<%BANNER%>

Polymorphisms in Candidate Genes for the Nitric Oxide Pathway in Sickle Cell Patients with Acute Chest Syndrome and Asthma

Permanent Link: http://ufdc.ufl.edu/UFE0021254/00001

Material Information

Title: Polymorphisms in Candidate Genes for the Nitric Oxide Pathway in Sickle Cell Patients with Acute Chest Syndrome and Asthma
Physical Description: 1 online resource (89 p.)
Language: english
Creator: Duckworth, Laurie J D
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2007

Subjects

Subjects / Keywords: acute, asthma, cell, chest, disease, nitric, oxide, polymorphisms, sickle, syndrome, synthase
Nursing -- Dissertations, Academic -- UF
Genre: Nursing Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Sickle cell disease (SCD) is one of the most common genetic diseases, affecting one in 600 African Americans. Acute chest syndrome (ACS) is the leading cause of mortality and the second most common cause of hospitalizations in patients with SCD accounting for nearly half of premature deaths. A number of recent studies have reported that asthma may increase the risk of ACS in children with sickle cell disease. Nitric oxide is thought to play a key role in the pathogenesis of ACS. The main objectives of this study were to test the hypotheses that polymorphisms in candidate genes; Arginase 1, nitric oxide synthase (NOS) genes; NOS1 and NOS3, associate with ACS in SCD patients and to characterize the association between physician-diagnosed asthma and ACS. A total of 134 participants between 5-21 years of age with SCD were enrolled. Associations between acute chest syndrome and asthma with the following polymorphisms were explored: the AAT in intron 13 (formerly intron 20) of the NOS1; T-786C and G894T and the repeat polymorphism in intron 4 of NOS3; and ARG I Pvu polymorphism. African Americans (n=74) comprised a cohort of healthy controls owing to non-Hardy-Weinberg equilibrium (HWE) in some variants. Physician-diagnosed asthma was determined by chart review, parental report, and medication use. Eighty five percent of participants with asthma had at least on episode of ACS compared to 14.6 % of participants without ACS; adjusted odds ratio (OR) (95%CI) 5.46 (2.20,13.5), P = ? 0.0001. Physician-diagnosed asthma correlated with the number of episodes of ACS (P ? 0.001). The NOS1 AAT repeat polymorphism associated with the risk of ACS (P = 0.001) in patients without physician-diagnosed asthma. No associations were found between the NOS3 T-786C polymorphism and ACS. Carriers of the ARG I minor allele were less likely to have asthma, 22/79 (28%) compared to WT homozygotes 6/47 (13%); p = 0.04. Findings from this study suggest that asthma is a major risk factor for ACS. The NOS1 AAT repeat polymorphism may contribute to ACS in SCD patients without asthma. Studies that further characterize the association between asthma, ACS, and NOS genes in children with sickle cell disease are warranted.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Laurie J D Duckworth.
Thesis: Thesis (Ph.D.)--University of Florida, 2007.
Local: Adviser: Stechmiller, Joyce K.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2007
System ID: UFE0021254:00001

Permanent Link: http://ufdc.ufl.edu/UFE0021254/00001

Material Information

Title: Polymorphisms in Candidate Genes for the Nitric Oxide Pathway in Sickle Cell Patients with Acute Chest Syndrome and Asthma
Physical Description: 1 online resource (89 p.)
Language: english
Creator: Duckworth, Laurie J D
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2007

Subjects

Subjects / Keywords: acute, asthma, cell, chest, disease, nitric, oxide, polymorphisms, sickle, syndrome, synthase
Nursing -- Dissertations, Academic -- UF
Genre: Nursing Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Sickle cell disease (SCD) is one of the most common genetic diseases, affecting one in 600 African Americans. Acute chest syndrome (ACS) is the leading cause of mortality and the second most common cause of hospitalizations in patients with SCD accounting for nearly half of premature deaths. A number of recent studies have reported that asthma may increase the risk of ACS in children with sickle cell disease. Nitric oxide is thought to play a key role in the pathogenesis of ACS. The main objectives of this study were to test the hypotheses that polymorphisms in candidate genes; Arginase 1, nitric oxide synthase (NOS) genes; NOS1 and NOS3, associate with ACS in SCD patients and to characterize the association between physician-diagnosed asthma and ACS. A total of 134 participants between 5-21 years of age with SCD were enrolled. Associations between acute chest syndrome and asthma with the following polymorphisms were explored: the AAT in intron 13 (formerly intron 20) of the NOS1; T-786C and G894T and the repeat polymorphism in intron 4 of NOS3; and ARG I Pvu polymorphism. African Americans (n=74) comprised a cohort of healthy controls owing to non-Hardy-Weinberg equilibrium (HWE) in some variants. Physician-diagnosed asthma was determined by chart review, parental report, and medication use. Eighty five percent of participants with asthma had at least on episode of ACS compared to 14.6 % of participants without ACS; adjusted odds ratio (OR) (95%CI) 5.46 (2.20,13.5), P = ? 0.0001. Physician-diagnosed asthma correlated with the number of episodes of ACS (P ? 0.001). The NOS1 AAT repeat polymorphism associated with the risk of ACS (P = 0.001) in patients without physician-diagnosed asthma. No associations were found between the NOS3 T-786C polymorphism and ACS. Carriers of the ARG I minor allele were less likely to have asthma, 22/79 (28%) compared to WT homozygotes 6/47 (13%); p = 0.04. Findings from this study suggest that asthma is a major risk factor for ACS. The NOS1 AAT repeat polymorphism may contribute to ACS in SCD patients without asthma. Studies that further characterize the association between asthma, ACS, and NOS genes in children with sickle cell disease are warranted.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Laurie J D Duckworth.
Thesis: Thesis (Ph.D.)--University of Florida, 2007.
Local: Adviser: Stechmiller, Joyce K.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2007
System ID: UFE0021254:00001


This item has the following downloads:


Full Text








POLYMORPHISMS IN CANDIDATE GENES FOR THE NITRIC OXIDE PATHWAY IN
SICKLE CELL PATIENTS WITH ACUTE CHEST SYNDROME AND ASTHMA



















By

LAURIE JILL DUCKWORTH


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA

2007


































2007 Laurie Jill Duckworth


































To my children, Lindsay and Lesley Duckworth, for their love, support, and patience. To my
parents, Louis and Lorraine Doucette, for believing in me. To all who nurtured my intellectual
curiosity making this milestone possible.









ACKNOWLEDGMENTS

I sincerely thank my doctoral committee, Drs. Joyce Stechmiller, Julie Johnson, Veronica

Feeg, John Lima, and Lorraine Frazier, for their mentorship, guidance, and support. The

expertise of each member has contributed greatly to the completion of my dissertation. I could

not have succeeded without them.

As chair of my committee, Dr. Joyce Stechmiller has served as an extraordinary teacher

and mentor. Her encouragement and positive nature has given me the confidence to explore my

research interest and believe in my contribution to the science of the nursing profession. Special

thanks to Dr. John Lima who not only served as a mentor but whom also provided daily

encouragement throughout this process. I could not have succeeded without his guidance and

support.

I would like to thank Dr. Niranjan Kissoon for providing the opportunity to develop my

research interest in nitric oxide. Special recognition goes to Jainwei Wang for enduring endless

questions related to genotyping. Also, Hua Feng for navigating me through the statistical

analyses for this project. My co-workers for their patience and understanding over the past

several years, I could not have completed this task without your support. Finally, I thank my

friends for their love and support.









TABLE OF CONTENTS

page

A CK N O W LED G M EN T S ................................................................. ........... ............. .....

LIST OF TA BLES ..................... ......... ...............................................................................................

LIST OF FIGURES .................................. .. ..... ..... ................. .8

LIST OF A BBREV IA TION S ......... ............... ...........................................................9

A B S T R A C T ................................ ............................................................ 10

CHAPTER

1 INTRODUCTION ............... .......................................................... 12

B background and Significance .................................................................................. ............... 14
Acute Chest Syndrome and Nitric Oxide .................................... .......... .................. 14
N itric O xide Synthase Enzym es ......................................................................... ...... 15
Nitric Oxide, Airway Inflammation, ACS, And Asthma..............................................16
Significant ce of R research .......................... .......... ........................................... .......... ..... ... 16
R research A im s and H ypotheses.............................................................................. ............17
S p ecific A im 1 ......................................................................... 17
H y p oth esis ...................................... ................................................... 17
S p ecific A im 2 ........................................................................ 17
H y p oth esis ...................................... ................................................... 17
Significance to N using ........................ .. ........................ .. .... ........ ........ 17
T heoretical F ram ew ork .......... .................................................................... ........... .. 18

2 M A TER IA L S A N D M ETH O D S ........................................ .............................................21

S u b j e c ts ..........................................................................................................2 1
Sam ple and Setting .............. ......................... ......... ... ..................... 21
In clu sion C criteria ...............................21..............................
Exclusion Criteria ...................... ................... .... ......... 21
M ethods A nd P rocedures............................................................................. .....................22
S tu d y D e sig n .............................................................................2 2
C o n se n t ................................ .......................................................2 2
D em graphic Inform action ....................................................................... ..................22
M medical History ................................. ............................... ......... 22
A cute Chest Syndrom e D diagnosis ............................................................. ............... 22
A sth m a D iag n o sis......... ...... ........................ ............................................ .. .... ........ .. 2 3
Isolation of G enom ic D N A ..................................................................... ..................23
G en oty p in g ................................................................2 4
Statistical A nalysis................................................... 25









3 L ITE R A TU R E R E V IE W ........................................................................ .. .......................28

S ick le C ell D ise a se ........................................................................................................... 2 8
A cute Chest Syndrom e ........................ .. ........................ .. .... ........ ........ 29
A sth m a ................... ...................3...................0..........
N itric Oxide ................................... ................ ............................ ......... 31
Historical Events Leading to the Discovery of Nitric Oxide .......................................32
Nitric Oxide Mechanisms of Action.... ......................................33
Exhaled Nitric Oxide and Airway Disease............... .... ......................35
Associations between NOS Genetic Variants and ACS .................. ............................. 38
NOS Genes and Association with Asthma... ..................... ....................40
N itric O xide Synthase 1 (nN O S) ......................................................................... ..... 40
N itric O xide Synthase 2 (iN O S)........................................................... ............... 41
N itric Oxide Synthase 3 (eN O S) .............................................................................. 42
N itric Oxide and A cute Chest Syndrom e ........................................ .......... ............... 42
A rginase G enes and A sthm a.......................................................................... ...................43
Im p a ct o f G en etic s ............................................................................................................ 4 4
G genetic Influence ..................................... ......... ..................................... 44
Analysis Of Ethical, Social, Political, Economic, and/or Cultural Issues...........................45
Limited understanding of etiology of ACS ........................... .........................47
Similarities and Differences Between Asthma and ACS with Regard to Symptomology
an d L u n g F u n ctio n .................................................................................... ................ .. 4 8

4 R E S U L T S ....................................................................... ............................ ............... 5 1

D e scrip tiv e R e su lts ................................................................................................... 5 1
Genotyping .......................................................................... 51
Asthma and Acute Chest Syndrome .............................................. .....................52
G genetic A associations ................................................................... 52

5 D ISC U SSIO N ............................................ ........ .............................. 58

Study L im stations ........................................... 59
Implications for Clinical Practice .............................................. 62

6 F U T U R E W O R K .............................................................................................................. 6 4

APPENDIX

A C O N SE N T F O R M .............................................. .......................... ..................... 66

B DEMOGRAPHIC INFORMATION ................................. ................................. 77

C M EDICAL HISTORY ................................................. 78

L IST O F R E F E R E N C E S ....................................................................................................79

B IO G R A PH IC A L SK E T C H ................................................................................................... 89


6









LIST OF TABLES


Table page

4-1 Characteristics of self-identified African Americans with sickle cell disease who had
at least one episode of acute chest syndrome (cases) and individuals with no episodes
of acute chest syndrome e (controls). ............................................................................. 54

4-2 Comparison of Hardy-Weinberg Equilibria (HWE) and minor allele frequencies of
NOS 1, NOS 3 and ARG I polymorphisms in 134 patients with sickle cell disease
(SCD ) and 74 healthy controls................................................ ............................... 54

4-3 Influence of physician-diagnosed asthma on the risk of having at least one episode of
acute chest syndrome in patients with sickle cell disease (cases) compared to no
physician-diagnosed asthm a (controls)........................................ .......................... 55

4-4 Association between ARG1 A2/A1 polymorphism and asthma among SCD patients.....57









LIST OF FIGURES


Figure page

1-1 Metabolic pathways for Arginine, Arginase, Nitric oxide synthase, and Nitric oxide......20

2-1 D iagram of study protocol. ...................................................................... ....................27

4-1 Comparison of distributions of alleles carrying AAT repeats in intron 13 on NOS 1
g e n e ................... ...................5...................5..........

4-2 Prevalence of physcian-diagnosed asthma and acute chest syndrome episodes ...............56

4-3 Risk of ACS and NOS 1 AAT repeats in intron 13 ............................ .................57









LIST OF ABBREVIATIONS

ACS acute chest syndrome

AAT intronic repeat NOS 1 gene

DNA deoxyribonucleic acid

FENO exhaled nitric oxide

ICS inhaled corticosteroid

NO nitric oxide

cNOS constitutive nitric oxide synthase

eNOS endothelial nitric oxide synthase (NOS3)

HWE Hardy-Weinberg equillibrium

iNOS inducible nitric oxide synthase (NOS2)

LABA long-acting beta agonists

OR odds ratio

PCR polymerase chain reaction

nNOS neuronal nitric oxide synthase (NOS1)

SABA short-acting beta agonists

SCD sickle cell disease

SNP single nucleotide polymorphism

NCC Nemours Children's Clinic









Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

POLYMORPHISMS IN CANDIDATE GENES FOR THE NITRIC OXIDE PATHWAY IN
SICKLE CELL PATIENTS WITH ACUTE CHEST SYNDROME AND ASTHMA

By

Laurie Jill Duckworth

August 2007

Chair: Joyce K. Stechmiller
Major: Nursing Sciences

Sickle cell disease (SCD) is one of the most common genetic diseases, affecting one in 600

African Americans. Acute chest syndrome (ACS) is the leading cause of mortality and the

second most common cause of hospitalizations in patients with SCD accounting for nearly half

of premature deaths. A number of recent studies have reported that asthma may increase the risk

of ACS in children with sickle cell disease. Nitric oxide is thought to play a key role in the

pathogenesis of ACS. The main objectives of this study were to test the hypotheses that

polymorphisms in candidate genes; Arginase 1, nitric oxide synthase (NOS) genes; NOS1 and

NOS3, associate with ACS in SCD patients and to characterize the association between

physician-diagnosed asthma and ACS. A total of 134 participants between 5-21 years of age

with SCD were enrolled. Associations between acute chest syndrome and asthma with the

following polymorphisms were explored: the AAT in intron 13 (formerly intron 20) of the

NOS1; T-786C and G894T and the repeat polymorphism in intron 4 of NOS3; and ARG I Pvu

polymorphism. African Americans (n=74) comprised a cohort of healthy controls owing to non-

Hardy-Weinberg equilibrium (HWE) in some variants.

Physician-diagnosed asthma was determined by chart review, parental report, and

medication use. Eighty five percent of participants with asthma had at least on episode of ACS









compared to 14.6 % of participants without ACS; adjusted odds ratio (OR) (95%CI) 5.46

(2.20,13.5), P = < 0.0001. Physician-diagnosed asthma correlated with the number of episodes of

ACS (P < 0.001). The NOS1 AAT repeat polymorphism associated with the risk of ACS (P =

0.001) in patients without physician-diagnosed asthma. No associations were found between the

NOS3 T-786C polymorphism and ACS. Carriers of the ARG I minor allele were less likely to

have asthma, 22/79 (28%) compared to WT homozygotes 6/47 (13%); p = 0.04.

Findings from this study suggest that asthma is a major risk factor for ACS. The NOS1

AAT repeat polymorphism may contribute to ACS in SCD patients without asthma. Studies that

further characterize the association between asthma, ACS, and NOS genes in children with sickle

cell disease are warranted.









CHAPTER 1
INTRODUCTION

Sickle cell disease (SCD) is one of the most common genetic diseases, affecting one in

600 African Americans. Acute chest syndrome (ACS) is the leading cause of mortality and the

second most common cause of hospitalizations in patients with sickle cell disease (SCD)

accounting for nearly half of premature deaths (Platt et al., 1994; Stuart, & Setty 2001; Buchanan

et al., 2004). Our current understanding of the pathophysiology and mechanisms leading to

ACS in SCD is limited and remains unclear. In a large prospective study infection and

pulmonary fat embolism were identified as causal in 38% of episodes, but in approximately 50%

of cases no cause was determined (Vichinsky et al., 2000).

Nitric oxide (NO) is thought to play a key role in the pathogenesis of ACS (Gladwin et

al., 1999). NO is formed through the hydrolysis of arginine to NO by nitric oxide synthase

(NOS). Arginine acts as a substrate for both NOS and arginase. The arginase and NOS pathways

can interfere with each other via substrate competition (Morris, 2002) (Fig 1-1). Recent studies

suggest that asthma may be related to decreased NO bioavailability (de Boer et al., 1999; Meurs,

Maarsingh, Zaagsma, 2003) rather than an overproduction due to inflammation

(Kharitonov&Barnes, 2007). This may occur as a result of the increased activity of arginase

(Meurs et al., 2002; Zimmermann et al., 2003). Notably, plasma concentrations of NO are

reduced during ACS as a consequence of reduced NO bioavailability (Morris et al., 2006)

(Morris, et al., 2004).

Compared to normal control subjects, arginine concentrations were lower and the activity

of arginase, the enzyme that hydrolyzes arginine to omithine and urea, was higher in patients

with asthma (Morris et al., 2004). Addtionally, arginase expression was strongly induced by IL-

4 and IL-13 in mice models of asthma and by Th 2 cytokines, which may contribute to NO









deficiency in asthma (Zimmermann et al., 2003). Wechsler et al (2000), identified a group of

patients with asthma with low concentrations of FENo that was inversely related to the AAT

repeat polymorphism in intron 13 on the NOS1 gene.

Recent studies demonstrate that administration of inhaled NO has beneficial effects in

treating ACS (Stuart & Setty, 2001; Sullivan et al., 1999; Atz & Wessel, 1997). Sullivan et al

(2001) reported lower concentrations of exhaled nitric oxide (FENo) in children who previously

had ACS. Additionally, they reported that low FENo was associated with a repeat polymorphism

in intron 13 (formerly called intron 20) on the NOS1 gene (Sullivan, 2001). Other NOS genes

may also be associated with ACS. For example, the NOS3 T-786C polymorphism and

increased susceptibility to ACS in females with SCD was reported (Sharan et al., 2004). Chaar et

al., (2006) reported that the C-786 allele was associated with a decreased risk of ACS. Genes that

are involved in the regulation of NO may be important in ACS because of the central role NO

plays in airway inflammation and the pulmonary endothelium.

In addition to genetic factors, environmental factors may contribute to the susceptibility

of patients with SCD to develop ACS. A number of recent studies have reported that asthma may

increase the risk of ACS in patients with SCD (Boyd et al., 2004; Knight-Madden et al, 2005;

Bryant, 2005; Nordness, 2005; Sylvester et al., 2007). These reports were based on studies that

documented a link between SCD and airway hyperresponsiveness, lower airway obstruction,

reversibility, abnormal pulmonary function tests and the fact that corticosteroids and

bronchodilators, drugs commonly used in asthma, were beneficial in ACS (Santoli et al., 1998;

Koumbourlis et al., 2001) (Klings et al., 2006).

The purpose of this study was to characterize the association between asthma and SCD.

The second aim of this study was to determine associations between polymorphisms in candidate









genes for the nitric oxide pathway. These genes code for enzymes that utilize arginine as a

substrate and regulate NO production. Therefore it is possible that genetic variants that regulate

NO production could contribute to ACS and asthma in SCD.

Background and Significance

Acute Chest Syndrome and Nitric Oxide

ACS is a common complication of sickle cell anemia. ACS is the second most common

cause of hospitalization in patients with sickle cell disease and is the leading cause of premature

deaths (Platt, 1994) (Vichinsky et al., 1997, 2000). It is characterized by the presence of a rapidly

progressing multi-lobe infiltrate, cough, hypoxemia and dyspnea. The etiology of ACS is

multifactorial and remains unclear. Our current understanding suggests that ACS may be a form

of acute lung injury that progresses to acute respiratory distress syndrome. This injury is thought

to be precipitated by sloughing of blood in the pulmonary microvascular resulting in pulmonary

infarction, fat embolisation, and infection (Vichinsky et al 1996) (Scully et al ,1997). There is

compelling evidence to support the central role of NO in the initiation of the pathophysiological

process in ACS. Stuart and Setty assessed plasma NO metabolites in 36 patients with SCD and

23 age-matched controls. They found that serum concentrations of NO metabolites were

decreased during acute chest syndrome with values lower than in controls and in patients at

steady state (Stuart & Setty, 1999). Hammerman and colleagues (1999) exposed cultured

pulmonary endothelial cells to the plasma of patients with sickle cell disease and acute chest

syndrome and found that within two hours of exposure there were increases in NOS 3 protein

and NOS 3 enzyme activity. They suggested that alterations of NO production and metabolism

contribute to the pathogenesis of ACS.









Nitric Oxide Synthase Enzymes

Nitric oxide synthase enzymes are expressed in the lung parenchyma. NOS 1 and 3 are

constitutive and regulated by intracellular calcium concentration. NOS 2 is induced under

inflammatory conditions, such as asthma, and is independent of calcium levels. Studies in pig

lungs suggest that exhaled nitric oxide originates at the alveolar surface rather than from the

pulmonary circulation and may be derived from NOS 3 expressed in the alveolar walls of normal

lungs (Kobzik et al., 1993). Airway epithelial cells express both NOS 1 and 3 and therefore

contribute to NO levels in the lower respiratory tract (Shaul et al., 1994; Asano et al., 1994).

Using exhaled nitric oxide (FENo) as a marker of NO production, Sullivan et al (2001) found that

the concentration of FENo was lower in children with SCD who had previously suffered from

acute chest syndrome as compared to children with sickle cell disease with no history of acute

chest syndrome and healthy controls. Additionally they demonstrated that the FENo levels are

significantly correlated with the number of NOS 1 AAT repeats. Given that FENO in healthy

controls is likely produced by NOS 1 and 3 at basal concentrations, the decreased level in

patients with ACS as compared to healthy controls suggest genetic variations in these genes. It

is tempting to speculate that the low FENo seen in SCD patients with ACS may have a genetic

origin and possibly may be due to polymorphisms in NOS genes. Finally, a study in 97 mild

asthmatic patients revealed that the size of the AAT repeat polymorphism on intron 13 of the

NOS 1 gene was significantly related to FENO (Weschler et al., 2000). A certain fraction or

phenotype of asthmatics had low FENo. Collectively these findings suggest and support the

hypothesis that genetic variation in NOS genes may contribute to airway disease predisposing

patients with SCD to ACS.









Nitric Oxide, Airway Inflammation, ACS, And Asthma

The importance of NO as a marker for airway inflammation in asthma is well documented

(Barnes, 1995; Batra, et al 2007). Exhaled nitric oxide levels serve as a useful marker for

assessing asthma severity and medication compliance (Naprawa et al., 2005). Asthma is the

most common chronic disease of childhood in the United States. The incidence of asthma in the

African American population surpasses that of Caucasians, 17% vs 6% respectively (Yeatts &

Shy, 2001) (Boyd et al., 2006). Differences in asthma related symptoms complicate the

treatment and management of this disease in patients with SCD who may also have ACS. For

example, patients with SCD who have recurring airway dysfunction may not be identified as

asthmatic in that they are not evaluated for this condition. Sub specialists and Pediatricians may

focus on the child's SCD and manage upper respiratory conditions on a case-by-case basis. This

may leave the patients more vulnerable to an increased risk for ACS.

Significance of Research

The information gained from the proposed research may identify candidate genetic variants

in the NO pathway that increase the risk of patients with SCD to develop ACS. More

specifically, this research may determine whether polymorphisms in NOS genes and other genes

that encode proteins that regulate NO predispose patients with sickle cell disease to episodes of

acute chest syndrome. If the NOS genotype is suggestive of decreased NO production in the

lung, early intervention with treatment modalities such as oral arginine may prevent ACS and

thereby reduce morbidity and mortality associated with this complication. Findings from this

research may lead to screening of patients with SCD for the genetic variants associated with

ACS early in life resulting in aggressive management and particular attention to associated lung

diseases such as asthma which may put them at heightened risk for pulmonary complications.









Research Aims and Hypotheses


Specific Aim 1

To characterize the relationship between ACS and asthma in children with SCD.

Hypothesis

Asthma is a risk factor for ACS.

Specific Aim 2

To explore associations among polymorphisms in candidate genes of the nitric oxide

pathway and their association with asthma, ACS and SCD.

Hypothesis

Polymorphisms in candidate genes of the nitric oxide pathway predict asthma and ACS in

children with SCD.

Significance to Nursing

This study will explore associations between candidate genes in the NO pathway and the

incidence of asthma and acute chest syndrome in a sickle cell disease population. Gaining

insight into mechanisms of chronic disease that may impact complications associated with SCD

is vital to nursing care. Outpatient Sickle Cell Disease clinics are generally managed by nurses.

The nurse is often the first contact when patients experience pain or respiratory distress. Asthma

is the leading chronic illness in children, can be life threatening, and is more prevalent in the

African American population. Recent retrospective studies suggest that patients with SCD who

also have a history of asthma may be at increased risk for acute chest syndrome. Knowledge

regarding polymorphisms in NOS genes and historical evidence of asthma, thereby predisposing

patients to ACS, may heighten awareness and result in aggressive management and treatment for

asthma related symptoms.









Theoretical Framework

Sickle Cell disease is the most common genetic disorder among African Americans.

Acute Chest syndrome is a leading cause of death in patients with SCD. The incidence of asthma

is greater in African Americans compared to Caucasians (Lugogo & Kraft, 2006). Racial

disparities in the morbidity and mortality associated with asthma can be staggering suggesting

that African Americans may receive substandard care with regard to diagnosis and treatment

(Ford, & McCaffrey, 2006). The reasons for this are unclear but may involve many factors

including; access to care, payment, and, educational resources. Theoretically, it stands to reason

that patients with SCD who also have asthma may be more susceptible to the complication of

ACS.

There is compelling evidence to support the central role of NO in the initiation of the

pathophysiological process in acute chest syndrome. Stuart et al (1999) found that serum NO

concentration metabolites were decreased during ACS with values lower than patients in steady

state, without ACS. Decreased NO production in patients with ACS may be the final common

pathway leading to ongoing hypoxemia, pulmonary hypertension, and acute lung injury. Patients

prone to develop ACS have decreased levels of FENo even during periods of stability (Sullivan et

al., 2001). This may be due to genetic variations in candidate genes that regulate NO, which

predispose patients to reduced NO production and recurring episodes of ACS. A growing body

of research suggests that decreased expression of NO synthase genes resulting in decreased NO

production is deleterious to the lung and may lead to acute chest syndrome (Hammerman et al.,

1999). Identifying these patients before developing ACS may decrease the morbidity and

mortality associated with this condition.

To date few modifiable risk factors for ACS have been identified. Several retrospective

studies have reported that having asthma may increase the risk of developing ACS in the SCD









population. Wechsler et al. identified a group of patients with asthma with low concentrations of

FENo that was inversely related to the number of AAT repeats in intron 13 on the NOS1 gene.

This study did not include patients with SCD (2000). A study in a SCD population reported that

the number of AAT repeats in intron 13 of the NOS 1 gene associated with FENo levels; lower

levels associated with a higher number of repeats (Sullivan, 2001)

The overall objective of this study was to determine whether patients with ACS and SCD

have one or more genetic polymorphisms in candidate genes for the nitric oxide pathway that

may predispose them to ACS. More specifically, the study will compare allele frequencies and

genotype distributions of polymorphisms in NOS 1, NOS 3, and Arginase 1 genes in children

with sickle cell disease and ACS with age, gender, and asthma. Additionally this study will

explore associations between asthma and ACS.












Body Protein
SFood
* Body Protein L. in .
- Protein L-Arginine

fumaa ASL NOS
Arginriao
sucrinate N OH L-Arine


ASS
aspartate


i 0

L-Citrulline 4".'


reatine

/-- C aiRii

Urea
pot
SX -- .
Lrr tC
O ~


L-'




L-Al-pi


NO
L-p
NO
LUNG -
S BLOOD
AIR -- O j NoNO0

KIDNEY
NO- URINE


yamines
',DC


rrtuiine .. _

Carb-mnol-

\--
Mrolne- 5- lucslate

l)iine L-lutamals


L-glutmine


Figure 1-1. Metabolic pathways for Arginine, Arginase, Nitric oxide synthase, and Nitric oxide.
Reprinted with permission by Lippincott, Williams & Wilkins.


I N-I-X1'42jX-'D www-medscape~r carn I


I(Sourci3 Grit Care Z 2004 irtltW'llP.L'ilaa"mnL'









CHAPTER 2
MATERIALS AND METHODS

This chapter is divided into three sections. The first section presents subject characteristics,

sampling method, and eligibility criteria. Second, the methods and procedures with specifics on

study design, protocol, and data collection are presented. Finally a description of data

management and statistical analyses of the two aims are reviewed.

Subjects

Sample and Setting

A convenience sample of 134 African American subjects with SCD were selected and

recruited from the Sickle Cell Disease Clinic, Emory University School of Medicine, Atlanta,

GA, and from the Hematology Clinics at the Nemours Children's Clinic, Jacksonville and

Orlando, Florida. All African American patients with SCD meeting eligibility criteria were

offered participation in the study.

Informed consent and children's assent were obtained in accordance with the requirements

and guidelines of the Institutional Review Boards at the participating centers. (Appendix A)

Inclusion Criteria

* African American
* > 5 years to 21 years of age
* Sickle Cell Disease diagnosis (HbSS, HbSC or HbSp)

Exclusion Criteria

Prematurity of birth resulting in Bronchopulmonary Dysplasia or Respiratory Distress

Syndrome

Blood transfusion within the past 30 days









Methods And Procedures


Study Design

A prospective descriptive correlation study design was utilized to investigate the

association between polymorphisms in NOS genes and the incidence of ACS and asthma in

children with sickle cell disease. Participants with a positive history of ACS served as cases,

those without served as controls. The diagram (Figure 2-1) illustrates the study protocol used in

this study.

Consent

Informed consent and children's assent was obtained in accordance with the requirements

and guidelines of the Institutional Review Boards at The University of Florida, Nemours

Children's Clinic, and Emory University. Participants and their guardians were approached in

person by the study coordinator or principal investigator. The purpose, risks, and benefits of the

study were explained and reviewed in detail. The participants right to withdraw from the study

at any time without penalty was discussed.

Demographic Information

General demographic information was collected from the participant and guardian

following informed consent. (Appendix B)

Medical History

A brief medical history checklist was completed by the study coordinator or PI following

informed consent (Appendix C).

Acute Chest Syndrome Diagnosis

The diagnosis of ACS was determined by history and chart review. ACS was defined by

the presence of multilobar infiltrates by chest radiograph and history of cough, hypoxemia, and

dyspnea. Patients with at least one episode of ACS were classified as cases. Patients with SCD









without a history of ACS were classified as controls. The age at which participants experienced

their first episode of ACS was recorded.

Asthma Diagnosis

Participants were classified as having asthma if it was diagnosed by a physician and if they

were currently prescribed one or more of the following asthma medications: inhaled short-acting

beta agonists (SABA), inhaled corticosteroids (ICS), long-acting beta agonists (LABA), a

leukotriene receptor antagonists (LTRA).

Isolation of Genomic DNA

Isolation of DNA was accomplished by a published, non-invasive method (Lum &

LeMarchand, 1998). At least one hour after eating, subjects rinsed their mouths with water, then

swished Scope mouthwash vigorously for one minute and emptied their oral contents into a

Sarstedt 50 ml Centrifugation tube with a screw cap for closure. Alternatively the study

participants could swish mouthwash for shorter duration on consecutive occasions until the

subject had swished mouthwash for one minute. The tubes were coded with the study ID

number, and mailed to the Cell and Molecular Biology Laboratory, Nemours Children's Clinic,

in Jacksonville Florida. Alternatively mouthwash samples were stored at -20 to -70 O C and sent

to Nemours in bulk shipment.

Mouthwash samples were centrifuged at 2700 rpm for 15 minutes. The supernatant was

poured off. Approximately 0.7ml of T10E10SDS0.5%PK100 g/ml was added to the concentrate. The

specimen was placed into a labeled and serum separator tube, and put in 50 0C incubator

overnight. 0.7ml of Phenol:Chloroform:Isoamyl Alcohol (25:24:1, pH 8.0) was added to the

serum separator tube, and centrifuged at 2700 rpm for 10 minutes. This step was repeated. The

supernatant was then placed in a labeled 2ml centrifuge tube. Approximately 0.7ml of 3M

Sodium Acetate and 0.7ml of Isopropyl was added to the sample and then centrifuged at 14000









rpm for 5 minutes. The supernatant was drawn off, 1 ml of 70% alcohol was added and the

sample was centrifuged again at 14,000 rpm for 2 minutes. The final specimen was suspended in

10mM of Tris, pH 7.5 and rehydrated overnight.

Genotyping

DNA was extracted as previously described and the quantity of DNA determined by

spectrophotometry. (Lum & LeMarchand, 1998). Aliquots of DNA containing 500 ng were

prepared and stored at -200C in a secure and locked freezer, and labeled with the participant's

code number. Forward and reverse primers specific to polymorphic loci in the NOS 1 and NOS3

genes were used to isolate regions of interest. Polymerase chain reaction was utilized to identify

patient genotype.

Below is a listing of the various known polymorphic loci in the NOS 1 and NOS 3 genes

and the ARG 1 gene. (Grasemann Yandava, & Drazen, 1999). In previous studies the location

of the AAT repeat was reported as intron 20 (Sullian et al., 2001; Wechsler, et al., 2000).

However, according to homosapiens chromosome 12 genomic contig NT_009775, the AAT

repeat polymorphism locates in the region of intron 13 (complement 8267923-8271203) of the

human NOS 1 gene. Oligonucleotides were synthesized by Operon Technologies (Alameda, CA,

USA). The restriction enzymes were purchased from New England Biolabs (Ipswhich, MA,

USA).

NOS 1 (neuronal NOS)

ATT intronic repeat: intron 13 (complement 8267923 8271203)

Forward primer: 5'CTGGGGCAATGGTGTGT-3'

Reverse primer: 5'GAGTAAAATTAAGGGTCAGC-3'

NOS 3 (endothelial NOS) (Sharan et al., 2000)









-786 T to C polymorphism: (rs2070744)


Forward primer: 5'GCATGCACTCTGGCCTGAAGTG-3'

Reverse primer: 5'CAGGAAGCTGCCTTCCAGTGC-3'

223BP PCR product

Exon 7 G894T = Glu298Asp polymorphism: (rs1799983)

Forward primer: 5'CTGGAGATGAAGGCAGGAGAC-3'

Reverse primer: 5'CTCCATCCCACCCAGTCAATC-3'

267 BP PCR product

Intron 4 Deletion/Insertion of 27 BP

Forward primer: 5'AGGCCCTATGGTAGTGCCTT-3'

Reverse primer: 5'TCTCTTAGTGCTGTGGTCAC-3'

Amplified by PCR on 6% polyacrylamide gels

ARG1 gene (Pvu II polymorphism) (rs17599586)

5'ATCTGAGGTAATAGAGAAGC 3'

5'TGAAAGTAGTACAGACAGAC 3'



Statistical Analysis

Data analysis was performed using SPSS version 11.0. The statistical significance of

differences in allele frequencies and genotype distributions were determined by calculating odds

ratios and by using chi square analysis. The Hardy -Weinberg equilibrium (HWE) was

examined using the Markov chain method with a program for population genetics data analysis

(Genepop, School of Biomedical Sciences, Curtin University of Technology, France) as well as









chi square goodness of fit tests. Differences in age among groups were determined using one-

way ANOVA with Bonferroni correction for multiple comparisons. Association between groups

with gender, allele, genotype, and the number of AAT repeats on NOS 1 were assessed using

chi-square test. The strength of associations between disease risk and genotype were evaluated

with Mantel-Haensze common odds ratios (OR) and 95% confidence intervals. The relationship

between risk of ACS and the number of AAT repeats in intron 13 of the NOS 1 gene in patients

with and without asthma was determined by simple linear regression. Associations between the

incidence of asthma and episodes of ACS were determined by logistic regression analysis with

age and gender as covariates.

The Hardy-Weinberg law is commonly used for calculating genotype frequencies from

allele frequencies. This law is the cornerstone of population genetics. In population genetics,

the Hardy-Weinberg principle is a relationship between the frequencies of alleles and the

genotype of a population. The occurrence of a genotype, perhaps one associated with a disease,

stays constant unless matings are non-random or inappropriate, or mutations accumulate.

Therefore, the frequency of genotypes and the frequency of alleles are said to be at "genetic

equilibrium". Genetic equilibrium is a basic principle of population genetics (Nussbaum,

McInnes, & Willard, 2004). This sudy tested for Hardy Wienberg Equillibrium (HWE) with 74

healthy African American control subjects. The reasons for testing HWE were to establish that

the allele frequencies in the study participants were consistent with an Arican American

population, and secondly to rule out genotyping error. Interestingly, the NOS 3 polymorphysims

were not in HWE when compared to the healthy control cohort. This suggest that

polymorphisms in this gene may be realted to the disease process. This was not however

confirmed with the results. In fact, associations were found between the AAT repeat









polymorphism in the NOS1 gene and the arginase 1 gene, neither of which showed differences

with regard to HWE.

Figure 2-1. Diagram of study protocol.


*History of asthma was not reported for one participant









CHAPTER 3
LITERATURE REVIEW

Sickle Cell Disease

Sickle cell disease is an inherited blood disease that is characterized by defective

hemoglobin. It is one of the most prevalent genetic disorders and is the most common genetic

disease in the African American population. The genetic mutation associated with sickle cell

disease occurs in approximately one in every 600 African American births. This disease affects

millions worldwide and approximately 72,000 people in the United States (Platt, 1994). The

clinical course of the disease varies from patient to patient. Some patients have mild symptoms

while others are severely affected. The reasons for this are unclear.


Sickle cell anemia is caused by an abnormal type of hemoglobin called hemoglobin S.

Hemoglobin is a protein inside red blood cells that carries oxygen. Hemoglobin S, however,

distorts the red blood cells shape. The fragile, sickle-shaped cells deliver less oxygen to the

body's tissues, and can break into pieces that disrupt blood flow (Goldman, 2004). Hypoxia

enhances the sickled erythrocytes adherence to both the macrovascular and microvascular

endothelium. The pulmonary microcirculation is particularly vulnerable to deoxygenation

(Stuart & Setty, 1999).


Sickle cell anemia is inherited as an autosomal recessive trait. This means it occurs in

someone who has inherited hemoglobin S from both parents. Sickle cell disease is much more

common in certain ethnic groups, significantly affecting African Americans. Someone who

inherits hemoglobin S from one parent and normal hemoglobin (A) from the other parent will

have sickle cell trait. Someone who inherits hemoglobin S from one parent and another type of









abnormal hemoglobin from the other parent will have another form of sickle cell disease, such as

thalassemia (Goldman, 2004).


Patients with sickle cell disease require continuous treatment, even when they are not

having a painful crisis. The purpose of treatment is to manage and control symptoms, and to try

to limit the frequency of crises. Supplementation with folic acid, an essential element in

producing red blood cells, is required because of the rapid red blood cell turnover. Analgesics

and hydration are mainstay treatments for patients during a sickle crisis. Treatment of pain is

critical. Non-narcotic medications may be effective, but many patients require narcotics.

Hydroxyurea was found to help some patients by reducing the frequency of painful crises and

episodes of acute chest syndrome. It also been shown to decrease the need for blood transfusions.

Newer drugs are being developed to manage sickle cell anemia. Some of these drugs work by

trying to induce the body to produce more fetal hemoglobin (in an attempt to decrease the

amount of sickling), or by increasing the binding of oxygen to sickle cells. To date, there are no

other commonly used drugs available for treatment (Hoffman, 2005).


Acute Chest Syndrome

Acute Chest Syndrome is a common complication of sickle cell disease and is the leading

cause of premature death in this population (Platt, 1994) (Stuart et al., 1994) (Buchanan et al.,

2004). ACS is characterized by the presence of multi-lobe infiltrates, cough, dyspnea, hypoxia,

and often chest pain. The pathophysiology of ACS is unclear but recent research indicates that

NO plays a central role in airway pathology associated with this condition (Hammerman et al.,

1999). This is not surprising when we take into account that the lung contains all three forms of

nitric oxide synthase (NOS), NOS 1, 2, and 3. Kharitonov et al (1995) demonstrated that oral

administration of L-arginine to healthy subjects increased exhaled nitric oxide (ENO) levels.









Recent studies have shown that L-arginine levels are low in patients with sickle cell disease

(Lopez et al., 2003 Enwonwu et al., 1990), and decreased to an even greater extent in patients

who have sickle cell disease with evidence of ACS. (Morris et al ,2000).

Asthma

Asthma is a disease involving chronic inflammation of the airways. Airway inflammation

is a consistent finding in patients with mild, moderate, and severe asthma. Numerous studies

have reported elevated exhaled nitric oxide levels in patients with asthma (Kissoon et al., 1999)

(Kharitonov, 1994,1996) (Piacentini et al., 1999). The following definition of asthma is the

accepted definition as proposed in the National, Heart, Lung and Blood Institutes (NHLBI's)

National Asthma and Prevention Program (NAEPP) Expert Panel Report: Guidelines for the

Diagnosis and Management of Asthma Update 2002:

Asthma is a chronic inflammatory disorder of the airways in which many cells and cellular

elements play a role, in particular, mast cells, eosinophils, T lymphocyutes, neutrophils, and

epithelial cells. In susceptible individuals, this inflammation causes recurrent episodes of

wheezing, breathlessness, chest tightness, and cough, particularly at night and in early morning.

These episodes are usually associated with widespread but variable airflow obstruction that is

often reversible either spontaneously or with treatment. The inflammation also causes an

associated increase in the existing bronchial hyperressponiveness to a variety of stimuli (National

Asthma Education and Prevention Program Expert Panel, (2003).

Asthma is one of the most common chronic diseases of industrialized nations and its

prevalence continues to increase throughout the world. Statistics form the Centers for Disease

Control reveal that the incidence of asthma in the United States is between 8-9 %. Asthma is the

leading chronic illness in children and the number one cause of school absences. Overall,

mortality rates for asthma have declined since 1995, however mortality rates continue to be 3









times higher for African American males as compared to white males, and 2.5 times higher for

black females when compared to white females (Fagan et al., 2000). Over the past 10-15 years

research has led to a greater understanding of the mechanisms of asthma, thereby reducing

mortality and improving the quality of life for many patients suffering with asthma. However,

reasons for disparities in mortality among African Americans continue to elude scientists. Recent

studies have reported a relationship between asthma and ACS (Boyd et al., 2004) (Knight-

Madden et al., 2005 (Bryant, 2005) (Nordness et al., 2005). Many of the symptoms related to

ACS are also seen in asthma; dyspnea, cough, decreased oxygen saturation. Surprisingly, the

prevalence of asthma in these studies ranged from 45 to 53%, a striking increase over the

incidence of asthma generally seen in African Americans. What remains unclear is direction of

the causality of the relationship between ACS and Asthma. Do patients with asthma have more

episodes of ACS, or are patients with a history of ACS more likely to develop asthma?

Few studies address polymorphisms in NOS genes and how they may impact airway

disease, specifically asthma, in patients with SCD. Given that asthma is the leading chronic

illness in children and more prevalent in African Americans, it is important to explore

relationships among candidate genes in the NO pathway, asthma, sickle cell disease, and acute

chest syndrome. Recent studies citing the importance of arginase in asthma pathogensis

additionally warrant further research (Vercelli, 2003).

Nitric Oxide

Nitric oxide (NO) plays a major role in lung physiology and airway disease. This

ubiquitous gas is an unstable free radical that serves as a mediator for several physiological

events including vascular and airway smooth muscle tone, bronchodilation, and airway

inflammation (Barnes, 1995). Nitric oxide may also be necessary for ciliary action (Jain et al.,

1993) and is thought to aid in maintaining sterility in the lower respiratory tract due to its









antimicrobial properties against pathogens including viruses and mycobacterium (Xia & Zweir,

1997). Endogenous NO is produced from the amino acid L-arginine by the enzyme NO synthase

which has three isoforms. Two constitutive forms (cNOS); neuronal (nNOS or NOS1) and

endothelial (eNOS or NOS3) are found in small quantities and serve basal metabolic functions.

The third isoform, inducible (iNOS or NOS2) is mediated by inflammatory cytokines and

endotoxin and plays a major role in the inflammation seen in asthma. All three of these isoforms

are found in the respiratory tract (Kobzik et al., 1993; Robbins et al., 1994).

Historical Events Leading to the Discovery of Nitric Oxide

Nitric oxide was discovered by Joseph Priestley in 1772 as a clear, colorless gas. In 1980.

Furchgott (1980) discovered that endothelial cells produce endedothelium relaxing factor

(EDRF) in response to acetylcholine In 1987 Moncada & Higgs (1987) and Ignarro et al (1987)

discovered that EDRF is nitric oxide. Within a years time Moncada reported that NO is

synthesized from the amino acid L-arginine (Palmer, Ashton & Moncada, 1988). Nitric Oxide

was proclaimed as molecule of the year on the cover of Science magazine in 1992. (Koshland,

1992). Six years later, the importance of the nitric oxide discovery was recognized by awarding

the Nobel Prize in Physiology and Medicine to Furchgott, Ignarrao, and Murad (Williams, 1998).

By 1993 NO had been implicated in the pathogenesis of a multitude of diseases including,

hypertension, septic shock, and dememntia (Moncada & Higgs, 1993). The next ten years led to

multiple publications related to NO, on average over 6000 papers per year addressing all areas of

medicine, including diabetes, wound healing, neurotransmission, cancer, immune function,

infection, eye disease, and respiratory function (Yetik-Anacak & Catravas, 2006). Presently it is

difficult to find a disease that is not associated with nitric oxide. This is amazing in that nitric

oxide was considered as nothing more than an irritant and pollutant twenty years ago (Moncada

& Higgs, 1993).









During the mid 1990's several studies demonstrated that nitric oxide plays a key role in

physiological regulation of airway disease (Gaston & Jonsen, 1994; Shaul et al., 1994; Barnes,

1995; Kharitonov et al 1994,1995,1996; Massaro et al., 1995, 1996). More specifically,

numerous studies reported increased exhaled nitric oxide levels in patients with asthma (Alving

Weitzberg, & Lundberg, 1993; Kharitonov et al., 1994, 1996; Barnes, 1995; Massaro et al.,

1995). Nitric oxide is released by a variety of pulmonary cells including epithelial cells,

eosinophils, and macrophages (Yates, 2001). It is believed that elevated nitric oxide in the

airways is generated by inducible nitric oxide synthase (iNOS) mediated by inflammatory

cytokines and endotoxin (Asano et al., 1994).

There is compelling evidence to support the central role of NO in the initiation of the

pathophysiological processes in acute chest syndrome. Stuart and Setty (1999) observed that

serum concentration of NO metabolites were decreased during episodes of ACS with values

lower than controls and patients in steady state. Recent studies have shown that L-arginine levels

are low in patients with sickle cell disease (Lopez et al., 2003; Enwonwu, 1990), and decreased

to an even greater extent in patients who have sickle cell disease with evidence of ACS (Morris

et al., 2000). These findings support the key role of NO in the pulmonary endothelium and

airway inflammation.

Nitric Oxide Mechanisms of Action

Nitric oxide (NO) is a simple free radical gas. NO reacts with oxygen to form nitrite and

nitrates. Endogenous nitric oxide is produced from the amino acid L-arginine by the enzyme NO

synthase, which has three isoforms (Nathan, & Xia, 1994) (Figl-1). Two constitutive forms

(cNOS); neuronal (nNOS or NOS1) and endothelial (eNOS or NOS3) and are found in small

quantities and serve basal metabolic functions. The third isoform, inducible (iNOS or NOS2) is

mediated by inflammatory cytokines and endotoxin and plays an important role in the









inflammation seen in asthma. All three of these isoforms are found in the respiratory tract

(Kobzik, 1993;Robbins, 1994). Synthesis of NO by cNOS is thought to be responsible for

vasodilator tone associated with regulation of blood pressure, neurotransmission, respiratory

function, cardiac contractility, and also plays a role in platelet aggregation (Nathan & Xia,

1994;Yates, 2001; Hammerman et al., 1999). NOS1 and NOS3 are regulated by intracellular

calcium concentration, whereas NOS2 is induced under inflammation independent of calcium

concentration. Agonists such as stress, bradykinin, acetylcholine, and histamine may activate

cNOS resulting in the release of pico molar levels of NO. Conversely, iNOS is generated by

cytokines present in the airway and produce nano molar levels of NO (Yates, 2001).

NO impacts vascular homeostasis in a variety of ways. Levels of NO may inhibit smooth

muscle cell proliferation, platelet aggregation, and platelet and monocyte adhesion to the

endothelium. Low levels, or decreased bioavailabilty of NO may lead to hypertension, coronary

artery disease, peripheral artery disease, sickle cell, or stroke (Puddu et al., 2005).

Nitric oxide acts as a vasodilator, bronchodilator, neurotransmitter, and mediator of

inflammation in the lung (Barnes, 1993). Due to its role in smooth muscle relaxation, NO

showed promise as a bronchodilator. A study in guinea pigs demonstrated that NO will limit

methacholine-induced bronchoconstriction however the effect is short-lived and requires high

levels of inhaled NO (Dupuy et al., 1992). A study in asthmatics revealed that inhalation of NO

has a small effect on airway caliber and resistance, thus not showing much promise as a

therapeutic agent (Frostell e tal, 1993). Smooth muscle exists in both the bronchi and pulmonary

vasculature within the lung. Numerous studies demonstrate that NO plays a key role in

pulmonary arterial vasoconstriction (Dinh-Xuan, 1992; Leeman & Naecje, 1995; Yetik-Anacak









& Catravas, 2006). Basal levels of NO in pulmonary endothelial cells maintain dilation of the

pulmonary vascular bed (Pepko-Zaba et al., 1991).

