<%BANNER%>

Molecular Growth Regulation of Bahiagrass (Paspalum notatum Flugge)

Permanent Link: http://ufdc.ufl.edu/UFE0021214/00001

Material Information

Title: Molecular Growth Regulation of Bahiagrass (Paspalum notatum Flugge)
Physical Description: 1 online resource (119 p.)
Language: english
Creator: Agharkar, Mrinalini As
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2007

Subjects

Subjects / Keywords: gibberellins, turfgrass
Agronomy -- Dissertations, Academic -- UF
Genre: Agronomy thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Bahiagrass (Paspalum notatum Flugge) is a predominant turf and forage species in the tropical and sub-tropical regions of the world. The popularity of this species can be attributed to its low fertility requirements, drought tolerance, few disease and pest problems and persistence under over-grazing and frequent mowing. 'Argentine', an apomictic tetraploid cultivar, is preferred for turf due to its limited flowering period compared to the sexual, diploid cultivars. Turf quality of bahiagrass is limited due to its open growth habit and production of tall seedheads in the summer and fall months. These characters restrict the use of turf bahiagrass to low-input areas such as shoulders of highways and large areas of residential lawns. Gibberellins are plant growth regulators involved in a large number of growth and developmental processes including stem elongation. Manipulation of bioactive gibberellins has successfully been used to alter the plant architecture of several species. The goal of this research was the improvement of the turf quality of bahiagrass by the over-expression of a gibberellin-catabolizing enzyme, GA 2-oxidase. The objectives of this research were: 1. Generation of transgenic bahiagrass lines over-expressing GA 2-oxidase; 2. Molecular characterization of transgenic bahiagrass lines over-expressing GA 2-oxidase. 3. Phenotypic and physiological characterization of transgenic lines over-expressing GA 2-oxidase under controlled environment conditions. The open reading frame (ORF) of AtGA2ox1 from Arabidopsis was amplified by PCR and was sub-cloned under the control of the constitutive maize ubiquitin promoter. A minimal AtGA2ox1 cassette and an nptII selectable marker cassette without vector backbone were used for biolistic gene transfer to embryogenic callus generated from mature seeds of Argentine bahiagrass. A total of eight putative transgenic lines were regenerated and characterized using PCR, RT-PCR, Southern and Northern blot hybridization, confirming the integration and expression of AtGA2ox1 in all lines. Phenotypic and physiological characterizations were carried out under controlled environment conditions using hydroponics and soil-grown plants. Transgenic lines produced significantly higher numbers of tillers compared to wild-type bahiagrass under both hydroponics as well as greenhouse conditions. The lengths of stems, leaves and consequently tillers were also reduced in the transgenic lines. Seedhead production of transgenic lines was delayed by at least two weeks compared to the wild-type. Root biomass and root length were not altered in the transgenics by the change in plant architecture. Even under reduced nitrogen, the transgenic lines continued to show a semi-dwarf phenotype in hydroponics. The alteration in plant architecture did not compromise the drought tolerance of the transgenic lines under controlled environment conditions. The performance of transgenic lines during drought stress and recovery was comparable to the wild-type. The over-expression of AtGA2ox1 in bahiagrass resulted in the production of semi-dwarf plants with increased tillering and delayed flowering. The transgenic lines also maintained drought tolerance levels similar to wild-type bahiagrass and therefore may have the potential to produce a better quality turf with minimal inputs.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Mrinalini As Agharkar.
Thesis: Thesis (Ph.D.)--University of Florida, 2007.
Local: Adviser: Altpeter, Fredy.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2017-08-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2007
System ID: UFE0021214:00001

Permanent Link: http://ufdc.ufl.edu/UFE0021214/00001

Material Information

Title: Molecular Growth Regulation of Bahiagrass (Paspalum notatum Flugge)
Physical Description: 1 online resource (119 p.)
Language: english
Creator: Agharkar, Mrinalini As
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2007

Subjects

Subjects / Keywords: gibberellins, turfgrass
Agronomy -- Dissertations, Academic -- UF
Genre: Agronomy thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Bahiagrass (Paspalum notatum Flugge) is a predominant turf and forage species in the tropical and sub-tropical regions of the world. The popularity of this species can be attributed to its low fertility requirements, drought tolerance, few disease and pest problems and persistence under over-grazing and frequent mowing. 'Argentine', an apomictic tetraploid cultivar, is preferred for turf due to its limited flowering period compared to the sexual, diploid cultivars. Turf quality of bahiagrass is limited due to its open growth habit and production of tall seedheads in the summer and fall months. These characters restrict the use of turf bahiagrass to low-input areas such as shoulders of highways and large areas of residential lawns. Gibberellins are plant growth regulators involved in a large number of growth and developmental processes including stem elongation. Manipulation of bioactive gibberellins has successfully been used to alter the plant architecture of several species. The goal of this research was the improvement of the turf quality of bahiagrass by the over-expression of a gibberellin-catabolizing enzyme, GA 2-oxidase. The objectives of this research were: 1. Generation of transgenic bahiagrass lines over-expressing GA 2-oxidase; 2. Molecular characterization of transgenic bahiagrass lines over-expressing GA 2-oxidase. 3. Phenotypic and physiological characterization of transgenic lines over-expressing GA 2-oxidase under controlled environment conditions. The open reading frame (ORF) of AtGA2ox1 from Arabidopsis was amplified by PCR and was sub-cloned under the control of the constitutive maize ubiquitin promoter. A minimal AtGA2ox1 cassette and an nptII selectable marker cassette without vector backbone were used for biolistic gene transfer to embryogenic callus generated from mature seeds of Argentine bahiagrass. A total of eight putative transgenic lines were regenerated and characterized using PCR, RT-PCR, Southern and Northern blot hybridization, confirming the integration and expression of AtGA2ox1 in all lines. Phenotypic and physiological characterizations were carried out under controlled environment conditions using hydroponics and soil-grown plants. Transgenic lines produced significantly higher numbers of tillers compared to wild-type bahiagrass under both hydroponics as well as greenhouse conditions. The lengths of stems, leaves and consequently tillers were also reduced in the transgenic lines. Seedhead production of transgenic lines was delayed by at least two weeks compared to the wild-type. Root biomass and root length were not altered in the transgenics by the change in plant architecture. Even under reduced nitrogen, the transgenic lines continued to show a semi-dwarf phenotype in hydroponics. The alteration in plant architecture did not compromise the drought tolerance of the transgenic lines under controlled environment conditions. The performance of transgenic lines during drought stress and recovery was comparable to the wild-type. The over-expression of AtGA2ox1 in bahiagrass resulted in the production of semi-dwarf plants with increased tillering and delayed flowering. The transgenic lines also maintained drought tolerance levels similar to wild-type bahiagrass and therefore may have the potential to produce a better quality turf with minimal inputs.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Mrinalini As Agharkar.
Thesis: Thesis (Ph.D.)--University of Florida, 2007.
Local: Adviser: Altpeter, Fredy.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2017-08-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2007
System ID: UFE0021214:00001


This item has the following downloads:


Full Text

PAGE 1

1 MOLECULAR GROWTH REGULATION OF BAHIAGRASS ( Paspalum notatum FLUGGE) By MRINALINI ASHOK AGHARKAR A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2007

PAGE 2

2 2007 Mrinalini Ashok Agharkar

PAGE 3

3 To my parents, my sister and my husband.for their love and support

PAGE 4

4 ACKNOWLEDGMENTS I thank my major professor Dr. Fredy Altpet er for his guidance, patience, encouragement and support during the course of my graduate pr ogram. His involvement and advice was crucial to the successful completion of this dissertation. I am also gr ateful to Dr. Maria Gallo, Dr. Kenneth Quesenberry, Dr. David Wofford, Dr. Brya n Unruh and Dr. Grady Miller for serving on my supervisory committee and their support and va luable suggestions throughout the course of this research. I am thankful to all the members of the lab, past and present, for their help and constant support. I thank Dr. Victoria James and Dr. Ha ngning Zhang for training me in various tissue culture and molecular biology tech niques and vector construction. I also thank Dr. Walid Fouad and Dr. Xi Xiong for their helpful suggestions and discussions. I am very thankful to all the graduate students in my lab, Sukhpreet Sandhu, Dr Gabriela Luciani, Isaac Neibaur, Paula Lomba and Jose Celedon for their friendship, help and support during the last four years. They made the lab a great place to work and I w ill always cherish the good times we had. Special thanks are extended to Sukhpreet Sandhu for critical reading of this disse rtation and help with editing. I would also like to thank Loan Ngo for her friendship and help both in and outside the lab. Thanks are also due to Angelika Altpeter, all the undergraduate stude nts and interns Erika and Sima who helped me duri ng the course of this work. I express my gratitude to Dr Theo Lange for the analysis of gibberellin content which was a critical component of this project. I also thank Jeff Seib for training me in radioactive work and Eric Ostmark for his help and support dur ing greenhouse work. I thank Dr. Vu for making his spectrophotometer available a nd Joan Anderson for helping me use it. I thank the University of Florida for financial support through the Graduate Alumni Fellowship. I also thank the

PAGE 5

5 Consortium for Plant Biotechnology Research (CPBR), the Scotts Company and Southwest Florida Water Management District for funding this research project. I thank Wiley-Blackwell Publishing Ltd. for allowing me to use materials from the journal article Stable expression of AtGA2ox1 in a low-input turfgrass Paspalum notatum Flugge) reduces bioactive gibberellin levels and improves turf quality under field conditions. Agharkar, M., Lomba, P., Altpeter, F., Zh ang, H., Kenworthy, K. and Lange, T. (2007) Plant Biotechnology Journal (In press) and the book chapter B ahiagrass. In A compendium of transgenic crop plants: Volume 1, (2007) Altpet er, F., Agharkar, M. and Sandhu, edited by S. Kole, C. and Hall, T.C.(In press) in this dissertation. I am deeply grateful to my family for al ways standing behind me during this journey. I thank my parents and my sister Shweta for beli eving in me and encouraging me to follow my dreams. I owe this accomplishment to their c onstant motivation and support. I express my gratidtude to my uncle and aunt Vijay and Laxmi, who have been my inspiration and greatest support here in the U.S. Last but not least, I thank my husband Rahul for his understanding, patience and faith in me.

PAGE 6

6 TABLE OF CONTENTS page ACKNOWLEDGMENTS...............................................................................................................4 LIST OF TABLES................................................................................................................. ..........9 LIST OF FIGURES................................................................................................................ .......10 ABSTRACT....................................................................................................................... ............11 CHAPTER 1 INTRODUCTION..................................................................................................................13 Bahiagrass ( Paspalum notatum Flugge).................................................................................13 Genetic Engineering for Turf Quality.....................................................................................14 Objectives..................................................................................................................... ..........15 2 LITERATURE REVIEW.......................................................................................................16 Bahiagrass ( Paspalum notatum Flugge).................................................................................16 Botanical Description......................................................................................................17 Cytological Features........................................................................................................17 Establishment and Production.........................................................................................18 Uses of Bahiagrass..........................................................................................................20 Traditional Breeding of Bahiagrass.................................................................................21 Limitations of Conventional Breeding............................................................................23 Tissue Culture and Genetic Transformation of Grasses.........................................................23 Tissue Culture................................................................................................................. .23 Genetic Transformation...................................................................................................25 Selectable Markers..........................................................................................................27 Transformation of Bahiagrass.........................................................................................28 Improvement of the Turf Quality of Bahiagrass.....................................................................30 Gibberellins................................................................................................................... ..........31 Gibberellin Mutants.........................................................................................................32 GA 2-oxidases.................................................................................................................34 3 MATERIALS AND METHODS...........................................................................................39 Tissue Culture and Transformation........................................................................................39 Vector Construction.........................................................................................................39 Tissue Culture and Genetic Transformation....................................................................39 Neomycin Phosphotransferase II (NPTII) Enzyme-Linked ImmunoSorbent (ELISA) Assay.............................................................................................................40 Molecular Characterization of Transgenic Plants...................................................................41

PAGE 7

7 Polymerase Chain Reaction (PCR) and Reverse Transcription PCR (RT-PCR)............41 Southern Blot Analysis....................................................................................................41 Northern Blot Analysis....................................................................................................42 Phenotypic and Physiological Charac terization of Transgenic Plants...................................42 Quantification of Endogenous Gibberellins....................................................................42 Evaluation of Plant Phenotypes under Hydroponics Growth Conditions.......................43 Greenhouse Evaluation of Plant Architecture.................................................................43 Progeny Analysis.............................................................................................................44 Evaluation of Drought Stress Response of Transgenic Lines under Greenhouse Conditions....................................................................................................................44 Statistical Analysis........................................................................................................... .......46 4 RESULTS AND DISCUSSION.............................................................................................47 Results........................................................................................................................ .............47 Generation and Molecular Characterizati on of Transgenic Bahiagrass Overexpressing a GA 2-oxidase..........................................................................................47 Quantification of Endogenous GAs.................................................................................48 Phenotypic and Physiological Evaluation of Transgenic Lines under Controlled Environment Conditions.....................................................................................................48 Evaluation of Plants Grown in Hydroponics...................................................................48 Evaluation of Plants Grown in Soil.................................................................................49 Progeny Analysis.............................................................................................................50 Response of Transgenic Li nes to Drought Stress............................................................50 Discussion..................................................................................................................... ..........53 5 SUMMARY AND CONCLUSIONS.....................................................................................74 APPENDIX: PROTOCOLS FOR MOLECULAR CLONING, TISSUE CULTURE, TRANSFORMATION AND CHARACTE RIZATION OF TRANSGENIC BAHIAGRASS PLANTS.......................................................................................................77 Preparation of Electro-competent E.coli .................................................................................77 Electroporation of E.coli .........................................................................................................77 Preparation of Glycerol Stocks...............................................................................................78 Purification of Plasmid DNA usi ng the QIAprep Miniprep kit..............................................78 Purification of Plasmid DNA using the QIAGEN Plasmid Midi Kit.....................................78 Gel Extraction using the QIAquick Gel Extraction kit...........................................................79 Sterilization of Bahiagrass Seeds............................................................................................80 Tissue Culture and Transformati on of Argentine Bahiagrass..............................................81 Biolistic Gene Transfer........................................................................................................ ...82 NPTII ELISA Assay.............................................................................................................. .83 Isolation of DNA using Mi ni Dellaporta Method...................................................................84 Basic PCR Set-up using the HotStarTaq DNA Polymerase (Qiagen)....................................84 Isolation of Total RNA using the RNeasy Plant Mini Kit (Qiagen).......................................85 DNase Treatment using the RNase-Free DNase Set (Qiagen)...............................................86 Using the Nanodrop Spectrophotometer................................................................................86

PAGE 8

8 cDNA Synthesis using the iScript cDNA Synthesis Kit (Bio-Rad).......................................86 Basic RT-PCR Set-up using the HotStarTaq DNA Polymerase (Qiagen).............................87 Large-scale Isolation of DNA using the CTAB method........................................................87 Isolation of Total RNA usi ng the TRI REAGENT (Sigma)...................................................88 Southern Blotting (A lkaline Transfer)....................................................................................89 Northern Blotting.............................................................................................................. ......91 Hybridization using the Prime-a-Ge ne Labeling System (Promega).....................................92 Quantification of Endogenous Gibberellins...........................................................................93 Hydroponics Nutrient Solution...............................................................................................94 Stock Solutions................................................................................................................ .......95 Media.......................................................................................................................... ............96 Buffers........................................................................................................................ ............97 LIST OF REFERENCES.............................................................................................................100 BIOGRAPHICAL SKETCH.......................................................................................................119

PAGE 9

9 LIST OF TABLES Table page 1-1 Analysis of gibberellin content (n g/g FW) from Line H1 and Wild-type........................ 73

PAGE 10

10 LIST OF FIGURES Figure page 1-1 Principal pathway of gibberellin metabolism in plants......................................................37 1-2 Substrates and catabolites of AtGA2ox1 ............................................................................38 4-1 pHZUbi-GA2ox1.............................................................................................................. .58 4-2 Transformation and molecular characteri zation of transgenic bahiagrass plants..............59 4-3 Phenotypic comparison of AtGA2ox1 expressing bahiagrass and wild-type following four weeks of growth of singl e rooted tillers in hydroponics............................................60 4-4 Phenotypic comparison of AtGA2ox1 expressing bahiagrass and wild-type following four weeks of growth of single rooted til lers in the full strength hydroponics solution....61 4-5 Phenotypic comparison of AtGA2ox1 expressing bahiagrass and wild-type following four weeks of growth of si ngle rooted tillers in the lo w nitrogen hydroponics solution...62 4-6 Phenotypic comparison of AtGA2ox1 expressing bahiagrass and wild-type following six weeks of growth of single rooted t illers in soil under greenhouse conditions.............63 4-7 Seed-derived progeny plants expressing AtGA2ox1 ..........................................................64 4-8 Response of transgenic lines to drought stress..................................................................65 4-9 Relative Water Content (RWC) of transg enic lines (H1, H2, H3, H4, H6, H7), St. Augustinegrass and wild-type bahiagrass..........................................................................66 4-10 Chlorophyll Content of transgenic lines (H1, H2, H3, H4, H6, H7), St. Augustinegrass and wild-type bahiagrass..........................................................................67 4.11 Maximum Quantum Yield of dark-adapted l eaves of transgenic lines (H1, H2, H3, H4, H6, H7), St. Augustinegra ss and wild-type bahiagrass...............................................68 4-12 Electron Transfer Rate (ETR) of transg enic lines (H1, H2, H3, H4, H6, H7), St. Augustinegrass and wild-type bahiagrass..........................................................................69 4-13 Response of transgenic lines to drought stress..................................................................70 4-14 Recovery of transgenic lines after drought stress..............................................................71 4-15 Productivity of transgenic lines after 12 weeks of witholding irrigation and three weeks of rehydration..........................................................................................................72

PAGE 11

11 Abstract of Dissertation Pres ented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy MOLECULAR GROWTH REGULATION OF BAHIAGRASS ( Paspalum notatum FLUGGE) By Mrinalini Ashok Agharkar August 2007 Chair: Fredy Altpeter Major: Agronomy Bahiagrass ( Paspalum notatum Flugge) is a predominant turf and forage species in the tropical and sub-tropical regions of the world. The popularity of this species can be attributed to its low fertility requirements, drought tolerance, few disease and pest problems and persistence under over-grazing and frequent mowing. Argentin e, an apomictic tetraploid cultivar, is preferred for turf due to its limited flowering peri od compared to the sexual, diploid cultivars. Turf quality of bahiagrass is limited due to its open growth habit and production of tall seedheads in the summer and fall months. These characters restrict the use of turf ba hiagrass to low-input areas such as shoulders of highways a nd large areas of re sidential lawns. Gibberellins are plant growth regulators i nvolved in a large number of growth and developmental processes including stem elongation. Manipulation of bioactive gibberellins has successfully been used to alter th e plant architecture of several spec ies. The goal of this research was the improvement of the turf quality of bahiagrass by the ov er-expression of a gibberellincatabolizing enzyme, GA 2-oxidase. The objectives of this research were: 1. Generation of transgenic bahiagrass lines over-expressing GA 2-oxidase; 2. Molecular characterization of transgenic bahiagrass lines over-expressing GA 2-oxidase. 3. Phenot ypic and physiological

PAGE 12

12 characterization of transgenic lines over-expressing GA 2-oxidase under controlled environment conditions. The open reading frame (ORF) of AtGA2ox1 from Arabidopsis was amplified by PCR and was sub-cloned under the control of the constitutive maize ubiquitin promoter. A minimal AtGA2ox1 cassette and an nptII selectable marker cassette wit hout vector backbone were used for biolistic gene transfer to embryogenic ca llus generated from mature seeds of Argentine bahiagrass. A total of eight puta tive transgenic lines were rege nerated and characterized using PCR, RT-PCR, Southern and Northern blot hybridization, confirming the integration and expression of AtGA2ox1 in all lines.. Phenotypic and physio logical characterizations were carried out under controlled environment cond itions using hydroponics and soil-grown plants. Transgenic lines produced significantly higher numbers of tillers compared to wild-type bahiagrass under both hydroponics as well as greenhouse conditions. The lengths of stems, leaves and consequently tillers we re also reduced in the transgen ic lines. Seedhead production of transgenic lines was delayed by at least two weeks compared to the wild-type. Root biomass and root length were not altered in the transgenics by the change in plant architecture. Even under reduced nitrogen, the transgenic lines continued to show a semi-dwarf phenotype in hydroponics. The alteration in plant ar chitecture did not compromise the drought tolerance of the transgenic lines under controlled environment c onditions. The performance of transgenic lines during drought stress and recovery wa s comparable to the wild-type. The over-expression of AtGA2ox1 in bahiagrass resulted in the production of semi-dwarf plants with increased tillering and delayed fl owering. The transgenic lines also maintained drought tolerance levels similar to wild-type bahiagrass and theref ore may have the potential to produce a better quality turf with minimal inputs.

PAGE 13

13 CHAPTER 1 INTRODUCTION Bahiagrass ( Paspalum notatum Flugge) Bahiagrass ( Paspalum notatum Flugge) is a perennial warm-season grass grown in the tropical and sub-tropical regions of the world. Since its introduction into the United States (U.S.) in 1913 (Scott, 1920), it has been wi dely used in the Southeast as both forage and turf, covering an estimated 6 million acres (Burton et. al, 1997). Bahiagrass has several attributes that make it popular: persistence, tolerance to sandy soils with low fertility, exte nsive root systems that allow it to tolerate periods of drought, re sistance to most diseases and pe sts, ability to establish from seed, and tolerance to over-gr azing (Blount et al., 2001a; Chamb liss and Adjei, 2002; Smith et al., 2002; Trenholm et al., 2003; Gates et al., 2004). There are two cytotypes of bahiagrass grown in Florida, the sexual diploids (2x = 20) such as cultivars Pensacola and Tifton 9 and th e apomictic tetraploids (2x = 40) such as the cultivar Argentine. Pensacola is the most commonly grown diploid cultivar of bahiagrass. It is characterized by long narrow leaves, extended peri ods of flowering and higher cold tolerance compared to Argentine (Chambliss and Adjei, 2002). Tifton-9 (Burton, 1989) was developed from Pensacola using the Restricted Recurrent Phenotypic Selection (RRPS) procedure (Burton, 1974), and has increased seedling vigor (Chambli ss and Adjei, 2002). The apomictic tetraploid cultivar, Argentine, is popular as turf due to its dark green colo r and reduced period of flowering compared to the diploid cultivars (Trenholm et al., 2003). However, bahiagrass use as turf is mainly in low-input areas such as highway shoulde rs and larger areas of residential lawns due to its open growth habit and the prolific producti on of more than 60 cm tall seedheads. The improvement of tetraploid cultivars by traditional br eeding methods involves the generation of sexual tetraploid s by doubling the chromosome num ber of diploid plants with

PAGE 14

14 colchicine treatment (Forbes and Burton, 1961a ; Quesenberry and Smith, 2003). These sexual tetaploids are then used as fe male parents crossed with apomic tic males to produce segregating tetraploid populations (Acuna et al., 2007). Th e development and use of genetic transformation provides an alternative for improvement of apomic tic bahiagrass and allows for the transfer of useful genes across natural hybridiz ation barriers. The apomictic natu re of the tetraploid cultivars can prove to be an advantage af ter genetic transformation because it may provide a natural gene containment system and hence reduce the potential for transgene dispersal. In addition, the progeny of apomictic cultivars are identical to the mother plant resulting in uniformity. This should be of great importance to assure uniform turf quality in genetically improved grasses. Genetic Engineering for Turf Quality Turf quality of bahiagrass is reduced becau se of its open growth habit and prolific seedhead production. Modification of these charac teristics may make bahiagrass more desirable for use as turf. Several approaches can be used to achieve this goal. Tr aditional breeding and has been used to generate dwarf cult ivars of several.turfgrass specie s. Mutation breeding can also be used for this purpose. However these strategies have not yet to be successful in generating a commercially-important dwarf bahiagrass cultiv ar. Application of pl ant growth regulators (PGRs) can also be used to induce or suppress plant growth. Frequent ap plication of PGRs is expensive and may also pose phytotoxicity pr oblems (Unruh and Brecke, 1999). Gibberellins (GAs) are plant growth regulators involved in key developmental processes including stem elongation and apical dominance. Gibberellin 2-oxidases (GA2ox) are a family of enzymes involved in the degradation of bioactive GAs namely 2-oxoglutaratedependent dioxygenases (2ODDs) that hydroxylate the C-2 of active GAs (Martin et al., 1999; Thomas et al., 1999; Sakamoto et al., 2001) making them inactive. A loss of function mutation in the GA 2-oxidase gene of garden pea results in the slender phenotype, indicating th at GA 2-oxidase has an

PAGE 15

15 important role in the regulation of elongation gr owth (Lester et al., 1999 ; Martin et al., 1999). GA 2-oxidase genes from different species including runner bean ( Phaseolus coccineus L.) (Thomas et al., 1999), garden pea ( Pisum sativum L.) (Lester et al., 1999; Martin et al., 1999), Arabidopsis (Thomas et al., 1999; Hedden and Phillip s, 2000; Schomburg et al., 2003), pumpkin (Frisse et al., 2003) and hybrid poplar ( Populus tremula X Populus alba ) (Busov et al., 2003) have been isolated. Over-expression of AtGA2ox8 from Arabidopsis in both Arabidopsis and tobacco resulted in transgenic lines with phenotype s ranging from nearly wild type to severely dwarf compact rosettes that had no discer nable internodes (Sch omburg et al., 2003). An alternative approach for the reduction of bioactive GAs is to down-regulate genes involved in GA biosynthesis (H edden and Phillips, 2000; Pimenta Lange and Lange, 2006). Anti-sense technology has been used to succes sfully down-regulate th e expression of GA 20oxidase in Arabidopsis (Coles et al., 1999) and potato ( Solanum tuberosum L.) (Carrera et al., 2000) and GA 3-hydroxylase in rice (Itoh et al., 2002). This strategy requires sequence information for the target gene. Such information for bahiagrass in unavailable at present. Hence the former approach was employed in this research. Objectives Based on the above results, the goa l of the present research was to explore the potential of over-expression of the GA-cataboliz ing GA 2-oxidase in bahiagrass for the improvement of turf quality. Specific objectives of my research were: 1. Generation of transgenic bahiagrass lines over-expressing GA 2-oxidase. 2. Molecular characterization of transgenic bahiagrass lines over-expressing GA 2-oxidase. 3. Phenotypic and physiological ev aluation of transgenic bahi agrass lines over-expressing GA 2-oxidase under controlled environment conditions.

PAGE 16

16 CHAPTER 2 LITERATURE REVIEW Bahiagrass ( Paspalum notatum Flugge) Species of the genus Paspalum are abundant in the tropical and warm temperate regions of the New World, especially Br azil, eastern Bolivia, Paraguay and northeastern Argentina. Pensacola, the predominantly used dipl oid cultivar of bahiagrass belongs to Paspalum notatum var. saurae Parodi. Large natural po pulations of the var. saurae types are found in Correientes, Entre Rios and the eastern edge of the Santa Fe Provinces in Argentin a (Burton, 1967) and hence this region is believed to be th e center of origin of the species (Gates et al., 2004). The greatest number of diverse Paspalum species is found in this area of th e origin and in Rio Grande do Sul state of Brazil. These diploid and tetr aploid species are closely related to P. notatum (Gates et al., 2004). Pensacola bahiagrass can be found in most mid-latitude countries of the Western hemisphere. Today Pensacola, as well as Tifton 9 bahiagrass, are used as both forage and turf in several South American countries including Brazil. Tetraploid races of bahiagrass are found in native pastures, open areas, savannas and cultivated pastures in South America, central Mexico and the West Indies. In addition, bahiagrass is also being used in Australia, Japa n, Zimbabwe and Taiwan. The first report of the introduction of bahiagrass to the U.S. was as ear ly as 1913 (Scott, 1920). The first experimental plantings were established in Georgia in 1930. S eed of Argentine bahiagrass and Paraguay 22 bahiagrass arrived in 1944 and 1947, respectively and were distribut ed for testing by the United Stated Department of Agriculture and the Flor ida Experimental Agricu lture Research Station. The bahiagrass population that was released as Pensacola was firs t found growing near the docks in Pensacola, FL probably afte r its arrival on a ship from Argentina some time before 1926 (Burton, 1967). Soils in the southern US are aci dic, low in nutrients and have a low water-

PAGE 17

17 holding capacity. Bahiagrass tolerates low fert ility, soil acidity, drought and over-grazing. The introduction and use of Pensacola bahiagrass for pastures in the Southeasten U.S. was a major achievement because it provided an alternative to existing poo r quality species (Hoveland, 2000). Since its first introduction, Pensacola bahiagra ss is spreading northwa rd, and it is now found growing as far north as south-eas tern Oklahoma (Gates et al., 2004). Botanical Description A thorough botanical description of bahiagrass can be found in Gates et al. (2004) and is summarized here. Bahiagrass is perennial, with st rong, shallow, horizontal rhizomes which have short, stout internodes. The inte rnodes are usually covered with ol d, dry leaf sheaths. Leaves are mostly crowded at the base with overlapped keel ed sheaths, glabrous or with ciliate margins mainly toward the summit. Inflorescences are su b-conjugate with a short almost imperceptible common axis, racemes two, rarely three and 3to 14cm long. Spikelets are solitary in two rows on one side of the rachis, obovate or ovate, shining, glabrous, 2.5 to 4mm long and 2to 2.8mm wide. Anthers and stigmas are usually purple, the fruit is oval about 1.2-mm wide and 1.8-mm wide. Common tetraploid bahiagra ss is the typical form of P. notatum characterized by broad leaves, strong roots and stout rhizomes with shor t internodes. In contrast the diploid Pensacola type is taller, with longer and narrower leav es, smaller spikelets and more racemes per inflorescence. It belongs to P. notatum var saurae Cytological Features The base chromosome number of bahiagrass is x = 10. Ploidy levels found in the wild range from diploid (2n = 2x = 20) to pentaploid (2n = 5x = 50) All diploid races belong to P notatum var. saurae Pentaploids and hexaploids (2n = 6x = 60) have been created artificially by pollinating apomictic tetraploids (2n = 4x = 40) with pollen from diploids and tetraploids, respectively by the fertilization of an unreduced egg (2n + n) (Burton, 1948; Martnez et al.,

PAGE 18

18 1994). Tetraploid plants have been produced by doubling the chromosome number of diploid plants with colchicine treatment (Forbe s and Burton, 1961a; Quesenberry and Smith, 2003). Octaploid plants with 80 chromosomes have also been produced from tetraploid plants using the same approach (Quarin, 1999). The tetraploid races are believed to have or iginated by autoploidy and evidence for this was provided by chromosome pairing studies carri ed out in induced sexual autotetraploids, natural apomictic tetraploid strains, and sexual x apomictic tetraploid hybrids (Forbes and Burton, 1961b). It has been observed that in the pollen mother cells (PMC) of tetraploid plants, the chromosomes pair primarily as multivalents during meiosis I, forming two to ten quadrivalents (Forbes and Burton, 1961b; Fernande s et al., 1973). Also, triploid hybrids from crosses between diploid and tetraploid plants have as many as 10 trivalents per PMC during meiosis I, indicating that there is complete homology between the genomes of the diploid parent and both genomes of the tetraploid male pare nt (Forbes and Burton, 1961b). These data provide evidence for the assumption that P. notatum is an agamic complex containing many cytotypes with different ploidy levels, primarily autotetraploids. Establishment and Production Bahiagrass, the predominant forage grass in Fl orida and the coastal pl ains region of states in the southeastern U.S., is also used as turf in low-maintenance area s such as shoulders of highways and large areas of lawns. Bahiagrass is well-adapted to sandy soils and produces good growth even with low fertility and low pH. Bahi agrass can persist in dr ought conditions due to its extensive root system and it tolerates over-gr azing or frequent mowi ng. Bahiagrass has few disease and pest problems, alt hough it is vulnerable to dollar spot and mole crickets. The rhizomes of bahiagrass store larg e amounts of organic and inorgani c nutrients and contribute to

PAGE 19

19 the persistence of the species. These factors are responsible for the immens e popularity of bahiagrass (Chambliss and Adjei, 2002; Trenholm et al., 2003). Bahiagrass is usually established from seed, but germination occurs slowly over a period of 28 days or more (West and Marousky, 1989). In addition, the seedlings are not very vigorous (Williams and Webb, 1958). Hence, the scarificati on of seeds, preparation of a good seedbed and careful seed placement may be necessary for uni form stand establishment (Burton, 1939, 1940a). Bahiagrass is used for grazing from April to Oc tober in the southeastern U.S. Moving further north, the growing season for bahiagrass is shorter. In Florida, the major growth period is during the six warmest months of the year (April-Sept ember) and this accounts for more than 85% of annual production (Beaty et al ., 1980; Mislevy and Everett, 1981). Day length plays an important role in the growth of bahiagrass (Bl ount et al., 2001a), and experimental manipulation of day length during the early fall to mid-winter period resulted in an increase in the herbage accumulation Gates et al., 2004). Nitrogen is the mo st important nutrient f actor for growth of bahiagrass. Increasing the nitrogen rate helps to increase dry matter yield, but it does not change the herbage accumulation pattern (Beaty et al., 1 960). Beaty et al. (1980) reported that applying two split applications of nitrogen in the middl e of the summer instead of one early growing season application can improve the yield distri bution of Pensacola bahiagrass. The rate of nitrogen application, alo ng with the date of residue removal, also affects the floral development and seed yield of Argentine bahi agrass (Adjei et al., 2000). The prot ein content of bahiagrass is low. Bahiagrass is also rich in anti-quality fact ors such as secondary metabolites and structural components of cells (Gates et al., 2004). Bahi agrass cannot be eliminated even by severe defoliation and tolerates in tense clipping or over-grazi ng (Sampaio and Beaty, 1976).

