20101114_AADRPE williams_j_Page_080.QC.jpg
c69e1b529df747906dcf222b26266ab8
507c84a137775d01f7e03a98fc128534f73e3f53
F20101114_AADQLN williams_j_Page_068.tif
08148e0f5dd921d3585eca2e394539f3
5e652ca27175b44bba8489d2cf6ded593fbf7218
6109 F20101114_AADROP williams_j_Page_073thm.jpg
27e4b8f2d7789b520c85430b498d9457
1ce7f2ff04483231f3d6a7aeca734ce1f148af98
184776 F20101114_AADQMD UFE0021298_00001.xml FULL
cb66d4f83332d33a0ec35a1bb8984e3a
c72ccaa017e32f59ff7bfc9d001b8a89ef596e4d
3111 F20101114_AADRPF williams_j_Page_081thm.jpg
c4daf9a31e9d9572a30daa34514ef8f9
4a28ac00e2db6875659acfa0ef7a34fe46c1c2d9
535 F20101114_AADQLO williams_j_Page_003thm.jpg
2bdf422dae51da45794a6e4e88735386
7b11ca69b577ba1e443aa0c44fd9e536c7442fba
25700 F20101114_AADROQ williams_j_Page_073.QC.jpg
8b28ad6dd3b7305ef3ccfbec014ec94f
fc36e6807a428a04e2b1798e730c25cb4ec2468b
12491 F20101114_AADRPG williams_j_Page_081.QC.jpg
995f105f458b4c84e2b25ef276e0b758
289d9b6f4802be9fd61acc88c4375e3cafd54891
1930 F20101114_AADQLP williams_j_Page_050.txt
05d64e02d4d7168c596cf1993507fb07
fcaea4014724cbd383a8ed7750f6e0d519a485f6
6152 F20101114_AADROR williams_j_Page_074thm.jpg
0814b90b6d62708ac55f2d109a4d8178
d6b0df6d4573a2e807e4b80a31432b721283c854
2324 F20101114_AADRPH williams_j_Page_082thm.jpg
850e13efeab42070d762f414d4ff2eed
99c21f466a7bf6913c8b9b79517b36710fb33167
94605 F20101114_AADQLQ williams_j_Page_066.jpg
d4a92d3d4505395bb96e0eea13a76f97
d08d489307d1f08a695f8d84da137ad74174010d
25142 F20101114_AADROS williams_j_Page_074.QC.jpg
a609a3eaaea0bdf56c71d66c9efd5e10
86bafb855ecdcf3528d2f198deadc0c6892d13ed
47713 F20101114_AADQLR williams_j_Page_011.jpg
26b22a8718eaca91474f43dddebd8fec
a8d8199306dde1e1fd09e2c91deb7ccb1a3a76ee
6476 F20101114_AADROT williams_j_Page_075thm.jpg
ef263f75224eb21611b781bf24d995ea
26a4768639e4d36c2b2a8e628c56b452dc5379a0
F20101114_AADQMG williams_j_Page_001.jpg
a38abb91ea1969edf6d4b3702f780785
17f8b706906d2c67371360d9b6b50571244a0354
8368 F20101114_AADRPI williams_j_Page_082.QC.jpg
4839f5c3dfd201e48438123210b6116e
457f7b280a7f8aa7777bc2a33cea0e00eeda20cc
2213 F20101114_AADQLS williams_j_Page_120.txt
f492b41512bbc71b20ddf7060b943ee8
9dbb199c39a87c47b93ea29f58f73a4b110cd38a
26220 F20101114_AADROU williams_j_Page_075.QC.jpg
359a55df906785164e7af14315c16e71
30200e47ae98af4dc197bf89adff530192da1f6b
3847 F20101114_AADQMH williams_j_Page_002.jpg
5cf5a57fa6418c92d82d059ada386059
e614cedae7d5cd74f2a4b5182ae9fcf9cf2f7ec9
6983 F20101114_AADRPJ williams_j_Page_083thm.jpg
aabb4b924f9ebc0c0fd4732889bdf4fa
13ddae4b4b11106874f4de8635f89a262787b1b7
2646 F20101114_AADQLT williams_j_Page_115.txt
b738a98512d77451eb88c162150e8f7b
2e9744356a476bb5a6da5b7a483a215c7aa671cf
5747 F20101114_AADROV williams_j_Page_076thm.jpg
4657a817b2843bbf21c6c2f4b8319c28
ebfb97a9957ce14cd7cdf24800110326157b3c6b
4988 F20101114_AADQMI williams_j_Page_003.jpg
c866219206002ca687ef20e31878525c
150642c22d89b242801927fe0266579eb54f6493
29002 F20101114_AADRPK williams_j_Page_083.QC.jpg
84d94bb72dce26f14e9e9bb5c744579d
7a1d96fb17e51eef110501e72dc893fdf1bfe959
98172 F20101114_AADQLU williams_j_Page_007.pro
ba2d4349190ec728a6e8225667eef0e0
d10cfcde18d082d34f111a9108026a458cc6d1ef
23515 F20101114_AADROW williams_j_Page_076.QC.jpg
28fe37097fe908f09625343fa10f1314
c64715225bd51ca5f8e374f154181967f4054083
25275 F20101114_AADRQA williams_j_Page_091.QC.jpg
cb11265b1749611995386733754eb115
ec2ff456336b4f03e130f14e667b738f9169bbe3
64441 F20101114_AADQMJ williams_j_Page_004.jpg
a4717227d9d8ab2b024514a4bc77ac46
040aa50556bfc9c954470460f60c100ac4575da6
7292 F20101114_AADRPL williams_j_Page_084thm.jpg
969c460378d7cdd1e941f47f052c823c
9e57a0663254b0d56c12fc894e1c94f846d5d846
63643 F20101114_AADQLV williams_j_Page_116.pro
fb58aa87f15db68207feb2d163b19819
073834f16bcab4babdbe9ec495a68d034d0c30dd
6491 F20101114_AADROX williams_j_Page_077thm.jpg
d94221a04a081a27bed1076e6b13980e
21ac1c45a5832aaf263552b98695dd1745729ec7
6248 F20101114_AADRQB williams_j_Page_092thm.jpg
dcf36b151c2cafb98d7839597dd5ecc2
5f144ddf8bb85f884ab6d69b30fba6c9f14b7e70
104113 F20101114_AADQMK williams_j_Page_005.jpg
9b7c1d287afa246c6ea13e7a07dc5397
da6c3ba22298ec3689e27b372e73a3e98dd793da
30183 F20101114_AADRPM williams_j_Page_084.QC.jpg
3b9e9efa2ca6242f17a0736641c69d2a
362925c0129f92ea11a6bf88a16ca4d2a596e121
77643 F20101114_AADQLW williams_j_Page_080.jpg
68c2758504eeeb1d478eaf1421e7a50f
5a939ab438beb066a6777410692f25cc838a90a0
26837 F20101114_AADROY williams_j_Page_077.QC.jpg
56038e80c175eb037a43dc5858d760d1
f0d2f7e7d12a54b06eba82dacd74198456709237
25000 F20101114_AADRQC williams_j_Page_092.QC.jpg
7f5bea0e86e6112c1db7c2c5146d710f
8314d21fdac223557e0361752f8214a9f427027d
125563 F20101114_AADQML williams_j_Page_006.jpg
6cce831cae6ce6212f5f49c4ee363769
7b6ae3c646400393534a458eb6768d8e72bfc356
7849 F20101114_AADRPN williams_j_Page_085thm.jpg
66f6a5991abdf93d23dec3d853b8192e
3df9be9e09a07f4bfa10845bb686a23fe167e009
87347 F20101114_AADQLX williams_j_Page_091.jpg
90df2e7fb1c9eb0d9a333acb4cca220c
9e65e697bd602d7664394d4632d21d7a9f7858c6
5732 F20101114_AADROZ williams_j_Page_078thm.jpg
e9144a4d0f085fb44518ca8a3122e353
25b0bdfced966b35ab5afd5513d761a730719411
89274 F20101114_AADQNA williams_j_Page_022.jpg
bb87b4419c9ca7d44ae211ce7b69b8de
6ee9c8649ae04c079b21232a09f0ba3eff31f87a
6115 F20101114_AADRQD williams_j_Page_093thm.jpg
8e1b77d5d82aa8491a3c2e4b7e3e41db
661c03b3fc2e6bb417f6dfc60a4b88de28ea31e5
128094 F20101114_AADQMM williams_j_Page_007.jpg
f291d3c56f988164edf1e5c9b0999de7
f9c24d06a86146e7b383580b9581509feac44501
31788 F20101114_AADRPO williams_j_Page_085.QC.jpg
be4d38a5784688dae868063e0a942d53
29d269af8ed20be7d2752b316b5a769f0716f0b4
57541 F20101114_AADQLY williams_j_Page_018.jp2
63bc091f11c4aa66e4ce093a2f4d30c7
b150cbe40e0cfb40dd630e9cf7b6f89db44535ef
82501 F20101114_AADQNB williams_j_Page_023.jpg
fb1bc5af6839b0cd764e831e97bd45e5
67f1964eaf2b39e7446eabb0918c33d864f7d9b7
26533 F20101114_AADRQE williams_j_Page_093.QC.jpg
b19250eae9970624d18eaeed2601ea12
cecc7fb409c9f854288b65c22e01d3d6ed3bb924
6245 F20101114_AADRPP williams_j_Page_086thm.jpg
a58fc14b8cae782b973c93dc1dbef83a
305e0e805c7b7872685f2b81d8d6682607481a95
28799 F20101114_AADQMN williams_j_Page_008.jpg
fbd894a8ece610b41620e695f9e5b3d7
2365b4105b726b1d0049cd8566c48a99762b7738
29809 F20101114_AADQLZ williams_j_Page_112.QC.jpg
d06cf20ef2f3a00f8676ac662c73f853
33b8c96b866ab9ce5d5a8184770aaef219c59e32
80631 F20101114_AADQNC williams_j_Page_024.jpg
b4e2529607810fd55515b10fe1eaa7db
fa8d73ed27b5ec78e8c779925f4225048dc08a8f
7031 F20101114_AADRQF williams_j_Page_094thm.jpg
958c36f647b4e83a2a685a4929672d07
6ddfca7e350c6c865d63f36536fad4173044a655
22318 F20101114_AADRPQ williams_j_Page_086.QC.jpg
2e3892f33aa03772f0d645ddf53f1a2a
af5dbee79f370267aad34b325611f08bb7cd9195
20665 F20101114_AADQMO williams_j_Page_009.jpg
854ea699c24ed38053d493fdfe8309df
593ba9098563913f8c0d4482fb7f1abbbf44dc52
82929 F20101114_AADQND williams_j_Page_025.jpg
86a6f3481496b84b6174da42509bbfca
b05033f636da7d2eafe0159a959011e258aaece9
30513 F20101114_AADRQG williams_j_Page_094.QC.jpg
a4e46f1ff26d52ed96ad14b47335c086
49ac1236d2d9086ebfcb11bcd34b8940c8c795ea
6428 F20101114_AADRPR williams_j_Page_087thm.jpg
54e750915147952fd5cc334ccc2cad16
23a96004bd1e53618a9065e5765587ccc21dced4
89209 F20101114_AADQMP williams_j_Page_010.jpg
83ffec343091bd65adcc6ab94c69c4db
f80c472c9cde35a94f340ecee596ebe840d8b124
84116 F20101114_AADQNE williams_j_Page_026.jpg
9ddb8296e224cadd7d717ccea3a8732b
b2003a09d8d9e882fb90b79bbd48323ddb71b92e
7160 F20101114_AADRQH williams_j_Page_095thm.jpg
1372101e85442db1b56660ca64beab01
4c1fcbcfb7106bf33111ac3990c5f5ba0a109ecb
24746 F20101114_AADRPS williams_j_Page_087.QC.jpg
6bdac62c177d45983fdb5f8c74754c97
03f605253e4e902a7ce1ab98e60594331e8e2543
32127 F20101114_AADQMQ williams_j_Page_012.jpg
bf5445e9eaddf5bb1d2c49ab5fd0f785
3ec56ffe946da15bf7bcadf23e48b1337f928e9c
88227 F20101114_AADQNF williams_j_Page_027.jpg
04f5244baf3f60661faddde996082a19
4f482224b8c024992fc64b1a613a39c4915e3988
31332 F20101114_AADRQI williams_j_Page_095.QC.jpg
fc8c8e29ecd5794a744e8e7c563bed42
2d60c2c44a473b7171d0b155b45b3880b86d59a6
7066 F20101114_AADRPT williams_j_Page_088thm.jpg
e69a1cd798df586485cc5b6a3cfb3227
1c24206ddd0b45c9bf119132b34c70520788e26a
22270 F20101114_AADQMR williams_j_Page_013.jpg
ec9cbc920ad1da15c993ad8111c96985
7c6fe53598ae44f323f93ba022612a130f39f956
92202 F20101114_AADQNG williams_j_Page_028.jpg
9cd5494e6a4471f1bbec34530a46f52d
51189cca6ef6b81646b175e095e95c503dafdb93
27293 F20101114_AADRPU williams_j_Page_088.QC.jpg
1b48b7d4629df60dcaa636591eed856e
0a7ba236aee126fa6b9fbf22f9cd054be6eefb7f
81191 F20101114_AADQMS williams_j_Page_014.jpg
45faa0b63b01a4e113b6c59e75bab3dd
045720287cd0c15e8b3bfde16d6ff15ef1015fd8
6822 F20101114_AADRQJ williams_j_Page_096thm.jpg
8ad51eee43dc3b166cb925785a359823
cad9688f667cd6a2f9fbdf80eb8e49d6a7bf3ce5
6385 F20101114_AADRPV williams_j_Page_089thm.jpg
5df63d3ebadf008c038e01a037ac8d68
51a8a5a8d77ca234e18090c6f8c8a2340e501312
25150 F20101114_AADQMT williams_j_Page_015.jpg
b352be7826443265a9a6999bf4c0dcfb
dc6258170a2e130f29a304aa6e76e98ac3593c21
91839 F20101114_AADQNH williams_j_Page_029.jpg
dfc8e787deec9c050b3bd2c23c96d317
1a550c4c08b7909a877aff182d46b2467a7360aa
28079 F20101114_AADRQK williams_j_Page_096.QC.jpg
dcb5d0e4816cc7ad6a7457d979e217cc
6ad20d6e0c3e8811a989d249cd7c359aa7e1085a
24226 F20101114_AADRPW williams_j_Page_089.QC.jpg
90f277b61563a5e74a28a09e838c0231
56670bed8fcf4829c8670e5cb6d0496adaf2b291
88687 F20101114_AADQMU williams_j_Page_016.jpg
e72e628e83fa24e17a5648e6d8faab75
3c40a44dc92ee877c209654b71457cdab118aedd
93169 F20101114_AADQNI williams_j_Page_030.jpg
4f5d31b7f2676fa9237c897a6144751c
d9087798f7dbf586afd18a744ad2962876b1155f
27165 F20101114_AADRRA williams_j_Page_104.QC.jpg
0a2af87c535c19723e00560c291fafa3
7ef159c4aceb19f371c407b2f8025a0e79dc6d93
6330 F20101114_AADRQL williams_j_Page_097thm.jpg
cc7634d0adabb7036f4ad3396b3775aa
df03922466c92441467874591d7aa001df3f5e49
7470 F20101114_AADRPX williams_j_Page_090thm.jpg
883b8b047f48c65669bccfdd221616bc
86945183df612031125fb63dfaed7fb00a986052
85331 F20101114_AADQMV williams_j_Page_017.jpg
bdb37222e2dfa36703357335d4b988f8
07045eead858b00190bb3ca691e097273188eb6d
86349 F20101114_AADQNJ williams_j_Page_031.jpg
25c06c012aa1d08e97971874791c856d
2228a81d76ddc89955355fe5bac5ed759c474c13
6721 F20101114_AADRRB williams_j_Page_105thm.jpg
1eb10458ba1f4a17cb2b1f68dbb8c85f
2f9301dfd289c2fb64105fcaa052e21f8af4faaf
23067 F20101114_AADRQM williams_j_Page_097.QC.jpg
b03caa77a6742fc81e84e5fefcc632f4
d022efb760e21d920d3e985cb6a59489275dabb1
28247 F20101114_AADRPY williams_j_Page_090.QC.jpg
2a7472dfe8acd508add9e77767e9733d
122faa83d105af6fc9a756104542f74d3e6a4472
44403 F20101114_AADQMW williams_j_Page_018.jpg
8e3a8e854bd1a1b1d55e65720b0cc52f
68a885b38604a2d7192e2bb935420a83a3db8ff0
89440 F20101114_AADQNK williams_j_Page_032.jpg
73da32a910852412bbb51f880d3a057a
d2392098aaea354e40e107dbe0edcdede155f383
29475 F20101114_AADRRC williams_j_Page_105.QC.jpg
21fa52c5303b63f61e74002474ec5208
9fef4d781b97f54ca67ba6c70a4577453d983bf6
7348 F20101114_AADRQN williams_j_Page_098thm.jpg
b24cff640a0c6519668a6542cbe059a1
e08250ee17e1b30436e7019c6b8e4cac08f05c82
6780 F20101114_AADRPZ williams_j_Page_091thm.jpg
786e9d125f4ac7370507e4f303cd14cc
42d4b38b5d68c8d3af24bac7987dcd6dc45e2197
83029 F20101114_AADQMX williams_j_Page_019.jpg
14383452ea54f001a695ecdaec65cd73
96aff2412cb1584519eb879fd03348ce7125559c
93668 F20101114_AADQOA williams_j_Page_048.jpg
f21f333ad0a78eedf3573ca889e8088f
72b39ef30dcdc335edfef1f64b3b0cf91320615a
89531 F20101114_AADQNL williams_j_Page_033.jpg
b5069040c53a44396b9211370758a9b5
a7514bd869ea1409ba0ae5ff10410a286c3ed6d5
6368 F20101114_AADRRD williams_j_Page_106thm.jpg
dc84e5de8d5a25e69aa2b0f9f37f8b60
90395e54eb025dfa74d3f6aba3fc420db2abb349
31732 F20101114_AADRQO williams_j_Page_098.QC.jpg
aaefb3b0d1ab217a1ff3a2b0ab1071c4
b4df4fe2764a01131fa6705fc7c7bceee926bbf1
88943 F20101114_AADQMY williams_j_Page_020.jpg
adc3bf09aedf231c26cc969998fe9b12
fcaa41f12c0b47944e219618157ff95ab5cb88ca
89543 F20101114_AADQOB williams_j_Page_049.jpg
1ac321db8188d1112289dcb5224ca0b4
e03d1499c37d901182a0d1cad2f970c06ad07988
89892 F20101114_AADQNM williams_j_Page_034.jpg
b051d3bf37a3914f67e2e251e1323d12
d00763c5f639e4bc9eca27afdfaa839b7a1cb1b0
27559 F20101114_AADRRE williams_j_Page_106.QC.jpg
e72bdbdd01d99e449ccb6c60bc8225ac
30c18bf928e8c8e475437003fc1cd1a3dbc29143
1300 F20101114_AADRQP williams_j_Page_099thm.jpg
4477af547efd9e661b0136ccacd4f7a7
acec902a6066fc92b76bf0a5bfb33d8beb8cda6a
80353 F20101114_AADQMZ williams_j_Page_021.jpg
bcd5d6838c5e1bf322be0c83525c7602
1ccafdf4d3c6676c4d69099a7a18f6200aacca0d
91644 F20101114_AADQOC williams_j_Page_050.jpg
5dfb74baacb0c2b7120b60044d16c969
5c4df1814cb5d0bbaa5a8e80896b1100bf1d65ea
88076 F20101114_AADQNN williams_j_Page_035.jpg
20861b4ecd3840502a3a1949c0825bef
f04a54ef289774a2db3582d51a45e0e9442d9b94
6500 F20101114_AADRRF williams_j_Page_107thm.jpg
75742b52ae6ac8aa8697ff5c29129844
54bde3884b95a09e44508e9fbd6a75ad52538f96
4892 F20101114_AADRQQ williams_j_Page_099.QC.jpg
91dd153c2b9a80d998972f6a8b2b2176
629c1eb301809938e6622504390064bafb8173cd
84228 F20101114_AADQOD williams_j_Page_051.jpg
f0e5c2cf72920ca401301dc007b58811
4e7dec26f0487da89dc8d5375037ae138d5acdb8
94170 F20101114_AADQNO williams_j_Page_036.jpg
46a7a5e96aec345f4eabc01054c72ed8
022a95765bad2dcdacb3996fb0fa247c9b5471f4
F20101114_AADRRG williams_j_Page_107.QC.jpg
cc9b70ddfc4ee25dcbfd56fcd636f05e
c2d8c163268521b9cf02b301e7f40725c533f54f
6687 F20101114_AADRQR williams_j_Page_100thm.jpg
a392ee276afac059c2d70719565ef020
5b216fa5ea2662db52bff024e9f18a902dd653d1
90215 F20101114_AADQOE williams_j_Page_052.jpg
a89632fdc5f2ae78454559c02e11e149
d45b8ebe02ae87d5cf45097adc1fbb3d83304350
84405 F20101114_AADQNP williams_j_Page_037.jpg
3e0457d6d239aa583fb9f83616030dc0
43b6dc231ffa386cccabba76025069d86e7332da
1584 F20101114_AADRRH williams_j_Page_108thm.jpg
edf4b6fde98d782c027df7c44968cb28
859530d2043e8e208df968fd8afdcbb685684c38
28403 F20101114_AADRQS williams_j_Page_100.QC.jpg
07371865409e0e88849d07904e4b483a
f7e48d06e9a45f360f55c10f9be00e1fc29af379
19473 F20101114_AADQOF williams_j_Page_053.jpg
dbbf38f33a47529ff98ad79da46aaf4a
928f381d76bef0433938d821a237fbeb7529a769
97831 F20101114_AADQNQ williams_j_Page_038.jpg
cc43629005444edde067924385f50c35
a9586d895437121291742303b2896b5522e76434
5827 F20101114_AADRRI williams_j_Page_108.QC.jpg
83c8ac54f7181756a7b54003ceed2400
33aca794f53b872391c6ddf454c0f10c840f2dee
6270 F20101114_AADRQT williams_j_Page_101thm.jpg
8b6f4e917e03e7a48b009e810bfdcc1f
0000d28bfae7f138dcd78dbc302bf3a1fad23725
78468 F20101114_AADQOG williams_j_Page_054.jpg
b771fe23262409d53e58cf8efd278cba
07873fb5dd71318036acf8e1fe97d7acc074f3b0
74240 F20101114_AADQNR williams_j_Page_039.jpg
fe3a83ca4b637a0ea3baad1d76bfe53d
e5d345eca24e4d7701eb7317115e5734bb4800d2
6757 F20101114_AADRRJ williams_j_Page_109thm.jpg
de8129b87f574d8cbb04c69d1dd45130
02d120407decbf1149a8f5afa29c19f32447c0a8
25271 F20101114_AADRQU williams_j_Page_101.QC.jpg
a97bcd0c3c7d11993fae08288f3a8016
9a02d653c7a593f679b8321e9056bad86e45d89b
87137 F20101114_AADQOH williams_j_Page_055.jpg
c3b378da5fcadb4edf9ad210ff02477b
93012f954ddc253e970ee6a4f2ae368d8262604b
88276 F20101114_AADQNS williams_j_Page_040.jpg
b237b44799287d6b001a391373c6e9db
c828bf752bab9d73081903a59b9c1b73f50a287b
F20101114_AADRQV williams_j_Page_102thm.jpg
5f94424775d9cc06bf1aa9561b43077f
e8d73d597f2b828bc5c932d57584f1a02cf9bc6a
80926 F20101114_AADQNT williams_j_Page_041.jpg
997a8af5f1b12128c1c0e0e465c152e4
1ceba3c47189fa6597e134eb86296d7775103625
29284 F20101114_AADRRK williams_j_Page_109.QC.jpg
f44e6ae73e74813ed8cbafaa777f34ba
4ddc7fcffa9690f6e831ad7de3d4893b69d93652
26170 F20101114_AADRQW williams_j_Page_102.QC.jpg
2487f6717fe469bde4c91fa131617984
02d6b7c99fd00ad456baa1cfaf5e61ab8fb188bf
86375 F20101114_AADQOI williams_j_Page_056.jpg
cc0caa092bc466d93d095120bac6d90e
57f8f9ad62a454c5b5bbdc59103ded379c75b523
87492 F20101114_AADQNU williams_j_Page_042.jpg
f88414f920c26db208aee62727f8b404
1464833d577170c5ba7914f1235eb7fc10bb1d3c
27979 F20101114_AADRSA williams_j_Page_118.QC.jpg
0a22925ea7194e1b202b10ec070244c2
5b60c905ecbe8cc1ea85f96ec257107994b7a163
6713 F20101114_AADRRL williams_j_Page_110thm.jpg
5340166ef608a5ca918e19320d7bb672
17821a58231c223829ebc6d6b047dbcff69c7b83
6618 F20101114_AADRQX williams_j_Page_103thm.jpg
e0fc7c0bd0d9bfe60fca8e28b89cd6aa
d57a301295ba69f1f904a9f3f52df94f30c05ea9
84369 F20101114_AADQOJ williams_j_Page_057.jpg
908194276f6d36eb4ba88697ea6e7e89
3275b26e83a8f15e02e20c2a74f88077c9b618eb
88177 F20101114_AADQNV williams_j_Page_043.jpg
12ac18145922abde2dd090968fd5497c
8dfd8dd03cb355fb5d04670f075b19489ba8e832
6980 F20101114_AADRSB williams_j_Page_119thm.jpg
60a9449142e2a0509ca04239c1b25d07
4a981f44e9ac81941407e7ee350756fcddcf3b3a
28749 F20101114_AADRRM williams_j_Page_110.QC.jpg
ae68b1f1e091b757496ea2e856e43df9
45c587d05564638927ec4d81701097b14ab6d1e8
28894 F20101114_AADRQY williams_j_Page_103.QC.jpg
233081fe2754405ba97e2cd2b942fa29
7d832f0c15d44a54d6d266d4b819bab1c8f495ab
85660 F20101114_AADQOK williams_j_Page_058.jpg
e27702c90908dde11d3e1cb865b0c138
d10ccb0f0e12faf3bb210df5506f0db80ed94c9a
92688 F20101114_AADQNW williams_j_Page_044.jpg
6abf7f11c676c573f6a7b276c2b1a96f
2663a0bed9c810fd73feb13b4f800362be82896d
29758 F20101114_AADRSC williams_j_Page_119.QC.jpg
954486bda775894b5fabf2e0751f617d
25f251a741dc4a39c270a5a13b22301b00c8ff8f
6740 F20101114_AADRRN williams_j_Page_111thm.jpg
cd1140142c84e9fef5f8728ce9b08b2c
60d85f2246d5057331f94fb93e16863f42de6911
6454 F20101114_AADRQZ williams_j_Page_104thm.jpg
7f07fbe75bf229d587b7a422bb35650d
ed82b333865f502321f3f1496b46d4cf049061fe
82162 F20101114_AADQPA williams_j_Page_075.jpg
6c471b5194d6cf3fd31cfba8517e71b3
37123b195df244c6b62d10c287fbe241d3d4f697
86630 F20101114_AADQOL williams_j_Page_059.jpg
050942b3e30a24bb1babf78af6bd0efb
a8c9b6b91a60d003dd68d3fc33b6d183c770ee1d
88216 F20101114_AADQNX williams_j_Page_045.jpg
00a1e410382aecaf6825f4c93edccc66
9aff9738e7e3c2afd7d9d0acfb14d92c20911298
5739 F20101114_AADRSD williams_j_Page_120thm.jpg
5ab6e77ee65d9a4cafaa101b26a29dee
4b0d5070f432eef5b340b768247496ce74a77be2
28553 F20101114_AADRRO williams_j_Page_111.QC.jpg
539864d79aaf123347884f68c5b13cc5
5b65db11e192876496b405254a5d9c3ce32557d6
74964 F20101114_AADQPB williams_j_Page_076.jpg
24d107a1ff4c1cbbf628c8a8a6ab285a
649927437f71e82b4f1621a5ca064c39feb8077f
92700 F20101114_AADQOM williams_j_Page_060.jpg
0cc038cf104425eb6a72f33949b498eb
79104217f80c0ad627d7f513e7ffdff6b8bb2dd5
90489 F20101114_AADQNY williams_j_Page_046.jpg
631f75f5adf3ee740d32ee808bbb9e91
2b0bd0a03da641d3e944164ffaa597fc08d3c530
24066 F20101114_AADRSE williams_j_Page_120.QC.jpg
df2e6eaf6f55a822f3ca8861b8f5b49a
07b8493998146db64b450a432358c310c920b605
6938 F20101114_AADRRP williams_j_Page_113thm.jpg
b7a93632a99cd5a7c0a604fac087b248
8df89e73fb4e4a12c2656a9bf8244680fd8833bf
84758 F20101114_AADQPC williams_j_Page_077.jpg
11524eb0fe590032579d2776d2f00988
a828b0962367c4c75565e62d3613bcae2d41822e
87339 F20101114_AADQON williams_j_Page_061.jpg
a773fd5b1725810fd3a44fe47809e047
7cb99075b25256e4d40fce44099e7db45b7a3f92
79097 F20101114_AADQNZ williams_j_Page_047.jpg
c4a289b5b5fbd233fffcfca6507b580c
4bb9f15db6a14093951b011311ad6f1cdb0a9138
6631 F20101114_AADRSF williams_j_Page_121thm.jpg
4ae4afe7192e1c24ba323fad515269c0
5cd9049007bbd04eed51cf534ed70042f1d730a6
27775 F20101114_AADRRQ williams_j_Page_113.QC.jpg
27f64a7f03ecd8e38f791cb14be809d6
2514179ee80d1e6c48e669d22f8e5e36a5199296
72973 F20101114_AADQPD williams_j_Page_078.jpg
5778008e01b1c65e44385fdebec89d73
ef618dd358bf295b9ce14c7062abac5dcc1f48ee
83735 F20101114_AADQOO williams_j_Page_062.jpg
27e7eb1f6504f2a413c9e809c1fccafd
7dc31a50f996cdb80e0bdf2acc017dd9d610a629
26534 F20101114_AADRSG williams_j_Page_121.QC.jpg
be4fc3660d5c659fcefd451ba07345ee
70b2e8c63d5cc12d3532ee0d2cbd62e07ae16204
7079 F20101114_AADRRR williams_j_Page_114thm.jpg
e01b03828b659de9dced1f20036a2439
ac56afabb8ad6ff1a8f8d9873f1611c83e030248
83827 F20101114_AADQPE williams_j_Page_079.jpg
50591ebedc3b203c2876de1fe20ceb76
9c1d6a60d58113cfb6017b07a6b9cda064823dd1
78158 F20101114_AADQOP williams_j_Page_063.jpg
6ec829681d08eb3bd8a07c058661cd6f
a0abc2d84fe277f56d652bacd77f3d079d9d6426
2925 F20101114_AADRSH williams_j_Page_122thm.jpg
b4e10b74999714d9ae0e793164d11224
3be12bde69717e4f29c264c7d8a3e5ecf7fa1a2c
29015 F20101114_AADRRS williams_j_Page_114.QC.jpg
30821dc16430247e5201ba22af74e874
ca7f1fc1f8559e83faba137221b1628f2a371570
41625 F20101114_AADQPF williams_j_Page_081.jpg
3045888eb0acf8a55b097d716ff87c9a
5f2519dadc3188895a37e0ac7476a1e95d4bd20c
91265 F20101114_AADQOQ williams_j_Page_064.jpg
0b511581818108f2380c22fe5a93b7f8
5c6b03150091eb64d92e7f43a0ec29c3a18cbcae
11639 F20101114_AADRSI williams_j_Page_122.QC.jpg
1689bf1ef4ad2780aa0e05cf6769913a
d71c6f7b7dac9fca97a358bf9c50e3945773df35
6700 F20101114_AADRRT williams_j_Page_115thm.jpg
47c18a0355ba1399f79d03beab4f7b3e
c2234ef7efea5ea633d7425fb092aecc22247a9e
28428 F20101114_AADQPG williams_j_Page_082.jpg
7fb0ace98b4a0feb9e3b0ad57b32c4d5
bf887689deeb0847bdd4c83a9ab7956eb35b66c7
60542 F20101114_AADQOR williams_j_Page_065.jpg
5607e61d9b72613ca88eef3608688b84
d591cfffb8fef094a8172e3148fa8e706ac6c388
142490 F20101114_AADRSJ UFE0021298_00001.mets
c01c0a221242e02a4e0a9569a82fae28
44aae33cfb30320fcf065e95a4ee2c47616b37ca
29578 F20101114_AADRRU williams_j_Page_115.QC.jpg
73f79434e6f8bc83637de85a53b5486f
4bfd9dd114c38c81fca4a18187d7be25aa6fe179
102497 F20101114_AADQPH williams_j_Page_083.jpg
f4fd02ff4990307c5ec047b83af3b5bb
c144413992d8f874b8a5098623fb4626aa058f8d
91704 F20101114_AADQOS williams_j_Page_067.jpg
cace6a865933267409eacbb100ff2470
c3729c9812318e006ca18dc36bfbf0cf54f266ee
6588 F20101114_AADRRV williams_j_Page_116thm.jpg
c78f0576511614b419275e620eafe71b
29a95b5a4faedad6c9788d8b2fe188d6ae8495ee
114256 F20101114_AADQPI williams_j_Page_084.jpg
4b334202871525479dfc8277cb887eee
e4177ffd38d32c7bfb77f42df805af8c9de6b787
79209 F20101114_AADQOT williams_j_Page_068.jpg
f6771df9779787f02069bd68ae594535
8d53cb5b238567845727be9ec6ab496b005dfb0e
28695 F20101114_AADRRW williams_j_Page_116.QC.jpg
a1af2828c3dd88fb15486dc2d54c655c
631e0349a1ecfe79f439cc2e37e833c40aa7d60c
67406 F20101114_AADQOU williams_j_Page_069.jpg
132b18704da5fa2a97526cd139d8be60
b47ddc6a4981a4c60ccc7058eaf1d526f3dc9198
6531 F20101114_AADRRX williams_j_Page_117thm.jpg
5f04979af55bb8a6aac38bfd4c6cda10
efdd4b4c96f9d13e0b88164f5bb7037532405582
111535 F20101114_AADQPJ williams_j_Page_085.jpg
8dd06111b711a7370681c7f911a835ca
7187e9dbb62eabb9121cc10f39c0b5013f130772
87679 F20101114_AADQOV williams_j_Page_070.jpg
53edeb5c920db618be44ab4226379825
7e33db757e867b3dd90b50f6bcd6ce91c8c7fc61
28639 F20101114_AADRRY williams_j_Page_117.QC.jpg
4b0107932b8e9b61ee922e5b07571378
8e277ee22d21d3c911fc1122761fbd3519e9b7b2
84502 F20101114_AADQOW williams_j_Page_071.jpg
d46e75f5db7f62a21f1d088a1127d2a4
71320dab28b991924620a0671003297dd3973e99
69138 F20101114_AADQPK williams_j_Page_086.jpg
f4fa88910807894c99bafad78c36b537
e37d79b53d7464b342be796ade89b5837014664d
6819 F20101114_AADRRZ williams_j_Page_118thm.jpg
2f443bf9ffdd590f3c0a5877fc4b60a0
d4abc7c53a500dbd8e512d7f5928ff775ebd9bd0
89413 F20101114_AADQOX williams_j_Page_072.jpg
e2c2c692bee195de7e1bc71b3f785f62
bccacdebfcd641dc55e1928e7bdb479d111f0c3b
90626 F20101114_AADQQA williams_j_Page_103.jpg
5977f14f3e70efb5227388e0d13dc23d
da0150f03b9ad503c9a5e1ce7b0e98b417f032fe
84842 F20101114_AADQPL williams_j_Page_087.jpg
dd8000c9f976f2b07bfeb22056779857
f8858fd9f34e896fdd6be4b1f185e0304d3b5bc7
83328 F20101114_AADQOY williams_j_Page_073.jpg
cb25fc319d746386306a5b49e1e70e2c
9093712f7923dc690fe768a5f5ac81502fe2b5f5
86874 F20101114_AADQQB williams_j_Page_104.jpg
c84deefc249edb4732d61e6c9d174722
f48e3cd0d9bbae58ca6d3cd2f5d5f9d0ed918aa3
84571 F20101114_AADQPM williams_j_Page_088.jpg
852c21b39416f549266a12cf6cf651ba
fbf1d41dcfba0f7d5809a32e16eceeb1f73537b8
78095 F20101114_AADQOZ williams_j_Page_074.jpg
95b5ec39b47112e546378afde5b600f8
1eddca7508a706908e3a0a1128712c6c2885b5e2
93034 F20101114_AADQQC williams_j_Page_105.jpg
fbe98236d7d447c5b5d0581bf248d165
3d76146f91196b80b3ee4f3717436fcc73ec7718
74282 F20101114_AADQPN williams_j_Page_089.jpg
9408ef4ca1723a2e681d3c6133c71ffa
ae4caea09149c444d44150ba5a21ae2255cce6e9
86956 F20101114_AADQQD williams_j_Page_106.jpg
8631a90cad216f3c24b991bbace6c360
d422fed20c55ca29572fa0092875f4b62589cf50
88053 F20101114_AADQPO williams_j_Page_090.jpg
c8c2dc58de28a0aaefcc29daf22c2992
025dca33658a32115a5f7957dcdc0ab26544a0cf
85280 F20101114_AADQQE williams_j_Page_107.jpg
23c4f3abaf7378789094011442719765
69e85acbbc3f0e0dff6868724a0941dea3cc934e
77737 F20101114_AADQPP williams_j_Page_092.jpg
e85af31722c6090c1ea4aacd287113c7
0dfccce5c4139c2b5f27fc9d7ff0fa84650ffe36
18327 F20101114_AADQQF williams_j_Page_108.jpg
3000b5b1b2698227b95fdf3f17459ca2
23b4e3705288f67a7cb18b4901f41a94f4b1b47c
103878 F20101114_AADQPQ williams_j_Page_093.jpg
d488ddbfad7884203a8740dff1e4c2c3
199253d0209feca3e1b9f5a9255cd3a07eec1e82
102420 F20101114_AADQQG williams_j_Page_109.jpg
e40f5de4fa2b1f92ea604fe0b9ee496d
b2211249b0e775eeb1f28dc239e756deb4cc3fc7
109094 F20101114_AADQPR williams_j_Page_094.jpg
960aea5dd4d5b862e7402e7b05681fc0
9dd1e1a6049dc7837ce419b143e3fd99b25e450a
99633 F20101114_AADQQH williams_j_Page_110.jpg
7339eccfde24158adb8bd77bbaf425a6
cd037cc7f5d075e6000418e9f1e293cfce7a3042
115306 F20101114_AADQPS williams_j_Page_095.jpg
344c628d352cb456c4889d1a84327912
292ed82f2a0132fb70c1a6bcff8a059ec46426d9
100401 F20101114_AADQQI williams_j_Page_111.jpg
00a9269ddfcc97da738f3bdde8e561f0
5cbb13db08d381eb3312b79c4ac7bce784ea0199
101918 F20101114_AADQPT williams_j_Page_096.jpg
7150a8d2ad873324110a438190cf1dd2
06e147acab82363869c5d3ee7fdc156314ba0d58
110619 F20101114_AADQQJ williams_j_Page_112.jpg
a9297f6b9c73c57fd39517afdc5b7dfa
e2c4992ae7716382d067fb6b36b1314d5043958b
69353 F20101114_AADQPU williams_j_Page_097.jpg
abab4d04f00ba37a3d6b211d33dc0cc4
e7ff5e24290c702b9966c796e02aa05bcdfbacb3
117194 F20101114_AADQPV williams_j_Page_098.jpg
d344daa650911ae717cf681594b1ab8c
361d240796a8723d6abff9bc33dca0d32b44060a
97394 F20101114_AADQQK williams_j_Page_113.jpg
9276854165016f2db54e5f1458dea08d
8c308430dd5a9da55057a6c3b44ab48dc983a964
14246 F20101114_AADQPW williams_j_Page_099.jpg
40c6a00931bff02cef043f391261bceb
c7b654bb20ffbb040745a8f28cd5305c0c2a044f
1051986 F20101114_AADQRA williams_j_Page_007.jp2
cd7c674c0446928dc672bfdda9f40602
93a51bfd57863d649953d1e1d5bcddbf757cf2e1
100492 F20101114_AADQQL williams_j_Page_114.jpg
0d2662f6b585ad5d23270d66d702fc4a
af3bf974d65a1c24bd9bb72135fa2f49fc443b67
90254 F20101114_AADQPX williams_j_Page_100.jpg
558507a27277d826dc6cd75266d79f98
fb3a9a843f06529daad212f0991b14055563a296
624821 F20101114_AADQRB williams_j_Page_008.jp2
2e049297a1fadd159d87659faa96058d
9587df6cebd332c412a3366159cf09cc1879b618
108041 F20101114_AADQQM williams_j_Page_115.jpg
f0222d06efb96d0d7d456c55767521ce
80c592eca5a307dd48540197ed7f4a9b6c8eaa05
79737 F20101114_AADQPY williams_j_Page_101.jpg
e76e784ad119a5feac65820049f0ab5f
55e25e8b6893771940da3831939068ed14958798
405343 F20101114_AADQRC williams_j_Page_009.jp2
c2377e38495693b43671b8f93780d68f
b8ed980a4d88c25feb52e9363d711982631b5c42
103505 F20101114_AADQQN williams_j_Page_116.jpg
eb1bfaff4a38ecc6be1daef997b6d9fd
60619dadbe11c5d76fa7b610fe1b93fd3dc36387
81913 F20101114_AADQPZ williams_j_Page_102.jpg
c451452c46b3496555186dc7e40f4635
00f0d8d650797a1a74987574404ebaf612f75c87
1051973 F20101114_AADQRD williams_j_Page_010.jp2
8e83598fb9f9fdf2b012ce5b0382ccc2
163a826f0205afbbe022eff7e70da6f52a5d4408
106302 F20101114_AADQQO williams_j_Page_117.jpg
48bd433d6343c603fc82e5d5bb121a4d
15c40ab8a9802b4acab8acb9087240b562d5fa49
1051971 F20101114_AADQRE williams_j_Page_011.jp2
e053163debe6a2085f34ab006e14f78b
83f73d39b0c2aa44438761413468d7be08733347
95992 F20101114_AADQQP williams_j_Page_118.jpg
aa31f63b1360fd61b6060680a34d87cb
47842abdb23c8bc257c6981555bc2251bbab0a05
40883 F20101114_AADQRF williams_j_Page_012.jp2
1d617b912471229a8b1cd08639089cc0
9e2e048e9dbef70b9d368c37cdf6f07cc6b58960
103842 F20101114_AADQQQ williams_j_Page_119.jpg
642c58ca27a39952fba0d6faccdab637
ebb324460bf6ad6f89c65c11c8ce4eabda67790f
27820 F20101114_AADQRG williams_j_Page_013.jp2
a562025c51dfdd2bba16cd46840d4dc5
ac6856447177e2bcae6cf9cecf325804aa80a26a
82188 F20101114_AADQQR williams_j_Page_120.jpg
c872e8eb7bf7b9b087e3943a3ce8a5fb
2a1ff50a26f77e33db7fe6210660aacd60cb1b12
101088 F20101114_AADQRH williams_j_Page_014.jp2
257fe44017cbb703247be911a250682c
e9e5799d63ec95b715292cffde13fed0e5c0d1dc
87036 F20101114_AADQQS williams_j_Page_121.jpg
01756f0042260b03cf2529285f066422
c716c5a334caabfca52ecb4d3a1047b16d9d14f1
31987 F20101114_AADQRI williams_j_Page_015.jp2
efa8fa852eea0aef0273e3a898072cd2
c645f04a2e451d7786671925030e330ce1fb7337
37425 F20101114_AADQQT williams_j_Page_122.jpg
b90d68ea66ecf276acc0daf44941a3e6
84c5f23d8fcc3bfe154755d4d099c96635157dfc
115230 F20101114_AADQRJ williams_j_Page_016.jp2
bcc5a1b4220453833ca843f71f7d1809
ad3d8f67970bd54598936c2446f28a7b96d1567e
25730 F20101114_AADQQU williams_j_Page_001.jp2
5f17fc0385057fef927560a6fb6b650c
90aba150087e3a1f40a87c7cea5fbd3d9c1372fa
109798 F20101114_AADQRK williams_j_Page_017.jp2
1d22e830cd722b137cf2f74e4b1a519f
32b4f812a992db619b7f5e593dc8e24bb8187c65
5610 F20101114_AADQQV williams_j_Page_002.jp2
b5d7c0555a3897aad7281272bfb05c89
d45462de4f0107df08100083fe35b573abf5947e
6664 F20101114_AADQQW williams_j_Page_003.jp2
6c4df59e3ac2f0f389197bbb4aed96ff
5d720606802a85e0e353d15e03eb6984ca02ee9a
F20101114_AADQRL williams_j_Page_019.jp2
6056dfb4337576e839663d2f35259085
dc7beea950bd5e9e589e8c867270f22f13b8b112
82082 F20101114_AADQQX williams_j_Page_004.jp2
d80ea54f91f721710a7e0dab21c6cb14
009721870a6132e26908cea6971ab9dd589dbf61
116609 F20101114_AADQSA williams_j_Page_034.jp2
80007f665a13045325bc5b128cd03b23
db6661417ff323db728702d556149be15f4e4fa0
1051972 F20101114_AADQRM williams_j_Page_020.jp2
0379448d2ad7d5bdecaf444d20fc5fa6
c9d46b53c4ffe7816988c40503f69e6913fa99a2
1051976 F20101114_AADQQY williams_j_Page_005.jp2
830479db5b11c10a167207e8595e463b
80aa9656b1d46d81962ba5ccee9560c2c8bb0cc1
113907 F20101114_AADQSB williams_j_Page_035.jp2
79f21cc78198c5416a6a1551773045d7
6b28ad6fa6683b212cb8abcd9342ec7227958005
1051982 F20101114_AADQRN williams_j_Page_021.jp2
1764b2808be5560c7cfcfe9a5670e30c
bd431028ed60d99653cebd7fa1d5c9dcb7130cf3
1051979 F20101114_AADQQZ williams_j_Page_006.jp2
be645c0b21b19cc5a06c26c4c5281d05
210540aa95f6fb17a227e641d55b6d82e8395dee
121910 F20101114_AADQSC williams_j_Page_036.jp2
4334804f79d5739adf8445b72a7052b9
e4aeddc79b6a47112fa08e998fbc67ab151562d3
114070 F20101114_AADQRO williams_j_Page_022.jp2
7114c902bc3f428ec6bc5218f7e4417a
71078c94bb74d26e8e79c8b58251eecb079557d9
1051928 F20101114_AADQSD williams_j_Page_037.jp2
c9175c87fb5a50cf79b53ecd3d885918
eaba40c87fd682f3c11000b24d91dbdcdf4f5ed2
105866 F20101114_AADQRP williams_j_Page_023.jp2
3d236af93c9364a01ef32539213c3299
7a0d1d4d0acc9a51fc3156a1e58113668170e95d
1051962 F20101114_AADQSE williams_j_Page_038.jp2
9f73bb75c61d68577316bc2ada24948a
6eb7c85a2b6596ab4e1c761ec07ff0929d8b6b1a
1051925 F20101114_AADQRQ williams_j_Page_024.jp2
4b27f703d30d36fd95a7f8269538a917
76f5b2a2060c5df256494fe302401778d29e2cd3
1051983 F20101114_AADQSF williams_j_Page_039.jp2
8a389c00c1c5bfac3bff289a5588132e
3182b2b8a70d3d9cce71f9b01b060e6319a98e6a
1051920 F20101114_AADQRR williams_j_Page_025.jp2
8c9dba49f0241d7535f0f20734a90ca9
7063df05bbcc91c10067d5ec9e3af5779a50f3c5
114766 F20101114_AADQSG williams_j_Page_040.jp2
246bd2a918b7b3fd4d168387e2d677f9
dfd387d52636d5a09f03853ac26cadb57b335071
109596 F20101114_AADQRS williams_j_Page_026.jp2
44867bdd07396bf52c11ddcab726f046
569d3d37c6513824dffee12d20c2eb0a953e0934
105842 F20101114_AADQSH williams_j_Page_041.jp2
955bf91568c6b4a4ef86553049792160
fabf9170def59a4a9b514d29fbb42e97b0ad9a64
114847 F20101114_AADQRT williams_j_Page_027.jp2
f25161d162957dd39662f67fde27821d
f40cb1bd25808b87f28d5b2d1d03b3e5f4f76708
113477 F20101114_AADQSI williams_j_Page_042.jp2
4d0cdf30cb8eb26829791c827b95835f
71080dc98051bdb094eb604eb7d7f955a89881eb
120790 F20101114_AADQRU williams_j_Page_028.jp2
2d65ec37468d6a448c09fc9ed22d1551
6166ddf2365271d8505ab7791ef58e9271545243
114354 F20101114_AADQSJ williams_j_Page_043.jp2
79fe02a781e023086e45c96b68cc75d4
4136737eab5717ba1080bcd5046f81c523609945
120196 F20101114_AADQRV williams_j_Page_029.jp2
8391865bb72f96383e5a5921ec220810
3f56f2b699622cd3bef0247a00f629d8b6e34f03
119904 F20101114_AADQSK williams_j_Page_044.jp2
bed7b64334ff35a4bab51bee13d932fd
63bcf762dcbd5da4304a41dc8a9837a74f614579
118908 F20101114_AADQRW williams_j_Page_030.jp2
d1165662c5aaed9ae6bf108737396a97
c45f9337f41d7bef7f9571a1a4ab87bc78a09486
116646 F20101114_AADQSL williams_j_Page_045.jp2
6af529b0522af29bc4b30c764f29bff4
539d470aea47c98c2c07b8b3cef2ea743a346a7e
114045 F20101114_AADQRX williams_j_Page_031.jp2
a9a78220dd5ba28f831fd232e6cd1c74
45262828482d93c29c6ec5d7b2710073db4edf81
118478 F20101114_AADQTA williams_j_Page_060.jp2
74a0ec82755725e5b9c5ff93e8ee8403
0eacc019ab8b76b8bad8617e71124beb12a2c79f
115940 F20101114_AADQRY williams_j_Page_032.jp2
b6965ef7695732a79431a05fc86d6974
18cbcdd157fe967607bea65892e8e616cc003371
114033 F20101114_AADQTB williams_j_Page_061.jp2
968c5e7a1871d3a814aefd02d017bfe4
a32ea3eed4474f0cbcef7ef1ab96a99e4926abad
118559 F20101114_AADQSM williams_j_Page_046.jp2
640af9733828c1816295ec6edd7ab7cd
f6c7ae10abb14d4da9b13b7659dd2da44e616472
115320 F20101114_AADQRZ williams_j_Page_033.jp2
394adcdbe36866e60a98f86fa3a822b8
1966a7f5000ddc33ae0c3be7e3f2a09f21728d1c
108618 F20101114_AADQTC williams_j_Page_062.jp2
9ae1460898642255057a36ac8d4d5d28
ec2baeb6eb60fc9829723e3c8c320471da8ee735
103750 F20101114_AADQSN williams_j_Page_047.jp2
26b75c09f125a134416dcb305c58f75e
f5c3b9ad9b7a7b166517e8206af38d8c73eb46bc
101227 F20101114_AADQTD williams_j_Page_063.jp2
7402cc720abda978dac87adfdaf27da5
23e115b66e7d2d4733b33abd7c68b4f895582eea
121655 F20101114_AADQSO williams_j_Page_048.jp2
6b027c4b6d04f78ee9ebb64b4c4757e0
e612c1099a82f4ac704e03a23a994495c09989a7
1051981 F20101114_AADQTE williams_j_Page_064.jp2
850e50d58461a9a85fb68b1797af6a72
751452ff45693be436332b0ad572dca9e5886ed5
118021 F20101114_AADQSP williams_j_Page_049.jp2
2d17ad4fab1cabd913802cbda96808a7
f1fde48c14b82c4dfd8223859e5eae34520f92c1
970767 F20101114_AADQTF williams_j_Page_065.jp2
49ae66f809f2240da8078417b429798e
79a146c95260ec92fffe79f700b48cbe228a2da4
1051977 F20101114_AADQSQ williams_j_Page_050.jp2
b5665d16e1f3c597528ed64da6912108
c6444239313822952b088a8c6fe4f7cf1a135d7e
1051985 F20101114_AADQTG williams_j_Page_066.jp2
ed59ae5be0f77d04eda2e7d2adcba250
e09ac9055de20f721b848901b755488c1281695c
109023 F20101114_AADQSR williams_j_Page_051.jp2
518e43f3ff0212b179a6b190aec13eeb
c7eeb5694fd31c443178ed6d2f796f2c25a2b117
116234 F20101114_AADQTH williams_j_Page_067.jp2
2578fdbaea4c65b1819dca3a8ff8f16f
256ab605222eec288783e19dbf0d551bd3927c91
117488 F20101114_AADQSS williams_j_Page_052.jp2
9500a97ccc9897cf131bf48830bfc918
4540d09c6d3bfe0c083980cfea3e103f30b08894
1051963 F20101114_AADQTI williams_j_Page_068.jp2
a4527528608cc24501931c16916647a2
4480a9ff2cc52b7286fff23451b3e3e5f1394702
24936 F20101114_AADQST williams_j_Page_053.jp2
08b8a4dd37f498d730804a530a6f640b
a9b991872e54df3fe4d6156c6577f716b73eb1ca
84803 F20101114_AADQTJ williams_j_Page_069.jp2
a2bc14e4b4df4d330933ecb2d2a72a7b
0641c9e1a238a613377714271175f58cf4ff3a45
103194 F20101114_AADQSU williams_j_Page_054.jp2
6d58a23ce2953cef098f2a7e836eaaa8
77247cff6aba348e52781f2dd56f5209f8c15f2f
110094 F20101114_AADQTK williams_j_Page_070.jp2
72bbd141dfbf8efd5f657ff27b0f1d13
6119e097bffd259e41e32e4726dacc718a4e3332
113029 F20101114_AADQSV williams_j_Page_055.jp2
7c7ebbb6030b26519fed457d69fd1203
ed9bdf67b81758332d8cec47518edfd42a3ca72e
108863 F20101114_AADQTL williams_j_Page_071.jp2
600884b5857d4ad6b63b15a05a8162b2
b4f630c1178509ca47d678d5f35e515a141e4618
112648 F20101114_AADQSW williams_j_Page_056.jp2
df88cea43eb85b7f6c157cc145c374f4
59cc8bdd18f613afbc51b05a3279f2f307c5ec20
831900 F20101114_AADQUA williams_j_Page_086.jp2
05e9a216d736df0db25a3b6c7bc8029e
e0d3bdef9473cb4ae61335512251bc05075fa708
113524 F20101114_AADQTM williams_j_Page_072.jp2
361aa9c7649521e87c8f29c1b7617808
ab829fa1bb8e306fbba783d4b6b6d4a6273716f2
107743 F20101114_AADQSX williams_j_Page_057.jp2
d3fa8fa64b8cf59a9a2d4e6e62c9a569
f8c6ce7fefdfdd776544d58b46e87a2a539b10fe
1021912 F20101114_AADQUB williams_j_Page_087.jp2
800c52b4cec60e89753b726059354312
9f12be7e3f6005f48977f93409907b8bcc389e06
109430 F20101114_AADQSY williams_j_Page_058.jp2
34e28ce5ef3da847acd534ee9661b2ea
0800c5a345217d01659aa09ee1df6db64162d798
1051970 F20101114_AADQUC williams_j_Page_088.jp2
f443db1964a9d006d1060aee792b605a
a1f33fd491259fdf55b7b82d07336a899cc472fc
103753 F20101114_AADQTN williams_j_Page_073.jp2
048d07197092d274c24f189417d6635b
6440b397439f532e2a75e2ce4c5b33510372dcb6
F20101114_AADQSZ williams_j_Page_059.jp2
850d7899014d17dc6c5adf33742978e9
f8f5ecada35c69f7de25e76ffaa029de4c29eb5b
908212 F20101114_AADQUD williams_j_Page_089.jp2
1e49d4d81c3c735b9df20901f989aa4a
93069383860798541028fe5ecb63f2563ceafac1
101176 F20101114_AADQTO williams_j_Page_074.jp2
6373276854b3aff2fe3beabefc24a8a9
c7e424dbee2eb1fc9e847f0a51565ab2dda749db
1051939 F20101114_AADQUE williams_j_Page_090.jp2
90605b8945d4cd58d59f1a70169fdbc5
e4f11cbbeb3bcee0e9ab04df7e80fa13bcb7ea7f
105278 F20101114_AADQTP williams_j_Page_075.jp2
b7929e72c2971a2261592a658fe1a19c
93010eb6a1675cb72d462ca56ab9ab38de59f917
F20101114_AADQUF williams_j_Page_091.jp2
39c5ad49063a2159b7739f2512619a50
4616f9d4e7304657e8b352660064aa6e7882ad70
93394 F20101114_AADQTQ williams_j_Page_076.jp2
7d55e158f7c60eeb8881a1d7ef3912a8
a3143a90883fe42371f2fcf4d5e89fc8f2268360
993480 F20101114_AADQUG williams_j_Page_092.jp2
1cb02a915eff6f7c18d69384349d5f16
c2ca759fbd79ffce681b01cddbe904a00a2368d4
107095 F20101114_AADQTR williams_j_Page_077.jp2
948a4f396cb11665e3fdc6d01785592a
a7264903d95cc76316938d069454f27292957dd4
F20101114_AADRAA williams_j_Page_122.tif
f5aac293852799f08e1f0bb66f468416
1bc7ea414a43c39c91dbc8a9485a25c40068e25d
1051792 F20101114_AADQUH williams_j_Page_093.jp2
cf38c86bf57bac4c74f3c164842e3b3d
dc47afc61ed43b16da230310ffef4691dbcac558
92772 F20101114_AADQTS williams_j_Page_078.jp2
0c6088af6366e13e8b9eda5d6c0e35be
93b6a6110e044a411b7a0a153f33dc9bb5a2d629
8738 F20101114_AADRAB williams_j_Page_001.pro
30015a71014ff22b97ade55c27685685
a71db35d30203b916d05238f954044944af77837
101794 F20101114_AADQTT williams_j_Page_079.jp2
fb22e0dabccbb62cb11418f93c941e9e
52aeba78ad1b38dd595addbf770b93a55a0b7a6c
1560 F20101114_AADRAC williams_j_Page_003.pro
a8e6a613ec32e6fe10faed40ada9c693
228cdbe80017b98c8d74565ac67b65f88fda18e6
1051761 F20101114_AADQUI williams_j_Page_094.jp2
0c310d3131bc37a995ebb2524b4b8cbe
9225f545e3f014ba8f3ec0a6300db6f4515ed033
98800 F20101114_AADQTU williams_j_Page_080.jp2
95611766cef5e6457a2cb81f653acb9b
be605fc8ddfe2c47f41c1feab3abedc50f292254
37018 F20101114_AADRAD williams_j_Page_004.pro
3ce4c0f1e50433e3312e972de6b79008
4cb24a3b90885121a3a492f7362e786f6306aca1
1051980 F20101114_AADQUJ williams_j_Page_095.jp2
def934da4ddb27a925ed2dfe8d04611a
e253d6cc30de61d5cfe71cd8c4171b19158d5600
49866 F20101114_AADQTV williams_j_Page_081.jp2
1f5c424201c8664b80306ad170ab412d
43a73bf4316afbcff43602fd758c82657d7007c8
84216 F20101114_AADRAE williams_j_Page_005.pro
1d4e0c3a2aaf1f427e0da8eef6164a9e
c580b4a52fe93502673a3157c8ee6651c7723b87
1051949 F20101114_AADQUK williams_j_Page_096.jp2
0780e22c0affba787a4b651767b273d5
0731cb7151023173febb54f716bac4701b9c7b7b
35009 F20101114_AADQTW williams_j_Page_082.jp2
6d92f165ebc0a16fedbc6c2aed8fabeb
631ae77939bc1eddfdd6b190bbe1712039e6742d
100808 F20101114_AADRAF williams_j_Page_006.pro
c0e49d143f4652b72393dc8e2a9ba132
a23b56427026bc33a012b037999b090c776cb004
824533 F20101114_AADQUL williams_j_Page_097.jp2
8e16fc780877ab0f3805726301453b11
c1fa1b76238687e531c6816eb804c5a34d81eadc
1051893 F20101114_AADQTX williams_j_Page_083.jp2
d0810c4b1040e1262d160e5325024ee0
f6ff9aba400277f58428b5dbd4a7e7ba0e8fa693
20129 F20101114_AADRAG williams_j_Page_008.pro
e41d7b503cd8b2dbc876fedaa73583d3
36d0f10640e2aaa72d84202383b6bc4ff33110cd
138126 F20101114_AADQVA williams_j_Page_112.jp2
59511ceaff4185a6a1e1a6e227e31c86
8bd5b04cd9e0dd71c8af1cf1cf272f14089aac20
F20101114_AADQUM williams_j_Page_098.jp2
403f18ddcdc947b08acca97bb21dbd5a
14dab6109ff207b60ba628b1c40971dfdafc4f38
1051922 F20101114_AADQTY williams_j_Page_084.jp2
561dda0733edca1bee4b78dae58a4e39
52441bb05df5aaf03acb3051501a734bf21718bc
11236 F20101114_AADRAH williams_j_Page_009.pro
dccf1944d0766d85c5cca7fb7e569c60
00174b9e67088a8161af96bbe3309888f1f54310
123541 F20101114_AADQVB williams_j_Page_113.jp2
a28c73b20f778188a0ebaaec16dfe4b9
80d8620e511bc0370c2286aa7810c0a49820a914
18129 F20101114_AADQUN williams_j_Page_099.jp2
54801b9e2b288db2102cb85c559755a4
bb7f0d3d60d5c04ca17cf15090ba5f106c731ca0
F20101114_AADQTZ williams_j_Page_085.jp2
fd410a120350f6c48a13b9c6377026b8
8d869b8781c49b15934840aa31fdae3374b7e324
59945 F20101114_AADRAI williams_j_Page_010.pro
bf9a99bf68171f42a7d34ad104275f8a
a40f6057a534651020cecc1a9b5e1f3a44b086fd
136839 F20101114_AADQVC williams_j_Page_114.jp2
108f0f2b3041a5bc874283ce5cbe9ae1
98f710bb0b16a7e82735f31d976831d3700568b7
F20101114_AADRAJ williams_j_Page_011.pro
0effcdb6133938b9f2991a1f7e5fc503
b5022c4828d3d5cfff0e608cf91e411218c7b941
136808 F20101114_AADQVD williams_j_Page_115.jp2
a3f35a74f74de6673d74330f0ebcce3a
f1484c084bbac01cb18d31398452b785b6ccec20
115412 F20101114_AADQUO williams_j_Page_100.jp2
1ecce8e2a5b4771a49719b2b8e611052
7464220477242411f60c33c41f2f829884079811
16290 F20101114_AADRAK williams_j_Page_012.pro
7e6021afa9dc2c1a7dc868c28c66b1cf
9898aec35bb6bb2e1fccac4c04e48800ecb14d87
133608 F20101114_AADQVE williams_j_Page_116.jp2
2ca8b19782b86557c10d416d6c2401f8
3f85b5a6e5d2e44dfe033321f995db0d91f1bf7d
103510 F20101114_AADQUP williams_j_Page_101.jp2
f9b2ceb4d2e84030de1a840ae3673bff
0fc744968c480646c230e67f16f612a896754dc4
10179 F20101114_AADRAL williams_j_Page_013.pro
d948556d958a56da6ce36aef10b564d6
fd9b424e42ecd617b2c441dd0b23cd1af7359600
132753 F20101114_AADQVF williams_j_Page_117.jp2
61ac0decf87bfcec5bb4086391e7fc5b
462e5119a021a27eaaf05618dd22d9784684ea15
106468 F20101114_AADQUQ williams_j_Page_102.jp2
487f02d15d967de49e33ea5579d17c91
59334c6b2b9e376f47ea5cb364c04bf4d93309b8
56908 F20101114_AADRBA williams_j_Page_028.pro
9d27bea2f2b0c5d2c63859171df981b9
526fccf3128886d611356cbd592fe80fd81b756a
46536 F20101114_AADRAM williams_j_Page_014.pro
03779f16840d7c3533cea47d71c8e252
dbf854f030f4c0e28e799b39f685a461f5f830e9
128387 F20101114_AADQVG williams_j_Page_118.jp2
f86acd8c19507b9b3889ebbfde56f625
1c6fbf55381649aafaef356952766e370c18d29a
117474 F20101114_AADQUR williams_j_Page_103.jp2
e010b5a3155b6ab67ee6bae320b37d49
63121cc7d63feaa3884921e421910777a8ec8ab4
56097 F20101114_AADRBB williams_j_Page_029.pro
7b8c3f498b9fe79e5489644d09b1300b
af2a49ff19a9ebffee6561ccd77dc3230ce00c69
13618 F20101114_AADRAN williams_j_Page_015.pro
f432ffd8d936608bf2de7e4edaebef01
bfd88094263ba3da91fdf5f4c5aa98139ba1ddce
137770 F20101114_AADQVH williams_j_Page_119.jp2
6d7022ebca92e2a82e710a59fc055e7c
3d783beec59a5496f707cf3db39e31f618f8f739
112276 F20101114_AADQUS williams_j_Page_104.jp2
5e808219e50335665a2d3208e31f8791
e3d10f079557e16a35f5c2db67055af2bfec1ef0
55776 F20101114_AADRBC williams_j_Page_030.pro
dcd160a507247737e445afbaf608a2f6
86e490f81cbd90c3a19932eed076aee4af4106d2
54651 F20101114_AADRAO williams_j_Page_016.pro
47e58a4fa08dab752a63b4144cb940fe
da3a7b140fd8b1bd99689361fe48bfc8567497f8
115264 F20101114_AADQVI williams_j_Page_120.jp2
05aec464992c0a3c51098c3ea787e2ec
d83bdc3633bc8f2c770a4de6d65e6ba5ccf244a3
119597 F20101114_AADQUT williams_j_Page_105.jp2
e14d28d888eb70168e871d5c5a6c2ff0
95344bbfcb7c85b88a8e421c823d0619e722ecea
53447 F20101114_AADRBD williams_j_Page_031.pro
ef9cc7970d55956868b4a737e0a9a438
cbfab412b7493bd04c035cf1b87da86c9e079db3
52181 F20101114_AADRAP williams_j_Page_017.pro
6c60fac1f0bae92e1bddfe75d3991a94
5ea55452741eb8bbbf343ba73073898f43a5dbc7
111441 F20101114_AADQVJ williams_j_Page_121.jp2
28d9aa6daf5c0ffd3d19a669ec9f4bae
f584bc271d80687b119a22ff22478ebcf8edcd6e
110566 F20101114_AADQUU williams_j_Page_106.jp2
e2bc94f80a11a5fed9cc45273d0bd016
0378c221ce01a8c221854e94abb8eed7cf386183
54521 F20101114_AADRBE williams_j_Page_032.pro
e7fef7ad7c95fa902889a4c4fd0b9fcd
0ff5eba2d960ce3ab931cb24e7bc6c172795c69f
25930 F20101114_AADRAQ williams_j_Page_018.pro
cd05109d40809bfb620bdd22dfc97b58
f1d7d69e2875356a2ecff4b41668f39070ae90f0
47273 F20101114_AADQVK williams_j_Page_122.jp2
1e877e7092053fc7badeed8023971fa9
c5d2c5e946e5e09ddef848709caefc0fb9f9c9ad
109529 F20101114_AADQUV williams_j_Page_107.jp2
fd547655fc7c0643db7b208687194837
f674a3a9312be18e1baef3b875a0dab38cdbc323
17576 F20101114_AADRAR williams_j_Page_019.pro
54b95fed88cf49fb2db884935f8c2173
d9fe531200f75028c6707cad34203043734a51b7
F20101114_AADQVL williams_j_Page_001.tif
a527d1bf15f3b20027f0c758db7f0886
62a2388f30b829abcdbeb6558a47571bc941d280
23257 F20101114_AADQUW williams_j_Page_108.jp2
9f161d3fe8d6da9afd0f790eae8b9261
3b1e34652cca93524a55020fe6afc5df8bad7ba2
54699 F20101114_AADRBF williams_j_Page_033.pro
c1717a92a16bf875cc2ec5aedf47f62e
9ded4a19ac1f7d2a72b6a40a80f965a014c2d2de
F20101114_AADQWA williams_j_Page_016.tif
37d32f8e8c44e923061fae243a1550ac
461f800a6ded9674b112526f538d705081361d9a
49690 F20101114_AADRAS williams_j_Page_020.pro
1adf46c9bb3fc909857bfeacf4d04cd1
957c5b4e8d91e63146b7e74d2e1a71446c10d2d5
F20101114_AADQVM williams_j_Page_002.tif
ad8fadf00b3af37060563b9ae6e322a3
5b44906052ce062c2653798bd2ee65f5ad9f684a
129497 F20101114_AADQUX williams_j_Page_109.jp2
8d406e1c510099e045b5c01d4a23297e
498fc433db89e2bd388eaf9b811661ce73c35acd
55516 F20101114_AADRBG williams_j_Page_034.pro
4694d2bd03a97488a89404b0f03d12b6
7f3b5c7af8bc9e5a559d853f3f7b63572ab1d5dd
F20101114_AADQWB williams_j_Page_017.tif
32d37a86943677388c9be3ceddf80105
712dbc7975ae009b24e8827daff848f6a8d8a5df
40465 F20101114_AADRAT williams_j_Page_021.pro
262c094c29961742fddff6d6d6bd2012
1006855b83728d34d773127aa590f95e8e200cb0
F20101114_AADQVN williams_j_Page_003.tif
1d03999aeb919eabefd60ad24a787cec
9805f2e8c2e68207713fe10e058b61971cecb637
131129 F20101114_AADQUY williams_j_Page_110.jp2
912a720837d81438cd9f21307c593e1e
4cada81863017c93c27dad6f830c067e6a388ab5
53828 F20101114_AADRBH williams_j_Page_035.pro
4659622a450894581912a5159ed58fc1
d005af37417efcbd9f436c7ed1dff42d5331dc1f
F20101114_AADQWC williams_j_Page_018.tif
e06af4540645927c30fba4346e1a2922
b0fd46a4acc6fe27dcb447eb55d881954279bbc9
53015 F20101114_AADRAU williams_j_Page_022.pro
3194d48a17a80466f046a13b57b99d9b
cc92434305a79a4a5c3c22a9ac371d335b75266e
F20101114_AADQVO williams_j_Page_004.tif
379e3277654bcd1cda0c45cf776d9e6c
eff1c39a02192d189a612cfa7770fedc89330aaa
135089 F20101114_AADQUZ williams_j_Page_111.jp2
9c55b8611716798f2d369e62cf315990
74a08b1cd5d60782c66ff2f560423c841ec9df75
58177 F20101114_AADRBI williams_j_Page_036.pro
843aa13700f8b0f2ae0977837322f162
03f3a8cb77d8b34141868ec25ba4d85774f517aa
F20101114_AADQWD williams_j_Page_019.tif
e7b277f924848882cfce048e2e1fdea7
b1fdf57e4c585c5afe3837b0b2410ffe91915154
49404 F20101114_AADRAV williams_j_Page_023.pro
ee80ba19104d22cb413eba22d0fdee8d
2d0c8163d4981738c8d02068d9cdbd81ecf89bd8
36084 F20101114_AADRBJ williams_j_Page_037.pro
3cff585a0c1298837d1b78b6ce5cedc8
ec099e86c634b39e468a3475d080d8e4881b16d3