NO is produced in the airways by inflammatory cells, most notably eosinophils,

macrophages, epithelial cells, and mast cells, all of which are relevant to asthma (Gustafsson,

1998). Epithelial cells stimulated by cytokines result in the induction of iNOS producing high

quantities of NO (Robbins, 1996). NO generated from epithelial cells may be a physiological

defense against infection and could influence susceptibility to airway disease given its

antimicrobial properties Decreased levels of NO in the airway may increase susceptibility to

infection (Hart, 1999). NO reacts with thiols to form S-nitorsothiols (Stamler et al., 1992). These

compounds have bronchodilator activity and may also contribute to airway homeostasis by their

antimicrobial and anti-inflammatory properties (Gaston, 1994)

Exhaled Nitric Oxide and Airway Disease

Airway inflammation plays a central role in the pathogenesis as well as symptomology of

asthma (Shelhamer et al.,1995; Obyrne, 1996) Exhaled nitric oxide (FENO) levels are elevated

in patients with asthma, however, there is a substantial amount of variance (Massaro et al., 1995,

1996; Kissoon et al., 1999; Rosias et al., 2004; Storm et al., 2004). Repeatable noninvasive

measurement of inflammation would be useful in order to assess severity and guide treatment in

patients with asthma. Measurement of exhaled nitric oxide levels is an exciting recent

development that may provide an indication of the degree of airway inflammation in asthmatics

as opposed to traditional pulmonary function test, which are indirect measures of airway flow.

Customary monitoring techniques for assessing asthma severity include peak expiratory flow

rates, spirometry, and responses to medications. Despite the importance of inflammation in

asthma, monitoring airway inflammation is not routine. This is due in large part to the fact that

only invasive techniques such as bronchoscopy can directly sample lung tissue and fluids for the









presence of inflammatory cells and mediators. Sputum examination is noninvasive and is one of

the few methods available that can produce valuable information from the lower respiratory tract

(Busse, 1998). Sputum sampling in children may be impractical in that it is time consuming,

expensive, and requires cooperation from the child. Additionally, these measures may only

reflect the severity of disease at the time of measurement. (Ratnawati & Thomas, 2005).

The great advantage of FENO measurement is that sample collection is noninvasive and

can be performed repeatedly (Kissoon et al., 1999; Barnes, 1996). There are several analyzers

now commercially available that have the capability to measure FENO. Most of the studies done

to date measure nitric oxide using a chemiluminescence analyzer which detects the

photochemical reaction between NO and ozone in the analyzer. (Kharitonov et al., 1994,1996;

Kissoon et al., 1999; Smith et al., 2005) The beauty of this method is the ability to measure

FENO directly in line to the analyzer, in real time, or indirectly by obtaining an exhaled air

sample in a balloon to be later analyzed at a more convenient time. Levels of FENO are reported

in parts per billion (ppb). Until recently reported values for FENO have varied widely most

likely due to significant differences in sampling technique. Major differences relate to exhalation

flow rate and nasal contamination (Kissoon et al., 1999). The American Thoracic Society has

published guidelines for FENO measurement in adults and children (American Thoracic Society,

1999). Portable devices are currently being developed for at home monitoring of FENO in

patients with asthma.

Exhaled nitric oxide is reduced in patients receiving anti-inflammatory treatment (Massaro

et al., 1995; Kharitonov, et al., 1996, 2007). It is believed that glucocorticoids prevent the

induction of inducible NOS (iNOS/NOS2) by cytokines in epithelial cells. (Kharitonov et al.,

1996). Measuring FENO may be useful for monitoring whether anti-inflammatory therapy is









adequate as well as patient compliance. A recent paper in The New England Journal of Medicine

reported that in patients with chronic, persistent asthma, treatment with inhaled corticosteroids

could successfully be titrated with the use of FENo measurements. Thus FENo measurements may

help to minimize the potential long-term side effects related to inhaled corticosteroids (Smith et

al., 2005; Deykin, 2005) With new technology currently available, FENo measurements are easy

to perform, can be reproduced accurately, and provide immediate results on which the primary

care provider can act.

While several studies have described the value of FENo measurement as a useful indicator

of airway inflammation and asthma (Cicutto & Downey, 2004; Karitonov et al ,2007; Zeidler,

Kleerup, Tashkin, 2004; Smith et al., 2005), few studies have addressed the variance of these

levels in patients with asthma or acute chest syndrome. Genetic variation may contribute to the

variability in exhaled nitric oxide levels. A limited number of studies have reported the

contribution of genetic variants in candidate genes for the NO pathway and how they may

correlate with exhaled nitric oxide and asthma.

Storm and colleagues (2003) identified a strong association between a NOS3 gene variant,

G893T, and the variability of FENO levels in patients with asthma. FENO levels were lowest in

subjects with the TT genotype and were significantly higher in subjects with either the GT or GG

genotype. As mentioned previously, the number or trinucleotide repeats (AAT) in the NOS1

gene correlated with FENO values in patients with asthma however varied depending on

genotype (Wechsler et al., 2000). Grasemann et al (2003) investigated FENO in both NOS1 and

NOS3 genes. Specifically they studied the number of AAT repeats in intron 13 (formerly intron

20) of the NOS1 gene and the 894G/T mutation in the NOS3 gene. They found no genetic

association between FENO levels and the NOS 1 gene. However, they did report that females









with 12 or more AAT repeats in NOS3 had lower FENO levels compared to females with fewer

than 12 AAT repeats, suggesting that gender and/or genetic variants in NOS3 may affect exhaled

nitric oxide levels. Collectively, these findings may offer a plausible explanation for differences

in asthma phenotype and may explain the variance in FENO values.

To date the only study reporting and association between FENO and NOS genotype in

patients with sickle cell disease and acute chest syndrome is that by Sullivan and colleagues

(2001). As mentioned, they found an inverse correlation between the number of repeats in NOS 1

and FENO levels. Further studies are warranted exploring associations between NOS genes,

variability in FENO, asthma, and SCD.

Associations between NOS Genetic Variants and ACS

Nitric oxide (NO) is thought to play a key role in the pathogenesis of ACS (Gladwin et al.,

1999). Plasma concentrations of NO are reduced during ACS as a consequence of reduced NO

bioavailability (Morris et al., 2006) (Morris et al., 2004). Recent studies demonstrate that

administration of inhaled NO has beneficial effects in treating ACS (Stuart & Setty, 2001;

Sullivan et al., 1999). Identifying genetic variants in NOS genes may be beneficial in predicting

susceptibility for developing ACS. Hammerman and colleagues (1999) investigated the theory

that alterations in endothelial cell production and metabolism of NO products might be

associated with ACS. They measured NO products from cultured pulmonary endothelial cells

exposed to plasma from sickle cell patients during crisis. They found that within two hours of

exposure there were increases in NOS3 protein and NOS3 enzyme activity suggesting that an

increase of toxic NO metabolites might contribute to the cellular and tissue damage seen in ACS.

In an attempt to clarify the genetic differences associated with the phenotypic diversity in

patients with SCD, Vargas et al (2006) analyzed three polymorphisms in the eNOS gene; the

single-nucleotide polymorphism (SNP) T-786C in the promoter region, the SNP E298D in exon









7, and a 27-bp-repeat VNTR in intron 4. They found no associations between E298D or VNTR

and SCD. Interestingly, they did report that all patients homozygous for the -786C variant had a

tendency to develop a more severe clinical course. Limitations to this study include the small

sample size, n=73. A recent retrospective study by Sharan et al (2004) investigated eNOS

polymorphisms; E298D and T-786C, in patients with SCD. They concluded that the D298 allele

was not associated with SCD, however the C-786 allele was strongly associated with the risk of

ACS in female subjects.

Sullivan et al (2001) tested the hypothesis that exhaled nitric oxide levels (FENo) are

altered in subjects with SCD who have had at least one episode of ACS. They also tested the

hypothesis that the number of AAT repeats in intron 13 (formerly intron 20) of the NOS1 gene

correlates with FENo. They reported that (FENo) levels in patients who have a history of ACS are

approximately one-third those observed in healthy controls and in patients with SCD who have

not had ACS. Additionally, they found that low FENo was associated with a repeat

polymorphism in the NOS 1 gene. More specifically, they identified that high numbers of repeats

are inversely correlated with FENo levels. It is tempting to speculate that the low FENo seen in

SCD patients with ACS may have a genetic origin and may be due to polymorphisms in NOS

genes.

Grasemann et al., (1999) demonstrated significant differences in allele frequencies and

genotypes of the NOS 1 gene among ethnically diverse populations. The number of AAT repeats

in intron 20 (currently noted as intron 13) of the NOS1 gene ranged from 7-16 in Causcasians

and African Americans. Individuals homozygous for allele 10 were more common among

Caucasians (p = 0.0004), whereas those homozygous for allele 14 were more common among

African Americans (p<0.05). These findings suggest that ethnicity may have an impact on









variants in the NOS1 gene and that these differences may be misinterpreted if not addressed in

future studies. This study did not report whether or not participants had a history of asthma.

NOS genes that are involved in the regulation of NO may be important in ACS because of

the central role NO plays in airway inflammation and the pulmonary endothelium.

NOS Genes and Association with Asthma

There is a plethora of research in the literature describing the key role of NO in the airway

epithelium. Patients with asthma have increased NO production in their airways (Kharitonov,

Yates, & Robbins, 1994; Massaro et al., 1996; Barnes, 1996; Piacentini et al., 1999). NOS genes

are located throughout the genome at 7q35-36 (NOS3) (Robinson et al., 1994), 12q24 (NOS1)

(Xu et al., 1993), and 17q12 (NOS2) (Marsden et al., 1994), all candidate loci for asthma

(Collaborative Study on the Genetics of Asthma, 1997; Daniels, 1996; Ober et al., 1998).

Nitric Oxide Synthase 1 (nNOS)

Genome-wide searches have established linkage between asthma and the NOS1 (nNOS)

gene (Collaborative Study on the Genetics of Asthma, 1997; Barnes, 1996; Ober et al., 1998).

Grasemann et al (2000) showed a genetic association between a polymorphism in the NOS1 gene

and asthma using a case control design. They demonstrated that frequencies for allele 17 and 18

of a CA repeat in exon 29 of the NOS 1 gene were significantly different between 490 asthmatic

and 350 control subjects. To confirm their findings they genotyped and additional 1131 control

subjects and verified that the frequencies of alleles 17 and 18 were nearly identical to those

found in their original control group. This study in particular is impressive given the sample

size, case-control design, and reproducibility. Findings from this study provide support for NOS 1

as a candidate gene for asthma.

A study in 97 mild asthmatic patients revealed that the size of the AAT repeat

polymorphism on intron 13 (formerly intron 20) of the NOS 1 gene was significantly related to









exhaled nitric oxide (FENo) (Weschler et al., 2000). These findings are extremely important

given that FENO is now widely accepted as a marker for airway inflammation in patients with

asthma. Results from this study may help explain the phenotypic variability among asthmatics.

In a genetic association study, Gao and colleagues (2000) tested whether variants ofNOS1,

NOS2, and NOS3 were related to asthma. Neither NOS2 nor NOS3 variants showed any

association with asthma. They did however find an association between variants in NOS1 and

asthma. More specifically they described significant differences in 183 bp allele frequencies

between control and asthmatic subjects. Homozygous 183 bp alleles were strongly associated

with asthma.

Nitric Oxide Synthase 2 (iNOS)

NO derived from NOS2 induciblee NOS or iNOS) is involved in inflammatory diseases of

the airways (Barnes, 1995). NOS2 has been shown to be upregulated in asthmatics and is a

substantial source of NO in the airways (Xia, 1992). Konno et al investigated whether the 14-

repeat allele (CCTTT) of the NOS2 gene influences the development of atopy and asthma. Their

findings suggest that the CCTTT repeat polymorphism is associated with atopy but not with

asthma. A recent study in 230 families with asthma investigated the genetic association of iNOS

repeats with asthma. Four repeats were identified; (CCTTT)n promoter repeat, intron 2(GT)n

repeat, intron 4 (GT)n repeat, and an intron 5 (CA)n repeat. This study is the first to identify

repeat polymorphisms in the iNOS gene and their association with asthma. Individuals carrying

allele 4 of the promoter repeat had high serum IgE and nitric oxide levels, characteristic of

asthma. Individuals carrying allele 3 of the intron 4 (GT)n repeat had elevated blood eosinophils

and increased asthma severity (Batra et al., 2006).

Given the role of NOS2 in airway inflammation further genetic studies are warranted

exploring variants in the gene and how they may contribute to asthma pathology.









Nitric Oxide Synthase 3 (eNOS)

Endothelial nitric oxide (eNOS) is expressed in the airway and pulmonary epithelium and

serves an important role in vasodilator tone (Shaul et al., 2002; Vallance & Moncada, 1989).

Genome screenings have identified gene linkages to eNOS and asthma. (Holgate, 1997; Lee et al

2000) demonstrated an association in polymorphisms of eNOS and angiotensin covering

enzyme in patients with asthma. A more recent study also looking at polymorphisms of eNOS

and angiotensin covering enzyme in patients with asthma found no relationship among

polymorphisms ofNOS3 and asthma (Yildiz et al., 2004). Finally, a study in 163 patients with

asthma found no relationship between the tandem repeat polymorphism in intron 4 and the

(G894T) variant of the NOS3 gene with atopic asthma (Holla et al., 2002). Although widely

discussed, there is a lack of research in the literature demonstrating as association among

polymorphisms in the NOS3 gene and asthma.

Nitric Oxide and Acute Chest Syndrome

Most of the morbidity associated with sickle cell disease stems from vaso-occlusive crisis

(Platt, 1994) (Vichinsky et al., 2000). Nitric oxide is a vasodilator (Busse, 1998). Could a

polymorphism in nitric oxide synthase genes interfere with or inhibit nitric oxide production?

Several studies are beginning to address this. Morris et al. (2000) found that there may indeed be

a relationship between L-arginine and the NO pathway. Their study attempted to sort out the

issue of substrate deficiency or substrate depletion. Sickle cell patients may experience lengthy

periods of vaso-occlusion, creating a constant demand for vasodilation mechanisms, i.e. NO

production. This overwhelming need or utilization may deplete the quantity of the substrate, L-

arginine, thereby decreasing overall NO production (Morris et al., 2000). Interestingly, Morris's

group studied 36 patients at steady state (period of wellness) and during vaso-occlusive crisis

(VOC). During steady state, L-arginine levels were normal. L-arginine levels were decreased









during periods ofvaso-occlusive crisis and acute chest syndrome. These findings suggest that

there may be arginine depletion in response to demand, as opposed to intrinsic substrate

deficiency. (Morris et al., 2000). A similar study looked at L-arginine levels during VOC when

sickle cell patients presented to the emergency department. They studied 50 adult patients and

found arginine levels were significantly low compared to steady state (Lopez et al., 2003). These

findings indicate that L-arginine levels are diminished during periods of exacerbation.

L-Citrulline is an amino acid and a precursor for arginine (Fig 1-1). Waugh et al. (2001)

demonstrated that giving 1-citrulline 0.lg/kg orally twice daily elevated plasma arginine levels,

and increased symptoms of wellness in children with SCD. The oral citrulline supplements were

well tolerated and without side effects.

Arginase Genes and Asthma

Characterization of an asthma phenotype will likely be related to a complex interaction of

genes and their polymorphic variants. The pathogenetic mechanisms of and contributing genetic

factors in asthma continue to elude scientists. In a murine model, Zimmerman et al (2003) found

that among signature asthma genes, there was over expression of the genes encoding for the

uptake and metabolism of arginine, a basic amino acid, by arginase. Additionally their results

demonstrated regulation of arginase by IL-4 and IL-13, cytokines that activate inflammatory

pathways seen in asthma. Microarray analysis in murine models of asthma found high levels of

arginase I and arginase II activity in association with IL-4 and IL13 overexpression (Vercelli,

2003). Notably, arginine acts as a substrate for both arginase and NO synthase. The arginase and

NO synthase pathways may interfere with each other by way of competition for arginine

(Vercelli, 2003). Much of the literature regarding NO in asthma has focused on iNOS and

centered on the proinflammatory role of NO. Meurs and colleagues report that a deficiency of

NO caused by increased arginase activity and altered arginine levels is a contributing factor in









the pathogenesis of asthma (Meurs, 2003). Using global micorarray analysis, Zimmermann et al

(2006) reported that asthmatic conditions involve metabolism of arginine by arginase. They

report that arginase I and arginase II genes are key regulators of processes associated with airway

tone and lung inflammation. Collectively these studies indicate the need for further investigation

of Arginase I and Arginase II genes and how they may relate to asthma and airway disease.

Impact of Genetics

In April 2003, sequencing of the human genome was completed. The consequences of this

landmark event will have a dramatic impact on the ability to understand the mechanisms of

disease and develop treatments specifically tailored to a patient's genetic profile (Collins et al.,

2003). Sickle cell disease (SCD) is one of the most common genetic diseases, affecting one in

600 African Americans. Despite its Mendelian inheritance the disease is phenotypically highly

variable. For example, some affected by the disease suffer from recurrent vaso-occlusive crisis

and die at a young age, while others seem minimally affected and enjoy a normal life span

(Buchanan,, Debaun, & Steinberg, 2004). Hence the need for identification of risk factors and

genetic variants that may predict outcomes and reduce mortality.

Acute chest syndrome (ACS) is the leading cause of mortality and the second most

common cause of hospitalizations in patients with sickle cell disease (SCD) accounting for

nearly half of premature deaths (Platt, 1994; Stuart & Setty, 2001; Buchanan, Debaun, &

Steinberg, 2004). Our current understanding of the pathophysiology and mechanisms leading to

ACS in SCD is limited and remains unclear. There is paucity in the literature describing

associations between ACS, airway disease, and genetic variation.

Genetic Influence

Studies investigating the influence of genetic variation in candidate genes in the NO

pathway are not unprecedented. The gene that encodes NOS 1 in humans is located on the long









arm of chromosome 12 in the region 12q24.2. Multiple genome wide screening studies in

different ethnic populations have shown linkage of this region to asthma (Grasemann et al.,

1999; Barnes, 1996; CSGA, 1997; Ober et al., 1998). Grasemann and colleagues (1999) found

significant differences in allele frequencies and genotypes of the NOS 1 gene among ethnically

diverse populations. They studied 305 American-Caucasian and 105 African -American healthy

subjects. The number of AAT repeats in intron 13 (formerly intron 20) ranged from 7-16. The

overall distribution of alleles differed significantly between groups. Individuals homozygous for

allele 10 were more common among Caucasians whereas those homozygous for allele 14 were

more common in African-American subjects. A study in 97 mild asthmatics revealed that the

size of the AAT repeat polymorphism on intron 13 (formerly intron 20) of the NOS 1 gene was

significantly associated with FENo (Weschler, 2000). The NOS3 gene is located at 7q35-36. A

recent study in SCD patients found a functional single nucleotide polymorphism (SNP) in the

NOS3 gene, T-786C, that associated with increased susceptibility to acute chest syndrome in

females (Sharan et al., 2004).

Analysis Of Ethical, Social, Political, Economic, and/or Cultural Issues

Asthma presents an enormous burden to both the individual and healthcare system. It is

estimated that 20 million persons in the United States suffer from asthma and asthma accounts

for more than 5.000 deaths annually (National Asthma Education and Prevention Program,

2002). In the last two decades there has been a rise in asthma hospitalizations and asthma

mortality (Akinbami & Schoenforf, 2002). Mortality associated with asthma peaked in 1998 and

has decreased over the past few years. This increase is more pronounced in African American,

and people of low socioeconomic background (Mannino et al.,1998). According to the National

Health Interview Survey, nine million children under the age of 18 years have been diagnosed

with asthma (13%), children in poor families (15%) were more likely to be diagnosed with









asthma, 4 million children (6%) had an asthma attack within the last 12 months, African

American children were more likely to have had an asthma attack in the last 12 months, and

children in fair or poor health were more than six times as likely to have had and asthma attack

in the past 12 months (National Center for Health Statistics, 2003). This is staggering given that

the National Institutes of Health and the international Global Initiatives for Asthma have focused

on asthma treatment and asthma management (National Heart, Lung and Blood Institute, 2003).

A recent study conducted by the American Lung Association Asthma Clinical Research

Centers reported that the number of asthma episodes was highest in children less than 10 years of

age. Additionally they found that African American ethnicity and a past history of severe asthma

were risk factors for poor asthma control (McCoy, et al., 2006). Minority groups with diverse

ethnic backgrounds experience disparities in asthma care and management resulting in increased

mortality (Coultas, Gong, & Grad, 1993). Lieu et al (2002) found that African American

children had worse asthma status compared to Caucasian children based on the American

Academy of Pediatrics Children's Health Survey (AAP), experiencing a greater number of

symptom-days, and an increased number of school absences. Additionally they discovered that

African American and Latino children were less likely to be using inhaled corticosteroid

medication compared to Caucasians. Notably, this cross sectional study included 1000 subjects

between the ages 2-16 years with a diagnosis of asthma, participating in a managed care

Medicaid plan. Zoratti and colleagues (1998) examined patterns of asthma care in 464 African

Americans and 1609 Caucasians with participating in a managed care program. Compared with

Caucasians, African Americans had fewer visits to asthma specialists, filled fewer prescriptions

for inhaled steroids, and were more likely to visit the emergency room for treatment of asthma.









These findings suggest ethnic differences in asthma related health care within a managed care

plan and suggest that financial barriers to health care are not the only cause for disparities.

As noted by Joseph et al (2005), it is important to distinguish race as a risk marker for

asthma as opposed to a risk factor. Risk markers imply a relationship between race and a

measured variable, whereas risk factors include ancestry, more specifically genetic variations

that associate with disease. Despite asthma guidelines, medical advances, and managed care

programs; ethnic disparities in the morbidity and mortality of asthma persist. This is not to

suggest that adherence to guidelines would minimize disparities but rather supports the role of

genetic variation.

Limited understanding of etiology of ACS

As stated previously, pulmonary disease manifested as ACS is a common complication of

sickle cell anemia. ACS is the second most common cause of hospitalization in patients with

sickle cell disease and is the leading cause of premature deaths (Platt, 1994;Vichinsky, 1996,

2000). ACS is characterized by the presence of a rapidly progressing multi-lobe infiltrate, cough,

hypoxemia and dyspnea. The etiology of ACS is multifactorial and remains unclear. Our current

understanding suggests that ACS may be a form of acute lung injury that progresses to acute

respiratory distress syndrome. This injury is thought to be precipitated by sloughing of blood in

the pulmonary microvascular resulting in pulmonary infarction, fat embolisation, and infection

(Vichinsky, 1996; Scully et al., 1997). There is compelling evidence to support the central role of

NO in the initiation of the pathophysiological process in ACS. Stuart and Setty assessed plasma

NO metabolites in 36 patients with SCD and 23 age-matched controls. Serum concentrations of

NO metabolites were decreased during acute chest syndrome with values lower than in controls

and in patients at steady state (Stuart et al 1999). Hammerman and colleagues (1999) exposed

cultured pulmonary endothelial cells to the plasma of patients with sickle cell disease and acute









chest syndrome and found that within two hours of exposure there were increases in NOS 3

protein and NOS 3 enzyme activity. They suggested that alterations of NO production and

metabolism contribute to the pathogenesis of ACS. In a 30-center study, Vichinsky et al (2000)

studied 671 episodes of ACS in 538 patients with SCD to determine the cause. They reported

ACS is precipitated by fat embolism and a variety of lung infections including; chalmydia,

mycoplasm, and legionella. More importantly their results show that in more than 50% of cases

the cause of ACS was undetermined. They conclude that the etiology for ACS remains unclear.

Surprisingly, the incidence of asthma in this study is reported to be 2%, significantly lower than

what is generally seen in the African American population.

Similarities and Differences Between Asthma and ACS with Regard to Symptomology and
Lung Function

A number of recent studies have reported that asthma may increase the risk of ACS in

patients with SCD (Boyd et al., 2004; Knight-Madden et al., 2005; Bryant, 2005; Nordness et al.,

2005). These reports were based on studies that documented a link between SCD and airway

hyperresponsiveness, lower airway obstruction, reversibility, abnormal pulmonary function tests

and the fact that corticosteroids and bronchodilators, drugs commonly used in asthma, were

beneficial in ACS (Santoli et al., 1998; Koumbourlis et al., 2001; Klings et al., 2006). Several

papers are cited in the literature describing pulmonary function in patients with sickle cell

disease (Koumbourlis et al., 2001; Sylvester et al., 2004, 2006; Klings et al., 2006). Exposure to

repeated vaso-occlusive crisis undoubtedly has an impact on the pulmonary vasculature resulting

in airway damage. This type of injury results in restrictive airway disease as opposed to the

obstructive airway disease seen in asthmatics. Multiple episodes of vaso-occlusive crisis and

recurrent episodes of ACS may result in irreversible airway damage (Sylvester, 2004, 2006;

Klings, 2006).









A recent study in children with SCD was conducted to determine whether children with

SCD have restrictive lung disease and if so whether this abnormality increases with age. Sixty-

four children with SCD and 64 ethnic matched controls, ages 5-16 years were studied.

Compared to controls, children with SCD had lower mean forced expiratory volume (FEV 1),

lower forced vital capacity (FVC), and lower peak expiratory flow (PEF). The effect of age on

lung function differed significantly between the two groups. Findings from this study

demonstrate that children with SCD have a restrictive airway disease pattern and this

abnormality increases with age. A limitation of this study is that episodes of acute chest

syndrome were not reported for children with SCD (Sylvester et al., 2004).

In 2006, this same group of investigators tested the hypothesis that children with SCD and

a positive history of acute chest syndrome would have worse lung function compared to children

with SCD and no history of acute chest syndrome. Forty subjects were enrolled, 20 positive for

ACS, and 20 negative for ACS. The mean total lung capacity and residual volumes were

significantly higher in children who had no history of ACS. They did not however demonstrate

any differences in bronchodilator reversibility tests. Their findings suggest that children with

SCD and a positive history for ACS have significant differences in lung function as compared to

children with SCD and no history of ACS. These differences are consistent with restrictive

airway disease often seen in adults with SCD (Sylvester, 2006).

A cross-sectional study of 310 adults with SCD found that 90% of subjects showed a

restrictive airway disease pattern. Additionally, they reported that the presence of restrictive

airway disease was associated with a more severe clinical course (Klings et al., 2006).

Koumbourlis and colleagues investigated the prevalence and reversibility of lower airway

obstruction in children with SCD ages 5-18 years. Interestingly they found that obstructive









disease, reversible in nature, precedes the development of restrictive airway disease. The

limitations of this study include; small sample size, limited historical information, and subjective

information with regard to a history of asthma. These children were not identified as having

physician-diagnosed asthma (Koumbourlis et al., 2001)

Asthma is a chronic inflammatory disease of the airways. In susceptible individuals, this

inflammation causes recurrent episodes of wheezing, breathlessness, chest tightness, and cough,

particularly at night and in early morning. These episodes are usually associated with widespread

but variable airflow obstruction that is often reversible either spontaneously or with treatment.

The inflammation also causes an associated increase in the existing bronchial

hyperressponiveness to a variety of stimuli (National Asthma Education and Prevention Program

Expert Panel, (2003).

ACS is characterized by the presence of multi-lobe infiltrates, cough, dyspnea, hypoxia,

and often chest pain (Hammermann, 1999). Many of the symptoms related to ACS are also seen

in asthma; dyspnea, coughs, and decreased oxygen saturation. Differentiating between asthma

and ACS may be difficult in patients with SCD. Further research is needed to establish an

objective assessment for primary care providers who are managing patients with SCD and

airway disease.









CHAPTER 4
RESULTS

The primary aim of the study was to characterize the association between physician-

diagnosed asthma and acute chest syndrome. The secondary aim of this study was to test the

hypothesis that polymorphisms in candidate genes for the NO pathway associate with ACS in

SCD patients.

Descriptive Results

A total of 134 children with SCD participated. Forty-eight patients with SCD had no

history of having ACS (36%) (controls), 86 at least one episode of ACS (64%) (cases). Fifty

percent of cases had either 1 or 2 episodes. No differences in age or sex were observed between

cases and controls (Table 1). Ninety percent (n=121) of patients with SCD were homozygous for

PS globin (HbSS); 6% (n=8) were heterozygous (HbSC); 3% (n=4) patients had sickle beta

thalassemia (HbS3); and genotype data on one patient was missing. On average the age for the

first episode of ACS was 4.4 years; the median age was 3.5 years; and the range was <1 to 17

years old. There was no relationship between age and the number of ACS episodes (data not

shown). The prevalence of physician-diagnosed asthma in our study was 36.1% (48 of 133;

asthma status was not recorded in one participant). There was 100% concordance between

physician-diagnosed asthma and asthma reported by patients or guardians. All participants with

physician-diagnosed asthma were taking inhaled SABA; 68.8 % were on ICS (33/48); 2 and 3

participants were on LABA (salmeterol) and LTRA (montelukast) respectively.

Genotyping

The success rate of genotyping ranged between 95 and 100% (average rate was 97.6%).

Table 2 compares the minor allele frequencies of the polymorphisms in SCD and healthy

controls. In SCD participants, the NOS1 AAT repeat polymorphism and the ARGI variant were









in HWE. The NOS3 polymorphisms were not in HWE, which was in contrast to healthy

controls, suggesting that genotyping of these variants was not in error, but was probably due to

the presence of disease in SCD patients. The minor allele frequency of the AAT repeat (< 12

repeats) was significantly higher in healthy controls compared to SCD patients, 0.21 vs. 0.091;

p< 0.001). The distribution of alleles carrying the number of AAT repeats in patients with SCD

was skewed to the right compared to healthy controls (X2=122; p< 0.0001) (Figure 2). The data

demonstrate that using a cut-off of < 12 repeats as suggested by Wechsler et al. in a mostly

Caucasian asthmatic cohort is reasonable for patients with SCD.

Asthma and Acute Chest Syndrome

Among SCD patients with physician-diagnosed asthma, 85.4% had at least one episode of

ACS compared to 14.6% of controls (odds= 5.85); whereas cases and controls were about evenly

distributed among participants without asthma (odds = 1.07). The adjusted OR (95%CI) is 5.47

(2.20,13.5), p = <0.0001 (Table 3). Figure 2 shows that the proportion of SCD patients who had

physician-diagnosed asthma was related to the number of episodes of ACS. The intercept of the

regression line was 0.178; the slope of the regression line was 0.097; and the correlation

coefficient, R, was 0.89, indicating that 79% (R2*100) of the variability in the proportion of

SCD patients with physician-diagnosed asthma is accounted for by the number of episodes of

ACS (p=0.001). Seven of 8 patients with 7 or more episodes of ACS had physician-diagnosed

asthma (one patient failed to report asthma status, his medical history was missing and he was on

asthma medications). Neither age nor gender contributed to the relationship (data not shown).

Genetic Associations

The association between the risk of ACS and the number of AAT repeats for the NOS1

gene in SCD patients is shown in Figure 3. The risk of ACS in participants without physician-

diagnosed asthma and who were carrying alleles with < 12 AAT repeats (n = 16 alleles; 11.6%)









was relatively high, 0.69, then declined to a risk of about 0.4 at 12 to 15 repeats (n = 87 alleles,

63%), followed by an increased risk at higher numbers of repeats (n=35 alleles, 25.4%). The r2

for the regression was 0.76; and the p values for coefficients of quadratic regression line: x and

x2, were 0.024 and 0.024, respectively. For SCD patients with physician-diagnosed asthma, the

mean SD risk of ACS was higher than in non-asthmatics: 0.87 0.09 vs. 0.49 0.12; p =

0.001, and was not associated with AAT repeat numbers. No associations were found between

the risk of ACS and the T-786C NOS3 polymorphism in either the asthma or the no-asthma

cohorts or by sex (Data not shown). A modest association was found between the A2/A1 ARG1

polymorphism and asthma (Table 4-4). Carriers of the Al allele (Al homozygotes and

heterozygotes) were less likely to have asthma, 22/79 (27.8%), compared to A2 homozygotes,

6/47 (12.8%) (Fisher's exact test: = 3.98; p = 0.04).









Table 4-1. Characteristics of self-identified African Americans with sickle cell disease who had
at least one episode of acute chest syndrome (cases) and individuals with no episodes
of acute chest syndrome (controls).
Characteristic Cases (ACS) Controls (No ACS)
Number 86 48
Mean SD age, years 12.6 4.64 14 + 8.9
Mean SD age at 1st ACS 4.4 + 3.6
episode, years
Percent female 49.3 50.0
Percent on Hydroxyurea
Current 5.8 10.4
Ever 12.7 16.6
Percent on chronic PRBC* 18.6 12.5
transfusion
Reprinted with permission by Wiley-Liss
Duckworth, L. et al. (2007). Pediatric Pulmonology, 42(4), 334.
*Packed Red Blood Cells. =Data from 70 participants


Table 4-2. Comparison of Hardy-Weinberg Equilibria (HWE) and minor allele frequencies of
NOS 1, NOS 3 and ARG I polymorphisms in 134 patients with sickle cell disease
(SCD) and 74 healthy controls


Gene Polymorphism Minor Allele Frequency
(reference SNP) Sickle Cell Disease Healthy
participants Controls
AAT repeats in intron 13 0.091 0.21
NOS 1 (WT, > 12; minor, < 12)
T-786C (rs2070744) =0.098 0.155
NOS3 G894T (rsl799983)= 0.14 0.121
27 bp repeat in intron 4 =
A=4 repeat 0.303 0.277
B=5 repeats 0.363 0.291
C=6 repeats 0.059 0.014
A2/A1 v(rs17599586) 0.133 0.142
ARG1
Reprinted with permission by Wiley-Liss
Duckworth, L. et al. (2007). Pediatric Pulmonology, 42(4), 335


= indicates polymorphisms not in HWE in patients with SCD
v Al is the T allele; which is not cut by Pvu II; A2 is the C allele, which is cut by Pvu II.








U SCD O HEALTHY


.nl


1i


6 7 8 9 10 11 12 13


14 15 16 17 18 19 20 21 22 23


AAT NUMBER

Figure 4-1. Comparison of distributions of alleles carrying AAT repeats in intron 13 on NOS 1
gene in healthy, 73 self-identified, healthy African Americans (n=146 alleles) and in
127 African Americans with sickle cell disease patients (n=254 alleles). Reprinted
with permission by Wiley-Liss. Duckworth, L. et al. (2007). Pediatric Pulmonology,
42(4), 335



Table 4-3. Influence of physician-diagnosed asthma on the risk of having at least one episode of
acute chest syndrome in patients with sickle cell disease (cases) compared to no
physician-diagnosed asthma (controls). (p value represents the chi square difference
between the asthma and no asthma groups)
Group, number (%)


Cases (ACS)
Controls (no ACS)
Total
Adjusted Odds Ratio
(95%CI)
p value


Physician-diagnosed
Asthma
41 (85.4)
7(14.6)
48 (100)
5.46
(2.20,13.5)
p <0.0001


No asthma

44(51.8)
41(48.2)
85 (100)
1.07


Reprinted with permission by Wiley-Liss
Duckworth, L. et al. (2007). Pediatric Pulmonology, 42(4), 335


_n l1














1.0- /* *
1.0 95% CI


co 0.8 /

CO,
0.6 -

/y = 0.178+0.097x
0 0.4
o /

0.2 -



0.0
0 2 4 6 8 10

Number of episodes (x)

Figure 4-2. Prevalence of physcian-diagnosed asthma and acute chest syndrome episodes. The
proportion of SCD patients having physician-diagnosed asthma was plotted against
the number of episodes of acute chest syndrome in children with sickle cell disease.
Reprinted with permission by Wiley-Liss. Duckworth, L. et al. (2007). Pediatric
Pulmonology, 42(4), 334










Mean SD = 0.87 i i ')'


X2
*






0. = 082 0.22x 4 0.03c2
1
I;?








Meai 8D = OA9 0.12
<12 12 13 14 15 16 >=17


AAT repeat number in intron 13 of NOS1


Sidde cell paTfents with asthma n=41
Sidce cell patient without asthma n=44
P=O.00 1
-- Quadratc regression line for SCDNA

Figure 4-3. Risk of ACS and NOS 1 AAT repeats in intron 13. The risk of ACS (1-
[controls/(cases+controls)]) is plotted against the number of NOS 1 AAT repeats in
patients with SCD with physician-diagnosed asthma (closed circles) and without
physician-diagnosed asthma (SCDNA). Reprinted with permission by Wiley-Liss.
Duckworth, L. et al. (2007). Pediatric Pulmonology, 42(4), 334.


Table 4-4. Association between ARG1 A2/A1 polymorphism and asthma among SCD patients.


Genotype


Number of SCD patients


Asthma No asthma


I


Odds'


Al carriers 6 22 0.27
A2 homozygotes 41 58 0.71
=Statistic likelihood ratio Fisher's exact test: 3.98; p= 0.04









CHAPTER 5
DISCUSSION

Acute chest syndrome is the leading cause of mortality and the second most common cause

of hospitalizations in patients with sickle cell disease accounting for 25% of premature deaths

(Platt, 1994; Stuart & Setty, 1999; Buchanan et al., 2004). The prevalence of ACS in children

with SCD in our study was 64%, which was in reasonable agreement with a previous study4 that

reported prevalence rates of 61% in 0 to 9 year olds, and 46% in 10 to 19 year olds, suggesting

that our sample was representative of the SCD population. In the present study, we identified

physician-diagnosed asthma as an important risk factor for ACS in patients with SCD. The

prevalence of physician-diagnosed asthma in SCD in our study was 36% (48 of 133

participants), and is in good agreement with those reported in previous studies, which ranged

between 17% and 53% (Boyd et al., 2004; Knight-Madden et al., 2005; Bryant, 2005; Nordness

et al., 2005) Among SCD patients with physician-diagnosed asthma, 85.4% had at least one

episode of ACS compared to 14.6% for participants who did not experience an episode of ACS

(OR= 5.47; p <0.0001). The prevalence of physician-diagnosed asthma in non-ACS

participants is in excellent agreement with the prevalence of asthma in African American

children without SCD (Yeatts & Shy, 2001; Fagan et al., 2001; Koumbourlis et al., 1997).

Importantly, our data also show that the proportion of patients with SCD who have physician-

diagnosed asthma increases linearly as the number of ACS episodes increase (Figure 2). To our

knowledge our study is the first to show this relationship, and, given the mortality and morbidity

associated with ACS, underscores the importance of coordinated pulmonary and sickle cell

hematology care in diagnosing asthma in SCD. These data are also important because they

point to the testable hypothesis that the aggressive treatment of asthma may reduce the mortality

and morbidity of ACS in SCD patients.









The results in Figure 2 imply that proportion of patients with physician-diagnosed asthma

is caused, at least in part, by the number of ACS episodes experienced by patients with SCD.

The fact is we cannot determine causality from our data. It is possible that ACS may cause

asthma, or that having asthma increases the risk of ACS, or that causality is bidirectional.

The results of this study support a genetic component for both ACS and for asthma in

SCD. The higher number of AAT repeats may act to decrease the activity of NOS enzyme

leading to reduced production and availability of NO, which can increase the risk of ACS and

possibly asthma (Weschler et al., 2000). Arginase activity is increased in asthma, leading to

reduced arginine availability, which can exacerbate NO deficiency in SCD patients. If the A2

allele of ARG1 leads to high expression of arginase I compared to the Al allele, then A2

homozygotes would utilize arginine to a greater extent than Al carriers, resulting in less arginine

for NOS 1 to convert to NO.

Study Limitations

A major limitation of the present study is how asthma was defined. We used a diagnosis

of asthma by a pediatrician, self- or guardian-reported asthma and drug use to define asthma.

Self- or guardian-reported asthma was in complete agreement with physician-diagnosed asthma,

and all participants with physician-diagnosed asthma were on SABA, two-thirds were on ICS,

which supports the idea that they had true asthma. Additionally, we only offered study

participation to those who presented for their clinic appointments. This may have biased the

study in that children with ACS may be more likely to keep their scheduled appointments

compared to SCD patients who are stable. Earlier studies show pulmonary function

abnormalities in children and adults with SCD. However, the data are conflicting in that some

studies in children with SCD have obstructive lung disease (Koumbourlas et al., 2001; Leong et

al., 1997), while others have found restrictive lung disease (Sylvester et al., 2006). Adults with









SCD have restrictive lung disease owing to repeated episodes of pulmonary vaso-occlusion,

which increases with age (Klings et al., 2006). Moreover, SABA and ICS are often prescribed to

patients with sickle cell lung disease. Although our study confirms the results of previous

studies that physician-diagnosed asthma is associated with ACS, and further shows that the risk

of physician-diagnosed asthma is strongly associated with the number of ACS episodes, it is not

clear that participants with physician-diagnosed asthma in our study had true asthma as defined

by conventional methods. Clearly, further studies are warranted to determine if obstructive lung

disease and asthma increase the risk of ACS in children with SCD.

In a pilot study of non-asthmatic children with SCD, we reported that FENo levels were

reduced in individuals with ACS compared to those without ACS and to a cohort of healthy

African American children (without SCD) (Sullivan et al., 2001). We also reported that levels of

FENo were inversely related to the allelic sum of AAT repeats in intron 13 of NOS1 gene, which

suggested a genetic link for ACS and led us to hypothesize that this repeat variant associated

with ACS. A specific aim of the present case-control study was to determine the association

between the AAT repeat polymorphism and ACS. We found that the risk of ACS in individuals

without physician-diagnosed asthma was reduced in alleles with 12 to 15 repeats compared to

alleles with < 12 or with alleles carrying 16 or more repeats. These data support the hypothesis

that the risk of ACS in SCD patients without asthma is associated with the AAT repeat

polymorphism, thereby implicating a genetic basis this disease. However, the association we

found, if true, was modest and may represent of false-positive association owing to small

numbers. The confounding influence of physician-diagnosed asthma on the risk of developing

ACS (Figure 3) reduced our numbers and our power to detect a true genetic association. Thus

we conclude that a larger study is warranted to replicate our findings.









The association between ACS and two polymorphisms in the NOS3 gene: E298D and T-

786C, has been reported in 87 African Americans with SCD (Sharan et al., 2004). The C-786

allele was associated with an increased risk of ACS in females (n=45; relative risk=8.7). We

were not able to replicate these data in the present study. The reasons for this are unclear, but

may be related to small number of patients in our study who did not have physician-diagnosed

asthma. Whether or not participants in the study by Sharan et al had physician-diagnosed asthma

is not clear.

The etiology of ACS is not completely understood but is known to involve infection,

pulmonary infarctions and pulmonary fat embolism (Vinchinsky et al., 2000; Vinchinsky et al

1994). Free fatty acids released by the hydrolysis of phospholipids in embolized fat can cause

acute lung injury (Styles et al., 1996). Isoenzymes of phospholipase A2 (PLA2) hydrolyze

phospholipids at the sn-2 position to generate lysophospholipids and free fatty acids (Dennis,

1994). Both cytosolic PLA2 and secretary PLA2 (sPLA2) function to generate arachidonic acid

from phospholipids in inflammatory cells (Balsinde et al., 1994; Calabrese et al., 2000). Plasma

concentrations of secretary phospholipase (sPLA2) are elevated in ACS ) (Styles et al., 1996)

and have been proposed as accurate markers of ACS in patients in SCD crises (Styles et al.,

2000; Naprawa et al., 2005). Asthma is accompanied by increased production of arachidonic

acid and enhanced activity of cysLT (Calabrese et al., 2000). Thus, it may be postulated that the

asthma phenotype associated with ACS in SCD may be leukotriene-dependent, and therefore

may be responsive to the leukotriene modifiers: 5-lipoxygenase inhibitors or leukotriene receptor

antagonists. Additionally, earlier studies have shown that corticosteroids may provide some

benefit to patients with ACS (Bernini et al., 1998), although associated with rebound

vasoocclusive pain when stopped abruptly. Aggressive treatment with moderate to high doses









of inhaled corticosteroids and a leukotriene modifier (5-liopoxygenase inhibitor or LTRA) in

SCD patients with physician-diagnosed asthma and SCD may reduce the mortality and morbidity

associated with ACS.

Conclusions

In summary, our study confirmed that physician-diagnosed asthma is an important risk

factor for ACS in SCD patients, and further demonstrated that the incidence of physician-

diagnosed asthma was highly correlated with the number of episodes of ACS. Our study

suggests that the NOS1 AAT repeat polymorphism may contribute to the risk of ACS in patients

without physician-diagnosed asthma, and that the A2/A1 ARGI polymorphism may contribute to

the incidence of asthma in SCD patients. Further studies are warranted to determine if

aggressive treatment of physician-diagnosed asthma reduces the risk of ACS in SCD, and if the

AAT repeat polymorphism contributes to ACS. It is important to note that our sample is

representative of the general African American population in that 14.6% of children with

physician diagnosed asthma who did not have a history of ACS is consistent with the incidence

of asthma nationally.

Implications for Clinical Practice

Findings from this study suggest that asthma may be a significant risk factor in children

with SCD for developing ACS. Quite often in primary care settings an asthma diagnosis is not

assigned before the age of 2 years. More specifically we often see related diagnoses such as

reactive airway disease, coughing, or upper airway congestion. In children with SCD the average

age for the first ACS episode is between 2 to 4 years of age. Provider education regarding the

association between asthma and ACS may heighten awareness of asthma related symptoms in

infants and young children with SCD and result in more aggressive airway management.

Additionally, educating the caregivers of patients with SCD regarding asthma symptoms and









their association with ACS may lead them to seek prompt medical attention for coughing

episodes and upper airway congestion, symptoms which may otherwise be viewed as the

common cold.

Sickle cell disease is clearly a genetic disease. Asthma on the other hand is a complex,

multifactorial disease. Children suffering from SCD who also have asthma may have several

specialists managing their care, for example a pulmonologist, hematologist, and primary care

provider. Enhancing communication between providers may lead to better outcomes for these

patients.









CHAPTER 6
FUTURE WORK

Several recent studies have reported that asthma may increase the risk for ACS in patients

with SCD (Boyd, 2004; Bryant, 2005; Knight-Madden, 2004; Nordness, 2005, Sylvester et al.,

2007). If indeed children with concomitant asthma and SCD have increased episodes of ACS,

studies investigating aggressive asthma treatment may have an affect on the mortality and

morbidity associated with this disease. Treatment with bronchodilators and inhaled steriods are

the mainstay of asthma management and are consistent with asthma guidelines (National Asthma

Education and Prevention Program Expert Panel, 2002). Likewise, patients with SCD and airway

compromise are routinely treated with bronchodilators and inhaled steroids. (Vichinsky, 2006;

Handelman, 1991; Mehta, 2006). Unlike preventative treatment in asthma, these medications are

used primarily as supportive care strategies in patients with SCD.

To date there are no randomized clinical trials exploring aggressive asthma management in

patients with SCD. Additionally, no studies have been reported that associate NOS genotypes,

asthma, and SCD. It is interesting to hypothesize that aggressive asthma treatment in patients

with SCD may prevent or reduce the incidence of ACS. More intriguing is the possibility that

identifying genotypes associated with asthma and ACS early in life, in conjunction with

aggressive asthma management, may reduce mortality in patients with SCD.

Montelukast, a leukotriene receptor antagonsist, is frequently prescribed for the treatment

and management of asthma in adults and young children (Knorr, 2001) (Biernacki, 2005)

Montelukast is widely accepted and commonly prescribed by pediatricians given its safety

profile and compliance. Recent updates to the national asthma guidelines suggest that

combination therapy with Montelukast and inhaled corticosteroids may improve asthma control.









Potential future studies could target patients with SCD and physician diagnosed asthma

early in childhood prior to the first episode of ACS. The first episode of ACS usually occurs

between 2-5 years of age (Knorr, 2001). Subjects would be randomized to receive either

aggressive asthma management with moderate to high doses of inhaled corticosteroids (ICS) and

a leukotriene receptor atagonist or standard of care, then followed over a period of 3-5 years.

Subjects would be monitored for asthma symptoms, episodes of ACS, and genotyped for the

AAT repeat polymorphism in the NOS1 gene. In addition, exhaled nitric oxide collection and

pulmonary function testing would be employed to assess and monitor airway inflammation.

Given that exhaled nitric oxide is an accepted measure of airway inflammation in asthma,

utilizing this biomarker as a predictor or diagnostic tool to measure airway inflammation, may be

useful when managing sickle cell disease patients.

Randomized clinical trials are warranted to determine if aggressive treatment of

physician diagnosed asthma reduces the risk of ACS in SCD, and to determine whether

polymorphisms in candidate genes in the nitric oxide pathway contribute to ACS. Collaboration

among sickle cell centers for large clinical trials will be especially important for genome wide

association studies related to SCD and asthma. Studies of this nature require large numbers of

patients in order to identify genetic associations. Finally, stressing the importance for

cooperation between pulmonary and hematology clinics can only benefit future studies involving

SCD and asthma.









APPENDIX A
CONSENT FORM

THE NEMOURS CHILDREN'S CLINIC
JACKSONVILLE, FLORIDA
INFORMED WRITTEN CONSENT
You are being asked to volunteer in a research study. This form will explain the study. It

is important that you understand the study before deciding to be in it. You may ask the people in

charge of the study who are listed on this page questions about the study at any time.


WHAT IS THE TITLE OF THIS STUDY?
Polymorphisms of Nitric Oxide Synthase Genes in Sickle Cell Patients with Acute Chest

Syndrome

WHO ARE THE PEOPLE IN CHARGE OF THIS STUDY?