PAGE 20

20 Uses of Bahiagrass Bahiagrass is mainly used as forage. It is a reliable source of forage for low-input beef cattle ( Bos taurus ) production, because of its persistence under low fertility, drought, and severe, continuous stocking (Gates et al., 2004). In Flor ida alone, grasslands support about 1.2 million head of beef cattle (Blount, 2004). Bahiagrass is used as turf in low-maintena nce situations. It has been planted along highway right-of ways throughout the southeastern U.S. and is used on large areas of lawns. Argentine is the preferre d cultivar for use as turf because it has a more prostrate growth habit compared to Pensacola. Its tolerance to frequent close mowing in addition to persistence and low fertility requirements, make it suitable for use as turf. Bahiagrass is used in rotation with a number of crops that can be grown on sandy soils. It is popular for this purpose mainly because it can be established by seed. The use of bahiagrass has been reported to reduce the populati on of nematodes root-knot nematode ( Meloidogyne arenaria (Neal) Chitwood race 1 in peanut ( Arachis hypogea L.) (Rodriguez-Kabana et al., 1988), Meloidogyne spp. in peach [ Prunus persica (L.) Batsch] (Evert et al., 1992), Meloidogyne incognita and Rotylenchulus reniformis in cotton ( Gossypium hirsutm L.) (Katsvairo et al., 2006) and root-knot and cyst nematodes ( Heterodera glycines Ichinohe) in soybean [ Glycine max (L.) Merr.] (Rodriguez-Kabana et al., 1989a, 1989b). Reduction in the incidence of stem rot ( Sclerotium rolfsii Sacc.) and limb rot ( Rhizoctonia solani Kuhn) in peanut (Johnson et al., 1999) and root diseases from Rhizotonia solani or Pythium spp. in snap bean ( Phaseolus vulgaris L.) and cucumber ( Cucumis sativus L.) (Sumner et al., 1999) was reported following rotation with bahiagrass. Bahiagrass rotation also reduced the in cidence of tomato spotted wilt virus (TSWV), Cercospora leaf spot and white mold ( Sclerotium rolfsii ) in peanut compared to rotation with

PAGE 21

21 cotton (Tsigbey et al., 2005). Rotation with bahiag rass may also result in a slight increase in organic matter (Chambliss and Adjei, 2002). Bahiagrass pastures also provide supplem entary income through seed, hay and sod production. In 2003, bahiagrass accounted for 24 % of the 92,950 acres of sod produced in Florida (Haydu et al., 2005). An acre of bahi agrass can yield from 50 to 150 lbs of seed (Chambliss and Adjei, 2002). Bahiagrass harveste d prior to flowering can provide good quality hay. Excess growth on pastures is harvested a nd sold as hay (Chambliss and Adjei, 2002). Traditional Breeding of Bahiagrass Breeding efforts in bahiagrass have been focused mainly on the sexual diploids. The apomictic nature of the tetraploid cultivars ma kes traditional breeding difficult. The tetraploid cultivars used at present are s uperior ecotypes selected from th e introduced germplasm (Gates et al., 2004). Two approaches have been used for breeding bahiagrass. In the first approach, selected inbred lines of Pensacola were vegetative ly established in altern ate rows in a field and the F1 hybrid seed was collected. Pensacola is self-i ncompatible; hence the seed were a result of out-crossing (Burton, 1974). Such an approach was relatively unsuccessful due to difficulties in establishing the seed produc tion fields vegetatively. The second approach was called Restricted Recurrent Phenotypic Selection (RRPS), a modification of the mass selection procedure (B urton, 1974). Twenty-three cycles of selection for increased forage production were completed using this approach in which 1000 space-planted individuals were used for select ion. Twenty percent of the plants were selected based on scoring for aboveground herbage accumulation. The selected individuals were then inter-mated in a polycross to produce seeds for the subsequent sel ection cycle. Seeds from the polycross were germinated in the greenhouse during the winter and transferred to the field in the spring. Tifton 9 was released as a cultivar from the ninth selectio n cycle. A similar approach was also used to

PAGE 22

22 select for increased yield and in vitro dry matter digestion (IVDMD), and hence, increased forage quality, but no cultivar was released fr om this research (Gates, unpublished data, 2002).. Low forage production in the fall and winter months poses severe problems for dairy and beef cattle production in the southeastern U.S. (Bl ount et al., 2001a). Selec tions for higher yield using RRPS also had a changed daylength response and more advanced cycles showed less response to supplemental light (Blount et al., 200 1b). A two-year study in Quincy, FL indicated distinct cycle differences in se nsitivity to day length (Blount et al., 2001a). This study also identified day-neutral plants and plants that were able to tolerate temperatures of -4C. These results were significant achievements since im proving cold tolerance is a main breeding objective for bahiagrass. In addition to increased yield, selections from more advanced cycles were also characterized by an in crease in early germination a nd reduced seed dormancy (Gates and Burton, 1998). There has also been some breedi ng effort directed toward reducing the time taken for stand establishment and the improvement of forage quality and seedling vigor (Blount et al., 2001a). Evaluation of rela ted germplasm is another activ ity being carried out by the University of Florida (Blount et al., 2001a). This includes new P. notatum accessions as well as Paspalum species. Similarly, molecular tools are being used to support conventional breeding programs and enable a better understanding of bahiagrass reproduction. Ortiz et al. (1997) developed Restriction Fragment Length Polymorphism (RFLP) and Random Amplified Polymorphic DNA (RAPD) markers for the identi fication of hybrid progeny in breeding programs. These markers can also be used to characterize natural popu lations and genetic relationships among cultivars and ecotypes. A genetic linkage map for diploid Paspalum notatum is available (Ortiz et al., 2001). The map was created as a fr amework for genetic studies, as well as for breeding purposes

PAGE 23

23 using heterologous RFLP clones fr om maize, rice and oat. This map makes it possible to study complex and simple traits and should prove to be a useful tool for plant breeders. Martnez et al. (2001) studied the transmission of apospory in bahi agrass and proposed that it is controlled by a single dominant gene. Recently, differences in gene expression in diploid bahiagrass and a newly formed autotetraploid were analy zed (Martelotto et al., 2005). The results of th is study show that at least 0.49% of genes from the flower transcri ptome are differentially expressed. Identification and further analysis of these genes may enha nce the understanding of the asexual and sexual modes of reproduction in Paspalum notatum Limitations of Conventional Breeding Since tetraploid cultivars of bahiagra ss are apomictic, their improvement using conventional breeding methods is difficult. The use of transgenic technology may help to overcome this problem. However, the apomictic na ture of these cultivars may prove to be an advantage in this type of research. In apomictic types, the progeny is genetically identical to the mother plant i.e. there is no segregati on. Hence the phenotype is fixed in the F1 generation which translates into uniformity of genetically improve d cultivars. In the case of diploid cultivars, introgression of desired traits by traditional me thods is generally a time-consuming procedure. Transgenic technology may help to expedite th e process and allow the introduction of useful genes across natural hybr idization barriers. Tissue Culture and Genetic Transformation of Grasses Tissue Culture A well-established tissue culture system is a pr erequisite in order to improve most species via genetic transformation. The ge netic engineering of plants in vitro via genetic transformation techniques is largely dependent on the ability of the tissue to regenerate whole plants (Fennell et al., 1996). Grasses were generally co nsidered to be recalcitrant to tissue culture. A large number

PAGE 24

24 of factors such as the explant, growth conditi ons, plant growth regulator concentrations and genotype influence the response of plants in tissue cultu re. These have been studied in a large number of grasses and efforts have been direct ed towards the developm ent of successful tissue culture protocols, especially for ce reals. In grasses, explants that contain meristematic cells, such as shoot meristems, young leaf bases, immature inflorescences, immature embryos, nodal tissues, anthers, and in rare instances, root tips, develop embryogenic callu s that remains totipotent. Of these explants, immature embryos are the most widely used for grass tissue culture (Bhaskaran and Smith, 1990). Much of the early research in grass tissue culture was focuse d on the manipulation of plant growth regulators and other or ganic and inorganic compounds. Fo r example, a combination of auxins and cytokinins was found to be suitable for embryogenic callus ini tiation in several rice cultivars (Bhaskaran and Smith, 1990). Grasses s how significant genotypic variation in tissue culture response. As a result, c onditions optimal for plant regene ration in one cultivar fail to produce plants in another cultivar of the same species. In recent years, efforts have been made to establish successful tissu e culture protocols for turfgrass species. Turfgrasses, like other major monocot crop speci es such as maize, wheat and rice, are recalcitrant to genetic manipulation in vitro The results obtaine d with cereal crops served as guidelines for deve loping tissue culture protocols fo r perennial grasses (reviewed by Chai and Sticklen, 1998) including bermudagra ss (Ahn et al., 1985, 1987), tall fescue (Lowe and Conger, 1979; Dalton, 1988 a,b), perennial ryeg rass (Krans, 1981; Creemers-Molenaar et al., 1988), Italian ryegrass (Ahloowalia, 1975; Kran s, 1981; Creemers-Molenaar et al., 1988), meadow fescue (Wang, et al., 1993a), red fescue (Torello et al., 1984; Zaghmout and Torello, 1988), redtop (Asano and Sugiura, 1990), creepi ng bentgrass (Krans, 198 1; Krans et al., 1982),

PAGE 25

25 Kentucky bluegrass (McDonnell and Conger, 1984; Boyd and Dale, 1986), St. Augustinegrass (Kuo and Smith, 1993), centipedegrass (Krans, 1981; Krans and Blanche, 1985) and zoysiagrass (Al-Khayri et al., 1989). Plan t regeneration from bahiagrass callus has been obtained when initiated from immature inflorescences (B ovo and Mroginski, 1986), mature and immature embryos (Bovo and Mroginski, 1989), young leaf tissue (Bienick, 1989) and mature seeds (Marousky and West, 1990; Akashi et al., 1993; Grando et al., 2002; Altpeter and Positano, 2005). Genetic Transformation Genetic transformation can be achieved by Agrobacterium -mediated transformation or by direct gene transfer methods. Agrobacterium -mediated transformation typically results in simpler transgene integration patterns a nd low copy number in contrast to direct gene transfer methods (Hiei et al., 1994). Several f actors affect the success of Agrobacterium -mediated gene transfer: co-cultivation conditions (Rashid et al., 1996), th e presence or absence of acetosyringone (Rashid et al., 1996), Agrobacterium strains, effective elimination of Agrobacterium after cocultivation, marker genes, selection protocols, and promoters (Koichi et al., 2002). After the establishment of Agrobacterium -mediated transformation protocol s for cereal crops (reviewed by Cheng et al., 2004) such as rice, wheat, barle y, sorghum and maize, this technique has been successfully applied to several forage and turf grass species including cr eeping bentgrass (Yu et al., 2000; Luo et al., 2004; Fu et al., 2005, Han et al., 2005), switchgrass (Somleva et al., 2002), Italian ryegrass (Bettany et al., 2003), zoysiagrass (Toyama et al., 2003), perennial ryegrass (Altpeter et al., 2004; Wu et al ., 2005; Bajaj et al., 2006; Sato and Takamizo, 2006), colonial bentgrass (Chai et al., 2004), tall fesc ue (Dong and Qu, 2005; Wang and Ge, 2005a), bermudagrass (Hu et al., 2005a, b; Li et al., 2005 ; Salehi et al., 2005) and weeping lovegrass (Neanana et al., 2005).

PAGE 26

26 Although Agrobacterium-mediated transformati on has been successful, recently genetic transformations in monocot has be en mostly carried out using dire ct gene transfer because they were initially considered to be outside the host range of Agrobacterium tumefaciens which is commonly used to transform many dicotyledonous plants (Koichi et al ., 2002). Two standard methods, protoplast and biolisti c transformation, have been us ed to successfully produce transgenic turfgrass and cereals (Lee et al., 1996). Several grass sp ecies have been successfully transformed using protoplast transformation (reviewed by Wang and Ge, 2006), namely orchardgrass (Horn et al., 1988) tall fescue (Wang et al., 1992; Ha et al., 1992; Dalton et al., 1995; Kuai et al., 1999), creepi ng bentgrass (Lee et al., 1996), redtop (Asano and Ugaki, 1994), red fescue (Spanenberg et al., 1994), Italian ryegrass (Wang et al., 1997 ), perennial ryegrass (Wang et al., 1997) and zoysiagrass (Inokuma et al., 1998). Protoplast mediated gene transfer, however requires a long tissue culture phase wh ich has the potential to increase somaclonal variation and reduce reproducibili ty. This gene transfer system is also highly genotype dependent. Biolistic gene transfer has several advantages over othe r methods of transformation, including Agrobacterium -mediated transformation (reviewed by Altpeter et al., 2005). These include: absence of biological constraints such as dependence on genotype and/or species, the ability to transform single cells as well as or ganized tissues, elimination of vector backbones prior to transformation, transfer of multiple ge nes for pathway engineering and gene stacking, and the transformation of organelle genomes. The versatility of this technique makes a number of transformation strategies possi ble including the use of plant viruses and high molecular weight DNA.

PAGE 27

27 The first successful generation of perennial gr asses by biolistic gene transfer was reported in 1992 for tall fescue ( Festuca arundinacea Schreb.) (Ha et al., 1992; Wang et al., 1992) followed by (reviewed by Wang and Ge, 2006) cr eeping bentgrass (Hartman et al., 1994; Zhong et al., 1993; Xiao and Ha, 1997; Da i et al., 2003; Guo et al., 2003), tall fescue (Spanenberg et al., 1995a; Cho et al., 2000; Wang et al., 2001b, 2003a; Ch en et al., 2003, 2004), Italian ryegrass (Ye et al., 1997, 2001; Dalton et al., 1999; Li et al., 2004; Petrovska et al., 2004), Kentucky bluegrass (Ha et al., 2001), blue grama grass (Aguado-Santacr uz et al., 2002), bermudagrass (Zhang et al., 2003; Goldman et al., 2004; Li and Qu, 2004), pe rennial reygrass (Spanenberg et al. 1995b; Wang et al., 1997; Dalton et al. 1999 ; Altpeter et al., 2000; Xu et al. 2001, Petrovska et al. 2004 and Chen et al. 2005), red fescue (Spanenberg et al., 1995a, 1998; Altpet er & Xu, 2000; Cho et al. 2000) and colonial bentgrass (Chai et al., 2004). Genetic tr ansformation of bahiagrass has been reported for the T7 genotype (Smith et al ., 2002), and the cultivars Argentine (Altpeter and James, 2005) and Pensacola (Gondo et al., 2005; Luciani et al., 2007) cultivars of bahiagrass. Selectable Markers Selectable markers are co-introduced with the gene of interest to enable selection of transformed cells after transformation. Genes conf erring resistance to antibiotics or herbicides are commonly used for this purpose. The most popular markers in monocot transformation are the genes encoding hygromycin phosphotransferase ( hpt ), phosphinothricin acetyltransferase ( pat or bar ) and neomycin phosphotransferase ( nptII ) (Cheng et al., 2004). Glyphosateinsensitive plant 3-enolpyruvylshikimate-5-phospha te synthase (EPSPS) genes confer resistance to the herbicide glyphosate. These genes have also been used as selectable markers by Zhou et al. (1995), Russell and Fromm (1997) and Howe et al. (2002). The CP4 gene, which also confers resistance to glyphosate, has been used in Agrobacterium -mediated transformation of wheat (Cheng et al., 2003; Hu et al., 2003). The presence of selectable marker s conferring antibiotic

PAGE 28

28 resistance in transgenic plants has been an i ssue for public concern due to the possibility of transfer of clinically important antibiotic resi stance genes to disease-causing bacteria (Daniell 1999; Puchta 2000; Darbani et al., 2007), inacti vation of oral doses of antibiotics due to consumption of transgenic produc e containing genes for resistance to these antibiotics (Daniell, 1999, Puchta, 2000; Darbani et al., 2007) and esca pe of herbicide-resistance through seeds or pollen (Daniell 1999; Darbani et al., 2007). Efforts are being ma de to eliminate the use of antibiotic based markers by using positive se lection (reviewed by Joersbo, 2001). Positive selection using phosphomannose isomerase was first de monstrated for dicot plants such as potato (Haldrup et al., 1998) and sugar beet (Joersbo et al., 1998). It has also been used effectively in the transformation of rice (Lucca et al., 2001), maize (Negrotto et al., 2000), and sugarcane (Jain et al., 2007). An alternative to the use of positive selecti on markers is the elimination of antibiotic selectable marker cassettes after regeneration of transgenic plants. Several strategies such as the use of site-specific recombination systems (C re/loxP, FLP/FRT and R/RS), transposon-based systems, and interchromosomal recombination-ba sed systems are now available for this purpose (Miki and McHugh, 2004; Darbani et al., 2007). In se xual species, the selectab le marker cassette can also be eliminated by integration of unli nked transgene cassettes in to separate loci and selecting for marker-free plants in the proge ny population (reviewed by Ebinuma et al., 2001). Transformation of Bahiagrass The establishment of an efficient tissue culture and transformation prot ocol for the cultivar Argentine has now made genetic engineering of this commercially important cultivar of bahiagrass possible (Altpeter a nd James, 2005). Several different transgenes have now been introduced into bahiagra ss resulting in the improvement of im portant characteristics as described below.

PAGE 29

29 The ability of plants to tolerate stress is dependent on changes in gene expression. Transcription factors play a key role in controlling gene expr ession. Hence the manipulation of transcription factors can be used to induce desired changes in ge ne expression. For example, the expression of DREB1A a member the CBF3 gene family, has resulted in the production of transgenic bahiagrass with increased drought and salt tolerance (James et al., 2007). Additionally, transgenic bahiagra ss plants over-expressing also WRKY38 exhibit improved drought tolerance compared to wild-type bahiagrass under controlled environment conditions (Xiong et al., 2006). Fall armyworm is an important pest in the U.S. and affects a number of commercially important species including tu rf and forage grasses (Luginbi ll 1928; Sparks, 1979; Hall, 1988). The introduction of a synthetic Cry1F gene in bahiagrass has resu lted in production of the Bt toxin in transgenic lines and c onferred resistance to the fall army worm under controlled conditions (Luciani et al., 2007). The open growth habit of bahi agrass facilitates weed encroachment. However, chemical weed control in bahiagrass is difficult due to its low tolerance to available herbicides (Trenholm et al., 2003). To address this pr oblem, bahiagrass expressing the pat gene has been generated (Sandhu et al., 2007). Transgenic lines exhibited resistance to high concentrations of glufosinate (Ignite) under controlled environment, as well as field conditions. A lthough Argentine is an apomictic cultivar, the level of sexuality is unknown. Consequently, these herbicide resistant transgenic lines are also being used to assess ge ne flow from transgenic tetraploids to normal tetraploids and diploids under contolled environment and field conditions (Sandhu et al., 2005a,b). Results of this study will help to de termine the level of sexuality of Argentine bahiagrass, as well as the ri sk of transgene dispersal.

PAGE 30

30 Improvement of the Turf Quality of Bahiagrass Bahiagrass displays a less dens e turf that is a consequen ce of reduced tillering, which severely limits its turf quali ty compared to other grasses (Anowarul Islam and Hirata, 2005). Reductions of length and number of inflorescences are also desira ble to decrease the need for frequent mowing and enhance aesth etic appearance (Goatl ey et al., 1998). The use of transgene technology to manipulate genes that determine plant architecture can be used to effectively alter plant growth characteristics. Two different appr oaches can be used to genetically alter plant architecture. The first approach involv es manipulation of regulatory genes. ATHB16 ( Arabidopsis thaliana H omeo b ox16) is a member of the HDZip family of plant transcription factors involved in the control of cell expansion (Wang et al ., 2003). Transgenic expression of ATHB16 in Arabidopsis resulted in plants with altered fl owering time, leaf expansion and shoot elongation (Wang et al., 2003). The rosette leaf area of transgenic lines was 30 % less than the wild-type. Hence the plants appeared more compact and smaller when compared to the wild type. Transgenic bahiagrass plants over-e xpressing the Arabidopsis ATHB16 exhibit reduced plant height, increased tillering and reduced flow ering compared to wild-type plants (Zhang et al., 2007). The control of transition to flowering is a complex process, involving several genes. The Arabidopsis TALE-homeobox gene, ATH1 is an inhibitor of fl oral transition (M.C.G. Proveniers and J.C.M. Smeekens, unpublishe d results). Constitu tive expression of ATH1 in perennial ryegrass ( Lolium perenne ) resulted in late flowering and altered phenotype (van der Valk et al., 2004). Transgenic plants produced mo re leaves and hence appeared more compact. The effects of over-expression of the Arabidopsis ATH1 in bahiagrass are being investigated (Altpeter, personal communication). The second approach involves targeting enzymes involved in the metabolism of gibberellins. Plant growth regulat ors control the growth and deve lopment of plants by affecting

PAGE 31

31 the division, elongation and differe ntiation of cells. Hence a change in their level can cause a multitude of effects. Thus, plant growth regulators can be used for manipulating and understanding various plant processes. There are fi ve major classes of plant growth regulators: auxins, cytokinins, gibber ellins, abscisic acid and ethylene. Gibberellins (GAs) stimulate growth in stem and leaves, trigger germination of th e seed, break bud dormancy, and stimulate fruit development. They also play a role in flower initiation and apical dominance (Harberd et al., 1998; Pimenta Lange and Lange, 2006). Gibberellin production occurs mainly in roots and young leaves; however, gibberellins do not affect root growth to a large extent. The GAs are also known to mediate the physiological responses (e .g. stem elongation and flowering) induced by environmental signals such as photoperiod a nd light quality (Hedde n and Phillips, 2000). Bioactive GAs have been proposed to suppress tiller bud outgrowth, enhance apical dominance and promote the formation of inflorescence deve lopment under long day (LD) in grasses (Lester et al., 1972; Johnston and Jeffcoat, 1977; MacMillan et al., 2005). The GAs were first identified in Japan during the investiga tion of the cause of the bakanae disease caused by the fungus Gibberella fujikuroi Subsequently, many investigations have been carried out to understand the mode of its biosynthesis and function. Gibberellins The GAs are substituted teracyclic diterpene carboxylic acids. To da te, 126 different GAs have been identified from pl ants, fungi and bacteria (http://www.plant-hormones.info/ gibberellins.htm ). However, only a few of th ese are biologically active: GA1, GA3, GA4 and GA7 (Hedden and Phillips, 2000). Mo st of these GAs are precursor s or degradation products of bioactive GAs. The first step in the bios ynthesis of GAs involv es the conversion of trans geranylgeranyl diphosphate (GGDP) to ent -kaurene via ent -copalyl diphosphate (CDP) by two kinds of diterpene cyclases in plastids, CDP synthase (CPS) and ent -kaurene synthase (KS). The

PAGE 32

32 ent -kaurene is then modified by se quential oxidations to produce GA12 via ent -kaurenoic acid. These steps are catalyzed by two membrane associated Cyt P450 monoxygenases, en t-kaurene oxidase (KO) and ent -kaurenoic acid oxidase (KAO). The final step of bioactive GA synthesis is catalyzed through two parallel pathways (i.e early-13-hydroxylation and non-13-hydroxylation pathways) by two soluble 2-oxoglutarate-depe ndent dioxygenases (2ODDs) in the cytosol, GA 20-oxidase (GA20ox) and GA 3-oxidase (GA3ox). The levels of bioactive GAs in the plant are controlled by a balance between the biosynthesis and degradation pathways. The firs t step in the degradation of bioactive GAs involves another 2ODD, GA 2-oxida se, which hydroxylates the C-2 of active GAs (Martin et al., 1999; Thomas et al., 1999; Sakamoto et al., 2001). Thus, the site of similar hydroxylation reactions determines the activity of GA molecule s (Schomburg et al., 2003). Almost all of the genes encoding the seven GA metabolic en zymes (CPS, KS, KO, KAO, GA20ox, GA3ox and GA2ox) and their related mutants have been isolat ed from various plants in recent years (Hedden and Phillips, 2000). The isolation of these genes has opened up new avenues which may further our understanding the metabolism of GAs. (Section modified from Agharkar et al., 2007) Gibberellin Mutants The production and analysis of mutants has pl ayed a crucial role in both the initial identification of the gi bberellins and the understa nding of their role in the control of shoot elongation and other plant developmental proces ses (Ross et al., 1997). The first GA mutants were altered shoot elongation mutants in pea ( Pisum sativum L.) (Brian and Hemming, 1955) and maize ( Zea mays L.) (Phinney, 1956). The application of GA to these mutants restored normal height, indicating a role of GAs in stem elongation. The sln mutant of pea is defective in the deactivation of bioactive GAs (Ross et al., 1995; Martin et al., 1999). The la cry-s mutants of

PAGE 33

33 pea (de Haan, 1927) also exhibit elongated inter nodes similar to the sln mutants; however they are elongated constitutive GA response mutant (Potts et al., 1985). The sln mutant of barley ( Hordeum vulgare L.) (Chandler 1988; Lanahan a nd Ho, 1988; Ross et al., 1997), the spy mutants of Arabidopsis (Jacobsen and Olszewski, 1993) and the pro mutants of tomato ( Lycopersicon esculentum L.) (Jones, 1987; Jupe et al., 1988) are also elongated constitutive GA response mutants. The el ongated phenotype of the lh mutant of cucumber ( Cucumis sativus L.) is a result of a mutation a phytochrome gene (A damse et al., 1987, 1988; L opez-Juez et al., 1995). The gai mutants of Arabidopsis (Koornneef et al., 1985) and barl ey (Boother et al., 1991) and D8 mutants of maize (Phinney, 1956; Fujioka et al ., 1988) accumulate GAs similar to wild-type plants however they exhibit a GA-deficien t phenotype due to insensitivity to GAs Predominantly, mutants in GA biosynthesis show either a dwarf or a semi-dwarf phenotype depending on which st ep of GA biosynthesis is affected. For example, the ga1-3 mutants of Arabidopsis which display the most severely dwarfed GA deficient phenotypes (Sun et al., 1992; Wilson et al., 1992), have a mutati on in the GA1 gene which encodes the only copy of copalyl diphosphate synthase in Arabidopsis (Sun and Kamiya, 1994). On the other hand, the ga5 mutants of Arabidopsis (Xu et al., 1995), which are bl ocked in GA 20-oxidation, show a semi-dwarf phenotype. This is because GA5 en zymatic activity is encoded by a small gene family of GA 20-oxidases (Phillips et al., 1995). Recently, Sakamoto et al., (2004) have shown that the enzymes catalyzing th e early steps in the GA biosynt hetic pathway (CPS, KS, KO and KAO) are encoded by single genes, while thos e for later steps (GA 20ox, GA3ox and GA2ox) are encoded by small gene families. They identified four GA20ox -like genes, two GA3ox -like genes and four GA2ox -like genes from the rice genome. In Arabidopsis eight GA2ox -like genes have been isolated, AtGA2ox1 through AtGA2ox3 (Thomas et al., 1999), AtGA2ox4 through AtGA2ox6

