<%BANNER%>

Phylogeography of the Swallow-Tailed Kite (Elanoides fortificatus)

Permanent Link: http://ufdc.ufl.edu/UFE0021296/00001

Material Information

Title: Phylogeography of the Swallow-Tailed Kite (Elanoides fortificatus)
Physical Description: 1 online resource (141 p.)
Language: english
Creator: Washburn, Audrey W
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2007

Subjects

Subjects / Keywords: dispersal, distance, elanoides, flow, forficatus, gene, kite, long, migration, migratory, pantanal, phylogeography, program, structure, swallow, swallowtailed, tailed, transequatorial
Wildlife Ecology and Conservation -- Dissertations, Academic -- UF
Genre: Wildlife Ecology and Conservation thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Little is known about genetic or morphologic variation in the Swallow-tailed Kite (STKI). I investigated patterns of global variation to test hypotheses relating to species history (origin and expansion) and behavior (dispersal and breeding). The STKI is highly mobile, social year round, and wide-ranging within and between its summer and winter ranges. Migration patterns allow frequent, extensive interaction among populations, from the southeastern U.S. to southeastern Brazil. It has been assumed that migration and dispersal are correlated, and that highly vagile animals will show less subdivision than more sedentary relatives, due to gene flow among populations. However, STKIs are thought to be natally philopatric in the US and long-distance migrants are generally known to operate on rigid schedules, which might discourage behaviors associated with gene flow. I assessed gene flow in STKIs with phylogenetic- and frequency-based analyses of mitochondrial and nuclear intron sequence data taken from live and museum specimens spanning the species? range. I also measured morphological variables currently used to distinguish subspecies. I found deep genetic divisions in the STKI without correlated morphological breaks. Mitochondrial clades were geographically coherent and corresponded to these 'genetic populations': 1. the southeastern U.S.; 2. southern Mexico to central Brazil; and 3. central to southern Brazil. The division near the Pantanal in central Brazil was unexpected. Nuclear loci also showed support for a U.S. population. Phylogenetic trees indicated an historic lack of gene flow among the three areas. One recent gene flow event was detected between the two southerly genetic populations and attributed to proximity rather than to migratory behavior. Coalescent and diversity analyses suggested that these populations originated in the early to late Pleistocene, the northern being the youngest. These STKI populations apparently have remained isolated throughout glacial cycles and range changes, resulting in a distribution where a large neotropical population of residents and short-distance migrants is bordered to the north and south by smaller temperate-breeding populations of long-distance migrants. Each population lacked phylogeographic structure. I suggest likely scenarios for population histories, reasons for current population boundaries, and explanations for panmixia within STKI populations. This study supports the hypothesis that long-distance migration can enable speciation and demonstrates that migratory behavior does not necessarily hinder differentiation. I consider potential isolating mechanisms and constraints to gene dispersal when population interaction is common and natal philopatry appears too weak to produce genetic structure. My results suggest that a cryptic pattern of genetic divergence can arise in long-distance migratory species whereby movements and breeding locations are flexible as migration patterns evolve, gene flow ceases as migratory patterns become specialized, populations continue to interact, and obvious morphologic differences do not develop. Long-distance migration could facilitate divergence by allowing displacement of populations for part of the year, strong stabilizing selection that limits behavioral plasticity during migration, and interaction among populations, reinforcing mate discrimination when hybrid fitness is reduced. I draw parallels to speciation patterns in other taxa and reflect on evolutionary implications and conservation for the STKI and similar species.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Audrey W Washburn.
Thesis: Thesis (M.S.)--University of Florida, 2007.
Local: Adviser: Meyer, Kenneth D.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2007
System ID: UFE0021296:00001

Permanent Link: http://ufdc.ufl.edu/UFE0021296/00001

Material Information

Title: Phylogeography of the Swallow-Tailed Kite (Elanoides fortificatus)
Physical Description: 1 online resource (141 p.)
Language: english
Creator: Washburn, Audrey W
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2007

Subjects

Subjects / Keywords: dispersal, distance, elanoides, flow, forficatus, gene, kite, long, migration, migratory, pantanal, phylogeography, program, structure, swallow, swallowtailed, tailed, transequatorial
Wildlife Ecology and Conservation -- Dissertations, Academic -- UF
Genre: Wildlife Ecology and Conservation thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Little is known about genetic or morphologic variation in the Swallow-tailed Kite (STKI). I investigated patterns of global variation to test hypotheses relating to species history (origin and expansion) and behavior (dispersal and breeding). The STKI is highly mobile, social year round, and wide-ranging within and between its summer and winter ranges. Migration patterns allow frequent, extensive interaction among populations, from the southeastern U.S. to southeastern Brazil. It has been assumed that migration and dispersal are correlated, and that highly vagile animals will show less subdivision than more sedentary relatives, due to gene flow among populations. However, STKIs are thought to be natally philopatric in the US and long-distance migrants are generally known to operate on rigid schedules, which might discourage behaviors associated with gene flow. I assessed gene flow in STKIs with phylogenetic- and frequency-based analyses of mitochondrial and nuclear intron sequence data taken from live and museum specimens spanning the species? range. I also measured morphological variables currently used to distinguish subspecies. I found deep genetic divisions in the STKI without correlated morphological breaks. Mitochondrial clades were geographically coherent and corresponded to these 'genetic populations': 1. the southeastern U.S.; 2. southern Mexico to central Brazil; and 3. central to southern Brazil. The division near the Pantanal in central Brazil was unexpected. Nuclear loci also showed support for a U.S. population. Phylogenetic trees indicated an historic lack of gene flow among the three areas. One recent gene flow event was detected between the two southerly genetic populations and attributed to proximity rather than to migratory behavior. Coalescent and diversity analyses suggested that these populations originated in the early to late Pleistocene, the northern being the youngest. These STKI populations apparently have remained isolated throughout glacial cycles and range changes, resulting in a distribution where a large neotropical population of residents and short-distance migrants is bordered to the north and south by smaller temperate-breeding populations of long-distance migrants. Each population lacked phylogeographic structure. I suggest likely scenarios for population histories, reasons for current population boundaries, and explanations for panmixia within STKI populations. This study supports the hypothesis that long-distance migration can enable speciation and demonstrates that migratory behavior does not necessarily hinder differentiation. I consider potential isolating mechanisms and constraints to gene dispersal when population interaction is common and natal philopatry appears too weak to produce genetic structure. My results suggest that a cryptic pattern of genetic divergence can arise in long-distance migratory species whereby movements and breeding locations are flexible as migration patterns evolve, gene flow ceases as migratory patterns become specialized, populations continue to interact, and obvious morphologic differences do not develop. Long-distance migration could facilitate divergence by allowing displacement of populations for part of the year, strong stabilizing selection that limits behavioral plasticity during migration, and interaction among populations, reinforcing mate discrimination when hybrid fitness is reduced. I draw parallels to speciation patterns in other taxa and reflect on evolutionary implications and conservation for the STKI and similar species.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Audrey W Washburn.
Thesis: Thesis (M.S.)--University of Florida, 2007.
Local: Adviser: Meyer, Kenneth D.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2007
System ID: UFE0021296:00001


This item has the following downloads:


