<%BANNER%>

Mycoplasma bovis Infection of Dairy Calves

Permanent Link: http://ufdc.ufl.edu/UFE0020660/00001

Material Information

Title: Mycoplasma bovis Infection of Dairy Calves
Physical Description: 1 online resource (269 p.)
Language: english
Creator: Maunsell, Fiona Pauline
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2007

Subjects

Subjects / Keywords: bovis, calves, cattle, immune, mycoplasma, otitis, responses, vaccination, vaccine
Veterinary Medicine -- Dissertations, Academic -- UF
Genre: Veterinary Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Mycoplasma bovis is an important cause of pneumonia, otitis media and arthritis in young dairy calves, and there is a critical need to develop improved preventative strategies for this disease. Because there is a lack of efficacy data for M. bovis vaccines, especially in young calves, we evaluated a commercial M. bovis vaccine in this age group. However, our major research focus was to define local immune responses to M. bovis in young calves. Specific objectives were to develop a reproducible model of M. bovis infection of the upper respiratory tract (URT) that mimicked natural infection and to define lymphocyte responses generated along the respiratory tract during M. bovis infection in young calves. A field trial to determine the efficacy of a commercial M. bovis vaccine for the prevention of M. bovis-associated disease in calves was conducted on three Florida dairies. Vaccination had no effect on rates of nasal colonization with M. bovis, age at first treatment, incidence of respiratory disease, or mortality to 90 days of age. In one herd, vaccination was associated with an increased risk of otitis media. We defined a model of M. bovis infection that mimics natural disease by feeding milk containing M. bovis to young calves. Mycoplasma bovis consistently colonized the eustachian tubes as well as the tonsils of inoculated calves, and otitis media and pneumonia developed in a subset of calves. Evaluation of immune responses along the respiratory tract showed that the infection site corresponded to the distribution of immune responses. The URT lymphoid tissues were major sites for B and T cell responses after oral infection, and M. bovis-specific mucosal IgA responses were observed. Overall, we found that local immune responses are important in the pathogenesis of M. bovis. The oral inoculation model will facilitate further study of host-pathogen interactions during colonization, expansion of infection and dissemination to the lungs and middle ear, as well as providing a tool for evaluating new control strategies for M. bovis infection of young calves.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Fiona Pauline Maunsell.
Thesis: Thesis (Ph.D.)--University of Florida, 2007.
Local: Adviser: Brown, Mary B.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2010-08-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2007
System ID: UFE0020660:00001

Permanent Link: http://ufdc.ufl.edu/UFE0020660/00001

Material Information

Title: Mycoplasma bovis Infection of Dairy Calves
Physical Description: 1 online resource (269 p.)
Language: english
Creator: Maunsell, Fiona Pauline
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2007

Subjects

Subjects / Keywords: bovis, calves, cattle, immune, mycoplasma, otitis, responses, vaccination, vaccine
Veterinary Medicine -- Dissertations, Academic -- UF
Genre: Veterinary Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Mycoplasma bovis is an important cause of pneumonia, otitis media and arthritis in young dairy calves, and there is a critical need to develop improved preventative strategies for this disease. Because there is a lack of efficacy data for M. bovis vaccines, especially in young calves, we evaluated a commercial M. bovis vaccine in this age group. However, our major research focus was to define local immune responses to M. bovis in young calves. Specific objectives were to develop a reproducible model of M. bovis infection of the upper respiratory tract (URT) that mimicked natural infection and to define lymphocyte responses generated along the respiratory tract during M. bovis infection in young calves. A field trial to determine the efficacy of a commercial M. bovis vaccine for the prevention of M. bovis-associated disease in calves was conducted on three Florida dairies. Vaccination had no effect on rates of nasal colonization with M. bovis, age at first treatment, incidence of respiratory disease, or mortality to 90 days of age. In one herd, vaccination was associated with an increased risk of otitis media. We defined a model of M. bovis infection that mimics natural disease by feeding milk containing M. bovis to young calves. Mycoplasma bovis consistently colonized the eustachian tubes as well as the tonsils of inoculated calves, and otitis media and pneumonia developed in a subset of calves. Evaluation of immune responses along the respiratory tract showed that the infection site corresponded to the distribution of immune responses. The URT lymphoid tissues were major sites for B and T cell responses after oral infection, and M. bovis-specific mucosal IgA responses were observed. Overall, we found that local immune responses are important in the pathogenesis of M. bovis. The oral inoculation model will facilitate further study of host-pathogen interactions during colonization, expansion of infection and dissemination to the lungs and middle ear, as well as providing a tool for evaluating new control strategies for M. bovis infection of young calves.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Fiona Pauline Maunsell.
Thesis: Thesis (Ph.D.)--University of Florida, 2007.
Local: Adviser: Brown, Mary B.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2010-08-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2007
System ID: UFE0020660:00001


This item has the following downloads:


Full Text





Mycoplasma bovis INFECTION OF DAIRY CALVES


By

FIONA P. MAUNSELL


















A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA

2007




























2007 Fiona P Maunsell



























To my parents, Pauline and John; and my husband, Fred.









ACKNOWLEDGMENTS

First and foremost, I am extremely grateful to my supervisory committee chair and

mentor (Dr. Mary Brown) for her infectious enthusiasm about the world of mycoplasmas and for

her wonderful encouragement and support. I am also extremely grateful to Dr. Art Donovan and

Dr. Jerry Simecka for giving me the opportunity to be involved in their research studies and for

their mentorship and support. I would especially like to thank Dr. Donovan for all his hands-on

help with the field studies and for helping me to keep a balanced perspective on the world! I wish

to thank Dr. Tom Brown, Dr. Peter Hansen, and Dr. Maureen Long for serving on my

supervisory committee and for the helpful advice they have provided.

I acknowledge the many members of the Brown lab who have worked so hard on these

research projects. A large number of people were involved and without their participation the

work presented here would not have been possible. Barbara Crenshaw and Janet Stevens have

helped me with so many things through my lengthy doctoral studies, including (but not limited

to) keeping me stocked with all of the supplies I need, keeping me and my technicians paid,

helping plan, set up and conduct experimental studies and running laboratory assays. They have

also provided wonderful shoulders to lean on when shoulders were needed! Many thanks to Dina

Demcovitz for her help with assays and her ever-positive attitude in the laboratory. My fellow

graduate students in our laboratory have given me help and support during these research studies.

In particular I thank Carolina Perez-Heydrich for her assistance with data analysis, and LeAnn

White for her help on the calf infection studies, especially for her fantastic organizational skills.

Ayman Allam has provided helpful discussions and assistance with experimental design as well

as friendship accompanied by many wonderful cups of tea. Thank you to my office mates Dr.

Margaret Riggs and Dr. Lori Wendland for their help with problem solving and for their

friendship. I am very appreciative for the numerous helpful suggestions and fresh perspectives on









problems in the laboratory that Dr. Leticia Reyes and Dr. Dan Brown have provided during my

doctoral research.

For their contributions to the vaccine efficacy field trial, I would like to thank Shelly

Lanhart for her skilled help in sample collection and for keeping me awake on the many trips

back and forth to the study farms, and Drs. Eduardo Garbarino and Christian Steenholdt for

taking many of the photographs for this study. In addition, I appreciate the contributions to study

design and analyses made by Dr. Carlos Risco, Dr. Jorge Hernandez and David Bray. For their

help with the laboratory work I thank Dr. Marissa Curtis and Dr. Kelly Kirk. I am deeply

indebted to the herd owners who agreed to participate in the study and to the calf-rearing

personnel who recorded data and vaccinated calves. In particular, I thank Sherry Hay and the rest

of the heifer crew at the UF Dairy Research Unit for their help with both this study and with

providing the calves for the experimental infection studies.

For their contributions to the calf infection studies, I thank the members of the Simecka

laboratory that traveled to Florida to assist with calf necropsies, especially Drew Ivey, Dr.

Matthew Woodard and Wees Love. In particular I thank Drew for his work optimizing the flow

cytometry and ELIspot assays. Calf necropsies necessitated the help of almost all members of

our laboratory and I am deeply grateful to all of them for their willingness to adjust their

schedules and participate. In particular, I thank Janet Stevens and Barbara Crenshaw for their

help with managing these studies and with the culture work, Dina Demcovitz for help with the

lymphocyte assays and Venus Appel and Annette Mach for their work on the insertion sequence

typing. Dr. Joshua Powe, Dr. William Castleman and Dr. Jeffery Abbott helped me with the

development of the histopathological scoring systems and with the reading of slides. In particular

I am indebted to Dr. Powe for all his help with the processing and reading of the middle ear









samples. A number of people assisted with the care and sampling of calves; in particular I thank

Erin Barney, Jessica Coan, Katherine Sayler, Mason Simmons, Dr. Lindsay Smith and LeAnn

White for their wonderful assistance. I thank Rachelle Wright and Luis Zorilla, as well as all the

members of the large animal team in UF Animal Care Services, for working so hard to

accommodate my needs and for doing a great job of caring for the calves.

Above all, I am deeply indebted to my husband Fred for his love and support, and for

hanging in there through my very lengthy academic career.

The research in this dissertation was supported by Florida Dairy Checkoff funds and

USDA NRI Animal Health & Well-Being award 2002-02147.









TABLE OF CONTENTS



A C K N O W L E D G M E N T S ..............................................................................................................4

L IS T O F T A B L E S ............................................................................................... ..................... 10

LIST OF FIGURES ............................................. .. ......... ............................ 11

A B S T R A C T ............... ................................................................ .......................................... 13

CHAPTER

1 Mycoplasma bovis AND BOVINE IMMUNOLOGY: REVIEW OF LITERATURE.......... 15

O v e rv ie w ................................................................................................................................. 1 5
Calf Specific Disease ......................... ..... .. ......... ........... ............... 16
Evidence forM. bovis as an Etiologic Agent of Calf Disease.................................... 16
C clinical D disease in D airy C alves ....................................... ...................... ............... 18
E co n o m ic L o sse s ............................................................................................................. 2 5
A n im al W welfare ............................................................................................................... 2 7
E pidem biology .............................................................................................................. 27
C olonization and Shedding ...................................................................... ................ 27
Transm mission and R isk Factors..................................... ........................ ................ 29
M olecular Epidem iology ...................... ................................................................ 39
P ath o lo g y ............................................................................................................. ....... .. 4 0
D iag n o sis ............................................................................................................. ....... .. 4 5
T reatm ent ............................................................................................ ........ 53
C control an d P rev mention ........................................................................................................... 57
M icrob ial P ath og en esis........................................................................................................... 6 1
A ntig enic V aviation .................................................. .............................................. 6 1
A d h e sio n ......................................................................................................... ........ .. 6 3
B iofi lm s .............. ................................. ................. .. . .................................. ........ 64
Other Microbial Factors That Might Contribute to M. bovis Virulence.......................66
Bovine Immunology: Relevant Background Information ................................................67
Lymphocyte Subpopulations in Cattle .................. ......... ... ................................67
Anatomical Barriers and Innate Defenses of the Bovine Respiratory Tract ................72
Adaptive Immune Responses of the Bovine Respiratory Tract .................................74
Im m unology of the N eonatal C alf .......................................... ........................ ................ 75
Influence of Colostrum ................. ............................... 76
Innate Immune Responses in Neonatal Calves ..........................................................78
Adaptive Immune Responses in Neonatal Calves......................................................79
Summary of the Neonatal Calf Immune Response ....................................................83
Immunology of the Eustachian Tube and Middle Ear.......................................................84
Immune Responses to Mycoplasmal Infections, with a Focus on M. bovis........................ 87
Innate Immune Responses to Mycoplasmal Infections .............................................88









Adaptive Immune Responses to Mycoplasmal Infections .........................................92
Humoral Immune Responses to M bovis in Cattle .................................... ................ 94
Function of Humoral Responses to Mycoplasmal Infections.....................................97
The Role of T Cell Responses to Mycoplasmal Infections .......................................... 99
Cytokine and T Helper Subset Responses to Mycoplasmal Infections...................... 102
Recruitment of T Cells in Mycoplasmal Infections .............................................103
Immunomodulatory Effects of M bovis on Bovine Lymphocytes ............................ 104
Hypersensitivity Responses to M bovis Infections...... ....................................... 105
P protective Im m unity to M bovis ........................................................................ ............... 106
Relevant Experiences with Mycoplasmal Vaccines for Diseases Other Than
M b o vis ............................................................................................ ......... .......... 10 6
V accination A against M bovis............................................................. ............... 110
Experimental Infection with M bovis in Calves ............... .......................115
Summary and Critical Gaps in Knowledge ................ ........ ......................116
O v erall G o als o f Stu d y ............................................................ ..................................... ... ... 1 18

2 FIELD EVALUATION OF A Mycoplasma bovis BACTERIA IN YOUNG DAIRY
C A L V E S ..................................................................................................... .................... 12 4

Intro du action ......................................................................................................... ........ .. 12 4
M methods ........................................................................................................ 127
Study P populations ................ .. .................. .................. .......................... ............... 127
S tu d y D e sig n ............... ..... ................................................................................... 12 8
Collection and Processing of Nasal Swabs .......... .........................130
The ELISA Procedure ........................... .......... ........................ 132
F field N e cro p sy .............................................................................................................. 13 3
S a m p le S iz e ................................................................................................................. .. 1 3 4
Statistical M eth od s .................................................. .............................................. 13 5
R results ........................................................................................................... 135
D discussion ................................................................................................... 138

3 ORAL INOCULATION OF DAIRY CALVES WITH Mycoplasma bovis RESULTS
IN RESPIRATORY TRACT INFECTION AND OTITIS MEDIA: ESTABLISHMENT
OF A MODEL OF AN EMERGING PROBLEM .................................... ..................... 153

Introduction .................................................................................................. 153
M eth o d s ....................................................................................................... .................... 1 5 5
C a lv e s .................. .......................................................................................... ......... 1 5 5
Strain ofM bovis and Experimental Infection ....................................... ............... 156
Clinical Monitoring and Sample Collection........................................157
Collection of Tissues ...................................... ...........................158
H isto p ath o lo g y .............................................................................................................. 15 9
M icro b io lo g y ................................................................................................................ 16 0
Insertion Sequence Typing ................................................................. ............... 161
The ELISA Procedure ........................... .......... ........................ 163
Statistical A n aly sis ........................................................................................................ 16 5
R esu lts ................................................................................................ .......... 16 5









Oral Inoculation of Calves and Development of Clinical Disease............................. 165
Colonization of the Upper Respiratory Tract ........................................... ............... 167
Isolation ofM bovis from Lungs and Clinical Signs of Respiratory Disease............ 168
Colonization of the Tonsil and Development of Disease................... ...................168
Gross and Histopathologic Lesions ....... ............ ............ ..................... 169
Im m unoglobulin R response ................................................................. ............... 170
D discussion ................................................................................................... 171

4 IMMUNE RESPONSES IN THE RESPIRATORY TRACT OF CALVES INFECTED
W ITH M ycop lasm a bovis .................................................. ............................................. 188

Introduction .................................................................................................. 188
M materials and M ethods .................................................... ............................................... 193
C alv e s .................. ........................................................................................ .......... 19 3
Strain ofM bovis and Experimental Infection ........................................ ............... 194
Preparation of Mononuclear Cells from Blood and Tissues ............... ...................195
Immunofluorescent Characterization of T Cell Populations............... .................. 196
E L Isp o t A ssay ............................................................................................................... 19 7
The ELISA Procedure ........................... .......... ........................ 198
Statistical A nalyses ............. .. .................. .................. .......................... ............... 199
R e su lts ..... . ..................... .. .. ............. .. ................................................................................. 2 0 0
Isolation ofM. bovis from Experimentally Infected Calves................ ...................200
Clinical Disease and Pathology in Experimentally Infected Calves ...........................200
Complete Blood Counts and T Cell Responses in Peripheral Blood and Spleen..........201
T Cell Populations in the URT and LRT...........................................202
B cell and A antibody R responses .................................... ...................... ................ 202
D discussion ................................................................................................... 205

5 CONCLUSIONS AND FUTURE DIRECTIONS ................. ......................................217

Field Efficacy of a Commercial M. bovis Bacterin in Young Dairy Calves ......................217
Establishment of an Experimental Model ofM. bovis Infection and Immune Responses
in the Respiratory Tract of Infected Neonatal Calves.................................. ................ 219
Implications for Control ofM bovis in Young Calves and Future Research Directions.....221

L IST O F R E F E R E N C E S ....................................................... ................................................ 227

B IO G R A PH IC A L SK E T C H .................................................... ............................................. 269









LIST OF TABLES


Table page

2-1 Clinical definitions of disease used by calf producers during this study .......................144

2-2 Summary of calves enrolled in vaccine field efficacy study ................ ...................145

2-3 Incidence risk for Mycoplasma bovis-associated disease and mortality between 3 and
90 days of age in calves in the three study herds....... ... ...................................... 145

2-4 Baseline data for calves in Herds B and C..........................................145

2-5 The age at which calves in Herds B and C received their first treatment for otitis
m edia or respiratory disease .................................................................. ............... 146

2-6 Temporal expression of Mycoplasma bovis-associated disease in vaccinated and
control calves in H erds B and C .......................................................... 146

2-7 Morbidity due to respiratory disease in vaccinated and control calves .........................147

2-8 Morbidity due to otitis media in vaccinated and control calves .................................147

2-9 Overall and Mycoplasma bovis-associated mortality in vaccinated and control calves ..148









LIST OF FIGURES


Figure page

1-1 Clinical manifestations ofMycoplasma bovis-associated respiratory disease..............1...19

1-2 Clinical manifestations and macroscopic lesions ofMycoplasma bovis-associated
otitis m edia.................................................................................................... ......... 12 0

1-3 Clinical manifestations and macroscopic lesions ofMycoplasma bovis-associated
arthritis and tenosynovitis .................................................................... ............... 12 1

1-4 Substantial economic costs are incurred for treatment and management of calves
with Mycoplasma bovis-associated disease .........................................122

1-5 Ingestion of milk contaminated with Mycoplasma bovis is a primary route of
transm mission in pre-w earned calves........................................................ ............... 123

2-1 Calf housing conditions for the three study farm s...................................... ................ 143

2-2 Sampling of a subset of calves in Herds A and B....... ... ...................................... 144

2-3 Temporal pattern of nasal colonization of calves by Mycoplasma bovis in Herds A
a n d B ..................................................................................................... ........ . ....... 14 8

2-4 Immunoglobulin A response in vaccinated and control calves ..................................149

2-5 Immunoglobulin M response in vaccinated and control calves..................150

2-6 Immunoglobulin G2 response in vaccinated and control calves.................................151

2-7 Immunoglobulin Gi response in vaccinated and control calves .................................152

3-1 Number of days that calves had a daily clinical score of> 2 ............... ...................178

3-2 The number of Mycoplasma bovis recovered at necropsy.................... ...................179

3-3 Relationship between the number of Mycoplasma bovis recovered from the left and
right eustachian tubes (L ET and R ET, respectively) and pharyngeal tonsils in calves
inoculated with M bovis by either the oral (n=8) or transtracheal (n=5) routes ...........181

3-4 Macroscopic lesions of otitis media in calves orally inoculated with Mycoplasma
b o v is ....................................................................................................... ........ . ....... 1 8 2

3-5 Histopathology of retropharyngeal lymph nodes from control calves (n 8) or calves
inoculated with Mycoplasma bovis by oral (n 8) or transtracheal (n 5) routes ..........183









3-6 Representative histopathological findings in retropharyngeal lymph nodes of calves
inoculated with sterile carrier (controls) or with Mycoplasma bovis by oral or
transtracheal routes .......................... ............ ............................. 184

3-7 Representative macroscopic lung lesion in a calf experimentally infected with
M ycoplasma bovis by the oral route ....... ........... ............ ...................... 185

3-8 Histopathological findings in the lungs of calves inoculated with sterile carrier
(controls, n 8) or with Mycoplasma bovis by oral (n 8) or transtracheal (n 5)
routes ........................................................................................... ......... 186

3-9 Geometric mean end-point titers for Mycoplasma bovis-specific serum IgG .................187

4-1 Overall experimental design for the infection study ............................. ..................... 209

4- 2 Weights (mean + SD) of upper and lower respiratory tract lymph nodes .....................210

4-3 Relative percentages of CD4+, CD8+ and WC1 y6 T cells in mononuclear cells
isolated from upper respiratory tract, lower respiratory tract, and systemic sites .........211

4-4 Mycoplasma bovis-specific B cell responses along the respiratory tract as determined
b y E L Isp ot assay .............................................................................................................. 2 13

4-5 Mucosal antibody responses in the upper respiratory tract................... ...................214

4-6 Mucosal antibody responses in the upper respiratory tract of individual calves with
or without otitis media .............................................................. 215

4-7 Geometric mean end-point titers for Mycoplasma bovis-specific serum
im m unoglobulin (Ig) ........................................................................................................ 2 16









Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

Mycoplasma bovis INFECTION OF DAIRY CALVES

By

Fiona P. Maunsell

August 2007

Chair: Mary B. Brown
Major: Veterinary Medical Sciences

Mycoplasma bovis is an important cause of pneumonia, otitis media and arthritis in young

dairy calves, and there is a critical need to develop improved preventative strategies for this

disease. Because there is a lack of efficacy data for M bovis vaccines, especially in young

calves, we evaluated a commercial M. bovis vaccine in this age group. However, our major

research focus was to define local immune responses to M bovis in young calves. Specific

objectives were to develop a reproducible model ofM bovis infection of the upper respiratory

tract (URT) that mimicked natural infection and to define lymphocyte responses generated along

the respiratory tract during M bovis infection in young calves.

A field trial to determine the efficacy of a commercial M. bovis vaccine for the

prevention ofM. bovis-associated disease in calves was conducted on three Florida dairies.

Vaccination had no effect on rates of nasal colonization with M bovis, age at first treatment,

incidence of respiratory disease, or mortality to 90 days of age. In one herd, vaccination was

associated with an increased risk of otitis media.

We defined a model ofM bovis infection that mimics natural disease by feeding milk

containing M bovis to young calves. Mycoplasma bovis consistently colonized the eustachian

tubes as well as the tonsils of inoculated calves, and otitis media and pneumonia developed in a









subset of calves. Evaluation of immune responses along the respiratory tract showed that the

infection site corresponded to the distribution of immune responses. The URT lymphoid tissues

were major sites for B and T cell responses after oral infection, and M. bovis-specific mucosal

IgA responses were observed. Overall, we found that local immune responses are important in

the pathogenesis ofM. bovis. The oral inoculation model will facilitate further study of host-

pathogen interactions during colonization, expansion of infection and dissemination to the lungs

and middle ear, as well as providing a tool for evaluating new control strategies forM bovis

infection of young calves.









CHAPTER 1
Mycoplasma bovis AND BOVINE IMMUNOLOGY: REVIEW OF LITERATURE

Overview

Mycoplasmas belong to the class Mollicutes (from the Latin mollis, soft; cutis, skin), a

group of bacteria so named because they lack cell walls, instead being enveloped by a complex

plasma membrane. Mollicutes are also characterized by their tiny size, small genomes (0.58 to

2.2 Mb), and low G + C content (24 to 33 mol %) (Razin et al., 1998). Perhaps as a direct

consequence of the limited biosynthetic capacity of their small genome, mycoplasmas usually

form an intimate association with host cells to obtain growth and nutritional factors necessary for

survival (Rosengarten et al., 2001). Mollicutes are found in a wide range of hosts including

mammals, birds, reptiles, fish, arthropods and plants (Razin, 1992). Their individual relationship

with the host varies from primary or opportunistic pathogens to commensals or epiphytes.

In mammalian hosts, mollicutes typically inhabit mucosal surfaces, including those of the

respiratory, urogenital and gastrointestinal tracts, eyes, and the mammary gland (Rosengarten et

al., 2000). As is typical of many mucosal pathogens, pathogenic species of mollicutes may

inhabit some mucosal sites without causing disease (Rottem and Naot, 1998; Hickman-Davis,

2002). Disease occurs when host and/or pathogen factors result in dissemination to other sites

(e.g. from the nasal mucosa to the lower respiratory tract [LRT]), invasion and destruction of

host tissues, or a detrimental inflammatory response. Hematologic dissemination from mucosal

surfaces can occur, with the joints being a frequent site of secondary colonization (Simecka et

al., 1992). Mollicutes are very effective at evading and modulating the host immune response

and the immune response contributes significantly to the pathogenesis of many mollicute-

associated diseases (Simecka et al., 1992; Rosengarten et al., 2000).









Mycoplasma bovis was first isolated from a case of severe mastitis in a U. S. dairy cow in

1961 (Hale et al., 1962), and is now recognized as a world-wide pathogen of intensively-farmed

cattle. At least nine pathogenic and numerous non-pathogenic mycoplasma species have been

isolated from cattle (Simecka et al., 1992). The most severe ruminant disease is caused by

Mycoplasma mycoides subsp. mycoides biotype small colony (SC), the etiologic agent of

contagious bovine pleuropneumonia, an Office International des Epizootes List-A disease. In

North America and most of Europe, where contagious bovine pleuropneumonia has been

eradicated, M. bovis is considered the most pathogenic of the bovine mycoplasmas (Nicholas and

Ayling, 2003). It causes mastitis in dairy cows (Gonzalez et al., 1992; Pfutzner and Sachse,

1996; Fox et al., 2003; Gonzalez and Wilson, 2003) and pneumonia and arthritis in feeder and

stocker cattle (Kusiluka et al., 2000b; Haines et al., 2001; Tschopp et al., 2001; Shahriar et al.,

2002; Thomas et al., 2002a; Gagea et al., 2006). In addition, in the past decade M bovis has

emerged as an important cause of pneumonia and otitis media in dairy calves (Stipkovits et al.,

2001; Nicholas and Ayling, 2003; Francoz et al., 2004; Lamm et al., 2004).

Calf Specific Disease

Evidence for M. bovis as an Etiologic Agent of Calf Disease

It is now well established that M bovis is a primary cause of respiratory disease, otitis

media and arthritis in calves. There are many reports of respiratory disease outbreaks where

M. bovis was the predominant bacteria isolated from lungs of affected calves (Buchvarova and

Vesselinova, 1989; Gourlay et al., 1989a; Brown et al., 1998a; Stipkovits et al., 2000;

Bashiruddin et al., 2001; Rosenbusch, 2001; Stipkovits et al., 2001). In addition, although bovine

pneumonia rarely involves a single infectious agent, experimental infection studies have shown

that inoculation with M bovis alone can cause pneumonia in calves (Gourlay et al., 1976;

Thomas et al., 1986; Poumarat et al., 2001). Seroconversion toM. bovis is associated with









increased respiratory disease rates (Martin et al., 1990) as well as decreased weight gain and

increased number of antibiotic treatments in feedlot calves (Van Donkersgoed et al., 1993;

Tschopp et al., 2001). However, as with most bovine respiratory pathogens, colonization is not

always sufficient cause for disease. Mycoplasma bovis can be isolated from the upper respiratory

tract (URT), trachea, and LRT of calves without clinical disease or gross lesions (Bennett and

Jasper, 1977c; Springer et al., 1982; Allen etal., 1992a; Virtala etal., 1996b; Tenk etal., 2004),

although its presence in the LRT may cause subclinical inflammation (Allen et al., 1992b).

Despite these findings, isolation ofM bovis as the predominant pathogen in numerous outbreaks

of respiratory disease and experimental confirmation of its ability to cause pneumonia in calves

verify its role as an important respiratory pathogen.

Field cases of respiratory disease caused by M. bovis are sometimes accompanied by

arthritis, and M bovis has been isolated in pure culture from affected joints, as well as from the

lungs of calves with concurrent respiratory disease (Stalheim and Page, 1975; Stipkovits et al.,

1993; Rosenbusch, 1995; Adegboye et al., 1996; Butler et al., 2000; Byrne et al., 2001).

Consistent with the observations of natural disease, arthritis has been induced by inoculation of

M. bovis into joints or lungs, or intravenously (Stalheim and Page, 1975; Gourlay et al., 1976;

Chima et al., 1980; Ryan et al., 1983; Thomas et al., 1986; Linker et al., 1998). Variation among

clinical isolates ofM. bovis in their ability to cause arthritis in an experimental infection model

has been reported (Rosenbusch, 1995).

In addition to causing disease of the LRT and arthritis, M. bovis is the predominant

pathogen isolated from the middle ear of young calves with otitis media (Dechant and Donovan,

1995; Walz et al., 1997; Maeda et al., 2003; Francoz et al., 2004; Lamm et al., 2004). However,

other bacteria, including Mycoplasma bovirhinis, Mycoplasma alkalescens, Mycoplasma









arginini, Pasteurella multocida, Mannheimia haemolytica, Histophilus somni, and

Arcanobacteriumpyogenes are isolated sporadically, and some have been associated with

outbreaks of otitis media, especially in feedlot cattle (Jensen et al., 1983; Nation et al., 1983;

McEwen and Hulland, 1985; Henderson and McCullough, 1993; Dechant and Donovan, 1995;

Lamm et al., 2004; Gagea et al., 2006). In tropical regions of the world, parasitic otitis followed

by secondary mixed bacterial infections of the external and middle ear occurs (Duarte and

Hamdan, 2004).

Susceptibility to M bovis-induced otitis media is age-related, with the peak incidence of

clinical disease at 2-6 weeks of age (Dechant and Donovan, 1995; Walz et al., 1997). In one

recent study of feedlot cattle (Gagea et al., 2006), M. bovis was frequently isolated from the

tympanic bullae of animals with no clinical or gross lesions of otitis media, suggesting it is the

expression of clinical disease rather than dissemination to the middle ear which is affected by

age-related factors. Nonetheless, in the past 15 years, outbreaks of otitis media in groups of

North American dairy calves have been largely attributable to M. bovis infection (Dechant and

Donovan, 1995; Walz et al., 1997; Lamm et al., 2004). Experimental infection studies using

M. bovis to induce otitis media have not been published, however, nor has otitis media been

reported as a sequelae following experimental inoculation of M bovis in studies of respiratory

disease. Therefore, although current information strongly supports the role ofM bovis as a cause

of otitis media, more studies are required to fulfill Koch's postulates and to determine the host

pathogen interactions contributing to disease expression.

Clinical Disease in Dairy Calves

Clinical disease associated with M bovis infection of dairy calves typically presents as

pneumonia, otitis media or arthritis, or any combination of these (Stalheim and Page, 1975;

Rosenbusch, 1995; Walz et al., 1997; Brown et al., 1998a; Butler et al., 2000; Stipkovits et al.,









2001; Francoz et al., 2004; Lamm et al., 2004). Mycoplasma bovis has also been associated with

a variety of other less common clinical manifestations in calves, including tenosynovitis,

decubital abscesses and meningitis (Kinde et al., 1993; Stipkovits et al., 1993; Adegboye et al.,

1996). The age of onset of clinical disease in affected calves is typically between 2 and 6 weeks

(Walz et al., 1997; Brown et al., 1998a; Stipkovits et al., 2000; Stipkovits et al., 2001) but has

been reported as early as 4 days of age (Stipkovits et al., 1993). Clinical disease caused by

M. bovis tends to be chronic, debilitating and unresponsive to therapy (Gourlay et al., 1989a;

Allen et al., 1992a; Adegboye et al., 1995a; Apley and Fajt, 1998; Shahriar et al., 2000;

Stipkovits et al., 2000; Gagea et al., 2006). Chronic endemic disease as well as epizootics can

occur (Rodriguez et al., 1996).

Mycoplasma bovis-associated respiratory disease has a similar clinical presentation to

other types of calf pneumonia (Figure 1-1). Fever, loss of appetite, nasal discharge, coughing,

and both increased respiratory rate and effort are typically reported, and concurrent cases of otitis

media and arthritis may occur (Adegboye et al., 1996; Walz et al., 1997; Brown et al., 1998a;

Stipkovits et al., 2001; Francoz et al., 2004; Lamm et al., 2004). As for undifferentiated calf

pneumonia, auscultation reveals abnormal breath sounds including increased bronchial sounds,

crackles, wheezes, and areas of cranioventral consolidation in severe cases (Ames, 1997). Both

acute and chronic disease can occur, and mixed infections are common (Howard et al., 1987b;

Gourlay et al., 1989a; Virtala et al., 1996b; Mosier, 1997; Stipkovits et al., 2000; Poumarat et

al., 2001; Vogel et al., 2001; Thomas et al., 2002a). Calves with chronic pneumonia often

develop extreme dyspnea and emaciation (Ames, 1997).

Otitis media has been an increasingly recognized form of M. bovis-associated disease in

North American dairy calves over the past 15 years (Figure 1-2) (Dechant and Donovan, 1995;









Walz et al., 1997; Lamm et al., 2004). The clinical signs of otitis media observed include loss of

appetite, fever, listlessness, ear pain evidenced by head shaking and scratching at or rubbing ears,

epiphora, ear droop and signs of facial nerve paralysis (Walz et al., 1997; Brown et al., 1998a;

Maeda et al., 2003; Francoz et al., 2004; Van Biervliet et al., 2004). One or both tympanic bullae

can be affected. In some cases, purulent discharge from the ear canal is observed following

rupture of the tympanic membrane (Walz et al., 1997; Francoz et al., 2004). In addition, calves

with M bovis-induced otitis media often have concurrent pneumonia (Dechant and Donovan,

1995; Walz et al., 1997; Maeda et al., 2003; Lamm et al., 2004). Bacteria gain access to the

middle ear by several possible routes that include extension of external ear infections via the

tympanic membrane, colonization of the oropharynx and extension into the tympanic bulla via

the eustachian tubes, or by hematogenous spread (Duarte and Hamdan, 2004; Morin, 2004). In

pigs, otitis media due to Mycoplasma hyorhinis has been shown to occur by extension of URT

infections to the middle ear via the eustachian (auditory) tube (Morita et al., 1995; Morita et al.,

1999). Although the route of infection has not been studied in calves, it is likely that a similar

mechanism occurs given the frequent colonization of the nasopharynx with M bovis in young

calves (Bennett and Jasper, 1977c).

Otitis internal is a common sequelae to otitis media in calves, and affected animals exhibit

varying degrees of vestibulocochlear dysfunction including head tilt, horizontal nystagmus,

staggering, circling, falling, and/or lateral recumbency (Dechant and Donovan, 1995; Maeda et

al., 2003; Lamm et al., 2004; Van Biervliet et al., 2004). Meningitis can occur as a complication

of otitis internal (Stipkovits et al., 1993; Francoz et al., 2004; Lamm et al., 2004; Van Biervliet et

al., 2004). Meningitis secondary to otitis media-interna may be localized, so cerebrospinal fluid

samples collected for diagnostic purposes should be from the atlanto-occipital, rather than the









lumbo-sacral space (Van Biervliet et al., 2004). Spontaneous regurgitation, loss of pharyngeal

tone and dysphagia have also been reported in calves with M bovis-associated otitis media-

interna, indicative of glossopharyngeal nerve dysfunction with or without vagal nerve

dysfunction (Van Biervliet et al., 2004). Whether these nerves are affected by inflammation

associated with meningitis or with inflammation at the site where the nerves pass over the

tympanic bullae is unknown (Van Biervliet et al., 2004). As is observed with M bovis-associated

respiratory disease, calves with chronic otitis media-interna may become emaciated (Walz et al.,

1997; Van Biervliet et al., 2004).

In contrast to M bovis infections of the upper and lower respiratory tracts, M. bovis-

induced arthritis is presumed to be a consequence of mycoplasmemia (Chima et al., 1981;

Thomas et al., 1986). Arthritis was preceded by mycoplasmemia in one calf that was inoculated

intratracheally with M bovis (Thomas et al., 1986). Infections of other body systems that

occasionally accompany polyarthritis are also likely to be a consequence of mycoplasmemia

(Stipkovits et al., 1993). Clinical cases of M. bovis-induced arthritis in dairy calves tend to be

sporadic and are typically accompanied by respiratory disease within the herd and often within

the same animal (Gonzalez et al., 1993; Stipkovits et al., 2005). Although uncommon, outbreaks

of disease where arthritis was the predominant clinical presentation have been reported

(Stipkovits et al., 1993; Butler et al., 2000). Clinical signs are typical of septic arthritis; affected

joints are painful and swollen, and calves exhibit varying degrees of lameness and may be febrile

in the acute phase of disease (Figure 1-3) (Stipkovits et al., 1993; Byrne et al., 2001; Step and

Kirkpatrick, 2001a). Large rotator joints such as the shoulder, elbow, carpal, hip, stifle and hock

joints are most frequently involved (Thomas et al., 1975; Stipkovits et al., 1993; Adegboye et

al., 1996; Step and Kirkpatrick, 2001a; Clark, 2002; Gagea et al., 2006). One or multiple joints









can be affected, and calves with M bovis arthritis are frequently culled due to poor response to

therapy (Adegboye et al., 1996; Byrne et al., 2001; Stokka et al., 2001).

Mycoplasma bovis also may cause a variety of less common clinical syndromes in calves,

with or without concurrent respiratory disease. In addition to its occurrence as a sequelae of otitis

media (Maeda et al., 2003; Francoz et al., 2004), meningitis has occurred as a consequence of

mycoplasmemia in very young calves (Stipkovits et al., 1993). For example, in one case report, 3

to 21 day-old calves developed polyarthritis and meningitis with an associated high mortality

rate. Mycoplasma bovis was the only pathogen isolated from joints and meninges of affected

calves (Stipkovits et al., 1993).

Mycoplasma bovis infections in or around tendons and synovial structures have been

reported, and tenosynovitis and bursitis are commonly reported in feedlot calves with concurrent

chronic M bovis arthritis (Adegboye et al., 1996; Step and Kirkpatrick, 2001a; Clark, 2002). In

addition, intra-articular inoculation of M bovis in calves resulted in arthritis plus tenosynovitis

(Stalheim and Page, 1975; Ryan et al., 1983). In an unusual presentation ofM bovis infections,

an outbreak of subcutaneous decubital abscesses over carpal and stifle joints and in the brisket

was reported in fifty calves fed unpasteurized waste milk on a Californian calf ranch.

Mycoplasma bovis was the only pathogen isolated from abscesses, which occurred at the sites of

pressure sores. Whether the bacteria gained entry through skin abrasions or via hematogenous

spread is unknown, but the authors hypothesized that M bovis in nasal secretions may have

contaminated pressure sores when calves licked these areas. There was no evidence of joint

involvement in affected calves, but at least one calf had concurrent M. bovis-associated

respiratory disease (Kinde et al., 1993).









Mycoplasma bovis can be isolated from the conjunctiva of cattle in infected herds

(Boothby et al., 1983b), although M. bovis-associated ocular disease is considered uncommon

(Brown et al., 1998b). However, there are several reports of outbreaks of keratoconjunctivitis

involving M bovis alone, or in mixed infections with Mycoplasma bovoculi (Jack et al., 1977;

Kirby and Nicholas, 1996; Levisohn et al., 2004; Alberti et al., 2006). An outbreak of severe

keratoconjunctivitis, from which M bovis was the only consistently isolated pathogen, was

reported in a group of 20 calves. Clinical signs included mucopurulent ocular discharge, severe

eyelid and conjunctival swelling, and corneal edema and ulceration. Most clinical signs resolved

within 2 weeks but some animals had residual corneal scarring (Kirby and Nicholas, 1996). In a

recent report (Alberti et al., 2006), an outbreak of M bovis-associated keratoconjunctivitis in

beef calves in Italy was followed by cases of pneumonia and arthritis.

In summary, M. bovis infections primarily result in pneumonia, otitis media and arthritis

in young calves, but other more unusual clinical presentations affecting a wide variety of body

systems can occur. Mycoplasma bovis is an important cause of mastitis in adult cows, but

discussion of this clinical syndrome is beyond the scope of this dissertation.

Prevalence

Mycoplasma bovis appears to be widespread within the North American dairy cattle

population (Uhaa et al., 1990; Gonzalez et al., 1992; Van Donkersgoed et al., 1993; Kirk et al.,

1997; Fox et al., 2003; USDA:APHIS, 2003). In the National Animal Health Monitoring System

(NAHMS) Dairy 2002 study, 7.9% of 871 dairies tested positive for mycoplasmas upon culture

of a single bulk tank milk sample; M. bovis was identified in 86% of the positive herds. States in

the Western region had a greater percentage of operations with positive mycoplasma culture

(9.4%) than states in the Midwest (2.2%), Northeast (2.8%) and Southeast (6.6%) regions. These









values are likely an underestimate of true prevalence, as subclinically infected cows shed

mycoplasmas intermittently in milk (Jasper, 1981; Biddle et al., 2003) and milk from cows with

clinical mastitis is usually withheld from the bulk tank. Reported prevalence in individual cows

varies widely among herds and among studies; Gonzalez et al., (1992) reported that 11.7% of

cows sampled between 1970 to 1990 in 165 New York herds were infected, whereas Wilson et

al., (1997) reported that only 85/105,083 (0.1%) of individual cow cultures collected in

Northeast U.S. dairy herds between 1991 and 1995 were positive for mycoplasmas. In a study of

463 dairy operations in the Northwest U.S., 93 (20%) of herds had at least one mycoplasma

positive bulk tank milk sample between 1998 and 2000.

Studies of the prevalence of M bovis-associated disease in dairy calves in North America

have not been published, but in Europe it has been estimated that M bovis is responsible for 25%

to 35% of calfhood respiratory disease (Nicholas and Ayling, 2003). Although the prevalence of

M. bovis-associated disease is unknown, there are data on the prevalence of undifferentiated

respiratory disease in North American calves. In fact, after diarrheal diseases, respiratory disease

is the second most important cause of morbidity and mortality in U.S. dairy heifers. In the

NAHMS Dairy 2002 study (USDA:APHIS, 2003), which represented 83% of U.S. dairy

operations, respiratory disease accounted for 21.3% of all heifer deaths; pre-weaning and post-

weaning mortality were 8.7% and 1.9%, respectively. Morbidity rates were not reported, but in

the 1991-1992 National Dairy Heifer Evaluation Project (NDHEP), which included 906 dairies

from 28 states, the cumulative incidence risk of respiratory disease to 8 weeks of age was 10%;

24.5% of mortality was due to respiratory disease (Wells et al., 1997). To the best of the author's

knowledge, more recent national estimates of respiratory disease rates in dairy heifers have not

been published. The incidence and severity of respiratory disease vary markedly among









individual farms and among regional studies. In 18 commercial New York dairy operations, the

incidence of pneumonia in the first 3 months of life was 25.6% and the case fatality rate was

2.2% (Virtala et al., 1996b). In a 1991 study of 30 Minnesota dairies, the incidence rate for

pneumonia was 0.10 per 100 calf days at risk, the case fatality rate was 9.4%, and pneumonia

accounted for 30% of mortality during the first 4 months of life (Sivula et al., 1996). In a study

of calf health on two large Florida dairies, mortality to 6 months of age was 11.7%, 22% of

which was attributed to respiratory disease (Donovan et al., 1998a). Although these prevalence

studies are not pathogen specific, it is clear from the reports of outbreaks ofM. bovis-associated

respiratory disease in North American dairy calves that M bovis can be a significant contributor

to overall rates of disease and mortality in affected herds (Walz et al., 1997; Brown et al., 1998a;

Butler et al., 2000). For example, in a 1996 prospective study of five New York dairies, 40 cases

of pneumonia occurred in 78 calves that were prospectively followed for the first 3 months of

life; 22 (55%) of these cases were attributed to M bovis infection (Musser et al., 1996).

Economic Losses

There are limited data available on the economic impact of M. bovis-associated disease.

Financial losses were estimated at approximately $350 per case per lactation for mycoplasmal

mastitis, based on records from 105,083 cows in the Northeast U.S. and a milk price of

$13.00/hundred pounds of milk (Wilson et al., 1997). Losses to the U.S. beef industry as a result

of reduced weight gain and carcass value due to M bovis-associated disease have been estimated

at $32 million per year, and in the U.K., it is estimated that M bovis contributes to at least a

quarter of economic loss due to bovine respiratory disease (Rosengarten and Citti, 1999).

However, the cost of M bovis-associated disease in dairy heifers has not been reported. In

addition, there is scant recent information available on the cost of undifferentiated respiratory

disease in dairy heifers in North America. In a 1990 study of Michigan dairy herds, the cost of









respiratory disease in calves was estimated at $14.71 per calf year (Kaneene and Hurd, 1990).

Esslemont and Kossaibati (1999) estimated that the average cost of respiratory disease in dairy

heifers in the U.K. was $61 per calf in the herd, based on 30% morbidity and 5% mortality rates.

Economic costs associated with calf respiratory disease include treatment costs, labor costs,

veterinary services, increased mortality, increased premature culling, reduced weight gain,

reduced fertility, increased age at first calving, and possibly reduced milk production (Waltner-

Toews etal., 1986; Warnick etal., 1995; Virtala etal., 1996a; Ames, 1997; Warnick etal., 1997;

Donovan et al., 1998b). Without pathogen-specific data being available, it is reasonable to

assume that M bovis-associated disease incurs many of the same costs.

Mycoplasma bovis-associated disease tends to be debilitating and unresponsive to therapy

(Gourlay et al., 1989a; Adegboye et al., 1995a; Apley and Fajt, 1998; Pollock et al., 2000;

Stipkovits et al., 2000; Rosenbusch, 2001). Tschopp et al., (2001) gives an example of an

outbreak of M. bovis-associated disease in which 54% of 415 calves introduced into an M bovis-

endemic facility seroconverted to M. bovis. Calves that seroconverted within 7 weeks of arrival

experienced an 8% reduction in weight gain and required twice as many antibiotics as did

seronegative calves. The proportion of clinical episodes of respiratory disease attributable to

M. bovis in these calves was 50.3%. In another report of an M bovis-associated disease outbreak,

70% of the calves in one dairy herd required treatment for respiratory disease or otitis media

prior to 3 months of age (Brown et al., 1998a). On the individual farm affected with M. bovis-

associated calf disease, losses resulting from treatment costs, death, and culling can be

substantial, and economically devastating outbreaks with very high morbidity rates and loss of

up to 30% of calves have been observed (Figure 1-4) (Gourlay et al., 1989a; Kinde et al., 1993;









Stipkovits et al., 1993; Dechant and Donovan, 1995; Walz et al., 1997; Butler et al., 2000;

Stipkovits et al., 2000; Stipkovits et al., 2001; Tschopp et al., 2001).

Animal Welfare

In addition to any economic consequences, M. bovis must be considered important from a

calf welfare perspective. M. bovis-associated disease is often chronic, responds poorly to

antibiotic therapy, often affects a substantial proportion of calves in a herd, may cause permanent

health issues for affected calves, and available vaccines are, at best, poorly efficacious (Gourlay

etal., 1989a; Allen etal., 1992a; Adegboye etal., 1995a; Apley and Fajt, 1998; Stipkovits etal.,

2000; Nicholas and Ayling, 2003; Gagea et al., 2006). Taken together, these characteristics result

in affected calves that may be subject to long periods of illness for which the producer or

veterinarian can provide only limited relief. There is therefore a critical need to develop

improved preventative and treatment strategies for M bovis-associated disease in young calves.

Epidemiology

Colonization and Shedding

Mycoplasma bovis is a frequent colonizer of the URT of healthy or diseased calves, with

nasal prevalence ranging from < 5% to 100% of calves in a herd (Bennett and Jasper, 1977c;

Springer et al., 1982; Allen et al., 1992a; ter Laak et al., 1992b; Brown et al., 1998a; Mettifogo

et al., 1998). Within-herd prevalence is generally higher in herds with a history ofM. bovis-

associated disease than in herds without such a history. For example, Bennett and Jasper (1977c)

reported a nasal prevalence of 34% in dairy calves < 8 months of age in herds with M bovis-

associated disease, compared with 6% in non-diseased herds. Cattle can remain infected for long

periods of time and may shed M bovis intermittently for many months and even years, acting as

reservoirs of infection in the herd (Bennett and Jasper, 1977c; Pfutzner and Sachse, 1996).

Chronic colonization of tonsils, with or without nasal shedding, has been described for









mycoplasmal respiratory pathogens in other hosts (Goltz et al., 1986; Friis et al., 1991), but

whether the bovine tonsils are the primary site of URT colonization forM bovis has not been

established.

The significance ofM bovis colonization as a risk factor for the development of clinical

disease in the individual animal is unknown. On a herd level, high prevalence of nasal

colonization is associated with increased rates of clinical disease and with isolation ofM bovis

from the LRT (Bennett and Jasper, 1977c; Springer et al., 1982; Allen et al., 1991; Brown et al.,

1998a). However, isolation ofM bovis from nasal swabs in individual calves is generally poorly

correlated with both clinical disease and the presence ofM bovis in the LRT (Bennett and

Jasper, 1977c; Allen et al., 1991; Thomas et al., 2002b), although a positive correlation between

M bovis isolation from nasal swabs and clinical disease was reported in one study (Wiggins et

al., 2007). Based on the current level of understanding, colonization of the URT precedes the

development of clinical disease in calves, but is not always sufficient cause for disease.

Little is known about the typical age of onset and duration of nasal shedding of M bovis

in endemically-infected herds. Bennett and Jasper (1977c) reported that in calves less than 1

week of age, nasal prevalence was 38% in herds with M bovis-associated disease and 7.5% in

non-diseased herds. Prevalence peaked at 48% between 1 and 4 months of age. Mycoplasma

bovis was still detected in nasal swabs from some calves at 8 months of age and from pre-partum

heifers, although whether these represented new or chronic infections was not determined. Other

investigators reported that almost 50% of calves in a herd with severe M bovis and P. multocida

pneumonia were shedding M bovis at 5 days of age and over 90% were shedding M bovis by 4

weeks; the onset of clinical disease peaked between 10 and 15 days of age. Approximately 10%

of the calves died as a result of severe pneumonia, and surviving calves had poor weight gain









(Stipkovits et al., 2001). On a Florida dairy experiencing an outbreak of M. bovis-associated

disease, M. bovis was isolated prior to 14 days of age from nasal swabs of all of 50 calves

sampled, and 70% of these calves required treatment for respiratory disease or otitis media

(Brown et al., 1998a). It is apparent from these studies that calves in infected herds are often

colonized when they are very young, even at less than 1 week of age, and that the highest rates of

nasal shedding occur in the first 2 months of life. In addition, Bennett and Jasper (1977c) found

that M bovis may be shed in nasal secretions of calves in herds with no history ofM bovis-

associated disease.

Although the URT is the most common site of infection, M. bovis may similarly colonize

and be shed from other body systems without causing clinical disease. Subclinical M. bovis

mastitis is common, and infected cows may intermittently shed the bacteria in milk for months to

years (Ruhnke et al., 1976; Jasper, 1981; Pfutzner and Sachse, 1996). M. bovis has also been

isolated from the conjunctiva (Boothby et al., 1983b), semen and vaginal secretions (Feenstra et

al., 1991; Pfutzner and Sachse, 1996) of cattle without clinical disease. Although both

respiratory tract and mammary gland shedding have been implicated as reservoirs of infection

within a herd (Pfutzner and Sachse, 1996), colonization at other sites does not seem to play a

major role in the epidemiology ofM bovis.

Transmission and Risk Factors

Mycoplasma bovis is thought to be introduced to M bovis-free herds by clinically healthy

cattle that are carrying this microorganism (Jasper, 1981; Burnens et al., 1999; Tschopp et al.,

2001; Gonzalez and Wilson, 2003). Spread to uninfected animals may occur at the time of

introduction into the herd or may be delayed until, and if, shedding occurs (Fox et al., 2005).

Little is published on the epidemiology ofM bovis within young calf populations, but there are

several potential routes of initial exposure. Calves could become infected from their dams or









from other adult cows in the maternity area that are shedding M. bovis in colostrum, vaginal or

respiratory secretions (Pfutzner and Sachse, 1996). The isolation ofM bovis from vaginal

secretions of cows at calving (Feenstra et al., 1991; Brown et al., 1998a) and congenital infection

of calves (Bocklisch et al., 1986; Stipkovits et al., 1993) have been reported, although both

events appear to occur infrequently and probably do not play a major role in transmission.

One of the major means of transmission to young calves is thought to be ingestion of

milk from cows shedding M bovis from the mammary gland (Figure 1-5) (Pfutzner and

Schimmel, 1985; Bocklisch etal., 1986; Walz etal., 1997; Brown etal., 1998a; Butler et al.,

2000). Colonization of the URT by M. bovis occurs more frequently in calves fed infected milk

than in those fed uninfected milk (Bennett and Jasper, 1977c), and clinical disease has been

documented following feeding of M. bovis-contaminated waste milk to calves or nursing of cows

with M bovis mastitis (Stalheim and Page, 1975; Walz et al., 1997; Brown et al., 1998a; Butler

et al., 2000). Because milk in modern husbandry systems is typically batched for feeding to

calves, a single cow shedding M bovis can potentially expose a large number of calves to

infection, and calves may be repeatedly exposed over the milk-feeding period. In a field study to

determine the method of transmission ofM bovis in one Florida dairy herd, 100% of 50 calves

exposed to M bovis contaminated waste milk became colonized in the URT by 14 days of age

(Brown et al., 1998a). Culture of nasal and vaginal swabs of cows at calving was only positive

forM bovis in one instance each. This led the authors to conclude that the main method of

spread ofM bovis from dam to calf was through contaminated waste milk. This hypothesis was

supported by other investigators (Walz et al., 1997; Butler et al., 2000), although experimental

infection by this route has not been published. Feeding of unpasteurized waste milk is clearly not

the only important factor in the epidemiology ofM bovis in calves, as clinical disease can occur









in herds that only feed milk replacer or in herds that effectively pasteurize bulk tank or hospital

milk prior to feeding (Lamm et al., 2004). The importance of colostrum as a source ofM. bovis

infection in calves is unknown, although in one study (Brown et al., 1998a), investigators did not

isolate M. bovis from 50 colostrum samples collected during an outbreak of M bovis-associated

disease.

Whatever the mechanism (infected milk, colostrum, respiratory or vaginal secretions, or

congenital infection) by which calves become infected, they may then shed M bovis in

respiratory secretions and potentially transmit it to other calves. Once established on multi-age

sites, M. bovis becomes extremely difficult to eradicate, suggesting that continual transmission

from older animals to incoming calves occurs (Bennett and Jasper, 1977c). Transmission is

likely to be a result of direct or indirect contact of uninfected calves with calves that are shedding

M. bovis in respiratory secretions (Bennett and Jasper, 1977c; Tschopp et al., 2001; Nicholas and

Ayling, 2003).

In general, for bacterial pathogens involved in multifactorial diseases, the risk of

infection and of developing clinical disease depends on a large number of pathogen, host and

environmental factors. With the exception of exposure to M bovis-contaminated milk (discussed

above), few specific risk factors for the transmission ofM. bovis or for outbreaks of clinical

disease have been identified. Mixing of calves from different sources and the presence of at least

one seropositive animal in new purchases increased the risk ofM. bovis-associated disease on a

ranch that raised dairy bull calves (Tschopp et al., 2001). This result is in agreement with

epidemiological studies ofM. bovis mastitis, where one of the few consistently identified herd-

level risk factors has been a history of purchasing cattle (Gonzalez et al., 1992; Burnens et al.,

1999). Herd size is the only other commonly identified risk factor for mycoplasmal mastitis.









Herd size was identified as a risk factor for an M bovis-positive bulk tank in the NAHMS Dairy

2002 study, with 21.7% of herds of 500 head or more having positive samples, compared with

3.9% and 2.1% of medium (100 to 400 head) and small (< 100 head) herds, respectively. In

several smaller-scale regional studies, large herds have been identified as being at increased risk

ofM. bovis mastitis (Thomas et al., 1981; Uhaa et al., 1990; Fox et al., 2003). However, some

investigators have not identified herd size as a risk factor after analyses were adjusted for

purchase of animals (Gonzalez et al., 1992). Larger herd size was associated with increased rates

of undifferentiated respiratory disease in calves in the NDHEP study (Wells et al., 1997), but the

effect of herd size on M bovis-associated disease in young calves has not been reported.

Despite the lack of published studies, other potential risk factors for M bovis infection in

young calves can be identified from the limited studies ofM bovis epidemiology in calves, from

studies ofM bovis mastitis and by extrapolating from what is known about risk factors for other

respiratory pathogens in calves. For example, calves with clinical M. bovis-associated disease

shed huge numbers of bacteria (Bennett and Jasper, 1977c) and are therefore likely to be the

greatest contributors to the load of bacteria within a calf-rearing facility and the most important

factor in calf-to-calf spread of disease. For undifferentiated respiratory disease, high bacterial

counts in the air of calf pens are associated with increased disease prevalence (Lago et al., 2006).

Large numbers ofM bovis can be isolated from the air in barns housing calves with M bovis-

associated disease (Jasper et al., 1974), and, therefore, factors that influence airborne bacteria

counts in calf pens, such as pen design, barn ventilation and stocking density (Lago et al., 2006)

may affect transmission rates. Independent of effects on bacterial load, poor air quality

compromises respiratory defenses, which may increase the risk of respiratory disease (Ames,

1997), although this has not been specifically evaluated with respect to M. bovis infections.









Mechanical transmission via fomites has been implicated in udder-to-udder spread of

M. bovis mastitis. Milking of uninfected and infected cows at the same time increases the risk for

new cases, and milking equipment, teat dip, hands, sponges, washcloths, and poor hygiene

during intramammary infusion of antibiotics have been implicated in the spread of M bovis

(Jasper et al., 1974; Bushnell, 1984; Step and Kirkpatrick, 2001b; Gonzalez and Wilson, 2003).

It is plausible that similar mechanical means of transfer could occur in calf facilities. Despite

being enveloped by only a thin plasma membrane, some mycoplasmas survive well in the

environment. Mycoplasma bovis survives at 40C for nearly 2 months in sponges and milk, over 2

weeks on wood and in water, and 20 days in straw, although at higher temperatures survival

drops considerably (Pfutzner and Sachse, 1996). In general, survival is best under cool, humid

conditions (Pfutzner and Sachse, 1996). In surveys of Florida dairy farms, M. bovis was

commonly isolated from cooling ponds and from dirt lots with recently calved cows on farms

that had a history of M. bovis-positive bulk tank milk culture (Bray et al., 1997; Bray et al.,

2001). These studies demonstrate that M. bovis can survive well in the dairy environment, and

that mechanical transmission via fomites could theoretically occur among calves. However,

further studies are required to examine the role of fomites in the epidemiology ofM bovis

infection in calf-rearing facilities.

In a study of the effect of temperature and humidity on nasal shedding of mycoplasmas in

calves, an abrupt change from warm (170C) to cold (50C) conditions was associated with

increased rates of nasal shedding ofM bovis. In addition, calves that were permanently housed

at 50C had higher rates of nasal shedding ofM bovis than calves housed at 160C (Woldehiwet et

al., 1990). Other investigators subjected healthy calves to extreme environmental temperatures

(50C or 350C) for 4 hours; calves were housed at 18 to 200C before and after the exposure.









Calves exposed to environmental extremes experienced significantly higher rates of respiratory

disease over the following 3 weeks than did unexposed control calves. Mycoplasma spp. were

identified as the cause of respiratory disease in calves that were exposed to 50C, whereas no

mycoplasmas were isolated from the lungs of calves exposed to 350C or in control calves

(Reinhold and Elmer, 2002). Together, these findings suggest that mycoplasmal nasal shedding

and, perhaps, clinical disease are favored by low environmental temperatures. However,

epidemiological studies to evaluate the association between temperature and clinical M. bovis-

associated disease have not been published.

Season may have some effect on M. bovis infections in calves. Lamm et al., (2004)

reported that there was a seasonal distribution in the number of cases of mycoplasmal otitis

media in calves submitted for necropsy to a Californian diagnostic laboratory, with the highest

proportion of cases submitted in the spring and the lowest in the summer months. Seasonal

effects have been observed in some studies of mycoplasmal mastitis (Bayoumi et al., 1988;

Gonzalez et al., 1992), but not in others (Kirk et al., 1997; Fox et al., 2003). For example,

Gonzalez et al., (1992) reported a significantly higher incidence of mycoplasmal clinical mastitis

in New York dairy herds in winter than in other seasons. Kirk et al., (1997) reported that there

was no seasonal pattern to M bovis isolation from bulk tank milk in 267 Californian herds,

contrary to previous findings where a higher incidence ofM. bovis mastitis was observed from

January to April in California dairies than at other times of the year (Bayoumi et al., 1988). The

reasons for these discrepancies are unknown. There are several possible explanations for

increased rates ofM. bovis-associated disease in winter or early spring compared with other

times of year. Survival of mycoplasmas in the environment is best in cool, humid conditions

(Pfutzner and Sachse, 1996) and the risk of indirect transmission between animals may be









greatest when these conditions predominate. Secondly, a seasonal distribution could reflect an

association ofM. bovis infection with exposure to cold environmental temperatures, as discussed

above (Woldehiwet et al., 1990; Reinhold and Elmer, 2002). Lastly, air quality in enclosed cattle

facilities may be worse in winter than at other times of the year, predisposing animals to

increased rates of respiratory disease (Ames, 1997; Lago et al., 2006). Further epidemiological

studies are required to definitively determine if there is a seasonal distribution of M bovis-

associated disease in calves.

The immune status of the calf is important in determining susceptibility to respiratory

infections. The calf is born with little or no humoral immunity and is dependent upon absorption

of maternal immunoglobulins from colostrum for disease protection during early life (Davis and

Drackley, 1998). Numerous investigators have found a strong association between failure of

passive transfer of maternal immunoglobulins and increased risk and severity of respiratory

disease in young calves (Thomas and Swann, 1973; Williams et al., 1975; Davidson et al., 1981;

Blom, 1982; Corbeil etal., 1984; Van Donkersgoed et al., 1993; Donovan et al., 1998a).

However, whether maternal antibodies have any protective effects against M. bovis infection is

not clear. In one study (Van Donkersgoed et al., 1993), there was no significant association

between M bovis-specific serum antibody titers in the first 2 weeks of life and occurrence of

pneumonia in 325 colostrum-fed dairy calves. Likewise, Brown et al., (1998a) did not find an

association between M bovis-specific serum antibody concentrations at 7 days of age and

occurrence of M. bovis-associated disease in 50 Holstein calves. Specific immunity to M bovis

will be further discussed later in this chapter.

Non-specific respiratory defenses are important in protection from mycoplasmal

respiratory infections in other hosts (Cartner et al., 1998; Hickman-Davis, 2002), and it is logical









that they would also be important in M. bovis infections. The non-specific respiratory defenses of

calves can be compromised by a variety of factors including infection with viral pathogens,

sudden changes in environmental temperature, heat- or cold-stress, overcrowding, transportation,

poor air quality and inadequate nutrition (Bryson, 1985; Ames, 1997). However, further studies

are required to define the role of factors affecting the non-specific respiratory defenses of calves

as well as the role of passive immunity in M bovis-associated calf disease.

Genetic background is thought to play an important role in the susceptibility of cattle to

infectious disease (Uribe et al., 1995; Kelm et al., 1997; Kelm et al., 2001; Abdel-Azim et al.,

2005). Genetic background is also important in determining susceptibility or resistance to

mycoplasmal respiratory infections of non-bovine species. In many cases, genetic susceptibility

to mycoplasmal respiratory disease appears to be a result of increased immunoreactivity of the

host when compared with resistant animals. For example, resistance to M pulmonis lung disease

in inbred strains of rats is a result of a more controlled host immune response after mycoplasmal

inoculation into the lung, compared with susceptible strains of rats (Davis et al., 1982). Inbred

strains of mice that are susceptible to M. pulmonis lung disease have reduced alveolar

macrophage clearance of mycoplasmas from the lung early in the infection process compared

with resistant strains of mice (Hickman-Davis et al., 1997). In addition, mice that are genetically

susceptible to asthma-associated symptoms, a phenotype mediated by impaired interferon (IFN)-

y secretion and strong Th2 responses, have a much greater susceptibility to M. pulmonis infection

than do immunocompetent mice (Bakshi et al., 2006). The resistance to M. pulmonis is

multifactorial, and has been mapped to several chromosomal locations (Cartner et al., 1996).

Interestingly, males are more susceptible than females, suggesting that hormonal regulation may

also be important in disease susceptibility (Yancey et al., 2001). Genetic susceptibility to









mycoplasmal infections is not limited to rodents. In pigs that were bred for high or low cellular

and humoral immune responses, high responders that were experimentally infected with

M. hyorhinis had more severe arthritis than did pigs bred for low immune response (Wilkie and

Mallard, 1999). These findings coupled with the fact that immune responsiveness in cattle has a

strong genetic influence implies that genetic background is likely to be associated with

susceptibility to M. bovis-associated disease in cattle. However, to date no studies have

addressed the role of genetics in susceptibility of cattle to mycoplasmal infections.

Bovine respiratory disease frequently involves a number of viral and bacterial pathogens

(Bryson, 1985; Ames, 1997), and M bovis-associated respiratory disease is no exception

(Howard etal., 1987a; Rodriguez et al., 1996; Virtala et al., 1996b; Mosier, 1997; Stipkovits et

al., 2000; Poumarat et al., 2001; Vogel et al., 2001; Thomas et al., 2002a; Gagea et al., 2006). In

fact, M. bovis infection may predispose the respiratory tract to invasion by other bacterial

pathogens (Houghton and Gourlay, 1983; Virtala et al., 1996b; Poumarat et al., 2001; Gagea et

al., 2006); similarly, other pathogens may enhance M bovis infection. Viral infections can

damage the respiratory mucosa, reduce ciliary activity, and impair secretary and cellular immune

defenses in the respiratory tract (Ames, 1997; Kapil and Basaraba, 1997). Any or all of these

changes could increase susceptibility to mycoplasmal infection. Studies in feedlot calves with

chronic, antibiotic-resistant pneumonia suggest that there may be synergism between Bovine

Viral Diarrhea virus (BVDV) and M bovis (Shahriar et al., 2000). Experimental infection studies

have confirmed that M bovis plays a synergistic role with other pathogens (Gourlay and

Houghton, 1985; Lopez et al., 1986; Thomas et al., 1986), especially P. multocida and

M. haemolytica.









Mixed infections can also occur in otitis media, although their significance is unknown

(Dechant and Donovan, 1995; Lamm et al., 2004). In several other host species, viral infections

of the URT are important risk factors for increased incidence, severity and chronicity of bacterial

otitis media; one mechanism by which viral infections can potentiate bacterial otitis media is by

perturbing the ciliary clearance mechanisms of the eustachian tubes (Bakaletz et al., 1993;

Eskola and Hovi, 1999; Tong et al., 2000). Specific viral etiologies have not been identified in

the lungs of pre-weaned calves with M bovis-associated otitis media (Walz et al., 1997; Maeda

et al., 2003; Lamm et al., 2004; Van Biervliet et al., 2004). However, attempts to isolate viruses

from lesions in the tympanic bullae have been reported only once (Maeda et al., 2003), and no

attempts to isolate viruses from the nasopharynx or eustachian tubes of affected calves have been

reported. In cases ofM bovis-associated arthritis, mixed infections in affected joints are

uncommon, although calves with arthritis often have concurrent respiratory disease from which

multiple pathogens may be isolated (Butler et al., 2000; Haines et al., 2001; Lamm et al., 2004).

Risk factors that have been identified for otitis media in other species include viral or

bacterial infection of the nasopharynx, eustachian tube dysfunction, age (with neonates being at

greatest risk), host factors such as impaired immunological status, URT allergies, genetic

predisposition, feeding method (breast vs. bottle in human infants) and environmental factors

such as mixing of different age groups and exposure to respiratory irritants (Bluestone, 1996;

Duffy et al., 1997). With the exception of an apparent age-related distribution, these factors have

not been evaluated with respect to M. bovis-induced otitis media in calves.

In summary, young calves can be infected at a very early age by ingestion of milk from

cows infected with M bovis or, probably, by direct or indirect transmission from other calves

shedding M. bovis in nasal secretions. However, other than the feeding of infected milk, few









specific risk factors have been identified, and factors associated with dissemination from the

upper to the LRT and clinical disease expression are poorly understood. Clearly, well designed

epidemiological studies would be helpful to establish risk factors and to provide guidance for

dairy producers to reduce M. bovis-associated disease.

Molecular Epidemiology

Mycoplasma bovis is well equipped to generate genetically diverse populations, and has

been observed to undergo DNA recombination and rearrangement events at high frequency

(Lysnyansky et al., 1996; Poumarat et al., 1999; Nussbaum et al., 2002). The M bovis genome

contains a large number of insertion sequences which are also likely to lead to heterogeneous

populations (Miles et al., 2005; Thomas et al., 2005b). There have been several molecular

epidemiological studies ofM. bovis utilizing a variety of DNA fingerprinting techniques

including randomly-amplified polymorphic DNA analysis, amplified fragment length

polymorphism analysis, restriction fragment length polymorphism analysis, pulsed-field gel

electrophoresis (PFGE) analysis, and insertion-sequence profile analysis (Poumarat et al., 1994;

Kusiluka et al., 2000a; Butler et al., 2001; McAuliffe et al., 2004; Biddle et al., 2005; Miles et

al., 2005). Considerable genomic heterogeneity among field isolates ofM. bovis has been

reported, especially when isolates were collected from diverse geographical regions and over a

period of several years (Poumarat et al., 1994; McAuliffe et al., 2004; Miles et al., 2005).

Correlations between particular DNA fingerprint types and geographic location, year of

isolation, and type or severity of pathology have not been identified (Poumarat et al., 1994;

Kusiluka et al., 2000a; McAuliffe et al., 2004; Miles et al., 2005). This may reflect the frequent

movement of cattle among herds in modem management systems, as well as the ability of

M. bovis to create genetically diverse populations.









Comparison of PFGE patterns for isolates of M bovis or Mycoplasma californicum

obtained at necropsy from multiple body sites in seven cows with mycoplasmal mastitis was

reported (Biddle et al., 2005). Within each cow, the same PFGE pattern was found in 100% of

isolates from sites in the mammary system (milk, mammary parenchyma and supra-mammary

lymph nodes). Forty-one percent of isolates obtained from the respiratory system and 90% of

isolates obtained from other body systems had PFGE patterns identical to that of the mammary

isolates. These findings indicate that the same strain ofM bovis often colonizes multiple body

sites, but also that multiple strains may be present within an animal. Isolates ofM bovis from

multiple sites of pathology within the same animal or from multiple animals in the same disease

outbreak typically are closely related or identical by DNA typing methods, especially when the

herd is closed (Gonzalez et al., 1993; Kusiluka et al., 2000a; Butler et al., 2001; McAuliffe et al.,

2005). In contrast, endemically-infected open herds, including dairy calf ranches, harbor

numerous genetically diverse strains ofM bovis; this has been attributed to introduction of

animals from multiple sources over time (Butler et al., 2001).

Pathology

The macroscopic and microscopic lesions of the respiratory tract in experimental

M. bovis infection vary considerably among studies, probably reflecting differences in the route

of inoculation, the dose and strain ofM bovis, the age and health status of the host and the

duration of infection. Macroscopic lesions have consisted of cranioventral lung consolidation,

sometimes accompanied by multiple necrotic foci (Gourlay et al., 1976; Lopez et al., 1986;

Thomas et al., 1986; Rodriguez et al., 1996). Histologically, experimental lung infections with

M bovis are characterized by peribronchiolar lymphoid hyperplasia or cuffing, often

accompanied by acute or subacute suppurative bronchiolitis, thickening of alveolar septa due to

cellular infiltration, atelectasis, and, in some cases, foci of coagulative necrosis (Gourlay et al.,









1976; Martin etal., 1983; Bryson, 1985; Lopez etal., 1986; Thomas etal., 1986; Rodriguez et

al., 1996). In one study, immunohistochemical staining ofM. bovis antigen was present at 14

days post-infection in bronchioles, peribronchiolar tissue and within inflammatory exudates in

alveoli; necrosis was not observed (Rodriguez et al., 1996). Other investigators identified large

amounts ofM bovis antigen at the edges of lesions of coagulative necrosis and in bronchiolar

exudates (Thomas et al., 1986).

Lesions described for the lungs of calves with natural M. bovis infections are similar to

those described for experimental disease, although often of much greater severity.

Macroscopically, affected lung lobes are a deep red color and have varying degrees of

consolidation, often accompanied in subacute to chronic cases by multifocal necrotizing lesions

(Gourlay et al., 1989a; Adegboye et al., 1995a; Adegboye et al., 1996; Clark, 2002; Shahriar et

al., 2002; Khodakaram-Tafti and Lopez, 2004; Gagea et al., 2006). Lesions usually have a

cranioventral distribution, but can involve whole lung lobes and the cranial portions of the caudal

lobes. Necrotic lesions can vary from 1-2 mm to several centimeters in diameter and contain

yellow caseous material. They are distinct from typical lung abscesses in that they are not usually

surrounded by a well-defined fibrous capsule (Clark, 2002; Khodakaram-Tafti and Lopez, 2004).

Diffuse fibrinous or chronic fibrosing pleuritis are sometimes observed, and interlobular septae

may contain edema fluid or linear yellow necrotic lesions (Rodriguez et al., 1996; Bashiruddin et

al., 2001; Step and Kirkpatrick, 2001a; Clark, 2002; Gagea et al., 2006). Occasionally, chronic

cases ofM. bovis pneumonia contain areas of lung sequestration, consisting of a central area of

necrotic tissue surrounded by red-brown exudate, and enclosed in a fibrous capsule that separates

the sequestra from surrounding lung (Gagea et al., 2006). Fibrinosuppurative tracheitis has been









reported in calves with mycoplasmal lung infections (Dungworth, 1993; Hewicker-Trautwein et

al., 2002).

Histologically, lung lesions in naturally-occurring M. bovis infections are characterized

by a subacute to chronic suppurative bronchopneumonia that is usually necrotizing (Adegboye et

al., 1995a; Rodriguez et al., 1996; Clark, 2002; Shahriar et al., 2002; Khodakaram-Tafti and

Lopez, 2004; Gagea et al., 2006). Mixed infections are common and often complicate

characterization of lesions (Adegboye et al., 1995a; Adegboye et al., 1996; Clark, 2002; Shahriar

et al., 2002; Khodakaram-Tafti and Lopez, 2004; Gagea et al., 2006). Bronchioles are filled with

purulent exudate that contains abundant M bovis antigen, accompanied by varying degrees of

peribronchiolar lympho-histiocytic cuffing, thickening of alveolar septa due to cellular

infiltration, and atelectasis.

Two distinct types of necrotic lesions have been reported in M. bovis pneumonia, the

most common being multifocal pyogranulomatous inflammation with centers of caseous necrosis

(Adegboye et al., 1995a; Rodriguez et al., 1996; Clark, 2002; Khodakaram-Tafti and Lopez,

2004; Gagea et al., 2006). These well-delineated necrotic foci have centers of amorphous

eosinophilic material in which degenerative neutrophils are sometimes visible, especially at the

periphery, and are surrounded by a band of lymphocytes, plasma cells, macrophages and

fibroblasts. In many cases, it appears that foci of caseous necrosis are centered on obliterated

bronchioles. Edema fluid, fibrin and variable numbers of neutrophils and macrophages are often

present in adjacent pulmonary parenchyma. The second, and less common, type of necrotic

lesion described is fibrinopurulent bronchopneumonia accompanied by multifocal irregular areas

of coagulative necrosis, surrounded by a dense zone of necrotic cells, especially neutrophils

(Bashiruddin et al., 2001; Shahriar et al., 2002; Maeda et al., 2003; Khodakaram-Tafti and









Lopez, 2004). Edema, fibrin deposition, and vascular and lymphatic thromboses in the

interlobular septa may accompany these types of lesion (Rodriguez et al., 1996; Khodakaram-

Tafti and Lopez, 2004). Large amounts of M. bovis antigen have been demonstrated in both

caseous and coagulative necrosis by immunohistochemical staining, especially at the periphery

of lesions (Rodriguez et al., 1996; Clark, 2002; Maeda et al., 2003; Khodakaram-Tafti and

Lopez, 2004; Gagea et al., 2006). Whether the two distinct types of necrosis are a result of

temporal events, co-infection with other pathogens, variation among strains ofM bovis, or

variation in the host response is unknown. In one study, (Khodakaram-Tafti and Lopez, 2004),

investigators hypothesized that foci of coagulative necrosis evolve over time into foci of caseous

necrosis, but this has not been demonstrated experimentally nor are both types of lesions usually

observed in the same lung. Further studies are required to better characterize M. bovis-associated

lung lesions.

Experimental and natural M. bovis-associated respiratory disease is typically

accompanied by hyperplasia of the lymphoid tissues in both the URT and LRT (Thomas et al.,

1986; Gagea et al., 2006). Foci of caseous necrosis in bronchial and mediastinal lymph nodes of

affected calves have been observed (Gagea et al., 2006).

Lesions in the joints and tendon sheaths of calves after experimental inoculation of

M. bovis are characterized as necrotizing fibrinosuppurative arthritis or tenosynovitis (Chima et

al., 1981; Ryan et al., 1983; Thomas et al., 1986). Similar lesions have been reported in

naturally-occurring M bovis arthritis (Adegboye et al., 1996; Clark, 2002; Hewicker-Trautwein

et al., 2002; Gagea et al., 2006). Macroscopic lesions vary from minimal to severe, but

chronically affected joints usually contain non-odorous, turbid, yellow, and fibrinous to caseous

exudate accompanied by thickening of the joint capsule. Histologically, affected joints usually









have severe erosion of articular cartilage, hyperplasia and caseous necrosis of synoviae, and

thrombosis of subsynovial vessels (Ryan et al., 1983; Gagea et al., 2006). Adjacent soft tissues,

including ligaments and tendons are frequently involved (Adegboye et al., 1996; Clark, 2002;

Gagea et al., 2006). Large amounts of M bovis antigen in the periphery of necrotic lesions and

within joint exudates have been demonstrated by immunohistochemical staining of the joints of

cattle with natural and experimental M. bovis arthritis (Thomas et al., 1986; Adegboye et al.,

1996; Clark, 2002; Gagea et al., 2006).

In calves with M bovis-associated otitis media, affected tympanic bullae are filled with

fibrinosuppurative to caseous exudate (Walz et al., 1997; Maeda et al., 2003; Lamm et al.,

2004). Histologically, extensive fibrinosuppurative exudates fill the tympanic bullae and normal

architecture may be obliterated (Walz et al., 1997; Maeda et al., 2003; Lamm et al., 2004). The

tympanic mucosa may have areas of ulceration and/or squamous metaplasia and is markedly

thickened due to infiltrates of macrophages, neutrophils, and plasma cells, and proliferation of

fibrous tissue. There is usually extensive osteolysis and/or remodeling of adjacent bone (Walz et

al., 1997; Lamm et al., 2004; Van Biervliet et al., 2004). Lesions are accompanied by

fibrinosuppurative eustachitis (Lamm et al., 2004). Large quantities ofM. bovis antigen have

been observed within necrotic exudates and, particularly, at the margins of necrotic lesions

within the tympanic bullae, similar to findings in M. bovis pneumonia (Maeda et al., 2003). In

chronic cases, lesions frequently extend into the inner ear and include petrous temporal bone

osteomyelitis (Maeda et al., 2003; Lamm et al., 2004). Meningitis as a consequence of otitis

internal is usually localized to the regions adjacent to the affected petrous temporal bone and

characterized as fibrinous to fibrinosuppurative and sometimes necrotizing (Lamm et al., 2004;

Ayling et al., 2005). In addition, diffuse fibrinous meningitis has been described in neonatal









calves with M bovis meningitis which likely originated from mycoplasmemia (Stipkovits et al.,

1993).

