<%BANNER%>

Phylogeny and Character Evolution in the Blakeeae (Melastomataceae)

Permanent Link: http://ufdc.ufl.edu/UFE0021173/00001

Material Information

Title: Phylogeny and Character Evolution in the Blakeeae (Melastomataceae)
Physical Description: 1 online resource (176 p.)
Language: english
Creator: Penneys, Darin
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2007

Subjects

Subjects / Keywords: blakea, huilaea, melastomataceae, mutualisms, neotropical, phylogenetics, pollination, systematics, topobea
Botany -- Dissertations, Academic -- UF
Genre: Botany thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: In this dissertation, the systematics of the Neotropical tribe Blakeeae (Melastomataceae) was investigated. A Maximum Parsimony morphological cladistic analysis using 111 characters for 78 species was conducted. Additionally, Maximum Parsimony and Maximum Likelihood molecular analyses sampling 122 species for the nuclear ribosomal internal transcribed spacer (ITS) region, and three chloroplast regions, accD-psaI, atpB-rbcL spacer, and trnL-trnF, were conducted as individual and combined analyses. Finally, a Maximum Parsimony analysis was performed combining all morphological and molecular data sets. These analyses all support the transfer of Topobea to Blakea (which has nomenclatural priority), as all cladistic evidence indicated that the genera, as currently circumscribed, are polyphyletic. Additionally, the hummingbird-pollinated, Andean tree genera, Chalybea and Huilaea, must be transferred into the Blakeeae, as they are consistently strongly supported as members of that tribe, and not the Miconieae where they had formerly been placed. Detailed discussions regarding character evolution and clades identified within the tribe are provided. A revised and expanded circumscription of the tribe is also presented along with a key to the genera and an enumeration of new combinations under Blakea.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Darin Penneys.
Thesis: Thesis (Ph.D.)--University of Florida, 2007.
Local: Adviser: Judd, Walter S.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2009-08-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2007
System ID: UFE0021173:00001

Permanent Link: http://ufdc.ufl.edu/UFE0021173/00001

Material Information

Title: Phylogeny and Character Evolution in the Blakeeae (Melastomataceae)
Physical Description: 1 online resource (176 p.)
Language: english
Creator: Penneys, Darin
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2007

Subjects

Subjects / Keywords: blakea, huilaea, melastomataceae, mutualisms, neotropical, phylogenetics, pollination, systematics, topobea
Botany -- Dissertations, Academic -- UF
Genre: Botany thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: In this dissertation, the systematics of the Neotropical tribe Blakeeae (Melastomataceae) was investigated. A Maximum Parsimony morphological cladistic analysis using 111 characters for 78 species was conducted. Additionally, Maximum Parsimony and Maximum Likelihood molecular analyses sampling 122 species for the nuclear ribosomal internal transcribed spacer (ITS) region, and three chloroplast regions, accD-psaI, atpB-rbcL spacer, and trnL-trnF, were conducted as individual and combined analyses. Finally, a Maximum Parsimony analysis was performed combining all morphological and molecular data sets. These analyses all support the transfer of Topobea to Blakea (which has nomenclatural priority), as all cladistic evidence indicated that the genera, as currently circumscribed, are polyphyletic. Additionally, the hummingbird-pollinated, Andean tree genera, Chalybea and Huilaea, must be transferred into the Blakeeae, as they are consistently strongly supported as members of that tribe, and not the Miconieae where they had formerly been placed. Detailed discussions regarding character evolution and clades identified within the tribe are provided. A revised and expanded circumscription of the tribe is also presented along with a key to the genera and an enumeration of new combinations under Blakea.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Darin Penneys.
Thesis: Thesis (Ph.D.)--University of Florida, 2007.
Local: Adviser: Judd, Walter S.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2009-08-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2007
System ID: UFE0021173:00001


This item has the following downloads:


Full Text

PAGE 1

1 PHYLOGENY AND CHARACTER EVOLUTION IN THE BLAKEEAE (MELASTOMATACEAE) By DARIN S. PENNEYS A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2007

PAGE 2

2 2007 Darin S. Penneys

PAGE 3

3 To my family

PAGE 4

4 ACKNOWLEDGMENTS I acknowledge the assistance of numerous people and organizations that have contributed to the success of this investigation. First and foremost, I thank my advisor and committee chairperson, Walter S. Judd, fo r his exceptional guidance throughout my graduate career. Frank Almeda has generously shared his wisdom and in sights regarding Melastomataceae systematics. Norris H. Williams and W. Mark Whitten pr ovided assistance with DNA sequencing. Doug E. Soltis and Jon Reiskind are acknowledged for their helpful comments. Amongst the people who assisted with fieldwor k, or who provided collections, a special gratitude is extended to Diana F rnandez who accompanied me in th e field in Ecuador, and later arranged for the liberation from governmental cont rol the entire set of collections from that expeditition. Maria-Eugenia Mo rales-P. is gratefully acknowle dged for sharing collections of Colombian melastomes, and also for her ongoing collaborations. Ri cardo Kriebel and Frank Almeda for providing material of Blakea venusta and T. gerardoana ; Bill Haber for bringing me to material of T. brenesii ; Fabian Michelangeli for B. schlimii ; Barry Hammel for his help in finding B. austin-smithii on Cerro Chompipe; J. Richard Abbott for T. calycularis ; Chris Baraloto for collections of Bellucia, Henriettea, Loreya and Votomita ; and Judy Chen for Astronia and Pternandra Mario Blanco assisted with fi eldwork in Costa Rica and Panam. Fabian Michelangeli and the Lewis B. and Dorothy Cullman Program for Molecular Systematics Studies (NYBG) provided laborator y support at an early stage in this study. Matt Gitzendanner assisted with instruction on the use of GARLI. Organizations that provided cr itical support and collection pe rmits include in Costa Rica, Javier Guevara and the Ministerio del Ambiente y Energi; the Bosque Eterno de los Nios for permission to collect in their biological stations San Gerardo and Pocosol; and the Las Cruces Biological Station. In Panam, the Autoridad N acional del Ambiente for collecting permits, and

PAGE 5

5 Andres Maduro for assisting with permits and gene rously sharing his home at the Finca Dracula. In Ecuador, the Ministerio del Ambiente, Hugo Navarette, Diana Frnandez, Florian Werner, Nestor Len, Jaime Jaramillo, Fundacin Joco toco, Fundacin Jatun Sacha, and the San Francisco Biological Station. Funding was generously provided by th e National Science Foundation, Doctoral Dissertation Improvement Grant DEB: 0508582, the American Society of Plant Taxonomists, and the Botanical Society of America. The staff of the University of Florida Herbarium (FLAS), especially the careful curatorial work done by Kent Perkins and Trudy Linder, is gratefully acknowledge d. The curators and staff at CAS, INBio, LOJA, MO, NY, PMA, QCA, QCNE, STRI, and US are all acknowledged; MO, NY, and US in particular for providing specimens on loan.

PAGE 6

6 TABLE OF CONTENTS page ACKNOWLEDGMENTS...............................................................................................................4 LIST OF TABLES................................................................................................................. ..........9 LIST OF FIGURES................................................................................................................ .......10 ABSTRACT....................................................................................................................... ............13 CHAPTER 1 INTRODUCTION..................................................................................................................14 2 MORPHOLOGICAL CLADISTIC ANALYSIS OF THE BLAKEEAE (MELASTOMATACEAE).....................................................................................................20 Introduction................................................................................................................... ..........20 Materials and Methods.......................................................................................................... .20 Taxon Sampling...............................................................................................................20 Plant Materials................................................................................................................ .21 Phylogenetic Analysis.....................................................................................................21 Character Selection and Coding......................................................................................22 Characters..................................................................................................................... ...23 Results........................................................................................................................ .............40 Analysis of Qualitative Characters..................................................................................40 Analysis of Quantitative Characters................................................................................41 Analysis of All Morphological Characters......................................................................42 Discussion..................................................................................................................... ..........43 Support for Blakeeae.......................................................................................................43 Chalybea and Huilaea .....................................................................................................44 Monophyly of the Blakea + Topobea Clade....................................................................46 Anther Morphology and Generic Limits of Blakea and Topobea ...................................47 Character Evolution: Noteworthy Examples...................................................................50 Growth habit and form ............................................................................................. 51 Formicaria and ant associations ............................................................................. 52 Acarodomatia and mite associations ...................................................................... 54 Stipules.................................................................................................................... 56 Leaf venation ..........................................................................................................57 Encapsulating floral bracts ......................................................................................57 Fused bracts.............................................................................................................58 Bracts and p ubescence............................................................................................. 59 Calyx........................................................................................................................60 Corolla......................................................................................................................61 Androecium..............................................................................................................62 Gynoecium...............................................................................................................66

PAGE 7

7 Noteworthy Clades..........................................................................................................68 The fused-bract clade .............................................................................................68 Topobea parasitica complex ................................................................................... 69 Rodent-pollinated clade ..........................................................................................71 Hexandrous Topobea ................................................................................................73 3 MOLECULAR AND COMBINED MO LECULAR AND MORPHOLOGICAL CLADISTIC ANALYSES OF THE BLAKEEAE (MELASTOMATACEAE)..................108 Introduction................................................................................................................... ........108 Materials and Methods.........................................................................................................108 Plant Material................................................................................................................108 Morphological Data.......................................................................................................109 DNA Extraction.............................................................................................................110 DNA Regions and Primers............................................................................................110 Amplification.................................................................................................................111 Sequencing....................................................................................................................111 Sequence Editing and Alignment..................................................................................111 Cladistic Analysis..........................................................................................................112 Results........................................................................................................................ ...........113 ITS............................................................................................................................ .....113 accD-psaI and trnL-trnF ............................................................................................... 115 atpB-rbcL ...................................................................................................................... .115 accD-psaI + atpB-rbcL + trnL-trnF ............................................................................. 116 ITS + accD-psaI + atpB-rbcL + trnL-trnF ...................................................................117 Morphological Characters.............................................................................................118 ITS + accD-psaI + atpB-rbcL + trnL-trnF + Morphology........................................... 119 Discussion..................................................................................................................... ........120 Support for the Blakeeae...............................................................................................120 Chalybea + Huilaea .......................................................................................................121 Generic Circumscription of Blakea and Topobea .........................................................123 Noteworthy Clades Within Blakea Sensu Lato.............................................................125 Parasitica clade ......................................................................................................125 Hexandrous clade .................................................................................................. 127 Imbricate calyx clade ............................................................................................ 127 Solanum -flowered clade .......................................................................................128 Vertebrate-pollinated clade ................................................................................... 130 Blue-anther clade ..................................................................................................132 Wet bud clade .......................................................................................................133 4 TAXONOMY AND NOMENCLATURE...........................................................................148 Introduction................................................................................................................... ........148 Circumscription of Blakeeae:...............................................................................................152 Blakeeae....................................................................................................................... .152 Key to the Genera of Blakeeae......................................................................................156 Chalybea ........................................................................................................................156

PAGE 8

8 Huilaea ..........................................................................................................................157 Blakea ............................................................................................................................158 New Combinations........................................................................................................159 LIST OF REFERENCES.............................................................................................................167 BIOGRAPHICAL SKETCH.......................................................................................................176

PAGE 9

9 LIST OF TABLES Table page 2 Specimens examined in morphological cladistic analysis of the Blakeeae.......................99 2 Morphological character matrix for cl adistic analysis of the Blakeeae...........................100 2 Character state changes on representative tree in morphological analysis of the Blakeeae....................................................................................................................... ....103 3 Specimens examined in cladistic analysis of the Blakeeae.............................................134 3 Analyses of morphological and molecular data sets for Blakeeae, with additional outgroups...................................................................................................................... ....138 3 Summary bootstrap statistics for named clades in morphological, molecular and combined analyses of the Blakeeae.................................................................................139

PAGE 10

10 LIST OF FIGURES Figure page 1 Floral variation in Blakea ...................................................................................................18 1 Floral variation in Topobea Chalybea and Huilaea .........................................................19 2 Generalized diagrammatic flower of Blakeeae showing selected measurement definitions.................................................................................................................... ......74 2 Stipule form in the Blakeeae (character 5)........................................................................75 2 Acarodomatia in the Blakeeae (character 11)....................................................................76 2 Graph illustrating variation in tertiary ve in separation in the morphological analysis of the Blakeeae (character 17)...........................................................................................77 2 Graph illustrating variation in peduncle le ngth in the morphological analysis of the Blakeeae (character 20)......................................................................................................78 2 Graph illustrating length of the fused por tion of the outer flor al bracts in the morphological analysis of the Blakeeae (character 30).....................................................79 2 Pubescence types found in the Blakeeae...........................................................................79 2 Outer floral bract texture in the Blakeeae (character 37)...................................................80 2 Graph illustrating length of the fused por tion of the inner flor al bracts in the morphological analysis of th e Blakeeae (character 44).....................................................80 2 Graph illustrating length of the calyx tube in the morphological analysis of the Blakeeae (character 52)......................................................................................................81 2 Foliaceous calyx appendage (character 58).......................................................................81 2 External calyx tooth form in the Blakeeae (character 61).................................................82 2 Graph illustrating the anther length to width quotient (character 75) in the morphological analysis of the Blakeeae............................................................................82 2 Variation in Blakeeae anther pore form (character 80).....................................................83 2 Graph illustrating length of the anther appendage (character 84) in the morphological analysis of the Blakeeae.....................................................................................................83 2 Variation in the form of anther connec tive tissue in the Blakeeae (character 87).............84 2 Anther connective appendage varia tion in the Blakeeae (character 90)............................85

PAGE 11

11 2 Ovary locule apex form in the Blakeeae (character 98)....................................................86 2 Ovary apex appendage variation in the Blakeeae (character 101).....................................87 2 Graph illustrating length of the stigma (c haracter 106) in the morphological analysis of the Blakeeae................................................................................................................ ...88 2 Coloration of mature Blakeeae fruits (character 110)........................................................88 2 Strict consensus of 20 equally parsimoni ous trees derived from the analysis of 77 qualitative morphological characters.................................................................................89 2 Strict consensus of 20 equally parsimoni ous trees derived from the analysis of 34 quantitative morphological characters...............................................................................90 2 One of 8 equally parsimonious trees deri ved from the analysis of 111 morphological characters..................................................................................................................... ......91 2 Distribution of anther pore number in the Blakeeae..........................................................92 2 Distribution of anther connective appendage forms in the Blakeeae................................93 2 Anther length to width ratio in the Blakeeae.....................................................................94 2 Distribution of acarodomatia in the Blakeeae....................................................................95 2 Morphological character di stribution for the fused-br act clade of Blakeeae.....................96 2 Morphological character di stribution for the paras itica clade of Blakeeae.......................97 2 Morphological character dist ribution for the rodent-pollin ated clade of Blakeeae...........98 2 Morphological character di stribution for the hexandrous clade of Blakeeae....................98 3 Strict consensus of 6597 equally most pa rsimonious trees based upon ITS data in the phylogenetic analysis of the Blakeeae.............................................................................140 3 Strict consensus of 8134 equally most parsimonious trees based upon atpB-rbcL intergenic spacer region data in the phylogenetic analysis of the Blakeeae....................141 3 Strict consensus of 1600 equally most parsimonious trees based upon accD-psaI + atpB-rbcL + trnL-trnF data in the phylogenetic analysis of the Blakeeae......................142 3 Strict consensus of 4910 equally most parsimonious trees based upon ITS + accDpsaI + atpB-rbcL + trnL-trnF data in the phylogenetic analysis of the Blakeeae..........143 3 One of 4910 equally most parsimonious trees based upon ITS + accD-psaI + atpBrbcL + trnL-trnF data in the phylogenetic analys is of the Blakeeae with branch lengths illustrated............................................................................................................ .144

PAGE 12

12 3 ML tree resulting from combined ITS + accD-psaI + atpB-rbcL + trnL-trnF phylogenetic analysis of Blakeeae...................................................................................145 3 One of 8 equally most parsimonious trees resulting from the morphological phylogenetic analysis of Blakeeae...................................................................................146 3 Strict consensus of 37 equally most parsimonious trees resulting from the ITS + accD-psaI + atpB-rbcL + trnL-trnF + morphology phylogenetic analysis of Blakeeae....................................................................................................................... ....147

PAGE 13

13 Abstract of Dissertation Pres ented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy PHYLOGENY AND CHARACTER EVOLUTION IN THE BLAKEEAE (MELASTOMATACEAE) By Darin S. Penneys August 2007 Chair: Walter S. Judd Major: Botany In this dissertation, the systematics of the Neotropical tribe Blak eeae (Melastomataceae) was investigated. A Maximum Pa rsimony morphological cladistic an alysis using 111 characters for 78 species was conducted. Additionall y, Maximum Parsimony and Maximum Likelihood molecular analyses sampling 122 species for the nuclear ribosomal intern al transcribed spacer (ITS) region, and thre e chloroplast regions, accD-psaI atpB-rbcL spacer, and trnL-trnF were conducted as individual and co mbined analyses. Finally, a Maximum Parsimony analysis was performed combining all morphological and molecula r data sets. These an alyses all support the transfer of Topobea to Blakea (which has nomenclatural priority ), as all cladistic evidence indicated that the genera, as currently circ umscribed, are polyphylet ic. Additionally, the hummingbird-pollinated, Andean tree genera, Chalybea and Huilaea, must be transferred into the Blakeeae, as they are consistently strongly supported as members of th at tribe, and not the Miconieae where they had formerly been place d. Detailed discussions regarding character evolution and clades identifie d within the tribe are provi ded. A revised and expanded circumscription of the tribe is also presented al ong with a key to the genera and an enumeration of new combinations under Blakea

PAGE 14

14 CHAPTER 1 INTRODUCTION Melastomataceae Juss., with approximately 4500 species and 160 genera (Renner 1993), is one of the ten largest families of angiospe rms. The tribe Blakeeae Benth. & Hook., as historically circumscribed, is comprise d of about 180 species in two genera, Blakea L. and Topobea Aubl Blakeeae are strictly Neotropical, with centers of diversity in the megadiverse Choco-Andean region of South America and th e mountains of Costa Rica and Panama, though they range from Chiapas, Mexico, to the Amazon of Bolivia and Brazil, to French Guiana. Three species are found in the West Indies. Blakeeae are a monophyletic tribe (Michelangeli et al. 2004; Penneys et al. 2004), whose two genera are characterized by wood with multiser iate rays, the frequent occurrence of druse crystals, axillary, fasciculate inflorescences, larg e, 6-merous flowers each subtended by two pairs of decussate bracts (Figs. 1, 1), and be rry fruits (Almeda 1990). Blakeeae may be terrestrial, hemiepiphytic, epiphytic, or even stra nglers, and growth forms include lianas, shrubs, and small to emergent treesintermediate forms such as lianescent shrubs also occur. Flowers in this tribe are typically large and showy (up to 18 cm in diameter in Blakea princeps Cogn.), attracting a diversity of pollinators, including vari ous insects, birds, possibly bats (M. Morales, pers. comm.), and most remarkably, rodents. The rodent pollination syndrome is exceedingly rare and in the New World is known only from five species of Blakea and one species of Cajophora (Loasaceae) (Cocucci & Srsic 1998; Johnson et al. 2001). Mites and ants live in mutualistic associations in leaf and stem domatia of many Blakeeae (Fig. 2). Many species in this group have great potentia l in the horticultura l trade, but are as yet under utilized. Blakea was first described and illustrated by Browne (1756); later, Linnaeus (1759) assigned the binomial B. trinervia to this Jamaican species. Based upon his work in French

PAGE 15

15 Guiana, Aublet (1775) described Topobea parasitica (in the class Dodecandria, order Monogynia) without comparing it to any other ge nus. Jussieu (1789) recognized both genera and separated them on the basis of ovary position. David Don (1823) synonymized Topobea under Blakea with the stated justification of recen tly discovered species having nullified any supposed difference regarding terrestrial vs. hemiep iphytic (parasitic) habit, and in the number of bract pairs subtending each flowerhe made no mention of morphologi cal characteristics of the anthers or ovaries. This inclusive inte rpretation was followed by de Candolle (1828). Naudin (1852) resurrected Topobea and also described Pyxidanthus to accommodate three Andean species. The same arrangement was followed by Triana (1871), though he transferred the latter genus, and Valdesia Ruiz & Pavon, to Blakea Baillon (1881) followed the inclusive circumscription of Don, noting that the anther morphology was variable, and that some species occasionally have three sets of floral br acts. Cogniaux (1886, 1891) provided the first explicit key to the two genera and emphasized the form of the filaments and anthers in differentiating them, characters that also had been noted earl ier (Bentham & Hooker 1867). According to Cogniaux, Blakea has filaments that are thick (vs. filiform in Topobea), and anthers that are short, obtuse, laterally compressed, with a thick connective terminating in a spur (vs. anthers linear to oblong-subulate, rostrate, with a narrower connectiv e, sometimes lacking a spur). Except for Macbride (1941) who took a more inclusive view of Blakea recent workers have followed Cogniaux in recognizing Topobea (e.g., Standley 1924, 1938; Standley and Williams 1963; Gleason 1958; Wurdack 1973, 1980; Almeda 1990, 2000a, 2001a, 2001b, 2007). Gleason (1945) chose to maintain Topobea on the basis of his respec t for tradition, aversion to merging genera that are well-established in the l iterature, and his belief that the genera were easily separable (intermediate species were essentially unknown to him). Wurdack (1957)

PAGE 16

16 ascribed to the same philosophy. Alme da (2001a, 2001b, 2007) has also recognized Topobea though with reservations (1974, 1989, 1990). For additional detail s on the taxonomic history of the Blakeeae, see Almeda (1990). An examination of species exhibiting the typical androecium character suites for each genus might provide justification for their separation, but a number of intermediate species have been discovered, eroding the already-dubious and long-contested dist inctions between the genera. In order to accommodate these taxa, Al meda (1990, p. 305) expanded the generic key of Cogniaux as follows: Stamens 12 in number; anthers 2-pored, oval, oblong, or elliptic, compressed laterally, bluntly obtuse or broadly rounded at the summit with two typically wellseparated (often minute) apical pores Blakea Stamens 6, 8 ,or 12 in number; anthers 1-pored or 2-pored, linear-oblong to obl ong-subulate or rostrate, usuall y not compressed laterally (if conspicuously compressed then 1-pored or dorso -basally appendiculate) with approximate or confluent dorsally inclined pores (if pores are prominently inclined ventrally then flowers are hexandrous or pedicels are beset with spreading brown hairs 1-2.5 mm long) Topobea The phylogenetic analyses of the Blakeeae presen ted here complement other recent efforts to elucidate ill-defined infraf amilial relationships within Melastomataceae (Clausing & Renner 2001; Schulman, & Hyvnen 2003; Fr itsch et al. 2004; Michelange li et al. 2004; Judd 2007). Blakeeae were last given comprehensive system atic consideration by Cogniaux (1891) whose treatment included 54 species, and since that tim e the number of described species has nearly quadrupled. These phylogenetic analyses seek to elucidate the evolutiona ry relationships of Blakea and Topobea and serve as a foundation for futu re monographic work by providing a hypothesis of phylogenetic relationships of th ese plants allowing us to move beyond the

PAGE 17

17 subjective and phenetic-based classi fications that have been main tained in order to facilitate floristic treatments (Wurdack 1973, 1980; Almeda 2007). Also investigated in this tr eatment is the hypothesis that Chalybea and Huilaea are members of the Blakeeae, rather than the Miconieae as was suggested by Wurdack (1957). Previous workers have suggested an affinity between these two genera and the Blakeeae (KoekNoorman et al. 1979; ter Welle & Koek-Noor man 1981) on the basis of wood anatomical characters, a result that has al so been supported by preliminary molecular data (Penneys et al. 2004). In the following chapters, a series of separa te and combined morphological and molecular cladistic analyses of the Blakeeae are provided. Chapter 2 is a morphological analysis and includes detailed discussions of ch aracter evolution. Chapter 3 fo cuses on molecular analyses of nucleotide sequence variation in nuclear ribos omal ITS and three chloroplast regions; accD-psaI, atpB-rbcL and trnL-trnF Included in Chapter 3 are anal yses of each individual DNA region, a combined analysis of the three chloroplast regi ons, and a combined, four-region analysis. All molecular analyses were conducted using both Maximum Parsimony and Maximum Likelihood methods; analyses including morphology were ba sed solely on Maximum Parsimony. Finally, a parsimony analysis combining four-molecular re gions, plus a morphological data set, is presented. Chapter 4 provides an updated circum scription of the Blakeeae and an enumeration of nomenclatural changes.

PAGE 18

18 Fig. 1. Floral variation in Blakea a) Blakea anomala b) B. brasiliensis c) B. chlorantha d) B. foliacea e) B. fuchsioides f) B. grandiflora g) B. hirsuta h) B. hispida i) B. involvens j) B. litoralis k) B. oldemanii l) B. pauciflora m) B. pulverulenta n) B. repens o) B. rosea p) B. scarlatina q) B. subvaginata r) B. tuberculata s) B. wilburiana t) B. wilsoniorum

PAGE 19

19 Fig. 1. Floral variation in Topobea Chalybea and Huilaea a) Topobea acuminata b) T. calycularis (photo by J.R. Abbott). c) T. crassifolia (photo by W. Mark Whitten). d) T. maurofernandeziana e) T. multiflora f) T. parasitica (photo by M.E. MoralesP.). g) T. pittieri h) T. subscabrula i) T cf. watsonii j) Chalybea corymbifera (photo by M.E. Morales-P.). k) Huilaea calyptrata l. H) ecuadorensis

PAGE 20

20 CHAPTER 2 MORPHOLOGICAL CLADISTIC ANALYSIS OF THE BLAKEEAE (MELASTOMATACEAE) Introduction The goal of this morphological cladistic an alysis is to examine the support for the monophyly of Blakea and Topobea as well as to clarify relations hips within the Blakeeae. Also further tested here is the hypothesis that Chalybea and Huilaea are properly placed in the Blakeeae (Penneys et al. 2004), rather than in the Miconieae (Wurdack 1957, Judd and Skean 1991). To achieve these objectives, 111 morphologi cal characters were observed and scored for 78 taxa. With guidance provided by a separate ly conducted four-region, combined molecular analyses, four species from three phylogenetically adjacent tribes we re selected as outgroups. I have concentrated on relationships within Blakeeae as the proper assessment of outgroup relationships will remain somewhat obscure until completion of a large-scale, familial molecular cladistic analysis, but current hypotheses s uggest that the Bertolonieae, Microlicieae, Melastomeae, or the Dissochaeteae-Sonerileae co mplex (Clausing et al. 2000; Clausing & Renner 2001; Penneys, unpublished data) may be most closely related to the Blakeeae. Materials and Methods Taxon Sampling This analysis includes 78 OTUs, four of which are used as outgroups. Monochaetum floribundum and Tibouchina longifolia (Tibouchineae), Graffenrieda latifolia (Merianieae), and Miconia laevigata (Miconieae), were selected on the basis of their respective placement as tribes closely related to the Blakeeae, as indicated by a separate four-region, molecular analysis (Penneys, this dissertation). Amongst the 74 ingroup OTUs, 48 are referred to Blakea two of which ( Blakea involvens DSP1625 and B. pulverulenta DSP1627 ) were collected from cultivat ed plants lacking collection

PAGE 21

21 data at the Atlanta Botanical Garden. These tw o species were included in order to test the capability of this character matrix and phylogenetic analysis to properly place specimens of unknown provenance. Twenty-three OTUs belong to Topobea The 71 taxa of Blakea and Topobea span most of the geographical range and morphological variation of described species in the two genera, though endemic Colomb ian taxa are presently underrepresented. Chalybea corymbifera, Huilaea ecuadorensis and Huilaea calyptrata are included as ingroup taxa in the analysis as their placemen t in Blakeeae was suggested by Penneys et al. (2004) and subsequently confirmed by recent an alyses (Chapter 3; Morales-P. & Penneys, unpublished data). Table 1 enumerates the taxa sampled, vouchers (along with their place of deposition), and includes authority names, which will not be repeated elsewhere. Plant Materials Field collections, including herbarium speci mens, EtOH-preserved (fixed in FAA) materials, and photographs, were made of nearly a ll taxa used in this st udy (Table 1), and the vast majority of morphological observations comes strictly from these materials. Reproductive characters account for 89 of 111 characters in the matrix (Table 2) and with the exception of ten taxa that were scored from re-hydrated herbar ium sheets, observations were made from EtOHpreserved flowers. Fig. 2 illustrates how some floral characters were defined and measured. In the rare instances (e.g. stamens of T. caliginosa T. hexandra and T. cordata ) in which particular structures were not av ailable, character values were ta ken from the literature if they could be unambiguously applied; otherwise the character state was treated as missing. Phylogenetic Analysis A character matrix (Table 2) with 78 taxa scored for 111 characters was analyzed using Maximum Parsimony as implemented in PAUP*4.0b10 (Swofford 2002). The matrix consists of 50 binary and 61 multistate characters. Of 8658 cells, 495 (5.72%) were scored as either missing

PAGE 22

22 data or inapplicable. All char acters were treated as unordered a nd equally weighted. Heuristic searches were performed with 1000 tree-bis ection-reconnection (T BR) branch swapping searches, starting trees were obtained from step wise random addition replicates with 10 trees held at each step, MulTrees in effect, and st eepest descent option not in effect. Bootstrap analyses were performed with 1000 replicates, 2 TBR branch swapping searches, starting trees were obtained from stepwise random addition rep licates with 2 trees held at each step with MulTrees in effect, and steepest descent option not in effect. More rigorous bootstrap analyses (1000 replicates, 10 TBR branch swapping search es, starting trees obtained from stepwise random addition replicates with 10 trees held at each step) were also performed but these recovered identical clades, a nd in all cases the strength of support was within 0%. This methodology was employed for three analyses of the data matrix: 1) one using only qualitative characters, with a total of 77 char acters included, 2) one using only quantitative characters, with a tota l of 34 characters incl uded, and, 3) one includ ing all 111 characters. Character sets were treated separately in or der to elucidate the re lative phylogenetic signal contained in each partition. Character Selection and Coding Below is an enumeration of the 111 morphologi cal characters used in this investigation along with notes on state delimitations. Seventy-se ven characters are treated here as qualitative, and their coding was generally unambiguous (e .g., margin entire vs. toothed, inflorescence terminal vs. axillary, etc.). The distinction betwee n qualitative and quantitative characters is sometimes blurred (Stevens 1991; Thiele 1993), and an attempt was made to treat as metric any character that could be construed as such. Thir ty-four characters, listed with either millimeter units or ratios, are strictly mo rphometric and require a detaile d presentation of the techniques used to analyze the da ta and delimit states.

PAGE 23

23 Initially, about 250 morphological features we re considered for potential inclusion as cladistic characters. Traits that were autapomor phic, or subsequently proven to be invariable (e.g. peduncle insertion in axils vertical, ridges on inner hypanthium present, anthers porose), linked with a character included in the matrix (e.g., hyaline processes located between floral bracts correlated with membranaceous stipules, br act nerve number correlat ed with bract width), or that varied continuously in a manner that precl uded division into discrete states (e.g., shapes of internodes, leaves, calyx lobes, hypanthium, anther summit curv ature, etc.), were excluded. All remaining quantitativ e traits were plotted graphically along a curv e, and divided into nonoverlapping states using simple ga p coding (e.g., Figs. 2, 2, 2, 2, 2, 2, 2, 2 20), illustrate this approach; Almeida & Bisby 1984). This procedure has been discussed and generally advocated by Stevens (1991) and Gift & Stevens (1997), but may result in the loss of some phylogenetic signal as compared to othe r methods of coding quan titative character data (Garcia-Cruz & Sosa 2006). Characters 1. Plants predominantly terrestrial (0 ); hemiepiphytic (1); epiphytic (2). Members of the Blakeeae may be terrestrial sh rubs or trees, hemiepiphytes, epiphytes, or even stranglers. Taxa were scored according to their predominant form as interpreted on the basis of field observations, along with info rmation on herbarium labels and in species descriptions. While some species are apparently uniform in habit, others exhibit plasticity depending on local environmental conditions. Some species (e.g. Blakea chlorantha, B. crinita ) when encountered atop exposed, cloud forest ri dges are mainly terrestrial, while in nearby sheltered areas the same species are hemiep iphytes. Here, the predominant condition was generally scored, though species commonly encountered both terres trially and as hemiepiphytes were scored as polymorphic. Although cas ual collectors commonly note many species as

PAGE 24

24 epiphytes, careful observation usua lly proves that the root syst em descends the host trunk and penetrates the soil. 2. Plants herbaceous (0); lianescent (1); co mpact shrub (2); large shrub or tree (3). Blakeeae are uniformly woody plants ranging fr om rather slender-stemmed root-climbers (e.g., Blakea wilburiana Topobea brevibractea both with stems ca. 2 cm wide) to massive strangling trees over 30 meters ta ll and ultimately developing trunks one meter in diameter (e.g. Blakea rotundifolia ). Those species scored as compact sh rubs (state 2) are relatively densely branched with crown diameters of under two meters. 3. Formicaria absent (0); formicaria formed from hollow twigs, with subnodal entrance (1); layered, membranaceous stip ules forming formicaria (2). Approximately 11 species of Blakeeae harbor ants in morphologically diverse formicaria, not all of which were sampled in this investigation. Topobea inflata (and several related species) has hollow internodes that are ap ically bulbous and inflated. Blakea formicaria has inflated lamina bases. Formicaria are also diverse in the Miconieae, occurring in genera such as Clidemia, Conostegia, Maieta and Tococa (Michelangeli 2000). 4. Node width (mm): 2.3.8 (0 ); 4.32 (1); 10.35 (2). Nodal widths were measured approximately 5 nodes below the twig apex. 5. Stipules absent (0); present and coriaceous (1); present and papery (2). In the Myrtales, stipules are generally regard ed as being rudimentary (Dahlgren & Thorne 1984). In some Blakeeae and paleot ropical Dissochaeteae, interpe tiolar stipules (or stipuliform flaps sensu Wurdack) occur. The stipules (Fig. 2) scored as state (1) are quite similar to the interpetiolar stipules characteristic of Rubiaceae, though developmental studies of melastomataceous stipules are needed, and they may prove to be non-homologous with stipules

PAGE 25

25 in other families. In state (2), the stipules are very large (to ca. 8 x 3 cm), thin, occur in a multilayered series, and are sometimes inhabited by ants The correlation between papery stipules and ant habitation remains unknown in a series of Colombian species of Blakea 6. Nodal ridge absent or very low (0); pronounced to very prominent (1). 7. Petioles basally terete, or nearly so (0); laterally expanded to stem-clasping (1). In species with stem-clasping petiole bases, the flower buds are usually encapsulated and protected until they, and the leaves, are fairly mature. In extreme cases (e.g., Blakea involvens, B. platypoda ) the petioles are not only deeply sulcate, but also essentially winged. 8. Leaf length (mm): 39 (0); 90 (1); 212 (2). 9. Leaf width (mm): 10 (0); 34 (1); 58 (2); 98 (3). 10. Foliar acarodomatia absent (0); marginal (1); in the vein ax ils (2); at the apex of the petiole (3). Acarodomatia are common in Neotropical Melastomataceae, and the Blakeeae are no exception. Many species throughout the tribe s geographical range produce specialized structures interpreted as acarodomatia. Walter (2 004) noted that moderately setose leaves may also provide a favorable habitat for mites without the development of actual domiciles; leaves with this type of pubescence were not scored as harboring mites. 11. Acarodomatia hair tuft (0): marsupiform poc ket (1); open pocket (2); recessed pit (3); lateral laminae (4); pinwheel (5); petiolar flap (6); coalesced veins (7); revolute margin (8). Mite domatia in the Blakeeae (Fig. 2) are morphologically diverse These structures are always located near the base of the lamina, a nd are generally composed of hairs or membranes arising from major veins or leaf blades. Hair tufts (Fig. 2a, st ate 0) are perhaps the simplest form and consist of setae attach ed to major vein bases and/or laminar epidermis between the

PAGE 26

26 veins. Marsupiform pockets (Fig. 2b, state 1) occur when major veins are baso-laterally coalesced. The open pocket (Fig. 2c, state 2) here applies only to Topobea dodsonorum a taxon in which it appears as though the marsupiform pocket has been pulled open and the expanded tissue is held essentially perpendicula r to the leaf blade. The recessed pit domatium (Fig. 2d, state 3) occurs where a concavity is partially enclosed by leaf tissue creating an opening that may either be central or apical over the pocket. State 4 (Fig. 2e), lateral laminae, describes the condition in which tissue flaps exte nd out from the vein bases, and usually only from the midrib and interior side of innermost secondary veins. Chalybea corymbifera and Huilaea spp. all have pinwheel (Fig. 2f, state 5) acarodomatia that are produced from laminar flaps of tissue projecting from each side of each major vein and somewhat overlapping. Blakea austin-smithii and B. chlorantha share a unique hemispheric flap of tissue (Fig. 2g, state 6) that projects away from the lamina, covers, and partially encloses, the apical portion of the petiole. Coalesced veins (Fig. 23h, state 7) sometimes enclose enough space to function as a protective domatium. Revolute margins (Fig. 2i, state 8) are common in Graffenrieda (Merianieae), used in this study as an outgroup, a nd consist of small auricles at the leaf base, usually adjacent to the petiole, that are folded under forming a protective space below the blade. 12. Leaf abaxial surface glands absent (0); present and sess ile-globular (1); present and erect (2). Although SEM studies were not co nducted in the current inves tigation, the se ssile globular hair type (state 1) is comparable with the gl ands illustrated in Wurdack (1986), his figures 42 and 44, while the erect glands (state 2) are similar to his figures 3 2, 39, and 51. Characters 12 and 13 were found to vary independently of characters 31.

PAGE 27

27 13. Elongate setae on major veins of abaxial l eaf surface absent (0); present, simple, and smooth (1); present, simple, and roughe ned (2); present and branched (3). Smooth hairs (state 1; Fig. 2b) correlate with Wurdack (1986) fi gures 81; roughened hairs (state 2; Fig. 2c-d) with figures 112; and branched hair s with figures 163. 14. Leaf pairs persistent (0); sma ller leaf occasionally deciduous (1). This character is scored for mature plants on ly. In some secondary hemiepiphytic species (Putz & Holbrook 1986), seedlings that germinate on the ground are essentia lly alternate-leaved, though as adults they have equal, opposite leaves (e.g., Blakea eriocalyx ). This is perhaps an adaptation to climbing host trunks while also cons erving energy in the lowlight environment of the forest floor. This condition, although of potential phylogenetic significance, was not included in these analyses because of inadequa te sampling of seedlings. Several unsampled, Colombian relatives of Topobea dodsonorum (e.g., B. alternifolia T. anisophylla ) are generally alternate-leaved, even as adults, perhaps thr ough retention of this se edling characteristic. 15. Leaf margin entire (0); toothed (1). 16. Secondary vein pairs (including weak submarginal): 2 (0); 3 (1); 4 (2). 17. Distance between tertiary veins (mm) : 0.2.1 (0); 1.25.3 (1); 3.32.47 (2); 12 (3). Distance was measured in the middle of the la mina and the value recorded was an average of about five observations. Blakeeae are often cons idered to have striolate venation (state 0), a condition that has arisen multiple times a nd occurs in only a minority of species. 18. Inflorescence type: other (0 ); ramified truncate monotelic synflorescence (1); nonramified truncate monotelic synflorescence (2). Outgroup taxa are scored as state 0 and have varied inflorescence architectures. MoraOsejo (1966) examined the comparative morphology of Huilaea, Blakea, and Topobea

PAGE 28

28 inflorescences and concluded th at they are homologous, the only si gnificant difference being the presence of paracladia in Huilaea Here, state 1 refe rs to cymose inflorescences that may (e.g., Chalybea corymbifera H. calyptrata ; Fig. 1j-k) or may not be compound ( H. ecuadorensis ; Fig. 1l); state 2 ( Blakea + Topobea ; Fig. 1a, i) includes only unbranched inflorescences. Weberling (1988) also concluded that the para cladia of the proliferating inflorescence are reduced to single flowers in Blakea and Topobea In rare collections of T. dodsonorum (e.g., Penneys 1686 FLAS; McPherson 12500 MO, NY; Clark & Bergman 317 MO) simple cymes are weakly developed. This phenomenon has not been observed in any other species. 19. Inflorescence terminal (0); axillary (1). 20. Peduncle length (mm): 1.5 (0); 5 (1 ); 12 (2); 23 (3); 40 (4); 63 (5). The length of the peduncle was measured in fl owers at anthesis. In some species, the peduncle continues to elongate in fruit, presumably to facilitate fruit presentation and dispersal. 21. Peduncle pubescence length (mm): 0.04.16 (0); 0.20.36 (1); 0.40 (2); 1.4 (3); 2.2 (4). 22. Peduncle lenticels absent (0); present (1). 23. Flowers variously oriented, mainly horiz ontal to erect (0); always pendant (1). Some species that occasionally produce downwar d-oriented flowers, but appear to do so coincidentally rather than as a biologically esse ntial condition, were code d as state (0). Some Solanum -flowered Topobea spp. (e.g., T. acuminata (Fig. 1a) T. brevibractea, T. dodsonorum, T. pittieri ) that frequently have pendant flower s, as well as flowers held in other orientations were scored as polymorphic. Although the Costa Rican endemic Blakea anomala usually has erect flowers, one popul ation in the Parque Nacional Brau llio Carillo near the Zurqui

PAGE 29

29 tunnel has pendant flowers (and redd ish, rather than yellow, anthers, ); the specific status of this population needs investigation. 24. Flowers subtended by one pair of bracts (0); two pairs (1). Mora-Osejo (1966) and Weberli ng (1988) interpreted the two pa irs of bracts (state 1; Fig. 1c, e, n, s; Fig. 1a, i) subtending each flower in Blakea and Topobea as indications of a formerly ramified inflorescence. The flowers of Chalybea corymbifera (Fig. 1j) and Huilaea spp. (Fig. 1k, l) have a single pair of early caducous, reduce d, subtending bracteoles, which are likely homologous with the i nner floral bracts of Blakea and Topobea (Mora-Osejo 1966) Some specimens of B. hirsuta and B. trinervia have three pairs of bracts. Topobea fragrantissima and B. paludosa have deciduous bracts. In bo th of the latter cases, the phenomena are autapomorphic and the species were scored as state 1. 25. Older flower buds merely subtended by outer floral bracts (0); encapsulated by outer floral bracts (1). Flower buds in the Blakeeae may be either exposed (state 0), or protec ted (state 1) by their subtending bracts, often until anthesis. 26. Older flower buds dry (0); fluid filled (1). In some species with encapsulating bracts, the b uds are bathed in a watery to viscous fluid similar to the condition common in Heliconia (Bronstein 1986). 27. Floral bracts in fruit remain ing green (0); becoming red (1). See Fig. 2a, d for examples of states 0 and 1, respectively. 28. Outer floral bract length (mm) : 1.4.15 (0); 4.57.7 (1); 17.7 (2); 25 (3). 29. Outer floral bract width (mm): 1.72.4 (0); 3.32.5 (1); 11.69.4 (2); 20 (3).