Full Text
xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E20101113_AAAAQK INGEST_TIME 2010-11-13T23:47:21Z PACKAGE UFE0021296_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES
FILE SIZE 2157 DFID F20101113_AADUJI ORIGIN DEPOSITOR PATH washburn_a_Page_077.txt GLOBAL false PRESERVATION BIT MESSAGE_DIGEST ALGORITHM MD5
a147c428bebbc23ff86f6a45d566c9cf
SHA-1
c1b8676d01fc24609787bbdee72fb2dd65483eb1
2129 F20101113_AADUIU washburn_a_Page_062.txt
1f9e6e0bc54997807ecb07699fb95d99
b79ab3e081a242f3d25e181f6bc8d62413016059
2190 F20101113_AADUJJ washburn_a_Page_078.txt
a8b39ce716f49b44dd270bf61d26918c
017ca86d1f5fc2ce2aecedbe8d0eb8a38ac3b9c8
2033 F20101113_AADUIV washburn_a_Page_063.txt
d19cca892fd94d202d2f00d15ba4337f
ed37f4ae2940a614b45e8e4bc235575437354ee1
2247 F20101113_AADUJK washburn_a_Page_080.txt
8d9d4d4e746e2af6ad6feffde382d894
d6157114fcdbb8f320467d9036e0fdbceb5063f9
2179 F20101113_AADUIW washburn_a_Page_064.txt
878e213e45bc95b45e90e5b4d4d53bf8
40eec04238348fa53262b60f7825142ca0db71f8
2152 F20101113_AADUJL washburn_a_Page_081.txt
49da0ddcb486721134643ceea0186067
685834f340abeb469287c06f9822a396e8fec98a
2221 F20101113_AADUIX washburn_a_Page_066.txt
c4ddf8c13e651bf4ef87008401608c05
64a8130b86c8d9a469c4cfa7f391bcff9b878dfe
87 F20101113_AADUJM washburn_a_Page_084.txt
f5412f33486cf374682a993f2492ade4
672ca98a2436abfefd9b4ef712fe6fd152009135
2078 F20101113_AADUIY washburn_a_Page_067.txt
5661abeca738411e363a291239342ddb
681cf9af10d163acc10f0c9ea38bb120b8388e3d
1907 F20101113_AADUKA washburn_a_Page_100.txt
28618d75994b390b6566a0e5b61a1ae9
01846763fe97da59d2c43638e44dfedc1086c379
1640 F20101113_AADUJN washburn_a_Page_086.txt
f4b496a87bb506f3b987b18f2d14c9d7
4461624cf28ff0798cd7459ece37841be93ae1dd
2184 F20101113_AADUIZ washburn_a_Page_068.txt
9c0b17d8f49867419d9e5bd686553ab4
659a223a556013622a6fecc0ae86784152a991f8
2119 F20101113_AADUKB washburn_a_Page_101.txt
7f81f2a9bed1426f0841eb91c33bfda4
d9a0cd8f7d827444e9f72a3845db6dda452c3820
1675 F20101113_AADUJO washburn_a_Page_087.txt
302bc0c518bb33f3e855636613effce8
1deeb6588998c26e4fc266a41ba66b35eff9e7b4
2110 F20101113_AADUKC washburn_a_Page_102.txt
55ba11001b9e6034cadf3977aa3d9f7e
15d2bdf3ea22080f7df92788ea19101ca8ff906d
1468 F20101113_AADUJP washburn_a_Page_088.txt
d602d37e642a3e0a42fb0cc6d5ffdd0f
9145fcbc378accb5f8ab4d25edf5462e2334f787
2238 F20101113_AADUKD washburn_a_Page_103.txt
0ecc6dbded3398539fb97bc6af234297
40942831b33f27eccdb371279f0c784c7939d973
1828 F20101113_AADUJQ washburn_a_Page_089.txt
cb85825644b5b02cf228e487f5c8d2ad
3294a9b5e6a8928e176cae636048a882e0e8a027
F20101113_AADUKE washburn_a_Page_104.txt
0b874272f935a704228de767859ee567
cc89d021770e87ba71c31c9b3508b3cdf03ce71e
1402 F20101113_AADUJR washburn_a_Page_090.txt
a74e12b933db3e49bc7de12bc60975ac
d045b64ed572f1c8f0c786b5bbe5c2b17919ffa4
2088 F20101113_AADUKF washburn_a_Page_106.txt
4a5189f1fe2943b2d30920b28b775a9a
fd4e102172ac5ea2ebec503885bad1de7e05e318
1529 F20101113_AADUJS washburn_a_Page_091.txt
ff922edea1dd853f6888dc89e138426f
7621d9aa21b180906aebd52af1ffd2187c7bed51
1977 F20101113_AADUKG washburn_a_Page_107.txt
bb91337ce76c864c69661403ab2d3589
a14db088451ab37f6ff5e00d89b31783d5442078
1728 F20101113_AADUJT washburn_a_Page_092.txt
06212e15be4eccd265e57c5f50842c75
2048ac6b38e8912f55214cf1fd0508ec0e9c77eb
2144 F20101113_AADUKH washburn_a_Page_108.txt
0fb1b3c7765624b3bef8f2d562830701
eeb2263d299971a7c85739e79eeee9b2b3ab0d85
2068 F20101113_AADUJU washburn_a_Page_093.txt
e9fa24b06460c2a0b187e74dc0f18d51
3428af01b9dae456dd23a76f71b926e9fbb78ab0
2069 F20101113_AADUKI washburn_a_Page_109.txt
2ea1d36c4a69dfcfbb6556f64d4f7443
79958d8857bc254e393203659b1f09a62d8a4015
1885 F20101113_AADUJV washburn_a_Page_094.txt
650c9bbfff9f323bc41312f3840dbf15
67d6dd860452f6636a32c30f3ca3b519de29c1dd
2092 F20101113_AADUKJ washburn_a_Page_110.txt
a0182b815bab914b842f96e2af68965a
270e023f2237ea4587d2c1b0acdf14ab20065cd7
1986 F20101113_AADUJW washburn_a_Page_095.txt
4cb7057d1325c8db386df5df0b897984
2e416a93406f7071475c873791cbe2c61695ba7b
1490 F20101113_AADUKK washburn_a_Page_111.txt
91765353625a727d9e1abf0bcc3ad9cd
efc0707c9400fc2e9a4600045ab7979f98fb040f
2017 F20101113_AADUJX washburn_a_Page_096.txt
f43be019131dd49fa8adad5a5524259e
50ea282ab768ee927b561d6e97312f780ad11f89
1611 F20101113_AADUKL washburn_a_Page_112.txt
0e966e399462473ba2971a3bec3b07f4
7082966f349eff9e19a68ac01783def1d0fba1fc
2095 F20101113_AADUJY washburn_a_Page_097.txt
36ea5bb46cd8976c467310fe1bd36e02
b6cf7b7032075b24c5ef5e3e4845cf02e6e3a183
3482 F20101113_AADULA washburn_a_Page_129.txt
d1e14601e351bb5eff96dea22bc4c37a
d4def72800d0150db8a05cdaba6eab9816798824
1537 F20101113_AADUKM washburn_a_Page_114.txt
e18505f2dbd80f0bef6331aa77788a9f
3f20d06b68bafb1169316ab35198f05686bed634
1856 F20101113_AADUJZ washburn_a_Page_099.txt
eaec35413e9c81e0e0d8d6ff9f1aaeb6
be9db671805840965c521fdbb52bb47c22e51607
3455 F20101113_AADULB washburn_a_Page_131.txt
b436ed429200f086e6b0ab41b48ff9d0
d2a28dad18223cac8b7879835b9b00223ab92d16
1662 F20101113_AADUKN washburn_a_Page_115.txt
7b049e3f63c280b445ca9907eb71798d
d5c212ac93e5871a8b5ae08c2b609d428a691e25
3528 F20101113_AADULC washburn_a_Page_133.txt
1ccf483241da963070e1a30c8e22aa2f
0e041fca078926fc2aa3fc98513713857ff09a71
1427 F20101113_AADUKO washburn_a_Page_116.txt
65261bdf64edfbda89c5b3561967bb77
745d390d8788a01d94bd5f0e8a10422a247c28f0
3531 F20101113_AADULD washburn_a_Page_134.txt
d359ffbe763d7fbd60c04baf3b347369
74d61664a581c3830b787baa0e070112d19189dd
2321 F20101113_AADUKP washburn_a_Page_117.txt
934a8bbb486e98083246c85227d709d4
2d804df5f931a7fade1dfd8d0127ecb12926bb30
3594 F20101113_AADULE washburn_a_Page_135.txt
0a406d2195189a352f25f55cd0530646
165c907a144b26fb9ed52b3beef147e84ab5cc86
103 F20101113_AADUKQ washburn_a_Page_118.txt
6c45ecc88984db2603e016b7e6c0209f
64e487e5ea247615791b228e78370b10e3733e44
3458 F20101113_AADULF washburn_a_Page_136.txt
61728b758c201c08758cb4d30461d88c
2ada04fb2371040cd2f6c2faa0ef3e70d8cd858e
1511 F20101113_AADUKR washburn_a_Page_119.txt
b93f4da89ce7221ae99084adffed0dd0
12aceabc5c5459f15828f3bcc3ae94d740e35cbc
3434 F20101113_AADULG washburn_a_Page_137.txt
8a4489446862ac6aa0e4b051c8ec4c6e
c830af08afb71989e80918c78344038ba5029a1c
94 F20101113_AADUKS washburn_a_Page_120.txt
0837dde031c37abd208f0f139950acad
54c788dd96ad624005816762c5accc37e96904a1
3615 F20101113_AADULH washburn_a_Page_139.txt
a580a44d2e2092990afbf18d2f42bdae
32e15295f4319caf47aaeff40fbf8dfe95bc1dd4
1820 F20101113_AADUKT washburn_a_Page_121.txt
e4b8b9798c91aa05e0f94dd98f734afc
2f1ff5a2386a1314e1227d6aa188550159df3a0c
2642 F20101113_AADULI washburn_a_Page_140.txt
92eb1c66da8fc47c7a5a7ca24d260cbd
4481c046bddbdd3f97e6f0a7895907697c561be1
1723 F20101113_AADUKU washburn_a_Page_122.txt
2252ce094b99d311c60f21b715b45be7
cbc672b3a43c9233035e50217681ff9b29cded1f
1000 F20101113_AADULJ washburn_a_Page_141.txt
e0129dc1e592f97287acb175a742a154
fb26df3019a25f68ff620d41c94324ad14122297
2239 F20101113_AADUKV washburn_a_Page_123.txt
78a711f53e13699542fbc2b959d09005
bccfef1224c660885b5adec494072d04ffc6aed4
1577 F20101113_AADULK washburn_a_Page_001thm.jpg
76b291fde03fdd8c3cf56f6da2b4542f
ac1043190241ae618cfc9d857c9afd4597be7a49
F20101113_AADUKW washburn_a_Page_124.txt
c6c9623a613dfa69f4ef59a470207238
e0dc0314d0bf7022e8dd68868aca6c40ff8d2b66
6783 F20101113_AADUMA washburn_a_Page_034thm.jpg
f17f81fef5baf2b28dfda71fafd8d2a8
42bd85f3f4b861eed54f551443d67c42608ca572
638975 F20101113_AADULL washburn_a.pdf
13922b2604753d7405c60500416c6429
bb1e61d6365139ff93c16fe76d98b17bee0124a3
948 F20101113_AADUKX washburn_a_Page_125.txt
0220608635fba9df9bef66f2144f6c0b
c0df3dddd8d21a397a8f5250e37fcfd5e07c168b
35192 F20101113_AADULM washburn_a_Page_139.QC.jpg
fbcc4d2d09494057ca4c32b139d4f455
c7d63ec90ba3a1ff36f3a79bc771c96dbe8b2039
900 F20101113_AADUKY washburn_a_Page_126.txt
234725a6cd164e696a1232b4c038cc81
ee4dceba3df52d854ff78f10eaf9e1d3a06254b7
1656 F20101113_AADUMB washburn_a_Page_003.QC.jpg
79b9f0f1da5c5b4fd55d5597a680ae5e
54ea1d23fce5adf71344b065899471a39a7b913b
27434 F20101113_AADULN washburn_a_Page_035.QC.jpg
34cf07058e65fb2e7f512175b15bc127
a6bf4e81adf8872726f937dd19fc4f403fa9fb97
1181 F20101113_AADUKZ washburn_a_Page_127.txt
23b0cc6f1c4ee0a662c94979afb9ea15
03b00ff97f2ea4f9a8d6d91a2ff5d7bc7a8a0987
6921 F20101113_AADUMC washburn_a_Page_066thm.jpg
a0e2c0a2581c7d083034a489a4d49449
faf83a818758da940b38e7bb9eab97ff41d7c0b7
6538 F20101113_AADULO washburn_a_Page_016thm.jpg
dc6fe070c6bed70523aabf5decbd7990
555ac4bbd2ba3f52b3759b3e26a252b7bfa6a2b2
1062 F20101113_AADUMD washburn_a_Page_002.QC.jpg
4ccaf91b25f0bdcb8607ccae976415cc
e2ce43e6a5dba13637a26256f7bcf56ec1b7cc40
6832 F20101113_AADULP washburn_a_Page_058thm.jpg
9bcec2dbb641f105e4fcf2baf1571fde
49d427aa57c5716b5957ad319a9036f46a723f8c
28194 F20101113_AADUME washburn_a_Page_064.QC.jpg
faff717b79023e38af934d39a9f111d4
415fdbde478b33120aefe39655e73ddced9f2153
9155 F20101113_AADULQ washburn_a_Page_008.QC.jpg
aaa9189f3552b57cf0d2fe9df3031bd7
c846c847eb55231fa682add6b1ffbd5bb99cc06c
5333 F20101113_AADUMF washburn_a_Page_005thm.jpg
c6731c2d630a9fcf503a049b471d3727
1703aae0ce486758a292b6d50eb0e1296660c480
6345 F20101113_AADULR washburn_a_Page_140thm.jpg
fbb3eb6cbac33576d655728d21be8a33
b8bf5c866f9f307cc3d31d88fef67783fc5b148d
11798 F20101113_AADUMG washburn_a_Page_086.QC.jpg
dce08ba4a81c93c6890fbc9909869436
40cf57d11145bead81ad3a76bda02b4c7046bd42
6165 F20101113_AADULS washburn_a_Page_050thm.jpg
aecb6c2d9f123bd015cda6f11739661e
54209a0c5f38f670f7d06d9b872cd30e82c2e95a
7731 F20101113_AADUMH washburn_a_Page_138thm.jpg
899d934d0188413d1477498f266ee831
5b2fdcfa849246e72dad12158666ec897924e37f
3326 F20101113_AADULT washburn_a_Page_114thm.jpg
912744d8b9aa40f7164279862de97aef
717a0d3c8f9c9bba74afaf1bf1e0fd823fca46e4
28879 F20101113_AADUMI washburn_a_Page_078.QC.jpg
96172b6ef966652cc798591bb33a8e49
10e49e39f039d1e012520efe86274b7ed6a36fd7
28095 F20101113_AADULU washburn_a_Page_052.QC.jpg
a4569dca4beba2b8397bb098ada27386
308964c2496b5689f3ba5ac9b03e8761667fa7e7
26390 F20101113_AADULV washburn_a_Page_043.QC.jpg
91ea9ab3fdee7caf55e2c3cf9f0da3fd
8d281a1158daf84225bcfc67e9d4b9e6c6058324
2341 F20101113_AADUMJ washburn_a_Page_048thm.jpg
434699759e8dfc0413182ad84f2fdaa4
14230a837b562704de5ff91b37bd02f323467eaa
6828 F20101113_AADULW washburn_a_Page_056thm.jpg
35f423bd1695b53b8d50c22c5c081706
df87bb238c65a085890cb806708b7d0eb52b0987
1458 F20101113_AADUMK washburn_a_Page_084.QC.jpg
b1c832dc6e1d77c11cdbd283e6f32a7d
caf3cd894969cc2bc84c4605d909e774310f0f07
27136 F20101113_AADULX washburn_a_Page_063.QC.jpg
999d9d10857848bdb30c5316a427741f
99c4a6f1ed7c2926bd29a35941130133932ac19f
3461 F20101113_AADUNA washburn_a_Page_085thm.jpg
b7688d8b25ee032111e538b4cb3cb761
eba8e53256c75c7fd02ebfc2d5f154e552c76557
3521 F20101113_AADUML washburn_a_Page_089thm.jpg
57bc84544da8548f6e5bf8003dad8099
bca9aa54c957e1b51c0a412510ec494b34443531
6700 F20101113_AADULY washburn_a_Page_070thm.jpg
5675b74890ad9a3ca54270a16b95adc3
b62122ce4dd2a6b1cb4ac4bd708957f034bfe741
27941 F20101113_AADUNB washburn_a_Page_036.QC.jpg
41a50c4dcfd0b5d1c1b5bd42d1459024
98332a41bea26e60ce1008bfa07a38e9dc61f3c8
3252 F20101113_AADUMM washburn_a_Page_091thm.jpg
caf751a4c9e92c69cf9c91cff98faf94
788c0ef2325b227bc4c38cb9377d5aef46009d36
3571 F20101113_AADULZ washburn_a_Page_110thm.jpg
fa3f5515dc2834b52bd868fd8ee827c2
9d3151bff3831091adc92faeba81fefbe1447eae
13499 F20101113_AADUMN washburn_a_Page_110.QC.jpg
3d7d0bcdd4f9b76771d01b48fc76c36d
fa99b1685d2ac528d1c6342ca9ff76a41b71aaf0
1998 F20101113_AADTKA washburn_a_Page_060.txt
8088dafab1df41bbc1d935077ab07a0b
0fc97531e42b3ccb5018e96ca60f32d6c9457db0
25306 F20101113_AADUNC washburn_a_Page_051.QC.jpg
c311b16cc6698c920684708a8e2a1eaa
0ed637cf4b47780cba794f1006fc567e7d9fc876
34147 F20101113_AADTJM washburn_a_Page_136.QC.jpg
3a28d799973c1dd9ca11a581344dbb9f
4ba2399f9b4d6b0ede6c911f9c19cb1273095021
15713 F20101113_AADUMO washburn_a_Page_123.QC.jpg
d3fea67c998f3201a92d32ad676ed5f6
99bf198de4d5ace3a766e7c73e54799c73de5049
21931 F20101113_AADTKB washburn_a_Page_019.pro
2bd1930a69dedb1de4c06cefa2ac4097
e343afcd54608d5cf868f83fd554e9b27a59f263
27999 F20101113_AADUND washburn_a_Page_016.QC.jpg
46dbe188d13a9236da2f448b7941c4da
ac6a345e87cd66c657e58aae273946ed347b9952
40665 F20101113_AADTJN washburn_a_Page_093.pro
2e88cdc5f9ed507f751238e78074afbb
399de9571c97baa5cff052a3bd676776b34dc58b
2818 F20101113_AADUMP washburn_a_Page_088thm.jpg
c82e0791232905659afab2589e96d40f
56a0c29bc05b7032d773d67915aeb16f2dbe2a32
90326 F20101113_AADTKC washburn_a_Page_122.jp2
abc28f0ce8b4ca9c32dc3219aa7773db
f22a89aa46b77b4b56068880dbebf3ef97c548a0
529 F20101113_AADUNE washburn_a_Page_002thm.jpg
3573c82af5029a1808a60f48cb7a2503
0f5a94382eef1e83f723ea6848f821b53942129e
53700 F20101113_AADTJO washburn_a_Page_071.pro
0939d15554189d9a6d4d690a2fe9737d
fcc21a0fcae5f2e74192dfccae5efa1baf9645fe
28711 F20101113_AADUMQ washburn_a_Page_013.QC.jpg
efe466b514a2f8a81e644c0ed59fe2b3
74fe5b02a6e6ef6d9330d05bd19dc02faf06e9a6
47435 F20101113_AADTKD washburn_a_Page_079.pro
0352d595fe3c029076698429c6f92fb0
221281a19b77f5805235b75c91b82d8ba67ce7cf
36822 F20101113_AADUNF washburn_a_Page_135.QC.jpg
5c34eaba9c1b7e6b4196f315c0b023f6
192e0bd64c769441abcab868ac197ee4ca907e3f
2135 F20101113_AADTJP washburn_a_Page_065.txt
0acd9176d00e6ca574f562b224277dc6
9c9098bee0daf76d4661b478394a0416cbb40472
29654 F20101113_AADUMR washburn_a_Page_068.QC.jpg
cd85adfba3a3aed3f631b2aaaf52b7aa
740a13e1ae2eef98fc7aaf15ae8d7eb4f8d71c37
1053954 F20101113_AADTKE washburn_a_Page_034.tif
20606a83d469c58d94d5467d4fe08542
cf265eaa7e4f7a32a8e93a7bd464a875b0e89907
3490 F20101113_AADUNG washburn_a_Page_108thm.jpg
9104c5e1a88938e32b37360b30bc767a
c59b9e01e50c58440cc64ae285c560ee6b107feb
F20101113_AADTJQ washburn_a_Page_098.txt
1e0057367051f2b4d38f87bbfc616ee1
6415d7d4bb83d5335f85e039912de6ce816f1b8d
3831 F20101113_AADUMS washburn_a_Page_122thm.jpg
e2083543e0e61bfb10c9685f3f2744e6
a04230b111494bce2324076d27ada34c741d43b7
1894 F20101113_AADTKF washburn_a_Page_105.txt
e39eaf13e8924891a323ce7aef359b09
c6864dc4def0006cb7c8132b68ef511d852c52f9
3581 F20101113_AADUNH washburn_a_Page_117thm.jpg
7e731ee42c5ff5ff9149a3fb26c07c6f
854f2602de43d840c6975942dc3bfb2b90a92fff
873905 F20101113_AADTJR washburn_a_Page_108.jp2
5b3b7c685095c629cb8e2b1f3f75b2a5
eb3744cc500ae980c17525ceb20190ae782f1d43
20927 F20101113_AADUMT washburn_a_Page_083.QC.jpg
d9e43487c39c9bcaa7525ca2782edd87
4e9152502d46a2497aac1b0e0b91f2f645d539e1
12658 F20101113_AADTKG washburn_a_Page_047.QC.jpg
407a2b8cc7f28f524902608915a00264
2ca210f5a881d8fe1a8f61401a7f253fbcb804e9
6629 F20101113_AADUNI washburn_a_Page_071thm.jpg
facaa2cb38936de62b885dfec9ce335f
5d4894d08ce694d38e4231e1eec69eac2fb13804
8425398 F20101113_AADTJS washburn_a_Page_112.tif
15226cd9c76a34569bd537183cfd032b
a764ce8e570d709abc8be908e1392d110d5c78bb
6874 F20101113_AADUMU washburn_a_Page_065thm.jpg
11668bcbf17cd52ca9da3a99878b9402
ad631d149510bac8f8a8b838af0995be5c62fbf7
35023 F20101113_AADTKH washburn_a_Page_008.jp2
8ad807672ef9c4d74b1f8a4a4bca2323
ed80d7f87de7e57a475bd0de6990cf76433549a6
12241 F20101113_AADUNJ washburn_a_Page_085.QC.jpg
04729c46dfe5fbe35ec4f7a96ca5e772
a6040a8e1312200da7f75c7716774ea8e2441cf4
62306 F20101113_AADTJT washburn_a_Page_046.jp2
5312795b70dfe4beb922ff109271febe
9d78dafcd73579c4022ec1f863b2ff0bbcae95f3
6984 F20101113_AADUMV washburn_a_Page_011thm.jpg
2ee87128846a08bff94b59c1ba547943
a4e8e0e525e5c9f46af374daf0663b48643d10e1
1534 F20101113_AADTKI washburn_a_Page_083.txt
7299d9874f59a65877b14417477db95a
9fd74f2f733b79ce1e6911ad6367698e25c63e94
4737 F20101113_AADUNK washburn_a_Page_020thm.jpg
eb716556e4cc3c060f8debd9731e85f3
37d9c9681c5fc58730c6707e38e0bb72969521bf
92369 F20101113_AADTJU washburn_a_Page_013.jpg
e43cb6fc73b6a69e53e17f42ed48cd2d
e3624f2aee4363b431640115d0ea06c00984dc77
10583 F20101113_AADUMW washburn_a_Page_116.QC.jpg
52ae6017e45f1188b1a316a0b7e9a676
f7e0f1bbc8b3c9daf6aa3e4c1b8df1963fd3527c
28090 F20101113_AADUOA washburn_a_Page_074.QC.jpg
9dc9800368623e3af96553b31959888d
87ddf101cb4724d4c90880f4c65b474b56272194
5870 F20101113_AADTKJ washburn_a_Page_047.pro
9be85a8d674924aec1ceaa1d84dd38d0
afe119a0d3479d6b3ed07483c6a9eafb506686b1
28295 F20101113_AADUNL washburn_a_Page_061.QC.jpg
bbb64ba2e39c35fe955151976bbf1cc6
20ec16a443ade1813a81ac79c616758dc96f70b1
3433 F20101113_AADTJV washburn_a_Page_130.txt
a0b51dd484d9cf532c57d1b64b80ffe8
ebc66a4fb3300c42b78f6e780d4f4d3aa9fb9784
6644 F20101113_AADUMX washburn_a_Page_044thm.jpg
571bfaeb33866577d0fa9d649fe74887
ff76954bd3f4dfed91a86c6912a42e3319bc6fcb
11797 F20101113_AADUOB washburn_a_Page_087.QC.jpg
6ef4345f0307565774d66d89ca8ca2a2
1dc87fd58f2dde7f5a665e814511db53f9fb30a2
F20101113_AADTKK washburn_a_Page_078.tif
8cc22b81419441850a768f809ab44af4
7c292b8ff420339b2c4a0eaa921c28c5e3b9a98f
3027 F20101113_AADUNM washburn_a_Page_019thm.jpg
fdfa28e3a38191263b944e26bf675aaf
c92ec631208054813c5da726d6c85240ae9ceebd
F20101113_AADTJW washburn_a_Page_032.tif
6a8c7b0396d82e6116ae566a2f89294d
2b16eceaef436a0a6e096cea93e4993a4fccbcf7
7556 F20101113_AADUMY washburn_a_Page_137thm.jpg
9f2a9a44ae617744059bf35d12ee5a47
f06973882b9c969f86748686dbff6c15c859af63
6717 F20101113_AADUOC washburn_a_Page_081thm.jpg
28d3330418bf5ed494791982f05db2be
41cd638c52fd09760ce8875202f77d9ce13d0a4d
114109 F20101113_AADTLA washburn_a_Page_044.jp2
2e8a47c8902c8ca85b5153d7042e6937
6d89988c27b23443a906eabe3333803feed09c1d
53015 F20101113_AADTKL washburn_a_Page_117.pro
9b511c90ce808125fbca8b031441b462
6bb13522021def3df6705b098ed073ef4456df83
F20101113_AADUNN washburn_a_Page_089.QC.jpg
7375ee55b5f72ef761460a0c96cc51cc
f07618f75bed0900d35f6ece8ef1bb39dfb4ccad
7828 F20101113_AADTJX washburn_a_Page_132thm.jpg
1cefc70d8a340887e530972c5698008a
8289fe786d68d949e19bffee17d3766b25d09cb9
6685 F20101113_AADUMZ washburn_a_Page_073thm.jpg
7d7ce7de4e8d409eeaa3e5c6df39a755
7ec6393f3a34523e9d909dfe7c69377ff7c9f51d
28187 F20101113_AADTKM washburn_a_Page_055.QC.jpg
27f45b7c4887e8ca9900b22f281c66cb
590e8267a88e5742f6690297c6d64742c8a44c42
2358 F20101113_AADUNO washburn_a_Page_008thm.jpg
63aa82d3c939c584a86a6b5456f51b87
ba6670ea1d76abcb5aa7b2b7702eb6a09ebcab82
16479 F20101113_AADTJY washburn_a_Page_006.QC.jpg
24a61b8bb3cd2e7bc7436a2399256bc7
43040337f51b85e2f24ceca32f743f7ade5e420f
3363 F20101113_AADUOD washburn_a_Page_127thm.jpg
6d5ba677e999dd4651d136dd46be50b4
59596d101633999ce61ee5dd713df825e4d8f576
79324 F20101113_AADTLB washburn_a_Page_010.jpg
4858758828b189fb4ee15d0914b7a3f4
5e1687282ddec87160b7c2c71b3ee8594240149f
1821 F20101113_AADTKN washburn_a_Page_113.txt
46a3655247c0a8000812afb3e6425978
d64756c7d764174e48bfbc8469cbc11c959e974f
25619 F20101113_AADUNP washburn_a_Page_027.QC.jpg
c74010e13ef95a9be1dc0e3b9c690496
4bd1ab3729dfe81fe411395c2d854a24a3b1c25e
89692 F20101113_AADTJZ washburn_a_Page_074.jpg
df004322b0b607155ebbb31523ed7b97
e64b8a38443509145baca3f9fbff99853d41a5d4
7523 F20101113_AADUOE washburn_a_Page_130thm.jpg
a34129031ee1fd2afbdd39b3c9d26afb
058d4ca804d45a789251565a8f469046136f7fe6
90493 F20101113_AADTLC washburn_a_Page_058.jpg
11297946a929ae76b3b44c574891c2a3
440dbdf702c05346116c6356c3322543eec20d9a
40063 F20101113_AADTKO washburn_a_Page_096.pro
643c7684ea133c2145be578318708af6
bfd8aa6c45b1b1a8af1a3d27de0bbdb379ec7b21
10923 F20101113_AADUNQ washburn_a_Page_119.QC.jpg
43fc90c9ca174f77c0461b19d1278e5d
4bc706bc4f4aadbe3fb46630e810f45281aad0ba
F20101113_AADUOF washburn_a_Page_095thm.jpg
d7a376d934ec80df647da7794d6579e8
ac08d82f91cfc3f6ff1f4045c95b4d7a13abe054
F20101113_AADTLD washburn_a_Page_064.tif
5d24bbbbc2489c6e4f2f4b2a3085fd82
49b6f253ece4cd22210222b7b001c443178a0bf7
1054428 F20101113_AADTKP washburn_a_Page_046.tif
5e87283b324a8369ddfa7fe26b5c7a3f
182b6df6c1c106a8196d16469e4ab36223cfc35b
34710 F20101113_AADUNR washburn_a_Page_130.QC.jpg
324cb280b3070ff344c21ce4b2d10334
6ba23b68f3032bef049b658bf2e0e08a021752cb
6940 F20101113_AADUOG washburn_a_Page_041thm.jpg
df1a0842e7d59f8e4919ed5656836327
f69ef9035634963cffa47d39e106cc43f1a6bad7
5050 F20101113_AADUNS washburn_a_Page_083thm.jpg
0d7003b104c2e7fb119048dbf2699148
73553216ce00bcec0b535a3f05f70ae1d975719e
3620 F20101113_AADTLE washburn_a_Page_093thm.jpg
ec6571ca84dba5653298f2e0395a52fc
e06b13bb1b1f25b4b3f279323bec7612f8f924ca
7776 F20101113_AADTKQ washburn_a_Page_136thm.jpg
8c8d761624a198cca5294d723880455c
d59ecb806bb4b27827fcc998a386c567bf190a69
212838 F20101113_AADUOH UFE0021296_00001.xml FULL
c6ce4c38c113a2ad01324d58b44ad2b5
8398c09119727cb5b20f83b464412577c332284b
6718 F20101113_AADUNT washburn_a_Page_060thm.jpg
5d5415edc27804a50680b36caa28c62c
be965ac7f0075274bd78f909a33fac265fe10cf5
7267 F20101113_AADTLF washburn_a_Page_080thm.jpg
48ab72d6a1c30d29ced1a3a4fd7947a9
d673f444127658819e4aa0f2570f3dc4e5e0b5f3
3610 F20101113_AADTKR washburn_a_Page_103thm.jpg
408c23e092844b46da338bb231c8c2b1
937273c64066f9d40b81f3ba3d59721b3548d4a5
528 F20101113_AADUOI washburn_a_Page_003thm.jpg
7dfd86f7cae63249b69a0290492678da
099f11db472084d64ae4968853025d855a1f09b9
3400 F20101113_AADUNU washburn_a_Page_104thm.jpg
fdc2c88578af5360998cc8e65dcaf565
3c8d32ecf31bf788d2afc269a8512a85f470001e
F20101113_AADTLG washburn_a_Page_024.tif
1cbf9099a656728009dbd82062c3ef9a
0952721d9944d0f3395beac108e5760bff562eca
1918 F20101113_AADTKS washburn_a_Page_085.txt
b64a6ad7c1e1bb53f8eca1f4a90d9f0d
506d25ca3198427032fa286e6e09e1519d3d1593
6373 F20101113_AADUOJ washburn_a_Page_004thm.jpg
de8c45bb1885115da32a7310b21c1f63
fa032250507dbbecf3efc72ee8048ac56de96dad
7715 F20101113_AADUNV washburn_a_Page_133thm.jpg
bf7833be4ac755d8a07071adf63d7a2e
26d6f0552a145e1f532612878d5bb67e54829cfc
F20101113_AADTLH washburn_a_Page_013.tif
c10f2e15ce78be5ccd585447cbc31446
992375ffdc11533c55f6566bdd58d0006a98ada2
F20101113_AADTKT washburn_a_Page_016.tif
dbd2c79e8f6b5999dbfcfba82be088f5
e209e97f76f0a3a767e95777540b709bd5db82fb
25485 F20101113_AADUOK washburn_a_Page_004.QC.jpg
f0a4bb6ff099b32cc12687a1b67a7c14
083e6b47214ddbcc25c163099307c05c851c9506
7366 F20101113_AADUNW washburn_a_Page_009.QC.jpg
bc4c270967c75f7a88c3befef5578dc9
1238a56f6152e6451376cd03918247d8e2dab4ec
6175 F20101113_AADTLI washburn_a_Page_079thm.jpg
2a39f33db5ab71b07f5199d292767230
45bafa306c9f57ab6b37a85ca6852fe0f21f5e24
3283 F20101113_AADTKU washburn_a_Page_128.txt
4d3f82b0f3e435cd8cfb9b84697830e3
21e166558ea8a3a666986b058bc0456ee577e325
27589 F20101113_AADUPA washburn_a_Page_017.QC.jpg
9a71f541a5d82823adc42d8cb1cd7b07
2a63a93c46a386763c729d070b87cd0ffd0d614b
23327 F20101113_AADUOL washburn_a_Page_005.QC.jpg
6ce72af0f302cdb76cd53ad5990e0ee5
319bcc7a2d8211119079bed557b83f4c68002f5a
27779 F20101113_AADUNX washburn_a_Page_053.QC.jpg
da4dd91e29e080391a2c96cc56cf3a63
9c6ebd3a4fd5dba7935c02d92725319f70f08a92
53782 F20101113_AADTLJ washburn_a_Page_055.pro
f2fd4a7cfe7ab8e769772dbb90599083
3e0d740ed325e75a06441b0ca12a6fbbcd6a9cd1
6013 F20101113_AADTKV washburn_a_Page_001.QC.jpg
9dc0b33d3f4ad7eaece86a7a84cb1e91
4db042f502f30a2e0ab2f0e2759864a9c8f1a01d
6742 F20101113_AADUPB washburn_a_Page_018thm.jpg
255f9e77fb335a79ab38dedf82696962
457c5866c5b1c1a564e1386480b4eedb83316737
4306 F20101113_AADUOM washburn_a_Page_006thm.jpg
bfd47d07e77d7fd7c5bf86f51380d7cd
94413b4d0bc6c2ec7e4406a55e3e93405147f04d
3462 F20101113_AADUNY washburn_a_Page_087thm.jpg
42de1bf906bd6d8c3a48dea3f2308f32
3493ad1f6f28e283dac5542a0516eca7e5bf3607
F20101113_AADTLK washburn_a_Page_098.tif
ae8e2aebd48bda541dcef71c98d0e94a
93498c30106997187ac71ac09167cbc44bc545fa
2210 F20101113_AADTKW washburn_a_Page_082.txt
8814d2e7e43f56a61c1062159e875198
5af46a300c823d40077a25acdf2c15146d5203d5
28695 F20101113_AADUPC washburn_a_Page_018.QC.jpg
a9e730f92f21048ab653912a5822077d
f8f00a40b0b3fad368c69c31638ddc6eee9e0741
5829 F20101113_AADUON washburn_a_Page_007.QC.jpg
f97873ab750a5e824b41de42aa58638a
33f0a03937eabb94b4ad5bad850c34e9c246168c
5969 F20101113_AADUNZ washburn_a_Page_051thm.jpg
655959e02bed6d8973fd3bf029ac41d6
b0b96513e813eb5a96a2f1ab427b431726ec5bc3
88343 F20101113_AADTLL washburn_a_Page_012.jpg
ec1f7c5479def7a11dbbff3c6643d3a7
d2854719dfd90a22c4486b86b7bc66b98d1b890b
3510 F20101113_AADTKX washburn_a_Page_138.txt
a4c0457268099656330463376260e273
cb5ec4960e938cda222b2e2dcd7c794e17507e8f
F20101113_AADTMA washburn_a_Page_053.tif
f73624e71d1cebd0202fc16c83e4af05
a4d899beb66f943cda648ed5a00ee4c6388048dd
12328 F20101113_AADUPD washburn_a_Page_019.QC.jpg
6cfae1a3b9b9352a811c9ff0e691e6fe
a3d4d73d53dca6dc83691e21b1c0a4d8c3b4ed17
1943 F20101113_AADUOO washburn_a_Page_009thm.jpg
4abbaa3a62365a8135c64454f0a42293
8afd7ce1c25ad4800e1fe5e83f7d64b4b68069b7
88188 F20101113_AADTLM washburn_a_Page_059.jpg
0a6f1f9f04718240f3949872505175ca
941eda28f8f4e71b88de35dec6b21294d6775b42
1923 F20101113_AADTKY washburn_a_Page_079.txt
e725e0951d0c5f62f700f25718087e50
15bd056d5b4c55c52cf2e079016b9ec62aa44b37
7767 F20101113_AADTMB washburn_a_Page_139thm.jpg
a46ff184edadd5b903e3f2edff000bc3
62b1e5c37e601b73abc833e7ca3df2f85bfbf183
5882 F20101113_AADUOP washburn_a_Page_010thm.jpg
b0077051b336153c2c53ca0edeb2d00c
dd65aff483a0f9d23a16217f5f2dd0882d8e419a
F20101113_AADTLN washburn_a_Page_132.txt
d1cae441c49234cf0c91290fa98867f2
75fb731008dc3f861533bb880ba4accfde174967
77364 F20101113_AADTKZ washburn_a_Page_049.jpg
ab69366e9674392878b2daf769d1be70
fb9abecd8237c40885c3ed42efe7d5f8936bf803
16849 F20101113_AADUPE washburn_a_Page_020.QC.jpg
3a4863f16f9c173c142635f807c08fb7
af2c1335f28603f50a8e569a95de0b31e25bff8d
23736 F20101113_AADUOQ washburn_a_Page_010.QC.jpg
d0535bdaa9f1112fb161a54df77491f5
b739895273fc71c03374e245ed874029a3239840
41916 F20101113_AADTLO washburn_a_Page_093.jpg
cded21380d6065a082c1f2f1c762b5c0
cc29d1379fa5502b13be08a301ca05932c982517
7004 F20101113_AADTMC washburn_a_Page_026thm.jpg
e9700e35e2e73aba3405a0801843607c
fc2e84bb1e92c70fcfa165b6d17b84389e203b4a
5896 F20101113_AADUPF washburn_a_Page_021thm.jpg
3291837160c72ff07d13593562dffb7e
37f1e674e2646196d883e41b00eec8cf0caee23e
29327 F20101113_AADUOR washburn_a_Page_011.QC.jpg
744bdbe216be27c8cda51b597c06379e
a15105b72de329f79299c5b57a217847b5a71ddd
3934 F20101113_AADTLP washburn_a_Page_047thm.jpg
3c27689a846b86f13875e3f702a91523
1df6613bbc4e4652c3e3fb9be163cdefe8685813
1491 F20101113_AADTMD washburn_a_Page_007thm.jpg
e8ea757435d73d3243f31928bec777dc
a622dffb0e41a51caf21b313d7b60551dd432849
24176 F20101113_AADUPG washburn_a_Page_021.QC.jpg
b3158f4ba4f643c18160eadeceec05ae
f8edff5e7b364769c9615773e97b14a0bc4139f6
6502 F20101113_AADUOS washburn_a_Page_012thm.jpg
901bc0465b4a1e9b820cea4a4b1cba29
63d7aaaaa17d1922dac03641b38c9ba3a5c55a36
25271604 F20101113_AADTLQ washburn_a_Page_126.tif
837810d0a1c58ce2ed2981d2a2d9bead
0031b718210e4cf316fcf457cecf663bc4bbda88
6500 F20101113_AADTME washburn_a_Page_072thm.jpg
861634596d73bbdb46a88d6cf052875b
79800ec7aa7119f2e7c4abdb95aa6814fc502d65
6642 F20101113_AADUPH washburn_a_Page_022thm.jpg
eaa4a97cac47f78add04e7b00276f4ac
ee2e34d3890cdd0b2522bf3c29f0b06956a28621
26787 F20101113_AADUOT washburn_a_Page_012.QC.jpg
ed7b679826bb99af4b08f224bf903cd0
977fac66425f1c8a02a48d26f54a1c9cfc684e09
72592 F20101113_AADTLR washburn_a_Page_119.jp2
05e5988f8912dc8dcf5cc6836b7bcb47
5b12014cf052bcc403e074c204ef7c0a6d2b7eeb
1939 F20101113_AADTMF washburn_a_Page_027.txt
0d652636ed3d83042858f66ea11b3bb7
6ca589531c2ed4aac36733fd36e27b6884b9e99c
28218 F20101113_AADUPI washburn_a_Page_022.QC.jpg
b985b74ea8f59898177fd3ecbc7feb11
ed99105db3bbe9feb68037937c8c040cce4ba0cd
6701 F20101113_AADUOU washburn_a_Page_013thm.jpg
e3a6baa6a2dbf80524c4c8815789147a
66e3cf525044a6bee24ec211c3bc6c15ef0ae6e1
F20101113_AADTLS washburn_a_Page_030.txt
9438962f2cce6f6de395839573044518
d0e230a21bef8346fadd3ab9a5a378dd864232e1
41714 F20101113_AADTMG washburn_a_Page_089.jpg
aba2ef52498cdeac09a4f7b903df4ce2
de51b804457beb8eaf5a6fec73b50ca7be4b0b0b
6627 F20101113_AADUPJ washburn_a_Page_023thm.jpg
f68103873f5ff36909d53c65ab6d27e2
c986786b751a39c03c2ad2903708a38f26f87812
6616 F20101113_AADUOV washburn_a_Page_014thm.jpg
fd20a8af463fd584643803d0cb7966f1
332859cb887017dac0eb46c933201779ca0355a4
F20101113_AADTLT washburn_a_Page_084.tif
110bde539a66e32823b09fa895a2c39e
52f9a04dc4622e56aefea11af3e64a8e558de36f
116456 F20101113_AADTMH washburn_a_Page_030.jp2
d3cb6061a61dd8c34214a44e1125cfe0
ffc34f60b0e134232610f2196940842a0216a40f
26153 F20101113_AADUPK washburn_a_Page_023.QC.jpg
2aa26ac933aef2c972f06f6d7b2d57e1
f16fe91db507f66f7d1ebaf426583a60c64721f4
28076 F20101113_AADUOW washburn_a_Page_014.QC.jpg
b543afdc37702f58e7449b0c27b02207
63766ee545a764137d6ed5d42ea89eb5524dc7be
2005 F20101113_AADTLU washburn_a_Page_028.txt
da6e6febe5d5a933b249cc49b190dbd2
4a0e1de7862e13bcad1e9e37a3f34b7369cc525b
9153 F20101113_AADTMI washburn_a_Page_037.QC.jpg
bca3f7fc4681582c272e96766c8220e5
afe77dfff41994a3ae7960219ae5e6a8042cd9e9
28492 F20101113_AADUQA washburn_a_Page_032.QC.jpg
2ef9fb02691629b668cb8a76123154aa
b528ef21dbb74a5abfaa902b47c016cbb4002501
6756 F20101113_AADUPL washburn_a_Page_024thm.jpg
63cf0acdd7007a44bd5bdc8c4f7c2108
aa144979040c73463a8df1f8d3c817c89952d5df
6744 F20101113_AADUOX washburn_a_Page_015thm.jpg
95be771b274ec50eb0f9d2a008a0d49a
249c9535c68a05f8dd53f1ffb56d1e5ce092de6a
35502 F20101113_AADTLV washburn_a_Page_138.QC.jpg
73080be9fb0a7be3625d49acac8c3782
290808fa548e6150298184935f1232d132496e88
40634 F20101113_AADTMJ washburn_a_Page_089.pro
92b493bb06dd9ef45bfd4cacbebd67a3
c6376ac5816976136917d511432f5efbeed9d48e
6908 F20101113_AADUQB washburn_a_Page_033thm.jpg
460dc21658a3af8b05e6d070768f27e0
7486ffbfbfae0f4b1e8737fa40e4593ced7c31ab
28205 F20101113_AADUPM washburn_a_Page_024.QC.jpg
a52e64e61408afdf9ef4e51e06e0982c
fb3e0a9516c74fedf761b1d8366e747819412f6a
28856 F20101113_AADUOY washburn_a_Page_015.QC.jpg
9e730cb97269c4b17f1e8df8640775cf
091760f228ff9262a4b341af1ae987a03fb556bf
633 F20101113_AADTLW washburn_a_Page_009.txt
652f93d4e2d6c5db4759d6e2aa7f9664
cfd6db495ba5bac0f3a34e68752c4921fe1e77ec
428611 F20101113_AADTMK washburn_a_Page_127.jp2
6131200c1b789c436b9d2160cd2c14d3
46bb9cc1a1c8e03db739849a08552c60d948e0f0
29114 F20101113_AADUQC washburn_a_Page_033.QC.jpg
5713ddce34408d191b6512263bdb00db
fe967686c140c57e5d848f4b09b3ca50e3631c82
6892 F20101113_AADUPN washburn_a_Page_025thm.jpg
8ef7677dd1e9bf0ee2caa323a0b935be
9ad1480f908df5b8fc5be80564dcd0c6565ad959
F20101113_AADUOZ washburn_a_Page_017thm.jpg
3df442db347f83215c35ea7ecf05672c
2142614f9d67808e637740cd09563036bc097f93
92137 F20101113_AADTNA washburn_a_Page_015.jpg
165597985d293597e765eb754f3f1dbd
6adadcc1662a34962976748c5ebde36756d80a68
1997 F20101113_AADTML washburn_a_Page_029.txt
5441f4b0ed456e6d4fc79569bbc98b2b
d14f4a8d2044a4457f8906b00dde9cc0352e2cd3
171552 F20101113_AADTLX washburn_a_Page_129.jp2
b14d07c4f86b2f539c7df48efd3ac0cd
2435a6735b49df18f2297a505c35042c6e26dfd1
27614 F20101113_AADUQD washburn_a_Page_034.QC.jpg
fea91f5dafb6a69e328c3f78325aba51
51efd1cbc30f9d44a165dfee2e26a05ed73a9750
28245 F20101113_AADUPO washburn_a_Page_025.QC.jpg
2131e0d3961ba663b36dba2c14abdd26
d821e20e71e5bf12459d542217fb56f98fc27e41
89967 F20101113_AADTNB washburn_a_Page_016.jpg
8db9b93205add5bf8474100087f45851
f332fae4d47512b2586afd764346c6cf050adc9f
164247 F20101113_AADTMM UFE0021296_00001.mets
d3eb96cd2e5e764bd1374fcc50456744
f670d191fd16ea91e8f2374643596c0ab09883b1
2103 F20101113_AADTLY washburn_a_Page_026.txt
05577568b4d74aefa6dabb9be8d6b286
7916b944e1715cd951f6dbc6caa97fd067756c58
6729 F20101113_AADUQE washburn_a_Page_035thm.jpg
2a8765042a1762bed72c724b37e729c5
fca6be8e6d05586d79335d7f3a71520a5decf9f1
28904 F20101113_AADUPP washburn_a_Page_026.QC.jpg
7cea32e6ab19fbdbcc4f5fd0c5c6e5ad
ef01af221435d0a5a92a1667e244c5919aa40b79
87809 F20101113_AADTNC washburn_a_Page_017.jpg
925e9446a85c13353bd45e5f801f7a14
00980e87bb66ff96d2d2e1b31be86685f45b6d2a
92333 F20101113_AADTLZ washburn_a_Page_018.jpg
9cce8b0af881543fc9cb6b56dcf5bff3
a9427269617c93b7300f3df78057489a9dad2151
6305 F20101113_AADUPQ washburn_a_Page_027thm.jpg
0ee355cfee7e22f1c4b9047ec1b24eee
6d76b0020883c1c7bbeced621fdf7a6673a160f2
6562 F20101113_AADUQF washburn_a_Page_036thm.jpg
1954b6e36a8cb00f3cb435b82800de2f
7ddad1619d2862bcc90aee4335f383528792f500
F20101113_AADUPR washburn_a_Page_028thm.jpg
555624742124e49fbaa69def1c2a6b12
21815a82b331174ac058b8cdf14f595688df95bb
39536 F20101113_AADTND washburn_a_Page_019.jpg
a41b4b52a45d86e48f5bdbf41336525a
b570861664e376dab2cac3c8793d16550f41d1e6
19107 F20101113_AADTMP washburn_a_Page_001.jpg
77d3503f3f1573485026fb6dee51007b
5bb3940a506e5ab5b3e4be5c1c5ceab2130fda9d
2551 F20101113_AADUQG washburn_a_Page_037thm.jpg
fbada4af4faef8c4d56304d7e74b34f6
be9dc95f99c9b9eced867c23938a28812e883f7e
26809 F20101113_AADUPS washburn_a_Page_028.QC.jpg
c81cd04cff0225709cf3e40575ca3150
e34275c4dec6b42cf2f31af5ae15d8e682c142a2
54822 F20101113_AADTNE washburn_a_Page_020.jpg
d98d54626f4ca4a76f1e69408fd76705
c811df044f8150052a0af521e106afe605c73426
3638 F20101113_AADTMQ washburn_a_Page_002.jpg
b10c78ee27b476fb28d4ff50e52a2adb
408493980e6ff7cc341300285237d41c011a3f21
2645 F20101113_AADUQH washburn_a_Page_038thm.jpg
0e3a7dd32938fa994a324ede4b1ada04
ff8723f26a08201d5b59b4a584455c9d559af1e5
6349 F20101113_AADUPT washburn_a_Page_029thm.jpg
6e465643926f13de28ad92f3d086c018
95209f8d50870ca6874d4b79d724ee5220352668
79268 F20101113_AADTNF washburn_a_Page_021.jpg
c2930eceeee314b687fe60a9fdd80752
d7105fe95f78c167b9698544e53567bf4e740eaf
4708 F20101113_AADTMR washburn_a_Page_003.jpg
778b12673706a57640694a053fb5be55
3279a6cddcbb1449fa614707dec176bc72114cb7
8551 F20101113_AADUQI washburn_a_Page_038.QC.jpg
9e7608bcaecbdc0024b9ee494d1c3dc5
f7e1f3f6113f0ba4a45cc507ef3c7485c15eaf68
26599 F20101113_AADUPU washburn_a_Page_029.QC.jpg
fb3cf0090cc8e1c6433f53a50c1731ea
4cfe099ce644708b3ff0d33063e8743c9ee292d1
89915 F20101113_AADTNG washburn_a_Page_022.jpg
5597b766852272df518873a4d7f8a8bf
f9aa856dead93200ef6233b5cb38ce99f373b3b3
80816 F20101113_AADTMS washburn_a_Page_004.jpg
cba2ca3753a49dbcf02e4f0318ef266e
9917c39fe49e4765aff8dc6d3bd53bb636d6b825
5908 F20101113_AADUQJ washburn_a_Page_039thm.jpg
d2afd782419045cb401c3d9dd8d35933
fffd5dc54972a0c7369809d31b6ccc394193f915
6558 F20101113_AADUPV washburn_a_Page_030thm.jpg
d8e2ca18879c52ed253c8e2d5c636a91
2e19869d94dfd704f9a21e8ea5b55d519c8df095
84772 F20101113_AADTNH washburn_a_Page_023.jpg
b258b7653698c78dcc089823c24873d6
195fdbb64be5ad7808956fff81d79ed0d2f470b0
73211 F20101113_AADTMT washburn_a_Page_005.jpg
e5a253a0172572e182a30ee9f94dab62
cba3234f64772a5526e494267044795fa658dd45
25158 F20101113_AADUQK washburn_a_Page_039.QC.jpg
daa0be463dae17c73da95ceccb3c7431
f4ad3b816d3f4bfcb796dd5372ece235ea8afeb6
28349 F20101113_AADUPW washburn_a_Page_030.QC.jpg
52a20e101c3bc37a0a2bc217f3d08058
fc65ed56cc73f3d69934a10bff30db7f7ef71079
90495 F20101113_AADTNI washburn_a_Page_024.jpg
8e17c72be51c9e40d5756737867907aa
30aca000941a9380e38b9e3df6fe98b26ecf6295
73109 F20101113_AADTMU washburn_a_Page_006.jpg
dedac94a9c1e9fd05f96acf1a2250968
7d95a9b658a53f54eea3293be10bdd18d0d6021d
6743 F20101113_AADURA washburn_a_Page_052thm.jpg
2121857622302aa08d4d65d5aa7e7e25
a01efdebf05c5cdfc327f4e18174ba4002c8a98d
5703 F20101113_AADUQL washburn_a_Page_040thm.jpg
341c5f1daff76c702b3b1ded877d060f
32ecb926c189e1f62e679cfcb4e6e20f3f49d7b9
6712 F20101113_AADUPX washburn_a_Page_031thm.jpg
6f8d9f93bee1a23efbfa6b111475b600
56a15cc7ddfc1786c940c3abb60380c758020ef8
90548 F20101113_AADTNJ washburn_a_Page_025.jpg
2ee22e1f7fa3c92d98e9bcb1b5d29d6c
c13b4d0175d406739825de94e80f0cee7744043c
19984 F20101113_AADTMV washburn_a_Page_007.jpg
0e6648afba69f8f85b20f9885fb2cb26
4f26fd67f8d6dc1e9759b0571d1c01f00863d2ec
6514 F20101113_AADURB washburn_a_Page_053thm.jpg
be19a7303f79a1a253c59bb838ea983e
25b50f254c49b597e8dde372d13d5be1a53b6b2a
24580 F20101113_AADUQM washburn_a_Page_040.QC.jpg
f49d2fbfd105b1145bd4c3e29b5bdbbc
4a4058c9d15983c1d78b09b95c17ffff595fc3ee
27610 F20101113_AADUPY washburn_a_Page_031.QC.jpg
fef2ac43fa73642eee7f2a537f3f76b0
f7735ed2f4b36e1acf5de6c42dc7cfe316f24fc5
90746 F20101113_AADTNK washburn_a_Page_026.jpg
d36eda8c0458bcb3fb94e06686ecf770
67550bc454bb81ccf46a1f84b1a652d0973d41c5
30504 F20101113_AADTMW washburn_a_Page_008.jpg
0ad473dbf3757c710dc2949e1ff7263d
a53bc16ec5bdedeb4bdf5b652e6d928fa38e53fb
6468 F20101113_AADURC washburn_a_Page_054thm.jpg
ed4d7eca5790cc83c8d830ef4e536f7d
c8ba5eb698157ac67e3975ce82a0a9d8ff7bc1dc
28750 F20101113_AADUQN washburn_a_Page_041.QC.jpg
607c60078857ade6f06cc46afd6b743d
7b24c01f83148c49a6fa29d142812552880e1075
6755 F20101113_AADUPZ washburn_a_Page_032thm.jpg
d5cb4499d4d8229299b969604cfdcca3
a9400f2476a4fc00d0273da67f42d26634e9bde2
82330 F20101113_AADTNL washburn_a_Page_027.jpg
cfe1e6632bb2447e830c185cb3eef03c
58537570ef05b3486d06b32c6d35c1affbfeeda9
23613 F20101113_AADTMX washburn_a_Page_009.jpg
1ccff716955c7092b0e1196554fd6a49
d7179c07f1e115acfd80019ba06b1f49af22360b
86819 F20101113_AADTOA washburn_a_Page_042.jpg
4d49de18bf079112e7d6874a5e678f8a
d47a100b47a9fd014e2bf6890b5f14b51ce0c5de
27331 F20101113_AADURD washburn_a_Page_054.QC.jpg
a99b28a8c03f52d00a8b6e61571872df
f9fa4314fc5eb66ef374415c6fbb00d394a86325
F20101113_AADUQO washburn_a_Page_042thm.jpg
86b8290b77ecac9f1d3ec5324f1f57ec
265f2ffb0c20c62c745159facf9c1a135519c00e
86441 F20101113_AADTNM washburn_a_Page_028.jpg
e3535cee4c6ec43d3024dbe7fd9dbab1
a4662f536cbf2e95032db0ea2073f68ebc68c0db
93712 F20101113_AADTMY washburn_a_Page_011.jpg
3a74658f67725e65de4055905fa44cb8
e0a63f39eaea2d3d6cbfaf1bc3a4c396a3aff25a
84161 F20101113_AADTOB washburn_a_Page_043.jpg
482d4b8a0f7978f62bbbe65113473a25
4e802ddd0465ae6c9b1983f13e76bf8c433117e6
6587 F20101113_AADURE washburn_a_Page_055thm.jpg
b6cb9c6c4697370559fbb6c793bb9b5a
21050bf63dad3b9e0204fe2d742c20ec283c7b56
27261 F20101113_AADUQP washburn_a_Page_042.QC.jpg
16925638744b9385c1ccba57e5c7fbec
c9a1d64bdf4bf2a7d2eb6fd8a3c56fed4635deea
83802 F20101113_AADTNN washburn_a_Page_029.jpg
2a28c559bf16f25512ef2e2f0306c53c
4383097c6616d4d667616ad065540f35be22dd1e
89439 F20101113_AADTMZ washburn_a_Page_014.jpg
c130ddf28fd9494f33764c74e66d6a72
86f864066214eca292295229b89f676acaeadc5c
87462 F20101113_AADTOC washburn_a_Page_044.jpg
9fc194c12a80339c5bf7d636f2c57409
1e41648e9b78029002b3813ab5193c921f914958
28894 F20101113_AADURF washburn_a_Page_056.QC.jpg
c8a677cdd379051dd0e1a3825007446b
b67b8896137c458612e5035dcd4b8f50419b9db2
6555 F20101113_AADUQQ washburn_a_Page_043thm.jpg
8543fb1ede1853f91b0e864f1f18baa4
fe018f76e6a4ea202f208ba1f2cbf2f2f902a073
88771 F20101113_AADTNO washburn_a_Page_030.jpg
53a51c9bb5a87d4d66826d227862fd9a
85142746e1f95a78336cef2c68f747c67c2bfef5
45021 F20101113_AADTOD washburn_a_Page_045.jpg
9b2132373b2d148030342b38205f5ddb
11b449e7a602242606eba9434498a7dd808f9822
27734 F20101113_AADUQR washburn_a_Page_044.QC.jpg
e32833f88e696a1518d4f5a1e2b90479
90ce24c35727fe316366780166806c2a2a3b2a57
88917 F20101113_AADTNP washburn_a_Page_031.jpg
2084392c6cb452fafa9518105aa8e81b
812b58f909a4631d470f408edb3890cb020b156f
6851 F20101113_AADURG washburn_a_Page_057thm.jpg
8a19bebc13c8ac48d8d4417e2520e590
a0cd8970d6ee9de020caa701e5e53a96904db1f7
3137 F20101113_AADUQS washburn_a_Page_045thm.jpg
2e663bf3b28c8157c8ef4f93ec6d3b91
ac66b0002c34c2b9e58446ce9b77a2a087dc04a1
90317 F20101113_AADTNQ washburn_a_Page_032.jpg
31db0f8ae65824dbddf804e2d1bd0cba
9e83451b4c1e7048f8426eb74e616432eac7dc0b
32026 F20101113_AADTOE washburn_a_Page_046.jpg
37520d7b5b20fcb84089c57f4896b6d4
470e4e56dfc246bdfcfddf8da9ee87fb7d005641
28835 F20101113_AADURH washburn_a_Page_057.QC.jpg
9d564d03b6abaa22b36869f7cc4dfb58
663b55fb63b0afde87995bb29b435c6f1edca7d8
12624 F20101113_AADUQT washburn_a_Page_045.QC.jpg
7b7840b5dbd710d1752861eb7af898bc
3318387d2a00c9cb9cdf316fdd4afaaa909cbeff
93975 F20101113_AADTNR washburn_a_Page_033.jpg
654e7a585fe31a5f521a90ec4dabb5f3
587bc12ebe99c837a31088aaaab00f558bf274c2
35147 F20101113_AADTOF washburn_a_Page_047.jpg
bf0a26073b39cfff6be088ed9c7a3373
4c1735c2cad667c61665c0309c6e34248e71e377
28420 F20101113_AADURI washburn_a_Page_058.QC.jpg
ff0b8622e8719270e33e55b56807b88b
9ab5ab25cf68837bdb99981b3744b6153ac41b18
1972 F20101113_AADUQU washburn_a_Page_046thm.jpg
0d55d574c3861325f0352ed5b9684437
0ae9c4be6d6ac83efd1db59e64a43c2fc2a5a4fb
88683 F20101113_AADTNS washburn_a_Page_034.jpg
f85a4ebc893b706f4b9b1663d3c8c1c1
5517974165c94d81c6afdff2b85de85ebf64db43
42506 F20101113_AADTOG washburn_a_Page_048.jpg
26d573ab429c11c16944fe2e33a36094
0e734dd2f1158c20122e17e97f384e73ce717290
6550 F20101113_AADURJ washburn_a_Page_059thm.jpg
6038792bde662469781c0ee52a552261
106c859cd95228c03cd864fc38631f7fef4bc7d6
8269 F20101113_AADUQV washburn_a_Page_046.QC.jpg
bb1619f325c2f858b5d04adcdd710242
74444b04c56449b5eceaea9e870c0e22bfbd1476
88594 F20101113_AADTNT washburn_a_Page_035.jpg
9dd4f1a8d7340ea530a20d194a4d8de0
931bf61fbf4880d34b448d7ea0357c41c95383bb
84670 F20101113_AADTOH washburn_a_Page_050.jpg
55687eb595fea97cbce4a4279a2b5929
43314764817ffa79b39e55d17cde1bd86b5c4f06
27201 F20101113_AADURK washburn_a_Page_059.QC.jpg
236de16e6b20b9fe14ed4fe2e9aa9db6
d4896f903420351529ad5f533cffce7fba0eb771
10629 F20101113_AADUQW washburn_a_Page_048.QC.jpg
b26a51a99cd76d6a4915bfcebe12d28b
df6dce00feb7cf84c8fd6bc2760e1d4e44cf8db0
89948 F20101113_AADTNU washburn_a_Page_036.jpg
417a27d4c8bddbcf596e8c5e49c6d535
d86a101f0bdc59d79165676aa8a31571bbe1b25a
82685 F20101113_AADTOI washburn_a_Page_051.jpg
7c8cf5c5be67a9cc70d41996c8b64add
3367e7f0cc1d4923f11d85907c83a5061b023c5b
27427 F20101113_AADUSA washburn_a_Page_072.QC.jpg
a982fdf04ae48f079b0def7c6a16a021
e209860a584dfc2c6dd6c04cfe62dfc39753bab4
26562 F20101113_AADURL washburn_a_Page_060.QC.jpg
503e8d4c670e9d5e0d3ad2de20c0017f
eb4c526dd8f8a607828a3fd81f4af820b2495a43
5906 F20101113_AADUQX washburn_a_Page_049thm.jpg
63e57876fc62fc7729531217052f55e9
f544ab2ba065242ebfdf3667021df9f054f5ebe5
30413 F20101113_AADTNV washburn_a_Page_037.jpg
8d96d99aed8fe7f4c6cc369397cf1f9c
846ce12885a51f0a4607444d7f58ae460dcf2fab
89424 F20101113_AADTOJ washburn_a_Page_052.jpg
c2135d31c08346b62586cfc1900aef5e
d62ff8ea1a8e03eceb9fe08e3384bc8b1085511a
26673 F20101113_AADUSB washburn_a_Page_073.QC.jpg
f74d315b8b749ef4b31f41949d791981
703322ad22eeca89d11cd0c939fd4f5f0f35fe4f
6665 F20101113_AADURM washburn_a_Page_061thm.jpg
9ba235aa54fe6a10bbf87715b8cbd67e
63e8b89b98b838ef909fb075030d6a923028f87c
22845 F20101113_AADUQY washburn_a_Page_049.QC.jpg
6ee94bb989235c9764d62ebf396e39d3
bda5d995db470b90dfde98f3354f5e9810b80d69
29250 F20101113_AADTNW washburn_a_Page_038.jpg
ffe4b372dbfea6f150928432fed572e6
f830089e4f488a65303190b36629d757b298672c
88551 F20101113_AADTOK washburn_a_Page_053.jpg
ff5af56ed426f7b708cda1b16f1cc4ad
1335abf36a781003e668a2c466194e8ed03c4b29
6650 F20101113_AADUSC washburn_a_Page_074thm.jpg
8b8031296ca15270904fca90a9a57b9f
5b52cb2d4083601928b8ffb12f26ebc08cabb2f6
6740 F20101113_AADURN washburn_a_Page_062thm.jpg
36aac8c408733c6758b43a23677e816d
a60292bfecd62a54411aa4fbd9e7a6f9c81f7732
25665 F20101113_AADUQZ washburn_a_Page_050.QC.jpg
fe1b0d2a5ac30f2c9d9e5a7137ef50cf
d3a70eb57fc15020baed36237667e2dc55d5b596
82640 F20101113_AADTNX washburn_a_Page_039.jpg
965217e7771b1a85d18336a1b814c6b5
47c563fc2ba87c8a7f55c9c8218122a927dcb0fd
90166 F20101113_AADTPA washburn_a_Page_071.jpg
b1187bc95284bfec740ccbb9830748a8
27d2e45d19b42f337ebc1d0774e7fa93874328b2
87304 F20101113_AADTOL washburn_a_Page_054.jpg
beec4cfb1e069265bbc8ca5fce987dce
85dd35a5bdd966ac486f97697d19d34d953ac21a
F20101113_AADUSD washburn_a_Page_075thm.jpg
e85cc99cc77589c33e792a8ddbdc1208
f75c17b875d4191be58f67dde59493d035dbafff
27985 F20101113_AADURO washburn_a_Page_062.QC.jpg
153631cac8d0d6feb01314450beef16c
8e616848c59833fe33fe4da62477dff1f32bdc68
77929 F20101113_AADTNY washburn_a_Page_040.jpg
e09bf463e5e4d5c6e5d41e0187282ea5
1813ff5b190880af79a4371f7f0b48cb2cb430fc
86498 F20101113_AADTPB washburn_a_Page_072.jpg
426cab8d80c5eac93fcf757dfb46d4d7
5d2a27aaa670e518ec4c160d4cef342a8ab89498
90062 F20101113_AADTOM washburn_a_Page_055.jpg
c7a25084417f59140a86c2913b708af4
3ff68b0c2b619b94fabab99b52a64b0c7dbac7e3
28668 F20101113_AADUSE washburn_a_Page_075.QC.jpg
8dc46b694cb63394611a035d359fe10a
6cc73c51ab62d54db383105aa29cbed2e79f778f
6455 F20101113_AADURP washburn_a_Page_063thm.jpg
acbcd91fdcd8fcdd131e91f1ac4715cc
2cd95ab35640ea5c29cdad7732b50b2f38a390bf
91626 F20101113_AADTNZ washburn_a_Page_041.jpg
d8550fcd9e334b27a02ab770d3c0a6dd
e2253ed0e12dc08ada45c627004895d94fac232c
84840 F20101113_AADTPC washburn_a_Page_073.jpg
95be3154ea3af669c23a902561dcf36c
dc9553078fbc6d58890bb3d475df04542f1dfab0
91950 F20101113_AADTON washburn_a_Page_056.jpg
3d94e615b5996e470309fffb210ab71a
3ddddd17130535388d806f8302977fd1c6eb12d3
6531 F20101113_AADUSF washburn_a_Page_076thm.jpg
8afed7a3ebe5f19b95939faded64081c
69acfa993e68c083d20709b64274064649fd1f1f
6713 F20101113_AADURQ washburn_a_Page_064thm.jpg
47461f93e9b781f1ead32b7cb36a24c2
393385de5f2edecf06e24ab99d24db1fc76481e0
91900 F20101113_AADTPD washburn_a_Page_075.jpg
796bdd5481ff0079e7f19c068488ff20
8aeb40aea2c4e5c71552d96ec9e042a71b4ede94
91892 F20101113_AADTOO washburn_a_Page_057.jpg
ad43e66a3bb24a73fffc22c03d6b96dc
c0478705619003413926f29a2c0e9691d9fab213
26996 F20101113_AADUSG washburn_a_Page_076.QC.jpg
22dfc5b03b1ab774d6eee20a4cf2795c
555750feb3645ddbe783d1ff51b35022c6510e26
29082 F20101113_AADURR washburn_a_Page_065.QC.jpg
2959c380e89c33439865b0b77ed8f5d8
34be97bb365e18736ba951a953f528661da0d44b
87237 F20101113_AADTPE washburn_a_Page_076.jpg
b385d6707c6d98f1509224be1051698a
711dd5d410a157bcc87a24708c7814d03809f566
84430 F20101113_AADTOP washburn_a_Page_060.jpg
bdb1938c7bcec3073fea731c1097eaef
3b620c66446fafeaaed0bd2af9db31d22a39f005
29532 F20101113_AADURS washburn_a_Page_066.QC.jpg
eec8622e4e501c4c88c6509bd5f24435
eb0a31eff274a63a3b067245afa8f7732d46c611
90786 F20101113_AADTOQ washburn_a_Page_061.jpg
a8b8f118bddb3a068b47d017ac82eacd
4dee95be941a6d55eb1f35d10f18b8fc58295b25
6769 F20101113_AADUSH washburn_a_Page_077thm.jpg
0f7c79521255bff3b99d6df8bab047fd
bb82810e37a0156cb785d82ff227bd5338006300
6387 F20101113_AADURT washburn_a_Page_067thm.jpg
ff7e1ba7918dd44d34b8f24a6a6ac455
a54006b10f17ff5eace225aa20fc9d4136f6b2d1
90342 F20101113_AADTPF washburn_a_Page_077.jpg
33b74535a4198ed6fe29f11f84c8849b
3bde2381f06b5429f6a4412f2b96b61c627fc938
90005 F20101113_AADTOR washburn_a_Page_062.jpg
3a2e1c0ff4043a57a1855bb94418eae9
63adf78c1bc9c5cff110169349322468c45b5bda
28239 F20101113_AADUSI washburn_a_Page_077.QC.jpg
752ce2dcd84c7f9aee9fb98a45bf5cbc
de37b01db51cee21941ed2deea8f0a16fc097746
26987 F20101113_AADURU washburn_a_Page_067.QC.jpg
7bb28b4f4d237f899d007a7b4940f10a
acebb401be091b743f8ef1f72d69431ca1d78658
92350 F20101113_AADTPG washburn_a_Page_078.jpg
f72ecd883ada8112edc199a140552e7f
400986aaa2de2eadaf708d9d7a98cc0c87488164
86949 F20101113_AADTOS washburn_a_Page_063.jpg
5ae8a6df2471011180d729289b160cd0
8d6cf94320aaa8175709170010143f1a2b77a373
6775 F20101113_AADUSJ washburn_a_Page_078thm.jpg
b5b89632ee21538f331c421cb16181c7
c46f21a0662a1b3c4ca2aa7ef789f3d86e5ca148
7045 F20101113_AADURV washburn_a_Page_068thm.jpg
abd49531ed986514d3ae683979ab6aa2
40d90ec91add166d778524d56ec5b4ce16fca22e
78887 F20101113_AADTPH washburn_a_Page_079.jpg
f43d4b502e55c4e376b9709a094195c8
00ebf9d7e72f1afbe5c9579497d0f89d31676e5d
91713 F20101113_AADTOT washburn_a_Page_064.jpg
dc9555a3373aaa523a335f4650ea4798
5cbf4916ac41294bc506481d99ef0da92038ef76
24702 F20101113_AADUSK washburn_a_Page_079.QC.jpg
3d1903f43b3a243d0056875575858d9e
5de3c176854f81eeff0955f7e3b635f2d3cf2ee1
6472 F20101113_AADURW washburn_a_Page_069thm.jpg
00828c4e148ef3097bc4fba7199db561
12f6c672d19596509aa994f17a6a8f222644c854
96717 F20101113_AADTPI washburn_a_Page_080.jpg
f093a2659bd821b22276161cac379650
98dd1747ffa3ad569a5f10a01abf9383a46d5f5e
91177 F20101113_AADTOU washburn_a_Page_065.jpg
45839578a2a76abf0f3eeadbe1155e7e
8a0422ba92188f8002e823a1e53630cd44b64a3c
11870 F20101113_AADUTA washburn_a_Page_095.QC.jpg
a042169e6bc5f38d3ab5ca393b17e54c
f84af290eff99b6b45a8ae6a309fdc454acb4098
29932 F20101113_AADUSL washburn_a_Page_080.QC.jpg
837e3c6a06c662139a85db218af60739
0526b395362adc59f39647c0b9b06c04fb8092f8
27151 F20101113_AADURX washburn_a_Page_069.QC.jpg
3b12b6feb99231fa5b9b40662311eb42
972e4085b552bf1949ea2ab6ed59e2ce2fb9a316
91798 F20101113_AADTPJ washburn_a_Page_081.jpg
e28db0ba3072da12b1cf75ff640104db
f4aea3d0273aa1556fce586a155d1441f24705d8
94417 F20101113_AADTOV washburn_a_Page_066.jpg
db11bcb6f85b260e4a87b30be2723068
08d4a2fdc239af5eac573e9c6503e4f45f8f830e
3822 F20101113_AADUTB washburn_a_Page_096thm.jpg
d94565277780a3cc5bc52152c0c5353f
0779b0f02d9ccef25cc9f16748fcf13e4979dcea
28412 F20101113_AADUSM washburn_a_Page_081.QC.jpg
1a7c2675d1ea6b0fc17bfb8614ce0549
9a5299707d56cca7fabe967508460553b1401f77
27420 F20101113_AADURY washburn_a_Page_070.QC.jpg
37187f8679cc25eb1518427288a51473
1f302cd7f0c89e2bf268fa2c2ab6bf6dd91c5dbf
90196 F20101113_AADTPK washburn_a_Page_082.jpg
56d62741013a6b9c09375637df5e7917
76ec804df650d7b789aa6e5f95498f67096a714e
86448 F20101113_AADTOW washburn_a_Page_067.jpg
2686f9e2507e0c4c9078bedfecc22ff4
32e9ef9c36d3a424740cf9d164460eec313ecf6d
14504 F20101113_AADUTC washburn_a_Page_096.QC.jpg
7026ebfa87846cba667bb719dd7ab78b
317521f4ec954d8cb8187639784ed13f7f5b2ae6
6549 F20101113_AADUSN washburn_a_Page_082thm.jpg
9017ecd6e5487894b50cfa119303f105
92d2d9180f2ac260f146de807e19a3a40046ff60
28009 F20101113_AADURZ washburn_a_Page_071.QC.jpg
adf0212942463a6391a68e1012b08985
002ef00889863f88144e043fc629220101b5b662
39768 F20101113_AADTQA washburn_a_Page_100.jpg
cf023400a38d58517760ec3261d3f599
a9e3d54fa780d4238ec8f5022eb01bb37c0ba44d
65062 F20101113_AADTPL washburn_a_Page_083.jpg
09f5b55cc111401a132570c60f8771dc
a113c7b6232a62de7a60db574a59151095eea77a
94654 F20101113_AADTOX washburn_a_Page_068.jpg
44127640949062f7b06d33e9ee86c4d0
0e28d5350a39f4a94087c11839994d01c8e796a8
3599 F20101113_AADUTD washburn_a_Page_097thm.jpg
df06a437687b0269f5a07144475d491c
9090f1a9c45f15615a02cdbd3685dd74be9c1d82
27647 F20101113_AADUSO washburn_a_Page_082.QC.jpg
0612d29c22a9628ce04a83dddca03e0c
abe60f4325daab8c6f62138f20457f30e3eb6f1d
45388 F20101113_AADTQB washburn_a_Page_101.jpg
a28af8035ba0d48e83c6a89aee90d75c
5b849bb6a6524336d1f010fdbaf6b562ffcdebcc
4317 F20101113_AADTPM washburn_a_Page_084.jpg
51df48f7fcb0c0071ac129a888d02678
fb9dd1936972c79b3f42d855a94d7290a352ac6b
86870 F20101113_AADTOY washburn_a_Page_069.jpg
25cbef0147950e72e3a86d6f430d9195
b3d394a36bec6bfb4a3bd86ae05c1bb8f187a3c0
13013 F20101113_AADUTE washburn_a_Page_097.QC.jpg
20f4dcab601d0d2041d7c71db9af7896
298c9f1c5ab2bc6a3496a39adf450d2b5e778412
473 F20101113_AADUSP washburn_a_Page_084thm.jpg
15a979149c2177b75222470c0e025133
d61e4a983fed0b95fea5789342ae0220b9f8398a
48359 F20101113_AADTQC washburn_a_Page_102.jpg
2017fd4af1a164ff684da0411dd83359
b15eab66496b9e904abe6b839abe079a681e862b
41704 F20101113_AADTPN washburn_a_Page_085.jpg
1adc1dd400c5e39303c2ff6f9834a3a9
c565b6a954988d0bc3e1b7551b2a5082ce0aece5
88446 F20101113_AADTOZ washburn_a_Page_070.jpg
7f5edfec4d53a3d7bf30329ac75dd55f
658a99a19273f9474ea396ef0321138085bacdc5
3729 F20101113_AADUTF washburn_a_Page_098thm.jpg
f8adb30a37e74de342cb5f8891a9d452
5002e14419a95be737c354b05e0f108d69f87b00
3330 F20101113_AADUSQ washburn_a_Page_086thm.jpg
2004e5d8b32b4b3a4da2bedf8bb10980
9718da4672168d0c1b602b3caa71472237b1070a
48409 F20101113_AADTQD washburn_a_Page_103.jpg
6dc16dbf00d579f7de972da40e209c87
b9571906a29950176baab367ec863ce075d11835
36892 F20101113_AADTPO washburn_a_Page_086.jpg
2349f8054291edb3717e03822dd63413
addc4db2aeb847dc34249dbe4f7fbc4c8ee52bb2
13119 F20101113_AADUTG washburn_a_Page_098.QC.jpg
4d631f46be2b94a77d550d2138b39014
dfc2cfb8bd1267d63d7ef058d361a8194a7ebfc6
9462 F20101113_AADUSR washburn_a_Page_088.QC.jpg
2d9175c6ebed60a6ab00205e0a7add4a
29c9b7bd13eff7c71aec283fc19527af77575da8
40429 F20101113_AADTQE washburn_a_Page_104.jpg
e530c962873234c663b7287d9905cddb
ed42c114c637774ae2d9a2cdf8e1630c4497fef9
39118 F20101113_AADTPP washburn_a_Page_087.jpg
3f33a6a57966f69e679aed6a5cf3bc14
20dfaf1d9996a8ff1f24b5fa3a10163b770b417a
3422 F20101113_AADUTH washburn_a_Page_099thm.jpg
a0dc6a7f809effd3fe83b3eaddfb7c85
82a734754208643f720d77a4e1fc2bc95f278f01
3179 F20101113_AADUSS washburn_a_Page_090thm.jpg
f706c330c69b1b52eda87dd18efa1654
3d039c881bb8cc2ec8dd7304cc9af377e3c31961
42529 F20101113_AADTQF washburn_a_Page_105.jpg
8227302ffa1cebe0b2ef3d45de369a95
d6ef6fa22e5475e910d4cfc969717be8f838f8d1
31841 F20101113_AADTPQ washburn_a_Page_088.jpg
5e2f13594db9882fd752b41df6421ee7
820f4ca4800ea7f987afbca6391da5a202183688
10288 F20101113_AADUST washburn_a_Page_090.QC.jpg
a8a81f3cb2411b118c3a7e50451bc86f
97e9a8edbb100b7b334a4a00d4b53cfcbd1066d2
32471 F20101113_AADTPR washburn_a_Page_090.jpg
414963dfc44a7671b0cbbed84714bcac
157ba24c43910c44ab8189562d4cf05dea237064
12322 F20101113_AADUTI washburn_a_Page_099.QC.jpg
c54fc4d1ee336cb17e5a1f504c072f22
372123a96a46ad1b6f98f688535b1d5aae2d34f4
9949 F20101113_AADUSU washburn_a_Page_091.QC.jpg
abc538dd7d73a8e1ac67b2f5363fe7eb
af935034f3a2274a8afdddf2c75a6c4ec5721c04
44314 F20101113_AADTQG washburn_a_Page_106.jpg
69bc65d336731f6ca0579bf415b9ddef
0b015bffa7cae01275a2866df57120fe93a0b986
32787 F20101113_AADTPS washburn_a_Page_091.jpg
8422cafaeaeb9dec7f86923297424d2d
a2e39b2f49b9018cd61a3e1c438d9a55299c1862
3505 F20101113_AADUTJ washburn_a_Page_100thm.jpg
f24295d38b0e8d9222c107cf56111546
3717f9e54226ff9be2b518f6a3633590e9bfd2fe
3468 F20101113_AADUSV washburn_a_Page_092thm.jpg
c4981606f4e584736cbdafc78022dc56
02304ac267cf9ee68cfcba0dca1fc286c174397c
42788 F20101113_AADTQH washburn_a_Page_107.jpg
37e4e9374ab120b43c9a4a37d0ce5efc
8a7b36032ffdb321761fd4e1b3dd1be9e39d0470
37417 F20101113_AADTPT washburn_a_Page_092.jpg
c341e4b8bfca972946e0dd9c39382d3a
d89d56f93b2e10be4763348b9b7735f8c09190a9
11780 F20101113_AADUTK washburn_a_Page_100.QC.jpg
81527468d976e03556ba59d8405ba7b4
a2d393749ab335fd9363c76431315767d293bb1f
11746 F20101113_AADUSW washburn_a_Page_092.QC.jpg
d1dd3c786eeb33b6a296a57c036f3439
3864a2a8f662ec2e2482ca8fb8306bd92e5ec021
43824 F20101113_AADTQI washburn_a_Page_108.jpg
4680cd193808f6b5f8bbef182c9e907c
0c84fc43f23401d52447d033381c353cbf2f26e7
39213 F20101113_AADTPU washburn_a_Page_094.jpg
f774f26493805fc4e728904d8501a14f
871eda0d049a294e87263b654f4462cdc1cdc410
3355 F20101113_AADUUA washburn_a_Page_111thm.jpg
dc7fb6a9423d4ebe96f3f49308b95473
1c40420dbdf04870e6ba4e9d842fc02ba40e98c8
3778 F20101113_AADUTL washburn_a_Page_101thm.jpg
6518e41c7270f2d2db4f1541c1fcb506
6993be73d62091b7516337b0800b6cbd824632ed
12787 F20101113_AADUSX washburn_a_Page_093.QC.jpg
618a0d299900cec99722c7cda0a4bf48
1dc07eb551c4c2af4f63c573fe0be6f35fef5428
42992 F20101113_AADTQJ washburn_a_Page_109.jpg
9865614b5a96c3f853d78d168dc05088
be4bb07f3e037b69d0218e3b23919f1cbd83b297
38220 F20101113_AADTPV washburn_a_Page_095.jpg
9e80e7597a2abb4d65895beeee19bc5f
56850dfb0f8d4920e8c2fc299c17b8d3436c40fe
13151 F20101113_AADUUB washburn_a_Page_111.QC.jpg
fd787fd9e4705eb9d69d4f928f979357
f440802bb8c6777d204f58169bce03ba494a7972
14393 F20101113_AADUTM washburn_a_Page_101.QC.jpg
4fdc3428c2e0ba2dd1f4884db6926816
1afa3eef21dcca3e94c5eb6672cfa7270426888e
3647 F20101113_AADUSY washburn_a_Page_094thm.jpg
ae7e12ba709361aaada1ffe0bc261048
df62f77fb1a59698efb3adff52e65107c6c45fe9
46013 F20101113_AADTQK washburn_a_Page_110.jpg
f3705ffb90c228124dde86df9fd8f4c6
469361c581c580d380f5a6e3d4f2f6c123317221
44036 F20101113_AADTPW washburn_a_Page_096.jpg
afe227bb8cc4e3e47f65bb7dbe26f3ac
904f8186cb9a09609fc9da42991d534170cc9075
3511 F20101113_AADUUC washburn_a_Page_112thm.jpg
26ab47ebf86b5139d66188fefcdf25a1
f2cf3ea6af42e8156b7a49f4bb13181c88b0ed53
F20101113_AADUTN washburn_a_Page_102thm.jpg
afc7e886eef676c0209703eee859a379
614339caf3061bc9c6b24870a381443868c75b3a
12951 F20101113_AADUSZ washburn_a_Page_094.QC.jpg
27dc998f0d320dab7896e9ebe6cec36a
ac3ec58d74834ada9c7613c3ce3e9db1436c2a1b
39592 F20101113_AADTQL washburn_a_Page_111.jpg
f26595e9ce6ce1c96c63d5a46afcf014
c69b0fc59616220b9b0528b24328423d3f25c99f
42740 F20101113_AADTPX washburn_a_Page_097.jpg
5332e0f3b4800478cdeb65fbf281928a
359f22af984430b5d75b37f66afdf5425914de3f
33204 F20101113_AADTRA washburn_a_Page_126.jpg
9ff914d4d48b6a9930dc05f2d96ffbe7
bf6d040e07dc9d4dfbf9faac68dbf7de9a944ecc
13814 F20101113_AADUUD washburn_a_Page_112.QC.jpg
6093daa7d32be920b1f23c4ed08421d2
165ffb420c492af38c9c84ef1412894350e34006
14234 F20101113_AADUTO washburn_a_Page_102.QC.jpg
6caf1acb30a52418980acb7ea6acf8c5
563caa71d08dc11fb181c26e3423420414588cb8
44992 F20101113_AADTQM washburn_a_Page_112.jpg
3308a01c69bed4dc3843d5fc209f0568
04f81c4a39beea95e1d67464121caf29c971da11
43545 F20101113_AADTPY washburn_a_Page_098.jpg
5075487152a7ae1920c36ce891219d46
ea671b8126b0ad3b44ce01f5cfbb82bdbbe00b69
37073 F20101113_AADTRB washburn_a_Page_127.jpg
46aed78fb9dfd5e4a71eb059b7f403e4
d7fe14c9231eac408057bb2cfddd18b62ff62abc
3613 F20101113_AADUUE washburn_a_Page_113thm.jpg
a376b5610bc41cffa2c0e3a1c2c8aa17
ec2db82b130a629af27a735f238c318a3f3dfb37
13742 F20101113_AADUTP washburn_a_Page_103.QC.jpg
6f5e07175c0e8dfa075a2a1e457fb79b
17639abbd9eafc3572a046e68ec340d137df3fa9
45466 F20101113_AADTQN washburn_a_Page_113.jpg
13d1d93fb4cfee941fc1a60835b4dd60
fec26c8f50019abe40c0f6e36b2100cf5b2228ac
38566 F20101113_AADTPZ washburn_a_Page_099.jpg
998408ee4c9d82ba54110462a2e9374a
f1139c4ecc7e88f2a99351bbbac4e8d238c95702
129174 F20101113_AADTRC washburn_a_Page_128.jpg
39be827a396a4f64e0dd1718c2ccd979
65521ca6cbaad0de70a716e13632ac5b76da0388
14035 F20101113_AADUUF washburn_a_Page_113.QC.jpg
ac11b8ba83096d660e59685b3f0e0e53
dab99d7085023beb3691d5dc14ac79e7709b7dd2
12279 F20101113_AADUTQ washburn_a_Page_104.QC.jpg
8250a360c48dff8d4fec97b283b9b1dd
f42a1757c62656184f8fc166996aac2da8545a9e
37688 F20101113_AADTQO washburn_a_Page_114.jpg
f276aa5c025d8c276fe96e3de84f5922
a22e294a2fb0b8cc03115e726e829a3252497f22
135272 F20101113_AADTRD washburn_a_Page_129.jpg
bd307afd63587aec4d144f53e527916a
d8153d6758916613919b3944821edf8ec6155ea2
12550 F20101113_AADUUG washburn_a_Page_114.QC.jpg
36ce143a8d9db6e977961604b03c26ad
e3a3e11e39302684c9f0f32027d61c4dba24eb8c
3452 F20101113_AADUTR washburn_a_Page_105thm.jpg
381662d1a91d2b7005302011703d89d0
bc3452b2fcea2130ed65232ee01264804d1464f6
45489 F20101113_AADTQP washburn_a_Page_115.jpg
9283342a0d21ebf2e599915fdabd86bc
8fb6d3257d486f10dd5aed38b14bb8245e899fa1
135073 F20101113_AADTRE washburn_a_Page_130.jpg
08309e211f08d9d935f2a5b08a4e6fdc
db30ca87fa541aa52832817f65bb519323e3846b
3360 F20101113_AADUUH washburn_a_Page_115thm.jpg
a0ba162cfda36584429efe69fa2a011e
3beda886aef67203ccf2874631db109f3bbdd398
12796 F20101113_AADUTS washburn_a_Page_105.QC.jpg
0f26fa5dc21a0122c37c52af6306908b
56eea01f59554f66e6f41f4867b6aff79d8fb05d
36421 F20101113_AADTQQ washburn_a_Page_116.jpg
43a4b1037027e6fe2efbecc522489af9
de0435f9b1d4789a14d4d8a79ee006c6c2e6e16a
134645 F20101113_AADTRF washburn_a_Page_131.jpg
d0cf12f6b83b2c4d985e5e753814911a
e7d3a0c1a80a3deea535cb27ef1eb82ce632e201
13786 F20101113_AADUUI washburn_a_Page_115.QC.jpg
653c95e9f8a282610f6a15cb0ccaf517
74dd747dc5c353e8fd66250d6e21e43dffb3208b
F20101113_AADUTT washburn_a_Page_106thm.jpg
c7d448452608678674279b673fea9e70
d8ae76c89d606d782376698a99f108645ab616c3
58090 F20101113_AADTQR washburn_a_Page_117.jpg
f0c0e6557f8f2bd00b97f5f1a3a04c78
e30f9f8fa4abcf9ca9b13e3f0602650a79d06636
139942 F20101113_AADTRG washburn_a_Page_132.jpg
6aa5c6ad802719c1bceb97027d18240a
cde96e59d4e8bcaa8a2a1d07583f16b39d00ab74
13020 F20101113_AADUTU washburn_a_Page_106.QC.jpg
8c9f058deaeb3c52feb8fcd1e0e0b29a
5f6036d47394cf115d409bf675d12d63c8bf777f
5118 F20101113_AADTQS washburn_a_Page_118.jpg
d8d1b4ece879c21a80ffbec35009ea2c
9e514f92f6043a235dc6a0e6e415851e7c6b396d
2860 F20101113_AADUUJ washburn_a_Page_116thm.jpg
3b6319f2901ebcf4d512fb026161493d
c753839de506ee1f76c2cd529526393950a1ddf3
3435 F20101113_AADUTV washburn_a_Page_107thm.jpg
90d2561072edb9ee1fd0442bc9959be9
50ecd4b193dc21bf9969dbee55cfb2a2d5c967f1
37142 F20101113_AADTQT washburn_a_Page_119.jpg
c2c5dfc380b9b4ca1211a4177d14b1ca
d7181a33c566139ab126e2758b42e26df6320d9c
136926 F20101113_AADTRH washburn_a_Page_133.jpg
47092392bed936691dc3e7660f604de0
581573a8a04e81afaad982a8ba6351d63a8610c0
15269 F20101113_AADUUK washburn_a_Page_117.QC.jpg
aeade54b6483a2a90ba416ceb0435f13
b65267d73ebcc0b4e416bb8403b35e9c05c18df0
12825 F20101113_AADUTW washburn_a_Page_107.QC.jpg
4f02116f63c80f338bf7302ad3f51146
0a1c6241e7c2ff4fc16cf18dc9f442c1ca84b35f
136937 F20101113_AADTRI washburn_a_Page_134.jpg
ace6b2c876a76ff36ed819a362ea8379
1c6ddbd9a0c8c118b994999b64a158caafad3085
4741 F20101113_AADTQU washburn_a_Page_120.jpg
aae162bd81a30071c1f5b58bc0b2ab96
8bf2daf0e6d85701d8619e9da989e8ebe0076d5b
11730 F20101113_AADUVA washburn_a_Page_127.QC.jpg
0ac772ff8a1888b3e1a40a35020d83b3
5bda4926d6b6bbb43a1182366cb54f357340e682
533 F20101113_AADUUL washburn_a_Page_118thm.jpg
1ca75caef71a347c94453843ff7c8a4f
5b970d9fb377bdf9f99b72618128a99d48fccda1
12351 F20101113_AADUTX washburn_a_Page_108.QC.jpg
f95df6489d6580299d4e6d95c1bcec21
f43dd64d54286a5461c8dc026c3087063854bc22
142118 F20101113_AADTRJ washburn_a_Page_135.jpg
c1c833ee9b29156b3561d7654eefdd19
a900054cc6b0c094daf2b9f25420363c2edc5d8f
48403 F20101113_AADTQV washburn_a_Page_121.jpg
79e42ee94bda8dd160557f650b85b8ab
87b7d4d9dfd9879255dba272620a434ff4163d79
7287 F20101113_AADUVB washburn_a_Page_128thm.jpg
fbe5941110ddc5e8843fb3a84c3fda2c
3b3602bfc0aeb5efbc411c0aa8f4b26543905044
1754 F20101113_AADUUM washburn_a_Page_118.QC.jpg
c69ded3977b7873ec609eb12a7d25422
6fd1af1ca369bea8c83e559cf88e20d2c9584c86
3591 F20101113_AADUTY washburn_a_Page_109thm.jpg
ab6a88fefc478b7a13495639b147fe65
99f5b005516577bf304575dad4ff577ec6c22d85
131546 F20101113_AADTRK washburn_a_Page_136.jpg
f864b220315af955d72be4b135f4915f
b07cd62b8e8eac6ee4b8e3e311bb57090191a03a
48268 F20101113_AADTQW washburn_a_Page_122.jpg
09781d1daf5aa482ed2c1f81a4f4ecab
46c3b1853ee1df7d549e1bf1b8b740d939640ef4
33106 F20101113_AADUVC washburn_a_Page_128.QC.jpg
2e2a7acd6c075565eaceac4f25b2c646
38ba4bbbce6f66aad82504f979fd29ee6fe93217
2618 F20101113_AADUUN washburn_a_Page_119thm.jpg
7c2ea6025cf44c4acb91e132d78be738
e5bb023c2b2ba6d7b69f4b1619cc8e910527f1b4
12387 F20101113_AADUTZ washburn_a_Page_109.QC.jpg
ca8010161e70832fb15e132e2bf1b64c
50d1120b549f9df28b0d6e75ab35353ee3b3bf5a
115843 F20101113_AADTSA washburn_a_Page_012.jp2
5939610171966118302ccdb25ee7a508
ab0bbf6e33d0ef6312f2732c11a94bf9ca685493
134514 F20101113_AADTRL washburn_a_Page_137.jpg
8a84966a1548e4e34541d393466315ca
94d2cb85b5e1c018fe5d38f1e521f65ad86e37b2
55389 F20101113_AADTQX washburn_a_Page_123.jpg
52a39db19fbc1f1e390533599c463961
2b447c8ffd36ebaad70dd43fd839373c8dd304a6
7748 F20101113_AADUVD washburn_a_Page_129thm.jpg
cf1cda7e871110202e65933f68e27645
670161a10dc41aee8288bd3d9c9c9b4fc7deb45a
540 F20101113_AADUUO washburn_a_Page_120thm.jpg
3a88dabb0f696c0c73ada346f9cf104e
dd3a738f38d6b242b3529048b91f68b3790926d8
120608 F20101113_AADTSB washburn_a_Page_013.jp2
7824391380f3f65145de2c55b005e4d1
b52c1511aed594591aca86785bd0e75fe292406a
137044 F20101113_AADTRM washburn_a_Page_138.jpg
0c0827c7ce77882d3780e4437ce8f85b
06756e031d4c06a1e22c4496729e65c59c16310e
4327 F20101113_AADTQY washburn_a_Page_124.jpg
bf909d21f2f8b3b1e23a1d695b7b5d68
d566aed9b313bbf9d3a6ed508d4b6b8c02283dbd
34989 F20101113_AADUVE washburn_a_Page_129.QC.jpg
1bfb06d0109eaf7703b5ac9ee71445bf
6419ec12a324c46cd393afb541d5e5136bc47e9e
1584 F20101113_AADUUP washburn_a_Page_120.QC.jpg
500099489f1453db9826600b5a518c78
de5c5f8ef6291decbd8c0585d0d8219a9f2e0d77
118127 F20101113_AADTSC washburn_a_Page_014.jp2
f69a7a3a02fb0f515d3578c2059d5bd3
4ed2b6d4ad54a5127d977a3988d7655357fe889f
141026 F20101113_AADTRN washburn_a_Page_139.jpg
d7ce8928ef2bafdac6991050ecf6169a
f049ba3ecdc55aa02970e9bdf21e7f5463f1463f
25900 F20101113_AADTQZ washburn_a_Page_125.jpg
73701c1b8b977ff667c3c9d2a2cfab65
c27ac814903fe58a1367f1b64136c12bcba3a412
7648 F20101113_AADUVF washburn_a_Page_131thm.jpg
712b27efea4112abcbb9bf1f34adbedd
ba57d315523e5f129c82c119522195a80fff70dc
3837 F20101113_AADUUQ washburn_a_Page_121thm.jpg
d95725ba4b8e7f62b3d9688937229d8c
df630f1d64866cbd85733cc5dfd6054e8dc8e55b
120499 F20101113_AADTSD washburn_a_Page_015.jp2
9c65cbc041df1d7d8e66ff613b47a051
9beb9823b92a125884583a96f4dd809062ff888f
105798 F20101113_AADTRO washburn_a_Page_140.jpg
5f26e1065a3cc19cea9572f5fbb98ecd
766e2b0408a7982d083b62bc228ef91abc3afa10
34874 F20101113_AADUVG washburn_a_Page_131.QC.jpg
3fb276e9df0d30e6055b98bc6a2f87fb
ab2249b7c8bb577b9b975b776f94070dfd530ba0
14891 F20101113_AADUUR washburn_a_Page_121.QC.jpg
1b94d80719287855ba8bf2c9ebd421f4
be2e45c77c9c7ad96869eff1a5bbc41e0afa470f
117056 F20101113_AADTSE washburn_a_Page_016.jp2
ad039002e087adf066852e1dbcdaac51
87f805a95767b9febcbaa82cdbe106cc5af877ab
43112 F20101113_AADTRP washburn_a_Page_141.jpg
ad69c62b46d5c0d404ca71014954dc2a
613e60f0baf767211d87e3d47bf8bea9526b97bb
35683 F20101113_AADUVH washburn_a_Page_132.QC.jpg
51790d9fee9030e79c5f0c29e8c4f816
8470c740d44b000483168be3239add583c6f0905
14552 F20101113_AADUUS washburn_a_Page_122.QC.jpg
6c02cd861c45dad4bd8bb3b97cda4377
9e9001c2941b9932087e855b59c7a401f98e0128
113496 F20101113_AADTSF washburn_a_Page_017.jp2
ad9aca424ec7e372812200a3214969bf
b9775df6131373a3058a986ad496bf556cee8031
23404 F20101113_AADTRQ washburn_a_Page_001.jp2
1c56eccc487b1702e13e3a46d7054b38
ca9d74aa0d91a6461c796640a09236dab5f17ea9
35714 F20101113_AADUVI washburn_a_Page_133.QC.jpg
d1612cebfda31661fe974fc002f68a88
53ddc8522a096d516feb749ba2fa93f964153626
3760 F20101113_AADUUT washburn_a_Page_123thm.jpg
861507b9a16d18005170090dc7c4cf86
f43a297a7598bdd7c7cef08701293ae1acb3e642
119750 F20101113_AADTSG washburn_a_Page_018.jp2
b0774688aee93572c3c127513650ea44
dc5fc15ded5d99b528c36c0f74929c3894f81e85
5477 F20101113_AADTRR washburn_a_Page_002.jp2
a7dcd8576ebc40e393c44ec2909ce9dd
1291c4b8102554ab4b49729cb08cd4afb609b4ac
7764 F20101113_AADUVJ washburn_a_Page_134thm.jpg
0b4be33949410887c44f5f46c443f893
f05f1cf58ada3712b502463e7cf02269d97532e1
516 F20101113_AADUUU washburn_a_Page_124thm.jpg
a080a497cd5334e0b31043269ee0b1cc
65a33412ed7e34d9c676d4eb5cb28c6277d82266
51281 F20101113_AADTSH washburn_a_Page_019.jp2
934b00f96f623867c70a47ee13b763af
13d13a2fe98810e31c064656c0305554683efb4e
6372 F20101113_AADTRS washburn_a_Page_003.jp2
7da327c3ac48fa15a9660d26d2ac068c
dbf25a3f456dd571d7c9709efdf70341514380d8
1422 F20101113_AADUUV washburn_a_Page_124.QC.jpg
9b2811b0add2b621f98541a691279206
aeac27164bfe876101601fb432c98a30e25e6886
104345 F20101113_AADTRT washburn_a_Page_004.jp2
4412f8134d70743fd380c001993446a5
bdc704cdeb4296b571e37ea96f7a0798449572c3
35482 F20101113_AADUVK washburn_a_Page_134.QC.jpg
f3af6bd7ebb9f02798b9dfee8cf1e155
dc163bc894c6d9969ecd546071b5d9ad72928175
2639 F20101113_AADUUW washburn_a_Page_125thm.jpg
a07c21c618e58b92625c307e4b5fc19d
21119714f900c5c2cdaa18be8fbde5fd4b4c48ed
761906 F20101113_AADTSI washburn_a_Page_020.jp2
e41177047ed943d7458cba5d8278c4dc
208cb2e6876107570b4425d8411f90d2b918eed0
93616 F20101113_AADTRU washburn_a_Page_005.jp2
cbb459c74a4aae7d9fda087a99d43655
83a117928f3f8768501fe7e1113d6cb720966dcf
7775 F20101113_AADUVL washburn_a_Page_135thm.jpg
0473b811da9dd0587428799a49e77ea5
3ed3e8b3251378ae2f6e90ab833f674c45da2a41
8951 F20101113_AADUUX washburn_a_Page_125.QC.jpg
92da7b5d6a3f095be1018e83f0746400
e035d0b590ddea7a36a373eead74f598abc000f2
101844 F20101113_AADTSJ washburn_a_Page_021.jp2
1954c5833c97fa401c87a625335e7927
0a11f3c986940615e7ba4c8c24ac12e8e73c786a
82488 F20101113_AADTRV washburn_a_Page_006.jp2
fcd260730603b1343989fe5a6866bc06
19d92f490895a385ed295b738270fc14125ea14c
34358 F20101113_AADUVM washburn_a_Page_137.QC.jpg
42c1551b90cd3fdad0759f524d675962
f6900d339f380013006794cdb9a28ce883e762c7
3304 F20101113_AADUUY washburn_a_Page_126thm.jpg
fe1b11bb4d52a472790c85fbee8963bd
3db158c319aae39882321efd5c9adf5c36ee141f
117234 F20101113_AADTSK washburn_a_Page_022.jp2
655ed308e9af0f3b6bf8c82dadb485f4
76923d2c5312ff659965b777bbcd2b62853e4916
20971 F20101113_AADTRW washburn_a_Page_007.jp2
5a8383ba53eb99cdf5166ed0fd866c2d
79ff1f4476d0c69ef08ab2118541eaaa87ad5022
28283 F20101113_AADUVN washburn_a_Page_140.QC.jpg
f18edbb8cf880b8835f17aaa82bc3693
83d8c561d549fee69350f1686d877f72ab941ef9
10299 F20101113_AADUUZ washburn_a_Page_126.QC.jpg
9e2219da61afebaf24cd2ae0d4d9eef8
1fe7242f7c6ea9af6b37f35aa68a56096d7b7488
111089 F20101113_AADTSL washburn_a_Page_023.jp2
8d0bda1a136ef419b3b21d8dfc717549
8c843d3fc77e3c51bb11f86391b72ae7790b1cf8
27996 F20101113_AADTRX washburn_a_Page_009.jp2
24db71dfa3003609ce470c15a6fb088c
b7237917f111ea18dad2b6bd4f2bc95d49e2632d
107048 F20101113_AADTTA washburn_a_Page_039.jp2
844781d47dc633a352891d71dbd03f9b
738c2510f6abff6de7b58944c2c1a366f2434aef
3276 F20101113_AADUVO washburn_a_Page_141thm.jpg
7169b3dd97cea244dc396ca6aacb9776
b36529bb6d0a133a6d51a240705fd4385e083a1d
117601 F20101113_AADTSM washburn_a_Page_024.jp2
7818cee17ad7d20f40418feb49785d1d
49501b83e2d5fd00f163d579885c1e97c71f3ab4
102738 F20101113_AADTRY washburn_a_Page_010.jp2
462e55e7aaa24c1712a80a73a6bf1481
7644f183dfa0d72546571904dca3c8cd4b36052d
1029077 F20101113_AADTTB washburn_a_Page_040.jp2
f741283198b1ba8d7d37fbd0dd604a9d
2063872c008723a3e2767ecc6532222fd317bc64
13750 F20101113_AADUVP washburn_a_Page_141.QC.jpg
f69601aa2891f49b9a03cb2e5f5beb09
c656cd10016ee9fa203c6fab3484839c4e9863de
115676 F20101113_AADTSN washburn_a_Page_025.jp2
532b8b90918551ddad67974d584fb51a
69adbd4449077310de1be9ce758175dedf619f7e
124179 F20101113_AADTRZ washburn_a_Page_011.jp2
72a2237974f2ac818dfd6beb4ef2e97f
e35cf9b0338f376a526898646a53001e7d845c5d
118753 F20101113_AADTTC washburn_a_Page_041.jp2
697670dfe32747f2a38bdba2649856cd
728c013c1fcb0aace574d3733b9413cac47235f1
115015 F20101113_AADTSO washburn_a_Page_026.jp2
d567acfd59863ce57ca36b47a08290df
a972de4d10973c7b79ba29739c1fc51de45b314e
110901 F20101113_AADTTD washburn_a_Page_042.jp2
0ea23c7dbe082e6da73ffde83da62f5a
a65497e2e3fc8caebb5ce27c923a7c9a81379cb2
109073 F20101113_AADTSP washburn_a_Page_027.jp2
bee74293981094d5820ff2cd9597cab2
5d83b05dbbace8fb017ab1ae4185761239c8a876
110491 F20101113_AADTTE washburn_a_Page_043.jp2
6b6265042e441665845cce31c452111e
3208c55b5ffc6588d2fd41ecec2f113c46a8bf74
113032 F20101113_AADTSQ washburn_a_Page_028.jp2
2c6095273df3d2d70e1fbc8be415c2dd
3efac93a763f1cc55be4f795922410e4d9b7586f
84023 F20101113_AADTTF washburn_a_Page_045.jp2
948b5cb4ca184e8702e5129a96b57706
ba1ca45707ffff4b09817382ecc342d1d1894a44
110557 F20101113_AADTSR washburn_a_Page_029.jp2
6f1af2cd241211414f0e9e3e30b45f22
c7bf257f9356b07ef900a8b034bae8532ede1e1b
619099 F20101113_AADTTG washburn_a_Page_047.jp2
69a3bd95711088cb504c68b94da2201c
447a8dd52f099d0e81325959068c46477cc8c8af
116093 F20101113_AADTSS washburn_a_Page_031.jp2
6a9838983da873d2da4be40f2964f223
d780404efb11bf4db517fa5c98aa9dc96eab195b
51470 F20101113_AADTTH washburn_a_Page_048.jp2
ac50726a508cf1997f17dd2b15c84d49
a5610de373bb3b09160b85fa33aa834a9e6843cb
117983 F20101113_AADTST washburn_a_Page_032.jp2
450849ff68dd84ec63872d2cfbbffa51
9a3093f65c94068a5740f2e544f95267355bbc6d
924680 F20101113_AADTTI washburn_a_Page_049.jp2
3ebea51860507e3cf245ba62c080c9a6
3e09a4a297a94f853b269912b6c7a42041f15053
120389 F20101113_AADTSU washburn_a_Page_033.jp2
1cd466d3ac0e5a7754d947f5a98bc4cd
7e2b452463b21a33b451116f0faaef7af2f46190
116178 F20101113_AADTSV washburn_a_Page_034.jp2
2a92cd730a37f4fd80b498e282a41dd9
452d8e9f3e6c86ff5f4d4af5bc20e7657979e211
110085 F20101113_AADTTJ washburn_a_Page_050.jp2
cbaff2efa46f7a7eb26272fc9ad64c9f
951f63dc620c89d5b48b09dc60b60b5a443fdb7a
1051983 F20101113_AADTSW washburn_a_Page_035.jp2
e48bd1a658cb07a4797b6917522768d5
59c5c522314fb670cfe7a994792c402a72c08198
107385 F20101113_AADTTK washburn_a_Page_051.jp2
fa06e5d0eada85e126c426d628bfb826
9e348b3b0ebbe45cf2c44884fa8657d82e821b7e
116936 F20101113_AADTSX washburn_a_Page_036.jp2
7a657ad135b3fe40c2eeecff978d6361
2335a208b563eb3c2c8e360854e71e3effee1c7f
114938 F20101113_AADTUA washburn_a_Page_067.jp2
f8526b846acb04d825a313a9f14398b7
a4b86240c8e9e9fbf67efb16653dc698165b7acf
118028 F20101113_AADTTL washburn_a_Page_052.jp2
7fa2be878061e653be561537b42bed49
4e6292b048c7796976b336fe52cd615a5aaa2c53
56989 F20101113_AADTSY washburn_a_Page_037.jp2
d47f9cee89b916e9f4b677d54ebd9e8f
afc1fa2bff8ce2a3ef2a956aebb518d222f27367
1051943 F20101113_AADTUB washburn_a_Page_068.jp2
a46827352f8f677ff7ef74c0d70916d5
bdbf58bac163c5b72dc9a82599dfe81e6dcf23d6
115033 F20101113_AADTTM washburn_a_Page_053.jp2
cbcab28e9168f48437f360298a3f538e
9fc1801b57421fecb15c6fc83abbbb2547ed4f02
57407 F20101113_AADTSZ washburn_a_Page_038.jp2
b24ad0d906413767c5665ba98a7fd878
fa2d114efeaa9530d19e04cb9a0e31b560524b2f
113961 F20101113_AADTUC washburn_a_Page_069.jp2
df4ca93fb2f752dd414cffe1aae0b578
cf05815c09588ac0b3a1138bcaf29c1a25242518
114249 F20101113_AADTTN washburn_a_Page_054.jp2
6152333dd7df2e92d8d2a7660d690350
03e7fb31a9308a7ff0471caa7fd8525443653ad0
116594 F20101113_AADTUD washburn_a_Page_070.jp2
cfe257d0c35f97cdc406dbe52f7deb41
03a98994598b845d73d565523d1b88d2f6d67c92
118181 F20101113_AADTTO washburn_a_Page_055.jp2
b73b63eff7d21148a0cb7ca7c1270330
4fe5a99eb78d1a648cc11e39b9e907cbc474b195
118429 F20101113_AADTUE washburn_a_Page_071.jp2
50691d2b294eec855e1ba36eee5718e7
a3cf2058925d9f87e6bfe2a6960c2e6916196d1f
121564 F20101113_AADTTP washburn_a_Page_056.jp2
924521f362c1b2b6f910c06eecd5c9ce
a790908bac0d6b31c6551b3c9d013d34bbc41e5e
114005 F20101113_AADTUF washburn_a_Page_072.jp2
881b2ab917274b172856b2ca07a5e12d
25c907b850f6c607b1742747ac0ac4d266bd33f7
119621 F20101113_AADTTQ washburn_a_Page_057.jp2
2e03e9e2fca5ecb1cb9836cc62d3bc34
9635dc0b7b45b386bd840961831a7c81005b188a
111406 F20101113_AADTUG washburn_a_Page_073.jp2
c4fbc12ae9dc1c146a74bbbfc3025512
b70eadf8ccab74c3dbe599d3ee903d28b1173cdf
120690 F20101113_AADTTR washburn_a_Page_058.jp2
2c23b3ac7ca669db5f95133a71ed0fd2
c19f1b8204c5b20b5848b7caa45a1ee5856c5490
F20101113_AADUAA washburn_a_Page_097.tif
691d8ecf2d7a6f9d902cbd989f996c82
de083dca1896f7bbde6d8f94ea707ca77c4843c0
116912 F20101113_AADTUH washburn_a_Page_074.jp2
2102d47e48fb5348770a68f5d8760e99
e1edbcd38a24f57fab9e6778fbe00d7e2ba5d601
115337 F20101113_AADTTS washburn_a_Page_059.jp2
1c91fa79729c21ceaf8b3ef96b0a222a
c94ef0b156d528b676e11f4e191de34d547e1f65
F20101113_AADUAB washburn_a_Page_099.tif
bbf3d52463efe2ae2b53c6dc26776431
a03196d4bdf7d8be38bc9b24f5e010dd38539165
118851 F20101113_AADTUI washburn_a_Page_075.jp2
8c57e18c9566e400613cc580880a928a
2ac9b64d7cbea95f7084b64f578e8e718eabfe0e
112503 F20101113_AADTTT washburn_a_Page_060.jp2
0dfad870cae5eb0d3ed7f8d575a0255b
e5e69167574e1d2e34c211751bf877365fa939e8
F20101113_AADUAC washburn_a_Page_100.tif
5877850a44adf99f50b29b29629711a5
465365c82a6b6511072cff92508bbb52a20877ac
113164 F20101113_AADTUJ washburn_a_Page_076.jp2
e4f72b67da777184a008e8849748dfcc
d0f6c361521597aab708c143bca092ed19e97bca
120355 F20101113_AADTTU washburn_a_Page_061.jp2
d1c42665c00dcccc3e1a7bf6a836a30f
7fc6851c607740a11323683aa7e932b951f193ab
F20101113_AADUAD washburn_a_Page_101.tif
f0fb09ff421e295d83c1f6fe590d10e2
f75e0b2f9cbce17fce7d35461469e2a309782b16
119453 F20101113_AADTTV washburn_a_Page_062.jp2
20a0c207d8ce9ace52b51902426ac617
39c842432f97b738f0819d3d6a0a764d75dfc7f5
F20101113_AADUAE washburn_a_Page_102.tif
e06665d702c1eabe653b4ce275823ed8
0a45fd02bcde061bd918d1f2c0e871562ec67198
117009 F20101113_AADTUK washburn_a_Page_077.jp2
484dc8b6890a383b89b6dcb7489ceb09
1c5325cd16ecda720eaafd38028545f40969b976
114404 F20101113_AADTTW washburn_a_Page_063.jp2
0136fbfbb6b9f3ca5cdfa608869e88e3
b26666ca055472dac6bb837e446784a0661553c3
F20101113_AADUAF washburn_a_Page_103.tif
469b7e5c2bdcf6ef99526e4c502a0f4d
5bd63a56e365c3acd8526eed5e9028e0b6a9b730
87017 F20101113_AADTVA washburn_a_Page_093.jp2
6d6a021efb6b03fae2c6b91484e920be
a6ca1a7a8277ccd07f8e9d49c3bae6009c67ba56
121194 F20101113_AADTUL washburn_a_Page_078.jp2
8500d8e5b620abb13962f43ea52f68c4
a16153ef57524101d19f7f0bb51de5c1fb0f2660
122054 F20101113_AADTTX washburn_a_Page_064.jp2
327ac1bff57e5f4db893dace89813bd3
be1a46dea214dcdbd85df6de3808253e6bdbf7ae
F20101113_AADUAG washburn_a_Page_104.tif
69961b14bcdc2e13c1c19976d4cbedb8
da333370c1e40c70266012deb429cb3e80ec9502
85465 F20101113_AADTVB washburn_a_Page_094.jp2
b1af02e7e29646c6e9d77ecfa84871ae
f91c49518dab61731cd60975e8e16377b7b4ba82
104294 F20101113_AADTUM washburn_a_Page_079.jp2
b312e331c77a68baca7528b6bd4d3dcf
235b2e60e524cd4a9ea814943f5d7896446da2e1
120783 F20101113_AADTTY washburn_a_Page_065.jp2
fb96b2127d2b0cb93fa8b215d969e7b1
3b0b0386d1cc9c95135c151036418cc54ef6f696
F20101113_AADUAH washburn_a_Page_105.tif
4156a62e5fca82f84c5e87491f1dc0d5
61978f1e3309023e3d93b818593201efd329e6ef
81139 F20101113_AADTVC washburn_a_Page_095.jp2
989d3685b1867c37401de28f4f8a1615
e9993b9e8d4a57e7500200125f12264a88195d8b
1051937 F20101113_AADTUN washburn_a_Page_080.jp2
30c5048bf0a8c6e80dfc206eee730fb3
4c80b3f6e3f14338614e4fc46d07b62d651f72b6
122793 F20101113_AADTTZ washburn_a_Page_066.jp2
9ea926ca93d4fadeefa9dd1ce471980a
fbf3e799fff77d24d13b200a730cca210af7a5ec
F20101113_AADUAI washburn_a_Page_106.tif
531f566687c10f8b35bb9890fda88fda
585e5fed071624a7ff2e244f955b48f27ce0257f
91317 F20101113_AADTVD washburn_a_Page_096.jp2
6b671b6f6d1b4d420f7841c1105e209a
aa4b53692766e04cc3df33cb8b62e82d7bb2c84e
1051968 F20101113_AADTUO washburn_a_Page_081.jp2
7fa9d67dd846fde7295efbaef95301ed
0673568c8283d29fb111ec94994acee7c4ee2f06
F20101113_AADUAJ washburn_a_Page_107.tif
0302fa3bb6436d41ac6e4ecf535f63bd
88aab5f55b27a0e459305309e861c23fa4055902
88926 F20101113_AADTVE washburn_a_Page_097.jp2
645229cfae49de55a90efdeb80b74b1c
0a261bd94570d756e4fb06d00d14a52cc12f4363
118427 F20101113_AADTUP washburn_a_Page_082.jp2
6274ae7de1141bf3816a1f870d4fa95c
3cffe65eb1843c3bce594bf37dcb9ff15c6e7457
F20101113_AADUAK washburn_a_Page_108.tif
13a0571f302d585e01374abb1d55bc79
40dbfb366c8d92392e35a051c55efe0db69185f4
85959 F20101113_AADTVF washburn_a_Page_098.jp2
d4c66f4ebcdad986bc87e9a2f23f90b0
6f50b34258d7b7055639bab6958498a089380ca9
86803 F20101113_AADTUQ washburn_a_Page_083.jp2
e4a9365cbeab3eeda5d59ea18e545924
1978bc04bb816f94f7590f7de77897a2b7d52553
F20101113_AADUAL washburn_a_Page_109.tif
58c95d795f4f79fd89bd476257e84293
2a63cd630a82df4f55eeffdc12a10fcf824909b7
79459 F20101113_AADTVG washburn_a_Page_099.jp2
4c8f0205332e67c9fc01abd107caaef1
3d472b8da29989b38ca677633edc54b2007864e5
6285 F20101113_AADTUR washburn_a_Page_084.jp2
c01bdf402b54b821cca9a7a8beec1df4
00cd8461bfa0115d7e224c5af211b7c8383c778d
F20101113_AADUBA washburn_a_Page_125.tif
70ab6c7dcca17f5955af10ae65aa3f26
8e9dd9ba2fe8ef9894dd38dc271c82b8a33884ad
F20101113_AADUAM washburn_a_Page_110.tif
c41ae863c9bbb4eb9143634fa6c623f3
a1fea741e9b5f57fb30bdf30134136864078d040
82839 F20101113_AADTVH washburn_a_Page_100.jp2
c9d27ec9609aef78b1fd3bed63b37957
1d17a77e1d1b9ef7fd7426759c02e15ab55c2fce
85114 F20101113_AADTUS washburn_a_Page_085.jp2
167479cfc4cd8275df8984cfb1bca3a5
33ffbb2a39ac8c484f8e09d2d3e7e43350d578ef
F20101113_AADUBB washburn_a_Page_127.tif
219e0612f578f06fe23c2d09f7f3aa86
df6bf70e6166529fe022c8e727a4c43390844449
F20101113_AADUAN washburn_a_Page_111.tif
b0d43c6116c5e64864085c04f87ac266
04befb295cc73458ecca2d5a0cdd81286b1cb734
92437 F20101113_AADTVI washburn_a_Page_101.jp2
5bfcda3206b5f6840e8fbe2001c8b1ed
9a2ad8dc76e240d5957f4c2d92bead0cce13f46a
78035 F20101113_AADTUT washburn_a_Page_086.jp2
62877f9509f94a3bceffd7239a472cd5
5bf013a0881da9974c8ec7d9be5126b0e813997e
F20101113_AADUBC washburn_a_Page_128.tif
1bc9e6fade95fc5f871fbd7a8f340b0b
dddf36fb24f477aee1b32d39e3896e658ea8fc65
F20101113_AADUAO washburn_a_Page_113.tif
b455ae0c86a9bff159d22df964a82d03
80d763cfb40e958868baa9cec1db8e68dfeb16cf
98700 F20101113_AADTVJ washburn_a_Page_102.jp2
068bca9fa0174e9de99c7b5cc94aade1
f6bf6b35cf0c5af194dd2d7c76c944d33a63d5e6
79705 F20101113_AADTUU washburn_a_Page_087.jp2
3dfa8aaa257825482722ce303d745aea
cdc0bcbb21d951698825ddc0df90449721d45707
F20101113_AADUBD washburn_a_Page_129.tif
c1c6d0d4d7ec163389ee94c4460f36df
c09cd8aefe0a8fcab1ce0e08b551555646adbdac
F20101113_AADUAP washburn_a_Page_114.tif
89b185613660be57f2167ff13a3ad59e
b0749026e85ad6ec3ef8e175d5d94c1bcc60790a
965241 F20101113_AADTVK washburn_a_Page_103.jp2
ef98f6174508db7484efc9bc76cbd232
34d3bf6d69c829024a77091b565c1c23f0b3918a
66662 F20101113_AADTUV washburn_a_Page_088.jp2
4490fdfdae407ef64ad072d884e77e37
4f342ea72ad58941659c4fad8285b2f1ed5da3a7
F20101113_AADUBE washburn_a_Page_130.tif
8de72ea46996b41d24a56891bfe4cf82
947bab9ac4e0cc6c9fbbedf44c3c98b5f3c05f48
F20101113_AADUAQ washburn_a_Page_115.tif
e16c56d71802183b2ba5a1cd102d2f0b
e0eb25ad5d5d74bfa0b71b176ad8e30543a58c20
86343 F20101113_AADTUW washburn_a_Page_089.jp2
393b559f7bcb4a18ee204ae1372946f4
23f4aa0cb3f77c539d0c3668afed06da0da6727e
F20101113_AADUBF washburn_a_Page_131.tif
6333bec20edc1a199b290e4c4cd09c39
4ba0751e656177c6fdd2293e7808c227e0c81fec
F20101113_AADUAR washburn_a_Page_116.tif
9b7e5046cdd8984e5777fad74b3c94a3
0676087f6ed6e2a1acab56fb4a4439e897a98fed
789379 F20101113_AADTVL washburn_a_Page_104.jp2
d0e65a7b09fe13dd752b5402de5dd06e
50d365819ba2405eb5aadeb4ed72a5d7b630e6e5
69067 F20101113_AADTUX washburn_a_Page_090.jp2
80e15e700154d1be2c60106e90da6bf6
7cef01c14d592e8710b3a8748dcdaef35c89933b
F20101113_AADUBG washburn_a_Page_132.tif
bf24f6761d9696898b7b68a2fcb10961
f23b13faba51414ee11eefdf79f0b69529b5cc65
92922 F20101113_AADTWA washburn_a_Page_121.jp2
f1d39e4c46ffb1e2461edd8c50af4d0b
764c19058bf0a7646fd5bf0e8e13534301146661
F20101113_AADUAS washburn_a_Page_117.tif
1be106cc8a30d3c3b3834473f93b51e4
1552385d27cb87f9d87909e2bcb850e7af73d5d2
828803 F20101113_AADTVM washburn_a_Page_105.jp2
7c6138d2c62c5deec9e814313642ba6d
9b04c38596fb6764c0f4ffa5fb6bc57c4e36343f
69339 F20101113_AADTUY washburn_a_Page_091.jp2
d2c5ad1eb3294219ca513f4466059ce5
d064f632d443f7848247d33a3d63512f94e75aff
F20101113_AADUBH washburn_a_Page_133.tif
e4bac8c134b1e3ff3293d67f069220d7
8f77a7d5ff4827d52924ff3c6799614583f3221c
109907 F20101113_AADTWB washburn_a_Page_123.jp2
a4d666ffc41c34732d796e93313a28b2
5321045aa113049698078b42fbff29bebcac41cc
F20101113_AADUAT washburn_a_Page_118.tif
8edf7206a1b2d3f06a8ffc75c6ea5da6
3d0f3aef79b0651138b28a1d3f0901547979dab7
893532 F20101113_AADTVN washburn_a_Page_106.jp2
3c9e7aeedb730308a2afb8d3d264bb5d
7876f15038301508205098d325075793fcf2b634
78508 F20101113_AADTUZ washburn_a_Page_092.jp2
e0d6cd05c522169e251bdaeb2f88750d
9e828e97a2faca8ca425bffcd09a12038e81f465
F20101113_AADUBI washburn_a_Page_134.tif
d00e3ee80ccf950ccebc10c4722a65ff
1f9fa0b15d3e198009290ad09dab59dbe6725645
6096 F20101113_AADTWC washburn_a_Page_124.jp2
60072b1193044909ed6358b7acf24f48
89699bbea3e40d573cc04ee2be160dee45daf5fb
F20101113_AADUAU washburn_a_Page_119.tif
e767a032f4c233061e3e70f9afe16dd4
2cf3abff4cb82dc594dd359dfce65c4562720074
845796 F20101113_AADTVO washburn_a_Page_107.jp2
71d061248d76f6270d77dda0df8dc9b1
bdf016ec6c097702345f4172b738c3bd94fdf8cd
F20101113_AADUBJ washburn_a_Page_135.tif
0b86e7793546ac1a795bcca4c46aea86
dd0c3ad9d89d87c99b35786a81105e8a5e400ae2
268815 F20101113_AADTWD washburn_a_Page_125.jp2
995a6909bcedb8f8fd441573f9320e98
6080d2330172dd624fcc69323bd492536d70f0a1
880159 F20101113_AADTVP washburn_a_Page_109.jp2
743fa8f6c5585c6dd19c58f00a651a1f
d0f179f6146b93daa45e3d5f2668974d91962f96
F20101113_AADUBK washburn_a_Page_136.tif
1114a55fd4c7feaefb9facee4e5e6c9a
c3967a0fcd7b299918f67be0afac95b523894cbd
354059 F20101113_AADTWE washburn_a_Page_126.jp2
3c2ed968079dca82b846fd5075e75a12
71e05e2494feda5a228e8f259a6fe725d23ce015
F20101113_AADUAV washburn_a_Page_120.tif
189f23484142634e835bd00df5e5fb18
4d983f6260db37b54f7c068c20d7a791117cc394
899076 F20101113_AADTVQ washburn_a_Page_110.jp2
7702281a11eb2da8aaa14baa547d38c3
30c690d6f9bf91ae27129c3ce476c420685cb30c
F20101113_AADUBL washburn_a_Page_137.tif
65a72c3bb1811383d7bed08c513c799c
fd60e71cf1c570995e8618dab1aa8c59170f60b2
164046 F20101113_AADTWF washburn_a_Page_128.jp2
5d6143197b5e7fb0997a7722e24bff60
f3cd45a886af9b5aafac59ebb10cb2846a7052fe
F20101113_AADUAW washburn_a_Page_121.tif
6b04a506ba6f179a9bbd1fc76bc50737
2bdbd5165eb23e3abf54a33239373306552e90d1
57455 F20101113_AADUCA washburn_a_Page_011.pro
beab8e6550577082e890071e5c0244e0
18f57133fa1197ed12de3b531527d0c1604a8478
F20101113_AADUBM washburn_a_Page_138.tif
c684f84349e75f2ac587b45853cc9d0e
a0f43d5dc31a63bc3e5aa00874b571b4d25b4554
170496 F20101113_AADTWG washburn_a_Page_130.jp2
8f2385808c147a30d188b7edf2e4181b
95aa93b3587fd983a43824ef7d6a5a6ef56500da
F20101113_AADUAX washburn_a_Page_122.tif
493d2710979cdb9f7c9c53e101b2ba44
d90433db86d5ca9d2b1a1b2ce0d8dece9018975d
757338 F20101113_AADTVR washburn_a_Page_111.jp2
39e4daa733401207efbaf5f0c1b0f3a0
9578ed260e4fc7b743a5d2ed3684c6075ceefd2a
52688 F20101113_AADUCB washburn_a_Page_012.pro
8a7c98374de7ef1782d2ff411a95b770
3cc4a452a0024720a7c28e00296e04d00fadcc1e
F20101113_AADUBN washburn_a_Page_139.tif
491718f61c372d123ca59dd6dda12930
56db9e9fad46a3e850c3c2dc337e87b63277524e
172558 F20101113_AADTWH washburn_a_Page_131.jp2
0cb9a7702780b12955ce5c5daba4d8f5
cb6f8105c4b2f6a46728ef4156b5ab38a8dc2ce8
F20101113_AADUAY washburn_a_Page_123.tif
e0ccbe82041a7a03dcfcb9243db833a4
a832f13e902d88a1e8702c5e38e73e724e3b3a7c
805981 F20101113_AADTVS washburn_a_Page_112.jp2
fc1d36bfd60e6282610af6c43394e318
ba4ab67508fd99a0a4650be12a06120e9c2d43f8
55268 F20101113_AADUCC washburn_a_Page_013.pro
528b4c9fdeb1630e6620ae7403532f26
c22d4900a9ff3d3e70674a2b367a578a8f046875
F20101113_AADUBO washburn_a_Page_140.tif
ca49db4c2b9aabd7302e0a19e6761af5
cb932f56eeceb750962143d27c3d66e112d14f63
175970 F20101113_AADTWI washburn_a_Page_132.jp2
e2f06aff200a22c17c1dcc486b38ebfc
ef96fa4b5e1bf4c16a74c30dfe6a6a90b4a6a111
F20101113_AADUAZ washburn_a_Page_124.tif
4945ba47441b8d722554ce04ced178e2
0fac92998cf08231110d0e287a0f4760e60b9933
868410 F20101113_AADTVT washburn_a_Page_113.jp2
ffa4e52fe047c37ef2c3c85bd23b1755
75155468106e4cb881032b24b96a496538969ffe
52661 F20101113_AADUCD washburn_a_Page_014.pro
eea18b2cab49d9320b2be5e1805b0da0
d192358249401d2cbfb4db0367fab026b3804ec9
F20101113_AADUBP washburn_a_Page_141.tif
698b11f6295bf01a0fdbf7b5e8734660
7286b99d6d8c195ab41e8f39dfb406ef72b035a6
174823 F20101113_AADTWJ washburn_a_Page_133.jp2
3d8d2134021de3fe5c6390c20df2012c
561aef23999aafd6493e1bba686ace0c29872a29
746362 F20101113_AADTVU washburn_a_Page_114.jp2
e91b8243cca97bdf5aa975a440bb9fbb
cacd9ad89473fcfb0b558aa6d347839fb951be54
55010 F20101113_AADUCE washburn_a_Page_015.pro
7ee371058f81ba11263aed58a3ef6ece
4e70294ab170c51be6fbe04290df86924d5d8221
7569 F20101113_AADUBQ washburn_a_Page_001.pro
b5451a2ae8d273a12456b634ea43e9cf
e55b82e1ae34fa8618ccdefb1aa3ecdd29ef517e
171721 F20101113_AADTWK washburn_a_Page_134.jp2
b9cbdddcda1536e83a0c66beb465034c
367af1281253bf2655235c16b8000a0c93f49b80
842694 F20101113_AADTVV washburn_a_Page_115.jp2
741d4a12fe86f87ebdb8ae903e90d50f
278a6808c8f13294f00a7f4a4e075656733b8459
53190 F20101113_AADUCF washburn_a_Page_016.pro
bb29017aba5f1ab5e11ff2b45e3e35d2
756f2a5b26f0ee466cecde2f87a26d60c7b1d06f
858 F20101113_AADUBR washburn_a_Page_002.pro
a451d0146669cd731daab9ca9fcb5518
5613d780d228e559bde9a83dbbfc7fded8b2c98e
179421 F20101113_AADTWL washburn_a_Page_135.jp2
5c4c860843f12a45820daf5bcb177ac0
406a75147a58c986b9303de7b055cc826a01fbb8
71855 F20101113_AADTVW washburn_a_Page_116.jp2
083da1c009e499b399643f9b082d55c5
204d0d2c9cb48c0c1be1575828023e377d6de71b
52360 F20101113_AADUCG washburn_a_Page_017.pro
f4211b672f0500a00429fe0b9f9cbbf9
6473d79131f0f1d350050d5407e0887803e30c70
F20101113_AADTXA washburn_a_Page_009.tif
53d09aa11759f19b74d4a3b46b0622bd
dfc50e8d21417413d3faff331e0b8d89799e6e39
1404 F20101113_AADUBS washburn_a_Page_003.pro
a4581c399426e2fdff2465180e6cd178
77336526de9a90968a5450105664f5a6e46d2f21
1051986 F20101113_AADTVX washburn_a_Page_117.jp2
67df555ee93fabd287a842eb2a8f2e8c
16aada248b072d493e44029a82011ffa1dc81ea1
55346 F20101113_AADUCH washburn_a_Page_018.pro
e53b8b239162579bb3833571cdf81281
08f59d335b0d33f83f451c01edc81be1c1c2c15f
F20101113_AADTXB washburn_a_Page_010.tif
3d68f42baf39f337465edadb9e684918
e72f5cf580438e735f3d9f8a678b065088f7fc35
46629 F20101113_AADUBT washburn_a_Page_004.pro
cb2fd608be827628ebb47d9c0c56b34a
ba31a5401c67de202f262db0f1647b083a36e489
169947 F20101113_AADTWM washburn_a_Page_136.jp2
4f24fe3e5b3d3e058d74426952d6b207
61d105703cec0ae0ceff428e4a88bb20908d780c
6920 F20101113_AADTVY washburn_a_Page_118.jp2
0a6761b49d38820f6a483f9dc0804b1d
0e682ef0e641902f7f870e9c44c988cb3e345b41
18492 F20101113_AADUCI washburn_a_Page_020.pro
d74df3af069e480f299afc4cc47cc54a
8e02e7ae7cd665bb52979f87f5c1e750ec92f6bb
F20101113_AADTXC washburn_a_Page_011.tif
c8bebecfafea5e687920397476160b05
a3278d2745538319e2c399651ece370d05132dfd
40517 F20101113_AADUBU washburn_a_Page_005.pro
40f6c4d3f89ba07ab2fa9591d499fce1
2f93477d4f3da163c72846ff9ff8880fb8d66125
170850 F20101113_AADTWN washburn_a_Page_137.jp2
74d0346417b8e64d8cb5f5baa3f37501
4610905f3e1c24250863819239c7f232c6e99ff4
6679 F20101113_AADTVZ washburn_a_Page_120.jp2
c013789a6bf3ff4ce569f6b6da0d5988
8fafed60b4dab29cdc7fa518d3a5522851e5a4f8
46566 F20101113_AADUCJ washburn_a_Page_021.pro
6b4c1e9c43227a06a83b90995e5815d0
91fc38214bd000fd84e38bc76f553a559d5983e4
F20101113_AADTXD washburn_a_Page_012.tif
5581e4b9d6ef0d04a66e669b1ea022b2
f75013717e0dbf78765a797a8a7246e43a5ff4d3
60370 F20101113_AADUBV washburn_a_Page_006.pro
c9aac6114de3cc11023db5849f8ab520
786b668a0931ee18c3ab7a75983abdade81a4c72
172930 F20101113_AADTWO washburn_a_Page_138.jp2
4b1b28d3520e21a727af4c8ff03ec781
e3e16153bc961d22e19cc410ee4f1631e1e22eb2
53515 F20101113_AADUCK washburn_a_Page_022.pro
7af31d174ca7606ff7c06054517e2417
0a9578d12b2aee68890302e37d77016f8981744f
F20101113_AADTXE washburn_a_Page_014.tif
3706a50fb474d6a1105504b1bfd0e8b1
d4efdcc920c78e3737950d233a45ab301d9c96d7
178236 F20101113_AADTWP washburn_a_Page_139.jp2
e5b2f77ecdda51035dff4156da37294f
68195da6ce2026a1d3b38be59c624c2248504bef
50348 F20101113_AADUCL washburn_a_Page_023.pro
8ba0d762b482a83ea1b4b04ee59e83f6
d3b92544630ad11291e08efb1381152536ce1fee
F20101113_AADTXF washburn_a_Page_015.tif
93fdceae80199b4e7dd901424ca4946f
1ffa77e26dc9e8f938f68011485281560506daf3
12668 F20101113_AADUBW washburn_a_Page_007.pro
1b94394a9fb212231e2e2fc8cdad06a1
3eaf432d4a847d1c1ea7c560ad32676531a301c6
133523 F20101113_AADTWQ washburn_a_Page_140.jp2
fd306d80c8715f67901b101ceae89665
50d87a270621d1d1bd1b7884aa0af64819b7eb9c
54044 F20101113_AADUCM washburn_a_Page_024.pro
2034b6926ca233bfb6a119a73774926f
5c6b7f8cc4d313cd234b98a4ccaeb0b9d23e91a3
F20101113_AADTXG washburn_a_Page_017.tif
32ffbbb991c01d5d6d0d284e97e6a0b6
2eef55661d89945aa21df799d2a5ec2a154e6da9
19720 F20101113_AADUBX washburn_a_Page_008.pro
c1552e86b6471a8d62ef16798d637032
5dd5017b6050b4a52308e30b572d8144fe22cb2f
54226 F20101113_AADTWR washburn_a_Page_141.jp2
3259cf62683f6edef553210017728700
5c32095bfb2a36bd241fc6cf1d84021d658d9788
24904 F20101113_AADUDA washburn_a_Page_038.pro
2b66e95a60518481471d2398eb65702f
a92ec26f1c11ce3ff0cb2ba906abb5629c26492f
52659 F20101113_AADUCN washburn_a_Page_025.pro
7f41c4542380ce6ef758cbc567b767e3
11f652e5b3a3f91b50b742b75e530e85c41392e9
F20101113_AADTXH washburn_a_Page_018.tif
c8dd1ddb2e76bf7037d1614ce053ec85
55eec310693bbd1131d6f57cf1ae4f3701ae0d01
15406 F20101113_AADUBY washburn_a_Page_009.pro
6e3ba5631082b893ffed4bfd039f6611
92962a9db0a035fa01d408c126a76592275388ee
F20101113_AADTWS washburn_a_Page_001.tif
5dcdb341bad4585ba31871f077616389
e6481e40a93e4d9489f23101542eb64dc9ff4490
48212 F20101113_AADUDB washburn_a_Page_039.pro
75af5e955ae62ff96b7bc2f740878f91
3c17aa8ead38cf0077be7dea356d8c53faca3939
53122 F20101113_AADUCO washburn_a_Page_026.pro
15fb0c69ef542993e8a6d095555bb86a
061db6d6b6a4ce9803055edb6425ce9b8133dfaf
F20101113_AADTXI washburn_a_Page_019.tif
8e8d3a2fd2cb4a3715ceb4af5e5e80b9
a065c8bf0549ec66f60ad349d85ef5c5bb3f8c0e
46409 F20101113_AADUBZ washburn_a_Page_010.pro
f3936c5e913828e0bc61e987a0e649c2
b36437813babb7b2e586b7a4f89977e5c04090b4
F20101113_AADTWT washburn_a_Page_002.tif
dadb230c92cb6f798dc644007b007ea2
66c0882690a0009ae8082402f51c5bbc4651e5ae
45544 F20101113_AADUDC washburn_a_Page_040.pro
60426d67446447d1ac058e19c942db19
2db0e29cc79f659f7af46690159d17ba5b2827e0
F20101113_AADTXJ washburn_a_Page_020.tif
1632a4c5b0db622aad2c93d3e4a8bb68
1841425efc8c57a94ef9100d5f696180fd860a5c
F20101113_AADTWU washburn_a_Page_003.tif
d033c2ece741b6d9e92d59947d084864
7607bd7f57dbf3ff344f16839ff18fedcaed4514
54601 F20101113_AADUDD washburn_a_Page_041.pro
d1648ae4962170cf4716eb9c619b050a
a849a629c53841384218448d0c78eab3404c25da
48159 F20101113_AADUCP washburn_a_Page_027.pro
2e5abf1f0663f5d83392a3b508ec4e9b
164e80e609be5964f7f8435df634e0d6112e63b1
F20101113_AADTXK washburn_a_Page_021.tif
a9e9a6485c3e9b9f7fcbc24965cef1dc
3bf827f27e30517b3a57c51bb958069169c26705
F20101113_AADTWV washburn_a_Page_004.tif
62abc87e21ebdb8538fb1d9d946d75c4
ba3a38831c48e55432ad1b0c29d8c9785b5f62a4
50688 F20101113_AADUDE washburn_a_Page_042.pro
935e27fd24cdd0ced5ab74b04bfa6157
6b8d04e575079ac49fd2f6842decff9392d1fcec
50737 F20101113_AADUCQ washburn_a_Page_028.pro
9aa9257cb6c9ecbe9143e824ddf4db5e
56050994297b244c2ee3c81917f20ff7143e97e6
F20101113_AADTXL washburn_a_Page_022.tif
8cab70dc4baed38e7b6bc186c9f4dd73
b1f01882fdb04c5aa65a9a7db53c70525e0b8577
F20101113_AADTWW washburn_a_Page_005.tif
6d0224b69400d32da9008fcc18d398a4
d8fd5095f78f956b8d8eebfafef2cb6010488e19
50227 F20101113_AADUDF washburn_a_Page_043.pro
aa80e0b9ddee5010bb9f05918674cf14
e0bf621014a3c9f05f6fad12d3269acd0f562eb0
49715 F20101113_AADUCR washburn_a_Page_029.pro
006a33396b2d05aec31135c435d61c91
86951d78e737aada1f947fabac330a42a36e00b8
F20101113_AADTXM washburn_a_Page_023.tif
43ec1f97095ae081e7c182a6b7b5ca6e
6e236789d1278be67d05f5e442f27f96d7598e00
F20101113_AADTWX washburn_a_Page_006.tif
424afb90a075c3856f3ab411f4bf8dfb
9fc5f2ac30269cb7f0fec260e3b28578cb8fbc62
52435 F20101113_AADUDG washburn_a_Page_044.pro
165adbf96d435b9a5161329cb55a52a4
fdaf78758ccc89620a24cb2b4efec8afc17c6eef
8423998 F20101113_AADTYA washburn_a_Page_040.tif
e58e6c0854238ac550becc7d0966fafc
20aa098fd9d4f7ac3550fec884c4a2a01f7b2591
53118 F20101113_AADUCS washburn_a_Page_030.pro
930e2ea20e03903669c3f989bda13c3a
927824eb50e4fa261a29fd72bd618f5171ee270e
F20101113_AADTWY washburn_a_Page_007.tif
e438219ac150f868f35d99a24787fe36
e97ae61a3266ef66a4eb014e65793a7914e3a1d5
37079 F20101113_AADUDH washburn_a_Page_045.pro
5e0d29bf835cf77ccf28a4a78d8ecc15
3c7c2d460d59798f849eae9eb9a670764bd61204
F20101113_AADTYB washburn_a_Page_041.tif
8e4988604c54f2f2a2d9905a58486d2a
3da94fbe884497833586fdc95b67139fea4a3eb8
52801 F20101113_AADUCT washburn_a_Page_031.pro
744d49ca510df0b61b96d2e80f87fb89
070a45e3f8198cdbc8cb27fd47de5fdefe2ac6b7
F20101113_AADTXN washburn_a_Page_025.tif
7e770b0d0c3531e26fdf2bf3474234de
9d8831e7ebfbc2adf54efb28c9224e8fc5e45bf1
F20101113_AADTWZ washburn_a_Page_008.tif
e3cd391bf4a693af76a8d52fbd3466c0
c718f3cd6047858a2c3e9bd7fc83c4217cc36e3a
25493 F20101113_AADUDI washburn_a_Page_046.pro
a5be15797b44ffa94c8d6d684b2324df
bf77bd044fa201b046f94d11289e9cafd3fc1412
F20101113_AADTYC washburn_a_Page_042.tif
352d5b4d5123529274bb98d10263b2ff
dd9b79142b2870cbdff0222f75793e153ac5bfc2
54813 F20101113_AADUCU washburn_a_Page_032.pro
94cf974b24ffb92e9f7263507adb20f9
42051260809d3ce4799e323d18136a173b97f5be
F20101113_AADTXO washburn_a_Page_026.tif
dad53ff5015eb4c180d1ae36fc569d37
3619ed0dca253dfdf9191daa03bf98884251a71b
24188 F20101113_AADUDJ washburn_a_Page_048.pro
1d39bf3aa58707dfdadbe7d980de1a62
79e16d90276c8190657f00f5d101dcbc57f5d76b
F20101113_AADTYD washburn_a_Page_043.tif
f419b46d188cc9126cb5a4187ae03346
50164d03a2cc273f62c1fefc0c8b585c421f3547
56089 F20101113_AADUCV washburn_a_Page_033.pro
d35d17b369228ea579a5a389b085c9c6
7ab36399c5c12e1fe0b2d69506c8b16ab006d10a
F20101113_AADTXP washburn_a_Page_027.tif
01fed59d8987e643485e8ff5bc867aa7
8962123344875515a5432e77cb2a634939c022af
27390 F20101113_AADUDK washburn_a_Page_049.pro
c7150d49295b913378c109564e2be770
856dd0ead2fe8258bfe22211ee740d4b9c56f10c
F20101113_AADTYE washburn_a_Page_044.tif
6700b68eccc9e67d98046c2f3ad12c8f
be6772e38fe6aced1c52c3270ce68162c027410d
52721 F20101113_AADUCW washburn_a_Page_034.pro
303255fde4e14b015717e54238d2d8d0
7d5d2b3fd43dab545bc4dbcb1d956fc54212e3d6
F20101113_AADTXQ washburn_a_Page_028.tif
1255c33201c428bab1b2163e07cd016e
641e981fdaa1a90510f63f1f19ad216e4910904a
50065 F20101113_AADUDL washburn_a_Page_050.pro
132e4e92bb07153252a05c90ba8666a5
0725a93ed056fa2b90cafba177ee663b260badd9
F20101113_AADTYF washburn_a_Page_045.tif
11d5539f35157db88ae4de108dd2d5a8
b8aa6fdfa58114874a4fdac01168404e55276933
F20101113_AADTXR washburn_a_Page_029.tif
722f57748a7574da094eb663c0dbdee5
455e0e21e79fcbb3d4e72c3b1dbf25be61801168
56736 F20101113_AADUEA washburn_a_Page_066.pro
ca18bf0570fb122e6a095b4e921c2c7a
b7deef41fb5ad30a15496326f9f0a00da555ab5e
48670 F20101113_AADUDM washburn_a_Page_051.pro
696b49a2f7aadad66c0d10385ce8b8a2
f5f697e389fc5f3831df4d5f7ff5f4010c3dbcb4
25265604 F20101113_AADTYG washburn_a_Page_047.tif
de911b668237cd047fd8eacc2ffd1f67
260e78f4de916fb04adee734dde432a3879a6466
53642 F20101113_AADUCX washburn_a_Page_035.pro
c7b57b4a0c82d413029d233d57bf37be
d27ecaa834fa1ef63507cceb8c31509e681b29e2
F20101113_AADTXS washburn_a_Page_030.tif
288770b1bce1fc3dabb713f6a30aef0f
54dfbc3a62ef5fc9eac09ca3572cd38e92ab9d67
52555 F20101113_AADUEB washburn_a_Page_067.pro
16bc6c1301e0c7cad9c41a7eb3da7c2c
50bb4a5806a9cce6266cc990388a3d41f1f005e9
53270 F20101113_AADUDN washburn_a_Page_052.pro
da287dd9e2288ff52781e34c9466f183
f0d5da916228d9f64f57b860209c1df8f9e57772
F20101113_AADTYH washburn_a_Page_048.tif
82e4656d6db274f01e6ca3f8e5eb66ba
9045d80e63f3b635f5bbd342c1452110b4265730
52563 F20101113_AADUCY washburn_a_Page_036.pro
93c9b4b28bb150007874424abb3e7dc5
8f57502fbdd5b4ab8da3d26e21917d547ca69309
F20101113_AADTXT washburn_a_Page_031.tif
be42dbd16c1843c465a4f8faa63d98c1
d82bacdeade7be330aa91f834d9f6cb96727722f
55581 F20101113_AADUEC washburn_a_Page_068.pro
09c99af808d55d832226f6ca0c803f02
bfcdfbc51b303d876628030e106e30d53074ac40
52602 F20101113_AADUDO washburn_a_Page_053.pro
7f27080160291026e3e244fe21d51c66
db858e4a55069a204afda88ebf07b2b3cdff420f
F20101113_AADTYI washburn_a_Page_049.tif
5525f9b9dbfaea581da8d6489470d69b
6bacbe397ecb89b8296825c74f483b7a759b4029
24260 F20101113_AADUCZ washburn_a_Page_037.pro
1f5200acb9c6b0439c0e766968c6eb38
4eb847f2737e5252b79f621cddf76b0bc1f86276
F20101113_AADTXU washburn_a_Page_033.tif
9dac7cd30016a1a3017746d885f0fca1
a2895eeb1660c1d0e0f50987d8cfc0a0fd825f39
52211 F20101113_AADUED washburn_a_Page_069.pro
f417fc6828c208252ac851c864da1113
f4951568c27a69a2f99e74d52a676c3aff21614b
52669 F20101113_AADUDP washburn_a_Page_054.pro
b1babf5437cadf22f761407f2666b982
adaaae92da11cc6ba54b469059dd01f25532583f
F20101113_AADTYJ washburn_a_Page_050.tif
fa972b426b40fdf5e4008a5e27c08d0b
a72a5ec8813f2379574f072b5c148411a968419b
F20101113_AADTXV washburn_a_Page_035.tif
93c43097c412f892ec02286a3232bb40
a04dcc0ab99ad3a02f213f03b63a2d27dbf58a4f
52851 F20101113_AADUEE washburn_a_Page_070.pro
8b0d1556ed162685db38041d0870c9b5
9170225ad6abe7f3c9240605b30c79fa689a7b82
55852 F20101113_AADUDQ washburn_a_Page_056.pro
0f730ec5986b02826a8053303a3b10a6
250a47d6ab2d12e42d9f9993373560aa19584d99
F20101113_AADTYK washburn_a_Page_051.tif
e99e75c56f8df64bbab71900c92fddd8
f6cd5611fd2806fcbf9a9bed0667f4e2cab7c5fb
F20101113_AADTXW washburn_a_Page_036.tif
e365ee12ff76c4fab13afa391a23615d
2573d9f1cc36da9d796b02467cbc83ed28761984
51359 F20101113_AADUEF washburn_a_Page_072.pro
91a2a6afce2883d04d185e469d70dc29
0e7b3ae9fabea38a1469b230639de4a6246f20bc
55682 F20101113_AADUDR washburn_a_Page_057.pro
96ada9f29a328608bd27da55ee38a1ed
a5510a2e30aea36e16c28c1ae4f09e14c9440a0c
F20101113_AADTYL washburn_a_Page_052.tif
c731362c8aaadadf07db19784432cda2
6565277ab7e919028f99c87655041e8150415b4c
F20101113_AADTXX washburn_a_Page_037.tif
5e2e749737b4fe913ab5cfae2423367c
be390139eee14dbe2429d448887355b0fd5a2c15
51184 F20101113_AADUEG washburn_a_Page_073.pro
6054c121cd40054bf40ec3a6bd678036
9869b36cdfd7ac9541dfb7ebb366800978c4305e
F20101113_AADTZA washburn_a_Page_069.tif
8740f0100b1428ffa3079c443e5a3e45
9a14edaddfaf13834b25e5ad4088530511d7777e
54688 F20101113_AADUDS washburn_a_Page_058.pro
20f187c8f0a5536ea1772b2ba0cb2359
faf84188fb364dc53a7cd549f7adb7dbaac8b827
F20101113_AADTYM washburn_a_Page_054.tif
8145552a5b829680bdb1bd1b4e56fa21
5a22e273651b25c5c778be3de2875910a20c6a01
F20101113_AADTXY washburn_a_Page_038.tif
28f5abc54e7438f8994d4787ba957b77
830b08c2be0a67075f95c5a1de102be9caf2cbe1
53656 F20101113_AADUEH washburn_a_Page_074.pro
a5afaef16edc06acd2c298fae872070a
feff54433b21350ab45b22266ca4592dc8f89b78
F20101113_AADTZB washburn_a_Page_070.tif
357a767cf1b56a07659285bb3009dfdb
55dd23f314972d01dcc7a4559dddb93e35ca8b47
52881 F20101113_AADUDT washburn_a_Page_059.pro
f6d516137bfe8b52c1edb5e87d4db395
8cc7db205880d02d39b5d6ef282d5c5bd996d7d2
F20101113_AADTYN washburn_a_Page_055.tif
c70debdd7fe658f2b5bdfab19b61ddc7
9f0f1eb0e50bace40bb1a40b41ecf0a23fc7acaf
F20101113_AADTXZ washburn_a_Page_039.tif
6b2b538b7dad4f4661e4180bfcd7a259
8c639c4f22492e421bfd73cfc214f848cf30dbe3
55383 F20101113_AADUEI washburn_a_Page_075.pro
18195d58db2c2081eb94083014db5f99
03ed6925a1532224b54b930484a6824ea4a8c037
F20101113_AADTZC washburn_a_Page_071.tif
6a01aba170e3466a9540696ebccf2c2c
f9efd5884b2d431420987b41231942c2e8c37f38
50497 F20101113_AADUDU washburn_a_Page_060.pro
32ec0f47d38ea63c4e6420cdb229e457
25e1f44bc8a469e8ef1ff1ffefe9c164212372e7
52443 F20101113_AADUEJ washburn_a_Page_076.pro
a9b37eddf611d09676ba7189eaa64e5a
285e099c252356e3da3133cb089b3b8975ccc6e3
F20101113_AADTZD washburn_a_Page_072.tif
395f0aea2c4d73de39c056afbfdb7028
deffed380bfd92dee36c0f590a9bdcb503491406
54933 F20101113_AADUDV washburn_a_Page_061.pro
6a067a43c56cfe47530b07459f89e62b
66ed2d67a012382153362304b7e63b2390433474
F20101113_AADTYO washburn_a_Page_056.tif
bdbbc3f33c946dc36e7ed16129c1062d
e883671000341603499d4fc9c521f066af8bf7ae
54064 F20101113_AADUEK washburn_a_Page_077.pro
aa10e2444d5c7b8259020daf2474ceaa
cae9104a65001c41694a202a8d0adb8830489c69
F20101113_AADTZE washburn_a_Page_073.tif
0bcda3a2f2b5f9a9bbbb45c9f02664bc
643405042f79d4a9a96bbeb2b73fff494f7ae3bf
54120 F20101113_AADUDW washburn_a_Page_062.pro
b08dbee72cc0e1b446cc852323c3bbf8
ebf162040f658d32939443f5b9621490f1ebc391
F20101113_AADTYP washburn_a_Page_057.tif
52b8a5175ef68322180f601813b9e181
9e82f6d00b634482b2a49a84c601f4aa537f7b69
55840 F20101113_AADUEL washburn_a_Page_078.pro
292e6649ae28ca433bc8344681325f69
9679a3fed7990de6e79ec5bb43d33ef5ab935814
F20101113_AADTZF washburn_a_Page_074.tif
61088787a5ea9ad1bf26ceb91b84f5a4
53b2657c14dac0144f8dd99e35810b586aee71a9
51535 F20101113_AADUDX washburn_a_Page_063.pro
e05931f720992183477597aa699ba50a
d54e474822c93464e182dd12109ec5bbbd83eb3c
F20101113_AADTYQ washburn_a_Page_058.tif
079f55e929c895412f85bc29bb995407
ebf1f3b3d11fec6bd3831e9911149173588a72a2
57213 F20101113_AADUEM washburn_a_Page_080.pro
ab8600303422b65a13766cccf4275af3
7cb35b9b841319203abd30008636c9a01957e3af
F20101113_AADTZG washburn_a_Page_075.tif
7aaa1c075d92b18b00e35903dcfadf5e
3b4605374f9a4c6af27740ef812210543e439c9b
F20101113_AADTYR washburn_a_Page_059.tif
6510a5a1d595bfe6f8495f325c22a09c
8e93269a3c64f158405f401ed3c6fef3c5c7838b
39913 F20101113_AADUFA washburn_a_Page_097.pro
475e3d8ede353ac39d4c2a8128275331
70a45788809c5524df8894ca45ced8f8e7f318d6
54611 F20101113_AADUEN washburn_a_Page_081.pro
cdce88f6acae9134eb10b74b10410fd3
40f4527be84795e22fac6b60bedf92208455d100
F20101113_AADTZH washburn_a_Page_076.tif
1e77321b90dac9a340522b55e756ea9e
48d9705b8018f4786cd235c4410be2703c04d74c
55398 F20101113_AADUDY washburn_a_Page_064.pro
91b7ff3bb886865e5ac9e661fbb6e39d
fcbcf7e20f0dafbd2a0209f418d82e2039897d76
F20101113_AADTYS washburn_a_Page_060.tif
55af1eaf7fff21c8e8e1f756f483019d
e7583dc2fb26388e6225de88892f377f9dd6948b
38848 F20101113_AADUFB washburn_a_Page_098.pro
ce3d0c4f4adf5bbd51c240c45dc110f0
2f42120bf17944d30f3461c22f4a95db896d6265
54192 F20101113_AADUEO washburn_a_Page_082.pro
d2e434fea53ac8f6cdf48f972d594144
c4d06e9929faf0a9f29630435f8a0a514b638aa4
F20101113_AADTZI washburn_a_Page_077.tif
26136c39c4a62c6d0999dffb924a7dee
9cc4e77218aa6bd5dc627ab8dcd1b548a278222e
54429 F20101113_AADUDZ washburn_a_Page_065.pro
3bae7fbe670b14fdd31f078a264a9ac1
af14c31640b147a3e92df6cbf8e955304001eed1
F20101113_AADTYT washburn_a_Page_061.tif
94804d5e3100293b18ed7a8067472b68
fc90b598c5a8c94127fd07ab878a1638d8d58a96
35689 F20101113_AADUFC washburn_a_Page_099.pro
985d4b97eedee803607ee0b205f1ac29
5591bf9ed4501ac92bb941a6af181ab4cb2b78e6
38538 F20101113_AADUEP washburn_a_Page_083.pro
9c7219c470be0ca42778258d269dd76c
a3efd54f0df02b4537a0b46282a9e759882ddfda
F20101113_AADTZJ washburn_a_Page_079.tif
088a64d3e74a7b69971a9d43351ac5b8
c34e2d01baaca175dac01344f8b42410a58b99f5
F20101113_AADTYU washburn_a_Page_062.tif
0fc2cd9526bc2ed3484421dd81f54616
062a08fbb054fba177dcbaca7e762f902a6661b6
38953 F20101113_AADUFD washburn_a_Page_100.pro
17250b12c2d5e93291bbb1b7c43dbce2
163279292b9591ee0776e18a7beee7dda9181c34
1055 F20101113_AADUEQ washburn_a_Page_084.pro
d00d540e58a85eed6de6ddd04e0f1fcb
bc4b8fde2b9128aa9c7b97ef0b07e4ce71b02f30
F20101113_AADTZK washburn_a_Page_080.tif
55c978a0070d3322e8df29b3e0d8068e
f1315ddb4f6ece15d12c153e7b27fe2fff9772e0
F20101113_AADTYV washburn_a_Page_063.tif
cf7ddca1c194a26463666a04fb8dd45b
338971186e9878406917ed52d7d2c964aa257121
43909 F20101113_AADUFE washburn_a_Page_101.pro
a82dc6acdbd1e6d822a818abba57db7b
6f1402f3be6f457c0a198edc858b688d5712c915
40454 F20101113_AADUER washburn_a_Page_085.pro
9f9276d8ab784ffbebaddb268159d118
08aeb2d50e8d23922cbb8dad27899b73a83ea0a0
F20101113_AADTZL washburn_a_Page_081.tif
4b5a12868857a8f5a5c2d83e5005668b
d34f8b79c1a91370f0ed80869b72f52ddc8cff8d
F20101113_AADTYW washburn_a_Page_065.tif
e147640af70ec79bc359836ebbe402b6
7b8232061b3a495e27983b6d8a43cd8dcc8ef816
45833 F20101113_AADUFF washburn_a_Page_102.pro
c87d5822e90dac88a85e1a499385180b
d6f448afe5e75fe27fe6d740f4694970d8847904
35950 F20101113_AADUES washburn_a_Page_086.pro
e25d15afb5952d3c7bf941e8954f822e
933daa59b6a7288c4cef6db560f6b3792e1d42c4
F20101113_AADTZM washburn_a_Page_082.tif
19132ea30637b6ddd93aedc47dc53924
a2abb5342f133a0f90b5e43688caf71ff16e2d5b
F20101113_AADTYX washburn_a_Page_066.tif
1e6d3dcc0799e4a7c615324a7a4678ec
92cfcf951284027ca40b0298bf58fa1af8ec9190
44439 F20101113_AADUFG washburn_a_Page_103.pro
fa67e60597299ff9504b789c3ddae431
2a69e1a8b156b4bd991ce30cf3055f1c78035b9a
37137 F20101113_AADUET washburn_a_Page_087.pro
ae650be8f20d8ff84d1f754be03db1bb
5ff46ff04a9e95987c62d8ede7b47c38e8359d3a
F20101113_AADTZN washburn_a_Page_083.tif
3e86cfeb676be703639f40fa1f030152
2099c0c0f5b462a00b844bb655b83fa4a320e916
F20101113_AADTYY washburn_a_Page_067.tif
bfb4d3bcc490cd965387b15c2a0ffd28
63a3d43946dcb1a7fe2a7ca009042092a9432288
36013 F20101113_AADUFH washburn_a_Page_104.pro
022bf974ae3af385c6256edee18215b0
8e95435ac4c63b70972f1781664cc8c0b40085f3
30840 F20101113_AADUEU washburn_a_Page_088.pro
f7284b2a3ceca40790cac8e03c607499
84c045d7768a5dcdd061f236267e108bf708c95d
F20101113_AADTZO washburn_a_Page_085.tif
b801ef4791384beb9f0b1b3ba73c26df
5cc4eac3885ac900e5f3e7d317befa7de7a716f6
F20101113_AADTYZ washburn_a_Page_068.tif
2a0cb32d6fcd5d7d4afb1fa5b5ed8af4
dda07081f06a1bd4afda613eeed046cd847a19e5
38090 F20101113_AADUFI washburn_a_Page_105.pro
1365b73a44108cf791a5c2c575d52b4f
a8648f00891193da02a4aa72e049c1b8a3506af5
31196 F20101113_AADUEV washburn_a_Page_090.pro
821ce96e31ad44f9f878af90bef425df
fd1a3f59e78d0f06cdd8b823dd7c4f8399b99588
41573 F20101113_AADUFJ washburn_a_Page_106.pro
fe794ea890a6c2e7dcc7bfab4646bef6
c7f99f6c964dbf9b7f0d1237cc5e5ebeaf2ed30d
31527 F20101113_AADUEW washburn_a_Page_091.pro
ecb5f38c1fb45fd85b9dcaebf1b7c3df
589d57c9d942668d009c2d24b5efe2e8834f829b
F20101113_AADTZP washburn_a_Page_086.tif
54d9ba75ee530829715c7145f56e8161
ef780121c05310e6571148c6c1cfdaf22f257b9d
39090 F20101113_AADUFK washburn_a_Page_107.pro
8b972b0e312d05366c8359406d29ed68
eb98f48bfe85950cc0daa0e05843ad8eb1bf6c4c
36606 F20101113_AADUEX washburn_a_Page_092.pro
a72cab85ed403404855047af9460f8fb
ca622aa0d1001490911a97a995ff470d5f513e13
F20101113_AADTZQ washburn_a_Page_087.tif
7248214cd224d6cbd7ad7a11bbdd98e7
8c5a1e32fadb803112870eecb2055bdbe05900f1
41248 F20101113_AADUFL washburn_a_Page_108.pro
b05f143657526f5c5c7f283b04c4eae1
ae660e9d27700ad779ba86e627d28a3205a8970f
37847 F20101113_AADUEY washburn_a_Page_094.pro
2249aef5e4d80e8ccfa0e89ab79ef9a9
c50290e574c0d380d3617e52038fffdc288464d4
F20101113_AADTZR washburn_a_Page_088.tif
086347f195b6072bf2c800e70585559b
c60f05fef1c3f92a2257a9018a4b49303815af79
F20101113_AADUGA washburn_a_Page_124.pro
745223643c93e347c08086ac88c47d2c
da7f4fc225954a8b331ffa7b2069159e7833f121
41301 F20101113_AADUFM washburn_a_Page_109.pro
9baa806a2a058fdc97d3c2b738d90b64
be5cdea20ade6c3263bc113d3a0f5715442e0cd5
F20101113_AADTZS washburn_a_Page_089.tif
54cafe2e38d64bb97829b1cf31950c9d
6f640d44f10eecc617030f972071afe01d8bde66
11424 F20101113_AADUGB washburn_a_Page_125.pro
b084ffbcb826bc47a9a14554735784e4
81abdba17eedd11d8778627f4e2d768e80478de2
41795 F20101113_AADUFN washburn_a_Page_110.pro
2aa493b06fe5ae1db82b78ad447a33f2
1b622877a07ac589622b184f1c7e7957a7cb9b45
36344 F20101113_AADUEZ washburn_a_Page_095.pro
469a0a1c092eec5b7a7ae4ef032300ad
71740dda89963a8f0ea25e8f3270c452dacc8232
F20101113_AADTZT washburn_a_Page_090.tif
ea6effa2c1f7bb026f8762f347b33a51
6fa6c8967294d0598fc48b6dda386a52a934a789
16611 F20101113_AADUGC washburn_a_Page_126.pro
657ec811d17ae00c848693044851b0a5
a0a104d881e9f11e52ab55a8072a504eb44ca89c
32513 F20101113_AADUFO washburn_a_Page_111.pro
b5b5edf7f7078204717737673674419c
330e7fc13a8d7742cc904d7aaccf598df8653776
F20101113_AADTZU washburn_a_Page_091.tif
8a408b0ebc36f026f572b0d0de054039
2e5a12bb7febef0cba8b9292a8dd3c3ac1f01cc6
21842 F20101113_AADUGD washburn_a_Page_127.pro
8f077b9d2fa76a6b0ae25a54aff76f10
7d5a83c99f2c9d713942b1f47ccebc08fdf2e61a
35434 F20101113_AADUFP washburn_a_Page_112.pro
1608ae4d64a63cde740cafaaf1ac0367
1f8d76c9f91fc91e7a6fa2feca41c5e3315dfaa6
F20101113_AADTZV washburn_a_Page_092.tif
63a3df9157bee5306e6792008e91700c
2d0231f1ab0c99ea9e7e86867f40b5801898a348
80636 F20101113_AADUGE washburn_a_Page_128.pro
4f11a2199d2086daef9da28d54acf221
3924cdb0e0d73d7b367914f72250f69c7d0bb8b5
37952 F20101113_AADUFQ washburn_a_Page_113.pro
f88b9654a0635c1cce87ff7a1be0c538
6246a5808cbfb1682bb39487e4847182633c11b6
F20101113_AADTZW washburn_a_Page_093.tif
295b54ef76373986fca6738c5bf1f0f1
f6684dd9f9be7820600e5016c96c0c01b28a622d
86298 F20101113_AADUGF washburn_a_Page_129.pro
216b75d5b8d1eb03a1140baace902af0
f8734b5323b4e400e89bfe09afea1fee49eca836
32146 F20101113_AADUFR washburn_a_Page_114.pro
69b83f01d91e179f87b91af20523dba2
727f6d0094e305e8e907d2196177956dad9f8e2f
F20101113_AADTZX washburn_a_Page_094.tif
51ec621a4897d2f44b3f354894733c72
cc720498d1b76def2cc2418a0310340b1d4aab6f
84395 F20101113_AADUGG washburn_a_Page_130.pro
9d143771bfe17636499e1f0687e0b045
cf4ebef1cd65957c954bfa6b536b86051fe89c73
37141 F20101113_AADUFS washburn_a_Page_115.pro
934e51afaad06d48c50eb531c658cbcf
ddf959872660c327332fbd56ab46d9b8c5298f06
F20101113_AADTZY washburn_a_Page_095.tif
e7ee6378e8f2b61ede225bd91ce17ba7
519f61636dc9e6b4f8bcecfad596bd55f459d5d8
85420 F20101113_AADUGH washburn_a_Page_131.pro
ec92c71372a79d671459d0b4b2edd2af
29f150086e353199fe3cf66f50075dcf7b63b5a6
33143 F20101113_AADUFT washburn_a_Page_116.pro
b1dc23d0147f38cdc3afd429772425d2
066b937ea9ef4d3c390032eedd4e8c8745327a27
F20101113_AADTZZ washburn_a_Page_096.tif
ad3e332b8605d1a1c5cf94f6a5f98c14
562af2a43610689e421dcedbc46ac0b4b424453b
89248 F20101113_AADUGI washburn_a_Page_132.pro
24b0f1f03df90e2fff1845f381196e43
ec8a11dfe4810bd628efb3c9da204c4c85487708
1341 F20101113_AADUFU washburn_a_Page_118.pro
242069d2bce4f70d6db13790d111bb70
15f082a2b94728378c12268c7f29fec3e6dac954
87562 F20101113_AADUGJ washburn_a_Page_133.pro
3f8a8ca520c254d8d9e508fdbe7e1df5
142e46a7345e1946450ebaf226a60db21654eaa6
37964 F20101113_AADUFV washburn_a_Page_119.pro
e3aa4eaf73e0482b6b8cd3d6617c0ac7
5b644200387e811fbb2300fa2776962cdeb06c33
87075 F20101113_AADUGK washburn_a_Page_134.pro
1af61fd344e756059dd8857b4d22c4ca
bb43b2360231e154d7d24e4d1a9967c757736357
1159 F20101113_AADUFW washburn_a_Page_120.pro
69a16ec8c34e7a328d4a7f3f20d4d3ef
97657db95765761eee9848d15412be43f7688c79
89197 F20101113_AADUGL washburn_a_Page_135.pro
6b94b409079daefb63c8e6f7524eca12
48887f631db6bee0ae5198824820572ca29f3958
42311 F20101113_AADUFX washburn_a_Page_121.pro
120db0365d55ef570e9c6ff67636a77f
260405580780a23bcd02ba9ef4f81c305bbd2c88
2019 F20101113_AADUHA washburn_a_Page_010.txt
67a5bfd52f1a7ba0ee9293df88723c86
675eb8a59a2c95eaa5a39d7a142f3f0171a04bac
85317 F20101113_AADUGM washburn_a_Page_136.pro
b3b8697d0722fd488fb29a9f08da6234
b4ef33a2455ebe5fdf71b297769c2aa94759aa12
36642 F20101113_AADUFY washburn_a_Page_122.pro
81998cd7ff803b770a3db39439d86fba
44f18551798042c337feeac0d45b18a1a12f05ce
2248 F20101113_AADUHB washburn_a_Page_011.txt
92dabcf9b444cb7b59245f9a18e08c9a
234f125b5f6d450743b977131410563c9ca73d47
84464 F20101113_AADUGN washburn_a_Page_137.pro
b2c9d7d48492e97ee9ef583f12724a4a
15c03bd5137f8e0d2f122be8dc27525aa7a425fe
50591 F20101113_AADUFZ washburn_a_Page_123.pro
057e44dbe91513d9f6105b1d53ae6f41
41773f48cc5a59544eea6224e2353a517a86bad9
2147 F20101113_AADUHC washburn_a_Page_012.txt
bcce09628b221b4f1a805e0af073a810
a52c7d35e8b2f24df8df38631f3f8d99563cc55a
86980 F20101113_AADUGO washburn_a_Page_138.pro
c6cd39e9438db60ac2dcdd143b72bb1e
8c0d40a990ec5381c4127439f8a63e27d2ff90ad
2170 F20101113_AADUHD washburn_a_Page_013.txt
d67675c318c8b5a71c13a40b51999ea1
d0d0c198fb670fbf1db091889f390975d1015009
89496 F20101113_AADUGP washburn_a_Page_139.pro
db73c44bb8014bb13caad1678466643c
1220cfb20ebb2ff221eb9ec32d073e6698f35e91
2079 F20101113_AADUHE washburn_a_Page_014.txt
8558077dc32660879380a089304b2f1d
3423ed4cf734769a165ed0de736b409ad803525d
64266 F20101113_AADUGQ washburn_a_Page_140.pro
34aaa7796db53fbd6c7ade47236e8976
d2f0b3a424c557f99775f8dce46c90bee7944aaf
2162 F20101113_AADUHF washburn_a_Page_015.txt
52990f83fe1fb193039d56730feefb52
3625886dad40c660417424fffb9355a74784b488
24043 F20101113_AADUGR washburn_a_Page_141.pro
ab8008155f5b15d8035d67f00d12ae0c
7ec4192447210bb83c8cd1c7b9630fee1b7f7c9f
2093 F20101113_AADUHG washburn_a_Page_016.txt
c6b51d7ca69a688e67e44f249632db4f
4ba4afb6ff81065f6d61327d8f979f26301b8908
429 F20101113_AADUGS washburn_a_Page_001.txt
a74cb31111fddb749eb54170c7543416
90b3c12c7d44b915d5763b285694bbc8c8994543
2064 F20101113_AADUHH washburn_a_Page_017.txt
a72acd8e8add8bc79b21e81030e9b0ad
394e7d90a13a2f7890432f08e9830688b9ce02d0
89 F20101113_AADUGT washburn_a_Page_002.txt
ad263ee47c354ef501093a7c1e749fae
5f6a60d8b2c6bb186e0b213866143b5f6a51b8e7
2173 F20101113_AADUHI washburn_a_Page_018.txt
19655656b26c01bad422f245c62be777
4b65794f37b307aa21325940429db16e38ff48dc
104 F20101113_AADUGU washburn_a_Page_003.txt
26d1ce57e7cdf19c41fea5b022bf92f7
ca084e5da23c18f8f334e36891afa66e837a9716
876 F20101113_AADUHJ washburn_a_Page_019.txt
5671429e9193b7ab3a745a493b316866
ce11232c687193dcdafb3f036075ad5242e8fb6a
1887 F20101113_AADUGV washburn_a_Page_004.txt
314bd5d0e3df910f7d38a5ade8975ffb
1ec4d68ad639cdabd6bc5dc79d5c335919358423
826 F20101113_AADUHK washburn_a_Page_020.txt
dae1869e298324b8bbacc3386dda86b7
5e48fff7b4463aef505a5f5e783c079845ec4805
1622 F20101113_AADUGW washburn_a_Page_005.txt
1050ae6f4c243468b902783044b61b80
da2d721a1e9da2e5c0670934c9a0dc95eeb6dc97
1963 F20101113_AADUHL washburn_a_Page_021.txt
1629be35b0d076e24e1698adc98d28c2
6655396faf5455d95d7101eee49dc818d79974a1
2730 F20101113_AADUGX washburn_a_Page_006.txt
34ce41025347dbc5cf5a170fc20c90b7
34594f45a55a2d458c217209a11f4936c6b857b0
506 F20101113_AADUGY washburn_a_Page_007.txt
100dae8d7d303b42707f902c45e6186a
cba28a9141af89ecf68f2302e37c20f7b4963274
2171 F20101113_AADUIA washburn_a_Page_041.txt
80baa256fc23ee986d8115c1da4935fc
0e9ae2745ac8f8032a6d2c6a2431134207bb8153
2121 F20101113_AADUHM washburn_a_Page_022.txt
7b73819fa05fe3e953faebaa1e72133e
a70c531420be965efd124f877088635af8d22d37
817 F20101113_AADUGZ washburn_a_Page_008.txt
556a251ff6fd62878ea9228a2e2b71f7
d2e5437d8ef30965bbfd99578ac530586f60c761
2026 F20101113_AADUIB washburn_a_Page_042.txt
792f2b546627404866faee981050215d
aa567d2354a339c1e67a95a0b7f895a2879b0963
2027 F20101113_AADUHN washburn_a_Page_023.txt
02caa65f1165ff4dbec6f088b98dbbc8
edfe9c411f3d86a974606389a10a5a9b8bc4e383
2003 F20101113_AADUIC washburn_a_Page_043.txt
55ed207f9805163ba87f95d690bf1e98
3316ed34fbaf1077dbf50c62be2712bec78aad00
2124 F20101113_AADUHO washburn_a_Page_024.txt
12be4b647539ff4972532a107f5c7f78
d3a19e6f530b52522353f233716a2a2f76f07b65
2094 F20101113_AADUID washburn_a_Page_044.txt
0de6b328240330d15d5bf7e81f471b03
7f08deaf3d6883d1d483d7fc80becc262d25b66d
F20101113_AADUHP washburn_a_Page_025.txt
7d9fbc71d8af3c3b81000aba8bc7564a
b3eca9b0dce69e45754822649bf2ffbf5225b51c
1710 F20101113_AADUIE washburn_a_Page_045.txt
3766965fc20230f5671a5f096fdbda7c
00a0edea84c8c52c0b502c572c8a0f5639ab875b
2084 F20101113_AADUHQ washburn_a_Page_031.txt
76a8ca0beb217e79c5f12dde12a3ea5f
bd52902d5d0e34cd0b36fa2bf67c8a7fa6be72c8
1092 F20101113_AADUIF washburn_a_Page_046.txt
080fc3fbc556a06bdfcb8dc7117eb938
130d4c107075fd8e50bd0ef6852cab4680b70e3d
2155 F20101113_AADUHR washburn_a_Page_032.txt
846a7e55b011926f785d8d6e8a77ee81
175d580eb679d530e90563bedd2503d4cabe2aa9
301 F20101113_AADUIG washburn_a_Page_047.txt
fb25211430e1dffdb4040ada0c1bb6aa
65faf929376bdf40fc3a570cc6bc558dffd54291
2205 F20101113_AADUHS washburn_a_Page_033.txt
182f3e1af10f0b52d8f9e1512803cebb
ba0fcf9aee011ee92d3d96295f167fcb170b4037
945 F20101113_AADUIH washburn_a_Page_048.txt
acdfa21497d6288e7cf3d1a62632fec8
d60ec2521caf85ed2cd59f971df544593070bc22
F20101113_AADUHT washburn_a_Page_034.txt
b8158ff07d24efedb96ba044302d96bd
7f265a454544dd7bad89f346608d4c4ba2a4fa4a
1106 F20101113_AADUII washburn_a_Page_049.txt
3149893439517a97d9f1044677f90c1c
72fbe742df3f5573041348fac363134d77f25994
2113 F20101113_AADUHU washburn_a_Page_035.txt
b5fc1ebe2aa8020011a9f8d6c52f15a9
5becdf1cf0fbbe8ff4f1488a6890a5a34e143467
2077 F20101113_AADUIJ washburn_a_Page_050.txt
42c0a16ed788d93fdb691acc7ddbdcaa
b50db344fd99d3ad38ca0438786211f4a7f4144b
F20101113_AADUHV washburn_a_Page_036.txt
00749e1b3665787932fd72e76d1e27e0
9972d52370261d04e202ee430990a4e636724061
1932 F20101113_AADUIK washburn_a_Page_051.txt
19895c335accf5cdd558ce718feffea7
4e56999a09b4778aee8e930c6050dc2a95fb2517
1241 F20101113_AADUHW washburn_a_Page_037.txt
ac98e2085c802d13c528a1433f51e57f
9c0410c49b2eda7a9a71e75af7ee0f8ccfc92737
2104 F20101113_AADUIL washburn_a_Page_052.txt
4fa013126a0d2cad398a14c60c0818b3
7d6f83bad6b979f59d43363ea068a7518dc32a5b
1281 F20101113_AADUHX washburn_a_Page_038.txt
79fd7645741ba863f11a8971f997932c
0197e45a756a461e18134ebbb8f790e0e47749ba
2052 F20101113_AADUJA washburn_a_Page_069.txt
8b4c8fc983859da1abbac1ced1169d05
1793b0ea05b37e36947ff0a02201d8cfbd5f3777
2070 F20101113_AADUIM washburn_a_Page_053.txt
4ed3e568e3edc6572745949ffcf3c257
905ac4668986d4d6ad4bfbe9a82347c50cab0794
2013 F20101113_AADUHY washburn_a_Page_039.txt
8021ac617630420635810cf619c306ce
7628ffe1cd77a71e04ded32afab2ddc3bab7541a
2111 F20101113_AADUJB washburn_a_Page_070.txt
57488818cba855c56487276b6b3f5285
4167f1ce2737eb13b7c3d6864f32f2c32e26da32
2072 F20101113_AADUIN washburn_a_Page_054.txt
767b79970c0179723e79716675be72f1
c991fd959c43fbd60ac8537031bf375892884f32
1819 F20101113_AADUHZ washburn_a_Page_040.txt
d49b1be2008a927b983bcb5bc324adec
0b30a3c949e6b7f67fb69a5fa294884a02bf691b
F20101113_AADUJC washburn_a_Page_071.txt
271ad82b2099ac8a4eba3405c57717de
ea40b66253179f96fdc87bdc60444d913b5c5ecb
2127 F20101113_AADUIO washburn_a_Page_055.txt
dfe3154749cc13e99a34f8fe49068918
4dc3028a898d259f7b2b5697070e280f75ae31e5
2021 F20101113_AADUJD washburn_a_Page_072.txt
6fd0192df4a6503929897efe47af8b97
416ef154faa92a53427a028160ad935889e89da5
2195 F20101113_AADUIP washburn_a_Page_056.txt
c8b2bdf4d1dc43159dbc96160e95ed8f
35f4f56a06c1d40b9055131d3e81e00e5e78fc69
2059 F20101113_AADUJE washburn_a_Page_073.txt
4da1f361c6739f010b307720ed83c3e6
c81e9955e23a6a4a7a8a44fe88d28b633004441a
2187 F20101113_AADUIQ washburn_a_Page_057.txt
beadf78001265ad63d772957091ee6ca
87ec83aacac5c69c180c08a4bc8949c1814584d8
2109 F20101113_AADUJF washburn_a_Page_074.txt
730dd23ade6401e18060cd777b925429
806549d553db87132fe3b95fa9315dd35289c136
2149 F20101113_AADUIR washburn_a_Page_058.txt
b45a0071ec2218ae5dc8ecf390ac763c
31bc57c68379c497121c9d50a6d012b7b1baec62
2180 F20101113_AADUJG washburn_a_Page_075.txt
b4ee6ee7912d5c2dd92cfb29b0eda11b
7b812180373bd0d54227bf4efc0c108d3611c3b8
2087 F20101113_AADUIS washburn_a_Page_059.txt
3f79b55c221881b952dc48e064efcfd9
51def53c381578bebebf6d4dd9df278ea19cdae6
2061 F20101113_AADUJH washburn_a_Page_076.txt
29d9d90908d927fde1bc7335314b9a90
947460e5f501d0d5c6cae855d0e3dedce9c1df7d
2159 F20101113_AADUIT washburn_a_Page_061.txt
e1a41a4ff30f023643ab0deae6d5d840
2b01918956506f42161ab6b6c1a5bb9455501299