Principal Investigator:



Telephone number:

Sub-Investigators:


John Lima, Pharm.D.
Nemours Children's Clinic
807 Children's Way
Jacksonville, FL 32207
(904) 390-3483 (904) 390-3600 (operator)
(800) SOS-KIDS
Niranjan Kissoon, M.D.
Professor & Chief Pediatric Critical Care Medicine
University of Florida-Jacksonville
(904) 202-8758
Jim Sylvester, PhD
Nemours Children's Clinic
807 Children's Way
Jacksonville, FL 32207
(904) 390-3483 (904) 390-3600 (operator)
(800) SOS-KIDS
Kevin Sullivan, M.D.
Division of Pediatric Anesthesiology
Nemours Children's Clinic
807 Children's Way
Jacksonville, FL 32207
Phone Number: (904) 202-8332
Lewis Hsu, M.D.
Emory University
69 Butler St. SE
Atlanta, Georgia 30303
(404) 616-3545









Laurie Duckworth MSN, ARNP
Nemours Children's Clinic
807 Children's Way
Jacksonville, FL 32207
(904) 390-3483
(904) 390-3600 (operator)
(800) SOS-KIDS


WHO CAN I TALK TO ABOUT MY RIGHTS AS A STUDY SUBJECT?
Tim Wysocki, Ph.D.
Chairperson
Nemours-Florida IRB
Nemours Children's Clinic
807 Children's Way
Jacksonville, FL 32207
(904) 390-3698

WHAT IS THE PURPOSE OF THIS STUDY?
Some patients with sickle cell anemia may develop a condition called acute chest

syndrome (ACS). This condition is believed to be caused by the sickle red blood cells clogging

the blood vessels in the lungs. After repeated episodes of ACS, the blood pressure in the blood

vessels between the heart and lungs can remain high permanently. This condition is called

pulmonary hypertension.

The doctors who take care of children with sickle cell anemia have noticed that certain

children have a greater tendency to develop repeated episodes of acute chest syndrome while

others do not develop this complication. The reason for this is not clear. Likewise, intensive

care doctors who care for children with the acute chest syndrome have noticed that these children

respond dramatically to an inhaled gas called nitric oxide (NO) when they are extremely ill. NO

is a gas that is made in the cells that line the pulmonary (lung) blood vessels and is normally

made in our own bodies. We believe that children with sickle cell anemia who are prone to ACS

may not make enough NO in their pulmonary (lung) blood vessels. Recent research has shown









that patients with ACS have lower amounts of NO in the air they exhale when compared to

sickle cell patients who have not had ACS.

We believe that sickle cell patients with ACS produce very low quantities of NO in the

pulmonary (lung) system. We believe that this may be because some children have different

types of the protein (amino acid) that produces NO than others. This protein is called nitric oxide

synthase (NOS). Humans have three different types of the enzyme that produces NO. We want to

examine whether or not there is a link between tendency to suffer from ACS, and the type of

enzyme the patient has. This can be determined by studying your DNA (Studying genes or DNA

is becoming more common in clinical research studies, but is still in an early stage. We know

that certain genes make you tall or short. Certain genes give you brown or black hair). This will

be important to know because if there is a genetic or inherited component that determines how

severe the sickle cell disease will be it could be important for screening and lead to treatment that

may help avoid complications in groups that are at high risk of having ACS.


WHAT IS THE PURPOSE OF COLLECTING THESE SAMPLES FOR DNA
ANALYSIS?
You/your child are being asked to take part in this research study because you/your child

have sickle cell disease, or are a healthy volunteer. Similarly, certain genes are associated with

sickle cell disease, and may be associated with whether or not you/your child may develop ACS.

Studying DNA from people who have sickle cell disease may help us better understand the

importance of those genes and how they are involved in causing ACS.

You/your child are being invited to provide a sample of your/your child's buccal cells

(cells from your/your child's mouth) to test for DNA or genes related to sickle cell disease.

Participation is voluntary. You/your child do not have to provide a sample for DNA analysis.









We would also like to store some of your/your child's DNA in a bank (storage
facilities) so that it may be used in future studies of sickle cell disease.

WHO IS SPONSORING THIS STUDY?
This study is being sponsored by The American Lung Association who will pay Nemours

Children's Clinic for conducting this study.


WHO CAN BE IN THIS STUDY?
You may participate in this study if you have sickle cell disease. You may or may not

have had an ACS episode. You do no have to have sickle cell disease to participate, however,

you may participate as a healthy volunteer. You must be African American to participate.


HOW MANY OTHER PEOPLE WILL BE PARTICIPATING IN THIS STUDY?
This study will involve approximately 300 children, ages 6 and older, and adults from the

Jacksonville, Florida and Atlanta, Georgia area. This study lasts only as long as it takes for

you/your child to provide a buccal cell sample.

WHAT ARE THE PROCEDURES FOR THIS STUDY?

Buccal Samples

In order to provide a buccal sample, you/your child must not have eaten for one hour.

Then, you/your child will gargle a mouthful of water for the purpose of washing and spit out the

water. You/your child will receive a small bottle of mouthwash (Scope) and an empty tube,

which will be labeled with an identification number. You/your child will vigorously gargle a

mouthful of mouthwash for one minute and spit the gargled mouthwash into the coded tube. If

you/your child find it hard to gargle the mouthwash for one minute, you/your child can gargle

the mouthwash for shorter times, and repeat the procedure until you/your child have gargled for a

total of one minute (For example, you/your child can gargle a mouthful of mouthwash for 20









seconds, and gargle another mouthful of mouthwash for 20 seconds and repeat the procedure one

more time). The gargled mouthwash contains buccal cells from your/your child's mouth.

WHAT HAPPENS AFTER THE SAMPLES ARE COLLECTED?

The buccal cells will be processed and your/your child's DNA will be stored in our

laboratory at the Nemours Children's Clinic in Jacksonville, FL. You/your child will not be

notified of individual results and no results will appear in your/your child's medical records.

For those patients who have sickle cell disease, information from the medical record may

be collected, for example, how many episodes of acute chest syndrome you have had, and

number of hospitalizations.

WHAT ARE THE POTENTIAL RISKS OR DISCOMFORTS?

Any treatment has potential risks. The most common risks of the treatment used in this

study are listed below. In addition, there is always the risk of very uncommon or previously

unknown side effects.

DNA Testing

Even though we will be careful to not reveal the results of the DNA testing on your/your

child's sample, there is a very small chance this information could accidentally become known to

you, your child, your doctor, or others. Presently we know of no risk to you/your child if the

genetic results become known.

Gargling with Mouthwash

You/your child may experience burning or tingling in your/his/her mouth from gargling

with the mouthwash for one minute. You/your child can minimize burning or tingling by

gargling for shorter periods of time on more occasions until he/she has gargled for one minute.









WHAT ARE THE POTENTIAL BENEFITS TO ME/MY CHILD OR OTHERS?
There is no direct medical benefit to you/your child for participating in this study.

Although you/your child may not benefit directly from this research, there may be a benefit to

society, in general, from the knowledge gained in connection with your/your child's participation

in this study.


IS BEING IN THE STUDY VOLUNTARY?
Being in this study is totally voluntary. Anyone who does take part in the study can stop

being in it at any time. There will be no change to the medical care given to anyone who decides

not to be in it or who stops being in it. The researchers will destroy the samples obtained from

anyone in the study if they are asked to do so.


WHAT ARE ALTERNATIVE TREATMENT OR PROCEDURES?
There are no alternative procedures for this study other than you/your child can choose not

to participate.


WHAT HAPPENS IF MY CHILD DEVELOPS PROBLEMS FROM BEING IN THE
STUDY?
In the event that your child suffers any injury directly resulting from these studies, you

may contact any of the investigators listed on the front of this form. In the event that your child's

participation in this study results in a medical problem, treatment will be made available. No

other compensation of any type is available through Dr. Sylvester, Dr. Lima, Dr. Kissoon, Dr.

Hsu Dr. Sullivan, Laurie Duckworth or Nemours Children's Clinic. Nemours Children's Clinic

will not pay for treatment if your child suffers any injury related to this study.

You are responsible for reporting any adverse effects) to the investigator in charge as soon

as possible.









WHAT HAPPENS IF I DECIDE FOR MY CHILD NOT TO PARTICIPATE OR TO
WITHDRAW MY CHILD FROM THE STUDY?
If you decide that you do not want you/your child's samples to be studied any longer and

you wish your/your child's samples to be destroyed, you can notify the investigators listed on the

front of this form.

You understand that your consent for you/your child to participate in this study is given

voluntarily. You may withdraw yourself/your child from or decide not to participate in the study

at any time without prejudice. If you decide for yourself/your child to no longer participate in

this study, it will not affect your/your child's future health care at Nemours Children's Clinic.


CAN I/MY CHILD BE TAKEN OUT OF THE STUDY WITHOUT MY CONSENT?
Presently, there is no known reason for taking you/your child out of this study without

your consent. However, the study investigators can remove your sample from the study at any

time, for any reasons) deemed appropriate.


WHAT ARE THE COSTS FOR BEING IN THE STUDY?
There will be no charge to you or your insurance company for the tests involved in this

study.


HOW WILL PEOPLE BE PAID FOR BEING IN THIS STUDY?
You will not be paid for participating in this study. You will not receive, either now or in

the future, compensation, financial benefits, or any royalties which result from information

obtained from this study.


WILL I BE TOLD OF NEW FINDINGS WHILE THE STUDY IS IN PROGRESS?
Participants will be told of any significant new findings developed during the course of this

study that may relate to their willingness to continue participation in the study..









HOW WILL THE INFORMATION COLLECTED FROM AND ABOUT PEOPLE IN
THE STUDY BE PROTECTED?
All information will be maintained on a confidential basis. Your/your child's identity will

be protected to the extent permitted by law. Care will be taken to preserve the confidentiality of

all information. You/your child understand that a record of your/your child's progress while in

this study will be kept in a confidential file at Nemours Children's Clinic. The samples will be

coded with a unique identifying number and stored in a secure location. The confidentiality of

any central computer record will be carefully guarded and no information by which you/your

child can be identified will be released or published. However, information from this study will

be submitted to the American Lung Association and the Food and Drug Administration (FDA).

(It may be submitted to governmental agencies in other countries where the study drug

combination may be considered for approval.) Medical records which identify participants and

the signed consent form can be inspected by

* The sponsoring drug company or designee
* The U.S. Food and Drug Administration
* The U.S. Department of Health and Human Services
* Governmental agencies in other countries; and
* The Nemours Florida Institutional Review Board (a group of people who carefully review
the study activities and are responsible for protecting the safety and the rights of the
volunteers).

Because of the need to release information to these parties, absolute confidentiality cannot

be guaranteed. The results of this research project may be presented at meetings or in

publications; however, your child's identity will not be disclosed in those presentations.


WHO CONTROLS AND OWNS GENETIC MATERIALS?
The sample that you/your child provide will be stored for 10 years at Nemours Children's

Clinic.









You/your child's DNA samples will remain in possession of the Nemours Children's Clinic

and stored in Jacksonville, FL. The results of this genetic research might be valuable for

commercial and/or intellectual property (for example, patent) purposes. If you decide to

participate in this genetic research, you are giving your/your child's sample to Nemours

Children's Clinic. Nemours Children's Clinic retains sole ownership of the research results, and

of any use or development of the research records (including your/your child's sample)

consistent with this consent. You will not receive any financial benefit that might come from the

research results.

WILL I HAVE ACCESS TO THE GENETIC INFORMATION?
You/your child will not be notified of individual results from DNA tests and no results will

appear in your/your child's medical records.


HOW ELSE MIGHT THESE SAMPLES BE USED?
The samples obtained in this study will be analyzed for genes of related to sickle cell

disease and other related diseases. Samples will not be shared with other investigators.

Your/your child's DNA samples will not be sold. It is possible that we may wish to contact

you/your child for further study. If you do not want yourself/your child to be re-contacted for

further study, please indicate by checking the box below:

I do not wish (my child) to be re-contacted
I do wish (my child) to be re-contacted

PARENT'S (LEGAL REPRESENTATIVE) STATEMENT OF CONSENT
By signing this form, you have not waived any of the legal rights which your child

otherwise would have as a participant in a research study.









The signing of this consent does not absolve doctors from responsibility for proper medical
care at all times.
My signature indicates that I consent and authorize Drs. Lima, Kissoon, Sullivan
and whomever they may designate as their assistants including Nemours
Children's Clinic, its employees and its agents to perform upon
(Name of Patient) the research described
above.
I am making a decision whether or not to have my child or myself participate in
this study. I have read, or had read to me in a language that I understand, all of
the above, asked questions and received answers concerning areas I did not
understand, and willingly give my consent for my/my child's participation in this
study. Upon signing this form, I will receive a signed and dated copy.


Name of Participant (Print) Birthdate Signature of Participant Date

If participant is less than 18 years of age the parent/legal representative must give consent:


Name of Signature of Date
Parent/Legal Representative Parent/Legal representative


Name of Witness Signature of Witness Date
I the undersigned, certify that to the best of my knowledge the
subject/parent/legal representative signing this consent had the study fully and
carefully explained. He/she clearly understands the nature, risks and benefits in
his/her child's participation in this project.


Signature of Investigator/Designee Date









CHILDREN'S INFORMED ASSENT (for 6 to 12 year olds)
You are being asked to be in a research study. Before you decide whether you want to be in it,
we want to tell you about it so you can ask any questions you have about it.
The doctor in charge of the study is Dr. Lima. This doctor would like to find out if you have
certain genes that influence whether or not you develop acute chest syndrome (a lung disease
associated with sickle cell disease). Genes come from your mother and father and help make up
what you look like and how your body works.
If you decide to be in the study, here is what will happen. For this study, you will be asked to
gargle with a mouthwash.
To gargle, you will first wash out your mouth with water. You will then gargle some mouthwash
for one minute and spit the mouthwash into a tube. You can also choose to gargle the
mouthwash for shorter periods of time more than once until you have gargled mouthwash for one
minute.
You may feel burning or tingling from the mouthwash.
You don't have to do the study if you don't want to. If you are in the study, you can stop being it
at any time. Nobody will be upset at you if you don't want to be in the study or if you want to
stop being in the study. The doctors and their assistants will take care of you as they have in the
past. If you have any questions or don't like what is happening, please tell the doctor or assistant.
Your parent or guardian knows about this study. You have had the study explained to you and
you have been given a chance to ask questions about it. By writing your name below, you are
saying that you know what will happen to you in the study and that you want to be in it.


Child's Signature Signature of Witness


Researcher's Signature Date









APPENDIX B
DEMOGRAPHIC INFORMATION

MR#:


DOB:


AGE:


SEX: M F


Date enrolled:


Date of DNA Collection:


Date of Consent:


Name:


Study #

RACE:









APPENDIX C
MEDICAL HISTORY

Date of birth

Hb type SS SC S beta thel S other

Baseline pulse ox

Premature birth yes no

Asthma yes no

Reactive airway disease yes no

On any long term Antisickling therapy yes no

Episodes of ACS

Dates






Medications

PRN Albuterol
ICS
Singulair
Salmeterol









LIST OF REFERENCES


Akinbami, L.J., & Schoendorf, K.C.(2002). Trends in childhood asthma: prevalence, heath care
utilization, and mortality. Pediatrics: 110(2 Pt 1),315-322.

Alving, K., Weitzberg, E., & Lundberg, J.M. (1993). Increased amount of nitric oxide in exhaled
air of asthmatics. Eur Respir, 6,1268-1270.

Asano, K., Chee, C.B., Gaston, B., Lilly, C.M., Gerard, C., Drazen, J.M., & Stamler, J.S. (1994).
Constitutive and inducible nitric oxide synthase gene expression, regulation, and activity in
human lung epithelial cells. Proc Natl Acad Sci U.S.A., 91(21),10089-10093.

Atz, A.M., & Wessel, D.L. (1997). Inhaled nitric oxide in sickle cell disease with acute chest
syndrome. Anesthesiology. 87,998-990.

Balsinde, J.S., Barbour, E., Bianco, I.D.,& Dennis, E.A., (1994). Arachidonic acid mobilization
in P388D1 macrophages is controlled by two distinct Ca(2+)-dependent phospholipase A2
enzymes. Proc NatlAcad Sci U.S.A., 91,11060-11064.

Barnes, P.J., & Belvisi, M.G. (1993). Nitric oxide and lung disease. Thorax. 48,1034-1043.

Barnes, P.J. (1995). Nitric oxide in airway disease. Ann. Med., 27, 389-393.

Batra, J., Singh, T., Mabalirajan, U., Sinha, A., Prasad, R., Ghosh, B. (2006). Association of
inducible nitric oxide synthase with asthma severity, total serum immunoglobin E and
blood eosinophil levels. Thorax, 62, 16-22.

Bernini, J. C., Rogers, Z. R., Sandler, E. S., Reisch, J. S., Quinn, C. T., & Buchanan, G. R.,
(1998). Beneficial effect of intravenous dexamethasone in children with mild to
moderately severe acute chest syndrome complicating sickle cell disease. Blood 92,3082-
3089

Biernacki, W.A., Kharitonov, S.A., Diemacka, H.M., & Barnes, P.J. (2005) Effect of
Montelukast on exhaled leukotrienes and quality of life in asthmatic patients. Chest, 128,
1958-1963.

Boyd, J. H., Moinuddin, A., Strunk, R.C., & Debaun, M. R.(2004). Asthma and acute chest in
sickle-cell disease. Pediatr Pulmonology, 38, 229-232.

Boyd, J. H., Macklin, E. A., Strunk, R. C.,& Debaun. M. R.(2006). Asthma is associated with
acute chest syndrome and pain in children with sickle cell anemia. Blood, 108, 2923-2927.

Bryant, R. (2005). Asthma in the pediatric sickle cell patient with acute chest syndrome. J
Pediatr Health Care, 19, 157-162.

Buchanan, G.R., Debaun, C.T., & Steinberg, M..H. (2004). Sickle cell disease. Hematology AM
Soc Hematol. Educ. Program, 35-47.









Busse, W.W., & Holgate, S.T. (1998). Evidence from induced sputum. Inflammatory
mechanisms in asthma. (pp. 75-81). New York, NY: Marcel Dekker Inc.

Busse, W.W., & Holgate, S.T. (1998). Mediator Functions of Epithelial Cells. Inflammatory
Mechanisms in Asthma. (p.479). New York, NY: Marcel Dekker Inc.

Calabrese, C., Triggiani, M., Marone, G., & Mazzarella, G. (2000). Arachidonic acid metabolism
in inflammatory cells of patients with bronchial asthma. Allergy 55 Suppl 61, 27-30.

Chaar, V., Tarer. V., Etienne-Julan, M., Diara, J., Elion, J., & Romana, M.(2006). ET-1 and
eNOS gene polymorphisms and susceptibility to acute chest syndrome an painful vaso-
occlusive crises in children with sickle cell anemia. Haematologica. 91(9) ,1277-1278.

Cicutto L.C., & Downey, G.P. (2004). Biological markers in diagnosing, monitoring, and
treating asthma: a focus on noninvasive measurements. AACNClin Issues, 15(1), 97-111.

Collaborative Study on the Genetics of Asthma (CSGA)(1997). A genome wide search for
asthma susceptibility loci in ethnically diverse populations. Nature Genetics, 15, 389-392.

Collins, F., Green, E., Guttmacher, A., & Guyer, M. (2003). A vision for the future ofgenomics
research. A blueprint for the genomic era. Nature. 422, 835-847.

Coultas, D., Gong, H., & Grad, R. (1993). Respiratory diseases in minorities of the United
States. Am J Respir Crit Care. (149), S93-131.

De Boer, J., Duyvendak, M., Schuurman, F., Pouw, F., Zaagmsaj., & Meurs, H.(1999). Role of
L-arginine in the deficiency of nitric oxide and airway hyperactivity after the allergen-
induced early asthmatic reaction in guinea pigs. Br JPharmacol 128, 1114-1120.

Dennis, E. A. (1994). Diversity of group types, regulation, and function of phospholipase A2. J
Biol Chem 269, 13057-13060.

Deykin, A. (2005). Targeting biologic markers in asthma-is exhlaed nitric oxide the bul's eye.
The New England Journal of Medicine, 352 21, 2233-2235.

Dinh-Xuan, A.T.(1992). Endothelial modulation of pulmonary vascular tone. Eur Respir J. 5,
757-762.

Duckworth, L., Hsu, L., Feng, H.., Wang, J., Sylvester, J.E., Kissoon, N., Sandler, E., & Lima, J.
(2007). Physician -Diagnosed Asthma and Acute Chest Syndrome: Associations with
NOS Polymorphisms. Pediatric Pulmonology, 42(4), 332-338.

Dupuy, P. M., Shore, S.A., Drazen, J.M., Frostgell, C., Hill, W.A., & Zapol, W.M. (1992).
Bronchodilator action of inhaled nitric oxide in guinea pigs. J Clin Invest. 90, 421-428.

Enwonwu, C.O., Xu, S.X., Turner, E. (1990). Nitrogen metabolism in sickle cell anemia: free
amino acids in plasma and urine. Am J Med Sci., 300(6), 366-371.









Fagan, J. K., Scheff, P.A., Hryhorczuk, D., Ramakrishnan, V., Ross, M., & Persky, V. (2001).
Prevalence of asthma and other allergic diseases in an adolescent population: association
with gender and race. Ann Allergy Asthma Immunol 86, 177-184.

Frostell, C., Hogman, M., Hedenstrom, H., & Hedenstierna, G. (1993). Is nitric oxide inhalation
beneficial to the asthmatic patient? Am Rev Respir Dis. 147:,A515.

Ford, J.G., & McCaffrey, L. (2006). Understanding disparities in asthma outcomes among
African Americans.Clin Chest Med. 27(3), 423-30.

Furchgott. R.F.,& Zawadzki, J.V. (1980). The obligatory role of endothelial cells in the
relaxation of arterial smooth muscle by acetylcholine. Nature. 288, 373-376.

Gaston, B., Drazen, J.M., Loscalzo, J., & Stamler, J.S. (1994). The biology of nitrogen oxides in
the airways. Am JRespir Crit Care Med. 149, 538-551.

Gaston, B., Drazen, J., & Jonsen, A. (1994). Relaxation of bronchial smooth muscle by S-
nitrosothiols invitro. JPharmacolExp Ther. 268, 978-985.

Getahun, D., Demissie, K., Rhoads, G.G. (2005). Recent trends in asthma hospitalization and
mortality in the United States. Journal ofAsthma. 42, 373-378.

Gladwin, M. T., Schechter, A. N., Shelhamer, J.H., & Ognibene, F.P., (1999). The acute chest
syndrome in sickle cell disease. Possible role of nitric oxide in its pathophysiology and
treatment. Am JRespir Crit Care Med, 159, 1368-1376.

Goldman L, & Ausiello D. (2004). Cecil Textbook of Medicine. 22nd ed. Philadelphia, Pa: WB
Saunders; 1030-1039.

Grasemann, H., et al. (1999). Simple tandem repeat of polymorphisms in the neuronal nitric
oxide synthase gene in different ethnic populations. Human Heredity, 139-141.

Grasemann, H., Yandava, C.N., & Drazen, J.M. (1999). Neuronal NO synthase (NOS1) is a
major candidate gene for asthma. Clinical and Experimental Allergy, 29, 39-41.

Grasemann, H., Storm vans's Gravesande, K., Buscher, R., Drazen, J.M., & Ratjen, F. (2003).
Effects of sex and of gene variants in constitutive nitric oxide synthase on exhaled nitric
oxide. American Journal ofRespiratory Critical Care, 167(8) ,1113-6.

Gustafsson, L.E. (1998). Exhaled nitric oxide as a marker in asthma. European Respiratory
Journal, 11(Suppl.), 4s-52s.

Hammerman, S.I., Klings, E.S., Hendra, K.P., Upchurch, G.R., Rishikof, D.C., Loscalzp, J., &
Farber, H.W. (1999). American Journal ofPhysiology, (Heart and Circulatory
Physiology), 277, 1579-1592.

Hart, C.M. (1999). Nitric oxide in lung disease. Chest, 111(5), 1407-1417.









Hoffman R, Benz Jr. EJ, & Shattil SJ, et al., (2005). Hematology: Basic Principles and Practice.
4th ed. Philladelphia, Pa: Churchill Livingston.

Holgate, S.T. (1997). The cellular and mediator basis of asthma in relation to natural history.
Lancet. 350 :5-9.

Holla, L.I., Buckova, D., Kuhrova, V., Stejkalova, A., Francova, H., Znojil, V., & Vacha, J.
(2002). Prevalence of endothelial nitric oxide synthase gene polymorphisms in patients
with atopic asthma. Clinical and Experimental Allergy, 32 :1193-1198.

Ignarro, L.J., Buga. G.M., Wood, K.S., Byrns, R.E., & Chaudhuri,G.(1987). Endothelium
derived relaxing factor produced and released from artery and vein in nitric oxide.
Proceedings of the National Academy of Sciences U.S.A., 84, 9265-9269.

Jain, B., Rubenstein, I., Robbins, R.A., Leise, K.L., & Sisson, J.H. (1993). Modulation of airway
epithelial cell ciliary beat frequency by nitric oxide. Biochemical andBiophysical
Research Communications, 26, 83-88.

Joseph, C. L., Williams, L.K., Ownby, D.R., Saltzgaber, J., & Johnson, C.C. (2005). Applying
epidemiologic concepts of primary, secondary, and tertiary prevention to the elimination of
racial disparities in asthma. Journal of Allergy Clinical Immunology, 117(2), 233-240.

Khairtonov, S.A., Yates, D.H., Robbins, R.A., et al. (1994). Increased nitric oxide in exhaled air
of asthmatic patients. Lancet, 343,133-135.

Kharitonov, S.A., Lubec, G., Lubec, B., Hjelm, M., & Barnes, P.J. (1995). Clinical Science
(Lond), 88, 135-139.

Kharitonov, S.A., Yates, D.H., Chung, K.F., & Barnes, P.J. (1996). Changes in the dose of
inhaled steroids affect exhaled nitric oxide levels in asthmatic patients. European
Respiratory Journal, 9, 196-201.

Kharitonov, S., & Barnes, P.J. (2007). Exhaled Biomarkers. Chest, 130,1541-1456.

Klings, E. S. Wyszynski, D.F., Nolan, V.G., & Steinberg, M.H.. (2006). Abnormal pulmonary
function in adults with sickle cell anemia. American Journal Respiratory Critical Care
Medicine, 173, 1264-1269.

Knight-Madden, J. M., T. S. Forrester, N. A. Lewis, & A. Greenough. (2005). Asthma in
children with sickle cell disease and its association with acute chest syndrome. Thorax 60,
206-210

Kobzik, L., Bredt Lowenstein, C.J., Drazen, J., Gaston, B., Sugarbaker, D.,& Stamler, J.S.
(1993). Nitric oxide synthase in human and rat lung: immunocytochemical and
histochemical localization. American Journal of Respiratory Cellular Molecular Biology.,
9, 371-377.

Koshland, D.E. (1992). The molecule of the year. Science, 258, (5090), 1861.









Koumbourlis, A., Hurlet-Jensen, A.C., & Bye, M.R. (1997). Lung function in infants with sickle
cell disease. Pediatr Pulmonology, 24:277-281.

Koumbourlis, A. C., Zar, H.J., Hurlet-Jensen, A.,& Goldberg, M.R.. (2001). Prevalence and
reversibility of lower airway obstruction in children with sickle cell disease. Journal of
Pediatrics, 138, 188-192.

Leeman, M.,& Naeije, R. (1995). Nitric oxide and hypoxic pulmonary hypertension (editorial)
European Respiratory Journal, 8, 513-514.

Leong, M. A., Dampier, C., Varlotta, L., & Allen, J.L. (1997). Airway hyperreactivity in children
with sickle cell disease. JPediatr, 131:278-283.

Lieu, T.A., Lozano, P., Finkelstein, J.A., Chi, F.W. et al (2002). Racial/Ethnic variation in
asthma status and management practices among children in managed medicaid.
Pediatrics. 109(5), 857-865.

Lopez, B.L., Kreshak, A.A., Morris, C.R., Davis-Moon, L., Ballas, S.K., Ma, X.L. (2003). L-
arginine levels are diminished in adult acute vaso-occlusive sickle cell crisis in the
emergency department. Br. J. Haematol., 120, 552-534.

Lugogo, N.L., Kraft, M. (2006). Epidemiology of Asthma. Clin Chest Med, 27(1):1-15.

Luiking, Y.C., Poeze, M., Dejong, C.H., Ramsay, G., Deutz, N.E.(2004). Arginine availability in
sepsis. Critical Care Medicine, 32(10), 2135-2145.

Lum, A., LeMarchand, L. (1998). A simple mouthwash method for obtaining genomic DNA in
molecular epidemiological studies. Cancer Epidemiol Biomarkers Prev. 7(8): 719-724.

Mannino, D.M., Homa, D.M., Akinbami, L., Moorman, J.E., Gwynn, C., & Redd, S.C. (2002).
Surveillance for asthma-United States 1980-1999. MMAWR: Surveillance Summaries,
29;51(1),1-13.

Marsden, P., Heng, H., Duff, c., Shi, X., Tsui, L., & Hall, A. (1994) Localization of the human
gene for inducible nitric oxide synthase (NOS2) to chromosome 17ql 1.2-q12. Genomics,
19, 183-185.

Massaro, P.P., Gaston, B., Dieter, K., Fanta, C., Stamler, J.S., & Drazen, J.M. (1995). Expired
nitric oxide levels during treatment of acute asthma. American Journal Respiratory
Critical Care Medicine, 152,800-803.

Massaro, A.P., Mehta, S., Lilly, C.M., Kobzik, L., Reilly, J., Drazen, J.M. (1996). Elevated nitric
oxide concentrations in isolated lower airway gas of asthmatic subjects. American Journal
Respiratory Critical Care Medicine, 153, 1510-1514.

McCoy, K., Shade, D.M., Irvin, C.G., Mastronarde, J.G., Hanania, N.A., Castro, M., Anthonisen,
N.R. (2006). Predicting episodes of poor asthma control in treated patients with asthma.
Journal of Allergy and Clinical Immunology, 118(6), 1226-1233.









Mehta, S.R., Annan, A.A., Byrns, P.J.(2006). Opportunities to improve outcomes in sickle cell
disease. American Family Physician. 74(2), 303-306.

Meurs, H., McKay, S., Maarsingh, H., Hamer, M., Macic, L., Molendijk, N., Zaagsma, J. (2002).
Increased arginase activity underlies allergen-induced deficiency of cNOS derived nitric
oxide and airway hyperresonsiveness. British Journal ofPharmacology, 136:391-398.

Meurs, H., H. Maarsingh, and J. Zaagsma. (2003). Arginase and asthma: novel insights into
nitric oxide homeostasis and airway hyperresponsiveness. Trends in Pharmacological
Sciences, 24, 450-455.

Moncado, S., Higgs, A., (1993). The L-arginine nitric oxide pathway. The New England Journal
of Medicine, 329, 2002-2012.

Morris, C.R., Kuypers, F.A., Larkin, S., Vinchinsky, E.P., Styles, L.A.(2000). Patterns of
arginine and nitric oxide in patients with sickle cell disease with vaso-occlusive crisis and
acute chest syndrome. Journal of Pediatric Hematology Oncology, 22, 515-520.

Morris, S.(2002). Regulation of enzymes of the urea cycle and arginine metabolism. Annual
Review ofNutrition, 22:87-105.

Morris, C. R., M. Poljakovic, L. Lavrisha, L. Machado, F. A. Kuypers, and S. M. Morris, Jr.
(2004). Decreased arginine bioavailability and increased serum arginase activity in asthma.
American Journal ofRespiratory Critical Care Medicine, 170, 148-153.

Morris, C. R., F. A. Kuypers, S. K. Larkin, E. Vichinsky, and L. A. Styles. (2006). Patterns of
Arginine and Nitric Oxide in Patients With Sickle Cell Disease With Vaso-occlusive Crisis
and Acute Chest Sydrome. Journal of Pediatric Hematology Oncology, 515-520.

Naprawa, J. T., B. K. Bonsu, D. G. Goodman, and M. A. Ranalli. (2005). Serum biomarkers for
identifying acute chest syndrome among patients who have sickle cell disease and present
to the emergency department. Pediatrics, 116, e420-e425

Nathan, C., Xie, Q.W. (1994). Nitric oxide synthase : roles, tolls, and controls. Cell, 78, 915-
918.

National Asthma Education and Prevention Program Expert Panel (2002). Guidelines for the
Diagnosis and Management of Asthma. Journal ofAllergy and Clinical Immunology,
(Suppl.1), 142-144.

National Center for Health Statistics. (2003). U.S. Department of Health and Human Services,
Centers for Disease Control and Prevention. National Center for Health Statistics. Series
10, Number 223:p. 4.

National Heart, Lung and Blood Institute (2003). National Asthma Education Program Expert
Panel Report: Guidelines for the Diagnosis and Management of Asthma. Bethesda (MD):
National Institutes of Health.









National Heart, Lung and Blood Institute (1995). Global initiative for asthma: global strategy for
asthma management and prevention. Bethesda (MD): National Institutes of Health.

Nordness, M. E., J. Lynn, M. C. Zacharisen, P. J. Scott, and K. J. Kelly. (2005). Asthma is a risk
factor for acute chest syndrome and cerebral vascular accidents in children with sickle cell
disease. Clinical and Molecular Allergy, 3,2.

Nussbaum, R., Mc Innes, R., Willard, H. (2004).Genetics in Medicine. (6th ed)..Saunders,
Philadelphia, Pennssylvania..

Ober, C., Cox, N., Abney, M., Di Rienzo, A., Lander, E., Changyaleket, B., Cidley, H., Kurtz,
B., Lee, J., Nance, M., & Petterson, A. (1998). Genome-wide search for asthma
susceptibility loci in a founder population. Human Molecular Genetics, 7, 1393-1398.

O'Byrne, P.M. (1996). Airway inflammation and asthma. Alimentary Pharmacology and
Therapeutics, 10,18-24.

Palmer, R.M., Ashton, D.S., & Moncada, S., (1988). Vascular endothelial cells synthesize nitric
oxiede from L-arginine. Nature, 333 664-666.

Pepko-Zaba, J., Higenbottam, T.W., Dinh-Xuan, A.T., Stone, A., & Wallwork, J. (1991). Inhaled
nitric oxide as a cause of selective pulmonary vasodilatation in pulmonary hypertension.
Lancet, 338, 1173-1174.

Piacentini, G.L., Bodini, A., Costella, S., Vicentini, L., Mazzi, P., & Sperandio, S., (1999).
Exhaled nitric oxide and sputum eosinophil markers of inflammation in asthmatic children.
European Respiratory Journal, 13, 1386-1390.

Platt, O.S., Brambilla, D.J., Rosse, W.F., Milner, P.F., Castro, O., Steinberg, M.H., & Klug, P.P.
(1994). Mortality in sickle cell disease: life expectancy and risk factors for early death. The
New England Journal ofMedicine, 337, 762-769.

Puddu, G.M., Cravero, E., Armone, G., Muscari, A., & Puddu, P.(2005). Molecular aspects of
atherogenesis: new insights and unsolved questions. Journal of Biomedical Sciences, 1-15.

Ratnawati, R., & Thomas, P.S.(2005). Exhaled nitric oxide in pediatric asthma. Chronic
Respiratory Disease, 2(3), 163-174.

Robbins, R.A., Barnes, P.J., Springall, D.R., Warren, J.B.,& Kwon, L.D. (1994, Aug).
Expression of inducible nitric oxide synthase in human bronchial epithelial cells.
Biochemistry and Biophysiology Research Communications, 203, 209-218.

Robbins, R.A., Florcani, A.A., Von Essen, S.G. (1996). Measurement of exhaled nitric oxide by
three different techniques. American Journal ofRespiratory Critical Care Medicine,
153:1631-1635.

Robinson, L., Weremowicz, W., Morton, C., & Michel, T. (1994). Genomics. 19: 350-357









Rosias, P.P., Dompeling, E., Dentener, M.A., Pennings, H.J., Hendriks, H.E., Van lersel, M., &
Jobsis, Q. (2004). Childhood asthma: exhaled markers of airway inflammation, asthma
control score, and lung function tests. Pediatric Pulmonology. 38, 107-114.

Santoli, F., Zerah, F., Vasile, N., Bachir, D., Galacteros, F., & Atlan, G. (1998). Pulmonary
function in sickle cell disease with or without acute chest syndrome. European Respiratory
Journal, 12, 1124-1129.

Scully, R.E., Mark, E.J., Mc Neely, W.F., Ebeling, S.H., & Phillips, L.D., (1997). Case records
of Massachusetts General Hospital: Case 34-1997. The New England Journal of Medicine,
337, 1293-1301.

Sharan, K., S. Surrey, S. Ballas, M. Borowski, M. Devoto, K. F. Wang, E. Sandler,& M. Keller.
(2004). Association of T-786C eNOS gene polymorphism with increased susceptibility to
acute chest syndrome in females with sickle cell disease. British Journal ofHaematology,
124, 240-243.

Shaul, P.W., North, A.J., Wu, L.U., wells, L.B., & Brannon, T.S. (1994) Endothelial nitric oxide
synthase is expressed in cultured human bronchiolar epithelium. Journal of Clinical
Investigation, 94(6) ,2231-2236.

Shaul, P. (2002). Regulation of endothelial nitric oxide synthase: location, location, location.
Annual Review ofPhysiology, 64, 749-774.

Smith, A., Cowan, J., Brassett, K., Herbison, P., & Taylor, D. (2005). Use of Exhaled Nitric
Oxide Measurements to Guide Treatment in Chronic Asthma. The New England Journal of
Medicine, (12) 352, 2163-2173.

Stamler, J.S., Jaraki, O., & Osborne, J. (1992). Nitric oxide circulates in mammalian plasma
primarily as an S-nitroso adduct of serum albumin. Proceedings of the National Academy
of Science U.S.A., 89, 7674-7677.

Storm Van's Gravesande, K., Mattes, J., Endlicher, A., & Alving, K. (2004). Effect of two doses
of budesonide on exhaled nitric oxide and urinary EPX excretion in asthmatic children.
Pneumologie, 58(7), 483-8

Stuart, M. J., & Setty, B.N. (1999) Sickle cell acute chest syndrome: pathogenesis and rationale
for treatment. Blood, 94, 1555-1560

Stuart, M. J.& B. N. Setty. (2001). Acute chest syndrome of sickle cell disease: new light on an
old problem. Current Opinions Hematology, 8, 111-122.

Styles, L. A., Schalkwijk, C.G., Aarsman, A.J., Vichinsky, E.P., Lubin, B.H., & Kuypers F.A.
(1996). Phospholipase A2 levels in acute chest syndrome of sickle cell disease. Blood, 87,
2573-2578.









Styles, L. A., Aarsman, A.J., Vichinsky, E.P., & Kuypers, F.A. (2000). Secretory phospholipase
A(2) predicts impending acute chest syndrome in sickle cell disease. Blood, 96, 3276-
3278.

Sullivan, K.J., Kissoon, N., Duckworth, L.J., Sandler, E., Freeman, B., & Bayne, E. (2001). Low
Exhaled Nitric Oxide and a Polymorphism in the NOS I Gene Is Associated with Acute
Chest Syndrome. American Journal of Respiratory Critical Care Medicine, 164, 2186-
2190.

Sylvester, K.P., Patey, R.A., Broughton, S., Rafferty, G.F., Rees, D., Thein, S.L., & Greenough,
A.(2007). Temporal Relationship of Asthma to Acute Chest Syndrome in Sickle Cell
Disease. Pediatric Pulmonology, 42, 103-106.

Sylvester, K.P., Patey, R.A., Milligan, P., Dick, M., Rafferty, G.F., Rees, D., Thein, S.L., &
Greenough, A. (2004). Pulmonary function abnormalities in children with sickle cell
disease. Thorax, 59, 67-70.

Sylvester, K. P., Patey, R.A., Milligan, P., Rafferty, G.F., Broughton, S., Rees, D., Thein, S.L., &
Greenough, A. (2006). Impact of acute chest syndrome on lung function of children with
sickle cell disease. JPediatr 149:17-22.

Vallance, P., Collier, J., & Moncada, S.(1989). Effects of endothelium derived nitric oxide on
peripheral arteriolar tone in man. Lancet, 2, 997-1000.

Vargas, A., Da Silva, M., Silla, L., & Chies, J. (2005). Polymorphisms of chemokine receptors
and eNOS in Brazilian patients with sickle cell disease. Tissue Antigens, 66, 683-690.

Vercelli, D. (2003). Arginase : marker, effector, or candidate gene for asthma ? The Journal of
Clinical Investigation, 111, 1815-1816.

Vichinsky, E., Styles, L. (1996). Sickle cell disease. Pulmonary complications. Hematology/
Oncology Clinics of North America, 10,1275-1287.

Vichinsky, E. P,. Neumayr, L., Earles, A.N., Williams, R., Lennette, E.T., Dean, D., Nickerson,
B., Orringer, E., McKie, V., Bellevue, R., Daeschner, C., & Manci, E.A. (2000). Causes
and outcomes of the acute chest syndrome in sickle cell disease. National Acute Chest
Syndrome Study Group. The New England Journal of Medicine, 342, 1855-1865.

Vichinsky, E., Williams, R., Das, M., Earles, A.N., Lewis, N., Adler, A., & McQuitty, J. (1994).
Pulmonary fat embolism: a distinct cause of severe acute chest syndrome in sickle cell
anemia. Blood, 83, 3107-3112.

Waugh, W.H., Daeschner, C.W., Files, B.A., McConnell, M.E., & Strandjord, S.E. (2001). Oral
citrulline as arginine precursor may be beneficial in sickle cell disease: early phase two
results. Journal of the National Medical Association, 93, 363-371.









Wechsler, M. E., Grasemann, H., Deykin, A., Silverman, E.K., Yandava, C.N., Israel, E., Wand,
M., & Drazen, J.M. (2000). Exhaled nitric oxide in patients with asthma: association with
NOS1 genotype. American Journal of Respiratory Critical Care Medicine, 162, 2043-
2047.

Williams, N. (1998). NO news is good news...but only for three Americans. Science, 282,
(5389), 610-611.

Xia, Y., & Zweir, J.L. (1997). Superoxide and peroxynitrite generation from inducible nitric
oxide synthase in macrophages. Proceeings of the National Academy of Sciences U.S.A.,
94, 6954-6958.

Yates, D.H. (2001). Role of exhaled nitric oxide in asthma. Immunology and Cell Biology, 79,
178-190.

Yeatts, K.B. & Shy, C.M. (2001). Prevalence and consequences of asthma and wheezing in
African-American and White adolescents. Journal ofAdolescent Health, 29, 314-319.

Yetik-Anacak, G., & Catravas, J.D. (2006). Nitric oxide and the endothelium: History and
impact on cardiovascular disease. Vascular Pharmacology, 45, 268-276.

Yildiz, P., Oflaz, H., Cine, N., Genchallac, H., Erginel-Unaltuna, N., Yildiz, A., & Yilmaz, V.
(2004). Endothelial dysfunction in patients with asthma : The role of polymorphisms of
ACE and endothelial genes. International Archives ofAllergy and Immunology, 41, 159-
166.

Zeidler, M.R., Kleerup, E.C., & Tashkin, D.P. (2004). Exhaled nitric oxide in the assessment of
asthma. Current Opinion in Pulmonary Medicine, 10(1), 31-6.

Zimmermann, N., King, N.E., Laporte J., Yang, M., Mishra, A., Pope, S.M., Muntel, E.E., Witte,
D.P., Pegg, A.A., Foster, P.S., Hamid, Q., & Rothenberg, M.E. (2003). Dissection of
experimental asthma with DNA microarray analysis identifies arginase in asthma
pathogenesis. Journal of Clinical Investigation, 111, 1863-1874.

Zimmermann, N., & RothenbergM.E. (2005). The arginine-rginase balance in asthma and lung
inflammation. European Journal ofPharmacology, 533, 253-263.

Zoratti, E.M., Havstad, S., Rodriguez, J., Robens-Paradise, Y., Lafata, J.E., & McCarthy, B.
(1998). Health service use by African Americans and Caucasians with asthma in a
managed care setting. American Journal ofRespiratory Critical Care Medicine, 158, 371-
377.









BIOGRAPHICAL SKETCH

Laurie Duckworth, native Floridian, grew up in Miami, Florida. She received her Bachelor

of Science in Nursing with honors from Florida State University in 1983 and began her career as

a registered nurse in the burn unit at Jackson Memorial Hospital, Miami, Florida. In 1985 she

relocated to Jacksonville, Florida and was employed as a pediatric intensive care nurse. In 1987

she joined Nemours Children's Clinic, Jacksonville, Florida as a registered nurse and clinic

coordinator. For the past 17 years she has served as a clinical research coordinator in the

Biomedical Research Department with a focus on pulmonary disorders, specifically asthma and

acute chest syndrome. She enrolled in the accelerated BSN to PhD program at the University of

Florida in 2001 and completed her Masters of Science in Nursing degree and received her license

as a nurse practitioner in 2003. She is a member of Sigma Theta Tau, Council for the

Advancement of Nursing Science, Florida Nurse Practitioners Association, Association of

Clinical Research Professionals, and the Florida Nurse's Association.

The summer of 2003 she was awarded a competitive grant from the National Institutes of

Nursing Research, National Institutes of Health for a fellowship in genetics and completed a

minor degree in genetics at Georgetown University. In 2006 she presented at the National

Congress for Nurse Scientists in Washington, D.C. As a nurse scientist, she realizes the

importance of how she may contribute to society through scientific research. She strongly

believes that dissemination of knowledge through research in a multidisciplinary setting will

enhance and contribute to evidence-based practice.





PAGE 1

1 POLYMORPHISMS IN CANDIDATE GENES FOR THE NITRIC OXIDE PATHWAY IN SICKLE CELL PATIENTS WITH ACU TE CHEST SYNDROME AND ASTHMA By LAURIE JILL DUCKWORTH A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2007

PAGE 2

2 2007 Laurie Jill Duckworth

PAGE 3

3 To my children, Lindsay and Lesley Duckworth, fo r their love, support, a nd patience. To my parents, Louis and Lorraine Doucette, for believi ng in me. To all who nurtured my intellectual curiosity making this milestone possible.

PAGE 4

4 ACKNOWLEDGMENTS I sincerely thank my doctoral committee, Dr s. Joyce Stechmiller, Julie Johnson, Veronica Feeg, John Lima, and Lorraine Frazier, for th eir mentorship, guidance, and support. The expertise of each member has contributed greatly to the completion of my dissertation. I could not have succeeded without them. As chair of my committee, Dr. Joyce Stechmille r has served as an extraordinary teacher and mentor. Her encouragement and positive nature has given me the confidence to explore my research interest and believe in my contribution to the science of the nursing profession. Special thanks to Dr. John Lima who not only served as a mentor but whom also provided daily encouragement throughout this process. I coul d not have succeeded without his guidance and support. I would like to thank Dr. Niranjan Kissoon for providing the opportunity to develop my research interest in nitric oxi de. Special recognition goes to Jainwei Wang for enduring endless questions related to genotypi ng. Also, Hua Feng for navigating me through the statistical analyses for this project. My co-workers for their patience and understanding over the past several years, I could not have completed this task without your support. Finally, I thank my friends for their love and support.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS...............................................................................................................4 LIST OF TABLES................................................................................................................. ..........7 LIST OF FIGURES................................................................................................................ .........8 LIST OF ABBREVIATIONS..........................................................................................................9 ABSTRACT....................................................................................................................... ............10 CHAPTER 1 INTRODUCTION..................................................................................................................12 Background and Significance.................................................................................................14 Acute Chest Syndrome and Nitric Oxide........................................................................14 Nitric Oxide Synthase Enzymes......................................................................................15 Nitric Oxide, Airway Inflammation, ACS, And Asthma................................................16 Significance of Research....................................................................................................... .16 Research Aims and Hypotheses..............................................................................................17 Specific Aim 1.................................................................................................................17 Hypothesis..................................................................................................................... ..17 Specific Aim 2.................................................................................................................17 Hypothesis..................................................................................................................... ..17 Significance to Nursing........................................................................................................ ..17 Theoretical Framework.......................................................................................................... .18 2 MATERIALS AND METHODS...........................................................................................21 Subjects....................................................................................................................... ............21 Sample and Setting..........................................................................................................21 Inclusion Criteria.............................................................................................................21 Exclusion Criteria............................................................................................................21 Methods And Procedures........................................................................................................22 Study Design...................................................................................................................22 Consent........................................................................................................................ ....22 Demographic Information...............................................................................................22 Medical History...............................................................................................................22 Acute Chest Syndrome Diagnosis...................................................................................22 Asthma Diagnosis............................................................................................................23 Isolation of Genomic DNA.............................................................................................23 Genotyping..................................................................................................................... .24 Statistical Analysis........................................................................................................... .......25

PAGE 6

6 3 LITERATURE REVIEW.......................................................................................................28 Sickle Cell Disease............................................................................................................ .....28 Acute Chest Syndrome...........................................................................................................29 Asthma......................................................................................................................... ...........30 Nitric Oxide................................................................................................................... .........31 Historical Events Leading to th e Discovery of Nitric Oxide..........................................32 Nitric Oxide Mechanisms of Action.............................................................................33 Exhaled Nitric Oxide and Airway Disease.............................................................................35 Associations between NOS Genetic Variants and ACS.........................................................38 NOS Genes and Association with Asthma.............................................................................40 Nitric Oxide Synthase 1 (nNOS).....................................................................................40 Nitric Oxide Synthase 2 (iNOS)......................................................................................41 Nitric Oxide Synthase 3 (eNOS).....................................................................................42 Nitric Oxide and Acute Chest Syndrome...............................................................................42 Arginase Genes and Asthma...................................................................................................43 Impact of Genetics............................................................................................................. .....44 Genetic Influence.............................................................................................................. ......44 Analysis Of Ethical, Social, Politic al, Economic, and/or Cultural Issues..............................45 Limited understanding of etiology of ACS............................................................................47 Similarities and Differences Between Asth ma and ACS with Regard to Symptomology and Lung Function..............................................................................................................48 4 RESULTS........................................................................................................................ .......51 Descriptive Results............................................................................................................ .....51 Genotyping..................................................................................................................... ........51 Asthma and Acute Chest Syndrome.......................................................................................52 Genetic Associations........................................................................................................... ...52 5 DISCUSSION..................................................................................................................... ....58 Study Limitations.............................................................................................................. ......59 Implications for Clinical Practice...........................................................................................62 6 FUTURE WORK....................................................................................................................64 APPENDIX A CONSENT FORM..................................................................................................................66 B DEMOGRAPHIC INFORMATION......................................................................................77 C MEDICAL HISTORY............................................................................................................78 LIST OF REFERENCES............................................................................................................. ..79 BIOGRAPHICAL SKETCH.........................................................................................................89

PAGE 7

7 LIST OF TABLES Table page 4-1 Characteristics of self-identified African Americans with sickle cell disease who had at least one episode of acute chest syndrom e (cases) and individuals with no episodes of acute chest syndrome (controls)....................................................................................54 4-2 Comparison of Hardy-Weinberg Equilibri a (HWE) and minor allele frequencies of NOS 1, NOS 3 and ARG I polymorphisms in 134 patients with sickle cell disease (SCD) and 74 healthy controls...........................................................................................54 4-3 Influence of physician-diagnosed asthma on th e risk of having at least one episode of acute chest syndrome in patients with sick le cell disease (cases) compared to no physician-diagnosed asthma (controls)..............................................................................55 4-4 Association between ARG1 A2/A1 poly morphism and asthma among SCD patients.....57

PAGE 8

8 LIST OF FIGURES Figure page 1-1 Metabolic pathways for Arginine, Arginase Nitric oxide synthase, and Nitric oxide......20 2-1 Diagram of study protocol.................................................................................................27 4-1 Comparison of distributions of allele s carrying AAT repeats in intron 13 on NOS 1 gene........................................................................................................................... .........55 4-2 Prevalence of physcian-diagnosed asth ma and acute chest syndrome episodes................56 4-3 Risk of ACS and NOS 1 AAT repeats in intron 13...........................................................57

PAGE 9

9 LIST OF ABBREVIATIONS ACS acute chest syndrome AAT intronic repeat NOS1 gene DNA deoxyribonucleic acid FENO exhaled nitric oxide ICS inhaled corticosteroid NO nitric oxide cNOS constitutive n itric oxide synthase eNOS endothelial nitric oxide synthase (NOS3) HWE Hardy-Weinberg equillibrium iNOS inducible nitric oxide synthase (NOS2) LABA long-acting beta agonists OR odds ratio PCR polymerase chain reaction nNOS neuronal nitric oxide synthase (NOS1) SABA short-acting beta agonists SCD sickle cell disease SNP single nucleotide polymorphism NCC Nemours Childrens Clinic

PAGE 10

10 Abstract of Dissertation Pres ented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy POLYMORPHISMS IN CANDIDATE GENES FOR THE NITRIC OXIDE PATHWAY IN SICKLE CELL PATIENTS WITH ACU TE CHEST SYNDROME AND ASTHMA By Laurie Jill Duckworth August 2007 Chair: Joyce K. Stechmiller Major: Nursing Sciences Sickle cell disease (SCD) is one of the most common genetic diseases, affecting one in 600 African Americans. Acute chest syndrome (ACS ) is the leading cause of mortality and the second most common cause of hospitalizations in patients with SCD accounting for nearly half of premature deaths. A number of recent studies have reported that asthma may increase the risk of ACS in children with sickle cell disease. Nitr ic oxide is thought to play a key role in the pathogenesis of ACS. The main objectives of this study were to test the hypotheses that polymorphisms in candidate genes; Arginase 1, ni tric oxide synthase (NOS) genes; NOS1 and NOS3, associate with ACS in SCD patients a nd to characterize the association between physician-diagnosed asthma and ACS. A total of 134 participants between 5-21 years of age with SCD were enrolled. Asso ciations between acute chest syndrome and asthma with the following polymorphisms were explored: the AAT in intron 13 (formerl y intron 20) of the NOS1; T-786C and G894T and the repeat polymorphism in intron 4 of NOS3; and ARG I Pvu polymorphism. African Americans (n=74) comprise d a cohort of healthy controls owing to nonHardy-Weinberg equilibrium (HWE) in some variants. Physician-diagnosed asthma was determined by chart review, parental report, and medication use. Eighty five per cent of participants with asthma had at least on episode of ACS

PAGE 11

11 compared to 14.6 % of participants without ACS; adjusted odds ratio (OR) (95%CI) 5.46 (2.20,13.5), P = 0.0001. Physician-diagnosed asthma correla ted with the number of episodes of ACS ( P 0.001). The NOS1 AAT repeat polymorphism associated with the risk of ACS ( P = 0.001) in patients without physician-diagnosed asth ma. No associations were found between the NOS3 T-786C polymorphism and ACS. Carriers of the ARG I minor allele were less likely to have asthma, 22/79 (28%) compared to WT homozygotes 6/47 (13%); p = 0.04. Findings from this study suggest that asthma is a major risk factor for ACS. The NOS1 AAT repeat polymorphism may cont ribute to ACS in SCD patients without asthma. Studies that further characterize the associati on between asthma, ACS, and NOS genes in children with sickle cell disease are warranted.