PAGE 30

30 30. Extent of fusion of the outer floral bracts (mm): 0.18.60 (0); 0.83 (1); 3.34 (2); outer floral bracts free (3). 31. Furfuraceous-granulose hairs of outer floral bracts absent (0); present (1). In order to avoid inadvertent weighting, th e pubescence found only on the abaxial surface of the outer floral bracts is used here to represent that also f ound on other vegetative organs (i.e., internodes, petioles, leaf abax ial surface) as it is assumed th at the genetic basis for hair development functions similarly throughout these structures. The furfuraceous-granulose hair type (Fig. 2a; Figs. 149, 154, 163 in Wurdack 1986) is quite common in the Melastomataceae. This hair type is likely to be, in many cases, merely a diminutive form of various other, larger hair types, and therefore the gene tic controls leading to the development of this hair form may not be homologous. 32. Gland-headed hairs on outer floral bracts absent (0); present (1). Fig. 2e and Wurdack (1986), figures 25 are representative of the elongate, glandheaded hairs (state 1) found in some Blakeeae. 33. Elongate setae on outer floral bracts absent (0); present and smooth (1); present and roughened (2); present and branched (3). This character was found to vary independent ly from character 13. Comments regarding the hair types in character 13 also apply here. 34. Stoutly conic, elongate, barb ellate setae on outer floral br acts absent (0); present (1). Fig. 2g and Wurdack (1986; Fig. 128) are simila r to the robust, conic, and barbellate setae (state 1) observed in many Blakeeae. 35. Elongate setae with fimbriate apices on ou ter floral bracts absent (0); present (1).

PAGE 31

31 Setae that are apically divide d into long, slender, sinuous bran ches (state 1; Fig. 2f) give some species (e.g., Blakea lanuginosa ) a densely pubescent, wooly appearance. 36. Outer floral bracts essentially glabrous (0 ); moderately pubescent (1); with epidermis obscured by dense pubescence (2). 37. Outer floral bracts basally thin (0); markedly thickened (1). Species scored as state 1 have outer floral bracts that are in most cases not only markedly thickened (up to ca. 3 mm in Blakea scarlatina ) but also flaring out almo st perpendicular to the point at which the bracts join the peduncle (Fig. 2b). While all species scored as state 1 here have subcoriaceous to coriaceous bracts (character 38, states 1 a nd 2), those species whose bracts are basally thin may have bracts ranging in texture from membranaceous through coriaceous, thus these two characters are not entirely linked. When basally thin (state 0), the outer floral bracts generally follow a gently curving line continuing up from the peduncle. 38. Outer floral bract texture: membranaceous (0); subcoriaceous (1); coriaceous (2). 39. Outer floral bracts apically adhere nt to hypanthium (0); spreading (1). This character was recorded at anthesis, not in fruit, at which point some species have outer floral bracts that spread a nd make the red berry more visibl e. In many species that have floral bracts exceeding the calyx, they are scored as state 0 if the outer floral bract apex is curved toward the center of the flower. 40. Lenticels on outer floral br acts absent (0); present (1). 41. Margin of outer floral bracts en tire (0); remotely denticulate (1). 42. Inner floral bract length (mm): 0.6.5 (0); 4.98 (1); 10.5.2 (2); 15 (3); 28 33 (4). 43. Inner floral bract width (mm): 0.22.8 (0); 5 (1); 12.2 (2); 20 (3).

PAGE 32

32 44. Extent of fusion of inner floral br acts (mm): 0.16.16 (0); 5.8 (1); inner floral bracts free (2). 45. Inner floral bracts overlapp ing basally: no (0); yes (1). 46. Inner floral bract length / hypant hium length: 0.18.04 (0); 1.07.72 (1); 3.2.3 (2). 47. Hypanthium width (mm): 1.6.49 (0 ); 3.74.35 (1); 9.38.69 (2); 12.6.54 (3). 48. Lenticels on hypanthium absent (0); present (1). 49. Hypanthium terete (0); vertically ridged (1). 50. Inner hypanthium length (mm): 0.25.84 (0); 1.91.4 (1); 2.49.74 (2); 3.84.06 (3). The inner hypanthium is measured from the point at which the ovary is laterally attached to the adjacent hypanthium tissue to the torus (Fig. 2g). 51. Flowers 4-merous (0); 5-merous (1); 6-merous (2). 52. Calyx tube length (mm): 0.01.34 (0 ); 1.66.28 (1); 2.32.82 (2); 4.73.23 (3); 6.81.68 (4). The calyx tube (Fig. 2c) is measured from the torus to the lowest point, usually a descending notch that separa tes adjacent calyx lobes. 53. Calyx lobe length (mm): 0.17.8 (0); 0.83.41 (1); 2.6 (2); 6.2 (3); 20.7 (4). 54. Calyx lobe width (mm): 0.26 (0); 3.4 (1); 5.08.5 (2); 8.35.5 (3). 55. Elongate gland-headed setae on calyx absent (0); present (1). See character 32 for descri ption of these hairs. 56. Calyx lobes free (0); partly fused, irregu larly dehiscent (1); fu sed, calyptrate (2).

PAGE 33

33 Unsampled species with calyptrate calyces include Blakea argentea Gleason, B. calyptrata Gleason, B. fissicalyx L. Uribe, and Topobea steyermarkii Wurdack. 57. Calyx lobes valvate (0); imbricate (1). 58. Calyx lobes simple (0); with a foliaceous appendage appressed to abaxial surface (1). Blakea calycosa and B. tuberculata share the structure referenced in state 1. This is a very unusual, large flap of tissue elaborated from the apical and distal porti on of the calyx lobe, then tightly held to the underside of th e lobe (Fig. 2). It is abou t as wide and long as the lobe itself, and the margins are undulate. The buds of this species pair resemble pinwheels and are sometimes mistaken for flowers. The appenda ges may serve a protec tive function by providing an additionally barrier to th e internal floral parts. 59. Calyx lobes in fruit erect to sp reading (0); tightly inrolled (1). For examples of state 0, s ee Fig. 2b; state 1, Fig. 2a. 60. Calyx lobes in fruit remaining green (0 ); becoming red (1); becoming orange (2). For examples of state 0, see Fig. 2c; state 1, Fig. 2a, d; state 2, Fig. 2f. 61. External calyx teeth absent (0); a blunt, apic al callosity (1); well-defined and subapical, with an acute apex, ascendi ng separately from the calyx lobe (2). State 1 includes those taxa with a simple, apical callosity, which in some species is elongated longitudinally and descends the calyx lobe (Fig. 2). State 2 is restricted to those subapical external calyx t eeth with an acute tip, which is distin ct from the apex of the calyx lobe. Blakea jativae (scored as state 2) has calyx lobes with a distinct median keel, which is basally divergent and forms a ridge around the circumference of the calyx. 62. Petal length (mm): 3.2.7 (0); 11 (1); 23 (2); 32 (3). 63. Petal width (mm): 2.08.1 (0); 6.89 (1 ); 12.7 (2); 22 (3); 40 (4).

PAGE 34

34 64. Petal apex rounded to obtuse (0); acute (1). 65. Petals lacking druses (0 ); with large druses (1). Some members of the fused-bract clade (Fig. 2 9) have petals containing druses so hard that they resist grinding with mortar and pestle during DNA extrac tion. Note the visible rippling of the petal surface of B. tuberculata in Fig. 1r. 66. Petals rotate (0); pseudocampanulate (1). A false tube (state 1; Fig. 1c e; Fig. 1j-l) is created by th e vertical, overlapping petals typical of vertebrate-polli nated species of Blakeeae. 67. Petal color predominantly white to pink (0); magenta (1); red (2); green (3). For examples of state 0, see Fig. 1a, d, f, h; state 1, Fig. 1b, e, j, m, q; state 2, Fig. 1 1p; state 3, Fig. 1c. 68. Flowers actinomorphic (0), zygomorphi c due to declinate androecium (1). Zygomorphic flowers (state 1; e.g., Fig. 1a, d, f, h) ar e common in the Melastomataceae and are generally produced by a curvature in the f ilaments. Although not e xplicitly treated here, some modifications of the zygomor phic condition are worth noting. Blakea pauciflora (Fig. 1 1l) has its anthers in a ring declined below the style, rather than encircling it. In Topobea albertiae (see Almeda 1990, Fig. 3c), T. maurfernandeziana T. multiflora, and T. parasitica, (scored as state 1; Fig. 1d-f), the laterally co nnate anthers are positioned more or less in a plane above the style. 69. Androecium diplostemonous (0); haplostemonous (1). Diplostemony (Fig. 1b, d, state 0) is part of the Blakeeae ground plan, but a small group of hexandrous (Fig. 1c, state 1) Topobea species from Panama and Costa Rica are haplostemonous.

PAGE 35

35 70. Filaments terete or elliptical (0); laterally flattened (1). The morphology of the filament has been used as one of the distinguishing characters separating Blakea, which has thick filaments, from Topobea which has filiform (i.e., narrowly cylindrical) filaments (Cogniaux 1891). Only in rare cases are the fila ments terete or elliptical in cross-section (state 0). The usua l condition is for the dorsal side of the filament to be curving while the ventral face has a longit udinal median keel (sometimes obscure) that flattens laterally (state 1). The resulting shape is essentially an isosceles triangle with th e two equal sides curved inward. In flowers with deflexed androecia, th e outermost filaments are quite sigmoid and have more pronounced flanges. In some B. litoralis specimens, the lateral flanges are appressed to the central keel, thus forming channels. 71. Filament length (mm): 2.19 (0); 9.55.5 (1); 17.5.2 (2). 72. Anthers parallel with filaments or near ly so (0); ca. 120 (1); ca. 30 (2). The angle of the anthers in relation to the f ilaments appears to be significantly correlated with phylogenetic relationships. For examples of state 0, see Fig. 1b; state 1, Fig. 1d, f, l; state 2, Fig. 1a, b, g. The pronounced adaxia l tilt of the anther s (state 2) in Blakea cuatrecasii is especially remarkable. 73. Filament length / anther leng th: 0.28.61 (0); 0.69.06 (1); 1.08.57 (2); 1.681.88 (3). 74. Anther width (mm): 0.44.48 (0); 1.74.6 (1); 2.82.15 (2); 4.57.7 (3). 75. Anther length / width: 1.02.67 (0); 3.03.46 (1); 6.57.42 (2). The length: width ratio of the anthers has hi storically been emphasi zed (Cogniaux 1891) as the foremost key characteristic defining Blakea (with relatively rounde d, obtuse anthers) and Topobea (anthers linear-subulate).

PAGE 36

36 76. Anthers free (0); laterally coherent (1). 77. Anthers laterally rou nded (0); flattened (1). Along with the anther length-to-width ratio, th e lateral compression (d egree of flattening) of the anthers has been st ressed in the separation of Blakea and Topobea (Cogniaux 1891). Ingroup taxa with anthers of the Topobea -type are laterally compressed, and this feature is best observed near the theca base. Chalybea and Huilaea anthers are similar to those of other Blakeeae, but the thecae are thinner-walled, and mo re inflated and flaring. The anthers of Blakea fuchsioides (coded as state 0), with th eir various modifications related to the shift to hummingbird pollination, are unique; the rounded thecae and gaping apical pores facilitate the shedding of pollen. 78. Anther color white to cream (0); yellow (1); bluish-magenta (2); deep purple (3). Anther color in the Blakeeae is relatively unifo rm (states 0, 1) with the notable exceptions of the bluish-magenta anthers (state 2; Fig. 1g) found in some Amazonian species, and the deep purple anthers (state 3) of the rodent-pollin ated species of Central America. Blue anthers are also present in a clade of Amazonian Tococa (Michelangeli 2000) an d many Olisbeoideae. 79. Anthers uniformly colored throughout (0); connective differs from thecae, or colors grading longitudinally (1). Anthers may be uniformly colored (state 0), or the connectives, appendages, and thecae may variously differ from each other, or transition in to other colors (state 1; Fig. 1i). Some of the most complexly colored stamens are found in Blakea involvens and putatively related species. 80. Anther sacs apically united, opening by a single pore (0); c onfluent, the pores somewhat united (1); well-separated, pores functionally distant (2).

PAGE 37

37 The degree to which the anther pores are separate d is also an indication of how separate or united the anther sacs are at th e apex (Fig. 2). Some anthers with thecae well-separated for some portion of their length may be essentially un ited near the apex. In state 0 (Fig. 2a-b), the septum does not extend to the opening. Spec ies assigned to state 1 (Fig. 2c-d) have pores that are partially united, usually along their distal edge. St ate 2 (Fig. 2e-f) accounts for anther sacs that are pr ofoundly cleft at the apex. 81. Anther pore length (mm): 0.04.12 (0); 0.14.26 (1); 0.28.4 (2); 0.48.7 (3). 82. Anther pore width (mm): 0.03.14 (0); 0.16.26 (1); 0.28.64 (2). 83. Pore position dorsal (0); dorsally inclined (1 ); apical (2); ventrally inclined (3); ventral (4). 84. Anther appendage length (mm): 0.04.92 (0); 1.15.74 (1); 4.15.47 (2). 85. Anther ventro-basal appenda ge present (0); absent (1). 86. Anther connectives smooth (0); s lightly to markedly rugose (1). The anther connectives vary from completely smooth (e.g. Blakea gracilis, Topobea parvifolia ) to remarkably rugose (e.g., B. rotundifolia, B. scarlatina ). In scoring this character, any rugae observed from the connective appendag e to the surface approaching the fertile portion of the thecae qualified the specimen as state 1. 87. Connective tissue restricted (0 ); decurrent along filament (1). In some species the demarcation between fila ments and thecae is blurred, with connective tissue grading into the filament (state 1), particularly along the lateral margins (Fig. 2c-d). 88. Connective dorso-basally flatte ned or rounded (0); sulcate (1). 89. Anther connective basal (0); positioned well above anther base (1).

PAGE 38

38 This character was observed in side-view. In most species of Blakeeae, the connective is nearly level with the base of the thecae (state 0), though in so me Central American taxa, the connective is positioned approximately midway along the length of the anther (state 1). 90. Anther connective a blunt knob (0); blunt ly bi-lobed (1); elongate bi-lobed (2); triangular spur (3); saddle-shaped (4); scalloped (5); doubled (6); caudate (7); squared tab (8). The morphological diversity of the dorsal anther appendage within the Blakeeae is impressive (Fig. 2). In some species, the appendage is an obscure, blunt knob ( Blakea foliacea, Topobea parvifolia : state 0; Fig. 2a). Many species of Blakea have triangular spurs (e.g., B. cuatrecasii, B. eriocalyx, B. scarlatina : state 3; Fig. 2d). A doubled spur is diagnostic for some species of Topobea (e.g., T. bullata, T. cutucuensis : state 6; Fig. 2g), as is a caudate appendage ( T. multiflora, T. parasitica : state 7; Fig. 2h). The adaptive significance of the vari ous connective appendage forms is unknown. In B. scarlatina Trigona bees destroy the appendages and thecae. 91. Stamen length / hypanthium length: 0.93.48 (0); 1.59.86 (1); 1.95.57 (2); 2.87 3.79 (3). 92. Stamen length / petal length : 0.17.55 (0); 0.56.71 (1); 0.72.06 (2); 1.15.73 (3). 93. Ovary locule number: two (0); three (1); four (2); five (3); six (4); eight (5); nine (6); twelve (7). 94. Ovary locule length (mm): 0.92.32 (0); 1.68.81 (1); 5.5.1 (2). 95. Ovary locule width (mm): 0.8.3 (0); 1.4.6 (1); 2.72.5 (2); 5.73.55 (3); 7.64 12 (4).

PAGE 39

39 96. Ovary position (at anthesis): wholly inferi or (0); 80% inferior (1); 50% inferior (2); 10% inferior to superior (3). In the Melastomataceae, various structures ar e frequently developed at the apex of the ovary (e.g., crowns, conic protuberances, hairs, et c.; Fig. 2, left of dashed line). Additionally, there is often a zone of sterile tissue below the locules that grades into the hypanthium base and peduncle. In order to unambiguously score ovar y position, that character is here defined by comparing the proximal and distal limits of the locules (Fig. 2d) with the point at which the ovary is laterally attached to the inner hypanthium (Fig. 2g). 97. Placentation intruded axile (0); axile (1). Taxa with intruded axile placentation vary in placenta shape from rounded clubto Tshaped, and from somewhat shallow, to deeply lobed. 98. Ovary locule apex apico-late rally rounded (0); narrowed (1). Most Blakeeae have locules that, when obser ved in longitudinal section, appear rather elliptic to rounded (Fig. 2a-b). In taxa scored as having narro wed locule apices (state 1, Fig. 2c-d), the locules are apically narrowed and acute laterally. 99. Ovary apex equal or below torus (0); protruding above the torus (1). The ovary depicted in Fig. 2, to the left of the dashed line, illustrates state (1). 100. Ovary apex glabrous (0); puberulent (1). 101. Ovary apex appendages absent (0); tria ngular ridge extensions (1); cephalopoid (2); rectangular flaps (3). Blakea hirsuta has a series of twelve, tentacle-lik e appendages emerging from the apex of the ovary cone (Fig. 2c), radi ating outwards and ascending towards the torus (state 2); this very unusual character is shared with B. glandulosa

PAGE 40

40 102. Style base flush with ovary apex (0); immersed in a crown (1). The ovary depicted in Fig. 2, to the left of th e dashed line, illustrates state (1), as does Fig. 2d. 103. Style glabrous (0 ); puberulent (1). 104. Style cylindrical or tapering apically (0); somewhat swollen around middle (1). 105. Style + stigma length (mm): 1.25.02 (0); 9.6.5 (1); 20 (2); 28 (3). 106. Stigma length (mm): 0.06.44 (0); 0.58 (1); 3.2.2 (2). 107. Stigma width (mm): 0.12.3 (0); 0.34.84 (1); 1.92.88 (2). 108. Fruit a capsule (0); berry (1). Berries in the Blakeeae may be thin-walled and juicy (e.g., Blakea litoralis, Topobea pittieri ) or very thick-walled and leathery (e.g., Blakea grandiflora and close relatives). The mature berries become attractive (see character 110) and the calyx and floral bracts frequently are also involved in display. Huilaea ecuadorensis produces a delicious fru it that at maturity is ca. 6 cm x 4 cm and tastes like a comb ination of kiwi and passion-fruit. 109. Fruit exocarp thin (0); thick and leathery (1). 110. Mature berries (observed at hypanthium) red (0); yellowish-green (1); deep purple (2); pale green-white (3); lavender (4); orange (5). 111. Seeds cochleate (0); pyramidal (1). Results Analysis of Qualitative Characters The analysis including 77 qualita tive characters produced 20 equa lly most parsimonious trees of 649 steps, CI = 0.206, and RI = 0.536. In the strict consensus (Fig. 2) Monochaetum floribundum forms a clade with Tibouchina longifolia and Graffenrieda latifolia is then sister to the Blakeeae. The Blakeeae sensu lato are resolved as a monophyletic tribe with bootstrap

PAGE 41

41 support of 81%. Within the tribe, a clade containing Chalybea corymbifera, Huilaea calyptrata and H. ecuadorensis (BS = 92%) is sister to the clade containing Blakea and Topobea although the monophyly of neither of the latter two ge nera is supported. The following groups are identified in a large polytomy along with all other non-listed taxa: a B. eriocalyx + B. hispida + B. jativae + B. lanuginosa + B. polyantha + B. repens clade; a B. costaricensis + B. storkii + B. wilsoniorum +B. brunnea + B. tapantiana clade ; a B. wilburiana + Topobea intricata + B. fuchsioides + B. venusta + B. crinita clade, in which B. wilburiana and T. intricata are sister species (BS = 56%); a B. austin-smithii + B. chlorantha clade (BS = 93%) that is sister to B. penduliflora (BS = 90%), and these three species are then sister to T. subscabrula ; a T. caliginosa + T. cordata + T. hexandra clade (BS = 82%); a B. brasiliensis + B. scarlatina clade; a B. calycosa + B. tuberculata clade (BS = 83%); a B. gracilis + B. pauciflora clade; a T. adscendens + T. cutucuensis clade (BS = 54%); a T. dodsonorum + T. pittieri clade (BS = 67%); and a T. multiflora + T. parasitica clade. Analysis of Quantitative Characters The analysis of quantitative characters, 34 in total, resulted in 20 most parsimonious trees of 610 steps, CI = 0.162, and RI = 0.557. The strict consensus (Fig. 2) resolves Miconia laevigata and Graffenrieda latifolia as sister to a polyphyle tic Blakeeae (BS = 51%) which includes Monochaetum floribundum and Tibouchina longifolia Although numerous clades are identified in the strict consensus, few receive st atistical support. It is noteworthy, however, that neither Blakea nor Topobea are resolved as monophyletic. As part of a basal grade that includes all of the Solanum -flowered Topobea species, T. dodsonorum and T. pittieri form a clade (BS = 58%). Chalybea corymbifera forms a clade with Huilaea ecuadorensis and H. calyptrata though only the latter two receive st atistical support (BS = 97%). Finally, two other clades are

PAGE 42

42 resolved: Blakea brunnea + B. costaricensis + B. wilsoniorum + B. scarlatina (BS = 56%); and B. grandiflora + B. storkii (BS = 70%). Analysis of All Morphological Characters The analysis of all morphological characters, 111 in total, resu lted in eight most parsimonious trees of 1360 steps, CI = 0.171, and RI = 0.502. One of the most parsimonious trees (topologically identical to the majority rule tr ee) is shown in Fig. 2, with the clades that collapse in the strict consensus indicated. The trees are well-r esolved, though only eleven clades receive bootstrap support exceeding 50%, including Monochaetum floribundum + Tibouchina longifolia (BS = 73%). A monophyletic Blakeeae sens u lato is moderately supported (BS = 77%), with Topobea dodsonorum + T. pittieri (BS = 77%) sister to all remaining species. In this investigation, weak bootstrap support is de fined as 50%, modera te support 66%, and strong support 80%. The clade comprising T. caliginosa, T. cordata and T. hexandra receives 84% bootstrap support, wi th the latter two species placed as sisters (BS = 71%). This monophyletic group is part of a grade including most of the Solanum -flowered Topobea species, i.e., T. acuminata, T. cf. brevibractea, T. dodsonorum, and T. pittieri. Blakea wilburiana is sister to T. intricata (BS = 51%). Strong bootstrap support (98%) indicates that Chalybea and Huilaea form a clade, which is nested within Blakea and Topobea The H. ecuadorensis + H. calyptrata clade also is strongly supported (B S = 99%). The rodent-pollinated clade is also supported (BS = 64%), with B. penduliflora sister to B. austin-smithii + B. chlorantha (BS = 89%). Blakea calycosa is united with B. tuberculata (BS = 90%). It is evident (Fig. 2) that neither Blakea nor Topobea is monophyletic. Placement of each of the morphological syna pomorphies on the tree shown in Fig. 24 is given in Table 2. The pattern of morphologi cal variation is addressed in detail in the discussion.

PAGE 43

43 Discussion Support for Blakeeae In order to facilitate disc ussion of morphological characte r evolution in the Blakeeae, characters have been optimized using ACCTRA N on one of the eight mo st parsimonious trees (Fig. 2; Table 2) that is topologically identical to the major ity rule tree. This tree is also largely congruent with the strict consensus tree, although in the latt er relationships in the series from Blakea hispida through Blakea pulverulenta DSP1627 are obscured as nodes collapse along that portion of the spine and within some clades (Fig. 2). Blakeeae, including Chalybea and Huilaea are resolved with moderate support (BS = 77%). The monophyly of the tribe is supported by axillary synflore scences (19), external calyx teeth being blunt, callose thicke nings (61), and flowers zygomor phic because of the declinate androecium (68). Under DELTRAN optimiza tion, additional synapomorphies for the Blakeeae include six-merous flowers (except Topobea tetramera ) (51), berry fruits (108), and pyramidal seeds (111). Additional potential anatomical synapomorphies for the Blakeeae are the combination of multiseriate rays and frequent occurrence of druse crystals, the druses always present in unlignified cells or idioblasts (ter Welle & Koek-Noorman 1981). Rhombic crystals and crystals of intermediate forms have also been noted in Blakea latifolia and in Huilaea macrocarpa (ter Welle & Koek-Noorman 1981), and their occurrence is perhaps more prevalent. Druse crystals occur throughout the hypanthium and ovary roof in most Blakeeae. The presence of sheath cells and/or the presence of many pits on tangential fiber walls characterizes Blakea and Topobea though these two characters are absent in Huilaea (Koek-Noorman et al. 1979). Blakeeae, without exception, and in common with various other tribes, possess many medullary vascular

PAGE 44

44 bundles in their stems; cortical vascular bundles, however, are absent (van Tieghem 1891, 1892; Solereder 1908). Chalybea and Huilaea The clade (BS = 98%) comprised of Chalybea corymbifera Huilaea ecuadorensis, and H. calyptrata is supported by numerous synapomorphie s such as the terrestrial habit (1), acarodomatia in the vein axils (10), truncate mo notelic synflorescences (18), elongate peduncles (20), flowers subtended by a single pair of brac ts (24) that are narro w (43), flowers with lenticellate hypanthia (48), anther s relatively short compared to filament length (73), anthers laterally rounded (77) and white to cream in colo r (78), and yellowish-green (110) fruits with the exocarp thick and leathery (109). These ge nera are also charac terized (under DELTRAN optimization) by acarodomatia of the pinwh eel type, and pseudocampanulate corollas. In a four-region molecular analysis as well as an analysis combining these four molecular regions with the complete 111 character matr ix of this analysis (Chapter 3), this Chalybea + Huilaea clade is positioned as the sister group to a large clade containing all of the analyzed species of Blakea and Topobea a position also seen in the in the analysis of qualitative-only characters (Fig. 2). Thus, I investigated th e strength of support for the placement of this clade deeply within the Blakea + Topobea clade in the combined morphological analysis (Fig. 2 24). Using MacClade (Maddison & Maddison 1999) to constrain the Chalybea + Huilaea clade to the node sister to Blakea + Topobea incurs a cost of only five out of 1360 steps, suggesting that the derived position indicated (Fig. 2) is not well supported. Metr ic characters relating to the size of reproductive structures (e.g., 53, 74, 84, 91, 92) cause this clade to be nested within Blakea + Topobea thus explaining why the Chalybea + Huilaea clade was not nested within the Blakea + Topobea clade in the analysis of qua litative characters (Fig. 2).

PAGE 45

45 Huilaea ecuadorensis and H. calyptrata are resolved as sisters on the basis of numerous quantitative features including ve ry short floral bracts compared to hypanthium length (i.e., 0.18.04; 46), relatively wide hypanthia (i.e., 9.38.69 mm; 47), relatively long calyx tube (i.e., 6.81.68 mm; 52), long filaments (i.e., 17.5.2 mm; 71), anther lengt h/width quotient of 3.03.46 (75), anther pores 0.48.70 mm wide (81) ovary locules 5.5.1 mm long (94), and style + stigma 28 mm long (105). Huilaea ecuadorensis consistently has three flowers per inflorescence, while H. calyptrata has 15. Naudin (1852) described Chalybea corymbifera and placed this new genus and species in Miconieae; it was la ter transferred to Pachyanthus by Triana (1871). Systematists have debated the monophyly of Pachyanthus (Wurdack 1988; Judd & Skean 1991), a genus now known to be polyphyletic, at least in part, as the result of th e inclusion of P. corymbiferus (Becquer, in prep., Morales & Penneys, in prep.). In the publication of the new genus, Huilaea Wurdack (1957) stated that within the Miconieae, no close rela tive was apparent, but he did compare it with Pachyanthus Miconia sect. Octomeris M sect. Amblyarrhena Bellucia and Loreya Failing to find any potential sister group within the Miconieae, Wurdack went on to compare Huilaea to Blakea and Topobea but then backed away from this pr oposal, citing differences in bract and bracteole insertion, and noting that the anther pores are somewhat ventrally inclined rather than dorsally as in most Blakeeae. In fact, a slight minority of species in this analysis do have dorsally inclined pores (character 83). The eight species of Huilaea conform in most characters with Chalybea differing primarily in the size and color of the flowers, and number of flowers per inflorescence. If Chalybea is ultimately shown to be nested within Huilaea as preliminary results suggest (Morales & Penneys, in pre p.), new combinations must be made under Chalybea

PAGE 46

46 Others have noted the similarities between Huilaea and the Blakeeae. Mora-Osejo (1966) presented a detailed comparative examina tion of the inflorescence architecture of Huilaea and Blakea using the approach and terminology of Tro ll (1964). However, Mora-Osejo did not conclude that the observed similarities justifie d tribal realignments. On the basis of wood anatomical characters, the placement of Huilaea in the Blakeeae was confirmed (Koek-Noorman et al. 1979; ter Welle & Koek-Noorman 1981); they al so suggested that uniseriate rays may be a synapomorphy for Huilaea In a four-region (ITS, accD-psaI, atpB-rbcL, trnL-trnF ) molecular phylogenetic analysis of the Blakeeae including Chalybea corymbifera (2 exemplars) and six species of Huilaea (14 exemplars), Morales-P. and Penneys (in prep.) demonstrate that Chalybea + Huilaea form a clade sister to Blakea + Topobea This conclusion is also su pported in the molecular, and combined morphological and molecular analyses presented in Chapter 3 (Figs. 3, 3, 3, 3 6, 3). The monophyly of both groupings is strongly supported as is that of the Blakeeae, as broadly circumscribed: this conclusion is in ag reement with Penneys et al. (2004). Thus, based upon both morphological and molecular evidence (C hapter 3), the circumscription of the Blakeeae must be expanded to include Chalybea and Huilaea (Chapter 4). In the discussion below, we accept the hypothesis of a sister group relationship of the Chalybea + Huilaea clade and the Blakea + Topobea clade, and largely restrict the discussion of mor phological character evolution to the latter two genera. Disc ussion of morphological phylogenetics of the Chalybea + Huilaea clade will be presented in more deta il in Morales-P and Penneys (in prep.). Monophyly of the Blakea + Topobea Clade Blakea and Topobea were resolved as a single clade, with each genus, as traditionally circumscribed, polyphyletic. Characters th at were found to be synapomorphic for Blakea and Topobea include a hemiepiphytic habit (1), ax illary, non-ramified truncate monotelic

PAGE 47

47 synflorescences (18, 19), flowers subtended by two pairs of decussate bracts (24), external calyx teeth lacking (61), flowers zygom orphic due to declinate androeci um (68), and anthers that are laterally compressed (77). Anther Morphology and Generic Limits of Blakea and Topobea As discussed above, there has been a long-stan ding debate regarding the justification of recognizing both Blakea and Topobea with students of the family as far back as David Don (1823) arguing for their union. Most, however, ha ve chosen to recogni ze both genera (Naudin 1852; Bentham & Hooker 1867; Triana 1871; C ogniaux 1891), sometimes with the admission that this decision is base d upon tradition (Gleason 1945; Wurd ack 1957), or convenience in terms of facilitating floristic treatments (Wurdack 1973, 1980). Thirty species of Blakea and 24 of Topobea were known to Cogniaux (1891) when he published the most recent monograph of the tribethe number of describe d species has nearly quadrupled in the intervening years. Recent DNA-based phylogenetic analyses ha ve supported the monophyly of the Blakeeae (Clausing & Renner 2001; Renner et al. 2001; Pe nneys et al. 2004) but until now, none have attempted to examine the relationships between Blakea and Topobea An examination of species exhibiting the typical character suites for each genus would, perhaps, provide justification for their separation, however, a number of species with intermediate states have been discovered, and these erode the alreadydubious distinctions between Blakea and Topobea Five key characters, all pertaining to the andro ecium, have been used to separate Blakea and Topobea and their phylogenetic u tility is tested here. According to Cogniaux (1891), the filaments in Blakea are thick while in Topobea they are filiform (70). Unequivocally narrowly-cylindrical (filiform) filaments were found within the Blakeeae only in four species of Topobea three of which are in the basal grade. Topobea parasitica the generotype, clearly does not have filiform filaments. The remaining taxa have

PAGE 48

48 filaments with an obscure to prominent median keel and they are frequently laterally flattened. When the latter two characters are simultaneously present, the filaments ar e nearly triangular in cross-section, with the dorsal side somewh at convex and the othe r two sides concave. The anthers of Blakea have been said (Cogniaux 1891, Almeda 2000b) to be laterally compressed while those of Topobea are rounded (77). Careful examination of Topobea anthers proves that they are also latera lly flattened, though since the anth ers are generally more subulate, this fact is less apparent than in Blakea Truly rounded anthers were found only in Blakea fuchsioides, Chalybea Huilaea and outgroup speciesthese all have free anthers, but many other ingroup taxa have free, compressed anthers. Almeda (1990) noted that Blakea has two, typically well-separated anther pores, while Topobea has approximate or confluent pores (80). Th e distribution of this character is shown in Fig. 2. Though this distinction accommodates most taxa, exceptions may be found in the rodent-pollinated species of Blakea which have nearly confluen t pores, and in a number of species of Topobea with well-separated pores (e.g., Topobea brenesii T. brevibractea, T. calycularis, T. intricata, T. parvifolia ). Blakea alternifolia (Gleason) Gleason has uniporose anthers similar to those t ypically associated with Topobea and is most likely a member of the Solanum -flowered alliance. The latter species is illustrative of the bidirectional nomenclatural combinations that have been made, as it was originally described as T. alternifolia and later transferred to Blakea Thus, many currently accepted binomials in Blakea and Topobea have basionyms in the other genus (Chapter 4). Within the Melastomataceae, anthers commonly have elaborate and diverse connective appendages that may be dorsal or ventral and bran ched or not, and they are crucial in diagnosing generic and supra-generic groups. Anther conn ective appendages (characters 85) in Blakeeae

PAGE 49

49 are uniformly dorsal, simple, and mostly basal their form has been used to define genera traditionally included in the Blakeeae. The si mplistic characterization of dorsal appendages applied by Cogniaux (1891), spur thick in Blakea vs. spur smaller or absent in Topobea, inadequately describes the observed variation. The actual morphological diversity of anther appendages in the Blakeeae is evidenced by the ni ne states scored for character 90 (Fig. 2). and whose actual distributions on the cladogram (Fig. 2; Tabl e 2) are incongruent with traditional concepts of Blakea and Topobea Dorsal appendage morphology is synapomorphic for particular clades (discussed below and in Ch apter 3, e.g., bluntly bi-lobed in the fused-bract clade, caudate in the T. parasitica group, doubled in the imbricatecalyx clade, etc.) but does not support generic monophyly. Given the importance historically ascribed to the anther length-to-width ratio (75), a special comment is merited. Beginning with the generic key provi ded by Cogniaux (1886, 1891) and amplified by Wurdack (1980) and Almeda (1990), Blakea has been defined primarily as having anthers that are short, oval, oblong, or ellipt ic (i.e., ca. 1/2/3 as wi de as long), while the anthers of Topobea are said to be linear-oblong to oblongsubulate (i.e., ca. 1/5/4 as wide as long). Although many species can be easily placed in one genus or the other based upon this metric, numerous others cannot, as has been observed previously (Almeda 1989, 1990). The weakness of the anther length-to-w idth ratio can be demonstrated by plotting it on a graph (Fig. 2) whereupon it becomes evident th at the ratio is c ontinuously varying, with some minor gaps in the present sample. The observed gaps were used to score this character into three states, i.e., 1.02.67 (0); 3.03.46 (1); 6. 57.42 (3), and tracing these st ates on the cladogram (Fig. 2, Table 2), it can be concl uded that elongate anthers ar e ancestral and the stout, Blakea type anther is derived in the Blakeeae. This is expected as most melastomes have subulate

PAGE 50

50 anthers, though rounded anthers are found sporad ically throughout the family. Within the Blakeeae, rounded anthers represent a derived cond ition that may have evolved in response to pollinator pressures. In this cladistic analys is, none of the androecium characte rs that have traditionally been used for diagnosing Blakea and Topobea support the monophyly of either genus (Fig. 2). On the contrary, the characters pertaining to fila ment and anther morphology have either been misinterpreted (e.g., filament form, lateral co mpression of the anther, connective appendage form) are continuous (anther length-to-width rati o) or are homoplastic (pore number). Using MacClade to constrain Topobea such that it and Blakea are each monophyletic incurs a cost of 53 steps. We conclude that neither Blakea nor Topobea are monophyletic, thus Topobea must be transferred to Blakea and the range of variat ion in the latter genus expanded. Almeda (1989, 1990) has signaled his inclination to merge the genera, but dec lined to formally make new combinations before the completion of a global analysis. Other workers such as Don (1823), Baillon (1881), and Macbride ( 1941) were unimpressed by the putat ive generic differences and united them. Koek-Noorman et al (1979) also concluded that Blakea and Topobea do not differ sufficiently in their anatomy to justify generic separation. Character Evolution: Noteworthy Examples By mapping morphological characters onto th e representative tree shown in Fig. 2, along with Table 2, it is possible to examine character evolution a nd distribution in the Blakeeae. Some of the more interesting examples are presented below with further discussion on characters traditionally used to separate Blakea and Topobea Many of the following characters are useful in identifying part icular radiations, and may also be helpful in constructing dichotomous keys to the species.

PAGE 51

51 Growth habit and form All Blakeeae are woody plants and most are large shrubs or trees (the symplesiomorphic condition). Some, such as Blakea rotundifolia attain a height of up to 35 meters, and a trunk diameter of one meter. Blakeeae may be terrest rial, hemiepiphytic, or epiphytic, and sometimes these habits are dependent upon lo cal environmental conditions. In this sample, with the exception of B. polyantha which is a small sparingly-branched shrub of less than four meters, all strictly terrestrial species are large shrubs or trees (2). Amongst the hemiepiphytic species, large shrubs and trees dominate, but lianescent form s are not uncommon. The lianescent habit is a synapomorphy for the clade containing B. venusta, B. fuchsioides, B. wilburiana and T. intricata Melastomataceae are among the most dominant families of Neotropical epiphytes and hemiepiphytes (Madison 1977), and Blakea and Topobea contribute greatly to this diversity (Renner 1986). General collectors often erroneou sly note the species of Blakea and Topobea as being epiphyticin fact, most are hemiepiphytes. Careful tracing of the primary axis of the plant body, and especially the root systems, dem onstrate that they may descend the host trunk rather vertically, variously bran ch horizontally and wrap arou nd (in some cases strangling, e.g., B. rotundifolia ) the host. Rarely are these plants tr uly epiphytic, rather, their roots almost invariably penetrate the ground at some point, thus the term hemiepiphyte is more appropriate. Hemiepiphytes have been classe d as either primary or sec ondary (Putz & Holbrook 1986), the former germinating upon the host with the root sy stem subsequently desce nding into the soil, and in the latter, germination occurs terrestrially then the seedlings seek out and climb up a host trunk. Few observations have been made of Blakeeae seedlings, but both conditions are known. In some terrestrial seedlings (e.g., B. eriocalyx Penneys pers. obs.), the juvenile leaf pairs are very strongly dimorphic, though on the mature plant the leaves are equal.