THE ROLE OF THE Wnt FAMILY OF SECRETED PROTEINS IN
OVAL "STEM" CELL BASED LIVER REGENERATION




















By

JENNIFER MARIE WILLIAMS


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA

2007





































O 2007 Jennifer M. Williams




























To the rock that steadies me, my husband Matthew.










ACKNOWLEDGMENTS

I thank my principle investigator Bryon E. Petersen for the scientific knowledge and ideals

of perseverance that he has favored me. He has graciously humbled me and rewarded me when I

was deserving. My mentor in college, Dr. Jerry Goldstein also provided me with the desire to

understand the unknown and for that I am truly grateful. I would also like to thank the other

members of my committee: drs. James M. Crawford, W. Stratford May, Jr., Naohiro Terada, and

Barry J. Byrne for pushing me to evolve into the scientist I am now. Without their continued

support and scientific dialogue I would not be prepared for the scientific world outside graduate

school .

I cannot explain the importance of friends and family. Never once have my parents or

family told me I could not achieve any goal toward which I set my mind. My lab mates and my

dearest friends, Kara Hrdlicka, Lisa Stilling, and Emma Westermann-Clark, have seen me

through thick and thin. Never have I been without a shoulder to cry on during the tough times or

without a hand to squeeze during the exciting ones. For their time and devotion I can only send

them smiles in return.

Lastly, I could never have survived the last few years without someone to maintain my

sanity and keep me on track. My husband has given me everything I have ever needed and more.

I love him and can never tell him enough how much he means to me.












TABLE OF CONTENTS


page

ACKNOWLEDGMENTS .............. ...............4.....


LIST OF TABLES ................ ...............9............ ....


LIST OF FIGURES .............. ...............10....


LI ST OF AB BREVIAT IONS ................. ................. 12......... ....


AB S TRAC T ............._. .......... ..............._ 14...


1 INTRODUCTION ................. ...............16.......... ......


2 BACKGROUND AND SIGNIFICANCE............... ..............1


2.1 The Liver ....................... ...............19
2.1.1 Anatomy of the Liver .............. ...............19....
2.1.1.1 Structure of the hepatic organ .............. ...............19....
2. 1.1.2 Microarchitecture of the liver ................. .....__..................2
2. 1.2 Functions of the Liver ................. ...............22......... ...
2. 1.2. 1 Homeostasis .............. ...............22....
2. 1.2.2 Storage ............._. ... ... ......_ ...............23....
2. 1.2.3 Drug and toxin detoxification .............. ...............23....
2. 1.2.4 Liver endocrine functions ............... ...............23........_.__
2. 1.2.5 Liver exocrine function ................ ...............24........... ..
2. 1.3 Liver Regeneration .................. .... ...... .... ............ ... ........2
2. 1.4 Hepatocyte Transplantation for the Treatment of Liver Diseases.............._._. .......26
2. 1.5 Hepatocellular and Cholangiocellular Carcinomas ................ .......................29
2.2 Stem Cells and Their Therapeutic Potential .............. ...............30....
2.2.1 Pluripotenitality of Stem Cells .............. ...............31....
2.2. 1.1 Embryonic stem cells ................ ...............31...........
2.2.1.2 Adult stem cells............... ...............32.
2.2.2 Stem Cell Therapeutics............... ..............3
2.3 Liver Oval "Stem" Cell .............. ...............35....
2.3.1 Oval Cell Biology ................. ... ........ ...............35....
2.3.1.1 Hepatic oval cell compartment............... ..............3
2.3.1.2 Oval cell plasticity............... ...............3
2.3.1.3 Oval cells in therapeutics .............. ...............40....
2.4 Stem Cells and Cancer............... ..... .............4
2.4. 1 Theories of Cancer Development ................. ...............41...............
2.4. 1.1 Cellular origins of cancer ................. ...............41...........
2.4. 1.2 Stem cell theory of cancer ................. ...............42...........
2.4.2 Oval Cells and Liver Cancers ................. .. ......... ...............42 ..
2.4.2. 1 History of oval cell theory of hepatic carcinogenesis ................. ...............42
2.4.2.2 Evidence for oval cell theory of hepatic cancers ................. ........_..._.. ...44












2.5 Wnt Family of Proteins ................. ...............47...............
2.5.1 Wnt Pathway .................. ..... ...............4
2.5.1.1 History of the Wnt pathway ................. ......... ..................4
2.5.1.2 Wnt proteins and signaling............... ...............4
2.5.2 Functions of the Wnt Family ............... ... .. ......... ... ...............49..
2.5.2. 1 Role of Wnt in differentiation and development ................. ................ ...49
2.5.2.2 Wnt family and disease .............. ...............50....
2.5.3 Wnts and the Liver .............. .... ...............51..
2.5.3.1 Wnts and liver regeneration .............. ..... ...............51.
2.5.3.2 Wnts and liver development and liver zonation............... ................5
2.5.3.3 Wnts and liver diseases .............. ...............52....


3 SPECIFIC AIMS .............. ...............54....


4 MATERIALS AND METHODS............... ...............57


4. 1 Anim als Studies .................. ... ........ ..... ...............57...
4.1.1 Animals and Animal Housing Facilities............... ...............5
4. 1.2 Animal Sacrifice and Tissue Collection ................ ...............58..............
4.1.3 Oval Cell Induction in the Rat............... ...............58..
4.1.3.1 2-AAF pellet implantation .............. ...............58....
4.1.3.2 Two-thirds partial hepatectomy .............. ...............60....
4. 1.4 Density-Based Separation of the Liver ................. ...............61..............
4. 1.4. 1 Perfusion of the liver .................. ........... ...............61 ...
4. 1.4.2 Density gradient separation of liver cells ................... ...............62
4.2 Liver Stem Cell Response to Wnt ................................... ...............6
4.2. 1 In vitro Response of Rat Liver Epithelial cells to Wnt3A ................. ................ .62
4.2. 1.1 Maintenance of liver stem-like cells, WB-F344 ................. ............... ....62
4.2. 1.2 Exposure of liver stem-like cells to Wnt3A ................. .......................63
4.3 Wnt shRNA Model in Rat .............. ...............63....
4.3.1 Wnt shRNA Plasmid .............. ...............63...
4.3.1.1 Design of Wnt shRNA vector ................. ...............63.............
4.3.1.2 Wnt shRNA plasmid amplification ................. ...............64...........
4.3.1.3 Wnt1 shRNA plasmid analysis .............. ...............67....
4.3.2 Verification ofWnt1 shRNA Function ........................... .. ............6
4.3.2.1 Confirmation ofWnt1 knockdown in PC12/Wnt1 cells .............. ................67
4.3.3 Inhibition of Wnt1 in the Rat................... ....................... ................68
4.3.3.11In vivo shRNA to Wntl .............. .. ...............68...
4.3.3.2 Femoral inj sections of shRNA vector ................. .............................69
4.3.3.3 Animal numbers .............. ...............69....
4.4 Histology and Immunohistochemistry ................. ...............70................
4.4.1 Histological Analysis............... .. .. .........................7
4.4. 1.1 Hematoxylin and eosin of paraffin embedded tissue ........._..... .........._....70
4.4. 1.2 Hematoxylin and eosin of frozen sections ................. .. ............... .......70
4.4. 1.3 Periodic Acid-Schiff staining of paraffin embedded tissue ........._..............71
4.4.2 Immunohi stochemi stry ................. ...............71.......... ...
4.4.2.1 Chromogen staining .............. ...............71....











4.4.2.2 Fluorescent staining........................ ..........7
4.4.2.3 Antibodies Utilized for Immunohistochemi stry ................. ........................72
4.5 Protein Analysis................... ......................7
4.5.1 Protein Isolation and Quantification............... .............7
4.5.1.1 Protein isolation from tissue or cells ................ ...............72...........
4.5.1.2 Protein quantification with DC Protein Assay .............. ....................7
4.5.2 Western Blot Analysis of Protein Levels ................. ...............73......._.. .
4.5.2. 1 Pouring an acrylamide gel ........._..__......_ ... ...............73
4.5.2.2 Protein sample preparation............... ..............7
4.5.2.3 Electrophoresis of the western gel ................. ........... ............... ....7
4.5.2.4 Transferring of a western gel to a PVDF membrane ................. ...............75
4.5.2.5 Probing of western membrane ................ .........__. ... .. ........... ....7
4.5.2.6 Developing of western membrane with ECL Plus ................ ................. .76
4.5.2.7 Membrane stripping for reprobing .............. ...............76....
4.5.2.9 Antibodies Utilized in Western blotting............... ...............76
4.6 RN A analy si s............... ...............76
4.6.1 RNA Isolation............... ...............7
4.6.1.1 Homogenization .............. .. ... ...............76
4.6. 1.2 Phenol-chloroform phase separation ................. ............... ......... ...77
4.6. 1.3 Precipitation and redissolving of RNA ..........._..._ ......_._ .........._.....77
4.6. 1.4 Quantification of RNA by spectrophotometry ................. ............. .......78
4.6.2 RT-PCR ........._................ ...... .. .. .._. ... ........ .......7
4.6.2. 1 First-strand cDNA synthesis from total RNA ........._._ ...... .._.._..........78
4.6.2.2 PCR amplification of target cDNA ................. ....._.. ............. .....78
4.6.2.3 Primers utilized for DNA/cDNA amplification .............. ....................7
4.6.2.4 Agarose gel electrophoresis .............. ...............79....
4.6.3 Real-Time PCR analysis of Wnt1 levels ................ ...............80..............
4.6.3.1 Real-Time PCR of Wntl ................. ........................ ..............80
4.6.3.2 Real-Time PCR of 18S rRNA ............... ... .. .......... .. .......... .......8
4.6.3.3 Statistical analysis of Real-Time PCR and densitometry. ................... .........80
4.7 Solutions .............. ...............80....

5 RE SULT S .............. ...............83....


5.1 Evaluation of the Wnt Family During Oval Cell Induction ................. ............. .......83
5.2 In vivo Inhibition of Wnt1 During Oval Cell Induction ................. ........................90

6 DISCUSSION AND FUTURE STUDIES .............. ...............100....


6.1 Summary of Results............... ...............10
6.2 Interpretation of Results ........................ ....... ... ... ...................10
6.2. 1 Wnt Signaling is Required During Oval Cell Based Liver Regeneration ............101
6.2. 1.1 Novel findings ............ ...... ._ ...............101.
6.2. 1.2 Basic science applications ...._ ......_____ .......___ ..........10
6.2. 1.3 Clinical applications ............... .. ......__....... ..............10
6.2.2 Disregulation of Wnt1 Signaling and Cancer Induction ................. ................ 105
6.2.2.1 Atypical ductular proliferation after Wnt1 shRNA exposure in vivo.........105












6.2.2.2 Use of Wnt1 in preneoplastic foci ................. ...............106........... ..
6.3 Future Studies .................. ......... .......... ................... ......... ......... 0
6.3.1 Continuation of the Wnt1 shRNA 2AAF/PHx Protocol ................... ...............106
6.3.2 Exposure of Oval Cells to Wntl ................ ...............107.............
6.3.3 Wnt1 Conditional Knockout Animal ................. ...............107..............
6.3.4 Summary of Proposed Experiments ................. ...............107..............


LIST OF REFERENCE S ................. ...............109................


BIOGRAPHICAL SKETCH ................. ...............121......... ......










LIST OF TABLES


Table page

4-1 Numbers of animals sacrificed during in vivo Wnt1 shRNA inhibition. ...........................69

4-2 Antibodies utilized for immunohistochemistry. ............. ...............72.....

4-3 Antibodies utilized for western blot analysis............... ...............76

4-4 Primers utilized for PCR, and rtPCR. .............. ...............79....











LIST OF FIGURES


Figure page

2-1 Diagrams of hepatic microarchitecture ................. ...............19......__ ...

2-2 Diagrams of the various liver lobules. .......... ............._ ..........._._........_.....20

2-3 The liver acinus. ........._._. ......_. ...............21....

2-4 Graphic representation of growth of remaining three liver lobes after %/ partial
hepatecomy in the rat. .............. ...............24....

2-5 Graph of the amount of various resident hepatic cells within the cell cycle during the
time following %/ partial hepatectomy. ............. ...............25.....

2-6 H and E of rat liver from day 11 of the 2-AAF/CCl4 prOtocol ................. ................ ...37

2-7 H and E of livers from the 2AAF/PHx protocol .............. ...............38....

2-8 Drawing of potential end points of oval cell differentiation ................. ......._._. ........39

2-9 Representation of the "cononical" Wnt pathway ................. ...............50........... ..

4-1 Oval cell induction in the rat............... ...............59..

4-2 shRNA hairpin structures ................. ...............64................

4-3 Map of the pshRNA-H1-gz-Wnt1 vector. ............. ...............65.....

4-4 The sequence and relevant restriction enzyme sites of the pshRNA-H1-gz-Wnt1
vector ................. ...............66.................

4-5 Diagrammatic representation of Wnt shRNA model ................. ............................68

5-1 2AAF/PHx 9 Days post PHx versus Wnt Family ................. ...............83........... .

5-2 Staining of Wnt1 during 2AAF/PHx. ............. ...............84.....

5-3 Dual Staining of Wnt1 and p-catenin in 2AAF/PHx .............. ...............85....

5-4 Change in p-catenin and Wnt1 protein levels during 2AAF/PHx oval cell induction.......86

5-5 p-catenin levels of liver cell fractions .........__. ........... ...............87.

5-6 Reverse transcription PCR of liver from 2AAF/PHx oval cell induction model .............88

5-7 Real Time PCR analysis of Wnt1 expression during oval cell induction ................... .......89











5-8 Response of WB-F344 cells to Wnt3 a stimulation ................. ............... ......... ...90

5-9 Knockdown of Wnt1 in PC12/Wnt1 cells .............. ...............91....

5-10 GFP expression in shRNA treated animals............... ...............91

5-11 Percent liver weights of animals treated with shRNA ................. ......... ................92

5-12 H and E of livers from shRNA treated animals ................ ...............93.............

5-13 OV6 and CD45 staining of serial fresh frozen sections from the livers of shRNA
treated anim al s .............. ...............94....

5-14 Ki67 comparison of 2AAF/Phx versus Wnt1 shRNA treated animals..............................95

5-15 AFP and Wnt1 staining of serial sections from Wnt1 shRNA treated animals.................96

5-16 Real Time PCR analysis of Wnt1 expression of shRNA treated animals ................... ......97

5-17 Atypical ductular hyperplasia within Wnt shRNA treated animals............... ................9









LIST OF ABBREVIATIONS


2-AAF 2-acetoaminofluorene

AFP a-fetoprotein

APS Ammonium persulfate

bp Base pair

CK Cytokeratin

DAPM Methylene dianaline

DNA Deoxyribonucleic acid

ECM Extracellular matrix

FBS Fetal bovine serum

FRP Frizzled Related Protein

Fzd Frizzled

GFP Green Fluorescent Protein

HGF Hepatocyte Growth Factor

HSC Hematopoietic stem cells

IHC Immunohi stochemi stry

ip. Intraperitoneal

LRP Low density lipoprotein receptor-Related Protein

NRL Normal rat liver

nt Nucleotide

OCT Optimal cutting temperature

OLT Orthotopic liver transplant

O/N Overnight

PBS Phosphate buffered saline









PCR Polymerase chain reaction

PHx Partial hepatectomy

RNA Ribonucleic acid

RPM Revolutions per minute

RT Room temperature

rtPCR reverse transcription PCR

RT-PCR Real Time PCR

SCRsi Scrambled shRNA

shRNA small interfering RNA

shRNA small hairpin RNA

TEMED Tetramethyl ethyl enedi ami ne

TGF-a Transforming Growth Factor a

TGF-P Transforming Growth Factor P

Wntlsi Wnt1 shRNA









Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

THE ROLE OF THE Wnt FAMILY OF SECRETED PROTEINS IN
OVAL "STEM" CELL BASED LIVER REGENERATION

By

Jennifer M. Williams

December 2007

Chair: Bryon E. Petersen
Major: Medical Sciences--Molecular Cell Biology

The Wnt/p-catenin pathway has been shown to be essential in embryogenesis and has been

implicated in carcinogenesis. The current study reports novel findings in the Wnt pathway during

the rat liver oval "stem" cell induction protocol of 2-acetylaminofluorene (2AAF) and 70%

partial hepatectomy (PHx). Western blot analyses, rt-PCR, RT-PCR, and immunohistochemistry

(IHC) were utilized to analyze the involvement of the Wnt family in liver injury and oval cell

activation.

It was found that Wnt-1, Wnt3, Wnt~a, Frizzled Related Protein 1, Frizzled 5 and Frizzled

7 proteins were predominantly localized in pericentral hepatocytes. Following oval cell

proliferation, an increase in Wnt proteins in concordance with the increase in oval cell number

was observed. Wnt1 levels message levels peaked during the peak in oval cell numbers, and

Wnt1 protein levels as well as p-catenin protein levels peaked after the increase in oval cell

numbers. IHC analysis of p-catenin demonstrated oval cells with nuclear translocation of P-

catenin throughout the 2AAF/PHx protocol. Hepatic stem cells responded to Wnt3a in culture by

exhibiting the same p-catenin translocation visualized by IHC.

Subsequent in vivo exposure to an shRNA construct directed toward Wntl, inhibited the

oval cell based liver regeneration. Without the Wnt1 signal oval cells were unable to differentiate









into hepatocytes, lost AFP expression, and underwent atypical ductular hyperplasia that

exhibited epithelial metaplasia and mucin production. It is hypothesized that changes in the Wnt

pathway during oval cell induction control liver stem cell differentiation through regulation of 0-

catenin levels, which is known to induce cell proliferation and target gene expression.

Furthermore, changes in Wnt1 levels are required for the efficient regeneration of the liver by

oval cells during massive hepatic injury.









CHAPTER 1
INTTRODUCTION

Uncovering the Role of Wnt in Oval Cells: The discovery of stem cells has led to some

of the greatest medical advances of the 20th century. Stem cells, whether adult or embryonic,

have differentiation potentials that far exceed initial thought. Cells from practically any organ or

tissue can be manipulated toward any cell lineage desired. One day in the not so far future, a

simple blood draw could produce the cells needed to grow replacement organs. In conjunction

with gene therapy, the therapeutic potential behind these observations is tremendous.

In order to unlock the true capabilities of an adult stem cell one must understand the cell's

function in its site of origin. Recognizing an organ specific stem cell through histology and

morphology has proven relatively easy; however, thoroughly characterizing the molecular

makeup of the same cell has proven more difficult. The use of phenotypical markers has aided

the characterization process, but the cellular variations present during routine cellular processes,

chemical exposure, and other stresses have made this method of characterization imprecise and

difficult to say the least.

Cell labeling techniques have advanced the study of cell differentiation fates, but again this

technique has not always provided definitive results. In order to track the differentiation states of

progenitors, these cells are frequently labeled with dyes. However, when the cell of interest has

been labeled with a dye, after numerous cellular divisions the dye dilutes to undetectable levels.

This ultimately makes the determination that a specific cell was directly derived from a distinct

progenitor nearly impossible. Another labeling method entails the genetic modification of the

cell of interest. The cells contain a gene encoding a fluorescent protein or other protein markers

usually under the control of a viral promoter; however, these marker genes have frequently been

found to have been silenced in vivo, thereby, effectively unlabeling the cell of interest and its










progeny. Although the techniques currently available for the classification of stem cells and their

differentiation potentials are not perfect, they can provide a better understanding of stem cell

morphology and function, but it is important to note that any observations made by removing a

cell from is in vivo environment does not adequately describe the cell. Once removed for its site

of origin the cell of interest has changed.

Ultimately, scientists must be able to define the characteristics of an organ specific

stem/progenitor cell, isolate that cell, and demonstrate in vivo, the steps of differentiation which

the stem cell undergoes. Once this pathway is clearly defined, the mechanisms controlling these

pathways must be elucidated. A thorough understanding of the molecular signals that direct these

cells can then be utilized therapeutically.

The identification of an adult liver "stem" cell, the oval cell, has created opportunities for

alleviating the shortage of livers available for transplant as well designating a cell for use in gene

therapy for the treatment of metabolic disorders. Molecular characterization of the oval cell

population has been fruitful, but these cells have still not been completely classified. Oval cells

have been manipulated both in vitro and in vivo toward numerous different cell types of various

germ layers, thereby demonstrating their pluripotentiality. Although this is significant for future

therapeutics, until the natural functions of oval cells within the liver are understood, the true

potential of the oval cell will remain hidden.

This proj ect was designed to further understand the signals that guide an oval cell's

differentiation toward a hepatic lineage. Previous works had demonstrated the requirement of

Wnt in normal liver development, as well as the role of p-catenin in regulation of liver growth

and regeneration. The Wnt family is a known regulator of stem cells that guides self renewal and









differentiation, and, consequently, it was theorized that Wnt could possess some control over

oval cell fate during stem cell based liver regeneration.

Through IHC, protein, and RNA analysis a link between the Wnt signaling pathway and

oval cell based liver regeneration was established. Inhibition of Wnt1 in vivo resulted in an

abnormal regenerative process, failure of the oval cells to transdifferentiate into hepatocytes, and

extensive atypical ductular hyperplasia.

This proj ect outlined the requirement of Wnt signaling for the differentiation of oval cells

toward a hepatic lineage. Without exposure to Wnt, oval cells defaulted to a ductular epithelial

state and failed to aid in the regenerative process. This study only begins to elucidate a better

understanding of the role of certain signaling proteins in oval cell based regeneration. In

addition, the current studies open the door to several other avenues for the classification of the

liver stem cell's functions.









CHAPTER 2
BACKGROUND AND SIGNIFICANCE

2.1 The Liver

2.1.1 Anatomy of the Liver

2.1.1.1 Structure of the hepatic organ

In an adult human, the largest parenchymal organ, the liver, weighs approximately 1400 to

1600g. This represents approximately 2% of the total body weight. In the rat, the liver weighs 7

to 8g which accounts for a greater percent of the body weight (approximately 5%).1 In the

human, the liver is comprised of four lobes, whereas, the rat liver contains five lobes.2


ALiver Lobule *11~ *. a- Jac






Detail of Lobuwle Jn'r

Hepatic ver u e












Diagramre ofhptcbodfo.Rdarw ndct lo lwadgenarw
indct h ieto fbl lw.B eai iracietr.










The liver has dual afferent blood supplies to maintain its highly vascular parenchyma. The

portal vein supplies over 60% of the incoming blood.1,2 The blood from the portal vein is venous

and, therefore, oxygen poor. However, this venous supply is extremely nutrient rich due to the

direct drainage of the intestinal epithelium. The hepatic artery provides the remaining 40% of

oxygen rich blood to the liver.1,2 In parallel to the blood vessels but opposing direction of flow,

the biliary tree forms excretory ducts that transport bile into the duodenum. The portal vein,

hepatic artery and biliary tree form a central vascular bundle termed the portal triad.2

2.1.1.2 Microarchitecture of the liver

The liver is divided into hepatic lobules surrounding terminal hepatic venules (central

veins) and outlined by portal triads. A hexagonal column of hepatocytes arranged in cords

radiating from the central vein toward the portal triad forms the structure of the hepatic lobule

(Figure 2-1A).4 Sinusoids composed of endothelial cells line each cord of hepatocytes and

enclose the micro-vascular circulatory system of the liver.2-4 Essentially, blood enters the liver

through the portal triads and flows through the parenchyma in direct contact with each

hepatocyte within a cord and ultimately drains into the central vein. Metabolites produced by the

hepatocytes are excreted via the bile canaliculus into the canal of Hering, a terminal portion of

the bile network within the portal triad.


A. B. C.
I *
Central Central Central
Vein r ~~~ IVein Vein

Portal L,~Portal \ ~ /\Portal
Triad TriaTri d TriadTia

Classic Lobule Portal Lobule Liver Acinus


Figure 2-2. Diagrams of the various liver lobules. A. The "classic" lobule. B. The portal lobule.
C. The functional unit known as the liver acinus.









The liver parenchyma consists of a various group of cell types including hepatocytes, bile

ductular epithelial cells, fat containing stellate cells, sinusoidal and vascular endothelial cells,

and liver specific macrophages known as Kupffer cells which rid the liver of debris and aged red

blood cells. Hepatocytes encompass 90% of liver weight and carry out the biochemical functions

of the liver as well as the production of bile.2 Hepatocytes are polygonal in shape, large in size

(30-40Cpm), and have a high abundance of smooth and rough endoplasmic reticulum.4

The architectural makeup of the liver can be described in three ways. The unit most

frequently recognized by histology is the "classic" lobule (Figure 2-2A).4 This lobule contains

portal triad surrounding hepatic cords radiating out from a single central vein. The portal lobule

depicts blood flow from one portal triad to its surrounding central veins (Figure 2-2B).4 Lastly,

although the "classic" lobule can be most easily recognized, the liver acinus is the functional unit

of the liver (Figure 2-2C).4






,** 'Central
Vein



Portal
Triad
Zones

Figure 2-3. The liver acinus. Diagram of the liver acinus including the three zones radiating
toward the central veins.

The hepatocytes that extend from one central vein to another can be divided into three

zones. Zone 1 includes hepatocytes surrounding the portal triad and receives the greatest

concentration of nutrients; Zone 2 is composed of inter-zonal hepatocytes; and Zone 3 consists of









poorly oxygenated hepatocytes nearest to the central vein (Figure 2-3.).2,4 Within the liver

acinus, blood flows through sinusoids from Zone 1 to Zone 3, and the bile moves from Zone 3 to

Zone 1. Interestingly, hepatocytes within Zone 3 have an increased DNA content (4N to 16N),

predominant bi-nucleation, large size and can undergo centrilobular necrosis. Conversely,

hepatocytes within Zone 1 are smaller and usually single nucleated (2N).5

It should be noted that the macroarchitecture of the liver seen histologically does not truly

elucidate the dynamic functional units of the liver.6 The liver microarchitecture with regard to

the organization of hepatic microcirculation, hepatic venous and arterial systems as well as the

biliary tree are much more complex in their functional units than can adequately be described in

two dimensions.6 Three dimensional analysis of these systems via reconstructions complied from

modern imaging techniques have begun to unlock the true physiologic hepatic lobule.6

2.1.2 Functions of the Liver

2.1.2.1 Homeostasis

As a large parenchymal organ in the body, the liver performs a multitude of functions. To

control homeostasis of the body, liver metabolizes amino acids, lipids, and carbohydrates, and

serum proteins. For example, by converting glucose into the storage form glycogen during

carbohydrate metabolism, the liver effectively decreases blood level of glucose, and conversely,

by metabolizing glycogen into glucose, the liver increases blood glucose levels. One of the main

sites of glycogen storage is the liver. The liver also maintains the colloid osmotic pressure of the

blood by producing the most abundant protein in the plasma, albumin. The liver also produces

other important plasma proteins such as lipoproteins glycoproteins including prothrombin and

fibrinogen, and the nonimmune a- and P-globulins. Additionally, the liver plays a role in amino

acid metabolism through the deamination of amino acids and the formation of urea.4









2.1.2.2 Storage

The liver stores and converts several important vitamins taken up from the blood stream.

Stellate cells stores vitamin A within their lipid pools. Without the liver, vitamin D metabolism

would not be completed. Then the circulating form of vitamin D (25-hydroxycholecaliferol)

would never be subsequently converted by the kidney to its active form which would result in

rickets and failures in bone mineralization. Lastly, the liver utilizes vitamin K for the production

of clotting factors. Decreases in hepatic vitamin K utilization have strong implications in clotting

and/or bleeding disorders.4

Due to the liver' s intricate vasculature and large size, a large volume of blood is located

within it at any given time; thus making the liver the largest blood storage organ in the body. An

adult human liver can hold about 1500ml of blood which equates to approximately 25% of

cardiac output perminute.4 Also the liver is the main site for iron storage. Homeostasis of blood

iron levels depends directly on the ability of the liver to store and metabolize iron. Iron overload

results in hemochromatosis which can result in severe liver damage.

2.1.2.3 Drug and toxin detoxification

Processing large volumes of blood induces the liver to function as a detoxifying organ.

Liver enzymes, such as alcohol dehydrogenase (ADH), cytochrome-P (CYP) and isoforms of

uridine diphosphoglucuronate glucuronosyltransferase (UGT) allow for the alteration of

chemical composition of many xenobiotics and their subsequent removal.2 The liver' s

conversion of nonhydrophilic drugs to a more water soluble form aids in their excretion by the

kidneys.

2.1.2.4 Liver endocrine functions

Although the liver does not actively produce hormones, it modifies the actions of

hormones released by other organs. The liver specifically modifies Vitamin D and thyroxin









through metabolism, but it releases growth hormone-releasing hormone to regulate the pituitary's

release of growth hormone. Lastly, the liver is one of the main sites for insulin and glucagon

degradation which further controls blood glucose levels.2

2.1.2.5 Liver exocrine function

The most important function of liver is the production of bile. Bile is important for

intestinal absorption of nutrients and elimination of cholesterol. Bile, mostly comprised of

conjugated bilirubin, is collected in the liver biliary tree, stored in the gall bladder and eventually

drained into the duodenum to act as a detergent.2











Normal At operation One week









Two weeks Three weeks Four weeks


Figure 2-4. Graphic representation of growth of remaining three liver lobes after %/ partial
hepatecomy in the rat. Compensatory hyperplasia results in the liver regaining
original tissue mass in approximately 10 to 14 days.6 01931 American Medical
Association. All Rights Reserved.

2.1.3 Liver Regeneration

Compensatory hyperplasia of the liver, most often referred to as liver regeneration, takes

place in response to mild to severe liver injury resulting from surgical resection of a portion of









the liver or exposure to destructive agents such as hepato-toxins or hepatotropic viruses. Under

normal conditions, hepatocytes exhibit minimal replicative activity; only 1 in every 20,000

hepatocytes undergoes mitotic division at any one given time point, but hepatocyte division is

the maj or driving force behind liver regeneration.7 Figure 2-4 represents a drawing by Higgins

and Anderson of the growth of the residual lobes of the liver after %/ partial hepatectomy.8


30-
~- Hopat~cytes
Bldiary duula cells
-~ Kupffe r ad Ilo ce(Is
ii- SiKarsueda codothelsa cult.










u 1 2 3 4i 5 6 7 6 9 10
Days after Ipartial hepatectomy


Figure 2-5. Graph of the amount of various resident hepatic cells within the cell cycle during the
time following %/ partial hepatectomy. Hepatocytes represent the prolifereative
driving source behind liver regeneration." 01997 AAAS. All Rights Reserved.

In the rat, hepatocytes move from the GO resting phase of the cell cycle into Gl, as

mediated by the cyclin Dl pathway within 15 hours of partial hepatectomy (PHx).9,10 Peri-portal

hepatocytes are the first to undergo DNA synthesis and proliferation gradually spreads to include

the hepatocytes located around the central vein. A large peak of DNA synthesis is observed at

about 24-hrs post PHx, and a second, yet smaller peak arises at 48 hrs. The smaller peak reflects

DNA synthesis occurring in non-parenchymal cells (NPC) and pericentral hepatocytes. Unlike

hepatocytes, which display a wave of DNA synthesis from periportal to pericentral, NPCs across









the lobule exhibit simultaneous DNA synthesis.9 The original liver mass is usually restored

within 10 days of the hepatectomy.12 Figure 2-5 is a graph by Michalopoulos and DeFrances,

1997, representing the percent of individual hepatic cell types dividing at various time points

during hepatic regeneration induced by %/ PHx.13

Several animal models of chemical hepatotoxicity have been developed to study the

mechanisms regulating the proliferative response to liver injury. Among the most extensively

utilized chemical agents are carbon tetrachloride (CCl4), which causes necrosis of the

centrilobular regions of the liver, and allyl alcohol (AA), which causes periportal necrosis.14-1 I

both models, regeneration of the necrotic region is mediated by proliferation of mature

hepatocytes elsewhere in the liver lobule, and the oval cell response is not activated to a degree

of importance, if at all.

The liver has an enormous capacity to regenerate, as demonstrated by the %/ partial

hepatectomy model in rodents. In addition, the liver has a stem cell compartment acting as a

backup regenerative system. Activation of the stem cell compartment only occurs when the

hepatocytes are unable to divide, functionally compromised, or both. In stem cell-aided liver

regeneration, progeny of the stem cells multiply in an amplification compartment composed of

the hepatic oval cells. The origins of oval cells remain controversial and several key questions

regarding the molecular cues that initiate oval cell proliferation and direct lineage specific

differentiation still remain.

2.1.4 Hepatocyte Transplantation for the Treatment of Liver Diseases

The most commonly used and currently most effective treatment for the maj ority of liver

diseases, metabolic and environmental, is the orthotopic liver transplant (OLT). Although

extremely effective, OLT is expensive, the numbers of donors does not currently meet the need,









and the post surgical immune suppression has severe side effects. Other potential treatments are

currently being developed including hepatocyte transplantation.

Due to the multiple functions of the hepatocyte, transplantation of "normal" hepatocytes in

the case of inborn errors in metabolism seems logical. In addition to this, successes in "curing"

animal models of these diseases have been intriguing, but in actuality, the clinical application of

hepatocyte transplantation still lacks the advances seen in animal models. As of 2006, only 78

hepatocyte transplants have been performed worldwide." Of those transplants, only twenty-one

were performed in patients with inherited metabolic disorders.l Twenty patients suffered from

chronic liver diseases, and the remaining transplants were delivered to acute liver failure

patients. The history of hepatocyte transplantation gives insight into the struggles seen in the

clinical application of this seemingly simple solution to the worldwide epidemic of liver

diseases.

In 1976, Matas et al. reported that a portal infusion of hepatocytes resulted in the reduction

of plasma bilirubin levels in the rat Crigler-Nijj ar model (the Gunn rat).19 The success of this rat

model promoted hope for the future of treatments in patients with inherited and acquired

metabolic disorders and liver diseases. The first human trial of hepatocyte transplantation was

not achieved until 1992 when Mito et al. performed a partial hepatectomy on a series of patients

with chronic cirrhotic liver failure.20 After isolation of hepatocytes from the rejected liver, they

were autologously implanted via intrasplenic inj section. Transplanted, labeled cells were present

in the spleen up to six months post transplant, however, the only clinical relevance of these

transplants was the demonstration of engraftment.20

After successful decreases in serum cholesterol in the Watanabe Heritable Hyperlipidemic

rabbit were obtained following transplantation of genetically modified hepatocytes, the first









human inborn error in metabolism was chosen for human trials.21 Five patients with homozygous

familial hypercholesterolemia underwent left lateral segment resection. Hepatocytes were

isolated and transduced with the LDL receptor and reimplanted via the liver portal vein three

days post resection.21 This trial demonstrated safety from tumor and infection with over a two

year follow up. Nonetheless, the less than 5% transgene expression four months post

transplantation ended further hepatocyte transduction and implantation therapy.l

Conversely, successful treatment for inherited metabolic disorders has been achieved.

Intraportal transplantation of allogeneic mature hepatocytes into four children with Crigler-Nijj ar

Syndrome type 1 has reproducibly reduced serum billirubin levels by 30 to 50% for greater than

three years.22-25 Of the sixteen humans receiving allogeneic hepatocyte transplants, most saw a

decrease in the serum indicators of their diseases, however, the decreases were not significant to

prevent orthotopic liver transplantation (OLT).ls Also the level of donor cell engraftment varied

drastically. This factor, in conjunction with the efficacy of whole organ transplant, has inhibited

the advances in the treatment of metabolic liver diseases by somatic cell therapy.l

Chronic liver disease and acute liver failure present an alternative use for hepatocyte

transplantation. Ten patients with chronic liver disease receiving autologous hepatocyte

transplantation had hepatocytes present at the inj section site (the spleen) up to six months post

transplant, but encephalopathy resolution (a clinical indicator of hepatic disease regression) was

not attributed to the transplants.20 Of the seven adults receiving allotransplants, only one

recipient' s liver demonstrated histologic evidence of hepatocytes forming cord like structures,

and only one showed any significant clinical benefit but still underwent OLT.ls Interestingly,

two of three pediatric patients who received a single allotransplant of hepatocytes to treat chronic

liver failure fully recovered and the third was successfully bridged to OLT.26,27









Acute liver failure has by far had the most patients receiving hepatocyte transplantations,

but out of thirty-seven patients treated, only two children and four adults had achieved full

recovery with hepatocyte transplant alone. The remainder exhibited varying levels of metabolic

improvement as measured by improved encephalopathy and decreased ammonia levels.

However, in these cases hepatocyte transplant only functioned as a bridge to OLT.l

As seen in hepatocyte transplantation, the possibility of curing human metabolic diseases

with somatic cell therapy has great potential. Nonetheless, the current treatment strategies have

not proven as effective as the animal models for the same diseases. Furthermore, availability of

donor hepatocytes is extremely limited. This fact, compounded by the lack of significant success

with autologous cell manipulation and reimplantation, has severely inhibited the current

treatment strategies of somatic cell therapy for metabolic diseases. These difficulties have led

researchers to determine alternative treatment strategies which might utilize different cell

populations.

2.1.5 Hepatocellular and Cholangiocellular Carcinomas

Despite extensive research into its treatment and prevention, HCC remains one of the most

frequent malignant diseases worldwide. It is the 4th most common cancer comprising 5.4% of all

new cases, and over 437,000 new cases are reported each year.28 Although rates are much lower

in the Northern Hemisphere, the disease is endemic in China, Taiwan, Korea, and Sub-Saharan

Africa. This is most likely due in part to the extensive levels of aflatoxin exposure in this region

of the world, as well as the endemic rates of viral hepatitis.29 In these countries, HCC leads the

list of causes of death due to a devastating average 5-year survival rate of less than 3%.29

Although less prevalent than HCC, cholangiocarcinoma (CCC) accounts for 3% of all

gastrointestinal cancers worldwide.30 In the US alone, approximately 5000 new cases are

reported each year. There has also been a three-fold increase in the number of CCC cases within









the US between 1975 and 1999 with no apparent cause.30 As with HCC, the survival rate of CCC

is devastatingly small with a 5-year survival rate of <5% for intrahepatic CCC and 10-15% for

extrahepatic CCC.30

Cellular morphology of CCC differs from HCC in that the tumor cells are most often

arranged in tubules and gland like structures; whereas, HCC cells tends to display a more

trabecular or pseudoglandular morphology.30 Also CCC tends to display a fibrous stroma that

HCC lacks.30 Important to this research, CCC frequently contains mucin positive cells and/or

glandular lumens.30 A more thorough understanding of the cellular origins of HCC and CCC

could provide more avenues of attack in the treatment of these endemic diseases while increasing

the number of strategies that exist for hepatic cancer prevention.

2.2 Stem Cells and Their Therapeutic Potential

Almost one hundred years ago, Alexander Maximov theorized that within the peripheral

blood lymphocytes there exists a population of common circulating stem cells (genteinsa~ne

Sta~nmnzellen) that possessed pluripotency or could regain this potential.31 Maximov was the first

to believe in the capacity of adult cells to differentiate into one of many cell types. Unbeknownst

to Maximov, it would take almost fifty years before his theories could be put into clinical

practice, and another forty before a single cell was shown to repopulate bone marrow long

term.32,33 Incidentally, his theories are the basis for the current research boom in the field of

somatic cell therapy. The progress therein has the potential to answer three maj or questions: i)

What are the differential and self-renewal capabilities of the various types of somatic cells within

the body? ii) Are end organ "stem cells" truly lineage committed? And iii) Can stem cells be

utilized to treat cancer, autoimmune disorders, and aberrant genetics in an organ specific

manner? Each of these poignant questions has opened a door within the Hield of medicine

currently classified as "Somatic Cell Therapy". Although somatic cell therapy currently has little









clinical utilization aside from bone marrow transplants, somatic cell therapy has limitless

potential for the treatment of diseases when utilized in conjunction with gene therapy.

2.2.1 Pluripotenitality of Stem Cells

Stem cells are defined as cells that have the capacity for self renewal and are multipotent,

meaning they have the ability to differentiate into cells of various germ layers. Stem cells can be

found within the adult somatic tissue as well as the embryo. At this time, the only truly totipotent

cell in existence is found in the fertilized egg although current research has revealed the truly

multipotent nature of both the adult and embryonic stem cells. However, the true differentiation

capacity of these cells has not been fully recognized.

2.2.1.1 Embryonic stem cells

The concept of cell differentiation has been in existence since the 1850's, well before

Pappenheim first described the premise of the stem cell in 1919.34 However, it wasn't until the

early 1980's that the clonogenicity and totipotential nature of the embryonic stem cell was Einally

elucidated.35

Murine embryonic stem cells were discovered over twenty years ago. This breakthrough in

cell biology enabled a revolution in experimental medicine by establishing an in vitro model for

early mammalian development, as well as a new source of cells for replacement therapies.

Embryonic stem (ES) cells are pluripotent cells derived from the inner cell mass of blastocyst

stage embryos.36-3 ES cells have been manipulated in culture and in vivo via directed

differentiation into each of the three germ cell layers of ectoderm, mesoderm, and endoderm.3739

Specifically, ES cells can be easily directed toward mesoderm specific cell types such as

hematopoetic,40-43 hemangioblast,44-47 VaScular,48-51 cardiac,52-5 Skeletal muscle, chondrogenic,

osteogenic, and adipogenic lineages." With more effort, endodermal lineages, most

specifically of pancreatic and hepatic origin, can be developed.59-6 Lastly, the neuronal









differentiation of ES cells has provided a vast amount of research that some suggest indicates

that a ES cells may be the revolutionary treatment needed for diseases such as Alzheimer's and

Parkinson's.62 Much research has gone into the pluripotential nature of embryonic stem cells,

however, with the current ethical issues and evidence of teratoma formation, use of these cells

for somatic cell therapy has many hurdles to overcome before the advantages of this cell type can

come to clinical fruition.

2.2.1.2 Adult stem cells

In recent years there has been an increasing body of evidence that adult stem cells have a

far greater degree of plasticity than once thought. Bone marrow derived stem cells have been

found to naturally produce (or can be manipulated towards producing) practically all endothelial,

mesenchymal and epithelial lineages found in the body.63-65 Neuronal stem cells have been

shown to be capable of differentiating into a hematopoietic line and then back to a neuronal

lineage.66 In addition, stem cells isolated from the brain have been shown to generate an entire

mammalian organism, more specifically a mouse.67 Although these studies have only been

conducted in rodent models, they do suggest that adult mammalian stem cells may be utilized to

treat cellular dysfunction within any organ system of the body. Theise et al. (2000) and Alison et

al. (2000) reported that human adult bone marrow stem cells could differentiate into mature

hepatocytes, thereby providing the first link from animal studies to human studies and proof of

concept.68-70 This data has the potential to develop into clinical applications within the very near

future.

Over one hundred years after the conception of the "stem cell", the first single cell

transplant to successfully rescue a lethally irradiated mouse was published. To address the

pluripotentiality of the adult stem cells, specifically the hematopoietic stem cells (HSC), Krause

et al. performed a transplant of single cell HSC combined with short term repopulating cells. The









single cell transplanted was a lineage negative, PKH26 labeled cell transplanted into lethally

irradiated mice." These cells demonstrated multi-lineage engraftment as seen by donor cells

present that had differentiated into epithelial cells of the lung alveoli, GI tract, cholangiocytes

and hair follicles eleven months post transplant." However, the technique used for this and other

similar experiments was a very simple feet up or feet down (animals either lived or died) and,

thus, the extension of single cell transplantation to human clinical trials has been and will be very

nearly impossible.

Bone marrow stem cells have also been shown to posses the ability to differentiate into

liver, intestine, skin, skeletal muscle, heart muscle, pancreas, and central nervous system both in

mouse models and human recipients of bone marrow or organ transplants.69,72-74 Mesenchymal

stem cells (MSC) from the bone marrow also exhibit a similar pluripotentiality.7 Bone marrow

stem cells (HSC or MSC) have been shown to give rise to endothelial cells of the vascular

system and muscle as well as hepatocytes in vivo.76 In addition, bone marrow stem cells have

been shown to participate in neural development and vice versa.76-78 Stem cells in vitro have

have been shown to produce bone, connective tissue, and cartilage.76-7 Lastly, neural stem cells

from the adult mouse brain can contribute to the formation of chimeric chick and mouse

embryos, and give rise to cells of all germ layers.67 Other adult stem cells are currently being

evaluated for their pluripotential nature, but none to date have been as successful as the HSC.