PAGE 34

34 (Hedden and Phillips, 2000), and AtGA2ox7 and AtGA2ox8 (Schomburg et al., 2003). These genes can be used to manipulate bioactive GA le vels in plants and may produce phenotypes of economical, as well as scientific value. GA 2-oxidases GA 2-oxidases play an important role in the regulation of plan t growth through the reduction of endogenous levels of bioactive GAs. The first GA 2-oxidase gene was cloned from runner bean ( Phaseolus coccineus ) followed by three GA 2-oxidase cDNAs from Arabidopsis (Thomas et al., 1999). Two cDNAs for GA 2-oxidase were also isolated from garden pea ( Pisum sativum ) (Lester et al., 1999; Martin et al., 1999 ). A loss of function mutation in the GA 2oxidase gene of garden pea results in the slender phenotype, indicating that GA 2-oxidase has an important role in the regulation of elongation gr owth (Lester et al., 1999 ; Martin et al., 1999). OsGA2ox1 was the first rice GA 2-oxidase to be cloned (Sakamoto et al., 2001). Constitutive expression of this gene in rice under the control of the actin promoter led to extremely dwarfed transformants that were were six times shorter than normal ri ce. The leaf blades of the transformants were dark green and shorter and wider than those of w ild-type rice plants. This is a typical phenotype for GA-deficien t dwarf rice. The formation of floral organs and internode elongation was delayed in the transformants a nd they did not produce seed. However, when AtGA2ox1 was constitutively expressed in tobacc o, seed production was not compromised in dwarf plants (Biemelt et al., 2004) The authors suggest that seed production could be induced by the application of GAs. The same group has now id entified three more GA 2-oxidases from rice, OsGA2ox2 OsGA2ox3 and OsGA2ox4 (Sakamoto et al., 2004). Busov et al., (2003) have identified a GA 2-oxidase from poplar by activation tagging. This is the first GA 2-oxidase to be identified from a tree species. The stumpy mutant of poplar and GA-deficient Arabidopsis mutants share severely reduced stem elongation, decreased leaf

PAGE 35

35 size and dark-green foliage (Sun and Kamiya, 1994; Helliwell et al., 19 98; Yamaguchi et al., 1998). This phenotype also resembles the rose tte form phenotype of the GA 2-oxidase over expression in rice described above. To date, eight GA 2-oxidases have been isolated from Arabidopsis AtGA2ox1 through AtGA2ox3 (Thomas et al., 1999); AtGA2ox4 through AtGA2ox6 (Hedden and Phillips, 2000) and AtGA2ox7 and AtGA2ox8 (Schomburg et al., 2003). A lthough the over-expression of AtGA2ox1 AtGA2ox7 and AtGA2ox8 has resulted in similar phenotypes in tobacco (Schomburg et al., 2003; Biemelt et al., 2004), these enzymes target diffe rent steps in GA metabolism (Thomas et al., 1999; Schomburg et al., 2003). AtGA2ox1 converts GA9 and GA20, the immediate C19 precursors of bioactive GA4 and GA1 into biologically inactive GA51 and GA29, respectively (Thomas et al., 1999). It is also known to hydroxylate the carbon-2 of bioactive GAs, GA4 and GA1 and convert them into their inactive forms GA34 and GA8, respectively (Martin et al., 1999; Thomas et al., 1999). On the other hand, AtGA2ox7 and AtGA2ox8 have been shown to catalyze the 2 hydroxylation of the C20-GA precursors GA12 and GA53 and render them inactive (Schomburg et al., 2003). Variation in the phenotypes of plants over-expressing GA 2-oxidases may occur depending on the copy number of the transgene and/or positional effects (Schomburg et al. 2003). Alternatively, the feedback or feed-forward regulation of GA metabo lism may play a role in producing this variation in the heights of the transgenic lines (Pimenta Lange and Lange, 2006). The effects of a transgene also depend on its pr omoter. The promoter di ctates the level of expression and also the tissues in which the gene is expressed. The use of a constitutive promoter to express the OsGA2ox1 gene in rice resulted in plants that did not produce seed (Sakamoto et al., 2001). Over-expression of the OsGA2ox1 gene under the control of the OsGA3ox2 gene

PAGE 36

36 promoter, which is expressed mainly in vegeta tive tissues, resulted in the production of semidwarf plants with normal flowers and seed set (Sakamoto et al., 2003). GA-oxidase gene expression can be controlled in part by feedback or feed-forward types of regulation mechanisms that are activated in the plant when bioactive GA-levels are a ltered (Pimenta Lange and Lange, 2006). The use of a strong promoter was eff ective to overrule such possible feedback mechanisms (Radi et al., 2006). The heterologous expression of GA 2-oxidases resulted in the production of plants with reduced height and de layed flowering in wheat (Hedden and Phillips, 2000) and rice (Sakamoto et al., 2001). Hence, in the present study GA 2-oxidase overexpression was used in transgenic bahiagrass to explore its effect on turf quality parameters and plant performance. [Modified from Altpeter, F., Agharkar, M. a nd Sandhu, S. (2007) Bahiagrass. In A compendium of transgenic crop plants: Volume 1, Kole, C. a nd Hall, T.C., (eds), Wiley Blackwell (In press)].

PAGE 37

37 Figure 1-1 Principal pathway of gibbe rellin metabolism in plants. GGDP trans -geranylgeranyl diphosphate, CDP ent -copalyl diphosphate, CPS CDP synthase, KS ent -kaurene synthase, KO en t-kaurene oxidase, KAO ent -kaurenoic acid oxidase. Enzymes involved in biosynthesis ar e marked by green while enzymes involved in the degradation are marked by red. GA1(R=OH)GA4(R=H)GA8(R=OH)GA34(R=H)ent -kaurene GGDP CDPCPS KS ent -kaurenoicacidKO GA12KAO GA53GA13ox GA53(R=OH)GA12(R=H) GA20(R=OH)GA9(R=H) GA20ox GA3oxGA29(R=OH)GA51(R=H) GA2ox1 GA2ox1E.R. membrane GA44(R=OH)GA15(R=H) GA19(R=OH)GA24(R=H)Plastid CytoplasmGA1(R=OH)GA4(R=H)GA8(R=OH)GA34(R=H)ent -kaurene GGDP CDPCPS KS ent -kaurenoicacidKO GA12KAO GA53GA13ox GA53(R=OH)GA12(R=H) GA20(R=OH)GA9(R=H) GA20ox GA3oxGA29(R=OH)GA51(R=H) GA2ox1 GA2ox1E.R. membrane GA44(R=OH)GA15(R=H) GA19(R=OH)GA24(R=H)Plastid Cytoplasment -kaurene GGDP CDPCPS KS ent -kaurenoicacidKO GA12KAO GA53GA13ox GA53(R=OH)GA12(R=H) GA20(R=OH)GA9(R=H) GA20ox GA3oxGA29(R=OH)GA51(R=H) GA2ox1 GA2ox1E.R. membrane GA44(R=OH)GA15(R=H) GA19(R=OH)GA24(R=H)Plastid Cytoplasm

PAGE 38

38 Figure 1-2 Substrates and catabolites of AtGA2ox1 OH H CO O H COOH HO HOGA20 H OH CO O H COOHGA1 OH H CO O H COOH HO GA8 OH H CO O H COOH HOGA29 GA3ox GA2ox1 GA2ox1 OH H CO O H COOH HO HO OH H CO O H COOH HO HOGA20 H OH CO O H COOHGA1 OH H CO O H COOH HO GA8 OH H CO O H COOH HOGA29 GA3ox GA2ox1 GA2ox1GA20 H OH CO O H COOH H OH CO O H COOHGA1 OH H CO O H COOH HO OH H CO O H COOH OH H CO O H COOH HO GA8 OH H CO O H COOH HO OH H CO O H COOH HOGA29 GA3ox GA2ox1 GA2ox1

PAGE 39

39 CHAPTER 3 MATERIALS AND METHODS Tissue Culture and Transformation Vector Construction The coding region of AtGA2ox1 (accession no. AJ132435) was amplified from Arabidopsis genomic DNA using the primer pair sense 5.GGATCC ATCAATGGCGGTATTGTCTAAACCG-3 and anti-sense 5GAGCTC TCAATTTAGGAGATTTTTTATAGTC3described by Biemelt et al. (2004). The underlined portions of the forward and reve rse primers are the restriction sites for Bam HI and Sac I respectively. The expected 1.2 kb amplified fragment was clone d into the pDrive vector (Qiagen, Valencia, CA, USA), sequenced, and insert ed into an expression vector between the polyubiquitin (ubi) promoter from Zea mays (S94464; Christensen & Quail, 1996; Christensen et al., 1992) with polyubiquitin (ubi) mature mRNA and first intron enhancer sequence from Zea mays (S94464; Christensen et al., 1992) and NOS (nopaline synthase) 3UTR (Fraley et al., 1983; Bevan, 1983) following excision with the restriction enzymes Bam HI (New England Biolabs Inc., Ipswich, MA, USA) and Sac I (New England Biolabs Inc. ) to create the vector pHZUbi-GA2ox1 (Fig. 4-1a). Tissue Culture and Genetic Transformation Mature seeds of Argentine bahiagrass we re used to initiate callus for genetic transformation. The seeds were scarified with co ncentrated sulfuric aci d for 16 min. to break dormancy. This was followed by treatment with vapors from a mixture of Clorox bleach and glacial acetic acid (2:1) in a dessicator for 60 mi n. The seeds were then soaked in sterile deionized water (DI H2O) for 60 min and cultured on the callus induction medium (Appendix A). The tissue culture and gene transformation pro cedures are described in Appendix A and were

PAGE 40

40 performed as described by Altpeter a nd James (2005). For selection, the gene nptII (neomycin phosphotransferase II) under tran scriptional control of the en hanced 35S promoter from cauliflower mosaic virus (CaMV) (AF234315; Ode ll et al., 1985; Kay et al., 1985) with heat shock protein 70 (HSP70) intron from Zea mays (X03714, X03697; Rochester et al., 1986) and the CAMV35S polyadenylation signal (Dixon et al., 1986) was used. Following the strategy described by Fu et al. (2000) minimal transg ene expression co nstructs containing only the expression cassettes without vect or backbone were used for biolistic gene transfer. After digestion with Not I (New England Biolabs Inc.) and Not I/ Alw NI (New England Biolabs Inc.) respectively, minimal pHZUbiox1 and selectable 35S-nptII-35S 3UTR expression cassettes were isolated by gel electrophoresis, the corres ponding band was excised and purified using the QIAquick Gel Extraction K it (Qiagen) to remove v ector backbone sequences. The AtGA2ox1 and nptII expression cassettes were mixed in a 2:1 ratio, an d precipitated on a 1:1 mixture of 0.75 m and 1.0 m diameter gold particles and delivered to embryogenic calli of Argentine bahiagrass using a DuPontPDS-1000/ He device (Sanford et al., 1991) at 1100 psi. Putative transgenic callus and plantlets (Fig. 42a) were selected and regenerated on culture medium containing 50 mgl-1 paromomycin sulfate (Phytot echnology Laboratories, Shawnee Mission, KS, USA). Rooted transgenic plants (Fi g. 4-2b) were transferre d to soil and propagated under controlled environment conditions at 27 C /20 C day/night with 12 hour photoperiod and 500 mEm-2S-1 light. Neomycin Phosphotransferase II (NPTII) En zyme-Linked ImmunoSorbent (ELISA) Assay Expression of NPTII in regenerated plants was confirmed by NPTII ELISA assay (Agdia Inc., Elkhart, IN, USA). Total protein was extr acted from 100 mg of leaf tissue using the extraction buffer supplied with the kit (Agdia catalogue no. PSP 73000). Concentration of total protein was estimated using the Bradford pr otein assay (Bradford, 1976) (Appendix A). The

PAGE 41

41 ELISA assay was performed according to the ma nufacturers instructions (Appendix A). Total protein (20 g) was used from each putative transg enic plant or wild-type plant in comparison to a serial dilution of the NPTII standard supplied with the kit. Qualitative evaluation of NPTII expression was possible by visual comparison of color development. Molecular Characterization of Transgenic Plants Polymerase Chain Reaction (PCR) and Reverse Transcription PCR (RT-PCR) Genomic DNA was extracted as described by Dellaporta et al. ( 1983) (Appendix A). 75-80 ng genomic DNA was used as a template for P CR. Amplification was carried out in an Eppendorf Mastercycler (Eppendorf, West bury, NY, USA) using HotStarTaq DNA Polymerase (Qiagen). Samples were denatured at 95C for 15 min; followed by 30 cycles at 95C for 30 s, 52.3C for 30 s, 72C for 1 min; and fi nal extension at 72C for 10 min. PCR products were analyzed by electrophoresis on a 1.2% agar ose gel. The primer pair with sense 5GAACACGAGACCGTCGATTT-3and anti-sense 5CGGGCTTTTGAGAAGACTTG-3 was designed to amplify a 189 bp fragment from AtGA2ox1 For RT-PCR, total RNA was extracted from l eaf tissue (100 mg) using the RNeasy Plant Mini Kit (Qiagen) followed by treatment with R NAse-free DNase (Qiagen) to eliminate genomic DNA contamination. For cDNA synthesis, the iScriptTM cDNA Synthesis Kit (Bio-Rad Laboratories, Hercules, CA USA) was used with 1 g of total RNA in a reaction volume of 20 l. To detect AtGA2ox1 transcripts by PCR, 2 l of the cDNA was used as a template with the same primer pair as described above for PCR from genomic DNA and the amplification conditions described above. Southern Blot Analysis Total genomic DNA was isolated from leaves of transgenic and w ild-type plants as described by Saghai-Maroof et al. (1984). Restriction digestion with Bam HI (New England

PAGE 42

42 Biolabs Inc.) of 20 g genomic DNA, was followed by electrophoresis on a 1% agarose gel and blotting onto Hybond-N+ membrane (Amersham Bi osciences, Piscataway, NJ, USA). As a positive control, 25 pg of pHZUbiox1 DNA were used, following linearization by restriction digestion with Bam HI. The entire 1.2 coding sequence of AtGA2ox1 was excised with a BamH I/ Sac I digest and used as a probe. The probe was labeled with [ -32P] dCTP by random priming using the Prime-a-Gene Labeli ng System (Promega, Madison, WI, USA). Hybridization and detection were performed acco rding to the manufacturers instructions. Northern Blot Analysis TRI REAGENT (Sigma-Aldrich, St. Louis, MO, USA) was used for the isolation of total RNA from leaves of transgenic and wild-type plants. The extrac tion was performed according to the manufacturers instructions us ing 300 mg of leaf tis sue. For Northern blot analysis, 10 g total RNA was resolved on a formaldehyde agar ose gel (1.2% agarose) and transferred to Hybond-N+ membrane (Amersham). The prim er pair sense 5 AGAACACGAGACCGTCGATT 3and anti-sense 5 GGAGGGA CAGAGATCCATGA 3 was used to amplify a 500 bp region from Arabidopsis cDNA for use as the probe following labeling with [ -32P] dCTP by random priming using the Prime-a-Gene Labeling System (Promega). Samples were denatured at 95C for 15 min; followed by 40 cycles at 95C for 30 s, 57.3C for 30 s, 72C for 1 min; and final extension at 72C for 10 min. Hybridization a nd detection were perf ormed according to the manufacturers instructions. Phenotypic and Physiological Charac terization of Transgenic Plants Quantification of Endogenous Gibberellins For quantitative determination of endogenous GAs, newly emerging tillers approximately 3 cm in length were sampled. Fresh plant materi al (0.1 g dry weight) wa s pulverized under liquid nitrogen and spiked with 17, 17-d2-GA standards (2 ng each; from Professor L. Mander,

PAGE 43

43 Australian National University, Canberra, Au stralia). Samples were extracted, purified, derivatized, and analyzed by combined gas ch romatography-mass spectrometry using selected ion monitoring as described by (Lange et al., 2005). Means represent four biological replications. Evaluation of Plant Phenotypes und er Hydroponics Growth Conditions Single tillers with newly formed, 2 3 cm l ong roots were transferred to a full-strength hydroponics nutrient solution pH 6.0 to allow for establishment (Broadley et al., 2003). Roots were fully submerged into aerated nutrient solution with approximate ly 80 % oxygen saturation. Following one week of growth, tillers were transfe rred to a full strength (4 mM nitrogen) nutrient solution or low nitrogen (0.3 mM nitrogen) hydr oponics solution (Broadley et al., 2003) in a completely randomized block design with four re plications for each so lution. Nutrient solution was continuously aerated and replaced every we ek. Four weeks after th e culture initiation, the tiller number, root length, and ti ller and root biomass measure d. The experiment was conducted in a walk-in growth chamber with 400 mEm-2S-1 light intensity, 16/8 h light/dark, and 28 C / 20 C day/night temperatures. Transgenic lines (H 1, H2, H3, H4) were co mpared with wild-type (WT) and transgenic line (L 1) showing a PCR and RT-PCR amplification product with AtGA2ox1 specific primers but no detectable AtGA2ox1 hybridization signal following Northern blot analysis. Greenhouse Evaluation of Plant Architecture Single rooted tillers from transgenic plants expressing the AtGA2ox1 according to Northern blot analysis (H1, H2, H3, and H4 ) or wild-type plants were tran splanted into 8 x 8 x 7 cm pots filled with steam sterili zed Earthgro topsoil (The Scotts Mi racle-Gro Company, Marysville, OH, USA) randomized in 12 replications and propaga ted in the greenhouse. After a six wk growth period, the following parameters were evaluated: til ler number, tiller length (from crown to tip of leaf), stem length (from crown to first leaf) and leaf length (ave rage length of the three longest

PAGE 44

44 leaves). The temperature was controlled with ai r conditioning to approx imately 30 C during the day and 25 C at night. Irrigati on and fertilization was provided using an ebb and flow system with watering twice a day for five minutes. The daylength was maintained at 14 h using 1000 Watt sodium vapor lights. Progeny Analysis Inflorescences of transgenic lines were ba gged following the dehiscence of anthers to prevent seed loss by shattering. Seeds were harves ted four weeks after bagging. For germination, seeds of transgenic lines and wild-type were so aked overnight in distilled water and the lemma and palea were removed with a scalpel to break dormancy. Seeds were then soaked over-night in distilled water and transferred th e following day to Fafard no. 2 mi x (Conrad Fafard Inc.). Tiller length and number of tillers were recorded six wk after germination. Leaf tissue was harvested six wk after germination. RNA isolation and RT-PCR was carried out as described above. Evaluation of Drought Stress Response of Transgenic Lines under Greenhouse Conditions Transgenic lines (H1, H2, H3, H4, H6, H7), wild-type bahiagrass and St. Augustinegrass (Floratam) were established in Earthgro topsoil (The Scotts Mira cle-Gro Company) using single uniform tillers per pot (15 cm diameter) in five replications. Plants were allowed to grow under greenhouse conditions to achieve closed canopy unde r natural photoperiod. Plan ts were fertilized every two weeks and irrigated once a day. Plants we re then transplanted into 15 x 41 cm treepots filled with Earthgro top soil (The Scotts Miracle-Gr o Company). Pots were placed in bins with a 20 cm layer of gravel to stab ilize them and allow sub-surf ace irrigation before and after prolonged drought stress. Plants were arranged in a completely randomized design with five replications. After transplanti ng, the plants were allowed to grow for four wk with daily irrigation to generate a closed canopy.

PAGE 45

45 Before drought treatment, pots were saturated wi th water by filling the bins with water for four h. Bins were then drained and the total volumetric water cont ent of each pot was measured using a time domain reflectometer (TDR) to ev aluate uniformity of soil moisture. Pre-stress measurements were then taken for relative wate r content (RWC), chlorophyll content, maximum quantum yield, electron transfer rate (ETR) and quantum yield of photosystem II. The plants were then maintained for twelve wk without irri gation. During this time, all measurements were made every two wk. For measurement of RWC, the first fully expand ed leaf was harvested from three tillers per pot. Each leaf was then weighed (FW) and submerged in de-ionized water (DIH2O) for 16 h in a 15 ml tube. The leaf was then taken out of the water, excess water was removed by using absorbent tissue paper and the turgid weight (T W) was measured. The leaf was then placed in a paper envelope and dried at 80 C for 48 h. Following this, the dry weight (DW) of the leaf was estimated. The RWC was then calculated by applying the equation RWC = (FW-DW)/(TWDW). Maximum quantum yield of photosystem II was measured using dark-adapted leaves. Measurements were made between 5 am and 7 am (before sunrise) using Pulse Amplitude Modulated Flourometry (PAM 2100, Heinz Walz GmbH, Germany). The Photosynthetic Active Radiation (PAR) was maintained between 11 and 13 during the measurements. Standard instrument settings were used and the measurem ents were made in the saturation pulse mode (Sat. Pulse). Maximum quantum yield (Fv/Fm) data was obtained by using the Fm key on the instrument. The third fully expanded leaves fr om three tillers per pot were used for the measurements.

PAGE 46

46 The ETR and Quantum Yield of photosystem II were measured between 8 am and 10 am (after sunrise) and the PAR was maintained between 250 and 280. The third fully expanded leaf from three tillers per pot was used for the measur ements. Standard instrument settings were used and the measurements were made in the saturation pulse mode (Sat. Pulse) with the actinic light turned on. Chlorophyll measurements were made on the second fully expande d leaf using a Spad meter (Minolta SPAD 502 Chlorophyll Meter, Sp ectrum Technologies, Inc., East-Plainfield, Illinois, USA). At the end of the 12 wk period without irrigation, the bins were filled with water for 4 h to saturate the soil with water. The water was th en drained and the plan ts were watered daily. Weekly visual scores from 1 9 were given fo r recovery from drought stress with 1 representing a plant with no green leaves and 9 representing a fu lly recovered plant. At the end of three weeks after watering, the plants were removed from the pots and the soil was washed off. Shoot and root fresh weights were recorded and the samples were then dried in an 80 C oven for one wk. Following drying, shoot, root and rhizome dry we ights were evaluated. Shoot growth during recovery was estimated by deducting the shoot dry weight from the shoot freshweight (dead and green) measured at the end of three weeks after re-hydration. Statistical Analysis Statistical analysis was performed accordi ng to the randomization structure using the ANOVA-procedure of SAS version 9.1 (2005) (SAS Institute Inc. Cary, North Carolina, U.S.A.). Means were compared by the t-test (LSD, p < 0. 05). Standard error is shown in figures as a vertical bar. [Modified from Agharkar, M., Lomba, P., Altpeter, F., Zhang, H., Kenworthy, K. and Lange, T.(2007) Stable expression of AtGA2ox1 in a low-input turfgrass Paspalum notatum Flugge) reduces bioactive gibberellin levels and improves turf quality under field conditions. Plant Biotechnology Journal (In press)].

PAGE 47

47 CHAPTER 4 RESULTS AND DISCUSSION Results Generation and Molecular Characterization of Transgenic Bahiagrass Over-expressing a GA 2-oxidase Eight independent paromomycin-resistant lin es were regenerated following particle bombardment of 600 pieces of callus. NP TII ELISA confirmed the expression of nptII in all regenerated transgenic lines (Fi g. 4-2c), indicating that no nontransgenic plants escaped the selection process. PCR primers amplifying a region within the coding sequence of AtGA2ox1 indicated that all the lines had at least a singl e copy of the transgene (Fig. 42d). RT-PCR analysis (Fig. 4-2e) of the lines enabled detection of the transcript in seven lines. S outhern blot analysis was carried out following restriction dige stion of genomic DNA with Bam HI which cuts once at the 5 end of the AtGA2ox1 coding sequence. Hybridization wi th the entire c oding sequence of AtGA2ox1 revealed different transgene integration patte rns for each line, confirming their independent nature (Fig. 4-2f). The transgenic lines displayed a simple transgene integration pattern with two (H1, H2, H6) to four (H3) hybridization signa ls. Ethidium bromide staining (not shown) confirmed equal loading of all DNA samples. Northern blot analysis of transgenic lines revealed a clearly detectable AtGA2ox1 hybridization signal in a ll bahiagrass lines except L1 and w ild-type (Fig. 4-2g). Methylene blue staining of the membrane confirme d equal loading of all samples (data not shown). Lines H1 and H6 showed the highest level of expression compar ed to lines H2, H3 and H4, which displayed a clearly detectable hybridizati on signal of lower intensity.

PAGE 48

48 Quantification of Endogenous GAs The levels of the primary, bioactive GA in bahiagrass, GA1, its precursor (GA20) and the products of their catabolism (GA8 and GA29, respectively) were analyzed in AtGA2ox1 expressing line H1 and wild-type by gas chroma tography mass spectrometry (GC-MS) single ion monitoring. Line H1 displayed 75 % less GA1 and 30 % less GA20 than wild-type ( P <0.05; Table 1). Compared to wild-type, line H1 contained 7.3-times more GA29, the 2 -hydroxylated form of GA20 ( P <0.05; Table 1). The content of GA8 (2 -hydroxylated GA1) was almost 2-times lower in H1 compared to wild-type. Phenotypic and Physiological Evaluation of Transgenic Lines under Controlled Environment Conditions Evaluation of Plants Grown in Hydroponics Single, rooted tillers of uniform size were obtained from greenhouse grown plants and propagated in a constantly aerated full stre ngth (4 mM nitrogen) or low nitrogen (0.3 mM) hydroponics solution (Fig. 4-3). The plants were evaluated for thei r growth characteristics four weeks after establishment in hydr oponics. Transgenic lines H1, H 2, H3, H4 were compared with wild-type and transgenic line L1 with no detectable AtGA2ox1 Northern hybridization signal (Fig. 4-2g) but detectable AtGA2ox1 transcript by the more sensitive RT-PCR (Fig. 4-2e). When grown in the full st rength hydroponics solution, AtGA2ox1 expressing lines produced between 1.8(H2) and 2.4-times (H1) the number of tillers of wild-type ( P < 0.05), while wildtype did not differ significantly from line L1 (Fig. 4-4a). AtGA2ox1 expressing lines displayed also 21 % (H2; H4) to 34 % (H1) shorter tillers than wild-type ( P < 0.05; Fig. 4-4b) as well as 25 % and 40 % shorter leaves respectively ( P < 0.05; Fig. 4-4g). Upto 32 % shorter stems ( P < 0.05; Fig. 4-4c) contributed to the shorter tillers of th e transgenic lines. Wild-type and line L1 did not differ significantly in any of th ese parameters. The leaf width of line H2 was reduced by 18 %

PAGE 49

49 compared to the wild-type ( P < 0.05; Fig. 4-4h). The length of th e longest root did not differ significantly between lines H1; H3; H4, L1 and wild-type. However, line H2 displayed a 37% shorter root length than wild-typ e (Fig. 4-4d). Total biomass (dat a not shown), as well as shoot biomass (Fig. 4-4e) or root bi omass (Fig. 4-4f) produced by the AtGA2ox1 expressing lines did not differ significantly from the biomass of wild-type or L1. Under low nitrogen conditions, the transgenic lines and the wild-type exhibited severely reduced growth compared to plants grown unde r full nitrogen conditions (Fig. 4-3). Line H1 produced the highest number of tillers, almost 2.5 times more than the wild-type while line H4 produced two times more tillers compared to the wild-type ( P < 0.05; Fig. 4-5a). All transgenic lines produced significantly shorter tillers compared to both line L1 and the wild-type, with line H1 producing the shortest tillers ( P < 0.05; Fig. 4-5b). Line H1 also produced 40 % shorter stems ( P < 0.05; Fig. 4-5c) and 31 % shorter leaves ( P < 0.05; Fig. 4-5g) compared to the wild-type. The shoot biomass ( P < 0.05; Fig. 4-5e), leaf width ( P < 0.05; Fig. 4-5h), root length ( P < 0.05; Fig. 4-5d) and root biomass ( P < 0.05; Fig. 4-5f) of transgenic lines did not differ significantly from the wild-type. Evaluation of Plants Grown in Soil Single rooted tillers from transgenic lines H1, H2, H3, H4 and wild-type plants were established in steam-sterilized Earthgro top soil (The Scotts Mira cle-Gro Company) in 8 x 8 x 7 cm pots. After 6 weeks of growth under greenho use conditions, the plants were evaluated for number of tillers, tiller length (from crown to tip of leaf), length of stem (from crown to first leaf) and leaf length (average lengt h of the three longest leaves). AtGA2ox1 expressing lines grown in soil produced between 1.2 (H2; H3) and 2.0 times (H1) the number of tillers of wildtype ( P < 0.05; Fig. 4-6a; 4-6e; 4-6f; 4-6h). AtGA2ox1 expressing lines displayed also 18 % to 33 % shorter tillers than wild-type ( P < 0.05; Fig. 4-6b). Both, 14 % to 34 % shorter leaves ( P <

PAGE 50

50 0.05; Fig. 4-6c) and 27 % to 45 % shorter stems (Fig. 4-6d; P < 0.05) contributed to the shorter tillers of the AtGA2ox1 expressing lines. Flowering in AtGA2ox1 expressing lines was delayed for approximately two weeks co mpared to the wild-type. Progeny Analysis Transgenic and wild-type plants produ ced seeds under greenhouse conditions. The lemma and palea were physically removed to release dormancy of the freshly harvested seeds. Seedlings from transgenic lines H3, H4, H6 and w ild-type were grown for 4 wks. Seedlings from lines H3 and H4 showed a 20 % to 30 % growth reduction and more tillers compared to wildtype (data not shown). Seedlings from the highly AtGA2ox1 expressing line H6 displayed uniformly a more than 50 % decreased height co mpared to wild-type along with more tillers (Fig. 4-7a). RT-PCR analys is revealed expression AtGA2ox1 in all analyzed transgenic seedlings in contrast to wild -type (Fig. 4-7b). Response of Transgenic Lines to Drought Stress Transgenic lines (H1, H2, H3, H4, H6, H7), wild-type bahiagrass and St. Augustinegrass (Floratam) were transplanted into 15 x 15 cm wide and 41 cm deep tree pots containing Earthgro top soil (The Scotts Miracle-Gro Company) with daily irrigation in bins to allow sub-surface irrigation before and after the dehydration period. The plants we re arranged in a completely randomized design with five replications (Fig. 4-8a ). The plants were allowed to grow for four weeks with daily irrigation to allow the development of a closed canopy. Pre-stress measurements were taken for relative water content (RWC), chlorophyll content, maximum quantum yield, electron transfer rate (ETR) and quantum yield of photosystem II. After four weeks of growth, irrigation was stopped and th e plants were maintained under non-irrigated conditions for 12 weeks (Fig. 4-8b, 4-8c and 48d). During the non-irri gated period, the same measurements as described for presress were taken every two weeks.