Mycoplasma bovis-associated lesions have occasionally been identified in other body

systems in both experimentally- and naturally-infected calves (Thomas et al., 1986; Adegboye et

al., 1995a; Maeda et al., 2003; Ayling et al., 2005). Ayling et al., (2005) described a 10-month-

old calf with a history of respiratory disease that had lesions of endocarditis and encephalitis

from which M bovis was the only pathogen isolated. In another report (Thomas et al., 1986),

intratracheal inoculation ofM bovis resulted in arthritis in one calf, and mycoplasmas were

isolated from the blood during the first week post-inoculation. At necropsy, investigators

observed perivascular mononuclear cell infiltration in portal areas of the liver, and

immunohistochemical staining revealed M. bovis in association with these lesions. Other

investigators identified M bovis antigen within foci of mononuclear cell infiltrates in the liver

and kidneys of 2 calves with chronic M bovis pneumonia (Adegboye et al., 1995a).

Diagnosis

The occurrence ofM. bovis is generally underestimated for several reasons. Mycoplasma

culture requires special equipment and expertise (Gourlay and Howard, 1983; Waites and

Taylor-Robinson, 1999), and few laboratories routinely monitor for this organism. Cows with

M. bovis mastitis can shed the bacteria intermittently, so repeated milk cultures may be required

to determine true infection status (Jasper, 1981; Biddle et al., 2003). In respiratory disease,

multiple pathogens are often present, and as other bacteria such as M. haemolytica and

P. multocida are easier to culture, the presence of M. bovis may be missed (Ames, 1997; Gagea

et al., 2006). Recent studies suggest that M bovis-associated disease is under-diagnosed, perhaps

because veterinarians and pathologists fail to recognize the infection during routine physical,

gross and microscopic examination (Nicholas and Ayling, 2003; Gagea et al., 2006). In otitis









media and arthritis, where M bovis is often the only pathogen present, it may also be missed

unless culture for mycoplasmas is specifically requested. In addition, the physical location of the

tympanic bullae makes sample collection difficult in otitis media cases. Mycoplasma bovis is

sometimes associated with a variety of unusual clinical presentations in which its involvement is

not widely recognized, and so appropriate diagnostic tests to detect this pathogen may not be

requested.

A history of respiratory disease that is poorly responsive to antibiotic therapy is

suggestive ofM bovis involvement, especially when accompanied by cases of arthritis and/or

otitis media. Although the associated lung pathology can be variable, multiple nodular lesions of

caseous necrosis are strongly suggestive ofM. bovis infections (Adegboye et al., 1995a; Gagea

et al., 2006). However, as there are no pathognomonic clinical or pathological signs for M bovis-

associated disease, a definitive diagnosis is based on isolation ofM bovis from the affected site,

and/or by demonstrating its presence in affected tissues by polymerase chain reaction (PCR),

capture enzyme-linked immunosorbent assay (ELISA) or by immunohistochemistry (IHC).

The culture of bovine mycoplasmas requires the use of nutritionally complex media as

well as a moist carbon-dioxide enriched atmosphere (Jasper, 1981; Gourlay and Howard, 1983;

Nicholas and Baker, 1998; Waites and Taylor-Robinson, 1999). Growth of M bovis in

appropriate media is often apparent after 48 hr, but may take up to 10 days (Jasper, 1981;

Gourlay and Howard, 1983; Nicholas and Ayling, 2003). Mycoplasmal colonies on solid media

are identified by their characteristic morphology; growth in broth is indicated by turbidity, film

formation, and by subculture onto solid media (Gourlay and Howard, 1983). A number of

pathogenic and non-pathogenic bovine mycoplasmal species may be isolated from the URT or

from sites of pathology, either alone or in mixed infections (Nicholas and Ayling, 2003; Lamm









et al., 2004; Gagea et al., 2006). Many of these cannot be differentiated morphologically, so

speciation by immunological methods (direct or indirect immunofluorescence or

immunoperoxidase testing) or by PCR is necessary (Jasper, 1981; Kotani and McGarrity, 1986;

Poumarat et al., 1991; Rosenbusch, 2001).

In live calves with clinical signs of respiratory disease, mycoplasmal culture of

transtracheal wash or broncho-alveolar lavage (BAL) fluids are suitable for the diagnosis of

M. bovis infections (Allen et al., 1991; Virtala et al., 2000; Thomas et al., 2002b). Comparisons

of paired culture results for nasopharyngeal swabs and BAL samples in cattle with respiratory

disease indicate that, in individual animals, isolation ofM bovis from the URT is not well

correlated with its presence in the LRT or with clinical disease (Allen et al., 1991; Thomas et al.,

2002b). For example, in one study nasal swabs had a sensitivity of only 21% for predicting

M. bovis-associated lung disease (Thomas et al., 2002b). Nasopharyngeal swabs can be used at

the group level to indicate the presence of M bovis within a calf facility (Bennett and Jasper,

1977c), although the sensitivity of this test has not been determined. In calves with arthritis or

tenosynovitis, affected joints and tendon sheaths can be aspirated for culture (Byrne et al., 2001).

Due to difficulties with access to the site of infection, samples are not usually collected from the

tympanic bulla in live calves with otitis media.

Mycoplasma culture of necropsy specimens can be performed directly from homogenates

of fresh tissues, aspirates, swabs collected from lesion sites and lavage samples (Gourlay and

Howard, 1983; Rosenbusch, 2001; Thomas et al., 2002b). As for other infectious diseases, calves

that are selected for necropsy for the diagnosis of a herd problem should be representative of the

cases seen in that herd. Culture of BAL samples collected at necropsy may be preferable to

culture of lung tissue when tissues cannot be processed immediately; mycoplasmas remain viable









in BAL fluids for months at -200C or -700C, for a few days at 40C and for several hours at room

temperature, whereas isolation rates from lung tissue decrease markedly over a few hours after

collection due to release of mycoplasmal inhibitors from disrupted tissue (Gourlay, 1983;

Taylor-Robinson and Chen, 1983; Nicholas and Baker, 1998). Complete agreement between

mycoplasmal cultures of paired BAL fluids collected at necropsy and corresponding lung tissue

cultured immediately after collection from cattle euthanized for respiratory disease has been

reported (Thomas et al., 2002b).

Sample handling and transport are particularly important to ensure the survival of

M. bovis. Swabs should be collected into transport media such as Ames (without charcoal) or

Stuart's (Clyde and McCormack, 1983). Swabs, lavage fluids, aspirates, milk and colostrum

samples should be refrigerated and tissue samples should be collected as soon as possible after

death and placed in sealed plastic bags on ice (Clyde and McCormack, 1983). Samples should be

transported to the laboratory within 24 hr (Clyde and McCormack, 1983; Biddle et al., 2004). If

samples such as milk are stored frozen, they should still be submitted within 7 to 10 days of

collection, as longer storage significantly decreases the isolation ofM bovis (Biddle et al.,

2004). Detection of mycoplasmas in clinical samples can potentially be improved by using

enrichment techniques and large inoculum sizes (Biddle et al., 2003). Limitations of

mycoplasma culture include the requirement for specialized equipment and expertise, the need to

speciate any mycoplasmas that are isolated, the length of time before results are obtained, the

overgrowth of slower growing species by other more rapidly growing mycoplasmas or other

bacteria and fungi, the need to process samples rapidly after collection to maximize sensitivity,

and the occurrence of false negative cultures due to the presence of antibiotics or other inhibitors

in clinical samples (Tully, 1983).









In part to address frustrations with conventional culture techniques, a variety of PCR

systems have been developed for the diagnosis ofM. bovis infections. A few are designed to

permit differentiation of multiple bovine mycoplasmal species within a single assay (Ayling et

al., 1997; Bashiruddin et al., 2005) whilst most are designed to be specific forM bovis (Hotzel

et al., 1996; Ghadersohi et al., 1997; Subramaniam et al., 1998; Pinnow et al., 2001; Bashiruddin

et al., 2005). Three PCR systems have been most widely adopted for clinical diagnostics,

including (1) amplification of the 16SrRNA gene with species or class-specific primers followed

by digestion with various restriction enzymes to permit differentiation of several species of

mollicutes within a single assay (Ayling et al., 1997; Bashiruddin et al., 2005), (2) amplification

of the 16SrRNA gene with species-specific primers (Chavez Gonzalez et al., 1995; Bashiruddin

et al., 2005), and (3) amplification of the housekeeping gene uvrC with species-specific primers

(Subramaniam et al., 1998; Thomas et al., 2004; Bashiruddin et al., 2005). PCR can be used for

the speciation of mycoplasmas that have already been isolated by routine culture methods

(Ayling et al., 1997; Subramaniam et al., 1998; Thomas et al., 2004), as well as for the direct

detection ofM bovis in clinical samples (Chavez Gonzalez et al., 1995; Hotzel et al., 1996;

Hotzel et al., 1999; Pinnow et al., 2001). However, PCR performed directly from clinical

samples can have variable sensitivity, and some authors report that samples containing < 102

colony forming units/ml were often detected as negative by PCR (Hotzel et al., 1999), a

detection level that is no better than standard culture procedures. Sensitivity has been improved

by antigen capture prior to PCR using an M bovis-specific monoclonal antibody (Hotzel et al.,

1999). A nested PCR was slightly more sensitive than assays based on culture of fresh milk

samples, but was much more sensitive than culture (100% compared with 27%) for detection of

M. bovis in milk after 2 years of frozen storage (Pinnow et al., 2001).









Because of the very close genotypic relationship between M. bovis and Mycoplasma

agalactiae there has been considerable work invested in developing assays that accurately

differentiate these two species (Mattsson et al., 1991; Chavez Gonzalez et al., 1995; Tola et al.,

1996; Subramaniam et al., 1998; Thomas et al., 2004; Bashiruddin et al., 2005; Foddai et al.,

2005). In a recent study (Bashiruddin et al., 2005) five laboratories evaluated the specificity of

four PCR detection systems for differentiating M bovis and M agalactiae. PCR based on

detection of the housekeeping genes oppD/F or uvrC had better specificities (both at 100%) than

did detection of the 16SrRNA gene combined with restriction enzyme analysis (96%) or

detection of species-specific sequences in the 16SrRNA gene (95.8%). However, because

M. agalactiae is a pathogen of small ruminants that is presumed to be absent from North

America and is rarely isolated outside of its typical hosts, differentiation from M. bovis is less of

a concern on this continent than in regions where both pathogens exist.

A sandwich ELISA has been developed to capture M bovis antigen from culture medium

or clinical samples, and is commercially available in Europe (Bio-X Diagnostics, Belgium) (Ball

and Finlay, 1998). The ELISA has a similar sensitivity to conventional culture when performed

directly from clinical samples, but sensitivity is improved when samples are incubated in broth

culture medium for a brief period prior to antigen capture.

Immunohistochemical demonstration of M bovis antigen within tissues is a sensitive and

specific means of determining the involvement ofM bovis in observed pathology (Haines and

Chelack, 1991; Adegboye et al., 1995b; Rodriguez et al., 1996; Haines et al., 2001; Clark, 2002;

Shahriar et al., 2002; Maeda et al., 2003; Khodakaram-Tafti and Lopez, 2004; Gagea et al.,

2006). Advantages of IHC are that it performs well using formalin fixed, paraffin embedded

tissues, and can be performed retrospectively, especially when other findings suggest aM. bovis









infection but culture is negative. An additional advantage of IHC is that it reveals the location of

M. bovis within lesions. In one recent retrospective study (Gagea et al., 2006), 98% and 100% of

cases of caseonecrotic bronchopneumonia from feedlot calves submitted to a diagnostic

laboratory were positive forM bovis by culture and IHC, respectively. In cases of

fibrinosuppurative pneumonia where M haemolytica was isolated, M. bovis was also isolated in

82% of cases, and was demonstrated by IHC within lesions in mixed infections with

M. haemolytica by IHC in 85% of cases (Gagea et al., 2006). The involvement ofM bovis in

lesions at a variety of other body sites has also been verified by IHC (Thomas et al., 1986; Kinde

et al., 1993; Stipkovits et al., 1993; Adegboye et al., 1996; Clark, 2002; Maeda et al., 2003;

Gagea et al., 2006). An indirect fluorescent antibody test using polyclonal antisera has been

described for the detection of M bovis in fresh, frozen lung tissue (Knudtson et al., 1986).

A variety of methods for the detection of M. bovis-specific antibodies in serum and other

body fluids have been described (Boothby et al., 1983a; Rosendal and Martin, 1986; Brank et al.,

1999; Ghadersohi et al., 2005). An indirect hemagglutination test (IHA) has been successfully

used to demonstrate the presence of M. bovis-specific antibody in serum, colostral whey and

joint fluid (Cho et al., 1976; Boothby et al., 1983a; Rosendal and Martin, 1986; Gagea et al.,

2006). However, the most widely applied method to detect M bovis-specific antibodies is an

indirect ELISA (Le Grand et al., 2002; Nicholas and Ayling, 2003). Most studies have used

whole cell or membrane protein antigens derived from various reference or field strains of

M. bovis. Laboratory-grown strains ofM bovis vary over time in their variable surface protein

(Vsp) expression profiles, and it has been proposed that this may effect the reliability of

immunological assays (Rosengarten and Yogev, 1996), although studies addressing whether this

issue is of practical concern in diagnostic ELISA have not been published. Le Grand et al.,









(2002) developed an indirect ELISA using membrane proteins derived from a phenotypic clonal

variant of the M bovis type strain PG45 with a high-level of expression of Vsp A; the assay

performed well in experimentally- and naturally-infected cattle populations, although whether

the antigen was superior to traditional antigens was not determined. A variety of ELISA tests for

serological detection ofM bovis antibodies are now commercially available in North America

and Europe; for example, Biovet in Canada, Bio-X Diagnostics in Belgium, and Bommelli in

Switzerland all manufacture ELISA kits that detect M. bovis antibodies.

Mycoplasma bovis-specific serum immunoglobulin (Ig) is detectable as early as 6 days

(IgM) to 10 days (IgG) after experimental inoculation ofM bovis into the respiratory tract

(Brank et al., 1999; Le Grand et al., 2002). Specific serum immunoglobulin concentrations

remain elevated for months to years after M bovis infection, so a high titer does not necessarily

indicate very recent exposure (Le Grand et al., 2001; Nicholas and Ayling, 2003). Maternal

antibody can also result in high antibody levels in young calves, although with a half-life of 12 to

16 days this typically wanes by a few months of age (Tschopp et al., 2001). Virtala et al., (2000)

reported that of 75 pneumonic dairy calves less than 3 months of age in which M. bovis was

isolated from tracheal wash samples, only 57% had a 4-fold or greater increase in M bovis serum

antibody titers by IHA. The authors concluded that paired serum samples were not a good

predictor of M. bovis-associated respiratory disease, possibly due to the presence of maternal

antibody titers. Other investigators also failed to find a correlation between serum antibody titers

to M bovis and M bovis-associated respiratory disease in naturally infected individual animals

(Rosendal and Martin, 1986; Martin et al., 1989). However, on a group level, seroconversion has

been predictive of M. bovis-associated respiratory disease (Martin et al., 1990; Tschopp et al.,

2001). Therefore, serology is of limited diagnostic value in individual animals and is really most









useful in epidemiological surveillance (Rosendal and Martin, 1986; Le Grand et al., 2002).

Serology has also been effective as a biosecurity tool to screen new purchases prior to

introduction into a herd, but this would only be applicable to animals more than a few months of

age, after maternal antibodies have waned (Byrne et al., 2000; Nicholas and Ayling, 2003).

Treatment

The fact that Mycoplasma species lack a cell wall has important implications for

treatment, as it means the beta-lactam antibiotics are ineffective (Taylor-Robinson and Bebear,

1997). Mycoplasma species are also naturally resistant to sulfonamides. Currently, only one

product, containing the triamilide antibiotic tulathromycin (Draxxin; Pfizer, Inc.) is approved

for treatment ofM. bovis-associated disease in dairy calves in the U.S. Other antimicrobials that

have a theoretical basis for efficacy against M. bovis, and that are approved in the U.S. for

treatment of respiratory disease in dairy heifers less than 20 months of age, include florfenicol,

oxytetracycline, spectinomycin, tilmicosin, and tylosin. Recent evidence suggests that

antimicrobial resistance to antibiotics traditionally used for treatment of mycoplasma infections

is increasing in field isolates ofM bovis in North America (Francoz et al., 2005; Rosenbusch et

al., 2005) and Europe (Ayling et al., 2000; Thomas et al., 2003a); isolates from both continents

show widespread resistance to tetracyclines and tilmicosin, and European isolates show

increasing resistance to spectinomycin. Although in vitro antibiotic susceptibility profiles of

M. bovis may be useful in making broad generalizations about antibiotic resistance, data have not

been published on the relevance of these profiles to clinical efficacy on an individual or a herd

level. The antibiotic susceptibility profiles of paired M bovis isolates obtained from nasal swabs

and BAL samples in calves with respiratory disease were found to differ considerably within









animals, suggesting that if susceptibility profiles are used, they need to be based on isolates

obtained from the site of infection (Thomas et al., 2002b).

In spite of the limited choice of potentially effective antibiotics available, antibiotics are

widely used to treat M bovis-associated disease. However, treatment is frequently unrewarding,

with affected calves requiring a long duration of treatment or failing to respond (Stalheim and

Stone, 1975; Romvary et al., 1979; Allen et al., 1992a; Stipkovits etal., 1993; Adegboye et al.,

1996; Pfutzner and Sachse, 1996; Walz et al., 1997; Apley and Fajt, 1998; Poumarat et al., 2001;

Stokka et al., 2001; Francoz et al., 2004; Van Biervliet et al., 2004). Calves with chronic and/or

multisystemic disease are reported to have an especially poor response to treatment (Stalheim

and Stone, 1975; Stipkovits etal., 1993; Adegboye etal., 1996; Apley and Fajt, 1998; Stokka et

al., 2001). There are few controlled clinical trials evaluating the efficacy of various antibiotics

available for treatment ofM. bovis-associated disease, and the few efficacy studies published

must be interpreted with caution, as most use experimentally infected calves and treatment is

often started early in the disease course (Gourlay et al., 1989b; Poumarat et al., 2001; Godinho et

al., 2005). In an industry-sponsored study, tulathromycin was an effective treatment for

respiratory disease in dairy calves that had been experimentally infected with M. bovis, when

treatment was initiated at 3 or 7 days after inoculation (Godinho et al., 2005). Likewise,

tilmicosin administered 6 hrs prior to inoculation or at the onset of clinical disease was effective

in reducing lung colonization by M. bovis in calves that had been experimentally infected with

M. haemolytica plus M. bovis (Gourlay et al., 1989b). However, treatment with spectinomycin

did not alter the clinical course of disease in calves with M bovis plus P. multocida pneumonia

when treatment was started 6 days after inoculation, although the numbers of M. bovis in the

lung were reduced in treated calves (Poumarat et al., 2001).









Scant information is available regarding treatment ofM. bovis-associated disease in field

situations, and most studies have come from Europe. Marbofloxacin, a fluoroquinolone

antibiotic, was an effective treatment for naturally-occurring M. bovis-associated respiratory

disease (Thomas et al., 1998), but this antibiotic cannot be used in cattle in the U.S. Available

therapies that have resulted in clinical improvement in calves with M. bovis-associated

respiratory disease in field trials include oxytetracycline, tilmicosin, or a combination of

lincomycin and spectinomycin (Picavet et al., 1991; Musser et al., 1996). However, given the

recent evidence that resistance against these drugs is increasing, these antibiotics may no longer

be appropriate choices. Without other data to guide choice of an antibiotic, selection of a specific

treatment regimen from the list of potentially effective antibiotics based on past performance in

the affected herd is frequently recommended (Apley and Fajt, 1998; Step and Kirkpatrick,

2001 a).

In addition to antibiotics, short term use of anti-inflammatory drugs can be beneficial in

the treatment of bovine respiratory disease (Bednarek et al., 2003). Although these therapeutic

agents have not been specifically evaluated for the treatment ofM. bovis-associated disease,

there is a logical basis for their use, as the inflammatory response may contribute significantly to

the pathology ofM. bovis infections (Howard et al., 1987c; Rosenbusch, 2001). Non-specific

supportive therapy including oral or intravenous fluids and nutritional support may be indicated

in specific animals (Van Biervliet et al., 2004).

Irrigation of the middle ear after the tympanic membrane has ruptured has been

recommended for treatment of otitis media in calves (Morin, 2004), although studies of the

efficacy of this procedure were not identified in a literature search. Puncture of the tympanic

membrane myringotomyy) followed by insertion of tympanostomy tubes is commonly used in









the treatment of children with chronic or recurrent otitis media (Lous et al., 2005; Poetker et al.,

2006), and some veterinarians have promoted blind myringotomy using a sharp object such as a

knitting needle in the treatment of otitis media in calves (Schnepper, 2002). To the best of the

author's knowledge, studies on the risks and efficacy of this procedure in clinical cases have not

been published. The potential benefit of myringotomy is the relief of pain and pressure caused by

the build-up of exudate in the middle ear, as well as access to the middle ear for irrigation

(Rosenfeld et al., 2004). Whether the procedure might provide relief for calves that have the

thick, caseous exudate characteristic of chronic M. bovis otitis media is not clear. In a recent

study using calf cadavers, investigators reported that blind insertion of a 3.5 mm diameter

straight knitting needle approximately 3 cm into the ear canal to perforate the ear drum was

anatomically feasible (Villarroel et al., 2006). Studies are clearly needed to evaluate the effect of

myringotomy on drainage from the middle ear and the health and recovery of the calf.

Another more aggressive surgical treatment of otitis media/interna was described in one

case report (Van Biervliet et al., 2004). A bilateral tympanic bulla osteotomy was performed on a

4-week-old calf with severe, chronic M bovis-associated otitis media-interna that had failed to

respond to antibiotic treatment. Post-surgically, the tympanic bullae were lavaged daily with

warm saline for 3 days, and antibiotics were continued for 16 days. Surgery coincided with a

dramatic improvement in clinical signs and the calf was reported to be clinically normal at 1 year

of age. Because of the cost and complexity of this procedure, as well as the requirement for

general anesthesia, its application is probably limited to refractory cases of otitis media in high-

value calves without concurrent respiratory disease.

To summarize, antibiotic treatment ofM. bovis-associated disease is often unrewarding,

especially in calves with chronic or multisystemic infections. Improved efficacies are reported in









experimental infection studies when treatment is initiated early in the disease course, suggesting

that early intervention or, perhaps, metaphylactic therapy in high risk calves (discussed below)

may be more rewarding. Extended duration of antimicrobial therapy is frequently recommended.

Further studies are needed to determine field efficacy of particular antibiotic regiments for

treatment of clinical disease in U.S. dairy calves and to evaluate the safety and efficacy of

myringotomy and irrigation of the middle ear in calves with otitis media.

Control and Prevention

Results of epidemiological studies of mycoplasmal mastitis suggest that the best way to

prevent M. bovis infections is to maintain a closed herd or to screen and quarantine purchased

animals (Gonzalez et al., 1992; Burnens et al., 1999; Step and Kirkpatrick, 2001b; AABP, 2005).

Results of such studies also suggest that M bovis-associated mastitis can be effectively

eliminated from dairy herds through aggressive surveillance and culling of cows with M. bovis

mastitis (Brown et al., 1990; Fox et al., 2003). In feedlot cattle, where these types of biosecurity

measures are not practical, recommendations for the control and prevention ofM. bovis-

associated respiratory disease and arthritis focus on limiting stress, vaccinating to reduce the

incidence of other respiratory pathogens and segregating affected groups of calves from new

arrivals to reduce exposure of high-risk animals toM. bovis (Step and Kirkpatrick, 2001 la; Stokka

et al., 2001). Dairies that are expanding and calf ranches that rear animals from multiple sources

obviously cannot maintain closed herds, and calf ranches are not usually able to screen new

calves prior to introduction into the facility. However, calf ranches do have the ability to be

selective in purchasing calves, and animals could be screened on arrival to determine if a

particular supplier is consistently providing M bovis-infected calves. Prevention ofM bovis-

associated disease is hampered in dairy calf operations by the extremely limited understanding of

its epidemiology and risk factors.









Current recommendations for prevention ofM. bovis-associated calf disease are based on

reducing exposure to M. bovis. Potential sources of exposure that could be controlled include

unpasteurized bulk tank or waste milk, colostrum, and indirect or direct contact with respiratory

aerosols from infected calves. Exposure to M bovis in milk could be limited by culling infected

cows or avoiding feeding milk from cows that are infected, by on-farm pasteurization of milk

prior to feeding, or by feeding milk replacer (Pfutzner and Meeser, 1986; Walz et al., 1997;

Butler et al., 2000; Stabel et al., 2004). On-farm batch pasteurization of discard milk to 650C for

1 hr or 700C for 3 min (Butler et al., 2000) or the use of a high-temperature short-time

pasteurizer (Stabel et al., 2004) will inactivate Mycoplasma species. Frequent monitoring by

culture of pasteurized milk samples to ensure that pasteurization has been effective is important

in any on-farm pasteurization program (Godden et al., 2005). Pasteurization of colostrum is also

possible; authors of some recent studies reported that on-farm batch pasteurization at 600C for

30 min eliminated viable M bovis while immunoglobulin concentration and colostral

consistency were not adversely affected (Godden et al., 2006; McMartin et al., 2006).

Pasteurization methods that use higher temperatures have resulted in reduced colostral quality

and unacceptable feeding characteristics (Godden et al., 2003; Stabel et al., 2004; Godden et al.,

2006). If colostrum is not pasteurized, it has been recommended that it should not be pooled to

minimize potential exposure of calves to M bovis (Rosenbusch, 2001).

Large numbers ofM bovis can be shed in respiratory secretions of calves with clinical

M. bovis-associated disease (Bennett and Jasper, 1977c; Pfutzner and Sachse, 1996). It has

therefore been recommended to segregate affected and healthy calves, although this is frequently

impractical (Step and Kirkpatrick, 2001 la). Other recommendations that have been made include

taking appropriate precautions to prevent potential transfer ofM. bovis between calves by









personnel or equipment (Nicholas and Ayling, 2003). Nipples, bottles, tube feeders and buckets

should be adequately sanitized, and pens disinfected between calves. As discussed earlier,

M. bovis survives surprisingly well in the environment, but it is highly susceptible to heat and to

most commonly used chlorine-, chlorhexidine- acid- or iodine-based disinfectants (Pfutzner et

al., 1983b; Boddie et al., 2002). 'All in, all out practices' have been recommended to prevent

older animals from infecting younger ones, but are often impractical in dairy calf facilities

(Nicholas and Ayling, 2003).

Management practices that help control other respiratory diseases by maximizing the

ability of the calf's respiratory system to resist and control infection have been recommended for

M. bovis, although none of these has been specifically evaluated with respect to this pathogen

(Ames, 1997; Rosenbusch, 2001; Step and Kirkpatrick, 2001a). Such measures include providing

proper nutrition, adequate ventilation at the pen level and reducing environmental stressors such

as overcrowding and heat- and cold-stress. Because viral respiratory pathogens, especially

BVDV, may predispose to M. bovis infection (Ames, 1997; Shahriar et al., 2000), herd

vaccination protocols for infectious bovine rhinotracheitis virus (BR), parainfluenza type 3 virus

(PI3), BVDV and bovine respiratory syncytial virus (BRSV), as well as the herd BVDV

monitoring program, should be evaluated to ensure that they are appropriate. Although the role

of passive transfer of M. bovis-specific antibodies in protection of calves from M bovis-

associated disease is unclear, a sound colostrum feeding program can reduce the risk of infection

with other respiratory pathogens (Ames, 1997), and may therefore decrease the risk of secondary

M. bovis infections.

There are no M. bovis vaccines approved for use in the U.S. in young dairy calves,

although at least two are approved for prevention of respiratory disease in older cattle, and one









for prevention of mastitis. Autogenous vaccines are also used by some producers in an attempt to

prevent M. bovis-associated disease in calves (Thomson and White, 2006). Although some

vaccines have appeared promising (Chima et al., 1980; Chima et al., 1981; Howard et al., 1987a;

Nicholas et al., 2002), others have failed to protect from or have worsened clinical disease

(Rosenbusch, 1998; Bryson et al., 1999). Vaccination will be further discussed in the sections on

relevant experiences with mycoplasmal vaccines for diseases other than M bovis, and

vaccination against M bovis, below.

The prophylactic or metaphylactic use of antibiotics is generally undesirable but its use

may be justified when high levels of morbidity and mortality are being sustained. Strategic

antibiotic treatment of calves that are deemed to be at high risk for respiratory disease upon

arrival at feedlots has clearly been demonstrated to reduce the incidence and severity of

respiratory disease (Galyean et al., 1995; Schunicht et al., 2002; Thomson and White, 2006). In

addition, feeding metaphylactic levels of antibiotics in milk replacer to dairy calves on calf

ranches reduces disease incidence and delays the onset of clinical disease during the pre-weaning

period (Berge et al., 2005). For M bovis-associated disease, the response to treatment when

antibiotics are given prior to, or early in the course of experimentally induced disease, is often

better than the response rates reported in field cases, suggesting that metaphylactic treatment

might be more successful than treatment after disease is clinically apparent. In one European

study, investigators found that valnemulin added to the milk from 4 days of age for 3 weeks was

effective in limiting M bovis-associated disease in calves (Stipkovits et al., 2001). Animals in

the treated group had fewer clinical signs and reduced clinical scores, although disease was not

eliminated and calves still required a considerable number of individual treatments. Nagatomo et

al., (1996) treated calves that were at high risk of M. bovis-associated disease with









chloramphenicol. Untreated calves had high mortality rates (up to 41%), while the onset of

clinical disease was delayed in treated calves and all treated calves survived. Prophylaxis or

metaphylaxis with antibiotics that are approved for use in U.S. cattle have not been evaluated

with respect to M bovis-associated disease in young dairy calves.

Microbial Pathogenesis

Antigenic Variation

Mycoplasmal lipoproteins are involved in many diverse functions including modulation

of essential cellular pathways, acquisition of nutrients, immune modulation and cytadhesion

(Citti and Rosengarten, 1997; Chambaud et al., 1999). Surface lipoprotein variation in

mycoplasmas is thought to be a means of adapting to varying environmental conditions,

including the host immune response, and may be important in determining the chronic nature of

many mycoplasmal infections (Citti and Rosengarten, 1997; Chambaud et al., 1999). Many of

these immunodominant mycoplasmal antigens undergo phase and/or size variation (Jan et al.,

1995; Razin et al., 1998). There is some evidence that lipoprotein variation in mycoplasmas is

involved in protection from the immune response. Antigenic variation is observed in vivo

(Levisohn et al., 1995; Rasberry and Rosenbusch, 1995), and particular variants ofM. bovis can

be selected in vitro by the addition of antibodies to culture medium (Jensen et al., 1995; Le

Grand et al., 1996). The accessibility of antibodies to a mycoplasma colony depends on the size

of Vsps (Levisohn et al., 1995) and elongated surface lipoproteins protect mycoplasma cells

from growth inhibiting antibodies (Citti et al., 1997), possibly by limiting epitope accessibility.

The variable surface antigens (Vsa) ofM. pulmonis are hypothesized to form a "molecular

shield" that prevents lysis by complement (Simmons and Dybvig, 2003; Simmons et al., 2004).

Consistent with other mycoplasmal infections, cell-surface lipoproteins are the

preferential target of the humoral immune response in M bovis infections (Behrens et al., 1996;









Brank et al., 1999). A large family of immunodominant Vsp lipoproteins has been characterized

in M. bovis (Behrens etal., 1994; Lysnyansky et al., 1996; Beier etal., 1998; Brank et al., 1999;

Sachse et al., 2000; Nussbaum et al., 2002). Structurally, Vsp molecules contain extensive

regions of tandemly reiterated sequences that can comprise over 80% of the entire protein

(Behrens et al., 1994). The members of the Vsp family undergo independent high frequency

phase and size variation to generate diversity in the Vsp repertoire (Behrens et al., 1994;

Lysnyansky et al., 1996; Lysnyansky et al., 1999). Phenotypic switching in Vsp antigens is

associated with high frequency chromosomal rearrangement in the vsp genomic locus, which

consists of a large cluster of related but divergent single-copy vsp genes (Lysnyansky et al.,

1999). Because of the processes producing antigenic variants, a given population of M bovis

cells always comprises variants differing in their lipoprotein repertoire (Rosengarten and Yogev,

1996). The expression of particular Vsp antigens has not been associated with geographical

location, year of isolation, clinical manifestation, mode of infection, or pathology (Rosengarten

et al., 1994; Brank et al., 1999; McAuliffe et al., 2004). However, compared to the type strain of

M. bovis, field strains have been shown to possess modified versions of the vsp gene complex in

which there is extensive variation in the reiterated coding sequences of the vsp structural genes,

indicating a vast capacity for antigenic variation within M. bovis populations (Nussbaum et al.,

2002).

In addition to the Vsp family, M. bovis may possess other methods to increase its

capacity for antigenic variation. For example, M. bovis has recently been found to contain genes

with homology to the abundantly expressed MALP-404 surface lipoprotein of Mycoplasma

fermentans (Lysnyansky et al., 2006). Posttranslational processing of MALP-404, involving

specific cleavage of part of the molecule into the extracellular environment, results in dramatic









changes in the surface phenotype ofM. fermentans (Davis and Wise, 2002). Whether these types

of events also occur in M. bovis is currently unknown, but may be feasible given the genetic data

that has been reported (Lysnyansky et al., 2006).

Adhesion

Adherence is an important feature of mycoplasma pathogenicity. Adherence is thought to

be the initial step in the disease-causing process of pathogenic mycoplasmas (Baseman and

Tully, 1997; Rottem and Naot, 1998; Rosengarten et al., 2000). Once attached, the mycoplasma

effectively colonizes the host respiratory surface, can induce physiological changes such as

ciliostasis, and establishes a persistent and chronic infection (Rottem and Naot, 1998;

Rosengarten et al., 2000). The microbe then elicits a host immune response, and it is the

character and intensity of the host response that is critical in lesion severity (Jones and Simecka,

2003).

Unlike some pathogenic mycoplasmas (Krause, 1998; Rosengarten et al., 2000), M bovis

lacks a defined attachment tip. Although little is known about the ligands involved in M. bovis

cytadherence, neuraminidase-sensitive sialyl moieties are important for adherence of many

mycoplasmas, including M bovis (Sachse et al., 1996). Mycoplasma bovis adheres in vitro to

neutrophils, embryonic bovine lung cells, and primary cultures of bovine bronchial epithelial

cells in a specific manner (Thomas et al., 2003b; Thomas et al., 2003c). Immunohistochemical

and electron microscopic studies have demonstrated in vivo adherence of M bovis to respiratory

and other mucosal surfaces, including the joint and mammary gland (Stanarius et al., 1981;

Thomas et al., 1987; Adegboye et al., 1995b; Adegboye et al., 1996). Surface molecules of

M. bovis that have been identified as important in adhesion include the protein P26, as well as

members of the Vsp family, particularly Vsp C, Vsp F, and an as-yet uncharacterized Vsp

(Sachse et al., 2000; Thomas et al., 2005a). Recently, M. bovis has been shown to form a biofilm









in vitro (see discussion below), and surprisingly, the inability to form biofilms was linked to

expression of Vsp F (McAuliffe et al., 2006). Completion of M. bovis genome sequencing

projects are anticipated in the near future and likely will provide additional information on

putative adhesins for this pathogen.

Biofilms

Although flocculent growth of mycoplasmas in liquid medium as well as development of

microcolonies have been observed (Pollock and Bonner, 1969; Miyata et al., 2000), little

attention has been given to the development of biofilms by these microorganisms. However, the

ability of mycoplasmas to colonize mucosal surfaces, the development of persistent, chronic

infections even in the face of a robust host immune response, and the refractory nature of many

mycoplasmal infections to antibiotic therapy are characteristics that have been associated with

biofilm formation (Donlan, 2000; Donlan, 2002; Donlan and Costerton, 2002). Biofilm

formation is well established as a mechanism by which bacteria, alone or in concert with other

microbes, form sessile microbial communities that facilitate persistence within the host and

development of chronic infections (Costerton et al., 1999; Donlan, 2000; Donlan, 2002; Donlan

and Costerton, 2002; Morris and Hagr, 2005). A key feature of biofilms that contributes to

persistence is the increased resistance to antibiotic therapy, often rendering microbes within the

biofilm refractory to standard treatment regimens (Donlan, 2000). Additionally, microbes in

biofilms are protected from components of the host immune response (Costerton et al., 1999;

Donlan and Costerton, 2002).

Biofilm formation has now been documented for several ruminant mycoplasmas

(McAuliffe et al., 2006) as well as the rodent pathogen M. pulmonis (Simmons et al., 2007;

Simmons and Dybvig, 2007). Strains of M. agalactiae, M. bovis, Mycoplasma cotewii,

Mycoplasma putrefaciens, and Mycoplasma yeatsii all produced substantive biofilms, with other









mycoplasmal species isolated from ruminants producing limited biofilms. In vitro analysis

demonstrated that M bovis in the biofilm were resistant to desiccation and heat stress, but did not

alter the minimum inhibitory concentrations for standard antibiotics (McAuliffe et al., 2006).

Somewhat surprisingly, the most virulent bovine mycoplasma M mycoides subsp. mycoides

biotype SC, did not produce a biofilm; in fact none of the 24 SC strains tested could produce a

biofilm (McAuliffe et al., 2006).

Biofilm formation was influenced by the strain ofM bovis, and the inability to form

biofilms was linked to expression of Vsp F (McAuliffe et al., 2006). In fact, Vsp F was not

expressed by any strain that was capable of forming prolific biofilms. Conversely, expression of

Vsp B and 0 was more common in strains that produced strong biofilms. A similar association

of Vsa expression and biofilm formation has been reported for M pulmonis (Simmons et al.,

2007; Simmons and Dybvig, 2007). In M pulmonis, the size of the Vsa as determined by the

tandem repeat length rather than the specific Vsa type was the critical determinant. Expression of

short Vsa proteins was associated with strong surface attachment and production of a substantial

biofilm, whereas expression of longer Vsa proteins resulted in free-floating microcolonies that

failed to attach to surfaces (Simmons et al., 2007; Simmons and Dybvig 2007). The attached

M. pulmonis were more resistant to complement-mediated lysis but were sensitive to gramicidin.

The relationship between Vsa size and susceptibility to complement killing was shown

previously (Simmons and Dybvig, 2003; Simmons et al., 2004), but more recent studies suggest

that resistance to complement killing is localized to the tower structures of the biofilm (Simmons

and Dybvig 2007), which contained the most complex and dense association of M pulmonis.

Although biofilms are regulated by environmental factors and quorum sensing in both

Gram negative and Gram-positive bacteria (Sauer, 2003; Stanley and Lazazzera, 2004),









mycoplasmas appear to lack the classic two-component regulatory systems. It has been

suggested that in M. pulmonis, slipped strand mispairings that generate variation in tandem Vsa

repeats provide a stochastic mechanism for control of biofilm formation (Simmons et al., 2007)

and thus represent a simplistic model to study biofilm development in the absence of known

regulatory elements. It is important to note that to date these studies have been done with in vitro

systems, and definitive proof of the role of biofilms in the pathogenesis of mycoplasmal

infections will require studies in animal models.

Recently, biofilm formation has been given greater consideration as a potential

mechanism by which microbial pathogens establish chronic, nonresponsive infections of the ear

in humans (Post, 2001; Roland, 2002; Fergie et al., 2004; Post et al., 2004; Morris and Hagr,

2005; Vlastarakos et al., 2007). Bacterial biofilms have been detected in biopsy material from

the ears of children with a history of chronic otitis (Hall-Stoodley et al., 2006). Biofilms were

confirmed in 90% of these patients. The formation ofbiofilms by Haemophilus influenzae during

experimental infection of chinchillas was confirmed by both scanning electron microscopy and

confocal microscopy (Ehrlich et al., 2002). All animals with effusions had evidence of biofilms.

Development of Pseudomonas aeruginosa biofilms in the middle ear of experimentally infected

cynomolgus monkeys has also been observed (Dohar et al., 2005). Therefore, it is reasonable to

suggest that the ability ofM. bovis to form biofilms may be directly relevant to otitis media in

calves.

Other Microbial Factors That Might Contribute to M. bovis Virulence

There are several other biological properties of mycoplasmas that have been implicated

as virulence determinants. Mycoplasmas compete with host cells for nutrients and biosynthetic

precursors, and can therefore disrupt host cell maintenance and function (Baseman and Tully,

1997). After cytadherence, many mycoplasmal species generate enzymes such as









phospholipases, as well as other products such as hydrogen peroxide and superoxide radicals,

which may damage host cells (Baseman and Tully, 1997; Minion, 2002). However, much of the

host cell damage and resulting clinical manifestations in mycoplasmal infections are due to the

host immune reaction and inflammatory responses rather than direct toxic effects of

mycoplasmal products (Rosengarten et al., 2000; Jones and Simecka, 2003).

Several toxins have been identified in mycoplasmas, including the neurotoxin associated

with Mycoplasma neurolyticum (Tully, 1981) and the most recent description of community-

acquired respiratory disease syndrome (CARDS) toxin in Mycoplasma pneumoniae (Kannan and

Baseman, 2006). There is one report of a 73 kD polysaccharide toxin in M. bovis (Geary et al.,

1981). The polysaccharide component was present in association with a membrane glycoprotein

and when injected intradermally into guinea pigs increased vascular permeability, activated

complement, and resulted in a massive recruitment of eosinophils into the dermis. Infusion of

large amounts of the polysaccharide into the udder induced clinical mastitis and lesions

consistent with mycoplasmal mastitis. However, this polysaccharide has not been further

characterized. Phenotypic classification ofM bovis isolates based on the presence or absence of

in vitro cytotoxic activity has been reported, but cytotoxic strains have not been fully

characterized and the relevance of this phenotype with respect to virulence potential is unknown

(Rosenbusch, 1996a; Rosenbusch, 1996b).

Bovine Immunology: Relevant Background Information

Lymphocyte Subpopulations in Cattle

There are three major bovine lymphocyte subpopulations: B cells, T cells expressing the

up T cell receptor, and T cells expressing the y6 T cell receptor. As in other species,

lymphocytes within the u 3 T cell population coexpress either CD4 (T helper [Th] cells) and are









MHC class-II restricted, or express CD8 (cytotoxic/suppressor T cells) and are MHC class-I

restricted. Some cells within the y6 T cell population also coexpress CD8 (MacHugh et al.,

1997). T cells have important effector functions and are pivotal in the regulation of the nature

and intensity of an immune response. Th cells produce cytokines in response to recognition of an

antigen-MHC complex on antigen presenting cells (APC). By secreting particular cytokines, Th

cells play a vital role in activation of B cells, other T cells, macrophages and various other cells

that participate in the immune response (Sordillo et al., 1997). CD8+ T cells are uniquely

equipped to recognize and kill bacterial or viral infected cells, as well as tumor cells, parasites

and some free bacteria. They are also very important modulators of immune and inflammatory

responses through the production of cytokines.

In laboratory rodents, Th cells can be divided into distinct Thl and Th2 subpopulations;

Thl cells secrete cytokines such as IFN-y, interleukin (IL)-2 and tumor necrosis factor (TNF)-f3

that are associated with inflammatory responses, whereas Th2 cells secrete cytokines including

IL-4, IL-5, IL-6, IL-10 and IL-13 that mediate humoral responses (Jones and Simecka, 2003).

IFN-y and IL-4 are the classical cytokines used to indicate Thl and Th2 immune responses,

respectively. In rodents, the T cell response is often polarized to a Thl or Th2 response, with

large increases in one cytokine and the T cells that produce it, and a corresponding low

production of the opposing cytokine (Jones and Simecka, 2003). In cattle, however, this clear

division of immune response phenotypes is less evident, and strongly polarized cytokine profiles

are rarely observed (Brown et al., 1998c). However, highly skewed immunoglobulin isotype

expression patterns occur in many cattle diseases, especially in chronic infections, with IgGi

responses being driven by IL-4 and IgG2 responses driven by IFN-y (Brown et al., 1998c). These

types of responses have been applied in cattle to indicate Thl versus Th2 polarization, with IgGi









indicating a Th2 response, and IgG2 indicating a Thl response. In addition, ratios of IL-4 and

IFN-y have been used to determine Thl versus Th2 responsiveness in cattle (Brown et al.,

1998d; Vanden Bush and Rosenbusch, 2003; Miao et al., 2004). Thus, although Thl/Th2

responses may not be well defined in cattle, some polarization of the immune response does

occur and can be defined by IgGi/IgG2 or IL-4/IFN-y ratios.

Ruminants have a relatively higher percentage of y6 T cells compared with other species

(Hein and Mackay, 1991). The percentage of the circulating mononuclear cell population that

expresses the y6 T cell receptor is approximately 10-15% in adult cattle, and up to 40% in

neonatal calves (Wilson et al., 1996; Kampen et al., 2006). Bovine y6 T cells can be divided into

subpopulations that differ in terms of tissue distribution and function (Wyatt et al., 1994; Wyatt

et al., 1996; Wilson et al., 1998). The largest subpopulation within the circulation expresses the

surface molecule WC1 (Workshop Cluster 1). WC1 y6 T cells are CD3+ but do not express

CD2, CD4, or CD8 (MacHugh et al., 1997). Between 65 and 90% of circulating y6 T cells are

WC1 and this percentage is not affected by age (Blumerman et al., 2006; Kampen et al., 2006).

WC1 T cells are also found in the white pulp of the spleen, outer cortex of peripheral lymph

nodes, mucosal associated lymphoid tissue (MALT), epithelial layers of the gut and respiratory

tract, skin, and sites of inflammation (Clevers et al., 1990; Wilson et al., 1999). In contrast,

WC1- y6 T cells, which do express CD2 and CD8, represent a small percentage of the circulating

y6 T cell population (MacHugh et al., 1997). WC1- CD8+ y6 T cells comprise a large percentage

of the y6 T cells in some tissues including the red pulp of the spleen and in the healthy mammary

gland, uterus and other mucosal epithelial sites (e.g. lamina propria of the gut) (MacHugh et al.,

1997; Hedges et al., 2003).









The role that y6 T cells play in immune responses is poorly understood, but they appear

to have broad effector and regulatory functions and are involved in many aspects of the bovine

immune response to pathogens (Pollock and Welsh, 2002). y6 T cells can recognize non-protein

antigens such as bacterial carbohydrates as well as classical protein antigens, and may therefore

have unique roles in immune responses to unconventional antigens (Pollock and Welsh, 2002).

Gene expression and microarray data suggest that the WC 1 T cells are primarily an

inflammatory cell population with some subsets expressing IFN-y, whereas WC1- y6 T cells

have regulatory functions and promote quiescence (Hedges et al., 2003; Rogers et al., 2005).

Within the WC1 T cell population, distinct subsets of y6 T cells exist that may perform different

functions (Rogers et al., 2006; Price et al., 2007). WC1 T cell subsets in peripheral sites

contribute to early production of IFN-y during infection with intracellular and extracellular

pathogens, and are thought to be important in linking the innate and adaptive immune responses

(Price et al., 2007). In addition, subsets of circulating WC1 T cells express surface molecules

that allow them to home efficiently to sites of inflammation, whereas WC1-y6 T cells do not

express these molecules and are not recruited to sites of inflammation (Wilson et al., 2002). In

very young calves, y6 T cells appear to have a predominantly dampening effect on antibody

responses and on antigen-specific and mitogen-stimulated responses of other T cells (Howard et

al., 1989). Calves that have been depleted ofWC y6 T cells have reduced non-specific

production of IFN-y, greater mucosal and systemic antibody responses to antigens, and increased

tendency to Th2-biased responses (Taylor et al., 1995; Kennedy et al., 2002; Rogers et al.,

2005). Thus, bovine y6 T cells are likely to be important in early immune responses to a broad

range of antigens, and distinct y6 T cell subsets are likely to have unique functions in these

immune responses.









Lymphocyte subpopulations in the lungs or BAL fluid from normal cattle have been

described (Mathy et al., 1997; McBride et al., 1997). Mathy et al., (1997) examined lymphocyte

subpopulations in lungs of adult cattle. T cells predominated over B cells in BAL and lung

parenchyma cell populations, and CD8+ T cells predominated over CD4+ T cells. y6 T cells made

up approximately 9% of the lymphocyte populations. Most CD4+ and CD8+ T cells expressed

high amounts of the activation marker CD44, as did B cells from BAL fluid. The authors did not

report on the WC 1 subpopulation, but other investigators found that WC 1 y6 T cells are present

within bronchial lymph nodes of normal adult cattle (Cassidy et al., 2001; Sopp and Howard,

2001). In addition, in the lungs of healthy 8-month-old cattle, small numbers of WC1 y6 T cells

were resident in bronchial submucosa and interalveolar septae (Cassidy et al., 2001). Further, 1-

year-old calves experimentally inoculated with M. haemolytica had a substantial increase in the

percentage of y6 T cells in BAL fluid by 7 days post-infection (McBride et al., 1999). Although

their function within the lung is unknown, the presence of y6 T cells is consistent with a role in

the early response to lung infection.

Although limited information is available, lymphocyte subpopulations in the peripheral

lymphoid tissues of the respiratory tract in cattle have been described. Lymphocyte

subpopulations in palatine and pharyngeal tonsils of healthy adult cattle have been reported

(Rebelatto et al., 2000). Populations at both tonsil sites were similar, and consisted of

approximately 3% y6 T cells, 2% WC1 y6 T cells, 15% CD4+ T cells and 7% CD8+ T cells, with

the remainder being B and other mononuclear cells. In 10-day-old calves, y6 T cells comprised

approximately 8% of the mononuclear cell population in bronchial lymph nodes and 15% in

lungs, although there was large calf-to-calf variation (McInnes et al., 1999). In adult cattle,

WC1 y6 T cells, CD4+ T cells, and CD8+ T cells comprised 5%, 30% and 11% of bronchial









lymph node mononuclear cells, respectively (Sopp and Howard, 2001). These and other studies

have shown that y6 T cells are resident in the lymphoid tissues of the URT and LRT and

therefore could be expected to play a role in early immune responses at these sites.

Anatomical Barriers and Innate Defenses of the Bovine Respiratory Tract

In the URT, defenses against infection are mainly in the form of physical and mechanical

barriers to invading microbes, as well as in the specific antibacterial substances secreted onto the

mucosal surface (Dungworth, 1993; Ellis, 2001). The structural design of the respiratory tract

means that almost all inhaled particles are trapped in the nasal turbinates, trachea and bronchi,

with subsequent removal by mucociliary clearance before the trapped particles reach the alveoli.

The mucosa of the URT and airways is also coated with mucus that contains non-specific and

specific antimicrobial factors such as lysozyme, surfactants, and pathogen-specific

immunoglobulins. The importance of the mucociliary apparatus in lung defense in cattle is

illustrated by the fact that damage to the structural integrity of the mucociliary system by viral

agents is strongly associated with increased risk of secondary bacterial pneumonia (Ames, 1997;

Kapil and Basaraba, 1997).

Alveolar macrophages, neutrophils, natural killer (NK) cells, and mast cells are involved

in innate immune defenses of the LRT. In addition, epithelial cells contribute to innate defenses

through the secretion of pro-inflammatory cytokines and chemokines (Kruger and Baier, 1997;

Ackermann and Brogden, 2000; Yang et al., 2002). Alveolar macrophages are probably the most

important cell in initial response to infectious agents (Ellis, 2001). Alveolar macrophages can be

activated through a variety of pathways by contact with pathogens or their products; opsonized

particles are generally more effective activators of alveolar macrophages than are unopsonized

particles (Howard and Taylor, 1983). Activated alveolar macrophages secrete substances such as









IL-8 that are chemotactic for neutrophils and other macrophages as well as pro-inflammatory

acute-phase cytokines such as IL-1, IL-6 and TNF-ca (Caswell et al., 1998). In addition, activated

alveolar macrophages also display increased phagocytic capacity and bactericidal ability. As in

other body systems, acute phase cytokines activate endothelial cells of blood vessels, initiating a

cascade of events that results in leakage of serum factors including complement into the lung.

Acute phase cytokines also potentiate expression of adhesion molecules to allow trafficking of

leukocytes into affected lung (Caswell et al., 1998; Ackermann and Brogden, 2000). Neutrophils

attracted to the site participate in phagocytosis and killing of pathogens, and are also involved in

exacerbation of inflammatory responses in several bovine respiratory diseases (Ackermann and

Brogden, 2000; Ellis, 2001).

Major functions of NK cells are to kill tumor- or virus-infected cells, but they may also

play a role in the initial response to infection in the bovine lung. In other species, NK cells

responding to early lung infection activate macrophages by secretion of pro-inflammatory

cytokines including IFN-y and TNF-uc; NK cells also secrete a variety of chemotactic factors

(Curtis, 2005). Although NK cells are associated with protective responses against IBR infection

in cattle (Ellis, 2001), little work has been done to define the role of NK cells in responses of the

bovine respiratory tract to this or other pathogens.

Mast cells are located in the submucosa of the URT and LRT. Large numbers of mast

cells are present along the respiratory tract of adult cattle, but numbers of mast cells in neonatal

calves are more limited (Chen et al., 1990; Ackermann and Brogden, 2000; Ramirez-Romero et

al., 2000). In other species, mast cells contribute to non-specific immune responses to bacterial

pathogens through a variety of pathogen- and inflammatory-associated stimuli, in addition to

their well-recognized role in IgE-mediated allergic reactions (Brandtzaeg et al., 1996; Boyce,









2003). Although the role of mast cells in bovine respiratory disease has not been well studied,

mast cell degranulation at the site of infection has been shown to contribute to the acute

inflammatory response to M. haemolytica inoculation in young calves (Ackermann and Brogden,

2000). The role of mast cells in bovine respiratory disease is also receiving increasing attention

as being important in the immunopathogenesis of BRSV and H. somni infections (Jolly et al.,

2004; Gershwin et al., 2005).

Adaptive Immune Responses of the Bovine Respiratory Tract

The URT, including the pharyngeal and palatine tonsils, contains organized MALT.

Interaction of cells of the immune system with potential pathogens of the respiratory system

occurs at the MALT sites. Primary interactions occur between activated APCs, especially

dendritic cells, and lymphocytes in tonsils and in draining lymph nodes. For respiratory

pathogens, the importance of the URT as a site of immune induction is emphasized by studies

where inoculation of an antigen into the URT results in specific antibody in both nasal and BAL

fluids, but inoculation directly into the LRT only results in specific antibody in the lung. This can

be important for disease protection; intranasal immunization of cattle against M. haemolytica

resulted in protective immune responses to aerosol challenge, whereas intratracheal

immunization did not (Jericho et al., 1990). In adult animals, IgA is the predominant antibody

isotype secreted in the URT, although in calves other isotypes including IgG may be equally or

more important; this is discussed under neonates, below.

The contribution of immune responses to protection from, or exacerbation of, clinical

disease caused by a number of viral and bacterial bovine respiratory pathogens has been widely

studied. Both cell-mediated and antibody responses to viral respiratory pathogens are associated

with reduced clinical disease (Ellis, 2001; Endsley et al., 2002; Woolums et al., 2003; Ellis et al.,

2007). However, cellular responses may also contribute to pathology in infected cattle (Ellis,









2001; Gershwin et al., 2005). For some pathogens, local cell-mediated immunity, mediated by

CD8+ T cells, is thought to be the critical protective immunological mechanism (Ellis, 2001).

Protection against the bacterial pathogens M. haemolytica, P. multocida, and H. somni is

associated with high concentrations of antibody (maternal or endogenous) to various virulence

determinants, particularly outer membrane proteins involved in iron acquisition, as well as the

leukotoxin ofM. haemolytica (Mosier, 1997; Potter et al., 1999; Ackermann and Brogden,

2000). Thus effective protection is pathogen-dependent and may involve one or more arms of the

immune system.

Although specific immune responses confer protective immunity to many pathogens,

some pathogen-specific immune responses are receiving increasing attention for their roles in

exacerbation of respiratory disease in cattle. For example, lung lesions due to BRSV infections

are thought to have a significant immunopathological component resulting from the stimulation

of a strong Th2-biased immune response, production of IL-4, and substantial amounts of IgE

(Gershwin et al., 2000). In lung infection with M haemolytica, immune complex deposition

within alveolar walls and the subsequent inflammatory response is thought to contribute to

pathology of this disease (McBride et al., 1999; Ackermann and Brogden, 2000). Similarly, host

immune responses are a major contributor to mycoplasmal disease in cattle and will be discussed

in more detail below.

Immunology of the Neonatal Calf

Although calves are born with a competent immune system, they are immunonaive and

many aspects of the immune system are developmentally immature (Barrington and Parish,

2001). This functional immaturity of the immune system is considered a major factor in

determining the increased susceptibility to bacterial and viral infections observed during the first

few months of life (Barrington and Parish, 2001). Colonization of the URT of dairy calves with









M. bovis often occurs within the first few weeks of life, with the peak incidence of clinical

disease at around a month of age. During this period, the immune system of the young calf is

undergoing rapid changes associated with maturation (Barrington and Parish, 2001; Nonnecke et

al., 2003; Foote et al., 2005a). Therefore, age-specific features of the immune system are likely

to be important in determining the susceptibility or resistance of the young dairy calf to M. bovis-

associated disease. Vaccine strategies that target young calves may need to be tailored

specifically to this age group.

Influence of Colostrum

Because the bovine syndesmochorial placenta does not permit passive transfer of

maternal antibody in utero, calves are born essentially agammaglobulinemic and rely on

maternal antibodies absorbed from colostrum for disease protection in the first few months of life

(Davis and Drackley, 1998). More than 80% of the immunoglobulin in bovine colostrum is IgGi;

the remainder is mostly IgG2 and IgA (Davis and Drackley, 1998). Fresh colostrum also contains

large numbers of viable leukocytes as well as factors involved in non-specific immune defenses

(Park et al., 1992; Barrington and Parish, 2001). Selected populations of functional T cells are

transferred into colostrum and readily cross the neonatal intestinal barrier and become distributed

systemically (Liebler-Tenorio et al., 2002; Reber et al., 2006). In the neonatal calf, maternal

antibodies, lymphocytes and other factors modulate immune responses, especially B cell

responses (Barrington and Parish, 2001; Endsley et al., 2003; Reber et al., 2005; Prgomet et al.,

2007). The functions of maternal T cells in the neonatal calf have been partially defined in vitro;

maternal CD4+ T cells are thought to stimulate immune responses in newborns by secretion of

cytokines while CD8+ T cells are thought to have mainly an immunosuppressive or dampening

effect on the neonatal immune response (Riedel-Caspari and Schmidt, 1991 la; Riedel-Caspari and

Schmidt, 1991b; Barrington and Parish, 2001). How long maternal T cells survive in the calf and









their long term effects have not been determined. The contribution of maternal lymphocytes to

immune responses in the respiratory tract of newborn calves is unknown, although maternal

lymphocytes do play a role in neonatal resistance to some enteric pathogens (Archambault et al.,

1988; Riedel-Caspari, 1993). B cells are also transferred into colostrum, although their primary

role is believed to be synthesis of dimeric IgA within mammary secretions (Barrington and

Parish, 2001).

The half-life of colostral antibody in calves is 11.5 to 16 days (Sasaki et al., 1976; Davis

and Drackley, 1998), and the majority of passively acquired antibody is cleared by transfer

across the mucosal epithelia, where it is functional and helps prevent infections (Besser et al.,

1988a; Besser et al., 1988b). Transfer of maternal IgG from serum to nasal secretions has been

demonstrated in young lambs (Wells et al., 1975). In calves, most of the work in this area has

involved study of receptor-mediated transcytosis of IgG into the intestinal lumen (Besser et al.,

1988a; Besser et al., 1988b), and there are limited data defining the mechanisms by which

maternal immunoglobulin is involved in protection of the respiratory tract. However, there is a

strong association between failure of passive transfer of maternal antibody and increased risk and

severity of respiratory disease in young calves, leaving little doubt that maternal immunoglobulin

does play an important role in protecting the LRT from disease in the neonatal calf (Thomas and

Swann, 1973; Williams etal., 1975; Davidson etal., 1981; Blom, 1982; Corbeil etal., 1984; Van

Donkersgoed etal., 1993; Donovan etal., 1998a).

Aside from the obvious benefits in protecting the calf from infectious disease, colostral

antibody also has potent immunomodulatory effects and can prevent the development of an

active humoral immune response to certain antigens (Riedel-Caspari and Schmidt, 1991b; Ellis

et al., 1996; Barrington and Parish, 2001; Ellis et al., 2001). This has particular relevance to the









development of effective vaccines for use in neonatal calves. However, at least with some

antigens, an anamnestic response in the face of maternal antibody can occur after second

exposure even without a measurable humoral response after the first exposure (Menanteau-Horta

et al., 1985; Ellis et al., 1996). Age-matched colostrum-deprived calves as well as neonatal

calves euthanized immediately after birth have increased numbers of IgG1- and IgG2-secreting

cells in lymph nodes as compared with colostrum-fed calves (Aldridge et al., 1998); thus feeding

of colostrum actually depletes the numbers of IgGi- and IgG2-secreting cells in lymph nodes.

This effect does not require the presence of viable maternal leukocytes and is thought to be

mediated by antibody or other soluble factors in colostrum. Isotype-specific depletion of

antibody-secreting cells represents one mechanism by which colostrum down-regulates humoral

capacity in newborn calves. Colostrum also modulates cell-mediated immune responses in

calves, and peripheral blood lymphocytes in colostrum-fed calves have lower blastogenic

responses to T cell mitogens than do colostrum-deprived calves (Clover and Zarkower, 1980).

Innate Immune Responses in Neonatal Calves

Despite the fact that the innate immune system is of primary importance in protection

from disease during the first few months of life, there are limited data on the functional capacity

of innate defenses in neonatal calves. The total number of neutrophils in peripheral blood is

higher in newborn calves than in adult cattle, and gradually decreases over the first 2 months of

life (Kampen et al., 2006; Mohri et al., 2007). Results of in vitro studies of the functional

maturity of neutrophils in newborn calves are conflicting (Hauser et al., 1986; Menge et al.,

1998; Kampen et al., 2006). In a recent study, Kampen et al., (2006) reported that in vitro

phagocytosis, respiratory burst, and bactericidal activity was intact and functional in neutrophils

from 1-week-old calves. Another major cell of the innate immune system, NK cells, comprise a

greater percentage of the total lymphocyte population in calves (< 6 months of age) than in adult









cattle (Kulberg et al., 2004), but NK cell functions specific to young calves have not been

defined.

Alveolar macrophages are a major cell type contributing to innate defenses of the LRT,

including defenses against mycoplasmal infections (Cartner et al., 1998). The proportion of

alveolar macrophages in BAL fluid is similar for calves at 1 week of age and for adults (Pringle

et al., 1988; Yeo et al., 1993), but in vitro phagocytic capacity was reported to be markedly

reduced in calves less than 3 weeks of age (Yeo et al., 1993). Alveolar macrophages of young

calves also have impaired secretion of neutrophil chemotactic factors compared with adult cattle

(Lu et al., 1996). This implies that the alveolar macrophages in calves are functionally immature

even though their numbers are equivalent to those found in immunocompetent adults. Reduced

phagocytosis, decreased secretion of cytokines and chemotactic factors, and/or lowered

bactericidal activity in neonates compared with adults has been reported for alveolar

macrophages in other species including humans, rhesus monkeys, horses, pigs, rats, and sheep

(Weiss etal., 1986; Liu etal., 1987; D'Ambola etal., 1988; Kurland etal., 1988; Grigg etal.,

1999; du Manoir et al., 2002; Goldman et al., 2004).

Adaptive Immune Responses in Neonatal Calves

The initial site of immune system interactions with respiratory pathogens in the URT is

MALT. Palatine and pharyngeal tonsils are not fully developed in the neonatal calf and do not

attain a mature MALT structure until approximately 2 months of age (Schuh and Oliphant, 1992;

Manesse et al., 1998). In 3 week-old calves, T and B cell dependent areas in the tonsils are not

well-differentiated, with few germinal centers and few WC1+ y6 T cells as compared with tonsils

of 2-month-old calves. Numbers of T and B cells are much less than in mature tonsils.

Maturation of MALT in the URT is thought to be triggered by exposure to antigens over the first









few weeks of life (Manesse et al., 1998). The impact of the apparent immaturity of the neonatal

calf tonsils has not been studied, but lower numbers of B and T cells at these sites could be

expected to limit the number of antigens in the URT that the calf is able to respond to early in

life.

The circulating lymphocyte population in young calves differs significantly from that of

adult cattle. Calves have higher absolute numbers of lymphocytes in peripheral blood than do

adult cattle (Kulberg et al., 2004), but calves have a much lower proportion of circulating B cells

(Senogles et al., 1978; Nonnecke et al., 1999; Kampen et al., 2006) and a much higher

proportion of y6 T cells (Wilson et al., 1996; Nonnecke et al., 1999; Kampen et al., 2006).

Composition of the circulating lymphocyte population changes gradually over the first few

months of life, and by 3 to 4 months the relative proportions of various lymphocyte populations

are similar to those of adult cattle (Nonnecke et al., 1999; Nonnecke et al., 2005; Kampen et al.,

2006). The relative proportion of peripheral blood mononuclear cells (PBMC) reported to be y6

T cells is 35-40% in the first week of life, decreasing to approximately 25% at one month of age

(Wilson et al., 1996). The decrease in the relative proportion of y6T cells that occurs over the

first few months of life is due to an increase in the absolute numbers of other lymphocyte

subsets, mainly CD4+ T cells and B cells, rather than a decrease in the absolute y6T cell numbers

(Kampen et al., 2006). The absolute number and proportion of CD4+ T cells in healthy calves

increases in the first few weeks of life, whereas there is little difference between calves and

adults in the number or relative proportion of CD8+ T cells (Kampen et al., 2006; Foote et al.,

2007).

Perhaps the most obvious difference between the lymphocyte populations of calves and

adults is that young calves have markedly lower numbers and relative proportions of circulating









B cells than do adults (Senogles et al., 1978; Nagahata et al., 1991; Nonnecke et al., 2003;

Kampen et al., 2006). For example, the relative proportion of PBMC that were B cells

expressing the maturation marker CD21 was very low in the first week of life (4%) and then

increased gradually to 6 months of age (30%) (Kampen et al., 2006). Other investigators have

reported that B cell numbers reach adult levels by a month of age (Senogles et al., 1978;

Nagahata et al., 1991). Endogenous antibody production is measurable as early as a few days of

age (Barrington and Parish, 2001), but expression of some isotypes and/or allotypes of antibody

is delayed for weeks to months after birth (Corbeil et al., 1997). Overall, humoral antibody

responses and in vitro responses of B cells to stimulation are markedly less in neonatal calves

than in adult cattle (Nagahata et al., 1991; Barrington and Parish, 2001; Nonnecke et al., 2003).

Immunoglobulin secreted into the lumen of the respiratory tract helps prevent adhesion of

pathogens to host cells and acts as an opsonin for phagocytic cells (Daniele, 1990; Brandtzaeg et

al., 1996). In mature animals, most immunoglobulin on mucosal surfaces is secretary IgA, but

other isotypes may predominate in young animals (Sheoran et al., 2000). BAL fluid from 2-

week-old calves contains a higher proportion of IgG2 compared to serum, suggesting that local

selective transfer of IgG2 occurs in the LRT of calves (Pringle et al., 1988). The ratio of IgG/IgA

and of IgGi/IgG2 were found to be 12:1 and 1.3:1, respectively in BAL fluid from 2-week-old

calves (Pringle et al., 1988), although the ratio of IgG/IgA in BAL of young calves has varied

among reports, probably due to differences in sampling technique (Walker et al., 1980; Wilkie

and Markham, 1981). Plasma cells secreting IgG2 do not appear in the respiratory tract of calves

until after the second week of life (Allan et al., 1979), so IgG2 present in BAL fluid of younger

calves is likely to be derived from distant lymphoid tissues or from maternal immunoglobulin. In

the intestinal tract, IgM is the predominant endogenous antibody present in the first few weeks of









life (Logan and Pearson, 1978; Heckert et al., 1991), but there is little data on the levels of IgM

in respiratory secretions of young calves.

The number of antigens to which the calf can produce an adaptive immune response is

limited at birth compared with mature cattle, and calves respond to specific antigens at different

times early in life. Some antigens may elicit an antibody response at birth, whereas others may

not elicit a response until weeks or months of age (Barrington and Parish, 2001). The

mechanisms by which this occurs are poorly understood, but several factors may contribute to

the limited immune response observed in the newborn calf. The low numbers of functional

B cells in neonatal calves and the suppression of humoral responses by colostrum have already

been discussed. In addition, T cells of neonatal calves are hypo-responsive in activation

(Nonnecke et al., 2003; Foote et al., 2005a) and homing mechanisms (Foote et al., 2005a) when

compared to those of older calves and adults. Relative to the mitogen induced responses of

T cells from adult cattle, T cells from neonatal calves show decreased proliferative capacity

(CD4+ cells), delayed increase in the expression of the IL-2 receptor (CD25) associated with

activation (CD4+ cells), no expression of the adhesion molecule CD44 associated with leukocyte

trafficking to sites of inflammation (CD4+ and y6T cells), and no decrease in expression of the

lymph node homing receptor, CD62L (CD4+, CD8+ and y6T cells). However, by 8 weeks of age

mitogen-induced and antigen-specific responses are similar to those of adult cattle, indicating

that T cell function matures rapidly during the first few weeks of life (Foote et al., 2005a; Foote

et al., 2005b).

The neonates of many species have a decreased capacity to produce cytokines, especially

those associated with Thl responses. There is a tendency to a Th2-biased immune response

characterized by a predominance of IL-4 and IgGi in neonatal response to antigens (Adkins,









2000; Siegrist, 2000). This Th2 bias is also observed in calves, and the capacity of PBMCs from

neonatal calves to produce IFN-y is substantially less than that of adult cattle (Nonnecke et al.,

2003). However, neonates, including calves, are capable of producing a Thi-biased response

when exposed to potent inducers of such responses such as purified proteins from

Mycobacterium bovis (Adkins, 1999; Ota et al., 2002; Nonnecke et al., 2005).

The nutritional status of the neonatal calf affects immune responses. Feeding calves at a

high plane of nutrition is associated with reduced viability of circulating T cell populations

(Foote et al., 2007) as well as reduced mitogen-induced proliferative responses of T cells (Foote

et al., 2005a). The effects of protein-energy malnutrition on the neonatal calf immune system is

unknown, but in other species malnutrition and weight loss are associated with defects in cell-

mediated immunity, antibody production, cytokine production, and phagocytic function

(Chandra, 2002). Although the mechanism by which nutrition influences immune function in the

neonate is unknown, it is clear that nutrition during the pre-weaning period can have a major

impact on the rate of maturity of the immune system in the young calf.

Summary of the Neonatal Calf Immune Response

In summary, components from all arms of the immune system (local and systemic, innate

and adaptive) of the neonatal calf differ substantially from that of adult cattle; these components

undergo rapid immunological maturation during the first few months of life. The young calf

initially can respond to only a limited number of antigens and this repertoire of antigens

increases gradually over time. Humoral immune responses, in particular, are suppressed during

the first few weeks of life, especially in colostrum-fed calves. The relative proportion of T cell

subsets, the intensity of their response to antigen, and the types of cytokines that are secreted all

differ substantially in neonates as compared with adults. Importantly, neonates tend to produce a









Th2 polarized immune response. The relative immaturity of innate and adaptive immune

responses likely contributes to the increased susceptibility to infectious disease that is observed

in young calves. The immaturity of adaptive immune responses in young calves also has

important implications for development of effective vaccines for use in neonates.

Immunology of the Eustachian Tube and Middle Ear

Otitis media can occur in all age groups, but young animals and human infants are at

greatest risk. Although there is little published on age-related anatomical changes in the middle

ear and eustachian tubes of cattle, anatomical features that vary between adults and infants such

as the length and the angle of the eustachian tube are thought to contribute to susceptibility to

otitis media (Bluestone, 1996). Because of inefficient eustachian tube opening, infants are more

likely than adults to develop negative pressure in the middle ear which can increase the risk of

entry of nasopharyngeal fluids and bacteria (Bluestone, 1996). However, the major factor

determining age-related susceptibility to otitis media is the functional immaturity of the immune

system in neonates and high susceptibility to viral and secondary bacterial infections of the URT

observed in this age group (Giebink, 1994; Bakaletz, 1995; Chonmaitree and Heikkinen, 1997;

Adkins, 2000; Barrington and Parish, 2001). The age at which colonization of the nasopharynx

or tonsils first occurs affects the risk of developing otitis media. For example, infants that are

first colonized in the nasopharynx with Streptococcus pneumoniae, H. influenzae or Moraxella

catarrhalis before 3 months of age have increased risk and severity of otitis media compared

with infants who are first colonized after 3 months of age (Faden et al., 1997). Colonization of

the nasopharynx with bacterial pathogens within the first week of life is associated with

extremely high rates of otitis media (Leach et al., 1994). Interestingly, a similar pattern is

observed in animals. Age-related susceptibility to otitis media is also observed in M. hyorhinis

infections of piglets and M bovis infections of calves, although age-specific factors contributing









to susceptibility in these species have not been determined (Morita et al., 1995; Friis et al.,

2002). These findings suggest that the ability to delay colonization by only a few weeks might

have a dramatic impact on susceptibility to M. bovis-associated otitis media in calves.

Pathogens that cause otitis media in children are able to colonize and cause a local

inflammatory response in the nasopharyngeal tonsils (adenoids). The adenoids may act as a nidus

of infection, seeding the distal end of the eustachian tube, which is in close physical proximity

(Rynnel-Dagoo and Freijd, 1988; Kiroglu et al., 1998). In fact, surgical removal of the adenoids

is often effective at curing older children with chronic or recurrent otitis media (Rynnel-Dagoo

and Freijd, 1988; Paradise et al., 1999; Rosenfeld et al., 2004). The pharyngeal tonsil in cattle is

the anatomical equivalent of the adenoids (Schuh and Oliphant, 1992). However, its role in

colonization of the URT and subsequent seeding of the eustachian tubes has not been addressed

in calves.

For all species studied, the middle ear and eustachian tube are lined by a respiratory

epithelium. The mucosa of the eustachian tube and parts of the middle ear consists of ciliated

epithelial cells and mucous-secreting cells. Cilia beat in a coordinated fashion to clear fluid,

bacteria and other particles from the middle ear to the nasopharynx, as well as to prevent entry of

pathogens into the middle ear (Bluestone, 1996). Cells within the eustachian tube mucosa also

secrete non-specific antibacterial substances such as surfactant proteins that may be important in

protection against pathogens (Lim et al., 1987; Paananen et al., 2001). Increased mucus

production by cells of the eustachian tube is stimulated by the presence of inflammatory

mediators (Lim et al., 1987). Viral and bacterial infections of the nasopharynx and eustachian

tube are associated with damage to the eustachian tube epithelium and disruption of ciliary

function (Miyamoto and Bakaletz, 1997; Chonmaitree, 2000; Heikkinen and Chonmaitree,









2003). In addition, the inflammation associated with these infections, along with other causes of

inflammation of nasopharyngeal mucosa such as allergic disease, can cause physical obstruction

of the eustachian tube (Lim et al., 1987; Bluestone, 1996). In fact, eustachian tube dysfunction is

thought to be the most important risk factor for the development of otitis media (Bluestone,

1996).

In animal models of human otitis, macrophages are the primary cells responding to

infection of the middle ear during the acute phase of otitis media (Bakaletz et al., 1987;

Takahashi et al., 1992). Impaired function of alveolar macrophages is described in neonatal

calves (Yeo et al., 1993; Lu et al., 1996), but whether macrophages of the middle ear are

likewise suppressed in young calves has not been determined. Substantial numbers of mast cells

are also present in the middle ear of rodents and humans, mainly located adjacent to blood

vessels in the lamina propria (Brandtzaeg et al., 1996). Although no definitive data are available,

it is generally assumed that mast cells play a role in inflammation; whether there are similar

numbers of mast cells in the middle ears of young calves has not been reported.

The middle ear and eustachian tubes contain MALT that is involved in the production of

a localized specific immune response to bacterial and viral agents (Ogra, 2000). However,

MALT is typically not found in healthy children less than 1 month of age, and this may be a

factor in the increased susceptibility to otitis media in this very young age group (Kamimura et

al., 2000). Both B cells and T cells are present in the MALT of the middle ear during otitis

media, but data regarding the cell-mediated immune response in the middle ear are limited

(Ogra, 2000). In healthy rats, IgA can be detected in the mucosa of the eustachian tubes but in

relatively small amounts; in the healthy, uninfected middle ear almost no antibody-secreting cells

are present (Watanabe et al., 1992). During otitis media, however, large amounts of IgA are









detected in the eustachian tube, and IgA, IgG, and IgM are all detected in the middle ear

(Svinhufvud et al., 1992). In young children with otitis media, a strong local IgA response can

occur in the nasopharynx without a detectable systemic antibody response (Virolainen et al.,

1995; Nieminen et al., 1996).

Passive protection against bacterial otitis media in infants is provided by feeding breast

milk containing high amounts of pathogen-specific IgA, which prevents adherence to and

colonization of the pharyngeal mucosa (Hanson et al., 1984; Duffy et al., 1997). Similarly,

passive transfer with IgA has been effective in limiting colonization of the nasopharynx and

preventing clinical disease in animal models ofH. influenzae otitis media (Kennedy et al., 2000).

Interestingly, while complete eradication ofH. influenzae from the nasopharynx was highly

effective at preventing otitis media, reduction of the bacterial load in the nasopharynx to below a

critical threshold level appeared similarly effective (Kennedy et al., 2000).

In humans and in animal models of human otitis media, viral infection of the URT is a

major predisposing factor to bacterial otitis media. In pigs, no specific viruses have been

identified in association with M. hyorhinis-induced otitis media (Morita et al., 1995; Friis et al.,

2002). However, M. hyorhinis itself causes eustachitis and it may therefore induce the eustachian

tube dysfunction that is an important factor leading to development of otitis media (Morita et al.,

1999). Whether viral infections play a role in M bovis-associated otitis media in cattle has not

been established; unlike some mycoplasmal pathogens, M. bovis did not cause marked disruption

of ciliary activity in tracheal organ cultures (Howard et al., 1987b).

Immune Responses to Mycoplasmal Infections, with a Focus on M. bovis

Mycoplasmal respiratory infections are characterized by an initial inflammatory response

triggered by interactions of mycoplasmas with cells of the respiratory tract. Frequently, the host

is unable to clear the infection and the mycoplasma persists despite an active immune response









(Fernald, 1982; Cartner et al., 1998; Razin et al., 1998). These features mean that virtually all

aspects of the host immune system are involved in responses to mycoplasmal infections, and

immune responses critically affect the level of mycoplasmal infection and the progression of

disease. Innate responses and humoral immunity are the major contributors to defense against

mycoplasmal respiratory infections, whereas cell-mediated immunity is less important in

protection (Cartner et al., 1998; Jones and Simecka, 2003; Woolard et al., 2005). However,

much of the pathology and resulting clinical manifestations that occur in mycoplasmal diseases

are an effect of the host immune response rather than a direct effect of the mycoplasmas

themselves. Cell-mediated immunity likely plays a major role in these immunopathological

responses (Rottem and Naot, 1998; Rosengarten et al., 2000; Jones and Simecka, 2003).