PHYLOGEOGRAPHY OF THE SWALLOW-TAILED KITE (Elanoides forficatus)


By

AUDREY WASHBURN

















A THESIS PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
MASTER OF SCIENCE

UNIVERSITY OF FLORIDA

2007


































O 2007 Audrey Washburn































To my parents, Marcy Rol and John Washburn.









ACKNOWLEDGMENTS

I am thankful to my family and friends and advisors, who never doubted me, and

especially to my parents who have funded my life. My academic advisor, Ken Meyer, and lab

advisors, Allan Strand and Kim Norris-Caneda, taught me everything I know about biology, and

I am so grateful for all of their support and enormous amounts of help. Douglas Taylor and

Maurine Neiman provided guidance, statistical support, and facilities. Douglas Levey and

Kathryn Sieving allowed me to overstay my welcome, then read and helped edit my long thesis.

Swallow-tailed kites were my inspiration, and I apologize to those whom I annoyed. Their

beauty and grace kept me going in the field when times got tough. My dogs, Sarah and Chiara,

kept me company in the tedium of lab and desk-work. I appreciate Mario Cohn-Haft for his

ideas and conversation.

Many families and labs hosted me throughout my research. I greatly appreciated their

hospitality. These included: Arthur Coelho Barbosa and family at Fazenda Campana; Tetsuo

No, Jercelino and Rosemary Aparecido Santos at Fazenda Palmital; Gilda de Jesus Martims de

Oliveira, Leonildo and Viuma Nespoli at Rancho Alegre and Fazenda Laranj al; managers at

Tikal National Park; Stephen B. Aley at University of Texas at El Paso; and Doug Taylor' s lab

including the helpful Stephen Keller and Dan Sloan.

During fieldwork, I also had a lot of help. People who provided invaluable assistance in

the field included: Richard P. Gerhardt, Miguel Angel Vasquez, Francisco "Chico" Cruz Neto,

Sergio Seipke, Renata Leite Pitman, Marcos de Azevedo, Vitor de Piacentini, Edson Aparecido

Santos, Gina Zimmerman, and Andy Day. I especially thank John Arnett, Diana Swan, and

Jennifer Edwards, for their help and friendship.









Tissue samples were provided by many sources. Everyone was extremely generous.

These individuals and museums included: Richard P. Gerhardt, The Peregrine Fund; Jennifer

Coulson, Department of Ecology and Evolutionary Biology, Tulane University; John Cely,

South Carolina Department of Natural Resources; Jim Elliott, South Carolina Center for Birds of

Prey; Marcos de Azevedo; Andreas Helbig, Institute of Zoology, University of Greifswald;

Auburn University Natural History Museum and Learning Center; Museum of Comparative

Zoology at Harvard; Museo de Historia Natural Capao Imbuia; Moore Laboratory of Zoology at

Occidental College; University of California, Museum of Vertebrate Zoology; University of

Michigan Museum of Zoology; National Museum of Natural History; Yale Peabody Museum;

Florida Museum of Natural History; Academy of Natural Sciences of Philadephia; Field

Museum of Natural History; Louisiana State University Museum of Natural Science; American

Museum of Natural History; Royal Ontario Museum; and the Western Foundation of Vertebrate

Zoology.

Permits were provide by IBAMA, CEMAVE, and CNPQ in Brazil. Funding was

provided by The Disney Wildlife Conservation Fund, Florida Fish and Wildlife Conservation

Commission, Georgia Department of Natural Resources, National Fish and Wildlife Foundation,

Jennings Scholarship (University of Florida), Women's Agricultural Society Scholarship, The

Broussard Conservancy Conservation Award, Explorer's Club of Florida, and the Florida

Ornithological Society Cruickshank Award.











TABLE OF CONTENTS
page

ACKNOWLEDGMENT S .............. ................ 4


LIST OF TABLES ............. .................... 8


LIST OF FIGURES .............. .................... 9


AB ST RAC T ......_ ................. ..........._..._ 10....


CHAPTER


1 INTRODUCTION .............. .................... 12


2 M ETHODS .............. .................... 21


Sam pling ................. ..............._ 21..............
Lab Techniques................ .............. 23
Resolving Genetic Variation .............. .................... 27
Morphological Techniques ................. ................. 29.............
Analysis .............. .................... 30

3 RESULTS .............. .................... 39


Descriptive Statistics by Locus................ ... ........... ........ 39
Swallow-Tailed Kite Phylogeography Based on mtDNA ................. .......... .............. 41
Swallow-Tailed Kite Phylogeography Based on nDNA ................ .......... ............... 42
Differences between Populations as Defined A Posteriori ................. ....___ ............. 43
Structure within Clade/Genetic Population ................. ....._.._.....................4


4 DISCUSSION ........._._.. ........... ............... 500....


Subdivision/Gene Flow: Between Populations ...................... .... .............. 500
Possible Explanations for Population Structure in Elan2oides ........................_.... 533
Reduced Gene Flow within Elan2oides Compared to Other Migratory Species......... 600
Relationship between Migration and Speciation in Elan2oides and Similar Species.... 63
Morphology and Sub species............... .............. 700
Population History ............... ..... ..._._._ ..............733...
Subdivision/Gene Flow: Within Populations .............. .................... 77
Im plications .............. .................... 79

5 SUMMARY............... ................ 822


APPENDIX












A SAMPLE INFORMATION ................. ................. 84......... ....


B PCR CONDITIONS FOR EACH LOCUS .......................... ......... ..........18


C MORPHOLOGICAL RAW DATA .................... .............. 120


D PHYLOGENETIC TREES ............. ...... __ .............. 124..


LITERATURE CITED ............. ...... .............. 128...


BIOGRAPHICAL SKETCH ................... __ .............. 141...










LIST OF TABLES


Table Page

2-1 Description of genetic regions amplified and associated primers .............. .. ........ .37

3-1 Descriptive statistics for each mitochondrial clade ............... ............ ..... 45

3-2 Mismatch distribution data ............... ...........45..................

3-3 Comparison of measurements between groups of Swallow-tailed Kites. .................. .46

A-1 Sample collection information. ...._.. ...._._._._ ......_... ...........8

A-2 Sample contributor, population designations, and accession numbers .........._......... 103

B-1 PCR conditions for each locus ........._.... ......._.. ......119_.. ...

C-1 Morphological raw data ............... ............121. .......... ....










LIST OF FIGURES


Finure Page

1-1 Documented breeding of Swallow-tailed Kites ............... ................ ...._20

3-1 Molecular data as it relates to geography ............... .............. ........ .47

3-2 Phylogeographic structure within clades or genetic populations ........... ...............49

D-1 NJ tree based on CR Breeder Long dataset ............... .......... ............125

D-2 NJ tree based on CR Breeder Short dataset ............... ......... ............126

D-3 NJ tree based on CR All Short dataset ............... ............... .........127









Abstract of Thesis Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Master of Science

PHYLOGEOGRAPHY OF THE SWALLOW-TAILED KITE (Elanoides forticatus)

By

Audrey Washburn

August 2007
Chair: Kenneth D. Meyer
Major: Wildlife Ecology and Conservation

Little is known about genetic or morphologic variation in the Swallow-tailed Kite

(STKI). I investigated patterns of global variation to test hypotheses relating to species' history

(origin and expansion) and behavior (dispersal and breeding). The STKI is highly mobile, social

year round, and wide-ranging within and between its summer and winter ranges. Migration

patterns allow frequent, extensive interaction among populations, from the southeastern U.S. to

southeastern Brazil. It has been assumed that migration and dispersal are correlated, and that

highly vagile animals will show less subdivision than more sedentary relatives, due to gene flow

among populations. However, STKIs are thought to be natally philopatric in the US and long-

distance migrants are generally known to operate on rigid schedules, which might discourage

behaviors associated with gene flow. I assessed gene flow in STKIs with phylogenetic- and

frequency-based analyses of mitochondrial and nuclear intron sequence data taken from live and

museum specimens spanning the species' range. I also measured morphological variables

currently used to distinguish subspecies.

I found deep genetic divisions in the STKI without correlated morphological breaks.

Mitochondrial clades were geographically coherent and corresponded to these "genetic

populations": 1. the southeastern U.S.; 2. southern Mexico to central Brazil; and 3. central to









southern Brazil. The division near the Pantanal in central Brazil was unexpected. Nuclear loci

also showed support for a U.S. population. Phylogenetic trees indicated an historic lack of gene

flow among the three areas. One recent gene flow event was detected between the two southerly

genetic populations and attributed to proximity rather than to migratory behavior. Coalescent

and diversity analyses suggested that these populations originated in the early to late Pleistocene,

the northern being the youngest. These STKI populations apparently have remained isolated

throughout glacial cycles and range changes, resulting in a distribution where a large neotropical

population of residents and short-distance migrants is bordered to the north and south by smaller

temperate-breeding populations of long-distance migrants. Each population lacked

phylogeographic structure. I suggest likely scenarios for population histories, reasons for current

population boundaries, and explanations for panmixia within STKI populations.

This study supports the hypothesis that long-distance migration can enable speciation and

demonstrates that migratory behavior does not necessarily hinder differentiation. I consider

potential isolating mechanisms and constraints to gene dispersal when population interaction is

common and natal philopatry appears too weak to produce genetic structure. My results suggest

that a cryptic pattern of genetic divergence can arise in long-distance migratory species whereby

movements and breeding locations are flexible as migration patterns evolve, gene flow ceases as

migratory patterns become specialized, populations continue to interact, and obvious

morphologic differences do not develop. Long-distance migration could facilitate divergence by

allowing displacement of populations for part of the year, strong stabilizing selection that limits

behavioral plasticity during migration, and interaction among populations, reinforcing mate

discrimination when hybrid fitness is reduced. I draw parallels to speciation patterns in other

taxa and reflect on evolutionary implications and conservation for the STKI and similar species.









CHAPTER 1
INTTRODUCTION

Studies of phylogeography can reveal historical and current behavior of a species,

facilitate evaluation of explanatory hypotheses, and help predict future behavior.

Phylogeographic structure (geographic patterns in a gene genealogy) is often found in species

that appear panmictic based on morphological similarity and/or range continuity (Tilley et

al.1978, Avise and Nelson 1989, Soltis et al. 1997, Irwin 2002a, Bickford et al. 2007)

demonstrating that boundaries between vagile organisms can be cryptic. Alternatively, many

wide-ranging species with discontinuous ranges and/or morphological variation have been found

to be relatively panmictic (Ball et al. 1988, Brower and Jeansonne 2004, Davis et al. 2006).

Phylogeographic studies referred to above have elucidated unexpected behaviors within species

such as strong natal philopatry, short or long distance dispersal, assortative mating, reproductive

isolation, or interbreeding between populations; have aided in assessment of causal ecological

conditions; and have helped develop predictions concerning future changes in population

structure.

Seasonal migratory behavior is often studied using phylogeographic information, mainly

in regard to its evolution (Freeland et al. 2003, Helbig 2003, Joseph 2005, Mila et al. 2006). One

suggested pattern points to tropical origins for tropical/temperate migratory birds, whereby

populations expanded into temperate zones to take advantage of lower competition and seasonal

resources when breeding, and then returned to the tropics to winter (reviewed by Gauthreaux

1982, Rappole 1995, Safriel 1995, Joseph 1997). Since tradition is the easiest way to explain

why migrants often travel so far to winter, it is often postulated that the population most closely

related to the ancestral population is the one harboring wintering migrants, (Lincoln 1950, Carr

and Coleman 1974, Outlaw et al. 2003). The species' origin might also be located near the









population containing non-migratory birds, from which migratory populations are believed to

have stemmed (Rappole and Jones 2002, Helbig 2003, Joseph 2003). Temperate populations are

usually found to be less diverse and more recently expanded than related tropical populations,

probably due to glacial cycles and related movements (Capparella 1988, Hewitt 2000).

While the evolution of migration in various species has received much attention, the

effects of migration on the species' evolution are less often studied. This may result from the

traditional prediction that highly vagile species should be the least genetically subdivided

(Corbin 1987, Ball et al. 1988, Helbig 2003, reviewed by Winker and Pruett 2006).

Alternatively, some have hypothesized that migratory patterns may promote speciation (Cox

1968, Safriel 1995, Winker 2000, Irwin and Irwin 2005). Winker (2006) called this process

heteropatric speciation because populations often occur in allopatry and sympatry during a

migratory cycle. A lack of data has limited examination of whether bird migration ultimately

facilitates or retards gene flow, and therefore, genetic subdivision (Helbig 2003, Irwin and Irwin

2005, Winker and Pruett 2006).

Several lines of evidence indicate that migration facilitates the dispersal of genes. Long-

distance migratory species within their hemisphere of origin are more widely distributed than

con-generic resident species (Boihning-Gaese et al. 1998). The creation of these distributions

must have required relatively flexible migration strategies over a period of time (Baker 1978,

Levey and Stiles 1992, Safriel 1995, Berthold 1999, Bell 2000). Flexibility should involve

diverse and plastic expressions of migratory orientation and phenology, resulting in dispersal and

incremental range changes. If flexibility were beneficial in the past, might it not still occur, even

in species that appear to have set patterns? Migratory species have been found to disperse farther

than resident species (Paradis 1998, Sutherland 2000, Thorup 2006) and even obligate migrants









can settle opportunistically to breed when they experience large areas of suitable habitat during

the migratory cycle (Martinez 1983, Johnson and Grier 1988, Spendelow et al. 1995). Nomadic

and facultative migratory species illustrate the benefits of flexibility by regularly taking

advantage of temporary resource conditions and shorter migrations (Ward 1971, Pulliam and

Parker 1979). Otherwise non-irruptive migratory species have also shifted their wintering

grounds, probably based on resource availability (Berthold et al. 1992, Viverette et al. 1996, Hill

et al. 1998). Migratory birds may be pre-adapted as explorers and exploiters of novel

environments (Leisler 1990, Mettke-Hofmann and Greenberg 2005, Winkler 2005, reviewed by

Salewski and Jones 2006). Research regarding the flexibility of behavior in avian migratory

species gained increased relevance recently due to concerns regarding responses to global

warming (Sutherland 1998, Pulido and Berthold 2004, Both et al. 2006).

The logistics of migration provide many opportunities to disperse genes between

breeding populations. Migratory organisms often get thrown off course during migration and

gene flow can result (Baker 1978, Rappole 1995, Bildstein 2004). Conspecifics from different

breeding populations interact on the migratory route or non-breeding grounds and can either

mate or change breeding population (McKinney 1965, Rockwell and Cooke 1977, Moore and

McDonald 1993, Wenink et al. 1996, Calambokis et al. 2001, Brower and Pyle 2004, Roberts et

al. 2004, Pomilla and Rosenbaum 2005). Studies of long-distance migratory species population

structure usually find gene flow between breeding populations, even when those populations

showed strong phylogeographic structure (Bowen et al. 1992, Baker et al. 1998, Wenink et al.

1996).

Conversely, long-distance migration may generate barriers to gene flow between

populations. Migration allows populations to breed allopatrically because places not habitable









year round can still be used for breeding by animals able to migrate. Factors likely to promote

reproductive isolation between migratory populations that interact but breed allopatrically

include philopatry to natal area (Baker et al. 1990, Bowen et al. 1992, Baker 2002), divergence

of behavioral or physical traits due to drift or ecological/sexual selection (Bensch et al. 1998,

Irwin et al. 2001a, Winker and Pruett 2006), hybrid unfitness and reinforcement (Helbig et al.

2001, Irwin and Irwin 2005) and physiological or cognitive constraints due to adaptations for

migration (Hamner and Stocking 1970, Briskie 1996, Gwinner 1996, Bensch 1999, Pulido and

Berthold 2004, Mettke-Hofmann and Greenberg 2005, Sol et al. 2005a). The seemingly

suboptimal migration routes of some species suggest that many migration patterns are fixed

(Moreau 1972, Carr and Coleman 1974, Sutherland 1998, Ruegg and Smith 2002). Divergence

can occur between sympatrically-breeding migratory populations as well, due to assortative

mating between individuals that share migratory strategy (McKinnon et al. 2004, Bearhop et al.

2005, Irwin and Irwin 2005).

I collected phylogeographic data on the Swallow-tailed Kite with a primary goal of

evaluating two competing hypotheses concerning the relationship between migration and gene

dispersal. The Swallow-tailed Kite appears equally predisposed to reproduce in isolated groups,

which would restrict gene flow, or to interbreed at a low-frequency across its range, which would

maintain gene flow. The Swallow-tailed Kite is highly mobile, social year round, and encounters

few obvious limitations to long range dispersal within its large range. The species has many

traits that would appear to pre-dispose it to long-distance dispersal (Paradis 1998), but limited

radio-tracking data indicate that Swallow-tailed Kites are natally philopatric (Meyer 1995).

Their migration pattern allows frequent, extensive interaction among all populations,

from the southeastern U.S. to southeastern Brazil. Breeding areas and phenologies are shown in










Figure 1-1. Swallow-tailed Kites disappear from most of their northern (red area Figure 1-1) and

southern (green area Figure 1-1) range when not breeding (Robertson 1988, Meyer 1995). Dates

of disappearance and observations of extremely large wintering roosts in Brazil suggest that

Central and North American breeders co-migrate and winter together (Robertson 1988, Meyer

1995, K. Meyer, unpubl. data). The species' trans-equatorial range and gregarity (conspecific

attraction on wintering and breeding grounds), results in wintering and breeding population co-

existence for extended periods of time (Meyer 2004, K. Meyer, unpubl. data). In the austral

summer, I often found Swallow-tailed Kite nests in Brazil next to large roosts of wintering

breeders from North America (Meyer 2004). Wintering birds often arrived before eggs were laid

and left a few weeks after most young fledged (pers. obs.). Recent information also suggests that

in the austral winter, breeders from the southernmost portion of the species' range may winter

alongside birds breeding in northern South America (K. Meyer, unpubl. data).

Regardless of interaction between populations, subspecies have been described in this

species and allopatric breeding populations may exist because of: 1. change in nesting

phenology (Figure 1-1, nest date changes most noticeable at the division between green and

purple areas) and; 2. gap in the Swallow-tailed Kite breeding range in the northern half of

Mexico (Robertson 1988). This arid zone in Mexico divides the northern and southern species.

E~f forJicatus (U.S) was defined based on longer wing and tail measurements and purple

iridescence on shoulder scapulars, while E~Jf yetapa (Latin America) is said to exhibit green

iridescence (Viellot 1818 in Robertson 1988). Subspecies have been called "scarcely separable"

and their designation "doubtful" (Robertson 1988). Personal observation suggests that Swallow-

tailed Kite subspecies are phenotypically indistinguishable in the Hield.









I tested several hypotheses concerning Swallow-tailed Kite population structure. Gene

flow might occur throughout the species if occasional mating occurs between breeding,

wintering, or migrating conspecifics from different populations, or if birds switch breeding

populations as a result of social interactions. If this was true, I predicted that I would find

Swallow-tailed Kites form a panmictic population and that no phylogeographic structure would

be found in phylogenetic- or frequency- based analyses of molecular data. However, if

phylogeographic structure does exist, I hypothesized that it is due to restricted gene flow in

northern Mexico at the gap in breeding, and near the equator, where nesting phenology changes,

in which case phylogenetic- and frequency-based analyses would find Swallow-tailed Kites

breeding in the following three regions to be more similar to each other than to those breeding in

other regions: The "Northern Biological Population," which consists of the U. S. breeding range,

the "Central Biological Population," which consists of breeding areas south of the U. S. and north

of latitude 80S (non-U.S. red area and the purple area in Figure 1-1), and the "Southern

Biological Population," which includes breeding areas south of latitude 80S (green area in Figure

1-1). I also hypothesized that restricted gene flow, if found, is due to Swallow-tailed Kite natal

philopatry, which should reveal itself locally. Therefore I predicted additional phylogeographic

structure would be found within any large population. Finally, I tested the hypothesis that

currently accepted morphological rationales are not appropriate for distinguishing subspecies or

Biological Populations. I predicted that ranges of wing and tail measurements and iridescence on

shoulder scapulars would overlap between subspecies and Biological Populations, and that the

most significant morphological differences would be found when samples were grouped into

sub-regions.









I also considered the history of the Swallow-tailed Kite, in terms of geographic origins

and expansions. The species may have originated in northern South America, suggested by the

fact that putatively non-migratory kites reside there. Alternatively, it may have originated in

central or southern South America, suggested by the fact that Swallow-tailed Kites from

throughout the rest of the range winter there. The potential for a North American origin of

neotropical migratory species has been suggested by some studies (reviewed by Gauthreaux

1982), although it does not seem likely in most cases (Joseph 1997, Rappole 2005). To test the

null hypothesis that all Swallow-tailed Kite populations are equally likely to be the most closely

related to the ancestral population, I predicted that no population would be more diverse than any

other and that phylogenetic analyses would not indicate a basal or oldest clade. Expansion of the

ancestral population into temperate zones may have been facilitated by long periods with warm

climatic conditions. I hypothesized that expansion of populations could have occurred during

Marine Isotope Stage 11 (MIS 11) (ca. 360-420 ka), reputed to be have been the longest and

warmest interglacial period during the past 500 ka, characterized by the highest amplitude

deglacial warming in the past five million years (Burckle 1993, Ortlieb et al. 1996, Droxler and

Farrell 2000). I predicted that phylogenetic analyses would determine a range of dates for each

population' s origin that included MIS 11. Also, I hypothesized that the Northern Biological

Population is the least diverse and most recently expanded population because of glacial cycles

in North America and associated range changes that may have caused repeated bottlenecks and

founder effects, not experienced to the same magnitude by other Swallow-tailed Kite

populations. I predicted that genetic diversity and demographic analyses would find individuals

in the U.S. to be less diverse and to have experienced a more recent sudden population expansion

than in other populations.









I tested hypotheses using molecular and morphological data. Swallow-tailed Kite tissue

(n=142) was collected range wide from live birds and museum specimens. DNA was amplified

and sequenced in the mitochondrial control region, cytochrome b, and several nuclear introns. I

used phylogenetic and frequency analyses to assess gene flow and indicate phylogeographic

structure in Swallow-tailed Kites. Demographic and diversity analyses elucidated population

history. I analyzed morphological data (n=52) to judge the rationale behind current subspecies

designations and to determine the extent to which morphological differences correspond to

genetically determined population structure. Results from genetic analyses provided insight into

Swallow-tailed Kite behavior, history, and the role of migration in genetic diversification.

























Red- Breeding Mar.-Aug.

Purple- Breedmng year round.

Green- Breeding Sept.-Jan.









D 500 1000
kilometer-s


3o'sj


Figure 1-1.


Documented breeding of Swallow-tailed Kites based on nesting, not sighting,
records, since Elanoides is wide-ranging outside of the breeding season. Nesting
phenology changes near the equator. The three known nesting phenologies are
shown with different colors. Map based on: Robertson (1988), Meyer (1995),
authors' observations in the field, dates of nesting and kite presence/absence from
biologists working in Latin America, and breeding date/location on museum
specimen tags. Diagonal lines represent areas with no nesting records, but where
data is scarce.









CHAPTER 2
METHOD S

Sampling

Swallow-tailed Kite nests were found in the southeastern United States, Guatemala, and

Brazil. Swallow-tailed Kites are secretive nesters, usually choosing sites high in trees in swamps

or near rivers. In Brazil, half of the nesting areas were discovered by following radio-tagged

migrants from North America. In Guatemala, I used a nest area previously discovered for

another study (Gerhardt et al. 2004). To extract blood from nestlings, I climbed nest trees with

climbing ropes and mechanical ascenders (pines and hardwoods) or slings (palm trees) (n=40). I

collected blood from three adults in Central and South America captured with a noose trap, and

from eight adults in the U.S., netted as they dove at tethered owls placed near their nests. In

cases where a nestling was found dead (n=3), skin, bone, or organ tissue was collected. In the

case where a nestling flew from the nest (n=1), or when a nest was in the egg stage (n=1),

feathers were removed from the nest. Organ tissue from two individuals that died near nesting

areas in Brazil and four feathers from under a roost of breeding birds in Guatemala were also

used (Appendix A describes sample origins). Researchers from South Carolina and Louisiana

donated additional fresh tissue samples from those states (n=8). To reduce the incidence of

sampling close relatives, I limited tissue collection in most cases to one breeding season per

nesting neighborhood.

I stored most blood, skin, organ tissue, and bone in lysis buffer (100mM Tris, 10mM

NaCL, 100 mM EDTA, 2% SDS) and dry feathers in plastic bags. Most samples were then kept

at 40C. A subset of these samples, collected in Brazil, was stored unrefrigerated for one year,

after which they were frozen.









To fill geographic gaps in sampling I requested tissue of Swallow-tailed Kite museum

specimens (usually skin from toe pads) from various museums (n=73, Appendix A). In addition

to specimens with labels that suggested breeding activity or recent birth, I selected specimens

collected at places and times when the presence of migrants was unlikely based on knowledge of

migration and wintering patterns of Swallow-tailed Kite populations. I relied on current

assumptions that all Swallow-tailed Kites leave their wintering areas to return to their breeding

grounds and that those breeding in Central America and Mexico have approximately the same

migration pattern as those breeding in the U.S. (Robertson 1988, Meyer 1995).

Most museum specimens collected in northern South America were collected at times

when breeders from southern South America may have been wintering there. To reduce the

likelihood of sampling these wintering birds, I restricted requests for tissue in northern South

America to Swallow-tailed Kites collected north of latitude 40N in non-mountainous regions, or

north of the equator in the Andes. Unless the specimen was accompanied by breeding

information, I labeled it as an "Unconfirmed Breeder" (n=40).

Two samples were requested from museums because of the interesting geographic

circumstances surrounding their collection. AL27 was collected in Alabama in April 1964

(AUNHMLC B-662) and thought by the collector to belong to subspecies E~Jf yetapa based on

its size, even though it was found in the U.S. (Skinner 1964). M52 was collected in Saltillo,

northern Mexico, in April 1908 with a set of eggs (MCZ 309708). Other than this collection

record, no other evidence exists for Swallow-tailed Kite nesting in this arid zone that lies within

the geographic gap in the breeding ranges of the two subspecies.

Samples from confirmed breeders are represented as squares and circles on the sample

map in Figure 3-1. Only the following types of Swallow-tailed Kites or Swallow-tailed Kite









tissue were considered to represent the breeding populations where they were sampled, and these

are henceforth referred to as Confirmed Breeders: 1. Adult Swallow-tailed Kite trapped near

nest; 2. Swallow-tailed Kite young in or under a nest; 3. Feather from nest; 4. Feather under roost

of birds breeding at that time in Guatemala; 5. Museum specimen adults collected in northern

South America Dec.1i-Jan 2, in Mexico and Guatemala April 1-May 25, and in Argentina

throughout May (since no Swallow-tailed Kites should be wintering/migrating in these places at

these times); 6. Museum specimens with label information indicating age under five weeks or

thickened skin on breast; and 7. Specimens with enlarged gonads or eggs present in oviduct

(gonad size compared to Swallow-tailed Kite specimens collected in Florida during breeding

season) .

Outgroups were chosen based on current understanding of relationships in Accipitridae

(Lerner and Mindell 2005). Pernis is considered to be a sister taxon to Elan2oides; however,

Elan2oides is apparently an old species and no genus thus far has been found to be closely related.

Sequences from Elanzus caeruleus and Ictinia mississippiensis were used to supplement Pernis

apivorus sequences as outgroups for some loci, and also in one locus where Pernis could not be

amplified.

Lab Techniques

Total genomic DNA was isolated from blood stored in lysis buffer and from dry feather-

shaft bases with the Qiagen DNeasy Kit protocol for animal tissues (Qiagen Inc., Valencia, CA).

I doubled the amount of proteinase-K suggested in the protocol and increased digestion times.

I attempted the following methods to isolate amplifiable DNA from degraded tissues such

as museum samples, feather shafts, and skin/organ tissue/bone collected from dead nestlings.

The Qiagen DNeasy kit (Qiagen Inc., Valencia, CA) did not perform well with these tissues,









although it did better than glassmilk purification from the Geneclean Kit for Ancient DNA

(Qbiogene, Inc., Carlsbad, CA). Geneclean rarely produced DNA, and only when the guanidine

dehybernation solution replaced the EDTA-based solution. Chelex 100 (Bio-rad, Richmond,

CA) performed well with feathers and slightly better than most other techniques with the tissues.

I tried Chelex 5%, 10%, and 20% solutions, with and without proteinase-K and/or a boiling step

(Walsh et al. 1991). A standard phenol chloroform extraction protocol with ethanol precipitation

was unsuccessful.

Maceration of tissue frozen with liquid nitrogen, changing the amounts of tissue, cleaning

bone surfaces with ethanol or UV light or by scraping, did not improve yields. An added

decalcification step for the bone (Thomas et al. 1990, Yang 1998 protocol minus the centricon

step) decreased yields, perhaps due to oxidation of the bone tissue. Soaking temperature for

bone was reduced to 40C as recommended by a user protocol for Isolation of Genomic DNA

from Compact Bone (protocol number DYO 1, Qiagen Inc., Valencia, CA), and ascorbic acid was

added to the solution to help decrease oxidation. However, yields remained poor.

The only method that provided consistent results required large amounts of proteinase k,

long digestion times, phenol chloroform extractions, and purification/concentration with

Centricon centrifugal filters (Millipore Corp., Billerica, MA). A basic protocol can be found in

Fleischer et al. 2000. Before protein digestion, I rinsed tissue and bone with buffer

(concentration 0. 1M EDTA, 0.05M NACL, 0.05M Tris, ph 8.0) to remove contaminating tissue

from other museum specimens or earth and microbes. Approximately 25 mg of tissue was then

minced with a razor blade, put into an o-ring screw top tube with 750 ul buffer, placed into

individual Erlenmeyer flasks, and gently shaken at 550C for two days. I changed the buffer on

the second day. This soaking step was intended to remove fixatives, storage solution, and excess









dark coloration that may have been protein, from the tissue. For protein digestions, final

extraction solution concentrations were: DTT 10mg/ml, SDS 1%, 0.2 mg/ml 0.5 mg/ml Pro K,

0.02M EDTA, 0.01M Tris, 0.01M NaCL. Samples were digested in 750 ul for two days. I

added an additional 0.4 mg of Proteinase K on the second day. Phase Lock Gel tubes

(Eppendorf, Hamburg, Germany) simplified phenol chloroform extractions by creating a barrier

at phase interface, so the aqueous portion could be easily poured into the centricon filters.

A few tissue samples had been previously stored in formalin. Two protocols to isolate

amplifiable DNA from these tissues were followed with no success (France et al. 1996

"Shiozawa" method, Qiagen DNeasy kit instructions for formalin fixed tissues Qiagen Inc.

Valencia, CA).

Isolated DNA was amplified through the polymerase chain reaction (PCR) on a Perkin

Elmer 9700 thermal cycler (Perkin Elmer, Wellesley, MA). PCR recipes and cycling parameters

are reported in Appendix B. For PCR of DNA from degraded tissues I added Amplitaq Gold

DNA Polymerase (Applied Biosystems, Foster City, CA) and BSA to reactions, lowered

standard TM by 1- 40C, and re-amplified one ul of the PCR product. Five micro liters of each

PCR reaction was electrophoresed on a 1.5 % agarose gel in lx TBE to confirm amplification.

Loci from both nuclear (nDNA) and mitochondrial (mtDNA) genomes were employed to

study the population structure of Swallow-tailed Kites. The use of multiple loci helps avoid the

problems inherent in relying on only one locus (Pamilo and Nei 1988, Slatkin and Maddison

1990, Palumbi and Baker 1994, Edwards and Beerli 2000), only the nuclear genome (Moore

1995, Poke et al. 2006), or only the mitochondrial genome (Wilson et al. 1985, Cronin 1993,

Hoelzer 1997, Ballard et al. 2004). Genes considered to be the most rapidly evolving, and thus

most variable, were chosen (Vigilant et al. 1991, Marshall and Baker 1997, Friesen 2000, and










Zhang and Hewitt 2003, but see Ruokonen et al. 2002). Except for cytochrome b (cytb), genes

used here are presumed to be selectively neutral (but see Zhang and Hewitt 2003, and Ballard et

al. 2004). Genetic regions assayed in this study and primers used to amplify them are listed in

Table 2-1.

I focused on the control region Domain I (CR), and to a lesser extent, cytb, in mtDNA.

Primers for a 550 base pair (bp) fragment on the 5' end of the CR were designed with Program

Primer v. 0.5 (Whitehead Institute for Biomedical Research) based on Norris- Caneda's sequence

published in Genbank, Accession Number AF438152. I developed additional primers to amplify

480 of those 550 bp and a 150 bp fragment in the most variable part of the Swallow-tailed Kite

Domain I for use with degraded DNA. Cytb primers were taken from Sorenson et al. (1999).

I tried to amplify nine nDNA loci, each of which included intronic regions, using primers

from the literature: 1. Aldolase Intron G (Lessa and Applebaum 1993); 2. Glyceraldehyde-3-

phosphate dehydrogenase exon 11- exon 12 (Friesen et al. 1997); 3. Myelin proteolipid protein

exon 4- exon 5 (Friesen et al. 1999); 4. Intron P3 (primers P8 & P2, Griffiths et al. 1998); 5.

Lamin A exon 3- exon 4 (Friesen et al. 1997); 6. Alpha-enolase exon 8- exon 9 (Friesen et al.

1997); 7. Ornithine Decarboxylase exon 6- exon 8 (Friesen et al. 1999); 8. Lactate

Dehydrogenase b exon 3- exon 4 (Friesen et al. 1999); and 9. Aldolase B exon 3- exon 5 (Friesen

et al. 1997). The first two loci did not amplify in initial screening. The third gave multiple

products. I amplified 400 bp in the fourth, but chose to focus on only the last five nDNA regions

listed above and named them LAM, ENOL, ORN, LDH, and ALD, respectively.

ORN, LDH, and ALD fragments initially generated were over 700bp. I designed

alternative reverse primers to decrease fragment size, and named the resulting loci: ORN2,

LDH2, and ALD2. Sequences for all nDNA loci used (LAM, ENOL, ORN2, LDH2, and










ALD2), were run through the BLAST search engine on Genbank to confirm genetic region

(Table 2-1 lists regions). Expected matches resulted except in the case of ALD2, for which no

homologous gene was found. Since the forward ALD2 primer blasts to the latter portion of exon

3, and the latter portion of the longer ALD fragment blasted with aldolase B exon 4, I believe

that ALD2, which encompasses the first two thirds of the ALD fragment, includes intron 3 of

aldolase B.

Outgroups were amplified in all loci analyzed except LAM and ALD2. Primers were the

same as those for the Swallow-tailed Kite. I also obtained cytb sequences for Pernis from

Genbank, Accession Numbers AY987242 and X86758.

Resolving Genetic Variation

Denaturing gradient gel electrophoresis (DGGE) (Lessa and Applebaum 1993) facilitated

screening of nDNA fragments for variation. Samples were run at 600C and 150 volts, on gels

with an acrylamide concentration of 6.5% and a ratio of acrylamide:bisacryalmide of 37.5:1.

Time, urea concentration, and formamide concentration varied by locus. LDH2 and ALD2

showed no variation with DGGE and so were treated like mtDNA loci and sequenced as below.

LAM and ENOL gels started at 2.65M Urea and 16% formamide concentrations. ORN2 gels

started at OM Urea and 0% formamide. All three gels went up to a concentration of 5.6M Urea

and 32% formamide. Electrophoresis times for LAM, ENOL, and ORN2 were eight, four, and

fiye hours respectively.

At least one example of each band produced at each locus was excised from the

polyacrylamide gel, cleaned according to Qiagen user protocol number QQ05, (Qiagen Inc.,

Valencia, CA)), and sequenced. In one case where a band was found to represent two alleles, I

sequenced all individuals expressing that band. At least six examples of the most common









bands, and samples with unclear banding patterns, were also sequenced to confirm that DGGE

was detecting all variation. DGGE data were treated like sequences in analyses. The number of

samples evaluated with DGGE is listed in Table 2-1.

Final PCR amplifications were purified with a QIAquick PCR Purification Kit according

to the manufacturer' s instructions (Qiagen Inc., Valencia, CA) except when amplifications

resulted in double banded products. In those cases, the targeted band was excised from an

agarose gel and purified with a Qiagen Gel Extraction Kit per manufacturer' s instructions

(Qiagen Inc., Valencia, CA). Purified products were then cycle sequenced with an ABI Big Dye

Terminator Kit and sequenced on an ABI377 according to manufacturers instructions (Applied

Biosystems, Foster City, CA). I sequenced both strands of DNA when base calls were not clear

on one strand.

Chromatograms were viewed with the Chromas IVFC Application v. 2.3.0 (Technelysium

Pty Ltd, 2000) and corrected by eye. I identified double peaks in nDNA chromatograms and

translated them into heterozygous sequences. When more than one double peak was found in a

sequence, known homozygous sequences at the same locus and the program PHASE (Stephens

et al. 2001) were used to infer haplotypes. Ingroup sequences were aligned by eye in Bioedit

v.7.0.0 (Hall, 1999). CLUSTALW (Thompson et al. 1994) embedded in Bioedit aligned

outgroups with the Swallow-tailed Kite in the CR. The number of samples and bp sequenced for

each locus is reported in Table 2-1.

To guard against false data, several precautions were taken. To avoid contamination of

one sample by other samples, I used filtered pipette tips, pre- and post-PCR equipment, and

negative amplification controls (water replaced template) during all lab work. When working

with degraded DNA, I changed gloves and implements between each sample for isolation and









PCR. Sterile reagents were purchased and daily cleansed of DNA with UV light, along with

other re-usable products and equipment. I cleaned bench tops and equipment with sodium

hypochloride bleach weekly. Negative extraction controls were made during DNA isolation,

amplified along with DNA, and sequenced. When a negative control was positive, DNA was re-

isolated and re-amplified. If the negative control was still positive as occurred in one instance,

the negative control sequence was compared to all sequences generated and similar ones were

excluded from analysis.

To eliminate the possibility of mtDNA PCR products being derived from nuclear

pseudogenes, or N~UMTs (Lopez et al. 1994), precautions were taken as follows: sequences were

compared to those based on DNA from liver tissue, a mitochondrial-rich tissue; PCR products

were generated by different primers and overlapping sequences compared; PCR-based

sequencing was checked for the presence of double peaks; and protein-coding gene sequences

were analyzed for stop codons and indels.

Finally, sequences based on single amplification of a recently-collected museum tissue

were compared to those based on double amplifications of the same tissue, to ensure that

sequences did not change as result of double amplification.

Morphological Techniques

I measured unflattened wing chord and tail on live and specimen kites (Appendix C).

Only measurements of birds in definitive plumage from known Genetic Population were used in

analyses (Appendix A). Definitive plumage is found in Swallow-tailed Kites older than

approximately 14 months of age and can be distinguished from immature plumage in two ways.

It is characterized by a long tail and lacks white or buffy margins on the trailing edges (friction

zones) of body or wing feathers, viewed dorsally. I found pre-adult tail lengths to be on average









18% shorter than adults' and always under 275mm in dried specimens (n=9). In cases where

museums provided measurements, I did not include any specimens with tails shorter than

275mm, unless the museum re-verified absence of molt and white margins on feathers. I limited

analyses to non-molting birds except in one case where a tail measurement was included from a

specimen that had molt in the wings, but not in the tail. To compensate for specimen shrinkage

(Winker 2003), I calculated coefficients (1.091 for tail, 1.012 for wing) to convert dry tissue

measurements to fresh tissue measurements. The coefficient was based on comparisons between

measurements made when specimens were collected, and once specimens were dried.

I assessed amount of purple and green iridescence on shoulder scapulars by eye in many

of the same individuals used for measurements (Appendix C). An additional Eive individuals,

not used for measurements because they appeared to be one year of age or molting, were used in

comparisons of iridescence since coloration in their plumage was developed.

Analysis

Sequence and genotype data were partitioned in multiple ways for analysis. Datasets

differed as to locus used and individuals sampled. Sample inclusion in datasets is detailed in

Appendix A. The ten datasets were as follows (note: samples sizes do not include outgroups,

and data from individuals known to be related were never included within the same dataset): 1.

LAM (n=51, 233bp); 2. ENOL (n=54, 323bp); 3. ORN2 (n=70, 285bp); 4. LDH2 (n=26, 406bp);

5. ALD2 (n=40, 496bp); 6. CR Breeder Long (n=57, 372bp) consisted of all CR sequences

longer than 372 bp from confirmed breeders; 7. CR Breeder Short (n=99, 134bp) consisted of all

CR sequences from confirmed breeders; 8. CR All Short (n=137, 134bp) consisted of all CR

sequences; 9. Cytb (n=11, 520bp) consisted of cytb sequences from a subset of the individuals

sequenced in the CR, with at least three individuals from each Biological Population; 10.









Morphological (n=48 for measurements, n=27 for iridescence) consisted of samples as described

in the morphology section above.

Descriptive statistics including number of variable sites, number of alleles, and number of

transversions, transitions, and gaps were calculated manually for each locus. Observed

heterozygosity (Ho) was calculated manually by dividing the number of heterozygous

individuals by the total number of individuals sampled, averaged over all nDNA datasets.

Expected heterozygosity (He) was calculated manually by subtracting the sum of squared allele

frequencies from one, averaged over all nDNA datasets. Overall haplotypic diversity was

calculated for the CR Breeder Long dataset using Arlequin v. 2.000 (Swofford 1998).

I used analysis of molecular variance (AMOVA, Excoffler et al. 1992) as implemented

within Arlequin v. 2.000 to test the hypothesis that genetic differentiation reflects the existence

of the Northern, Central, and Southern Biological Populations. Arlequin calculated Fst using the

estimator of Weir and Cockerham (1984). Each allele from the CR Breeder Long dataset was

designated "North," "South," or "Central," according to the collection location of the sample

relative to the hypothesized population boundaries (designations recorded in Appendix A). Each

AMOVA was based on 1023 permutations.

Phylogenetic structure in the global Swallow-tailed Kite population was assessed with

maximum likelihood (ML) and neighbor j oining (NJ) phylogenetic analyses in PAUP* 4.04b

(Swofford 1998). Likelihood-ratios were used to determine the model of nucleotide evolution

that best fit the data when generating the ML tree. I started with the most complex model

(general-time-reversible with gamma-distributed rate variation estimating the proportion of

variable sites), calculated the likelihood of the data given this model, and then compared the

likelihood ratios from increasingly simpler models. The best model of evolution was the general-









time-reversible + invariable sites (0.44) (GTR + I). Inclusion of indels as variable sites did not

affect results, therefore I did not consider them. ML analyses were performed with a heuristic

search with 10 random additi on sequences and tree-bi secti on-reconnecti on algorithm s (TBR).

For the NJ analyses, I calculated distance with the Jukes-Cantor model of evolution to correct for

multiple hits. NJ trees were topologically similar to the ML tree, so the NJ tree was used for all

further analyses in order to minimize computational time during bootstrapping. Bootstrap

resampling with 1000 replicates determined the degree of support for each node in the NJ tree

and support values were calculated from a 70% maj ority-rule consensus tree.

I built the first tree based on all sequences available to help assess relationships between

the largest number of CR haplotypes (dataset CR All Short, 134bp, n=137). Then, to evaluate

phylogeography, I restricted the tree only to sequences from samples collected that I considered

representative of breeding populations from which they were collected (dataset CR Breeder

Short, 134bp, n=99). Finally, I built a tree based on 372bp sequences from Swallow-tailed Kites

known to belong to the breeding populations where they were sampled to take advantage of

increased phylogenetic information in the longer sequences (dataset CR Breeder Long, n=57).

Clades from the CR phylogenetic trees are henceforth called Northern, Central, and Southern

Clades, depending on geographic origin of the maj ority of samples in the clade. Appendix A

details clade membership.

To test for differences in relative clade ages, I estimated the time to most recent common

ancestor in coalescent units (TMRCA) for each clade with the coalescent-based software

Genetree (http://www.maths.monash. edu.au/~ mbahlo /mpg/gtree.html, Griffiths and Tavare

1994). Cytb was used for this analysis because it has fewer indels than the CR and a more

uniform and better understood mutation rate. I pruned the cytb dataset to eliminate homoplasy,









as required under the infinite alleles model utilized in Genetree. I estimated TMRCA for the

pruned tree, using the distribution of mutations on the genealogy to determine the most likely

value of 9, equal to 2NfCL for mitochondrial loci, where Nf is the effective population size of

females, and CL represents the mutation rate per gene per generation. TMRCA was estimated with

CL reflecting both the low (1.0% sequence divergence/ma) and high (2.0% sequence

divergence/ma) end of the range of estimates of the rate of pairwise sequence divergence in

avian cytb (Lovette 2004, Helbig et al. 2005, Pereira & Baker 2006). After estimating 9 (8.95),

I ran one million simulations of the coalescent process to obtain an estimate for TMRCA and SD

in coalescent units. Using equation t (years) = TMRCA x NfCgg and g = 6.33 years (generation

time), I calculated t for the mutation predating the origin of the clade to provide an upper limit

for divergence time and t for the oldest mutation within a clade to set a lower limit for

divergence time. Thus, I was able to "bracket" the actual clade origin between two mutations.

To compare clades I used the CR Breeder Long dataset to estimate the following:

nucleotide diversity (7n); the total number of polymorphic sites not including indels (S);

haplotype diversity (h); theta (Ox) estimated from the infinite site equilibrium relationship

between the mean number of pairwise differences (2) and theta (E(xn)= 9); and Tajima' s Test of

Selective Neutrality (D) in each clade; and average pairwise distance between clades. The

Tamura-Nei model of nucleotide substitution (Tamura and Nei 1993) as applied within Arlequin

v. 2.000 was used for these analyses. This model was chosen because it best represented the

model selected for ML analysis (GTR + I). Allele frequencies for each nDNA dataset, and Ho

and He averaged over all nDNA datasets, were also calculated for each clade.

By plotting the geographic origin of samples used to build the CR Breeder gene trees, and

coding each sample location by clade, I divided global Swallow-tailed Kite breeding populations









into three regions (see shading on map in Figure 3-1). Each region reflects the maj ority of

haplotypes found there. Samples contained within each of the three regions correspond to

samples contained within the Northern, Central, and Southern Clades in all but one instance. I

refer to these regions as Northern, Central, and Southern Genetic Populations.

Within each Genetic Population, samples with CR Breeder Long haplotypes were

assigned to subpopulations. Subpopulations were designed so that each sample could be

included in a group located within 70 km of sample origin. See sample assignments to Genetic

Population and subpopulation in Appendix A, and subpopulation locations on the map in Figure

3-2. The phylogeographic structure within each Genetic Population was evaluated with a

hierarchical AMOVA.

To test for subdivision within clades based on genealogical relationships between

haplotypes, I used the software TCS (Clement et al. 2000) to create haplotype networks based on

the CR Breeder Long dataset. Unlike traditional phylogenetic reconstruction methods, TCS

explicitly accounts for population-level phenomena such as recombination and the presence of

extant ancestral haplotypes, which is critical when considering intraspecific genealogies

(Clement et al. 2000). Uncorrected pairwise divergence between all haplotypes were calculated

in Arlequin and entered into TCS. TCS requires that the distance matrix be composed of the

number of mutations separating each pair of haplotypes, meaning that multiple mutations at

single sites will necessarily go uncorrected. Haplotypes on the networks were assigned to

geographic subpopulations as described above, to allow for phylogeographic inference.

I also examined the spatial organization of haplotypes by applying the program

Geneland (http:// www.inapg.inra.fr/ens~rech/ mathinfo/personnel/guillot/Geneland.html, G.

Guillot et al. 2005) to the CR Breeder Short dataset. The CR Breeder Short dataset (all of the










samples shown on map in Figure 3-1), is the largest and geographically best distributed dataset

from confirmed breeders. Collection sites for each sample were assigned coordinates using a

world atlas. Geneland tests for population structure corresponding to geography within clades by

trying to j oin geographically contiguous individuals into separate populations based on similarity

of haplotype frequency. Geneland identifies spatial groups of haplotypes a posteriori, treating all

unknown variables (e.g. number of populations, allele frequencies, population membership) as

random variables, and estimates them using Markov-Chain Monte Carlo simulation. The

program estimates the number of populations in the dataset, the population membership, and

produces a map of locations.

Pairwise mismatch distributions for each clade were calculated to test for sudden

population expansion (Schneider and Excoffier 1999) by estimating tau (z ) with Arlequin v.

2.000 in the CR Breeder Long dataset. z can be used to calculate time since clade expansion

because z = 2ut, where u = the mutation rate/genome/generation, and t = generations since

expansion of the clade. To span the range of current nucleotide substitution rate estimates in

domain I of the avian mitochondrial CR, I used a u corresponding to a mutation rate of 5% and

of 15% per ma (but see Pereira 2004).

I considered, but did not entirely base mutation rate range on, the estimate by Quinn

(1992) of Domain I mutation rate in geese (20.8% per ma). This rate, or derivations of it, is

popular. However, concerns have been raised recently about the original figure upon which

Quinn's rate is based (Pereira 2006). Independent calculations of the avian CR mutation rate are

rare. Other rates to consider include 7.23 +/- 1.58% per ma for the entire CR (Drovetski 2003)

and 7.3% per ma for Domains I and III (Buehler and Baker 2005). I considered rates for the CR

as a whole, even though Domain I is one of the most variable regions, because approximately









20% of the CR Breeder Long CR fragment is Domain II, one of the more conserved regions

(Baker and Marshall 1997). Finally, I also considered a CR mutation rate based on variation

found in Swallow-tailed Kite cytb, following the reasoning of Quinn (1992). Since the Swallow-

tailed Kite CR fragment varied approximately six times more than the Swallow-tailed Kite Cytb

fragment (see Results section), I calculated a CR mutation rate of 6%-12% per ma by

multiplying estimates of avian cytb mutation rates by six (see cytb rate description earlier).

Correspondence between wing or tail morphology and Swallow-tailed Kite group was

investigated using two way analysis of variance (ANOVA). Tail and wing length were response

variables, and group and sex were independent variables. Male and female measurements were

analyzed separately in case sexual dimorphism affected lengths. Analyses were run with group

defined in three different ways. 1. Genetic Population; 2. subspecies; and 3. region. Regions

included the U.S. (N); Central America (CA); South America north of the Pantanal (nSA); and

south of the Pantanal (sSA). I determined Genetic Population membership for samples using

CR haplotype or label information. The latter was used when I had no genetic information. In

those cases, the Swallow-tailed Kite was either found in the U.S. (Northern Genetic Population),

or, southern Brazil (Southern Genetic Population) with a formed egg in her oviduct. Members of

the Northern Genetic Population were considered to represent subspecies E~f forficatus, and

members of the Central and Southern Genetic Populations were considered to belong to

subspecies E~Jf yetapa. Samples were assigned to the N and sSA regions based on affiliation

with the Northern, and Southern Genetic Populations, respectively. Individuals with Central

Genetic Population haplotypes were assigned to either the CA or nSA region using collection

location, date, and accompanying breeding information (if any).










Table 2-1. Description of genetic regions amplified and associated primers
Label Genetic region Forward primer 5'-3' Reverse primer 5'-3' # Base # Individuals***
pairs sequence\DGGE
amplified
Cytb Cytochrome b Cytb L15517 Thr H16064 620 11\0 n=11


CRdbox Control Region
early Domain I
through Dbox in
early Domain II

CRpre- Control Region
dbox early Domain I
through Fbox in
early Domain II
CRshort Control Region
Central Domain



LAM Lamin A (Exon
3- Exon 4)

ORN Ornithine
Decarboxylase
Long (Exon 6-
Exon 8)


Glu STKI L1
"CCAAGACCCCCGACCT
GAAAA"


Glu STKI L1
"CCAAGACCCCCGACCT
GAAAA"


CRshort 1F
"TGYATGTACTGTGTCC
ATTACA"


DboxH
"CGCCTCTGGTTCCTTTTTCAGG "


n/a **


Pre-DboxH
"CCTGAAGCTAGTAACGCAGGATCT"



CR short 4R
"CCAAGAATATCCGWAGGGT"


61\0 n= 61
(includes CRdbox
samples)

141\0 n=141
(includes CRpre-
dbox & CRdbox
samples)
6\53 n= 53


n/a


LamL724


LamH892


ODF


ODR










Table 2-1. Continued
Label Genetic region Forward primer 5'-3' Reverse primer 5'-3' # Base # Individuals***
pairs sequence\DGGE
amplified
ORN2 Ornithine ODF Orn R-2 300 33\50 n= 75


Decarboxdlase
Short (Exon 6-
Exon 7)


"CACAGCGGGCATCAGAAATG"


ENOL Alpha-enolase
gene (Exon 8-
Exon 9)

LDH Lactate
Dehydrogenase
b Long (Exon 3-
Exon4)
LDH2 Lactate
Dehydrogenase
b Short (Intron


ALD Aldolase B Long
(Exon 3 Exon


ALD2 Aldolase B Short
(Intron 3)


EnolL 731


EnolH 912


400


16\55 n= 55



n/a


LDH-BF


LDH-B R


LDH-BF


LDH-B R-2
"TTATGAGTAGCTTCTCCACTGTGCC"


28\0 n= 28


AldL200


AldH283


n/a



42\0 n= 42


AldL200


AldH-2
"CCC TGC TAG GGG TGC TGT GC"


A subset of this data was used in analyses. Primers without sequence shown were taken from the literature,
CRpre-dbox dataset to make "CR Long" and "CR Short." *** Does not include outgroup sequences


citation in text. ** Data added to









CHAPTER 3
RESULTS

Descriptive Statistics by Locus

MtDNA loci were highly variable and were not very similar to other falconiform

sequences on Genbank. Variation in the longer CR fragment (372bp sequences from CRpredbox

and CRdbox) included 73 transitions, two transversions, two indels, three sites with both

transitions and transversions, and one with both a transition and indel, resulting in 40 distinct

haplotypes. Uncorrected sequence differences ranged from 0.3%- 11.3% between haplotypes,

with some individuals sharing haplotypes. Haplotype diversity was 0.9793 +/- 0.0088 SE. The

shorter segment of the CR, locus CRshort, captured much of the same variation (42 transitions,

two transversions, one indel, two sites with transition/transversion, one site with transition/indel)

and an additional variable site (indel/transition) due to increased sample size. CRshort exhibited

51 haplotypes. Uncorrected sequence differences ranged from 0.8%- 20.0% between haplotypes,

with some individuals sharing haplotypes. Variation between individuals in the Cytb locus

included 17 transitions and two transversions, resulting in seven distinct haplotypes.

Uncorrected sequence differences ranged from 0.2%- 2.9% between haplotypes, with some

individuals sharing haplotypes.

The nuclear loci were less variable. Overall Ho and He were 0.284 and 0.43 respectively.

DGGE demonstrated that in the LAM locus, all individuals except for two were homozygous for

the same band/allele. The two heterozygous individuals shared an additional band/allele

(Ho=0.039, He=0.038). I found three bands in ENOL. The fast and middle bands represented

one allele each, while the slow band represented two potential alleles. Most individuals (n= 50)

were homozygous for the middle band/allele while the rest displayed two bands (n= 5)










(Ho=0.093, He=0.124). The three variable sites in ENOL, and the one variable site in LAM,

were transitions.

Two bands, each representing one allele varying by a transversion, were found in DGGE

analysis of the ORN2 locus. All individuals were homozygous for one of those bands/alleles in

DGGE (n= 50); however, sequence data for unresolved and additional samples (n= 25) revealed

three more alleles, each of which was expressed in one individual heterozygous for the private

allele and one of the primary alleles seen in DGGE (Ho=0.043, He=0.52). The variable sites

distinguishing the private alleles were two transitions and a transversion.

In ALD2, two transitions and three transversions resulted in five alleles. Each allele was

demonstrated by at least five individuals. Heterozygous individuals displayed one double peak

on chromatograms (Ho=0.475, He=0.688). LDH2 produced eight alleles based on five

transitions and one transversion. Three alleles were not demonstrated by more than one

individual. Heterozygous individuals displayed up to three double peaks on chromatograms

(Ho=0.769, He=0.79).

While the 19 variable sites were spread relatively equally throughout the Cytb fragment,

60% of the 81 variable sites in the longer CR fragment were concentrated in the first half of the

CR Domain I. Only two variable sites were found in the small portion of Domain II

(approximately 60 bp) amplified. All variable sites found in nDNA loci were located within the

intronic portions except in the case of ORN2 where the three variable sites that defined private

alleles were found in adj acent exons. Every haplotype found in this study has been placed on

Genbank under Accession #s: EU012028-EU012134 (Appendix A).









Swallow-Tailed Kite Phylogeography Based on mtDNA

I found strong population structure in Swallow-tailed Kites. An AMOVA of the

Northern, Central and Southemn Biological Populations yielded a Fst of 0.71, p= 0.00, where the

maj ority of genetic variation occurred among, rather than within, the populations. Phylogenetic

analyses also demonstrated population structure. Gene trees based on datasets CR All Short, CR

Breeder Short, and CR Breeder Long, all described three clades in an unresolved polytomy

(Figure 3-1, Appendix D). The clades had high bootstrap support and long branches, but

branches within each clade were short and showed little genetic structure. A NJ tree based on

the Cytb dataset exhibited similar topology to the CR trees (unpubl. data), but showed the

Central Clade as basal with low bootstrap support, suggesting the possibility that the unresolved

polytomy could be resolved with increased sample size at the cytb locus.

Phylogeographic inferences can be made based on the phylogenetic trees built with

samples representative of breeding populations where collected (CR Breeder Long and Short).

Each clade appears to correspond to a distinct portion of the Swallow-tailed Kite breeding range

that I refer to as Northern, Central, and Southern Genetic Populations (Figure 3-1). The

Northern Genetic and Biological Populations are congruent with E~f forJicatus. The Central and

Southern Genetic Populations differ from the hypothesized Biological Populations. The Central

Genetic Population covers a wider latitudinal range than expected, stretching from southern

Mexico to the northern boundary of the Pantanal in Brazil (160S) and the Southemn Genetic

Population covers a much shorter latitudinal range than expected, ranging from near the southern

boundary of the Pantanal (210S) to northwestern Argentina and southeastern Brazil (280S).

It is interesting to note the location of a few samples on the gene trees. Museum sample

AL27, collected in Alabama and labeled E. f: yetapa by the collector, was found in the Northern









Clade with other samples from the U.S. Another museum sample, M52, collected in northern

Mexico (equidistant from the Northern and Central Genetic Populations) was found in the

Central Clade along with the samples from southern Mexico. Because the area where M52 was

collected is not known to harbor breeding Swallow-tailed Kites, I did not include that zone in the

map of Genetic Population ranges (Figure 3-1). Finally, one incident of recent gene flow is

observed. A nestling (B5-00) sampled on the southern border of the Pantanal in the Southern

Genetic Population range, expressed a haplotype found otherwise only in the Central Genetic

Population. On the CR ALL Short tree, some samples (n=9) from museums, collected in far

northern South America and Central America, exhibited haplotypes normally seen in samples

from southern South America.

Swallow-Tailed Kite Phylogeography Based on nDNA

The Northern Genetic Population was distinguished from the other Genetic Populations

in the ORN2 and ALD2 loci where no alleles were shared (Figure 3-1). The Central and

Southern Genetic Populations were not similarly distinguished from each other as they always

shared at least one allele. However, allele frequencies varied between them and each population

had at least one endemic allele. The Central Genetic Population had two endemic alleles in

LDH2 and one in ENOL. The Southern Genetic Population had one endemic allele in ORN2.

I compared Swallow-tailed Kite and outgroup sequences in the three nDNA loci that had

outgroup sequences. In ENOL and ORN2 loci, outgroups were more similar to haplotypes

endemic to Central and Southern Genetic Populations. In the LDH2 locus, outgroups were

equally similar to all populations.

In general, the nuclear haplotypes that were unique to one or two Genetic Populations

varied at sites where I observed individuals to be homozygous. The nuclear haplotypes that









varied within Genetic Populations usually varied at the sites causing individuals to be

heterozygous. This suggests that the nDNA mutations I saw varying within individuals are

younger than those I saw varying among populations.

Differences between Populations as Defined A Posteriori

I found clades, as defined by the gene trees, to have diverged significantly from one

another. Corrected average pairwise distances in the CR between clades were as follows:

Northern versus Central = 9% (2.6% uncorrected in cytb); Northern versus Southern = 7.9%

(2.2% uncorrected in cytb); and Central versus Southern = 6.5% (2.3% uncorrected in cytb).

Averaging these values for each clade, the Northern Clade appears to be the most divergent

(Table 3-1).

The Northern Clade also appears to be the youngest, with the most recent sudden

population expansion, while the Central Clade appears be the oldest with the least recent sudden

population expansion (Table 3-1, Table 3-2). Genetree analyses indicated that clades have been

separated for a long time. The TMRCA in coalescent units bracketing the origin of the Northern

Clade equaled 0.09 (+/- 0.09 SD) 0.45 (+/- 0.24 SD), of the Southern Clade equaled 0.58 (+/-

0.21 SD) 0.86 (+/-0.24 SD), and of the Central Clade equaled 0.6 (+/- 0.2 SD) 0.86 (+/- 0.24

SD). Mismatch distributions were unimodal (graphs not shown) and suggested that all clades'

population sizes expanded suddenly within the past 43,000 years, some perhaps as recently as

2,889 years ago (Table 3-2).

Ranges of wing and tail measurements overlapped for all groups (Table 3-3). In a Two

Way ANOVA, no interaction between group and sex was detected for either tail or wing. Wing

lengths significantly differed between clades (f=4.8 df=2,40 p=0.013), subspecies (f=6.2 df=1,42

p=0.017), and region (f-5.9 df=3,38 p=0.0002). Tail lengths were only significantly different










between regions (f=4.1 df=3,40 p=0.013). Significance in all cases was due to longer lengths in

groups located farther north. Sexual dimorphism in the wing was not significant, however it was

in the tail. On average, females had longer tails across clades (f=5.6 df=1,42 p=0.02), subspecies

(f=5.23 df=1,44 p=0.03), and region (f=4.6 df=1,40 p=0.04).

Iridescence appeared to be strongly purple in the Northern Genetic Population (n=12) and

purple, usually mixed with green, in the Southern Genetic Population (n=7). Individuals

surveyed from the Central Genetic Population (n=8) were mostly those breeding in Central

America (n=6), and these Central American samples exhibited only green iridescence. Of the

other two samples from the Central Genetic Population, both collected in northern South

America, one showed green iridescence and the other purple and green. The general pattern

implied is one where purple iridescence is strongest at the extremes of the Swallow-tailed Kite

range, and green iridescence is more prominent toward the center of the range.

Structure within Clade/Genetic Population

He and Ho were similar within each clade, suggesting random mating throughout each.

Although the amount of genetic variation within each clade or Genetic Population does not

appear to be low, I discovered very little genetic structure, and no phylogeographic structure in

the data. As reported above, the gene trees showed very little genetic structure within each

clade. When the gene tree and haplotype network nodes were coded by sample location within

each clade, no geographic patterns emerged. The program Geneland also found no significant

geographic structure in haplotype frequencies. A hierarchical AMOVA reported less than 6% of

genetic variation was held between subpopulations in each Genetic Population. Figure 3-2

presents AMOVA results for each Genetic Population, a haplotype network for each clade, and

the CR Breeder Long NJ tree separated by clade.










Table 3-1. Descriptive statistics for each mitochondrial clade
Clade S Un +/- SD h +/- SE Oxn +/- SD D % Ho/He TMRCA in years
Divergence
Northern 21 0.0098 +/- 0.0056 0.9462 +/- 0.0198 3.6 +/- 2.09 -1.00075 8.4 0.22/0. 18 71,840 -1,116,881
p=0.168 (+/- 71,840 SD) (+/- 595,670 SD)
Central 32 0.02 +/- 0.01126 1 +/- 0.0302 7.29 +/- 4.1 -1.13459 7.7 0.36/0.32 323,784 -1,780,535
p=0.14 (+/- 107,928 SD) (+/- 496,893 SD)
Southern 14 0.0119 +/- 0.0073 0.9722 +/- 0.0640 4.48 +/- 2.76 -0.65849 7.2 0.31/0.32 294,454 -1,780,535
p=0.291 (+/- 106,613 SD) (+/- 496,893 SD)
Statistics are based on CR Breeder Long dataset except: TMRCA in years (cytb dataset) and Ho/He (nDNA datasets). % Divergence is
the average of the two pairwise average distances presented in the text that were calculated for each clade. All analyses described in
text.