PAGE 52

52 Thirteen species in the current sample were sc ored as polymorphic, be ing either terrestrial or hemiepiphytic. This is a reflection upon an a pparent behavioral labilit y in response to local environmental conditions. For example, Blakea chlorantha grows terrestrially as a compact shrub on the exposed, windswept ridges of the el fin forest, but in nearby protected pockets will assume a hemiepiphytic, scandent shrubby habit. The hexandrous Topobea clade (Fig. 2) is supported by several synapomorphies including their being epiphytic, compact shrubs, though the roots of T. hexandra sometimes penetrate the ground. The Chalybea + Huilaea clade is comprised of about ten species of small to medium sized terrestrial trees restricted to Andean fo rests between ca. 2000 m. However, one population, tentatively identified as H. ecuadorensis from Carchi, Ecuador, is known from only two collections that record the habit as semi-scandent tree or arbol hemiepfito. Formicaria and ant associations It has recently been observed that the majo r diversification of ants and angiosperms occurred simultaneously in the Cretaceous (Moreau et al. 2006), and close associations between them may be ancient. Myrmecophytism occurs in at least 23 plant families (Beattie 1985; Benson 1985; Jolivet 1996), and the association is generally thought to benefit both partners as the ants are provided shelter, and in return pr otect the plants by pruning other plant competitors (Janzen 1967, 1969; Morawetz et al. 1992; Renner & Ricklefs 1998), aggre ssively driving away herbivores (Janzen 1966, 1967; McKey 1984; Vasconcelos & Davidson 2000; Michelangeli 2003); or by providing critical ch emical nutrients such as CO2 and N for the host plant through their wastes (Treseder et al. 1995). Formicaria, ant-harboring hollow chambers located in the stems, petioles, or laminae, have long been noted in the Melastomataceae (Aubl et 1775; de Candolle 1828; Triana 1871; Cogniaux 1891), however, their occurrence in Ne otropical melastomes has generally been

PAGE 53

53 associated with genera assigned to the Miconieae such as Tococa Clidemia, Conostegia and Maieta Within the Miconieae, studies have been conducted exploring some of the benefits conferred by this association (Morawetz et al. 1992; Renner & Ricklefs 1998; Michelangeli 2003). Ant-plant associations in the Blakeeae have rarely b een reported (Triana 1871; Almeda 2000b), but occur in at least 11 species of Blakea and Topobea In the present set of analyzed species, two independent acquisitions of this feature are suggested ( Blakea subconnata and B. jativae ), and increased taxon sampling would likely support multiple additional evolutionary acquisitions in diverse lineages. Formicaria in the Blakeeae may take the form of hollow cylindrical internodes (e.g., B. perforata Almeda B. punctulata (Triana) Wurdack B. subconnata, B. subvaginata ), apically inflated internodes ( B. podagrica Triana T. gracilis Triana T. inflata Triana T. pluvialis Standley), or inflated laminar pouches ( B. formicaria Wurdack). A previously unreporte d formicarial type (Fig. 2b) is that of layered, chartaceous, stipules, which form a relatively loose ne st. This condition is well developed in B. jativae and B. squamigera Uribe, and weakly so in B. polyantha Additional, putatively related species with similar stipules include B. allotricha Uribe, B. florifera Gleason, B. hydraeformis Wurdack, B. megaphylla Wurdack, B. nodosa Wurdack, B. paleacea Gleason, and B. pilosa Gleason. In his description of Blakea squamigera Uribe (1975) noted the presence of numerous, small, warty bodies surrounding the young nodes whose significance was unknown, and similar structures have been seen in B. jativae (Penneys, pers. obs.). Given that these structures occur on young nodes in close proximity to ants, the possibili ty that they are food bodies similar to those found in Cecropia should be explored. Investigations in to the effects of ant exclusions should also be conducted in order to document defi nitively the beneficial nature of ant-plant

PAGE 54

54 relationships in the Blakeeae, as has been shown to be the case in other groups of Melastomataceae (Morawetz et al. 1992; Renne r & Ricklefs 1998; Michelangeli 2003). Acarodomatia and mite associations Although the association between mites and plants is quite ancient (O Dowd & Wilson 1991) and was first described in 1887 (Lundstrm 1887), investigations in to the occurrence of acarodomatia in general are few and most freque ntly pertain to economically important crops and viticulture. Many tropical plants produce foliar acarodomatia usually in the vein axils on the abaxial leaf surface. Acarodomatia benefit mites by prov iding shelter in which they can avoid predators, lay eggs, safely molt, and gain protection from desiccation (Pemberton & Turner 1989; Grostal & ODowd 1994; Norton et al. 2001; Walter 2004). Plants benefit by having spores, fungal hyphae, algae, lichens, an d phytophagous mites removed from the lamina by predatory and fungivorous mites (ODowd & Wilson 1991; Walter 1996, 2004; English-Loeb et al. 2002). In the neotropics only a few publications indicate that mites can be the main inhabitants of these structur es (e.g., Romero & Benson 2004) a nd their importance in tropical forest ecosystems remains largely unexplored. This study is among the first to examine the occurrence of acarodomatia in a phylogenetic context (Skean 1993, Penneys & Judd 2003, 2005; Judd 200 7; Kriebel et al. in prep.). Within the Blakeeae, about one-third of the nearly 200 spec ies (Almeda 2001) and 29 of 72 species (38.9%) in this analysis produce acarodomatia. The dist ribution of this character on the preferred cladogram (Fig. 2) shows that the presence of acarodomatia is ancestral in the tribe. Mite associations have been lost and regained re peatedly in the Blakeeae, suggesting that the evolution of this association is be neficial to the plants. In some clades that lack acarodomatia entirely, such as the fused-bract clade (Fig. 2), the pl ants often have scatte red, elongate setae, a condition that is also favorable for mites (W alter 2004). Including the nineteen species that

PAGE 55

55 commonly have setose abaxial leaf surfaces woul d increase the number of species that possibly harbor mites to 66.7%. It may be significant th at most species that produce acarodomatia lack setose leaf surfaces, and most setose species lack specialized acarodomatia. The homology of each type of acarodomatium re mains the subject of future developmental and anatomical investigation. Nine states were scored representing domatial morphological diversity. Pinwheel domatia (state 5, Fig. 2f) are synapomorphic for the Chalybea + Huilaea clade, and consist of laminar tissue flaps that project laterally from the bases of all major veins and are distally proximate or overlapping, thus forming a more or less cylindrical chamber. Topobea pittieri representing a basal branch in the Blakea + Topobea clade, has lateral laminae (state 4, Fig. 2e), a form likely reduced from (and therefore homologous to) the pinwheel type, though in this state the tissue flaps are developed almost exclusively on the midrib. On occasion (e.g., B. rotundifolia ) the midrib coalesces with the adjacent secondary veins (s tate 7, Fig. 2h). The latter form perhaps became further modifie d, forming a marsupiform pocket (state 1, Fig. 2 3b) in which a single sheet of tissue unites adjacent secondary veins (best developed in B. subconnata but present in several clades). The op en pocket (state 2, Fig. 2c), essentially a marsupiform pocket that has pulled away from th e leaf surface assuming a nearly perpendicular posture, is autapomorphic for T. dodsonorum Recessed pits, or lebetif orm domatia (state 3, Fig. 2d), occur in the paraphylet ic grade that includes T. parvifolia, B. pauciflora, B. gracilis, B. litoralis and B. foliacea (Fig. 2). Hair tuft domatia (sta te 0, Fig. 2a) typically are formed by elongate, roughened setae emanating from the major vein bases. This character is a synapomorphy for the T. multiflora + T. calycularis + T. cf. watsonii clade, and was also recorded for B. schlimii and B. eriocalyx, in which it arose independently. Blakea austin-smithii and B. chlorantha share numerous synapomorphies incl uding a unique, petiolar acarodomatium

PAGE 56

56 (state 6, Fig. 2g) that is formed by a nearly circ ular flap of tissue inserted on the distal, adaxial surface of the petiole. The flap projects back towards the stem and is often clasping around the petiole. Acarodomatia in the Merianieae, an outgroup, are typically formed by a revolute marginal rolling of the basal lamina (state 8, Fig. 2i). Stipules Stipules in the Myrtales ar e generally reported to be e ither lacking or rudimentary (Dahlgren & Thorne 1984; Stevens 2001). A lthough no studies have yet been conducted examining the developmental homology of stipul es in the Melastomataceae with other more commonly stipulate families, superficially, most stipules in the Blakeeae (5, Fig. 2a) are quite similar to the interpetiolar stipules of Rubi aceae. Species of Blakeeae with stipules (i.e., stipuliform flaps sensu Wurdack) occur primarily in Colombia and Ecuador, with Blakea repens and Topobea multiflora ranging south to Bolivia (and the latter also north to Costa Rica). Taxa included in this analysis with suborbicular to triangular, interpetio lar stipules include B. eriocalyx, B. hispida, B. lanuginosa and B. repens Other species with very similar stipules, not represented in this analysis include B. fasciculata Gleason B. pichinchensis Wurdack, B. stipulacea Wurdack and B. villosa Cogn. Topobea multiflora was also scored as state 1 for character 5, though in this species the stipule is less well developed and may be an unusually elongated nodal ridgethis structur e is particularly evident in young nodes where the stipule is appendaged. Blakea jativae (along with the unsampled B. megaphylla, B. nodosa, and B. squamigera ) have stipules (character 5, state 2; Fig. 2b) that may not be homologous with the previously listed taxa. In these species, the sti pules are composed of multiple layers of large (up to 6 cm x 2.5 cm in B. jativae ) hyaline processes that protect the apical meristem for an extended period, and sometimes harbor ants. Blakea polyantha (and unsampled B. allotricha, B. florifera and B. paleacea ) have stipules very similar to the B. jativae group, except that they are only

PAGE 57

57 weakly developed. Other unsampled taxa with in triguing nodal structures that may be stipulate are B. hydraeformis, B. pilosa and T. mortoniana Wurdackall are centered in Colombia. All species scored as having stipules also ha ve a pronounced to very prominent nodal ridge (character 6), though many other specie s with such ridges lack stipules. Leaf venation Blakeeae are sometimes thought to be characterized by striolate, or Clusia -like, leaf venation with the tertiary veins running parallel and in very cl ose proximity. Measurements for the distance between tertia ry veins (17) are essentially contin uous, but small gaps in the pattern of variation served to delimit the character into four states (Fig. 2), one of which only pertains to an outgroup species, Graffenrieda latifolia The most basally branching species in this analysis, the clade of Topobea dodsonorum + T. pittieri (Fig. 2), was scored as having veins 1.25.3 mm apart (state 1); the subsequent grade has more closely-spaced veins (state 0, 0.2 1.1 mm apart), but the two states appear sporad ically throughout the cladogram (Fig. 2). In total, 31.9% of the ingroup OTUs have fine striolate venation, while another 41.7% possess tertiary veins somewhat more widely spaced. Finally, 25% have venation typical (state 2, 3.32 7.47 mm apart) of other woody Neotr opical melastomes. Almost two-th irds of the species in this sample have tertiary veins spaced 3.3 mm or less apart (Table 2), thus there is some justification for the generaliza tion that Blakeeae have striolat e venation, but there are also significant exceptions with more widely-spaced veins. Encapsulating floral bracts In two South American clades (resolved as a single clade in a separate four molecular region + morphology analysis), the flower buds remain encapsulated by the relatively large (characters 28, 29, 42, 43) subtending bracts nearly until anthesis (25, state 1), whereas in all other taxa the bracts are either too small to cover the buds, or they are widely spreading. The

PAGE 58

58 species in this analysis with covered buds include Blakea involvens, B. glabrescens, B. jativae, B. rotundifolia, B. repens, B. lanuginosa, B. hispida, B. eriocalyx, B. subconnata and B. subvaginata (Fig. 2; Table 2). The following unsampled species likely belong to a complex related to B. eriocalyx : B. acostae Wurdack, B. incompta Markgr., B. pichinensis Wurdack, B. platypoda Gleason, B. punctulata (Triana) Wurdack, B. stipulacea Wurdack, and B. villosa Cogn. In addition to encapsulati ng their buds with floral brac ts, some of the same species also have been found to have those buds filled wi th a watery to slightly mucilaginous liquid (26, state 1). This wet bud clade (Figs. 3, 3, 3, 3, 3, 3) is discussed in detail in Chapter 3. This liquid may serve as additional protection for the young buds as has been shown in the Heliconiaceae (Bronstein 198 6). To date, only one species, B. cuatrecasii, with merely subtending bracts has been found to produce some fluid. Fused bracts The majority of Blakea and Topobea species have their outer fl oral bracts free or only slightly fused (30), however, bracts fused thr oughout most of their le ngth (state 2) is synapomorphic for the Central American clade comprised of B. grandiflora, B. storkii, B. wilsoniorum, B. scarlatina, B. costaricen sis, B. brunnea, B. crinita, B. calycosa and B. tuberculata (Fig. 2). Blakea tapantiana is basal in the clade and also has fused outer floral bracts, though for a lesser portion of their length. This clade is also united by their highly fused inner floral bracts (character 44, state 1), in contrast to nearly all other members of Blakea and Topobea in which these bracts are free or only sligh tly fused. Unsampled species that perhaps belong in the fused-bract clade include B. cuneata Standley B. perforata, B. coloradensis Almeda, and T. gerardoana Almeda.

PAGE 59

59 Bracts and pubescence Melastomataceae have more variation in pubesc ence than any other angiosperm family (Metcalfe & Chalk 1950; Wurdack 1986), and Blakeeae contribute significantly to this pattern. The relatively persistent pubescen ce on the abaxial surface of the out er floral bracts was used in these analyses to represent the diverse trichome fo rms. Hairs in this location are almost always the same as those found on the young stems, pe tioles, and leaves, though in those locations, pubescence is often soon deciduous. Most species of Blakea and Topobea have at least some furfuraceous-granulose hairs on the bracts (31, state 1, Fig. 2a ); however, their absence is a synapomorphy of the clade comprised of B. venusta, B. fuchsioides, B. wilburiana and T. intricata This clade is also united by the presence of smooth, elongate setae on the abaxial leaf ma jor veins (13, state 1, Fig. 2b), bracts (33, state 1), and sepals with gland-headed setae ( 55, state 1, Fig. 2e; lost in B. wilburiana ). Furfuraceous-granulose pubescence is also lacking in the clade of B. jativae, B. involvens and B. glabrescens (although there is a reve rsal in the last spec ies). Nine additional species in various lineages sh are this homoplastic (but info rmative) character (Table 2). Elongate setae are entirely lack ing (33, state 0) in the rela tively glabrous, paraphyletic basal grade from Topobea dodsonorum through Blakea subvaginata with the exception of B. venusta and relatives mentioned above (Fig. 2) Elongate smooth setae (state 1) are a synapomorphy for the rodent-pollinated clade containing B. penduliflora, B. austin-smithii and B. chlorantha (Fig. 2). Roughened setae (33, state 2, Fig 2c-d), al ong with the presence of stout, conic, barbellate setae (34, state 1, Fig. 2g), are synapomo rphic for the clade comprising T. brenesii, T. setosa, T. adscendens, T. bullata and T. cutucuensis (Fig. 2). The fused-bract clade (Fig. 2) is likewise supported by the sa me two characters and states, although both are lost in B. scarlatina and some populations of B. grandiflora and character 34 is lost in B. crinita

PAGE 60

60 Elongate setae with fine, fimbriate apices (35, state 1, Fig. 2f) are a synapomorphy for the clade containing Blakea eriocalyx, B. hispida (reversal to absence), B. polyantha B. lanuginosa and B. repens This hair type is expected to be found in other, unsampled, stipulate species. The fused-bract clade (Fig. 2), al ong with the clade comprised of Blakea sawadae, B. subpanduriformis, B. cuatrecasii and Topobea albertiae share the synapomorphy of having markedly thickened outer floral bracts (37, stat e 1; Fig. 2b). In this condition, when observed in longitudinal section through a fl ower, the peduncle apex flares laterally near the confluence with the outer floral bract bases, which themse lves are expanded. These two clades share the additional apomorphy of lenticel late peduncles (40, state 1). Basally overlapping inner fl oral bracts (45, state 1) occur in several clades including first, a portion of the covered-bud group, second, Blakea rosea, B. sawadae, B. subpanduriformis, B. cuatrecasii plus Topobea albertiae and third, the T. parasitica complex (which includes T. albertiae in a molecular analysis) (Fig. 2). The inner floral bracts of some flowers of T. albertiae were observed to be laterally extended and folded back across the inner bract surface. Species representing basal branches in the Blakea + Topobea clade, except T. cordata and T. hexandra (Fig. 2), have inner floral bracts that ar e much shorter than, to equal in length to, the hypanthium (46, state 0). The encapsulatedbud clade (Fig. 2) mos tly has inner floral bracts much longer than the hypanthium (sta te 2), as does the clade comprised of B. fuchsioides, B. wilburiana and T. intricata (Fig. 2). Calyx Valvate calyx lobes are the norm in the Blakeeae (56, state 1); however, they may be partly fused and irregularly splitting as in Blakea anomala or calyptrate as in Huilaea calyptrata, B. costaricensis and B. crinita Other unsampled species wi th calyptrate calices include B.

PAGE 61

61 argentea Gleason B. calyptrata Gleason B. fissicalyx Uribe, and Topobea steyermarkii Wurdack. The calyptrate calyx has arisen indepe ndently several times within the Blakeeae, and is also known from genera assigned to other tribes such as Pternandra (Astronieae) and Conostegia (Miconieae). Laterally overlapping calyx lobes (57, state 1) were found only in B. eriocalyx and the clade centered around southeastern Ecuador comprised of T. adscendens, T. bullata and T. cutucuensis (Fig. 2). Some species have calyx lobes that become inrolled as the berry ripens (59, state 1, Fig, 2a). This feature is a synapomorphy for B. wilburiana + T. intricata and also for some stipulate species including B. hispida, B. polyantha, B. lanuginosa, B. repens and B. jativae other unsampled species with stipules (see above) likely shar e this character. External calyx teeth (61) occur sporadically throughout the Melastomataceae, and in the Blakeeae, most species have at least a blunt, callos e thickening at or near the apex of the calyx lobe (state 1, Fig. 2a). A well-defined toot h (state 2, Fig. 2b) is a synapomorphy for the clade comprised of B. jativae, B. involvens and B. glabrescens (Fig. 2). A distinct tooth is also present in B. eriocalyx and B. subvaginata and these species all form a clade in a separate, molecular analysis (Fig. 2, Fig. 3). Corolla Most Blakeeae have petals rounded at the apex (64, state 0, e.g., Fig. 1a, d, f), though acute petals (state 1, e.g., Fig. 1g, i) are present in the basal clade of Topobea dodsonorum + T. pittieri (Fig. 2), and also scattered elsewhere th roughout the tree (Table 2). Large druse crystals in the petals (65, st ate 1, Fig. 1r) are a unique char acter previously thought to be shared only by Blakea calycosa and B. tuberculata As this discussion was being written and characters reassessed, the same structur es were discovered in the petals of B. crinita The matrix was revised accordingly and re-run first under th e parameters as before, and second, using

PAGE 62

62 branch-and-bound on the members of the fused-bract clade with B. penduliflora designated as the outgroup. In neither case did the topology change. These struct ures are resistant to grinding in a mortar and pestle, and would certainly be effective in deterring herbivores. Generally associated with pollination by vertebrates, ps eudocampanulate corollas (66, state 1, Fig. 1j-l) are a synapomorphy for Chalybea + Huilaea and the green-petaled (67, state 3, Fig. 1c) rodent-pollinated clade of Blakea penduliflora, B. austin-smithii and B. chlorantha a clade (Figs. 2, 2) discussed in greater detail below. Blakea fuchsioides has a pseudocampanulate corolla with magenta petals (67, state 1, Fig. 1e). The floral bracts of B. fuchsioides are a very showy, scarlet re d, and may be more attractive than the corolla. Petal position is unclear for B. wilburiana and T. intricata thus they were both scored as polymorphic for this trait. The only additional taxon with a pseudocampanulate corolla is T. parvifolia and this is notable since it also has pendant flow ers, a combination in the Blakeeae otherwise known only from vertebrate-pollinated speciesits pollinators are unknown, but the small, white flowers are suggestive of insect pollination. Ro tate corollas (66, stat e 1, e.g., Fig. 1f-o) that are white to pink-tinged, or lavend er-magenta (67, states 1 and 2, respectively), dominate in the Blakea + Topobea clade. Androecium Most Blakeeae have flowers that are zygomor phic as a result of the declinate androecium (68, state 1, e.g., Fig. 1a, d, f, h, i), a condition usually achieved by a sigmoid twisting of the filaments, particularly those ex teriorly positioned. All vertebra te-pollinated species in this analysis have completely actinomorphic flower s (state 2, e.g., Fig. 1b, k, o). Actinomorphic flowers are synapomorphic for Blakea hirsuta, B. sc hlimii, B. oldemanii and B. quadriflora and also for the following species pairs: B. brasiliensis + B. trinervia, Topobea bullata + T. cutucuensis and B. calycosa + B. tuberculata (Fig. 2, Table 2). Topobea brevibractea, B.

PAGE 63

63 rosea, B. lanuginosa, and T. sp. DSP1600 also have actinomorphic flowers. The biological significance or advantage of floral symmetr y in the Blakeeae has not been empirically investigated, however, given that 75% of the in group OTUs in this analysis have zygomorphic flowers, and that actinomorphy has independently arisen multiple times, it may be hypothesized that selection pressure from insect pollinators favors bilaterally symmetric flowers (Rodrguez et al. 2004). Within the family, and also in basal Blakeeae, free anthers (76, state 0, Fig. 1b-c) are the norm. Laterally coherent (connate) anthers (state 1, Fig. 1h-q) are present in a slight majority of the present sample where they are predominantly found in the grade from Blakea anomala through B. guatemalensis (Fig. 2, Table 2). Within that series, free anthers only occur in the clade comprised of B. fuchsioides, B. wilburiana and T. intricata Free anthers are a synapomorphy for the clade comprised of 12 Topobea species (in which a reversal to connate anthers occurred twice (F ig. 2); plus for the Chalybea + Huilaea clade, the rodent-pollinated clade, and the fused-bract clade (in which reversals occurred in B. crinita and B. calycosa ; Fig. 2). All vertebrate-pollinated species have fr ee anthers, but insectpollinated species have anthers that are eith er free or connate. Yellow anthers (78, state 1, e.g., Fig. 1a, d, f) are both the basal and most common conditions in the Blakeeae (Fig. 2, Table 2 Table 2). In the Amazon, a clade with bluish-magenta anthers (state 2, Fig. 1g, o) is here recognized, including B. rosea, B. sawadae and B. subpanduriformis (Fig. 2); B. cuatrecasii and Topobea albertiae are nested within the blue-anther clade, but they have yellow anthers. In a total evidence analysis, the latter two species are not members of this clade, but B. hirsuta (with blue anthers) is a member (Fig. 3). Other Amazonian species with bluish-magenta anthers presumed to be closely related to B.

PAGE 64

64 hirsuta include B. bracteata Gleason, B. hirsutissima (J. F. Macbr.) Wurdack, B. glandulosa Gleason, and B. formicaria Blakea subconnata and B. involvens also have bluish-magenta anthers. Blue anthers are uncommon in the Me lastomataceae, but have also been reported in some Amazonian Tococa (Michelangeli 2000) and members of the Olisbeoideae. The rodentpollinated clade (Figs. 2, 2), B. penduliflora, B. austin-smithii and B. chlorantha all have deep purple anthers (state 3). Huilaea calyptrata and H. ecuadorensis share with Blakea fuchsioides anther pores that are both quite long (81, state 3) and wi de (82, state 2). Gaping pores likely facilitate free shedding of pollen during brief visits by hummingbirds. It is also interesting to note that some species with quite large anthers, e.g., B. cuatrecasii, B. brunnea both with anthers over 9 mm long, have very small pores, (81, 82). Many Topobea species were scored as having wide anther pores (82, state 2); however, most taxa have incomplete ly united (confluent, Fig. 2c) pores and the measurement nearly spanned the breadth of the anther apex. Contrary to Wurdacks statement (1957) that the anther pores of most Blakeeae are dorsal, in this sample, only 29 of 72 (40.3%) OTUs were f ound to have dorsal, or dorsally inclined pores (character 83, states 1 and 2, resp ectively; Table 2). Of the 16 with strictly dorsal pores, all are Topobea species, except for Blakea trinervia An additional five species of Topobea have dorsally inclined pores (vs. eight species of Blakea ), two (vs. 14) have apical pores, one (vs. 16) has ventrally inclined pores, and none (vs. ni ne) has ventral pores. Po re position is correlated with anther shape, especially in the case of dorsal pores. As anthers become rounded across the apex, and the dorsal connective is thickened along the entire lengt h of the anther, the pores are pushed away from the dorsal side. The immature pores are sealed by a hymenoid membrane that ruptures marginally as the anthers mature.

PAGE 65

65 Anther connectives in the Blakeeae are smooth (86, state 1, Fig. 2a-b) in the Chalybea + Huilaea clade, the basal grade from Topobea pittieri through T. intricata the rodent-pollinated clade, and in basal members of the fused-brac t clade (Fig. 2; Table 2). Most of the remaining species have connectives that ar e rugose (state 2, Fig. 2d), sometimes quite markedly so, as in Blakea brasiliensis (Table 2). In some species the thickened tissue of the anther appendage descends the di stal dorso-lateral portion of th e filament (87, state 1, Fig. 2 16c-d). This condition is especial ly evident in many South American Blakea species, and is a synapomorphy for B. eriocalyx, B. hispida, B. polyantha, B. lanuginosa and B. repens (Fig. 2 24; Table 2); it is also syna pomorphic for a portion of the fused-bract clade (Fig. 2; Table 2). Nearly all South American Blakea species in this sample have dorso-basally sulcate anther connectives (88, state 1, Fig. 2c-d). This c ondition occurs when the portion of the anther connective above the filament is concave, rather than flattened or rounded (state 0, Fig. 2a-b), as is the case in the majority of species (Table 2). Sulcat e connectives are also found in T. cutucuensis, T. calycularis, B. scarlatina and B. costaricensis As was mentioned previously, anther connectives are far more morphologically diverse (90) than the simplified generic key of Cogniaux ( 1891) recognized. Nine st ates were scored for this character, with the triangular spur (state 3, Fig. 2d) occurring in the basal Topobea species and also throughout th e cladogram in 27 additional sp ecies, including most South American species of Blakea (Fig. 2; Table 2). Blunt kn obs (state 0, Fig. 2a) are present in most of the basal grade from T. parvifolia through Blakea fuchsioides and also in B. foliacea and T. calycularis Bluntly bi-lobed connective appenda ges (state 1, Fig. 2b) all have two, laterally adjacent, knobby protuberances, and are present in B. austin-smithii + B. chlorantha and also most of the fused-bract clade (F igs. 2, 2; Table 2) Elongate, bi-lobed

PAGE 66

66 connectives (state 2, Fig. 2c), a condition that describes a l ongitudinal invagination along the dorsal side of the anther, are found in B. subconnata, B. involvens and B. glabrescens (Fig. 2 24; Table 2). A saddle-shaped connectiv e (state 4, Fig. 2e) is autapomorphic for B. wilburiana a form quite different from its putativ e relatives. Synapomorphic for the clade comprised of T. setosa, T. adscendens, T. bullata and T. cutucuensis (Fig. 2; Table 2) is a doubled connective (state 6, Fig. 2g) in whic h two dorsal spurs (rather than the usual one) are present. Caudate appendages (state 7, Fig. 2h), essentially narrow, elongate and conical in form, are a synapomorphy for T. maurofernandeziana, T.parasitica, T. multiflora, T. calycularis (reversal to state 0), and T. cf. watsonii (Fig. 2). The squared tab form (state 8, Fig. 2i), a wedge-shaped connective, is a hom oplastic character appearing on the cladogram in six locations (Fig. 2; Table 2). Gynoecium All Blakeeae (except Topobea tetramera ) have six-merous flower s, and most are found to have a six-loculate gynoecium (93, state 4). Solanum -flowered Topobea species (Chapter 3) through T. fragrantissima (Fig. 2) have two, three, or four carpels. In the fused-bract clade, Blakea costaricensis and B. brunnea are exceptional in having nine and twelve carpels, respectively. Carpel numbers in Chalybea + Huilaea are different for each of the three species sampled, ranging from four in C. corymbifera to six in H. ecuadorensis and eight in H. calyptrata In this study, ovary position (96) was determin ed by observing the distal-most point of the locule in relation to the point at which the ovary roof conn ects to the inner hypanthium wall (Fig. 2d, g). This is an unambiguous metric whose estimation is not influenced by ovary crowns or stylar pedestals. Entirely inferi or ovaries (state 0, Fig. 2c-d) are the dominant condition in the tribe (Table 2) and are present in all sampled members of the Chalybea +

PAGE 67

67 Huilaea clade. Topobea dodsonorum also has inferior ovaries, though its sister species, T. pittieri, has ovaries 80% inferi or (state 1). Most Topobea species have ovaries 50% inferior (state 2, Fig. 2a-b), though T. setosa, T. maurofernandeziana and T. multiflora have ovaries 10% inferior to w holly superior. Within Blakea all have inferior ovaries, except B. jativae and B. chlorantha (state 1), and B. penduliflora (state 2). Except for T. acuminata, T. brevibractea, T. calycularis, B. oldemanii and B. quadriflora, which have axile placentation (97, state 1), all Blakeeae sampled have intruded axile placentation (state 0). Generally, the shape of the locules in longitudinal secti on is evenly orbicular to broadl y elliptic (98, Fig. 2a-b), but in some cases, most notably the fused-bract clade, the locules are pinched outward near the lateral apex (state 1, Fig. 2c-d). Puberulent to glandular styles (103, state 1) were found in 12 Blakea species (Table 2), and the presence of trichomes in this position is not associated with pubescence elsewhere, i.e., some rather glabrous plants (e.g., B. pauciflora, B. brasiliensis, B. spruceana ) were scored as state 1, and most densely pubescent species have glabrous styles (state 0). Large, capitate stigmas (106, 107) are a synapomorphy for B. subconnata + B. subvaginata and B. involvens + B. glabrescens (Fig. 2; Table 2). In most other Bl akeeae, the stigma is punctate or, rarely, subcapitate. Berry fruits (108, state 1, Fig. 2) are a synapomorphy for the Blakeeae, and the thickness of the exocarp may be thin (109, state 0, Fig. 2b, e) as in most species, or quite thick and leathery (state 1, Fig. 2c), as in Chalybea + Huilaea and most of the fused-bract clade Fully ripened fruits are as yet unknown for many species, but amongst the documented ones, red (110, state 0, Fig. 2a-b) is the prevalent color. Only Blakea rosea and unsampled B. bracteata have deep purple berries (state 2); la vender (state 4) berr ies are present in Topobea

PAGE 68

68 brevibractea ; B. litoralis and T. parasitica have pale greenish-white berries (state 3, Fig. 2de); orange berries are autapomorphic for T. maurofernandeziana (state 5, Fig. 2f). The thickrinded, very palatable, yellowish -green (state 1) berries of Chalybea + Huilaea known to be consumed by squirrels (M. Morales-P., pers comm.)are probably adapted for dispersal by mammals, such as bats or monkeys, a dispersal shift also postulated to have occurred in Bellucia (Renner 1989). Huilaea ecuadorensis produces a delicious berry (Fig. 2c) about 4 cm x 3 cm that has a flavor reminiscent of kiwi and passion fruit. This small tree is an endangered species (Penneys 2007) that has great potential as an or namental because of its very attractive foliage, large, red flowers, and edible fruits. Pyrami dal seeds (111, state 1) are found in all Blakeeae. Noteworthy Clades This cladistic analysis is the first step towards the production of a natural classification of the Blakeeae. Below, and also in Chapter 3, several clades identified in this investigation are discussed in detail. The pattern of character evolution within these clades is also addressed. The fused-bract clade As currently understood, the fused-bract clad e (Fig. 2) is strictly Central American, and, except for Blakea cuneata (found in Belize, Guatemala, and Honduras) and B. scarlatina (Costa Rica and Nicaragua), is centered in Co sta Rica and Panama. Me mbers of this clade include B. brunnea, B. calycosa, B. costaricensis, B. crinita, B. grandiflora, B. scarlatina, B. tapantiana, B. tuberculata, B. wilsoniorum and B. storkii Additionally, B. coloradensis, B. cuneata and B. perforata are presumed to belong to this as semblage, but were not included in the phylogenetic analyses. In the strict consensu s tree (Fig. 2) only the B. calycosa + B. tuberculata clade receives bootstrap suppor t (90%); however, in a major ity rule tree (not shown), every node in the fused-bract clad e has a value of 100%, a result that is duplicated in a separate, total evidence analysis (Chapter 3).

PAGE 69

69 For this clade, the outstanding phenotypic ch aracters (and putative synapomorphies) are the fused outer and inner floral bracts, the comb ination of which is unique in the Blakeeae. Almeda (1990, 1991, 1995, 2000b, 2007) has implicitly recognized the unity of this group. Additional synapomorphic characters for the fusedbract clade are the fairly closely spaced (17; 1.25.3 mm) tertiary veins (but wider in B. crinita, B. brunnea, B. calycosa and B. tuberculata ); stout, conic, barbellate setae on the outer floral br acts (34; absent in some B. grandiflora, B. scarlatina and B. crinita ); markedly thickened outer floral bracts (37, Fig. 2b); inner hypanthium length between 1.9 .4 mm long (50; except in B. crinita, B. calycosa and B. tuberculata ); locules apico-laterally narrowed (98; Fig. 2c-d) ; and the style somewhat thickened around middle (104; except in B. calycosa, B. grandiflora, B. scarlatina and B. tuberculata ). Some especially remarkable aspects of this clade include the enormous flowers of B. brunnea and B. costaricensis which have diameters of 13.5 and 11 centimeters, respectively. The large, showy, s carlet flowers of B. scarlatina are very attractive, an d this would make an excellent ornamental plant. The extremely hard, large, crystal inclusions within the petals of B. crinita, B. calycosa, and B. tuberculata are very unusual. The foliaceous calyx lobe appendage in the latter species pair is also unique. Fina lly, the saucer-like, fused, outer floral bracts of B. coloradensis are autapomorphic. Topobea parasitica complex Although recognition of the genus Topobea can no longer be jus tified, this analysis indicates that most sampled Topobea species are either members of a basal, paraphyletic grade, or they form a clade (nested well within Blakea ) of twelve species, in cluding the generotype, T. parasitica (Fig. 2). This clade receives no bootstra p support; however, in the majority rule tree (not shown) every branch within the parasitica clade has a value of 100% In a separate, total evidence analysis (Fig. 3), a T. adscendens + T. bullata + T. cutucuensis clade (i.e.,

PAGE 70

70 imbricate calyx clade; Fig. 3) is strongly supported (BS = 93%), with T. setosa sister (BS = 73%); the species are otherwis e unresolved in a paraphyletic grade and a polytomy. Although the parasitica complex here lacks statistical supp ort, some morphological characters are shown to be likely synapomorphies for the complex as a w hole, as well as some noteworthy subclades. Four morphological characters support the monophyly of the Topobea parasitica complex sensu lato; petal width (63, state 1), dorsal an ther pores (83, state 0) ovaries between 50% inferior (96, state 2), and recta ngular flaps crowning the ovary apex (101, state 3). Within this assemblage, two clades are wort hy of a brief examination. The T. adscendens + T. bullata + T. cutucuensis clade a radiation centered in the Cordillera del Condor and Cordillera de Consuelo of southeastern Ecuador, is diagnosed by a serr ate leaf margin (15, state 1), calyx tube 2.32.82 mm long (52, state 2), and imbricate cal yx lobes (57, state 1). Including T. setosa which is sister to the abovementioned species, this imbricate calyx clade is also ch aracterized by the double dorsal spur type of anther connective (90, state 6, Fig. 2g). The strikingly verrucose leaves of T. bullata are also found in T. muricata G. Lozano C., T. pascoensis Wurdack, and T. verrucosa Wurdack. These three species are also likely refe rable to this clade on the basis of imbricate calyx lobes and ovary apex appendage form. Th is imbricate calyx clade is also supported by molecular and combined molecular and mor phological analyses (Figs. 3 through 3). The parasitica sensu stricto clade, comprised of T. subscabrula + T. maurofernandeziana + T. parasitica + T. multiflora + T. calycularis + T. cf. watsonii, is supported by the outer floral bracts tightly adherent to the hypanthium (39, state 0, Fig. 2e-f), inner floral bracts overlapping (45, state 1), cal yx lobes 3.4 mm wide (54, st ate 1), anthers 0.44.48 mm wide (74, state 0), and the ovary apex crowned with triangular appendages (101, state 1, e.g., Fig. 2 1). Eliminating the basally branching T. subscabrula the remaining species are united by

PAGE 71

71 glabrous outer floral bracts (36, state 0), calyx tube 1.66.28 mm long (52, state 2), anthers laterally coherent (76, state 1, Fig. 1d-f), anther connective appendages caudate (90, state 7, Fig. 2h), and stamen length:hypanthium length 2.87.79 (91, state 3). Within this clade, it is also noteworthy that the anthers are frequently positioned in a plane above the style (see Fig. 1d-f, i). Almeda (Flora of Co sta Rica, in mss.) noted that Topobea cf. watsonii ( Penneys 301, 1525, 1801 ) may be a regional variant with unusually small flowers. Topobea parasitica has a more complex synonymy than any other member of the Blakeeae, a situation contributed to by its broad geographic distribution extending from Brazil across the northern South American c ountries of French Guiana, Surinam, Venezuela, Colombia, and north into Panama and Costa Rica. Many loca l variants have been described as separate species, and others such as T. floribunda Gleason, T. pubescens Gleason, T. rhodantha L.Uribe, and T. rupicola Hoehne await revisionary study to confirm their specific status. Topobea multiflora has been collected in Costa Rica, Panama, Ecuador (southern), Peru, and Bolivia. The vast majority of Blakeeae are quite restricted in distribution, and distant disjunctions are exceedingly rare These specimens may represen t two species as the Central American collections tend to be much less pube scent and occur at lowe r elevations (0m, rarely 1400m) than the South American one s (1400m). Another e xplanation for this pattern could be unrecognized synony mous species in Colombia, e.g., T. superba Naudin, that bridge the geographic and morphol ogical gaps. Other species, pr imarily South American, likely referable to the parasitica clade include T. albertiae T. amplifolia Almeda, T. discolor Hochr., T. macbrydei Wurdack, T. stephanochaeta Naud., T. tetroici Wurdack, and T. trianaei Cogn. Rodent-pollinated clade In terms of reproductive biology, the most rema rkable adaptation in the Blakeeae is rodent pollination. The pendant, green-flowered species of Blakea have received s ubstantial attention

PAGE 72

72 since the discovery of rodent pollination in this group (Lumer 1980, 2000; Lumer & Schoer 1986; but see Langtimm & Unnasch 2000). Three of the five species belonging to this clade were collected and analyzed during the course of this investigation. Synapomorphies for B. penduliflora + B. austin-smithii + B. chlorantha (BS = 64%; Figs. 2, 2) include peduncle pubescence 0.40 mm long (21, state 2), flow ers pendant (23, state 1), corolla pseudocampanulate (66, state 1) and green (67, st ate 3, Fig. 1c), stamens in a complete ring around style (68, state 0), anthers deep purple (78, state 3), anther sacs ap ically confluent, the pores somewhat united (80, stat e 1, Fig. 2d), and the anther pores dorsally inclined. Synapomorphies for B. austin-smithii + B. chlorantha (BS = 89%) include the position (10, state 3) and type (11, state 6, Fig. 2g) of the acarod omatia, densely pubescent outer floral bracts (36, state 2), calyx lobes 3.4 mm wi de (54, state 1), calyx lobes remaining green in fruit (60, state 0), and petals 3.2.7 mm long (62, state 0). Nocturna l anthesis and production of mucilaginous nectar are also presum ed synapomorphies for this clade. Blakea purpusii Brandegee and B. gregii Almeda have also been considered to be members of this assemblage (Almeda 1980a, 1980b, 1990, 2000b), and at present, no evidence to the contrary exists. No other described Blakea species has green, pseudocampanulate, nectariferous flowers, and we are confident that this gr oup is monophyletic. Future cladistic analyses including morphological and molecular data for B. purpusii will be especially interesting given its geographic isolation in Chiapas, Mexi co and the bordering region of Guatemala (Quezaltenango and San Marcos). Blakea purpusii is somewhat divergent from the other four species in that it has yellow an thers, red filaments, and petals that are red at the base (Almeda 2000b).

PAGE 73

73 Hexandrous Topobea Although the vast majority of Blakeeae posse ss twelve stamens, five species of Topobea found in Costa Rica and Panama, i.e., T. arboricola, T. caliginosa, T. cordata, T. crassifolia, and T. hexandra have only six, antesepalous stamens (69, st ate 1) and this character does, indeed, support the monophyly of that unus ual group. Three species bel onging to the hexandrous group (Figs. 2, 2) of Topobea (Almeda 2000a) were includ ed in this analysis. Topobea caliginosa + T. cordata + T. hexandra are resolved as monophylet ic (BS = 84%) based on their epiphytic (at maturity; 1, state 2), compact shrub (2, state 2) habit, very short peduncles (20, state 0), and apical anther pores (83, state 2). Topobea cordata and T. hexandra were resolved as sister species (BS = 71%), however, in contrast to the vast majority of species included in these analyses, in which morphological data was derived from liquidpreserved flowers, only dried floral material was available. Therefore, 75 ce lls (22.5%) of the matrix were scored as missing data, and some of the included data were derived from the literature For these reasons, we feel it is still appropriate to accept the phylogenetic relationshi ps hypothesized by Almeda (2000a), i.e., T. arboricola sister to T. caliginosa T. cordata sister to T. crassifolia and T. hexandra unplaced. We agree with Almeda (2000a) that this clade is indeed quite highly specialized on the basis of the six, antesepalous stamens, subse ssile flowers, and inferior ovaries with two or four carpels. Unsampled species include T. arboricola Almeda and T. crassifolia (Almeda) Almeda. Topobea tetramera Almeda (not included in this analys is) is exceptional in that it has fourmerous flowers with eight stamensit is probably more closely allied with Blakea wilburiana, T. dimorphophylla, and T. intricata than it is with the hexandrous group.

PAGE 74

74 Figure 2. A-B. Generalized diagrammatic flow er of Blakeeae showing selected measurement definitions. Numbers (in parentheses) re fer to characters in the morphological analysis. A) Flower, longitudinal section. a) Calyx lobe width ( 54). b) Calyx lobe length (53). c) Calyx tube length (52). d) Ovary locule length (94). e) Ovary locule width (95). f) H ypanthium width (measured thr ough middle of locules) (47). g) Inner hypanthium length (50). B) Stamen, side view. h) Anther length (75). i) Anther width (74). j) Anther appendage length (84). k) Filament length (71).

PAGE 75

75 Fig. 2. Stipule form in the Blakeeae (character 5). a) Blakea repens coriaceous stipule. b) B. jativae papery stipules.

PAGE 76

76 Figure 2. Acarodomatia in the Bl akeeae (character 11). a) Topobea multiflora hair tuft acarodomatium. b) Blakea subconnata marsupiform pocket. c) T. dodsonorum open pocket. d) B. litoralis recessed pit. e) B. quadriflora lateral laminae. f) Huilaea ecuadorensis pinwheel. g) B. austin-smithii petiolar flap. h) B. rotundifolia coalesced veins. i) Graffenrieda harlingii revolute margin.

PAGE 77

77 Figure 2. Graph illustrating variat ion in tertiary vein separati on in the morphological analysis of the Blakeeae (character 17). State 3 (d istance = 12 mm) not graphed in order to better illustrate variation present in most species.

PAGE 78

78 Figure 2. Graph illustrating vari ation in peduncle length in the morphological analysis of the Blakeeae (character 20). State 5 (pedunc le 6380 mm) not graphed in order to better illustrate variation present in most species.

PAGE 79

79 Figure 2. Graph illustrating lengt h of the fused portion of the outer floral bracts in the morphological analysis of the Blakeeae (character 30). Figure 2. Pubescence types found in the Blakeeae. a) Furfuraceous-granulose. b) Simple, smooth seta. c-d) Roughened setae. e) Gl and-headed seta. f) Seta with fimbriate apex. g) Stoutly conic, elongate, barbellate seta.

PAGE 80

80 Figure 2. Outer floral br act texture in the Blakeeae (character 37). a) Blakea subconnata outer floral bract s thin. b) B. scarlatina, outer floral bracts markedly thickened. Figure 2. Graph illustrating lengt h of the fused portion of the inner floral bracts in the morphological analysis of the Blakeeae (character 44).

PAGE 81

81 Figure 2. Graph illustrating length of the calyx tube in the morphologi cal analysis of the Blakeeae (character 52). Figure 2. Foliaceous calyx appe ndage (character 58). a) Blakea calycosa young fruit. b-c) B. tuberculata flower and buds

PAGE 82

82 Figure 2. External calyx tooth form in the Blakeeae (character 61). a) Blakea oldemanii external calyx tooth a blunt callose thickening. b) B. jativae calyx tooth welldefined. Figure 2. Graph illustrating the anther length to width quo tient (character 75) in the morphological analysis of the Blakeeae.

PAGE 83

83 Figure 2. Variation in Blakeeae anther pore form (character 80). Anther sacs apically united, opening by a single pore: a) Topobea cf. watsonii b) T. fragrantissima Pores confluent, somewhat united: c) T. multiflora d) Blakea chlorantha Pores wellseparated, functionally distant: e) B. subconnata f) B. scarlatina Figure 2. Graph illustrating length of the anther appendage (cha racter 84) in the morphological analysis of the Blakeeae.

