<%BANNER%>

Role of Clp Stress Response System in Porphyromonas gingivalis Stress Response, Biofilm Formation, and Invasion

Permanent Link: http://ufdc.ufl.edu/UFE0021160/00001

Material Information

Title: Role of Clp Stress Response System in Porphyromonas gingivalis Stress Response, Biofilm Formation, and Invasion
Physical Description: 1 online resource (106 p.)
Language: english
Creator: Capestany, Cindy Ann
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2007

Subjects

Subjects / Keywords: biofilm, clp, gingivalis, invasion, periodontal, porphyromonas, response, stress
Immunology and Microbiology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: The Clp proteins are ubiquitous among prokaryotes and eukaryotes and they function both as proteases and chaperones. In many pathogenic bacteria, the Clp stress response system is essential for pathogenesis as well as virulence gene regulation. The purpose of my project was to determine the role of the Clp system in P. gingivalis. The clpB, clpC, clpP, clpX genes in P. gingivalis were inactivated by allelic replacement and complemented. In addition a clpXP double mutant was generated as these genes are adjacent on the chromosome. Mutants were first tested for stress tolerance, such as heat and oxygen tolerance. The mutants were then examined at different stages of P. gingivalis pathogenesis, biofilm formation and gingival epithelial cell (GEC) invasion. Biofilm formation was assessed by crystal violet staining and confocal scanning laser microscropy. Adherence to gingival epithelial cells was measured in an ELISA format with formalin fixed gingival epithelial cells. Invasion of gingival epithelial cells was determined by confocal scanning laser microscopy and quantitative image analysis. In the heat tolerance experiment, clpC and clpXP mutants showed a three log decrease in viability counts compared to wild type. No differences were observed between wild type and clp mutants for oxygen tolerance. The clpC and clpXP mutants also demonstrated elevated monospecies biofilm formation, but only clpXP mutants displayed elevated heterotypic P. gingivalis-Streptococcus gordonii biofilm formation. All clp mutants adhered to gingival epithelial cells to the same level as wild type. The ClpC, ClpP, and ClpX are necessary for entry and intracellular survival in epithelial cells. However, the ClpB seems to play no role in the entrance of P. gingivalis in epithelial cells, but is important for intracellular survival. My research then investigated the possible connection of known P. gingivalis virulence factors with the Clp system, which led to the discovery of a previously undescribed connection of ClpX to the Mfa1 protein. Our findings delineate a virulence-related role of the Clp system in P gingivalis.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Cindy Ann Capestany.
Thesis: Thesis (Ph.D.)--University of Florida, 2007.
Local: Adviser: Lamont, Richard J.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2012-08-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2007
System ID: UFE0021160:00001

Permanent Link: http://ufdc.ufl.edu/UFE0021160/00001

Material Information

Title: Role of Clp Stress Response System in Porphyromonas gingivalis Stress Response, Biofilm Formation, and Invasion
Physical Description: 1 online resource (106 p.)
Language: english
Creator: Capestany, Cindy Ann
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2007

Subjects

Subjects / Keywords: biofilm, clp, gingivalis, invasion, periodontal, porphyromonas, response, stress
Immunology and Microbiology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: The Clp proteins are ubiquitous among prokaryotes and eukaryotes and they function both as proteases and chaperones. In many pathogenic bacteria, the Clp stress response system is essential for pathogenesis as well as virulence gene regulation. The purpose of my project was to determine the role of the Clp system in P. gingivalis. The clpB, clpC, clpP, clpX genes in P. gingivalis were inactivated by allelic replacement and complemented. In addition a clpXP double mutant was generated as these genes are adjacent on the chromosome. Mutants were first tested for stress tolerance, such as heat and oxygen tolerance. The mutants were then examined at different stages of P. gingivalis pathogenesis, biofilm formation and gingival epithelial cell (GEC) invasion. Biofilm formation was assessed by crystal violet staining and confocal scanning laser microscropy. Adherence to gingival epithelial cells was measured in an ELISA format with formalin fixed gingival epithelial cells. Invasion of gingival epithelial cells was determined by confocal scanning laser microscopy and quantitative image analysis. In the heat tolerance experiment, clpC and clpXP mutants showed a three log decrease in viability counts compared to wild type. No differences were observed between wild type and clp mutants for oxygen tolerance. The clpC and clpXP mutants also demonstrated elevated monospecies biofilm formation, but only clpXP mutants displayed elevated heterotypic P. gingivalis-Streptococcus gordonii biofilm formation. All clp mutants adhered to gingival epithelial cells to the same level as wild type. The ClpC, ClpP, and ClpX are necessary for entry and intracellular survival in epithelial cells. However, the ClpB seems to play no role in the entrance of P. gingivalis in epithelial cells, but is important for intracellular survival. My research then investigated the possible connection of known P. gingivalis virulence factors with the Clp system, which led to the discovery of a previously undescribed connection of ClpX to the Mfa1 protein. Our findings delineate a virulence-related role of the Clp system in P gingivalis.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Cindy Ann Capestany.
Thesis: Thesis (Ph.D.)--University of Florida, 2007.
Local: Adviser: Lamont, Richard J.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2012-08-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2007
System ID: UFE0021160:00001


This item has the following downloads:


Full Text

PAGE 1

ROLE OF CLP STRESS RESPONSE SYSTEM IN Porphyromonas gingivalis STRESS RESPONSE, BIOFILM FORM ATION, AND INVASION By CINDY ANN CAPESTANY A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2007 1

PAGE 2

2007 Cindy Ann Capestany 2

PAGE 3

To my husband, for his support and encouragement in the most difficult of times, and to my parents, in appreciation of th eir sacrifices on my behalf a nd for always believing in me. 3

PAGE 4

ACKNOWLEDGMENTS The author wishes to express her gratitude to Dr. Richard J. Lamont, chairman of my advisory committee, for his friendship, help a nd encouragement during the course of this research. I also thank all pers onnel associated with the laborator y, who were very generous and cooperative in supporting my research efforts. Sp ecial thanks is extended to drs. Y. Park, G. Tribble, and M. Kuboniwa who assisted me with trouble-shooting my experiments; Dr. S. Mao who assisted me with the cell cultures; G. Lam ont who assisted me w ith the complementation strains; and Tim Vaught from the McKnight Brain Institute and Dr. S. Grieshaber whom provided me with the confocal microscope. I thank drs. T. Brown, M. Handfield, S. Holliday, and O. Yilmaz for serving on the advisory comm ittee and for their support. I acknowledge the financial support from the NIDCR grants, DE11 111 and T32DE007200. Last but not least, I am most grateful to my loving husband, David, and my family for supporting and encouraging me throughout this degree program. 4

PAGE 5

TABLE OF CONTENTS page ACKNOWLEDGMENTS ...............................................................................................................4 LIST OF TABLES ...........................................................................................................................7 LIST OF FIGURES .........................................................................................................................8 ABSTRACT .....................................................................................................................................9 CHAPTER 1 INTRODUCTION................................................................................................................. .11 Medical Importance ................................................................................................................11 Pathophysiological Ch aracterization of P. gingivalis .............................................................11 Pathogenesis of P. gingivalis ..................................................................................................13 Biofilm Formation ...........................................................................................................13 Epithelial Cell Invasion ...................................................................................................15 Role of Clp Stress Response System ......................................................................................20 2 ROLE OF CLP SYSTEM IN P. gingivalis STRESS RESPONSE........................................25 Introduction .............................................................................................................................25 Materials and Methods ...........................................................................................................25 Bacterial Strains and Culture Conditions ........................................................................25 Construction of P. gingivalis Mutant Strains ..................................................................26 Isolation of RNA from P. gingivalis ...............................................................................28 Verifying Mutant Expression with RT-PCR...................................................................28 Complementation of the Clp Genes................................................................................28 In vitro Stress Experiments .............................................................................................30 Results .....................................................................................................................................30 Clp Gene Replacement Mutation and Complementation ................................................30 ClpC and ClpXP are Required for Heat Tolerance .........................................................33 Discussion ...............................................................................................................................34 3 ROLE OF CLP SYSTEM IN P. gingivalis BIOFILM FORMATION..................................47 Introduction .............................................................................................................................47 Materials and Methods ...........................................................................................................49 Bacterial Strains and Culture Conditions ........................................................................49 Microtiter Plate Monobiofilm Production Assay ............................................................49 Microscopic Monobiofilm Formation Assay ..................................................................49 Microscopic Mixed Biofilm Formation Assay ................................................................50 Imaging and Analysis of M icroscopic Biofilms ................................................................50 Statistical Analysis ..........................................................................................................51 5

PAGE 6

Results .....................................................................................................................................51 The Absence of ClpC or ClpXP Enhances Monospecies Biofilm Formation .................51 ClpXP Deficiency Increases P. gingivalis Accumulation in Mixed Biofilm ..................52 Discussion ...............................................................................................................................53 4 ROLE OF CLP SYSTEM IN P. gingivalis EPITHELIAL CELL INVASION.....................61 Introduction .............................................................................................................................61 Materials and Methods ...........................................................................................................62 Bacterial Strains and Culture Conditions ........................................................................62 Culture of Primary Gingival Epithelial Cells ..................................................................62 Adherence Assay .............................................................................................................62 Cell Invasion Assay of Primar y Gingival Epithelial Cell Using Immunofluorescence Microscopy ................................................................................63 Imaging and Analysis of Microscopic Invasion ..............................................................64 Intracellular Survival by Antibiotic Protection Assay .....................................................64 Results .....................................................................................................................................64 All Clp Mutants Adhere Normally to Gingival Epithelial Cells, but Internalization of ClpC ClpP, ClpX and ClpXP Mutants are Reduced ..............................................64 All Clp Mutants Exhibit Decrease in Intracellular Survival ...........................................65 Discussion ...............................................................................................................................66 5 RELATIONSHIP OF CLP SYSTEM WI TH KNOWN VIRULENCE FACTORS of P. gingivalis .................................................................................................................................73 Introduction .............................................................................................................................73 Materials and Methods ...........................................................................................................74 Gingipain Activities .........................................................................................................74 Western Blot Analysis of Select P. gingivalis Virulence Factors ...................................74 ELISA for Select Outer Membrane Proteins ...................................................................75 Quantitative RT-PCR ......................................................................................................76 Statistical Analysis ..........................................................................................................77 Results .....................................................................................................................................77 Clp Proteins Do Not Alter Gingipain Proteinase Activities ............................................77 ClpX and ClpXP Induce Total and Surface Expression of Mfa1 Protein .......................77 Discussion ................................................................................................................................78 6 SUMMARY AND CONCLUSION.......................................................................................85 APPENDIX PUBLICATION: ROLE OF Porphyromonas gingivalis INLJ PROTEIN IN HOMOTYPIC AND HETEROTYPIC BIOFILM DEVELOPMENT.................93 LIST OF REFERENCES ...............................................................................................................98 BIOGRAPHICAL SKETCH .......................................................................................................106 6

PAGE 7

LIST OF TABLES Table page 3-1 Available bacterial strains ..................................................................................................37 3-2 Oligonucleotides us ed in this project.................................................................................38 7

PAGE 8

LIST OF FIGURES Figure page 2-1 Mutant construction of P. gingivalis using the PCR fusion technique ..............................39 2-2 RT-PCR products from P. gingivalis wild type and clp mutants ......................................40 2-3 E. coliBacteroides shuttle vector plasmid pT-COW ........................................................41 2-4 Complementation plasmid of Clp ......................................................................................42 2-5 Complement construction of P. gingivalis clp mutants using the plasmid pT-COW ........43 2-6 Stress tolerance of clp mutants ..........................................................................................44 2-7 Heat tolerance of clp mutants ............................................................................................45 2-8 Oxidative tolera nce of clp mutants ....................................................................................46 3-1 Microtiter plate monosp ecies biofilm production by P. gingivalis clp mutants. ...............56 3-2 Microscopic monospeci es biofilm production of P. gingivalis clp mutants ......................57 3-3 Monospecies biofilm production of P. gingivalis clpC and clpXP complemented mutants ...............................................................................................................................58 3-4 Microscopic mixed species biofilm production of P. gingivalis clp mutants. ...................59 3-5 Mixed species biofilm production of P. gingivalis clpXP complemented mutant. ...........60 4-1 P. gingivalis clp mutants adherence to prim ary gingival epithelial cells ..........................68 4-2 P. gingivalis clp mutants invasion of primar y gingival epithelial cells .............................69 4-3 Microscopic invasion of prim ary gingival epithelial cells by P. gingivalis ......................70 4-4 P. gingivalis clp complemented mutants invasion of primary gingival epithelial cells ....71 4-5 Antibiotic protection assays of P. gingivalis clp mutants in gingival epithelial cells. ......72 5-1 Gingipain proteinase activities of clp mutants ...................................................................81 5-2 Western analysis of P. gingivalis virulence factors in clp mutants ...................................82 5-3 ELISA for outer membrane proteins accumulation in clp mutants ...................................83 5-4 Quantitative RT-PCR of mfa1 gene in complemented clpX and clpXP mutants ...............84 8

PAGE 9

Abstract of Dissertation Pres ented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy ROLE OF CLP STRESS RESPONSE SYSTEM IN Porphyromonas gingivalis STRESS RESPONSE, BIOFILM FORMATION, AND INVASION By Cindy Ann Capestany August 2007 Chair: Richard J. Lamont Major: Medical SciencesImmunology and Microbiology The Clp proteins are ubiquitous among prokaryot es and eukaryotes and they function both as proteases and chaperones. In many pathogeni c bacteria, the Clp stress response system is essential for pathogenesis as well as virulence gene regulation. The pur pose of my project was to determine the role of the Clp system in P. gingivalis The clpB clpC clpP clpX genes in P. gingivalis were inactivated by allelic replacem ent and complemented. In addition a clpXP double mutant was generated as these genes are ad jacent on the chromosome. Mutants were first tested for stress tolerance, such as heat and oxyge n tolerance. The mutants were then examined at different stages of P. gingivalis pathogenesis, biofilm formation and gingival epithelial cell (GEC) invasion. Biofilm formation was assesse d by crystal violet staining and confocal scanning laser microscropy. Adherence to gingival epithelial cells was measured in an ELISA format with formalin fixed gingival epithelial cells. Invasion of gingival epithelial cells was determined by confocal scanning laser microscopy and quantitative image analysis. In the heat tolerance experiment, clpC and clpXP mutants showed a three log decrease in viability counts compared to wild type. No di fferences were observed between wild type and clp mutants for oxygen tolerance. The clpC and clpXP mutants also demonstrated elevated monospecies biofilm formation, but only clpXP mutants displayed elevated heterotypic P. 9

PAGE 10

gingivalis Streptococcus gordonii biofilm formation. All clp mutants adhered to gingival epithelial cells to the same level as wild type. The ClpC, ClpP, and ClpX are necessary for entry and intracellular survival in epithelial cells. However, the ClpB seems to play no role in the entrance of P. gingivalis in epithelial cells, but is importa nt for intracellular survival. My research then investigated the possible connection of known P. gingivalis virulence factors with the Clp system, which led to the discovery of a pr eviously undescribed connection of ClpX to the Mfa1 protein. Our findings de lineate a virulence-related role of the Clp system in P gingivalis 10

PAGE 11

CHAPTER 1 INTRODUCTION Medical Importance The oral cavity is residence to over 700 different species of bacteria (1). These oral communities consist of known pathogens, e.g., Streptococcus mutans and P. gingivalis and socalled beneficial organisms such as Streptococcus sanguinis (2). Oral bacterial infections have long been recognized to cause peri odontal diseases. One of the ma jor etiological agents in the development and progression of severe and chro nic manifestation of a dult periodontitis is the Gram-negative anaerobe P. gingivalis Approximately 80% of Amer ican adults currently have some form of this disease (3). Periodontal diseases range from a simple gum inflammation, gingivitis, to a serious di sease which results in the destruc tion of the supporting tissues of the teeth, which include the gingiva, periodontal ligament, and alveol ar bone. If left untreated, periodontal disease may ultimately result in exfoliation of the teeth (4). In addition to its pathoge nic role in the mouth, P. gingivalis has been associated with systematic conditions such as coronary artery disease, preterm deliver y of low birth weight infants, and difficulty in contro lling blood sugar levels in people with diabetes (5, 6). More recently, a study showed P. gingivalis causing osteomyelitis of the ulna, and new evidence has emerged that links periodontal disease with an increased risk of pancreatic cancer, the fourthleading cause of cancer deaths in the United States (7, 8). Pathophysiological Characterization of P. gingivalis P. gingivalis is a Gram-negative black-pigmented coccibacillus (9). Important pathophysiological characteristics of P. gingivalis are the obligate anaerobic respiration and the requirement for hemin, which produces the black pi gmentation, as an iron source for bacterial growth. Also, this bacterium is incapable of fermenting carbohydrates and must obtain its 11

PAGE 12

nutrients from proteins and peptides within the mouth. However, the amino acid metabolic pathways of P. gingivalis have been difficult to determine and some enzymes involved in this metabolism are known to be oxygen labile (inactivated in the presence of oxygen) (10). In order to facilitate nutrient uptake and to effectively colonize, P. gingivalis produces hemin-binding proteins and protein adhesins including fimbriae, hemaggulutinins, proteinases and other membrane proteins, which also co ntribute to virulence (9). P. gingivalis belongs to the Cytophaga / Flavobacter / Bacteroides (CFB) phylum (11). The CFB phylum is more distant from the Proteobacteria than the Gram-positives, based on both evolutionary distance between sequences and parsimony analysis of the 16S rRNA sequences (11). P. gingivalis was the first organism from this phylum to be sequenced, and, not surprisingly, its sequence revealed many genes encoding orthologs also found in Bacteroides fragilis and other Bacteroides species (2). The genome of P. gingivalis W83, a virulent strain in the mouse abscess model, was sequenced and stud ied by The Forsyth Institute and The Institute for Genomic Research (TIGR) [ http://www.tigr.org ] (2, 12). The genome size of P gingivalis is approximately 2.2 Mb. The P. gingivalis sequence is extremely valuable for comparative genomics, and can further our knowledge of path ogenic-related genes, of metabolism of Gramnegative anaerobes, and of bacter ial diversity. Furthermore, the completed sequence allowed the application of global expression measuremen ts, including proteomics, to the study of P. gingivalis -host interactions. P. gingivalis is an extensively studied oral bacterium, because, in addition to sequence availability, se veral of its virulence factors are assayed readily, there are gene transfer systems providing the means to make mutant strains, and there are animal models for infection (13). The advantages of animal mode ls is that they not only provide a valuable confirmation of in vitro results but also to yield important ob servations that might not have been 12

PAGE 13

made otherwise. A number of limitations of animal models are; the cost compared to cell culture systems in order to conduct an experiment and even more expensive is the study of primate models, which demonstrate more complex disease situations and mimic the human situation better than the murine models. The mouse abscess a nd rat bone loss models of periodontal disease is used to study the vi rulence of and host response to P. gingivalis. Pathogenesis of P. gingivalis P. gingivalis is essentially an opportunistic path ogen that can exist in a commensal relationship with the host, but can also extert its pathogenic potential according to local host and environmental factors (4). There are several stages of the lifetstyle of P. gingivalis in the oral cavity. The first is colonization of the oral cavity by entering the mouth probably by person-toperson contact and then localizing at surfaces ( 9, 14). The next stage is the formation of complex biofilms on oral surfaces. Thirdly, P. gingivalis can invade gingival epithelial cells (GEC) and has been observed in gingival epithelial cells of periodontitis patients in vivo (15). This intracellular location may provide the bacteria a nutritionally rich environment that is sheltered from the immune system. Finally, if P. gingivalis is not constrained by the host, tissue destruction and disease can occur. Biofilm Formation The dental plaque biofilm is complex and dynami c with temporally distinct patterns of microbial colonization. The initial colonization of the oral cavity by the non-motile P. gingivalis involves attachment to the supragingival and s ubgingival tooth surfaces (16, 17). The tooth surface available for P. gingivalis already contains a layer of ear ly bacterial colonizers comprised predominantly of Gram-positive commensals, such as Streptococcus gordonii and related streptococci as well as Actinomyces species. These facultative anaerobes will reduce the oxygen 13

PAGE 14

tension and provided the anaerobic conditions required for biofilm development and survival of P. gingivalis (18-20). Therefore, P. gingivalis is a secondary colonizer of dental biofilms and attaches to the surface of other bacteria. Current models of initial biofilm developm ent in Gram-negative organisms include two major steps. In the first step bacteria attach to the surface in a monolayer, and then aggregate into microcolonies. In Pseudomonas aeruginosa flagella are required for formation of the monolayer and type IV pili promote the cell-cell interaction that assembles a monolayer into microcolonies (21). Other studies have speculated that multiple extracellular proteins may also be involved in P. gingivalis biofilm formation (22). P. gingivalis can adhere to S. gordonii and the two organisms accumulate into heterotypic biofilms (19, 23). P. gingivalis adherence to S. gordonii is multimodal and driven by at least two distinct peritrichous fimbriae and receptors. The two distinctly di fferent fimbriae that are present on the surface of P. gingivalis cells are known as the major (l ong) and minor (short) fimbriae (24). The short fimbriae of P. gingivalis have been described independently by two groups as 0.1 to 0.5 m in length and antigeni cally and genetically distinct from the long fimbriae that can extend up to 3m (25, 26). Previ ous studies show that only strains possessing the two distinct fimbriae are able to develop into mature monosp ecies biofilms in vitro (22). This study also suggests that the long fimbriae are required for P. gingivalis attachment and initiation of colonization, while the short fimbriae are i nvolved in the formation of microcolonies by facilitating cell-cell interactions and in the maturation of P. gingivalis biofilms. The long fimbriae of P. gingivalis are predominantly comprised of the FimA (fimbrillin) protein. The FimA protein is 41 kDa and is encoded by the fimA gene, which is monocistronic and can be grouped into six varian ts (type I to V and Ib) on the basis of nucleotide sequences 14

PAGE 15

(27, 28). Amino acid sequence analysis has re vealed no significant homology with fimbrial proteins from other bacteria (29). The long fimbriae of P. gingivalis interact with glyceraldehyde 3-phosphate dehydrogenase on the streptococcal surface (30). Subsequent accretion of P. gingivalis into a mixed species biofilm requires an additional interaction between the short fimbriae and the Ssp major surface proteins on the streptococcal surface (31, 32). The short fimbriae are comprise d predominantly of the Mfa1 protein, a 67 kDa protein encoded by the mfa1 gene (25). Previous analyses show ed that the Mfa1 molecule is the same as that of the 75 kDa outer membrane pr otein and PgII fimbriae (72 kDa) (33-35). The mfa1 gene was shown to be co-transcribed wi th the downstream gene PG0179, which does not contribute to binding with S. gordonii (31, 36). The Ssp proteins ar e members of the antigen I/II family of streptococcal surface proteins that are highly conserved across all the human oral streptococcal species (37, 38). However, desp ite the high degree of structural similarity, P. gingivalis can discriminate between antigen I/II proteins from differe nt species. In particular, P. gingivalis Mfa1 protein adheres to SspA and SspB proteins of S. gordonii but not to the antigen I/II homologue of S. mutans SpaP. This species-specific interaction is determined by a discrete domain designated BAR (Ssp B a dherence r egion), that spans amino acid residues 1167 to 1250 of SspB (38, 39). The Mfa1 major structur al subunit protein of the short fimbriae of P. gingivalis is responsible for binding to S. gordonii SspB BAR domain (36). Within this domain, the amino acids asparagine at position 1182 and valine at 1185 appear to confer a unique structural determinant that is require d for binding and is not conserved in S. mutans SpaP (39). Epithelial Cell Invasion P. gingivalis resides predominantly in the subgingival crevice (the channel between the tooth root and the gingiva that deepens into a periodontal pocke t as disease progresses) and invades the non-phagocytic gingival epithelial cells (9, 40 )). Gingival epithe lial cells are the 15