Northern 4.062 (2.04-5.49) 5,753.54 (2889.52-7776.2) 17,358.97 (8717.95-23461.54)

Central 7.574 (4.97-9.79) 10,728 (7039.66-13866.86) 32,367.52 (21239.32-42606.84)

Southern 5.44 (2.58-7.6) 7,705.38 (3654.39-10764.87) 23,247.86 (11025.64-32478.63)
3.53 x 1 0-4/gene/generation and 1.17 x 1 0-4/gene/generation correspond to mutation rates of 5% and of 15% per ma respectively.


Table 3-2. Mismatch distribution data
Clade z (CI)


Years since expansion (CI)
u= 3.53 x 10-4 /gene/generation


Years since expansion (CI)
u= 1.17x 10-4 /gene/generation










Table 3-3. Comparison of measurements between groups of Swallow-tailed kites
Group Female tail Male tail range Female wing chord Male wing chord
range (avg.) in mm (avg.) in mm range (avg.) in mm range (avg.) in mm
(n=26) (n=22) (n=25) (n=21)
Northern Genetic Population//
311-382 (343) 306-360 (333) 411-455 (435) 404-446 (428)
Ef ~forJicatus (n=20)
Central Genetic Population (n=20) 312-364 (340) 278-359 (325) 403-439 (424) 405-443 (424)
Southern Genetic Population (n=8) 316-353 (335) 278-327 (307) 385-440 (417) 394-416 (407)
EfJ yetapa (n=28) 312-364 (338) 278-359 (321) 385-440 (422) 394-443 (420)
Central America (n=12) 322-364 (348) 314-359 (338) 417-439 (427) 427-443 (434)
EfJ yetapa data is the combination of Central and Southern Genetic Population measurements. Central America data represents one
portion of the Central Genetic Population measurements. Data correspond to measurements taken from or converted into those of
fresh tissue.









Allele Frequencies in
Nuclear Introns


12345
North








Centrhal


00)





South~


Control Re~gion


Samplle~s &
Genetic Popula~tions


Fatanal


0 500 1000)
kilomneters


re 3005


subisite


outgroup


outgroup










Figure 3-1.


Molecular data as it relates to geography. NJ gene tree based on CR Breeder
Long dataset. Bootstrap values shown only for main nodes. Samples yielding at
least 370 bp in CR are depicted by squares on map and gene tree. Samples
yielding 134 bp in CR depicted as circles on map. A NJ tree (134 bp, not
displayed) built using all samples presented on map resulted in a very similar tree
topology as one shown. Samples collected within approx. 50 km from each other
are represented by one, or a few joined, symbols on map. Number next to sample
marker indicates number, if greater than 1, samples collected in one location.
Map shading of Genetic Populations based on CR gene trees, and known breeding
distribution. Sample sizes as follows: For CR tree- Northern region 35; Central
region 12; Southern region 10. For Nuclear Introns- 1 (LAM): 51; 2 (ORN2): 71;
3 (ALD2): 40; 4 (ENOL): 54; 5 (LDH2): 26.










-CD
-DH
-CDF
7r4DH


--D
-E
-Ee
-CH
--B
-AH

- F


Fst = -0.05104, p = 0.84848















Fst = 0.05979, p = 0.17204


U
Pantamal


so Z

Ys X

Z
-XZ


W X


0 5m 10U
kilometers



Figure 3-2.


Fst = -0.00058, p = 0.55914


Phylogeographic structure within clades or genetic populations. AMOVA Fst for
each Genetic Population, NJ tree and TCS Haplotype Network presented by
clade, with sample locations indicated on map. Each unbroken line on network
represents one nucleotide difference between haplotypes. The haplotype with the
highest outgroup probability is displayed as a square, while other haplotypes are
displayed as ovals. The size of the square or oval corresponds to the haplotype
frequency. Letters represent subpopulations as described in text. Letters A-H, M-
U, and W-Z belong to North, Central, and Southern Genetic Populations
respectively. Due to sample size issues, I added these subpopulations together:
A+B; T+U; W+X; Y+Z, for the AMOVA performed on Genetic Populations.









CHAPTER 4
DISCUSSION

Subdivision/Gene Flow: Between Populations

Interaction among Swallow-tailed Kite populations as well as the species' rather

homogeneous morphology has until now obscured deep subdivision in this group. Phylogenetic

trees based on mtDNA show three geographically coherent clades, suggesting that three global

populations exist in this species (Figure 3-1). Populations are located in 1. southeastern U.S.; 2.

southern Mexico to central Brazil; 3. central Brazil to the southern end of range. I hereafter refer

to these as Genetic Populations (Northern, Central, and Southern) in contrast to the predicted

Biological Populations. I therefore rej ect hypotheses predicting panmixia or population divisions

based on a restricted gene flow near the equator.

An AMOVA of mtDNA found that over 70% of genetic variation in Swallow-tailed Kites

is explained by Biological Populations. Most of the remaining variation occurs within the

Southern Biological Population. This probably results from a cryptic barrier to gene flow within

the Southemn Biological Population. According to phylogenetic trees, gene flow is restricted near

the Pantanal (between 160S and 200S ), not where nesting phenology changes (between 80N and

80S), as expected,. The Pantanal consists of poorly drained lowlands in western Brazil and

bordering Paraguay and Bolivia. Breeding Swallow-tailed Kites on either side of the Pantanal

nest at the same time, and probably co-migrate to northern South America to winter, but are

contained in separate Genetic Populations (Central and Southern). No restriction of gene flow is

seen in the transition area where nesting phenology changes. Therefore, migratory Swallow-

tailed Kites that breed in opposite seasons plus putative residents are represented within the same

Genetic Population (Central). The Northern and Southemn Genetic Populations include









individuals that migrate long distances between temperate breeding and tropical wintering ranges

(Meyer 2004, K. Meyer, unpubl. data).

Average pairwise sequence distance is large between the clades, 6.5 9% in the control

region (corrected for within population divergence) and 2.2 2.6% in cytb (uncorrected). Gene

flow among Genetic Populations, inferred from phylogenetic trees (Slatkin and Maddison 1989,

1990, Edwards 1993) denotes an historical lack of gene flow between all populations and no

recent gene flow into or out of the Northern Genetic Population.

An enigmatic sample collected in northern Mexico, a location equidistant between the

Northern and Central Genetic Populations, belongs to the Central Genetic Population based on

genetic data. If breeding historically occurred in this region (considered doubtful by Robertson

[1988]), the breeding gap between the two populations was likely less than 700 km at that time.

Because breeding is not known to occur there, I have defined the northern limit of the Central

Genetic Population as southern Mexico, and excluded northern Mexico where this sample was

collected.

One sample of a nestling collected near the southern border of the Pantanal had a

haplotype matching those found north of the Pantanal. Since other than this one instance,

haplotypes form monophyletic clades, historical gene flow is not invoked, nor is incomplete

lineage sorting. It is extremely unlikely that an ancestral haplotype would have accumulated no

changes during the same period of time over which other haplotypes diverged by over 8%.

Proximity of the nest to the population boundary suggests that the "misplaced" haplotype

represents gene flow that occurred because of proximity, not migration. I conclude that gene

flow between these populations is a recent and uncommon phenomenon.









On a phylogenetic tree based on all control region sequences, nine samples from

museums, collected in far northern South America and Central America, exhibited haplotypes

normally seen in samples from southern South America. The most likely explanation is that

these samples represent Swallow-tailed Kites wintering, not breeding, in these regions.

Collection data for these samples gives no indication of breeding group membership, therefore

these samples were categorized as "Unconfirmed Breeders" along with many other museum

specimens. Other explanations for the "misplaced" samples in the CR ALL Short tree include

gene flow, incomplete lineage splitting, contamination (in the museum or lab), and poor museum

records that misidentified geographic origin of samples.

Gene flow or incomplete lineage splitting explanations are not supported by phylogenetic

analysis of datasets based only on samples from "Confirmed Breeders." When "Unconfirmed

Breeders" were culled from the sample set, no haplotypes were found in common between

northern and southern South America. Contamination is not likely because: extraction and

amplification controls were negative when DNA from these samples was amplified and

sequenced; tissue was rinsed to remove skin cells that might have come from other specimens;

four separate museums donated the samples; and the samples expressed seven distinct

haplotypes. Communication with museum staff and information about collectors of these

specimens suggested that the stated locations probably were correct. Finally, new information

about the wintering range of Swallow-tailed Kites breeding in southern South America indicates

that these specimens could represent wintering birds (K. Meyer, unpubl. data).

Overall expected heterozygosity in nuclear loci was larger than observed probably due to

non-random mating among Genetic Populations. This Wahlund effect (Wahlund 1928)

influenced expected heterozygosity levels at most nuclear loci when population membership was









disregarded. Nuclear loci data overall were consistent with one division (Northern Genetic

Population/Clade) exhibited by the mtDNA and less differentiated for the other division

(between two southern populations), presumably because of incomplete lineage sorting. Since

nuclear genes have a larger effective population size than mtDNA, they tend to change more

slowly than the mitochondria. Incomplete lineage sorting in the nDNA loci is suggested here

because nDNA loci completely distinguished the Clade/Genetic Population found to be most

divergent by mtDNA.

Other possible explanations include: male gene flow; selection on genes used; and

intralocus sampling variance. To minimize the effects of selection and intralocus variance on

population structure assessment I used genes from both genomes and multiple genes from the

nuclear genome. Furthermore, there is no reason to suspect that male kites switch populations

more than females. Although it is easier for males to leave gametes behind in a population, if

that were occurring, males from the Northern Genetic Population would likely behave similarly,

in which case no population should have been distinguished by nDNA data.

Possible Explanations for Population Structure in Elanoides

In total, the genetic data suggested divergence among populations due to current and

historically restricted gene flow. Do geographic barriers explain this pattern? The Northern

Genetic Population is separated from the Central Genetic Population by over 1000 km of arid

land in southern Texas and northern Mexico. This barrier could contribute to restriction of gene

flow between the two populations. No geographic barrier is apparent between the Central and

Southern Genetic Populations. The Pantanal lies at the division between the two Genetic

Populations, in the Paraguay River basin of west central Brazil and bordering Bolivia and

Paraguay. It is formed by a 135,000km2 (Assine and Soares 2004) to 75,000 km2 (Sick 1993)









mosaic of swamp, forest, and grassland communities that flood annually, interspersed with non-

flooded "terra firme" and cerrado (Prance and Schaller 1982).

Arid vegetation zones in South America appear to cause a geographic bottleneck in

Swallow-tailed Kite habitat near the Pantanal. Drier, more open forms of cerrado lie to the east

and northeast, and chaco occurs to the southwest (Prado 1993, Sick 1993). No nesting records

are known from these areas. However, to the north and northwest of the Pantanal, Amazonian

vegetation joins semi-deciduous tropical forest, palm forests ("buriti groves" [Sick 1993]), and

wooded cerrado (Stotz et al. 1996, Haase 1998). Immediately south and southeast of the

Pantanal the vegetation is composed of gallery forests, cerradio (densely wooded cerrado), and

seasonally dry tropical forest congruent with the "Missiones Nucleus" (Pennington 2000, Prado

and Gibbs 1993). Environments become more humid closer to the mountainous Mata Atlintica

on the southeast coast of Brazil. Swallow-tailed Kite nests are common in all of these areas.

Although the Pantanal is assumed to harbor breeding Swallow-tailed Kites because they are seen

around its borders and appropriate habitat appears to occur within, I found no evidence of

nesting. Explanations for why Swallow-tailed Kites do not nest in the Pantanal include:

environmental fluctuation (Brown 1986), paucity of nest trees (hardwood trees may be too short,

and buriti palms, often used as nest trees, are not found there [pers. obs.]), and less abundant

food (according to farmers in the region, termites are less plentiful in the native grasses that still

exist in the Pantanal). Although Swallow-tailed Kite habitat seems to be bottlenecked near the

Pantanal, within which there is no known nesting, the resulting gap in their breeding range is

only 400 kilometers, Swallow-tailed Kites roost and migrate in between, suggesting that this gap

does not explain the extremely restricted gene flow.









Were past geographic barriers between the Central and Southern Genetic Populations

stronger? Depending on the historical locations of populations, breeding gaps could have been

wider. Kite distributions probably depend on climate and seasonal distribution patterns of

swarming insects, both of which fluctuate. A broader swath of open savanna is thought to have

occurred between the cerrado and chaco zones described above (Ab' Saber 1977, Ledru et al.

1993), and cycles of varying humidity and warmth have been hypothesized for the late Tertiary

and Quaternary periods in central Brazil (Assine and Soares 2004). Greater isolation of

populations, especially small ones, could explain their divergence. However, unless populations

became reproductively isolated, this divergence would have gradually diminished as populations

became more proximate under current climatic conditions. Regardless, given the amount of

population interaction due to migration (currently and probably historically), no geographical

barrier can completely explain restricted gene flow in Swallow-tailed Kites.

Strong behavioral mechanisms may restrict interbreeding. For example, while "lost"

Swallow-tailed Kites have often been observed (Morris 1891, Robertson 1988,

http:.//www.rarebirds. com), there is no evidence that kite vagrancy results in gene flow (even

occasional long-distance dispersal can prevent substantial genetic differentiation [Slatkin 1987]).

Swallow-tailed Kites also do not appear to be switching populations or mating opportunistically

with individuals from other populations when migrating or wintering. It must not be adaptive or

possible to disperse genes in this way. Fitness benefits of philopatry may outweigh costs,

populations may have diverged due to drift or selection, or behavior of migratory species might

be constrained.

Benefits of philopatry could deter birds from dispersing into other Genetic Populations,

as long as they outweighed the costs of migration. Belichon et al. (1996) reviewed studies on the









costs of transience and re-settlement. Benefits of philopatry include local knowledge, social

cohesion, and optimal inbreeding (Greenwood and Harvey 1982, Robertson and Cooke 1999).

The social-cohesion concept is especially compelling in relation to Swallow-tailed Kites because

they probably associate with conspecifics to aid predator detection, defense, and foraging for

ephemeral food sources (Meyer 1995). Nesting areas are loosely colonial and birds roost

together when not incubating or brooding. Extra non-breeding birds are usually observed near

nests and Swallow-tailed Kites are often found paired with the same mate, using the same nest

site, year after year (Meyer 1995, 2004). Telemetry data indicate that Swallow-tailed Kites do

not remain paired throughout the year, suggesting that mate retention might be a direct result of

philopatry (Meyer 2004). However, genetic data show no evidence of natal philopatry

(discussed below), suggesting that philopatry, to whatever extent it occurs, is not strong enough

to cause the demonstrated population structure.

Traits involved with recognition or courtship can diverge due to random drift or sexual

selection between allopatric or parapatric populations, leading to reproductive isolation (Bensch

et al. 1998, Irwin and Price 1999, Irwin et al. 2001b, Haavie et al. 2004). In migrants, traits that

promote quick mate assessment, such as song, are likely targets for sexual selection (Irwin and

Irwin 2005). Traits might also diverge due to ecological selection based on a habitat differences

(Orr and Smith 1998). Sexually or ecologically selected characteristics that vary among

populations can lead to pre-zygotic isolation of those populations (Edwards et al. 2005). This

could explain why Swallow-tailed Kites would not mate with members of other populations.

Differentiation might lead to post-zygotic isolation (hybrid unfitness), ultimately

reinforcing character divergence (Berthold 1996, Saetre et al. 1997, Helbig et al. 2001, Edwards

et al. 2005). Reinforcement is strongest when populations are sympatric, as are those of the









Swallow-tailed Kite for portions of the year, and is especially implicated in the divergence of

courtship signals (reviewed by Irwin and Price 1999). It may be rare for hybrid unfitness to

cause pre-zygotic isolation in birds (Irwin and Price 1999, Price and Bouvier 2002), but as a

post-zygotic barrier, it may help explain the restricted gene flow I have documented for

Swallow-tailed Kites. A commonly hypothesized mechanism for reduced fitness in migratory

hybrids is that resulting from hybridization between populations expressing different migratory

routes. Such hybrids may use intermediate migration pathways and suboptimal wintering

grounds, resulting in poor survival (Irwin and Irwin 2005, Veen et al. 2007).

For the Swallow-tailed Kite, explanations for population differentiation based on current

selection or drift are problematic but worth considering. Migration patterns of the Northern and

Southern Genetic Populations may differentiate them from the Central Genetic Population in

some respects. For example, both populations have unique breeding destinations, and in the case

of the Southern Genetic Population, recent data suggests population wintering destination may

be unique (K. Meyer, unpubl, data). However, broad scale timing, direction, and breeding

destinations are similar for groups located near Genetic Population boundaries, and differ among

breeding groups within the Central Genetic Population.

Each Genetic Population is so large, and therefore ecologically diverse, that it is difficult

to imagine how selection or drift could cause one population to diverge as a whole from another.

The Northern Genetic Population is in the most geographically isolated and ecologically

differentiated part of the range, but the Central and Southern Genetic Populations show much

less differentiation at their respective boundary. The single aspect of their ecology that does

clearly differ at this boundary is that all nests of the Central Genetic Population in Brazil were

found in buriti palm trees, while those of the Southern Genetic Population were in hardwoods.









This may result from relative differences in palm abundance or predation pressures.

Nonetheless, nest site selection could represent ecologically diverged behaviors in breeding

groups located at the division between these Genetic Populations, which might create pre- or

post-zygotic barriers.

Migratory species' behavior could also be constrained in regards to allowance of gene

dispersal. Adaptations to a migratory lifestyle could cause loss of flexibility in timing or location

of breeding, even if that flexibility would be advantageous (e.g. Coppack and Both 2002). An

endogenous circannual calendar is proposed for long distance migrants, cued by environmental

factors, to explain the particularly precise timing of their breeding, molting, and migration cycles

(Berthold 1996, Gwinner and Helm 2003). Boihning-Gaese et al's (1988) survey of migratory

species' distributions concluded that long-distance dispersal is constrained by genetically-

controlled physiological and behavioral adaptations associated with long-distance migration.

Swallow-tailed Kites may not disperse among populations because, as some researchers

suggest, cognitive adaptations to migration can compromise the ability to settle in less familiar

places long term (O'Connor 1986, Veltman et al. 1996, Boihning-Gaese et al. 1998, Sol and

Lefebvre 2000, Mettke-Hofmann and Greenberg 2005, but see Thorup 2006). Migrants may be

adapted for superficial, rather than detailed, exploration of environments on migration (Mettke-

Hofmann and Gwinner 2004, Mettke-Hofmann 2007) and may be more "neophobic" than less

migratory relatives (Mettke-Hofmann et al. 2005). Sol et al. (2005a, 2005b) showed that

migrants exhibit less innovative feeding behaviors than residents, potentially due to smaller brain

size (Winkler et al. 2004, Sol 2005a). He proposed that as a result, migrants are unable to cope

with novel or seasonal environments long-term. Bensch (1999) submitted that migrants are slow

to colonize new areas because novel migratory programs would then be required to reach









suitable wintering grounds. Migratory programs are defined here as distance, direction, and

timing of migration.

The potential for interbreeding on wintering grounds (between migrants or by a migrant

with a local breeder) may also be limited. Wintering males may not be in reproductive condition

if physical exhaustion from the breeding season and migration compromise migrants' abilities to

breed more than once (Safriel 1995). If a breeding male tries to mate with a wintering female, in

addition to the obstacle of sexual receptivity, the female would have to store sperm until reaching

her own breeding ground, which is not considered possible for many bird species (Briskie 1996).

At a proximate level, second breeding in migrants is prevented by interplay between endogenous

annual rhythm and photoperiod according to Berthold and Terrill (1991). Migrants may have a

"reproductive window" of inflexible width that provides the temporal framework for breeding

(Helm 2005).

However, migratory birds have been known to breed in two places (Safriel 1995, Hahn

1998), reinitiate gonadal activity under favorable conditions (reviewed Helm et al. 2005), or

switch breeding populations (Baker and Marshall 1997). These behaviors are possible under

certain conditions. It is unknown whether they are possible in Swallow-tailed Kites.

Isolating mechanisms such as geographical barriers, philopatry, divergent traits, and

behavioral constraints related to long-distance migration might individually explain restriction of

gene flow in different parts of the Swallow-tailed Kite' s range at different stages in the migratory

cycle. While none of these mechanisms can provide a complete explanation, for reasons

discussed above, in combination they might, especially considering that divisions among

populations originated a long time ago, when their locations and sizes were much different than

they are now. If historically at least two small populations were isolated geographically, and










perhaps phenologically, from the main population, each population could have experienced a

founder effect due to small size, strong random drift, or sexual/ecological selection. Thus,

reproductive isolation of three populations might have resulted, enforced by female choice

during sympatry.

If this scenario is accurate and Genetic Populations are reproductively isolated, then

current lack of strong geographic barriers and distinguishing ecological features between

populations, lack of genetic evidence for philopatry, and current behavioral constraints to

interbreeding, are moot points in respect to gene flow in Swallow-tailed Kites. However, if

populations are not reproductively isolated, all mechanisms heretofore described should still be

considered as possible barriers to gene flow.

Although I am able to rej ect hypotheses of panmixia in Swallow-tailed Kites, and barriers

to gene flow such as differences in nesting phenology or philopatry, I am unable to provide

support for many of the isolating mechanisms discussed above. One predicted barrier, the

breeding range gap in Northern Mexico, appears to be supported, although, as discussed, while

this gap likely restricts gene flow to some extent, it cannot provide a complete barrier since kites

annually cross it.

Reduced Gene Flow within Elanoides Compared to Other Migratory Species

Regardless of mechanism, gene flow appears to be restricted or non-existent among

global Swallow-tailed Kite populations. Why are Swallow-tailed Kites different than other long-

distance migratory species such as the Houbara Bustard (Chlamydotis undulata), Humpback

Whale (M~egaptera novaeangliae), Monarch Butterfly (Danaus plexippus), Dunlin (Calidris

alpina), Green Sea Turtle (Chelonia myda~s), several warblers, and certain ducks and geese, that

at minimum, experience intermittent gene flow among populations (Johnson and Grier 1988,









Baker and Marshall 1997, Baker et al. 1998, Kimura et al 2002, Brower and Pyle 2004, Pitra et

al. 2004, Roberts et al. 2004, Davis et al. 2006, Mila et al. 2007)? I offer four explanations for

these apparent differences. 1. Swallow-tailed Kites have a longer North-South breeding range

than most migratory species. 2. Swallow-tailed Kites are more philopatric than most migratory

species 3. Migratory behavior is more genetically constrained in the Swallow-tailed Kite than in

most migratory species. 4. Isolating mechanisms and the genetic component of migratory

behavior are not stronger in Swallow-tailed Kites than in other migratory species- the Swallow-

tailed Kite is simply farther along the same evolutionary traj ectory.

A long north-south breeding distribution might allow Swallow-tailed Kite populations to

become ecologically differentiated between geographic extremes (Belliure 2000). The species'

large and relatively continuous range also guarantees that wintering grounds will lie near active

breeding grounds. The resulting breeding/wintering interaction might mean that Swallow-tailed

Kites are more, rather than less, reproductively isolated because, as previously noted, sympatry

can reinforce pre-zygotic isolation.

Degree of philopatry is considered key to differentiation of populations that show weak

migratory connectivity (populations that interact in non-breeding seasons) (Webster and Marra

2005). Swallow-tailed Kites may be more philopatric than many migratory species because of

their complex social structure, great ease of flight to return to their natal region, and stability of

resources on their breeding grounds. Surprisingly though, Sutherland (2000) found no

correlation between dispersal distance and gregariousness in migratory species. Like many

insectivorous species (Faaborg 1982), Swallow-tailed Kites appear to have a relatively

predictable resource base (Meyer 1995). Homing is generally more pronounced among species

that use more stable resources, whereas opportunistic settling usually occurs in species with an










unpredictable resource base (Wiens 1976, Gauthreaux 1980,1982, Greenwood and Harvey 1982,

Johnson and Grier 1988) .

That migration in Swallow-tailed Kites may be more genetically constrained than in other

species is suggested by their long migrations and relatively brief period of parental care. Current

research on phenotypic plasticity in migratory programs centers on genetics (reviewed by Pulido

2007). Kites in two of the three Genetic Populations migrate 4,000-8,000 km between breeding

and wintering grounds. Long migrations may be subject to more rigid control by endogenous

factors than short migrations because of severe time and energetic pressures (Berthold 2001).

The longer the distance, the smaller the influence of environmental factors, and the stronger

selection on traits of the "migratory syndrome," a tightly integrated group of adaptive traits that

enable birds to perform highly organized seasonal migrations (Dingle 1996, Pulido and Widmer

2005, Pulido 2007). The fact that juvenile Swallow-tailed Kites do not migrate with their parents

(Meyer 2004), what Sutherland (1998) referred to as "non-extended parental care," indicates that

migratory behavior may be genetically, rather than culturally, transmitted. Sutherland (1998)

suggested that suboptimal routes demonstrate migration strategies under strong genetic control,

which he found to be most common in species without extended parental care. Geese and ducks,

which exhibit extended parental care, are often opportunistic settlers and breeders (Sutherland

1998, Robertson and Cooke 1999).

I have discussed several reasons why Swallow-tailed Kites may experience less gene

flow throughout migration than other long-distance migratory species. However, there are long-

distance migrants, such as Dunlins, that may be more philopatric than Swallow-tailed Kites

(Wenink et al. 1996). Many other species have longer migration routes or comparable range

sizes (Rasmussen et al. 2007), while others are similar to Swallow-tailed Kites in the other traits









discussed. I propose that, in these cases, isolating mechanisms and the genetic component of

migratory behavior have not been stronger in Swallow-tailed Kites, but rather Elan2oides is

farther along on the same evolutionary trajectory. In other words, levels of gene flow, already

unexpectedly low in many similar long-distance migratory species (Bowen et al. 1992, Baker et

al. 1998, Wenink et al. 1996), may currently be diminishing in said species, as has already

occurred in the kite. In which case, the more appropriate taxa to use as comparisons to the

Swallow-tailed Kite may be those that have already experienced this reduction in gene flow and

have been split into species.

For example, populations and migration patterns of the Ictinia species complex (I.

mississippiensis and I. plumbea ) bear a striking resemblance to those of the Swallow-tailed Kite

(Brown and Amadon 1968, Sick 1993). Locations and migratory patterns are so similar that

populations of both Ictinia species and of Elan2oides, winter together in central Brazil, alongside

breeding Ictinia plumbea and Swallow-tailed Kites (pers. obs.). Ictiniaplumbea, like Elan2oides

breeding in Latin America, may be similarly genetically subdivided, but more importantly,

Ictinia and Elanoides both appear to have highly diverged temperate northern populations, one of

which, Ictinia mississippiensis, is considered its own species

Relationship between Migration and Speciation in Elanoides and Similar Species

Safriel (1995) proposed a process of diversification for migratory species originating in

the tropics that would have resulted in speciation of temperate populations. Joseph (1997) cited

a few examples of temperate/tropical species complexes that may have undergone a similar

process: Vireo olivaceus, Pyrocephalus rubinus, Legatus leucophaius, Tyrannus melan2cholicus

and Tyrannus savanna. Each complex, like the Swallow-tailed Kite, exhibits populations that









reside in the tropics, migrate between northern temperate and tropical zones, and migrate

between the southern temperate and tropical zones.

Is the Swallow-tailed Kite an example of a temperate/tropical speciation pattern

involving migratory species? Speciation is usually described in terms of spatial relationships

among diverging populations, e.g. sympatric, allopatric, parapatric, etc.. Each of these terms

could be applied at different stages in the speciation process for most species. Migratory species

similar to the Swallow-tailed Kite exhibit these spatial relationships annually. In these cases, it

may be more helpful to describe speciation in terms of displacement of breeding grounds,

breeding season, wintering grounds, or migration route. Although Helbig (2003) hypothesized

that highly migratory species possess a lower propensity for speciation, he also reviewed cases

where breeding range disjunctions, and consequent habitat preferences, may have caused

subdivision within migratory species. Winker (2000) also attributed subdivision within

migratory species to heterogeneously distributed cyclic resources. Both papers acknowledge the

possibility that while long-distance dispersal in migratory species can result in gene flow, it can

also result in diversification (but see Belliure 2000) as illustrated by a morphologically divergent

population of booted eagles breeding on what were solely wintering grounds (Helbig 2003). A

population of Barn Swallows (Hirundo rustica), which began breeding on its winter range in

Argentina within the past 30O years, a migrating flock of Fieldfares (Turdus pilaris) that blew off

course and began breeding in Greenland, and several examples of "migration dosing" in raptors

(Martinez 1983, Gill 1995, Bildstein 2004), may provide additional support for the hypothesis

that migration can facilitate divergence via creation of new breeding populations.

Breeding ground displacement is often synonymous with displacement of breeding

season; however the latter can occur independently, yielding the same effect as the former-










reproductive isolation and united wintering of populations. A Blackcap population (Sylvia

atricapilla), with a displaced wintering ground, consequently has a slightly earlier breeding

season than con-specifics on the shared breeding grounds (Bearhop et al. 2005). A population of

Band-rumped Storm Petrels (Oceanodroma ca~stro) began to breed in a season when more nest

sites were available (Monteiro and Furness 1998). Changes of nesting phenology resulted in

assortative mating in both species. Concordant changes in petrel population structure have been

documented (Monteiro and Furness 1998, Bearhop et al. 2005). Displacement of non-breeding

grounds and resultant divergence of migration patterns, can cause divergence between

populations, even without a concordant change in breeding season, if selection pressures change

as a result (Berthold 1996, Perez-Tris 2003, Irwin and Irwin 2005) or if pair formation occurs

away from the breeding ground (Baker et al. 1998, Robertson and Cooke 1999). "Migratory

divide" avian populations (related species or subspecies that breed sympatrically but migrate and

winter separately), similar to Humpback Whale populations, are often better defined by

migratory route than by breeding grounds (Baker et al. 1990, Irwin and Irwin 2005). In the case

of the Swallow-tailed Kite, I suggest that the Northern and Southern Genetic Populations have

incurred displacement of breeding season and breeding ground from a putative tropical ancestral

population.

Deciding whether speciation has occurred within a taxon is often difficult and arbitrary

(Edwards et al. 2005, Bickford 2007). I consider the concept briefly here only to underscore the

potential relationship between migration and speciation in the Swallow-tailed Kite.

Mitochondrial DNA phylogenetic trees show three clades that correspond geographically to three

clearly partitioned breeding grounds. Proposals to designate species based on mtDNA occur

(Wiens and Penkrot 2002, Baker et al. 2003) but have been criticized (Zinc and McKitrick 1995,









Edwards et al. 2005). Nuclear DNA split samples into two monophyletic clades, strongly

supporting one division demonstrated by mtDNA, and failing to show clear support for the other

division likely because of incomplete lineage splitting. Based on these data, under the

Phylogenetic Species Concept (Cracraft 1983, Donoghue 1985), the "exclusivity" model (Baum

and Donoghue 1995), and British Ornithologists Union Guidelines (Helbig et al. 2002, but see

below), the Swallow-tailed Kite would be regarded as at least two species and perhaps three.

However, the use of gene trees or monophyly to define species can be problematic (Doyle 1995,

Baker et al. 2003, Wang et al. 2003). Reproductive isolation is indirectly suggested here by the

extent to which populations interact with no resultant gene flow. Reproductive isolation is

difficult to prove in this case where no two populations interact while both are breeding, and

recent gene flow has occurred between two populations. Finally, the clades are not

morphologically distinguishable by variables used in this study (see morphology section).

Assessment of speciation often considers factors such as current and future level of

contact between populations (e.g. Helbig et al. 2002). For example, speciated populations should

show a propensity to remain genetically separate (O'Hara 1994). If populations are sympatric or

parapatric, requirements for defining divergent characters are less stringent because the contact

ensures that populations are reproductively isolated and have a high likelihood of retaining their

integrity (Helbig et al. 2002). Levels of current contact are hard to define in the Swallow-tailed

Kite, where all populations are sympatric at some point annually, but never when both

populations are breeding. The Central and Southern Genetic Populations should be considered

parapatric since the distance between them is negligible compared to the Swallow-tailed Kite's

potential for movement. As for future level of contact between populations, levels of gene flow

suggest that differentiation will continue, although, if proximity of the two southernmost










populations is relatively recent, there is a chance that gene flow between the populations might

mecrease.

Whether this species is subdivided depends on the rationale used to define

subspecies/species. It is appealing to take an integrative approach, whereby phylogenetic

divisions are corroborated by concordant changes in independent characters such as morphology,

behavior (e.g. non-visual mating cues such as song), or ecological differences (e.g. habitat use

and adaptation [Crandall et al. 2000]), although these types of traits are not always indicative of

phylogenetic relationships (Ball and Avise 1992, Wiens and Penkrot 2002, Bickford 2007).

This study demonstrates extremely restricted gene flow and strong population structure in

the Swallow-tailed Kite. Determinations regarding Swallow-tailed Kite taxonomy may depend

on future research on population differentiation and resolution in the scientific community about

how to define species. It is sufficient for my purposes to suggest that cladogenesis has occurred

in this highly migratory species.

Swallow-tailed Kite population structure demonstrates that migration does not

necessarily facilitate gene flow via interbreeding or dispersal of reproductively successful

individuals. Furthermore, related species that are less migratory are not necessarily less prone to

gene flow. For example, the Snail Kite (Rostrhamnus sociabilis) has been shown to be relatively

panmictic (S. Haas, unpubl. data). Also, the long-distance migratory portion of Swallow-tailed

Kites (Northern and Southern Genetic Populations) did not appear any more disposed to disperse

genes than did the resident/short-di stance migrant portion (maj ority of the Central Genetic

Population). In fact, residents may be the key to maintenance of gene flow throughout the large

Central Genetic Population because they breed year round, which may serve to connect the two

phenologically differentiated breeding groups to the north and south.









Biologically, the link between migration and dispersal may be non-existent once

migration patterns are established. Migration and dispersal are very different mechanisms, with

different functions and selection pressures, perhaps only connected historically, when novel

breeding grounds and migration patterns were created (Belliure 2000, Sutherland 2000, Rappole

et al. 2003, Winkler 2005). Understanding of the rate and impact of long-distance dispersal is

poor (Paradis et al. 1998, Nathan et al. 2003, Trakhtenbrot et al. 2005, Winkler 2005). Assuming

that Elanoides populations are not reproductively isolated, and individuals are capable of

interbreeding, my results show no evidence of current long-distance dispersal due to migration,

surprising in a species that contains many attributes correlated with long-distance dispersal

(Paradis et al. 1998) and that presumably exhibited flexible dispersal behavior historically. The

Swallow-tailed Kite may be a prime example of evolutionary liability compared to current

rigidity in terms of migration patterns.

Migratory behavior appears to be flexible in some species, or at some points in a species'

history, and not in others. Are there distinguishing features of species that can be used to predict

whether their migratory patterns will promote or retard gene dispersal? Constraints for

evolutionary transitions in migration were described by Alerstam (2003) and evidenced by

Boihning-Gaese et al. (1988), Bensch (1999) and Sutherland (1998) (but see Thorup 2006). Yet,

species have been shown to adopt novel migration strategies rapidly (Hill et al. 1998, Fiedler

2003, Helbig 2003, Pulido and Berthold 2004, Pulido 2007, Winkler 2007) often with no cultural

transmission (Berthold 1999). Meanwhile, indirect evidence for evolutionary stasis in migratory

traits found in phylogeographic studies suggests that populations and their migratory patterns

have existed without changing for thousands of generations (Baker 2002, Ruegg and Smith

2002). Rigidity of migrant schedules is exemplified by a study in which seasonally breeding









Stonechats (Salxicola torquata), when placed in conducive aviary conditions, continued to

produce only one brood per year, unlike less migratory, multibrooded, conspecifics (Helm et al.

2005). Yet irruptive migrants, like Red Crossbills (Loxia curvirostra) breed in many different

seasons (Hahn 1998).

How is such variation possible at a proximate level? Studies of heritability indicate that

the degree of genetic control over migratory behavior differs among species and populations, and

even between years (Potti 1998, Pulido et al. 2001, Pulido and Berthold 2003). Genetic

architecture can allow for the expression of different behaviors depending on environmental and

social cues (Terrill and Ohmart 1984, Sutherland 1998). Flexibility in migratory behavior of

many species cited in this paper is assumed to cause at least a small degree of long-distance

dispersal, consequent homogenizing gene flow, and lack of subdivision (Helbig 2003).

Assuming that the converse is true, that subdivision indicates an absence of long-distance

dispersal (Belliure 2000) and, therefore, inflexibility in migratory behavior, what proximate

mechanism could reduce the ability of Swallow-tailed Kites to express such flexibility? As

previously discussed, successful long-distance migration may require an endogenous spatio-

temporal program insensitive to environmental perturbation. Pulido and Berthold (2004) and

Helm et al. (2005) reviewed the evidence that long-distance migratory birds often show little

phenotypic variation in the timing of life-history events like breeding, molt, or migration. All of

the species with suboptimal migration routes in the study by Sutherland (1998) not only

exhibited non-extended parental care, but were also long-distance migrants. Pulido and Widmer

(2005) and Pulido (2007) hypothesized that that such low expressed variation is a consequence

of environmental canalization, or reduced levels of genetic variation, resulting from strong









stabilizing selection on migratory traits. Long-distance migratory behavior then, appears likely

to hinder dispersal of genes, and thereby to promote speciation.

Morphology and Subspecies

Wing and tail length ranges were not diagnostic for any group (Table 4-1). Although

ranges overlapped substantially between groups, it may be possible to assign measurements

found at the range extremes to certain groups. Iridescent coloration was potentially diagnostic

for certain locations. The Northern Genetic Population exhibited strongly purple iridescence.

The Southern Genetic Population, and possibly all other South American breeders, had purple

iridescence, often mixed with green. Breeders in Central America exhibited green iridescence.

Although more data are needed to confirm patterns in northern South America, my results

support the hypothesis that current morphological rationale for distinguishing subspecies are not

appropriate, since neither wing length, tail length, nor iridescent coloration distinguished current

subspecies, Biological Populations, or Genetic Populations. Average lengths increased as group

location moved north. Although averages lengths were significantly different among Genetic

Populations, this probably resulted from an interaction between the north-south orientation of

populations and Bergmann' s rule (Bergman 1847), since no discontinuities in lengths were noted

at geographic divisions between populations and averages were most significantly different when

samples were grouped into sub-regions.

The genetic data, like the morphological data, do not completely support current

subspecies designations. Current designations recognize divergence of the Northern Genetic

Population (E~f forficatus), but they obscure divergence between Central and Southern Genetic

Populations (currently lumped into E~Jf yetapa). The level of mtDNA divergence between the

latter populations was higher than between most avian subspecies, and equaled that found









between many sibling species (Mila et al. 2007, Buerkle 1999, Klicka and Zink 1997, Baker et

al. 2003, Burg and Croxall 2001, Wenink 1996, Avise and Walker 1998, Kimura et al. 2002).

Why was subspecies morphology considered diagnostic in earlier studies? Friedmann

(1950) collected measurements for both subspecies, and Snyder and Wiley (1976) collected

measurements for EfJ forficatus (Appendix C). There are obstacles to obtaining accurate

morphological data in Swallow-tailed Kites. First, there is often no way to know if one is

measuring a resident or migrant. Second, measurements taken from dry specimens cannot be

compared directly to those from live or freshly collected specimens because of shrinkage

(Winker 1993, pers. obs.). Finally, although it is often difficult to identify Swallow-tailed Kites

less than one and a half years of age, it is important to exclude them because their tails are

shorter than those of adults. I do not know if Friedmann (1950) or Snyder and Wiley (1976)

considered these issues. I assume that measurements given by Friedmann are from dry non-

molting specimens, while those of Snyder and Wiley are from fresh specimens or live non-

molting birds.

While ranges overlapped substantially between subspecies in every category of

measurement in this study, Friedmann's (1950) ranges overlapped significantly (more than 2 cm)

only in male wing chord. Friedmann's average measurements were much larger than mine for

Ef ~forJicatus (even without consideration of shrinkage), hence the greater difference between

subspecies in his analysis. In addition, averages for Friedmann' s EfJ yetapa measurements were

slightly smaller than in my study. Although our samples sizes were comparable, Friedmann's

ranges are of much smaller magnitude, especially in Ef ~forticatus. Snyder and Wiley's (1976)

sample sizes are much larger, and their average wing and tail lengths for E f forficatus were

slightly smaller than mine. Apparently, my data are from a more variable set of~J forficatus









than used by Friedmann. Friedmann's data led a collector, Skinner (1964), to label a small

specimen collected in Alabama as E~Jf yetapa. The specimen was used in this study and DNA

suggests it is E~f forficatus. Its measurements fall within the ranges of both subspecies', as

reported here.

Why are Swallow-tailed Kites much less variable in appearance than their population

structure would suggest? Morphological differences are not always correlated with boundaries

between taxa or reproductive isolation between groups (Greenberg et al. 1998, Bensch et al.

1999, Omland and Lanyon 2000, Cheviron et al. 2005). In fact, sibling-species and subspecies in

other kite genera are often only weakly differentiated by morphology (Brown and Amadon

1968). One explanation sometimes invoked in cryptic speciation is morphological stasis

(Bickford 2007). Extreme environmental conditions can impose stabilizing selection on

morphology, reducing or eliminating morphological change that can accompany differentiation

(reviewed in Bickford 2007). Might flight be one such homogenizing force on the species?

Swallow-tailed Kites feed on the wing, and most individuals migrate (Meyer 1995). Wing

length, a variable thought indicative of selection due to migratory flight (Belliure et al. 2000,

Perez-Tris et al. 2003) is shorter on average in putative Swallow-tailed Kite residents from

northern South America than in migrants from the same Genetic Population (Appendix C).

However, these migrants were Central American breeders, thereby confounding this comparison

because of the relationship previously described between latitude and wing/tail lengths. More

research is needed to determine whether migratory flight causes stabilizing selection on

Swallow-tailed Kite wing and tail length, and whether morphological variables not measured in

this study, or cryptic variation such as non-visual mating signals, distinguish Genetic

Populations.










Population History

According to coalescent and demographic analyses, Swallow-tailed Kite Genetic

Populations started to diverge early to mid-Pleistocene and continued into late Pleistocene. This

agrees with recent avian phylogenies that indicate the species is old relative to other falconiform

species (Lerner and Mindell 2005). It might also explain why most loci sequences in this study

were not very similar to those of other raptors on Genbank. The MIS 11 interglacial period (ca.

360-420 ka) was included in the ranges of dates for each population's origin, which supports the

hypothesis that at least one of the populations diverged during MIS 11. Another reputably warm

interglacial, MIS 5e (ca. 110-130 ka), occurred within the Northern Genetic Population's range

of origin.

Clade origin times calculated in Genetree were bracketed between a mutation predating

the origin of the clade, and the oldest mutation within a clade. A range of mutation rates was

used for both mismatch and Genetree analyses. However, because of the many underlying

assumptions of mismatch and Genetree analyses (Edwards and Beerli 2000, Baker 2002), and the

wide ranges of clade origin and expansion dates, I take a very broad view of the time periods

reported by these analyses, and focus on information gained from relative comparisons, such as

those between clades.

The Central Genetic Population was the most genetically diverse of the three Genetic

Populations, followed closely by the Southern Genetic Population. Diversity levels, especially

Oxn, suggest that the Central Genetic Population has had a higher effective size historically than

the other populations. Currently it is the largest population. High diversity indices and a more

hierarchically structured haplotype network suggest that the Central Genetic Population is the

oldest population or has experienced the fewest bottlenecks. The Central Genetic Population









also had the highest average TRMCA, followed closely by the Southern Genetic Population.

The Northern Genetic Population experienced the most recent sudden population expansion and

is the least diverse, which supports my hypothesis that this population's history was heavily

influenced by climatic fluctuations.

Control region phylogenetic trees showed all populations to be equally related. No

population was basal, potentially due to the use of an outgroup that was not sufficiently related to

the Swallow-tailed Kite to provide evolutionary insight (Smith 1994). Preliminary analysis

suggested that a cytb phylogenetic tree, built with a larger sample size than was used here, may

place the Central Clade in a basal location. nDNA outgroup allele sequences were most similar

to Latin American allele sequences, providing additional support for the species' tropical origin.

mtDNA average sequence distances suggested deep and almost equal divergence between clades,

however, the Northern Genetic Population was the most divergent based on nDNA and mtDNA

pairwise differences, especially when the instance of mtDNA haplotype sharing between the

other Genetic Populations is considered.

The current distribution of Swallow-tailed Kite populations, two small temperate

populations peripheral to a large diverse tropical population, is a classic arrangement for

migratory species originating in the tropics (Rappole 1995, Safriel 1995, Joseph 1997, but see

Zinc 2002), although sometimes the southern temperate population is not present or not

considered in migration literature (Levey 1994, Joseph 1997, Jahn et al. 2004). Based on

current Swallow-tailed Kite distributions, genetic data, migration patterns, and literature

regarding the evolution of similar migratory species (references above in this paragraph), I

considered four possible histories for populations' origins. I assumed that the latitudinal order of

populations was the same historically as it is now. "C-S/N": A population most closely related









to the Central Genetic Population in the neotropics expanded both north and south into temperate

zones. "C-S then C-N": Same as above but expansion to the south occurred before expansion

to the north; "S-C-N": A population most closely related to the Southemn Genetic Population

expanded north, throughout the tropics, and then into northern temperate zone. "C-N-S": A

population most closely related to the Central Genetic Population expanded into the northern

temperate zone. When birds migrated south for the winter, they leap-frogged over their ancestral

population, wintering father south, where they ultimately established a breeding population.

I cannot rej ect any of these possibilities because of the broad overlap in population ages

and lack of branching order on gene trees, therefore I cannot reject the null hypothesis that all

populations are equally related to the ancestral population. The Northern Genetic Population

seems the least likely based on calculated TMRCA and current literature concerning ancestry of

temperate/tropical migratory species. The data show most support for the "C-S then C-N"

scenario. Resident and most wintering Swallow-tailed Kites are found within the Central

Genetic Population, attributes often considered indicative of the ancestral population (Rappole

1995). The S-C-N" scenario is the next best interpretation of data because of the age of the

Southern Genetic Population. Many migrants bypass the Central Genetic Population to winter in

the Southemn Genetic Population zone. However, if the ancestral population was in a temperate

zone as the Southemn Genetic Population is now, expansion into the tropics to breed would be

unusual behavior according to Safriel (1995), since food resources are less predictable and

abundant there during the breeding season.

Dates from coalescence analyses show that expansion to the south may have occurred

during the late Pliocene or the MIS 11 interglacial, when warm conditions prevailed in southern

South America (Ortlieb et al. 1996, Genise 1997) and that expansion to the north might have









occurred later during late MIS 11 or MIS Se, intervals of relative warmth in the northern

hemisphere (Howard 1997, Petit et al. 1999, Kukla et al. 2002). Population expansion would

have resulted in gradual displacement of breeding grounds and nesting phenology. Breaks in

suitable habitat and/or glacial events likely increased isolation between breeding populations.

How did breeding populations remain separate throughout glacial cycles when the most suitable

habitat was probably in northern South America (Williams et al. 1998), presumably within reach

of all Swallow-tailed Kite populations? I suspect that populations maintained separation either

due to disparate refugia or behavioral isolating mechanisms that are still in place. To explain

how geography could have been instrumental in divergence among the populations, I have

formulated the following scenarios for each population. These scenarios are consistent with the

data and assume a tropical origin.

In the Northern Genetic Population, the data indicate a recent sudden population

expansion, possibly since the last glacial retreat. Swallow-tailed Kites may have expanded into

North America several times since their origin, which would explain why this population is the

youngest, yet most divergent. Founder effects and bottlenecks due to small colonizing

population sizes, and ecological selection in a vegetation zone much different than that of Latin

America, could have caused a great, rapid, divergence of this population from the others.

Although it is possible that Swallow-tailed Kites remained in parts of the southeastern U. S.

during glacial times, their ease of movement suggests a more likely shift south to a warmer

climate. However, analyses suggest that the Northern Genetic Population did not interbreed

during the last few glacial cycles with the population immediately to the south the Central

Genetic Population. Portions of Central America, south of approximately 150N, maintained a









relatively warm humid climate during glacial cycles (Williams et al. 1998), and it is possible that

members of the Northern Genetic Population stayed there rather than moving farther south.

Climate and vegetation studies indicate that the largest areas in the New World with a

relatively warm humid environment during the last glacial maximum were in northeastern and

western Amazonia (Clapperton 1993, Williams et al. 1998, Colinvaux et al. 2000, Lessa et al.

2003). If members of the Central Genetic Population bred in this area, they might have avoided

contact with members of the Northern Genetic Population in Central America, especially if arid

conditions dominated in the intervening area (Clapperton 1993). The hypothesis of a large

refugium for the Central Genetic Population concords with diversity estimates and a haplotype

network that did not show much evidence for contractions and expansions in this population.

The Southern and Central Genetic Populations have co-existed for many glacial cycles,

and have therefore maintained their genetic separation during many changes in range. I

speculate that the best explanation for this is the movement of the Southern Genetic Population

to refugia far removed from those of the Central Genetic Population. Possible locations include

the coastal mountains of southeastern Brazil or the Iguagu region (reviewed pg. 56-60, Sick

1993, Hewitt 2000, Spichiger et al. 2004). Repeated movements to different locations could

partially explain original divergence between the two populations and the recent gene flow event,

if the two populations have only recently come back into contact.

Subdivision/Gene Flow: Within Populations

Genetic data show no support for the hypothesis that Swallow-tailed Kite

phylogeographic structure results from natal philopatry. I found high haplotypic diversity within

populations, and relative to other birds, a high level of nuclear diversity. However, no

phylogeographic structure was found within populations, even in the large Central Genetic










Population where time and effective population size have likely been sufficient to allow

development of structure in neutral markers. This result is surprising for a few reasons, one of

which is illustrated by the shape of the phylogenetic trees. Branches to each clade are extremely

long, while branches within each clade are extremely short, implying that while no gene flow is

occurring between clades, a great deal of gene flow is occurring within them. Observed and

expected heterozygosity estimates were similar within each Genetic Population, more evidence

that Swallow-tailed Kites are mating randomly within populations. The degree to which gene

flow differs depending upon scale (global versus local) is unexpected. This pattern would make

sense if strong geographic boundaries existed between populations and interbreeding among

subpopulations was plentiful, but, the opposite appears to be true. Strong divisions between

populations are not obvious and evidence acquired from years of research on the natural history

of Swallow-tailed Kites suggests that natal and breeding philopatry is high, as is suggested for

semi-colonial nesters (Greenwood and Harvey 1982).

Are Swallow-tailed Kites dispersing long distances (defined here as over 300 kilometers)

from their natal areas? If so, they could disperse like ducks that settled to breed at the first

suitable location encountered during spring migration (Johnson and Grier 1988). This is unlikely

because long distance dispersal, if it were occurring, should have been demonstrated more often

via haplotype sharing between Genetic Populations at their proximate borders. Also, radio

tracking in the U.S. has not documented long-distance dispersal, indicating it is probably a rare

event, in which case shallow population structure should have been found within populations.

However, no population structure was found in this study or in a concurrent study of random

amplified polymorphic DNA (RAPDS) (K. Meyer, unpubl. data), suggesting that something else

must be occurring in addition to, or instead of, rare long-distance dispersal.










Incremental gene flow within populations is more likely. A scenario of gradual nesting-

neighborhood overlaps, considers the sociality of Swallow-tailed Kites and reconciles radio-

tracking and genetic data, and strong Eidelity to Genetic Population but not to nest area. If

nesting neighborhoods shifted with time, eventually overlapping, kites could transfer between

social groups, causing gene flow. Natal and breeding philopatry would still appear to be high if

movements were gradual. Transfers may occur when nests fail or when an overlapping

neighborhood is larger. In colonial nesting species, individuals may be more attracted to sites

inhabited by large numbers of conspecifies rather than areas with better habitat and few

conspecifies (Kharitonov and Siegel-Causey 1988, Serrano et al. 2004). Biological evidence for

transfers of breeding kites is that nesting neighborhoods are abandoned occasionally (Meyer

1995, Meyer 2004).

Genetic analysis is useful in that it can detect movements that are rare or incremental

(Edwards 1993, Baker et al. 1993, Pitra et al. 2004). Without biological data, however, the scale

of these movements is difficult to determine. A combination of genetic and biological data

suggests that while strong natal philopatry is not a complete explanation for divisions in

Swallow-tailed Kite, fidelity to nesting neighborhoods may explain some of the observed

divi sion.

Implications

Although Swallow-tailed Kites are one of the most mobile species in the world, their

movements do not appear to increase dispersal of their genes. Instead, two small genetically

unique populations have formed on either side of a large diverse population. These temperate

populations occupy areas where habitat alteration is extreme. Small population size and an










apparent inability to disperse long distances make these populations vulnerable in zones where

environmental change is imminent (Cain et al. 2000, Sutherland 2000, Trakhtenbrot 2005).

Information about U.S. population dynamics and the degree to which it is genetically

distinct will inform conservation planning and decisions about how management resources are

allocated. Swallow-tailed Kite dispersal into populations encountered during the non-breeding

season is probably not affecting population dynamics in the U.S. Gene flow appears to occur

among Swallow-tailed Kite subpopulations, in which case U.S. reintroduction programs may

have flexibility in choosing donors (as long as they are from the U.S.). Primers developed and

geographically-linked molecular and morphological markers discovered in this study will be

valuable for future Swallow-tailed Kite research.

Swallow-tailed Kite breeding populations in South America were unstudied prior to this

project. This research has demonstrated the importance and vulnerability of several habitats in Brazil.

Nests were found within humid forested fragments of cerrado and in the Atlantic rain forest. The

cerrado, which houses much biodiversity, is less protected and undergoing more modification than

most other biomes in South America (Myers et al. 2000, da Silva and Bates 2002). It is well known

that less than 8% of the Atlantic rainforest remains (Myers et al. 2000). Lesser known is the plight of

habitat found on cattle ranches in the states of Mato Grosso and Mato Grosso do Sul. All Swallow-

tailed Kite nests were found on ranches, except in southeastern Brazil where ranches are rare. Nest

success was very high on ranch lands, higher than in forests of southeastern Brazil (unpubl. data).

However, land there is in high demand for agricultural development (Haase 1998). Owners of ranches

where nests were found for this study are all considering conversion to agriculture (row-cropping) for

financial reasons. While ranch land hosts many species of wildlife and appears to provide a variety of

habitats, crop land in this region contains no apparent wildlife habitat (pers. obs.).









Contrary to traditional thought, this study suggests that migratory species do not

necessarily experience fewer restrictions on gene flow than other species. The proposition that

migration enables the dispersal of genes, primarily via dispersal of individuals (Paradis et al.

1998, Sutherland 2000), could lead to the prediction that migratory species are relatively resilient

to environmental stochasticity (Trakhtenbrot 2005). Instead, behavior of long-distance migrants

is subj ect to strong selection, and the resulting loss of phenotypic plasticity may constrain short

term responses to natural selection (examples given pg. 169, Pulido and Berthold 2004).

Ironically, long-distance migrants might be limited in their movements.

A cryptic pattern of divergence in long-distance migratory species may have been

revealed in this study, where bird movements are initially flexible as migration patterns evolve

and gradual cessation of gene flow occurs as migratory patterns become specialized. Under this

scenario, long-distance migration facilitates reproductive isolation/speciation in two main ways.

It allows for the displacement of populations in space and/or time. Then, strong selection

associated with the migratory behavior of long-distance migrants limits flexibility during

migration, such that dispersal of genes does not occur. Migration might contribute

to diversification in a third way, in species whose populations are j oined for portions of the year.

Interaction might stimulate increased mating discrimination through reinforcement, especially

if at least one of the populations is breeding, as is the case with Swallow-tailed Kites and a

number of other migratory species including: Ictinia plumbea (pers. obs.), various raptors

(Bildstein 2004), many passerines (Stotz et al. 1996), storks and rollers (Safriel 1995),

"migratory divide" species (Irwin and Irwin 2005), and others (pg. 110, Rappole 1995).

Speciation in such cases is cryptic in that populations are not necessarily morphologically

distinguishable and they interact.









CHAPTER 5
SUMMARY

Regardless of great vagility, extensive interaction throughout their trans-equatorial range,

and apparent phenotypic similarity, there exist deep genetic divisions in the Swallow-tailed Kite.

I found no evidence of gene flow among populations that could be attributed to migratory

behavior. This study lends support to the hypothesis that long-distance migration can enable

speciation and demonstrates that migratory behavior does not necessarily hinder differentiation

or cause panmixia. I speculated on potential isolating mechanisms and constraints that could

explain the extent to which gene flow is restricted among populations, while levels of interaction

are high and natal philopatry is apparently not strong enough to cause genetic divisions within,

let alone among, populations. Flexibility in dispersal patterns that might have accompanied the

evolution of migration in Swallow-tailed Kites is not evidenced through recent gene flow,

suggesting that they are not opportunistic settlers or breeders. Population boundaries were

unexpected, as was the lack of phylogeographic structure within each population. Gene flow

within populations is probably due to short-distance dispersal.

Analyses suggested a neotropical species origin with Pleistocene diversification. Three

populations maintained isolation throughout glacial cycles and accompanying range changes,

eventually resulting in a distribution where a large neotropical population composed of putative

residents and migrants is bordered to the north and south by smaller temperate-breeding

populations of long-distance migrants. Current subspecies designations distinguish the most

divergent Swallow-tailed Kite population (E~f forficatus) but do not consider the full genetic

diversity of the species. They are not based on sound rationale, since morphological variables

considered here were not diagnostic for any Genetic Population, and appeared to be

ecophenotypic. I reflect on evolutionary implications and conservation for the Swallow-tailed









Kite and similar species. My objective in this study was to document evolutionary processes in

the Swallow-tailed Kite, especially as they relate to migratory behavior, not to draw taxonomic

conclusions; however, I recommend that the genetic uniqueness of the three Genetic Populations

be considered in conservation planning.

This study suggests several areas for future research. Temperate/tropical migratory

species such as Elanzus leucurus and Ictiniaplumbea may have population structures similar to

the Swallow-tailed Kite. Studies on the history and level of diversification in these species could

help resolve the legitimacy of many hypotheses offered here. To gain insight into restricted gene

flow among Swallow-tailed Kite populations, I recommend research gauging population

reproductive isolation and differences in non-visual mating cues, especially song. Microsatellite

markers may allow comparison between migratory and resident population structures in

Swallow-tailed Kites breeding in northern and central South America. Comparing wing and tail

measurements between these groups would also help test a hypothesis of morphological stasis

due to flight-related selection in the species. To determine the degree of dispersal among

breeding areas within Genetic Populations, rigorous radio-tracking data, mark recapture

methods, or the use of stable isotopes could be helpful. Finally, increased sampling in cytb

might illuminate population origins.



























APPENDIX A
SAMPLE INFORMATION










Table A-1. Sample collection information
Sample Species Date of Country Location of Age Sex Breeding, measurement, or Tissue Certain
name collection collection* collection Information** breeder?***


FL 0500 Elanoides f
forficatus


Summer United
2000 States

Summer United
2001 States

Summer United
2000 States


Summer United
2001 States

Summer United
2000 States


Summer United
2000 States


Summer United
1999 States

Summer United
1998 States

Summer United
1999 States


Fish Camp
nest, Levy Co.,
North Florida
Road 31 nest,
Levy Co.,
North Florida
MacIntire
Moody nest,
Levy Co.,
North Florida
Buckfish nest,
Levy Co.,
North Florida
Parker Rock Pit
nest, Levy Co.,
North Florida

Buck Island 1
nest, Levy Co.,
North Florida

Flowing Well
nest, Levy Co.,
North Florida
Gulf Hammock
nest, Levy Co.,
North Florida
Lake Disston
nest, Flagler
Co., Central
Florida


A M Sample collected at nest.



AHY F Sample collected at nest.


A F Sample collected at nest.


Blood Yes



Blood Yes


Blood Yes




Blood Yes


Blood Yes



Blood Yes



Blood Yes


Blood Yes



Blood Yes


FL 0601 Elanoides
Forficatus

FL 0800 Elanoides f
forficants


FL 1001 Elanoides f
forficants

oo FL 0900 Elanoides J
forficants


FL 1000 Elanoides f
forficants


FL 0199 Elanoides f
forficants

FL 0598 Elanoides f
forficants

FL 0299 Elanoides f
~forficatus


A F Sample collected at nest.


A M Sample collected at nest.



A F Sample collected at nest.



A F Sample collected at nest.


YOY M


Sample collected at nest.


A M Sample collected at nest.










Table A-1 (cont.)
Sample Species Date of Country Location of Age Sex Breeding, measurement, or Tissue Certain
name collection collection* collection Information** breeder?***


FL 3 1 Elanoides f
forficatus


FL 7 Elanoides f
forficatus

FL 17 Elanoides f
forficatus

FL 10 Elanoides f
forficatus



FL 39 Elanoides f
forficatus


FL 43 Elanoides f
forficatus


FL 11 Elanoides f
forficatus



FL 15 Elanoides f
forficatus


Summer United
1996 States



Summer United
1995 States


Summer United
1995 States

Summer United
1995 States



Summer United
1996 States


Summer United
1996 States


Summer United
1995 States



Summer United
1995 States


The Blocks
nest, Collier
Co., South
Florida
The Loop nest,
Monroe Co.,
South Florida
The Everglades
nest, Dade Co.,
South Florida
Bear Island
nest, Collier
Co., South
Florida
Crew nest, Lee
Co., South
Florida

Bar-D nest,
Highlands Co.,
Central Florida

Highlands
Hammock nest,
Highlands Co.,
Central Florida

Kicco nest,
Highlands Co.,
Central Florida


YOY M Sample collected at nest.


Blood Yes


YOY M Sample collected at nest.



YOY M Sample collected at nest.



YOY F Sample collected at nest.




YOY M Sample collected at nest.



YOY F Sample collected at nest.



YOY M Sample collected at nest.




YOY F Sample collected at nest.


Blood Yes



Blood Yes



Blood Yes




Blood Yes


Blood Yes



Blood Yes




Blood Yes










Table A-1 (cont.)
Sample Species Date of Country Location of Age Sex Breeding, measurement, or Tissue Certain
name collection collection* collection Information** breeder?***


FL 8 Elanoides f
forficatus


FL 0898 Elanoides f
forficatus

FL 2398 Elanoides f
forficatus


FL 2198 Elanoides f
forficatus



FL 1898 Elanoides f
forficatus


Summer United
1995 States


Summer United
1998 States


Summer United
1998 States


Summer United
1998 States



Summer United
1998 States


Tiger Creek
nest, Polk Co.,
Central Florida

Osceola nest,
Columbia Co.,
North Florida
Gunter's nest,
Marion Co.,
North Florida

Ochlockonee
nest, Franklin
Co., Northwest
Florida

Apalachicola
nest, Liberty
Co., Northwest
Florida

Finger N
Additions nest,
Collier Co.,
South Florida
Fern Hammock
nest, Marion
Co., North
Florida
Rainbow
Springs nest,
Marion Co.,
North Florida


YOY F Sample collected at nest.



YOY M Sample collected at nest.



YOY F Sample collected at nest.



YOY F Sample collected at nest.




YOY M Sample collected at nest.


Blood Yes


Blood Yes



Blood Yes



Blood Yes




Blood Yes


FL 9 Elanoides f
forficatus


FL 1398 Elanoides f
forficatus


FL 1198 Elanoides f
forficatus


Summer United
1995 States



Summer United
1998 States


Summer United
1998 States


YOY F Sample collected at nest.


Blood Yes




Blood Yes



Blood Yes


YOY F


Sample collected at nest.


YOY F Sample collected at nest.










Table A-1 (cont.)
Sample Species Date of Country Location of Age Sex Breeding, measurement, or Tissue Certain
name collection collection* collection Information** breeder?***


FL 2298 Elanoides f
forficatus



FL Elanoides f
Museum forficatus


LA 76 Elanoides f
forficatus



LA 78 Elanoides f
forficatus




LA 79 Elanoides f
forficatus




LA 81 Elanoides f
forticatus


Summer United
1998 States


Tosohatchee
nest, Orange
Co., Central
Florida
Raccoon Point,
Collier Co.,
South Florida

Carroll Dr.
nest, Lacombe,
St. Tammany
Parish,
Louisiana
Ormond nest,
Pearl River, St.
Tammany
Parish,
Louisiana
Blackwell's
Trailer nest,
Pearl River, St.
Tammany
Parish,
Louisiana
Boque Chitto
NWR nest,
Talisheek, St.
Tammany
Parish,
Louisiana


YOY F Sample collected at nest.


Blood Yes


United
States


United
States



United
States




United
States





United
States


YOY unk Sample collected from dead,
recent fledgling, in nesting
area.

YOY M Sample collected at nest.





YOY M Sample collected at nest.





YOY M Sample collected at nest.






YOY M Sample collected at nest.


Skin


35217


35964





35974





35974






35974


Blood Yes





Blood Yes





Blood Yes






Blood Yes










Table A-1 (cont.)
Sample Species Date of Country Location of Age Sex Breeding, measurement, or Tissue Certain
name collection collection* collection Information** breeder?***


SC CC1 Elanoides f
forficatus


SC W1- Elanoides f
158 forficatus



SC # 2 Elanoides f
forficatus

SC Elanoides f
Dead forficatus



GA 18 Elanoides f
forficatus

GA 19 Elanoides f
forficatus
GA 20 Elanoides f
forficatus


AL 27 Elanoides spp.


B1 Elanoides f
yetapa


35947


United
States



United
States


Cedar Creek
nest, Charleston
Co., South
Carolina
Francis Marion
NF nest,
Berkeley Co.,
South Carolina

Big Lake nest,
Horry Co.,
South Carolina
Black Mingo
nest,
Georgetown
Co., South
Carolina
Satilla River
nest, Brantley
Co., Georgia
McIntosh Co.
nest, Georgia
Steed nest,
Brantley Co.,
Georgia
Monroe Co.,
Alabama

Vitor's nest,
Florianopolis,
Santa Catarina


unk unk Sample collected at nest.


Blood Yes


35947


unk unk Sample collected at nest.


Blood Yes


36678


36708


United
States

United
States


unk unk Sample collected at nest.


YOY unk Sample collected from dead
nestling below nest.



YOY M Sample collected at nest.



YOY M Sample collected at nest.


YOY M Sample collected at nest.



A F Specimen "Coll. by Lonnie
Williamson, prep.& descr.by
R.W. Skinner. E.f~yetapa?"
YOY unk Sample collected at nest.


Blood Yes


Liver Yes





Blood Yes



Blood Yes


Blood Yes


Summer United
2000 States


Summer
2000


United
States


Summer United
2000 States


23484


United
States


Skin


36126 Brazil


Blood Yes










Table A-1 (cont.)
Sample Species Date of Country Location of Age Sex Breeding, measurement, or Tissue Certain
name collection collection* collection Information** breeder?***


B2 Elanoides f
yetapa


B3 Elanoides f
yetapa



B4 Elanoides f
yetapa


36126 Brazil


Vitor's nest,
Florianopolis,
Santa Catarina

Campana nest,
Dourados,
Mato Grosso do
Sul
Seccl nest,
between
Caceres &
Cuiaba, Mato
Grosso

Secc2 nest,
between
Caceres &
Cuiaba, Mato
Grosso

Quarry2 nest,
Florianopolis,
Santa Catarina

Rancho Alegre
nest, Engenho
near Cuiaba,
Mato Grosso

Florianopolis,
Santa Catarina


A F Sample collected at nest.
Parent of Bl.


YOY unk Sample collected at nest.


Blood Yes


36131


Brazil


Blood Yes


36140 Brazil


YOY unk Sample collected at nest.


Blood Yes


B5 Elanoides f
yetapa


36141


Brazil


YOY unk Sample collected at nest.


Blood Yes


Elanoides f
yetapa


Elanoides f
yetapa



Elanoides f
yetapa


36146 Brazil



36527 Brazil


YOY unk



YOY unk


Sample collected at nest.



Sample collected at nest.


Blood Yes



Blood Yes


36495 Brazil


A M Sample taken from bird found Liver
dying near local nesting area.
Gonads 3X5 & 2X6mm










Table A-1 (cont.)
Sample Species Date of Country Location of Age Sex Breeding, measurement, or Tissue Certain
name collection collection* collection Information** breeder?***


B-bone Elanoides f
yetapa


36528 Brazil


Rancho Alegre
dead, Engenho
near Cuiaba,
Mato Grosso

Palmital nest 1,
Barra dos
Bugres, Mato
Grosso

Palmital nest 2,
Barra dos
Bugres, Mato
Grosso
Palmital nest 3,
Barra does
Bugres, Mato
Grosso

Palmital nest 4,
Barra dos
Bugres, Mato
Grosso

Casa Verde
nest 1, Casa
Verde, Mato
Grosso do Sul
Casa Verde
nest 2, Casa
Verde, Mato
Grosso do Sul


YOY unk Sample taken from nestling
found dead in nesting area.


Bone Yes


B1-00 Elanoides f
yetapa



B2-00 Elanoides f
yetapa



io B3-00 Elanoides f
yetapa



B4-00 Elanoides f
yetapa


36867 Brazil




36867 Brazil




36868 Brazil




36868 Brazil


YOY unk Sample collected at nest.




YOY unk Sample collected at nest.




YOY unk Sample collected at nest.




YOY unk Sample collected at nest.


Blood Yes




Blood Yes




Blood Yes




Blood Yes


B5-00 Elanoides f
yetapa



B6-00 Elanoides f
yetapa


36871




36871


Brazil




Brazil


YOY unk Sample collected at nest.




YOY unk Sample collected at nest.


Blood Yes




Blood Yes










Table A-1 (cont.)
Sample Species Date of Country Location of Age Sex Breeding, measurement, or Tissue Certain
name collection collection* collection Information** breeder?***


B7-00 Elanoides f
yetapa



B8-00 Elanoides f
yetapa


B9-00 Elanoides f
yetapa



B10-00 Elanoides f
yetapa


B11-00 Elanoides f
yetapa

B-Flor Elanoides f
yetapa

B-QF Elanoides f
yetapa


B- SF Elanoides f
yetapa


36871


Brazil


Casa Verde
nest 3, Casa
Verde, Mato
Grosso do Sul

Casa Verde
nest 4, Casa
Verde, Mato
Grosso do Sul
Paranagua, Rio
Guaraguacu,
Parana


Carijos nest 1,
Florianopolis,
Santa Catarina

Carijos nest 2,
Florianopolis,
Santa Catarina
Florianopolis,
Santa Catarina

Quarryl nest,
Florianopolis,
Santa Catarina

Secc'00 nest,
between
Caceres &
Cuiaba, Mato
Grosso


YOY unk Sample collected at nest.


Blood Yes


36871


Brazil


YOY unk Sample collected at nest.


Blood Yes




Heart Yes




Blood Yes



Blood Yes


33555 Brazil




36874 Brazil



36874 Brazil



11/01/00? Brazil


36146 Brazil


A F Specimen "Gonads 15X8
[cm:?]; Varios ovos 4mm.
Cranium quase ossif. Coll. M.
Bornschein""

YOY unk Sample collected at nest.



YOY unk Sample collected at nest.



A unk Sample taken from bird found
dying near local nesting area.

A unk Sample collected from nest
with eggs.


unk unk Sample collected from nest
with nestling.


Liver


Feather Yes


36526 Brazil


Feather Yes










Table A-1 (cont.)
Sample Species Date of Country Location of Age Sex Breeding, measurement, or Tissue Certain
name collection collection* collection Information** breeder?***


GF1


Elanoides f
yetapa



Elanoides f
yetapa


Elanoides f
yetapa



Elanoides f
yetapa


33025 Guatemala Tikal


unk unk Sample collected from ground
under roost of birds in local
nesting area during nesting
season.
unk unk Sample collected from ground
under roost of birds in local
nesting area during nesting
season.
unk unk Sample collected from ground
under roost of birds in local
nesting area during nesting
season.
unk unk Sample collected from ground
under roost of birds in local
nesting area during nesting
season.

YOY unk Sample collected from dead
nestling in nest.

YOY unk Sample collected at nest.


A F Sample collected at nest.
Parent of G-W2

YOY unk Sample collected at nest.


A M Sample collected at nest.
Parent of G-W2


Feather Yes


GF2




GF3




GF4


33025 Guatemala Tikal




33025 Guatemala Tikal




33025 Guatemala Tikal


Feather Yes




Feather Yes




Feather Yes


G- W1 Elanoides f
yetapa

G- W2 Elanoides f
yetapa
G- W3 Elanoides f
yetapa

G- W4 Elanoides f
yetapa
G- W5 Elanoides f
yetapa

CR- 1 Elanoides/ J
yetapa


36302 Guatemala Mundo Perdido
nest, Tikal

36303 Guatemala Plaza Mayor
nest, Tikal
36305 Guatemala Plaza Mayor
nest, Tikal

36307 Guatemala Uaxactun


36308 Guatemala Plaza Mayor
nest, Tikal


Skin-
wet


Blood Yes


Blood Yes


Blood Yes


Blood Yes


7486


Costa
Rica


Navaritto


A F Specimen


Skin










Table A-1 (cont.)
Sample Species Date of Country Location of Age Sex Breeding, measurement, or Tissue Certain
name collection collection* collection Information** breeder?***


CR-2 Elanoides/
yetapa
G-4 Elanoides/
yetapa
P-5 Elanoides/
yetapa

P-6 Elanoides/
yetapa
S-7 Elanoides/
yetapa

V-9 Elanoides/
yetapa
V-10 Elanoides f
yetapa
V-11 Elanoides f
yetapa

V-12 ElanoidesJ
yetapa
V-13 Elanoides f
yetapa
V-14 Elanoides f
yetapa



V-15 Elanoides f
yetapa


7447

9264

9287


9313


Costa
Rica


Navaritto


A F Specimen "skin on breast
thickened"
A M Specimen

A M Specimen; "W Panama, Cape
Mala Peninsula; 1200 alt."

A M Specimen; "W Panama, Cape
Mala Peninsula; 1200 alt."

A M Specimen


A M Specimen "lat/long=
6.16N/61.38.60W 1312 feet"
A F Specimen "lat/long=
6.16N/61.38.60W 1312 feet"

A M Specimen "lat/long=
6.16N/61.38.60W 1312 feet"


Skin

Skin

Skin


Guatemala Finca Sepacuite

Panama Cerro Largo


Panama Cerro Largo


Skin No


8018 Surinam Lelydorp
("Lelqosp" on
tag?)
7/7/1897 Venezuela Valle


4/8/1895 Venezuela Valle


Skin


Skin


Skin


1297


Venezuela Valle


Skin No


Skin No

Skin No


6/22/1895 Venezuela Merida, Culata

4/1/1894 Venezuela Merida, Greril


4/27/1896 Venezuela Sucupana




4/27/1896 Venezuela Sucupana


M Specimen


A unk Specimen


A F Specimen "53x122" ovary;
specimen plumage in molt or
worn plumage w/ missing 6th
rectrix.

A F Specimen "54x114" ovary


Skin




Skin










Table A-1 (cont.)
Sample Species Date of Country Location of Age Sex Breeding, measurement, or Tissue Certain
name collection collection* collection Information** breeder?***


V-16 Elanoides f
yetapa
V-17 Elanoides/
yetapa
V-2 1 Elanoides f
yetapa



E-26 Elanoides f
yetapa

C-28 Elanoides f
yetapa


M-29 Elanoides f
yetapa


4/27/1896 Venezuela Sucupana

7/22/1896 Venezuela San Antonio,
Bermudez


A F Specimen "34x14.5" ovary


Skin


A unk Specimen


Skin No


33079


Venezuela Bolivar


A F Specimen "40 km E. of
Tumaremo on rd. to
Bochinche; ovary 12x15,
follicle approx. Imm; no
moult"
A M Specimen "ne San Francisco
de Panguri; gonads 15x5mm"

A M Specimen "Rio Anchicaya km.
72, Lat N3.65 Long W76.933,
eley. 1900 ft., testis 11 mm"
A M Specimen "28 mi. ese Comitan
de
Dominguez,N16.094W9 1.7391
4900 ft.;Coll. FA Pitelka;testis
9 mm"
A F Specimen "6500 ft."


A M Specimen "6000 ft."


A M Specimen "6600 ft."


A M Specimen


Skin-
wet



Skin


Skin



Skin


33803 Ecuador Zamora-
Chinchipe

21300 Columbia Depto. Valle
del Cauca


18370 Mexico Chiapas


C-39 Elanoides f
yetapa

C-40 Elanoides f
yetapa

C-4 1 Elanoides f
yetapa

C-42 Elanoides f
yetapa


14217 Columbia El Tambo,
Cerro
Munchique
14217 Columbia El Tambo,
Cerro
Munchique
14230 Columbia El Tambo,
Cerro
Munchique
14217 Columbia El Tambo,
Cerro
Munchique


Skin


Skin


Skin


Skin










Table A-1 (cont.)
Sample Species Date of Country Location of Age Sex Breeding, measurement, or Tissue Certain
name collection collection* collection Information** breeder?***


CR-43 Elanoides f
yetapa
H-44 Elanoides f
yetapa
H-45 Elanoides f
yetapa
P-46 Elanoides f
yetapa

A-47 ElanoidesJ
yetapa

Bel-48 Elanoides f
yetapa
CR-50 Elanoides f
yetapa
G-5 1 Elanoides/ J
yetapa
M-52 Elanoides f
yetapa

S-54 Elanoides/
yetapa
S-55 Elanoides/
yetapa
V-56 Elanoides f
yetapa

V-57 Elanoides f
yetapa


3785

12960

12960

24221


Costa
Rica
Honduras

Honduras

Panama



Argentina


British
Honduras
Costa
Rica
Guatemala

Mexico


Limon, Limon


Copan

Copan

Volcan de
Chiriqui, near
El Hate

Misiones, Pto.
Segundo
Sitte R.

El General


Finca Sepacuite

Saltillo


A M Specimen

A M Specimen "gonads fully
enlarged"
A F Specimen "gonads fully
enlarged"
A M Specimen "gonads 11Ixbmm;"
Lat NO84900 Long WO823800


A M Specimen "Coll. J Mogenson"


A M Specimen

A M Specimen "Coll. C.F.
Underwood"
A M Specimen "Coll. A.W.
Anthony"
A F Specimen "parent of set of
eggs in my collection. Coll. J
Johnson"
A F Specimen

A F Specimen

A M Specimen "3000 ft.; Coll.
Gabaldon e hijos" Molting.

A M Specimen "3000 ft.; blue eyes;
Coll. Gabaldon e hijos"


Skin

Skin

Skin

Skin



Skin


Skin

Skin

Skin

Skin


Skin

Skin

Skin


Skin


6332


2674

3106

9294

3021


8020

8038

3785


2364


i


Surinam Scholelweg,
Lelydorp
Surinam Scholelweg,
Lelydorp
Venezuela Merida Region,
Cupas

Venezuela Merida Region,
Culata










Table A-1 (cont.)
Sample Species Date of Country Location of Age Sex Breeding, measurement, or Tissue Certain
name collection collection* collection Information** breeder?***


V-58 Elanoides f
yetapa


3037


Venezuela Merida, Culata


A M Specimen "eley. 2500 ft.; blue
eyes; Coll. Gabaldon e hijos"
Plumage indicates age 1.5
years.
YOY unk Specimen; YOY; tail 10-12cm;
"blue eyes"

A M Specimen; largest gonad
10X~mm (size drawn on tag)

A F Specimen "Pueblo Nuevo
Solistahuacan, Rancho Nuevo
Mundo;1900m eley."
A M Specimen "Villa Allende
Tolemayla, 20 km to the
northeast; Coll. W.J.Sheffler"
A F Specimen; eastern Peru;"ovary
32 mm, largest ova 4mm"
A F Specimen "Buenos Aires, Las
Animas, ovary enlarged; Coll.?
Paul Slud"

A F Specimen "ready to lay
(shelled egg in oviduct); Coll.?
J. Van Tyne"
A M Specimen "Champoton,
Esperanza; Coll.? PW
Shufeldt"
A F Specimen "Champoton,
Esperanza; Coll.? PW
Shufeldt"


Skin


V-59 Elanoides f
yetapa

Bel-6 1 Elanoides f
yetapa

M-62 Elanoides f
yetapa

M-63 Elanoides f
yetapa


4188


Venezuela Merida region


Skin


Skin


Skin



Skin



Skin


Skin



Skin



Skin



Skin


20638 Belize Orange walk
District:Gallon
Jug
19104 Mexico Chiapas



21335 Mexico Chiapas


Per-64 Elanoides f
yetapa
CR-65 Elanoides f
yetapa

G-66 Elanoides f
yetapa

M-67 Elanoides f
yetapa

M-68 Elanoides f
yetapa


22868 Peru


19129 Costa
Rica


Ucayali Dept:
Yarinacocha


Puntarenas


11416 Guatemala Peten,
Uaxactun


Mexico Campeche



Mexico Campeche


4856



4856










Table A-1 (cont.)
Sample Species Date of Country Location of Age Sex Breeding, measurement, or Tissue Certain
name collection collection* collection Information** breeder?***


M-69 Elanoides f
yetapa

M-70 Elanoides f
yetapa


4856


4856



17344


Mexico Campeche


Mexico Campeche



Surinam Republick


A M Specimen "Champoton,
Esperanza; Coll.? PW
Shufeldt"
A M Specimen "Champoton,
Esperanza; Coll.? PW
Shufeldt"
A F Specimen; near Paramaribo?
Coll.? "Francois
Haverschmidt"
A M Specimen "Coll. Ollala and
Sons"

A M Specimen "Turrialba"

A F Specimen "Turrialba"

A F Specimen "Demerara River"



A F Specimen "lat 063300N long
0574400 W"
A M Specimen "Cordillera de Los
Culata; blue eyes"

YOY F Specimen; Bajo Cauca
Province; <1yr. old based on
plumage; "12 km NW Pto.
Antioquia"
A M Specimen "25 mi. w of
Simiti;" plumage molt


Skin


Skin



Skin


S-71


Elanoides f
yetapa


E-73 Elanoides f
yetapa

CR-74 Elanoides f
yetapa
CR-75 Elanoides f
yetapa
Guy-76 Elanoides f
yetapa


Guy-77 ElanoidesJ
yetapa
V-79 Elanoides f
yetapa

C-8 1 Elanoides f
yetapa


C-82 Elanoides f
yetapa


11094 Ecuador Mindo-
Occidentale


Skin No


Skin No


Skin No

Skin No



Skin No


4/14/1899 Costa
Rica
188 Costa
Rica


Cartago Prov.

Cartago Prov.


3/1/1890 Guyana West
Demerara-
Essequibo
Coast Dist.
6/1/1891 Guyana Abary


4945


Venezuela Merida Prov.


Skin


Skin


17648 Columbia Antioquia;
Taraza, Rio
Taraza

17302 Columbia Bolivar;
Volador


Skin No





Table A-1 (cont.)
Sample Species
name
C-83 Elanoides f
yetapa
C-85 Elanoides f
yetapa

CR-86 Elanoides f
yetapa
CR-87 Elanoides f
yetapa
H-89 ElanoidesJ
yetapa
V-9 1 Elanoides f
io yetapa


V-92 Elanoides f
yetapa
CR-93 Elanoides f
yetapa


Date of
collection
15318


15880


3023


3023


6/15/1887


17696



1215


26053




24609


24609


23115


Country

Columbia


Columbia


Costa
Rica
Costa
Rica
Honduras


Venezuela



Venezuela


Costa
Rica



Costa
Rica
Costa
Rica
Mexico


Location of
collection*

Caqueta;
Morelia
Norte de
Santander;
Convencion
Bonilla


Bonilla


Segovia River


Monagas,
Cairara


Merida; Culata


Puntarenas,
Helechales



San Jose, San
Gerardo
San Jose, San
Gerardo

Chiapas


Sex


M


F


M


M


unk


F



M


F




F


M


M


Breeding, measurement, or
collection Information**

Specimen


Specimen; plumage molt


Specimen


Specimen


Specimen


Specimen; Probably Caicara;
"Female gonads slightly
enlarged"

Specimen; "3000m"


Specimen "15 km ene Potrero
Grande; ovary 20x12mm;
Lgst. follicle 4mm2; incomplt
oss., 1600 m"
Specimen "Canaan 4500 ft."


Specimen "Canaan 4500 ft."


Specimen "Comitan, Pioo
Lacantun, 85 km east"


Tissue


Skin


Skin


Skin


Skin


Skin


Skin



Skin


Skin




Skin


Skin


Skin


Certain
breeder?***
Yes


No


No


No


No


No



No


Yes




No


No


Yes


CR-94


CR-95


M-96


Elanoides f
yetapa
Elanoides f
yetapa
Elanoides f
yetapa










Table A-1 (cont.)
Sample Species Date of Country Location of Age Sex Breeding, measurement, or Tissue Certain
name collection collection* collection Information** breeder?***


CR-97 Elanoides f
yetapa


10038 Costa
Rica


Limon Prov.