PAGE 84

84 Figure 2. Variation in the form of anther connective tissue in the Blakeeae (character 87). Anther connective tissue restricted: a) Topobea fragrantissima b) Blakea tapantiana Tissue decurrent along filament: c) B. eriocalyx d) B. repens

PAGE 85

85 Figure 2. Anther connective appendage vari ation in the Blakeeae (character 90). a) Blakea foliacea anther connective blunt knob. b) B. wilsoniorum, bluntly bi-lobed. c) B. involvens elongate bi-lobed. d) B. eriocalyx triangular spur. e) B. wilburiana saddle-shaped. f) Huilaea calyptrata scalloped. g) Topobea cutucuensis doubled. h) T. cf. watsonii caudate. i) B. litoralis squared tab.

PAGE 86

86 Figure 2. Ovary locule apex form in the Blak eeae (character 98). Ovar y apex apico-laterally rounded: a) Topobea fragrantissima b) T parvifolia. Ovary apex narrowed: c) Blakea wilburiana. d) B. litoralis

PAGE 87

87 Figure 2. Ovary apex appendage variation in the Blakeeae (character 101). a) Blakea quadriflora ovary apex appendages absent. b) B. eriocalyx, triangular ridge extensions. c) B. hirsuta cephalopoid. d) Topobea brenesii rectangular flaps.

PAGE 88

88 Figure 2. Graph illustrating length of the stigma (character 106) in the morphological analysis of the Blakeeae. Figure 2. Coloration of mature Blak eeae fruits (character 110). a) Blakea repens red. b) B. hirsuta red. c) Huilaea ecuadorensis yellowish-green. d) B. litoralis pale green-white. e) T. parasitica pale green-white. f) T. maurofernandeziana orange.

PAGE 89

89 Blakeaeriocal y x DSP16 2 0 Blakeahispida DSP1869 Blakeajativae DSP1565 Blakealanuginosa DSP1897 Blakeapolyantha DSP1583 Blakearepens DSP1849 Blakeacostaricensis DSP1648 BlakeastorkiiMcPherson9326 Blakeawilsoniorum DSP1820 Blakeabrunnea DSP1713 Blakeatapantiana DSP1789 Blakeawilburiana DSP1761 Topobeaintricata DSP1723 Blakeafuchsioides DSP1744 Blakeavenusta DSP1810 Blakeacrinita DSP1656 Blakeaaustin-smithii DSP1830 Blakeachlorantha DSP1512 Blakeapenduliflora DSP1782 Topobeasubscabrula DSP1582 Topobeacaliginosa DSP1711a Topobeacordata DSP1667 Topobeahexandra DSP1689 Blakeabrasiliensis DSP1875 Blakeascarlatina DSP1797 Blakeacalycosa DSP1700 Blakeatuberculata DSP1518 Blakeagracilis DSP1628 BlakeapaucifloraMori5900 Topobeaadscendens DSP1888 Topobeacutucuensis DSP1613 Topobeadodsonorum DSP1686 Topobeapittieri DSP1571 Topobeamultiflora DSP1817 TopobeaparasiticadeGranville8734 BlakeaanomalaLuteyn4498 BlakeacuatrecasiiCuatrecasas16393 Blakea foliacea DSP1646 Blakeaglabrescens DSP1563 BlakeagrandifloraGuindon1104 Blakeaguatemalensis DSP1818 Blakea aff herrerae DSP1682 Blakeahirsuta DSP1844 Blakeainvolvens DSP1625 Blakealitoralis DSP1819 Blakeapulverulenta DSP1627 Blakeaoldemanii DSP1896 Blakeapulverulenta DSP1305 Blakeaquadriflora DSP1599 Blakearosea DSP1858 TopobeaspDSP1600 Blakearotundifolia DSP1622 Blakeasawadae DSP1874 BlakeaschlimiiDorr7385 Blakeaspruceana DSP1624 Blakeasubconnata DSP1580 Blakeasubpanduriformis DSP1887 Blakeasubvaginata DSP1861 Blakeainvolvens DSP1619 Blakea trinerviaJudd5323 Topobea acuminata DSP1851 Topobeaalbertiae DSP1698 Topobeabrenesii DSP1770 Topobeabrevibractea DSP1572 Topobeabullata DSP1886 Topobeafragrantissima DSP1715 Topobea maurofernandezianaHaber8011 Topobeaparvifolia DSP1655 Topobeasetosa DSP1577 Topobea cf watsonii DSP1525 TopobeacalycularisAbbott19758 ChalybeacorymbiferaStein3610 Huilaea ecuadorensis DSP1589 Huilaeacalyptrata DSP1892 Graffenriedalatifolia DSP1303 Monochaetumfloribundum DSP1449 Tibouchinalongifolia DSP1433 MiconialaevigataJudd534256 93 90 82 83 54 67 92 70 81 Figure 2. Strict consensus of 20 equally pars imonious trees derived from the analysis of 77 qualitative morphological ch aracters (length = 649 step s; CI = 0.206; RI = 0.536). Numbers above the branch indicate bootstrap support above 50%.

PAGE 90

90 Blakea j ati v ae DSP1565 Blakearotundifolia DSP1622 Blakeainvolvens DSP1619 Blakeainvolvens DSP1625 Blakeaglabrescens DSP1563 Blakeasubvaginata DSP1861 BlakeagrandifloraGuindon1104 BlakeastorkiiMcPherson9326 Blakea trinerviaJudd5323 Blakeapulverulenta DSP1627 Blakeapulverulenta DSP1305 Blakearepens DSP1849 Blakeaeriocalyx DSP1620 Blakeabrasiliensis DSP1875 Blakeaspruceana DSP1624 Blakeascarlatina DSP1797 Blakeawilsoniorum DSP1820 Blakeacostaricensis DSP1648 Blakeabrunnea DSP1713 Blakeatuberculata DSP1518 Blakeacalycosa DSP1700 Blakeacrinita DSP1656 Blakealanuginosa DSP1897 Blakeafuchsioides DSP1744 Blakeasubconnata DSP1580 Blakeapenduliflora DSP1782 Blakeahispida DSP1869 Blakeapolyantha DSP1583 Topobeaintricata DSP1723 Blakeawilburiana DSP1761 Blakeachlorantha DSP1512 Topobeaadscendens DSP1888 Topobeasetosa DSP1577 Topobeacutucuensis DSP1613 Topobeabrenesii DSP1770 Topobeabullata DSP1886 Blakeaaustin-smithii DSP1830 Topobeaalbertiae DSP1698 TopobeaparasiticadeGranville8734 Topobea maurofernandezianaHaber8011 Topobeamultiflora DSP1817 Huilaea ecuadorensis DSP1589 Huilaeacalyptrata DSP1892 ChalybeacorymbiferaStein3610 Blakeaquadriflora DSP1599 BlakeaschlimiiDorr7385 BlakeacuatrecasiiCuatrecasas16393 Blakea foliacea DSP1646 Blakeagracilis DSP1628 Blakeaguatemalensis DSP1818 Blakeahirsuta DSP1844 Blakealitoralis DSP1819 Blakeaoldemanii DSP1896 Blakearosea DSP1858 Topobeasp DSP1600 Blakeasawadae DSP1874 Blakeasubpanduriformis DSP1887 Blakeatapantiana DSP1789 Blakeavenusta DSP1810 Topobeasubscabrula DSP1582 BlakeapaucifloraMori5900 BlakeaanomalaLuteyn4498 Blakea aff herrerae DSP1682 Topobeafragrantissima DSP1715 Topobeacordata DSP1667 Topobeahexandra DSP1689 Tibouchinalongifolia DSP1433 Topobeabrevibractea DSP1572 Topobeacaliginosa DSP1711a Topobeaparvifolia DSP1655 Topobeadodsonorum DSP1686 Topobeapittieri DSP1571 Monochaetumfloribundum DSP1449 Topobea acuminata DSP1851 TopobeacalycularisAbbott19758 Topobea cf watsonii DSP1525 Graffenriedalatifolia DSP1303 MiconialaevigataJudd534270 56 97 51 58 51 Figure 2. Strict consensus of 20 equally pars imonious trees derived from the analysis of 34 quantitative morphological ch aracters (length = 610 step s; CI = 0.162; RI = 0.557). Numbers above the branch indicate bootstrap support above 50%.

PAGE 91

91 Blakeabrunnea DSP1713 Blakeacrinita DSP1656 Blakeacalycosa DSP1700 Blakeatuberculata DSP1518 Blakeacostaricensis DSP1648 Blakeascarlatina DSP1797 Blakeawilsoniorum DSP1820 BlakeagrandifloraGuindon1104 BlakeastorkiiMcPherson9326 Blakeatapantiana DSP1789 Blakeaaustin-smithii DSP1830 Blakeachlorantha DSP1512 Blakeapenduliflora DSP1782 Huilaea ecuadorensis DSP1589 Huilaeacalyptrata DSP1892 ChalybeacorymbiferaStein3610 TopobeacalycularisAbbott19758 Topobea cf watsonii DSP1525 Topobeamultiflora DSP1817 Topobea maurofernandezianaHaber8011 TopobeaparasiticadeGranville8734 Topobeasubscabrula DSP1582 Topobeaadscendens DSP1888 Topobeabullata DSP1886 Topobeacutucuensis DSP1613 Topobeasetosa DSP1577 Topobeabrenesii DSP1770 Topobeasp DSP1600 Blakeaguatemalensis DSP1818 Blakeahispida DSP1869 Blakeapolyantha DSP1583 Blakealanuginosa DSP1897 Blakearepens DSP1849 Blakeaeriocalyx DSP1620 Blakeaglabrescens DSP1563 Blakeainvolvens DSP1625 Blakeainvolvens DSP1619 Blakeajativae DSP1565 Blakearotundifolia DSP1622 Blakeaspruceana DSP1624 Blakeaoldemanii DSP1896 Blakeaquadriflora DSP1599 BlakeaschlimiiDorr7385 Blakeahirsuta DSP1844 BlakeacuatrecasiiCuatrecasas16393 Topobeaalbertiae DSP1698 Blakeasubpanduriformis DSP1887 Blakeasawadae DSP1874 Blakearosea DSP1858 Blakeasubconnata DSP1580 Blakeasubvaginata DSP1861 Blakeapulverulenta DSP1305 Blakeabrasiliensis DSP1875 Blakea trinerviaJudd5323 Blakeapulverulenta DSP1627 Blakea foliacea DSP1646 Blakealitoralis DSP1819 Blakeawilburiana DSP1761 Topobeaintricata DSP1723 Blakeafuchsioides DSP1744 Blakeavenusta DSP1810 Blakeagracilis DSP1628 BlakeapaucifloraMori5900 Blakea aff herrerae DSP1682 BlakeaanomalaLuteyn4498 Topobeafragrantissima DSP1715 Topobeacordata DSP1667 Topobeahexandra DSP1689 Topobeacaliginosa DSP1711a Topobeabrevibractea DSP1572 Topobeaparvifolia DSP1655 Topobea acuminata DSP1851 Topobeadodsonorum DSP1686 Topobeapittieri DSP1571 Monochaetumfloribundum DSP1449 Tibouchinalongifolia DSP1433 MiconialaevigataJudd5342 Graffenriedalatifolia DSP1303 fused-bract rodent parasitica hexandrous90 89 64 99 98 51 71 84 77 73 772 73 75 76 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 1 74 Figure 2. One of 8 equally parsimonious trees derived from the analysis of 111 morphological characters (length = 1360 st eps; CI = 0.171; RI = 0.502). Numbers above the branch indicate bootstrap suppor t above 50%, numbers below branches indicate nodes listed in Ta ble 2. Thin lines collapse in strict consensus.

PAGE 92

92 Figure 2. Distribution of anther pore number in the Blakeeae. State (0) = uniporose; (1) = pores confluent, somewhat united; (2) = two, well-separated pores.

PAGE 93

93 Figure 2. Distribution of anther connective appendage forms in the Blakeeae. State (0) = blunt knob; (1) = bluntly bi-lob ed; (2) = elongate bi -lobed; (3) = triangular spur; (4) = saddle-shaped; (5) = scalloped; (6) = doubled; (7) = caudate; (8) = squared tab.

PAGE 94

94 Figure 2. Anther length to width ratio in the Blakeeae. State (0) = 1.02 2.67; (1) = 3.03 5.46; (2) 6.57 9.42.

PAGE 95

95 Figure 2. Distribution of acarodomatia in th e Blakeeae. State (0) = hair tuft; (1) = marsupiform pocket; (2) = open pocket; (3) rece ssed pit; (4) = lateral laminae; (5) = pinwheel; (6) = petiolar flap; (7) = co alesced veins; (8) = revolute margin.

PAGE 96

96 Blakea tuberculata Blakea calycosa Blakea crinita Blakea brunnea Blakea costaricensis Blakea scarlatina Blakea wilsoniorum Blakea storkii Blakea grandiflora Blakea tapantiana 21 2 3 29 3 2 42 3 2 43 3 2 46 1 0 67 0 1 73 1 0 79 0 1 100 0 1 4 2 1 37 1 0 39 0 1 47 3 2 54 3 2 60 1 0 74 3 2 76 0 1 50 3 0 53 3 4 58 0 1 62 3 2 65 0 1 68 1 0 84 0 1 89 1 0 90 1 3 98 1 0 102 0 1 103 0 1 104 1 0 12 0 1 13 2 1 20 1 0 21 2 4 22 1 0 29 3 2 31 1 0 33 2 1 34 1 0 40 1 0 42 3 2 43 3 2 47 3 2 50 3 2 56 0 2 62 3 1 73 1 2 74 3 2 76 0 1 83 2 3 82 0 1 93 4 7 81 1 0 87 1 0 99 1 0 9 2 3 16 0 1 17 1 2 12 0 1 31 1 0 46 1 0 48 0 1 56 0 2 72 0 2 93 4 6 4 2 1 37 1 0 39 0 1 47 3 2 54 3 2 22 1 0 33 2 0 34 1 0 36 1 0 38 2 1 40 1 0 52 3 4 67 0 2 71 0 1 84 0 2 89 1 0 90 1 3 91 0 3 102 0 1 104 1 0 1 1 0 12 0 2 49 0 1 91 0 1 106 0 1 20 2 1 53 2 3 63 3 4 87 0 1 21 0 1 54 2 3 86 0 1 95 2 4 105 1 2 9 2 1 21 0 2 28 2 1 39 1 0 82 0 1 83 3 2 12 0 1 13 2 0 33 2 0 34 1 0 36 1 0 40 1 0 53 2 1 104 1 0 106 0 1 71 0 1 73 1 2 91 0 2 29 1 3 43 1 3 52 1 3 62 1 3 63 2 3 9 2 1 15 0 1 79 1 0 81 1 0 17 2 1 34 0 1 37 0 1 44 2 1 50 2 1 98 0 1 104 0 1 Figure 2. Morphological character distribu tion for the fused-bract clade of Blakeeae.

PAGE 97

97 Topobea cf. watsonii Topobea calycularis Topobea multiflora Topobea parasitica Topobea maurofernandeziana Topobea subscabrula Topobea cutucuensis Topobea bullata Topobea adscendens Topobea setosa Topobea brenesii Topobea sp.DSP1600 4 1 0 8 1 0 29 1 0 43 1 0 44 2 0 45 1 0 52 2 1 54 1 0 63 1 0 89 1 0 99 0 1 49 1 0 72 2 0 76 1 0 79 1 0 82 2 1 86 1 0 87 0 1 88 0 1 90 7 0 91 3 2 93 4 3 97 0 1 101 1 0 28 1 0 42 1 0 46 1 0 47 1 0 95 2 1 5 0 1 6 0 1 12 0 2 78 1 0 92 2 3 96 2 3 9 2 1 10 0 2 53 1 0 22 1 0 38 2 0 59 0 1 63 1 2 78 1 0 82 2 0 86 1 0 89 1 0 92 2 3 107 1 0 4 1 2 20 1 2 40 0 1 45 1 0 52 2 3 54 1 2 60 1 2 72 2 1 74 0 2 80 1 0 83 0 1 96 2 3 99 0 1 106 0 1 17 0 1 67 0 1 81 1 2 84 0 1 36 1 0 52 1 2 76 0 1 90 8 7 91 1 3 15 0 1 20 1 0 46 1 0 72 2 1 83 0 1 86 1 0 106 0 1 39 1 0 45 0 1 54 2 1 74 1 0 101 3 1 9 2 3 21 2 4 29 2 3 47 1 2 52 2 0 88 0 1 22 0 1 30 3 1 40 0 1 61 1 0 80 1 0 84 1 0 86 1 0 93 4 3 96 2 0 68 1 0 73 1 0 2 3 1 31 1 0 36 2 0 64 0 1 72 2 1 83 0 1 15 0 1 52 1 2 57 0 1 16 1 2 20 1 3 21 2 4 50 2 3 63 1 2 70 1 0 76 0 1 96 2 3 100 0 1 101 3 0 78 1 0 81 1 2 84 0 1 90 8 6 106 0 1 4 1 0 9 2 1 16 1 0 30 3 1 32 0 1 44 2 1 49 0 1 54 2 3 72 2 0 86 1 0 17 0 2 21 1 2 22 1 0 34 0 1 36 1 2 42 1 2 53 1 3 61 1 0 20 2 1 75 0 1 13 2 0 41 0 1 50 2 3 52 1 0 62 1 0 73 1 0 74 1 2 92 2 3 100 0 1 105 1 0 63 2 1 83 3 0 96 0 2 101 0 3 Figure 2. Morphological char acter distribution for the pa rasitica clade of Blakeeae.

PAGE 98

98 Blakea chlorantha Blakea austin-smithii Blakea penduliflora 9 2 1 20 2 1 28 2 1 39 1 0 52 1 0 96 0 2 30 3 1 42 1 2 79 1 0 105 1 2 10 0 3 36 1 2 54 2 1 60 1 0 62 1 0 4 1 2 12 0 1 20 2 3 29 1 2 42 1 3 43 1 2 47 1 2 52 1 2 95 2 3 96 0 1 21 0 2 23 0 1 67 0 3 78 1 3 80 2 1 83 3 1 Figure 2. Morphological character distribution for the rodent-pollinated clade of Blakeeae. Topobea hexandra Topobea cordata Topobea caliginosa 38 2 1 83 2 3 16 0 1 42 0 1 53 1 2 75 0 1 92 2 3 17 0 1 28 0 1 43 0 1 46 0 1 4 0 1 1 1 2 2 3 2 20 3 0 69 0 1 83 0 2 Figure 2. Morphological char acter distribution for the he xandrous clade of Blakeeae.

PAGE 99

99 Table 2. Specimens examined in morphologi cal cladistic analysis of the Blakeeae. Outgroups Specimen examined Graffenrieda latifolia (Naudin) Triana Penneys 1303 (FLAS) Miconia laevigata (L.) D. Don Penneys 1317 (FLAS) Monochaetum floribundum (Schltdl.) Naudin Penneys 1449 (FLAS) Tibouchina longifolia (Vahl) Baill. Penneys 1433 (FLAS) Ingroup Blakea anomala Donn.Sm. Luteyn 4498 (US) Blakea austin-smithii Standl Penneys 1830 (FLAS) Blakea brasiliensis Cogn Penneys 1875 (FLAS) Blakea brunnea Gleason Penneys 1713 (FLAS) Blakea calycosa Gleason Penneys 1700 (FLAS) Blakea chlorantha Almeda Penneys 1512 (FLAS) Blakea costaricensis G.Umaa Dodero & Almeda Penneys 1648 (FLAS) Blakea crinita Gleason Penneys 1656 (FLAS) Blakea cuatrecasii Gleason Cuatrecasas 16393 (US) Blakea eriocalyx Wurdack Penneys 1620 (FLAS) Blakea foliacea Gleason Penneys 1646 (FLAS) Blakea fuchsioides Almeda Penneys 1744 (FLAS) Blakea glabrescens Benth Penneys 1563 (FLAS) Blakea gracilis Hemsl Penneys 1628 (FLAS) Blakea grandiflora Hemsl Guindon 1104 (NY) Blakea guatemalensis Donn.Sm. Penneys 1818 (FLAS) Blakea aff herrerae Almeda Penneys 1682 (FLAS) Blakea hirsuta O.Berg ex Triana Penneys 1844 (FLAS) Blakea hispida Markgr Penneys 1869 (FLAS) Blakea involvens Markgr Penneys 1619 (FLAS) Blakea involvens Markgr Penneys 1625 (FLAS) Blakea jativae Wurdack Penneys 1565 (FLAS) Blakea lanuginosa Wurdack Penneys 1897 (FLAS) Blakea litoralis L.O.Williams Penneys 1819 (FLAS) Blakea oldemanii Wurdack Penneys 1896 (FLAS) Blakea pauciflora Gleason Mori 5900 (US) Blakea penduliflora Almeda Penneys 1782 (FLAS) Blakea polyantha Wurdack Penneys 1583 (FLAS) Blakea pulverulenta Vahl Penneys 1305 (FLAS) Blakea pulverulenta Vahl Penneys 1627 (FLAS) Blakea quadriflora Gleason Penneys 1599 (FLAS) Blakea repens D.Don Penneys 1849 (FLAS) Blakea rosea D.Don Penneys 1858 (FLAS) Blakea rotundifolia D.Don Penneys 1622 (FLAS) Blakea sawadae J.F.Macbr Penneys 1874 (FLAS) Blakea scarlatina Almeda Penneys 1797 (FLAS) Blakea schlimii Triana Dorr 7385 (NY) Blakea spruceana Cogn Penneys 1624 (FLAS)

PAGE 100

100 Table 2. Continued. Blakea storkii (Standl.) Almeda McPherson 9326 (US) Blakea subconnata O.Berg ex Triana Penneys 1580 (FLAS) Blakea subpanduriformis E. Cotton & Matezki Penneys 1887 (FLAS) Blakea subvaginata Wurdack Penneys 1861 (FLAS) Blakea tapantiana G.Umaa Dodero & Almeda Penneys 1789 (FLAS) Blakea trinervia L Judd 5323 (FLAS) Blakea tuberculata Donn.Sm. Penneys 1518 (FLAS) Blakea venusta Kriebel, Almeda & Estrada Penneys 1810 (FLAS) Blakea wilburiana Almeda Penneys 1761 (FLAS) Blakea wilsoniorum Almeda Penneys 1820 (FLAS) Chalybea corymbifera Naudin Stein 3610 (NY) Huilaea ecuadorensis Wurdack Penneys 1589 (FLAS) Huilaea calyptrata Penneys & Morales-P. Penneys 1892 (FLAS) Topobea acuminata Wurdack Penneys 1851 (FLAS) Topobea adscendens E. Cotton & Matezki Penneys 1888 (FLAS) Topobea albertiae Wurdack Penneys 1698 (FLAS) Topobea brenesii Standl Penneys 1770 (FLAS) Topobea brevibractea Gleason Penneys 1572 (FLAS) Topobea bullata E. Cotton & Matezki Penneys 1886 (FLAS) Topobea caliginosa Almeda Penneys 1711a (FLAS) Topobea calycularis Naudin Abbott 19758 (FLAS) Topobea cordata Gleason Penneys 1667 (FLAS) Topobea cutucuensis Wurdack Penneys 1613 (FLAS) Topobea dodsonorum Wurdack Penneys 1686 (FLAS) Topobea fragrantissima Almeda Penneys 1715 (FLAS) Topobea hexandra Almeda Penneys 1689 (FLAS) Topobea intricata Almeda Penneys 1723 (FLAS) Topobea maurofernandeziana Cogn Haber 8011 (US) Topobea multiflora (D.Don) Triana Penneys 1817 (FLAS) Topobea parasitica Aubl de Granville 8734 (US) Topobea parvifolia (Gleason) Almeda Penneys 1655 (FLAS) Topobea pittieri Cogn. in DC Penneys 1571 (FLAS) Topobea setosa Triana Penneys 1577 (FLAS) Topobea sp. Penneys 1600 (FLAS) Topobea subscabrula Triana Penneys 1582 (FLAS) Topobea cf watsonii Cogn Penneys 1525 (FLAS) Table 2. Morphological character matrix for cladistic analysis of the Blakeeae (see text for listing of characters and character states). A=(0, 1); B=(0, 2); C=(0, 3); D=(1, 2); E=(1, 3); F=(1, 7); G=(1, 3) 1 2 3 4 5 5 12345678901234567890123456789012345678901234567890123456 Blakea anomala 1300010000?000010214100100101110000002000002001000203301 Blakea austin-smithii 13010001236020002212211100021110100202100212011002212100 Blakea brasiliensis D301000120?000010214110100033310000011100322011002222300

PAGE 101

101 Table 2. Continued. Blakea brunnea 1302000130?020112211210100?23210210212010331013003223300 Blakea calycosa 1301000130?020012211210100013210210D02110331012000214200 Blakea chlorantha A3010001136020002211211100011310100202000112011002202100 Blakea costaricensis 1302000120?100001211210100013200D1011201033100310323??02 Blakea crinita A302000130?110112210400100?122001002120002210120022???02 Blakea cuatrecasii 1301000120?1000022130001A1012110000012000222112002230300 Blakea eriocalyx A30111013200D011121311011?033310101A00000432021002202200 Blakea foliacea 13010001123000011214000100122110000002100112011000212200 Blakea fuchsioides 1100000010?0D0001215301100132300DA0100101322121010222210 Blakea glabrescens 1301011120?030010213000111?33310000000000432122012221200 Blakea gracilis 13000000123000000213?001??031310000000100212011011210000 Blakea grandiflora 1301010120?100011214010100023210000012100231011001231200 Blakea guatemalensis 1301000120?1G1010212100100?11310G00100100112011000210100 Blakea aff herrerae 1G00000010?000000212010100?11310000002010002001000211100 Blakea hirsuta 13010001221010011213410100121311100100100212011000222210 Blakea hispida 1301110110?0E0111213410111022300E00100100312021001201110 Blakea involvens1619 1302011230?020121213010111?33300000001000232111012221200 Blakea involvens1625 13020112321100111214000111033300000000000432121012221300 Blakea jativae 1322210230?21012221301011??33300100001000432122002203300 Blakea lanuginosa A302111130?03011121141011?013300301102000332013000212200 Blakea litoralis 13010001123000010213010100121010000001100212011010200200 Blakea oldemanii A30100112210G01112121101A?112310G00000100222011000211200 Blakea pauciflora 13010010123100000213000100101310000000000002001000210100 Blakea penduliflora 1302000120?120002213211100022310100101110322012002222200 Blakea polyantha A20221023210E01222124001??031300E01100000312021001201100 Blakea pulverulenta1303 1301000112E10000121310011??22310000002100322011002202200 Blakea pulverulenta1627 13010001221D000012130001??022300000002100322011002222200 Blakea quadriflora 130100112241000112130001A0111300000000100212011000200100 Blakea repens 1301111230?0E0111213400111023310E01101100322011011202200 Blakea rosea 1301000120?001010211010100111110000002110112111000212100 Blakea rotundifolia A30200023270G002221410011??33310G10201000432021001221200 Blakea sawadae 13010001221000011212010100022110200212010222112000213200 Blakea scarlatina 1301000120?000001211100100023210000011100331013001243300 Blakea schlimii 130100112200200102132101A??12310G00101100212011000201100 Blakea spruceana A301000120?0G0001214100100033310000100000422021000211200 Blakea subconnata 13120011221100011213000111A22300000001000322021001201200 Blakea subpanduriformis 1101000120?000000211210100?121??????12010122111001212200 Blakea subvaginata 03010111321000011213010111023310000001000332111012201200 Blakea tapantiana 1301010110?020111212010100021110G10111110111011001212200 Blakea trinervia 1301000122A1000102130101???22310000001000322021001221300 Blakea tuberculata A302000130?020112211310100?22210210D12010221003000204300 Blakea venusta 1100000110?111010211200100011301E0020010021201?010210110 Blakea wilburiana 1100000110?010002213300100111301100100100312021000203000 Blakea wilsoniorum 0301010120?220001212110100?23210210112110331012013232300 Blakea storkii A301000110?020001213210100?13210210112010231012001232200 Chalybea corymbifera 030100013250G0112115000000???????????????202011102211200 Graffenrieda latifolia 03020002318100023003010000?????????????????20?0000001000 Huilaea calyptrata 030200023250G0022115110000???????????????102002102241202 Huilaea ecuadorensis 03010001225100012114011000???????????????002002103240000 Miconia laevigata 0301000110?000112003010000???????????????002000010100000 Monochaetum floribundum 0001010000?010001011200000?????????????????20?0012002010 Tibouchina longifolia 0000000000?010111003300000???????????????002000010101000 Topobea acuminata A300010002100001021100A100?00010000001100002000000201000 Topobea adscendens 1101000120?1201122112?01???123002100020?0??2???002223200 Topobea albertiae 1301010120?100001212010100112310200A12010122111003240100 Topobea brenesii 1300000110?0G0002211200100012111G10201100221011012213300 Topobea brevibractea 1100011000?10001021101A100000310000002100000000000201000 Topobea bullata 1301000120?0G0112212210100?12110G10202110222111002223100 Topobea caliginosa 2201010000?100000210000100?00310000002000002001000201000 Topobea calycularis 1301000112A00001021101A100?01010000002000012100012220100 Topobea cordata 2200010000?100011210000100?1131000000210011201?00?202000

PAGE 102

102 Table 2. Continued. Topobea cutucuensis 1301000130?DG0112210400100?13310G10202000222112002203300 Topobea dodsonorum 1100010122210101121201A10000101000000200001000000?201000 Topobea fragrantissima 1300010000?000000213000100?11310000000100002001001201100 Topobea hexandra D200010000?100001210000100?1131000000110001201100?201000 Topobea intricata D101010110?010102213300100033300100100101312021002212110 Topobea maurofernandeziana 1302000120?0G0011212010100011110000002010112011003231200 Topobea multiflora 13011101120200010211010100011110000002000112111003220100 Topobea parasitica A301000120?000011211100100011310000000000112111003221100 Topobea parvifolia 13000100023100000213001100?00010000002000002000000201000 Topobea pittieri A300000112F10002121201A100001010000002000000000000200000 Topobea setosa 1301000120?0G0022213400100?11310G10202100212011003213200 Topobea spDSP1600 1301000120?000010212110100011310000101101112011003201200 Topobea subscabrula 1301000120?0G0110210110100011310000102000112101002211100 Topobea cf watsonii 13000000120000010211010100000010000002000000000002210000 5 6 7 8 9 1 1 7890123456789012345678901234567890123456789012345678901 Blakea anomala 00011120000101023201110200101000003241200000000010110?1 Blakea austin-smithii 00A0101001300102110013011010100011014120000001002011001 Blakea brasiliensis 00011330001001020301110211321111031041200010001010111?1 Blakea brunnea 00011340000101021300110201201100110072400100000120111?1 Blakea calycosa 0100?2101000010212011102??21111003004240001001101011?01 Blakea chlorantha 0000100001300102?10013111110100011??4122000001001011001 Blakea costaricensis 000??340000101?0???01102??2?111111??6240011000012??1??1 Blakea crinita 000??1200001010?2201110200301100110042400100000?1011??1 Blakea cuatrecasii 0001112000B101122301110200221111032241300110000010110?1 Blakea eriocalyx 10002230000101021201111221311111032141200A0011001011??1 Blakea foliacea 0001122000010101220111120030110000204120000000001011001 Blakea fuchsioides 0001112001100101201000023220100010004120000000003011001 Blakea glabrescens 000?2230000101012201101232411001022041300A1011102221??1 Blakea gracilis 00011220000101002101111200301000102041200A0000001111001 Blakea grandiflora 0001133000010111220011121030100011204120011000001111001 Blakea guatemalensis 000?112000110102110111120131110003324120010001001011??1 Blakea aff herrerae 000?100000C10?01201111?2??4?1?0?0?024120000000000111001 Blakea hirsuta 0001112100000102020112120021111103114120000120001011001 Blakea hispida 00101120000101021201100221311111031141200A0011101011001 Blakea involvens1619 000?223000010110310112122140100102214120000000102221??1 Blakea involvens1625 0001233000010112211112122240110102204130000011102221001 Blakea jativae 001?222000010110230110121040110103214131001000002011??1 Blakea lanuginosa 0011112000000102120110?210211111030142400??00100101100? Blakea litoralis 0001112000110101110111120040110008204120010001001011031 Blakea oldemanii 00011110000001021201101210111111032241201010010010110?1 Blakea pauciflora 00011110000101012101111200301000002141100?0000101111001 Blakea penduliflora 0001112001300102110013?11110100018004131000000001??1001 Blakea polyantha 00A11110000?0?0021011??2??401?????1041200010011?1111001 Blakea pulverulenta1303 000?122000110101130110021031110103214??0000000001111??1 Blakea pulverulenta1627 000012300001010022011??20131110003214130001000001111001 Blakea quadriflora 0001101000000102001111?2??111000030241201010010000110?1 Blakea repens 0011122000010102120111121121111103214120010111101111001 Blakea rosea 00011111000001011201121200301101032141200A0000001011021 Blakea rotundifolia 000?1230001101122301101221211101033141200010000010110?1 Blakea sawadae 0001111000010102120112120021110103224130010100101011??1 Blakea scarlatina 00011340002101121300111210121111033041400110010020111?1 Blakea schlimii 000?1110000?0101010110?210211001030141200?1000000011??1 Blakea spruceana 000?1221000101020201101221221101031041200100001010110?1 Blakea subconnata 0001112000010101220112121140100102324120000001001221001 Blakea subpanduriformis 0001111100010102220112120011110103024120001000001011??1 Blakea subvaginata 0001223000110111230111021131111103324130000011002121001 Blakea tapantiana 0001112000010102110011020030100018004120010001011011?01 Blakea trinervia 000?133000100101030111022201100003204130000000001111??1 Blakea tuberculata 0101?22010100102030011121021111003004240001101101011??1 Blakea venusta 0001110000010?0131011112??401?0000024230010000000??1001

PAGE 103

103 Table 2. Continued Blakea wilburiana 001111100A010101110011?210301000142041200100110010110?1 Blakea wilsoniorum 0001133000010101130011121030110011104140010000012111??1 Blakea storkii 0001133000010111220011121120100011204120011000011011??1 Chalybea corymbifera 0000100001C00101310000021030100011132110000000001011111 Graffenrieda latifolia 000?0000000001021010010010301000??330003000001000000??1 Huilaea calyptrata 0001?32001B00120311000123230100015125230000000003011111 Huilaea ecuadorensis 0000132001B00120311000123230100010124230000000003011111 Miconia laevigata 000?2000000001001000000111300000??231002000001000011021 Monochaetum floribundum 00010010000101002020010011310000??222113000101000010??0 Tibouchina longifolia 000?0000000000002010011000300000??223112000100000010??0 Topobea acuminata 000?1000000100021010110011001000032221121010010000010?1 Topobea adscendens 10???11100010?01111?1??1??111?????224??2001031001??1??? Topobea albertiae 00011220000101121121110222011111033221220010000010110?1 Topobea brenesii 0001011000010100111011?211001000181241220010310?1011001 Topobea brevibractea 0000100100000001100010020000100017111112101001000001041 Topobea bullata 100?11100000010201101??0??00100006013120001031001??10?? Topobea caliginosa 000?1000000?1?0?2000??????2?1??????20??00000000?0??1??? Topobea calycularis 000?111000010100102011021100101110223112100001001011001 Topobea cordata 000?1000000?1?0?201011????201000???32??00?00?00?0??1??1 Topobea cutucuensis 100?011000B0010?011010?12201110106134122001031001111??1 Topobea dodsonorum 000010010001010?201011?0??101??????22??0000001000?01001 Topobea fragrantissima 00011120000101002010110012001000103221120010000010110?1 Topobea hexandra 00??100000011?01200011?2??301??????20??00??000000??1??? Topobea intricata 001111100A010101110011?21100100018114111000011001011001 Topobea maurofernandeziana 0002111000110101121111102211110017324123001011002111051 Topobea multiflora 0001111100010102102110111200110017334123000011001011001 Topobea parasitica 0011112000110102102110112001100007334122000011000001031 Topobea parvifolia 000?1010010101002011110201001000102221120010010000010?1 Topobea pittieri 0000100100010002101011101111100003202111000001000001001 Topobea setosa 000?012000010002111110112201110016224123001101001111??1 Topobea spDSP1600 000110100000010?020011?2110011000?1341220011310?0011001 Topobea subscabrula 0001111000010101101011111210100018124122000011001111001 Topobea cf watsonii 0000110100010102101111101200110007324112001011001011001 Table 2. Character state changes (ACCTRAN optimization) on representative tree in morphological analysis of the Blakeeae. Node 1: 1 0>1, 18 0>2, 19 0>1, 24 0>1, 61 0>1, 68 0>1, 77 0>1 Node 2: 17 1>0, 22 1>0, 99 0>1 Topobea acuminata DSP1851 : 12 1>0, 20 3>1, 38 2>1, 70 1>0, 97 0>1 Node 3: 11 1>3, 80 0>2, 81 1>0, 89 0>1, 90 3>0 Topobea parvifolia DSP1655 : 23 0>1, 63 0>1, 66 0>1, 76 0>1 Node 4: 10 2>0, 30 0>3, 75 1>0, 82 1>0 Topobea brevibractea DSP1572 : 2 3>1, 7 0>1, 20 3>1, 22 0>1, 44 2>0, 64 0>1, 68 1>0, 70 1>0, 78 1>0, 90 0>7, 92 2>1, 93 2>1, 97 0>1, 110 0>4 Node 5: 47 0>1, 102 1>0 Node 6: 12 1>0, 54 0>1, 62 0>1, 63 0>2, 105 0>1 Topobea fragrantissima DSP1715 : 28 0>1, 38 2>0, 50 0>1, 72 1>0, 75 0>1, 80 2>0, 81 0>1, 82 0>2 Node 7: 76 0>1, 89 1>0, 93 2>4, 95 1>2 Blakea anomala Luteyn4498 : 16 0>1, 20 3>4, 21 0>1, 30 3>1, 53 1>3, 54 1>3, 56 0>1, 72 1>2, 73 2>3, 74 0>2 Node 8: 6 1>0, 9 0>1, 52 0>1, 106 0>1 Blakea aff. herrerae DSP1682 : 20 3>2, 22 0>1, 28 0>1, 40 0>1, 62 1>0, 63 2>0, 75 0>1, 105 1>0

PAGE 104

104 Table 2. Continued Node 9: 10 0>2, 38 2>0, 53 1>0, 74 0>1 Blakea pauciflora Mori5900 : 4 0>1, 7 0>1, 12 0>1, 63 2>1, 95 2>1, 103 0>1 Node 10: 28 0>3, 39 0>1, 42 0>2, 43 0>1, 46 0>1, 49 0>1 Blakea gracilis DSP1628 : 27 1>0, 50 0>1, 54 1>0, 62 1>2, 72 1>0, 89 0>1 Node 11: 8 0>1, 106 1>0 Node 12: 4 0>1, 28 3>2, 54 1>2, 86 0>1 Blakea litoralis DSP1819 : 22 0>1, 30 3>0, 52 1>0, 67 0>1, 73 2>1, 83 3>4, 90 0>8, 98 0>1, 102 0>1, 110 0>3 Node 13: 17 0>1, 42 2>1, 49 1>0, 53 0>2, 74 1>2 Blakea foliacea DSP1646 : 20 3>4, 30 3>1 Node 14: 9 1>2, 11 3>1, 27 1>0, 84 0>1, 90 0>3, 92 0>1 Node 15: 10 2>0, 22 0>1, 28 2>1, 73 2>1 Node 16: 13 0>2, 21 0>1, 36 0>1, 53 2>1, 91 2>1 Node 17: 17 1>0, 74 2>1, 92 1>2 Blakea guatemalensis DSP1818 : 12 0>1, 14 0>1, 22 1>0, 53 1>0, 54 2>1, 67 0>1, 91 1>3, 98 0>1 Node 18: 50 0>2, 76 1>0, 81 0>1, 84 1>0 Node 19: 17 0>2, 21 1>0, 86 1>0 Node 20: 53 1>2, 91 1>0, 92 2>0 Node 21: 17 2>1, 34 0>1, 37 0>1, 44 2>1, 50 2>1, 98 0>1, 104 0>1 Blakea tapantiana DSP1789 : 9 2>1, 15 0>1, 79 1>0, 81 1>0 Node 22: 29 1>3, 43 1>3, 52 1>3, 62 1>3, 63 2>3 Node 23: 21 0>1, 54 2>3, 86 0>1, 95 2>4, 105 1>2 Blakea wilsoniorum DSP1820 : 1 1>0, 12 0>2, 49 0>1, 91 0>1, 106 0>1 Node 24: 20 2>1, 53 2>3, 63 3>4, 87 0>1 Blakea scarlatina DSP1797 : 22 1>0, 33 2>0, 34 1>0, 36 1>0, 38 2>1, 40 1>0, 52 3>4, 67 0>2, 71 0>1, 84 0>2, 89 1>0, 90 1>3, 91 0>3, 102 0>1, 104 1>0 Node 25: 4 1>2, 21 1>2, 39 1>0, 79 1>0, 94 1>2 Blakea costaricensis DSP1648 : 12 0>1, 31 1>0, 46 1>0, 48 0>1, 56 0>2, 72 2>0, 93 4>6 Node 26: 9 2>3, 16 0>1, 17 1>2 Node 27: 50 3>0, 53 3>4, 58 0>1, 62 3>2, 65 0>1, 68 1>0, 84 0>1, 89 1>0, 90 1>3, 98 1>0, 102 0>1, 103 0>1, 104 1>0 Blakea tuberculata DSP1518 : 21 2>3, 29 3>2, 42 3>2, 43 3>2, 46 1>0, 67 0>1, 73 1>0, 79 0>1, 100 0>1 Blakea calycosa DSP1700 : 4 2>1, 37 1>0, 39 0>1, 47 3>2, 54 3>2, 60 1>0, 74 3>2, 76 0>1 Node 28: 81 1>0, 87 1>0, 99 1>0 Blakea crinita DSP1656 : 12 0>1, 13 2>1, 20 1>0, 21 2>4, 22 1>0, 29 3>2, 31 1>0, 33 2>1, 34 1>0, 40 1>0, 42 3>2, 43 3>2, 47 3>2, 50 3>2, 56 0>2, 62 3>1, 73 1>2, 74 3>2, 76 0>1, 83 2>3 Blakea brunnea DSP1713 : 82 0>1, 93 4>7 Node 29: 71 0>1, 73 1>2, 91 0>2 Blakea storkii McPherson9326 : 9 2>1, 21 0>2, 28 2>1, 39 1>0, 82 0>1, 83 3>2 Blakea grandiflora Guindon1104 : 12 0>1, 13 2>0, 33 2>0, 34 1>0, 36 1>0, 40 1>0, 53 2>1, 104 1>0, 106 0>1 Node 30: 21 0>2, 23 0>1, 67 0>3, 78 1>3, 80 2>1, 83 3>1