PAGE 16

primary physical barrier to inf ections by periodontopathogens in vivo. Invasion of epithelial cells is an important strategy developed by many pathogenic bacteria to evade the host immune system and cause tissue damage. Similar to other pathogens, P. gingivalis can invade various host cells, including multilayered pocket epithelial cells, transformed epithelial cells, endothelial cells, and fibroblasts (15, 41-43). The induction of self-uptake by non-professional phagocytic cells is a property of several major pathogens, including sp ecies of the genus Salmonella Shigella Listeria and Yersinia, and is considered an important virulence determinant (44). The pathogenic mechanisms of many Gram-negative organi sms, with regard to their interactions with epithelial cells, revolve around a specialized type III secretion system (TTSS) that injects effector proteins directly into the host cell cytosol (45, 46). Proteins secreted and translocated by the type III machinery have the capacity to m odulate a variety of hos t cell functions, including the signal transduction pathways and cytoskeletal rearrangements required for bacterial entry. However, one aspect of the P. gingivalis invasion of the gingival epithelial cells is that it is accomplished without any obvious homologs of the type III secretion apparatus or effector proteins (47). Gram-positive pathogens such as Listeria monocytogenes have also evolved an intracellular lifestyle without the involvement of type II I secretion systems (46, 48). Adhesion of P. gingivalis to host epithelial is multimodal and involves a variety of cell surface and extracellular compone nts, including fimbriae, proteinases (e.g. gingipains), hemagglutinins, and lipopolysaccharide (LPS) (4, 49). A critical trigger event for subsequent invasion is mediated by P. gingivalis long fimbriae FimA binding to 1 integrin receptors of the gingival epithelial cells (50) A deficiency in the fimA gene leads to a diminished capacity to adhere to human gingival fibrobl asts and epithelial cells, and attenuation of periodontal bone loss in gnotobiotic-rat model (51, 52). P. gingivalis fimbria-deficient mutants have a reduced ability 16

PAGE 17

to invade human gingival epitheli al and KB cells (53-55). Recent investigations have focused on the functional differences in P. gingivalis FimA variants with regard s to the adhesion to and invasion of human epithe lial cells (56, 57). A type II FimA strain (HW24D1) was found to adhere to and invade significantly more ep ithelial cells than strains with other known fimA genotypes. In addition to their role in adhesion, fimbri ae are also known to stimulate both humoral and cellular immune responses of th e host as seen in periodontal patients with elevated serum antibody titers to P. gingivalis fimbriae and to synthetic peptid es derived from their sequences (58-60). Furthermore, immunization with purified fimbriae prevents periodontal destruction in in vivo rat models induced by P. gingivalis infection (61, 62). The major fimbriae can interrupt the host immune system by inducing human peripheral macrophages and neutrophils to overproduce several proinflammatory cytokines su ch as interleukin-1 (IL-1), IL-6, and tumor necrosis factor alpha (63, 64). In addition, Hiramine et al. (65) have shown that the short fimbriae induce IL-1 IL-1 IL-6, and tumor necrosis factor alpha expression in mouse peritoneal macrophages, sugges ting their possible involvement in the inflammatory response during the development of periodontal disease an d as a causative factor of alveolar bone resorption in animal models. However, the role of the short fimbriae in P. gingivalis invasion is not completely understood. Other known virulence factors that are involved in P. gingivalis invasion of gingival epithelial cells are trypsin-like proteinases, gingipains, and a haloacid dehalogenase (HAD) family phosphatase, SerB653 (66, 67). Gingipains may play a role in binding to host cells, either by binding to a cognate receptor or by exposi ng crytitope receptors (68). Gingipains are responsible for most of the extracellular and cell-bound proteolytic activities produced by P. 17

PAGE 18

gingivalis Three different genes code for arginine-X (Arg-gingipa in A and B [rgpA and rgpB])and lysine-X (Lys-gingipain [kgp])specific cyst eine proteinases, which occur in multiple forms due to proteolytic processing of the initial polypeptides (69, 70). Moreover, gingipains have been shown to play important phys iological roles, more particularly in cont rolling the expression of virulence factors and the stab ility and/or processing of extra cellular and cell-surface proteins (71). Subunits of the two fimb riae are regulated by proteolytic processing involving Rgp and Kgp. Recent reports delineated the role of the P. gingivalis SerB653 phosphoserine phosphatase during the invasion of gingi val epithelial cells (67). SerB653 is predicted to localize to the outer membrane due to the presence of two putativ e transmembrane domains and is secreted by P. gingivalis after contact with epithelial cells or th eir components. SerB653 is required for maximum invasion efficiency since both internali zation and intracellular survival were affected by loss of this enzyme. In addition, interac tion between SerB653 and gingival epithelial cell extracts showed that the phosphatase may exer t its effect on invasion through components of membrane vesicular transport systems, in cluding GAPDH and microt ubules. Invasion of P. gingivalis into gingival epithelial cells is rapid and completed within 20 minutes and requires the bacteria and host cells to be metabolically active (72). After invasion, internalized P. gingivalis are found associated directly with the epithelial cell cytoplasm, and not encapsulated by endocytic vacuoles or trafficked to the autophagosomes as found in endothelial and smooth muscle cells (40, 42). P. gingivalis cells remain viable for an extended period in vitro and accumulate in high numbers in the perinuclear region (40, 72). Invasion of P. gingivalis is accompanied by the phosphorylation /de phosporylation and activation of integrinsignaling molecules such as MAPK (mitrogen-activated protein kinase ); the modulation of 18

PAGE 19

calcium influx; recruitment of integrin-associated structural proteins, i. e., FAK (focal adhesion kinase) and paxillin; and the remodeling of the actin cytoskeleton (50, 7375). These molecular events suggest that rearrangements of the hos t cell signaling/cytoskel eton proteins permit bacterial entry into gingival epithelial cells ( 50, 75). Furthermore, th e epithelial cells undergo morphological changes after prolonged ( 24 hr) association with intracellular P. gingivalis ; however, they do not undergo apoptosis and maintain physiological in tegrity for extended periods (40, 72, 76). The survival of gingival epithelial cells during P. gingivalis infection could be promoted by several signaling pathways including the phosphatidylinositol 3-kinase (PI3K)/Akt (protein ki nase B) pathway (77). Recent evidence have shown that P. gingivalis is capable of inte rcellular spreading. Yilmaz et al. (78) showed a mechanism mediated th rough actin-based membrane protrusion in which P. gingivalis can disseminate directly from ce ll to cell without passing through the extracellular space. This inte rcellular spreading may allow P. gingivalis to colonize oral tissues without exposure to the host humoral immune response. Both bacteria and host cells sense and respond to each other; therefore, P. gingivalis may regulate gene and protein expression according to th e prevailing epithelial cell environment (79). Recent proteomics and genomics studies have revealed that P. gingivalis regulates a large number of proteins and genes that could be important for the adaptation and survival of the microorganism in epithelial cells (79-81). One proteomic study demonstrated on a global level the differential protein e xpression that occurs in P. gingivalis as a result of contact with secreted epithelial cell components (79). Interestingly, the results of this study indicate that P. gingivalis may have devised a means to enter and surviv e within epithe lial cells based on orthologous components of the Listeria system. This study found a numbe r of differentially regulated 19

PAGE 20

proteins in P. gingivalis that possess homology with in vasion-related proteins of L. monocytogenes, including subunits of the ATP-depende nt Clp protease complex. ClpC, ClpP, and ClpX proteins were up-regulated by P. gingivalis when exposed to epithelial cell components. Role of Clp Stress Response System The Clp proteins are ubiquitous among prokaryot es and eukaryotes and they function both as proteases and chaperones (82). As characterized in Escherichia coli and Bacillus subtilis the Clp protease proteolytic subunit, ClpP, is a cytoplasmic barrelshaped serine protease composed of two heptameric rings. ClpP is self-compartmentalized me aning it has a constricted pore entrance to the active sites of proteolysis that pr ohibits access of globular proteins. In order to gain proteolytic activity, ClpP must associate with its Clp ATPase partner (83). A number of Clp ATPases regulatory components (e.g. ClpA, ClpB, ClpC, ClpE, ClpL and ClpX), which individually form hexameric ri ngs, can function solely as chap erones with protein reactivation and remodeling activities whereas others additionally can associat e with ClpP peptidase forming a Clp proteolytic complex that specifically targets damaged or misfolded proteins for translocation and degradation (84-86). Furthermore, a study performed in B. subtilis determined the number of Clp ATPases present within bacteria and suggested that the Clp ATPases do not compete for the proteolytic ClpP subunit (86). These Clp-heat shock protein (HSP100) ATPa se chaperones or chaperonins are members of the AAA+ ( A TPase a ssociated with a variety of cellular a ctivities) superfamily and are divided into subfamilies on the basis of the pr esence of specific signature sequences and the number and spacing of the nucleotide binding domains (87, 88). The nucleotide binding or ATPase domains (AAA1 and AAA2) are proposed to mediate substrate interaction. The domains, although highly conserved with the Wa lker A acid and Walk er B nucleotide binding 20

PAGE 21

motifs, contain significant differences and hen ce can be classed accordingly. The N-terminal domains of the ATPases are variable and are in most cases involved in substrate recognition and specificity, whether directly to the substrate or indirectly through the use of specific cofactors or adaptor proteins (88). Association of ClpA, ClpC, ClpE and ClpX with the peptidase ClpP is dependent on the presence of a ClpP recogni tion motif P within the AAA-2, while ClpB acts exclusively as a chaperone and does not appear to have this motif ; therefore, does not associate with the peptidase and has no known protease activity (82, 88). The specific number and types of Clp ATPases vary even between closely related genera but as a general rule, ClpX and ClpC are presen t in all low GC Gram-positive bacteria, such as B. subtilis L. monocytogenes, Staphylococcus aureus, and Streptococcus pneumoniae while ClpA is absent (89). Gram-negative bacterial species like Salmonella sp. and Yersinia sp. possess ClpA, ClpX, and ClpB, but do not encode ClpC, ClpE, and ClpL. In P. gingivalis the presence of only the ATPases ClpB, Cl pC, and ClpX, has been identified. Clp ATPases and Clp-containi ng proteolytic complexes perf orm indispensable roles in cellular protein quality control systems by refolding or degrad ing damaged proteins in both stressed and non-stressed cells ( 89). Moreover, Clp-controlled proteolysis seems to play a substantial role in bacterial su rvival particularly under stress c onditions where proteins tend to unfold and aggregate. Furthermore, Clp prot eases are required for virulence of several pathogenic bacteria (e. g. Yersinia sp., L. monocytogenes S. aureus, and S. pneumoniae ) (83). There are several potential role s of ATP-dependent proteases during pathogenesis; however, there are few examples where it is precise ly understood how the Clp protease helps the bacterium infect or survive within the host. When a pathogen inva des a host cell, it is assumed that bacterial proteins are irreversibly denatu red or damaged and need to be eliminated by 21

PAGE 22

proteases in order to prevent toxicity to the ba cterium. Mutant studies in pathogenic bacteria have demonstrated that clpP mutants are more susceptible to several in vitro stresses such as heat, oxidative, and high osmolarity, suggesting a general stress response defect (90-93). In S. aureus ClpCP is required for heat stress; while Cl pXP is important for survival under osmotic stress, oxidative stress, and cold (92). In L. monocytogenes S. aureus and E. coli, ClpB is necessary for heat shock-induced thermotolerance, which allows bacteria to survive at otherwise lethal temperatures if briefly pre-exposed to a non-lethal temperature (92, 94, 95). In E. coli, thermotolerance requires the disaggregation activ ity of the bi-chaperone system, consisting of ClpB in cooperation with DnaK (Hsp70) chaperone system (96). In addition, regulated proteolysis is required for normal protein turnover and the loss of regulated proteolysis of these enzymes could alter the biochemical profile of a bacterium, cha nging its ability to survive and grow in a host (83). Also, recent data show that the Clp protease is essential for virulence gene regulation through degrading transcription f actors or perhaps also by direct regulation (83). Among various pathogenic bacteria, the Clp prot eins are involved in an arra y of different virulence gene regulation networks. In Yersinia pestis ClpXP and Lon are required for the expression of the type III secretion system by the degradation of YmoA, a histone-like protein that represses expression of the type III secre tion system (97). The type III secretion system are found in many Gram-negative pathogens and are associated w ith a variety of virulence phenotypes including invasion of epithelial cells and the ability to kill cells such as macrophages. YmoA also regulates the Yersinia enterocolitica inv gene that encodes invasin, wh ich is an outer membrane protein that promotes the entry of bacteria into epithelial cells (98). The role of these proteases 22

PAGE 23

and YmoA in Yersinia survival in vivo and effects of clpXP or ymoA mutations on in vitro growth have not been assessed (83). In Y. enterocolitica ClpP is also required for the expression of the attachment invasion locus ( ail ), which encodes a surface exposed protein th at mediates adherence and cell invasion, in vitro (99). In Salmonella enterica serovar Typhimurium and E. coli, the stationary-phase sigma factor S (RpoS) regulates genes involved in the environmental stress response in addition to regulating many virulence properties, and is negatively regulated by ClpXP-mediated degradation (90). In ad dition, the expression of S. aureus arg regulon required ClpXP. The S. aureus arg regulon is extremely comple x, with numerous regulators, including an autoinducing peptide, coordinating the producti on of the secreted virulence factors, hemolysin and Protein A (100). Expression of the hemolysin gene hla was drastically reduced in clpX and clpP mutants (101). Also, ClpX independent of Cl pP, was required for activation of spa gene, which encodes Protein A (102). Furthermore, Cl pXP controls the expression of locus of enterocyte effacement (LEE), which encodes the type III secretion system and virulence proteins, in enterohemorrhagic E. coli and this regulation occurs by two pathways: the S -dependent and independent pathways (103). In L. monocytogenes ClpP and ClpC affect regulati on of the PrfA-regulated genes ( inlA inlB actA and hly) (83, 104, 105). A clpP mutant had a decrease in activity of the essential virulence factor listeriol ysin O (LLO, encoded by hly and required for escape from the phagosome), and a clpC ATPase mutant exhibited reduced expression of the invasion genes inlA and inlB (encoding internalin and required for entr y into epithelial cells) as well as actA (required for actin polymerization, cell-cell mobilit y, and invasion) and did not invade cultured epithelial cells efficientl y. ClpC ATPase was also found to be required for the activity of the 23

PAGE 24

tricarboxylic acid (TCA) cy cle enzyme aconitase ( citB ) in S. aureus (106). Furthermore, ClpB ATPase in Y. enterocolitica affects the expression of invasin and the motility regulon (107). The potential relationship between the Clp subunits and P. gingivalis pathogenesis has not been previously examined. This project inve stigated the phy siological role of Clp subunits (ClpB, ClpC, ClpP, and ClpX) in the stress responses and pathogenesis of P. gingivalis. Gene replacement mutants were assessed for their abili ty to grow or survive under a variety of environmental stress conditions, such as oxidative, aerobic, cold, and thermal stress and only the clpC and clpXP mutants displayed a phenotype with thermal stress. In addition, the clpC and clpXP mutants formed more abundant monospecies biofilms. However, only the clpXP mutant resulted in more P. gingivalis accumulation in heterotypic biofilm s indicating a possible role of ClpXP in the regulation of biofilm accre tion. Regarding intr acellular invasion, all clp mutants demonstrated deficiency in internalization and/ or intracellular survival in gingival epithelial cells. Furthermore, known virulence proteins of P. gingivalis were analyzed for possible differential expression in the clp mutants using western blot and ELISA. These results demonstrated that clpX and clpXP mutants may be involved in the normal degradation of Mfa1 protein since these mutants showed an increase in total and surface protein expressions of this protein. 24

PAGE 25

CHAPTER 2 ROLE OF CLP SYSTEM IN P. gingivalis STRESS RESPONSE Introduction During conditions of stress, most notably during heat stress, cellular pr oteins tend to unfold and aggregate (108, 109). The cell responds by increasing the synthesis of chaperones and proteases that function to eith er disaggregate and refold stre ss-damaged proteins, or degrade those that cannot be refolded. In Gram-positive bacteria, recent data have shown that ClpP proteolytic complexes are important for survival during stress, and that they play a major role in the degradation of non-native proteins under th ese conditions (85, 93, 110) The Clp proteins have also shown that they play a substantial role for bacterial surviv al in other pathogenic bacteria particularly under e nvironmental stress conditions. Clp mutants of P. gingivalis were constructed and compared to the wild type and a ssessed for their ability to grow or survive under a variety of environmental stress conditions, such as oxidative, aerobi c, cold, and thermal stress. The clpB clpC clpP clpX genes in P. gingivalis were inactivated by allelic replacement and complemented. In addition, a clpXP double mutant was generated as these genes are adjacent on the chromosome. Materials and Methods Bacterial Strains and Culture Conditions P. gingivalis ATCC 33277, a strain that has demonstr ated virulence in the rate bone loss model of periodontal disease, was utilized (111). All bacterial st rains are listed in Table 2-1. P. gingivalis ATCC 33277 and its derivatives were cultured anaerobically at 37C in trypticase soy broth (TSB) supplemented with y east extract (1 mg/ml), hemin (5 g/ml) and menadione (1 g/ml). When necessary, erythromycin at a fina l concentration of 10 g/ml or tetracycline at 1 g/ml were added to the medium. Solid medi um were prepared by supplementation with 5% 25

PAGE 26

sheep blood and 1.5% agar. E. coli TOP10 and R751 were grown in Luria-Bertani (LB) broth containing, when necessary, ampicillin at 100 g/ml. Construction of P. gingivalis Mutant Strains Mutations of P. gingivalis clpB (PG1118) and clpC (PG0010) were previously accomplished by using cloning vectors (G. Tribble, personal communication). The clpB PCR product was cloned into pUC19 and the ermF (erythromycin resistant gene) fragment was cloned into the PstI sites. The clpC PCR product was cloned into an existing plasmid pUC18 and the ermF fragment was cloned into the SphI sites. Then, gene replacements of both genes were performed by transformation of the constructed plasmid into P. gingivalis ATCC 33277. Mutations in clpP (PG0418), clpX (PG0417), and clpXP were achieved in this project. These mutants were constructed by gene replacement using a PCR fusion technique modified from Kuwayama et al. (112). A schematic illustration of the mutant constructs is shown in Figure 2-1. Primers were designed using DNASTAR PrimerSelect so ftware and are listed in Table 2-2. P. gingivalis ATCC 33277 (wild type) genomic DNA was is olated with the Wizard Genomic DNA Purification Kit. Three fragments for mutant construction were amplified using the Taq polymerase system (Eppendorf). For the first fragment, the upstream region, ~500-1000 bp, of the target gene was amplified with specific prim ers. The sequence of the reverse primer was immediately preceding the start codon of the ta rget gene and had a 5 extension of 24 bp corresponding to the reverse complement of the 5 end of the replacement gene, ermF For the second fragment, the downstream region, ~500-1000 bp, of the target gene was amplified with specific primers. The forward primer was imme diately following the stop codon of the target gene and had a 5 extension of 27 bp correspond ing to the identical to the 3 end of the ermF gene. During fusion PCR, these 5 exte nsions allow the sequence annealing of ermF to the other 26

PAGE 27

fragments. For the third fragment, the ermF gene product of 801 bp was amplified from plasmid pVA3000 with specific primers. Each amplifi cation was executed in 100 l of PCR mixture using 33 ng of genomic DNA or 10 ng of pVA3000 plasmid with the following reagents: a 0.4 M concentration of each primer, a 800 M con centration of the deoxynu cleoside triphosphates (dNTP), 1X buffer, and 5U/l of Takara LA Ta q Polymerase. The PCR cycling conditions were performed as follows: heating to 95C for 6 min; 30 cycles of 94C for 30 s, 57C for 30 s, and 72C for 2 min; followed by a final extension at 72C for 7 min. Each PCR product was then size-fractionated on a 1% agarose gel in TAE bu ffer. The corresponding band was excised and then purified with the Wizard SV Gel and PCR Clean-up System. After quantification of the three fragments, the fusion PCR reaction was performed in 100 l of PCR mixture using 2 ng of each fragment and the outermost primers, the upstream forward primer from fragment 1 and the downstream reverse primer from fragment 2, for the corresponding gene. For the clpXP fusion PCR, clpP upstreamForw and clpX downstreamRev primers were used. The previously described P CR reagents were again utilized. The fusion PCR cycling conditions were similar to the above PCR conditions except that the cycles were increased to 40 cycles in order to increase yield amount, and the extension times in the cycles were increased to 3 min to accommodate for the larger fusion PCR product size. To confirm the product size and purity, the fusion PCR product wa s size-fractionated on a gel. The final construct was then purified with Wizard PCR Clean-up System before electroporation into P. gingivalis P. gingivalis 33277 competent cells were obtaine d by suspending early-log-phase cells in electroporation buffe r (10% glycerol, 1.0 mM MgCl 2 ). The cells were incubated with 2 g of the purified final PCR product in TE buffer and pulsed with a Bio-Rad Gene Pulser at 2.5 kV. The cells were then immediately added to the TSB and incubated anaerobically for 16 h. A 27

PAGE 28

double cross-over recombination event was se lected by plating th e electroporated P. gingivalis at different dilutions on TSBY agar containing erythromycin (10 g /ml). To verify mutations, diagnostic PCR approaches with the upstream forward primer and ermF reverse primer were performed on randomly selected colonies to confirm correct gene replacement. Isolation of RNA from P. gingivalis Bacterial cells were lysed using Trizol (Invitrogen) as described by the manufacturer for Gram-negative bacteria. RNA were extracted with phenol:chloroform and precipitated with isopropanol. RNA preparations were washed with 70% ethanol, dissolved in RNase-free H 2 O and treated with RNase-free DNaseI (Ambion). The RNA were then purified on RNeasy columns (Qiagen) and visualized for purity on gel. Verifying Mutant Expression with RT-PCR Reverse-transcriptase PCR (RT-PCR) was performed in order to confirm that clpP and clpX are on the same operon and verify a ppropriate gene expressions of the clp mutants. Total RNA was isolated a nd purified from P. gingivalis strains, as described above. The second-strand cDNAs were synthesized by st andard PCR methods using specific primers within the corresponding gene (Table 2-2). The cDNA product wa s then visualized on a gel to verify that a specific product is generated. Complementation of the Clp Genes The clp mutants were complemented with the w ild type allele in trans. A region containing the appropriate clp ORF, plus no less than an additional 100 bp upstream and 30 bp downstream, was PCR-amplified by using ExTaq (T akara). The primers were engineered to contain the following restriction sites: SalI-HindIII for clpB NheI-HindIII for clpC and clpP and NheI-BamHI for clpXP (Table 2-2). The E. coli-Bacteroides shuttle vector plasmid, pT-COW, was purified from E. coli DH5a containing pT-COW using Qiagen QlAprep Spin Miniprep Kit 28