A? M Specimen "Suretka, lat
NO93600, W 0825800; Coll.
Austin Paul Smith" 6-14
months of age based on
plumage .
A F Specimen "Suretka, lat
NO93600, W 0825800; Coll.
Austin Paul Smith"
A F Specimen "near Torreo, sea
level, egg with hard shell"
Green & purple iridescence
A F Specimen "ovary well
developed; found dead"


Skin No


CR-98 Elanoides f
yetapa

B-101 Elanoides f
yetapa

Ber- 102 Elanoides f
forficatus

FL-103 Elanoides f
forficatus


FL-104 Elanoides f
forficatus


FL-105 Elanoides f
forficatus

FL-106 Elanoides f
forficatus

FL-107 Elanoides f
forficatus


10038 Costa
Rica

10529 Brazil


Limon Prov.


Rio Grande do
Sul; Lagoa do
Forro


Skin No


20896 Bermuda unk


N/A


N/A



N/A



N/A


N/A


N/A


N/A


N/A



N/A



N/A


N/A


N/A


35199



36318



36664


36676


36766


United
States


United
States


United
States

United
States

United
States


Bar-D (Steve's)
nest, Highlands
Co., Central
Florida
Osceola 263
nest, Columbia
Co., North
Florida
Lower Wekiva
nest, Central
Florida
Tiger Creek
nest, Polk Co.,
Central Florida
Lake Woodruff
nest, Central
Florida


F Bird caught near nest.


A F Bird caught near nest.


M Bird caught near nest.


A M Bird caught near nest.


A F Bird caught near nest.










Table A-1 (cont.)
Sample Species Date of Country Location of Age Sex Breeding, measurement, or Tissue Certain
name collection collection* collection Information** breeder?***


FL-108 Elanoides f
forficatus


37047


37414

37779

37792


38520


38530


471


United
States

United
States
United
States
United
States

United
States

United
States

United
States


United
States


United
States

United
States

United
States


Road 5 nest,
Levy Co.,
North Florida
Gill Bay nest,
Georgia
Thalman nest,
Georgia
Steed nest,
Brantley Co.,
Georgia
Alex Creek 052
nest, AHY#1,
Georgia
Alex Creek 052
nest, AHY#2,
Georgia
Osceola Co.,
Florida


Osceola Co.,
Florida


Osceola Co.,
Florida

Brevard Co.,
Florida


A M Bird caught near nest.


A F Bird caught near nest.

A M Bird caught near nest.

A F Bird caught near nest.


N/A N/A


N/A

N/A


N/A

N/A


GA- 109 Elanoides f
forficatus
GA- 110 Elanoides f
forficatus
GA- 1 11 Elanoides f
forficatus

GA- 113 Elanoides f
forficatus

GA-114 Elanoides f
forficatus

FL-115 ElanoidesJ
forficatus


N/A N/A


F Bird caught near nest.


M Bird caught near nest.


N/A


N/A


N/A



N/A



N/A


N/A


N/A


N/A


N/A


N/A



N/A



N/A


N/A


N/A


A M Specimen: Coll. Meamns: "Big
Cypress Lake: Mated with
[176959]"
A F Specimen: Coll. Meams:"Big
Cypress Lake: Egg 14mm:
Mated with [176960]"

A F Specimen: Coll. Meamns: "Big
Cypress Lake: Mated with
[176961]"
A M Specimen: Coll. Meamns:
"Padgett creek: Mated with
[176962]"
A F Specimen: Coll. Weber: "large
yolks"


FL-116 Elanoides f
forficatus


FL-117 Elanoides f
forficatus

FL-118 Elanoides f
forficatus

FL-119 Elanoides/
forficatus


7754


Lee Co.,
Florida










Table A-1 (cont.)
Sample Species Date of Country Location of Age Sex Breeding, measurement, or Tissue Certain
name collection collection* collection Information** breeder?***


Skin sample is dry unless otherwise noted. "Wet skin", "bone", & "organ" samples stored in buffer or alcohol. Unk=
Unknown. AHY= Adult, YOY= Young of the year. *If specimen, location information from museum tag. ** Paraphrased tag
information is in quotes. *** "Yes," if genetic analyses considered this sample as definite member of breeding population
where collected.


FL-120 Elanoides f
forficatus

FL-12 1 Elanoides/ J
forficatus

FL-122 Elanoides J
forficatus

M-123 Elanoides f y.?



FL-124 Elanoides f
forficatus


7/18/1888 United
States

5/13/1892 United
States


Chatham Bend.
Monroe Co.,
Florida
Old Town,
Florida

Kissimmee
River, Florida


YOY F


Specimen: plumage indicates
less than 6 months of age


N/A N/A


A M Specimen: plumage indicates
approx. 1 year old

A M Specimen: plumage indicates
approx. 1 year old

YOY unk Specimen: plumage indicates
less than 6 months of age:
"Juv., female?, E.ff."
A unk Specimen: plumage indicates
approx. 1 year old
YOY unk Specimen: plumage indicates
less than 6 months of age
YOY unk Specimen: plumage indicates
less than 6 months of age:
"E.ff."
unk unk unk
unk unk unk

unk unk unk

unk unk unk


N/A


N/A


N/A



N/A


N/A


N/A


N/A


No



N/A


No


489


10/1875


United
States


Mexico Tehnontepec.
Cacoprieto


unk


unk


unk



unk
unk

unk

unk


United
States
British
Guiana


Guy-
125


Elanoides f: y. ?


G-126 Elanoides f y.?



Pernis Pernis apivorus
Elanl0 Elames
caentleus
Miss Ictinia

Elan8 Elames
caentleus


Guatemala unk


Blood N/A
Blood N/A

Liver N/A

Blood N/A











Table A-2. Sample contributor, population designations, and accession numbers
Sample Museum/ Museum Dataset Biol. Sub Clade Gene. Genbank accession #s
name Contributor record # pop. pop. pop.
FL 0500 N/A N/A CR Breeder LongCR Breeder N D N N EU012029; EU012099;


Short, CR ALL Short, ENOL
ALD2, LDH2,ORN2, Morph
ORN2
CR Breeder Long, CR Breeder
Short, CR ALL Short, ENOL,
ALD2, LDH2, ORN2
LDH2, ORN2

CR Breeder Long, CR Breeder
Short, CR ALL Short, ENOL
ALD2, LDH2, ORN2
CR Breeder Long, CR Breeder
Short, CR ALL Short, ALD2,
LDH2, ORN2
CR Breeder Long, Cytb, CR
Breeder Short, CR ALL Short,
LAM, ENOL, ORN2
CR Breeder Long, CR Breeder
Short, CR ALL Short, LAM,
ENOL, ALD2, ORN2
CR Breeder Long, Cytb, CR
Breeder Short, CR ALL Short,
LAM, ENOL, ALD2, ORN2,
Morph
CR Breeder Long, CR Breeder
Short, CR ALL Short, LAM,
ENOL, ALD2, LDH2, ORN2


EU0 12100; EU0 12118:
EU0 12126; EU0 12132
N/A N/A N/A N/A EU0 12118
N D N N EU0 12030: EU0 12099;
EU0 12118: EU0 12126;
EU0 12127; EU0 12132
N/A N/A N/A N/A EU0 12118: EU012127

N D N N EU0 12028: EU0 12099;
EU0 12118: EU0 12126;
EU012127; EU0 12132
N D N N EU012036; EU0 12099;
EU012100; EU0 12118:
EU012126; EU012127


FL 0601 N/A
FL 0800 N/A


FL 1001 N/A

FL 0900 N/A



FL 1000 N/A


FL 0199 N/A



FL 0598 N/A


FL 0299 N/A



FL 31 N/A


N/A
N/A


N/A

N/A



N/A


N/A



N/A


N/A



N/A


N D N N EU012031;
EU012097:
EU012118:


EU0 12092:
EU0 12098:
EU012132


D N N EU012032; EU0 12098:
EU012099; EU012118:
EU012132


N D N N EU0 12038:
EU0 12098:
EU0 12100;
EU0 12132
N B N N EU0 12040:
EU0 12099;
EU0 12126;
EU0 12132


EU0 12091:
EU0 12099;
EU0 12118:

EU0 12098:
EU0 12118:
EU0 12127;











Sample Museum/ Museum Dataset Biol. Sub Clade Gene. Genbank accession #s
name Contributor record # pop. pop. pop.
FL 7 ?LY< ?LY CR Beeder Long.CTL hreeder N B N N 190012037;I900 12098;


Table A-2


(cont.)


Short, CR ALL Short, LAh,
ENOL, ORN2
CR Breeder Long, CR Breeder
Short, CR ALL Short, LAh,
ENOL, ORN2
CR Breeder Long, CR Breeder
Short, CR ALL Short, LAh,
ENOL, ORN2
CR Bheeder Long, CTL reeder
Short, CR ALL Short, LAh,
ENOL, ORN2
CR Breeder Long, CR Breeder
Short, CR ALL Short, LAh,
ENOL, ORN2
CR Bheeder Long, CTL reeder
Short, CR ALL Short, LAh,
ENOL, ORN2
CR Breeder Long, CR Breeder
Short, CR ALL Short, LAh,
ENOL, ORN2
CR Breeder Long, CTL reeder
Short, CR ALL Short, LAh,
ENOL, ORN2

CR Breeder Long, CR Breeder
Short, CR ALL Short, LAh,
ENOL, ORN2


EU1012118; EU1012132


FL 17 N/A


FL 10 N/A



FL 39 N/A<



FL 43 N/A


FL 11 N/A<



FL 15 N/A


N/A


N/A



N/A<



N/A


N/A<



N/A



N/A<



N/A


A N N EU0 12039; EU0 12098;
EU1012118; EU1012132

B N N EU012038; EU0 12098;
EU1012118; EU1012119;
EU012132
B N N 190012038;I900 12098;
11012118; E1012132

C N N EU012041; EU0 12098;
11012118; E1012132

C N N 190012045; EU0012098;
E11012118; ER012132


C N N EU0 12045; EU0 12098;
11012118; E1012132


C N N 190012030; I90012098;
11012118; E1012132


D N N EU0 12032; EU0 12098;
11012118; E1012132


FL 8


N/A<


FL 0898 N/A











Sample Museum/ Museum Dataset Biol. Sub Clade Gene. Genbank accession #s
name Contributor record # pop. pop. pop.
FL 2398 N/A N/A CR Breeder Long.CR Breeder N D N N EU0 12032; EU0 12098:


Table A-2


(cont.)


Short, CR ALL Short, LAM,
ENOL, ORN2

CR Breeder Long, CR Breeder
Short, CR ALL Short, LAM,
ENOL, ALD2, ORN2
CR Breeder Long, CR Breeder
Short, CR ALL Short, LAM,
ENOL, ORN2

CR Breeder Long, CR Breeder
Short, CR ALL Short, LAM,
ENOL, ALD2, ORN2

CR Breeder Long, CR Breeder
Short, CR ALL Short, LAM,
ENOL, ALD2, ORN2
CR Breeder Long, CR Breeder
Short, CR ALL Short, LAM,
ENOL, ORN2
CR Breeder Long, CR Breeder
Short, CR ALL Short, LAM,
ENOL, ALD2, ORN2

CR Breeder Short, CR ALL
Short
CR Breeder Long, CR Breeder
Short, CR ALL Short, LAM,
ENOL, ORN2


EU0 12118: EU0 12132


FL 2198 N/A



FL 1898 N/A


N/A



N/A



N/A



N/A



N/A



N/A


N E N N EU0 12035; EU0 12098:
EU0 12099; EU0 12118:
EU0 12132
N E N N EU012034; EU0 12098:
EU0 12118: EU0 12132


N B N N EU012038: EU0 12098:
EU012099; EU0 12118:
EU012132

N D N N EU012033; EU0 12098:
EU012099; EU012118:
EU012132
N D N N EU012030: EU0 12098:
EU012118: EU012132


N C N N EU0 12036; EU0 12098:
EU012099; EU012118:
EU0 12132

N/A N/A N N/A bpl00-234 of
EU012028
N H N N EU0 12029; EU0 12098:
EU012118: EU012132


FL 9


N/A


FL 1398 N/A



FL 1198 N/A



FL 2298 N/A


FL
Museum


FLMNH


39359


LA 76 Jennifer O.
Coulson,
Tulane
University


N/A











Sample Museum/ Museum Dataset Biol. Sub Clade Gene. Genbank accession #s
name Contributor record # pop. pop. pop.
LA 78 Jennifer O. N/A CR Breeder Long.Cytb CR N H N N EU0 12031; EU0 12092;


Table A-2


(cont.)


Coulson,
Tulane
University


Breeder Short, CR ALL Short,
LAM, ENOL, ORN2


CR Breeder Long, CR Breeder
Short, CR ALL Short, LAM,
ENOL, ALD2, ORN2


CR Breeder Long, CR Breeder
Short, CR ALL Short, LAM,
ENOL, ALD2, ORN2

CR Breeder Long, CR Breeder
Short, CR ALL Short, LAM,
ENOL, ORN2
CR Breeder Long, CR Breeder
Short, CR ALL Short, LAM,
ENOL, ALD2, ORN2


CR Breeder Long, CR Breeder
Short, CR ALL Short, LAM,
ENOL, ALD2, ORN2
CR Breeder Long, Cytb, CR
Breeder Short, CR ALL Short,
LAM, ENOL, ALD2, ORN2
CR Breeder Long, CR Breeder
Short, CR ALL Short, LAM,
ENOL, ALD2, ORN2


EU0 12098; EU0 12118;
EU0 12132


LA 79 Jennifer O.
Coulson,
Tulane
University
LA 81 Jennifer O.
Coulson,
Tulane
University
SC CC1 SCDNR/
SCCBP

SC W1- SCDNR/
158 SCCBP



SC # 2 SCDNR/
SCCBP

SC Dead SCDNR/
SCCBP

GA 18 N/A


N/A


H N N EU0 12039; EU0 12098;
EU0 12099; EU0 12118;
EU0 12132


H N N EU012045; EU0 12098;
EU0 12099; EU0 12118;
EU012132

G N N EU012033; EU0 12098;
EU012118; EU012132


N/A


N/A


N/A




N/A



N/A


N/A


N G N N EU012038;
EU012098;
EU012124;
EU012132

N G N N EU012043;
EU012099;
EU012118;
N G N N EU0 12042;
EU0 12098;
EU0 12118;


EU0 12097;
EU0 12118;
EU0 12126;


EU0 12098;
EU0 12100;
EU012132
EU0 12090;
EU0 12099;
EU012132


F N N EU0 12044; EU0 12098;
EU012099; EU012118;
EU0 12132











Sample Museum/ Museum Dataset Biol. Sub Clade Gene. Genbank accession #s
name Contributor record # pop. pop. pop.
GA 19 N/A N/A CR Breeder Long..CR Breeder N F N N EU0 12038: EU0 12098:


Table A-2


(cont.)


Short, CR ALL Short, LAM,
ENOL, ALD2, ORN2

CR Breeder Long, CR Breeder
Short, CR ALL Short
CR Breeder Short, CR ALL
Short, Morph
CR Breeder Long, Cytb, CR
Breeder Short, CR ALL Short,
LAM, ENOL, LDH2, ORN2

ALD2, Morph
CR Breeder Long, Cytb, CR
Breeder Short, CR ALL Short,
LAM, ENOL, ALD2, LDH2,
ORN2


CR Breeder Long, Cytb, CR
Breeder Short, CR ALL Short,
LAM, ENOL, ALD2, ORN2


CR Breeder Long, CR Breeder
Short, CR ALL Short, LAM,
ENOL, ALD2, LDH2, ORN2


CR Breeder Long, CR Breeder
Short, CR ALL Short, LAM,
ENOL, ALD2, ORN2


EU0 12099; EU0 12100;
EU0 12118: EU0 12132


GA 20 N/A


N/A


F N N EU012030


AL 27 AUNHMLC


B-662


N/A N/A N N bpl00-234 of
EU012043
S Z S S EU012050; EU0 12094:
EU012098: EU0 12122:
EU012129; EU0 12130:
EU012132
N/A N/A N/A S EU0 12101; EU012103


N/A


N/A



N/A
N/A





N/A




N/A




N/A


N/A
N/A


S W S S EU012051;
EU012098:
EU012102;
EU012127;
EU012132
S U C C EU012052;
EU012098:
EU012102;
EU012132;
S U C C EU0 12053;
EU0 12101;
EU0 12122:
EU0 12130:

S Z S S EU012054;
EU0 12101;
EU0 12122:


EU0 12093:
EU0 12101;
EU0 12122:
EU0 12128:

EU0 12095:
EU0 12101;
EU0 12122:
EU012133

EU0 12098:
EU0 12103;
EU0 12123;
EU012132

EU0 12098:
EU0 12102;
EU012132


N/A


N/A


B6 N/A











Sample Museum/ Museum Dataset Biol. Sub Clade Gene. Genbank accession #s
name Contributor record # pop. pop. pop.
B7 N/A N/A CR Breeder Long.Cvtb CR S T C C EU0 12055; EU012096:


Table A-2


(cont.)


Breeder Short, CR ALL Short,
LAM, ENOL, ALD2, LDH2,
ORN2

CR ALL Short, Cvtb, LAM,
ENOL, ALD2, LDH2, ORN2


CR Breeder Short, CR ALL
Short, ORN2

CR Breeder Long, CR Breeder
Short, CR ALL Short, LAM,
ENOL, ALD2, LDH2, ORN2

CR Breeder Long, CR Breeder
Short, CR ALL Short, LAM,
ENOL, ALD2, LDH2, ORN2

CR Breeder Long, CR Breeder
Short, CR ALL Short, LAM,
ENOL, ALD2, ORN2

CR Breeder Long, CR Breeder
Short, CR ALL Short, LAM,
ENOL, ALD2, ORN2
CR Breeder Long, CR Breeder
Short, CR ALL Short, LAM,
ENOL, ALD2, LDH2, ORN2


EU0 12098: EU0 12101;
EU0 12102; EU0 12122:
EU0 12129; EU0 12130:
EU012132
N/A N/A S N/A EU0 12056; EU0 12094:
EU0 12098: EU0 12101;
EU0 12122: EU0 12127;
EU0 12128: EU0 12132
N/A N/A C N/A bpl00-234 of
EU0 12047; EU0 12122
S S C C EU012057; EU0 12098:
EU012101; EU0 12103;
EU012122: EU0 12126;
EU012127; EU012132


M. Azevedo


N/A


B-bone N/A


B1-00 N/A




B2-00 N/A


N/A


N/A




N/A


S C C EU012058:
EU012101;
EU012125:
EU012132
S C C EU012059;
EU012101;
EU012122:
EU012130:


EU0 12098:
EU0 12122:
EU0 12130:

EU0 12098:
EU0 12103;
EU0 12126;
EU012132


B3-00 N/A



B4-00 N/A


B5-00 N/A


N/A



N/A


N/A


S C C EU0 12060; EU0 12098:
EU012101; EU012122:
EU012132


X C S EU0 12061;
EU0 12101;
EU0 12122:
EU0 12130:


EU0 12098:
EU0 12103;
EU0 12126;
EU012132











Sample Museum/ Museum Dataset Biol. Sub Clade Gene. Genbank accession #s
name Contributor record # pop. pop. pop.
186-00 bb?< bb? CR Ereeder LxxygCRBe~eder S X S S 190012066;I900 12098;


Table A-2


(cont.)


Short, CR ALL Short, LAh,
ENOL, ALD2, LDH2, ORN2

CR Ereeder Lxxg, CRBe~eder
Short, CR ALL Short, LAh,
ENOL, ALD2, ORN2

CR Breeder Long, CR Breeder
Short, CR ALL Short, LAh,
ENOL, ALD2, ORN2


EU1012101; EU1012103;
EU0 12122; EU0 12129;
EU1012130; EU1012132
X S S 190012062; I90012098;
EU1012101; EU1012122;
EU0 12129; EU0 12130;
EU1012132
X S S EU012063; EU0 12098;
EU1012101; EU1012122;
EU012131; EU0 12133


187-00 Nb?<


Nb?<


B8-00 N/A



189-00 MERVCI



B10-00 Nb?<




1811-00 N/A<




B-Flor M. Azevedo



B-QF N/A

Bi-SF Nb?<


N/A


NOL1047 62 CR Ereeder Long, CR Ereeder
N1L4497 Short, Cl ALL -Short, ALJ2,
OIUV2,Moqph


S Y


S S ER1012064; I90012101;
11012103; EU1012122;
190012120


Nb?<




N/A<




N/A


N/A

Nb?<


CR Ereeder Long, CR Ereeder
Short, Cl ALL -Short, LAh,
ENOL, ALD2, LDH2, ORN2

CR feeder Long, CR Breeder
Short, Cl ALLA Short, LAh,
ENOL, ALD2, LDH2, ORN2

CR ALL Short, ALD2, LDH2,
0142

CR Breeder Short, CR ALL
Short,0IV2
CR Breeder Long, CR Ereeder
Short, CR ALL Short, ORN2


Z S S ER1012065;
11012101;
EU012122;
EX1012132
Z S S 190012066;
E11012101;
EU012122;
E11012132


I90012098;
EU1012103;
EU0 12126;

EU0012098;
EUO012102;
EU0 12130;


N/A N/A S N/A EU0 12056; EU0 12101;
190012122; E0012127;
EX1012128
N/A N/A S N/A bpl00-234 of
190012066; E0012122
S U C C 190012067;I900 12122











Sample Museum/ Museum Dataset Biol. Sub Clade Gene. Genbank accession #s
name Contributor record # pop. pop. pop.
GF1 RP Gerhardt N/A CR Breeder Short, CR ALL N/A N/A C N/A bp1024o


Table A-2


(cont.)


EU012061
N/A N/A C N/A bpl00-234 of
EU0 12061; EU0 12122
N/A N/A C N/A EU0 12077: EU0 12122

N/A N/A C N/A bpl00-234 of
EU012061; EU012122


Short
CR Breeder Short, CR ALL
Short, ORN2
CR Breeder Short, CR ALL
Short, ORN2
CR Breeder Short, CR ALL
Short, ORN2

CR Breeder Long, Cvtb, CR
Breeder Short, CR ALL Short,
LAM, ENOL, ALD2, LDH2,
ORN2


GF2

GF3

GF4


RP Gerhardt

RP Gerhardt

RP Gerhardt


N/A

N/A

N/A


N/A


G- W1 N/A


C M C C EU012046;
EU012098:
EU012103;
EU012129;
N/A N/A C N/A EU0 12096

C M C C EU012047;
EU012101;
EU012126;
EU012132;
C M C C EU0 12048:
EU0 12101;
EU0 12127;
EU0 12131;
C M C C EU0 12049:
EU0 12101;
EU0 12126;
EU0 12131;


EU0 12095:
EU0 12101;
EU0 12122:
EU012132


EU0 12098:
EU0 12122:
EU0 12130:
EU012134
EU0 12098:
EU0 12122:
EU0 12128:
EU012132
EU0 12098:
EU0 12122:
EU0 12130:
EU012134


G- W2 N/A

G- W3 N/A


N/A


Cvtb


CR Breeder Long, CR Breeder
Short, CR ALL Short, LAM,
ENOL, ALD2, LDH2, ORN2,
Morph
CR Breeder Long, CR Breeder
Short, CR ALL Short, LAM,
ENOL, ALD2, LDH2, ORN2

CR Breeder Long, CR Breeder
Short, CR ALL Short, LAM,
ENOL, ALD2, LDH2, ORN2,
Morph
CR ALL Short, Morph

CR Breeder Short, CR ALL
Short, Morph


G- W4 N/A



G- W5 N/A


N/A



N/A


CR-1

CR-2


AMNH

AMNH


389187

389189


N/A N/A C C EU0 12085

N/A N/A C C bpl00-234 of
EU012067










Table A-2 (cont.)
Sample Museum/ Museum Dataset Biol. Sub Clade Gene. Genbank accession #s
name Contributor record # pop. pop. pop.


G-4

P-5
P-6

S-7

V-9

V-10

V-11

V-12

V-13

V-14

V-15

V-16

V-17

V-21


AMNH

AMNH
AMNH

AMNH

AMNH

AMNH

AMNH

AMNH

AMNH

AMNH

AMNH

AMNH

AMNH

AMNH


393653

233115
233116

313399

469962

469963

352044

469959

469960

132353

132354

132355

73542


rop270


CR Breeder Short, CR ALL
Short, Morph
CR ALL Short, Morph
CR ALL Short, Morph

CR Breeder Short, CR ALL
Short, Morph
CR ALL Short

CR ALL Short

CR ALL Short

CR ALL Short

CR ALL Short

CR Breeder Short, CR ALL
Short
CR Breeder Short, CR ALL
Short, Morph
CR Breeder Short, CR ALL
Short, Morph
CR ALL Short

CR ALL Short, LDH2, ORN2,
Morph


N/A

N/A
N/A

N/A

N/A

N/A

N/A

N/A

N/A

N/A

N/A

N/A

N/A

N/A


N/A

N/A
N/A

N/A

N/A

N/A

N/A

N/A

N/A

N/A

N/A

N/A

N/A

N/A


C

C
C

C

N/A

N/A

N/A

N/A

N/A

N/A

C

C

N/A

S


bpl00-234 of
EU012061
EU012068
bpl00-234 of
EU012047
EU012069


bpl00-234 of
EU012047
bpl00-234 of
EU012067
bpl00-234 of
EU012061
bpl00-234 of
EU012061
EU012070


bpl00-234 of
EU012067
bpl00-234 of
EU012047
EU012071


bpl00-234 of
EU012047
bpl00-234 of
EU012066; EU012122;
EU012121; EU012130











Genbank accession #s


Sample Museum/ Museum Dataset Biol. Sub Clade Gene.
name Contributor record # pop. pop. pop.
E-26 ANSP 185071 CR Breeder Short CR ALL N/A N/A C N/A


Table A-2


(cont.)


C-28

M-29

C-39

C-40

C-41

C-42

CR-43
H-44

H-45

P-46

A-47

Bel-48

CR-50
G-51


Short, ORN2
CR Breeder Short,
Short, Morph
CR Breeder Short,
Short, Morph
CR Breeder Short,
Short
CR Breeder Short,
Short
CR Breeder Short,
Short
CR Breeder Short,
Short
CR ALL Short

CR Breeder Short,
Short
CR Breeder Short,
Short
CR Breeder Short,


CR ALL

CR ALL

CR ALL

CR ALL

CR ALL

CR ALL


N/A

N/A

N/A

N/A

N/A

N/A

N/A
N/A

N/A

N/A

N/A

N/A

N/A
N/A


N/A

N/A

N/A

N/A

N/A

N/A

N/A
N/A

N/A

N/A

N/A

N/A

N/A
N/A


N/A

N/A

N/A

N/A

N/A

N/A

N/A
N/A

N/A

N/A

N/A

N/A

N/A
N/A


bpl00-234 of
EU0 12067; EU0 12122
bpl00-234 of
EU012061
bpl00-234 of
EU012061
bpl00-234 of
EU012067
EU012077

EU012072


bpl00-234 of
EU012067
EU012073
EU0 12073

EU012078

EU0 12074

b 100-234 of
EU012051
EU012077

EU012077
bpl00-234 of
EU012061


MVZ

MVZ

FMNH

FMNH

FMNH

FMNH

FMNH
FMNH

FMNH

FMNH


138096

120955

101978

101977

101975

101976

44038
100932

100931

324635

99661

119742

120792
145658


CR ALL

CR ALL

CR ALL


Short
CR Breeder Short, CR ALL
Short, Morph
CR ALL Short

CR ALL Short
CR ALL Short


MCZ

MCZ

MCZ
MCZ












Sample Museum/ Museum Dataset Biol. Sub Clade Gene. Genbank accession #s
name Contributor record # pop. pop. pop.
M-52 MCZ 309708 CR Breeder Short CR ALL N/A N/A C N/A EU0 12075


Table A-2


(cont.)


Short, Morph
CR Breeder Short, CR ALL
Short
CR Breeder Short, CR ALL
Short
CR ALL Short

CR ALL Short
CR ALL Short, ORN2, Morph

CR Breeder Short, CR ALL
Short
CR Breeder Short, CR ALL
Short
CR Breeder Short, CR ALL
Short
CR Breeder Short, CR ALL
Short
CR Breeder Short, CR ALL
Short, ORN2
CR Breeder Short, CR ALL
Short, Morph
CR Breeder Short, CR ALL
Short, Morph
CR Breeder Short, CR ALL
Short
CR Breeder Short, CR ALL
Short


S-54

S-55

V-56

V-57
V-58

V-59


MCZ

MCZ

MCZ

MCZ
MCZ

MCZ


143030

143031

92584

92580
92583

92582

22588/
B-37224
39149/
B-37226
61026/
B-37227
28192/B-
37225
132060

70084

136851

136852


N/A N/A C N/A bpl00-234 of
EU012060
N/A N/A C N/A bpl00-234 of
EU012060
N/A N/A S N/A bpl00-234 of
EU012051
N/A N/A C N/A EU012076
N/A N/A S N/A bpl00-234 of
EU012051; EU0 12122
N/A N/A C N/A bpl00-234 of
EU012061
N/A N/A C N/A EU012077

N/A N/A C N/A bpl00-234 of
EU012061
N/A N/A C N/A EU0 12078

N/A N/A C N/A EU0 12079; EU0 12122

N/A N/A C C bpl00-234 of
EU012047
N/A N/A C C bpl00-234 of
EU012049
N/A N/A C N/A bpl00-234 of
EU012047
N/A N/A C N/A b 100-234 of
EU012049


Bel-61 LSU


M-62

M-63


LSU

LSU


Per-64 LSU

CR-65 UMMZ


G-66

M-67

M-68


UMMZ

UMMZ

UMMZ











Sample Museum/ Museum Dataset Biol. Sub Clade Gene. Genbank accession #s
name Contributor record # pop. pop. pop.


Table A-2


(cont.)


M-69


M-70

S-71


E-73


CR-74

CR-75


Guy-76


Guy-77

V-79

C-81

C-82

C-83

C-85
CR-86


UMMZ


UMMZ

UMMZ


MLZ


ROM

ROM

ROM


ROM

ROM

USNM

USNM

USNM

USNM
USNM


136853


136854

116631


4706


JHF 26410/
CN 35647
JHF 11425/
CN 35645
JHF
1434/CN
35644
AN
26.11.1.180
JHF 31688/
CN 35648
401194

391860

524077

372341
209843


CR Breeder Short,
Short
CR Breeder Short,
Short
CR ALL Short


CR ALL Short


CR ALL Short

CR ALL Short

CR ALL Short


CR ALL


CR ALL


N/A


N/A

N/A


N/A


N/A

N/A

N/A


N/A

N/A

N/A

N/A

N/A

N/A
N/A


N/A


N/A

N/A


N/A


N/A

N/A

N/A


N/A

N/A

N/A

N/A

N/A

N/A
N/A


N/A


N/A

N/A


N/A


N/A

N/A

N/A


N/A

N/A

N/A

N/A

C

S
C


bpl00-234 of
EU012061

bpl00-234 of
EU012067
bpl00-234 of
EU012061

bpl00-234 of
EU012061
EU012080


bpl00-234 of
EU012060
bpl00-234 of
EU012060

bp l00-234 of
EU012060
EU012081

EU012082

EU012083

EU012069

EU012084
EU012085


CR ALL Short

CR ALL Short

CR ALL Short,
Morph(iridescence only)
CR ALL Short;
Morph(iridescence only)
CR Breeder Short, CR ALL
Short, Morph
CR ALL Short, Morph
CR ALL Short, Morph











Sample Museum/ Museum Dataset Biol. Sub Clade Gene. Genbank accession #s
name Contributor record # pop. pop. pop.
CR-87 USNM 209844 CR ALL Short, Morph N/A N/A C C bpl00-234 of


Table A-2


(cont.)


EU012060
N/A EU012086
C EU012087


H-89
V-91
V-92


USNM
USNM
USNM


112244
406415
190326

20201

18555

18556
10884

55686
55685

313887
788956
N/A
N/A
N/A
N/A
N/A
N/A
N/A
N/A
N/A
N/A


CR ALL Short
CR ALL Short, Morph
CR ALL Short, Morph

CR Breeder Short, CR ALL
Short, ORN2, Morph
CR ALL Short

CR ALL Short
CR Breeder Short, CR ALL
Short
CR ALL Short
CR ALL Short


N/A N/A
N/A N/A


N/A N/A S S bpl00-234 of
EU012050
N/A N/A C C bpl00-234 of
EU0 12067; EU0 12122
N/A N/A C N/A bpl00-234 of
EU012047
N/A N/A C N/A EU0 12088
N/A N/A C N/A bpl00-234 of
EU012060


CR-93 WFVZ

CR-94 WFVZ

CR-95 WFVZ
M-96 WFVZ


CR-97
CR-98

B-101
Ber-102
FL-103


YPM
YPM


N/A N/A
N/A N/A


N/A
N/A


EU012089
bpl00-234 of
EU012066
N/A
N/A
N/A
N/A
N/A


AMNH
AMNH
N/A


Morph
Morph
Morph
Morph
Morph
Morph
Morph
Morph
Morph
Morph
Morph
Morph


N/A
N/A
N/A


N/A
N/A
N/A


N/A
N/A
N/A
N/A
N/A


FL-104 N/A
FL-105 N/A
FL-106 N/A


N/A N/A
N/A N/A


N/A N/A N/A N N/A


FL-107
FL-108
GA-109
GA-110
GA-111
GA-113


N/A
N/A
N/A
N/A
N/A
N/A


N/A
N/A
N/A
N/A
N/A
N/A


N/A
N/A
N/A
N/A
N/A
N/A


N/A
N/A
N/A
N/A
N/A
N/A


N/A
N/A
N/A
N/A
N/A
N/A










Table A-2 (cont.)
Sample Museum/ Museum Dataset Biol. Sub Clade Gene. Genbank accession #s
name Contributor record # pop. pop. pop.
GA-114 N/A N/A Morph N/A N/A N/A N N/A


USNM
USNM
USNM
USNM


Morph
Morph
Morph
Morph
Morph
No dataset- Immature
specimen, used to help
determine size limits for
morphology dataset.
Immature specimen, used to
help determine size limits for
morphology dataset and for
iridescence data.
Immature specimen, used to
help determine size limits for
morphology dataset and for
iridescence data.
No dataset- Immature
specimen, used to help
determine size limits for
morphology dataset.
Immature specimen, used to
help determine size limits for
morphology dataset and for
iridescence data.
No dataset- Immature
specimen, used to help
determine size limits for
morphology dataset.


N/A N/A
N/A N/A
N/A N/A
N/A N/A


N/A
N/A
N/A
N/A


FL-115
FL-116
FL-117
FL-118


176960
176959
176962
176961
414222
146854



126344




176963



76987



146855



131938


N/A N
N/A N
N/A N
N/A N


FL-119 USNM
FL-120 USNM



FL-121 USNM




FL-122 USNM



M-123 USNM



FL-124 USNM




Guy-125 USNM


N/A N/A N/A N N/A
N/A N/A N/A N/A N/A



N/A N/A N/A N/A N/A




N/A N/A N/A N/A N/A



N/A N/A N/A N/A N/A



N/A N/A N/A N/A N/A



N/A N/A N/A N/A N/A





Sample Museum/ Museum Dataset Biol. Sub Clade Gene. Genbank accession #s
name Contributor record # pop. pop. pop.
G-126 USNM 103378 No dataset- Immature N/A N/A N/A N/A N/A
specimen, used to help
determine size limits for
morphology dataset.
Pernis Dr. Andreas unk CR Breeder Long, Cytb, CR N/A N/A N/A N/A EU0 12113; EU0 12115;
Helbig Breeder Short, CR ALL Short, AY987242; X86758
LDH2, ORN2
Elanl10 Dr. Andreas unk ENOL, LDH2, ORN2 N/A N/A N/A N/A EU0 12105; EU012111;
Helbig EU0 12112; EU0 12114
Miss SCCBP N/A Cytb, ENOL, ORN2 N/A N/A N/A N/A EU012104; EU012108;
EU012117
Elan8 Dr. Andreas unk CR Breeder Long, CR Breeder N/A N/A N/A N/A EU012106; EU0 12107;
Helbig Short, CR ALL Short, ENOL, EU012109; EU0 12110;
ORN2 EU012116


Table A-2


(cont.)


Biol.Pop.= Biological Population assignment; Subpop.= Subpopulation assignment; Gene.Pop.= Genetic Population; Unk=
Unknown; Contributors include: Andreas Helbig, Institute of Zoology, University of Greifswald, Vogelwarte Hiddensee, D-
18565 Kloster, Germany; Jennifer O. Coulson, Ph.D., Department of Ecology and Evolutionary Biology, Tulane University;
Rick Gerhardt, The Peregrine Fund; AUNHMLC= Auburn University Natural History Museum and Learning Center; MCZ=
Museum of Comparative Zoology at Harvard; MHNCI= Museo de Historia Natural Capao Imbuia; MLZ= Moore Laboratory
of Zoology at Occidental College; MVZ= University of California, Museum of Vertebrate Zoology; SCDNR= South Carolina
Dept. Natural Resources (John Cely); SCCBP= South Carolina Center for Birds of Prey (Jim Elliott); UMMZ= University of
Michigan Museum of Zoology; USNM= Division of Birds, National Museum of Natural History; YPM= Yale Peabody
Museum; FLMNH= Florida Museum of Natural History; ANSP= Academy of Natural Sciences of Philadephia; FMNH= Field
Museum of Natural History; LSU= Louisiana State University Museum of Natural Science; AMNH= American Museum of
Natural History; ROM= Royal Ontario Museum; WFVZ= Western Foundation of Vertebrate Zoology.



























APPENDIX B
PCR CONDITIONS FOR EACH LOCUS












Table B-1. PCR conditions for each locus
Label of PCR recipe in ul (50 ul total reactic
genetic 10x Buffer \ 25mM MgCl2 \ 2mM
region
Cytb 5 \3 \5\0.25 \ 0.25 \2


DNTPs \ 50 uM each Primer \ 5u/ul Taq \ 50ng/ul DNA


Thermal cycler program
Co/Minutes


Requires 250 mM KCL 8.0 8.5 pH buffer.
CRdbox 5 \3 \5\0.5 \0.5 \2


95/1. Then 35 cycles: 94/0.75;
51/0.75; 72/0.5. Then 72/3.
95/2. Then 35 cycles 94/0.75; 55/1;
72/1. Then 72/5.
95/2. Then 35 cycles 94/0.75; 57/1;
72/1. Then 72/5.
95/10 (if using taq gold). Then 40
cycles: 94/0.75; 47/0.75; 72/0.5.
Then 72/10
95/1. Then 35 cycles: 94/0.75;
63/0.5; 72/0.75. Then 72/1.
95/1. Then 35 cycles: 94/1; 57/0.75;
72/1. Then 72/3.
95/1. Then 35 cycles: 94/0.75;
48/0.5; 72/0.75. Then 72/1.
95/1. Then 35 cycles: 94/0.75;
64/0.5; 72/0.75. Then 72/1.
95/1. Then 35 cycles: 94/1; 57/0.75;
72/1. Then 72/3.
95/1. Then 35 cycles: 94/0.75;
57/0.5; 72/0.75. Then 72/1.
95/1. Then 35 cycles: 94/1; 60/0.75;
72/1. Then 72/3.
95/1. Then 35 cycles: 94/0.75;
63/0.5; 72/0.75. Then 72/1.


CRpre-
dbox


5 \3 \5\0.6 \0.5 \2


CRshort 5 \2 \5\0.6 \0.5 \2
plus 4ul BSA (10mg/ml).

LAM 5 \5 \5 \1\0.25 \2


Best with 250 mM KCL buffer.


ORN


5 \4 \5\0.1 \0.5 \2


ORN2 12 \7 \12 \0.1 \0.5 \2

ENOL 5 \5 \2.5 \0.2 \0.25 \2


LDH


5 \4 \5\0.1 \0.5 \2


LDH2 12 \5 \12 \0.1 \0.5 \2


ALD


10 \8\10 \0.2 \0.5 \2


ALD2 10 \5 \10 \0.15 \0.6 \2



























APPENDIX C
MORPHOLOGICAL RAW DATA










Table C-1. Morphological raw data
Sample name; Subsp. Gene. Region Dry or Molt? Age >14 Tail female Tail male in Wing ch. Wing ch. Irides.
"Measurement taker" pop. fresh months?* in mm mm female in male in mm
mm
A-47; "Museum" yetapa S sSA Dry No^' Yes 290 411 unk.
AL 27; "Museum" forticatus N N Dry No 320 405 unk.
AL 27; "Collector" forticatus N N Fresh No 319 412 unk.
B-101; "AW" yetapa S sSA Dry No Yes 324 435 g& p
B2; "AW" yetapa S sSA Fresh No Yes 340 418 p
B9-00, "Museum" yetapa S sSA Dry No Yes 310 380 p
Ber-102; "AW" forticatus N N Dry No Yes 308 441 unk.
Ber-102; "Collector" forticatus N N Fresh No Yes 337 447 unk.
C-28; "Museum" yetapa C nSA Dry No Yes 255 401.5 unk.
C-81; "AW" yetapa S sSA Dry No No 225 p& g
S C-82; "AW" yetapa S sSA Dry Yes Yes n/a n/a n/a n/a p& g
SC-83; "AW" yetapa C nSA Dry No Yes 276 g
C-85; "AW" yetapa S sSA Dry No^' Yes 290 g& p
CR-1; "AW" yetapa C CA Dry No 295 424 g
CR-2; "AW" yetapa C CA Dry No Yes 298 413 g
CR-65; "Museum" yetapa C CA Dry No Yes 334 434 unk.
CR-86; "AW" yetapa C CA Dry No Yes 305 433 g
CR-87; "AW" yetapa C CA Dry No Yes 320 438 g
CR-93; "Museum" yetapa C CA Dry No Yes 329 429 unk.
CR-97; "Museum" yetapa n/a n/a Dry No No 271 385 dull
FLO299; "KM" forticatus N N Fresh No Yes 331 434 unk.
FLO500; "KM" forticatus N N Fresh No Yes 359 446 unk.
FL-103; "KM" forticatus N N Fresh No Yes 336 443 unk.
FL-104; "KM" forticatus N N Fresh No Yes 311 411 unk.
FL-105; "KM" forticatus N N Fresh No Yes 318 425 unk.
FL-106; "KM" forticatus N N Fresh No Yes 335 410 unk.










Table C-1 (cont.)
Sample name;
"Measurement taker'

FL-107; "KM"
FL-108; "KM"
FL-115; "AW"
FL-115; "Collector"
FL-116; "AW"
FL-116; "Collector"
FL-117; "AW"
FL-117; "Collector"
FL-118; "AW"
FL-118; "Collector"
SFL-119; "AW"
0- FL-120; "AW"
FL-121; "AW"
FL-122; "AW"
FL-124; "AW"
G- W5; "AW"
G-126; "AW"
G-4; "AW"
G-66; "Museum"
GA-109; "KM"
GA-110; "KM"
GA-111; "KM"
GA-113; "KM"
GA-114; "KM"
Guy-125; "AW"
G-W3; "AW"


Subsp. Gene. Region Dry or Molt? Age >14 Tail female Tail male in Wing ch. Wing ch. Irides.
pop. fresh months?* in mm mm female in male in mm
mm
forticatus N N Fresh No Yes 352 428 unk.


forticatus
forticatus
forticatus
forticatus
forticatus
forticatus
forticatus
forticatus
forticatus
forticatus
forticatus
forticatus
forticatus
forticatus
yetapa
yetapa?
yetapa
yetapa
forticatus
forticatus
forticatus
forticatus
forticatus
yetapa?
yetapa


Fresh
Dry
Fresh
Dry
Fresh
Dry
Fresh
Dry
Fresh
Dry
Dry
Dry
Dry
Dry
Fresh
Dry
Dry
Dry
Fresh
Fresh
Fresh
Fresh
Fresh
Dry
Fresh


No
No
No
No
No
No
No
No
No
No
No
Yes
Yes
Yes
No
No
No
No
No
No
No
No
No
No
No


Yes
Yes
Yes
Yes
Yes
Yes
Yes
Yes
Yes
Yes
No
No
No
No
Yes
No

Yes
Yes
Yes
Yes
Yes
Yes
No
Yes


unk.
p
p
p
p
p
p
p
p
p
dull
p
p
p
g
unk.
unk.
unk.
unk.
unk.
unk.
unk.
unk.
dull
g


253 -sex unk.


275 -sex unk.


251 -sex unk.
353










Table C-1 (cont.)
Sample name; Subsp. Gene. Region Dry or Molt? Age >14 Tail female Tail male in Wing ch. Wing ch. Irides.
"Measurement taker" pop. fresh months?* in mm mm female in male in mm
mm
M-123; "AW" yetapa? n/a n/a Dry No No 268 if Female young
M-29; "Museum" yetapa C CA Dry No Yes 329 421.5 unk.
M-52; "Museum" yetapa C CA Dry No Yes 322 412 unk.
P-5; "AW" yetapa C CA Dry No 313 422 unk.
P-6; "AW" yetapa C CA Dry No 305 400 unk.
S-7; "AW" yetapa C nSA Dry No 283 400 unk.
V-15; "AW" yetapa C nSA Dry No Yes 286 398 unk.
V-16; "AW" yetapa C nSA Dry No Yes 308 422 unk.
V-21;"AW" yetapa S sSA Fresh No 325 425 unk.
V-56; "Museum" yetapa n/a n/a Dry Yes Yes 226 374 unk.
V-58; "Museum" yetapa S sSA Dry No Yes 255 389 unk.
V-91; "AW" yetapa C nSA Dry No Yes 290 417 g& p
V-92; "AW" yetapa S sSA Dry No Yes 300 407 p& g
343-370 328-343 436-445 423-436
Friedmann(1950); "Fried" forticatus N N Dry No? unk (356) (334) (440) (431) unk.
275-326 298-330 390- 405-447
Friedmann(1950); "Fried" yetapa unk. unk. Dry No? unk (304) (318) 427(411) (418) unk.
Snyder & Wiley(1976); "?" ~forticatus N N Fresh? No? Probably 428.4 420.8 unk.
Measurement takers include the collector of specimen ("Collector"), museum staff ("Museum"), author of previous morphological study
"Friedmann," or one of the authors of this paper ("KM" or "AW"). Friedmann (1950) sample size is 8 males and 12 females for EfJ
forficatus; 26 males and 14 females for EfJ yetapa. Snyder and Wiley (1976) sample size is 26 males and 24 females. Subsp.= Subspecies;
Gene.Pop=Genetic Population assignment; "Dry or Fresh" refers to condition of tissue when measured; Wing Ch=Wing Chord;
unk.=unknown. *Based on knowledge of breeding or plumage trailing edge coloration; ^'Bird in molt, however, where longest feathers
retained, measurement used. <> Based on tail length. Irides.= iridescence. P= purple. G= green.



























APPENDIX D
PHYLOGENETIC TREES












Elarzzzs


Pernis


FLO900

FL1000,FL2298
FLO500,LA76


S14 FL0199,L ;78
FL43
87
", FL299,FI410,FL39,FL9,SCW1-158,GA1 9
.FL1398,SC-CC1

100 1- FL0598,FLO0898,FL2398
SFL1898


FL7

FL11,FL1$,L

FL31

FL17,LA79

SC Dead
SC#2

GA18

G-W1


100


B4

B5

B7
B-SF


B3-00

B4-00

B5-00

96 B1

B9-00
B6
76
SB7-00

-B8-00
100
10-00

-B11-00,B6-00
B3

-001 substitutonshfi~it



Figure D-1. NJ tree based on CR Breeder Long dataset





Pernis


.FLO500,LA76,

FL0598,FL0898,FL2398,

FL0800,FL1000,FL8,FL1198,FL2298,GA20

FL2198

FL7
FLO299,FL10,FL39,FL43,FL9,FL1398, SC-
-CC1,SC W1-158,GA19
FLO900,FL Museum

FL0199,LA78,
FL31,FL17,FL11,FL1 5,FL1898,LA79,LA81, SC#2, S
-C Dead,GA18,AL27
G-W1

G-W4

W5,G66,M68

B4

B5



B-FCR2,V14,E26,CR93,C39,C42,M70

81-00

B2-00

B3-00



V16


100


GF1,GF2G~F4,C28,M29,V59,B5-00,G4,3162,M16
H44

92 cH45,M63

GF3,Bel-61,C40

P46

3152

Per64

B-bone,G-W3,V1 5,CR65,M67

SB1 S7,C83
-C41
B3,B7-00,A47

SB6

B 8- 00

B9-00

10-00

B6-00,B11-00,B-QF


71


0.0~5 su~slitutionshiba


Figure D-2. NJ tree based on CR Breeder Short dataset





Elanus


FLO900,FL Museum
FLO500,LA76
FL0199,LA78
FLO299,FL10,FL39,FL43,FL9,FL1398,SC-
CC1,SC W1-158,GA19
FL0598,FL0898,FL2398,
FL0800,FL1000,FL8,FL1198,FL2298,GA20
FL2198
FL7
FL31,FL17,FL11 ,FL15,FL1 898,AL27,GA18,SC
-- Dead,SC #2,LA81,LA79
-G-W1
-G-W4
-G-W5,G66,M68
B4
B5
B7
B1-00
B2-00
B3-00
P5
S7,C83
V13
V16
C41
CR43,H44
P46
72
CR74
CR1,CR86
3152
V57
89 GF3,C40,Bel48,CR50,Bel61
H45,M63
Per64

B-SF,CR2,V10,V14,E26,C39,C42,M70,CR93
GF1,GF2,GF4,G4,V11 ,V12,E73,M69, S71,C28,M29,M
-62,G51,V59,B5-00
V79
H89
V91
B-bone,G-W3,P6,V9,V15,V17,CR65,AI67,CR64
CR95
B4-00,S54,S55,CR75,Guy76,Guy77,CR87,M96


100




























96


100


B1,V92
B6
B8-00
B9-00
B10-00
B3,B8,B7-00,B-Flor, A47,V56,V58
SC81
C82
C85
CR97
B6-00,B11-00,B-QF,V21,CR98


90


-- 0.01 s;ubstikd~on s~ftal~


Figure D-3. NJ tree based on CR All Short dataset










Literature Cited


Ab'Saber, A. N. 1977. Espagos ocupados pela expansio dos climas secos na America do Sul, por
ocasiho dos periods glaciais. Paleoclimas 3:1-19.
Alerstam, T., A. Hedenstrom, and S. Akesson. 2003. Long-distance migration: evolution and
determinants. Oikos 103:247-260.
Assine, M. L., and P. C. Soares. 2004. Quaternary of the Pantanal, west-central Brazil.
Quaternary International 114:23-34.
Avise, J. C., and W. S. Nelson. 1989. Molecular genetic relationships of the extinct dusky
seaside sparrow. Science 243:646-648.
Avise, J. C., and D. Walker. 1998. Pleistocene phylogeographic effects on avian populations and
the speciation process. Proceedings of the Royal Society of London Series B-Biological
Sciences 265:457-463.
Baker, A. J. 2002. The deep roots of bird migration: Inferences from the historical record
preserved in DNA. Ardea 90:503-513.
Baker, A. J., and H. D. Marshall. 1997. Mitochondrial control region sequences as tools for
understanding evolution. Pp. 51-82 in D. P. Mindell, ed. Avian Molecular Evolution and
Systematics. Academic Press, San Diego.
Baker, C. S., L. Medrano-Gonzalez, J. Calambokidis, A. Perry, F. Pichler, H. Rosenbaum, J. M.
Straley, J. Urban-Ramirez, M. Yamaguchi, and O. Von Ziegesar. 1998. Population
structure of nuclear and mitochondrial DNA variation among humpback whales in the
North Pacific. Molecular Ecology 7:695-707.
Baker, C. S., S. R. Palumbi, R. H. Lambertsen, M. T. Weinrich, J. Calambokidis, and S. J.
Obrien. 1990. Influence of seasonal migration on geographic distribution of
mitochondrial DNA haplotypes in humpback whales. Nature 344:238-240.
Baker, C. S., A. Perry, J. L. Bannister, M. T. Weinrich, R. B. Abernethy, J. Calambokidis, J.
Lien, R. H. Lambertsen, J. U. Ramirez, O. Vasquez, P. J. Clapham, A. Ailing, S. J.
Obrien, and S. R. Palumbi. 1993. Abundant mitochondrial DNA variation and worldwide
population structure in humpback whales. Proceedings of the National Academy of
Sciences of the United States of America 90:8239-8243.
Baker, J. M., E. Lopez-Medrano, A. G. Navarro-Siguenza, O. R. Rojas-Soto, and K. E. Omland.
2003. Recent speciation in the orchard oriole group: Divergence of Ictents spurius
spurius and Ictents spurius frertesi. Auk 120:848-859.
Baker, R. R. 1978. The Evolutionary Ecology of Animal Migration. Hodder & Stoughton,
London.
Ballard, J. W. O., and M. C. Whitlock. 2004. The incomplete natural history of mitochondria.
Molecular Ecology 13:729-744.
Ball, R. M., and J. C. Avise. 1992. Mitochondrial DNA phylogeographic differentiation among
avian populations and the evolutionary significance of subspecies. Auk 109:626-636.
Ball, R. M., S. Freeman, F. C. James, E. Bermingham, and J. C. Avise. 1988. Phylogeographic
population structure of red-winged blackbirds assessed by mitochondrial DNA.
Proceedings of the National Academy of Sciences of the United States of America
85:1558-1562.
Baum, D. A., and M. J. Donoghue. 1995. Choosing among alternative phylogenetic species
concepts. Systematic Botany 20:560-573.










Bearhop, S., W. Fiedler, R. W. Furness, S. C. Votier, S. Waldron, J. Newton, G. J. Bowen, P.
Berthold, and K. Famnsworth. 2005. Assortative mating as a mechanism for rapid
evolution of a migratory divide. Science 310:502-504.
Belichon, S., J. Clobert, and M. Massot. 1996. Are there differences in fitness components
between philopatric and dispersing individuals? Acta Oecologica-International Joumnal of
Ecology 17:5 03-517.
Bell, C. P. 2000. Process in the evolution of bird migration and pattern in avian ecogeography.
Journal of Avian Biology 3 1:258-265.
Belliure, J., G. Sorci, A. P. Moller, and J. Clobert. 2000. Dispersal distances predict subspecies
richness in birds. Journal of Evolutionary Biology 13:480-487.
Bensch, S. 1999. Is the range size of migratory birds constrained by their migratory program?
Journal of Biogeography 26:1225-1235.
Bensch, S., T. Andersson, and S. Akesson. 1999. Morphological and molecular variation across a
migratory divide in willow warblers, Phylloscopus trochilus. Evolution 53:1925-1935.
Bensch, S., D. Hasselquist, B. Nielsen, and B. Hansson. 1998. Higher fitness for philopatric than
for immigrant males in a semi-isolated population of great reed warblers. Evolution
52:877-883.
Bergmann, C. 1847. Ujber die verhaltnisse der warmeiikonomie der there zu ihrer griisse.
Giittinger Studien, Giittingen 3:595-708.
Berthold, P. 1996. Control of bird migration. Chapman and Hall, London.
Berthold, P. 1999. A comprehensive theory for the evolution, control and adaptability of avian
migration. Ostrich 70: 1-11.
Berthold, P. 2001. Bird migration: a general survey, 2nd edn. Oxford University Press, New
York.
Berthold, P., A. J. Helbig, G. Mohr, and U. Querner. 1992. Rapid microevolution of migratory
behavior in a wild bird species. Nature 360:668-670.
Berthold, P., and S. B. Terrill. 1991. Recent advances in studies of bird migration. Annual
Review of Ecology and Systematics 22:3 57-378.
Bickford, D., D. J. Lohman, N. S. Sodhi, P. K. L. Ng, R. Meier, K. Winker, K. K. Ingram, and I.
Das. 2007. Cryptic species as a window on diversity and conservation. Trends in Ecology
and Evolution 22: 148-155.
Bildstein, K. L. 2004. Raptor migration in the neotropics: Pattemns, processes, and consequences.
Ornitologia Neotropical 15:83-99.
Biihning-Gaese, K., L. I. Gonzalez-Guzman, and J. H. Brown. 1998. Constraints on dispersal and
the evolution of the avifauna of the Northern Hemisphere. Evolutionary Ecology 12:767-
783.
Both, C., S. Bouwhuis, C. M. Lessells, and M. E. Visser. 2006. Climate change and population
declines in a long-distance migratory bird. Nature 441:81-83.
Bowen, B. W., A. B. Meylan, J. P. Ross, C. J. Limpus, G. H. Balazs, and J. C. Avise. 1992.
Global population structure and natural history of the green turtle (Chelonia mydas) in
terms of matriarchal phylogeny. Evolution 46:865-881.
Briskie, J. V. 1996. Lack of sperm storage by female migrants and the significance of
copulations en route. Condor 98:414-417.
Brower, A. V. Z., and M. M. Jeansonne. 2004. Geographical populations and "subspecies" of
new world monarch butterflies (Nymphalidae) share a recent origin and are not
phylogenetically distinct. Annals of the Entomological Society of America 97:519-523.










Brower, L. P., and R. M. Pyle. 2004. The interchange of migratory monarchs between Mexico
and the western United States, and the importance of floral corridors to the fall and spring
migrations in G. Nabhan, ed. Conserving migratory pollinators and nectar corridors in
western North America. University of Arizona Press, Tucson.
Brown, K. S. J. 1986. Zoogeografia da regiho do Pantanal Mato-Grossense. Pp. 137-178. Anais
do lo simp6sio sobre recursos naturals e s6cio-econ8micos do Pantanal. EMBRAPA-
CPAP, Brasilia.
Brown, L. H., and D. and Amadon. 1968. Eagles, hawks, and falcons of the world. McGraw-Hill,
New York.
Buehler, D. M., and A. J. Baker. 2005. Population divergence times and historical demography
in red knots and dunlins. Condor 107:497-513.
Buerkle, C. A. 1999. The historical pattern of gene flow among migratory and nonmigratory
populations of prairie warblers (Aves: Parulinae). Evolution 53:1915-1924.
Burckle, L. H. 1993. Late quaternary interglacial stages warmer than present. Quaternary
Science Reviews 12:825-831.
Burg, T. M., and J. P. Croxall. 2001. Global relationships amongst black-browed and grey-
headed albatrosses: analysis of population structure using mitochondrial DNA and
microsatellites. Molecular Ecology 10:2647-2660.
Bush, M. B. 1994. Amazonian speciation- a necessarily complex model. Journal of
Biogeography 21:5-17.
Cain, M. L., B. G. Milligan, and A. E. Strand. 2000. Long-distance seed dispersal in plant
populations. American Journal of Botany 87:1217-1227.
Calambokidis, J., G. H. Steiger, J. M. Straley, L. M. Herman, S. Cerchio, D. R. Salden, J. Urban,
J. K. Jacobsen, O. von Ziegesar, K. C. Balcomb, C. M. Gabriele, M. E. Dahlheim, S.
Uchida, G. Ellis, Y. Miyamura, P. L. de Guevara, M. Yamaguchi, F. Sato, S. A. Mizroch,
L. Schlender, K. Rasmussen, J. Barlow, and T. J. Quinn. 2001. Movements and
population structure of humpback whales in the North Pacific. Marine Mammal Science
17:769-794.
Capparella, A. P. 1988. Genetic variation in Neotropical birds: implications for the speciation
process. Proceedings of the Intemnational Omithological Congress 19:1658-1664.
Carr, A., and P. J. Coleman. 1974. Seafloor spreading theory and the odyssey of the green turtle.
Nature 249:128-130.
Cheviron, Z. A., S. J. Hackett, and A. P. Capparella. 2005. Complex evolutionary history of a
neotropical lowland forest bird (Lepidothrix coronate) and its implications for historical
hypotheses of the origin of Neotropical avian diversity. Molecular Phylogenetics and
Evolution 36:338-357.
Clapperton, C. M. 1993. Nature of environmental changes in South America at the last glacial
maximum. Palaeogeography Palaeoclimatology Palaeoecology 101:189-208.
Clement, M., D. Posada, and K. A. Crandall. 2000. TCS: a computer program to estimate gene
genealogies. Molecular Ecology 9:1657-1659.
Colinvaux, P. A., P. E. De Oliveira, and M. B. Bush. 2000. Amazonian and neotropical plant
communities on glacial time-scales: The failure of the aridity and refuge hypotheses.
Quaternary Science Reviews 19:141-169.
Coppack, T., and C. Both. 2002. Predicting life-cycle adaptation of migratory birds to global
climate change. Ardea 90:369-378.










Corbin, K. W. 1987. Geographic variation and speciation. Pp. 321-353 in F. Cooke, and P. A.
Buckley, eds. Avian genetics. Academic Press, London.
Cox, G. W. 1968. The role of competition in the evolution of migration. Evolution 22:180-189.
Cracraft, J. 1983. Species concepts and speciation analysis. Pp. 159-187. Current Ornithology.
Plenum Press, New York.
Crandall, K. A., O. R. P. Bininda-Emonds, G. M. Mace, and R. K. Wayne. 2000. Considering
evolutionary processes in conservation biology. Trends in Ecology & Evolution 15:290-
295.
Cronin, M. A. 1993. Mitochondrial DNA in wildlife taxonomy and conservation biology-
Cautionary notes. Wildlife Society Bulletin 21:339-348.
Da Silva, J. M. C., and J. M. Bates. 2002. Biogeographic patterns and conservation in the South
American cerrado: A tropical savanna hotspot. Bioscience 52:225-233.
Davis, L. A., E. H. Roalson, K. L. Cornell, K. D. McClanahan, and M. S. Webster. 2006. Genetic
divergence and migration patterns in a North American passerine bird: implications for
evolution and conservation. Molecular Ecology 15:2141-2152.
Dingle, H. 1996. Migration: The Biology of Life on the Move. Oxford University Press, New
York.
Donoghue, M. J. 1985. A critique of the biological species concept and recommendations for a
phylogenetic alternative. Bryologist 88:172-181.
Doyle, J. J. 1995. The irrelevance of allele tree topologies for species delimitation, and a
nontopological alternative. Systematic Botany 20:574-588.
Drovetski, S. V., and F. Ronquist. 2003. Plio-Pleistocene climatic oscillations, Holarctic
biogeography and speciation in an avian subfamily. Journal of Biogeography 30:1173-
1181.
Droxler, A. W., and J. W. Farrell. 2000. Marine isotope stage 11 (MIS 11): new insights for a
warm future. Global and Planetary Change 24:1-5.
Edwards, S. V. 1993. Long-distance gene flow in a cooperative breeder detected in genealogies
of mitochondrial DNA sequences. Proceedings of the Royal Society of London Series B-
Biological Sciences 252:177-185.
Edwards, S. V., and P. Beerli. 2000. Perspective: Gene divergence, population divergence, and
the variance in coalescence time in phylogeographic studies. Evolution 54:1839-1854.
Edwards, S. V., S. B. Kingan, J. D. Calkins, C. N. Balakrishnan, W. B. Jennings, W. J. Swanson,
and M. D. Sorenson. 2005. Speciation in birds: Genes, geography, and sexual selection.
Proceedings of the National Academy of Sciences of the United States of America
102:6550-6557.
Excoffler, L., P. E. Smouse, and J. M. Quattro. 1992. Analysis of molecular variance inferred
from metric distances among DNA haplotypes- Application to human mitochondrial
DNA restriction data. Genetics 131:479-491.
Faaborg, J. 1982. Avian population fluctuations during drought conditions in Puerto Rico.
Wilson Bulletin 94:20-30.
Fiedler, W. 2003. Recent changes in migratory behavior of birds: a compilation of field
observations and ringing data. Pp. 21-28 in P. Berthold, E. Gwinner, and E.
Sonnenschein, eds. Avian migration. Springer Verlag, Heidelberg.
Fleischer, R. C., S. L. Olson, H. F. James, and A. C. Cooper. 2000. Identification of the extinct
Hawaiian eagle (Haliaeetus) by mtDNA sequence analysis s. Auk 11 7: 1051 105 6.










France, S. C., and T. D. Kocher. 1996. DNA sequencing of formalin-fixed crustaceans from
archival research collections. Molecular Marine Biology and Biotechnology 5:304-313.
Freeland, J. R., M. May, R. Lodge, and K. F. Conrad. 2003. Genetic diversity and widespread
haplotypes in a migratory dragonfly, the common green darner Ancocjunius. Ecological
Entomology 28:413-421.
Friedmann H. 1950. The birds of Middle and North America XI. United States National Museum
Bulletin 50. Smithsonian Institution, Washington, D.C.
Friesen, V. L. 2000. Introns. Pp. 274-294 in A. J. Baker, ed. Molecular methods in ecology.
Blackwell Science, Oxford.
Friesen, V. L., B. C. Congdon, M. G. Kidd, and T. P. Birt. 1999. Polymerase chain reaction
(PCR) primers for the amplification of five nuclear introns in vertebrates. Molecular
Ecology 8:2147-2149.
Friesen, V. L., B. C. Congdon, H. E. Walsh, and T. P. Birt. 1997. Intron variation in marbled
murrelets detected using analyses of single-stranded conformational polymorphisms.
Molecular Ecology 6: 1047-1058.
Gauthreaux, S. 1982. The ecology and evolution of avian migration systems. Pp. 93-168 in D. S.
Farner, J. R. King, and K. C. Parkes, eds. Avian biology. Academic Press, New York.
Gauthreaux, S. A., JR. 1980. The influences of long-term and short-term climatic changes on the
dispersal and migration of organisms. Pp. 103-174 in S. A. Gauthreaux, Jr., ed. Animal
migration, orientation, and navigation. Academic Press, New York.
Genise, J. F. 1997. A fossil termite nest from the Marplatan stage (late Pliocene) of Argentina:
palaeoclimatic indicator. Palaeogeography Palaeoclimatology Palaeoecology 136:139-
144.
Gerhardt, R. P., Gerhardt, D. M., and M. A. Vasquez 2004. Food delivered to nests of Swallow-
tailed Kites in Tikal National Park, Guatemala. Condor 106:1:177-181.
Gill, F. B. 1995. Ornithology, 2nd edition. W.H. Freeman and Co., New York.
Greenberg, R., P. J. Cordero, S. Droege, and R. C. Fleischer. 1998. Morphological adaptation
with no mitochondrial DNA differentiation in the coastal plain swamp sparrow. Auk
115:706-712.
Greenwood, P. J., and P. H. Harvey. 1982. The natal and breeding dispersal of birds. Annual
Review of Ecology and Systematics 13:1-21.
Griffiths, R. C., and S. Tavare. 1994. Simulating probability distributions in the coalescent.
Theoretical Population Biology 46:131-159.
Griffiths, R., M. C. Double, K. Orr, and R. J. G. Dawson. 1998. A DNA test to sex most birds.
Molecular Ecology 7:1071-1075.
Guillot, G., F. Mortier, and A. Estoup. 2005. Geneland: a computer package for landscape
genetics. Molecular Ecology Notes 5:712-715.
Gwinner, E. 1996. Circannual clocks in avian reproduction and migration. Ibis 138:47-63.
Gwinner, E., and B. Helm. 2003. Circannual and circadian contributions to the timing of avian
migration. Pp. pp 81-95 in P. Berthold, E. Gwinner, and E. Sonnenschein, eds. Avian
migration. Springer, Berlin, Heidelberg, New York.
Haase, R., and R. Y. Hirooka. 1998. Structure, composition and small litter dynamics of a semi-
deciduous forest in Mato Grosso, Brazil. Flora 193:141-147.
Haavie, J., T. Borge, S. Bures, L. Z. Garamszegi, H. M. Lampe, J. Moreno, A. Qvarnstrom, J.
Torok, and G. P. Saetre. 2004. Flycatcher song in allopatry and sympatry convergence,
divergence and reinforcement. Journal of Evolutionary Biology 17:227-237.










Hahn, T. P. 1998. Reproductive seasonality in an opportunistic breeder, the red crossbill, Loxia
curvirostra. Ecology 79:2365-2375.
Hamner, W. M., and J. Stocking. 1970. Why don't bobolinks breed in Brazil? Ecology 51:743-&.
Helbig, A. J. 2003. Evolution of bird migration: a phylogenetic and biogeographic perspective.
Pp. 3-20 in P. Berthold, E. Gwinner, and E. Sonnenschein, eds. Avian migration.
Springer, Berlin.
Helbig, A. J., A. G. Knox, D. T. Parkin, G. Sangster, and M. Collinson. 2002. Guidelines for
assigning species rank. Ibis 144:518-525.
Helbig, A. J., A. Kocum, I. Seibold, and M. J. Braun. 2005. A multi-gene phylogeny of aquiline
eagles (Aves : Accipitriformes) reveals extensive paraphyly at the genus level. Molecular
Phylogenetics and Evolution 35:147-164.
Helbig, A. J., M. Salomon, S. Bensch, and I. Seibold. 2001. Male-biased gene flow across an
avian hybrid zone: evidence from mitochondrial and microsatellite DNA. Journal of
Evolutionary Biology 14:277-287.
Helm, B., E. Gwinner, and L. Trost. 2005. Flexible seasonal timing and migratory behavior
results from stonechat breeding programs. Pp. 216-227. Bird hormones and bird
migrations: Analyzing hormones in droppings and egg yolks and assessing adaptations in
long-distance migration. New York Academy of Sciences, New York.
Hewitt, G. 2000. The genetic legacy of the Quatemnary ice ages. Nature 405:907-913.
Hewitt, G. M. 2004. Genetic consequences of climatic oscillations in the Quaternary.
Philosophical Transactions of the Royal Society of London Series B-Biological Sciences
359:183-195.
Hill, G. E., R. R. Sargent, and M. B. Sargent. 1998. Recent change in the winter distribution of
rufous hummingbirds. Auk 115:240-24-5.
Hoelzer, G. A. 1997. Inferring phylogenies from mtDNA variation: Mitochondrial-gene trees
versus nuclear-gene trees revisited. Evolution 51:622-626.
Howard, W. R. 1997. Palaeoclimatology A warm future in the past. Nature 388:418-419.
Irwin, D. E. 2002. Phylogeographic breaks without geographic barriers to gene flow. Evolution
56:2383-2394.
Irwin, D. E., S. Bensch, and T. D. Price. 2001b. Speciation in a ring. Nature 409:333-337.
Irwin, D. E., and J. H. Irwin. 2005. Siberian migratory divides--the role of seasonal migration in
speciation in R. Greenberg, and P. P. Marra, eds. Birds of two worlds: The ecology and
evolution of migration. Johns Hopkins University Press, Baltimore.
Irwin, D. E., J. H. Irwin, and T. D. Price. 2001a. Ring species as bridges between microevolution
and speciation. Genetica 112:223-243.
Irwin, D. E., and T. Price. 1999. Sexual imprinting, learning and speciation. Heredity 82:347-
354.
Jahn, A. E., D. J. Levey, and K. G. Smith. 2004. Reflections across hemispheres: A system-wide
approach to new world bird migration. Auk 121:1005-1013.
Johnson, D. H., and J. W. Grier. 1988. Determinants of breeding distributions of ducks. Wildlife
Monographs:1-37.
Joseph, L. 1997. Towards a broader view of neotropical migrants: Consequences of a re-
examination of austral migration. Ornitologia Neotropical 8:31-36.
Joseph, L. 2005. Molecular approaches to the evolution and ecology of migration. Pp. 18-26 in
R. Greenberg, and P. P. Marra, eds. Birds of two worlds: The ecology and evolution of
migration. Johns Hopkins University Press, Baltimore.










Joseph, L., T. Wilke, and D. Alpers. 2003. Independent evolution of migration on the South
American landscape in a long-distance temperate-tropical migratory bird, Swainson's
flycatcher (M~yiarchus swainsoni). Journal of Biogeography 30:925-937.
Kharitonov, S. P., and D. Siegel-Causey. 1988. Colony formation in seabirds. Pp. 223-272 in R.
F. Johnson, ed. Current Ornithology. Plennum Press, New York.
Kimura, M., S. M. Clegg, I. J. Lovette, K. R. Holder, D. J. Girman, B. Mila, P. Wade, and T. B.
Smith. 2002. Phylogeographical approaches to assessing demographic connectivity
between breeding and overwintering regions in a nearctic-neotropical warbler (Wilsonia
pusilla). Molecular Ecology 11:1605-1616.
Klicka, J., and R. M. Zink. 1997. The importance of recent ice ages in speciation: A failed
paradigm. Science 277:1666-1669.
Kukla, G. J., M. L. Bender, J. L. de Beaulieu, G. Bond, W. S. Broecker, P. Cleveringa, J. E.
Gavin, T. D. Herbert, J. Imbrie, J. Jouzel, L. D. Keigwin, K. L. Knudsen, J. F. McManus,
J. Merkt, D. R. Muhs, H. Muller, R. Z. Poore, S. C. Porter, G. Seret, N. J. Shackleton, C.
Turner, P. C. Tzedakis, and I. J. Winograd. 2002. Last interglacial climates. Quaternary
Research 58:2-13.
Ledru, M. P. 1993. Late quaternary environmental and climatic changes in central Brazil.
Quaternary Research 39:90-98.
Leisler, B. 1990. Selection and use of habitat of wintering migrants. Pp. 156-174 in E. Gwinner,
ed. Bird migration. Springer Verlag, Berlin.
Lemner, H. R. L., and D. P. Mindell. 2005. Phylogeny of eagles, Old World vultures, and other
Accipitridae based on nuclear and mitochondrial DNA. Molecular Phylogenetics and
Evolution 37:327-346.
Lessa, E. P., and G. Applebaum. 1993. Screening techniques for detecting allelic variation in
DNA sequences. Molecular Ecology 2: 119-129.
Lessa, E. P., J. A. Cook, and J. L. Patton. 2003. Genetic footprints of demographic expansion in
North America, but not Amazonia, during the Late Quaternary. Proceedings of the
National Academy of Sciences of the United States of America 100:1033 1-10334.
Levey, D. J. 1994. Why we should adopt a broader view of neotropical migrants. Auk 1 11:233-
236.
Levey, D. J., and F. G. Stiles. 1992. Evolutionary precursors of long-distance migration, resource
availability, and movement patterns in neotropical landbirds. American Naturalist
140:447-476.
Lincoln, F. C. 1950. Migration of Birds. Circular 16 of the Fish and Wildlife Service, Dept. of
Interior. U.S. Govt. Printing office.
Lopez, J. V., N. Yuhki, R. Masuda, W. Modi, and S. J. Obrien. 1994. NUMT, a recent transfer
and tandem amplification of mitochondrial DNA to the nuclear genome of the domestic
cat. Journal of Molecular Evolution 3 9:174-190.
Lovette, I. J. 2004. Mitochondrial dating and mixed-support for the "2% rule" in birds. Auk
121:1-6.
Marshall, H. D., and A. J. Baker. 1997. Structural conservation and variation in the
mitochondrial control region of fringilline finches (Fringilla spp) and the greenfinch
(Carduelis chloris). Molecular Biology and Evolution 14:173-184.
Martinez, M. M. 1983. Nidificacion de Hirundo rustica etythroga~ster (Boddaert) en la Argentina
(Aves, Hirondinidae). Neotropica 29:83-86.
McKinney, F. 1965. Spacing and chasing in breeding ducks. Wildfowl 16:92-106.










McKinnon, J. S., S. Mori, B. K. Blackman, L. David, D. M. Kingsley, L. Jamieson, J. Chou, and
D. Schluter. 2004. Evidence for ecology's role in speciation. Nature 429:294-298.
Mettke-Hofmann, C. 2007. Obj ect exploration of garden and Sardinian warblers peaks in spring.
Ethology 113:174-182.
Mettke-Hofmann, C., and R. Greenberg. 2005. Behavioral and cognitive adaptations to long-
distance migration. Pp. 114-123 in R. Greenberg, and P. P. Marra, eds. Birds of two
Worlds: The ecology and evolution of migration. Johns Hopkins University Press,
Baltimore.
Mettke-Hofmann, C., and E. Gwinner. 2004. Differential assessment of environmental
information in a migratory and a nonmigratory passerine. Animal Behaviour 68:1079-
1086.
Mettke-Hofmann, C., M. Wink, H. Winkler, and B. Leisler. 2005. Exploration of environmental
changes relates to lifestyle. Behavioral Ecology 16:247-254.
Meyer, K. D. 2004. Demography, dispersal, and migration of the swallow-tailed kite. Final
Report. Florida Fish and Wildlife Conservation Commission, Tallahassee, Florida.
Meyer, K. D. 1995. Swallow-tailed Kite (Elanoides forticatus) in A. Poole, and F. Gill, eds. The
birds of North America, No. 138. The Academy of Natural Sciences, Philadelphia, PA,
and The American Ornithologists' Union, Washington, DC.
Mila, B., T. B. Smith, and R. K. Wayne. 2006. Postglacial population expansion drives the
evolution of long-distance migration in a songbird. Evolution 60:2403-2409.
Mila, B., T. B. Smith, and R. K. Wayne. 2007. Speciation and rapid phenotypic differentiation in
the yellow-rumped warbler Dendroica coronata complex. Molecular Ecology 16: 159-
173.
Monteiro, L. R., and R. W. Fumness. 1998. Speciation through temporal segregation of Madeiran
storm petrel (Oceanodroma ca~stro) populations in the Azores? Philosophical
Transactions of the Royal Society of London Series B-Biological Sciences 3 53:945-953.
Moore, F. R., and M. V. McDonald. 1993. On the possibility that intercontinental landbird
migrants copulate en-route. Auk 110:157-160.
Moore, W. S. 1995. Inferring phylogenies from mtDNA variation- Mitochondrial gene trees
versus nuclear gene trees. Evolution 49:718-726.
Moreau, R. E. 1972. The Palearctic-African bird migration systems. Academic Press, London.
Morris, Rev. F. O. 1891. A History of British Birds. Groombridge & Sons, London.
Myers, N., R. A. Mittermeier, C. G. Mittermeier, G. A. B. da Fonseca, and J. Kent. 2000.
Biodiversity hotspots for conservation priorities. Nature 403:853-858.
Nathan, R., G. Perry, J. T. Cronin, A. E. Strand, and M. L. Cain. 2003. Methods for estimating
long-distance dispersal. Oikos 103:261-273.
O'Connor, R. J. 1986. Biological characteristics of invaders among bird species in Britain.
Philosophical Transactions of the Royal Society of London Series B-Biological Sciences
314:583-598.
O'Hara, R. J. 1994. Evolutionary history and the species problem. American Zoologist 34:12-22.
Omland, K. E., and S. M. Lanyon. 2000. Reconstructing plumage evolution in orioles (Icterus):
Repeated convergence and reversal in patterns. Evolution 54:2119-2133.
Orr, M. R., and T. B. Smith. 1998. Ecology and speciation. Trends in Ecology & Evolution
13:502-506.
Ortlieb, L., A. Diaz, and N. Guzman. 1996. A warm interglacial episode during Oxygen isotope
stage 11 in northern Chile. Quaternary Science Reviews 15:857-871.










Outlaw, D. C., G. Voelker, B. Mila, and D. J. Girman. 2003. Evolution of long-distance
migration in and historical biogeography of Catharus thrushes: A molecular phylogenetic
approach. Auk 120:299-310.
Palumbi, S. R., and C. S. Baker. 1994. Contrasting population structure from nuclear intron
sequences and mtDNA of humpback whales. Molecular Biology and Evolution 1 1:426-
435.
Pamilo, P., and M. Nei. 1988. Relationships between gene trees and species trees. Molecular
Biology and Evolution 5:568-583.
Paradis, E., S. R. Baillie, W. J. Sutherland, and R. D. Gregory. 1998. Patterns of natal and
breeding dispersal in birds. Journal of Animal Ecology 67:518-536.
Pennington, R. T., D. E. Prado, and C. A. Pendry. 2000. Neotropical seasonally dry forests and
Quaternary vegetation changes. Journal of Biogeography 27:261-273.
Pereira, S. L., and A. J. Baker. 2006. A mitogenomic timescale for birds detects variable
phylogenetic rates of molecular evolution and refutes the standard molecular clock.
Molecular Biology and Evolution 23:1731-1740.
Pereira, S. L., E. T. Grau, and A. Wajntal. 2004. Molecular architecture and rates of DNA
substitutions of the mitochondrial control region of cracid birds. Genome 47:53 5-545.
Perez-Tris, J., A. Ramirez, and J. L. Telleria. 2003. Are Iberian chiffchaffs Phylloscopus
(collybita) brehmii long-distance migrants? An analysis of flight-related morphology.
Bird Study 50:146-152.
Petit, J. R., J. Jouzel, D. Raynaud, N. I. Barkov, J. M. Barnola, I. Basile, M. Bender, J.
Chappellaz, M. Davis, G. Delaygue, M. Delmotte, V. M. Kotlyakov, M. Legrand, V. Y.
Lipenkov, C. Lorius, L. Pepin, C. Ritz, E. Saltzman, and M. Stievenard. 1999. Climate
and atmospheric history of the past 420,000 years from the Vostok ice core, Antarctica.
Nature 399:429-436.
Pitra, C., M. A. D'Aloia, D. Lieckfeldt, and O. Combreau. 2004. Genetic variation across the
current range of the Asian houbara bustard (Chlamydotis und'ulata macqueenii).
Conservation Genetics 5:205-215.
Poke, F. S., D. P. Martin, D. A. Steane, R. E. Vaillancourt, and J. B. Reid. 2006. The impact of
intragenic recombination on phylogenetic reconstruction at the sectional level in
Eucalyptus when using a single copy nuclear gene (cinnamoyl CoA reductase).
Molecular Phylogenetics and Evolution 39:160-170.
Pomilla, C., and H. C. Rosenbaum. 2005. Against the current: an inter-oceanic whale migration
event. Biology Letters 1:476-479.
Potti, J. 1998. Arrival time from spring migration in male pied flycatchers: Individual
consistency and familial resemblance. Condor 100:702-708.
Prado, D. E. 1993. What is the Gran Chaco vegetation in South America? I. A review. Candollea
48:145-172.
Prado, D. E., and P. E. Gibbs. 1993. Patterns of species distributions in the dry seasonal forests
of South America. Annals of the Missouri Botanical Garden 80:902-927.
Prance, G. T., and G. B. Schaller. 1982. Preliminary study of some vegetation types of the
Pantanal, Mato Grosso, Brazil. Brittonia 34:228-251.
Price, T. D., and M. M. Bouvier. 2002. The evolution of F-1 postzygotic incompatibilities in
birds. Evolution 56:2083-2089.
Pulido, F. 2007. The genetics and evolution of avian migration. Bioscience 57: 165-174.










Pulido, F., and P. Berthold. 2003. Quantitative genetic analysis of migratory behavior. Pp. 53-80
in P. Berthold, E. Gwinner, and E. Sonnenschein, eds. Avian migration. Springer Verlag,
Heidelberg.
Pulido, F., and P. Berthold. 2004. Microevolutionary response to climatic change. Pp. 151-183.
Birds and climate change. Academic Press Ltd, London.
Pulido, F., P. Berthold, G. Mohr, and U. Querner. 2001. Heritability of the timing of autumn
migration in a natural bird population. Proceedings of the Royal Society of London Series
B-Biological Sciences 268:953-959.
Pulido, F., and M. Widmer. 2005. Are long-distance migrants constrained in their evolutionary
response to environmental change? Causes of variation in the timing of autumn migration
in a blackcap (S-atricapilla) and two garden warbler (Sylvia borin) populations. Pp. 228-
241. Bird Hormones and bird migrations: analyzing hormones in droppings and egg yolks
and assessing adaptations in long-distance migration. New York Acad Sciences, New
York.
Pulliam, H. R., and T. A. Parker. 1979. Population regulation of sparrows. Fortschritte Der
Zoologie 25:137-147.
Quinn, T. W. 1992. The genetic legacy of Mother Goose- phylogeographic patterns of lesser
snow goose Chen caerulescens caerulescens maternal lineages. Molecular Ecology
1:105-117.
Rappole, J. 1995. The ecology of migrant birds: a neotropical perspective. Smithsonian
Institution Press, Washington, DC.
Rappole, J. H. 2005. Evolution of old and new world migration systems: a response to Bell.
Ardea 93:125-131.
Rappole, J. H., H. Helm, and M. A. Ramos. 2003. An integrative framework for understanding
the origin and evolution of avian migration. Journal of Avian Biology 34: 124-128.
Rappole, J. H., and P. Jones. 2002. Evolution of old and new world migration systems. Ardea
90:525-537.
Rasmussen, K., D. M. Palacios, J. Calambokidis, M. Saborio, L. Dalla-Rosa, E. Secchi, G.
Steiger, J. Allen, and G. Stone. 2007. Southern Hemisphere humpback whales wintering
off Central America: insights from water temperature into the longest mammalian
migration. Biology Letters 3. doi:10. 1098/rsbl.2007.0067.
Roberts, M. A., T. S. Schwartz, and S. A. Karl. 2004. Global population genetic structure and
male-mediated gene flow in the green sea turtle (Chelonia myda~s): Analysis of
microsatellite loci. Genetics 166:1857-1870.
Robertson, G., and F. Cooke. 1999. Winter philopatry in migratory waterfowl. Auk 116:20-34.
Robertson, W. B. J. 1988. American swallow-tailed kite. Pp. 109-131 in R. S. Palmer, ed.
Handbook of North American birds. Yale University Press, New Haven.
Rockwell, R. F., and F. Cooke. 1977. Gene flow and local adaptation in a colonially nesting
dimorphic bird, lesser snow goose (Anser caerulescens caerulescens). American
Naturalist 111:91-97.
Ruegg, K. C., and T. B. Smith. 2002. Not as the crow flies: a historical explanation for circuitous
migration in Swainson's thrush (Catharus ustulatus). Proceedings of the Royal Society of
London Series B-Biological Sciences 269:1375-1381.
Ruokonen, M., and L. Kvist. 2002. Structure and evolution of the avian mitochondrial control
region. Molecular Phylogenetics and Evolution 23:422-432.