Results from these studies demonstrate that adult stem cells have a very broad developmental

and differentiation capacity.

2.2.2 Stem Cell Therapeutics

Clinical uses of stem cells for the repair of tissues such as heart and nervous system have

been attempted with clinical trials.79'80 Transplantation of stem cells into the heart after

myocardial infarction has improved revascularization and has aided in healing; however, the









clinical trials have failed to demonstrate that the cells have truly differentiated into cardiac

myocytes.8 As with other somatic cell therapies, clinical relevance of these procedures has yet to

be demonstrated even though success has again been seen in animal models.

Another avenue for the clinical use of stem cells presents itself with the advent of

bioengineered organs and/or tissues. The development of tissue scaffolds for the seeding of stem

cells has immense potential, but until recently the clinical applications of these scaffolds have

been limited. The most clinically relevant engineered tissue has been cartilage.82 The inj section of

tissue engineered cartilage into osteoarthritic as well as nonarthritic knees and other j points been

reported to have greatly improved joint stability and motion.83 However, further long-term

studies must be made to determine the stability and long term effects of these grafts.83 The

growth of autologous cells on decellularized human heart valves and subsequent implantation of

these valves has also been clinically worthwhile.84 Another engineered tissue that had been

evaluated in a clinical study was the bladder. Here, patients received bladders engineered with

autologous urothelial and muscle cells." Up to five years post implantation these patients

demonstrated clinical benefit from the implanted tissue." The successes seen with bladders,

heart valves and cartilage demonstrate the endless possibilities for the clinical use of stem cells.

The combination of tissue engineering in conjunction with autologous stem cells could

revolutionize the organ transplant field. However, the ability to grow a patient another kidney

from a stem cell isolated from their blood is still a dream that is yet to be fully realized.

Someday, adult and/or embryonic stem cells may be used in a variety of ways for the treatment

of different human diseases. Nevertheless, until the scientific community is able to reproduce

successes seen in animal models, the huge clinical potential of the stem cell will remain locked

within the Petri dish.









2.3 Liver Oval "Stem" Cell


2.3.1 Oval Cell Biology

2.3.1.1 Hepatic oval cell compartment

There is a strong interest in characterizing hepatic stem cells with respect to their origin,

mechanism of activation, and their final lineage destination. Oval cells are the primary

candidates for the title of liver stem cell. Adequate data has been gathered demonstrating oval

cells existence within the regenerating liver, but their place of origin and their role in liver

development, regeneration, and carcinogenesis remains enigmatic. Oval cells dramatically

increase in number when hepatocyte proliferation is suppressed. 2-Acetoaminofluorene (2-AAF)

given prior to hepatic injury induced by %/ partial hepatectomy (PHx) results in suppression of

hepatocyte proliferation through inhibition of Cyclin D as well as DNA adduct formation.86 Oval

cells of undetermined origin then arise in the portal zones of the liver. Morphologically, oval

cells are small in size (approximately 10Cpm), with a large nuclear to cytoplasmic ratio, and

contain an oval shaped nucleus, hence the name "oval cell" (Figure 2-6).58

Figure 2-7 shows the oval cell migration and infiltration of the liver during the 2AAF/PHx

protocol. Beginning about 3 days after PHx, oval cells are visible within the portal region of the

liver. They proliferate and peak in number 9 days post PHX. They then differentiate into small,

basophilic hepatocytes and eventually mature hepatocytes. After 21 days, little evidence of oval

cell infiltration remains and hepatic architecture has returned to normal.

Oval cells have similarities to bile ductular epithelial cells in their distinct isoenzyme

profiles, expressing certain cytokeratins (e.g. CK-19), gamma-glutamyl transpeptidase (yGT),

and may also express high levels of alpha-fetoprotein (AFP).88,89 Several monoclonal antibodies

including A6 for mouse and OV6, OC.2, and BD1 for rat have been developed to aid in their

identification and characterization within various species including humanS.88-10









Within the rat model, Evarts et al. (1987 and 1989) revealed extensive activation of the

oval cell compartment within the 2-AAF/PHx model, a variant of the Solt-Farber protocol.103'104

In additional studies, the same investigators illustrated that proliferation of oval cells and their

subsequent differentiation into hepatocytes during the early stages of carcinogenesis were closely

associated with an activation of stellate cells. It was then suggested that perisinusoidal stellate

cells may regulate the developmental fate of the progenitor cells, either directly by secreting

growth factors, such as hepatocyte growth factor (HGF) and transforming growth factors alpha

(TGF-a) and beta (TGF-P), or indirectly via effects of extracellular matrix (ECM) components

induced by urokinase up-regulation.'os Progenitor cell proliferation and differentiation may also

be regulated by autocrine production of TGF-P, acidic fibroblast growth factor, and insulin-like

growth factor II, which are factors that oval cells have been shown to produce.' Hence, hepatic

injury-induced changes in cytokines and growth factors appear to modulate in situ oval cell

proliferation/differentiation within the liver. Further study of the growth factors, such as Wnt,

that are involved in these processes will lead to great advances in liver therapeutics.

Oval cells in the liver represent an alternative source of proliferating cells in the

regenerating liver. Proliferating oval cells in both the rat and murine models appear to radiate

from the periportal region, forming primitive ductular structures with poorly defined lumena.106

The origin of oval cells remains unclear. Due to their involvement in periportal repair, some data

suggests that oval cells exist in very small numbers in the periportal region of the liver lobule,

and that they emerge from this niche in response to severe hepatic injury.107.10s Though oval cells

do not normally participate in the regenerative response to PHx or CCl4 injury, they can be

induced to do so through suppressing mature hepatocyte proliferation. Administration of 2-AAF

prior to and during hepatic injury induced by PHx or CCl4, blocks the proliferation of









hepatocytes by interfering with their ability to divide. As with allyl alcohol induced injury, oval

cell proliferation in these models begins in the periportal region before arborizing into the mid-

zone as regeneration progresses. Oval cell proliferation can thus be stimulated in these otherwise

non-oval cell aided regenerating modelS.109








Figure 2-6. H and E of ra lv r, frmdy1 fte2AFCl .oo.Tesaloa el
(arw) r itute bewe the lage heaoye urudn apra raPT)
Magnification 20X
Leir ad aut (99) hoe thakt a er malnubr~ ofclslclze ntecnl

of~4~ Heigo dl ora a ie xresdteftlf rm 8 ofAPmNsgetnhtti
ma etecmarmn hr natv vlcls eie10Cnvrey n192Mreue l





to bre t-.he puatdEo aive stem cells because theylce otherCC1 makrstcl stemal oa cell mresadi


contras to d he atolsts, they1 dho nteac wtha ther moncoall antiberody BPlslCS."d nth






Petersen et. al exposed rats to methylene dianaline (DAPM) 24 hrs prior to hepatic damage

(2-AAF/hepatic injury, PHx or CCl4).112 Under these circumstances the bile ductular epithelium

was destroyed and the oval cell response was severely inhibited.112 This study was the first to

elucidate a direct association between the requirement of an intact bile ductular epithelium and

the ability to mount an oval cell response. This data, however, does not prove that oval cells arise









from bile ductular cells because the DAPM could have elicited either a direct or indirect toxic

effect upon the oval cells, which may have resulted in the inhibition of their activation. This

study does support the idea that oval cells arise from the periportal zone, specifically from the

canals of Hering.112

























Figure 2-7. H and E of livers from the 2AAF/PHx protocol. Oval cell infiltration can be
visualized across the 2AAF/PHx time course. Oval cells appear within portal regions
of the liver rapidly following PHx. Peak oval cell production occurs after 9 days.
Arrows within the 40 X magnification of Day 9 indicate the oval cells migrating
toward the central vein. 13 days post PHx small, basophilic hepatocytes emerge as the
oval cells differentiate. After 21 days the hepatic microarchitecture has returned to
normal. Magnification 20X.

Interestingly, Petersen et. al has also shown that a percentage of oval cells may actually

arise from an extra-hepatic source within the bone marrow.65 Several other investigators have

confirmed that bone marrow derived cells possess the ability to produce functioning hepatocytes

and bile ductular cells. 69,70,113These recent findings have clouded the clarity as to the origin of

oval cells. Although numerous studies suggest that the oval cells reside somewhere within the









hepatic architecture in close association with bile duct epithelium, the exact oval cell niche has

yet to be discovered.






/ HCC or CCC Biliary Epithelium




Hepatocvtes [tstin








Basophilic Hepatocytes




ThyC1, ,ckit


Hepatic Progenitor Cells Canal of Hering Neural Cells

Figure 2-8. Drawing of potential end points of oval cell differentiation. Hepatic progenitors may
reside in an extrahepatic site or within the Canal of Hering in the portal regions. Oval
cells can differentiate into cells of hepatic, pancreatic, intestinal, and neuronal
lineages and they have been implicated in hepatic cancers.

2.3.1.2 Oval cell plasticity

Figure 2-8 represents a schematic diagram of the endpoints and potential endpoints of oval

cells according to a review by Lowes et al (2003) and work by Deng et. al. 114,115 The hypothesis

that oval cells differentiate into hepatocytes is certainly not a novel idea, having been proposed

as early as 1937 by Kinosita et al.116 Through the years several investigators have provided









evidence to substantiate this thought to varying degrees.117-121 The unpredictable success of these

earlier studies in demonstrating oval cells differentiating into hepatocytes and bile ductular cells

results from the complex problems posed by both the heterogeneous starting population of oval

cells used in transplantation studies together with kinetic complexities inherent with tracing

tagged DNA. Additionally, the limited types of reagents utilized by these earlier studies may

have affected the results obtained. However, it is generally accepted that oval cells possess the

ability to become both hepatocytes and bile ductular cells.

Scientists have found that HSCs obtained from adult peripheral blood retain a tremendous

developmental "plasticity". Environment has become a key factor in determining the

developmental proclivity of a stem cell. HSCs have been shown to give rise to the oval cells and

within the liver, oval cells retain many hematopoietic stem cell markers including Sca-1 (mouse)

and Thy-1 (rat) but gain expression of liver specific markers such as AFP.77,88,89,122 Taken

together these data suggest that either these HSCs and oval cells share a common developmental

origin or they are both derived directly from the same stem cell.

Regardless of origin, all stem cells execute their developmental program by regulating

gene expression. Determining which signals internal or external that induce differentiation,

maintenance of pluripotentiality, or self renewal could prove very therapeutically relevant.

Understanding both an oval cell's potential plasticity as well as the control of that plasticity will

lead to a better understanding of the biology of oval cell as a whole.

2.3.1.3 Oval cells in therapeutics

With the increasing interest in characterizing oval cells with respect to their origin,

questions arise regarding the mechanism of their recruitment and their differentiation potential.

Investigators hope that some day these cells can be used therapeutically in the restoration of










human livers damaged by chemicals and infectious disease, as well as inherited metabolic

di orders.

Two distinct obstacles must be overcome for oval cells to be considered for clinical

application. Maintenance of oval cells in an undifferentiated state in culture has surfaced as the

first maj or hurdle. Developing this technique is critical, because any therapeutic use of these

cells will require the expansion of a small population of cells ex vivo prior to transplantation. The

second impediment has been selectively directing the differentiation of oval cells down a

hepatocyte or bile duct epithelial committed pathways as needed. It is anticipated that the signals

mediating these differentiation processes will be sufficiently complicated as to disallow their

exact replication in vitro. Factors governing oval cell differentiation may include contact with

other cell types, contact with the ECM, or exposure to soluble signaling proteins in the serum

such as the Wnt family of proteins. To circumvent the need for overcoming this second hurdle,

cells could be transplanted in their precursor form and the natural microenvironment of the liver

used to dictate their differentiation, but this theory has yet to be validated.

2.4 Stem Cells and Cancer

2.4.1 Theories of Cancer Development

2.4.1.1 Cellular origins of cancer

To accurately determine the cellular origin of any cancer, one must identify the individual

cell type that initiates the cascade of events ultimately resulting in tumor development. The

linear progression from that initial cell through the multistep process of tumor initiation,

promotion, and progression must be clearly defined. The use of phenotypic cellular markers to

indicate distinct cellular origins of a cancer has proven highly unreliable due to cellular

variations present during routine cellular processes, chemical exposure and other stresses.









Although certain cell types consistently exhibit specific cellular markers, the presence of those

markers is not definitive of a cell's origin or differentiation potential.

The similar histologic appearance and growth characteristics linking embryonic tissues and

cancer have led the pioneers of pathology to conceptualize a stem cell origin of cancer. Research

linking the resident organ specific stem cells and the development of cancer has been observed in

numerous malignancies in the skin, liver, as well exocrine glands such as breast and prostate, and

the hematopoietic system. Regardless of their origin, transformation of cells to a malignant

phenotype requires a series of epigenetic changes and genetic mutations.

2.4.1.2 Stem cell theory of cancer

In the late 1800's, Conheim and Durante hypothesized that cancer developed from

rudimentary embryonic tissues present in mature organs.123 These tissues resulted from excessive

proliferation of embryonic tissue that lay dormant in mature organs and later underwent

oncogenesis. This theory became known as the embryonall rest hypothesis."123 Later, the theory

of anaplasia based on the dedifferentiation of mature tissues induced by chemical or viral

exposure replaced the embryonal rest theory.123 The most recent theory of carcinogenesis

involves the maturation arrest of resident tissue stem cells. The more primitive arrested stem cell

results in a tumor with a less differentiated phenotype.123 Currently, the scientific community

hotly debates whether the dedifferentiation theory or the maturation arrest theory correctly

defines neoplastic development.

2.4.2 Oval Cells and Liver Cancers

2.4.2.1 History of oval cell theory of hepatic carcinogenesis

The liver should be viewed as an organ that contains two distinct cellular pools: the

unipotential hepatocytes and the multipotential oval "stem" cell. Tumors may arise by either the

dedifferentiation of an adult mature hepatocyte or by the maturation arrest of a liver stem cell.









The immature state of a stem cell does imply an increased potential for self-renewal and

differentiation, and the ability to undergo numerous and rapid divisions indicates a higher

likelihood of DNA damage and malignant transformation in the presence of a carcinogen.

Conversely, the minute number of oval cells within a normal liver in comparison with the

multitudes of hepatocytes causes one to question the theory that only hepatic stem cells are

sufficiently damaged during chemical carcinogenesis. It seems reasonable to expect that both

cellular pools could provide progenitors cells for neoplastic development. As it stands, these two

proposed origins of hepatic cancers have support in the literature demonstrating their cell of

origin in both HCC and CCC development, and yet the debate still continues.

Genesis of liver tumors most likely occurs via multiple molecular mechanisms, which

depend on both the nature of the carcinogen and the lesion it induces. In reality, researchers may

never determine that only one cell type can undergo neoplastic changes, but the most long-

standing theory of the dedifferentiation of the hepatocyte has numerous studies behind it. In

1992, Farber stated that rare, original mature hepatocytes in all three zones of the adult liver

appear after initiation with genotoxic carcinogens, and he stated that foci or islands of altered

hepatocytes and nodules derived from these rare, original mature hepatocytes.124

The concept of the liver stem cell playing a role in chemically induced carcinogenesis can

be traced back as far as the early 1930s.8 These studies demonstrated that hyperplasia of small

round cells in the periportal region of the liver preceded the development of hepatocellular

carcinoma.8 The hepatic oval "stem" cell is currently believed to play an essential role in the

etiology of liver development, growth, and regeneration, and they are also still being implicated

in the progression of hepatocellular carcinogenesis. With this premise, the stem cell origin of









liver cancer is either the resident facultative "oval" stem cell, the progeny of such a cell, or the

transitional duct cell.125

2.4.2.2 Evidence for oval cell theory of hepatic cancers

In 1956 Farber et. al initially theorized the participation of oval cells in the formation of

hepatic cancers due to their morphological changes during early chemical carcinogenesis."' The

exposure of the liver to ethionine, 2-acetylaminofluorene (2-AAF) and 3'-methyl-4-

dimethylaminoazobenzene (Me-DAB), result in: 1) oval cell proliferation which progressively

involved the entire liver lobule, 2) degenerative and hypertrophic changes in the hepatocytes next

to proliferating oval cells and 3) nodular regenerative hyperplasia of liver cells."' There were,

however, some important differences observed in the three models involving the time course of

the appearance of oval cells and the fate of these cells after stimulation by the chemicals. In the

ethionine and 2-AAF models the oval cells appeared at days 7 and 14 days post-exposure,

respectively. In contrast, the Me-DAB model produced oval cells significantly later, 21 days

post-exposure. More importantly, the fate of the oval cells in the Me-DAB model was different

from those induced by ethionine and 2-AAF. At the earlier time points oval cells derived from all

three models appear similar in morphology. However, at later time points, areas of apparent

transition between oval cells and hepatocytes were more numerous in the Me-DAB animals but

almost absent in those animals that received either ethionine or 2-AAF.11

The above observation raises an important issue. If the morphological transition from oval

cell to hepatocyte can be observed after Me-DAB exposure, then the theory that oval cells have

the capacity to differentiate into hepatocytes can be verified. The fact that ethionine or 2-AAF

did not produce the same results suggests that the compounds capable of inducing oval cell

proliferation may greatly affect both the rate and extent of oval cell differentiation into

hepatocytes. That a large percentage of oval cells are in the cell cycle during the early stages of









chemical carcinogenesis indicates these cells have the capacity to differentiate into hepatocytes.

This suggests that at least a percentage of HCCs can be derived from an oval cell lineage. Also

CCCs are thought to be derived from a bile ductular type of stem cell that has lost the capacity to

generate hepatocytes.

Interestingly, there has been increasing experimental evidence to support of the notion of

stem cell derived HCC. Hixson and colleagues employed a battery of monoclonal antibodies

specific for antigens associated with bile duct cells, oval cells, and fetal, adult and neoplastic

hepatocytes to analyze the phenotypic relationship between oval cells, foci, nodules and HCC

during chemical hepatocarcinogenesiS.102 They determined that oval cells, y-GT-positive

hepatocellular foci, persistent hepatocyte nodules, and primary HCCs all express both oval cell

and hepatocyte antigens, suggesting a precursor-product relationship between oval cells and

carcinomas. Similar results were obtained by Dunsford et al. (1989) using different monoclonal

antibodies raised against oval cells.126,127 These lineage relationships between oval cells and

HCC also exist in other models of liver carcinogenesis. For example, animals on a choline

deficient diet supplemented with ethionine (CDE) diet display markers for oval cells in a

significant percentage of nodules and HCC.102

Evidence for oval or ductal cells as progenitors for HCC is not restricted to experimental

rodent models of chemical hepatocarcinogenesis. Results from Van Eyken et al. (1988) on CK

expression in 34 "classical" human HCCs using monospecific anti-cytokeratin antibodies

showed that all HCCs were positive for CK-8 and CK-18.128 However, in 17 cases, a variable

number of tumor cells were positive for CK-7 and CK-19, both known to be bile ductular

epithelium markers.128 The authors also reported that only 3 of 11 well-differentiated tumors

displayed this "unexpected" pattern of immuno-reactivity as opposed to 7 out of 7 poorly









differentiated tumors.128 This is important in light of earlier findings by Denk et al. (1982) that

CKs continue to be expressed when hepatocytes become neoplastic.129 These observations

become particularly significant in light of Hsia et al. (1992) and Vandersteenhoven et al. (1990)

who demonstrated immunohistochemically the presence of oval type cells with characteristics of

both bile ducts and hepatocytes in the liver of patients with end stage cirrhosis and/or tumors in

patients with hepatitis B infection.130,131 Although this molecular evidence does suggest that

these tumors are derived from the oval cell compartment, they do not eliminate the possibility

that these tumors developed via dedifferentiation of hepatocytes.

A recent paper documented evidence of oval cells and/or rat liver epithelial (RLE) cells

capable of progressing to HCC and CCC from the in vitro transformation of these cell types.

Spontaneous transformation of RLE or transformation of oval cells with chemical carcinogens

resulted in the tumors displaying a wide range of phenotypes including well-differentiated

HCCs, CCCs, hepatoblastomas and poorly differentiated or anaplastic tumors.132-13 While these

findings are interesting from the point of view of what might happen, theoretically, these in vitro

studies have been of limited value in clarifying what really happens in vivo. To date, no reported

study on in vitro neoplastic transformation of oval cells has been able to match up, step-by-step

with what occurs in vivo with the exception of morphologic and immunohistochemical

similarities between these in vitro tumors and some in vivo cancers. As stated earlier, cancer may

arise from the phenotypic change in a rare cell, both in vivo and in vitro, but it becomes almost

impossible in vivo to identify the cell of origin.

Currently, there is no direct evidence that any cell type among the hepatocytes,

proliferating ductal epithelial cells and/or oval cells is the cell of origin for foci, nodules and

HCC or CCC development. Thus the basis for oval cell participation in hepatic cancer









development is all circumstantial, speculative and indirect, albeit strong, it is still not conclusive.

Within these complex animal carcinogenesis models, conclusions concerning whether original

hepatocytes, altered hepatocytes, or proliferating oval cells are the likely cells of origin for

evolution to cancer has not been feasible to date.

2.5 Wnt Family of Proteins

2.5.1 Wnt Pathway

2.5.1.1 History of the Wnt pathway

The Wnt family of highly conserved growth factors has an active role in the in vivo

regulation of developmental and homeostatic processes across the animal kingdom. Interestingly,

membership within this class of proteins is not based on functionality but instead relies on amino

acid sequence homology. This method of classification has created a large group of proteins with

various functions associated with often contradictory activities and numerous mechanisms of

downstream signaling. The implied involvement of Wnt pathways in a wide variety of

developmental events as well as numerous human diseases ranging from deformities to cancer

has caused a drastic increase in the interest in unraveling the actions of this complex protein

family.

Wnt protein sequences are highly conserved across species and there are a large number of

proteins included in the family. Mammals have 19 Wnt genes which can be classified into twelve

distinct subfamilies.135 Of these twelve subfamilies, eleven are found in the Cnidarian genome.

The family of Wnt receptors, proteins known as Frizzled, also has a large number of members

(10) which are also highly conserved across species.135 This cross phylum conservation of these

gene families indicates the developmental role of Wnts was initiated over 650 million years ago

and very early in the evolution of metazoans.135









2.5.1.2 Wnt proteins and signaling

The Wnt proteins are characterized by a highly conserved series of cysteine residues, and

although they have an N-terminal signaling sequence, they are highly insoluble. This insolubility

has been one of the most difficult obstacles to the understanding of concentration dependent

morphogenic nature of the Wnt proteins. Discovering the palmitolated state of Wnt3 a by Willert

et. al alleviated some of the problems associated with their notoriously difficult purification.136

The discovery of this lipid modification resulted in the first ever isolation of a biologically active

form of a Wnt protein. The palmitolation occurs exclusively on the highly conserved cyteine

residues and facilitate secretion of the protein and probably the formation of the gradients that

determine the morphogenic activity of the Wnt proteins.137

The Wnt family has several downstream signaling pathways including the Wnt/p-catenin

cascade, the noncanonical planar cell polarity pathway, and the Wnt/Ca" pathway; however, the

maj ority of research has focused on the p-catenin dependent signaling cascade. Although the

Wnt1 gene (initially termed int-1) was initially discovered in 1982 by Nusse and Varmus, the

link between Wnt and p-catenin was not discovered for nearly ten years when Wnt-1 was

definitively shown to regulate cell adhesion p-catenin levels.138139 Since that time the signaling

pathway that is termed the "canonical" pathway has been fairly well defined.

In cells not exposed to Wnt, p-catenin is phosphorylated by Axin and GSK-3P within the

destruction complex. This phosphorylation signals p-catenin for ubiquination and degradation.

Concurrently, Wnt target genes are repressed by the association of TCF with Groucho. While

completed with Groucho, TCF activates the transcription of genes not regulated by the canonical

Wnt pathway and represses the activation of Wnt responsive genes.

The canonical Wnt signaling pathway begins with Wnt binding to its receptor Frizzled and

the coreceptor LRP5/6. This binding allows for the phosphorylation of LRP and the recruitment









of Axin from the destruction complex to the membrane. Disheveled (Dsh) is also phosphorylated

by an unknown mechanism. The removal of Axin and the phosphorylation of Dsh inhibit the

function of the destruction complex which results in a cytoplasmic accumulation of p-catenin.

Whether actively transported or simply due to excess cytoplasmic p-catenin concentration, P-

catenin translocates to the nucleus and replaces Groucho in order to associate with TCF. P-

catenin in complex with TCF acts as a transcriptional activator for Wnt responsive genes. Figure

2-9 is a diagrammatic representation of the canonical Wnt signaling pathway.

2.5.2 Functions of the Wnt Family

2.5.2.1 Role of Wnt in differentiation and development

The Wnt family of proteins and their in depth "canonical" signaling pathway (Figure 2-9)

has been implicated in a variety of regulatory aspects of cellular differentiation and embryonic

development. 135,140,141 This family been described as a requirement for differentiation and

development of the brain, cartilage, mesenchymal tissues arising from somites, and limb bud

formation.142-151 Individual Wnt proteins and their downstream signals are also instrumental in

the directing the differentiation of progenitor cells.136,149,152 It should be noted that some of these

studies illustrate a Wnt involved in the differentiation of progenitors, while others implicate

different Wnt family members responsible for the maintenance of progenitors undifferentiated

sae136,152-154

The best example of Wnt control on differentiation was exhibited by Weismann' s lab at

Stanford. He demonstrated Wnt signaling resulted in the expansion of hematopoietic stem cells

(HSCs) that lacked discernable lineage specific markers, and when transplanted these cells

generated B, T, and myeloid cells.154 This pioneering paper, demonstrated Wnt' s role in inducing

a stem cell's self-renewal without altering the stem cell's original lineage potential. Wnt has also

been acknowledged as being responsible for the expansion of progenitors possessing predefined









fates such as the self-renewing crypts of the intestine, cardiac neural crest cells, and cells of the

anterior pituitary.15~5

A. B.


Fzd ,' LRP Fzdl LRP



GSK-3


Ubiquitin TCF




Figure 2-9. Representation of the "cononical" Wnt pathway. A. In the absence of Wnt, p-catenin
is dually phosphorylated by GSK-3P and Axin within the destruction complex. This
phosphorylation initiates the ubiquitination and degradation of p-catenin. B. When
Wnt binds to Frizzled and its co-receptor LRP5/6, LRP is phosphorylated which
draws Axin to the membrane and away from the destruction complex. Disheveld
(Dsh) is also activated in an unknown manner and facilitates the phosphorylation of
GSK-3P. Phosphorylated GSK-3P cannot phosphorylated p-catenin. The
unphosphorylated and, therefore, unubiquitinated p-catenin accumulates in the
cytoplasm and is shuttled into the nucleus. Within the nucleus, p-catenin displaces
Groucho from its complex with TCF, thereby, changing TCF from a repressor into an
activator of Wnt responsive genes.

2.5.2.2 Wnt family and disease

Although no documentation of any mutation or amplification of genes encoding Wnt

ligands or receptors has been linked to human cancer to date, several components of the Wnt

pathway have been implicated in carcinogenesis, especially TCF, APC and beta-catenin. "" The

member of the destruction complex known as adenomatous polyposis coli (APC) was first

discovered as the tumor suppressor that undergoes a loss of function in Familial adenomatous

polyposis (FAP) and >80% sporadic colorectal cancer.159 Mutations in other downstream signals

within the Wnt pathway have been specifically connected to the formation of HCC, CCC,









sporadic medulloblastomas, and esophageal squamous cell cancinomas.159 Cancers containing

mutations resulting in the disregulation of the downstream Wnt signaling molecules include

cancers of the colon, liver, breast, prostate, and brain."

The various functions of the Wnt proteins, their receptors, and downstream signals can

readily be seen in the variety of human diseases linked to these genes. A large portion of the

diseases are associated with bone and connective tissue morphogenesis and include Familial

tooth agenesis, osteoporosis pseudoglioma syndrome, and Dupuytren skin disease.159

Interestingly, a homozygous mutation in the human Wnt3 gene results in the drastic phenotype

of tetra-amelia.1l59,160 This single mutation indicates the intense developmental requirement of the

Wnt proteins in limb bud formation. Neurologic requirements for Wnts are more generalized as

they have been implicated in Alzheimer's disease and schizophrenia.159 Within the heart, Frizzled

receptors have been implicated in cardiac hypertrophy and myocardial infarctions. Lastly, Wnt4

mutations result in Mullerian-duct regression and virilization, an intersex phenotype, and errors

in kidney development.159 The vast actions of this family and its cross species developmental

requirements can readily be observed in the various human diseases directly linked to Wnt and

its downstream signals.

2.5.3 Wnts and the Liver

2.5.3.1 Wnts and liver regeneration

The Wnt family has strong ties to the process of regeneration. Wnt knockouts inhibit

regeneration of limbs.151,160 Mutations in Wnt3 result in a complete failure in limb bud

formation. Also, the evident rise in Wnt and its downstream signals immediately following

partial PHx deeply implies the involvement of Wnt in the regenerative processes of the liver.161

Through the study the expression of Wnt and its downstream mediators throughout oval cell









differentiation along the hepatic lineage as well as during the oval cell response to injury, the

role of the Wnt family in the liver can be fully elucidated.

2.5.3.2 Wnts and liver development and liver zonation

p-catenin has a dual role in regulating hepatocyte adherens junctions and transcription of

Wnt regulated genes. The regulation of p-catenin by both the Wnt family and the HGF have been

implicated in the control of hepatocyte division and liver growth.162 Mice that over express P-

catenin have a three to four fold increase in hepatic size due to increased hepatocyte

proliferation. 163,164 This clearly indicates the dramatic role p-catenin has in liver growth and

development. Also changes in APC levels across the liver functional lobule have been

recognized as contributing to the zonation of the lobule. APC levels are high in pericentral

hepatocyte which correlates to low levels of p-catenin activation.165,166 COHVersely, in periportal

hepatocytes, p-catenin activation is high whereas APC levels are low. Knocking out APC

resulted in Zone 3 hepatocytes with gene expression profies similar to those of Zone 1.165

Clearly Wnt signaling has critical roles within the liver.

2.5.3.3 Wnts and liver diseases

Although Wnt family members are not as clearly associated with liver diseases as their

down stream signals, these signaling molecules have severe implications in liver disease

processes. Most significant are the roles that these molecules play in liver tumors both benign

and cancerous. Nuclear localization of p-catenin has been reported in 90-100% of

hepatoblastomas and a significant but small percentage of hepatic adenomas.162 Also interesting

was that in those adenomas that had nuclear translocation of p-catenin, 46% progressed to HCC.

p-catenin translocation is present in a very high percentage of HCC.162 Although the mechanisms

controlling that translocation vary, the influence of the Wnt signaling cascade is very apparent in

HCC development.162 Lastly, within CCC, a decrease in adherens p-catenin and E-cadherin in










conjunction with nuclear p-catenin localization has been observed. Although no mutations in

Wnt genes have been found in tumors, their down stream molecules are actively implicated in

carcinogenesis and other disease processes, therefore, understanding the role Wnt family

members have in normal tissues can greatly increase our understanding of disease processes.









CHAPTER 3
SPECIFIC AIMS

In 1956 E. Farber recognized the same cell type appearing in the liver after several

different chemical injury models. He classified these small cells with high nuclear to cytoplasmic

ratios as oval cells. Although debate continues as to the site of origin of these cells, they are

universally considered to be the resident hepatic stem cell. Some suggest that oval cells arise in

the Canal of Hering; while others believe they arise form an extra hepatic source. In situ oval

cells are bipotential in nature. When they are present in the liver they differentiate toward both

hepatic and bile ductular epithelial lineages.

The Wnt family of secreted proteins controls various differentiation pathways during

numerous stages of embryogenesis, including hepatic development. Wnts have been shown to

maintain stem cells in an undifferentiated state while increasing self renewal, and they have been

shown to direct progenitor differentiation. They have also been implicated in hepatocyte based

liver regeneration after partial hepatectomy. With known Wnt involvement in hepatic

organogenesis and regeneration, investigating the role of this family during stem cell directed

liver regeneration seemed logical.

Based upon the involvement of Wnt family members in hepatic organogenesis, it is

hypothesized that Wnt1 is a critical molecule required for the differentiation of oval cells

toward mature hepatocytes. In order to test this hypothesis, two specific aims were designed.

They are as follows:

* Specific Aim #1: To determine if the Wnt signaling pathway plays a role in hepatic stem
cell based liver regeneration

* Specific Aim #2: To determine whether Wnt1 is required for directing oval cells to
differentiate toward hepatic lineage during stem cell based liver regeneration.










Specific Aim #1: To fully understand the signals which direct oval cell differentiation the

2AAF/PHx model was employed. Briefly, animals received an implant of a 28 day time release

2AAF pellet. Hepatocytes are inhibited from their normal replication by 2AAF. Seven days after

2AAF implantation animals underwent a%2/ partial hepatectomy. As early as 3 days after partial

hepatectomy oval cells begin to migrate out from the portal region and infiltrate the hepatic

lobule, radiating toward the central vein. Oval cell numbers peak at approximately 9 days after

partial hepatectomy. Oval cells begin to differentiate into basophilic small hepatocytes roughly

13 days post PHx. By 21 days after PHx the liver has regained its normal architecture and little

evidence of the oval cell infiltrate remains.

Initially, livers obtained from the peak of oval cell production were analyzed for the

presence of members of the Wnt signaling pathway. Immunohistochemistry was performed for

the Wnt receptors Frizzled numbers 7 and 5; Frizzled related protein 1 (Frpl), a known inhibitor

of the Wnt pathway; low density lipoprotein receptor-related protein 5 (LRP5), the coreceptor for

Wnt; three individual Wnts (Wnt~a, Wnt3, and Wntl), and the downstream signaling molecule

p-catenin. After determining that the Wnt pathway was activated during oval cell induction,

western blot, rt-PCR and IHC were utilized to asses the pattern of Wnt activation throughout the

2AAF/PHx model.

Cells isolated from perfused livers were separated by density with a Nycodenz

fractionation gradient. The resulting four fractions contained immune cells and stellate cells (F l),

oval cells (F2), small hepatocytes and Kupffer cells (F3) and hepatocytes (F4). Isolated cell

fractions from normal liver and the peak of oval cell proliferation were compared for Wnt1

levels and p-catenin levels. As an indicator of active Wnt signaling, changes in the

phosphorylation status of p-catenin were also examined.









The observation that hepatocytes expressed high levels of Wnt proteins and oval cells

demonstrated evidence of p-catenin translocation and decreased phosphorylation levels indicated

an active response to Wnt signaling by oval cells. This response was further evaluated by

exposing a hepatic stem cell line, designated WB-F344, to purified Wnt3a protein. After 48

hours of incubation with Wnt3 a, p-catenin translocation was visualized.

Specific Aim #2: The in vitro protein and RNA data supported a role for the Wnt pathway

in oval cell based liver regeneration, however, as no definitive link between Wnt1 and oval cell

differentiation had been established, a short hairpin Wnt1 siRNA construct was designed. To test

the efficiency of the shRNA construct to knockdown Wnt1 protein levels, stably transfected

PC12/Wnt1 cells were transiently transfected with Wnt1 or scrambled (SCR) shRNA vectors

containing green fluorescent protein (GFP). GFP expression was utilized to determine

transfection efficiencies. Wnt1 levels were then assessed by western blot.

The construct was deemed successful enough for in vivo knockdown of Wnt1 signaling

during oval cell activation. Animals underwent 2AAF implantation and PHx. Venous inj sections

of shRNA vectors completed with the cationic lipid vector JetPEI were performed 3 and 6 days

after PHx. Animals were sacrificed at 9, 11, 13, 15, and 21 days after PHx. Tissue was collected

for paraffin sections, frozen sectioning, protein analysis and RNA analysis, and liver and body

weights measured.

GFP expression was evaluated in every organ collected from the animals in order to

ascertain the sites of shRNA vector uptake. Histology and morphology of livers were then

analyzed for deviations from normal oval cell based liver regeneration. Immunohistochemi stry,

western blot, and rtPCR were performed to detect changes in Wnt protein levels as compared to

standard 2AAF/PHx animals.









CHAPTER 4
MATERIALS AND METHODS

4.1 Animals Studies

The 2-AAF/PHx model was utilized to accurately assess the activation and fundamental

biology of the liver stem cell. This model provided the basis for understanding oval cell biology

with respect to growth, proliferation and differentiation, as well as in response to extrinsic

interventions. The assessment of oval cell differentiation states in vitro can be informational;

however, in vivo evaluation holds greater value in the analysis of the liver stem cell's inherent

functions. To date, no substitute has been found that adequately replaces an animal model in

examining the fate of oval cells.

4.1.1 Animals and Animal Housing Facilities

All animals utilized in this study were under approved animal protocols submitted to the

University of Florida IACUC committee. All animals utilized in this study were Fisher 344 male

rats obtained from Charles River Laboratories, Inc. (Wilmington, MA). Animals were housed in

a barrier facility under sterile conditions at the Animal Care Services Facility in the Medical

Science/ Communicore Building. The Animal Care Services is a state of the art animal facility

that provides a pathogen-free barrier environment. The animal care program is accredited by

AAALAC. The facility is supervised by veterinarians, which are always present at the facility or

on call. Animals are checked several times per day, and a veterinarian is always available for

consultation, particularly if decisions need to be made regarding euthanizing an animal prior to

the sacrifice date. The University of Florida meets National Institutes of Health standards as set

forth in the DHHS publication #NIH 86-23 and accepts as mandatory the PHS "Policy on

Humane Care and Use of Laboratory Animals by Awardee Institutions" and the National

Institutes of Health "Principles for the Utilization and Care of Vertebrate Animals Used in









Testing, Research and Training." The University of Florida has on Eile with the Office for

Protection Form Research Risks an approved Assurance of Compliance.

4.1.2 Animal Sacrifice and Tissue Collection

All animals utilized for tissue collection were euthanized by administration of an overdose

(150 mg/kg) of Nembutal Sodium Solution (OVATION Pharmaceuticals, Inc., Deerfield, IL)

This is consistent with the recommendations of the panel on euthanasia of the American

Veterinary Medical Association and the Guide for the Use and Care of Laboratory Animals (U. S.

Department of Health and Human Services/NIH Publication #86-23).

After euthanasia, tissue from brain, heart, lung, liver, pancreas, spleen, kidney, and

intestine was collected for paraffin embedding, frozen sectioning, and RNA and protein

collection. Samples for protein and RNA were snap frozen in a histobath containing 2-

methylbutane and kept at -80oC until isolation was performed. Tissues for paraffin embedding

were fixed O/N in 10% Neutral Buffered Formalin (Richard-Allan Scientific, Kalamazoo, MI).

The formalin was then exchanged for PBS and the tissue submitted for embedding by the

University of Florida Molecular Pathology Core Facility. Tissue collected for frozen sectioning

was immediately placed in Tissue-Tek O.C.T. Compound (Sakura Finetek U.S.A., Inc.,

Torrance, CA), snap frozen in a histobath containing 2-methylbutane, and stored at -80oC until

sectioning. All paraffin and frozen sections were cut to a 5Cpm thickness.

4.1.3 Oval Cell Induction in the Rat

4.1.3.1 2-AAF pellet implantation

Continuous administration of 2-AAF was used to suppress proliferation of mature

hepatocytes prior to partial hepatectomy. Utilization of a 2-AAF time release pellet alleviated

undue stress to the animals associated with multiple 2-AAF oral gavage and reduced the amount

of human exposure to the 2-AAF.









Briefly, the animals were anesthetized with isoflorane. The abdomen was shaved and

scrubbed three times in a circular pattern emanating from the center outward with ethanol and

three times with Betadine (Purdue Pharma L.P., Stamford, CT). The animal was then draped

with a Steri-Drape (3M, St. Paul, MN) with only the incision site exposed. Then a very small,

approximately 1/4 inch, incision was made in the lower right quadrant of the animal's abdomen.

A midline incision would not suffice because the pellet must be placed distal to the liver in order

to prevent adherence of the pellet to the body of the liver. The fibrosis associated with adherence

would complicate the subsequent partial hepatectomy.

After opening the abdominal wall, a small incision was made within the abdominal muscle

to facilitate entry to the peritoneal cavity. A 70 mg/28 day release (2.5 mg/day) 2-AAF time

release pellet (Innovative Research Inc., Sarasota, Fl) was carefully introduced through the

incision into the peritoneal cavity. The muscle tissue was then closed using 1-2 sutures of 3-0

Vicryl (Ethicon, Inc., Cornelia, GA). The skin was closed with the Autoclip Wound Closing

System (Braintree Scientific, Inc., Braintree, MA). Rats were then placed in a warmed cage and

monitored for complete recovery. This procedure yielded a survival rate of greater than 95%.

2-AAF 2/3 PHx




-7 _- 0 3 5 7 9 11 13 15 17 19 21
Day At Date of Sacrifice

Figure 4-1. Oval cell induction in the rat. Diagrammatic representation of oval cell induction
model in the rat including 2-AAF pellet implantation, partial hepatectomy, and dates
of sacrifice.

In successful procedures, hypothermia and dehydration were not an issue during recovery,

and in the event of excessive blood loss during surgery, animals were inj ected i.p. with 1-3ml









sterile saline. The animals were checked every six hours until fully recovered. The stainless steel

staples were removed after 10 days.

4.1.3.2 Two-thirds partial hepatectomy

The removal of 66% of the liver was originally described by Higgins and Anderson.8

Figure 4-1 represents a diagrammatic representation of the 2-AAF/PHx oval cell induction model

in the rat. The animals were anesthetized with isoflorane. The abdomen was shaved and scrubbed

three times in a circular pattern emanating from the center outward with ethanol and three times

with Betadine (Purdue Pharma L.P.). The animal was then draped with a Steri-Drape (3M) with

only the incision site exposed. A 1.5 cm longitudinal incision was made in the skin just below

the xyphoid process. The incision was continued through the midline of the abdominal muscle,

exposing the liver. The tip of the xyphoid process was excised to facilitate removal of the liver

and limit liver injury during extrusion. Next the left medial, right medial and the left lobe of the

liver were gently extruded through the incision. The lobes were then tied off with a silk suture.

The exposed lobes were excised and the remaining stump examined for excessive bleeding prior

replacement within the peritoneal cavity. Bleeding from the stump indicated incorrect tying off

of the excised lobes. If bleeding occurred and was unable to be controlled the animal was

euthanized. The muscle tissue was then closed using 4-5 sutures of 3-0 Vicryl (Ethicon, Inc.).

The skin was closed with the Autoclip Wound Closing System (Braintree Scientific, Inc.). The

stainless steel staples were removed after 10 days. Rats were then placed in a warmed cage and

monitored for complete recovery.

This procedure yielded a survival rate of greater than 90%. The 10% death rate was usually

associated with the aforementioned bleeding from the incorrectly tied liver stump. The difficult

in obtaining the correct the tension on the lighting suture should be noted. A ligature tied too

tightly causes the liver proximal to the knot to tear and this situation is practically impossible to










resolve. Conversely, insufficient tension on the ligature results in the inability to staunch the

blood flow to the stump and subsequent bleeding.

In successful procedures, hypothermia and dehydration were not an issue during recovery.

In the event that any blood was lost during surgery, animals were inj ected i.p. with 1-3ml sterile

saline. The animals were checked every six hours until fully recovered. The stainless steel staples

were removed after 10 days. Animals were sacrificed at days 3, 5, 7, 9, 11, 13, 15, 17, and 21

days post-PHx. Tissue collected was analyzed by IHC, rtPCR, and western blot.

4.1.4 Density-Based Separation of the Liver

4.1.4.1 Perfusion of the liver

In order to isolate intact hepatocytes and oval cells from the whole liver a perfusion was

performed. Following an i.p. inj section of 60 mg/kg sodium pentobarbital, complete anesthesia

was determined by pinching the back feet and absence of a leg and/or abdominal muscle

contraction. The animal's four appendages were then secured to the surgical table with tape. The

abdomen was shaved and then sterilized with 95% ethanol. A midline incision was made to

expose the peritoneum. The incision was then expanded laterally distal to the ribcage as well as

proximal to the iliac crest. These lateral incisions create abdominal flaps that can then be secured

to the table and creates greater access to the abdominal organs. The abdominal viscera were

displaced toward the rat' s lower right quadrant in order to expose the inferior vena cava. The

inferior vena cava was cannulated with a 20 gauge catheter and the hepatic artery ligated. The

thoracic cavity was then opened, and the superior vena cava occluded with a hemostat. The liver

was then perfused with lX S and M solution followed by an 80mg of collagenase in lX CaCl2

modified lX S and M. The entire liver was then harvested and placed in lX PBS for subsequent

oval cell and hepatocyte isolation. The procedure resulted in the complete exsanguination of the

animal.









4.1.4.2 Density gradient separation of liver cells

The suspension was filtered through a 125Cpm nylon mesh and centrifuged at 500 rpm for

5min to pellet the maj ority of hepatocytes. Two Nycodenz stock solutions at 30% (wt./vol.) were

prepared, one with cyanol FF, one without. The stock solutions were subsequently serially

diluted to 26, 19 (blue), 15 and 13% (blue) in lX PBS (Gibco) and sequentially layered (volume

of 1.5ml each). The cells of the pellet were resuspended in 1 1% Nycodenz solution and loaded

on the top of the gradient. Centrifugation was then performed at 8,000 x g for 30min. Cells were

located at the four gradient interphases Fl-4 starting at the top. Fraction 1 contained stellate cells

and immunologic cells. Fraction 2 contained mostly oval cells. Fraction 3 was small hepatocytes

and Kupfer cells. The final fraction contains mature hepatocytes. Cells from the interphases were

collected and finally washed in lX PBS and then utilized for protein or RNA isolation.

4.2 Liver Stem Cell Response to Wnt

4.2.1 Inz vitro Response of Rat Liver Epithelial cells to Wnt3A

In order to verify that oval cells do respond to Wnt signaling, WB-F344 a rat liver

epithelial cell was exposed to Wnt3a. WB-F344 cells were derived from the liver of an adult

Fisher 344 rat.167 WB-F344 cells are considered to be liver stem cell like and are accepted as a

substitute for primary oval cell culture as oval cells are notoriously difficult to grow in

culture. 167-173

4.2.1.1 Maintenance of liver stem-like cells, WB-F344

WB-F344 cells were graciously provided by Lijun Yang, M.D. The cells were maintained

in DMEM (GIBCO) media containing 10% fetal bovine serum, 10 I.U. Penicillin/ml, and

10Clg/ml Streptomycin in a 370C humidified incubator containing 5% CO2 and 95% air, and

passage using 0.25% trypsin plus 0.02% EDTA treatment. The culture medium was changed

every other day.










4.2.1.2 Exposure of liver stem-like cells to Wnt3A

WB-F344 cells were plated at approximately 20-25% confluency on collagen coated

coverslips within a 6 well dish. 24 hours after plating, the media was replaced with 1.0ml of

media supplemented with 250ng/ml Wnt3A (R and D Systems,minneapolis, MN). 48 hours after

exposure to Wnt3A, the media was removed and the cells washed twice with lX PBS. The cells

were then fixed with ice cold methanol for 10min. Immunofluorescence staining for p-catenin

was performed as described below to determine the response of rat liver epithelial cells to Wnt3a

exposure.

4.3 Wnt shRNA Model in Rat

In order to confirm that oval cells require Wnt signaling in order to differentiate into

hepatocytes, Wnt1 protein expression was inhibited with shRNA technology. Transiently

blocking the production of Wnt1 RNA effectively impeded Wnt1 protein production. Due to the

lack of Wnt1 stimulation, oval cells could not differentiate toward a hepatic lineage. As a result,

oval cells underwent atypical ductular hyperplasia.

4.3.1 Wnt shRNA Plasmid

4.3.1.1 Design of Wnt shRNA vector

A shRNA hairpin to the rat Wnt gene was constructed with shRNA Wizard (InvivoGen,

San Diego, CA). A custom-made psiTNA-Hlgz-Wnt1 plasmid was then created by InvivoGen.

As a control, a vector containing a scrambled shRNA construct that is not complimentary to any

known gene was utilized. The vector contained a 21nt sequence incorporated into a hairpin with

a 7nt spacer region. Once the shRNA was transcribed in a mammalian cell, the hairpin was

cleaved resulting in a 21bp double stranded RNA that served to bind to and knockdown the

production of the Wnt mRNA through the dicer pathway.










A. CA B. C
GC~CIUA~~~rCOUUeCCUA~CUGCAUG U GCUUUCUCUCA A 0
A A
nuCG~AULGCAAiCGAUGAel~~ACCGGAC G G unCGe UAUACCGCU GG~IAUCGUAl GAG


Figure 4-2. shRNA hairpin structures. Diagram of the (A) Wnt1 and (B) SCR shRNA hairpins.

The shRNA hairpin construct was under the control of the H1 promoter. The H1 promoter

drove the expression of the unique gene encoding the H1 RNA, the RNA component of the

human RNase P complex. The pshRNA vector also contained a CMV-HTLV promoter

controlling the expression of a GFP::zeo fusion gene. The GFP::zeo fusion gene produced the

GFP protein and Zeocin resistance in mammalian cells. A bacterial origin of replication and

EC2K promoter allowed E. coli to produce the vector and express Zeocin resistance. Lastly, the

P-Glo pAN site within the vector contained the human beta-globin 3' untranslated region and

polyadenylation sequence which allows for sufficient arrest of the GFP::zeo transgene

transcription. Figure 4-2 is a diagrammatic representation of the Wnt1 and SCR shRNA hairpins.

Figure 4-3 is a diagrammatic representation of the pshRNA-Wnt1 vector. Figure 4-4 is the

sequence of the pshRNA-Wnt1 vector and the relevant restriction enzyme sites, gene sites, and

orientations of open reading frames.

4.3.1.2 Wnt shRNA plasmid amplification

The lyophilized pshRNA vector was resuspended in 20Cl of molecular grade H20 to

obtain a plasmid solution at 1lyg/Cl1. The pshRNA vector was transformed into LyComp GT116

E. coli (InvivoGen). GT116 is a strain that contains a sbcCD deletion mutant that helps the

bacteria to better handle hairpin DNA structures than other strains ofE. coli. A vial of GT116

was thawed on stored on ice for 5min and then reconstituted with 1ml of reconstitution solution

on ice for 5min. The cells were rehydrated for 30min on ice. Then 1CL1 of 1l g/Cl1 pshRNA was

incubated with 100Cl~ of GT1 16 cells on ice for 30min. The cells were then heat shocked at 42oC










for 30 sec and placed on ice for 2min. 900Cl of SOC medium was then added and the tubes

shaken at 250 rpm for 1hr at 37oC. The cells were then spread on Fast-Media Zeo (InvivoGen)

agar plates and incubated O/N at 37oC.


HindIII r3430.


del (182)
naBI (288)


si-Wa~t1
HI prom~


Apall (2841


CMV-HFTLVE prom


sHpal (1186)


4

i~GI~ p.4n


GFP: :zen


EC2K


Mlfel 1169)


a 1633.


100


Figure 4-3. Map of the pshRNA-H1-gz-Wnt1 vector.

Colonies were then chosen and grown in volumes of 5ml of Low salt LB (10.0g Tryptone,

5.0g NaC1, 5.0g Yeast Extract) supplemented with 50Cpg/ml Zeocin (Invitrogen, Carlsbad, CA).

Plasmids were isolated from the 5ml cultures with QIAprep Spinminiprep Kit (Qiagen, Valencia,

CA) as per manufacturers' specifications. Larger quantities of plasmid were obtained with the

with QIAGEN Plasmid Maxi Kit (Qiagen) from 1L low salt LB supplemented with 50Cpg/ml

Zeocin (Invitrogen) cultures of transformed bacteria.


psiRNA-H1-gz-Wnt1
(3449 bp)















Sdal td)


NCdrl (182)
191

Sunul (288)
201

301

411

501

601

791

Nadr (522)

8911

91Bd



11081



1301

1491

1591L gtnagicartgactgtctaiog~ctggguangggtgggraggtggcggag

A~Sel (14i33) Mifrl (1469)
16-81 anagiggenet aigone ccACTAGTTTGb~b~ kCATITAATCAAAGCTAGTAJITAAdBTACAATETATAB~canittgt actanre ct tice tctieCcECe


1701 igaca g :GAGGACCCATbA EAATATC2A CAT CC-CACAGAAGGGA T-2AGG2-::2-AAT TOA A AT

1801 A"TCTC AGAGAbCT-TOT AAGA--OOTOT CA24G4-2AT-TCAC-:TGATTCAGT-C:ACAGTOCC CA

1991r ACCCT GETTG: GTrTS::- CAGAG:- GEC-AG AC- CGA-GEGAGA CGECAT"CGGTCCC2CCAEA

201 AGAA :Laar- --a ACAACC TOG GAAGGG AA-T: C: T i0AAACTE2AA- CTT2ACGGACGATA S




------ S-T:-BTi~.ib~:-5 -Td-C"T~nT C 4:-ST~bCT~i'j:k-fT-4-ilbl~i~~m
2591 AAACCC CT-S-~ CGCGTTTT"CTTGGAAGCACAAGCAGACTAAG2GG 2C CTTTC T



2691 bCGECCCCTTEACAGCTCACAAAAAT~L-TITCGACGTCAGCGGTEEACCAAGCAAAAACGC "CCCGAGT



2701 T~GTGCjCTCTC~TGTTEGAdICCCT TGCTACGGATACCTj GTCCTC'CTGGAGTGCCT"ACTACTTGT

apal.I 12841)
Z891 TCTCAGTCEGTGTAGTbjGTT TTGCTCCAAG:C'GGCTTC AGACCCGT3CGCGCSGC""CE-A"TTT

2991T TCCAACCCjG "AAGACACGACTTATCSCCACTGGCACAGCCETACGATGCGEGGTAGAEGGGTCGG"CTA2



3181 CAAA~CAATC~CACGCTGjTAECGTGTTTTGTTGCAA2CCCAGATAKAGAAAAGA"TAAGACTGTCTTT




Acc55] (33di2)
3301 A TCACCAbTAAATGTGAAA~CTGTCTTGTTTGGGATCTTAGTCGTTGGCCACGGTACCT~GCGTAC~GTTG(ICTCTGGCbEATGr~btmagagT C

Khal (3435)l
3401 AGTGCCAGTAG CAA{EGT AG CT-TTTG~jb~ GAAAACTTTAGAC TATTAA.




Figure 4-4. The sequence and relevant restriction enzyme sites of the pshRNA-H1-gz-Wnt1
vector.









4.3.1.3 Wnt1 shRNA plasmid analysis

The presence of plasmids isolated from cultures was analyzed by agarose gel

electrophoresis. A 30ml mini gel containing 0.7% (w/v) agarose in 0.5X TBE and was heated to

dissolve the agarose, and then 0.001% (v/v) ethidium bromide was added. The gel was then

allowed to cool in a gel pouring apparatus and a comb with appropriately sized wells was

inserted. After hardening, the comb was removed and the gel submerged in 0.5 X TBE in a gel

electrophoresis chamber. 0.5Cl1 of 10X Agarose gel loading buffer and 3.5Cl~ of Mill-Q H20 was

added to 1CL1 of each sample and each sample was loaded into the wells along with an appropriate

molecular weight ladder (1 Kb, 100 bp, etc.). The gel was then run at 90-110 volts for

approximately 1 hr or until desired separation of bands was visible on a UV light box. Pictures of

agarose gels were obtained with a GelDoc XR (Bio-Rad, Hercules, CA).

After 0.7% agarose gel electrophoresis confirmed presence of plasmids, the plasmids were

further analyzed by restriction enzyme digestion with Asel (New England Biolabs, Ipswich, MA)

as per manufactures' recommendations. Asel yielded a linearized 3448 bp plasmid when the

shRNA hairpin is present. When absent, Asel digestion of pshRNA yields two bands of 1801 bp

and 1647 bp. Also DpnI (NEB) digestion was utilized to distinguish between the SCRsi vector

and the Wntlsi vector. DpnI digestion of Wntlsi vector resulted in 8 bands of the following

sizes: 1747 bp, 593 bp, 536 bp, 277 bp, 202 bp, 75 bp, 11 bp, and 8bp. Whereas, the DpnI

digestion of the SCRsi vector yielded only 7 bands of the following sizes: 1747 bp, 795 bp, 536

bp, 277 bp, 202 bp, 75 bp, 11 bp, and 8 bp.

4.3.2 Verification of Wnt1 shRNA Function

4.3.2.1 Confirmation of Wnt1 knockdown in PC12/Wnt1 cells

Wnt1 stably transfected rat pheochromocytoma cells (PC 12/Wntl) were graciously

donated by G.M. Shackleford, PhD from the Division of Hematology-Oncology, The Saban










Research Institute, Children's Hospital Los Angeles, CA. PC12/Wnt1 cells were grown in Ham's

F l2K medium with 2mM L-glutamine adjusted to contain 1.5 g/L sodium bicarbonate, 15%

horse serum, 2.5% bovine calf serum, 10 I.U. penicillin/ml, and 10 Clg/ml streptomycin in a 37

OC humidified incubator containing 5% CO2 and 95% air, and passage using 0.25% trypsin

plus 0.02% EDTA treatment. PC12/Wnt1 cells were grown to 80% confluency in a 6 well dish

and transfected with 4.0Cpg of DNA utilizing Lipofectamine 2000 (Invitrogen) as per

manufacturer' s instructions. After 48 hours Wnt1 mRNA and protein levels were analyzed by

rtPCR and western blot.

4.3.3 Inhibition of Wnt1 in the Rat

4.3.3.1 In vivo shRNA to Wnt1

Animals underwent 2-AAF implantation and %/ PHx as previously described. 250Cpg of

pshRNA vector was completed with 20pl of in vivo JetPEI (Polyplus Transfection, NY, NY) as

per manufacturers' recommendations. 400Cl was given via the femoral vein to each animal in a

solution with a final concentration of 5% glucose. Nine animals received the SCRsi vector and

twenty-four received the Wntlsi vector. Animals were sacrificed at days 9, 11, 13, 15, and 21

days post-PHx. Tissue was collected and analyzed by IHC, rtPCR, and western blot. Figure 4-5

represents a diagrammatic representation of the shRNA model in the rat.