PAGE 105

105 Table 2. Continued Blakea penduliflora DSP1782 : 4 1>2, 12 0>1, 20 2>3, 29 1>2, 42 1>3, 43 1>2, 47 1>2, 52 1>2, 95 2>3, 96 0>1 Node 31: 10 0>3, 36 1>2, 54 2>1, 60 1>0, 62 1>0 Blakea chlorantha DSP1512 : 9 2>1, 20 2>1, 28 2>1, 39 1>0, 52 1>0, 96 0>2 Blakea austin-smithii DSP1830 : 30 3>1, 42 1>2, 79 1>0, 105 1>2 Node 32: 1 1>0, 10 0>2, 18 2>1, 20 2>5, 24 1>0, 43 1>0, 48 0>1, 73 1>3, 77 1>0, 78 1>0, 109 0>1, 110 0>1 Chalybea corymbifera Stein3610 : 15 0>1, 22 1>0, 42 1>2, 63 2>0, 79 1>0, 92 2>3, 93 4>2 Node 33: 46 1>0, 47 1>2, 52 1>4, 71 0>2, 75 0>1, 81 1>3, 94 1>2, 105 1>3 Huilaea calyptrata DSP1892 : 4 1>2, 8 1>2, 16 1>2, 21 0>1, 56 0>2, 93 4>5 Huilaea ecuadorensis DSP1589 : 12 0>1, 13 2>0, 20 5>4, 23 0>1, 42 1>0, 50 2>3, 53 1>0, 54 2>0 Node 34: 63 2>1, 83 3>0, 96 0>2, 101 0>3 Topobea sp. DSP1600 : 13 2>0, 41 0>1, 50 2>3, 52 1>0, 62 1>0, 73 1>0, 74 1>2, 92 2>3, 100 0>1, 105 1>0 Node 35: 20 2>1, 75 0>1 Node 36: 39 1>0, 45 0>1, 54 2>1, 74 1>0, 101 3>1 Topobea subscabrula DSP1582 : 15 0>1, 20 1>0, 46 1>0, 72 2>1, 83 0>1, 86 1>0, 106 0>1 Node 37: 36 1>0, 52 1>2, 76 0>1, 90 8>7, 91 1>3 Node 38: 9 2>1, 10 0>2, 53 1>0 Topobea multiflora DSP1817 : 5 0>1, 6 0>1, 12 0>2, 78 1>0, 92 2>3, 96 2>3 Node 39: 28 1>0, 42 1>0, 46 1>0, 47 1>0, 95 2>1 Topobea cf. watsonii DSP1525 : 4 1>0, 8 1>0, 29 1>0, 43 1>0, 44 2>0, 45 1>0, 52 2>1, 54 1>0, 63 1>0, 89 1>0, 99 0>1 Topobea calycularis Abbott19758 : 49 0>1, 72 2>0, 76 1>0, 79 1>0, 82 2>1, 86 1>0, 87 0>1, 88 0>1, 90 7>0, 91 3>2, 93 4>3, 97 0>1, 101 1>0 Node 40: 17 0>1, 67 0>1, 81 1>2, 84 0>1 Topobea parasitica deGranville8734 : 22 1>0, 38 2>0, 59 0>1, 63 1>2, 78 1>0, 82 2>0, 86 1>0, 89 1>0, 92 2>3, 107 1>0 Topobea maurofernandeziana Haber8011 : 4 1>2, 20 1>2, 40 0>1, 45 1>0, 52 2>3, 54 1>2, 60 1>2, 72 2>1, 74 0>2, 80 1>0, 83 0>1, 96 2>3, 99 0>1, 106 0>1 Node 41: 17 0>2, 21 1>2, 22 1>0, 34 0>1, 36 1>2, 42 1>2, 53 1>3, 61 1>0 Topobea brenesii DSP1770 : 4 1>0, 9 2>1, 16 1>0, 30 3>1, 32 0>1, 44 2>1, 49 0>1, 54 2>3, 72 2>0, 86 1>0 Node 42: 78 1>0, 81 1>2, 84 0>1, 90 8>6, 106 0>1 Topobea setosa DSP1577 : 16 1>2, 20 1>3, 21 2>4, 50 2>3, 63 1>2, 70 1>0, 76 0>1, 96 2>3, 100 0>1, 101 3>0 Node 43: 15 0>1, 52 1>2, 57 0>1 Topobea cutucuensis DSP1613 : 9 2>3, 21 2>4, 29 2>3, 47 1>2, 52 2>0, 88 0>1 Topobea bullata DSP1886 : 22 0>1, 30 3>1, 40 0>1, 61 0>1, 80 1>0, 84 1>0, 86 1>0, 93 4>3, 96 2>0 Topobea adscendens DSP1888 : 2 3>1, 31 1>0, 36 2>0, 64 0>1, 72 2>1, 83 0>1 Node 44: 68 1>0, 73 1>0 Node 45: 78 1>0, 83 3>2 Node 46: 28 1>3, 29 1/2>3, 39 1>0, 46 1>2, 62 1>2, 81 0>2

PAGE 106

106 Table 2. Continued. Blakea spruceana DSP1624 : 16 1>0, 20 3>4, 22 1>0, 64 0>1, 84 1>2, 92 1>0, 98 0>1, 103 0>1 Node 47: 9 2>3, 25 0>1, 26 0>1, 50 0>1/2, 91 1>2 Node 48: 4 1>2, 8 1>2, 16 1>2, 38 0>1, 71 0>1, 74 2>3 Blakea rotundifolia DSP1622 : 10 0>2, 11 1>7, 20 3>4, 22 1>0, 34 0>1, 67 0>1, 91 2>3 Node 49: 21 1>0, 31 1>0, 45 0>1, 61 1>2, 83 2>4, 84 1>0, 105 1>2 Blakea jativae DSP1565 : 3 0>2, 5 0>2, 12 0>2, 13 2>1, 47 1>2, 53 1>3, 54 2>3, 59 0>1, 81 2>1, 82 1>0, 96 0>1 Node 50: 7 0>1, 49 0>1, 74 3>1, 90 3>2, 103 0>1, 106 0>2, 107 1>2 Blakea involvens DSP1619 : 42 4>2, 46 2>1, 73 2>3 Node 51: 16 2>1, 22 1>0, 38 1>0, 82 1>2, 92 1>0, 101 0>1, 102 0>1 Blakea involvens DSP1625 : 10 0>2, 12 0>1, 20 3>4, 54 2>3, 62 2>3, 75 0>1 Blakea glabrescens DSP1563 : 4 2>1, 8 2>1, 9 3>2, 15 1>0, 17 1>0, 31 0>1, 47 1>2, 71 1>0, 74 1>2, 81 2>3, 84 0>1 Node 52: 5 0>1, 35 0>1, 87 0>1, 102 0>1 Blakea eriocalyx DSP1620 : 10 0>2, 11 1>0, 57 0>1, 60 1>0, 61 1>2, 78 0>1 Node 53: 13 2>3, 21 1>4, 42 4>3, 59 0>1 Node 54: 7 0>1, 46 2>1, 81 2>1 Blakea repens DSP1849 : 8 1>2, 22 1>0, 39 0>1, 43 3>2, 49 0>1, 78 0>1, 100 0>1, 106 0>1 Blakea lanuginosa DSP1897 : 4 1>2, 20 3>1, 47 1>3, 50 1>0, 52 0>1, 68 1>0, 82 1>0, 91 2>0, 94 1>2, 95 2>4 Node 55: 43 3>1, 54 2>1, 91 2>1 Blakea polyantha DSP1583 : 2 3>2, 4 1>2, 5 1>2, 8 1>2, 10 0>2, 16 1>2, 17 1>2, 20 3>2, 22 1>0, 63 2>1, 72 2>0, 73 1>2, 74 2>1, 84 1>0, 92 1>0, 99 0>1, 106 0>1 Blakea hispida DSP1869 : 9 3>1, 35 1>0, 39 0>1, 55 0>1, 60 1>0 Node 56: 10 0>2, 27 0>1, 68 1>0 Blakea hirsuta DSP1844 : 13 2>1, 21 1>4, 28 1>2, 32 0>1, 53 1>2, 55 0>1, 64 0>1, 78 0>2, 87 0>1, 100 0>1, 101 0>2 Node 57: 7 0>1, 63 2>1, 81 0>1, 91 1>0, 99 0>1 Blakea schlimii Dorr7385 : 11 1>0, 17 1>0, 21 1>2, 38 0>1, 72 2>1, 74 2>1 Node 58: 36 1>0, 83 2>1, 92 1>2, 97 0>1, 102 0>1 Blakea quadriflora DSP1599 : 11 1>4, 12 0>1, 13 2>0, 21 1>0, 22 1>0, 31 1>0, 53 1>0, 62 1>0, 74 2>0, 75 0>1, 78 0>1, 88 1>0 Blakea oldemanii DSP1896 : 15 0>1, 20 3>2, 43 1>2, 73 0>1, 87 0>1, 91 0>2 Node 59: 30 3>1, 40 0>1, 45 0>1, 63 2>1, 78 1>2 Blakea rosea DSP1858 : 14 0>1, 17 1>0, 27 0>1, 54 2>1, 64 0>1, 68 1>0, 84 1>0 Node 60: 37 0>1, 39 1>0, 43 1>2, 83 3>2, 92 1>2 Blakea sawadae DSP1874 : 10 0>2, 28 1>2, 36 0>2, 42 1>2, 47 1>2, 53 2>3, 95 2>3, 98 0>1, 100 0>1, 103 0>1 Node 61: 16 1>0, 99 0>1 Blakea subpanduriformis DSP1887 : 2 3>1, 17 1>0, 21 0>2, 64 0>1, 83 2>1, 91 2>0 Node 62: 12 0>1, 53 2>0, 63 1>2, 71 0>1, 78 2>1, 79 1>0, 87 0>1 Topobea albertiae DSP1698 : 6 0>1, 27 0>1, 30 1>3, 62 1>2, 75 0>2, 81 0>2, 82 0>2, 83 2>0, 91 2>3, 93 4>2, 96 0>2 Blakea cuatrecasii Cuatrecasas16393 : 17 1>2, 22 1>0, 26 0>1, 40 1>0, 42 1>2, 47 1>2, 84 1>2, 95 2>3, 98 0>1

PAGE 107

107 Table 2. Continued. Node 63: 12 0>1, 42 1>3, 43 1>2, 50 0>2, 52 1>2, 106 0>1 Blakea pulverulenta DSP1627 : 16 1>0, 31 1>0, 60 1>0, 72 1>0, 99 0>1 Node 64: 67 0>1, 74 2>3, 81 0>1 Node 65: 25 0>1, 52 2>0 Blakea pulverulenta DSP1305 : 9 2>1, 16 1>0, 21 0>1, 73 2>1, 78 1>0, 82 1>0 Node 66: 7 0>1, 39 1>0, 53 2>1, 91 2>3, 92 1>2, 102 0>1, 107 1>2 Blakea trinervia Judd5323 : 39 1>0, 46 1>2, 50 2>1, 53 2>1, 81 1>2, 82 1>2, 83 3>0, 86 1>0 Blakea brasiliensis DSP1875 : 10 2>0, 12 1>0, 20 3>4, 21 0>1, 28 2>3, 29 2>3, 37 0>1, 72 1>2, 84 1>2, 87 0>1, 91 2>1, 99 0>1, 103 0>1, 106 1>0 Blakea subvaginata DSP1861 : 1 1>0, 6 0>1, 9 2>3, 12 1>0, 22 0>1, 29 2>3, 43 2>3, 45 0>1, 49 0>1, 61 1>2, 71 0>1, 87 0>1, 101 0>1, 105 1>2 Blakea subconnata DSP1580 : 3 0>1, 4 1>2, 31 1>0, 46 1>2, 50 2>1, 62 2>1, 67 1>0, 74 3>2, 78 1>2, 79 0>1, 83 3>4, 84 1>0, 86 1>0, 90 3>2, 106 1>2 Node 67: 17 1>0, 22 0>1, 54 2>3, 62 2>3, 68 1>0, 73 2>0, 92 1>0 Node 68: 2 3>1, 10 2>0, 13 0>1, 31 1>0, 33 0>1, 55 0>1 Blakea venusta DSP1810 : 12 0>1, 14 0>1, 20 3>1, 27 1>0, 28 3>1, 32 0>1, 63 2>0, 73 2>3, 83 3>4, 92 0>2, 94 1>2, 95 2>3, 98 0>1, 105 1>0 Node 69: 42 2>3, 46 1>2, 53 0>2, 76 1>0, 89 0>1 Blakea fuchsioides DSP1744 : 8 1>0, 20 3>5, 23 0>1, 29 1>2, 43 1>2, 45 0>1, 52 1>2, 54 1>2, 67 0>1, 68 1>0, 74 1>0, 75 0>1, 77 1>0, 78 1>0, 82 0>2, 83 3>2, 105 1>3 Node 70: 49 1>0, 59 0>1, 63 2>1, 73 2>1, 101 0>1, 102 0>1 Topobea intricata DSP1723 : 4 0>1, 6 0>1, 15 0>1, 27 1>0, 29 1>3, 50 0>2, 82 0>1, 83 3>0, 92 0>1, 95 2>1, 96 0>1 Blakea wilburiana DSP1761 : 28 3>1, 32 0>1, 52 1>0, 53 2>3, 54 1>0, 55 1>0, 98 0>1 Node 71: 1 1>2, 2 3>2, 20 3>0, 69 0>1, 83 0>2 Topobea caliginosa DSP1711a : 4 0>1 Node 72: 17 0>1, 28 0>1, 43 0>1, 46 0>1 Topobea hexandra DSP1689 : 38 2>1, 83 2>3 Topobea cordata DSP1667 : 16 0>1, 42 0>1, 53 1>2, 75 0>1, 92 2>3 Node 73: 20 3>2, 44 2>0, 64 0>1 Topobea pittieri DSP1571 : 16 1>2, 53 1>0, 70 1>0, 84 0>1, 92 2>0 Topobea dodsonorum DSP1686 : 2 3>1, 11 1>2, 14 0>1, 43 0>1, 73 1>2 Node 74: 1 1>0, 18 2>0, 19 1>0, 24 1>0, 61 1>0, 68 1>0, 77 1>0 Graffenrieda latifolia DSP1303 : 8 0/1>2, 9 0/1>3, 16 1>2, 17 1>3, 82 1>0, 91 2>3, 93 2>0, 96 2>3 Node 75: 12 1>0, 49 0>1, 72 2>0, 85 1>0, 107 0>1 Miconia laevigata Judd5342 : 17 1>2, 53 1>0, 61 0>2, 75 1>0, 78 1>0, 80 0>1, 93 2>1 Node 76: 2 3>0, 13 0>1, 22 1>0, 73 1>2, 100 0>1, 111 1>0 Tibouchina longifolia DSP1433 : 70 1>0, 79 0>1, 81 1>0, 82 1>0, 93 2>3, 102 1>0 Monochaetum floribundum DSP1449 : 6 0>1, 16 1>0, 19 0>1, 20 3>1, 50 0>2, 53 1>2, 55 0>1, 63 0>1, 68 0>1, 75 1>2, 84 0>1, 96 2>3

PAGE 108

108 CHAPTER 3 MOLECULAR AND COMBINED MOLECULAR AND MORPHOLOGICAL CLADISTIC ANALYSES OF THE BLAKEEAE (MELASTOMATACEAE) Introduction In this chapter, I present the resu lts of individual analyses of ITS, accD-psaI, atpB-rbcL, and trnL-trnF DNA regions. These datasets were then variously combined, including first an analysis of the three plastid regi ons, then a combined nuclear plus plastid analysis, and finally, a combined molecular and morphological analysis. These analyses, including a separate analysis of morphological data (Chapter 2), and the resulting cladograms are used as a basis for the discussion of phylogenetic relationships with in the Blakeeae, generic and suprageneric taxonomic circumscriptions, identification of partic ular infrageneric radi ations, and patterns of character change. Materials and Methods Plant Material The sources of plant material, including voucher specimens and GenBank accession numbers for all sequenced DNA regions, are presen ted in Table 3. Authorities given for the taxa sampled are listed in Table 3 and will not be repeated elsewhere. All sequences were obtained from clean, fresh leaves preserved in silica gel; floral organs have proved to provide inferior extractions, which c ontained confounding secondary com pounds. Samples in silica gel and DNA extractions were kept at -20C for long-term storage. Voucher specimens of all taxa utilized in the DNA analysis are deposited as stated in Table 3, with additional duplicates at A, ALBC, CAS, COL, FLAS, INBio, MO, NY, PMA, QCA, QCNE, and US. Up to 115 ingroup OTUs and 20 outgroup species (ITS) were sample d in individual data sets, while 105 ingroup OTUs and 17 species from five tribes were in cluded as outgroups in the combined molecular analysis (Table 3). In the fi nal analysis, in which all molecu lar and morphological characters

PAGE 109

109 were combined, 74 Blakeeae and four species from three related tribes were examined. The same species, and usually the same collections examined for morphological characters were sequenced for internal transcribed spacer regions of nuclear ribosomal DNA, including portions of the 18S gene, the entire ITS 1, 5.8S cistron and ITS 2 regions, as well as the plastid regions accD-psaI, atpB-rbcL, and trnL-trnF Morphological Data Field collections, including herbarium speci mens, EtOH-preserved (fixed in FAA) materials, and photographs, were made of nearly a ll taxa used in this st udy (Table 1), and the vast majority of morphological observations comes strictly from these materials. Reproductive characters account for 89 of 111 characters in the matrix (Table 2) and with the exception of ten taxa that were scored from re-hydrated herbar ium sheets, observations were made from EtOHpreserved flowers. Fig. 2a-b illustrates how some floral characte rs were defined and measured. In the rare instances (e.g. stamens of T. caliginosa T. hexandra and T. cordata ) in which particular structures were not available, character values we re taken from the literature if they could be unambiguously applied; otherw ise the character state was treated as missing. Initially, about 250 morphological features we re considered for potential inclusion as cladistic characters. Traits that were autapomor phic, or subsequently shown to be invariable (e.g. peduncle insertion in axils vertical, ridges on inner hypanthium present, anthers porose), closely associated with a character included in the matrix (e.g., hyaline processes located between floral bracts correlated with the pr esence of membranaceous stipules, bract nerve number correlated with bract width), or that varied conti nuously in a manner that precluded division into discrete states (e.g., shape of internodes, leaves calyx lobes, hypanthium, anther summit curvature, etc.), were excluded. A ll remaining quantitative traits were plotted graphically along a curve, and divided into non -overlapping states us ing simple gap coding

PAGE 110

110 (Almeida & Bisby 1984) (e.g., Figs. 2, 2, 2, 2, 20, 2, 2, 2). This procedure has been discussed and generally a dvocated by Stevens (1991) and Gift & Stevens (1997), but may result in less useful phylogene tic signal than other methods of coding quantitative character data (Gar cia-Cruz & Sosa 2006). For addi tional information regarding the morphological data set including a detailed account of the characters, see Chapter 2. DNA Extraction Total genomic DNA was extracted from silica ge l dried leaves using a modified CTAB (hexadecyltrimethylammonium br omide) procedure of Doyle a nd Doyle (1987). The specimens were ground in mortars, or shaken in tubes, w ith 1.2 ml CTAB and 8l of 2-mercaptoethanol or 5l of ProteinaseK, then transferred to la beled 1.5ml tubes and incubated at 65C for 30 minutes. DNA was precipitated overnight with isopropanol at C, centrifuged for 20 minutes at 13,000 rpm, washed twice with 70% etha nol, and dried. The DNA pellet was then resuspended in 75l of 1X TE (Tris-EDTA buffer, pH 8.5) or purified water and incubated at 65C for approximately 30 minutes. DNA quality was checked by electrophoresis in a 1% agarose gel containing ethidium bromide in a Tr is-Borate-EDTA buffer (T BE). Preceding PCR amplification, total DNA samples were cleaned with QIAquick columns (Qiagen, Inc., Santa Clarita, California, USA) following the manufacturers instructions. DNA Regions and Primers One nuclear and three plastid re gions were sequenced. Primers used for ITS are those of Sun et al. (1994): 17SE (F) ACGAA TTCATGGTCCGGTGAAGTGT TCG; 26SE (R) TAGAATTCCCCGGTTCGCTCGCCGTTAC; accD-psaI (Small et al. 1998): (F) 5' GGGATATCATTATTGCCGAACC 3; (R) 5 AGAAGCCATTGCAATTGCCGGAAA 3'; atpB-rbcL spacer region (Chiang et al. 1998): (F ) 5' ACATCKARTACKGGACCAATAA 3';

PAGE 111

111 (R) 5' AACACCAGC TTTRAATCCAA 3'; and trnL-trnF (Taberlet et al. 1991): (C) 5' CGAAATCGGTAGACGCTACG 3'; (F) 5 ATTTGAACTGGTGACACGAG 3'. Amplification Polymerase chain reactions (PCR) amplif ication were performed on an Eppendorf Mastercycler EP Gradient S thermocycler in 25 L reactions including 13 L of template, 2.5 L of 10X buffer (including 15mM Mg(OAc)2 premixed), 2.5 L of 25mM Mg(OAc)2, 0.5 L of 10 M primers, 0.5 L of 10 mM dNTPs, 0.3 L of Taq (polymerase), and 17 L PCR water. The PCR parameters for ITS were 99C, 10 mi n; 94C hold for Taq polymerase addition; 33X (94C, 45 sec; 65C, 1 min; 72C, 1 min) ; 72C, 3 min. The PCR parameters for accD-psaI were 94C, 3 min; 33X (94C, 45 sec; 58C, 45 sec; 72C, 1:45 min); 72C, 6 min. The PCR parameters for atpB-rbcL and trnL-trnF were 94C, 3 min; 35X ( 94C, 1 min; 58C, 1 min; 72C, 1:20 min); 72C, 6 min. The PCR products were purified using either MicroClean or QIAquick columns following manufactur ers protocols, eluted with 50 L of 10 mM Tris-Cl (pH 8.5), checked on an agarose gel for quality, and stored at 4C. Sequencing Cycle sequencing of both strands was performed using the same amplification primers, Big Dye dideoxy terminator, and Better Buffer. The thermocycler program used for cycle sequencing began at 96C for two minutes, followed by 25 cycles of 10 seconds at 96C, five seconds at 60C, and 4 minutes at 60 C. U pon completion of this program, the product was held at 4C. A 70% ethanol precipitation procedure was used to clean the cycle sequencing product. The cycle sequencing pr oducts were analyzed on either an Applied Biosystems ABI 377 or 3130 Sequencer at the DNA Sequencing Core La b at the University of Florida or the New York Botanical Garden using the manufacturer s protocols for the dye-terminator reaction. Sequence Editing and Alignment

PAGE 112

112 Forward and reverse sequences were check ed and edited using Sequencher 4.7 (Gene Codes Corporation, Ann Arbor, MI). Edited sequ ences were easily manually aligned in Se-Al v2.0a11 (Rambout 1996), and the ends of all matr ices were trimmed to exclude sequencing artifacts. Sections of the matrices contai ning polymononucleotide strings were excluded from the analysis. Cladistic Analysis Separate cladistic analyses were performe d upon each individual data set. Combined analyses were performed with the plastid regions accD-psaI + atpB-rbcL + trnL-trnF; ITS + accD-psaI + atpB-rbcL + trnL-trnF; and finally, using all four molecular regions plus morphology. No hard incongruence (i.e., clades characterized by strong bootstrap support in one analysis that have contradicti ng membership in the other) (S eelanen et al. 1997; Wiens 1998) was observed in the bootstrap consensus trees obt ained for the four molecular regions, thus the datasets were combined. The same approach to combining data sets is frequently employed (e.g., Whitten et al. 2000; Reeves et al. 2001). PAUP*4.0b10 (Swofford 2002) was used to analyze the matrices with gaps coded as missing values. Each separate and variously co mbined data set was analyzed using Maximum Parsimony as implemented in PAUP*4.0b10. All characters were scored as unordered and equally weighted, and gaps were treated as mi ssing data. Heuristic searches were performed with 1000 tree-bisection -reconnection (TBR) branch swapping searches, starting trees were obtained from stepwise random addition replicates with 10 trees held at each step, MulTrees in effect, and steepest descent option not in effect Relative amounts of hom oplasy and structure in the data, the consistency index (C I) and retention indice s (RI) were calculated (Farris 1989). The strength of support for th e cladistic relationships found in the initial analyses was assessed using bootstrap analysis (Felsenstein 1985), which were performed with 1000 replicates, two TBR

PAGE 113

113 branch swapping searches, starting trees obtained from stepwise random addition replicates with two trees held at each step with MulTrees in e ffect, and steepest descent option not in effect. More rigorous bootstrap analyses (1000 replicat es, 10 TBR branch swapping searches, starting trees obtained from stepwise random addition rep licates with 10 trees held at each step) were also performed on some datasets, and in all cas es the strength of suppor t was within 0% of the faster analyses (see also Mort et al. 2000). MacClade ve rsion 4.0 (Maddison and Maddison 1999) was used to examine patterns of character change. Maximum likelihood analyses were conducted on all individual and combined molecular datasets using GARLI ver. 0.95 (Zwickl 2006). The ML search was conducted under the GTR + + I model in a heuristic search manner with th e SPR branch algorithm. ML bootstrap analyses were performed using 100 pseudoreplicates, 10 random sequence additions and SPR branch swapping beginning with the topology resu lting from the ML heuristic search. Results ITS The range of lengths of all ITS 1, ITS 2 spacers and the 5.8S cistron is similar to that found in other angiosperms (Baldwin 1992). A total of 135 OTUs were sequenced, with ten from Colombia (courtesy of M.E.MoralesP.) arriving too late to be trea ted in subsequent datasets, but included here for preliminary assessment of their phylogenetic relationships. Twenty-nine species were sequenced from two or three separa te collections. The ITS analysis (Fig. 3) of 287 informative characters resu lted in 6597 most parsimonious trees of 854 steps, CI = 0.624, and RI = 0.808 (Table 3). A maximum likelih ood heuristic search was performed using the GTR + + I model and resulted in a single tree. The tree (not shown) derive d from this analysis of the ITS data had a loglikelihood score (lnL) of -5698.7027.

PAGE 114

114 In illustrating the cladograms resulting from the analysis of each molecular data set, a conservative approach is taken, whereby the pref erred hypothesis of phylogen etic relationships is the MP strict consensus tree. In this tree (Fi g. 3) and all other trees presented, MP bootstrap support is indicated above the br anches, with ML bootstrap valu es below. Clades receiving statistical support in th e MP and ML analyses are highly c ongruent, and the minor differences are fully enumerated below. With only one ex ception, where a clade receives bootstrap support in ML, but not MP, the clades are pres ent in the MP majority rule trees. Outgroup relationships at the tribal level remain mostly obscure at nodes below the Blakeeae, which itself receives strong bootst rap support (Fig. 3, Table 3; MPBS = 99, MLBS = 89). Within Blakeeae, Huilaea and Chalybea form a paraphyletic group below Blakea and Topobea with the latter two genera together, resolved as monophyletic (MPBS = 97, MLBS = 91). A clade (MPBS = 97, MLBS = 98) of Amazonian Blakea species with blue anthers is sister to a large clade (re ceiving only weak support; MPBS = 50, MLBS = 51) within which phylogenetic relationships are poorly known (i.e., it is comprised of unplaced species, species pairs, and small clades). In this treatment, weak bootstra p support is defined as 50%, moderate support 66%, and strong support 80%. One clade (MPBS = 84, MLBS = 84) of Topobea species with imbricate calyx lobes, a nd another clade (MPBS = 82, MLBS = 80) of species with flower buds encapsulated by large, fl uid-filled bracts, are identified. A large clade comprised entirely of Central American taxa receives statistical s upport (MPBS = 66, MLBS = 69). The hexandrous species of Topobea form a clade (MPBS = 60, MLBS = 62). Only one clade (and a subclade) receiving boot strap support in the ML analysis of ITS (Fig. 3) failed to receive such support under MP although the MP major ity rule tree provided support. The clade comprising Blakea punctulata, Topobea setosa, T. glabrescens, B.

PAGE 115

115 granatensis, B. polyantha, B. spruceana, B. jativ ae, B. repens, B. hispida, B. lanuginosa, and B. eriocalyx (MPBS = 0, MLBS = 66) has a value of 95% in the MP majority rule tree. The latter four species form a clade (MPBS = 0, MLBS = 58), with a value of 77% in the MP majority rule tree. accD-psaI and trnL-trnF A total of 122 taxa were sequenced for the plastid region accD-psaI (Table 3). The analysis of 139 informative characters resulted in 2330 most parsimonious trees of 416 steps, CI = 0.769, and RI = 0.832 (Table 3). The ML tree ( not shown) derived from this analysis of the accD-psaI data had a lnL -4336.2752. The sa me taxa were sequenced for trnL-trnF resulting in 115 informative characters, 8180 most parsimoni ous trees of 291 steps, CI = 0.782, and RI = 0.881. The ML tree (not shown) deri ved from this analysis of the trnL-trnF data had a lnL 3096.1678. The Blakeeae were resolved as m onophyletic in the two analyses with accD-psaI (MPBS = 67, MLBS = 52) and trnL-trnF (MPBS = 59). In the ML analysis of trnL-trnF data, the Blakeeae do not receive bootstrap support, however, the node below the tribe, including Monolena panamensis is resolved with BS = 82. The MP st rict consensus trees (not shown) of each of these chloroplast regions are poorly resolve d, and the utility of these regions proved to be most useful at the supragen eric level. Combined, the two regions yielded 254 parsimonyinformative sites. atpB-rbcL A total of 120 taxa were sequenced for atpB-rbcL (Fig. 3; Table 3). The analysis of 113 informative characters resu lted in 8134 most parsimonious trees of 359 steps, CI = 0.794, and RI = 0.799 (Table 3). The ML tree (not shown) derived from th is analysis of the atpBrbcL data had a lnL -3667.83. Outgroup relationships in trees resulting fro m both analyses were fairly well-resolved and supported, while Bl akeeae were resolved as monophyletic with

PAGE 116

116 statistical support (T able 3; MPBS = 67, MLBS = 85). Most taxa within the tribe were placed in a large polytomy, though 14 subclades were identified, nine of which received bootstrap support. The hexandraous Topobea clade was the best-supported (MPBS = 82, MLBS = 74). The imbricate calyx clade was resolved (MPBS = 63, MLBS = 59), and the bl ue anther clade is present, though without stat istical support (Fig. 3). Clades receiving bootstrap support in the ML, but not MP, analysis of atpB-rbcL include Blakea brunnea + B. lanuginosa (MLBS = 54, absent in MP majority rule tree), Topobea intricata + T. parvifolia (MLBS = 53, MP majority rule 100), and B. calycosa + B. tuberculata (MLBS = 51, MP majority rule 80). accD-psaI + atpB-rbcL + trnL-trnF A total of 122 taxa were sequenced for accD-psaI + atpB-rbcL + trnL-trnF (Fig. 3; Table 3). The combined plastid analysis of 404 informative characters resulted in 1600 most parsimonious trees of 1355 steps, CI = 0.782, and RI = 0.808 (Table 3). The ML tree (not shown) derived from this analysis had a lnL -11429.976. This three-region analysis greatly improves the topological resoluti on and statistical suppor t for clades throughout the sample. All tribes are resolved as monophyletic with MP BS and MLBS 86%. Blakeeae as a whole are strongly supported as monophyletic (MPBS = 100, MLBS = 95), as are Chalybea + Huilaea (Table 3; MPBS = 99, MLBS = 98); Blakea + Topobea, when considered together, constitute a moderately supported clade (MPBS = 78, not s upported in ML), which is sister to the Chalybea + Huilaea clade. A large polytomy within the Blakea + Topobea clade is comprised almost exclusively of Central American species, and th is aggregation forms a clade (91%) in the MP majority rule tree. The Central American clade is also present in the ML analysis, though again without bootstrap support. Also found in the MP strict consensus is a clade (without bootstrap support) comprised almost exclus ively of South American speci esthis clade has a score of

PAGE 117

117 100% in the majority rule tree. The South Am erican clade is present in the ML tree, though without bootstrap support. Blakea pulverulenta and B. trinervia two of the three Blakea species found in the Caribbean, are nested wi thin the South American clade. Topobea parasitica and related species, form a well-resolved clade, a ll internal nodes of which receive high values (100%) in the MP majority rule tree, though bootst rap support is weaker for most nodes. The parasitica clade is present, w ithout support, in the ML tree. Supported clades within the Blakeeae include the vertebrate-pollinated sp ecies (MPBS = 60, MLBS = 63), the hexandrous species of Topobea (MPBS = 93, MLBS = 85), the imbricate calyx clade (MPBS = 51, MLBS = 55), the blue-anthered Blakea species (MPBS = 77, MLBS = 66), and the wet bud clade (MPBS = 86, MLBS = 94) (Fig 3). ITS + accD-psaI + atpB-rbcL + trnL-trnF A total of 122 taxa were sequenced for ITS + accD-psaI + atpB-rbcL + trnL-trnF (Table 3). The combined, four-region molecular analys is of 558 informative ch aracters resulted in 4910 most parsimonious trees of 1913 steps, CI = 0.725, and RI = 0.804 (Figs. 3, 3, Table 3). The ML tree (Fig. 3) derived from this analysis had a lnL -16959.012. This combined analysis resulted in a tree fully resolved below the Blakea + Topobea clade with very strong support for most nodes, particularly notable are the 92% MP and ML bootstrap values for all tribes (Table 3; MPBS = 100, MLBS = 97, for Blakeeae), a pattern also replicated in an ongoing family-level phylogenetic in vestigation utilizing the same four molecular regions. The sister relationship between the Chalybea + Huilaea clade (MPBS = 93, MLBS = 94) and the Blakea + Topobea clade (MPBS = 98, MLBS = 86) is strongly supported. Although relationships within the latter pair of genera are not fully resolved, many clades are now apparent. One clade (MPBS = 81, MLBS = 88) is comprised of all sampled Central American species of Blakea (except B. cuatrecasii which was collected in Panama but is primarily a

PAGE 118

118 Colombian species) and most Topobea species from the same region. The remaining Central American Topobea species are placed in the parasiti ca clade (without MP or ML bootstrap support >50%, but with a value of 100% in the MP majo rity rule tree) comp rised only of other Topobea species, some of which have very broad distributions (e.g., T. multiflora and T. parasitica ). The wet bud clade (MPBS = 65, MLBS = 78) comprised of B. glabrescens + B. involvens + B. subconnata represents a portion of a very poorly delimited group of about ten, mainly Colombian, species. Other evident clad es are the imbricate calyx clade (MPBS = 82, MLBS = 88), and the blue anther clade (M PBS = 99, MLBS = 99). Amongst the Central American taxa, the vertebratepollinated clade (MPBS = 67, MLBS = 63) and a clade comprising the hexandrous species of Topobea (MPBS = 96, MLBS = 97) are c onsistently present (Figs. 3 4, 3, 3). Clades receiving bootstrap support >50% in the ML (indicated on Fig. 3), but not MP (Fig. 3), analysis of ITS + accD-psaI + atpB-rbcL + trnL-trnF include Topobea sp. DSP1600 sister (MLBS = 52) to the imbricate cal yx clade (Fig. 3). The clade comprising B. lanuginosa, B. hispida, B. repens, B. spruceana B. granatensis T. setosa, B. jativae, B. polyantha and B. eriocalyx receives weak support (MLBS = 52). Both of these relationships are present (100%) in the MP majority rule tree. Morphological Characters The analysis of 111 morphologica l characters for 78 taxa resu lted in eight, almost fully resolved, most parsimonious trees of 1360 steps, CI=0.171, and RI=0.502 (Table 3). One tree (Fig. 3), identical topologically to the majority rule tree, is pres ented with thin lines collapsing in the strict consensus. Eleven clades receive bootstrap support >50% including Monochaetum floribundum + Tibouchina longifolia (MPBS = 73). A monophyletic Blakeeae is moderately well supported (Table 3; MPBS = 77), with Topobea dodsonorum + T. pittieri (MPBS = 77)

PAGE 119

119 sister to all remaining species. The clade T. caliginosa + ( T. cordata + T. hexandra : MPBS = 71) receives 84% bootstrap support and is part of a grade including most of the Solanum flowered Topobea species. Blakea wilburiana is sister to T. intricata (MPBS = 51). Strong bootstrap support (MPBS = 98) indicates that Chalybea and Huilaea form a clade, while the sister group relationship H. ecuadorensis + H. calyptrata is strongly supported (MPBS = 99). The rodent-pollinated clade is supported (MPBS = 64), with B. penduliflora sister to B. austinsmithii + B. chlorantha (MPBS = 89). Blakea calycosa is united with B. tuberculata (MPBS = 90). See Chapter 2 for additional details regarding this analysis. ITS + accD-psaI + atpB-rbcL + trnL-trnF + Morphology A combined analysis including ITS, accD-psaI, atpB-rbcL, trnL-trnF and morphology for 78 OTUs (76 species) provided 393 parsimony inform ative characters, and resulted in 37 most parsimonious trees of 2594 steps, CI = 0.437, a nd RI = 0.547 (Table 3). Again, no hard incongruence exists between the molecular and morphological datasets, and thus they were combined. The relatively high pr oportion of homoplasious characters in the morphological data set (Table 3) is demonstrated in the somewhat lower CI and RI values, though nearly all clades retaining bootstrap support in the total evidence strict consen sus tree (Fig. 3) have higher values than in the combined, four-region mol ecular analysis (Figs 3, 3, 3). Additionally, every clade represented on the stri ct consensus tree receives a valu e of 100% in the majority rule tree (not shown), and that tree has only one polyt omy. In the strict co nsensus tree (Fig. 3), Chalybea + Huilaea and Blakea + Topobea are resolved as two sister clades within a monophyletic Blakeeae (MPBS = 100), receiving 100% and 96% bootstrap support, respectively. Within the Blakea + Topobea clade, there are two, nearly mutually exclusive geographic clades, one Central American, the other South American and Caribbean. Sister to a large clade of strictly Central American taxa is a monophyletic group of four Solanum -flowered Topobea

PAGE 120

120 species (MPBS = 82), i.e., T. acuminata + T. brevibractea (MPBS = 71) and T. dodsonorum + T. pittieri (MPBS = 97). The former pair is South American, T. dodsonorum is found in Panama and Ecuador, and T. pittieri grows from Costa Rica through Ecuador. The vertebrate-pollinated species of Blakea form a clade (MPBS = 55). Sister to a large, South American radiation are three additional species of Topobea (Fig. 3). While the basal-most, T. calycularis, is restricted to Guatemala and Chiapas, Mexico, T. multiflora ranges from Bolivia to Costa Rica, and T. watsonii is found from Colombia through Chiapas, Me xico. Clades receivi ng statistical support and discussed below are the imbricate calyx clad e (MPBS = 93), the blue anther clade (MPBS = 96), and the wet bud clade (MPBS = 59). Within the South American/Caribbean clade, only the Central American T. maurofernandeziana is entirely extralimital. The relatively discrete geographic segregation demonstrated here prob ably would be weakened by more intensive sampling of Colombian taxa. As in the other anal yses, this total evidence approach continues to indicate a total absence of suppor t for the recognition of either Blakea or Topobea as they have been traditionally circumscribed. Discussion Support for the Blakeeae In analyses of each individua l data partition, Blakeeae, with Chalybea + Huilaea included, receive bootstrap support >50%, and in each of the combined analyses (Figs. 3, 3, 3, 3, 3; Table 3) the tribe is strongly supported (MPBS and MLBS = 97). Morphological characters that were found to be synapomorphi c for the Blakeeae in the total evidence analysis (Fig. 3) include axillar y synflorescences (19, Fig. 1a, i, l) six-merous flowers (51, Figs. 1 1, 1), external calyx teeth being blunt, callose thickenings (61, Fig. 2), anthers opening by two pores (80, Fig. 2), and berry fruits (108, Fig. 2). Although not resolved as synapomorphic for the tribe, all members of the Blakeeae have pyr amidal seeds (111).