Saetre, G. P., T. Moum, S. Bures, M. Kral, M. Adamjan, and J. Moreno. 1997. A sexually
selected character displacement in flycatchers reinforces premating isolation. Nature
387:589-592.
Safriel, U. N. 1995. The evolution of palearctic migration- The case for southern ancestry. Israel
Journal of Zoology 41:417-43 1.
Salewski, V., and P. Jones. 2006. Palearctic passerines in Afrotropical environments: a review.
Journal of Ornithology 147: 192-201.
Serrano, D., M. G. Forero, J. A. Donazar, and J. L. Tella. 2004. Dispersal and social attraction
affect colony selection and dynamics of lesser kestrels. Ecology 85:3438-3447.
Sick, H. 1993. Birds in Brazil: A natural history. Princeton University Press, Princeton.
Skinner, R. W. 1964. Two significant specimens of the Swallow-tailed kite from Alabama.
Alabama Birdlife 12:42.
Slatkin, M. 1987. Gene flow and the geographic structure of natural populations. Science
236:787-792.
Slatkin, M., and W. P. Maddison. 1989. A cladistic measure of gene flow inferred from the
phylogenies of alleles. Genetics 123:603-613.
Slatkin, M., and W. P. Maddison. 1990. Detecting isolation by distance using phylogenies of
genes. Genetics 126:249-260.
Smith, A. B. 1994. Rooting molecular trees- problems and strategies. Biological Joumnal of the
Linnean Society 51:279-292.
Snyder, N. F. R., and J. W. Wiley. 1976. Sexual size dimorphism in hawks and owls of North
America. American Ornithologists' Union.
Sol, D., R. P. Duncan, T. M. Blackbum, P. Cassey, and L. Lefebvre. 2005b. Big brains,
enhanced cognition, and response of birds to novel environments. Proceedings of the
National Academy of Sciences of the United States of America 102:5460-5465.
Sol, D., and L. Lefebvre. 2000. Behavioural flexibility predicts invasion success in birds
introduced to New Zealand. Oikos 90:599-605.
Sol, D., L. Lefebvre, and J. D. Rodriguez-Teijeiro. 2005a. Brain size, innovative propensity and
migratory behaviour in temperate Palaearctic birds. Proceedings of the Royal Society B-
Biological Sciences 272:1433-1441.
Soltis, D. E., M. A. Gitzendanner, D. D. Strenge, and P. S. Soltis. 1997. Chloroplast DNA
intraspecific phylogeography of plants from the Pacific Northwest of North America.
Plant Systematics and Evolution 206:353-373.
Sorenson, M. D., J. C. Ast, D. E. Dimcheff, T. Yuri, and D. P. Mindell. 1999. Primers for a PCR-
based approach to mitochondrial genome sequencing in birds and other vertebrates.
Molecular Phylogenetics and Evolution 12:105-114.
Spendelow, J. A., J. D. Nichols, I. C. T. Nisbet, H. Hays, G. D. Cormons, J. Burger, C. Safina, J.
E. Hines, and M. Gochfeld. 1995. Estimating annual survival and movement rates of
adults within a metapopulation of roseate temns. Ecology 76:2415-2428.
Spichiger, R., C. Calenge, and B. Bise. 2004. Geographical zonation in the neotropics of tree
species characteristic of the Paraguay-Parana Basin. Journal of Biogeography 3 1 :1489-
1501.
Stephens, M., N. J. Smith, and P. Donnelly. 2001. A new statistical method for haplotype
reconstruction from population data. American Journal of Human Genetics 68:978-989.
Stotz, D. F., J. W. Fitzpatrick, T. A. I. Parker, and D. B. Moskovits. 1996. Neotropical birds:
Ecology and conservation. University of Chicago Press, Chicago.










Sutherland, G. D., A. S. Harestad, K. Price, and K. P. Lertzman. 2000. Scaling of natal dispersal
distances in terrestrial birds and mammals. Conservation Ecology 4:44.
Sutherland, W. J. 1998. Evidence for flexibility and constraint in migration systems. Journal of
Avian Biology 29:441-446.
Swofford, D. 1998. Phylogenetic analysis using parsimony (and other methods) PAUP 4.04 beta
version. Sinauer Associates, Sunderland.
Terrill, S. B., and R. D. Ohmart. 1984. Facultative extension of fall migration by yellow-rumped
warblers (Dendroica coronata). Auk 101:427-438.
Thomas, W. K., S. Paabo, F. X. Villablanca, and A. C. Wilson. 1990. Spatial and temporal
continuity of kangaroo rat populations shown by sequencing mitochondrial DNA from
museum specimens. Journal of Molecular Evolution 3 1 :101-1 12.
Thompson, J. D., D. G. Higgins, and T. J. Gibson. 1994. CLUSTAL-W Improving the
sensitivity of progressive multiple sequence alignment through sequence weighting,
position-specific gap penalties, and weight matrix choice. Nucleic Acids Research
22:4673-4680.
Thorup, K. 2006. Does the migration programme constrain dispersal and range sizes of
migratory birds? Journal of Biogeography 3 3: 1166-1 171.
Tilley, S. G., R. B. Merritt, B. Wu, and R. Highton. 1978. Genetic differentiation in salamanders
of Desmognathus ochrophaeus complex (Plethontidae). Evolution 32:93-1 15.
Trakhtenbrot, A., R. Nathan, G. Perry, and D. M. Richardson. 2005. The importance of long-
distance dispersal in biodiversity conservation. Diversity and Distributions 11:173-181.
Veen, T., N. Svedin, J. T. Forsman, M. B. Hjernquist, A. Qvarnstrom, K. A. T. Hjemquist, J.
Traff, and M. Klaassen. 2007. Does migration of hybrids contribute to post-zygotic
isolation in flycatchers? Proceedings of the Royal Society B-Biological Sciences
274:707-712.
Veltman, C. J., S. Nee, and M. J. Crawley. 1996. Correlates of introduction success in exotic
New Zealand birds. American Naturalist 147:542-557.
Vigilant, L., M. Stoneking, H. Harpending, K. Hawkes, and A. C. Wilson. 1991. African
populations and the evolution of human mitochondrial DNA. Science 253:1503-1507.
Viverette, C. B., S. Struve, L. J. Goodrich, and K. L. Bildstein. 1996. Decreases in migrating
sharp-shinned hawks (Accipiter striatus) at traditional raptor-migration watch sites in
eastern North America. Auk 113:32-40.
Walsh, P. S., D. A. Metzger, and R. Higuchi. 1991. Chelex-100 as a medium for simple
extraction of DNA for PCR based typing from forensic material. Biotechniques 10:506-
513.
Wahlund, S. 1928. Zusammensetzung von population und korrelationserscheinung vom
standpunkt der vererbungslehre aus betrachtet. Heredita~s 11:65-106.
Wang, Z. S., A. J. Baker, G. E. Hill, and S. V. Edwards. 2003. Reconciling actual and inferred
population histories in the house finch (Carpodacus mexicanus) by AFLP analysis.
Evolution 57:2852-2864.
Ward, P. 1971. Migration patterns of Quelea quelea in Africa. Ibis 1 13:275-297.
Webster, M. S., and P. P. Marra. 2005. The importance of understanding migratory connectivity
and seasonal interactions in R. Greenberg, and P. P. Marra, eds. Birds of Two Worlds:
The Ecology and Evolution of Migration. Johns Hopkins University Press, Baltimore.
Weir, B. S., and C. C. Cockerham. 1984. Estimating F-statistics for the analysis of population
structure. Evolution 38:1358-1370.










Wenink, P. W., A. J. Baker, H. U. Rosner, and M. G. J. Tilanus. 1996. Global mitochondrial
DNA phylogeography of Holarctic breeding dunlins (Calidris alpina). Evolution 50:3 18-
330.
Wiens, J. A. 1976. Population responses to patchy environments. Annual Review of Ecology and
Systematics 7:81-120.
Wiens, J. J., and T. A. Penkrot. 2002. Delimiting species using DNA and morphological
variation and discordant species limits in spiny lizards (Sceloporus). Systematic Biology
51:69-91.
Williams, D., D. Dunkerley, P. DeDeckker, P. Kershaw, and M. Chappell. 1998. Quaternary
Environments. Amold, London.
Wilson, A. C., R. L. Cann, S. M. Carr, M. George, U. B. Gyllensten, K. M. Helmbychowski, R.
G. Higuchi, S. R. Palumbi, E. M. Prager, R. D. Sage, and M. Stoneking. 1985.
Mitochondrial DNA and 2 perspectives on evolutionary genetics. Biological Journal of
the Linnean Society 26:375-400.
Winker, K. 1993. Specimen shrinkage in Tennessee Warblers and Trails Flycatchers. Journal of
Field Ornithology 64:331-336.
Winker, K. 2000. Evolution Migration and speciation. Nature 404:36-36.
Winker, K. 2006. On the origin of species through heteropatric differentiation. Journal of
Ornithology 147:273-273.
Winker, K., and C. L. Pruett. 2006. Seasonal migration, speciation, and morphological
convergence in the genus Catharus (Turdidae). Auk 123:1052-1068.
Winkler, D. W. 2005. How do migration and dispersal interact? Pp. 401-413 in R. Greenberg,
and P. P. Marra, eds. Birds of two worlds: The ecology and evolution of migration. Johns
Hopkins University Press, Baltimore.
Winkler, D. W. 2007. Roosts and migrations of swallows (Hirondinidae). Homnero (B. Aires) in
press.
Winkler, H., B. Leisler, and G. Bernroider. 2004. Ecological constraints on the evolution of
avian brains. Journal of Ornithology 145:238-244.
Yang, D. Y., B. Eng, J. S. Waye, J. C. Dudar, and S. R. Saunders. 1998. Technical note:
Improved DNA extraction from ancient bones using silica-based spin columns. American
Journal of Physical Anthropology 105:539-543.
Zhang, D. X., and G. M. Hewitt. 2003. Nuclear DNA analyses in genetic studies of populations:
practice, problems and prospects. Molecular Ecology 12:563-584.
Zink, R. M. 2002. Towards a framework for understanding the evolution of avian migration.
Journal of Avian Biology 33:433-436.
Zink, R. M., and M. C. McKitrick. 1995. The debate over species concepts and its implications
for omithology. Auk 112:701-719.









BIOGRAPHICAL SKETCH

Audrey was born in North Carolina and has lived many places in her life. Charlottesville,

Virginia is the closest she ever came to home although her mother's family as well as her

research has taken her to lovely Brazil many times. She loves to run, play with her dog,

read, travel to Central and South America, and dance to Latin or Alt-country music.

Her undergraduate education ranged from the Universities of North Carolina and

Montana to Cornell University where she received a degree in natural resources with honors.

Her research while enrolled at the University of Florida also took her to many other academic

settings including the College of Charleston, University of Texas at El Paso, and University of

Virginia She hopes to continue working on conservation issues in Latin America, including

side-proj ects involving the exquisite, disarming, and alluring Swallow-tailed Kite.





PAGE 1

1 PHYLOGEOGRAPHY OF THE SWALLOW-TAILED KITE ( Elanoides forficatus ) By AUDREY WASHBURN A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2007

PAGE 2

2 2007 Audrey Washburn

PAGE 3

3 To my parents, Marcy Rol and John Washburn.

PAGE 4

4 ACKNOWLEDGMENTS I am thankful to my family and friend s and advisors, who never doubted me, and especially to my parents who have funded my lif e. My academic advisor, Ken Meyer, and lab advisors, Allan Strand and Kim Norris-Caneda, taught me everything I know about biology, and I am so grateful for all of their support and enormous amounts of help. Douglas Taylor and Maurine Neiman provided guidance, statistical support, and facilities Douglas Levey and Kathryn Sieving allowed me to overstay my welcom e, then read and helped edit my long thesis. Swallow-tailed kites were my inspiration, a nd I apologize to those whom I annoyed. Their beauty and grace kept me going in the field wh en times got tough. My dogs, Sarah and Chiara, kept me company in the tedium of lab and de sk-work. I appreciate Mario Cohn-Haft for his ideas and conversation. Many families and labs hosted me throughout my research. I greatly appreciated their hospitality. These included: Ar thur Coelho Barbosa and family at Fazenda Campana; Tetsuo No, Jercelino and Rosemary Aparecido Santos at Fazenda Palmital; Gilda de Jesus Martims de Oliveira, Leonildo and Viuma Nespoli at Rancho Alegre and Fazenda Laranjal; managers at Tikal National Park; Stephen B. Aley at Universi ty of Texas at El Paso; and Doug Taylors lab including the helpful Ste phen Keller and Dan Sloan. During fieldwork, I also had a lo t of help. People who provide d invaluable assistance in the field included: Richard P. Gerhardt, Miguel Angel Vsquez, Francisco Chico Cruz Neto, Sergio Seipke, Renata Leite Pitman, Marcos de Azevedo, Vitor de Piacentini, Edson Aparecido Santos, Gina Zimmerman, and Andy Day. I espe cially thank John Arnett, Diana Swan, and Jennifer Edwards, for thei r help and friendship.

PAGE 5

5 Tissue samples were provided by many sour ces. Everyone was extremely generous. These individuals and museums included: Richar d P. Gerhardt, The Peregrine Fund; Jennifer Coulson, Department of Ecology and Evolutiona ry Biology, Tulane University; John Cely, South Carolina Department of Natural Resources; Jim Elliott, South Carolina Center for Birds of Prey; Marcos de Azevedo; Andreas Helbig, In stitute of Zoology, University of Greifswald; Auburn University Natural History Museum an d Learning Center; Museum of Comparative Zoology at Harvard; Museo de Hi storia Natural Capao Imbuia; Moore Laboratory of Zoology at Occidental College; University of California, Museum of Vertebrate Zoology; University of Michigan Museum of Zoology; National Museum of Natural History; Yale Peabody Museum; Florida Museum of Natural Hi story; Academy of Natural Sc iences of Philadephia; Field Museum of Natural History; Louisiana State Univ ersity Museum of Natural Science; American Museum of Natural History; Royal Ontario Mu seum; and the Western Foundation of Vertebrate Zoology. Permits were provide by IBAMA, CEMAVE and CNPQ in Brazil. Funding was provided by The Disney Wildlife Conservation F und, Florida Fish and Wildlife Conservation Commission, Georgia Department of Natural Re sources, National Fish and Wildlife Foundation, Jennings Scholarship (University of Florida), Women's Agricu ltural Society Scholarship, The Broussard Conservancy Conservation Award, Expl orer's Club of Florida, and the Florida Ornithological Societ y Cruickshank Award.

PAGE 6

6 TABLE OF CONTENTS page ACKNOWLEDGMENTS...................................................................................................... 4 LIST OF TABLES ................................................................................................................ ........8 LIST OF FIGURES................................................................................................................ .......9 ABSTRACT....................................................................................................................... ..........10 CHAPTER 1 INTRODUCTION................................................................................................................12 2 METHODS........................................................................................................................ ...21 Sampling....................................................................................................................... .........21 Lab Techniques................................................................................................................. .....23 Resolving Genetic Variation.................................................................................................27 Morphological Techniques....................................................................................................29 Analysis....................................................................................................................... ..........30 3 RESULTS........................................................................................................................ .....39 Descriptive Statistics by Locus..............................................................................................39 Swallow-Tailed Kite Phylogeography Based on mtDNA.....................................................41 Swallow-Tailed Kite Phylogeography Based on nDNA.......................................................42 Differences between Populations as Defined A Posteriori....................................................43 Structure within Clade/Genetic Population...........................................................................44 4 DISCUSSION.....................................................................................................................500 Subdivision/Gene Flow: Between Populations...................................................................500 Possible Explanations for Population Structure in Elanoides ....................................533 Reduced Gene Flow within Elanoides Compared to Other Migratory Species.........600 Relationship between Migr ation and Speciation in Elanoides and Similar Species....63 Morphology and Subspecies................................................................................................700 Population History............................................................................................................. ..733 Subdivision/Gene Flow: Within Populations........................................................................77 Implications................................................................................................................... ........79 5 SUMMARY........................................................................................................................822 APPENDIX

PAGE 7

7 A SAMPLE INFORMATION.................................................................................................84 B PCR CONDITIONS FOR EACH LOCUS........................................................................118 C MORPHOLOGICAL RAW DATA..................................................................................120 D PHYLOGENETIC TREES................................................................................................124 LITERATURE CITED..............................................................................................................1 28 BIOGRAPHICAL SKETCH.....................................................................................................141

PAGE 8

8 LIST OF TABLES Table page 2-1 Description of genetic regions amp lified and associated primers... .37 3-1 Descriptive statistics for each mitochondrial clade.. 45 3-2 Mismatch distribution data 3-3 Comparison of measurements between groups of Swallow-tailed Kites..46 A-1 Sample collection information.......... 85 A-2 Sample contributor, population designations, and accession numbers... 103 B-1 PCR conditions for each locus.119 C-1 Morphological raw data...

PAGE 9

9 LIST OF FIGURES Figure page 1-1 Documented breeding of Swallow-tailed Kites ........20 3-1 Molecular data as it relates to geography..47 3-2 Phylogeographic structure within clades or genetic populations .49 D-1 NJ tree based on CR Breeder Long dataset ....125 D-2 NJ tree based on CR Breeder Short dataset ...126 D-3 NJ tree based on CR All Short dataset ..127

PAGE 10

10 Abstract of Thesis Presente d to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Master of Science PHYLOGEOGRAPHY OF THE SWALLOW-TAILED KITE ( Elanoides forficatus ) By Audrey Washburn August 2007 Chair: Kenneth D. Meyer Major: Wildlife Ecology and Conservation Little is known about genetic or morphologi c variation in the Sw allow-tailed Kite (STKI). I investigated patterns of global variation to test hypothe ses relating to species history (origin and expansion) and behavi or (dispersal and breeding). Th e STKI is highly mobile, social year round, and wide-ranging with in and between its summer a nd winter ranges. Migration patterns allow frequent, extensiv e interaction among populations, from the southeastern U.S. to southeastern Brazil. It has b een assumed that migration and di spersal are correlated, and that highly vagile animals will show less subdivision than more sedentary relative s, due to gene flow among populations. However, STKIs are thought to be natally phi lopatric in the US and longdistance migrants are generally known to opera te on rigid schedules, which might discourage behaviors associated with gene flow. I asse ssed gene flow in STKIs with phylogeneticand frequency-based analyses of m itochondrial and nuclear intron se quence data taken from live and museum specimens spanning the species range I also measured morphological variables currently used to distinguish subspecies. I found deep genetic divisions in the STKI without correlated mo rphological breaks. Mitochondrial clades were ge ographically coherent and co rresponded to these genetic populations: 1. the southeastern U.S.; 2. southern Mexico to central Br azil; and 3. central to

PAGE 11

11 southern Brazil. The division near the Pantanal in central Brazil was unexpected. Nuclear loci also showed support for a U.S. population. Phylogenet ic trees indicated an hi storic lack of gene flow among the three areas. One recent gene fl ow event was detected between the two southerly genetic populations and attributed to proximity rather than to migratory behavior. Coalescent and diversity analyses suggested th at these populations originated in the early to late Pleistocene, the northern being the youngest. These STKI popul ations apparently have remained isolated throughout glacial cycles and range changes, resulting in a distri bution where a large neotropical population of residents and short-di stance migrants is bordered to the north and south by smaller temperate-breeding populations of long-dist ance migrants. Each population lacked phylogeographic structure. I sugge st likely scenarios for population histories, reasons for current population boundaries, and explanations fo r panmixia within STKI populations. This study supports the hypothesis that long-distance migrati on can enable speciation and demonstrates that migratory behavior does not necessarily hinder differentiation. I consider potential isolating mechanisms a nd constraints to gene dispersal when population interaction is common and natal philopatry appear s too weak to produce genetic structure. My results suggest that a cryptic pattern of genetic divergence can arise in long-distance mi gratory species whereby movements and breeding locations are flexible as migration patterns evolve, gene flow ceases as migratory patterns become specialized, popula tions continue to interact, and obvious morphologic differences do not de velop. Long-distance migration could facilitate divergence by allowing displacement of populations for part of th e year, strong stabilizi ng selection that limits behavioral plasticity during migration, and interaction among populations, reinforcing mate discrimination when hybrid fitness is reduced. I draw parallels to speci ation patterns in other taxa and reflect on evolutionary implications and conservation for the STKI and similar species.

PAGE 12

12 CHAPTER 1 INTRODUCTION Studies of phylogeography can reveal histori cal and current behavior of a species, facilitate evaluation of explanatory hypothe ses, and help predict future behavior. Phylogeographic structure (geogra phic patterns in a gene geneal ogy) is often found in species that appear panmictic based on morphological sim ilarity and/or range c ontinuity (Tilley et al.1978, Avise and Nelson 1989, Soltis et al. 1997, Irwin 2002a, Bickford et al. 2007) demonstrating that boundaries between vagile organisms can be cryptic Alternatively, many wide-ranging species with disc ontinuous ranges and/or morphologi cal variation have been found to be relatively panmictic (Ball et al. 1988, Brower and Jeansonne 2004, Davis et al. 2006). Phylogeographic studies referred to above have elucidated unexpected behaviors within species such as strong natal philopatry, short or long di stance dispersal, assort ative mating, reproductive isolation, or interbreed ing between populations; have aided in assessment of causal ecological conditions; and have helped develop predicti ons concerning future changes in population structure. Seasonal migratory behavior is often studi ed using phylogeographic information, mainly in regard to its evolution (Freeland et al. 2003, Helbig 2003, Joseph 2005, M ila et al. 2006). One suggested pattern points to tropical origins fo r tropical/temperate migratory birds, whereby populations expanded into temperate zones to ta ke advantage of lower competition and seasonal resources when breeding, and then returned to the tropics to winter (reviewed by Gauthreaux 1982, Rappole 1995, Safriel 1995, Joseph 1997). Since tr adition is the easiest way to explain why migrants often travel so far to winter, it is often postulated that th e population most closely related to the ancestral population is the one harboring wi ntering migrants, (Lincoln 1950, Carr and Coleman 1974, Outlaw et al. 2003). The specie s origin might also be located near the

PAGE 13

13 population containing non-migrator y birds, from which migrator y populations are believed to have stemmed (Rappole and Jones 2002, Helbig 2003, Joseph 2003). Temperate populations are usually found to be less diverse and more r ecently expanded than related tropical populations, probably due to glacial cycles and rela ted movements (Capparella 1988, Hewitt 2000). While the evolution of migration in various species has received much attention, the effects of migration on the speci es evolution are less often stud ied. This may result from the traditional prediction that highly vagile specie s should be the least genetically subdivided (Corbin 1987 Ball et al. 1988, Helbig 2003, review ed by Winker and Pruett 2006). Alternatively, some have hypothesized that mi gratory patterns may pr omote speciation (Cox 1968, Safriel 1995, Winker 2000, Irwin and Irwin 2005). Winker (2006) called this process heteropatric speciation because populations ofte n occur in allopatry and sympatry during a migratory cycle. A lack of data has limited examination of whether bird migration ultimately facilitates or retards gene fl ow, and therefore, genetic subdi vision (Helbig 2003, Irwin and Irwin 2005, Winker and Pruett 2006). Several lines of evidence indicate that migra tion facilitates the disp ersal of genes. Longdistance migratory species within their hemisphere of origin are more widely distributed than con-generic resident species (B hning-Gaese et al. 1998). The cr eation of these distributions must have required relatively flexible migration strategies over a period of time (Baker 1978, Levey and Stiles 1992, Safriel 1995, Berthold 1999, Bell 2000) Flexibility should involve diverse and plastic expressions of migratory orientation and phe nology, resulting in dispersal and incremental range changes. If flexibility were bene ficial in the past, might it not still occur, even in species that appear to have set patterns? Migratory species ha ve been found to disperse farther than resident species (Paradis 1998, Sutherla nd 2000, Thorup 2006) and even obligate migrants

PAGE 14

14 can settle opportunistically to breed when they experience large areas of suitable habitat during the migratory cycle (Martinez 1983, Johnson and Gr ier 1988, Spendelow et al. 1995). Nomadic and facultative migratory species illustrate the benefits of flexibility by regularly taking advantage of temporary resource conditions and shorter migrations (Ward 1971, Pulliam and Parker 1979). Otherwise non-irruptive migrator y species have also shifted their wintering grounds, probably based on resource availability (Berthold et al. 1992, Vi verette et al. 1996, Hill et al. 1998). Migratory bird s may be pre-adapted as expl orers and exploiters of novel environments (Leisler 1990, Mettke-Hofma nn and Greenberg 2005, Winkler 2005, reviewed by Salewski and Jones 2006). Research regarding th e flexibility of behavior in avian migratory species gained increased relevance recently du e to concerns regarding responses to global warming (Sutherland 1998, Pulido a nd Berthold 2004, Both et al. 2006). The logistics of mi gration provide many opportunities to disperse genes between breeding populations. Migratory organisms often get thrown off course during migration and gene flow can result (Baker 1978, Rappole 1995, B ildstein 2004). Conspeci fics from different breeding populations interact on the migratory route or non-br eeding grounds and can either mate or change breeding population (McK inney 1965, Rockwell and Cooke 1977, Moore and McDonald 1993, Wenink et al. 1996, Calambokis et al. 2001, Brower and Pyle 2004, Roberts et al. 2004, Pomilla and Rosenbaum 2005). Studies of long-distance migratory species population structure usually find gene flow between breed ing populations, even when those populations showed strong phylogeographic stru cture (Bowen et al. 1992, Ba ker et al. 1998, Wenink et al. 1996). Conversely, long-distance migr ation may generate barriers to gene flow between populations. Migration allows populations to breed allopatrically because places not habitable

PAGE 15

15 year round can still be used for breeding by animal s able to migrate. Factors likely to promote reproductive isolation between mi gratory populations that intera ct but breed allopatrically include philopatry to natal ar ea (Baker et al. 1990, Bowen et al. 1992, Baker 2002), divergence of behavioral or physical traits due to drift or ecological/se xual selection (Bensch et al. 1998, Irwin et al. 2001a, Winker and Pruett 2006), hybrid unfitness and reinforcement (Helbig et al. 2001, Irwin and Irwin 2005) and phy siological or cognitive constr aints due to adaptations for migration (Hamner and Stocking 1970, Br iskie 1996, Gwinner 1996, Bensch 1999, Pulido and Berthold 2004, Mettke-Hofmann and Greenberg 2005, Sol et al. 2005a). The seemingly suboptimal migration routes of some species suggest that many migra tion patterns are fixed (Moreau 1972, Carr and Coleman 1974, Sutherland 1998, Ruegg and Smith 2002). Divergence can occur between sympatrically-breeding migrat ory populations as well, due to assortative mating between individuals that share migrat ory strategy (McKinnon et al. 2004, Bearhop et al. 2005, Irwin and Irwin 2005). I collected phylogeographic data on the Swa llow-tailed Kite with a primary goal of evaluating two competing hypothese s concerning the relationship between migration and gene dispersal. The Swallow-tailed Kite appears equa lly predisposed to reproduce in isolated groups, which would restrict gene flow, or to interbreed at a low-frequency acros s its range, which would maintain gene flow. The Swallow-tailed Kite is highly mobile, social year round, and encounters few obvious limitations to long range dispersal wi thin its large range. The species has many traits that would appear to pr e-dispose it to long-distance di spersal (Paradis 1998), but limited radio-tracking data indicate that Swallow-tailed Kites are natally philopatric (Meyer 1995). Their migration pattern allows frequent, extensive interaction among all populations, from the southeastern U.S. to southeastern Braz il. Breeding areas and ph enologies are shown in

PAGE 16

16 Figure 1-1. Swallow-tailed Kites disappear from most of their nor thern (red area Figure 1-1) and southern (green area Figure 1-1) range when not breeding (R obertson 1988, Meyer 1995). Dates of disappearance and observations of extremely large wintering roosts in Brazil suggest that Central and North American breeders co-migrate and winter together (Robertson 1988, Meyer 1995, K. Meyer, unpubl. data). The species transequatorial range and gregarity (conspecific attraction on wintering and br eeding grounds), results in wint ering and breeding population coexistence for extended periods of time (Meyer 2004, K. Meyer, unpubl. data). In the austral summer, I often found Swallow-taile d Kite nests in Brazil next to large roosts of wintering breeders from North America (Meyer 2004). Winteri ng birds often arrived before eggs were laid and left a few weeks after most young fledged (pers. obs.). Recent information also suggests that in the austral winter, breeders from the southe rnmost portion of the species range may winter alongside birds breeding in northern South America (K. Meyer, unpubl. data). Regardless of interaction betw een populations, subspecies ha ve been described in this species and allopatric breeding populations ma y exist because of: 1. change in nesting phenology (Figure 1-1, nest date changes most no ticeable at the division between green and purple areas) and; 2. gap in the Swallow-tailed Kite breeding range in the northern half of Mexico (Robertson 1988). This arid zone in Me xico divides the northern and southern species. E.f. forficatus (U.S) was defined based on longer wi ng and tail measurements and purple iridescence on shoulder scapulars, while E.f. yetapa (Latin America) is said to exhibit green iridescence (Viellot 1818 in Robe rtson 1988). Subspecies have been called scarcely separable and their designation doubtful (Robertson 1988). Personal observation suggests that Swallowtailed Kite subspecies are phenotypica lly indistinguishable in the field.

PAGE 17

17 I tested several hypotheses concerning Swallo w-tailed Kite population structure. Gene flow might occur throughout the species if occasional mating occurs between breeding, wintering, or migrating conspeci fics from different populations or if birds switch breeding populations as a result of social interactions. If this was true, I pred icted that I would find Swallow-tailed Kites form a panmictic population and that no phylogeographic structure would be found in phylogeneticor fre quencybased analyses of molecular data. However, if phylogeographic structure does exist, I hypothesized that it is due to restricted gene flow in northern Mexico at the gap in breeding, and near the equator, where nesting phenology changes, in which case phylogeneticand frequency-based analyses would find Swallow-tailed Kites breeding in the following three regi ons to be more similar to each other than to those breeding in other regions: The Northern Biol ogical Population, which consis ts of the U.S. breeding range, the Central Biological Population, which consists of breeding areas south of the U.S. and north of latitude 80S (non-U.S. red area and the purple ar ea in Figure 1-1), and the Southern Biological Population, which includes breeding areas south of latitude 80S (green area in Figure 1-1). I also hypothesized that rest ricted gene flow, if found, is due to Swallow-tailed Kite natal philopatry, which should reveal itself locally. Therefore I predicted additional phylogeographic structure would be found within any large populat ion. Finally, I test ed the hypothesis that currently accepted morphological ra tionales are not appropriate for distinguishing subspecies or Biological Populations. I predicte d that ranges of wing and tail measurements and iridescence on shoulder scapulars would overlap between subsp ecies and Biological Popu lations, and that the most significant morphological differences woul d be found when samples were grouped into sub-regions.

PAGE 18

18 I also considered the history of the Swallo w-tailed Kite, in terms of geographic origins and expansions. The species may have originat ed in northern South Am erica, suggested by the fact that putatively non-migratory kites reside there. Alternativ ely, it may have originated in central or southern South Amer ica, suggested by the fact that Swallow-tailed Kites from throughout the rest of the range winter there. The potential for a North American origin of neotropical migratory species has been suggested by some studies (reviewed by Gauthreaux 1982), although it does not seem likely in most cases (Joseph 1997, Rappole 2005). To test the null hypothesis that all Swallow-ta iled Kite populations are equally likely to be the most closely related to the ancestral population, I predicted th at no population would be more diverse than any other and that phylogenetic analyses would not indicate a basal or ol dest clade. Expansion of the ancestral population into temperate zones may have been facilitated by long periods with warm climatic conditions. I hypothesized that expans ion of populations could have occurred during Marine Isotope Stage 11 (MIS11) (ca. 360-420 ka), reputed to be have been the longest and warmest interglacial period during the past 500 ka, characterized by the highest amplitude deglacial warming in the past five million year s (Burckle 1993, Ortlieb et al. 1996, Droxler and Farrell 2000). I predicted that phylogenetic anal yses would determine a range of dates for each populations origin that include d MIS11. Also, I hypothesized th at the Northern Biological Population is the least diverse and most recently expanded population beca use of glacial cycles in North America and associated range changes that may have caused repeated bottlenecks and founder effects, not experienced to the sa me magnitude by other Swallow-tailed Kite populations. I predicted that ge netic diversity and demographic analyses would find individuals in the U.S. to be less diverse and to have experienced a more recent sudden population expansion than in other populations.

PAGE 19

19 I tested hypotheses using mol ecular and morphological data. Swallow-tailed Kite tissue (n=142) was collected range wide from live bi rds and museum specimens. DNA was amplified and sequenced in the mitochondrial control regio n, cytochrome b, and several nuclear introns. I used phylogenetic and frequency analyses to assess gene flow and indicate phylogeographic structure in Swallow-tailed Kites. Demographi c and diversity analyses elucidated population history. I analyzed morphological data (n=52) to judge the rationale behi nd current subspecies designations and to determine the extent to which morphological differences correspond to genetically determined population structure. Resu lts from genetic analyses provided insight into Swallow-tailed Kite behavior, history, and the role of migration in genetic diversification.

PAGE 20

20 Figure 1-1. Documented breedi ng of Swallow-tailed Kites based on nesting, not sighting, records, since Elanoides is wide-ranging outside of th e breeding season. Nesting phenology changes near the equator. Th e three known nesting phenologies are shown with different colors. Map base d on: Robertson ( 1988), Meyer (1995), authors' observations in the field, dates of nesting and kite presence/absence from biologists working in Latin America, and breeding date/location on museum specimen tags. Diagonal lines represent ar eas with no nesting records, but where data is scarce RedBreeding Mar.-Aug. PurpleBreeding year round. GreenBreeding Sept.-Jan.

PAGE 21

21 CHAPTER 2 METHODS Sampling Swallow-tailed Kite nests were found in the southeastern United States, Guatemala, and Brazil. Swallow-tailed Kites are secretive nesters, usually choosi ng sites high in trees in swamps or near rivers. In Brazil, ha lf of the nesting areas were discovered by following radio-tagged migrants from North America. In Guatemala, I used a nest area pr eviously discovered for another study (Gerhardt et al. 2004 ). To extract blood from nestli ngs, I climbed nest trees with climbing ropes and mechanical ascenders (pines and hardwoods) or slings (palm trees) (n=40). I collected blood from three adults in Central and South America captured with a noose trap, and from eight adults in the U.S., ne tted as they dove at te thered owls placed near their nests. In cases where a nestling was found dead (n=3), ski n, bone, or organ tissue was collected. In the case where a nestling flew from the nest (n=1), or when a nest was in the egg stage (n=1), feathers were removed from the nest. Organ tissu e from two individuals that died near nesting areas in Brazil and four feathers from under a roost of breeding birds in Guatemala were also used (Appendix A describes sample origins). Researchers from South Ca rolina and Louisiana donated additional fresh tissue samples from thos e states (n=8). To reduce the incidence of sampling close relatives, I limited tissue collect ion in most cases to one breeding season per nesting neighborhood. I stored most blood, skin, organ tissue, and bone in lysis buffer (100mM Tris, 10mM NaCL, 100 mM EDTA, 2% SDS) and dr y feathers in plastic bags. Most samples were then kept at 40C. A subset of these samples, collected in Brazil, was stored unrefrigerated for one year, after which they were frozen.

PAGE 22

22 To fill geographic gaps in sampling I requested tissue of Swallow-tailed Kite museum specimens (usually skin from toe pads) from various museums (n=73, Appendix A). In addition to specimens with labels that suggested breedi ng activity or recent birth, I selected specimens collected at places and times when the presence of migrants was unlikely based on knowledge of migration and wintering pattern s of Swallow-tailed Kite popula tions. I relied on current assumptions that all Swallow-tailed Kites leave th eir wintering areas to return to their breeding grounds and that those breeding in Central America and Mexico have approximately the same migration pattern as those breeding in the U.S. (Robertson 1988, Meyer 1995). Most museum specimens collected in norther n South America were collected at times when breeders from southern South America may have been wintering there. To reduce the likelihood of sampling these wintering birds, I re stricted requests for tissue in northern South America to Swallow-tailed Kite s collected north of latitude 40N in non-mountainous regions, or north of the equator in the Andes. Un less the specimen was accompanied by breeding information, I labeled it as an Unconfirmed Breeder (n=40). Two samples were requested from museum s because of the interesting geographic circumstances surrounding their collection. AL 27 was collected in Alabama in April 1964 (AUNHMLC B-662) and thought by the co llector to belong to subspecies E.f. yetapa based on its size, even though it was found in the U.S. (S kinner 1964). M52 was collected in Saltillo, northern Mexico, in April 1908 w ith a set of eggs (MCZ 309708). Other than this collection record, no other evidence exists for Swallow-tailed K ite nesting in this arid zone that lies within the geographic gap in the breeding ranges of the two subspecies. Samples from confirmed breeders are represen ted as squares and circles on the sample map in Figure 3-1. Only the following types of Swallow-tailed Kites or Swallow-tailed Kite

PAGE 23

23 tissue were considered to repr esent the breeding populations wher e they were sampled, and these are henceforth referred to as Confirmed Breeder s: 1. Adult Swallow-tail ed Kite trapped near nest; 2. Swallow-tailed Kite young in or under a nest; 3. Feather fr om nest; 4. Feather under roost of birds breeding at that time in Guatemala; 5. Museum specimen adults collected in northern South America Dec.1-Jan 2, in Mexico and Guatemala April 1-May 25, and in Argentina throughout May (since no Swallow-tail ed Kites should be wintering/ migrating in these places at these times); 6. Museum specimens with label information indicating age under five weeks or thickened skin on breast; and 7. Specimens with enlarged gonads or eggs present in oviduct (gonad size compared to Swallow-tailed Kite specimens collected in Florida during breeding season). Outgroups were chosen based on current under standing of relationships in Accipitridae (Lerner and Mindell 2005). Pernis is considered to be a sister taxon to Elanoides ; however, Elanoides is apparently an old specie s and no genus thus far has been found to be closely related. Sequences from Elanus caeruleus and Ictinia mississippiensis were used to supplement Pernis apivorus sequences as outgroups for some loci, and also in one locus where Pernis could not be amplified. Lab Techniques Total genomic DNA was isolated from blood stor ed in lysis buffer and from dry feathershaft bases with the Qiagen DNeasy Kit protocol for animal tissues (Qiagen Inc., Valencia, CA). I doubled the amount of proteinase-K suggested in the protocol and increased digestion times. I attempted the following methods to isolate amplifiable DNA from degraded tissues such as museum samples, feather shafts, and skin/organ tissue/bone collected from dead nestlings. The Qiagen DNeasy kit (Qiagen Inc., Valencia, CA) did not perform well with these tissues,

PAGE 24

24 although it did better than glassmilk purifica tion from the Geneclean Kit for Ancient DNA (Qbiogene, Inc., Carlsbad, CA). Geneclean rare ly produced DNA, and only when the guanidine dehybernation solution replaced the EDTA-based solution. Chelex 100 (Bio-rad, Richmond, CA) performed well with feathers and slightly better than most ot her techniques with the tissues. I tried Chelex 5%, 10%, and 20% solutions, with and without proteinase-K and/or a boiling step (Walsh et al. 1991). A standard phenol chloroform extraction protocol wi th ethanol precipitation was unsuccessful. Maceration of tissue frozen with liquid nitr ogen, changing the amounts of tissue, cleaning bone surfaces with ethanol or UV light or by scraping, did not improve yields. An added decalcification step for the bone (Thomas et al. 1990, Yang 1998 protocol minus the centricon step) decreased yields, perhaps due to oxidation of the bone tissu e. Soaking temperature for bone was reduced to 40C as recommended by a user protoc ol for Isolation of Genomic DNA from Compact Bone (protocol number DY01, Qiagen Inc., Valencia, CA), and ascorbic acid was added to the solution to help decrease oxi dation. However, yields remained poor. The only method that provided consistent re sults required large am ounts of proteinase k, long digestion times, phenol chloroform extract ions, and purification/ concentration with Centricon centrifugal filt ers (Millipore Corp., Biller ica, MA). A basic pr otocol can be found in Fleischer et al. 2000. Before protein digestion, I rinsed tissue and bone with buffer (concentration 0.1M EDTA, 0.05M NACL, 0.05M Tris ph 8.0) to remove contaminating tissue from other museum specimens or earth and micr obes. Approximately 25 mg of tissue was then minced with a razor blade, put into an o-ring screw top tube with 750 ul buffer, placed into individual Erlenmeyer flasks and gently shaken at 550C for two days. I changed the buffer on the second day. This soaking step was intended to remove fixatives, storage solution, and excess

PAGE 25

25 dark coloration that may have been protein, from the tissue. For protein digestions, final extraction solution concentrations were: DTT 10mg/ml, SDS 1%, 0.2 mg/ml 0.5 mg/ml Pro K, 0.02M EDTA, 0.01M Tris, 0.01M NaCL. Samples were digested in 750 ul for two days. I added an additional 0.4 mg of Proteinase K on the second day. Phase Lock Gel tubes (Eppendorf, Hamburg, Germany) simplified phenol chloroform extractions by creating a barrier at phase interface, so the aque ous portion could be easily poured into the centricon filters. A few tissue samples had been previously stor ed in formalin. Two protocols to isolate amplifiable DNA from these tissues were fo llowed with no success (France et al. 1996 Shiozawa method, Qiagen DNeasy kit instructions for formalin fixed tissues Qiagen Inc. Valencia, CA). Isolated DNA was amplified through the pol ymerase chain reaction (PCR) on a Perkin Elmer 9700 thermal cycler (Perkin Elmer, Wellesle y, MA). PCR recipes and cycling parameters are reported in Appendix B. Fo r PCR of DNA from degraded tissues I added Amplitaq Gold DNA Polymerase (Applied Biosystems, Foster City, CA) and BSA to reactions, lowered standard TM by 140C, and re-amplified one ul of the PCR product. Five micro liters of each PCR reaction was electrophoresed on a 1.5 % agaros e gel in 1x TBE to c onfirm amplification. Loci from both nuclear (nDNA) and mitoc hondrial (mtDNA) genomes were employed to study the population structure of Sw allow-tailed Kites. The use of multiple loci helps avoid the problems inherent in relying on only one lo cus (Pamilo and Nei 1988, Slatkin and Maddison 1990, Palumbi and Baker 1994, Edwards and Beerli 2000), only the nuclear genome (Moore 1995, Poke et al. 2006), or only the mito chondrial genome (Wilson et al. 1985, Cronin 1993, Hoelzer 1997, Ballard et al. 2004). Genes considered to be the mo st rapidly evolving, and thus most variable, were chosen (Vigilant et al. 1991, Marshall and Baker 1997, Friesen 2000, and

PAGE 26

26 Zhang and Hewitt 2003, but see Ruokonen et al. 2002). Except for cytochrome b (cytb), genes used here are presumed to be selectively neut ral (but see Zhang and Hewitt 2003, and Ballard et al. 2004). Genetic regions assayed in this study and primers used to amplify them are listed in Table 2-1. I focused on the control region Domain I (CR) and to a lesser extent, cytb, in mtDNA. Primers for a 550 base pair (bp) fragment on th e 5 end of the CR were designed with Program Primer v. 0.5 (Whitehead Institute for Biomedical Research) based on NorrisCanedas sequence published in Genbank, Accession Number AF438152. I developed additional primers to amplify 480 of those 550 bp and a 150 bp fragment in the most variable part of the Swallow-tailed Kite Domain I for use with degraded DNA. Cytb prim ers were taken from So renson et al. (1999). I tried to amplify nine nDNA loci, each of which included intronic regions, using primers from the literature: 1. Aldolase Intron G (L essa and Applebaum 1993); 2. Glyceraldehyde-3phosphate dehydrogenase exon 11exon 12 (Friesen et al. 1997); 3. Myelin proteolipid protein exon 4exon 5 (Friesen et al. 1999); 4. Intron P3 (primers P8 & P2, Griffiths et al. 1998); 5. Lamin A exon 3exon 4 (Friesen et al. 1997); 6. Alpha-enolase e xon 8exon 9 (Friesen et al. 1997); 7. Ornithine Decarboxylas e exon 6exon 8 (Friesen et al. 1999); 8. Lactate Dehydrogenase b exon 3exon 4 (Fri esen et al. 1999); and 9. Aldolas e B exon 3exon 5 (Friesen et al. 1997). The first two loci did not amplif y in initial screening. The third gave multiple products. I amplified 400 bp in the fourth, but ch ose to focus on only the last five nDNA regions listed above and named them LAM, ENOL ORN, LDH, and ALD, respectively. ORN, LDH, and ALD fragments initiall y generated were over 700bp. I designed alternative reverse primers to decrease fragme nt size, and named the resulting loci: ORN2, LDH2, and ALD2. Sequences for all nDNA loci used (LAM, ENOL, ORN2, LDH2, and

PAGE 27

27 ALD2), were run through the BLAST search engine on Genbank to confirm genetic region (Table 2-1 lists regions). Expected matches re sulted except in the cas e of ALD2, for which no homologous gene was found. Since the forward ALD2 primer blasts to the latter portion of exon 3, and the latter portion of the l onger ALD fragment bl asted with aldolase B exon 4, I believe that ALD2, which encompasses the first two thir ds of the ALD fragment, includes intron 3 of aldolase B. Outgroups were amplified in all loci analy zed except LAM and ALD 2. Primers were the same as those for the Swallow-tailed K ite. I also obtained cytb sequences for Pernis from Genbank, Accession Numbers AY987242 and X86758 Resolving Genetic Variation Denaturing gradient gel elec trophoresis (DGGE) (Lessa and Applebaum 1993) facilitated screening of nDNA fragments for va riation. Samples were run at 600C and 150 volts, on gels with an acrylamide concentra tion of 6.5% and a ratio of acryl amide:bisacryalmide of 37.5:1. Time, urea concentration, and formamide concen tration varied by locus. LDH2 and ALD2 showed no variation with DGGE a nd so were treated like mtDNA loci and sequenced as below. LAM and ENOL gels started at 2.65M Urea and 16% formamide concentrations. ORN2 gels started at 0M Urea and 0% formamide. All three gels went up to a concentration of 5.6M Urea and 32% formamide. Electrophoresis times for LAM, ENOL, and ORN2 were eight, four, and five hours respectively. At least one example of each band produced at each locus was excised from the polyacrylamide gel, cleaned according to Qiag en user protocol number QQ05, (Qiagen Inc., Valencia, CA)), and sequenced. In one case wher e a band was found to represent two alleles, I sequenced all individuals expressing that band. At least six examples of the most common

PAGE 28

28 bands, and samples with unclear banding patterns were also sequenced to confirm that DGGE was detecting all variatio n. DGGE data were treated like sequ ences in analyses. The number of samples evaluated with DGGE is listed in Table 2-1. Final PCR amplifications were purified with a QIAquick PCR Purification Kit according to the manufacturers instructions (Qiagen In c., Valencia, CA) except when amplifications resulted in double banded products. In those ca ses, the targeted band was excised from an agarose gel and purified with a Qiagen Gel Ex traction Kit per manufacturers instructions (Qiagen Inc., Valencia, CA). Purified products were then cycle sequenced with an ABI Big Dye Terminator Kit and sequenced on an ABI377 acco rding to manufacturers instructions (Applied Biosystems, Foster City, CA). I sequenced both strands of DNA when base calls were not clear on one strand. Chromatograms were viewed with the Chro mas MFC Application v. 2.3.0 (Technelysium Pty Ltd, 2000) and corrected by eye. I iden tified double peaks in nDNA chromatograms and translated them into heterozygous sequences. When more than one double peak was found in a sequence, known homozygous sequences at the same locus and the program PHASE (Stephens et al. 2001) were used to infer haplotypes. I ngroup sequences were aligned by eye in Bioedit v.7.0.0 (Hall, 1999). CLUSTALW (Thompson et al. 1994) embedded in Bioedit aligned outgroups with the Swallow-tailed Kite in the CR. The number of samples and bp sequenced for each locus is reported in Table 2-1. To guard against false data, several precautions were taken. To avoid contamination of one sample by other samples, I used filtered pipette tips, preand post-PCR equipment, and negative amplification controls (water replaced template) during all lab work. When working with degraded DNA, I changed gloves and impl ements between each sample for isolation and

PAGE 29

29 PCR. Sterile reagents were purchased and daily cleansed of DNA with UV light, along with other re-usable products and equipment. I cl eaned bench tops and equipment with sodium hypochloride bleach weekly. Negative extractio n controls were made during DNA isolation, amplified along with DNA, and sequenced. When a negative control was positive, DNA was reisolated and re-amplified. If the negative cont rol was still positive as occurred in one instance, the negative control sequence was compared to al l sequences generated an d similar ones were excluded from analysis. To eliminate the possibility of mtDNA PCR products being derived from nuclear pseudogenes, or NUMTs (Lopez et al. 1994), precauti ons were taken as follows: sequences were compared to those based on DNA from liver tissu e, a mitochondrial-rich tissue; PCR products were generated by different primers and overlapping sequences compared; PCR-based sequencing was checked for the presence of doubl e peaks; and protein-coding gene sequences were analyzed for stop codons and indels. Finally, sequences based on single amplifica tion of a recently-collected museum tissue were compared to those based on double amplifi cations of the same tissue, to ensure that sequences did not change as result of double amplification. Morphological Techniques I measured unflattened wing chord and tail on live and specimen kites (Appendix C). Only measurements of birds in definitive plum age from known Genetic Population were used in analyses (Appendix A). Definitive plumage is found in Swallow-tailed Kites older than approximately 14 months of age and can be distin guished from immature plumage in two ways. It is characterized by a long tail and lacks white or buffy margins on the trailing edges (friction zones) of body or wing feathers, viewed dorsally. I found pre-adult tail le ngths to be on average

PAGE 30

30 18% shorter than adults and always under 275mm in dried specimens (n=9). In cases where museums provided measurements, I did not incl ude any specimens with tails shorter than 275mm, unless the museum re-verified absence of molt and white margins on feathers. I limited analyses to non-molting birds except in one case where a tail measurement was included from a specimen that had molt in the wings, but not in th e tail. To compensate for specimen shrinkage (Winker 2003), I calculated coefficients (1.091 for tail, 1.012 for wing) to convert dry tissue measurements to fresh tissue measurements. Th e coefficient was based on comparisons between measurements made when specimens were co llected, and once specimens were dried. I assessed amount of purple and green ir idescence on shoulder scapulars by eye in many of the same individuals used for measurements (Appendix C). An additional five individuals, not used for measurements because they appeared to be one year of age or molting, were used in comparisons of iridescence since colora tion in their plumage was developed. Analysis Sequence and genotype data were partitioned in multiple ways for analysis. Datasets differed as to locus used and individuals sampled. Sample inclusion in datasets is detailed in Appendix A. The ten datasets were as follows (note: samples sizes do not include outgroups, and data from individuals known to be related we re never included within the same dataset): 1. LAM (n=51, 233bp); 2. ENOL (n=54, 323bp); 3. ORN2 (n=70, 285bp); 4. LDH2 (n=26, 406bp); 5. ALD2 (n=40, 496bp); 6. CR Breeder Long (n= 57, 372bp) consisted of all CR sequences longer than 372 bp from confirmed breeders; 7. CR Breeder Short (n=99, 134bp) consisted of all CR sequences from confirmed breeders; 8. CR All Short (n=137, 134bp) consisted of all CR sequences; 9. Cytb (n=11, 520bp) consisted of cytb sequences from a subset of the individuals sequenced in the CR, with at least three in dividuals from each Biological Population; 10.

PAGE 31

31 Morphological (n=48 for measurements, n=27 for irid escence) consisted of samples as described in the morphology section above. Descriptive statistics including number of variab le sites, number of alleles, and number of transversions, transitions, and gaps were calculated manually for each locus. Observed heterozygosity (Ho) was calculated manually by dividing the number of heterozygous individuals by the total number of individuals sampled, averaged over all nDNA datasets. Expected heterozygosity (He) wa s calculated manually by subtrac ting the sum of squared allele frequencies from one, averaged over all nDNA da tasets. Overall hapl otypic diversity was calculated for the CR Breeder Long dataset using Arlequin v. 2.000 (Swofford 1998). I used analysis of molecular variance (A MOVA, Excoffier et al. 1992) as implemented within Arlequin v. 2.000 to test the hypothesis that genetic differentiation reflects the existence of the Northern, Central, and Southern Biologica l Populations. Arlequin calculated Fst using the estimator of Weir and Cockerham (1984). Each allele from the CR Breeder Long dataset was designated North, South, or Central, acco rding to the collection location of the sample relative to the hypothesized populat ion boundaries (designations reco rded in Appendix A). Each AMOVA was based on 1023 permutations. Phylogenetic structure in the global Swallowtailed Kite populati on was assessed with maximum likelihood (ML) and neighbor joini ng (NJ) phylogenetic analyses in PAUP* 4.04b (Swofford 1998). Likelihood-ratios were used to determine the model of nucleotide evolution that best fit the data when generating the ML tree. I started with the most complex model (general-time-reversible with gamma-distributed rate varia tion estimating the proportion of variable sites), cal culated the likelihood of the data given this model, and then compared the likelihood ratios from increasingly simpler models. The best model of evolution was the general-

PAGE 32

32 time-reversible + invariable sites (0.44) (GTR + I). Inclusion of indels as variable sites did not affect results, therefore I did not consider them. ML analyses were performed with a heuristic search with 10 random addition sequences and tree-bisection-reconnection algorithms (TBR). For the NJ analyses, I calculated distance with the Jukes-Cantor m odel of evolution to correct for multiple hits. NJ trees were topologically similar to the ML tree, so the NJ tree was used for all further analyses in order to minimize com putational time during bootstrapping. Bootstrap resampling with 1000 replicates determined the degree of support for each node in the NJ tree and support values were cal culated from a 70% majority-rule consensus tree. I built the first tree based on all sequences av ailable to help assess relationships between the largest number of CR haplotypes (dataset CR All Short, 134bp, n=137). Then, to evaluate phylogeography, I restricted the tree only to sequences from sample s collected that I considered representative of breeding populat ions from which they were collected (dataset CR Breeder Short, 134bp, n=99). Finally, I built a tree base d on 372bp sequences from Swallow-tailed Kites known to belong to the breeding populations wher e they were sampled to take advantage of increased phylogenetic information in the longe r sequences (dataset CR Breeder Long, n=57). Clades from the CR phylogenetic trees are hencef orth called Northern, Central, and Southern Clades, depending on geographic origin of the majo rity of samples in the clade. Appendix A details clade membership. To test for differences in relative clade ages I estimated the time to most recent common ancestor in coalescent units (TMRCA) for each clade with the coalescent-based software Genetree (http://www.maths.monash.edu.au/~ mbahlo /mpg/gtree.html, Griffiths and Tavar 1994). Cytb was used for this analysis because it has fewer indels than the CR and a more uniform and better understood mutation rate. I pr uned the cytb dataset to eliminate homoplasy,

PAGE 33

33 as required under the infinite al leles model utilized in Genetr ee. I estimated TMRCA for the pruned tree, using the distributi on of mutations on the genealogy to determine the most likely value of equal to 2Nf for mitochondrial loci, where Nf is the effective population size of females, and represents the mutation rate per gene per generation. TMRCA was estimated with reflecting both the low (1.0% sequence divergence/ma) and high (2.0% sequence divergence/ma) end of the range of estimates of the rate of pairwise sequence divergence in avian cytb (Lovette 2004, Helbig et al. 2005, Pereira & Baker 2006). After estimating (8.95), I ran one million simulations of the coalescent process to obtain an estimate for TMRCA and SD in coalescent units. Using e quation t (years) = TMRCA x Nf g and g = 6.33 years (generation time), I calculated t for the mutation predating the origin of the clade to provide an upper limit for divergence time and t for the oldest mutation within a clade to set a lower limit for divergence time. Thus, I was able to "bracket" the actual clade origin between two mutations. To compare clades I used the CR Breeder Long dataset to estimate the following: nucleotide diversity ( n); the total number of polymorphic sites not including indels (S); haplotype diversity (h); theta ( ) estimated from the infinite site equilibrium relationship between the mean number of pairwise differences ( ) and theta (E( )= ); and Tajimas Test of Selective Neutrality (D) in each clade; and av erage pairwise distance between clades. The Tamura-Nei model of nucleotide substitution (Tam ura and Nei 1993) as applied within Arlequin v. 2.000 was used for these analyses. This model was chosen because it best represented the model selected for ML analysis (GTR + I). A llele frequencies for each nDNA dataset, and Ho and He averaged over all nDNA datasets, we re also calculated for each clade. By plotting the geographic origin of samples used to build the CR Breeder gene trees, and coding each sample location by clade, I divided gl obal Swallow-tailed Kite breeding populations

PAGE 34

34 into three regions (see shading on map in Figure 3-1). Each region reflects the majority of haplotypes found there. Samples contained with in each of the three regions correspond to samples contained within the Northern, Central, a nd Southern Clades in all but one instance. I refer to these regions as Northern, Centra l, and Southern Genetic Populations. Within each Genetic Population, samples with CR Breeder Long haplotypes were assigned to subpopulations. Subpopulations were designed so that each sample could be included in a group located within 70 km of samp le origin. See sample assignments to Genetic Population and subpopulation in Appendix A, a nd subpopulation locations on the map in Figure 3-2. The phylogeographic structure within each Genetic Population was evaluated with a hierarchical AMOVA. To test for subdivision within clades ba sed on genealogical relationships between haplotypes, I used the software TCS (Clement et al. 2000) to crea te haplotype networks based on the CR Breeder Long dataset. Unlike traditio nal phylogenetic reconstruction methods, TCS explicitly accounts for populati on-level phenomena such as recombination and the presence of extant ancestral haplotypes, wh ich is critical when consider ing intraspecific genealogies (Clement et al. 2000). Uncorrected pairwise di vergence between all hapl otypes were calculated in Arlequin and entered into TC S. TCS requires that the distan ce matrix be composed of the number of mutations separating each pair of ha plotypes, meaning that multiple mutations at single sites will necessarily go uncorrected. Ha plotypes on the networks were assigned to geographic subpopulations as described above to allow for phylogeographic inference. I also examined the spatial organiza tion of haplotypes by applying the program Geneland (http:// www.inapg.inra.fr/ens_rech/ ma thinfo/personnel/guillo t/Geneland.html, G. Guillot et al. 2005) to the CR Breeder Short datase t. The CR Breeder Short dataset (all of the

PAGE 35

35 samples shown on map in Figure 3-1), is the larg est and geographically best distributed dataset from confirmed breeders. Collection sites for each sample were assigne d coordinates using a world atlas. Geneland tests for population structure corr esponding to geography within clades by trying to join geographically con tiguous individuals into separate populations based on similarity of haplotype frequency. Geneland identifies spatial groups of haplotypes a posteriori, treating all unknown variables (e.g. number of populations, allele frequencies, population membership) as random variables, and estimates them using Markov-Chain Monte Carl o simulation. The program estimates the number of populations in the dataset, the population membership, and produces a map of locations. Pairwise mismatch distributions for each clade were calculated to test for sudden population expansion (Schneider and Excoffier 1999) by estimating tau ( ) with Arlequin v. 2.000 in the CR Breeder Long dataset. can be used to calculate time since clade expansion because = 2ut, where u = the mutation rate/genom e/generation, and t = generations since expansion of the clade. To span the range of current nucleotide substitution rate estimates in domain I of the avian mitochondrial CR, I used a u corresponding to a mutation rate of 5% and of 15% per ma (but see Pereira 2004). I considered, but did not enti rely base mutation rate range on, the estimate by Quinn (1992) of Domain I mutation rate in geese (20.8% per ma). This rate, or derivations of it, is popular. However, concerns have been raised recently about the original figure upon which Quinns rate is based (Pereira 2006). Independent calculations of the avian CR mutation rate are rare. Other rates to consider include 7.23 +/1.58% per ma fo r the entire CR (Drovetski 2003) and 7.3% per ma for Domains I and III (Buehler a nd Baker 2005). I considered rates for the CR as a whole, even though Domain I is one of the most variable regions, because approximately

PAGE 36

36 20% of the CR Breeder Long CR fragment is Doma in II, one of the more conserved regions (Baker and Marshall 1997). Finally, I also co nsidered a CR mutation rate based on variation found in Swallow-tailed Kite cytb, following th e reasoning of Quinn (1992). Since the Swallowtailed Kite CR fragment varied approximately six times more than the Swallow-tailed Kite Cytb fragment (see Results section), I calculat ed a CR mutation rate of 6%-12% per ma by multiplying estimates of avian cytb mutation rate s by six (see cytb rate description earlier). Correspondence between wing or tail morphology and Swallo w-tailed Kite group was investigated using two way anal ysis of variance (ANOVA). Tail and wing length were response variables, and group and sex were independent vari ables. Male and female measurements were analyzed separately in case sexual dimorphism af fected lengths. Analyses were run with group defined in three different ways. 1. Genetic P opulation; 2. subs pecies; and 3. region. Regions included the U.S. (N); Central America (CA); So uth America north of the Pantanal (nSA); and south of the Pantanal (sSA). I determined Genetic Population membership for samples using CR haplotype or label information. The latter wa s used when I had no genetic information. In those cases, the Swallow-tailed Ki te was either found in the U.S. (Northern Genetic Population), or, southern Brazil (Southern Gene tic Population) with a formed egg in her oviduct. Members of the Northern Genetic Population were considered to represent subspecies E.f. forficatus and members of the Central and Southern Genetic Populations were considered to belong to subspecies E.f. yetapa Samples were assigned to the N and sSA regions based on affiliation with the Northern, and Southern Genetic Popula tions, respectively. Individuals with Central Genetic Population haplotypes were assigned to either the CA or nSA region using collection location, date, and accompanying breeding information (if any).

PAGE 37

37Table 2-1. Description of genetic regions amplified and associated primers Label Genetic region Forward primer 5' -3' Reverse primer 5'-3' # Base pairs amplified # Individuals*** sequence\DGGE Cytb Cytochrome b Cytb L15517 Thr H16064 620 11\0 n=11 CRdbox Control Region early Domain I through Dbox in early Domain II Glu STKI L1 "CCAAGACCCCCGACCT GAAAA" DboxH "CGCCTCTGGTTCCTTTTTCAGG 550 n/a ** CRpredbox Control Region early Domain I through Fbox in early Domain II Glu STKI L1 "CCAAGACCCCCGACCT GAAAA" Pre-DboxH "CCTGAAGCTAGTAACGCAGGATCT" 480 61\0 n= 61 (includes CRdbox samples) CRshort Control Region Central Domain I CRshort 1F "TGYATGTACTGTGTCC ATTACA" CR short 4R "CCAAGAATATCCGWAGGGT" 175 141\0 n=141 (includes CRpredbox & CRdbox samples) LAM Lamin A (Exon 3Exon 4) LamL724 LamH892 300 6\53 n= 53 ORN Ornithine Decarboxylase Long (Exon 6Exon 8) ODF ODR 800 n/a

PAGE 38

38Table 2-1. Continued Label Genetic region Forward primer 5' -3' Reverse primer 5'-3' # Base pairs amplified # Individuals*** sequence\DGGE ORN2 Ornithine Decarboxylase Short (Exon 6Exon 7) ODF Orn R-2 "CACAGCGGGCATCAGAAATG" 300 33\50 n= 75 ENOL Alpha-enolase gene (Exon 8Exon 9) EnolL 731 EnolH 912 400 16\55 n= 55 LDH Lactate Dehydrogenase b Long (Exon 3Exon4) LDH-BF LDH-B R 750 n/a LDH2 Lactate Dehydrogenase b Short (Intron 3) LDH-BF LDH-B R-2 "TTATGAGTAGCTTCTCCACTGTGCC 500 28\0 n= 28 ALD Aldolase B Long (Exon 3 Exon 5) AldL200 AldH283 800 n/a ALD2 Aldolase B Short (Intron 3) AldL200 AldH-2 "CCC TGC TAG GGG TGC TGT GC" 650 42\0 n= 42 A subset of this data was used in analyses. Primers without sequence shown were taken from the literature, c itation in text. ** Data added to CRpre-dbox dataset to make "CR Long" and "CR S hort." *** Does not include outgroup sequences

PAGE 39

39 CHAPTER 3 RESULTS Descriptive Statistics by Locus MtDNA loci were highly variable and were not very similar to other falconiform sequences on Genbank. Variation in the longe r CR fragment (372bp sequences from CRpredbox and CRdbox) included 73 transitions, two transv ersions, two indels, three sites with both transitions and transversions, and one with both a transition and indel, re sulting in 40 distinct haplotypes. Uncorrected sequence differences ranged from 0.3%11.3% between haplotypes, with some individuals sharing haplotypes. Ha plotype diversity was 0.97 93 +/0.0088 SE. The shorter segment of the CR, locus CRshort, capture d much of the same variation (42 transitions, two transversions, one indel, two sites with transition/tr ansversion, one site with transition/indel) and an additional variable site (i ndel/transition) due to increased sample size. CRshort exhibited 51 haplotypes. Uncorrected sequence differenc es ranged from 0.8%20.0% between haplotypes, with some individuals sharing haplotypes. Va riation between individu als in the Cytb locus included 17 transitions and two transversions, resulting in seven distinct haplotypes. Uncorrected sequence differences ranged from 0.2%2.9% between haplotypes, with some individuals sharing haplotypes. The nuclear loci were less variable. Overall Ho and He were 0.284 and 0.43 respectively. DGGE demonstrated that in the LAM locus, a ll individuals except for two were homozygous for the same band/allele. The two heterozygous in dividuals shared an additional band/allele (Ho=0.039, He=0.038). I found three bands in ENOL The fast and middle bands represented one allele each, while the slow ba nd represented two potential allele s. Most individuals (n= 50) were homozygous for the middle band/allele wh ile the rest displayed two bands (n= 5)

PAGE 40

40 (Ho=0.093, He=0.124). The three variable sites in ENOL, and the one vari able site in LAM, were transitions. Two bands, each representing one allele va rying by a transversion, were found in DGGE analysis of the ORN2 locus. All individuals we re homozygous for one of those bands/alleles in DGGE (n= 50); however, sequence data for unresol ved and additional samples (n= 25) revealed three more alleles, each of which was expresse d in one individual heterozygous for the private allele and one of the primary alleles seen in DGGE (Ho=0.043, He=0.52). The variable sites distinguishing the private alleles were two transitions and a transversion. In ALD2, two transitions and thre e transversions resulted in five alleles. Each allele was demonstrated by at least five i ndividuals. Heterozygous indivi duals displayed one double peak on chromatograms (Ho=0.475, He=0.688). LDH2 produced eight alleles based on five transitions and one transversion. Three allele s were not demonstrated by more than one individual. Heterozygous i ndividuals displayed up to thr ee double peaks on chromatograms (Ho=0.769, He=0.79). While the 19 variable sites were spread re latively equally throughout the Cytb fragment, 60% of the 81 variable sites in th e longer CR fragment were concentrated in the first half of the CR Domain I. Only two variable sites we re found in the small portion of Domain II (approximately 60 bp) amplified. All variable si tes found in nDNA loci were located within the intronic portions except in the cas e of ORN2 where the three variable sites that defined private alleles were found in adjacent exons. Every ha plotype found in this study has been placed on Genbank under Accession #s: EU012028-EU012134 (Appendix A).

PAGE 41

41 Swallow-Tailed Kite Phylogeography Based on mtDNA I found strong population struct ure in Swallow-tailed Kites. An AMOVA of the Northern, Central and Southern Biological Popu lations yielded a Fst of 0.71, p= 0.00, where the majority of genetic variation occurred among, rath er than within, the populations. Phylogenetic analyses also demonstrated populat ion structure. Gene trees ba sed on datasets CR All Short, CR Breeder Short, and CR Breeder Long, all descri bed three clades in an unresolved polytomy (Figure 3-1, Appendix D). The clades had hi gh bootstrap support and long branches, but branches within each clade were short and showed little genetic structure. A NJ tree based on the Cytb dataset exhibited similar topology to the CR trees (unpubl. da ta), but showed the Central Clade as basal with low bootstrap support, suggesting the possibility that the unresolved polytomy could be resolved with increas ed sample size at the cytb locus. Phylogeographic inferences can be made based on the phylogenetic trees built with samples representative of breeding populations where collected (CR Breeder Long and Short). Each clade appears to correspond to a distinct portion of the Swallow-tailed Kite breeding range that I refer to as Northern, Central, and Southern Genetic Populations (Figure 3-1). The Northern Genetic and Biological Populations are congruent with E.f. forficatus The Central and Southern Genetic Populations differ from the hypothesized Biological Populations. The Central Genetic Population covers a wider latitudinal range than expected, stretching from southern Mexico to the northern boundary of the Pantanal in Brazil (160S) and the Southern Genetic Population covers a much shorter latitudinal range than expected, ranging from near the southern boundary of the Pantanal (210S) to northwestern Argentin a and southeaste rn Brazil (280S). It is interesting to note the location of a few samples on the gene trees. Museum sample AL27, collected in Alabama and labeled E. f. yetapa by the collector, was found in the Northern

PAGE 42

42 Clade with other samples from the U.S. Anot her museum sample, M52, collected in northern Mexico (equidistant from the Northern and Central Genetic Populations) was found in the Central Clade along with the samples from sout hern Mexico. Because the area where M52 was collected is not known to harbor br eeding Swallow-tailed Kites, I di d not include that zone in the map of Genetic Population ranges (Figure 3-1). Finally, one incident of recent gene flow is observed. A nestling (B5-00) sampled on the southe rn border of the Pantanal in the Southern Genetic Population range, expressed a haplotyp e found otherwise only in the Central Genetic Population. On the CR ALL Short tree, some sa mples (n=9) from museums, collected in far northern South America and Central America, e xhibited haplotypes normally seen in samples from southern South America. Swallow-Tailed Kite Phylogeography Based on nDNA The Northern Genetic Population was distingui shed from the other Genetic Populations in the ORN2 and ALD2 loci where no alleles were shared (Figure 3-1). The Central and Southern Genetic Populations were not similarly distinguished from each other as they always shared at least one allele. However, allele fr equencies varied between them and each population had at least one endemic allele. The Central Genetic Population had two endemic alleles in LDH2 and one in ENOL. The Southern Genetic Population had one endemic allele in ORN2. I compared Swallow-tailed Kite and outgroup sequences in the three nDNA loci that had outgroup sequences. In ENOL and ORN2 loci, outgroups were more similar to haplotypes endemic to Central and Southern Genetic Popu lations. In the LDH2 locus, outgroups were equally similar to all populations. In general, the nuclear haplotypes that were unique to one or tw o Genetic Populations varied at sites where I observed individuals to be homozygous. The nuclear haplotypes that

PAGE 43

43 varied within Genetic Populations usually va ried at the sites causi ng individuals to be heterozygous. This suggests that the nDNA mutations I saw va rying within individuals are younger than those I saw varying among populations. Differences between Populatio ns as Defined A Posteriori I found clades, as defined by the gene trees, to have diverged significantly from one another. Corrected average pairwise distance s in the CR between clades were as follows: Northern versus Central = 9% (2.6% uncorrected in cytb); No rthern versus Southern = 7.9% (2.2% uncorrected in cytb); and Central versus Southern = 6.5% (2.3% uncorrected in cytb). Averaging these values for each clade, the Nort hern Clade appears to be the most divergent (Table 3-1). The Northern Clade also appears to be the youngest, with the most recent sudden population expansion, while the Cent ral Clade appears be the oldest with the least recent sudden population expansion (Table 3-1, Table 3-2). Genetr ee analyses indicated that clades have been separated for a long time. The TMRCA in coalescen t units bracketing the or igin of the Northern Clade equaled 0.09 (+/0.09 SD) 0.45 (+/0.24 SD ), of the Southern Clade equaled 0.58 (+/0.21 SD) 0.86 (+/-0.24 SD), and of the Central Clade equaled 0.6 (+/0.2 SD) 0.86 (+/0.24 SD). Mismatch distributions were unimodal (g raphs not shown) and suggested that all clades population sizes expanded suddenly within the pa st 43,000 years, some perhaps as recently as 2,889 years ago (Table 3-2). Ranges of wing and tail measurements overlappe d for all groups (Table 3-3). In a Two Way ANOVA, no interaction between group and sex was detected for eith er tail or wing. Wing lengths significantly differ ed between clades (f=4.8 df=2,40 p=0.013), subspecies (f=6.2 df=1,42 p=0.017), and region (f=5.9 df=3,38 p=0.0002). Tail lengths were only significantly different

PAGE 44

44 between regions (f=4.1 df=3,40 p=0.013). Significance in all cases was due to longer lengths in groups located farther north. Sexual dimorphism in the wing was not significant, however it was in the tail. On average, females had longer tails across clades (f=5.6 df=1,42 p=0.02), subspecies (f=5.23 df=1,44 p=0.03), and region (f=4.6 df=1,40 p=0.04). Iridescence appeared to be st rongly purple in the Northern Genetic Population (n=12) and purple, usually mixed with green, in the Sout hern Genetic Population (n=7). Individuals surveyed from the Central Genetic Population (n=8) were mostly those breeding in Central America (n=6), and these Central American samp les exhibited only green iridescence. Of the other two samples from the Central Genetic P opulation, both collected in northern South America, one showed green iridescence and the other purple and green. The general pattern implied is one where purple iridescence is strongest at the extremes of the Swallow-tailed Kite range, and green iridescence is more prominent toward the center of the range. Structure within Clade/Genetic Population He and Ho were similar within each clad e, suggesting random mating throughout each. Although the amount of genetic va riation within each clade or Genetic Population does not appear to be low, I discovered very little ge netic structure, and no phyl ogeographic structure in the data. As reported above, the gene trees show ed very little genetic structure within each clade. When the gene tree and haplotype network nodes were coded by sample location within each clade, no geographic patterns emerged. The program Geneland also found no significant geographic structure in haplotype frequencies. A hierarchical AMOVA reported less than 6% of genetic variation was held be tween subpopulations in each Genetic Population. Figure 3-2 presents AMOVA results for each Genetic Popula tion, a haplotype network for each clade, and the CR Breeder Long NJ tree separated by clade.

PAGE 45

45Table 3-1. Descriptive statisti cs for each mitochondrial clade Clade S n +/SD h +/SE +/SD D % Divergence Ho/He TMRCA in years Northern 21 0.0098 +/0.0056 0.9462 +/0.0198 3.6 +/2.09 -1.00075 p=0.168 8.4 0.22/0.18 71,840 1,116,881 (+/71,840 SD) (+/595,670 SD) Central 32 0.02 +/0.01126 1 +/0.0302 7.29 +/4.1 -1.13459 p=0.14 7.7 0.36/0.32 323,784 1,780,535 (+/107,928 SD) (+/496,893 SD) Southern 14 0.0119 +/0.0073 0.9722 +/0.0640 4.48 +/2.76 -0.65849 p=0.291 7.2 0.31/0.32 294,454 1,780,535 (+/106,613 SD) (+/496,893 SD) Statistics are based on CR Breeder Long data set except: TMRCA in years (cytb dataset) and Ho/He (nDNA datasets). % Divergence i s the average of the two pairwise average dist ances presented in the text that were calculated for each clade. All analyses desc ribed in text. 3.53 x 10-4/gene/generation and 1.17 x 10-4/ge ne/generation correspond to mutation rates of 5% and of 15% per ma respectively. Table 3-2. Mismatch distribution data Clade (CI) Years since expansion (CI) u= 3.53 x 10-4 /gene/generation Years since expansion (CI) u= 1.17 x 10-4 /gene/generation Northern 4.062 (2.04-5.49) 5,753.54 (2889.52-7776.2) 17,358.97 (8717.95-23461.54) Central 7.574 (4.97-9.79) 10,728 (7039.66-13866.86) 32,367.52 (21239.32-42606.84) Southern 5.44 (2.58-7.6) 7,705.38 (3654.39-10764.87) 23,247.86 (11025.64-32478.63)

PAGE 46

46 Table 3-3. Comparison of measurements between groups of Swallow-tailed kites Group Female tail range (avg.) in mm (n=26) Male tail range (avg.) in mm (n=22) Female wing chord range (avg.) in mm (n=25) Male wing chord range (avg.) in mm (n=21) Northern Genetic Population// E.f. forficatus (n=20) 311-382 (343) 306-360 (333) 411-455 (435) 404-446 (428) Central Genetic Population (n=20) 312-364 (340) 278-359 (325) 403-439 (424) 405-443 (424) Southern Genetic Population (n=8) 316-353 (335) 278-327 (307) 385-440 (417) 394-416 (407) E.f. yetapa (n=28) 312-364 (338) 278-359 (321) 385-440 (422) 394-443 (420) Central America (n=12) 322-364 (348) 314-359 (338) 417-439 (427) 427-443 (434) E.f. yetapa data is the combination of Central an d Southern Genetic Population measurements Central America data represents one portion of the Central Genetic Popu lation measurements. Data correspond to measurem ents taken from or converted into those of fresh tissue.

PAGE 47

47

PAGE 48

48 Figure 3-1. Molecular data as it relates to geography. NJ gene tree based on CR Breeder Long dataset. Bootstrap values shown onl y for main nodes. Samples yielding at least 370 bp in CR are depi cted by squares on map and gene tree. Samples yielding 134 bp in CR depicted as ci rcles on map. A NJ tree (134 bp, not displayed) built using all samples presented on map resulted in a very similar tree topology as one shown. Samples collected within approx. 50 km from each other are represented by one, or a few joined, sy mbols on map. Number next to sample marker indicates number, if greater than 1, samples collected in one location. Map shading of Genetic Populations ba sed on CR gene trees, and known breeding distribution. Sample sizes as follows: For CR treeNorthern region 35; Central region 12; Southern region 10. For Nucl ear Introns1 (LAM): 51; 2 (ORN2): 71; 3 (ALD2): 40; 4 (ENOL): 54; 5 (LDH2): 26.

PAGE 49

49 Figure 3-2. Phylogeographic structure within clades or genetic populations. AMOVA Fst for each Genetic Population, NJ tree and TCS Haplotype Network presented by clade, with sample locations indica ted on map. Each unbroken line on network represents one nucleotide difference betw een haplotypes. The haplotype with the highest outgroup probability is displayed as a square, while other haplotypes are displayed as ovals. The size of the square or oval correspond s to the haplotype frequency. Letters represent subpopulations as described in text. Letters A-H, MU, and W-Z belong to North, Central, and Southern Genetic Populations respectively. Due to sample size issues, I added thes e subpopulations together: A+B; T+U; W+X; Y+Z, for the AM OVA performed on Genetic Populations.

PAGE 50

50 CHAPTER 4 DISCUSSION Subdivision/Gene Flow: Between Populations Interaction among Swallow-tailed Kite popula tions as well as the species rather homogeneous morphology has until now obscured deep subdivision in this group. Phylogenetic trees based on mtDNA show three geographically coherent clades, suggesting that three global populations exist in this species (Figure 3-1). Populations are located in 1. southeastern U.S. ; 2. southern Mexico to central Brazil; 3. central Brazil to the southern end of range. I hereafter refer to these as Genetic Populations (Northern, Centra l, and Southern) in contrast to the predicted Biological Populations. I theref ore reject hypotheses predicting pa nmixia or population divisions based on a restricted gene flow near the equator. An AMOVA of mtDNA found that over 70% of ge netic variation in Swallow-tailed Kites is explained by Biological Populations. Most of the remaining variati on occurs within the Southern Biological Population. Th is probably results from a cryptic barrier to gene flow within the Southern Biological P opulation. According to phylogenetic tree s, gene flow is restricted near the Pantanal (between 160S and 200S ), not where nesting phenology changes (between 80N and 80S), as expected,. The Pantanal consists of poorly drained lo wlands in western Brazil and bordering Paraguay and Bolivia. Breeding Swallowtailed Kites on either side of the Pantanal nest at the same time, and probably co-migrate to northern South America to winter, but are contained in separate Genetic Populations (Central and Southern). No restriction of gene flow is seen in the transition area where nesting phenology changes. Therefor e, migratory Swallowtailed Kites that breed in opposite seasons plus pu tative residents are represented within the same Genetic Population (Central). The Northern and Southern Genetic Populations include

PAGE 51

51 individuals that migrate long di stances between temperate breedi ng and tropical wintering ranges (Meyer 2004, K. Meyer, unpubl. data). Average pairwise sequence distance is large between the clades, 6.5 9% in the control region (corrected for within population divergence) and 2.2 2.6% in cytb (uncorrected). Gene flow among Genetic Populations, inferred from phylogenetic trees (Slatkin and Maddison 1989, 1990, Edwards 1993) denotes an historical lack of gene flow between all populations and no recent gene flow into or out of the Northern Genetic Population. An enigmatic sample collected in northern Mexico, a location equidistant between the Northern and Central Genetic P opulations, belongs to the Cent ral Genetic Population based on genetic data. If breeding historically occurred in this region (considered doubtful by Robertson [1988]), the breeding gap between the two populations was likely le ss than 700 km at that time. Because breeding is not known to occur there, I have defined the northern limit of the Central Genetic Population as southern Mexico, and ex cluded northern Mexico where this sample was collected. One sample of a nestling collected near the southern border of the Pantanal had a haplotype matching those found north of the Pant anal. Since other than this one instance, haplotypes form monophyletic clad es, historical gene flow is not invoked, nor is incomplete lineage sorting. It is extremely unlikely that an ancestral haplotype would have accumulated no changes during the same period of time over which other haplotypes diverged by over 8%. Proximity of the nest to the population boundary suggests that the misplaced haplotype represents gene flow that occurred because of proximity, not migration. I conclude that gene flow between these populations is a recent and uncommon phenomenon.

PAGE 52

52 On a phylogenetic tree based on all control region sequences, nine samples from museums, collected in far northern South Amer ica and Central America, exhibited haplotypes normally seen in samples from southern South Am erica. The most likel y explanation is that these samples represent Swallo w-tailed Kites wintering, not breeding, in these regions. Collection data for these samples gives no indi cation of breeding group membership, therefore these samples were categorized as Unconfir med Breeders along with many other museum specimens. Other explanations for the misplaced samples in the CR ALL Short tree include gene flow, incomplete lineage splitting, contamin ation (in the museum or lab), and poor museum records that misidentified geogr aphic origin of samples. Gene flow or incomplete lineage splitting explanations are not supported by phylogenetic analysis of datasets based only on samples fr om Confirmed Breeders. When Unconfirmed Breeders were culled from the sample set, no haplotypes were found in common between northern and southern South America. Contam ination is not likely because: extraction and amplification controls were negative when DNA from these samples was amplified and sequenced; tissue was rinsed to remove skin ce lls that might have come from other specimens; four separate museums donated the samples; and the samples expressed seven distinct haplotypes. Communication with museum staff and information about collectors of these specimens suggested that the stated locations pr obably were correct. Finally, new information about the wintering range of Swallow-tailed Kite s breeding in southern South America indicates that these specimens coul d represent wintering bird s (K. Meyer, unpubl. data). Overall expected heterozygosity in nuclear loci was larger than observed probably due to non-random mating among Genetic Populations This Wahlund effect (Wahlund 1928) influenced expected heterozygosity levels at mo st nuclear loci when population membership was

PAGE 53

53 disregarded. Nuclear loci da ta overall were consistent with one division (Northern Genetic Population/Clade) exhibited by the mtDNA and less differentiated for the other division (between two southern populations), presumably because of incomplete lineage sorting. Since nuclear genes have a larger e ffective population size than mtDNA, they tend to change more slowly than the mitochondria. Incomplete lineag e sorting in the nDNA loci is suggested here because nDNA loci completely distinguished th e Clade/Genetic Population found to be most divergent by mtDNA. Other possible explanations include: male gene flow; selection on genes used; and intralocus sampling variance. To minimize the effects of selection a nd intralocus variance on population structure assessment I used genes from both genomes and multiple genes from the nuclear genome. Furthermore, there is no reason to suspect that male kites switch populations more than females. Although it is easier for males to leave gametes behind in a population, if that were occurring, males from the Northern Ge netic Population would likely behave similarly, in which case no population should have been distinguished by nDNA data. Possible Explanations for Population Structure in Elanoides In total, the genetic data suggested di vergence among populations due to current and historically restricted gene fl ow. Do geographic barri ers explain this pattern? The Northern Genetic Population is separated from the Cent ral Genetic Population by over 1000 km of arid land in southern Texas and northern Mexico. This barrier could contribute to restriction of gene flow between the two populations. No geographi c barrier is apparent between the Central and Southern Genetic Populations. The Pantanal lies at the division between the two Genetic Populations, in the Paraguay River basin of west central Brazil and bordering Bolivia and Paraguay. It is formed by a 135,000km2 (Assine and Soares 2004) to 75,000 km2 (Sick 1993)

PAGE 54

54 mosaic of swamp, forest, and grassland commun ities that flood annually, interspersed with nonflooded terra firme and cerrado (Prance and Schaller 1982). Arid vegetation zones in South America appe ar to cause a geographic bottleneck in Swallow-tailed Kite habitat near the Pantanal. Drier, more open forms of cerrado lie to the east and northeast, and chaco occurs to the southw est (Prado 1993, Sick 1993). No nesting records are known from these areas. However, to the north and northwest of the Pantanal, Amazonian vegetation joins semi-deciduous tropical forest, palm forests (buriti groves [Sick 1993]), and wooded cerrado (Stotz et al. 1996, Haase 1998). Immediately south and southeast of the Pantanal the vegetation is composed of gallery forests, cerrado (dense ly wooded cerrado), and seasonally dry tropical forest congruent with the Missiones Nucleus (Pennington 2000, Prado and Gibbs 1993). Environments become more hu mid closer to the mountainous Mata Atlntica on the southeast coast of Brazil. Swallow-tailed Kite nests are common in all of these areas. Although the Pantanal is assumed to harbor breed ing Swallow-tailed Kites because they are seen around its borders and appropriate habitat appear s to occur within, I found no evidence of nesting. Explanations for why Swallow-tailed Kites do not nest in the Pantanal include: environmental fluctuation (Brown 1986), paucity of nest trees (hardwood trees may be too short, and buriti palms, often used as nest trees, ar e not found there [pers. obs.]), and less abundant food (according to farmers in the region, termites ar e less plentiful in the native grasses that still exist in the Pantanal). Although Swallow-tailed Kite habitat seem s to be bottlenecked near the Pantanal, within which there is no known nestin g, the resulting gap in their breeding range is only 400 kilometers, Swallow-tailed Kites roost a nd migrate in between, suggesting that this gap does not explain the extremely restricted gene flow.