2-AAF 2/3 PHx
A= Date of Sacrifice


-7 -0 3 5 7 9 11 13 15 17 19 21
Days

Figure 4-5. Diagrammatic representation of Wnt shRNA model in the rat including 2-AAF pellet
implantation, partial hepatectomy, shRNA inj sections, and dates of sacrifice.









4.3.3.2 Femoral injections of shRNA vector

All shRNA constructs were delivered via the femoral vein. Briefly, after anesthetization by

isoflorane, a very small incision was made on the medial aspect of the left thigh. Fascia

surrounding the femoral vein, artery, and nerve was carefully excised. A standard butterfly

catheter infusion set with a 21 gauge needle was then inserted into the femoral vein. 400Cl of the

desired solution was then inj ected. Bleeding was controlled with pressure and the skin closed

with a single Autoclip (Braintree Scientific, Inc.). This procedure lasted less than minutes and

no complications were observed. The stainless steel staple was removed after 10 days.


Days Post Phx Wnt1 shRNA SCR shRNA
7 3 0
9 5 2
11 4 2
13 4 2
15 3 1
21 5 2
Total 24 9

Table 4-1. Numbers of animals sacrificed during in vivo Wnt1 shRNA inhibition.

4.3.3.3 Animal numbers

Animals were sacrificed at days 9, 11, 13, 15, and 21 days after PHx. Animal numbers at

the various time points are described in Table 4-1. Three animals treated with Wnt shRNA died 7

days after PHx which was one day after the second inj section. These animals exhibited massive

intestinal hemorrhage. Reasons for these deaths have been determined to be linked to possible

loss of vascular and/or intestinal epithelial integrity due to decreases in Wnt1 levels. Localized

hepatic administration of the shRNA vector could alleviate this problem in the future.









4.4 Histology and Immunohistochemistry


4.4.1 Histological Analysis

4.4.1.1 Hematoxylin and eosin of paraffin embedded tissue

Tissue sections of 5CLM in size were cut and placed in a 42oC water bath. They were then

lifted from the bath with a Superfrost Plus (Thermo Fisher Scientific Inc. Waltham, MA)

positively charged slide. The slides were air dried O/N at RT. The paraffin was removed and the

slides rehydrated by incubating them in Xylene 2 x 5min, 100% Ethanol 2 x 2min, 95% x

Ethanol 2 x Imin, and distilled H20 for 1min. Nucleic acids and other positively charged

molecules were then stained with Hematoxylin 7211 (Richard-Allan Scientific) for 2min 15 sec

and rinsed with distilled H20 for 2 x Imin. The blue color of the Hematoxylin was intensified by

incubating the slides in Clarifier 1 (Richard-Allan Scientific) for 1min, distilled H20 for 1min,

Bluing Reagent (Richard-Allan Scientific) for 1min, distilled H20 for 1min, and 80% Ethanol for

1min. Proteins were then stained a pink color with Eosin-Y (Richard-Allan Scientific) for 1min

30 sec. The tissue was then dehydrated for coverslipping with 2 x Imin 95% ethanol, 2 x Imin

100% ethanol, and 3 x Imin xylene. Coverslips were then applied with Cytoseal XYL (Richard-

Allan Scientific).

4.4.1.2 Hematoxylin and eosin of frozen sections

Tissue sections of 5CLM in size were cut and placed on Superfrost Plus (Thermo Fisher

Scientific Inc. Waltham, MA) positively charged slides. The slides were air dried for 5min at RT.

The tissues were fixed in Pen-Fix (Richard-Allan Scientific) for 30 sec. The slide was then

washed in distilled H20 for 1min. Nucleic acids and other positively charged molecules were

then stained with Hematoxylin 7211 (Richard-Allan Scientific) for 45 sec and rinsed with

distilled H20 for 1min. The blue color of the Hematoxylin was intensified by incubating the

slides in Clarifier 1 (Richard-Allan Scientific) for 25 sec, distilled H20 for 30 sec, Bluing









Reagent (Richard-Allan Scientific) for 30 sec, distilled H20 for 30 sec, and 80% Ethanol for 30

sec. Proteins were then stained a pink color with Eosin-Y (Richard-Allan Scientific) for 30 sec.

The tissue was then dehydrated for coverslipping with 2 x Imin 95% ethanol, 2 x Imin 100%

ethanol, and 3 x Imin xylene. Coverslips were then applied with Cytoseal XYL (Richard-Allan

Scientific).

4.4.1.3 Periodic Acid-Schiff staining of paraffin embedded tissue

PAS staining was performed to determine the presence or absence of mucin and glycogen

in liver tissue sections. All tissue stained with PAS for was performed by the University of

Florida, Department of Pathology, Molecular Pathology Core Laboratory.

4.4.2 Immunohistochemistry

4.4.2.1 Chromogen staining

All staining of paraffin and frozen sections was performed with Vector ABC Kits and Dab

or Vector Blue Reagent kits (Vector Laboratories, Burlingame, CA). All staining was performed

as per manufacturer' s instructions. DAB slides were counterstained with Vector Hematoxylin QS

(Vector Laboratories) and mounted with Cytoseal XYL (Richard-Allan Scientific). Vector Blues

stained slides were counterstained with Nuclear Fast Red (Vector Laboratories) and coverslipped

with VectaMount Permanent Mounting Medium (Vector Laboratories). Slides were incubated

O/N at 4oC for primary antibody and 30min for secondary antibodies. Any special retrieval

method needed for a specific antibody is listed in 4.4.2.3.

4.4.2.2 Fluorescent staining

All paraffin slides were deparaffinized and rehydrated as in H and E staining. Frozen

sections were air dried and fixed for 10min in ice cold methanol unless otherwise stated in

Section 3: Antibodies utilized for Immunohistochemistry. Slides were incubated for 5min in lX

TBS plus 0. 1% Tween (TB S-T), and then blocked with serum for 20min and incubated with the










primary antibody 1hr at RT or O/N at 4oC. Slides were then washed for 5min in lX TBS-T at RT

and incubated with a fluorochrome labeled secondary antibody for 30min. Slides were again

washed for 5min in TBS-T at RT and then coverslipped with Vectashield Mounting Media with

DAPI (Vector Laboratories). Fluorescence was observed and photographed with a fluorescent

microscope or a confocal fluorescent microscope. The microscope, camera, and software

utilized to assess IHC were a BX51 Olympus Fluorescent microscope fitted with cubes for FITC,

Texas Red, DAPI and dual pass FITC/Texas Red, an Optromic Digital Cemera with Image Pro

3.1 Software, and Magnafire 3.1. All confocal microscopy was performed by Doug Smith at the

University of Florida Stem Cell program on the Leica TCS SP2 AOBS Spectral Confocal

Microscope with the LCS (Leica Confocal Software) Version 2.61, Build 1537 software.

4.4.2.3 Antibodies Utilized for Immunohistochemistry

Protein Animal Concentration Retrieval Company Cat. #
Wnt 1 Goat 1:50 None Santa Cruz sc-6280
Wnt3 Goat 1:50 None Santa Cruz sc-28824
WntS a Goat 1:50 None Santa Cruz sc-3 0224
B-catenin Mouse 1:800 Citrate BD Biosciences 610153
OV6 Mouse 1:150 None Gift from S. Sell Albany, NY
CD45 Mouse 1:100 None BD Biosciences 554875
Ki67 Mouse 1:100 Citrate BD Biosciences 556003
SDF-1 Goat 1:50 Citrate Santa Cruz sc-6193
AFP Rabbit 1:800 Trilogy Dako A0008
GFP Rabbit 1 ug/ml Citrate Abcam ab6556

Table 4-2. Antibodies utilized for immunohistochemi stry.

4.5 Protein Analysis

4.5.1 Protein Isolation and Quantification

4.5.1.1 Protein isolation from tissue or cells

Tissue was placed in desired amount of RIPA buffer with Protease Inhibitor. The tissue

was broken up and then sheared with an 18 gauge needle and 3ml syringe. The tissue was

pipetted up and down until tissue was thoroughly homogenized. The sample was vortexed for 30









seconds and then spun at 10,000 x g at 4oC for 10min to remove excess lipids and DNA. The

supernatant was collected into 2.0ml screw cap tube and placed in -80oC until use.

4.5.1.2 Protein quantification with DC Protein Assay

Blank and protein standards were made in 1ml tube as follows:

1. Blank 25 Cll RIPA Buffer without Protease Inhibitor
2. Standard #1 1Cl1+ 24C1l RIPA Buffer without Protease Inhibitor
3. Standard #2 2C1l + 23 Cl RIPA Buffer without Protease Inhibitor
4. Standard #3 4C1l + 21Cll RIPA Buffer without Protease Inhibitor
5. Standard #4 8C1l + 17C1l RIPA Buffer without Protease Inhibitor

Samples were made with lul sample and 24Cl RIPA Buffer without Protease Inhibitor

Solution in 1ml Clear Tube. In another 1ml tube 125C1l Reagent A per reaction and 2.5C1l Reagent

S per reaction from the DC Protein Assay (Bio-Rad, Hercules, CA) were mixed. Note: Reaction

number equals "sample number plus five". 125C1l of combined solutions A and S was added to

each reaction. When ready to measure Iml Reagent B was added and tubes vortexed. 5-10min

after the addition of solution B the OD of the samples were measured in disposable cuvettes in

Spectrophotometer set to 750nm.

4.5.2 Western Blot Analysis of Protein Levels

4.5.2.1 Pouring an acrylamide gel

Main gel (10%, 8%, or 6% Acrylamide Gels): All components of gel except TE1VED

were mixed in a 15ml polypropelene tube. When ready to pour the gel the TE1VED was added.

1. H20 4.85ml=10%, 5.35ml=8%, 5.85ml=6%
2. 40% Bis-Acrylamide 2.50ml=10%, 2ml=8%, 1.5ml=6%
3. 2.50ml 1.5M Tris-Cl (pH 8.8)
4. 100 Cil 10%SDS
5. 33 Cll Ammonium Per Sulfate (APS)
6. 7 Cll TE1VED

The sponge on the gel pouring apparatus was dampened and the plates cleaned with

alcohol. The plates were then aligned and secured in gel pouring apparatus. The gels were









poured using electronic or plastic Pasteur pipettes. They were poured to approximately 1-1.25

cm below the top of the plate. Butyl alcohol was added to top of glass to prevent bubbles and

smiling of gel. After 30min the remaining solution in the 15ml tube was inverted to determine if

gel solidified. The butyl alcohol was removed and the gel rinsed with Milli-Q H20.

Stacking gel: All components of gel except Temed were mixed in a 15ml polypropelene

tube. When ready to pour the gel the TEMED was added.

1. 1.25ml H20
2. 0.50ml 40% Bis-Acrylamide
3. 0.50 0.5M Tris-Cl (pH 6.8)
4. 20Cl 10%SDS
5. 15C1l Ammonium Per Sulfate (APS)
6. 2Cl TEMED

The gels were pored using electronic or plastic Pasteur pipettes to slightly below top of

glass and the comb inserted. After 10-15min, the gel was ready to run after gently removing

comb and rinsing the wells with Milli-Q H20.

4.5.2.2 Protein sample preparation

The amount of protein to be loaded per well was determined based on source of isolation

(tissue or cell culture) and the sensitivity of the antibody being used for detection. Samples were

added to the appropriate amount of RIPA Buffer to equal 12C1l per lane and placed in a screw cap

2.0ml tube. 3 Cl of 5X Western Loading Buffer per lane was added to each tube. Each sample

was boiled for 10min and then incubated at RT for 5min to cool. Each well of 0.75mm gel was

loaded with 15C1l of sample with dye. The samples were immediately loaded and any remaining

solution placed on ice and returned to storage at -800C.

4.5.2.3 Electrophoresis of the western gel

The gel was loaded in the running apparatus with small plate facing inward. The inner

chamber was filled with lX Running Buffer till full and overflows and the outer chamber was









filled 2.0 inches. 15Cl1 of samples were loaded per well with 10pl1 of Protein Standard within the

first well. Any empty lanes were filled with 15Cl~ of 2X Western Loading Buffer. The gel was run

at 60-80 Volts until the loading dye had migrated out of the stacking gel. Then the gel was run at

100 Volts until the loading dye ran the length of the gel.

4.5.2.4 Transferring of a western gel to a PVDF membrane

The upper left corner of the Immun-Blot PVDF (Bio-Rad) membrane was cut and the

membrane was labeled with pencil. It was then dipped in methanol, soaked in water for 5 min,

and soaked in lX transfer buffer for 20min. Sponges and fi1ter papers were also soaked transfer

buffer. The gel plates were opened and the stacking gel/wells were removed. The gel was

submerged in lX transfer buffer. A sandwich consisting of black assembly tray, sponge, fi1ter

paper, gel, PVDF membrane, fi1ter paper, sponge, and red assembly tray along with an ice block

and stir bar were placed in the transfer apparatus. The transfer apparatus was filled with lX

transfer buffer and placed on a stir plate. The transfer buffer was stirred continuously while

transferring to ensure the apparatus would not overheat. The proteins were transferred at 200

milliamps for 60min for a 0.75mm gel and 90min for a 1.50mm gel.

4.5.2.5 Probing of western membrane

The membrane was blocked for 1-2 hours at RT with a blocking solution consisting of 5g

skim milk, 2g glycine, and 100ml lX PBS-T. The membrane was then probed with the

appropriate concentration of primary antibody O/N at 4oC. The membrane was then rinsed 3x for

5min each with lX PBS. The appropriate horseradish peroxidase conjugated secondary antibody

was applied in lX PBS for 30min to 1 hr shaking at RT. The membrane was then rinsed again

3X with lX PB S for 5 min each.









4.5.2.6 Developing of western membrane with ECL Plus

Excess liquid was removed from the membrane and it was placed within a plastic bag. 25ul

of Solution A mixed with 1ml of Solution B ECL Plus reagents (GE Healthcare, Piscataway, NJ)

was incubated on the membrane for 5min. Excess ECL Plus reagent was removed. Film was

exposed to the membrane for 5s to 10min depending on the brightness of the banding pattern.

The membrane was then stripped if further probing was necessary.

4.5.2.7 Membrane stripping for reprobing

20ml of 5X stripping solution was diluted to lX with 80ml water (100ml total). Then

714Cl P-Mercaptoethanol was added and membrane placed within the solution. The membranes

were incubated in closed Tupperware container at 56oC for no longer than 30min with

intermittent shaking. The membrane was then washed for 5-8 times of 5min each with lX PBS-T

until all residual B-Mercaptoethanol was removed. Membranes were then reblocked with milk

and reprobed as normal.

4.5.2.9 Antibodies Utilized in Western blotting

MW
Protein Animal Conc.(~a Company Cat #
Wnt 1 Goat 1:1000 40-42 Santa Cruz sc-6280
B-catenin Mouse 1:2000 92 BD Biosciences 610153
Phospho-P-catenin Mouse 1:1000 92 Cell Signaling 9561
B-Actin Mouse 1:5000 42 Abcam 3280

Table 4-3. Antibodies utilized for western blot analysis.

4.6 RNA analysis

4.6.1 RNA Isolation

4.6.1.1 Homogenization

Tissues: Tissue samples were homogenized in 1ml of RNABee Reagent (Tel-Test, Inc.,

Friendswood, TX) per 50-100 mg of tissue using a sonic homogenizer.









Cells Grown in Monolayer: Cells were lysed directly in a culture dish by adding Iml of

RNABee Reagent to a 3.5 cm diameter dish, and passing the cell lysate several times through a

pipette. The amount of RNABee Reagent added is based on the area of the culture dish (1ml per

10 cm2) and not on the number of cells present. An insufficient amount of RNABee Reagent

may result in contamination of the isolated RNA with DNA.

Cells Grown in Suspension: Cells were trypsinized and the trypsin inactivated with

media supplemented with FBS. The cells were then pelleted by centrifugation at 500rpm for

5min. The cells were then lysed in RNABee Reagent by repetitive pipetting. Iml of the RNABee

reagent was used per 5-10 x 106 of animal cells.

4.6.1.2 Phenol-chloroform phase separation

The homogenized samples were incubated for 5min at RT to permit the complete

dissociation of nucleoprotein complexes. Then 0.2ml of chloroform per 1ml of RNABee Reagent

was added and the tubes vortexed for 30s. The samples were then centrifuged at 12,000 x g for

15min at 40C. Following centrifugation, the mixture separated into a lower blue, phenol-

chloroform phase, an interphase, and a colorless upper aqueous phase. RNA remained

exclusively in the aqueous phase. The volume of the aqueous phase was about 60% of the

volume of RNABee Reagent used for homogenization.

4.6.1.3 Precipitation and redissolving of RNA

RNA Precipitation: The aqueous phase was transferred to a fresh tube, and the RNA

precipitated from the aqueous phase by mixing with 600pl isopropyl alcohol per 1ml of RNABee

Reagent used for the initial homogenization. The samples were then incubated at RT 10min and

centrifuged at 12,000 x g for 10min at 40C. The RNA precipitate, often invisible before

centrifugation, formed a gel-like pellet on the side and bottom of the tube.









RNA Wash: The supernatant was removed and the pellet washed in 1ml of 75% ethanol.

The sample was then vortexed and centrifuged at 7,500 x g for 5min at 4oC.

Redissolving the RNA: The RNA pellet was air-dried for 5-10minutes, but the pellet was

not allowed to dry completely, as this would greatly decrease its solubility. The RNA was

dissolved in RNase-free water and stored at -800C.

4.6.1.4 Quantification of RNA by spectrophotometry

In order to accurately determine the concentration of RNA in each sample, 1 Cll of RNA

sample was diluted in 99 Cll of DEPC-treated H20. This solution's absorbance was then analyzed

at OD of 260nM and 280nM in a spectrophotometer. The purity was determined based on an OD

260/280 of > 1.8. The concentration of RNA was determined using the following formula:

RNA (ng/Cl) = OD260 x 40 ng/Cl1 x dilution factor of 100

4.6.2 RT-PCR

4.6.2.1 First-strand cDNA synthesis from total RNA

First strand cDNA was synthesized utilizing SuperScript First-Strand Synthesis System

(Invitrogen) as per manufacturer' s instructions. Note: For samples collected from the various

time points of the oval cell induction model, 10Cpg of RNA from three individual animals was

pooled. 5.0Cpg of this pooled RNA was then used for cDNA production. 5.0Cpg of each individual

animal that underwent shRNA inj sections was utilized for cDNA production.

4.6.2.2 PCR amplification of target cDNA

1. 2Cl 10X PCR buffer
2. 0.25pl 10mM dNTP Mix
3. 0.5Cl~ 10LM Forward Primer
4. 0.5Cl~ 10LM Reverse Primer
5. 1 C1 cDNA
6. 15.55pl Milli-Q H20
7. 0.2pl Taq Polymerase (5 U/Cl1)










All previously listed components of PCR reaction were combined on ice with Taq

Polymerase added immediately before samples were placed in a thermocycler. The PCR reaction

was run as follows with the annealing temperature adjusted to the individual primer sets:

1. 940C for 10min
2. 31 cycles of
a. 940C for 30sec
b. Annealing temp for 30 sec
c. 720C for 30sec
3. 720C for 10min
4. 40 indefinitely

4.6.2.3 Primers utilized for DNA/cDNA amplification

Primer ,Annealing cDNA DNA size
Primrsqec (5 3'
name Prmrscune('3)temp (oc) size (bp) (bp)
F= TTC TGC TAC GTT GCT ACT GGC ACT
Wnt 1 51 626 3214
R= CAT TTG CAC TCT TGG CGC ATC TCA
F= GCC GAC TTC GGG GTG CTG GT
Wnt3 56 317 1005
R=CTT AAA GAG TGC ATA CTT GG
F= TCC TAT GAG AGC GCA CGC AT
WntS a 58 224 4028
R= CAG CTT GCC CCG GCT GTT GA
F= AGG CTG TAC TCA TCA TTA AAC T
AFP 58 485 4139
R= ATA TTG TCC TGG CAT TTC G
F= GCC AGT GGA TTC CGT ACT GT
p-catenin 58 202 202
R= GAG CTT GCT TTC CTG ATT GC
F= TGA GGG AGA TGC TCA GTG TT
GapDH 58 577 577
R= ATC ACT GCC ACT CAG AAG AC

Table 4-4. Primers utilized for PCR, and rtPCR.

4.6.2.4 Agarose gel electrophoresis

A 30ml mini gel containing 0.7% (w/v) agarose in 0.5X TBE and was heated to dissolve

the agarose, and then 0.001% (v/v) ethidium bromide was added. The gel was then allowed to

cool in a gel pouring apparatus and a comb with appropriately sized wells was inserted. After

hardening, the comb was removed and the gel submerged in 0.5 X TBE in a gel electrophoresis

chamber. 0.5Cl~ of 10X Agarose gel loading buffer and 3.5Cl1 of Mill-Q H20 was added to 1CL1 of

each sample and each sample was loaded into the wells along with an appropriate molecular










weight ladder (1 Kb, 100 bp, etc.). The gel was then run at 90-110 volts for approximately 1 hr

or until desired separation of bands was visible on a UV light box. Pictures of agarose gels were

obtained with a GelDoc XR (Bio-Rad, Hercules, CA).

4.6.3 Real-Time PCR analysis of Wnt1 levels

To accurately assess the variations of Wnt1 levels during various time points of the rat oval

cell induction model, levels of Wnt1 message were analyzed quantitatively by Real Time PCR.

Wnt1 levels were also quantitatively analyzed in all animals that received shRNA inj sections.

4.6.3.1 Real-Time PCR of Wnt1

For the analysis of Wnt1 message levels, 2Cl~ of cDNA and 1.25Cl each of forward and

reverse Wnt1 primer were added to 25Cl of Power SYBR Green PCR Master Mix (Applied

Biosystems, Foster City, CA). The final reaction volume was 50Cl1. The reaction was performed

on an ABI Prism 7700 Sequence Detection System. The thermocycle sequence consisted of

10min at 95oC and then 40 cycles of 95oC for 30 sec, 51oC for 30 sec, and 60oC for 30 sec.

4.6.3.2 Real-Time PCR of 18S rRNA

As an internal control for quantification purposes QuantumRNA 18S Internal Standards

(Ambion, Austin, TX) were used to amplify 18S message. Samples were prepared as with Wnt1

quantification. The ratio of 18S primer: competimer was 3:7 as per manufacturers instructions.

4.6.3.3 Statistical analysis of Real-Time PCR and densitometry

A statistical analysis was performed as a student T-Test to determine the probability that

the data occurred merely by chance.

4.7 Solutions

*10X Agarose Gel Loading Buffer
1. 15.0mg bromophenol blue
2. 15.0mg xylene cyanol
3. 8.0g sucrose
4. Milli-Q H20 qs to 10ml










* 10X CaCl2
1. 6.36g CaCl2
2. Milli-Q H20 qs to 1L

* 10X PBS
1. 80.0g NaCl
2. 2.0g KCl
3. 11.5g Na2HPO4 x 7H20
4. 2.0g KH2PO4
5. Milli-Q H20 qs to 1L

* RIPA Buffer and Protease Inhibitor Solution
RIPA Buffer
1. 1.5ml IM NaCl
2. 0.5ml IM Tris-Cl pH 8.0
3. 1.0ml 10% NP-40
4. 1.0ml 10% NaDeoxycholate
5. 5.4ml Milli-Q H20

Protease Inhibitor Solution (added to RIPA just prior to use)
1. 100C1l 10mg/ml PMSI in isopropanol
2. 300Cl Apoprotonin
3. 100C1l 100mM NaOrthovanadate
Total = 10.0ml

* 10X S and M Solution
1. 500mg KCl
2. 8.0g NaCl
3. 2.4g HEPES
4. 190 mg NaOH
5. pH to 7.4
6. Milli-Q H20 qs to 1L and filter

*5X TBE
1. 54.0g Tris base.
2. 22.5g Boric acid
3. 4.7g EDTA
4. Milli-Q H20 qs to 1L

* 10X TBS
1. 80.0g NaCl
2. 2.0g KCl
3. 30.0g Tris base
4. 800ml H20
5. Milli-Q H20 qs to 1L
Adjust pH to 7.4 using IM HCI










*5X Western Loading Buffer
1. 1.5ml 0.5M Tris-HCI
2. 1.0g 10% SDS
3. 2.5ml P-mercaptoethanol
4. 1.5mg Bromophenol Blue
5. Milli-Q H20 qs to 10ml

* 10X Western Running Buffer
1. 144.0g Glycine
2. 30.0g Tris-Base
3. 10.0g SDS
4. Milli-Q H20 qs to 1L

* 5X Western Stripping Solution
1. 37.83g Tris-Base
2. 1g SDS
3. pH to 6.8
4. Milli-Q H20 qs to 1L

* 10X Western Transfer Buffer
1. 115.0g Glycine
2. 24.0g Tris-Base
3. Milli-Q H20 qs to 800ml

When diluted to lX, 80ml of 10X Transfer Buffer was added to 720ml Milli-Q H20 and

200ml Methanol.










CHAPTER 5
RESULTS

5.1 Evaluation of the Wnt Family During Oval Cell Induction

During oval cell activation, members of the Wnt family were up regulated. Specifically, by

IHC analysis Wnt3, Wntl, Fzd 7 and Fzd 5 demonstrated increased expression in pericentral

hepatocytes (Figure 5-1). Interestingly, Wnt~a and FRP 1, known negative regulators of the

canonical Wnt pathway, were only expressed in low levels late in the oval cell induction

protocol. The most prevalently expressed Wnt during 2AAF/PHx appeared to be the first Wnt

discovered, Wntl. Further analysis of Wnt one expression during oval cell induction revealed an

association of Wnt1 expression and liver "stem" cell based regeneration.











Figure~~~~ 5-.2A/u asps ~ essWtFaiy eilscin f2A/~ a
tise .H n ;A nsr.IGIotp eaieoto.B Frzze Reate
Prtin1 R5;D rizle 5; E. Frzld7 .Wn~;G nl F n3 ..
Centralvein; .T.= Prta ra;Arw niaeoa cl ihiflrt urudn
the portal riad and raiat~inEg toward'' the cenra ven n aiymebr nhi
receptors reside ithin pbericentra hepatocte bu not ova cels Manfcain 10X.



Prevousl Mona`~. et ,' al. f demonstrated up reuato of Wn ihi or o r.61A h

timeI of P' uigte2A/Pxpooo eete ieslbssowlwlvl fWt










expression (Figure 5-2). Levels of Wnt1 increase during peak oval cell production within the

cytoplasm of pericentral and inter zonal hepatocytes. Also hepatocytes surrounded by streaming

oval cells migrating toward the central vein activate high levels of Wnt1 expression as visualized

by IHC.


Figure 5-2. Staining of Wnt1 during 2AAF/PHx. A. Day 0; B. Day 3. C. Day 9; D. Day 13. Wnt1
is produced by hepatocytes within hours of PHx as seen in liver obtained at the time
of PHx. Pericentral hepatocytes production of Wnt1 can be seen as early as Day 3,
and levels increase through out oval cell induction. Hepatocytes engulfed by the
migrating oval cells express high levels ofWnt 1 (black arrow). Magnification 20X.

Although Wnt1 expression is not visible within oval cells, they do respond to the Wnt

signaling cascade by translocating p-catenin to their nucleus. Dual immunofluorescence for









Wnt1 (red) and p-catenin (blue) of days 9, 13, 15, and 21 days post PHx of the oval cell

induction protocol confirms the strict localization ofWnt1 to hepatocytes (Figure 5-3.). p-catenin

expression is not confined to adherens junctions within the oval cells. Cytoplasmic and nuclear

localization of p-catenin indicates active canonical Wnt signaling pathway.


Figure 5-3. Dual Staining of Wnt1 and p-catenin in 2AAF/PHx. A. Day 9; B. Day 13; C. Day 15;
D. Day 21; E. and F. Day 13; Pericentral hepatocytes express Wnt1 within their
cytoplasm, and oval cells translocate p-catenin to the nucleus in response to Wnt
signaling (white arrows). Magnification A.-D. 63X, E. 126X.

Western blot analysis of protein pooled from three individual animals collected from

various time points of the oval cell induction protocol further confirmed the Wnt1 expression

profile visualized by IHC (Figure 5-4). Both Wnt1 and p-catenin protein levels rapidly increase

during the initial stages of oval cell induction and past the peak of oval cell proliferation. This









indicates a role of Wnt1 in not only the activation but more probably in directing the

differentiation of oval cells.


A. s.o *=poo
7. = p<0.005

6.0 **00


S5.0 **-f

S4.0



2.0

I p-catenin 1.0
I Wnt1
0.0
NRL Day 3 Day 5 Day 7 Day 9 Day 11 Day 13


Il, -~I~II


B. Wnt1

j$-Catenin

p -Actin


Figure 5-4. Change in p-catenin and Wnt1 protein levels during 2AAF/PHx oval cell induction.
A. Densitometric analysis of p-catenin and Wnt1 Western Blots. All data was
normalized to p-actin levels and compared to NRL. B. Western blots of various time
points after 2AAF implantation and PHx. Both p-catenin and Wnt1 levels increase
dramatically after 7 days post PHx.

Fractionation of liver perfusate by Nycodenz gradient centrifugation results in four

separate cellular fractions (Fl-F4). Fraction 1 mostly includes immunologic cells and stellate

cells; Fractions 2 contains oval cells; Fraction 3 holds immature hepatocytes and resident liver

macrophages known as Kupffer cells; and Fraction 4 contains mature and multinucleated

hepatocytes.











A 11. "
~C= p<0.05
~CC= p<0.005




5 .




0.




NRL~ Fl NRL F2 NRL~ F3 NRL F4 Day 9Fl Day 9F2 Day 9F3 Day 9F4

B
Wnt1

P-Cateninl ..
Phosphorylated
p-Catenin
p -Actin


Figure 5-5. p-catenin levels of liver cell fractions. Cells isolated from liver by Nycodenze density
based gradient were analyzed by western blot for Wntl, p-catenin, and
phosphorylated p-catenin. A. Densitometric analysis of p-catenin Western Blot. All
data was normalized to p-actin levels and compared to NRL F l. B. Western blot of
cells isolated by perfusion from normal liver or 9 days post PHx in oval cell induction
model. NRL cells fail to express Wntl, however after oval cell induction, cells within
fractions 2 through 4 express Wntl. p-catenin is considerably increased in cells
isolated from Day 9 liver (p<0.05 and p <0.005). Whereas phosphorylated p-catenin
levels are the same in the hepatocyte fraction, increase in the small hepatocyte
fraction, and are almost absent from fraction 2 (oval cells) during oval cell induction.

Western blot analysis of protein from these four fractions further confirmed the up

regulation of Wnt1 and p-catenin levels in cells from 2AAF day 9 post PHx as compared to NRL

(Figure 5-5). More specifically, phosphorylation of p-catenin, an indicator of p-catenin

degredation and a lack of Wnt signaling is localized to the hepatocyte fractions. Low levels of

phosphorylation is found in the oval cell fraction, but the dramatic 9.08 fold increase in p-catenin










levels in F2 of 2AAF/PHx when compared to the NRL F2 signifies a maj or decrease in the

ubiquitination and destruction of p-catenin in oval cells due to Wnt signaling.

Analysis of the RNA expression of Wnt family members by rt-PCR verified the results

seen with IHC and western blot (Figure 5-6). Wnt1 and Wnt3 levels increase over 2AAF/PHx,

whereas, low levels of Wnt~a only appears late in oval cell induction. AFP levels indicate the

amount of oval cells present within the liver and the expression of AFP peaks at 9 days after

PHx. Interestingly, p-catenin message levels remain fairly constant across 2AAF/PHx. This, in

conjunction with the drastic protein level increase and the significant lack of phosphorylation in

the oval cell fraction, indicates that the increase in p-catenin protein levels is strictly due to a lack

of degradation induced by Wnt signaling.

Ladder NRL Day 3 Day 5 Day 7 Day 9 Day 11 Day 13

ji-Catenin

Wnt1

Wnt3

Wnt~a

AFP

GapDH

Figure 5-6. Reverse transcription PCR of liver from 2AAF/PHx oval cell induction model. RNA
from NRL and 3, 5, 7, 9, 11, and 13 days after PHx in the 2AAF/PHX model. As seen
during IHC, levels of Wntl, Wnt3 and AFP increase during oval cell induction.
Wnt~a is not produced until very late in the process, however, p-catenin message
levels remain fairly constant.

Real Time PCR of Wnt1 mRNA levels throughout 2AAF/PHx quantitatively demonstrated

a statistically relevant increase in Wnt1 message levels prior to and during the peak in oval cell

production (Figure 5-7). The Wnt1 mRNA data correlated with the Wnt1 Protein analysis










indicates a strong relationship between Wnt1 and the oval cell induction protocol. The peak in

mRNA matches the peak in oval cell proliferation, and the fact that the highest expression of

Wnt1 protein occurs after oval cell numbers peak would suggest that Wnt1 more specifically has

a role in the oval cell differentiation process.

G.0
= p<0.05
aas = D<0.005
3.0


S4.0


3.0 m wnt1


S2.0


1.0


0.0
NRL 3 7 9 11 13 15 21
Days after PHx

Figure 5-7. Real Time PCR analysis of Wnt1 expression during oval cell induction. Wnt1 mRNA
expression increases prior to the peak in oval cell production. The liver contains the
greatest Wnt1 message at the height of oval cell production. Significant message
levels differences occurs during oval cell induction as compared to NRL.

All data previously collected revealed a correlation between Wnt1 levels and oval cell

activation. Although phosphorylation status of p-catenin and imaging of p-catenin nuclear

translocation confirm the theory that oval cells respond to Wnt1 signaling, none of this data

actually demonstrates a direct oval cell response to Wnt signaling. However, the nuclear

translocation of p-catenin by WB-F344 cells, a known hepatic stem cell line, treated with

palmitolated Wnt3A definitively links active Wnt signaling and hepatic stem cells (Figure5-8).

Untreated WB-F344 cells retain p-catenin within their adherens junctional complexes.







































Figure 5-8. Response of WB-F344 cells to Wnt3a stimulation. A. and B.) The p-catenin staining
of unstimulated WB cells remains localized to the membrane within adherens
junctions. C. and D.) In cells exposed to Wnt3A, p-catenin accumulates in the
cytoplasm as well as translocating to the nucleus. Magnification: A. and C. 40X; B.
and D. 100X.

5.2 Inz vivo Inhibition of Wnt1 During Oval Cell Induction

To determine the effectiveness of the designed Wnt1 shRNA vector, PC12 cells previously

reported to constitutively express murine Wnt1 were transfected with the shRNA in complex

with Lipofectamine 2000. Although PC12/Wnt1 cells were highly resistant to the transfection

(only approximately 60% transfection efficiency) after 48 hours cells exposed to the shRNA

exhibited a 41.8% decrease in cytoplasmic Wnt1 expression (Figure 5-9).










B. SCR shRNA Wnt shRNA

Wnt 1

ji-Actin










Figure 5-9. Knockdown of Wnt1 in PC12/Wnt1 cells. A. GFP expression in cells 48 hrs after
transfection with a Wnt1 shRNA vector containing GFP. B. Western blot of Wnt1
levels in cells treated with Wnt1 shRNA or SCR shRNA. Approximately 60% of
PC12/Wnt1 cells expressed GFP 48hrs after transfection. Densitometric analysis
showed Wnt1 levels were decreased 41.8% in cells treated with Wnt1 shRNA as
compared to SCR shRNA(p<.005). Magnification 20X.


Figure 5-10. GFP expression in shRNA treated animals. A. Heart; B. Intestine; C. Lung; D.
Spleen; E. and F. Liver; G. and H. Pancreas; I. Brain, Cortex; J. Brain, Midbrain; K.
Kidney; L. Liver from a Control GFP' Mouse. GFP positive cells can be visualized in
all tissues sampled, and expression was not limited to vasculature. Magnification
40X.

































Je


Je


Analysis of GFP expression through IHC allowed for determination of efficient shRNA

vector delivery to target tissues (Figure 5-10). Although expression levels were not uniform

across all tissues, GFP expression was found in all tissues analyzed, and expression was not

limited to vascular endothelium. Intestinal and bronchial epithelia were distinctly positive.

Within the pancreas, islet cells as well as ductular epithelium demonstrated GFP positivity.

Interestingly, the brain also expressed high levels of GFP within the cortex and midbrain,

demonstrating the cationic lipid delivery mechanism was sufficient to cross the blood-brain

barrier. GFP levels were low in spleen and kidney but still visible within the renal tubular

epithelium and splenic white pulp.


-- SCR
--Wnt1


7 9 11 13 15 17 19 21
Days post PHx = D
Figure 5-1 1. Percent liver weights of animals treated with shRNA. The livers of animals treated
with shRNA to Wnt1 initially were no larger than those treated with SCR shRNA.
However, as time progressed their livers actually surpassed the size of their
scrambled counterparts.

Animals and their livers at the time of sacrifice after exposure to shRNA were weighed and

the percent of liver weight calculated as liver weight/body weight x 100 (Figure 5-11).

Interestingly, Wnt1 shRNA treated animals initially demonstrated no significant difference in









their percent liver weights, however, after what would normally be the peak in oval cell

proliferation, Wnt1 shRNA treated animal percent liverweights were on average 0.8% higher

than those treated with SCR shRNA (p <0.05). After histological examination, it was possible to

conclude this change in percent liver weight was due to both atypical ductular hyperplasia and

hepatocyte compensation for the failure of oval cells to function in the regeneration of the liver.


Figure 5-12. H and E of livers from shRNA treated animals. Histologically livers in Wnt shRNA
treated animals are similar to nontreated or SCR treated individuals 9 days after PHx.
Oval cell infiltrate mimicked the standard reaction. However, as early as 13 to 15
days after PHx atypical ductular hyperplasia appears in Wnt shRNA treated animals.
Ultimately, 21 days after PHx, Wnt shRNA treated animals exhibited large sites of
atypical ductular hyperplasia (Black arrow) and persistent oval cell streaming from
portal triads to other portal triads. (White arrows). SCR shRNA treated animals were
unremarkable. Magnification 20X.










Histological analysis of Wnt1 shRNA treated animals revealed morphological changes in

oval cell based liver regeneration after Wnt1 shRNA treatment (Figure 5-12). Oval cell

morphology appeared unremarkable 9 days after PHx. However, atypical ductular hyperplasia

was present in one animal as early as 13 days after PHx. The remaining Wnt1 shRNA treated

animals exhibited atypical ductular hyperplasia within 15 days of PHx. As of 21 days after PHx,

the atypical ductular hyperplasia appears throughout the liver and oval cells persist in streams

extending from portal triads toward other portal triads.


Wntlsi D9 2AAF/PHx D9 Wntlsi D21 SCRsi D21






; ~~"~i~', i~trl~~. p~ ~ a~prc~e~~~.:~W T~t~B~.-









inlmatr epos s enb rinfeun D5stiig hN tetetde



Figre5animV6als still psesustaintn f ial numersh of oval sclls iflratin the liver, w hich i
nt seaed n in camle. or anontreated animals. Manifiatio 20X. ferPx;B ad

Cofiermto that the initrtn g C cells wereae ain atoal cellas andnte inlamaor cellsOV
wasacievdy tainning serial froze sectnions ftorg OV6 2and ~ CD45 ( igdure 5-3) Ovlcell

nubes n Wt1 shRNmAtia treated animls mapproximawete d thse in SCR shRNA treatedan






nontreated animals 9 days post PHx. Conversely, 21 days post PHx oval cells are virtually









nonexistent in SCR shRNA treated and untreated animals. The cells that compose the atypical

ductular hyperplasia as well as the persistent streaming cells exhibit OV6 staining indicating they

are of oval cell origin. Minimal CD45 staining in both nontreated and treated animals signify the

cells infiltrating the livers are not of an inflammatory origin.


















Figure 5-14. Ki67 comparison of 2AAF/Phx versus Wnt1 shRNA treated animals. A. 2AAF/PHx
Day 9; B. 2AAF/PHx Day 15; C. 2AAF/PHx Day 21; D. Intestine (Positive control);
E. Wnt shRNA Day 9; F. Wnt shRNA Day 15; G. Wnt shRNA Day 21; H. Wnt
shRNA Day 21. Proliferation of oval cells 9 days after PHx in shRNA treated animals
mimics that observed in 2AAF/PHx alone. In 2AAF/PHx alone, by day 15
proliferation has subsided as oval cells begin differentiating. On the contrary, oval
cells in shRNA treated animals continue to proliferate 15 days after PHx. Also,
hepatocytes that have begun to recover from the influence of 2AAF exhibit a very
high proliferative rate 21 days after PHx. Under normal conditions the liver has
completely recovered and division is unnecessary 21 days after PHx. It can also be
observed that the sites of atypical ductular hyperplasia are also rapidly dividing 21
days after PHx. Magnification 20X.

The proliferative index of shRNA treated animals was assessed by Ki67 staining (Figure 5-

14). Oval cells in Wnt1 shRNA, SCR shRNA treated and standard 2AAF/PHx animals at the day

9 time point were unremarkably similar. However, the oval cells in Wnt shRNA treated animals

were still proliferating at an increased rate 15 days post PHx. Interestingly after 21 days the

effects of 2AAF upon hepatocytes was diminishing and a significant portion of hepatocytes

began dividing in Wnt1 shRNA treated animals. This division along with the ductular









hyperplasia could account for the increased percent liver weights of Wnt1 shRNA treated

animals. Also large portions of the hyperplastic foci found in Wnt1 shRNA treated animals 21

days post PHx were also undergoing proliferation as determined by Ki67 staining.

2AAF/PHx D9 Wntlsi D9 Wntlsi D13 Wntlsi D21



AFP






Wnt1




Figure 5-15. AFP and Wnt1 staining of serial sections from Wnt1 shRNA treated animals. A. and
E. 2AAF/PHx animal 9 days after PHx after PHx; B. and F. Wnt1 shRNA treated
animal 9 days after PHx; C. and G. Wnt1 shRNA treated animal 13 days after PHx.
D. and H. Wnt1 shRNA treated animal 21 days after PHx. A.-D. AFP Staining. E.-H.
Wnt1 staining. Oval cells from 2AAF/PHx express AFP in high levels, and
pericentral hepatocytes express Wntl. In vivo treatment of animals with shRNA to
Wnt1 on days 3 and 6 post PHx, inhibits Wnt1 expression until at least day 13 post
PHx. After 21 days post PHx, Wnt1 expression returns to inter-zonal and pericentral
hepatocytes. The oval cells that infiltrate the liver in shRNA treated animals initially
express AFP. After 11 days post PHx, AFP levels decline to negligible 21 days post
PHx. Magnification 20X.

As oval cells mature they gain the fetal protein marker known as AFP prior to their

differentiation into basophilic, small hepatocytes. Therefore, AFP has been utilized as an oval

cell marker. AFP staining of shRNA treated animals further confirmed the previous OV6

staining of the oval cells (Figure 5-15). Nevertheless, although the atypical ductular proliferation

maintained OV6 staining, cellular levels of AFP lost intensity beginning 13 days after PHx and

were completely lost by 21 days post PHx. Loss of AFP indicates a failure to differentiate toward

a hepatic lineage.










Wnt1 levels were also assessed by IHC (Figure 5-15). Although in the standard oval cell

induction protocol Wnt1 protein levels are high 9 days post PHx, they were nonexistent by IHC

in Wnt1 shRNA treated animals until day 13. Intense expression of Wnt1 appeared in virtually

all hepatocytes at this time. On day 21 hepatocytes of Wnt1 shRNA treated animals were still

expressing Wntl, whereas in the SCR shRNA treated or nontreated animals this expression had

subsided at this point.





5.0-


4.0


c~ 0 SCR shRNA
o~ 2AAF/PHx
3. 5 WntlshRNA

2d.0



1.0-



NRL 7 9 11 13 15 21 ^=p<0.05
Days Post PHx ** p-f oo

Figure 5-16. Real Time PCR analysis of Wnt1 expression of shRNA treated animals. Wnt1
shRNA treated animals exhibited virtually no Wnt1 message until 13 days after PHx.

Real Time PCR analysis of Wnt1 levels confirmed IHC analysis of Wnt1 levels in shRNA

treated animals (Figure 5-16). Animals treated with the scrambled vector demonstrated no

appreciable variation in Wnt1 message as compared to 2AAF/PHx control. Wnt1 shRNA treated

animals, however, displayed a delayed expression of Wntl. Wnt1 message was virtually absent









from the animals one day after the last inj section with a rapid incline in expression levels 11 days

after PHx.























Figure 5-17. Atypical ductular hyperplasia within Wnt shRNA treated animals. A. H and E 9
Days post PHx; B. H and E 13 days post PHx; C. and F. H and E 21 Days post PHx;
D. PAS staining of Wnt shRNA treated animal 21 days after PHx; E. PAS staining of
day 9 2AAF/PHx. Treatment with shRNA to Wnt1 in the 2AAF/PHx model induces
oval cells to undergo differentiation toward a ductular lineage. Ducts remain retain a
fairly normal cuboidal morphology until 15-21 days post PHx. At this point, atypical
ductular hyperplasia ensues. As seen in D. some ducts undergo transformation into
columnar (black arrow) and even squamous (White arrow) phenotypes. The atypical
ducts are mucin positive (*), whereas, ducts found in the standard 2AAF/PHx
protocol are mucin negative (8). This indicates the atypical ducts are no longer of a
biliary lineage. Magnification A., D., E, and F. 40X; B. and C. 20X.

Further examination of the morphology of the atypical ductular hyperplasia present in

Wnt1 shRNA treated animals revealed a potentially preneoplastic state (Figure 5-17). The

hyperplastic ducts began appearing 9 days after PHx which is only 3 days after the last Wnt1

shRNA injection. Initially the morphology of the ducts was identical to that of a standard bile

duct, small cuboidal cells with a basalar nucleus, but by 15 days post PHx cytology began to

change. Not only were the sites of hyperplasia present in nearly all liver lobules, but the cells in









some had undergone metaplasia. Ducts could be visualized with both columnar and squamous

metaplasia. Also these hyperplastic ducts were producing mucin which is absent in normal liver

or livers from any time during 2AAF/PHx oval cell induction.









CHAPTER 6
DISCUSSION AND FUTURE STUDIES

6.1 Summary of Results

The data presented in this study demonstrated a clear link between Wnt1 signaling and

oval cell based liver regeneration. Hepatocytes express and secrete Wnt1 in response to massive

hepatic injury (2AAF/PHx). Oval cells invade the liver and respond to Wnt1 signaling by

decreasing phosphorylation of p-catenin and translocating it to their nucleus to activate Wnt

responsive genes. The message levels of Wnt1 rise during and at the point of peak oval cell

production, but protein levels are delayed in reaching their maximum. This clearly indicates that

Wnt1 is not responsible for recruiting oval cells to the liver or inducing oval cell proliferation.

Instead Wnt1 is essential in guiding oval cells down a hepatic differentiation path.

To provide evidence that Wnt1 is required for oval cell differentiation, an shRNA designed

to Wnt1 was utilized in vivo during oval cell based liver regeneration. Inhibition of Wnt1 in vivo

did not delay oval cell migration into the liver. Nevertheless, the oval cells were unable to

function normally. Without Wnt1 signaling, oval cells were forced toward a biliary lineage and

underwent atypical ductular hyperplasia. It is as if without the Wnt1 signal, oval cells lose AFP

expression, and they defaulted to a bile duct phenotype. In compensation, as the effects of 2AAF

on hepatocytes wore off, hepatocytes began rapidly dividing to reform the functional liver that

the oval cells were unable to generate. Essentially, Wnt1 directs oval cells to differentiate into

hepatocytes and without this signal oval cells are unable to differentiate and function normally.

Instead of oval cells simply creating numerous bile ducts, there is morphologic evidence

that these cells are potentially going through a preneoplastic process. Within the foci of

proliferating ducts, epithelial metaplasia occurred. At the end of the study every animal that was

treated with shRNA toward Wnt1 had large areas of atypical ductular hyperplasia, and in about









5-10% of ducts either columnar or squamous metaplasia was present. Chromatin within the

metaplastic ducts appeared irregular, but no definitive signs of dysplasia were present. The

epithelial metaplasia in conjunction with mucin production is indicative of a preneoplastic

process, but no further claims can be made.

Although this study definitively demonstrates a role of Wnt1 in oval cell based liver

regeneration and indicates a potentially prenoeplastic state when Wnt1 is absent, it must be

repeated and time points collected later than 21 days after PHx. The presence of these atypical

ducts is encouraging in regards to indicating an oval cell origin of cholangiocarcinoma, but at

this stage no comments can be elicited as to their true purpose. These atypical ducts have two

potential paths. They could turn neoplastic or they could regress. Only a longer study could

differentiate between these two possible outcomes.

6.2 Interpretation of Results

6.2.1 Wnt Signaling is Required During Oval Cell Based Liver Regeneration

6.2.1.1 Novel findings

No previous study has shown the requirement of the Wnt family in the differentiation of

oval cells. Wnts have been implicated in this process but no definitive correlation has been

established until now. Also, the mechanism by which Wnt signals are sent and received has only

previously been postulated and not truly defined. This research clearly demonstrates a hepatic

origin of the Wnt signal and an oval cell response to this signal. When compared to the levels of

phosphorylation of p-catenin, the dramatic increase in protein levels of p-catenin without a

subsequent increase in p-catenin message can only be explained by Wnt signaling. Also when

Wnt1 signaling is absent, oval cell behave distinctly different than when in the presence of Wntl.










Although much research has been done on p-catenin null and dominant mutant mice and

the function of p-catenin in the liver, little has been done with regard to the penultimate upstream

signal. Perhaps this is because Wnt is so important and highly regulated.

Mutations in the Wnt family and their receptors are practically nonexistent in the cancer

literature. Instead only relative changes in expression levels of certain Wnts can be found. This

further implicates the integral role Wnt plays in cellular processes and tumor development.

Perhaps changes in the expression of Wnt family members induces so drastic a result the cells

are immediately culled to prevent further mishap. If mutations occurred silently in tumors, the

expression of these mutations would have some prevalence in the literature but this has not

happened.

Conversely, it could be that there are so many Wnts in the family because they are

redundant. This redundancy could compensate for any mutations that occur. However, this

research tends to negate this theory. Knockdown of a single Wnt protein has induced a drastic

phenotype, when other Wnts are known to be expressed throughout the oval cell induction

model. This indicates that the evolution of a family of 19 individual Wnts is due to the complex

and distinct pathways regulated by these Wnt proteins.

6.2.1.2 Basic science applications

In order for the true nature of oval cells to be understood, their behavior in situ has to be

monitored, but as Richard Feynman theorized, once you remove something or observe it, the

entity has changed due to observation. However, even though the oval cell changes once

observed, this is the only mechanism we have to further our understanding of their biology.

Therefore, knowing Wnt1 is required for inducing oval cell hepatic differentiation has further

defined the role of oval cells in liver regeneration.









Knowledge of the signals necessary to induce oval cells to differentiate into hepatocytes is

currently very limited. In culture, the cytokine milieu needed for inducing hepatocyte

differentiation is mixed and fairly nonspecific. Also the results are not consistent, not all

cytokine mixtures force all oval cells in culture to differentiate. This indicates that either not all

the cells are being triggered or there is a heterogeneous population being evaluated. Including

Wnt1 in this differentiation media could induce more rapid and more complete differentiation in

vitro. Also using a known inhibitor of this pathway such as Wif (Wnt inhibitory factor) one

could theoretically maintain oval cells in an undifferentiated state in culture.

Investigation of the role of AFP in oval cell differentiation is essential to understanding

this process. This research demonstrated AFP expression during the peak in oval cell

proliferation. However without Wntl, AFP expression was lost. This suggests that although

some oval cells initially express AFP in the hepatic differentiation path more signals are

necessary to complete the differentiation process. Perhaps AFP primes the pump, i.e. prepares

the oval cells to differentiate into hepatocytes, but Wnt1 actually pushes them over that

differentiation hill. If this is the case, determining what induces AFP expression may further

allow us to manipulate oval cells in culture and in vivo. Also use of Wnt in culture could possibly

be utilized to "prime" cells for transplantation.

6.2.1.3 Clinical applications

The demonstration of Wntl's requirement for oval cell differentiation has strong clinical

implications. With the severe shortage of livers to supply the ever increasing need for

transplants, clinicians are asking basic scientists to develop alternate methods of organ

replacement. Hepatocyte transplant has been performed as previously described, however, the

results vary and the number of studies that has been performed is limited. Utilizing stem cells for

the facilitation of organ and or functional replacement of tissues has shown great promise. Stem









cells have a much greater capacity for division, differentiation and subsequent repopulation of

damaged tissues. Ideally one day we will be able to isolate stem cells from the blood, manipulate

them in vitro, and implant them into the desired organ.

Oval cells have already been shown to be bone marrow derived, and therefore,

theoretically can be isolated from the blood. Oval cells have repeatedly been implanted into

livers and donor derivation of regenerated tissue demonstrated. The biggest set back has been the

limited numbers of donor derived hepatocytes appearing in the liver. Proving that one can

engraft cells into the liver was the first step. Increasing the numbers of donor derived cells is the

next step, and perhaps Wnt is the answer. Exposure of oval cells ex vivo or in vivo to Wnt1 has

the potential to increase the differentiation rate of oval cells. Essentially, you could use Wnt

exposure to increase the likelihood that the cells you implant will differentiate the way you want

them too. If exposure to Wnt1 pushes oval cells down the hepatocyte lineage, it may function

exactly the same way on the bone marrow precursor of the oval cell. If true, this would facilitate

and even simpler method of obtaining cells for transplantation into the liver.

The clinical implications of this are astounding. It is known that hepatocyte transplantation

only results in transient engraftment. Perhaps transplanting precursor cells might ensure

prolonged engraftment. If Wnt1 signaling truly initiates hepatocyte differentiation while not

inhibiting proliferation, treatment of oval cells or bone marrow precursor cells might even cause

an intrahepatic expansion of the transplanted cells along with directed hepatocyte differentiation.

Essentially, the engrafted cells are directed down a hepatic lineage and allowed to proliferate,

which would increase the numbers of engrafted cells and, therefore, enlarge the size of the graft

without having to increase the number of transplanted cells.









6.2.2 Disregulation of Wnt1 Signaling and Cancer Induction

6.2.2.1 Atypical ductular proliferation after Wnt1 shRNA exposure in vivo

It is evident that without Wnt1 signaling oval cells cannot differentiate down the hepatic

lineage. Every animal exposed to the Wnt1 shRNA had developed severe atypical ductular

hyperplasia globally throughout the liver after 21 days. These foci were even undergoing

potentially preneoplastic changes. Nuclear pleomorphisms and squamous or columnar metaplasia

was evident in numerous of these foci in various animals. These findings indicate that oval cells

must receive a distinct pattern of signals to undergo hepatocyte differentiation. Without Wnt1

signaling they "defaulted" to a biliary lineage. The dual differentiation potential of the oval cell

has been well documented, but until now no one has shown that without stimulus to become a

hepatocyte, oval cells revert to a biliary lineage. Also Wnt1 is the only signal preventing the

severe atypical ductular hyperplastic phenotype. This suggests that tight control of oval cells is

required and without tight control there are drastic consequences.

Although the study only went for 21 days after PHx, this potentially preneoplastic state

strongly aids the oval cell theory of cholangiocarcinoma. If all it takes to push oval cells down a

cancerous road is the lack of one growth factor, then it is no wonder that they have the potential

to create liver tumors of hepatocyte and/or biliary origin. Extension of the study will determine if

these foci of atypical ductular hyperplasia spontaneously resolve or if they undergo true

transformation into a tumor of a biliary origin.

Use of the Wnt1 shRNA 2AAF/PHx protocol could provide a very fast method for forming

repeatable tumors in a very rapid manner. Assuming the foci develop into true cancerous nodules

within another month of the study, this would result in a cholangiocarcinoma model executable

in only 2 months from initiation of the protocol (2AAF implantation) and tumor development (8-

9 weeks). That is definitely faster than the standard protocols utilized in the literature.









6.2.2.2 Use of Wnt1 in preneoplastic foci

Conceivably Wnt1 exposure might reverse the changes seen during Wnt1 shRNA and

2AAF/PHx protocol. If so then this could be utilized to reverse preneoplastic changes initiated

by disregulation of hepatic stem cells. Only studies that replace the Wnt1 protein levels after

shRNA could determine the efficacy of this technique, but if Wnt1 protein does "rescue" this

phenotype, it could lead to therapies in the early stages of cancer or preneoplastic changes seen

in massive, chronic hepatic damage.

Increasing the understanding of the regulation of stem cells can only aid in our

understanding of the things that can potentially go wrong during initiation and promotion of

tumors. It may be that Wnt1 is the only signal preventing oval cells from becoming cancerous

during stem cell based liver regeneration. This is possibly why oval cells are rarely seen in

human livers. The need for oval cells must be so great as to risk the potential damage they could

inflict if tight control on them is not maintained. This risk need not be taken in normal situations

as hepatocytes have the immense capacity for proliferation necessary to resolve most hepatic

injuries. Perhaps oval cells are only seen in humans when hepatocyte function is beyond repair

and the need outweighs the potential for damage induced by disregulation of the hepatic stem

cell.

6.3 Future Studies

6.3.1 Continuation of the Wnt1 shRNA 2AAF/PHx Protocol

Extending the shRNA studies will elucidate the question of whether the changes seen

within the foci of atypical ductular hyperplasia are truly preneoplastic or benign. Resolution of

these foci is possible and is seen in the DDC diet in mice. Remove the stimulus (DDC) and the

oval cell numbers decline and the sites of atypical ductular hyperplasia regress. If the foci present

21 days after PHx in the Wnt1 shRNA treated animals do not regress but maintain themselves or










progress into neoplastic lesions, then the functions of Wnt1 in oval cells must truly be

discovered. Knowledge of one growth factor having such control over normal function or

tumorgenic changes would greatly advance the fields of stem cell and tumor biology.