PAGE 29

(113). The plasmid was then digested with the appropriate restriction enzymes to allow cloning of the PCR product into the tetC region, shown in Figure 2-3. The PCR products were digested with the appropriate restriction enzymes (Pro mega/New England BioLab s), ligated into pTCOW by T4 DNA Ligase (Promega), and transformed into E. coli TOP10 (Invitrogen). The transformed E. coli was selected on ampicillin (100 g/ml) plates and screened by colony direct PCR and restriction digestion. The clones with the correct restriction profile were designated pT-ClpB, pT-ClpC, pT-ClpP, and pT-ClpXP (Figure 2-4). The conjugation experiment s were performed with E. coli TOP10 containing the appropriate pT-Clp plasmid and helper E. coli J53 containing R751, an IncP plasmid used to mobilize vectors from E. coli to a Bacteroides recipient, as the donor cells and with the appropriate P. gingivalis clp -deficient mutants as the recipient cells. Briefly, E. coli TOP10 containing the pT-Clp plasmids and R751 was cultured aerobically in LB broth for 1 to 2 h to an A 600 of 0.2, and P. gingivalis was grown anaerobically in TSB medium to an A 600 of 0.2 (early logarithmic growth). The conj ugation mixture had a donor-to reci pient ratio of 0.2. The mating was performed in a candle jar on TSB sheep blood plates for 16 h. Transconjugants were selected on TSB blood plates containing gentamicin (100 g/ml) and tetracycline (1 g/ml), to select the presence of the tetQ gene on the plasmid. Since P. gingivalis is naturally resistant to this concentration of gentamicin and E. coli is naturally sensitive to gentamicin, colonies growing on the antibiotic plates were P. gingivalis with the appropriate pT-Clp plasmid. Transconjugants appeared after 1 week incubation and were conf irmed by PCR for the presence of pT-COW plasmid and ermF gene on chromosome. The DNA was isolated by Wizard Genomic DNA Purification Kit. As a positive control, wild type 33277 with the parent plasmid pT-COW was utilized as a referenc e for the complemented strains. 29

PAGE 30

In vitro Stress Experiments For all stress experiments, overnight cultures of P. gingivalis strains were diluted and grown anaerobically at 37C until mid-exponential growth phase (OD 600nm = 1.0: 1x10 9 CFU/ml). If necessary, cultures were adjusted to th e same starting amount. To compare the effect of heat stress on survival, exponentially growing cultures were diluted (10 -2 10 -6 ) and 20 l of each dilution were spotted on TSBY blood agar plates, as modified from Frees et al. (92). The plates were incubated at 37C or 42C for 5 days To assess effect of heat and cold stress on growth, the cultures were grown at 37C, 42C, or on ice for 1, 3 and 5 h and monitored by measuring the OD. For the effect of oxidati ve stress, the cultures were diluted (10 -2 10 -6 ) and hydrogen peroxide was added to the dilutions to a final concentration of 30 mM. Then, 20 l of each dilution were plated on TSBY blood agar plates and incubated (37C, 5 day). For effect of oxidative stress on growth, the cultures were split, 7.5 or 15 mM of hydrogen peroxide were added to one half, and then both halves were incubated at 37C for 1, 3, 5 h and monitored by measuring the OD. For aerotolerance, the cultures were split, one half were shaken aerobically at 37C and the other half inc ubated anaerobically at 37C at 1, 3, and 5 h and monitored by measuring the OD. All the above experiments were performed in duplicate. Statistical analysis determined the mean, standard deviation, and th e significant difference between the mutant and parental strains by Students t -tests and ANOVA software. Results Clp Gene Replacement Mutati on and Complementation Since P. gingivalis clpB and clpC mutants were previously co nstructed in our lab, mutation of P. gingivalis clpP, clpX and clpXP genes still needed to be accomplished (Table 2-1). These mutations were constructed by gene replacemen t using a novel PCR fusion technique. The schematic illustration of the mutant construct is shown in Figure 2-1A. The fragment sizes for 30

PAGE 31

the upstream and downstream regions of clpP and clpX were respectively 542, 566, 1024 and 799 bp and the final PCR fusion product for clpP clpX and clpXP were respectively 1858, 2573, and 2091 bp (Figure 2-1B). To verify mutations, diagnostic PCR approaches were performed on randomly selected colonies to confirm corr ect gene replacement (Figure 2-1C). The clpP and clpXP mutants were confirmed by using the upstream clpP forward primer and ermF downstream primer, while clpX mutant was confirmed with the upstream clpX forward primer and ermF downstream primer. No amplified band was expected for the wild type; however, a 1319 bp fragment for the clpP and clpXP mutants and a 1801 bp fragment for the clpX mutant was expected if a double cross-over and gene replacement occurred. The appropriate size fragments were observed in all the clp mutants tested. These resu lts confirm that the double cross-over with each of the two outside frag ments and their homologous domains within the genome generated a clean gene replacement. RT-PCR was performed in order to confirm that clpP and clpX are on the same operon as suggested by there close proximity in P. gingivalis W83, only 36 bp apart from each other; to check for appropriate gene expressions of the clp mutants; and to ensure that there is no polar effect on clpX due to mutation of clpP RT-PCR verified that clpP and clpX are on the same operon with a cDNA product size of 1454 bp (Figure 2-2). In addition, all mutants showed the appropriate gene expressions with the presence or absence of a ~500 bp band. The RT-PCR results also demonstrate that clpP mutant showed no polar effect on clpX expression. The positive control, wild type strain, showed expression of both genes and the negative control, RNA isolation, showed no DNA contamination. Furthermore, all clp mutants growth rate and entry to log-phase were indistinguis hable from wild type (not shown). 31

PAGE 32

Furthermore, complementation of the clp genes was used to verify that the loss of wild type phenotype is due to the deletion of the specific clp gene and not the result of pleiotropic effects. The PCR products and pT-COW were dige sted with the appropiate restriction enzymes (Figure 2-5A). However, the clpB gene displayed a different restriction profile in P. gingivalis 33277 compared the the sequenced W83. The availa ble sequence showed no restriction site for NheI and HindIII; however when digested with NheI it was degraded within the gene and appropriately digested with HindIII (Figure 2-5B). Therefore, NheI was switched with SalI, which did not digest within the gene. The clp genes were ligated into pT-COW and transformed to E. coli TOP10. Figure 2-5C shows the purified pT -COW and its dereviates isolated from E. coli TOP10 and digested by the appropiate restriction enzyme. This gel showed two main digested products for each pT-C OW derivative, the smaller fragments denote the gene and the larger fragment represents the rest of the pl asmid (~10 kb). There are also fragments that represent incomplete digestion. The expected size of the PCR product and total plasmid sizes are shown in Figure 2-4. Once clones were identified, conjugation wa s performed by a three way mating of the E. coli TOP10 containing the pT-COW derivatives with the helper E. coli J53 containing plasmid R751 and the P. gingivalis clp -deficient mutants. Theoretically, the helper E. coli J53 containing plasmid R751, an IncP plasmid used to mobilize vectors from E. coli to a Bacteroides recipient, would quickly conjugate R751 into E. coli TOP10. E. coli TOP10 then becomes a competent donor cell and able to deliver the pT-COW derivatives to the P. gingivalis clp -deficient mutants. The transconjugants were screened for the desired clp gene and ermF gene (Figure 2-5D). The presence of the antibiotic marker validates that the original gene de letion was not replaced by homologous recombination occurring with the ch romosome. The presence of both the gene 32

PAGE 33

product and ermF fragment proves that the gene is expressed in trans within the mutants. In this figure, complemented clpX and clpXP mutants possess two gene products since the PCR primers are outside of the genes of interest, this gel showed both the antibiotic replaced fragment on the chromosome and the presence of the gene fragme nt in the plasmid. This is impossible to visualize in the complemented clpP mutant since both the gene and ermF products are similar sizes, so primers within the gene was used to detect the clpP gene. Also, the absence of two bands in complemented clpB and clpC mutants is most likely due to the PCR primers being within the original deleted gene site. Moreover, this method of P. gingivalis conjugation of pTCOW was extremely efficient in this project with majority of the colonies screened containing the desired pT-COW derivatives (not shown). ClpC and ClpXP are Required for Heat Tolerance The Clp proteins have been shown to play a s ubstantial role for bacterial survival in other pathogenic bacteria particularly under environmental stress conditions. The clp mutants were compared to wild type and assessed for their ab ility to grow or surv ive under a variety of environmental stress conditions, such as oxida tive, aerobic, cold, and thermal stress. Experiments were performed to see the effect of the clp mutations on short-term growth (1, 3, and 5 h) under the different stress conditions. All mutants maintained relatively the same percentage of growth as the wild type under th e aforementioned stress conditions and were not significantly different ( P < 0.05) (Figure 2-6). These results suggest that Clp system may not play a role in short-term stress response of P. gingivalis. Also, since P. gingivalis is a slow growing bacterium, differences in growth effects may not be appa rent during short-term growth. Therefore, the clp mutants and wild type were assessed fo r their ability to survive under certain stress conditions for extended periods. The stra ins were grown to mid-exponential growth phase. The dilutions were spotted in duplicate and an aerobically incubated fo r 5 days on TSBY blood 33

PAGE 34

agar plates to either 37C or 42C. In the control temperature (37 C), the wild type and clp mutants maintained similar viability counts (F igure 2-7A). However, at high temperature (42C), clpC and clpXP mutants showed a three log decreas e in viability counts compared to wild type. The decreased heat tolerance levels were significant at the P < 0.005 level (t-test). However, clpB, clpP, and clpX mutants still maintained a simila r number of colonies to wild type, although all strains did not fo rm colonies of the same size as those observed at 37C. To confirm the involvement of ClpC and ClpXP in heat resistance, we complemented the P. gingivalis mutants with a plasmid containing the appropriate clp genes. Additionally, the parent plasmid pT-COW was conjugated in to the wild type 33277 strain. This strain was used as a positive control and to ensure that the presence of plasmid does not hinder P. gingivalis heat tolerance ability. The complemented strains showed complete restoration of the wild type phenotype during the heat tolerance experiment (Figure 2-7B). To assess oxidative tolerance, P. gingivalis wild type and mutants were exposed to the final concentration of 30 mM of hydrogen peroxide. The dilutions were spotted on TSBY plates and the plates were incubated anaerobically at 37C for 5 days. The colonies were then visualized and counted. No significant differences, ( P < 0.05), were observed between wild type and clp mutants for oxygen tolerance (Figure 2-8). Discussion Clp ATPases are ubiquitously present in bact eria. The specific number and types of Clp ATPases, however, vary even between closel y related species suggesting some functional redundancy (89). In E. coli four classes of ATP-dependent proteases, ClpAP/XP, ClpYQ (HslVU), Lon and FtsH, have overlapping subs trate specificities, pe rhaps explaining why inactivation of individua l proteases causes only modest phe notypic changes under the conditions tested (114). In striking contra st, the wide range of phenotypes c onferred by inactivation of ClpP 34

PAGE 35

in the low GC Gram-positive bacteria suggest that the ClpP proteolytic proteases are the major proteases both for eliminating misfolded protei ns and for controlling the activity of central regulatory proteins in th ese organisms (89). In P. gingivalis it appears that ClpC may play a more dominant role in heat tolerance and is not compensated for by ot her Clp subunits or ATPdependent proteases. During heat stress, ClpC may be involved in gene regulation and/or protein fate of the key elements required for b acterial survival. The effect of the clpXP mutant is possibly due to a functional redundancy between ClpX and ClpP since single clpP and clpX mutation showed no differences from wild type. This finding proposes that the elimination of both genes may over-exert the Cl p stress response system. In general, other bacteria have shown a dist inct stress tolerance pr ofile among the various Clp subunits in which each Clp subunits can be asso ciated with one or more stress response. For example, stress response experiments performed on S. aureus showed that ClpB, ClpC, and ClpP are important for high-temperature survival, whil e ClpX and ClpP are susceptible to hydrogen peroxide, cold, and osmotic stresse s (92). With the exception of heat tolerance, the overall Clp system in P. gingivalis does not appear to play an impera tive role in promoting general stress tolerance due to the common lack of stress susceptibility by the clp mutations or a possible redundant system. Perhaps, the Clp system in P. gingivalis has a more exclusive function in maintaining normal protein turnover rather than by promoting stress tolerance. In addition, P. gingivalis has other proteins that functi on to resist specific stress. Previous studies suggest that DnaK and GroEL are related to temperature stress in P. gingivalis but not oxidative or pH stresses (115). Other findings suggest that FeoB 2 has a role in oxidative stress, while HtrA may play a role in both oxidativ e and temperature stress in P. gingivalis (116, 117). In addition, the stress response under the condition tested may be different in vivo. Since stress tolerance 35

PAGE 36

towards other stresses, such as pH and salt stresses were not tested in this project, these results cannot fully exclude the Cl p system involvement in P. gingivalis stress response. 36

PAGE 37

Table 2-1. Available bacterial strains Strain Source Porphyromonas gingivalis ATCC 33277 American type culture collection P. gingivalis 33277 clpB Laboratory stock P. gingivalis 33277 clpC Laboratory stock P. gingivalis 33277 clpP This project P. gingivalis 33277 clpX This project P. gingivalis 33277 clpXP This project P. gingivalis 33277 pT-COW Laboratory stock P. gingivalis 33277 clpB pT-ClpB This project P. gingivalis 33277 clpC pT-ClpC This project P. gingivalis 33277 clpP pT-ClpP This project P. gingivalis 33277 clpX pT-ClpXP This project P. gingivalis 33277 clpXP pT-ClpXP This project Escherichia coli DH5 (plasmid pT-COW) Laboratory stock E. coli TOP10 Invitrogen E. coli J53 (plasmid R751) Laboratory stock Streptococcus gordonii DL1 Laboratory stock 37

PAGE 38

Table 2-2. Oligonucleotides used in this project Primers Sequence (5 3)* Amplicon size (bp) PCR Primers clpP upstream F: TCAGTGGCAGCGGAGATG R: AACGGGCAATTTCTTTTTTGTCAT TGTCTTTACTGTGATCATATTTGTTTT 542 clpP downstream F: GTCCCTGAAAAATTTCATCCTTCGTAG CCCTCTCGTTACCCAAAG R: GCGGCCTGCAAAAGTCT 566 clpX upstream F: ACTCGCCCTTACTACATTTG R: AACGGGCAATTTCTTTTTTGTCAT GAGAAATATACAGTCCCCCTT 1024 clpX downstream F: GTCCCTGAAAAATTTCATCCTTCGTAG TAGAAGTACCCCCAAGAGAATC R: CCGGCTGGGATAGGATGTA 799 ermF F: ATGACAAAAAAGAAATTGCCCGTT R: CTACGAAGGATGAAATTTTTCAGGGAC 801 pT-ClpB(SalI) pT-ClpB(HindIII) F: CA GTCGAC AACCTTTACTTTCTTTCTTATACC R: AC AAGCTT CCATCCCTTTGCTTTCTCCTCTGT 3209 pT-ClpC(NheI) pT-ClpC(HindIII) F: CA GCTAGC ACTTTCGCATCGGTCATTAT R: AC AAGCTT GCTTTGCTTCCGTTGTCGTCT 2775 pT-ClpP/XP(NheI) pT-ClpP(HindIII) F: CA GCTAGC GCAAATGCGCAATGGTAG R: AC AAGCTT GAAATATACAGTCCCCCT 844 pT-ClpP/XP(NheI) pT-ClpXP(BamHI) F: CA GCTAGC GCAAATGCGCAATGGTAG R: AC GGATCC ACACTCCGGGTAGCAACTC 2133 RT-PCR Primers clpP-X cDNA TCTTGGGGGTACTTCTATTATTGA clpP F: AAAAATACGCGACCCGACATA R: GCCCCTGCATACCACCAA 462 clpX F: GATTGCTCCAGCAAGAGGAC R: CTCTATGCCGTCGAAAGCTC 473 Real-time PCR Primers fimA F: TTGTTGGGACTTGCTGCTCTTG R: TTCGGCTGATTTGATGGCTTCC 210 mfa1 F: TGCGGCGAAGTCGTATATG R: ATCTTCAGCACTCTCCACAAG 190 Bold sequences represent 5 extension fo r fusion PCR. Underlined sequences re present restriction enzyme sites. 38

PAGE 39

clpP clpX ermF ermF ermF ermF clpP clpX clpXP518 bp 539 bp 518 bp 1000 bp 772 bp 772 bp 801 bp clpXP clpP clpX500 bp Marker 1858 bp 2091 bp 2573 bp clpP clpXP 33277 clpX 500 bp Marker 33277 1319 bp 1801 bpA BC669 bp 1236 bp clpP clpX ermF ermF ermF ermF clpP clpX clpXP518 bp 539 bp 518 bp 1000 bp 772 bp 772 bp 801 bp clpXP clpP clpX500 bp Marker 1858 bp 2091 bp 2573 bp clpP clpXP 33277 clpX 500 bp Marker 33277 1319 bp 1801 bpA BC clpP clpX ermF ermF ermF ermF clpP clpX clpXP518 bp 539 bp 518 bp 1000 bp 772 bp 772 bp 801 bp clpXP clpP clpX500 bp Marker 1858 bp 2091 bp 2573 bp clpP clpXP 33277 clpX 500 bp Marker 33277 1319 bp 1801 bpA BC669 bp 1236 bp Figure 2-1. Mutant construction of P. gingivalis using the PCR fusion te chnique. A) Schematic illustration of the clpP clpX and clpXP gene replacement constructs with the locations of the specific primers used for PCR fusion and the product size of the upstream and downstream regions. B) Fi nal PCR fusion product size demonstrated correct product size for the genes of inte rest. These products were purified and electroporated into P. gingivalis 33277. C) P. gingivalis mutant colonies verified by PCR. The clpP and clpXP mutants were confirmed by using the upstream clpP forward primer and ermF downstream primer, while clpX mutant was confirmed with the upstream clpX forward primer and ermF downstream primer. P. gingivalis 33277 (wild type) was used as a negative control. 39

PAGE 40

clpP clpX RNA100bp Marker 500bp MarkerOperon 33277 clpP clpX clpXPclpP clpX RNA clpP clpX RNA clpP clpX RNA 1454 bp clpP = 462 bp clpX = 473 bp 45678910111213141516 321 LaneP. gingivalis clpP clpX RNA100bp Marker 500bp MarkerOperon 33277 clpP clpX clpXPclpP clpX RNA clpP clpX RNA clpP clpX RNA 1454 bp clpP = 462 bp clpX = 473 bp 45678910111213141516 321 LaneP. gingivalis Figure 2-2. RT-PCR products from P. gingivalis wild type and clp mutants. P. gingivalis wild type showed co-transcription of clpP and clpX (Lane 3) and was the positive control for the expression of these genes (Lane 4 a nd 5). All mutants showed the appropriate gene expression with the presence/absence of a ~500 bp band (Lane 7, 8, 11, 12, 14, and 15). The cDNA was synthesized using gene specific primers, then amplified to detect products. Negative controls were amplified from RNA that was not reverse transcribed (Lane 6, 9, 13, and 16). 40

PAGE 41

Figure 2-3. E. coliBacteroides shuttle vector plasmid pT-COW. The regions denoted in black function in E. coli and regions represente d in gray function in Bacteroides / Porphyromonas The gene insertion region for the clp genes is characterized on the plasmid. The tetC gene was disrupted during complementation. The restriction enzymes with one site on the plasmid are indicated. 41

PAGE 42

pT-ClpC 13030 bp ClpC region (2759) AatII (12539) Acc65I (8959) BamHI (9713) BmtI (9571) BsiWI (39) BssHII (7091) BstEII (5424) HindIII (6802) KpnI (8963) NdeI (510) NheI (9567) PsrI (3945) SacI (3612 ) SalI (9989) SfiI (1644) SgrAI (9748) Tth111I (7067) pT-ClpP 11099 bp ClpP region (828) AatII (10608) AhdI (9686) AvaI (8832) BamHI (7782) BclI (7522) BmtI (7640) BsiWI (39) BstEII (5424) Bsu36I (5662) EagI (8346) HindIII (6802) NcoI (4142) NdeI (510) NheI (7636) Nli3877I (8836) PsrI (3945) PstI (9931) PvuI (10056) SacI (3612) SalI (8058) SfiI (1644) SgrAI (7817) SphI (7973) pT-ClpB 13042 bp ClpB region (3193) AgeI (9048) BanII (3612) BclI (8270) BsiWI (39) BstEII (5424) ClaI (7291) EcoO109I (12605) HindIII (6802) MfeI (7866) MluI (7917) NcoI (4142) PsrI (3945) PssI (12608) SacI (3612) SalI (10001) pT-ClpXP 12442 bp ClpXP region (2117) AatII (11951) AhdI (11029) AvaI (10175) BamHI (9125) BclI (7116) BlpI (8610) BmtI (7006) BstEII (5424) Bsu36I (5662) EagI (9689) MluI (8429) NdeI (510) NheI (7002) Nli3877I (10179) PsrI (3945) PstI (11274) SacI (3612 ) SfiI (1644) SgrAI (9160)A B C D pT-ClpC 13030 bp ClpC region (2759) AatII (12539) Acc65I (8959) BamHI (9713) BmtI (9571) BsiWI (39) BssHII (7091) BstEII (5424) HindIII (6802) KpnI (8963) NdeI (510) NheI (9567) PsrI (3945) SacI (3612 ) SalI (9989) SfiI (1644) SgrAI (9748) Tth111I (7067) pT-ClpP 11099 bp ClpP region (828) AatII (10608) AhdI (9686) AvaI (8832) BamHI (7782) BclI (7522) BmtI (7640) BsiWI (39) BstEII (5424) Bsu36I (5662) EagI (8346) HindIII (6802) NcoI (4142) NdeI (510) NheI (7636) Nli3877I (8836) PsrI (3945) PstI (9931) PvuI (10056) SacI (3612) SalI (8058) SfiI (1644) SgrAI (7817) SphI (7973) pT-ClpB 13042 bp ClpB region (3193) AgeI (9048) BanII (3612) BclI (8270) BsiWI (39) BstEII (5424) ClaI (7291) EcoO109I (12605) HindIII (6802) MfeI (7866) MluI (7917) NcoI (4142) PsrI (3945) PssI (12608) SacI (3612) SalI (10001) pT-ClpXP 12442 bp ClpXP region (2117) AatII (11951) AhdI (11029) AvaI (10175) BamHI (9125) BclI (7116) BlpI (8610) BmtI (7006) BstEII (5424) Bsu36I (5662) EagI (9689) MluI (8429) NdeI (510) NheI (7002) Nli3877I (10179) PsrI (3945) PstI (11274) SacI (3612 ) SfiI (1644) SgrAI (9160)A B C D Figure 2-4. Complementation plasmi d of Clp. A) Plasmid pT-ClpB. B) Plasmid pT-ClpC. C) Plasmid pT-ClpP. D) Plasmid pT-ClpXP. The clp gene regions are shown in gray, flanked by the cloning restrict ion sites. The plasmid a nd gene sizes are indicated. 42