PAGE 121

121 Additional potential anatomical synapomorphies for the Blakeeae are the combination of multiseriate rays and frequent occurrence of druse crystals; the druses, when present, are always in unlignified cells or idiobl asts (ter Welle & Koek-Noorma n 1981). Rhombic crystals and crystals of intermediate form s have also been noted in Blakea latifolia and in Huilaea macrocarpa (terWelle & Koek-Noorman 1981), and thei r occurrence is perhaps more common in the tribe. Druse cr ystals occur throughout th e hypanthium and ovary roof in most Blakeeae (Penneys, pers. obs.). The presence of sheath cells and/or the presence of many pits on tangential fiber walls characterizes Blakea and Topobea though these two characters are absent in Huilaea (Koek-Noorman et al. 1979). Blakeeae, without exception, and in common with various other tribes, possess many medullary vascul ar bundles in their stem s; cortical vascular bundles, however, are absent (van Tieghem 1891, 1892; Solereder 1908). Chalybea + Huilaea Analyses of individual data sets show that Chalybea + Huilaea either form a grade leading into Blakea + Topobea (ITS, Fig. 3), or is a clade nested within Blakea + Topobea ( accD-psaI MPBS = 94, MLBS = 89, Fig. not shown; atpB-rbcL MPBS = 60, Fig. 3; morphology MPBS = 98, Fig. 3). MP and ML cladistic analysis of the trnL-trnF region placed the species of Chalybea and Huilaea in a large polytomy. All combined analyses place a clade comprising the species of Chalybea and Huilaea as the sister group of the Blakea + Topobea clade with strong statistical support (three plas tid regions MPBS = 99, MLBS = 98, Fig. 3; four molecular regions MPBS = 93, MLBS = 94, Figs. 3, 3; four molecular regions + morphology MPBS = 100, Fig. 3). In the total evidence analysis (Fig. 38), Chalybea and Huilaea are united by numerous morphological characters such as the terrestrial, arborescent habit (1, 2) ; pinwheel acarodomatia in the vein axils (10, 11, Fig. 2f); truncate mo notelic synflorescences (18) with elongate

PAGE 122

122 peduncles (20, Fig. 1l); flowers su btended by a single pair of bract s (24) that are narrow (43); flowers with lenticella te hypanthia (48, Fig. 1l), pseudocam panulate corollas (66, Fig. 1j-l), flowers actinomorphic (68), anthers relatively short compared to th e filament length (73), anthers laterally rounded (77, Fig. 2f), inferior ovaries (96), styles not immersed in a crown (102), and white to cream colored (78); and yellowish -green (110, Fig. 2c) fruits with thick and leathery exocarps (109). Historically, most systematists have classified Chalybea and Huilaea as members of the Miconieae (Naudin 1852; Triana 1871; Wurd ack 1957, 1988; Judd and Skean 1991), however, our results indicate that these genera are prop erly placed in the Blakeeae. The placement of Huilaea in the Blakeeae has been confirmed by wood anatomical characters (Koek-Noorman et al. 1979; ter Welle & Koek-Noorman 1981). They al so suggested that uniseriate rays may be a synapomorphy for Huilaea Mora-Osejo (1966) presented a de tailed comparative examination of the inflorescence architecture of Huilaea and Blakea using the approach and terminology of Troll (1964). However, Mora-Osejo did not conc lude that the observed similarities justified tribal realignments. Cl adistic analyses of morphological, mo lecular, and combined data sets (Figs. 3 through 3) clearly indicate that Chalybea and Huilaea are not members of Miconieae, rather they form one of two majo r subclades in the Blakeeae. The monophyly of both subclades is strongly supported, as is that of the Blakeeae, as broadl y circumscribed. This conclusion is in agreement with the preliminary analyses of Penneys et al. (2004). Thus, based upon both morphological and molecular evidence, th e circumscription of the Blakeeae must be expanded to include Chalybea and Huilaea. Several characters that are synapomorphic for Chalybea and Huilaea expand the pattern of morphological variation within the Blakeeae, e.g.,

PAGE 123

123 the truncate monotelic synflorescences (18), elon gate peduncles (20), and flowers subtended by a single pair of caducous bracteoles (24) that are lanceolate (43). The eight species of Huilaea conform in most characters with Chalybea differing primarily in the size and color of the flowers, and number of flowers per inflorescence. If Chalybea is ultimately shown to be nested within Huilaea as preliminary results suggest (Morales & Penneys, in prep.), new combinations must be made under Chalybea Species of the Chalybea + Huilaea clade can most easily be dis tinguished from members of the Blakea + Topobea clade by their cymose or compound cymose inflorescences with elongate peduncles (vs. solitary or fasciculate inflorescences) with the flowers each subtended by a single pair of caducous, lanceolate bracts (vs. two pairs of decu ssate, persistent, and usua lly expanded bracts). Generic Circumscription of Blakea and Topobea The clade comprised of Blakea and Topobea (sister to the Chalybea + Huilaea clade) was found in the molecular analyses of ITS (Fig. 3, MPBS = 97, MLBS = 91), accD-psaI + atpBrbcL + trnL-trnF (Fig. 3, MPBS = 78), ITS + accD-psaI + atpB-rbcL + trnL-trnF (Fig. 3, 3, 3, BS = 98, MLBS = 86), and the total ev idence analysis (Fig. 3, MPBS = 96). Characters that were found to be synapomorphic for Blakea and Topobea in the total evidence analysis (Fig. 3) include a hemiepiphytic habit (character 1), axillary, non-ramified truncate monotelic synflorescences (18, 19, Fig. 2b, e), fl owers subtended by two pairs of decussate bracts (24, Fig. 2a-b, d-e), flow ers zygomorphic due to declin ate androecium (68, Fig. 1a, d, f), anthers laterally compressed (77, Fig. 2) and opening by dorsal pores (83, Fig. 2). There has been a long-standing taxonomic debate regarding the justif ication of recognizing both Blakea and Topobea with students of the family as early as David Don (1823) arguing for their union. Most, however, have chosen to recognize both genera (Naudin 1852; Bentham & Hooker 1867; Triana 1871; Cogniaux 1891), sometime s with the admission that this decision is

PAGE 124

124 based upon tradition (Gleason 1945; Wurdack 1957), or convenience in te rms of facilitating floristic treatments (Wurdack 1973, 1980). Thirty species of Blakea and 24 of Topobea were known to Cogniaux (1891) when he published the most recent monograph of the tribe, but the number of described species has nearly quadruple d in the intervening years. Recent DNA-based phylogenetic analyses have supported the monophyl y of the Blakeeae sensu stricto (Clausing & Renner 2001; Renner et al. 2001), or Blakeeae sens u lato (Penneys et al. 2004), but until now, none has attempted to examine the relationships between Blakea and Topobea An examination of species exhibiting the typical androecium character suites for each genus (Chapter 2, and below) would, perhaps, prov ide justification for their separation, however, a number of species with intermediate states have been disc overed, and these erode the alreadydubious distinctions between Blakea and Topobea According to Cogniaux (1891) and Almeda (1990), the genera can be separa ted on the basis of overall anther shape (short, oval, oblong, or elliptic, i.e., ca. 1/2/ 3 as wide as long in Blakea vs. linear-oblong to oblong-subulate, i.e., ca. 1/5/4 as wide as long in Topobea ), lateral compression of the anth ers (flat vs. rounded), anther pore number and separation (two, we ll-separated vs. two, confluent or united into a single pore), connective appendage morphology (thick spur vs. s pur smaller or absent), and filament form (thick vs. filiform). In these analyses, none of the androecium characters that have traditionally been used for diagnosing Blakea and Topobea indicate that either ge nus is monophyletic (Figs. 3, 3, 3, 3, 3). On the contrary, the charac ters pertaining to filament and anther morphology have either been misinterpreted (e .g., filament form, late ral compression of the anther, connective appendage form) are conti nuous (anther length-towidth ratio) or are homoplastic (pore number). Us ing MacClade to constrain Topobea such that it (and Blakea ) is monophyletic incurs a cost of 53 steps, based on the morphology tree (Chapter 2). Likewise,

PAGE 125

125 combined molecular (Figs. 3, 3, 3, 3) and total evidence analyses (Fig. 3) demonstrate that both genera are pol yphyletic. We conclude that neither Blakea nor Topobea is monophyletic, thus the species of Topobea must be transferred to Blakea (which has nomenclatural priority, Chapter 4). The range of morphological variation in the latter genus is thus expanded. An inclusive Blakea must accommodate the androecium forms discussed above, plus variation in flower merosity (e.g., the 4-merous T. tetramera Almeda) and ovary position. Almeda (1989, 1990) has signaled his inclination to merge the genera, but declined to formally make new combinations before the completion of a global analysis. Other workers such as Don (1823), Baillon (1881), and Macbride (1941) were unimpressed by the putative generic differences and united them. Koek-Noorma n et al. (1979) also concluded that Blakea and Topobea do not differ sufficiently in thei r anatomy to justify separation. Noteworthy Clades Within Blakea Sensu Lato Parasitica clade The continued recognition of Topobea is unjustifiable given the results presented in a detailed morphological character analysis. Furthe rmore, no individual, combined molecular, or total evidence analysis supports a monophyletic Topobea However, these analyses do indicate that particular assemblages re present discrete radiations, an d recognition of them and their morphological synapomorphies may facilitate flor istic and revisionary treatments. One such example is the parasitica clade whose mor phological synapomorphies are comprehensively described elsewhere (Chapter 2). Topobea parasitica is the generotype; it is a broadly distributed, frequently collected species, and forms a clade with a number of closely related species. For these reasons, it is well suited to serve as the basis for an informal clade name. In the combined plastid analysis (Fig. 3), a clade (without st atistical support) containing T. parasitica, T. calycularis, T. subscabrula, and T. cf. watsonii is identified, within which T

PAGE 126

126 albertiae, T. multiflora and T. maurofernandeziana (MPBS = 62, MLBS = 70) are nested. Similarly, a clade (without support) is identified in the combined molecular analysis (Figs. 3, 3, 3) in which T. calycularis and T. subscabrula form basal branches. This clade also contains a subclade (M PBS = 53) comprised of T. albertiae, T. multiflora T. cf. watsonii and T. parasitica In the total eviden ce analysis (Fig. 3), T. calycularis, T. cf. watsonii and T. multiflora are basal (without support) to a larger clade comprised of most South American Blakeeae and the other members of the parasitica clade. The pa rasitica clade appears (without support) in the morphol ogical analysis, although T. albertiae is placed elsewhere (mainly due to homoplastic character states rela ted to its relatively large flower s). The morphological analysis also supports the hypothesis that the parasitica clade is sist er to a clade comprised of T. adscendens, T. bullata, T. cutucuensis, T. setosa, and T. brenesii. This grouping was not present in the cladograms resulting from any other analysis. Some morphological synapomorphies for the parasitica clade (Fi g. 2) include outer floral bracts tightly adherent to the hypanthium (39, Fig. 2e-f), inner floral bracts overlapping (45), and ovaries crowned with triangular appendages (101 e.g., Fig. 2, left of dashed line). The members of this clade, excluding Topobea subscabrula are also united by laterally coherent anthers (76, Fig. 1d-f), caudate anther connective appendage s (90, Fig. 2h), and stamen length:hypanthium length 2.87.79 (91). Some other, primarily South American, species that may be related to the parasitica clade include T. amplifolia Almeda, T. discolor Hochr., T. macbrydei Wurdack, T. stephanochaeta Naud., T. superba Naudin, T. tetroici Wurdack, and T. trianaei Cogn. For additional details on the mor phology and taxonomy of this assemblage, see Chapter 2.

PAGE 127

127 Hexandrous clade Although the vast majority of the species of Blakeeae are diplostemonous and have twelve stamens (except Topobea tetramera Almeda, which has eight st amens), five species of Topobea found in Costa Rica and Panama have only six, antesepalous st amens (69), a character that strongly supports the monophyly of this unusual group. Six OTUs pertaining to the hexandrous group (Almeda 2000a) of Topobea were included in this anal ysis. The hexandrous clade is supported in the analysis of morphological characters (Fig. 3, MPBS = 84), ITS (Fig. 3, MPBS = 60, MLBS = 62), atpB-rbcL (Fig. 3, MPBS = 82, MLBS = 74), combined plastid data (Fig. 3, MPBS = 93, MLBS = 85), comb ined molecular data (Figs. 3, 3, 3, MPBS = 96, MLBS = 97), and total evidence da ta (Fig. 3, MPBS = 100) (Table 3). Hexandrous species included in this analysis are T. caliginosa, T. cordata, and T. hexandra taxa that form a clade (Fig. 3) ba sed upon the morphological synapomorphies of their epiphytic habit (1), subsessile flowers (20), the presen ce of six, antesepalous stamens (69) with apical anther pores (83). These species ar e also characterized by having inferior ovaries with two or four carpels. The unsampled species, T. arboricola Almeda and T. crassifolia (Almeda) Almeda, are also presumed to be members of this clade (Almeda 2000a). Imbricate calyx clade The imbricate calyx clade, comprised of Topobea adscendens, T. bullata, and T. cutucuensis, centered in the cordilleras of Cndor, Consuelo, and Cutuc of southeastern Ecuador, appears in the analys is of morphological characters (Fig. 3, without support), ITS (Fig. 3, MPBS = 84, MLBS = 84), atpB-rbcL (Fig. 3, MPBS = 63, MLBS = 59), combined plastid data (Fig. 3, MPBS = 51, MLBS = 55) with T. sp. DSP1600 included, combined ITS + plastid regions (Figs. 3, 3, 3, MPBS = 82, MLBS = 88) with T. sp. DSP1600 sister, and in

PAGE 128

128 the combined molecular and morphological analysis (Fig. 3, MPBS = 93) with T. setosa sister (MPBS = 73). Topobea adscendens, T. bullata, and T. cutucuensis are united (Fig. 3) by roughened setae on the veins of the abaxial leaf surface and outer floral bract s (13, 33), serrate leaf margins (15), outer floral bracts densely pubescent (36), rectangular processes crowning the ovary apex (101), and their very unusual imbricate calyx lo bes (57), a character f ound elsewhere in the present sample only in Blakea eriocalyx, in which it apparently evolved independently. Including T. setosa which is sister to the imbricate cal yx clade in the total evidence analysis (Fig. 3), this clade is also characterized by the double dorsal spur type anther connective (90, Fig. 2g). The cordilleras in which these three sp ecies are found, the eas tern slopes of the Andes in southern Ecuador, are es pecially rich in melastomes, and have very high levels of endemism (Cotton & Matezki 2003). The strikingly verrucose leaves of T. bullata are also found in T. muricata G. Lozano C., T. pascoensis Wurdack, and T. verrucosa Wurdack. These three species are likely referable to this clade, as also evidenced by their ove rlapping calyx lobes and ovary apex appendage. Solanum -flowered clade A number of species of Topobea have flowers distin ctly reminiscent of Solanum (Solanaceae). In the total ev idence analysis, a clade (Fig. 38, MPBS = 82) is identified comprised of T. acuminata + T. brevibractea (MPBS = 71) and T. dodsonorum + T. pittieri (MPBS = 97). A topologically identical clade is also present in the combined, four-region molecular analysis ML tree (Fig. 3), and the MP majority rule tree (n ot shown), though in the MP strict consensus (Fig 3), the subclades of T. dodsonorum + T. pittieri (MPBS = 79, MLBS = 83) and T. acuminata + T. brevibractea (MPBS = 62, MLBS = 66) (Table 3) are resolved as members of a large polytomy. A combined analysis of three plastid regi ons demonstrates that

PAGE 129

129 these four species form a clade (Fig. 3) without MP or ML stat istical support, though the sister relationship of each sp ecies pair is strongly supported. The atpB-rbcL analysis (Fig. 3) resolves the two species pairs with weak bootst rap support. Morphology alone (Fig. 3) places T. dodsonorum and T. pittieri as sister species (MPBS = 77), a nd places these basal to a grade of Topobea species including T. acuminata, T. parvifolia and T. brevibractea The Solanum -flowered species of Topobea in this sample are united in the total evidence analysis (Fig. 3) by morphological synapomorphi es including the presence of acarodomatia (11), relatively short-pe duncles (20), small outer and inner floral bracts (28, 29, 42, 43), calyx lobes remaining green in fruit (60), fl owers with acute pe tals (64, rounded in T. acuminata Fig. 1a, g), anther connective appendages a triangular spur (90), and four-loc ular ovaries (93). Additional diagnostic but non-synapomorphic charac ters shared by these species include flowers with white petals, and yellow anthers (cream in T. brevibractea ) opening by a single pore (except two pores in T. brevibractea ). In overall appearance, the flow ers of these four species are quite similar to many Solanum species that frequently can be found in the same forests. The flowers of both groups have porose anthers that are buzz-pollinated by bees. Blakea alternifolia (Gleason) Gleason, a species originally described in Topobea, appears in a clade, without support, along with the aforementioned taxa in the ITS analysis (Fig. 3)it also has Solanum like flowers, and is probably a member of this clade. Other species of Topobea that were not sampled in the present study but that ma y also belong to this alliance include T. anisophylla Triana, T. caudata Wurdack, T. reducta Gleason, and T. toachiensis Wurdack. In the total evidence analysis (Fig. 38), the Solanum -flowered clade is placed as the sister group of a large clade of Centra l American species. Though th is position lacks statistical support, the hypothesis is bolstered by certain collections of T. dodsonorum (e.g., Penneys 1686

PAGE 130

130 FLAS; McPherson 12500 MO, NY; Clark & Bergman 317 MO) in which simple cymes are weakly developed. This phenomenon has not been observed in a ny other species of Blakea sensu lato. If the hypothesis that this assemblage represents an early divergent branch in the Blakea + Topobea clade is confirmed, it woul d suggest that the typical Blakea -type anther is derived, and may have arisen more than once within the Blakeeae. Vertebrate-p ollinated clade A clade of vertebrate-pollinated species comp rised of the rodent-pollinated (Lumer 1980, 2000; Lumer & Schoer 1986; but see Langtimm & Unnasch 2000) Blakea austin-smithii, B. chlorantha, B. penduliflora and hummingbird-pollinated (Almeda 1989, DSP pers.obs.) B. fuchsioides receives statistical support in the analys is of three chloroplast regions (Fig. 3, Table 3; MPBS = 60, MLBS = 63), ITS + chlo roplast regions (Figs. 3, 3, 3, MPBS = 67, MLBS = 63), and total eviden ce analysis (Fig. 3, MPBS = 55) Furthermore, the three, green-flowered species (i.e., B. austin-smithii, B. chlorantha, B. penduliflora ) form a clade with bootstrap support based upon analyses of mo rphology alone (Fig. 3, MPBS = 64), three chloroplast regions (Fig. 3, MPBS = 55), a nd ITS + chloroplast regions (Figs. 3, 3, 3, MPBS = 54, MLBS = 69). These results suggest that there has been a sing le shift from buzz to vertebrate pollination, and within that group, once to hummingbirds and once to rodents. Lumer (1982) hypothesized that a bird or bat pollinated Blakea would provide a possible evolutionary pathway from bee to rodent pollinationand th e hummingbird pollinated B. fuchsioides was discovered shortly thereafter (Almeda 1989)! The vertebrate-pollin ated clade is supported by the morphological synapomorphies (Fig. 3) of actinomorphi c (68), pendant flowers (23, Fig. 1c, e), pseudocampanulate corollas (66, Fig. 1c, e), and either green or pink petals (67, Fig. 1c, e).

PAGE 131

131 Mucilaginous nectar is known from the green -flowered species (Lumer 1980). Nectar has been observed (Penneys, pers. obs.) to be produced in B. fuchsioides flowers, and stomatic nectaries located upon the anther connective appenda ge were recently discovered (Varasin et al. in prep.) in that species, B. chlorantha and Huilaea ecuadorensis. We presume that the same condition is present in the unsampled rodent -pollinated species. Although hummingbird pollination is the norm in the Chalybea + Huilaea clade (Snow & S now 1980), within Blakea + Topobea it has evolved only in B. fuchsioides In his description of the species, Almeda (1989) hypothesized this pollination strategy based upo n a series of morphological characters, e.g., pendant flowers with red bracts and pseudocampanul ate, pink corollas; however, the critical feature of nectar production was only recently confirmed (Varasin et al, in prep.). In terms of reproductive biology, the most rema rkable adaptation in the Blakeeae is rodent pollination. This pollination syndrome is extremely ra re in angiosperms, and in the Neotropics is known only in five species of Blakea and one Cajophora (Loasaceae; Cocucci & Srsic 1998; Johnson et al. 2001). The pendant, green-flowered species of Blakea have received substantial attention since the discovery of rodent pollina tion in this group (Lumer 1980, 2000; Lumer & Schoer 1986; but see Langtimm & Unnasch 2000). Three of the five species (i.e., B. austinsmithii, B. chlorantha and B. penduliflora ) belonging to this clade we re collected and analyzed during the course of this investigation. Blakea purpusii Brandegee and B. gregii Almeda have also been considered to be members of this assemblage (Almeda 1990, 2000b), and at present, no evidence to the contrary exists. An ITS sequence of B. purpusii supports a close relationship with the fused-bract clade (Fig. 3), a result also suggested in the morphological and total evidence analyses in regards to the three fully sa mpled members of the rodent-pollinated clade. The petals basally flushed with red and yellow anthers of B. purpusii may represent transitional

PAGE 132

132 states between B. fuchsioides and the remaining green-flowe red species. The primary morphological synapomorphies (Fi g. 3) for the rodent-pollinated clade include lenticellate peduncles (22), pendant flowers (23), pseudocampanul ate (66) and green coro llas (67), and deep purple anthers (78) with dorsally inclined pores (83) somewhat conflu ent (80). Nocturnal anthesis and production of mucilagin ous nectar are also presumed s ynapomorphies for this clade. Additional details regarding character evolution in this clade discussed are discussed elsewhere (Chapter 2). Blue-anther clade A western Amazonian clade, all members of wh ich have bluish-magenta anthers, includes Blakea hirsuta, B. rosea, B. sawadae, and B. subpanduriformis, and it appears in the analyses of ITS (Fig. 3, MPBS = 97, MLBS = 98), atpB-rbcL (Fig. 3, without support), combined plastid regions (Fig. 3, MPBS = 77, MLBS = 66), combined DNA regions (Figs. 3, 3, 3 6, MPBS = 99, MLBS = 99), and total evidence (Fig. 3, MPBS = 96) (Table 3). In the analysis of morphological char acters, a clade comprised of B. rosea, B. sawadae, B. subpanduriformis, B. cuatrecasii and T. albertiae is present, however, th e latter two taxa do not form a clade with the remaining species in a ny other analysis, and th eir inclusion here is doubtful. Blakea hirsuta has bluish-magenta anthers, and only in the mor phological analysis does it fail to form a clade with the other species considered here. Several morphological characters are synapom orphic (Fig. 3) for the clade containing Blakea hirsuta, B. rosea, B. sawadae, and B. subpanduriformis The bluish-magenta anthers (78, Fig. 1g, o) are especially notable because yello w anthers are the most commonly encountered condition in the Blakeeae. Blue anthers are uncommon in the Melastomataceae, but have also been reported in some Amazonian Tococa (Michelangeli 2000) and members of the Olisbeoideae. This clade is also united by the pa rtially fused outer floral bracts (30) that are

PAGE 133

133 lenticellate (40), and the basall y overlapping inner flor al bracts (45). Other Amazonian species with bluish-magenta anthers presumed to be cl osely related to the afor ementioned taxa include B. bracteata Gleason, B. formicaria Wurdack, B. glandulosa Gleason, and B. hirsutissima (J.F. Macbr.) Wurdack. Wet bud clade A clade comprised of Blakea glabrescens, B. involvens, B. subconnata and B. subvaginata is resolved with MPBS = 59 in the total evidence analysis (Fi g. 3). The same clade is also found, although without B. subconnata in the ITS analysis (Fig. 3, Table 3; MPBS = 82, MLBS = 80), or without B. subvaginata in both the combined plastid (Fig. 3, MPBS = 86, MLBS = 94) and combined DNA analyses (Figs. 3, 3, 3; MPBS = 65, MLBS = 78). MP majority rule trees show the entire clade w ith values of 98% and 100% in the combined DNA and total evidence analyses, respectively. Members of this wet bud clade all have relatively large outer and inner floral bracts that completely encapsulate the flower buds nearly un til anthesis. These bracts contain a watery to slightly mucilaginous fluid that perhaps has a pr otective function. Field observations should be made to determine whether this fluid is produced by the plant, or if rainwater seeps into the bracts and is held there (the former is suspect ed). These species are united by the morphological synapomorphies in the total evidence analysis (F ig. 3) of prominent nodal ridges (6), petioles that are basally expanded to clasping (7), fluidfilled buds (26), overlappi ng inner floral bracts (45), ridged hypanthia (terete in B. subconnata 49), well-defined extern al calyx teeth (blunt callose thickening in B. subconnata 61), anther connective appenda ges that are elongate and bilobed (triangular spur in B. subvaginata 90, Fig. 2c), style basally immersed in a crown (102), and capitate stigmas (106, 107, Fig. 1i).

PAGE 134

134 Blakea subconnata is distributed from Ecuador through Panama from sea level to nearly 2000m. Gleason (1945) noted the comparatively wide, obtuse fl oral bracts of a Colombian population and described it as B. subconnata var. obtusa Wurdack (1979) segregated B. subvaginata from specimens previously identified as B. subconnata on the basis of the former having anther appendage connectives calcarate (ra ther than elongate, bi-lobed), a somewhat less capitate stigma, and glabrous (vs. glandular-pubescent) styles. It should also be noted that B. subvaginata has distinctly pink-magenta corollas rath er than the white to pink-tinged petals typically found in B. subconnata Most species in this group al so have a network of prominent veins on the calyx. Blakea glabrescens, B. involvens, B. subconnata and B. subvaginata are a very closely related group of species that ar e part of a larger, and taxonomica lly very complicated, complex. Other species not included in th is analysis that are perhaps members of this group include Blakea acostae Wurdack, Blakea incompta Markgr., Blakea platypoda Gleason, Blakea punctulata (Triana) Wurdack, Blakea schultzei Markgr., and Topobea latifolia Triana. Many specimens accessioned in herbaria and pertaining to this complex are misidentified. Careful monographic work must be conducted in order to determine species limits in this troublesome assemblage. Table 3. Specimens examined in cladistic an alysis of the Blakeeae. All vouchers are deposited at FLAS, except R.Kriebel colle ctions deposited at CAS, and Moran collections at NY. Taxon Coll. No. ITS accDpsaI atpBrbcL trnLtrnF morph. Adelobotrys panamensis Almeda Penneys 1759 X X X X Astronia ferruginea Elmer Chen 555 X Bellucia pentamera Naudin Penneys 1868 X X X X Blakea alternifolia Gleason Morales-P. 1824 X Blakea anomala Donn.Sm. Penneys 1498 X X X X X Blakea austin-smithii Standl. Penneys 1830 X X X X X

PAGE 135

135 Table 3. Continued. Blakea brasiliensis Cogn. Penneys 1875 X X X X X Blakea brunnea Gleason Penneys 1713 X X X X X Blakea calycosa Gleason Penneys 1720 X X X X X Blakea chlorantha Almeda Penneys 1512 X X X X X Blakea aff. costaricensis G.Umaa Dodero & Almeda Penneys 1648 X X X X X Blakea aff. costaricensis G.Umaa Dodero & Almeda Penneys 1756 X X X X Blakea crinita Gleason Penneys 1656 X X X X X Blakea cuatrecasii Gleason Penneys 1688 X X X X X Blakea cuatrecasii Gleason Morales-P. 1841 X Blakea eriocalyx Wurdack Penneys 1620 X X X X X Blakea foliacea Gleason Penneys 1646 X X X X X Blakea foliacea Gleason Penneys 1709 X X X X Blakea fuchsioides Almeda Penneys 1744 X X X X X Blakea glabrescens Benth. Penneys 1563 X X X X X Blakea gracilis Hemsl. Penneys 1628 X X X X X Blakea gracilis Hemsl. Penneys 1772 X X X X Blakea gracilis Hemsl. Penneys 1809 X X X X Blakea granatensis Naudin Morales-P. 1778 X X X X Blakea grandiflora Hemsl. Penneys 1494 X X X X X Blakea grandiflora Hemsl. Penneys 1805 X X X X Blakea guatemalensis Donn.Sm. Penneys 1818 X X X X X Blakea aff. herrerae Almeda Penneys 1682 X X X X X Blakea hirsuta O.Berg ex Triana Penneys 1844 X X X X X Blakea hirsuta O.Berg ex Triana Penneys 1871 X X X X Blakea hispida Markgr. Penneys 1845 X X X X Blakea hispida Markgr. Penneys 1869 X X X X X Blakea involvens Wurdack Penneys 1619 X X X X X Blakea involvens Markgr. Penneys 1625 X X X X X Blakea involvens Markgr. Penneys 1901 X X X X Blakea jativae Wurdack Penneys 1565 X X X X X Blakea lanuginosa Wurdack Penneys 1897 X X X X X Blakea litoralis L.O.Williams Penneys 1799 X X X X Blakea litoralis L.O.Williams Penneys 1819 X X X X X Blakea oldemanii Wurdack Penneys 1896 X X X X X Blakea aff. paleacea Gleason Morales-P. 1833 X Blakea pauciflora Gleason Penneys 1714 X X X X Mori 5900 (US) Blakea pauciflora Gleason Penneys 1784 X X X X Blakea penduliflora Almeda Penneys 1782 X X X X X

PAGE 136

136 Table 3. Continued. Blakea platypoda Gleason Morales-P. 1834 X Blakea polyantha Wurdack Penneys 1583 X X X X X Blakea pulverulenta Vahl Penneys 1305 X X X X X Blakea pulverulenta Vahl Penneys 1627 X X X X X Blakea punctulata (Triana) Wurdack Morales-P. 1885 X Blakea purpusii Brandegee Breedlove & Almeda 47747 X Blakea quadriflora Gleason Penneys 1599 X X X X X Blakea repens D.Don Penneys 1847 X X X X Blakea repens D.Don Penneys 1849 X X X X X Blakea rosea D.Don Penneys 1858 X X X X X Blakea rotundifolia D.Don Penneys 1622 X X X X X Blakea sawadae J.F.Macbr. Penneys 1843 X X X X Blakea sawadae J.F.Macbr. Penneys 1874 X X X X X Blakea scarlatina Almeda Penneys 1797 X Blakea schlimii Triana Michelangeli 726 X X X X X Blakea spruceana Cogn. Penneys 1624 X X X X X Blakea storkii (Standl.) Almeda Penneys 1716 X X X X Blakea storkii (Standl.) Almeda Penneys 1825 X X X X McPherson 9463 (US) Blakea subconnata O.Berg ex Triana Penneys 1570 X X X X Blakea subconnata O.Berg ex Triana Penneys 1580 X X X X X Blakea subconnata O.Berg ex Triana Morales-P. 1850 X Blakea subpanduriformis E. Cotton & Matezki Penneys 1887 X X X X X Blakea subvaginata Wurdack Penneys 1841 X X X X Blakea subvaginata Wurdack Penneys 1861 X X X X X Blakea tapantiana G.Umaa Dodero & Almeda Penneys 1789 X X X X X Blakea trinervia L. Penneys 1629 X X X X X Blakea tuberculata Donn.Sm. Penneys 1518 X X X X X Blakea tuberculata Donn.Sm. Penneys 1643 X X X X Blakea venusta Kriebel, Almeda & Estrada Kriebel 4081 X X X Blakea venusta Kriebel, Almeda & Estrada Penneys 1810 X X X X X Blakea wilburiana Almeda Penneys 1644 X X X X Blakea wilburiana Almeda Penneys 1761 X X X X X Blakea wilsoniorum Almeda Penneys 1816 X X X X Blakea wilsoniorum Almeda Penneys 1820 X X X X X Chaetolepis cufodontisii Standl. Penneys 1807 X X X X

PAGE 137

137 Table 3. Continued. Chalybea corymbifera Naudin Morales-P. 1741 X X X X Stein 3610 (NY) Charianthus alpinus (Sw.) R.A. Howard Penneys 1301 X X X X Graffenrieda latifolia (Naudin) Triana Penneys 1303 X X X X X Henriettea succosa DC. Baraloto 2826 X X X X Henriettella flavescens Triana Baraloto 2827 X X X X Huilaea calyptrata Penneys & Morales-P. Penneys 1892 X X X X X Huilaea ecuadorensis Wurdack Penneys 1589 X X X X X Loreya mespiloides Miq. Baraloto 2824 X X X X Loreya spruceana Triana Penneys 1854 X X X X Meriania hernandii Uribe Penneys 1850 X X X X Miconia donaeana Naudin Penneys 1539 X X X X Miconia laevigata (L.) D. Don Penneys 1317 X X X X X Monochaetum floribundum (Schltdl.) Naudin Penneys 1541 X X X X X Monolena panamensis R.H. Warner Penneys 1654 X X X X Pternandra coerulescens Jack Chen 543 X Pternandra echinata Jack Chen 542 X Tibouchina longifolia (Vahl) Baill. Penneys 1433 X X R X X Topobea acuminata Wurdack Penneys 1851 X X X X X Topobea albertiae Wurdack Penneys 1684 X X X X Topobea albertiae Wurdack Penneys 1698 X X X X X Topobea ascendens E. Cotton & Matezki Penneys 1888 X X X X X Topobea brenesii Standl. Penneys 1770 X X X X X Topobea brevibractea Gleason Penneys 1572 X X X X Topobea bullata E. Cotton & Matezki Penneys 1886 X X X X X Topobea caliginosa Almeda Penneys 1711a X X X X X Topobea caliginosa Almeda Penneys 1751 X X X Topobea calycularis Naudin Abbott 19758 X X X X X Topobea cordata Gleason Penneys 1667 X X X X X Topobea cordata Gleason Penneys 1750 X X X X Topobea aff. cordata Gleason Penneys 1757 X X X X Topobea cutucuensis Wurdack Penneys 1613 X X X X X Topobea dodsonorum Wurdack Penneys 1686 X X X X X Topobea fragrantissima Almeda Penneys 1715 X X X X X Topobea gerardoana Almeda Kriebel 4058 X X X Topobea glaberrima Triana Morales-P. 1837 X Topobea glabrescens Triana Morales-P. 1806 X

PAGE 138

138 Table 3. Continued. Topobea glabrescens Triana Morales-P. 1806 X Topobea hexandra Almeda Penneys 1689 X X X X X Topobea intricata Almeda Penneys 1723 X X X X X Topobea intricata Almeda Penneys 1787 X X X X Topobea maurofernandeziana Cogn. Penneys 1783 X X X X Topobea multiflora (D.Don) Triana Penneys 1754 X X X X Topobea multiflora (D.Don) Triana Penneys 1817 X X X X X Topobea parasitica Aublet Moran 6453 X X X X Topobea parasitica Aublet Penneys 1821 X X X X deGranville 8734 (US) Topobea parvifolia (Gleason) Almeda Penneys 1655 X X X X X Topobea pittieri Cogn. Penneys 1536 X X X X X Topobea pittieri Cogn. Penneys 1724 X X X X Topobea setosa Triana Penneys 1577 X X X X X Topobea sp. Penneys 1600 X X X X X Topobea sp. Penneys 1885 X X X X Topobea subscabrula Triana Penneys 1582 X X X X X Topobea subscabrula Triana Penneys 1900 X X X X Topobea trianaei Cogn. Morales-P. 1829 X Topobea cf. watsonii Cogn. Penneys 1525 X X X X X Topobea cf. watsonii Cogn. Penneys 1801 X X X X Triolena pileoides (Triana) Wurdack Penneys 1626 X X X X Triolena spicata (Triana) L.O. Williams Penneys 1762 X X X X Table 3. Analyses of morphological and molecu lar data sets for Blakeeae, with additional outgroups. ITS accDpsaI atpBrbcL trnLtrnF total plastid total DNA morphology total evidence no. of taxa in matrix 135 122 120 122 122 122 78 78 no. of included characters in matrix 870 1220 963 885 3232 3898 111 3955 no. of constant characters 498 932 709 675 2347 2770 0 3061 no. of variable, uninformative characters 85 149 141 95 481 570 1 501 no. of informative characters 287 139 113 115 404 558 110 393

PAGE 139

139 Table 3. Continued. no. of MPTs 6597 2330 8134 8180 1600 4910 8 37 no. of steps 854 416 359 291 1355 1913 1360 2594 CI 0.624 0.769 0.794 0.825 0.782 0.725 0.171 0.437 RI 0.808 0.832 0.799 0.881 0.808 0.804 0.502 0.547 Figure 31 32 33 34, 35MP 36ML 37 38 Table 3. Summary boot strap statistics for named clades in morphological, molecular and combined analyses of the Blakeeae. (MPBS/MLBS). Morphology and total evidence analyses only conducted using MP. Clad es present without bootstrap support indicated with an *. Clades abse nt from trees marked with a -. clade ITS atpB-rbcL total plastidTotal DNAmorph Total evidence Blakeeae 99/89 67/85 100/95 100/97 77 100 Blakea + Topobea 97/91 -/78/* 98/86 96 Chalybea + Huilaea -/60/* 99/98 93/94 98 100 Solanum -flowered */* -/*/* -/* 82 hexandrous 60/62 82/74 93/85 96/97 84 100 parasitica -/* -/* */* */* fused bract */* -/-/-/* blue anther 97/98 */* 77/66 99/99 96 imbricate calyx 84/84 63/59 51/55 82/88 93 wet bud 82/80 -/86/94 65/78 59 vertebrate pollinated -/-/60/63 67/63 55 rodent pollinated -/-/* 55/* 54/69 64

PAGE 140

140 BlakeabrunneaDSP1713 BlakeacalycosaDSP1720 BlakeagrandifloraDSP1494 BlakeagrandifloraDSP1805 BlakeastorkiiDSP1716 BlakeatapantianaDSP1789 BlakeatuberculataDSP1518 BlakeacrinitaDSP1656 BlakeastorkiiDSP1825 BlakeatuberculataDSP1643 BlakeawilsoniorumDSP1816 BlakeawilsoniorumDSP1820 TopobeagerardoanaRK4058 TopobeaintricataDSP1723 TopobeaintricataDSP1787 Blakea foliaceaDSP1646 Blakea foliaceaDSP1709 BlakeapurpusiiMH BlakeawilburianaDSP1644 BlakeawilburianaDSP1761 TopobeafragrantissimaDSP1715 TopobeaparvifoliaDSP1655 TopobeacordataDSP1667 TopobeacordataDSP1750 TopobeacaliginosaDSP1711a TopobeacaliginosaDSP1751 Topobea aff cordataDSP1757 TopobeahexandraDSP1689 BlakeacostaricensisDSP1648 BlakeacostaricensisDSP1756 BlakeagracilisDSP1628 BlakeagracilisDSP1772 BlakeagracilisDSP1809 BlakeapaucifloraDSP1714 BlakeapaucifloraDSP1784 BlakeaanomalaDSP1498 Blakeaaustin-smithiiDSP1830 BlakeachloranthaDSP1512 BlakeafuchsioidesDSP1744 BlakeaguatemalensisDSP1818 Blakea aff herreraeDSP1682 BlakealitoralisDSP1799 BlakealitoralisDSP1819 BlakeapendulifloraDSP1782 BlakeavenustaDSP1810 BlakeavenustaRK4081 TopobeabrenesiiDSP1770 BlakeapulverulentaDSP1305 BlakeapulverulentaDSP1627 BlakeaschlimiiFAM726 Blakea trinerviaDSP1629 BlakeaalternifoliaMEM1824 BlakeabrasiliensisDSP1875 TopobeaspDSP1885 Topobea acuminataDSP1851 TopobeabrevibracteaDSP1572 TopobeadodsonorumDSP1686 TopobeapittieriDSP1536 TopobeapittieriDSP1724 BlakeaglabrescensDSP1563 BlakeainvolvensDSP1625 BlakeainvolvensDSP1901 BlakeainvolvensDSP1619 BlakeasubvaginataDSP1841 BlakeasubvaginataDSP1861 TopobeaadscendensDSP1888 TopobeabullataDSP1886 TopobeacutucuensisDSP1613 TopobeamultifloraDSP1754 TopobeamultifloraDSP1817 Topobea trianaeiMEM1829 TopobeaalbertiaeDSP1684 TopobeaalbertiaeDSP1698 TopobeaglabrescensMEM1806 TopobeasetosaDSP1577 TopobeaparasiticaMoran6453 TopobeaparasiticaDSP1821 TopobeasubscabrulaDSP1582 TopobeasubscabrulaDSP1900 Topobea cf watsoniiDSP1525 Topobea cf watsoniiDSP1801 BlakeaeriocalyxDSP1620 BlakeagranatensisMEM1778 BlakeahispidaDSP1845 BlakeahispidaDSP1869 BlakeajativaeDSP1565 BlakealanuginosaDSP1897 BlakeaoldemaniiDSP1896 Blakea aff paleaceaMEM1833 BlakeaplatypodaMEM1834 BlakeapolyanthaDSP1583 BlakeapunctulataMEM1885 BlakeaquadrifloraDSP1599 BlakearepensDSP1847 BlakearepensDSP1849 TopobeaspDSP1600 BlakearotundifoliaDSP1622 BlakeaspruceanaDSP1624 BlakeasubconnataDSP1570 BlakeasubconnataDSP1580BlakeasubconnataMEM1850 TopobeacalycularisAbbott19758 TopobeaglaberrimaMEM1837 Topobea maurofernandezianaDSP1783 BlakeacuatrecasiiDSP1688 BlakeacuatrecasiiMEM1841 BlakeahirsutaDSP1844 BlakeahirsutaDSP1871 BlakearoseaDSP1858 BlakeasubpanduriformisDSP1887 BlakeasawadaeDSP1843 BlakeasawadaeDSP1874 ChalybeacorymbiferaMEM1741 HuilaeacalyptrataDSP1892 Huilaea ecuadorensisDSP1589 LoreyamespiloidesCB2824 LoreyaspruceanaDSP1854 BelluciapentameraDSP1868 HenrietteasuccosaCB2826 HenriettellaflavescensCB2827 AstroniaferrugineaChen555 MiconiadonaeanaDSP1539 MiconialaevigataDSP1317 CharianthusalpinusDSP1301 GraffenriedalatifoliaDSP1303 MerianiahernandiiDSP1850 AdelobotryspanamensisDSP1759 TriolenapileoidesDSP1626 TriolenaspicataDSP1762 MonolenapanamensisDSP1654 ChaetolepiscufodontisiiDSP1807 MonochaetumfloribundumDSP1541 TibouchinalongifoliaDSP1433 Pternandra echinataChen542 PternandracoerulescensChen54368 60 51 66 87 64 99 86 82 84 67 88 66 97 59 93 50 97 94 63 61 59 97 63 99 86 99 97 99 83 84 93 67 90 100 69 100 100 100 71 blueanther fused-bract hexandrous wetbud imbricate calyx100 83 99 84 86 93 86 81 76 74 100 100 100 89 98 65 72 56 64 91 92 69 62 68 67 85 51 51 80 97 94 75 74 92 60 84 100 92. Figure 3. Strict consensus of 6597 equally mo st parsimonious trees based upon ITS data in the phylogenetic analysis of the Blakeeae. MP bootstrap values above 50% are depicted above the branches, ML below.