6.3.2 Exposure of Oval Cells to Wnt1

Isolation of oval cells and exposure of them to Wnt1 in vitro may facilitate oval cell

engraftment in oval cell transplantation. It also may induce hepatocyte differentiation in culture

faster than the current differentiation protocols. Currently Wnt1 is not available in a palmitolated

form. However, the same isolation procedure employed by Nusse et al. for Wnt3a, Wnt~a,

Wnt~b, and Wnt7a (currently all sold by R and D Systems) could be easily employed.

Furthermore, portal vein inj sections of Wnt1 protein during 2AAF/PHx protocol might increase

the rate by which oval cells regenerate the liver. Use of a retrovirus containing the Wnt1 gene

could also be utilized to expose the infiltrating oval cells to an increase in Wnt1 signaling during

2AAF/PHx.

6.3.3 Wnt1 Conditional Knockout Animal

Changes in Wnt levels during embryogenesis results in severe and drastic malformations

of numerous tissues and/or failure of the embryo to fully develop, therefore development of a

Wnt1 conditional knockout could further define the role of Wnt1 in liver regeneration.

Controlling Wnt1 with a Tet on/off system and the albumin promoter would result in a

conditional knockout that would only be active in the liver when desired, i.e. during oval cell

activation protocols. This knockout would confirm the results seen in this study and provide

alternative methods for looking at the role of Wnt1 in the liver.

6.3.4 Summary of Proposed Experiments

Each of these experiments would confirm the results found in this study while enhancing

the knowledge of Wntl's role in oval cell based liver regeneration and normal liver function.









Complete understanding of Wntl's functions during these processes is essential for the

understanding of oval cell based liver regeneration. This study has demonstrated the crucial role

Wnt1 plays in initiation of oval cell hepatocyte differentiation, as well as how disregulation of

Wnt1 creates a potentially preneoplastic state in oval cells.









LIST OF REFERENCES


1. Desmet,V.J. The liver: biology and pathobiology. Arias,I.M. & Boyer,J.L. (eds.), pp. 3-15,
Raven Press, New York (2001).

2. Crawford,J.M. Robbins and Cotran: Pathologic Basis of Disease. Kumar,V., Abbas,A. &
Fausto N. (eds.), pp. 877-938, Elsevier Saunders, Philadelphia (2005).

3. Cunningham,C.C. & Van Horn,C.G. Energy availability and alcohol-related liver
pathology. Alcohol Res. Health 27, 291-299 (2003).

4. Ross,M.H., Kaye,G.I. & Pawlina,W. Histology: a text and atlas. Lippincott Williams &
Wilkins, Philadelphia, Pa (2003).

5. Fausto N. The Liver biology and pathobiology. Arias,I.M. & Boyer,J.L. (eds.), pp. 1501-
1518, Raven Press, New York (1994).

6. Saxena,R., Theise,N.D. & Crawford,J.M. Microanatomy of the human liver-exploring the
hidden interfaces. Hepatology 30, 1339-1346 (1999).

7. Steer,C.J. Liver regeneration. FASEB J. 9, 1396-1400 (1995).

8. Higgins,G.M. & Anderson R.M. Experimental pathology of the liver: Restoration of the
liver of the white rat following partial surgical removal. Arch Pathol l2, 186-202 (1931i).

9. Bucher NLR. Regeneration of Mammalian Liver. Int Rev Cytol 15, 245 (1963).

10. Michalopoulos,G.K. Liver regeneration: molecular mechanisms of growth control. FASEB
J. 4, 176-187 (1990).

11. Rabes,H.M. Kinetics of hepatocellular proliferation after partial resection of the liver.
Prog. Liver Dis. 5, 83-99 (1976).

12. Petersen,B.E. Hepatic stem cells and growth factor regulation in liver regeneration
following toxic injury. 1996. Graduate School of Public Health, Dept. of Environmental
and Occupational Health and Toxicology, University of Pittsburgh.
Ref Type: Thesis/Dissertation

13. MichalopoulosG.K. & DeFrances,M.C. Liver regeneration. Science 276, 60-66 (1997).

14. Badr,M.Z., Belinsky, S.A., Kauffman,F.C. & Thurman,R.G. Mechanism of hepatotoxicity
to periportal regions of the liver lobule due to allyl alcohol: role of oxygen and lipid
peroxidation. J. Pharmacol. Exp. Ther. 238, 1138-1142 (1986).

15. Edwards,M.J., Keller,B.J., Kauffman,F.C. & Thurman,R.G. The involvement of Kupffer
cells in carbon tetrachloride toxicity. Toxicol. Appl. Pharmacol. 119, 275-279 (1993).

16. Lombardi,B. & Ugazio,G. Serum lipoproteins in rats with carbon tetrachloride-induced
fatty liver. J. LipidRes. 6, 498-505 (1965).










17. Reid,W.D. Mechanism of allyl alcohol-induced hepatic necrosis. Experientia 28, 1058-
1061 (1972).

18. Fisher,R.A. & Strom,S.C. Human hepatocyte transplantation: worldwide results.
Transplantation 82, 441-449 (2006).

19. Matas,A.J. et al. Hepatocellular transplantation for metabolic deficiencies: decrease of
plasms bilirubin in Gunn rats. Science 192, 892-894 (1976).

20. Mito,M., Kusano,M. & Kawaura,Y. Hepatocyte transplantation in man. Transplan2t. Proc.
24, 3052-3053 (1992).

21. Raper,S.E. et al. Safety and feasibility of liver-directed ex vivo gene therapy for
homozygous familial hypercholesterolemia. Ann. Surg. 223, 116-126 (1996).

22. Ambrosino,G. et al. Isolated hepatocyte transplantation for Crigler-Najj ar syndrome type 1.
Cell Transplan2t. 14, 151-157 (2005).

23. Fox,I.J. et al. Treatment of the Crigler-Najj ar syndrome type I with hepatocyte
transplantation. N. Engl. J. M~ed. 338, 1422-1426 (1998).

24. Horslen,S.P. & Fox,I.J. Hepatocyte transplantation. Transplantation 77, 1481-1486 (2004).

25. Hughes,R.D., Mitry,R.R. & Dhawan,A. Hepatocyte transplantation for metabolic liver
disease: UK experience. J. R. Soc. M~ed. 98, 341-345 (2005).

26. Soriano,H.E. et al. Lack of C/EBP alpha gene expression results in increased DNA
synthesis and an increased frequency of immortalization of freshly isolated mice
[correction of rat] hepatocytes. Hepatology 27, 392-401 (1998).

27. Strom, S.C. et al. Hepatocyte transplantation as a bridge to orthotopic liver transplantation
in terminal liver failure. Transplantation 63 559-569 (1997).

28. Parkin,D.M., Bray,F., Ferlay,J. & Pisani,P. Global cancer statistics, 2002. CA Cancer J
Clin. 55, 74-108 (2005).

29. Di Bisceglie,A.M., Rustgi,V.K., Hoofnagle,J.H., Dusheiko,G.M. & Lotze,M.T. NIH
conference. Hepatocellular carcinoma. Ann. Intern. M~ed. 108, 390-401 (1988).

30. Goodman,Z.D. Neoplasms of the liver. M~od. Pathol. 20 Suppl 1, S49-S60 (2007).

31. Maximow A. Der Lymphozyt als gemeinsame Stammzelle der verschiedenen Blutelemente
in der embryonalen Entwicklung und im postfetalen Leben der Saugetiere. Folia Haematol.
Int. Mag. Klin. M~orphol. Blutforsch. 8, 125-141 (1909).

32. Buckner,C.D. et al. Allogeneic marrow engraftment following whole body irradiation in a
patient with leukemia. Blood 35, 741-750 (1970).









33. Osawa,M., Hanada,K., Hamada,H. & Nakauchi,H. Long-term lymphohematopoietic
reconstitution by a single CD34-low/negative hematopoietic stem cell. Science 273, 242-
245 (1996).

34. Pappenheim,A. Morphologische Hamatologie. W. Klinkhardt, Leipzig (1919).

35. Magnuson,T., Epstein,C.J., Silver,L.M. & Martin,G.R. Pluripotent embryonic stem cell
lines can be derived from tw5/tw5 blastocysts. Nature 298, 750-753 (1982).

36. Evans,M.J. & Kaufman,M.H. Establishment in culture of pluripotential cells from mouse
embryos. Nature 292, 154-156 (1981).

37. Keller,G.M. In vitro differentiation of embryonic stem cells. Curr. Opin. Cell Biol. 7, 862-
869 (1995).

38. Martin,G.R. Isolation of a pluripotent cell line from early mouse embryos cultured in
medium conditioned by teratocarcinoma stem cells. Proc. Natl. Acad. Sci. U. S. A 78,
7634-7638 (1981).

39. Smith,A.G. Embryo-derived stem cells: of mice and men. Annu. Rev. Cell Dev. Biol. 17 ,
435-462 (2001).

40. Kabrun,N. et al. Flk-1 expression defines a population of early embryonic hematopoietic
precursors. Development 124, 2039-2048 (1997).

41. Nishikawa, S.I., Nishikawa,S., Hirashima,M., Matsuyoshi,N. & Kodama,H. Progressive
lineage analysis by cell sorting and culture identifies FLKl+VE-cadherin+ cells at a
diverging point of endothelial and hemopoietic lineages. Development 125, 1747-1757
(1998).

42. Robertson, S.M., Kennedy,M., Shannon,J.M. & Keller,G. A transitional stage in the
commitment of mesoderm to hematopoiesis requiring the transcription factor SCL/tal-1.
Development 127, 2447-2459 (2000).

43. Schmitt,R.M., Bruyns,E. & Snodgrass,H.R. Hematopoietic development of embryonic stem
cells in vitro: cytokine and receptor gene expression. Genes Dev. 5, 728-740 (1991).

44. Faloon,P. et al. Basic fibroblast growth factor positively regulates hematopoietic
development. Development 127, 1931-1941 (2000).

45. Fehling,H.J. et al. Tracking mesoderm induction and its specification to the hemangioblast
during embryonic stem cell differentiation. Development 130, 4217-4227 (2003).

46. Huber,T.L., Kouskoff,V., Fehling,H.J., Palis,J. & Keller,G. Haemangioblast commitment is
initiated in the primitive streak of the mouse embryo. Nature 432, 625-630 (2004).

47. Lacaud,G. et al. Runx1 is essential for hematopoietic commitment at the hemangioblast
stage of development in vitro. Blood 100, 458-466 (2002).










48. Bautch,V.L. et al. Characterization of the vasculogenic block in the absence of vascular
endothelial growth factor-A. Blood 95, 1979-1987 (2000).

49. Kearney,J.B. et al. Vascular endothelial growth factor receptor Flt-1 negatively regulates
developmental blood vessel formation by modulating endothelial cell division. Blood 99,
2397-2407 (2002).

50. Roberts,D.M. et al. The vascular endothelial growth factor (VEGF) receptor Flt-1
(VEGFR-1) modulates Flk-1 (VEGFR-2) signaling during blood vessel formation. Am. J.
Pathol. 164, 1531-1535 (2004).

51. Zippo,A., De Robertis,A., Bardelli,M., Galvagni,F. & Oliviero,S. Identification of Flk-1
target genes in vasculogenesis: Pim-1 is required for endothelial and mural cell
differentiation in vitro. Blood 103, 4536-4544 (2004).

52. Maltsev,V.A., Rohwedel,J., Hescheler,J. & Wobus,A.M. Embryonic stem cells
differentiate in vitro into cardiomyocytes representing sinusnodal, atrial and ventricular cell
types. M~ech. Dev. 44, 41-50 (1993).

53. Hescheler,J. et al. Embryonic stem cells: a model to study structural and functional
properties in cardiomyogenesis. Cardiova~sc. Res. 36, 149-162 (1997).

54. Banach,K., Halbach,M.D., Hu,P., Hescheler,J. & Egert,U. Development of electrical
activity in cardiac myocyte aggregates derived from mouse embryonic stem cells. Am. J.
Physiol Heart Circ. Physiol 284, H2114-H2123 (2003).

55. Buttery,L.D. et al. Differentiation of osteoblasts and in vitro bone formation from murine
embryonic stem cells. Tissue Eng 7, 89-99 (2001).

56. Rohwedel,J. et al. Muscle cell differentiation of embryonic stem cells reflects myogenesis
in vivo: developmentally regulated expression of myogenic determination genes and
functional expression of ionic currents. Dev. Biol. 164, 87-101 (1994).

57. Kramer,J. et al. Embryonic stem cell-derived chondrogenic differentiation in vitro:
activation by BMP-2 and BMP-4. M~ech. Dev. 92, 193-205 (2000).

58. Dani,C. et al. Differentiation of embryonic stem cells into adipocytes in vitro. J. Cell Sci.
110 (Pt 11), 1279-1285 (1997).

59. Lumelsky,N. et al. Differentiation of embryonic stem cells to insulin-secreting structures
similar to pancreatic islets. Science 292, 1389-1394 (2001).

60. Hamazaki,T. et al. Hepatic maturation in differentiating embryonic stem cells in vitro.
FEBSLett. 497, 15-19 (2001).

61. Chinzei,R. et al. Embryoid-body cells derived from a mouse embryonic stem cell line show
differentiation into functional hepatocytes. Hepatology 36, 22-29 (2002).









62. Gault,V.A. et al. Effects of Sub chronic Treatment With the Long-Acting Glucose-
Dependent Insulinotropic Polypeptide Receptor Agonist, N-AcGIP, on Glucose
Homeostasis in Streptozotocin-Induced Diabetes. PancreasPPP~~~~PPP~~~PPP 35, 73-79 (2007).

63. Asahara,T. et al. Isolation of putative progenitor endothelial cells for angiogenesis. Science
275, 964-967 (1997).

64. Ferrari,G. et al. Muscle regeneration by bone marrow-derived myogenic progenitors.
Science 279, 1528-1530 (1998).

65. Petersen,B.E. et al. Bone marrow as a potential source of hepatic oval cells. Science 284,
1168-1170 (1999).

66. Bj ornsonC.R., Rietze,R.L., Reynolds,B.A., Magli,M.C. & Vescovi,A.L. Turning brain into
blood: a hematopoietic fate adopted by adult neural stem cells in vivo. Science 283, 534-
537 (1999).

67. Clarke,D.L. et al. Generalized potential of adult neural stem cells. Science 288, 1660-1663
(2000).

68. Alison,M.R. et al. Hepatocytes from non-hepatic adult stem cells. Nature 406, 257 (2000).

69. Theise,N.D. et al. Liver from bone marrow in humans. Hepatology 32, 11-16 (2000).

70. Theise,N.D. et al. Derivation of hepatocytes from bone marrow cells in mice after
radiation-induced myeloablation. Hepatology 31, 235-240 (2000).

71. Krause,D.S. et al. Multi-organ, multi-lineage engraftment by a single bone marrow-derived
stem cell. Cell 105, 369-377 (2001).

72. Herzog,E.L., Chai,L. & Krause,D.S. Plasticity of marrow-derived stem cells. Blood 102,
3483-3493 (2003).

73. Ianus,A., Holz,G.G., Theise,N.D. & Hussain,M.A. In vivo derivation of glucose-competent
pancreatic endocrine cells from bone marrow without evidence of cell fusion. 1. Clin.
Invest 111, 843-850 (2003).

74. Korbling,M. et al. Hepatocytes and epithelial cells of donor origin in recipients of
peripheral-blood stem cells. N. Engl. J. M~ed. 346, 738-746 (2002).

75. Jiang,Y. et al. Pluripotency of mesenchymal stem cells derived from adult marrow. Nature
418, 41-49 (2002).

76. Horwitz,E.M. Stem cell plasticity: a new image of the bone marrow stem cell. Curr. Opin.
Pediatr. 15, 32-37 (2003).

77. Petersen,B.E. Hepatic stem" cells: coming full circle. Blood Cells 2ol. Dis. 27, 590-600
(2001).










78. Petersen,B.E. & Terada,N. Stem cells: a journey into a new frontier. J. Am. Soc. Nephrol.
12, 1773-1780 (2001).

79. Boyle,A.J., Schulman,S.P., Hare,J.M. & Oettgen,P. Is stem cell therapy ready for patients?
Stem Cell Therapy for Cardiac Repair. Ready for the Next Step. Circulation 114, 339-3 52
(2006).

80. Lindvall,O. & Kokaia,Z. Stem cells for the treatment of neurological disorders. Nature 441,
1094-1096 (2006).

81. Sam,J., Angoulvant,D., Fazel,S., Weisel,R.D. & Li,R.K. Heart cell implantation after
myocardial infarction. Coron. Artery Dis. 16, 85-91 (2005).

82. Hollander,A.P. et al. Maturation of tissue engineered cartilage implanted in injured and
osteoarthritic human knees. Tissue Eng 12, 1787-1798 (2006).

83. Kuo,C.K., Li,W.J., Mauck,R.L. & Tuan,R.S. Cartilage tissue engineering: its potential and
uses. Curr. Opin. Rheumatol. 18, 64-73 (2006).

84. Cebotari,S. et al. Clinical application of tissue engineered human heart valves using
autologous progenitor cells. Circulation 114, 1132-1137 (2006).

85. Atala,A., Bauer,S.B., Soker,S., Yoo,J.J. & Retik,A.B. Tissue-engineered autologous
bladders for patients needing cystoplasty. Lancet 367, 1241-1246 (2006).

86. Lindeman,B. et al. Alteration of G1 cell-cycle protein expression and induction of p53 but
not p21/wafl by the DNA-modifying carcinogen 2-acetylaminofluorene in growth-
stimulated hepatocytes in vitro. Mol1. Carcinog. 24 36-46 (1999).

87. Petersen,B.E., Zaj ac,V.F. & Michalopoulos,G.K. Hepatic oval cell activation in response to
injury following chemically induced periportal or pericentral damage in rats. Hepatology
27, 1030-1038 (1998).

88. Petersen,B.E., Goff,J.P., Greenberger,J.S. & Michalopoulos,G.K. Hepatic oval cells
express the hematopoietic stem cell marker Thy-1 in the rat. Hepatology 27, 433-445
(1998).

89. Petersen,B.E. et al. Mouse A6-positive hepatic oval cells also express several
hematopoietic stem cell markers. Hepatology 37, 632-640 (2003).

90. Corcelle,V., Stieger,B., Gjinoyci,A., Wollheim,C.B. & Gauthier,B.R. Characterization of
two distinct liver progenitor cell subpopulations of hematopoietic and hepatic origins. Exp.
CellRes. 312, 2826-2836 (2006).

91. Guettier,C. Which stem cells for adult liver?. Ann. Pathol. 25, 33-44 (2005).

92. Qin,A.L., Zhou,X.Q., Zhang,W., Yu,H. & Xie,Q. Characterization and enrichment of
hepatic progenitor cells in adult rat liver. World J. Gastroenterol. 10, 1480-1486 (2004).









93. Strain,A.J., Crosby,H.A., Nijj ar,S., Kelly,D.A. & Hubscher, S.G. Human liver-derived stem
cells. Semin. Liver Dis. 23, 373-384 (2003).

94. Van Den Heuvel,M.C. et al. Expression of anti-OV6 antibody and anti-N-CAM antibody
along the biliary line of normal and diseased human livers. Hepatology 33, 1387-1393
(2001).

95. Kano,J., Noguchi,M., Kodama,M. & Tokiwa,T. The in vitro differentiating capacity of
nonparenchymal epithelial cells derived from adult porcine livers. Am. J. Pathol. 156,
2033-2043 (2000).

96. Roskams,T., De Vos,R. & Desmet,V. 'Undifferentiated progenitor cells' in focal nodular
hyperplasia of the liver. Histopathology 28, 291-299 (1996).

97. Yang,L., Faris,R.A. & Hixson,D.C. Characterization of a mature bile duct antigen
expressed on a subpopulation of biliary ductular cells but absent from oval cells.
Hepatology 18, 357-366 (1993).

98. Yang,L., Faris,R.A. & Hixson,D.C. Long-term culture and characteristics of normal rat
liver bile duct epithelial cells. Gastroenterology 104, 840-852 (1993).

99. Zvibel,I., Fiorino,A. S., Brill,S. & Reid,L.M. Phenotypic characterization of rat hepatoma
cell lines and lineage-specific regulation of gene expression by differentiation agents.
Differentiation 63, 215-223 (1998).

100. Engelhardt,N.V. et al. Common antigen of oval and biliary epithelial cells (A6) is a
differentiation marker of epithelial and erythroid cell lineages in early development of the
mouse. Differentiation 55, 19-26 (1993).

101. Evarts,R.P., Hu,Z., Fujio,K., Marsden,E.R. & Thorgeirsson,S.S. Activation of hepatic stem
cell compartment in the rat: role of transforming growth factor alpha, hepatocyte growth
factor, and acidic fibroblast growth factor in early proliferation. Cell G; 1,n thr Differ. 4, 555-
561 (1993).

102. Hixson,D.C. & Allison,J.P. Monoclonal antibodies recognizing oval cells induced in the
liver of rats by N-2-fluorenylacetamide or ethionine in a choline-deficient diet. Cancer Res.
45, 3750-3760 (1985).

103. Evarts,R.P., Nagy,P., Marsden,E. & Thorgeirsson,S.S. A precursor-product relationship
exists between oval cells and hepatocytes in rat liver. Carcinogenesis 8, 1737-1740 (1987).

104. Evarts,R.P., Nagy,P., Nakatsukasa,H., Marsden,E. & Thorgeirsson,S.S. In vivo
differentiation of rat liver oval cells into hepatocytes. Cancer Res. 49, 1541-1547 (1989).

105. Fausto,N. Protooncogenes and growth factors associated with normal and abnormal liver
growth. Dig. Dis. Sci. 36, 653-658 (1991).









106. Preisegger,K.H. et al. Atypical ductular proliferation and its inhibition by transforming
growth factor betal in the 3,5-diethoxycarbonyl-1,4-dihydrocollidine mouse model for
chronic alcoholic liver disease. Lab Invest 79, 103-109 (1999).

107. Golding,M., SarrafC., Lalani,E. & Alison,M.R. Reactive biliary epithelium: The product
of a pluripotential stem cell compartment? Human Pathology 27, 872-884 (1996).

108. Sigal,S.H. et al. Evidence for Stem-Cells and Lineages in Embryonic and Adult Liver, A
Tissue Assuming A Quiescent State. Journal of Cellular Biochemistry 268 (1 993).

109. Evarts,R.P. et al. Cellular and molecular changes in the early stages of chemical
hepatocarcinogenesis in the rat. Cancer Res. 50, 3439-3444 (1990).

110. Lemire,J.M. & Fausto,N. Multiple alpha-fetoprotein RNAs in adult rat liver: cell type-
specific expression and differential regulation. Cancer Res. 51, 4656-4664 (1991).

1 11. Marceau,N., Grenier,A., Noel,M., Mailhot,D. & Loranger,A. Modulation of cytokeratin
and actin gene expression and fibrillar organization in cultured rat hepatocytes. Biochem.
CellBiol. 70, 1238-1248 (1992).

112. Petersen,B.E., Zajac,V.F. & Michalopoulos,G.K. Bile ductular damage induced by
methylene dianiline inhibits oval cell activation. Am. J Pathol. 151, 905-909 (1997).

113. Lagasse,E. et al. Purified hematopoietic stem cells can differentiate into hepatocytes in
vivo. Nat. M~ed. 6, 1229-1234 (2000).

114. Deng,J., Steindler,D.A., Laywell,E.D. & Petersen,B.E. Neural trans-differentiation
potential of hepatic oval cells in the neonatal mouse brain. Exp. Neurol. 182, 373-3 82
(2003).

115. Lowes,K.N., Croager,E.J., Olynyk,J.K., Abraham,L.J. & Yeoh,G.C. Oval cell-mediated
liver regeneration: Role of cytokines and growth factors. J. Gastroenterol. Hepatol. 18, 4-
12 (2003).

116. Kinosita,R. Studies on the cancerogenic chemical substances. Transactions of the Japanese
Pathological Society 665-727 (1937).

117. Farber E. Similarities in the sequence of early histologic changes induced in the liver of the
rat by ethionine, 2-acetylaminoflouorene, and 3'-methyl-4-dimethylaminoazbenzene.
Cancer Res. 16, 142. 1956.
Ref Type: Journal (Full)

118. Leduc,E.H. & Wilson,J.W. Injury to liver cells in carbon tetrachloride poisoning;
histochemical changes induced by carbon tetrachloride in mouse liver protected by
sulfaguanidine. AM4A. Arch. Pathol. 65, 147-157 (1958).









119. Lemire,J.M., Shiojiri,N. & Fausto,N. Oval cell proliferation and the origin of small
hepatocytes in liver injury induced by D-galactosamine. Am. J. Pathol. 139, 535-552
(1991).

120. Price,J.M., Harman,J.W., Miller,E.C. & Miller,J.A. Progressive microscopic alterations in
the livers of rats fed the hepatic carcinogens 3'-methyl-4-dimethylaminoazobenzene and 4'-
fluoro-4-dimethylaminoazobenzene. Cancer Res. 12, 192-200 (1952).

121. Wilson,J.W. &Leduc,E.H. Role of cholangioles in restoration of the liver of the mouse
after dietary injury. J. Pathol. Bacteriol. 76, 441-449 (1958).

122. Petersen,B.E. & Hatch,H.M. Methods of tissue engineering. Atala,A. & Lanza,R.P. (eds.),
pp. 429-437 (Academic Press, San Diego, CA,2001).

123. Sell,S. Stem cell origin of cancer and differentiation therapy. Crit Rev. Oncol. Hematol. 51,
1-28 (2004).

124. Farber,E. Hepatocyte proliferation in stepwise development of experimental liver cell
cancer. Dig. Dis. Sci. 36, 973-978 (1991).

125. Sell, S. & Pierce,G.B. Maturation arrest of stem cell differentiation is a common pathway
for the cellular origin of teratocarcinomas and epithelial cancers. Lab Invest 70, 6-22
(1994).

126. Dunsford,H.A., KarnasutaC., Hunt,J.M. & Sell,S. Different lineages of chemically induced
hepatocellular carcinoma in rats defined by monoclonal antibodies. Cancer Res. 49, 4894-
4900 (1989).

127. Dunsford,H.A. & Sell,S. Production of monoclonal antibodies to preneoplastic liver cell
populations induced by chemical carcinogens in rats and to transplantable Morris
hepatomas. Cancer Res. 49, 4887-4893 (1989).

128. Van Eyken,P. et al. Cytokeratin expression in hepatocellular carcinoma: an
immunohistochemical study. Hum. Pathol l9, 562-568 (1988).

129. Denk,H., Krepler,R., Lackinger,E., Artlieb,U. & Franke,W.W. Biochemical and
immunocytochemical analysis of the intermediate filament cytoskeleton in human
hepatocellular carcinomas and in hepatic neoplastic nodules of mice. Lab invest 46, 584-
596 (1982).

130. Hsia,C.C., Evarts,R.P., Nakatsukasa,H., Marsden,E.R. & Thorgeirsson,S.S. Occurrence of
oval-type cells in hepatitis B virus-associated human hepatocarcinogenesis. Hepatology 16,
1327-1333 (1992).

131. Vandersteenhoven,A.M., Burchette,J. & Michalopoulos,G. Characterization of ductular
hepatocytes in end-stage cirrhosis. Arch Pathol Lab M~ed. 114, 403-406 (1990).










132. Fausto,N. Oval cells and liver carcinogenesis: an analysis of cell lineages in hepatic tumors
using oncogene transfection techniques. Prog. Clin. Biol. Res. 331, 325-334 (1990).

133. Garfield,S., Huber,B.E., Nagy,P., Cordingley,M.G. & Thorgeirsson,S.S. Neoplastic
transformation and lineage switching of rat liver epithelial cells by retrovirus-associated
oncogenes. Mol1. Carcinog. 1, 189-195 (1988).

134. Marceau,N. Cell lineages and differentiation programs in epidermal, urothelial and hepatic
tissues and their neoplasms. Lab Invest 63, 4-20 (1990).

135. Gordon,M.D. & Nusse,R. Wnt signaling: multiple pathways, multiple receptors, and
multiple transcription factors. J. Biol. Chem. 281, 22429-22433 (2006).

136. Willert,K. et al. Wnt proteins are lipid-modified and can act as stem cell growth factors.
Nature 423, 448-452 (2003).

137. He,X. & Axelrod,J.D. A WNTer wonderland in Snowbird. Development 133, 2597-2603
(2006).

138. Hinck,L., Nelson,W.J. & Papkoff,J. Wnt-1 modulates cell-cell adhesion in mammalian
cells by stabilizing beta-catenin binding to the cell adhesion protein cadherin. J. Cell Biol.
124, 729-741 (1994).

139. Nusse,R. & Varmus,H.E. Many tumors induced by the mouse mammary tumor virus
contain a provirus integrated in the same region of the host genome. Cell 31, 99-109
(1982).

140. Smalley,M.J. & Dale,T.C. Wnt signalling in mammalian development and cancer. Cancer
M~eta~sta~sis Rev. 18, 215-230 (1999).

141. Wodarz,A. & Nusse,R. Mechanisms of Wnt signaling in development. Annu. Rev. Cell
Dev. Biol. 14, 59-88 (1998).

142. Borycki,A.G. & Emerson,C.P., Jr. Multiple tissue interactions and signal transduction
pathways control somite myogenesis. Curr. Top. Dev. Biol. 48, 165-224 (2000).

143. Church,V.L. & Francis-West,P. Wnt signalling during limb development. Int. J. Dev. Biol.
46, 927-936 (2002).

144. Deardorff,M.A. & Klein,P.S. Xenopus frizzled-2 is expressed highly in the developing eye,
otic vesicle and somites. M~ech. Dev. 87, 229-233 (1999).

145. Galli,L.M. et al. A proliferative role for Wnt-3a in chick somites. Dev. Biol. 269, 489-504
(2004).

146. Hartmann,C. & Tabin,C.J. Dual roles of Wnt signaling during chondrogenesis in the
chicken limb. Development 127, 3141-3159 (2000).










147. Hartmann,C. & Tabin,C.J. Wnt-14 plays a pivotal role in inducing synovial joint formation
in the developing appendicular skeleton. Cell 104, 341-351 (2001).

148. Ikeya,M., Lee,S.M., Johnson,J.E., McMahon,A.P. & Takada,S. Wnt signalling required for
expansion of neural crest and CNS progenitors. Nature 389, 966-970 (1997).

149. Lee,S.M., Tole,S., Grove,E. & McMahon,A.P. A local Wnt-3a signal is required for
development of the mammalian hippocampus. Development 127, 457-467 (2000).

150. Sela-Donenfeld,D. & Kalcheim,C. Localized BMP4-noggin interactions generate the
dynamic patterning of noggin expression in somites. Dev. Biol. 246, 3 11-328 (2002).

151. Yamaguchi,T.P., Bradley,A., McMahon,A.P. & Jones,S. A Wnt~a pathway underlies
outgrowth of multiple structures in the vertebrate embryo. Development 126, 121 1-1223
(1999).

152. Bienz,M. & Clevers,H. Linking colorectal cancer to Wnt signaling. Cell 103, 311-320
(2000).

153. Kostakopoulou,K., Vogel,A., Brickell,P. & Tickle,C. 'Regeneration' of wing bud stumps of
chick embryos and reactivation of Msx-1 and Shh expression in response to FGF-4 and
ridge signals. M~ech. Dev. 55, 119-131 (1996).

154. Reya,T. et al. A role for Wnt signalling in self-renewal of haematopoietic stem cells.
Nature 423, 409-414 (2003).

155. Kioussi,C. et al. Identification of a Wnt/Dvl/beta-Catenin --> Pitx2 pathway mediating
cell-type-specific proliferation during development. Cell 111, 673-685 (2002).

156. Treier,M. et al. Multistep signaling requirements for pituitary organogenesis in vivo. Genes
Dev. 12, 1691-1704 (1998).

157. van de Wetering,M. et al. The beta-catenin/TCF-4 complex imposes a crypt progenitor
phenotype on colorectal cancer cells. Cell 111, 241-250 (2002).

158. Karim,R., Tse,G., Putti,T., Scolyer,R. & Lee,S. The significance of the Wnt pathway in the
pathology of human cancers. Pathology 36, 120-128 (2004).

159. Luo,J. et al. Wnt signaling and human diseases: what are the therapeutic implications? Lab
hzvest 87, 97-103 (2007).

160. Torres,M.A. et al. Activities of the Wnt-1 class of secreted signaling factors are
antagonized by the Wnt-5A class and by a dominant negative cadherin in early Xenopus
development. J. CellBiol. 133, 1123-1137 (1996).

161. Monga,S.P., Pediaditakis,P., Mule,K., Stolz,D.B. & Michalopoulos,G.K. Changes in
WNT/beta-catenin pathway during regulated growth in rat liver regeneration. Hepatology
33, 1098-1109 (2001).









162. Thompson,M.D. & Monga,S.P. WNT/beta-catenin signaling in liver health and disease.
Hepatology 45, 1298-1305 (2007).

163. Cadoret,A. et al. Hepatomegaly in transgenic mice expressing an oncogenic form of beta-
catenin. Cancer Res. 61, 3245-3249 (2001).

164. Tan,X. et al. Epidermal growth factor receptor: a novel target of the Wnt/beta-catenin
pathway in liver. Gastroenterology 129, 285-302 (2005).

165. Benhamouche,S., Decaens,T., Perret,C. & Colnot,S. Wnt/beta-catenin pathway and liver
metabolic zonation: a new player for an old concept. M~ed. Sci. (Paris) 22, 904-906 (2006).

166. Benhamouche,S. et al. Apc tumor suppressor gene is the "zonation-keeper" of mouse liver.
Dev. Cell 10, 759-770 (2006).

167. Tsao,M.S., Smith,J.D., Nelson,K.G. & Grisham,J.W. A diploid epithelial cell line from
normal adult rat liver with phenotypic properties of 'oval' cells. Exp. Cell Res. 154, 38-52
(1984).

168. Muller-Borer,B.J. et al. Mechanisms controlling the acquisition of a cardiac phenotype by
liver stem cells. Proc. Natl. Acad'. Sci. U. S. A 104, 3877-3882 (2007).

169. Couchie,D. et al. Expression and role of Gas6 protein and of its receptor Axl in hepatic
regeneration from oval cells in the rat. Gastroenterology 129, 1633-1642 (2005).

170. Zhong,X.G., He,S., Yin,W., Deng,J.Y. & Chen,B. Tropism of adult liver stem cells toward
hepatocellular carcinoma cells in vitro. Zhonghua Gan Zang.ZZ~~~~~ZZZZZ~~~~ Bing. Za Zhi. 13, 644-647
(2005).

171. Muller-Borer,B.J. et al. Adult-derived liver stem cells acquire a cardiomyocyte structural
and functional phenotype ex vivo. Am. J. Pathol. 165, 135-145 (2004).

172. Couchie,D., Holic,N., Chobert,M.N., Corlu,A. & Laperche,Y. In vitro differentiation of
WB-F344 rat liver epithelial cells into the biliary lineage. Differentiation 69, 209-215
(2002).

173. Coleman,W.B. et al. Evaluation of the differentiation potential of WB-F344 rat liver
epithelial stem-like cells in vivo. Differentiation to hepatocytes after transplantation into
dipeptidylpeptidase-IV-deficient rat liver. Am. J. Pathol. 151, 353-359 (1997).









BIOGRAPHICAL SKETCH

Jennifer Marie LaPlante was born in St. Louis, MO. She attended St. Elizabeth's of

Hungary School until seventh grade (1990) when she moved to Woodstock, IL. Here she

finished grade school at St. Mary's of Woodstock and completed high school at Marian Central

Catholic High School. During high school she was actively involved in sports achieving varsity

letters in volleyball, softball, and basketball. As editor in chief of the school newspaper, a

member of the National Honor Society, the leader of academic clubs such as Math team and

J.E.T.S., and a straight "A" student, she was rewarded with a Presidential Scholarship to Ohio

Wesleyan University (OWU).

While attending OWU Jennifer was an active member of her sorority, Delta Delta Delta

and involved in various choral groups. She was inducted into the Omicron Delta Kappa, Phi Beta

Kappa, Phi Sigma, and Phi Sigma lota Societies as well as a member of the Deans list. Jennifer

was awarded honorary admission into the Sigma Xi society based on her senior thesis work

sequencing the 16s rRNA isolated from the intestinal contents of the Licking County American

Mastodont (2Mannut a~nericanunt; NCBI Accession #s AF279699 and AF279699. 1). During the

semester of the fall of 1998, she studied abroad in Salamanca, Spain, and in 2000, Jennifer

graduated with a Bachelor of Arts in Botany/Microbiology with a concentration in genetics and a

minor in Spanish.

Jennifer was accepted into the University of Florida MD-PhD program beginning the fall

of 2000. During her two years of didactic medical school work, Jennifer was active in numerous

medical associations and volunteer organizations including the AMA-MSS, AMSA, and the

student run Equal Access Volunteer Health Clinic. Jennifer served the AMA nationally in

various positions including serving as the medical student liaison to the NBME for 3 years.









After completing her medical school didactic years as well as the USMLE step I exam,

Jennifer began her graduate studies in the University of Florida Interdisciplinary Program.

Jennifer studied under the tutelage of Dr. Bryon E. Petersen in the University of Florida

Department of Pathology during her graduate work. Her proj ect consisted of discerning the role

of Wnt1 in oval cell based liver regeneration. Jennifer presented a portion of her research at the

Washington, DC, 2006 national convention of the American Association for Cancer Research

(AACR) .

Jennifer then married Matthew James Williams on July 17th, 2006. She completed her

dissertation requirements and returned to her clinical studies in order to complete her medical

degree at the University of Florida.





PAGE 1

1 THE ROLE OF THE Wnt FAMILY OF SECRETED PROTEINS IN OVAL STEM CELL BASED LIVER REGENERATION By JENNIFER MARIE WILLIAMS A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2007

PAGE 2

2 2007 Jennifer M. Williams

PAGE 3

3 To the rock that steadie s me, my husband Matthew.

PAGE 4

4 ACKNOWLEDGMENTS I thank my principle investigator Bryon E. Pe tersen for the scientif ic knowledge and ideals of perseverance that he has favored me. He has graciously humbled me and rewarded me when I was deserving. My mentor in college, Dr. Jerry Goldstein also provided me with the desire to understand the unknown and for that I am truly grat eful. I would also like to thank the other members of my committee: drs. James M. Crawford, W. Stratfor d May, Jr., Naohiro Terada, and Barry J. Byrne for pushing me to evolve into the scientist I am now. Without their continued support and scientific dialogue I wo uld not be prepared for the scie ntific world outside graduate school. I cannot explain the importance of friends a nd family. Never once have my parents or family told me I could not achieve any goal towa rd which I set my mind. My lab mates and my dearest friends, Kara Hrdlicka, Lisa Stilli ng, and Emma Westermann-Clark, have seen me through thick and thin. Never have I been withou t a shoulder to cry on during the tough times or without a hand to squeeze during the exciting ones. For their time and devotion I can only send them smiles in return. Lastly, I could never have survived the last few years without someone to maintain my sanity and keep me on track. My husband has give n me everything I have ever needed and more. I love him and can never tell him enough how much he means to me.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS...............................................................................................................4 LIST OF TABLES................................................................................................................. ..........9 LIST OF FIGURES................................................................................................................ .......10 LIST OF ABBREVIATIONS........................................................................................................12 ABSTRACT....................................................................................................................... ............14 1 INTRODUCTION..................................................................................................................16 2 BACKGROUND AND SIGNIFICANCE.............................................................................. 19 2.1 The Liver.................................................................................................................. ........19 2.1.1 Anatomy of the Liver.............................................................................................19 2.1.1.1 Structure of the hepatic organ......................................................................19 2.1.1.2 Microarchitecture of the liver.......................................................................20 2.1.2 Functions of the Liver............................................................................................22 2.1.2.1 Homeostasis.................................................................................................22 2.1.2.2 Storage..........................................................................................................23 2.1.2.3 Drug and toxin detoxification......................................................................23 2.1.2.4 Liver endocrine functions.............................................................................23 2.1.2.5 Liver exocrine function................................................................................24 2.1.3 Liver Regeneration.................................................................................................24 2.1.4 Hepatocyte Transplantation for the Treatment of Liver Diseases..........................26 2.1.5 Hepatocellular and Chola ngiocellular Carcinomas................................................29 2.2 Stem Cells and Their Therapeutic Potential.....................................................................30 2.2.1 Pluripotenitality of Stem Cells...............................................................................31 2.2.1.1 Embryonic stem cells...................................................................................31 2.2.1.2 Adult stem cells............................................................................................32 2.2.2 Stem Cell Therapeutics...........................................................................................33 2.3 Liver Oval Stem Cell....................................................................................................35 2.3.1 Oval Cell Biology...................................................................................................35 2.3.1.1 Hepatic oval cell compartment.....................................................................35 2.3.1.2 Oval cell plasticity........................................................................................39 2.3.1.3 Oval cells in therapeutics.............................................................................40 2.4 Stem Cells and Cancer......................................................................................................41 2.4.1 Theories of Cancer Development...........................................................................41 2.4.1.1 Cellular origins of cancer.............................................................................41 2.4.1.2 Stem cell theory of cancer............................................................................42 2.4.2 Oval Cells and Liver Cancers.................................................................................42 2.4.2.1 History of oval cell theory of hepatic carcinogenesis..................................42 2.4.2.2 Evidence for oval cell theo ry of hepatic cancers..........................................44

PAGE 6

6 2.5 Wnt Family of Proteins.....................................................................................................47 2.5.1 Wnt Pathway..........................................................................................................47 2.5.1.1 History of the Wnt pathway.........................................................................47 2.5.1.2 Wnt proteins and signaling...........................................................................48 2.5.2 Functions of the Wnt Family..................................................................................49 2.5.2.1 Role of Wnt in differentiation and development..........................................49 2.5.2.2 Wnt family and disease................................................................................50 2.5.3 Wnts and the Liver.................................................................................................51 2.5.3.1 Wnts and liver regeneration.........................................................................51 2.5.3.2 Wnts and liver development and liver zonation...........................................52 2.5.3.3 Wnts and liver diseases................................................................................52 3 SPECIFIC AIMS.................................................................................................................. ..54 4 MATERIALS AND METHODS............................................................................................57 4.1 Animals Studies............................................................................................................ ....57 4.1.1 Animals and Animal Housing Facilities.................................................................57 4.1.2 Animal Sacrifice and Tissue Collection.................................................................58 4.1.3 Oval Cell Induction in the Rat................................................................................58 4.1.3.1 2-AAF pellet implantation...........................................................................58 4.1.3.2 Two-thirds partial hepatectomy...................................................................60 4.1.4 Density-Based Separation of the Liver...................................................................61 4.1.4.1 Perfusion of the liver....................................................................................61 4.1.4.2 Density gradient separation of liver cells.....................................................62 4.2 Liver Stem Cell Response to Wnt....................................................................................62 4.2.1 In vitro Response of Rat Liver Epith elial cells to Wnt3A......................................62 4.2.1.1 Maintenance of liver stem-like cells, WB-F344..........................................62 4.2.1.2 Exposure of liver stem-like cells to Wnt3A.................................................63 4.3 Wnt shRNA Model in Rat................................................................................................63 4.3.1 Wnt shRNA Plasmid..............................................................................................63 4.3.1.1 Design of Wnt shRNA vector......................................................................63 4.3.1.2 Wnt shRNA plasmid amplification..............................................................64 4.3.1.3 Wnt1 shRNA plasmid analysis....................................................................67 4.3.2 Verification of Wnt1 shRNA Function..................................................................67 4.3.2.1 Confirmation of Wnt1 knockdown in PC12/Wnt1 cells..............................67 4.3.3 Inhibition of Wnt1 in the Rat..................................................................................68 4.3.3.1 In vivo shRNA to Wnt1................................................................................68 4.3.3.2 Femoral injections of shRNA vector............................................................69 4.3.3.3 Animal numbers...........................................................................................69 4.4 Histology and Immunohistochemistry..............................................................................70 4.4.1 Histological Analysis..............................................................................................70 4.4.1.1 Hematoxylin and eosin of paraffin embedded tissue...................................70 4.4.1.2 Hematoxylin and eosin of frozen sections...................................................70 4.4.1.3 Periodic Acid-Schiff staini ng of paraffin embedded tissue.........................71 4.4.2 Immunohistochemistry...........................................................................................71 4.4.2.1 Chromogen staining.....................................................................................71

PAGE 7

7 4.4.2.2 Fluorescent staining......................................................................................71 4.4.2.3 Antibodies Utilized for Immunohistochemistry..................................................72 4.5 Protein Analysis........................................................................................................... .....72 4.5.1 Protein Isolation and Quantification.......................................................................72 4.5.1.1 Protein isolation from tissue or cells............................................................72 4.5.1.2 Protein quantification with DC Protein Assay.............................................73 4.5.2 Western Blot Analysis of Protein Levels...............................................................73 4.5.2.1 Pouring an acrylamide gel............................................................................73 4.5.2.2 Protein sample preparation...........................................................................74 4.5.2.3 Electrophoresis of the western gel...............................................................74 4.5.2.4 Transferring of a western gel to a PVDF membrane...................................75 4.5.2.5 Probing of western membrane......................................................................75 4.5.2.6 Developing of western membrane with ECL Plus.......................................76 4.5.2.7 Membrane stripping for reprobing...............................................................76 4.5.2.9 Antibodies Utilized in Western blotting.......................................................76 4.6 RNA analysis............................................................................................................... .....76 4.6.1 RNA Isolation.........................................................................................................76 4.6.1.1 Homogenization...........................................................................................76 4.6.1.2 Phenol-chloroform phase separation............................................................77 4.6.1.3 Precipitation and redissolving of RNA........................................................77 4.6.1.4 Quantification of RNA by spectrophotometry.............................................78 4.6.2 RT-PCR..................................................................................................................78 4.6.2.1 First-strand cDNA synthe sis from total RNA..............................................78 4.6.2.2 PCR amplification of target cDNA..............................................................78 4.6.2.3 Primers utilized for DNA/cDNA amplification...........................................79 4.6.2.4 Agarose gel electrophoresis.........................................................................79 4.6.3 Real-Time PCR analysis of Wnt1 levels................................................................80 4.6.3.1 Real-Time PCR of Wnt1..............................................................................80 4.6.3.2 Real-Time PCR of 18S rRNA......................................................................80 4.6.3.3 Statistical analysis of R eal-Time PCR and densitometry.............................80 4.7 Solutions.................................................................................................................. .........80 5 RESULTS........................................................................................................................ .......83 5.1 Evaluation of the Wnt Family During Oval Cell Induction.............................................83 5.2 In vivo Inhibition of Wnt1 Du ring Oval Cell Induction...................................................90 6 DISCUSSION AND FUTURE STUDIES...........................................................................100 6.1 Summary of Results........................................................................................................100 6.2 Interpretation of Results.................................................................................................101 6.2.1 Wnt Signaling is Required During Oval Cell Based Liver Regeneration............101 6.2.1.1 Novel findings............................................................................................101 6.2.1.2 Basic science applications..........................................................................102 6.2.1.3 Clinical applications...................................................................................103 6.2.2 Disregulation of Wnt1 Signa ling and Cancer Induction......................................105 6.2.2.1 Atypical ductular proliferatio n after Wnt1 shRNA exposure i n vivo .........105

PAGE 8

8 6.2.2.2 Use of Wnt1 in preneoplastic foci..............................................................106 6.3 Future Studies............................................................................................................. ....106 6.3.1 Continuation of the Wnt1 shRNA 2AAF/PHx Protocol......................................106 6.3.2 Exposure of Oval Cells to Wnt1...........................................................................107 6.3.3 Wnt1 Conditional Knockout Animal....................................................................107 6.3.4 Summary of Proposed Experiments.....................................................................107 LIST OF REFERENCES.............................................................................................................109 BIOGRAPHICAL SKETCH.......................................................................................................121

PAGE 9

9 LIST OF TABLES Table page 4-1 Numbers of animals sacrificed during in vivo Wnt1 shRNA inhibition............................69 4-2 Antibodies utilized for immunohistochemistry.................................................................72 4-3 Antibodies utilized for western blot analysis.....................................................................76 4-4 Primers utilized for PCR, and rtPCR.................................................................................79

PAGE 10

10 LIST OF FIGURES Figure page 2-1 Diagrams of hepatic microarchitecture..............................................................................19 2-2 Diagrams of the various liver lobules................................................................................20 2-3 The liver acinus........................................................................................................... .......21 2-4 Graphic representation of growth of remaining three liver lobes after partial hepatecomy in the rat.........................................................................................................24 2-5 Graph of the amount of various resident hepatic cells within th e cell cycle during the time following partial hepatectomy...............................................................................25 2-6 H and E of rat liver from day 11 of the 2-AAF/CCl4 protocol..........................................37 2-7 H and E of livers from the 2AAF/PHx protocol................................................................38 2-8 Drawing of potential end poi nts of oval cell differentiation..............................................39 2-9 Representation of the cononical Wnt pathway...............................................................50 4-1 Oval cell induction in the rat............................................................................................. .59 4-2 shRNA hairpin structures...................................................................................................64 4-3 Map of the pshRNA-H1-gz-Wnt1 vector..........................................................................65 4-4 The sequence and relevant restriction enzyme sites of the pshRNA-H1-gz-Wnt1 vector......................................................................................................................... .........66 4-5 Diagrammatic representation of Wnt shRNA model.........................................................68 5-1 2AAF/PHx 9 Days post PHx versus Wnt Family..............................................................83 5-2 Staining of Wnt1 during 2AAF/PHx.................................................................................84 5-3 Dual Staining of Wnt1 and -catenin in 2AAF/PHx.........................................................85 5-4 Change in -catenin and Wnt1 protein levels during 2AAF/PHx oval cell induction.......86 5-5 -catenin levels of liver cell fractions................................................................................87 5-6 Reverse transcription PCR of liver from 2AAF/PHx oval cell induction model..............88 5-7 Real Time PCR analysis of Wnt1 expression during oval cell induction..........................89

PAGE 11

11 5-8 Response of WB-F344 cells to Wnt3a stimulation............................................................90 5-9 Knockdown of Wnt1 in PC12/Wnt1 cells.........................................................................91 5-10 GFP expression in shRNA treated animals........................................................................91 5-11 Percent liver weights of animals treated with shRNA.......................................................92 5-12 H and E of livers from shRNA treated animals.................................................................93 5-13 OV6 and CD45 staining of serial fresh fr ozen sections from the livers of shRNA treated animals................................................................................................................ ...94 5-14 Ki67 comparison of 2AAF/Phx versus Wnt1 shRNA treated animals..............................95 5-15 AFP and Wnt1 staining of serial sect ions from Wnt1 shRNA treated animals.................96 5-16 Real Time PCR analysis of Wnt1 expression of shRNA treated animals.........................97 5-17 Atypical ductular hyperplasia w ithin Wnt shRNA treated animals...................................98

PAGE 12

12 LIST OF ABBREVIATIONS 2-AAF 2-acetoaminofluorene AFP -fetoprotein APS Ammonium persulfate bp Base pair CK Cytokeratin DAPM Methylene dianaline DNA Deoxyribonucleic acid ECM Extracellular matrix FBS Fetal bovine serum FRP Frizzled Related Protein Fzd Frizzled GFP Green Fluorescent Protein HGF Hepatocyte Growth Factor HSC Hematopoietic stem cells IHC Immunohistochemistry i.p. Intraperitoneal LRP Low density lipoprotein receptor-Related Protein NRL Normal rat liver nt Nucleotide OCT Optimal cutting temperature OLT Orthotopic liver transplant O/N Overnight PBS Phosphate buffered saline

PAGE 13

13 PCR Polymerase chain reaction PHx Partial hepatectomy RNA Ribonucleic acid RPM Revolutions per minute RT Room temperature rtPCR reverse transcription PCR RT-PCR Real Time PCR SCRsi Scrambled shRNA shRNA small interfering RNA shRNA small hairpin RNA TEMED Tetramethylethylenediamine TGFTransforming Growth Factor TGFTransforming Growth Factor Wnt1si Wnt1 shRNA

PAGE 14

14 Abstract of Dissertation Pres ented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy THE ROLE OF THE Wnt FAMILY OF SECRETED PROTEINS IN OVAL STEM CELL BASED LIVER REGENERATION By Jennifer M. Williams December 2007 Chair: Bryon E. Petersen Major: Medical Sciences--Molecular Cell Biology The Wnt/ -catenin pathway has been shown to be essential in embryogenesis and has been implicated in carcinogenesis. The current study reports novel findings in the Wnt pathway during the rat liver oval stem cell induction prot ocol of 2-acetylaminofluorene (2AAF) and 70% partial hepatectomy (PHx). Western blot anal yses, rt-PCR, RT-PCR, and immunohistochemistry (IHC) were utilized to analyze the involvement of the Wnt family in liver injury and oval cell activation. It was found that Wnt-1, Wnt3, Wnt5a, Frizzled Related Protein 1, Fri zzled 5 and Frizzled 7 proteins were predominantly localized in pericentral hepatocyte s. Following oval cell proliferation, an increase in Wnt proteins in concordance with the in crease in oval cell number was observed. Wnt1 levels message levels peak ed during the peak in oval cell numbers, and Wnt1 protein levels as well as -catenin protein levels peaked after the increase in oval cell numbers. IHC analysis of -catenin demonstrated oval cells with nuclear translocation of catenin throughout the 2AAF/PHx protocol. Hepatic stem cells responded to Wnt3a in culture by exhibiting the same -catenin translocation visualized by IHC. Subsequent in vivo exposure to an shRNA construct di rected toward Wnt1, inhibited the oval cell based liver regeneration. Without the Wnt1 signal oval cells were unable to differentiate

PAGE 15

15 into hepatocytes, lost AFP expression, a nd underwent atypical ductu lar hyperplasia that exhibited epithelial metaplasia and mucin producti on. It is hypothesized th at changes in the Wnt pathway during oval cell induction control liver stem cell differentiation through regulation of catenin levels, which is known to induce cel l proliferation and ta rget gene expression. Furthermore, changes in Wnt1 levels are require d for the efficient regeneration of the liver by oval cells during massi ve hepatic injury.

PAGE 16

16 CHAPTER 1 INTRODUCTION Uncovering the Role of Wnt in Oval Cells: The discovery of stem cells has led to some of the greatest medical advances of the 20th century. Stem cells, whether adult or embryonic, have differentiation potentials that far exceed initi al thought. Cells from practically any organ or tissue can be manipulated toward any cell lineage desired. One day in the not so far future, a simple blood draw could produce the cells needed to grow replacement organs. In conjunction with gene therapy, the therap eutic potential behind these observations is tremendous. In order to unlock the true capabilities of an adult stem cell one must understand the cells function in its site of origin. Recognizing an organ specific stem cell through histology and morphology has proven relatively easy; however thoroughly characterizing the molecular makeup of the same cell has proven more difficu lt. The use of phenotypical markers has aided the characterization process, but the cellular vari ations present during rou tine cellular processes, chemical exposure, and other stresses have made this method of characterization imprecise and difficult to say the least. Cell labeling techniques have a dvanced the study of cell differe ntiation fates, but again this technique has not always provided definitive results. In order to track the differentiation states of progenitors, these cells are frequently labeled with dyes. However, when the cell of interest has been labeled with a dye, after num erous cellular divisions the dye dilutes to undetectable levels. This ultimately makes the determination that a sp ecific cell was directly derived from a distinct progenitor nearly impossible. A nother labeling method entails th e genetic modification of the cell of interest. The cells contai n a gene encoding a fluorescent pr otein or other protein markers usually under the control of a viral promoter; how ever, these marker genes have frequently been found to have been silenced in vivo thereby, effectively unlabeling the cell of interest and its

PAGE 17

17 progeny. Although the techniques currently available fo r the classification of stem cells and their differentiation potentials are not perfect, they can provide a better understanding of stem cell morphology and function, but it is important to note that any observations made by removing a cell from is in vivo environment does not adequately describe the cell. Once removed for its site of origin the cell of interest has changed. Ultimately, scientists must be able to define the characteristics of an organ specific stem/progenitor cell, isolate that cell, and demonstrate in vivo, the steps of differentiation which the stem cell undergoes. Once this pathway is clea rly defined, the mechanisms controlling these pathways must be elucidated. A thorough understandi ng of the molecular signa ls that direct these cells can then be utilized therapeutically. The identification of an adult liver "stem" cell, the oval cell, has created opportunities for alleviating the shortage of livers available for tr ansplant as well designati ng a cell for use in gene therapy for the treatment of metabolic disorder s. Molecular characterization of the oval cell population has been fruitful, but these cells have s till not been completely classified. Oval cells have been manipulated both in vitro and in vivo toward numerous different cell types of various germ layers, thereby demonstrating their pluripot entiality. Although this is significant for future therapeutics, until the natural f unctions of oval cells within th e liver are understood, the true potential of the oval cell will remain hidden. This project was designed to further unders tand the signals that guide an oval cells differentiation toward a hepatic lineage. Previous works had dem onstrated the requirement of Wnt in normal liver development, as well as the role of -catenin in regulation of liver growth and regeneration. The Wnt family is a known regulator of stem cells that guides self renewal and

PAGE 18

18 differentiation, and, consequently, it was theorized that Wnt could possess some control over oval cell fate during stem cell based liver regeneration. Through IHC, protein, and RNA analysis a link between the Wnt signaling pathway and oval cell based liver regeneration was established. Inhibition of Wnt1 in vivo resulted in an abnormal regenerative process, failure of the oval cel ls to transdifferentiate into hepatocytes, and extensive atypical duct ular hyperplasia. This project outlined the requirement of Wnt signaling for the differentiation of oval cells toward a hepatic lineage. Without exposure to Wn t, oval cells defaulted to a ductular epithelial state and failed to aid in the regenerative proc ess. This study only begi ns to elucidate a better understanding of the role of cer tain signaling proteins in ova l cell based regeneration. In addition, the current studies open the door to several other avenue s for the classification of the liver stem cells functions.