PAGE 12

12 CHAPTER 1 INTRODUCTION Sickle cell disease (SCD) is one of the most common genetic diseases, affecting one in 600 African Americans. Acute chest syndrome (ACS ) is the leading cause of mortality and the second most common cause of hospitalizations in patients with sickle cell disease (SCD) accounting for nearly half of premature deaths (P latt et al., 1994; Stuart, & Setty 2001; Buchanan et al., 2004). Our current understanding of the pathophysiology and mechanisms leading to ACS in SCD is limited and remains unclear. In a large prospective study infection and pulmonary fat embolism were identified as causal in 38% of episodes, but in approximately 50% of cases no cause was determined (Vichinsky et al., 2000). Nitric oxide (NO) is thought to play a key role in the pat hogenesis of ACS (Gladwin et al., 1999). NO is formed through the hydrolysis of arginine to NO by nitric oxide synthase (NOS). Arginine acts as a substrate for both NOS and arginase. The arginase and NOS pathways can interfere with each other via substrate comp etition (Morris, 2002) (Fig 1-1). Recent studies suggest that asthma may be rela ted to decreased NO bioa vailability (de Boer et al., 1999; Meurs, Maarsingh, Zaagsma, 2003) rather than an overproduction due to inflammation (Kharitonov&Barnes, 2007). This may occur as a result of the increased activity of arginase (Meurs et al., 2002; Zimmermann et al., 2003). Notably, plasma concentrations of NO are reduced during ACS as a consequence of redu ced NO bioavailability (Morris et al., 2006) (Morris, et al., 2004). Compared to normal control subjects, arginine concentrations were lower and the activity of arginase, the enzyme that hydrolyzes arginine to ornithine and urea, was higher in patients with asthma (Morris et al., 2004). Addtionall y, arginase expression wa s strongly induced by IL4 and IL-13 in mice models of asthma and by Th 2 cytokines, which may contribute to NO

PAGE 13

13 deficiency in asthma (Zimmermann et al., 2003). Wechsler et al (2000), identified a group of patients with asthma with low concentrations of FENO that was inversely related to the AAT repeat polymorphism in intron 13 on the NOS1 gene. Recent studies demonstrate that administrati on of inhaled NO has beneficial effects in treating ACS (Stuart & Sett y, 2001; Sullivan et al., 1999; Atz & Wessel, 1997). Sullivan et al (2001) reported lower concentratio ns of exhaled nitric oxide (FENO) in children who previously had ACS. Additionally, they reported that low FENO was associated with a repeat polymorphism in intron 13 (formerly called intron 20) on the NO S1 gene (Sullivan, 2001). Other NOS genes may also be associated with ACS. For example, the NOS3 T-786C polymorphism and increased susceptibility to ACS in females with SCD was reported (Sharan et al., 2004). Chaar et al., (2006) reported that the C-786 al lele was associated with a decr eased risk of ACS. Genes that are involved in the regulation of NO may be im portant in ACS because of the central role NO plays in airway inflammation a nd the pulmonary endothelium. In addition to genetic factors, environmenta l factors may contribute to the susceptibility of patients with SCD to develop ACS. A number of recent studies have reported that asthma may increase the risk of ACS in patients with SC D (Boyd et al., 2004; Kni ght-Madden et al 2005; Bryant, 2005; Nordness, 2005; Sylvester et al., 2 007). These reports were based on studies that documented a link between SCD and airway hy perresponsiveness, lower airway obstruction, reversibility, abnormal pulmonary function te sts and the fact that corticosteroids and bronchodilators, drugs commonly used in asthma, we re beneficial in ACS (Santoli et al., 1998; Koumbourlis et al., 2001) (Klings et al., 2006). The purpose of this study was to characteri ze the association betw een asthma and SCD. The second aim of this study was to determine as sociations between polymorphisms in candidate

PAGE 14

14 genes for the nitric oxide pathway. These genes code for enzymes that utilize arginine as a substrate and regulate NO production. Therefore it is possible that genetic variants that regulate NO production could contribute to ACS and asthma in SCD. Background and Significance Acute Chest Syndrome and Nitric Oxide ACS is a common complication of sickle ce ll anemia. ACS is the second most common cause of hospitalization in patients with sickle cell disease and is the leading cause of premature deaths (Platt, 1994) (Vichinsky et al., 1997, 2000). It is characterized by th e presence of a rapidly progressing multi-lobe infiltrate, cough, hypoxe mia and dyspnea. The etiology of ACS is multifactorial and remains unclear. Our current unde rstanding suggests that ACS may be a form of acute lung injury that progresses to acute resp iratory distress syndrome. This injury is thought to be precipitated by sloughing of blood in the pulmonary microvascular resulting in pulmonary infarction, fat embolisation, and infection (Vichins ky et al 1996) (Scully et al ,1997). There is compelling evidence to support the central role of NO in the init iation of the pathophysiological process in ACS. Stuart and Setty assessed pl asma NO metabolites in 36 patients with SCD and 23 age-matched controls. They found that serum concentrations of NO metabolites were decreased during acute chest syndrome with values lower than in controls and in patients at steady state (Stuart & Setty, 1999). Hammerman and colleagues (1999) exposed cultured pulmonary endothelial cells to the plasma of pa tients with sickle cell disease and acute chest syndrome and found that within two hours of expos ure there were increases in NOS 3 protein and NOS 3 enzyme activity. They suggested that alterations of NO production and metabolism contribute to the pathogenesis of ACS.

PAGE 15

15 Nitric Oxide Synthase Enzymes Nitric oxide synthase enzyme s are expressed in the lung parenchyma. NOS 1 and 3 are constitutive and regulated by intracellular calcium concentra tion. NOS 2 is induced under inflammatory conditions, such as asthma, and is independent of calcium le vels. Studies in pig lungs suggest that exhaled nitric oxide originates at the alveolar surface rather than from the pulmonary circulation and may be derived from NOS 3 expressed in the alveolar walls of normal lungs (Kobzik et al., 1993). Ai rway epithelial cells express bo th NOS 1 and 3 and therefore contribute to NO levels in the lo wer respiratory tract (Shaul et al., 1994; Asano et al., 1994). Using exhaled nitric oxide (FENO) as a marker of NO production, Su llivan et al (2001) found that the concentration of FENO was lower in children with SCD who had previously suffered from acute chest syndrome as compared to children with sickle cell di sease with no history of acute chest syndrome and healthy controls. Additionally they demonstrated that the FENO levels are significantly correlated with the number of NOS1 AAT repeat s. Given that FENO in healthy controls is likely produced by NOS 1 and 3 at basal concentrations, th e decreased level in patients with ACS as compared to healthy controls suggest genetic variations in these genes. It is tempting to speculate that the low FENO seen in SCD patients with ACS may have a genetic origin and possibly may be due to polymorphism s in NOS genes. Finally, a study in 97 mild asthmatic patients revealed that the size of th e AAT repeat polymorphism on intron 13 of the NOS 1 gene was significantly related to FENO (Weschler et al., 2000). A certain fraction or phenotype of asthmatics had low FENO. Collectively these findings suggest and support the hypothesis that genetic variation in NOS genes may contribute to airway disease predisposing patients with SCD to ACS.

PAGE 16

16 Nitric Oxide, Airway Inflammation, ACS, And Asthma The importance of NO as a marker for airway inflammation in asthma is well documented (Barnes, 1995; Batra, et al 2007). Exhaled nitric oxide levels serve as a useful marker for assessing asthma severity and medication compli ance (Naprawa et al., 2005). Asthma is the most common chronic disease of childhood in the Un ited States. The incidence of asthma in the African American population surpas ses that of Caucasians, 17% vs 6% respectively (Yeatts & Shy, 2001) (Boyd et al., 2006). Differences in asthma related symptoms complicate the treatment and management of this disease in pa tients with SCD who may also have ACS. For example, patients with SCD who have recurring airway dysfunction may not be identified as asthmatic in that they are not evaluated for th is condition. Sub specialists and Pediatricians may focus on the childs SCD and manage upper respirat ory conditions on a case-by-case basis. This may leave the patients more vulnerable to an increased risk for ACS. Significance of Research The information gained from the proposed rese arch may identify candidate genetic variants in the NO pathway that increase the risk of patients with SCD to develop ACS. More specifically, this research may determine whet her polymorphisms in NOS genes and other genes that encode proteins that regulat e NO predispose patients with sick le cell disease to episodes of acute chest syndrome. If the NOS genotype is suggestive of decreased NO production in the lung, early intervention with treat ment modalities such as oral arginine may prevent ACS and thereby reduce morbidity and mort ality associated with this co mplication. Findings from this research may lead to screening of patients with SCD for the genetic variants associated with ACS early in life resulting in aggressive manageme nt and particular atten tion to associated lung diseases such as asthma which may put them at heightened risk for pulmonary complications.

PAGE 17

17 Research Aims and Hypotheses Specific Aim 1 To characterize the relationship between AC S and asthma in children with SCD. Hypothesis Asthma is a risk factor for ACS. Specific Aim 2 To explore associations among polymorphisms in candidate genes of the nitric oxide pathway and their association with asthma, ACS and SCD. Hypothesis Polymorphisms in candidate genes of the nitr ic oxide pathway predic t asthma and ACS in children with SCD. Significance to Nursing This study will explore associations between candidate genes in the NO pathway and the incidence of asthma and acute chest syndrome in a sickle cell diseas e population. Gaining insight into mechanisms of chronic disease that may impact complications associated with SCD is vital to nursing care. Outpatient Sickle Ce ll Disease clinics are gene rally managed by nurses. The nurse is often the first contact when patients experience pain or respiratory distress. Asthma is the leading chronic illness in children, can be life threateni ng, and is more prevalent in the African American population. Rece nt retrospective stud ies suggest that patients with SCD who also have a history of asthma may be at increased risk for ac ute chest syndrome. Knowledge regarding polymorphisms in NOS genes and histor ical evidence of asthma, thereby predisposing patients to ACS, may heighten awareness and resu lt in aggressive management and treatment for asthma related symptoms.

PAGE 18

18 Theoretical Framework Sickle Cell disease is the most common genetic disorder among African Americans. Acute Chest syndrome is a leading cause of death in patients with SCD. The incidence of asthma is greater in African Americ ans compared to Caucasians (Lugogo & Kraft, 2006). Racial disparities in the morbidity and mortality associ ated with asthma can be staggering suggesting that African Americans may receive substandard care with regard to diagnosis and treatment (Ford, & McCaffrey, 2006). The reasons for this are unclear but may involve many factors including; access to care, paymen t, and, educational resources. Th eoretically, it stands to reason that patients with SCD who also have asthma ma y be more susceptible to the complication of ACS. There is compelling evidence to support the central role of NO in the initiation of the pathophysiological process in acute chest syndrome. Stuart et al (1999) found that serum NO concentration metabolites were d ecreased during ACS with values lower than patients in steady state, without ACS. Decreased NO production in patients with ACS ma y be the final common pathway leading to ongoing hypoxemia, pulmonary hypertension, and acute l ung injury. Patients prone to develop ACS have decreased levels of FENO even during periods of stability (Sullivan et al., 2001). This may be due to genetic variatio ns in candidate genes that regulate NO, which predispose patients to reduced NO production an d recurring episodes of ACS. A growing body of research suggests that decreased expression of NO synthase genes resulting in decreased NO production is deleterious to the lung and may lead to acute chest syndrome (Hammerman et al., 1999). Identifying these patients before deve loping ACS may decrease the morbidity and mortality associated with this condition. To date few modifiable risk factors for ACS have been identified. Several retrospective studies have reported that havi ng asthma may increase the risk of developing ACS in the SCD

PAGE 19

19 population. Wechsler et al. identified a group of patients with as thma with low concentrations of FENO that was inversely related to the number of AAT repeats in intron 13 on the NOS1 gene. This study did not include patients with SCD ( 2000). A study in a SCD popul ation reported that the number of AAT repeats in intron 13 of the NOS 1 gene associated with FENO levels; lower levels associated with a higher number of repeats (Sullivan, 2001) The overall objective of this study was to de termine whether patients with ACS and SCD have one or more genetic polymorphisms in candi date genes for the nitric oxide pathway that may predispose them to ACS. More specificall y, the study will compare allele frequencies and genotype distributions of polymorphisms in NO S 1, NOS 3, and Arginase 1 genes in children with sickle cell disease and ACS with age, gender, and asthma. Additionally this study will explore associations betw een asthma and ACS.

PAGE 20

20 Figure 1-1. Metabolic pathways fo r Arginine, Arginase, Nitric oxi de synthase, and Nitric oxide. Reprinted with permission by Lippincott, Williams & Wilkins. NOS L-Arginine L Ornithine L Citrulline L-Arginine NOS Arginase L-Ornithine L-Citrulline NO

PAGE 21

21 CHAPTER 2 MATERIALS AND METHODS This chapter is divided into three sections. The first section presents subject characteristics, sampling method, and eligibility criteria. Second the methods and procedures with specifics on study design, protocol, and data collection are presented. Finally a description of data management and statistical analyses of the two aims are reviewed. Subjects Sample and Setting A convenience sample of 134 African American subjects with SCD were selected and recruited from the Sickle Cell Disease Clinic, Emory University School of Medicine, Atlanta, GA, and from the Hematology Clinics at the Nemours Childrens Clinic, Jacksonville and Orlando, Florida. All African American patient s with SCD meeting eligibility criteria were offered participation in the study. Informed consent and childrens assent were obtained in accordance with the requirements and guidelines of the Institutional Review Boards at the participating centers. (Appendix A) Inclusion Criteria African American 5 years to 21 years of age Sickle Cell Disease diagnosis (HbSS, HbSC or HbS) Exclusion Criteria Prematurity of birth resulti ng in Bronchopulmonary Dyspla sia or Respiratory Distress Syndrome Blood transfusion within the past 30 days

PAGE 22

22 Methods And Procedures Study Design A prospective descriptive correlation study design was utilized to investigate the association between polymorphisms in NOS gene s and the incidence of ACS and asthma in children with sickle cell disease. Participants with a positive history of ACS served as cases, those without served as controls The diagram (Figure 2-1) illust rates the study protocol used in this study. Consent Informed consent and childrens assent was obtained in accordance with the requirements and guidelines of the Institutional Review Boards at The University of Florida, Nemours Childrens Clinic, and Emory University. Particip ants and their guardians were approached in person by the study coordinator or pr incipal investigator. The purpose, risks, and benefits of the study were explained and reviewed in detail. The participants ri ght to withdraw from the study at any time without pena lty was discussed. Demographic Information General demographic information was colle cted from the participant and guardian following informed consent. (Appendix B) Medical History A brief medical history checkli st was completed by the study coordinator or PI following informed consent (Appendix C). Acute Chest Syndrome Diagnosis The diagnosis of ACS was determined by hist ory and chart review. ACS was defined by the presence of multilobar infi ltrates by chest radiograph and history of cough, hypoxemia, and dyspnea. Patients with at least one episode of ACS were classified as cases. Patients with SCD

PAGE 23

23 without a history of ACS were clas sified as controls. The age at which participants experienced their first episode of ACS was recorded. Asthma Diagnosis Participants were classified as having asthma if it was dia gnosed by a physician and if they were currently prescribed one or more of the following asthma medicati ons: inhaled short-acting beta agonists (SABA), inhaled corticostero ids (ICS), long-acting be ta agonists (LABA), a leukotriene receptor antagonists (LTRA). Isolation of Genomic DNA Isolation of DNA was accomplished by a pub lished, non-invasive method (Lum & LeMarchand, 1998). At least one hour after eating, s ubjects rinsed their mouths with water, then swished Scope mouthwash vigorously for one minut e and emptied their oral contents into a Sarstedt 50 ml Centrifugation tube with a sc rew cap for closure. Alternatively the study participants could swish mouthwash for shorte r duration on consecutive occasions until the subject had swished mouthwash for one minute. The tubes were coded with the study ID number, and mailed to the Cell and Molecular Biology Laboratory Nemours Childrens Clinic, in Jacksonville Florida. Alternatively mouthwash samples were stored at to C and sent to Nemours in bulk shipment. Mouthwash samples were centrifuged at 2700 rpm for 15 minutes. The supernatant was poured off. Approximately 0.7ml of T10E10SDS0.5%PK100g/ml was added to the concentrate. The specimen was placed into a labeled and serum separator tube, and put in 50 oC incubator overnight. 0.7ml of Phenol:Chloroform:Isoamyl Alcohol (25:24:1, pH 8.0) was added to the serum separator tube, and centrif uged at 2700 rpm for 10 minutes. This step was repeated. The supernatant was then placed in a labeled 2ml centrifuge tube. Approximately 0.7ml of 3M Sodium Acetate and 0.7ml of Isopropyl was adde d to the sample and then centrifuged at 14000

PAGE 24

24 rpm for 5 minutes. The supernat ant was drawn off, 1 ml of 70% alcohol was added and the sample was centrifuged again at 14,000 rpm for 2 minutes. The final specimen was suspended in 10mM of Tris, pH 7.5 and rehydrated overnight. Genotyping DNA was extracted as previously describe d and the quantity of DNA determined by spectrophotometry. (Lum & LeMarchand, 1998) Aliquots of DNA containing 500 ng were prepared and stored at -20C in a secure and locked freezer, a nd labeled with th e participants code number. Forward and reverse primers spec ific to polymorphic loci in the NOS 1 and NOS3 genes were used to isolate regions of interest. Polymerase chain reaction was utilized to identify patient genotype. Below is a listing of the various known polym orphic loci in the NOS 1 and NOS 3 genes and the ARG 1 gene. (Grasemann Yandava, & Dr azen, 1999). In previous studies the location of the AAT repeat was reported as intron 20 (Su llian et al., 2001; Wechsler, et al., 2000). However, according to homosapiens chromo some 12 genomic contig NT_009775, the AAT repeat polymorphism locates in the region of intron 13 (complement 8267923-8271203) of the human NOS1 gene. Oligonucleotides were synt hesized by Operon Technologies (Alameda, CA, USA). The restriction enzymes were purchas ed from New England Bi olabs (Ipswhich, MA, USA). NOS 1 (neuronal NOS) ATT intronic repeat: intron 13 (complement 8267923 8271203) Forward primer: 5CTGGGGCAATGGTGTGT-3 Reverse primer: 5GAGTAAAATTAAGGGTCAGC-3 NOS 3 (endothelial NOS) (Sharan et al., 2000)

PAGE 25

25 -786 T to C polymorphism: (rs2070744) Forward primer: 5GCATGCACTCTGGCCTGAAGTG-3 Reverse primer: 5CAGGAAGCTGCCTTCCAGTGC-3 223BP PCR product Exon 7 G894T = Glu298Asp polymorphism : (rs1799983) Forward primer: 5CT GGAGATGAAGGCAGGAGAC-3 Reverse primer: 5CT CCATCCCACCCAGTCAATC-3 267 BP PCR product Intron 4 Deletion/Insertion of 27 BP Forward primer: 5AG GCCCTATGGTAGTGCCTT-3 Reverse primer: 5TC TCTTAGTGCTGTGGTCAC-3 Amplified by PCR on 6% polyacrylamide gels ARG1 gene (Pvu II polymorphism) (rs17599586) 5ATCTGAGGTAATAGAGAAGC 3 5TGAAAGTAGTACAGACAGAC 3 Statistical Analysis Data analysis was performed using SPSS vers ion 11.0. The statis tical significance of differences in allele frequenc ies and genotype distributions we re determined by calculating odds ratios and by using chi square analysis. The Hardy Weinberg equilibrium (HWE) was examined using the Markov chain method with a program for population genetics data analysis (Genepop, School of Biomedical Sciences, Curtin University of Technology, France) as well as

PAGE 26

26 chi square goodness of fit tests. Differences in age among groups were determined using oneway ANOVA with Bonferroni correction for multiple comparisons. Association between groups with gender, allele, genotype, and the number of AAT repeats on NOS 1 were assessed using chi-square test. The strength of associations between disease ri sk and genotype were evaluated with Mantel-Haensze comm on odds ratios (OR) and 95% confid ence intervals. The relationship between risk of ACS and the number of AAT rep eats in intron 13 of the NOS 1 gene in patients with and without asthma was determined by simple linear regression. Associations between the incidence of asthma and episodes of ACS were de termined by logistic regression analysis with age and gender as covariates. The Hardy-Weinberg law is commonly used for calculating genotype frequencies from allele frequencies. This law is the cornerstone of population genetics. In population genetics, the HardyWeinberg principle is a re lationship between the frequencies of alleles and the genotype of a population. The occurrence of a genot ype, perhaps one associated with a disease, stays constant unless matings are non-random or inappropriate, or mutations accumulate. Therefore, the frequency of genotypes and the freque ncy of alleles are said to be at "genetic equilibrium". Genetic equilibrium is a basic principle of population genetics (Nussbaum, McInnes, & Willard, 2004). This sudy tested fo r Hardy Wienberg Equillibrium (HWE) with 74 healthy African American control subjects. The r easons for testing HWE were to establish that the allele frequencies in the study participants were consiste nt with an Arican American population, and secondly to rule out genotyping error. Interes tingly, the NOS 3 polymorphysims were not in HWE when compared to the healthty control cohort. This suggest that polymorphisms in this gene may be realted to the disease process. This was not however confirmed with the results. In fact, associations were found between the AAT repeat

PAGE 27

27 polymorphism in the NOS1 gene and the arginase 1 gene, neither of which showed differences with regard to HWE. Figure 2-1. Diagra m of study protocol. *History of asthma was not reported for one participant *

PAGE 28

28 CHAPTER 3 LITERATURE REVIEW Sickle Cell Disease Sickle cell disease is an inherited blood disease that is characterized by defective hemoglobin. It is one of the most prevalent ge netic disorders and is the most common genetic disease in the African American population. Th e genetic mutation associ ated with sickle cell disease occurs in approximately one in every 600 African American births. This disease affects millions worldwide and approximately 72,000 peopl e in the United States (Platt, 1994). The clinical course of the disease varies from patie nt to patient. Some patients have mild symptoms while others are severely affected. The reasons for this are unclear. Sickle cell anemia is caused by an abnorma l type of hemoglobin called hemoglobin S. Hemoglobin is a protein inside red blood cells that carries oxygen. Hemoglobin S, however, distorts the red blood cells shape. The fragile sickle-shaped cells deliver less oxygen to the body's tissues, and can break into pieces th at disrupt blood flow (Goldman, 2004). Hypoxia enhances the sickled erythrocytes adherence to both the macrovascular and microvascular endothelium. The pulmonary microcirculation is particularly vulne rable to deoxygenation (Stuart & Setty, 1999). Sickle cell anemia is inherited as an autoso mal recessive trait. This means it occurs in someone who has inherited hemoglobin S from both parents. Sickle cell disease is much more common in certain ethnic groups, significantly affecting African Americans. Someone who inherits hemoglobin S from one parent and norma l hemoglobin (A) from the other parent will have sickle cell trait. Someone who inherits hemogl obin S from one parent and another type of

PAGE 29

29 abnormal hemoglobin from the other parent will have another form of sickle cell disease, such as thalassemia (Goldman, 2004). Patients with sickle cell disease require con tinuous treatment, even when they are not having a painful crisis. The purpose of treatment is to manage and control symptoms, and to try to limit the frequency of crises. Supplementation with folic acid, an essential element in producing red blood cells, is requir ed because of the rapid red bl ood cell turnover. Analgesics and hydration are mainstay treatments for patients during a sickle crisis. Treatment of pain is critical. Non-narcotic medications may be e ffective, but many patient s require narcotics. Hydroxyurea was found to help some patients by re ducing the frequency of painful crises and episodes of acute chest syndrome. It also been shown to decrease the need for blood transfusions. Newer drugs are being developed to manage sickle cell anemia. Some of these drugs work by trying to induce the body to produce more fetal hemoglobin (in an attempt to decrease the amount of sickling), or by increasing the binding of oxygen to sickle cells. To date, there are no other commonly used drugs availa ble for treatment (Hoffman, 2005). Acute Chest Syndrome Acute Chest Syndrome is a common complication of sickle cell disease and is the leading cause of premature death in this population (Pla tt, 1994) (Stuart et al., 1994) (Buchanan et al., 2004). ACS is characterized by the presence of multi-lobe infiltrates, cough, dyspnea, hypoxia, and often chest pain. The pathophysiology of ACS is unclear but recent re search indicates that NO plays a central role in airway pathology asso ciated with this condition (Hammerman et al., 1999). This is not surprising when we take into account that the lung cont ains all three forms of nitric oxide synthase ( NOS), NOS 1, 2, and 3. Kharitonov et al (1995) demonstr ated that oral administration of L-arginine to healthy subjects increased exhale d nitric oxide (ENO) levels.

PAGE 30

30 Recent studies have shown that L-arginine levels are low in patients with sickle cell disease (Lopez et al., 2003 Enwonwu et al., 1990), and decreased to an even greater extent in patients who have sickle cell diseas e with evidence of ACS. (Morris et al ,2000). Asthma Asthma is a disease involving chronic inflam mation of the airways. Airway inflammation is a consistent finding in patients with mild, moderate, and severe asthma. Numerous studies have reported elevated exhaled nitric oxide leve ls in patients with asthma (Kissoon et al., 1999) (Kharitonov, 1994,1996) (Piacentini et al., 1999). The following definition of asthma is the accepted definition as proposed in the National, Heart, Lung and Blood Institutes (NHLBIs) National Asthma and Prevention Program (NAEPP) Expert Panel Report: Guidelines for the Diagnosis and Management of Asthma Update 2002: Asthma is a chronic inflammatory disorder of the airways in which many cells and cellular elements play a role, in particular, mast cells, eosinophils, T lymphoc yutes, neutrophils, and epithelial cells. In susceptible individuals, this inflammation causes recurrent episodes of wheezing, breathlessness, chest tightness, and cough, particularly at night and in early morning. These episodes are usually associated with widesp read but variable airflow obstruction that is often reversible either spontan eously or with treatment. The inflammation also causes an associated increase in the existi ng bronchial hyperressponiveness to a variety of st imuli (National Asthma Education and Prevention Program Expert Panel, (2003). Asthma is one of the most common chronic diseases of industrialized nations and its prevalence continues to increase throughout the world. Statistics form the Centers for Disease Control reveal that the incidence of asthma in the United States is between 8-9 %. Asthma is the leading chronic illness in children and the number one cause of school absences. Overall, mortality rates for asthma have declined since 1995, however mortality ra tes continue to be 3

PAGE 31

31 times higher for African American males as compared to white males, and 2.5 times higher for black females when compared to white females (F agan et al., 2000). Over the past 10-15 years research has led to a greater understanding of the mechanisms of asthma, thereby reducing mortality and improving the quality of life for many patients suffering with asthma. However, reasons for disparities in mortal ity among African Americans conti nue to elude scientists. Recent studies have reported a relationship between asthma and ACS (Boyd et al., 2004) (KnightMadden et al., 2005 (Bryant, 2005) (Nordness et al., 2005). Many of the symptoms related to ACS are also seen in asthma; dyspnea, cough, de creased oxygen saturation. Surprisingly, the prevalence of asthma in these studies range d from 45 to 53%, a st riking increase over the incidence of asthma generally seen in African Am ericans. What remains unclear is direction of the causality of the relationship between ACS and Asthma. Do patients with asthma have more episodes of ACS, or are patients with a hist ory of ACS more likely to develop asthma? Few studies address polymorphisms in NOS genes and how they may impact airway disease, specifically asthma, in patients with SCD. Given that asthma is the leading chronic illness in children and more prevalent in African Americans, it is important to explore relationships among candidate genes in the NO path way, asthma, sickle cell disease, and acute chest syndrome. Recent studies citing the impor tance of arginase in asthma pathogensis additionally warrant further research (Vercelli, 2003). Nitric Oxide Nitric oxide (NO) plays a major role in lung physiology and airway disease. This ubiquitous gas is an unstable fr ee radical that serves as a me diator for several physiological events including vascular and airway smoot h muscle tone, bronchodilation, and airway inflammation (Barnes, 1995). Nitr ic oxide may also be necessary for ciliary action (Jain et al., 1993) and is thought to aid in maintaining steri lity in the lower respiratory tract due to its

PAGE 32

32 antimicrobial properties against pathogens includ ing viruses and mycobacterium (Xia & Zweir, 1997). Endogenous NO is produced from the amino aci d L-arginine by the enzyme NO synthase which has three isoforms. Tw o constitutive forms (cNOS); neuronal (nNOS or NOS1) and endothelial (eNOS or NOS3) are found in small quantities and serve basa l metabolic functions. The third isoform, inducible (iNOS or NOS2) is mediated by inflammatory cytokines and endotoxin and plays a major role in the inflammation seen in asthma. All th ree of these isoforms are found in the respiratory tract (Kobzik et al., 1993; Robbins et al., 1994). Historical Events Leading to the Discovery of Nitric Oxide Nitric oxide was discovered by Joseph Priestle y in 1772 as a clear, colorless gas. In 1980. Furchgott (1980) discover ed that endothelial cells produ ce endedothelium relaxing factor (EDRF) in response to acetylcholine In 1987 M oncada & Higgs (1987) and Ignarro et al (1987) discovered that EDRF is nitric oxide. Within a years time Moncada reported that NO is synthesized from the amino acid L-arginine (P almer, Ashton & Moncada, 1988). Nitric Oxide was proclaimed as molecule of the year on the cover of Science magazine in 1992. (Koshland, 1992). Six years later, the importance of the ni tric oxide discovery was recognized by awarding the Nobel Prize in Physiology and Medicine to Furchgott, Ignarrao, and Murad (Williams, 1998). By 1993 NO had been implicated in the pathogen esis of a multitude of diseases including, hypertension, septic shock, and dememntia (Mon cada & Higgs, 1993). The next ten years led to multiple publications related to NO, on average ov er 6000 papers per year addressing all areas of medicine, including diabetes, wound healing, neurotransmission, cancer, immune function, infection, eye disease, and respiratory functi on (Yetik-Anacak & Catravas, 2006). Presently it is difficult to find a disease that is not associated with nitric oxide. This is amazing in that nitric oxide was considered as nothing more than an ir ritant and pollutant twenty years ago (Moncada & Higgs, 1993).

PAGE 33

33 During the mid 1990s several studies demonstrated that nitric oxide plays a key role in physiological regulation of airway disease (Gaston & Jonsen 1994; Shaul et al., 1994; Barnes, 1995; Kharitonov et al 1994,1995,1996; Massaro et al., 1995, 1996). More specifically, numerous studies reported increas ed exhaled nitric oxide levels in patients with asthma (Alving Weitzberg, & Lundberg, 1993; Kharitonov et al., 1994, 1996; Barnes, 1995; Massaro et al., 1995). Nitric oxide is released by a variety of pulmonary cells including epithelial cells, eosinophils, and macrophages (Yates, 2001). It is be lieved that elevated nitric oxide in the airways is generated by inducib le nitric oxide synthase (iNOS) mediated by inflammatory cytokines and endotoxi n (Asano et al.,1994). There is compelling evidence to support the central role of NO in the initiation of the pathophysiological processes in acute chest synd rome. Stuart and Setty (1999) observed that serum concentration of NO metabolites were decreased during episodes of ACS with values lower than controls and patients in steady state. Recent studies have shown that L-arginine levels are low in patients with sickle cell disease (L opez et al., 2003; Enwonwu, 1990), and decreased to an even greater extent in patients who have sickle cell disease with evidence of ACS (Morris et al., 2000). These findings support the key ro le of NO in the pulmonary endothelium and airway inflammation. Nitric Oxide Mechanisms of Action Nitric oxide (NO) is a simple free radical gas. NO reacts with oxygen to form nitrite and nitrates. Endogenous nitric oxide is produced fr om the amino acid L-arginine by the enzyme NO synthase, which has three isoforms (Nathan, & Xia, 1994) (Fig1-1). Two constitutive forms (cNOS); neuronal (nNOS or NOS1) and endothe lial (eNOS or NOS3) and are found in small quantities and serve basal metabolic functions. The third isoform, inducible (iNOS or NOS2) is mediated by inflammatory cytokines and endot oxin and plays an important role in the

PAGE 34

34 inflammation seen in asthma. All three of these isoforms ar e found in the respiratory tract (Kobzik, 1993;Robbins, 1994). Synthesis of NO by cNOS is thought to be responsible for vasodilator tone associated w ith regulation of blood pressure, neurotransmission, respiratory function, cardiac contractility, a nd also plays a role in platel et aggregation (Nathan & Xia, 1994;Yates, 2001; Hammerman et al., 1999). NOS1 and NOS3 are regulated by intracellular calcium concentration, whereas NOS2 is induc ed under inflammation i ndependent of calcium concentration. Agonists such as stress, bradyki nin, acetylcholine, and histamine may activate cNOS resulting in the release of pico molar le vels of NO. Conversely iNOS is generated by cytokines present in the ai rway and produce nano molar levels of NO (Yates, 2001). NO impacts vascular homeostasis in a variet y of ways. Levels of NO may inhibit smooth muscle cell proliferation, plat elet aggregation, and platelet and monocyte adhesion to the endothelium. Low levels, or decreased bioavailab ilty of NO may lead to hypertension, coronary artery disease, peripher al artery disease, sickle cell, or stroke (Puddu et al., 2005). Nitric oxide acts as a vasodilator, bronchod ilator, neurotransmitter, and mediator of inflammation in the lung (Barne s, 1993). Due to its role in smooth muscle relaxation, NO showed promise as a bronchodilator. A study in guinea pigs demonstrated that NO will limit methacholine-induced bronchoconstriction however th e effect is short-liv ed and requires high levels of inhaled NO (Dupuy et al., 1992). A study in asthmatics revealed that inhalation of NO has a small effect on airway caliber and resi stance, thus not showing much promise as a therapeutic agent (Frostell e tal, 1993). Smooth muscle exists in both the bronchi and pulmonary vasculature within the lung. Numerous studi es demonstrate that NO plays a key role in pulmonary arterial vasoconstr iction (Dinh-Xuan, 1992; Leeman & Naecje, 1995; Yetik-Anacak

PAGE 35

35 & Catravas, 2006). Basal levels of NO in pulmona ry endothelial cells ma intain dilation of the pulmonary vascular bed (P epko-Zaba et al., 1991). NO is produced in the airways by inflammatory cells, most notably eosinophils, macrophages, epithelial cells, and mast cells, all of which are relevant to asthma (Gustafsson, 1998). Epithelial cells stimulated by cytokines result in the in duction of iNOS producing high quantities of NO (Robbins, 1996). NO generated fr om epithelial cells may be a physiological defense against infection and could influence susceptibility to airway disease given its antimicrobial properties Decreased levels of NO in the airway may increase susceptibility to infection (Hart, 1999). NO reacts with thiols to fo rm S-nitorsothiols (Stamler et al., 1992). These compounds have bronchodilator acti vity and may also contribute to airway homeostasis by their antimicrobial and anti-inflamma tory properties (Gaston, 1994) Exhaled Nitric Oxide and Airway Disease Airway inflammation plays a cen tral role in the pathogenesi s as well as symptomology of asthma (Shelhamer et al.,1995; Obyrne, 1996) E xhaled nitric oxide (FENO) levels are elevated in patients with asthma, however, there is a subs tantial amount of variance (Massaro et al., 1995, 1996; Kissoon et al., 1999; Rosias et al., 2004; Storm et al., 2004). Repeatable noninvasive measurement of inflammation would be useful in order to assess severity and guide treatment in patients with asthma. Measurement of exhaled nitric oxide levels is an exciting recent development that may provide an indication of the degree of airway inflammation in asthmatics as opposed to traditional pulmonary function test, wh ich are indirect measures of airway flow. Customary monitoring techniques for assessing asth ma severity include peak expiratory flow rates, spirometry, and responses to medications Despite the importance of inflammation in asthma, monitoring airway inflammation is not routine. This is due in large part to the fact that only invasive techniques such as bronchoscopy can directly sample lung tissue and fluids for the

PAGE 36

36 presence of inflammatory cells and mediators. Sputum examination is noninvasive and is one of the few methods available that can produce valuable information from the lower respiratory tract (Busse, 1998). Sputum sampling in children may be impractical in that it is time consuming, expensive, and requires cooperation from the child. Additionally, these measures may only reflect the severity of diseas e at the time of measurement. (Ratnawati & Thomas, 2005). The great advantage of FENO measurement is that sample collection is noninvasive and can be performed repeatedly (Kissoon et al., 1999; Barnes, 1996). There are several analyzers now commercially available that have the capability to measure FENO. Most of the studies done to date measure nitric oxide using a ch emiluminescence analyzer which detects the photochemical reaction between NO and ozone in the analyzer. (Kharitonov et al., 1994,1996; Kissoon et al., 1999; Smith et al., 2005) The beauty of this method is the ability to measure FENO directly in line to the analyzer, in real time, or indirectly by obtaining an exhaled air sample in a balloon to be later analyzed at a more convenient time. Levels of FENO are reported in parts per billion (ppb). Until recently repor ted values for FENO have varied widely most likely due to significant differences in sampling t echnique. Major differences relate to exhalation flow rate and nasal contamination (Kissoon et al., 1999). The American Thoracic Society has published guidelines for FENO measurement in adu lts and children (American Thoracic Society, 1999). Portable devices are curre ntly being developed for at home monitoring of FENO in patients with asthma. Exhaled nitric oxide is reduced in patients receiving anti-inflammatory treatment (Massaro et al., 1995; Kharitonov, et al., 1996, 2007). It is believed that glucocorticoids prevent the induction of inducible NOS (iNOS/ NOS2) by cytokines in epithelial cells. (Kharitonov et al., 1996). Measuring FENO may be useful for mon itoring whether anti-inflammatory therapy is

PAGE 37

37 adequate as well as patient compliance. A recent paper in The New England Journal of Medicine reported that in patients with chronic, persistent asthma, treatment with inhaled corticosteroids could successfully be titrated with the use of FENO measurements. Thus FENO measurements may help to minimize the potential long-term side effects related to inhaled corticosteroids (Smith et al., 2005; Deykin, 2005). With new technology currently available, FENO measurements are easy to perform, can be reproduced accurately, and provide immediate results on which the primary care provider can act. While several studies have described the value of FENO measurement as a useful indicator of airway inflammation and asthma (Cicutto & Downey, 2004; Karitonov et al ,2007; Zeidler, Kleerup, Tashkin, 2004; Smith et al., 2005), few studies have addressed the variance of these levels in patients with asthma or acute chest syndrome. Genetic varia tion may contribute to the variability in exhaled nitric oxide levels. A limited number of studies have reported the contribution of genetic variants in candidate genes for the NO pathway and how they may correlate with exhaled nitric oxide and asthma. Storm and colleagues (2003) identified a strong association between a NOS3 gene variant, G893T, and the variability of FENO levels in patie nts with asthma. FENO levels were lowest in subjects with the TT genotype and were significantly higher in subjects with either the GT or GG genotype. As mentioned previously, the number or trinucleotide repeats (AAT) in the NOS1 gene correlated with FENO values in patient s with asthma however varied depending on genotype (Wechsler et al., 2000). Grasemann et al (2003) investigated FENO in both NOS1 and NOS3 genes. Specifically they studied the numbe r of AAT repeats in intron 13 (formerly intron 20) of the NOS1 gene and the 894G/T mutation in the NOS3 gene. They found no genetic association between FENO levels and the NOS1 ge ne. However, they did report that females

PAGE 38

38 with 12 or more AAT repeats in NOS3 had lower FENO levels compared to females with fewer than 12 AAT repeats, suggesting that gender and/or genetic variants in NOS3 may affect exhaled nitric oxide levels. Collectively, these findings may offer a plausible explanation for differences in asthma phenotype and may explain the variance in FENO values. To date the only study reporting and associ ation between FENO and NOS genotype in patients with sickle cell disease and acute ches t syndrome is that by Sullivan and colleagues (2001). As mentioned, they found an inverse corre lation between the number of repeats in NOS1 and FENO levels. Further studies are warranted exploring associations between NOS genes, variability in FENO, asthma, and SCD. Associations between NOS Genetic Variants and ACS Nitric oxide (NO) is thought to play a key role in the pathoge nesis of ACS (Gladwin et al., 1999). Plasma concentrations of NO are reduced during ACS as a consequence of reduced NO bioavailability (Morris et al., 2006) (Morris et al., 2004). Recent studies demonstrate that administration of inhaled NO ha s beneficial effects in trea ting ACS (Stuart & Setty, 2001; Sullivan et al., 1999). Identifying genetic variants in NOS genes may be beneficial in predicting susceptibility for developing ACS. Hammerman and colleagues (1999) inve stigated the theory that alterations in endothe lial cell production and metabo lism of NO products might be associated with ACS. They measured NO produc ts from cultured pulmonary endothelial cells exposed to plasma from sickle cell patients durin g crisis. They found that within two hours of exposure there were increases in NOS3 protei n and NOS3 enzyme activity suggesting that an increase of toxic NO metabolites might contribute to the cellular a nd tissue damage seen in ACS. In an attempt to clarify the genetic differen ces associated with the phenotypic diversity in patients with SCD, Vargas et al (2006) analyzed three polymorphisms in the eNOS gene; the single-nucleotide polymorphism (SNP) T-786C in the promoter region, the SNP E298D in exon

PAGE 39

39 7, and a 27-bp-repeat VNTR in intron 4. They found no associations between E298D or VNTR and SCD. Interestingly, they did report that all patients hom ozygous for the C variant had a tendency to develop a more severe clinical cour se. Limitations to this study include the small sample size, n=73. A recent retrospective study by Sharan et al (2004) investigated eNOS polymorphisms; E298D and T-786C, in patients with SCD. They concluded that the D298 allele was not associated with SCD, how ever the C-786 allele was strongl y associated with the risk of ACS in female subjects. Sullivan et al (2001) tested the hypothesis that exhaled nitric oxide levels (FENO) are altered in subjects with SCD who have had at least one episode of ACS. They also tested the hypothesis that the number of AAT repeats in in tron 13 (formerly intron 20) of the NOS1 gene correlates with FENO. They reported that (FENO) levels in patients who ha ve a history of ACS are approximately one-third those obser ved in healthy controls and in patients with SCD who have not had ACS. Additionally, they found that low FENO was associated with a repeat polymorphism in the NOS1 gene. More specifically they identified that high numbers of repeats are inversely correlated with FENO levels. It is tempting to speculate that the low FENO seen in SCD patients with ACS may have a genetic orig in and may be due to polymorphisms in NOS genes. Grasemann et al., (1999) demons trated significant differences in allele frequencies and genotypes of the NOS1 gene among ethnically dive rse populations. The number of AAT repeats in intron 20 (currently noted as intron 13) of the NOS1 gene ranged from 7-16 in Causcasians and African Americans. Indi viduals homozygous for allele 10 were more common among Caucasians (p = 0.0004), whereas those homozyg ous for allele 14 were more common among African Americans (p0.05). These findings suggest that ethnicity may have an impact on

PAGE 40

40 variants in the NOS1 gene and that these differen ces may be misinterpreted if not addressed in future studies. This study did not report whether or not participants had a history of asthma. NOS genes that are involved in the regulation of NO may be important in ACS because of the central role NO plays in airway in flammation and the pulmonary endothelium. NOS Genes and Association with Asthma There is a plethora of research in the literature describing the key role of NO in the airway epithelium. Patients with asthma have increas ed NO production in thei r airways (Kharitonov, Yates, & Robbins, 1994; Massaro et al., 1996; Ba rnes, 1996; Piacentini et al., 1999). NOS genes are located throughout the genome at 7q35-36 ( NOS3) (Robinson et al., 1994), 12q24 (NOS1) (Xu et al., 1993), and 17q12 (NOS2) (Marsden et al., 1994), all candidate loci for asthma (Collaborative Study on the Genetics of Asthma 1997; Daniels, 1996; Ob er et al., 1998). Nitric Oxide Synthase 1 (nNOS) Genome-wide searches have established lin kage between asthma and the NOS1 (nNOS) gene (Collaborative Study on th e Genetics of Asthma, 1997; Barnes, 1996; Ober et al., 1998). Grasemann et al (2000) showed a genetic association between a polymorphism in the NOS1 gene and asthma using a case control design. They de monstrated that frequencies for allele 17 and 18 of a CA repeat in exon 29 of the NOS1 gene were significantly different between 490 asthmatic and 350 control subjects. To confirm their findings they genotyped and additional 1131 control subjects and verified that the frequencies of alleles 17 and 18 were nearly identical to those found in their original control gr oup. This study in particular is impressive given the sample size, case-control design, and reproducibility. Fi ndings from this study provide support for NOS1 as a candidate gene for asthma. A study in 97 mild asthmatic patients reve aled that the size of the AAT repeat polymorphism on intron 13 (formerly intron 20) of the NOS 1 gene was significantly related to

PAGE 41

41 exhaled nitric oxide (FENO ) (Weschler et al., 2000). These fi ndings are extremely important given that FENO is now widely accepted as a marker fo r airway inflammation in patients with asthma. Results from this study may help explai n the phenotypic variability among asthmatics. In a genetic association study, Gao and collea gues (2000) tested whether variants of NOS1, NOS2, and NOS3 were related to asthma. Neither NOS2 nor NOS3 variants showed any association with asthma. They did however fi nd an association between variants in NOS1 and asthma. More specifically they described sign ificant differences in 183 bp allele frequencies between control and asthmatic subjects. Homo zygous 183 bp alleles were strongly associated with asthma. Nitric Oxide Synthase 2 (iNOS) NO derived from NOS2 (inducible NOS or iNOS) is involved in inflammatory diseases of the airways (Barnes, 1995). NOS2 has been show n to be upregulated in asthmatics and is a substantial source of NO in the airways (Xia, 1992). Konno et al inves tigated whether the 14repeat allele (CCTTT) of the NOS 2 gene influences the development of atopy and asthma. Their findings suggest that the CCTTT repeat polymorphi sm is associated with atopy but not with asthma. A recent study in 230 families with asthma investigated the genetic association of iNOS repeats with asthma. Four repe ats were identified; (CCTTT)n pr omoter repeat, intron 2(GT)n repeat, intron 4 (GT)n repeat, a nd an intron 5 (CA)n repeat. This study is the first to identify repeat polymorphisms in the iNOS gene and thei r association with asth ma. Individuals carrying allele 4 of the promoter repeat had high serum IgE and nitric oxide levels, characteristic of asthma. Individuals carrying allele 3 of the in tron 4 (GT)n repeat had elevated blood eosinophils and increased asthma severi ty (Batra et al., 2006). Given the role of NOS2 in airway inflamma tion further genetic st udies are warranted exploring variants in the ge ne and how they may contribute to asthma pathology.