PAGE 43

N-H clpBclpCclpPclpXP M pT-COW N-B NheIHindIII M clpB S-HpT-COW S-H MABpT-COW pT-ClpBpT-ClpCpT-ClpPpT-ClpXP M c clpX c clpBc clpCc clpP c clpXP Mc clpP MCDclpB N-H clpBclpCclpPclpXP M pT-COW N-B NheIHindIII M clpB S-HpT-COW S-H MABpT-COW pT-ClpBpT-ClpCpT-ClpPpT-ClpXP M c clpX c clpBc clpCc clpP c clpXP Mc clpP MCDclpB Figure 2-5. Complement construction of P. gingivalis clp mutants using the plasmid pT-COW. A) PCR products of the clpB clpC clpP and clpXP genes and the plasmid pT-COW after the appropriate restriction enzyme digestion. N-H symbolizes double digestion by NheI and HindIII and N-B symbolizes doubl e digestion by Nhe1-BamHI. B) NheI and HindIII single digestion of the clpB gene. The additional gel shows clpB PCR product and pT-COW digestion by SalI and HindIII, denoted as S-H. C) The purified pT-COW and its derivative s isolated from several E. coli TOP10 colonies and digested by the appropriate restriction enzymes. D) P. gingivalis transconjugants were verified by P CR for the desired clp gene (top wells) and ermF gene (bottom wells). In the additional gel, primers within the clpP gene were used to visualize its presence. 43

PAGE 44

Percentage of WT Percentage of WT Percentage of WT 0.0 25.0 50.0 75.0 100.0 125.0 150.0 175.0 200.0P.g 33277 P.g clpB P.g clpC P.g clpP P.g clpX P.g clpXP P.g 33277 P.g clpB P.g clpC P.g clpP P.g clpX P.g clpXP P.g 33277 P.g clpB P.g clpC P.g clpP P.g clpX P.g clpXP 0mM 7.5mM 15mM 0 h 1 h 3 h 5 h 0.0 25.0 50.0 75.0 100.0 125.0 150.0 175.0 200.0P.g 33277 P.g clpB P.g clpC P.g clpP P.g clpX P.g clpXP P.g 33277 P.g clpB P.g clpC P.g clpP P.g clpX P.g clpXP Anaerobic Aerobic 0 h 1 h 3 h 5 h 0.0 25.0 50.0 75.0 100.0 125.0 150.0 175.0 200.0P.g 33277 P.g clpB P.g clpC P.g clpP P.g clpX P.g clpXP P.g 33277 P.g clpB P.g clpC P.g clpP P.g clpX P.g clpXP P.g 33277 P.g clpB P.g clpC P.g clpP P.g clpX P.g clpXP 4C 37C 42C 0 h 1 h 3 h 5 hA B CPercentage of WT Percentage of WT Percentage of WT 0.0 25.0 50.0 75.0 100.0 125.0 150.0 175.0 200.0P.g 33277 P.g clpB P.g clpC P.g clpP P.g clpX P.g clpXP P.g 33277 P.g clpB P.g clpC P.g clpP P.g clpX P.g clpXP P.g 33277 P.g clpB P.g clpC P.g clpP P.g clpX P.g clpXP 0mM 7.5mM 15mM 0 h 1 h 3 h 5 h 0.0 25.0 50.0 75.0 100.0 125.0 150.0 175.0 200.0P.g 33277 P.g clpB P.g clpC P.g clpP P.g clpX P.g clpXP P.g 33277 P.g clpB P.g clpC P.g clpP P.g clpX P.g clpXP Anaerobic Aerobic 0 h 1 h 3 h 5 h 0.0 25.0 50.0 75.0 100.0 125.0 150.0 175.0 200.0P.g 33277 P.g clpB P.g clpC P.g clpP P.g clpX P.g clpXP P.g 33277 P.g clpB P.g clpC P.g clpP P.g clpX P.g clpXP P.g 33277 P.g clpB P.g clpC P.g clpP P.g clpX P.g clpXP 4C 37C 42C 0 h 1 h 3 h 5 hA B C Figure 2-6. Stress tolerance of clp mutants. P. gingivalis wild type and mutants were grown to an OD600 of 1.0 and exposed to different stress conditions. The cultures were checked at 1, 3, and 5 h. A) Temperature tolerance of P. gingivalis 33277 and the clp mutants at 4C and 42C. B) Oxidative tolerance of P. gingivalis 33277 and the clp mutants at 7.5 and 15 mM of hydrogen pe roxide. C) Aerobic tolerance of P. gingivalis 33277 and the clp mutants. Data is presented as percentage of wild type for each time period. 44

PAGE 45

P. gingivalisCFU* 1.0E+00 1.0E+01 1.0E+02 1.0E+03 1.0E+04 1.0E+05 1.0E+06 1.0E+07 1.0E+08 1.0E+09 1.0E+10 33277 clpB clpC clpP clpX clpXP 37C 42CA BCFUP. gingivalis 1.0E+00 1.0E+01 1.0E+02 1.0E+03 1.0E+04 1.0E+05 1.0E+06 1.0E+07 1.0E+08 1.0E+09 1.0E+10 33277 pT-COW clpC pT-ClpC clpXP pT-ClpXP 37C 42CP. gingivalisCFU* 1.0E+00 1.0E+01 1.0E+02 1.0E+03 1.0E+04 1.0E+05 1.0E+06 1.0E+07 1.0E+08 1.0E+09 1.0E+10 33277 clpB clpC clpP clpX clpXP 37C 42CA BCFUP. gingivalis 1.0E+00 1.0E+01 1.0E+02 1.0E+03 1.0E+04 1.0E+05 1.0E+06 1.0E+07 1.0E+08 1.0E+09 1.0E+10 33277 pT-COW clpC pT-ClpC clpXP pT-ClpXP 37C 42C Figure 2-7. Heat tolerance of clp mutants. P. gingivalis wild type and mutants were grown to an OD600 of 1.0, diluted, and spotted on TSBY plates. The plates were incubated anaerobically at either control temperature (37C) or a higher temperature (42C) for 5 days. The colony forming units (CFU) were then determined. A) Heat tolerance of P. gingivalis 33277 and the clp mutants. Asterisks indica te a significant difference ( P < 0.005) between the mutant and wild type strains. B) Heat tolerance of the complemented clp mutants. As a positive control, P. gingivalis 33277 containing parental pT-COW was utilized. 45

PAGE 46

1.0E+00 1.0E+01 1.0E+02 1.0E+03 1.0E+04 1.0E+05 1.0E+06 1.0E+07 1.0E+08 1.0E+09 1.0E+10 33277 clpB clpC clpP clpX clpXP 0 mM 30 mMP. gingivalisCFU 1.0E+00 1.0E+01 1.0E+02 1.0E+03 1.0E+04 1.0E+05 1.0E+06 1.0E+07 1.0E+08 1.0E+09 1.0E+10 33277 clpB clpC clpP clpX clpXP 0 mM 30 mMP. gingivalisCFU Figure 2-8. Oxidative tolerance of clp mutants. P. gingivalis w ild type and mutants were grown to an OD600 of 1.0, diluted, and hydrogen pero xide was added to the dilutions to a final concentration of 30 mM. The diluti ons were spotted on TSBY plates and the plates were incubated anaerobically at 37 C for 5 days. The colony forming units (CFU) were then determined 46

PAGE 47

CHAPTER 3 ROLE OF CLP SYSTEM IN P. gingivalis BIOFILM FORMATION Introduction Biofilm development is a series of complex but discrete and wellregulated steps. The exact molecular mechanisms differ from organi sm to organism, but the stages of biofilm development are similar across a wide range of microorganisms (118). The sequential stages of biofilm development are: 1) microbial attach ment to the surface; 2) adhesion, growth, and aggregation of cells into micr ocolonies; and 3) maturation and dissemination of progeny cells for new colony formation. Direct contact of the mi croorganism with the su rface is required for attachment and subsequent colonization. The mere "touch" of the cell wall with the surface can alter the microorganisms gene expression profile and phenotype as well as induce the expression of adhesins (119). The continued formation of the biofilm commu nity evolves according to the biochemical and hydrodynamic conditions, as well as the av ailability of nutrients in the immediate environment (119). The structural organizati on is mainly influenced by regulatory signals produced by the biofilm cells themselves in r eaction to growth conditi ons. This interactive network of signals allows for communicati on among the cells, not only controlling colony formation but also regulating gr owth rate, species in teractions, toxin prod uction, and invasive properties (120). The cel l clusters are structurally and me tabolically heterogeneous, and both aerobic and anaerobic processes occur simultaneously in different parts of the multicellular community. Expanded growth can evolve into co mplex 3-D structures of towerand mushroomshaped cell clusters. Adjoining microcolonies can be connected by water channels that are thought to serve as a primitive circulatory system fo r delivery of nutrients and removal of wastes. 47

PAGE 48

The thickness of the biofilm is variable and uneven, as determined by the balance between growth of the biofilm and detachment of cells (1 21). The formation of biofilm is a universal strategy for microbial survival. In order to colonize new surfaces and to prevent densitymediated starvation within the mature biofilm, th e cells must detach and disseminate. Dispersal is accomplished by shedding, detachment, or shear ing. Shedding occurs when daughter cells from actively growing bacteria in the upper regions of the microcolonies are released from the cell clusters. Increased cell density induces cell-ce ll signaling to direct chemical degradation of the extracellular polymeric subs tances, sending clumps or fragments of detached biofilm to accumulate in other areas, while leaving behind an adherent layer of cells on the surface to regenerate the biofilm (122, 123). Furthermore, cells may produce biofilms as a mechanism for concentrating cells and attaching to surfaces, as a protective barrier, and as a reserve for nutrient supply. Biofilms can be induced by nonphysiological extremes of pH and temperature, by high concentrations of metals, and by addi tion of antibiotics or oxygen (124). In periodontal disease, the b acterial balance in subgingival biofilm shifts from a Grampositive aerobic poulation over to a Gram-nega tive anaerobic population (4). Accordingly, biofilm formation is an important pathogenic attribute of P. gingivalis While forming biofilm in the oral cavity, P. gingivalis is exposed to many stress conditions. Moreover in other organisms, the Clp proteins are important in biofilm fo rmation, although, the func tion of specific Clp subunits may change between organisms. Inte restingly, the absence of ClpX or ClpC in S. aureus reduced monospecies biofilm formation, whereas it was enhanced in the absence of ClpP (92). However, a clpP mutant strain showed a reduced capacity to form monospecies biofilms in S. mutans (125). The Clp stress response system may therefore be necessary for survival during biofilm formation of P. gingivalis On the tooth surfaces, P. gingivalis are in contact with the 48

PAGE 49

diverse species that comprise the plaque biofilm. Thus, this study assessed the role of clp mutants in both homotypic and he terotypic biofilm, containing S. gordonii Materials and Methods Bacterial Strains and Culture Conditions Available bacterial strains are listed in Table 2-1. Porphyromonas gingivalis ATCC 33277 and its derivatives were cultured as descri bed in Chapter 2 Materials and Methods. S. gordonii DL1 was cultured under static conditions in Todd Hewitt Broth (THB). Microtiter Plate Monobiofilm Production Assay Homotypic biofilm formation was tested in the microtiter plate assay of OToole and Kolter (8). The overnight cultures of parent al and mutant strains were centrifuged and resuspended in pre-reduced phosphate-buffered sa line (PBS). Three repl icates of 100 l of P. gingivalis/ PBS suspension (2 x 10 8 CFU/well) were inoculated into a 96-well microtiter plate (Costar), and the plate was incubated at 37C fo r 24 h in an anaerobic chamber. After a 24 h incubation period, PBS was removed from the we lls and microtiter plate wells were washed three times with PBS to remove loosely asso ciated bacteria. Wells were stained with 50 l of 1% crystal violet solution in water for 15 min. Af ter staining, plates were washed with sterile distilled water three times. Quantitative anal ysis of biofilm production was performed by adding 50 l of 95% ethanol to destain the wells. The leve l (OD) of the crystal violet present in the destaining solution was measured at OD 595 nm on a Benchmark microplate reader (Bio-Rad Laboratories). The average background OD was subtracted from the OD of all sample wells. Microscopic Monobiofilm Formation Assay Homotypic biofilms were also examined by confocal microscopy. P. gingivalis were stained with 5-(and-6)-carboxyf luorescein succinimidyl ester (FITC; 4 g/ml; Molecular Probes). 200 l of FITC stained P. gingivalis/ PBS suspension (5 x 10 7 CFU/well) was 49

PAGE 50

inoculated into a 16-well Culture Well TM chambered coverglass system, and the chamber was incubated at 37C for 24 h with lig ht shielding on a rotating platfo rm in an anaerobic chamber. The supernatant was carefully exchanged with fr esh PBS. The biofilms that developed on the coverglass bottom were observed by c onfocal scanning laser microscopy. Microscopic Mixed Biofilm Formation Assay S. gordonii strains were stained with hexidium i odide (HI; 15 g/ml; Molecular Probes), and P. gingivalis was dyed with 5-(and-6)-carbo xyfluorescein succinimidyl ester (FITC; 4 g/ml; Molecular Probes). 100 l of HI stained S. gordonii (2 x 10 7 CFU/well) suspended in a modified chemically defined medium (mCDMT) was inoculated into a 16-well Culture Well TM chambered coverglass system (126). The chamber was incubated at 37C for 24 h with light shielding on a rotating platform in an anaerobic chamber. The supernatant was carefully removed and 100 l of FITC stained P. gingivalis/ PBS suspension (2 x 10 6 CFU/well) was added. The chamber was further incubated unde r the same conditions for 24 h then the supernatant was exchanged with fresh PBS. The biofilms that developed on the coverglass bottom were observed by confo cal scanning laser microscopy. Imaging and Analysis of Microscopic Biofilms The biofilms were examined with a Bio-Rad MRC600 confocal scanning laser microscope (Kr/Ar) system with MS plan 60 x 1.4 NA objective. Biofilms were observed with reflected laser light of combined 488, 546 and 647 nm wave lengths. A series of fluorescent optical x-y sections were collected to create digitally reconstructed images ( x-z section; and z -projection of x-y sections) with Image J 1.35c (National In stitutes of Health) and Adobe Photoshop 6.0 software. The total P. gingivalis fluorescent accumulations in optical sections through the biofilms by using the total grain ar ea analysis were quantitatively determined with Image J 1.35c 50

PAGE 51

using the area calculator plugin. The average he ight of the biofilms wa s also determined by Image J. Statistical Analysis Statistical analysis determined the mean, st andard deviation, and the significant difference between the mutant and pare ntal strains by Students t -tests and ANOVA software. Results The Absence of ClpC or ClpXP Enhan ces Monospecies Biofilm Formation Homotypic biofilm formation of P. gingivalis clp mutants were first tested in the microtiter plate assay. The monospecies biofi lm formation was enhanced in the clpC and clpXP mutants to 129.3% and 137.4% after 24 h compared to the parent al strain (Figure 3-1). Biofilm formation, observed by confocal micr oscopy, showed that the clpC and clpXP mutant were visibly denser than that of the parent. Total accumulation was increased to 279.4% and 355.5% (Figure 3-2A and B). During biofilm formation it is noticeable that the clpXP mutant appear s to generate extra microcolonies as well as enhancing the rigidity of the vertical stru cture with little dissemination of cells. The other biofilms however, appear plia ble with a substantial am ount of dispersion. In addition, the average height of the x-z sections of the clpC clpP and clpXP mutants biofilm was enlarged by 119.3%, 120.9% and 123.5% compared to the parent (Figure 3-2C). The complemented P. gingivalis clpC and clpXP mutants were examined in order to confirm the involvement of ClpC and ClpXP in the increased biofilm phenotype. Additionally, the wild type containing pT-COW was utilized as a positive c ontrol and to ensure that the presence of plasmid does not hinder P. gingivalis biofilm formation efficiency. Complementation restored the biofilm phenotype to parental level and pT-COW demonstrated no adverse effect on biofilm formation (Figure 3-3) Hence, in the absence of ClpC and ClpXP 51

PAGE 52

more luxuriant phonotypic biofilms are formed by P. gingivalis In addition, as described above, ClpC and ClpXP were also important for heat tolerance. ClpXP Deficiency Increases P. gingivalis Accumulation in Mixed Biofilm S. gordonii is a common component of dental plaque and will be encountered by P. gingivalis upon initial colonization. S. gordonii cells were cultured for 24h on chambered coverglass and stained with hexidium iodide. P. gingivalis cells were stained with FITC as before and reacted anaerobically with the S. gordonii biofilm for 24 h and 37 C in pre-reduced PBS. After washing, accumulations of heterotypic biofilms were observed by confocal microscopy as described above. Similar to the monobiofilm, the clpXP mutant formed more abundant accumulations within the mixed P. gingivalisS. gordonii biofilm (Figure 3-4A). This observation was supported by the total grain analysis of P. gingivalis accumulation increasing by 174.2% compared to wild type (Figure 3-4B). The increased biofilm formation levels were significant at the P < 0.05 level (t-test). However, measur ement of average biofilm height across x-z sections showed no increase in the vertical accretion of any clp mutants compared to the parental strain (Figure 3-4C). To verify the involvement of the clpXP gene in the enhanced mixed biofilm phenotype, we examined the complemented P. gingivalis clpXP mutant. Additionally, the wild type strain with the parent plasmid pT-COW was utilized as a pos itive control and to ensure that the presence of plasmid does not hinder P. gingivalis mixed biofilm formation. Similar to the monospecies biofilm, the presence of plasmid does not impede P. gingivalis mixed biofilm formation and the complemented strain showed a restoration of th e phenotype to wild type level (Figure 3-5). Therefore, in the absence of ClpXP more copious monospecies and multispecies biofilms are formed by P. gingivalis 52

PAGE 53

Discussion Biofilm accumulation proceeds through a se ries of developmental steps involving attachment of bacterial cells to a surface, accumulation by recruitment of additional cells and by proliferation, and, in certain cases, inclusion of additional species. Defined genetic profiles are considered important for distinct phases of biofilm development (127, 128). Regulation of biofilm development can be hypothesized to involve mechanisms that both stimulate an increase in biomass and also limit or stabilize accumulatio n according to environmental constraints. For example, In P. aeruginosa, biofilm depth is reduced by the transcription factor RpoS and rpoS mutants of P. aeruginosa form biofilms of greater depth under flowing conditions (129, 130). RpoS production is regulated at multiple leve ls, including transcription, translation and proteolysis, in response to diffe rent stress conditions including nutrient limitation (131). There are several proteins that are known to be involved in P. gingivalis single and multispecie biofilm, such as InlJ and LuxS (132, 133). InlJ has been shown to play a nuan ced role in regulating biofilm accumulations of P. gingivalis (132) This work demonstrated that inactivation of inlJ reduced monospecies biofilm formation by P. gingivalis In contrast, heterotypic P. gingivalis Streptococcus gordonii biofilm formation was enhanced in the InlJ-deficient mutant. Furthermore, LuxS-dependent interc ellular communication is essential for biofilm formation between P. gingivalis and S. gordonii (133). The results of the current study indicate th at both the ClpC and ClpXP proteins of P. gingivalis are exploited to regulate biofilm accumulation on abiotic surfaces. The clpC and clpXP mutants displayed an increase in both accumulation and average height of the monospecies biofilm. Although the basis for th is phenotype is unknown, we can speculate that ClpC and ClpXP may act by controlling the stability or activity of transcriptional regulators and other factors of biofilm maturation. These regula tors or factors may be identified by proteomic 53

PAGE 54

or microarray studies. Another possibility, associated with the heat resist ant role of these two Clp proteins, may be that tolerance to nutrient limitation or accumulation of metabolites resulting from mass transport limitations in biofilms may re quire a functional ClpC and ClpXP for protein turnover. The linkage of stress tolerance with biofilm formation is important for impending investigations. In S. aureus cells lacking ClpP are hypersensi tive to heat, cold, oxidative, and salt stress (92, 101). Moreover, the absence of ClpP enhanced biofilm formation, whereas it was reduced in the absence of ClpX or ClpC (92). Finally, the ClpXP proteolytic complex seems to play a direct role in controlling the virulence regulation of S. aureus which may also be occurring in P. gingivalis (101, 102). In addition, the enhanced biofilms of the clpC and clpXP mutants may result in less susceptibility to sheer forces, and therefore, prevent the dispersal of biofilm cells to other areas. Furthermore, only the ClpXP protein is involved in biofilm control in the more complex and in vivo relevant situation wher e other organisms are present. P. gingivalis attaches to the plaque commensal S. gordonii and this co-adhesion event leads to the development of P. gingivalis biofilms (32). Binding of these organisms is multimodal, involving both the P. gingivalis major fimbrial FimA protein and the species-specific interaction of the minor fimbrial Mfa1 protein with the streptococcal SspB protein. ClpXP enhanced P. gingivalis accumulation in the mixed species biofilm; however, it had no effect on the average height of the mixed biofilm. Therefore, this re sult suggests that ClpXP is promoting interaction with S. gordonii but S. gordonii seems to be responsible for controlling th e biofilm height. Fu rthermore, ClpXP may be important in constraining biofilm growth of P. gingivalis possibly to avoid excessive exposure to oxygen in the oral cav ity. As a strict anaerobe, P. gingivalis is likely to favor an existence deep within the plaque biofilm. Alte rnatively, control of biofilm development may be 54

PAGE 55

important to maintain the integrity of channels that allow nutrient penetration into the biofilm. Furthermore, these experiments represent the early stages of biofilm formation; therefore, the mutants biofilm phenotypes may be different in later time points of biofilm growth. 55

PAGE 56

OD 595 nmP. gingivalis* *APercentage of 33277 pT-COWP. gingivalis B 0.00 0.05 0.10 0.15 0.20 0.25 0.30 0.35 0.40 0.45 0.50 33277 clpB clpC clpP clpX clpXP 0.0 20.0 40.0 60.0 80.0 100.0 120.0 140.0 160.0 33277 pT-COW clpC pT-ClpC clpXP pT-ClpXPOD 595 nmP. gingivalis* *APercentage of 33277 pT-COWP. gingivalis B 0.00 0.05 0.10 0.15 0.20 0.25 0.30 0.35 0.40 0.45 0.50 33277 clpB clpC clpP clpX clpXP 0.0 20.0 40.0 60.0 80.0 100.0 120.0 140.0 160.0 33277 pT-COW clpC pT-ClpC clpXP pT-ClpXP Figure 3-1. Microtiter plate monospeci es biofilm production by P. gingivalis clp mutants. P. gingivalis biofilms were stained with 1% crystal violet. A) Biofilms of P. gingivalis 33277 and the clp mutants at 24 h. Asterisks in dicate a significant difference ( P < 0.05) between the mutant and parental strains. B) Biofilms of P. gingivalis 33277 pT-COW, and complemented clpC and clpXP mutants. 56