PAGE 19

19 CHAPTER 2 BACKGROUND AND SIGNIFICANCE 2.1 The Liver 2.1.1 Anatomy of the Liver 2.1.1.1 Structure of the hepatic organ In an adult human, the largest parenchymal or gan, the liver, weighs approximately 1400 to 1600g. This represents approximately 2% of the to tal body weight. In the ra t, the liver weighs 7 to 8g which accounts for a greater percen t of the body weight (approximately 5%).1 In the human, the liver is comprised of four lobes, whereas, the rat liver contains five lobes.2 Figure 2-1. Diagrams of hepatic microarchitectur e. A. Diagram of a classic hepatic lobule. Diagram of hepatic blood flow. Red arrows indicate blood flow and green arrows indicate the direction of bile flow. B. Hepa tic microarchitecture.3 A B

PAGE 20

20 The liver has dual afferent blood supplies to ma intain its highly vascular parenchyma. The portal vein supplies over 60% of the incoming blood.1,2 The blood from the portal vein is venous and, therefore, oxygen poor. However, this venous supply is extremely nutrient rich due to the direct drainage of the intestin al epithelium. The hepatic artery provides the remaining 40% of oxygen rich blood to the liver.1,2 In parallel to the blood vessels but opposing direction of flow, the biliary tree forms excretory ducts that transport bile in to the duodenum. The portal vein, hepatic artery and biliary tree form a centr al vascular bundle termed the portal triad.2 2.1.1.2 Microarchitecture of the liver The liver is divided into hepatic lobules su rrounding terminal hepa tic venules (central veins) and outlined by portal triads. A hexagona l column of hepatocytes arranged in cords radiating from the central vein toward the porta l triad forms the structur e of the hepatic lobule (Figure 2-1A).4 Sinusoids composed of endothelial cells line each cord of hepatocytes and enclose the micro-vascular circulatory system of the liver.2-4 Essentially, blood enters the liver through the portal triads and fl ows through the parenchyma in direct contact with each hepatocyte within a cord and ultimately drains into the central vein. Me tabolites produced by the hepatocytes are excreted via the bile canaliculus into the canal of Hering, a terminal portion of the bile network within the portal triad. Figure 2-2. Diagrams of the vari ous liver lobules. A. The classi c lobule. B. The portal lobule. C. The functional unit known as the liver acinus. A. Central Vein Portal Triad C. Central Vein Portal Triad B. Central Vein Portal Triad Classic Lobule Liver Acinus Portal Lobule

PAGE 21

21 The liver parenchyma consists of a various gr oup of cell types includi ng hepatocytes, bile ductular epithelial cells, fat contai ning stellate cells, sinusoidal and vascular endothelial cells, and liver specific macrophages known as Kupffer cells which rid the liver of debris and aged red blood cells. Hepatocytes encompass 90% of liver we ight and carry out the biochemical functions of the liver as well as the production of bile.2 Hepatocytes are polygonal in shape, large in size (30 m), and have a high abundance of sm ooth and rough endoplasmic reticulum.4 The architectural makeup of the liver can be described in three ways. The unit most frequently recognized by histology is the classic l obule (Figure 2-2A).4 This lobule contains portal triad surrounding hepatic cord s radiating out from a single central vein. The portal lobule depicts blood flow from one portal triad to its surrounding central veins (Figure 2-2B).4 Lastly, although the classic lobule can be most easily recognized, the liver acinus is the functional unit of the liver (Figure 2-2C).4 Figure 2-3. The liver acinus. Diagram of the liv er acinus including the three zones radiating toward the central veins. The hepatocytes that extend from one central vein to another can be divided into three zones. Zone 1 includes hepatocytes surrounding the portal triad and r eceives the greatest concentration of nutrients; Zone 2 is composed of inter-zonal hepato cytes; and Zone 3 consists of Central Vein Portal Triad Zones 3 2 1 1 2 3

PAGE 22

22 poorly oxygenated hepatocytes nearest to the central ve in (Figure 2-3.).2,4 Within the liver acinus, blood flows through sinusoids from Zone 1 to Zone 3, and the bile moves from Zone 3 to Zone 1. Interestingly, hepatocytes within Zone 3 have an increased DNA content (4N to 16N), predominant bi-nucleation, large size and can undergo centrilobular necrosis. Conversely, hepatocytes within Zone 1 are smalle r and usually single nucleated (2N).5 It should be noted that the macroarchitecture of the liver seen histol ogically does not truly elucidate the dynamic functi onal units of the liver.6 The liver microarchite cture with regard to the organization of hepatic micr ocirculation, hepatic venous and ar terial systems as well as the biliary tree are much more complex in their functi onal units than can adequately be described in two dimensions.6 Three dimensional analysis of these sy stems via reconstructions complied from modern imaging techniques have begun to unlock the true physio logic hepatic lobule.6 2.1.2 Functions of the Liver 2.1.2.1 Homeostasis As a large parenchymal organ in the body, the liver performs a multitude of functions. To control homeostasis of the body, liver metabolizes amino acids lipids, and carbohydrates, and serum proteins. For example, by converting gl ucose into the storage form glycogen during carbohydrate metabolism, the liver e ffectively decreases blood leve l of glucose, and conversely, by metabolizing glycogen into glucose, the liver increases blood glucose levels. One of the main sites of glycogen storage is the liv er. The liver also maintains the colloid osmotic pressure of the blood by producing the most abunda nt protein in the plasma, al bumin. The liver also produces other important plasma proteins such as lipop roteins glycoproteins including prothrombin and fibrinogen, and the nonimmune and -globulins. Additionally, the liver plays a role in amino acid metabolism through the deamination of amino acids and the formation of urea.4

PAGE 23

23 2.1.2.2 Storage The liver stores and converts several importa nt vitamins taken up from the blood stream. Stellate cells stores vi tamin A within their lipid pools. W ithout the liver, vitamin D metabolism would not be completed. Then the circulati ng form of vitamin D (25-hydroxycholecaliferol) would never be subsequently converted by the ki dney to its active form which would result in rickets and failures in bone mine ralization. Lastly, the liver utilizes vitamin K for the production of clotting factors. Decreases in hepatic vitamin K utilization have strong implications in clotting and/or bleeding disorders.4 Due to the livers intricate vasculature and la rge size, a large volume of blood is located within it at any given time; thus making the li ver the largest blood stor age organ in the body. An adult human liver can hold about 1500ml of blood which equates to approximately 25% of cardiac output perminute.4 Also the liver is the main site for iron storage. Homeostasis of blood iron levels depends directly on th e ability of the liver to store and metabolize iron. Iron overload results in hemochromatosis which can result in severe liver damage. 2.1.2.3 Drug and toxin detoxification Processing large volumes of blood induces the liver to function as a detoxifying organ. Liver enzymes, such as alcohol dehydrogenase (ADH), cytochrome-P (CYP) and isoforms of uridine diphosphoglucuronate gl ucuronosyltransferase (UGT) a llow for the alteration of chemical composition of many xenobiot ics and their subsequent removal.2 The livers conversion of nonhydrophilic drugs to a more water soluble form aids in their excretion by the kidneys. 2.1.2.4 Liver endocrine functions Although the liver does not actively produce hormones, it modifies the actions of hormones released by other organs. The liver specifically modifies Vitamin D and thyroxin

PAGE 24

24 through metabolism, but it releases growth hormone -releasing hormone to re gulate the pituitarys release of growth hormone. Lastly, the liver is one of the main sites for insulin and glucagon degradation which further c ontrols blood glucose levels.2 2.1.2.5 Liver exocrine function The most important function of liver is the production of bile. Bile is important for intestinal absorption of nutrients and eliminati on of cholesterol. Bile mostly comprised of conjugated bilirubin, is collected in the liver biliary tree, stored in the gall bladder and eventually drained into the duodenum to act as a detergent.2 Figure 2-4. Graphic representation of growth of remaining three liver lobes after partial hepatecomy in the rat. Compensatory hype rplasia results in the liver regaining original tissue mass in approximately 10 to 14 days.6 American Medical Association. All Rights Reserved. 2.1.3 Liver Regeneration Compensatory hyperplasia of the liver, most often referred to as liver regeneration, takes place in response to mild to severe liver injury resulting from surgical resection of a portion of

PAGE 25

25 the liver or exposure to destructive agents such as hepato-toxins or hepa totropic viruses. Under normal conditions, hepatocytes exhibit minimal replicative activity; only 1 in every 20,000 hepatocytes undergoes mitotic division at any one given time point, but he patocyte division is the major driving force behind liver regeneration.7 Figure 2-4 represents a drawing by Higgins and Anderson of the growth of th e residual lobes of the liver after partial hepatectomy.8 Figure 2-5. Graph of the amount of various resident hepatic cells within the cell cycle during the time following partial hepatectomy. Hepatocy tes represent the prolifereative driving source behind liver regeneration.11 AAAS. All Rights Reserved. In the rat, hepatocytes move from the G0 resting phase of the cell cycle into G1, as mediated by the cyclin D1 pathway within 15 hours of partial hepatectomy (PHx).9,10 Peri-portal hepatocytes are the first to unde rgo DNA synthesis and proliferati on gradually spreads to include the hepatocytes located around the central vein.7,11 A large peak of DNA synthesis is observed at about 24-hrs post PHx, and a second, yet smaller peak arises at 48 hrs. The smaller peak reflects DNA synthesis occurring in non-parenchymal cells (NPC) and pericentral hepatocytes. Unlike hepatocytes, which display a wave of DNA synthesi s from periportal to pericentral, NPCs across

PAGE 26

26 the lobule exhibit simultaneous DNA synthesis.9 The original liver mass is usually restored within 10 days of the hepatectomy.12 Figure 2-5 is a graph by Mi chalopoulos and DeFrances, 1997, representing the percent of individual hepatic cell types di viding at various time points during hepatic regeneration induced by PHx.13 Several animal models of chemical hepato toxicity have been developed to study the mechanisms regulating the prolif erative response to liver injury. Among the most extensively utilized chemical agents are carbon tetrachloride (CCl4), which causes necrosis of the centrilobular regions of the liver, and allyl al cohol (AA), which causes periportal necrosis.14-17 In both models, regeneration of the necrotic re gion is mediated by proliferation of mature hepatocytes elsewhere in the live r lobule, and the oval cell response is not ac tivated to a degree of importance, if at all. The liver has an enormous capacity to regenerate, as demonstrated by the partial hepatectomy model in rodents. In addition, the liver has a stem cell compartment acting as a backup regenerative system. Activation of the stem cell compartment only occurs when the hepatocytes are unable to divide, functionally compromised, or both. In stem cell-aided liver regeneration, progeny of the stem cells multiply in an amplification compartment composed of the hepatic oval cells. The origins of oval cells remain controversial and several key questions regarding the molecular cues that initiate oval cell proliferation and direct lineage specific differentiation still remain. 2.1.4 Hepatocyte Transplantation for the Treatment of Liver Diseases The most commonly used and currently most e ffective treatment for the majority of liver diseases, metabolic and environmental, is th e orthotopic liver tran splant (OLT). Although extremely effective, OLT is expensive, the num bers of donors does not currently meet the need,

PAGE 27

27 and the post surgical immune suppression has severe side effects. Other pot ential treatments are currently being developed includ ing hepatocyte transplantation. Due to the multiple functions of the hepatocyte transplantation of normal hepatocytes in the case of inborn errors in metabolism seems logi cal. In addition to this, successes in curing animal models of these diseases have been intr iguing, but in actuality, the clinical application of hepatocyte transplantation still lacks the advan ces seen in animal models. As of 2006, only 78 hepatocyte transplants have been performed worldwide.18 Of those transplants, only twenty-one were performed in patients with inherited metabolic disorders.18 Twenty patients suffered from chronic liver diseases, and the remaining transp lants were delivered to acute liver failure patients.18 The history of hepatocyte transplantation gi ves insight into the struggles seen in the clinical application of this seemingly simple solution to the worldwide epidemic of liver diseases. In 1976, Matas et al. reported that a portal infusion of he patocytes resulted in the reduction of plasma bilirubin levels in the ra t Crigler-Nijjar mode l (the Gunn rat).19 The success of this rat model promoted hope for the future of treatme nts in patients with inherited and acquired metabolic disorders and liver diseases. The first human trial of hepatocyte transplantation was not achieved until 1992 when Mito et al performed a partial hepatect omy on a series of patients with chronic cirrhotic liver failure.20 After isolation of hepatocytes from the resected liver, they were autologously implanted via in trasplenic injection. Transplant ed, labeled cells were present in the spleen up to six months post transplant, however, the only clinical relevance of these transplants was the demons tration of engraftment.20 After successful decreases in se rum cholesterol in the Watanabe Heritable Hyperlipidemic rabbit were obtained following tran splantation of genetically modi fied hepatocytes, the first

PAGE 28

28 human inborn error in metabolism was chosen for human trials.21 Five patients with homozygous familial hypercholesterolemia underwent left la teral segment resection. Hepatocytes were isolated and transduced with the LDL receptor and reimplanted via the liver portal vein three days post resection.21 This trial demonstrated safety from tumor and infection with over a two year follow up. Nonetheless, th e less than 5% transgene expression four months post transplantation ended further hepatocyte transduction and implantation therapy.18 Conversely, successful treatment for inherite d metabolic disorders has been achieved. Intraportal transplantation of allogeneic mature he patocytes into four children with Crigler-Nijjar Syndrome type 1 has reproducibly reduced serum b illirubin levels by 30 to 50% for greater than three years.22-25 Of the sixteen humans receiving allogene ic hepatocyte transplants, most saw a decrease in the serum indicators of their diseas es, however, the decreases were not significant to prevent orthotopic liver transplantation (OLT).18 Also the level of donor cell engraftment varied drastically. This factor, in conj unction with the efficacy of whole organ transplant, has inhibited the advances in the treatment of metabo lic liver diseases by somatic cell therapy.18 Chronic liver disease and acute liver failure present an alternative use for hepatocyte transplantation. Ten patients w ith chronic liver disease rece iving autologous hepatocyte transplantation had hepatocytes pr esent at the injection site (the spleen) up to six months post transplant, but encephalopathy resolution (a clinic al indicator of hepatic disease regression) was not attributed to the transplants.20 Of the seven adults receivi ng allotransplants, only one recipients liver demonstrated histologic evidence of hepatocytes forming cord like structures, and only one showed any significant clin ical benefit but still underwent OLT.18 Interestingly, two of three pediatric patients w ho received a single allotransplant of hepatocytes to treat chronic liver failure fully recovered and the th ird was successfully bridged to OLT.26,27

PAGE 29

29 Acute liver failure has by far had the most patients receiving hepatocyte transplantations, but out of thirty-seven patient s treated, only two children and four adults had achieved full recovery with hepatocyte transp lant alone. The remainder exhibite d varying levels of metabolic improvement as measured by improved ence phalopathy and decrea sed ammonia levels. However, in these cases hepatocyte transp lant only functioned as a bridge to OLT.18 As seen in hepatocyte transplantation, the po ssibility of curing human metabolic diseases with somatic cell therapy has great potential. None theless, the current treatment strategies have not proven as effective as the animal models for the same diseases. Furthermore, availability of donor hepatocytes is extremely limited. This fact, compounded by the lack of significant success with autologous cell manipula tion and reimplantation, has seve rely inhibited the current treatment strategies of somatic cell therapy for metabolic diseases. These difficulties have led researchers to determine alternative treatment strategies which might utilize different cell populations. 2.1.5 Hepatocellular and Cholangiocellular Carcinomas Despite extensive research into its treatment and prevention, HCC remains one of the most frequent malignant diseases worl dwide. It is the 4th most comm on cancer comprising 5.4% of all new cases, and over 437,000 new cases are reported each year.28 Although rates are much lower in the Northern Hemisphere, the disease is ende mic in China, Taiwan, Korea, and Sub-Saharan Africa. This is most likely due in part to the ex tensive levels of aflatoxi n exposure in this region of the world, as well as the endemic rates of viral hepatitis.29 In these countries, HCC leads the list of causes of death due to a devastating average 5-year survival rate of less than 3%.29 Although less prevalent than HCC, cholangi ocarcinoma (CCC) accounts for 3% of all gastrointestinal cancers worldwide.30 In the US alone, approximately 5000 new cases are reported each year. There has also been a threefold increase in the number of CCC cases within

PAGE 30

30 the US between 1975 and 1999 with no apparent cause.30 As with HCC, the survival rate of CCC is devastatingly small with a 5-year survival rate of <5% for intrahepatic CCC and 10-15% for extrahepatic CCC.30 Cellular morphology of CCC differs from HCC in that the tumor cells are most often arranged in tubules and gland like structures ; whereas, HCC cells tends to display a more trabecular or pseudoglandular morphology.30 Also CCC tends to display a fibrous stroma that HCC lacks.30 Important to this research, CCC frequen tly contains mucin positive cells and/or glandular lumens.30 A more thorough understanding of the cellular origins of HCC and CCC could provide more avenues of a ttack in the treatment of these endemic diseases while increasing the number of strategies that ex ist for hepatic cancer prevention. 2.2 Stem Cells and Their Therapeutic Potential Almost one hundred years ago, Alexander Maxim ov theorized that within the peripheral blood lymphocytes there exists a populati on of common circulating stem cells ( gemeinsame Stammzellen ) that possessed pluripotency or could regain this potential.31 Maximov was the first to believe in the capacity of adult cells to diffe rentiate into one of many cell types. Unbeknownst to Maximov, it would take almost fifty years befo re his theories could be put into clinical practice, and another forty before a single cell was shown to repopul ate bone marrow long term.32,33 Incidentally, his theories are the basis for the current research boom in the field of somatic cell therapy. The progress therein has the potential to answer th ree major questions: i) What are the differential and self-r enewal capabilities of the various types of somatic cells within the body? ii) Are end organ stem cells truly lin eage committed? And iii) Can stem cells be utilized to treat cancer, autoimm une disorders, and aberrant ge netics in an organ specific manner? Each of these poignant questions has opened a door within th e field of medicine currently classified as Somatic Cell Therapy. Although somatic cell thera py currently has little

PAGE 31

31 clinical utilization aside from bone marrow tr ansplants, somatic cell therapy has limitless potential for the treatment of diseases when utilized in conjunction with gene therapy. 2.2.1 Pluripotenitalit y of Stem Cells Stem cells are defined as cells that have th e capacity for self rene wal and are multipotent, meaning they have the ability to differentiate into cells of various germ layers. Stem cells can be found within the adult somatic tissu e as well as the embryo. At this time, the only truly totipotent cell in existence is found in the fertilized egg although current research has revealed the truly multipotent nature of both the a dult and embryonic stem cells. However, the true differentiation capacity of these cells has not been fully recognized. 2.2.1.1 Embryonic stem cells The concept of cell differentiation has been in existence since the 1850s, well before Pappenheim first described the pr emise of the stem cell in 1919.34 However, it wasnt until the early 1980s that the clo nogenicity and totipotential nature of the embryonic stem cell was finally elucidated.35 Murine embryonic stem cells were discovered ov er twenty years ago. This breakthrough in cell biology enabled a revolution in experi mental medicine by establishing an in vitro model for early mammalian development, as well as a new source of cells for replacement therapies. Embryonic stem (ES) cells are pluripotent cells de rived from the inner cell mass of blastocyst stage embryos.36-38 ES cells have been manipulated in culture and in vivo via directed differentiation into each of th e three germ cell layers of ectoderm, mesoderm, and endoderm.37,39 Specifically, ES cells can be easily directed toward mesoderm specific cell types such as hematopoetic,40-43 hemangioblast,44-47 vascular,48-51 cardiac,52-54 skeletal muscle, chondrogenic, osteogenic, and adipogenic lineages.55-58 With more effort, endodermal lineages, most specifically of pancreatic and he patic origin, can be developed.59-61 Lastly, the neuronal

PAGE 32

32 differentiation of ES cells has pr ovided a vast amount of research that some suggest indicates that a ES cells may be the revolutionary treatment needed for diseases such as Alzheimers and Parkinsons.62 Much research has gone into the pluri potential nature of embryonic stem cells, however, with the current ethical issues and evidence of teratoma formation, use of these cells for somatic cell therapy has many hu rdles to overcome before the advantages of this cell type can come to clinical fruition. 2.2.1.2 Adult stem cells In recent years there has been an increasing bod y of evidence that adult stem cells have a far greater degree of plasticity than once thought. Bone marrow derived stem cells have been found to naturally produce (or can be manipulated towards producing) practi cally all endothelial, mesenchymal and epithelia l lineages found in the body.63-65 Neuronal stem cells have been shown to be capable of differentiating into a he matopoietic line and then back to a neuronal lineage.66 In addition, stem cells isolated from the br ain have been shown to generate an entire mammalian organism, more specifically a mouse.67 Although these studies have only been conducted in rodent models, they do suggest that adult mammalian stem cells may be utilized to treat cellular dysfunction within a ny organ system of the body. Theise et al (2000) and Alison et al (2000) reported that human a dult bone marrow stem cells could differentiate into mature hepatocytes, thereby providing the first link from animal studies to human studies and proof of concept.68-70 This data has the potential to develop into clinical applications within the very near future. Over one hundred years after the conception of the stem cell, the first single cell transplant to successfully rescue a lethally irradiated mouse was published. To address the pluripotentiality of the adult stem cells, specifica lly the hematopoietic stem cells (HSC), Krause et al performed a transplant of si ngle cell HSC combined with short term repopulating cells. The

PAGE 33

33 single cell transplanted was a lin eage negative, PKH26 labeled cell transplanted into lethally irradiated mice.71 These cells demonstrated multi-lineag e engraftment as seen by donor cells present that had differentiated into epithelial cells of the lung alveoli, GI tract, cholangiocytes and hair follicles eleven months post transplant.71 However, the technique used for this and other similar experiments was a very simple feet up or feet down (animals either lived or died) and, thus, the extension of single cell transplantation to human clinical trials has been and will be very nearly impossible. Bone marrow stem cells have also been shown to posses the ability to differentiate into liver, intestine, skin, skeletal muscle, heart musc le, pancreas, and central nervous system both in mouse models and human recipients of bone marrow or organ transplants.69,72-74 Mesenchymal stem cells (MSC) from the bone marrow al so exhibit a similar pluripotentiality.75 Bone marrow stem cells (HSC or MSC) have been shown to gi ve rise to endothelial cells of the vascular system and muscle as well as hepatocytes in vivo .76 In addition, bone marrow stem cells have been shown to participate in ne ural development and vice versa.76-78 Stem cells in vitro have have been shown to produce bone, connective tissue, and cartilage.76-78 Lastly, neural stem cells from the adult mouse brain can contribute to the formation of chimeric chick and mouse embryos, and give rise to cells of all germ layers.67 Other adult stem cells are currently being evaluated for their pluripotential nature, but none to date have been as successful as the HSC. Results from these studies demonstrate that adul t stem cells have a very broad developmental and differentiation capacity. 2.2.2 Stem Cell Therapeutics Clinical uses of stem cells for the repair of tissues such as heart and nervous system have been attempted with clinical trials.79,80 Transplantation of stem cells into the heart after myocardial infarction has improved revasculariz ation and has aided in healing; however, the

PAGE 34

34 clinical trials have failed to demonstrate that the cells have truly differentiated into cardiac myocytes.81 As with other somatic cell therapies, clini cal relevance of these procedures has yet to be demonstrated even though success has ag ain been seen in animal models. Another avenue for the clinical use of stem cells presents itself with the advent of bioengineered organs and/or tissu es. The development of tissue scaffolds for the seeding of stem cells has immense potential, but until recently the clinical applications of these scaffolds have been limited. The most clinically releva nt engineered tissue has been cartilage.82 The injection of tissue engineered cartilage into os teoarthritic as well as nonarthrit ic knees and other joints been reported to have greatly impr oved joint stability and motion.83 However, further long-term studies must be made to determine the stab ility and long term eff ects of these grafts.83 The growth of autologous cells on decellularized human heart valves and subsequent implantation of these valves has also been clinically worthwhile.84 Another engineered tissue that had been evaluated in a clinical study was the bladder. He re, patients received bladders engineered with autologous urothelial and muscle cells.85 Up to five years post implantation these patients demonstrated clinical benefit from the implanted tissue.85 The successes seen with bladders, heart valves and cartilage demonstrate the endless po ssibilities for the clinical use of stem cells. The combination of tissue engineering in c onjunction with autologous stem cells could revolutionize the organ transplant field. However, the ability to grow a patient another kidney from a stem cell isolated from their blood is st ill a dream that is yet to be fully realized. Someday, adult and/or embryonic stem cells may be used in a variety of ways for the treatment of different human diseases. Nevertheless, until the scientific community is able to reproduce successes seen in animal models, the huge clinical potential of the stem cell will remain locked within the Petri dish.

PAGE 35

35 2.3 Liver Oval Stem Cell 2.3.1 Oval Cell Biology 2.3.1.1 Hepatic oval cell compartment There is a strong interest in characterizing hepa tic stem cells with re spect to their origin, mechanism of activation, and their final lin eage destination. Oval cells are the primary candidates for the title of liver stem cell. Ade quate data has been gathered demonstrating oval cells existence within the regenerating liver, but their place of origin a nd their role in liver development, regeneration, and carcinogenesis remains enigmatic. Oval cells dramatically increase in number when hepatocyte prolifer ation is suppressed. 2-Acetoaminofluorene (2-AAF) given prior to hepatic injury induced by partial hepatectomy (PHx) results in suppression of hepatocyte proliferation through inhibition of Cyclin D as well as DNA adduct formation.86 Oval cells of undetermined origin then arise in th e portal zones of the liver. Morphologically, oval cells are small in size (approximately 10 m), with a large nuclear to cytoplasmic ratio, and contain an oval shaped nucleus, henc e the name oval cell (Figure 2-6).5,87 Figure 2-7 shows the oval cell migration and infiltration of the liver during the 2AAF/PHx protocol. Beginning about 3 days after PHx, oval cel ls are visible within the portal region of the liver. They proliferate and peak in number 9 days post PHX. They then differentiate into small, basophilic hepatocytes and eventually mature hepa tocytes. After 21 days, little evidence of oval cell infiltration remains and hepatic ar chitecture has returned to normal. Oval cells have similarities to bile ductular epithelial cells in their distinct isoenzyme profiles, expressing certain cytokeratins (e.g. CK-19), gamma-glutamyl transpeptidase ( GT), and may also express high levels of alpha-fetoprotein (AFP).88,89 Several monoclonal antibodies including A6 for mouse and OV6, OC.2, and BD1 fo r rat have been developed to aid in their identification and characterization wi thin various species including humans.88-102

PAGE 36

36 Within the rat model, Evarts et al. (1987 and 1989) revealed ex tensive activation of the oval cell compartment within the 2-AAF/PHx model, a variant of the Solt-Farber protocol.103,104 In additional studies, the same i nvestigators illustrated that pro liferation of oval cells and their subsequent differentiation into he patocytes during the ea rly stages of carci nogenesis were closely associated with an activation of stellate cells. It was then suggested that perisinusoidal stellate cells may regulate the developmental fate of the progenitor cells, either directly by secreting growth factors, such as hepatocyte growth fact or (HGF) and transforming growth factors alpha (TGF) and beta (TGF), or indirectly via effects of ex tracellular matrix (ECM) components induced by urokinase up-regulation.105 Progenitor cell proliferation and differentiation may also be regulated by autocr ine production of TGF, acidic fibroblast growth factor, and insulin-like growth factor II, which ar e factors that ova l cells have been shown to produce.5 Hence, hepatic injury-induced changes in cytokines and growth fact ors appear to modulate in situ oval cell proliferation/differentiation within the liver. Furt her study of the growth factors, such as Wnt, that are involved in these processes will lead to great advances in liver therapeutics. Oval cells in the liver represent an altern ative source of prolif erating cells in the regenerating liver. Proliferating oval cells in both the rat and muri ne models appear to radiate from the periportal region, forming primitive ductular structures with poorly defined lumena.106 The origin of oval cells remains unclear. Due to th eir involvement in peripor tal repair, some data suggests that oval cells exist in very small numb ers in the periportal regi on of the liver lobule, and that they emerge from this niche in response to seve re hepatic injury.107,108 Though oval cells do not normally participate in the regenerative response to PHx or CCl4 injury, they can be induced to do so through suppressing mature he patocyte proliferation. Administration of 2-AAF prior to and during hepatic injury induced by PHx or CCl4, blocks the proliferation of

PAGE 37

37 hepatocytes by interfering with th eir ability to divide. As with allyl alcohol induced injury, oval cell proliferation in these models begins in the periportal region before arborizing into the midzone as regeneration progresses. Oval cell prolifer ation can thus be stimulated in these otherwise non-oval cell aided regenerating models.109 Figure 2-6. H and E of rat live r from day 11 of the 2-AAF/CCl4 protocol. The small oval cells (arrows) are situated between the larger he patocytes surrounding a portal triad (P.T.). Magnification 20X. Lemire and Fausto (1991) showed that a very small number of cells localized in the canals of Hering of adult normal rat liv er expressed the fetal form of AFP mRNA, suggesting that this may be the compartment where unactive oval cells reside.110 Conversely, in 1992 Marceau et al. suggested that bile ductular cell s expressing the fetal form of A FP in the adult liver are unlikely to be the putative stem cells, because they la cked other markers stem cell markers, and in contrast to hepatoblasts, they do not react with the monoclonal antibody BPC5.111 Petersen et. al exposed rats to methylene dianaline ( DAPM) 24 hrs prior to hepatic damage (2-AAF/hepatic injury, PHx or CCl4).112 Under these circumstances the bile ductular epithelium was destroyed and the oval cell response was severely inhibited.112 This study was the first to elucidate a direct association between the requirem ent of an intact bile ductular epithelium and the ability to mount an oval cell response. This da ta, however, does not prove that oval cells arise

PAGE 38

38 from bile ductular cells because the DAPM could have elicited either a dire ct or indirect toxic effect upon the oval cells, which may have resulted in the inhibition of th eir activation. This study does support the idea that oval cells arise from the periportal zone, specifically from the canals of Hering.112 Figure 2-7. H and E of livers from the 2AAF/P Hx protocol. Oval cell infiltration can be visualized across the 2AAF/PHx time course. Oval cells appear w ithin portal regions of the liver rapidly following PHx. Peak oval cell production occurs after 9 days. Arrows within the 40 X magnification of Day 9 indicate the oval cells migrating toward the central vein. 13 days post PHx sm all, basophilic hepatocytes emerge as the oval cells differentiate. After 21 days the he patic microarchitectur e has returned to normal. Magnification 20X. Interestingly, Petersen et. al has also shown that a percen tage of oval cells may actually arise from an extra-hepatic source within the bone marrow.65 Several other investigators have confirmed that bone marrow derived cells possess the ability to produce functioning hepatocytes and bile ductular cells. 69,70,113These recent findings have clouded th e clarity as to the origin of oval cells. Although numerous studie s suggest that the oval cells reside somewhere within the NRL Day 5 Day 7 Day 9 Day 11 Day 13 Day 17 Day 21 Day 15 Day 3 Day 0 Day 9 40X

PAGE 39

39 hepatic architecture in close asso ciation with bile duct epitheliu m, the exact oval cell niche has yet to be discovered. Figure 2-8. Drawing of potential end points of oval cell different iation. Hepatic progenitors may reside in an extrahepatic site or within the Canal of Hering in the portal regions. Oval cells can differentiate into cells of he patic, pancreatic, inte stinal, and neuronal lineages and they have been im plicated in hepatic cancers. 2.3.1.2 Oval cell plasticity Figure 2-8 represents a schematic diagram of the endpoints and potential endpoints of oval cells according to a review by Lowe s et al (2003) and work by Deng et. al .114,115 The hypothesis that oval cells differentia te into hepatocytes is certainly not a novel idea, having been proposed as early as 1937 by Kinosita et al .116 Through the years several i nvestigators have provided HCC or CCC Biliary Epithelium Intestine Pancreas Neural Cells Canal of Herin g He p atoc y tes Basophilic Hepatocytes He p atic Pro g enitor Cells Thy1+, ckit+ CD34 Oval Cells

PAGE 40

40 evidence to substantiate this thought to varying degrees.117-121 The unpredictable success of these earlier studies in demonstrating oval cells differentiating into hepa tocytes and bile ductular cells results from the complex problems posed by bot h the heterogeneous starting population of oval cells used in transplantation st udies together with kinetic co mplexities inherent with tracing tagged DNA. Additionally, the limited types of re agents utilized by thes e earlier studies may have affected the results obtaine d. However, it is generally accep ted that oval cells possess the ability to become both hepatocy tes and bile ductular cells. Scientists have found that HSCs obtained fr om adult peripheral blood retain a tremendous developmental plasticity. Environment has become a key factor in determining the developmental proclivity of a stem cell. HSCs have been shown to give rise to the oval cells and within the liver, oval cells retain many hemato poietic stem cell markers including Sca-1 (mouse) and Thy-1 (rat) but gain expression of liver specific markers such as AFP.77,88,89,122 Taken together these data suggest that either these HSCs and oval cells share a common developmental origin or they are both derived directly from the same stem cell. Regardless of origin, all stem cells execute their developmental program by regulating gene expression. Determining whic h signals internal or extern al that induce differentiation, maintenance of pluripotentiality, or self renewa l could prove very therapeutically relevant. Understanding both an oval cells po tential plasticity as well as the control of that plasticity will lead to a better understanding of th e biology of oval ce ll as a whole. 2.3.1.3 Oval cells in therapeutics With the increasing interest in characterizi ng oval cells with respect to their origin, questions arise regarding the mech anism of their recruitment and their differentiation potential. Investigators hope that some day these cells can be used therapeutically in the restoration of

PAGE 41

41 human livers damaged by chemicals and infectio us disease, as well as inherited metabolic disorders. Two distinct obstacles must be overcome for oval cells to be considered for clinical application. Maintenance of oval cel ls in an undifferentiated state in culture has su rfaced as the first major hurdle. Developing this technique is critical, because any therapeutic use of these cells will require the expansion of a small population of cells ex vivo prior to transplantation. The second impediment has been selectively dir ecting the differentiation of oval cells down a hepatocyte or bile duct epithelial committed pathways as needed. It is anticipated that the signals mediating these differentiation proc esses will be sufficiently comp licated as to disallow their exact replication in vitro Factors governing oval cell differen tiation may include contact with other cell types, contact with the ECM, or expos ure to soluble signaling proteins in the serum such as the Wnt family of proteins. To circum vent the need for overcoming this second hurdle, cells could be transplanted in their precursor fo rm and the natural microenvironment of the liver used to dictate their differentiation, but this theory has yet to be validated. 2.4 Stem Cells and Cancer 2.4.1 Theories of Cancer Development 2.4.1.1 Cellular origins of cancer To accurately determine the cellular origin of any cancer, one must identify the individual cell type that initiates the cascade of events u ltimately resulting in tumor development. The linear progression from that in itial cell through the multistep process of tumor initiation, promotion, and progression must be clearly defined. The use of phenotypic cellular markers to indicate distinct cellular origins of a cancer has proven highly unreliable due to cellular variations present during routine cellular pro cesses, chemical exposure and other stresses.

PAGE 42

42 Although certain cell types consiste ntly exhibit specific cellular markers, the presence of those markers is not definitive of a cells origin or differentiation potential. The similar histologic appear ance and growth characterist ics linking embryonic tissues and cancer have led the pioneers of pa thology to conceptuali ze a stem cell origin of cancer. Research linking the resident organ specific stem cells and the development of cancer has been observed in numerous malignancies in the skin, liver, as well exocrine glands such as breast and prostate, and the hematopoietic system. Regardless of their or igin, transformation of cells to a malignant phenotype requires a series of epigen etic changes and genetic mutations. 2.4.1.2 Stem cell theory of cancer In the late 1800s, Conheim and Durante hypothesized that cancer developed from rudimentary embryonic tissues present in mature organs.123 These tissues resulted from excessive proliferation of embryonic tissue that lay dor mant in mature organs and later underwent oncogenesis. This theory became known as the embryonal rest hypothesis.123 Later, the theory of anaplasia based on the dedifferentiation of mature tissues induced by chemical or viral exposure replaced the embryonal rest theory.123 The most recent theory of carcinogenesis involves the maturation arrest of resident tissue stem cells. The more primitive arrested stem cell results in a tumor with a less differentiated phenotype.123 Currently, the scientific community hotly debates whether the dediffe rentiation theory or the matura tion arrest theory correctly defines neoplastic development. 2.4.2 Oval Cells and Liver Cancers 2.4.2.1 History of oval cell theory of hepatic carcinogenesis The liver should be viewed as an organ that contains two distin ct cellular pools: the unipotential hepatocytes and the multipotential oval stem cell. Tumors may arise by either the dedifferentiation of an adult mature hepatocyte or by the maturation arrest of a liver stem cell.

PAGE 43

43 The immature state of a stem cell does impl y an increased potentia l for self-renewal and differentiation, and the ability to undergo numer ous and rapid divisions indicates a higher likelihood of DNA damage and malignant transf ormation in the presence of a carcinogen. Conversely, the minute number of oval cells within a normal liver in comparison with the multitudes of hepatocytes causes one to question the theory that only hepatic stem cells are sufficiently damaged during chemi cal carcinogenesis. It seems r easonable to expect that both cellular pools could provide progenitors cells for neoplastic development. As it stands, these two proposed origins of hepatic cancers have support in the literature demonstrating their cell of origin in both HCC and CCC development, and yet the debate still continues. Genesis of liver tumors most likely occurs via multiple molecular mechanisms, which depend on both the nature of the carcinogen and th e lesion it induces. In reality, researchers may never determine that only one cell type can undergo neoplastic change s, but the most longstanding theory of the dedifferen tiation of the hepatocyte has numerous studies behind it. In 1992, Farber stated that rare, original mature he patocytes in all three z ones of the adult liver appear after initiation with genot oxic carcinogens, and he stated th at foci or islands of altered hepatocytes and nodules derived from thes e rare, original mature hepatocytes.124 The concept of the liver stem cell playing a ro le in chemically induced carcinogenesis can be traced back as far as the early 1930s.8 These studies demonstrated that hyperplasia of small round cells in the periportal region of the live r preceded the development of hepatocellular carcinoma.8 The hepatic oval stem cell is currently be lieved to play an essential role in the etiology of liver development, growth, and regene ration, and they are also still being implicated in the progression of hepatocellular carcinogenesis With this premise, the stem cell origin of

PAGE 44

44 liver cancer is either the resident facultative oval stem cell, the progeny of such a cell, or the transitional duct cell.125 2.4.2.2 Evidence for oval cell theory of hepatic cancers In 1956 Farber et. al initially theorized the participation of oval cells in the formation of hepatic cancers due to their morphological changes during early chemical carcinogenesis.117 The exposure of the liver to ethionine, 2-acet ylaminofluorene (2-AAF) and 3-methyl-4dimethylaminoazobenzene (Me-DAB), result in: 1) oval cell proliferation which progressively involved the entire liver lobule, 2) degenerative and hypertrophic ch anges in the hepatocytes next to proliferating oval cells and 3) nodular regenerative hyperplasia of liver cells.117 There were, however, some important differences observed in the three models involv ing the time course of the appearance of oval cells and th e fate of these cells after stimu lation by the chemicals. In the ethionine and 2-AAF models th e oval cells appeared at days 7 and 14 days post-exposure, respectively. In contrast, the Me-DAB model pr oduced oval cells significantly later, 21 days post-exposure. More importantly, the fate of the oval cells in the Me-DAB model was different from those induced by ethionine and 2-AAF. At th e earlier time points oval cells derived from all three models appear similar in morphology. Howeve r, at later time points, areas of apparent transition between oval cells and hepatocytes were more numerous in the Me-DAB animals but almost absent in those animals that received either ethionine or 2-AAF.117 The above observation raises an important issu e. If the morphological transition from oval cell to hepatocyte can be observed after Me-DAB exposure, then the theory that oval cells have the capacity to differentiate into hepatocytes can be verified. The fact that ethionine or 2-AAF did not produce the same results suggests th at the compounds capable of inducing oval cell proliferation may greatly affect both the rate and extent of oval cell differentiation into hepatocytes. That a large percenta ge of oval cells are in the cell cycle during the early stages of

PAGE 45

45 chemical carcinogenesis indicates th ese cells have the capacity to di fferentiate into hepatocytes. This suggests that at least a per centage of HCCs can be derived from an oval cell lineage. Also CCCs are thought to be derived from a bile ductular t ype of stem cell that ha s lost the capacity to generate hepatocytes. Interestingly, there has been increasing experi mental evidence to support of the notion of stem cell derived HCC. Hixson and colleagues employed a battery of monoclonal antibodies specific for antigens associated with bile duct ce lls, oval cells, and fetal, adult and neoplastic hepatocytes to analy ze the phenotypic relationship between oval cells, foci, nodules and HCC during chemical hepatocarcinogenesis.102 They determined that oval cells, -GT-positive hepatocellular foci, persistent hepatocyte nodules and primary HCCs all express both oval cell and hepatocyte antigens, suggesting a precurs or-product relationship between oval cells and carcinomas. Similar results we re obtained by Dunsford et al. (1989) using different monoclonal antibodies raised against oval cells.126,127 These lineage relationships between oval cells and HCC also exist in other models of liver carcinogenesis. For example, animals on a choline deficient diet supplemented with ethionine (C DE) diet display markers for oval cells in a significant percentage of nodules and HCC.102 Evidence for oval or ductal cells as progenitors for HCC is not restri cted to experimental rodent models of chemical hepatocar cinogenesis. Results from Van Eyken et al. (1988) on CK expression in 34 classical human HCCs usi ng monospecific anti-cyt okeratin antibodies showed that all HCCs were positive for CK-8 and CK-18.128 However, in 17 cases, a variable number of tumor cells were positive for CK-7 and CK-19, both known to be bile ductular epithelium markers.128 The authors also reported that on ly 3 of 11 well-differentiated tumors displayed this unexpected pattern of imm uno-reactivity as opposed to 7 out of 7 poorly

PAGE 46

46 differentiated tumors.128 This is important in light of ear lier findings by Denk et al. (1982) that CKs continue to be expressed when hepatocytes become neoplastic.129 These observations become particularly significant in light of Hsia et al (1992) and Vandersteenhoven et al (1990) who demonstrated immunohistochemically the presen ce of oval type cells with characteristics of both bile ducts and hepatocytes in the liver of patients with end st age cirrhosis and/or tumors in patients with hepatitis B infection.130,131 Although this molecular evidence does suggest that these tumors are derived from the oval cell compartment, they do not eliminate the possibility that these tumors developed via de differentiation of hepatocytes. A recent paper documented evidence of oval cells and/or rat liver epithelial (RLE) cells capable of progressing to HCC and CCC from the in vitro transformation of these cell types. Spontaneous transformation of R LE or transformation of oval cel ls with chemical carcinogens resulted in the tumors displaying a wide range of phenotypes incl uding well-differentiated HCCs, CCCs, hepatoblastomas and poorly differentiated or anaplastic tumors.132-134 While these findings are interesting from the point of vi ew of what might happe n, theoretically, these in vitro studies have been of limited value in clarifying what really happens in vivo To date, no reported study on in vitro neoplastic transformation of oval cells has been able to match up, step-by-step with what occurs in vivo with the exception of morphol ogic and immunohistochemical similarities between these in vitro tumors and some in vivo cancers. As stated earlier, cancer may arise from the phenotypic change in a rare cell, both in vivo and in vitro but it becomes almost impossible in vivo to identify the cell of origin. Currently, there is no direct evidence that any cell t ype among the hepatocytes, proliferating ductal epithe lial cells and/or oval cells is the cell of origin for foci, nodules and HCC or CCC development. Thus the basis fo r oval cell participation in hepatic cancer

PAGE 47

47 development is all circumstantial, speculative and indirect, albeit st rong, it is still not conclusive. Within these complex animal carcinogenesis m odels, conclusions concer ning whether original hepatocytes, altered hepa tocytes, or proliferating oval cells are the likely cells of origin for evolution to cancer has not been feasible to date. 2.5 Wnt Family of Proteins 2.5.1 Wnt Pathway 2.5.1.1 History of the Wnt pathway The Wnt family of highly conserved grow th factors has an active role in the in vivo regulation of developmental and homeostatic pro cesses across the animal kingdom. Interestingly, membership within this class of proteins is not based on functionality but instead relies on amino acid sequence homology. This method of classificati on has created a large group of proteins with various functions associated w ith often contradictory activitie s and numerous mechanisms of downstream signaling. The implied involvement of Wnt pathways in a wide variety of developmental events as well as numerous human diseases ranging from deformities to cancer has caused a drastic increase in the interest in unraveling the actions of this complex protein family. Wnt protein sequences are highl y conserved across species and there are a large number of proteins included in the family. Mammals have 19 Wnt genes which can be classified into twelve distinct subfamilies.135 Of these twelve subfamilies, eleven are found in the Cnidarian genome. The family of Wnt receptors, proteins known as Frizzled, also has a large number of members (10) which are also highl y conserved across species.135 This cross phylum conservation of these gene families indicates the developmental role of Wnts was initiated over 650 million years ago and very early in the evolution of metazoans.135

PAGE 48

48 2.5.1.2 Wnt proteins and signaling The Wnt proteins are characterized by a highly conserved series of cy steine residues, and although they have an N-terminal signaling sequence, they are highly insoluble. This insolubility has been one of the most difficult obstacles to the understanding of c oncentration dependent morphogenic nature of the Wnt proteins. Discover ing the palmitolated state of Wnt3a by Willert et. al alleviated some of the problems associated with their notoriously difficult purification.136 The discovery of this lipid modification resulted in the first ever isolation of a biologically active form of a Wnt protein. The palm itolation occurs exclusively on the highly conserved cyteine residues and facilitate secretion of the protein and probably the fo rmation of the gradients that determine the morphogenic activ ity of the Wnt proteins.137 The Wnt family has several downstream signaling pathways including the Wnt/ -catenin cascade, the noncanonical planar ce ll polarity pathway, and the Wnt/Ca++ pathway; however, the majority of research has focused on the -catenin dependent signaling cascade. Although the Wnt1 gene (initially termed int-1) was init ially discovered in 1982 by Nusse and Varmus, the link between Wnt and -catenin was not discovered for nearly ten years when Wnt-1 was definitively shown to regulate cell adhesion -catenin levels.138,139 Since that time the signaling pathway that is termed the canonical pathway has been fairly well defined. In cells not exposed to Wnt, -catenin is phosphorylated by Axin and GSK-3 within the destruction complex. This phosphorylation signals -catenin for ubiquination and degradation. Concurrently, Wnt target genes are repressed by the association of TC F with Groucho. While complexed with Groucho, TCF activ ates the transcription of gene s not regulated by the canonical Wnt pathway and represses the acti vation of Wnt responsive genes. The canonical Wnt signaling pathway begins with Wnt binding to its receptor Frizzled and the coreceptor LRP5/6. This binding allows fo r the phosphorylation of LRP and the recruitment

PAGE 49

49 of Axin from the destruction complex to the me mbrane. Disheveled (Dsh) is also phosphorylated by an unknown mechanism. The removal of Axin and the phosphorylation of Dsh inhibit the function of the destruction complex which results in a cytoplasmic accumulation of -catenin. Whether actively transported or simply due to excess cytoplasmic -catenin concentration, catenin translocates to the nucleus and repla ces Groucho in order to associate with TCF. catenin in complex with TCF acts as a transcriptional activator for Wnt responsive genes. Figure 2-9 is a diagrammatic representation of the canonical Wnt signaling pathway. 2.5.2 Functions of the Wnt Family 2.5.2.1 Role of Wnt in differentiation and development The Wnt family of proteins and their in de pth canonical signaling pathway (Figure 2-9) has been implicated in a variety of regulator y aspects of cellular differentiation and embryonic development.135,140,141 This family been described as a requirment for differentiation and development of the brain, cartilage, mesenchyma l tissues arising from somites, and limb bud formation.142-151 Individual Wnt proteins and their downs tream signals are also instrumental in the directing the differen tiation of progenitor cells.136,149,152 It should be noted that some of these studies illustrate a Wnt involve d in the differentiation of prog enitors, while others implicate different Wnt family members responsible for th e maintenance of progenitors undifferentiated state.136,152-154 The best example of Wnt control on differe ntiation was exhibited by Weismanns lab at Stanford. He demonstrated Wnt si gnaling resulted in the expansi on of hematopoietic stem cells (HSCs) that lacked discernable lineage specific markers, and when transplanted these cells generated B, T, and myeloid cells.154 This pioneering paper, demons trated Wnts role in inducing a stem cells self-renewal without altering the stem cells original lineage potential. Wnt has also been acknowledged as being responsible for the expansion of progenitors possessing predefined

PAGE 50

50 fates such as the self-renewing crypts of the intes tine, cardiac neural cres t cells, and cells of the anterior pituitary.155-157 Figure 2-9. Representation of the cononical Wn t pathway. A. In the absence of Wnt, -catenin is dually phosphorylated by GSK-3 and Axin within the destruction complex. This phosphorylation initiates the ubiqu itination and degradation of -catenin. B. When Wnt binds to Frizzled and its co-recept or LRP5/6, LRP is phosphorylated which draws Axin to the membrane and away from the destruction complex. Disheveld (Dsh) is also activated in an unknown manner and facili tates the phosphorylation of GSK-3 Phosphorylated GSK-3 cannot phosphorylated -catenin. The unphosphorylated and, theref ore, unubiquitinated -catenin accumulates in the cytoplasm and is shuttled into the nucleus. Within the nucleus, -catenin displaces Groucho from its complex with TCF, there by, changing TCF from a repressor into an activator of Wnt responsive genes. 2.5.2.2 Wnt family and disease Although no documentation of any mutation or amplification of genes encoding Wnt ligands or receptors has been linked to human cancer to date, several components of the Wnt pathway have been implicated in carcinogenesi s, especially TCF, APC and beta-catenin.158 The member of the destruction complex known as adenomatous polyposis coli (APC) was first discovered as the tumor suppressor that undergoes a loss of function in Familial adenomatous polyposis (FAP) and >80% spor adic colorectal cancer.159 Mutations in other downstream signals within the Wnt pathway have been specifically connected to the formation of HCC, CCC, A. AP C Axin GSK 3 D s h Fz d LRP Groucho -cat T C F AP C Axin -cat T C F GSK 3 Fz d LRP W nt B. Groucho Dsh Ubiquitin

PAGE 51

51 sporadic medulloblastomas, and esophageal squamous cell cancinomas.159 Cancers containing mutations resulting in the disr egulation of the downstream Wn t signaling molecules include cancers of the colon, liver, breast, prostate, and brain.158 The various functions of the Wnt proteins, their receptors, and dow nstream signals can readily be seen in the variety of human diseas es linked to these genes. A large portion of the diseases are associated with bone and conn ective tissue morphogenesis and include Familial tooth agenesis, osteoporosi s pseudoglioma syndrome, a nd Dupuytren skin disease.159 Interestingly, a homozygous mutation in the human Wnt3 gene results in the drastic phenotype of tetra-amelia.159,160 This single mutation indicates the inte nse developmental requirement of the Wnt proteins in limb bud formation. Neurologic re quirements for Wnts are more generalized as they have been implicated in Al zheimer's disease and schizophrenia.159 Within the heart, Frizzled receptors have been implicated in cardiac hyp ertrophy and myocardial infarctions. Lastly, Wnt4 mutations result in Mullerian-duct regression and virilization, an intersex phenotype, and errors in kidney development.159 The vast actions of this family and its cross species developmental requirements can readily be observed in the vari ous human diseases directly linked to Wnt and its downstream signals. 2.5.3 Wnts and the Liver 2.5.3.1 Wnts and liver regeneration The Wnt family has strong ties to the pr ocess of regeneration. Wnt knockouts inhibit regeneration of limbs.151,160 Mutations in Wnt3 result in a complete failure in limb bud formation. Also, the evident rise in Wnt and its downstream signals immediately following partial PHx deeply implies the involvement of Wnt in the regenerative processes of the liver.161 Through the study the expression of Wnt and its downstream mediators throughout oval cell

PAGE 52

52 differentiation along the hepatic lineage as well as during the oval cell re sponse to injury, the role of the Wnt family in the liver can be fully elucidated. 2.5.3.2 Wnts and liver development and liver zonation -catenin has a dual role in re gulating hepatocyte adherens junctions and transcription of Wnt regulated genes. The regulation of -catenin by both the Wnt family and the HGF have been implicated in the control of hepatocyte division and liver growth.162 Mice that over express catenin have a three to four fold increase in hepatic size due to increased hepatocyte proliferation.163,164 This clearly indicates the dramatic role -catenin has in liver growth and development. Also changes in APC levels ac ross the liver functional lobule have been recognized as contributing to the zonation of th e lobule. APC levels are high in pericentral hepatocyte which correlat es to low levels of -catenin activation.165,166 Conversely, in periportal hepatocytes, -catenin activation is high whereas AP C levels are low. Knocking out APC resulted in Zone 3 hepatocytes with gene e xpression profiles similar to those of Zone 1.165 Clearly Wnt signaling has critical roles within the liver. 2.5.3.3 Wnts and liver diseases Although Wnt family members are not as clearly associated with liver diseases as their down stream signals, these signa ling molecules have severe im plications in liver disease processes. Most significant are the roles that these molecules pl ay in liver tumors both benign and cancerous. Nuclear localization of -catenin has been reported in 90-100% of hepatoblastomas and a significant but sm all percentage of hepatic adenomas.162 Also interesting was that in those adenomas that had nuclear translocation of -catenin, 46% progressed to HCC. -catenin translocation is present in a very high percentage of HCC.162 Although the mechanisms controlling that translocation var y, the influence of the Wnt signali ng cascade is very apparent in HCC development.162 Lastly, within CCC, a decrease in adherens -catenin and E-cadherin in

PAGE 53

53 conjunction with nuclear -catenin localization has been observed. Although no mutations in Wnt genes have been found in tumors, their down stream molecules are actively implicated in carcinogenesis and other disease processes, therefore, understanding the role Wnt family members have in normal tissues can greatly incr ease our understanding of disease processes.

PAGE 54

54 CHAPTER 3 SPECIFIC AIMS In 1956 E. Farber recognized the same cell type appearing in the liver after several different chemical injury models. He classified these small cells with high nuclear to cytoplasmic ratios as oval cells. Although debate continues as to the site of origin of these cells, they are universally considered to be the resident hepatic stem cell. Some suggest that oval cells arise in the Canal of Hering; while others believe they arise form an extra hepatic source. In situ oval cells are bipotential in nature. When they are pr esent in the liver they differentiate toward both hepatic and bile ductular epithelial lineages. The Wnt family of secreted proteins cont rols various differen tiation pathways during numerous stages of embryogenesis, including hepa tic development. Wnts have been shown to maintain stem cells in an undifferentiated state wh ile increasing self renewal, and they have been shown to direct progenitor diffe rentiation. They have also been implicated in hepatocyte based liver regeneration after partial hepatectom y. With known Wnt involvement in hepatic organogenesis and regeneration, inve stigating the role of this fa mily during stem cell directed liver regeneration seemed logical. Based upon the involvement of Wnt family members in hepatic organogenesis, it is hypothesized that Wnt1 is a critical molecule required for the differe ntiation of oval cells toward mature hepatocytes In order to test this hypothesis, two specific aims were designed. They are as follows: Specific Aim #1: To determine if the Wnt signaling pa thway plays a role in hepatic stem cell based liver regeneration Specific Aim #2: To determine whether Wnt1 is re quired for directing oval cells to differentiate toward hepatic lineage dur ing stem cell based liver regeneration.

PAGE 55

55 Specific Aim #1: To fully understand the signals whic h direct oval cell differentiation the 2AAF/PHx model was employed. Briefly, animals r eceived an implant of a 28 day time release 2AAF pellet. Hepatocytes are inhibited from th eir normal replication by 2AAF. Seven days after 2AAF implantation animals underwent a partial hepatectomy. As early as 3 days after partial hepatectomy oval cells begin to migrate out fr om the portal region and infiltrate the hepatic lobule, radiating toward the centr al vein. Oval cell numbers peak at approximately 9 days after partial hepatectomy. Oval cells begin to differe ntiate into basophilic small hepatocytes roughly 13 days post PHx. By 21 days after PHx the liver has regained its normal architecture and little evidence of the oval cell infiltrate remains. Initially, livers obtained from the peak of oval cell production were analyzed for the presence of members of the Wnt signaling path way. Immunohistochemistry was performed for the Wnt receptors Frizzled numbers 7 and 5; Friz zled related protein 1 (Frp1), a known inhibitor of the Wnt pathway; low density lipoprotein recep tor-related protein 5 (LRP5), the coreceptor for Wnt; three individual Wnts (Wnt5a, Wnt3, and Wnt1), and the downstream signaling molecule -catenin. After determining that the Wnt path way was activated during oval cell induction, western blot, rt-PCR and IHC were utilized to asses the pattern of Wn t activation throughout the 2AAF/PHx model. Cells isolated from perfused livers were separated by density with a Nycodenz fractionation gradient. The resulti ng four fractions contained immune cells and stellate cells (F1), oval cells (F2), small hepatocytes and Kupffer ce lls (F3) and hepatocytes (F4). Isolated cell fractions from normal liver and the peak of ova l cell proliferation were compared for Wnt1 levels and -catenin levels. As an indicator of active Wnt signali ng, changes in the phosphorylation status of -catenin were also examined.