PAGE 55

55 Were past geographic barriers between the Central and Southern Genetic Populations stronger? Depending on the hist orical locations of populations, breeding gaps could have been wider. Kite distributions probably depend on climate and s easonal distribution patterns of swarming insects, both of which fluctuate. A broader swath of open savanna is thought to have occurred between the cerrado and chaco zone s described above (Ab Saber 1977, Ledru et al. 1993), and cycles of varying humidity and warmth have been hypothesized fo r the late Tertiary and Quaternary periods in central Brazil (Assi ne and Soares 2004). Greater isolation of populations, especially small ones, could explain their divergence. However, unless populations became reproductively isolated, this divergence w ould have gradually diminished as populations became more proximate under current climatic conditions. Regardless, given the amount of population interaction due to migration (curren tly and probably historic ally), no geographical barrier can completely explain restricted gene flow in Swallow-tailed Kites. Strong behavioral mechanisms may restrict interbreeding. For example, while lost Swallow-tailed Kites have often b een observed (Morris 1891, Robertson 1988, http://www.rarebirds.com), there is no evidence that kite vagrancy results in gene flow (even occasional long-distance dispersal can prevent subs tantial genetic differentiation [Slatkin 1987]). Swallow-tailed Kites also do not appear to be switching populations or mating opportunistically with individuals from other populat ions when migrating or winteri ng. It must not be adaptive or possible to disperse genes in this way. Fitn ess benefits of philopatry may outweigh costs, populations may have diverged due to drift or selection, or behavi or of migratory species might be constrained. Benefits of philopatry could deter birds from dispersing in to other Genetic Populations, as long as they outweighed the costs of migratio n. Belichon et al. (1996) reviewed studies on the

PAGE 56

56 costs of transience and re-settlement Benefits of philopatry incl ude local knowledge, social cohesion, and optimal inbreeding (Greenwood and Harvey 1982, Robertson and Cooke 1999). The social-cohesion concept is especially compelli ng in relation to Swallow-tailed Kites because they probably associate with cons pecifics to aid predator det ection, defense, and foraging for ephemeral food sources (Meyer 1995). Nesting areas are loosely col onial and birds roost together when not incubating or brooding. Ex tra non-breeding birds are usually observed near nests and Swallow-tailed Kites ar e often found paired with the sa me mate, using the same nest site, year after year (Meyer 1995, 2004). Teleme try data indicate that Swallow-tailed Kites do not remain paired throughout the year, suggesting th at mate retention might be a direct result of philopatry (Meyer 2004). However, genetic data show no evidence of natal philopatry (discussed below), suggesting that philopatry, to whatever extent it o ccurs, is not strong enough to cause the demonstrat ed population structure. Traits involved with recognition or courtship can diverge due to random drift or sexual selection between allopatric or parapatric populations, leading to reproductive isolation (Bensch et al. 1998, Irwin and Price 1999, Irwin et al. 2001b, Haav ie et al. 2004). In migrants, traits that promote quick mate assessment, such as song, ar e likely targets for sexua l selection (Irwin and Irwin 2005). Traits might also diverge due to ec ological selection based on a habitat differences (Orr and Smith 1998). Sexually or ecologically selected characteristic s that vary among populations can lead to pre-zygotic isolation of those populations (Edwards et al. 2005). This could explain why Swallow-tailed Kites would not mate with members of other populations. Differentiation might lead to post-zygotic isolation (hybrid unfitness), ultimately reinforcing character divergence (Berthold 1996, Saetre et al. 1997, Helbig et al. 2001, Edwards et al. 2005). Reinforcement is strongest when populations are sympatric, as are those of the

PAGE 57

57 Swallow-tailed Kite for portions of the year, a nd is especially implicat ed in the divergence of courtship signals (reviewed by Irwin and Price 1999). It may be rare for hybrid unfitness to cause pre-zygotic isolation in birds (Irwin and Price 1999, Pr ice and Bouvier 2002), but as a post-zygotic barrier, it may help explain the restricted gene flow I have documented for Swallow-tailed Kites. A commonly hypothesized mechanism for reduced fitness in migratory hybrids is that resulting from hybridization betw een populations expressing different migratory routes. Such hybrids may use intermediate mi gration pathways and suboptimal wintering grounds, resulting in poor survival (Irwin and Irwin 2005, Veen et al. 2007). For the Swallow-tailed Kite, explanations for population differentiation based on current selection or drift are problematic but worth considering. Migrati on patterns of the Northern and Southern Genetic Populations may differentiate them from the Central Genetic Population in some respects. For example, both populations ha ve unique breeding destinations, and in the case of the Southern Genetic Population, recent data suggests population wintering destination may be unique (K. Meyer, unpubl, data). Howeve r, broad scale timing, direction, and breeding destinations are similar for groups located ne ar Genetic Population boundaries, and differ among breeding groups within the Ce ntral Genetic Population. Each Genetic Population is so large, and theref ore ecologically diverse, that it is difficult to imagine how selection or drift could cause one population to diverge as a whole from another. The Northern Genetic Population is in the mo st geographically isolated and ecologically differentiated part of the range but the Central and Southern Genetic Populations show much less differentiation at their respective boundary. The single aspect of their ecology that does clearly differ at this boundary is that all nests of the Central Genetic Population in Brazil were found in buriti palm trees, while those of the S outhern Genetic Population were in hardwoods.

PAGE 58

58 This may result from relative differences in palm abundance or predation pressures. Nonetheless, nest site selec tion could represent ecologically diverged behaviors in breeding groups located at the division between these Ge netic Populations, which might create preor post-zygotic barriers. Migratory species behavior could also be c onstrained in regards to allowance of gene dispersal. Adaptations to a migratory lifestyle c ould cause loss of flexibility in timing or location of breeding, even if that flexib ility would be advantageous (e.g. Coppack and Both 2002). An endogenous circannual calendar is proposed for l ong distance migrants, cued by environmental factors, to explain the particul arly precise timing of their breeding, molting, and migration cycles (Berthold 1996, Gwinner and Helm 2003). BhningGaese et als (1988) survey of migratory species distributions conclude d that long-distance dispersal is constrained by geneticallycontrolled physiological and beha vioral adaptations associated with long-distance migration. Swallow-tailed Kites may not disperse among populations because, as some researchers suggest, cognitive adaptations to migration can comp romise the ability to settle in less familiar places long term (OConnor 1986, Veltman et al. 1996, Bhning-Gaese et al. 1998, Sol and Lefebvre 2000, Mettke-Hofmann and Greenberg 2005, but see Thorup 2006). Migrants may be adapted for superficial, rather than detailed, exploration of environmen ts on migration (MettkeHofmann and Gwinner 2004, Mettke-Hofmann 2007) and may be more neophobic than less migratory relatives (Mettke-Hofmann et al. 2005). Sol et al. (2005a, 2005b) showed that migrants exhibit less innovative f eeding behaviors than residents, potentially due to smaller brain size (Winkler et al. 2004, Sol 2005a). He proposed that as a result, migrants are unable to cope with novel or seasonal environments long-term. Be nsch (1999) submitted that migrants are slow to colonize new areas because novel migratory programs would then be required to reach

PAGE 59

59 suitable wintering grounds. Migr atory programs are defined here as distance, direction, and timing of migration. The potential for interbreeding on wintering grounds (between migrants or by a migrant with a local breeder) may also be limited. Wintering males may not be in reproductive condition if physical exhaustion from the br eeding season and migration compro mise migrants abilities to breed more than once (Safriel 1995). If a breeding male tries to ma te with a wintering female, in addition to the obstacle of sexual receptivity, the female would have to store sperm until reaching her own breeding ground, which is not considered possible for many bird species (Briskie 1996). At a proximate level, second breeding in migran ts is prevented by interplay between endogenous annual rhythm and photoperiod according to Berthol d and Terrill (1991). Migrants may have a reproductive window'' of inflex ible width that provides the te mporal framework for breeding (Helm 2005). However, migratory birds have been known to breed in two places (Safriel 1995, Hahn 1998), reinitiate gonadal activity under favorable conditions (reviewed Helm et al. 2005), or switch breeding populations (Baker and Marsha ll 1997). These behavi ors are possible under certain conditions. It is unknown whether they are possible in Swallow-tailed Kites. Isolating mechanisms such as geographical barriers, philopatry, di vergent traits, and behavioral constraints related to long-distance migration might i ndividually explain restriction of gene flow in different parts of the Swallow-tailed Kites range at different stages in the migratory cycle. While none of these mechanisms can provide a complete explanation, for reasons discussed above, in combination they might, es pecially considering that divisions among populations originated a long time ago, when their locations and si zes were much different than they are now. If historically at least two small populations we re isolated geographically, and

PAGE 60

60 perhaps phenologically, from th e main population, each population could have experienced a founder effect due to small size, strong random dr ift, or sexual/ecologi cal selection. Thus, reproductive isolation of three populations might have resulted, enforced by female choice during sympatry. If this scenario is accurate and Genetic P opulations are reproductively isolated, then current lack of strong geogra phic barriers and distinguishi ng ecological features between populations, lack of genetic evidence for phil opatry, and current behavi oral constraints to interbreeding, are moot points in respect to gene flow in Swallow-tailed Kites. However, if populations are not reproductively is olated, all mechanisms heretofo re described should still be considered as possible barriers to gene flow. Although I am able to reject hypotheses of panmix ia in Swallow-tailed Kites, and barriers to gene flow such as differences in nesti ng phenology or philopatry, I am unable to provide support for many of the isolating mechanisms di scussed above. One predicted barrier, the breeding range gap in Northern Mexico, appears to be supporte d, although, as discussed, while this gap likely restricts gene flow to some exte nt, it cannot provide a comp lete barrier since kites annually cross it. Reduced Gene Flow within Elanoides Compared to Other Migratory Species Regardless of mechanism, gene flow appear s to be restricted or non-existent among global Swallow-tailed Kite populations. Why are Swallow-tailed Kites different than other longdistance migratory species such as the Houbara Bustard ( Chlamydotis undulata ), Humpback Whale ( Megaptera novaeangliae ), Monarch Butterfly ( Danaus plexippus ), Dunlin ( Calidris alpina ), Green Sea Turtle ( Chelonia mydas ), several warblers, and cert ain ducks and geese, that at minimum, experience intermittent gene flow among populations (Johnson and Grier 1988,

PAGE 61

61 Baker and Marshall 1997, Baker et al. 1998, Kimura et al 2002, Brower and Pyle 2004, Pitra et al. 2004, Roberts et al. 2004, Davis et al. 2006, Mila et al. 2007)? I offer four explanations for these apparent differences. 1. Swallow-tailed Kites have a longer North-South breeding range than most migratory species. 2. Swallow-tailed Kites are more philopatric than most migratory species 3. Migratory behavi or is more genetically constrained in the Swallow-tailed Kite than in most migratory species. 4. Is olating mechanisms and the ge netic component of migratory behavior are not stronger in Sw allow-tailed Kites than in other migratory speciesthe Swallowtailed Kite is simply farther along the same evolutionary trajectory. A long north-south breeding dist ribution might allow Swallowtailed Kite populations to become ecologically differentiated between geog raphic extremes (Belliure 2000). The species large and relatively continuous range also guarant ees that wintering grounds will lie near active breeding grounds. The resulting breeding/wintering interaction might mean that Swallow-tailed Kites are more, rather than less, reproductively is olated because, as previously noted, sympatry can reinforce pre-zygotic isolation. Degree of philopatry is considered key to di fferentiation of populations that show weak migratory connectivity (populations that interact in non-breedi ng seasons) (Webster and Marra 2005). Swallow-tailed Kites may be more philopatric than many migratory species because of their complex social structure, gr eat ease of flight to return to their natal region, and stability of resources on their breeding grounds. Su rprisingly though, Sutherland (2000) found no correlation between dispersal distance and greg ariousness in migrator y species. Like many insectivorous species (Faaborg 1982), Swallow-ta iled Kites appear to have a relatively predictable resource base (Meyer 1995 ) Homing is generally mo re pronounced among species that use more stable resources, whereas opportunis tic settling usually occurs in species with an

PAGE 62

62 unpredictable resource base (Wiens 1976, Gauthreaux 1980,1982, Greenwood and Harvey 1982, Johnson and Grier 1988) That migration in Swallow-tailed Kites may be more genetically cons trained than in other species is suggested by their long migrations and relatively brief pe riod of parental care. Current research on phenotypic plasticity in migratory programs centers on genetics (reviewed by Pulido 2007). Kites in two of the three Genetic P opulations migrate 4,000-8,000 km between breeding and wintering grounds. Long migrations may be subject to more rigid control by endogenous factors than short migrations because of seve re time and energetic pressures (Berthold 2001). The longer the distance, the smaller the influenc e of environmental factors, and the stronger selection on traits of th e migratory syndrome, a tightly integrated group of adaptive traits that enable birds to perform highly organized season al migrations (Dingle 1996, Pulido and Widmer 2005, Pulido 2007). The fact that juvenile Swallowtailed Kites do not migrate with their parents (Meyer 2004), what Sutherland (1998) referred to as non-extended parental care, indicates that migratory behavior may be genetically, rather than culturally, transmitted. Sutherland (1998) suggested that suboptimal routes demonstrate migration strategi es under strong genetic control, which he found to be most common in species w ithout extended parental care. Geese and ducks, which exhibit extended parental care, are often opportunistic set tlers and breeders (Sutherland 1998, Robertson and Cooke 1999). I have discussed several reasons why Swallo w-tailed Kites may experience less gene flow throughout migration than other long-distance migratory species. However, there are longdistance migrants, such as Dunlins, that may be more philopatric than Swallow-tailed Kites (Wenink et al. 1996). Many other species have longer migration routes or comparable range sizes (Rasmussen et al. 2007), while others are similar to Swallow-ta iled Kites in the other traits

PAGE 63

63 discussed. I propose that, in these cases, isol ating mechanisms and th e genetic component of migratory behavior have not been stronge r in Swallow-tailed Kites, but rather Elanoides is farther along on the same evolutiona ry trajectory. In other words, levels of gene flow, already unexpectedly low in many similar long-distance migratory species (Bowen et al. 1992, Baker et al. 1998, Wenink et al. 1996), may currently be di minishing in said species, as has already occurred in the kite. In which case, the more appropriate taxa to use as comparisons to the Swallow-tailed Kite may be those that have alr eady experienced this reduction in gene flow and have been split into species. For example, populations and migration patterns of the Ictinia species complex ( I. mississippiensis and I. plumbea ) bear a striking resemblance to those of the Swallow-tailed Kite (Brown and Amadon 1968, Sick 1993). Locations and migratory patterns are so similar that populations of both Ictinia species and of Elanoides winter together in central Brazil, alongside breeding Ictinia plumbea and Swallow-tailed Kites (pers. obs.). Ictinia plumbea like Elanoides breeding in Latin America, may be similarly genetically subdivided, but more importantly, Ictinia and Elanoides both appear to have highly diverged temperate northern populations, one of which, Ictinia mississippiensis, is considered its own species Relationship between Migration and Speciation in Elanoides and Similar Species Safriel (1995) proposed a proce ss of diversification for migr atory species originating in the tropics that would have resu lted in speciation of temperat e populations. Joseph (1997) cited a few examples of temperate/tropical species complexes that may have undergone a similar process: Vireo olivaceus, Pyrocephalus rubinus, Le gatus leucophaius, Tyrannus melancholicus and Tyrannus savanna Each complex, like the Swallow-tail ed Kite, exhibits populations that

PAGE 64

64 reside in the tropics, migrate between norther n temperate and tropical zones, and migrate between the southern temper ate and tropical zones. Is the Swallow-tailed Kite an example of a temperate/tropical speciation pattern involving migratory species? Spec iation is usually described in terms of spatia l relationships among diverging populations, e.g. sympatric, allopatr ic, parapatric, etc.. Each of these terms could be applied at different stages in the spec iation process for most species. Migratory species similar to the Swallow-tailed Kite exhibit these sp atial relationships annually. In these cases, it may be more helpful to describe speciation in terms of displacement of breeding grounds, breeding season, wintering grounds, or migratio n route. Although Helbig (2003) hypothesized that highly migratory species possess a lower pr opensity for speciation, he also reviewed cases where breeding range disjunctions, and conseque nt habitat preferences, may have caused subdivision within migratory species. Winker (2000) also attributed subdivision within migratory species to heterogeneous ly distributed cyclic resources. Both papers acknowledge the possibility that while long-distan ce dispersal in migratory species can result in gene flow, it can also result in diversification (but see Belliure 2000) as illustrated by a morphologically divergent population of booted eagles breeding on what were solely wintering grounds (Helbig 2003). A population of Barn Swallows ( Hirundo rustica ), which began breeding on its winter range in Argentina within the past 30 years, a migrating flock of Fieldfares ( Turdus pilaris ) that blew off course and began breeding in Greenland, and severa l examples of migrati on dosing in raptors (Martinez 1983, Gill 1995, Bildstein 2004), may pr ovide additional support for the hypothesis that migration can facilitate divergence via creation of new breeding populations. Breeding ground displacement is often synonymous with displacement of breeding season; however the latter can occur independen tly, yielding the same effect as the former-

PAGE 65

65 reproductive isolation and united winteri ng of populations. A Blackcap population ( Sylvia atricapilla ), with a displaced winter ing ground, consequently has a slightly earlier breeding season than con-specifics on th e shared breeding grounds (Bear hop et al. 2005). A population of Band-rumped Storm Petrels ( Oceanodroma castro ) began to breed in a season when more nest sites were available (Monteiro and Furness 199 8). Changes of nesting phenology resulted in assortative mating in both species. Concordant changes in petrel populati on structure have been documented (Monteiro and Furness 1998, Bearhop et al. 2005). Displacement of non-breeding grounds and resultant divergence of migrati on patterns, can cause divergence between populations, even without a concor dant change in breeding season, if selection pressures change as a result (Berthold 1996, Prez-Tris 2003, Irwin and Irwin 2005) or if pair formation occurs away from the breeding ground (B aker et al. 1998, Robertson and Cooke 1999). Migratory divide avian populations (related sp ecies or subspecies that breed sympatrically but migrate and winter separately), similar to Humpback Whale populations, are often better defined by migratory route than by breeding grounds (Baker et al. 1990, Irwin and Irwin 2005). In the case of the Swallow-tailed Kite, I s uggest that the Northern and Sout hern Genetic Populations have incurred displacement of breeding season and breed ing ground from a putative tropical ancestral population. Deciding whether speciation ha s occurred within a taxon is often difficult and arbitrary (Edwards et al. 2005, Bickford 2007). I consider th e concept briefly here only to underscore the potential relationship between migration a nd speciation in the Swallow-tailed Kite. Mitochondrial DNA phylogenetic trees show three clades that correspond ge ographically to three clearly partitioned breeding gr ounds. Proposals to designate species based on mtDNA occur (Wiens and Penkrot 2002, Baker et al. 2003) but have been criticized (Zinc and McKitrick 1995,

PAGE 66

66 Edwards et al. 2005). Nuclear DNA split samp les into two monophylet ic clades, strongly supporting one division demonstrated by mtDNA, a nd failing to show clear support for the other division likely because of incomplete lineag e splitting. Based on these data, under the Phylogenetic Species Concept (Cracraft 1983, Donoghue 1985), the exclusivity model (Baum and Donoghue 1995), and British Ornithologists Uni on Guidelines (Helbig et al. 2002, but see below), the Swallow-tailed Kite would be regarded as at least two species and perhaps three. However, the use of gene trees or monophyly to define species can be problematic (Doyle 1995, Baker et al. 2003, Wang et al. 2003). Reproductive isolation is i ndirectly suggested here by the extent to which populations interact with no re sultant gene flow. Re productive isolation is difficult to prove in this case where no two popul ations interact while both are breeding, and recent gene flow has occurred between two populations. Finally, the clades are not morphologically distinguishable by variables us ed in this study (see morphology section). Assessment of speciation often considers fact ors such as current and future level of contact between populations (e.g. Helbig et al. 20 02). For example, speciated populations should show a propensity to remain genetically separate (OHara 1994). If populat ions are sympatric or parapatric, requirements for defi ning divergent characters are le ss stringent because the contact ensures that populations are repr oductively isolated and have a hi gh likelihood of retaining their integrity (Helbig et al. 2002). Levels of current contact are hard to define in the Swallow-tailed Kite, where all populations are sympatric at some point annually, but never when both populations are breeding. The Central and Southe rn Genetic Populations should be considered parapatric since the distance between them is ne gligible compared to the Swallow-tailed Kites potential for movement. As for future level of contact between populations, levels of gene flow suggest that differentiation will continue, alt hough, if proximity of the two southernmost

PAGE 67

67 populations is relatively recent, there is a chan ce that gene flow between the populations might increase. Whether this species is subdivided depe nds on the rationale used to define subspecies/species. It is a ppealing to take an integrativ e approach, whereby phylogenetic divisions are corroborated by concordant change s in independent characters such as morphology, behavior (e.g. non-visual mating cues such as song), or ecological diffe rences (e.g. habitat use and adaptation [Crandall et al. 2000 ]), although these types of traits are not always indicative of phylogenetic relationships (Ball and Avise 1992, Wiens and Penkrot 2002, Bickford 2007). This study demonstrates extremely restricted gene flow and strong population structure in the Swallow-tailed Kite. Determinations rega rding Swallow-tailed Ki te taxonomy may depend on future research on population differentiation a nd resolution in the scientific community about how to define species. It is sufficient for my purposes to suggest that cladogenesis has occurred in this highly migratory species. Swallow-tailed Kite populat ion structure demonstrates that migration does not necessarily facilitate gene fl ow via interbreeding or disper sal of reproductively successful individuals. Furthermore, relate d species that are less migratory are not necessarily less prone to gene flow. For example, the Snail Kite ( Rostrhamus sociabilis ) has been shown to be relatively panmictic (S. Haas, unpubl. data). Also, the long -distance migratory port ion of Swallow-tailed Kites (Northern and Southern Gene tic Populations) did not appear a ny more disposed to disperse genes than did the resident/short-distance migr ant portion (majority of the Central Genetic Population). In fact, residents may be the key to maintenance of gene flow throughout the large Central Genetic Population because they breed year round, which may serve to connect the two phenologically differentiated breedin g groups to the north and south.

PAGE 68

68 Biologically, the link between migration and dispersal may be non-existent once migration patterns are established. Migration and dispersal are very different mechanisms, with different functions and selecti on pressures, perhaps only conn ected historically, when novel breeding grounds and migration patterns were created (Belliure 2000, Sutherland 2000, Rappole et al. 2003, Winkler 2005). Understanding of the ra te and impact of long-distance dispersal is poor (Paradis et al. 1998, Nathan et al. 2003, Trakhtenbrot et al. 2005, Winkler 2005). Assuming that Elanoides populations are not reproduc tively isolated, and indi viduals are capable of interbreeding, my result s show no evidence of current long-di stance dispersal du e to migration, surprising in a species that c ontains many attributes correlat ed with long-distance dispersal (Paradis et al. 1998) and that pres umably exhibited flexible disper sal behavior historically. The Swallow-tailed Kite may be a prime example of evolutionary lability compared to current rigidity in terms of migration patterns. Migratory behavior appear s to be flexible in some species, or at some points in a species history, and not in others. Are th ere distinguishing featur es of species that ca n be used to predict whether their migratory patterns will promote or retard gene dispersa l? Constraints for evolutionary transitions in migration were described by Al erstam (2003) and evidenced by Bhning-Gaese et al. (1988), Bens ch (1999) and Sutherland (1998) (but see Thorup 2006). Yet, species have been shown to adopt novel migra tion strategies rapidly (Hill et al. 1998, Fiedler 2003, Helbig 2003, Pulido and Berthold 2004, Pulido 2007, Winkler 2007) often with no cultural transmission (Berthold 1999). M eanwhile, indirect evidence for evol utionary stasis in migratory traits found in phylogeographic studies suggests that populations and their migratory patterns have existed without changing for thousands of generations (Baker 2002, Ruegg and Smith 2002). Rigidity of migrant schedules is exem plified by a study in which seasonally breeding

PAGE 69

69 Stonechats ( Saxicola torquata ), when placed in conducive aviary conditions, continued to produce only one brood per year, unlike less migrat ory, multibrooded, conspecifics (Helm et al. 2005). Yet irruptive migrants, like Red Crossbills ( Loxia curvirostra ) breed in many different seasons (Hahn 1998). How is such variation possible at a proximate le vel? Studies of herita bility indicate that the degree of genetic control over migratory be havior differs among species and populations, and even between years (Potti 1998, Pulido et al 2001, Pulido and Berthold 2003). Genetic architecture can allow for the expression of di fferent behaviors dependi ng on environmental and social cues (Terrill and Ohmart 1984, Sutherland 1998). Flexibility in migratory behavior of many species cited in this paper is assumed to cause at least a small degree of long-distance dispersal, consequent homoge nizing gene flow, and lack of subdivision (Helbig 2003). Assuming that the converse is true, that subdivision indicate s an absence of long-distance dispersal (Belliure 2000) and, therefore, inflexib ility in migratory behavior, what proximate mechanism could reduce the ability of Swallow-tail ed Kites to express such flexibility? As previously discussed, successful long-distan ce migration may require an endogenous spatiotemporal program insensitive to environmental perturbation. Pulido a nd Berthold (2004) and Helm et al. (2005) reviewed the evidence that long-distance migratory birds often show little phenotypic variation in the timing of life-history events like breedi ng, molt, or migration. All of the species with suboptimal migration routes in the study by Suth erland (1998) not only exhibited non-extended parental care, but were also long-distan ce migrants. Pulido and Widmer (2005) and Pulido (2007) hypothesized that that such low expresse d variation is a consequence of environmental canalization, or reduced leve ls of genetic variation, resulting from strong

PAGE 70

70 stabilizing selection on migratory traits. Long-distan ce migratory behavior then, appears likely to hinder dispersal of genes, and thereby to promote speciation. Morphology and Subspecies Wing and tail length ranges were not diagnos tic for any group (Table 4-1). Although ranges overlapped substantially between groups, it may be possi ble to assign measurements found at the range extremes to certain groups. Iridescent coloration was potentially diagnostic for certain locations. The Northern Genetic Popu lation exhibited strongly purple iridescence. The Southern Genetic Population, and possibly a ll other South American breeders, had purple iridescence, often mixed with gree n. Breeders in Central Americ a exhibited green iridescence. Although more data are needed to confirm patte rns in northern South America, my results support the hypothesis that current morphological rationale for dist inguishing subspecies are not appropriate, since neither wing lengt h, tail length, nor iridescent co loration distinguished current subspecies, Biological Populations or Genetic Populations. Aver age lengths increased as group location moved north. Although av erages lengths were signifi cantly different among Genetic Populations, this probably resulted from an in teraction between the nor th-south orientation of populations and Bergmanns rule (Bergman 1847), si nce no discontinuities in lengths were noted at geographic divisions between populations and av erages were most significantly different when samples were grouped into sub-regions. The genetic data, like the morphological data, do not completely support current subspecies designations. Curre nt designations recognize diverg ence of the Northern Genetic Population ( E.f. forficatus ), but they obscure divergence betw een Central and Southern Genetic Populations (currently lumped into E.f. yetapa ). The level of mtDNA divergence between the latter populations was higher than between mo st avian subspecies, and equaled that found

PAGE 71

71 between many sibling species (Mila et al. 2007, Buerkle 1999, Klicka and Zink 1997, Baker et al. 2003, Burg and Croxall 2001, Wenink 1996, Avise and Walker 1998, Kimura et al. 2002). Why was subspecies morphology considered di agnostic in earlier studies? Friedmann (1950) collected measurements for both subspecies, and Snyder and Wiley (1976) collected measurements for E.f. forficatus (Appendix C). There are obstacles to obtaining accurate morphological data in Swallow-tailed Kites. Fi rst, there is often no way to know if one is measuring a resident or migrant. Second, meas urements taken from dry specimens cannot be compared directly to those from live or fres hly collected specimens because of shrinkage (Winker 1993, pers. obs.). Finally, although it is often difficult to identify Swallow-tailed Kites less than one and a half years of age, it is im portant to exclude them because their tails are shorter than those of adults. I do not know if Friedmann ( 1950) or Snyder and Wiley (1976) considered these issues. I assume that meas urements given by Friedmann are from dry nonmolting specimens, while those of Snyder and Wiley are from fresh specimens or live nonmolting birds. While ranges overlapped substantially betw een subspecies in every category of measurement in this study, Friedmanns (1950) ranges overlapped significantly (more than 2 cm) only in male wing chord. Friedmanns average m easurements were much larger than mine for E.f. forficatus (even without considerati on of shrinkage), hence the greater difference between subspecies in his analysis. In addition, averages for Friedmanns E.f. yetapa measurements were slightly smaller than in my study. Although our samples sizes were comparable, Friedmanns ranges are of much smaller magnitude, especially in E.f. forficatus Snyder and Wileys (1976) sample sizes are much larger, and th eir average wing and tail lengths for E.f. forficatus were slightly smaller than mine. Apparently, my data are from a more variable set of E.f. forficatus

PAGE 72

72 than used by Friedmann. Friedmanns data le d a collector, Skinner ( 1964), to label a small specimen collected in Alabama as E.f. yetapa The specimen was used in this study and DNA suggests it is E.f. forficatus Its measurements fall within the ranges of both subspecies, as reported here. Why are Swallow-tailed Kites much less vari able in appearance than their population structure would suggest? Morphol ogical differences are not alwa ys correlated with boundaries between taxa or reproductive is olation between groups (Greenbe rg et al. 1998, Bensch et al. 1999, Omland and Lanyon 2000, Cheviron et al. 2005). In fact, sibling-species and subspecies in other kite genera are often only weakly differentiated by morphology (Brown and Amadon 1968). One explanation sometimes invoked in cryptic speciation is morphological stasis (Bickford 2007). Extreme environmental c onditions can impose stabilizing selection on morphology, reducing or eliminating morphological change that can accompany differentiation (reviewed in Bickford 2007). Might flight be one such homogenizing force on the species? Swallow-tailed Kites feed on the wing, and most individuals migr ate (Meyer 1995). Wing length, a variable thought indicativ e of selection due to migrator y flight (Belliure et al. 2000, Prez-Tris et al. 2003) is shorter on average in putative Swallow-tailed Kite residents from northern South America than in migrants from the same Genetic Population (Appendix C). However, these migrants were Central Ameri can breeders, thereby c onfounding this comparison because of the relationship previously describe d between latitude and wing/tail lengths. More research is needed to determine whether migr atory flight causes stab ilizing selection on Swallow-tailed Kite wing and tail length, and whether morphological variables not measured in this study, or cryptic variation such as nonvisual mating signals, distinguish Genetic Populations.

PAGE 73

73 Population History According to coalescent and demographic analyses, Swallow-tailed Kite Genetic Populations started to diverge earl y to mid-Pleistocene and continued into late Pleistocene. This agrees with recent avian phylogenies that indicate the sp ecies is old relative to other falconiform species (Lerner and Mindell 2005). It might also explain why most loci sequences in this study were not very similar to those of other raptor s on Genbank. The MIS 11 interglacial period (ca. 360-420 ka) was included in the ranges of dates for each populations origin, which supports the hypothesis that at least one of the populations diverged during MIS 11. Another reputably warm interglacial, MIS 5e (ca. 110-130 ka), occurred within the Northern Genetic Populations range of origin. Clade origin times calculated in Genetree we re bracketed between a mutation predating the origin of the clade, and th e oldest mutation within a clade. A range of mutation rates was used for both mismatch and Genetree analys es. However, because of the many underlying assumptions of mismatch and Genetree analyses (Edwards and Beerli 2000, Baker 2002), and the wide ranges of clade origin and expansion dates, I take a very broad vi ew of the time periods reported by these analyses, and focus on informati on gained from relative comparisons, such as those between clades. The Central Genetic Population was the most genetically diverse of the three Genetic Populations, followed closely by the Southern Gene tic Population. Diversity levels, especially suggest that the Central Genetic Population has had a higher e ffective size historically than the other populations. Currently it is the largest popul ation. High diversity indices and a more hierarchically structured haplot ype network suggest th at the Central Genetic Population is the oldest population or has experien ced the fewest bottlenecks. The Central Genetic Population

PAGE 74

74 also had the highest average TRMCA, followed closely by the Southern Genetic Population. The Northern Genetic Population experienced the most recent sudden population expansion and is the least diverse, which supports my hypothe sis that this population s history was heavily influenced by climatic fluctuations. Control region phylogenetic trees showed all populations to be equally related. No population was basal, potentially due to the use of an outgroup that was not sufficiently related to the Swallow-tailed Kite to provide evolutionary insight (Smith 1994). Preliminary analysis suggested that a cytb phylogeneti c tree, built with a larger samp le size than was used here, may place the Central Clade in a basal location. n DNA outgroup allele sequences were most similar to Latin American allele sequences, providing add itional support for the species tropical origin. mtDNA average sequence distances suggested deep and almost equal divergence between clades, however, the Northern Genetic Population wa s the most divergent based on nDNA and mtDNA pairwise differences, especially when the inst ance of mtDNA haplotype sharing between the other Genetic Populations is considered. The current distribution of Swallow-tailed Kite populat ions, two small temperate populations peripheral to a larg e diverse tropical population, is a classic arrangement for migratory species originati ng in the tropics (Rappole 1995, Safriel 1995, Joseph 1997, but see Zinc 2002), although sometimes the southern te mperate population is not present or not considered in migration literature (Levey 1994, Joseph 1997, Jahn et al. 2004). Based on current Swallow-tailed Kite distributions, gene tic data, migration patte rns, and literature regarding the evolution of similar migratory species (refer ences above in th is paragraph), I considered four possible histories for populations origins. I assume d that the latitudinal order of populations was the same historical ly as it is now. C-S/N: A population most closely related

PAGE 75

75 to the Central Genetic Population in the neotropi cs expanded both north a nd south into temperate zones. C-S then C-N: Same as above but expansion to the south occurred before expansion to the north; S-C-N: A popul ation most closely related to the Southern Genetic Population expanded north, throughout the tropi cs, and then into northern te mperate zone. C-N-S: A population most closely related to the Central Genetic Population expanded into the northern temperate zone. When birds migrated south for the winter, they leap-fr ogged over their ancestral population, wintering father sout h, where they ultimately establ ished a breeding population. I cannot reject any of these possibilities b ecause of the broad overlap in population ages and lack of branching order on gene trees, therefore I cannot re ject the null hypothesis that all populations are equally related to the ancestral population. Th e Northern Genetic Population seems the least likely based on calculated TMRCA and current literature concerning ancestry of temperate/tropical migratory species. The data show most support for the C-S then C-N scenario. Resident and most wintering Swallow-tailed Kite s are found within the Central Genetic Population, attributes often considered indicative of the ances tral population (Rappole 1995). The S-C-N scenario is the next best in terpretation of data because of the age of the Southern Genetic Population. Ma ny migrants bypass the Central Gene tic Population to winter in the Southern Genetic Population zone. However, if the ancestral population was in a temperate zone as the Southern Genetic P opulation is now, expans ion into the tropics to breed would be unusual behavior according to Safriel (1995), si nce food resources are less predictable and abundant there during the breeding season. Dates from coalescence analyses show that expansion to the south may have occurred during the late Pliocene or the MIS 11 interglacial when warm conditions prevailed in southern South America (Ortlieb et al. 1996, Genise 1997) and that expans ion to the north might have

PAGE 76

76 occurred later during late MIS 11 or MIS 5e, in tervals of relative warmth in the northern hemisphere (Howard 1997, Petit et al. 1999, Kukla et al. 2002). Population expansion would have resulted in gradual disp lacement of breeding grounds and nesting phenology. Breaks in suitable habitat and/or glacial events likely increased isolatio n between breeding populations. How did breeding populations remain separate thr oughout glacial cycles when the most suitable habitat was probably in northern South America (W illiams et al. 1998), presumably within reach of all Swallow-tailed Kite populations? I suspec t that populations maintained separation either due to disparate refugia or behavioral isolating mechanisms that are still in place. To explain how geography could have been instrumental in divergence among the populations, I have formulated the following scenarios for each popula tion. These scenarios are consistent with the data and assume a tropical origin. In the Northern Genetic Population, the data indicate a recent sudden population expansion, possibly since th e last glacial retreat Swallow-tailed Kites may have expanded into North America several times since their origin, which would explain why this population is the youngest, yet most divergent. Founder effect s and bottlenecks due to small colonizing population sizes, and ecologica l selection in a vegetation zone mu ch different than that of Latin America, could have caused a great, rapid, di vergence of this populati on from the others. Although it is possible that Swallo w-tailed Kites remained in part s of the southeastern U.S. during glacial times, their ease of movement s uggests a more likely shift south to a warmer climate. However, analyses suggest that the Northern Genetic Population did not interbreed during the last few glacial cycl es with the population immediatel y to the south the Central Genetic Population. Portions of Centra l America, south of approximately 150N, maintained a

PAGE 77

77 relatively warm humid climate during glacial cycles (Williams et al. 1998), and it is possible that members of the Northern Genetic Population stayed there rath er than moving farther south. Climate and vegetation studies indicate that the largest areas in the New World with a relatively warm humid environment during the la st glacial maximum were in northeastern and western Amazonia (Clapperton 1993, Williams et al. 1998, Colinvaux et al. 2000, Lessa et al. 2003). If members of the Central Genetic Population bred in this area, they might have avoided contact with members of the Nort hern Genetic Population in Centra l America, especially if arid conditions dominated in the intervening area (Clapperton 1993). The hypothesis of a large refugium for the Central Genetic Population conc ords with diversity estimates and a haplotype network that did not show much evidence for co ntractions and expansio ns in this population. The Southern and Central Genetic Populations have co-existed fo r many glacial cycles, and have therefore maintained their genetic separation during many ch anges in range. I speculate that the best explanat ion for this is the movement of the Southern Genetic Population to refugia far removed from those of the Centra l Genetic Population. Poss ible locations include the coastal mountains of south eastern Brazil or the Iguau region (reviewed pg. 56-60, Sick 1993, Hewitt 2000, Spichiger et al. 2004). Repeated movements to different locations could partially explain original diverg ence between the two populations and the recent gene flow event, if the two populations have only re cently come back into contact. Subdivision/Gene Flow: Within Populations Genetic data show no support for the hypothesis that Swallow-tailed Kite phylogeographic structure results from natal phil opatry. I found high haplot ypic diversity within populations, and relative to other birds, a hi gh level of nuclear diversity. However, no phylogeographic structure was found within popula tions, even in the large Central Genetic

PAGE 78

78 Population where time and effective population si ze have likely been sufficient to allow development of structure in neutral markers. Th is result is surprising for a few reasons, one of which is illustrated by the shape of the phylogenetic trees. Branches to each clade are extremely long, while branches within each clade are extremel y short, implying that while no gene flow is occurring between clades, a great deal of gene flow is occurri ng within them. Observed and expected heterozygosity estimates were similar within each Genetic Population, more evidence that Swallow-tailed Kites are mating randomly within populations. The degree to which gene flow differs depending upon scale (global versus local) is unexpected. This pattern would make sense if strong geographic boundaries existed between populations and interbreeding among subpopulations was plentiful, but, the opposite appears to be true Strong divisions between populations are not obvious and ev idence acquired from years of re search on the natural history of Swallow-tailed Kites suggests that natal and breeding philopatry is high, as is suggested for semi-colonial nesters (Greenwood and Harvey 1982). Are Swallow-tailed Kites disper sing long distances (defined here as over 300 kilometers) from their natal areas? If so, they could disper se like ducks that settled to breed at the first suitable location encountered duri ng spring migration (Johnson and Grier 1988). This is unlikely because long distance dispersal, if it were occurring, should have been demonstrated more often via haplotype sharing between Genetic Populatio ns at their proximate borders. Also, radio tracking in the U.S. has not documented long-dista nce dispersal, indicating it is probably a rare event, in which case shallow population struct ure should have been found within populations. However, no population structure was found in th is study or in a conc urrent study of random amplified polymorphic DNA (RAPDS) (K. Meyer, unpubl data), suggesting that something else must be occurring in addition to, or instead of, rare l ong-distance dispersal.

PAGE 79

79 Incremental gene flow within populations is more likely. A scenario of gradual nestingneighborhood overlaps, considers the sociality of Swallow-tailed Kite s and reconciles radiotracking and genetic data, and strong fidelity to Genetic Population but not to nest area. If nesting neighborhoods shifted with time, eventua lly overlapping, kites could transfer between social groups, causing gene flow. Natal and bree ding philopatry would still appear to be high if movements were gradual. Transfers may o ccur when nests fail or when an overlapping neighborhood is larger. In coloni al nesting species, individuals ma y be more attracted to sites inhabited by large numbers of conspecifics rather than areas with better habitat and few conspecifics (Kharitonov and Si egel-Causey 1988, Serrano et al. 2004) Biological evidence for transfers of breeding kites is that nesting nei ghborhoods are abandoned occasionally (Meyer 1995, Meyer 2004). Genetic analysis is useful in that it can detect movements that are rare or incremental (Edwards 1993, Baker et al. 1993, Pi tra et al. 2004). Without biol ogical data, however, the scale of these movements is difficult to determine. A combination of genetic and biological data suggests that while strong natal philopatry is not a complete explanat ion for divisions in Swallow-tailed Kite, fidelity to nesting neighborhoods may explain some of the observed division. Implications Although Swallow-tailed Kites ar e one of the most mobile species in the world, their movements do not appear to increase dispersal of their genes. Instea d, two small genetically unique populations have formed on either side of a large diverse popula tion. These temperate populations occupy areas where ha bitat alteration is extreme. Small population size and an

PAGE 80

80 apparent inability to disperse long distances ma ke these populations vulnerable in zones where environmental change is imminent (Cain et al. 2000, Sutherland 2000, Trakhtenbrot 2005 ). Information about U.S. population dynamics and the degree to whic h it is genetically distinct will inform conservation planning and decisions about how management resources are allocated. Swallow-tailed Kite dispersal into populations enc ountered during the non-breeding season is probably not affecting population dynamics in the U.S. Gene flow appears to occur among Swallow-tailed Kite subpopulations, in wh ich case U.S. reintroduction programs may have flexibility in choosing donors (as long as they are from the U.S.). Primers developed and geographically-linked molecular and morphological markers discovered in this study will be valuable for future Swallow-tailed Kite research. Swallow-tailed Kite breeding populations in South America we re unstudied prior to this project. This research has demonstrated the importan ce and vulnerability of seve ral habitats in Brazil. Nests were found within humid forested fragments of cerrado and in the Atlantic rain forest. The cerrado, which houses much biodiversity, is less protected and undergoing mo re modification than most other biomes in South America (Myers et al. 2000, da Silva and Bates 2002). It is well known that less than 8% of the Atlantic rainforest remains (Myers et al. 2000). Lesser known is the plight of habitat found on cattle ranches in th e states of Mato Grosso and Mato Grosso do Sul. All Swallowtailed Kite nests were found on ranches, except in southeastern Brazil where ranches are rare. Nest success was very high on ranch lands higher than in forests of sout heastern Brazil ( unpubl. data). However, land there is in high demand for agricu ltural development (Haase 1998). Owners of ranches where nests were found for this st udy are all considering conversion to agriculture (row-cropping) for financial reasons. While ranch land hosts many species of wildlife and appears to provide a variety of habitats, crop land in this region contains no apparent wildlife habitat (pers. obs.).

PAGE 81

81 Contrary to traditional thought, this st udy suggests that migratory species do not necessarily experience fewer restri ctions on gene flow than other species. The proposition that migration enables the dispersal of genes, primarily via dispersal of individuals (Paradis et al. 1998, Sutherland 2000), could lead to the prediction th at migratory species ar e relatively resilient to environmental stochasticity ( Trakhtenbrot 2005) Instead, behavior of long-distance migrants is subject to strong selection, a nd the resulting loss of phenotypic plasticity may constrain short term responses to natural selection (exa mples given pg.169, Pulido and Berthold 2004). Ironically, long-distance migrants might be limited in their movements. A cryptic pattern of diverg ence in long-distance migrator y species may have been revealed in this study, where bird movements are initially flexible as mi gration patterns evolve and gradual cessation of gene flow occurs as migr atory patterns become specialized. Under this scenario, long-distance migration facilitates repr oductive isolation/speciation in two main ways. It allows for the displacement of populations in space and/or time. Then, strong selection associated with the migratory behavior of long-distance migrants limits flexibility during migration, such that dispersal of genes doe s not occur. Migration might contribute to diversification in a third way, in species whose populations ar e joined for portions of the year. Interaction might stimulate incr eased mating discrimination thr ough reinforcement, especially if at least one of the populations is breeding, as is the case wi th Swallow-tailed Kites and a number of other migratory species including: Ictinia plumbea (pers. obs.), various raptors (Bildstein 2004), many passerines (Stotz et al 1996), storks and ro llers (Safriel 1995), migratory divide species (Irwin and Irwin 2005), and others (pg. 110, Rappole 1995). Speciation in such cases is cryptic in that populations are not necessarily morphologically distinguishable a nd they interact.

PAGE 82

82 CHAPTER 5 SUMMARY Regardless of great vagility, ex tensive interaction throughout their trans-equatorial range, and apparent phenotypic similarit y, there exist deep genetic divisi ons in the Swallow-tailed Kite. I found no evidence of gene flow among populations that could be attributed to migratory behavior. This study lends support to the hypothe sis that long-distance migration can enable speciation and demonstrates that migratory behavior does not ne cessarily hinder differentiation or cause panmixia. I speculated on potential is olating mechanisms and constraints that could explain the extent to which gene flow is restricted among populati ons, while levels of interaction are high and natal philopatry is apparently not strong enough to cau se genetic divisions within, let alone among, populations. Flexibility in disper sal patterns that might have accompanied the evolution of migration in Swa llow-tailed Kites is not eviden ced through recent gene flow, suggesting that they are not opportunistic settlers or breeders. Population boundaries were unexpected, as was the lack of phylogeographic structure within each population. Gene flow within populations is probably due to short-dist ance dispersal. Analyses suggested a neotropical species orig in with Pleistocene di versification. Three populations maintained isolation throughout glac ial cycles and accompanying range changes, eventually resulting in a distribution where a large neotropical populati on composed of putative residents and migrants is bor dered to the north and south by smaller temperate-breeding populations of long-distance migrants. Current subspecies designati ons distinguish the most divergent Swallow-ta iled Kite population ( E.f. forficatus ) but do not consider the full genetic diversity of the species. They are not base d on sound rationale, since morphological variables considered here were not diagnostic for a ny Genetic Population, and appeared to be ecophenotypic. I reflect on evolutionary implica tions and conservation for the Swallow-tailed

PAGE 83

83 Kite and similar species. My objective in this study was to document evol utionary processes in the Swallow-tailed Kite, especially as they relate to migratory behavior, not to draw taxonomic conclusions; however, I recommend that the geneti c uniqueness of the three Genetic Populations be considered in conservation planning. This study suggests several areas for future research. Temperate/tropical migratory species such as Elanus leucurus and Ictinia plumbea may have population structures similar to the Swallow-tailed Kite. Studies on the history and level of divers ification in these species could help resolve the legitimacy of many hypotheses offered here. To gain insight into restricted gene flow among Swallow-tailed Kite populations, I recomme nd research gauging population reproductive isolation and differences in non-visual mating cues, especially song. Microsatellite markers may allow comparison between migrat ory and resident population structures in Swallow-tailed Kites breeding in northern and central South Ameri ca. Comparing wing and tail measurements between these groups would also help test a hypot hesis of morphological stasis due to flight-related selection in the species. To determin e the degree of dispersal among breeding areas within Genetic Populations, rigorous radio-tr acking data, mark recapture methods, or the use of stable isotopes could be helpful. Finally, increased sampling in cytb might illuminate population origins.

PAGE 84

84 APPENDIX A SAMPLE INFORMATION

PAGE 85

85Table A-1. Sample collection information Sample name Species Date of collection Country Location of collection* Age SexBreeding, measurement, or collection Information** Tissue Certain breeder?*** FL 0500 Elanoides f. forficatus Summer 2000 United States Fish Camp nest, Levy Co., North Florida A M Sample collected at nest. Blood Yes FL 0601 Elanoides Forficatus Summer 2001 United States Road 31 nest, Levy Co., North Florida AHYF Sample collected at nest. Blood Yes FL 0800 Elanoides f. forficatus Summer 2000 United States MacIntire Moody nest, Levy Co., North Florida A F Sample collected at nest. Blood Yes FL 1001 Elanoides f. forficatus Summer 2001 United States Buckfish nest, Levy Co., North Florida A F Sample collected at nest. Blood Yes FL 0900 Elanoides f. forficatus Summer 2000 United States Parker Rock Pit nest, Levy Co., North Florida A M Sample collected at nest. Blood Yes FL 1000 Elanoides f. forficatus Summer 2000 United States Buck Island 1 nest, Levy Co., North Florida A F Sample collected at nest. Blood Yes FL 0199 Elanoides f. forficatus Summer 1999 United States Flowing Well nest, Levy Co., North Florida A F Sample collected at nest. Blood Yes FL 0598 Elanoides f. forficatus Summer 1998 United States Gulf Hammock nest, Levy Co., North Florida YOYM Sample collected at nest. Blood Yes FL 0299 Elanoides f. forficatus Summer 1999 United States Lake Disston nest, Flagler Co., Central Florida A M Sample collected at nest. Blood Yes

PAGE 86

86Table A-1 (cont.) Sample name Species Date of collection Country Location of collection* Age SexBreeding, measurement, or collection Information** Tissue Certain breeder?*** FL 31 Elanoides f. forficatus Summer 1996 United States The Blocks nest, Collier Co., South Florida YOYM Sample collected at nest. Blood Yes FL 7 Elanoides f. forficatus Summer 1995 United States The Loop nest, Monroe Co., South Florida YOYM Sample collected at nest. Blood Yes FL 17 Elanoides f. forficatus Summer 1995 United States The Everglades nest, Dade Co., South Florida YOYM Sample collected at nest. Blood Yes FL 10 Elanoides f. forficatus Summer 1995 United States Bear Island nest, Collier Co., South Florida YOYF Sample collected at nest. Blood Yes FL 39 Elanoides f. forficatus Summer 1996 United States Crew nest, Lee Co., South Florida YOYM Sample collected at nest. Blood Yes FL 43 Elanoides f. forficatus Summer 1996 United States Bar-D nest, Highlands Co., Central Florida YOYF Sample collected at nest. Blood Yes FL 11 Elanoides f. forficatus Summer 1995 United States Highlands Hammock nest, Highlands Co., Central Florida YOYM Sample collected at nest. Blood Yes FL 15 Elanoides f. forficatus Summer 1995 United States Kicco nest, Highlands Co., Central Florida YOYF Sample collected at nest. Blood Yes

PAGE 87

87Table A-1 (cont.) Sample name Species Date of collection Country Location of collection* Age SexBreeding, measurement, or collection Information** Tissue Certain breeder?*** FL 8 Elanoides f. forficatus Summer 1995 United States Tiger Creek nest, Polk Co., Central Florida YOYF Sample collected at nest. Blood Yes FL 0898 Elanoides f. forficatus Summer 1998 United States Osceola nest, Columbia Co., North Florida YOYM Sample collected at nest. Blood Yes FL 2398 Elanoides f. forficatus Summer 1998 United States Gunter's nest, Marion Co., North Florida YOYF Sample collected at nest. Blood Yes FL 2198 Elanoides f. forficatus Summer 1998 United States Ochlockonee nest, Franklin Co., Northwest Florida YOYF Sample collected at nest. Blood Yes FL 1898 Elanoides f. forficatus Summer 1998 United States Apalachicola nest, Liberty Co., Northwest Florida YOYM Sample collected at nest. Blood Yes FL 9 Elanoides f. forficatus Summer 1995 United States Finger N Additions nest, Collier Co., South Florida YOYF Sample collected at nest. Blood Yes FL 1398 Elanoides f. forficatus Summer 1998 United States Fern Hammock nest, Marion Co., North Florida YOYF Sample collected at nest. Blood Yes FL 1198 Elanoides f. forficatus Summer 1998 United States Rainbow Springs nest, Marion Co., North Florida YOYF Sample collected at nest. Blood Yes

PAGE 88

88Table A-1 (cont.) Sample name Species Date of collection Country Location of collection* Age SexBreeding, measurement, or collection Information** Tissue Certain breeder?*** FL 2298 Elanoides f. forficatus Summer 1998 United States Tosohatchee nest, Orange Co., Central Florida YOYF Sample collected at nest. Blood Yes FL Museum Elanoides f. forficatus 35217 United States Raccoon Point, Collier Co., South Florida YOYunkSample collected from dead, recent fledgling, in nesting area. Skin Yes LA 76 Elanoides f. forficatus 35964 United States Carroll Dr. nest, Lacombe, St. Tammany Parish, Louisiana YOYM Sample collected at nest. Blood Yes LA 78 Elanoides f. forficatus 35974 United States Ormond nest, Pearl River, St. Tammany Parish, Louisiana YOYM Sample collected at nest. Blood Yes LA 79 Elanoides f. forficatus 35974 United States Blackwell's Trailer nest, Pearl River, St. Tammany Parish, Louisiana YOYM Sample collected at nest. Blood Yes LA 81 Elanoides f. forficatus 35974 United States Boque Chitto NWR nest, Talisheek, St. Tammany Parish, Louisiana YOYM Sample collected at nest. Blood Yes

PAGE 89

89Table A-1 (cont.) Sample name Species Date of collection Country Location of collection* Age SexBreeding, measurement, or collection Information** Tissue Certain breeder?*** SC CC1 Elanoides f. forficatus 35947 United States Cedar Creek nest, Charleston Co., South Carolina unk unkSample collected at nest. Blood Yes SC W1158 Elanoides f. forficatus 35947 United States Francis Marion NF nest, Berkeley Co., South Carolina unk unkSample collected at nest. Blood Yes SC # 2 Elanoides f. forficatus 36678 United States Big Lake nest, Horry Co., South Carolina unk unkSample collected at nest. Blood Yes SC Dead Elanoides f. forficatus 36708 United States Black Mingo nest, Georgetown Co., South Carolina YOYunkSample collected from dead nestling below nest. Liver Yes GA 18 Elanoides f. forficatus Summer 2000 United States Satilla River nest, Brantley Co., Georgia YOYM Sample collected at nest. Blood Yes GA 19 Elanoides f. forficatus Summer 2000 United States McIntosh Co. nest, Georgia YOYM Sample collected at nest. Blood Yes GA 20 Elanoides f. forficatus Summer 2000 United States Steed nest, Brantley Co., Georgia YOYM Sample collected at nest. Blood Yes AL 27 Elanoides spp. 23484 United States Monroe Co., Alabama A F Specimen "Coll. by Lonnie Williamson, prep.& descr.by R.W. Skinner. E.f.yetapa?" Skin Yes B1 Elanoides f. yetapa 36126 Brazil Vitor's nest, Florianopolis, Santa Catarina YOYunkSample collected at nest. Blood Yes

PAGE 90

90Table A-1 (cont.) Sample name Species Date of collection Country Location of collection* Age SexBreeding, measurement, or collection Information** Tissue Certain breeder?*** B2 Elanoides f. yetapa 36126 Brazil Vitor's nest, Florianopolis, Santa Catarina A F Sample collected at nest. Parent of B1. Blood Yes B3 Elanoides f. yetapa 36131 Brazil Campana nest, Dourados, Mato Grosso do Sul YOYunkSample collected at nest. Blood Yes B4 Elanoides f. yetapa 36140 Brazil Secc1 nest, between Caceres & Cuiaba, Mato Grosso YOYunkSample collected at nest. Blood Yes B5 Elanoides f. yetapa 36141 Brazil Secc2 nest, between Caceres & Cuiaba, Mato Grosso YOYunkSample collected at nest. Blood Yes B6 Elanoides f. yetapa 36146 Brazil Quarry2 nest, Florianopolis, Santa Catarina YOYunkSample collected at nest. Blood Yes B7 Elanoides f. yetapa 36527 Brazil Rancho Alegre nest, Engenho near Cuiaba, Mato Grosso YOYunkSample collected at nest. Blood Yes B8 Elanoides f. yetapa 36495 Brazil Florianopolis, Santa Catarina A M Sample taken from bird found dying near local nesting area. Gonads 3X5 & 2X6mm Liver No

PAGE 91

91Table A-1 (cont.) Sample name Species Date of collection Country Location of collection* Age SexBreeding, measurement, or collection Information** Tissue Certain breeder?*** B-bone Elanoides f. yetapa 36528 Brazil Rancho Alegre dead, Engenho near Cuiaba, Mato Grosso YOYunkSample taken from nestling found dead in nesting area. Bone Yes B1-00 Elanoides f. yetapa 36867 Brazil Palmital nest 1, Barra dos Bugres, Mato Grosso YOYunkSample collected at nest. Blood Yes B2-00 Elanoides f. yetapa 36867 Brazil Palmital nest 2, Barra dos Bugres, Mato Grosso YOYunkSample collected at nest. Blood Yes B3-00 Elanoides f. yetapa 36868 Brazil Palmital nest 3, Barra does Bugres, Mato Grosso YOYunkSample collected at nest. Blood Yes B4-00 Elanoides f. yetapa 36868 Brazil Palmital nest 4, Barra dos Bugres, Mato Grosso YOYunkSample collected at nest. Blood Yes B5-00 Elanoides f. yetapa 36871 Brazil Casa Verde nest 1, Casa Verde, Mato Grosso do Sul YOYunkSample collected at nest. Blood Yes B6-00 Elanoides f. yetapa 36871 Brazil Casa Verde nest 2, Casa Verde, Mato Grosso do Sul YOYunkSample collected at nest. Blood Yes

PAGE 92

92Table A-1 (cont.) Sample name Species Date of collection Country Location of collection* Age SexBreeding, measurement, or collection Information** Tissue Certain breeder?*** B7-00 Elanoides f. yetapa 36871 Brazil Casa Verde nest 3, Casa Verde, Mato Grosso do Sul YOYunkSample collected at nest. Blood Yes B8-00 Elanoides f. yetapa 36871 Brazil Casa Verde nest 4, Casa Verde, Mato Grosso do Sul YOYunkSample collected at nest. Blood Yes B9-00 Elanoides f. yetapa 33555 Brazil Paranagua, Rio Guaraguacu, Parana A F Specimen "Gonads 15X8 [cm:?]; Varios ovos 4mm. Cranium quase ossif. Coll. M. Bornschein"" Heart Yes B10-00 Elanoides f. yetapa 36874 Brazil Carijos nest 1, Florianopolis, Santa Catarina YOYunkSample collected at nest. Blood Yes B11-00 Elanoides f. yetapa 36874 Brazil Carijos nest 2, Florianopolis, Santa Catarina YOYunkSample collected at nest. Blood Yes B-Flor Elanoides f. yetapa 11/01/00? Brazil Florianopolis, Santa Catarina A unkSample taken from bird found dying near local nesting area. Liver No B-QF Elanoides f. yetapa 36146 Brazil Quarry1 nest, Florianopolis, Santa Catarina A unkSample collected from nest with eggs. Feather Yes BSF Elanoides f. yetapa 36526 Brazil Secc'00 nest, between Caceres & Cuiaba, Mato Grosso unk unkSample collected from nest with nestling. Feather Yes

PAGE 93

93Table A-1 (cont.) Sample name Species Date of collection Country Location of collection* Age SexBreeding, measurement, or collection Information** Tissue Certain breeder?*** GF1 Elanoides f. yetapa 33025 GuatemalaTikal unk unkSample collected from ground under roost of birds in local nesting area during nesting season. Feather Yes GF2 Elanoides f. yetapa 33025 GuatemalaTikal unk unkSample collected from ground under roost of birds in local nesting area during nesting season. Feather Yes GF3 Elanoides f. yetapa 33025 GuatemalaTikal unk unkSample collected from ground under roost of birds in local nesting area during nesting season. Feather Yes GF4 Elanoides f. yetapa 33025 GuatemalaTikal unk unkSample collected from ground under roost of birds in local nesting area during nesting season. Feather Yes GW1 Elanoides f. yetapa 36302 GuatemalaMundo Perdido nest, Tikal YOYunkSample collected from dead nestling in nest. Skinwet Yes GW2 Elanoides f. yetapa 36303 GuatemalaPlaza Mayor nest, Tikal YOYunkSample collected at nest. Blood Yes GW3 Elanoides f. yetapa 36305 GuatemalaPlaza Mayor nest, Tikal A F Sample collected at nest. Parent of G-W2 Blood Yes GW4 Elanoides f. yetapa 36307 GuatemalaUaxactun YOYunkSample collected at nest. Blood Yes GW5 Elanoides f. yetapa 36308 GuatemalaPlaza Mayor nest, Tikal A M Sample collected at nest. Parent of G-W2 Blood Yes CR-1 Elanoides f. yetapa 7486 Costa Rica Navaritto A F Specimen Skin No

PAGE 94

94Table A-1 (cont.) Sample name Species Date of collection Country Location of collection* Age SexBreeding, measurement, or collection Information** Tissue Certain breeder?*** CR-2 Elanoides f. yetapa 7447 Costa Rica Navaritto A F Specimen "skin on breast thickened" Skin Yes G-4 Elanoides f. yetapa 9264 GuatemalaFinca Sepacuite A M Specimen Skin Yes P-5 Elanoides f. yetapa 9287 Panama Cerro Largo A M Specimen; "W Panama, Cape Mala Peninsula; 1200 alt." Skin No P-6 Elanoides f. yetapa 9313 Panama Cerro Largo A M Specimen; "W Panama, Cape Mala Peninsula; 1200 alt." Skin No S-7 Elanoides f. yetapa 8018 Surinam Lelydorp ("Lelqosp" on tag?) A M Specimen Skin Yes V-9 Elanoides f. yetapa 7/7/1897 Venezuela Valle A M Specimen "lat/long= 6.16N/61.38.60W 1312 feet" Skin No V-10 Elanoides f. yetapa 4/8/1895 Venezuela Valle A F Specimen "lat/long= 6.16N/61.38.60W 1312 feet" Skin No V-11 Elanoides f. yetapa 1297 Venezuela Valle A M Specimen "lat/long= 6.16N/61.38.60W 1312 feet" Skin No V-12 Elanoides f. yetapa 6/22/1895Venezuela Merida, Culata A M Specimen Skin No V-13 Elanoides f. yetapa 4/1/1894 Venezuela Merida, Greril A unkSpecimen Skin No V-14 Elanoides f. yetapa 4/27/1896Venezuela Sucupana A F Specimen "53x122" ovary; specimen plumage in molt or worn plumage w/ missing 6th rectrix. Skin Yes V-15 Elanoides f. yetapa 4/27/1896Venezuela Sucupana A F Specimen "54x114" ovary Skin Yes

PAGE 95

95Table A-1 (cont.) Sample name Species Date of collection Country Location of collection* Age SexBreeding, measurement, or collection Information** Tissue Certain breeder?*** V-16 Elanoides f. yetapa 4/27/1896Venezuela Sucupana A F Specimen "34x14.5" ovary Skin Yes V-17 Elanoides f. yetapa 7/22/1896Venezuela San Antonio, Bermudez A unkSpecimen Skin No V-21 Elanoides f. yetapa 33079 Venezuela Bolivar A F Specimen "40 km E. of Tumaremo on rd. to Bochinche; ovary 12x15, follicle approx. 1mm; no moult" Skinwet No E-26 Elanoides f. yetapa 33803 Ecuador ZamoraChinchipe A M Specimen "ne San Francisco de Panguri; gonads 15x5mm" Skin Yes C-28 Elanoides f. yetapa 21300 Columbia Depto. Valle del Cauca A M Specimen "Rio Anchicaya km. 72, Lat N3.65 Long W76.933, elev. 1900 ft., testis 11 mm" Skin Yes M-29 Elanoides f. yetapa 18370 Mexico Chiapas A M Specimen "28 mi. ese Comitan de Dominguez,N16.094W91.7391 4900 ft.;Coll. FA Pitelka;testis 9 mm" Skin Yes C-39 Elanoides f. yetapa 14217 Columbia El Tambo, Cerro Munchique A F Specimen "6500 ft." Skin Yes C-40 Elanoides f. yetapa 14217 Columbia El Tambo, Cerro Munchique A M Specimen "6000 ft." Skin Yes C-41 Elanoides f. yetapa 14230 Columbia El Tambo, Cerro Munchique A M Specimen "6600 ft." Skin Yes C-42 Elanoides f. yetapa 14217 Columbia El Tambo, Cerro Munchique A M Specimen Skin Yes

PAGE 96

96Table A-1 (cont.) Sample name Species Date of collection Country Location of collection* Age SexBreeding, measurement, or collection Information** Tissue Certain breeder?*** CR-43 Elanoides f. yetapa 3785 Costa Rica Limon, Limon A M Specimen Skin No H-44 Elanoides f. yetapa 12960 Honduras Copan A M Specimen "gonads fully enlarged" Skin Yes H-45 Elanoides f. yetapa 12960 Honduras Copan A F Specimen "gonads fully enlarged" Skin Yes P-46 Elanoides f. yetapa 24221 Panama Volcan de Chiriqui, near El Hate A M Specimen "gonads 11x6mm;" Lat N084900 Long W0823800 Skin Yes A-47 Elanoides f. yetapa 6332 Argentina Misiones, Pto. Segundo A M Specimen "Coll. J Mogenson" Skin Yes Bel-48 Elanoides f. yetapa 2674 British Honduras Sitte R. A M Specimen Skin No CR-50 Elanoides f. yetapa 3106 Costa Rica El General A M Specimen "Coll. C.F. Underwood" Skin No G-51 Elanoides f. yetapa 9294 GuatemalaFinca Sepacuite A M Specimen "Coll. A.W. Anthony" Skin No M-52 Elanoides f. yetapa 3021 Mexico Saltillo A F Specimen "parent of set of eggs in my collection. Coll. J Johnson" Skin Yes S-54 Elanoides f. yetapa 8020 Surinam Scholelweg, Lelydorp A F Specimen Skin Yes S-55 Elanoides f. yetapa 8038 Surinam Scholelweg, Lelydorp A F Specimen Skin Yes V-56 Elanoides f. yetapa 3785 Venezuela Merida Region, Cupas A M Specimen "3000 ft.; Coll. Gabaldon e hijos" Molting. Skin No V-57 Elanoides f. yetapa 2364 Venezuela Merida Region, Culata A M Specimen "3000 ft.; blue eyes; Coll. Gabaldon e hijos" Skin No

PAGE 97

97Table A-1 (cont.) Sample name Species Date of collection Country Location of collection* Age SexBreeding, measurement, or collection Information** Tissue Certain breeder?*** V-58 Elanoides f. yetapa 3037 Venezuela Merida, Culata A M Specimen "elev. 2500 ft.; blue eyes; Coll. Gabaldon e hijos" Plumage indicates age 1.5 years. Skin No V-59 Elanoides f. yetapa 4188 Venezuela Merida region YOYunkSpecimen; YOY; tail 10-12cm; "blue eyes" Skin Yes Bel-61 Elanoides f. yetapa 20638 Belize Orange walk District:Gallon Jug A M Specimen; largest gonad 10X5mm (size drawn on tag) Skin Yes M-62 Elanoides f. yetapa 19104 Mexico Chiapas A F Specimen "Pueblo Nuevo Solistahuacan, Rancho Nuevo Mundo;1900m elev." Skin Yes M-63 Elanoides f. yetapa 21335 Mexico Chiapas A M Specimen "Villa Allende Tolemayla, 20 km to the northeast; Coll. W.J.Sheffler" Skin Yes Per-64 Elanoides f. yetapa 22868 Peru Ucayali Dept: Yarinacocha A F Specimen; eastern Peru;"ovary 32 mm, largest ova 4mm" Skin Yes CR-65 Elanoides f. yetapa 19129 Costa Rica Puntarenas A F Specimen "Buenos Aires, Las Animas, ovary enlarged; Coll.? Paul Slud" Skin Yes G-66 Elanoides f. yetapa 11416 GuatemalaPeten, Uaxactun A F Specimen "ready to lay (shelled egg in oviduct); Coll.? J. Van Tyne" Skin Yes M-67 Elanoides f. yetapa 4856 Mexico Campeche A M Specimen "Champoton, Esperanza; Coll.? PW Shufeldt" Skin Yes M-68 Elanoides f. yetapa 4856 Mexico Campeche A F Specimen "Champoton, Esperanza; Coll.? PW Shufeldt" Skin Yes

PAGE 98

98Table A-1 (cont.) Sample name Species Date of collection Country Location of collection* Age SexBreeding, measurement, or collection Information** Tissue Certain breeder?*** M-69 Elanoides f. yetapa 4856 Mexico Campeche A M Specimen "Champoton, Esperanza; Coll.? PW Shufeldt" Skin Yes M-70 Elanoides f. yetapa 4856 Mexico Campeche A M Specimen "Champoton, Esperanza; Coll.? PW Shufeldt" Skin Yes S-71 Elanoides f. yetapa 17344 Surinam Republick A F Specimen; near Paramaribo? Coll.? "Francois Haverschmidt" Skin No E-73 Elanoides f. yetapa 11094 Ecuador MindoOccidentale A M Specimen "Coll. Ollala and Sons" Skin No CR-74 Elanoides f. yetapa 4/14/1899Costa Rica Cartago Prov. A M Specimen "Turrialba" Skin No CR-75 Elanoides f. yetapa 188 Costa Rica Cartago Prov. A F Specimen "Turrialba" Skin No Guy-76 Elanoides f. yetapa 3/1/1890 Guyana West DemeraraEssequibo Coast Dist. A F Specimen "Demerara River" Skin No Guy-77 Elanoides f. yetapa 6/1/1891 Guyana Abary A F Specimen "lat 063300N long 0574400 W" Skin No V-79 Elanoides f. yetapa 4945 Venezuela Merida Prov. A M Specimen "Cordillera de Los Culata; blue eyes" Skin No C-81 Elanoides f. yetapa 17648 Columbia Antioquia; Taraza, Rio Taraza YOYF Specimen; Bajo Cauca Province; <1yr. old based on plumage; "12 km NW Pto. Antioquia" Skin No C-82 Elanoides f. yetapa 17302 Columbia Bolivar; Volador A M Specimen "25 mi. w of Simiti;" plumage molt Skin No

PAGE 99

99Table A-1 (cont.) Sample name Species Date of collection Country Location of collection* Age SexBreeding, measurement, or collection Information** Tissue Certain breeder?*** C-83 Elanoides f. yetapa 15318 Columbia Caqueta; Morelia A M Specimen Skin Yes C-85 Elanoides f. yetapa 15880 Columbia Norte de Santander; Convencion A F Specimen; plumage molt Skin No CR-86 Elanoides f. yetapa 3023 Costa Rica Bonilla A M Specimen Skin No CR-87 Elanoides f. yetapa 3023 Costa Rica Bonilla A M Specimen Skin No H-89 Elanoides f. yetapa 6/15/1887Honduras Segovia River A unkSpecimen Skin No V-91 Elanoides f. yetapa 17696 Venezuela Monagas, Cairara A F Specimen; Probably Caicara; "Female gonads slightly enlarged" Skin No V-92 Elanoides f. yetapa 1215 Venezuela Merida; Culata A M Specimen; "3000m" Skin No CR-93 Elanoides f. yetapa 26053 Costa Rica Puntarenas, Helechales A F Specimen "15 km ene Potrero Grande; ovary 20x12mm; Lgst. follicle 4mm2; incomplt oss., 1600 m" Skin Yes CR-94 Elanoides f. yetapa 24609 Costa Rica San Jose, San Gerardo A F Specimen "Canaan 4500 ft." Skin No CR-95 Elanoides f. yetapa 24609 Costa Rica San Jose, San Gerardo A M Specimen "Canaan 4500 ft." Skin No M-96 Elanoides f. yetapa 23115 Mexico Chiapas A M Specimen "Comitan, Rio Lacantun, 85 km east" Skin Yes

PAGE 100

100Table A-1 (cont.) Sample name Species Date of collection Country Location of collection* Age SexBreeding, measurement, or collection Information** Tissue Certain breeder?*** CR-97 Elanoides f. yetapa 10038 Costa Rica Limon Prov. A? M Specimen "Suretka, lat N093600, W 0825800; Coll. Austin Paul Smith" 6-14 months of age based on plumage. Skin No CR-98 Elanoides f. yetapa 10038 Costa Rica Limon Prov. A F Specimen "Suretka, lat N093600, W 0825800; Coll. Austin Paul Smith" Skin No B-101 Elanoides f. yetapa 10529 Brazil Rio Grande do Sul; Lagoa do Forro A F Specimen "near Torreo, sea level, egg with hard shell" Green & purple iridescence N/A N/A Ber-102 Elanoides f. forficatus 20896 Bermuda unk A F Specimen "ovary well developed; found dead" N/A N/A FL-103 Elanoides f. forficatus 35199 United States Bar-D (Steve's) nest, Highlands Co., Central Florida A F Bird caught near nest. N/A N/A FL-104 Elanoides f. forficatus 36318 United States Osceola 263 nest, Columbia Co., North Florida A F Bird caught near nest. N/A N/A FL-105 Elanoides f. forficatus 36664 United States Lower Wekiva nest, Central Florida A M Bird caught near nest. N/A N/A FL-106 Elanoides f. forficatus 36676 United States Tiger Creek nest, Polk Co., Central Florida A M Bird caught near nest. N/A N/A FL-107 Elanoides f. forficatus 36766 United States Lake Woodruff nest, Central Florida A F Bird caught near nest. N/A N/A

PAGE 101

101Table A-1 (cont.) Sample name Species Date of collection Country Location of collection* Age SexBreeding, measurement, or collection Information** Tissue Certain breeder?*** FL-108 Elanoides f. forficatus 37047 United States Road 5 nest, Levy Co., North Florida A M Bird caught near nest. N/A N/A GA-109 Elanoides f. forficatus 37414 United States Gill Bay nest, Georgia A F Bird caught near nest. N/A N/A GA-110 Elanoides f. forficatus 37779 United States Thalman nest, Georgia A M Bird caught near nest. N/A N/A GA-111 Elanoides f. forficatus 37792 United States Steed nest, Brantley Co., Georgia A F Bird caught near nest. N/A N/A GA-113 Elanoides f. forficatus 38520 United States Alex Creek 052 nest, AHY#1, Georgia A F Bird caught near nest. N/A N/A GA-114 Elanoides f. forficatus 38530 United States Alex Creek 052 nest, AHY#2, Georgia A M Bird caught near nest. N/A N/A FL-115 Elanoides f. forficatus 471 United States Osceola Co., Florida A M Specimen; Coll. Mearns; "Big Cypress Lake; Mated with [176959]" N/A N/A FL-116 Elanoides f. forficatus 471 United States Osceola Co., Florida A F Specimen; Coll. Mearns;"Big Cypress Lake; Egg 14mm; Mated with [176960]" N/A N/A FL-117 Elanoides f. forficatus 474 United States Osceola Co., Florida A F Specimen; Coll. Mearns; "Big Cypress Lake; Mated with [176961]" N/A N/A FL-118 Elanoides f. forficatus 474 United States Brevard Co., Florida A M Specimen; Coll. Mearns; "Padgett creek; Mated with [176962]" N/A N/A FL-119 Elanoides f. forficatus 7754 United States Lee Co., Florida A F Specimen; Coll. Weber; "large yolks" N/A N/A

PAGE 102

102Table A-1 (cont.) Sample name Species Date of collection Country Location of collection* Age SexBreeding, measurement, or collection Information** Tissue Certain breeder?*** FL-120 Elanoides f. forficatus 7/18/1888United States Chatham Bend, Monroe Co., Florida YOYF Specimen; plumage indicates less than 6 months of age N/A N/A FL-121 Elanoides f. forficatus 5/13/1892United States Old Town, Florida A M Specimen; plumage indicates approx. 1 year old N/A N/A FL-122 Elanoides f. forficatus 489 United States Kissimmee River, Florida A M Specimen; plumage indicates approx. 1 year old N/A N/A M-123 Elanoides f. y.? 10/1875 Mexico Tehnontepec, Cacoprieto YOYunkSpecimen; plumage indicates less than 6 months of age; "Juv., female?, E.f.f." N/A No FL-124 Elanoides f. forficatus unk United States unk A unkSpecimen; plumage indicates approx. 1 year old N/A N/A Guy125 Elanoides f. y.? unk British Guiana unk YOYunkSpecimen; plumage indicates less than 6 months of age N/A No G-126 Elanoides f. y.? unk Guatemalaunk YOYunkSpecimen; plumage indicates less than 6 months of age; "E.f.f." N/A No Pernis Pernis apivorus unk unk unk unk unkunk Blood N/A Elan10 Elanus caeruleus unk unk unk unk unkunk Blood N/A Miss Ictinia mississippiensis unk unk unk unk unkunk Liver N/A Elan8 Elanus caeruleus unk unk unk unk unkunk Blood N/A Skin sample is dry unless otherwise note d. Wet skin, bone, & organ sample s stored in buffer or alcohol. Unk= Unknown. AHY= Adult, YOY= Young of the year. *If specimen, lo cation information from museum tag. ** Paraphrased tag information is in quotes. *** Yes, if genetic analyses considered this sample as definite member of breeding population where collected.