PAGE 57

y z 33277 clpB clpC clpX clpXP clpP y z x x x A y z 33277 clpB clpC clpX clpXP clpP y z x x x AP. gingivalis P. gingivalisTotal Grain Area (m2) BiofilmHeight (m)* 0 20000 40000 60000 80000 100000 120000 140000 160000 180000 33277 clpB clpC clpP clpX clpXP 0.0 0.5 1.0 1.5 2.0 2.5 3.0 33277 clpB clpC clpP clpX clpXPBC*P. gingivalis P. gingivalisTotal Grain Area (m2) BiofilmHeight (m)* 0 20000 40000 60000 80000 100000 120000 140000 160000 180000 33277 clpB clpC clpP clpX clpXP 0.0 0.5 1.0 1.5 2.0 2.5 3.0 33277 clpB clpC clpP clpX clpXPBC* Figure 3-2. Microscopic monos pecies biofilm production of P. gingivalis clp mutants. A) Confocal laser scanning microscopy projecti ons of monospecies biofilm formation by P. gingivalis strains 33277 and the clp mutants after 24 h. P. gingivalis was prestained with FITC (green). Magnificati on 40X. B) Total grain area analysis of a 268.6by 268.6-m x-y section. C) Average biofilm height of P. gingivalis accumulation across three random x-z sections. Asterisks indicate a significant difference ( P < 0.05) between the mutant and wild type strains. 57

PAGE 58

A BPercentage of 33277 pT-COWP. gingivalisPercentage of 33277 pT-COWP. gingivalis 0.0 20.0 40.0 60.0 80.0 100.0 120.0 140.0 160.0 33277 pT-COW clpC pT-ClpC clpXP pT-ClpXP 0.0 20.0 40.0 60.0 80.0 100.0 120.0 140.0 160.0 33277 pT-COW clpC pT-ClpC clpXP pT-ClpXPA BPercentage of 33277 pT-COWP. gingivalisPercentage of 33277 pT-COWP. gingivalis 0.0 20.0 40.0 60.0 80.0 100.0 120.0 140.0 160.0 33277 pT-COW clpC pT-ClpC clpXP pT-ClpXP 0.0 20.0 40.0 60.0 80.0 100.0 120.0 140.0 160.0 33277 pT-COW clpC pT-ClpC clpXP pT-ClpXP Figure 3-3. Monospecies biofilm production of P. gingivalis clpC and clpXP complemented mutants. Analysis by confocal laser s canning microscopy of monospecies biofilm formation by P. gingivalis strains 33277 pT-COW, and complemented clpC and clpXP mutants after 24 h. A) Total grai n area analysis of a 268.6by 268.6-m x-y section. B) Average biofilm height of P. gingivalis accumulation across three random x-z sections. Data is presented as pe rcentage of 33277 pT-COW compared to mutants. 58

PAGE 59

y z 33277 y z x x x clpB clpC clpX clpXP clpP A y z 33277 y z x x x clpB clpC clpX clpXP clpP ATotal Grain Area (m2)P. gingivalisBiofilmHeight (m)P. gingivalis* 0 2000 4000 6000 8000 10000 12000 14000 33277 clpB clpC clpP clpX clpXP 0.0 0.5 1.0 1.5 2.0 2.5 3.0 3.5 33277 clpB clpC clpP clpX clpXPBCTotal Grain Area (m2)P. gingivalisBiofilmHeight (m)P. gingivalis* 0 2000 4000 6000 8000 10000 12000 14000 33277 clpB clpC clpP clpX clpXP 0.0 0.5 1.0 1.5 2.0 2.5 3.0 3.5 33277 clpB clpC clpP clpX clpXPBC Figure 3-4. Microscopic mixed species biofilm production of P. gingivalis clp mutants. A) Confocal laser scanning microscopy projections of mixed biofilms of S. gordonii DL1 with P. gingivalis strains 33277 and the clp mutants after 24 h. S. gordonii was prestained with hexidium iodide (red), and P. gingivalis was prestained with FITC (green). Magnification 40X. B) Total gr ain area analysis of a 268.6x 268.6-m x-y section. C) Average biofilm height of P. gingivalis accumulation across three random x-z sections. Asterisks indicat e a significant difference (P < 0.05) between the mutant and wild type strains. 59

PAGE 60

A B P. gingivalis P. gingivalisPercentage of 33277 pT-COW Percentage of 33277 pT-COW 0.0 20.0 40.0 60.0 80.0 100.0 120.0 140.0 160.0 33277 pT-COW clpXP pT-ClpXP 0.0 20.0 40.0 60.0 80.0 100.0 120.0 140.0 160.0 33277 pT-COW clpXP pT-ClpXPA B P. gingivalis P. gingivalisPercentage of 33277 pT-COW Percentage of 33277 pT-COW 0.0 20.0 40.0 60.0 80.0 100.0 120.0 140.0 160.0 33277 pT-COW clpXP pT-ClpXP 0.0 20.0 40.0 60.0 80.0 100.0 120.0 140.0 160.0 33277 pT-COW clpXP pT-ClpXP Figure 3-5. Mixed spec ies biofilm production of P. gingivalis clpXP complemented mutant. Analysis by confocal laser scanni ng microscopy of mixed biofilms of S. gordonii DL1 with P. gingivalis strains 33277 pT-COW, and complemented clpXP mutants after 24 h. A) Total grain area analysis of a 268.6x 268.6-m x-y section. B) Average biofilm height of P. gingivalis accumulation across three random x-z sections. Data is presented as percen tage of 33277 pT-COW compared to mutants. 60

PAGE 61

CHAPTER 4 ROLE OF CLP SYSTEM IN P. gingivalis EPITHELIAL CELL INVASION Introduction The Clp proteases are required for cell invasi on of several pathogenic bacteria. There are several potential roles of ATP-dependent proteas es during pathogenesis; however, there are few examples where it is precisely understood how the Clp protease system helps the bacterium infect or survive within the host (83). For th e most part, it is hypothe sized that in the host bacterial proteins are denatured or damaged and need to be remove d in order to prevent toxicity to the organism. In several cases, we know that proteases degrade transcription factors that regulate virulence gene expressi on. However, it is not known whether gene regulation is the only reason why these proteases ar e needed to cause disease. P. gingivalis possesses a sophisticated array of virulence factors, including those that allow the orga nism to adhere to and invade host epithelial ce lls (4). Invasion is accomplishe d through manipulati on of host signal transduction and remodeling of cytoskeletal architecture. Moreover, P. gingivalis localizes to the perinuclear region, where it remains viable a nd blocks apoptosis of th e infected cell (76). The molecular mechanisms used by P. gingivalis to facilitate internalization and intracellular survival are not fully understood. Because the Clp proteins were originally r ecovered extracellularly in the presence of gingival epithelial cell co mponents, we hypothesized that the Clp subunits may perhaps play a role in the invasion process of P. gingivalis (134). The potential re lationship between the Clp subunits and P. gingivalis invasion has not been previously examined. Moreover, this project explores the role of the Clp sy stem in the various stages of P. gingivalis epithelial cell invasion, including adherence, entry, and intracellular survival. 61

PAGE 62

Materials and Methods Bacterial Strains and Culture Conditions Available bacterial strains ar e listed in Table 2-1. P. gingivalis ATCC 33277 and its derivatives were cultured as described in Chapter 2 Materials and Methods. Culture of Primary Gingival Epithelial Cells Primary cultures of gingival epithelical cells were generated in our laboratory as described previously (40). Briefly, hea lthy gingival tissue wa s obtained from patients undergoing surgery for removal of impacted third molars. Specimens were cut into small pieces and incubated with 0.4% dispase overnight at room temperature. The surface epithelium was separated and placed in sterile PBS containing 0.05% trypsin and 0.53 mM EDTA to dissociat e the intact epithelium into single-cell su spensions. The cells were cultured as a monolayer in serum-free Keratinocyte Growth Medium (KGM) (Clonetics) at 37C in 5% CO 2 /95% air. For interaction with bacteria, cells were trypsinized and seeded in Culture Well TM chambered coverglass system (Grace Bio Labs) or 12-well plate at a density of 2 x 10 4 or 2 x 10 5 cells per well respectively. Cells from multiple donors were used at passage 4-6 and were exposed to bacteria at ~80% confluence for invasion experiments or ~90% conf luence for adherence experiments. Adherence Assay Adherence of P. gingivalis strains to gingival epithelial cells was detected by a modified ELISA. Briefly, gingival epithelial cells cultivated on 96-well plates were fixed with 5% buffered formalin, to prevent P. gingivalis invasion, and reacted with P. gingivalis strains at a multiplicity of infection (MOI) of 100. After incubation for 30 min at 37C, the cells were washed five times with PBS to remove nonadhe rent bacteria. Surface bacteria were then immunolabeled with P. gingivalis whole-cell antibodies (1:1,000) and horseradish peroxidase (HRP) conjugated goat anti-rabbit immunoglobulin G (IgG) (ICNBiochemicals, CostaMesa, 62

PAGE 63

CA,USA). Adherence of each strain was dete rmined by a colorimetric reaction using the 3,3,5,5-tetramethylbenzidine (TMB) liquid subs trate system for ELISA (Sigma, St. Louis, MO,USA).Wells with uninfected gingival epithelial cells were used as a negative control. Cell Invasion Assay of Primary Gingival Epithelial Cell Using Immunofluorescence Microscopy Gingival epithelial cell s were cultivated on 4-well chambered coverglass system (Lab-Tek) for 24 h and then exposed to P. gingivalis strains at a multiplicity of infection (MOI) of 100 at 37C in 5% CO 2 for 30 min and 2 h. Controls for nonspecific antibody staining include the parallel processing of non-infected epithelial cells. The cells were washed three times with KGM medium without supplements to remove nona dherent bacteria. Cells were fixed with 4% paraformaldehyde (PFA) for 20 min, washed with PBS, and blocked overn ight at 4C in 10% normal goat serum in PBS to mask nonspecific bi nding sites prior to the fluorescence labeling. The cells were permeabilized for 20 min at room temperature (RT) with 10% normal goat serum and 0.2% saponin in PBS. Then, the samples we re incubated with rabbit polyclonal antibody to P. gingivalis 33277 at 1:500 for 2 h at room temperatur e. Samples were washed, blocked and permeabilized again. Afterwards, the samples were incubated in fluorescein (FITC) conjugated Affini-Pure F(ab') 2 fragment goat anti-rabbit IgG (H+L) (Jackson ImmunoReasearch Laboratories) at 1:500 for 2 h at RT. The actin microfilaments of the epithelial cells were stained with TRITC-phalloidin (Sigma) at 1:200 for 15 min at room temperature in order to highlight the outline of the cells and allow determination of intracellular P. gingivalis. The slides were then rinsed in PBS and visualizati on of intracellular bacteria wa s performed by indirect IF microscopy. 63

PAGE 64

Imaging and Analysis of Microscopic Invasion The images were acquired on a Bio-Rad MRC600 confocal scanning laser microscope (Kr/Ar) system with MS plan 60 x 1.4 NA objective. The sample s were observed with reflected laser light of combined 488, 546 and 647 nm wave lengths. A series of fluorescent optical x-y sections were collected to create digitally reconstructed images (x-z section; and z-projection of x-y sections) with Image J 1.35c and A dobe Photoshop 6.0 software. The total P. gingivalis fluorescent accumulations in optical sections thr ough the cells and in the stack of z-projections representing whole cells by usi ng the total grain area analysis were quantitatively determined with Image J 1.35c using th e area calculator plugin. Intracellular Survival by An tibiotic Protection Assay Gingival epithelial cell s were cultivated on 6-well cell cu lture plates (Corning) for 24 h and then exposed to P. gingivalis strains at a multiplicity of inf ection (MOI) of 100 at 37C in 5% CO 2 for 2 h. The MOI and viabililty were confir med by plating bacteria on TSB plates. Infected gingival epithelial cells were in cubated with metronidazole (200 g/ml) and gentamicin (300 g/ml) for one hour to kill extrac ellular bacteria, and lysed with sterile, distilled water for 15 min. The intracellular P. gingivalis released by cell lysis are e numerated by viable counting on TSB plates. Results All Clp Mutants Adhere Normally to Gingival Epithelial Cells, but Internalization of ClpC, ClpP, ClpX, and ClpXP Mutants are Reduced Adherence to gingival epithelial cells was measured in an ELISA format with formalin fixed gingival epithelial cells. Invasion of gingival epithileal cells was determined by confocal scanning laser microscopy and qua ntitative image analysis. All clp mutants adhered to gingival epithelial cells to the same level as wild type (Figure 4-1). The negative control, fimA mutant, 64

PAGE 65

adherence was consistent with previous reports. However, the invasion of gingival epithelial cells by clpC and clpXP mutants showed a reduction of 46.5% and 59.3% respectively compared to wild type at 30 min, as well as a decrease of 82.2% and 84.7% at 2 h (Figure 4-2 A and B). The clpX mutant showed a 49.7% and 74.9% reduction at 30 min and 2 h compared to wild type. The clpP mutant demonstrated a 49.1% and 55.6% decr ease in invasion compared to wild type at 30 min and 2 h. Interestingly, the clpB mutant displayed an e quivalent invasion capacity compared to wild type at the 30 min time course and still maintained a relatively similar invasion aptitude at 2 h. Furthermore, the microscopy projections of gingival epithe lial cells infected with P. gingivalis strains 33277 and the clp mutants at 2 h are shown in Figure 4-3. To confirm the involvement of the Clp subun its in the reduced i nvasion phenotype, we examined the complemented P. gingivalis mutants. Additionally, the wild type strain with the parent plasmid pT-COW was used as positive cont rols for invasion. As shown in a previous study, the presence of plasmid impeded P. gingivalis invasion efficiency ( 67). Nonetheless, the complemented strain showed a restoration of th e invasion phenotype to wi ld type containing the pT-COW level (Figure 4-4 A and B). The comple mented strains were significantly improvement in invasion over the mutants. Therefore, the clpC and clpXP genes are important for P. gingivalis invasion of gingival epithelial cells. As the mutants adhere normally to gingival epithelial cells, the defect in invasion occurs dur ing the entry or intracellular survival steps. All Clp Mutants Exhibit Decrease in Intracellular Survival An intercellular lifestyle produces a stressful environment for the organism. A direct measure of intracellular survival of P. gingivalis is provided by the antibiotic protection assay. Primary gingival epithelial cells were infected with P. gingivalis for two hours and afterward treated with antibiotics that killed only extrace llular bacteria. The epithelial cells were then lysed and the bacteria diluted and plated. All of the clp mutants exhibit a significant (P < 0.005) 65

PAGE 66

decrease in intracellular survival compared to parental level (4.5 %) (Figure 4-5A). Additionally, the complemented mutants successfully restored the invasion phenotype to the wild type with pT-COW level (Figure 4-5B). Therefore, the Clp stress response system is essential for intracellular survival of P. gingivalis in gingival epithelial cells based on these results. Discussion Our data show that Clp proteolytic comp lex and the Clp ATPases control several key processes of importance to the success of P. gingivalis as a pathogen. In P. gingivalis, the clpC, clpX, and clpP genes were found to be necessary for entr y and intracellular survival. Similarly, Zhang et al. (79) showed that the insertional inactivation of clpP resulted in approximately a 50% reduction in invasion of P. gingivalis. Likewise, the ClpC ATPase is required for cell adhesion and invasion of L. monocytogenes (104). Furthermore, intracellular Salmonella requires the ClpXP protease to degr ade FlhD and FlhC, a master regul ator of flagellum synthesis, in order to survive within the macrophages (135). However, ClpB seems to play no role in the entrance of P. gingivalis in epithelial cells, but is important for intracellular survival. Similarly, S. aureus cells lacking the ClpB chaperone are unable to replicate intracellularly in bovine cells (92). During the infection process, pathogen s face various stress conditions, including temperature shifts, pH changes, nutritional star vation and exposure to reactive oxygen species. In addition, regulated proteolysi s is required for normal protein tu rnover and the loss of regulated proteolysis of these enzymes could alter the bi ochemical profile of a bacterium, changing its ability to survive and grow in a host (83). However, does the imperative and apparently conserved roles of the Clp proteins in virulence result as a consequence of their involvement in handling stress or do they reflect a more direct function in regulati ng virulence factors? Our data did not support a uniform relations hip between reduced stress survival and reduced virulence. P. 66

PAGE 67

gingivalis expresses a number of pote ntial invasion effectors, such as gingipains, major and minor fimbriae, and SerB653, which may c ontribute to the various stages of P. gingivalis pathogenesis (4, 9, 13, 55, 67, 70, 136, 137). The next chapter examined how inactivation of the Clp proteins may affect the expression of P. gingivalis virulence factors that comprise a large repertoire of extracellular and cell surface-associated proteins. 67

PAGE 68

OD 655 nmP. gingivalis* 0.0 0.5 1.0 1.5 2.0 2.5 33277 clpB clpC clpP clpX clpXP fimAOD 655 nmP. gingivalis* 0.0 0.5 1.0 1.5 2.0 2.5 33277 clpB clpC clpP clpX clpXP fimA Figure 4-1. P. gingivalis clp mutants adherence to primary gingival epithelial cells. Adherence assay to formalin-fixed gingival epithelial cells compared the efficiency between the wild type and the clp mutants. A P. gingivalis 33277 fimbria(fimA) deficient mutant was used as a control for reduced adhere nce. Asterisks indicate a significant difference (P < 0.005) compared to wild type. 68

PAGE 69

Total Grain Area (m2)P. gingivalisTotal Grain Area (m2)P. gingivalis * * A B 0 5000 10000 15000 20000 25000 30000 35000 40000 45000 50000 33277 clpB clpC clpP clpX clpXP 0 50000 100000 150000 200000 250000 300000 33277 clpB clpC clpP clpX clpXPTotal Grain Area (m2)P. gingivalisTotal Grain Area (m2)P. gingivalis * * A B 0 5000 10000 15000 20000 25000 30000 35000 40000 45000 50000 33277 clpB clpC clpP clpX clpXP 0 50000 100000 150000 200000 250000 300000 33277 clpB clpC clpP clpX clpXP Figure 4-2. P. gingivalis clp mutants invasion of primary gingiva l epithelial cells. Total grain area analysis of P. gingivalis fluorescence accumulation within primary gingival epithelial cells infected at a MOI of 100. These analyses were obtained by immunofluorescence microscopy of epithelial cells staine d with TRITC-phalloidin, and antibody to P. gingivalis. A) Invasion of gingival epithelial cells with P. gingivalis 33277 and clp mutants for 30 min. B) Invasi on of gingival epithelial cells with P. gingivalis 33277 and clp mutants for 2 h. The graph shows the invasion percentage versus wild type. Asteri sks indicate a signi ficant difference of P < 0.05 between the mutant and wild type strains. 69

PAGE 70

CTRL WT ClpB ClpC ClpP ClpX ClpXP CTRL WT ClpB ClpC ClpP ClpX ClpXP Figure 4-3. Microscopi c invasion of primary gi ngival epithelial cells by P. gingivalis. Confocal laser scanning microscopy projections of gingival epitheli al cells infected with P. gingivalis strains 33277 and the clp mutants at MOI of 100 for 2 h. Magnification 40X. The slides were exposed to antibody to P. gingivalis (green) and the epithelial cells were stained with TRITC-phalloidin (red). The control image consists of epithelial cells not exposed to P. gingivalis. 70

PAGE 71

Total Grain Area (m2)P. gingivalisTotal Grain Area (m2)P. gingivalis A B 0 5000 10000 15000 20000 25000 30000 35000 40000 45000 5000033277 pT-COW clpB pT-clpB clpC pT-clpC clpP pT-clpP clpX pT-clpXP clpXP pT-clpXP 0 50000 100000 150000 200000 250000 30000033277 pT-COW clpB pT-clpB clpC pT-clpC clpP pT-clpP clpX pT-clpXP clpXP pT-clpXPTotal Grain Area (m2)P. gingivalisTotal Grain Area (m2)P. gingivalis A B 0 5000 10000 15000 20000 25000 30000 35000 40000 45000 5000033277 pT-COW clpB pT-clpB clpC pT-clpC clpP pT-clpP clpX pT-clpXP clpXP pT-clpXP 0 50000 100000 150000 200000 250000 30000033277 pT-COW clpB pT-clpB clpC pT-clpC clpP pT-clpP clpX pT-clpXP clpXP pT-clpXP Figure 4-4. P. gingivalis clp complemented mutants invasion of primary gingival epithelial cells. Total grain area analysis of P. gingivalis fluorescence accumulation within primary gingival epithelial cells infect ed at a MOI of 100. These analyses were obtained by immunofluorescence microscopy of epithelial cells staine d with TRITC-phalloidin, and antibody to P. gingivalis. A) Invasion of gingival epithelial cells with P. gingivalis 33277 pT-COW and clp complements for 30 min. B) Invasion of gingival epithelial cells with P. gingivalis 33277 pT-COW and clp complements for 2 h. 71

PAGE 72

CFUP. gingivalis* *CFUP. gingivalis 0.0E+00 2.0E+05 4.0E+05 6.0E+05 8.0E+05 1.0E+06 1.2E+06 1.4E+06 33277 clpB clpC clpP clpX clpXPA B 0.0E+00 1.0E+05 2.0E+05 3.0E+05 4.0E+05 5.0E+05 6.0E+05 7.0E+05 8.0E+05 9.0E+05 1.0E+06 33277 pT-COW clpB pT-clpB clpC pT-clpC clpP pT-clpP clpX pT-clpXP clpXP pT-clpXPCFUP. gingivalis* *CFUP. gingivalis 0.0E+00 2.0E+05 4.0E+05 6.0E+05 8.0E+05 1.0E+06 1.2E+06 1.4E+06 33277 clpB clpC clpP clpX clpXPA B 0.0E+00 1.0E+05 2.0E+05 3.0E+05 4.0E+05 5.0E+05 6.0E+05 7.0E+05 8.0E+05 9.0E+05 1.0E+06 33277 pT-COW clpB pT-clpB clpC pT-clpC clpP pT-clpP clpX pT-clpXP clpXP pT-clpXP Figure 4-5. Antibiotic protection assays of P. gingivalis clp mutants in gingival epithelial cells. The gingival epithelial cells were invaded by P. gingivalis (1 x 10 7 CFU/well) for 2h before the addition of antibiotics. P. gingivalis was then recovered and colony forming units (CFU) were determined. A) Invasion of gingival ep ithelial cells with P. gingivalis 33277 and clp mutants. Asterisks indicate a significant difference of P < 0.0005 between the mutant and wild type stra ins. B) Invasion of gingival epithelial cells with P. gingivalis 33277 pT-COW and clp complements. 72

PAGE 73

CHAPTER 5 RELATIONSHIP OF CLP SYSTEM WITH KNOWN VIRULENCE FACTORS OF P. gingivalis Introduction Other pathogens have demonstrated a clos e connection between the Clp proteins and important virulence factors. Fo r example, the ClpC ATPase in Listeria is required for adhesion and invasion and the protein modul ates the expression of other vi rulence factors including InlA and InlB (104). ClpC also promotes the early escape of Listeria from the phagosomal compartment of macrophages (138). The serine protease ClpP is involved in the rapid adaptive response of Listeria within macrophages (93). Therefor e, the Clp system may have an association between known virulence factors in P. gingivalis. As previously described, this pathogen expresses a number of potential virulence factors, such as cysteine proteases named gingipain s, as well as major and minor fimbriae, lipopolysaccharide (LPS), and serine phosphatase (SerB653) which ma y contribute to the various stages of P. gingivalis pathogenesis (4, 9, 13, 55, 67, 70, 136, 137). Among these factors, gingipains degrade collagen and fibronectin and inhibit interaction between epithelial cells and the extracellular matrix (137, 139). Gingipains al so degrade various cyto kines, such as tumor necrosis factor-alpha (TNF), interleukin-6 (IL-6), and IL-8, wh ich results in the disturbance of host cytokine network (137, 140, 141). They are classified into two groups, arginine-specific gingipains (Arg-gingipain-A and -B) and lysine-s pecific gingipain (Lys-g ingipain). The major fimbriae and their subunit protein, fimbrillin (Fim A), are reported to me diate bacterial adhesion to and invasion of human epithelial cells (53). The minor fimbriae are important for biofilm interaction with streptococcal surfaces (36). The LPS, a major component of the outer membrane of Gram-negative bacteria, displays multiple biological and immunological activities through mammalian innate receptors named Toll-like receptors (TLRs) (142). The SerB653 73