PAGE 56

56 The observation that hepatocytes expressed hi gh levels of Wnt proteins and oval cells demonstrated evidence of -catenin translocation and decrea sed phosphorylation levels indicated an active response to Wnt signaling by oval ce lls. This response was further evaluated by exposing a hepatic stem cell line, designated WB-F344, to purified Wnt3a protein. After 48 hours of incubation with Wnt3a, -catenin translocation was visualized. Specific Aim #2: The in vitro protein and RNA data supported a role for the Wnt pathway in oval cell based liver regeneration, however, as no definitive link between Wnt1 and oval cell differentiation had been establishe d, a short hairpin Wnt1 siRNA c onstruct was designed. To test the efficiency of the shRNA construct to knockdo wn Wnt1 protein levels, stably transfected PC12/Wnt1 cells were transiently transfected with Wnt1 or scrambled (SCR) shRNA vectors containing green fluorescent pr otein (GFP). GFP expression wa s utilized to determine transfection efficiencies. Wnt1 levels were then assessed by western blot. The construct was deemed successful enough for in vivo knockdown of Wnt1 signaling during oval cell activation. Anim als underwent 2AAF implantati on and PHx. Venous injections of shRNA vectors complexed with the cationic lipid vector JetPEI were performed 3 and 6 days after PHx. Animals were sacrificed at 9, 11, 13, 15, and 21 days after PHx. Tissue was collected for paraffin sections, frozen sectioning, protei n analysis and RNA anal ysis, and liver and body weights measured. GFP expression was evaluated in every organ collected from the animals in order to ascertain the sites of shRNA vector uptake. Histology and morphology of livers were then analyzed for deviations from normal oval cell based liver regeneration. Immunohistochemistry, western blot, and rtPCR were performed to detect changes in Wnt protein le vels as compared to standard 2AAF/PHx animals.

PAGE 57

57 CHAPTER 4 MATERIALS AND METHODS 4.1 Animals Studies The 2-AAF/PHx model was utilized to accura tely assess the activation and fundamental biology of the liver stem cell. This model pr ovided the basis for understanding oval cell biology with respect to growth, proliferation and diffe rentiation, as well as in response to extrinsic interventions. The assessment of oval cell differentiation states in vitro can be informational; however, in vivo evaluation holds greater value in the anal ysis of the liver stem cells inherent functions. To date, no substitute has been found th at adequately replaces an animal model in examining the fate of oval cells. 4.1.1 Animals and Animal Housing Facilities All animals utilized in this study were unde r approved animal protocols submitted to the University of Florida IACUC committee. All animal s utilized in this study were Fisher 344 male rats obtained from Charles Ri ver Laboratories, Inc. (Wilmingt on, MA). Animals were housed in a barrier facility under sterile conditions at the Animal Care Services F acility in the Medical Science/ Communicore Building. The Animal Care Se rvices is a state of th e art animal facility that provides a pathogen-free barrier environmen t. The animal care program is accredited by AAALAC. The facility is supervised by veterinarians, which are always presen t at the facility or on call. Animals are checked several times per da y, and a veterinarian is always available for consultation, particularly if deci sions need to be made regarding euthanizing an animal prior to the sacrifice date. The University of Florida meet s National Institutes of Health standards as set forth in the DHHS publication #NIH 86-23 and accepts as mandatory the PHS Policy on Humane Care and Use of Laboratory Animals by Awardee Institutions and the National Institutes of Health Principles for the Utili zation and Care of Vertebrate Animals Used in

PAGE 58

58 Testing, Research and Training. The University of Florida has on file with the Office for Protection Form Research Risks an approved Assurance of Compliance. 4.1.2 Animal Sacrifice and Tissue Collection All animals utilized for tissu e collection were euthanized by administration of an overdose (150 mg/kg) of Nembutal Sodium Solution ( OVATION Pharmaceuticals, Inc., Deerfield, IL) This is consistent with the recommendations of the panel on euthanasia of the American Veterinary Medical Association and the Guide fo r the Use and Care of Laboratory Animals (U.S. Department of Health and Human Services/NIH Publication #86-23). After euthanasia, tissue from brain, heart, lung, liver, pa ncreas, spleen, kidney, and intestine was collected for paraffin embeddi ng, frozen sectioning, and RNA and protein collection. Samples for protein and RNA were snap frozen in a histobath containing 2methylbutane and kept at -80 C until isolation was performed. Tissues for paraffin embedding were fixed O/N in 10% Neutral Buffered Forma lin (Richard-Allan Scientific, Kalamazoo, MI). The formalin was then exchanged for PBS and the tissue submitted for embedding by the University of Florida Molecular Pathology Core F acility. Tissue collected for frozen sectioning was immediately placed in Tissue-Tek O.C. T. Compound (Sakura Finetek U.S.A., Inc., Torrance, CA), snap frozen in a histobath cont aining 2-methylbutane, and stored at -80C until sectioning. All paraffin and frozen sections were cut to a 5 m thickness. 4.1.3 Oval Cell Induction in the Rat 4.1.3.1 2-AAF pellet implantation Continuous administration of 2-AAF was used to suppress proliferation of mature hepatocytes prior to partial hepatectomy. Utilizat ion of a 2-AAF time release pellet alleviated undue stress to the animals associated with mu ltiple 2-AAF oral gavage and reduced the amount of human exposure to the 2-AAF.

PAGE 59

59 Briefly, the animals were anesthetized with isoflorane. The abdomen was shaved and scrubbed three times in a circular pattern eman ating from the center outward with ethanol and three times with Betadine (Purdue Pharma L.P. Stamford, CT). The animal was then draped with a Steri-Drape (3M, St. Paul, MN) with only the incision site exposed. Then a very small, approximately 1/4 inch, incision was made in th e lower right quadrant of the animals abdomen. A midline incision would not suffice because the pelle t must be placed distal to the liver in order to prevent adherence of the pellet to the body of the liver. The fibr osis associated with adherence would complicate the subseque nt partial hepatectomy. After opening the abdominal wall, a small inci sion was made within the abdominal muscle to facilitate entry to the pe ritoneal cavity. A 70 mg/28 day release (2.5 mg/day) 2-AAF time release pellet (Innova tive Research Inc., Sarasota, Fl) wa s carefully introduced through the incision into the peritoneal cavity. The muscle tis sue was then closed using 1-2 sutures of 3-0 Vicryl (Ethicon, Inc., Cornelia, GA). The skin was closed with the Autoclip Wound Closing System (Braintree Scientific, Inc., Braintree, MA). Rats were then placed in a warmed cage and monitored for complete recovery. This procedure yielded a survival rate of greater than 95%. Figure 4-1. Oval cell induction in the rat. Diagrammatic representation of oval cell induction model in the rat including 2-AAF pellet implantation, partial hepatectomy, and dates of sacrifice. In successful procedures, hypothermia and dehyd ration were not an issue during recovery, and in the event of excessive blood loss during su rgery, animals were injected i.p. with 1-3ml 2-AAF 2/3 PHx Day -7 3 0 5 7 9 11 13 15 17 19 21 = Date of Sacrifice

PAGE 60

60 sterile saline. The animals were checked every six hours until fully recovered. The stainless steel staples were removed after 10 days. 4.1.3.2 Two-thirds partial hepatectomy The removal of 66% of the liver was orig inally described by Higgins and Anderson.8 Figure 4-1 represents a diagrammatic representa tion of the 2-AAF/PHx oval cell induction model in the rat. The animals were an esthetized with isoflorane. The abdomen was shaved and scrubbed three times in a circular pattern emanating from the center outward with ethanol and three times with Betadine (Purdue Pharma L.P.). The animal was then draped with a Steri-Drape (3M) with only the incision site exposed. A 1.5 cm longitudina l incision was made in the skin just below the xyphoid process. The incision was continued through the midline of the abdominal muscle, exposing the liver. The tip of the xyphoid process wa s excised to facilitate removal of the liver and limit liver injury during extrusio n. Next the left medial, right me dial and the left lobe of the liver were gently extruded thr ough the incision. The lobes were then tied off with a silk suture. The exposed lobes were excised and the remainin g stump examined for excessive bleeding prior replacement within the peritoneal cavity. Bleeding from the stum p indicated incorrect tying off of the excised lobes. If bleed ing occurred and was unable to be controlled the animal was euthanized. The muscle tissue was then closed us ing 4-5 sutures of 3-0 Vicryl (Ethicon, Inc.). The skin was closed with the Autoclip Wound Clos ing System (Braintree Scientific, Inc.). The stainless steel staples were removed after 10 days Rats were then placed in a warmed cage and monitored for complete recovery. This procedure yielded a survival rate of gr eater than 90%. The 10% death rate was usually associated with the aforementioned bleeding from the incorrectly tied liver stump. The difficult in obtaining the correct the tension on the ligati ng suture should be noted. A ligature tied too tightly causes the liver proximal to the knot to tear and this situation is practically impossible to

PAGE 61

61 resolve. Conversely, insufficient tension on the li gature results in the inability to staunch the blood flow to the stump and subsequent bleeding. In successful procedures, hypothermia and dehyd ration were not an issue during recovery. In the event that any blood was lost during surgery, animals were injected i.p. with 1-3ml sterile saline. The animals were checked every six hours until fully recovered. The stainless steel staples were removed after 10 days. Animals were sa crificed at days 3, 5, 7, 9, 11, 13, 15, 17, and 21 days post-PHx. Tissue collected was analyzed by IHC, rtPCR, and western blot. 4.1.4 Density-Based Separation of the Liver 4.1.4.1 Perfusion of the liver In order to isolate intact he patocytes and oval cells from th e whole liver a perfusion was performed. Following an i.p. injection of 60 mg/ kg sodium pentobarbital, complete anesthesia was determined by pinching the back feet and absence of a leg and/or abdominal muscle contraction. The animals four a ppendages were then secured to th e surgical table with tape. The abdomen was shaved and then sterilized with 95% ethanol. A midline incision was made to expose the peritoneum. The incision was then expa nded laterally distal to the ribcage as well as proximal to the iliac crest. These lateral incisions create abdominal flaps that can then be secured to the table and creates greater access to the abdominal organs The abdominal viscera were displaced toward the rats lower right quadrant in order to expose the in ferior vena cava. The inferior vena cava was cannulated with a 20 gaug e catheter and the hepati c artery ligated. The thoracic cavity was then opened, and the superior vena cava occl uded with a hemostat. The liver was then perfused with 1X S and M solution followed by an 80mg of collagenase in 1X CaCl2 modified 1X S and M. The entire liver was then harvested and placed in 1X PBS for subsequent oval cell and hepatocyte isolation. The procedure resulted in the complete exsanguination of the animal.

PAGE 62

62 4.1.4.2 Density gradient sepa ration of liver cells The suspension was f iltered through a 125 m nylon mesh and centrifuged at 500 rpm for 5min to pellet the majority of hepatocytes. Two Nycodenz stock solutions at 30% (wt./vol.) were prepared, one with cyanol FF, one without. The stock solutions were subsequently serially diluted to 26, 19 (blue), 15 and 13% (blue) in 1X PBS (Gibco) and sequentially layered (volume of 1.5ml each). The cells of the pellet were resuspended in 11% Nycodenz solution and loaded on the top of the gradient. Centrifugation was th en performed at 8,000 g for 30min. Cells were located at the four gradient inte rphases F1-4 starting at the top. Fr action 1 contained stellate cells and immunologic cells. Fraction 2 contained mostly oval cells. Fraction 3 was small hepatocytes and Kupfer cells. The final fracti on contains mature hepatocytes. Cells from the interphases were collected and finally washed in 1X PBS and then utilized for protein or RNA isolation. 4.2 Liver Stem Cell Response to Wnt 4.2.1 In vitro Response of Rat Liver Epithelial cells to Wnt3A In order to verify that oval cells do respond to Wnt signali ng, WB-F344 a rat liver epithelial cell was exposed to Wn t3a. WB-F344 cells were derived from the liver of an adult Fisher 344 rat.167 WB-F344 cells are considered to be liver stem cell like and are accepted as a substitute for primary oval cell culture as ova l cells are notoriously difficult to grow in culture.167-173 4.2.1.1 Maintenance of liver stem-like cells, WB-F344 WB-F344 cells were graciously provided by L ijun Yang, M.D. The cells were maintained in DMEM (GIBCO) media containing 10% fetal bovine serum, 10 I.U. Penicillin/ml, and 10g/ml Streptomycin in a 37C humidified incubator containing 5% CO2 and 95% air, and passaged using 0.25% trypsin plus 0.02% EDTA treatment. The culture medium was changed every other day.

PAGE 63

63 4.2.1.2 Exposure of liver stem-like cells to Wnt3A WB-F344 cells were plated at approximatel y 20-25% confluency on collagen coated coverslips within a 6 well dish. 24 hours after plating, the media was replaced with 1.0ml of media supplemented with 250ng/ml Wnt3A (R and D Systems,minneapolis, MN). 48 hours after exposure to Wnt3A, the media was removed and th e cells washed twice with 1X PBS. The cells were then fixed with ice cold methanol for 10min. Immunofluorescence staining for -catenin was performed as described below to determine the response of rat liver epithelial cells to Wnt3a exposure. 4.3 Wnt shRNA Model in Rat In order to confirm that oval cells require Wnt signaling in order to differentiate into hepatocytes, Wnt1 protein e xpression was inhibited with shRNA technology. Transiently blocking the production of Wnt1 RNA effectively impeded Wnt1 protein production. Due to the lack of Wnt1 stimulation, oval cells could not diffe rentiate toward a hepatic lineage. As a result, oval cells underwent atypi cal ductular hyperplasia. 4.3.1 Wnt shRNA Plasmid 4.3.1.1 Design of Wnt shRNA vector A shRNA hairpin to the rat Wnt gene was constructed with shRNA Wizard (InvivoGen, San Diego, CA). A custom-made psiTNA-H1gz-Wnt 1 plasmid was then created by InvivoGen. As a control, a vector containing a scrambled sh RNA construct that is not complimentary to any known gene was utilized. The vector contained a 21nt sequence incorporated into a hairpin with a 7nt spacer region. Once the shRNA was tran scribed in a mammalian cell, the hairpin was cleaved resulting in a 21bp doubl e stranded RNA that served to bind to and knockdown the production of the Wnt mRNA th rough the dicer pathway.

PAGE 64

64 Figure 4-2. shRNA hairpin struct ures. Diagram of the (A) Wnt1 and (B) SCR shRNA hairpins. The shRNA hairpin construct was under the cont rol of the H1 promoter. The H1 promoter drove the expression of the unique gene enc oding the H1 RNA, the RNA component of the human RNase P complex. The pshRNA vector also contained a CMV-HTLV promoter controlling the expression of a GFP::zeo fusion gene. The GFP::zeo fusion gene produced the GFP protein and Zeocin resistance in mammalian cells. A bacterial origin of replication and EC2K promoter allowed E. coli to produce the vector and expre ss Zeocin resistance. Lastly, the -Glo pAN site within the vector contained th e human beta-globin 3 untranslated region and polyadenylation sequence which allows for su fficient arrest of the GFP::zeo transgene transcription. Figure 4-2 is a diagrammatic repr esentation of the Wnt1 and SCR shRNA hairpins. Figure 4-3 is a diagrammatic representation of the pshRNA-Wn t1 vector. Figure 4-4 is the sequence of the pshRNA-Wnt1 vector and the releva nt restriction enzyme sites, gene sites, and orientations of open reading frames. 4.3.1.2 Wnt shRNA plasmid amplification The lyophilized pshRNA vector was resuspended in 20 l of molecular grade H2O to obtain a plasmid solution at 1 g/ l. The pshRNA vector was transformed into LyComp GT116 E. coli (InvivoGen). GT116 is a strain that contains a sbcCD deletion mutant that helps the bacteria to better handle hairpin DNA structures than other strains of E. coli. A vial of GT116 was thawed on stored on ice for 5min and then reconstituted with 1ml of reconstitution solution on ice for 5min. The cells were rehydrated for 30min on ice. Then 1 l of 1 g/ l pshRNA was incubated with 100 l of GT116 cells on ice for 30min. The cells were then heat shocked at 42C A. B.

PAGE 65

65 for 30 sec and placed on ice for 2min. 900 l of SOC medium was then added and the tubes shaken at 250 rpm for 1hr at 37 C. The cells were then spread on Fast-Media Zeo (InvivoGen) agar plates and incubated O/N at 37C. Figure 4-3. Map of the ps hRNA-H1-gz-Wnt1 vector. Colonies were then chosen and grown in vol umes of 5ml of Low salt LB (10.0g Tryptone, 5.0g NaCl, 5.0g Yeast Extract) supplemented with 50 g/ml Zeocin (Invitrogen, Carlsbad, CA). Plasmids were isolated from the 5ml cultures wi th QIAprep Spinminiprep Kit (Qiagen, Valencia, CA) as per manufacturers specif ications. Larger quantities of plasmid were obtained with the with QIAGEN Plasmid Maxi Kit (Qiagen) fr om 1L low salt LB supplemented with 50 g/ml Zeocin (Invitrogen) cultures of transformed bacteria.

PAGE 66

66 Figure 4-4. The sequence and relevant restrict ion enzyme sites of the pshRNA-H1-gz-Wnt1 vector.

PAGE 67

67 4.3.1.3 Wnt1 shRNA plasmid analysis The presence of plasmids isolated fro m cultures was analyzed by agarose gel electrophoresis. A 30ml mini gel containing 0.7% (w /v) agarose in 0.5X TBE and was heated to dissolve the agarose, and then 0.001% (v/v) ethidium bromide was added. The gel was then allowed to cool in a gel pouring apparatus a nd a comb with appropria tely sized wells was inserted. After hardening, the comb was removed and the gel submerged in 0.5 X TBE in a gel electrophoresis chamber. 0.5 l of 10X Agarose gel loading buffer and 3.5 l of Mill-Q H2O was added to 1 l of each sample and each sample was loaded into the wells along with an appropriate molecular weight ladder (1 Kb, 100 bp, etc.). The gel was then run at 90-110 volts for approximately 1 hr or until desired separation of bands was visible on a UV light box. Pictures of agarose gels were obtained with a Ge lDoc XR (Bio-Rad, Hercules, CA). After 0.7% agarose gel electrophoresis confirmed presence of plasmids, the plasmids were further analyzed by restriction enzyme digestion with AseI (New England Biolabs, Ipswich, MA) as per manufactures recommendations. AseI yielded a linearized 3448 bp plasmid when the shRNA hairpin is present. When absent, AseI digestion of pshRNA yiel ds two bands of 1801 bp and 1647 bp. Also DpnI (NEB) digestion was utili zed to distinguish between the SCRsi vector and the Wnt1si vector. DpnI digestion of Wnt1si vector resulted in 8 bands of the following sizes: 1747 bp, 593 bp, 536 bp, 277 bp, 202 bp, 75 bp, 11 bp, and 8bp. Whereas, the DpnI digestion of the SCRsi vector yielded only 7 bands of the following sizes: 1747 bp, 795 bp, 536 bp, 277 bp, 202 bp, 75 bp, 11 bp, and 8 bp. 4.3.2 Verification of Wnt1 shRNA Function 4.3.2.1 Confirmation of Wnt1 knockdown in PC12/Wnt1 cells Wnt1 stably transfected rat pheochromocyt oma cells (PC12/Wnt1) were graciously donated by G.M. Shackleford, PhD from the Di vision of Hematology-Oncology, The Saban

PAGE 68

68 Research Institute, Childrens Hospital Los Angele s, CA. PC12/Wnt1 cells were grown in Ham's F12K medium with 2mM L-glut amine adjusted to contain 1. 5 g/L sodium bicarbonate, 15% horse serum, 2.5% bovine calf serum, 10 I.U. penicillin/ml, and 10 g/ml streptomycin in a 37 C humidified incubator cont aining 5% CO2 and 95% air, a nd passaged using 0.25% trypsin plus 0.02% EDTA treatment. PC12/Wnt1 cells were grown to 80% confluency in a 6 well dish and transfected with 4.0 g of DNA utilizing Lipofect amine 2000 (Invitrogen) as per manufacturers instruct ions. After 48 hours Wnt1 mRNA and protein levels were analyzed by rtPCR and western blot. 4.3.3 Inhibition of Wnt1 in the Rat 4.3.3.1 In vivo shRNA to Wnt1 Animals underwent 2-AAF implantation and PHx as previously described. 250 g of pshRNA vector was complexed with 20 l of in vivo JetPEI (Polyplus Transfection, NY, NY) as per manufacturers recommendations. 400 l was given via the femoral ve in to each animal in a solution with a final concentration of 5% glucos e. Nine animals received the SCRsi vector and twenty-four received the Wnt1si vector. Animals were sacrificed at days 9, 11, 13, 15, and 21 days post-PHx. Tissue was collected and analyzed by IHC, rtPCR, and we stern blot. Figure 4-5 represents a diagrammatic representati on of the shRNA model in the rat. Figure 4-5. Diagrammatic representation of Wnt shRNA model in the rat including 2-AAF pellet implantation, partial hepatectomy, shRNA injections, and dates of sacrifice. = Date of Sacrifice Da y s shRN 2-AAF 2/3 PHx -7 3 0 5 7 9 11 13 15 17 19 21

PAGE 69

69 4.3.3.2 Femoral injections of shRNA vector All shRNA constructs were delivered via the femoral vein. Briefly, af ter anesthetization by isoflorane, a very small incision was made on th e medial aspect of th e left thigh. Fascia surrounding the femoral vein, artery, and nerve was carefully excised. A standard butterfly catheter infusion set with a 21 ga uge needle was then inserted into the femoral vein. 400 l of the desired solution was then injected. Bleeding was controlled with pressure and the skin closed with a single Autoclip (Braintree Scientific, Inc. ). This procedure lasted less than 5minutes and no complications were observed. The stainles s steel staple was removed after 10 days. Days Post Phx Wnt1 shRNA SCR shRNA 7 3 0 9 5 2 11 4 2 13 4 2 15 3 1 21 5 2 Total 24 9 Table 4-1. Numbers of an imals sacrificed during in vivo Wnt1 shRNA inhibition. 4.3.3.3 Animal numbers Animals were sacrificed at days 9, 11, 13, 15, and 21 days after PHx. Animal numbers at the various time points are descri bed in Table 4-1. Three animals treated with Wnt shRNA died 7 days after PHx which was one day after the seco nd injection. These animals exhibited massive intestinal hemorrhage. Reasons for these deaths have been determined to be linked to possible loss of vascular and/or intestinal epithelial integrity due to decreases in Wnt1 levels. Localized hepatic administration of the shRNA vector could alleviate this problem in the future.

PAGE 70

70 4.4 Histology and Immunohistochemistry 4.4.1 Histological Analysis 4.4.1.1 Hematoxylin and eosin of paraffin embedded tissue Tissue sections of 5 M in size were cut and placed in a 42C water bath. They were then lifted from the bath with a Superfrost Plus (Thermo Fisher Scientif ic Inc. Waltham, MA) positively charged slide. The slides were air dried O/N at RT. The paraffin was removed and the slides rehydrated by incubating them in Xylene 2 5min, 100% Ethanol 2 2min, 95% Ethanol 2 1min, and distilled H2O for 1min. Nucleic acids and other positively charged molecules were then stained with Hematoxylin 7211 (Richard-Allan Scientific) for 2min 15 sec and rinsed with distilled H2O for 2 min. The blue color of the Hematoxylin was intensified by incubating the slides in Clarifier 1 (Richa rd-Allan Scientific) for 1min, distilled H2O for 1min, Bluing Reagent (Richard-Allan Scie ntific) for 1min, distilled H2O for 1min, and 80% Ethanol for 1min. Proteins were then stained a pink color w ith Eosin-Y (Richard-Allan Scientific) for 1min 30 sec. The tissue was then dehydrated for covers lipping with 2 1min 95% ethanol, 2 1min 100% ethanol, and 3 1min xylene. Coverslips we re then applied with Cytoseal XYL (RichardAllan Scientific). 4.4.1.2 Hematoxylin and eosin of frozen sections Tissue sections of 5 M in size were cut and placed on Superfrost Plus (Thermo Fisher Scientific Inc. Waltham, MA) posit ively charged slides. The slides were air dried for 5min at RT. The tissues were fixed in PenFix (Richard-Allan Scientific) for 30 sec. The slide was then washed in distilled H2O for 1min. Nucleic acids and other positively charged molecules were then stained with Hematoxylin 7211 (Richard-Allan Scientific) for 45 sec and rinsed with distilled H2O for 1min. The blue color of the Hematoxylin was intensified by incubating the slides in Clarifier 1 (Richard-Allan Scientific) for 25 sec, distilled H2O for 30 sec, Bluing

PAGE 71

71 Reagent (Richard-Allan Scient ific) for 30 sec, distilled H2O for 30 sec, and 80% Ethanol for 30 sec. Proteins were then stained a pink color wi th Eosin-Y (Richard-Allan Scientific) for 30 sec. The tissue was then dehydrated for coverslippi ng with 2 1min 95% ethanol, 2 1min 100% ethanol, and 3 1min xylene. Coverslips were th en applied with Cytoseal XYL (Richard-Allan Scientific). 4.4.1.3 Periodic Acid-Schiff staining of paraffin embedded tissue PAS staining was performed to determine the presence or absence of mucin and glycogen in liver tissue sections. All tissue stained with PAS for was performed by the University of Florida, Department of Pathology, Mo lecular Pathology Core Laboratory. 4.4.2 Immunohistochemistry 4.4.2.1 Chromogen staining All staining of paraffin and frozen sections was performed with Vector ABC Kits and Dab or Vector Blue Reagent kits (V ector Laboratories, Burlingame, CA). All staining was performed as per manufacturers instructions. DAB slides we re counterstained with Vector Hematoxylin QS (Vector Laboratories) and mounted with Cytoseal XYL (Richard-All an Scientific). Vector Blues stained slides were counterstained with Nuclear Fast Red (Vector Laboratories) and coverslipped with VectaMount Permanent Mounting Medium (Vect or Laboratories). Slides were incubated O/N at 4C for primary antibody and 30min for secondary anti bodies. Any special retrieval method needed for a specific antibody is listed in 4.4.2.3. 4.4.2.2 Fluorescent staining All paraffin slides were depa raffinized and rehydrated as in H and E staining. Frozen sections were air dried and fixe d for 10min in ice cold methanol unless otherwise stated in Section 3: Antibodies utilized fo r Immunohistochemistry. Slides we re incubated for 5min in 1X TBS plus 0.1% Tween (TBS-T), and then blocked with serum for 20min and incubated with the

PAGE 72

72 primary antibody 1hr at RT or O/N at 4C. Slides were then washed for 5min in 1X TBS-T at RT and incubated with a fluorochrome labeled se condary antibody for 30min. Slides were again washed for 5min in TBS-T at RT and then c overslipped with Vectashield Mounting Media with DAPI (Vector Laboratories). Fluorescence was ob served and photographed with a fluorescent microscope or a confocal fluorescent miscro scope. The microscope, camera, and software utilized to assess IHC were a BX51 Olympus Fluore scent microscope fitted with cubes for FITC, Texas Red, DAPI and dual pass FITC/Texas Red, an Optromic Digital Cemera with Image Pro 3.1 Software, and Magnafire 3.1. All confocal mi croscopy was performed by Doug Smith at the University of Florida Stem Cell program on the Leica TCS SP2 AOBS Spectral Confocal Microscope with the LCS (Leica Confocal Software) Version 2.61, Build 1537 software. 4.4.2.3 Antibodies Utilized for Immunohistochemistry Table 4-2. Antibodies utilized for immunohistochemistry. 4.5 Protein Analysis 4.5.1 Protein Isolation and Quantification 4.5.1.1 Protein isolation from tissue or cells Tissue was placed in desired amount of RIPA buffer with Protease Inhibitor. The tissue was broken up and then sheared with an 18 ga uge needle and 3ml syringe. The tissue was pipetted up and down until tissue was thoroughly homogenized. The sample was vortexed for 30 Protein Animal Concentrati on Retrieval Company Cat. # Wnt1 Goat 1:50 None Santa Cruz sc-6280 Wnt3 Goat 1:50 None Santa Cruz sc-28824 Wnt5a Goat 1:50 None Santa Cruz sc-30224 -catenin Mouse 1:800 Citrate BD Biosciences 610153 OV6 Mouse 1:150 None Gift from S. Sell Albany, NY CD45 Mouse 1:100 None BD Biosciences 554875 Ki67 Mouse 1:100 Citrate BD Biosciences 556003 SDF-1 Goat 1:50 Citrate Santa Cruz sc-6193 AFP Rabbit 1:800 Trilogy Dako A0008 GFP Rabbit 1 ug/ml Citrate Abcam ab6556

PAGE 73

73 seconds and then spun at 10,000 g at 4C for 10min to remove excess lipids and DNA. The supernatant was collected into 2.0ml screw cap tube and placed in -80C until use. 4.5.1.2 Protein quantification with DC Protein Assay Blank and protein standards were made in 1ml tube as follows: 1. Blank 25 l RIPA Buffer w ithout Protease Inhibitor 2. Standard #1 1l + 24l RIPA Bu ffer without Protease Inhibitor 3. Standard #2 2l + 23l RIPA Bu ffer without Protease Inhibitor 4. Standard #3 4l + 21l RIPA Bu ffer without Protease Inhibitor 5. Standard #4 8l + 17l RIPA Bu ffer without Protease Inhibitor Samples were made with 1ul sample and 24 l RIPA Buffer without Protease Inhibitor Solution in 1ml Clear Tube. In another 1ml tube 125l Reagent A per reac tion and 2.5l Reagent S per reaction from the DC Protein Assay (Bio -Rad, Hercules, CA) were mixed. Note: Reaction number equals sample number plus five. 125l of combined solutions A and S was added to each reaction. When ready to measure 1ml Reagent B was added and tubes vortexed. 5-10min after the addition of solution B the OD of the samp les were measured in disposable cuvettes in Spectrophotometer set to 750nm. 4.5.2 Western Blot Analysis of Protein Levels 4.5.2.1 Pouring an acrylamide gel Main gel (10%, 8%, or 6% Acrylamide Gels): All components of gel except TEMED were mixed in a 15ml polypropelene tube. When ready to pour the gel the TEMED was added. 1. H2O 4.85ml=10%, 5.35ml=8%, 5.85ml=6% 2. 40% Bis-Acrylamide 2.50ml=10%, 2ml=8%, 1.5ml=6% 3. 2.50ml 1.5M Tris-Cl (pH 8.8) 4. 100 l 10%SDS 5. 33 l Ammonium Per Sulfate (APS) 6. 7 l TEMED The sponge on the gel pouring apparatus was dampened and the plates cleaned with alcohol. The plates were then aligned and secured in gel pouring apparatus. The gels were

PAGE 74

74 poured using electronic or plastic Pasteur pipettes. They were poured to approximately 1-1.25 cm below the top of the plate. Butyl alcohol was added to top of glass to prevent bubbles and smiling of gel. After 30min the re maining solution in the 15ml tube was inverted to determine if gel solidified. The butyl al cohol was removed and the gel rinsed with Milli-Q H2O. Stacking gel: All components of gel except Teme d were mixed in a 15ml polypropelene tube. When ready to pour the gel the TEMED was added. 1. 1.25ml H2O 2. 0.50ml 40% Bis-Acrylamide 3. 0.50 0.5M Tris-Cl (pH 6.8) 4. 20l 10%SDS 5. 15l Ammonium Per Sulfate (APS) 6. 2l TEMED The gels were pored using elec tronic or plastic Pasteur pipette s to slightly below top of glass and the comb inserted. After 10-15min, th e gel was ready to run after gently removing comb and rinsing the wells with Milli-Q H2O. 4.5.2.2 Protein sample preparation The amount of protein to be loaded per well was determined based on source of isolation (tissue or cell culture) and the sensitivity of the antibody being used for detection. Samples were added to the appropriate amount of RIPA Buffer to equal 12l per lane and placed in a screw cap 2.0ml tube. 3l of 5X Western Loading Buffer per lane was added to each tube. Each sample was boiled for 10min and then incubated at RT for 5min to cool. Each well of 0.75mm gel was loaded with 15l of sample with dye. The samp les were immediately loaded and any remaining solution placed on ice and retu rned to storage at -80C. 4.5.2.3 Electrophoresis of the western gel The gel was loaded in the r unning apparatus with small pl ate facing inward. The inner chamber was filled with 1X R unning Buffer till full and overflows and the outer chamber was

PAGE 75

75 filled 2.0 inches. 15 l of samples were loaded per well with 10 l of Protein Standard within the first well. Any empty lanes were filled with 15 l of 2X Western Loading Buffer. The gel was run at 60-80 Volts until the loading dye had migrated out of the stacki ng gel. Then the gel was run at 100 Volts until the loading dye ran the length of the gel. 4.5.2.4 Transferring of a western gel to a PVDF membrane The upper left corner of the Immun-Blot PVDF (Bio-Rad) membrane was cut and the membrane was labeled with pencil. It was then dipped in methanol, soaked in water for 5 min, and soaked in 1X transfer buffer for 20min. Sponges and filter papers were also soaked transfer buffer. The gel plates were opened and the stacking gel/wells were removed. The gel was submerged in 1X transfer buffer. A sandwich consisting of black assembly tray, sponge, filter paper, gel, PVDF membrane, filte r paper, sponge, and red assembly tray along with an ice block and stir bar were placed in the transfer appara tus. The transfer apparatus was filled with 1X transfer buffer and placed on a stir plate. The transfer buffer was stir red continuously while transferring to ensure the appa ratus would not overheat. The prot eins were transferred at 200 milliamps for 60min for a 0.75mm gel and 90min for a 1.50mm gel. 4.5.2.5 Probing of western membrane The membrane was blocked for 1-2 hours at RT with a blocking solution consisting of 5g skim milk, 2g glycine, and 100ml 1X PBST. The membrane was then probed with the appropriate concentration of primary antibody O/N at 4C. The membrane was then rinsed 3x for 5min each with 1X PBS. The appropriate horser adish peroxidase conjugated secondary antibody was applied in 1X PBS for 30min to 1 hr shaking at RT. The membrane was then rinsed again 3X with 1X PBS for 5 min each.

PAGE 76

76 4.5.2.6 Developing of western membrane with ECL Plus Excess liquid was removed from the membrane and it was placed within a plastic bag. 25ul of Solution A mixed with 1ml of Solution B ECL Plus reagents (GE Healthcare, Piscataway, NJ) was incubated on the membrane for 5min. Excess ECL Plus reagent was removed. Film was exposed to the membrane for 5s to 10min de pending on the brightness of the banding pattern. The membrane was then stripped if further probing was necessary. 4.5.2.7 Membrane stripping for reprobing 20ml of 5X strippi ng solution was diluted to 1X with 80ml water (100ml total). Then 714 l -Mercaptoethanol was added and membrane placed within the solution. The membranes were incubated in closed Tupperware contai ner at 56C for no longe r than 30min with intermittent shaking. The membrane was then wash ed for 5-8 times of 5min each with 1X PBS-T until all residual B-Mercaptoethanol was removed. Membranes were then reblocked with milk and reprobed as normal. 4.5.2.9 Antibodies Utilized in Western blotting Protein Animal Conc. MW (KDa) Company Cat # Wnt1 Goat 1:1000 40-42 Santa Cruz sc-6280 -catenin Mouse 1:2000 92 BD Biosciences 610153 Phospho-catenin Mouse 1:1000 92 Cell Signaling 9561 -Actin Mouse 1:5000 42 Abcam 3280 Table 4-3. Antibodies utilized for western blot analysis. 4.6 RNA analysis 4.6.1 RNA Isolation 4.6.1.1 Homogenization Tissues: Tissue samples were homogenized in 1ml of RNABee Reagent (Tel-Test, Inc., Friendswood, TX) per 50-100 mg of tissue using a sonic homogenizer.

PAGE 77

77 Cells Grown in Monolayer: Cells were lysed directly in a culture dish by adding 1ml of RNABee Reagent to a 3.5 cm diameter dish, a nd passing the cell lysate several times through a pipette. The amount of RNABee Re agent added is based on the area of the culture dish (1ml per 10 cm2) and not on the number of cells presen t. An insufficient am ount of RNABee Reagent may result in contamination of the isolated RNA with DNA. Cells Grown in Suspension: Cells were trypsinized and the trypsin inactivated with media supplemented with FBS. The cells were then pelleted by centr ifugation at 500rpm for 5min. The cells were then lysed in RNABee Re agent by repetitive pipetting. 1ml of the RNABee reagent was used per 5-10 106 of animal cells. 4.6.1.2 Phenol-chloroform phase separation The homogenized samples were incubated fo r 5min at RT to permit the complete dissociation of nucleoprotein complexes. Then 0.2 ml of chloroform per 1ml of RNABee Reagent was added and the tubes vortexed for 30s. The samples were then centrifuged at 12,000 g for 15min at 4C. Following centrifugation, the mixt ure separated into a lower blue, phenolchloroform phase, an interphase, and a co lorless upper aqueous phase. RNA remained exclusively in the aqueous phase. The volume of the aqueous phase was about 60% of the volume of RNABee Reagent used for homogenization. 4.6.1.3 Precipitation and redissolving of RNA RNA Precipitation : The aqueous phase was transferre d to a fresh tube, and the RNA precipitated from the aqueous phase by mixing with 600 l isopropyl alcohol per 1ml of RNABee Reagent used for the initial homogenization. The sa mples were then incubated at RT 10min and centrifuged at 12,000 g for 10min at 4C. Th e RNA precipitate, often invisible before centrifugation, formed a gel-like pellet on the side and bottom of the tube.

PAGE 78

78 RNA Wash: The supernatant was removed and the pe llet washed in 1ml of 75% ethanol. The sample was then vortexed and centrifuged at 7,500 g for 5min at 4C. Redissolving the RNA : The RNA pellet was air-dried for 5-10minutes, but the pellet was not allowed to dry completely, as this would greatly decreas e its solubility. The RNA was dissolved in RNase-free water and stored at -80C. 4.6.1.4 Quantification of RNA by spectrophotometry In order to accurately de termine the concentration of RNA in each sample, 1 l of RNA sample was diluted in 99 l of DEPC-treated H2O. This solutions absorbance was then analyzed at OD of 260nM and 280nM in a spectrophotometer. The purity was determined based on an OD 260/280 of > 1.8. The concentration of RNA was determined using the following formula: RNA (ng/ l) = OD260 40 ng/ l dilution factor of 100 4.6.2 RT-PCR 4.6.2.1 First-strand cDNA synthesis from total RNA First strand cDNA was synthesized utilizing SuperScript First-Stra nd Synthesis System (Invitrogen) as per manufacturers instructions. Note: For samples collected from the various time points of the oval cell induction model, 10 g of RNA from three individual animals was pooled. 5.0 g of this pooled RNA was then used for cDNA production. 5.0 g of each individual animal that underwent shRNA injecti ons was utilized for cDNA production. 4.6.2.2 PCR amplification of target cDNA 1. 2 l 10X PCR buffer 2. 0.25 l 10mM dNTP Mix 3. 0.5 l 10 M Forward Primer 4. 0.5 l 10 M Reverse Primer 5. 1 l cDNA 6. 15.55 l Milli-Q H2O 7. 0.2 l Taq Polymerase (5 U/ l)

PAGE 79

79 All previously listed components of P CR reaction were combined on ice with Taq Polymerase added immediately before samples we re placed in a thermocycler. The PCR reaction was run as follows with the annealing temperature adjusted to the individual primer sets: 1. 94 C for 10min 2. 31 cycles of a. 94 C for 30 sec b. Annealing temp for 30 sec c. 72 C for 30 sec 3. 72 C for 10min 4. 4 indefinitely 4.6.2.3 Primers utilized for DNA/cDNA amplification Primer name Primer sequence (5 3) Annealing temp (c) cDNA size (bp) DNA size (bp) Wnt1 F= TTC TGC TAC GTT GCT ACT GGC ACT R= CAT TTG CAC TC T TGG CGC ATC TCA 51 626 3214 Wnt3 F= GCC GAC TTC GGG GTG CTG GT R=CTT AAA GAG TGC ATA CTT GG 56 317 1005 Wnt5a F= TCC TAT GAG AGC GCA CGC AT R= CAG CTT GCC CCG GCT GTT GA 58 224 4028 AFP F= AGG CTG TAC TCA TCA TTA AAC T R= ATA TTG TCC TGG CAT TTC G 58 485 4139 -catenin F= GCC AGT GGA TTC CGT ACT GT R= GAG CTT GCT TTC CTG ATT GC 58 202 202 GapDH F= TGA GGG AGA TGC TCA GTG TT R= ATC ACT GCC ACT CAG AAG AC 58 577 577 Table 4-4. Primers utilized for PCR, and rtPCR. 4.6.2.4 Agarose gel electrophoresis A 30ml mini gel containing 0.7% (w/v) agaros e in 0.5X TBE and was heated to dissolve the agarose, and then 0.001% (v/v) ethidium br omide was added. The gel was then allowed to cool in a gel pouring apparatus and a comb with appropriately sized we lls was inserted. After hardening, the comb was removed and the gel su bmerged in 0.5 X TBE in a gel electrophoresis chamber. 0.5 l of 10X Agarose gel loading buffer and 3.5 l of Mill-Q H2O was added to 1 l of each sample and each sample was loaded into th e wells along with an appropriate molecular

PAGE 80

80 weight ladder (1 Kb, 100 bp, etc.). The gel was then run at 90-110 volts for approximately 1 hr or until desired separation of ba nds was visible on a UV light box. Pi ctures of agarose gels were obtained with a GelDoc XR (Bio-Rad, Hercules, CA). 4.6.3 Real-Time PCR analysis of Wnt1 levels To accurately assess the variati ons of Wnt1 levels during various time points of the rat oval cell induction model, levels of Wnt1 message we re analyzed quantitatively by Real Time PCR. Wnt1 levels were also quantitatively analyzed in all animals that received shRNA injections. 4.6.3.1 Real-Time PCR of Wnt1 For the analysis of Wnt1 message levels, 2 l of cDNA and 1.25 l each of forward and reverse Wnt1 primer were added to 25 l of Power SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA). The final reaction volume was 50 l. The reaction was performed on an ABI Prism 7700 Sequence Detection System The thermocycle sequence consisted of 10min at 95C and then 40 cycles of 95C fo r 30 sec, 51C for 30 sec, and 60C for 30 sec. 4.6.3.2 Real-Time PCR of 18S rRNA As an internal control for qua ntification purposes QuantumRNA 18S Internal Standards (Ambion, Austin, TX) were used to amplify 18S message. Samples were prepared as with Wnt1 quantification. The ratio of 18S primer: competimer was 3:7 as per manufacturers instructions. 4.6.3.3 Statistical analysis of Re al-Time PCR and densitometry A statistical analysis was performed as a stude nt T-Test to determine the probability that the data occurred merely by chance. 4.7 Solutions 10X Agarose Gel Loading Buffer 1. 15.0mg bromophenol blue 2. 15.0mg xylene cyanol 3. 8.0g sucrose 4. Milli-Q H2O qs to 10ml

PAGE 81

81 10X CaCl2 1. 6.36g CaCl2 2. Milli-Q H2O qs to 1L 10X PBS 1. 80.0g NaCl 2. 2.0g KCl 3. 11.5g Na2HPO4 7H2O 4. 2.0g KH2PO4 5. Milli-Q H2O qs to 1L RIPA Buffer and Protease Inhibitor Solution RIPA Buffer 1. 1.5ml 1M NaCl 2. 0.5ml 1M Tris-Cl pH 8.0 3. 1.0ml 10% NP-40 4. 1.0ml 10% NaDeoxycholate 5. 5.4ml Milli-Q H2O Protease Inhibitor Solution (added to RIPA just prior to use) 1. 100l 10mg/ml PMSI in isopropanol 2. 300l Apoprotonin 3. 100l 100mM NaOrthovanadate Total = 10.0ml 10X S and M Solution 1. 500mg KCl 2. 8.0g NaCl 3. 2.4g HEPES 4. 190 mg NaOH 5. pH to 7.4 6. Milli-Q H2O qs to 1L and filter 5X TBE 1. 54.0g Tris base. 2. 22.5g Boric acid 3. 4.7g EDTA 4. Milli-Q H2O qs to 1L 10X TBS 1. 80.0g NaCl 2. 2.0g KCl 3. 30.0g Tris base 4. 800ml H20 5. Milli-Q H2O qs to 1L Adjust pH to 7.4 using 1M HCl

PAGE 82

82 5X Western Loading Buffer 1. 1.5ml 0.5M Tris-HCl 2. 1.0g 10% SDS 3. 2.5ml -mercaptoethanol 4. 1.5mg Bromophenol Blue 5. Milli-Q H2O qs to 10ml 10X Western Running Buffer 1. 144.0g Glycine 2. 30.0g Tris-Base 3. 10.0g SDS 4. Milli-Q H2O qs to 1L 5X Western Stripping Solution 1. 37.83g Tris-Base 2. 1g SDS 3. pH to 6.8 4. Milli-Q H2O qs to 1L 10X Western Transfer Buffer 1. 115.0g Glycine 2. 24.0g Tris-Base 3. Milli-Q H2O qs to 800ml When diluted to 1X, 80ml of 10X Transfer Buffer was added to 720ml Milli-Q H2O and 200ml Methanol.

PAGE 83

83 CHAPTER 5 RESULTS 5.1 Evaluation of the Wnt Family During Oval Cell Induction During oval cell activation, memb ers of the Wnt family were up regulated. Specifically, by IHC analysis Wnt3, Wnt1, Fzd 7 and Fzd 5 demo nstrated increased expression in pericentral hepatocytes (Figure 5-1). Interestingly, Wnt5 a and FRP1, known negative regulators of the canonical Wnt pathway, were only expressed in low levels late in the oval cell induction protocol. The most prevalently expressed Wnt du ring 2AAF/PHx appeared to be the first Wnt discovered, Wnt1. Further analysis of Wnt one expression during oval cell induction revealed an association of Wnt1 expression and liver stem cell based regeneration. Figure 5-1. 2AAF/PHx 9 Days post PHx versus Wnt Family. Serial sections of 2AAF/PHx Day 9 tissue. A. H and E; A. Insert. IgG Isotype negative control. B. Frizzled Related Protein 1; C. LRP5; D. Frizzl ed 5; E. Frizzled 7; F. Wn t5a; G. Wnt1; F. Wnt3. C.V.= Central vein; P.T.= Portal triad; Arrows indicate oval cell rich infiltrate surrounding the portal triad and radiating toward the cen tral vein. Wnt family members and their receptors reside within pericentral hepato cytes but not oval cells. Magnification: 10X. Previously Monga et al. demonstrated up regulation of Wnt within hours of PHx.161 At the time of PHx during the 2AAF/PHx protocol resected livers lobe s show low levels of Wnt1 G.Wnt1 H. Wnt3 D. Fzd5 F. Wnt5a B. Frp1 E. Fzd7 C.LRP5 A. H C.V. P.T.

PAGE 84

84 expression (Figure 5-2). Levels of Wnt1 increase during peak oval cell production within the cytoplasm of pericentral and in ter zonal hepatocytes. Also he patocytes surrounded by streaming oval cells migrating toward the central vein activat e high levels of Wnt1 e xpression as visualized by IHC. Figure 5-2. Staining of Wnt1 durin g 2AAF/PHx. A. Day 0; B. Day 3. C. Day 9; D. Day 13. Wnt1 is produced by hepatocytes with in hours of PHx as seen in liver obtained at the time of PHx. Pericentral hepatocyte s production of Wnt1 can be seen as early as Day 3, and levels increase throu gh out oval cell induction. He patocytes engulfed by the migrating oval cells express high levels of Wnt 1 (black arrow). Magnification 20X. Although Wnt1 expression is not visible within oval cells, they do respond to the Wnt signaling cascade by translocating -catenin to their nucleus. Dual immunofluorescence for A. B. C. E.

PAGE 85

85 Wnt1 (red) and -catenin (blue) of days 9, 13, 15, a nd 21 days post PHx of the oval cell induction protocol confirms the strict localizat ion of Wnt1 to hepato cytes (Figure 5-3.). -catenin expression is not confined to adherens junctions within the oval cells. Cytoplasmic and nuclear localization of -catenin indicates active canon ical Wnt signaling pathway. Figure 5-3. Dual Staining of Wnt1 and -catenin in 2AAF/PHx. A. Day 9; B. Day 13; C. Day 15; D. Day 21; E. and F. Day 13; Pericentra l hepatocytes express Wnt1 within their cytoplasm, and oval cells translocate -catenin to the nucleus in response to Wnt signaling (white arrows). Ma gnification A.-D. 63X, E. 126X. Western blot analysis of pr otein pooled from three individual animals collected from various time points of the oval cell induction protocol further confirmed the Wnt1 expression profile visualized by IHC (F igure 5-4). Both Wnt1 and -catenin protein levels rapidly increase during the initial stages of oval cell induction and past the peak of oval cell prol iferation. This B C A D F E

PAGE 86

86 indicates a role of Wnt1 in not only the act ivation but more proba bly in directing the differentiation of oval cells. Figure 5-4. Change in -catenin and Wnt1 protein levels during 2AAF/PHx oval cell induction. A. Densitometric analysis of -catenin and Wnt1 Wester n Blots. All data was normalized to -actin levels and compared to NRL. B. Western blots of various time points after 2AAF implantation and PHx. Both -catenin and Wnt1 levels increase dramatically after 7 days post PHx. Fractionation of liver perfusate by Nycodenz gradient centrifugation results in four separate cellular fractions (F1-F4). Fraction 1 mostly includes immunol ogic cells and stellate cells; Fractions 2 contains oval cells; Fraction 3 holds immature hepatocytes and resident liver macrophages known as Kupffer cells; and Fracti on 4 contains mature and multinucleated hepatocytes. A. B. Wnt1 -Catenin -Actin Fold Change from NRL -catenin Wnt1 0.0 1.0 2.0 3.0 4.0 5.0 6.0 7.0 8.0 N RL Day 3 Day 5 Day 7 Day 9 Day 11 Day 13 * ** ** ** ** = p<0.05 ** = p <0.005

PAGE 87

87 Figure 5-5. -catenin levels of liver cell fractions. Cells isolated from liver by Nycodenze density based gradient were analyzed by western blot for Wnt1, -catenin, and phosphorylated -catenin. A. Densitome tric analysis of -catenin Western Blot. All data was normalized to -actin levels and compared to NRL F1. B. Western blot of cells isolated by perfusion from normal liver or 9 days post PHx in oval cell induction model. NRL cells fail to express Wnt1, howev er after oval cell indu ction, cells within fractions 2 through 4 express Wnt1. -catenin is considerably increased in cells isolated from Day 9 liver (p<0.05 and p <0.005). Whereas phosphorylated -catenin levels are the same in th e hepatocyte fraction, increas e in the small hepatocyte fraction, and are almost absent from fract ion 2 (oval cells) duri ng oval cell induction. Western blot analysis of pr otein from these four fractions further confirmed the up regulation of Wnt1 and -catenin levels in cells from 2AAF day 9 post PHx as compared to NRL (Figure 5-5). More specif ically, phosphorylation of -catenin, an indicator of -catenin degredation and a lack of Wnt si gnaling is localized to the hepato cyte fractions. Low levels of phosphorylation is found in the oval cell fraction, but the dramatic 9.08 fold increase in -catenin B -Catenin Wnt1 -Actin Phosphorylated -Catenin A 0. 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. N RL F1 N RL F2 N RL F3 N RL F4 Day 9 F1 Day 9 F2 Day 9 F3 Day 9 F4 Fold Change from NRL ** ** ** = p<0.05 ** = p<0.005

PAGE 88

88 levels in F2 of 2AAF/PHx when compared to the NRL F2 signifies a major decrease in the ubiquitination and destruction of -catenin in oval cells due to Wnt signaling. Analysis of the RNA expression of Wnt fam ily members by rt-PCR verified the results seen with IHC and western blot (Figure 5-6). Wnt1 and Wnt3 levels increase over 2AAF/PHx, whereas, low levels of Wnt5a only appears late in oval cell induction. AFP levels indicate the amount of oval cells present within the liver a nd the expression of AFP peaks at 9 days after PHx. Interestingly, -catenin message levels remain fairly constant across 2AAF/PHx. This, in conjunction with the drastic protei n level increase and the signif icant lack of phosphorylation in the oval cell fraction, indicat es that the increase in -catenin protein levels is strictly due to a lack of degradation induced by Wnt signaling. Figure 5-6. Reverse transcription PCR of liver from 2AAF/PHx oval cell induction model. RNA from NRL and 3, 5, 7, 9, 11, and 13 days after PHx in the 2AAF/PHX model. As seen during IHC, levels of Wnt1, Wnt3 and AFP increase during oval cell induction. Wnt5a is not produced until very late in the process, however, -catenin message levels remain fairly constant. Real Time PCR of Wnt1 mRNA levels thr oughout 2AAF/PHx quantitatively demonstrated a statistically relevant increase in Wnt1 message levels prior to and during the peak in oval cell production (Figure 5-7). The Wnt1 mRNA data correlated with the Wnt1 Protein analysis -Catenin Wnt1 Wnt3 Wnt5a AFP GapDH Ladder NRL Day 3 Day 5 Day 7 Day 9 Day 11 Day 13

PAGE 89

89 indicates a strong relatio nship between Wnt1 and the oval cel l induction protocol. The peak in mRNA matches the peak in oval cell proliferation, and the fact that the highest expression of Wnt1 protein occurs after oval cell numbers peak would suggest that Wnt1 more specifically has a role in the oval cell differentiation process. Figure 5-7. Real Time PCR anal ysis of Wnt1 expression duri ng oval cell induction. Wnt1 mRNA expression increases prior to the peak in oval cell production. The liver contains the greatest Wnt1 message at the height of oval cell production. Significant message levels differences occurs during oval cell induction as compared to NRL. All data previously collected revealed a co rrelation between Wnt1 levels and oval cell activation. Although phosphor ylation status of -catenin and imaging of -catenin nuclear translocation confirm the theory that oval cells respond to Wnt1 signaling, none of this data actually demonstrates a direct oval cell res ponse to Wnt signaling. Ho wever, the nuclear translocation of -catenin by WB-F344 cells, a known he patic stem cell line, treated with palmitolated Wnt3A definitively links active Wnt signaling and hepatic stem cells (Figure5-8). Untreated WB-F344 cells retain -catenin within their adherens junctional complexes. NRL 3 7 911131521 Wnt1Days after PHx Fold Change from NRL 0.0 1.0 2.0 3.0 4.0 5.0 6.0 ** = p<0.05 ** = p <0.005

PAGE 90

90 Figure 5-8. Response of WB-F344 cells to Wnt3a stimulation. A. and B.) The -catenin staining of unstimulated WB cells remains locali zed to the membrane within adherens junctions. C. and D.) In cells exposed to Wnt3A, -catenin accumulates in the cytoplasm as well as translocating to the nucleus. Magnification: A. and C. 40X; B. and D. 100X. 5.2 In vivo Inhibition of Wnt1 Duri ng Oval Cell Induction To determine the effectiveness of the designe d Wnt1 shRNA vector, PC12 cells previously reported to constitutively express murine Wnt1 were transfected with the shRNA in complex with Lipofectamine 2000. Although PC12/Wnt1 cells were highly resistant to the transfection (only approximately 60% transf ection efficiency) after 48 hours cells exposed to the shRNA exhibited a 41.8% decrease in cytopl asmic Wnt1 expression (Figure 5-9). B. D. C. A.

PAGE 91

91 Figure 5-9. Knockdown of Wnt1 in PC12/Wnt1 cells A. GFP expression in cells 48 hrs after transfection with a Wnt1 shRNA vector cont aining GFP. B. West ern blot of Wnt1 levels in cells treated with Wnt1 shR NA or SCR shRNA. Ap proximately 60% of PC12/Wnt1 cells expressed GFP 48hrs after transfection. Densitometric analysis showed Wnt1 levels were decreased 41.8% in cells treated with Wnt1 shRNA as compared to SCR shRNA(p<.005). Magnification 20X. Figure 5-10. GFP expression in shRNA treated anim als. A. Heart; B. Intestine; C. Lung; D. Spleen; E. and F. Liver; G. and H. Pancre as; I. Brain, Cortex; J. Brain, Midbrain; K. Kidney; L. Liver from a Control GFP+ Mouse. GFP positive cells can be visualized in all tissues sampled, and expression was not limited to vasculature. Magnification 40X. A. H. J. F. K. G. I. E. D. C. B. L. A. SCR shRNA Wnt shRNA Wnt 1 -ActinB.

PAGE 92

92 Analysis of GFP expression through IHC allo wed for determination of efficient shRNA vector delivery to target tissu es (Figure 5-10). Although expre ssion levels were not uniform across all tissues, GFP expression was found in all tissues analyzed, and expression was not limited to vascular endothelium. Intestinal and bronchial epithelia were distinctly positive. Within the pancreas, islet cells as well as du ctular epithelium demonstrated GFP positivity. Interestingly, the brain also expressed high le vels of GFP within th e cortex and midbrain, demonstrating the cationic lipid delivery mechanism was sufficient to cross the blood-brain barrier. GFP levels were low in spleen and ki dney but still visible within the renal tubular epithelium and splenic white pulp. Figure 5-11. Percent liver weights of animals treated with shRNA. The livers of animals treated with shRNA to Wnt1 initially were no larger than those treated with SCR shRNA. However, as time progressed their livers actually surpassed the size of their scrambled counterparts. Animals and their livers at the time of sacrifice after exposure to shRNA were weighed and the percent of liver weight calculated as liver weight/body weight (Figure 5-11). Interestingly, Wnt1 shRNA treated animals initi ally demonstrated no significant difference in 1.5 2.0 2.5 3.0 3.5 4.0 4.5 5.0 5.5 7 911 13 15 17 19 21 Da y s p ost PHx % Liver SC R Wnt1* = p <0.05

PAGE 93

93 their percent liver weights, however, after wh at would normally be the peak in oval cell proliferation, Wnt1 shRNA treated animal pe rcent liverweights were on average 0.8% higher than those treated with SCR shRNA (p <0.05). Afte r histological examina tion, it was possible to conclude this change in per cent liver weight was due to bot h atypical ductula r hyperplasia and hepatocyte compensation for the failure of oval cells to function in the rege neration of the liver. Figure 5-12. H and E of livers fr om shRNA treated animals. Histologically livers in Wnt shRNA treated animals are similar to nontreated or SCR treated individuals 9 days after PHx. Oval cell infiltrate mimicked the standard reaction. However, as early as 13 to 15 days after PHx atypical ductu lar hyperplasia appears in Wnt shRNA treated animals. Ultimately, 21 days after PHx, Wnt shRNA tr eated animals exhibited large sites of atypical ductular hyperplasia (B lack arrow) and persistent oval cell streaming from portal triads to other portal triads. (White arrows). SCR shRNA treated animals were unremarkable. Magnification 20X. 2AAF/PHx A Day 9 F. E. I. H. B. Day 15 C. Day 21 D. SCR shRNA G. Wnt1 shRNA

PAGE 94

94 Histological analysis of Wnt1 shRNA treated animals revealed morphological changes in oval cell based liver regeneration after Wnt1 shRNA treatment (Figure 5-12). Oval cell morphology appeared unremarkable 9 days after PHx. However, atypical ductular hyperplasia was present in one animal as early as 13 days after PHx. The remaining Wnt1 shRNA treated animals exhibited atypical ductular hyperplasia w ithin 15 days of PHx. As of 21 days after PHx, the atypical ductular hyp erplasia appears through out the liver and oval cells persist in streams extending from portal triads toward other portal triads. Figure 5-13. OV6 and CD45 staining of serial fresh frozen sections from the livers of shRNA treated animals. A. and E. Wnt1 shRNA treat ed animal 9 days after PHx; B. and F. 2AAF/PHx animal 9 days after PHx; C. a nd G. Wnt1 shRNA treated animal 21 days after PHx. D. and H. SCR shRNA treated animal 21 days after PHx. A.-D. OV6 Staining. E.-H. CD45 staining. Although the 2AAF/PHx does induce a slight inflammatory response as seen by infre quent CD45 staining, shRNA treatment does not dramatically increase inflammation. Twenty days post PHx, Wnt shRNA treated animals still posses substantia l numbers of oval cells infiltrating the liver, which is not seen in scramble or nontreat ed animals. Magnification 20X. Confirmation that the infiltrating cells were in fact oval cells and not inflammatory cells was achieved by staining serial frozen secti ons for OV6 and CD45 (Figure 5-13). Oval cell numbers in Wnt1 shRNA treated animals a pproximated those in SCR shRNA treated and nontreated animals 9 days post PHx. Conversel y, 21 days post PHx oval cells are virtually 2AAF/PHx D9 Wnt1si D21 SCRsi D21 Wnt1si D9 OV6 CD45 A. B. C. D. E. F G. H.