PAGE 51

51 Pre-stress Relative Water Content (RWC) measurements ( P < 0.05; Fig. 4-9a) were fairly uniform (0.9 to 1) with St. Augustinegrass havi ng the highest RWC while the transgenic lines were not siginificantly different from wild-t ype bahiagrass. A sim ilar trend was observed following four ( P < 0.05; Fig. 4-9b) and eight ( P < 0.05; Fig. 4-9c) wk of growth under nonirrigated conditions. Line H2 displayed the lowest RWC at eight wk and was the only line that was significantly different from both wild -type bahiagrass and St. Augustinegrass ( P < 0.05; Fig. 4-9c). The chlorophyll content differed from tran sgenic line to transgen ic line during the prestress measurements ( P < 0.05; Fig. 4-10a). Transgenic lines H2 and H6 had significantly higher chlorophyll content compared to wild-type bahi agrass (14 % and 12 %, respectively) while transgenic line H4 and St. Augustinegrass had the lowest chlorophyll co ntent (11 % and 17 %, respectively) ( P < 0.05; Fig. 4-10a). After four wk unde r non-irrigated conditions, transgenic lines H3 and H4 and St. Augustinegrass had signif icantly lower chlorophyll content compared to wild-type bahiagrass (12 %, 17 % and 21 %, resp ectively) and transgenic lines H1, H2, H6 and H7 ( P < 0.05; Fig. 4.10b). At eight wk under non-irri gated conditions, line H2 had the lowest chlorophyll content and lines H1 and H6 had the highest chlorophyll content ( P < 0.05; Fig. 410c). However, none of these lines were signi ficantly different from wild-type bahiagrass. Maximum Quantum Yield (Fv/Fm) of Phot osystem II measured under well-watered conditions indicated no significan t differences between the transgenic lines and wild-type bahiagrass ( P < 0.05; Fig. 4-11a). After four wk of growth under non-watered conditions, line H6 displayed the highest Fv/Fm measurement ( P < 0.05; Fig. 4.11b) but wa s not significantly different from other transgenic lines or wild-type bahiagrass. After eight wk under non-watered conditions, line H2 showed the lowest Fv/Fm measurement and was significantly lower than lines H4, H6, H7, St Augustineg rass and wild-typ e bahiagrass ( P < 0.05; Fig. 4-11c).

PAGE 52

52 Electron Transfer Rate (ETR) measuremen ts did not show any significant difference between the transgenic lines, St. Augustinegrass and wild-type bahiagrass before stress ( P < 0.05; Fig. 4-12a) and four wk after witholding irrigation ( P <0.05; Fig 4-12b). At eight wk growth after witholding irrigati on, transgenic line H3 displaye d the lowest ETR but was not significantly different from the other transgenic lines and wild-type bahiagrass ( P < 0.05; Fig. 412c). After 12 weeks of witholding irrigation, th e plants were re-watered by sub-surface irrigation for 4 hours followed by daily irrigation and monitored for recovery from drought stress (Fig. 4-13). Time Domain Refl ectometry (TDR) was used to measure the volumetric water content (VWC) and hence monitor the soil mois ture in every pot duri ng the period of drought (Fig. 4-14a). Pre-stress measuremen ts indicate that line H6 had the highest average volumetric water content. Subsequent measurements indica ted that wild-type bahi agrass had a significantly higher volumetric soil water content compared to the transgenic lines and St. Augustinegrass. Measurements taken eight wk after witholding irri gation showed that the VWC of the transgenic lines was zero while that of the wild-type was high er (Fig. 4-14a). Weekly visual scores from 1 to 9 were given for recovery w ith 1 representing a pl ant without green leav es and 9 representing a fully recovered plant. Scores given at the end of the first week indica ted that line H1 showed the fastest recovery from th e drought stress and was signifi cantly higher th an wild-type bahiagrass and St. Augustinegrass ( P < 0.05; Fig. 4-14b). Following th ree wk growth after rehydration, none of the transgenic lines were significantly different from wild-type bahiagrass in recovery scores ( P < 0.05; Fig. 4-14c). Lines H1, H3, H4 an d H7 had significantly higher scores than St. Augustinegrass ( P < 0.05; Fig. 4-14c).

PAGE 53

53 Recovery was also evaluated by estimating the growth of new shoots during recovery. This was done by deducting the dry weight of th e shoots from the freshweight of the shoots (necrotic and green). The differen tial between the shoot freshweight and dry weight of transgenic lines was not significantly different from wild-type bahiagrass ( P < 0.05; Fig. 4-15a). St. Augustinegrass had the lowest fresh weight/dry we ight differential and wa s significantly lower than transgenic lines H1, H2, H3, H4 and H7 ( P <0.05; Fig 4-15a). The root biomass of transgenic lines after de hydration and rehydration was not sign ificantly different from wild-type bahiagrass and St. Augustinegrass (Fig. 4-15b). The weight of the rhizome of transgenic lines also did not differ significantly from wild-type bahiagrass (Fig. 4-15c). Discussion This work describes a novel approach for th e improvement of the turf quality of an apomictic, low-input grass ( Paspalum notatum Flugge). A constitutive expression cassette of AtGA2ox1, a GA 2-oxidase from Arabidopsis, was st ably introduced into bahiagrass using biolistic gene transfer. Co-transfer of the minimal AtGA2ox1 and selectable marker cassettes, following removal of the vector backbone, resulted in 100% co -integration and co-expression frequency of the transgenes along with a simple transgene integration pattern. Minimal vector technology has been described earlie r to reduce complexity of tran sgene integration and enhance co-expression frequencies of co-transferred tran sgenes (Fu et al., 2000; Agrawal et al., 2005; reviewed by Altpeter et al., 2005). Transgen ic bahiagrass constitutively over-expressing AtGA2ox1, a GA 2-oxidase from Arabidopsis displayed 75 % less GA1 and 30 % less GA20 than wild-type, while the 2 -hydroxylated metabolites GA29 and GA8 were elevated 7.3and 2.6-fold, respectively. This response is consistent with the earlier desc ribed substrate specificities of AtGA2ox1 (Thomas et al., 1999). Constitutive over-expression of OsGA2ox1 in rice (Sakamoto

PAGE 54

54 et al., 2001) caused very similar chan ges in GA-levels with 75 % less GA1 than wild-type while the 2 -hydroxylated metabolites of GA20 and GA1 were elevated 6.8and 2.5fold, respectively. Over-expression of AtGA2ox1 in bahiagrass resulted in semi -dwarf plants with 27 % to 45 % shorter stems, 18 % to 34 % shorter leaves, de layed flowering, and 8 cm shorter inflorescence stems compared to wild-type plants. Constitutive over-expression of AtGA2ox1 in tobacco also resulted in significant shorter plants than wild -type, while allowing th e production of viable seeds (Biemelt et al., 2004). In contrast, rice constitutively over-expressing OsGA2ox1 suppressed formation of inflorescences completely (Sakamoto et al., 2001). The role of GAs as a leaf-sourced stimula ting hormonal signal fo r flowering under long day photoperiod has been proposed in perennial ryegrass ( Lolium perenne L.) (MacMillan et al., 2005). Consistently, over-expression of AtGA2ox1 resulted in a delay of at least two weeks in flowering of transgenic bahiagrass grown unde r greenhouse conditions. However, viable seeds were obtained from most of the transgenic line s, and transgene expres sion and phenotype were transmitted to seed derived progeny. Many of the warm season turfgrasses including bahiagrass are vegetatively propagated and lawns are most often established from sod. Nevertheless, availability of seeds, as observed in AtGA2ox1 over-expressing plants, can be desirable for establishment of turf in low-input situations The apomictic nature of Argentine bahiagrass results in uniform progeny by asexual seed pr oduction (Burton, 1948) an d can hence reduce the risk of unintended transg ene dispersal by pollen. Production of tillers by the transgen ic plants correlated with AtGA2ox1 expression and was significantly higher in several lines than the wild-type under hydroponics and greenhouse. The highest AtGA2ox1 expressing line produced approximately twice as many tillers than the wildtype under controlled environment conditions. Interestingly, earlier reports on GA 2-oxidase

PAGE 55

55 over-expression in annual crops did not describe an enhanced number of vegetative tillers, consistent with the concept that GAs primarily control plant height (Hedden and Phillips, 2000; Sakamoto et al., 2001; Busov et al., 2003; Saka moto et al., 2003; Schomberg et al., 2003; Biemelt et al., 2004; Radi et al., 2006). However, bioactive GAs have been proposed to suppress tiller bud outgrowth and enhance apical dominance in grasses (L ester et al., 1972; Johnston and Jeffcoat, 1977). Enhanced axillary bud outgrowth is usually attributed to loss of apical dominance. Increasing evidence suggests that auxin and cytokinins are not the exclusive effectors of apical dominance (Wang and Li, 20 06). Enhancement of turf density supported by more intense tillering was achieved by multiple a pplications of the plant growth regulator trinexapac-ethyl (Primo), which specifically i nhibits the biosynthesis of bioactive GAs (Ervin and Koski, 1998). Turf treated consistently with trinexapac-ethyl displaye d better visual quality than untreated turf (Lickfedt et al., 2001). Over-expression of ATH1 in perennial ryegrass resulted in 56 % to 69 % decreased levels of GA1 and was accompanied by the outgrowth of normally quiescent lateral meristems into ex tra leaves and dela yed development of inflorescences (van der Valk et al., 2004). Phyt ochrome B mutants in sorghum display elevated GA-levels along with enhanced apical dominance (Foster et al., 1994), enhanced expression of the SbTB1 repressor of bud outgrowth (Kebrom et al., 2006) and absence of tillering. The mechanism by which phyB regulates SbTB1 abundance remains to be discovered (Kebrom et al., 2006). The data in this present study suggest that the GA-signaling pathway, among other components (Wang and Li, 2005), is i nvolved in outgrowth of axillary bu ds in perennial grasses. The drought tolerance of bahiagrass is attributed to its extensive root system. Reduction in plant height did not compromise th e root length of the transgenic plants as shown in data from both the hydroponics as well as so il culture under contro lled environment. Tolerance to drought

PAGE 56

56 is one of the characteristics that make bahiag rass popular (Blount et al., 2001a; Chambliss and Adjei, 2002; Smith et al., 2002; Trenholm et al., 2003; Gates et al., 2004). Hence it was important to determine if change in the plant architecture compromised the drought tolerance of bahiagrass. The ability to tolerate drought is de pendent on a variety of tr aits (Swemmer., et al., 2006) and one or more of these traits could be responsible for the drough t response of a species. In a study comparing the drought response of Andropogon gerardii and Sorghastrum nutans Swemmer et al. (2006) suggest th at the faster recovery of A. gerardii could be attributed to greater leaf turnover after water stress leading to rapid recovery of photosynthesis after stress, more allocation to roots and reduced allocation to flowering. Rapid photos ynthetic recovery was also observed in the water stress resistant Console cultivar of E. curvula (Colom and Vazzana, 2001, 2003). A study of the drought responses of five Brachiaria species revealed that root length and distribution was an important f actor in determining the respon se to drought stress among species (Guenni et al., 2002). The data genera ted in this research indicated that the transgenic lines were similar to wild-type bahiagrass for all the drought tolerance parameters measured. The rhizomes produced by the wild-type may be an important trait contributi ng to the drought tolerance of bahiagrass combined with its extensive root system. As observed in hydroponics, the root biomass of transgenic lines was not different from the wild-type even under drought stress demonstrating that root production of transgenic lines was not alte red in spite of the changes in plant architecture. The increased tillering ability of transgenic lines resulted in faster leaf turnover compared to the wild-t ype resulting in a quicker rec overy from drought stress than wildtype.

PAGE 57

57 Transgenic lines grown under low nitrogen cond itions continued to maintain their semidwarf phenotype and increased ti ller number. All the lines incl uding the wild-type exhibited severely reduced shoot growth, however the root lengths of all lines were higher than those obtained in the full strength nutrient solution. The findings of this research indicate that there was no significant difference in the biomass produc tion between the transgenic lines compared to the wild-type when the nitrogen was reduced to less than 1/10th of the full strength solution. The transgenic lines may have nitrogen requireme nts similar to wild-typ e bahiagrass and hence maintain the low-input nature of bahi agrass while producing better quality turf. In summary, over-expressi on of a GA 2-oxidase from Arabidopsis in bahiagrass resulted in the production of semi-dwarf pl ants with increased tilleri ng and delayed flowering. The transgenic lines also showed to lerance to drought stress at a leve l that was comparable to wildtype bahiagrass. [Modified from Agharkar, M., Lomba, P., Altpeter, F., Zhang, H., Kenworthy, K. and Lange, T. (2007) Stable expression of AtGA2ox1 in a low-input turfgrass Paspalum notatum Flugge) reduces bioactive gibberellin levels and improves turf quality under field conditions. Plant Biotechnology Journal (In press)].

PAGE 58

58 Figure 4-1 pHZUbi-GA2ox1. (a) pHZUbi-GA2ox1 containing AtGA2ox1 under the control of the maize Ubiquitin promoter and in tron. (b) Transgene expression cassette containing the maize ubiquitin promoter, AtGA2ox1 and nos terminator a b pHZUbiOX16122 bp KanR GA 2-oxidase1 nos 3' Ubiquitin Promoter and Intron BamHI (2161) SacI (3396) NotI (144) NotI (3675) PvuII (50) PvuII (3864) PvuII (5532) PvuII (5892) HZUbiOX1 fragment3531 bp GA 2-oxidase1 nos 3' Ubiquitin Promoter and Intron BamHI (2018) SacI (3253)a b pHZUbiOX16122 bp KanR GA 2-oxidase1 nos 3' Ubiquitin Promoter and Intron BamHI (2161) SacI (3396) NotI (144) NotI (3675) PvuII (50) PvuII (3864) PvuII (5532) PvuII (5892) HZUbiOX1 fragment3531 bp GA 2-oxidase1 nos 3' Ubiquitin Promoter and Intron BamHI (2018) SacI (3253)

PAGE 59

59 Figure 4-2 Transformation and molecular characteri zation of transgenic bahiagrass plants. (a) and (b) Regeneration of putative transgen ic plants on medium containing 50mg/l paromomycin. (c) NPTII ELISA assay showi ng the wild-type (WT), negative control (NC) and positive control (PC). Yellow co lored samples are positive while the clear samples are negative. (d) PCR analysis of genomic DNA isolated from transgenic lines (L1, H1, H2, H3, H4, H5, H6, H7) co mpared to the wild-type and plasmid pHZUbiox1 (M) 2-Log DNA Ladder (0.1-10 kb) (New England Biolabs). (e) Expression analysis of transgenic lines (H1, H2, H3, H4, H5, H6, H7, L1) and wildtype by RT-PCR. (M) 2-Log DNA Ladder (0.1 -10 kb) (New England Biolabs) (f) Southern hybridization of genomic DNA from the wild-type and tr ansgenic lines (H1, H2, H3, H6, H7) following re striction dige stion with Bam HI. The linearized plasmid pHZUbiox1 was used as the positive contro l and the entire 1.2 kb coding sequence was used as a probe. (g) Northern blot anal ysis of total RNA from transgenic lines (L1, H1, H2, H3, H4, H5, H 6, H7) and the wild-type. M L1 H1 H2 H3 H4 H5 H6 H7 WT NC PCd 200bp WT L1 H1 H2 H3 H4 H5 H6 H7gWT H1 H2 H3 H6 H7 PC 23kb 9.4kb 6.5kb 2.3kb 4.3kbf200bp eM H1 H2 H3 H4 H5 H6 H7 L1 WT NCPC ab WT PC NC PC c M L1 H1 H2 H3 H4 H5 H6 H7 WT NC PCd 200bp WT L1 H1 H2 H3 H4 H5 H6 H7 WT L1 H1 H2 H3 H4 H5 H6 H7gWT H1 H2 H3 H6 H7 PC 23kb 9.4kb 6.5kb 2.3kb 4.3kbf200bp eM H1 H2 H3 H4 H5 H6 H7 L1 WT NCPC ab WT PC NC PC c

PAGE 60

60 Figure 4-3 Phenotypic comparison of AtGA2ox1 expressing bahiagrass and wild-type following four weeks of growth of singl e rooted tillers in hydroponics. Transgenic lines (H1, H2, H3, H4), wild-type (WT) grown in a) full nitrogen nutrient solution and b) low nitrogen nutrient solution. WT H1 H2 H3 H4WT H1 H2 H3 H4a b WT H1 H2 H3 H4WT H1 H2 H3 H4a b

PAGE 61

61 Figure 4-4 Phenotypic comparison of AtGA2ox1 expressing bahiagrass and wild-type following four weeks of growth of single rooted til lers in the full strength hydroponics solution. (a) Number of tillers (b) Length of the tiller measured from the crown to the tip of the leaf (c) Length of the stem from the crown to the base of the first leaf (d) Length of the longest root (e) Shoot biomass (f ) Root biomass g) Leaf length of AtGA2ox1 expressing bahiagrass (H1, H2, H3. H4 and L1 ), and wild-type (WT) (h) Leaf width of AtGA2ox1 expressing bahiagrass (H1, H2, H3. H4 and L1), and wild-type (WT) Root Dry Weight 0 0.4 0.8Weight (g) Shoot Dry Weight 0 2 4 6 8 10Weight (g) Tiller Number0 10 20 30 40Tillers Tiller Length 0 10 20 30 40Length (cm) Stem Length 0 5 10 15Length (cm) Root Length 0 20 40 60 80Length (cm) Leaf Length 0 5 10 15 20 25 30H1H2H3H4L1WTLinesLength (cm) Leaf Width 0.0 0.2 0.4 0.6 0.8 1.0 1.2H1H2H3H4L1WTLinesWidth (cm) a aba a b b b b b b a a c bcc abcaba abb aba a a a a a a a a a a a a a a d bccdcda ab bcc ababca aba b c d e f g h Root Dry Weight 0 0.4 0.8Weight (g) Shoot Dry Weight 0 2 4 6 8 10Weight (g) Tiller Number0 10 20 30 40Tillers Tiller Length 0 10 20 30 40Length (cm) Stem Length 0 5 10 15Length (cm) Root Length 0 20 40 60 80Length (cm) Leaf Length 0 5 10 15 20 25 30H1H2H3H4L1WTLinesLength (cm) Leaf Width 0.0 0.2 0.4 0.6 0.8 1.0 1.2H1H2H3H4L1WTLinesWidth (cm) a aba a b b b b b b a a c bcc abcaba abb aba a a a a a a a a a a a a a a d bccdcda ab bcc ababca aba b c d e f g h

PAGE 62

62 Figure 4-5 Phenotypic comparison of AtGA2ox1 expressing bahiagrass and wild-type following four weeks of growth of single rooted til lers in the low nitr ogen hydroponics solution. (a) Number of tillers (b) Length of the tiller measured from the crown to the tip of the leaf (c) Length of the stem from the crown to the base of the first leaf (d) Length of the longest root (e) Shoot biomass (f ) Root biomass g) Leaf length of AtGA2ox1 expressing bahiagrass (H1, H2, H3. H4 and L1 ), and wild-type (WT) (h) Leaf width of AtGA2ox1 expressing bahiagrass (H1, H2, H3. H4 and L1), and wild-type (WT) Root Dry Weight 0 0.2 0.4 0.6 0.8 1Weight (g) Leaf Width 0 0.4 0.8 1.2H1H2H3H4L1WTLinesWidth (cm) Tiller Number0 5 10 15Tillers Tiller Length 0 10 20 30Length (cm) Stem Length 0 5 10Length (cm) Root Length 0 20 40 60 80 100Length (cm) Shoot Dry Weight 0 2 4 6 8Weight (g) Leaf Length 0 5 10 15 20 25H1H2H3H4L1WTLinesLength (cm) a abcbcabbcc b b b b a a c c bcbca ab ababb aba ab a a a a a a b b b b a b d b cdcda bca b c d f e ga a a a a ah Root Dry Weight 0 0.2 0.4 0.6 0.8 1Weight (g) Leaf Width 0 0.4 0.8 1.2H1H2H3H4L1WTLinesWidth (cm) Tiller Number0 5 10 15Tillers Tiller Length 0 10 20 30Length (cm) Stem Length 0 5 10Length (cm) Root Length 0 20 40 60 80 100Length (cm) Shoot Dry Weight 0 2 4 6 8Weight (g) Leaf Length 0 5 10 15 20 25H1H2H3H4L1WTLinesLength (cm) a abcbcabbcc b b b b a a c c bcbca ab ababb aba ab a a a a a a b b b b a b d b cdcda bca b c d f e ga a a a a ah

PAGE 63

63 Figure 4-6 Phenotypic comparison of AtGA2ox1 expressing bahiagrass and wild-type following six weeks of growth of single rooted till ers in soil under greenhouse conditions. (a) Number of tillers (b) Length of the tiller measured from the crown to the tip of the leaf (c) Length of the longest l eaf from the base to the tip of AtGA2ox1 expressing bahiagrass (H1, H2, H3 and H4) and the w ild-type (WT) (d) Length of the stem from the crown to the base of the first leaf of AtGA2ox1 expressing bahiagrass (H1, H2, H3 and H4) and the wild-t ype (WT). (e) Comparison of AtGA2ox1 expressing line H1 and wild-type (WT) following 6 weeks of growth of single rooted tillers in soil. (f) Comparison of AtGA2ox1 expressing line H4 and wild-type (WT) following 6 weeks of growth of single rooted tillers in soil. (g) Comparison of AtGA2ox1 expressing line H2 and wild-type (WT) followi ng 6 weeks of growth of single rooted tillers in soil. (h) Comparison of AtGA2ox1 expressing lines H3 and wild-type (WT) following 6 weeks of growth of si ngle rooted tillers in soil. Tiller Number0 5 10 15 20 25Tillers Tiller Length 0 10 20 30 40Length (cm) H1WTe H4 WTf H2WTg H3WTha bcbcb c b c c b aa b Leaf Length 0 10 20 30 H1H2H3H4WT LinesLength (cm) Stem Length 0 5 10 H1H2H3H4WTLinesLength (cm) b c c b a bcb c bcac d Tiller Number0 5 10 15 20 25Tillers Tiller Length 0 10 20 30 40Length (cm) H1WTe H4 WTf H2WTg H3WTha bcbcb c b c c b aa b Leaf Length 0 10 20 30 H1H2H3H4WT LinesLength (cm) Stem Length 0 5 10 H1H2H3H4WTLinesLength (cm) b c c b a bcb c bcac d

PAGE 64

64 Figure 4-7 Seed-derived progeny plants expressing AtGA2ox1 (a) Comparison of the seed progeny of AtGA2ox1 expressing line H6 and WT following 6 weeks of growth after germination. (b) RT-PCR using AtGA2ox1 specific primers for amplification of cDNA from progeny of transgenic lines H3 (3 -1, 3-2), H4 (4-1, 4-2), H6 (6-1, 6-2) compared to the wild-type (WT), plasmid pHZUbiox1 (PC) and buffer (NC). (M) 2Log DNA Ladder (0.1-10 kb) (New England Biolabs) H6 WT a M 3-1 3-2 4-1 4-2 6-1 6-2 WT NC PC200bp b H6 WT a H6 WT a M 3-1 3-2 4-1 4-2 6-1 6-2 WT NC PC200bp b M 3-1 3-2 4-1 4-2 6-1 6-2 WT NC PC200bp b H6 WT a M 3-1 3-2 4-1 4-2 6-1 6-2 WT NC PC200bp b H6 WT a H6 WT a M 3-1 3-2 4-1 4-2 6-1 6-2 WT NC PC200bp b M 3-1 3-2 4-1 4-2 6-1 6-2 WT NC PC200bp b

PAGE 65

65 Figure 4-8 Response of transgenic lines to drought stress. (a) Esta blishment of transgenic lines (H1, H2, H3, H4, H6, H7), wild-type bahiag rass and St. Augustin egrass in treepots placed in bins. (b) Transgenic lines (H1, H 2, H3, H4, H6, H7), St. Augustinegrass and wild-type bahiagrass after four weeks under non-irrigated conditions. (c) Transgenic lines (H1, H2, H3, H4, H6, H7), St. Augus tinegrass and wild-type bahiagrass after eight weeks under non-irrigated conditions. (d) Transgenic lines (H1, H2, H3, H4, H6, H7), St. Augustinegrass and wild-type bahiagrass after tw elve weeks under nonirrigated conditions.

PAGE 66

66 Figure 4-9 Relative Water Content (RWC) of tr ansgenic lines (H1, H2, H3, H4, H6, H7), St. Augustinegrass and wild-type bahiagrass. (a) pre-stress, (b) four weeks under nonirrigated conditions and (c) eight weeks under non-irrigated conditions. Relative Water Content ( Av g VWC 26.5)0 0.2 0.4 0.6 0.8 1 1.2 abb b b ababb a a Relative Water Content ( Av g VWC 6.5)0 0.2 0.4 0.6 0.8 1 1.2 b c bcb b b bca b Relative Water Content ( Av g VWC 0.8)0 0.2 0.4 0.6 0.8 1 1.2H1H2H3H4H6H7WTFloraLines a b ababababa a c Relative Water Content ( Av g VWC 26.5)0 0.2 0.4 0.6 0.8 1 1.2 abb b b ababb a a Relative Water Content ( Av g VWC 6.5)0 0.2 0.4 0.6 0.8 1 1.2 b c bcb b b bca b Relative Water Content ( Av g VWC 0.8)0 0.2 0.4 0.6 0.8 1 1.2H1H2H3H4H6H7WTFloraLines a b ababababa a c

PAGE 67

67 Figure 4-10 Chlorophyll Content of transgen ic lines (H1, H2, H3, H4, H6, H7), St. Augustinegrass and wild-type bahiagrass. (a ) pre-stress, (b) four weeks under nonirrigated conditions and (c) eight weeks under non-irrigated conditions. Chlorophyll content (Avg. VWC 26.5)0 10 20 30 40 50Chlorophyll content abca d e abbcdcde a Chlorophyll Content (Avg. VWC 6.5)0 10 20 30 40 50Chlorophyll Content a a b b a a a b b Chlorophyll Content (Avg. VWC 0.8)0 10 20 30 40 50H1H2H3H4H6H7WTFloraLinesChlorophyll Content a b ababa abababc Chlorophyll content (Avg. VWC 26.5)0 10 20 30 40 50Chlorophyll content abca d e abbcdcde a Chlorophyll Content (Avg. VWC 6.5)0 10 20 30 40 50Chlorophyll Content a a b b a a a b b Chlorophyll Content (Avg. VWC 0.8)0 10 20 30 40 50H1H2H3H4H6H7WTFloraLinesChlorophyll Content a b ababa abababc

PAGE 68

68 Figure 4.11 Maximum Quantum Yield of dark-adapted leaves of tr ansgenic lines (H1, H2, H3, H4, H6, H7), St. Augustinegrass and wild-t ype bahiagrass. (a) pre-stress, (b) four weeks under non-irrigated conditions and (c) eight weeks und er non-irrigated conditions. Maximum Quantum Yield of DarkAdapted Leaves (Avg. VWC 26.5)0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 a a ababa a a b Maximum Quantum Yield of DarkAdapted Leaves (Avg. VWC 6.5)0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 Maximum Quantum Yield of Dark Adapted Leaves (Avg. VWC 0.8)0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8H1H2H3H4H6H7WTFloraLines bcabbcaba bcabcc abcc bcaba ababa c b a Maximum Quantum Yield of DarkAdapted Leaves (Avg. VWC 26.5)0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 a a ababa a a b Maximum Quantum Yield of DarkAdapted Leaves (Avg. VWC 6.5)0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 Maximum Quantum Yield of Dark Adapted Leaves (Avg. VWC 0.8)0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8H1H2H3H4H6H7WTFloraLines bcabbcaba bcabcc abcc bcaba ababa c b a

PAGE 69

69 Figure 4-12 Electron Transfer Rate (ETR) of tr ansgenic lines (H1, H2, H3, H4, H6, H7), St. Augustinegrass and wild-type bahiagrass. (a ) pre-stress, (b) four weeks under nonirrigated conditions and (c) eight weeks under non-irrigated conditions. Electron Transfer Rate (Avg. VWC 26.5)0 10 20 30 40 50 60 a a a a a a a a Electron Transfer Rate (Avg. VWC 6.5)0 10 20 30 40 50 60 Electron Transfer Rate (Avg. VWC 0.8)0 10 20 30 40 50 60H1H2H3H4H6H7WTFloraLines a a a a a a a a abb b abb b abac b a Electron Transfer Rate (Avg. VWC 26.5)0 10 20 30 40 50 60 a a a a a a a a Electron Transfer Rate (Avg. VWC 6.5)0 10 20 30 40 50 60 Electron Transfer Rate (Avg. VWC 0.8)0 10 20 30 40 50 60H1H2H3H4H6H7WTFloraLines a a a a a a a a abb b abb b abac b a

PAGE 70

70 Figure 4-13 Response of transgenic lines to drought stress. (a) and (b) Transgenic lines (H1, H2, H3, H4, H6, H7), St. Augustinegrass and wild -type bahiagrass after twelve weeks of dehydration followed by three week s growth after re-hydration.