PAGE 74

protein is required for in ternalization and intracellular survival within gingival epithelial cells. Accordingly, this project investigated the po ssible connection of these virulence factors, gingipain, FimA, Mfa1, and SerB653 pr oteins, with the Clp system. Materials and Methods Gingipain Activities P. gingivalis strains were grown in 5 mL to an OD of 1.0. A 1mL aliquot of the culture was taken and used as whole cell culture for m easurement of proteinase activity. Another 1 mL aliquot was subjected to centr ifugation (13,000 rpm, 2 min, 4C). The resulting supernant was then filtered to remove residual cells. The filtrate was used as the culture supernant for the assay, while the pelleted cells were applied as whole cells. Lys-X and Arg-X specific cysteine proteinase (Kgp and Rgp gingipains, respectively) activities were determined by measuring the hydrolysis of the synthetic substrates, N-(p-Tosyl)-Gly-Pro-Lys-p-nitroanilide (Sigma-Aldrich) and N-Benzoyl-L-arginine-p-nitroanilide (L-BAPNA) (Sigma-Aldrich), respectively. In brief, the reaction mixture (100 l) containing 0.2 mM substrate, 50 mM Tris-HCl (pH 8.5) and 10 mM DTT was added to a 96-well plate. The reac tion was started by additi on of the 5 l of the whole cell culture, 5 l of the whole cells, or 10 l of the culture supernant and followed by incubation at 37C. Release of the cleaved product, p-nitroanilide, was determined by measuring the absorbance at 410 nm and was qua ntified every 5 min. Proteinase activities were divided by the A 600 values of the cell density to normalize all the values per A 600 unit. The assays were carried out in duplicate and were repeated at least twice with independent cultures. Western Blot Analysis of Select P. gingivalis Virulence Factors Bacterial lysates prepared w ith RIPA buffer (Santa Cruz Biotechnology) or with outer membrane extraction buffer (1% Triton X100, 20 mM Tris [pH 7.5], 20 mM MgCl 2 and 2 mM N-alpha-tosyl-L-lysine chlorome thyl ketone (TLCK)) were an alyzed by conventional Western 74

PAGE 75

blotting. Protein (10 g) was electrophoresed through an SDS-polyacrylamide gel and transferred to a polyvinylidene difluoride me mbrane (Bio-Rad) by electroblotting. The membranes were incubated in blocking buffer (5 % nonfat dried milk, 10 mM Tris [pH 7.5], 100 mM NaCl, and 0.1% Tween 20). Immunoblotting for protein expression was performed with rabbit polyclonal antibodies ag ainst rMfa, FimA, and SerB653. We used horseradish peroxidase-conjugated goat anti-r abbit as a secondary antibody. The blots were developed with an enhanced chemiluminescence system (Amersham) Western blotting was repeated at least two times. ELISA for Select Outer Membrane Proteins The level of cell surface Mfa1 FimA, and SerB653 proteins were determined by enzymelinked immunosorbent assay ( ELISA) after absorption of P. gingivalis strains onto Maxisorp plates (Nunc). Briefly, P. gingivalis cells were harvested, washed with PBS, and fixed with 0.5% buffered formalin in PBS at 4C overnight. 10 5 or 10 7 bacteria were added to each well in a total volume of 100 L. After being washed with PBS to remove unbound bacteria, P. gingivalis cells were blocked in 10% goat serum/PBSTw, then reacted with rMfa, FimA, or SerB653 antibodies (1:10,000) followed by peroxidase-conjugated se condary antibody (1:3,000), each for 1 h at 37C. These antibodies were diluted in PBST w and the plate was washed three times with PBSTw after antibody incubations. Antigen-anti body binding was determined by a colorimetric reaction using the 3,3 ,5,5 -tetramethylbenzidine liquid substrat e for ELISA (Sigma Aldrich) in a Bio-Rad Benchmark Microplate re ader at 655 nm. Antiserum to P. gingivalis 33277 whole cells was used as control to compare the cell numbers fixed in each well. The assays were carried out in triplicate and were repeated at least twice with independent cultures. 75

PAGE 76

Quantitative RT-PCR RNA were extracted and purified as descri bed in Chapter 3 Materials and Methods. Primers were designed using Beacon Designer 2.0 software. cDNA were synthesized from RNA using Superscript III. As a negative control, fimA, a gene that showed no difference in regulation by western blot analysis were used. Specific DNA standard s for each gene under investigation were synthesized from chromosomal DNA using standard PCR methods and visualized by gel electrophoresis to verify that a single specific product had been generated. Each product was purified using the QIAquick PCR Purificati on Kit, and quantified using an Eppendorf BioPhotometer. The DNA product copy number (per ml) (also called the starting quantity [SQ]) was calculated using the formula of Yin et al. (143) as [(6.023 10 23 g of DNA/ml)/(molecular weight of product)]/1000. The molecular weight of the product is calculated as base pairs 6.58 10 2 g. A 10-fold dilution series of each DNA standard was prepared for SQs of 10 8 to 10 4 copies/ l. These were used in duplicate in each real-time PCR assay to allow the real-time PCR software to estimate the SQ of that gene in cDNA samples. The standard DNA dilution series (SQ = 10 8 -10 4 copies/ l) or cDNA templates (2 l) were added in dupli cate to an iCycler iQ 96-well PCR plate (Bio-Rad). RNA extracts we re prepared in duplicate from independent experiments and cDNA samples were loaded in tr iplicate. To each well, the following were added: 1 l each 5 and 3 specific pr imer (50 pmol each); 12.5 l iQ SYBR Green Supermix (Bio-Rad) containing 100 mM KCl, 40 mM Tris-HCl, pH 8.4, 0.4 mM of each dNTP (dATP, dCTP, dGTP, and dTTP), iTaq DNA polymerase, 50 U / ml, 6 mM MgCl2, 20 nM fluorescein, and st abilizers; and 8.5 l dH 2 O, making a final volume of 25 l per well. The 96well plate were sealed with optical tape and samples were quantified in the iCycler machine (Bio-Rad) using a standard thermal cycling program. Real-time results were analyzed using 76

PAGE 77

iCycler iQ Optical System software version 3.0a (Bio-Rad). The melt curve profile were analyzed to verify a single peak for e ach sample, indicating primer specificity. Statistical Analysis Statistical analysis determined the mean, stan dard deviation, and th e significant difference between the mutants and pare ntal strains by Students t-tests (P < 0.05) and ANOVA software. Results Clp Proteins Do Not Alter Gingipain Proteinase Activities Gingipain activities of the whole cell culture, the culture supernant, and the whole cells from the P. gingivalis wild type and clp mutants were measured as described in the Materials and Methods Section. Using mid-log phase P. gingivalis cultures, the Rgp and Kgp activities were assayed every 5 min for a tota l time period of 70 min. Th e results show no significant differences between the wild type and the clp mutants in both the Rgp and Kgp activities of the whole cell culture (Figure 5-1). Similarly, no si gnificant differences were observed in both Rgp and Kgp activities of the culture supernant and whole cells. Cons equently, the Clp proteins are not involved in the activities of Rgp and Kgp gingipains. ClpX and ClpXP Induce Total and Sur face Expression of Mfa1 Protein To gain more insight into th e potential role of the Clp stress response system in this pathogen, the known virulence factors of P. gingivalis, FimA, SerB653, and Mfa1, were assessed by western blot analysis. Total bacterial proteins extracted from the RIPA buffer were used to determine FimA and Mfa1. However, SerB653 is expressed in very low quantities, and therefore, require more concentr ated fractionalizations of the out er membrane by the lysis buffer in order to examine its expression level. Intere stingly, the western blot analysis suggested a potential link between Mfa1 protein and clpX and clpXP mutants either by di rect or indirect interactions. The expression level of Mfa1 prot ein from total bacterial lysate was increased 77

PAGE 78

compared to wild type in only the clpX and clpXP mutants (Figure 5-2A). Furthermore, the protein expression of mfa1 was restor ed to wild type levels in the clpx and clpxp complemented strains (Figure 5-2B). However, no change in expression of FimA and SerB653 was found in any of the clp mutants (Figure 5-2A). As a result the blots were analysed by scanning densitometry that determined the relative ratios of Mfa1/FimA and Mfa1/SerB653 and was evaluated to ratios in the wild type. These graph quantitatively confirmed the visualized induction of Mfa1 protein in the clpX and clpXP mutants. The protein gels were analyzed by coomassie stain before blotting in order to assure equal loading of samples. All samples showed equal level of total protein expression except for the band that represented Mfa1 (data not shown). To see whether the same phenomonom is occu ring at the cell surf ace level, the Mfa1, FimA, and SerB653 proteins were determined by the ELISA method. The ELISA determined the cell surface expression of the proteins from fixed P. gingivalis cells. The results supported the western analysis data with an incr ease accumulation of Mfa1 antibody in only clpX and clpXP mutants and no change in expression for FimA and SerB653 antibodies compared to wild type (Figure 5-3). The mfa1, fimA, and serB653 mutants were used as negative controls and showed background level of antibody accumulation (data not shown). To determine whether the Mfa1 product is transcriptional or post-transcrip tional modified in the clpX and clpXP mutants, real-time PCR was performed. There was no cha nge in the transcriptional expression of the mfa1 gene; therefore, altered expression is potentially due to post-transcriptional modification (Figure 5-4). Discusion One interpretation of these results is that an activator of Mfa1 activ ity or the actual Mfa1 protein is degraded by the ATP-dependent Cl pXP protease. If this was true, then a clpP 78

PAGE 79

mutation would also confer increa sed Mfa1 expression; however, a clpP mutation showed no effect on the pattern of Mfa1 expression. This da ta indicates that ClpP is probably not involved in the regulation of the Mfa1 protein or not expressed under thes e conditions. That is not to say that we have ruled out ClpXP as being a factor in Mfa1 proteolytic regulation. It is possible that ClpP, in association with ClpX, functions in growth phase degrad ation of Mfa1. As shown in B. subtilis, ClpP did not significantly affect the stimulation of H -dependent gene expression in the late log/stationary phase; however ClpP, in association with Cl pX, functions in the exponential phase degradation of H thus mimicking its role in RpoS degradation (144). Furthermore, another possibility is that ClpX may be performing either or bot h of these two functions, one is to repress, directly or indirectly, Mfa1 protein production, and the other is to facilitate ClpPindependent degradation of Mfa1 protein. In E. coli, the ClpX-dependent ClpP-independent degradation of GFP-ssrA was obser ved and that the unfolding of this substrate by ClpX appears to enhance intracellular degrada tion by other prot eases (145). Though there may be multimodal effects when clpX and clpXP genes are deleted. These results may provide one of many factors that lead the clpXP mutants to develop thicker monospecies and mixed species biofilm. Even though, the clpX mutant did not show the significantly different biofilm pheno type, it did have slightly el evated average biofilm height compared to wild type. Therefore, the exce ss amount of Mfa1 protei n can lead to more aggregation between P. gingivalis cells. Moreover, the interaction of Mfa1 with SspB is necessary for optimal co-adhesion between P. gingivalis and S. gordonii; therefore, the excess amount of Mfa1 proteins may result in more association and signa l transduction with S. gordonii. Excess Mfa1 protein may also give insights to why the epithelial cell invasions of the clpX and clpXP mutants were reduced. Since excess amount of Mfa1 surface proteins could disrupt other 79

PAGE 80

cell surface proteins orientation, such as FimA, and block interac tion with epithelial cells. As reported, the FimA appears to be involved for ma ny of the adhesive properties of the organism (9). Binding is mediated through a number of specific domains that are located throughout the molecule but cluster predominately at the C-t erminus. However, the adhesive domain amino acid residues that interact with epithelial cells are located on the less exposed N-terminus region of the molecule, which makes it more susceptible to blockage. ClpC, however, does not alter the expression of Mfa1 and must involve other processes to in fluence monospecies biofilm formation and cell invasion. 80

PAGE 81

0.00 0.10 0.20 0.30 0.40 02 04 06 08 0 33277 clpB clpC clpP clpX clpXP 0.00 0.10 0.20 0.30 0.40 020406080 33277 clpB clpC clpP clpX clpXP 0.00 0.10 0.20 0.30 0.40 020406080 33277 clpB clpC clpP clpX clpXP 0.00 0.20 0.40 0.60 0.80 020406080 33277 clpB clpC clpP clpX clpXP 0.00 0.20 0.40 0.60 0.80 020406080 33277 clpB clpC clpP clpX clpXP 0.00 0.20 0.40 0.60 0.80 020406080 33277 clpB clpC clpP clpX clpXPOD 410/600 nmMinutesOD 410/600 nm OD 410/600 nm OD 410/600 nm OD 410/600 nm OD 410/600 nmMinutes Minutes Minutes Minutes MinutesRGP Whole Culture Whole Culture Cell Pellet Cell Pellet Supernant Supernant KGP AB 0.00 0.10 0.20 0.30 0.40 02 04 06 08 0 33277 clpB clpC clpP clpX clpXP 0.00 0.10 0.20 0.30 0.40 020406080 33277 clpB clpC clpP clpX clpXP 0.00 0.10 0.20 0.30 0.40 020406080 33277 clpB clpC clpP clpX clpXP 0.00 0.20 0.40 0.60 0.80 020406080 33277 clpB clpC clpP clpX clpXP 0.00 0.20 0.40 0.60 0.80 020406080 33277 clpB clpC clpP clpX clpXP 0.00 0.20 0.40 0.60 0.80 020406080 33277 clpB clpC clpP clpX clpXPOD 410/600 nmMinutesOD 410/600 nm OD 410/600 nm OD 410/600 nm OD 410/600 nm OD 410/600 nmMinutes Minutes Minutes Minutes MinutesRGP Whole Culture Whole Culture Cell Pellet Cell Pellet Supernant Supernant KGP AB Figure 5-1. Gingipain pr oteinase activities of clp mutants. P. gingivalis strains were grown to an OD of 1.0. The cultures were sampled as whole culture, cell pellet and supernant. A) Arg-gingipain (RGP) and B) Lys-gingipain (KGP) proteinase activities were measured at OD 410 nm and was quantified ev ery 5 min. Proteinase activities were divided by the A 600 values of the cell density to normalize all the values per A 600 unit. 81

PAGE 82

-Mfa1 -FimA -SerB 46 kDa 67 kDa 33277 clpB clpC clpP clpX clpXP 41 kDa 41 kDa 33277 clpX clpXP -Mfa1 -FimA67 kDa33277 pT-COW clpX clpXP MutantComplement A B Relative Ratio Mfa1/FimA Relative Ratio Mfa1/SerB Relative Ratio Mfa1/FimA 0.0 0.5 1.0 1.5 33277 clpB clpC clpP clpX clpXP 0.0 0.1 0.2 0.3 33277 clpB clpC clpP clpX clpXP P. gingivalis P. gingivalis P. gingivalis 0.0 1.0 2.0 3.0 4.0 33277 clpX clpXP33277 pTCOW clpX pTClpXP clpXP pTClpXP -Mfa1 -FimA -SerB 46 kDa 67 kDa 33277 clpB clpC clpP clpX clpXP 41 kDa 41 kDa 33277 clpX clpXP -Mfa1 -FimA67 kDa33277 pT-COW clpX clpXP MutantComplement A B Relative Ratio Mfa1/FimA Relative Ratio Mfa1/SerB Relative Ratio Mfa1/FimA 0.0 0.5 1.0 1.5 33277 clpB clpC clpP clpX clpXP 0.0 0.1 0.2 0.3 33277 clpB clpC clpP clpX clpXP P. gingivalis P. gingivalis P. gingivalis 0.0 1.0 2.0 3.0 4.0 33277 clpX clpXP33277 pTCOW clpX pTClpXP clpXP pTClpXP Figure 5-2. Western analysis of P. gingivalis virulence factors in clp mutants. Bacterial lysates prepared with RIPA buffer or membra ne fraction buffer were analyzed by conventional western blotting. A) A re presentative immunoblotting for protein expression in P. gingivalis 33277 and clp mutants was performed with rabbit polyclonal antibodies agains t rMfa, FimA, and SerB653. The relative ratios of Mfa1/FimA and Mfa1/SerB653 we re determined by scanning densitometry. B) The protein expression of Mfa1 and FimA in complemented strains of clpX and clpXP were analyzed with 33277, 33277 pT-COW, and clpX and clpXP mutants. The relative ratios of Mfa1/FimA was examined. 82

PAGE 83

OD 655 nmAntiserum* 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 -Mfa1 -FimA -SerB 33277 clpB clpC clpP clpX clpXPOD 655 nmAntiserum* 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 -Mfa1 -FimA -SerB 33277 clpB clpC clpP clpX clpXP Figure 5-3. ELISA for outer membrane proteins accumulation in clp mutants. The level of cell surface Mfa1, FimA, and SerB653 proteins were determined by enzyme-linked immunosorbent assay (ELISA) after fixation of P. gingivalis strains onto Maxisorp plates. The samples were reacted with rM fa, FimA, or SerB653 antibodies (1:10,000) followed by peroxidase-conjugated secondary antibody (1:3,000). The antigenantibody binding was determined by a colori metric reaction at OD 655 nm. Asterisks indicate a significant difference (P < 0.05) compared to wild type. 83

PAGE 84

mRNA copy number 1.00E+00 1.00E+02 1.00E+04 1.00E+06 1.00E+08 fimA mfa1 33277 clpX clpXPmRNA copy number 1.00E+00 1.00E+02 1.00E+04 1.00E+06 1.00E+08 fimA mfa1 33277 clpX clpXP Figure 5-4. Quantitative RT-PCR of mfa1 gene in complemented clpX and clpXP mutants. Gene expression was measured by quantitative RT-PCR on 33277, complemented clpX and complemented clpXP cultures were grown to OD600 of 1.0. The mRNA copy number was calculated from formula de scribed in the Materials and Methods section. The fimA genes were used as a control. 84

PAGE 85

CHAPTER 6 SUMMARY AND CONCLUSION Under adverse environmental conditions, b acteria have evolved complex regulatory networks in order to maintain cell viability. An essential element of these networks is the controlled intracellular proteolysis performed by energy-dependent protease s. Clp ATPases and proteases are ubiquitously present in bacteria and play a dyna mic role in the control of availability of regulatory prot eins and the breakdown of abno rmal and misfolded proteins. However, ATP-dependent proteases, Lon, ClpP and HslVU (ClpQY), appear to have some redundancy because they recognize seve ral of the same substrates in E. coli, perhaps explaining why inactivation of individual proteases can cau se only modest phenotypic changes (114). In striking contrast, the wide range of phenotypes conferred by inactiv ation of ClpP in the low GC Gram-positive bacteria suggest th at the ClpP proteolytic protea ses are the major proteases both for eliminating misfolded proteins and for controlling the activity of central regulatory proteins in these organisms (89). Intriguingly, inactivation of ClpP or Clp ATPa ses significantly affects various pathogenic stages, such as biofilm formation and/or cell invasion, of the important pathogens, S. aureus, L. monocytogenes and S. pneumoniae (92, 104, 125). For instance, a clpP mutant strain showed a reduced capacity to form monospecies biofilms in S. mutans (125). The entry of bacterial pathogens into the host constitutes a dramatic environmental change and the apparently conserved role of Clp proteins in virulence could be a consequence of their involvement in handling host stress imposed damage of bacter ial proteins. However, Clp chaperones and proteases also contribute to virulence by controlling synthesis of major virulence factors. For example, ClpC is required for transcription of inlA, inlB and actA, encoding proteins important for host cell invasion of L. monocytogenes (104). Similarly, S. aureus ClpXP is required for 85

PAGE 86

transcription of a number of important viru lence genes encoding hemolysins, extracellular proteases surface adhesions, and others (101, 102, 146). Interestingly, the regulatory activity of ClpXP seems to be tightly linked to the quor um sensing Agr two component system. In P. gingivalis, the regulation of clpB and other stress-related genes seems to involve LuxS quorumsensing system (147). However, does the impera tive and apparently cons erved roles of the Clp proteins in virulence result from their involvement in handling stress, or does it reflect a more direct function in regulating virulence factors. This project investigated the physiological role of Clp subunits in the stress responses and pathogenesis of P. gingivalis by mutational analysis. The clpB, clpC, clpP, and clpX genes in P. gingivalis were inactivated by allelic replacement. In addition, a clpXP double mutant was generated and these genes are part of a polycistronic operon. Mu tants were first assessed for tolerance to common environmenta l stresses, such as temperature, oxidative, and aerobic stresses. They were also examined for their ability to form biofilm and to invade cells. Moreover, a virulence factor of P. gingivalis, the Mfa1 short fimbrial protein, was found in this study to be induced in the clpX and clpXP mutants. Since there was no change in the transcriptional expression of the mfa1 gene, the modification may be post-transcriptional. Without the expression of clpX, the Mfa1 proteins are possibly not targeted for degradation and thus results in excess accumulation within the cytoplasm and on the surface of P. gingivalis. These findings suggest that the Cl pX chaperon may target an activat or of Mfa1 expression or the actual Mfa1 protein for normal degradation within the ClpXP complex or other proteases. The ClpXP proteolytic complex is probably not involv ed in the Mfa1 regulation, as a mutation in clpP did not significantly stimulate Mfa1 protein expression. However, it is possible that ClpP, in association with ClpX, functi ons in growth phase dependent de gradation of Mfa1. Therefore, 86

PAGE 87

the ClpX chaperone is important for the regulation of Mfa1 prot ein by repressing, directly or indirectly, Mfa1 protein producti on, and/or facilitating ClpP-inde pendent degrada tion of Mfa1 protein. In E. coli, ClpX-dependent ClpP-independent degradation of GFP-ssrA was observed, and unfolding of this substrate by ClpX appears to enhance intracellula r degradation by other proteases (174). Further experiements are required to verify how the Mfa1 protein is interacting with these Clp proteins. It will be interesting to determine ex actly how ClpX is reducing Mfa1 production and if ClpX is binds directly to the Mf a1 protein. If so, it will be exciting to find out the location and sequence of thei r interaction site. Furthermor e, no change in activity or expression of the other examined virulence f actors, gingipains, FimA, and SerB653, was found in any of the clp mutants. However, this does not rule out that the Clp proteins may affect trascriptionally or translationally other unexamined virulence factors. The only link to stress sensitivity was clpC and clpXP mutants showing a several log decrease in viability counts co mpared to wild type during the heat stress experiment. Since single clpP and clpX mutation showed no differences from wild type the effect of the clpXP mutant is possibly due to a f unctional redundancy between ClpX a nd ClpP. The result proposes that the elimination of both genes may over-exert the Clp stress response system. Nevertheless, the data obtained demonstrate that ClpC plays a crit ical role in the survival of heat stress, most likely by preventing the accumulation of denature d proteins, and this is not compensated by other Clp subunits or ATP-dependent proteases. With the exception of heat tolerance, the overall Clp system in P. gingivalis does not appear to play an imperativ e role in promoting general stress tolerance due to the common lack of stress susceptibility by the clp mutations. Perhaps, the Clp system in P. gingivalis has a more exclusive function in maintaining normal protein turnover rather than by promoting stress tolerance. However, the stress response under the condition 87