PAGE 42

42 Nitric Oxide Synthase 3 (eNOS) Endothelial nitric oxide (eNOS ) is expressed in the airway and pulmonary epithelium and serves an important role in vasodilator tone (Shaul et al., 2002; Valla nce & Moncada, 1989). Genome screenings have identifi ed gene linkages to eNOS and as thma. (Holgate, 1997; Lee et al 2000) demonstrated an association in polymor phisms of eNOS and angiotensin coverting enzyme in patients with asthma. A more recen t study also looking at po lymorphisms of eNOS and angiotensin coverting enzyme in patie nts with asthma found no relationship among polymorphisms of NOS3 and asthma (Yildiz et al ., 2004). Finally, a study in 163 patients with asthma found no relationship between the tand em repeat polymorphism in intron 4 and the (G894T) variant of the NOS3 gene with atopic asthma (Holla et al., 2002). Although widely discussed, there is a lack of research in the literature demonstrating as association among polymorphisms in the NOS3 gene and asthma. Nitric Oxide and Acute Chest Syndrome Most of the morbidity associated with sickle cell disease stems from vaso-occlusive crisis (Platt, 1994) (Vichinsky et al., 2000). Nitric oxide is a vasodilator (Busse, 1998). Could a polymorphism in nitric oxide synthase genes interfe re with or inhibit nitr ic oxide production? Several studies are beginning to address this. Mo rris et al. (2000) found that there may indeed be a relationship between L-arginine and the NO pa thway. Their study attempted to sort out the issue of substrate deficiency or substrate depletion. Sickle cell patients may experience lengthy periods of vaso-occlusion, creating a constant demand for vasodilation mechanisms, i.e. NO production. This overwhelming need or utilizatio n may deplete the quantity of the substrate, Larginine, thereby decreasing ove rall NO production (Morris et al., 2000). Interestingly, Morriss group studied 36 patients at steady state (period of wellness) and during vaso-occlusive crisis (VOC). During steady state, L-arginine levels were normal. L-arginine levels were decreased

PAGE 43

43 during periods of vaso-occlusive crisis and acute chest syndrome. These findings suggest that there may be arginine depletion in response to demand, as opposed to intrinsic substrate deficiency. (Morris et al., 2000). A similar study looked at L-arginine le vels during VOC when sickle cell patients presented to the emergency department. They studied 50 adult patients and found arginine levels were signif icantly low compared to steady state (Lopez et al., 2003). These findings indicate that L-argini ne levels are diminished during periods of exacerbation. L-Citrulline is an amino acid and a precursor fo r arginine (Fig 1-1). Waugh et al. (2001) demonstrated that giving l-citrul line 0.1g/kg orally twice daily el evated plasma arginine levels, and increased symptoms of wellne ss in children with SCD. The oral citrulline supplements were well tolerated and without side effects. Arginase Genes and Asthma Characterization of an asthma phenotype will likely be related to a complex interaction of genes and their polymorphic variants. The pathog enetic mechanisms of and contributing genetic factors in asthma continue to elude scientists. In a murine mo del, Zimmerman et al (2003) found that among signature asthma genes, there was ov er expression of the genes encoding for the uptake and metabolism of arginine, a basic amin o acid, by arginase. Addi tionally their results demonstrated regulation of argina se by IL-4 and IL-13, cytokines that activate inflammatory pathways seen in asthma. Microa rray analysis in murine models of asthma found high levels of arginase I and arginase II activity in associ ation with IL-4 and IL 13 overexpression (Vercelli, 2003). Notably, arginine acts as a substrate for both arginase a nd NO synthase. The arginase and NO synthase pathways may interfere with each other by way of competition for arginine (Vercelli, 2003). Much of the literature regarding NO in asthma has focused on iNOS and centered on the proinflammatory role of NO. Meur s and colleagues report that a deficiency of NO caused by increased arginase acti vity and altered arginine levels is a contributing factor in

PAGE 44

44 the pathogenesis of asthma (Meurs, 2003). Using global micorarray analysis, Zimmermann et al (2006) reported that asthmatic conditions invol ve metabolism of argini ne by arginase. They report that arginase I an d arginase II genes are key regulators of processes associated with airway tone and lung inflammation. Collectively these studi es indicate the need for further investigation of Arginase I and Arginase II genes and how they may relate to asthma and airway disease. Impact of Genetics In April 2003, sequencing of the human genome was completed. The consequences of this landmark event will have a dramatic impact on the ability to understand the mechanisms of disease and develop treatments specifically tailored to a patients genetic profile (Collins et al., 2003). Sickle cell disease (SCD) is one of the most common genetic diseases, affecting one in 600 African Americans. Despite its Mendelian i nheritance the disease is phenotypically highly variable. For example, some affected by the disease suffer from recurrent vaso-occlusive crisis and die at a young age, while others seem mini mally affected and enjoy a normal life span (Buchanan,, Debaun, & Steinberg, 2004). Hence the need for identification of risk factors and genetic variants that may predict outcomes and reduce mortality. Acute chest syndrome (ACS) is the leadi ng cause of mortality and the second most common cause of hospitalizations in patients with sickle cell disease (SCD) accounting for nearly half of premature deaths (Platt, 1994; Stuart & Setty, 2001; Buchanan, Debaun, & Steinberg, 2004). Our current understanding of the pathophysiology and mechanisms leading to ACS in SCD is limited and remains unclear. Th ere is paucity in the literature describing associations between ACS, airway disease, and genetic variation. Genetic Influence Studies investigating the infl uence of genetic variation in candidate genes in the NO pathway are not unprecedented. The gene that encodes NOS 1 in humans is located on the long

PAGE 45

45 arm of chromosome 12 in the region 12q24.2. Multiple genome wide screening studies in different ethnic populations have shown linkage of this region to asthma (Grasemann et al., 1999; Barnes, 1996; CSGA, 1997; Ober et al., 1998). Grasemann and colleagues (1999) found significant differences in allele frequencies and genotypes of the NOS1 gene among ethnically diverse populations. They studi ed 305 American-Caucasian and 105 African American healthy subjects. The number of AAT repeats in intron 13 (formerly intron 20) ranged from 7-16. The overall distribution of allele s differed significantly between groups. Individuals homozygous for allele 10 were more common among Caucasians whereas those homozygous for allele 14 were more common in African-American subjects. A study in 97 mild asthmatics revealed that the size of the AAT repeat polymorphism on intron 13 (formerly intron 20) of the NOS 1 gene was significantly associated with FENO (Weschler, 2000). The NOS3 gene is located at 7q35-36. A recent study in SCD patients found a functional single nucleotide polymorphism (SNP) in the NOS3 gene, T-786C, that associated with increased susceptibility to acute chest syndrome in females (Sharan et al., 2004). Analysis Of Ethical, Social, Politica l, Economic, and/or Cultural Issues Asthma presents an enormous burden to both th e individual and health care system. It is estimated that 20 million persons in the United States suffer from asthma and asthma accounts for more than 5.000 deaths annually (Nationa l Asthma Education and Prevention Program, 2002). In the last two decades there has been a rise in asthma hospitaliz ations and asthma mortality (Akinbami & Schoenforf, 2002). Mortality associated with asthma peaked in 1998 and has decreased over the past few years. This in crease is more pronounced in African American, and people of low socioeconomic background (Ma nnino et al.,1998). Accord ing to the National Health Interview Survey, nine million children under the age of 18 years have been diagnosed with asthma (13%), children in poor families (1 5%) were more likely to be diagnosed with

PAGE 46

46 asthma, 4 million children (6%) had an asthma attack within the last 12 months, African American children were more likely to have had an asthma attack in the last 12 months, and children in fair or poor health were more than six times as likely to have had and asthma attack in the past 12 months (National Center for Health Sta tistics, 2003). This is staggering given that the National Institutes of Health and the internat ional Global Initiatives for Asthma have focused on asthma treatment and asthma management (N ational Heart, Lung a nd Blood Institute, 2003). A recent study conducted by the American Lung Association Asthma Clinical Research Centers reported that the number of asthma epis odes was highest in children less than 10 years of age. Additionally they found that African American ethnicity and a past hi story of severe asthma were risk factors for poor asthma control (McC oy, et al., 2006). Minority groups with diverse ethnic backgrounds experience disparities in asth ma care and management resulting in increased mortality (Coultas, Gong, & Grad, 1993). Lieu et al (2002) found that African American children had worse asthma status compared to Caucasian children based on the American Academy of Pediatrics Childrens Health Surv ey (AAP), experiencing a greater number of symptom-days, and an increased number of school absences. Additionally they discovered that African American and Latino children were less likely to be using inhaled corticosteroid medication compared to Caucasians. Notably, th is cross sectional study included 1000 subjects between the ages 2-16 years with a diagnosis of asthma, participating in a managed care Medicaid plan. Zoratti and co lleagues (1998) examined patterns of asthma care in 464 African Americans and 1609 Caucasians with participating in a managed care program. Compared with Caucasians, African Americans had fewer visits to asthma specialists, filled fewer prescriptions for inhaled steroids, and were more likely to vi sit the emergency room fo r treatment of asthma.

PAGE 47

47 These findings suggest ethnic differences in asth ma related health care within a managed care plan and suggest that financial barriers to he alth care are not the onl y cause for disparities. As noted by Joseph et al (2005), it is important to distinguis h race as a risk marker for asthma as opposed to a risk factor. Risk ma rkers imply a relationship between race and a measured variable, whereas risk factors include ancestry, more specifically genetic variations that associate with disease. Despite asthma guidelines, medical advances, and managed care programs; ethnic disparities in th e morbidity and mortality of asthma persist. This is not to suggest that adherence to guideli nes would minimize disparities bu t rather supports the role of genetic variation. Limited understanding of etiology of ACS As stated previously, pulmonary disease manifested as ACS is a common complication of sickle cell anemia. ACS is the second most co mmon cause of hospitalization in patients with sickle cell disease and is the leading cause of premature deaths (Platt, 1994;Vichinsky, 1996, 2000). ACS is characterized by the presence of a rapidly progressing multi-lobe infiltrate, cough, hypoxemia and dyspnea. The etiology of ACS is multifactorial and remains unclear. Our current understanding suggests that ACS may be a form of acute lung injury that progresses to acute respiratory distress syndrome. This injury is thought to be precipitat ed by sloughing of blood in the pulmonary microvascular resulting in pulmonary infarction, fat embolisation, and infection (Vichinsky, 1996; Scully et al., 1997). There is co mpelling evidence to support the central role of NO in the initiation of the pathophys iological process in ACS. Stua rt and Setty assessed plasma NO metabolites in 36 patients with SCD and 23 age-matched controls. Serum concentrations of NO metabolites were decreased during acute chest syndrome with values lower than in controls and in patients at steady state (Stuart et al 1999). Hammerman and colleagues (1999) exposed cultured pulmonary endothelial cells to the plasma of patients with sickle cell disease and acute

PAGE 48

48 chest syndrome and found that within two hours of exposure th ere were increases in NOS 3 protein and NOS 3 enzyme activity. They sugge sted that alterations of NO production and metabolism contribute to the pathog enesis of ACS. In a 30-center study, Vichinsky et al (2000) studied 671 episodes of ACS in 538 patients with SCD to determine the cause. They reported ACS is precipitated by fat embolism and a variet y of lung infections including; chalmydia, mycoplasm, and legionella. More importantly their results show that in more than 50% of cases the cause of ACS was undetermined. They conc lude that the etiology for ACS remains unclear. Surprisingly, the incidence of asthma in this stud y is reported to be 2%, significantly lower than what is generally seen in th e African American population. Similarities and Differences Between Asthma and ACS with Regard to Symptomology and Lung Function A number of recent studies have reported th at asthma may increase the risk of ACS in patients with SCD (Boyd et al., 2004; Knight-Madden et al., 2005; Bryant, 2005; Nordness et al., 2005). These reports were based on studies th at documented a link between SCD and airway hyperresponsiveness, lower airway obstruction, reversibility, a bnormal pulmonary function tests and the fact that cort icosteroids and bronchodilators, drugs commonly used in asthma, were beneficial in ACS (Santoli et al., 1998; Koumbour lis et al., 2001; Klings et al., 2006). Several papers are cited in the literatu re describing pulmonary function in patients with sickle cell disease (Koumbourlis et al., 2001; Sylvester et al., 2004, 2006; Klings et al., 2006). Exposure to repeated vaso-occlusive crisis undoubtedly has an impact on the pulmonary vasculature resulting in airway damage. This type of injury result s in restrictive airway disease as opposed to the obstructive airway disease seen in asthmatics. Multiple episodes of vaso-occlusive crisis and recurrent episodes of ACS may result in irreve rsible airway damage (Sylvester, 2004, 2006; Klings, 2006).

PAGE 49

49 A recent study in children with SCD was c onducted to determine whether children with SCD have restrictive lung disease and if so whet her this abnormality increases with age. Sixtyfour children with SCD and 64 ethnic matched controls, ages 5-16 years were studied. Compared to controls, children with SCD had lo wer mean forced expiratory volume (FEV 1), lower forced vital capacity (FVC), and lower peak expiratory flow (PEF). The effect of age on lung function differed significantly between th e two groups. Findings from this study demonstrate that children with SCD have a restrictive airway disease pattern and this abnormality increases with age. A limitation of this study is that episodes of acute chest syndrome were not reported for children with SCD (Sylvester et al., 2004). In 2006, this same group of investigators te sted the hypothesis that children with SCD and a positive history of acute chest syndrome woul d have worse lung function compared to children with SCD and no history of acute chest syndrom e. Forty subjects were enrolled, 20 positive for ACS, and 20 negative for ACS. The mean to tal lung capacity and re sidual volumes were significantly higher in children w ho had no history of ACS. They did not however demonstrate any differences in bronchodilator reversibility tests. Their findings suggest that children with SCD and a positive history for ACS have significan t differences in lung function as compared to children with SCD and no history of ACS. Thes e differences are consistent with restrictive airway disease often seen in a dults with SCD (Sylvester, 2006). A cross-sectional study of 310 adults with SCD found that 90% of subjects showed a restrictive airway disease patter n. Additionally, they reported that the presence of restrictive airway disease was associated with a more se vere clinical course (Klings et al., 2006). Koumbourlis and colleagues investigated the prev alence and reversibility of lower airway obstruction in children with SCD ages 5-18 year s. Interestingly they found that obstructive

PAGE 50

50 disease, reversible in nature, precedes the de velopment of restrictive airway disease. The limitations of this study include; small sample size limited historical information, and subjective information with regard to a history of asthma These children were not identified as having physician-diagnosed asthma (Koumbourlis et al., 2001) Asthma is a chronic inflammatory disease of th e airways. In susceptible individuals, this inflammation causes recurrent episodes of wheezi ng, breathlessness, chest tightness, and cough, particularly at night and in early morning. These episodes are usua lly associated with widespread but variable airflow obstruc tion that is often reversible either spontaneously or with treatment. The inflammation also causes an associat ed increase in the existing bronchial hyperressponiveness to a variety of stimuli (National Asthma Education and Prevention Program Expert Panel, (2003). ACS is characterized by the presence of mu lti-lobe infiltrates, cough, dyspnea, hypoxia, and often chest pain (Hammerma nn, 1999). Many of the symptoms related to ACS are also seen in asthma; dyspnea, coughs, and decreased oxygen saturation. Differentiating between asthma and ACS may be difficult in patients with SCD. Further research is needed to establish an objective assessment for primary care providers who are managing patients with SCD and airway disease.

PAGE 51

51 CHAPTER 4 RESULTS The primary aim of the study was to char acterize the association between physiciandiagnosed asthma and acute chest syndrome. The secondary aim of this study was to test the hypothesis that polymorphisms in candidate gene s for the NO pathway associate with ACS in SCD patients. Descriptive Results A total of 134 children with SCD participat ed. Forty-eight patients with SCD had no history of having ACS (36%) (contr ols), 86 at least one episode of ACS (64%) (cases). Fifty percent of cases had either 1 or 2 episodes. No differences in age or sex were observed between cases and controls (Table 1). Ninety percent (n=121) of patients with SCD were homozygous for S globin (HbSS); 6% (n=8) were heterozygous (HbSC); 3% (n=4) patients had sickle beta thalassemia (HbS); and genotype data on one patient was missing. On average the age for the first episode of ACS was 4.4 years; the median age was 3.5 years; and the range was <1 to 17 years old. There was no relationship between age and the number of ACS episodes (data not shown). The prevalence of physician-diagnosed asthma in our study was 36.1% (48 of 133; asthma status was not recorded in one part icipant). There was 100% concordance between physician-diagnosed asthma and asthma reported by pa tients or guardians. All participants with physician-diagnosed asthma were taking inhale d SABA; 68.8 % were on ICS (33/48); 2 and 3 participants were on LABA (salmeterol) and LTRA (montelukast) respectively. Genotyping The success rate of genotyping ranged between 95 and 100% (average rate was 97.6%). Table 2 compares the minor allele frequenc ies of the polymorphisms in SCD and healthy controls. In SCD participants, the NOS1 AAT re peat polymorphism and the ARGI variant were

PAGE 52

52 in HWE. The NOS3 polymorphisms were not in HWE, wh ich was in contrast to healthy controls, suggesting that genotyping of these variants was not in error, but was probably due to the presence of disease in SCD patients. The minor allele frequency of the AAT repeat (< 12 repeats) was significantly higher in healthy controls compared to SCD patients, 0.21 vs. 0.091; p< 0.001). The distribution of al leles carrying the numbe r of AAT repeats in patients with SCD was skewed to the right comp ared to healthy controls (2=122; p< 0.0001) (Figure 2). The data demonstrate that using a cut-off of < 12 repeats as suggested by Wechsler et al. in a mostly Caucasian asthmatic cohort is reasonable for patients with SCD. Asthma and Acute Chest Syndrome Among SCD patients with physician-diagnosed as thma, 85.4% had at le ast one episode of ACS compared to 14.6% of controls (odds= 5.85); whereas cases and contro ls were about evenly distributed among participants without asthma ( odds = 1.07). The adjusted OR (95%CI) is 5.47 (2.20,13.5), p = <0.0001 (Table 3). Figure 2 sh ows that the proportion of SCD patients who had physician-diagnosed asthma was rela ted to the number of episodes of ACS. The intercept of the regression line was 0.178; the slope of the re gression line was 0.097; and the correlation coefficient, R, was 0.89, indi cating that 79% (R2*100) of the variability in the proportion of SCD patients with physician-diagnosed asthma is accounted for by the number of episodes of ACS (p=0.001). Seven of 8 patients with 7 or more episodes of ACS had physician-diagnosed asthma (one patient failed to report asthma st atus, his medical history was missing and he was on asthma medications). Neither age nor gender contri buted to the relationship (data not shown). Genetic Associations The association between the risk of ACS a nd the number of AAT repeats for the NOS1 gene in SCD patients is shown in Figure 3. The risk of ACS in participants without physiciandiagnosed asthma and who were carrying alleles with < 12 AAT repeats (n = 16 alleles; 11.6%)

PAGE 53

53 was relatively high, 0.69, then declined to a risk of about 0.4 at 12 to 15 repeats (n = 87 alleles, 63%), followed by an increased risk at higher numb ers of repeats (n=35 alleles, 25.4%). The r2 for the regression was 0.76; and the p values for coefficients of quadratic regression line: x and x2, were 0.024 and 0.024, respectively. For SC D patients with physician-diagnosed asthma, the mean SD risk of ACS was higher than in non-asthmatics: 0.87 0.09 vs. 0.49 0.12; p = 0.001, and was not associated with AAT repeat numbers. No associations were found between the risk of ACS and the T-786C NOS3 polymorphism in either the asthma or the no-asthma cohorts or by sex (Data not s hown). A modest association was found between the A2/A1 ARG1 polymorphism and asthma (Table 4-4). Carri ers of the A1 allele (A1 homozygotes and heterozygotes) were less likely to have asthma, 22/79 (27.8%), compared to A2 homozygotes, 6/47 (12.8%) (Fishers exact test: = 3.98; p = 0.04).

PAGE 54

54 Table 4-1. Characteristics of self-identified Af rican Americans with sickle cell disease who had at least one episode of acute chest syndrom e (cases) and individuals with no episodes of acute chest syndrome (controls). Characteristic Cases (ACS) Controls (No ACS) Number 86 48 Mean SD age, years 12.6 4.64 14 8.9 Mean SD age at 1st ACS episode, years 4.4 3.6 -Percent female 49.3 50.0 Percent on Hydroxyurea Current Ever 5.8 12.7 10.4 16.6 Percent on chronic PRBC* transfusion 18.6 12.5 Reprinted with permission by Wiley-Liss Duckworth, L. et al. (2007). Pediatric Pulmonology, 42(4), 334. *Packed Red Blood Cells. Data from 70 participants Table 4-2. Comparison of Har dy-Weinberg Equilibria (HWE) and minor allele frequencies of NOS 1, NOS 3 and ARG I polymorphisms in 134 patients with sickle cell disease (SCD) and 74 healthy controls Minor Allele Frequency Gene Polymorphism (reference SNP) Sickle Cell Disease participants Healthy Controls NOS 1 AAT repeats in intron 13 (WT, 12; minor, < 12) 0.091 0.21 T-786C (rs2070744) 0.098 0.155 G894T (rs1799983) 0.14 0.121 27 bp repeat in intron 4 A=4 repeat 0.303 0.277 B=5 repeats 0.363 0.291 NOS 3 C=6 repeats 0.059 0.014 ARG1 A2/A1 (rs17599586) 0.133 0.142 Reprinted with permission by Wiley-Liss Duckworth, L. et al. (2007). Pediatric Pulmonology, 42(4), 335 indicates polymorphisms not in HWE in patients with SCD A1 is the T allele; which is not cut by Pvu II; A2 is the C allele, which is cut by Pvu II.

PAGE 55

55 Figure 4-1. Comparison of dist ributions of alleles carrying AAT repeats in intron 13 on NOS 1 gene in healthy, 73 self-identified, healt hy African Americans (n=146 alleles) and in 127 African Americans with sickle cell di sease patients (n=254 alleles). Reprinted with permission by Wiley-Liss. Duckworth, L. et al. (2007). Pediatric Pulmonology, 42(4), 335 Table 4-3. Influence of physiciandiagnosed asthma on the risk of having at least one episode of acute chest syndrome in patients with sick le cell disease (cases) compared to no physician-diagnosed asthma (controls). (p va lue represents the ch i square difference between the asthma and no asthma groups) Group, number (%) Physician-diagnosed Asthma No asthma Cases (ACS) 41 (85.4) 44 (51.8) Controls (no ACS) 7 (14.6) 41 (48.2) Total 48 (100) 85 (100) Adjusted Odds Ratio (95%CI) 5.46 (2.20,13.5) 1.07 p value p <0.0001 Reprinted with permission by Wiley-Liss Duckworth, L. et al. (2007). Pediatric Pulmonology, 42(4), 335

PAGE 56

56 Number of episodes (x) 0246810 Proportion having asthma, P(x) 0.0 0.2 0.4 0.6 0.8 1.0 1.2 Observed P(x) Linear probability model 95% CI x y 097 0 178 0 Figure 4-2. Prevalence of physci an-diagnosed asthma and acute chest syndrome episodes. The proportion of SCD patients having physiciandiagnosed asthma wa s plotted against the number of episodes of acute chest syndrom e in children with sickle cell disease. Reprinted with permission by Wiley-Li ss. Duckworth, L. et al. (2007). Pediatric Pulmonology, 42(4), 334

PAGE 57

57 Figure 4-3. Risk of ACS and NOS 1 AAT re peats in intron 13. The risk of ACS (1[controls/(cases+controls)]) is plotted agai nst the number of NO S1 AAT repeats in patients with SCD with physician-diagnosed asthma (closed circles) and without physician-diagnosed asthma (SCDNA). Reprinted with permission by Wiley-Liss. Duckworth, L. et al. (2007). Pediatric Pulmonology, 42(4), 334. Table 4-4. Association between ARG1 A2/A1 polymorphism and asthma among SCD patients. Number of SCD patients Genotype Asthma No asthma Odds A1 carriers 6 22 0.27 A2 homozygotes 41 58 0.71 Statistic likelihood ratio Fisher s exact test: 3.98; p= 0.04

PAGE 58

58 CHAPTER 5 DISCUSSION Acute chest syndrome is the leading cause of mortality and the second most common cause of hospitalizations in patients with sickle ce ll disease accounting for 25% of premature deaths (Platt, 1994; Stuart & Setty, 1999; Buchanan et al., 2004). The prevalence of ACS in children with SCD in our study was 64%, which was in reasonable agreement w ith a previous stiudy4 that reported prevalence rates of 61% in 0 to 9 year olds, and 46% in 10 to 19 year olds, suggesting that our sample was representative of the SCD popul ation. In the pres ent study, we identified physician-diagnosed asthma as an important risk factor for ACS in patients with SCD. The prevalence of physician-diagnosed asthma in SCD in our study was 36% (48 of 133 participants), and is in good agreement with those reported in previous studies, which ranged between 17% and 53% (Boyd et al., 2004; Kni ght-Madden et al., 2005; Bryant, 2005; Nordness et al., 2005) Among SCD patients with physicia n-diagnosed asthma, 85.4% had at least one episode of ACS compared to 14.6% for participan ts who did not experience an episode of ACS (OR = 5.47; p <0.0001). The prevalence of physician-diagnosed asthma in non-ACS participants is in excellent ag reement with the prevalence of asthma in African American children without SCD (Yeatts & Shy, 2001; Faga n et al., 2001; Koumbo urlis et al., 1997). Importantly, our data also show that the pr oportion of patients with SCD who have physiciandiagnosed asthma increases linearly as the number of ACS episodes increase (Figure 2). To our knowledge our study is the first to show this relationship, and, gi ven the mortality and morbidity associated with ACS, underscores the importan ce of coordinated pulmonary and sickle cell hematology care in diagnosing asthma in SCD. These data are also important because they point to the testable hypothesis that the aggressive treatment of asthma may reduce the mortality and morbidity of ACS in SCD patients.

PAGE 59

59 The results in Figure 2 imply that proportion of patients with physician-diagnosed asthma is caused, at least in part, by the number of ACS episodes experi enced by patients with SCD. The fact is we cannot determine causality from our data. It is possi ble that ACS may cause asthma, or that having asthma increases the risk of ACS, or that causality is bidirectional. The results of this study support a genetic component for both ACS and for asthma in SCD. The higher number of AAT repeats may act to decrease the activity of NOS1 enzyme leading to reduced production a nd availability of NO, which can increase the risk of ACS and possibly asthma (Weschler et al., 2000). Arginase activity is increased in asthma, leading to reduced arginine availability, wh ich can exacerbate NO deficiency in SCD patients. If the A2 allele of ARG1 leads to high expression of argi nase I compared to the A1 allele, then A2 homozygotes would utilize arginine to a greater extent than A1 carriers, resulting in less arginine for NOS 1 to convert to NO. Study Limitations A major limitation of the present study is how asthma was defined. We used a diagnosis of asthma by a pediatrician, se lfor guardian-reported asthma and drug use to define asthma. Selfor guardian-reported asthma was in comple te agreement with physician-diagnosed asthma, and all participants with physician-diagnosed as thma were on SABA, two-thirds were on ICS, which supports the idea that they had true asthma. Additionally, we only offered study participation to those who presen ted for their clinic appointments. This may have biased the study in that children with ACS may be more likely to keep their scheduled appointments compared to SCD patients who are stable. Earlier studies show pulmonary function abnormalities in children and adults with SCD. However, the data are conflicting in that some studies in children with SCD ha ve obstructive lung disease (K oumbourlas et al., 2001; Leong et al., 1997), while others have found restrictive lung disease (Sylvester et al., 2006). Adults with

PAGE 60

60 SCD have restrictive lung disease owing to re peated episodes of pulm onary vaso-occlusion, which increases with age (Klings et al., 2006). Moreover, SABA a nd ICS are often prescribed to patients with sickle cell lung disease. Alt hough our study confirms the results of previous studies that physician-diagnosed as thma is associated with ACS, and further shows that the risk of physician-diagnosed asthma is strongly associated with the numb er of ACS episodes, it is not clear that participants with phys ician-diagnosed asthma in our st udy had true asthma as defined by conventional methods. Clearly, further studies are warranted to determine if obstructive lung disease and asthma increase the risk of ACS in children with SCD. In a pilot study of non-asthmatic chil dren with SCD, we reported that FENO levels were reduced in individuals with ACS compared to those without ACS and to a cohort of healthy African American children (without SCD) (Sullivan et al., 2001). We also reported that levels of FENO were inversely related to the allelic sum of AAT repeats in intron 13 of NOS1 gene, which suggested a genetic link for ACS and led us to hy pothesize that this rep eat variant associated with ACS. A specific aim of the present casecontrol study was to determine the association between the AAT repeat polymorphi sm and ACS. We found that th e risk of ACS in individuals without physician-diagnosed asthma was reduced in alleles with 12 to 15 repeats compared to alleles with < 12 or with alleles carrying 16 or more repeats. These data s upport the hypothesis that the risk of ACS in SCD patients without asthma is asso ciated with the AAT repeat polymorphism, thereby implicating a genetic basis this disease. However, the association we found, if true, was modest and may represent of false-positive associ ation owing to small numbers. The confounding influence of physiciandiagnosed asthma on the risk of developing ACS (Figure 3) reduced our numbers and our power to detect a true genetic association. Thus we conclude that a larger study is warr anted to replicate our findings.

PAGE 61

61 The association between ACS and two polym orphisms in the NOS3 gene: E298D and T786C, has been reported in 87 African Americans with SCD (S haran et al., 2004). The C-786 allele was associated with an increased risk of ACS in females (n=45; relative risk=8.7). We were not able to replicate these data in the present study. The reasons for this are unclear, but may be related to small number of patients in our study who did not have physician-diagnosed asthma. Whether or not participants in the st udy by Sharan et al had physician-diagnosed asthma is not clear. The etiology of ACS is not completely unders tood but is known to involve infection, pulmonary infarctions and pulmonary fat embolis m (Vinchinsky et al., 2000; Vinchinsky et al 1994). Free fatty acids released by the hydrolysis of phospholipids in embolized fat can cause acute lung injury (Styles et al., 1996). Isoenzymes of phospholipase A2 (PLA2) hydrolyze phospholipids at the sn-2 position to generate lysophospholipids and free fatty acids (Dennis, 1994). Both cytosolic PLA2 and secretory PLA2 (sPLA2) function to generate arachidonic acid from phospholipids in inflammatory cells (Balsind e et al., 1994; Calabrese et al., 2000). Plasma concentrations of secretory phospholipase (sPLA2) are elevated in ACS ) (Styles et al., 1996) and have been proposed as accurate markers of AC S in patients in SCD crises (Styles et al., 2000; Naprawa et al., 2005). Asthma is acco mpanied by increased production of arachidonic acid and enhanced activity of cysLT (Calabrese et al., 2000). Thus, it may be postulated that the asthma phenotype associated with ACS in SC D may be leukotriene-dependent, and therefore may be responsive to the leukotriene modifiers: 5-lipoxygenase inhibitors or leukotriene receptor antagonists. Additionally, earlier studies have shown that corticosteroids may provide some benefit to patients with ACS (Bernini et al., 1998), although associated with rebound vasoocclusive pain when stopped abruptly. Aggr essive treatment with moderate to high doses

PAGE 62

62 of inhaled corticosteroids and a leukotriene modifier (5-liopo xygenase inhibitor or LTRA) in SCD patients with physician-diagnosed asthma a nd SCD may reduce the mortality and morbidity associated with ACS. Conclusions In summary, our study confirmed that physicia n-diagnosed asthma is an important risk factor for ACS in SCD patients, and further demonstrated that the incidence of physiciandiagnosed asthma was highly correlated with the number of episodes of ACS. Our study suggests that the NOS1 AAT repeat polymorphism may contribute to the risk of ACS in patients without physician-diagnosed asth ma, and that the A2/A1 ARGI pol ymorphism may contribute to the incidence of asthma in SCD patients. Fu rther studies are warrant ed to determine if aggressive treatment of physicia n-diagnosed asthma reduces the ri sk of ACS in SCD, and if the AAT repeat polymorphism contributes to ACS. It is important to note that our sample is representative of the general African American population in that 14.6% of children with physician diagnosed asthma who did not have a hist ory of ACS is consistent with the incidence of asthma nationally. Implications for Clinical Practice Findings from this study suggest that asthma may be a significant risk factor in children with SCD for developing ACS. Quite often in pr imary care settings an asthma diagnosis is not assigned before the age of 2 years. More specif ically we often see related diagnoses such as reactive airway disease, coughing, or upper airway congestion. In children with SCD the average age for the first ACS episode is between 2 to 4 years of age. Provider education regarding the association between asthma and ACS may heighten awareness of asthma related symptoms in infants and young children with SCD and result in more aggressive airway management. Additionally, educating the careg ivers of patients with SCD re garding asthma symptoms and

PAGE 63

63 their association with ACS may lead them to seek prompt medical attention for coughing episodes and upper airway congest ion, symptoms which may otherwise be viewed as the common cold. Sickle cell disease is clearly a genetic disease. Asthma on the other hand is a complex, multifactorial disease. Children suffering from SCD who also have asthma may have several specialists managing their care, for example a pulmonologist, hematologist, and primary care provider. Enhancing communication between providers may lead to better outcomes for these patients.

PAGE 64

64 CHAPTER 6 FUTURE WORK Several recent studies have re ported that asthma may increase the risk for ACS in patients with SCD (Boyd, 2004; Bryant, 2005; Knight-Ma dden, 2004; Nordness, 2005, Sylvester et al., 2007). If indeed children with concomitant asth ma and SCD have increased episodes of ACS, studies investigating aggressive asthma treatment may have an affect on the mortality and morbidity associated with this disease. Treatment with bronchodilators and inhaled steriods are the mainstay of asthma management and are cons istent with asthma guidelines (National Asthma Education and Prevention Program Expert Panel, 2002). Likewise, patients with SCD and airway compromise are routinely treated with bronchodila tors and inhaled steroids. (Vichinsky, 2006; Handelman, 1991; Mehta, 2006). Unlike preventative treatment in asthma, these medications are used primarily as supportive care st rategies in patients with SCD. To date there are no randomized clinical trials exploring aggressive asthma management in patients with SCD. Additionally, no studies have been reported that associate NOS genotypes, asthma, and SCD. It is intere sting to hypothesize that aggressi ve asthma treatment in patients with SCD may prevent or reduce the incidence of ACS. More intriguing is the possibility that identifying genotypes associated with asthma and ACS early in life, in conjunction with aggressive asthma management, may redu ce mortality in patients with SCD. Montelukast, a leukotriene receptor antagonsist, is frequently prescrib ed for the treatment and management of asthma in adults a nd young children (Knorr, 2001) (Biernacki, 2005) Montelukast is widely accepte d and commonly prescribed by pe diatricians given its safety profile and compliance. Recent updates to the national asthma guidelines suggest that combination therapy with Montelukast and inhale d corticosteroids may improve asthma control.

PAGE 65

65 Potential future studies could target patient s with SCD and physician diagnosed asthma early in childhood prior to the first episode of ACS. The first episode of ACS usually occurs between 2-5 years of age (Knorr, 2001). Subjec ts would be randomized to receive either aggressive asthma management with moderate to high doses of inhaled corticosteroids (ICS) and a leukotriene receptor atagonist or standard of care, then followed over a period of 3-5 years. Subjects would be monitored for asthma symp toms, episodes of ACS, and genotyped for the AAT repeat polymorphism in the NOS1 gene. In addition, exhaled nitric oxide collection and pulmonary function testing would be employed to assess and monitor airway inflammation. Given that exhaled nitric oxide is an accepted measure of ai rway inflammation in asthma, utilizing this biomarker as a predictor or diagnos tic tool to measure airway inflammation, may be useful when managing sickle cell disease patients. Randomized clinical trials are warranted to determine if aggressive treatment of physician diagnosed asthma reduces the risk of ACS in SCD, and to determine whether polymorphisms in candidate genes in the nitric oxide pathway contribute to ACS. Collaboration among sickle cell centers for large clinical trials will be especially important for genome wide association studies related to SCD and asthma. St udies of this nature re quire large numbers of patients in order to identify genetic associations. Finally, stressing the importance for cooperation between pulmonary and hematology clin ics can only benefit future studies involving SCD and asthma.

PAGE 66

66 APPENDIX A CONSENT FORM THE NEMOURS CHILDREN'S CLINIC JACKSONVILLE, FLORIDA INFORMED WRITTEN CONSENT You are being asked to volunteer in a research study. This form will explain the study. It is important that you understand th e study before deciding to be in it. You may ask the people in charge of the study who are listed on this page questions about the study at any time. WHAT IS THE TITLE OF THIS STUDY? Polymorphisms of Nitric Oxide Synthase Gene s in Sickle Cell Patients with Acute Chest Syndrome WHO ARE THE PEOPLE IN CH ARGE OF THIS STUDY? Principal Investigator: John Lima, Pharm.D. Nemours Childrens Clinic 807 Children's Way Jacksonville, FL 32207 Telephone number: (904) 3903483 (904) 390-3600 (operator) (800) SOS-KIDS Sub-Investigators: Niranjan Kissoon, M.D. Professor & Chief Pediatri c Critical Care Medicine University of Florida-Jacksonville (904) 202-8758 Jim Sylvester, PhD Nemours Children's Clinic 807 Children's Way Jacksonville, FL 32207 (904) 390-3483 (904) 390-3600 (operator) (800) SOS-KIDS Kevin Sullivan, M.D. Division of Pe diatric Anesthesiology Nemours Childrens Clinic 807 Children's Way Jacksonville, FL 32207 Phone Number: (904) 202-8332 Lewis Hsu, M.D. Emory University 69 Butler St. SE Atlanta, Georgia 30303 (404) 616-3545

PAGE 67

67 Laurie Duckworth MSN, ARNP Nemours Childrens Clinic 807 Children's Way Jacksonville, FL 32207 (904) 390-3483 (904) 390-3600 (operator) (800) SOS-KIDS WHO CAN I TALK TO ABOUT MY RIGHTS AS A STUDY SUBJECT? Tim Wysocki, Ph.D. Chairperson Nemours-Florida IRB Nemours Children's Clinic 807 Childrens Way Jacksonville, FL 32207 (904) 390-3698 WHAT IS THE PURPOSE OF THIS STUDY? Some patients with sickle cell anemia may develop a condition called acute chest syndrome (ACS). This condition is believed to be caused by the sickle red blood cells clogging the blood vessels in the lungs. After repeated episodes of ACS, the blood pressure in the blood vessels between the heart and lungs can remain high permanently. This condition is called pulmonary hypertension. The doctors who take care of children with si ckle cell anemia have noticed that certain children have a greater tendency to develop re peated episodes of acute chest syndrome while others do not develop this complication. The re ason for this is not clear. Likewise, intensive care doctors who care for children wi th the acute chest syndrome have noticed that these children respond dramatically to an inhaled gas called nitric oxide (NO) when they are extremely ill. NO is a gas that is made in the cells that line th e pulmonary (lung) blood vessels and is normally made in our own bodies. We believe that childre n with sickle cell anemia who are prone to ACS may not make enough NO in their pulmonary (lung) blood vessels. Recent research has shown

PAGE 68

68 that patients with ACS have lo wer amounts of NO in the air they exhale when compared to sickle cell patients who have not had ACS. We believe that sickle cell patients with ACS produce very low quantities of NO in the pulmonary (lung) system. We believe that this may be because some children have different types of the protein (amino acid) th at produces NO than others. This protein is called nitric oxide synthase (NOS). Humans have thr ee different types of the enzyme that produces NO. We want to examine whether or not there is a link between tendency to suffer from ACS, and the type of enzyme the patient has. This can be dete rmined by studying your DNA (Studying genes or DNA is becoming more common in clinical research studi es, but is still in an early stage. We know that certain genes make you tall or short. Certai n genes give you brown or black hair). This will be important to know because if there is a gene tic or inherited component that determines how severe the sickle cell disease will be it could be important for screening and lead to treatment that may help avoid complications in groups that are at high ri sk of having ACS. WHAT IS THE PURPOSE OF CO LLECTING THESE SAMPLES FOR DNA ANALYSIS? You/your child are being asked to take part in this research study because you/your child have sickle cell disease, or are a healthy voluntee r. Similarly, certain genes are associated with sickle cell disease, and may be associated with whether or not you/your child may develop ACS. Studying DNA from people who have sickle cell disease may help us better understand the importance of those genes and how th ey are involved in causing ACS. You/your child are being invited to provide a sample of your/your childs buccal cells (cells from your/your childs mouth) to test for DNA or genes related to sickle cell disease. Participation is voluntary You/your child do not have to pr ovide a sample for DNA analysis.

PAGE 69

69 We would also like to stor e some of your/your childs DNA in a bank (storage facilities) so that it may be used in future studies of sickle cell disease. WHO IS SPONSORING THIS STUDY? This study is being sponsored by The Ameri can Lung Association who will pay Nemours Childrens Clinic for conducting this study. WHO CAN BE IN THIS STUDY? You may participate in this study if you have sickle cell disease. You may or may not have had an ACS episode. You do no have to have sickle cell disease to participate, however, you may participate as a healthy volunteer. You must be African American to participate. HOW MANY OTHER PEOPLE WILL BE PART ICIPATING IN THIS STUDY? This study will involve approximately 300 children ages 6 and older, and adults from the Jacksonville, Florida and Atlanta, Georgia area. This study lasts only as long as it takes for you/your child to provide a buccal cell sample. WHAT ARE THE PROCEDUR ES FOR THIS STUDY? Buccal Samples In order to provide a buccal sample, you/your child must not have eaten for one hour. Then, you/your child will gargle a mouthful of water for the purpose of washing and spit out the water. You/your child will rece ive a small bottle of mouthwas h (Scope) and an empty tube, which will be labeled with an identification number. You/your child will vigorously gargle a mouthful of mouthwash for one minute and spit the garg led mouthwash into the coded tube. If you/your child find it hard to gargle the mouthw ash for one minute, you/your child can gargle the mouthwash for shorter times, and repeat the procedure until you/your child have gargled for a total of one minute (For example, you/your child can gargle a mouthful of mouthwash for 20

PAGE 70

70 seconds, and gargle another mouthful of mouthw ash for 20 seconds and repeat the procedure one more time). The gargled mouthwash contains buccal cells from your/your childs mouth. WHAT HAPPENS AFTER THE SAMPLES ARE COLLECTED? The buccal cells will be processed and your /your childs DNA will be stored in our laboratory at the Nemours Childrens Clinic in Jacksonville, FL. You/your child will not be notified of individual results a nd no results will appear in you r/your childs medical records. For those patients who have sick le cell disease, information from the medical record may be collected, for example, how many episodes of acute chest syndrom e you have had, and number of hospitalizations. WHAT ARE THE POTEN TIAL RISKS OR DISCOMFORTS? Any treatment has potential risks. The most common risks of the treatment used in this study are listed below. In additi on, there is always the risk of very uncommon or previously unknown side effects. DNA Testing Even though we will be careful to not reve al the results of th e DNA testing on your/your childs sample, there is a very small chance this information could accidentally become known to you, your child, your doctor, or others. Presently we know of no risk to you/your child if the genetic results become known. Gargling with Mouthwash You/your child may experience burning or ting ling in your/his/her mouth from gargling with the mouthwash for one minute. You/your child can minimize burning or tingling by gargling for shorter periods of time on more o ccasions until he/she has gargled for one minute.

PAGE 71

71 WHAT ARE THE POTENTIAL BENEFITS TO ME/MY CHILD OR OTHERS? There is no direct medical benefit to you/your child for participating in this study. Although you/your child may not benef it directly from this research there may be a benefit to society, in general, from the knowledge gained in connection with your/your childs participation in this study. IS BEING IN THE STUDY VOLUNTARY? Being in this study is totally voluntary. Anyone who does take part in the study can stop being in it at any time. There will be no change to the medical care given to anyone who decides not to be in it or who stops be ing in it. The researchers will destroy the samples obtained from anyone in the study if they are asked to do so. WHAT ARE ALTERNATIVE TR EATMENT OR PROCEDURES? There are no alternativ e procedures for this study other than you/your child can choose not to participate. WHAT HAPPENS IF MY CHILD DEVELO PS PROBLEMS FROM BEING IN THE STUDY? In the event that your child suffers any injury directly resulting from these studies, you may contact any of the investigator s listed on the front of this form In the event that your child's participation in this study results in a medical problem, treatment will be made available. No other compensation of any type is available th rough Dr. Sylvester, Dr. Lima, Dr. Kissoon, Dr. Hsu Dr. Sullivan, Laurie Duckworth or Nemours Childrens Clinic. Nemours Childrens Clinic will not pay for treatment if your child suffe rs any injury related to this study. You are responsible for reporting any adverse eff ect(s) to the investigator in charge as soon as possible.

PAGE 72

72 WHAT HAPPENS IF I DECIDE FOR MY CHILD NOT TO PARTICIPATE OR TO WITHDRAW MY CHILD FROM THE STUDY? If you decide that you do not want you/your ch ilds samples to be studied any longer and you wish your/your childs samples to be destroye d, you can notify the inve stigators listed on the front of this form. You understand that your consent for you/your child to participate in this study is given voluntarily. You may withdraw yourse lf/your child from or decide not to participate in the study at any time without prejudice. If you decide for yourself/your ch ild to no longer participate in this study, it will not affect your/your childs futu re health care at Nemours Childrens Clinic. CAN I/MY CHILD BE TAKEN OUT OF TH E STUDY WITHOUT MY CONSENT? Presently, there is no known reason for taki ng you/your child out of this study without your consent. However, the st udy investigators can remove your sample from the study at any time, for any reason(s) deemed appropriate. WHAT ARE THE COSTS FOR BEING IN THE STUDY? There will be no charge to you or your insu rance company for the te sts involved in this study. HOW WILL PEOPLE BE PAID FO R BEING IN THIS STUDY? You will not be paid for particip ating in this study. You will not receive, either now or in the future, compensation, financial benefits, or any royalties which result from information obtained from this study. WILL I BE TOLD OF NEW FINDINGS WH ILE THE STUDY IS IN PROGRESS? Participants will be told of any significant ne w findings developed during the course of this study that may relate to their willingness to continue participation in the study..

PAGE 73

73 HOW WILL THE INFORMATION COLLECTED FROM AND ABOUT PEOPLE IN THE STUDY BE PROTECTED? All information will be maintained on a confid ential basis. Your/your childs identity will be protected to the extent permitted by law. Care will be taken to preserve the confidentiality of all information. You/your child understand that a record of your/ your childs progress while in this study will be kept in a confidential file at Nemours Children's Clinic. The samples will be coded with a unique identifying number and stored in a secure location. The confidentiality of any central computer record will be carefu lly guarded and no information by which you/your child can be identified will be released or pub lished. However, information from this study will be submitted to the American Lung Association and the Food and Drug Administration (FDA). (It may be submitted to governmental agencies in other countries where the study drug combination may be considered for approval.) Me dical records which identify participants and the signed consent form can be inspected by The sponsoring drug company or designee The U.S. Food and Drug Administration The U.S. Department of Health and Human Services Governmental agencies in other countries; and The Nemours Florida Institutional Review Boar d (a group of people who carefully review the study activities and are res ponsible for protecting the sa fety and the rights of the volunteers). Because of the need to release information to these parties, absolu te confidentiality cannot be guaranteed. The results of this research project may be presented at meetings or in publications; however, your childs identity w ill not be disclosed in those presentations. WHO CONTROLS AND OWNS GENETIC MATERIALS? The sample that you/your child provide will be stored for 10 years at Nemours Children's Clinic.

PAGE 74

74 You/your childs DNA samples will remain in possession of the Nemours Children's Clinic and stored in Jacksonville, FL. The results of this genetic research might be valuable for commercial and/or intellectual property (for example, patent ) purposes. If you decide to participate in this genetic re search, you are giving your/your childs sample to Nemours Children's Clinic. Nemours Children's Clinic retains sole ownership of the research results, and of any use or development of the research records (including your/your childs sample) consistent with this consent. You will not receive any financial benefit that might come from the research results. WILL I HAVE ACCESS TO TH E GENETIC INFORMATION? You/your child will not be no tified of individual results fr om DNA tests and no results will appear in your/your ch ilds medical records. HOW ELSE MIGHT THESE SAMPLES BE USED? The samples obtained in this study will be anal yzed for genes of related to sickle cell disease and other related diseases. Samples w ill not be shared with other investigators. Your/your childs DNA samples will not be sold. It is possible that we may wish to contact you/your child for further study. If you do not wa nt yourself/your child to be re-contacted for further study, please indicate by checking the box below: I do not wish (my child) to be re-contacted I do wish (my child) to be re-contacted PARENT'S (LEGAL REPRESENTA TIVE) STATEMENT OF CONSENT By signing this form, you have not waived any of the legal rights which your child otherwise would have as a pa rticipant in a research study.