PAGE 71

71 Figure 4-14 Recovery of transgen ic lines after drought stress. (a) Volumetric Water Content (VWC) of soil for transgenic lines (H1, H 2, H3, H4, H6, H7), St. Augustinegrass and wild-type bahiagrass monitored throughout the period of drought measured by TDR. Recovery scores given to transgenic lines (H1, H2, H3, H4, H6, H7), St. Recovery Scores (3 weeks)0 2 4 6 8 10 H1H2H3H4H6H7WTFloraLinesScores a aba a aba abbc Recovery Scores (1 week)0 2 4 6 8 10 H1H2H3H4H6H7WTFloraLinesScores Volumetric Soil Water Content0 10 20 30 40 H1H2H3H4H6H7WTFloraLines Pre-stress 4 weeks 6 weeks 8 weeks ab c bcbcbcbcbc e d d c f e a b e d d c gf a b a b c ccc c caa abcdababccdabcdbcddb Recovery Scores (3 weeks)0 2 4 6 8 10 H1H2H3H4H6H7WTFloraLinesScores a aba a aba abbc Recovery Scores (1 week)0 2 4 6 8 10 H1H2H3H4H6H7WTFloraLinesScores Volumetric Soil Water Content0 10 20 30 40 H1H2H3H4H6H7WTFloraLines Pre-stress 4 weeks 6 weeks 8 weeks ab c bcbcbcbcbc e d d c f e a b e d d c gf a b a b c ccc c caa abcdababccdabcdbcddb

PAGE 72

72 Augustinegrass and wild-type bahiagrass fo llowing 1 week (b) and three weeks (c) growth after re-hydration. Figure .4-15 Productivity of transg enic lines after 12 weeks of w itholding irrigation and three weeks of rehydration. (a) Shoot growth of tr ansgenic lines (H1, H2, H3, H4, H6, H7), St. Augustinegrass and wild-typ e bahiagrass after three w eeks of recovery. (b) Root Root Dry Weight 0 5 10 15 20 25 30Weight (g) a a a a a a a a Rhizome Dry Weight 0 10 20 30 40 50H1H2H3H4H6H7WTFloraLinesWeight (g) aba abb b b abbc b Differential Between Shoot Freshweight and Dry Weight 0 5 10 15 20 25 30 35Shoot Freshweight Dry Weight (g) a a a a aba abb a Root Dry Weight 0 5 10 15 20 25 30Weight (g) a a a a a a a a Rhizome Dry Weight 0 10 20 30 40 50H1H2H3H4H6H7WTFloraLinesWeight (g) aba abb b b abbc b Differential Between Shoot Freshweight and Dry Weight 0 5 10 15 20 25 30 35Shoot Freshweight Dry Weight (g) a a a a aba abb a Differential Between Shoot Freshweight and Dry Weight 0 5 10 15 20 25 30 35Shoot Freshweight Dry Weight (g) a a a a aba abb a

PAGE 73

73 and (c) Rhizome biomass of transgenic lines (H1, H2, H3, H4, H6, H7), St. Augustinegrass and wild-type bahiagrass. Table 4-1 Analysis of Gibberellin Conten t (ng/g FW) from Line H1 and Wild-type GA H1 WT GA20 2.23 0.36b 3.20 0.39a GA1 0.70 0.14b 2.80 0.34a GA8 0.13 0.48a 0.23 0.05a GA29 0.73 0.05a 0.10 0.04b *Means across rows followed by the same le tter were not significantly different at P <0.05. [Modified from Agharkar, M., Lomba, P., Altpeter, F., Zhang, H., Kenworthy, K. and Lange, T. (2007) Stable expression of AtGA2ox1 in a low-input turfgrass Paspalum notatum Flugge) reduces bioactive gibberellin levels and improves turf quality under field conditions. Plant Biotechnology Journal (In press)].

PAGE 74

74 CHAPTER 5 SUMMARY AND CONCLUSIONS Bahiagrass, a warm season perennial, is popular as both turf and forage in the southeastern U.S. However, the turf quality of bahiagrass is limited by its open growth habit and prolific production of tall seedheads (Trenho lm et al., 2003). Hence, the goa l of this research was the improvement of turf quality of this low-input grass by the over-expression of a gibberellincatabolizing enzyme, GA 2-oxidase. GA 2-oxidase from Arabidopsis AtGA2ox1 was isolated and sub-cloned under the control of the constitutive ubiquitin promoter. Following biolistic gene transfer of AtGA2ox1 and selectable marker nptII minimal cassettes to 600 pieces of callus, eight independent paromomycin-resistant lines were regenerated. NPTII ELISA assay detected the expression of the selectable marker in all the lines and hen ce confirmed their transgen ic nature. Subsequent analysis using PCR and RT-PCR confirme d the presence and expression of AtGA2ox1 in transgenic lines. Southern blot analysis revealed simple and inde pendent transgene patterns with atleast two transgene copies in the transgenic lines. Northern hybridization further confirmed detectable expression of AtGA2ox1 in seven transgenic lines Although the transformation efficiency obtained in this experiment is lowe r than those previously reported (Altpeter and James, 2005), expression of the selectable mark er was confirmed in all regenerated indicating 100 % selection efficiency, as described by Altp eter and James (2005). In addition, the results are consistent with previous repor ts indicating that the use of minimal cassettes results in simple integration patterns and enhances co-expression fr equencies of co-transferred genes (Fu et al., 2000; Agrawal et al., 2005; review ed by Altpeter et al., 2005). Four transgenic lines were evaluated for growth characteristic s in hydroponics. Under hydroponics, transgenic lines showed reduced tiller and stem length compared to the wild-type.

PAGE 75

75 Most transgenic lines also produced a significantly higher number of tillers compared to the wild-type. The root length of thr ee out of the four transgenic li nes was not signifi cantly different from the wild-type. A transgenic line with barely detectable AtGA2ox1 expression in the Northern analysis was also incl uded in the study. This transgenic line behaved similar to the wild-type in hydroponics thus indi cating that the phenotype exhibite d by the transgenic lines was not likely an effect of tissue culture or gene disruption. Somaclonal variation is less likely to occur in tetraploid bahiagrass due to th e redundancy of the genetic information. The nitrogen requirement of the transgenic lines was evaluated by growing them in a low nitrogen hydroponics solution. A ll transgenic lines and the w ild-type exhibited a stunted phenotype compared to the plants grown in th e full strength hydroponics solution. However, the transgenic lines still had shorte r tillers and stems compared to the wild-type. The number of tillers produced by the transgenic lines was also significantly higher than the wild-type. There was no significant difference in the total biomass of the transgenic lines and the wild-type grown in both, full strength and low nitrogen hydroponi cs solutions indicati ng that the nitrogen requirement of the transgenic lines was not affected by the over-expression of AtGA2ox1 Three transgenic lines produced viable seed s under greenhouse conditions. This is in contrast to reports from Sakamo to et al. (2001) indicating that seed production in rice was compromised by constitutive over-expression of GA 2-oxidase however viable seeds were produced when AtGA2ox1 was constitutively over-e xpressed in tobacco (Biemelt et al., 2004). Seed progeny was grown under greenhouse c onditions and retained the dwarf phenotype. Expression of AtGA2ox1 in the progeny was confirmed by RT-PCR. Drought stress response of transgenic lines wa s evaluated by maintaining transgenic lines and the wild-type under non-watered conditions for 12 weeks. At the end of 12 weeks, the plants

PAGE 76

76 were re-watered and recovery was monitored. Seve ral parameters were used to evaluate drought response: Relative water content, chlorophyll co ntent, maximum quantum yield, electron transfer rate and quantum yield of photosystem II. The res ponse of the transgenic lines was similar to the wild-type for all the physiological measurements i ndicating that the change in plant architecture did not affect the drought tolerance of the tr ansgenic lines. Volumetric water content measurements were made to monitor uniformity of soil moisture as well as the progression of drought stress. In conclusion, over-expression of the AtGA2ox1 in bahiagrass resulted in transgenic plants with reduced height and increased tillering a nd delayed flowering. The drought tolerance of the transgenic lines was not compromised and was si milar to wild-type bahiagrass. The transgenic lines may thus have the potential to produce a denser turf with reduced mowing requirements under field conditions while maintaining the high persistence for which wild-type bahiagrass is known. Further evaluation of these lines under fi eld conditions is in progress and already confirmed the persistence and enhanced turf qu ality of these transgenic bahiagrass lines under mowing (Lomba et al., 2007).

PAGE 77

77 APPENDIX PROTOCOLS FOR MOLECULAR CLONING, TISSUE CULTURE, TRANSFORMATION AND CHARACTERIZATION OF TRAN SGENIC BAHIAGRASS PLANTS Preparation of Electro-competent E.coli 1. Grow over-night DH5 culture in 5ml LB. 2. Inoculate 2 x 250ml LB in 1L flasks with 2ml over-night cu lture. Incubate shaking (220 rpm) at 37 C until OD600 = 0.6-0.8 (Approx 5.5 hours). 3. Pellet cells for 15 min, 4000g at 4 C (Sorvall with GSA rotor, 3x 250ml bottles). 4. Pour off supernatant and resuspend in an equi valent volume of ice-cold sterile water (3x 165ml). Handle cells gently at all times. 5. Centrifuge 15 min, 4000g, 4 C. 6. Pour off supernatant and resuspend in 0.5 vol ume of ice-cold ster ile water (3x 83ml). Divide cell culture between 2 bottles. 7. Centrifuge 15 min, 4000g, 4 C. 8. Pour off supernatant and resuspend in 0.5 vol ume of ice-cold ster ile water (2x 125ml). 9. Centrifuge 15 min, 4000g, 4 C. 10. Pour off supernatant and resuspend in 0.02 vol ume of ice-cold sterile water (2x 5ml). Transfer cell culture to 30ml centrifuge tube. 11. Centrifuge 15 min, 4000g, 4 C (Sorvall, SS-34 rotor). 12. Pour off supernatant and resuspend in 0.02 volum e ice-cold sterile 10 % glycerol (1.2ml). 13. Transfer 40 l aliquots to sterile 1.5ml eppendorf tubes with holes pierced in the lids using a sterile needle. Quick-freeze in liquid nitrogen and store at C. Electroporation of E.coli 1. Chill 0.1cm gap cuvettes (BioRad) on ice. 2. Place DNA for transformation in 1.5ml eppendorf tubes on ice. 3. Thaw required number of 40 l aliquots of electro-competent cells on ice. 4. Set BioRad micropulser to Ec1 (1.8kV, 5msec, 0.1cm gap). 5. Add cells to DNA (upto 10 ng). Leave on ice 1 min. 6. Transfer cells to cuvette. Tap suspension to bottom. 7. Place cuvette in slide and push slide into cham ber ensuring that cuvette is seated between contacts in the base of the chamber. 8. Pulse once by pressing pulse button. Al arm signifies pulse is complete. 9. Remove cuvette and immediately add 360ml SOC medium to the cuvette. Quickly but gently transfer cells to a 2ml tube. Time is critical. 10. Check and record pulse parameters (tim e constant should be close to 5msec). 11. Incubate cells at 37 C shaking (220 rpm) for 1 hour before plating on appropriate antibiotic medium (50 l for circular plasmid, 100-200 l for ligation product).

PAGE 78

78 Preparation of Glycerol Stocks 1. Grow an over-night culture of a colony contai ning the desired plasmid in 2 ml LB broth containing the appropriate an tibiotic at 37C with constant shaking (220 rpm). 2. Sterilize glycerol by autoclav ing (121C, 15psi for 20 min) and cool to room-temperature before use. 3. Working in a clean bench, pipet 850 l of the bacterial cultu re into a sterile microcentrifuge tube. 4. To this, add 150 l of glycerol and mix well by pipeting gently. 5. Store at -80C. 6. Make multiple tubes for each plasmid and avoid successive freeze-thaw cycles. Purification of Plasmid DNA usi ng the QIAprep Miniprep kit 1. Grow over-night cultures each from a single colony of bacteria in 5 ml LB broth containing 50 g/ml kanamycin at 37 C with constant shaking (220 rpm). 2. Add the provided RNase A solution to Buffer P1, mix well by inverti ng and store at 4C. 3. Add 100% ethanol (volume provided on the bottle label) to the Buffer PE concentrate to prepare the working solution. 4. Centrifuge the cultures at 16,100g for 1 min to pellet the bacteria l cells. Remove the supernatant by pipetting and autoclave fo r 60 min (121C, 15psi) before disposing. 5. Resuspend the bacterial cells in 250 l Buffer P1 by vortexing and transfer the suspension to a sterile 1.5 ml microcentrifuge tube. 6. Add 250 l Buffer P2 and mix well by i nverting the tube gently 4-6 times. 7. Add 350 l Buffer P3 and mix immediately but gently by inve rting the tube 4-6 times. 8. Centrifuge the samples at 15,700g for 10 mi n. A compact white pellet will form. 9. Pipet the supernatant onto QIAprep Spin Columns and centrifuge for 1 min at 15,700g. Discard the flow-through. 10. Pipet 750 l Buffer PE onto the columns a nd centrifuge for 1 min at 15,700g to wash the columns. 11. Discard the flow-through and cen trifuge for 1 min at 15,700g to remove all traces of the wash buffer (Buffer PE). 12. Place the QIAprep columns in clean 1.5 ml mi crocentrifuge tubes. Add 50 l Buffer EB to the center of each QIAprep column to el ute DNA. Let stand for 1 min and centrifuge at 15,700g for 1 min. 13. Estimate the DNA concentration using a sp ectrophotometer or by running on a 0.8% agarose gel. 14. Store the samples at -20C. Purification of Plasmid DNA usi ng the QIAGEN Plasmid Midi Kit 1. Inoculate a starter culture from either a single colony or a gly cerol stock of the bacteria in 5 ml LB broth containing 50 g/ml kanamycin. Grow the culture at 37C for 8 hours with constant shaking (220 rpm). 2. Prepare Buffer P1 by adding the provided RN ase A solution, mix well by inverting and store at 4C.

PAGE 79

79 3. Prepare 250 ml flasks containing 25 ml LB br oth, one per midi prep. Sterilize the broth by autoclaving the flasks for 20 mi n. Cool the broth before use. 4. Prepare 50 ml corning tubes (3 per sample ) by autoclaving for 20 min followed by drying at 60C. 5. After cooling add filter-sterilised kanamycin to each flask to get a final concentration of 50 g/ml kanamycin (25 l) in a clean bench. Add 250 l of the actively growing starter culture to each flask (1:1000 dilution) and in cubate for 16 hr at 37C with constant vigorous shaking. 6. Transfer each culture to a ster ile 50 ml corning tube and centrifuge at 6000g for 15 min at 4C. 7. Place Buffer P3 in ice. 8. Resuspend the bacterial pellet in 4 ml Buffer P1 by vortexing the samples until no clumps are visible. 9. Add 4 ml Buffer P2 and mix well by gently i nverting 4-6 times. Incubate the samples at room temperature for 5 min. 10. Add 4 ml of chilled Buffer P3 and mix imme diately but gently by inverting the tube 4-6 times. Incubate the samples in ice for 20 min. 11. Centrifuge at 20,000g for 30 min at 4C. Immedi ately transfer the supernatant to a new tube by pipetting. 12. Centrifuge the supernatant again at 20,000g for 15 min at 4C. Transfer the supernatant to a new tube by pipetting immediately. 13. Apply 4 ml Buffer QBT to a QIAGEN-tip 100 for equilibration and allow the column to empty by gravity flow. 14. Apply the supernatant from Step 12 immediatel y to the equilibrated tip and allow it to enter the resin by gravity flow. 15. After all the liquid has entered the column wash the QIAGEN-tip 2x with 10 ml Buffer QC. 16. Add 5 ml Buffer QF to the column to elute th e DNA. Collect the eluate in a sterile 50 ml tube. 17. Add 3.5 ml (0.7 volumes) room-temperature is opropanol to the eluted DNA to precipitate it. Mix well and centrifuge immediately at 15,000g for 30 min at 4C. Carefully decant the supernatant taking care not to disturb the pellet. 18. Wash the DNA pellet with 2 ml room-tempera ture ethanol and centrifuge at 15,000g for 10 min. Remove the supe rnatant by pipetting. 19. Air-dry the pellet by inverting the tu be on absorbent paper for 5-10 min. 20. Add 200 l TE to the tube and rinse the wall s of the tube thoroughly to resuspend the DNA. 21. Leave resuspending over-night at 4C. Transfer to a sterile microcentr ifuge tube, estimate concentration and store at -20C. Gel Extraction using the QIAquick Gel Extraction kit 1. Prepare Buffer PE by adding 40 ml 100% ethanol to the provided concentrate. 2. Excise the DNA fragment precisely from the agarose gel using a cl ean sharp scalpel. Avoid excess agarose. 3. Weigh the gel slice in a colorless sterile micr ocentrifuge tube. Restrict the volume of gel in each tube to 400 mg or less.

PAGE 80

80 4. Add 3 volumes of Buffer QG to 1 volume of gel. 5. Incubate at 50C in a heating block for 10 mi n or until the gel has completely dissolve. Vortex every 2 min during incubation to ensure complete dissolution of gel. 6. Following incubation check that the color of the mixture remains similar to Buffer QG (yellow), indicating that the pH has not changed. 7. Add 1 gel volume of isopropanol to the mixt ure and mix by inverting the tube several times. 8. Place a QIAquick spin column in a provided 2 ml collection tube and apply the sample to the column. Centrifuge at 16,100g for 1 min. Re peat this step if the volume of the mixture is more than 800 l, the maxi mum capacity of the QIAquick column. 9. Discard the flow-through and place the co lumn in the same collection tube. 10. Wash the QIAquick column by adding 750 l Buffer PE to the column and centrifuging for 1 min at 15,700g. 11. Discard the flow-through, place the column back in the same collection tube and spin for an additional 1 min at 15,700g to remove residual ethanol from Buffer PE. 12. Place the QIAquick column in a clean, sterile 1.5 ml microcentrifuge tube. 13. Add 30 l Buffer EB (10 mM Tris-Cl, pH 8.5) to the center of the QIAquick membrane to elute DNA, let stand for 1 min a nd then centrifuge for 1 min at 15,700g. 14. Store DNA at -20C. Sterilization of Bahiagrass Seeds (Modified from Smith et al., 2002) 1. Sort out good seeds. Remove any seeds that are broken or have a black fungus (check both sides). Put the selected seeds into a 15 ml tube until it is 1/3 full (approximately 500 seeds). 2. Fill 3-4 1 litre beakers w ith de-ionised water (DI H2O). Also collect an empty beaker, a glass rod and two 2-ply squares of cheesecloth for each tube. 3. In the fume hood add concentrated sulphuric acid until the tube is full and shake well to mix. 4. Leave the tube standing for 16 minutes. 5. Transfer the seeds from the tube to the empty beaker using 500 ml DI H2O. Stir the mixture with the glass rod to mix. 6. Pour off the liquid and floa ting debris. Add 500 ml DI H2O to the seeds and strain them through one piece of cheesecloth. 7. Gently rub the seeds in the cloth to rem ove the blackened seed-coat. Remove excess water from the seeds and wash them off the cloth into an empty beaker using 500 ml DI H2O. 8. Repeat 2x, using a new piece of cheesecloth for the third wash. 9. Leave the seeds in the cheesecloth after the third wash and allow to dry partially for 20 min. 10. Transfer seeds to a Petri-dish. 11. Fill a small beaker with 20 ml Clorox bleach (6% sodium hypochlorite) and 10 ml glacial acetic acid. Place the mixture in the bottom of a glass dessicator in the fume hood. 12. Place open Petri-dishes of seeds and lid in the dessicator. Leave for one hour. The chlorine fumes from the mixture ster ilize the seeds and the Petri-dishes.

PAGE 81

81 13. Add a small volume (enough to submerge the seeds) of autoclaved dH2O, seal the plate and leave soaking for at least one hour. Tissue Culture and Transformati on of Argentine Bahiagrass (Altpeter and James, 2005) 1. Sterilise mature seeds of Argentine bahiagrass according to the protocol described above. 2. Following sterilisation, transfer the seeds to callus induction medium (IF), 20 seeds per plate. 3. Incubate at 28C in the dark to produce callus. 4. Maintain the cultures on the callus induction me dium for six weeks, transferring to fresh medium every two weeks. 5. Transfer the callus to fresh medium at the e nd of the sixth week and use for bombardment within one week. 6. On the day of the bombardment transfer the callus to IF medium containing 0.4M sorbitol (0.4M IF) for osmotic treatment. Arrange the ca llus in the center of th e dish to fill an area equivalent to that of a circle with 2.5 cm diameter. 7. The osmotic treatment should last for atleast four hours but not more than six hours. 8. After four hours of osmotic treatment, use the callus for biolistic gene transfer as described below. 9. Keep bombarded callus on the osmotic medium for 4-16 hours after bombardment. 10. Transfer the callus to callus induction medium (IF) and in cubate in the dark at 28C for 10 days for recovery from medium. 11. Transfer the callus to selection medium containing 50 mg/l paromomycin (IFP50) and incubate in the dark at 28C for two weeks. Keep track of individua l pieces of callus to facilitate identification of i ndependent transformation events. 12. Transfer callus to fresh IFP50 and continue incubation in the dark for one week. Move the plates to incubator wi th low light intensity (30 Em-2s-1 light) at 28C and incubate for one week in preparation for regeneration. Keep track of indivi dual pieces of callus. 13. Transfer the callus to regeneration medi um containing 50 mg/l paromomycin (IFRP50) and incubate under high light intensity (150 Em-2s-1 light) at 28C for two weeks. Keep track of individual pieces of callus. 14. Transfer pieces of callus w ith shoots to media in deep Petri-dishes containing no hormones and with 50 mg/l paromomycin (NHP50) always keeping tr ack of individual pieces of callus. Incubate under high light intensity (150 Em-2s-1 light) at 28C for two weeks. 15. Transfer pieces of callus with no visible shoots to fresh IFRP50 medium and continue incubation as before for two weeks. Proceed to transfer all shoot s to NHP50 medium as described above. Discard any pieces of callus that do not produce shoots. 16. At the end of two weeks, select healthy pl antlets with roots th at penetrate the NHP50 medium and transfer to small pots containing Farfard No. 2 soil. Cover with magenta box to help acclimatization and transfer to growth (400 mEm-2S-1 light intensity, 16/8 h light/dark, and 28C / 20C day/night temperatures). 17. Remove the magenta boxes one week after transfer to soil.

PAGE 82

82 18. After the plants have established in soil (2-4 w eeks after transfer to soil), transfer them to 6-inch pots containing Fafard No. 2 soil a nd move to the greenhouse for faster growth (14/10 h light/dark, 30C / 25 C day/night temperatures). 19. Small or weak plantlets can be transferred to fresh NHP50 medium and maintained for an additional two weeks, giving them enough time to elongate. Note: Always make medium containing paromomycin fr esh a few days before transfer to prevent degradation of paromomycin. Medium can be stored for up to a week before use. Biolistic Gene Transfer 1. Autoclave macrocarrier holders, macrocarri ers and stopping screen s and lay out in a clean bench to dry. 2. Sterilize 1100 psi rupture discs by dipping briefly in absolute (200 proof) ethanol followed by drying in the clean bench. 3. Place all the sterile components in Petr i dishes and seal using parafilm. 4. Clean the gun and flow hood thoroughly using 70% ethanol half an hour before use and allow to dry. 5. To prepare the gold for bombardment (25 shots), mix 30 l 0.75 m gold, 30 l 1 m gold and 60 l DNA in a sterile 1.5 ml microcen trifuge tube by vortexing 1 min. 6. Add 40 l 0.1M spermidine and 100 l 2.5M CaCl2 while vortexing. 7. Continue vortexing for 1 min to ensure mixing of all components. 8. Centrifuge (5,900g ) for a few seconds to sett le the gold and remove the supernatant. 9. Add 500 l Absolute (200 proof) ethanol and vortex to resuspend and wash the settled gold. 10. Centrifuge (5,900g) for a few seconds and remove the supernatant. 11. Add 180 l Absolute (200 proof) ethanol to the gold and resuspend by sonication (Branson 2200, Branson Ultrasonics, Danbury, CT USA) for 2 s. Vortex before use for bombardment. 12. Pipet 5 l of this suspension per microcarrier to deliver 100 g gold per bombardment and allow ethanol to evaporate completely. 13. For the bombardment, turn on the gun, vacuum pump and helium and place the macrocarriers into macrocarrier holders. 14. Place rupture disc into holder and fix securely in place. 15. Place stopping screen into shelf assembly and put inverted macrocarrier assembly on top. Place macrocarrier assembly at the highest level in the gun chamber. 16. Place the open tissue culture plate two shelves below macrocarrier assembly. 17. Close door and apply vacuum of 28 in Hg. 18. Press fire button and check pre ssure gauge to confirm that th e disc ruptures at 1100 psi. 19. Vent the vacuum, remove the tissue culture plate and cover with lid. 20. Dismantle assembly and prepare for the next shot. Use the same stopping screen for upto 10 shots.

PAGE 83

83 NPTII ELISA Assay 1. Dilute the PEB1 buffer concentr ate (10x) to 1x using sterile ddH2O. Prepare enough to use 600 l per sample. 2. Harvest 3 eppendorf lengths of leaf, always choosing the youngest fully expanded leaf. Store samples on ice. 3. Add 10 mg polyvinyl pyrrolidone (PVP) and 600 l PEB1 buffer to each sample. Grind the leaf materials using a sterile blue micr opestle. Keep the samples on ice. 4. Centrifuge the samples at 20,817g at 4C for 15 min. Transfer the s upernatant to a new microcentrifuge tube by pi petting and store on ice. 5. If the samples still contain leaf debris, centrifuge again. 6. Turn on spectrophotometer half an hour before use. 7. Dilute Protein Determination Reagent (USB Corporation, product code 30098) 1:5 using sterile ddH2O. Prepare enough to use 1 ml per sa mple including standards and blank. 8. Prepare a dilution series using BSA for use as standards (0 g, 2.5 g, 5 g, 10 g, 15 g, 20 g). 9. Add 1 ml diluted Protein Determination Reagen t to each cuvette. Add 10 l of sample to each cuvette and mix by pipetting. 10. To ensure complete mixing, immediately i nvert the cuvette covered with a piece of parafilm. Leave to incubate at room-temperature while preparing the remaining samples. Use a new piece of parafilm for each sample to prevent contamination. 11. Measure OD595 of each sample (ideally these should be between 0.2 and 0.8). 12. Plot a standard curve using BSA and use it to estimate protein concentration of the samples. 13. Calculate the volume of each sample required to apply 15 g per well. 14. Prepare the samples, including wild-type, in new tubes using 15 g protein and the volume of buffer PEB1 required to make the total volume 110 l. 15. Prepare standards as follows: 110 l buffer PEB1 (negative control) and 110 l of the provided positive control. Keep all prepared samples on ice. 16. Prepare a humid box by putting some damp paper towel in a box with a lid. 17. Add 100 l of each prepared samples into th e test wells, making note of the sequence in which the samples were applied. Also a dd 100 l of the prepared standards. 18. Place the plate in the humid box and incubate for 2 hours at room temperature. 19. Prepare the wash buffer PBST by dilu ting 5 ml to 100 ml (20x) with ddH2O. 20. Prepare the enzyme conjugate diluent by mi xing 1 part MRS-2 with 4 parts 1x buffer PBST. Make enough to add 100 l per well. 21. A few minutes before the incubation ends, add 10 l from bottle A and 10 l from bottle B per 1 ml of enzyme conjugate dilu ent to prepare the enzyme conjugate. 22. When incubation is complete, remove plate from humid box and empty wells. 23. Fill all wells with 1x buffer PBST and then empty them again. Repeat 5x. 24. After washing tap the frame firmly upsid e down on paper towels to dry the wells. 25. Add 100 l of prepared enzyme conjugate into each well. 26. Place the plate in the humid box and incubate for 2 hours at room temperature. 27. Measure out sufficient TMB substrate solution for 100 l per well into a clean container. Allow to warm to room temper ature during the 2 hour incubation. 28. When the incubation is complete, wash th e plate with 1x buffer PBST as before.

PAGE 84

84 29. Add 100 l of room temperature TMB substrat e solution to each well and place the plate in the humid box for 15 min. 30. Add 50 l 3M sulphuric acid (stop solution) to each well. The substrate color will change from blue to yellow. 31. The results must be recorded within 15 min after addition of the stop solution otherwise the reading will decline. 32. Color development can be visually scored or recorded with the help of a plate reader. Isolation of DNA using Mini Dellaporta Method (Dellporta et al., 1983) 1. Harvest young leaf material approximately e quivalent to one lengt h of a 1.5 ml eppendorf tube. 2. Add -mercaptoethanol to Buffer D im mediately before use (0.72 l -mercaptoethanol per ml buffer D). 3. Add 300 l buffer D and grind with a sterile blue micropestle until buffer is green. 4. Add 20 l 20% SDS. Vortex. 5. Incubate at 65C for 10 min in a heating block. 6. Add 100 l 5M potassium acetate. Mix well by inverting the tube several times. 7. Incubate on ice for 20 min. 8. Centrifuge at 16,100g for 20 min. Transfer s upernatant to fresh 1.5 ml eppendorf tube. 9. Centrifuge again at 16,100g for 10 min to ensure complete removal of all debris. Transfer the supernatant to a fresh 1.5 ml eppendorf tube. 10. Add 450 l isopropanol and mix by gently inverting the tubes several times. 11. Incubate at -20C for 1 hour or over-night. 12. Centrifuge samples at 16,100g for 15 min. Pour off supernatant. 13. Air-dry pellet until no water droplets are visibl e on the sides of the tube (15-20 min) and resuspend in 100 l TE. 14. Add 10 l 3M sodium acetate plus 220 l 100% ethanol to precipitate the DNA. 15. Centrifuge the samples at 16,100g for 10 min. Pour off supernatant. 16. Wash the pellet with 500 l 70% ethanol. 17. Centrifuge at 16,100g for 10 min. Remove the supernatant by pipetting. 18. Air-dry the pellet for 10 min and resuspend in 150l TE. 19. Store samples at -20C. 20. Use 1 l DNA(80-100 ng) in PCR reactions. Basic PCR Set-up using the HotStarTaq DNA Polymerase (Qiagen) 1. Determine the number of samples to be used for PCR analysis. Also include the wildtype, negative control (reaction with all co mponents but no template) and positive control (reaction containing the plasmid as template). 2. Prepare a master-mix for all the samples together as follows: 10x Buffer 2.50 l 5x Q solution 5.00 l 50x dNTP mix 0.50 l 50x MgCl2 0.50 l

PAGE 85

85 10 M Forward primer 1.00 l 10 M Reverse primer 1.00 l HotStarTaq 0.15 l Sterile ddH2O 13.35 l Final volume 24.00 l 3. Label the tubes for PCR and dispense 24 l of the master mix into each tube. 4. Add 1 l DNA to the samples (80-100 ng), 1 l sterile ddH2O to the negative control and 1 l plasmid (100pg/l) to the positive contro l. Mix well by pipetting, spin briefly and start the PCR program. Note: Remember to start the PCR program with 15 min at 95C to activate the HotStarTaq polymerase. Isolation of Total RNA using the RNeasy Plant Mini Kit (Qiagen) 1. Harvest 100 mg young leaves and freeze immediately using liquid nitrogen. 2. Add 10 l -mercaptoethanol per 1 ml Buffer RLT immediately before use. 3. Add 44 ml of 100% ethanol to the RPE buf fer concentrate to prepare the working solution. 4. Grind the sample to a fine powder using a sterile (autoclaved for 30 min) mortar and pestle. Transfer the ground sample to a sterile, liquid-nitrogen cooled 2 ml microcentrifuge tube. 5. Add 450 l prepared Buffer RLT to the powder and vortex vigorously. 6. Pipet the lysate onto a QIAshredder spin co lumn placed in a 2 ml collection tube and centrifuge for 2 min at 16,100g in a bench-top ce ntrifuge. Transfer the supernatant of the flow-through to a new sterile microcentrifuge tu be taking care not to disturb the pellet of cell-debris. Estimate the approxima te volume of the supernatant. 7. Add 0.5 volume (225 l) ethanol (200 proof) to the collected supernatant and mix immediately by pipetting. 8. Immediately transfer sample, including any precipitate formed, to an RNeasy mini column placed in a 2 ml collection tube. Close the tube gently and centrifuge for 15s at 9,300g. Discard the flow-through solution. 9. Perform DNase treatment using th e RNase-Free DNase Set (Qiagen). 10. Transfer the RNeasy column to a new 2 ml co llection tube. Wash th e column by pipetting 500 l Buffer RPE onto it and centrifuging for 15 s at 9,300g. Discard the flow-through solution. 11. To dry the RNeasy silica-gel membrane, pipe tte another 500 l of Buffer RPE onto the column and centrifuge for 2 min at 9,300g. Discard the flow-through solution. 12. Transfer the column to a new sterile 1.5 ml co llection tube supplied with the kit. To elute RNA, pipet 30 l RNase-free water directly onto the RNeasy silica membrane in the center of the column. Close the tube gen tly and centrifuge for 1 min at 9,300g. 13. Estimate concentration using the Nanodrop sp ectrophotometer (see below) and use 1g RNA immediately to prepare cDNA. 14. Store remaining RNA at -80C.