PAGE 88

tested may be different in vivo. In addition, P. gingivalis has other proteins th at function to resist specific stress. For example, DnaK and Gr oEL are involved in temperature stress in P. gingivalis and OxyR plays a role in both the resistance to hydrogen peroxide and the aerotolerance of P. gingivalis (115, 148). Further st udies are requisite to see if these genes are up-regulated in clp mutants. Conversely, not all possible stresses were examined in this project, so these results cannot fully exclude the Clp system involvement in P. gingivalis stress response. An emerging theme in biology is the realiza tion that a single protein can have multiple functions. This is almost certainly true for energy-dependent proteases and their associated factors. In addition to heat sensitivity, both clpC and the clpXP mutants induced monospecies biofilm formation, as well as displaying reduced invasion phenotypes comp ared to wild type. Accordingly, the possible linkage of stress tolerance of ClpC and ClpXP with biofilm formation and cell invasion is important for impending investigation. The results of the current study indicate that both ClpC and ClpXP protein of P. gingivalis is exploited to regulate biofilm accumulation on abiotic surfaces. Furthermore, only the ClpXP protein is involved in biofilm control in the more complex and in vivo relevant situation where other organisms are present. Although the basis for this phenotype is unknown and there may be multimodal effects, it can be speculated that ClpC and/or ClpXP may act by controlling the stability or activity of transcrip tional regulators or other factors of biofilm maturation(29). These regulators or factors may be iden tified by proteomic or microarra y analysis. Furthermore, the excess amount of Mfa1 protein can lead to more aggregation between P. gingivalis clpXPdeficient cells and lead to the development of thicker monospeci es and mixed species biofilm. Moreover, the interaction of Mfa1 with SspB is necessary for optim al co-adhesion between P. gingivalis and S. gordonii; therefore, the excess amount of Mfa1 proteins may result in more 88

PAGE 89

association and signa l transduction with S. gordonii (36). In addition, these experiments represent the early stages of biofilm formation; therefore, the mutants biofilm phenotypes may be different in later time point s of biofilm maturation. Hence, our data show that Clp proteolytic complex and the Clp ATPases control several key processes of importance to the success of P. gingivalis as a pathogen. The ClpC, ClpP, and ClpX are necessary for entry and intracellular survival. Du ring the infection process, intracellular pathogens face various stress condit ions generated by host cells. In addition, regulated proteolysis is required for normal protein turnover and th e loss of regulated proteolysis by these enzymes could alter the biochemical prof ile of a bacterium, changing its ability to survive and grow in a host (83). Excess Mfa1 protein may also give insights to why the epithelial cell invasion efficiencies of the clpX and clpXP mutants were reduced. An excess amount of Mfa1 surface protein could disrupt othe r cell surface proteins orientation, such as FimA, and block interaction with epithelial cells. As reported, the FimA appears to be involved for many of the adhesive propert ies of the organism (9). Bi nding is mediated through a number of specific domains that are lo cated throughout the molecule but cluster predominately at the Cterminus. However, the adhesive domain amino acid residues that interact with epithelial cells are located on the less exposed N-terminus region of the molecule, which makes it more susceptible to blockage. The clpB mutant showed no stress vulnerability among the stress cond itions tested. Correspondingly, ClpB was described in S. aureus as needed for growth only under conditions generating massive protein aggregation, such as thermotolerance, and supports our finding of lack of stress sensitivity (89). This study also mentioned that Cl pB did not affect production of any known virulence factors in S. aureus, which contributes the idea th at the Clp protein quality 89

PAGE 90

control systems are required in the host. Furthermore, the clpB gene seems to play no role in the entrance of P. gingivalis in epithelial cells, but is important for intracellular survival. Similarly, S. aureus cells lacking the ClpB chaperone are unable to replicate intracellularly in bovine cells (92). Noteworthy, the conserved role of Clp protei ns in pathogenesis may also be exploited therapeutically. The enzymatic activities of energy-de pendent proteases may prove to be ideal targets for antimicrobial drug de velopment. Interestingly, S. aureus ClpP was recently shown to be the target of a new promising class of antib iotics, the acyldepsipep tides (149). This compound apparently enables ClpP to de grade proteins in the absence of an associating Clp ATPase, leading to uncontrolled proteolysis that even tually kills the bacteria, including multi-drugresistant S. aureus. Thus, targeting proteases and associ ated factors already shows promise for the development of new antimicrobial therapies that would be more efficient if able to penetrate inside host cells and target intracellular bacteria. An approaching challenge will be to unravel the complex networks controlling regulated proteolysis in P. gingivalis. Studies aimed at elucidating the mechanisms underlying regulated proteolysis, and specifically the ways external si gnals are communicated to the proteases, will be essential for future work. For exam ple, the alternative sigma factors 32 E and 54 positively regulate heat-shock-induced gene expression in E. coli (150, 151). Furthermore, another potential ch allenge is to identify substrates that bind the Clp proteins and their binding sites. A breakthrough in unde rstanding the general rules governing substrate recognition by the ClpXP pr otease was obtained in E. coli, where specifically one large class of substrate proteins carry the C-term inal -LAA signature that is part of the SsrA tag (152). Similar motifs have been shown to be required for ClpP dependent proteolysis in Gram-positive bacteria 90

PAGE 91

suggesting that recognition of substrate proteins follow the general rules established in E. coli. In addition, ClpXP also degrades many native prot ein substrates that are not SsrA tagged, and ClpX, by itself, catalyzed en ergy-dependent disassembly of extraordinarily stable macromolecular complexes (153-155). The capacity of ClpX or ClpXP to denature very stable proteins is probable; therefor e it is inherently important in both protein degradation and disassembly activities. However, an important mechanistic difference to the E. coli paradigm was demonstrated by the finding that ClpC in c ontrast to other charac terized Clp ATPases has low intrinsic ATPase activity and depends on cof actors for all basic activ ities (156, 157). One major task of future studies will be to understand the role of cofactors in relation to selection of substrates. Proteomics analysis and substrate trap experiments, such as protein pull down assays, as well as microarray analysis could begin to examine the possibility of Clp-associated substrates. Taken together, en ergy-dependent proteolysis is likely to be important during pathogenesis for numerous reasons. The challeng e will be to design experiments to determine which processes, transcription or translation regulati on, degradation of damaged or misfolded proteins, normal protein turnove r, or all of the above, are important during infection. Understanding why energy-dependent proteolysis is required for survival of or causing disease by a pathogen may also help id entify host factors required for defending against disease. In addition, identification of degradation substrates may reveal pathways within the pathogen that are essential for causing disease or allowing persistent infection. In conclusion, our analysis begins to shed lig ht on the physiological significance of the Clp proteins in P. gingivalis and have led to the discovery of a previously undescribed connection of ClpX to the virulence factor, Mf a1 protein. Clp protein activities impact the regulation of biofilm and are required for optimal invasion and intracellular survival of the organism. The 91

PAGE 92

challenges now are to elucidate the mechanistic ba sis of biofilm formation, internalization, and intracellular activity. Such inve stigations will provide new in sights into the multi-factorial virulence mechanisms of P. gingivalis. 92

PAGE 93

APPENDIX PUBLICATION: ROLE OF Porphyromonas gingivalis INLJ PROTEIN IN HOMOTYPIC AND HETEROTYPIC BIOFILM DEVELOPMENT 93

PAGE 94

INFECTIONANDIMMUNITY,May2006,p.3002 Vol.74,No.5 0019-9567/06/$08.00 0doi:10.1128/IAI.74.5.3002.2006 Copyright2006,AmericanSocietyforMicrobiology.AllRightsReserved.NOTESRoleofthe Porphyromonasgingivalis InlJProteininHomotypic andHeterotypicBiolmDevelopmentCindyA.Capestany, MasaeKuboniwa,Il-YoungJung,YoonsukPark,GenaD.Tribble, andRichardJ.Lamont *DepartmentofOralBiology,CollegeofDentistry,UniversityofFlorida,Gainesville,Florida32607Received9December2005/Returnedformodication16January2006/Accepted6February2006Theoralpathogen Porphyromonasgingivalis expressesahomologoftheinternalinfamilyproteinInlJ.Inactivationof inlJ reducedmonospeciesbiolmformationby P.gingivalis .Incontrast,heterotypic P.gingivalis Streptococcusgordonii biolmformationwasenhancedintheInlJ-decientmutant.Theresultsindicatea nuancedroleforInlJinregulatingbiolmaccumulationsof P.gingivalis Theinternalinproteinfamilywasoriginallyidentiedin Listeriamonocytogenes andischaracterizedbythepresenceof anN-terminalleucine-richrepeat(LRR)domain(1).LRRs areinvolvedinprotein-proteininteractionsincludingligandreceptorbinding(5).Indeed,internalinA(InlA)andInlBof L.monocytogenes areinvolvedinadherenceandinvasionof theorganism(1,3).Recently,anovelinternalin,InlJ,was identiedin L.monocytogenes (12).InlJdenesanewsubclass familyofcysteine-containingLRRproteins.AnInlJmutantof Listeria wasfoundtobesignicantlyattenuatedinvirulencein mice(12).InlJtypeproteinsarecurrentlyidentiedinonlysix bacterialspecies,oneofwhichisthegram-negativeoral anaerobe Porphyromonasgingivalis (12).ExpressionofInlJ (PG0350)(http://www.lanl.gov)in P.gingivalis wasoriginally detectedwhentheorganismwasincontactwithhostepithelial cells(2).However,anInlJmutantof P.gingivalis didnot exhibitaninvasion-relatedphenotype(18),asisalsothecase forthe Listeria InlJmutant(12).Inadditiontoanintracellular location,asignicantcomponentofthe P.gingivalis lifestyleis withinthecomplexmultispeciesbiolm(dentalplaque)that developsontoothsurfaces.Inthisstudy,weinvestigatedthe roleofthe P.gingivalis InlJproteininsingle-speciesandmultispeciesbiolmformationbytheorganism.Interestingly,an InlJ-nullmutantexhibitedreducedmonospeciesbiolmdevelopmentbutenhancedheterotypicbiolmformationwith Streptococcusgordonii AnInlJ-decientmutantwasgeneratedbyinsertionalinactivationin P.gingivalis strain33277.Acentral847-bpfragmentof inlJ (PG0350)wasampliedbyPCRusingprimers5 -TCTTCT GCAGGGGACTATGG-3 and5 -TTTCCACGTGTTCGGTT GTA-3 andsubclonedintothesuicideplasmidpVA3000.The recombinantplasmidwasintroducedinto P.gingivalis 33277by conjugationasdescribedpreviously(10).Theabsenceof inlJ transcriptwasconrmedbyreversetranscription-PCR.Asthe inlJ geneislocatedbetweentwogenestranscribedintheoppositedirection,thepotentialforpleiotropiceffectsofthis mutationarediminished.TheadjacentgenesarePG0349,a putativehydrolaseofthehaloaciddehalogenase-likefamily, andPG0351,ahypotheticalprotein,neitherofwhichhasa documentedroleinbiolmbiogenesis.Homotypicbiolmformationwasrsttestedinthemicrotiterplateassaydescribed previouslybyOTooleandKolter(8).Parentalandmutant strainsweresuspendedinprereducedphosphate-bufferedsaline,and5 107cellswereincubatedat37Canaerobicallyin individualwellsof96-wellplates.Theresultingbiolmswere washed,stainedwith1%crystalviolet,anddestainedwith95% *Correspondingauthor.Mailingaddress:DepartmentofOralBiology,CollegeofDentistry,UniversityofFlorida,Gainesville,FL 32610-0424.Phone:(352)392-5067.Fax:(352)392-2361.E-mail:rlamont @dental.u.edu. Presentaddress:DepartmentofConservativeDentistry,College ofDentistry,YonseiUniversity,Sinchon-dong,Seodaemun-gu,Seoul 120-752,Korea. FIG.1.Microtiterplatemonospeciesbiolmproductionby P.gingivalis 33277andtheInlJmutantat24hand48h.Asterisksindicate asignicantdifference( P 0.05, t test; n 3)betweenthemutantand parentalstrains.OD,opticaldensity. 3002

PAGE 95

ethanol.Absorbanceat595nmwasdeterminedusingaBenchmarkmicroplatereader.Figure1showsthatmonospeciesbiolmformationwasreducedintheInlJmutantby13.6%after 24hand56.1%after48h.Forvisualizationandquantication ofbiolmstructure,biolmsweregeneratedina16-wellCultureWellchamberedcoverglasssystem,stainedwith5(and 6)-carboxyuoresceinsuccinimidylester(uoresceinisothiocyanate[FITC],4 gml 1;MolecularProbes),andexamined byconfocalmicroscopy(Bio-RadMRC600confocalscanning lasermicroscope[Kr/Ar]systemwithanMSplan 601.4numerical-apertureobjective).Biolmswereobservedwiththe reectedlaserlightofcombined488-,546-,and647-nmwavelengths.TheimageswereanalyzedwithImageJ1.35cand AdobePhotoshop6.0software.MCID-M55.1softwarewas usedtodeterminethetotalgrainarea.Biolmformationby theInlJmutantwasvisiblymoresparsethanthatbytheparent strain(Fig.2A),andtotalaccumulationwasreducedby46.2% (Fig.2B).Inaddition,theaverageheightacrossthreerandom FIG.2.(A)Confocallaserscanningmicroscopyprojectionsofmonospeciesbiolmformationby P.gingivalis strains33277andtheInlJmutant after24h.Magnication, 40.(B)Totalgrainareaanalysisofa268.6-by268.6m x-y section.(C)Averagebiolmheightof P.gingivalis accumulationacrossthreerandom x-z sections.Asterisksindicateasignicantdifference( P 0.05, t test; n 3)betweenthemutantandparental strains. VOL.74,2006 NOTES3003

PAGE 96

x-z sectionsofthemutantbiolmwasreducedby36.5%comparedtotheparentstrain(Fig.2C).TheseexperimentsdemonstratethatInlJisrequiredforoptimalhomotypicbiolm formationby P.gingivalis Onthetoothsurfaces, P.gingivalis willbeincontactwiththe diversespeciesthatcomprisetheplaquebiolm.Thus,tobegintoassesstheroleofInlJinheterotypicbiolms,mixed S. gordonii P.gingivalis biolmswereexamined. S.gordonii isa commoncomponentofdentalplaque(11,13,14)andisencounteredby P.gingivalis uponinitialcolonization. S.gordonii cellswereculturedfor24honchamberedcoverglassand stainedwithhexidiumiodide(15 gml 1;MolecularProbes). P.gingivalis cellswerestainedwithFITCasdescribedabove andreactedanaerobicallywiththe S.gordonii biolmfor24h at37Cinprereducedphosphate-bufferedsaline.Afterwashing,accumulationsofheterotypicbiolmswereobservedby confocalmicroscopyasdescribedabove.Incontrasttothe monospeciesbiolm,theInlJmutantformedmoreabundant accumulationswithinthemixed P.gingivalis S.gordonii biolm (Fig.3A).Thisobservationwassupportedbythetotalgrain FIG.3.(A)Confocallaserscanningmicroscopyprojectionsofmixedbiolmsof S.gordonii DL1with P.gingivalis strains33277andtheInlJ mutantafter24h. S.gordonii wasprestainedwithhexidiumiodide(red),and P.gingivalis wasprestainedwithFITC(green).Magnication, 40. (B)Totalgrainareaanalysisofa268.6268.6m x-y section.(C)Averagebiolmheightof P.gingivalis accumulationacrossthreerandom x-z sections.Asterisksindicateasignicantdifference( P 0.05, t test; n 3)betweenthemutantandwild-typestrains. 3004NOTES INFECT.IMMUN.

PAGE 97

analysisof P.gingivalis accumulation(Fig.3B).Inaddition, measurementofaveragebiolmheightacrossthreerandom x-z sectionsshowedhigherverticalaccretionoftheInlJmutant thantheparentalstrain(Fig.3C).Hence,intheabsenceof InlJ,moreluxuriantheterotypicbiolmsareformedby P. gingivalis Biolmaccumulationproceedsthroughaseriesofdevelopmentalstepsinvolvingattachmentofbacterialcellstoasurface;accumulationbytherecruitmentofadditionalcellsand proliferation;and,incertaincases,inclusionofadditionalspecies.Denedgeneticprolesareconsideredimportantfor distinctphasesofbiolmdevelopment(7,15).Regulationof biolmdevelopmentcanbehypothesizedtoinvolvemechanismsthatbothstimulateanincreaseinbiomassandlimitor stabilizeaccumulationaccordingtoenvironmentalconstraints. Forexample,in Pseudomonasaeruginosa ,biolmdepthisreducedbythetranscriptionfactorRpoS(4,17).However,RpoS mutantsof P.aeruginosa formbiolmsofgreaterdepthunder owingconditions(17).RpoSproductionisregulatedatmultiplelevels,includingtranscription,translation,andproteolysis,inresponsetodifferentstressconditionssuchasnutrient limitation(16).Theresultsofthecurrentstudyindicatethat theInlJproteinof P.gingivalis isexploitedtoperformroles bothinthestimulationofbiolmaccumulationonabiotic surfacesandinbiolmcontrolinthemorecomplexandin vivo-relevantsituationwhereotherorganismsarepresent. SuchamultifunctionalroleisnotinconsistentwiththestructureandpropertiesofLRRproteins.Internalinsof Listeria are involvedinadherence,andadhesiveactivitymediatedbyInlJ maybeimportantforbiolminitiationonabioticsurfaces.InlJ doespossessasignalpeptideandisthereforelikelytobe presentonthesurfaceof P.gingivalis .Adherenceof P.gingivalis to S.gordonii ,however,ismediatedthroughthelongand shortmbriae(6,9)andthusmaynotrequirethepresenceof InlJ.LRRscanalsobeinvolvedinsignaltransductionthrough theircapacitytoprovideaversatilestructuralframeworkfor theformationofprotein-proteininteractions.Sucharolefor InlJmaybeimportantinconstrainingbiolmgrowth,possibly toavoidexcessiveexposuretooxygenintheoralcavity.Asa strictanaerobe, P.gingivalis islikelytofavoranexistencedeep withintheplaquebiolm.Alternatively,restrictionofbiolm developmentmaybeimportanttomaintaintheintegrityof channelsthatallownutrientpenetrationintothebiolm.ThisworkwassupportedbyNIDCRDE12505andDE11111.REFERENCES 1. Cabanes,D.,P.Dehoux,O.Dussurget,L.Frangeul,andP.Cossart. 2002. Surfaceproteinsandthepathogenicpotentialof Listeriamonocytogenes TrendsMicrobiol. 10: 238. 2. Chen,W.,K.E.Laidig,Y.Park,K.Park,J.R.YatesIII,R.J.Lamont,and M.Hackett. 2001.Searchingthe Porphyromonasgingivalis genomewithpeptidefragmentationmassspectra.Analyst 126: 52. 3. Cossart,P.,J.Pizarro-Cerda,andM.Lecuit. 2003.Invasionofmammalian cellsby Listeriamonocytogenes :functionalmimicrytosubvertcellularfunctions.TrendsCellBiol. 13: 23. 4. Heydorn,A.,B.Ersboll,J.Kato,M.Hentzer,M.R.Parsek,T.TolkerNielsen,M.Givskov,andS.Molin. 2002.Statisticalanalysisof Pseudomonas aeruginosa biolmdevelopment:impactofmutationsingenesinvolvedin twitchingmotility,cell-to-cellsignaling,andstationary-phasesigmafactor expression.Appl.Environ.Microbiol. 68: 2008. 5. Kajava,A.V. 1998.Structuraldiversityofleucine-richrepeatproteins.J. Mol.Biol. 277: 519. 6. Lamont,R.J.,A.El-Sabaeny,Y.Park,G.S.Cook,J.W.Costerton,andD.R. Demuth. 2002.Roleofthe Streptococcusgordonii SspBproteininthedevelopmentof Porphyromonasgingivalis biolmsonstreptococcalsubstrates. Microbiology 148: 1627. 7. Moorthy,S.,andP.I.Watnick. 2005.Identicationofnovelstage-specic geneticrequirementsthroughwholegenometranscriptionprolingof Vibrio cholerae biolmdevelopment.Mol.Microbiol. 57: 1623. 8. OToole,G.A.,andR.Kolter. 1998.Initiationofbiolmformationin Pseudomonasuorescens WCS365proceedsviamultiple,convergentsignallingpathways:ageneticanalysis.Mol.Microbiol. 28: 449. 9. Park,Y.,R.Simionato,K.Sekiya,Y.Murakami,D.James,W.Chen,M. Hackett,F.Yoshimura,D.R.Demuth,andR.J.Lamont. 2005.Short mbriaeof Porphyromonasgingivalis andtheirroleincoadhesionwith Streptococcusgordonii .Infect.Immun. 73: 3983. 10. Park,Y.,O.Yilmaz,I.Y.Jung,andR.J.Lamont. 2004.Identicationof Porphyromonasgingivalis genesspecicallyexpressedinhumangingivalepithelialcellsbyusingdifferentialdisplayreversetranscription-PCR.Infect. Immun. 72: 3752. 11. Quirynen,M.,R.Vogels,M.Pauwels,A.D.Haffajee,S.S.Socransky,N.G. Uzel,andD.vanSteenberghe. 2005.Initialsubgingivalcolonizationofpristinepockets.J.Dent.Res. 84: 340. 12. Sabet,C.,M.Lecuit,D.Cabanes,P.Cossart,andH.Bierne. 2005.LPXTG proteinInlJ,anewlyidentiedinternalininvolvedin Listeriamonocytogenes virulence.Infect.Immun. 73: 6912. 13. Scannapieco,F.A.,L.Solomon,andR.O.Wadenya. 1994.Emergenceof humandentalplaqueandhostdistributionofamylase-bindingstreptococci. J.Dent.Res. 73: 1627. 14. Socransky,S.S.,A.D.Haffajee,M.A.Cugini,C.Smith,andR.L.Kent. 1998.Microbialcomplexesinsubgingivalplaque.J.Clin.Periodontol. 25: 134. 15. Stanley,N.R.,andB.A.Lazazzera. 2004.Environmentalsignalsandregulatorypathwaysthatinuencebiolmformation.Mol.Microbiol. 52: 917 924. 16. Venturi,V. 2003.Controlof rpoS transcriptionin Escherichiacoli and Pseudomonas :whysodifferent.Mol.Microbiol. 49: 1. 17. Whiteley,M.,M.G.Bangera,R.E.Bumgarner,M.R.Parsek,G.M.Teitzel, S.Lory,andE.P.Greenberg. 2001.Geneexpressionin Pseudomonasaeruginosa biolms.Nature 413: 860. 18. Zhang,Y.,T.Wang,W.Chen,O.Yilmaz,Y.Park,I.Y.Jung,M.Hackett, andR.J.Lamont. 2005.Differentialproteinexpressionby Porphyromonas gingivalis inresponsetosecretedepithelialcellcomponents.Proteomics 5: 198. Editor: V.J.DiRitaVOL.74,2006 NOTES3005