Interactions between mycoplasmal pathogens and their hosts are much more complex

than might be expected from the small genome, structural simplicity and limited biosynthetic

capacity of mycoplasmas. Mycoplasmas can induce a broad range of immunomodulatory events

by direct effects on macrophages, neutrophils, and lymphocytes, and by indirect effects through

induction of cytokine secretion from these and other cells such as epithelial cells (Baseman and

Tully, 1997; Rosengarten et al., 2000). The complicated relationship between mycoplasmas and

their hosts means that many aspects of these interactions are poorly understood, even for the

host-pathogen relationships for which there is a large body of research data. For M. bovis

infections, very little is known about the host and microbial factors that contribute to

development of disease or to the production of an effective immune response.

Innate Immune Responses to Mycoplasmal Infections

Innate immune responses are critical in the early phase of mycoplasmal respiratory

infections for clearance of the microorganism and control of infection (Cartner et al., 1998;

Hickman-Davis, 2002). Macrophages, and alveolar macrophages in particular, are the most









important cells in innate defense of the respiratory tract. However, other cells including

neutrophils, NK cells and epithelial cells play important roles in initial responses to mycoplasmal

infections and, in some cases, contribute to detrimental host responses (Cartner et al., 1998;

Hickman-Davis, 2002).

The importance of alveolar macrophages in control of mycoplasmal respiratory infections

is illustrated by comparing strains of mice that are genetically resistant or susceptible to

M. pulmonis-induced lung disease (Parker et al., 1987; Hickman-Davis et al., 1997; Cartner et

al., 1998). This difference in disease susceptibility is due to enhanced clearance of M pulmonis

from the lungs of resistant, compared with susceptible, strains of mice. Clearance from the lungs

in resistant mice occurs early in the course of infection, before any influx of inflammatory cells,

suggesting that resident alveolar macrophages are responsible (Parker et al., 1987). Consistent

with this hypothesis, mice of the same resistant or susceptible genetic backgrounds but which

lacked the ability to produce antibody or T cell responses retained the differences in pulmonary

clearance of mycoplasma (Cartner et al., 1998). Depletion of alveolar macrophages in resistant

strains of mice resulted in a dramatic increase in the numbers of M pulmonis in the lung and in

the severity of disease, whereas depletion of alveolar macrophages in susceptible strains had

minimal effect, confirming the essential role of alveolar macrophages in mycoplasmal killing

during early lung infection (Hickman-Davis et al., 1997).

Alveolar macrophages are often unable to engulf and kill mycoplasmas without

opsonization (Howard and Taylor, 1983; Hickman-Davis, 2002). Various opsonins have been

identified as important in this role, including specific antibodies, complement and surfactant

proteins (Bredt et al., 1977; Howard and Taylor, 1979; Howard and Taylor, 1983; Hickman-

Davis, 2002). Opsonization with specific antibody was required in vitro for killing ofM. bovis by









macrophages (Howard et al., 1976). IgG2 was a superior opsonin to IgG1, but both isotypes could

mediate these interactions (Howard, 1984). Whether other opsonins, such as surfactant proteins,

are important in defense against M. bovis has not been determined.

In addition to opsonization, alveolar macrophages also require activation for efficient

phagocytosis and killing of some mycoplasmas (Hickman-Davis, 2002). As well as displaying

enhanced killing abilities, activated macrophages secrete large amounts of pro-inflammatory

cytokines and recruit neutrophils and other immune cells to the site of infection (Razin et al.,

1998). Many mycoplasmal pathogens, including M bovis, are potent activators of alveolar

macrophages (Jungi et al., 1996; Rottem and Naot, 1998). Detrimental host inflammatory

responses have been attributed to excessive TNF-ca production by alveolar macrophages in

mycoplasmal infections (Faulkner et al., 1995), including M bovis (Rosenbusch, 2001). What

benefit stimulation of an exuberant inflammatory response has to the survival of mycoplasmal

pathogens is unclear, but induction of TNF-ca is not a feature of nonpathogenic mycoplasmal

species. The bovine mycoplasmal pathogens M bovis, Mycoplasma dispar and M mycoides,

subsp. mycoides biotype SC are all potent in vitro stimulators of TNF-ca production by bovine

alveolar macrophages, but the non-pathogenic species M. bovirhinis and Acholeplasma laidlawii

do not trigger this response (Jungi et al., 1996).

Following macrophage activation and expression of pro-inflammatory cytokines and

chemoattractants, neutrophils are recruited to sites of inflammation. In fact, neutrophils are often

the most abundant immune cell early in mycoplasma-associated respiratory disease, and they

may remain relatively abundant even in chronic disease. The extent of neutrophil recruitment is

often directly correlated with the severity of disease. Neutrophils are a prominent cell type in the

lungs, middle ear, and joints ofM bovis infected calves (Adegboye et al., 1995a; Rodriguez et









al., 1996; Clark, 2002; Shahriar et al., 2002; Maeda et al., 2003; Khodakaram-Tafti and Lopez,

2004; Lamm et al., 2004; Gagea et al., 2006). Even in calves without clinical lung disease, the

presence ofM. bovis is associated with increased numbers of neutrophils in BAL fluid (Allen et

al., 1992b). Widespread activation of macrophages by pathogenic mycoplasmas can result in

excessive recruitment of neutrophils to sites of infection, with subsequent release of large

amounts of inflammatory mediators that are associated with increased disease severity (Xu et al.,

2006b). In vitro studies showed that bovine neutrophils are able to kill opsonized M bovis, but

this interaction requires the presence of IgG2; IgGi was not an effective opsonin (Howard, 1984).

Despite their ability to kill opsonized mycoplasmas in vitro, the overall contribution of

neutrophils to clearance of mycoplasmas in vivo is unknown. Thomas et al., (1991) showed that

unopsonized M bovis can adhere to the surface of neutrophils without being ingested, and that

adherent viable or non-viable M. bovis cells inhibit respiratory burst activity. This ability to

suppress neutrophil function, coupled with the fact that young calves produce very little IgG2,

which is required, at least in vitro, for neutrophil-mediated killing ofM. bovis, may mean that

neutrophils are not particularly effective in the clearance ofM. bovis in young calves.

In addition to interactions with macrophages and neutrophils, mycoplasmas can interact

with other cell types such as epithelial cells (Seya et al., 2002). In fact, interactions between

mycoplasmas and other cells are probably critical in the initiation of an inflammatory response.

Mycoplasmas have been shown to stimulate both nasal epithelial cells (Kazachkov et al., 2002)

and type II epithelial cells in the lung (Kruger and Baier, 1997) to produce IL-8 and other

neutrophil chemoattractants. Mycoplasma bovis activates bovine lung microvascular endothelial

cells to express cell surface molecules specific for mononuclear cell and neutrophil

transmigration (Lu and Rosenbusch, 2004).









Little is known about the role of NK cells in mycoplasmal respiratory disease; they are

recruited to sites of inflammation in the initial stages of infection by chemoattractants released

from macrophages. Large amounts of IFN-y are secreted by NK cells, as well as by other cells

such as y6 T cells. IFN-y is thought to be important for the activation of macrophages during the

initiation of the inflammatory response, and may have other protective or potentially pathologic

roles in mycoplasmal disease (Lai et al., 1990b; Woolard et al., 2005). Like NK cells, little is

known about the role of mast cells in mycoplasmal disease. Recent studies (Xu et al., 2006a)

using mast-cell deficient mice indicate that mast cells may be important in innate immune

containment and clearance ofM pulmonis infection in mice. Potential roles for mast cells in

bovine mycoplasmal disease have not been reported.

To summarize, innate immune responses are very important in the early clearance of

mycoplasmas from the lung. In particular, alveolar macrophages are essential in the early

response to infection. However, inappropriate activation of alveolar macrophages by

mycoplasmas may promote an excessive inflammatory response. Little is known about the innate

responses specific toM. bovis infections in the lungs of calves, or in other sites including the

middle ear, mammary gland and joints of affected cattle. Given the ability ofM. bovis to

modulate responses of macrophages and neutrophils in vitro, together with the relative scarcity

of effective opsonins and the functional immaturity of macrophages in young calves, it is

reasonable to conclude that impaired innate responses are likely to contribute to the increased

susceptibility to M. bovis infections that is observed in this age group.

Adaptive Immune Responses to Mycoplasmal Infections

Adaptive immune responses to mycoplasmal infections play important roles in

determining the progression of disease. Adaptive responses can clearly be beneficial in clearing









or controlling mycoplasmal infections, but they also can be ineffective and can be major

contributors to the severity of disease (Rottem and Naot, 1998; Rosengarten et al., 2000; Jones

and Simecka, 2003). Despite a substantial body of work examining adaptive responses to

mycoplasmal infections, the optimal immune responses for protection and the types of responses

contributing to disease remain poorly defined.

The fact that adaptive immune responses can protect from disease is illustrated by

examples of successful vaccination against some mycoplasmal infections (Taylor et al., 1977;

Cassell and Davis, 1978; Howard et al., 1987a; Thacker et al., 2000; Kyriakis et al., 2001).

However, immunity after vaccination or infection is often short-lived. For example, after

inoculation of the mammary gland with M. bovis, cows were resistant to subsequent re-challenge

after 2 months in both previously infected and non-infected quarters; at 6 months, cows were

generally resistant to infection only in the previously challenged quarter, and at one year all

quarters were susceptible (Bennett and Jasper, 1978a). Prior infection with M bovis seems to

protect cows from developing the severe clinical mycoplasmal mastitis that is typically observed

on primary infection; most re-infections result in subclinical or very mild clinical disease

(Bennett and Jasper, 1978b). Thus, adaptive immune responses that are in place at the time of

mycoplasmal exposure do appear to contribute to the control or prevention of new mycoplasmal

infections.

Adaptive immune responses are frequently ineffective at eliminating established

mycoplasmal infections, and mycoplasmas are often able to persist in the face of an intense

response (Fernald, 1982; Cartner etal., 1998; Razin etal., 1998; Rosengarten etal., 2000).

Ongoing, ineffective immune responses result in the chronic inflammation that is associated with

many mycoplasmal diseases (Cartner et al., 1998; Rosengarten et al., 2000; Jones and Simecka,









2003). Exactly how mycoplasmas manage to avoid clearance by the host is not well understood.

However, mycoplasmas exhibit the ability to induce a broad range of immunomodulatory events

(Baseman and Tully, 1997) that may induce ineffective responses. In addition, variation of

surface antigens may help mycoplasmas to avoid clearance mediated by adaptive immune

responses (Rosengarten et al., 2000).

Adaptive responses also play an important role in immunopathologic disease. Cellular

responses in mycoplasmal infections are characterized by large accumulations of lymphocytes

(Simecka et al., 1992), suggesting that lymphocyte activation and recruitment to sites of

mycoplasmal infection are important in the development of pathology. Autoimmune reactions

also contribute to some mycoplasmal respiratory diseases (Kitazawa et al., 1998; Wilson et al.,

2007), but have not been identified in disease caused by M. bovis.

Humoral Immune Responses to M. bovis in Cattle

Experimental infection of cattle with M. bovis usually elicits a strong humoral immune

response. Specific serum immunoglobulin is detectable as early as 6 days (IgM) to 10 days (IgG)

after experimental inoculation of M. bovis into the respiratory tract of calves (Brank et al., 1999;

Le Grand et al., 2002). Humoral responses to M bovis in calves are characterized by high levels

of IgGi (Howard and Gourlay, 1983; Vanden Bush and Rosenbusch, 2003). Very little IgG2 is

produced in calves infected at 12 weeks of age (Vanden Bush and Rosenbusch, 2003),

suggesting that the response to M. bovis respiratory infection in calves has a Th2-bias. In

addition, the younger the calf, the higher the ratio of IgGi to IgG2 produced in response to

M. bovis infection (Howard and Gourlay, 1983), consistent with the delay in IgG2 production

observed in very young animals (Adkins, 2000; Siegrist, 2000).

In cattle infected with non-mycoplasmal pathogens, both IgG and IgA are important in

immune responses of the LRT, and IgA is important in the URT (Mosier, 1997; Potter et al.,









1999; Ackermann and Brogden, 2000); both compartments contribute significantly to antibody

responses. Although data are limited, these types of local responses seem to also occur in

M. bovis infections of calves. In one study, IgGi-producing plasma cells predominated in the

lungs at 2 weeks after M bovis inoculation, accompanied by smaller numbers of IgM, IgG2 and

IgA producing cells. By 4 weeks, a significant increase in the number of IgG2 producing cells

was observed (Howard et al., 1987c). These studies used 4- to 6-week-old calves, and the

distribution of antibody-producing cells in the respiratory tract of other age groups with M bovis

infection has not been reported. In the URT, IgGi producing cells were observed in the

submucosa of the trachea, and IgA producing cells were abundant in the trachea and nasal cavity

of infected calves (Howard et al., 1987c). These findings are consistent with the distribution of

immunoglobulin isotypes found in nasal lavage and BAL fluids after M bovis infection (Howard

et al., 1980). In calves with experimentally-induced M bovis arthritis, titers of IgG1, IgG2 and

IgM are similar in both serum and joint fluid, consistent with leakage of serum proteins into

affected joints. However, IgA concentrations in joint fluid are greater than those in serum,

indicating some local production of IgA during M bovis arthritis (Chima et al., 1981). Local

humoral responses in calves with M bovis-associated otitis media have not been reported.

In contrast with the humoral response observed after experimental M. bovis infection of

calves, responses in naturally infected calves are more variable. Virtala et al., (2000) reported

that only 57% of 75 pneumonic dairy calves less than 3 months of age in which M bovis was

isolated from tracheal wash samples had a 4-fold or greater increase in M bovis serum antibody

titers by IHA. The authors concluded that a rise in titer on paired serum samples was not a good

predictor ofM. bovis-associated respiratory disease, possibly due to the presence of maternal

antibody. Maternal antibody is associated with suppression of humoral responses to specific









antigens, but vaccination of young calves with killed M. bovis or respiratory challenge with live

M. bovis in the face of maternal antibody usually elicits a detectable humoral response (Howard

and Gourlay, 1983). It is reasonable to hypothesize that mild or superficial infections of the

respiratory tract fail to elicit a systemic antibody response in colostrum-fed calves, whereas more

significant challenges or systemic presentation of antigen usually do elicit such a response. Other

investigators have also failed to find a correlation between serum antibody titers and the presence

M. bovis in the LRT of naturally-infected individual animals (Rosendal and Martin, 1986; Martin

et al., 1989). However, on a group level, seroconversion has been predictive ofM. bovis-

associated respiratory disease (Martin et al., 1990; Tschopp et al., 2001). Specific serum

immunoglobulin concentrations remain elevated for months to years after an immune response to

clinical M bovis-associated disease (Le Grand et al., 2001; Nicholas and Ayling, 2003).

In adult cows, inoculation of the mammary gland with M bovis results in a classical early

serum IgM response followed by IgG as the response matures. Peak serum titers occur 6 to 8

weeks after experimental infection (Bennett and Jasper, 1980). Both IgGi and IgG2 are produced

by infected cows (Boothby et al., 1987), suggesting that the immune response to intramammary

infection in mature animals is less Th2-biased than that of young animals with respiratory tract

infections. In the mammary gland, local IgGi, IgG2 and IgA responses toM. bovis mastitis are

observed (Bennett and Jasper, 1980; Bennett and Jasper, 1978b; Boothby et al., 1987).

In summary, it appears that specific antibody to M bovis is generally present in

respiratory secretions of M. bovis-infected calves. Systemic humoral responses are also often

present, but subclinical infections of the respiratory tract may not generate a detectable serum

antibody response.









Function of Humoral Responses to Mycoplasmal Infections

Together with innate immune responses, humoral responses are probably the most

important in protection from mycoplasmal infections. Systemic humoral responses are

particularly important in preventing disseminated mycoplasmal infections such as arthritis

(Cartner et al., 1998), and local humoral responses provide important opsonins to the cells of the

innate immune system to aid in clearance of mycoplasmas (Howard and Taylor, 1983). Animals

and humans with humoral deficiencies initially develop mycoplasma-induced lung disease that is

of similar severity to that of immunocompetent hosts. However, immunodeficient hosts typically

go on to develop chronic pneumonia and disseminated disease such as arthritis or meningitis,

while these events occur less frequently in immunocompetent hosts (Taylor-Robinson et al.,

1980; Berglof et al., 1997). Consistent with these observations, pre-existing serum IgG titers to

M. bovis are correlated with protection from arthritis by intravenous or aerosol challenge (Chima

et al., 1981; Nicholas et al., 2002).

The role of humoral responses in protection from mycoplasmal infections is also

illustrated by the fact that passive transfer of antibody can prevent disseminated mycoplasmal

infections. Passive transfer of antibody in immunodeficient mice prevents the development of

mycoplasmal arthritis (Cartner et al., 1998), and has also been associated with protection from

some mycoplasmal respiratory pathogens (Taylor and Taylor-Robinson, 1977; Barile et al.,

1988; Rautiainen and Wallgren, 2001). The role of passively transferred antibody in protection

from M bovis-associated disease has not been evaluated in controlled challenge studies. Limited

data from field studies do not support a protective role for maternal antibody against M bovis

infections. In one study of 325 colostrum-fed dairy calves, there was no significant association

between M bovis-specific serum antibody titers in the first 2 weeks of life and occurrence of

pneumonia (Van Donkersgoed et al., 1993). Likewise, Brown et al., (1998a) did not find an









association between M. bovis-specific serum antibody concentrations at 7 days of age and

occurrence of M. bovis-associated disease in 50 Holstein calves. Administration of large volumes

of hyperimmune serum against M. bovis to calves at the same time as or following intranasal

inoculation ofM bovis had no effect on the severity of respiratory disease (Brys and Pfutzner,

1989).

Antibody present at the site of infection may be more important for protection from

M. bovis infections than is systemic antibody. Concentrations of antibodies in serum after

experimental induction ofM bovis mastitis did not differentiate between cows susceptible or

resistant to reinfection of the mammary gland, but concentrations of IgA and IgG in milk from

glands resistant to reinfection were higher than those in susceptible glands (Bennett and Jasper,

1978a; Bennett and Jasper, 1978b). In addition, the daily production of total IgG and IgA during

peak infection was greater in mammary glands that were able to resolve the infection than in

glands that remained chronically infected (Bennett and Jasper, 1980). In studies where

vaccination resulted in some protection from M. bovis-associated respiratory disease, both serum

antibody titers (Nicholas et al., 2002), and IgG concentrations in BAL fluids (Howard et al.,

1980) have been correlated with disease protection.

The Vsps are the preferred targets of the humoral immune response in M bovis infections

(Brank et al., 1999; Rosengarten et al., 2000), although other M bovis surface lipoproteins also

elicit antibody responses (Behrens et al., 1996; Robino et al., 2005). However, the specific

surface molecules ofM bovis involved in eliciting protective humoral responses have not been

defined.

In summary, humoral immune responses, especially local antibody responses at the site

of infection, appear to be important in protection from M. bovis infections. Conversely, strong









humoral responses often develop during M. bovis-associated clinical disease but fail to clear

M. bovis from the host. The tendency towards an IgGi dominated humoral response in calves

may not be optimal for clearance ofM bovis, given that IgG2 is a superior opsonin for

macrophage- and neutrophil-mediated killing ofM bovis (Howard, 1984). More work is needed

in calves to better define the humoral responses that are most efficient at M bovis clearance as

well as responses that protect from new infections.

The Role of T Cell Responses to Mycoplasmal Infections

Over 30 years ago, histopathological similarities between perivascular cellular infiltrates

observed in M pneumoniae infections and the lesions of cutaneous delayed hypersensitivity

reactions led to the suggestion that cell-mediated mechanisms might be contributing to

mycoplasmal disease (Fernald et al., 1972). It is now widely accepted that mycoplasmal

respiratory infections have substantial immunopathological components, characterized in part by

large accumulations of lymphocytes in affected areas of the respiratory tract (Simecka et al.,

1992). Lymphocyte aggregation is not as marked in M bovis infections (Rosenbusch, 2001) as

with some mycoplasmal infections in other hosts, but lymphocytes are still a substantial

contributor to lesions in M. bovis-associated disease. Both B and T cells accumulate in the lungs

of affected calves (Howard et al., 1987c), in the joints of calves with mycoplasmal arthritis

(Gourlay et al., 1976; Adegboye et al., 1996; Gagea et al., 2006) and in the mammary glands of

cows with M bovis mastitis (Bennett and Jasper, 1977a; Seffner and Pfutzner, 1980). These

findings suggest that lymphocyte activation and recruitment to sites ofM. bovis infection are

important in the development of pathology. However, there are only limited data describing the

lymphocyte populations that contribute to these responses in cattle, and virtually no data

specifically from neonatal calves.









Because of their essential role as regulators of the immune system, T cells play a pivotal

role in the development of protective responses as well as in host mediated immunopathogenesis.

T cells are a major component of the mononuclear infiltrates observed in the lungs and draining

lymph nodes of mycoplasma infected hosts (Davis et al., 1982; Rodriguez et al., 1996;

Rodriguez et al., 2001; Jones and Simecka, 2003). Studies ofM. pulmonis disease in mice

suggest that T cells are of limited importance in initial responses to mycoplasmal infections.

Both T cell deficient mice and severe combined immunodeficiency mice develop less severe

lung disease than their immunocompetent counterparts (Keystone et al., 1980; Cartner et al.,

1998). These effects are independent of mycoplasmal numbers in the lungs. Reconstitution of

immunodeficient mice with naive T cells restores the severity of respiratory disease to the level

observed in immunocompetent mice (Cartner et al., 1998). These studies indicate that T cells are

unlikely to play a major role in early control of mycoplasmal infections but instead are

associated with regulating detrimental host inflammatory responses. However, T cells do

contribute to the establishment of humoral responses that, as discussed earlier, are beneficial in

control of mycoplasmal infections.

Much of the current understanding of T cell responses in mycoplasmal infections is based

on studies ofM. pulmonis infections in resistant and susceptible strains of mice. In susceptible

strains of mice, increases in both CD4+ and, to a lesser extent, CD8+ T cells occur in the lungs

and draining lymph nodes during infection with M pulmonis. These major T cell subsets have

opposing regulatory roles in the progression of mycoplasmal lung disease. In vivo depletion of

CD4+ cells results in reduced lung lesions in infected mice, but depletion of CD8+ cells results in

dramatically more severe lung lesions; these changes are not associated with changes in

mycoplasma numbers in the lungs. Therefore, CD8+ T cells are involved in dampening of the









inflammatory reaction in mycoplasmal lung disease, whereas CD4 T cells contribute to disease

pathology (Jones et al., 2002). The interaction between these cell types has a major impact on the

outcome of mycoplasmal respiratory disease.

The role of y6 T cells in mycoplasmal respiratory disease has not been clearly defined,

but they appear to be important in the pathogenesis of murine mycoplasma infection. In mice, y6

T cell numbers in the lungs increase early in infection and return to basal levels by day 14 (J. W.

Simecka, personal communication). Knockout mice unable to produce y6 T cells develop

significantly less severe M. pulmonis-associated disease than immunocompetent mice, despite

similar numbers of mycoplasmas in the lungs of both groups, suggesting that y6 T cells play a

role in the development of inflammatory lesions (J. W. Simecka, personal communication). y6

T cells are thought to contribute to IFN-y secretion early in the infection process, and therefore

play a role in macrophage activation and initiation of the host response, but other roles of y6

T cells in mycoplasmal infections are poorly defined. In calves, y6 T cells are a major

lymphocyte population and have been shown to play a role in other infectious diseases. Thus,

there is a clear need to determine whether y6 T cells respond toM. bovis infection in cattle and if

they contribute to the regulatory network involved in the generation of immunity and pathologic

responses against the mycoplasma.

T cell subsets in the lungs of calves with M. bovis infection have not been defined. In a

study ofM bovis infection in 3-month-old goat kids, intratracheal inoculation resulted in clinical

respiratory disease and pathology similar to that reported for calves (Rodriguez et al., 2000).

T cells predominated in lymphoid accumulations in the lungs at 14 and 21 days post infection,

and CD4+ T cells were a greater contributor to these lesions than were CD8+ T cells. Although









this study was conducted in a different host species, it suggests that activation of CD4 T cells

plays a prominent role in M. bovis infections.

Cytokine and T Helper Subset Responses to Mycoplasmal Infections

Respiratory mycoplasmal infections are characterized by production of pro-inflammatory

cytokines and associated lung inflammation (Faulkner et al., 1995; Narita et al., 2000; Sun et al.,

2006). Mycoplasmas also induce cytokines that can down-regulate inflammatory responses in

vitro and in animal models (Sun et al., 2006). The intensity of the inflammatory response

following mycoplasma infection is driven by the balance of cytokines produced (Chambaud et

al., 1999). IFN-y is produced early in infection by a variety of cells, including NK cells, y6

T cells and others, resulting in macrophage activation and in the promotion of Thl responses. In

contrast, IL-4 promotes Th2 cell maturation, IgE responses, and is important in maintenance of

humoral mucosal responses, which are an important contributor to protection from mycoplasmal

disease. The immune response in the lungs of mice infected with M. pulmonis is characterized by

both IL-4 and IFN-y responses, with IFN-y predominating at 14 days post-infection (Jones et al.,

2002). These findings are consistent with a mixed Thl-Th2 response in mice with mycoplasmal

lung disease. Experiments using IFN-y knockout mice found that the presence of IFN-y early in

infection is important for innate clearance of mycoplasmas. Infected knockout mice had higher

mycoplasmal numbers in the lungs and increased severity of lung lesions compared with

immunocompetent mice (Woolard et al., 2004). Similarly, T-bet deficient mice, which are

unable to produce IFN-y as well as producing very strong Th2 cytokine responses, develop much

more severe mycoplasmal lung disease than do immunocompetent mice (Bakshi et al., 2006).

Little is known about the cytokine environment or the Th subsets present in the lungs of

calves with mycoplasmal disease. However, PBMC responses, serum cytokine and serum









antibody responses were characterized in 12-week-old calves infected by combined intratracheal

and intranasal inoculation with M bovis (Vanden Bush and Rosenbusch, 2003). At 21 days after

inoculation, PBMCs from M bovis infected calves exhibited antigen-specific proliferative

responses in vitro. In addition, CD4+, CD8+ and y6 T cells all exhibited higher in vitro activation

(CD25 expression) in response to M. bovis antigens than did cells from uninfected control calves.

The PBMCs from infected animals secreted IFN-y and IL4 in response to in vitro stimulation

with M bovis antigen. Intracellular staining of stimulated cells revealed approximately equal

numbers of IFN-y and IL-4-secreting cells. There was a strong IgGi humoral response, and little

IgG2 was present in the serum of infected calves. These findings indicate that calves infected

with M bovis produce a mixed Thl-Th2 systemic cytokine response, although the lack of IgG2

production is consistent with a Th2-biased response. Studies in M. pulmonis-infected mice have

demonstrated that the Th profile can differ between compartments of the immune system (Jones

et al., 2001; Jones et al., 2002), and so whether the above findings using PBMCs ofM bovis-

infected calves are representative of the immune environment at the site of infection is unknown.

Recruitment of T Cells in Mycoplasmal Infections

Lymphocytes are recruited to sites of mycoplasmal infection by chemokines released

from cells of the innate immune system. In a recent study, microarray analysis of cytokine and

chemokine expression in the lungs of genetically resistant and susceptible strains of mice during

M. pulmonis infection was examined (Sun et al., 2006). Pro-inflammatory cytokines and a

number of chemokines were produced in susceptible, but not resistant, mice and the degree of

cytokine expression was correlated with the severity of disease. The expression of two potent

chemokines for monocytes and lymphocytes, macrophage inflammatory protein-1 3, and

monocyte chemoattractant protein-2, was markedly up regulated during mycoplasmal disease.









These chemokines were preferentially associated with lesions within the lungs of infected mice,

and cells producing these chemokines were physically associated with clusters of CD4+ T cells

that expressed receptors for these proteins. Thus, it may be that chemotactic factors released at

sites of mycoplasmal infection in the lung are largely responsible for recruitment of

lymphocytes, and thereby determine the severity and type of inflammatory response. This is in

contrast to previous hypotheses that local non-specific proliferation of lymphocytes by

M. pulmonis mitogens is responsible for the observed lymphocyte accumulation (Naot et al.,

1984; Davis et al., 1985). M. bovis has not displayed lymphocytes mitogenic potential in vitro, so

it may be that a similar mechanism of lymphocyte recruitment occurs in infected calves.

Immunomodulatory Effects ofM. bovis on Bovine Lymphocytes

Several studies have demonstrated immunomodulatory effects ofM bovis on cell-

mediated immune responses. Thomas et al., (1990), reported that M bovis suppresses bovine

PBMC responses to the mitogen phytohemagglutinin in vitro. Earlier studies had found that

lymphocytes from calves immunized with killed M bovis antigens (and no adjuvant) have

reduced proliferative responses in M. bovis-specific and mitogen-induced in vitro assays

(Bennett and Jasper, 1977b). Similar findings were reported for lymphocytes from cows that had

recovered from M bovis mastitis, although uninfected controls were not included for comparison

(Bennett and Jasper, 1978b). Supernatant from M bovis cultures has also been reported to

suppress in vitro lymphocyte proliferation (Bennett and Jasper, 1977b). Consistent with this

observation, a 26 kD peptide homologous to the C-terminal region of the M bovis surface

lipoprotein Vsp L and present in culture supernatant inhibited mitogen-induced in vitro

proliferation of bovine lymphocytes (Vanden Bush and Rosenbusch, 2003). The recombinant

peptide was recognized by sera from calves with naturally-occurring M bovis infections,









suggesting that the protein is expressed in vivo. Whether it is shed in vivo or is surface bound is

unknown.

M. bovis has been reported to induce apoptosis of bovine lymphocytes in vitro (Vanden

Bush and Rosenbusch, 2002); this action was inhibited by treatment with chloramphenicol,

indicating that M bovis protein production is necessary for the induction of programmed

lymphocyte death. The in vivo significance, the extent to which induction of apoptosis occurs,

and the cell type(s) targeted are unknown, but induction of apoptosis in a particular lymphocyte

subset could be another mechanism by which M bovis modulates the host immune response.

Hypersensitivity Responses to M. bovis Infections

An interesting finding from early experimental infection studies of calves with

mycoplasmal respiratory disease and cows with M bovis mastitis was the presence of acute and,

in some cases, delayed type hypersensitivity reactions to intradermal injection ofM bovis

antigen (Bennett et al., 1977; Bennett and Jasper, 1978b; Boothby et al., 1988). Maximal

inflammatory responses at skin test sites were reported to occur within the first 4 hours after

injection, and skin reactions resolved rapidly (Bennett and Jasper, 1978b) or persisted at close to

maximal levels for more than 72 hours (Boothby et al., 1988). Animal-to-animal variation was

been reported; pronounced skin sensitivity test responses to M. bovis antigens were present in

some cows that had recovered from M. bovis mastitis, but not in others. Further, skin test results

did not differentiate between cows susceptible or resistant to re-infection of the mammary gland

(Bennett and Jasper, 1978a). These observations could indicate that hypersensitivity responses

contribute to development of pathology in some animals during M bovis infections. However,

the antigens involved in these dermal responses need to be better defined. Serum IgE levels in

M. bovis infected animals have not been reported. IgE-mediated responses have been implicated

as important in the pathogenesis ofM pneumoniae infections in atopic humans (Yano et al.,









1994; Seggev et al., 1996; Stelmach et al., 2005). Acute and delayed type hypersensitivity

responses to intradermal administration of mycoplasmal antigens have also been reported with

M. mycoides subsp. mycoides biotype SC and M pneumoniae infections (Windsor et al., 1974;

Yano et al., 1994).

Protective Immunity to M. bovis

Relevant Experiences with Mycoplasmal Vaccines for Diseases Other Than M. bovis

Vaccination that results in reduced severity of disease is possible for a number of

mycoplasmal pathogens (Taylor et al., 1977; Cassell and Davis, 1978; Whithear, 1996; Maes et

al., 1998; Thacker et al., 2000; Dawson et al., 2002; Dedieu et al., 2005), including M bovis

(Howard et al., 1987a; Stott et al., 1987; Nicholas et al., 2002). However, vaccination rarely

prevents establishment of infection or shedding of mycoplasmas (Cassell and Davis, 1978;

Howard et al., 1980; Thacker et al., 2000; Nicholas et al., 2002). Furthermore, vaccination can

result in harmful exacerbation of immune responses (Boothby et al., 1986b; Thiaucourt et al.,

2003). Positive or negative host responses to mycoplasmal vaccination seem difficult to predict;

vaccines will appear efficacious in some studies and some individuals, but not others. These

findings are not surprising given the complex nature of host-mycoplasmal relationships, and are

likely to be at least partly attributable to the fact that immune responses to mycoplasmas are

strongly influenced by genetics and other host-related factors (Simecka et al., 1987; Parker et al.,

1989; Shahriar et al., 2002). The frequent switching of dominant surface antigen expression in

many mycoplasmas is another factor that may influence vaccine efficacy.

Most mycoplasmal vaccines in use today are administered systemically. However, studies

ofM. pulmonis infection in mice have shown that the nasal route of immunization can protect

from mycoplasmal disease (Lai et al., 1990a), and is superior to systemic immunization in

generating mucosal IgA responses in both the URT and LRT (Taylor and Howard 1980; Hodge









and Simecka 2002). As well as protecting from clinical disease, nasal immunization can reduce

mycoplasmal colonization of the URT (Taylor and Howard 1980; Hodge and Simecka 2002).

However, mucosal adjuvants may be required to achieve these effects (Hodge and Simecka

2002), and some of these adjutants have been associated with development of adverse

inflammatory responses to mycoplasmal antigens (Simecka et al., 2000). Together, these data

suggest that mucosal targeting of vaccines against mycoplasmal respiratory pathogens may be

more effective than current systemic approaches, but further work is needed to identify

appropriate mucosal adjuvants for mycoplasmal vaccines.

Despite the limitations of current vaccines, a number of commercially successful

vaccines for mycoplasmal diseases of livestock are in use throughout the world. Most current

mycoplasmal vaccines are either live attenuated or inactivated preparations of whole cells.

Subunit or recombinant protein vaccines have been largely unsuccessful to date, although newer

technologies are resulting in experimental vaccines and delivery systems that may prove to be

efficacious against some mycoplasmal diseases (Barry et al., 1995; Abusugra and Morein, 1999;

March et al., 2006).

Perhaps the most widely used mycoplasmal vaccines are Mycoplasma hyopneumoniae

bacterins in pigs. Mycoplasma hyopneumoniae is a pathogen contributing to the porcine

respiratory disease complex, a world-wide disease that causes substantial economic losses in the

grower-finisher phase of pig production (Pfutzner and Blaha, 1995). A number of field efficacy

trials, as well as experimental infection studies, have found that vaccination against

M. hyopneumoniae is associated with reduced rates of clinical disease, reduced treatment costs,

improved feed efficiency and improved weight gain (Le Grand and Kobisch, 1996; Maes et al.,

1998; Maes et al., 1999; Okada et al., 1999; Bouwkamp et al., 2000; Thacker et al., 2000;









Kyriakis et al., 2001; Dawson et al., 2002), although it must be pointed out that several of these

trials were industry-sponsored. Vaccine-induced immunity in pigs is associated with increased

levels ofM. hyopneumoniae-specific IgG and IgA in BAL fluid (Boettcher et al., 2002), and

increased IFN-y production and reduced TNF-c. production in lungs (Thacker et al., 2000). Pigs

are first vaccinated as early as 7 days of age, indicating that in some hosts, neonates can be

successfully immunized against mycoplasmas. Passive transfer of specific antibodies in the

colostrum of vaccinated sows occurs, and has been associated with reduced prevalence of

M. hyopneumoniae in piglets (Ruiz et al., 2003; Kristensen et al., 2004). Although these vaccines

are associated with reductions in clinical disease, they do not prevent colonization of the URT or

shedding ofM. hyopneumoniae (Meyns et al., 2006). To address these issues, several

experimental M. hyopneumoniae vaccines targeted to the mucosal immune system have been

reported (Fagan et al., 2001; Shimoji et al., 2002; Lin et al., 2003), but further work is required

to determine their field efficacy and potential benefits over the current vaccines. Inactivated

mycoplasmal vaccines are also used in other livestock species, including vaccines against

M. agalactiae in sheep, a pathogen that is closely related to M. bovis. However, little data are

available on the efficacy of these vaccines.

Vaccines against the important avian respiratory pathogens Mycoplasma gallisepticum

and Mycoplasma synoviae are widely used in commercial poultry production. In contrast to the

killed bacterins used for M hyopneumoniae in pigs, attenuated live strains ofM. gallisepticum

and M synoviae are used to vaccinate poultry (Whithear, 1996; Papazisi et al., 2002). They are

administered by mucosal routes, including in drinking water, by aerosol or by eye drop. These

strains colonize the URT, displacing endemic strains in infected flocks and stimulating mucosal

cellular and humoral immune responses against future virulent challenges (Whithear, 1996). A









number of studies have demonstrated these vaccines to be efficacious in reducing losses due to

clinical and subclinical mycoplasmal disease (Markham et al., 1998a; Markham et al., 1998b;

Barbour et al., 2000; Biro et al., 2005; Feberwee et al., 2006; Jones et al., 2006). However,

problems do occur with these vaccines, including inherent virulence of some vaccine strains and

failure to establish infection in the URT or to stimulate long-term immunity in other strains

(Whithear, 1996).

Live attenuated mycoplasmal vaccines are also used for the control of contagious bovine

pleuropneumonia (CBPP) caused by M mycoides subsp. mycoides biotype SC in endemically-

infected sub-Saharan Africa (Thiaucourt et al., 1998). Vaccines are injected subcutaneously and

stimulate short-lived serum antibody responses; protection is associated with induction of a

mucosal Thi-biased response (Dedieu et al., 2005). The vaccines do not prevent colonization of

vaccinated animals (Thiaucourt et al., 1998). CBPP vaccines are typically administered to

susceptible cattle in regions surrounding an outbreak, but have only limited efficacy in

containing these outbreaks (Thiaucourt et al., 2004). Several strains of varying degrees of

attenuation have been used (Dyson and Smith, 1975). Unfortunately, the more virulent vaccine

strain that provides better protection against CBPP has a high rate of serious, and sometimes

fatal, side effects including severe hypersensitivity reactions and reversion to virulence (Mbulu

et al., 2004; Thiaucourt et al., 2004). Other experimental vaccines for CBPP have not been

successful; inactivated vaccines have often resulted in exacerbation of clinical disease in

challenge studies (Gourlay, 1975). A recent study described a bacteriophage DNA vaccine for

M. mycoides subsp. mycoides biotype SC that was effective in a mouse-challenge model, but this

approach has not yet been applied in the natural host (March et al., 2006).









From these studies of mycoplasmal vaccines in use today, it can be concluded that some

vaccines provide disease protection, but that virtually none are able to prevent chronic infection

of the host and shedding of mycoplasmas. In addition, deleterious effects of vaccination are often

reported. More sophisticated approaches to vaccine development and delivery, as well as a better

understanding of the host immune response in mycoplasmal diseases are clearly required.

Vaccination Against M. bovis

A number of attempts to vaccinate cattle against M bovis mastitis have been reported, but

have been largely unsuccessful. In one series of studies evaluating the effect of vaccination on

susceptibility to M. bovis mastitis, cows were vaccinated five times at 2 week intervals during

the dry period with killed M. bovis; the first three doses were administered subcutaneously in

Freund's complete adjuvant (FCA), and the last two doses without adjuvant by intramammary

infusion (Boothby et al., 1986a; Boothby et al., 1986b; Boothby et al., 1987). One week after

calving, vaccinated and control cows were experimentally challenged in two of four quarters

with live M bovis. All challenged quarters became infected, developed clinical mastitis, and had

a drastic (greater than 85%) loss of milk production. Inflammatory responses occurred earlier

and were more severe in vaccinated cows. Vaccinated cows cleared M. bovis from the milk

earlier than unvaccinated cows, but inflammation persisted. In addition, vaccination did not

protect from quarter to quarter spread ofM bovis. Serum antibody titers to IgM, IgGi and IgG2,

and milk whey titers for IgGi were higher prior to challenge in vaccinated compared to control

cows. After challenge, M. bovis-specific IgA, IgGi and IgG2 were elevated in milk whey of both

vaccinated and control cows, suggesting that intramammary exposure to live organisms was

necessary to elicit a local, specific IgA response.

A number of vaccines for prevention of M. bovis-associated disease in calves have been

evaluated in experimental challenge studies and field trials. Many of these have demonstrated









that vaccination can offer some protection from clinical mycoplasmal disease in calves. For

example, in an experimental study, (Chima et al., 1980), 1- to 5-month-old beef calves were

vaccinated subcutaneously with live M. bovis, intraperitoneally with live M. bovis, or

subcutaneously with a formalin-inactivated bacterin. Two boosters were given at 10 day intervals

and animals were challenged by intravenous inoculation ofM bovis. Clinical arthritis was seen

in 100% of non-vaccinated as compared with 13% of vaccinated calves, and lesion severity was

decreased in those vaccinated calves that did get arthritis.

In a study of an apparently efficacious vaccine in young calves, Nicholas et al., (2002)

vaccinated 3-week-old dairy calves with a single dose of saponin-inactivated bacterin. Calves

received an aerosol challenge with live M. bovis 3 weeks after vaccination. Vaccinated calves

had fewer numbers ofM bovis at colonized sites, fewer numbers of body sites colonized by

M. bovis, and reduced severity and incidence of clinical disease and lesions compared with

control calves. There was also a significant decrease in body weight gain in control calves

compared with vaccinates. Additionally, no vaccinated calves and two of seven control calves

developed arthritis. Vaccinated calves produced a strong IgG response prior to challenge, but

IgG subtypes were not reported. No adverse events associated with vaccination were reported.

A killed vaccine against four bovine respiratory pathogens (BRSV, PI3, M. bovis, and

M. dispar) was evaluated for protection against naturally-occurring respiratory disease in beef

calves (Howard et al., 1987a; Stott et al., 1987). Calves were vaccinated subcutaneously and

received two boosters at 3 week intervals. In one study (Stott et al., 1987), three batches of beef

calves aged 12, 7 and 3 weeks at the time of first vaccination were used, and calves were

followed for 6 months. Respiratory disease occurred in a significantly higher (P < 0.05)

proportion of the control calves (27%) compared with the vaccinates (16.3%). In a second study









(Howard et al., 1987a) using the same vaccination protocol, M. bovis and BRSV were implicated

in outbreaks of respiratory disease during the trial period. Morbidity due to respiratory disease

was significantly reduced in vaccinated calves (25%) compared with controls (32%), and

mortality in the vaccinated group was similarly reduced (2% and 9% for vaccinates and controls,

respectively). No adverse effects of vaccination were noted.

In a report ofM bovis vaccination of feedlot cattle (Urbaneck et al., 2000), a bacterin

consisting of autogenous formalin-inactivated strains ofM bovis and M haemolytica was used

in 3,000 cattle at arrival. The feedlot had a history of M. bovis-associated clinical disease. The

vaccine was reported to be efficacious for the prevention of respiratory disease in newly

introduced cattle, but, unfortunately, comparisons were made to an historical control group. No

adverse effects of vaccination were noted.

Despite the promise shown in some of the studies discussed above, other vaccine trials

have been less successful. Rosenbusch (1998) vaccinated 2-month-old dairy calves with a

formalin-inactivated bacterin prepared from two strains ofM bovis; calves received a single

booster at 3 weeks post-vaccination. Calves were challenged by transthoracic inoculation of

M. bovis. Vaccination exacerbated disease, with four of five vaccinated calves and one of five

control calves developing severe respiratory disease. A similar exacerbation of disease was seen

in calves vaccinated with partially purified membrane proteins from M. bovis; increased clinical

disease and pathology following aerosol challenge was greater in vaccinated calves than in

controls (Bryson et al., 1999).

Mycoplasma bovis vaccine antigens have been shown to exert some of the immuno-

modulatory effects that are observed with live M bovis, and these effects can be altered by the

presence of specific adjuvants. For example, lymphocytes from calves inoculated subcutaneously









with killed M bovis had reduced mitogen-induced and antigen-specific lymphoproliferative

responses in vitro, while those inoculated with killed M. bovis in FCA exhibited increased

responses (Bennett and Jasper, 1977b). Calves given the vaccine in FCA also developed higher

serum antibody titers against M bovis, and much greater immediate and delayed cutaneous

hypersensitivity responses to M bovis antigens than did calves given the unadjuvanated vaccine.

Even where M. bovis vaccines have been associated with clinical benefits, they often fail

to induce an immune response that clears infection (Chima et al., 1980; Nicholas et al., 2002).

For example, intramuscular injection with formalin-killed M bovis with adjuvant followed after

14 days by intratracheal inoculation with killed organisms without adjuvant resulted in reduced

M. bovis in the lungs compared to control calves after intratracheal challenge, but significant

numbers of mycoplasmas were still present in vaccinated calves (Howard et al., 1980). Induction

of protective immune responses against M bovis by vaccination is also complex. For example, in

the aforementioned study (Howard et al., 1980), a vaccination protocol of three subcutaneous

injections also induced protective responses, but two intramuscular or two intratracheal

inoculations did not. In these studies, the number ofM bovis isolated from the lungs of calves

was negatively correlated with IgG concentrations in BAL fluid, and different vaccination

regimens were more or less effective at inducing an IgG response in the respiratory tract.

Despite very limited data on the field efficacy ofM bovis vaccines, several bacterin-

based vaccines for M bovis are licensed for marketing in the U.S. Currently, one vaccine is

licensed for reducing the duration and severity of mycoplasmal mastitis in adult dairy cattle

(Mycomune; Biomune, Lenexa, KS). At least two vaccines are licensed for prevention of

M. bovis-associated respiratory disease in cattle. One product (Myco-B BacTM; Texas Vet. Labs,

Inc., San Angelo, TX), is aimed at stocker and feeder cattle. Another product (Pulmo-GuardTM









MbP; Boehringer Ingelheim Vetmedica, Inc., St. Joseph, MO) is licensed for vaccination of

cattle older than 45 days of age and is primarily marketed to the beef industry. The technical

bulletin for Pulmo-GuardTM (Boehringer Ingelheim, 2003) describes two experimental challenge

trials using 4- to 6-week-old Holstein calves, each trial using 10 vaccinated and five control

animals. Calves were vaccinated twice, 2 weeks apart by subcutaneous injection. The company

reports that vaccinated calves had reduced gross lung lesion scores, higher M. bovis-specific

serum IgGi and IgG2 titers, and higher levels ofM. bovis-specific IgA in BAL fluid compared

with controls. In addition to these vaccines, a number of U.S. companies are licensed to produce

custom autogenous bacterins using strains of M bovis isolated from the target herds. To the best

of the author's knowledge, no controlled, peer-evaluated efficacy studies of any of the above

commercial or autogenous bacterins have been reported. To date, no commercial M. bovis

vaccines are labeled for use in young dairy calves in North America. The lack of well-designed,

independent efficacy studies that include a valid control group, blinding of evaluators, adequate

power, clinically relevant outcomes, and are conducted in an appropriate age group is a major

gap in our understanding of the true potential value of currently available vaccines as a

management strategy to control M. bovis infection.

In conclusion, vaccination against M bovis is possible, but vaccines reported to date do

not prevent colonization of the URT with M bovis. Vaccination can also induce harmful effects.

Probably the biggest challenge for the development of vaccines for use in dairy calves is the

early age at which these calves often become infected. Achieving a protective immune response

in young calves prior to challenge may be very difficult. New approaches, including

investigation of passive transfer, the mucosal route of immunization and development of more

sophisticated vaccines and delivery systems are needed. Also, appropriate field efficacy studies









of the available commercial and autogenous vaccines in North American dairy calf production

systems are urgently needed.

Experimental Infection with M. bovis in Calves

A number of experimental models have been used to study M bovis infection in calves.

Various routes of inoculation have been employed, including inhalation of aerosolized bacteria,

intranasal, intra- or transtracheal, endobronchial, transthoracic, intravenous, intraarticular or

subcutaneous inoculation, as well as combinations of these routes (Chima et al., 1980; Howard et

al., 1980; Pfutzner et al., 1983a; Ryan et al., 1983; Gourlay and Houghton, 1985; Lopez et al.,

1986; Brys et al., 1989; Gourlay et al., 1989b; Nicholas et al., 2002; Vanden Bush and

Rosenbusch, 2003). Although useful in the study of events associated with M bovis infection at

particular body sites, none of these models mimic the ingestion ofM. bovis-contaminated milk, a

major route of infection in young calves (Bennett and Jasper, 1977c; Walz et al., 1997; Brown et

al., 1998a; Butler et al., 2000). In addition, most experimental infection studies have been

conducted in calves that are at least 2 weeks of age, whereas natural colonization with M. bovis

often occurs in younger calves (Brown et al., 1998a; Stipkovits et al., 2000). Although neonatal

calves are immunocompetent, their immune system responds differently to many antigens than

that of older calves (Barrington and Parish, 2001), so selection of an appropriate age group is

likely to be important for a model to accurately mimic natural disease. Importantly, the

experimental models previously used to study M. bovis infection in calves did not induce clinical

otitis media, which is a newly emerging disease in young calves. An experimental infection

model to study the events that occur in the URT of young calves after exposure to M. bovis in

milk, particularly those factors leading to the dissemination of infection and the development of

otitis media and LRT disease, would be invaluable.









Summary and Critical Gaps in Knowledge


Mycoplasma bovis has emerged as an important pathogen of young dairy calves. A

variety of clinical diseases are associated with M bovis infections of calves, including

respiratory disease, otitis media, arthritis and some other less common presentations. Clinical

disease associated with M bovis is often chronic, debilitating and poorly responsive to

antimicrobial therapy, and current management strategies often fail to control clinical

mycoplasmal disease. Thus, there is a critical need to develop better preventive, control and

treatment strategies for M bovis-associated disease in young calves. Improvements in these areas

are hampered by a lack of understanding of the epidemiology ofM. bovis infections in young

calves and of the host-pathogen interactions involved in the establishment of infection and

development of clinical disease. A number of critical gaps in knowledge need to be addressed:

* Other than the feeding of M. bovis-contaminated milk, few specific risk factors for
M. bovis infections in young calves have been identified. In addition, risk factors
associated with dissemination ofM bovis from the URT to the LRT and with clinical
disease expression are poorly understood. Clearly, well designed epidemiological studies
ofM bovis in infected calf-rearing facilities are required to establish risk factors and
provide guidance for dairy producers to prevent and control disease. In addition, long-term
epidemiological studies would be helpful to determine the impact ofM bovis infection in
young calves on the risk of URT or mammary gland infection with M bovis as adults.
Prevalence estimates for M. bovis-associated disease in U.S. dairy calves have not been
published and would be useful in determining the true extent of this problem and in
estimating associated losses.

* Because effective biosecurity is probably one of the best ways to prevent M. bovis
infections, studies to define the optimal diagnostic tests for determining the M bovis
infection status of young calves need to be conducted.

* Current treatment measures need to be critically evaluated. Controlled clinical trials
evaluating the efficacy of particular therapeutic and metaphylactic antibiotic regimens for
clinical disease in U.S. dairy calves are needed. In addition, the safety and efficacy of
myringotomy and irrigation of the middle ear in calves with otitis media needs to be
assessed.

* The role of passive transfer of maternal antibodies in M bovis-associated disease needs to
be defined from both epidemiological and immunological perspectives.









* Research into the microbial factors involved in the ability ofM. bovis to colonize, persist,
and cause disease in the host is ongoing, but many critical gaps in knowledge remain. This
field will likely be greatly assisted by the M bovis genome sequencing projects that are
currently nearing completion. One factor in particular that needs to be addressed is to
define whether specific surface antigens ofM. bovis are involved in protective versus
immunopathological responses.

* Current understanding of the pathogenesis of otitis media in young calves is extremely
limited. Although current data from field and pathology studies indicate that M bovis does
cause otitis media in calves, experimental infection studies are required to fulfill Koch's
postulates and to better define the host-pathogen interactions leading to this disease. In
particular, the route of infection with otitis media needs to be defined. Whether other
agents, such as viruses, increase the risk of mycoplasmal otitis media in calves also needs
to be determined.

* The immune response to M. bovis infections appears to be complex. A much better
understanding of the immune responses of young calves to M. bovis is needed. In
particular, responses that contribute to development of disease or production of an
effective immune response need to be determined; this knowledge may lead to improved
vaccines against M bovis infections. Specifically, the local innate and adaptive immune
responses to M. bovis that are important at sites of infection in the URT, LRT and middle
ear of young calves need to be defined. The lymphocyte populations and cytokines
involved in these responses at the sites of infection also need to be determined. The role, if
any, of hypersensitivity responses and IgE in M bovis-associated disease needs to be
investigated.

* Experimental models that mimic naturally occurring disease as closely as possible may
improve our understanding ofM. bovis infections in calves. Models that utilize the
appropriate age group and a natural route of infection, so as to accurately represent events
involved in establishment of URT infection, dissemination of M bovis to other sites and
development of clinical otitis media and LRT would be invaluable.

* In experimental challenge and field studies, efficacy of vaccination against M bovis has
been variable. Although some vaccines have reduced clinical disease, they do not prevent
colonization and shedding; some have been associated with exacerbation of clinical
disease. More sophisticated approaches to vaccine development and delivery systems and a
better understanding of host immune response in mycoplasmal diseases would likely lead
to improved vaccine strategies. A better understanding of the immunology of the neonatal
calf, especially with respect to ability to respond to different antigens, the types of
responses that are produced, and modulation of these responses by mucosal and systemic
adjuvants may improve our ability to produce efficacious vaccines, if, indeed, vaccination
of the very young calf against M bovis is possible. The efficacy of the mucosal route for
immunization of young calves against M bovis needs to be evaluated in a relevant
experimental infection model. In addition to research into new vaccination strategies,
critical evaluation of currently marketed M bovis vaccines for use in young calves in well
designed, independent efficacy studies that include a valid control group, blinding,
adequate power, relevant clinical outcomes and that are conducted in an appropriate age









group are clearly required. The lack of such studies is a major gap in understanding the
potential of currently available vaccines as a management strategy to control M. bovis
infections in young calves.

Overall Goals of Study

The overall goal of these studies was to address key deficiencies in the current knowledge

ofM. bovis-associated disease in young calves. Ultimately, these studies may lead to the

development of improved preventative or control strategies for M bovis. Because there is a lack

of data on the efficacy of currently available M bovis vaccines, especially in young calves, we

conducted a field trial to determine the efficacy of a commercial vaccine for the prevention of

M. bovis-associated disease in this age group. In addition to this field trial, the major focus of the

studies presented here was to improve our knowledge of the local immune response to M. bovis

in the respiratory tract of young dairy calves. This second main objective involved development

of a reproducible model of M bovis infection of the URT that closely mimicked natural infection

in young dairy calves. This model was then used to define the lymphocyte responses generated

along the respiratory tract during infection with M. bovis.


































B




















Figure 1-1. Clinical manifestations ofMycoplasma bovis-associated respiratory disease. A) Calf
with purulent nasal discharge as well as a right ear droop. B) Calf with purulent nasal
discharge.





































B












Figure 1-2. Clinical manifestations and macroscopic lesions ofMycoplasma bovis-associated
otitis media. A) Calf with left ear droop and epiphora. B) Transverse section of skull
at the level of the tympanic bullae. Bullae are impacted with caseous exudate,
especially on the left side.




















































Figure 1-3. Clinical manifestations and macroscopic lesions of Mycoplasma bovis-associated
arthritis and tenosynovitis. A) Swollen right carpal joint and proximal forelimb due to
M. bovis arthritis and tenosynovitis. B) Flexed carpal joint with an incision into the
extensor tendons containing purulent exudate, as well as dermal necrosis over the
carpal joint. C) Incision into the dorsal aspect of the carpal joint containing copious
purulent exudate.






























Figure 1-4. Substantial economic costs are incurred for treatment and management of calves
with Mycoplasma bovis-associated disease.





























Figure 1-5. Ingestion of milk contaminated with Mycoplasma bovis is a primary route of
transmission in pre-weaned calves.









CHAPTER 2
FIELD EVALUATION OF A Mycoplasma bovis BACTERIA IN YOUNG DAIRY CALVES

Introduction

Mycoplasma bovis is distributed world-wide and is a significant pathogen of adult dairy

cows as well as intensively reared beef and dairy calves (Brown et al., 1998a; Stipkovits et al.,

2001; Thomas et al., 2002a; Fox et al., 2003; Gonzalez and Wilson, 2003; Nicholas and Ayling,

2003; Lamm et al., 2004; Gagea et al., 2006). Clinical manifestations include mastitis,

respiratory disease, otitis media, polyarthritis, and tenosynovitis (Adegboye et al., 1996; Brown

et al., 1998a; Step and Kirkpatrick, 2001 la; Step and Kirkpatrick, 2001b; Nicholas and Ayling,

2003). Although the pathogenicity of M. bovis is well-established, the disease patterns associated

with the microorganism are variable. Outbreaks can be acute with substantive morbidity and

mortality or manifest as endemic disease with sporadic cases (Rodriguez et al., 1996; Walz et al.,

1997; Brown et al., 1998a; Butler et al., 2000; Nicholas and Ayling, 2003; Gagea et al., 2006).

In addition to its role as a primary pathogen, M. bovis also exhibits synergism with other

pathogens in the bovine respiratory disease complex (Houghton and Gourlay, 1983; Gourlay and

Houghton, 1985; Lopez etal., 1986; Thomas etal., 1986; Virtala etal., 1996b; Shahriar etal.,

2000; Poumarat etal., 2001; Gagea et al., 2006).

In the past decade, M. bovis has emerged as an important cause of respiratory disease,

otitis media and arthritis in pre-weaned calves (Brown et al., 1998a; Stipkovits et al., 2000;

Stipkovits et al., 2001; Nicholas and Ayling, 2003; Lamm et al., 2004). Onset of clinical disease

occurs between 2 and 6 weeks of age. The disease is chronic and poorly responsive to antibiotic

therapy (Gourlay et al., 1989a; Allen et al., 1992a; Adegboye et al., 1995a; Apley and Fajt,

1998; Shahriar et al., 2000; Stipkovits et al., 2000; Gagea et al., 2006). In herds with clinical

M. bovis disease, a high prevalence of upper respiratory tract (URT) colonization occurs in









healthy calves, suggesting that only a subset of calves develop clinical disease (Bennett and

Jasper, 1977c; Springer et al., 1982; Allen et al., 1992a; ter Laak etal., 1992a; Brown etal.,

1998a; Mettifogo et al., 1998). Morbidity and mortality occurs as a result of respiratory

infection, otitis media, and arthritis, acting alone or in concert. Respiratory infection occurs when

M. bovis spreads from the URT to the lower respiratory tract. Otitis media occurs when M bovis

spreads to the middle ear, probably via the eustachian tube. Respiratory disease and otitis can

present independently, together, or sequentially. Arthritis occurs as a result of hematogenous

spread with localization in joints, usually as sequelae to respiratory disease. Multiple joints are

often affected, and mortality is frequently observed in arthritic calves.

Ingestion of contaminated milk, especially unpasteurized waste milk, has been identified

as an important primary route of transmission of M. bovis to young calves (Pfutzner and

Schimmel, 1985; Walz et al., 1997; Brown et al., 1998a; Butler et al., 2000). The role of

colostrum in transmission is less well-established in dairy calves, but is known to be important in

small ruminant mycoplasmal disease (DaMassa et al., 1983). Once infection has established,

aerosol droplet and direct contact probably play an important role in calf-to-calf transmission

(Jasper et al., 1974; Bennett and Jasper, 1977c; Nicholas and Ayling, 2003). The economic

consequences of infection are primarily associated with intensive treatment of affected calves

coupled with culling of animals that are unresponsive to therapy (Nicholas and Ayling, 2003).

Control ofM bovis infection in calves focuses on removal of identified risk factors for

acquisition ofM. bovis. Removal of infected milk from the diet by pasteurization or feeding of

milk replacer has been successfully applied to reduce infection (Pfutzner and Meeser, 1986;

Walz et al., 1997; Brown et al., 1998a; Butler et al., 2000; Stabel et al., 2004); breaks in

pasteurization have been associated with subsequent infection outbreaks. Management practices









to reduce stocking density and improve ventilation are examples of changes that can reduce

undifferentiated respiratory disease and are often recommended for M bovis control (Ames,

1997; Rosenbusch, 2001; Step and Kirkpatrick, 2001 a). Similarly, control of other pathogens that

are involved in the bovine respiratory disease complex is likely to reduce M. bovis infections. At

the level of the calf, management techniques that improve general immune function, such as

improving nutritional status and minimizing environmental stress, have been suggested as

beneficial (Rosenbusch, 2001; Step and Kirkpatrick, 2001a). Vaccination is a potential strategy

to control infection, but as discussed in Chapter 1 and briefly summarized below, efforts to

develop efficacious vaccines have been problematic.

Mycoplasma bovis vaccines have afforded some protection from respiratory disease in

European field trials (Howard et al., 1987a; Stott et al., 1987; Urbaneck et al., 2000). Other

vaccines have been efficacious against respiratory disease (Howard et al., 1980; Nicholas et al.,

2002), and arthritis (Chima et al., 1980; Chima et al., 1981; Nicholas et al., 2002) in

experimental challenge studies. Importantly, in some cases vaccination has significantly

exacerbated clinical disease (Rosenbusch, 1998; Bryson et al., 1999). Most vaccine studies have

been performed in calves that are older than the age at which colonization with M bovis is often

first observed (Stipkovits et al., 1993; Walz et al., 1997; Brown et al., 1998a; Butler et al., 2000;

Stipkovits et al., 2001). There are several commercial M. bovis vaccines currently marketed in

the U.S., as well as a number of companies that manufacture autogenous M bovis bacterins.

However, none are licensed for use in young dairy calves, and, to the best of the author's

knowledge, no independent studies have been published on their efficacy. Thus, there is a critical

gap in the knowledge of vaccine strategy and efficacy for protection of the young dairy calf that

is at risk for otitis media, pneumonia, and arthritis.









In order to address the lack of knowledge on the efficacy of currently available vaccines

in young calves, we conducted a field trial using a commercial M. bovis bacterin that was

approved for use in feeder and stocker calves. The objective of this field trial was to determine

the efficacy of this commercially produced M bovis bacterin for the prevention ofM bovis-

associated disease (respiratory disease, otitis media, arthritis) and mortality in dairy calves from

birth to 90 days of age. Additional objectives were to compare vaccinated and placebo-treated

calves with respect to 1) weight gain from birth to 90 days of age, 2) rates of nasal colonization

by M. bovis, and 3) M bovis-specific serum immunoglobulin (Ig) concentrations.

Methods

Study Populations

We studied 373 Holstein heifers in three Florida herds using a randomized field trial

design. The reference population for this study was heifer calves in Florida dairy herds with

endemic M bovis infection. The study unit was a Holstein heifer calf clustered in one of three

herds in north-central Florida. Herds were selected based on their willingness to participate and

on a history of mycoplasma-associated disease in calves. According to calf health records, at

least 15% of calves were treated for respiratory disease, otitis media and/or arthritis during each

of the 2 years preceding the study.

Herd A, containing approximately 500 lactating cows, was the University of Florida

Institute of Food and Agricultural Sciences Dairy Research Unit. Calves were bedded on sand in

individual hutches placed approximately 1 m apart, in an open-sided barn (Figure 2-1A). Calves

were fed unpasteurized bulk tank milk. Calves received a modified live virus (MLV) intranasal

vaccine against parainfluenza virus type 3 (PI3) virus and infectious bovine rhinotracheitis virus

(IBR) in the first week of life. An intramuscular MLV vaccine against IBR, PI3, bovine

respiratory syncytial virus (BRSV) and bovine viral diarrhea virus (BVDV) types 1 and 2 was









administered at 2, 6 and 8 weeks of age. A 7-way clostridial vaccine was administered at 2 and

6 weeks of age. Calves were weaned at approximately 6 weeks of age and turned out into group

pens at approximately 8 weeks of age.

Herd B was a commercial herd of approximately 750 lactating cows. The majority of

calves were housed in individual elevated metal crates in a concrete-floored open-sided barn

(Figure 2-1B), with some calves housed on grass in individual hutches. Calves housed in metal

crates had nose-to-nose contact with neighboring calves. The calf feeding protocol varied during

the study period and included milk replacer and unpasteurized or pasteurized waste milk. The

vaccination protocol was similar to that described for Herd A. Calves were weaned at 6 to

8 weeks of age and turned out into group pens at 8 to 10 weeks of age.

Herd C was a commercial herd of approximately 1,000 lactating cows. Calves were

housed on grass in individual hutches placed at least 1 m apart (Figure 2-1C). Calves were

primarily fed pasteurized waste milk, supplemented with milk replacer when necessary. Several

failures of pasteurization were documented during the study period. Calves received an oral

bolus containing antibodies against bovine coronavirus and Escherichia coli at the time of

colostrum feeding (First Defense, Portland, ME). The vaccination protocol for MLV intranasal

PI3/IBR and clostridial vaccines was similar to that described for Herd A. An intramuscular

MLV vaccine against PI3, IBR, BVDV types 1 and 2, and BRSV was administered at 4 and

8 weeks of age. Calves were weaned at 6 to 8 weeks of age and turned out into group pens at 8 to

10 weeks of age.

Study Design

All Holstein heifer calves that were born during the study period and were considered

healthy by the producer at 3 days of age were enrolled in the study. The enrollment period

extended from March to December, 2002. Calves were assigned to either a vaccinated or a









control group based on ear tag numbers, with odd numbers assigned to one group and even

numbers to the other group. Assignment of odd and even numbers to groups was decided on a

per farm basis by a coin flip. A 1 ml dose of a heat-inactivated, single strain, M. bovis bacterin in

proprietary oil-based adjuvant that had a conditional license for use in U.S. feeder and stocker

calves (Texas Vet Lab, Inc.) or a sterile vaccine vehicle (control group) was administered

subcutaneously in the neck at 3 days and 2 weeks of age. A 2 ml booster dose was administered

at 5 weeks of age. Vaccine or placebo boosters were not administered to calves that were sick at

2 weeks of age; however, if the calf recovered within 5 days, then the booster was administered

at 3 weeks of age. Calves that failed to recover within 5 days remained in the study but were

coded as "booster 1 missed". A similar protocol was followed for calves that were sick at the

time of their 5 week booster. The bacterin and placebo were prepared and coded by the vaccine

manufacturer. Investigators and farm personnel were blinded throughout data collection and

analysis. Data recorded for each calf included date of birth, ear-tag number, group allocation,

dates of vaccine/placebo administration, and date of weaning. The dates of administration of any

preventative treatments or other vaccines were recorded for each calf.

The primary outcomes of interest were treatment for respiratory disease, otitis media, and

arthritis, as well as mortality attributed to these diseases. Calves were followed until 90 days of

age, and all treatment for clinical disease was recorded by farm personnel using standardized

case definitions (Table 2-1). Sick calves were treated as per normal farm protocols. For each

clinically-ill calf, farm personnel recorded the type and dose of antimicrobial, the date(s) of

treatment, and the reason for treatment. Whenever a calf died, farm personnel recorded the cause

of death if this was obvious. In most cases, cause of death was verified by field necropsy

performed by the investigators. Study personnel visited each of the dairies at least once a week to









collect calf health data, monitor compliance, and collect samples. Because passive transfer of

colostral immunoglobulins can influence the immune response to vaccination or to infectious

agents, blood was collected from all calves between 2 and 9 days of age for the measurement of

total serum protein concentration.

A subset of calves from Herds A (n=40) and B (n=60) was studied more intensively.

These calves were weighed at birth and approximately 90 days of age. Weight gain from birth to

90 days was expressed in kg/day. Nasal swabs (Figure 2-2A) and blood samples (Figure 2-2B)

were collected weekly until 8 weeks of age and then at 90 days of age. Serum was analyzed for

M. bovis-specific IgA, IgM, IgGI and IgG2 by enzyme-linked immunosorbent assay (ELISA).

Swabs were cultured to detect nasal colonization with M bovis.

Collection and Processing of Nasal Swabs

Prior to collecting nasal swabs, gross debris was wiped from the external nares using

sterile gauze. A sterile rayon-tipped swab with a polyurethane plastic shaft (BBLTM

CultureSwabTM Liquid Stuart Medium, BD, Franklin Lakes, NJ) was inserted into the ventral

nasal meatus to a depth of approximately 4 inches. Swabs were kept on ice during transport and

were processed within 6 hr of collection. Each swab was used to streak the surface of modified

Frey's agar. All mycoplasma cultures were performed in modified Frey's broth and agar medium

containing 2.25% (wt./vol.) Mycoplasma broth base (Frey) (BD Diagnostic Systems, Sparks,

MD), 0.02% (wt./vol.) DNA from herring sperm, 20% (vol./vol.) horse serum, 10% (vol./vol.)

fresh yeast extract, 0.5% (wt./vol.) glucose, and supplemented with 100,000 U/l each of

penicillin G and polymixin B and 65 mg/1 of cefoperazone, with the final pH adjusted to 7.6 to

7.8. Plates were incubated at 37C in 5% CO2 and examined at 2, 4, 7 and 10 days for mycoplasmal

growth. Colonies with typical M. bovis morphology were plugged into broth, incubated at 37C for









48 hours and stored at -800C until they could be confirmed as M. bovis by polymerase chain

reaction (PCR). Samples were confirmed as M bovis by PCR amplification of the uvrC gene.

To prepare samples for PCR, 500 [tl of broth culture was thawed at room temperature

then pelleted by centrifugation at 14,000 rpm at 40C for 1 hr. The supernatant was discarded and

the pellet resuspended in 20 [tl of lysis buffer (100 mM tris hydroxymethyll] aminomethane, pH

7.5 with 0.05% [vol./vol.] Tween 20 and 6.5 mM dithiothreitol). Samples were incubated at

990C for 20 min then cooled to 200C. 5 dtl of clarified sample was used as the DNA template in

the PCR. As a positive control, broth was inoculated with the M bovis type strain (ATCC 27368)

and processed with nasal isolates. Sterile water was used as a negative control template.

Mycoplasma bovis was identified by PCR of the housekeeping gene uvrC (Subramaniam

et al., 1998). PCR reactions were carried out in a total volume of 50 ptl containing 5 ptl of

template, 2.5 U Taq DNA polymerase (Promega Corporation, Madison, WI), 3 [tl of 25 mM

MgCl2 (final concentration 2.0 mM, Promega), 5 [tl of 10X reaction buffer (final concentration

50 mM KC1, 10 mM Tris pH 9.0, 0.1% [vol./vol.] Triton X-100, Promega), 2 [tl of a mixture of

equal parts 10 mM deoxyribonucleotide triphosphates, 1 [tl of each primer (final amount

20 pmol, commercially synthesized), and 32.75 [tl of sterile, purified DEPC-treated water. The

primers used in the PCR were MbouvrC2-L (5'-TTACGCAAGAGAATGCTTCA-3) and

MbouvrC2-R (5'-TAGGAAAGCACCCTATTGAT-3), corresponding to bases 362 to 381 and

1988 to 1969 in the uvrC coding sequence (Genbank AF003959), respectively. The PCR cycling

conditions were initial denaturation at 940C for 3 min, followed by 35 cycles of denaturation at

940C for 30 sec, annealing at 520C for 30 sec, polymerization at 720C for 60 sec, and a final

extension for 10 min at 720C. PCR products were analyzed by electrophoresis at 110 V for 1 hr

in 1.5% agarose gels and visualized by staining with ethidium bromide.









The ELISA Procedure

Blood samples were allowed to clot after collection, and then serum was harvested by

centrifugation and stored at -80C. Whole-cell lysate antigen (Schumacher et al., 1993) was

prepared from a 1 liter culture ofM bovis type strain PG45 grown at 37C in modified Frey's

broth. The protein concentration was determined using a colorimetric assay (Bio-Rad, Hercules,

CA) and adjusted to 100 [tg/ml. The antigen was stored in aliquots at -800C and thawed at room

temperature when required. The ELISA procedure was optimized using standard methodology.

Microtiter plates (Maxisorb F96, Nunc, Kamstrup, Denmark) were coated with 20 |tg per well of

antigen in 0.01 M sodium phosphate buffer (pH 7.2) containing 0.15 M NaCl and 0.02%

(wt./vol.) NaN3 (PBS/A), and incubated overnight at 40C. Plates were then washed three times

with PBS/A containing 0.05% (vol./vol.) Tween 20 (PBS/T) using an automated plate washer

(ELx405 Auto Plate Washer, BioTek Instruments, Inc., Winooski, VT), blocked with 300 [tl per

well of blocking buffer (PBS/T containing 1% [wt./vol.] egg albumin), and stored at 40C for a

minimum of 24 hr or until needed. Sera were diluted (1:100 for IgGi assay; 1:50 for IgM and

IgG2 assays; 1:25 for IgA assay) in blocking buffer and 50 [tl of the diluted serum was added to

duplicate wells; plates were incubated at room temperature for 1 hr. Plates were washed as

described above and 50 [tl of goat anti-bovine isotype conjugated to alkaline phosphatase (Bethyl

Laboratories Inc., Montgomery, TX) and diluted to 1:1,000 in blocking buffer was added to each

well. Plates were incubated at room temperature for 2 hr and then washed as described above.

100 [tl of 0.1% (wt./vol.) p-nitrophenol phosphate was added to each well and plates were

incubated in the dark at room temperature for 1 hr. The optical density (OD) in each well was

read at a wavelength of 405 nm using an automated plate reader (ELx808 Ultra Microplate

Reader, BioTek Instruments, Inc., Winooski, VT). For each microtiter plate, the blank was the









mean value for two wells coated with antigen and incubated with the conjugated secondary

antibody and substrate only. The blank OD value was subtracted from each sample well, and

mean values for each pair of duplicate tests calculated.

A pool of sera from 20 calves with naturally occurring mycoplasmal disease and high

M. bovis-specific titers were included on each plate as a positive control; the negative control

was a pool of serum collected from the same 20 calves prior to ingestion of their first colostrum

meal. The cutoff for a positive titer was the average OD value (minus the blank) for the negative

control sera plus two standard deviations, established over ten assay runs. The highest dilution of

the test serum that gave an average OD value higher than the cutoff was defined as the titer for

that sample. Within-batch and between-batch assay variability was assessed by using the Youden

plot graphic method (Jeffcoate, 1982). The ELISA values obtained for the lowest, middle and

highest dilution of the control serum included on each plate were used to establish target values

and control limits to be used for monitoring the consistency of the assay (ten batches). The values

obtained at the beginning of a series of assays were plotted against the values obtained for the

same standards at the end of the series. If values for the pooled sera deviated more than 10%

from target values, the assay was repeated.

Field Necropsy

A standard field necropsy was performed by one of the study veterinarians on most

calves that died or had to be euthanized during the study. Calves were examined to determine the

cause of death and specifically determine the involvement ofM bovis associated pathology. All

necropsies included culture of swabs of the palatine tonsils, tympanic bullae and primary bronchi

for mycoplasmas. Additionally, if the animal had previously been diagnosed with respiratory

disease, arthritis or otitis media, or if any macroscopic lung pathology was observed, appropriate

samples were collected from the lesion site(s) to determine the involvement ofM. bovis as well









as other viral and bacterial respiratory pathogens. Further samples were collected when deemed

necessary to determine the cause of death by the veterinarian performing the necropsy. All swabs

and fresh tissue samples were transported on ice to the laboratory as soon as possible and were

processed within 24 hr after collection. When tissue samples for fixation were collected, they

were placed into containers of 10% buffered formalin and submitted to the Diagnostic Pathology

Service, College of Veterinary Medicine, University of Florida. Samples then were embedded in

paraffin and sections (5 [tm) stained with hematoxylin and eosin. Histopathology was read by

diagnostic pathologists without knowledge of experimental treatment groups. In addition to

culture for mycoplasmas (described under nasal swabs, above), swabs for aerobic

microbiological culture were processed and isolates identified using routine clinical

bacteriological methods. These methods were focused on identifying bacterial pathogens of the

respiratory tract other than mycoplasmas, particularly Arcanobacterium pyogenes, Histophilus

somni, Mannheimia haemolytica and Pasteurella multocida as well as pathogens that may cause

septicemia and associated sequelae in young calves. Additional diagnostic testing was performed

as requested by the veterinarian who conducted the necropsy based on the presumptive diagnosis

and any macroscopic pathology. Samples were submitted to the Florida State Diagnostic

Laboratory (Kissimmee, FL) for detection of bovine respiratory viruses when indicated.

Sample Size

Morbidity due to M. bovis was the major outcome of interest and was therefore used to

calculate sample size. At the time the study was initiated, health records indicated that the

incidence of respiratory disease, otitis media and/or arthritis in the study herds was at least 15%.

We hypothesized that a reduction in incidence to 5% would be biologically and economically

significant. Using these values together with 95% confidence and 80% power, and taking into









consideration an attrition rate of approximately 10%, the calculated sample size was 180 calves

per group.

For the secondary outcomes of interest from a subset of calves in Herds A and B, we

hypothesized that a reduction in the nasal colonization rate from 50% to 20% would be

biologically significant. Using these values together with the parameters outlined above, the

calculated sample size was 50 calves per group.

Statistical Methods

Calves were excluded from analyses if clinical signs referable to other organ systems

occurred concurrently with respiratory disease, otitis media or arthritis, with the exception of

diarrhea without fever of less than 7 days duration. Categorical variables were compared among

groups using Chi-square tests; data were analyzed for effects of herd and passive transfer status

by Stratified Mantel-Haenszel analysis. Simple continuous variables were compared among

groups using t-tests, and ELISA data were analyzed using repeated measures ANOVA. Analyses

were performed using commercial statistical software (SPSS 12.0, SPSS Inc, Chicago IL).

Results

Between March and December, 2002, 328 calves from Herds B and C (166 and

162 calves, respectively) were enrolled and were eligible for inclusion in the study (Table 2-2).

Despite a history of M. bovis infection, Herd A did not experience any M. bovis-associated

disease during the study and therefore is excluded from some analyses, but data from this herd

are included where relevant.

The incidence risk for clinical respiratory disease, otitis media, and arthritis was assessed

from birth to 90 days of age (Table 2-3). Mycoplasma bovis-associated respiratory disease and

otitis media were major contributors to calf disease in Herds B and C. One case of arthritis was

observed in Herd B, and none were observed in Herd C. Herd A had a much lower overall









mortality risk (0.02) than did Herds B (0.13) and C (0.10); M. bovis-associated mortality in Herd

B accounted for the majority of the mortality risk (0.10 vs. 0.13 overall).

The baseline data for vaccinated and control animals are shown in Table 2-4. Vaccinated

and control groups had equivalent levels of post-colostral total serum protein. A small percentage

of calves did not receive their second vaccine due to illness. In Herd B, no control calves missed

the third vaccine as opposed to 9% of the vaccine group that missed this vaccination (P = 0.005).

Vaccination did not influence the age of first treatment for either otitis media or

respiratory disease (Table 2-5). Similarly, vaccination neither reduced overall M. bovis-

associated morbidity nor altered the temporal expression of disease in either herd (Table 2-6).