PAGE 86

86 DNase Treatment using the RNase-Free DNase Set (Qiagen) 1. Dissolve the solid DNase I (1500 Kunitz units ) in 550 l of the provided RNase-free water to prepare the DNase I stock solution. Mix gently by inverti ng the vial. Store the solution at -20C. 2. Wash the RNeasy column by pipetting 350 l Buffer RW1 onto the column and centrifuging for 15 s at 9 ,300g. Discard the flow-through. 3. Add 10 l DNase I stock solution to 70 l Buffer RDD for each sample and mix by inverting gently. 4. Pipet the 80 l DNase I mixture onto the RN easy silica-gel membrane and incubate at room temperature for 15 min. 5. Wash the RNeasy column again using 350 l Buffer RW1 and centrifuge for 15 s at 9,300g. 6. Continue with step 10 of the total RNA isolation protocol. Using the Nanodrop Spectrophotometer 1. Install the operating software on a PC. 2. Pipet a drop of water on the upper and lowe r pedestals and wipe off using a soft laboratory wipe to clean the pedestals. 3. Pipet 1 l water on the lower pedestal, clos e the sampling arm, initialize the instrument using the operating software and then set the blank. 4. Open the sampling arm and wipe the pedestals using a laboratory wipe. 5. With the sampling arm open, pipet 1 l sample onto the lower pedestal. 6. Close the sampling arm and initiate the measurement using the operating software. 7. On completion of the measurement, open the sampling arm and wipe the sample from both the upper and lower pedestals using a laboratory wipe. 8. Repeat from step 5 for subsequent samples. 9. Clean the pedestals as described in step 2 after completion of all measurements. cDNA Synthesis using the iScrip t cDNA Synthesis Kit (Bio-Rad) 1. Estimate the volume of each sample required to get 1 g RNA. 2. Set up the reaction as follows: 5x iScript Reaction Mixture 4 l iScript Reverse Transcriptase 1 l Nuclease-free water x l RNA template (1 g RNA) x l Final volume 20 l 3. Use the following cycling conditions: 5 min at 25C 30 min at 42C 5 min at 85C Hold at 4C 4. Store the cDNA at 4C. 5. Use 2 l of the reaction for RT-PCR analysis.

PAGE 87

87 Basic RT-PCR Set-up using the HotStarTaq DNA Polymerase (Qiagen) 1. Determine the number of samples to be used for RT-PCR analysis. Also include the wildtype, negative control (reaction with all co mponents but no template) and positive control (reaction containing the plasmid as template). 2. Prepare a master-mix for all the samples together as follows: 10x Buffer 2.50 l 5x Q solution 5.00 l 50x dNTP mix 0.50 l 50x MgCl2 0.50 l 10 M Forward primer 1.00 l 10 M Reverse primer 1.00 l HotStarTaq 0.15 l Sterile ddH2O 12.35 l Final volume 23.00 l 3. Label the tubes for RT-PCR and dispense 23 l of the master mix into each tube. 4. Add 2 l of cDNA to the samples, 2 l of sterile ddH2O to the negative control and 2 l of plasmid (50 pg/l) to the pos itive control. Mix well by pipe tting, spin briefly and start the PCR program. Note: Remember to start the PCR program with 15 min at 95C to activate the HotStarTaq polymerase. Large-scale Isolation of DNA using the CTAB method (Saghai-Maroof et al., 1984). 1. Sterilize mortar, pestles and spatulas by auto claving for 20 min and drying in 60 C oven. 2. Pipet 15 ml of CTAB buffer (5 ml/gram leaf material) into 50 ml sterile disposable polypropylene tubes, one for each sample. Add 30 l -mercaptoethanol to each tube and mix well. Heat to 65C in a water bath. 3. Harvest 3 g young leaf material and stor e on ice or freeze in liquid nitrogen. 4. Cool mortar and pestle by adding liquid ni trogen. Cut fresh leaf into small pieces in liquid nitrogen using scissors a nd then grind to a fine powder. 5. Add the frozen leaf powder to the pre-heated buffer and mix well to remove lumps using a spatula or glass rod. 6. Incubate at 65 C for 1 hour. Mix the conten ts 2-3 times during the incubation by gentle inversion of the tubes. C ool to room temperature. 7. Add equal volume (15 ml) chloroform/isoamyl alcohol (24:1) and mi x gently by gently inverting the tubes. Then place on an orbital shaker (AdamsTM Nutator Mixer (120V)) with gentle mixing for 30 min to form an emulsion. Mix samples by gently inverting the tubes half-way th rough the incubation. 8. Centrifuge at 3,220g for 1 mi n. Discard lower layer. 9. Centrifuge at 3,220g for 10 min. Transfer the top layer to a new sterile 50 ml tube. 10. Add 2/3 volumes (10 ml) isopropanol and mix gently by inverting.

PAGE 88

88 11. Use a sterile blue pipette tip to hold the s pool of DNA and pour away the liquid. Transfer the DNA to a sterile 2 ml microcentrifuge tube. 12. Wash the DNA 2x in 70% ethanol, while holding the DNA inside the tube with a sterile pipette tip. 13. Centrifuge at 18,506g for 1 min and remove the supernatant. 14. Air-dry the pellet for 15 min in a clean bench and resuspend in 500 l TE. 15. Add 2 l RNase A (30 mg/ml) and incubate at 60C over-night. 16. Add 300 l phenol/chloroform (25:24:1 Phenol :Chloroform:Isoamylalcohol) and mix by inverting and tapping to form an emulsion. 17. Centrifuge at 18,506g for 5 min at 4C. Remove the top layer and transfer to a new sterile 2 ml microcentrifuge tube. 18. Repeat the phenol/chloroform extraction. 19. Add 300 l chloroform/isoamylalcohol (24: 1) and mix well to form an emulsion. 20. Centrifuge at 18,506g for 5 min at 4C. Remove the top layer and transfer to a new sterile 2 ml microcentrifuge tube. 21. Repeat the chloroform extraction. 22. Add 1/10 volume (50 l) 3M sodium acetat e and 2 volumes (1 ml) 100% ethanol. 23. Spin for 1 min at 18,506g and remo ve the supernatant by pipetting. 24. Wash 2x in 70% ethanol. After the first wa sh pour off the supernatant and after the second wash spin for 1 min at 18,506g and remove supernatant by pipetting. This allows faster drying of the DNA pellet. 25. Dry the pellet for 15-25 min (depending on the size of the pellet) in a vacuum rotatory evaporator (Speed-Vac). Do not over-dry the pellet as this may compromise the solubility of the DNA. 26. Resuspend in 200 l T1/10E. Incubate at 60C over-night to help resuspension. 27. Make 10x dilutions for all samples. Use th ese samples to estimate DNA concentration using the Nanodrop spectrophotometer and by 1 l running on a 0.8% agarose gel (80V, 60 min). 28. Store the dilutions and stocks at 4C. Isolation of Total RNA usi ng the TRI REAGENT (Sigma) 1. Treat mortars and pestles, spatulas and 2 ml microcentrifuge tube s over-night with diethyl pyrocarbonate (DEPC) by subm erging in double-distilled water (ddH2O) containing 1 ml DEPC (Sigma) per liter of ddH2O. 2. Following treatment, transfer DE PC containing water to autoclavable containers. Sterilize mortars, pestles, spatulas and microcentrif uge tubes by autoclaving for 20 mins followed by drying at 60C. DEPC containing water should also be au toclaved to ensure complete degradation of DEPC. 3. Harvest 300 mg of young leaf tissu e and freeze using liquid nitrogen. 4. Cool the mortar and pestle using liquid ni trogen. Grind the tissue to a fine powder and transfer to a cooled 2 ml microcentr ifuge tube using a cooled spatula. 5. Add 1.5 ml TRI REAGENT to the tissue pow der and vortex to ensure proper mixing. 6. Centrifuge the mixture at 12,000g for 10 min at 4C. Transfer the supernatant to a new 2 ml microcentrifuge tube.

PAGE 89

89 7. Allow the samples to stand for 5 min at room temperature to ensure complete dissociation of nucleoprotein complexes. 8. Add 0.3 ml chloroform (0.2 ml chloroform per ml of TRI REAGENT used), close the tubes and shake vigorously for 15 s. Allow the sample to stand for 15 min at room temperature. 9. Centrifuge the samples at 12,000g for 15 min at 4C. Transfer the supernatant to a new 2 ml microcentrifuge tube. 10. Add equal volume of chloroform to the samples, mix vigorously for 15 s and allow to stand for 10 min at room temperature. 11. Centrifuge the samples at 12,000g for 15 min at 4C. Transfer the supernatant to a new 2 ml centrifuge tube. 12. Add 0.75 ml isopropanol (0.5 ml isopropanol per ml of TRI REAGE NT used) to the samples. Mix by inverting the tube several times. 13. Incubate the samples at room temperature for 8 min. Centrifuge at 12,000g for 10 min at 4C. RNA forms a pellet on the bottom of th e tube. Discard the supernatant by decanting. 14. Prepare 75% ethanol (3 ml per sample) using 200 proof et hanol and DEPC-treated sterile ddH2O. 15. Wash the RNA pellet with 1.5 ml 75% ethano l. Vortex the samples and centrifuge at 11,000g for 5 min at 4C. Do not use high speed s for centrifuging as this may result in shearing of the RNA. 16. Remove the ethanol using a pipette. Repeat the wash. 17. Air-dry the pellet for 5-10 min in a clean bench. Take care not to over-dry the pellet as this will compromise its solubility. 18. Add 30 l sterile, DEPC-treated ddH2O and incubate at 55C for 15 min. Mix 2-3 times during incubation using a pipette. 19. Prepare 10x dilutions for all samples and use the dilutions to estimate RNA concentration using the Nanodrop spectrophotometer. 20. Store the RNA samples at -80C. Southern Blotting (A lkaline Transfer) 1. Extract genomic DNA from tran sgenic lines as well as wild -type using the CTAB method as described above. 2. Following quantification, digest 1 g DNA from all samples with th e restriction enzyme to be used for Southern blotting. Run the digested DNA on a 1% ag arose gel to ensure complete restriction digestion. 3. Use 15 g DNA to set up restriction digests for Southern blotting. First, estimate the volume of each sample required to get 15 g DNA and pipet it into a sterile 1.5 ml microcentrifuge tube. Add sterile ddH2O to make up the volume to 30 l. 4. Set up the digestion as follows: DNA (15 g DNA + sterile ddH2O) 30.0 l 10x Bam HI buffer 6.0 l 100x BSA 0.6 l Bam HI (1000U/l) 2.0 l Sterile ddH2O 21.4 l Final volume 60.0 l

PAGE 90

90 5. To avoid excessive pipetting, make a master mi x for all samples that includes the buffer, BSA (if required for the enzyme chosen), enzyme and water. Mix well and add 30 l DNA. Mix well, centrifuge for a few seconds a nd incubate in a wate r-bath at 37C overnight. 6. Run 2 l from each digest on a 1% agarose gel to ensure complete digestion. 7. Prepare a 1 cm thick 1% agarose gel for Sout hern blotting using 1x TAE. Concentrate all the digests to reduce the volume by half (30 l) in a Speed-Vac. 8. Centrifuge the samples briefly and add 6 l 6x loading dye. Mix well by pipetting and load samples on the gel. Also load a molecu lar weight marker for estimating band size following hybridization. 9. Dilute the plasmid containing the transgene and load 50 pg on the gel for use as a positive control. 10. Run the gel at 20V over-night (12-14 hours) in 1x TAE. 11. Remove the gel from the electrophoresis unit and place on a piece of plexiglass. Use a clean scalpel blade to cut excess gel. Remove any unused portions of the gel and measure the dimensions of the gel. 12. Stain the gel for one hour using freshl y prepared ethidium bromide stain. 13. Wash the gel five times using de-ionized water (DI H2O). 14. Visualize the gel on a Gel-documentation system to check equal loading of all samples. Also measure and record the distance of the bands of the molecular weight marker from the top of the gel. 15. Prepare 500 ml 0.25N hydrochlor ic acid (HCl) and 3 L 0.4N sodium hydroxide (NaOH) solution. 16. Treat the gel with 0.25N HCl on a shaker with gentle shaking for 15 min for depurination. Wash the gel three times with DI H2O. 17. Cut three pieces of filter paper to match the size of the gel and two pieces for the bridge. Also cut a piece of the Hybond-N+ membrane (Amersham) to match the size of the gel. 18. Treat the gel with 0.4N NaOH on a shak er with gentle shaking for 30 min. 19. Cover the bench with Saran wrap or bench coat to prevent damage due to the NaOH solution. 20. Assemble the tray and the platform on which the blot is to be set up. Place the filter paper bridges on top of each other on the platform and fold them so that they dip into the tray on both sides. 21. Pour 0.4N NaOH on the bridge to wet it complete ly. Roll a disposable pipette or glass rod over it several times to remove air bubbl es. Pour more NaOH onto the bridge. 22. Place the gel in the center of the bridge, pour NaOH over it and remove air-bubbles. 23. Mark the membrane to determine the or ientation of the gel following blotting. 24. Wet the membrane using 0.4N NaOH, place the membrane on the gel, pour NaOH onto it and remove air bubbles. 25. Place three pieces of Whatmann filter paper on the membrane, remembering to remove air bubbles after placing each pi ece. Pour more NaOH over the top to avoid drying of the filter papers. 26. Place pieces of parafilm all around the gel to cover the br idge to ensure that the movement of the transfer buffer (0.4N NaOH) takes place only through the gel. 27. Fill the tray with the transfer buffer to the top and cover the tray with Saran wrap to prevent evaporation of th e buffer during blotting.

PAGE 91

91 28. Place a stack of absorbent paper towels on the gel and place another piece of plexi-glass on top. On this, place a small weight to ensu re uniform blotting and leave over-night (1618 hours). 29. Disassemble the blot and expose the membra ne to UV for 2 min to fix the DNA on the membrane. Wrap the membrane in Saran Wra p, place in a zip-loc bag and store at 4C. 30. Visualize the gel using a gel-documentation system to make sure the transfer was complete. 31. Follow the hybridization pr otocol described below. Northern Blotting 1. Extract total RNA from transgenic lines as well as wild-type using the TRI REAGENT as described above. 2. Prepare 4 L DEPC-treated ddH2O as described above. Use this water to prepare all buffers. Treat the electrophores is unit, gel box and comb w ith RNaseZAP (Sigma) and rinse several times with DEPC-treated ddH2O. Place in a fume hood. 3. For a 1.2% gel, boil 9.6 g agaros e in 696 ml DEPC-treated ddH2O. Place the mixture in a 60C water-bath. 4. Once the gel has cooled to 60C, add 24 ml 37% formaldehyde and 80 ml 10x MOPS running buffer. Mix well and replace in the wa ter-bath until the gel apparatus is ready. (Formaldehyde is toxic and shoul d be handled in a fume hood). 5. Pour the gel in the fume hood and allow to set for 45-60 min. Once the gel is ready, carefully remove the comb, pl ace it in the electrophoresis unit and fill the unit with 1x MOPS running buffer. 6. Prepare the following pre-mix for each sample: 10x MOPS running buffer 5.00 l 37% formaldehyde 8.75 l Formamide 25.00 l Total volume 38.75 l Dispense pre-mix into individual tubes for each sample. 7. Estimate the volume of each sample (maximum volume 11.25 l) required to get 10 g total RNA and add it to the pre-mix. Add DEPC-treated ddH2O to make up the volume to 50 l. 8. Mix the samples thoroughly by vortexing, centrif uge for a few seconds and incubate at 55C for 15 min. 9. Add 10 l formaldehyde loading dye to each sample and mix by vortexing. Centrifuge the samples briefly and load the sample on the gel. 10. Run the gel at a constant voltage of 125V for 2 hours 30 min in the fume hood. 11. Working in the fume hood, remove any unused portions of the gel w ith a clean scalpel and place it in a tray tr eated with RNaseZAP. 12. Rinse the gel at least five times with DEPC-treated ddH2O to remove the formaldehyde. Measure the dimensions of the gel. 13. Add 500 ml 10x SSC in the tray containing th e gel and place on a shaker for 45 min with gentle shaking. 14. Cut two pieces of Whatmann filter paper to make the bridge and three pieces to match the size of the gel. Also cut a piece of the HybondN+ membrane to match the dimensions of the gel.

PAGE 92

92 15. Place the membrane in a tray containing DEPC-treated ddH2O for 1 min and then transfer to 20x SSC for 10 min. 16. Treat the platform and tray to be used for blotting with RNaseZAP. 17. Assemble the blot as described above for S outhern Blotting using 20x SSC as the transfer buffer. Allow the transfer to proceed for 18-20 hours. 18. Disassemble the blot, wrap the membrane in Saran wrap and expose it to UV for 2 min. 19. Place in a zip-loc bag and store at 4C. 20. Follow the hybridization prot ocol described below. Hybridization using the Prime-aGene Labeling System (Promega) 1. Thaw blocking DNA (sheared salmon sperm DNA), labelling buffer, dNTPs (dATP, dGTP, dTTP), BSA and probe on ice. Place [ -32P] dCTP behind the plexiglass shield to thaw. 2. Pre-heat the hybridization oven and water-bath to 65C. Place the hybridization buffer in the water-bath. 3. Wrap nylon tape around the mouth of the hybridization tubes to prevent leaks. 4. Place the membrane inside the hybridization tu be. Add 50 ml 5x SSC to the tube and prewet the membrane for 5-10 min. Make sure that the seal around the lid is complete and there are no leaks. 5. Estimate the volume of probe required to get 25 ng of the probe and pipet it into a clean microcentrifuge tube with a lid. Make up the volume to 30 l using the nuclease-free water provided in the labelling kit. 6. Close the tube tightly and boil the probe for 5 min. Also boil 500 l of salmon sperm DNA in a separate tube. Place on ice for 5 min immediately after boiling. 7. Discard the 5x SSC into the sink and invert the hybridization tube s on a paper tissue to drain. 8. Prepare the dNTP mix by mi xing equal parts of dTTP, dA TP and dGTP. Prepare enough to use 2 l per labelling reaction. 9. Set up the labelling reaction as follows: Add the following to the denatured probe5x labelling buffer 10 l Unlabeled dNTP mix 2 l BSA 2 l Klenow (5U/l) 1 l Total volume 45 l 10. Move the mixture behind the plexiglass shield; add 5 l [ -32P] dCTP and mix well by pipetting. Final volume of the reaction is 50 l. 11. Incubate the mixture behind the plexiglass shield at room-tempe rature for 4 hours. 12. Replace the contents of the k it and the isotope at -20C. 13. For pre-hybridization, add 15 ml pre-heated (65C) hybr idization buffer and 500 l denatured salmon sperm DNA in the hybridization tube. 14. Replace the lid; ensure that there are no leak s and place the tubes in the hybridization oven. Incubate at 65C for 4 hours. 15. Add 500 l salmon sperm DNA to the labelled probe and boil for 5 min behind the plexiglass shield.

PAGE 93

93 16. Discard the pre-hybridization so lution into the sink and drain the tube on a paper towel. 17. Just before the probe is ready, add 6 ml pre-heated hybridization buffer in the hybridization tube and move th e tube behind the plexiglass shield. Turn off the waterbath. 18. Immediately after boiling, add the probe mixtur e to the hybridization tube. Take care to avoid any spills. 19. Place the hybridization tube in the hybridizat ion oven and incubate over-night at 65C (18 hours). 20. Prepare the wash solution (0.1x SSC + 0.1% SD S). Prepare enough to use 70 ml per wash for three washes per blot. 21. Heat the solution to 65 C using the water-bath. 22. Remove hybridization tubes from the oven and place behind the plexiglass shield. 23. Working behind the plexiglass shield, dis pose the hybridization solution into the hazardous waste container using a funnel taking care to avoid any spills. 24. Pour 70 ml pre-heated wash so lution (65C) into the hybridiza tion tube, replace lid tightly and perform a quick wash by shaking the tube for a few seconds. 25. Dispose the wash solution into the hazardous waste containe r and add another 70 ml preheated wash solution into the tube. 26. Place the tubes in the oven for 20 min. Working behind the plexiglass shield, dispose the wash solution into the hazardous waste contai ner and add 70 ml pre-heated wash solution into the tube for the final wash. 27. Place the tube in the oven for 20 min. Remove the tubes from the oven and place them behind the plexiglass shield. Dispose the wash solution into the hazardous waste container and wrap the membrane in Saran wrap. 28. Check for radioactivity on the membrane using a Geiger counter. 29. Place the membrane in an autoradiography cassette and allow 16-18 hours for exposure of X-ray film (Kodak) depending on the intensity of the signal from the Geiger counter. Place the cassette at -80C during exposure. Quantification of Endogenous Gibberellins (Lange et al., 2005) 1. Harvest newly emerging tillers (2-3 cm length) from healthy plants. 2. Grind the tissue to a fine pow der in a mortar and pestle using liquid nitrogen and freezedry over-night. 3. Spike 0.1 g dry-weight of each sample w ith 17, 17-d2-GA standards, add 8 ml eighty percent methanol-water and stir the extract for 60 min at 4C. 4. Centrifuge the samples, re-extract the pell et with 4 ml metha nol for 30 min and re-centrifuge. Repeat this step two times. 5. Combine the methanol extracts, evaporate to dryness and re-suspend in 3 ml water adjusted to pH to 8.0 with 1M KOH. 6. Use 1 ml ethyl acetate to perform solvent part ition four times. Adjust pH of the aqueous phase to 3.0 using acetic acid and use for solv ent partition with 1 ml ethyl acetate four times.

PAGE 94

94 7. Combine the ethyl acetate fractions, evapor ate to dryness and re-suspend in 100 l methanol. Methylate the re-suspended sa mples two times using 200 l ethereal diazomethane. 8. Dry the methylated samples and re-dissolve in 100 l methanol and 5 ml water adjusted to pH to 3.2 with glacial acid. Load the samples onto a C18 cartridge and wash the cartridge with 10 ml water adjusted to pH 3.2. 9. Elute the methylated GAs with 6 ml methanol and evaporate to dryness. 10. For purification by HPLC, re-dissolve the resi dues in methanol-water (1:1), pH 3.2 and apply to a C18 reverse-phase column (10 cm long, 8 mm inner diameter and 4 m particle size). 11. Elute the column with a gradient from 25% methanol in water to 100% methanol. The approximate time required was 40 min using a tw o-pump HPLC system at a flow rate of 1 ml/min. 12. Starting from 13.5 ml, collect 18 fractions, each containing 2 ml eluate, per run. Dry the fractions and re-dissolve in 2 l N -methylN -trimethylsilyltriflouracetamide. 13. Inject the samples (1-2 l) into a SG E BPX5 capillary column (30 m long, 0.25 mm internal diameter and 0.25-m film th ickness) at oven temperature of 60C. 14. After the split value (30:1) ope ns, increase the temp erature to 220C at 45C/min and then to 300C at 4C/min. 15. Set the injector, transfer line and sour ce temperatures to 220C, 280C and 300C respectively, and the He inlet at a constant flow rate of 1.5 ml/min. 16. Collect data in the following ion monitoring modes after 5 min: monitor ions 418 and 420 (GA20), 506 and 508 (GA1), 594 and 596 (GA8). 17. Use retention times and the co-occurrence of additional ions to identify GAs. 18. Calculate the endogenous levels on the basis of peak areas after correcting for the contribution of naturally occurring isotopes a nd for the presence of unlabelled GAs in the internal standards wherever necessary. Hydroponics Nutrient Solution (Broadley et al., 2003) Full Strength Component Stock Vol./L Final conc. Ca(NO3)2 1M 2.00 ml 2.00 mM NH4NO3 1M 2.00 ml 2.00 mM KH2PO4 1M 0.25 ml 0.25 mM KOH 1M 0.50 ml 0.50 mM MgSO4.7H2O 1M 0.75 ml 0.75 mM CaCl2 1M 0.03 ml 0.03 mM FeNaEDTA 0.0734 g/L 0.20 mM H3BO3 10 mM 3.00 ml 30 M MnSO4 10 mM 1.00 ml 10 M ZnSO4 1 mM 1.00 ml 1 M CuSO4 1 mM 3.00 ml 3 M Na2MoO4 1 mM 0.50 ml 0.5 M

PAGE 95

95 Low Nitrogen (0.03 mM) Component Stock Vol./L Final conc. Ca(NO3)2 1M 0.075 ml 0.075 mM NH4NO3 1M 0.075 ml 0.075 mM KH2PO4 1M 0.25 ml 0.25 mM KOH 1M 0.50 ml 0.50 mM MgSO4.7H2O 1M 0.75 ml 0.75 mM CaCl2 1M 0.03 ml 0.03 mM FeNaEDTA 0.0734 g/L 0.20 mM H3BO3 10 mM 3.00 ml 30 M MnSO4 10 mM 1.00 ml 10 M ZnSO4 1 mM 1.00 ml 1 M CuSO4 1 mM 3.00 ml 3 M Na2MoO4 1 mM 0.50 ml 0.5 M CaSO4 0.521 g/L 3.025 mM Stock Solutions Kanamycin (10 mg/ml) Dissolve 100 mg kanamycin in 10 ml ddH2O. Filter sterilize and store in aliquots at -20C. Use 5 l per ml of LB broth. Paromomycin (50 mg/ml) Dissolve 0.5g paromomycin sulphate in 10 ml ddH2O. Filter sterilize and store in aliquots at 20 C. Use 1 ml/L media. CuSO4 (12.45mg/ml) 0.6225g CuSO4.5H2O dissolved in 50ml ddH2O. Filter sterilize and st ore in aliquots at -20 C. Use 100 l/L media. MS Vitamins (1000x) 5.156g powdered stock dissolved in 50ml ddH2O. Filter sterilize and store in aliquots at -20 C. Use 1 ml/L media. BAP (1mg/ml) 0.025g powder dissolved in 500 l 1N NaOH. Make up to 25ml with ddH2O. Filter sterilize and store in aliquots at -20 C. Use 1.1 ml/L media. Dicamba (2mg/ml) 0.1g dissolved in 1ml absolute EtOH (200 proof) by warming to 40 C. Slowly add 49ml warm ddH2O (40 C). Stir to dissolve. Filter steri lize and store in aliquots at -20 C. Use 1.5 ml/L media.

PAGE 96

96 Media SOB medium (200 ml) 4 g Tryptone 1 g Yeast Extract 0.1 g NaCl Dissolve in 180 ml dH2O. Add 2 ml 250 mM KCl, adjust pH to 7 with 5N NaOH and make up the volume to 200 ml. Add 10 l 1M MgCl2 per ml SOB. SOC medium Add 4ml sterile 1M glucose to 200ml SOB after cooling. Callus Induction medium (IF) (400 ml) 1.72 g MS salts 40 l CuSO4 (12.45 mg/ml) 8 g Sucrose Dissolve in 350 ml ddH2O, adjust pH to 5.8 with 1N NaOH and make up the volume to 400 ml. Dispense into autoclavable media bottles and add 1.2 g phytagel. Autoclave for 20 min. Just before pouring in to Petri dishes add: 400 l MS Vitamins (1000x) 440 l BAP (1 mg/ml) 600 l Dicamba (2 mg/ml) Osmotic medium (0.4M IF) (400 ml) 1.72 g MS salts 40 l CuSO4 (12.45 mg/ml) 8 g Sucrose 29.12 g Sorbitol Dissolve in 350 ml ddH2O, adjust pH to 5.8 with 1N NaOH and make up the volume to 400 ml. Dispense into autoclavable media bottles and add 1.2 g phytagel. Autoclave for 20 min. Just before pouring in to Petri dishes add: 400 l MS Vitamins (1000x) 440 l BAP (1 mg/ml) 600 l Dicamba (2 mg/ml) Selection medium (IFP50) (400 ml) 1.72 g MS salts 40 l CuSO4 (12.45 mg/ml) 8 g Sucrose Dissolve in 350 ml ddH2O, adjust pH to 5.8 with 1N NaOH and make up the volume to 400 ml. Dispense into autoclavable media bottles and add 2.4 g agarose. Autoclave for 20 min.