PAGE 141

141 TopobeacaliginosaDSP1711a TopobeacaliginosaDSP1751 Topobea cf cordataDSP1757 TopobeacordataDSP1667 TopobeacordataDSP1750 TopobeahexandraDSP1689 BlakeahirsutaDSP1844 BlakearoseaDSP1858 BlakeasawadaeDSP1843 BlakeasawadaeDSP1874 BlakeasubpanduriformisDSP1887 TopobeaintricataDSP1723 TopobeaintricataDSP1787 TopobeaparvifoliaDSP1655 Blakea aff herreraeDSP1682 BlakeagracilisDSP1772 BlakeagracilisDSP1809 BlakeaguatemalensisDSP1818 Huilaea ecuadorensisDSP1589 HuilaeacalyptrataDSP1892 ChalybeacorymbiferaMEM1741 TopobeaadscendensDSP1888 TopobeabullataDSP1886 TopobeacutucuensisDSP1613 TopobeadodsonorumDSP1686 TopobeapittieriDSP1536 TopobeapittieriDSP1724 BlakeapulverulentaDSP1627 BlakeapulverulentaDSP1305 BlakeahirsutaDSP1871 BlakeahispidaDSP1869 BlakeasubconnataDSP1570 BlakeasubconnataDSP1580 Topobea acuminataDSP1851 TopobeabrevibracteaDSP1572 Topobea cf watsoniiDSP1525 TopobeasubscabrulaDSP1582 BlakeaanomalaDSP1498 Blakeaaustin-smithiiDSP1830 BlakeabrasiliensisDSP1875 BlakeabrunneaDSP1713 BlakeacalycosaDSP1720 BlakeainvolvensDSP1619 BlakeachloranthaDSP1512 BlakeacostaricensisDSP1648 BlakeacostaricensisDSP1756 BlakeacrinitaDSP1656 BlakeacuatrecasiiDSP1688 BlakeaeriocalyxDSP1620 Blakea foliaceaDSP1646 Blakea foliaceaDSP1709 BlakeafuchsioidesDSP1744 BlakeaglabrescensDSP1563 BlakeagracilisDSP1628 BlakeagranatensisMEM1778 BlakeagrandifloraDSP1494 BlakeagrandifloraDSP1805 BlakeahispidaDSP1845 BlakeainvolvensDSP1625 BlakeainvolvensDSP1901 BlakeajativaeDSP1565 BlakealanuginosaDSP1897 BlakealitoralisDSP1799 BlakealitoralisDSP1819 BlakeaoldemaniiDSP1896 BlakeapaucifloraDSP1714 BlakeapaucifloraDSP1784 BlakeapendulifloraDSP1782 BlakeapolyanthaDSP1583 BlakeaquadrifloraDSP1599 BlakearepensDSP1847 BlakearepensDSP1849 BlakearotundifoliaDSP1622 BlakeaschlimiiFAM726 BlakeaspruceanaDSP1624 BlakeastorkiiDSP1716 BlakeastorkiiDSP1825 BlakeasubvaginataDSP1841 BlakeasubvaginataDSP1861 BlakeatapantianaDSP1789 Blakea trinerviaDSP1629 BlakeatuberculataDSP1518 BlakeatuberculataDSP1643 BlakeavenustaDSP1810 BlakeavenustaRK4081 BlakeawilburianaDSP1644 BlakeawilburianaDSP1761 BlakeawilsoniorumDSP1816 BlakeawilsoniorumDSP1820 TopobeaalbertiaeDSP1684 TopobeaalbertiaeDSP1698 TopobeabrenesiiDSP1770 TopobeacalycularisJRA19758 TopobeafragrantissimaDSP1715 TopobeagerardoanaRK4058 Topobea maurofernandezianaDSP1783 TopobeamultifloraDSP1754 TopobeamultifloraDSP1817 TopobeaparasiticaDSP1821 TopobeaparasiticaMoran6453 TopobeasetosaDSP1577 Topobea cf watsoniiDSP1801 TopobeaspDSP1885 TopobeasubscabrulaDSP1900 ChaetolepiscufodontisiiDSP1807 MonochaetumfloribundumDSP1541 TriolenapileoidesDSP1626 TriolenaspicataDSP1762 MonolenapanamensisDSP1654 AdelobotryspanamensisDSP1759 MerianiahernandiiDSP1850 GraffenriedalatifoliaDSP1303 MiconiadonaeanaDSP1539 MiconialaevigataDSP1317 CharianthusalpinusDSP1301 HenriettellaflavescensCB2827 LoreyaspruceanaDSP1854 HenrietteasuccosaCB2826 LoreyamespiloidesCB2824 BelluciapentameraDSP1868 82 69 60 63 66 62 74 59 65 67 87 56 89 100 100 100 94 63 100 97 hexandrous blueanther imbricate calyx74 100 59 69 53 60 69 69 98 75 62 85 100 85 91 98 76 85 91 Figure 3. Strict consensus of 8134 equa lly most parsimonious trees based upon atpB-rbcL intergenic spacer region data in the phyl ogenetic analysis of the Blakeeae. MP bootstrap values above 50% are depict ed above the branches, ML below.

PAGE 142

142 BlakeainvolvensDSP1625 BlakeainvolvensDSP1901 BlakeaglabrescensDSP1563 BlakeasubconnataDSP1570 BlakeasubconnataDSP1580 BlakeainvolvensDSP1619 BlakeahirsutaDSP1844 BlakeahirsutaDSP1871 BlakeasawadaeDSP1843 BlakeasawadaeDSP1874 BlakeasubpanduriformisDSP1887 BlakearoseaDSP1858 TopobeapittieriDSP1536 TopobeapittieriDSP1724 TopobeadodsonorumDSP1686 Topobea acuminataDSP1851 TopobeabrevibracteaDSP1572 BlakeahispidaDSP1869 BlakearepensDSP1847 BlakearepensDSP1849 BlakeacuatrecasiiDSP1688 TopobeaascendensDSP1888 TopobeabullataDSP1886 TopobeaspDSP1600 TopobeacutucuensisDSP1613 BlakeabrasiliensisDSP1875 BlakeahispidaDSP1845 BlakeaoldemaniiDSP1896 BlakeaquadrifloraDSP1599 BlakeapulverulentaDSP1305 BlakeapulverulentaDSP1627 BlakeasubvaginataDSP1841 BlakeasubvaginataDSP1861 BlakeaeriocalyxDSP1620 BlakeagranatensisMEM1778 BlakeajativaeDSP1565 BlakealanuginosaDSP1897 BlakeapolyanthaDSP1583 BlakearotundifoliaDSP1622 BlakeaschlimiiFAM726 BlakeaspruceanaDSP1624 Blakea trinerviaDSP1629 TopobeasetosaDSP1577 TopobeaspDSP1885 TopobeamultifloraDSP1754 TopobeamultifloraDSP1817 Topobea maurofernandezianaDSP1783 TopobeaalbertiaeDSP1684 TopobeaalbertiaeDSP1698 Topobea cf watsoniiDSP1525 TopobeaspDSP1801 TopobeasubscabrulaDSP1582 TopobeasubscabrulaDSP1900 TopobeacalycularisAbbott19758 TopobeaparasiticaMoran6453 TopobeaparasiticaDSP1821 TopobeacaliginosaDSP1711a TopobeacaliginosaDSP1751 TopobeacordataDSP1667 TopobeacordataDSP1750 Topobea aff cordataDSP1757 TopobeahexandraDSP1689 BlakeawilburianaDSP1644 BlakeawilburianaDSP1761 Blakeaaustin-smithiiDSP1830 BlakeachloranthaDSP1512 BlakeapendulifloraDSP1782 BlakeafuchsioidesDSP1744 TopobeagerardoanaRK4058 BlakeabrunneaDSP1713 BlakeaguatemalensisDSP1818 BlakealitoralisDSP1819 BlakeavenustaDSP1810 BlakeavenustaRK4081 BlakealitoralisDSP1799 TopobeaintricataDSP1723 TopobeaintricataDSP1787 TopobeaparvifoliaDSP1655 Blakea aff herreraeDSP1682 BlakeagracilisDSP1628 BlakeagracilisDSP1772 BlakeagracilisDSP1809 BlakeastorkiiDSP1825 BlakeawilsoniorumDSP1816 BlakeawilsoniorumDSP1820 Blakea foliaceaDSP1709 BlakeapaucifloraDSP1784 BlakeaanomalaDSP1498 BlakeacalycosaDSP1720 BlakeacostaricensisDSP1648 BlakeacostaricensisDSP1756 BlakeacrinitaDSP1656 Blakea foliaceaDSP1646 BlakeagrandifloraDSP1494 BlakeagrandifloraDSP1805 BlakeapaucifloraDSP1714 BlakeastorkiiDSP1716 BlakeatapantianaDSP1789BlakeatuberculataDSP1518 BlakeatuberculataDSP1643 TopobeabrenesiiDSP1770 TopobeafragrantissimaDSP1715 Huilaea ecuadorensisDSP1589 HuilaeacalyptrataDSP1892 ChalybeacorymbiferaMEM1741 ChaetolepiscufodontisiiDSP1807 MonochaetumfloribundumDSP1541 TibouchinalongifoliaDSP1433 TriolenapileoidesDSP1626 TriolenaspicataDSP1762 MonolenapanamensisDSP1654 AdelobotryspanamensisDSP1759 MerianiahernandiiDSP1850 GraffenriedalatifoliaDSP1303 MiconiadonaeanaDSP1539 MiconialaevigataDSP1317 CharianthusalpinusDSP1301 HenrietteasuccosaCB2826 HenriettellaflavescensCB2827 LoreyaspruceanaDSP1854 LoreyamespiloidesCB2824 BelluciapentameraDSP1868 93 54 88 61 86 62 86 88 86 72 77 55 60 56 90 95 71 99 84 62 51 60 89 87 78 83 93 84 99 100 100 88 100 71 100 78 100 62 99 100 62 100 100 86 100 100 100 100 84 94 89 hexandrous vertebratepollinated parasitica imbricate calyx Solanumflowered blueanther wetbud85 90 53 85 74 94 91 83 66 74 94 68 99 85 70 63 55 70 79 73 74 78 98 84 87 95 100 100 82 100 67 95 100 100 64 100 90 100 100 79 100 100 67. 85 95 100 Figure 3. Strict consensus of 1600 equa lly most parsimonious trees based upon accD-psaI + atpB-rbcL + trnL-trnF data in the phylogenetic analysis of the Blakeeae. MP bootstrap values above 50% are depicted above the branches, ML below.

PAGE 143

143 TopobeacordataDSP1667 TopobeacordataDSP1750 TopobeacaliginosaDSP1711a TopobeacaliginosaDSP1751 Topobea aff cordataDSP1757 TopobeahexandraDSP1689 BlakeaguatemalensisDSP1818 BlakealitoralisDSP1819 BlakeavenustaDSP1810 BlakeavenustaRK4081 BlakealitoralisDSP1799 Blakeaaustin-smithiiDSP1830 BlakeachloranthaDSP1512 BlakeapendulifloraDSP1782 BlakeafuchsioidesDSP1744 TopobeaintricataDSP1723 TopobeaintricataDSP1787 TopobeaparvifoliaDSP1655 Blakea aff herreraeDSP1682 BlakeagracilisDSP1628 BlakeagracilisDSP1772 BlakeagracilisDSP1809 BlakeastorkiiDSP1825 BlakeawilsoniorumDSP1816 BlakeawilsoniorumDSP1820 BlakeapaucifloraDSP1714 BlakeapaucifloraDSP1784 BlakeawilburianaDSP1644 BlakeawilburianaDSP1761 BlakeaanomalaDSP1498 BlakeabrunneaDSP1713 BlakeacalycosaDSP1720 BlakeacostaricensisDSP1648 BlakeacostaricensisDSP1756 BlakeacrinitaDSP1656 BlakeafoliaceaDSP1646 BlakeafoliaceaDSP1709 BlakeagrandifloraDSP1494 BlakeagrandifloraDSP1805 BlakeastorkiiDSP1716 BlakeatapantianaDSP1789 BlakeatuberculataDSP1518 BlakeatuberculataDSP1643 TopobeabrenesiiDSP1770 TopobeafragrantissimaDSP1715 TopobeagerardoanaRK4058 BlakeahispidaDSP1869 BlakearepensDSP1847 BlakearepensDSP1849 BlakeabrasiliensisDSP1875 BlakeahispidaDSP1845 BlakeaeriocalyxDSP1620 BlakeagranatensisMEM1778 BlakealanuginosaDSP1897 BlakeapolyanthaDSP1583 BlakeaspruceanaDSP1624 BlakeajativaeDSP1565 TopobeasetosaDSP1577 BlakearotundifoliaDSP1622 TopobeaparasiticaMoran6453 TopobeaparasiticaDSP1821 Topobea cf watsoniiDSP1525 Topobea cf watsoniiDSP1801 TopobeamultifloraDSP1754 TopobeamultifloraDSP1817 TopobeaalbertiaeDSP1684 TopobeaalbertiaeDSP1698 TopobeamaurofernandezianaDSP1783 TopobeasubscabrulaDSP1582 TopobeasubscabrulaDSP1900 TopobeacalycularisAbbott19758 BlakeaglabrescensDSP1563 BlakeainvolvensDSP1625 BlakeainvolvensDSP1901 BlakeasubconnataDSP1570 BlakeasubconnataDSP1580 BlakeainvolvensDSP1619 BlakeahirsutaDSP1844 BlakeahirsutaDSP1871 BlakeasawadaeDSP1843 BlakeasawadaeDSP1874 BlakearoseaDSP1858 BlakeasubpanduriformisDSP1887 TopobeaascendensDSP1888 TopobeabullataDSP1886 TopobeacutucuensisDSP1613 TopobeaspDSP1600 TopobeapittieriDSP1536 TopobeapittieriDSP1724 TopobeadodsonorumDSP1686 Blakea oldemaniiDSP1896 BlakeaquadrifloraDSP1599 BlakeapulverulentaDSP1305 BlakeapulverulentaDSP1627BlakeaschlimiiFAM726 BlakeatrinerviaDSP1629 BlakeasubvaginataDSP1841 BlakeasubvaginataDSP1861 TopobeaacuminataDSP1851 TopobeabrevibracteaDSP1572 BlakeacuatrecasiiDSP1688 TopobeaspDSP1885 HuilaeaecuadorensisDSP1589 HuilaeacalyptrataDSP1892 ChalybeacorymbiferaMEM1741 ChaetolepiscufodontisiiDSP1807 MonochaetumfloribundumDSP1541 TibouchinalongifoliaDSP1433 TriolenapileoidesDSP1626 TriolenaspicataDSP1762 MonolenapanamensisDSP1654 AdelobotryspanamensisDSP1759 MerianiahernandiiDSP1850 GraffenriedalatifoliaDSP1303 MiconiadonaeanaDSP1539 MiconialaevigataDSP1317 CharianthusalpinusDSP1301 HenrietteasuccosaCB2826 HenriettellaflavescensCB2827 LoreyamespiloidesCB2824 LoreyaspruceanaDSP1854 BelluciapentameraDSP1868 62 96 75 95 74 54 67 71 99 86 62 91 66 81 86 88 65 100 93 97 99 88 100 53 82 92 79 99 100 93 62 99 100 85 100 98 100 63 93 100 100 100 90 100 92 100 100 89 100 100 parasitica wetbud blueanther imbricate calyx hexandrous vertebratepollinated99 99 100100100100 5352100 100 99 100 100 99 83 93 100 99 99 94 88 97 86 100 80 100 97 66 95 100 100 83 97 100 52 88 99 95 96 100 78 93 92 52 88 88 68 90 78 85 97 82 63 69 75 95 73 97 63. Figure 3. Strict consensus of 4910 equally most parsimonious trees based upon ITS + accDpsaI + atpB-rbcL + trnL-trnF data in the phylogenetic analysis of the Blakeeae. MP bootstrap values above 50% are depict ed above the branches, ML below.

PAGE 144

144 BlakeahispidaDSP1869 BlakearepensDSP1847 BlakearepensDSP1849 BlakeabrasiliensisDSP1875 BlakeahispidaDSP1845 BlakealanuginosaDSP1897 BlakeagranatensisMEM1778 BlakeaspruceanaDSP1624 BlakeaeriocalyxDSP1620 BlakeapolyanthaDSP1583 BlakeajativaeDSP1565 TopobeasetosaDSP1577 BlakearotundifoliaDSP1622 BlakeaglabrescensDSP1563 BlakeainvolvensDSP1625 BlakeainvolvensDSP1901 BlakeasubconnataDSP1570 BlakeasubconnataDSP1580 BlakeainvolvensDSP1619 BlakeasubvaginataDSP1841 BlakeasubvaginataDSP1861 TopobeaadscendensDSP1888 TopobeabullataDSP1886 TopobeacutucuensisDSP1613 TopobeaspDSP1600 TopobeaparasiticaMoran6453 TopobeaparasiticaDSP1821 Topobea cf watsoniiDSP1525 Topobea cf watsoniiDSP1801 TopobeamultifloraDSP1754 TopobeamultifloraDSP1817 TopobeaalbertiaeDSP1684 TopobeaalbertiaeDSP1698 TopobeamaurofernandezianaDSP1783 TopobeasubscabrulaDSP1582 TopobeasubscabrulaDSP1900 TopobeacalycularisAbbott19758 TopobeapittieriDSP1536 TopobeapittieriDSP1724 TopobeadodsonorumDSP1686 TopobeaacuminataDSP1851 TopobeabrevibracteaDSP1572 BlakeapulverulentaDSP1305 BlakeapulverulentaDSP1627 BlakeaschlimiiFAM726 BlakeatrinerviaDSP1629 TopobeaspDSP1885 Blakea oldemaniiDSP1896 BlakeaquadrifloraDSP1599 TopobeaintricataDSP1723 TopobeaintricataDSP1787 TopobeaparvifoliaDSP1655 BlakeaaffherreraeDSP1682 BlakeafoliaceaDSP1646 BlakeafoliaceaDSP1709 TopobeafragrantissimaDSP1715 BlakeaguatemalensisDSP1818 BlakealitoralisDSP1819 BlakeavenustaDSP1810 BlakeavenustaRK4081 BlakealitoralisDSP1799 BlakeagracilisDSP1628 BlakeagracilisDSP1772 BlakeagracilisDSP1809 BlakeapaucifloraDSP1714 BlakeapaucifloraDSP1784 BlakeaanomalaDSP1498 BlakeastorkiiDSP1825 BlakeawilsoniorumDSP1816 BlakeawilsoniorumDSP1820 BlakeatuberculataDSP1518 BlakeacrinitaDSP1656 BlakeastorkiiDSP1716 BlakeatuberculataDSP1643 BlakeabrunneaDSP1713 BlakeacalycosaDSP1720 BlakeagrandifloraDSP1494 BlakeagrandifloraDSP1805 BlakeatapantianaDSP1789 BlakeawilburianaDSP1644 BlakeawilburianaDSP1761 Blakeaaustin-smithiiDSP1830 BlakeachloranthaDSP1512 BlakeapendulifloraDSP1782 BlakeafuchsioidesDSP1744 TopobeagerardoanaRK4058 TopobeabrenesiiDSP1770 TopobeacordataDSP1667 TopobeacordataDSP1750 TopobeacaliginosaDSP1711a TopobeacaliginosaDSP1751 TopobeaaffcordataDSP1757 TopobeahexandraDSP1689 BlakeacostaricensisDSP1648 BlakeacostaricensisDSP1756 BlakeasawadaeDSP1843 BlakeasawadaeDSP1874 BlakeasubpanduriformisDSP1887 BlakearoseaDSP1858 BlakeahirsutaDSP1844 BlakeahirsutaDSP1871 BlakeacuatrecasiiDSP1688HuilaeaecuadorensisDSP1589 HuilaeacalyptrataDSP1892 ChalybeacorymbiferaMEM1741 ChaetolepiscufodontisiiDSP1807 MonochaetumfloribundumDSP1541 TibouchinalongifoliaDSP1433 TriolenapileoidesDSP1626 TriolenaspicataDSP1762 MonolenapanamensisDSP1654 AdelobotryspanamensisDSP1759 MerianiahernandiiDSP1850 GraffenriedalatifoliaDSP1303 MiconiadonaeanaDSP1539 MiconialaevigataDSP1317 CharianthusalpinusDSP1301 BelluciapentameraDSP1868 LoreyamespiloidesCB2824 LoreyaspruceanaDSP1854 HenrietteasuccosaCB2826 HenriettellaflavescensCB2827 5changes imbricate calyx blueanther wetbud parasitica hexandrous vertebratepollinated Solanum flowered fusedbract Figure 3. One of 4910 equally most parsimonious trees based upon ITS + accD-psaI + atpBrbcL + trnL-trnF data in the phylogenetic analysis of the Blakeeae with branch lengths illustrated.

PAGE 145

145 Topobea albertiaeDSP1684 Topobea albertiaeDSP1698 TopobeamaurofernandezianaDSP1783 Topobea multifloraDSP1754 Topobea multifloraDSP1817 TopobeacfwatsoniiDSP1525 TopobeacfwatsoniiDSP1801 TopobeaparasiticaMoran6453 TopobeaparasiticaDSP1821 TopobeasubscabrulaDSP1582 TopobeasubscabrulaDSP1900 TopobeacalycularisAbbott19758 BlakeaeriocalyxDSP1620 BlakeapolyanthaDSP1583 Blakea jativaeDSP1565 TopobeasetosaDSP1577 Blakea granatensisMEM1778 Blakea spruceanaDSP1624 BlakeahispidaDSP1869 Blakea repensDSP1847 Blakea repensDSP1849 BlakeahispidaDSP1845 BlakealanuginosaDSP1897 BlakeaoldemaniiDSP1896 BlakeaquadrifloraDSP1599 Blakea glabrescensDSP1563 BlakeainvolvensDSP1901 BlakeainvolvensDSP1625 BlakeasubconnataDSP1570 BlakeasubconnataDSP1580 BlakeainvolvensDSP1619 BlakeasubvaginataDSP1841 BlakeasubvaginataDSP1861 Topobea bullataDSP1886 TopobeacutucuensisDSP1613 TopobeaascendensDSP1888 Topobea spDSP1600 BlakearotundifoliaDSP1622 Topobea pittieriDSP1536 Topobea pittieriDSP1724 TopobeadodsonorumDSP1686 TopobeaacuminataDSP1851 TopobeabrevibracteaDSP1572 Blakea pulverulentaDSP1305 Blakea pulverulentaDSP1627 BlakeabrasiliensisDSP1875 Topobea spDSP1885 BlakeaschlimiiFAM726 BlakeatrinerviaDSP1629 BlakeawilsoniorumDSP1816 BlakeawilsoniorumDSP1820 BlakeastorkiiDSP1825 BlakeabrunneaDSP1713 BlakeatuberculataDSP1518 BlakeastorkiiDSP1716 BlakeacrinitaDSP1656 BlakeatuberculataDSP1643 Blakea grandifloraDSP1494 BlakeatapantianaDSP1789 Blakea grandifloraDSP1805 BlakeacalycosaDSP1720 Blakeaaustin-smithiiDSP1830 BlakeachloranthaDSP1512 BlakeapendulifloraDSP1782 BlakeafuchsioidesDSP1744 TopobeagerardoanaRK4058 TopobeabrenesiiDSP1770 BlakeawilburianaDSP1644 BlakeawilburianaDSP1761 TopobeafragrantissimaDSP1715 TopobeaintricataDSP1723 TopobeaintricataDSP1787 TopobeaparvifoliaDSP1655 Blakeaaff herreraeDSP1682 BlakeafoliaceaDSP1646 BlakeafoliaceaDSP1709 BlakeaguatemalensisDSP1818 BlakealitoralisDSP1819 BlakeavenustaDSP 1810 BlakeavenustaRK4081 BlakealitoralisDSP1799 Blakea gracilisDSP1628 Blakea gracilisDSP1772 Blakea gracilisDSP1809 BlakeapaucifloraDSP1714 BlakeapaucifloraDSP1784 BlakeaanomalaDSP1498 TopobeacaliginosaDSP1711a Topobea hexandraDSP1689 TopobeacordataDSP1667 TopobeacordataDSP1750 TopobeaaffcordataDSP1757 TopobeacalignosaDSP1751 BlakeaaffcostaricensisDSP1648 BlakeaaffcostaricensisDSP1756 BlakeacuatrecasiiDSP1688 BlakeasawadaeDSP1843 BlakeasawadaeDSP1874 BlakeasubpanduriformisDSP1887 BlakeahirsutaDSP1844BlakeahirsutaDSP1871 BlakearoseaDSP1858 HuilaeaecuadorensisDSP1589 HuilaeacalyptrataDSP1892 ChalybeacorymbiferaMEM1741 ChaetolepiscufodontisiiDSP1807 MonochaetumfloribundumDSP1541 TibouchinalongifoliaDSP1433 Triolena pileoidesDSP1626 Triolena spicataDSP1762 MonolenapanamensisDSP1654 AdelobotryspanamensisDSP1759 Meriania hernandiiDSP1850 GraffenriedalatifoliaDSP1303 MiconiadonaeanaDSP1539 MiconialaevigataDSP1317 Charianthus alpinusDSP1301 LoreyamespiloidesCB2824 Loreya spruceanaDSP1854 BelluciapentameraDSP1868 HenrietteasuccosaCB2826 HenriettellaflavescensCB2827 0.001changes 53 100 99 100 100 100 100 100 99 99 97 83 93 100 99 99 94 88 100 80 100 97 66 86 95 100 100 83 97 54 100 52 88 99 95 61 96 74 100 78 93 92 52 88 88 68 90 78 85 97 82 63 69 75 95 73 97 63 imbricate calyx blueanther wetbud parasitica hexandrous vertebratepollinated Solanumflowered fusedbract Figure 3. ML tree resulting from combined ITS + accD-psaI + atpB-rbcL + trnL-trnF phylogenetic analysis of Blakeeae. ML boot strap values above 50% are depicted above the branches. Clades receiving bootstrap support with ML, but not MP, are marked with an *.

PAGE 146

146 Blakeabrunnea DSP1713 Blakeacrinita DSP1656 Blakeacalycosa DSP1700 Blakeatuberculata DSP1518 Blakeacostaricensis DSP1648 Blakeascarlatina DSP1797 Blakeawilsoniorum DSP1820 BlakeagrandifloraGuindon1104 BlakeastorkiiMcPherson9326 Blakeatapantiana DSP1789 Blakeaaustin-smithii DSP1830 Blakeachlorantha DSP1512 Blakeapenduliflora DSP1782 Huilaea ecuadorensis DSP1589 Huilaeacalyptrata DSP1892 ChalybeacorymbiferaStein3610 TopobeacalycularisAbbott19758 Topobea cf watsonii DSP1525 Topobeamultiflora DSP1817 Topobea maurofernandezianaHaber8011 TopobeaparasiticadeGranville8734 Topobeasubscabrula DSP1582 Topobeaadscendens DSP1888 Topobeabullata DSP1886 Topobeacutucuensis DSP1613 Topobeasetosa DSP1577 Topobeabrenesii DSP1770 Topobeasp DSP1600 Blakeaguatemalensis DSP1818 Blakeahispida DSP1869 Blakeapolyantha DSP1583 Blakealanuginosa DSP1897 Blakearepens DSP1849 Blakeaeriocalyx DSP1620 Blakeaglabrescens DSP1563 Blakeainvolvens DSP1625 Blakeasubvaginata DSP1619 Blakeajativae DSP1565 Blakearotundifolia DSP1622 Blakeaspruceana DSP1624 Blakeaoldemanii DSP1896 Blakeaquadriflora DSP1599 BlakeaschlimiiDorr7385 Blakeahirsuta DSP1844 BlakeacuatrecasiiCuatrecasas16393 Topobeaalbertiae DSP1698 Blakeasubpanduriformis DSP1887 Blakeasawadae DSP1874 Blakearosea DSP1858 Blakeasubconnata DSP1580 Blakeasubvaginata DSP1861 Blakeapulverulenta DSP1305 Blakeabrasiliensis DSP1875 Blakea trinerviaJudd5323 Blakeapulverulenta DSP1627 Blakea foliacea DSP1646 Blakealitoralis DSP1819 Blakeawilburiana DSP1761 Topobeaintricata DSP1723 Blakeafuchsioides DSP1744 Blakeavenusta DSP 1810 Blakeagracilis DSP1628 BlakeapaucifloraMori5900 Blakea aff herrerae DSP1682 BlakeaanomalaLuteyn4498 Topobeafragrantissima DSP1715 Topobeacordata DSP1667 Topobeahexandra DSP1689 Topobeacaliginosa DSP1711a Topobea cf brevibractea DSP1572 Topobeaparvifolia DSP1655 Topobea acuminata DSP1851 Topobeadodsonorum DSP1686 Topobeapittieri DSP1571 Monochaetumfloribundum DSP1449 Tibouchinalongifolia DSP1433 MiconialaevigataJudd5342 Graffenriedalatifolia DSP1303 fused-bract rodent parasiticas.s. hexandrous90 89 64 99 98 51 71 84 77 73 77 Figure 3. One of 8 equally most parsimoni ous trees resulting from the morphological phylogenetic analysis of Blakeeae. Bootstra p values above 50% are depicted above the branches. Thin lines collapse in strict consensus.

PAGE 147

147 BlakeahispidaDSP1869 BlakearepensDSP1849 BlakeajativaeDSP1565 BlakeapolyanthaDSP1583 BlakeaeriocalyxDSP1620 BlakealanuginosaDSP1897 BlakearotundifoliaDSP1622 BlakeaspruceanaDSP1624 BlakeaglabrescensDSP1563 BlakeainvolvensDSP1619 BlakeainvolvensDSP1625 BlakeasubconnataDSP1580 BlakeasubvaginataDSP1861 BlakeahirsutaDSP1844 BlakearoseaDSP1858 BlakeasawadaeDSP1874 BlakeasubpanduriformisDSP1887 TopobeaadscendensDSP1888 TopobeabullataDSP1886 TopobeacutucuensisDSP1613 TopobeasetosaDSP1577 BlakeaoldemaniiDSP1896 BlakeaquadrifloraDSP1599 BlakeapulverulentaDSP1305 BlakeapulverulentaDSP1627 BlakeabrasiliensisDSP1875 BlakeacuatrecasiiDSP1688 BlakeaschlimiiFAM726 Blakea trinerviaDSP1629 TopobeaalbertiaeDSP1698 Topobea maurofernandezianaDSP1783 TopobeaparasiticaDSP1821 TopobeaspDSP1600 TopobeasubscabrulaDSP1582 TopobeamultifloraDSP1817 Topobea cf watsoniiDSP1525 TopobeacalycularisAbbott19758 BlakeacalycosaDSP1720 BlakeatuberculataDSP1518 BlakeabrunneaDSP1713 BlakeacostaricensisDSP1648 BlakeascarlatinaDSP1797 BlakeawilsoniorumDSP1820 BlakeastorkiiDSP1825 BlakeagrandifloraDSP1494 BlakeatapantianaDSP1789 BlakeacrinitaDSP1656 Blakeaaustin-smithiiDSP1830 BlakeachloranthaDSP1512 BlakeafuchsioidesDSP1744 BlakeapendulifloraDSP1782 TopobeabrenesiiDSP1770 BlakeawilburianaDSP1761 TopobeaintricataDSP1723 BlakeavenustaDSP1810 BlakeaguatemalensisDSP1818 BlakealitoralisDSP1819 Blakea foliaceaDSP1646 BlakeagracilisDSP1628 BlakeapaucifloraDSP1784 Blakea aff herreraeDSP1682 BlakeaanomalaDSP1498 TopobeafragrantissimaDSP1715 TopobeacordataDSP1667 TopobeahexandraDSP1689 TopobeacaliginosaDSP1711a TopobeaparvifoliaDSP1655 Topobea acuminataDSP1851 TopobeabrevibracteaDSP1572 TopobeadodsonorumDSP1686 TopobeapittieriDSP1724 Huilaea ecuadorensisDSP1589 HuilaeacalyptrataDSP1892 ChalybeacorymbiferaMEM1741 MonochaetumfloribundumDSP1541 TibouchinalongifoliaDSP1433 GraffenriedalatifoliaDSP1303 MiconialaevigataDSP131767 59 93 55 96 71 97 82 93 73 77 100 93 61 51 88 100 73 96 99 100 100 100 100 wetbud blue anther imbricate calyx fusedbract vertebratepollinated hexandrous SolanumfloweredSouthAmerica CentralAmerica Figure 3. Strict consensus of 37 equally most parsimonious trees resulting from the ITS + accD-psaI + atpB-rbcL + trnL-trnF + morphology phylogenetic analysis of Blakeeae. MP Bootstrap values above 50% are depicted above the branches.

PAGE 148

148 CHAPTER 4 TAXONOMY AND NOMENCLATURE Introduction Melastomataceae Juss., with approximately 4500 species and 160 genera (Renner 1993), is one of the ten largest families of angios perms. The tribe Blakeeae Benth. & Hook., as historically circumscribed, is composed of about 180 species in two genera, Blakea L. and Topobea Aubl Blakeeae are strictly Neotropical, with centers of diversity in the megadiverse Choco-Andean region of South America and th e mountains of Costa Rica and Panama, though they range from Chiapas, Mexico, to the Amazon of Bolivia and Brazil, to French Guiana. Three species are found in the West Indies. Cladistic analyses (Penneys et al. 2004, Ch apters 2 and 3) have necessitated certain taxonomic changes in the circumscription of the Bl akeeae discussed herein. In brief, it has been discovered that the recognition of Topobea renders both that genus and Blakea polyphyletic, thus Topobea is here relegated to synonymy under Blakea Chalybea Naudin and Huilaea Wurdack, formerly placed in the Miconieae, are strongly supported as members of the Blakeeae and form a clade sister to Blakea sensu lato. The inclusion of Chalybea and Huilaea in Blakeeae requires an expansion of the described morphologi cal variation of the tribe. Each of these topics is discussed in detail below, along with a complete description of the Blakeeae, a key to the three genera with diagnoses of each, and an enumeration of the necessary new combinations. Blakea was first described and illustrated by Br owne (1756) in his encyclopedic volume; later, Linnaeus (1759) assigned the binomial B. trinervia to this Jamaican species. Based upon his work in French Guiana, Aublet (1775) described Topobea parasitica (in the class Dodecandria, order Monogynia) wi thout comparing it to any ot her genus. Jussieu (1789) recognized both genera and separated them on th e basis of ovary position. David Don (1823)

PAGE 149

149 synonymized Topobea under Blakea with the stated justificati on of recently discovered species having nullified any supposed difference regardi ng terrestrial vs. hemiepiphytic (parasitic) habit, and in the number of bract pairs subt ending each flower. D on made no mention of morphological characteristics of the anthers or ovaries. This inclusive interpretation was followed by de Candolle (1828). Naudin (1852) resurrected Topobea and also described Pyxidanthus to accommodate three Andean species. The same arrangement was followed by Triana (1871), though he tran sferred the latter genus, and Valdesia Ruiz & Pavon, to Blakea Baillon (1881) followed the inclusive circumsc ription of Don, and not ed that the anther morphology was variable, and that so me species occasionally have three sets of floral bracts. Cogniaux (1886, 1891) provided the firs t explicit key to the two ge nera and emphasized the form of the filaments and anthers in differentiating them, characters that were also noted earlier (Bentham & Hooker 1867). According to Cogniaux, Blakea has filaments that are thick (vs. filiform in Topobea ), and anthers that are short, obtuse, laterally compressed, with a thick connective terminating in a spur (vs. anthers lin ear to oblong-subulate, ro strate, with a narrower connective, sometimes lacking a spur). Except for Macbride (1941), who took a more inclusive view of Blakea recent workers have followed Cogniaux in recognizing Topobea (e.g., Standley 1924, 1938; Standley and Williams 1963; Gl eason 1958; Wurdack 1973, 1980; Almeda 1990, 2000b, 2001, 2007). Gleason (1945) chose to maintain Topobea on the basis of his respect for tradition, aversion to mergi ng genera that are well-established in the literature, and his belief that the genera were easily separable (intermediat e species were essentially unknown to him). Wurdack (1957) ascribed to the same philos ophy. Almeda (2001, 2007) has also recognized Topobea though with reservations (1974, 1989, 1990). For additional details on the taxonomic history of the Blakeeae, see Almeda (1990).

PAGE 150

150 An examination of species exhibiting the typical androecium character suites for each genus might provide some justification for their separation, but a number of intermediate species have been discovered, eroding the already-dubious and long-contested distinctions between the genera. In order to accommodate these taxa Almeda (1990) expanded the generic key of Cogniaux as follows: Blakea has twelve stamens, anthers th at are oval, oblong, or elliptic, compressed laterally, bluntly obtuse or broadly rounded at the summit with two, typically wellseparated apical pores; Topobea has six, eight, or twelve stamen s, anthers that are linear-oblong to oblong-subulate or rostrate, le ss compressed laterally, with appr oximate or confluent, dorsally inclined pores. Recent phylogenetic analyses (Penneys et al. 2004; Chapters 2 and 3) based upon morphological, molecular, and combined data sets all confirm that the segregation of Topobea from Blakea is artificial. If recognized, each genus would be polyphyletic, and the morphological characters upon which they were ba sed are clearly shown to be homoplasious (Chapters 2 and 3). Therefore, in this paper the necessary formal nomenclatural transfers to Blakea are made for any species of Topobea that have not previously been so treated by earlier workers (e.g., Don 1823, Macbride 1941). Blakea is recognized primarily on the basis of solitary or fasciculate inflorescences with flowers i ndividually subtended by two pairs of decussate, persistent bracts. During the course of these same phylogenetic analyses, it was also discovered that the Andean genera Chalybea and Huilaea are strongly supported as members of the Blakeeae, sister to Blakea (Penneys et al. 2004, Chapters 2, 3). Chalybea and Huilaea are not members of the Miconieae as was suggested by Wurdack (1957). Previous workers (Koek-Noorman et al. 1979; ter Welle & Koek-Noorman 1981) have noted the affinity between these two genera and the

PAGE 151

151 Blakeeae on the basis of wood anatomical characte rs. Mora-Osejo (1966) presented a detailed comparative examination of th e inflorescence architecture of Huilaea and Blakea However, Mora-Osejo did not conclude that the observe d similarities justified tribal realignments. Naudin (1852) described Chalybea corymbifera and placed this new genus and species in Miconieae; it was la ter transferred to Pachyanthus by Triana (1871). Systematists have debated the monophyly of Pachyanthus (Wurdack 1988; Judd 1991), a genus now known to be polyphyletic, at least in part, as the result of th e inclusion of P. corymbiferus (Becquer, in prep., Morales-P. & Penneys, in prep.). In the publication of the new genus, Huilaea Wurdack (1957) stated that within the Miconieae, no close rela tive was apparent, but he did compare it with Pachyanthus Miconia sect. Octomeris M sect. Amblyarrhena Bellucia and Loreya Failing to find any potential sister group within the Miconieae, Wurdack went on to compare Huilaea to Blakea and Topobea but then backed away from this pr oposal, citing differences in bract and bracteole insertion, and noting that the anther pores are somewhat ventrally inclined rather than dorsally as in most Blakeeae. The eight species of Huilaea conform in most characters with Chalybea differing primarily in the si ze and color of the flowers, and number of flowers per inflorescence. If Chalybea is ultimately shown to be nested within Huilaea as present results suggest (Morales-P. & Penneys, in prep.) new combinations must be made under Chalybea The inclusion of Chalybea and Huilaea within the Blakeeae necessi tates an expansion of the described morphological variation of the tribe. In contrast to Blakea which has solitary or fasciculate flowers, Chalybea and Huilaea have inflorescences that are typically longpedunculate cymes or compound cymes. Flowers of Chalybea and Huilaea are subtended by a single pair of rather narrow and early caducous bracts, and not two pa irs of usually expanded, persistent bracts as in Blakea. Chalybea and Huilaea have fruits becoming yellowish-green at

PAGE 152

152 maturity with a thick, leathery exocarp. Finally, the pinwheel-t ype acarodomatia of Chalybea and Huilaea are unique to those genera. A detailed discussion of the Chalybea + Huilaea clade will be presented in Morales-P and Penneys (i n prep.), a cladistic investigation based upon molecular, and combined molecular and morphologi cal analyses with nearly complete sampling of the species. The Blakeeae are characterized by wood with multis eriate rays, the frequent occurrence of druse crystals, axillary inflores cences, 6-merous flowers and berry fruits (Almeda 1990, Chapters 2 and 3). They may be terrestrial, hemiepiphytic epiphytic, or even stranglers, and growth forms include lianas, shrubs, and small to emergent tree sintermediate forms such as lianescent shrubs also occur. Flowers in this tr ibe are typically large and showy ( up to ca. 14 cm in diameter in Blakea princeps (Linden) Cogn.), attracting diverse pollinat ors, including various insects, birds, possibly bats (M. Morales, pers. comm.), and most remarkably, rodents. Many species in this group have great potential in th e horticultural trade, but ha ve been rarely cultivated. Circumscription of Blakeeae: Blakeeae BLAKEEAE Bentham & J. D. Hooker, Gene ra Plantarum 1: 727, 735. 1867. Type genus: Blakea P. Browne. Pyxidantheae Triana, Bull. Congr. Bot. dAmsterd. 457. 1865. Type genus: Pyxidanthus Naudin. Evergreen shrubs, trees, or lianas, growing as terrestrials, hemiepiphytes, or epiphytes, with very variable indumentum, the hairs sparsely to densel y distributed, unicellular or multicellular, variously smooth to roughened to barbellate, furfuraceous-granulose, eglandular, or sessile to shortto long-stalk ed globular glandular, setae slende r to stoutly conic, occasionally

PAGE 153

153 apically fimbriate. Twigs rectangular, square, quadrate, to terete in cross-section, sometimes formicarial with hollow or apically inflated internodes and subnodal entr ance holes. Stipules absent, interpetiolar and co riaceous or layered and memb ranaceous. Petioles terete, canaliculate, to winged; leaves opposite, decussate, nearly sess ile to petiolate, equal to anisophyllous, then the smaller l eaf sometimes deciduous; blade char taceous to coriaceous, flat to verrucose, frequently drooping an d vivid yellow to scarlet when senescent, the apex acute, to broadly rounded, often abruptly sh ort to long acuminate, the base acute, to rounded, to cordate, rarely subpeltate or decu rrent along petiole margins, the marg in plane to revolute, entire to toothed; venation acrodromous, basal to plinerve d, with prominent midvein and 2 to 7 pairs of secondary veins (including a pair of weak, s ubmarginal veins), tertia ry veins numerous and striolate to widely spaced, subperpendicular to midvein; adaxial surface us ually glabrescent, but sometimes with persistent hairs (as above), the veins variously fl at to impressed; abaxial surface light to dark green or tan, esse ntially glabrous to densely pubes cent with various hair types (as above), the midvein and major secondary veins rais ed, minor secondary veins, tertiary veins and higher order veins raised to flat; acarodomatia freque ntly present in primary-axillary vein axils, formed by hair tufts, coalesced veins, or membrane s, or rarely a foliose flap of tissue partially encircling the adaxial apex of the petiole ( B. austin-smithii, B. chlorantha ). Inflorescences axillary in distal nodes, simple or compound cyme ( Chalybea and Huilaea ) or solitary to fasciculate ( Blakea ), bracts and bracteoles caducous ( Chalybea and Huilaea ) or persistent ( Blakea ), each flower subte nded by a single pair ( Chalybea and Huilaea ) or two (very rarely three) pairs ( Blakea ) of bracteoles, the bracteoles obscu re to foliaceous, membranaceous to coriaceous, free to completely c onnate, appressed to hypanthium or spreading, linear to elliptic to oblate, entire to remotely denticulate, with pube scence as above. Flowers perfect, 6-merous (4-

PAGE 154

154 merous in Blakea tetramera ), mostly showy, actinomorphic to zygomorphic as a result of declinate androecium ( Blakea ), frequently with pleasantly sweet to musky fragrance ( Blakea ), rarely nectariferous, the stomatal nectaries located on the anther connective appendages. Hypanthium narrowly to broadly globose, cylindri cal to conical, terete to costate, the outer surface glabrous or with pubescen ce (as above), when present, ha irs usually denser proximally, the inner surface glabrous or rarely glandularpubescent, obscurely to prominently ridged, the apices of the ridges not to dis tinctly projecting around style base. External calyx lobes, when present, 6, distinct with apex acuminate to acu te, or variously reduced to blunt thickenings; internal calyx lobes 6 (rarely 3, bu t absent in calyptrate species) valvate or rarely imbricate, the lobes merely inconspicuous tubercles, to na rrowly to broadly triangular truncate, lanceolate, to orbicular, rarely with a large flap of tissue elaborated from the apical and distal portion of the calyx lobe, then tightly held to the underside of the lobe ( B. calycosa, B. tuberculata ), the margin entire, often callose-thickened, in fruit, the lobes sometimes becoming colorful, sometimes inrolled; calyx tube glabrous inside. Petals 6 (4 in B. tetramera ), rarely containing druse crystals, imbricate in bud, orbiculate, ovate, ellip tic, obovate, to rhombic, frequently widely so, sometimes clawed, symmetrical or oblique, re flexed, rotate, or ps eudocampanulate, white, cream, pink, lavender, magenta, red, or green, the apex acute, obtuse, rounded, truncate, to emarginate; margin entire to minutely erose; bo th surfaces usually glabrous, rarely sparsely pubescent. Stamens 12, but 6 and antesepalous (in the hexandrous Blakea clade), and 8 (in B. tetramera ), incurved in bud, isomorphic or rarely s ubequal with central stamens slightly larger than those at perimeter of cycle ( Blakea ); filaments in cross section nearly flat dorsally, usually with an obscure to prominent ventral keel and laterally narrowed (rarely cylindrical), white, cream, pink, or lavender; anthers white, cream, yello w, bluish, lavender, to deep purple, free or

PAGE 155

155 connate ( Blakea ), laterally rounded to flattened, anther sa cs somewhat to deeply cleft ventrally, linear to obtuse, opening by one or two pores, the pores sometimes confluent, dorsally to ventrally positioned; dorsal basal anther c onnective appendages smooth to rugose, mostly modified blunt knobs, parallel l ongitudinal ridges, triangular spur s (sometimes two present), or caudate. Ovary (2) 4 ()-loc ulate, superior to inferior, apically glabrous or rarely glandular-pubescent, smooth to ridged, unadorned or with circumstylar, s hortto long-acute projections, rectangular flange s, or rarely with ascending, ra diating, elongate appendages ( B. glandulosa, B. hirsuta ); placentation axile to deeply intruded axile, the ovules numerous, anatropous; style elongate (bluntly clavate in B. princeps ), terete, cylindrical slightly swollen suprabasally, or tapered, glabr ous or glandular-pubescent, wh ite, cream, pink, or lavender; stigma truncate to capitate, rarely obs curely lobed and concave (mostly in Chalybea and Huilaea ). Berries globose to elliptical, greenish when immature, becoming yellowish-green, pale greenish-white, red, lavender, orange, or de ep purple at maturity, gl abrous to pubescent (as above), the exocarp thin to le athery, fairly dry and unpalata ble to juicy, sweet, and highly comestible (especially Chalybea and Huilaea ). Seeds pyramidal to ovoid, testa smooth to sculpted. Karyology: Blakea schlimii (Naudin) Triana, n = ca. 90; B. trinervia L., n = 31; B. tuberculata Donn. Sm., n = ca. 31; Topobea superba Naudin, n = 28 (Solt & Wurdack 1980). Topobea calycularis Naudin, n = 36 (Almeda & Chuang 1992).