Morbidity specifically associated with respiratory disease also was not affected by vaccination

(Table 2-7). The incidence of otitis media was higher (P = 0.004) in vaccinated calves than in

control calves in Herd B, but no differences in the incidence of otitis media between groups were

observed in Herd C (Table 2-8). There was no difference between vaccinated and control calves

in Herd B in the age of first treatment for otitis media (data not shown). There was no significant

difference between vaccinated and control calves with respect to mortality (Table 2-9). For

Herds A and B, weight gain was monitored from birth to 90 days of age; no significant

difference was observed in average daily gain between groups in Herd A. Similarly, no

significant difference was observed in average daily gain between vaccinated (0.48

0.18 kg/day, n=27) and control (0.54 0.11 kg/day, n=29) calves in Herd B, where endemic

M. bovis disease was present.

Nasal colonization was not affected by vaccination; in Herd B where endemic M. bovis

disease was present, the mean percentage ( SEM) of calves with M bovis-positive nasal swabs

at each sampling time was 81.4 8.2% for vaccinated calves and 75.8 6.7% in control calves.









The average number of sampling times that M bovis was recovered from each calf was also not

affected by vaccination. However the temporal pattern of colonization observed in calves from

Herd A (no mycoplasmal disease) was quite different from that observed in calves in Herd B

(significant mycoplasmal disease; Figure 2-3). Calves in Herd A had minimal to no nasal

shedding ofM. bovis during the pre-weaning period. Calves in Herd A were moved out of

individual hutches into group pens after the 8 week samples were collected; at the next sampling

period (12 weeks of age), the level of nasal colonization was similar to that in the herd that

experienced M. bovis-associated disease. In Herd B, calves were shedding M. bovis as early as

1 week of age, and by 3 weeks of age over 70% of calves were colonized in the URT. This level

of colonization was maintained throughout the sampling period.

The serum antibody subclass response in a subset of calves in Herds A and B was

assessed by ELISA. No significant differences between vaccinated and control calves were

found in either Herd A or B for IgA (Figure 2-4), IgM (Figure 2-5), or IgG2 (Figure 2-6).

However, vaccination did induce a serum IgGi response (Figure 2-7). Significant differences

(P < 0.05) between vaccinated and control groups were first evident at 7 weeks of age in Herd A

(no endemic disease) and at 12 weeks of age in Herd B (endemic disease). We then assessed if

there was an association between Ig subclass response and morbidity in calves from Herd B.

There was no association of any Ig subclass response with morbidity, nasal colonization rate, or

weight gain.

Interestingly, there was no significant association between post-colostral total serum

protein concentrations and the incidence or duration of treatment for respiratory disease or otitis

media in Herds B and C (data not shown). Similarly, the incidence ofM. bovis-specific calf

mortality in Herds B and C was not associated with post-colostral total serum protein









concentrations (data not shown). There was also no association between M. bovis-specific IgA,

IgM, IgGi or IgG2 post-colostral serum titers and either morbidity or mortality in a subset of

calves in Herd B (data not shown).

Discussion

The commercial M. bovis bacterin tested in this trial was not efficacious in prevention of

either M bovis-associated respiratory disease or otitis media in pre-weaned calves in two north-

central Florida herds with endemic M bovis disease. The response to vaccination was herd-

dependent, and a higher rate of otitis media was associated with vaccination in one herd.

Other investigators have reported some protection from mycoplasmal respiratory disease

by subcutaneous vaccination of calves with killed whole cell bacterins (Howard et al., 1980;

Howard et al., 1997; Nicholas et al., 2002). In a study of an apparently efficacious vaccine in

young calves, Nicholas et al., (2002) vaccinated 3-week-old dairy calves with a single dose of

saponin-inactivated bacterin. Calves received an aerosol challenge with live M. bovis 3 weeks

after vaccination. Vaccinated calves had fewer numbers ofM bovis at colonized sites, fewer

body sites colonized by M bovis, and reduced severity and incidence of clinical disease and

lesions as compared to control calves. There was also a significant decrease in body weight gain

in control calves compared with vaccinates. Additionally, no vaccinated calves and two of seven

control calves developed arthritis. Vaccinated calves produced a strong IgG response prior to

challenge, but IgG subtypes were not reported. No adverse events associated with vaccination

were reported.

A killed vaccine against four bovine respiratory pathogens (BRSV, PI3, M. bovis, and

M. dispar) was evaluated for protection against naturally-occurring respiratory disease in beef

calves (Howard et al., 1987a; Stott et al., 1987). Calves were vaccinated subcutaneously and

received two boosters at 3 week intervals. In one study (Stott et al., 1987), three groups of beef









calves aged 12, 7 and 3 weeks at the time of first vaccination were used, and calves were

followed for 6 months. Respiratory disease occurred in a significantly higher (P < 0.05)

proportion of the control calves (27%) compared with the vaccinates (16.3%). In a second study

(Howard et al., 1987a) using the same vaccination protocol, M. bovis and BRSV were implicated

in outbreaks of respiratory disease during the trial period. Morbidity due to respiratory disease

was significantly reduced in vaccinated calves (25%) compared with controls (32%), and

mortality in the vaccinated group was similarly reduced (2% and 9% for vaccinates and controls,

respectively). No adverse effects of vaccination were noted.

There are a number of key differences between the studies reported above and our study

that may have influenced vaccine efficacy. Firstly, the strain of bacteria, the antigen

concentration, the method of bacterial inactivation and the adjuvant used are all factors that exert

significant effects on the efficacy of bacterial vaccines, although there are limited data on how

these affect M. bovis vaccines in particular. Although some of these data are not reported in the

above studies, and some are not available for our vaccine (e.g. the adjuvant used is proprietary),

it is likely that all these factors varied significantly between our study and those listed above.

Secondly, calves in the above studies were first vaccinated at a substantially older age than the

calves in our study. As discussed in Chapter 1, immune responses of the newborn calf have

unique characteristics and undergo rapid changes during the first few weeks of life (Barrington

and Parish, 2001). Vaccination at 3, 14 and 35 days of age (as was performed in our study) may

not elicit the same type of immune response as vaccination at 3 weeks of age (as in the

Nicholson et al., 2002 study, above). Our vaccination protocol was chosen based on a) protocols

that were being applied on dairies in Florida, and b) the early age of infection that had been

observed in previous studies (Brown et al., 1998a). Thirdly, calves in endemically-infected herds









in our study became colonized at a very early age, meaning that infection was likely well

established before a vaccine-induced immune response could develop. As discussed in Chapter

1, adaptive immune responses that develop after infection are very inefficient at clearing

mycoplasmal infections and often result in detrimental chronic inflammatory responses. Lastly,

the challenge load ofM. bovis that calves are exposed to can affect the efficacy of vaccination.

Given the high incidence of clinical mycoplasmal disease and the early age of colonization

observed in our endemically-infected herds, the level ofM bovis challenge that calves were

exposed to may have been significantly greater than that of the calves in other vaccine studies

(Howard et al., 1980; Howard et al., 1997; Nicholas et al., 2002).

Vaccinated calves in one herd in our study had a greater risk of otitis media than did

control calves. The risk of otitis media in control calves in Herd B seemed substantially less than

that in Herd C, but examination of calf health records from previous years in Herd B showed that

the risk of otitis media observed in control calves was similar to that which had been historically

present (data not shown). Therefore, vaccination seemed to exacerbate clinical otitis media in

this herd. There are other reports of exacerbation of clinical disease following M. bovis

vaccination (Boothby et al., 1987; Rosenbusch, 1998; Bryson et al., 1999). However, the

immune mechanisms associated with adverse outcomes after M bovis vaccination have not been

determined.

Vaccination of calves did stimulate a systemic humoral immune response, with an

increase in serum IgGi being detectable after the third vaccination. A tendency towards Th2-

biased IgGi-dominated humoral responses has also been reported after infection of calves with

M. bovis (Howard et al., 1987c; Vanden Bush and Rosenbusch, 2003). As IgG2 is a much more

effective opsonin for phagocytosis ofM. bovis than is IgGi, it is not surprising that an IgGi









response is ineffective for control ofM bovis respiratory infections (Howard et al., 1976). It is

somewhat puzzling that a humoral response to infection was not obvious in control calves in

Herd B where there was a high incidence of M bovis-associated disease. Statistical comparison

of IgGi responses in control groups in Herds A and B was not conducted. However, it appears

that in the control group in Herd A, post-colostral IgGi antibody levels continued to decline

throughout the study period (see Figure 2-7), whereas in the control group in Herd B, they did

not decline after 7 weeks of age. This result may reflect continued stimulation of the immune

response as a result of the endemic nature of M. bovis in this herd. Other investigators have also

noted a poor correlation between serum antibody responses and M. bovis infection in individual

calves during the first 3 months of life (Virtala et al., 2000). However, M. bovis infection can

result in local mucosal antibody responses without eliciting a substantial systemic humoral

response (Howard et al., 1980).

The vaccine used in our study was ineffective at preventing URT colonization with

M. bovis in calves, even when colonization occurred after a humoral immune response was well

established. Calves in Herd A were not colonized until between 8 and 12 weeks of age, whereas

a significant increase in serum IgGi responses was evident by 7 weeks of age. This is consistent

with other reports on M. bovis vaccines; even where M bovis vaccines have been associated with

clinical benefits, they typically fail to induce an immune response that prevents URT infection

(Chima et al., 1980; Nicholas et al., 2002). As discussed in Chapter 1, protection from URT

colonization and from clinical respiratory tract disease is better correlated with local mucosal

immune responses than with serum antibody titers.

Post-colostral total serum protein concentrations or M bovis-specific antibody levels

were not associated with protection from M bovis-associated disease in calves in this study.









However, as colostrum was not pasteurized on this farm, it is possible that some colostrum

containing high antibody concentrations to M. bovis may have come from cows with

intramammary infection and therefore may also have contained live M bovis. This could

certainly mask any protective effect of passive transfer when assessed on a herd level. Further

studies are required to determine the efficacy of passive transfer for prevention of M bovis-

associated disease in a controlled setting.

To the best of the author's knowledge this is the first controlled, independent efficacy

study of any of the M bovis vaccines available in North America. The response to vaccination

was herd-dependent, and a higher rate of otitis media was associated with vaccination in one

herd. The vaccine did stimulate a systemic IgGi response that was detectable after the third

vaccination. However, most clinical disease occurred prior to this adaptive humoral immune

response. Pre-weaned calves in endemically-infected herds were colonized with M. bovis at a

very young age, and it is likely that this represents the greatest impediment to successful

vaccination in this age group. Whether vaccination may be efficacious at preventing clinical

disease in older calves was not evaluated in this study. In conclusion, vaccination was not

efficacious in preventing M bovis-associated disease in pre-weaned calves in two endemically-

infected Florida dairy herds, nor was it effective at preventing colonization of the URT in older

calves in a third dairy herd. New approaches to immune protection of young calves from

M. bovis infections, including controlled studies investigating the efficacy of passive transfer and

the mucosal route of immunization, are needed.

























F r B











C













Figure 2-1. Calf housing conditions for the three study farms. A) Herd A. B) Herd B. C) Herd C.









Table 2-1. Clinical definitions of disease used by calf producers during this study.
Disease Clinical definition
Scours Diarrhea plus rectal temperature of < 103.50 F
Scours with fever Diarrhea plus rectal temperature of > 103.50 F
Digestive Clinical signs attributable to alimentary tract disease, other
than scours
Fever of unknown cause Fever in the absence of specific clinical signs
Respiratory disease Fever (rectal temperature > 103.50 F) plus increased
respiratory rate or effort and/or coughing and/or nasal
discharge
Otitis media Ear droop and/or evidence of ear pain (head shaking,
scratching or rubbing ear)
Arthritis Lameness attributable to painful distention of any joint
Navel infection Enlarged umbilical stalk that is non-reducible on
palpation, confirmed by a veterinarian at next visit
Other Clinical signs described by farm personnel or veterinarian.


Figure 2-2. Sampling of a subset of calves in Herds A and B. A) Collection of nasal swabs.
B) Collection of blood from the jugular vein.









Table 2-2. Summary of calves enrolled in vaccine field efficacy study.
Herd Vaccinated Control Exclusions* Total
A 21 20 0 41
B 81 85 2 168
C 82 80 2 164


All Herds 184 185 4 373
* In Herd B, one calf was excluded because of concurrent disease and one calf was excluded
because of a booster was inadvertently missed; in Herd C, one calf was excluded because of
concurrent disease and one calf was excluded because it received the wrong booster.


Table 2-3. Incidence risk for Mycoplasma bovis-associated disease and mortality between 3 and
90 days of age in calves in the three study herds.
Herd A Herd B Herd C
Disease
All M bovis-associated 0.00 0.55 0.74
Otitis media 0.00 0.22 0.35
Respiratory disease 0.00 0.48 0.69
Arthritis 0.00 0.04 0.00
Other 0.07 0.15 0.19
Mortality
M. bovis-associated 0.00 0.10 0.03
All causes 0.02 0.13 0.10


Table 2-4. Baseline data for calves in Herds B and C.
Vaccinated (n=163) Control (n=165) P
Herds B+C
TTSP (g/dl) 5.84 + 0.73 5.76 + 0.58 ns
TT No 2nd vaccine 9/157(6%) 7/157(4%) ns
"No 3rd vaccine 10/153 (7%) 8/153 (5%) ns
Herd B
"No 3rd vaccine 7/77 (9%) 0/82 (0%) 0.005
*TSP = total serum protein; Results are expressed as mean + standard deviation.
"Results are expressed as number of calves that missed the vaccine/total number of calves
eligible for that vaccine, percentage is given in parentheses.
*ns = no significant difference









Table 2-5. The age at which calves in Herds B and C received their first treatment for otitis
media or respiratory disease.
Age in days at first treatment
Disease Vaccinated Control P
Otitis media
Herd B 37 + 16 37 + 17 ns
Herd C 27 +10 24 + 9 ns
Herd B+C 32 + 13 31 + 13 ns
Respiratory disease
Herd B 30 + 13 33 + 14 ns
Herd C 20 +17 21 + 17 ns
Herd B+C 24 + 15 25 + 16 ns
Results are expressed as mean age in days standard deviation; ns = no significant difference


Table 2-6. Temporal expression ofMycoplasma bovis-associated disease in vaccinated and
control calves in Herds B and C
Age Herd Vaccinated (%) Control (%) P
4 weeks B 19/81 (23) 17/85 (20) ns
C 46/82 (56) 46/80 (58) ns
B+C 65/163 (40) 63/165 (38) ns


8 weeks B
C
B+C


42/81 (52)
57/82 (70)
99/163 (61)


38/85 (45)
53/80 (66)
91/165 (55)


12 weeks B 44/81 (54) 40/85 (47) ns
C 58/82 (71) 55/80 (69) ns
B+C 102/163 (63) 95/165 (58) ns
Results are expressed as the number of calves receiving their first therapeutic intervention by 4,
8, or 12 weeks of age/total number of calves. ns = no significant difference.









Table 2-7. Morbidity due to respiratory disease in vaccinated and control calves.
Vaccinated (%) Control (%) P
Herd B
Respiratory only 18/81 (22) 26/85 (31) ns
All Respiratory 38/81 (47) 36/85 (42) ns
Herd C
Respiratory only 35/82 (43) 25/80 (31) ns
All Respiratory 55/82 (67) 51/80 (64) ns
Herd B + C
All Respiratory 93/163 (57) 87/165 (53) ns
Results are expressed as the number of calves with respiratory disease/total number of calves in
that group. "All Respiratory" includes calves that were treated for respiratory disease alone or for
respiratory disease and otitis media or arthritis. ns = no significant difference.


Table 2-8. Morbidity due to otitis media in vaccinated and control calves.
Vaccinated (%) Control (%) P
Herd B


Otitis media only
Otitis media + Respiratory
All otitis media
Herd C


4/81 (5)
20/81 (25)
24/8 (30)


1/85 (1)
9/85(11)
10/85 (12)


ns
0.017
0.004


Otitis media only 3/82 (4) 4/80 (5) ns
Otitis media + Respiratory 20/82 (24) 26/80 (33) ns
All otitis media 23/82 (28) 30/80 (38) ns
Results are expressed as the number of calves with otitis media/total number of calves in that
group. ns = no significant difference.








Table 2-9. Overall and Mycoplasma bovis-associated mortality in vaccinated and control calves.
Vaccinated (%) Control (%) P
All mortality
Herd B 11/81 (14) 10/85 (12) ns
Herd C 6/82 (7) 11/80 (13) ns
Herd B+C 17/163 (10) 21/165 (13) ns
M. bovis-associated
Herd B 9/81 (11) 7/85 (8) ns
Herd C 1/82 (1) 4/80 (5) ns
Herd B+C 10/163 (6) 11/165 (7) ns
Results are expressed as the number of calves that died/total number of calves in that group. ns =
no significant difference.


100 -
90 -
80 -
.N 70
S60 -
F r 2 Herd A (n=40)
S50 -
>4 Herd B (n= 60)
S40 -
30 -
20 -
10 -

1 2 3 4 5 6 7 8 12
Age (weeks)
Figure 2-3. Temporal pattern of nasal colonization of calves by Mycoplasma bovis in Herds A
and B.




































0.45 B
0.40 -
0.35 -
0.30 -
S0.25 -

0. 2" -- Vaccine
S0.15 -m- Control
0.10 -
0.05 -
0.00 I
0 2 4 6 8 10 12 14

Age (weeks)


Figure 2-4. Immunoglobulin A response in vaccinated and control calves. A) Herd A.
B) Herd B.


0.45 -A
0.40 -
0.35 -
0.30 -
C 0.25 -
S0.20 -A-- Vaccine
0.15 Control
0.10 -
0.05 -
0.00 I ,
0 2 4 6 8 10 12 14

Age (weeks)




























































Figure 2-5. Immunoglobulin M response in vaccinated and control calves. A) Herd A.
B) Herd B.


0.90 -

0.80 -

0.70 -
. 0.60 -

5 0.50 -

0.40 Vaccine
0.30- Control
o 0.30 -
0.20 -
0.10

0.00 I I I II
0 2 4 6 8 10 12 14
Age (weeks)


B
0.90 -
0.80 -
0.70 -
0.60 -
5 0.50 -
-o
. 0.40- -A-- Vaccine
0 0.30 --- Control
0.20 -
0.10 -
0.00 .-...ii
0 2 4 6 8 10 12 14
Age (weeks)







































B
0.3 -

0.25 -

0.2 -

0.15 -


0. -- VaControl

0.05 -__ ---

0

-0.05 I I ,
0 2 4 6 8 10 12 14
Age (weeks)


Figure 2-6. Immunoglobulin G2 response in vaccinated and control calves. A) Herd A.
B) Herd B.


0.3 -

0.25 -

0.2 -

0.15 -

0.1

0.05 -

0

-0.05


0.1 -~- Vaccine


-A- Vaccine
-- Control


I I I I I I I


0 2 4 6 8 10 12 14

Age (weeks)











0.5 -


B
0.5
*

0.4 -


0.3 -
-- Vaccine

0.2- --- Control
0

0.1 -




0 2 4 6 8 10 12 14
Age (weeks)


Figure 2-7. Immunoglobulin Gi response in vaccinated and control calves. A) Herd A.
B) Herd B. *Asterisks indicates time points at which vaccinated and control groups
were statistically different (P < 0.05).


*
0.4 *


0.3 -
"-e
-*A Vaccine
0.2 -
S2-- Control





0
0 2 4 6 8 10 12 14

Age (weeks)









CHAPTER 3
ORAL INOCULATION OF DAIRY CALVES WITH Mycoplasma bovis RESULTS IN
RESPIRATORY TRACT INFECTION AND OTITIS MEDIA: ESTABLISHMENT OF A
MODEL OF AN EMERGING PROBLEM

Introduction

Mycoplasma bovis has emerged in recent years as a widespread and important etiologic

agent of otitis media, respiratory disease and arthritis in intensively-reared pre-weaned dairy

calves. Clinical disease caused by M. bovis tends to be chronic, debilitating and unresponsive to

antimicrobial therapy (Gourlay et al., 1989a; Adegboye et al., 1995a; Apley and Fajt, 1998;

Pollock et al., 2000; Stipkovits et al., 2000; Rosenbusch, 2001; Shahriar et al., 2002). Disease

outbreaks with high morbidity rates occur (Gourlay et al., 1989a; Walz et al., 1997; Brown et al.,

1998a; Butler et al., 2000; Stipkovits et al., 2001) and can be economically devastating for the

affected farm. An absence of efficacious vaccines for use in young calves combined with a poor

response to therapeutic agents means that this disease is often very difficult to control once

established in a herd. Therefore, there is a critical need to develop improved preventative or

control measures forM. bovis-associated calf disease.

Ingestion of milk or colostrum from cows shedding M bovis from the mammary gland is

considered to be a major means of transmission to young dairy calves (Bennett and Jasper,

1977c; Walz et al., 1997; Brown et al., 1998a; Butler et al., 2000), although direct contact with

infected animals and secondary transmission through fomites are also likely to be important.

Following exposure by any of these routes, the upper respiratory tract (URT) appears to be the

initial site of colonization (Bennett and Jasper, 1977c; Brys and Pfutzner, 1989), and this

colonization precedes the development of clinical disease. However, as with many other

pathogens which inhabit mucosal surfaces, colonization alone does not necessarily result in the

development of clinical disease, and M bovis is frequently isolated from the nasal passages of









apparently healthy cattle (ter Laak et al., 1992a; Brown et al., 1998a; Mettifogo et al., 1998;

Maeda et al., 2003).

The host and microbial factors that contribute to development of disease after

colonization of the URT by M bovis are poorly understood. A defined experimental animal

model that mimics naturally occurring disease would facilitate understanding of these factors. In

addition such a model could be applied in the development of optimal vaccine approaches

against M. bovis as well as efficacy testing of new treatments and vaccines for use in young dairy

calves. A number of experimental models have been used to study M bovis infection in calves.

Various routes of inoculation have been employed, including inhalation of aerosolized bacteria,

intranasal, intra- or transtracheal, endobronchial, transthoracic, intravenous, intraarticular or

subcutaneous inoculation, as well as combinations of these routes (Chima et al., 1980; Howard et

al., 1980; Pfutzner et al., 1983a; Ryan et al., 1983; Gourlay and Houghton, 1985; Lopez et al.,

1986; Brys et al., 1989; Gourlay et al., 1989b; Nicholas et al., 2002; Vanden Bush and

Rosenbusch, 2003). Although useful in the study of events associated with M bovis infection at

particular body sites, none of these models mimic the ingestion ofM. bovis-contaminated milk, a

major route of infection in young calves (Bennett and Jasper, 1977c; Walz et al., 1997; Brown et

al., 1998a; Butler et al., 2000). In addition, most experimental infection studies have been

conducted in calves that are at least 2 weeks of age, whereas natural infection often occurs in

younger calves (Brown et al., 1998a; Stipkovits et al., 2000). Although neonatal calves are

immunocompetent, their immune system responds differently to many antigens than does that of

older calves (Barrington and Parish, 2001), so selection of an appropriate age group is likely to

be important for a model to accurately mimic natural disease. Importantly, the experimental

models previously used to study M bovis infection in calves did not induce clinical otitis media,









which is a newly emerging disease in young calves. An experimental infection model to study

the events that occur in the URT of young calves after exposure to M. bovis in milk, particularly

those factors leading to the dissemination of infection and the development of otitis media and

lower respiratory tract (LRT) disease would be invaluable.

The goal of this study was to develop a reproducible model of M bovis infection of the

URT that closely mimicked natural infection, and to compare this model with a transtracheal

inoculation approach. Because the very young calf presents some special challenges with respect

to vaccine development and treatment of clinical disease, we chose to focus our studies on this

age group. To best mimic a natural route of infection, we infected calves by feeding milk-

replacer inoculated with a field strain ofM bovis. This model consistently resulted in

colonization of the URT and eustachian (auditory) tubes and caused otitis media in 37% of

calves by two weeks post-infection. The model is suitable for use in further studies to define

local and systemic immune responses to M. bovis infection of the URT and to evaluate new

therapeutic or preventative strategies against M. bovis-associated disease.

Methods

Calves

All animal work was approved by the University of Florida (UF) Institutional Animal

Care and Use Committee. Healthy male Holstein calves were obtained from the UF Dairy

Research Unit, where no clinical mycoplasmal disease had been observed in calves for 2 years

preceding the study. Calves were removed from the cow at birth before suckling could occur. In

the first 12 hr of life, calves were fed two doses of a mycoplasma-free colostrum-replacement

product formulated from a spray-dried bovine serum (AcquireTM, APC Inc., Ames, IA). Calves

were weighed, ear-tagged and given one oral dose of a commercial product containing antibody

against F5-piliated E. coli (Bovine Ecolizer, Novartis Animal Health U.S., Inc., Greensboro,









NC). Serum and nasal swabs were collected prior to initial colostrum replacer feeding and at

approximately 48 hr of age. Total serum protein was measured at 48 hr of age as an estimate of

passive transfer of immunoglobulin (Ig). Nasal swabs were cultured to detect mycoplasmas and

other URT pathogens. At 1 to 4 days of age, calves were transported to UF research facilities

where they were housed in individual stalls with no direct contact between animals. Calves were

maintained on non-medicated milk replacer and had free-choice access to non-medicated starter

pellets and fresh water. Calves that developed uncomplicated diarrhea (diarrhea without fever) in

the pre-enrollment period were given oral electrolytes (Enterolyte HETM, Pfizer, Kalamazoo, MI)

as needed to replace fluid and electrolyte losses. Calves that developed other clinical signs of

disease were not enrolled in the study. Control and infected groups were housed in different

rooms.

Strain of M. bovis and Experimental Infection

Mycoplasma bovis Fl, confirmed as M bovis by 16S rRNA gene sequencing (data not

shown), is a field strain isolated from a lung abscess in a calf with severe fibrinous

bronchopneumonia. The source herd had experienced high morbidity rates due to M. bovis-

associated pneumonia and otitis media in pre-weaned dairy calves in the two years prior to the

isolate being obtained. A second passage culture ofM. bovis Fl in Frey's broth was stored in

aliquots at -800C and used for all infection studies.

All calves were inoculated between 7 and 11 days of age (Day 0 = day of inoculation).

For the oral inoculation groups, calves received a total dose of 2.9 + 2.5 x 1010 colony forming

units (CFU) ofM bovis Fl (infected group, n 8) or an identical volume of sterile Frey's broth

(control group, n 4) over three consecutive feedings in a 24 hr period. At each feeding, an

aliquot of M bovis F 1 was thawed at room temperature, mixed with two pints of milk replacer at









35 to 37C in a bucket and immediately fed to the calf. The remaining volume of the calfs milk

was then added to the bucket and fed.

For the transtracheal inoculation groups, calves received a single inoculum (3.8 + 1.1 x

109 CFU/ml) of M bovis Fl in sterile, endotoxin-free isotonic saline (Abbott Laboratories,

Chicago, IL; infected group, n 5) or an identical volume of saline (control group, n 4).

Approximately two hr prior to inoculation, an aliquot ofM. bovis Fl was thawed at room

temperature, pelleted, washed twice, and resuspended in 20 ml of saline. Each calf was sedated

with xylazine hydrochloride, and the inoculum delivered at the level of the tracheal bifurcation

using a commercial transtracheal wash kit (MILA International, Inc., Florence, KY).

Clinical Monitoring and Sample Collection

A complete physical examination was performed or supervised by a veterinarian on each

calf at approximately the same time each day, and data were recorded using standardized forms.

Calves were also observed a second time during the day for clinical abnormalities. Due to

biosecurity protocols in the housing facility, the examiners were not blinded as to calf infection

status.

A clinical scoring system was developed in which calves were scored in four categories:

Behavior (0: normal behavior, gets up when approached; 1: depressed or dull, must be stimulated

to get up; 2: gets up only with assistance) rectal temperature (0: < 1030F; 1:103 to 104.90F;

2: > 1050F), clinical signs of otitis media (0: no clinical signs of otitis media; 1: occasional head-

shaking and/or scratching ears, ear droop evident at rest; 2: occasional head-shaking and/or

scratching ears, ear droop evident continuously; 3: frequent head-shaking or ear scratching,

pronounced ear droop) and clinical signs of respiratory disease (0: none of the following clinical

abnormalities: cough, mucopurulent nasal discharge, abnormal breath sounds on thoracic









auscultation, tachypnea (> 60 breaths/min) or dyspnea; 1: one of the above clinical

abnormalities; 2: two of the above clinical abnormalities; 3: three or more of the above clinical

abnormalities). The scores for each of the four categories were summed each day to give a

maximum overall daily clinical score of 10.

Swabs of the left and right nares (BBLTM CultureSwabTM Liquid Stuart Medium, BD,

Franklin Lakes, NJ) were collected at 0, 3, 7 and 14 days post-infection for mycoplasma culture.

Blood samples were collected by jugular venipuncture at the same times for mycoplasma culture

(all time points) and for assay ofM. bovis-specific serum IgG titers by enzyme-linked

immunosorbent assay (ELISA) (days 0 and 14).

Collection of Tissues

Calves were euthanized 14 days after the first inoculation of M bovis, or earlier if criteria

for euthanasia were met. One calf had to be euthanized at 10 days post-infection; samples were

collected immediately prior to euthanasia from this animal. At necropsy, each of the six major

lung lobes, the spleen, the tracheobronchial lymph nodes (TBLN) and the medial and lateral

retropharyngeal lymph nodes (MRPLN and LRPLN) were examined for gross lesions and

samples collected for culture and histopathology. Lymph nodes were weighed prior to sample

collection. Each lung lobe was weighed and photographed; digital photographs were later used to

calculate the percentage of each lobe affected with visible lesions. Mean lung lobe weights of

control calves were used to calculate the ratio of each lobe to the total lung mass, and these

figures used to determine the total percentage of visibly affected lung for each calf (Jericho and

Langford, 1982). For mycoplasmal culture, approximately 300 mg of tissue was collected

aseptically from a standard site in each lung lobe and the spleen. In addition, the cut surface of

each of these tissues was swabbed. Swabs were collected aseptically from the mucosal or

synovial surfaces of the palatine tonsils, trachea, primary bronchi, carpal and stifle joints, and









from the cut surface of the MRPLN, LRPLN and TBLN. Samples also were collected from each

of these tissues for histopathology. Spinal fluid was aspirated from the atlanto-occipital space for

culture. The exterior and cut surfaces of the tissues described above as well as all other major

organs were examined for gross abnormalities.

Samples from the nasopharynx, eustachian tubes and tympanic bullae were collected after

removal of the brain and bisection of the skull. The brain, meninges, nasal passages and sinuses

were examined for gross lesions. Swabs of the mucosal surface of the pharyngeal tonsil (Schuh

and Oliphant, 1992) and nasal mucosa were collected for culture, and tissue collected for

histopathology. After collection of swabs from the distal eustachian tubes via the nasopharyngeal

openings, the external ear canal, tympanic bulla and the eustachian tube were removed using a

reticulating saw. The distal portion of the eustachian tube was removed for histopathology. A

small (4x4mm) section of bone was removed aseptically from the most ventral aspect of the

tympanic bulla. Any exudate present within the bulla was aspirated for culture, and the tympanic

mucosa was swabbed.

Histopathology

Tissue samples were fixed in 10% neutral buffered formalin, embedded in paraffin wax

and sections (5 [tm) stained with hematoxylin and eosin. The ear was fixed in 10% neutral

buffered formalin, subsequently band-sawed through a line incorporating the rostral margins of

the insertion of the stylohyoid bone and the external auditory meatus, then trimmed and

decalcified for 24 hr prior to embedding. Histopathology was read in a blinded fashion without

knowledge of experimental groups or gross pathologic findings. Histopathology of the

eustachian tubes, nasal mucosa, tonsils, trachea, primary bronchi and lymph nodes was graded

on a scale from 1 (minimal to no lesions and/or lymphoid hyperplasia) to 3 (most severe lesions









and or lymphoid hyperplasia). In addition, tissues were graded with respect to numbers of plasma

cells present on a scale from 1 (minimal or no plasma cells) to 4 (large numbers of plasma cells).

Histopathology of the tympanic bullae and lungs was graded from 1 (minimal to no lesions) to

5 (most severe lesions), and lungs were also graded with respect to the degree of lymphoid

infiltration and hyperplasia of bronchial-associated lymphoid tissue from 1 (minimal to no

lymphoid hyperplasia) to 4 (marked and widespread lymphoid hyperplasia).

Microbiology

All mycoplasma cultures were performed in modified Frey's broth and agar medium

containing 2.25% (wt/vol) Mycoplasma broth base (Frey) (BD Diagnostic Systems, Sparks,

MD), 0.02% (wt/vol) DNA from herring sperm, 20% (vol/vol) horse serum, 10% (vol/vol) fresh

yeast extract, 0.5% (wt/vol) glucose and supplemented with 100,000 U/1 each of penicillin G and

polymixin B and 65 mg/1 of cefoperazone, with the final pH adjusted to 7.6 to 7.8. For culture of

blood samples, 5 ml of blood collected into tubes containing sodium citrate was inoculated into

45 ml of broth within 15 min after collection and subcultured onto agar at the time of broth

inoculation and after 48 hr incubation at 37C. Swabs were streaked on agar plates within 30 min

after collection and also used to inoculate broth, from which ten-fold serial dilutions were plated

(20 [tl) in duplicate on agar. When present, the volume of exudate aspirated from the tympanic

bulla was measured, a specified volume inoculated into broth and serial dilutions plated as

described. Spinal fluid was inoculated into broth and subcultured onto agar plates. Tissues

collected for quantitative culture were weighed and minced in broth from which ten-fold serial

dilutions were plated (20 [tl) in duplicate on agar.

Plates were incubated in 5% CO2 at 37C and examined at 2, 3, 5, 7 and 10 days for the

presence of mycoplasmal colonies. Colonies with typical morphology were classified as positive









pending polymerase chain reaction (PCR) confirmation. Two to eight single isolated colonies

were inoculated into separate aliquots of broth, incubated for 24 hours at 37C, and then stored at

-80C. In addition, when plates were positive for mycoplasmal growth, the original broth

dilutions were subcultured on agar to check viability and stored at -80C. Isolates were identified

as M bovis based on PCR of the 16SrRNA gene (Mattsson et al., 1991). DNA fingerprinting by

insertion sequence (IS) typing was performed (see below) to ensure that recovered isolates

originated from the F 1 strain used for inoculation.

Results for streaked plates were recorded as positive or negative for mycoplasmal

growth. Semiquantitative culture results for swabbed tissues were expressed as Logio of the

highest dilution that yielded mycoplasmal colonies. When only the undiluted broth was positive,

results were assigned a Logio value of 0.5. Quantitative culture results were expressed as CFU/g

of tissue or CFU/ml of exudate. Whole lung culture data represents an average of the six

standardized lung sites sampled and was calculated by summing the CFU isolated from all lung

sites and dividing this by the total weight of lung tissue sampled.

In addition to culturing for mycoplasma, swabs of the nares, palatine tonsils, trachea,

lungs and tympanic bullae were processed using routine clinical bacteriological methods to

identify other potential bacterial pathogens of the respiratory tract. Appropriate samples were

submitted to the Florida State Diagnostic Laboratory for diagnosis of bovine respiratory

syncytial virus, bovine viral diarrhea virus, infectious bovine rhinotracheitis virus, and

parainfluenza-3 virus.

Insertion Sequence Typing

Stored M. bovis broth cultures representing a single-colony expansion from each positive

site were thawed at room temperature. The inoculating isolate (M bovis Fl) was used as the

reference for hybridization profiles and the PG45 type strain ofM bovis used for probe









synthesis. Cells were harvested by centrifugation at 1500 x g for 30 min, rinsed twice with sterile

PBS and centrifuged at 10,000 x g for 15 min. Genomic DNA extractions were performed using

UltraClean Microbial DNA Isolation Kits (MO BIO, Carlsbad, CA) as per the manufacturer's

protocol. DNA was quantified spectrophotometrically and stored at -80C. Probes for the

insertion sequences ISMbov2 and ISMbov3 (Miles et al., 2005) were synthesized by PCR in a

50 [L reaction mixture which contained a final concentration of 40 ng ofM. bovis PG45

template DNA, 0.8 [M each of the forward and reverse primers, 1.5 mM MgCl2, 200 pM of each

dNTP with 70 jiM DIG-11-dUTP nucleotide mix and 3.5 U Taq enzyme (PCR DIG Probe

Synthesis Kit, Roche Applied Science, Penzberg, Germany). The primers used were ISMbov2-F

(GGTAAATCTAGTTCGAAGATG), ISMbov2-R (GGGTAAACAGAACTTGCAAC),

ISMbov3-F (CAGGAAATGTTACTGATTCA) and ISMbov3-R

(TTGTTTGCTTCCAGCTTTCA) (Miles et al., 2005). PCR conditions for probe synthesis were

3 min denaturation at 950C followed by 30 cycles of denaturation for 30 sec at 950, annealing for

30 sec at 550C for ISMbov2 or 500C for ISMbov3, extension for 1 min at 680C, and a 5 min final

extension at 680C.

Genomic DNA (4.5 to 5 jg) was digested with 20 U EcoRI (New England Bio Labs,

Inc., Ipswich, MA) overnight at 37C in a final volume of 30 [iL. The resulting fragments were

separated on 0.8% agarose gel by electrophoresis at 20 V for 18 to 20 hr. The ensuing gel was

depurinated and denatured then transferred to a nylon membrane (Nytran SPC, pore size

0.45 jm, Whatman, Inc., Florham Park NJ) using a vacuum blotting apparatus for 90 min

following the manufacturer's instructions (Bio-Rad Laboratories, Inc., Hercules, CA). After

transfer, the membrane was probed overnight at 650C. The ISMbov2 probe was diluted to

1.5 jg/ml of hybridization buffer (DIG Easy Hyb, Roche Applied Science, Penzberg, Germany)









per 100 cm membrane and the ISMbov3 probe was diluted to 2.0 pg/ml of hybridization buffer

per 100 cm2 membrane. After probing, the membrane was washed twice with low stringency

buffer (2X NaCl sodium citrate [SSC], 0.1% sodium dodecyl sulfate [SDS]) at room temperature

for 5 min with shaking and twice with high stringency buffer (0.5X SSC, 0.1% SDS) at 650C for

15 min with shaking. Blocking, washing and detection were performed using DIG Wash and

Block Buffer Set and DIG Nucleic Acid Detection Kit as per the manufacturer's protocols

(Roche Applied Science, Penzberg, Germany). Hybridization profiles were recorded digitally

(FluorChem 8900, Alpha Innotech, San Leandro, CA) and examined for differences in banding

patterns between the F 1 isolate used for inoculation and isolates recovered from tissues at

necropsy.

The ELISA Procedure

Blood samples were allowed to clot after collection, and then serum was harvested by

centrifugation and stored at -80C. Serum end-point titers of M. bovis-specific IgG were

determined using ELISA. Whole-cell lysate antigen (Schumacher et al., 1993) was prepared

from a 1 liter culture ofM bovis type strain PG45 grown at 37C in Frey's broth. The protein

concentration was determined using a colorimetric assay (Bio-Rad, Hercules, CA) and adjusted

to 100 [tg/ml. The antigen was stored in aliquots at -800C and thawed at room temperature when

required. The ELISA procedure was optimized using standard methodology. Microtiter plates

(Maxisorb F96, Nunc, Kamstrup, Denmark) were coated with 20 |tg per well of antigen in

0.01 M sodium phosphate buffer (pH 7.2) containing 0.15 M NaCl and (wt./vol.) NaN3 (PBS/A),

and incubated overnight at 40C. Plates were then washed three times with PBS/A containing

0.05% (vol./vol.) Tween 20 (PBS/T) using an automated plate washer (ELx405 Auto Plate

Washer, BioTek Instruments, Inc., Winooski, VT), blocked with 300 [tl per well of blocking









buffer (PBS/T containing 1% [wt./vol.] egg albumin), and stored at 40C for a minimum of 24 hr

or until needed. Two-fold serial dilutions of serum were made in blocking buffer and 50 [tl of

each dilution added to duplicate wells; plates were incubated at room temperature for 1 hr. The

highest serum dilution tested was 1:8,196. Plates were washed as described above and 50 [tl of

goat anti-bovine IgG conjugated to alkaline phosphatase (Bethyl Laboratories Inc., Montgomery,

TX) and diluted to 1:1,000 in blocking buffer was added to each well. Plates were incubated at

room temperature for 2 hr and then washed as described above. 100 [tl of 0.1% (wt./vol.)

p-nitrophenol phosphate was added to each well and plates incubated in the dark at room

temperature for 1 hr. The optical density (OD) in each well was read at a wavelength of 405 nm

using an automated plate reader (ELx808 Ultra Microplate Reader, BioTek Instruments, Inc.,

Winooski, VT). For each microtiter plate, the blank was the mean value for two wells coated

with antigen and incubated with the conjugated secondary antibody and substrate only. The

blank OD value was subtracted from each sample well, and mean values for each pair of

duplicate tests calculated.

Two-fold serial dilutions of a pool of sera from 20 calves with naturally occurring

mycoplasmal disease and high M bovis-specific IgG titers were included on each plate as a

positive control, as well as a 1:2 dilution of a negative control pool of serum collected from the

same 20 calves prior to ingestion of their first colostrum meal. The cutoff for a positive titer was

the average OD value (minus the blank) for the negative control sera plus two standard

deviations, established over ten assay runs. The highest dilution of the test serum that gave an

average OD value higher than the cutoff was defined as the titer for that sample. Within-batch

and between-batch assay variability was assessed by using the Youden plot graphic method

(Jeffcoate, 1982). The ELISA values obtained for the lowest, middle and highest dilution of the









control serum included on each plate were used to establish target values and control limits to be

used for monitoring the consistency of the assay (ten batches). The values obtained at the

beginning of a series of assays were plotted against the values obtained for the same standards at

the end of the series. If values for the pooled sera deviated more than 10% from target values, the

assay was repeated.

Statistical Analysis

Continuous variables (total serum protein concentrations, bodyweight, % of lung with

macroscopic lesions, serum IgG titers) were compared between groups using ANOVA or

repeated measures ANOVA (IgG titers). Tukey's tests were applied to post-hoc comparisons.

Ordinal variables (lesion scores, daily clinical scores) were analyzed using Kruskal-Wallace

ANOVA or Friedman Test, as appropriate. Correlations between numbers of mycoplasmas

isolated at various body sites were examined using Pearson's correlation analyses. A P value of

0.05 or less was considered statistically significant, with the exception of the overall significance

levels in ANOVA, where a P value of 0.1 was considered significant. Preliminary analyses

performed on data from the oral and transtracheal control groups determined that there were no

statistical differences between the 2 groups for any outcome variable. Data from the 2 control

groups were then pooled for the main analyses to increase statistical power. Analyses were

performed using commercial statistical analyses packages (SPSS 12.0, SPSS Inc, Chicago IL and

SAS/STAT, SAS institute, Inc., Cary NC).

Results

Oral Inoculation of Calves and Development of Clinical Disease

Oral inoculation of calves resulted in development of clinical disease. Prior to infection,

calves were monitored for their health and serology. Post-colostral total serum protein

concentrations, pre- and post-colostral M. bovis-specific serum antibody titers, and bodyweight









on day 0 did not vary between infected and control calves (data not shown). Most calves were

treated with oral electrolytes for uncomplicated calf diarrhea during the pre-enrollment period,

and there was no significant difference in the number of calves treated among groups. No

mycoplasmas or other respiratory tract pathogens were isolated from calves prior to enrollment,

and the calves were in good health at the time of infection.

Eight calves were inoculated orally, and five calves were inoculated transtracheally with

M. bovis Fl. As controls, four calves per route were inoculated with sterile carrier (Frey's broth

or sterile saline for the orally or transtracheally inoculated groups, respectively). The clinical

status of each calf was monitored twice a day. Three of the eight (37%) calves infected by the

oral route developed clinical signs of otitis media. These clinical signs were first observed on 7,

9 or 13 days post-infection, depending on the individual calf. Affected calves developed

unilateral or bilateral ear droops, occasional head-shaking and were mildly depressed or

lethargic. Two of the three calves developed ptosis. Calves with otitis media were febrile (rectal

temperature > 103F) on the day prior to (n 2) or on the day (n 1) that an ear droop was first

observed. In contrast to orally inoculated calves, clinical signs of otitis media were not observed

in any of the calves inoculated by the transtracheal route.

Six of the eight (75%) calves infected by the oral route exhibited clinical signs of LRT

disease. In most cases, clinical signs were transient and mild. However, two of the calves with

otitis media developed more serious LRT disease (mucopurulent nasal discharge, coughing,

intermittent tachypnea and dyspnea and persistent abnormalities of breath sounds on

auscultation), and one was euthanized at 10 days post-inoculation due to increasing severity of

clinical disease including persistent fever. None of the orally inoculated control calves exhibited

clinical signs of respiratory disease. Within the transtracheally inoculated group, four of the five









infected calves and two of the four control calves exhibited transient tachypnea and/or abnormal

breath sounds on auscultation in the first few days after inoculation. During the second week of

the study, control calves were all clinically normal, whereas three of five (60%) transtracheally

infected calves exhibited mild and transient clinical signs of respiratory disease (tachypnea,

abnormal breath sounds on auscultation, mucopurulent nasal discharge). Clinical signs of

arthritis were not observed in calves inoculated by oral or transtracheal routes. There was no

statistically significant difference among groups in median daily clinical scores. However, calves

that received M. bovis via the oral route tended (P = 0.06) to have more days when a daily

clinical score of > 2 was present than transtracheally inoculated or control calves (Figure 3-1).

Colonization of the Upper Respiratory Tract

The URT, and in particular, the tonsils, was a major site of colonization by M bovis.

Mycoplasma bovis was isolated from both palatine and pharyngeal tonsils of all inoculated

calves at necropsy (Figure 3-2A and B). Colonization at these sites tended to be heavier in orally

than transtracheally inoculated calves. Similarly, M. bovis was isolated from the eustachian tubes

of calves inoculated by either route, but the CFU recovered from the eustachian tubes were up to

105 times higher in orally than transtracheally inoculated calves (Figure 3-2C and D). Eustachian

tube colonization was bilateral in all cases except one. Large numbers (105 to 109 CFU/ml) of

M. bovis were isolated from both tympanic bullae of all three calves with clinical signs of otitis

media (Figure 3-2C). Once M bovis colonization of the bullae occurred, the CFU levels were the

highest achieved at any body site. M. bovis was not isolated from the bullae of orally inoculated

calves without clinical signs of otitis media or from any of the transtracheally inoculated calves.

In addition, M. bovis was isolated from the MRPLN of all except one of the infected calves

(Figure 3-2A and B). It is notable that despite heavy colonization of tonsils, M. bovis was only

isolated from nasal swabs of two calves over the complete course of the study (Figure 3-2A and









B), and then only on day 14 post-infection. No mycoplasmas were recovered from control

calves, nor were other bacterial or viral pathogens of the respiratory tract isolated from any calf.

All mycoplasmal isolates recovered from infected calves were confirmed to be M. bovis by PCR

sequencing of the 16S rRNA gene (data not shown) and had IS hybridization profiles consistent

with that of the Fl isolate used for inoculation (data not shown).

Isolation of M. bovis from Lungs and Clinical Signs of Respiratory Disease

Isolation ofM bovis from the lungs was associated with clinical signs of respiratory

disease in calves inoculated by the oral route. Four of the eight (50%) orally inoculated calves

were colonized in at least one LRT site (trachea, bronchi, TBLN and/or lung) at necropsy (Figure

3-2E to H). However, colonization was most extensive in the two calves that had more severe

clinical signs of respiratory disease, and importantly, these were the only orally inoculated calves

in which M bovis was isolated from the lungs (Figure 3-2G and H). In contrast, M. bovis was

isolated from the lungs of four of five (80%) transtracheally inoculated calves (Figure 3-2G and

H), but these calves only exhibited transient and mild clinical signs of respiratory disease.

M. bovis appeared to have been cleared from the LRT in one of the transtracheally inoculated

calves and was only recovered from URT sites (both tonsil sites and the MRPLN).

Colonization of the Tonsil and Development of Disease

The level of tonsil colonization was associated with the development of disease. The

Logio CFU ofM. bovis isolated from the pharyngeal tonsils was positively correlated with that

isolated from both the left (R2 = 0.74, P = 0.004) and right (R2= 0.72, P = 0.005) eustachian

tubes (Figure 3-3). In addition, the severity of lesions in the eustachian tube and in the tympanic

bullae was positively correlated with the number of mycoplasma isolated from the same site

(J. Powe, F. P. Maunsell, J. W. Simecka and M. B. Brown, submitted for publication). Similarly,









there was a trend (P = 0.11) for the number ofM. bovis isolated from the palatine tonsils to be

positively correlated with that isolated from the lungs (data not shown).

Gross and Histopathologic Lesions

Experimentally inoculated calves had gross and/or histopathologic lesions typical of

M. bovis infection. In nasal passages, there was little evidence of inflammation or other

pathologies in either orally or transtracheally inoculated calves, and histopathologic scores of

nasal passages were no different than those from control calves. There was also no difference

among groups in histopathologic scores of pharyngeal tonsils. Histopathologic scores of the

palatine tonsils of infected calves tended to be higher than those of control calves, but these

differences were not statistically significant (P = 0.1).

All three calves with clinical signs of otitis media had bilateral suppurative otitis media at

necropsy (Figure 3-4). There was an obvious purulent discharge from the nasopharyngeal

opening of the eustachian tube from one of these calves, but other gross abnormalities of the

URT were not observed. As indicated above, these calves with otitis media were inoculated

orally with M bovis, and the pathology is fully characterized in a companion paper (J. Powe,

F. P. Maunsell, J. W. Simecka and M. B. Brown, submitted for publication). Importantly, there

was no evidence of eustachitis or middle ear disease in transtracheally inoculated calves.

There were histopathologic changes in the lymph nodes draining the URT of calves after

mycoplasma inoculation. In orally inoculated calves, histopathologic scores for both MRPLN

and LPRLN were higher (P < 0.05) than those of control calves (Figure 3-5A and B). Lymphoid

hyperplasia, edema and focal areas of necrosis and suppurative lymphadenitis were observed in

these lymph nodes (Figure 3-6). Transtracheally infected calves tended to have higher scores

than control calves (Figure 3-5A and B) but these differences were not statistically significant.

As part of the overall histopathologic score, lymphoid tissues were graded based on the number









of plasma cells present. Plasma cell subscores for MRPLN and LRPLN were significantly higher

in infected calves when compared with control calves, regardless of the route of inoculation

(Figure 3-5C and D).

In the LRT, neither orally nor transtracheally inoculated calves had significant gross or

histopathologic lesions in tracheal or primary bronchial mucosa. Focal areas of consolidation and

pneumonic lesions were observed in the lungs of four of eight (50%) orally inoculated and four

of five (80%) transtracheally inoculated calves (Figure 3-7), although there was no statistically

significant difference in the percentage of visibly affected lung among groups. In contrast,

histopathologic lung lesion scores differed among groups (P < 0.05); calves infected by the

transtracheal route had higher lung lesion scores when compared with control calves (Figure 3-

8A). Calves from which M bovis was isolated from the lung had focal areas of suppurative or

non-suppurative broncho- or bronchointerstitial pneumonia, sometimes with foci of coagulative

necrosis surrounded by a mixed inflammatory cell population (Figure 3-8D). These calves also

had areas of bronchiolitis with peribronchial infiltration of lymphocytes, plasma cells and

macrophages, often accompanied by suppurative bronchial exudates. The bronchiolar changes

were mostly limited to small airways. Subscores for lymphoid hyperplasia in lungs were

significantly higher (P < 0.05) in both orally and transtracheally inoculated calves than in control

calves (Figure 3-8B). In contrast to the findings for the lymph nodes in the URT,

histopathological scores or plasma cell subscores for tracheobronchial lymph nodes did not vary

significantly among groups (data not shown).

Immunoglobulin Response

Orally infected calves exhibited aM. bovis-specific serum IgG response. It is important

to note that some M bovis-specific Ig was passively transferred via the colostrum substitute fed

to the calves, and, therefore colostral-derived antibody to M bovis was detected at day 0. While









the titer of passively-acquired serum IgG in control calves either remained static or declined over

the study period, the titer ofM. bovis-specific serum IgG in infected calves remained stable or

increased (Figure 3-9), indicating an active immune response to infection in these animals. When

the fold-change in M bovis specific serum antibody titers between days 0 and 14 of the study

were compared among groups, calves in the orally infected group had a significant fold-increase

in IgG (P = 0.049), compared with the control group. Calves infected by the oral route exhibited

a stronger serum IgG response than calves infected by the transtracheal route, although there

were individual calf variations.

Discussion

We have definitively demonstrated that bucket nursing of milk containing M. bovis does

result in colonization of the URT of young calves and can cause clinical disease. Despite the fact

that ingestion ofM. bovis-contaminated milk or colostrum is thought to be a major route of

natural infection in young calves (Bennett and Jasper, 1977c; Walz et al., 1997; Brown et al.,

1998a; Butler et al., 2000), experimental infection by this route has not previously been reported.

Other investigators have reported that calves allowed to nurse cows with M bovis mastitis

develop URT colonization and/or M bovis-associated clinical disease (Stalheim and Page, 1975;

Bennett and Jasper, 1977c), and colonization of the URT by M. bovis occurs more frequently in

calves fed infected milk than in those fed uninfected milk (Bennett and Jasper, 1977c). Reports

of a strong temporal association between the feeding of milk containing M bovis and disease

outbreaks have added support to the hypothesis that contaminated milk is a means by which

infection is introduced into a group of calves (Dechant and Donovan, 1995; Walz et al., 1997),

although direct contact with infected animals and secondary transmission through respiratory

aerosols or fomites are also likely to play a significant role in calf-to-calf spread. Because our

model mimics an important natural route ofM. bovis infection, it will facilitate studies of host









and pathogen-related events that are relevant to natural infection in young calves, especially

those events involved in colonization of the URT and dissemination from the URT to the LRT

and/or middle ear. In addition, experimental verification that calves fed contaminated milk do

become colonized with M bovis lends support to control measures aimed at eliminating M. bovis

contaminated milk and colostrum from calf diets.

Using the oral route of inoculation, our model resulted in colonization of the eustachian

tubes with M bovis in seven of eight inoculated calves, with otitis media developing in 37% of

calves by 2 weeks post-infection. The clinical signs of otitis media observed in naturally infected

calves include fever, anorexia, listlessness, ear pain evidenced by head shaking and scratching at

or rubbing ears, epiphora, and ear droop and other signs of facial nerve paralysis (Walz et al.,

1997; Brown et al., 1998a; Maeda et al., 2003; Francoz et al., 2004). In some cases, purulent

discharge from the ear canal is observed following rupture of the tympanic membrane (Walz et

al., 1997; Francoz et al., 2004). Secondary complications such as otitis internal (Lamm et al.,

2004) and meningitis (Francoz et al., 2004) can occur. In addition, calves with M bovis-induced

otitis media often have concurrent pneumonia (Walz et al., 1997; Maeda et al., 2003; Lamm et

al., 2004). With the exception of rupture of the tympanic membrane and secondary

complications of otitis media, all of the clinical signs reported in natural infections were

observed in our experimentally infected animals, providing support for the validity of the oral

route of infection in our model system. The more severe sequelae, which were not observed in

calves in this study, are most frequently associated with chronic otitis media, and under our

protocol, calves were euthanized prior to reaching this stage of disease. Otitis media in our

experimentally infected calves was shown to be histopathologically similar to natural disease and

was likely due to an ascending infection through the eustachian tubes (J. Powe, F. P. Maunsell,









J. W. Simecka and M. B. Brown, submitted for publication). Thus, the clinical signs and

pathology observed in our study is consistent with that described for naturally occurring M

bovis-induced otitis media in young calves.

Clinical signs of LRT disease were observed in six of eight calves inoculated by the oral

route. Although clinical signs were mainly transient and mild, two calves developed more

serious LRT disease and these were the only calves from which M. bovis was recovered from the

lung at necropsy. Histopathological lesions in these calves were consistent with other reports of

naturally occurring and experimentally induced M bovis pneumonia (Rodriguez et al., 1996;

Maeda et al., 2003). Interestingly, there was little gross or histopathological evidence of

tracheitis or lesions involving large bronchi in inoculated calves, even when M. bovis was

recovered from these sites. Large airway lesions are reported to accompany field cases of

mycoplasmal pneumonia (Dungworth, 1993), although it may be that these lesions do not

develop until later in the course of disease, that they require the presence of other pathogens, or

that they are not a prominent feature ofM bovis infection in this age animal.

Variable disease expression is a key feature of mycoplasmal infections in general

(Rosengarten et al., 2000), including M bovis (Gourlay and Houghton, 1985; Allen et al., 1991).

Consistent with this feature of the naturally occurring disease, 37% of the orally inoculated

calves in our model developed clinical otitis media and 75% exhibited mild, transient clinical

signs of respiratory disease. Although inoculation of a larger dose ofM. bovis may have resulted

in increased severity or incidence of clinical disease and/or pathology, we selected our inoculum

dose to be biologically relevant in order to mimic naturally occurring disease as closely as

possible. The dose utilized in our model was a total of 2.9 + 2.5 x 1010 CFU over 3 milk

feedings, which equated to approximately 106 CFU/ml of milk replacer. Concentrations of









M. bovis in mammary secretions of infected cows vary markedly, but are frequently 106 CFU/ml

or greater (Jasper, 1981; Fox and Gay, 1993). In pilot studies, we found that repeated exposure to

106 CFU of M. bovis per ml of milk was necessary to achieve colonization of the URT in all

inoculated calves (data not shown).

Variation in disease expression may also have been influenced by genetic variability

among calves; this is a potential disadvantage of using an outbred host in an experimental

infection model. However, there are currently no suitable alternative inbred laboratory animals in

which to model M. bovis infection of young calves. An additional factor that is likely to have

contributed to the variable disease expression observed in our study is that calves were

euthanized on or prior to 14 days after infection. This infection period was chosen because we

are primarily interested in studying the immunological events that occur early in infection.

However, several calves without otitis media did have colonization of the eustachian tubes at

necropsy, but with lower CFU ofM. bovis recovered than those with otitis media. Given the

direct correlation between CFU in tonsils, eustachian tubes and the bullae, it is likely that a

longer infection period would result in increased numbers ofM. bovis in these sites with a

concomitant increased rate of otitis media in this model. Increasing the length of the infection

period may also result in an increase in the rate and severity of LRT disease, although further

studies would be required to determine this.

The URT, and in particular, the tonsilar mucosa was an important site of colonization

following oral inoculation ofM bovis in this study. In fact, both the palatine and pharyngeal

tonsils of all inoculated calves were colonized with M bovis at the time of necropsy. Our

findings are consistent with studies of naturally occurring M bovis infection in calves that have

suggested that the URT is the initial site of colonization (Bennett and Jasper, 1977c; Brys et al.,









1989). We found that the number ofM. bovis recovered from the tonsils was correlated with the

presence of clinical disease. It is intriguing to hypothesize that control strategies specifically

aimed at limiting growth ofM bovis in tonsils may be effective in preventing clinical disease,

and this oral inoculation model could be applied to evaluate such potential control measures.

Additionally, we found that the tonsils of infected calves can be heavily colonized with M bovis

without the microorganism being recovered from deep nasal swabs, suggesting that, although

more technically challenging to obtain, tonsil swabs may be a better choice for determining the

true M bovis colonization status of an animal. Our tonsil swabs were obtained at necropsy which

eliminated the difficulties of obtaining good access to the sampling site; further studies will be

required in live animals of various ages to determine the usefulness of tonsil swabs for

determining the M bovis status of an animal in a clinical setting. Once colonization of the URT

occurs, a variety of factors are likely to influence dissemination from this site and development

of disease; these may include virulence factors expressed in vivo by M. bovis, the host immune

response, the frequency and dose of exposure, the presence of other pathogens and various

environmental factors. The use of our model to obtain a better understanding of these factors

may lead to improved preventative strategies against this disease.

Calves inoculated with M. bovis by either the oral or transtracheal routes exhibited local

and systemic immune responses to infection. Both transtracheally and orally inoculated calves

had increased lymphoid hyperplasia in the lymph nodes of the URT and in the lungs when

compared with control calves, consistent with an active response to infection. Calves inoculated

by the oral route had a higher serum IgG response than calves infected by the transtracheal route,

despite the presence of significant histopathological lung lesions in the latter group. Although

there did appear to be a trend for serum IgG titers to M. bovis to increase over the 14 day









infection period in transtracheally inoculated calves (Figure 3-9), they were not statistically

different from the control group. The difference in IgG response between orally and

transtracheally inoculated calves may reflect differences in inoculation dose between the two

groups, or could indicate that a M. bovis infection of the URT stimulates a stronger humoral

response than one which originates primarily in the LRT.

Calves infected transtracheally did become colonized in the URT, presumably by ciliary

transport of organisms up the trachea. However, the numbers ofM. bovis recovered from URT

sites were usually fewer than for orally inoculated calves, and transtracheally inoculated calves

did not develop otitis media. These findings indicate that oral inoculation is better suited to study

of events occurring during M. bovis infection of the URT and middle ear than a model where

M. bovis is inoculated directly into the LRT. It was also interesting that transtracheally

inoculated calves had significantly greater lung lesion scores than orally inoculated calves,

despite exhibiting only mild and transient clinical signs of LRT disease. M. bovis was recovered

from the lung of four of the five transtracheally inoculated calves and only two of the eight orally

inoculated calves, suggesting that if lung colonization within 14 days of inoculation is the goal of

a particular experimental inoculation procedure then transtracheal route may be a better choice.

However, the host and pathogen events involved in dissemination from URT sites to the lung are

likely to be important in naturally occurring disease and may not be present in a model where

M. bovis is inoculated directly into the LRT.

In summary, we have developed a reproducible model ofM. bovis infection of the URT

that closely mimics naturally occurring M bovis infections in young (pre-weaned) calves. There

are important differences between very young calves and older cattle in terms of their immune

environment and the occurrence of middle ear infections. Therefore, an infection model that uses









a clinically relevant age group, especially when considering events leading to middle ear

infection, is likely to be critical when studying this emerging disease problem. Our study also has

direct clinical relevance by definitively demonstrating for the first time that calves consistently

become infected when they ingest M. bovis contaminated milk, and that calves can be colonized

heavily in the tonsils without M. bovis being detected on nasal swabs. The oral inoculation model

that we have presented here is particularly suited to the study of host-pathogen interactions

during initial colonization of the tonsils, expansion of infection and dissemination to the LRT

and middle ear. In addition, the model could be used to investigate potential new preventative or

control strategies, especially those aimed at limiting colonization of the tonsils and/or spread to

the middle ear.











CA 8
A
0
2 6-








6 0- EO-- *oooo 00000

Control Oral Transtracheal

Infection group


Figure 3-1. Number of days that calves had a daily clinical score of > 2. Calves were followed
for 14 days post-inoculation or until they reached criteria for euthanasia (*One calf
was euthanized at 10 days post-inoculation). The maximum daily clinical score was
10. Calves were inoculated with sterile carrier (controls, n=8) or with Mycoplasma
bovis by oral (n=8) or transtracheal (n=5) routes.














me -
* 0O

* 0 C


A

Q
.'<
0
Q


)lrn S -
z~ %Z~


* 0


0

S..
S
m 0


0
00oa


00 000 0

0 0

0
00 0 00
0


00


(KM IDOO


Figure 3-2. The number ofMycoplasma bovis recovered at necropsy. A) M bovis recovered
from upper respiratory tract sites (URT) for calves inoculated by the oral (n 8) route.
B) M. bovis recovered from URT sites for calves inoculated by the transtracheal (n=5)
route. C) M bovis recovered from middle ear sites for calves inoculated by the oral
route. D) M bovis recovered from middle ear sites for calves inoculated by the
transtracheal route. E) M. bovis recovered from lower respiratory tract (LRT) sites of
calves inoculated by the oral route. F) M. bovis recovered from LRT sites of calves
inoculated by the transtracheal route. G) M. bovis recovered from the lungs of calves
in the oral and transtracheal inoculation groups. H) The number of lung sites from
which M. bovis was recovered out of a total of 6 standard sites which were cultured (1
site per lung lobe) for calves in the oral and transtracheal inoculation groups.
Semiquantitative culture results are expressed as Logio of the highest dilution that
yielded mycoplasmal colonies. When only the undiluted broth was positive, results
were assigned a Logio value of 0.5. Quantitative culture results are expressed as
colony forming units (CFU)/g of tissue (lung) or CFU/ml of exudate tympanicc
bullae). No mycoplasmas were recovered from control calves (data not shown). Pha
Tonsil = pharyngeal tonsil,


0
0acm


^













S 6.

4"

S 42-

0-
a 2













5-

U 4-

&o 3-
S 2'

i 1.

S0'


2-


0-




6-







S 4-




0
c 0-


Transtracheal


Infection group


0


0
o o o
0 0 0

00 000 0
0 0 000


& &~s
Ni


00**



068666


Transtracheal


Infection group


Figure 3-2. (continued). Pal Tonsil = palatine tonsil, MRPLN=medial retropharyngeal lymph
nodes, LRPLN = lateral retropharyngeal lymph nodes, L ET = left eustachian tube,
R ET = right eustachian tube, L Bulla = left tympanic bulla, R Bulla = right tympanic
bulla, L Bronchus = left primary bronchus, R Bronchus = right primary bronchus,
TBLN = tracheobronchial lymph nodes, No. = number, Mb = Mycoplasma bovis.


S@ S


******
Oral











H 6- L ET
~6"
v RET


S4- -
Sv

o 2- D o

SV V U
0- 0 0 D

0 1 2 3 4 5

M. bovis (Loglo CFU) from pharyngeal tonsil

Figure 3-3. Relationship between the number of Mycoplasma bovis recovered from the left and
right eustachian tubes (L ET and R ET, respectively) and pharyngeal tonsils in calves
inoculated with M bovis by either the oral (n=8) or transtracheal (n=5) routes.
Culture results are expressed as Logio of the highest dilution that yielded
mycoplasmal colonies. When only the undiluted broth was positive, results were
assigned a Logio value of 0.5. No mycoplasmas were recovered from carrier
inoculated control calves (data not shown).







































C











Figure 3-4. Macroscopic lesions of otitis media in calves orally inoculated with Mycoplasma
bovis. A) Ventral aspect of the tympanic bulla reflected to reveal exudate. B) Caseous
exudate within a sagittal section of the tympanic bulla after tissue fixation. C) Syringe
containing suppurative exudate aspirated from the tympanic bulla.













b
****


DO


*000 -0-


Control Oral Transtracheal


b ab
**** -ee--


DDD


DDDD


Control Oral Transtracheal


Infection group


Infection group


b b
0

a 00



Control Oral Transtracheal


** 0
a -O0-88


00

00


***0


Control Oral Transtracheal


Infection group


Infection group


Figure 3-5. Histopathology of retropharyngeal lymph nodes from control calves (n 8) or calves
inoculated with Mycoplasma bovis by oral (n 8) or transtracheal (n 5) routes. A)
Histopathological lesion scores of medial retropharyngeal lymph nodes (MRPLN). B)
Histopathological lesion scores of lateral retropharyngeal lymph nodes (LRPLN). C)
Plasma cell subscores of MRPLN. D) Plasma cell subscores of LRPLN. Samples
were collected at necropsy (14 days post-infection except for one calf inoculated with
M. bovis by the oral route which had to be euthanized at 10 days post-infection).
Tissues were graded on a scale from 1 (minimal or no lesions or lymphoid
hyperplasia) to 3 (severe lesions and/or marked lymphoid hyperplasia) and from
1 (few plasma cells) to 4 (large numbers of plasma cells) for histopathologic scores
and plasma cell subscores, respectively. Data are represented as scores for individual
calves with the median value for the group indicated by a horizontal line.
abSuperscript letters at the top of each data column indicate significant (P < 0.05)
differences between groups.






































Figure 3-6. Representative histopathological findings in retropharyngeal lymph nodes of calves
inoculated with sterile carrier (controls) or with Mycoplasma bovis by oral or
transtracheal routes. A) Medial retropharyngeal lymph node of an infected calf.
Scattered small accumulations of neutrophils can be seen in this region of cortex,
indicative of focal lymphadenitis. Magnification x60. B) Lateral retropharyngeal
lymph node (LRPLN) of an infected calf with lymphoid hyperplasia. Magnification
x4. C) LRPLN of a control calf. Medullary sinuses contain scattered small
lymphocytes. Magnification x60. D) LRPLN of an infected calf. Medullary sinuses
contain large numbers of plasma cells and small and large lymphocytes.
Magnification x60.

























Figure 3-7. Representative macroscopic lung lesion in a calf experimentally infected with
Mycoplasma bovis by the oral route.















00
a-- -


00
AAA

CAA r @00

Control Oral Transtrachi


iu
A
CO)
3
ct
-o






cal




eal '


AAA ,-uu-- 0

M
ftftft0


Control


Oral Transtracheal


Figure 3-8. Histopathological findings in the lungs of calves inoculated with sterile carrier
(controls, n 8) or with Mycoplasma bovis by oral (n 8) or transtracheal (n 5)
routes. Samples were collected at necropsy (14 days post-infection except for one calf
inoculated with M bovis by the oral route which had to be euthanized at 10 days post-
infection). A) Overall histopathological lesion scores. B) Subscores for lymphoid
hyperplasia. Data in A and B are represented as scores for individual calves with the
median value indicated by a horizontal line. Tissues were graded on a scale from
1 (minimal or no lesions) to 5 (most severe lesions) and from 1 (no lymphoid
hyperplasia) to 4 (marked lymphoid hyperplasia) for lesion scores and lymphoid
hyperplasia subscores, respectively. aSuperscript letters indicate significant (P <
0.05) differences between groups. C) Representative histopathologic appearance of a
lung section with a lesion score of 1 (control calf). D) Representative histopathologic
appearance of a lung section with a lesion score of 5 (orally inoculated calf from
which M bovis was recovered from the lung). Magnification x 10.











3000-

2000-

1000-

0-
0 Inoculation Necropsy

Sampling time

Figure 3-9. Geometric mean end-point titers for Mycoplasma bovis-specific serum IgG. Calves
were experimentally inoculated with sterile carrier (n 8, solid white bars) or with
M. bovis by the oral (n 8, solid black bars) or transtracheal (n 5, hatched bars)
routes. Geometric mean end-point titers are shown at the time of inoculation (day 0)
and at necropsy (14 days post infection, except for one calf inoculated with M bovis
by the oral route which was had to be euthanized at 10 days post-infection).









CHAPTER 4
IMMUNE RESPONSES IN THE RESPIRATORY TRACT OF CALVES INFECTED WITH
Mycoplasma bovis

Introduction

Mycoplasma bovis is an important contributor to morbidity and mortality in pre-weaned

dairy calves, causing respiratory disease, otitis media and arthritis as well as some other less

common clinical manifestations (Stipkovits et al., 2001; Nicholas and Ayling, 2003; Francoz et

al., 2004; Lamm et al., 2004). In addition, M. bovis causes chronic respiratory disease and

arthritis in stocker and feeder cattle (Haines et al., 2001; Thomas et al., 2002a; Gagea et al.,

2006) and is a major mastitis pathogen in adult dairy cattle (Jasper, 1981; Fox et al., 2003;

Gonzalez and Wilson, 2003). One of the major routes of transmission ofM. bovis to young

calves is thought to be ingestion of contaminated milk from cows with M bovis mastitis

(Stalheim and Page, 1975; Pfutzner and Schimmel, 1985; Walz et al., 1997; Brown et al., 1998a;

Butler et al., 2000). Calf-to-calf transmission via aerosols, fomites and direct contact are also

likely to be important (Jasper et al., 1974; Bennett and Jasper, 1977c; Tschopp et al., 2001;

Nicholas and Ayling, 2003). Regardless of the route of exposure, M. bovis first colonizes the

upper respiratory tract (URT) (Bennett and Jasper, 1977c; Pfutzner and Sachse, 1996).

Colonization often occurs very early in life; during some M bovis-associated disease outbreaks

the majority of calves have been infected before 2 weeks of age (Brown et al., 1998a; Stipkovits

et al., 2000). Infection may remain localized, orM. bovis can disseminate to the lower

respiratory tract (LRT), middle ear, joints and/or other body sites where it may cause clinical

disease. Factors controlling dissemination ofM. bovis from the URT and clinical disease

expression are unknown.

Immune responses to M. bovis infections in young calves are poorly defined, despite the

fact that immunologic responses probably have the greatest impact on the progression of









mycoplasmal disease. Innate responses and mucosal antibody responses are critical for early

clearance and control of mycoplasmal infections (Cartner et al., 1998; Hickman-Davis, 2002).

Effective killing ofM bovis by phagocytes requires the presence of mucosal antibody,

particularly IgG2 (Howard, 1984). Early mucosal and serum antibody responses in young calves

infected with M bovis are characterized by high levels of IgGi and little IgG2, which is unlikely

to be optimal for clearance of the infection (Howard et al., 1980; Howard and Gourlay, 1983;

Howard et al., 1987c; Vanden Bush and Rosenbusch, 2003). Although antibody responses in

M. bovis infections have been defined, there is only limited data describing the lymphocyte

populations that contribute to adaptive immune responses in cattle, and virtually no data is

available from neonatal calves. Advances in the development of vaccines or other strategies to

prevent M bovis-associated disease in young dairy calves are likely require a better

understanding of the immune response to M bovis in this age group. In particular, the local

immune responses generated at the site ofM. bovis infection, as well as immune system events

leading to dissemination of infection, need to be defined in young calves.

Adaptive immune responses can protect from mycoplasmal respiratory infections (Taylor

et al., 1977; Cassell and Davis, 1978; Whithear, 1996; Thacker et al., 2000; Kyriakis et al., 2001;

Dedieu et al., 2005), including M bovis (Howard et al., 1987a; Nicholas et al., 2002). However,

immunity is often short-lived, and animals are susceptible to repeated infections (Bennett and

Jasper, 1978b). Vaccination against M bovis, Mycoplasma hyopneumoniae and Mycoplasma

pulmonis confers only partial protection from disease, as organisms are easily isolated from

challenged animals (Cassell and Davis, 1978; Howard et al., 1980; Thacker et al., 2000;

Nicholas et al., 2002). Although adaptive responses that are present prior to challenge may

afford some degree of protection, responses that develop after mycoplasmal infection often fail









to clear the organisms or prevent clinical disease. In fact, adaptive immune responses also

contribute to the development of disease.

Many mycoplasmal respiratory diseases are clearly immunopathologic. One of the

consistent characteristics of respiratory disease caused by a wide variety of mycoplasmal species

is the large accumulation of lymphoid cells along the respiratory tract, independent of the host

species (Simecka et al., 1992; Rodriguez et al., 1996). Both B and T cells accumulate in lungs of

affected calves (Howard et al., 1987c), in joints of calves with mycoplasmal arthritis (Gourlay et

al., 1976; Adegboye et al., 1996; Gagea et al., 2006) and in the mammary glands of cows with

M. bovis mastitis (Bennett and Jasper, 1977a; Seffner and Pfutzner, 1980). These findings,

together with similar findings in other host species (Jones and Simecka, 2003), suggest that

lymphocyte activation and recruitment to sites of mycoplasmal infection are important in the

development of pathology. Probably the best evidence for an immunopathologic response comes

from studies in laboratory rats and mice infected with M. pulmonis, where the number of T cells

recovered from the lungs is correlated with the severity of disease (Davis et al., 1982; Jones et

al., 2002). Immunodeficient (T cell deficient and severe combined immunodeficiency) mice or

T cell deficient hamsters develop significantly less severe mycoplasmal respiratory disease than

their immunocompetent counterparts (Keystone et al., 1980; Cartner et al., 1998). Importantly,

these changes in severity occur with little effect on the number of mycoplasmas in the lungs of

infected animals. Thus, the severity of mycoplasmal respiratory diseases is increased by an intact

T cell response. A similar phenomenon may occur in M. bovis infections; the accumulation of

lymphocytes at sites of infection together with reports of enhanced disease severity after

immunization for M bovis (Rosenbusch, 1998; Bryson et al., 1999) are certainly consistent with

the development of immunopathologic responses.









Specific T cell subsets have been associated with protective or immunopathologic

responses in M. pulmonis respiratory disease. In mice infected with M pulmonis, CD4+ T cells

are the major population contributing to lymphoid accumulations in the lungs and lymphoid

tissues of the LRT, and in vivo depletion of CD4+ T cells results in reduced severity of

M. pulmonis-induced pulmonary lesions but has no effect on the numbers of mycoplasmas in the

lungs (Jones et al., 2002). Thus, CD4+ T cells appear to exacerbate the severity of mycoplasmal

respiratory disease rather than resolving the infection. CD8+ T cells also contribute to the T cell

responses in mycoplasmal respiratory infections, but to a lesser extent than CD4+ T cells (Jones

et al., 2002). CD8+ T cells appear to play an immunomodulatory role in mycoplasmal disease.

Strains of rats that are resistant to M. pulmonis infections have a higher CD8+:CD4+ T cell ratio

in their lungs than do susceptible strains of rats (Davis et al., 1985). In vivo depletion of CD8+

T cells in mice results in a dramatic increase in the severity of mycoplasmal respiratory disease

that is independent of mycoplasma numbers in the lungs. Thus CD8+ T cells play a significant

role in modulating the inflammatory response against M pulmonis lung infections. The

interaction between CD8+ and CD4+ T cells is thought to have a major impact on the outcome of

M. pulmonis respiratory disease.

The T cell subsets involved in protective and immunopathologic responses in the lungs of

calves with M. bovis infection have not been defined. However, in goat kids experimentally

infected with M bovis, T cells predominated in lymphoid accumulations in the lungs, and CD4+

T cells were a greater contributor to these lesions than were CD8+ T cells (Rodriguez et al.,

2000). Although conducted in a different host species, the clinical disease and pathology were

similar to that reported for M bovis infection of calves. These findings suggest that activation of









CD4 T cells plays a prominent role in M. bovis infections, similar to findings reported for

M. pulmonis disease in mice.

y6 T cells are a major component of the bovine lymphoid population and can comprise up

to 40% of the circulating mononuclear cell population in young calves (Wilson et al., 1996;

Kampen et al., 2006). Distinct subpopulations of y6 T cells are present in calves and differ in

terms of their tissue distribution and function (Wyatt et al., 1994; Wyatt et al., 1996; Wilson et

al., 1998). The presence or absence of the surface molecule WC1 can be used to divide bovine y6

T cells into two major subpopulations. WC1 y6 T cells are CD3+ but do not express CD2, CD4,

or CD8 (MacHugh et al., 1997). Between 65 and 90% of circulating y6 T cells are WC1

(Blumerman et al., 2006; Kampen et al., 2006). WC1 T cells are also found in the white pulp of

the spleen, outer cortex of peripheral lymph nodes, mucosal associated lymphoid tissue,

epithelial layers of the gut and respiratory tract, and in skin (Clevers et al., 1990; Wilson et al.,

1999). In contrast, WC1- y6 T cells, which do express CD2 and CD8, represent a small

percentage of the circulating y6 T cell population (MacHugh et al., 1997), and a large percentage

of the y6 T cells in some tissues including the red pulp of the spleen and many mucosal epithelial

sites (Hedges et al., 2003). y6 T cells are thought to be important in early immune responses to a

broad range of antigens, and distinct y6 T cell subsets are likely to have unique functions in these

immune responses (Pollock and Welsh, 2002). In calves, WC1 T cells contribute to early

production of interferon-y during infection (Price et al., 2006) and are the major y6 T cell

population recruited to sites of inflammation (Wilson et al., 2002). Although the role of y6

T cells in M bovis infections has not been determined, preliminary data suggests that y6 T cells

contribute to the pathogenesis of murine mycoplasmal respiratory disease (J.W. Simecka,

personal communication).