PAGE 75

75 The signing of this consent does not absolve doct ors from responsibility for proper medical care at all times. My signature indicates that I consent and authorize Drs. Lima, Kissoon, Sullivan and whomever they may designate as their assistants including Nemours Childrens Clinic, its employees and its agents to perform upon ________________________ ________(Name of Patient) the research described above. I am making a decision whethe r or not to have my child or myself participate in this study. I have read, or had read to me in a language that I understand, all of the above, asked questions and received answers concerning areas I did not understand, and willingly give my consent fo r my/my childs participation in this study. Upon signing this form, I w ill receive a signed and dated copy. ________________________ ________ ___________________ _______ Name of Participant (Print) Birthdate Signature of Participant Date If participant is less than 18 years of age th e parent/legal representative must give consent: ____________________________ ____________________ __________ Name of Signature of Date Parent/Legal Representative Parent/Legal representative ____________________________ ______________________ ___________ Name of Witness Signature of Witness Date I the undersigned, certify that to the best of my knowledge the subject/parent/legal representative signing this consent had the study fully and carefully explained. He/she clearly unders tands the nature, risks and benefits in his/her childs particip ation in this project. _____________________________ ___________ Signature of Investigator/Designee Date

PAGE 76

76 CHILDRENS INFORMED ASSENT (for 6 to 12 year olds) You are being asked to be in a research study. Before you decide whether you want to be in it, we want to tell you about it so you ca n ask any questions you have about it. The doctor in charge of the study is Dr. Lima. This doctor would like to find out if you have certain genes that influence whether or not you develop acute chest syndrome (a lung disease associated with sickle cell disease). Genes come from your mother and father and help make up what you look like and how your body works. If you decide to be in the study, here is what will happen. For this study, you will be asked to gargle with a mouthwash. To gargle, you will first wash out your mouth with water. You will then gargle some mouthwash for one minute and spit the mouthwash into a tube. You can also choose to gargle the mouthwash for shorter periods of time more than once until you have gargled mouthwash for one minute. You may feel burning or ting ling from the mouthwash. You dont have to do the study if you dont want to If you are in the study, you can stop being it at any time. Nobody will be upset at you if you dont want to be in the study or if you want to stop being in the study. The doctors and their assistants will take care of you as they have in the past. If you have any questions or dont like what is happening, please tell the doctor or assistant. Your parent or guardian knows about this study. You have ha d the study explained to you and you have been given a chance to ask questions about it. By writing your name below, you are saying that you know what will happen to you in the study and that you want to be in it. _______________________ _____________________ Childs Signature Signature of Witness _______________________ _____________________ Researchers Signature Date

PAGE 77

77 APPENDIX B DEMOGRAPHIC INFORMATION Name: MR#: Study # DOB: AGE: SEX: M F RACE: Date enrolled: Date of DNA Collection: Date of Consent:

PAGE 78

78 APPENDIX C MEDICAL HISTORY Date of birth ___________________ Hb type SS SC S beta thel S other Baseline pulse ox Premature birth yes no Asthma yes no Reactive airway disease yes no On any long term Antisickling therapy yes no Episodes of ACS Dates__________, ____________, ____________, _____________, _____________, ____________. _______________, _______________, _____________ Medications PRN Albuterol ICS __________________________ Singulair _______________________ Salmeterol____________

PAGE 79

79 LIST OF REFERENCES Akinbami, L.J., & Schoendorf, K.C.(2002). Trends in childhood asthma: prevalence, heath care utilization, and mortality. Pediatrics:110(2 Pt 1),315-322. Alving, K., Weitzberg, E., & Lundberg, J.M. (1993). Increased amount of nitr ic oxide in exhaled air of asthmatics. Eur Respir, 6,1268-1270. Asano, K., Chee, C.B., Gaston, B., Lilly, C.M., Gerard, C., Drazen, J.M., & Stamler, J.S. (1994). Constitutive and inducible nitric oxide synthase gene expression, regulation, and activity in human lung epithelial cells. Proc Natl Acad Sci U.S.A., 91(21),10089-10093. Atz, A.M., & Wessel, D.L. (1997). Inhaled nitric oxide in sickle cell di sease with acute chest syndrome. Anesthesiology. 87,998-990. Balsinde, J.S., Barbour, E., Bianco, I.D.,& Denni s, E.A., (1994). Arachidonic acid mobilization in P388D1 macrophages is controlled by two distinct Ca(2+)-dependent phospholipase A2 enzymes. Proc Natl Acad Sci U.S.A., 91,11060-11064. Barnes, P.J., & Belvisi, M.G. (1993) Nitric oxide and lung disease. Thorax. 48,1034-1043. Barnes, P.J. (1995). Nitric oxide in airway disease. Ann. Med., 27, 389-393. Batra, J., Singh, T., Mabalirajan, U., Sinha, A ., Prasad, R., Ghosh, B. (2006). Association of inducible nitric oxide syntha se with asthma severity, to tal serum immunoglobin E and blood eosinophil levels. Thorax, 62, 16-22. Bernini, J. C., Rogers, Z. R., Sandler, E. S., Reisch, J. S., Quinn, C. T., & Buchanan, G. R., (1998). Beneficial eff ect of intravenous dexamethasone in children with mild to moderately severe acute chest syndrome complicating sickle cell disease. Blood 92,30823089 Biernacki, W.A., Kharitonov, S.A., Diernacka, H.M., & Barnes, P.J. (2005) Effect of Montelukast on exhaled leukotrienes and qua lity of life in asthmatic patients. Chest, 128, 1958-1963. Boyd, J. H., Moinuddin, A., Strunk, R.C., & De baun, M. R.(2004). Asthma and acute chest in sickle-cell disease. Pediatr Pulmonology, 38, 229-232. Boyd, J. H., Macklin, E. A., Strunk, R. C.,& Debaun. M. R.(2006). Asthma is associated with acute chest syndrome and pain in ch ildren with sickle cell anemia. Blood, 108, 2923-2927. Bryant, R. (2005). Asthma in the pediatric si ckle cell patient with acute chest syndrome. J Pediatr Health Care, 19, 157-162. Buchanan, G.R., Debaun, C.T., & Steinberg, M..H. (2004). Sickle cell disease. Hematology AM Soc Hematol. Educ. Program, 35-47.

PAGE 80

80 Busse, W.W., & Holgate, S.T. (1998). Evidence from induced sputum. Inflammatory mechanisms in asthma. (pp. 75-81). New York, NY: Marcel Dekker Inc. Busse, W.W., & Holgate, S.T. (1998). Me diator Functions of Epithelial Cells. Inflammatory Mechanisms in Asthma. (p.479). New York, NY: Marcel Dekker Inc. Calabrese, C., Triggiani, M., Marone, G., & Mazzarella, G. (2 000). Arachidonic acid metabolism in inflammatory cells of patients with bronchial asthma. Allergy 55 Suppl 61, 27-30. Chaar, V., Tarer. V., Etienne-Julan, M., Diara, J., Elion, J., & Romana, M.(2006). ET-1 and eNOS gene polymorphisms and susceptibility to acute chest syndrome an dpainful vasoocclusive crises in children with sickle cell anemia. Haematologica. 91(9) ,1277-1278. Cicutto L.C., & Downey, G.P. (2004). Biological markers in diagnosing, monitoring, and treating asthma: a focus on noninvasive measurements. AACN Clin Issues, 15(1), 97-111. Collaborative Study on the Genetic s of Asthma (CSGA)(1997). A genome wide search for asthma susceptibility loci in ethnically diverse populations. Nature Genetics, 15, 389-392. Collins, F., Green, E., Guttmacher, A., & Guyer, M. (2003). A vision for the future of genomics research. A blueprint for the genomic era. Nature. 422, 835-847. Coultas, D., Gong, H., & Grad, R. (1993). Resp iratory diseases in minorities of the United States. Am J Respir Cr it Care. (149), S93-131. De Boer, J., Duyvendak, M., Schuurman, F., Pouw F., Zaagmsaj., & Meurs, H.(1999). Role of L-arginine in the deficiency of nitric oxide and airway hyperactivity after the allergeninduced early asthmatic reaction in guinea pigs. Br J Pharmacol 128, 1114-1120. Dennis, E. A. (1994). Diversity of group types, regulation, and function of phospholipase A2. J Biol Chem 269, 13057-13060. Deykin, A. (2005). Targeting biologic markers in asthma-is exhlaed nitric oxide the buls eye. The New England Journal of Medicine, 352 21, 2233-2235. Dinh-Xuan, A.T.(1992). Endothelial modul ation of pulmonary vascular tone. Eur Respir J. 5, 757-762. Duckworth, L., Hsu, L., Feng, H.., Wang, J., Sylv ester, J.E., Kissoon, N., Sandler, E., & Lima, J. (2007). Physician -Diagnosed Asthma and Ac ute Chest Syndrome: Associations with NOS Polymorphisms. Pediatric Pulmonology, 42(4), 332-338. Dupuy, P. M., Shore, S.A., Drazen, J.M., Fros tgell, C., Hill, W.A., & Zapol, W.M. (1992). Bronchodilator action of inhaled nitric oxide in guinea pigs. J Clin Invest. 90, 421-428. Enwonwu, C.O., Xu, S.X., Turner, E. (1990). Nitr ogen metabolism in sickle cell anemia: free amino acids in plasma and urine. Am J Med Sci., 300(6), 366-371.

PAGE 81

81 Fagan, J. K., Scheff, P.A., Hryhorczuk, D., Rama krishnan, V., Ross, M., & Persky, V. (2001). Prevalence of asthma and other allergic diseases in an a dolescent population: association with gender and race. Ann Allergy Asthma Immunol 86, 177-184. Frostell, C., Hogman, M., Hedenstrom, H., & Hede nstierna, G. (1993). Is nitric oxide inhalation beneficial to the asthmatic patien t? Am Rev Respir Dis. 147:,A515. Ford, J.G., & McCaffrey, L. (2006). Understa nding disparities in asthma outcomes among African Americans.Clin Chest Med. 27(3), 423-30. Furchgott. R.F.,& Zawadzki, J.V. (1980). The obligatory role of endot helial cells in the relaxation of arterial smooth muscle by acetylcholine. Nature. 288, 373-376. Gaston, B., Drazen, J.M., Loscalzo, J., & Stamler, J.S. (1994). The biology of nitrogen oxides in the airways. Am J Respir Crit Care Med. 149, 538-551. Gaston, B., Drazen, J., & Jonsen, A. (1994). Relaxation of bronchial smooth muscle by Snitrosothiols invitro. J Pharmacol Exp Ther. 268, 978-985. Getahun, D., Demissie, K., Rhoads, G.G. (2005). Recent trends in asthma hospitalization and mortality in the United States. Journal of Asthma. 42, 373-378. Gladwin, M. T., Schechter, A. N., Shelhamer, J.H., & Ognibene, F.P ., (1999). The acute chest syndrome in sickle cell disease. Possible role of nitric oxide in its pathophysiology and treatment. Am J Respir Crit Care Med, 159, 1368-1376. Goldman L, & Ausiello D. (2004). Cecil Textbook of Medicine. 22nd ed. Philadelphia, Pa: WB Saunders; 1030-1039. Grasemann, H., et al. (1999). Simple tandem re peat of polymorphisms in the neuronal nitric oxide synthase gene in different ethnic populations. Human Heredity, 139-141. Grasemann, H., Yandava, C.N., & Drazen, J.M. (1999). Neuronal NO synthase (NOS1) is a major candidate gene for asthma. Clinical and Experimental Allergy, 29, 39-41. Grasemann, H., Storm vanss Gravesande, K., Buscher, R., Drazen, J.M., & Ratjen, F. (2003). Effects of sex and of gene vari ants in constitutive nitric oxi de synthase on exhaled nitric oxide. American Journal of Respiratory Critical Care, 167(8) ,1113-6. Gustafsson, L.E. (1998). Exhaled nitric oxide as a marker in asthma. European Respiratory Journal, 11(Suppl.), 4s-52s. Hammerman, S.I., Klings, E.S., Hendra, K.P., Up church, G.R., Rishikof, D.C., Loscalzp, J., & Farber, H.W. (1999). American Journal of Physiology, (Heart and Circulatory Physiology), 277, 1579-1592. Hart, C.M. (1999). Nitric oxide in lung disease. Chest, 111(5), 1407-1417.

PAGE 82

82 Hoffman R, Benz Jr. EJ, & Shattil SJ, et al., (2005). Hematology: Basic Principles and Practice. 4th ed. Philladelphia, Pa: Churchill Livingston. Holgate, S.T. (1997). The cellular and mediator basis of asthma in relation to natural history. Lancet. 350 :5-9. Holla, L.I., Buckova, D., Kuhrova, V., Stejkalova A., Francova, H., Znojil, V., & Vacha, J. (2002). Prevalence of endothelial nitric oxid e synthase gene polymorphisms in patients with atopic asthma. Clinical and Experimental Allergy, 32 :1193-1198. Ignarro, L.J., Buga. G.M., Wood, K.S., Byrn s, R.E., & Chaudhuri,G.(1987). Endothelium derived relaxing factor produced and released from artery and vein in nitric oxide. Proceedings of the National Academy of Sciences U.S.A., 84, 9265-9269. Jain, B., Rubenstein, I., Robbins, R.A., Leise, K. L., & Sisson, J.H. (1993). Modulation of airway epithelial cell ciliary beat frequency by nitric oxide. Biochemical and Biophysical Research Communications, 26, 83-88. Joseph, C. L., Williams, L.K., Ownby, D.R., Sa ltzgaber, J., & Johnson, C.C. (2005). Applying epidemiologic concepts of primary, secondary, and tertiary prevention to the elimination of racial disparities in asthma. Journal of Allergy Clinical Immunology, 117(2), 233-240. Khairtonov, S.A., Yates, D.H., Robbins, R.A., et al (1994). Increased nitric oxide in exhaled air of asthmatic patients. Lancet, 343,133-135. Kharitonov, S.A., Lubec, G., Lubec, B., Hjelm, M., & Barnes, P.J. (1995). Clinical Science (Lond), 88, 135-139. Kharitonov, S.A., Yates, D.H., Chung, K.F., & Barnes, P.J. (1996). Changes in the dose of inhaled steroids affect e xhaled nitric oxide levels in asthmatic patients. European Respiratory Journal, 9, 196-201. Kharitonov, S., & Barnes, P.J. (2007). Exhaled Biomarkers. Chest, 130,1541-1456. Klings, E. S. Wyszynski, D.F., Nolan, V.G ., & Steinberg, M.H.. (2006). Abnormal pulmonary function in adults with sickle cell anemia. American Journal Respiratory Critical Care Medicine, 173, 1264-1269. Knight-Madden, J. M., T. S. Forrester, N. A. Lewis, & A. Greenough. (2005). Asthma in children with sickle cell disease and its association with acute chest syndrome. Thorax 60, 206-210 Kobzik, L., Bredt Lowenstein, C.J., Drazen, J., Gaston, B., Sugarbaker, D.,& Stamler, J.S. (1993). Nitric oxide synthase in human and rat lung: immunocytochemical and histochemical localization. American Journal of Respiratory Cellular Molecular Biology., 9, 371-377. Koshland, D.E. (1992). The molecule of the year. Science, 258, (5090), 1861.

PAGE 83

83 Koumbourlis, A., Hurlet-Jensen, A.C., & Bye, M.R. (1997). Lung function in infants with sickle cell disease. Pediatr Pulmonology, 24:277-281. Koumbourlis, A. C., Zar, H.J., Hurlet-Jensen, A.,& Goldberg, M.R.. (2001). Prevalence and reversibility of lower airway obstruction in children with sickle cell disease. Journal of Pediatrics, 138, 188-192. Leeman, M.,& Naeije, R. (1995). Nitric oxide and hypoxic pulmonary hypertension (editorial) European Respiratory Journal, 8, 513-514. Leong, M. A., Dampier, C., Varlotta, L., & Allen, J.L. (1997). Airway hype rreactivity in children with sickle cell disease. J Pediatr, 131:278-283. Lieu, T.A., Lozano, P., Finkelstein, J.A., Chi, F. W. et al (2002). Racial/Ethnic variation in asthma status and managemeent practic es among children in managed medicaid. Pediatrics. 109(5) 857-865. Lopez, B.L., Kreshak, A.A., Morris, C.R., Da vis-Moon, L., Ballas, S.K., Ma, X.L. (2003). Larginine levels are diminished in adult acu te vaso-occlusive sickle cell crisis in the emergency department. Br. J. Haematol., 120, 552-534. Lugogo, N.L., Kraft, M. (2006). Epidemiology of Asthma. Clin Chest Med, 27(1):1-15. Luiking, Y.C., Poeze, M., Dejong, C.H., Ramsay, G ., Deutz, N.E.(2004). Arginine availability in sepsis. Critical Care Medicine, 32(10), 2135-2145. Lum, A., LeMarchand, L. (1998). A simple mouthwash method for obtaining genomic DNA in molecular epidemiological studies. Cancer Epidemiol Biomarkers Prev. 7(8): 719-724. Mannino, D.M., Homa, D.M., Aki nbami, L., Moorman, J.E., Gwynn, C., & Redd, S.C. (2002). Surveillance for asthma-United States 1980-1999. MMWR: Surveillance Summaries, 29;51(1),1-13. Marsden, P., Heng, H., Duff, c., Shi, X., Tsui, L., & Hall, A. (1994) Localization of the human gene for inducible nitric oxide synt hase (NOS2) to chromosome 17q11.2-q12. Genomics, 19, 183-185. Massaro, P.P., Gaston, B., Dieter, K., Fanta, C., Stamler, J.S., & Drazen, J.M. (1995). Expired nitric oxide levels during treatment of acute asthma. American Journal Respiratory Critical Care Medicine, 152,800-803. Massaro, A.P., Mehta, S., Lilly, C.M., Kobzik, L ., Reilly, J., Drazen, J.M. (1996). Elevated nitric oxide concentrations in isolated lo wer airway gas of asthmatic subjects. American Journal Respiratory Critical Care Medicine, 153, 1510-1514. McCoy, K., Shade, D.M., Irvin, C.G., Mastronarde, J.G., Hanania, N.A., Castro, M., Anthonisen, N.R. (2006). Predicting episodes of poor asthma control in treated patients with asthma. Journal of Allergy and Clinical Immunology, 118(6), 1226-1233.

PAGE 84

84 Mehta, S.R., Annan, A.A., Byrns, P.J.(2006). O pportunities to improve outcomes in sickle cell disease. American Family Physician. 74(2), 303-306. Meurs, H., McKay, S., Maarsingh, H., Hamer, M., Macic, L., Molendijk, N., Zaagsma, J. (2002). Increased arginase activity underlies allergen-i nduced deficiency of cNOS derived nitric oxide and airway hyperresonsiveness. British Journal of Pharmacology, 136:391-398. Meurs, H., H. Maarsingh, and J. Zaagsma. ( 2003). Arginase and asthma: novel insights into nitric oxide homeostasis a nd airway hyperresponsiveness. Trends in Pharmacological Sciences, 24, 450-455. Moncado, S., Higgs, A., (1993). The Larginine nitric oxide pathway. The New England Journal of Medicine, 329, 2002-2012. Morris, C.R., Kuypers, F.A., Larkin, S., Vinchi nsky, E.P., Styles, L.A.(2000). Patterns of arginine and nitric oxide in patients with sick le cell disease with vaso -occlusive crisis and acute chest syndrome. Journal of Pediatric Hematology Oncology, 22, 515-520. Morris, S.(2002). Regulation of enzynmes of the urea cycle and arginine metabolism. Annual Review of Nutrition, 22:87-105. Morris, C. R., M. Poljakovic, L. Lavrisha, L. Machado, F. A. Kuypers, and S. M. Morris, Jr. (2004). Decreased arginine bioava ilability and increas ed serum arginase activity in asthma. American Journal of Respirator y Critical Care Medicine, 170, 148-153. Morris, C. R., F. A. Kuypers, S. K. Larkin, E. Vichinsky, and L. A. Styles. (2006). Patterns of Arginine and Nitric Oxide in Patients With Sickle Cell Disease With Vaso-occlusive Crisis and Acute Chest Sydrome. Journal of Pediatric Hematology Oncology, 515-520. Naprawa, J. T., B. K. Bonsu, D. G. Goodman, and M. A. Ranalli. (2005). Serum biomarkers for identifying acute chest syndrome among patient s who have sickle cell disease and present to the emergency department. Pediatrics, 116, e420-e425 Nathan, C., Xie, Q.W. (1994). Nitric oxide synthase : roles, tolls, and controls. Cell, 78, 915918. National Asthma Education and Prevention Progra m Expert Panel (2002). Guidelines for the Diagnosis and Management of Asthma. Journal of Allergy and Clinical Immunology, (Suppl.1), 142-144. National Center for Health Statistics. (2003). U. S. Department of Health and Human Services, Centers for Disease Control and Prevention. Na tional Center for Health Statistics. Series 10, Number 223:p. 4. National Heart, Lung and Blood Institute (2003). National Asthma Education Program Expert Panel Report: Guidelines for the Diagnosis a nd Management of Asthma. Bethesda (MD): National Institutes of Health.

PAGE 85

85 National Heart, Lung and Blood Institute (1995). Gl obal initiative for asthma: global strategy for asthma management and prevention. Bethesda (MD): National Institutes of Health. Nordness, M. E., J. Lynn, M. C. Zacharisen, P. J. Scott, and K. J. Kelly. (2005). Asthma is a risk factor for acute chest syndrome and cerebral va scular accidents in children with sickle cell disease. Clinical and Molecular Allergy, 3,2. Nussbaum, R., Mc Innes, R., Willard, H. (2004).G enetics in Medicine. (6th ed)..Saunders, Philadelphia, Pennssylvania.. Ober, C., Cox, N., Abney, M., Di Rienzo, A., La nder, E., Changyaleket, B., Cidley, H., Kurtz, B., Lee, J., Nance, M., & Petterson, A. (1998). Genome-wide search for asthma susceptibility loci in a founder population. Human Molecular Genetics, 7, 1393-1398. OByrne, P.M. (1996). Airway inflammation and asthma. Alimentary Pharmacology and Therapeutics, 10,18-24. Palmer, R.M., Ashton, D.S., & Moncada, S., (1988) Vascular endothelial cells synthesize nitric oxiede from L-arginine. Nature, 333 664-666. Pepko-Zaba, J., Higenbottam, T.W ., Dinh-Xuan, A.T., Stone, A., & Wallwork, J. (1991). Inhaled nitric oxide as a cause of selective pulmonary vasodilatation in pulmonary hypertension. Lancet, 338, 1173-1174. Piacentini, G.L., Bodini, A., Cost ella, S., Vicentini, L., Mazzi, P., & Sperandio, S., (1999). Exhaled nitric oxide and sputum eosinophil mark ers of inflammation in asthmatic children. European Respiratory Journal, 13, 1386-1390. Platt, O.S., Brambilla, D.J., Rosse, W.F., Milner, P.F., Castro, O., Steinberg, M.H., & Klug, P.P. (1994). Mortality in sickle cell disease: life expectancy and risk factors for early death. The New England Journal of Medicine, 337, 762-769. Puddu, G.M., Cravero, E., Armone, G., Muscar i, A., & Puddu, P.(2005). Molecular aspects of atherogenesis: new insights and unsolved questions. Journal of Biomedical Sciences, 1-15. Ratnawati, R., & Thomas, P.S.(2005). Exha led nitric oxide in pediatric asthma. Chronic Respiratory Disease, 2(3), 163-174. Robbins, R.A., Barnes, P.J., Springall, D.R ., Warren, J.B.,& Kwon, L.D. (1994, Aug). Expression of inducible nitric oxide synthase in human bronchial epithelial cells. Biochemistry and Biophysiology Research Communications, 203, 209-218. Robbins, R.A., Florcani, A.A., Von Essen, S.G. (1996). Measurement of exhaled nitric oxide by three different techniques. American Journal of Respirat ory Critical Care Medicine, 153:1631-1635. Robinson, L., Weremowicz, W., Morton, C., & Michel, T. (1994). Genomics. 19: 350-357

PAGE 86

86 Rosias, P.P., Dompeling, E., Dentener, M.A., Pe nnings, H.J., Hendriks, H.E., Van Iersel, M., & Jobsis, Q. (2004). Childhood asthma: exhaled markers of airway inflammation, asthma control score, and lung function tests. Pediatric Pulmonology. 38, 107-114. Santoli, F., Zerah, F., Vasile, N., Bachir, D ., Galacteros, F., & Atlan, G. (1998). Pulmonary function in sickle cell disease with or without acute chest syndrome. European Respiratory Journal, 12, 1124-1129. Scully, R.E., Mark, E.J., Mc Neely, W.F., Ebeli ng, S.H., & Phillips, L.D., (1997). Case records of Massachusetts Genera l Hospital: Case 34-1997. The New England Journal of Medicine, 337, 1293-1301. Sharan, K., S. Surrey, S. Ballas, M. Borowski, M. Devoto, K. F. Wang, E. Sandler,& M. Keller. (2004). Association of T-786C eNOS gene polym orphism with increased susceptibility to acute chest syndrome in females with sickle cell disease. British Journal of Haematology, 124, 240-243. Shaul, P.W., North, A.J., Wu, L.U., wells, L.B., & Brannon, T.S. (1994) E ndothelial nitric oxide synthase is expressed in culture d human bronchiolar epithelium. Journal of Clinical Investigation, 94(6) ,2231-2236. Shaul, P. (2002). Regulation of endothelial nitric oxide synthase : location, location, location. Annual Review of Physiology, 64, 749-774. Smith, A., Cowan, J., Brassett, K., Herbison, P ., & Taylor, D. (2005). Use of Exhaled Nitric Oxide Measurements to Guide Treatment in Chronic Asthma. The New England Journal of Medicine, (12) 352, 2163-2173. Stamler, J.S., Jaraki, O., & Osborne, J. (1992). Nitric oxide circulates in mammalian plasma primarily as an S-nitroso adduct of serum albumin. Proceedings of the National Academy of Science U.S.A., 89 7674-7677. Storm Vans Gravesande, K., Mattes, J., Endlicher, A., & Alving, K. (2004). Effect of two doses of budesonide on exhaled nitric oxide and ur inary EPX excretion in asthmatic children. Pneumologie, 58(7), 483-8 Stuart, M. J., & Setty, B.N. (1999) Sickle cell acute chest syndrome: pathogenesis and rationale for treatment. Blood, 94, 1555-1560 Stuart, M. J.& B. N. Setty. (2001). Acute chest syndrome of sickle cell di sease: new light on an old problem. Current Opinions Hematology, 8, 111-122. Styles, L. A., Schalkwijk, C.G., Aarsman, A.J., Vichinsky, E.P., Lubin, B.H., & Kuypers F.A. (1996). Phospholipase A2 levels in acute chest syndrome of sickle cell disease. Blood, 87, 2573-2578.

PAGE 87

87 Styles, L. A., Aarsman, A.J., Vichinsky, E. P., & Kuypers, F.A. (2000). Secretory phospholipase A(2) predicts impending acute chest syndrome in sickle cell disease. Blood, 96, 32763278. Sullivan, K.J., Kissoon, N., Duckworth, L.J., Sand ler, E., Freeman, B., & Bayne, E. (2001). Low Exhaled Nitric Oxide and a Polymorphism in the NOS I Gene Is Associated with Acute Chest Syndrome. American Journal of Respirat ory Critical Care Medicine, 164, 21862190. Sylvester, K.P., Patey, R.A., Broughton, S., Rafferty, G.F., Rees, D., Thein, S.L., & Greenough, A.(2007). Temporal Relationship of Asthma to Acute Chest Syndrome in Sickle Cell Disease. Pediatric Pulmonology, 42, 103-106. Sylvester, K.P., Patey, R.A., Milligan, P., Dick, M., Rafferty, G.F., Rees, D., Thein, S.L., & Greenough, A. (2004). Pulmonary function abnormalities in children with sickle cell disease. Thorax, 59, 67-70. Sylvester, K. P., Patey, R.A., Milligan, P., Rafferty, G.F., Broughton, S., Rees, D., Thein, S.L., & Greenough, A. (2006). Impact of acute chest syndrome on lung function of children with sickle cell disease. J Pediatr 149:17-22. Vallance, P., Collier, J., & Moncada, S.(1989). E ffects of endothelium derived nitric oxide on peripheral arteriolar tone in man. Lancet, 2, 997-1000. Vargas, A., Da Silva, M., Silla, L., & Chies, J. (2005). Polymorphisms of chemokine receptors and eNOS in Brazilian patients with sickle cell disease. Tissue Antigens, 66, 683-690. Vercelli, D. (2003). Arginase : marker, eff ector, or candidate ge ne for asthma ? The Journal of Clinical Investigation, 111, 1815-1816. Vichinsky, E., Styles, L. (1996). Sickle cell disease. Pulmonary complications. Hematology/ Oncology Clinics of North America, 10,1275-1287. Vichinsky, E. P,. Neumayr, L., Earles, A.N., Wi lliams, R., Lennette, E.T., Dean, D., Nickerson, B., Orringer, E., McKie, V., Bellevue, R., Daeschner, C., & Manci, E.A. (2000). Causes and outcomes of the acute chest syndrome in sickle cell disease. National Acute Chest Syndrome Study Group. The New England Journal of Medicine, 342, 1855-1865. Vichinsky, E., Williams, R., Das, M., Earles, A.N ., Lewis, N., Adler, A., & McQuitty, J. (1994). Pulmonary fat embolism: a distinct cause of severe acute chest syndr ome in sickle cell anemia. Blood 83, 3107-3112. Waugh, W.H., Daeschner, C.W., Files, B.A., McC onnell, M.E., & Strandjord, S.E. (2001). Oral citrulline as arginine precursor may be beneficial in si ckle cell disease: early phase two results. Journal of the National Medical Association, 93, 363-371.

PAGE 88

88 Wechsler, M. E., Grasemann, H., Deykin, A., S ilverman, E.K., Yandava, C.N., Israel, E., Wand, M., & Drazen, J.M. (2000). Exhaled nitric oxide in patients with asthma: association with NOS1 genotype. American Journal of Respiratory Critical Care Medicine, 162, 20432047. Williams, N. (1998). NO news is good newsbut only for three Americans. Science, 282, (5389), 610-611. Xia, Y., & Zweir, J.L. (1997). Superoxide a nd peroxynitrite generation from inducible nitric oxide synthase in macrophages. Proceeings of the National Academy of Sciences U.S.A., 94, 6954-6958. Yates, D.H. (2001). Role of exhaled nitric oxide in asthma. Immunology and Cell Biology, 79, 178-190. Yeatts, K.B. & Shy, C.M. (2001). Prevalence an d consequences of asthma and wheezing in African-American and White adolescents. Journal of Adolescent Health, 29, 314-319. Yetik-Anacak, G., & Catravas, J.D. (2006). N itric oxide and the endothelium: History and impact on cardiovascular disease. Vascular Pharmacology, 45, 268-276. Yildiz, P., Oflaz, H., Cine, N., Genchallac, H., Erginel-Unaltuna, N., Yildiz, A., & Yilmaz, V. (2004). Endothelial dysfunction in patients with asthma : The role of polymorphisms of ACE and endothelial genes. International Archives of Allergy and Immunology, 41, 159166. Zeidler, M.R., Kleerup, E.C., & Tashkin, D.P. ( 2004). Exhaled nitric oxide in the assessment of asthma. Current Opinion in Pulmonary Medicine, 10(1), 31-6. Zimmermann, N., King, N.E., Laporte J., Yang, M ., Mishra, A., Pope, S.M ., Muntel, E.E., Witte, D.P., Pegg, A.A., Foster, P.S., Hamid, Q ., & Rothenberg, M.E. (2003). Dissection of experimental asthma with DNA microarray an alysis identifies arginase in asthma pathogenesis. Journal of Clinical Investigation, 111, 1863-1874. Zimmermann, N., & RothenbergM.E. (2005). The arginine-rginase balance in asthma and lung inflammation. European Journal of Pharmacology, 533, 253-263. Zoratti, E.M., Havstad, S., Rodriguez, J., Robe ns-Paradise, Y., Lafata, J.E., & McCarthy, B. (1998). Health service use by African Americans and Caucas ians with asthma in a managed care setting. American Journal of Respirator y Critical Care Medicine, 158, 371377.

PAGE 89

89 BIOGRAPHICAL SKETCH Laurie Duckworth, native Florid ian, grew up in Miami, Florida. She received her Bachelor of Science in Nursing with honors from Florida Stat e University in 1983 a nd began her career as a registered nurse in the burn un it at Jackson Memorial Hospital, Miami, Florida. In 1985 she relocated to Jacksonville, Florida and was employed as a pediatric intensive care nurse. In 1987 she joined Nemours Childrens Clinic, Jacksonville Florida as a register ed nurse and clinic coordinator. For the past 17 years she has serv ed as a clinical research coordinator in the Biomedical Research Department with a focus on pulmonary disorders, specifically asthma and acute chest syndrome. She enrolled in the acceler ated BSN to PhD program at the University of Florida in 2001 and completed her Masters of Scie nce in Nursing degree and received her license as a nurse practitioner in 2003. She is a member of Sigma Theta Tau, Council for the Advancement of Nursing Science, Florida Nurs e Practitioners Association, Association of Clinical Research Professionals, and th e Florida Nurses Association. The summer of 2003 she was awarded a competitive grant from the National Institutes of Nursing Research, National Institutes of Health for a fellowship in genetics and completed a minor degree in genetics at Georgetown Univer sity. In 2006 she pres ented at the National Congress for Nurse Scientists in Washington, D. C. As a nurse scientist, she realizes the importance of how she may contribute to societ y through scientific research. She strongly believes that dissemination of knowledge through research in a multidisciplinary setting will enhance and contribute to evidence-based practice.


xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E20101206_AAAAFU INGEST_TIME 2010-12-07T03:36:44Z PACKAGE UFE0021254_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES
FILE SIZE 1706 DFID F20101206_AADHUS ORIGIN DEPOSITOR PATH duckworth_l_Page_74.txt GLOBAL false PRESERVATION BIT MESSAGE_DIGEST ALGORITHM MD5
9293a364d67a0cb7f69147a262520e40
SHA-1
de7e88802ed3c2b6c26580b43d7caed566c82307
27558 F20101206_AADHVG duckworth_l_Page_22.QC.jpg
87a3bce3b589c221c6d6f023e3880291
d4b159b1cbab99f80d34fa57feba400b87b2845c
1857 F20101206_AADHUT duckworth_l_Page_76.txt
ddf30c3a2f937d5cc10e60fb6ed29bee
19aac378eab67299212baf42f5e690ca170f5671
38580 F20101206_AADHVH duckworth_l_Page_38.QC.jpg
c7b2bba15cf83494d055fe9eaaeb5e57
9b0ae9cfecb6bead9bb25ab6b5ee182fea622722
213 F20101206_AADHUU duckworth_l_Page_77.txt
e4533fb843101bcf30dea13f957600d8
ba6e78c35ef5a939b7ccdceace7f66581be2fd7b
8703 F20101206_AADHVI duckworth_l_Page_62thm.jpg
e825164ba4a06c9cb8ca2624192b2e58
062c6d442f1b0968ed9de5dadde68c7276ca2d43
489 F20101206_AADHUV duckworth_l_Page_78.txt
1c444f24092138444f89b5df3b6ddba9
727293e3fde00113bd7e1d9bba8308e100f098ea
22537 F20101206_AADHVJ duckworth_l_Page_25.QC.jpg
9bc803d0b71f2e4b6a66079803e76dc7
49fa9a4f335f10a5ee36ace4793abf4b3f604a6c
2543 F20101206_AADHUW duckworth_l_Page_79.txt
b116c8fc493db1ba4d236f5fd81718e6
95b7f028d370c97be894c9863095fd80472bb109
7121 F20101206_AADHVK duckworth_l_Page_74thm.jpg
aa5bdbcd30675ec984c531d5917167d1
8e4b7f2932974f29bdbea3c15c7afd3272702f43
2770 F20101206_AADHUX duckworth_l_Page_80.txt
32ab179bb897ce8637072e1bbf9738be
f7606df484f17f31138c27682da9ec389c0a15a4
8857 F20101206_AADHVL duckworth_l_Page_18thm.jpg
1da050858e351151d9caa4fa2a9df186
22cfa13f9d109d48aa187916a2d63cb31f85688a
2657 F20101206_AADHUY duckworth_l_Page_81.txt
1fedeb1f10375e4429bd997f7d7407cb
26ec435159d3c34887c20461ae0e4fd7556ad123
17012 F20101206_AADHWA duckworth_l_Page_11.QC.jpg
d19cea82e307718d8fd558f213991f0f
9005166bc728818f5c19d6839261dd1d76d61b15
30858 F20101206_AADHVM duckworth_l_Page_89.QC.jpg
dd7482dcd5648f37b21d822f785b20a4
b7f827ac6bd15dfcad0fdaa4cd69198c030147a7
341989 F20101206_AADHUZ duckworth_l.pdf
f570b60b7bfc2d1844417c332d646568
42bea18a3a7437180bebc8873c56f425ef6c1e64
33769 F20101206_AADHWB duckworth_l_Page_12.QC.jpg
d04c4e37939440573a8ca3e2611006f6
e89d885c374c1d74ab3e734b023962868d421ce1
38425 F20101206_AADHVN duckworth_l_Page_45.QC.jpg
056fc17794a666b05c7b7e23eef22c6e
c9c92d83038efc5daf1e0ef8b0fcf775636cd059
4507 F20101206_AADHWC duckworth_l_Page_20thm.jpg
9e5ae1f01caac600d6a543d401355147
c32238e78d7e130f7313ac8b28506ed2718ad9ae
35870 F20101206_AADHVO duckworth_l_Page_16.QC.jpg
5f97b804720bd7ea016b0d07398b8235
eba50644368abeaaa2431e27132d5f22e8f9cf19
6384 F20101206_AADHWD duckworth_l_Page_21thm.jpg
65c46c332e10d00c365951a0b464138c
4608374dccfd584846aa90c00da98d18d35b2b6b
37272 F20101206_AADHVP duckworth_l_Page_43.QC.jpg
04391472d87e7a4202fa86f405995d83
9ee08372829e5e99b19c5650c4a0df939665e3d0
23573 F20101206_AADHWE duckworth_l_Page_21.QC.jpg
ab1b19145058e46e0b633bc117bf5091
3c0e14ef5d41d20c5ae4b8d625af32970431dadb
35874 F20101206_AADHVQ duckworth_l_Page_36.QC.jpg
615355f08494263426b1a3eecb5860c4
529d5965decf0560d9835bf88182f1e5ef4f4ef8
7934 F20101206_AADHWF duckworth_l_Page_24thm.jpg
e564bf1d841e25d74e4939602ca80e42
c9bd7c3fe1b5bfd1e58563f8e5dbe65fd6a39f50
136103 F20101206_AADHVR UFE0021254_00001.xml FULL
8422008cffbeb1909c1d962acd4375de
5ea9bc9ddbc2bdcc88bbd9c3be2d6439912233fd
30365 F20101206_AADHWG duckworth_l_Page_24.QC.jpg
b211837131fc00dcd9a59eeaec199e10
7da7f9f07e1203494391db17f758fb58c1fb68d4
641 F20101206_AADHVS duckworth_l_Page_02thm.jpg
d4c6edf188c74c21c2ad10a591f5d904
a1f43a996f0cf1d597aa4ffe9d3ae0264f295218
6118 F20101206_AADHWH duckworth_l_Page_25thm.jpg
4435423a1f35cbc534e595e59a57fe64
8df4016f3e9b6bc110a44580dacddda4d8bd515a
1238 F20101206_AADHVT duckworth_l_Page_02.QC.jpg
062b99c55d61e5b2b90afac5b1d75998
86910aa732db12a30c8a9c84256dbd84e8ac8c30
9061 F20101206_AADHWI duckworth_l_Page_26thm.jpg
1c2c4b6cb523c755f4e788b291e31802
98cd2a3b3eaa7d99c557c090ef07f563b3f28a14
24011 F20101206_AADHVU duckworth_l_Page_05.QC.jpg
c88452daef8435a8064101777e0079a1
f666dff9183b49017ac3868e38539379b1bb314e
29767 F20101206_AADHWJ duckworth_l_Page_28.QC.jpg
e14c8265e8d8754e7051c3d77386ce1c
f2a6d5cbd374850078ee1fa289a14d02ad1be1a1
6976 F20101206_AADHVV duckworth_l_Page_06thm.jpg
d70723438ef3828f18fe0547a9cc3a5a
f2c93ff82a5a9927ef47623e937b6a25eaa19405
36664 F20101206_AADHWK duckworth_l_Page_30.QC.jpg
2eccecc9826eba53cc3df8473da03d4b
2b237c88676e7e21f27736e812c465bd7fe207b7
3972 F20101206_AADHVW duckworth_l_Page_07thm.jpg
2e212486d21055b9d887794a4c976394
cbd31d3e3cc4c71ee81682f4af29f0fce0f55303
36940 F20101206_AADHWL duckworth_l_Page_31.QC.jpg
32b87dc8ae87871d299a14d0fcd0d589
eccd5503f09d011da67528c704594eec3ecc3f9e
15334 F20101206_AADHVX duckworth_l_Page_07.QC.jpg
7833f61c460918649ccd36b33ef97bb3
8da0bfd3669b248243f30eb64cde5fe23100f0e3
6766 F20101206_AADHXA duckworth_l_Page_54thm.jpg
0b22fd830312c34ac4b17a41de03ddc7
1729243c0c695d638e01adbc80b062af14e62aec
34996 F20101206_AADHWM duckworth_l_Page_34.QC.jpg
bc5387a6ca9da66f54ffc0afea4e758d
f7e8a04658e24e57a274857f3fb03d829f52259d
12839 F20101206_AADHVY duckworth_l_Page_09.QC.jpg
97d4ad4bf642187cf7d3a70973d2ad6c
2ffb258ec50f360643cf86b98ffba4974656e850
26474 F20101206_AADHXB duckworth_l_Page_54.QC.jpg
eeb97ea0094e5a972579303380bfd9d4
7c9b681e96493b899d13acbb05703ac5b04dc258
8772 F20101206_AADHWN duckworth_l_Page_36thm.jpg
27cb9ec2b4554a28fc77649255dbb8b6
396429fb180362546f5326fa113a28bdd7659f0b
32002 F20101206_AADHVZ duckworth_l_Page_10.QC.jpg
4ab3f49dfc1f61346803b316656e93be
18dd2c32f705344abdc9b6aba4e66bfa5f43aa00
21364 F20101206_AADHXC duckworth_l_Page_55.QC.jpg
6ed23b67e9dcfdcd2e240cf5c417fb0d
019c4bf89d16328fc3c347ab85b23314bfabf168
35683 F20101206_AADHWO duckworth_l_Page_37.QC.jpg
eea161cdf6ebcfb6a5c32999528f4525
16a449d06d93762236d7f36f488f530eb1b4d0b9
4151 F20101206_AADHXD duckworth_l_Page_56thm.jpg
f5c95bb5b791ae38cb2cc42279a34999
88bf3f509fb891a06878aaa4935f012838146f97
8814 F20101206_AADHWP duckworth_l_Page_39thm.jpg
cd63de0bd5958f297c1bd6a4c4536aa2
c61e1efed19a7d629dc52b0621ed89368d5438f6
14298 F20101206_AADHXE duckworth_l_Page_56.QC.jpg
c4707272c8f792be8ca067f8dde3066e
c230649b2860cf2d9a7f16abbed931530b17e48c
9055 F20101206_AADHWQ duckworth_l_Page_40thm.jpg
34e9b4acb8f574e4093857127c519511
9f1a85834a8da1b7ccfff6d91efe464503854f07
5906 F20101206_AADHXF duckworth_l_Page_57thm.jpg
f3391cd267c926ce1305546dfef92901
908d17953e3371cf4a0f883c205679b4d376a4c5
9085 F20101206_AADHWR duckworth_l_Page_45thm.jpg
bc500e108cdefde0562414a775c75125
0e3927557c74e373f1e7dc63db223dcc22028911
21007 F20101206_AADHXG duckworth_l_Page_57.QC.jpg
cf4d99c91e0f9f4d595d16eb28a37068
9ec3bf128fcab2c2e593545732321f25f894762a
9131 F20101206_AADHWS duckworth_l_Page_47thm.jpg
b64bccfd04886f3388a641c17def1513
e1a564941b1c3bca2c39c3e7110a0cfb42a25566
8698 F20101206_AADHXH duckworth_l_Page_58thm.jpg
826abaa0534bfbf5d3d17082003c6c2e
c0449916f8ea73fbc0d9ff172dc6bbd05c30a196
37684 F20101206_AADHWT duckworth_l_Page_47.QC.jpg
ae82d958f36fa647489412bcfab70075
6f0ba9025818b734abee81fde0af1a4180e4a034
37860 F20101206_AADHXI duckworth_l_Page_59.QC.jpg
25d25d0ef1b3d2282f7084ed90c2d725
7c3358ca519f83e306b03a12e0dd3b5666069bf1
8975 F20101206_AADHWU duckworth_l_Page_48thm.jpg
47f0db77d96534e73432dd33a828465b
aaf458efd2961b10e415ae2b83530cf02dda86f4
37122 F20101206_AADHXJ duckworth_l_Page_60.QC.jpg
6e7fd3ec8fa56275a6e7b01f6ccf3fc7
1a2b5c217a498a56aed4f48393abaea6c2f4994b
36427 F20101206_AADHWV duckworth_l_Page_49.QC.jpg
c8c7fe58ce0af230c9651ed53b0f467e
acea61ff276aaa97b01384c4a20b19ed3601f899
27944 F20101206_AADHAC duckworth_l_Page_01.jpg
45728fb44d41215c7c0bdc5d9a9788e2
0295afb53026f82f6fd369795974e0fdba972cdc
8193 F20101206_AADHXK duckworth_l_Page_64thm.jpg
ab78d8c01aacbaf66e51737d834695f7
d3020148c4642ad6f6a7f14278d8fb65a4507a06
6589 F20101206_AADHWW duckworth_l_Page_50thm.jpg
f91cae35a40c980dfbe2516ac6742922
065f244b138f3e59de8590e24688926adb21d4bf
33775 F20101206_AADHAD duckworth_l_Page_15.QC.jpg
cdcf72408e4154810933e6f4b8bd68c7
ee971cc56c79240dc1cda783d9ea3df118c5ab82
28667 F20101206_AADHXL duckworth_l_Page_65.QC.jpg
226df0e769eb4a57937d9f255e10d3f7
60f5b69fc3422370c05cdb82fb2240d3747eb1a0
32016 F20101206_AADHWX duckworth_l_Page_51.QC.jpg
fc3a66cc025d37fa890f068f9a1eb66e
f6edeb9b3e503cfcae6a542e1c322e4517bf5413
124591 F20101206_AADHAE duckworth_l_Page_88.jp2
6d7abb523b220df6cb0cba093209e08f
139ba974a5a27f6e8d3264e7437117fad8614219
8651 F20101206_AADHXM duckworth_l_Page_68thm.jpg
0595a167a220b9bbba179a6bd2e01204
b9d1d2e8e3aaa2e8dd67bc1d821d50736ea461be
9006 F20101206_AADHWY duckworth_l_Page_52thm.jpg
a16784620db5af9b98a9fd1f1ffd53ed
56e3dafd96bf2b3d8b22a73e4077390aba513801
8771 F20101206_AADHAF duckworth_l_Page_30thm.jpg
21c7e25dd27bae0b308b0dd612430961
4349e6b3dbe4984e32fd77beed630acd30252eaf
39644 F20101206_AADHYA duckworth_l_Page_80.QC.jpg
5914580b23dd6447700968eaad650948
701ceddc212fdd81af7de533904c9f4645128bd5
34790 F20101206_AADHXN duckworth_l_Page_68.QC.jpg
899cd321e0e8e9683685d7f190955059
59a2b953d59757740d9df49f8d1376525a736163
18402 F20101206_AADHWZ duckworth_l_Page_53.QC.jpg
581865225ef9aaa4add35e56d5414c24
19daa3fed6e24a84ff53298048776aad4f9c76b8
1053954 F20101206_AADHAG duckworth_l_Page_82.tif
ff97389f41c1bd83cef26bee201a1048
b64e9ffeb6cc72b1df4576e6ea7f3dc5550eb2b0
38426 F20101206_AADHYB duckworth_l_Page_82.QC.jpg
b9fb32699c3177e8509cc2879248de83
9bd3fea9070c0e45518d3c4d7b4b2f98d71b4ee0
33144 F20101206_AADHXO duckworth_l_Page_69.QC.jpg
e7d5046ea2cfc2d8d60bf606345f743d
4babdcca3056d6986bdf3369054117a9fd8a1178
38559 F20101206_AADHYC duckworth_l_Page_83.QC.jpg
42123ad6ae45e826765bf6c5fcc722af
b02bcb5b82daa0bbb2cce7aba2340fe02301820d
7409 F20101206_AADHXP duckworth_l_Page_71thm.jpg
f996581869fc492b25281aeedcf4942c
a159fb00d477d447e1912570f589b48224c78438
1530 F20101206_AADHAH duckworth_l_Page_75.txt
59ccb7600addddf7849dbe72468ddc74
55dd13ca23f5e7100f5de97ee4814b9034ee2eba
9122 F20101206_AADHYD duckworth_l_Page_84thm.jpg
33ba3698865c09c88817c9f87dcef90a
4f1638c57bfc4da1460a7cad845516e9bec1f429
2193 F20101206_AADHAI duckworth_l_Page_59.txt
ff8ec29ac39ee6ffc1e494fd88ff4dbb
ac2462fa088b9ddce71f8cd15c75fdbbb9e14f20
9087 F20101206_AADHYE duckworth_l_Page_86thm.jpg
23754d0737565dfe8758fcbbd8212611
c59538e09dcc451790f2f001b865f9ffa7d4bda4
31183 F20101206_AADHXQ duckworth_l_Page_71.QC.jpg
f2e3b35fc9d8b833f9298d52dadff305
69b4b07cad789cda0d17bea5e1948d7e0c5c1c03
63206 F20101206_AADHAJ duckworth_l_Page_79.pro
5ccff2f2aa688aa7e76fd5eea031c8b0
b4031e54562b5fa9895ae75019ac9d87ae179d25
7326 F20101206_AADHYF duckworth_l_Page_89thm.jpg
e8172168e0f2d7460c269160232a9704
5ee435b70553528ed063e22ceea00ff1de582afb
8152 F20101206_AADHXR duckworth_l_Page_72thm.jpg
2c2ad0a1875720f300b2449eef90dc95
66553165c3d1c6e874c2039efa10eaf85206173a
F20101206_AADHAK duckworth_l_Page_66thm.jpg
f492c1ade2881edf9aeac361f7de460a
92f94c33e70caa06d3e12ce8cfec49dbb8a65279
7825 F20101206_AADHXS duckworth_l_Page_73thm.jpg
66f83325bb9cfbca6e904cc9acc98b35
ecd142b5c5198cd395011112c57d7d8779642587
38929 F20101206_AADHBA duckworth_l_Page_85.QC.jpg
855fdb919a0071776def58a0424c3c08
0a14ba02985a46770e9cc4415ceeb7546ea1cd78
1359 F20101206_AADHAL duckworth_l_Page_57.txt
3c9c1e54ff952c150102f02c44941c99
675d2abfc1bbf61c2a48b83598b5df0c6d228ead
34000 F20101206_AADHXT duckworth_l_Page_73.QC.jpg
71b5830f2da622a088605d60fbb8cb6a
f851568464f0e72754d7687df769427862ba1bc5
4029 F20101206_AADHBB duckworth_l_Page_03.QC.jpg
9271190a38cfeb9251d1e0bf4e66ae2f
1341ea586cd5110705d5f31036c45536ed51584b
8583 F20101206_AADHAM duckworth_l_Page_16thm.jpg
8914bfd8ee093368cece50e92eec2af5
ebf4af41340e98f5f4b616e366639ae720b7d46e
29844 F20101206_AADHXU duckworth_l_Page_74.QC.jpg
3f9f0e16bac519de5b1baa869f678fbb
138082fb591f3eb629e423fb88e2c8121ddc33de
42524 F20101206_AADHBC duckworth_l_Page_65.pro
f886432ea5a9a79cd46d211016be9768
ffa305b14f89173b2a890fc053a8851823ba01e1
2132 F20101206_AADHAN duckworth_l_Page_61.txt
e03fc1b6a37d737a91f927ff64d061af
82dd9c888c911d7c2eccab17c554369ded5f21f5
6702 F20101206_AADHXV duckworth_l_Page_75thm.jpg
6fa8619502d937103fc075cca7b40246
764002e8143bf14f231307434691233d249b6581
1896 F20101206_AADHAO duckworth_l_Page_28.txt
fe8824181138836bdea8868eb5adaf5e
8a79b1cdc56818b0c40b415fa7822441d7ec8f2d
5551 F20101206_AADHXW duckworth_l_Page_76thm.jpg
b78e7cd5bb165ccb745cdb19aa743ed3
8e42c6f80790dbfe111b9f3d74f67888afed2a2a
F20101206_AADHBD duckworth_l_Page_50.tif
1e917759ebf34aa3b57844113bd28d59
8ef364af3703274212d215dfcef050089f6165a0
25271604 F20101206_AADHAP duckworth_l_Page_57.tif
1cd71c754d987f89302822fc2e75abe3
ee65cdf22322bb470d640a515797c7f21e2ef9d9
1457 F20101206_AADHXX duckworth_l_Page_77thm.jpg
6d3a80be3622e2303b5a64540a8d7020
fbd0bf2b05abed140e5facab7219c4f44b376443
22913 F20101206_AADHBE duckworth_l_Page_66.QC.jpg
cb94e0bdacb1c1709e2641046d105c41
543a9ae43b0040b6c13a062045da553776f1821e
93650 F20101206_AADHAQ duckworth_l_Page_76.jpg
30af7f16d24248e8410d84a35fcb8c4c
bd094b255c5316d8db221a1392b78b02c85d81d3
2518 F20101206_AADHXY duckworth_l_Page_78thm.jpg
076f5d4d535f738f2f0b50efe62bd46f
ce473d6db67f282dffc245f03ca2a0e526091ecc
21901 F20101206_AADHBF duckworth_l_Page_11.pro
fe7d354fda1e7aca623f2550b4fb49d2
5064697566896f907a1592f860d24bce3fe50ec2
112203 F20101206_AADHAR duckworth_l_Page_68.jp2
976813ed40cbf7b2110549bae290e6e2
631229ed5716d651834d36729dcc1ce62c7169e0
35852 F20101206_AADHXZ duckworth_l_Page_79.QC.jpg
6c07816a422eb88aa5b0054d031ac522
5b138fb037323c065def3b00b4c0d76806801913
111972 F20101206_AADHBG duckworth_l_Page_61.jpg
90f68367c8abe62f6e4606a6aef2ee28
11b9c6a9ff1f10d33b75b146268baca7309a783a
2195 F20101206_AADHAS duckworth_l_Page_30.txt
55a35cccd39c09e286b9dfab079cab25
9a00d0e6d707536f6d402428e08279bbc1dd3ced
140266 F20101206_AADHBH duckworth_l_Page_82.jp2
d3f4a39b36496a94853cf3d6bb88ce86
fb96fd43d66378f86deaad817121a33e5112ac99
1873 F20101206_AADHAT duckworth_l_Page_67.txt
554a2d645737a9527707d97c6bba91ab
9af45d98f9ebe2e51e1f5b982f420e77e2aa24c3
77015 F20101206_AADHAU duckworth_l_Page_21.jp2
fbdd5ba5fdd22fd6ad5e2c42efb55c96
7728a19fb98a1e5b253327954205380795015f1d
95453 F20101206_AADHBI duckworth_l_Page_65.jp2
9ececa7a425bc8cb558547771e301022
5949ac50660b6dbd35b2030c267d5f52d16d971c
14200 F20101206_AADHAV duckworth_l_Page_77.jp2
2cf4afb1470ec01e61fff9e37a78f760
9e3c432d5b7b676dc9e072f83196c0cd6666986d
24402 F20101206_AADHBJ duckworth_l_Page_76.QC.jpg
72e8eab21bf5e7772d1ad23af292c3e6
deba1468cd2097c443ede542ee9bc3272a264b8a
114367 F20101206_AADHAW duckworth_l_Page_52.jpg
4cc2b1c58c978136b8afe4f8d10c173c
ee352de4bc9c7368cfdab2d4f76d8809d660a9c4
107508 F20101206_AADHBK duckworth_l_Page_39.jpg
17396881cf3eb65889e29897bc01951e
a21e53644b1f9cd079c8e4a1f25a67fa0e2cd2c3
5585 F20101206_AADHAX duckworth_l_Page_02.jp2
5e8bd2cee3856b38e864aeff1956db5d
3a02ae4f8dbf24ebc28aaedb199f506d02f3bd15
26852 F20101206_AADHCA duckworth_l_Page_07.pro
65abf4203203efedd6afb9cd20d380a9
366d2ef392f14b29de47f3816583d99e5cb53d17
134028 F20101206_AADHBL duckworth_l_Page_83.jpg
00fc9e2b385c93a46cf8e196fce4f70a
349169fcf1d47ea79ded39d89cfad56546a9a552
1629 F20101206_AADHAY duckworth_l_Page_22.txt
cab35d996fe2347f147c90f8fe3982a7
3f869e583f9be3d14a193d8e373b083a2232806d
F20101206_AADHCB duckworth_l_Page_27.tif
4d2d4b311bb462d57c942dd51611d8f8
9cc4374a2369a6b06337572110ad1f9c42f8b9bd
67991 F20101206_AADHBM duckworth_l_Page_83.pro
35ce5d91d8ba3e342ec5305c269fa099
7d63d6ea64a0aebc03359b7920c9e66dcc7c5f74
137466 F20101206_AADHAZ duckworth_l_Page_84.jpg
9384f32267b34ce54e8d855447d45369
a23b679b526e4eab364383667dbec40b19755011
118108 F20101206_AADHCC duckworth_l_Page_18.jp2
37d5ba5e212c76e137e8ead2d1742a05
8f99cbd3735417cf63cb2de0f73469d1f5b25037
4119 F20101206_AADHBN duckworth_l_Page_11thm.jpg
dab727e6b41fcc274f13e11cc220e0dd
830835406197bf32480d913fb59ca30a68023d37
55634 F20101206_AADHCD duckworth_l_Page_38.pro
4a78c6a74be1fbae382091943a956162
c2ee6a5ff18a049afae882f87ef750adc4f9c115
112722 F20101206_AADHBO duckworth_l_Page_05.jpg
b81eb506b891f85db9eba2694c790c8b
91fe14835bf4d5eab074bd0f8c558f01ef428a17
F20101206_AADHCE duckworth_l_Page_52.tif
fbce80686429f40046c97c257f84993b
262e552fe390ff142ed6d15d82a1fdabffc0cdb6
99040 F20101206_AADHBP duckworth_l_Page_51.jpg
dcb50f016dd29425535ec9aee32b841b
a8f6ba81dfb8440cb531b00534507d1b00d31149
36694 F20101206_AADHCF duckworth_l_Page_41.QC.jpg
85d415a5f311e785011f2a2a1caa6597
ec4dc1ec96f1747a7bcff057602d212a42278b25
36161 F20101206_AADHBQ duckworth_l_Page_26.QC.jpg
0551c0b1976a642cfbadfea15b2034fe
4fb8ae4d8aaac3f3349e269cc1a8f3cc6c57a0f4
7482 F20101206_AADHCG duckworth_l_Page_70thm.jpg
ed88a95a64e2664005f6dab3e67a6bac
f9c4ab40e8f9acd5f5120ea32b7cb1f3dc8124eb
89866 F20101206_AADHBR duckworth_l_Page_24.jpg
73c6f050e28d9097b1add07fe3f187f8
8501f3a189fa49afa654fdb3e667b2bc89e368b8
110390 F20101206_AADHCH duckworth_l_Page_40.jpg
7e4357da4757507ec1bf46faca9a97d8
1b68a36b01f896fb6ffdabd962d81c267bedc562
80706 F20101206_AADHBS duckworth_l_Page_17.jpg
fba2f3d6cea6e0e856bf37364d318da6
c0eaaba3c69020df6239b6918fc80030c1378023
1998 F20101206_AADHCI duckworth_l_Page_51.txt
3ba95fe24515d7d89701e0f929fff21c
46b56b235d7d12883152634095dc9023ac9cf3ad
50101 F20101206_AADHBT duckworth_l_Page_23.pro
b6e7ba04495e00e49bb17b8365612b1a
309903764fefc5ce2fdfb9d622c26993affd4036
15704 F20101206_AADHBU duckworth_l_Page_03.jp2
4be890b2fef44089fe8697683e1dc7e9
e94cd829a79ec0451070aec45e00a941b3df5830
F20101206_AADHCJ duckworth_l_Page_25.tif
6f8c49755ffd3db4cee02292bff968a1
37c47419be3fdbce2d30c02059f7f9793df26d1b
698462 F20101206_AADHBV duckworth_l_Page_55.jp2
5b59908a5794e47ce82dd254e45a10fc
08d3c0fd01f8823b8d5ec31536d67c2825c8fee9
8766 F20101206_AADHCK duckworth_l_Page_44thm.jpg
7e367836a54b8e1cc275838b1b655ee4
28d8e05e0bab316ec25bc13c42e95e3745fa2170
4175 F20101206_AADHBW duckworth_l_Page_06.txt
c3520fcd475d0aeb8588f341622395a6
2e01ea20d5f63b8a43ac222f8e4d9877efd65e83
F20101206_AADHDA duckworth_l_Page_62.tif
417eea9e9e81f631b9ae3db8cc089448
061eec7ebd74812a53eb74515dc26c576d410c50
113118 F20101206_AADHCL duckworth_l_Page_62.jp2
c973fc94d73b85bfd5c99ff8896e30c6
362c505f52a84a0905dda6bbad0f32b003edc820
123439 F20101206_AADHBX duckworth_l_Page_45.jp2
65f4079dc9d8e5894689d5e5f8546558
211be0a5bd3375631f80269cbd299b407f2516e2
1946 F20101206_AADHDB duckworth_l_Page_73.txt
c21ac6987012de624dc22438d153ddf4
f920dec1e8405d765387598b4e3b3f5d5017895e
F20101206_AADHCM duckworth_l_Page_01.tif
6ac8da0624b0c7635a2c414c10ff7549
88ace29851e608f745d5fcae3d60964896e83b52
8284 F20101206_AADHBY duckworth_l_Page_14thm.jpg
09d515eb4d4ca7da6fc3e8885e51d92f
79d3d891d0a4b3382842af8acf83a8711d3efbb0
1991 F20101206_AADHDC duckworth_l_Page_15.txt
44d14e69a56fd4a335cd65be6acfb01d
a8809791b1d7f6f735556b581056f9b46ae26418
F20101206_AADHCN duckworth_l_Page_34.tif
068effa0e1ed3cab46f0f5f184525508
e63e019f9f6eb83b00107afd350db33b2e658286
F20101206_AADHBZ duckworth_l_Page_09.tif
35253b8db94e9d967c7b09b9a28feb7e
5ae572ddb3e1d9d5b8ac67b26b12f2ad8c0ea588
36908 F20101206_AADHDD duckworth_l_Page_87.QC.jpg
2a10496fb8a8bf1ad28dc7e596f44fec
cf545aeaa5afc744770998253b8c57b31947c496
114700 F20101206_AADHCO duckworth_l_Page_35.jpg
d840568162f3ab717fd0e879e6eebb16
8541268048e999c2038434907435571942ecfd9f
7104 F20101206_AADHDE duckworth_l_Page_65thm.jpg
211a70026a33df5d4fd20c41bd699c6f
0f585455ecc85b28098b3ae079c3006562f3dba6
F20101206_AADHCP duckworth_l_Page_28.tif
f48a400838943e8e91caa7aebcac2110
fb81ae5abfa4c3de6a16806a075dee891f89822d
1456 F20101206_AADHDF duckworth_l_Page_50.txt
601e2253ebff9db4d76c87decf392c4b
a5db224cd2f1b68ab6b4cd150e67bd72db5d04d1
54296 F20101206_AADHCQ duckworth_l_Page_61.pro
d078e6cf787de59f06cdef57704400d1
581f34bf7f8eaefb8555e966647047b0d7aaba4e
120393 F20101206_AADHDG duckworth_l_Page_60.jp2
0cfea4299478f2a4ed7559e049194175
57dd8dce6e3452b052dfbb1467d72738f551b380
26116 F20101206_AADHCR duckworth_l_Page_17.QC.jpg
b52c1a3f7f6a995f6d61f932f914c40f
e24a1cf02e257b26589e8ae8d5280caa471ed922
119746 F20101206_AADHDH duckworth_l_Page_31.jp2
2575341703cb5b110041fbb26fdac60e
c0bea82c7fae81716986f1925eca803edb7e9ff0
104623 F20101206_AADHCS duckworth_l_Page_15.jpg
c7c76dcbdf90deae247d73a9ca37100e
969c1cf2e6487289c042c8792b148e2b4d31c987
F20101206_AADHDI duckworth_l_Page_13.tif
407be62f683066d4e7ffbd18ef0db53c
5deaf137f20b02b93d180b05f1ffe876784edde5
140461 F20101206_AADHCT duckworth_l_Page_87.jp2
b2f22139be7c612f3f9a09cba4e17683
645da61b3db69cc99e1c4acea5bdbfc698e308ff
50482 F20101206_AADHDJ duckworth_l_Page_15.pro
f1fdbd08b23ecdba1eaf843863cff5ce
5947c30381c6b23dfbcef0244f9a7ee2a96e7ba9
13856 F20101206_AADHCU duckworth_l_Page_03.jpg
1adf72eba6f6e319ac956c33f9efe7bf
ae18194be99c338dfc93083748ecb93a13fe028f
52371 F20101206_AADHCV duckworth_l_Page_11.jp2
bddd4ae3d1b8f33f2f506afd3a1f4485
7958b045eda8e46d5a492e6e58c97338537c11d3
F20101206_AADHDK duckworth_l_Page_77.tif
a27167571324cb33a162e04f7e76f79f
1f71599cc3ac4faf6c92f6cc8fb86c2fd6a111f1
F20101206_AADHCW duckworth_l_Page_70.tif
1677f4cc48026bc7f0aba30aac5da9c1
3e98cf1136e2e0ed09fc152cf89db983a2546cd6
F20101206_AADHDL duckworth_l_Page_14.tif
fffa1d3e5bca23e43acfc2a0981db9ff
e66012ae4a99f30945fd80a444e3002769b92bfe
41153 F20101206_AADHCX duckworth_l_Page_24.pro
c9c2d404d30866e261dc4160a76c66b3
bc7db53752b28dbbf8dd22fff4e86a0c6aa68c6f
112841 F20101206_AADHEA duckworth_l_Page_60.jpg
099b1805c83b3f595f1ec5a90de2a823
a4fd9c6f50f4e88a5cfec21cc2f3303f2537b686
55871 F20101206_AADHDM duckworth_l_Page_32.pro
2b6b0762a756c77ea8b29900b0d5380f
971888266a2596f178b8350dac6d712726cca3f1
117559 F20101206_AADHCY duckworth_l_Page_33.jp2
34109d857484c46836b3dc16bb48baaa
179d928d9e47d1be4a28d869646ab3fca27ae0a8
100506 F20101206_AADHEB duckworth_l_Page_05.pro
2ec175bc9908449e1d429c06ede48bf8
f6d934073e169343b2dc0f30fd7fb0d0d8b32cab
58037 F20101206_AADHDN duckworth_l_Page_07.jpg
350f94d165cba15f9e48526afce7b7f4
77c1df735d9ab6d542803763932473fc9715f9b5
5982 F20101206_AADHCZ duckworth_l_Page_05thm.jpg
de6fffddfb9669a30cad6cd8ad462079
c388a85fa824ab72e8563b53d26feb0796f7dece
2228 F20101206_AADHEC duckworth_l_Page_35.txt
6114129ba9aa5d91f119cba596a06bfc
b8c66a2a0f6351c9a179e3cb77bb5b63182b8610
67019 F20101206_AADHDO duckworth_l_Page_82.pro
e6bd13d2d8ba8cf0cbef14d909547b61
5473f0cd94a3103dbc1e486de2ee378ed88b2757
36440 F20101206_AADHED duckworth_l_Page_86.QC.jpg
778568cea65ecf289e241eebcc6d6903
de5d7b630ce63e0407a3859c2778b9632a4f48e7
755301 F20101206_AADHDP duckworth_l_Page_20.jp2
ed847eefa54c77372366e668a3f45264
269bf00bf02b025aa06d1fb7c0a994bb38be51c2
1816 F20101206_AADHEE duckworth_l_Page_89.txt
9bb067fc65ce797d79289bcc1fd38997
7cebf6435654590bc3593656685e0f1def025922
6221 F20101206_AADHDQ duckworth_l_Page_03.pro
0faf3523981d8c1a13a392e8e4cce98e
5c9e1616904e0f110343c64b6fea5b92ad174b89
52508 F20101206_AADHEF duckworth_l_Page_58.pro
bf8a0602b0df849f2f4d85e4c3a2c19a
800dec6cd0196095367b0584f85dd39c72236507
145221 F20101206_AADHDR duckworth_l_Page_84.jp2
184c9d5abec4b55acb3c1fbf26f31fd8
6f47170751c84db826cf64962b26f582672ff41c
36282 F20101206_AADHEG duckworth_l_Page_48.QC.jpg
fe75f79cb5bbb73816203e8a0f49dd30
3e6f90edecf7e3d5c4b0ab3a71f7116d80523dfa
110756 F20101206_AADHDS duckworth_l_Page_15.jp2
96d9293905255409f9173917f71c33bc
f5d2bb21425a72748460bc59228f329863a77c36
110573 F20101206_AADHEH duckworth_l_Page_33.jpg
20c8c9ce440c609bc781ecce7d18ae69
11a36fbeb36ad8c416179ea8bfe748b0247c7e7b
87950 F20101206_AADHDT duckworth_l_Page_75.jpg
d12f4957026424d81ea9e8a5236c3cbe
704ab0f6793c62008bdfd6b95dac3cbfd110b5c1
2747 F20101206_AADHEI duckworth_l_Page_84.txt
41649893d816b454d8f9af494baa71df
a63715237583f183a1cdc00edf53af42ebfaf00b
746 F20101206_AADHDU duckworth_l_Page_08.txt
b1bbe95d3bdbf2856fe183effdf0f589
8eafcde1ed55eb53f788a5c3c373a4cf77d3a348
45535 F20101206_AADHEJ duckworth_l_Page_69.pro
1a2ef3d1b94cf540a8a77ac481c7d3d1
55b28da87ae9e3c51566d22dd377f238247c24dd
67553 F20101206_AADHDV duckworth_l_Page_85.pro
c52966e7fb59c4ce36560d410778e01e
86c78435edbe44b1d4370efb43c6a0040d57fdfb
6841 F20101206_AADHEK duckworth_l_Page_17thm.jpg
fe4ab107b43107a8a45dd1d521aaa789
b8e19030b37a47edeba4155db70953c54f83f399
38462 F20101206_AADHDW duckworth_l_Page_84.QC.jpg
b19e9ec34d18fe372eae81a1bf3854cd
1432b4c4ac8e190de86cf2fad464a73085703e9a
9401 F20101206_AADHDX duckworth_l_Page_83thm.jpg
0fe190e3b630691a1612cd8489d1a32d
2ecd9e9ec2eaaa0ff666169518cf5b749f414b15
25744 F20101206_AADHFA duckworth_l_Page_53.pro
76a0d6db179757727202c7e50628a491
64675cfcffd9f0206b5bf2c22e50aa052cfc6d3d
35169 F20101206_AADHEL duckworth_l_Page_29.QC.jpg
257c9e69162b92f28f11e63686b5aab3
57a5d4b527ac1da481f1e2729ec32c6d534d1eff
1325 F20101206_AADHDY duckworth_l_Page_03thm.jpg
6004ce78ba42348e4bcab62beadd5683
123251a758fe68015f192daa6b01af7267cbd101
113969 F20101206_AADHFB duckworth_l_Page_39.jp2
eda90bfcfd12e13c8a4b783d29553487
bdac60fb6b01ee267c124976d65fc7b4d9a4c379
2714 F20101206_AADHEM duckworth_l_Page_87.txt
c64aa2ac049ff5630852f026fc5d3cd3
c7b5037c870871b08e8a177e3b51b4e6e9cd76bf
F20101206_AADHDZ duckworth_l_Page_85.tif
a6efbf81e93d5c35bb2349d5f762e894
d8eb862288605796a9b776c313b4c18b922d7299
78281 F20101206_AADHFC duckworth_l_Page_66.jpg
f880e4a7b4c5ba281a112ea09d1a4876
33c5969f10f8a014bbefb4875c328f4542c2a527
41669 F20101206_AADHEN duckworth_l_Page_70.pro
15c241d7c38810c0a728ec9782ec5461
51917e871f0222c0b7bd486592718581967c31cd
12082 F20101206_AADHFD duckworth_l_Page_63.QC.jpg
1e116a993c38b3b3820e153f02f9611f
7f8d94d57029ca67a0b12601a0400c1e9fa885e4
2202 F20101206_AADHEO duckworth_l_Page_38.txt
76a36708a7330e17091ec84bb6866cec
e60224c3bf9c785e4547a16b64ca92e6b2c5617a
106474 F20101206_AADHFE duckworth_l_Page_73.jp2
f166916adfd8642198d8315e84f8eb81
2133dfacc252b3326a9b4d72b594657d91361d6c
111433 F20101206_AADHEP duckworth_l_Page_46.jpg
338df378448c6708abc6527a36186308
ba2427e0e3daddde7eae3ca0bb0b8b5b7e8c13e4
F20101206_AADHFF duckworth_l_Page_41.tif
a2923812569f29a037cb269eaea74145
e014749e0e46e5a3fe22a8f68006832579e4bde5
2149 F20101206_AADHEQ duckworth_l_Page_49.txt
b54c4fccb0d1a425a80c8a62f3ecd41f
e2a3f284b824335d9cb5ff5531bff6d2ed964aaa
110530 F20101206_AADHFG duckworth_l_Page_26.jpg
1ed5a4ddd205e8176a7b852dc5f17fe7
ad88e661b61b5de7ad1eb9e99d84a3a5be918e0d
7431 F20101206_AADHER duckworth_l_Page_22thm.jpg
88781a3fa7629d7f9f4cad4b8d916ac3
8bda509da9bb6e1f1359bb467812e37306dddb5f
117751 F20101206_AADHFH duckworth_l_Page_36.jp2
040d40bf31ac0cca18ec74ad06108907
de3484fbf54b9792d3523d749faf81c415f95da8
3089 F20101206_AADHES duckworth_l_Page_63thm.jpg
b8143d868b88edb67b0f0efc3b90e85d
419892b1a67680d5f604f0106cf97d3d4a4278fb
2211 F20101206_AADHFI duckworth_l_Page_52.txt
9dc8117a991990605fc8679920645caa
4805ac77e58c94f3075b1541a7a96a67310ebe36
54082 F20101206_AADHET duckworth_l_Page_48.pro
fb6d7b001cd2f430af0ccbb96db1eea2
90362981713099cec2bcf2dd12680aa8575e6f99
28806 F20101206_AADHFJ duckworth_l_Page_70.QC.jpg
aac534c048e6380e51c4ebb0369e430d
e787cdd5726516a6c79a847cc6bd388819b00df0
F20101206_AADHEU duckworth_l_Page_26.tif
c02b36f07813dc62d3706b1b83fe39d7
80ea09ea23a6c80f8583b2ad6902321c32b266b9
121828 F20101206_AADHFK duckworth_l_Page_79.jpg
39d1e28810ed1d195270f7f308011c80
1cd0d1279ff8fa08eeb256ac25be8139515a6d96
9216 F20101206_AADHEV duckworth_l_Page_81thm.jpg
0fe3c680882cb9ea2d48f8bc130ffd07
3ed5029511fcdf92a20c61d1992659ab82cda039
102262 F20101206_AADHFL duckworth_l_Page_23.jpg
6e665dbd9ef946a4bb090a60ab1e9b47
5db6f5d63013ec9326b3c12506254d797462a74a
43551 F20101206_AADHEW duckworth_l_Page_56.jp2
ccb7c4a46a0844dcbed0b5182d6d20f4
c4da2431c49e4373aac94b00adef3ed38c5f15f2
2117 F20101206_AADHEX duckworth_l_Page_46.txt
06209606de3ce7a32185c738ca85c487
d27d63ef5570dce126dc67ca98f188e322533cfe
1793 F20101206_AADHGA duckworth_l_Page_69.txt
9a0d0fb5dcc5d3dfdc52ea4fa6d24f27
e622b66f0d8ae3f7266dbc18b5e5b41e57925e45
599 F20101206_AADHFM duckworth_l_Page_63.txt
8dba3f00c932defa4fe77b308a6b3926
2a8e811befbe6a6a3958fd2915c34c6a80154e81
2335 F20101206_AADHEY duckworth_l_Page_88.txt
53b29299c97e6a3b21cd025a181a5a25
a6452dd1a9b07e9604d5c81ceb725b0bf103415e
94851 F20101206_AADHGB duckworth_l_Page_72.jp2
68131e691afdc61fe7d8eb682b92eb20
83a937c29c76c052df409ce01d5e6f8668c6e36d
37051 F20101206_AADHFN duckworth_l_Page_81.QC.jpg
b23dae4a01f6268b329742199eebd988
b6f40650c555501d885b9d27ad691dcffbf3ec38
107037 F20101206_AADHEZ duckworth_l_Page_51.jp2
2229398692e03c22a6a7d38e096cfeea
5753d36e1f13df9a6172a1c441ea8f1c2450c3f1
38249 F20101206_AADHGC duckworth_l_Page_32.QC.jpg
f3fe6e79a032cb027936ad3b3020d087
b0698dd4926b53e327e726d00444097b7d37b7bd
86895 F20101206_AADHFO duckworth_l_Page_17.jp2
aa250fe3633bd750c12735a922e3f979
4ebc18ace0a5177fbe65266994e5287b21f17554
35722 F20101206_AADHGD duckworth_l_Page_44.QC.jpg
6ba93ea5b07a9b9d43f86225ecd6c4c2
72acee17f76cbe3fd08202bdbd81f48e43583627
1502 F20101206_AADHFP duckworth_l_Page_66.txt
f0c916f2d56eed0fcd50b81b1963a6f5
fdb5dd1e2d89160d948343177778866c64bc37f4
110064 F20101206_AADHGE duckworth_l_Page_37.jpg
0b1a22e7723da2cdc97f223172e55159
b7db130917993fd813153026dcb4a050a907cb7d
99159 F20101206_AADHFQ duckworth_l_Page_89.jp2
71517d6c168424836099ce98454d6687
4caa823ce802d84365ccd0088be5e2e5c141c52e
35149 F20101206_AADHGF duckworth_l_Page_23.QC.jpg
17b87f30af1bdde724c6c997c810080f
e7cdf841f1498cfc95b23855dc6ee1740bbf14e6
35126 F20101206_AADHFR duckworth_l_Page_58.QC.jpg
5d4aa5c655d6004f798aa86819a26338
a2db51c9d209f33cd1a1b8ca85e5f6e355805cf9
8200 F20101206_AADHGG duckworth_l_Page_15thm.jpg
a8c68f6b395abd088a5298d353df14f3
ea8bf0261722a35d5c35578f80047a49e4c95fd5
9447 F20101206_AADHFS duckworth_l_Page_85thm.jpg
c95fb4cb9bd61e8deb124b51b80c2d74
439b194b20ae8af3ec9ba36b12e2e51ae61f5b25
2171 F20101206_AADHGH duckworth_l_Page_42.txt
c7ded9da7424189f582a7ad21350d0d5
b3d7d39db39127c5c7449499b59d79f3165e78c4
8234 F20101206_AADHFT duckworth_l_Page_78.QC.jpg
9797190b876c79fdf7a9f71b6dbe55b2
1b235b359391d82f62eab77658f9d020d60ff33c
8443 F20101206_AADHGI duckworth_l_Page_78.pro
9699c1701f904b9a9d844e203742476a
989b94d5172bf66f7401a46f0468c95e27bbddbd
68231 F20101206_AADHFU duckworth_l_Page_84.pro
0d9bfc8af9705485332e3bbf5916359c
478cee451db0204007079cfc4c4447e36b1885ee
116616 F20101206_AADHGJ duckworth_l_Page_13.jp2
389682c4569349d8f380fbbb2c0da138
7d493710a4bc25cbd9b675cf6557ff9290a390f8
112635 F20101206_AADHFV duckworth_l_Page_42.jpg
6b99a34563a2b2f1e55c72b63cb47caf
18d77851d9031bc2c0a0e26f3c2e3744822bd905
36520 F20101206_AADHGK duckworth_l_Page_08.jpg
d64a619e9c2a3e4c0e53aa17c0d76f56
05069b2af6cf83c2519641042eb48229e3e84184
4707 F20101206_AADHFW duckworth_l_Page_53thm.jpg
6a6784b755e9971f589428a8963f2b2b
ec2ea43213b670c2bb8b461cc24d598f89a3d814
110705 F20101206_AADHGL duckworth_l_Page_48.jpg
bd5b40a4a1db03dde315f8b48209a5fe
399c74f5f29cca266b3a06fe8de89aad76e4a4c2
F20101206_AADHFX duckworth_l_Page_47.tif
ecf6986f9794a95d0e6fc579924b9425
b2c763303e5d87beb2a564ad631e622f7f7cb8a3
8575 F20101206_AADHHA duckworth_l_Page_34thm.jpg
f29bc47f38ff247ebc65e201526403be
94b8e110622732e974dfe964487cc8361ea2345b
29563 F20101206_AADHGM duckworth_l_Page_55.pro
c77b02ea663655b91d9e947e1c6c304c
2a39253a3d4094d5dbd7cf33a6e849736a1706c1
36364 F20101206_AADHFY duckworth_l_Page_61.QC.jpg
a35264428949abdac1ca8b6a7bc4ff14
d9661eccaed1c642cb6ed4707cc94f568c3596c1
128622 F20101206_AADHHB duckworth_l_Page_87.jpg
d28568191c5b9239511a3ee3f66738d8
f494ffc00b661e4234db0409ffd219181f257420
91664 F20101206_AADHFZ duckworth_l_Page_22.jp2
f6bdd825e30b984759312febc953f5e0
d35488c7b4c32342d1d114f2a6b9ec2652e7fe50
F20101206_AADHHC duckworth_l_Page_72.tif
af03be1f148fa881e579fac37f4d7a31
17e9ec758c514653da54da48d609960a7f5a2aac
108317 F20101206_AADHGN duckworth_l_Page_14.jp2
e9d010be2dddacd545e28669030ce6c2
ecbee2eec8c6029da6eb0d9a53392a4e5c8de776
44002 F20101206_AADHHD duckworth_l_Page_56.jpg
0cd05e0f53d1c1dedd28631366c99029
45fe68549f3b2d230e339cac6390f24a0b671007
38054 F20101206_AADHGO duckworth_l_Page_17.pro
724ca7d26e512326459488614770cd82
0e072df5f5fe956b7e05238251626362dd383e7e
4163 F20101206_AADHHE duckworth_l_Page_02.jpg
684377dd2ef269b1e03f5e4143970b27
498dfe1a6c72af9513522f7265def9ed8ab3573b
1698 F20101206_AADHGP duckworth_l_Page_65.txt
7f48e2bf39afe87fa4b9078d341517e4
d1ef25c8cf48ae94244e2f6b8bb5b20581148c51
2102 F20101206_AADHHF duckworth_l_Page_41.txt
07e1b22eb76700bdac4820a2ed34e2e2
f10efc221f3ca5e6a66647a76d80c768374bb061
28464 F20101206_AADHGQ duckworth_l_Page_06.QC.jpg
fe1c62668f29116238fb7641e4e71c76
91f588a7d3338e8053e7c7a540d41f8b1e5c947e
36087 F20101206_AADHHG duckworth_l_Page_13.QC.jpg
9518340e02a544c8357b3a7970546a99
2686df909e74b8567e3e59023f7bf1f84274ac7c
33821 F20101206_AADHGR duckworth_l_Page_64.QC.jpg
d212b8221823c2c85f053e4a3a6699a6
cdc21a80e99bd6617c1ef24c42bc88d940b4ee11
2076 F20101206_AADHHH duckworth_l_Page_34.txt
a0b6711b6ed365304775471e1d5ad536
696f6913ee11d0598397d2965670b9b571c8b669
3017 F20101206_AADHGS duckworth_l_Page_08thm.jpg
deb1fa28da3f8d8fbc9019bcb0478956
caea3fda9e65b3e10099e0e014c5e8e0b9c14e31
35677 F20101206_AADHHI duckworth_l_Page_39.QC.jpg
53847a869eaedde10a9a527eb8c083b9
746e281d30172a02c44989fd3f92bdd42ace6ecf
41804 F20101206_AADHGT duckworth_l_Page_74.pro
a0a6d231a5aca53a38d1ce019cea2efe
441864a2a29a35ca9fd8cc314d0848f48e1cc825
2109 F20101206_AADHHJ duckworth_l_Page_26.txt
4ad0f86d9ed3e8ae8b6955425062637b
868dd7d8c3aca46225f63fe9801104b696c450e5
56512 F20101206_AADHGU duckworth_l_Page_43.pro
9740b21fe64da64227a7d08c0f3a03c4
c938e5aa409e44b884d4d072fe7bc16b647e3c49
52681 F20101206_AADHHK duckworth_l_Page_16.pro
100459917a35c462ed2702932758129b
e4d8ed5b3602e123649673c20760f70534d8b415
18399 F20101206_AADHGV duckworth_l_Page_19.QC.jpg
10e147bc2b85a7c716de236e41d74ad5
e24c91570a02b4a044408aa5667a4a150660bf6e
9476 F20101206_AADHHL duckworth_l_Page_80thm.jpg
6c534e3b26851543424369f8ca3acfc4
3b67d8ad8b3ea4f83d2efe1e5eb26bf9d07a4193
8917 F20101206_AADHGW duckworth_l_Page_33thm.jpg
c517a6da3b6f03be57b38aa8cb96f4ed
a5bdb1de6c69b6eac9b515b024db6c60fd27dc8b
27894 F20101206_AADHIA duckworth_l_Page_67.QC.jpg
285818c5dca79ca079dac06782b9a327
067589d03c6044ae9695209978e3c163a0035351
55179 F20101206_AADHHM duckworth_l_Page_31.pro
b3512149d98dc2ef7e6d8af8003d4956
905264a23ead686261310f3bfa91db5f4fdd5b51
F20101206_AADHGX duckworth_l_Page_53.tif
628581f8522b9242ebbafeb0236a9f55
6dd85f36e5f01fa62e2efeabd53322661263b2fe
2588 F20101206_AADHIB duckworth_l_Page_86.txt
f7a2bc00271452ac41b09620df30d89a
76dd349cc31e3b83dc1ad48649fc61160ab71561
6921 F20101206_AADHHN duckworth_l_Page_67thm.jpg
a52f8b01afde7ebe5ed2a7b65edbcace
24ecc518b64ec2857061c228b5d1c757ca8c2377
2727 F20101206_AADHGY duckworth_l_Page_83.txt
cfb4d355cbe35b72b1ba9b61b63fabae
a26025e08f01b755d3af74df46c08c22ccab9c03
106896 F20101206_AADHIC duckworth_l_Page_10.jp2
09809cbb97a8d49626c8fdc0687392ab
588f3330fdf1de30360101ccc21d3f90b8146198
2128 F20101206_AADHGZ duckworth_l_Page_29.txt
bd1826834e52d01668b781697da21e50
93ba4bc7642dc4818fdb551332b9cfd8488cd948
119821 F20101206_AADHID duckworth_l_Page_52.jp2
f74f48eebafe960f78dd8e809ab6ec94
4507627da5fcab6d0af3093e4a31aeb773e9c822
8422 F20101206_AADHHO duckworth_l_Page_51thm.jpg
63e1c5c73fc5149fac5d2ae6630e4d4a
02258ecbad102b2dd0a533b8e0deae39e67cf940
10731 F20101206_AADHIE duckworth_l_Page_08.QC.jpg
c10a8a9cbc4bcb860bfda7f3794494f9
14f7c948980d4280abfcb316e20690716515656a
9086 F20101206_AADHHP duckworth_l_Page_60thm.jpg
aad8381ffaad133c609cf68db53ca7b0
2e8de0e337d203f722ac7489be2513171f1882a4
23000 F20101206_AADHIF duckworth_l_Page_04.QC.jpg
4ce106a0cb9b1b4844790da557403bd8
88f1fb4abdd86d5a9de999b98a80740c335823eb
4371 F20101206_AADHHQ duckworth_l_Page_27thm.jpg
f3698feb82c4e77f74bb1ecc41c27da1
75140e442eb0d3933ee4a724dffd34744615695b
37352 F20101206_AADHIG duckworth_l_Page_33.QC.jpg
84ff75e64cc57123b3a0bf9bced01b6c
8eba4b2bec90d2ae4241aedda633194c0650a5e0
53398 F20101206_AADHHR duckworth_l_Page_44.pro
91462725191e23ffd84120b98a553848
50f6db470c354832c81b91b497c22b460963afe4
69252 F20101206_AADHIH duckworth_l_Page_80.pro
bdfe9a42620cb63295470313959756f2
f421f8dd915090baa58598395944e586ede2803a
8819 F20101206_AADHHS duckworth_l_Page_31thm.jpg
5d366ca2b085c73522a3c0f0624d9f8d
b387dc68695de826a0186bac348bbf9cfc763498
4593 F20101206_AADHII duckworth_l_Page_77.QC.jpg
48717e5413469a0f79a953c9b955758b
14f4686953d101bd4b7832be4074aafdbdd9bfed
96057 F20101206_AADHHT duckworth_l_Page_24.jp2
b0ee4d4aa4d76b2d1a38d35a99073cd0
2a65789e6dd0c40760d32031872ecf3a3b909762
94160 F20101206_AADHIJ duckworth_l_Page_71.jp2
b89bc7bc95b6096999a798bd62baa0c9
df3411a7a9b597f02194fa54cba240811bd8fa1f
F20101206_AADHHU duckworth_l_Page_29.tif
8f30e3fb10c10e7c815e1e275f3171c1
f81eab44ba4fb131e95440b4a3a98903918b8cdf
8717 F20101206_AADHIK duckworth_l_Page_59thm.jpg
37eb4654025379e12d94fd5752edbcdf
1954cd1e549d467e7a020e8a3b93376ef6a5ff61
141528 F20101206_AADHHV duckworth_l_Page_85.jp2
c97c034ae3abbc595d101eea100f3193
a11c1a3b58b59061c8c526f8898d57907af30098
37831 F20101206_AADHIL duckworth_l_Page_35.QC.jpg
5be7c6ec72e63d87f0c420e16317d705
1a79f64dc8b59f9d43d5873bfe78000741ca3738
101977 F20101206_AADHHW duckworth_l_Page_14.jpg
9561b0caf1efcea369050e1bbb1d7ae4
aa20e2665c90787642386461105a75e3258c45f0
31919 F20101206_AADHIM duckworth_l_Page_72.QC.jpg
8d60c1c03af95285a5944ec63acf376c
d4ac3e810b6114acce7a08632902acbd850ee5ed
72522 F20101206_AADHHX duckworth_l_Page_04.jpg
5a7d37619192d3cfc233bb8efdb2449a
ee5d08018d86650e6daa741855a4519ef724f28d
2156 F20101206_AADHJA duckworth_l_Page_40.txt
184248a3adb6a352a38b5e2150ad449a
b5e148b8d7f6f7c6d60941324225eacac01b6250
8783 F20101206_AADHIN duckworth_l_Page_61thm.jpg
dc72a288268e69ccd8faa4f20b2ac84b
f87a264af45db3c0c9c72a20d0ec7b9c15aefafb
49690 F20101206_AADHHY duckworth_l_Page_20.jpg
98a95d59b76cec9db65da2b69de4565c
7f844a8b7b0019f486862282a29598795a9d160b
38802 F20101206_AADHJB duckworth_l_Page_52.QC.jpg
e62f1090b8103c7dbcad24ff45583f85
f485c550275c272bec2a938cd13a5a820f0ddd55
4517 F20101206_AADHIO duckworth_l_Page_19thm.jpg
de676a1547506433c5584de46e741169
055f0421c0ba65c5b46e38b291315ef88c0af1dc
53545 F20101206_AADHHZ duckworth_l_Page_41.pro
e278dc643cfebbf424de454e36abcc8a
4670bc3f671c017f56282f03a9330dd287888a39
25331 F20101206_AADHJC duckworth_l_Page_50.QC.jpg
dabce9d1d45e6b4a1a1c7807fdfaeefe