PAGE 98

LIST OF REFERENCES 1. Aas, J. A., Paster, B. J., Stokes, L. N., Olsen, I. & De whirst, F. E. (2005) J Clin Microbiol 43, 5721-32. 2. Duncan, M. J. (2003) Crit Rev Oral Biol Med 14, 175-87. 3. Burt, B. (2005) J. Periodontol. 76, 1406-1419. 4. Lamont, R. J., and H. F. Jenkinson (1998) Microbiol. Mol. Biol. Rev. 62, 1244-1263. 5. Teng, Y. T., Taylor, G. W., Scannapieco, F., Kinane, D. F., Curtis, M., Beck, J. D. & Kogon, S. (2002) J Can Dent Assoc 68, 188-92. 6. Williams, R. C. & Offenbacher, S. (2000) Periodontol 2000 23, 9-12. 7. Welkerling, H., Geissdorfer, W ., Aigner, T. & Forst, R. (2006) J Clin Microbiol 44, 3835-7. 8. Michaud, D. S. (2007) J Natl Cancer Inst 99, 739. 9. Lamont, R. J. & Jenkinson, H. F. (2000) Oral Microbiol Immunol 15, 341-9. 10. Takahashi, N., Sato, T. & Yamada, T. (2000) J Bacteriol 182, 4704-10. 11. Woese, C. R. (1987) Microbiol Rev 51, 221-71. 12. Grenier, D. & Mayrand, D. (1987) J Clin Microbiol 25, 738-40. 13. Holt, S. C., Kesavalu, L., Walker, S. & Genco, C. A. (1999) Periodontol 2000 20, 168238. 14. Tuite-McDonnell, M., Griffen, A. L., Moeschbe rger, M. L., Dalton, R. E., Fuerst, P. A. & Leys, E. J. (1997) J Clin Microbiol 35, 455-61. 15. Noiri, Y., Ozaki, K., Nakae, H., Matsuo, T. & Ebisu, S. (1997) J Periodontal Res 32, 598-607. 16. Tanaka, S., et (2003) Periatr. Dent. 25, 143-148. 17. Ximenez-Fyvie, L. A., et (2000) J. Clin. Periodontol. 27, 722-732. 18. Marsh, P. D. (1994) Adv Dent Res 8, 263-71. 19. Rosan, B. & Lamont, R. J. (2000) Microbes Infect 2, 1599-607. 20. Kolenbrander, P. E. & London, J. (1993) J Bacteriol 175, 3247-52. 21. O'Toole, G. A. & Kolter, R. (1998) Mol Microbiol 30, 295-304. 98

PAGE 99

22. Lin, X., Wu, J. & Xie, H. (2006) Infect Immun 74, 6011-5. 23. Cook, G. S., Costerton, J. W. & Lamont, R. J. (1998) J Periodontal Res 33, 323-7. 24. Amano, A., I. Nakagawa, K. Kataoka I. Morisaki, and S. Hamada. (1999) J. Clin. Microbiol. 37, 1426-1430. 25. Hamada, N., Sojar, H. T., Cho, M. I. & Genco, R. J. (1996) Infect Immun 64, 4788-94. 26. Ogawa, T., Yasuda, K., Yamada, K., Mo ri, H., Ochiai, K. & Hasegawa, M. (1995) FEMS Immunol Med Microbiol 11, 247-55. 27. Hamada, S., Fujiwara, T., Morishima, S., Takahashi, I., Nakagawa, I., Kimura, S. & Ogawa, T. (1994) Microbiol Immunol 38, 921-30. 28. Nakagawa, I., Amano, A., Ohara-Nemoto Y., Endoh, N., Morisaki, I., Kimura, S., Kawabata, S. & Hamada, S. (2002) J Periodontal Res 37, 425-32. 29. Dickinson, D. P., Kubiniec, M. A., Yoshimura, F. & Genco, R. J. (1988) J Bacteriol 170, 1658-65. 30. Maeda, K., Nagata, H., Yamamoto, Y., Tanaka, M., Tanaka, J., Minamino, N. & Shizukuishi, S. (2004) Infect Immun 72, 1341-8. 31. Chung, W. O., Demuth, D. R. & Lamont, R. J. (2000) Infect Immun 68, 6758-62. 32. Lamont, R. J., El-Sabaeny, A., Park, Y., Cook, G. S., Costerton, J. W. & Demuth, D. R. (2002) Microbiology 148, 1627-36. 33. Watanabe, K., Takasawa, T., Yoshimura, F., Ozeki, M., Kawanami, M. & Kato, H. (1992) FEMS Microbiol Lett 71, 47-55. 34. Ogawa, T., Mori, H., Yas uda, K. & Hasegawa, M. (1994) FEMS Microbiol Lett 120, 2330. 35. Hamada, N., Watanabe, K., Arai, M., Hiramine, H. & Umemoto, T. (2002) Oral Microbiol Immunol 17, 197-200. 36. Park, Y., Simionato, M. R., Sekiya, K., Mura kami, Y., James, D., Chen, W., Hackett, M., Yoshimura, F., Demuth, D. R. & Lamont, R. J. (2005) Infect Immun 73, 3983-9. 37. Jenkinson, H. F. & Lamont, R. J. (1997) Crit Rev Oral Biol Med 8, 175-200. 38. Brooks, W., Demuth, D. R., Gil, S. & Lamont, R. J. (1997) Infect Immun 65, 3753-8. 39. Demuth, D. R., Irvine, D. C., Costerton, J. W., Cook, G. S. & Lamont, R. J. (2001) Infect Immun 69, 5736-41. 99

PAGE 100

40. Lamont, R. J., Chan, A., Belton, C. M., Izut su, K. T., Vasel, D. & Weinberg, A. (1995) Infect Immun 63, 3878-85. 41. Duncan, M. J., Nakao, S., Skobe, Z. & Xie, H. (1993) Infect Immun 61, 2260-5. 42. Dorn, B. R., Burks, J. N., Seifert, K. N. & Progulske-Fox, A. (2000) FEMS Microbiol Lett 187, 139-44. 43. Amornchat, C., S. Rassameemasmaung, W. Sripairojthikoon, and S. Swasdison (2003) J. Int. Acad. Periodontol. 5, 98-105. 44. Rosenshine, I., Duronio, V. & Finlay, B. B. (1992) Infect Immun 60, 2211-7. 45. Hueck, C. J. (1998) Microbiol Mol Biol Rev 62, 379-433. 46. Gauthier, A. & Finlay, B. B. (2001) Curr Biol 11, R264-7. 47. Park, Y. & Lamont, R. J. (1998) Infect Immun 66, 4777-82. 48. Portnoy, D. A., Auerbuch, V. & Glomski, I. J. (2002) J Cell Biol 158, 409-14. 49. Cutler, C. W., Kalmar, J. R. & Genco, C. A. (1995) Trends Microbiol 3, 45-51. 50. Yilmaz, O., Watanabe, K. & Lamont, R. J. (2002) Cell Microbiol 4, 305-14. 51. Hamada, N., Watanabe, K., Sasakawa, C., Yoshikawa, M., Yoshimura, F. & Umemoto, T. (1994) Infect Immun 62, 1696-704. 52. Malek, R., Fisher, J. G., Cal eca, A., Stinson, M., van Oss, C. J., Lee, J. Y., Cho, M. I., Genco, R. J., Evans, R. T. & Dyer, D. W. (1994) J Bacteriol 176, 1052-9. 53. Njoroge, T., Genco, R. J., Sojar, H. T., Hamada, N. & Genco, C. A. (1997) Infect Immun 65, 1980-4. 54. Sugano, N., Ikeda, K., Oshikawa, M., Sa wamoto, Y., Tanaka, H. & Ito, K. (2004) Oral Microbiol Immunol 19, 121-3. 55. Weinberg, A., Belton, C. M., Park, Y. & Lamont, R. J. (1997) Infect Immun 65, 313-6. 56. Nakagawa, I., Amano, A., Kuboniwa, M., Nakamura, T., Kawabata, S. & Hamada, S. (2002) Infect Immun 70, 277-85. 57. Amano, A., Nakagawa, I., Okahashi, N. & Hamada, N. (2004) J Periodontal Res 39, 13642. 58. Ogawa, T., Kono, Y., McGhee, M. L., McGh ee, J. R., Roberts, J. E., Hamada, S. & Kiyono, H. (1991) Clin Exp Immunol 83, 237-44. 100

PAGE 101

59. Yoshimura, F., Sugano, T., Kawanami M., Kato, H. & Suzuki, T. (1987) Microbiol Immunol 31, 935-41. 60. Ogawa, T. (1994) J Med Microbiol 41, 349-58. 61. Evans, R. T., Klausen, B., Sojar, H. T., Bedi, G. S., Sfintescu, C., Ramamurthy, N. S., Golub, L. M. & Genco, R. J. (1992) Infect Immun 60, 2926-35. 62. Deslauriers, M., Haque, S. & Flood, P. M. (1996) Infect Immun 64, 434-40. 63. Ogawa, T., Ogo, H., Uchi da, H. & Hamada, S. (1994) J Med Microbiol 40, 397-402. 64. Ogawa, T., Uchida, H. & Hamada, S. (1994) FEMS Microbiol Lett 116, 237-42. 65. Hiramine, H., Watanabe, K., Ha mada, N. & Umemoto, T. (2003) FEMS Microbiol Lett 229, 49-55. 66. Chen, T., Nakayama, K., Belliveau, L. & Duncan, M. J. (2001) Infect Immun 69, 304856. 67. Tribble, G. D., Mao, S., Jame s, C. E. & Lamont, R. J. (2006) Proc Natl Acad Sci U S A 103, 11027-32. 68. Andrian, E., Grenier, D. & Rouabhia, M. (2006) J Dent Res 85, 392-403. 69. Potempa, J., Pike, R. & Travis, J. (1995) Infect Immun 63, 1176-82. 70. Potempa, J. & Travis, J. (1996) Acta Biochim Pol 43, 455-65. 71. Kadowaki, T., Nakayama, K., Yoshimura, F., Okamoto, K., Abe, N. & Yamamoto, K. (1998) J Biol Chem 273, 29072-6. 72. Belton, C. M., K. T. Izutsu, P. C. Goodwin, Y. Park, and R. J. Lamont (1999) Cell. Microbiol. 1, 215-223. 73. Izutsu, K. T., Belton, C. M., Chan, A., Father azi, S., Kanter, J. P., Park, Y. & Lamont, R. J. (1996) FEMS Microbiol Lett 144, 145-50. 74. Watanabe, K., Yilmaz, O., Nakhjiri, S. F., Belton, C. M. & Lamont, R. J. (2001) Infect Immun 69, 6731-7. 75. Yilmaz, O., Young, P. A., Lamont, R. J. & Kenny, G. E. (2003) Microbiology 149, 241726. 76. Nakhjiri, S. F., Park, Y., Yilmaz, O., Chung, W. O., Watana be, K., El-Sabaeny, A., Park, K. & Lamont, R. J. (2001) FEMS Microbiol Lett 200, 145-9. 77. Yilmaz, O., Jungas, T., Verbeke, P. & Ojcius, D. M. (2004) Infect Immun 72, 3743-51. 101

PAGE 102

78. Yilmaz, O., Verbeke, P., Lamont R. J. & Ojcius, D. M. (2006) Infect Immun 74, 703-10. 79. Zhang, Y., Wang, T., Chen, W., Yilmaz, O., Park, Y., Jung, I. Y., Hackett, M. & Lamont, R. J. (2005) Proteomics 5, 198-211. 80. Hosogi, Y. & Duncan, M. J. (2005) Infect Immun 73, 2327-35. 81. Park, Y., Yilmaz, O., Jung, I. Y. & Lamont, R. J. (2004) Infect Immun 72, 3752-8. 82. Gottesman, S. (1996) Annu Rev Genet 30, 465-506. 83. Butler, S. M., R. A. Festa, M. J. Pearce, K. H. Darwin (2006) Mol. Microbiol. 60, 553562. 84. Kessel, M., Maurizi, M. R., Kim, B., Kocsis, E., Trus, B. L., Singh, S. K. & Steven, A. C. (1995) J Mol Biol 250, 587-94. 85. Kruger, E., Witt, E., Ohlmeier, S ., Hanschke, R. & Hecker, M. (2000) J Bacteriol 182, 3259-65. 86. Wiegert, T. & Schumann, W. (2001) J Bacteriol 183, 3885-9. 87. Neuwald, A. F., Aravind, L., Spouge, J. L. & Koonin, E. V. (1999) Genome Res 9, 27-43. 88. Dougan, D. A., Mogk, A., Zeth, K., Turgay, K. & Bukau, B. (2002) FEBS Lett 529, 6-10. 89. Frees, D., Savijoki, K., Varmanen, P. & Ingmer, H. (2007) Mol Microbiol 63, 1285-95. 90. Thomsen, L. E., Olsen, J. E., Foster, J. W. & Ingmer, H. (2002) Microbiology 148, 272733. 91. Ibrahim, Y. M., Kerr, A. R., Silv a, N. A. & Mitchell, T. J. (2005) Infect Immun 73, 73040. 92. Frees, D., Chastanet, A., Qazi, S., Sorensen K., Hill, P., Msadek, T. & Ingmer, H. (2004) Mol Microbiol 54, 1445-62. 93. Gaillot, O., Pellegrini, E., Bregenholt, S., Nair, S. & Berche, P. (2000) Mol Microbiol 35, 1286-94. 94. Chastanet, A., J. Fert, and T. Msadek (2003) Mol. Microbiol. 47, 1061-1073. 95. Chastanet, A., I. Derre, S. Nair, and T. Msadek (2004) J. Bacteriol. 186, 1165-1174. 96. Weibezahn, J., Tessarz, P., Schlieker, C., Za hn, R., Maglica, Z., Lee, S., Zentgraf, H., Weber-Ban, E. U., Dougan, D. A., Tsai, F. T., Mogk, A. & Bukau, B. (2004) Cell 119, 653-65. 97. Jackson, M. W., Silva-Herz og, E. & Plano, G. V. (2004) Mol Microbiol 54, 1364-78. 102

PAGE 103

98. Ellison, D. W., Young, B., Nelson, K. & Miller, V. L. (2003) J Bacteriol 185, 7153-9. 99. Pederson, K. J., Carlson, S. & Pierson, D. E. (1997) Mol Microbiol 26, 99-107. 100. Novick, R. P. (2003) Mol Microbiol 48, 1429-49. 101. Frees, D., Qazi, S. N., Hill, P. J. & Ingmer, H. (2003) Mol Microbiol 48, 1565-78. 102. Frees, D., Sorensen, K. & Ingmer, H. (2005) Infect Immun 73, 8100-8. 103. Tomoyasu, T., Takaya, A., Handa, Y ., Karata, K. & Yamamoto, T. (2005) FEMS Microbiol Lett 253, 59-66. 104. Nair, S., Milohanic, E. & Berche, P. (2000) Infect Immun 68, 7061-8. 105. Geoffroy, C., Gaillard, J. L., Alouf, J. E. & Berche, P. (1987) Infect Immun 55, 1641-6. 106. Chatterjee, I., P. Becker, M. Grundmeier, M. Bischoff, G. A. Somerville, G. Peters, B. Sinha, N. Harraghy, R. A. Proc tor, and M. Herrmann (2005) J. Bacteriol. 187, 44884496. 107. Badger, J. L., B. M. Young, A. J. Darwin, and V. L. Miller (2000) J. Bacteriol. 182, 5563-5571. 108. Goff, S. A. & Goldberg, A. L. (1985) Cell 41, 587-95. 109. Somero, G. N. (1995) Annu Rev Physiol 57, 43-68. 110. Frees, D. & Ingmer, H. (1999) Mol Microbiol 31, 79-87. 111. Rajapakse, P. S., O'Brien-Simpson, N. M ., Slakeski, N., Hoffmann, B. & Reynolds, E. C. (2002) Infect Immun 70, 2480-6. 112. Kuwayama, H., Obara, S., Morio, T., Kat oh, M., Urushihara, H. & Tanaka, Y. (2002) Nucleic Acids Res 30, E2. 113. Gardner, R. G., Russell, J. B., Wilson, D. B., Wang, G. R. & Shoemaker, N. B. (1996) Appl Environ Microbiol 62, 196-202. 114. Gottesman, S. (2003) Annu Rev Cell Dev Biol 19, 565-87. 115. Lu, B. & McBride, B. C. (1994) Oral Microbiol Immunol 9, 166-73. 116. Roy, F., Vanterpool, E. & Fletcher, H. M. (2006) Microbiology 152, 3391-8. 117. He, J., Miyazaki, H., Anaya, C., Yu, F ., Yeudall, W. A. & Lewis, J. P. (2006) Infect Immun 74, 4214-23. 118. O'Toole, G. A. (2003) J Bacteriol 185, 2687-9. 103

PAGE 104

119. Vandecasteele, S. J., Peetermans, W. E., Merckx, R. & Van Eldere, J. (2003) J Infect Dis 188, 730-7. 120. Costerton, J. W. (1999) Int J Antimicrob Agents 11, 217-21; discussion 237-9. 121. Donlan, R. M. (2002) Emerg Infect Dis 8, 881-90. 122. Fux, C. A., Wilson, S. & Stoodley, P. (2004) J Bacteriol 186, 4486-91. 123. Costerton, W., Veeh, R., Shirtliff, M., Pasmore, M., Post, C. & Ehrlich, G. (2003) J Clin Invest 112, 1466-77. 124. Lapaglia, C. & Hartzell, P. L. (1997) Appl Environ Microbiol 63, 3158-3163. 125. Lemos, J. A. & Burne, R. A. (2002) J Bacteriol 184, 6357-66. 126. Kuboniwa, M., Tribble, G. D., James, C. E ., Kilic, A. O., Tao, L., Herzberg, M. C., Shizukuishi, S. & Lamont, R. J. (2006) Mol Microbiol 60, 121-39. 127. Moorthy, S. & Watnick, P. I. (2005) Mol Microbiol 57, 1623-35. 128. Socransky, S. S., Haffajee, A. D., Cugini M. A., Smith, C. & Kent, R. L., Jr. (1998) J Clin Periodontol 25, 134-44. 129. Heydorn, A., Ersboll, B., Kato, J., Hentzer, M., Parsek, M. R., Tolker-Nielsen, T., Givskov, M. & Molin, S. (2002) Appl Environ Microbiol 68, 2008-17. 130. Whiteley, M., Bangera, M. G., Bumgarner, R. E., Parsek, M. R., Teitzel, G. M., Lory, S. & Greenberg, E. P. (2001) Nature 413, 860-4. 131. Venturi, V. (2003) Mol Microbiol 49, 1-9. 132. Capestany, C. A., Kuboniwa, M., Jung, I. Y., Park, Y., Tribble, G. D. & Lamont, R. J. (2006) Infect Immun 74, 3002-5. 133. McNab, R., Ford, S. K., El-Sabaeny, A., Barb ieri, B., Cook, G. S. & Lamont, R. J. (2003) J Bacteriol 185, 274-84. 134. Chen, W., Laidig, K. E., Park, Y., Park, K., Yates, J. R., 3rd, Lamont, R. J. & Hackett, M. (2001) Analyst 126, 52-7. 135. Tomoyasu, T., Takaya, A., Isogai, E. & Yamamoto, T. (2003) Mol Microbiol 48, 443-52. 136. Amano, A. (2003) J Periodontol 74, 90-6. 137. Imamura, T. (2003) J Periodontol 74, 111-8. 138. Rouquette, C., de Chastellier, C ., Nair, S. & Berche, P. (1998) Mol Microbiol 27, 123545. 104

PAGE 105

139. Kontani, M., Kimura, S., Nakagawa, I. & Hamada, S. (1997) Mol Microbiol 24, 1179-87. 140. Nassar, H., Chou, H. H., Khlgatian, M., Gibs on, F. C., 3rd, Van Dyke, T. E. & Genco, C. A. (2002) Infect Immun 70, 268-76. 141. Potempa, J., Banbula, A. & Travis, J. (2000) Periodontol 2000 24, 153-92. 142. Akira, S., Takeda, K. & Kaisho, T. (2001) Nat Immunol 2, 675-80. 143. Yin, J. L., Shackel, N. A., Zekry, A., Mc Guinness, P. H., Richards, C., Putten, K. V., McCaughan, G. W., Eris, J. M. & Bishop, G. A. (2001) Immunol Cell Biol 79, 213-21. 144. Liu, J., Cosby, W. M. & Zuber, P. (1999) Mol Microbiol 33, 415-28. 145. Farrell, C. M., Grossman, A. D. & Sauer, R. T. (2005) Mol Microbiol 57, 1750-61. 146. Michel, A., Agerer, F., Hauck, C. R., Herrma nn, M., Ullrich, J., Hacker, J. & Ohlsen, K. (2006) J Bacteriol 188, 5783-96. 147. Yuan, L., Hillman, J. D. & Progulske-Fox, A. (2005) Infect Immun 73, 4146-54. 148. Diaz, P. I., Slakeski, N., Reynolds, E. C., Morona, R., Rogers, A. H. & Kolenbrander, P. E. (2006) J Bacteriol 188, 2454-62. 149. Brotz-Oesterhelt, H., Beyer, D., Kroll, H. P., Endermann, R., Ladel, C., Schroeder, W., Hinzen, B., Raddatz, S., Paulsen, H., Henni nger, K., Bandow, J. E., Sahl, H. G. & Labischinski, H. (2005) Nat Med 11, 1082-7. 150. Narberhaus, F. (1999) Mol Microbiol 31, 1-8. 151. Bukau, B. (1993) Mol Microbiol 9, 671-80. 152. Flynn, J. M., Neher, S. B., Kim, Y. I., Sauer, R. T. & Baker, T. A. (2003) Mol Cell 11, 671-83. 153. Levchenko, I., Luo, L. & Baker, T. A. (1995) Genes Dev 9, 2399-408. 154. Kruklitis, R., Welty, D. J. & Nakai, H. (1996) Embo J 15, 935-44. 155. Jones, J. M., Welty, D. J. & Nakai, H. (1998) J Biol Chem 273, 459-65. 156. Schlothauer, T., Mogk, A., Dougan, D. A., Bukau, B. & Turgay, K. (2003) Proc Natl Acad Sci U S A 100, 2306-11. 157. Kirstein, J., Schlothauer, T., Dougan, D. A., Lilie, H., Tischendorf, G., Mogk, A., Bukau, B. & Turgay, K. (2006) Embo J 25, 1481-91. 105

PAGE 106

BIOGRAPHICAL SKETCH Cindy Ann Capestany was born in Hialeah, Florida to Jesus and Nancy Capestany. She attended her primary and secondary education in the Orlando-Kissimmee ar ea, Florida where she graduated from Gateway High School in 1999. She received her Bachelor of Science in Microbiology and Cell S cience in 2003 from Univ ersity of Florida. In the fall of 2003, she continued her education by pursuing the degree of Doctor of Philosophy in Medical SciencesImmunology and Microbiology at Un iversity of Florida under th e supervision of Richard J. Lamont. Cindy was married to David W. Bassf ord in 2005 while attending graduate school. Upon completing her degree requirements, she plan s to enter the physician assistant program at University of Florida. She hopes to utilize bo th her research and clin ical backgrounds in her career. On a more personal note, she enjoys various at hletic and outdoor activities and desires to travel to numerous famous and exotic places. 106