The broad, long-term objective of our studies is to determine the immune and

inflammatory responses that impact the pathogenesis of and foster protection from bovine

mycoplasmal respiratory disease. Based on studies of mycoplasmal disease in laboratory rodents,

we hypothesize that the balance between beneficial and detrimental host responses during

M. bovis respiratory disease is a function of distinct T cell populations. The primary objective of

the work presented here was to characterize the B and T lymphocyte populations generated in the

URT and LRT of neonatal calves infected with M bovis. As described in Chapter 3, we have

defined a model forM bovis infection in young calves that uses feeding of M bovis in milk as

the means of inoculation. This model mimics natural infection of calves and results in consistent

colonization of the URT. Additionally, the model results in clinical disease expression in a subset

of infected calves by 2 weeks post-inoculation. In the current study, we use this model to define

the local lymphocyte responses to M. bovis infection in young calves and compare these findings

with calves infected by transtracheal inoculation.

Materials and Methods

Calves

The calves used for this study have been described in Chapter 3. Briefly, mycoplasma-

free male Holstein calves were obtained at birth and were fed two doses of a mycoplasma-free

colostrum-replacement product (AcquireTM, APC Inc., Ames, IA). Calves were maintained on

non-medicated milk replacer and had access to non-medicated calf starter pellets and fresh water

at all times. All procedures were conducted with the approval of the University of Florida (UF)

Institutional Animal Care and Use Committee.









Strain of M. bovis and Experimental Infection

Mycoplasma bovis F 1l, confirmed as M bovis by PCR and 16S rRNA sequence, is a field

strain isolated from a lung abscess in a calf with severe fibrinopurulent pneumonia and pleuritis.

A second passage culture was stored in aliquots at -800C and used for all infection studies.

The overall infection design is shown in Figure 4-1, and the details of the experimental

infections are provided in Chapter 3. Briefly, calves were experimentally infected between 7 and

11 days of age with an oral dose ofM. bovis Fl (total dose 2.9 + 2.5 x 1010 colony forming units

[CFU], infected group, n=8) or an identical volume of sterile modified Frey's broth (control

group, n=4) at each of three consecutive feedings over a 24 hr period. The inoculum was added

to milk replacer and bucket fed to calves. A second group of calves were infected via

transtracheal inoculation of a single dose of 3 x 109 CFU of M. bovis Fl in 20 ml of PBS

(infected group, n=5), or sterile PBS only (control group, n=4). A complete physical examination

was performed daily and calves were scored as to the presence of clinical signs of mycoplasmal

disease; the scoring system is described in Chapter 3.

At 0, 3, and 7 days post-infection, nasal swabs and blood were obtained for mycoplasmal

culture. Serum was collected for determination of specific immunoglobulin (Ig) subclass

responses to M. bovis. Blood was collected for determination of T cell populations by

immunofluorescent cell staining, and additional blood was submitted to the UF Clinical

Pathology Laboratory for total and differential leukocyte counts and measurement of plasma

fibrinogen and total protein concentrations using standard methodology.

Calves were euthanized at 14 days post infection, with the exception of one orally

infected calf that had to be euthanized 10 days post-infection due to severity of clinical disease.

At 14 days post-infection, calves underwent full necropsy protocols. The collection of samples









for culture and histopathology, and the assessment of gross lesions were as described in

Chapter 3. Histopathology of the eustachian (auditory) tubes, nasal mucosa, tonsils, trachea,

primary bronchi and lymph nodes was graded on a scale from 1 (minimal to no lesions and/or

lymphoid hyperplasia) to 3 (most severe lesions and or lymphoid hyperplasia). In addition,

tissues were graded with respect to numbers of plasma cells present on a scale from 1 (minimal

or no plasma cells) to 4 (large numbers of plasma cells). Histopathology of the tympanic bullae

and lungs was graded from 1 (minimal to no lesions) to 5 (most severe lesions), and lungs were

also graded with respect to the degree of lymphoid infiltration and hyperplasia of bronchial-

associated lymphoid tissue from 1 (minimal to no lymphoid hyperplasia) to 4 (marked and

widespread lymphoid hyperplasia). All scoring was done in a blinded fashion and the coding

system was broken for final data analysis.

Preparation of Mononuclear Cells from Blood and Tissues

To examine the changes in B and T lymphocyte populations in calves after infection with

M. bovis, mononuclear cells were isolated from blood samples collected at 0, 3, and 7 days post-

infection, and from lungs, tracheobronchial lymph nodes (TBLN), lateral retropharyngeal lymph

nodes (LRPLN), medial retropharyngeal lymph nodes (MRPLN), palatine tonsils, peripheral

blood and spleen samples at necropsy. Weights of whole organs and tissue samples were

recorded prior to processing. Heparinized blood was diluted 1:1 in Hank's balanced salt solution

(HBSS) and, using standard techniques, peripheral blood mononuclear cells (PBMC) were

isolated by centrifugation over Histopaque-1077 (Sigma-Aldrich, St. Louis, MO). Lymph node

and spleen mononuclear cells were isolated by teasing in HBSS, followed by centrifugation.

Spleen preparations were treated with ACK (ammonium chloride potassium) lysis buffer

(Quality Biological Inc., Gaithersburg, MD) to lyse erythrocytes then washed twice in HBSS.

Pulmonary mononuclear cells were prepared from at least 20 g of lung tissue pooled from two









sites in each of the six lung lobes. Lung was finely chopped in RPMI-1640 medium containing

1% (vol./vol.) IM Hepes solution (Sigma-Aldrich, St. Louis, MO), 1% (vol./vol.) Cellgro

Antibiotic-Antimycotic solution (Mediatech Inc., Herndon, VA), 1% (vol./vol.) L-glutamine,

10% (vol./vol.) gamma-free equine serum, 300 U/ml of DNase (Worthington Biochemical

Corporation, Lakewood, NJ) and 300 U/ml Type IV collagenase (Worthington Biochemical

Corporation, Lakewood, NJ). Lung preparations were incubated for 1.5 hr at 370C and were

vigorously pipetted every 20 to 30 min during the incubation period. Cells were separated from

debris by pouring through mesh and centrifuged over Histopaque-1077. Cells from the interface

were washed once in RPMI-1640 medium. Cells harvested from all sites were counted and re-

suspended in RPMI-1640 medium at the appropriate concentrations for the assays described

below.

Immunofluorescent Characterization of T Cell Populations

The proportions of CD3+CD4+ T cells, CD3+CD8+ T cells and WC1 y6 T cells in

mononuclear cell populations were determined using immunofluorescent staining and flow

cytometry. The monoclonal antibody (mAb) clones recognizing various bovine lymphocyte

surface molecules used were as follows: MM1A (CD3; VMRD Inc., Pullman, WA), CC88

(CD4; Serotech Inc., Raleigh, NC), CC63 (CD8; Serotech Inc., Raleigh, NC) and IL-A29 (WC1;

VMRD Inc., Pullman, WA). For detection, mAb were conjugated directly with fluorescein

isothiocyante (FITC) or phycoerythrin (PE) or were detected using a secondary FITC-conjugated

anti-mouse Ig (Southern Biotechnology Associates Inc., Birmingham, AL). Monoclonal

antibodies in staining buffer (PBS without calcium and magnesium containing 3% [vol./vol.]

gamma-free equine serum and 0.05% [vol./vol.] Tween 20) were added to 1 x 106 mononuclear

cells per tube at a final concentration of 5 [tg/ml. Cells were incubated on ice for 30 min and









washed once in staining buffer. When required, the secondary antibody was added to cell

preparations and samples were incubated on ice for a further 30 min then washed once in

staining buffer. Stained cell preparations were fixed in 2% paraformaldehyde for 30 min, then

resuspended in staining buffer and stored at 40C for a maximum of 18 hr prior to flow cytometry.

The samples were measured with a FACSCalibur flow cytometer (Becton Dickinson

Biosciences, Mountain View, CA) using standard methodology. Lymphocyte gates and detector

voltages were set using unstained cells from each tissue. Data were collected from 10,000 cells

per sample and the gate was set for lymphocytes. Analysis was performed with FCS ExpressTM

software (De Novo Software, Thornhill, Ontario, CA). The percentage of gated cells positive for

each cell surface marker combination was determined.

ELIspot Assay

To determine if the distribution of B cell responses correspond to the changes in T cell

populations, we developed an enzyme-linked immunospot (ELIspot) assay (Simecka et al., 1991)

to monitor the number of M. bovis-specific antibody forming cells (AFC) along the respiratory

tract. The assay was optimized using M bovis immunized mice, followed by testing in infected

calves. The number of cells producing M bovis-specific antibody (IgM, IgG and IgA) were

determined. A crude preparation of M. bovis Fl membranes was used as antigen in the ELIspot

assay and was prepared as previously described (Jones et al., 2002). Ninety-six well ELIspot

plates were coated with antigen at a concentration of 5 [tg/ml, incubated at 40C overnight,

washed three times in PBS and blocked with PBS containing 10% (vol./vol.) gamma-free equine

serum. Three concentrations of mononuclear cells (10 104, 103 cells/ml) were prepared for each

tissue to be analyzed, and 100 [tl of cell suspension was added to each well. Each sample was

analyzed in triplicate. Plates were incubated overnight in 5% carbon dioxide at 370C, then









washed three times in PBS containing 0.05% (vol./vol.) Tween 20. Polyclonal antibodies to

bovine IgG, IgM and IgA conjugated to horseradish peroxidase (Bethyl Laboratories,

Montgomery, TX) were diluted 1:2,000 in PBS containing 0.05% (vol./vol.) Tween 20 and

1% (vol./vol.) gamma-free equine serum. Primary antibodies were added to wells and plates

were incubated at 40C overnight. Plates were washed three times in PBS containing

0.05% (vol./vol.) Tween 20, and avidin-peroxidase diluted 1:1,000 in PBS containing

0.05% (vol./vol.) Tween 20 was added. Plates were incubated at room temperature for 2 hr, then

washed three times in PBS containing 0.05% (vol./vol.) Tween 20. Spots were developed using

the chromogenic substrate 3-amino-9-ethylcarbazole (AEC), plates were washed in water and

then air dried. Spots were counted manually under a stereomicroscope. Results were expressed

as the number of IgG, IgM or IgA AFC for the entire lymph node, per gram of lung or tonsil

tissue, or per milliliter of blood.

The ELISA Procedure

Blood samples were allowed to clot after collection, and then serum was harvested by

centrifugation and stored at -80C. Serum end-point titers of M. bovis-specific IgG1, IgG2, IgM,

and IgA were determined. All secondary antibodies were polyclonal, conjugated to alkaline

phosphatase (Bethyl Laboratories Inc., Montgomery, TX), and were used at a 1:1,000 dilution.

All other methods, incubation times, concentrations, controls and data acquisition were the same

as described for the IgG enzyme linked immunosorbent assay (ELISA) in Chapter 3. All serum

samples were tested in duplicate.

Nasal lavage was performed at necropsy with 40 ml of sterile PBS. Recovered lavage

fluids were centrifuged at 400 x g for 10 min, the cell fraction discarded and the supernatant

stored at -80C. Mycoplasma bovis-specific mucosal IgA, IgG, IgG1, IgG2, and IgM responses in









undiluted nasal lavage fluids were determined using an ELISA as described above. Total amount

of each isotype in nasal lavage fluids were calculated by coating microtiter plates (Maxisorb F96,

Nunc, Kamstrup, Denmark) with triplicates of serial 10-fold dilutions of lavage fluid in blocking

buffer (0.01 M sodium phosphate buffer [pH 7.2] containing 0.15 M NaCl, 0.02% NaN3, 0.05%

Tween 20 and 1% egg albumin). Serial dilutions of a standard bovine serum containing defined

concentrations of immunoglobulins (Bethyl Laboratories Inc., Montgomery, TX) were included

on the plate. Plates were incubated at 40C overnight, and isotypes were detected with secondary

antibodies as described for the standard ELISA. The concentration of each isotype in nasal

lavage samples was calculated from the curve created from the standard bovine serum. Results

for M. bovis-specific antibody levels were expressed as a ratio of the optical density (OD) units

to the concentration of total antibody for that isotype in the sample.

Statistical Analyses

Continuous variables were compared among groups using ANOVA or repeated measures

ANOVA. Tukey's tests were applied to post-hoc comparisons. Ordinal variables were analyzed

using Kruskal-Wallace ANOVA or Friedman Test, as appropriate. A P value of 0.05 or less was

considered statistically significant, with the exception of the overall significance levels in

ANOVA, where a P value of 0.1 was considered significant. Preliminary analyses performed on

data from the oral and transtracheal control groups determined that there were no statistical

differences between the two groups for any outcome variable. Data from the two control groups

were then pooled for the main analyses to increase statistical power. Analyses were performed

using commercial statistical analyses packages (SPSS 12.0, SPSS Inc, Chicago IL and

SAS/STAT, SAS institute, Inc., Cary NC).









Results

Isolation of M. bovis from Experimentally Infected Calves

Details on the isolation of M. bovis from various body sites are presented in Chapter 3

(see Figure 3-2) and will be briefly summarized here. All inoculated calves became colonized in

the URT, regardless of the route of infection. In the orally inoculated group (n=8), mycoplasmas

were isolated from the palatine tonsils, pharyngeal tonsils and MRPLN of all calves, from the

eustachian tubes of seven calves, from both tympanic bulla of three calves, and from the LRT of

two calves. In calves inoculated by the transtracheal route (n=5), M bovis was recovered from

the palatine and pharyngeal tonsils of all calves, from the MRPLN of four calves, from the

eustachian tubes of three calves, and from the LRT of four calves. There were no mycoplasmas

isolated from any of the control calves.

Clinical Disease and Pathology in Experimentally Infected Calves

Details on the clinical disease and pathology observed in inoculated calves are presented

in Chapter 3 and will be briefly summarized here. Clinical evidence of otitis media was observed

in three of the eight orally inoculated calves and none of the control calves. Transient and mild

clinical signs of LRT disease were observed in most of the orally inoculated calves and none of

the control calves. Two calves with otitis media developed more severe respiratory disease; one

calf with severe clinical signs of disease was euthanized at 10 days post-infection. Transtracheal

inoculation ofM bovis resulted in mild clinical signs of LRT disease in four of five infected

calves, and no clinical signs of otitis media.

Experimentally inoculated calves had gross and/or histopathological lesions typical of

M. bovis infection. Three of eight orally infected calves had suppurative otitis media. No gross

lesions of the URT were observed in calves that were inoculated by the transtracheal route.

Increased histopathological scores, lymphoid hyperplasia and increased numbers of plasma cells









were observed in the URT lymph nodes of infected calves (see Chapter 3, and Figures 3-4 and 3-

5 for more detail). Lymphoplasmacytic infiltrates were also observed in the tympanic mucosa of

calves with otitis media, and lymphocytes, plasma cells and histiocytes were present diffusely or

in large dense aggregates in the lamina propria of eustachian tubes from which M. bovis was

isolated (J. Powe, F. P. Maunsell, J. W. Simecka and M. B. Brown, submitted for publication).

Calves inoculated by the oral route had significantly (P = 0.041) heavier LRPLN at necropsy

than did control calves or calves inoculated by the transtracheal route (Figure 4-2), but weights

of MRPLN did not differ among groups.

Lymphocyte accumulations were also a key feature of histopathology observed in the

lungs. The lungs of calves infected by either route had significantly (P < 0.05) greater lymphoid

hyperplasia compared with lungs of control calves (data shown in Chapter 3; see Figure 3-8 for

details). In addition, in calves from which M. bovis was isolated from the lung, lymphocytes

were a prominent component of the peribronchiolar and parenchymal cellular infiltrate in sites of

lung pathology. In contrast to the findings for the lymph nodes in the URT, histopathologic

scores or plasma cell sub scores for TBLN did not vary significantly among groups (data not

shown). However, TBLN of transtracheally inoculated calves were significantly (P = 0.049)

heavier than those of control calves or calves inoculated by the oral route (Figure 4-2).

Complete Blood Counts and T Cell Responses in Peripheral Blood and Spleen

There were no significant differences among groups at any of the sampling times in total

leukocyte, lymphocyte, segmented neutrophil or monocyte counts or in the relative proportions

of these cells in peripheral blood (data not shown). Likewise, there were no significant

differences among groups in total plasma protein concentration or plasma fibrinogen

concentration at any of the sampling times (data not shown). There were also no differences









among groups in the percentages of CD4 CD8 or WC 1 y6 T cells in mononuclear cells from

peripheral blood at any of the sampling times, or from spleen collected at necropsy (Figure 4-3).

T Cell Populations in the URT and LRT

Both CD4+ and CD8+ T cell responses were observed in the URT of calves at 14 days

after M bovis infection. CD4+ T helper (Th) cells were the major responding T cell population in

the tonsils of orally inoculated calves, whereas the proportion of CD8+ T cells was increased in

the MRPLN (Figure 4-3). The relative proportion of CD4+ and CD8+ T cells in the URT of

transtracheally inoculated calves were lower than those observed in orally inoculated calves.

There was a tendency (P = 0.089) for an increase in the percentage of CD4+ T cells in the tonsils

of the transtracheally inoculated group compared with control calves, but responses in the URT

lymph nodes were no different than those of control calves. The percentage of WC 1 y6 T cells

in URT tissues at necropsy was not affected by infection via either route as there were no

differences among groups (Figure 4-3). In a limited number of cases, low cell recovery from

specific tissues and some sample loss precluded complete analysis.

There was little difference between calves infected with M. bovis and control calves in

the relative proportion of CD4+, CD8+ and WC1 y6 T cells in the TBLN or lungs (Figure 4-3).

CD4+ Th cell responses in the TBLN of calves inoculated by the transtracheal route were highly

variable and ranged from 24% to 60% (Figure 4-3).

B cell and Antibody Responses

The URT was the major site of mycoplasma-specific B cell responses in orally inoculated

calves (Figure 4-4). Using the M bovis-specific ELIspot assay, the numbers of mycoplasma-

specific AFC were determined in URT (LRPLN and MRPLN) and LRT (TBLN) lymph nodes,

lungs, peripheral blood and spleen samples. Not all tissues were analyzed for every calf due to









low cell recovery from some tissues and some sample loss. As shown in Figure 4-4, M. bovis-

specific B cell responses were observed in both the URT and LRT of orally inoculated calves.

However, the URT had a much greater increase in the number of mycoplasma-specific AFC

(IgM, IgG and IgA) than did the LRT. Calves infected by the transtracheal route had

significantly (P < 0.05) higher numbers of IgG and IgA AFC in LRT sites when compared with

orally inoculated and control calves (Figure 4-4). Mycoplasma bovis-specific B cell responses

were also observed in the URT lymph nodes of calves inoculated by the transtracheal route, but

responses were of a lesser magnitude than those observed for orally inoculated calves.

In agreement with the ELIspot data, orally inoculated calves had increased levels of

M. bovis-specific IgA in nasal lavage fluids, compared with control or transtracheally inoculated

groups (Figure 4-5). Orally inoculated calves also tended (P = 0.11) to have higher levels of

M. bovis-specific IgGi in nasal lavage fluids than did control or transtracheally inoculated calves,

although this response was highly variable. Specific M bovis IgG2 responses were not observed

in nasal lavage fluids of orally or transtracheally inoculated calves. Orally inoculated calves had

higher concentrations of total IgM in nasal lavage fluids than did other groups (Figure 4-5),

whereas transtracheally inoculated calves had statistically higher (P = 0.02) concentrations of

total IgG2 in nasal lavage fluids than did control or orally inoculated calves (Figure 4-5).

Calves with otitis media tended to have higher M bovis-specific IgGi responses and

higher total IgM responses in the URT than did orally inoculated calves without otitis media;

total and M bovis IgG2 and IgA responses were similar for calves with and without otitis media

(Figure 4-6). Calves with otitis media also tended (P = 0.15) to have higher M bovis-specific

IgGi:IgG2 ratios in nasal lavage fluids than did other study calves, although there was inadequate

statistical power to detect significant differences (Figure 4-6).









Experimentally infected calves exhibited a M. bovis-specific serum Ig response that was

evident 14 days after infection (Figure 4-7). Antibody to M bovis was detected at day 0,

indicating passive transfer of specific Ig via the colostrum substitute fed to the calves. While the

titer of passively-acquired serum IgGi in control calves remained static over the study period, the

titer of M. bovis-specific serum IgGi in infected calves remained stable or increased, suggesting

an active immune response to infection in these animals. There was a large amount of variation

in individual titers in all groups, and any differences in M bovis-specific serum IgGi titers

among groups over the course of the study were not statistically significant. When the fold-

change in M bovis-specific serum antibody titers between days 0 and 14 of the study were

compared among groups, calves in the orally infected group had a significant fold-increase in

IgGi (P < 0.001) compared with the control group. Transtracheally infected calves also had a

significant fold-increase in IgGi titers (P = 0.015), when compared with the control group. In

addition to the IgGi response, a trend for an increase in serum IgA titers is apparent in infected

calves over the course of the study, but no significant differences were detected among groups.

Serum IgM responses followed a similar pattern as the serum IgGi and IgA, but responses were

more marked, with the titer ofM. bovis-specific serum IgM being significantly higher (P = 0.01)

in orally infected calves than in transtracheally infected or control calves at necropsy. In contrast

with the orally infected group, no differences were detected in serum IgM responses between the

transtracheally inoculated group and the control group. Low post-colostral IgG2 titers toM. bovis

were observed in both control and infected calves, and no serum IgG2 response was observed to

M. bovis infection. Overall, calves infected by the oral route exhibited a greater serum antibody

response than calves infected by the transtracheal route, although there were individual calf

variations.









Discussion

Accumulation of lymphoid cells at the local site of infection was a key feature of the

histopathological findings in calves inoculated with M bovis by the oral or transtracheal routes.

Draining lymph nodes at the major sites of respiratory tract infection were enlarged, supportive

of a local immune response at those sites. In calves inoculated by a natural route through feeding

ofM. bovis-inoculated milk replacer, the URT was the major site of T cell immune responses,

and both CD4+ and CD8+ T cell responses were observed in URT lymphoid tissues. Thus the

major site of T cell responses corresponded to the major site of infection in orally inoculated

calves. Our findings are consistent with the development of predominantly an URT disease and

an accompanying local immune response after oral inoculation. Other investigators have reported

that CD4+ and CD8+ T cells in PBMC of calves experimentally inoculated with M bovis

exhibited higher in vitro activation (CD25 expression) in response to M. bovis antigens than did

cells from uninfected control calves, suggesting that these cell populations are responding to

infection (Vanden Bush and Rosenbusch, 2003). Our results indicate that in local lymphoid

tissues, both CD4+ and CD8+ T cells are responding during the early stages ofM bovis infection

by a natural route. Thus, both of the major T cell populations are likely to contribute to the

immune responses in the URT, similar to studies in murine mycoplasma respiratory disease

(Jones et al., 2002).

In contrast with calves inoculated by the oral route, significant changes in the relative

proportions of T cell subpopulations were not observed in calves inoculated by the transtracheal

route, despite a significant increase in the weight of TBLN and a substantial contribution of

lymphocytes to lung lesions in transtracheally inoculated calves. There are several possible

explanations for these data: expansion of lymphoid populations could have occurred without

changes to the relative proportions of the three major T cell subpopulations, our small sample









size may have precluded finding significant differences if such differences did exist, or the

lymphoid expansion may have been due to other cell populations (e.g. B cells, NK cells). Other

investigators (Rodriguez et al., 2000) found that CD4+ T cells were the major T cell population

contributing to M. bovis-induced lung lesions in infected goat kids by immunohistochemical

staining of affected lung, but the relative proportions of T cell subpopulations in infected and

control kids were not reported.

There was no significant change in WC1 y6 T cell populations in either URT or LRT

tissues of infected calves, suggesting that this population does not undergo preferential

expansion during early M. bovis infection. Other investigators have shown that in young calves,

WC1 y6 T cells are recruited to sites of epithelial inflammation (Wilson et al., 2002) and

contribute to local immune responses in other respiratory diseases (Price et al., 2006). No

substantial recruitment of WC1 y6 T cells was observed in lungs or palatine tonsils of infected

calves. We did not examine T cell responses within the epithelium of the URT, so whether WC1

y6 T cells contribute to M bovis responses at the level of the epithelium was not determined.

The presence of large numbers of plasma cells at the local site ofM bovis infection was a

prominent feature of the histopathological findings in calves inoculated by the oral or

transtracheal routes. Consistent with this finding, we observed that local B cell responses in the

respiratory tract of calves experimentally inoculated with M. bovis corresponded to the site of

infection. The URT was the major site ofM. bovis-specific B cell and mucosal IgA responses in

calves inoculated by the oral route, while the LRT was the major site of B cell responses in

transtracheally inoculated calves. Calves infected by the transtracheal route did have significant

B cell responses in the URT lymph nodes, which was not surprising given that all calves became

colonized with M bovis in the URT. However, responses were not as marked as those for orally









infected calves, corresponding well with the level of colonization observed in the two infection

groups.

Interestingly, calves inoculated by the oral route had significantly higher numbers of

mycoplasma-specific AFC in the LRT than uninfected calves. This suggests either the

beginnings of an adaptive immune response developing in the lungs or, more likely, immune

cells from the URT are migrating to other tissues. In support of tissue migration, occasional

mycoplasma-specific AFC were found in the blood and spleen of orally inoculated calves (data

not shown), demonstrating the presence of circulating cells.

Taken together, our data demonstrate that B cells responses, similar to changes in T cell

populations, are preferentially found at the site of infection and are likely to play a role in disease

progression. There are also indications that the B cell responses in the URT may augment

responses in the lung and other tissues.

The ratio of IgGi:IgG2 is often used to indicate Thl- or Th2-biased responses in cattle

(Brown et al., 1998c). Calves with otitis media tended (P = 0.15) to have higher local M. bovis-

specific IgG1:IgG2 ratios that did other calves inoculated with M bovis by the oral route,

suggesting that these calves had a more Th2-biased response than did calves without otitis

media. Three of four calves with the highest M bovis-specific IgG1:IgG2 ratios had otitis media,

and the fourth calf had the highest level of eustachian tube colonization without concurrent otitis

media of any calf in the study (data not shown). In addition, the one transtracheally inoculated

calf that cleared M bovis infection from the LRT was the calf with the lowest M bovis-specific

IgG1:IgG2 ratio; this calf also had the highest total IgG2 concentration in nasal lavage fluids of

any calf in the study (0.512 [tg/ml). Although the data was obtained from a relatively small

number of animals, these data support the idea that a local Thl-biased (IgG2) antibody response









may preferable to a Th2-biased response in clearing or controlling mycoplasmal infections. Thus,

more extensive studies to define the role of Thl local responses in protection are warranted.

The MRPLN and LRPLN of calves infected with M. bovis by the oral route showed

different immune responses. No differences between groups were observed in the weight of

MRLPN, whereas LRPLN of infected calves were heavier than those of control calves. There

were significant increases in the proportion of CD8+ T cells and in B cell responses in both

lymph nodes, but B cell responses were much more marked in the LRPLN than in the MRPLN.

Both lymph nodes drain the oro- and nasopharynx as well as the middle ear, but the MRPLN

receives a greater proportion of lymph drainage from the nasopharynx including the pharyngeal

tonsils, while the LRPLN receives a greater proportion of lymph from the oropharynx including

the palatine tonsils (Pasquini, 1983). Our findings may reflect differences in the level ofM. bovis

colonization within the drainage field of each lymph node, or could be consistent with different

roles for the MRPLN and LRPLN in M bovis infections. In any event, future studies should take

into account the fact that considerable differences can exist in the immune responses within these

two lymph nodes.

Our findings support the hypothesis that local and systemic immune responses generated

using the transtracheal approach differ from those generated after oral inoculation. Overall, our

data support the idea that local immune responses within the respiratory tract are important in

disease pathogenesis. Further comparison of immune responses generated after primary infection

of the URT to those generated in the LRT will help to discern the relative contributions of these

sites during mycoplasmal disease. These local responses will also be important considerations in

the development of new vaccination strategies against M bovis.


















I II I I
Birth 0 3 7 14
S 7-11 days 4
Pre-infection Days post-infection

Figure 4-1. Overall experimental design for the infection study. Calves were infected between
7 and 11 days of life. Calves were sampled at infection (day 0), post-infection days
3 and 7, and at necropsy (post-infection dayl4, except for one calf inoculated with
Mycoplasma bovis by the oral route which had to be euthanized at 10 days post-
infection). Ig = immunoglobulin; PB = peripheral blood.


* Culture forM. bovis (blood and nasal swabs)
* M. bovis-specific serum Ig
* PB leukocyte profile and plasma fibrinogen
* PB T cell subsets
















-I-


I I I
Control Oral Transtracheal

MRPLN


Control Oral Transtracheal


LRPLN


Control Oral Transtracheal

TBLN


Figure 4- 2. Weights (mean + SD) of upper and lower respiratory tract lymph nodes. A) Medial
retropharyngeal lymph nodes (MRPLN). B) Lateral retropharyngeal lymph nodes
(LRPLN). C) Tracheobronchial lymph nodes (TBLN). Weights for left and right
retropharyngeal lymph nodes were combined for each calf. abSuperscript letters
indicate significant (P < 0.05) differences between control calves (n=8), and calves
inoculated with Mycoplasma bovis by the oral (n=8) or transtracheal (n=5) route at
necropsy (14 days post infection except for one calf that was euthanized at 10 days
post infection).

























Palatine tonsil


0s




-H
^ 40-



c 20-


TBLN


Lung


Figure 4-3. Relative percentages of CD4 CD8 and WC1 y6 T cells in mononuclear cells
isolated from upper respiratory tract, lower respiratory tract, and systemic sites. A)
Medial retropharyngeal lymph nodes (MRPLN). B) Lateral retropharyngeal lymph
nodes (LRPLN) C) Palatine tonsil D) Tracheobronchial lymph nodes (TBLN) E)
Lung. F) Peripheral blood. G) Spleen. Data are represented as the mean percentage
+ SD of the mononuclear population isolated from tissues at necropsy (14 days post
infection except for one calf that was euthanized at 10 days post infection) from
control calves (white bars), and calves infected with Mycoplasma bovis by oral (black
bars) or transtracheal (hatched bars) routes. abSuperscript letters indicate significant
(P < 0.05) differences among groups for that tissue and cell population.


MRPLN


LRPLN
















-H -H
40-



C 20- 1



0




Figure 4-3. (continued).


CD4 CD8 WC1

Spleen











A U B
2.5x105- 2.5x105- b

O 2.0xl05 2.0xl05-
b b
A 1.5x105- b 1.5x105-

1.0x105. b 1.0xl05- b
b I c
S 5.0x104- c 5.0x104.


IgM IgG IgA IgM IgG IgA

MRPLN LRPLN
2.5x105- C8.0x104 D
0 D
2.0x105-
8 6.0x104-
1.5x105-
S 4.0x104-
1.0x105-
o a 2.0x10 4.
5.0x104. b b
b a b b ab ab
IgM IgG IgA IgM IgG IgA

TBLN Lung

Figure 4-4. Mycoplasma bovis-specific B cell responses along the respiratory tract as determined
by ELIspot assay. A) Medial retropharyngeal lymph nodes (MRPLN). B) Lateral
retropharyngeal lymph nodes (LRPLN). C) Tracheobronchial lymph nodes (TBLN).
D) Lung. The data for lymph nodes (A, B and C) are represented as the mean SD of
the total number of cells within that tissue. Data for the lungs (D) are represented as
the mean ( SD) of the number of cells/g of tissue. ELISpot assays were performed
on tissue collected at necropsy (14 days post infection except for one calf that was
euthanized at 10 days post infection) from control calves (n=5; white bars) and from
calves inoculated by oral (n=4; black bars) or transtracheal (n=3; hatched bars) routes.
abcSuperscript letters indicate significant (P < 0.05) differences in class-specific
responses between groups.














4-




S2-

a b


IgM IgG1 IgGq IgA




0.8. b B


0.6-
C.)


0.4-
i< a

0.2- a


0.0
IgM IgG1 IgG2 IgA

Figure 4-5. Mucosal antibody responses in the upper respiratory tract. Antibody responses were
measured in nasal lavage fluids obtained from calves inoculated with Mycoplasma
bovis by the oral (n=8, solid black bars) or transtracheal (n=5, hatched bars) route,
and from control calves (n=6, solid white bars; samples were not collected on two
control calves). Samples were collected at necropsy (14 days post infection, except
for one calf inoculated with M. bovis by the oral route which had to be euthanized at
10 days post-infection). A) Concentration of class-specific total immunoglobulin (Ig)
in nasal lavage fluid. B) M bovis-specific antibody levels in nasal lavage fluid.
*Optical density adjusted for the total amount of Ig, expressed as the optical density
for M. bovis-specific Ig/total Ig in the sample for each isotype. abSuperscript letters
indicate significant (P < 0.05) differences between groups.













A 6-


t4-
:f-
&oJ*


2"


0
S
S


o:. 000


Control Oral Transtracheal


Figure 4-6. Mucosal antibody responses in the upper respiratory tract of individual calves with
or without otitis media. A) Mycoplasma bovis-specific antibody levels in nasal lavage
fluid of calves inoculated with M bovis by the oral route (n=8). *Optical density
adjusted for the total amount of immunoglobulin (Ig), expressed as the optical density
for M. bovis-specific Ig/total Ig in the sample for each isotype. B) Total Ig ([tg/ml) in
nasal lavage fluids of calves inoculated with M bovis by the oral route (n=8). C) The
ratio of M. bovis-specific IgGi to IgG2 in nasal lavage fluids of control calves (n=6)
or calves inoculated with M bovis by the oral (n=8) or transtracheal (n=5) route. Data
points from the three calves with otitis media are highlighted in red, blue and pink,
respectively, whereas data points from calves without otitis media are displayed in
black and white. Nasal lavage samples were collected at necropsy (14 days post
infection, except for one calf inoculated with M bovis by the oral route which had to
be euthanized at 10 days post-infection).


*X
o
1.0.




0.5



0.0.


0
0
0


0


*


*


*gG


0 go


IgG2


Ig'M IgG1


IgG2 IgA


1gM


a0
0
a











1500-

1000*

500-


I iIII I I I I


0 3 7


Necropsy


Day post-infection


50- t
40-
30-
20-
10"

0 3 7 Necropsy
Day post-infection


-H 1500-

-4-
G 1000-

.o 500-

0 0


41 H1K


0 3 7


Necropsy


Day post-infection


D
- 250,
200-
150-
100
50-
o 0
0 0 3 7 Necropsy
Day post-infection


Figure 4-7. Geometric mean end-point titers for Mycoplasma bovis-specific serum
immunoglobulin (Ig). A) IgM. B) IgGi. C) IgG2. D) IgA. Serum samples were
collected at prior to inoculation (day 0), days 3 and 7 post-infection, and at necropsy
(14 days post infection, except for one calf which had to be euthanized at 10 days
post-infection) from calves experimentally inoculated with M bovis by the oral (n=8;
black bars) or transtracheal (n=5; hatched bars) routes, and from control calves (n=8;
white bars). abSuperscript letters indicate significant
(P < 0.05) differences among groups.









CHAPTER 5
CONCLUSIONS AND FUTURE DIRECTIONS

Mycoplasma bovis has emerged as an important pathogen of young dairy calves, and

economic losses resulting from M bovis-associated morbidity and mortality can be substantive.

Clinical disease associated with M bovis is often chronic, debilitating and poorly responsive to

antimicrobial therapy, and current management strategies often fail to control disease. Further,

most research has focused on adult cows with mastitis or on older calves with pneumonia,

neglecting the young dairy calf population. Thus, there is a critical need to develop better

preventive, control and treatment strategies for M. bovis-associated disease in young calves that

are at high risk for both pneumonia and otitis media. Improvements in these areas are hampered

by a lack of understanding of the epidemiology of M bovis infections in young calves and of the

host-pathogen interactions involved in the establishment of infection and the development of

clinical disease. The overall goal of these studies was to address key deficiencies in the current

knowledge of M. bovis-associated disease in young calves.

Field Efficacy of a Commercial M. bovis Bacterin in Young Dairy Calves

In experimental challenge and field studies, efficacy of vaccination against M bovis has

been variable in both adult cows and calves. Although some vaccines have reduced clinical

disease in older calves (Chima et al., 1980; Howard et al., 1987a; Nicholas et al., 2002), they

have not prevented colonization and shedding; indeed, some vaccines have been associated with

exacerbation of clinical disease (Rosenbusch et al., 1998; Bryson et al., 1999). In addition to

research into new vaccination strategies, critical evaluation of the currently marketed M bovis

vaccines in controlled, independent efficacy studies using an appropriate age group are clearly

required. The lack of such studies has been a major gap in understanding the potential of

currently available vaccines as a management strategy to control M. bovis infections in young









calves. In order to address this gap in knowledge, we conducted a field trial using a commercial

M. bovis bacterin that was approved for use in feeder and stocker calves.

The major conclusions from the vaccine efficacy study were 1) that an M bovis bacterin

licensed for prevention of M. bovis-associated respiratory disease in stocker and feeder cattle was

not efficacious in preventing disease in pre-weaned calves in two Florida dairy herds with

endemic M bovis disease, 2) vaccination was not efficacious at preventing colonization of the

upper respiratory tract (URT) in older calves in a third dairy herd, and, 3) vaccination not only

failed to protect young calves, but also exacerbated the rate of clinical otitis media in one herd.

In our study, we found that vaccination with a killed M bovis bacterin at 3, 14 and 35 days

of age did stimulate a systemic humoral immunoglobulin (Ig) Gi response that was detectable

after the third dose of vaccine. Little IgG2 was produced, and as IgG2 is a much more effective

opsonin for phagocytosis ofM bovis than is IgGi (Howard, 1984), the vaccine-induced antibody

response may have been less than optimal for effective clearance ofM bovis from the host. The

observed IgG subclass responses were indicative of a Th2-biased humoral response and were

similar to that reported after infection of older calves with M. bovis (Howard et al., 1987c;

Vanden Bush and Rosenbusch, 2003). Importantly, we also determined that most calves in the

herds with endemic M bovis-associated disease were colonized before 3 weeks of age, meaning

that infection was likely well established before a vaccine-induced immune response could

develop. Adaptive immune responses that develop after infection are very inefficient at clearing

mycoplasmal infections and often result in detrimental chronic inflammatory responses.

Therefore, it is not surprising that vaccination failed to stimulate protective immune responses

and that exacerbation of disease was observed in one herd.









Taken together, data from the field vaccine study provide compelling support for the

concept that alternative approaches to protection of young calves from M bovis infections are

needed. Immune responses of the newborn calf have unique characteristics and undergo rapid

changes during the first few weeks of life (Barrington and Parish, 2001) that may impact vaccine

strategies and control measures. Therefore any new strategies need to be targeted specifically to

this age group.

Establishment of an Experimental Model of M. bovis Infection and Immune Responses in
the Respiratory Tract of Infected Neonatal Calves

A critical gap in knowledge is the availability of an experimental model ofM bovis

infection in young calves that mimics naturally occurring disease. Therefore, the second main

objective of the work presented in this dissertation was to develop a reproducible model of

M. bovis infection of the URT that closely mimicked natural infection in young dairy calves and

to use this model to define the immune responses generated along the respiratory tract during

infection with M bovis.

Current understanding of the pathogenesis of mycoplasmal infections in young calves is

extremely limited. In our oral infection studies, we demonstrated for the first time that M bovis

consistently colonizes the eustachian (auditory) tubes of young calves, as well as the palatine and

pharyngeal tonsils, after oropharyngeal exposure. We also demonstrated for the first time that

inoculation with M bovis can result in the development of otitis media in young calves. The high

rate of pharyngeal tonsil and eustachian tube colonization observed in this study supports the

idea that M. bovis-associated otitis media is a result of ascending infection from the pharyngeal

tonsil via the eustachian tube, similar to otitis media caused by Mycoplasma hyorhinis in pigs

(Morita et al., 1995; Morita et al., 1999). Therefore, generation of immunity in the URT, rather

than systemic immunity, may be the most effective means of preventing otitis media. Because of









the anatomical proximity of the pharyngeal tonsil to the pharyngeal opening of the eustachian

tubes, mycoplasma infection of the tonsils may increase the likelihood of eustachian tube

colonization and eventual development of otitis media. Consistent with this hypothesis, we found

that the level of tonsil colonization was correlated with the presence of clinical disease at

necropsy. These findings suggest that strategies which prevent infection of the tonsils or limit

replication at this site may be beneficial in preventing otitis media in calves.

Despite the fact that ingestion ofM. bovis-contaminated milk is thought to be a major

route of natural infection, experimental infection by this route has not previously been reported.

In these experimental infection studies, we have verified that bucket-nursing of milk containing

M. bovis does result in colonization of the URT of young calves and can cause clinical disease.

This experimental verification that calves fed contaminated milk do become colonized with

M. bovis lends support to control measures aimed at eliminating M. bovis contaminated milk and

colostrum from calf diets.

Our model was used to compare the immune responses to M. bovis infection after oral

inoculation with those observed after inoculation directly into the lower respiratory tract (LRT).

Evaluation of humoral and cellular immune responses in the URT and LRT of calves inoculated

by oral and transtracheal routes showed that the infection site corresponded to the distribution of

immune responses. We demonstrated that the URT lymphoid tissues are major sites for immune

responses after infection via a natural route and that both CD4+ and CD8+ T cells as well as

mycoplasma-specific B cells responded toM bovis infection of the URT. Similarly, when calves

were inoculated directly into the LRT, substantial B cell responses were observed in the lungs

and LRT lymph nodes. Overall, these data indicate that local immune responses within the

respiratory tract are important in M bovis infections.









Interestingly, calves with more severe clinical disease in this study had the highest

IgGi:IgG2 ratios in nasal lavage fluids, while the one calf that cleared M bovis from the LRT had

the lowest IgGi:IgG2 ratio and the highest total IgG2 concentration in nasal lavage fluids.

Together with findings from other studies (Howard, 1984; Howard et al., 1987c; Vanden Bush

and Rosenbusch, 2003) these data support the idea that a local Thi-biased (IgG2) antibody

response may be preferable to a Th2-biased response in clearing or controlling mycoplasmal

infections in calves. Thus, more extensive studies to define the role of local Thl responses in

protection from M bovis-associated disease are warranted.

In summary, we have developed a reproducible model ofM. bovis infection of the URT

that closely mimics naturally occurring M. bovis infections in neonatal calves. There are

important differences between very young calves and older cattle in terms of their immune

environment and the occurrence of middle ear infections. Therefore, an infection model that uses

a clinically relevant age group, especially when considering events leading to middle ear disease,

is likely to be critical when studying this emerging problem. The oral inoculation model that we

have presented here is particularly suited to the study of host-pathogen interactions during initial

colonization of the tonsils, expansion of infection and dissemination to the LRT and middle ear.

In addition, the model could be used to investigate potential new preventive or control strategies,

especially those aimed at limiting colonization of the tonsils and/or spread to the middle ear.

Implications for Control of M. bovis in Young Calves and Future Research Directions

There are many critical gaps in our knowledge ofM bovis infections in young calves that

still need to be addressed. Clearly, well designed epidemiological studies ofM bovis in infected

calf-rearing facilities are required to better establish risk factors and provide guidance for dairy

producers to prevent and control disease. In addition, long term epidemiological studies would

be helpful to determine the impact of M bovis infections of young calves on the risk of URT or









mammary gland infection with M bovis as adults. Prevalence estimates for M. bovis-associated

disease in U.S. dairy calves have not been published and would be useful in determining the true

extent of this problem and in estimating associated losses. In addition, current treatment

measures need to be critically evaluated. Controlled clinical trials evaluating the efficacy of

particular therapeutic and metaphylactic antibiotic regimens for clinical disease in U.S. dairy

calves are needed, and the safety and efficacy of myringotomy in calves with otitis media needs

to be assessed.

The results of our field vaccine efficacy trial provide compelling support for the concept

that alternative approaches to immune protection of young calves from M bovis infections are

needed. More sophisticated approaches to vaccine development and delivery systems and a

better understanding of host immune responses in mycoplasmal disease would likely lead to

improved vaccination strategies. A better understanding of the immunology of the neonatal calf,

especially with respect to ability to respond to different antigens, the types of responses that are

produced, and modulation of these responses by mucosal and systemic adjuvants may improve

our ability to produce efficacious vaccines, if, indeed, vaccination of the very young calf against

M. bovis is possible.

The observations from the field trial on the nasal colonization patterns in herds with or

without endemic M bovis-associated disease strongly suggest that strategies which delay URT

colonization until after the first few weeks of life may have a dramatic impact on susceptibility to

M. bovis-associated disease in calves. Interestingly, studies of otitis media in humans have also

shown that the age at which colonization of the nasopharynx or tonsils first occurs strongly

affects the risk of developing otitis media, and that delaying colonization for a few weeks greatly

reduces the incidence of clinical disease (Faden et al., 1997; Leach et al., 1994). In a study of









M. bovis-associated pneumonia in feedlot cattle, middle ear colonization with M. bovis was

common but no evidence of otitis media was observed (Gagea et al., 2006), further supporting

the idea that susceptibility to M bovis-associated otitis media is largely age-related. In addition

to age-related effects, studies in animal models of a human otitis media pathogen, Haemophilus

influenzae, have indicated that there is a critical bacterial load in the nasopharynx below which

otitis media does not usually occur, and that keeping bacterial levels lower than this threshold is

effective in preventing otitis media (Kennedy et al., 2000). A similar situation may occur with

M. bovis infections; in our experimental studies, the level of tonsil colonization was associated

with the development of clinical disease. Our findings suggest that even if colonization of the

URT cannot be prevented, strategies which limit the level of replication ofM. bovis in the URT

may be effective at preventing clinical disease. Strategies that could be evaluated for their

efficacy in delaying URT colonization until calves are older, or limiting M bovis replication in

URT of young calves include metaphylactic antibiotic therapy, management practices to reduce

environmental exposure to M. bovis, strategies to improve innate defenses in the respiratory tract,

and alternative immunization strategies that improve local adaptive immune responses. In

particular, based on our limited understanding of protective immune responses in mycoplasmal

respiratory disease, immunization strategies that increase the presence of effective opsonins such

as IgG2 in the URT may be effective.

Local immunity along the respiratory tract plays a major role in resisting and controlling

mycoplasma infection in a number of hosts, and our studies have demonstrated that locally

generated immune responses are important in M bovis infections. In addition, studies of murine

mycoplasmal infections have shown that local immunization is more effective than systemic

immunization for disease protection (Taylor and Howard, 1980; Hodge and Simecka, 2002).









Thus, further studies are warranted to determine if local immunization of the respiratory tract

early in life will provide for effective protection against M. bovis infection in calves. To the best

of the author's knowledge this route has been minimally investigated for protection against

M. bovis infections. Local immunization of the mammary gland with killed M bovis without

adjuvant resulted in an IgGi-dominated humoral response and exacerbation of mastitis in adult

cows (Boothby et al., 1987). A combination of intramuscular (with Freund's complete adjuvant)

and intratracheal (without adjuvant) inoculation with killed M bovis was successful in reducing,

but not preventing, lung colonization and clinical disease in challenged calves (Howard et al.,

1980). However, intratracheal immunization with killed M bovis alone failed to induce

protective responses.

Careful evaluation of alternative methods of antigen formulation and use of mucosal

adjuvants may identify strategies that result in a protective local response in the URT without

exacerbation of clinical disease in young calves. The experimental infection model we have

developed could be used in evaluating such strategies. Future studies are planned to determine

whether the nasal route of immunization, using either killed or live M bovis vaccines, can be

used to generate local immunity against infection very early in life. More sophisticated systemic

vaccine strategies such as those using subunit vaccines or DNA vaccines have not been

particularly successful in protection against mycoplasmal infections in general, and none have

been developed against M bovis. In any case, any of these immunization alternatives requires an

adaptive immune response and will likely be hampered by the early age at which colonization

first occurs, unless concurrent strategies that delay colonization in young calves can also be

developed and employed.









An alternative strategy that should be further investigated to prevent or limit M. bovis

colonization is passive immunization of calves. Although passive transfer of M. bovis-specific

colostral antibodies did not appear to affect the outcome of clinical disease in our field study, it is

likely that some colostrum containing high antibody concentrations to M. bovis may have come

from cows with intramammary infection and therefore may also have contained live M bovis.

This could certainly have masked any protective effect of passive transfer. Other data on passive

immunization against M bovis is extremely limited, and the role of passive transfer needs to be

evaluated in a controlled setting. Even if colostral protection is not generally efficacious, it is

possible that passive immunization with antibodies of specific isotypes (e.g. IgA or IgG2) or

antibodies that are directed to specific mycoplasmal antigens might limit or delay colonization of

the URT. For example, potential target antigens might include putative virulence factors such as

proteins involved in antigenic variation, adhesion, or biofilm formation.

In addition to understanding the host response to infection, it is also important to identify

the virulence factors ofM. bovis. Research into the microbial factors involved in the ability of

M. bovis to colonize, persist, and cause disease in the host is ongoing, but many critical gaps in

knowledge remain. This field will likely be greatly assisted by the M bovis genome sequencing

projects, including the M bovis F 1 genome project, that are currently nearing completion. One

factor in particular that needs to be addressed is to define whether specific surface antigens of

M. bovis are involved in protective versus immunopathological responses. Based on our studies,

any microbial factors involved in colonization of the tonsils and other URT sites would also be

key virulence determinants.

In summary, control and prevention ofM. bovis-associated disease in young dairy calves

presents a complex and challenging problem. Successful strategies will likely include a variety of









approaches, including practical on-farm management practices predicated on epidemiological

risk factors, therapeutic modalities, modification and augmentation of the host immune response

by mechanisms tailored to the specific needs of the neonatal calf, and an understanding of the

microbial factors involved in acute and chronic M. bovis disease. Traditional vaccine strategies

may prove difficult to implement in the young dairy calf, and new approaches to prevention will

likely be required to protect this at risk age group. Our study was the first to critically assess the

efficacy of a commercial vaccine in young calves; importantly the vaccine trial was performed

under actual field conditions and on multiple farms. The results of the field trial served as an

impetus to develop a reproducible model that mimicked natural disease and that could be used to

address critical issue for improved vaccine development. Importantly, the development of this

reproducible model will provide the foundation that may lead to the development of improved

preventative or control strategies forM bovis as well as provide a tool to assess the specific

virulence factors ofM. bovis.









LIST OF REFERENCES


AABP. (2005) Special Report from the AABP Mastitis Committee: Mycoplasma Fact Sheet.
Opelika, AL: American Association of Bovine Practitioners.

Abdel-Azim, G.A., Freeman, A.E., Kehrli, M.E. Jr., Kelm, S.C., Burton, J.L., Kuck, A.L., and
Schnell, S. (2005) Genetic basis and risk factors for infectious and noninfectious diseases
in U.S. Holsteins. I. Estimation of genetic parameters for single diseases and general
health. JDairy Sci 88: 1199-1207.

Abusugra, I., and Morein, B. (1999) ISCOM is an efficient mucosal delivery system for
Mycoplasma mycoides subsp. mycoides (MmmSC) antigens inducing high mucosal and
systemic antibody responses. FEMS Immunol MedMicrobiol23: 5-12.

Ackermann, M.R., and Brogden, K.A. (2000) Response of the ruminant respiratory tract to
Mannheimia (Pasteurella) haemolytica. Microbes Infect 2: 1079-1088.

Adegboye, D.S., Halbur, P.G., Nutsch, R.G., Kadlec, R.G., and Rosenbusch, R.F. (1996)
Mycoplasma bovis-associated pneumonia and arthritis complicated with pyogranulomatous
tenosynovitis in calves. JAm VetMedAssoc 209: 647-649.

Adegboye, D.S., Halbur, P.G., Cavanaugh, D.L., Werdin, R.E., Chase, C.C., Miskimins, D.W.,
and Rosenbusch, R.F. (1995a) Immunohistochemical and pathological study of
Mycoplasma bovis-associated lung abscesses in calves. J Vet Diagn Invest 7: 333-337.

Adegboye, D.S., Rasberry, U., Halbur, P.G., Andrews, J.J., and Rosenbusch, R.F. (1995b)
Monoclonal antibody-based immunohistochemical technique for the detection of
Mycoplasma bovis in formalin-fixed, paraffin-embedded calf lung tissues. J Vet Diagn
Invest 7: 261-265.

Adkins, B. (1999) T-cell function in newborn mice and humans. Immunol Today 20: 330-335.

Adkins, B. (2000) Development of neonatal Thl/Th2 function. Int Rev Immunol 19: 157-171.

Alberti, A., Addis, M.F., Chessa, B., Cubeddu, T., Profiti, M., Rosati, S., Ruiu, A., and Pittau,
M. (2006) Molecular and antigenic characterization of a Mycoplasma bovis strain causing
an outbreak of infectious keratoconjunctivitis. J Vet Diagn Invest 18: 41-51.

Aldridge, B.M., McGuirk, S.M., and Lunn, D.P. (1998) Effect of colostral ingestion on
immunoglobulin-positive cells in calves. Vet Immunol Immunopathol 62: 51-64.

Allan, E.M., Pirie, H.M., Selman, I.E., and Wiseman, A. (1979) Immunoglobulin containing
cells in the bronchopulmonary system of non-pneumonic and pneumonic calves. Res Vet
Sci 26: 349-355.

Allen, J.W., Viel, L., Bateman, K.G., and Rosendal, S. (1992a) Changes in the bacterial flora of
the upper and lower respiratory tracts and bronchoalveolar lavage differential cell counts in
feedlot calves treated for respiratory diseases. Can J Vet Res 56: 177-183.









Allen, J.W., Viel, L., Bateman, K.G., Rosendal, S., and Shewen, P.E. (1992b) Cytological
findings in bronchoalveolar lavage fluid from feedlot calves: associations with pulmonary
microbial flora. Can J Vet Res 56: 122-126.

Allen, J.W., Viel, L., Bateman, K.G., Rosendal, S., Shewen, P.E., and Physick-Sheard, P. (1991)
The microbial flora of the respiratory tract in feedlot calves: associations between
nasopharyngeal and bronchoalveolar lavage cultures. Can J Vet Res 55: 341-346.

Ames, T.R. (1997) Dairy calf pneumonia. The disease and its impact. Vet Clin North Am Food
Anim Pract 13: 379-391.

Apley, M.D., and Fajt, V.R. (1998) Feedlot therapeutics. Vet Clin North Am FoodAnim Pract
14: 291-313.

Archambault, D., Morin, G., Elazhary, Y., Roy, R.S., and Joncas, J.H. (1988) Immune response
of pregnant heifers and cows to bovine rotavirus inoculation and passive protection to
rotavirus infection in newborn calves fed colostral antibodies or colostral lymphocytes. Am
J Vet Res 49: 1084-1091.

Ayling, R., Nicholas, R., Hogg, R., Wessels, J., Scholes, S., Byrne, W., Hill, M., Moriarty, J.,
and O'Brien, T. (2005) Mycoplasma bovis isolated from brain tissue of calves. Vet Rec
156: 391-392.

Ayling, R.D., Baker, S.E., Peek, M.L., Simon, A.J., and Nicholas, R.A. (2000) Comparison of in
vitro activity of danofloxacin, florfenicol, oxytetracycline, spectinomycin and tilmicosin
against recent field isolates of Mycoplasma bovis. Vet Rec 146: 745-747.

Ayling, R.D., Nicholas, R.A., and Johansson, K.E. (1997) Application of the polymerase chain
reaction for the routine identification of Mycoplasma bovis. Vet Rec 141: 307-308.

Bakaletz, L.O. (1995) Viral potentiation of bacterial superinfection of the respiratory tract.
Trends Microbiol 3: 110-114.

Bakaletz, L.O., Daniels, R.L., and Lim, D.J. (1993) Modeling adenovirus type 1-induced otitis
media in the chinchilla: effect on ciliary activity and fluid transport function of eustachian
tube mucosal epithelium. JInfect Dis 168: 865-872.

Bakaletz, L.O., DeMaria, T.F., and Lim, D.J. (1987) Phagocytosis and killing of bacteria by
middle ear macrophages. Arch Otolaryngol Head Neck Surg 113: 138-144.

Bakshi, C.S., Malik, M., Carrico, P.M., and Sellati, T.J. (2006) T-bet deficiency facilitates
airway colonization by Mycoplasmapulmonis in a murine model of asthma. JImmunol
177: 1786-1795.

Ball, H.J., and Finlay, D. (1998) Diagnostic application of monoclonal antibody (MAb)-based
sandwich ELISAs. Methods Mol Biol 104: 127-132.









Barbour, E.K., Hamadeh, S.K., and Eidt, A. (2000) Infection and immunity in broiler chicken
breeders vaccinated with a temperature-sensitive mutant of Mycoplasma gallisepticum and
impact on performance of offspring. Poult Sci 79: 1730-1735.

Barile, M.F., Chandler, D.K., Yoshida, H., Grabowski, M.W., and Razin, S. (1988) Hamster
challenge potency assay for evaluation ofMycoplasmapneumoniae vaccines. Infect Immun
56: 2450-2457.

Barrington, G.M., and Parish, S. (2001) Bovine neonatal immunology. Vet Clin North Am Food
Anim Pract 17: 463-476.

Barry, M.A., Lai, W.C., and Johnston, S.A. (1995) Protection against mycoplasma infection
using expression-library immunization. Nature 377: 632-635.

Baseman, J.B., and Tully, J.G. (1997) Mycoplasmas: sophisticated, reemerging, and burdened by
their notoriety. Emerg Infect Dis 3: 21-32.

Bashiruddin, J.B., De Santis, P., Varga, E., and Stipkovits, L. (2001) Confirmation of the
presence of Mycoplasma bovis in Hungarian cattle with pneumonia resembling
pleuropneumonia. Vet Rec 148: 743-746.

Bashiruddin, J.B., Frey, J., Konigsson, M.H., Johansson, K.E., Hotzel, H., Diller, R., De Santis,
P., Botelho, A., Ayling, R.D., Nicholas, R.A., Thiaucourt, F., and Sachse, K. (2005)
Evaluation of PCR systems for the identification and differentiation of Mycoplasma
agalactiae and Mycoplasma bovis: a collaborative trial. Vet J 169: 268-275.

Bayoumi, F.A., Farver, T.B., Bushnell, B., and Oliveria, M. (1988) Enzootic mycoplasmal
mastitis in a large dairy during an eight-year period. JAm VetMedAssoc 192: 905-909.

Bednarek, D., Zdzisinska, B., Kondracki, M., and Kandefer-Szerszen, M. (2003) Effect of
steroidal and non-steroidal anti-inflammatory drugs in combination with long-acting
oxytetracycline on non-specific immunity of calves suffering from enzootic
bronchopneumonia. Vet Microbiol 96: 53-67.

Behrens, A., Heller, M., Kirchhoff, H., Yogev, D., and Rosengarten, R. (1994) A family of
phase- and size-variant membrane surface lipoprotein antigens (Vsps) of Mycoplasma
bovis. Infect Immun 62: 5075-5084.

Behrens, A., Poumarat, F., Le Grand, D., Heller, M., and Rosengarten, R. (1996) A newly
identified immunodominant membrane protein (pMB67) involved in Mycoplasma bovis
surface antigenic variation. Microbiology 142: 2463-2470.

Beier, T., Hotzel, H., Lysnyansky, I., Grajetzki, C., Heller, M., Rabeling, B., Yogev, D., and
Sachse, K. (1998) Intraspecies polymorphism of vsp genes and expression profiles of
variable surface protein antigens (Vsps) in field isolates of Mycoplasma bovis. Vet
Microbiol 63: 189-203.









Bennett, R.H., Carroll, E.J., and Jasper, D.E. (1977) Skin-sensitivity reactions in calves
inoculated with Mycoplasma bovis antigens: humoral and cell-mediated responses. Am J
Vet Res 38: 1721-1730.

Bennett, R.H., and Jasper, D.E. (1977a) Bovine mycoplasma mastitis from intra-mammary
inoculation of small numbers of Mycoplasma bovis 1. Microbiology and pathology. Vet
Microbiol 2: 341-355.

Bennett, R.H., and Jasper, D.E. (1977b) Immunosuppression of humoral and cell-mediated
responses in calves associated with inoculation of Mycoplasma bovis. Am J Vet Res 38:
1731-1738.

Bennett, R.H., and Jasper, D.E. (1977c) Nasal prevalence of Mycoplasma bovis and IHA titers in
young dairy animals. Cornell Vet 67: 361-373.

Bennett, R.H., and Jasper, D.E. (1978a) Factors associated with differentiation between cattle
resistant and susceptible to intramammary challenge exposure with Mycoplasma bovis. Am
J Vet Res 39: 407-416.

Bennett, R.H., and Jasper, D.E. (1978b) Systemic and local immune responses associated with
bovine mammary infections due to Mycoplasma bovis: resistance and susceptibility in
previously infected cows. Am J Vet Res 39: 417-423.

Bennett, R.H., and Jasper, D.E. (1980) Bovine mycoplasmal mastitis from intramammary
inoculations of small numbers of Mycoplasma bovis: local and systemic antibody response.
Am J Vet Res 41: 889-892.

Berge, A.C., Lindeque, P., Moore, D.A., and Sischo, W.M. (2005) A clinical trial evaluating
prophylactic and therapeutic antibiotic use on health and performance of preweaned calves.
JDairy Sci 88: 2166-2177.

Berglof, A., Sandstedt, K., Feinstein, R., Bolske, G., and Smith, C.I. (1997) B cell-deficient
muMT mice as an experimental model for Mycoplasma infections in X-linked
agammaglobulinemia. Eur JImmunol 27: 2118-2121.

Besser, T.E., Gay, C.C., McGuire, T.C., and Evermann, J.F. (1988a) Passive immunity to bovine
rotavirus infection associated with transfer of serum antibody into the intestinal lumen. J
Virol 62: 2238-2242.

Besser, T.E., McGuire, T.C., Gay, C.C., and Pritchett, L.C. (1988b) Transfer of functional
immunoglobulin G (IgG) antibody into the gastrointestinal tract accounts for IgG clearance
in calves. J Virol 62: 2234-2237.

Biddle, M.K., Fox, L.K., Evans, M.A., and Gay, C.C. (2005) Pulsed-field gel electrophoresis
patterns of Mycoplasma isolates from various body sites in dairy cattle with Mycoplasma
mastitis. JAm VetMedAssoc 227: 455-459.









Biddle, M.K., Fox, L.K., and Hancock, D.D. (2003) Patterns of mycoplasma shedding in the
milk of dairy cows with intramammary mycoplasma infection. JAm VetMedAssoc 223:
1163-1166.

Biddle, M.K., Fox, L.K., Hancock, D.D., Gaskins, C.T., and Evans, M.A. (2004) Effects of
storage time and thawing methods on the recovery of Mycoplasma species in milk samples
from cows with intramammary infections. JDairy Sci 87: 933-936.

Biro, J., Povazsan, J., Korosi, L., Glavits, R., Hufnagel, L., and Stipkovits, L. (2005) Safety and
efficacy ofMycoplasma gallisepticum TS-11 vaccine for the protection of layer pullets
against challenge with virulent M. gallisepticum R-strain. Avian Pathol 34: 341-347.

Blom, J.Y. (1982) The relationship between serum immunoglobulin values and incidence of
respiratory disease and enteritis in calves. Nord VetMed34: 276-284.

Bluestone, C.D. (1996) Pathogenesis of otitis media: role of eustachian tube. Pediatr Infect Dis J
15: 281-291.

Blumerman, S.L., Herzig, C.T., Rogers, A.N., Telfer, J.C., and Baldwin, C.L. (2006) Differential
TCR gene usage between WC1- and WC1+ ruminant gamma delta T cell subpopulations
including those responding to bacterial antigen. Immunogenetics 58: 680-692.

Bocklisch, H., Pfutzner, H., Martin, J., Templin, G., and Kreusel, S. (1986) [Mycoplasma bovis
abortion of cows following experimental infection]. Arch Exp Veterinarmed 40: 48-55.

Boddie, R.L., Owens, W.E., Ray, C.H., Nickerson, S.C., and Boddie, N.T. (2002) Germicidal
activities of representatives of five different teat dip classes against three bovine
mycoplasma species using a modified excised teat model. JDairy Sci 85: 1909-1912.

Boehringer Ingelheim. (2003) PulmoGuard MpB Bacterin Host Animal Challenge Studies.
Tech.bull. TB 03-109. St. Joseph, MO: Boehringer Ingelheim Vetmedica, Inc.

Boettcher, T.B., Thacker, B.J., Halbur, P.G., Waters, W.R., Nutsch, R., and Thacker, E.L. (2002)
Vaccine efficacy and immune response to Mycoplasma hyopneumoniae challenge in pigs
vaccinated against porcine reproductive and respiratory syndrome virus and M
hyopneumoniae. Journal of Swine Health and Production 10: 259-264.

Boothby, J.T., Jasper, D.E., and Rollins, M.H. (1983a) Characterization of antigens from
mycoplasmas of animal origin. Am J Vet Res 44: 433-439.

Boothby, J.T., Jasper, D.E., and Thomas, C.B. (1986a) Experimental intramammary inoculation
with Mycoplasma bovis in vaccinated and unvaccinated cows: effect on milk production
and milk quality. Can J Vet Res 50: 200-204.

Boothby, J.T., Jasper, D.E., and Thomas, C.B. (1986b) Experimental intramammary inoculation
with Mycoplasma bovis in vaccinated and unvaccinated cows: effect on the mycoplasmal
infection and cellular inflammatory response. Cornell Vet 76: 188-197.









Boothby, J.T., Jasper, D.E., and Thomas, C.B. (1987) Experimental intramammary inoculation
with Mycoplasma bovis in vaccinated and unvaccinated cows: effect on local and systemic
antibody response. Can J Vet Res 51: 121-125.

Boothby, J.T., Jasper, D.E., Zinkl, J.G., Thomas, C.B., and Dellinger, J.D. (1983b) Prevalence of
mycoplasmas and immune responses to Mycoplasma bovis in feedlot calves. Am J Vet Res
44: 831-838.

Boothby, J.T., Schore, C.E., Jasper, D.E., Osburn, B.I., and Thomas, C.B. (1988) Immune
responses to Mycoplasma bovis vaccination and experimental infection in the bovine
mammary gland. Can J Vet Res 52: 355-359.

Bouwkamp, F.T., Elbers, A.R., Hunneman, W.A., and Klaassen, C.H. (2000) [Effect of the
Stellamune Mycoplasma vaccine on growth, energy conversion, death, and medication use
in fattening pigs on a pig farm chronically infected with Mycoplasma hyopneumoniae].
Tijdschr Diergeneeskd 125: 444-448.

Boyce, J.A. (2003) Mast cells: beyond IgE. JAllergy Clin Immunol 111: 24-32.

Brandtzaeg, P., Jahnsen, F.L., and Farstad, I.N. (1996) Immune functions and immunopathology
of the mucosa of the upper respiratory pathways. Acta Otolaryngol 116: 149-159.

Brank, M., Le Grand, D., Poumarat, F., Bezille, P., Rosengarten, R., and Citti, C. (1999)
Development of a recombinant antigen for antibody-based diagnosis of Mycoplasma bovis
infection in cattle. Clin Diagn Lab Immunol 6: 861-867.

Bray, D.R., Brown, M.B., and Donovan, G.A. (2001) Mycoplasma again. In Proceedings 38th
Annu Florida Dairy Production Conf, pp. 52-60.

Bray, D.R., Shearer, J.K., and Donovan, G.A. (1997) Approaches to achieving and maintaining a
herd free of mycoplasma mastitis. In Proceedings National Mastitis Council 36th Annu
Meet, pp. 132-137.

Bredt, W., Wellek, B., Brunner, H., and Loos, M. (1977) Interactions between Mycoplasma
pneumoniae and the first components of complement. Infect Immun 15: 7-12.

Brown, M.B., Dechant, D.M., Donovan, G.A., Hutchinson, J., and Brown, D.R. (1998a)
Association of Mycoplasma bovis with otitis media in dairy calves. IOMLett 12: 104-105.

Brown, M.B., Shearer, J.K., and Elvinger, F. (1990) Mycoplasmal mastitis in a dairy herd. JAm
VetMedAssoc 196: 1097-1101.

Brown, M.H., Brightman, A.H., Fenwick, B.W., and Rider, M.A. (1998b) Infectious bovine
keratoconjunctivitis: a review. J Vet Intern Med 12: 259-266.

Brown, W.C., Rice-Ficht, A.C., and Estes, D.M. (1998c) Bovine type 1 and type 2 responses. Vet
Immunol Immunopathol 63: 45-55.









Brown, W.C., Shkap, V., Zhu, D., McGuire, T.C., Tuo, W., McElwain, T.F., and Palmer, G.H.
(1998d) CD4(+) T-lymphocyte and immunoglobulin G2 responses in calves immunized
with Anaplasma marginale outer membranes and protected against homologous challenge.
Infect Immun 66: 5406-5413.

Brys, A., Gunther, H., and Schimmel, D. (1989) [Experimental Mycoplasma bovis infection of
the respiratory tract of calves]. Arch Exp Veterinarmed 43: 667-676.

Brys, A., and Pfutzner, H. (1989) [Testing of a hyperimmune serum in calves infected
intranasally with Mycoplasma bovis]. Arch Exp Veterinarmed 43: 677-683.

Bryson, D.G. (1985) Calf pneumonia. Vet Clin North Am FoodAnim Pract 1: 237-257.

Bryson, D.G., Ball, H.J., Brice, N., Forster, F., and Pollock, D. (1999) Pathology of induced
Mycoplasma bovis calf pneumonia in experimentally vaccinated animals. In Mycoplasmas
of ruminants: pathogenicity, diagnostics, epidemiology and molecular genetics. Stipkovits,
L., Rosengarten, R., and Frey, J. (eds). Brussels: European Commission, pp. 128-132.

Buchvarova, Y., and Vesselinova, A. (1989) On the aetiopathogenesis of Mycoplasma
pneumonia in calf. Arch Exp Veterinarmed 43: 685-689.

Burnens, A.P., Bonnemain, P., Bruderer, U., Schalch, L., Audige, L., Le Grand, D., Poumarat,
F., and Nicolet, J. (1999) [The seroprevalence of Mycoplasma bovis in lactating cows in
Switzerland, particularly in the republic and canton of Jura]. Schweiz Arch Tierheilkd 141:
455-460.

Bushnell, R.B. (1984) Mycoplasma mastitis. Vet Clin North Am Large Anim Pract 6: 301-312.

Butler, J.A., Pinnow, C.C., Thomson, J.U., Levisohn, S., and Rosenbusch, R.F. (2001) Use of
arbitrarily primed polymerase chain reaction to investigate Mycoplasma bovis outbreaks.
Vet Microbiol 78: 175-181.

Butler, J.A., Sickles SA, Johanns, C.J., and Rosenbusch, R.F. (2000) Pasteurization of discard
mycoplasma mastitic milk used to feed calves: thermal effects on various mycoplasma. J
Dairy Sci 83: 2285-2288.

Byrne, W., Fagan, J., and McCormack, M. (2001) Mycoplasma bovis arthritis as a sequel to
respiratory disease in bought-in weanling cattle in the Republic of Ireland. Ir Vet J 54:
516-519.

Byrne, W.J, Ball, H.J., Brice, N., McCormack, R., Baker, S.E., Ayling, R.D., and Nicholas, R.A.
(2000) Application of an indirect ELISA to milk samples to identify cows with
Mycoplasma bovis mastitis. Vet Rec 146: 368-369.

Cartner, S.C., Lindsey, J.R., Gibbs-Erwin, J., Cassell, G.H., and Simecka, J.W. (1998) Roles of
innate and adaptive immunity in respiratory mycoplasmosis. Infect Immun 66: 3485-3491.









Cartner, S.C., Simecka, J.W., Briles, D.E., Cassell, G.H., and Lindsey, J.R. (1996) Resistance to
mycoplasmal lung disease in mice is a complex genetic trait. Infect Immun 64: 5326-5331.

Cassell, G.H., and Davis, J.K. (1978) Protective effect of vaccination against Mycoplasma
pulmonis respiratory disease in rats. Infect Immun 21: 69-75.

Cassidy, J.P., Bryson, D.G., Cancela, M.M.G., Forster, F., Pollock, J.M., and Neill, S.D. (2001)
Lymphocyte subtypes in experimentally induced early-stage bovine tuberculous lesions. J
Comp Pathol 124: 46-51.

Caswell, J.L., Middleton, D.M., Sorden, S.D., and Gordon, J.R. (1998) Expression of the
neutrophil chemoattractant interleukin-8 in the lesions of bovine pneumonic pasteurellosis.
Vet Pathol 35: 124-131.

Chambaud, I., Wroblewski, H., and Blanchard, A. (1999) Interactions between mycoplasma
lipoproteins and the host immune system. Trends Microbiol 7: 493-499.

Chandra, R.K. (2002) Nutrition and the immune system from birth to old age. Eur J Clin Nutr
56 (Suppl 3): S73-S76.

Chavez Gonzalez, Y.R., Ros, B.C., Bolske, G., Mattsson, J.G., Fernandez, M.C., and Johansson,
K.E. (1995) In vitro amplification of the 16S rRNA genes from Mycoplasma bovis and
Mycoplasma agalactiae by PCR. Vet Microbiol 47: 183-190.

Chen, W., Alley, M.R., Manktelow, B.W., and Slack, P. (1990) Mast cells in the bovine lower
respiratory tract: morphology, density and distribution. Br Vet J 146: 425-436.

Chima, J.C., Wilkie, B.N., Nielsen, K.H., Ruhnke, H.L., Truscott, R.B., Maxie, G., and Chick, B.
(1981) Synovial immunoglobulin and antibody in vaccinated and nonvaccinated calves
challenged with Mycoplasma bovis. Can J Comp Med 45: 92-96.

Chima, J.C., Wilkie, B.N., Ruhnke, H.L., Truscott, R.B., and Curtis, R.A. (1980)
Immunoprophylaxis of experimental Mycoplasma bovis arthritis in calves. Protective
efficacy of live organisms and formalinized vaccines. Vet Microbiol 5: 113-122.

Cho, H.J., Ruhnke, H.L., and Langford, E.V. (1976) The indirect hemagglutination test for the
detection of antibodies in cattle naturally infected mycoplasmas. Can J Comp Med 40: 20-
29.

Chonmaitree, T. (2000) Viral and bacterial interaction in acute otitis media. Pediatr Infect Dis J
19: S24-S30.

Chonmaitree, T., and Heikkinen, T. (1997) Role of viruses in middle-ear disease. Ann N.Y. Acad
Sci 830: 143-157.

Citti, C., Kim, M.F., and Wise, K.S. (1997) Elongated versions of Vlp surface lipoproteins
protect Mycoplasma hyorhinis escape variants from growth-inhibiting host antibodies.
Infect Immun 65: 1773-1785.









Citti, C., and Rosengarten, R. (1997) Mycoplasma genetic variation and its implication for
pathogenesis. Wiener Klinische Wochenschrift 109: 562-568.

Clark, T. (2002) Relationship of polyarthritis and respiratory disease in cattle. In Proceedings
35th Annu Conf Am Assoc Bov Practitioners, pp. 26-29.

Clevers, H., MacHugh, N.D., Bensaid, A., Dunlap, S., Baldwin, C.L., Kaushal, A., lams, K.,
Howard, C.J., and Morrison, W.I. (1990) Identification of a bovine surface antigen
uniquely expressed on CD4-CD8- T cell receptor gamma/delta+ T lymphocytes. Eur J
Immunol 20: 809-817.

Clover, C.K., and Zarkower, A. (1980) Immunologic responses in colostrum-fed and colostrum-
deprived calves. Am J Vet Res 41: 1002-1007.

Clyde, W.A., and McCormack, W.M. (1983) Collection and transport of specimens. In Methods
in Mycoplasmology. Razin, S. and Tully, J.G. (eds). New York: Academic Press, Inc., pp.
103-107.

Corbeil, L.B., Gogolewski, R.P., Kacskovics, I., Nielsen, K.H., Corbeil, R.R., Morrill, J.L.,
Greenwood, R., and Butler, J.E. (1997) Bovine IgG2a antibodies to Haemophilus somnus
and allotype expression. Can J Vet Res 61: 207-213.

Corbeil, L.B., Watt, B., Corbeil, R.R., Betzen, T.G., Brownson, R.K., and Morrill, J.L. (1984)
Immunoglobulin concentrations in serum and nasal secretions of calves at the onset of
pneumonia. Am J Vet Res 45: 773-778.

Costerton, J.W., Stewart, P.S., and Greenberg, E.P. (1999) Bacterial biofilms: a common cause
of persistent infections. Science 284: 1318-1322.

Curtis, J.L. (2005) Cell-mediated adaptive immune defense of the lungs. Proc Am Thorac Soc
2: 412-416.

DaMassa, A.J., Brooks, D.L., and Adler, H.E. (1983) Caprine mycoplasmosis: widespread
infection in goats with Mycoplasma mycoides subsp mycoides (large-colony type). Am J
Vet Res 44: 322-325.

D'Ambola, J.B., Sherman, M.P., Tashkin, D.P., and Gong, H. Jr. (1988) Human and rabbit
newborn lung macrophages have reduced anti-Candida activity. Pediatr Res 24: 285-290.

Daniele, R.P. (1990) Immunoglobulin secretion in the airways. Annu Rev Physiol 52: 177-195.

Davidson, J.N., Yancey, S.P., Campbell, S.G., and Warner, R.G. (1981) Relationship between
serum immunoglobulin values and incidence of respiratory disease in calves. JAm Vet
MedAssoc 179: 708-710.

Davis, C.L., and Drackley, J.K. (1998) The development, nutrition, and management of the
young calf. Ames, IA: Iowa State University Press.









Davis, J.K., Simecka, J.W., Williamson, J.S., Ross, S.E., Juliana, M.M., Thorp, R.B., and
Cassell, G.H. (1985) Nonspecific lymphocyte responses in F344 and LEW rats:
susceptibility to murine respiratory mycoplasmosis and examination of cellular basis for
strain differences. Infect Immun 49: 152-158.

Davis, J.K., Thorp, R.B., Maddox, P.A., Brown, M.B., and Cassell, G.H. (1982) Murine
respiratory mycoplasmosis in F344 and LEW rats: evolution of lesions and lung lymphoid
cell populations. Infect Immun 36: 720-729.

Davis, K.L., and Wise, K.S. (2002) Site-specific proteolysis of the MALP-404 lipoprotein
determines the release of a soluble selective lipoprotein-associated motif-containing
fragment and alteration of the surface phenotype of Mycoplasmafermentans. Infect Immun
70: 1129-1135.

Dawson, A., Harvey, R.E., Thevasagayam, S.J., Sherington, J., and Peters, A.R. (2002) Studies
of the field efficacy and safety of a single-dose Mycoplasma hyopneumoniae vaccine for
pigs. VetRec 151: 535-538.

Dechant, D.M., and Donovan, G.A. (1995) Otitis media in dairy calves: a preliminary case
report. In Proceedings 28th Annu Conf Am Assoc Bov Practitioners, pp. 237.

Dedieu, L., Balcer-Rodrigues, V., Yaya, A., Hamadou, B., Cisse, 0., Diallo, M., and Niang, M.
(2005) Gamma interferon-producing CD4 T-cells correlate with resistance to Mycoplasma
mycoides subsp. mycoides S.C. infection in cattle. Vet Immunol Immunopathol 107: 217-
233.