PAGE 97

97 Just before pouring in to Petri dishes add: 400 l MS Vitamins (1000x) 440 l BAP (1 mg/ml) 600 l Dicamba (2 mg/ml) 400 l Paromomycin (50 mg/ml) Regeneration medium (IFRP50) (400 ml) 1.72 g MS salts 40 l CuSO4 (12.45 mg/ml) 8 g Sucrose Dissolve in 350 ml ddH2O, adjust pH to 5.8 with 1N NaOH and make up the volume to 400 ml. Dispense into autoclavable media bottles and add 2.4 g agarose. Autoclave for 20 min. Just before pouring in to Petri dishes add: 400 l MS Vitamins (1000x) 40 l BAP (1 mg/ml) 400 l Paromomycin (50 mg/ml) Rooting medium (NHP50) (400 ml) 1.72 g MS salts 40 l CuSO4 (12.45 mg/ml) 8 g Sucrose Dissolve in 350 ml ddH2O, adjust pH to 5.8 with 1N NaOH and make up the volume to 400 ml. Dispense into autoclavable media bottles and add 2.4 g agarose. Autoclave for 20 min. Just before pouring in to Petri dishes add: 400 l MS Vitamins (1000x) 400 l Paromomycin (50 mg/ml) Buffers Buffer D (500 ml) 4.44 g Tris-HCl 2.65 g Tris base 9.3 g EDTA (disodium salt) 7.3 g NaCl Make up the volume to 500 ml with ddH2O. 20% SDS (500 ml) 100 g SDS dissolved in 450 ml dH2O by heating Adjust pH to 7.2 with concentrated HCl Make up to 500 ml 5M potassium acetate (100 ml) 29.44 g potassium acetate dissolved in up to 60 ml

PAGE 98

98 Add: 11.5 ml glac ial acetic acid 28.5 ml dH2O 3M sodium acetate (10 ml) Dissolve 0.82 g NaOAc in 10 ml ddH2O. Adjust pH to 5.2 with glacial acetic acid. CTAB buffer (500 ml) 50 ml 1M Tris-HCl 20 ml 0.5M EDTA (disodium salt) 40.91 g NaCl 10g CTAB Make up the volume to 500 ml with ddH2O and autoclave for 20 min. 3M sodium acetate (50 ml) Dissolve 4.1 g sodium acetate in 50 ml ddH2O. Adjust pH to 5.2 with glacial acetic acid. 0.5M EDTA disodium salt, pH 8.0 (100 ml) Dissolve 18.61 g EDTA disodium salt in 100 ml ddH2O. 6x Loading dye (100 ml) 0.25% bromophenol blue 0.25% xylene cyanol FF 15% Ficoll Dissolve 15 g Ficoll in 60 ml ddH2O while stirring constantly. Add 20 ml ddH2O and warm the mixture. Add 0.25 g of both dyes, dissolve completely and make up volume to 100 ml with ddH2O. Autoclave for 20 min and store at room temperature. 50x TAE (1L) 242 g Tris base 57.1 ml glacial acetic acid 100 ml 0.5M EDTA (pH 8.0) Combine all components in ddH2O, adjust the volume to 1000 ml and autoclave for 20 min. Use 1x TAE as running buffer. 5X TBE (1L) 54 g Tris base 27.5 g boric acid 20 ml 0.5M EDTA (pH 8.0) Combine all components in ddH2O, adjust the volume to 1000 ml and autoclave for 20 min. Use 0.5x TBE as running buffer. Formaldehyde loading buffer 1 mM EDTA, pH 8.0 0.25% Bromophenol Blue 0.25% Xylene Cyanol 50% Glycerol

PAGE 99

99 Prepare using DEPC-treated ddH2O 10x MOPS [3-(N-morpholino)-propanesulf onic acid] running buffer (1L) Add 41.8 g MOPS to 800 ml DEPC-treated ddH2O. Adjust the pH to 7.0 with NaOH. Add 16.6 ml 3M DEPC-treated sodium acetate and 20 ml 0.5M DEPC-treated EDTA, pH 8.0. Adjust the volume to 1L with DEPC-treated ddH2O and filter sterilize. Wrap the container with aluminium foil and store at room temperature. Hybridization Buffer (500 ml) 125 ml 1M Na2HPO4 (pH 7.4) 1 ml 0.5M EDTA (pH 8.0) 5 g BSA 175 ml 20% SDS Make up the volume to 500 ml with ddH2O. Autoclave for 20 min and store at 4C. 1M Na2HPO4, pH 7.4 (1L) Dissolve 142 g Na2HPO4 in 800 ml ddH20. Adjust the pH to 7.4 with phosphoric acid and make up the volume to 1L. 20x SSC, pH 7.0 (1L) 175.3 g NaCl 88.2 g sodium citrate Dissolve in 800 ml ddH2O. Adjust pH to 7.0 with 1N HCl, make up the volume to 1L and autoclave for 20 min.

PAGE 100

100 LIST OF REFERENCES Acuna, C.A., Blount, A.S., Quesenberry, K.H ., Hanna, W.W. and Kenworthy, K.E. (2007) Reproductive characterization of bahiagrass germplasm. Crop Science (In press). Adamse, P., Jaspers, P.A.P.M., Kendrick, R.E. and Koornneef, M. (1987) Photomorphogenetic responses of a long hypocotyl mutant of Cucumis sativus L. J. Plant Physiol. 127 481491. Adamse, P., Jaspers, P.A.P.M., Bakker, J. A., Kendrick, R.E. and Koornneef, M. (1988) Photophyiology and phytochrome content of long-hypocotyl mutant and wild-type cucumber seedlings. Plant Physiol. 87 264-268. Adjei, M.B., Mislevy, P. and Chason, W. (2000) Timing, defoliation management and nitrogen effects on seed yield of Argentine bahiagrass. Agron. J. 92 36-41. Agharkar, M., Lomba, P., Altpeter, F., Zhang, H., Kenworthy, K. and Lange, T. (2007) Stable expression of AtGA2ox1 in a low-input turfgrass Paspalum notatum Flugge) reduces bioactive gibberellin levels and improve s turf quality under field conditions. Plant Biotechnology Journal (In press). Agrawal, P.K., Kohli, A., Twyman, R.M. and Ch ristou, P. (2005) Transformation of plants with multiple cassettes generates simple transgen e integration patterns and high expression levels. Mol. Breeding 16 247-260. Aguado-Santacruz, G.A., Rascon-Cruz, Q., Cabr era-Ponce, J.L., Martinez-Hernandez, A., Olalde-Portugal, V. and Herrera-Estrella, L. (2002) Transgenic plants of blue grama grass, Bouteloua gracilis (H.B.K.) Lag. ex Steud. from microprojectile bombardment of highly chlorophyllous embryogenic cells. Theor. Appl. Genet. 104 763-771. Ahloowalia, B.S. (1975) Regeneration of ryegrass plants in tissue culture. Crop Sci. 15 449-452. Ahn, B.J., Huang, F.H. and King, J.W. (1985) Pl ant regeneration through somatic embryogenesis in common bermudagrass tissue culture. Crop Sci. 25 1107-1109. Ahn, B.J., Huang, F.H. and King, J.W. (1987) Regeneration of bermuda grass cultivars and evidence of somatic embryogenesis. Crop Sci. 27 594-597. Akashi, R., Hashimoto, A. and Adashi, T. (1993) Plant regeneration from see-derived embryogenic callus and cell suspen sion cultures of bahiagrass ( Paspalum notatum ). Plant Sci. 90, 73-80. Al-Khayri, J.M., Huang, F.H., Thompson, L.F. and King, J.W. (1989) In vitro plant regeneration of zoysiagrass. Arkansas Farm Res. 38 11. Altpeter, F. and Xu, J. (2000) Rapid production of transgenic turfgrass ( Festuca rubra L.) plants. J. Plant Physiol. 157 441-448.

PAGE 101

101 Altpeter, F., Xu, J. and Ahmed, S. (2000) Ge neration of large numb ers of independently transformed fertile perennial ryegrass ( Lolium perenne L.) plants of forageand turf-type cultivars. Mol. Breed. 6 519-528. Altpeter, F., Baisakh, N., Beachy, R., Bock, R., Capell, T., Christou, P., Daniell, H., Datta, K., Datta, S., Dix, P.J., Fauquet, C., Huang, N., Kohli, A., Mooibroek, H., Nicholson, L., Nguyen, T.T., Nugent, G., Raemakers, K., Ro mano, A., Somers, D.A., Stoger, E., Taylor, N. and Visser, R. (2005) Particle bombardment and th e genetic enhancement of crops: myths and realities. Mol. Breed. 15 305-327. Altpeter, F., Fang, Y.D., Xu, J.P. and Ma, X. R. (2004) Comparison of transgene expression stability after Agrobacterium -mediated or biolistic gene transfer into perennial ryegrass ( Lolium perenne L.). In Hopkins, A., Wang, Z.Y., Mian, R., Sledge, M., Barker, R.E. (eds.) Molecular breeding of forage and turf Dordrecht: Kluwer Academic Publishers, 255-260. Altpeter, F. and James, V.A. (2005) Genetic transformation of turf-type bahiagrass ( Paspalum notatum Flugge) by biolistic gene transfer. International Turfgrass Society Research Journal 10 1-5. Altpeter, F. and Positano, M. (2005) Efficient plant regeneration from mature seed derived embryogenic callus of turf-type bahiagrass ( Paspalum notatum Flugge). International Turfgrass Society Research Journal 10 479-484. Altpeter, F., Agharkar, M. and Sandhu, S. (2007) Bahiagrass. In A compendium of transgenic crop plants: Volume 1, Kole, C. and Hall, T.C., (eds), Wiley Blackwell (In press). Anowarul Islam, M. and Hirata, M. (2005) Leaf appearance, death and detachment, and tillering in centipedegrass ( Eremochloa ophiuroides (Munro) Hack.) in comparison with bahiagrass ( Paspalum notatum Flgge): A study at a small sod scale. Grassland Science 51 121-127. Asano, Y. and Sugiura, K. (1990) Plant regenera tion from suspension cult ure-derived protoplasts of Agrostis alba L. (redtop). Plant Sci. 72 267-273. Asano, Y. and Ugaki, M. (1994) Transgenic plants of Agrostis alba obtained by electroporationmediated direct gene tr ansfer into protoplasts. Plant Cell Rep. 13 243-246. Bajaj, S., Ran, Y., Phillips, J., Kulrajathevan, G ., Pal, S., Cohen, D., Elborough, K. and Puthigae, S. (2006) A high throughput Agrobacterium tumefaciens -mediated transformation method for functional genomics of perennial ryegrass (Lolium perenne L.). Plant Cell Rep. 25 651-659. Beaty, E.R., McCreery, R.A. and Powell, J.D. (1960) Response of Pensacola bahiagrass to nitrogen fertilization. Agron. J. 52 453-455.

PAGE 102

102 Beaty, E.R., Tan, K.H., McCreery, R.A. and Powell, J.D. (1980) Yield and N content of closely clipped bahiagrass as affected by N treatments. Agron. J. 72, 56-60. Bettany, A.J.E., Dalton, S.J., Timms, E., Manderyc k, B., Dhanoa, M.S. and Morris, P. (2003) Agrobacterium tumefaciens -mediated transformation of Festuca arundinacea (Schreb.) and Lolium multiflorum (Lam.). Plant Cell Rep. 21 437-444. Bevan, M. (1984) Binay Agrobacteriu m vectors for plant transformation. Nucleic Acids Res. 12 8711-8721. Bhaskaran, S. and Smith, R.H. (1990) Regene ration in cereal tissu e culture: a review. Crop Sci. 30 1328-1336. Biemelt, S., Tschiersch, H. and Sonnewald, U. (2004) Impact of altered gibberellin metabolism on biomass accumulation, lignin biosynthesis, and photosynthesis in transgenic tobacco plants. Plant Physiol. 135 254-265. Bienick, M.E. (1989) Plant regeneration vi a embryogenesis from young inflorescences and young leaf tissue of Paspalum notatum Flugge. M.S. Thesis, Department of Agronomy, University of Florida, Gainesville. Blount, A.R. (2004) Forage production in the so uthern coastal plain region. EDIS SS-AGR-81 Agronomy Department, Florida Cooperative Extension Service, In stitute of Food and Agricultural Sciences, University of Florida, Gainesville, FL, USA. Blount, A.R., Quesenberry, K.H., Mislevy, P., Gate s, R.N. and Sinclair, T.R. (2001a) Bahiagrass and other Paspalum species: An overview of the plant breeding efforts in the Southern Coastal Plain. Proc. 56th Southern Pasture and Forage Crop Improvement Conference, Springdale, US. Blount, A.R., Sinclair, T.R., Gates, R.N., Quesenberry, K.H. and Littell, R.C. (2001b) Photoperiod response in Pensacola bahiagrass. In J.A. Gomide et al. (ed.) Proc. Intl. Grassl. Congr., 19th Piracicaba, Sao Paulo, Brazil, 11-21 Feb. Boother, G.M., Gale, M.D., Gaskin, P., MacMilla n, J. and Sponsel, V.M. (1991) Gibberellin in shoots of Hordeum vulgare A comparison between cv. Tr iumph and two dwarf mutants which differ in their response to gibberellins. Physiol. Plant. 81 385-392 Bovo, O.A. and Mroginski, L.A. (1986) Tissue culture in Paspalum (Gramineae): plant regeneration from cultured inflorescences. J. Plant Physiol. 124, 481-492. Bovo, O.A. and Mroginski, L.A. (1989) Somatic embryogenesis and plant regeneration from cultured mature and immature embryos of Paspalum notatum (Gramineae). Plant Sci. 65 217-223.

PAGE 103

103 Boyd, L.A. and Dale, P.J. (1986) Callus production and plant regeneration from mature embryos of Poa pratensis L. Plant Breed. 97 246-254. Bradford, M. (1976) A Rapid and Sensitive Method for the Quantitation of Microgram Quantities of Protein Utilizing th e Principle of Protein-Dye Binding. Anal. Biochem. 72, 248-254. Brian, P.W. and Hemming, H.G. (1955) The effect of gibberellic acid on shoot growth of pea seedlings. Physiol. Plant. 8 669-681. Broadley, M.R., Seginer, I., Burns, A., Escoba r-Gutirrez, A.J., Burns, I.G. and White, P.J. (2003) The nitrogen and nitrate economy of butterhead lettuce ( Lactuca sativa var. capitata L.). J. Exp. Bot. 54 2081-2090. Burton, G.W. (1939) Scarification studies on southern grass seeds. J. Am. Soc. Agron. 31 179-187. Burton, G.W. (1940) The establishment of Bahia grass, Paspalum notatum J. Am. Soc. Agron. 32 545-549. Burton, G.W. (1948) The method of reproduction in common bahiagrass, Paspalum notatum J. Am. Soc. Agron 40 443-452. Burton, G.W. (1967) A search for the origin of Pensacola bahiagrass. Econ. Bot. 21, 319-382. Burton, G.W. (1974) Recurrent restricted phenot ype selection increase s forage yields of Pensacola bahiagrass. Crop Sci. 14 831-835. Burton, G.W. (1989) Registration of Tifton-9 Pensacola bahiagrass. Crop Sci. 29 1326. Burton, G.W., Gates, R.N. and Gasho, G.J. (1997) Response of Pensacola bahiagrass to rates of nitrogen, phosphorus and potassium fertilizers. Soil Crop Sci. Soc. Florida Proc. 56 3135. Busov, V.B., Meilan, R., Pearce, D.W., Caipi ng, M., Rood, S.B. and Strauss, S.H. (2003) Activation tagging of a dominant gi bberellin catabolism gene (GA 2oxidase ) from poplar that regulates tree stature. Plant Physiol. 132, 1283-1291. Carrera, E., Bou, L., Garca-Martinez, J.L. and Prat, S. (2000) Changes in GA 20-oxidase gene expression strongly affect stem length, tuber induction and tu ber yield of potato plants. Plant J. 22 247-256. Chai, B. and Sticklen, M.B. (1998) Applica tions of biotechnology in turfgrass genetic improvement. Crop Sci. 38 1320-1338.

PAGE 104

104 Chai, M.L., Senthil, K.K. and Kim, D.H. (2004) Transgenic plants of co lonial bentgrass from embryogenic callus via Agrobacterium -mediated transformation. Plant Cell Tiss. Organ Cult. 77 165-171. Chambliss, C.G. and Adjei, M.B.(2002) Ba hiagrass. EDIS SSR-36 Agronomy Department, Florida Cooperative Extension Service, Inst itute of Food and Agricultural Sciences, University of Florida, Gainesville, FL, USA. Chandler, P.M. (1988) Hormonal regulation of gene expression in the slender mutant of barley ( Hordeum vulgare L.). Planta 175, 115-120. Chen, L., Auh, C., Dowling, P., Bell, J., Che n, F., Hopkins, A., Dixon, R.A. and Wang, Z.-Y. (2003) Improved forage digestibility of tall fescue ( Festuca arundinacea )by transgenic down-regulation of cinnamy l alcohol dehydrogenase. Plant Biotechnol. J 1 437-449. Chen, L., Auh, C., Dowling, P., Bell, J., Lehm ann, D. and Wang, Z.-Y. (2004) Transgenic downregulation of caffeic acid O -methyltransferase (COMT) led to improved digestibility in tall fescue ( Festuca arundinacea ). Funct. Plant Biol. 31 235-245. Chen, X., Yang, W.Q., Sivamani, E., Bruneau, A.H., Wang, B.H. and Qu, R.D. (2005) Selective elimination of perennial ryegrass by activa tion of a pro-herbicide through engineering E. coli argE gene. Mol. Breed. 15 339-347. Cheng, M., Hu, T., Layton, J., Liu, C.-N. and Fry, J.E. (2003) Dessication of plant tissues postAgrobacterium infection enhances T-DNA delivery a nd increases stable transformation efficiency in wheat. In Vitro Cell. Dev. Biol. Plant 39 595-604. Cheng, M., Lowe, B.A., Spencer, T.M., Ye, X. and Armstrong, C.L. (2004) Factors influencing Agrobacterium -mediated transformation of monocotyledonous species. In Vitro Cell. Dev. Biol.-Plant 40 31-45. Cho, M.J., Ha, C.D. and Lemaux, P.G. (2000) Producti on of tall fescue and red fescue plants by particle bombardment of mature seed -derived highly regenerative tissues. Plant Cell Rep. 19 1084-1089. Christensen, A.H., Sharrock, R.A. and Quail, P.H. (1992) Maize polyubiquitin genes: structure, thermal perturbation of expression and tr anscript splicing, and promoter activity following transfer to prot oplasts by electroporation. Plant Mol. Biol. 18 675-689. Christensen, A.H. and Quail, P.H. (1996) Ub iquitin promoter-based vectors for high-level expression of selectable and/ or screenable marker genes in monocotyledonous plants. Transgenic Res. 5 213-218. Coles, J.P., Phillips, A.L., Croker, S.J., Garcia-Lepe, R., Lewis, M.J. and Hedden, P. (1999) Modification of gibberellin produ ction and plant development in Arabidopsis by sense and antisense expression of gibberellin 20-oxidase genes. Plant J. 17 547-556.

PAGE 105

105 Colom, M.R. and Vazzana, C. (2001) Drought stress effects on th ree cultivars of Eragrostis curvula : photosynthesis and water relations. Plant Growth Reg. 34 195-202. Colom, M.R. and Vazzana, C. (2003) Phottosynthe sis and PSII functionality of drought-resistant and drought-sensitive weeping lovegrass. Env. Exp. Bot. 49 135-144. Creemers-Molenaar, T., Loeffe, J.P.M. and Z aal, M.A.C.M. (1988) Isolation, culture and regeneration of Lolium perenne and Lolium multiflorum protoplasts. Curr. Plant Sci. Biotech. Agric. 7 53-54. Dai, W.D., Bonos, S., Guo, Z., Meyer, W.A., Day, P.R. and Belanger, F.C. (2003) Expression of pokeweed antiviral proteins in creeping bentgrass. Plant Cell Rep. 21 497-502. Dalton, S.J. (1988a) Plant regeneration from cell suspension protoplasts of Festuca arundinacea Schreb. (tall fescue) and Lolium perenne L. (perennial ryegrass). J. Plant Physiol. 132 170-175. Dalton, S.J. (1988b) Plant regeneration from cell suspension protoplasts of Festuca arundinacea Schreb., Lolium perenne L. and L. multiflorum Lam. Plant Cell Tiss. Organ Cult. 12 137-140. Dalton, S.J., Bettany, A.J.E., Timms, E. and Morris, P. (1995) The effect of selection pressure on transformation frequency and copy number in transgenic plants of tall fescue ( Festuca arundinacea Schreb.). Plant Sci. 108 63-70. Dalton, S.J., Bettany, A.J.E., Timms, E. and Mo rris, P. (1999) Co-transformed, diploid Lolium perenne (Perennial ryegrass), Lolium multiflorum (Italian ryegrass) and Lolium temulentum (Darnel) plants produced by microprojectile bombardment. Plant Cell Rep. 18 721-726. Daniell, H. (1999) GM crops: Public perceptions and scientific solutions. Trends Plant Sci. 4 467-469. Darbani, B., Eimanifar, A., Stewart Jr., C.N. and Camargo, W.N. (2007) Methods to produce marker-free transgenic plants. Biotech. J. 2 83-90. de Haan, H. (1927) Length factors in Pisum Genetica 9 481-497. Dellaporta, S.L., Wood, J. and Hicks, J.B. ( 1983) A plant DNA minipreparation: Version II. Plant Mol. Biol. Rep. 1 19-21. Dixon, L., Nyffenegger, T., Delley, G., Martinezizquierdo, J. and Hohn, T. (1986) Evidence for replicative recombination in Cauliflower Mosaic-Virus. Virology 150 463-468.

PAGE 106

106 Dong, S. and Qu, R. (2005) High efficiency transformation of tall fescue with Agrobacterium tumefaciens Plant Sci. 168 1453-1458. Ebinuma, H., Sugita, K., Matsunaga, E., Endo, S., Yamada, K. and Komamine, A. (2001) Systems for the removal of a selectable ma rker and their combin ation with a positive marker. Plant Cell. Rep. 20 383-392. Ervin, E.H. and Koski, A.J. (1998) Growth responses of Lolium perenne L. to Trinexapac-ethyl. HortSci. 33 1200-1202. Evert, D.R., Bertrand, P.F. and Mullinix Jr., B.G. (1992) Nematode population and peach tree survival, growth, and nutriti on at an old orchard site. J.Am. Soc. Hortic. Sci. 117 6-13. Fennell, S., Bohorova, N., van Ginkel, M., Cr ossa, J. and Hoisington, D. (1996) Plant regeneration from immature embryos of 48 elite CIMMYT bread wheats. Theor. Appl. Genet. 92 163-169. Fernandes, M.I.B. de M., Barreto, I.L. and Salzano, F.M. (1973) Cyt ogenetic, ecologic and morphologic studies in Brazilian forms of Paspalum notatum Can. J. Genet. Cytol. 15, 523-531. Frisse, A., Pimenta, M.J. and Lange, T. (2003) Expression studies of gi bberellin oxidases in developing pumpkin seeds. Plant Physiol. 131 1220-1227. Forbes, I. and Burton, G.W. (1961a) Induction of tetraploidy and a rapid field method of detecting induced tetraploidy in Pensacola bahiagrass. Crop Sci. 1 :383-384. Forbes, I. and Burton, G.W. (1961b) Cytology of diploids, natural and induced tetraploids and intraspecific hybrids of bahiagrass, Paspalum notatum Flgge. Crop Sci. 1, 402-406. Foster, K.R., Miller, F.R., Childs, K.L. a nd Morgan, P.W. (1994) Genetic regulation of development in Sorghum bicolor VIII. Shoot Growth, tille ring, flowering, gibberellin biosynthesis and phytochrome levels are di fferentially affected by dosage of the ma3 R allele. Plant Physiol. 105 941-948. Fraley, R.T., Rogers, S.G., Horsch, R.B., Sanders, P.R., Flick, J.S., Adams, S.P., Bittner, M.L., Brand, L.A., Fink, C.L., Fry, J.S., Galluppi, G.R., Goldberg, S.B., Hoffmann, N.L. and Woo, S.C. (1983) Expression of b acterial genes in plant cells. Proc. Natl. Acad. Sci. USA 80 4803-4807. Fu, X., Duc, L.T., Fontana, S., Bong, B.B., Sudh akar, P.T.D., Twyman, R.M., Christou, P. and Kohli, A. (2000) Linear transg ene constructs lack ing vector backbone sequences generate low-copy-number transgenic plants with simple integration patterns. Transgenic Res. 9 11.

PAGE 107

107 Fu, D., Tisserat Ned, A., Xiao, Y., Settleb, D ., Muthukrishnane, S. and Liang, G.H. (2005) Overexpression of rice TLPD34 enhances dollar-s pot resistance in transgenic bentgrass. Plant Sci. 168 671-680. Fujioka, S., Yamane, H., Spray, C.R., Katsumi, M ., Phinney, B.O., Gaskin, P., MacMillan, J. and Takashi, N. (1988) The dominant nongibberellin-responding dwarf mutant ( D8 ) of maize accumulates native gibberellins. Proc. Natl. Acad. Sci. USA, 85, 9031-9035 Gates, R.N. and Burton, G.W. (1998) Seed yield and seed quality response of Pensacola and improved bahiagrasses to fertilization. Agron. J. 90 607-611. Gates, R.N., Quarin, C.L. and Pedreira, C.G.S. (2004) Bahiagrass. In: Warm season C4 grasses. Moser LE, Burson BL and LE Sollenberger, eds. ASA, CSSA, SSSA Agronomy N 45. Goatley Jr., J.M., Maddox, V.L. and Watkins, R. M. (1998) Bahiagrass response to plant growth regulator as affected by mowing interval. Crop Sci. 38 196-200. Goldman, J.J., Hanna, W.W., Fleming, G.H. and Ozias-Akins, P. (2004) Ploidy variation among herbicide-resistant be rmudgrass plants of cultivar Ti fEagle transformed with the bar gene. Plant Cell Rep. 22 553-560. Gondo, T., Tsuruta, S.-I., Akashi, R., Kawamura, O. and Hoffman, F. (2005) Green, herbicide resistant plants by particle inflow gen-medi ated gene transfer to diploid bahiagrass ( Paspalum notatum ). J. Plant Physiol. 162 1367-1375. Grando, M.F., Franklin, C.I. and Shatters, Jr. R.G. (2002) Optimizing embryogenic callus production and plant regenerati on from Tifton 9 bahiagrass seed explants for genetic manipulation. Plant Cell Tiss. Org. Cult. 71, 213-222. Guenni, O., Marn, D. and Baruch, Z. (2002) Responses to drought of five Brachiaria species. I. Biomass production, leaf growth, root dist ribution, water use and forage quality. Plant and Soil 243 229-241. Guo, Z.F., Bonos, S., Meyer, W.A., Day, P.R. an d Belanger, F.C. (2003) Transgenic creeping bentgrass with delayed dollar spot symptoms. Mol. Breed. 11 95-101. Ha, S.B., Wu, F.S. and Thorne, T.K. ( 1992) Transgenic turf-type tall fescue ( Festuca arundinacea schreb.) plants regenerated from protoplasts. Plant Cell Rep. 11, 601-604. Ha, C.D., Lemaux, P.G. and Cho, M.J. (2001) Stab le transformation of a recalcitrant Kentucky bluegrass ( Poa pratensis L.) cultivar using mature s eed-derived highl y regenerative tissues. In Vitro Cell. Dev. Biol. Plant 37 6-11. Haldrup, A., Petersen, S.G. and Okkels, F.T. (1998) Positive selection: a plant selection principle based on xylose isomerase, an enzyme used in the food industry. Plant Cell Rep. 18, 76-81.

PAGE 108

108 Hall, D.G. (1988) Insects and mites associated with sugarcane in Florida. Fla. Entomol. 71 138-150. Han, N., Chen, D., Bian, H.-W., Deng, M.-J., Zhu, M.-Y. (2005) Produc tion of transgenic creeping bentgrass Agrostis stolonifera var. palustris plants by Agrobacterium tumefaciens -mediated transformation using hygromycin selection. Plant Cell Tiss. Organ Cult. 81 131-138. Harberd, N.P., King, K.E., Carol, P., Cowli ng, R.J. Peng, J. and Richards, D.E. (1998) Gibberellin: inhibitor of an inhibitor of? Bioessays 20 1001-1008. Hartman, C.L., Lee, L., Day, P.R. and Turner, N.E. (1994) Herbicide resistant turfgrass ( Agrostis palustris Huds.) by biolistic transformation. Bio/Technology 12 919-923. Haydu, J.J., Satterthwaite, L.N. and Cisar, J.L. (2005) An economic and agronomic profile of Floridas sod industry in 2003. Florida Agri cultural Experiment Stations, Florida Cooperative Extension Service, Food & Res ource Economics Department, Mid-Florida REC, University of Florida, IFAS, April, 34 pp. Hedden, P. and Phillips, A.L. (2000) Gibberellin metabolism: New insights revealed by the genes. Trends Plant Sci. 5 523-530. Helliwell, C.A., Sheldon, C.C., Olive, M.R., Walk er, A.R., Zeevaart, J.A.D., Peacock, W.J. and Dennis, E.S. (1998) Cloning of the Arabidopsis ent -kaurene oxidase gene GA3 Proc. Natl. Acad. Sci. USA 95 9019-9024. Hiei, Y., Ohta, S., Komari, T. and Kumashiro, T. (1994) Efficient tr ansformation of rice ( Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the TDNA. Plant J. 6, 271-282. Horn, M.E., Shillito, R.D., Conger, B.V. and Ha rms, C.T. (1988) Transgenic plants of orchardgrass ( Dactylis glomerata L.) from protoplasts. Plant Cell Rep. 7 469-472. Hoveland, C.S. (2000) Achievements in manageme nt and utilization of southern grasslands. J. Range Manage. 53, 17-22. Howe, A.R., Gasser, C.S., Brown, S.M., Padgette, .S.R, Hart, J., Parker, G.B., Fromm, M.E. and Armstrong, C.L. (2002) Glyphosate as a select ive agent for the production of fertile transgenic maize ( Zea mays L.) plants. Mol. Breed. 10 ,153-164. Hu, T., Metz, S., Chay, C., Zhou, H.-P., Biest, N., Chen, G., Cheng, M., Feng, X., Radioneko, M., Lu, F. and Fry, J.E. (2003) Agrobacteriu m-mediated large-scale transformation of wheat ( Triticum aestivum L.). Plant Cell Rep. 21 ,1010-1019.