PAGE 95

95 nonexistent in SCR shRNA treated and untreated animals. The cells that compose the atypical ductular hyperplasia as well as the persistent st reaming cells exhibit OV6 staining indicating they are of oval cell origin. Minimal CD45 staining in both nontreated and trea ted animals signify the cells infiltrating the livers are not of an inflammatory origin. Figure 5-14. Ki67 comparison of 2AAF/Phx versus Wnt1 shRNA treated animals. A. 2AAF/PHx Day 9; B. 2AAF/PHx Day 15; C. 2AAF/PHx Day 21; D. Intestine (Positive control); E. Wnt shRNA Day 9; F. Wnt shRNA Da y 15; G. Wnt shRNA Day 21; H. Wnt shRNA Day 21. Proliferation of oval cells 9 days after PHx in shRNA treated animals mimics that observed in 2AAF/PHx alone. In 2AAF/PHx alone, by day 15 proliferation has subsided as oval cells begin differentiating. On the contrary, oval cells in shRNA treated animals continue to proliferate 15 days after PHx. Also, hepatocytes that have begun to recover from the influence of 2AAF exhibit a very high proliferative rate 21 days after PHx. Under normal conditions the liver has completely recovered and divi sion is unnecessary 21 days after PHx. It can also be observed that the sites of atypical ductular hyperplasia ar e also rapidly dividing 21 days after PHx. Magnification 20X. The proliferative index of shRNA treated an imals was assessed by Ki67 staining (Figure 514). Oval cells in Wnt1 shRNA, SCR shRNA treat ed and standard 2AAF/PHx animals at the day 9 time point were unremarkably similar. However, the oval cells in Wnt shRNA treated animals were still proliferating at an increased rate 15 days post PHx. Interestingly after 21 days the effects of 2AAF upon hepatocytes was diminish ing and a significant portion of hepatocytes began dividing in Wnt1 shRNA treated animal s. This division along with the ductular E. A. H. G. F. D. C. B.

PAGE 96

96 hyperplasia could account for the increased perc ent liver weights of Wnt1 shRNA treated animals. Also large portions of the hyperplast ic foci found in Wnt1 shRNA treated animals 21 days post PHx were also undergoing prolif eration as determined by Ki67 staining. Figure 5-15. AFP and Wnt1 staining of serial sections from Wnt1 shRNA treated animals. A. and E. 2AAF/PHx animal 9 days after PHx after PHx; B. and F. Wnt1 shRNA treated animal 9 days after PHx; C. and G. Wnt1 shRNA treated animal 13 days after PHx. D. and H. Wnt1 shRNA treated animal 21 days after PHx. A.-D. AFP Staining. E.-H. Wnt1 staining. Oval cells from 2AAF/PHx express AFP in high levels, and pericentral hepatocytes express Wnt1. In vivo treatment of animals with shRNA to Wnt1 on days 3 and 6 post PHx, inhibits Wnt1 expression until at least day 13 post PHx. After 21 days post PHx, Wnt1 expression returns to inter-zonal and pericentral hepatocytes. The oval cells that infiltrate the liver in shRNA treated animals initially express AFP. After 11 days post PHx, AFP le vels decline to negligible 21 days post PHx. Magnification 20X. As oval cells mature they gain the fetal protein marker known as AFP prior to their differentiation into basophilic, small hepatocytes. Therefore, AFP has been utilized as an oval cell marker. AFP staining of shRNA treated animals further confir med the previous OV6 staining of the oval cells (Figure 5-15). Neverthe less, although the atypical ductular proliferation maintained OV6 staining, cellular levels of A FP lost intensity beginni ng 13 days after PHx and were completely lost by 21 days post PHx. Loss of AFP indicates a failure to differentiate toward a hepatic lineage. 2AAF/PHx D9 Wnt1si D9 Wnt1si D13 Wnt1si D21 A. B. F E. C. D. G. H. AFP Wnt1

PAGE 97

97 Wnt1 levels were also assessed by IHC (Fi gure 5-15). Although in the standard oval cell induction protocol Wnt1 protein levels are hi gh 9 days post PHx, they were nonexistent by IHC in Wnt1 shRNA treated animals until day 13. Intens e expression of Wnt1 a ppeared in virtually all hepatocytes at this time. On day 21 hepatocy tes of Wnt1 shRNA treated animals were still expressing Wnt1, whereas in the SCR shRNA treated or nontreated animals this expression had subsided at this point. Figure 5-16. Real Time PCR anal ysis of Wnt1 expression of shRNA treated animals. Wnt1 shRNA treated animals exhibited virtually no Wnt1 message until 13 days after PHx. Real Time PCR analysis of Wnt1 levels conf irmed IHC analysis of Wnt1 levels in shRNA treated animals (Figure 5-16). Animals treated with the scrambled vector demonstrated no appreciable variation in Wnt1 message as compar ed to 2AAF/PHx control. Wnt1 shRNA treated animals, however, displayed a delayed expression of Wnt1. Wnt1 message was virtually absent 0.0 1.0 2.0 3.0 4.0 5.0 6.0 7.0 NRL 7 9 11131521 Da y s Post PHxFold Chan g e from NRL SCR shRNA 2AAF/PHx Wnt1shRNA* = p<0.05 ** = p<0.005 * ** **

PAGE 98

98 from the animals one day after the last injection with a rapid incl ine in expression levels 11 days after PHx. Figure 5-17. Atypical ductular hyperplasia within Wnt shRNA tr eated animals. A. H and E 9 Days post PHx; B. H and E 13 days post PH x; C. and F. H and E 21 Days post PHx; D. PAS staining of Wnt shRNA treated animal 21 days after PHx; E. PAS staining of day 9 2AAF/PHx. Treatment with shRNA to Wnt1 in the 2AAF /PHx model induces oval cells to undergo differentiation toward a ductular lineage. Duct s remain retain a fairly normal cuboidal morphology until 15-21 days post PHx. At this point, atypical ductular hyperplasia ensues. As seen in D. some ducts undergo transformation into columnar (black arrow) and even squam ous (White arrow) phe notypes. The atypical ducts are mucin positive (*), whereas, ducts found in the standard 2AAF/PHx protocol are mucin negative (). This i ndicates the atypical du cts are no longer of a biliary lineage. Magnification A., D ., E, and F. 40X; B. and C. 20X. Further examination of the morphology of th e atypical ductular hype rplasia present in Wnt1 shRNA treated animals revealed a potentia lly preneoplastic state (Figure 5-17). The hyperplastic ducts began appearing 9 days after PHx which is only 3 days after the last Wnt1 shRNA injection. Initially the morphology of the ducts was identical to that of a standard bile duct, small cuboidal cells with a basalar nucleus, but by 15 days post PHx cytology began to change. Not only were the sites of hyperplasia presen t in nearly all liver l obules, but the cells in A. B. D. E. F. C.

PAGE 99

99 some had undergone metaplasia. Ducts could be visualized with both columnar and squamous metaplasia. Also these hyperplastic ducts were producing mucin which is ab sent in normal liver or livers from any time during 2AAF/PHx oval cell induction.

PAGE 100

100 CHAPTER 6 DISCUSSION AND FUTURE STUDIES 6.1 Summary of Results The data presented in this study demonstrat ed a clear link between Wnt1 signaling and oval cell based liver regeneration. Hepatocytes expr ess and secrete Wnt1 in response to massive hepatic injury (2AAF/PHx). Oval cells inva de the liver and res pond to Wnt1 signaling by decreasing phosphorylation of -catenin and translocating it to their nucleus to activate Wnt responsive genes. The message levels of Wnt1 rise during and at the point of peak oval cell production, but protein levels are de layed in reaching their maximum. This clearly indicates that Wnt1 is not responsible for recruiting oval cells to the liver or inducing oval cell proliferation. Instead Wnt1 is essential in guiding oval cells down a hepatic differentiation path. To provide evidence that Wnt1 is required for oval cell differentiation, an shRNA designed to Wnt1 was utilized in vivo during oval cell based liver regeneration. Inhibition of Wnt1 in vivo did not delay oval cell migration into the liver. Nevertheless, the oval cells were unable to function normally. Without Wnt1 signaling, oval cells were forced toward a biliary lineage and underwent atypical ductular hyperplasia. It is as if without the Wnt1 sign al, oval cells lose AFP expression, and they defaulted to a bile duct phenotype. In compensation, as the effects of 2AAF on hepatocytes wore off, hepatocytes began rapidl y dividing to reform the functional liver that the oval cells were unable to generate. Essentially Wnt1 directs oval cells to differentiate into hepatocytes and without this signa l oval cells are unable to differe ntiate and function normally. Instead of oval cells simply creating numer ous bile ducts, there is morphologic evidence that these cells are pot entially going through a preneoplastic process. Within the foci of proliferating ducts, epithelial metaplasia occurred. At the end of the study every animal that was treated with shRNA toward Wnt1 had large area s of atypical ductular hyp erplasia, and in about

PAGE 101

101 5-10% of ducts either columnar or squamous metaplasia was present. Chromatin within the metaplastic ducts appeared irregular, but no defi nitive signs of dysplasia were present. The epithelial metaplasia in conj unction with mucin production is indicative of a preneoplastic process, but no further claims can be made. Although this study definitively demonstrates a role of Wnt1 in oval cell based liver regeneration and indicates a poten tially prenoeplastic state when Wnt1 is absent, it must be repeated and time points collected later than 21 days after PHx. The presence of these atypical ducts is encouraging in regards to indicating an oval cell origin of cholangiocarcinoma, but at this stage no comments can be elicited as to th eir true purpose. These at ypical ducts have two potential paths. They could turn neoplastic or they could regress. On ly a longer study could differentiate between these two possible outcomes. 6.2 Interpretation of Results 6.2.1 Wnt Signaling is Required During Oval Cell Based Liver Regeneration 6.2.1.1 Novel findings No previous study has shown the requirement of the Wnt family in the differentiation of oval cells. Wnts have been implicated in this process but no definitive correlation has been established until now. Also, the mechanism by which Wnt signals are sent and received has only previously been postulated and not truly defined. This research clearly demonstrates a hepatic origin of the Wnt signal and an ova l cell response to this signal. When compared to the levels of phosphorylation of -catenin, the dramatic increa se in protein levels of -catenin without a subsequent increase in -catenin message can only be e xplained by Wnt signaling. Also when Wnt1 signaling is absent, oval cell behave distinctly different than when in the presence of Wnt1.

PAGE 102

102 Although much research has been done on -catenin null and dominant mutant mice and the function of -catenin in the liver, little has been done with regard to the penultimate upstream signal. Perhaps this is because Wnt is so important and highly regulated. Mutations in the Wnt family and their recepto rs are practically none xistent in the cancer literature. Instead only relative changes in expression levels of certain Wnts can be found. This further implicates the integral role Wnt play s in cellular processes and tumor development. Perhaps changes in the expressi on of Wnt family members induces so drastic a result the cells are immediately culled to prevent further mishap. If mutations occurred silently in tumors, the expression of these mutations would have some prevalence in the litera ture but this has not happened. Conversely, it could be that there are so many Wnts in the family because they are redundant. This redundancy could compensate for any mutations that occur. However, this research tends to negate this theory. Knockdow n of a single Wnt protei n has induced a drastic phenotype, when other Wnts are known to be expressed throughout the oval cell induction model. This indicates that the ev olution of a family of 19 indivi dual Wnts is due to the complex and distinct pathways regul ated by these Wnt proteins. 6.2.1.2 Basic science applications In order for the true nature of oval cells to be understood, their behavior in situ has to be monitored, but as Richard Feynman theorized, once you remove something or observe it, the entity has changed due to observation. Ho wever, even though the oval cell changes once observed, this is the only mechanism we have to further our understa nding of their biology. Therefore, knowing Wnt1 is re quired for inducing oval cell hepa tic differentiation has further defined the role of oval ce lls in liver regeneration.

PAGE 103

103 Knowledge of the signals necessary to induce ova l cells to differentiate into hepatocytes is currently very limited. In culture, the cytoki ne milieu needed for inducing hepatocyte differentiation is mixed and fairly nonspecific. Also the results are not consistent, not all cytokine mixtures force all oval ce lls in culture to differentiate. This indicates that either not all the cells are being triggered or there is a heterogeneous popul ation being evaluated. Including Wnt1 in this differentiation me dia could induce more rapid and more complete differentiation in vitro. Also using a known inhibitor of this pathwa y such as Wif (Wnt inhibitory factor) one could theoretically maintain oval cells in an undifferentiated state in culture. Investigation of the role of AFP in oval cell differentiation is essential to understanding this process. This research demonstrated AFP expression during the peak in oval cell proliferation. However without Wnt1, AFP expr ession was lost. This suggests that although some oval cells initially express AFP in the hepatic differentiation path more signals are necessary to complete the differentiation process. Perhaps AFP primes the pump, i.e prepares the oval cells to differentiate into hepatocy tes, but Wnt1 actually pushes them over that differentiation hill. If this is the case, determining what induces AFP expression may further allow us to manipulate oval cells in culture and in vivo. Also use of Wnt in culture could possibly be utilized to prime cells for transplantation. 6.2.1.3 Clinical applications The demonstration of Wnt1s requirement fo r oval cell differentiati on has strong clinical implications. With the severe shortage of livers to supply the ever increasing need for transplants, clinicians are as king basic scientists to devel op alternate methods of organ replacement. Hepatocyte transplant has been performed as previously described, however, the results vary and the number of studies that has been performed is limited. Utilizing stem cells for the facilitation of organ and or functional replace ment of tissues has shown great promise. Stem

PAGE 104

104 cells have a much greater capacity for division, differentiation and subs equent repopulation of damaged tissues. Ideally one day we will be able to isolate stem cells from the blood, manipulate them in vitro and implant them into the desired organ. Oval cells have already been shown to be bone marrow derived, and therefore, theoretically can be isolated from the blood. Oval cells have repeatedly been implanted into livers and donor derivation of regenerated tissue de monstrated. The biggest set back has been the limited numbers of donor derived hepatocytes ap pearing in the liver. Proving that one can engraft cells into the liv er was the first step. Increasing the numbers of donor derived cells is the next step, and perhaps Wnt is th e answer. Exposure of oval cells ex vivo or in vivo to Wnt1 has the potential to increase the differentiation rate of oval cells. Essentially, you could use Wnt exposure to increase the likeli hood that the cells you implant will differentiate the way you want them too. If exposure to Wnt1 pushes oval cells down the hepatocyte lineage, it may function exactly the same way on the bone marrow precursor of the oval cell. If true, this would facilitate and even simpler method of obtaining cel ls for transplantat ion into the liver. The clinical implications of this are astounding. It is known th at hepatocyte transplantation only results in transient engraftment. Perhap s transplanting precursor cells might ensure prolonged engraftment. If Wnt1 signaling truly initiates hepatocyte di fferentiation while not inhibiting proliferation, treatment of oval cells or bone marrow precursor cells might even cause an intrahepatic expansion of th e transplanted cells along with di rected hepatocyte differentiation. Essentially, the engrafted cells ar e directed down a hepatic lineage and allowed to proliferate, which would increase the numbers of engrafted ce lls and, therefore, enlarge the size of the graft without having to increase the number of transplanted cells.

PAGE 105

105 6.2.2 Disregulation of Wnt1 Si gnaling and Cancer Induction 6.2.2.1 Atypical ductular proliferation after Wnt1 shRNA exposure i n vivo It is evident that without Wn t1 signaling oval cells cannot di fferentiate down the hepatic lineage. Every animal exposed to the Wnt1 shRNA had developed severe atypical ductular hyperplasia globally throughout the liver after 21 days. These foci were even undergoing potentially preneoplastic changes. Nuclear pleomo rphisms and squamous or columnar metaplasia was evident in numerous of these foci in various animals. These findings i ndicate that oval cells must receive a distinct pattern of signals to undergo hepatocy te differentiation. Without Wnt1 signaling they defaulted to a biliary lineage. The dual differentiation potential of the oval cell has been well documented, but until now no one has shown that without stimulus to become a hepatocyte, oval cells revert to a biliary lineage. Also Wnt1 is the only signal preventing the severe atypical ductular hyperplastic phenotype. This suggests that tig ht control of oval cells is required and without tight control there are drastic consequences. Although the study only went for 21 days after PHx, this potentially preneoplastic state strongly aids the oval cell theory of cholangiocarcinoma. If all it takes to push oval cells down a cancerous road is the lack of one growth factor, then it is no wonde r that they have the potential to create liver tumors of hepato cyte and/or biliary or igin. Extension of the study will determine if these foci of atypical ductular hyperplasia spont aneously resolve or if they undergo true transformation into a tumo r of a biliary origin. Use of the Wnt1 shRNA 2AAF/PHx protocol c ould provide a very fast method for forming repeatable tumors in a very rapid manner. Assu ming the foci develop into true cancerous nodules within another month of the st udy, this would result in a chola ngiocarcinoma model executable in only 2 months from initiation of the protocol (2AAF implantation) and tumor development (89 weeks). That is definitely faster than the standard protocols utili zed in the literature.

PAGE 106

106 6.2.2.2 Use of Wnt1 in preneoplastic foci Conceivably Wnt1 exposure might reverse the changes seen during Wnt1 shRNA and 2AAF/PHx protocol. If so then this could be ut ilized to reverse preneoplastic changes initiated by disregulation of hepatic stem cells. Only studi es that replace the Wnt1 protein levels after shRNA could determine the efficacy of this tech nique, but if Wnt1 protein does rescue this phenotype, it could lead to therapie s in the early stages of cancer or preneoplastic changes seen in massive, chronic hepatic damage. Increasing the understanding of the regulat ion of stem cells can only aid in our understanding of the things that can potentially go wrong duri ng initiation and promotion of tumors. It may be that Wnt1 is the only si gnal preventing oval cells from becoming cancerous during stem cell based liver regeneration. This is possibly why oval cells are rarely seen in human livers. The need for oval cells must be so gr eat as to risk the pote ntial damage they could inflict if tight control on them is not maintained. This risk need not be taken in normal situations as hepatocytes have the immense capacity for pro liferation necessary to resolve most hepatic injuries. Perhaps oval cells are only seen in hum ans when hepatocyte function is beyond repair and the need outweighs the potential for damage induced by disregulation of the hepatic stem cell. 6.3 Future Studies 6.3.1 Continuation of the Wnt1 shRNA 2AAF/PHx Protocol Extending the shRNA studies will elucidate the question of whether the changes seen within the foci of atypical ductu lar hyperplasia are truly preneo plastic or benign. Resolution of these foci is possible and is seen in the DDC di et in mice. Remove the stimulus (DDC) and the oval cell numbers decline and the sites of atypical duc tular hyperplasia regress. If the foci present 21 days after PHx in the Wnt1 sh RNA treated animals do not regress but maintain themselves or

PAGE 107

107 progress into neoplastic lesions, then the functions of Wnt1 in oval cells must truly be discovered. Knowledge of one growth factor having such control over normal function or tumorgenic changes would greatly advance th e fields of stem ce ll and tumor biology. 6.3.2 Exposure of Oval Cells to Wnt1 Isolation of oval cells and exposure of them to Wnt1 in vitro may facilitate oval cell engraftment in oval cell transplantation. It also may induce hepatocyte differentiation in culture faster than the current differentiation protocols. Currently Wnt1 is not available in a palmitolated form. However, the same isolation procedure employed by Nusse et al. for Wnt3a, Wnt5a, Wnt5b, and Wnt7a (currently all sold by R and D Systems) could be easily employed. Furthermore, portal vein injections of Wnt1 protein during 2AAF/PHx protocol might increase the rate by which oval cells regenerate the liver Use of a retrovirus containing the Wnt1 gene could also be utilized to expose the infiltrating oval cells to an increase in Wnt1 signaling during 2AAF/PHx. 6.3.3 Wnt1 Conditional Knockout Animal Changes in Wnt levels during embryogenesis re sults in severe and drastic malformations of numerous tissues and/or failure of the embr yo to fully develop, therefore development of a Wnt1 conditional knockout could further define the role of Wnt1 in liver regeneration. Controlling Wnt1 with a Tet on/off system a nd the albumin promoter would result in a conditional knockout that would only be active in the liver when desired, i.e. during oval cell activation protocols. This knockout would confirm the results s een in this study and provide alternative methods for looking at the role of Wnt1 in the liver. 6.3.4 Summary of Proposed Experiments Each of these experiments would confirm th e results found in this study while enhancing the knowledge of Wnt1s role in oval cell based liver regenera tion and normal liver function.

PAGE 108

108 Complete understanding of Wnt1 s functions during these pro cesses is essential for the understanding of oval cell based li ver regeneration. This study has demonstrated the crucial role Wnt1 plays in initiation of oval cell hepatocyte differentiation, as well as how disregulation of Wnt1 creates a potentially prene oplastic state in oval cells.

PAGE 109

109 LIST OF REFERENCES 1. Desmet,V.J. The liver: biology and pathobiol ogy. Arias,I.M. & Boyer,J.L. (eds.), pp. 3-15, Raven Press, New York (2001). 2. Crawford,J.M. Robbins and Cotran: Pathol ogic Basis of Disease. Kumar,V., Abbas,A. & Fausto N. (eds.), pp. 877-938, Else vier Saunders, Philadelphia (2005). 3. Cunningham,C.C. & Van Horn,C.G. Energy availability and al cohol-related liver pathology. Alcohol Res. Health 27 291-299 (2003). 4. Ross,M.H., Kaye,G.I. & Pawlina,W. Histol ogy: a text and atlas. Lippincott Williams & Wilkins, Philadelphia, Pa (2003). 5. Fausto N. The Liver biology and pathobi ology. Arias,I.M. & Boyer,J.L. (eds.), pp. 15011518, Raven Press, New York (1994). 6. Saxena,R., Theise,N.D. & Crawford,J.M. Mi croanatomy of the human liver-exploring the hidden interfaces. Hepatology 30 1339-1346 (1999). 7. Steer,C.J. Liver regeneration. FASEB J. 9 1396-1400 (1995). 8. Higgins,G.M. & Anderson R.M. Experimental pathology of the liver: Restoration of the liver of the white rat following partial surgical removal. Arch Pathol 12 186-202 (1931). 9. Bucher NLR. Regeneration of Mammalian Liver. Int Rev Cytol 15 245 (1963). 10. Michalopoulos,G.K. Liver regeneration: mo lecular mechanisms of growth control. FASEB J. 4 176-187 (1990). 11. Rabes,H.M. Kinetics of hepatocellular prol iferation after partial resection of the liver. Prog. Liver Dis. 5 83-99 (1976). 12. Petersen,B.E. Hepatic stem cells and gr owth factor regulation in liver regeneration following toxic injury. 1996. Graduate School of Public Health, Dept. of Environmental and Occupational Health and Toxico logy, University of Pittsburgh. Ref Type: Thesis/Dissertation 13. Michalopoulos,G.K. & DeFrances,M.C. Liver regeneration. Science 276 60-66 (1997). 14. Badr,M.Z., Belinsky,S.A., Kauffman,F.C. & Thurman,R.G. Mechanism of hepatotoxicity to periportal regions of the liver lobule due to allyl alcohol: ro le of oxygen and lipid peroxidation. J. Pharmacol. Exp. Ther. 238 1138-1142 (1986). 15. Edwards,M.J., Keller,B.J., Kauffman,F.C & Thurman,R.G. The i nvolvement of Kupffer cells in carbon tetrachloride toxicity. Toxicol. Appl. Pharmacol. 119 275-279 (1993). 16. Lombardi,B. & Ugazio,G. Serum lipoproteins in rats wi th carbon tetrachloride-induced fatty liver. J. Lipid Res. 6 498-505 (1965).

PAGE 110

110 17. Reid,W.D. Mechanism of ally l alcohol-induced hepatic necrosis. Experientia 28 10581061 (1972). 18. Fisher,R.A. & Strom,S.C. Human hepato cyte transplantation: worldwide results. Transplantation 82 441-449 (2006). 19. Matas,A.J. et al. Hepatocellular transplantation for metabolic deficiencies: decrease of plasms bilirubin in Gunn rats. Science 192 892-894 (1976). 20. Mito,M., Kusano,M. & Kawaura,Y. Hepatocyte transplantation in man. Transplant. Proc. 24 3052-3053 (1992). 21. Raper,S.E. et al. Safety and feasibility of liver-d irected ex vivo gene therapy for homozygous familial hypercholesterolemia. Ann. Surg. 223 116-126 (1996). 22. Ambrosino,G. et al. Isolated hepatocyte transplantati on for Crigler-Najjar syndrome type 1. Cell Transplant. 14 151-157 (2005). 23. Fox,I.J. et al. Treatment of the Crigler-Najjar sy ndrome type I with hepatocyte transplantation. N. Engl. J. Med. 338 1422-1426 (1998). 24. Horslen,S.P. & Fox,I.J. Hepatocyte transplantation. Transplantation 77 1481-1486 (2004). 25. Hughes,R.D., Mitry,R.R. & Dhawan,A. Hepa tocyte transplantation for metabolic liver disease: UK experience. J. R. Soc. Med. 98 341-345 (2005). 26. Soriano,H.E. et al. Lack of C/EBP alpha gene ex pression results in increased DNA synthesis and an increased frequency of immortalizati on of freshly isolated mice [correction of rat] hepatocytes. Hepatology 27 392-401 (1998). 27. Strom,S.C. et al. Hepatocyte transplantati on as a bridge to orthot opic liver transplantation in terminal liver failure. Transplantation 63 559-569 (1997). 28. Parkin,D.M., Bray,F., Ferlay,J. & Pisani,P. Global cancer statistics, 2002. CA Cancer J. Clin. 55 74-108 (2005). 29. Di Bisceglie,A.M., Rustgi,V.K., Hoof nagle,J.H., Dusheiko,G.M. & Lotze,M.T. NIH conference. Hepatocellular carcinoma. Ann. Intern. Med. 108 390-401 (1988). 30. Goodman,Z.D. Neoplasms of the liver. Mod. Pathol. 20 Suppl 1 S49-S60 (2007). 31. Maximow A. Der Lymphozyt als gemeinsame Stammzelle der verschiedenen Blutelemente in der embryonalen Entwicklung und im postfetalen Leben der Sugetiere. Folia Haematol. Int. Mag. Klin. Morphol. Blutforsch. 8 125-141 (1909). 32. Buckner,C.D. et al. Allogeneic marrow engraftment following whole body irradiation in a patient with leukemia. Blood 35 741-750 (1970).

PAGE 111

111 33. Osawa,M., Hanada,K., Hamada,H. & Na kauchi,H. Long-term lymphohematopoietic reconstitution by a single CD34-low/ne gative hematopoietic stem cell. Science 273 242245 (1996). 34. Pappenheim,A. Morphologische Hmato logie. W. Klinkhardt, Leipzig (1919). 35. Magnuson,T., Epstein,C.J., Silver,L.M. & Ma rtin,G.R. Pluripotent embryonic stem cell lines can be derived from tw5/tw5 blastocysts. Nature 298 750-753 (1982). 36. Evans,M.J. & Kaufman,M.H. Establishment in culture of pluripotential cells from mouse embryos. Nature 292 154-156 (1981). 37. Keller,G.M. In vitro differe ntiation of embryonic stem cells. Curr. Opin. Cell Biol. 7 862869 (1995). 38. Martin,G.R. Isolation of a pluripotent cell line from ear ly mouse embryos cultured in medium conditioned by teratocarcinoma stem cells. Proc. Natl. Acad. Sci. U. S. A 78 7634-7638 (1981). 39. Smith,A.G. Embryo-derived stem cells: of mice and men. Annu. Rev. Cell Dev. Biol. 17 435-462 (2001). 40. Kabrun,N. et al. Flk-1 expression defines a populati on of early embryonic hematopoietic precursors. Development 124 2039-2048 (1997). 41. Nishikawa,S.I., Nishikawa,S., Hirashima,M., Matsuyoshi,N. & Kodama,H. Progressive lineage analysis by cell sorting and culture identifies FLK1+VE-cadherin+ cells at a diverging point of endothelia l and hemopoietic lineages. Development 125 1747-1757 (1998). 42. Robertson,S.M., Kennedy,M., Shannon,J.M. & Keller,G. A transiti onal stage in the commitment of mesoderm to hematopoiesis re quiring the transcrip tion factor SCL/tal-1. Development 127 2447-2459 (2000). 43. Schmitt,R.M., Bruyns,E. & Snodgrass,H.R. He matopoietic development of embryonic stem cells in vitro: cytokine and receptor gene expression. Genes Dev. 5 728-740 (1991). 44. Faloon,P. et al. Basic fibroblast growth factor positively regulates hematopoietic development. Development 127 1931-1941 (2000). 45. Fehling,H.J. et al. Tracking mesoderm induction and its specification to the hemangioblast during embryonic stem cell differentiation. Development 130 4217-4227 (2003). 46. Huber,T.L., Kouskoff,V., Fehling,H.J., Palis ,J. & Keller,G. Haemangioblast commitment is initiated in the primitive streak of the mouse embryo. Nature 432 625-630 (2004). 47. Lacaud,G. et al. Runx1 is essential for hematopoietic commitment at the hemangioblast stage of development in vitro. Blood 100 458-466 (2002).

PAGE 112

112 48. Bautch,V.L. et al. Characterization of the vasculogenic block in the abse nce of vascular endothelial growth factor-A. Blood 95 1979-1987 (2000). 49. Kearney,J.B. et al. Vascular endothelial growth factor receptor Flt-1 negatively regulates developmental blood vessel formation by modulating endoth elial cell division. Blood 99 2397-2407 (2002). 50. Roberts,D.M. et al. The vascular endothelial growth factor (VEGF) receptor Flt-1 (VEGFR-1) modulates Flk-1 (VEGFR-2) signaling during blood vessel formation. Am. J. Pathol. 164 1531-1535 (2004). 51. Zippo,A., De Robertis,A., Bardelli,M., Galva gni,F. & Oliviero,S. Id entification of Flk-1 target genes in vasculogenesis: Pim-1 is required for endothelial and mural cell differentiation in vitro. Blood 103 4536-4544 (2004). 52. Maltsev,V.A., Rohwedel,J., Heschele r,J. & Wobus,A.M. Embryonic stem cells differentiate in vitro into cardiomyocytes repr esenting sinusnodal, atri al and ventricular cell types. Mech. Dev. 44 41-50 (1993). 53. Hescheler,J. et al. Embryonic stem cells: a model to study structural and functional properties in cardiomyogenesis. Cardiovasc. Res. 36 149-162 (1997). 54. Banach,K., Halbach,M.D., Hu,P., Hescheler, J. & Egert,U. Development of electrical activity in cardiac myocyte aggregates derived from mouse embryonic stem cells. Am. J. Physiol Heart Circ. Physiol 284 H2114-H2123 (2003). 55. Buttery,L.D. et al. Differentiation of osteoblasts and in vitro bone formation from murine embryonic stem cells. Tissue Eng 7 89-99 (2001). 56. Rohwedel,J. et al. Muscle cell differentiation of embr yonic stem cells reflects myogenesis in vivo: developmentally regulated expres sion of myogenic determination genes and functional expression of ionic currents. Dev. Biol. 164 87-101 (1994). 57. Kramer,J. et al. Embryonic stem cell-derived chondr ogenic differentiation in vitro: activation by BMP-2 and BMP-4. Mech. Dev. 92 193-205 (2000). 58. Dani,C. et al. Differentiation of embryonic stem cells into adipocytes in vitro. J. Cell Sci. 110 ( Pt 11) 1279-1285 (1997). 59. Lumelsky,N. et al. Differentiation of embryonic stem ce lls to insulin-secreting structures similar to pancreatic islets. Science 292 1389-1394 (2001). 60. Hamazaki,T. et al. Hepatic maturation in differentia ting embryonic stem cells in vitro. FEBS Lett. 497 15-19 (2001). 61. Chinzei,R. et al. Embryoid-body cells derived from a mouse embryonic stem cell line show differentiation into functional hepatocytes. Hepatology 36 22-29 (2002).

PAGE 113

113 62. Gault,V.A. et al. Effects of Subchronic Treatmen t With the Long-Acting GlucoseDependent Insulinotropic Polypeptide Receptor Agonist, N-AcGIP, on Glucose Homeostasis in Streptoz otocin-Induced Diabetes. Pancreas 35 73-79 (2007). 63. Asahara,T. et al. Isolation of putative progenitor e ndothelial cells for angiogenesis. Science 275 964-967 (1997). 64. Ferrari,G. et al. Muscle regeneration by bone marr ow-derived myogenic progenitors. Science 279 1528-1530 (1998). 65. Petersen,B.E. et al. Bone marrow as a potential s ource of hepatic oval cells. Science 284 1168-1170 (1999). 66. Bjornson,C.R., Rietze,R.L., Reynolds,B.A., Magli,M.C. & Vescovi,A.L. Turning brain into blood: a hematopoietic fate adopted by adult neural stem cells in vivo. Science 283 534537 (1999). 67. Clarke,D.L. et al. Generalized potential of a dult neural stem cells. Science 288 1660-1663 (2000). 68. Alison,M.R. et al. Hepatocytes from non-hepatic adult stem cells. Nature 406 257 (2000). 69. Theise,N.D. et al. Liver from bone marrow in humans. Hepatology 32 11-16 (2000). 70. Theise,N.D. et al. Derivation of hepatocytes from bone marrow cells in mice after radiation-induced myeloablation. Hepatology 31 235-240 (2000). 71. Krause,D.S. et al. Multi-organ, multi-lineage engraftment by a single bone marrow-derived stem cell. Cell 105 369-377 (2001). 72. Herzog,E.L., Chai,L. & Krause,D.S. Pl asticity of marrow-derived stem cells. Blood 102 3483-3493 (2003). 73. Ianus,A., Holz,G.G., Theise,N.D. & Hussain,M .A. In vivo derivation of glucose-competent pancreatic endocrine cells from bone marrow without evidence of cell fusion. J. Clin. Invest 111 843-850 (2003). 74. Korbling,M. et al. Hepatocytes and epithe lial cells of donor origin in recipients of peripheral-blood stem cells. N. Engl. J. Med. 346 738-746 (2002). 75. Jiang,Y. et al. Pluripotency of mesenchymal stem cells derived from adult marrow. Nature 418 41-49 (2002). 76. Horwitz,E.M. Stem cell plasticity: a new im age of the bone marrow stem cell. Curr. Opin. Pediatr. 15 32-37 (2003). 77. Petersen,B.E. Hepatic "stem" cells: coming full circle. Blood Cells Mol. Dis. 27 590-600 (2001).

PAGE 114

114 78. Petersen,B.E. & Terada,N. Stem cells: a journey into a new frontier. J. Am. Soc. Nephrol. 12 1773-1780 (2001). 79. Boyle,A.J., Schulman,S.P., Hare,J.M. & Oettgen ,P. Is stem cell therapy ready for patients? Stem Cell Therapy for Cardiac Repair. Ready for the Next Step. Circulation 114 339-352 (2006). 80. Lindvall,O. & Kokaia,Z. Stem cells for the treatment of neurological disorders. Nature 441 1094-1096 (2006). 81. Sam,J., Angoulvant,D., Fazel,S., Weisel,R .D. & Li,R.K. Heart ce ll implantation after myocardial infarction. Coron. Artery Dis. 16 85-91 (2005). 82. Hollander,A.P. et al. Maturation of tissue engineered ca rtilage implanted in injured and osteoarthritic human knees. Tissue Eng 12 1787-1798 (2006). 83. Kuo,C.K., Li,W.J., Mauck,R.L. & Tuan,R.S. Ca rtilage tissue engineering: its potential and uses. Curr. Opin. Rheumatol. 18 64-73 (2006). 84. Cebotari,S. et al. Clinical application of tissue e ngineered human heart valves using autologous progenitor cells. Circulation 114 I132-I137 (2006). 85. Atala,A., Bauer,S.B., Soker,S., Yoo,J.J & Retik,A.B. Tissue-engineered autologous bladders for patients needing cystoplasty. Lancet 367 1241-1246 (2006). 86. Lindeman,B. et al. Alteration of G1 cell-cycle protein expression and induction of p53 but not p21/waf1 by the DNA-modifying carcinoge n 2-acetylaminofluorene in growthstimulated hepatocytes in vitro. Mol. Carcinog. 24 36-46 (1999). 87. Petersen,B.E., Zajac,V.F. & Michalopoulos,G.K Hepatic oval cell activ ation in response to injury following chemically induced peri portal or pericentral damage in rats. Hepatology 27 1030-1038 (1998). 88. Petersen,B.E., Goff,J.P., Greenberger ,J.S. & Michalopoulos,G.K. Hepatic oval cells express the hematopoietic stem cell marker Thy-1 in the rat. Hepatology 27 433-445 (1998). 89. Petersen,B.E. et al. Mouse A6-positive hepatic oval cells also express several hematopoietic stem cell markers. Hepatology 37 632-640 (2003). 90. Corcelle,V., Stieger,B., Gjinovci,A., Wollh eim,C.B. & Gauthier,B.R. Characterization of two distinct liver progenitor cell subpopulations of hematopoi etic and hepatic origins. Exp. Cell Res. 312 2826-2836 (2006). 91. Guettier,C. Which stem cells for adult liver?. Ann. Pathol. 25 33-44 (2005). 92. Qin,A.L., Zhou,X.Q., Zhang,W., Yu,H. & Xi e,Q. Characterization and enrichment of hepatic progenitor cells in adult rat liver. World J. Gastroenterol. 10 1480-1486 (2004).

PAGE 115

115 93. Strain,A.J., Crosby,H.A., Nijjar,S., Kelly,D .A. & Hubscher,S.G. Human liver-derived stem cells. Semin. Liver Dis. 23 373-384 (2003). 94. Van Den Heuvel,M.C. et al. Expression of anti-OV6 antibody and anti-N-CAM antibody along the biliary line of normal and diseased human livers. Hepatology 33 1387-1393 (2001). 95. Kano,J., Noguchi,M., Kodama,M. & Tokiwa,T The in vitro differentiating capacity of nonparenchymal epithelial cells deri ved from adult porcine livers. Am. J. Pathol. 156 2033-2043 (2000). 96. Roskams,T., De Vos,R. & Desmet,V. 'Undi fferentiated progenitor cells' in focal nodular hyperplasia of the liver. Histopathology 28 291-299 (1996). 97. Yang,L., Faris,R.A. & Hixson,D.C. Charac terization of a mature bile duct antigen expressed on a subpopulation of biliary duc tular cells but absent from oval cells. Hepatology 18 357-366 (1993). 98. Yang,L., Faris,R.A. & Hixson,D.C. Long-term culture and characte ristics of normal rat liver bile duct epithelial cells. Gastroenterology 104 840-852 (1993). 99. Zvibel,I., Fiorino,A.S., Brill,S. & Reid,L.M Phenotypic characterization of rat hepatoma cell lines and lineage-specific regulation of gene expression by differentiation agents. Differentiation 63 215-223 (1998). 100. Engelhardt,N.V. et al. Common antigen of oval and bili ary epithelial cells (A6) is a differentiation marker of epithel ial and erythroid cell lineages in early development of the mouse. Differentiation 55 19-26 (1993). 101. Evarts,R.P., Hu,Z., Fujio,K., Marsden,E.R. & Thorgeirsson,S.S. Activat ion of hepatic stem cell compartment in the rat: role of transfor ming growth factor alpha hepatocyte growth factor, and acidic fibroblast growth factor in early proliferation. Cell Growth Differ. 4 555561 (1993). 102. Hixson,D.C. & Allison,J.P. Monoclonal antibodi es recognizing oval cells induced in the liver of rats by N-2-fluorenylacetamide or ethionine in a choline-deficient diet. Cancer Res. 45 3750-3760 (1985). 103. Evarts,R.P., Nagy,P., Marsden,E. & Thorgeir sson,S.S. A precursor-product relationship exists between oval cells and hepatocytes in rat liver. Carcinogenesis 8 1737-1740 (1987). 104. Evarts,R.P., Nagy,P., Nakatsukasa,H., Marsden,E. & Thorgeirsson,S.S. In vivo differentiation of rat liver oval cells into hepatocytes. Cancer Res. 49 1541-1547 (1989). 105. Fausto,N. Protooncogenes and growth factor s associated with normal and abnormal liver growth. Dig. Dis. Sci. 36 653-658 (1991).

PAGE 116

116 106. Preisegger,K.H. et al. Atypical ductular proliferation and its inhibition by transforming growth factor beta1 in the 3,5-diethoxy carbonyl-1,4-dihydrocollidine mouse model for chronic alcoholic liver disease. Lab Invest 79 103-109 (1999). 107. Golding,M., Sarraf,C., Lalani,E. & Alison,M .R. Reactive biliary epithelium: The product of a pluripotential stem cell compartment? Human Pathology 27 872-884 (1996). 108. Sigal,S.H. et al. Evidence for Stem-Cells and Lineages in Embryonic and Adult Liver, A Tissue Assuming A Quiescent State. Journal of Cellular Biochemistry 268 (1993). 109. Evarts,R.P. et al. Cellular and molecular changes in the early stages of chemical hepatocarcinogenesis in the rat. Cancer Res. 50 3439-3444 (1990). 110. Lemire,J.M. & Fausto,N. Multiple alpha-fet oprotein RNAs in adult rat liver: cell typespecific expression and differential regulation. Cancer Res. 51 4656-4664 (1991). 111. Marceau,N., Grenier,A., Noel,M., Mailhot,D & Loranger,A. Modulation of cytokeratin and actin gene expression and fibrillar or ganization in cultured rat hepatocytes. Biochem. Cell Biol. 70 1238-1248 (1992). 112. Petersen,B.E., Zajac,V.F. & Michalopoulos,G.K. Bile ductular damage induced by methylene dianiline inhib its oval cell activation. Am. J. Pathol. 151 905-909 (1997). 113. Lagasse,E. et al. Purified hematopoietic stem cells can differentiate into hepatocytes in vivo. Nat. Med. 6 1229-1234 (2000). 114. Deng,J., Steindler,D.A., Laywell,E.D. & Pe tersen,B.E. Neural trans-differentiation potential of hepatic oval cells in the neonatal mouse brain. Exp. Neurol. 182 373-382 (2003). 115. Lowes,K.N., Croager,E.J., Olynyk,J.K., Abraham,L.J. & Yeoh,G.C. Oval cell-mediated liver regeneration: Role of cy tokines and growth factors. J. Gastroenterol. Hepatol. 18 412 (2003). 116. Kinosita,R. Studies on the cance rogenic chemical substances. Transactions of the Japanese Pathological Society 665-727 (1937). 117. Farber E. Similarities in the sequence of early histologic changes induced in the liver of the rat by ethionine, 2-acetylaminoflouorene, and 3'-methyl-4-dimethylaminoazbenzene. Cancer Res. 16, 142. 1956. Ref Type: Journal (Full) 118. Leduc,E.H. & Wilson,J.W. Injury to liver cells in carbon tetrachloride poisoning; histochemical changes induced by carbon te trachloride in mouse liver protected by sulfaguanidine. AMA. Arch. Pathol. 65 147-157 (1958).

PAGE 117

117 119. Lemire,J.M., Shiojiri,N. & Fausto,N. Oval cell proliferation and the origin of small hepatocytes in liver injury induced by D-galactosamine. Am. J. Pathol. 139 535-552 (1991). 120. Price,J.M., Harman,J.W., Miller,E.C. & Miller ,J.A. Progressive microscopic alterations in the livers of rats fed the hepatic carcinogens 3'-methyl-4-d imethylaminoazobenzene and 4'fluoro-4-dimethylaminoazobenzene. Cancer Res. 12 192-200 (1952). 121. Wilson,J.W. &Leduc,E.H. Role of cholangioles in restoration of th e liver of the mouse after dietary injury. J. Pathol. Bacteriol. 76 441-449 (1958). 122. Petersen,B.E. & Hatch,H.M. Methods of tissu e engineering. Atala,A. & Lanza,R.P. (eds.), pp. 429-437 (Academic Press, San Diego, CA,2001). 123. Sell,S. Stem cell origin of cancer and differentiation therapy. Crit Rev. Oncol. Hematol. 51 1-28 (2004). 124. Farber,E. Hepatocyte proliferation in step wise development of e xperimental liver cell cancer. Dig. Dis. Sci. 36 973-978 (1991). 125. Sell,S. & Pierce,G.B. Maturation arrest of stem cell differentiation is a common pathway for the cellular origin of teratocarcinomas and epithelial cancers. Lab Invest 70 6-22 (1994). 126. Dunsford,H.A., Karnasuta,C., Hunt,J.M. & Sell ,S. Different lineages of chemically induced hepatocellular carcinoma in rats defined by monoclonal antibodies. Cancer Res. 49 48944900 (1989). 127. Dunsford,H.A. & Sell,S. Production of monoc lonal antibodies to pr eneoplastic liver cell populations induced by chemical carcinogens in rats and to transplantable Morris hepatomas. Cancer Res. 49 4887-4893 (1989). 128. Van Eyken,P. et al. Cytokeratin expression in hepatocellular carcinoma: an immunohistochemical study. Hum. Pathol 19 562-568 (1988). 129. Denk,H., Krepler,R., Lackinger,E., Ar tlieb,U. & Franke,W.W. Biochemical and immunocytochemical analysis of the intermedia te filament cytoskeleton in human hepatocellular carcinomas and in hepatic neoplastic nodules of mice. Lab Invest 46 584596 (1982). 130. Hsia,C.C., Evarts,R.P., Nakatsukasa,H., Ma rsden,E.R. & Thorgeirsson,S.S. Occurrence of oval-type cells in hepatitis B virus-as sociated human hepatocarcinogenesis. Hepatology 16 1327-1333 (1992). 131. Vandersteenhoven,A.M., Burchette,J. & Mich alopoulos,G. Characte rization of ductular hepatocytes in end-stage cirrhosis. Arch Pathol Lab Med. 114 403-406 (1990).

PAGE 118

118 132. Fausto,N. Oval cells and liver carcinogenesis: an analysis of cell lineages in hepatic tumors using oncogene transfection techniques. Prog. Clin. Biol. Res. 331 325-334 (1990). 133. Garfield,S., Huber,B.E., Nagy,P., Cordi ngley,M.G. & Thorgeirsson,S.S. Neoplastic transformation and lineage switching of rat liv er epithelial cells by retrovirus-associated oncogenes. Mol. Carcinog. 1 189-195 (1988). 134. Marceau,N. Cell lineages and differentiation pr ograms in epidermal, urothelial and hepatic tissues and their neoplasms. Lab Invest 63 4-20 (1990). 135. Gordon,M.D. & Nusse,R. Wnt signaling: multiple pathways, multiple receptors, and multiple transcription factors. J. Biol. Chem. 281 22429-22433 (2006). 136. Willert,K. et al. Wnt proteins are lipid-modified and can act as stem cell growth factors. Nature 423 448-452 (2003). 137. He,X. & Axelrod,J.D. A WN Ter wonderland in Snowbird. Development 133 2597-2603 (2006). 138. Hinck,L., Nelson,W.J. & Papkoff,J. Wnt-1 modulates cell-cell adhesion in mammalian cells by stabilizing beta-cat enin binding to the cell adhesion protein cadherin. J. Cell Biol. 124 729-741 (1994). 139. Nusse,R. & Varmus,H.E. Many tumors induced by the mouse mammary tumor virus contain a provirus integrated in th e same region of the host genome. Cell 31 99-109 (1982). 140. Smalley,M.J. & Dale,T.C. Wnt signalling in mammalian development and cancer. Cancer Metastasis Rev. 18 215-230 (1999). 141. Wodarz,A. & Nusse,R. Mechanisms of Wnt signaling in development. Annu. Rev. Cell Dev. Biol. 14 59-88 (1998). 142. Borycki,A.G. & Emerson,C.P., Jr. Multiple tissue interactions and signal transduction pathways control somite myogenesis. Curr. Top. Dev. Biol. 48 165-224 (2000). 143. Church,V.L. & Francis-West,P. Wnt signalling during limb development. Int. J. Dev. Biol. 46 927-936 (2002). 144. Deardorff,M.A. & Klein,P.S. Xenopus frizzled-2 is expressed highly in the developing eye, otic vesicle and somites. Mech. Dev. 87 229-233 (1999). 145. Galli,L.M. et al. A proliferative role for Wnt-3a in chick somites. Dev. Biol. 269 489-504 (2004). 146. Hartmann,C. & Tabin,C.J. Dual roles of Wnt signaling during chondrogenesis in the chicken limb. Development 127 3141-3159 (2000).

PAGE 119

119 147. Hartmann,C. & Tabin,C.J. Wnt-14 plays a pivota l role in inducing synovial joint formation in the developing appendicular skeleton. Cell 104 341-351 (2001). 148. Ikeya,M., Lee,S.M., Johnson,J.E., McMahon,A.P & Takada,S. Wnt signalling required for expansion of neural crest and CNS progenitors. Nature 389 966-970 (1997). 149. Lee,S.M., Tole,S., Grove,E. & McMahon,A.P A local Wnt-3a signal is required for development of the mammalian hippocampus. Development 127 457-467 (2000). 150. Sela-Donenfeld,D. & Kalcheim,C. Localized BMP4-noggin interactions generate the dynamic patterning of noggin expression in somites. Dev. Biol. 246 311-328 (2002). 151. Yamaguchi,T.P., Bradley,A., McMahon,A.P. & Jones,S. A Wnt5a pathway underlies outgrowth of multiple structur es in the vertebrate embryo. Development 126 1211-1223 (1999). 152. Bienz,M. & Clevers,H. Linking colorectal cancer to Wnt signaling. Cell 103 311-320 (2000). 153. Kostakopoulou,K., Vogel,A., Brickell,P. & Tick le,C. 'Regeneration' of wing bud stumps of chick embryos and reactivation of Msx-1 a nd Shh expression in response to FGF-4 and ridge signals. Mech. Dev. 55 119-131 (1996). 154. Reya,T. et al. A role for Wnt signalling in self-r enewal of haematopoietic stem cells. Nature 423 409-414 (2003). 155. Kioussi,C. et al. Identification of a Wnt/Dvl/beta-Ca tenin --> Pitx2 pathway mediating cell-type-specific prolifer ation during development. Cell 111 673-685 (2002). 156. Treier,M. et al. Multistep signaling requirements fo r pituitary organogenesis in vivo. Genes Dev. 12 1691-1704 (1998). 157. van de Wetering,M. et al. The beta-catenin/TCF-4 complex imposes a crypt progenitor phenotype on colorectal cancer cells. Cell 111 241-250 (2002). 158. Karim,R., Tse,G., Putti,T., Scolyer,R. & Lee, S. The significance of the Wnt pathway in the pathology of human cancers. Pathology 36 120-128 (2004). 159. Luo,J. et al. Wnt signaling and human diseases: what are the therapeutic implications? Lab Invest 87 97-103 (2007). 160. Torres,M.A. et al. Activities of the Wnt-1 class of secreted signaling factors are antagonized by the Wnt-5A class and by a dom inant negative cadherin in early Xenopus development. J. Cell Biol. 133 1123-1137 (1996). 161. Monga,S.P., Pediaditakis,P., Mule,K., Stol z,D.B. & Michalopoulos,G.K. Changes in WNT/beta-catenin pathway during regulat ed growth in rat liver regeneration. Hepatology 33 1098-1109 (2001).

PAGE 120

120 162. Thompson,M.D. & Monga,S.P. WNT/beta-catenin signaling in liver health and disease. Hepatology 45 1298-1305 (2007). 163. Cadoret,A. et al. Hepatomegaly in transgenic mice e xpressing an oncogenic form of betacatenin. Cancer Res. 61 3245-3249 (2001). 164. Tan,X. et al. Epidermal growth factor receptor: a novel target of th e Wnt/beta-catenin pathway in liver. Gastroenterology 129 285-302 (2005). 165. Benhamouche,S., Decaens,T., Perret,C. & Co lnot,S. Wnt/beta-cateni n pathway and liver metabolic zonation: a new player for an old concept. Med. Sci. (Paris) 22 904-906 (2006). 166. Benhamouche,S. et al. Apc tumor suppressor gene is the "zonation-keeper" of mouse liver. Dev. Cell 10 759-770 (2006). 167. Tsao,M.S., Smith,J.D., Nelson,K.G. & Grisham, J.W. A diploid epithe lial cell line from normal adult rat liver with phenot ypic properties of 'oval' cells. Exp. Cell Res. 154 38-52 (1984). 168. Muller-Borer,B.J. et al. Mechanisms controlling the acq uisition of a cardiac phenotype by liver stem cells. Proc. Natl. Acad. Sci. U. S. A 104 3877-3882 (2007). 169. Couchie,D. et al. Expression and role of Gas6 protei n and of its receptor Axl in hepatic regeneration from ova l cells in the rat. Gastroenterology 129 1633-1642 (2005). 170. Zhong,X.G., He,S., Yin,W., Deng,J.Y. & Chen,B. Tropism of adult liver stem cells toward hepatocellular carcinoma cells in vitro. Zhonghua Gan Zang. Bing. Za Zhi. 13 644-647 (2005). 171. Muller-Borer,B.J. et al. Adult-derived liver stem cells ac quire a cardiomyocyte structural and functional phenotype ex vivo. Am. J. Pathol. 165 135-145 (2004). 172. Couchie,D., Holic,N., Chobert,M.N., Corlu,A. & Laperche,Y. In vitro differentiation of WB-F344 rat liver epith elial cells into th e biliary lineage. Differentiation 69 209-215 (2002). 173. Coleman,W.B. et al. Evaluation of the differentiation potential of WB-F344 rat liver epithelial stem-like cells in vivo. Differentiati on to hepatocytes after transplantation into dipeptidylpeptidase-IV-d eficient rat liver. Am. J. Pathol. 151 353-359 (1997).

PAGE 121

121 BIOGRAPHICAL SKETCH Jennifer Marie LaPlante was bor n in St. Louis, MO. She attended St. Elizabeths of Hungary School until seventh grade (1990) when she moved to Woodstock, IL. Here she finished grade school at St. Ma rys of Woodstock and completed high school at Marian Central Catholic High School. During high school she was actively involved in sports achieving varsity letters in volleyball, softball, and basketball. As editor in chief of the school newspaper, a member of the National Honor Society, the leader of academic clubs such as Math team and J.E.T.S., and a straight A stude nt, she was rewarded with a Presidential Scholarship to Ohio Wesleyan University (OWU). While attending OWU Jennifer was an active me mber of her sorority, Delta Delta Delta and involved in various c horal groups. She was inducted into the Omicron Delta Kappa, Phi Beta Kappa, Phi Sigma, and Phi Sigma Iota Societies as well as a member of the Deans list. Jennifer was awarded honorary admission into the Sigma Xi society based on her senior thesis work sequencing the 16s rRNA isolated from the intes tinal contents of the Licking County American Mastodont ( Mammut americanum ; NCBI Accession #s AF279699 and AF279699.1). During the semester of the fall of 1998, she studied abro ad in Salamanca, Spain, and in 2000, Jennifer graduated with a Bachelor of Arts in Botany/Mi crobiology with a concentration in genetics and a minor in Spanish. Jennifer was accepted into the University of Florida MD-PhD program beginning the fall of 2000. During her two years of didactic medical school work, Jennifer was active in numerous medical associations and volunteer organizatio ns including the AMA-MSS, AMSA, and the student run Equal Access Volunteer Health C linic. Jennifer served the AMA nationally in various positions includ ing serving as the medical student liaison to the NBME for 3 years.

PAGE 122

122 After completing her medical school didactic years as well as the USMLE step I exam, Jennifer began her graduate studies in the Univ ersity of Florida Inte rdisciplinary Program. Jennifer studied under the tutelage of Dr. Bryon E. Petersen in the University of Florida Department of Pathology during he r graduate work. Her project c onsisted of discerning the role of Wnt1 in oval cell based liver regeneration. Jenn ifer presented a portion of her research at the Washington, DC, 2006 national convention of the American Association for Cancer Research (AACR). Jennifer then married Matthew James Williams on July 17th, 2006. She completed her dissertation requirements and return ed to her clinical studies in order to complete her medical degree at the University of Florida.