Dohar, J.E., Hebda, P.A., Veeh, R., Awad, M., Costerton, J.W., Hayes, J., and Ehrlich, G.D.
(2005) Mucosal biofilm formation on middle-ear mucosa in a nonhuman primate model of
chronic suppurative otitis media. Laryngoscope 115: 1469-1472.

Donlan, R.M. (2000) Role ofbiofilms in antimicrobial resistance. ASAIO J. 46: S47-S52.

Donlan, R.M. (2002) Biofilms: microbial life on surfaces. Emerg Infect Dis 8: 881-890.

Donlan, R.M., and Costerton, J.W. (2002) Biofilms: survival mechanisms of clinically relevant
microorganisms. Clin Microbiol Rev 15: 167-193.

Donovan, G.A., Dohoo, I.R., Montgomery, D.M., and Bennett, F.L. (1998a) Associations
between passive immunity and morbidity and mortality in dairy heifers in Florida, USA.
Prev Vet Med 34: 31-46.

Donovan, G.A., Dohoo, I.R., Montgomery, D.M., and Bennett, F.L. (1998b) Calf and disease
factors affecting growth in female Holstein calves in Florida, USA. Prev Vet Med 33: 1-10.

du Manoir, J.M., Albright, B.N., Stevenson, G., Thompson, S.H., Mitchell, G.B., Clark, M.E.,
and Caswell, J.L. (2002) Variability of neutrophil and pulmonary alveolar macrophage
function in swine. Vet Immunol Immunopathol 89: 175-186.









Duarte, E.R., and Hamdan, J.S. (2004) Otitis in cattle, an aetiological review. J Vet MedB Infect
Dis Vet Public Health 51: 1-7.

Duffy, L.C., Faden, H., Wasielewski, R., Wolf, J., and Krystofik, D. (1997) Exclusive
breastfeeding protects against bacterial colonization and day care exposure to otitis media.
Pediatrics 100: E7.

Dungworth, D.L. (1993) The Respiratory System. In Pathology of Domestic Animals. Jubb,
K.V.F., Kennedy, P.C., and Palmer, N. (eds). San Diego: Academic Press, pp. 539-699.

Dyson, D.A., and Smith, G.R. (1975) The virulence of vaccine strains of Mycoplasma mycoides
var. mycoides recovered from inoculated cattle. Res Vet Sci 18: 115-116.

Ehrlich, G.D., Veeh, R., Wang, X., Costerton, J.W., Hayes, J.D., Hu, F.Z., Daigle, B.J., Ehrlich,
M.D., and Post, J.C. (2002) Mucosal biofilm formation on middle-ear mucosa in the
chinchilla model of otitis media. JAMA 287: 1710-1715.

Ellis, J., Gow, S., West, K., Waldner, C., Rhodes, C., Mutwiri, G., and Rosenberg, H. (2007)
Response of calves to challenge exposure with virulent bovine respiratory syncytial virus
following intranasal administration of vaccines formulated for parenteral administration. J
Am VetMedAssoc 230: 233-243.

Ellis, J., West, K., Cortese, V., Konoby, C., and Weigel, D. (2001) Effect of maternal antibodies
on induction and persistence of vaccine-induced immune responses against bovine viral
diarrhea virus type II in young calves. JAm VetMedAssoc 219: 351-356.

Ellis, J.A. (2001) The immunology of the bovine respiratory disease complex. Vet Clin North Am
FoodAnim Pract 17: 535-550.

Ellis, J.A., Hassard, L.E., Cortese, V.S., and Morley, P.S. (1996) Effects of perinatal vaccination
on humoral and cellular immune responses in cows and young calves. JAm VetMedAssoc
208: 393-400.

Endsley, J.J., Quade, M.J., Terhaar, B., and Roth, J.A. (2002) BHV-1-Specific CD4+, CD8+, and
gamma delta T cells in calves vaccinated with one dose of a modified live BHV-1 vaccine.
Viral Immunol 15: 385-393.

Endsley, J.J., Roth, J.A., Ridpath, J., and Neill, J. (2003) Maternal antibody blocks humoral but
not T cell responses to BVDV. Biologicals 31: 123-125.

Eskola, J., and Hovi, T. (1999) Respiratory viruses in acute otitis media. NEnglJMed 340: 312-
314.

Esslemont, R.J., and Kossaibati, M.A. (1999) The cost of respiratory diseases in dairy heifer
calves. Bovine Practitioner 33: 174-178.









Faden, H., Duffy, L., Wasielewski, R., Wolf, J., Krystofik, D., and Tung, Y. (1997) Relationship
between nasopharyngeal colonization and the development of otitis media in children.
Tonawanda/Williamsville Pediatrics. JInfect Dis 175: 1440-1445.

Fagan, P.K., Walker, M.J., Chin, J., Eamens, G.J., and Djordjevic, S.P. (2001) Oral
immunization of swine with attenuated Salmonella typhimurium aroA SL3261 expressing
a recombinant antigen of Mycoplasma hyopneumoniae (NrdF) primes the immune system
for a NrdF specific secretary IgA response in the lungs. Microb Pathogen 30: 101-110.

Faulkner, C.B., Simecka, J.W., Davidson, M.K., Davis, J.K., Schoeb, T.R., Lindsey, J.R., and
Everson, M.P. (1995) Gene expression and production of tumor necrosis factor alpha,
interleukin 1, interleukin 6, and gamma interferon in C3H/HeN and C57BL/6N mice in
acute Mycoplasmapulmonis disease. Infect Immun 63: 4084-4090.

Feberwee, A., Landman, W.J., Banniseht-Wysmuller, T., Klinkenberg, D., Vernooij, J.C.,
Gielkens, A.L., and Stegeman, J.A. (2006) The effect of a live vaccine on the horizontal
transmission of Mycoplasma gallisepticum. Avian Pathol 35: 359-366.

Feenstra, A., Bisgaard, M.E., Friis, N.F., Meyling, A., and Ahrens, P. (1991) A field study of
Mycoplasma bovis infection in cattle. Zentralbl VeterinarmedB 38: 195-202.

Fergie, N., Bayston, R., Pearson, J.P., and Birchall, J.P. (2004) Is otitis media with effusion a
biofilm infection?. Cin Otolaryngol Allied Sci 29: 38-46.

Fernald, G.W. (1982) Immunological interactions between host cells and mycoplasmas: an
introduction. Rev Infect Dis 4 Suppl: S201-S204.

Fernald, G.W., Clyde, W.A. Jr., and Bienenstock, J. (1972) Immunoglobulin-containing cells in
lungs of hamsters infected with Mycoplasma pneumoniae. JImmunol 108: 1400-1408.

Foddai, A., Idini, G., Fusco, M., Rosa, N., de la Fe, C., Zinellu, S., Corona, L., and Tola, S.
(2005) Rapid differential diagnosis of Mycoplasma agalactiae and Mycoplasma bovis
based on a multiplex-PCR and a PCR-RFLP. Mol Cell Probes 19: 207-212.

Foote, M.R., Nonnecke, B.J., Beitz, D.C., and Waters, W.R. (2007) High growth rate fails to
enhance adaptive immune responses of neonatal calves and is associated with reduced
lymphocyte viability. JDairy Sci 90: 404-417.

Foote, M.R., Nonnecke, B.J., Fowler, M.A., Miller, B.L., Beitz, D.C., and Waters, W.R. (2005a)
Effects of age and nutrition on expression of CD25, CD44, and L-selectin (CD62L) on T-
cells from neonatal calves. JDairy Sci 88: 2718-2729.

Foote, M.R., Nonnecke, B.J., Waters, W.R., Palmer, M.V., Beitz, D.C., Fowler, M.A., Miller,
B.L., Johnson, T.E., and Perry, H.B. (2005b) Effects of increased dietary protein and
energy on composition and functional capacities of blood mononuclear cells from
vaccinated, neonatal calves. Int J Vitam Nutr Res 75: 357-368.









Fox, L., Kirk, J.H., and Britten, A., (2005) Mycoplasma mastitis: a review of transmission and
control. J VetMedB 52: 153-160.

Fox, L.K., and Gay, J.M. (1993) Contagious mastitis. Vet Clin North Am FoodAnim Pract
9: 475-487.

Fox, L.K., Hancock, D.D., Mickelson, A., and Britten, A. (2003) Bulk tank milk analysis: factors
associated with appearance of Mycoplasma sp. in milk. J Vet Med B Infect Dis Vet Public
Health 50: 235-240.

Francoz, D., Fecteau, G., Desrochers, A., and Fortin, M. (2004) Otitis media in dairy calves: a
retrospective study of 15 cases (1987 to 2002). Can Vet J45: 661-666.

Francoz, D., Fortin, M., Fecteau, G., and Messier, S.E. (2005) Determination of Mycoplasma
bovis susceptibilities against six antimicrobial agents using the E test method. Vet
Microbiol 105: 57-64.

Friis, N.F., Ahrens, P., and Larsen, H. (1991) Mycoplasma hyosynoviae isolation from the upper
respiratory tract and tonsils of pigs. Acta Vet Scand 32: 425-429.

Friis, N.F., Kokotovic, B., and Svensmark, B. (2002) Mycoplasma hyorhinis isolation from cases
of otitis media in piglets. Acta Vet Scand 43: 191-193.

Gagea, M.I., Bateman, K.G., Shanahan, R.A., van Dreumel, T., McEwen, B.J., Carman, S.,
Archambault, M., and Caswell, J.L. (2006) Naturally occurring Mycoplasma bovis-
associated pneumonia and polyarthritis in feedlot beef calves. J Vet Diagn Invest 18: 29-
40.

Galyean, M.L., Gunter, S.A., and Malcolm-Callis, K.J. (1995) Effects of Arrival Medication
with Tilmicosin Phosphate on Health and Performance of Newly Received Beef-Cattle. J
Anim Sci 73: 1219-1226.

Geary, S.J., Tourtellotte, M.E., and Cameron, J.A. (1981) Inflammatory toxin from Mycoplasma
bovis: isolation and characterization. Science 212: 1032-1033.

Gershwin, L.J., Berghaus, L.J., Arnold, K., Anderson, M.L., and Corbeil, L.B. (2005) Immune
mechanisms of pathogenetic synergy in concurrent bovine pulmonary infection with
Haemophilus somnus and bovine respiratory syncytial virus. Vet Immunol Immunopathol
107: 119-130.

Gershwin, L.J., Gunther, R.A., Anderson, M.L., Woolums, A.R., McArthur-Vaughan, K.,
Randel, K.E., Boyle, G.A., Friebertshauser, K.E., and McInturff, P.S. (2000) Bovine
respiratory syncytial virus-specific IgE is associated with interleukin-2 and -4, and
interferon-gamma expression in pulmonary lymph of experimentally infected calves. Am J
Vet Res 61: 291-298.

Ghadersohi, A., Coelen, R.J., and Hirst, R.G. (1997) Development of a specific DNA probe and
PCR for the detection of Mycoplasma bovis. Vet Microbiol 56: 87-98.









Ghadersohi, A., Fayazi, Z., and Hirst, R.G. (2005) Development of a monoclonal blocking
ELISA for the detection of antibody to Mycoplasma bovis in dairy cattle and comparison
to detection by PCR. Vet Immunol Immunopathol 104: 183-193.

Giebink, G.S. (1994) Preventing otitis media. Ann Otol Rhinol Laryngol Suppl 163: 20-23.

Godden, S., McMartin, S., Feirtag, J., Stabel, J., Bey, R., Goyal, S., Metzger, L., Fetrow, J.,
Wells, S., and Chester-Jones, H. (2006) Heat-treatment of bovine colostrum. II: effects of
heating duration on pathogen viability and immunoglobulin G. JDairy Sci 89: 3476-3483.

Godden, S.M., Fetrow, J.P., Feirtag, J.M., Green, L.R., and Wells, S.J. (2005) Economic analysis
of feeding pasteurized nonsaleable milk versus conventional milk replacer to dairy calves.
JAm VetMedAssoc 226: 1547-1554.

Godden, S.M., Smith, S., Feirtag, J.M., Green, L.R., Wells, S.J., and Fetrow, J.P. (2003) Effect
of on-farm commercial batch pasteurization of colostrum on colostrum and serum
immunoglobulin concentrations in dairy calves. JDairy Sci 86: 1503-1512.

Godinho, K.S., Rae, A., Windsor, G.D., Tilt, N., Rowan, T.G., and Sunderland, S.J. (2005)
Efficacy of tulathromycin in the treatment of bovine respiratory disease associated with
induced Mycoplasma bovis infections in young dairy calves. Vet Ther 6: 96-112.

Goldman, A., Rubin, C., Gomez, S., Palermo, M.S., and Tasat, D.R. (2004) Functional age-
dependent changes in bronchoalveolar lavage rat cells. CellMolBiol (Noisy -le-grand)
50 Online Pub: OL649-OL655.

Goltz, J.P., Rosendal, S., McCraw, B.M., and Ruhnke, H.L. (1986) Experimental studies on the
pathogenicity of Mycoplasma ovipneumoniae and Mycoplasma arginini for the respiratory
tract of goats. Can J Vet Res 50: 59-67.

Gonzalez, R.N., Jayarao, B.M., Oliver, S.P., and Sears, P.M. (1993) Pneumonia, arthritis and
mastitis in dairy cows due to Mycoplasma bovis. In Proceedings National Mastitis Council
32nd Annu Meet, pp. 178-186.

Gonzalez, R.N., Sears, P.M., Merrill, R.A., and Hayes, G.L. (1992) Mastitis due to Mycoplasma
in the state of New York during the period 1972-1990. Cornell Vet 82: 29-40.

Gonzalez, R.N., and Wilson, D.J. (2003) Mycoplasmal mastitis in dairy herds. Vet Clin North
Am FoodAnim Pract 19: 199-221.

Gourlay, R.N. (1975) Contagious bovine pleuropneumonia-protection following natural infection
and vaccination. Dev Biol Stand 28: 586-589.

Gourlay, R.N. (1983) Lavage techniques for recovery of animal mycoplasmas. In Methods in
Mycoplasmology: Diagnostic Mycoplasmology. Tully, J.G. and Razin, S. (eds). New York:
Academic Press, Inc., pp. 149-151.









Gourlay, R.N., and Houghton, S.B. (1985) Experimental pneumonia in conventionally reared and
gnotobiotic calves by dual infection with Mycoplasma bovis and Pasteurella haemolytica.
Res Vet Sci 38: 377-382.

Gourlay, R.N., and Howard, C.J. (1983) Recovery and identification of bovine mycoplasmas. In
Methods in Mycoplasmology: Diagnostic Mycoplasmology. Tully, J.G. and Razin, S. (eds).
New York: Academic Press, Inc., pp 81-89.

Gourlay, R.N., Thomas, L.H., and Howard, C.J. (1976) Pneumonia and arthritis in gnotobiotic
calves following inoculation with Mycoplasma agalactiae subsp bovis. Vet Rec 98: 506-
507.

Gourlay, R.N., Thomas, L.H., and Wyld, S.G. (1989a) Increased severity of calf pneumonia
associated with the appearance of Mycoplasma bovis in a rearing herd. Vet Rec 124: 420-
422.

Gourlay, R.N., Thomas, L.H., Wyld, S.G., and Smith, C.J. (1989b) Effect of a new macrolide
antibiotic (tilmicosin) on pneumonia experimentally induced in calves by Mycoplasma
bovis and Pasteurella haemolytica. Res Vet Sci 47: 84-89.

Grigg, J., Riedler, J., Robertson, C.F., Boyle, W., and Uren, S. (1999) Alveolar macrophage
immaturity in infants and young children. Eur Respir J 14: 1198-1205.

Haines, D.M., and Chelack, B.J. (1991) Technical considerations for developing enzyme
immunohistochemical staining procedures on formalin-fixed paraffin-embedded tissues for
diagnostic pathology. J Vet Diagn Invest 3: 101-112.

Haines, D.M., Martin, K.M., Clark, E.G., Jim, G.K., and Janzen, E.D. (2001) The
immunohistochemical detection of Mycoplasma bovis and bovine viral diarrhea virus in
tissues of feedlot cattle with chronic, unresponsive respiratory disease and/or arthritis. Can
Vet J42: 857-860.

Hale, H.H., Helmboldt, C.F., Plastridge, W.N., and Stula, E.F. (1962) Bovine mastitis caused by
a Mycoplasma species. Cornell Vet 52: 582-591.

Hall-Stoodley, L., Hu, F.Z., Gieseke, A., Nistico, L., Nguyen, D., Hayes, J., Forbes, M.,
Greenberg, D.P., Dice, B., Burrows, A., Wackym, P.A., Stoodley, P., Post, J.C., Ehrlich,
G.D., and Kerschner, J.E. (2006) Direct detection of bacterial biofilms on the middle-ear
mucosa of children with chronic otitis media. JAMA 296: 202-211.

Hanson, L.A., Ahlstedt, S., Andersson, B., Cruz, J.R., Dahlgren, U., Fallstrom, S.P., Porras, 0.,
Svanborg, E.C., Soderstrom, T., and Wettergren, B. (1984) The immune response of the
mammary gland and its significance for the neonate. Ann Allergy 53: 576-582.

Hauser, M.A., Koob, M.D., and Roth, J.A. (1986) Variation of neutrophil function with age in
calves. Am J Vet Res 47: 152-153.









Heckert, R.A., Saif, L.J., Mengel, J.P., and Myers, G.W. (1991) Isotype-specific antibody
responses to bovine coronavirus structural proteins in serum, feces, and mucosal secretions
from experimentally challenge-exposed colostrum-deprived calves. Am J Vet Res 52: 692-
699.

Hedges, J.F., Cockrell, D., Jackiw, L., Meissner, N., and Jutila, M.A. (2003) Differential mRNA
expression in circulating gamma delta T lymphocyte subsets defines unique tissue-specific
functions. JLeukoc Biol 73: 306-314.

Heikkinen, T., and Chonmaitree, T. (2003) Importance of respiratory viruses in acute otitis
media. Clin Microbiol Rev 16: 230-241.

Hein, W.R., and Mackay, C.R. (1991) Prominence of gamma delta T cells in the ruminant
immune system. Immunol Today 12: 30-34.

Henderson, J.P., and McCullough, W.P. (1993) Otitis media in suckler calves. Vet Rec 132: 24.

Hewicker-Trautwein, M., Feldmann, M., Kehler, W., Schmidt, R., Thiede, S., Seeliger, F.,
Wohlsein, P., Ball, H.J., Buchenau, I., Spergser, J., and Rosengarten, R. (2002) Outbreak
of pneumonia and arthritis in beef calves associated with Mycoplasma bovis and
Mycoplasma californicum. Vet Rec 151: 699-703.

Hickman-Davis, J.M. (2002) Role of innate immunity in respiratory mycoplasma infection.
FrontBiosci 7: dl347-dl355.

Hickman-Davis, J.M., Michalek, S.M., Gibbs-Erwin, J., and Lindsey, J.R. (1997) Depletion of
alveolar macrophages exacerbates respiratory mycoplasmosis in mycoplasma-resistant
C57BL mice but not mycoplasma-susceptible C3H mice. Infect Immun 65: 2278-2282.

Hodge, L.M., and Simecka, J.W. (2002) Role of upper and lower respiratory tract immunity in
resistance to Mycoplasma respiratory disease. JInfect Dis 186: 290-294.

Hotzel, H., Heller, M., and Sachse, K. (1999) Enhancement of Mycoplasma bovis detection in
milk samples by antigen capture prior to PCR. Mol Cell Probes 13: 175-178.

Hotzel, H., Sachse, K., and Pfutzner, H. (1996) Rapid detection of Mycoplasma bovis in milk
samples and nasal swabs using the polymerase chain reaction. JApplBacteriol 80: 505-
510.

Houghton, S.B., and Gourlay, R.N. (1983) Synergism between Mycoplasma bovis and
Pasteurella haemolytica in calf pneumonia. Vet Rec 113: 41-42.

Howard, C.J. (1984) Comparison of bovine IgGI, IgG2 and IgM for ability to promote killing of
Mycoplasma bovis by bovine alveolar macrophages and neutrophils. Vet Immunol
Immunopathol 6: 321-326.

Howard, C.J., and Gourlay, R.N. (1983) Immune response of calves following the inoculation of
Mycoplasma dispar and Mycoplasma bovis. Vet Microbiol 8: 45-56.









Howard, C.J., Gourlay, R.N., and Taylor, G. (1980) Immunity to Mycoplasma bovis infections of
the respiratory tract of calves. Res Vet Sci 28: 242-249.

Howard, C.J., Sopp, P., Parsons, K.R., and Finch, J. (1989) In vivo depletion of BoT4 (CD4) and
of non-T4/T8 lymphocyte subsets in cattle with monoclonal antibodies. Eur JImmunol 19:
757-764.

Howard, C.J., Stott, E.J., Thomas, L.H., Gourlay, R.N., and Taylor, G. (1987a) Protection
against respiratory disease in calves induced by vaccines containing respiratory syncytial
virus, parainfluenza type 3 virus, Mycoplasma bovis andMdispar. Vet Rec 121: 372-376.

Howard, C.J., and Taylor, G. (1979) Variation in the virulence of strains of Mycoplasma
pulmonis related to susceptibility to killing by macrophages in vivo. J Gen Microbiol 114:
289-294.

Howard, C.J., and Taylor, G. (1983) Interaction of mycoplasmas and phagocytes, Yale JBiol
Med 56: 643-648.

Howard, C.J., Taylor, G., Collins, J., and Gourlay, R.N. (1976) Interaction of Mycoplasma
dispar and Mycoplasma agalactiae subsp. bovis with bovine alveolar macrophages and
bovine lacteal polymorphonuclear leukocytes. Infect Immun 14: 11-17.

Howard, C.J., Thomas, L.H., and Parsons, K.R. (1987b) Comparative pathogenicity of
Mycoplasma bovis and Mycoplasma dispar for the respiratory tract of calves. Isr JMed Sci
23: 621-624.

Howard, C.J., Thomas, L.H., and Parsons, K.R. (1987c) Immune response of cattle to respiratory
mycoplasmas. Vet Immunol Immunopathol 17: 401-412.

Jack, E.J., Moring, J., and Boughton, E. (1977) Isolation of Mycoplasma bovis from an outbreak
of infectious bovine keratoconjunctivitis. Vet Rec 101: 287.

Jan, G., Fontenelle, C., Le Henaff, M., and Wroblewski, H. (1995) Acylation and immunological
properties of Mycoplasma gallisepticum membrane proteins. Res Microbiol 146: 739-750.

Jasper, D.E. (1981) Bovine mycoplasmal mastitis. Adv Vet Sci Comp Med 25: 121-159.

Jasper, D.E., Alaubaid, J.M., and Fabrican, J. (1974) Epidemiologic observations on
mycoplasma mastitis. Cornell Vet 64: 407-415.

Jeffcoate, S.L. (1982) Use of Youden plot for internal quality control in the immunoassay
laboratory. Ann Clin Biochem 19: 435-437.

Jensen, L.T., Ladefoged, S., Birkelund, S., and Christiansen, G. (1995) Selection of Mycoplasma
hominis PG21 deletion mutants by cultivation in the presence of monoclonal antibody 552.
Infect Immun 63: 3336-3347.









Jensen, R., Maki, L.R., Lauerman, L.H., Raths, W.R., Swift, B.L., Flack, D.E., Hoff, R.L.,
Hancock, H.A., Tucker, J.O., Horton, D.P., and Weibel, J.L. (1983) Cause and
pathogenesis of middle-ear infection in young feedlot cattle. JAm VetMedAssoc 182:
967-972.

Jericho, K.W., Cho, H.J., and Kozub, G.C. (1990) Protective effect of inactivated Pasteurella
haemolytica bacterin challenged in bovine herpesvirus-1 experimentally infected calves.
Vaccine 8: 315-320.

Jericho, K.W., and Langford, E.V. (1982) Aerosol vaccination of calves with Pasteurella
haemolytica against experimental respiratory disease. Can J Comp Med 46: 287-292.

Jolly, S., Detilleux, J., and Desmecht, D. (2004) Extensive mast cell degranulation in bovine
respiratory syncytial virus-associated paroxystic respiratory distress syndrome. Vet
Immunol Immunopathol 97: 125-136.

Jones, H.P., Hodge, L.M., Fujihashi, K., Kiyono, H., McGhee, J.R., and Simecka, J.W. (2001)
The pulmonary environment promotes Th2 cell responses after nasal-pulmonary
immunization with antigen alone, but Thl responses are induced during instances of
intense immune stimulation. JImmunol 167: 4518-4526.

Jones, H.P., and Simecka, J.W. (2003) T lymphocyte responses are critical determinants in the
pathogenesis and resistance to mycoplasma respiratory disease. Front Biosci 8: D930-
D945.

Jones, H.P., Tabor, L., Sun, X., Woolard, M.D., and Simecka, J.W. (2002) Depletion of CD8+
T cells exacerbates CD4+ Th cell-associated inflammatory lesions during murine
mycoplasma respiratory disease. JImmunol 168: 3493-3501.

Jones, J.F., Whithear, K.G., Scott, P.C., and Noormohammadi, A.H. (2006) Duration of
immunity with Mycoplasma synoviae: comparison of the live attenuated vaccine MS-H
(Vaxsafe MS) with its wild-type parent strain, 86079/7NS. Avian Dis 50: 228-231.

Jungi, T.W., Krampe, M., Sileghem, M., Griot, C., and Nicolet, J. (1996) Differential and strain-
specific triggering of bovine alveolar macrophage effector functions by mycoplasmas.
Microb Pathog 21: 487-498.

Kamimura, M., Balaban, C.D., Sando, I., Ganbo, T., and Suzuki, C. (2000) Cellular distribution
of mucosa-associated lymphoid tissue with otitis media in children. Ann Otol Rhinol
Laryngol 109: 467-472.

Kampen, A.H., Olsen, I., Tollersrud, T., Storset, A.K., and Lund, A. (2006) Lymphocyte
subpopulations and neutrophil function in calves during the first 6 months of life. Vet
Immunol Immunopathol 113: 53-63.

Kaneene, J.B., and Hurd, H.S. (1990) The National Animal Health Monitoring-System in
Michigan .3. Cost estimates of selected dairy cattle diseases. Prev Vet Med 8: 127-140.









Kannan, T.R., and Baseman, J.B. (2006) ADP-ribosylating and vacuolating cytotoxin of
Mycoplasmapneumoniae represents unique virulence determinant among bacterial
pathogens. Proc Natl Acad Sci U.S.A. 103: 6724-6729.

Kapil, S., and Basaraba, R.J. (1997) Infectious bovine rhinotracheitis, parainfluenza-3, and
respiratory coronavirus. Vet Clin North Am FoodAnim Pract 13: 455-469.

Kazachkov, M.Y., Hu, P.C., Carson, J.L., Murphy, P.C., Henderson, F.W., and Noah, T.L.
(2002) Release of cytokines by human nasal epithelial cells and peripheral blood
mononuclear cells infected with Mycoplasmapneumoniae. Exp BiolMed (Maywood.) 227:
330-335.

Kelm, S.C., Detilleux, J.C, Freeman, A.E., Kehrli, M.E. Jr., Dietz, A.B., Fox, L.K., Butler, J.E.,
Kasckovics, I., and Kelley, D.H. (1997) Genetic association between parameters of inmate
immunity and measures of mastitis in periparturient Holstein cattle. JDairy Sci 80: 1767-
1775.

Kelm, S.C., Freeman, A.E., and Kehrli, M.E. Jr. (2001) Genetic control of disease resistance and
immunoresponsiveness. Vet Clin North Am FoodAnim Pract 17: 477-493.

Kennedy, B.J., Novotny, L.A., Jurcisek, J.A., Lobet, Y., and Bakaletz, L.O. (2000) Passive
transfer of antiserum specific for immunogens derived from a nontypeable Haemophilus
influenzae adhesin and lipoprotein D prevents otitis media after heterologous challenge.
Infect Immun 68: 2756-2765.

Kennedy, H.E., Welsh, M.D., Bryson, D.G., Cassidy, J.P., Forster, F.I, Howard, C.J., Collins,
R.A., and Pollock, J.M. (2002) Modulation of immune responses to Mycobacterium bovis
in cattle depleted of WCl(+) gamma delta T cells. Infect Immun 70: 1488-1500.

Keystone, E.C., Taylor-Robinson, D., Osborn, M.F., Ling, L., Pope, C., and Fornasier, V. (1980)
Effect of T-cell deficiency on the chronicity of arthritis induced in mice by Mycoplasma
pulmonis. Infect Immun 27: 192-196.

Khodakaram-Tafti, A., and Lopez, A. (2004) Immunohistopathological findings in the lungs of
calves naturally infected with Mycoplasma bovis. J Vet MedA Physiol Pathol Clin Med
51: 10-14.

Kinde, H., Daft, B.M., Walker, R.L., Charlton, B.R., and Petty, R. (1993) Mycoplasma bovis
associated with decubital abscesses in Holstein calves. J Vet Diagn Invest 5: 194-197.

Kirby, F.D., and Nicholas, R.A. (1996) Isolation of Mycoplasma bovis from bullocks' eyes. Vet
Rec 138: 552.

Kirk, J.H., Glenn, K., Ruiz, L., and Smith, E. (1997) Epidemiologic analysis of Mycoplasma spp
isolated from bulk-tank milk samples obtained from dairy herds that were members of a
milk cooperative. JAm VetMedAssoc 211: 1036-1038.









Kiroglu, M.M., Ozbilgin, K., Aydogan, B., Kiroglu, F., Tap, 0., Kaya, M., and Ozsahinoglu, C.
(1998) Adenoids and otitis media with effusion: a morphological study. Am J Otolaryngol
19: 244-250.

Kitazawa, K., Tagawa, Y., Honda, A., and Yuki, N. (1998) Guillain-Barre syndrome associated
with IgG anti-GMlb antibody subsequent to Mycoplasmapneumoniae infection. JNeurol
Sci 156: 99-101.

Knudtson, W.U., Reed, D.E., and Daniels, G. (1986) Identification of Mycoplasmatales in
pneumonic calf lungs. VetMicrobiol 11: 79-91.

Kotani, H., and McGarrity, G.J. (1986) Identification of mycoplasma colonies by
immunobinding. J Cin Microbiol 23: 783-785.

Krause, D.C. (1998) Mycoplasma pneumoniae cytadherence: organization and assembly of the
attachment organelle. Trends Microbiol 6: 15-18.

Kristensen, C.S., Andreasen, M., Ersboll, A.K., and Nielsen, J.P. (2004) Antibody response in
sows and piglets following vaccination against Mycoplasma hyopneumoniae, toxigenic
Pasteurella multocida, and Actinobacillus pleuropneumoniae. Can J Vet Res 68: 66-70.

Kruger, T., and Baier, J. (1997) Induction of neutrophil chemoattractant cytokines by
Mycoplasma hominis in alveolar type II cells. Infect Immun 65: 5131-5136.

Kulberg, S., Boysen, P., and Storset, A.K. (2004) Reference values for relative numbers of
natural killer cells in cattle blood. Dev Comp Immunol 28: 941-948.

Kurland, G., Cheung, A.T., Miller, M.E., Ayin, S.A., Cho, M.M., and Ford, E.W. (1988) The
ontogeny of pulmonary defenses: alveolar macrophage function in neonatal and juvenile
rhesus monkeys. Pediatr Res 23: 293-297.

Kusiluka, L.J., Kokotovic, B., Ojeniyi, B., Friis, N.F., and Ahrens, P. (2000a) Genetic variations
among Mycoplasma bovis strains isolated from Danish cattle. FEMSMicrobiol Lett 192:
113-118.

Kusiluka, L.J., Ojeniyi, B., and Friis, N.F. (2000b) Increasing prevalence of Mycoplasma bovis
in Danish cattle. Acta Vet Scand 41: 139-146.

Kyriakis, S.C., Alexopoulos, C., Vlemmas, J., Sarris, K., Lekkas, S., Koutsoviti-Papadopoulou,
M., and Saoulidis, K. (2001) Field study on the efficacy of two different vaccination
schedules with HYORESP in a Mycoplasma hyopneumoniae-infected commercial pig unit.
J Vet MedB Infect Dis Vet Public Health 48: 675-684.

Lago, A., McGuirk, S.M., Bennett, T.B., Cook, N.B., and Nordlund, K.V. (2006) Calf
respiratory disease and pen microenvironments in naturally ventilated calf barns in winter.
JDairy Sci 89: 4014-4025.









Lai, W.C., Bennett, M., Lu, Y.S., and Pakes, S.P. (1990a) Biological evaluation of Mycoplasma
pulmonis temperature-sensitive mutants for use as possible rodent vaccines. Infect Immun
58: 2289-2296.

Lai, W.C., Bennett, M., Pakes, S.P., Kumar, V., Steutermann, D., Owusu, I., and Mikhael, A.
(1990b) Resistance to Mycoplasmapulmonis mediated by activated natural killer cells. J
Infect Dis 161: 1269-1275.

Lamm, C.G., Munson, L., Thurmond, M.C., Barr, B.C., and George, L.W. (2004) Mycoplasma
otitis in California calves. J Vet Diagn Invest 16: 397-402.

Le Grand, A., and Kobisch, M. (1996) [Comparison of the use of a vaccine and sequential
antibiotic treatment in a herd infected with Mycoplasma hyopneumoniae]. Vet Res 27: 241-
253.

Le Grand, D., Calavas, D., Brank, M., Citti, C., Rosengarten, R., Bezille, P., and Poumarat, F.
(2002) Serological prevalence ofMycoplasma bovis infection in suckling beef cattle in
France. VetRec 150: 268-273.

Le Grand, D., Philippe, S., Calavas, D., Bezille, P., and Poumarat, F. (2001) Prevalence of
Mycoplasma bovis infection in France. In Mycoplasmas of ruminants: pathogenicity,
diagnostics, epidemiology and molecular genetics. Poveda, J.B., Fernandez, A., Frey, J.,
and Johansson, K.E. (eds). Brussels: European Commission, pp 106-109.

Le Grand, D., Solsona, M., Rosengarten, R., and Poumarat, F. (1996) Adaptive surface antigen
variation in Mycoplasma bovis to the host immune response. FEMSMicrobiol Lett 144:
267-275.

Leach, A.J., Boswell, J.B., Asche, V., Nienhuys, T.G., and Mathews, J.D. (1994) Bacterial
colonization of the nasopharynx predicts very early onset and persistence of otitis media in
Australian aboriginal infants. Pediatr Infect Dis J 13: 983-989.

Levisohn, S., Garazi, S., Gerchman, I., and Brenner, J. (2004) Diagnosis of a mixed mycoplasma
infection associated with a severe outbreak of bovine pinkeye in young calves. J Vet Diagn
Invest 16: 579-581.

Levisohn, S., Rosengarten, R., and Yogev, D. (1995) In vivo variation of Mycoplasma
gallisepticum antigen expression in experimentally infected chickens. Vet Microbiol 45:
219-231.

Liebler-Tenorio, E.M., Riedel-Caspari, G., and Pohlenz, J.F. (2002) Uptake of colostral
leukocytes in the intestinal tract of newborn calves. Vet Immunol Immunopathol 85: 33-40.

Lim, D.J., DeMaria, T.F., and Bakaletz, L.O. (1987) Functional morphology of the
tubotympanum related to otitis media: a review. Am JOtol 8: 385-389.









Lin, J.H., Weng, C.N., Liao, C.W., Yeh, K.S., and Pan, M.J. (2003) Protective effects of oral
microencapsulated Mycoplasma hyopneumoniae vaccine prepared by co-spray drying
method. J Vet Med Sci 65: 69-74.

Linker, H., Poumarat, F., and Belli, P. (1998) Histomorphological and immunohistochemical
findings in joint tissues of calves following intraarticular inoculation with Mycoplasma
bovis. IOMLett 5: 59.

Liu, I.K., Walsh, E.M., Bernoco, M., and Cheung, A.T. (1987) Bronchoalveolar lavage in the
newborn foal. JReprodFertil Suppi 35: 587-592.

Logan, E.F., and Pearson, G.R. (1978) The distribution of immunoglobulins in the intestine of
the neonatal calf. Ann Rech Vet 9: 319-326.

Lopez, A., Maxie, M.G., Ruhnke, L., Savan, M., and Thomson, R.G. (1986) Cellular
inflammatory response in the lungs of calves exposed to bovine viral diarrhea virus,
Mycoplasma bovis, and Pasteurella haemolytica. Am J Vet Res 47: 1283-1286.

Lous, J., Burton, M.J., Felding, J.U., Ovesen, T., Rovers, M.M., and Williamson, I. (2005)
Grommets (ventilation tubes) for hearing loss associated with otitis media with effusion in
children. Cochrane Database Syst Rev 1: CD001801.

Lu, M.C., Peters-Golden, M., Hostetler, D.E., Robinson, N.E., and Derksen, F.J. (1996) Age-
related enhancement of 5-lipoxygenase metabolic capacity in cattle alveolar macrophages.
Am JPhysiol 271: L547-L554.

Lu, X., and Rosenbusch, R.F. (2004) Endothelial cells from bovine pulmonary microvasculature
respond to Mycoplasma bovis preferentially with signals for mononuclear cell
transmigration. Microb Pathog 37: 253-261.

Lysnyansky, I., Rosengarten, R., and Yogev, D. (1996) Phenotypic switching of variable surface
lipoproteins in Mycoplasma bovis involves high-frequency chromosomal rearrangements.
JBacteriol 178: 5395-5401.

Lysnyansky, I., Sachse, K., Rosenbusch, R., Levisohn, S., and Yogev, D. (1999) The vsp locus
of Mycoplasma bovis: gene organization and structural features. JBacteriol 181: 5734-
5741.

Lysnyansky, I., Yogev, D., and Levisohn, S. (2006) MbmA: A phase variable paralog of P48-
like protein of Mycoplasma bovis with homology to the MALP-404 of Mycoplasma
fermentans. IOMLett 16: 113.

MacHugh, N.D., Mburu, J.K., Carol, M.J., Wyatt, C.R., Orden, J.A., and Davis, W.C. (1997)
Identification of two distinct subsets of bovine gamma delta T cells with unique cell
surface phenotype and tissue distribution. Immunology 92: 340-345.









Maeda, T., Shibahara, T., Kimura, K., Wada, Y., Sato, K., Imada, Y., Ishikawa, Y., and Kadota,
K. (2003) Mycoplasma bovis-associated suppurative otitis media and pneumonia in bull
calves. J Comp Pathol 129: 100-110.

Maes, D., Deluyker, H., Verdonck, M., Castryck, F., Miry, C., Lein, A., Vrijens, B., and de
Kruif, A. (1998) The effect of vaccination against Mycoplasma hyopneumoniae in pig
herds with a continuous production system. Zentralbl VeterinarmedB 45: 495-505.

Maes, D., Deluyker, H., Verdonck, M., Castryck, F., Miry, C., Vrijens, B., Verbeke, W., Viaene,
J., and de Kruif, A. (1999) Effect of vaccination against Mycoplasma hyopneumoniae in
pig herds with an all-in/all-out production system. Vaccine 17: 1024-1034.

Manesse, M., Delverdier, M., Abella-Bourges, N., Sautet, J., Cabanie, P., and Schelcher, F.
(1998) An immunohistochemical study of bovine palatine and pharyngeal tonsils at 21, 60
and 300 days of age. Anat Histol Embryol 27: 179-185.

March, J.B., Jepson, C.D., Clark, J.R., Totsika, M., and Calcutt, M.J. (2006) Phage library
screening for the rapid identification and in vivo testing of candidate genes for a DNA
vaccine against Mycoplasma mycoides subsp. mycoides small colony biotype. Infect
Immun 74: 167-174.

Markham, J.F., Morrow, C.J., Scott, P.C., and Whithear, K.G. (1998a) Safety of a temperature-
sensitive clone of Mycoplasma synoviae as a live vaccine. Avian Dis 42: 677-681.

Markham, J.F., Scott, P.C., and Whithear, K.G. (1998b) Field evaluation of the safety and
efficacy of a temperature-sensitive Mycoplasma synoviae live vaccine. Avian Dis 42: 682-
689.

Martin, J., Bocklisch, H., Pfutzner, H., and Zepezauer, V. (1983) [Mycoplasma infection of
calves. 3. The histological picture of Mycoplasma bovis-induced pneumonia]. Arch Exp
Veterinarmed 37: 499-507.

Martin, S.W., Bateman, K.G., Shewen, P.E., Rosendal, S., and Bohac, J.G. (1989) The
frequency, distribution and effects of antibodies, to seven putative respiratory pathogens,
on respiratory disease and weight gain in feedlot calves in Ontario. Can J Vet Res 53: 355-
362.

Martin, S.W., Bateman, K.G., Shewen, P.E., Rosendal, S., Bohac, J.G., and Thorburn, M. (1990)
A group level analysis of the associations between antibodies to seven putative pathogens
and respiratory disease and weight gain in Ontario feedlot calves. Can J Vet Res 54: 337-
342.

Mathy, N.L., Walker, J., and Lee, R.P. (1997) Characterization of cytokine profiles and double-
positive lymphocyte subpopulations in normal bovine lungs. Am J Vet Res 58: 969-975.

Mattsson, J.G., Gersdorf, H., Gobel, U.B., and Johansson, K.E. (1991) Detection of Mycoplasma
bovis and Mycoplasma agalactiae by oligonucleotide probes complementary to 16S rRNA.
Mol Cell Probes 5: 27-35.









Mbulu, R.S., Tjipura-Zaire, G., Lelli, R., Frey, J., Pilo, P., Vilei, E.M., Mettler, F., Nicholas,
R.A., and Huebschle, O.J. (2004) Contagious bovine pleuropneumonia (CBPP) caused by
vaccine strain T1/44 of Mycoplasma mycoides subsp. mycoides SC. Vet Microbiol 98: 229-
234.

McAuliffe, L., Ellis, R.J., Lawes, J.R., Ayling, R.D., and Nicholas, R.A. (2005) 16S rDNA PCR
and denaturing gradient gel electrophoresis; a single generic test for detecting and
differentiating Mycoplasma species. JMedMicrobiol 54: 731-739.

McAuliffe, L., Ellis, R.J., Miles, K., Ayling, R.D., and Nicholas, R.A. (2006) Biofilm formation
by mycoplasma species and its role in environmental persistence and survival.
Microbiology 152: 913-922.

McAuliffe, L., Kokotovic, B., Ayling, R.D., and Nicholas, R.A. (2004) Molecular
epidemiological analysis ofMycoplasma bovis isolates from the United Kingdom shows
two genetically distinct clusters. J Clin Microbiol 42: 4556-4565.

McBride, J.W., Corstvet, R.E., Dietrich, M.A., Berry, C., Brennan, R., Taylor, B.C., Stott, J.L.,
and Osburn, B.I. (1997) Memory and CD8+ are the predominant bovine bronchoalveolar
lymphocyte phenotypes. Vet Immunol Immunopathol 58: 55-62.

McBride, J.W., Corstvet, R.E., Taylor, B.C., and Osburn, B.I. (1999) Primary and anamnestic
responses of bovine bronchoalveolar and peripheral blood lymphocyte subsets to
aerosolized Pasteurella haemolytica Al. Vet Immunol Immunopathol 67: 161-170.

McEwen, S.A., and Hulland, T.J. (1985) Haemophilus somnus-induced otitis and meningitis in a
heifer. Can Vet J26: 7-8.

McInnes, E., Sopp, P., Howard, C.J., and Taylor, G. (1999) Phenotypic analysis of local cellular
responses in calves infected with bovine respiratory syncytial virus. Immunology 96: 396-
403.

McMartin, S., Godden, S., Metzger, L., Feirtag, J., Bey, R., Stabel, J., Goyal, S., Fetrow, J.,
Wells, S., and Chester-Jones, H. (2006) Heat treatment of bovine colostrum. I: effects of
temperature on viscosity and immunoglobulin G level. JDairy Sci 89: 2110-2118.

Menanteau-Horta, A.M., Ames, T.R., Johnson, D.W., and Meiske, J.C. (1985) Effect of maternal
antibody upon vaccination with infectious bovine rhinotracheitis and bovine virus diarrhea
vaccines. Can JComp Med 49: 10-14.

Menge, C., Neufeld, B., Hirt, W., Schmeer, N., Bauerfeind, R., Baljer, G., and Wieler, L.H.
(1998) Compensation of preliminary blood phagocyte immaturity in the newborn calf. Vet
Immunol Immunopathol 62: 309-321.

Mettifogo, E., Muller, E.E., Medici, K.C., Buzinhani, M., and Pretto, L.G. (1998) Isolation of
Mycoplasma bovis from calves with pneumonia. IOMLett 5: 92-93.









Meyns, T., Dewulf, J., de Kruif, A., Calus, D., Haesebrouck, F., and Maes, D. (2006)
Comparison of transmission of Mycoplasma hyopneumoniae in vaccinated and non-
vaccinated populations. Vaccine 24: 7081-7086.

Miao, C., Woolums, A.R., Zarlenga, D.S., Brown, C.C., Brown, J.C. Jr., Williams, S.M., and
Scott, M.A. (2004) Effects of a single intranasal dose of modified-live bovine respiratory
syncytial virus vaccine on cytokine messenger RNA expression following viral challenge
in calves. Am J Vet Res 65: 725-733.

Miles, K., McAuliffe, L., Persson, A., Ayling, R.D., and Nicholas, R.A. (2005) Insertion
sequence profiling of UK Mycoplasma bovis field isolates. VetMicrobiol 107: 301-306.

Minion, F.C. (2002) Molecular pathogenesis of mycoplasma animal respiratory pathogens. Front
Biosci 7: dl410-dl422.

Miyamoto, N., and Bakaletz, L.O. (1997) Kinetics of the ascension of NTHi from the
nasopharynx to the middle ear coincident with adenovirus-induced compromise in the
chinchilla. Microb Pathog 23: 119-126.

Miyata, M., Yamamoto, H., Shimizu, T., Uenoyama, A., Citti, C., and Rosengarten, R. (2000)
Gliding mutants of Mycoplasma mobile: relationships between motility and cell
morphology, cell adhesion and microcolony formation. Microbiology 146: 1311-1320.

Mohri, M., Sharifi, K., and Eidi, S. (2007) Hematology and serum biochemistry of Holstein dairy
calves: Age related changes and comparison with blood composition in adults. Res Vet Sci
83: 30-39.

Morin, D.E. (2004) Brainstem and cranial nerve abnormalities: listeriosis, otitis media/interna,
and pituitary abscess syndrome. Vet Clin North Am Food Anim Pract 20: 243-273.

Morita, T., Fukuda, H., Awakura, T., Shimada, A., Umemura, T., Kazama, S., and Yagihashi, T.
(1995) Demonstration ofMycoplasma hyorhinis as a possible primary pathogen for
porcine otitis media. Vet Pathol 32: 107-111.

Morita, T., Ohiwa, S., Shimada, A., Kazama, S., Yagihashi, T., and Umemura, T. (1999)
Intranasally inoculated Mycoplasma hyorhinis causes eustachitis in pigs. Vet Pathol 36:
174-178.

Morris, D.P., and Hagr, A. (2005) Biofilm: why the sudden interest?. J Otolaryngol 34 (Suppl
2): S56-S59.

Mosier, D.A. (1997) Bacterial pneumonia. Vet Clin North Am FoodAnim Pract 13: 483-493.

Musser, J., Mechor, G.D., Grohn, Y.T., Dubovi, E.J., and Shin, S. (1996) Comparison of
tilmicosin with long-acting oxytetracycline for treatment of respiratory tract disease in
calves. JAm VetMedAssoc 208: 102-106.









Nagahata, H., Kojima, N., Higashitani, I., Ogawa, H., and Noda, H. (1991) Postnatal changes in
lymphocyte function of dairy calves. Zentralbl VeterinarmedB 38: 49-54.

Nagatomo, H., Shimizu, T., Higashiyama, Y., Yano, Y., Kuroki, H., and Hamana, K. (1996)
Antibody response to Mycoplasma bovis of calves introduced to a farm contaminated with
the organism. J Vet Med Sci 58: 919-920.

Naot, Y., Davidson, S., and Lindenbaum, E.S. (1984) Role of mitogenicity in pathogenicity of
mycoplasmas for murine hosts. Ann Microbiol (Paris) 135A: 95-101.

Narita, M., Tanaka, H., Abe, S., Yamada, S., Kubota, M., and Togashi, T. (2000) Close
association between pulmonary disease manifestation in Mycoplasma pneumoniae
infection and enhanced local production of interleukin-18 in the lung, independent of
gamma interferon. Clin Diagn Lab Immunol 7: 909-914.

Nation, P.N., Frelier, P.F., Gifford, G.A., and Carnat, B.D. (1983) Otitis in Feedlot Cattle. Can
Vet J24: 238.

Nicholas, R., and Baker, S. (1998) Recovery of mycoplasmas from animals. Methods Mol Biol
104: 37-43.

Nicholas, R.A., and Ayling, R.D. (2003) Mycoplasma bovis: disease, diagnosis, and control. Res
Vet Sci 74: 105-112.

Nicholas, R.A., Ayling, R.D., and Stipkovits, L.P (2002) An experimental vaccine for calf
pneumonia caused by Mycoplasma bovis: clinical, cultural, serological and pathological
findings. Vaccine 20: 3569-3575.

Nieminen, T., Virolainen, A., Kayhty, H., Jero, J., Karma, P., Leinonen, M., and Eskola, J.
(1996) Antibody-secreting cells and their relation to humoral antibodies in serum and in
nasopharyngeal aspirates in children with pneumococcal acute otitis media. JInfect Dis
173: 136-141.

Nonnecke, B.J., Foote, M.R., Smith, J.M., Pesch, B.A., and Van Amburgh, M.E. (2003)
Composition and functional capacity of blood mononuclear leukocyte populations from
neonatal calves on standard and intensified milk replacer diets. JDairy Sci 86: 3592-3604.

Nonnecke, B.J., Horst, R.L., Waters, W.R., Dubeski, P., and Harp, J.A. (1999) Modulation of
fat-soluble vitamin concentrations and blood mononuclear leukocyte populations in milk
replacer-fed calves by dietary vitamin A and beta-carotene. JDairy Sci 82: 2632-2641.

Nonnecke, B.J., Waters, W.R., Foote, M.R., Palmer, M.V., Miller, B.L., Johnson, T.E., Perry,
H.B., and Fowler, M.A. (2005) Development of an adult-like cell-mediated immune
response in calves after early vaccination with Mycobacterium bovis bacillus Calmette-
Guerin. JDairy Sci 88: 195-210.









Nussbaum, S., Lysnyansky, I., Sachse, K., Levisohn, S., and Yogev, D. (2002) Extended
repertoire of genes encoding variable surface lipoproteins in Mycoplasma bovis strains.
Infect Immun 70: 2220-2225.

Ogra, P.L. (2000) Mucosal immune response in the ear, nose and throat. Pediatr Infect Dis J
19: S4-S8.

Okada, M., Sakano, T., Senna, K., Maruyama, T., Murofushi, J., Okonogi, H., and Sato, S.
(1999) Evaluation of Mycoplasma hyopneumoniae inactivated vaccine in pigs under field
conditions. J Vet Med Sci 61: 1131-1135.

Ota, M.O., Vekemans, J., Schlegel-Haueter, S.E., Fielding, K., Sanneh, M., Kidd, M., Newport,
M.J., Aaby, P., Whittle, H., Lambert, P.H., McAdam, K.P., Siegrist, C.A., and Marchant,
A. (2002) Influence ofMycobacterium bovis bacillus Calmette-Guerin on antibody and
cytokine responses to human neonatal vaccination. JImmunol 168: 919-925.

Paananen, R., Sormunen, R., Glumoff, V., van Eijk, M., and Hallman, M. (2001) Surfactant
proteins A and D in eustachian tube epithelium. Am JPhysiol Lung CellMol Physiol 281:
L660-L667.

Papazisi, L., Silbart, L.K., Frasca, S., Rood, D., Liao, X., Gladd, M., Javed, M.A., and Geary,
S.J. (2002) A modified live Mycoplasma gallisepticum vaccine to protect chickens from
respiratory disease. Vaccine 20: 3709-3719.

Paradise, J.L., Bluestone, C.D., Colborn, D.K., Bernard, B.S., Smith, C.G., Rockette, H.E., and
Kurs-Lasky, M. (1999) Adenoidectomy and adenotonsillectomy for recurrent acute otitis
media: parallel randomized clinical trials in children not previously treated with
tympanostomy tubes. JAMA 282: 945-953.

Park, Y.H., Fox, L.K., Hamilton, M.J., and Davis, W.C. (1992) Bovine mononuclear leukocyte
subpopulations in peripheral blood and mammary gland secretions during lactation. J
Dairy Sci 75: 998-1006.

Parker, R.F., Davis, J.K., Blalock, D.K., Thorp, R.B., Simecka, J.W., and Cassell, G.H. (1987)
Pulmonary clearance of Mycoplasmapulmonis in C57BL/6N and C3H/HeN mice. Infect
Immun 55: 2631-2635.

Parker, R.F., Davis, J.K., Cassell, G.H., White, H., Dziedzic, D., Blalock, D.K., Thorp, R.B., and
Simecka, J.W. (1989) Short-term exposure to nitrogen dioxide enhances susceptibility to
murine respiratory mycoplasmosis and decreases intrapulmonary killing of Mycoplasma
pulmonis. Am Rev Respir Dis 140: 502-512.

Pasquini, C. (1983) Atlas of bovine anatomy. Eureka, CA: Sudz Publishing.

Pfutzner, H., and Blaha, T. (1995) The etiologic and economic importance of Mycoplasma
hyopneumoniae in the respiratory disease complex of pigs. Tierarztliche Umschau 50: 759.









Pfutzner, H., Kielstein, P., Martin, J., and Schimmel, D. (1983a) [Mycoplasma infection of
calves. 2. Experimental infection of calves with Mycoplasma bovis]. Arch Exp
Veterinarmed 37: 445-451.

Pfutzner, H., and Meeser, G. (1986) Heating of milk to kill Mycoplasma bovis. Arch Exp
Veterinarmed 40: 44-47.

Pfutzner, H., and Sachse, K. (1996) Mycoplasma bovis as an agent of mastitis, pneumonia,
arthritis and genital disorders in cattle. Rev Sci Tech 15: 1477-1494.

Pfutzner, H., Scherwa, B., and Trubner, S. (1983b) [Sensitivity of Mycoplasma bovis to
disinfection agents applied to the udder area]. Arch Exp Veterinarmed 37: 485-489.

Pfutzner, H., and Schimmel, D. (1985) [Mycoplasma bovis isolation in the offspring of cows
with M bovis mastitis and its epizootiological significance]. Zentralbl VeterinarmedB 32:
265-279.

Picavet, T., Muylle, E., Devriese, L.A., and Geryl, J. (1991) Efficacy of tilmicosin in treatment
of pulmonary infections in calves. Vet Rec 129: 400-403.

Pinnow, C.C., Butler, J.A., Sachse, K., Hotzel, H., Timms, L.L., and Rosenbusch, R.F. (2001)
Detection of Mycoplasma bovis in preservative-treated field milk samples. JDairy Sci 84:
1640-1645.

Poetker, D.M., Ubell, M.L., and Kerschner, J.E. (2006) Disease severity in patients referred to
pediatric otolaryngologists with a diagnosis of otitis media. Int JPediatr Otorhinolaryngol
70: 311-317.

Pollock, C.M., Campbell, J.R., Janzen, E.D., and West, K. (2000) Descriptive epidemiology of
chronic disease of calves in a Western Canadian feedlot. In Proceedings 33rd Annu Conf
Am Assoc Bov Practitioners, pp. 152-153.

Pollock, J.M., and Welsh, M.D. (2002) The WC1(+) gamma delta T-cell population in cattle: a
possible role in resistance to intracellular infection. Vet Immunol Immunopathol 89: 105-
114.

Pollock, M.E., and Bonner, S.V. (1969) Comparison of undefined medium and its dialyzable
fraction for growth of Mycoplasma. JBacteriol 97: 522-525.

Post, J.C. (2001) Direct evidence of bacterial biofilms in otitis media. Laryngoscope 111: 2083-
2094.

Post, J.C., Stoodley, P., Hall-Stoodley, L., and Ehrlich, G.D. (2004) The role of biofilms in
otolaryngologic infections. Curr Opin Otolaryngol Head Neck Surg 12: 185-190.

Potter, A.A., Schryvers, A.B., Ogunnariwo, J.A., Hutchins, W.A., Lo, R.Y., and Watts, T. (1999)
Protective capacity of the Pasteurella haemolytica transferrin-binding proteins TbpA and
TbpB in cattle. Microb Pathog 27: 197-206.









Poumarat, F., Le Grand, D., Philippe, S., Calavas, D., Schelcher, F., Cabanie, P., Tessier, P., and
Navetat, H. (2001) Efficacy of spectinomycin against Mycoplasma bovis induced
pneumonia in conventionally reared calves. Vet Microbiol 80: 23-35.

Poumarat, F., Le Grand, D., Solsona, M., Rosengarten, R., and Citti, C. (1999) Vsp antigens and
vsp-related DNA sequences in field isolates of Mycoplasma bovis. FEMSMicrobiol Lett
173: 103-110.

Poumarat, F., Perrin, B., and Longchambon, D. (1991) Identification of ruminant mycoplasmas
by dot immunobinding on membrane filtration (MF dot). Vet Microbiol 29: 329-338.

Poumarat, F., Solsona, M., and Boldini, M. (1994) Genomic, protein and antigenic variability of
Mycoplasma bovis. Vet Microbiol 40: 305-321.

Prgomet, C., Prenner, M.L., Schwarz, F.J., and Pfaffl, M.W. (2007) Effect of lactoferrin on
selected immune system parameters and the gastrointestinal morphology in growing
calves. JAnim Physiol Anim Nutr (Berl) 91: 109-119.

Price, S.J., Sopp, P., Howard, C.J., and Hope, J.C. (2007) Workshop cluster 1+ gammadelta
T cell receptor T cells from calves express high levels of interferon-gamma in response to
stimulation with interleukin-12 and -18. Immunology 120: 57-65.

Pringle, J.K., Viel, L., Shewen, P.E., Willoughby, R.A., Martin, S.W., and Valli, V.E. (1988)
Bronchoalveolar lavage of cranial and caudal lung regions in selected normal calves:
cellular, microbiological, immunoglobulin, serological and histological variables. Can J
Vet Res 52: 239-248.

Ramirez-Romero, R., Brogden, K.A., Gallup, J.M., Dixon, R.A., and Ackermann, M.R. (2000)
Reduction of pulmonary mast cells in areas of acute inflammation in calves with
Mannheimia (Pasteurella) haemolytica pneumonia. J Comp Pathol 123: 29-35.

Rasberry, U., and Rosenbusch, R.F. (1995) Membrane-associated and cytosolic species-specific
antigens of Mycoplasma bovis recognized by monoclonal antibodies. Hybridoma 14: 481-
485.

Rautiainen, E., and Wallgren, P. (2001) Aspects of the transmission of protection against
Mycoplasma hyopneumoniae from sow to offspring. J Vet Med B Infect Dis Vet Public
Health 48: 55-65.

Razin, S. (1992) Mycoplasma taxonomy and ecology. In Mycoplasmas: molecular biology and
plithigene,%i%. Maniloff, J. (ed). Washington, D.C.: American Society for Microbiology,
pp. 3-22.

Razin, S., Yogev, D., and Naot, Y. (1998) Molecular biology and pathogenicity of mycoplasmas.
Microbiol Mol Biol Rev 62: 1094-1156.

Rebelatto, M.C., Mead, C., and HogenEsch, H. (2000) Lymphocyte populations and adhesion
molecule expression in bovine tonsils. Vet Immunol Immunopathol 73: 15-29.









Reber, A.J., Hippen, A.R., and Hurley, D.J. (2005) Effects of the ingestion of whole colostrum or
cell-free colostrum on the capacity of leukocytes in newborn calves to stimulate or respond
in one-way mixed leukocyte cultures. Am J Vet Res 66: 1854-1860.

Reber, A.J., Lockwood, A., Hippen, A.R., and Hurley, D.J. (2006) Colostrum induced
phenotypic and trafficking changes in maternal mononuclear cells in a peripheral blood
leukocyte model for study of leukocyte transfer to the neonatal calf. Vet Immunol
Immunopathol 109: 139-150.

Reinhold, P., and Elmer, S. (2002) Consequences of changing ambient temperatures in calves -
Part 2: Changes in the health status within three weeks after exposure. Dtsch Tierarztl
Wochenschr 109: 193-200.

Riedel-Caspari, G. (1993) The influence of colostral leukocytes on the course of an experimental
Escherichia coli infection and serum antibodies in neonatal calves. Vet Immunol
Immunopathol 35: 275-288.

Riedel-Caspari, G., and Schmidt, F.W. (1991a) The influence of colostral leukocytes on the
immune system of the neonatal calf. I. Effects on lymphocyte responses. Dtsch Tierarztl
Wochenschr 98: 102-107.

Riedel-Caspari, G., and Schmidt, F.W. (1991b) The influence of colostral leukocytes on the
immune system of the neonatal calf. II. Effects on passive and active immunization. Dtsch
Tierarztl Wochenschr 98: 190-194.

Robino, P., Alberti, A., Pittau, M., Chessa, B., Miciletta, M., Nebbia, P., Le Grand, D., and
Rosati, S. (2005) Genetic and antigenic characterization of the surface lipoprotein P48 of
Mycoplasma bovis. Vet Microbiol 109: 201-209.

Rodriguez, F., Bryson, D.G., Ball, H.J., and Forster, F. (1996) Pathological and
immunohistochemical studies of natural and experimental Mycoplasma bovis pneumonia
in calves. J Comp Pathol 115: 151-162.

Rodriguez, F., Fernandez, A., Oros, J., Ramirez, A.S., Luque, R., Ball, H.J., and Sarradell, J.
(2001) Changes in lymphocyte subsets in the bronchus-associated lymphoid tissue of goats
naturally infected with different Mycoplasma species. J Vet Med B Infect Dis Vet Public
Health 48: 259-266.

Rodriguez, F., Sarradell, J., Poveda, J.B., Ball, H.J., and Fernandez, A. (2000)
Immunohistochemical characterization of lung lesions induced experimentally by
Mycoplasma agalactiae and Mycoplasma bovis in goats. J Comp Pathol 123: 285-293.

Rogers, A.N., Vanburen, D.G., Hedblom, E.E., Tilahun, M.E., Telfer, J.C., and Baldwin, C.L.
(2005) Gamma delta T cell function varies with the expressed WC 1 coreceptor. JImmunol
174: 3386-3393.









Rogers, A.N., Vanburen, D.G., Zou, B., Lahmers, K.K., Herzig, C.T., Brown, W.C., Telfer, J.C.,
and Baldwin, C.L. (2006) Characterization of WC 1 co-receptors on functionally distinct
subpopulations of ruminant gamma delta T cells. Cell Immunol 239: 151-161.

Roland, P.S. (2002) Chronic suppurative otitis media: a clinical overview. Ear Nose Throat J
81: 8-10.

Romvary, J., Rozsa, J., Stipkovits, L., and Meszaros, J. (1979) Incidence of diseases due to
Mycoplasma bovis in a cattle herd .2. Experimental therapy of the pneumo-arthritis
syndrome of calves. Acta Vet AcadSci Hung 27: 39-45.

Rosenbusch, R. (2001) Bovine mycoplasmosis. In Proceedings 34th Annu Conf Am Assoc Bov
Practitioners, pp. 49-52.

Rosenbusch, R.F. (1995) Acute feedlot arthritis associated with distinct strains of Mycoplasma
bovis. In Proceedings 27th Annu Conf Am Assoc Bov Practitioners, pp. 191-192.

Rosenbusch, R.F. (1996a) A species-specific cytotoxic activity from certain Mycoplasma bovis
strains is not host-cell specific. IOMLett 4: 147.

Rosenbusch, R.F. (1996b) Abscess-producing potential of Mycoplasma bovis strains lacking in-
vitro cytotoxic activity. IOMLett 4: 29.

Rosenbusch, R.F. (1998) Test of an inactivated vaccine against Mycoplasma bovis respiratory
disease by transthoracic challenge with an abscessing strain. IOMLett 5: 185.

Rosenbusch, R.F., Kinyon, J.M., Apley, M., Funk, N.D., Smith, S., and Hoffman, L.J. (2005) In
vitro antimicrobial inhibition profiles of Mycoplasma bovis isolates recovered from various
regions of the United States from 2002 to 2003. J Vet Diagn Invest 17: 436-441.

Rosendal, S., and Martin, S.W. (1986) The association between serological evidence of
mycoplasma infection and respiratory disease in feedlot calves. Can J Vet Res 50: 179-
183.

Rosenfeld, R.M., Culpepper, L., Doyle, K.J., Grundfast, K.M., Hoberman, A., Kenna, M.A.,
Lieberthal, A.S., Mahoney, M., Wahl, R.A., Woods, C.R. Jr., and Yawn, B. (2004) Clinical
practice guideline: Otitis media with effusion. Otolaryngol Head Neck Surg 130: S95-118.

Rosengarten, R., Behrens, A., Stetefeld, A., Heller, M., Ahrens, M., Sachse, K., Yogev, D., and
Kirchhoff, H. (1994) Antigen heterogeneity among isolates of Mycoplasma bovis is
generated by high-frequency variation of diverse membrane surface proteins. Infect Immun
62: 5066-5074.

Rosengarten, R., and Citti, C. (1999) The role of ruminant mycoplasmas in systemic infection. In
Mycoplasmas of ruminants: pathogenicity, diagnostics, epidemiology and molecular
genetics. Stipkovits, L., Rosengarten, R., and Frey, J. (eds). Brussels: European
Commission, pp. 14-17.









Rosengarten, R., Citti, C., Glew, M., Lischewski, A., Droesse, M., Much, P., Winner, F., Brank,
M., and Spergser, J. (2000) Host-pathogen interactions in mycoplasma pathogenesis:
Virulence and survival strategies of minimalist prokaryotes. Int JMedMicrobiol 290: 15-
25.

Rosengarten, R., Citti, C., Much, P., Spergser, J., Droesse, M., and Hewicker-Trautwein, M.
(2001) The changing image of mycoplasmas: from innocent bystanders to emerging and
reemerging pathogens in human and animal diseases. Contrib Microbiol 8: 166-185.

Rosengarten, R., and Yogev, D. (1996) Variant colony surface antigenic phenotypes within
Mycoplasma strain populations: Implications for species identification and strain
standardization. J Clin Microbiol 34: 149-158.

Rottem, S., and Naot, Y. (1998) Subversion and exploitation of host cells by mycoplasmas.
Trends Microbiol 6: 436-440.

Ruhnke, H.L., Thawley, D., and Nelson, F.C. (1976) Bovine mastitis in Ontario due to
Mycoplasma agalactiae subsp. bovis. Can J Comp Med 40: 142-148.

Ruiz, A.R., Utrera, V., and Pijoan, C. (2003) Effect of Mycoplasma hyopneumoniae sow
vaccination on piglet colonization at weaning. Journal of Swine Health and Production 11:
131-135.

Ryan, M.J., Wyand, D.S., Hill, D.L., Tourtellotte, M.E., and Yang, T.J. (1983) Morphologic
changes following intraarticular inoculation of Mycoplasma bovis in calves. Vet Pathol 20:
472-487.

Rynnel-Dagoo, B., and Freijd, A. (1988) Nasopharyngeal lymphoid tissue--a threat to the middle
ear?. Acta Otolaryngol Suppi 454: 208-209.

Sachse, K., Grajetzki, C., Rosengarten, R., Hanel, I., Heller, M., and Pfutzner, H. (1996)
Mechanisms and factors involved in Mycoplasma bovis adhesion to host cells. Zentralbl
Bakteriol 284: 80-92.

Sachse, K., Helbig, J.H., Lysnyansky, I., Grajetzki, C., Muller, W., Jacobs, E., and Yogev, D.
(2000) Epitope mapping of immunogenic and adhesive structures in repetitive domains of
Mycoplasma bovis variable surface lipoproteins. Infect Immun 68: 680-687.

Sasaki, M., Davis, C.L., and Larson, B.L. (1976) Production and turnover of IgGI and IgG2
immunoglobulins in the bovine around parturition. JDairy Sci 59: 2046-2055.

Sauer, K. (2003) The genomics and proteomics of biofilm formation. Genome Biol 4: 219.

Schnepper, R. (2002) Practice Tips. In Proceedings 35th Annu Conf Am Assoc Bov
Practitioners, pp. 26-28.

Schuh, J.C., and Oliphant, L.W. (1992) Development and immunophenotyping of the pharyngeal
tonsil (adenoid) in cattle. J Comp Pathol 106: 229-241.









Schumacher, I.M., Brown, M.B., Jacobson, E.R., Collins, B.R., and Klein, P.A. (1993) Detection
of antibodies to a pathogenic mycoplasma in desert tortoises (Gopherus agassizii) with
upper respiratory tract disease. J Clin Microbiol 31: 1454-1460.

Schunicht, O.C., Guichon, P.T., Booker, C.W., Jim, G.K., Wildman, B.K., Hill, B.W., Ward,
T.I., Bauck, S.W., and Jacobsen, J.A. (2002) A comparison of prophylactic efficacy of
tilmicosin and a new formulation of oxytetracycline in feedlot calves. Can Vet J43: 355-
362.

Seffner, W., and Pfutzner, H. (1980) [Mycoplasma mastitis of cattle. 8. Pathological anatomy
and histology of experimental Mycoplasma bovis mastitis], Arch Exp Veterinarmed 34:
817-826.

Seggev, J.S., Sedmak, G.V., and Kurup, V.P. (1996) Isotype-specific antibody responses to acute
Mycoplasma pneumoniae infection. Ann Allergy Asthma Immunol 77: 67-73.

Senogles, D.R., Muscoplat, C.C., Paul, P.S., and Johnson, D.W. (1978) Ontogeny of circulating
B lymphocytes in neonatal calves. Res Vet Sci 25: 34-36.

Seya, T., Matsumoto, M., Tsuji, S., Begum, N.A., Azuma, I., and Toyoshima, K. (2002)
Structural-functional relationship of pathogen-associated molecular patterns: lessons from
BCG cell wall skeleton and mycoplasma lipoprotein M161Ag. Microbes Infect 4: 955-961.

Shahriar, F.M., Clark, E.G., and Janzen, E. (2000) Mycoplasma bovis and primary bovine virus
diarrhea virus co-association in chronic pneumonia of feedlot cattle: a histopathological
and immunohistochemical study. In Proceedings 33rd Annu Conf Am Assoc Bov
Practitioners, pp. 146-147.

Shahriar, F.M., Clark, E.G., Janzen, E., West, K., and Wobeser, G. (2002) Coinfection with
bovine viral diarrhea virus and Mycoplasma bovis in feedlot cattle with chronic
pneumonia. Can Vet J 43: 863-868.

Sheoran, A.S., Timoney, J.F., Holmes, M.A., Karzenski, S.S., and Crisman, M.V. (2000)
Immunoglobulin isotypes in sera and nasal mucosal secretions and their neonatal transfer
and distribution in horses. Am J Vet Res 61: 1099-1105.

Shimoji, Y., Oishi, E., Kitajima, T., Muneta, Y., Shimizu, S., and Mori, Y. (2002) El) ipei/,,th iv
rhusiopathiae YS-1 as a live vaccine vehicle for heterologous protein expression and
intranasal immunization of pigs. Infect Immun 70: 226-232.

Siegrist, C.A. (2000) Vaccination in the neonatal period and early infancy. Int Rev Immunol
19: 195-219.

Simecka, J.W., Davis, J.K., and Cassell, G.H. (1987) Specific vs. nonspecific immune responses
in murine respiratory mycoplasmosis. Isr JMed Sci 23: 485-489.









Simecka, J.W., Davis, J.K., Davidson, M.K., Ross, S.E., Stadtlander, C.T., and Cassell, G.H.
(1992) Mycoplasma diseases of animals. in Mycoplasmas: molecular biology and
pliuthigene,%i%. Maniloff, J. (ed). Washington, D.C.: American Society for Microbiology,
pp. 391-415.

Simecka, J.W., Jackson, R.J., Kiyono, H., and McGhee, J.R. (2000) Mucosally induced
immunoglobulin E-associated inflammation in the respiratory tract. Infect Immun 68: 672-
679.

Simecka, J.W., Patel, P., Davis, J.K., Ross, S.E., Otwell, P., and Cassell, G.H. (1991) Specific
and nonspecific antibody responses in different segments of the respiratory tract in rats
infected with Mycoplasma pulmonis. Infect Immun 59: 3715-3721.

Simmons, W.L., Bolland, J.R., Daubenspeck, J.M., and Dybvig, K. (2007) A stochastic
mechanism for biofilm formation by Mycoplasma pulmonis. JBacteriol 189: 1905-1913.

Simmons, W.L., Denison, A.M., and Dybvig, K. (2004) Resistance of Mycoplasmapulmonis to
complement lysis is dependent on the number of Vsa tandem repeats: shield hypothesis.
Infect Immun 72: 6846-6851.

Simmons, W.L., and Dybvig, K. (2003) The Vsa proteins modulate susceptibility of Mycoplasma
pulmonis to complement killing, hemadsorption, and adherence to polystyrene. Infect
Immun 71: 5733-5738.

Simmons, W.L., and Dybvig, K. (2007) Biofilms protect Mycoplasmapulmonis cells from the
lytic effects of complement and gramicidin. Infect Immun 75: 3696-3699.

Sivula, N.J., Ames, T.R., Marsh, W.E., and Werdin, R.E. (1996) Descriptive epidemiology of
morbidity and mortality in Minnesota dairy heifer calves. Prev Vet Med 27: 155-171.

Sopp, P., and Howard, C.J. (2001) IFN gamma and IL-4 production by CD4, CD8 and WC1
gamma delta TCR+ T cells from cattle lymph nodes and blood. Vet Immunol
Immunopathol 81: 85-96.

Sordillo, L.M., Shafer-Weaver, K., and DeRosa, D. (1997) Immunobiology of the mammary
gland. JDairy Sci 80: 1851-1865.

Springer, W.T., Fulton, R.W., Hagstad, H.V., Nicholson, S.S., and Garton, J.D. (1982)
Prevalence of Mycoplasma and Chlamydia in the nasal flora of dairy calves. Vet Microbiol
7: 351-357.

Stabel, J.R, Hurd, S., Calvente, L., and Rosenbusch, R.F. (2004) Destruction of Mycobacterium
paratuberculosis, Salmonella spp., and Mycoplasma spp. in raw milk by a commercial on-
farm high-temperature, short-time pasteurizer. JDairy Sci 87: 2177-2183.

Stalheim, O.H., and Page, L.A. (1975) Naturally occurring and experimentally induced
mycoplasmal arthritis of cattle. J Clin Microbiol 2: 165-168.









Stalheim, O.H., and Stone SS (1975) Isolation and identification of Mycoplasma agalactiae
subsp. bovis from arthritic cattle in Iowa and Nebraska. J Clin Microbiol 2: 169-172.

Stanarius A, Seffner, W., and Pfutzner, H. (1981) [Mycoplasma mastitis in cattle. 9. Electron
microscopic findings in experimental Mycoplasma bovis mastitis]. Arch Exp Veterinarmed
35: 511-524.

Stanley, N.R., and Lazazzera, B.A. (2004) Environmental signals and regulatory pathways that
influence biofilm formation. Mol Microbiol 52: 917-924.

Stelmach, I., Podsiadlowicz-Borzecka, M., Grzelewski, T., Majak, P., Stelmach, W., Jerzynska,
J., Poplawska, M., and Dziadek, J. (2005) Humoral and cellular immunity in children with
Mycoplasma pneumoniae infection: a 1-year prospective study. Clin Diagn Lab Immunol
12: 1246-1250.

Step, D.L., and Kirkpatrick, J.G. (2001a) Mycoplasma infection in cattle. I. Pneumonia-arthritis
syndrome. Bovine Practitioner 35: 149-155.

Step, D.L., and Kirkpatrick, J.G. (2001b) Mycoplasma infection in cattle. II. Mastitis and other
diseases. Bovine Practitioner 35: 171-176.

Stipkovits, L., Rady, M., and Glavits, R. (1993) Mycoplasmal arthritis and meningitis in calves.
Acta Vet Hung 41: 73-88.

Stipkovits, L., Ripley, P., Varga, J., and Palfi, V. (2000) Clinical study of the disease of calves
associated with Mycoplasma bovis infection. Acta Vet Hung 48: 387-395.

Stipkovits, L., Ripley, P.H, Tenk, M., Glavits, R., Molnar, T., and Fodor, L. (2005) The efficacy
of valnemulin (Econor) in the control of disease caused by experimental infection of calves
with Mycoplasma bovis. Res Vet Sci 78: 207-215.

Stipkovits, L., Ripley, P.H, Varga, J., and Palfi, V. (2001) Use ofvalnemulin in the control of
Mycoplasma bovis infection under field conditions. Vet Rec 148: 399-402.

Stokka, G.L., Lechtenberg, K., Edwards, T., MacGregor, S., Voss, K., Griffin, D.,
Grotelueschen, D.M., Smith, R.A., and Perino, L.J. (2001) Lameness in feedlot cattle. Vet
Clin North Am FoodAnim Pract 17: 189-207.

Stott, E.J., Thomas, L.H., Howard, C.J., and Gourlay, R.N. (1987) Field trial of a quadrivalent
vaccine against calf respiratory disease. Vet Rec 121: 342-347.

Subramaniam, S., Bergonier, D., Poumarat, F., Capaul, S., Schlatter, Y., Nicolet, J., and Frey, J.
(1998) Species identification ofMycoplasma bovis and Mycoplasma agalactiae based on
the uvrC genes by PCR. Mol Cell Probes 12: 161-169.









Sun, X., Jones, H.P., Hodge, L.M., and Simecka, J.W. (2006) Cytokine and chemokine
transcription profile during Mycoplasma pulmonis infection in susceptible and resistant
strains of mice: macrophage inflammatory protein lbeta (CCL4) and monocyte
chemoattractant protein 2 (CCL8) and accumulation of CCR5+ Th cells. Infect Immun 74:
5943-5954.

Svinhufvud, M., Hellstrom, S., Hermansson, A., and Prellner, K. (1992) Mucosal
immunoreactivity in experimental pneumococcal otitis media. APMIS 100: 1015-1021.

Takahashi, M., Kanai, N., Watanabe, A., Oshima, 0., and Ryan, A.F. (1992) Lymphocyte
subsets in immune-mediated otitis media with effusion. Eur Arch Otorhinolaryngol 249:
24-27.

Taylor, G., and Howard, C.J. (1980) Class-specific antibody responses to Mycoplasmapulmonis
in sera and lungs of infected and vaccinated mice. Infect Immun 29: 1160-1168.

Taylor, G., Howard, C.J., and Gourlay, R.N. (1977) Protective effect of vaccines on Mycoplasma
pulmonis-induced respiratory disease of mice. Infect Immun 16: 422-431.

Taylor, G., and Taylor-Robinson, D. (1977) Factors in resistance to and recovery from M
pulmonis-induced arthritis in mice. Ann Rheum Dis 36: 232-238.

Taylor, G., Thomas, L.H., Wyld, S.G., Furze, J., Sopp, P., and Howard, C.J. (1995) Role of T-
lymphocyte subsets in recovery from respiratory syncytial virus-infection in calves. J Virol
69: 6658-6664.

Taylor-Robinson, D., and Bebear, C. (1997) Antibiotic susceptibilities of mycoplasmas and
treatment of mycoplasmal infections. JAntimicrob Chemother 40: 622-630.