c7f0de992e12665e654712453a7fad01220a660b
14590 F20101206_AADHJD duckworth_l_Page_20.QC.jpg
67f6e819352d5df53ecb4c76651c205d
190bf544142b4d04295b84234147ffedcbeb1b17
55502 F20101206_AADHIP duckworth_l_Page_53.jpg
dad4ad71496a4a463091e150034d03c9
be92239309e448813a638ef31a6327c03adfa9cb
53101 F20101206_AADHJE duckworth_l_Page_18.pro
b9281855e32e258cf3c3df1131417777
36c20e5b0d3abb3db78f90508e019ffcfaac53dd
45876 F20101206_AADHIQ duckworth_l_Page_54.pro
b93eed86ce65659c25564f51b5cf2d34
471934a5fbac8b21a99783700b522e3a921b773e
107633 F20101206_AADHJF duckworth_l_Page_44.jpg
52b4a4136b2d97830384909ff98b101e
9b3c6f8695fecab4086f62a7abd944cd14ef637c
F20101206_AADHIR duckworth_l_Page_07.tif
c0686e395ccf17b8d04a7c301c500fef
fba88405503e8a937746fee89de4536e3053b003
F20101206_AADHJG duckworth_l_Page_46.tif
c1c1e633ff0376ae61c430ac3849359c
b10874d2d5bdbaf20f16ac3bc672af242b995ead
8197 F20101206_AADHIS duckworth_l_Page_69thm.jpg
bea41262c8e575ac090e0ab604e8e59f
0fd8a63152a7e8e09bd5a5d7e098eed10757a85b
F20101206_AADHJH duckworth_l_Page_74.tif
f9dbb3212030b396a37e5b91ad5b89be
f8eede032cfe394e2a43321df62ee8ebd0dbc4bc
106772 F20101206_AADHIT duckworth_l_Page_68.jpg
1eadd0b4f1f826da408f8f48c8af9d98
1f9e481974c78191f319a76818d34b1312ea8409
F20101206_AADHJI duckworth_l_Page_21.tif
81e99a651ee9ca39df512d3603997cdb
16971f1e00d1f46968aaf3d805cd77bd546a66f6
37068 F20101206_AADHIU duckworth_l_Page_42.QC.jpg
e84410553390b27c888ce5cd8042034e
4be10c3febff633b62463f215f2ffddf922fd32a
F20101206_AADHJJ duckworth_l_Page_35.tif
57347a0426b799e3a9863cfeee873831
cdb1af8a4fe0e3726451fc20b98387ffc70c9337
7365 F20101206_AADHIV duckworth_l_Page_28thm.jpg
49408aa75111d2084ec3440fa0deaa1d
80c9c6c04cf45267d2044409f86c6a5f5067a5ad
109289 F20101206_AADHJK duckworth_l_Page_58.jpg
6ca1094a49b9340142ce629884899dda
daf4f9c95fd23fd7f0e8ac2694c985c4ef257a6c
37960 F20101206_AADHIW duckworth_l_Page_09.jpg
d8bb7c604f7a626b84391c29985dee3c
1af5c628f639ba4dde7388bae9abb1d91a04b572
112421 F20101206_AADHJL duckworth_l_Page_59.jpg
a554c122b294870c71ba25dd32fdb570
aaa3c04b53303d88706fe67e2412c86547d7a204
2715 F20101206_AADHIX duckworth_l_Page_85.txt
63bb4a11f25c6e8c8a90a3c954b7d18b
c05ee75a7a96bc8fa0db9e5ea4cbcdf5579b68c7
F20101206_AADHKA duckworth_l_Page_83.tif
d5b18de88a2d6a1902372f9221471ab0
98eee4ed924774bb2cf72d8fb4c12d015291cb1a
1957 F20101206_AADHJM duckworth_l_Page_14.txt
6f4777322b1728e7f066f303802e5dbb
9dab1ea61fd1b3129f00757c3e506cfafc2eee4c
F20101206_AADHKB duckworth_l_Page_88.tif
80c8d5d37b8023963655219f54b95748
d2861af65344016c437fad54c26eaa7901571482
9218 F20101206_AADHJN duckworth_l_Page_32thm.jpg
6f00b9d24491229bb30bc5b685f71785
3c6f70574849a677e6bc9ef282fc2388b964f5a8
F20101206_AADHIY duckworth_l_Page_63.tif
75a9cb42fb54197c2e3de9f70be3e3f4
4c4bb7d0853f7983ecc62e3fa3c8ce503b032a9e
F20101206_AADHKC duckworth_l_Page_37.tif
7e7f2b618de07a04b44c25288981a01d
d75296a2a14108b3cfa987ead55fdd19e9fab940
2127 F20101206_AADHJO duckworth_l_Page_18.txt
becc21ae28ed2626c4d2edb2e71418fb
ca31dac3be537bc10925abccd89c1050b467db35
9441 F20101206_AADHIZ duckworth_l_Page_82thm.jpg
01960acc85b90dbbc0c494b476d76ce0
7ac25e66cddd7ef8024aabdf227c3b71de39c091
37350 F20101206_AADHKD duckworth_l_Page_40.QC.jpg
88034794734becac32ad018c6aa13d55
3b2eef229e4a4961753c2b6e5f7b88877e9bc1ff
F20101206_AADHJP duckworth_l_Page_23.tif
237f44d91a918636e58f4bfe354c25fe
f9f5f1ff8365c452104749c952edb6efdde27cfd
84242 F20101206_AADHKE duckworth_l_Page_22.jpg
fa4a934f293f3a0288023861abf077a9
90ad57db9c4f42e351fd784a033e673c7e7e3226
4442 F20101206_AADHKF duckworth_l_Page_77.pro
4d8c299c4ba380d93d18e5733023879d
eab877beed4a895abb9bdb2c2ca3955544c102a0
F20101206_AADHJQ duckworth_l_Page_68.tif
94ec0057bf933e59f9122d839333b8ab
077e62b80e293b7ec2be14b2b04c2e8770d2172c
452660 F20101206_AADHKG duckworth_l_Page_27.jp2
68e44e5adfc002c3516f023e618c7a0e
6c8de719febbf02d1f73295563424ed7df88e36b
8273 F20101206_AADHJR duckworth_l_Page_10thm.jpg
4c140a09449bb24e7b1e90f6ba42083c
fa8bc819b0a6b376fc75113c037cff6b531422b4
127918 F20101206_AADHKH duckworth_l_Page_81.jpg
5a1a2cf35f90a91eb2a1f6d5165c93db
51ef8e428a4e174570e45581b35812c8403a95f8
57151 F20101206_AADHJS duckworth_l_Page_19.jp2
b68cd35a1a0888da39cbf068dc609d7a
32cab2c4684efb2e0abdf687195998b7aeb9ebe4
F20101206_AADHKI duckworth_l_Page_33.tif
9341683ceed3324a8400e2192c738cbf
42be36b33c1cfe78587f1fadb9cf6f8f3d6c6c6e
F20101206_AADHJT duckworth_l_Page_41thm.jpg
da5410db9b99e5c2461c2dc270a7bb91
755eb7784463065148da04fc3c1b75a4db6bb68f
116612 F20101206_AADHKJ duckworth_l_Page_58.jp2
3859eefd171c9261b6c827de814e4c0d
83c6ef274bd5164733777301700a5325941be76d
F20101206_AADHJU duckworth_l_Page_86.tif
8962080e0634d397fc026e17b40e24b5
bd6be8481a2a278463da75a5f98fa55696571f9f
108267 F20101206_AADHKK duckworth_l_Page_29.jpg
829fcb120449d9cc1c1d75af5c61cd7c
78b867417e963866b9fec921658e5c8de4048f7d
F20101206_AADHJV duckworth_l_Page_58.tif
6f3e5858dc6e7dbf8b863c37c0aa5a0e
1198650f27f0c008fca77d22a05b420eebc7db9f
94872 F20101206_AADHKL duckworth_l_Page_72.jpg
95f1eedbbf7343c410a6cc948f87ff51
01e4e686af993a0f4b3d1d4ccdf81d1d6bc734dc
1051973 F20101206_AADHJW duckworth_l_Page_06.jp2
d0f91799d4dd69662731b3643973d60a
fb139f352b3af9154effc7f30179453ef9530124
8581 F20101206_AADHKM duckworth_l_Page_12thm.jpg
b33b1776c0b35655690a0e144233aadb
f3bc92dbd775be27e3a841058b9edd79d84eac7a
83585 F20101206_AADHJX duckworth_l_Page_75.jp2
e80fda547ef6b9efa349446df308a9d0
0075f1c1e714e9d8eb78ce3033732b0a30b9e12f
F20101206_AADHLA duckworth_l_Page_40.tif
cc78074d69150aab69aa039127d537fe
b568f5fa206405ee59db0e635d6d7cb298caa5b3
F20101206_AADHKN duckworth_l_Page_44.tif
7e1228f0a6cf479d256a19d6d9aaa018
421bd9967d5996053415380f82d853823032950c
F20101206_AADHJY duckworth_l_Page_32.tif
1ddb0351abc0c90214f3e88e695a454a
4b8468490a9a2b5ce6806ae3a54499834a4e8b59
9032 F20101206_AADHLB duckworth_l_Page_79thm.jpg
279e97f9ce60ac8cdb63b614475aa803
28a359070d7e931c5492926746eafbfe77c28123
114217 F20101206_AADHKO duckworth_l_Page_29.jp2
4d306ea853a80b1a5eebc8d5dae3f7b4
9bccd8b8fd44079b063a43c108cfea64887baf46
78538 F20101206_AADHJZ duckworth_l_Page_66.jp2
70aa6d341c244de3bf4ad459a0f9beb2
a7d3549e0d90f923d2f7cd1d5a0cf4779d3c4c1f
6082 F20101206_AADHLC duckworth_l_Page_04thm.jpg
1eba1a87d4602060794b42ec4d7e00ed
9928924fc07e73f9a9e44500a7994f30acb46b42
24108 F20101206_AADHKP duckworth_l_Page_78.jp2
da43f9a6a0f482bc09592b0fcdb6821b
4a4af1da98fceaadf2e4ff786f81c21048fb8268
2123 F20101206_AADHLD duckworth_l_Page_33.txt
d70646f47e6d48b78f1a55814d43256c
e1b872965ed8a9c03b56130399981534f8fd8d26
8657 F20101206_AADHKQ duckworth_l_Page_23thm.jpg
a583f7368a01119e3f3b3c3cfeb23a25
27797dbc5b1f924b25007083cbe3bd602c03f420
1649 F20101206_AADHLE duckworth_l_Page_24.txt
307ca31238094c758fb39d23cba0d410
fd97f816965761b7b8c8de5761d3b63c30aa0d57
8768 F20101206_AADHLF duckworth_l_Page_35thm.jpg
fbddf63d40504c566060e9d278bee7a2
c733d0631638e4f942dc0b73c504a711e7ebf835
35891 F20101206_AADHKR duckworth_l_Page_46.QC.jpg
782d1d27bd702de1519e87dc2975a149
6cc9ea5ba33c9083353da64e7a648a6c639c4a53
93868 F20101206_AADHLG duckworth_l_Page_74.jp2
b38c6a7cf6a78900b359fc277abf1360
b578320fbdd4dc6919294f03ea97c1aea174bdcb
9023 F20101206_AADHKS duckworth_l_Page_87thm.jpg
9475d9796a4d6ac065f4274cfb581d18
9b554b9a723a8a95b27ea30969c9b5ec637e59e0
115775 F20101206_AADHLH duckworth_l_Page_38.jpg
24b93a51802dca7da151372ee5068e86
9056ed81aa5b6d3402afc2efc3c18e2c12ca61b1
8711 F20101206_AADHKT duckworth_l_Page_37thm.jpg
83eb4d5b34eb0316e884862187f48293
6539e7787ff7577ec051b62511c59afbb4ac250d
2160 F20101206_AADHLI duckworth_l_Page_48.txt
c57fe6fe79a9b47bce656d2ad13260db
6418861e9f12c35ac66daa396cec7f1944747bf1
128934 F20101206_AADHKU duckworth_l_Page_86.jpg
c80a9822be2dee1135873768eec0399f
0c6ffc4d62885a41fb183d85a3e3674ce77a87e9
103925 F20101206_AADHLJ duckworth_l_Page_73.jpg
84529b8645b241e1a87f48984f55e235
479a6a1a13d5f1b3aeea2c70d6c718b8edf17a3d
2699 F20101206_AADHKV duckworth_l_Page_82.txt
b5ea45e137ac90637f13157a6d42b61e
abd958d21ba492235bac8275599462f239ca157a
55318 F20101206_AADHLK duckworth_l_Page_19.jpg
da766661b9f532d776106abd112bf3ff
5e929529e1b3dc6487719675e0091579a1c860b6
8128 F20101206_AADHKW duckworth_l_Page_88thm.jpg
3de16cf7afbdb273ded71244d1130c1e
133a571835031b24e5f0029a13929fba6a010ae2
F20101206_AADHLL duckworth_l_Page_80.tif
c527dc5c5719682c8c3ec646a321defe
464a3f052854a99a87913ba06c5955ad57bc3a62
52758 F20101206_AADHKX duckworth_l_Page_34.pro
d75caed3316c681abe97354e1e0359ff
d666b8b22d2041faf1e6ba75ae796d757f863a3e
44811 F20101206_AADHMA duckworth_l_Page_89.pro
3d4298ad7307d937f90fe5c65380920a
56f40f575b4b889cf59e183916b34f0b04ec375e
99321 F20101206_AADHLM duckworth_l_Page_28.jp2
227d675911f04e88a5bd0f8b8e7b4a88
19452f01341edcff7bd09a2ac4ec57479a62b1e3
142076 F20101206_AADHKY duckworth_l_Page_83.jp2
3a8e77041b59eac77ba9b5de7a30eb6e
2aa4e1396cdeaeb4dc1ef31426e6487f21a1e5c6
32656 F20101206_AADHMB duckworth_l_Page_88.QC.jpg
ae4c0aee6c7074e702058531a8f0a0fb
5c37b1c93a6f2c747ba3f8afc4a23a1bb3924099
53953 F20101206_AADHLN duckworth_l_Page_46.pro
c294131ef26829cb94e65ab144d0cd3d
44b0e91f6d6d29a2ea624f56c44d723246c8f434
35772 F20101206_AADHKZ duckworth_l_Page_18.QC.jpg
6022dbf7a86883063d68bb280ccc5682
c6f0abcc50bf439fe09b8f0276ebc1bc0bd0abc7
F20101206_AADHMC duckworth_l_Page_03.tif
64bd62fc90494f67873f1b9d8bdc84ab
eaa9cf417e942fb78a4992686dbb9cc14247bfa1
1131 F20101206_AADHLO duckworth_l_Page_20.txt
dbf5fb255e0c14263550bb38709591e5
545d60d8dbedffe798505071be9f84e18b23af7b
133133 F20101206_AADHMD duckworth_l_Page_79.jp2
e8929e6d0fe2784866c80aff4c2d7693
d9f5df7f938c27cb64c4e9514c7b0c88764d78aa
114753 F20101206_AADHLP duckworth_l_Page_34.jp2
fca458d21b34eb831ad7d059cbbb5519
1308e5c5decbf86878110d47ce2867afe798a2ab
71605 F20101206_AADHME duckworth_l_Page_55.jpg
460c793db226f7cc3ea39942fbb8df95
afc8e5fff33372193aeb93d11723249784ccfb6d
1394 F20101206_AADHLQ duckworth_l_Page_04.txt
c26c7736753208fa455bd89aee5f5ab7
bfc59d0a64b589f6aa1a0ec8f9ad06c4b495ff23
8874 F20101206_AADHMF duckworth_l_Page_46thm.jpg
5732ac11b38cb539a5a63198bc57ccce
e0517f13b96e9b731720ae9acac818a55339e4eb
112894 F20101206_AADHLR duckworth_l_Page_64.jp2
68d936596562bb6d8c9caec8b137c64b
ff375d28184c2f29246b9a2b058e3c13f2126cfc
2141 F20101206_AADHMG duckworth_l_Page_36.txt
c096b22c88bd5c0924a2421517c8ec1f
c608f5c483a94dfba3d20ce4ee80565e29e6c75b
17857 F20101206_AADHMH duckworth_l_Page_08.pro
6b236b899d2842c8a702f10e38585e9f
98805bb09176134df1efdbc6a9fef95c86fce42d
117766 F20101206_AADHLS duckworth_l_Page_44.jp2
3c41917503a6ec0c3dfebde4d39f4d10
d7687589b87471146608c1adeaf2d8e619a1a3f1
51184 F20101206_AADHMI duckworth_l_Page_12.pro
aa6f91e1f224e1a03d33576b5556d4c6
54d2846574decc94b29e5977fc4b2f0ed97c013f
F20101206_AADHLT duckworth_l_Page_75.tif
c1f9d3065d9c42b60f921426db72a83b
ea08eebc8f32d8e5faae64a1b22ecc4585f1f468
93141 F20101206_AADHMJ duckworth_l_Page_28.jpg
7358e68e0c7a1db46d2e61dfaed17588
2eefa5824c6f21d374b105cb8696fcec9b8db4b9
25931 F20101206_AADHLU duckworth_l_Page_75.QC.jpg
54583d24dde8a0be32494e6155fba54d
b18f507fcbd9a7fad3404b83b63dc5a49eb8cca2
2137 F20101206_AADHMK duckworth_l_Page_01thm.jpg
54c3991bfd920e2f6070dcd27532a4f0
4642a040e9a95132ed71eb1f8142808de7def14b
9124 F20101206_AADHLV duckworth_l_Page_43thm.jpg
01b2fe587666526b75d2c76b9c9fd1e0
6588d65aebafb41f570f1ec6ca1ace4e52c5b692
53376 F20101206_AADHML duckworth_l_Page_29.pro
97b3c0140f6b18ddd2d941c2030b8a4b
7d301c5cc68237ee7e3df37c0e29362534bf1ec5
35458 F20101206_AADHLW duckworth_l_Page_62.QC.jpg
114e147d6373797c0ce5cbba70904633
43c01f1a6aaf5b58ff8ba87c4ce9491801f69078
26667 F20101206_AADHNA duckworth_l_Page_57.pro
db8cbe5f39b9598b937650b7d860892c
a7b6e0a407aaac42c8c78e3aff83148ab9dffd6e
72981 F20101206_AADHMM duckworth_l_Page_25.jp2
2237aa72e1f6ed83357535c283d980c7
fac397a9f9694f6cec3e70c7ea4d287e5d96a594
F20101206_AADHLX duckworth_l_Page_05.tif
2a1c07590b84c5d9b26c88874739977d
e0a1057d7bcfeda7cd7cec8a3adb90fcd04dc66a
9259 F20101206_AADHNB duckworth_l_Page_38thm.jpg
8d1e7972f2a49de6c10e0949fbfa2d1d
4d3e3559f5c2d21fe78095f5a9edb79259c3306d
105127 F20101206_AADHMN duckworth_l_Page_64.jpg
88f87e1f956f9ee3555e59ffc365daca
d77cdc9bd86a453fef4ab3e9539f98fdd6a4979c
F20101206_AADHLY duckworth_l_Page_17.tif
cc4bb4b86e848264ba705d8cc199224a
e406c1a899cf371dcaa500c744cff31dc4e2d4a3
2098 F20101206_AADHNC duckworth_l_Page_37.txt
74cce4e43ded28a9455dc25ef332ca8c
7fe42fa357a2e81e4c26611326b5003530ce261e
118117 F20101206_AADHMO duckworth_l_Page_41.jp2
35a4626b18509b663015f3fe6859fb32
680057340187b3aa40f3756e551fc1a1f80a86eb
8961 F20101206_AADHLZ duckworth_l_Page_49thm.jpg
4640113dd23c096b299e981596299693
95c9fe31948cc8d2c63b8058871fb2c854037fde
88409 F20101206_AADHND duckworth_l_Page_65.jpg
66f20cd3b6df410b54082d32270fcc0a
fd0999f71a7d36cb1654229c51a8e623b482f30a
117674 F20101206_AADHMP duckworth_l_Page_45.jpg
c4e7d1cc62aa312178d37c29da06729f
7a124bfff36af7b6666502a07a169902fe5b222a
105229 F20101206_AADHNE UFE0021254_00001.mets
9c236d8f68f0e87020b6454ecc3219ad
267087c52e7771ad8be9241517773dad7e41084d
54891 F20101206_AADHMQ duckworth_l_Page_59.pro
8f2b356d2f96605e073a6cfd5d5b6d85
4f2cc12bae6605d85151a76a570f7df8c00f80b2
113602 F20101206_AADHMR duckworth_l_Page_12.jp2
895a9482afc391eb2395b6c71ed913e4
906f4df7b1e98f98547ea38ada8d5a316b3f8da2
54528 F20101206_AADHMS duckworth_l_Page_36.pro
3d43741f00bd95cfbc5674c1f9e56981
e7f1ced1697af94962e3f837e2e5cbfe612db4fb
131078 F20101206_AADHNH duckworth_l_Page_06.jpg
c221203925b95ad1f1358badf80864bc
2b3d473060ab6224f143acf391b3ec26f6617834
102704 F20101206_AADHNI duckworth_l_Page_10.jpg
d39e31f9133a996ea8b99b3da9896aa8
cfd1b7956117f23951701231d20f401dd5e89880
68788 F20101206_AADHMT duckworth_l_Page_25.jpg
04de47f3b4529fca9b38e5744a1f8265
5fa620023d7720cde982715caf1308073e751503
105623 F20101206_AADHNJ duckworth_l_Page_12.jpg
9d95df738dae0007b5758528312ae48f
0c5260be0f20b365db87067da539883110890f86
518 F20101206_AADHMU duckworth_l_Page_01.txt
c6a5bc7f4c14bbc62a2ec564ea32c3de
da3926b24ee0b10d2ed0c93a798ab2edb50684bd
110143 F20101206_AADHNK duckworth_l_Page_13.jpg
624dcb771afdf02453ca7ea0ac48eb7b
183cebfa343f0dc89d7cfd06c48884e353a9bc32
32949 F20101206_AADHMV duckworth_l_Page_14.QC.jpg
791073332b993715f9f7adb167997ba9
54baf7b71ebfac1a9872945a79262c925dca9c85
109571 F20101206_AADHNL duckworth_l_Page_16.jpg
59dbf09a2c9354598122fb79e5667952
74aa44f07add1f83a3126fc5cdc183becca7c079
49861 F20101206_AADHMW duckworth_l_Page_11.jpg
f1ef355a5ef120bd84835f58c640b71f
8d3eae663242090204d6f3ea33df912443e72ef4
109708 F20101206_AADHNM duckworth_l_Page_18.jpg
b10de916699bdf6c0bbfec559c9aa794
e207a7066dad9728800ddccd51b20ee6d2d8798a
54748 F20101206_AADHMX duckworth_l_Page_42.pro
cb1ee1bfa3fc3cd64dad531236d89521
e574d34a708f3d6e481477c7981e033401401d61
105218 F20101206_AADHOA duckworth_l_Page_62.jpg
12076a9756f85416ce4dc8073ef21f2c
0f654d29bdfe8ee3eefde39548bc3e03d3a27b5b
71575 F20101206_AADHNN duckworth_l_Page_21.jpg
302405a2b787058ee0c7c1c11f4eacee
c6a0fd38ad3d6a74945a1e3688057f7feeb5f039
111246 F20101206_AADHMY duckworth_l_Page_30.jpg
70fabc5538a31d5033b3c338c8e2667c
1402eb1a5373bf895bab684e42897e7df0bc858f
33731 F20101206_AADHOB duckworth_l_Page_63.jpg
af9e239ab91e01f7cdc7e81ada8219b8
d24eed9507b4c2e56a2760d7962af139f96d5ee5
42714 F20101206_AADHNO duckworth_l_Page_27.jpg
b6449043926aa71f7d50cdd621729cf3
30fde76b33b0f2f89d3eb47f2093fe1460fce485
8817 F20101206_AADHMZ duckworth_l_Page_13thm.jpg
a3c373ca12477f50436576fff6dc3a8c
769aed6b45df74e6f3faae271f5714536c3798af
87607 F20101206_AADHOC duckworth_l_Page_67.jpg
c791988ac903177e6b75ec7e303369e4
90ae7525df7841e2d62851fd0a0934e05e0e1717
111528 F20101206_AADHNP duckworth_l_Page_31.jpg
5941892365e9483f6de30bebf1c0fd36
5f42f16b6bd1af892881967f76526687cd264128
98145 F20101206_AADHOD duckworth_l_Page_69.jpg
fb73df1e33adf57fae2845859d8e9f80
05f0c0e5812789dbd78d6fef864c2eeb91cc5f02
116180 F20101206_AADHNQ duckworth_l_Page_32.jpg
381bb1b06660ac87d5c3b63b754d4d33
2c5007c7fdb0a2f1c22eb5508a8460da87968e94
88656 F20101206_AADHOE duckworth_l_Page_70.jpg
36e280b5f99758991c02f0652f4d4988
a9162f528b2a84fe22b77d302515cb632bef3eb9
108092 F20101206_AADHNR duckworth_l_Page_34.jpg
5f91f1d2a30b298efe4ef622a759e18b
fd2ea7d60e086f45a3551cd46e3800f9609caf8f
90894 F20101206_AADHOF duckworth_l_Page_71.jpg
4cdca57e984571dafc74b4463b3e9e22
9b0afc374f679496f26f8b0f110e1e42c163a4a8
111130 F20101206_AADHNS duckworth_l_Page_36.jpg
bcd2aabd2a293342ac2a3d314c34aff5
7c16f29e749e83468da87faa4e3266a516ccc0c7
88930 F20101206_AADHOG duckworth_l_Page_74.jpg
7f88b4328bf85480227863bedeb138d9
a66a03ff0cf1cf486fc34aa82b579b48a9bdceff
111157 F20101206_AADHNT duckworth_l_Page_41.jpg
aa11ac06b71cc3508293de097b87dc2c
82684c910d83c899350b250c8dc1558170fdfdb2
12778 F20101206_AADHOH duckworth_l_Page_77.jpg
b32895993c14cc22aa23d5d318b0f9a8
80d8319c49e9eab0bacc1e24da095d462878d1be
23103 F20101206_AADHOI duckworth_l_Page_78.jpg
5984372b7191690402c2bdedd80300fc
ca84e4dbc91cfb4e9b1d8bfdbc5f86f7d5b6ffc2
116161 F20101206_AADHNU duckworth_l_Page_43.jpg
2cdc718db5eeacce5a583ceea8fba4a8
9ae3195032166496192fb192686f25ee3dcbfa6f
133047 F20101206_AADHOJ duckworth_l_Page_80.jpg
ec0f7c6a5165de7c20fc7106f569c1b5
4d4841eff24b1509fe2e2fb0a98ca926d5476cfe
136006 F20101206_AADHOK duckworth_l_Page_82.jpg
01e5dc40bf81a4b90c4989585b0798e0
d57ec223056adf9a3ce9a894dd2c905e5e4679d8
114821 F20101206_AADHNV duckworth_l_Page_47.jpg
f59867d690d97acbc30cdb8ecd9e85bc
c5b94a6c2704ca4636ec019710664df4280b93de
139281 F20101206_AADHOL duckworth_l_Page_85.jpg
a160cd8552f5fc87dd216accae253eef
29930611b3b599f6901e0d1c2069b30c051c1412
110609 F20101206_AADHNW duckworth_l_Page_49.jpg
28ee228e4be4b8c4f6ff8c9e53bf0e7d
36c29d0e3fd6c6d3e4e6e852aaa7cd4fc56e4ce1
117059 F20101206_AADHPA duckworth_l_Page_37.jp2
968dfd0be46e2fdc308143835f66f7a3
9701f4656c6498ae71c030734da1bd572b361dde
117113 F20101206_AADHOM duckworth_l_Page_88.jpg
ef83a8ecbc601ed573f003138ac1e22b
63fdb3a79b77a8a58c20331d4c4ace8a502a5523
75062 F20101206_AADHNX duckworth_l_Page_50.jpg
15858298f2df0b149c870bd52055d748
dd77c2acf41c451a99937667221aa71fcd43351b
122899 F20101206_AADHPB duckworth_l_Page_38.jp2
a84dd28b9cdec6674b9958262be8038a
23e26482b65998e8db1986b1ad6e32c28f361e7c
93359 F20101206_AADHON duckworth_l_Page_89.jpg
2313a574ca9fb1f12f89a3651bbcce4f
e38d2a3bcd4ba2733d31df642a735603bce1d843
89404 F20101206_AADHNY duckworth_l_Page_54.jpg
ead1a062f11212acead701d1c35abcf9
686ed3c957f5de9fda975b9cb81646a96d685619
118271 F20101206_AADHPC duckworth_l_Page_40.jp2
ec3a9da15d6f82ba3ecc7d2ca48634cb
63caf0deb20c694b8b8dbe568c96ea1de59c79ca
28977 F20101206_AADHOO duckworth_l_Page_01.jp2
ff2bb48321ab27bbadd3428a8e16145a
71abf1b5b3583918a29242eeac9716ed0fdfe8f7
64896 F20101206_AADHNZ duckworth_l_Page_57.jpg
365a5f256c19407876c2ddd20c6e1124
0f8c75c8cb43394b3884d2d5330e6e52e2d45e68
120033 F20101206_AADHPD duckworth_l_Page_42.jp2
c607784575ca994e2799d5502e2240ac
ffb68bc66d4f5f96214c8a1a89653d41b807d13f
76268 F20101206_AADHOP duckworth_l_Page_04.jp2
7037f7d9b83c41d9b61714ff0f4c7e19
08b82b5cb92b11a71e97c3326b1bf910fa9fbe2f
121882 F20101206_AADHPE duckworth_l_Page_43.jp2
a19f0b4e8886da13f249fdc98897f990
e4650bbe6a8eb1535b21db9af18f4c923a811e61
1051969 F20101206_AADHOQ duckworth_l_Page_05.jp2
129dd6b52a96666ad61fca800162d6a4
62ae60f988ba665a7e0174b6097e1f8e65e1aa53
118167 F20101206_AADHPF duckworth_l_Page_46.jp2
e52eb74b66fda204cee05350cc5d06c6
e83e0ea9130b4f3a4e55804318069e8ca045da0a
1051967 F20101206_AADHOR duckworth_l_Page_07.jp2
589e098418d3f4227e8f001b3292acbc
c0d0627a745e480ba954338b549d25db304bda90
122449 F20101206_AADHPG duckworth_l_Page_47.jp2
3887463ed10e386bc7fef3d18f1378af
5e701f0b41f70a4288838bf1a4b4e01daa3af899
617475 F20101206_AADHOS duckworth_l_Page_08.jp2
022164358208ddfde634bb5eebd514f0
5afe93784efd937cc240d5be7e1b8e6281ccc4af
118878 F20101206_AADHPH duckworth_l_Page_48.jp2
a0f5f783e535c446958fb1f1805044cd
3caa5ea6c4f8482ea087fdec1e9989274562d4c6
40923 F20101206_AADHOT duckworth_l_Page_09.jp2
295c658a65736b7bf4e299959aa21203
afb901bd60a3d982b2058c7c7bd86b92ed69d4b9
118581 F20101206_AADHPI duckworth_l_Page_49.jp2
2455ea98bbe9bd09dc465df7eaa1db84
47f01bddcce945828b0814dbdd6923daa6eaa5b0
116918 F20101206_AADHOU duckworth_l_Page_16.jp2
6638972d5c589b3cba91fe5a920ae228
b185ba119a113cb918d1004017dca57a3746fa78
82370 F20101206_AADHPJ duckworth_l_Page_50.jp2
8e33e608b83b4244f6a4ecdd07c21dcd
96b87cfb1baff1762c2fc780a7929f98daacefc3
58905 F20101206_AADHPK duckworth_l_Page_53.jp2
1391b98e856db0ff75db16084715c7b7
43a27a164e055392d60e922a75969e3380199509
110607 F20101206_AADHOV duckworth_l_Page_23.jp2
85183900551b20918a675ab151831fb7
0092c5056578a0109130e8c039986231fea0a44e
943952 F20101206_AADHPL duckworth_l_Page_54.jp2
c1fd32ee1d9982c0507d70de2ffc67aa
d099eca6a3325962b54a81c63af9f8541fa2ca62
118359 F20101206_AADHOW duckworth_l_Page_26.jp2
f94336386cb5740257e6e757bc47c85d
61d8127ffca890199ffa2c253d38ea0c582015f9
632509 F20101206_AADHPM duckworth_l_Page_57.jp2
c82348e6c3f1f40a8df9d9a51e922e13
f6a1b811b53ff9f9ebfe1a747b934eb6080a975b
117637 F20101206_AADHOX duckworth_l_Page_30.jp2
b97501008a57915188f78cd9aa5814e6
db5e0c9e9ce858c0a084c1be41c94f8bea3a6263
F20101206_AADHQA duckworth_l_Page_08.tif
18fe7d61704b746fcc98f70f9b4caf59
9acd63aa00eeaa6aef11d0395bc4a125cad65be0
118084 F20101206_AADHPN duckworth_l_Page_59.jp2
244387bebe9eae0da18fa4af16f674f7
156badf1b568338d6b7fe5f3342ccd6a96ef42f6
122560 F20101206_AADHOY duckworth_l_Page_32.jp2
cdc0631b3472a07e50ee75c0569278d0
feb9d72df43e8af07a15054339db5f6684a3255e
F20101206_AADHQB duckworth_l_Page_10.tif
5f6cb40f0c811e996fb212fd9022c415
c6107e8ee7ca09683c57883e229018047ed82aa4
119216 F20101206_AADHPO duckworth_l_Page_61.jp2
717b9100eab316a71059259f0b699ac7
1aa5d24152119b6223ca2eb233c8056f5469d358
120951 F20101206_AADHOZ duckworth_l_Page_35.jp2
f602e07d7a6ee7bca31bec96dd41c064
527c5c761bce37cfd43df176cafc7faa23caf675
F20101206_AADHQC duckworth_l_Page_11.tif
ccb5a76ba4881304efada585cd94130f
1c87f865ba47c499028cebd7221a0054dfb073e8
37302 F20101206_AADHPP duckworth_l_Page_63.jp2
c4d33371a2513e702c629f88f6c3efbc
5c1f404854199290a350595e6e86610313494e78
F20101206_AADHQD duckworth_l_Page_12.tif
d64448613b0b5f869af25ffda652dd6b
357ba236161f0f5f22dae159bf57fb51f4a78725
91228 F20101206_AADHPQ duckworth_l_Page_67.jp2
19b89a546f79ed8e9ae0e06cc95bf675
c844723e08ee6bd2af955c18a185723b6aaefcaf
F20101206_AADHQE duckworth_l_Page_15.tif
2a2768ac5631ab60c9eec4ab4cdd461c
62f75923fa2e32efff18b924dd6c768d6515d505
99855 F20101206_AADHPR duckworth_l_Page_69.jp2
5abe0c78eb93dffec6c0217e89d44641
035349b89537d0553cdf0cf4f75098da3da91998
F20101206_AADHQF duckworth_l_Page_16.tif
09a80e866a213478661bacc05d7de31c
6420a0323929a536fe8213f5e02fd54d2e116580
93501 F20101206_AADHPS duckworth_l_Page_70.jp2
f1d07964ee706855bc83f7834e912b62
692c4473012354398cbf77f74c278e3c20b106d6
F20101206_AADHQG duckworth_l_Page_18.tif
c9fbd30e19f08bfd16b24cacada1edff
eb129a4364e63985a93028ab7c1b91ca159f3386
93719 F20101206_AADHPT duckworth_l_Page_76.jp2
5026234c3d7c869c7b0110a5d0a85513
cba667a0d85a483082a04f5d6c7ed47383760cbc
F20101206_AADHQH duckworth_l_Page_19.tif
e1ff77c8acbd6e2c14b2602060991307
2d1e413a6c76cec3de663a13feabc60010bbcc4c
145226 F20101206_AADHPU duckworth_l_Page_80.jp2
e497741824c53d4196e21a3740604158
b9ef5effceeaf11ac5c91fdc72a42a75cd6ea64c
F20101206_AADHQI duckworth_l_Page_20.tif
967d453ccff1a251d1f76d7531e28345
0e28b5b99e706482837798575f0818e96650616c
139586 F20101206_AADHPV duckworth_l_Page_81.jp2
542772b7f01569f7589ae798cf1e9eba
5f743898e009a5e9b84517c1b911d87ab53dc34d
F20101206_AADHQJ duckworth_l_Page_22.tif
af356e3efbffe47034331eb65e335ff4
0f79f35c44c3428b9bf24ab7311fe220b7f2cb53
F20101206_AADHQK duckworth_l_Page_24.tif
9ac71d7142edeee3009a2368988ce775
5b1d22c929bb5be1278601d7dde3d165bd925ab5
135077 F20101206_AADHPW duckworth_l_Page_86.jp2
acad5cc73a79ad4bb83c749df0ab63cf
bf56b04b553a59d186cf073f9561b87b529e9f7f
F20101206_AADHQL duckworth_l_Page_30.tif
f358889f1ad35c7a34956b2fa4244aef
d86b52ac9c76d08153dded378de53c721b03ddda
F20101206_AADHPX duckworth_l_Page_02.tif
cacd11f92b5cd740c63f7db37b2e9152
3ac8c1b61d630f59c04ffa5180d75f46b8c89d22
F20101206_AADHRA duckworth_l_Page_60.tif
fae3df392e80db35c6368d29cc992bb2
2c2128405526826bc5df62a8876760f95a8bf53a
F20101206_AADHQM duckworth_l_Page_31.tif
13d7b9be22afd199ef868cc6e5ae00c6
3403b30e9a772f18974ada91fa7728717db5cdf7
F20101206_AADHPY duckworth_l_Page_04.tif
e41c516dbf55f5bbb3c4c41d6463d99f
f46f1c738741c26059a375903bfc10e154fde013
F20101206_AADHRB duckworth_l_Page_61.tif
87e1053e07a3a6e9d538e943268ae5d0
c96255b0f4d20c8e34cbba71e9e8ba099716801c
F20101206_AADHQN duckworth_l_Page_36.tif
0f9baa2575f63c7470b2dfa5d8b22b65
77420df817b36478e47523bbb6fd77c465491fe5
F20101206_AADHPZ duckworth_l_Page_06.tif
fe8deb18fd540b5ff6e2a1373db93124
ae0e1e7cd2c2b4c32282045ef553d70b2b03b435
F20101206_AADHRC duckworth_l_Page_64.tif
25ca465df01877d272d2b1b84db618e8
8b815bcdc6e8abedb2eef686aa1bcde0c06180f9
F20101206_AADHQO duckworth_l_Page_38.tif
3e96f341e657fc501377def4940d61e4
44797e3d9ca5f739c6ba8119ba3a66e622ab7700
F20101206_AADHRD duckworth_l_Page_65.tif
9a05c353c0aea21621c413f9e78dff46
9e38787c259e551a5060b618c4f4a0750e89c7c7
F20101206_AADHQP duckworth_l_Page_39.tif
19f4f72ac2c941a55593fc7e732c337a
3b69ed5165d86c32a5a051bb2a0c07ca0d92db53
F20101206_AADHRE duckworth_l_Page_66.tif
cfe4a35a37c7edd5b0193e4ac3267af3
ec960996bb38ce48062083613d161d6c3dc51187
F20101206_AADHQQ duckworth_l_Page_42.tif
c970cb8b9d1ec34a77d5a06606b26f61
5bb1fab9df036ecc2112c8543d3fa080e85b2c4b
F20101206_AADHRF duckworth_l_Page_67.tif
3bb5fde262cfce4cad9ce90c5678bfdb
a9270bbbc5385b4ae595450dd97c16bf5f4f261b
F20101206_AADHQR duckworth_l_Page_43.tif
5e2ddabcb2b2c72fab347c61ca813028
96a75b2b70adedddd4a91067cc75f1ee6b4a80c5
F20101206_AADHRG duckworth_l_Page_69.tif
6403c13df6c2aff67222f21e5059a4de
82a2857e1fc9e620bbdfe6398348cf6265ef017b
F20101206_AADHQS duckworth_l_Page_45.tif
eca69f0fe563600a7dd99f2b96fe01c3
8922c82203812a6352f794baad987b27ccef1161
F20101206_AADHRH duckworth_l_Page_71.tif
66f8f74a8bd1871c753e177a3e397837
ece7b8fc4c21ad1a6023a32175b65a1248250903
F20101206_AADHQT duckworth_l_Page_48.tif
89d2e7e66044ba0a637890b4fd6124ce
19974ff5fbaf5a7614a6ecf50c05374d5172d76f
F20101206_AADHRI duckworth_l_Page_73.tif
d51e093161401df26e18eea3f02c3783
72f07be16b9c046616e93df4ee929fe7ceecb190
F20101206_AADHQU duckworth_l_Page_49.tif
591dd7284708a48a684dff7357d031ea
dd95d32663ee5ccd9c82e0cc72131d702422fbad
F20101206_AADHRJ duckworth_l_Page_76.tif
c2efcb08359646abf80016bb7ba69c03
1a774aa1f9a97d10c991441e911b13fb39ff09e7
F20101206_AADHQV duckworth_l_Page_51.tif
000439477b9f5d8d1455b78f5a55d0ee
4c7fe531f7c0fc22815225fa3f34f9d41f7b603d
F20101206_AADHRK duckworth_l_Page_78.tif
f8da7b4c64fd5be13dde616b3cdb2ee7
66e00f85ce4a6fbc0c54c085143dff72ebc09e44
8423998 F20101206_AADHQW duckworth_l_Page_54.tif
850bbef95bc66c17b1e638a62ec4c4a7
bb7282c4e2cf80136c2cafb1ce598e82b778c839
F20101206_AADHRL duckworth_l_Page_79.tif
871fd703cc054e15d907cab8b08abcaf
56d37f54bfdc141ac78f50e8a8ccfb02faaed848
33453 F20101206_AADHSA duckworth_l_Page_21.pro
2eff4f8f5761a0df34121de37a9a0f34
3082a3b1794879275c36870779b8aff6e56422dd
F20101206_AADHRM duckworth_l_Page_81.tif
063dbf3b34e1a45d20fb242a6546910c
c098d716d06e5ee3e1c96d1087d8d26defa2b3a6
F20101206_AADHQX duckworth_l_Page_55.tif
fafd1ba52b30ddfb78e8b4bd0235d609
93f5c4536ab61d94567f1b9ce5ea4294df32cb7f
40601 F20101206_AADHSB duckworth_l_Page_22.pro
73e63d2e2f3f6ee70887242a45f26d2f
58008d199569e1954138018d02ae49d323d95b62
F20101206_AADHRN duckworth_l_Page_84.tif
0a48186b6738b6027b402d7522598e12
3ba5edf2736ebd56ff6c7e813012095f21ce685e
F20101206_AADHQY duckworth_l_Page_56.tif
6dd1d458018aa10d8ccd3b1c6e448908
3539bfcee07c418201e162ad5807cf209b25e30e
28901 F20101206_AADHSC duckworth_l_Page_25.pro
01e712c0601fcb3b9c7e44a5ab96dcaf
d0f8871b045edef0bbefd647668653c8fbf45247
F20101206_AADHRO duckworth_l_Page_87.tif
f4498d200819e9aa086b3846c8c9b0da
3e8ab78562b501238c385ff6bf06917bef3eb29e
F20101206_AADHQZ duckworth_l_Page_59.tif
176e571895070727f30f68ef02cecb73
531b839e43bf026ac592ce43e3a1853b517daee1
53784 F20101206_AADHSD duckworth_l_Page_26.pro
4a33c698d4f440270dac597c3490acef
54d8ab69dbf8770e4696af3969226d7b71783ebe
F20101206_AADHRP duckworth_l_Page_89.tif
f004d49a1c175264a557ce4d63ea8293
530ea0caa01082f84a0dc748a7e35e9affcd9280
5727 F20101206_AADHSE duckworth_l_Page_27.pro
1ca91c69bb73267c02d9a7a4a30693dd
6fa90f81b89c70dfe636844475852a9bb317fe2a
9479 F20101206_AADHRQ duckworth_l_Page_01.pro
dec16d73dc2661e84fe82ec1ff75af5f
f8c9c0c150e10157f6bf5a38acfd50de6183db1b
44962 F20101206_AADHSF duckworth_l_Page_28.pro
3242de069553d61f14c3b37f839ba212
5f238a28fb1cdfb44c7e0af942655ccfb5d3f032
1019 F20101206_AADHRR duckworth_l_Page_02.pro
c976048c355fa87cccefd88eea27838c
deb7cacd367e93f25d83320684d5476711a6d6ad
54825 F20101206_AADHSG duckworth_l_Page_30.pro
27b7c7ceba16598873ecb5ce1b551d6b
a3c26ddf60173a92ab9c011b39de57568210bd1b
33784 F20101206_AADHRS duckworth_l_Page_04.pro
b3736f59d55414411d954ba2b0f16260
ac985246ed36d94331d084f85149ded77c9e1c73
54013 F20101206_AADHSH duckworth_l_Page_33.pro
d3e586b0218f22a0516d5fc98a72f924
e1462b2c0c21c9513ecafca7e07ae98707f7114c
103743 F20101206_AADHRT duckworth_l_Page_06.pro
df9d7a3074995be4cbf318419add48c3
ecb61645fff27c6f8068c51b62a8c5a0cecf5497
56254 F20101206_AADHSI duckworth_l_Page_35.pro
4245426f598517bee62344f1abf3392e
237fb6f8798c6c996ae9c0b5a5140aa97c57ca20
17404 F20101206_AADHRU duckworth_l_Page_09.pro
99d3930856d646fcf8c4f3da8e7171c8
0ca98433d878852d42f9ff7dcad1158eacbecd40
53382 F20101206_AADHSJ duckworth_l_Page_37.pro
6e6a496398caa26ea6840c77a122eeb3
fafbff18104d4cc608d2472f176cbae4c2507fce
47513 F20101206_AADHRV duckworth_l_Page_10.pro
68bf0e7435fab762bfa36225eb776f19
a0d88ff77d72f939c0326ef405615fca9ef56e16
51757 F20101206_AADHSK duckworth_l_Page_39.pro
761108cbf49b8c8665e0ca313c4fea9d
0898b3767a79080dada8b07f83352241b762d55b
53105 F20101206_AADHRW duckworth_l_Page_13.pro
578e7767f4de0614992b9d3e71ba8bdd
5f75f290941f2f6d7dfc583da9d0e0cf2713ce27
53914 F20101206_AADHSL duckworth_l_Page_40.pro
bcca0fcd5f56194dd7cc997e8e56381b
c9f53dadab854c1336aedc1f038cab9553439620
48824 F20101206_AADHRX duckworth_l_Page_14.pro
7f1c9f8013e693bca96666ebae200928
c2d35b50caedf318a3bc466a6a7203fa74ee96a2
56419 F20101206_AADHSM duckworth_l_Page_45.pro
a5594fe67a0ee4b296725c57a4d3e72d
2fd31db92cc5ef1551676dbfbfb5a9c587dcf932
42599 F20101206_AADHTA duckworth_l_Page_71.pro
6a2d3b79a8f142a2d1ea2bf6c8b2cd93
7b6d55aa085d66e9aeded6856b523b79cd119564
56834 F20101206_AADHSN duckworth_l_Page_47.pro
d86d9e9fbb7a47ee3630a6dfd2c82bbc
e0c9dc03420bd6e07d77db0bf258b9d28426e7c1
24932 F20101206_AADHRY duckworth_l_Page_19.pro
0857a7248a74663117149958de5ecae1
804d69f84ccd2b6cfc579ea47dad6f99dd39c509
42963 F20101206_AADHTB duckworth_l_Page_72.pro
3ba81992b6ed95060863a1aedde725e8
2d09e06e1d882fcf5ab17e82c1673a13de701940
54424 F20101206_AADHSO duckworth_l_Page_49.pro
a86dc37e76a5e192feae24f84cdc4ba2
1661ddac9bace12bb04860c97a8c9624393bdae2
19466 F20101206_AADHRZ duckworth_l_Page_20.pro
0514520d0faa7743ebb02065e78357d5
395c48e8e74ef4d5540959963e1ea6fec7d022a8
48956 F20101206_AADHTC duckworth_l_Page_73.pro
bf35038be077053beee0a0e60289722b
abdb5361b8e147735821d6be339a9b6c9073c984
36384 F20101206_AADHSP duckworth_l_Page_50.pro
d40174f9e9b52a174b82c684c29029fa
2863af1b87636b2668f545f8a1a38a8ad90ff3de
38749 F20101206_AADHTD duckworth_l_Page_75.pro
82aa7d33448c4be5f8dacb1054d7a6a1
50f2448842a74a45fdb50cd5fa40057259cb8a12
46704 F20101206_AADHSQ duckworth_l_Page_51.pro
3b178bcbecd4098ae919bff62ec5c4db
905bcd495569e6603fa2ad376e30a8fc07f4c11b
46516 F20101206_AADHTE duckworth_l_Page_76.pro
ec38077ab048feaf40b8a613166cb012
8b17bb2eff310049656d47c086d20a59749740db
54792 F20101206_AADHSR duckworth_l_Page_52.pro
8cfe3831d931cb67ed599c534a66801b
076c4e29ede4be28121131a55c58e51523c192fc
66042 F20101206_AADHTF duckworth_l_Page_81.pro
b6a580d3758184dcad5b4312e823dbf9
899554f93b2d8459bc8909e641745c4115623166
16077 F20101206_AADHSS duckworth_l_Page_56.pro
fc155baafba75dc623df17bd12d92d5d
09129bb2a859ec7007c49b36807e12a5b16194bc
63951 F20101206_AADHTG duckworth_l_Page_86.pro
b4ea54d58ca8dabb0b9a62ff538de34d
a67896456ad600c79e59057cb9e81711fa7d714f
67214 F20101206_AADHTH duckworth_l_Page_87.pro
9b523a976aab527c1b5e67f1031f37e5
f860d32b1e7b52eaf1ba61d810deff9254a91a0e
55476 F20101206_AADHST duckworth_l_Page_60.pro
931907ca68f3cdd7c35702692434cb04
8887c9d22e9f14bd181d65631f6e1c1fe613232a
57188 F20101206_AADHTI duckworth_l_Page_88.pro
850ac1ab9a0b2740ee09100506c9793a
fbf495f002b535442c0ae21b6997e8dd3a86dd1a
50893 F20101206_AADHSU duckworth_l_Page_62.pro
6235e602febb743076c7ded1ef0846f5
5839b829aa9116c9d4ba0fbad9b97070ab15e451
97 F20101206_AADHTJ duckworth_l_Page_02.txt
fcd6304a6f2f5907cf24073cbe70210e
b12010b861452c8942ad91d1944c5829882bd200
14824 F20101206_AADHSV duckworth_l_Page_63.pro
fe66e355b145528833ba364f1f3b6b08
de20b9b0c04010dc4bb2d4a380bdd83b51eb9ecd
321 F20101206_AADHTK duckworth_l_Page_03.txt
684f2bcbbce0b9824309d11304c59404
86a0515c4a433120c592abf7bfe229863dc60b97
50505 F20101206_AADHSW duckworth_l_Page_64.pro
a60d754c3f21bed041dc7729d5431d7d
a732d19b9303b2a6aa428fbda50ded6641fe3779
4118 F20101206_AADHTL duckworth_l_Page_05.txt
f6f72f5491f1106d2e63452948c7c118
dd1b3bea09ad9ec847696cc16adfadcadc804eba
34230 F20101206_AADHSX duckworth_l_Page_66.pro
400a065ad5805e687c9a190c18de4cf6
bbd05a74a4c61f9ea709f77027f97e88b53ba9a5
2186 F20101206_AADHUA duckworth_l_Page_32.txt
4dd057ccec94802ff7adcc7e0a716ada
b7cb8b2c92a10302341df729395635ea5a769a21
1133 F20101206_AADHTM duckworth_l_Page_07.txt
8d1c95fb755828f2172320bafe6f7e5d
4288fda0079e1a2d4a31328b466cc09ec5378f56
40479 F20101206_AADHSY duckworth_l_Page_67.pro
87d12b30b4020b22e09c6164c0c9abac
24593de724efe66637095fbab124ae0bbfc2c52d
2035 F20101206_AADHUB duckworth_l_Page_39.txt
20d651aed841a08d18cc690b9f7edfa6
a68f705efe322c3c5bf7f9f64ef89f0aad931479
831 F20101206_AADHTN duckworth_l_Page_09.txt
6b6aaa8353465e0cd5513833a0e27e57
774dec95ea80a8234fc384b94b11561b28325d92
2244 F20101206_AADHUC duckworth_l_Page_43.txt
9ccf5158d1c000d3a9f9bbc802e72c8e
a57d8443023bc5f75a64d859287f4bd55e2713ba
2040 F20101206_AADHTO duckworth_l_Page_10.txt
bc0f6b191163b62c2069ad52c97af857
72841febd9715459b2b3379e20c153e5a90c6d60
51271 F20101206_AADHSZ duckworth_l_Page_68.pro
4400b71e7b968c25300766974386a0d2
66c4afbf5d3a4fd81cf99b64600f1bb430db2933
2182 F20101206_AADHUD duckworth_l_Page_44.txt
525ef8bd1b1e90252febbcd6c96b3134
fcf0c2451c8471f935c5fcd9552736710f7868ed
875 F20101206_AADHTP duckworth_l_Page_11.txt
d4a0bbf35c7202f44f60e46b7770fbc8
13178ecabe3371be5e7213f8ed8e4b5a1e1e3f78
2214 F20101206_AADHUE duckworth_l_Page_45.txt
38c98602922f1863267329913a3bac06
ca9d24832d59152bbe48ca834f5b8b88a3bf4f48
2094 F20101206_AADHTQ duckworth_l_Page_12.txt
4975fa506e9cb4138d3f7370d6b51dd6
d1d01fce20a823872bbe99bdca7ec557404df1df
2250 F20101206_AADHUF duckworth_l_Page_47.txt
19f22e8219a26e0df7bfab29cb7f40e2
79904fdc707943967dd8a834fce3c6eda2ec98a5
2099 F20101206_AADHTR duckworth_l_Page_13.txt
c7031770c7561dc655b1fa3f30a93b57
a4cec3aede5a59b2f28c277150a4a035da6fdd60
1026 F20101206_AADHUG duckworth_l_Page_53.txt
bb9f375652e81e1f4b899469cc586b30
71ff857d27a7416f1b96d3e8995b2fdfc08b2a2d
2105 F20101206_AADHTS duckworth_l_Page_16.txt
450c53fe9dd717b642a37e225d8890e3
663eec6c4371b6c2be79d1071df42fec3b289d20
2231 F20101206_AADHUH duckworth_l_Page_54.txt
fe0fbd393f47688cca53d13a56afa892
77e50f7361dfffb72a25f8391b6377079af8568c
1568 F20101206_AADHTT duckworth_l_Page_17.txt
8b63b1f305407644ec18de248b87a292
b1709d23cf613d00e0687981743f2eddf5634463
1378 F20101206_AADHUI duckworth_l_Page_55.txt
d14c3ab2c029f17dca7cd07728124153
5fab5115fc94a2451c2a9777d97bcee42f9a0e3c
995 F20101206_AADHTU duckworth_l_Page_19.txt
6007a1c4a9060f52aa7dcab9314cd29c
1c33de0eda37a0726af15afa56288c04db829e7a
899 F20101206_AADHUJ duckworth_l_Page_56.txt
7eb2e88c656482b2fb56c1f42dc7f8fe
dba4e441bd0e8d252cf497c8e999edbf5f8b54c9
1481 F20101206_AADHTV duckworth_l_Page_21.txt
f5ec933adca867586c206c4f9fdfa262
9312c6e5fe92da1346955d489586a28e5acd864c
2136 F20101206_AADHUK duckworth_l_Page_58.txt
986c9a16876f7bb8885c5b7c686e8b91
a423083e5c6376f0fe4a60b524f388269d68353d
1970 F20101206_AADHTW duckworth_l_Page_23.txt
286687f5918c221b1cdc69e89074bfb9
90ef0077cde3a3d22ec2662797f6aafa525affd8
2173 F20101206_AADHUL duckworth_l_Page_60.txt
10f561aa6992ca9f9afd9335dc8c3dee
891903fd95ee508638079c3bb51457fba7547752
1218 F20101206_AADHTX duckworth_l_Page_25.txt
864ce87554e018e806d36eb090fea64d
36bebaf289ad15bcb87a7f46db2d202212d13056
2065 F20101206_AADHUM duckworth_l_Page_62.txt
d89ac967da17846b6581c67c865b4f78
97200787482554faee48e98bbc48b093b12b5a9e
233 F20101206_AADHTY duckworth_l_Page_27.txt
dfc8f88b6bd797dfa63f8f0cd298501a
4152aa0d1ae5fd66a5af3a56aeb59880e32f3856
6017 F20101206_AADHVA duckworth_l_Page_55thm.jpg
bb07424d5343e118912ba1a3257b5219
60a6bfe85f812b3105d97e17d11a6319a4864bdb
2070 F20101206_AADHUN duckworth_l_Page_64.txt
b094e38c475ea026ed38015bb46f1fde
56a58425278722bf7c001ca62425f447da877058
2201 F20101206_AADHTZ duckworth_l_Page_31.txt
77a53eb4adb4693c07998fbd638fd8f4
e2949f8a36452f0734cec90d5405aeb02ebb1ce4
8494 F20101206_AADHVB duckworth_l_Page_01.QC.jpg
d4dbe7ab5ba75cc51fc9381555ee4222
d53844c32814f4937c0e9c277a7bde05db19811b
2023 F20101206_AADHUO duckworth_l_Page_68.txt
7dad9bf4cddb79329fe50862b2895875
abf9718e1838743b0d70aaaa5f2b5b9220bfcaf1
3554 F20101206_AADHVC duckworth_l_Page_09thm.jpg
5cbc11879bd134362017420ab1bf5667
f808798177ddea2a16db3fc81dbde0925384abba
1667 F20101206_AADHUP duckworth_l_Page_70.txt
705cac55036c5f148331bbf1476530d4
da97e51a292644a137727ac079faebfaf64be358
8624 F20101206_AADHVD duckworth_l_Page_42thm.jpg
e532b7e32050b0887b67b97837c55068
767a08428d09da9a7ceed3c5ea4fe9aa75661d8d
1704 F20101206_AADHUQ duckworth_l_Page_71.txt
db234146a60ec41c0011b6905b3664b5
9781fe834eae8e1a6799fe4631e132dee40bcbfa
14615 F20101206_AADHVE duckworth_l_Page_27.QC.jpg
10f2b18dc56e2691d7df857553da8bac
6ba51cd7203f97decd3fde8c63819709f053ebff
1719 F20101206_AADHUR duckworth_l_Page_72.txt
beab07db2ba1778c22e735e3383d4815
daf12a5f605280b40e2b0c66ef3b6a36bf26d706
8631 F20101206_AADHVF duckworth_l_Page_29thm.jpg
fe10985e44ae650fab4185e7f80e6c26
aefefa9ca1d7d619a22eb8b31f5521e6073bb09c