PAGE 103

103 Table A-2. Sample contributor, populat ion designations, and accession numbers Sample name Museum/ Contributor Museum record # Dataset Biol. pop. Sub pop. CladeGene. pop. Genbank accession #s FL 0500 N/A N/A CR Breeder Long, CR Breeder Short, CR ALL Short, ENOL, ALD2, LDH2, ORN2, Morph N D N N EU012029; EU012099; EU012100; EU012118; EU012126; EU012132 FL 0601 N/A N/A ORN2 N/A N/A N/A N/A EU012118 FL 0800 N/A N/A CR Breeder Long, CR Breeder Short, CR ALL Short, ENOL, ALD2, LDH2, ORN2 N D N N EU012030; EU012099; EU012118; EU012126; EU012127; EU012132 FL 1001 N/A N/A LDH2, ORN2 N/A N/A N/A N/A EU012118; EU012127 FL 0900 N/A N/A CR Breeder Long, CR Breeder Short, CR ALL Short, ENOL, ALD2, LDH2, ORN2 N D N N EU012028; EU012099; EU012118; EU012126; EU012127; EU012132 FL 1000 N/A N/A CR Breeder Long, CR Breeder Short, CR ALL Short, ALD2, LDH2, ORN2 N D N N EU012036; EU012099; EU012100; EU012118; EU012126; EU012127 FL 0199 N/A N/A CR Breeder Long, Cytb, CR Breeder Short, CR ALL Short, LAM, ENOL, ORN2 N D N N EU012031; EU012092; EU012097; EU012098; EU012118; EU012132 FL 0598 N/A N/A CR Breeder Long, CR Breeder Short, CR ALL Short, LAM, ENOL, ALD2, ORN2 N D N N EU012032; EU012098; EU012099; EU012118; EU012132 FL 0299 N/A N/A CR Breeder Long, Cytb, CR Breeder Short, CR ALL Short, LAM, ENOL, ALD2, ORN2, Morph N D N N EU012038; EU012091; EU012098; EU012099; EU012100; EU012118; EU012132 FL 31 N/A N/A CR Breeder Long, CR Breeder Short, CR ALL Short, LAM, ENOL, ALD2, LDH2, ORN2 N B N N EU012040; EU012098; EU012099; EU012118; EU012126; EU012127; EU012132

PAGE 104

104Table A-2 (cont.) Sample name Museum/ Contributor Museum record # Dataset Biol. pop. Sub pop. CladeGene. pop. Genbank accession #s FL 7 N/A N/A CR Breeder Long, CR Breeder Short, CR ALL Short, LAM, ENOL, ORN2 N B N N EU012037; EU012098; EU012118; EU012132 FL 17 N/A N/A CR Breeder Long, CR Breeder Short, CR ALL Short, LAM, ENOL, ORN2 N A N N EU012039; EU012098; EU012118; EU012132 FL 10 N/A N/A CR Breeder Long, CR Breeder Short, CR ALL Short, LAM, ENOL, ORN2 N B N N EU012038; EU012098; EU012118; EU012119; EU012132 FL 39 N/A N/A CR Breeder Long, CR Breeder Short, CR ALL Short, LAM, ENOL, ORN2 N B N N EU012038; EU012098; EU012118; EU012132 FL 43 N/A N/A CR Breeder Long, CR Breeder Short, CR ALL Short, LAM, ENOL, ORN2 N C N N EU012041; EU012098; EU012118; EU012132 FL 11 N/A N/A CR Breeder Long, CR Breeder Short, CR ALL Short, LAM, ENOL, ORN2 N C N N EU012045; EU012098; EU012118; EU012132 FL 15 N/A N/A CR Breeder Long, CR Breeder Short, CR ALL Short, LAM, ENOL, ORN2 N C N N EU012045; EU012098; EU012118; EU012132 FL 8 N/A N/A CR Breeder Long, CR Breeder Short, CR ALL Short, LAM, ENOL, ORN2 N C N N EU012030; EU012098; EU012118; EU012132 FL 0898 N/A N/A CR Breeder Long, CR Breeder Short, CR ALL Short, LAM, ENOL, ORN2 N D N N EU012032; EU012098; EU012118; EU012132

PAGE 105

105Table A-2 (cont.) Sample name Museum/ Contributor Museum record # Dataset Biol. pop. Sub pop. CladeGene. pop. Genbank accession #s FL 2398 N/A N/A CR Breeder Long, CR Breeder Short, CR ALL Short, LAM, ENOL, ORN2 N D N N EU012032; EU012098; EU012118; EU012132 FL 2198 N/A N/A CR Breeder Long, CR Breeder Short, CR ALL Short, LAM, ENOL, ALD2, ORN2 N E N N EU012035; EU012098; EU012099; EU012118; EU012132 FL 1898 N/A N/A CR Breeder Long, CR Breeder Short, CR ALL Short, LAM, ENOL, ORN2 N E N N EU012034; EU012098; EU012118; EU012132 FL 9 N/A N/A CR Breeder Long, CR Breeder Short, CR ALL Short, LAM, ENOL, ALD2, ORN2 N B N N EU012038; EU012098; EU012099; EU012118; EU012132 FL 1398 N/A N/A CR Breeder Long, CR Breeder Short, CR ALL Short, LAM, ENOL, ALD2, ORN2 N D N N EU012033; EU012098; EU012099; EU012118; EU012132 FL 1198 N/A N/A CR Breeder Long, CR Breeder Short, CR ALL Short, LAM, ENOL, ORN2 N D N N EU012030; EU012098; EU012118; EU012132 FL 2298 N/A N/A CR Breeder Long, CR Breeder Short, CR ALL Short, LAM, ENOL, ALD2, ORN2 N C N N EU012036; EU012098; EU012099; EU012118; EU012132 FL Museum FLMNH 39359 CR Breeder Short, CR ALL Short N/A N/A N N/A bp100-234 of EU012028 LA 76 Jennifer O. Coulson, Tulane University N/A CR Breeder Long, CR Breeder Short, CR ALL Short, LAM, ENOL, ORN2 N H N N EU012029; EU012098; EU012118; EU012132

PAGE 106

106Table A-2 (cont.) Sample name Museum/ Contributor Museum record # Dataset Biol. pop. Sub pop. CladeGene. pop. Genbank accession #s LA 78 Jennifer O. Coulson, Tulane University N/A CR Breeder Long, Cytb, CR Breeder Short, CR ALL Short, LAM, ENOL, ORN2 N H N N EU012031; EU012092; EU012098; EU012118; EU012132 LA 79 Jennifer O. Coulson, Tulane University N/A CR Breeder Long, CR Breeder Short, CR ALL Short, LAM, ENOL, ALD2, ORN2 N H N N EU012039; EU012098; EU012099; EU012118; EU012132 LA 81 Jennifer O. Coulson, Tulane University N/A CR Breeder Long, CR Breeder Short, CR ALL Short, LAM, ENOL, ALD2, ORN2 N H N N EU012045; EU012098; EU012099; EU012118; EU012132 SC CC1 SCDNR/ SCCBP N/A CR Breeder Long, CR Breeder Short, CR ALL Short, LAM, ENOL, ORN2 N G N N EU012033; EU012098; EU012118; EU012132 SC W1158 SCDNR/ SCCBP N/A CR Breeder Long, CR Breeder Short, CR ALL Short, LAM, ENOL, ALD2, ORN2 N G N N EU012038; EU012097; EU012098; EU012118; EU012124; EU012126; EU012132 SC # 2 SCDNR/ SCCBP N/A CR Breeder Long, CR Breeder Short, CR ALL Short, LAM, ENOL, ALD2, ORN2 N G N N EU012043; EU012098; EU012099; EU012100; EU012118; EU012132 SC Dead SCDNR/ SCCBP N/A CR Breeder Long, Cytb, CR Breeder Short, CR ALL Short, LAM, ENOL, ALD2, ORN2 N G N N EU012042; EU012090; EU012098; EU012099; EU012118; EU012132 GA 18 N/A N/A CR Breeder Long, CR Breeder Short, CR ALL Short, LAM, ENOL, ALD2, ORN2 N F N N EU012044; EU012098; EU012099; EU012118; EU012132

PAGE 107

107Table A-2 (cont.) Sample name Museum/ Contributor Museum record # Dataset Biol. pop. Sub pop. CladeGene. pop. Genbank accession #s GA 19 N/A N/A CR Breeder Long, CR Breeder Short, CR ALL Short, LAM, ENOL, ALD2, ORN2 N F N N EU012038; EU012098; EU012099; EU012100; EU012118; EU012132 GA 20 N/A N/A CR Breeder Long, CR Breeder Short, CR ALL Short N F N N EU012030 AL 27 AUNHMLC B-662 CR Breeder Short, CR ALL Short, Morph N/A N/A N N bp100-234 of EU012043 B1 N/A N/A CR Breeder Long, Cytb, CR Breeder Short, CR ALL Short, LAM, ENOL, LDH2, ORN2 S Z S S EU012050; EU012094; EU012098; EU012122; EU012129; EU012130; EU012132 B2 N/A N/A ALD2, Morph N/A N/A N/A S EU012101; EU012103 B3 N/A N/A CR Breeder Long, Cytb, CR Breeder Short, CR ALL Short, LAM, ENOL, ALD2, LDH2, ORN2 S W S S EU012051; EU012093; EU012098; EU012101; EU012102; EU012122; EU012127; EU012128; EU012132 B4 N/A N/A CR Breeder Long, Cytb, CR Breeder Short, CR ALL Short, LAM, ENOL, ALD2, ORN2 S U C C EU012052; EU012095; EU012098; EU012101; EU012102; EU012122; EU012132; EU012133 B5 N/A N/A CR Breeder Long, CR Breeder Short, CR ALL Short, LAM, ENOL, ALD2, LDH2, ORN2 S U C C EU012053; EU012098; EU012101; EU012103; EU012122; EU012123; EU012130; EU012132 B6 N/A N/A CR Breeder Long, CR Breeder Short, CR ALL Short, LAM, ENOL, ALD2, ORN2 S Z S S EU012054; EU012098; EU012101; EU012102; EU012122; EU012132

PAGE 108

108Table A-2 (cont.) Sample name Museum/ Contributor Museum record # Dataset Biol. pop. Sub pop. CladeGene. pop. Genbank accession #s B7 N/A N/A CR Breeder Long, Cytb, CR Breeder Short, CR ALL Short, LAM, ENOL, ALD2, LDH2, ORN2 S T C C EU012055; EU012096; EU012098; EU012101; EU012102; EU012122; EU012129; EU012130; EU012132 B8 M. Azevedo N/A CR ALL Short, Cytb, LAM, ENOL, ALD2, LDH2, ORN2 N/A N/A S N/A EU012056; EU012094; EU012098; EU012101; EU012122; EU012127; EU012128; EU012132 B-bone N/A N/A CR Breeder Short, CR ALL Short, ORN2 N/A N/A C N/A bp100-234 of EU012047; EU012122 B1-00 N/A N/A CR Breeder Long, CR Breeder Short, CR ALL Short, LAM, ENOL, ALD2, LDH2, ORN2 S S C C EU012057; EU012098; EU012101; EU012103; EU012122; EU012126; EU012127; EU012132 B2-00 N/A N/A CR Breeder Long, CR Breeder Short, CR ALL Short, LAM, ENOL, ALD2, LDH2, ORN2 S S C C EU012058; EU012098; EU012101; EU012122; EU012125; EU012130; EU012132 B3-00 N/A N/A CR Breeder Long, CR Breeder Short, CR ALL Short, LAM, ENOL, ALD2, ORN2 S S C C EU012059; EU012098; EU012101; EU012103; EU012122; EU012126; EU012130; EU012132 B4-00 N/A N/A CR Breeder Long, CR Breeder Short, CR ALL Short, LAM, ENOL, ALD2, ORN2 S S C C EU012060; EU012098; EU012101; EU012122; EU012132 B5-00 N/A N/A CR Breeder Long, CR Breeder Short, CR ALL Short, LAM, ENOL, ALD2, LDH2, ORN2 S X C S EU012061; EU012098; EU012101; EU012103; EU012122; EU012126; EU012130; EU012132

PAGE 109

109Table A-2 (cont.) Sample name Museum/ Contributor Museum record # Dataset Biol. pop. Sub pop. CladeGene. pop. Genbank accession #s B6-00 N/A N/A CR Breeder Long, CR Breeder Short, CR ALL Short, LAM, ENOL, ALD2, LDH2, ORN2 S X S S EU012066; EU012098; EU012101; EU012103; EU012122; EU012129; EU012130; EU012132 B7-00 N/A N/A CR Breeder Long, CR Breeder Short, CR ALL Short, LAM, ENOL, ALD2, ORN2 S X S S EU012062; EU012098; EU012101; EU012122; EU012129; EU012130; EU012132 B8-00 N/A N/A CR Breeder Long, CR Breeder Short, CR ALL Short, LAM, ENOL, ALD2, ORN2 S X S S EU012063; EU012098; EU012101; EU012122; EU012131; EU012133 B9-00 MHNCI ML1047 & ML4497 CR Breeder Long, CR Breeder Short, CR ALL Short, ALD2, ORN2, Morph S Y S S EU012064; EU012101; EU012103; EU012122; EU012120 B10-00 N/A N/A CR Breeder Long, CR Breeder Short, CR ALL Short, LAM, ENOL, ALD2, LDH2, ORN2 S Z S S EU012065; EU012098; EU012101; EU012103; EU012122; EU012126; EU012132 B11-00 N/A N/A CR Breeder Long, CR Breeder Short, CR ALL Short, LAM, ENOL, ALD2, LDH2, ORN2 S Z S S EU012066; EU012098; EU012101; EU012102; EU012122; EU012130; EU012132 B-Flor M. Azevedo N/A CR ALL Short, ALD2, LDH2, ORN2 N/A N/A S N/A EU012056; EU012101; EU012122; EU012127; EU012128 B-QF N/A N/A CR Breeder Short, CR ALL Short, ORN2 N/A N/A S N/A bp100-234 of EU012066; EU012122 BSF N/A N/A CR Breeder Long, CR Breeder Short, CR ALL Short, ORN2 S U C C EU012067; EU012122

PAGE 110

110Table A-2 (cont.) Sample name Museum/ Contributor Museum record # Dataset Biol. pop. Sub pop. CladeGene. pop. Genbank accession #s GF1 RP Gerhardt N/A CR Breeder Short, CR ALL Short N/A N/A C N/A bp100-234 of EU012061 GF2 RP Gerhardt N/A CR Breeder Short, CR ALL Short, ORN2 N/A N/A C N/A bp100-234 of EU012061; EU012122 GF3 RP Gerhardt N/A CR Breeder Short, CR ALL Short, ORN2 N/A N/A C N/A EU012077; EU012122 GF4 RP Gerhardt N/A CR Breeder Short, CR ALL Short, ORN2 N/A N/A C N/A bp100-234 of EU012061; EU012122 GW1 N/A N/A CR Breeder Long, Cytb, CR Breeder Short, CR ALL Short, LAM, ENOL, ALD2, LDH2, ORN2 C M C C EU012046; EU012095; EU012098; EU012101; EU012103; EU012122; EU012129; EU012132 GW2 N/A N/A Cytb N/A N/A C N/A EU012096 GW3 N/A N/A CR Breeder Long, CR Breeder Short, CR ALL Short, LAM, ENOL, ALD2, LDH2, ORN2, Morph C M C C EU012047; EU012098; EU012101; EU012122; EU012126; EU012130; EU012132; EU012134 GW4 N/A N/A CR Breeder Long, CR Breeder Short, CR ALL Short, LAM, ENOL, ALD2, LDH2, ORN2 C M C C EU012048; EU012098; EU012101; EU012122; EU012127; EU012128; EU012131; EU012132 GW5 N/A N/A CR Breeder Long, CR Breeder Short, CR ALL Short, LAM, ENOL, ALD2, LDH2, ORN2, Morph C M C C EU012049; EU012098; EU012101; EU012122; EU012126; EU012130; EU012131; EU012134 CR-1 AMNH 389187 CR ALL Short, Morph N/A N/A C C EU012085 CR-2 AMNH 389189 CR Breeder Short, CR ALL Short, Morph N/A N/A C C bp100-234 of EU012067

PAGE 111

111Table A-2 (cont.) Sample name Museum/ Contributor Museum record # Dataset Biol. pop. Sub pop. CladeGene. pop. Genbank accession #s G-4 AMNH 393653 CR Breeder Short, CR ALL Short, Morph N/A N/A C C bp100-234 of EU012061 P-5 AMNH 233115 CR ALL Short, Morph N/A N/A C C EU012068 P-6 AMNH 233116 CR ALL Short, Morph N/A N/A C C bp100-234 of EU012047 S-7 AMNH 313399 CR Breeder Short, CR ALL Short, Morph N/A N/A C C EU012069 V-9 AMNH 469962 CR ALL Short N/A N/A C N/A bp100-234 of EU012047 V-10 AMNH 469963 CR ALL Short N/A N/A C N/A bp100-234 of EU012067 V-11 AMNH 352044 CR ALL Short N/A N/A C N/A bp100-234 of EU012061 V-12 AMNH 469959 CR ALL Short N/A N/A C N/A bp100-234 of EU012061 V-13 AMNH 469960 CR ALL Short N/A N/A C N/A EU012070 V-14 AMNH 132353 CR Breeder Short, CR ALL Short N/A N/A C N/A bp100-234 of EU012067 V-15 AMNH 132354 CR Breeder Short, CR ALL Short, Morph N/A N/A C C bp100-234 of EU012047 V-16 AMNH 132355 CR Breeder Short, CR ALL Short, Morph N/A N/A C C EU012071 V-17 AMNH 73542 CR ALL Short N/A N/A C N/A bp100-234 of EU012047 V-21 AMNH rop270 CR ALL Short, LDH2, ORN2, Morph N/A N/A S S bp100-234 of EU012066; EU012122; EU012121; EU012130

PAGE 112

112Table A-2 (cont.) Sample name Museum/ Contributor Museum record # Dataset Biol. pop. Sub pop. CladeGene. pop. Genbank accession #s E-26 ANSP 185071 CR Breeder Short, CR ALL Short, ORN2 N/A N/A C N/A bp100-234 of EU012067; EU012122 C-28 MVZ 138096 CR Breeder Short, CR ALL Short, Morph N/A N/A C N/A bp100-234 of EU012061 M-29 MVZ 120955 CR Breeder Short, CR ALL Short, Morph N/A N/A C N/A bp100-234 of EU012061 C-39 FMNH 101978 CR Breeder Short, CR ALL Short N/A N/A C N/A bp100-234 of EU012067 C-40 FMNH 101977 CR Breeder Short, CR ALL Short N/A N/A C N/A EU012077 C-41 FMNH 101975 CR Breeder Short, CR ALL Short N/A N/A C N/A EU012072 C-42 FMNH 101976 CR Breeder Short, CR ALL Short N/A N/A C N/A bp100-234 of EU012067 CR-43 FMNH 44038 CR ALL Short N/A N/A C N/A EU012073 H-44 FMNH 100932 CR Breeder Short, CR ALL Short N/A N/A C N/A EU012073 H-45 FMNH 100931 CR Breeder Short, CR ALL Short N/A N/A C N/A EU012078 P-46 FMNH 324635 CR Breeder Short, CR ALL Short N/A N/A C N/A EU012074 A-47 MCZ 99661 CR Breeder Short, CR ALL Short, Morph N/A N/A S N/A bp100-234 of EU012051 Bel-48 MCZ 119742 CR ALL Short N/A N/A C N/A EU012077 CR-50 MCZ 120792 CR ALL Short N/A N/A C N/A EU012077 G-51 MCZ 145658 CR ALL Short N/A N/A C N/A bp100-234 of EU012061

PAGE 113

113Table A-2 (cont.) Sample name Museum/ Contributor Museum record # Dataset Biol. pop. Sub pop. CladeGene. pop. Genbank accession #s M-52 MCZ 309708 CR Breeder Short, CR ALL Short, Morph N/A N/A C N/A EU012075 S-54 MCZ 143030 CR Breeder Short, CR ALL Short N/A N/A C N/A bp100-234 of EU012060 S-55 MCZ 143031 CR Breeder Short, CR ALL Short N/A N/A C N/A bp100-234 of EU012060 V-56 MCZ 92584 CR ALL Short N/A N/A S N/A bp100-234 of EU012051 V-57 MCZ 92580 CR ALL Short N/A N/A C N/A EU012076 V-58 MCZ 92583 CR ALL Short, ORN2, Morph N/A N/A S N/A bp100-234 of EU012051; EU012122 V-59 MCZ 92582 CR Breeder Short, CR ALL Short N/A N/A C N/A bp100-234 of EU012061 Bel-61 LSU 22588/ B-37224 CR Breeder Short, CR ALL Short N/A N/A C N/A EU012077 M-62 LSU 39149/ B-37226 CR Breeder Short, CR ALL Short N/A N/A C N/A bp100-234 of EU012061 M-63 LSU 61026/ B-37227 CR Breeder Short, CR ALL Short N/A N/A C N/A EU012078 Per-64 LSU 28192/B37225 CR Breeder Short, CR ALL Short, ORN2 N/A N/A C N/A EU012079; EU012122 CR-65 UMMZ 132060 CR Breeder Short, CR ALL Short, Morph N/A N/A C C bp100-234 of EU012047 G-66 UMMZ 70084 CR Breeder Short, CR ALL Short, Morph N/A N/A C C bp100-234 of EU012049 M-67 UMMZ 136851 CR Breeder Short, CR ALL Short N/A N/A C N/A bp100-234 of EU012047 M-68 UMMZ 136852 CR Breeder Short, CR ALL Short N/A N/A C N/A bp100-234 of EU012049

PAGE 114

114Table A-2 (cont.) Sample name Museum/ Contributor Museum record # Dataset Biol. pop. Sub pop. CladeGene. pop. Genbank accession #s M-69 UMMZ 136853 CR Breeder Short, CR ALL Short N/A N/A C N/A bp100-234 of EU012061 M-70 UMMZ 136854 CR Breeder Short, CR ALL Short N/A N/A C N/A bp100-234 of EU012067 S-71 UMMZ 116631 CR ALL Short N/A N/A C N/A bp100-234 of EU012061 E-73 MLZ 4706 CR ALL Short N/A N/A C N/A bp100-234 of EU012061 CR-74 ROM JHF 26410/ CN 35647 CR ALL Short N/A N/A C N/A EU012080 CR-75 ROM JHF 11425/ CN 35645 CR ALL Short N/A N/A C N/A bp100-234 of EU012060 Guy-76 ROM JHF 1434/CN 35644 CR ALL Short N/A N/A C N/A bp100-234 of EU012060 Guy-77 ROM AN 26.11.1.180 CR ALL Short N/A N/A C N/A bp100-234 of EU012060 V-79 ROM JHF 31688/ CN 35648 CR ALL Short N/A N/A C N/A EU012081 C-81 USNM 401194 CR ALL Short, Morph(iridescence only) N/A N/A S N/A EU012082 C-82 USNM 391860 CR ALL Short; Morph(iridescence only) N/A N/A S N/A EU012083 C-83 USNM 524077 CR Breeder Short, CR ALL Short, Morph N/A N/A C C EU012069 C-85 USNM 372341 CR ALL Short, Morph N/A N/A S S EU012084 CR-86 USNM 209843 CR ALL Short, Morph N/A N/A C C EU012085

PAGE 115

115Table A-2 (cont.) Sample name Museum/ Contributor Museum record # Dataset Biol. pop. Sub pop. CladeGene. pop. Genbank accession #s CR-87 USNM 209844 CR ALL Short, Morph N/A N/A C C bp100-234 of EU012060 H-89 USNM 112244 CR ALL Short N/A N/A C N/A EU012086 V-91 USNM 406415 CR ALL Short, Morph N/A N/A C C EU012087 V-92 USNM 190326 CR ALL Short, Morph N/A N/A S S bp100-234 of EU012050 CR-93 WFVZ 20201 CR Breeder Short, CR ALL Short, ORN2, Morph N/A N/A C C bp100-234 of EU012067; EU012122 CR-94 WFVZ 18555 CR ALL Short N/A N/A C N/A bp100-234 of EU012047 CR-95 WFVZ 18556 CR ALL Short N/A N/A C N/A EU012088 M-96 WFVZ 10884 CR Breeder Short, CR ALL Short N/A N/A C N/A bp100-234 of EU012060 CR-97 YPM 55686 CR ALL Short N/A N/A S N/A EU012089 CR-98 YPM 55685 CR ALL Short N/A N/A S N/A bp100-234 of EU012066 B-101 AMNH 313887 Morph N/A N/A N/A S N/A Ber-102 AMNH 788956 Morph N/A N/A N/A N N/A FL-103 N/A N/A Morph N/A N/A N/A N N/A FL-104 N/A N/A Morph N/A N/A N/A N N/A FL-105 N/A N/A Morph N/A N/A N/A N N/A FL-106 N/A N/A Morph N/A N/A N/A N N/A FL-107 N/A N/A Morph N/A N/A N/A N N/A FL-108 N/A N/A Morph N/A N/A N/A N N/A GA-109 N/A N/A Morph N/A N/A N/A N N/A GA-110 N/A N/A Morph N/A N/A N/A N N/A GA-111 N/A N/A Morph N/A N/A N/A N N/A GA-113 N/A N/A Morph N/A N/A N/A N N/A

PAGE 116

116Table A-2 (cont.) Sample name Museum/ Contributor Museum record # Dataset Biol. pop. Sub pop. CladeGene. pop. Genbank accession #s GA-114 N/A N/A Morph N/A N/A N/A N N/A FL-115 USNM 176960 Morph N/A N/A N/A N N/A FL-116 USNM 176959 Morph N/A N/A N/A N N/A FL-117 USNM 176962 Morph N/A N/A N/A N N/A FL-118 USNM 176961 Morph N/A N/A N/A N N/A FL-119 USNM 414222 Morph N/A N/A N/A N N/A FL-120 USNM 146854 No datasetImmature specimen, used to help determine size limits for morphology dataset. N/A N/A N/A N/A N/A FL-121 USNM 126344 Immature specimen, used to help determine size limits for morphology dataset and for iridescence data. N/A N/A N/A N/A N/A FL-122 USNM 176963 Immature specimen, used to help determine size limits for morphology dataset and for iridescence data. N/A N/A N/A N/A N/A M-123 USNM 76987 No datasetImmature specimen, used to help determine size limits for morphology dataset. N/A N/A N/A N/A N/A FL-124 USNM 146855 Immature specimen, used to help determine size limits for morphology dataset and for iridescence data. N/A N/A N/A N/A N/A Guy-125 USNM 131938 No datasetImmature specimen, used to help determine size limits for morphology dataset. N/A N/A N/A N/A N/A

PAGE 117

117Table A-2 (cont.) Sample name Museum/ Contributor Museum record # Dataset Biol. pop. Sub pop. CladeGene. pop. Genbank accession #s G-126 USNM 103378 No datasetImmature specimen, used to help determine size limits for morphology dataset. N/A N/A N/A N/A N/A Pernis Dr. Andreas Helbig unk CR Breeder Long, Cytb, CR Breeder Short, CR ALL Short, LDH2, ORN2 N/A N/A N/A N/A EU012113; EU012115; AY987242; X86758 Elan10 Dr. Andreas Helbig unk ENOL, LDH2, ORN2 N/A N/A N/A N/A EU012105; EU012111; EU012112; EU012114 Miss SCCBP N/A Cytb, ENOL, ORN2 N/A N/A N/A N/A EU012104; EU012108; EU012117 Elan8 Dr. Andreas Helbig unk CR Breeder Long, CR Breeder Short, CR ALL Short, ENOL, ORN2 N/A N/A N/A N/A EU012106; EU012107; EU012109; EU012110; EU012116 Biol.Pop.= Biological Population assignment; Subpop.= Subpopulati on assignment; Gene.Pop.= Genetic Population; Unk= Unknown; Contributors include: Andreas He lbig, Institute of Zoology, University of Greifswald, Vogelwarte Hiddensee, D18565 Kloster, Germany; Jennifer O. Coulson, Ph.D., Department of Ecology and Evolutionary Biology, Tulane University; Rick Gerhardt, The Peregrine Fund; AUN HMLC= Auburn University Natural History Museum and Learning Center; MCZ= Museum of Comparative Zoology at Harvard; MHNCI= Museo de Historia Natural Capao Imbuia; MLZ= Moore Laboratory of Zoology at Occidental College; MVZ= University of California, Museum of Ve rtebrate Zoology; SCDNR= South Carolina Dept. Natural Resources (John Cely); SCCBP= South Carolina Center for Birds of Prey (Jim Elliott); UMMZ= University of Michigan Museum of Zoology; USNM= Di vision of Birds, National Museum of Natural History; YPM= Yale Peabody Museum; FLMNH= Florida Museum of Natu ral History; ANSP= Academy of Natural Sciences of Philadephia; FMNH= Field Museum of Natural History; LSU= Louisiana State University Museum of Natural Science; AMNH= American Museum of Natural History; ROM= Royal Ontario Museum ; WFVZ= Western Foundation of Vertebrate Zoology.

PAGE 118

118 APPENDIX B PCR CONDITIONS FOR EACH LOCUS

PAGE 119

119Table B-1. PCR conditions for each locus Label of genetic region PCR recipe in ul (50 ul total reaction) 10x Buffer \ 25mM MgCl2 \ 2mM DNTPs \ 50 uM each Primer \ 5u/ul Taq \ 50ng/ul DNA Thermal cycler program C0/Minutes Cytb 5 \ 3 \ 5 \ 0.25 \ 0.25 \ 2 Requires 250 mM KCL 8.0 8.5 pH buffer. 95/1. Then 35 cycles: 94/0.75; 51/0.75; 72/0.5. Then 72/3. CRdbox 5 \ 3 \ 5 \ 0.5 \ 0.5 \ 2 95/2. Then 35 cycles 94/0.75; 55/1; 72/1. Then 72/5. CRpredbox 5 \ 3 \ 5 \ 0.6 \ 0.5 \ 2 95/2. Then 35 cycles 94/0.75; 57/1; 72/1. Then 72/5. CRshort 5 \ 2 \ 5 \ 0.6 \ 0.5 \ 2 plus 4ul BSA (10mg/ml). Best with 250 mM KCL buffer. 95/10 (if using taq gold). Then 40 cycles: 94/0.75; 47/0.75; 72/0.5. Then 72/10 LAM 5 \ 5 \ 5 \ 1 \ 0.25 \ 2 95/1. Then 35 cycles: 94/0.75; 63/0.5; 72/0.75. Then 72/1. ORN 5 \ 4 \ 5 \ 0.1 \ 0.5 \ 2 95/1. Then 35 cycles: 94/1; 57/0.75; 72/1. Then 72/3. ORN2 12 \ 7 \ 12 \ 0.1 \ 0.5 \ 2 95/1. Then 35 cycles: 94/0.75; 48/0.5; 72/0.75. Then 72/1. ENOL 5 \ 5 \ 2.5 \ 0.2 \ 0.25 \ 2 95/1. Then 35 cycles: 94/0.75; 64/0.5; 72/0.75. Then 72/1. LDH 5 \ 4 \ 5 \ 0.1 \ 0.5 \ 2 95/1. Then 35 cycles: 94/1; 57/0.75; 72/1. Then 72/3. LDH2 12 \ 5 \ 12 \ 0.1 \ 0.5 \ 2 95/1. Then 35 cycles: 94/0.75; 57/0.5; 72/0.75. Then 72/1. ALD 10 \ 8 \ 10 \ 0.2 \ 0.5 \ 2 95/1. Then 35 cycles: 94/1; 60/0.75; 72/1. Then 72/3. ALD2 10 \ 5 \ 10 \ 0.15 \ 0.6 \ 2 95/1. Then 35 cycles: 94/0.75; 63/0.5; 72/0.75. Then 72/1.

PAGE 120

120 APPENDIX C MORPHOLOGICAL RAW DATA

PAGE 121

121Table C-1. Morphological raw data Sample name; "Measurement taker" Subsp. Gene. pop. RegionDry or fresh Molt? Age >14 months?* Tail female in mm Tail male in mm Wing ch. female in mm Wing ch. male in mm Irides. A-47; "Museum" yetapa S sSA Dry No^ Yes 290 411 unk. AL 27; "Museum" forficatus N N Dry No 320 405 unk. AL 27; "Collector" forficatus N N Fresh No 319 412 unk. B-101; "AW" yetapa S sSA Dry No Yes 324 435 g & p B2; "AW" yetapa S sSA Fresh No Yes 340 418 p B9-00, "Museum" yetapa S sSA Dry No Yes 310 380 p Ber-102; "AW" forficatus N N Dry No Yes 308 441 unk. Ber-102; "Collector" forficatus N N Fresh No Yes 337 447 unk. C-28; "Museum" yetapa C nSA Dry No Yes 255 401.5 unk. C-81; "AW" yetapa S sSA Dry No No 225 p & g C-82; "AW" yetapa S sSA Dry Yes Yes n/a n/a n/a n/a p & g C-83; "AW" yetapa C nSA Dry No Yes 276 g C-85; "AW" yetapa S sSA Dry No^ Yes 290 g & p CR-1; "AW" yetapa C CA Dry No 295 424 g CR-2; "AW" yetapa C CA Dry No Yes 298 413 g CR-65; "Museum" yetapa C CA Dry No Yes 334 434 unk. CR-86; "AW" yetapa C CA Dry No Yes 305 433 g CR-87; "AW" yetapa C CA Dry No Yes 320 438 g CR-93; "Museum" yetapa C CA Dry No Yes 329 429 unk. CR-97; "Museum" yetapa n/a n/a Dry No No 271 385 dull FL0299; "KM" forficatus N N Fresh No Yes 331 434 unk. FL0500; "KM" forficatus N N Fresh No Yes 359 446 unk. FL-103; "KM" forficatus N N Fresh No Yes 336 443 unk. FL-104; "KM" forficatus N N Fresh No Yes 311 411 unk. FL-105; "KM" forficatus N N Fresh No Yes 318 425 unk. FL-106; "KM" forficatus N N Fresh No Yes 335 410 unk.

PAGE 122

122Table C-1 (cont.) Sample name; "Measurement taker" Subsp. Gene. pop. RegionDry or fresh Molt? Age >14 months?* Tail female in mm Tail male in mm Wing ch. female in mm Wing ch. male in mm Irides. FL-107; "KM" forficatus N N Fresh No Yes 352 428 unk. FL-108; "KM" forficatus N N Fresh No Yes 321 432 unk. FL-115; "AW" forficatus N N Dry No Yes 330 435 p FL-115; "Collector" forficatus N N Fresh No Yes 360 440 p FL-116; "AW" forficatus N N Dry No Yes 335 442 p FL-116; "Collector" forficatus N N Fresh No Yes 370 447 p FL-117; "AW" forficatus N N Dry No Yes 350 453 p FL-117; "Collector" forficatus N N Fresh No Yes 382 455 p FL-118; "AW" forficatus N N Dry No Yes 320 430 p FL-118; "Collector" forficatus N N Fresh No Yes 358 435 p FL-119; "AW" forficatus N N Dry No Yes 313 431 p FL-120; "AW" forficatus n/a n/a Dry No No 252 dull FL-121; "AW" forficatus N N Dry Yes No 272 p FL-122; "AW" forficatus N N Dry Yes No 254 p FL-124; "AW" forficatus N N Dry Yes No 253 -sex unk. p GW5; "AW" yetapa C CA Fresh No Yes 314 430 g G-126; "AW" yetapa? n/a n/a Dry No No 275 -sex unk. unk. G-4; "AW" yetapa C CA Dry No 308 429 unk. G-66; "Museum" yetapa C CA Dry No Yes 330 414 unk. GA-109; "KM" forficatus N N Fresh No Yes 334 432 unk. GA-110; "KM" forficatus N N Fresh No Yes 309 425 unk. GA-111; "KM" forficatus N N Fresh No Yes 332 432 unk. GA-113; "KM" forficatus N N Fresh No Yes 362 440 unk. GA-114; "KM" forficatus N N Fresh No Yes 306 404 unk. Guy-125; "AW" yetapa? n/a n/a Dry No No 251 -sex unk. dull G-W3; "AW" yetapa C CA Fresh No Yes 353 431 g

PAGE 123

123Table C-1 (cont.) Sample name; "Measurement taker" Subsp. Gene. pop. RegionDry or fresh Molt? Age >14 months?* Tail female in mm Tail male in mm Wing ch. female in mm Wing ch. male in mm Irides. M-123; "AW" yetapa? n/a n/a Dry No No 268 if Female young M-29; "Museum" yetapa C CA Dry No Yes 329 421.5 unk. M-52; "Museum" yetapa C CA Dry No Yes 322 412 unk. P-5; "AW" yetapa C CA Dry No 313 422 unk. P-6; "AW" yetapa C CA Dry No 305 400 unk. S-7; "AW" yetapa C nSA Dry No 283 400 unk. V-15; "AW" yetapa C nSA Dry No Yes 286 398 unk. V-16; "AW" yetapa C nSA Dry No Yes 308 422 unk. V-21;"AW" yetapa S sSA Fresh No 325 425 unk. V-56; "Museum" yetapa n/a n/a Dry Yes Yes 226 374 unk. V-58; "Museum" yetapa S sSA Dry No Yes 255 389 unk. V-91; "AW" yetapa C nSA Dry No Yes 290 417 g & p V-92; "AW" yetapa S sSA Dry No Yes 300 407 p & g Friedmann(1950); "Fried" forficatus N N Dry No? unk 343-370 (356) 328-343 (334) 436-445 (440) 423-436 (431) unk. Friedmann(1950); "Fried" yetapa unk. unk. Dry No? unk 275-326 (304) 298-330 (318) 390427(411) 405-447 (418) unk. Snyder & Wiley(1976); "?" forficatus N N Fresh? No? Probably 428.4 420.8 unk. Measurement takers include the collector of specimen (Collector), museum staff (Mu seum), author of previous morphological s tudy Friedmann, or one of the authors of this paper (KM or AW ). Friedmann (1950) sample size is 8 males and 12 females for E.f. forficatus ; 26 males and 14 females for E.f. yetapa Snyder and Wiley (1976) sample size is 26 males and 24 females. Subsp.=Subspecies; Gene.Pop=Genetic Population assignment; Dry or Fresh refers to condition of tis sue when measured; Wing Ch=Wing Chord; unk.=unknown. *Based on knowledge of breeding or plumage trailing edge coloration; ^Bird in molt, however, where longest feath ers retained, measurement used. <> Based on tail length. Irides.= iridescence. P= purple. G= green.

PAGE 124

124 APPENDIX D PHYLOGENETIC TREES

PAGE 125

125 Figure D-1. NJ tree based on CR Breeder Long dataset B1 B5-00 B1-00 B2-00 Elanus FL0900 Pernis FL1000,FL2298 FL7 FL0500,LA76 FL0299,FL10,FL39,FL9,SCW1-158,GA19 FL43 FL2198 FL1898 FL1398,SC-CC1 FL0199,LA78 FL0598,FL0898,FL2398 FL0800,FL8,FL1198,GA20 FL11,FL15,LA81 FL17,LA79 FL31 SC Dead GA18 SC#2 G-W5 G-W4 G-W3 G-W1 B10-00 B5 B4 B7-00 B4-00 B-SF B6 B3-00 B7 B8-00 B3 B11-00,B6-00 B9-00 100 100 100 87 74 80 100 76 96 B1 B5-00 B1-00 B2-00 Elanus FL0900 Pernis FL1000,FL2298 FL7 FL0500,LA76 FL0299,FL10,FL39,FL9,SCW1-158,GA19 FL43 FL2198 FL1898 FL1398,SC-CC1 FL0199,LA78 FL0598,FL0898,FL2398 FL0800,FL8,FL1198,GA20 FL11,FL15,LA81 FL17,LA79 FL31 SC Dead GA18 SC#2 G-W5 G-W4 G-W3 G-W1 B10-00 B5 B4 B7-00 B4-00 B-SF B6 B3-00 B7 B8-00 B3 B11-00,B6-00 B9-00 100 100 100 87 74 80 100 76 96

PAGE 126

126 Figure D-2. NJ tree based on CR Breeder Short dataset Elan8 Pernis Elan8Elanus FL0598,FL0898,FL2398, FL0500,LA76, FL0800,FL1000,FL8,FL1198,FL2298,GA20 FL7 -FL2198 FL0299,FL10,FL39,FL43,FL9,FL1398, SCCC1,SC W1-158,GA19 FL0199,LA78, FL31,FL17,FL11,FL15,FL1898,LA79,LA81,SC#2,S C Dead,GA18,AL27 FL0900,FL Museum W5,G66,M68 G-W1 G-W4 B4 B5 B7 B-SF,CR2,V14,E26,CR93,C39,C42,M70 V16 B4-00,S54,S55,M96 B3-00 B2-00 B1-00 GF1,GF2,GF4,C28,M29,V59,B5-00,G4,M62,M69 H44 GF3,Bel-61,C40 H45,M63 P46 B-bone,G-W3,V15,CR65,M67 B1 Per64 M52 B3,B7-00,A47 B6 B8-00 B9-00 B6-00,B11-00,B-QF B10-00 95 100 71 92 71 95 S7,C83 C41Elan8 Pernis Elan8Elanus FL0598,FL0898,FL2398, FL0500,LA76, FL0800,FL1000,FL8,FL1198,FL2298,GA20 FL7 -FL2198 FL0299,FL10,FL39,FL43,FL9,FL1398, SCCC1,SC W1-158,GA19 FL0199,LA78, FL31,FL17,FL11,FL15,FL1898,LA79,LA81,SC#2,S C Dead,GA18,AL27 FL0900,FL Museum W5,G66,M68 G-W1 G-W4 B4 B5 B7 B-SF,CR2,V14,E26,CR93,C39,C42,M70 V16 B4-00,S54,S55,M96 B3-00 B2-00 B1-00 GF1,GF2,GF4,C28,M29,V59,B5-00,G4,M62,M69 H44 GF3,Bel-61,C40 H45,M63 P46 B-bone,G-W3,V15,CR65,M67 B1 Per64 M52 B3,B7-00,A47 B6 B8-00 B9-00 B6-00,B11-00,B-QF B10-00 95 100 71 92 71 95 S7,C83 C41 S7,C83 C41 C41

PAGE 127

127 Figure D-3. NJ tree based on CR All Short dataset Elan8 100 Elanus Pernis FL0900,FL Museum FL0500,LA76 FL0199,LA78 FL0299,FL10,FL39,FL43,FL9,FL1398,SCCC1,SC W1-158,GA19 FL0598,FL0898,FL2398, FL0800,FL1000,FL8,FL1198,FL2298,GA20 FL7 FL31,FL17,FL11,FL15,FL1898,AL27,GA18,SC Dead,SC #2,LA81,LA79 FL2198 G-W4 G-W5,G66,M68 B1-00 B2-00 B4 B5 B7 G-W1 B3-00 P5 S7,C83 V13 V16 V57 C41 CR43,H44 P46 CR74 CR1,CR86 M52 GF3,C40,Bel48,CR50,Bel61 H45,M63 Per64 B-SF,CR2,V10,V14,E26,C39,C42,M70,CR93 GF1,GF2,GF4,G4,V11,V12,E73,M69,S71,C28,M29,M 62,G51,V59,B5-00 H89 V91 B-bone,G-W3,P6,V9,V15,V17,CR65,M67,CR64 CR95 B4-00,S54,S55,CR75,Guy76,Guy77,CR87,M96 V79 B1,V92 B6 B9-00 B10-00 B3,B8,B7-00,B-Flor, A47,V56,V58 C81 C82 C85 CR97 B6-00,B11-00,B-QF,V21,CR98 B8-00 96 90 72 89 70 100 Elan8 100 Elanus Pernis FL0900,FL Museum FL0500,LA76 FL0199,LA78 FL0299,FL10,FL39,FL43,FL9,FL1398,SCCC1,SC W1-158,GA19 FL0598,FL0898,FL2398, FL0800,FL1000,FL8,FL1198,FL2298,GA20 FL7 FL31,FL17,FL11,FL15,FL1898,AL27,GA18,SC Dead,SC #2,LA81,LA79 FL2198 G-W4 G-W5,G66,M68 B1-00 B2-00 B4 B5 B7 G-W1 B3-00 P5 S7,C83 V13 V16 V57 C41 CR43,H44 P46 CR74 CR1,CR86 M52 GF3,C40,Bel48,CR50,Bel61 H45,M63 Per64 B-SF,CR2,V10,V14,E26,C39,C42,M70,CR93 GF1,GF2,GF4,G4,V11,V12,E73,M69,S71,C28,M29,M 62,G51,V59,B5-00 H89 V91 B-bone,G-W3,P6,V9,V15,V17,CR65,M67,CR64 CR95 B4-00,S54,S55,CR75,Guy76,Guy77,CR87,M96 V79 B1,V92 B6 B9-00 B10-00 B3,B8,B7-00,B-Flor, A47,V56,V58 C81 C82 C85 CR97 B6-00,B11-00,B-QF,V21,CR98 B8-00 96 90 72 89 70 100

PAGE 128

128 Literature Cited Ab'Saber, A. N. 1977. Espaos ocupados pela expa nso dos climas secos na Amrica do Sul, por ocasio dos perodos glacia is. Paleoclimas 3:1-19. Alerstam, T., A. Hedenstrom, and S. Akess on. 2003. Long-distance migration: evolution and determinants. Oikos 103:247-260. Assine, M. L., and P. C. Soares. 2004. Quater nary of the Pantanal, west-central Brazil. Quaternary International 114:23-34. Avise, J. C., and W. S. Nelson. 1989. Molecular genetic relationships of the extinct dusky seaside sparrow. Science 243:646-648. Avise, J. C., and D. Walker. 1998. Pleistocene phylogeographic effects on avian populations and the speciation process. Proceedings of th e Royal Society of London Series B-Biological Sciences 265:457-463. Baker, A. J. 2002. The deep roots of bird migrat ion: Inferences from the historical record preserved in DNA. Ardea 90:503-513. Baker, A. J., and H. D. Marshall. 1997. Mitoch ondrial control region se quences as tools for understanding evolution. Pp. 51-82 in D. P. Mindell, ed. Avian Molecular Evolution and Systematics. Academic Press, San Diego. Baker, C. S., L. Medrano-Gonzalez, J. Calambokidi s, A. Perry, F. Pichler, H. Rosenbaum, J. M. Straley, J. Urban-Ramirez, M. Yamaguc hi, and O. Von Ziegesar. 1998. Population structure of nuclear and m itochondrial DNA variation among humpback whales in the North Pacific. Molecular Ecology 7:695-707. Baker, C. S., S. R. Palumbi, R. H. Lambertse n, M. T. Weinrich, J. Calambokidis, and S. J. Obrien. 1990. Influence of seasonal mi gration on geographic distribution of mitochondrial DNA haplotypes in humpback whales. Nature 344:238-240. Baker, C. S., A. Perry, J. L. Bannister, M. T. Weinrich, R. B. Abernethy, J. Calambokidis, J. Lien, R. H. Lambertsen, J. U. Ramirez, O. Vasquez, P. J. Clapham, A. Alling, S. J. Obrien, and S. R. Palumbi. 1993. Abundant mitochondrial DNA variation and worldwide population structure in humpback whales. Proceedings of the National Academy of Sciences of the United Stat es of America 90:8239-8243. Baker, J. M., E. Lopez-Medrano, A. G. Navarro-Siguenza, O. R. Rojas-Soto, and K. E. Omland. 2003. Recent speciation in the orchard oriole group: Divergence of Icterus spurius spurius and Icterus spurius fuertesi Auk 120:848-859. Baker, R. R. 1978. The Evolutionary Ecol ogy of Animal Migration. Hodder & Stoughton, London. Ballard, J. W. O., and M. C. Whitlock. 2004. The incomplete natural history of mitochondria. Molecular Ecology 13:729-744. Ball, R. M., and J. C. Avise. 1992. Mitoc hondrial DNA phylogeographi c differentiation among avian populations and the evolutionary significance of subspecies. Auk 109:626-636. Ball, R. M., S. Freeman, F. C. James, E. Be rmingham, and J. C. Avise. 1988. Phylogeographic population structure of red-winged bl ackbirds assessed by mitochondrial DNA. Proceedings of the National Academy of Scie nces of the United States of America 85:1558-1562. Baum, D. A., and M. J. Donoghue. 1995. Choosi ng among alternative phylogenetic species concepts. Systematic Botany 20:560-573.

PAGE 129

129 Bearhop, S., W. Fiedler, R. W. Furness, S. C. Votier, S. Waldron, J. Newton, G. J. Bowen, P. Berthold, and K. Farnsworth. 2005. Assortat ive mating as a mechanism for rapid evolution of a migratory divide. Science 310:502-504. Belichon, S., J. Clobert, and M. Massot. 1996. Ar e there differences in fitness components between philopatric and disper sing individuals? Acta Oecologica-Internat ional Journal of Ecology 17:503-517. Bell, C. P. 2000. Process in the evolution of bi rd migration and pattern in avian ecogeography. Journal of Avian Biology 31:258-265. Belliure, J., G. Sorci, A. P. Moller, and J. Cl obert. 2000. Dispersal distances predict subspecies richness in birds. Journal of Evolutionary Biology 13:480-487. Bensch, S. 1999. Is the range size of migrator y birds constrained by their migratory program? Journal of Biogeography 26:1225-1235. Bensch, S., T. Andersson, and S. Akesson. 1999. Morphological and molecular variation across a migratory divide in willow warblers, Phylloscopus trochilus Evolution 53:1925-1935. Bensch, S., D. Hasselquist, B. Nielsen, and B. Hansson. 1998. Higher fitness for philopatric than for immigrant males in a semi-isolated popul ation of great reed warblers. Evolution 52:877-883. Bergmann, C. 1847. ber die verhltnisse der wrmekonomie der thiere zu ihrer grsse. Gttinger Studien, Gttingen 3:595-708. Berthold, P. 1996. Control of bird mi gration. Chapman and Hall, London. Berthold, P. 1999. A comprehensive theory for the e volution, control and ad aptability of avian migration. Ostrich 70:1-11. Berthold, P. 2001. Bird migration: a general su rvey, 2nd edn. Oxford University Press, New York. Berthold, P., A. J. Helbig, G. Mohr, and U. Querner. 1992. Rapid microevolution of migratory behavior in a wild bird species. Nature 360:668-670. Berthold, P., and S. B. Terrill. 1991. Recent adva nces in studies of bird migration. Annual Review of Ecology and Systematics 22:357-378. Bickford, D., D. J. Lohman, N. S. Sodhi, P. K. L. Ng, R. Meier, K. Winker, K. K. Ingram, and I. Das. 2007. Cryptic species as a window on di versity and conservation. Trends in Ecology and Evolution 22:148-155. Bildstein, K. L. 2004. Raptor migration in the neot ropics: Patterns, processes, and consequences. Ornitologia Neotropical 15:83-99. Bhning-Gaese, K., L. I. Gonzalez-Guzman, and J. H. Brown. 1998. Constr aints on dispersal and the evolution of the avifauna of the Northern Hemisphere. Evolutionary Ecology 12:767783. Both, C., S. Bouwhuis, C. M. Lessells, and M. E. Visser. 2006. Climat e change and population declines in a long-distance mi gratory bird. Nature 441:81-83. Bowen, B. W., A. B. Meylan, J. P. Ross, C. J. Limpus, G. H. Balazs, and J. C. Avise. 1992. Global population structure and natural history of the green turtle (Chelonia mydas) in terms of matriarchal phy logeny. Evolution 46:865-881. Briskie, J. V. 1996. Lack of sperm storage by female migrants and the significance of copulations en rout e. Condor 98:414-417. Brower, A. V. Z., and M. M. Jeansonne. 2004. Geographical populations and "subspecies" of new world monarch butterflies (Nymphalidae) share a recent origin and are not phylogenetically distinct. Annals of the En tomological Society of America 97:519-523.

PAGE 130

130 Brower, L. P., and R. M. Pyle. 2004. The interc hange of migratory monarchs between Mexico and the western United States, and the importan ce of floral corridors to the fall and spring migrations in G. Nabhan, ed. Conserving migratory pol linators and nectar corridors in western North America. Universi ty of Arizona Press, Tucson. Brown, K. S. J. 1986. Zoogeografia da regio do Pantanal Mato-Grossense. Pp. 137-178. Anais do 1 simpsio sobre recursos naturais e scio-econmicos do Pantanal. EMBRAPACPAP, Braslia. Brown, L. H., and D. and Amadon. 1968. Eagles, ha wks, and falcons of the world. McGraw-Hill, New York. Buehler, D. M., and A. J. Baker. 2005. Populatio n divergence times and historical demography in red knots and dunlins. Condor 107:497-513. Buerkle, C. A. 1999. The historic al pattern of gene flow am ong migratory and nonmigratory populations of prairie warblers (Ave s: Parulinae). E volution 53:1915-1924. Burckle, L. H. 1993. Late quaternary interglacial stages warmer than present. Quaternary Science Reviews 12:825-831. Burg, T. M., and J. P. Croxall. 2001. Global re lationships amongst black-browed and greyheaded albatrosses: analysis of populat ion structure using mitochondrial DNA and microsatellites. Molecular Ecology 10:2647-2660. Bush, M. B. 1994. Amazonian speciationa necessarily complex model. Journal of Biogeography 21:5-17. Cain, M. L., B. G. Milligan, and A. E. Stra nd. 2000. Long-distance seed dispersal in plant populations. American Journal of Botany 87:1217-1227. Calambokidis, J., G. H. Steiger, J. M. Straley, L. M. Herman, S. Cerchio, D. R. Salden, J. Urban, J. K. Jacobsen, O. von Ziegesar, K. C. Balc omb, C. M. Gabriele, M. E. Dahlheim, S. Uchida, G. Ellis, Y. Miyamura, P. L. de Guev ara, M. Yamaguchi, F. Sato, S. A. Mizroch, L. Schlender, K. Rasmussen, J. Barlow, and T. J. Quinn. 2001. Movements and population structure of humpback whales in the North Paci fic. Marine Mammal Science 17:769-794. Capparella, A. P. 1988. Genetic va riation in Neotropical birds: implications for the speciation process. Proceedings of the Intern ational Ornithological Congress 19:1658. Carr, A., and P. J. Coleman. 1974. Seafloor spreadi ng theory and the odysse y of the green turtle. Nature 249:128-130. Cheviron, Z. A., S. J. Hackett, and A. P. Ca pparella. 2005. Complex evolutionary history of a neotropical lowla nd forest bird ( Lepidothrix coronata ) and its implications for historical hypotheses of the origin of Neotropical av ian diversity. Molecular Phylogenetics and Evolution 36:338-357. Clapperton, C. M. 1993. Nature of environmental ch anges in South America at the last glacial maximum. Palaeogeography Palaeo climatology Palaeoecology 101:189-208. Clement, M., D. Posada, and K. A. Crandall. 2000. TCS: a computer program to estimate gene genealogies. Molecu lar Ecology 9:1657-1659. Colinvaux, P. A., P. E. De Oliveira, and M. B. Bush. 2000. Amazonian and neotropical plant communities on glacial time-scal es: The failure of the arid ity and refuge hypotheses. Quaternary Science Reviews 19:141-169. Coppack, T., and C. Both. 2002. Predicting life-cy cle adaptation of migratory birds to global climate change. Ardea 90:369-378.

PAGE 131

131 Corbin, K. W. 1987. Geographic va riation and speciation. Pp. 321-353 in F. Cooke, and P. A. Buckley, eds. Avian genetics. Academic Press, London. Cox, G. W. 1968. The role of competition in th e evolution of migra tion. Evolution 22:180-189. Cracraft, J. 1983. Species concepts and speci ation analysis. Pp. 159. Current Ornithology. Plenum Press, New York. Crandall, K. A., O. R. P. Bininda-Emonds, G. M. Mace, and R. K. Wayne. 2000. Considering evolutionary processes in conservation biology. Trends in Ecology & Evolution 15:290295. Cronin, M. A. 1993. Mitochondrial DNA in wild life taxonomy and conservation biologyCautionary notes. Wildlife Society Bulletin 21:339-348. Da Silva, J. M. C., and J. M. Bates. 2002. Bi ogeographic patterns and co nservation in the South American cerrado: A tropical sa vanna hotspot. Bioscience 52:225-233. Davis, L. A., E. H. Roalson, K. L. Cornell, K. D. McClanahan, and M. S. Webster. 2006. Genetic divergence and migratio n patterns in a North American pa sserine bird: implications for evolution and conservation. Molecular Ecology 15:2141-2152. Dingle, H. 1996. Migration: The Biology of Life on the Move. Oxford University Press, New York. Donoghue, M. J. 1985. A critique of the biologica l species concept and recommendations for a phylogenetic alternative. Bryologist 88:172-181. Doyle, J. J. 1995. The irrelevance of allele tree topologies for speci es delimitation, and a nontopological alternative. Systematic Botany 20:574-588. Drovetski, S. V., and F. Ronquist. 2003. Plio-P leistocene climatic oscillations, Holarctic biogeography and speciation in an avia n subfamily. Journal of Biogeography 30:11731181. Droxler, A. W., and J. W. Farrell. 2000. Marine isotope stage 11 (MIS 11): new insights for a warm future. Global and Planetary Change 24:1-5. Edwards, S. V. 1993. Long-distance gene flow in a cooperative breeder detected in genealogies of mitochondrial DNA sequences. Proceedings of the Royal Society of London Series BBiological Sciences 252:177-185. Edwards, S. V., and P. Beerli. 2000. Perspectiv e: Gene divergence, population divergence, and the variance in coalescence time in phyloge ographic studies. Evolution 54:1839-1854. Edwards, S. V., S. B. Kingan, J. D. Calkins, C. N. Balakrishnan, W. B. Jennings, W. J. Swanson, and M. D. Sorenson. 2005. Speciation in bird s: Genes, geography, and sexual selection. Proceedings of the National Academy of Scie nces of the United States of America 102:6550-6557. Excoffier, L., P. E. Smouse, and J. M. Quattr o. 1992. Analysis of molecular variance inferred from metric distances among DNA haplotype sApplication to human mitochondrial DNA restriction data. Genetics 131:479-491. Faaborg, J. 1982. Avian population fluctuations during drought conditions in Puerto Rico. Wilson Bulletin 94:20-30. Fiedler, W. 2003. Recent changes in migratory behavior of birds: a compilation of field observations and ringing data. Pp. 21 in P. Berthold, E. Gwinner, and E. Sonnenschein, eds. Avian migrati on. Springer Verlag, Heidelberg. Fleischer, R. C., S. L. Olson, H. F. James, a nd A. C. Cooper. 2000. Identification of the extinct Hawaiian eagle ( Haliaeetus ) by mtDNA sequence analysis. Auk 117:1051-1056.

PAGE 132

132 France, S. C., and T. D. Kocher. 1996. DNA sequencing of formalin-fixed crustaceans from archival research collecti ons. Molecular Marine Biol ogy and Biotechnology 5:304-313. Freeland, J. R., M. May, R. Lodge, and K. F. Conrad. 2003. Genetic dive rsity and widespread haplotypes in a migratory dragonf ly, the common green darner Anax junius Ecological Entomology 28:413-421. Friedmann H. 1950. The birds of Middle and Nort h America XI. United States National Museum Bulletin 50. Smithsonian Inst itution, Washington, D.C. Friesen, V. L. 2000. Introns. Pp. 274 in A. J. Baker, ed. Molecular methods in ecology. Blackwell Science, Oxford. Friesen, V. L., B. C. Congdon, M. G. Kidd, and T. P. Birt. 1999. Polymerase chain reaction (PCR) primers for the amplification of five nuclear introns in ve rtebrates. Molecular Ecology 8:2147-2149. Friesen, V. L., B. C. Congdon, H. E. Walsh, and T. P. Birt. 1997. Intron variation in marbled murrelets detected using analyses of si ngle-stranded conformational polymorphisms. Molecular Ecology 6:1047-1058. Gauthreaux, S. 1982. The ecology and evoluti on of avian migration systems. Pp. 93-168 in D. S. Farner, J. R. King, and K. C. Parkes, eds. Avian biology. Academic Press, New York. Gauthreaux, S. A., JR. 1980. The influences of lo ng-term and short-term climatic changes on the dispersal and migration of organisms. Pp. 103-174 in S. A. Gauthreaux, Jr., ed. Animal migration, orientation, and navigati on. Academic Press, New York. Genise, J. F. 1997. A fossil termite nest from the Marplatan stage (late Pliocene) of Argentina: palaeoclimatic indicator. Palaeogeog raphy Palaeoclimatology Palaeoecology 136:139144. Gerhardt, R. P., Gerhardt, D. M., and M. A. Vasquez 2004. Food delivered to nests of Swallowtailed Kites in Tikal National Park, Guatemala. Condor 106:1:177-181. Gill, F. B. 1995. Ornithology, 2nd edition. W.H. Freeman and Co., New York. Greenberg, R., P. J. Cordero, S. Droege, and R. C. Fleischer. 1998. Morphological adaptation with no mitochondrial DNA differentiation in the coastal plain swamp sparrow. Auk 115:706-712. Greenwood, P. J., and P. H. Harvey. 1982. The na tal and breeding dispersal of birds. Annual Review of Ecology and Systematics 13:1-21. Griffiths, R. C., and S. Tavare. 1994. Simulati ng probability distributions in the coalescent. Theoretical Population Biology 46:131-159. Griffiths, R., M. C. Double, K. Orr, and R. J. G. Dawson. 1998. A DNA test to sex most birds. Molecular Ecology 7:1071-1075. Guillot, G., F. Mortier, and A. Estoup. 2005. Ge neland: a computer package for landscape genetics. Molecular Ecology Notes 5:712-715. Gwinner, E. 1996. Circannual clocks in avian reproduction and migra tion. Ibis 138:47-63. Gwinner, E., and B. Helm. 2003. Circannual and circ adian contributions to the timing of avian migration. Pp. pp 81 in P. Berthold, E. Gwinner, and E. Sonnenschein, eds. Avian migration. Springer, Berlin, Heidelberg, New York. Haase, R., and R. Y. Hirooka. 1998. Structure, composition and small litter dynamics of a semideciduous forest in Mato Gro sso, Brazil. Flora 193:141-147. Haavie, J., T. Borge, S. Bures, L. Z. Garamszegi, H. M. Lampe, J. Moreno, A. Qvarnstrom, J. Torok, and G. P. Saetre. 2004. Flycatcher song in allopatry and sympatry convergence, divergence and reinforcement. Journa l of Evolutionary Biology 17:227-237.

PAGE 133

133 Hahn, T. P. 1998. Reproductive seasonality in an opportunistic breeder, the red crossbill, Loxia curvirostra Ecology 79:2365-2375. Hamner, W. M., and J. Stocki ng. 1970. Why don't bobolinks breed in Brazil? Ecology 51:743-&. Helbig, A. J. 2003. Evolution of bird migratio n: a phylogenetic and biogeographic perspective. Pp. 3-20 in P. Berthold, E. Gwinner, and E. Sonnenschein, eds. Avian migration. Springer, Berlin. Helbig, A. J., A. G. Knox, D. T. Parkin, G. Sangster, and M. Collinson. 2002. Guidelines for assigning species rank. Ibis 144:518-525. Helbig, A. J., A. Kocum, I. Seibold, and M. J. Braun. 2005. A multi-gene phylogeny of aquiline eagles (Aves : Accipitriformes) reveals extens ive paraphyly at the genus level. Molecular Phylogenetics and Evolution 35:147-164. Helbig, A. J., M. Salomon, S. Bensch, and I. Seibold. 2001. Male-biased gene flow across an avian hybrid zone: evidence from mitochondr ial and microsatellite DNA. Journal of Evolutionary Biology 14:277-287. Helm, B., E. Gwinner, and L. Trost. 2005. Flexib le seasonal timing and migratory behavior results from stonechat breeding progra ms. Pp. 216-227. Bird hormones and bird migrations: Analyzing hormones in droppings a nd egg yolks and assessing adaptations in long-distance migration. New York Academy of Sciences, New York. Hewitt, G. 2000. The genetic legacy of the Quaternary ice ages. Nature 405:907-913. Hewitt, G. M. 2004. Genetic consequences of climatic oscillations in the Quaternary. Philosophical Transactions of the Royal Soci ety of London Series BBiological Sciences 359:183-195. Hill, G. E., R. R. Sargent, and M. B. Sargent. 1998. Recent change in the winter distribution of rufous hummingbirds. Auk 115:240-245. Hoelzer, G. A. 1997. Inferring phylogenies from mtDNA variation: Mito chondrial-gene trees versus nuclear-gen e trees revisited. Evolution 51:622-626. Howard, W. R. 1997. Palaeoclimatology A warm future in the past. Nature 388:418-419. Irwin, D. E. 2002. Phylogeographic breaks without ge ographic barriers to gene flow. Evolution 56:2383-2394. Irwin, D. E., S. Bensch, and T. D. Pri ce. 2001b. Speciation in a ring. Nature 409:333-337. Irwin, D. E., and J. H. Irwin. 2005. Siberian migrat ory dividesthe role of seasonal migration in speciation in R. Greenberg, and P. P. Marra, eds. Birds of two worlds: The ecology and evolution of migration. Johns Hopkins University Press, Baltimore. Irwin, D. E., J. H. Irwin, and T. D. Price. 2001a Ring species as bridge s between microevolution and speciation. Genetica 112:223-243. Irwin, D. E., and T. Price. 1999. Sexual impr inting, learning and speci ation. Heredity 82:347354. Jahn, A. E., D. J. Levey, and K. G. Smith. 2004. Reflections across hemispheres: A system-wide approach to new world bi rd migration. Auk 121:1005-1013. Johnson, D. H., and J. W. Grier. 1988. Determinan ts of breeding distribu tions of ducks. Wildlife Monographs:1-37. Joseph, L. 1997. Towards a broader view of neot ropical migrants: Consequences of a reexamination of austral migration. Ornitologia Neotropical 8:31-36. Joseph, L. 2005. Molecular approaches to the evolution and ecology of migration. Pp. 18-26 in R. Greenberg, and P. P. Marra, eds. Birds of two worlds: The ecology and evolution of migration. Johns Hopkins University Press, Baltimore.

PAGE 134

134 Joseph, L., T. Wilke, and D. Alpers. 2003. Inde pendent evolution of migration on the South American landscape in a long-distance temper ate-tropical migrat ory bird, Swainson's flycatcher ( Myiarchus swainsoni ). Journal of Biogeography 30:925-937. Kharitonov, S. P., and D. Siegel-Causey. 1988. Colony formation in seabirds. Pp. 223 in R. F. Johnson, ed. Current Ornithol ogy. Plennum Press, New York. Kimura, M., S. M. Clegg, I. J. Lovette, K. R. Hold er, D. J. Girman, B. Mila, P. Wade, and T. B. Smith. 2002. Phylogeographical approaches to assessing demographic connectivity between breeding and overwintering regions in a nearctic-neotropical warbler ( Wilsonia pusilla ). Molecular Ecology 11:1605-1616. Klicka, J., and R. M. Zink. 1997. The importance of recent ice ages in speciation: A failed paradigm. Science 277:1666-1669. Kukla, G. J., M. L. Bender, J. L. de Beaulieu, G. Bond, W. S. Broecker, P. Cleveringa, J. E. Gavin, T. D. Herbert, J. Imbrie, J. Jouzel, L. D. Keigwin, K. L. Knudsen, J. F. McManus, J. Merkt, D. R. Muhs, H. Muller, R. Z. Poore, S. C. Porter, G. Seret, N. J. Shackleton, C. Turner, P. C. Tzedakis, and I. J. Winograd. 2002. Last interglacial climates. Quaternary Research 58:2-13. Ledru, M. P. 1993. Late quaternary environmenta l and climatic change s in central Brazil. Quaternary Research 39:90-98. Leisler, B. 1990. Selection and use of habitat of wintering migrants. Pp. 156 in E. Gwinner, ed. Bird migration. Spri nger Verlag, Berlin. Lerner, H. R. L., and D. P. Mindell. 2005. Phyl ogeny of eagles, Old World vultures, and other Accipitridae based on nuclear and mitoc hondrial DNA. Molecular Phylogenetics and Evolution 37:327-346. Lessa, E. P., and G. Applebaum. 1993. Screening techniques for detecti ng allelic variation in DNA sequences. Molecular Ecology 2:119-129. Lessa, E. P., J. A. Cook, and J. L. Patton. 2003. Ge netic footprints of demographic expansion in North America, but not Amazonia, during th e Late Quaternary. Proceedings of the National Academy of Sciences of th e United States of America 100:10331-10334. Levey, D. J. 1994. Why we should adopt a broader view of neotropical migrants. Auk 111:233236. Levey, D. J., and F. G. Stiles. 1992. Evolutionary precursors of long-distance migration, resource availability, and movement pa tterns in neotropical landb irds. American Naturalist 140:447-476. Lincoln, F. C. 1950. Migration of Bi rds. Circular 16 of the Fish and Wildlife Service, Dept. of Interior. U.S. Govt. Printing office. Lopez, J. V., N. Yuhki, R. Masuda, W. Modi, and S. J. Obrien. 1994. NUMT, a recent transfer and tandem amplification of mitochondrial DNA to the nucle ar genome of the domestic cat. Journal of Molecu lar Evolution 39:174-190. Lovette, I. J. 2004. Mitochondrial dating and mixed-support for the "2% rule" in birds. Auk 121:1-6. Marshall, H. D., and A. J. Baker. 1997. Stru ctural conservation and variation in the mitochondrial control region of fringilline finches ( Fringilla spp) and the greenfinch ( Carduelis chloris ). Molecular Biology and Evolution 14:173-184. Martinez, M. M. 1983. Nidificacion de Hirundo rustica erythrogaster (Boddaert) en la Argentina (Aves, Hirundinidae). Neotropica 29:83-86. McKinney, F. 1965. Spacing and chasing in breeding ducks. Wildfowl 16:92-106.

PAGE 135

135 McKinnon, J. S., S. Mori, B. K. Blackman, L. Da vid, D. M. Kingsley, L. Jamieson, J. Chou, and D. Schluter. 2004. Evidence for ecology's role in speciation. Nature 429:294-298. Mettke-Hofmann, C. 2007. Object e xploration of garden and Sardinian warblers peaks in spring. Ethology 113:174-182. Mettke-Hofmann, C., and R. Greenberg. 2005. Beha vioral and cognitive adaptations to longdistance migration. Pp. 114-123 in R. Greenberg, and P. P. Marra, eds. Birds of two Worlds: The ecology and evolution of migr ation. Johns Hopkins University Press, Baltimore. Mettke-Hofmann, C., and E. Gwinner. 2004. Diff erential assessment of environmental information in a migratory and a nonmigr atory passerine. Animal Behaviour 68:10791086. Mettke-Hofmann, C., M. Wink, H. Winkler, and B. Leisler. 2005. Exploration of environmental changes relates to lifestyle Behavioral Ecology 16:247-254. Meyer, K. D. 2004. Demography, dispersal, and migration of the swal low-tailed kite. Final Report. Florida Fish and Wildlife Conser vation Commission, Tallahassee, Florida. Meyer, K. D. 1995. Swallow-tailed Kite ( Elanoides forficatus ) in A. Poole, and F. Gill, eds. The birds of North America, No. 138. The Academ y of Natural Sciences, Philadelphia, PA, and The American Ornithologists' Union, Washington, DC. Mila, B., T. B. Smith, and R. K. Wayne. 2006. Postglacial population expansion drives the evolution of long-distance migrati on in a songbird. Evolution 60:2403-2409. Mila, B., T. B. Smith, and R. K. Wayne. 2007. Sp eciation and rapid phenot ypic differentiation in the yellow-rumped warbler Dendroica coronata complex. Molecular Ecology 16:159173. Monteiro, L. R., and R. W. Furness. 1998. Specia tion through temporal segregation of Madeiran storm petrel ( Oceanodroma castro ) populations in the Azores? Philosophical Transactions of the Royal Society of L ondon Series B-Biological Sciences 353:945-953. Moore, F. R., and M. V. McDonald. 1993. On th e possibility that inte rcontinental landbird migrants copulate en-route. Auk 110:157-160. Moore, W. S. 1995. Inferring phylogenies from mtDNA variationMitochondrial gene trees versus nuclear gene tr ees. Evolution 49:718-726. Moreau, R. E. 1972. The Palearctic-African bird migration systems. Academic Press, London. Morris, Rev. F. O. 1891. A History of British Birds. Groombridge & Sons, London. Myers, N., R. A. Mittermeier, C. G. Mitterme ier, G. A. B. da Fonseca, and J. Kent. 2000. Biodiversity hotspots for conserva tion priorities. Nature 403:853-858. Nathan, R., G. Perry, J. T. Cronin, A. E. St rand, and M. L. Cain. 2003. Methods for estimating long-distance disper sal. Oikos 103:261-273. O'Connor, R. J. 1986. Biological characteristics of invaders among bird species in Britain. Philosophical Transactions of the Royal Soci ety of London Series BBiological Sciences 314:583-598. O'Hara, R. J. 1994. Evolutionary history and th e species problem. American Zoologist 34:12-22. Omland, K. E., and S. M. Lanyon. 2000. Reconstr ucting plumage evolu tion in orioles ( Icterus ): Repeated convergence and reversal in patterns. Evolution 54:2119-2133. Orr, M. R., and T. B. Smith. 1998. Ecology an d speciation. Trends in Ecology & Evolution 13:502-506. Ortlieb, L., A. Diaz, and N. Guzman. 1996. A warm interglacial episode during Oxygen isotope stage 11 in northern Chile. Quat ernary Science Reviews 15:857-871.

PAGE 136

136 Outlaw, D. C., G. Voelker, B. Mila, and D. J. Girman. 2003. Evolution of long-distance migration in and hist orical biogeography of Catharus thrushes: A molecular phylogenetic approach. Auk 120:299-310. Palumbi, S. R., and C. S. Baker. 1994. Contra sting population structure from nuclear intron sequences and mtDNA of humpback whales Molecular Biology and Evolution 11:426435. Pamilo, P., and M. Nei. 1988. Relationships betw een gene trees and species trees. Molecular Biology and Evolution 5:568-583. Paradis, E., S. R. Baillie, W. J. Sutherland, and R. D. Gregory. 1998. Patterns of natal and breeding dispersal in birds. J ournal of Animal Ecology 67:518-536. Pennington, R. T., D. E. Prado, and C. A. Pe ndry. 2000. Neotropical seas onally dry forests and Quaternary vegetation changes. Journal of Biogeography 27:261-273. Pereira, S. L., and A. J. Baker. 2006. A mit ogenomic timescale for birds detects variable phylogenetic rates of molecular evolution a nd refutes the standard molecular clock. Molecular Biology and Evolution 23:1731-1740. Pereira, S. L., E. T. Grau, and A. Wajnta l. 2004. Molecular archit ecture and rates of DNA substitutions of the mitochondrial contro l region of cracid birds. Genome 47:535-545. Perez-Tris, J., A. Ramirez, and J. L. Telleria. 2003. Are Iberian chiffchaffs Phylloscopus (collybita) brehmii long-distance migrants? An anal ysis of flight-related morphology. Bird Study 50:146-152. Petit, J. R., J. Jouzel, D. Raynaud, N. I. Bar kov, J. M. Barnola, I. Basile, M. Bender, J. Chappellaz, M. Davis, G. Delaygue, M. Delm otte, V. M. Kotlyakov, M. Legrand, V. Y. Lipenkov, C. Lorius, L. Pepin, C. Ritz, E. Saltzman, and M. Stievenard. 1999. Climate and atmospheric history of the past 420,000 y ears from the Vostok ice core, Antarctica. Nature 399:429-436. Pitra, C., M. A. D'Aloia, D. Lieckfeldt, a nd O. Combreau. 2004. Genetic variation across the current range of the Asian houbara bustard ( Chlamydotis undulata macqueenii ). Conservation Genetics 5:205-215. Poke, F. S., D. P. Martin, D. A. Steane, R. E. Vaillancourt, and J. B. Reid. 2006. The impact of intragenic recombination on phylogenetic r econstruction at the sectional level in Eucalyptus when using a single copy nuclear gene (cinnamoyl CoA reductase). Molecular Phylogenetics and Evolution 39:160-170. Pomilla, C., and H. C. Rosenbaum. 2005. Against the current: an inter-oceanic whale migration event. Biology Letters 1:476-479. Potti, J. 1998. Arrival time from spring migra tion in male pied flycatchers: Individual consistency and familial resemblance. Condor 100:702-708. Prado, D. E. 1993. What is the Gran Chaco vegeta tion in South America? I. A review. Candollea 48:145. Prado, D. E., and P. E. Gibbs. 1993. Patterns of speci es distributions in th e dry seasonal forests of South America. Annals of the Missouri Botanical Garden 80:902-927. Prance, G. T., and G. B. Schaller. 1982. Pre liminary study of some vegetation types of the Pantanal, Mato Grosso, Br azil. Brittonia 34:228-251. Price, T. D., and M. M. Bouvier. 2002. The evol ution of F-1 postzygotic incompatibilities in birds. Evolution 56:2083-2089. Pulido, F. 2007. The genetics and evolution of avian migration. Bioscience 57:165-174.

PAGE 137

137 Pulido, F., and P. Berthold. 2003. Quantitative gene tic analysis of migr atory behavior. Pp. 53 in P. Berthold, E. Gwinner, and E. Sonnenschei n, eds. Avian migration. Springer Verlag, Heidelberg. Pulido, F., and P. Berthold. 2004. Microevolutionary response to climatic change. Pp. 151-183. Birds and climate change. Academic Press Ltd, London. Pulido, F., P. Berthold, G. Mohr, and U. Querne r. 2001. Heritability of the timing of autumn migration in a natural bird population. Proceedings of the Royal Society of London Series B-Biological Sciences 268:953-959. Pulido, F., and M. Widmer. 2005. Are long-distance mi grants constrained in their evolutionary response to environmental change? Causes of variation in the timing of autumn migration in a blackcap ( S-atricapilla ) and two garden warbler ( Sylvia borin ) populations. Pp. 228241. Bird Hormones and bird migrations: anal yzing hormones in droppings and egg yolks and assessing adaptations in long-distance migration. New York Acad Sciences, New York. Pulliam, H. R., and T. A. Parker. 1979. Popula tion regulation of sparro ws. Fortschritte Der Zoologie 25:137-147. Quinn, T. W. 1992. The genetic legacy of Mother Goosephylogeographic patterns of lesser snow goose Chen caerulescens caerulescens maternal lineages. Molecular Ecology 1:105-117. Rappole, J. 1995. The ecology of migrant birds: a neotropical perspective. Smithsonian Institution Press, Washington, DC. Rappole, J. H. 2005. Evolution of old and new world migration systems: a response to Bell. Ardea 93:125-131. Rappole, J. H., H. Helm, and M. A. Ramos. 2003. An integrative framework for understanding the origin and evolution of avian mi gration. Journal of Avian Biology 34:124-128. Rappole, J. H., and P. Jones. 2002. Evolution of old and new world migration systems. Ardea 90:525-537. Rasmussen, K., D. M. Palacios, J. Calambokidis, M. Saborio, L. Dalla-Rosa, E. Secchi, G. Steiger, J. Allen, and G. Stone. 2007. Southern Hemisphere humpback whales wintering off Central America: insights from wate r temperature into the longest mammalian migration. Biology Letter s 3. doi:10.1098/rsbl.2007.0067. Roberts, M. A., T. S. Schwartz, and S. A. Karl. 2004. Global population genetic structure and male-mediated gene flow in the green sea turtle ( Chelonia mydas ): Analysis of microsatellite loci. Genetics 166:1857-1870. Robertson, G., and F. Cooke. 1999. Winter philo patry in migratory wa terfowl. Auk 116:20-34. Robertson, W. B. J. 1988. Ameri can swallow-tailed kite. Pp. 109 in R. S. Palmer, ed. Handbook of North American birds. Ya le University Press, New Haven. Rockwell, R. F., and F. Cooke. 1977. Gene flow and local adaptation in a colonially nesting dimorphic bird, lesser snow goose ( Anser caerulescens caerulescens ). American Naturalist 111:91-97. Ruegg, K. C., and T. B. Smith. 2002. Not as the crow flies: a historical expl anation for circuitous migration in Swainson's thrush ( Catharus ustulatus ). Proceedings of the Royal Society of London Series B-Biological Sciences 269:1375-1381. Ruokonen, M., and L. Kvist. 2002. Structure and evolution of the avian mitochondrial control region. Molecular Phylogenetics and Evolution 23:422-432.

PAGE 138

138 Saetre, G. P., T. Moum, S. Bures, M. Kral, M. Adamjan, and J. Moreno. 1997. A sexually selected character displacement in flycatch ers reinforces premating isolation. Nature 387:589-592. Safriel, U. N. 1995. The evolution of palearctic migrationThe case for so uthern ancestry. Israel Journal of Zoology 41:417-431. Salewski, V., and P. Jones. 2006. Palearctic pass erines in Afrotropical environments: a review. Journal of Ornithology 147:192-201. Serrano, D., M. G. Forero, J. A. Donazar, and J. L. Tella. 2004. Dispersa l and social attraction affect colony selection and dynamics of lesser kestrels. Ecology 85:3438-3447. Sick, H. 1993. Birds in Brazil: A natural histor y. Princeton University Press, Princeton. Skinner, R. W. 1964. Two significant specimens of the Swallow-tailed kite from Alabama. Alabama Birdlife 12:42. Slatkin, M. 1987. Gene flow a nd the geographic structure of natural populations. Science 236:787-792. Slatkin, M., and W. P. Maddis on. 1989. A cladistic measure of gene flow inferred from the phylogenies of alleles. Genetics 123:603-613. Slatkin, M., and W. P. Maddis on. 1990. Detecting isolation by distance using phylogenies of genes. Genetics 126:249-260. Smith, A. B. 1994. Rooting molecula r treesproblems and strategi es. Biological Journal of the Linnean Society 51:279-292. Snyder, N. F. R., and J. W. Wiley. 1976. Sexual size dimorphism in hawks and owls of North America. American Ornithologists Union. Sol, D., R. P. Duncan, T. M. Blackburn, P. Cassey, and L. Lefebvre. 2005b. Big brains, enhanced cognition, and response of birds to novel environments. Proceedings of the National Academy of Sciences of th e United States of America 102:5460-5465. Sol, D., and L. Lefebvre. 2000. Behavioural fl exibility predicts invasion success in birds introduced to New Zealand. Oikos 90:599-605. Sol, D., L. Lefebvre, and J. D. Rodriguez-Teij eiro. 2005a. Brain size, in novative propensity and migratory behaviour in temperate Palaearctic birds. Proceedings of the Royal Society BBiological Sciences 272:1433-1441. Soltis, D. E., M. A. Gitzendanner, D. D. Strenge, and P. S. Soltis. 1997. Chloroplast DNA intraspecific phylogeography of plants from the Pacific Northwest of North America. Plant Systematics and Evolution 206:353-373. Sorenson, M. D., J. C. Ast, D. E. Dimcheff, T. Yuri, and D. P. Mindell. 1999. Primers for a PCRbased approach to mitochondrial genome se quencing in birds and other vertebrates. Molecular Phylogenetics and Evolution 12:105-114. Spendelow, J. A., J. D. Nichols, I. C. T. Nisbet H. Hays, G. D. Cormons, J. Burger, C. Safina, J. E. Hines, and M. Gochfeld. 1995. Estimating annual survival and movement rates of adults within a metapopulation of roseate terns. Ecology 76:2415-2428. Spichiger, R., C. Calenge, and B. Bise. 2004. Ge ographical zonation in th e neotropics of tree species characteristic of th e Paraguay-Parana Basin. J ournal of Biogeography 31:14891501. Stephens, M., N. J. Smith, and P. Donnelly. 2001. A new statistical method for haplotype reconstruction from population data. Amer ican Journal of Hu man Genetics 68:978-989. Stotz, D. F., J. W. Fitzpatrick, T. A. I. Pa rker, and D. B. Moskovits 1996. Neotropical birds: Ecology and conservation. University of Chicago Press, Chicago.

PAGE 139

139 Sutherland, G. D., A. S. Harestad, K. Price, a nd K. P. Lertzman. 2000. Scaling of natal dispersal distances in terrestr ial birds and mammals. Conservation Ecology 4:44. Sutherland, W. J. 1998. Evidence for flexibility and constraint in migration systems. Journal of Avian Biology 29:441-446. Swofford, D. 1998. Phylogenetic analysis usi ng parsimony (and other methods) PAUP 4.04 beta version. Sinauer Associates, Sunderland. Terrill, S. B., and R. D. Ohmart. 1984. Facultativ e extension of fall migr ation by yellow-rumped warblers ( Dendroica coronata ). Auk 101:427-438. Thomas, W. K., S. Paabo, F. X. Villablanca, and A. C. Wilson. 1990. Spatial and temporal continuity of kangaroo rat populations shown by sequencing mitochondrial DNA from museum specimens. Journal of Molecular Evolution 31:101-112. Thompson, J. D., D. G. Higgins, and T. J. Gibson. 1994. CLUSTAL-W Improving the sensitivity of progressive multiple seque nce alignment through sequence weighting, position-specific gap penalties, and weight matrix choice. Nucleic Acids Research 22:4673-4680. Thorup, K. 2006. Does the migration programme constrain dispersal and range sizes of migratory birds? Journa l of Biogeography 33:1166-1171. Tilley, S. G., R. B. Merritt, B. Wu, and R. Highton. 1978. Genetic differentiation in salamanders of Desmognathus ochrophaeus complex (Plethontidae). Evolution 32:93-115. Trakhtenbrot, A., R. Nathan, G. Perry, and D. M. Richardson. 2005. The importance of longdistance dispersal in biodiv ersity conservation. Diversit y and Distributions 11:173-181. Veen, T., N. Svedin, J. T. Forsman, M. B. Hjer nquist, A. Qvarnstrom, K. A. T. Hjernquist, J. Traff, and M. Klaassen. 2007. Does migrati on of hybrids contribute to post-zygotic isolation in flycatchers? Proceedings of the Royal Society B-Biological Sciences 274:707-712. Veltman, C. J., S. Nee, and M. J. Crawley. 1996. Correlates of introduction success in exotic New Zealand birds. American Naturalist 147:542-557. Vigilant, L., M. Stoneking, H. Harpending, K. Hawkes, and A. C. Wilson. 1991. African populations and the evolution of human mitochondrial DNA. Science 253:1503-1507. Viverette, C. B., S. Struve, L. J. Goodrich, and K. L. Bildstein. 1996. Decreases in migrating sharp-shinned hawks ( Accipiter striatus ) at traditional raptor-migration watch sites in eastern North America. Auk 113:32-40. Walsh, P. S., D. A. Metzger, and R. Higuc hi. 1991. Chelex-100 as a medium for simple extraction of DNA for PCR based typing from forensic material Biotechniques 10:506513. Wahlund, S. 1928. Zusammensetzung von popula tion und korrelationserscheinung vom standpunkt der vererbungs lehre aus betrachtet. Hereditas 11:65. Wang, Z. S., A. J. Baker, G. E. Hill, and S. V. Edwards. 2003. Reconciling actual and inferred population histories in the house finch ( Carpodacus mexicanus ) by AFLP analysis. Evolution 57:2852-2864. Ward, P. 1971. Migration patterns of Quelea quelea in Africa. Ibis 113:275-297. Webster, M. S., and P. P. Marra. 2005. The impo rtance of understanding migratory connectivity and seasonal interactions in R. Greenberg, and P. P. Marra, eds. Birds of Two Worlds: The Ecology and Evolution of Migration. J ohns Hopkins University Press, Baltimore. Weir, B. S., and C. C. Cockerham. 1984. Estimati ng F-statistics for the analysis of population structure. Evolution 38:1358-1370.

PAGE 140

140 Wenink, P. W., A. J. Baker, H. U. Rosner, and M. G. J. Tilanus 1996. Global mitochondrial DNA phylogeography of Holarctic breeding dunlins ( Calidris alpina ). Evolution 50:318330. Wiens, J. A. 1976. Population responses to patc hy environments. Annual Review of Ecology and Systematics 7:81-120. Wiens, J. J., and T. A. Penkrot. 2002. De limiting species using DNA and morphological variation and discordant speci es limits in spiny lizards ( Sceloporus ). Systematic Biology 51:69-91. Williams, D., D. Dunkerley, P. DeDeckker, P. Kershaw, and M. Chappell. 1998. Quaternary Environments. Arnold, London. Wilson, A. C., R. L. Cann, S. M. Carr, M. George, U. B. Gyllensten, K. M. Helmbychowski, R. G. Higuchi, S. R. Palumbi, E. M. Pr ager, R. D. Sage, and M. Stoneking. 1985. Mitochondrial DNA and 2 perspectives on evol utionary genetics. Biological Journal of the Linnean Society 26:375-400. Winker, K. 1993. Specimen shrinkage in Tennessee Wa rblers and Trails Flyc atchers. Journal of Field Ornithology 64:331-336. Winker, K. 2000. Evolution Migrati on and speciation. Nature 404:36-36. Winker, K. 2006. On the origin of species thro ugh heteropatric diffe rentiation. Journal of Ornithology 147:273-273. Winker, K., and C. L. Pruett. 2006. Seasona l migration, speciation, and morphological convergence in the genus Catharus (Turdidae). Auk 123:1052-1068. Winkler, D. W. 2005. How do migration and dispersal interact? Pp. 401-413 in R. Greenberg, and P. P. Marra, eds. Birds of two worlds: The ecology and evoluti on of migration. Johns Hopkins University Press, Baltimore. Winkler, D. W. 2007. Roosts and migrations of sw allows (Hirundinidae). Ho rnero (B. Aires) in press. Winkler, H., B. Leisler, and G. Bernroider. 2004 Ecological constraints on the evolution of avian brains. Journal of Ornithology 145:238-244. Yang, D. Y., B. Eng, J. S. Waye, J. C. Dudar, and S. R. Saunders. 1998. Technical note: Improved DNA extraction from ancient bones usi ng silica-based spin columns. American Journal of Physical Anthropology 105:539-543. Zhang, D. X., and G. M. Hewitt. 2003. Nuclear DNA analyses in genetic st udies of populations: practice, problems and prosp ects. Molecular Ecology 12:563-584. Zink, R. M. 2002. Towards a framework for unders tanding the evolution of avian migration. Journal of Avian Biology 33:433-436. Zink, R. M., and M. C. McKitrick. 1995. The debate over species concepts and its implications for ornithology. Auk 112:701-719.

PAGE 141

141 BIOGRAPHICAL SKETCH Audrey was born in North Carolina and has lived many places in her life. Charlottesville, Virginia is the closest she ever came to home although her mother's family as well as her research has taken her to lovely Brazil many times. She loves to run, play with her dog, read, travel to Central and South America, a nd dance to Latin or Alt-country music. Her undergraduate education ranged from th e Universities of North Carolina and Montana to Cornell University where she receive d a degree in natural resources with honors. Her research while enrolled at the University of Florida also took her to many other academic settings including the College of Charleston, Univer sity of Texas at El Paso, and University of Virginia She hopes to continue working on c onservation issues in La tin America, including side-projects involving the e xquisite, disarming, and allu ring Swallow-tailed Kite.