Taylor-Robinson, D., and Chen, T.A. (1983) Growth Inhibitory Factors in Animal and Plant
Tissues. In Methods in Mycoplasmology. Razin, S. and Tully, J.G. (eds). New York:
Academic Press, Inc., pp. 109-114.

Taylor-Robinson, D., Webster, A.D., Furr, P.M., and Asherson, G.L. (1980) Prolonged
persistence of Mycoplasmapneumoniae in a patient with hypogammaglobulinaemia. J
Infect 2: 171-175.

Tenk, M., Stipkovits, L., and Hufnagel, L. (2004) Examination of the role of Mycoplasma bovis
in bovine pneumonia and a mathematical model for its evaluation. Acta Vet Hung 52: 445-
456.

ter Laak, E.A., Noordergraaf, J.H., and Boomsluiter, E. (1992a) The nasal mycoplasmal flora of
healthy calves and cows. Zentralbl VeterinarmedB 39: 610-616.

ter Laak, E.A., Noordergraaf, J.H., and Dieltjes, R.P. (1992b) Prevalence of mycoplasmas in the
respiratory tracts of pneumonic calves. Zentralbl VeterinarmedB 39: 553-562.









Thacker, E.L., Thacker, B.J., Kuhn, M., Hawkins, P.A., and Waters, W.R. (2000) Evaluation of
local and systemic immune responses induced by intramuscular injection of a Mycoplasma
hyopneumoniae bacterin to pigs. Am J Vet Res 61: 1384-1389.

Thiaucourt, F., Aboubakar, Y., Wesonga, H., Manso-Silvan, L., and Blanchard, A. (2004)
Contagious bovine pleuropneumonia vaccines and control strategies: recent data. Dev Biol
(Basel) 119: 99-111.

Thiaucourt, F., Dedieu, L., Maillard, J.C., Bonnet, P., Lesnoff, M., Laval, G., and Provost, A.
(2003) Contagious bovine pleuropneumonia vaccines, historic highlights, present situation
and hopes. Dev Biol (Basel) 114: 147-160.

Thiaucourt, F., Lorenzon, S., David, A., Tulasne, J.J., and Domenech, J. (1998) Vaccination
against contagious bovine pleuropneumonia and the use of molecular tools in
epidemiology. Ann N.Y. Acad Sci 849: 146-151.

Thomas, A., Ball, H., Dizier, I., Trolin, A., Bell, C., Mainil, J., and Linden, A. (2002a) Isolation
of mycoplasma species from the lower respiratory tract of healthy cattle and cattle with
respiratory disease in Belgium. Vet Rec 151: 472-476.

Thomas, A., Dizier, I., Linden, A., Mainil, J., Frey, J., and Vilei, E.M. (2004) Conservation of
the uvrC gene sequence in Mycoplasma bovis and its use in routine PCR diagnosis. Vet J
168: 100-102.

Thomas, A., Dizier, I., Trolin, A., Mainil, J., and Linden, A. (2002b) Comparison of sampling
procedures for isolating pulmonary mycoplasmas in cattle. Vet Res Commun 26: 333-339.

Thomas, A., Leprince, P., Dizier, I., Ball, H., Gevaert, K., Van Damme, J., Mainil, J., and
Linden, A. (2005a) Identification by two-dimensional electrophoresis of a new adhesin
expressed by a low-passaged strain of Mycoplasma bovis. Res Microbiol 156: 713-718.

Thomas, A., Linden, A., Mainil, J., Bischof, D.F., Frey, J., and Vilei, E.M. (2005b) Mycoplasma
bovis shares insertion sequences with Mycoplasma agalactiae and Mycoplasma mycoides
subsp. mycoides SC: Evolutionary and developmental aspects. FEMSMicrobiolLett 245:
249-255.

Thomas, A., Nicolas, C., Dizier, I., Mainil, J., and Linden, A. (2003a) Antibiotic susceptibilities
of recent isolates of Mycoplasma bovis in Belgium. Vet Rec 153: 428-431.

Thomas, A., Sachse, K., Dizier, I., Grajetzki, C., Farnir, F., Mainil, J.G, and Linden, A. (2003b)
Adherence to various host cell lines of Mycoplasma bovis strains differing in pathogenic
and cultural features. Vet Microbiol 91: 101-113.

Thomas, A., Sachse, K., Farnir, F., Dizier, I., Mainil, J., and Linden, A. (2003c) Adherence of
Mycoplasma bovis to bovine bronchial epithelial cells. Microb Pathog 34: 141-148.









Thomas, C.B., Mettler, J., Sharp, P., Jensen-Kostenbader, J., and Schultz, R.D. (1990)
Mycoplasma bovis suppression of bovine lymphocyte response to phytohemagglutinin. Vet
Immunol Immunopathol 26: 143-155.

Thomas, C.B., Van Ess, P., Wolfgram, L.J., Riebe, J., Sharp, P., and Schultz, R.D. (1991)
Adherence to bovine neutrophils and suppression of neutrophil chemiluminescence by
Mycoplasma bovis. Vet Immunol Immunopathol 27: 365-381.

Thomas, C.B., Willeberg, P., and Jasper, D.E. (1981) Case-control study of bovine mycoplasmal
mastitis in California. Am J Vet Res 42: 511-515.

Thomas, E., Madelenat, A., Davot, J.L., and Boisrame, B. (1998) Clinical efficacy and tolerance
of marbofloxacin and oxytetracycline in the treatment of bovine respiratory disease.
Recueil de Medecine Veterinaire 174: 21-27.

Thomas, L.H., Howard, C.J., and Gourlay, R.N. (1975) Isolation ofMycoplasma agalactiae var
bovis from a calf pneumonia outbreak in the south of England. Vet Rec 97: 55-56.

Thomas, L.H., Howard, C.J., Parsons, K.R., and Anger, H.S. (1987) Growth of Mycoplasma
bovis in organ cultures of bovine foetal trachea and comparison with Mycoplasma dispar.
VetMicrobiol 13: 189-200.

Thomas, L.H., Howard, C.J., Stott, E.J., and Parsons, K.R. (1986) Mycoplasma bovis infection in
gnotobiotic calves and combined infection with respiratory syncytial virus. Vet Pathol 23:
571-578.

Thomas, L.H., and Swann, R.G. (1973) Influence of colostrum on the incidence of calf
pneumonia. Vet Rec 92: 454-455.

Thomson, D.U., and White, B.J. (2006) Backgrounding beef cattle. Vet Clin North Am Food
Anim Pract 22: 373-398.

Tola, S., Idini, G., Manunta, D., Galleri, G., Angioi, A., Rocchigiani, A.M., and Leori, G. (1996)
Rapid and specific detection of Mycoplasma agalactiae by polymerase chain reaction. Vet
Microbiol 51: 77-84.

Tong, H.H., Fisher, L.M., Kosunick, G.M., and DeMaria, T.F. (2000) Effect of adenovirus type 1
and influenza A virus on Streptococcus pneumoniae nasopharyngeal colonization and otitis
media in the chinchilla. Ann Otol Rhinol Laryngol 109: 1021-1027.

Tschopp, R., Bonnemain, P., Nicolet, J., and Burnens, A. (2001) [Epidemiological study of risk
factors for Mycoplasma bovis infections in fattening calves]. Schweiz Arch Tierheilkd 143:
461-467.

Tully, J.G. (1981) Mycoplasmal Toxins. Isr JMedSci 17: 604-607.









Tully, J.G. (1983) General cultivation techniques for mycoplasmas and spiroplasmas. In Methods
in Mycoplasmology. Razin, S. and Tully, J.G. (eds). New York: Academic Press, Inc., pp.
99-101.

Uhaa, I.J., Riemann, H.P., Thurmond, M.C., and Franti, C.E. (1990) The use of the enzyme-
linked immunosorbent assay (ELISA) in serological diagnosis of Mycoplasma bovis in
dairy cattle. Vet Res Commun 14: 279-285.

Urbaneck, D., Liebig, F., Forbrig, T., and Stache, B. (2000) Experiences with herd-specific
vaccines against respiratory infections with M. bovis in a large feedlot. Praktische Tierarzt
81: 756-763.

Uribe, H.A., Kennedy, B.W., Martin, S.W., and Kelton, D.F. (1995) Genetic parameters for
common health disorders of Holstein cows. JDairy Sci 78: 421-430.

USDA:APHIS. (2003) Mycoplasma in bulk tank milk on U.S. dairies. Info..h/eet #N395.0503.
Fort Collins, CO: USDA APHIS.

Van Biervliet, J., Perkins, G.A., Woodie, B., Pelligrini-Massini, A., Divers, T.J., and de Lahunta,
A. (2004) Clinical signs, computed tomographic imaging, and management of chronic
otitis media/interna in dairy calves. J Vet Intern Med 18: 907-910.

Van Donkersgoed, J., Ribble, C.S., Boyer, L.G., and Townsend, H.G. (1993) Epidemiological
study of enzootic pneumonia in dairy calves in Saskatchewan. Can J Vet Res 57: 247-254.

Vanden Bush, T.J., and Rosenbusch, R.F. (2002) Mycoplasma bovis induces apoptosis of bovine
lymphocytes. FEMS Immunol MedMicrobiol 32: 97-103.

Vanden Bush, T.J., and Rosenbusch, R.F. (2003) Characterization of the immune response to
Mycoplasma bovis lung infection. Vet Immunol Immunopathol 94: 23-33.

Villarroel, A., Heller, M., and Lane, V.M. (2006) Imaging study of myringotomy in dairy calves.
Bovine Practitioner 40: 14-17.

Virolainen, A., Jero, J., Kayhty, H., Karma, P., Leinonen, M., and Eskola, J. (1995) Antibodies
to pneumolysin and pneumococcal capsular polysaccharides in middle ear fluid of children
with acute otitis media. Acta Otolaryngol 115: 796-803.

Virtala, A.M., Grohn, Y.T., Mechor, G.D., Erb, H.N., and Dubovi, E.J. (2000) Association of
seroconversion with isolation of agents in transtracheal wash fluids collected from
pneumonic calves less than three months of age. Bovine Practitioner 34: 77-80.

Virtala, A.M., Mechor, G.D., Grohn, Y.T., and Erb, H.N. (1996a) The effect of calfhood diseases
on growth of female dairy calves during the first 3 months of life in New York State. J
Dairy Sci 79: 1040-1049.









Virtala, A.M.K., Mechor, G.D., Grohn, Y.T., Erb, H.N., and Dubovi, E.J. (1996b) Epidemiologic
and pathologic characteristics of respiratory tract disease in dairy heifers during the first
three months of life. JAm VetMedAssoc 208: 2035-2042.

Vlastarakos, P.V., Nikolopoulos, T.P., Maragoudakis, P., Tzagaroulakis, A., and Ferekidis, E.
(2007) Biofilms in ear, nose, and throat infections: How important are they?.
Laryngoscope 117: 668-673.

Vogel, G., Nicolet, J., Martig, J., Tschudi, P., and Meylan, M. (2001) [Pneumonia in calves:
characterization of the bacterial spectrum and the resistance patterns to antimicrobial
drugs]. Schweiz Arch Tierheilkd 143: 341-350.

Waites, K.B., and Taylor-Robinson, D. (1999) Mycoplasmas and Ureaplasmas. In Manual of
Clinical Microbiology. Murray, P.R., Baron, E.J., Pfeller, M.A., Tenovar, F.C., and
Yolken, R.H. (eds). Washington, D.C.: American Society for Microbiology, pp. 782-794.

Walker, R.D., Corstvet, R.E., Lessley, B.A., and Panciera, R.J. (1980) Study of bovine
pulmonary response to Pasteurella haemolytica: specificity of immunoglobulins isolated
from the bovine lung. Am J Vet Res 41: 1015-1023.

Waltner-Toews, D., Martin, S.W., and Meek, A.H. (1986) The effect of early calfhood health
status on survivorship and age at first calving. Can J Vet Res 50: 314-317.

Walz, P.H., Mullaney, T.P., Render, J.A., Walker, R.D., Mosser, T., and Baker, J.C. (1997)
Otitis media in preweaned Holstein dairy calves in Michigan due to Mycoplasma bovis. J
Vet Diagn Invest 9: 250-254.

Wamick, L.D., Erb, H.N., and White, M.E. (1995) Lack of association between calf morbidity
and subsequent first lactation milk production in 25 New York Holstein herds. JDairy Sci
78: 2819-2830.

Wamick, L.D., Erb, H.N., and White, M.E. (1997) The relationship of calfhood morbidity with
survival after calving in 25 New York Holstein herds. Prev Vet Med 31: 263-273.

Watanabe, N., Yoshimura, H., Shinoda, M., Bundo, J., and Mogi, G. (1992) Lymphocyte-
mucosal interaction of the middle ear mucosa. Acta Otolaryngol Suppl 493: 137-140.

Weiss, R.A., Chanana, A.D., and Joel, D.D. (1986) Postnatal maturation of pulmonary
antimicrobial defense mechanisms in conventional and germ-free lambs. Pediatr Res 20:
496-504.

Wells, P.W., Dawson, A.M, Smith, W.D., and Smith, B.S. (1975) Transfer of IgG from plasma
to nasal secretions in newborn lambs. Vet Rec 97: 455.

Wells, S.J., Garber, L.P., and Hill, G.W. (1997) Health status of preweaned dairy heifers in the
United States. Prev Vet Med 29: 185-199.









Whithear, K.G. (1996) Control of avian mycoplasmoses by vaccination, Rev Sci Tech 15: 1527-
1553.

Wiggins, M.C., Woolums, A.R., Sanchez, S., Hurley, D.J., Cole, D.J., Ensley, D.T., and Pence,
M.E. (2007) Prevalence of Mycoplasma bovis in backgrounding and stocker cattle
operations. JAm VetMedAssoc 230: 1514-1518.

Wilkie, B., and Mallard, B. (1999) Selection for high immune response: an alternative approach
to animal health maintenance?. Vet Immunol Immunopathol 72: 231-235.

Wilkie, B.N., and Markham, R.J. (1981) Bronchoalveolar washing cells and immunoglobulins of
clinically normal calves. Am J Vet Res 42: 241-243.

Williams, M.R., Spooner, R.L., and Thomas, L.H. (1975) Quantitative studies on bovine
immunoglobulins. Vet Rec 96: 81-84.

Wilson, D.J., Gonzalez, R.N., and Das, H.H. (1997) Bovine mastitis pathogens in New York and
Pennsylvania: Prevalence and effects on somatic cell count and milk production. JDairy
Sci 80: 2592-2598.

Wilson, E., Aydintug, M.K., and Jutila, M.A. (1999) A circulating bovine gamma delta T cell
subset, which is found in large numbers in the spleen, accumulates inefficiently in an
artificial site of inflammation: correlation with lack of expression of E-selectin ligands and
L-selectin. JImmunol 162: 4914-4919.

Wilson, E., Hedges, J.F., Butcher, E.C., Briskin, M., and Jutila, M.A. (2002) Bovine gamma
delta T cell subsets express distinct patterns of chemokine responsiveness and adhesion
molecules: a mechanism for tissue-specific gamma delta T cell subset accumulation. J
Immunol 169: 4970-4975.

Wilson, E., Walcheck, B., Davis, W.C., and Jutila, M.A. (1998) Preferential tissue localization of
bovine gamma delta T cell subsets defined by anti-T cell receptor for antigen antibodies.
Immunol Lett 64: 39-44.

Wilson, M.L., Menjivar, E., Kalapatapu, V., Hand, A.P., Garber, J., and Ruiz, M.A. (2007)
Mycoplasmapneumoniae associated with hemolytic anemia, cold agglutinins, and
recurrent arterial thrombosis. ,Smih MedJ 100: 215-217.

Wilson, R.A., Zolnai, A., Rudas, P., and Frenyo, L.V. (1996) T-Cell subsets in blood and
lymphoid tissues obtained from fetal calves, maturing calves, and adult bovine. Vet
Immunol Immunopathol 53: 49-60.

Windsor, R.S., Masiga, W.N., and Boarer, C.D. (1974) A single comparative intradermal test for
the diagnosis of contagious bovine pleuropneumonia. Res Vet Sci 17: 5-23.

Woldehiwet, Z., Mamache, B., and Rowan, T.G. (1990) Effects of age, environmental
temperature and relative humidity on the colonization of the nose and trachea of calves by
Mycoplasma spp. Br Vet J 146: 419-424.









Woolard, M.D., Hodge, L.M., Jones, H.P., Schoeb, T.R., and Simecka, J.W. (2004) The upper
and lower respiratory tracts differ in their requirement of IFN-gamma and IL-4 in
controlling respiratory mycoplasma infection and disease. JImmunol 172: 6875-6883.

Woolard, M.D., Hudig, D., Tabor, L., Ivey, J.A., and Simecka, J.W. (2005) NK cells in gamma-
interferon-deficient mice suppress lung innate immunity against Mycoplasma spp. Infect
Immun 73: 6742-6751.

Woolums, A.R., Siger, L., Johnson, S., Gallo, G., and Conlon, J. (2003) Rapid onset of
protection following vaccination of calves with multivalent vaccines containing modified-
live or modified-live and killed BHV-1 is associated with virus-specific interferon gamma
production. Vaccine 21: 1158-1164.

Wyatt, C.R., Brackett, E.J., Perryman, L.E., and Davis, W.C. (1996) Identification of gamma
delta T lymphocyte subsets that populate calf ileal mucosa after birth. Vet Immunol
Immunopathol 52: 91-103.

Wyatt, C.R., Madruga, C., Cluff, C., Parish, S., Hamilton, M.J., Goff, W., and Davis, W.C.
(1994) Differential distribution of gamma-delta-T-cell receptor lymphocyte subpopulations
in blood and spleen of young and adult cattle. Vet Immunol Immunopathol 40: 187-199.

Xu, X., Zhang, D., Lyubynska, N., Wolters, P.J., Killeen, N.P., Baluk, P., McDonald, D.M.,
Hawgood, S., and Caughey, G.H. (2006a) Mast cells protect mice from Mycoplasma
pneumonia. Am JRespir Crit Care Med 173: 219-225.

Xu, X., Zhang, D., Zhang, H., Wolters, P.J., Killeen, N.P., Sullivan, B.M., Locksley, R.M.,
Lowell, C.A., and Caughey, G.H. (2006b) Neutrophil histamine contributes to
inflammation in mycoplasma pneumonia. JExp Med 203: 2907-2917.

Yancey, A.L., Watson, H.L., Cartner, S.C., and Simecka, J.W. (2001) Gender is a major factor in
determining the severity of mycoplasma respiratory disease in mice. Infect Immun 69:
2865-2871.

Yang, J., Hooper, W.C., Phillips, D.J., and Talkington, D.F. (2002) Regulation of
proinflammatory cytokines in human lung epithelial cells infected with Mycoplasma
pneumoniae. Infect Immun 70: 3649-3655.

Yano, T., Ichikawa, Y., Komatu, S., Arai, S., and Oizumi, K. (1994) Association of Mycoplasma
pneumoniae antigen with initial onset of bronchial asthma. Am JRespir Crit Care Med
149: 1348-1353.

Yeo, S.P., Stokes, C.R., Taylor, F.G., and Bourne, F.J. (1993) Maturation of cellular defense in
the respiratory tract of young calves. Res Vet Sci 55: 292-297.









BIOGRAPHICAL SKETCH

Dr. Fiona P. Maunsell received her veterinary degree with honors in 1990 from the

University of Melbourne in Victoria, Australia. She then worked in private practice in

Newcastle, Australia until 1993. In 1995, Dr. Maunsell completed an internship in food animal

medicine and surgery at the University of Illinois, and followed this with a 3-year residency

program. She concurrently received a Master of Science degree from the University of Illinois in

1999. She is a Diplomate of the American College of Veterinary Internal Medicine (large animal

internal medicine). After her residency, she joined the faculty in Food Animal Medicine and

Surgery at the University of Illinois before moving to the University of Florida in 1999 for her

doctoral research training.

Dr. Maunsell's clinical interests include diseases of dairy replacement heifers and

metabolic and infectious diseases of cattle, particularly mastitis. Her research interests are

focused on ruminant mycoplasmal infections, and, in particular, on Mycoplasma bovis infections

of young calves. She was the recipient of the American Association of Bovine Practitioners

Research Summaries Graduate Student Award, 36th Annual Convention of the American

Association of Bovine Practitioners, Columbus, OH, 2003. Dr. Maunsell is a member of the

following professional societies: American Association of Bovine Practitioners, American Dairy

Science Association, American Veterinary Medical Association, Australian Veterinary

Association, The Society of Phi Zeta (Honor Society of Veterinary Medicine), and the

International Organization for Mycoplasmology





PAGE 1

1 Mycoplasma bovis INFECTION OF DAIRY C ALVES By FIONA P. MAUNSELL A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2007

PAGE 2

2 2007 Fiona P Maunsell

PAGE 3

3 To my parents, Pauline and John; and my husband, Fred.

PAGE 4

4 ACKNOWLEDGMENTS First and foremost, I am extremely grateful to my supervisory committee chair and mentor ( Dr. Mary Brown ) for her infectious enthusiasm about the world of mycoplasmas and for her wonderful encouragement and support. I am also extremely grat eful to Dr. Art Donovan and Dr. Jerry Simecka for giving me the opportunity to be involved in their research studies and for their mentorship and support. I would especially like to thank Dr. Donovan for all his hands on help with the field studies and for helping me to keep a balanced perspective on the world! I wish to thank Dr. Tom Brown, Dr. Peter Hansen and Dr. Maureen Long for serving on my supervisory committee and for the helpful advice they have provided. I acknowledge the many members of the Brow n lab who have worked so hard on these research projects. A large number of people were involved and without their participation the work presented here would not have been possible. Barbara Crenshaw and Janet Stevens have helped me with so many things thr ough my lengthy doctoral studies, including (but not limited to) keeping me stocked with all of the supplies I need, keeping me and my technicians paid, helping plan, set up and conduct experimental studies and running laboratory assays. They have also pro vided wonderful shoulders to lean on when shoulders were needed! Many thanks to Dina Demcovitz for her help with assays and her ever positive attitude in the laboratory. My fellow graduate students in our laboratory have given me help and support during th ese research studies. In particular I thank Carolina Perez Heydrich for her assistance with data analysis, and LeAnn White for her help on the calf infection studies, especially for her fantastic organizational skills. Ayman Allam has provided helpful disc ussions and assistance with experimental design as well as friendship accompanied by many wonderful cups of tea. Thank you to my office mates Dr. Margaret Riggs and Dr. Lori Wendland for their help with problem solving and for their friendship. I am very a ppreciative for the numerous helpful suggestions and fresh perspectives on

PAGE 5

5 problems in the laboratory that Dr. Leticia Reyes and Dr. Dan Brown have provided during my doctoral research. For their contributions to the vaccine efficacy field trial, I would like to thank Shelly Lanhart for her skilled help in sample collection and for keeping me awake on the many trips back and forth to the study farms, and Drs. Eduardo Garbarino and Christian Steenholdt for taking many of the photographs for this study. In a ddition, I appreciate the contributions to study design and analyses made by Dr. Carlos Risco, Dr. Jorge Hernandez and David Bray For their help with the laboratory work I thank Dr. Marissa Curtis and Dr. Kelly Kirk. I am deeply indebted to the herd owner s who agreed to participate in the study and to the calf rearing personnel who recorded data and vaccinated calves. In particular, I thank Sherry Hay and the rest of the heifer crew at the UF Dairy Research Unit for their help with both this study and with providing the calves for the experimental infection studies. For their contributions to the calf infection studies, I thank the members of the Simecka laboratory that traveled to Florida to assist with calf necropsies, especially Drew Ivey, Dr. Matthew W oodard and Wees Love. In particular I thank Drew for his work optimizing the flow cytometry and ELIspot assays. Calf necropsies necessitated the help of almost all members of our laboratory and I am deeply grateful to all of them for their willingness to a djust their schedules and participate. In particular, I thank Janet Stevens and Barbara Crenshaw for their help with managing these studies and with the culture work, Dina Demcovitz for help with the lymphocyte assays and Venus Appel and Annette Mach for t heir work on the insertion sequence typing. Dr. Joshua Powe, Dr. William Castleman and Dr. Jeffery Abbott helped me with the development of the histopathological scoring systems and with the reading of slides. In particular I am indebted to Dr. Powe for al l his help with the processing and reading of the middle ear

PAGE 6

6 samples. A number of people assisted with the care and sampling of calves; in particular I thank Erin Barney, Jessica Coan, Katherine Sayler, Mason Simmons, Dr. Lindsay Smith and LeAnn White for their wonderful assistance. I thank Rachelle Wright and Luis Zorilla, as well as all the members of the large animal team in UF Animal Care Services, for working so hard to accommodate my needs and for doing a great job of caring for the calves. Above all I am deeply indebted to my husband Fred for his love and support, and for hanging in there through m y very lengthy academic career The research in this dissertation was supported by Florida Dairy Checkoff funds and USDA NRI Animal Health & Well Being aw ard 2002 02147.

PAGE 7

7 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ ............... 4 LIST OF TABLES ................................ ................................ ................................ ......................... 10 LIST OF FIGURES ................................ ................................ ................................ ....................... 11 ABSTRACT ................................ ................................ ................................ ................................ ... 13 CHAPTER 1 Mycoplasma bovis AND BOVINE IMMUNOLOGY : REVIEW OF LITERATURE .......... 15 Overview ................................ ................................ ................................ ................................ 15 Calf Specific Disease ................................ ................................ ................................ .............. 16 Evidence for M. bovis as an Etiologic Agent of Calf Disease ................................ ......... 16 Clinical Disease in Dairy Calves ................................ ................................ ..................... 18 Economic Losses ................................ ................................ ................................ ............. 25 Animal Welfare ................................ ................................ ................................ ............... 27 Epidemiology ................................ ................................ ................................ .......................... 27 Colonization and Shedding ................................ ................................ .............................. 27 Transmission and Risk Factors ................................ ................................ ........................ 29 Molecular Epidemiology ................................ ................................ ................................ 39 Pathology ................................ ................................ ................................ ................................ 40 Diagnosis ................................ ................................ ................................ ................................ 45 Treatment ................................ ................................ ................................ ................................ 53 Control and Prevention ................................ ................................ ................................ ........... 57 Microbial Pathogenesis ................................ ................................ ................................ ........... 61 Antigenic Variation ................................ ................................ ................................ ......... 61 Adhesion ................................ ................................ ................................ .......................... 63 Biofilms ................................ ................................ ................................ ........................... 64 Other Microbial Factors That Might Contribute to M. bovis Virulence .......................... 66 Bovine Immunology: Relevant Background Information ................................ ...................... 67 Lymphocyte Subpopulations in Cattle ................................ ................................ ............ 67 Anatomical Barriers and Innate Defenses of the Bovine Respiratory Tract ................... 72 Adaptive Immune Responses of the Bovine Respiratory Tract ................................ ...... 74 Immunology of the Neonatal Calf ................................ ................................ .......................... 75 Influence o f Colostrum ................................ ................................ ................................ .... 76 Innate Immune Responses in Neonatal Calves ................................ ............................... 78 Adaptive Immune Responses in Neonatal Calves ................................ ........................... 79 Summary of the Neonatal Calf Immune Response ................................ ......................... 83 Immunology of the Eustachian Tube and Middle Ear ................................ ............................ 84 Immune Responses to Mycoplasmal Infections, with a Focus on M. bovis ........................... 87 Innate Immune Responses to Mycoplasmal Infections ................................ ................... 88

PAGE 8

8 Adaptive Immune Responses to Mycoplasmal Infections ................................ .............. 92 Humoral Immune Responses to M. bovis in Cattle ................................ ......................... 94 Function of Humoral Responses to Mycoplasmal Infections ................................ .......... 97 The Role of T Cell Responses to Mycoplasmal Infections ................................ ............. 99 Cytokine and T Helpe r Subset Responses to Mycoplasmal Infections ......................... 102 Recruitment of T Cells in Mycoplasmal Infections ................................ ...................... 103 Immunomodulatory Effects o f M. bovis on Bovine Lymphocytes ............................... 104 Hypersensitivity Responses to M. bovis Infections ................................ ....................... 105 Protective Immunity to M. bovis ................................ ................................ .......................... 106 Relevant Experiences with Mycoplasmal Vaccines for Diseases Other Than M. bovis ................................ ................................ ................................ ...................... 106 Vaccination Against M. bovis ................................ ................................ ........................ 110 Experimental Infection with M. bovis in Calves ................................ ................................ .. 115 Summary and Critical Gaps in Knowledge ................................ ................................ .......... 116 Overall Goals of Study ................................ ................................ ................................ ......... 118 2 F IELD E VALUATION OF A Mycoplasma bovis BACTERIN IN YOUNG DAIRY CALVES ................................ ................................ ................................ ............................... 124 Introdu ction ................................ ................................ ................................ ........................... 124 Methods ................................ ................................ ................................ ................................ 127 Study Populations ................................ ................................ ................................ .......... 127 Study Design ................................ ................................ ................................ ................. 128 Collection and Processing of Nasal Swabs ................................ ................................ ... 130 The ELISA Procedure ................................ ................................ ................................ ... 132 Field Necropsy ................................ ................................ ................................ ............... 133 Sample Size ................................ ................................ ................................ ................... 134 Statistical Methods ................................ ................................ ................................ ........ 135 Res ults ................................ ................................ ................................ ................................ ... 135 Discussion ................................ ................................ ................................ ............................. 138 3 O RAL INOCULATION OF DAIRY CALVES WITH Mycoplasma bovis RESULTS IN RESPIRATORY TRACT INFECTION AND OTIT IS MEDIA : ESTABLISHMENT OF A MODEL OF AN EMERGING PROBLEM ................................ ............................... 153 Introduction ................................ ................................ ................................ ........................... 153 Methods ................................ ................................ ................................ ................................ 155 Calves ................................ ................................ ................................ ............................ 155 Strain of M. bovis and Experimental Infection ................................ .............................. 156 Clinical Monitoring and Sample Collectio n ................................ ................................ .. 157 Collection of Tissues ................................ ................................ ................................ ..... 158 Histopathology ................................ ................................ ................................ .............. 159 Microbiology ................................ ................................ ................................ ................. 160 Insertion Sequence Typing ................................ ................................ ............................ 161 The ELISA Procedure ................................ ................................ ................................ ... 163 Statis tical Analysis ................................ ................................ ................................ ........ 165 Results ................................ ................................ ................................ ................................ ... 165

PAGE 9

9 Oral Inoculation of Calves and Development of Clinical Disease ................................ 165 Colonization of the Upper Respiratory Tract ................................ ................................ 167 Isolation of M. bovis from Lungs and Clinical Signs of Respiratory Disease ............... 168 Colonization of the Tonsil and Development of Disease ................................ .............. 168 Gross and Histopathologic Lesions ................................ ................................ ............... 169 Immunoglobulin Response ................................ ................................ ............................ 170 Discussion ................................ ................................ ................................ ............................. 171 4 I MMUNE R ESPONSES IN THE RESPIRATORY TRACT OF CALVES INFECTED WITH Mycoplasma bovis ................................ ................................ ................................ ..... 188 Introduction ................................ ................................ ................................ ........................... 188 Materials and Methods ................................ ................................ ................................ ......... 193 Calves ................................ ................................ ................................ ............................ 193 Strain of M. bovis and Experimental Infection ................................ .............................. 194 Preparation of Mononuclear Cells from Blood and Tissues ................................ ......... 195 Immunofluorescent Characterization of T Cell Populations ................................ ......... 196 ELIspot Assay ................................ ................................ ................................ ............... 197 The ELIS A Procedure ................................ ................................ ................................ ... 198 Statistical Analyses ................................ ................................ ................................ ........ 199 Results ................................ ................................ ................................ ................................ ... 200 Isolation o f M. bovis from Experimentally Infected Calves ................................ .......... 200 Clinical Disease and Pathology in Experimentally Infected Calves ............................. 200 Complete Blood Counts and T Cell Responses in Peripheral Blood and Spleen .......... 201 T Cell Populations in the URT and LRT ................................ ................................ ....... 202 B cell and Antib ody Responses ................................ ................................ ..................... 202 Discussion ................................ ................................ ................................ ............................. 205 5 CONCLUSIONS AND FUTURE DIRECTIONS ................................ ............................... 217 Field Efficacy of a Commercial M. bovis Bacterin in Young Dairy Calves ........................ 217 Establishment of an Experimental Model of M. bovis Infection and Immune Responses in the Respiratory Tract o f Infected Neonatal Calves ................................ ....................... 219 Implications for Control of M. bovis in Young Calves and Future Research Directions ..... 221 LIST OF R EFERENCES ................................ ................................ ................................ ............. 227 BIOGRAPHICAL SKETCH ................................ ................................ ................................ ....... 269

PAGE 10

10 LIST OF TABLES Table page 2 1 Clinical definitions of disease used by calf producers during this study. ........................ 144 2 2 Summary of calves enrolled in vaccine field efficacy study ................................ ........... 145 2 3 Incidence risk for Mycoplasma bovis associated disease and mortality between 3 and 90 days of age in calves in the three study herds ................................ ............................ 145 2 4 Baseline data for calves in Herds B and C ................................ ................................ ....... 145 2 5 The age at which calves in Herds B and C received their first treatm ent for otitis media or respiratory disease ................................ ................................ ............................. 146 2 6 Temporal expression of Mycoplasma bovis associated disease in vaccinated and control calves in Herds B and C ................................ ................................ ...................... 146 2 7 Morbidity due to respiratory disease in vaccinated and control calves ........................... 147 2 8 Morbidity due to otitis media in vaccinated and control calves ................................ ...... 147 2 9 Overall and Mycoplasma bovis associated mortality in vaccinated and control calves .. 148

PAGE 11

11 LIST OF FIGURES Figure page 1 1 Clinical manifestations of Mycoplasma bovis associated respiratory disease ................. 119 1 2 Cli nical manifestations and macroscopic lesions of Mycoplasma bovis associated otitis media. ................................ ................................ ................................ ...................... 120 1 3 Clinical manifestations and macroscopic lesions of Mycoplasma bovis associated arthritis and t enosynovitis ................................ ................................ ................................ 121 1 4 Substantial economic costs are incurred for treatment and management of calves with Mycoplasma bovis associated disease ................................ ................................ ..... 122 1 5 Ingestion of milk contaminated with Mycoplasma bovis is a primary route of transmission in pre weaned calves ................................ ................................ ................... 123 2 1 Calf housing conditions for the three study farms ................................ ........................... 143 2 2 Sampling of a subset of calves in Herds A and B ................................ ............................ 14 4 2 3 Temporal pattern of nasal colonization of calves by Mycoplasma bovis in Herds A and B. ................................ ................................ ................................ ............................... 148 2 4 Immunoglobulin A response in vaccinated and control calves ................................ ....... 149 2 5 Immunoglobulin M response in vacci nated and control calves ................................ ....... 150 2 6 Immunoglobulin G 2 response in vaccinated and control calves ................................ ...... 151 2 7 Immunoglobulin G 1 response in vaccinated and control calves ................................ ...... 152 3 1 Number of days that calves had a daily clinical score of > 2 ................................ .......... 178 3 2 The number of Myco plasma bovis recovered at necropsy. ................................ .............. 179 3 3 Relationship between the number of Mycoplasma bovis recovered from the left and right eustachian tubes (L ET and R ET, respectively) and pharyngeal tonsils in calves inoculated with M. bovis by either the oral ( n =8) or transtracheal ( n =5) routes ............. 181 3 4 Macroscopic lesions of otitis media in calves orally inoculated with Mycoplasma bovis ................................ ................................ ................................ ................................ 182 3 5 Histopathology of retropharyngeal lymph nodes from control calves ( n= 8) or calves inoculated with Mycoplasma bovis by oral ( n= 8) or transtracheal ( n= 5) routes ............ 183

PAGE 12

12 3 6 Representative histopathological findings in retropharyngeal lymph nodes of calves inoculated with sterile carrier (controls) or with Mycoplasma bovis by oral or transtracheal routes ................................ ................................ ................................ .......... 184 3 7 Representative macroscopic lung lesion in a calf experimentally infected with Mycoplasma bovis by the oral route ................................ ................................ ................ 185 3 8 Histopathological finding s in the lungs of calves inoculated with sterile carrier (controls, n= 8) or with Mycoplasma bovis by oral ( n= 8) or transtracheal ( n= 5) routes. ................................ ................................ ................................ ............................... 186 3 9 Geometric mean end point titers for Mycop lasma bovis specific serum IgG ................. 187 4 1 Overall experimental design for the infection study ................................ ........................ 209 4 2 Weights (mean SD) of upper and lower respiratory tract lymph nodes ....................... 210 4 3 Relative percentages of CD4 + CD8 + and WC1 + T cells in mononuclear cells isolated from upper respiratory tract, lower respiratory tract, and systemic sites ........... 211 4 4 Mycoplasma bovis specific B cell responses along the respiratory tract as determined by ELIspot assay ................................ ................................ ................................ .............. 213 4 5 Mucosal antibody responses in the upper respiratory tract ................................ .............. 214 4 6 Mucosal antibody responses in the upper respiratory tract of individual calves with or without otitis media ................................ ................................ ................................ ..... 215 4 7 Geometric mean end point titers for Mycoplasma bovis specific serum immunoglobulin (Ig) ................................ ................................ ................................ ........ 216

PAGE 13

13 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy Mycoplasma bovis INFECTION OF DAIRY CALVES By Fiona P Maunsell August 2007 Chair: Mary B. Brown Major: Veterinary Medical Sciences Mycoplasma bovis is an important cause of pneumonia, otitis media and arthritis in young dairy calves, and there is a critical need to develop improved preventative strategies for this disease Because there is a lack of efficacy data for M. bovis vaccines, especially in young calves, we evaluated a commercial M. bovis vaccine in this age group However, our major research focus was to define local immune responses to M. bovis in young calves. Specific objectives were to develop a reproducible model of M. bovis infection of the upper respiratory tract (URT) that mimicked natural infection and to define lymphocyte responses generated along the respiratory tract during M. bovis infection in young calves. A field trial to determine the efficacy of a commercial M. bovis vaccine for the prevention of M. bovis associated disease in calves was conducted on three Florida dairies. Vaccination had no effect on rates of nasal colonization with M. bovis age at first treatment, incidence of respiratory disease or mortality to 90 days of age In one herd, vaccination was associated with an increased risk of otitis media. We defined a model of M. bovis infection that mimics natural disease by feeding milk cont aining M. bovis to young calves. M ycoplasma bovis consistently colonized the eustachian tubes as well as the tonsils of inoculated calves, and otitis media and pneumonia developed in a

PAGE 14

14 subset of calves. Evaluation of immune responses along the respiratory tract showed that the infection site corresponded to the distribution of immune responses. The URT lymphoid tissues were major sites for B and T cell responses after oral infection, and M. bovis specific mucosal IgA responses were observed. Overall, we fou nd t hat local immune responses are important in the pathogenesis of M. bovis The oral inoculation model will facilitate further study of host pathogen interactions during colonization, expansion of infection and dissemination to the lungs and middle ear as well as providing a tool for evaluating new control strategies for M. bovis infection of young calves.

PAGE 15

15 CHAPTER 1 My coplasma bovis AND BOVINE IMMUNOLOG Y: REVIEW OF LITERAT URE Overview Mycoplasmas belong to the class Mollicutes (from the Latin mollis soft; cutis skin), a group of bacteria so named because they lack cell walls, instead being enveloped by a c omplex plasma membrane. Mollicutes are also characterized by their tiny size, small genomes (0.58 to 2.2 Mb), and low G + C content (24 to 33 mol %) (Razin et al ., 1998) Perhaps as a direct consequence of the limited biosynthetic capacity of their small g enome, mycoplasmas usually form an intimate association with host cells to obtain growth and nutritional factors necessary for survival (Rosengarten et al ., 2001) Mollicutes are found in a wide range of hosts including mammals, birds, reptiles, fish, arth ropods and plants (Razin, 1992) Their individual relationship with the host varies from primary or opportunistic pathogens to commensals or epiphytes. In mammalian hosts, mollicutes typically inhabit mucosal surfaces, including those of the respiratory, urogenital and gastrointestinal tracts, eyes, and the mammary gland (Rosengarten et al ., 2000) As is typical of many mucosal pathogens pathogenic species of mollicutes may inhabit some mucosal sites without causing disease (Rottem and Naot, 1998; Hickman Davis, 2002) Disease occurs when host and/or pathogen factors result in dissemination to other sites (e.g. from the nasal mucosa to the lower respiratory tract [ LRT ] ), invasion and destruction of host tissues, or a detrimental inflammatory response. Hema tologic dissemination from mucosal surfaces can occur, with the joints being a frequent site of secondary colonization (Simecka et al ., 1992) Mollicutes are very effective at evading and modulating the host immune response and the immune response contribu tes significantly to the pathogenesis of many mollicute associated diseases (Simecka et al ., 1992; Rosengarten et al ., 2000)

PAGE 16

16 Mycoplasma bovis was first isolated from a case of severe mastitis in a U. S. dairy cow in 1961 (Hale et al ., 1962), and is now r ecognized as a world wide pathogen of intensively farmed cattle. At least nine pathogenic and numerous non pathogenic mycoplasma species have been isolated from cattle (Simecka et al ., 1992). The most severe ruminant disease is caused by M ycoplasma mycoide s subsp. mycoides biotype small colony (SC) the etiologic agent of contagious bovine pleuropneumonia, an Office International des Epizootes List A disease. In North America and most of Europe, where contagious bovine pleuropneumonia has been eradicated, M bovis is considered the most pathogenic of the bovine mycoplasmas (Nicholas and Ayling, 2003) It causes mastitis in dairy cows (Gonzalez et al ., 1992; Pfutzner and Sachse, 1996; Fox et al ., 2003; Gonzalez and Wilson, 2003) and pneumonia and arthritis in feeder and stocker cattle (Kusiluka et al ., 2000b; Haines et al ., 2001; Tschopp et al ., 2001; Shahriar et al ., 2002; Thomas et al ., 2002a; Gagea et al ., 2006) In addition, in the past decade M. bovis has emerged as an important cause of pneumonia and oti tis media in dairy calves (Stipkovits et al ., 2001; Nicholas and Ayling, 2003; Francoz et al ., 2004; Lamm et al ., 2004) Calf Specific Disease Evidence for M. bovis as an E tiologic A gent of C alf D isease It is now well established that M. bovis is a primar y cause of respiratory disease, otitis media and arthritis in calves. There are many reports of respiratory disease o utbreaks where M. bovis was the predominant bacteria isolated from lungs of affected calves (Buchvarova and Vesselinova, 1989; Gourlay et a l ., 1989a; Brown et al ., 1998a; Stipkovits et al ., 2000; Bashiruddin et al ., 2001; Rosenbusch, 2001; Stipkovits et al ., 2001) In addition, although bovine pneumonia rarely involves a single infectious agent, experimental infection studies have shown that inoculation with M. bovis alone can cause pneumonia in calves (Gourlay et al ., 1976; Thomas et al ., 1986; Poumarat et al ., 2001) S eroconversion to M. bovis is associated with

PAGE 17

17 increased respiratory disease rates (Martin et al ., 1990) as well as decreased w eight gain and increased number of antibiotic treatments in feedlot calves (Van Donkersgoed et al ., 1993; Tschopp et al ., 2001) However, as with most bovine respiratory pathogens, colonization is not always sufficient cause for disease. Mycoplasma bovis c an be isolated from the upper respiratory tract (URT), trachea, and LRT of calves without clinical disease or gross lesions (Bennett and Jasper, 1977c; Springer et al ., 1982; Allen et al ., 1992a; Virtala et al ., 1996b; Tenk et al ., 2004) although its pres ence in the LRT may cause subclinical inflammation (Allen et al ., 1992b) Despite these findings, isolation of M. bovis as the predominant pathogen in numerous outbreaks of respiratory disease and experimental confirmation of its ability to cause pneumonia in calves verify its role as an important respiratory pathogen. Field cases of respiratory disease caused by M. bovis are sometimes accompanied by arthritis, and M. bovis has been isolated in pure culture from affected joints, as well as from the lungs o f calves with concurrent respiratory disease (Stalheim and Page, 1975; Stipkovits et al ., 1993; Rosenbusch, 1995; Adegboye et al ., 1996; Butler et al ., 2000; Byrne et al ., 2001) Consistent with the observations of natural disease, arthritis has been induc ed by inoculation of M. bovis into joints or lungs, or intravenously (Stalheim and Page, 1975; Gourlay et al ., 1976; Chima et al ., 1980; Ryan et al ., 1983; Thomas et al ., 1986; Linker et al ., 1998) Variation among clinical isolates of M. bovis in their ab ility to cause arthritis in an experimental infection model has been reported (Rosenbusch, 1995) In addition to causing disease of the LRT and arthritis, M. bovis is the predominant pathogen isolated from the middle ear of young calves with otitis media ( Dechant and Donovan, 1995; Walz et al ., 1997; Maeda et al ., 2003; Francoz et al ., 2004; Lamm et al ., 2004) However, o ther bacteria, including Mycoplasma bovirhinis Mycoplasma alkalescens Mycoplasma

PAGE 18

18 arginini Pasteurella multocida, Mannheimia haemolytica Histophilus somni, and Arcanobacterium pyogenes are isolated sporadically, and some have been associated with outbreaks of otitis media, especially in feedlot cattle (Jensen et al ., 1983; Nation et al ., 1983; McEwen and Hulland, 1985; Henderson and McCul lough, 1993; Dechant and Donovan, 1995; Lamm et al ., 2004; Gagea et al ., 2006) In tropical regions of the world, parasitic otitis followed by secondary mixed bacterial infections of the external and middle ear occurs (Duarte and Hamdan, 2004) Susceptibi lity to M. bovis induced otitis media is age related, with the peak incidence of clinical disease at 2 6 weeks of age (Dechant and Donovan, 1995; Walz et al ., 1997) In one recent study of feedlot cattle (Gagea et al ., 2006) M. bovis was frequently isolat ed from the tympanic bullae of animals with no clinical or gross lesions of otitis media, suggesting it is the expression of clinical disease rather than dissemination to the middle ear which is affected by age related factors. Nonetheless, in the past 15 years, outbreaks of otitis media in groups of North American dairy calves have been largely attributable to M. bovis infection (Dechant and Donovan, 1995; Walz et al ., 1997; Lamm et al ., 2004) Experimental infection studies using M. bovis to induce otitis media have not been published, however, nor has otitis media been reported as a sequelae following experimental inoculation of M. bovis in studies of respiratory disease. Therefore, although current information strongly supports the role of M. bovis as a cause of otitis media, more studies are required to fulfill Koch's postulates and to determine the host pathogen interactions contributing to disease expression. Clinical D isease in D airy C alves Clinical disease associated with M. bovis infection of dairy calves typically presents as pneumonia, otitis media or arthritis, or any combination of these (Stalheim and Page, 1975; Rosenbusch, 1995; Walz et al ., 1997; Brown et al ., 1998a; Butler et al ., 2000; Stipkovits et al .,

PAGE 19

19 2001; Francoz et al ., 2004; Lamm et a l ., 2004) Mycoplasma bovis has also been associated with a variety of other less common clinical manifestations in calves, including tenosynovitis, decu b ital abscesses and meningitis (Kinde et al ., 1993; Stipkovits et al ., 1993; Adegboye et al ., 1996) Th e age of onset of clinical disease in affected calves is typically between 2 and 6 weeks (Walz et al ., 1997; Brown et al ., 1998a; Stipkovits et al ., 2000; Stipkovits et al ., 2001) but has been reported as early as 4 days of age (Stipkovits et al ., 1993) C linical disease caused by M. bovis tends to be chronic, debilitating and unresponsive to therapy (Gourlay et al ., 1989a; Allen et al ., 1992a; Adegboye et al ., 1995a; Apley and Fajt, 1998; Shahriar et al ., 2000; Stipkovits et al ., 2000; Gagea et al ., 2006) Chronic endemic disease as well as epizootics can occur (Rodriguez et al ., 1996) Mycoplasma bovis associated respiratory disease has a similar clinical presentation to other types of calf pneumonia (Figure 1 1) Fever, loss of appetite, nasal discharge, coughing, and both increased respiratory rate and effort are typically reported, and concurrent cases of otitis media and arthritis may occur (Adegboye et al ., 1996; Walz et al ., 1997; Brown et al ., 1998a; Stipkovits et al ., 2001; Francoz et al ., 2004; Lam m et al ., 2004) As for undifferentiated calf pneumonia, auscultation reveals abnormal breath sounds including increased bronchial sounds, crackles, wheezes, and areas of cranioventral consolidation in severe cases (Ames, 1997) Both acute and chronic dise ase can occur, and mixed infections are common (Howard et al ., 1987b; Gourlay et al ., 1989a; Virtala et al ., 1996b; Mosier, 1997; Stipkovits et al ., 2000; Poumarat et al ., 2001; Vogel et al ., 2001; Thomas et al ., 2002a) C alves with c hronic pneumonia often develop extreme dyspnea and emaciation (Ames, 1997) Otitis media has been an increasingly recognized form of M. bovis associated disease in North American dairy calves over the past 15 years (Figure 1 2) (Dechant and Donovan, 1995;

PAGE 20

20 Walz et al ., 1997; La mm et al ., 2004) The clinical signs of otitis media observed include loss of appetite, fever, listlessness, ear pain evidenced by head shaking and scratching at or rubbing ears, epiphora, ear droop and signs of facial nerve paralysis (Walz et al ., 1997; B rown et al ., 1998a; Maeda et al ., 2003; Francoz et al ., 2004; Van Biervliet et al ., 2004) One or both tympanic bullae can be affected. In some cases, purulent discharge from the ear canal is observed following rupture of the tympanic membrane (Walz et al 1997; Francoz et al ., 2004) In addition, calves with M. bovis induced otitis media often have concurrent pneumonia (Dechant and Donovan, 1995; Walz et al ., 1997; Maeda et al ., 2003; Lamm et al ., 2004) Bacteria gain access to the middle ear by several p ossible routes that include extension of external ear infections via the tympanic membrane, colonization of the oropharynx and extension into the tympanic bulla via the eustachian tubes, or by hematogenous spread (Duarte and Hamdan, 2004; Morin, 2004) In pigs, o titis media due to Mycoplasma hyorhinis has been shown to occur by extension of URT infections to the middle ear via the eustachian (auditory) tube (Morita et al ., 1995; Morita et al ., 1999) Although the route of infection has not been studied in c alves, it is likely that a similar mechanism occurs given the frequent colonization of the nasopharynx with M. bovis in young calves (Bennett and Jasper, 1977c) Otitis interna is a common sequelae to otitis media in calves, and affected animals exhibit va rying degrees of vestibulocochlear dysfunction including head tilt, horizontal nystagmus, staggering, circling, falling, and/or lateral recumbency (Dechant and Donovan, 1995; Maeda et al ., 2003; Lamm et al ., 2004; Van Biervliet et al ., 2004) Meningitis ca n occur as a complication of otitis interna (Stipkovits et al ., 1993; Francoz et al ., 2004; Lamm et al ., 2004; Van Biervliet et al ., 2004) Meningitis secondary to otitis media interna may be localized, so cerebrospinal fluid samples collected for diagnost ic purposes should be from the atlanto occipital, rather than the

PAGE 21

21 lumbo sacral space (Van Biervliet et al ., 2004) Spontaneous regurgitation, loss of pharyngeal tone and dysphagia have also been reported in calves with M. bovis associated otitis media inte rna, indicative of glossopharyngeal nerve dysfunction with or without vagal nerve dysfunction (Van Biervliet et al ., 2004) Whether these nerves are affected by inflammation associated with meningitis or with inflammation at the site where the nerves pass over the tympanic bullae is unknown (Van Biervliet et al ., 2004) As is observed with M. bovis associated respiratory disease, calves with chronic otitis media interna may become emaciated (Walz et al ., 1997; Van Biervliet et al ., 2004) In contrast to M. bovis infections of the upper and lower respiratory tracts, M. bovis induced arthritis is presumed to be a consequence of mycoplasmemia (Chima et al ., 1981; Thomas et al ., 1986) Arthritis was preceded by mycoplasmemia in one calf that was inoculated intra tracheally with M. bovis (Thomas et al ., 1986) Infections of other body systems that occasionally accompany polyarthritis are also likely to be a consequence of mycoplasmemia (Stipkovits et al ., 1993) Clinical cases of M. bovis induced arthritis in dairy calves tend to be sporadic and are typically accompanied by respiratory disease within the herd and often within the same animal (Gonzalez et al ., 1993; Stipkovits et al ., 2005) Although uncommon, outbreaks of disease where arthritis was the predominant clinical presentation have been reported (Stipkovits et al ., 1993; Butler et al ., 2000) Clinical signs are typical of septic arthritis; affected joints are painful and swollen, and calves exhibit varying degrees of lameness and may be febrile in the acute phase of disease (Figure 1 3) (Stipkovits et al ., 1993; Byrne et al ., 2001; Step and Kirkpatrick, 2001a) Large rotator joints such as the shoulder, elbow, carpal, hip, stifle and hock joints are most frequently involved (Thomas et al ., 1975; Stipkovits e t al ., 1993; Adegboye et al ., 1996; Step and Kirkpatrick, 2001a; Clark, 2002; Gagea et al ., 2006) One or multiple joints

PAGE 22

22 can be affected, and calves with M. bovis arthritis are frequently culled due to poor response to therapy (Adegboye et al ., 1996; Byrn e et al ., 2001; Stokka et al ., 2001) Mycoplasma bovis also may cause a variety of less common clinical syndromes in calves, with or without concurrent respiratory disease. In addition to its occurrence as a sequelae of otitis media (Maeda et al ., 2003; F rancoz et al ., 2004) meningitis has occurred as a consequence of mycoplasmemia in very young calves (Stipkovits et al ., 1993) For example, in one case report, 3 to 21 day old calves developed polyarthritis and meningitis with an associated high mortality rate. Mycoplasma bovis was the only pathogen isolated from joints and meninges of affected calves (Stipkovits et al ., 1993) Mycoplasma bovis infections in or around tendons and synovial structures have been reported, and tenosynovitis and bursitis are c ommonly reported in feedlot calves with concurrent chronic M. bovis arthritis (Adegboye et al ., 1996; Step and Kirkpatrick, 2001a; Clark, 2002) In addition, intra articular inoculation of M. bovis in calves resulted in arthritis plus tenosynovitis (Stalhe im and Page, 1975; Ryan et al ., 1983) In an unusual presentation of M. bovis infections, an outbreak of subcutaneous decubital abscesses over carpal and stifle joints and in the brisket was reported in fifty calves fed unpasteurized waste milk on a Califo rnian calf ranch. Mycoplasma bovis was the only pathogen isolated from abscesses, which occurred at the sites of pressure sores. Whether the bacteria gained entry through skin abrasions or via hematogenous spread is unknown, but the authors hypothesized th at M. bovis in nasal secretions may have contaminated pressure sores when calves licked these areas. There was no evidence of joint involvement in affected calves, but at least one calf had concurrent M. bovis associated respiratory disease (Kinde et al ., 1993)

PAGE 23

23 Mycoplasma bovis can be isolated from the conjunctiva of cattle in infected herds (Boothby et al ., 1983b) although M. bovis associated ocular disease is considered uncommon (Brown et al ., 1998b) However, there are several reports of outbreaks of keratoconjunctivitis involving M. bovis alone, or in mixed infections with Mycoplasma bovoculi (Jack et al ., 1977; Kirby and Nicholas, 1996; Levisohn et al ., 2004; Alberti et al ., 2006) An outbreak of severe keratoconjunctivitis, from which M. bovis was t he only consistently isolated pathogen, was reported in a group of 20 calves. Clinical signs included mucopurulent ocular discharge, severe eyelid and conjunctival swelling, and corneal edema and ulceration. Most clinical signs resolved within 2 weeks but some animals had residual corneal scarring (Kirby and Nicholas, 1996) In a recent report (Alberti et al ., 2006) an outbreak of M. bovis associated keratoconjunctivitis in beef calves in Italy was followed by cases of pneumonia and arthritis. In summary, M. bovis infections primarily result in pneumonia, otitis media and arthritis in young calves, but other more unusual clinical presentations affecting a wide variety of body systems can occur. Mycoplasma bovis is an important cause of mastitis in adult co ws, but discussion of this clinical syndrome is beyond the scope of this dissertation. Prevalence Mycoplasma bovis appears to be widespread within the North American dairy cattle population (Uhaa et al ., 1990; Gonzalez et al ., 1992; Van Donkersgoed et al ., 1993; Kirk et al ., 1997; Fox et al ., 2003; USDA:APHIS, 2003) In the National Animal Health Monitoring System (NAHMS) Dairy 2002 study, 7.9% of 871 dairies tested positive for mycoplasmas upon culture of a single bulk tank milk sample; M. bovis was iden tified in 86% of the positive herds. States in the Western region had a greater percentage of operations with positive mycoplasma culture (9.4%) than states in the Midwest (2.2%), Northeast (2.8%) and Southeast (6.6%) regions. These

PAGE 24

24 values are likely an un derestimate of true prevalence, as subclinically infected cows shed mycoplasmas intermittently in milk (Jasper, 1981; Biddle et al ., 2003) and milk from cows with clinical mastitis is usually withheld from the bulk tank. Reported prevalence in individual c ows varies widely among herds and among studies; Gonzalez et al ., (1992) reported that 11.7% of cows sampled between 1970 to 1990 in 165 New York herds were infected, whereas Wilson et al ., (1997) report ed that only 85/105,083 (0.1%) of individual cow cult ures collected in North e ast U.S. dairy herds between 1991 and 1995 were positive for mycoplasmas. In a study of 46 3 dairy operations in the Northw est U.S ., 93 (20%) of herds had at least one mycoplasma positive bulk tank milk sample between 1998 and 2000. Studies of the prevalence of M. bovis associated disease in dairy calves in North America have not been published, but in Europe it has been estimated that M. bovis is responsible for 25% to 35% of calfhood respiratory disease (Nicholas and Ayling, 2003) Although the prevalence of M. bovis associated disease is unknown, there are data on the prevalence of undifferentiated respiratory disease in North American calves. In fact, after diarrheal diseases, respiratory disease is the second most important cause of morbidity and mortality in U.S. dairy heifers. In the NAHMS Dairy 2002 study (USDA:APHIS, 2003) which represented 83% of U.S. dairy operations, respiratory disease accounted for 21.3% of all heifer deaths; pre weaning and post weaning mortality were 8 .7% and 1.9%, respectively. Morbidity rates were not reported, but in the 1991 1992 National Dairy Heifer Evaluation Project ( NDHEP ), which included 906 dairies from 28 states, the cumulative incidence risk of respiratory disease to 8 weeks of age was 10%; 24.5% of mortality was due to respiratory disease (Wells et al ., 1997) To the best of the author's knowledge, more recent national estimates of respiratory disease rates in dairy heifers have not been published. The incidence and severity of respiratory disease vary markedly among

PAGE 25

25 individual farms and among regional studies. In 18 commercial New York dairy operations, the incidence of pneumonia in the first 3 months of life was 25.6% and the case fatality rate was 2.2% (Virtala et al ., 1996b) In a 1991 s tudy of 30 Minnesota dairies, the incidence rate for pneumonia was 0.10 per 100 calf days at risk, the case fatality rate was 9.4%, and pneumonia accounted for 30% of mortality during the first 4 months of life (Sivula et al ., 1996) In a study of calf hea lth on two large Florida dairies, mortality to 6 months of age was 11.7%, 22% of which was attributed to respiratory disease (Donovan et al ., 1998a) Although these prevalence studies are not pathogen specific, it is clear from the reports of outbreaks of M. bovis associated respiratory disease in North American dairy calves that M. bovis can be a significant contributor to overall rates of disease and mortality in affected herds (Walz et al ., 1997; Brown et al ., 1998a; Butler et al ., 2000) For example, in a 1996 prospective study of five New York dairies, 40 cases of pneumonia occurred in 78 calves that were prospectively followed for the first 3 months of life ; 22 (55%) of these cases were attributed to M. bovis infection (Musser et al ., 1996) Economic L osses There are limited data available on the economic impact of M. bovis associated disease. Financial losses were estimated at approximately $350 per case per lactation for mycoplasmal mastitis, based on records from 105,083 cows in the North e ast U.S. an d a milk price of $13.00/hundred pounds of milk (Wilson et al ., 1997) Losses to the U.S. beef industry as a result of reduced weight gain and carcass value due to M. bovis associated disease have been estimated at $32 million per year, and in the U.K ., it is estimated that M. bovis contributes to at least a quarter of economic loss due to bovine respiratory disease (Rosengarten and Citti, 1999) However, the cost of M. bovis associated disease in dairy heifers has not been reported. In addition, there is s cant recent information available on the cost of undifferentiated respiratory disease in dairy heifers in North America. In a 1990 study of Michigan dairy herds, the cost of

PAGE 26

26 respiratory disease in calves was estimated at $14.71 per calf year (Kaneene and H urd, 1990) Esslemont and Kossaibati (1999) estimated that the average cost of respiratory disease in dairy heifers in the U.K. was $61 per calf in the herd, based on 30% morbidity and 5% mortality rates. Economic costs associated with calf respiratory dis ease include treatment costs, labor costs, veterinary services, increased mortality, increased premature culling, reduced weight gain, reduced fertility, increased age at first calving, and possibly reduced milk production (Waltner Toews et al ., 1986; Warn ick et al ., 1995; Virtala et al ., 1996a; Ames, 1997; Warnick et al ., 1997; Donovan et al ., 1998b) Without pathogen specific data being available, it is reasonable to assume that M. bovis associated disease incurs many of the same costs. Mycoplasma bovis associated disease tends to be debilitating and unresponsive to therapy (Gourlay et al ., 1989a; Adegboye et al ., 1995a; Apley and Fajt, 1998; Pollock et al ., 2000; Stipkovits et al ., 2000; Rosenbusch, 2001) Tschopp et al ., (2001) gives an example of an ou tbreak of M. bovis associated disease in which 54% of 415 calves introduced into an M. bovis endemic facility seroconverted to M. bovis. Calves that seroconverted within 7 weeks of arrival experienced an 8% reduction in weight gain and required twice as ma ny antibiotics as did seronegative calves. The proportion of clinical episodes of respiratory disease attributable to M. bovis in these calves was 50.3% In another report of an M. bovis associated disease outbreak, 70% of the calves in one dairy herd requ ired treatment for respiratory disease or otitis media prior to 3 months of age (Brown et al ., 1998a) On the individual farm affected with M. bovis associated calf disease losses resulting from treatment costs, death, and culling can be substantial, and e conomically devastating outbreaks with very high morbidity rates and loss of up to 30% of calves have been observed (Figure 1 4) (Gourlay et al ., 1989a; Kinde et al ., 1993;

PAGE 27

27 Stipkovits et al ., 1993; Dechant and Donovan, 1995; Walz et al ., 1997; Butler et a l ., 2000; Stipkovits et al ., 2000; Stipkovits et al ., 2001; Tschopp et al ., 2001) Animal W elfare In addition to any economic consequences, M. bovis must be considered important from a calf welfare perspective. M. bovis associated disease is often chronic, responds poorly to antibiotic therapy, often affects a substantial proportion of calves in a herd, may cause permanent health issues for affected calves, and available vaccines are, at best, poorly efficacious (Gourlay et al ., 1989a; Allen et al ., 1992a; Adegboye et al ., 1995a; Apley and Fajt, 1998; Stipkovits et al ., 2000; Nicholas and Ayling, 2003; Gagea et al ., 2006) Taken together, these characteristics result in affected calves that may be subject to long periods of illness for which the producer or veterinarian can provide only limited relief. There is therefore a critical need to develop improved preventative and treatment strategies for M. bovis associated disease in young calves. Epidemiology Colonization and S hedding Mycoplasma bovis is a frequen t colonizer of the URT of healthy or diseased calves, with nasal prevalence ranging from < 5% to 100% of calves in a herd (Bennett and Jasper, 1977c; Springer et al ., 1982; Allen et al ., 1992a; ter Laak et al ., 1992b; Brown et al ., 1998a; Mettifogo et al ., 1998) Within herd prevalence is generally higher in herds with a history of M. bovis associated disease than in herds without such a history. For example, Bennett and Jasper (1977c) reported a nasal prevalence of 34% in dairy calves < 8 months of age in herds with M. bovis associated disease, compared with 6% in non diseased herds. Cattle can remain infected for long periods of time and may shed M. bovis intermittently for many months and even years, acting as reservoirs of infection in the herd (Bennett and Jasper, 1977c; Pfutzner and Sachse, 1996) Chronic colonization of tonsils, with or without nasal shedding, has been described for

PAGE 28

28 mycoplasmal respiratory pathogens in other hosts (Goltz et al ., 1986; Friis et al ., 1991) but whether the bovine tonsils are the primary site of URT colonization for M. bovis has not been established. The significance of M. bovis colonization as a risk factor for the development of clinical disease in the individual animal is unknown. On a herd level, high prevalence of na sal colonization is associated with increased rates of clinical disease and with isolation of M. bovis from the LRT (Bennett and Jasper, 1977c; Springer et al ., 1982; Allen et al ., 1991; Brown et al ., 1998a) However, i solation of M. bovis from nasal swabs in individual calves is generally poorly correlated with both clinical disease and the presence of M. bovis in the LRT (Bennett and Jasper, 1977c; Allen et al ., 1991; Thomas et al ., 2002b) although a positive correlation between M. bovis isolation from n asal swabs and clinical disease was reported in one study (Wiggins et al ., 2007) Based on the current level of understanding, colonization of the URT precedes the development of clinical disease in calves, but is not always sufficient cause for disease. Little is known about the typical age of onset and duration of nasal shedding of M bovis in endemically infected herds Bennett and Jasper (1977c) reported that in calves less than 1 week of age, nasal prevalence was 38% in herds with M. bovis associated disease and 7.5% in non diseased herds. Prevalence peaked at 48% between 1 and 4 months of age. Mycoplasma bovis was still detected in nasal swabs from some calves at 8 months of age and from pre partum heifers, although whether these represented new or ch ronic infections was not determined. Other investigators reported that almost 50% of calves in a herd with severe M. bovis and P. multocida pneumonia were shedding M. bovis at 5 days of age and over 90% were shedding M. bovis by 4 weeks; the onset of clini cal disease peaked between 10 and 15 days of age. Approximately 10% of the calves died as a result of severe pneumonia, and surviving calves had poor weight gain

PAGE 29

29 (Stipkovits et al ., 2001) On a Florida dairy experiencing an outbreak of M. bovis associated disease, M. bovis was isolated prior to 14 days of age from nasal s wabs of all of 50 calves sampled and 70% of these calves required treatment for respiratory disease or otitis media (Brown et al ., 1998a) It is apparent from these studies that calves in infected herds are often colonized when they are very young, even at less than 1 week of age, and that the highest rates of nasal shedding occur in the first 2 months of life. In addition, Bennett and Jasper (1977c) found that M. bovis may be shed in nasal secretions of calves in herds with no history of M. bovis associated disease. Although the URT is the most common site of infection, M. bovis may similarly colonize and be shed from other body systems without causing clinical disease. Subclinical M. bovis mastitis is common, and infected cows may intermittently shed the bacteria in milk for months to years (Ruhnke et al ., 1976; Jasper, 1981; Pfutzner and Sachse, 1996) M. bovis has also been isolated from the conjunctiva (Boothby et al ., 1983b) semen and vaginal secretions (Feenstra et al ., 1991; Pfutzner and Sachse, 1996) of cattle without clinical disease. Although both respiratory tract and mammary gland shedding have been implicated as reservoirs of infection within a herd (Pfutzner and Sachse, 1996) colonization at other sites does not seem to play a major role in the epidemiology of M. bovis Transmission and R isk F actors Mycoplasma bovis is thought to be introduced to M. bovis free herds by clinically healthy cattle that are carrying this microorgan ism (Jasper, 1981; Burnens et al ., 1999; Tschopp et al ., 2001; Gonzalez and Wilson, 2003) Spread to uninfected animals may occur at the time of introduction into the herd or may be delayed until, and if, shedding occurs (Fox et al ., 2005) Little is publi shed on the epidemiology of M. bovis within young calf populations, but there are several potential routes of initial exposure. Calves could become infected from their dams or

PAGE 30

30 from other adult cows in the maternity area that are shedding M. bovis in colost rum, vaginal or respiratory secretions (Pfutzner and Sachse, 1996) The isolation of M. bovis from vaginal secretions of cows at calving (Feenstra et al ., 1991; Brown et al ., 1998a) and congenital infection of calves (Bocklisch et al ., 1986; Stipkovits et al ., 1993) have been reported, although both events appear to occur infrequently and probably do not play a major role in transmission. One of the major means of transmission to young calves is thought to be ingestion of milk from cows shedding M. bovis f rom the mammary gland (Figure 1 5) (Pfutzner and Schimmel, 1985; Bocklisch et al ., 1986; Walz et al ., 1997; Brown et al ., 1998a; Butler et al ., 2000) Colonization of the URT by M. bovis occurs more frequently in calves fed infected milk than in those fed uninfected milk (Bennett and Jasper, 1977c) and clinical disease has been documented following feeding of M. bovis contaminated waste milk to calves or nursing of cows with M. bovis mastitis (Stalheim and Page, 1975; Walz et al ., 1997; Brown et al ., 1998a ; Butler et al ., 2000) Because milk in modern husbandry systems is typically batched for feeding to calves, a single cow shedding M. bovis can potentially expose a large number of calves to infection, and calves may be repeatedly exposed over the milk fee ding period. In a field study to determine the method of transmission of M. bovis in one Florida dairy herd, 100% of 50 calves exposed to M. bovis contaminated waste milk became colonized in the URT by 14 days of age (Brown et al ., 1998a) Culture of nasal and vaginal swabs of cows at calving was only positive for M. bovis in one instance each. This led the authors to conclude that the main method of spread of M. bovis from dam to calf was through contaminated waste milk. This hypothesis was supported by ot her investigators (Walz et al ., 1997; Butler et al ., 2000) although experimental infection by this route has not been published. Feeding of unpasteurized waste milk is clearly not the only important factor in the epidemiology of M. bovis in calves, as cli nical disease can occur

PAGE 31

31 in herds that only feed milk replacer or in herds that effectively pasteurize bulk tank or hospital milk prior to feeding (Lamm et al ., 2004) The importance of colostrum as a source of M. bovis infection in calves is unknown, altho ugh in one study (Brown et al ., 1998a) investigators did not isolate M. bovis from 50 colostrum samples collected during an outbreak of M. bovis associated disease. Whatever the mechanism (infected milk, colostrum, respiratory or vaginal secretions, or c ongenital infection) by which calves become infected, they may then shed M. bovis in respiratory secretions and potentially transmit it to other calves. Once established on multi age sites, M. bovis becomes extremely difficult to eradicate, suggesting that continual transmission from older animals to incoming calves occurs (Bennett and Jasper, 1977c) Transmission is likely to be a result of direct or indirect contact of uninfected calves with calves that are shedding M. bovis in respiratory secretions (Ben nett and Jasper, 1977c; Tschopp et al ., 2001; Nicholas and Ayling, 2003) In general, for bacterial pathogens involved in multifactorial diseases, the risk of infection and of developing clinical disease depends on a large number of pathogen, host and envi ronmental factors. With the exception of exposure to M. bovis contaminated milk (discussed above), few specific risk factors for the transmission of M. bovis or for outbreaks of clinical disease have been identified. Mixing of calves from different sources and the presence of at least one seropositive animal in new purchases increased the risk of M. bovis associated disease on a ranch that raised dairy bull calves (Tschopp et al ., 2001) This result is in agreement with epidemiological studies of M. bovis m astitis, where one of the few consistently identified herd level risk factors has been a history of purchasing cattle (Gonzalez et al ., 1992; Burnens et al ., 1999) Herd size is the only other commonly identified risk factor for mycoplasmal mastitis.

PAGE 32

32 Herd size was identified as a risk factor for an M. bovis positive bulk tank in the NAHMS Dairy 2002 study, with 21.7% of herds of 500 head or more having positive samples, compared with 3.9% and 2.1% of medium (100 to 400 head) and small (< 100 head) herds, re spectively. In several smaller scale regional studies, large herds have been identified as being at increased risk of M. bovis mastitis (Thomas et al ., 1981; Uhaa et al ., 1990; Fox et al ., 2003) However, some investigators have not identified herd size as a risk factor after analyses were adjusted for purchase of animals (Gonzalez et al ., 1992) Larger herd size was associated with increased rates of undifferentiated respiratory disease in calves in the NDHEP study (Wells et al ., 1997) but the effect of h erd size on M. bovis associated disease in young calves has not been reported. Despite the lack of published studies, other potential risk factors for M. bovis infection in young calves can be identified from the limited studies of M. bovis epidemiology in calves, from studies of M. bovis mastitis and by extrapolating from what is known about risk factors for other respiratory pathogens in calves. For example, calves with clinical M. bovis associated disease shed huge numbers of bacteria (Bennett and Jasper 1977c) and are therefore likely to be the greatest contributors to the load of bacteria within a calf rearing facility and the most important factor in calf to calf spread of disease. For undifferentiated respiratory disease, high bacterial counts in the air of calf pens are associated with increased disease prevalence (Lago et al ., 2006) Large numbers of M. bovis can be isolated from the air in barns housing calves with M. bovis associated disease (Jasper et al ., 1974) and, therefore, factors that infl uence airborne bacteria counts in calf pens, such as pen design, barn ventilation and stocking density (Lago et al ., 2006) may affect transmission rates. Independent of effects on bacterial load, poor air quality compromises respiratory defenses, which may increase the risk of respiratory disease (Ames, 1997) although this has not been specifically evaluated with respect to M. bovis infections.

PAGE 33

33 Mechanical transmission via fomites has been implicated in udder to udder spread of M. bovis mastitis Milking of uninfected and infected cows at the same time increases the risk for new cases, and milking equipment, teat dip, hands, sponges, washcloths, and poor hygiene during intramammary infusion of antibiotics have been implicated in the spread of M. bovis (Jaspe r et al ., 1974; Bushnell, 1984; Step and Kirkpatrick, 2001b; Gonzalez and Wilson, 2003) It is plausible that similar mechanical means of transfer could occur in calf facilities. Despite being enveloped by only a thin plasma membrane, some mycoplasmas surv ive well in the environment. Mycoplasma bovis survives at 4 C for nearly 2 months in sponges and milk, over 2 weeks on wood and in water, and 20 days in straw, although at higher temperatures survival drops considerably (Pfutzner and Sachse, 1996) In gene ral, survival is best under cool, humid conditions (Pfutzner and Sachse, 1996) In surveys of Florida dairy farms, M. bovis was commonly isolated from cooling ponds and from dirt lots with recently calved cows on farms that had a history of M. bovis positi ve bulk tank milk culture (Bray et al ., 1997; Bray et al ., 2001) These studies demonstrate that M. bovis can survive well in the dairy environment, and that mechanical transmission via fomites could theoretically occur among calves. However, further studi es are required to examine the role of fomites in the epidemiology of M. bovis infection in calf rearing facilities. In a study of the effect of temperature and humidity on nasal shedding of mycoplasmas in calves, an abrupt change from warm (17 C) to cold (5 C) conditions was associated with increased rates of nasal shedding of M. bovis In addition, calves that were permanently housed at 5 C had higher rates of nasal shedding of M. bovis than calves housed at 16 C (Woldehiwet et al ., 1990) Other investiga tors subjected healthy calves to extreme environmental temperatures (5 C or 35 C) for 4 hours; calves were housed at 18 to 20 C before and after the exposure.