PAGE 156

156 Distribution: Chiapas, Mexico to Bolivia and Brazil; Jamaica, Lesser Antilles. The Pacific slopes of the Colombian Andes represent the cen ter of specific and morphological diversity. Occurring from sea level to ca. 3000m. Key to the Genera of Blakeeae 1a. Flowers solitary or fascicul ate, each flower subtended by tw o (three) pairs of expanded (rarely lanceolate), persis tent, decussate bracts..... Blakea 1b. Flowers in simple or compound cymes, each flower subtended by a single pair of lanceolate, cauducous bracts.......2. 2a. Inflorescences with 21 flowers, the flowers 13 mm long; hypanthium 7 mm long x 8 mm wide; petals 12 mm long x 5.0.0 mm wide, white to cream, sometimes pink-tinged apically; an thers 3 mm long; style 10 mm long.... Chalybea 2b. Inflorescences with 3 flowers, th e flowers 45 mm long; hypanthium 13 mm long x 11 mm wide; petals 26 mm l ong x 10 mm wide, pink to red, paler inside; anthers 7 mm l ong; style 22 mm long....... Huilaea Chalybea CHALYBEA Naudin, Ann. Sci. Nat. Bot. 16: 99. 1851. Type: Chalybea corymbifera Naudin. Chalybea differs from the closely related Huilaea by having inflorescences with 21 flowers, the flowers 13 mm long, the hypa nthium 7 mm long and 8 mm wide, the petals 12 mm long and 5.0.0 mm wide, white to cream, sometimes pink-tinged apically, the anthers 3 mm long, and the style 10 mm long. Chalybea also differs somewhat from

PAGE 157

157 Huilaea on the basis of leaves entire to dentate, in florescence ramifications to the third order, pedicels 6 mm, hypanthium campanulate to narro wly globose, petals spat ulate, anthers ovate to oblong, and carpels 4. Chalybea includes two species of small, Andean trees: one endemic to Colombia, the other, Peru. For more information on the systematics of th is genus, see Morales-P., M. and Penneys, D. S. (submitted). Huilaea HUILAEA Wurdack, Brittonia 9: 106. 1957. Type species: Huilaea penduliflora Wurdack. Huilaea is distinguished from Chalybea by its inflorescences with 3 flowers, the flowers 45 mm long, the hypanthium 13 mm long and 11 mm wide, the petals 26 mm long and 10 mm wide, pink to red, paler in side, the anthers 7 mm long, and the style 22 mm long. Huilaea is also more or less distinguished from Chalybea on the basis of having denticulate leaves, inflorescence ramifica tions only to the second order, pedicels 8 mm, hypanthium urceolote to long-turbinate, peta ls spatulate to obovate, anthers narrowly ovate to oblong, and carpels 6. Huilaea includes eight species of small, Andean trees: six are Colombian endemics, while two are restricted to Ecuador. The genus is dubiously segregated from Chalybea, primarily on the basis of their larger and redder flowers. For more information on the systematics of Huilaea see Lozano-Contreras, G. & N. RuizR. (1996).

PAGE 158

158 Blakea BLAKEA P. Browne, Civ. Nat. Hist. Jamaica 323. 1756. Type: Blakea trinervia L., Syst. Nat. 10: 1044. 1759. Topobea Aubl., Pl. Gui. 1: 476. 1775. Type: Topobea parasitica Aublet. Drepanandrum Necker, Elem. Bot.. 2: 118. 1790. Type: not designated. Valdesia Ruiz & Pav., Prodr. Fl. Peruv. Chil. 67. 1794. Lectotype (designated here): Valdesia repens Ruiz & Pav., Systema Vegetablium Fl. Per. et Chil. 121. 1798. Ruiz & Pav. s.n. Peru. (Holotype: B, destroyed, photos at MO!, US!), Pyxidanthus Naud., Ann. Sci. Nat. Bot. 18: 150. 1852. Lectotype (designated here): Pyxidanthus schlimii Naud., Ann. Sci. Nat. Bot. 18: 151. 1852. Funck & Schlim 738 Trujillo, Venezuela. (Holotype: Delessert He rbarium, photos at MO!, US!). Amaraboya Linden, Illustr. Hort. 34: 15. 1887. Type: Amaraboya princeps Linden. Blakea is characterized by solitary or fascicul ate axillary inflorescences and flowers subtended by two (rarely three) pairs of d ecussate, (usually) expanded, subtending bracts. Additionally, Blakea may usually be distinguished from Chalybea and Huilaea by the species often being hemiepiphytic or epiphytic, mostly w ith rotate corollas, an thers that are usually laterally flattened and often connate and/or de flexed, with the connective appendages generally better developed and of diverse morphology, and many Blakea species have ovaries not entirely inferior, often with stylar collars. Cladistic anal yses (Penneys et al, 2004, Chapters 2 and 3) have provided conclusive evidence that the recognition Topobea makes both that genus and Blakea polyphyletic, thus Topobea is here relegated to synonymy under Blakea Blakea is comprised of approximately 180 species distributed from Chiapa s, Mexico to Bolivia and Brazil, with two species in Jamaica and one in the Lesser Antilles.

PAGE 159

159 Important references deali ng with the systematics of Blakea include Almeda (1990, 2000a, 2000b, 2001, 2007) and Wurdack (1973, 1980) New Combinations Blakea acuminata (Wurdack) Penneys & Judd, comb. nov. Topobea acuminata Wurdack, Phytologia 52: 69. 1982. Blakea adscendens (E. Cotton & Matezki) Penneys & Judd, comb. nov. Topobea adscendens E. Cotton & Matezki, Brittonia 55: 76. 2003. Blakea albertiae (Wurdack) Penneys & Almeda, comb. nov. Topobea albertiae Wurdack, Phytologia 55: 146. 1984. Blakea amplifolia (Almeda) Penneys & Almeda, comb. nov. Topobea amplifolia Almeda, Proc. Calif. Acad. Sci. 52: 518. 2001. Blakea arboricola (Almeda) Penneys & Almeda, comb. nov. Topobea arboricola Almeda, Proc. Calif. Acad. Sci. 52: 98. 2000. Blakea asplundii (Wurdack) Penneys & Judd, comb. nov. Topobea asplundii Wurdack, Phytologia, 29: 149. 1974. Blakea barbata (Gleason) Penneys & Judd, comb. nov. Topobea barbata Gleason, Bull. Torr. Bot. Club 72: 393. 1945. Blakea brenesii (Standl.) Penneys & Almeda, comb. nov. Topobea brenesii Standl., Field Mus. Pub. Bot 18: 842. 1938.

PAGE 160

160 Blakea brevibractea (Gleason) Penneys & Judd, comb. nov. Topobea brevibractea Gleason, Brittonia 2: 326. 1937. Blakea bullata (E. Cotton & Matezki) Penneys & Judd, comb. nov. Topobea bullata E. Cotton & Matezki Brittonia 55: 78. 2003. Blakea calcarata (L.Uribe) Penneys & Judd, comb. nov. Topobea calcarata L.Uribe, Caldasia 11: 89. 1971. Blakea calophylla (Almeda) Penneys & Almeda, comb. nov. Topobea calophylla Almeda, Proc. Calif. Acad. Sci 43: 281. 1984. Blakea calycularis (Naud.) Penneys & Almeda, comb. nov. Topobea calycularis Naud., Ann. Sci. Nat. Bot. 3: 149. 1852. Blakea castanedae (Wurdack) Penneys & Judd, comb. nov. Topobea castanedae Wurdack, Phytologia 7: 244. 1960. Blakea caudata (Wurdack) Penneys & Judd, comb. nov. Topobea caudata Wurdack, Phytologia 48: 251. 1981. Blakea clavata (Triana) Penneys & Judd, comb. et nom. nov. Topobea gracilis Triana, Trans. Linn. Soc. 28: 150. 1871. The specific epithet is preempted by Blakea gracilis Hemsl., Diag. Pl. Nov. 13. The new specific epithet is from the Latin clavata meaning club, in reference to the club-shape d, formicarial internodes. Blakea cordata (Gleason) Penneys & Almeda, comb. nov. Topobea cordata Gleason, Phytologia 3: 354. 1950.

PAGE 161

161 Blakea cuprina Penneys & Judd, comb. et nom. nov. Topobea glabrescens Triana, Trans. Linn. Soc. 28: 149. 1871. The specific epithet is preempted by Blakea glabrescens Benth., Bot. Voy. Sulph. 94. 1844. The new specific epithet for this species is from the Latin cuprina meaning copper, in reference to the dens e, coppery pubescence on the leaf undersides. Blakea cutucuensis (Wurdack) Penneys & Judd, comb. nov. Topobea cutucuensis Wurdack, Mem. N. Y. Bot. Gard 16: 45. 1967. Blakea dimorphophylla (Almeda) Penneys & Almeda, comb. nov. Topobea dimorphophylla Almeda, Proc. Calif. Acad. Sci. 52: 523. 2001. Blakea discolor (Hochr.) Penneys & Judd, comb. nov. Topobea discolor Hochr., Bull. N. Y. Bot. Gard 6: 282. 1910. Blakea dodsonorum (Wurdack) Penneys & Judd, comb. nov. Topobea dodsonorum Wurdack, Phytologia 38: 304. 1978. Blakea eplingii (Wurdack) Penneys & Judd, comb. nov. Topobea eplingii Wurdack, Phytologia 29: 151. 1974. Blakea ferruginea (Gleason) Penneys & Judd, comb. nov. Topobea ferruginea Gleason, Bull. Torr. Bot. Club 58: 434. 1931. Blakea fragrantissima (Almeda) Penneys & Almeda, comb. nov. Topobea fragrantissima Almeda, Proc. Calif. Acad. Sci 46: 318. 1990. Blakea gerardoana (Almeda) Penneys & Almeda, comb. nov. Topobea gerardoana Almeda, Proc. Calif. Acad. Sci. 52: 527. 2001.

PAGE 162

162 Blakea glaberrima (Triana) Penneys & Judd, comb. nov. Topobea glaberrima Triana, Trans. Linn. Soc. 28: 150. 1871. Blakea hexandra (Almeda) Penneys & Almeda, comb. nov. Topobea hexandra Almeda, Proc. Calif. Acad. Sci 46: 320. 1990. Blakea induta (Markgr.) Penneys & Judd, comb. nov. Topobea induta Markgr., Notizblatt 15: 382. 1941. Blakea inflata (Triana) Penneys & Judd, comb. nov. Topobea inflata Triana, Trans. Linn. Soc. 28: 150. 1871. Blakea insignis (Triana) Penneys & Judd, comb. nov. Topobea insignis Triana, Trans. Linn. Soc. 28: 150. 1871. Blakea intricata (Almeda) Penneys & Almeda, comb. nov. Topobea intricata Almeda, Brittonia, 53: 157. 2001. Blakea killipii (Wurdack) Penneys & Judd, comb. nov. Topobea killipii Wurdack, Phytologia 6: 7. 1957. Blakea lentii (Almeda) Penneys & Almeda, comb. nov. Topobea lentii Almeda, Brittonia 53: 160. 2001. Blakea longiloba (Wurdack) Penneys & Judd, comb. nov. Topobea longiloba Wurdack, Phytologia 6: 8. 1957. Blakea longisepala (Gleason) Penneys & Judd, comb. nov. Topobea longisepala Gleason, Bull. Torr. Bot. Club 72: 392. 1945.

PAGE 163

163 Blakea macbrydei (Wurdack) Penneys & Judd, comb. nov. Topobea macbrydei Wurdack, Phytologia 43: 354. 1979. Blakea maguirei (Wurdack) Penneys & Judd, comb. nov. Topobea maguirei Wurdack, Mem. N. Y. Bot. Gard 16: 43. 1967. Blakea maurofernandeziana (Cogn.) Penneys & Almeda, comb. nov. Topobea maurofernandeziana Cogn., Monogr. Phan 7: 1193. 1891. Blakea mcphersonii (Almeda) Penneys & Almeda, comb. nov. Topobea mcphersonii Almeda, Brittonia 53: 163. 2001. Blakea modica (Wurdack) Penneys & Judd, comb. nov. Topobea modica Wurdack, Phytologia 48: 251. 1981. Blakea mortoniana (Wurdack) Penneys & Judd, comb. nov. Topobea mortoniana Wurdack, Phytologia 21: 129. 1971. Blakea muricata (G.Lozano C.) Penneys & Judd, comb. nov. Topobea muricata G.Lozano C., Rev. Acad. Colomb. Cienc. Exact. Fis. Nat. 88: 342. 1999. Blakea pascoensis (Wurdack) Penneys & Judd, comb. nov. Topobea pascoensis Wurdack, Brittonia 40: 14. 1988. Blakea pittieriana (Cogn.) Penneys & Almeda, comb. et nom. nov. Topobea pittieri Cogn., Monogr. Phan 7: 1088. 1891. The specific epithet is preempted by Blakea pittierii Cogn., Monogr. Phan 7: 1080. 1891, which itself is a synonym of Blakea grandiflora Hemsl., Diag. Pl. Nov. 13.

PAGE 164

164 Blakea pluvialis (Standl.) Penneys & Almeda, comb. nov. Topobea pluvialis Standl., Field Mus. Pub. Bot 22: 162. 1940. Blakea sessilifolia (Triana) Penneys & Judd, comb. nov. Topobea sessilifolia Triana, Trans. Linn. Soc. 28: 150. 1871. Blakea setosa (Triana) Penneys & Judd, comb. nov. Topobea setosa Triana, Trans. Linn. Soc. 28: 149. 1871. Blakea standleyi (L.O.Williams) Penneys & Almeda, comb. nov. Topobea standleyi L.O.Williams, Fieldiana: Bot 29: 583. 1963. Blakea stephanochaeta (Naud.) Penneys & Judd, comb. nov. Topobea stephanochaeta Naud., Ann. Sci. Nat. Bot. 3: 148. 1852. Blakea steyermarkii (Wurdack) Penneys & Judd, comb. nov. Topobea steyermarkii Wurdack, Act. Bot. Venez 1: 56. 1966. Blakea suaveolens (Almeda) Penneys & Almeda, comb. nov. Topobea suaveolens Almeda, Proc. Calif. Acad. Sci 46: 323. 1990. Blakea subbarbata (Wurdack) Penneys & Judd, comb. nov. Topobea subbarbata Wurdack, Phytologia 6: 9. 1957. Blakea subscabrula (Triana) Penneys & Judd, comb. nov. Topobea subscabrula Triana, Trans. Linn. Soc. 28: 150. 1871. Blakea subsessiliflora (Wurdack) Penneys & Judd, comb. nov. Topobea subsessiliflora Wurdack, Phytologia 6: 10. 1957.

PAGE 165

165 Blakea superba (Naud.) Penneys & Judd, comb. nov. Topobea superba Naud., Ann. Sci. Nat. Bot. 3: 147. 1852. Blakea tetramera (Almeda) Penneys & Almeda, comb. nov. Topobea tetramera Almeda, Proc. Calif. Acad. Sci. 52: 543. 2001. Blakea tetroici (Wurdack) Penneys & Judd, comb. nov. Topobea tetroici Wurdack, Phytologia 6: 10. 1957. Blakea toachiensis (Wurdack) Penneys & Judd, comb. nov. Topobea toachiensis Wurdack, Phytologia 38: 306. 1978. Blakea trianaei (Cogn.) Penneys & Judd, comb. nov. Topobea trianaei Cogn., Monogr. Phan 7: 1083. 1891. Blakea verrucosa (Wurdack) Penneys & Judd, comb. nov. Topobea verrucosa Wurdack, Phytologia 38: 303. 1978. Blakea watsonii (Cogn.) Penneys & Almeda, comb. nov. Topobea watsonii Cogn., Monogr. Phan. 7: 1089. 1891. Probable synonyms, not transferred: Topobea floribunda Gleason, T. pubescens Gleason, T. rhodantha L.Uribe, T. rupicola Hoehne are probably synonyms of T. parasitica Aubl., and so as to not contribute nomenclatural clutter, new combinations will not be made un til their status has been confirmed. Likewise, T. reducta Gleason is likely a synonym of Blakea alternifolia (Gleason) Gleason and will not be transferred unless jus tified by further study.

PAGE 166

166 Ambiguous name: Topobea andreana Cogn. is not transferred at this time. This name is occupied by Blakea andreana Cogn. The species is poorly known, but was compared to T. subscabrula Triana by Cogniaux (1887) and to T. grandiflora Wurdack by Wurdack (1957). Study of the type is needed before a new combination can be proposed.

PAGE 167

167 LIST OF REFERENCES Almeda, F. 1974. A new epiphytic Blakea (Melastomataceae) from Panama. Brittonia 26: 393397. Almeda, F. 1980a. Blakea penduliflora (Melastomataceae): A new gr een-flowered species from Costa Rica. Brittonia 32: 508-511. Almeda, F. 1980b. Central American novelties in the genus Blakea (Melastomataceae). Rhodora 82: 609-615. Almeda, F. 1989. Five new berry-fruited speci es of tropical American Melastomataceae. Proceedings of the California Academy of Sciences 46: 137-150. Almeda, F. 1990. New species and new combinations in Blakea and Topobea (Melastomataceae), with an historical perspec tive on generic limits in the tribe Blakeeae. Proceedings of the California Academy of Sciences 46: 299-326. Almeda, F. 1991. Blakea costaricensis (Melastomataceae): A remarkable new epiphyte from southeastern Costa Rica. Selbyana 12: 1-4. Almeda, F. 1995. A new Blakea (Melastomataceae: Blakeeae) from Tapant National Park, Costa Rica. Novon 5: 305-308. Almeda, F. 2000a. The hexandrous species of Topobea (Melastomataceae). Proceedings of the California Academy of Sciences 52: 97-109. Almeda, F. 2000b. A synopsis of the genus Blakea (Melastomataceae) in Mexico and Central America. Novon 10: 299-319. Almeda, F. 2001a. The octandrous and dodecandrous species of Topobea (Melastomataceae) in Mexico and Central America. Proceedings of the California Acad emy of Sciences 52: 511-548. Almeda, F. 2001b. Melastomataceae. In: W. D. Stevens, C. Ulloa Ulloa, A. Pool, and O. M. Montiel, eds., Flora de Nicaragua. Monogra phs in Systematic Botany, Missouri Botanical Garden 85:1339-1419. Almeda, F. 2007. Melastomataceae. In: G. Davidse, M. Sousa-Snchez, S. Knapp, and F. Chiang, eds. Flora Mesoamericana 4: in press. Almeida, M. T., and F. A. Bisby. 1984. A simp le method for establishing taxonomic characters from measurement data. Taxon 33: 405-409. Aublet, J. B. C. F. 1775. Histoire des plante s de la Guiane Franoise 1: 1-621. Pierre-Franois didot, London & Paris.

PAGE 168

168 Baillon, H. E. 1881. Mlastomaces. Histoire des Plantes 7: 1-65. Librairie Hachette et Cie, Paris. Baldwin, B. G. 1992. Phylogenetic utility of the internal transcribe d spacers of nuclear ribosomal DNA in plants: an example from th e compositae. Molecu lar Phylogenetics and Evolution 1: 3-16. Beattie, A. J. 1985. The evolutionary ecology of ant-plant mutualisms. Cambridge University Press, Cambridge. Benson, W. W. 1985. Amazon ant-plants. Pp. 239-266. In : G. T. Prance and T. E. Lovejoy, eds. Amazonia. Pergamon Press, Oxford. Bentham, G., and J. D. Hooker. 1867. Melastomaceae. Genera Plantarum 1: 725-773. Bronstein, J. L. 1986. The origin of bract liquid in a Neotropical Heliconia species. Biotropica 18: 111-114. Browne, P. 1756. The civil and natural histor y of Jamaica in three parts. Browne, London. Candolle, A. P. de. 1828. Melastomaceae. In: A. P. de Candolle, ed., Prodromus systematis naturalis regni vegetabilis 3: 99202. Treuttel et Wrtz, Paris. Chiang, T.-Y., B. A. Schaal, and C.-I. Peng. 1998. Universal primers for amplification and sequencing a noncoding spacer between the atpB and rbcL genes of chloroplast DNA. Botanical Bulletin of A cademia Sinica 39: 245-250. Clausing, G., K. Meyer, and S. S. Renner. 2000. Correlations among fruit traits and evolution of different fruits within Melastomataceae. Botanical Journal of the Linnean Society 133: 303-326. Clausing, G., and S. S. Renner. 2001. Mo lecular phylogenetics of Melastomataceae and Memecylaceae: implications for character evolution. American Journal of Botany 88: 486498. Cocucci, A. A., and A. N. Srsic. 1998. Evidence of rodent pollination in Cajophora coronata (Loasaceae). Plant Systematics and Evolution 211: 113-128. Cogniaux, C. A. 1886-1888. Melastomataceae. In: C. F. P. Martius, ed. Flora Brasiliensis 14: 1-655. F. Fleischer, Munchen and Leipzig. Cogniaux, C. A. 1891. Melastomaceae. In: A. and C. de Candolle, eds. Monographiae Phanerogamarum 7: 1-1256. G. Masson, Paris. Cotton, E., and S. Matezki. 2003. Ecuadorian novelties in Blakea and Topobea (Melastomataceae). Brittonia 55: 73-81.

PAGE 169

169 Dahlgren, R., and R. F. Thorne. 1984. The or der Myrtales: Circumsc ription, variation, and relationships. Annals of the Mi ssouri Botanical Garden 71: 633-699. Don, D. 1823. An illustration of the natural fam ily of plants called Melastomaceae. Memoirs of the Wernerian Natural Hi story Society 4: 276-329. Doyle, J. J., and J. L. Doyle. 1987. A rapi d DNA isolation procedure for small quantities of fresh leaf tissue. Phytochemical Bulletin 19: 11-15. English-Loeb, G., A. P. Norton, and M. A. Walker. 2002. Behavioral and population consequences of acarodomatia in grapes on phytoseiid mites (Mesostigmata) and implications for plant breeding. Entomologi a Experimentalis et Applicata 104: 307-319. Farris, J. S. 1989. The retention index and the rescaled consistency index. Cladistics 5: 417419. Felsenstein, J. 1985. Confiden ce limits on phylogenies: an a pproach using the bootstrap. Evolution 39: 783-791. Fritsch, P. W., F. Almeda, S. S. Renner, A. B. Martins, and B. C. Cruz. 2004. Phylogeny and circumscription of the near-endemic Brazili an tribe Microlicieae (Melastomataceae). American Journal of Botany 91: 1105-1114. Garcia-Cruz, J., and V. Sosa. 2006. Coding quantitative character data for phylogenetic analysis: A comparison of five met hods. Systematic Botany 31: 302-309. Gift, N., and P. F. Stevens. 1997. Vagaries in th e delimitation of character states in quantitative variationan experimental study. Systematic Biology 46: 112-125. Gleason, H. A. 1945. On Blakea and Topobea Bulletin of the Torrey Botanical Club 72: 385393. Gleason, H. A. 1958. Melastomataceae. In: R. E. Woodson, Jr. and R. W. Schery, eds. Flora of Panama. Annals of the Misso uri Botanical Garden 45: 203-304. Grostal, P. and D. J. ODowd. 1994. Plants mites and mutualism: leaf domatia and the abundance and reproduction of mites on Viburnum tinus (Caprifoliaceae). Oecologia 97: 308-315. Janzen, D. H. 1966. Coevolution of mututalism between ants and acacias in Central America. Evolution 20: 249-275. Janzen, D. H. 1967. Interaction of the bulls horn acacia ( Acacia cornigera L.) with an ant inhabitant ( Pseudomyrmex ferruginea F. Smith) in eastern Mexic o. University of Kansas Science Bulletin 47: 315-558. Janzen, D. H. 1969. Allelopathy by myrmecophytes. The ant Azteca as an allelopathic agent of Cecropia Ecology 50: 147-153.

PAGE 170

170 Johnson, L. A. S., and B. G. Briggs. 1984. My rtales and Myrtaceaea phylogenetic analysis. Annals of the Missouri Bo tanical Garden 71: 700-756. Johnson, S. D., A. Pauw, and J. Midgley. 2001. Rodent pollination in the African lily Massonia depressa (Hyacinthaceae). American Journal of Botany 88: 1768-1773. Jolivet, P. 1996. Ants and plants. Backhuys Publishers, Leiden. Judd, W. S., and J. D. Skean, Jr. 1991. Taxonom ic studies in the Miconieae (Melastomataceae) IV. Generic realingnments among terminal-flowered taxa. Bulletin of the Florida Museum of Natural History, Biological Sciences 36: 25-84. Judd, W. S. 2007. Revision of Miconia sect. Chaenopleura (Miconieae: Melastomataceae) in the Greater Antilles. Systematic Botany Monographs 81: 1-235. Jussieu, A. L. de 1789. Genera pl antarum. Herissant and Barrois, Paris. Koek-Noorman, J., P. Hogeweg, W. H. M. van Maanen, and B. J. H. ter Welle. 1979. Wood anatomy of the Blakeeae (Melastomataceae). Acta Botanica Neerlandica 28: 21-43. Langtimm, C. A., and R. Unnasch. 2000. Mice, birds, and pollination of Blakea chlorantha In: N. M. Nadkarni and N. T. Wheelwright, eds. Monteverde: Ecology and conservation of a tropical cloud forest. Oxford University Press, New York. Linnaeus, C. 1759. Systema naturae. Vol. 2, 10th ed. Facsimile. J. Cramer, ed. Codicote, Wheldon and Wesley, Ltd., London. 1964. Lozano-Contreras, G. and N. Ruiz-R. 1996. El gnero Huilaea Wurdack (Melastomataceae). Revista Academia Colombiana Ciencias 20: 237-242. Lumer, C. 1980. Rodent pollination of Blakea (Melastomataceae) in a Costa Rican cloud forest. Brittonia 32: 512-517. Lumer, C. 1982. The pollination ecology, breeding systems and phenology of Blakea and Topobea (Melastomataceae) in Monteverde, Co sta Rica. Ph.D. Dissertation, City University of New York. Lumer, C. 2000. The reproductive biology of Blakea and Topobea (Melastomataceae). In: N. M. Nadkarni and N. T. Wheelwri ght, eds. Monteverde: Ec ology and conservation of a tropical cloud forest. Oxford University Press, New York. Lumer, C., and R. D. Schoer. 1986. Pollination of Blakea austin-smithii and B. penduliflora (Melastomataceae) by small rodents in Costa Rica. Biotropica 18: 363-364. Lundstrm, A. N. 1887. Pfla nzenbiologische Studien II. Die Anpassungen der Pflanzen an Thieren I. Von Domatia. Nova Acta Regiae So cietatis Scientiarum Upsaliensis 13: 1-88.

PAGE 171

171 Macbride, J. F. 1941. Melastomataceae. In: Flora of Peru. Field Museum of Natural History, Botany series 13: 249-521. Madison, M. 1977. Vascular epi phytes: their systematic occu rrence and salient features. Selbyana 2: 1-13. Maddison, W. P., and D. R. Maddison. 1999. M acClade: analysis of phylogeny and character evolution. Version 3.08a. Sina uer, Sunderland, Massachusetts. McKey, D. 1984. Interaction of the ant-plant Leonardoxa africana (Caesalpiniaceae) with its obligate inhabitants in a rain fore st in Cameroon. Biotropica 16: 81-99. Metcalfe, C. R., and L. Chalk. 1950. Melastomaceae. In : Anatomy of the Dicotyledons 1: 637649. Clarendon Press, Oxford. Michelangeli, F. A. 2000. A cladistic analysis of the genus Tococa (Melastomataceae) based on morphological data. Systematic Botany 25: 211-234. Michelangeli, F. A. 2003. Ant protection against herbivory in three species of Tococa (Melastomataceae) occupying different environments. Biotropica 35: 181-188. Michelangeli, F. A., D. S. Penneys, J. Giza, D. E. Soltis, M. H. Hils, and J. D. Skean, Jr. 2004. A preliminary phylogeny of the tribe Mico nieae (Melastomataceae) based on nrITS sequence data and its implications on inflorescence position. Taxon 53: 279-290. Morawetz, W., M. Henzl, and B. Wallnoefer. 1992. Tree killing by herbicide producing ants for the establishment of pure Tococa occidentalis populations in the Peruvian Amazon. Biodiversity and Conservation 1: 19-33. Mora-Osejo, L. E. 1966. Contribuciones al cono cimiento de la morfologa comparada de las inflorescencias y de las formas de crecimien to de las Melastomataceae 1. Inflorescencias de Huilaea, Topobea y Blakea Caldasia 9: 303-312. Morales-P., M. and D. S. Penneys. Nuevas especies de Chalybea Naud. y Huilaea Wurd. (Melastomataceae). Revista Academia Colombiana Ciencias. (submitted). Moreau, C. S., C. D. Bell, R. Vila, B. Archibal d, and N. E. Pierce. 2006. Phylogeny of the ants: Diversification in the age of angiosperms. Science 312: 101-104. Mort, M. E., P. S. Soltis, D. E. Soltis, and M. Mabry. 2000. Comparison of three methods for estimating internal support on phylogenet ic trees. Systematic Biology 49: 160-171. Naudin, C. V. 1852. Melastomacearum monographi cae descriptionis. Annales des Sciences Naturelles; Botanique, ser. 3 16: 381-382. Norton, A. P., G. English-Loeb, and E. Belde n. 2001. Host plant manipulation of natural enemies: leaf domatia protect beneficial m ites from insect predators. Oecologia 126: 535542.

PAGE 172

172 ODowd, D. J., and M. F. Willson. 1991. Associa tions between mites and leaf domatia. Trends in Ecology and Evolution 6: 179-182. Pemberton, R. W., and C. E. Turner. 1989. O ccurrence of predatory and fungivorous mites in leaf domatia. American Journal of Botany 76: 105-112. Penneys, D. S., and W. S. Judd. 2003. Th e resurrection and l ectotypification of Tetrazygia fadyenii (Melastomataceae: Miconieae): a hummingbird pollinated treelet endemic to Jamaica. Sida 20: 877-884. Penneys, D. S., and W. S. Judd. 2005. A system atic revision and cl adistic analysis of Charianthus (Melastomataceae) using morphologi cal and molecular characters. Systematic Botany 30: 559-584. Penneys, D. S., M. W. Whitten, N. H. Williams, and W. S. Judd. 2004. Huilaea and the Blakeeae (Melastomataceae): phylogene tic relationships recons idered. Abstract ID no. 136. Botany 2004. Alpine diversity: adapted to the peaks. July 31August 5. Salt Lake City, Utah. Penneys, D. S., and E. Cotton. 2007. Melastomataceae. In: R. Valencia, N. Pitman, S. LenYnez and P. M. Jrgensen, eds. Libro ro jo de las plantas endmicas del Ecuador. Herbario QCA, Pontificia Universidad Catlica del Ecuador, Quito. Putz, F. E., and N. M. Holbrook. 1986. Notes on the natural history of hemiepiphytes. Selbyana 9: 61-69. Rambaut, A. 1996. Se-Al: Sequence Alignment Editor. Available at http://evolve.zoo.ox.ac.uk/. Reeves, G., M. W. Chase, P. Goldblatt, P. R udall, M. F. Fay, A. V. Cox, B. Lejeune, and T. Souza-Chies. 2001. Molecular systematics of Iridaceae: evidence from four plastid DNA regions. American Journal of Botany 88: 2074-2087. Renner, S. S. 1986. The neotropical epiphytic Melastomataceae: phytogeographic patterns, fruit types, and floral biol ogy. Selbyana 9: 104-111. Renner, S. S. 1989. A survey of reproductiv e biology in Neotropical Melastomataceae and Memecylaceae. Annals of the Mi ssouri Botanical Garden 76: 496-518. Renner, S. S. 1993. Phylogeny and classificat ion of the Melastomataceae and Memecylaceae. Nordic Journal of Botany 13: 519-540. Renner, S. S., and R. E. Ricklefs. 1998. He rbicidal activity of do matia-inhabiting ants in patches of Tococa guianensis and Clidemia heterophylla Biotropica 30: 324-327. Renner, S. S., G. Clausing, and K. Meyer. 2001. Historical biogeography of Melastomataceae: the roles of Tertiary migration and long-dist ance dispersal. American Journal of Botany 88: 1290-1300.

PAGE 173

173 Rodrguez, I., A. Gumbert, N. Hempel de Ibarra J. Kunze, and M. Giurfa. 2004. Symmetry is in the eye of the beeholder: innate preference for bilatera l symmetry in flower-nave bumblebees. Naturwissenschaften 91: 374-377. Romero, G. Q., and W. W. Be nson. 2004. Leaf domatia mediate mutualism between mites and a tropical tree. Oecologia 140: 609-616. Seelanen, T., A. Schnabel, and J. F. Wendel. 1997. Congruence and consensus in the cotton tribe (Malvaceae). Systematic Botany 22: 259-290. Schulman, L., and J. Hyvnen. 2003. A cladistic analysis of Adelobotrys (Melastomataceae) based on morphology, with notes on generic limits within the tribe Merianieae. Systematic Botany 28: 738-756. Skean Jr., J. D. 1993. Monograph of Mecranium (Melastomataceae: Miconieae). Systematic Botany Monographs 39: 1-116. Solereder, H. 1908. Systematic anatomy of the dicotyledons. Clarendon Press, Oxford. Small, R. L., J. A. Ryburn, R. C. Cronn, T. Seel anan, and J. F. Wendel. 1998. The tortoise and the hare: choosing between noncoding plastome and nuclear Adh sequences for phylogeny reconstruction in a recently diverged plan t group. American Journal of Botany 85: 13011315. Snow, D. W., and B. K. Snow. 1980. Relations hips between hummingbird s and flowers in the Andes of Colombia. Bulletin of the British Museum of Natural History (Zoology) 38: 105139. Standley, P. C. 1924. Melastomaceae. In: Trees and shrubs of Mexi co. Contributions to the United States National Herbarium 23: 1046-1074. Standley, P. C. 1938. Melastomaceae. In: Flora of Costa Rica. Field Museum of Natural History, Botany series 18: 783-845. Standley, P. C., and L. O. Williams. 1963. Melastomaceae. In: Flora of Guatemala. Fieldiana, Botany 24: 407-525. Stevens, P. F. 1991. Character states, mor phological variation, and phy logenetic analysis: A review. Systematic Botany 16: 553-583. Stevens, P. F. 2001-onwards. Angiospe rm Phylogeny Website. Version 7, May 2006. http://www.mobot.org/MO BOT/research/APweb/ Sun, Y., D. A. Skinner, G. H. Liang, and S. H. Hulbert. 1994. P hylogenetic analysis of Sorghum and related taxa using internal transc ribed spacers of nuclear ribosomal DNA. Theoretical and Applied Genetics 89: 26-32.

PAGE 174

174 Swofford, D. L. 2002. PAUP* 4.0b10 Phylogene tic Analysis Using Parsimony (*and other methods). Sinauer Associates, Inc., Sunderland, Massachusetts: Taberlet, P., L. Gielly, G. Pautou, and J. Bouvet. 1991. Universal primers for amplification of three non-coding regions of chloroplast DNA. Plant Molecular Biology 17: 1105-1109. Thiele, K. 1993. The holy grail of the pe rfect character: The cl adistic treatment of morphometric data. Cladistics 9: 275-304. Tieghem, M. Ph. van. 1891. Classification an atomique des Mlastomaces. Bulletin de la Socit Botanique de France 38: 114-124. Tieghem, M. Ph. van. 1892. Deuxime addition aux recherches sur la structure et les affinits des Mlastomaces. Annales des Sciences Naturelles 7: 369-380. Treseder, K. K., D. W. Davidson, and J. R. Ehle ringer, J. R. 1995. Absorption of ant-provided carbon dioxide and nitrogen by a tropi cal epiphyte. Nature 375: 137-139. Triana, J. J. 1871. Les Mlastomaces. Tran sactions of the Linnaean Society of London, Botany 28: 1-188. Troll, W. 1964. Die Infloreszensen. Typologie und Stellung im Aufbau des Vegetationskorpers. Teil. 1. Jena. Uribe Uribe, L. 1975. Sertula florae colombiae, XIII. Caldasia 11: 9-17. van Vliet, G. J. C. M., J. Koek-Noorman, and B. J. H. ter Welle. 1981. Wood anatomy, classification and phylogeny of the Melastomataceae. Blumea 27: 463-473. Vasconselos, H. L., and D. W. Davidson. 2000. Relationship between plant size and ant associates in two Amazonian an t-plants. Biotropica 32: 100-111. Walter, D. E. 1996. Living on leaves: mites, to menta, and leaf domatia. Annual Review of Entomology 41: 101-114. Walter, D. E. 2004. Hidden in pl ain sight: Mites in the canopy. In: M. D. Lowman and H. B. Rinker, eds. Forest Canopies, 2nd edition. Elsevier Academic Press, San Diego, California. Weberling, F. 1988. The architecture of inflorescen ces in the Myrtales. Annals of the Missouri Botanical Garden 75: 226-310. Welle, B. J. H. ter, and J. Koek-Noorma n. 1981. Wood anatomy of the Neotropical Melastomataceae. Blumea 27: 335-394. Whitten, W. M., N. H. Williams, and M. W. Chase. 2000. Subtribal and generic relationships of Maxillarieae (Orchidaceae) with emphasis on Stanhopein ae: combined molecular evidence. American Journal of Botany 87: 1842-1856.

PAGE 175

175 Wiens, J. J. 1998. Combining data sets with different phylogenetic histories. Systematic Biology: 47: 568-581. Wurdack, J. J. 1957. Certamen Melastomataceis IV. Brittonia 9: 101-109. Wurdack, J. J. 1972. Certamen Melastomataceis XVIII. Phytologia 22: 399-418. Wurdack, J. J. 1973. Melastomataceae. In: T. Lasser, ed. Flora de Venezuela 8: 1-819. Instituto Botanico, Ministerio de Agricultura y Cria, Caracas. Wurdack, J. J. 1979. Certamen Mela stomataceis XXX. Phytologia 43: 339-355. Wurdack, J. J. 1980. Melastomataceae. In: G. Harling and B. Sparre, eds. Flora of Ecuador 13: 1-406. Univ. Gteborg and Riksmuseum, Stockholm. Wurdack, J.J. 1986. Atlas of hairs for Ne otropical Melastomataceae. Smithsonian Contributions to Botany 63:1-80. Wurdack, J. J. 1988. Certamen Melast omataceis XXXVIII. Phytologia 64: 293-301. Zwickl, D. J. 2006. Genetic algorithm approa ches for the phylogenetic analysis of large biological sequence datasets under the maxi mum likelihood criterion. Ph.D. Dissertation, The University of Texas at Austin.

PAGE 176

176 BIOGRAPHICAL SKETCH Darin S. Penneys was born in Philadelphia, Pennsylvania, on May 13, 1969 to Richard R. Penneys and Brynne V. Rivlin. He received the degree of Bachelor of Science in biology in 1992 from Southern Connecticut State University. His botanical explorati ons led to employment with the United States Department of Agricult ure, U. S. Forest Serv ice in Oregon, the North Carolina Botanical Garden, and various organiza tions in Costa Rica, where he developed a strong interest in tropical plant systematics. He continued his higher edu cation at the University of Florida, where he received a Master of Science in 2001, and a Doctor of Philosophy in 2007, both in botany and under the direc tion of Walter S. Judd. He plan s to serve as a postdoctoral research associate in Toulouse, France, on The BRIDGE project with Jerme Chave, Christopher Baraloto, and Vincent Savolainen.