PAGE 109

109 Hu, F., Zhang, L., Wang, X., Ding, J. and Wu, D. (2005a) Agrobacterium -mediated transformed transgenic triploid bermudagrass ( Cynodon dactylon X C. transvaalensis ) plants are highly resistant to the gluf osinate herbicide Liberty. Plant Cell Tiss. Organ Cult. 83 13-19. Hu, F., Jia, W., Wang, J., Zhang, Y., Yang, L. and Lin, Z. (2005b) Transgenic tall fescue containing the Agrobacterium tumefaciens ipt gene shows enhanced cold tolerance. Plant Cell Rep. 23 705-709. Inokuma, C., Sugiura, K., Imaizumi, N. and C ho, C. (1998) Transgenic Japanese lawngrass ( Zoysia japonica Steud.) plants regene rated from protoplasts. Plant Cell Rep. 17 334-338. Itoh, H., Ueguchi-Tanaka, M., Sakamoto, T., Kayano, T., Tanaka, H., Ashikari, M. and Matsuoka, M. (2002) Modification of rice plant height by suppressing the heightcontrolling gene, D18 in rice. Breeding Sci. 52 215-218. Jacobsen, J.V. and Olszewski, N.E. ( 1993) Mutations at the SPINDLY locus of Arabidopsis alter gibberellin signal transduction. Plant Cell 5 887-896. Jain, M., Chengalrayan, K., Abouzid, A. and Ga llo, M. (2007) Prospec ting the utility of a PMI/mannose selection system for the recovery of transgenic sugarcane ( Saccharum spp. hybrid) plants. Plant Cell Rep. 26 581-590. James, V.A., Neibaur, I. and Altpeter, F. (2007) Stress inducible expression of the DREB1A transcription factor from xeric, Hordeum spontaneum L. in turf and forage grass ( Paspalum notatum Flugge) enhances abio tic stress tolerance. Transgenic Research (In press). Joersbo, M., Donaldson, I., Kreiber, J., Peters on, S.G., Brunstedt, J. and Okkels, F.T. (1998) Analysis of mannose selection used for transformation of sugar beet. Mol. Breed. 4, 111-117. Joersbo, M. (2001) Advances in th e selection of transgenic plants using non-antibiotic markers. Physiol. Plant. 111 269-272. Johnson, A,W., Minton, N.A., Bren neman, T.B., Burton, G.W., Culbreath, A.K., Gascho, G.J. and Baker, S.H. (1999) Bahiagrass, corn, cotton rota tions and pesticides for managing nematodes, diseases and insects on peanut. J. Nematol. 31, 191-200. Johnston, G.F.S. and Jeffcoat, B. (1977) Eff ects of some growth regulators on tiller bud elongation in cereals. New Phytol. 79 239-245. Jones, M.G. (1987) Gibberellins a nd the procera mutant of tobacco. Planta 172 280-284.

PAGE 110

110 Jupe, S.C., Causton, D.R. and Scott, I.M. (1988) Ce llular basis of the effect of gibberellin and the pro gene on stem growth in tomato. Planta 174, 106-111. Katsvairo, T.W., Tsigbey, F.K., Wright, D.L., Maro is, J.J., Hartzog, D., Wiatrak, P.J. and Rich, J.R. (2006) Use of perennial grasses in p eanut/cotton rotations : Effect on pests. EDIS SSR-AGR-125 Agronomy Department, Florida C ooperative Extension Service, Institute of Food and Agricultural Sciences, Univers ity of Florida, Gainesville, FL, USA. Kay, R., Chan, A., Daly, M., and McPherson, J. (1985) Duplication of CaMV 35S promoter sequences creates a strong enhancer for plant genes. Science 236 1299-1302. Kebrom, T.H., Burson, B.L. and Finlays on, S.A. (2006) Phytochrome B represses Teosinte Branched1 expression and induces sorghum axillary bud outgrowth in response to light signals. Plant Physiol. 140 1109-1117. Krans, J.V. (1981) Cell culture of turfgrasses. In R.W. Sheard (ed.) Proc. Int. Turf. Res. Conf., 4th, Guelph, Ontario, Canada, 19 July 1980, 27-33. Krans, J.V., Henning, V.T. and Torres, K.C. ( 1982) Callus induction, maintenance and plantlets regeneration in creeping bentgrass. Crop Sci. 22 1193-1197. Krans, J.V. and Blanche, F.C.B. (1985) Tissue culture of centipedegrass. In F. Lemaire (ed.) Proc. Int. Turf. Res. Conf., 5th, Avignon, France, 1-5 July 1985, 159-164. Koichi, T., Bae, C.H., Seo, M.S., Song, I.J., Li m, Y.P., Song, P.S. and Lee, H.Y. (2002) Overcoming barriers to transf ormation in monocot plants. J. Plant Biotech. 4, 135-141. Koornneef, M. and van der Veen, J.H. (1980) In duction and analysis of gibberellin sensitive mutants. Theor. Appl. Genet. 58, 257-263. Kuai, B., Dalton, S.J., Bettany, A.J.E. and Morris, P. (1999) Regeneration of fertile transgenic tall fescue plants with a stab le highly expressed foreign gene. Plant Cell Tiss. Organ Cult. 58 149-154. Kuo, Y. and Smith, M.A.L. (1993) Plant regene ration from St. Augustinegrass immature embryo derived callus. Crop Sci. 33 1394-1396. Lanahan, M.B. and Ho, T.-H.D. (1988) Slende r barley: A constitutive gibberellin-response mutant. Planta 175 107-114. Lange, T., Kappler, J., Fischer, A., Frisse, A., Padeffke, T., Schmidtke, S., and Pimenta Lange, M.J. (2005) Gibberellin Biosynthesi s in developing pumpkin seedlings. Plant Physiol. 139 213-223. Lee, L., Laramore, C.L., Day, P.R. and Tumer, N.E. (1996) Transformation and regeneration of creeping bentgrass ( Agrostis palustris Huds.) protoplasts. Crop Sci. 36 401-406.

PAGE 111

111 Lester, D.C., Carter, O.J., Kelleher, F.M. and Laing, D.R. (1972) The effect of gibberellic acid on apparent photosynthesis and dark re spiration of simulated swards of Pennisetum clandestinum Hochst. Aust. J. Agric. Res. 23 205-213. Lester, D.R., Ross, J.J., Smith, J.J., Elliot, R.C. and Reid, J.B. (1999) Gibberellin 2-oxidation and the SLN gene of Pisum sativum Plant J. 19 65-73. Li, L. and Qu. R. (2004) Development of hi ghly regenerable callus lines and biolistic transformation of turf-t ype common bermudagrass [ Cynodon dactylon (L.) Pers.]. Plant Cell Rep. 22 403-407. Li, L., Robson, P.R.H., Bettany, A.J.E., Donnison, I.S., Thomas, H. and Scott, I.M. (2004) Modification of senescence in ryegrass transformed with IPT under the control of a monocot senescence-enhanced promoter. Plant Cell Rep. 22 816-821. Li, L., Fei, S. and Qu, R. (2005) Agrobacterium -mediated transformation of common bermudagrass ( Cynodon dactylon ). Plant Cell Tiss. Organ Cult. 83 223-229. Lickfeldt, D.W., Gardner, D.S., Branham, B.E. a nd Voigt, T.B. (2001) Implications of repeated trinexapac-ethyl applicati ons on Kentucky bluegrass. Agron. J. 93 1164-1168. Lomba, P.N., Altpeter, F., A gharkar, M., Zhang, H., Kenwort hy, K. and Sinclair, T. (2007) Comparative field evaluati on of turf-type bahiagrass with over-expression of a gibberellin-catabolizing enzyme or a repressor of cell expansion. Society for In Vitro Biology Meeting, Indianapolis, IN, June 9th -13th. Lopez-Juez, E., Kobayashi, M., Sakurai, A., Kamiya, Y. and Kendrick, R.E. (1995) Phytochrome, gibberellins and hypocotyl growth. A study using the cucumber ( Cucumis sativus L.) long hypocotyl mutant. Plant Physiol. 107 131-140. Lowe, K.W. and Conger, B.V. (1979) Root and shoot formation from callus cultures of tall fescue. Crop Sci. 19 397-400. Lucca, P., Ye, X. and Potrykus, I. (2001) Effectiv e selection and regenera tion of transgenic rice plants with mannose as selective agent. Mol. Breed. 7 43-49. Luciani G., Altpeter, F., Chang, J.-Y., Zhang, H ., Gallo, M., Meagher, R.L. and Wofford, D. (2007) Expression of a minimal cry1Fa expression cassette in bahiagrass ( Paspalum notatum Flugge) confers resistance to fall armyworm [ Spodoptera frugiperda (J.E. Smith)]. Crop Science (In press). Luginbill, P. (1928) The fall armyworm. U.S. Dep. Agric. Tech. Bull. 34 1-91. Luo, H., Hu, Q., Nelson, K., Longo, C., Kausch, A.P ., Chandlee, J.M., Wipff, J.K. and Fricker, C.R. (2004) Agrobacterium tumefaciens mediated creeping bentgrass ( Agrostis

PAGE 112

112 stolonifera L.) transformation using phosphinoth ricin selection results in a high frequency of single-copy transgene integration. Plant Cell Rep. 22 645-652. MacMillan, C.P., Blundell, C.A. and King, R.W. (2005) Flowering of the grass Lolium perenne Effects of vernalization and long days on gibberellin biosynthesis and signaling. Plant Physiol. 138 1794-1806. Marousky, F.J. and West, S.H. (1990) Somatic embryogenesis and plant regeneration from cultured mature caryopses of bahiagrass ( Paspalum notatum Flugge). Plant Cell Tiss. Org. Cult. 20 125-129. Martelotto, L.G., Ortiz, J.P.A., Stein, J., Espinoza, F., Quarin, C.L. and Pessino, S.C. (2005) A comprehensive analysis of gene expre ssion alterations in a newly synthesized Paspalum notatum autotetraploid. Plant Sci. 169 211-230. Martin, D.N., Proebsting, W.M. and Hedden, P. (1999) The SLENDER gene of pea encodes a gibberellin 2-oxidase. Plant Physiol. 121 775-781. Martnez, E.J., Espinoza, F. and Quarin, C.L. (1994) BIII progeny (2n+n) from apomictic Paspalum notatum obtained through early pollination. J. Hered. 85 295-297. Martnez, E.J., Urbani, M.H., Quarin, C.L. and Ortiz, J.P.A. (2001) Inheritance of apospory in bahiagrass, Paspalum notatum Hereditas 135 19-25. McDonnell, R.E. and Conger, B.V. (1984) Callus induction and plantlet formation from mature embryo explants of Kentucky bluegrass. Crop Sci. 24 573-578. Miki, B. and McHugh, S. (2004) Selectable marker genes in transgenic plants: applications, alternatives and biosafety. J. Biotech. 107 193-232. Neanana, S., Brandt, W., Lindsey, G. and Farrant J. (2005) Development of plant transformation and regeneration protocols for the dessication-sensitive weeping lovegrass Eragrostis curvula Plant Cell Rep. 24 335-340. Negrotto, D., Jolley, M., Beer, S., Wenck, A.R. and Hansen, G. (2000) The use of phosphomannose-isomerase as a selectable mark er to recover transg enic maize plants ( Zea mays L.) via Agrobacterium transformation. Plant Cell Rep. 19, 798-803. Odell, J.T., Nagy, F. and Chua, N.-H. (1985) Identification of DNA sequences required for activity of the cauliflower mosaic virus 35S promoter. Nature 313 810-812. Ortiz, J.P.A., Pessino, S.C., Leblane, O., Hayw ard, M.D. and Quarin, C.L. (1997) Genetic fingerprinting for determining the mode of reproduction in Paspalum notatum a subtropical apomictic forage grass. Theor. Appl. Genet. 95 850-856.

PAGE 113

113 Ortiz, J.P.A., Pessino, S.C., Bhat, V., Hayward, M. D and Quarin, C.L. (2001) A genetic linkage map of diploid Paspalum notatum Crop Sci. 41 823-830. Petrovska, N., Wu, X., Donato, R., Wang, Z.-Y., Ong, E.-K., Jones, E., Foster, J., Emmerling, M., Sidoli, A., OHehir, R. and Spane nberg, G. (2004) Transgenic ryegrasses ( Lolium spp.) with down-regulation of main pollen allergens. Mol. Breed. 14 489-501. Phillips, A.L., Ward, D.A., Uknes, S., Applef ord, N.E., Lange, T., Huttly, A.K., Gaskin, P., Graebe, J.E. and Hedden, P. (1995) Isolati on and expression of three gibberellin 20oxidase cDNA clones from Arabidopsis Plant Physiol. 108 1049-1057. Phinney, B.O. (1956) Restoration of normal grow th rates to single ge ne dwarf mutants of Zea mays by application of gibberellins. Proc. Natl. Acad. Sci. USA, 42 185-189. Pimenta Lange, M.J. and Lange, T. (2006) Gibberel lin biosynthesis and th e regulation of plant development. Plant Biol. 8 281-290. Potts, W.C., Reid, J.B. and Murfet, I.C. (1985) Internode length in Pisum Gibberellins and the slender phenotype. Physiol. Plant. 63 357-364. Puchta, H. (2000) Removing selectable marker genes: taking the shortcut. Trends Plant Sci. 5 273-274. Quarin, C.L. (1999) Effect of pollen source a nd pollen ploidy on endosperm formation and seed set in pseudogamous apomictic Paspalum notatum Sex. Plant Reprod. 11 331-35. Quesenberry, K.H. and Smith, R.L. (2003) Producti on of sexual tetraploid bahiagrass using in vitro chromosome doubling ag ents. Molecular Breeding of Forage and Turf, Third international symposium, Dallas, TX, May 18-22. Radi, A., Lange, T., Niki, T., Koshioka, M. and Pimenta Lange, M.J. (2006) Ectopic expression of pumpkin gibberellin oxidases alters gi bberellin biosynthesis and development of transgenic Arabidopsis plants. Plant Physiol. 140 528-536. Rashid, H., Yokoi, K., Toriyama, K. and Hi nata, K. (1996) Transgenic plant production mediated by Agrobacterium in Indica rice. Plant Cell Rep. 15 727-730. Rochester, D.E., Winer, J.A. and Shah, D.M. ( 1986) The structure and expression of maize genes encoding major heart shock protein hsp70. EMBO J. 5 451-458. Ross, J.J., Reid, J.B., Swain, S.M., Hasan, O., Poole, A.T., Hedden, P. and Willis, C.L. (1995) Genetic regulation of gibbe rellin deactivation in Pisum Plant J. 7, 513-523. Ross, J.J., Murfet, I.C. and Reid, J.B. (1997) Gibberellin mutants. Physiol. Plant. 100 550-560.

PAGE 114

114 Saghai-Maroof, M.A., Soliman, K.M., Jorgense n, R.A. and Allard, R.W. (1984) Ribosomal DNA spacer-length polymorphisms in barley : mendelian inheritance, chromosomal location, and population dynamics. Proc. Natl. Acad. Sci. USA 81 8014-8018. Sakamoto, T., Kobayashi, M., Itoh, H., Tagiri, A., Kayano, T., Tanaka, H., Iwahori, S. and Matsuoka, M. (2001) Expression of a gibberellin 2-oxidase gene around the shoot apex is related to phase transition in rice. Plant Physiol. 125 1508-1516. Sakamoto, T., Morinaka, Y., Ishiyama, K., Koba yashi, M., Itoh, H., Kayano, T., Iwahori, S., Matsuoka, M. and Tanaka, H. (2003) Genetic manipulation of gibberellin metabolism in transgenic rice. Nat. Biotechnol. 21 909-913. Sakamoto, T., Miura, K., Itoh, H., Tatsumi, T ., Ueguci-Tanaka, M., Ishiyama, K., Kobayashi, M., Agrawal, G.K., Takeda, S., Abe, K., Miyao, A., Hirochika, H., Kitano, H., Ashikari, M. and Matsuoka, M. (2004) An overview of gibberellin metabolism enzyme genes and their related mutants in rice. Plant Physiol. 134 1642-1653. Salehi, H., Seddighi, Z., Kravchenko, A.N. a nd Sticklen, M.B. (2005) Expression of the cryIAc in Arizona Common common bermudagrass via Agrobacterium -mediated transformation and control of black cutworm. J. Am. Society Hort. Sci. 130 619-623. Sampaio, E.V.S.B. and Beaty, E.R. (1976) Morphol ogy and growth of bahi agrass at three rates of nitrogen. Agron. J. 68 377-381. Sandhu, S., Altpeter, F., and Blount, A.S. (2005a ) Marker-assisted eval uation of transgene containment in apomictic bahiagrass. Flor ida Genetics Symposium, Gainesville, FL November 30th December 1st. Sandhu, S., Altpeter, F., and Blount, A.S. ( 2005b) Transgene containment in apomictic bahiagrass cv. Argentine. Internationa l Symposium on Biotechnology of Temperate Fruit Crops and Tropical Species Daytona Beach, FL, October 10th-14th. Sandhu, S., Altpeter, F. and Blount, A.R. ( 2007) Apomictic turf and forage grass ( Paspalum notatum Flugge cv. Argen tine) expressing the bar gene is highly resistant to glufosinate under field conditions Crop Science (In press). Sanford, J.C., De Vit, M.J., Russell, J.A., Smith, E.D., Harpending, P.R., Roy, M.K. and Johnson, S.A. (1991) An improved helium-driven biolistic device. Technique 3 3-16. Sato, H. and Takamizo, T. (2006) Agrobacterium tumefaciens -mediated transformation of forage-type perennial ryegrass ( Lolium perenne L.). Grassland Sci. 52 95-98. Schomburg, F.M., Bizzell, C.M., Lee, D.J., Zeevart, J.A.D. and Amasino, R.M. (2003) Overexpression of a novel class of gibberellin 2-oxidases decreases gi bberellin levels and creates dwarf plants. Plant Cell 15 151-163.

PAGE 115

115 Scott, J.M. (1920) Bahia grass. J. Am. Soc. Agron. 12 112-113. Smith, R.L., Grando, M.F., Li, Y.Y., Seib, J.C. and Shatters, R.G. (2002) Transformation of bahiagrass ( Paspalum notatum Flugge). Plant Cell Rep. 20 1017-1021. Somleva, M.N., Tomaszewski, Z. and Conger, B.V. (2002) Agrobacterium -mediated genetic transformation of switchgrass. Crop Sci. 42 2080-2087. Spanenberg, G., Wang, Z.Y., Nagel, J. and Potry kus, I. (1994) Protoplast culture and generation of transgenic plants in red fescue ( Festuca rubra L.). Plant Sci. 97 83-94. Spanenberg, G., Wang, Z.-Y., Wu, X.L., Nagel, J., Iglesias, V.A. and Potrykus, I. (1995a) Transgenic tall fescue ( Festuca arundinacea ) and red fescue ( F. rubra ) plants from microprojectile bombardment of embryogenic suspension cells. J. Plant Physiol. 145 693-701. Spanenberg, G., Wang, Z.-Y., Wu, X.L., Nagel, J. and Potrykus, I. (1995b) Transgenic perennial ryegrass ( Lolium perenne ) plants from microprojectil e bombardment of embryogenic suspension cells. Plant Sci. 108 209-217. Spanenberg, G., Wang, Z.-Y. and Potrykus, I. ( 1998) Biotechnology in forage and turf grass improvement. Berlin: Springer, 1998. Sparks, A.N. (1979) A review of the biology of the fall armyworm. Fla. Entomol. 62 82-86. Sumner, D.R., Minton, T.A., Br enneman, T.B., Burton, G.W. a nd Johnson, A.W. (1999) Root diseases and nematodes in bahi agrass vegetable rotations. Plant Dis. 83 55-59. Sun, T.P., Goodman, H.M. and Ausubel, F.M. (1992) Cloning the Arabidopsis GA1 locus by genomic subtraction. Plant Cell 4 119-128. Sun, T.P. and Kamiya, Y. (1994) The Arabidopsis GA1 locus encodes the cyclase ent -kaurene synthetase A of gibberellin biosynthesis. Plant Cell 6, 1509-1518. Swemmer, A.M., Knapp, A.K. and Smith, M.D. (2006) Growth responses of two dominant C4 grass species to altered water availability. Int. J. Plant Sci. 167, 1001-1010. Radi, A., Lange, T., Niki, T., Koshioka, M. and Pimenta Lange, M.J. (2006) Ectopic expression of pumpkin gibberellin oxidases alters gi bberellin biosynthesis and development of transgenic Arabidopsis plants. Plant Physiol. 140 528-536. Rodriguez-Kabana, R., Weaver, C.F., Robertson, D.G. and Ivey, H. (1988) Bahiagrass for the management of Meloidogyne arenaria in peanut. Annals Appl. Nematol. 2 110-114.

PAGE 116

116 Rodriguez-Kabana, R., Weaver, C.F., Garcia, R., Robertson, D.G. and Carden, E.L. (1989a) Bahiagrass for the management of root -knot and cyst nematodes in soybean. Nematropica 19 185-193. Rodriguez-Kabana, R., Weaver, C.F., Garcia, R., Robertson, D.G. and Carden, E.L. (1989b) Additional studies on the use of bahiagrass fo r the management of root-knot and cyst nematodes in soybean. Nematropica 19 185-193. Russell, D.A. and Fromm, M.E. (1997) Tissue-speci fic expression in transgenic maize of four endosperm promoters from maize and rice. Transgenic Res. 6 157-168. Thomas, S.G., Phillips, A.L. and Hedden, P. (1999) Molecular cloning and functional expression of gibberellin 2-oxidases, multifunctional en zymes involved in gibberellin deactivation. Proc. Natl. Acad. Sci. USA 96 4698-4703. Torello, W.A., Symington, A.G. and Rufner, R. ( 1984) Callus initiation, plant regeneration and evidence of somatic embryogenesis in red fescue. Crop Sci. 24 1037-1040. Toyama, K., Bae, C.-H., Kang, J.-G., Lim, Y.-P., Adachi, T., Rui, K.-Z., Song, P.-S. and Lee H.Y. (2003) Production of herbic ide-tolerant zoysiagrass by Agrobacterium -mediated transformation. Mol. Cells 16 19-27. Trenholm, L.E, Cisar, J.L. and Unruh, J.B. ( 2003) Bahiagrass for Florida Lawns. EDIS Fact Sheet ENH6 Environmental Horticulture Department, Florida Cooperative Extension Service, Institute of Food and Agricultural Scie nces, University of Fl orida, Gainesville, FL, USA. Tsigbey, F.K., Marois, J.J., Wright, D.L. and Katsvairo, T.W. (2005) In corporationg bahiagrass rotations into peanut cropping systems in North Florida to manage peanut diseases. Proceedings of the American Peanut Research and Education Society 37 104. Unruh, J.B. and Brecke, B.J. (1999) Plant growth re tardants for fine turf and roadsides/utilities. AGR-17, Florida Cooperative Extension Serv ice Institute of Food and Agricultural Sciences, University of Florida Gainesville, FL. van der Valk, P., Proveniers, M.C.G., Pertijs, J.H., Lamers, J.T.W.H., van Dun, C.M.P. and Smeekens, J.C.M. (2004) Late heading of perennial ryegrass cau sed by introducing an Arabidopsis homeobox gene. Plant Breeding 123 531-535. Wang, Z.Y., Takamizo, T., Iglesias, V.A., Osusky, M., Nagel, J., Potrykus, I. and Spanenberg, G. (1992) Transgenic plants of tall fescue ( Festuca arundinacea schreb.) obtained by direct gene transf er to protoplasts. Bio/Technology 10 691-696. Wang, Z.Y., Nagel, J., Potrykus, I. and Spangenber g, G. (1993) Fertile plant regeneration from protoplasts of meadow fescue ( Festuca pratensis Huds.). Plant Cell Rep. 12 95.

PAGE 117

117 Wang, G.R., Binding, H. and Posselt, U.K. (1997) Fe rtile transgenic plants from direct gene transfer to protoplasts of Lolium perenne L. and Lolium multiflorum Lam. J. Plant Physiol. 151 83-90. Wang, Z.-Y., Ye, X.D, Nagel, J., Potrykus, I. and Spanenberg, G. (2001) Expression of a sulphur-rich sunflower albumin gene in transgenic tall fescue ( Festuca arundinacea Schreb.) plants. Plant Cell Rep. 20 213-219. Wang, Y., Henriksson, E., Sdermann, E., Henriksson, K.N., Sundberg, E. and Engstrm, P. (2003) The Arabidopsis homeobox gene, ATHB16 regulates leaf development and the sensitivity to photoperiod in Arabidopsis. Developmental Biology 264 228-239. Wang, Y. and Li, J. (2005) The plant architecture of rice ( Oryza sativa ). Plant Mol. Biol. 59 75-84. Wang, Z.-Y., Bell, J., Ge, Y.X. and Lehmann, D. ( 2003) Inheritance of tran sgenes in transgenic tall fescue ( Festuca arundinacea Schreb.). In Vitro Cell. Dev. Biol. Plant 39 277-282. Wang, Z.-Y. and Ge, Y. (2005) Agrobacterium -mediated high frequency transformation of tall fescue ( Festuca arundinacea Schreb.). J. Plant Physiol. 162 103-113. Wang, Z.-Y. and Ge, Y. (2006) Recent advances in genetic transformation of forage and turf grasses. In Vitro Cell. Dev. Biol.-Plant 42 1-18. Wang, Y. and Li, J. (2006) Genes controlling plant architecture. Curr Opin Biotechnol. 17 123-129. West, S.H. and Marousky, F.J. (1989) Mechan ism of dormancy in Pensacola bahiagrass. Crop Sci. 29, 787-791. Williams, R.C. and Webb, B.C. ( 1958) Seed moisture relationships and germination behavior of acid scarified bahiagrass seed. Agron. J. 50 235-237. Wilson, R.N., Heckman, J.W. and Somerville, C.R. (1992) Gibberellin is required for flowering in Arabidopsis thaliana under short days. Plant Physiol. 100, 403-408. Wu, Y.Y., Chen, Q.J., Chen, M., Chen, J. a nd Wang, X.C. (2005) Salt -tolerant transgenic perennial ryegrass ( Lolium perenne L.) obtained by Agrobacterium tumefaciens -mediated transformation of the vacuol ar Na+/H+ antiporter gene. Plant Sci. 169 65-73. Xiao, L. and Ha, S.B. (1997) Efficient sel ection and regeneration of creeping bentgrass transformants following particle bombardment. Plant Cell Rep. 16 874-878. Xiong, X., James, V.A., Lomba, P., Halbig, S.M., Altpeter, F. and Blount, A.R. (2006) Transgenic approaches to enhance abiotic st ress tolerance of bahiagrass. Florida Genetics Symposium, Gainesville, FL, November 1st-2nd.

PAGE 118

118 Xu, Y.L., Li, L., Wu, K., Peeters, A.J.M., Gage, D.A. and Zeevart, J.A.D. (1995) The GA5 locus in Arabidopsis thaliana encodes a multifunctional gibberellin 20-oxidase: Molecular cloning and functional expression. Proc. Natl. Acad. Sci. USA 92 6640-6644. Xu, J.P., Schubert, J. and Altpeter, F. (2001) Diss ection of RNA-mediated ryegrass mosaic virus resistance in fertile transgenic perennial ryegrass ( Lolium perenne L.). Plant J. 26 265-274. Yamaguchi, S., Sun, T., Kawaide, H. and Kamiya, Y. (1998) The GA2 locus of Arabidopsis thaliana encodes ent -kaurene synthase of gi bberellin biosynthesis. Plant Physiol. 116, 1271-1278. Ye, X., Wang, Z.-Y., Wu, X., Potrykus, I. and Span enberg, G. (1997) Transgenic Italian ryegrass ( Lolium multiflorum ) plants from microprojectile bombardment of embryogenic suspension cells. Plant Cell Rep. 16 379-384. Ye, X., Wu, X.L., Zhao, H., Frehne r, M., Nosberger, J., Potrykus, I. and Spanenberg, G. (2001) Altered fructan accumulation in transgenic Lolium multiflorum plants expressing a Bacillus subtilis sacB gene. Plant Cell Rep. 20 205-212. Yu, T.T., Skinner, D.Z., Liang, G.H., Trick, H.N., Huang, B. and Muthukrishnan, S. (2000) Agrobacterium -mediated transformation of creeping bentgrass using GFP as a reporter gene. Hereditas 133 229-233. Zaghmout, O.M.F. and Torello, W.A. (1988) Enhan ced regeneration in l ong-term callus culture of red fescue by pretreatment with activated charcoal. HortScience 23 615-616. Zhang, G., Lu, S., Chen, T.A., Funk, C.R. and Me yer, W.A. (2003) Transformation of triploid bermudagrass ( Cynodon dactylon X C. transvaalensis cultivar TifEagle) by means of biolistic bombardment. Plant Cell Rep. 21 860-864. Zhang, H., Lomba, P. and Altpeter, F. (2007) Im proved turf quality of transgenic bahiagrass ( Paspalum notatum Flugge) constitutively expressing the ATHB16 gene, a repressor of cell expansion from Arabidopsis. Molecular Breeding (In press). Zhong, H., Bolyard, M.G., Srinivasan, C. and S ticklen, M.B. (1993) Transgenic plants of turfgrass ( Agrostis palustris Huds.) from microprojectile bombardment of embryogenic callus. Plant Cell Rep. 13 1-6. Zhou, H., Arrowsmith, J.W., Fromm, M.E., Hir onaka, C.M., Taylor, M.L., Rodriguez, D., Pajeau, M.E., Brown, S.M., Santino, C.J. and Fry, J.E. (1995) Glyphosate-tolerant CP4 and GOX genes as a selectable marker in wheat transformation. Plant Cell Rep. 15 ,159163.

PAGE 119

119 BIOGRAPHICAL SKETCH Mrinalini Ashok Agharkar was born in Mumbai India. She joined Fergusson College in Pune, India in 1996 and received her Bachelor of Science in botany in 1999. Immediately after, she joined the master of science (MSc) program in the Botany Department at the University of Pune, India in 1999. She obtained her MSc degree with specialization in plant biotechnology in 2001. She was hired as a research fellow at the A gharkar Research Institute (ARI), Pune, India. She worked on the assessment of genetic diversity in the genera Carissa and Asparagus from 2001 to 2003. In 2003, she was admitted into the gra duate program in the Agronomy Department at the University of Florida and was awarded a graduate alumni fellowship. She completed her doctoral program under the supervision of Dr. Fre dy Altpeter at the Univ ersity of Florida in 2007.