PAGE 34

34 Calves exposed to environmental extremes experienced significantly higher rates of respiratory di sease over the following 3 weeks than did unexposed control calves. Mycoplasma spp. were identified as the cause of respiratory disease in calves that were exposed to 5 C, whereas no mycoplasmas were isolated from the lungs of calves exposed to 35 C or in control calves (Reinhold and Elmer, 2002) Together, these findings suggest that mycoplasmal nasal shedding and, perhaps, clinical disease are favored by low environmental temperatures. However, epidemiological studies to evaluat e the association between t emperature and clinical M. bovis associated disease have not been published. Season may have some effect on M. bovis infections in calves. Lamm et al ., (2004) reported that there was a seasonal distribution in the number of cases of mycoplasmal otitis med ia in calves submitted for necropsy to a Californian diagnostic laboratory, with the highest proportion of cases submitted in the spring and the lowest in the summer months. Seasonal e ffects have been observed in some studies of mycoplasmal mastitis (Bayou mi et al ., 1988; Gonzalez et al ., 1992) but not in others (Kirk et al ., 1997; Fox et al ., 2003) For example, Gonzalez et al ., (1992) reported a significantly higher incidence of mycoplasmal clinical mastitis in New York dairy herds in winter than in othe r seasons. Kirk et al ., (1997) reported that there was no seasonal pattern to M. bovis isolation from bulk tank milk in 267 Californian herds, contrary to previous findings where a higher incidence of M. bovis mastitis was observed from January to April in California dairies than at other times of the year (Bayoumi et al ., 1988). The reasons for these discrepancies are unknown. There are several possible explanations for increased rates of M. bovis associated disease in winter or early spring compared with other times of year. Survival of mycoplasmas in the environment is best in cool, humid conditions (Pfutzner and Sachse, 1996) and the risk of indirect transmission between animals may be

PAGE 35

35 greatest when these conditions predominate. Secondly, a seasonal dist ribution could reflect an association of M. bovis infection with exposure to cold environmental temperatures, as discussed above (Woldehiwet et al ., 1990; Reinhold and Elmer, 2002) Lastly, air quality in enclosed cattle facilities may be worse in winter t han at other times of the year, predisposing animals to increased rates of respiratory disease (Ames, 1997; Lago et al ., 2006) Further epidemiological studies are required to definitively determine if there is a seasonal distribution of M. bovis associate d disease in calves. The immune status of the calf is important in determining susceptibility to respiratory infections. The calf is born with little or no humoral immunity and is dependent upon absorption of maternal immunoglobulins from colostrum for dis ease protection during early life (Davis and Drackley, 1998) Numerous investigators have found a strong association between failure of passive transfer of maternal immunoglobulins and increased risk and severity of respiratory disease in young calves (Tho mas and Swann, 1973; Williams et al ., 1975; Davidson et al ., 1981; Blom, 1982; Corbeil et al ., 1984; Van Donkersgoed et al ., 1993; Donovan et al ., 1998a) However, whether maternal antibodies have any protective effects against M. bovis infection is not cl ear. In one study (Van Donkersgoed et al ., 1993) there was no significant association between M. bovis specific serum antibody titers in the first 2 weeks of life and occurrence of pneumonia in 325 colostrum fed dairy calves. Likewise Brown et al ., (1998 a) did not find an association between M. bovis specific serum antibody concentrations at 7 days of age and occurrence of M. bovis associated disease in 50 Holstein calves. Specific immunity to M. bovis will be further discussed later in this chapter Non specific respiratory defenses are important in protection from mycoplasmal respiratory infections in other hosts (Cartner et al ., 1998; Hickman Davis, 2002) and it is logical

PAGE 36

36 that they would also be important in M. bovis infections. The non specific respi ratory defenses of calves can be compromised by a variety of factors including infection with viral pathogens, sudden changes in environmental temperature, heat or cold stress, overcrowding, transportation, poor air quality and inadequate nutrition (Bryso n, 1985; Ames, 1997) However, further studies are required to define the role of factors affecting the non specific respiratory defenses of calves as well as the role of passive immunity in M. bovis associated calf disease. Genetic background is thought to play an important role in the susceptibility of cattle to infectious disease (Uribe et al ., 1995; Kelm et al ., 1997; Kelm et al ., 2001; Abdel Azim et al ., 2005) G enetic background is also important in determining susceptibility or resistance to mycopla smal respiratory infections of non bovine species. In many cases, genetic susceptibility to mycoplasmal respiratory disease appears to be a result of increased immunoreactivity of the host when compared with resistant animals. For example, resistance to M. pulmonis lung disease in inbred strains of rats is a result of a more controlled host immune response after mycoplasmal inoculation into the lung, compared with susceptible strains of rats (Davis et al ., 1982) Inbred strains of mice that are susceptible to M. pulmonis lung disease have reduced alveolar macrophage clearance of mycoplasmas from the lung early in the infection process compared with resistant strains of mice (Hickman Davis et al ., 1997) In addition, mice that are genetically susceptible to a sthma associated symptoms, a phenotype mediated by impaired interferon ( IFN ) secretion and strong Th2 responses, have a much greater susceptibility to M. pulmonis infection tha n do immunocompetent mice (Bakshi et al ., 2006) The resistance to M pulmonis is multifactorial, and has been mapped to several chromosomal locations (Cartner et al ., 1996) Interestingly, males are more susceptible than females, suggesting that hormonal regulation may also be important in disease susceptibility (Yancey et al ., 200 1) Genetic susceptibility to

PAGE 37

37 mycoplasmal infections is not limited to rodents. In pigs that were bred for high or low cellular and humoral immune responses, high responders that were experimentally infected with M. hyorhinis had more severe arthritis than did pigs bred for low immune response (Wilkie and Mallard, 1999) These findings coupled with the fact that immune responsiveness in cattle has a strong genetic influence implies that genetic background is likely to be associated with susceptibility to M. bovis associated disease in cattle. However, to date no studies have addressed the role of genetics in susceptibility of cattle to mycoplasmal infections. Bovine respiratory disease frequently involves a number of viral and bacterial pathogens (Bryson, 19 85; Ames, 1997) and M. bovis associated respiratory disease is no exception (Howard et al ., 1987a; Rodriguez et al ., 1996; Virtala et al ., 1996b; Mosier, 1997; Stipkovits et al ., 2000; Poumarat et al ., 2001; Vogel et al ., 2001; Thomas et al ., 2002a; Gagea et al ., 2006) In fact, M. bovis infection may predispose the respiratory tract to invasion by other bacterial pathogens (Houghton and Gourlay, 1983; Virtala et al ., 1996b; Poumarat et al ., 2001; Gagea et al ., 2006) ; similarly, other pathogens may enhance M. bovis infection. Viral infections can damage the respiratory mucosa, reduce ciliary activity, and impair secretory and cellular immune defenses in the respiratory tract (Ames, 1997; Kapil and Basaraba, 1997) Any or all of these changes could increase susceptibility to mycoplasmal infection. Studies in feedlot calves with chronic, antibiotic resistant pneumonia suggest that there may be synergism between Bovine Viral Diarrhea virus (BVDV) and M. bovis (Shahriar et al ., 2000) Experimental infection stud ies have confirmed that M. bovis plays a synergistic role with other pathogens (Gourlay and Houghton, 1985; Lopez et al ., 1986; Thomas et al ., 1986) especially P. multocida and M. haemolytica

PAGE 38

38 Mixed infections can also occur in otitis media, although the ir significance is unknown (Dechant and Donovan, 1995; Lamm et al ., 2004) In several other host species, viral infections of the URT are important risk factors for increased incidence, severity and chronicity of bacterial otitis media; one mechanism by wh ich viral infections can potentiate bacterial otitis media is by perturbing the ciliary clearance mechanisms of the eustachian tubes (Bakaletz et al ., 1993; Eskola and Hovi, 1999; Tong et al ., 2000) Specific viral etiologies have not been identified in th e lungs of pre weaned calves with M. bovis associated otitis media (Walz et al ., 1997; Maeda et al ., 2003; Lamm et al ., 2004; Van Biervliet et al ., 2004) However, attempts to isolate viruses from lesions in the tympanic bullae have been reported only once (Maeda et al ., 2003) and n o attempts to isolate viruses from the nasopharynx or eustachian tubes of affected calves have been reported. In cases of M. bovis associated arthritis, mixed infections in affected joints are uncommon, although calves with arth ritis often have concurrent respiratory disease from which multiple pathogens may be isolated (Butler et al ., 2000; Haines et al ., 2001; Lamm et al ., 2004) Risk factors that have been identified for otitis media in other species include viral or bacterial infection of the nasopharynx, eustachian tube dysfunction, age (with neonates being at greatest risk), host factors such as impaired immunological status, URT allergies, genetic predisposition, feeding method (breast vs. bottle in human infants) and envir onmental factors such as mixing of different age groups and exposure to respiratory irritants (Bluestone, 1996; Duffy et al ., 1997) With the exception of an apparent age related distribution, these factors have not been evaluated with respect to M. bovis induced otitis media in calves. In summary, young calves can be infected at a very early age by ingestion of milk from cows infected with M. bovis or, probably, by direct or indirect transmission from other calves shedding M. bovis in nasal secretions. How ever, other than the feeding of infected milk, few

PAGE 39

39 specific risk factors have been identified, and factors associated with dissemination from the upper to the LRT and clinical disease expression are poorly understood. Clearly, well designed epidemiological studies would be helpful to establish risk factors and to provide guidance for dairy producers to reduce M. bovis associated disease. Molecular E pidemiology Mycoplasma bovis is well equipped to generate genetically diverse populations, and has been observ ed to undergo DNA recombination and rearrangement events at high frequency (Lysnyansky et al ., 1996; Poumarat et al ., 1999; Nussbaum et al ., 2002) The M. bovis genome contains a large number of insertion sequences which are also likely to lead to heteroge neous populations (Miles et al ., 2005; Thomas et al ., 2005b) There have been several molecular epidemiological studies of M. bovis utilizing a variety of DNA fingerprinting techniques including randomly amplified polymorphic DNA analysis, amplified fragme nt length polymorphism analysis, restriction fragment length polymorphism analysis, pulsed field gel electrophoresis (PFGE) analysis, and insertion sequence profile analysis (Poumarat et al ., 1994; Kusiluka et al ., 2000a; Butler et al ., 2001; McAuliffe et al ., 2004; Biddle et al ., 2005; Miles et al ., 2005) Considerable genomic heterogeneity among field isolates of M. bovis has been reported, especially when isolates were collected from diverse geographical regions and over a period of several years (Poumar at et al ., 1994; McAuliffe et al ., 2004; Miles et al ., 2005) Correlations between particular DNA fingerprint types and geographic location, year of isolation, and type or severity of pathology have not been identified (Poumarat et al ., 1994; Kusiluka et a l ., 2000a; McAuliffe et al ., 2004; Miles et al ., 2005) This may reflect the frequent movement of cattle among herds in modern management systems, as well as the ability of M. bovis to create genetically diverse populations.

PAGE 40

40 Comparison of PFGE patterns fo r isolates of M. bovis or Mycoplasma californicum obtained at necropsy from multiple body sites in seven cows with mycoplasmal mastitis was reported (Biddle et al ., 2005) Within each cow, the same PFGE pattern was found in 100% of isolates from sites in t he mammary system (milk, mammary parenchyma and supra mammary lymph nodes). Forty one percent of isolates obtained from the respiratory system and 90% of isolates obtained from other body systems had PFGE patterns identical to that of the mammary isolates. These findings indicate that the same strain of M. bovis often colonizes multiple body sites, but also that multiple strains may be present within an animal. Isolates of M. bovis from multiple sites of pathology within the same animal or from multiple ani mals in the same disease outbreak typically are closely related or identical by DNA typing methods, especially when the herd is closed (Gonzalez et al ., 1993; Kusiluka et al ., 2000a; Butler et al ., 2001; McAuliffe et al ., 2005) In contrast, endemically in fected open herds, including dairy calf ranches, harbor numerous genetically diverse strains of M. bovis ; this has been attributed to introduction of animals from multiple sources over time (Butler et al ., 2001) Pathology The macro scopic and microscopic l esions of the respiratory tract in experimental M. bovis infection vary considerably among studies, probably reflecting differences in the route of inoculation, the dose and strain of M. bovis the age and health status of the host and the duration of infe ction. Macroscopic lesions have consisted of cranioventral lung consolidation, sometimes accompanied by multiple necrotic foci (Gourlay et al ., 1976; Lopez et al ., 1986; Thomas et al ., 1986; Rodriguez et al ., 1996) Histologically, experimental lung infect ions with M. bovis are characterized by peribronchiolar lymphoid hyperplasia or cuffing, often accompanied by acute or subacute suppurative bronchiolitis, thickening of alveolar septa due to cellular infiltration, atelectasis, and, in some cases, foci of c oagulative necrosis (Gourlay et al .,

PAGE 41

41 1976; Martin et al ., 1983; Bryson, 1985; Lopez et al ., 1986; Thomas et al ., 1986; Rodriguez et al ., 1996) In one study, immunohistochemical staining of M. bovis antigen was present at 14 days post infection in bronchio les, peribronchiolar tissue and within inflammatory exudates in alveoli; necrosis was not observed (Rodriguez et al ., 1996) Other investigators identified large amounts of M. bovis antigen at the edges of lesions of coagulative necrosis and in bronchiolar exudates (Thomas et al ., 1986) Lesions described for the lungs of calves with natural M. bovis infections are similar to those described for experimental disease, although often of much greater severity. Macroscopically, affected lung lobes are a deep r ed color and have varying degrees of consolidation, often accompanied in subacute to chronic cases by multifocal necrotizing lesions (Gourlay et al ., 1989a; Adegboye et al ., 1995a; Adegboye et al ., 1996; Clark, 2002; Shahriar et al ., 2002; Khodakaram Tafti and Lopez, 2004; Gagea et al ., 2006) Lesions usually have a cranioventral distribution, but can involve whole lung lobes and the cranial portions of the caudal lobes. Necrotic lesions can vary from 1 2 mm to several centimeters in diameter and contain ye llow caseous material. They are distinct from typical lung abscesses in that they are not usually surrounded by a well defined fibrous capsule (Clark, 2002; Khodakaram Tafti and Lopez, 2004) Diffuse fibrinous or chronic fibrosing pleuritis are sometimes o bserved, and interlobular septae may contain edema fluid or linear yellow necrotic lesions (Rodriguez et al ., 1996; Bashiruddin et al ., 2001; Step and Kirkpatrick, 2001a; Clark, 2002; Gagea et al ., 2006) Occasionally, chronic cases of M. bovis pneumonia c ontain areas of lung sequestration, consisting of a central area of necrotic tissue surrounded by red brown exudate, and enclosed in a fibrous capsule that separates the sequestra from surrounding lung (Gagea et al ., 2006) Fibrinosuppurative tracheitis ha s been

PAGE 42

42 reported in calves with mycoplasmal lung infections (Dungworth, 1993; Hewicker Trautwein et al ., 2002) Histologically, lung lesions in naturally occurring M. bovis infections are characterized by a subacute to chronic suppurative bronchopneumonia t hat is usually necrotizing (Adegboye et al ., 1995a; Rodriguez et al ., 1996; Clark, 2002; Shahriar et al ., 2002; Khodakaram Tafti and Lopez, 2004; Gagea et al ., 2006) Mixed infections are common and often complicate characterization of lesions (Adegboye et al ., 1995a; Adegboye et al ., 1996; Clark, 2002; Shahriar et al ., 2002; Khodakaram Tafti and Lopez, 2004; Gagea et al ., 2006) Bronchioles are filled with purulent exudate that contains abundant M. bovis antigen, accompanied by varying degrees of peribronc hiolar lympho histiocytic cuffing, thickening of alveolar septa due to cellular infiltration, and atelectasis. Two distinct types of necrotic lesions have been reported in M. bovis pneumonia the most common being multifocal pyogranulomatous inflammation with centers of caseous necrosis (Adegboye et al ., 1995a; Rodriguez et al ., 1996; Clark, 2002; Khodakaram Tafti and Lopez, 2004; Gagea et al ., 2006) These well delineated necrotic foci have centers of amorphous eosinophilic material in which degenerative neutrophils are sometimes visible, especially at the periphery, and are surrounded by a band of lymphocytes, plasma cells, macrophages and fibroblasts. In many cases, it appears that foci of caseous necrosis are centered on obliterated bronchioles. Edema f luid, fibrin and variable numbers of neutrophils and macrophages are often present in adjacent pulmonary parenchyma. The second, and less common, type of necrotic lesion described is fibrinopurulent bronchopneumonia accompanied by multifocal irregular area s of coagulative necrosis, surrounded by a dense zone of necrotic cells, especially neutrophils (Bashiruddin et al ., 2001; Shahriar et al ., 2002; Maeda et al ., 2003; Khodakaram Tafti and

PAGE 43

43 Lopez, 2004) Edema, fibrin deposition, and vascular and lymphatic th romboses in the interlobular septa may accompany these types of lesion (Rodriguez et al ., 1996; Khodakaram Tafti and Lopez, 2004) Large amounts of M. bovis antigen have been demonstrated in both caseous and coagulative necrosis by immunohistochemical stai ning, especially at the periphery of lesions (Rodriguez et al ., 1996; Clark, 2002; Maeda et al ., 2003; Khodakaram Tafti and Lopez, 2004; Gagea et al ., 2006) Whether the two distinct types of necrosis are a result of temporal events, co infection with othe r pathogens, variation among strains of M. bovis or variation in the host response is unknown. In one study, (Khodakaram Tafti and Lopez, 2004) investigators hypothesized that foci of coagulative necrosis evolve over time into foci of caseous necrosis, b ut this has not been demonstrated experimentally nor are both types of lesions usually observed in the same lung. Further studies are required to better characterize M. bovis associated lung lesions. Experimental and natural M. bovis associated respirator y disease is typically accompanied by hyperplasia of the lymphoid tissues in both the URT and LRT (Thomas et al ., 1986; Gagea et al ., 2006) Foci of caseous necrosis in bronchial and mediastinal lymph nodes of affected calves have been observed (Gagea et a l ., 2006) Lesions in the joints and tendon sheaths of calves after experimental inoculation of M. bovis are characterized as necrotizing fibrinosuppurative arthritis or tenosynovitis (Chima et al ., 1981; Ryan et al ., 1983; Thomas et al ., 1986) Similar le sions have been reported in naturally occurring M. bovis arthritis (Adegboye et al ., 1996; Clark, 2002; Hewicker Trautwein et al ., 2002; Gagea et al ., 2006) Macroscopic lesions vary from minimal to severe, but chronically affected joints usually contain n on odorous, turbid, yellow, and fibrinous to caseous exudate accompanied by thickening of the joint capsule. Histologically, affected joints usually

PAGE 44

44 have severe erosion of articular cartilage, hyperplasia and caseous necrosis of synoviae, and thrombosis of subsynovial vessels (Ryan et al ., 1983; Gagea et al ., 2006) Adjacent soft tissues, including ligaments and tendons are frequently involved (Adegboye et al ., 1996; Clark, 2002; Gagea et al ., 2006) Large amounts of M. bovis antigen in the periphery of nec rotic lesions and within joint exudates have been demonstrated by immunohistochemical staining of the joints of cattle with natural and experimental M. bovis arthritis (Thomas et al ., 1986; Adegboye et al ., 1996; Clark, 2002; Gagea et al ., 2006) In calve s with M. bovis associated otitis media, affected tympanic bullae are filled with fibrinosuppurative to caseous exudate (Walz et al ., 1997; Maeda et al ., 2003; Lamm et al ., 2004) Histologically, extensive fibrinosuppurative exudates fill the tympanic bull ae and normal architecture may be obliterated (Walz et al ., 1997; Maeda et al ., 2003; Lamm et al ., 2004) The tympanic mucosa may have areas of ulceration and/or squamous metaplasia and is markedly thickened due to infiltrates of macrophages, neutrophils, and plasma cells, and proliferation of fibrous tissue. There is usually extensive osteolysis and/or remodeling of adjacent bone (Walz et al ., 1997; Lamm et al ., 2004; Van Biervliet et al ., 2004) Lesions are accompanied by fibrinosuppurative eustachitis (L amm et al ., 2004) Large quantities of M. bovis antigen have been observed within necrotic exudates and, particularly, at the margins of necrotic lesions within the tympanic bullae, similar to findings in M. bovis pneumonia (Maeda et al ., 2003) In chronic cases, lesions frequently extend into the inner ear and include petrous temporal bone osteomyelitis (Maeda et al ., 2003; Lamm et al ., 2004) Meningitis as a consequence of otitis interna is usually localized to the regions adjacent to the affected petrous temporal bone and characterized as fibrinous to fibrinosuppurative and sometimes necrotizing (Lamm et al ., 2004; Ayling et al ., 2005) In addition, diffuse fibrinous meningitis has been described in neonatal

PAGE 45

45 calves with M. bovis meningitis which likely or iginated from mycoplasmemia (Stipkovits et al ., 1993) Mycoplasma bovis associated lesions have occasionally been identified in other body systems in both experimentally and naturally infected calves (Thomas et al ., 1986; Adegboye et al ., 1995a; Maeda et al ., 2003; Ayling et al ., 2005 ). Ayling et al ., (2005) described a 10 month old calf with a history of respiratory disease that had lesions of endocarditis and encephalitis from which M. bovis was the only pathogen isolated. In another report (Thomas et al ., 1986) intratracheal inoculation of M. bovis resulted in arthritis in one calf, and mycoplasmas were isolated from the blood during the first week post inoculation. At necropsy, investigators observed perivascular mononuclear cell infiltration in portal areas of the liver, and immunohistochemical staining revealed M. bovis in association with these lesions. Other investigators identified M. bovis antigen within foci of mononuclear cell infiltrates in the liver and kidneys of 2 calves with chronic M. bovi s pneumonia (Adegboye et al ., 1995a) Diagnosis The occurrence of M. bovis is generally underestimated for several reasons. Mycoplasma culture requires special equipment and expertise (Gourlay and Howard, 1983; Waites and Taylor Robinson, 1999) and few la boratories routinely monitor for this organism. Cows with M bovis mastitis can shed the bacteria intermittently, so repeated milk cultures may be required to determine true infection status (Jasper, 1981; Biddle et al ., 2003) In respiratory disease, mult iple pathogens are often present, and as other bacteria such as M. haemolytica and P. multocida are easier to culture, the presence of M. bovis may be missed (Ames, 1997; Gagea et al ., 2006 ). Recent studies suggest that M. bovis associated disease is under diagnosed, perhaps because veterinarians and pathologists fail to recognize the infection during routine physical, gross and microscopic examination (Nicholas and Ayling, 2003; Gagea et al ., 2006) In otitis

PAGE 46

46 media and arthritis, where M. bovis is often th e only pathogen present, it may also be missed unless culture for mycoplasmas is specifically requested. In addition, the physical location of the tympanic bullae makes sample collection difficult in otitis media cases. Mycoplasma bovis is sometimes associ ated with a variety of unusual clinical presentations in which its involvement is not widely recognized, and so appropriate diagnostic tests to detect this pathogen may not be requested. A history of respiratory disease that is poorly responsive to antibio tic therapy is suggestive of M. bovis involvement, especially when accompanied by cases of arthritis and/or otitis media. Although the associated lung pathology can be variable, multiple nodular lesions of caseous necrosis are strongly suggestive of M. bov is infections (Adegboye et al ., 1995a; Gagea et al ., 2006) However, as there are no pathognomonic clinical or pathological signs for M. bovis associated disease, a definitive diagnosis is based on isolation of M. bovis from the affected site, and/or by de monstrating its presence in affected tissues by polymerase chain reaction (PCR), capture enzyme linked immunosorbent assay (ELISA) or by immunohistochemistry (IHC). The culture of bovine mycoplasmas requires the use of nutritionally complex media as well a s a moist carbon dioxide enriched atmosphere (Jasper, 1981; Gourlay and Howard, 1983; Nicholas and Baker, 1998; Waites and Taylor Robinson, 1999) Growth of M. bovis in appropriate media is often apparent after 48 hr, but may take up to 10 days (Jasper, 19 81; Gourlay and Howard, 1983; Nicholas and Ayling, 2003) Mycoplasmal colonies on solid media are identified by their characteristic morphology; growth in broth is indicated by turbidity, film formation, and by subculture onto solid media (Gourlay and Howa rd, 1983) A number of pathogenic and non pathogenic bovine mycoplasmal species may be isolated from the URT o r from sites of pathology, either alone or in mixed infections (Nicholas and Ayling, 2003; Lamm

PAGE 47

47 et al ., 2004; Gagea et al ., 2006) Many of these c annot be differentiated morphologically, so speciation by immunological methods (direct or indirect immunofluorescence or immunoperoxidase testing) or by PCR is necessary (Jasper, 1981; Kotani and McGarrity, 1986; Poumarat et al ., 1991; Rosenbusch, 2001) In live calves with clinical signs of respiratory disease, mycoplasmal culture of transtracheal wash or broncho alveolar lavage (BAL) fluids are suitable for the diagnosis of M. bovis infections (Allen et al ., 1991; Virtala et al ., 2000; Thomas et al ., 20 02b) Comparisons of paired culture results for nasopharyngeal swabs and BAL samples in cattle with respiratory disease indicate that, in individual animals, isolation of M. bovis from the URT is not well correlated with its presence in the LRT or with cli nical disease (Allen et al ., 1991; Thomas et al ., 2002b) For example, in one study nasal swabs had a sensitivity of only 21% for predicting M. bovis associated lung disease (Thomas et al ., 2002b) N asopharyngeal swabs can be used at the group level to ind icate the presence of M. bovis within a calf facility (Bennett and Jasper, 1977c), although the sensitivity of this test has not been determined In calves with arthritis or tenosynovitis, affected joints and tendon sheaths can be aspirated for culture (By rne et al ., 2001) Due to difficulties with access to the site of infection samples are not usually collected from the tympanic bulla in live calves with otitis media. Mycoplasma culture of necropsy specimens can be performed directly from homogenates of fresh tissues, aspirates, swabs collected from lesion sites and lavage samples (Gourlay and Howard, 1983; Rosenbusch, 2001; Thomas et al ., 2002b) As for other infectious diseases, calves that are selected for necropsy for the diagnosis of a herd problem should be representative of the cases seen in that herd. Culture of BAL samples collected at necropsy may be preferable to culture of lung tissue when tissues cannot be processed immediately; mycoplasmas remain viable

PAGE 48

48 in BAL fluids for months at 20 C or 70 C, for a few days at 4 C and for several hours at room temperature, whereas isolation rates from lung tissue decrease markedly over a few hours after collection due to release of mycoplasmal inhibitors from disrupted tissue (Gourlay, 1983; Taylor Robins on and Chen, 1983; Nicholas and Baker, 1998) Complete agreement between mycoplasmal cultures of paired BAL fluids collected at necropsy and corresponding lung tissue cultured immediately after collection from cattle euthanized for respiratory disease has been reported (Thomas et al ., 2002b) Sample handling and transport are particularly important to ensure the survival of M. bovis. Swabs should be collected into transport media such as Ames (without charcoal) or (Clyde and McCormack, 1983) Swab s, lavage fluids, aspirates, milk and colostrum samples should be refrigerated and tissue samples should be collected as soon as possible after death and placed in sealed plastic bags on ice (Clyde and McCormack, 1983) Samples should be transported to the laboratory within 24 hr (Clyde and McCormack, 1983; Biddle et al ., 2004) If samples such as milk are stored frozen, they should still be submitted within 7 to 10 days of collection, as longer storage significantly decreases the isolation of M. bovis (Bid dle et al ., 2004) Detection of mycoplasmas in clinical samples can potentially be improved by using enrichment techniques and large inoculum sizes (Biddle et al ., 2003) L imitations of mycoplasma culture include the requirement for specialized equipment a nd expertise, the need to speciate any mycoplasmas that are isolated, the length of time before results are obtained, the overgrowth of slower growing species by other more rapidly growing mycoplasmas or other bacteria and fungi, the need to process sample s rapidly after collection to maximize sensitivity, and the occurrence of false negative cultures due to the presence of antibiotics or other inhibitors in clinical samples (Tully, 1983)

PAGE 49

49 In part to address frustrations with conventional culture technique s, a variety of PCR systems have been developed for the diagnosis of M. bovis infections. A few are designed to permit differentiation of multiple bovine mycoplasmal species within a single assay (Ayling et al ., 1997; Bashiruddin et al ., 2005) whilst most are designed to be specific for M. bovis (Hotzel et al ., 1996; Ghadersohi et al ., 1997; Subramaniam et al ., 1998; Pinnow et al ., 2001; Bashiruddin et al ., 2005) Three PCR systems have been most widely adopted for clinical diagnostics, including (1) amplif ication of the 16S rRNA gene with species or class specific primers followed by digestion with various restriction enzymes to permit differentiation of several species of mollicutes within a single assay (Ayling et al ., 1997; Bashiruddin et al ., 2005) (2) amplification of the 16S rRNA gene with species specific primers (Chavez Gonzalez et al ., 1995; Bashiruddin et al ., 2005) and (3) amplification of the housekeeping gene uvr C with species specific primers (Subramaniam et al ., 1998; Thomas et al ., 2004; Bash iruddin et al ., 2005) PCR can be used for the speciation of mycoplasmas that have already been isolated by routine culture methods (Ayling et al ., 1997; Subramaniam et al ., 1998; Thomas et al ., 2004) as well as for the direct detection of M. bovis in cli nical samples (Chavez Gonzalez et al ., 1995; Hotzel et al ., 1996; Hotzel et al ., 1999; Pinnow et al ., 2001) However, PCR performed directly from clinical samples can have variable sensitivity, and some authors report that samples containing < 10 2 colony f orming units / ml were often detected as negative by PCR (Hotzel et al ., 1999) a detection level that is no better than standard culture procedures. Sensitivity has been improved by antigen capture prior to PCR using an M. bovis specific monoclonal antibody (Hotzel et al ., 1999) A nested PCR was slightly more sensitive than assays based on culture of fresh milk samples, but was much more sensitive than culture (100% compared with 27%) for detection of M. bovis in milk after 2 years of frozen storage (Pinnow et al ., 2001)

PAGE 50

50 Because of the very close genotypic relationship between M. bovis and Mycoplasma agalactiae there has been considerable work invested in developing assays that accurately differentiate these two species (Mattsson et al ., 1991; Chavez Gonzal ez et al ., 1995; Tola et al ., 1996; Subramaniam et al ., 1998; Thomas et al ., 2004; Bashiruddin et al ., 2005; Foddai et al ., 2005) In a recent study (Bashiruddin et al ., 2005) five laboratories evaluated the specificity of four PCR detection systems for di fferentiating M. bovis and M. agalactiae. PCR based on detection of the housekeeping genes opp D/F or uvr C had better specificities (both at 100%) than did detection of the 16S rRNA gene combined with restriction enzyme analysis (96%) or detection of species specific sequences in the 16S rRNA gene (95.8%). However, because M. agalactiae is a pathogen of small ruminants that is presumed to be absent from North America and is rarely isolated outside of its typical hosts, differentiation from M. bovis is less of a concern on this continent than in regions where both pathogens exist. A sandwich ELISA has been developed to capture M. bovis antigen from cul ture medium or clinical samples, and is commercially available in Europe (Bio X Diagnostics, Belgium) (Ball and Finlay, 1998) The ELISA has a similar sensitivity to conventional culture when performed directly from clinical samples, but sensitivity is improved when samples are incubated in broth culture medium for a brief period prior to antigen capture. Immunohis tochemical demonstration of M. bovis antigen within tissues is a sensitive and specific means of determining the involvement of M. bovis in observed pathology (Haines and Chelack, 1991; Adegboye et al ., 1995b; Rodriguez et al ., 1996; Haines et al ., 2001; C lark, 2002; Shahriar et al ., 2002; Maeda et al ., 2003; Khodakaram Tafti and Lopez, 2004; Gagea et al ., 2006) Advantages of IHC are that it performs well using formalin fixed, paraffin embedded tissues, and can be performed retrospectively, especially when other findings suggest a M. bovis

PAGE 51

51 infection but culture is negative. An additional advantage of IHC is that it reveals the location of M. bovis within lesions. In one recent retrospective study (Gagea et al ., 2006) 98% and 100% of cases of caseonecrotic bronchopneumonia from feedlot calves submitted to a diagnostic laboratory were positive for M. bovis by culture and IHC, respectively. In cases of fibrinosuppurative pneumonia where M. haemolytica was isolated, M. bovis was also isolated in 82% of cases, a nd was demonstrated by IHC within lesions in mixed infections with M. haemolytica by IHC in 85% of cases (Gagea et al ., 2006) The involvement of M. bovis in lesions at a variety of other body sites has also been verified by IHC (Thomas et al ., 1986; Kinde et al ., 1993; Stipkovits et al ., 1993; Adegboye et al ., 1996; Clark, 2002; Maeda et al ., 2003; Gagea et al ., 2006) An indirect fluorescent antibody test using polyclonal antisera has been described for the detection of M. bovis in fresh, frozen lung tiss ue (Knudtson et al ., 1986) A variety of methods for the detection of M. bovis specific antibodies in serum and other body fluids have been described (Boothby et al ., 1983a; Rosendal and Martin, 1986; Brank et al ., 1999; Ghadersohi et al ., 2005) An indire ct hemagglutination test (IHA) has been successfully used to demonstrate the presence of M. bovis specific antibody in serum, colostral whey and joint fluid (Cho et al ., 1976; Boothby et al ., 1983a; Rosendal and Martin, 1986; Gagea et al ., 2006) However, the most widely applied method to detect M. bovis specific antibodies is an indirect ELISA (Le Grand et al ., 2002; Nicholas and Ayling, 2003) Most studies have used whole cell or membrane protein antigens derived from various reference or field strains of M. bovis Laboratory grown strains of M. bovis vary over time in their variable surface protein ( Vsp ) expression profiles, and it has been proposed that this may effect the reliability of immunological assays (Rosengarten and Yogev, 1996) although studie s addressing whether this issue is of practical concern in diagnostic ELISA have not been published. Le Grand et al .,

PAGE 52

52 (2002) developed an indirect ELISA using membrane proteins derived from a phenotypic clonal variant of the M. bovis type strain PG45 with a high level of expression of Vsp A; the assay performed well in experimentally and naturally infected cattle populations, although whether the antigen was superior to traditional antigens was not determined. A variety of ELISA tests for serological detec tion of M. bovis antibodies are now commercially available in North America and Europe ; for example, Biovet in Canada Bio X Diagnostics in Belgi um, and Bommelli in Switzerland all manufacture ELISA kits that detect M. bovis antibodies Mycoplasma bovis sp ecific serum immunoglobulin (Ig) is detectable as early as 6 days (IgM) to 10 days (IgG) after experimental inoculation of M. bovis into the respiratory tract (Brank et al ., 1999; Le Grand et al ., 2002) Specific serum immunoglobulin concentrations remain elevated for months to years after M. bovis infection, so a high titer does not necessarily indicate very recent exposure (Le Grand et al ., 2001; Nicholas and Ayling, 2003) Maternal antibody can also result in high antibody levels in young calves, althoug h with a half life of 12 to 16 days this typically wanes by a few months of age (Tschopp et al ., 2001) Virtala et al ., (2000) reported that of 75 pneumonic dairy calves less than 3 months of age in which M. bovis was isolated from tracheal wash samples, o nly 57% had a 4 fold or greater increase in M. bovis serum antibody titers by IHA. The authors concluded that paired serum samples were not a good predictor of M. bovis associated respiratory disease, possibly due to the presence of maternal antibody titer s. Other investigators also failed to find a correlation between serum antibody titers to M. bovis and M. bovis associated r espiratory disease in naturally infected individual animals (Rosendal and Martin, 1986; Martin et al ., 1989) However, on a group le vel, seroconversion has been predictive of M. bovis associated respiratory disease (Martin et al ., 1990; Tschopp et al ., 2001) Therefore, serology is of limited diagnostic value in individual animals and is really most

PAGE 53

53 useful in epidemiological surveillan ce (Rosendal and Martin, 1986; Le Grand et al ., 2002) Serology has also been effective as a biosecurity tool to screen new purchases prior to introduction into a herd, but this would only be applicable to animals more than a few months of age, after mater nal antibodies have waned (Byrne et al ., 2000; Nicholas and Ayling, 2003) Treatment The fact that Mycoplasma species lack a cell wall has important implications for treatment, as it means the beta lactam antibiotics are ineffective (Taylor Robinson and Be bear, 1997) Mycoplasma species are also naturally resistant to sulfonamides. Currently, only one product, containing the triamilide antibiotic tulathromycin (Draxxin ; Pfizer, Inc.) is approved for treatment of M. bovis associated disease in dairy calves in the U.S. Other a ntimicrobials that have a theoretical basis for efficacy against M. bovis, and that are approved in the U.S. for treatment of respiratory disease in dairy heifers less than 20 months of age, include florfenicol, oxytetracycline, spectino mycin, tilmicosin and tylosin. Recent evidence suggests that antimicrobial resistance to antibiotics traditionally used for treatment of mycoplasma infections is increasing in field isolates of M. bovis in North America (Francoz et al ., 2005; Rosenbusch e t al ., 2005) and Europe (Ayling et al ., 2000; Thomas et al ., 2003a); isolates from both continents show widespread resistance to tetracyclines and tilmicosin, and European isolates show increasing resistance to spectinomycin. Although in vitro antibiotic s usceptibility profiles of M. bovis may be useful in making broad generalizations about antibiotic resistance, data have not been published on the relevance of these profiles to clinical efficacy on an individual or a herd level. The antibiotic susceptibili ty profiles of paired M. bovis isolates obtained from nasal swabs and BAL samples in calves with respiratory disease were found to differ considerably within

PAGE 54

54 animals, suggesting that if susceptibility profiles are used, they need to be based on isolates ob tained from the site of infection (Thomas et al ., 2002b) In spite of the limited choice o f potentially effective antibiotics available, antibiotics are widely used to treat M. bovis associated disease. However, treatment is frequently unrewarding, with a ffected calves requiring a long duration of treatment or failing to respond (Stalheim and Stone, 1975; Romvary et al ., 1979; Allen et al ., 1992a; Stipkovits et al ., 1993; Adegboye et al ., 1996; Pfutzner and Sachse, 1996; Walz et al ., 1997; Apley and Fajt, 1998; Poumarat et al ., 2001; Stokka et al ., 2001; Francoz et al ., 2004; Van Biervliet et al ., 2004) Calves with chronic and/or multisystemic disease are reported to have an especially poor response to treatment (Stalheim and Stone, 1975; Stipkovits et al 1993; Adegboye et al ., 1996; Apley and Fajt, 1998; Stokka et al ., 2001). There are few c ontrolled clinical trials evaluating the efficacy of various antibiotics available for treatment of M. bovis associated disease, and t he few efficacy studies publishe d must be interpreted with caution, as most use experimentally infected calves and treatment is often started early in the disease course (Gourlay et al ., 1989b; Poumarat et al ., 2001; Godinho et al ., 2005) In an industry sponsored study, tulathromycin wa s an effective treatment for respiratory disease in dairy calves that had been experimentally infected with M. bovis, when treatment was initiated at 3 or 7 days after inoculation (Godinho et al ., 2005) Likewise, t ilmicosin administered 6 hrs prior to ino culation or at the onset of clinical disease was effective in reducing lung colonization by M. bovis in calves that had been experimentally infected with M. haemolytica plus M. bovis (Gourlay et al ., 1989b) However, treatment with spectinomycin did not al ter the clinical course of disease in calves with M. bovis plus P. multocida pneumonia when treatment was started 6 days after inoculation, although the numbers of M. bovis in the lung were reduced in treated calves (Poumarat et al ., 2001)

PAGE 55

55 Scant informat ion is available regarding treatment of M. bovis associated disease in field situations, and most studies have come from Europe. M arbofloxacin, a fluoroquinolone antibiotic, was an effective treatment for naturally occurring M. bovis associated respiratory disease (Thomas et al ., 1998) but this antibiotic cannot be used in cattle in the U.S. Available therapies that have resulted in clinical improvement in calves with M. bovis associated respiratory disease in field trials include oxytetracycline, tilmicos in, or a combination of lincomycin and spectinomycin (Picavet et al ., 1991; Musser et al ., 1996) However, given the recent evidence that resistance against these drugs is increasing, these antibiotics may no longer be appropriate choices. Without other da ta to guide choice of an antibiotic, selection of a specific treatment regim en from the list of potentially effective antibiotics based on past performance in the affected herd is frequently recommended (Apley and Fajt, 1998; Step and Kirkpatrick, 2001a) In addition to antibiotics, short term use of anti inflammatory drugs can be beneficial in the treatment of bovine respiratory disease (Bednarek et al ., 2003) Although these therapeutic agents have not been specifically evaluated for the treatment of M. bovis associated disease, there is a logical basis for their use, as the inflammatory response may contribute significantly to the pathology of M. bovis infections (Howard et al ., 1987c; Rosenbusch, 2001) Non specific supportive therapy including oral or intravenous fluids and nutritional support may be indicated in specific animals (Van Biervliet et al ., 2004) Irrigation of the middle ear after the tympanic membrane has ruptured has been recommended for treatment of otitis media in calves (Morin, 2004) although studies of the efficacy of this procedure were not identified in a literature search. Puncture of the tympanic membrane (myringotomy) followed by insertion of tympanostomy tubes is commonly used in

PAGE 56

56 the treatment of children with chronic or recurre nt otitis media (Lous et al ., 2005; Poetker et al ., 2006) and some veterinarians have promoted blind myringotomy using a sharp object such as a knitting needle in the treatment of otitis media in calves (Schnepper, 2002) To the best of the author's knowl edge, studies on the risks and efficacy of this procedure in clinical cases have not been published. The potential benefit of myringotomy is the relief of pain and pressure caused by the build up of exudate in the middle ear, as well as access to the middl e ear for irrigation (Rosenfeld et al ., 2004) Whether the procedure might provide relief for calves that have the thick, caseous exudate characteristic of chronic M. bovis otitis media is not clear. In a recent study using calf cadavers, investigators rep orted that blind insertion of a 3.5 mm diameter straight knitting needle approximately 3 cm into the ear canal to perforate the ear drum was anatomically feasible (Villarroel et al ., 2006) Studies are clearly needed to evaluate the effect of myringotomy o n drainage from the middle ear and the health and recovery of the calf. Another more aggressive surgical treatment of otitis media/interna was described in one case report (Van Biervliet et al ., 2004) A bilateral tympanic bulla osteotomy was performed on a 4 week old calf with severe, chronic M. bovis associated otitis media interna that had failed to respond to antibiotic treatment. Post surgically, the tympanic bullae were lavaged daily with warm saline for 3 days, and antibiotics were continued for 16 days. Surgery coincided with a dramatic improvement in clinical signs and the calf was reported to be clin ically normal at 1 year of age Because of the cost and complexity of this procedure, as well as the requirement for general anesthesia, its applicati on is probably limited to refractory cases of otitis media in high value calves without concurrent respiratory disease. To summarize, antibiotic treatment of M. bovis associated disease is often unrewarding, especially in calves with chronic or multisystem ic infections. Improved efficacies are reported in

PAGE 57

57 experimental infection studies when treatment is initiated early in the disease course, suggesting that early intervention or, perhaps, metaphylactic therapy in high risk calves (discussed below) may be mo re rewarding. Extended duration of antimicrobial therapy is frequently recommended. Further studies are needed to determine field efficacy of particular antibiotic regiments for treatment of clinical disease in U.S. dairy calves and to evaluate the safety and efficacy of myringotomy and irrigation of the middle ear in calves with otitis media. Control and Prevention Results of epidemiological studies of mycoplasmal mastitis suggest that the best way to prevent M. bovis infections is to maintain a closed he rd or to screen and quarantine purchased animals (Gonzalez et al ., 1992; Burnens et al ., 1999; Step and Kirkpatrick, 2001b; AABP, 2005) Results of such studies also suggest that M. bovis associated mastitis can be effectively eliminated from dairy herds t hrough aggressive surveillance and culling of cows with M. bovis mastitis (Brown et al ., 1990; Fox et al ., 2003) In feedlot cattle, where these types of biosecurity measures are not practical, recommendations for the control and prevention of M. bovis ass ociated respiratory disease and arthritis focus on limiting stress, vaccinating to reduce the incidence of other respiratory pathogens and segregating affected groups of calves from new arrivals to reduce exposure of high risk animals to M. bovis (Step and Kirkpatrick, 2001a; Stokka et al ., 2001) Dairies that are expanding and calf ranches that rear animals from multiple sources obviously cannot maintain closed herds, and calf ranches are not usually able to screen new calves prior to introduction into the facility. However, calf ranches do have the ability to be selective in purchasing calves, and animals could be screened on arrival to determine if a particular supplier is consistently providing M. bovis infected calves. Prevention of M. bovis associated disease is hampered in dairy calf operations by the extremely limited understanding of its epidemiology and risk factors.

PAGE 58

58 Current recommendations for prevention of M. bovis associated calf disease are based on reducing exposure to M. bovis. Potential sour ces of exposure that could be controlled include unpasteurized bulk tank or waste milk, colostrum, and indirect or direct contact with respiratory aerosols from infected calves. Exposure to M. bovis in milk could be limited by culling infected cows or avoi ding feeding milk from cows that are infected, by on farm pasteurization of milk prior to feeding, or by feeding milk replacer (Pfutzner and Meeser, 1986; Walz et al ., 1997; Butler et al ., 2000; Stabel et al ., 2004) On farm batch pasteurization of discard milk to 65 C for 1 hr or 70 C for 3 min (Butler et al ., 2000) or the use of a high temperature short time pasteurizer (Stabel et al ., 2004) will inactivate Mycoplasma species Frequent monitoring by culture of pasteurized milk samples to ensure that paste urization has been effective is important in any on farm pasteurization program (Godden et al ., 2005) Pasteurization of colostrum is also possible; authors of some recent studies reported that on farm batch pasteurization at 60 C for 30 min eliminated via ble M. bovis while immunoglobulin concentration and colostral consistency were not adversely affected (Godden et al ., 2006; McMartin et al ., 2006) Pasteurization methods that use higher temperatures have resulted in reduced colostral quality and unaccepta ble feeding characteristics (Godden et al ., 2003; Stabel et al ., 2004; Godden et al ., 2006) If colostrum is not pasteurized, it has been recommended that it should not be pooled to minimize potential exposure of calves to M. bovis ( Rosenbusch, 2001 ) Larg e numbers of M. bovis can be shed in respiratory secretions of calves with clinical M. bovis associated disease (Bennett and Jasper, 1977c; Pfutzner and Sachse, 1996) It has therefore been recommended to segregate affected and healthy calves, although thi s is frequently impractical (Step and Kirkpatrick, 2001a) Other recommendations that have been made include taking appropriate precautions to prevent potential transfer of M. bovis between calves by

PAGE 59

59 personnel or equipment (Nicholas and Ayling, 2003) Nipp les, bottles, tube feeders and buckets should be adequately sanitized, and pens disinfected between calves. As discussed earlier, M. bovis survives surprisingly well in the environmen t but it is highly susceptible to heat and to most commonly used chlorin e chlorhexidine acid or iodine based disinfectants (Pfutzner et al ., 1983b; Boddie et al ., 2002) older animals from infecting younger ones, but are often impractical in dairy calf facilities (Nicholas and Ayling, 2003) Management practices that help control other respiratory diseases by maximizing the M. bovis although none of these has been s pecifically evaluated with respect to this pathogen (Ames, 1997; Rosenbusch, 2001; Step and Kirkpatrick, 2001a) Such measures include providing proper nutrition, adequate ventilation at the pen level and reducing environmental stressors such as overcrowdi ng and heat and cold stress Because viral respiratory pathogens, especially BVDV, may predispose to M. bovis infection (Ames, 1997; Shahriar et al ., 2000) herd vaccination protocols for infectious bovine rhinotracheitis virus ( IBR ) parainfluenza type 3 virus ( PI 3 ), BVDV and bovine respiratory syncytial virus ( BRSV ) as well as the herd BVDV monitoring program, should be evaluated to ensure that they are appropriate. Although the role of passive transfer of M. bovis specific antibodies in protection of c alves from M. bovis associated diseas e is unclear, a sound colostrum feeding program can reduce the risk of infection with other respiratory pathogens (Ames, 1997) and may therefore decrease the risk of secondary M. bovis infections. There are no M. bovis vaccines approved for use in the U.S. in young dairy calves, although at least two are approved for prevention of respiratory disease in older cattle, and one

PAGE 60

60 for prevention of mastitis. Autogenous vaccines are also used by some producers in an attempt to prevent M. bovis associated disease in calves (Thomson and White, 2006) Although some vaccines have appeared promising (Chima et al ., 1980; Chima et al ., 1981; Howard et al ., 1987a; Nicholas et al ., 2002) others have failed to protect from or have worse ned clinical disease (Rosenbusch, 1998; Bryson et al ., 1999) Vaccination will be further discussed in the sections on relevant experiences with mycoplasmal vaccines for diseases other than M. bovis and vaccination against M. bovis below. The prophylact ic or metaphylactic use of antibiotics is generally undesirable but its use may be justified when high levels of morbidity and mortality are being sustained. Strategic antibiotic treatment of calves that are deemed to be at high risk for respiratory diseas e upon arrival at feedlots has clearly been demonstrated to reduce the incidence and severity of respiratory disease (Galyean et al ., 1995; Schunicht et al ., 2002; Thomson and White, 2006) In addition, feeding metaphylactic levels of antibiotics in milk r eplacer to dairy calves on calf ranches reduces disease incidence and delays the onset of clinical disease during the pre weaning period (Berge et al ., 2005) For M. bovis associated disease, the response to treatment when antibiotics are given prior to, o r early in the course of experimentally induced disease, is often better than the response rates reported in field cases, suggesting that metaphylactic treatment might be more successful than treatment after disease is clinically apparent. In one European study, investigators found that valnemulin added to the milk from 4 days of age for 3 weeks was effective in limiting M. bovis associated disease in calves (Stipkovits et al ., 2001) Animals in the treated group had fewer clinical signs and reduced clinica l scores, although disease was not eliminated and calves still required a considerable number of individual treatments. Nagatomo et al ., (1996) treated calves that were at high risk of M. bovis associated disease with

PAGE 61

61 chloramphenicol. Untreated calves had high mortality rates (up to 41%), while the onset of clinical disease was delayed in treated calves and all treated calves survived. Prophylaxis or metaphylaxis with antibiotics that are approved for use in U.S. cattle have not been evaluated with respect to M. bovis associated disease in young dairy calves. Microbial Pathogenesis Antigenic V ariation Mycoplasmal lipoproteins are involved in many diverse functions including modulation of essential cellular pathways, acquisition of nutrients, im mune modulati on and cytadhesion (Citti and Rosengarten, 1997; Chambaud et al ., 1999) Surface l ipoprotein variation in mycoplasmas is thought to be a means of adapting to varying environmental conditions, including the host immune response, and may be important in dete rmining the chronic nature of many mycoplasmal infections ( Citti and Rosengarten, 1997; Chambaud et al ., 1999 ) Many of these immunodominant mycoplasmal antigens undergo phase and/or size variation (Jan et al ., 1995; Razin et al ., 1998) There is some evid ence that lipoprotein variation in mycoplasmas is involved in protection from the immune response. Antigenic variation is observed in vivo (Levisohn et al ., 1995; Rasberry and Rosenbusch, 1995) and particular variants of M. bovis can be selected in vit ro by the addition of antibodies to culture medium (Jensen et al ., 1995; Le Grand et al ., 1996) The accessibility of antibodies to a mycoplasma colony depends on the size of Vsp s (Levisohn et al ., 1995) and elongated surface lipoproteins protect mycoplasma c ells from growth inhibiting antibodies (Citti et al ., 1997) possibly by limiting epitope accessibility. T he variable surface antigens (Vsa) of M. pulmonis (Simmons and Dybvig, 2003; Simmons et al ., 2004). Consistent with other mycoplasmal infections, cell surface lipoproteins are the preferential target of the humoral immune response in M. bovis infections (Behrens et al ., 1996;

PAGE 62

62 Brank et al ., 1999) A large family of immunodomi nant Vsp lipoproteins has been characterized in M. bovis (Behrens et al ., 1994; Lysnyansky et al ., 1996; Beier et al ., 1998; Brank et al ., 1999; Sachse et al ., 2000; Nussbaum et al ., 2002) Structurally, Vsp molecules contain extensive regions of tandemly reiterated sequences that can comprise over 80% of the entire protein (Behrens et al ., 1994) The members of the Vsp family undergo independent high frequency phase and size variation to generate diversity in the Vsp repertoire (Behrens et al ., 1994; Lysny ansky et al ., 1996; Lysnyansky et al ., 1999) Phenotypic switching in Vsp antigens is associated with high frequency chromosomal rearrangement in the vsp genomic locus, which consists of a large cluster of related but divergent single copy vsp genes (Lysny ansky et al ., 1999) Because of the processes producing antigenic variants, a given population of M. bovis cells always comprises variants differing in their lipoprotein repertoire (Rosengarten and Yogev, 1996) The expression of particular Vsp antigens ha s not been associated with geographical location, year of isolation, clinical manifestation, mode of infection, or pathology (Rosengarten et al ., 1994; Brank et al ., 1999; McAuliffe et al ., 2004) However, compared to the type strain of M. bovis field str ains have been shown to possess modified versions of the vsp gene complex in which there is extensive variation in the reiterated coding sequences of the vsp structural genes, indicating a vast capacity for antigenic variation within M. bovis populations ( Nussbaum et al ., 2002) In addition to the Vsp family, M. bovis may possess other methods to increase its capacity for antigenic variation. For example, M. bovis has recently been found to contain genes with homology to the abundantly expressed MALP 404 s urface lipoprotein of Mycoplasma fermentans (Lysnyansky et al ., 2006) Posttranslational processing of MALP 404, involving specific cleavage of part of the molecule into the extracellular environment, results in dramatic

PAGE 63

63 changes in the surface phenotype of M. fermentans (Davis and Wise, 2002) Whether these types of events also occur in M. bovis is currently unknown but may be feasible given the genetic data that has been reported (Lysnyansky et al ., 2006) Adhesion Adherence is an important feature of my coplasma pathogenicity. Adherence is thought to be the initial step in the disease causing process of pathogenic mycoplasmas (Baseman and Tully, 1997; Rottem and Naot, 1998; Rosengarten et al ., 2000) Once attached, the mycoplasma effectively colonizes the host respiratory surface, can induce physiological changes such as ciliostasis, and establishes a persistent and chronic infection (Rottem and Naot, 1998; Rosengarten et al ., 2000) The microbe then elicits a host immune response, and it is the character and intensity of the host response that is critical in lesion severity (Jones and Simecka, 2003) Unlike some pathogenic mycoplasmas (Krause, 1998; Rosengarten et al ., 2000) M bovis lacks a defined attachment tip. Although little is known about the ligan d s involved in M. bovis cytadherence, neuraminidase sensitive sialyl moieties are important for adherence of many mycoplasmas including M. bovis (Sachse et al ., 1996) Mycoplasma bovis adheres in vitro to neutrophils, embryonic bovine lung cells, and prim ary cultures of bovine bronchial epithelial cells in a specific manner (Thomas et al ., 2003b; Thomas et al ., 2003c) Immunohistochemical and electron microscopic studies have demonstrated in vivo adherence of M. bovis to respiratory and other mucosa l surfa ces, including the joint and mammary gland (Stanarius et al ., 1981; Thomas et al ., 1987; Adegboye et al ., 1995b; Adegboye et al ., 1996). Surface molecules of M. bovis that have been identified as important in adhesion include the protein P26, as well as me mbers of the Vsp family particularly Vsp C, Vsp F, and an as yet uncharacterized Vsp (Sachse et al ., 2000; Thomas et al ., 2005a) Recently, M. bovis has been shown to form a biofilm

PAGE 64

64 in vitro (see discussion below), and surprisingl y, the inability to form biofilms was linked to expression of Vsp F (McAuliffe et al ., 2006) Completion of M. bovis genome sequencing projects are anticipated in the near future and likely will provide additional information on putative adhesins for this pathogen. Biofilms Altho ugh flocculent growth of mycoplasmas in liquid medium as well as development of microcolonies have been observed (Pollock and Bonner, 1969; Miyata et al ., 2000) little attention has been given to the development of biofilms by these microorganisms. Howeve r, the ability of mycoplasmas to colonize mucosal surfaces, the development of persistent, chronic infections even in the face of a robust host immune response, and the refractory nature of many mycoplasmal infections to antibiotic therapy are characterist ics that have been associated with biofilm formation (Donlan, 2000; Donlan, 2002; Donlan and Costerton, 2002) Biofilm formation is well established as a mechanism by which bacteria, alone or in concert with other microbes, form sessile microbial communiti es that facilitate persistence within the host and development of chronic infections (Costerton et al ., 1999; Donlan, 2000; Donlan, 2002; Donlan and Costerton, 2002; Morris and Hagr, 2005) A key feature of biofilms that contributes to persistence is the i ncreased resistance to antibiotic therapy, often rendering microbes within the biofilm refractory to standard treatment regimens (Donlan, 2000) Additionally, microbes in biofilms are protected from components of the host immune response (Costerton et al ., 1999; Donlan and Costerton, 2002). Biofilm formation has now been documented for several ruminant mycoplasmas (McAuliffe et al ., 2006) as well as the rodent pathogen M. pulmonis (Simmons et al ., 2007; Simmons and Dybvig, 2007) Strains of M. agalactiae, M. bovis M ycoplasma cotewii, M ycoplasma putrefaciens, and M ycoplasma yeatsii all produced substantive biofilms, with other

PAGE 65

65 mycoplasmal species isolated from ruminants producing limited biofilms. In vitro analysis demonstrated that M. bovis in the biofilm were resistant to desiccation and heat stress, but did not alter the minimum inhibitory concentrations for standard antibiotics (McAuliffe et al ., 2006) Somewhat surprisingly, the most virulent bovine mycoplasma M. mycoides subsp. mycoides biotype SC, did not produce a biofilm; in fact none of the 24 SC strains tested could produce a biofilm (McAuliffe et al ., 2006) Biofilm formation was influenced by the strain of M. bovis and the inability to form biofilms was linked to expression of Vsp F (McAuliffe et al ., 2006) In fact, Vsp F was not expressed by any strain that was capable of forming prolific biofilms. Conversely, expression of Vsp B and O was more common in strains that produced strong biofilms. A similar association of Vsa expression and biofilm formation has been reported for M. pulmonis (Simmons et al ., 2007; Simmons and Dybvig, 2007) In M. pulmonis the size of the Vsa as determined by the tandem repeat length rather than the specific Vsa type was the critical determinant. Expression of short Vsa proteins was associated with strong surface attachment and production of a substantial biofilm, whereas expression of longer Vsa proteins resulted in free floating microcolonies that failed to attach to surfaces (Simmons et al ., 2007; Simmons and Dybv ig 2007) The attached M. pulmonis were more resistant to complement mediated lysis but were sensitive to gramicidin. The relationship between Vsa size and susceptibility to complement killing was shown previously (Simmons and Dybvig, 2003; Simmons et al ., 2004) but more recent studies suggest that resistance to complement killing is localized to the tower structures of the biofilm (Simmons and Dybvig 2007) which contained the most complex and dense association of M. pulmonis. Although biofilms are regul ated by environmental factors and quorum sensing in both Gram negative and Gram positive bacteria (Sauer, 2003; Stanley and Lazazzera, 2004)

PAGE 66

66 mycoplasmas appear to lack the classic two component regulatory systems. It has been suggested that in M. pulmonis slipped strand mispairings that generate variation in tandem Vsa repeats provide a stochastic mechanism for control of biofilm formation (Simmons et al ., 2007) and thus represent a simplistic model to study biofilm development in the absence of known reg ulatory elements. It is important to note that to date these studies have been done with in vitro systems, and definitive proof of the role of biofilms in the pathogenesis of mycoplasmal infections will require studies in animal models. Recently, biofilm formation has been given greater consideration as a potential mechanism by which microbial pathogens establish chronic, nonresponsive infections of the ear in humans (Post, 2001; Roland, 2002; Fergie et al ., 2004; Post et al ., 2004; Morris and Hagr, 2005; Vlastarakos et al ., 2007) Bacterial biofilms have been detected in biopsy material from the ears of children with a history of chronic otitis (Hall Stoodley et al ., 2006). Biofilms were confirmed in 90% of these patients. The formation of biofilms by Haem ophilus influenzae during experimental infection of chinchillas was confirmed by both scanning electron microscopy and confocal microscopy (Ehrlich et al ., 2002) All animals with effusions had evidence of biofilms. Development of Pseudomonas aeruginosa bi ofilms in the middle ear of experimentally infected cynomolgus monkeys has also been observed (Dohar et al ., 2005) Therefore, it is reasonable to suggest that the ability of M. bovis to form biofilms may be directly relevant to otitis media in calves. Oth er M icrobial F actors T hat M ight C ontribute to M. bovis V irulence There are several other biological properties of m ycoplasmas that have been implicated as virulence determinants. Mycoplasmas compete with host cells for nutrients and biosynthetic precursor s, and can therefore disrupt host cell maintenance and function (Baseman and Tully, 1997) After cytadherence, many mycoplasmal species generate enzymes such as

PAGE 67

67 phospholipases as well as other products such as hydrogen peroxide and superoxide radicals, wh ich may damage host cells (Baseman and Tully, 1997; Minion, 2002) However, much of the host cell damage and resulting clinical manifestations in mycoplasmal infections are due to the host immune reaction and inflammatory responses rather than direct toxic effects of mycoplasmal products (Rosengarten et al ., 2000; Jones and Simecka, 2003) S everal toxins have been identified in mycoplasmas, including the neurotoxin associated with Mycoplasma neurolyticum (Tully, 1981) and the most recent description of com munity acquired respiratory disease syndrome (CARDS) toxin in Mycoplasma pneumoniae (Kannan and Baseman, 2006) There is one report of a 73 kD polysaccharide toxin in M. bovis (Geary et al ., 1981) The polysaccharide component was present in association wi th a membrane glycoprotein and when injected intradermal ly into guinea pigs increased vascular permeability, activated complement and resulted in a massive recruitment of eosinophils into the dermis. Infusion of large amounts of the polysaccharide into th e udder induced clinical mastitis and lesions consistent with mycoplasmal mastitis. However, this polysaccharide has not been further characterized. Phenotypic classification of M. bovis isolates based on the presence or absence of in vitro c ytotoxic activ ity ha s been reported, b ut cytotoxic strains have not been fully characterized and the relevance of this phenotype with respect to virulence potential is unknown (Rosenbusch, 1996a; Rosenbusch, 1996b) Bovine Immunology: Relevant Background Information Ly mphocyte Subpopulations in Cattle There are three major bovine lymphocyte subpopulations: B cells, T cells expressing the T cell receptor, and T cells expressing the T cell receptor. As in other species, lymphocytes within the T cell population co express either CD4 (T helper [Th] cells) and are

PAGE 68

68 MHC class II restricted, or express CD8 (cytotoxic/suppressor T cells) and are MHC class I restricted. Some cells within the T cell population also coexpress CD8 (MacHugh et al ., 1997). T cells have impor tant effector functions and are pivotal in the regulation of the nature and intensity of an immune response. Th cells produce cytokines in response to recognition of an antigen MHC complex on antigen presenting cells (APC). By secreting particular cytokine s, Th cells play a vital role in activation of B cells, other T cells, macrophages and various other cells that participate in the immune response (Sordillo et al ., 1997). CD8 + T cells are uniquely equipped to recognize and kill bacterial or viral infected cells, as well as tumor cells, parasites and some free bacteria. They are also very important modulators of immune and inflammatory responses through the production of cytokines. In laboratory rodents, Th cells can be divided into distinct Th1 and Th2 sub populations; Th1 cells secrete cytokines such as IFN interleukin (IL) 2 and tumor necrosis factor (TNF) that are associated with inflammatory responses, whereas Th2 cells secrete cytokines including IL 4, IL 5, IL 6, IL 10 and IL 13 that mediate humor al responses (Jones and Simecka, 2003). IFN and IL 4 are the classical cytokines used to indicate Th1 and Th2 immune responses, respectively. In rodents, the T cell response is often polarized to a Th1 or Th2 response, with large increases in one cytokin e and the T cells that produce it, and a corresponding low production of the opposing cytokine (Jones and Simecka, 2003) In cattle, however, this clear division of immune response phenotypes is less evident and strongly polarized cytokine profiles are ra rely observed (Brown et al ., 1998c). However, highly skewed immunoglobulin isotype expression patterns occur in many cattle diseases, especially in chronic infections, with IgG 1 responses being driven by IL 4 and IgG 2 responses driven by IFN (Brown et al ., 1998c). These types of responses have been applied in cattle to indicate Th1 versus Th2 polarization, with IgG 1

PAGE 69

69 indicating a Th2 response, and IgG 2 indicating a Th1 response. In addition, ratios of IL 4 and IFN have been used to determine Th1 versus T h2 responsiveness in cattle (Brown et al ., 1998d; Vanden Bush and Rosenbusch, 2003; Miao et al ., 2004). Thus, although Th1/Th2 responses may not be well defined in cattle, some polarization of the immune response does occur and can be defined by IgG 1 /IgG 2 or IL 4/IFN ratios. Ruminants have a relatively higher percentage of T cells compared with other species (Hein and Mackay, 1991) The percentage of the circulating mononuclear cell population that expresses the T cell receptor is approximately 10 1 5% in adult cattle, and up to 40% in neonatal calves (Wilson et al ., 1996; Kampen et al ., 2006) Bovine T cells can be divided into subpopulations that differ in terms of tissue distribution and function (Wyatt et al ., 1994; Wyatt et al ., 1996; Wilson e t al ., 1998) The largest subpopulation within the circulation expresses the surface molecule WC1 (Workshop Cluster 1). WC1 + T cells are CD3 + but do not express CD2, CD4, or CD8 (MacHugh et al ., 1997). B etween 6 5 and 90 % of circulating T cells are WC 1 + and this percentage is not affected by age (Blumerman et al ., 2006; Kampen et al ., 2006) WC1 + T cells are also found in the white pulp of the spleen, outer cortex of peripheral lymph nodes, mucosal associated lymphoid tissue (MALT) epithelial layers of the gut and respiratory tract, skin, and sites of inflammation (Clevers et al ., 1990; Wilson et al ., 1999). In contrast, WC1 T cells, which do express CD2 and CD8, represent a small percentage of the circulating T cell population (MacHugh et al ., 1997). WC1 CD8 + T cells comprise a large percentage of the T cells in some tissues including the red pulp of the spleen and in the healthy mammary gland, uterus and other mucosal epithelial sites (e.g. lamina propria of the gut) (MacHugh et al ., 19 97; Hedges et al ., 2003).

PAGE 70

70 The role that T cells play in immune responses is poorly understood, but they appear to have broad effector and regulatory functions and are involved in many aspects of the bovine immune response to pathogens (Pollock and Wels h, 2002) T cells can recognize non protein antigens such as bacterial carbohydrates as well as classical protein antigens, and may therefore have unique roles in immune responses to unconventional antigens (Pollock and Welsh, 2002). Gene expression and microarray data suggest that the WC1 + T cells are primarily an inflammatory cell population with some subsets express ing IFN whereas WC1 T cells have regulatory functions and promote quiescence (Hedges et al ., 2003; Rogers et al ., 2005) Within the WC1 + T cell population, distinct subsets of T cells exist that may perform different functions (Rogers et al ., 2006; Price et al ., 2007). WC1 + T cell subsets in peripheral sites contribute to early production of IFN during infection with intracellula r and extracellular pathogens, and are thought to be important in linking the innate and adaptive immune responses (Price et al ., 2007). In addition, subsets of circulating WC1 + T cells express surface molecules that allow them to home efficiently to sites of inflammation, whereas WC1 T cells do not express these molecules and are not recruited to sites of inflammation (Wilson et al ., 2002). In very young calves T cells appear to have a predominantly dampening effect on antibody responses and on ant igen specific and mitogen stimulated responses of other T cells (Howard et al ., 1989). Calves that have been depleted of WC1 + T cells have reduced non specific production of IFN greater mucosal and systemic antibody responses to antigens, and increas ed tendency to Th2 biased responses (Taylor et al ., 1995; Kennedy et al ., 2002; Rogers et al ., 2005) Thus, bovine T cells are likely to be important in early immune responses to a broad range of antigens, and distinct T cell subsets are likely to ha ve unique functions in these immune responses.

PAGE 71

71 Lymphocyte subpopulations in the lungs or BAL fluid from normal cattle have been described (Mathy et al ., 1997; McBride et al ., 1997) Mathy et al ., (1997) examined lymphocyte subpopulations in lungs of adult cattle. T cells predominated over B cells in BAL and lung parenchyma cell populations, and CD8 + T cells predominated over CD4 + T cells. T cells made up approximately 9% of the lymphocyte populations. Most CD4 + and CD8 + T cells expressed high amounts of the activation marker CD44, as did B cells from BAL fluid. The authors did not report on the WC1 + subpopulation, but other investigators found that WC1 + T cells are present within bronchial lymph nodes of normal adult cattle (Cassidy et al ., 2001; Sopp and Howard, 2001). In addition, in the lungs of healthy 8 month old cattle, small numbers of WC1 + T cells were resident in bronchial submucosa and interalveolar septae (Cassidy et al ., 2001). Further, 1 year old calves experimentally inoculated with M. haemolytica had a substantial increase in the percentage of T cells in BAL fluid by 7 days post infection (McBride et al ., 1999). Although their function within the lung is unknown, the presence of T cells is consistent with a role in the early respo nse to lung infection. Although limited information is available, lymphocyte subpopulations in the peripheral lymphoid tissues of the respiratory tract in cattle have been described. Lymphocyte subpopulations in palatine and pharyngeal tonsils of healthy adult cattle have been reported (Rebelatto et al ., 2000). Populations at both tonsil sites were similar, and consisted of approximately 3% T cells 2% WC1 + T cells 15% CD4 + T cells and 7% CD8 + T cells, with the remainder being B and other mononuclea r cells. In 10 day old calves, T cells comprised approximately 8% of the mononuclear cell population in bronchial lymph nodes and 15% in lungs, although there was large calf to calf variation (McInnes et al ., 1999). In adult cattle, WC1 + T cells CD4 + T cells, and CD8 + T cells comprised 5%, 30% and 11% of bronchial

PAGE 72

72 lymph node mononuclear cells, respectively (Sopp and Howard, 2001). These and other studies have shown that T cells are resident in the lymphoid tissues of the URT and LRT and therefore could be expected to play a role in early immune responses at these sites. Anatomical B arriers and I nnate D efenses of the B ovine R espiratory T ract In the URT, defenses against infection are mainly in the form of physical and mechanical barriers to invading microbes, as well as in the specific antibacterial substances secreted onto the mucosal surface (Dungworth, 1993; Ellis, 2001) The structural design of the respiratory tract means that almost all inhaled particles are trapped in the nasal turbinates, tra chea and bronchi, with subsequent removal by mucociliary clearance before the trap ped particles reach the alveoli The mucosa of the URT and airways is also coated with mucus that contains non specific and specific antimicrobial factors such as lysozyme, s urfactants, and pathogen specific immunoglobulins. The importance of the mucociliary apparatus in lung defense in cattle is illustrated by the fact that damage to the structural integrity of the mucociliary system by viral agents is strongly associated wit h increased risk of secondary bacterial pneumonia (Ames, 1997; Kapil and Basaraba, 1997) A lveolar macrophages, neutrophils, natural killer (NK) cells, and mast cells are involved in innate immune defenses of the LRT. In addition, epithelial cells contrib ute to innate defenses through the secretion of pro inflammatory cytokines and chemokines (Kruger and Baier, 1997; Ackermann and Brogden, 2000; Yang et al ., 2002) Alveolar macrophages are probably the most important cell in initial response to infectious agents (Ellis, 2001) Alveolar macrophages can be activated through a variety of pathways by contact with pathogens or their products; opsonized particles are generally more effective activators of alveolar macrophages than are unopsonized particles (Howar d and Taylor, 1983) Activated alveolar macrophages secrete sub stances such as

PAGE 73

73 IL 8 that are chemotactic for neutrophils and other macrophages as well as pro inflammatory acute phase cytokines such as IL 1, IL 6 and TNF (Caswell et al ., 1998) In additio n, activated alveolar macrophages also display increased phagocytic capacity and bactericidal ability. As in other body systems, acute phase cytokines activate endothelial cells of blood vessels, initiating a cascade of events that results in leakage of se rum factors including complement into the lung. Acute phase cytokines also potentiate expression of adhesion molecules to allow trafficking of leukocytes into affected lung (Caswell et al ., 1998; Ackermann and Brogden, 2000) Neutrophils attracted to the s ite participate in phagocytosis and killing of pathogens, and are also involved in exacerbation of inflammatory responses in several bovine respiratory diseases (Ackermann and Brogden, 2000; Ellis, 2001) Major functions of NK cells are to kill tumor or v irus infected cells, but they may also play a role in the initial response to infection in the bovine lung. In other species, NK cells responding to early lung infection activate macrophages by secretion of pro inflammatory cytokines including IFN and TN F ; NK cells also secrete a variety of chemotactic factors (Curtis, 2005) Although NK cells are associated with protective responses against IBR infection in cattle (Ellis, 2001) little work has been done to define the role of NK cells in responses of t he bovine respiratory tract to this or other pathogens. Mast cells are located in the submucosa of the URT and LRT. Large numbers of mast cells are present along the respiratory tract of adult cattle, but numbers of mast cells in neonatal calves are more limited (Chen et al ., 1990; Ackermann and Brogden, 2000; Ramirez Romero et al ., 2000). In other species, mast cells contribute to non specific immune responses to bacterial pathogens through a variety of pathogen and inflammatory associated stimuli in ad dition to their well recognized role in IgE mediated allergic reactions (Brandtzaeg et al ., 1996; Boyce,

PAGE 74

74 2003) Although the role of mast cells in bovine respiratory disease has not been well studied, mast cell degranulation at the site of infection has be en shown to contribute to the acute inflammatory response to M haemolytica inoculation in young calves (Ackermann and Brogden, 2000). The role of mast cells in bovine respiratory disease is also receiving increasing attention as being important in the imm unopathogenesis of BRSV and H. somni infections (Jolly et al ., 2004; Gershwin et al ., 2005) Adaptive I mmune R esponses of the B ovine R espiratory T ract The URT, including the pharyngeal and palatine tonsils, contains organized MALT Interaction of cells of the immune system with potential pathogens of the respiratory system occurs at the MALT sites. Primary interactions occur between activated APCs especially dendritic cells, and lymphocytes in tonsils and in draining lymph nodes. For respiratory pathogens the importance of the URT as a site of immune induction is emphasized by studies where inoculation of an antigen into the URT results in specific antibody in both nasal and BAL fluids, but inoculation directly into the LRT only results in specific antibo dy in the lung. This can be important for disease protection; intranasal immunization of cattle against M. haemolytica resulted in protective immune responses to aerosol challenge, whereas intratracheal immunization did not (Jericho et al ., 1990). In adult animals, IgA is the predominant antibody isotype secreted in the URT, although in calves other isotypes including IgG may be equally or more important; this is discussed under neonates, below. The contribution of immune responses to protection from, or e xacerbation of, clinical disease caused by a number of viral and bacterial bovine respiratory pathogens has been widely studied. Both cell mediated and antibody responses to viral respiratory pathogens are associated with reduced clinical disease (Ellis, 2 001; Endsley et al ., 2002; Woolums et al ., 2003; Ellis et al ., 2007) However, cellular responses may also contribute to pathology in infected cattle (Ellis,

PAGE 75

75 2001; Gershwin et al ., 2005) For some pathogens, local cell mediated immunity, mediated by CD8 + T cells, is thought to be the critical protective immunological mechanism (Ellis, 2001) Protection against the bacterial pathogens M. haemolytica P. multocida, and H. somni is associated with high concentrations of antibody (maternal or endogenous) to var ious virulence determinants, particularly outer membrane proteins involved in iron acquisition, as well as the leukotoxin of M. haemolytica (Mosier, 1997; Potter et al ., 1999; Ackermann and Brogden, 2000) Thus effective protection is pathogen dependent an d may involve one or more arms of the immune system. Although specific immune responses confer protective immunity to many pathogens, some pathogen specific immune responses are receiving increasing attention for their roles in exacerbation of respiratory disease in cattle. For example, lung lesions due to BRSV infections are thought to have a significant immunopathological component resulting from the stimulation of a strong Th2 bias ed immune response, production of IL 4, and substantial amounts of IgE (G ershwin et al ., 2000) In lung infection with M. haemolytica immune complex deposition within alveolar walls and the subsequent inflammatory response is thought to contribute to pathology of this disease (McBride et al ., 1999; Ackermann and Brogden, 2000) Similarly, host immune responses are a major contributor to mycoplasmal disease in cattle and will be discussed in more detail below. Immunology of the Neonatal Calf Although calves are born with a competent immune system, they are immunonaive and many a spects of the immune system are developmentally immature (Barrington and Parish, 2001). This functional immaturity of the immune system is considered a major factor in determining the increased susceptibility to bacterial and viral infections observed duri ng the first few months of life (Barrington and Parish, 2001) Colonization of the URT of dairy calves with

PAGE 76

76 M. bovis often occurs within the first few weeks of life, with the peak incidence of clinical disease at around a month of age. During this period, the immune system of the young calf is undergoing rapid changes associated with maturation (Barrington and Parish, 2001; Nonnecke et al ., 2003; Foote et al ., 2005a) Therefore, age specific features of the immune system are likely to be important in determ ining the susceptibility or resistance of the young dairy calf to M. bovis associated disease. Vaccine strategies that target young calves may need to be tailored specifically to this age group. Influence of C olostrum Because the bovine syndesmochorial pl acenta does not permit passive transfer of maternal antibody in utero calves are born essentially agammaglobulinemic and rely on maternal antibodies absorbed from colostrum for disease protection in the first few months of life (Davis and Drackley, 1998) More than 80% of the immunoglobulin in bovine colostrum is IgG 1 ; the remainder is mostly IgG 2 and IgA (Davis and Drackley, 1998) Fresh colostrum also contains large numbers of viable leukocytes as well as factors involved in non specific immune defenses (Park et al ., 1992; Barrington and Parish, 2001) Selected populations of functional T cells are transferred into colostrum and readily cross the neonatal intestinal barrier and become distributed systemically (Liebler Tenorio et al ., 2002; Reber et al ., 2 006) In the neonatal calf, maternal antibodies, lymphocytes and other factors modulate immune responses, especially B cell responses (Barrington and Parish, 2001; Endsley et al ., 2003; Reber et al ., 2005; Prgomet et al ., 2007) The functions of maternal T cells in the neonatal calf have been partially defined in vitro ; maternal CD4 + T cells are thought to stimulate immune responses in newborns by secretion of cytokines while CD8 + T cells are thought to have mainly an immunosuppressive or dampening effect o n the neonatal immune response (Riedel Caspari and Schmidt, 1991a; Riedel Caspari and Schmidt, 1991b; Barrington and Parish, 2001) How long maternal T cells survive in the calf and

PAGE 77

77 their long term effects have not been determined. The contribution of mate rnal lymphocytes to immune responses in the respiratory tract of newborn calves is unknown, although maternal lymphocytes do play a role in neonatal resistance to some enteric pathogens (Archambault et al ., 1988; Riedel Caspari, 1993) B cells are also tra nsferred into colostrum, although their primary role is believed to be synthesis of dimeric IgA within mammary secretions (Barrington and Parish, 2001) The half life of colostral antibody in calves is 11.5 to 16 days (Sasaki et al ., 1976; Davis and Drackl ey, 1998) and the majority of passively acquired antibody is cleared by transfer across the mucosal epithelia, where it is functional and helps prevent infections (Besser et al ., 1988a; Besser et al ., 1988b) Transfer of maternal IgG from serum to nasal s ecretions has been demonstrated in young lambs (Wells et al ., 1975) In calves, most of the work in this area has involved study of receptor mediated transcytosis of IgG into the intestinal lumen (Besser et al ., 1988a; Besser et al ., 1988b) and there are limited data defining the mechanisms by which maternal immunoglobulin is involved in protection of the respiratory tract. However, t here is a strong association between failure of passive transfer of maternal antibody and increased risk and severity of res piratory disease in young calves, leaving little doubt that maternal immunoglobulin does play an important role in protecting the LRT from disease in the neonatal calf (Thomas and Swann, 1973; Williams et al ., 1975; Davidson et al ., 1981; Blom, 1982; Corbe il et al ., 1984; Van Donkersgoed et al ., 1993; Donovan et al ., 1998a) Aside from the obvious benefits in protecting the calf from infectious disease, colostral antibody also has potent immunomodulatory effects and can prevent the development of an active humoral immune response to certain antigens (Riedel Caspari and Schmidt, 1991b; Ellis et al ., 1996; Barrington and Parish, 2001; Ellis et al ., 2001) This has particular relevance to the

PAGE 78

78 development of effective vacci nes for use in neonatal calves Howeve r, at least with some antigens, an anamnestic response in the face of maternal antibody can occur after second exposure even without a measurable humoral response after the first exposure (Menanteau Horta et al ., 1985; Ellis et al ., 1996) Age matched colo strum deprived calves as well as neonatal calves euthanized immediately after birth have increased numbers of IgG 1 and IgG 2 secreting cells in lymph nodes as compared with colostrum fed calves (Aldridge et al ., 1998) ; thus feeding of colostrum actually de pletes the numbers of IgG 1 and IgG 2 secreting cells in lymph nodes. This effect does not require the presence of viable maternal leukocytes and is thought to be mediated by antibody or other soluble factors in colostrum. Isotype specific depletion of anti body secreting cells represents one mechanism by which colostrum down regulates humoral capacity in newborn calves. Colostrum also modulates cell mediated immune responses in calves, and peripheral blood lymphocytes in colostrum fed calves have lower blast ogenic responses to T cell mitogens than do colostrum deprived calves (Clover and Zarkower, 1980) Innate I mmune R esponses in N eonatal C alves Despite the fact that the innate immune system is of primary importance in protection from disease during the firs t few months of life, there are limited data on the functional capacity of innate defenses in neonatal calves. The total number of neutrophils in peripheral blood is higher in newborn calves than in adult cattle, and gradually decreases over the first 2 mo nths of life (Kampen et al ., 2006; Mohri et al ., 2007) Results of in vitro studies of the functional maturity of neutrophils in newborn calves are conflicting (Hauser et al ., 1986; Menge et al ., 1998; Kampen et al ., 2006) In a recent study, Kampen et al (2006) reported that in vitro phagocytosis, respiratory burst, and bactericidal activity was intact and functional in neutrophils from 1 week old calves. Another major cell of the innate immune system, NK cells, comprise a greater percentage of the total lymphocyte population in calves (< 6 months of age) than in adult

PAGE 79

79 cattle (Kulberg et al ., 2004), but NK cell functions specific to young calves have not been defined. Alveolar macrophages are a major cell type contributing to in nate defenses of the LRT including defenses against mycoplasmal infections (Cartner et al ., 1998) The proportion of alveolar macrophages in BAL fluid is similar for calves at 1 week of age and for adults (Pringle et al ., 1988; Yeo et al ., 1993) but in vitro phagocytic capacity w as reported to be markedly reduced in calves less than 3 weeks of age (Yeo et al ., 1993) Alveolar macrophages of young calves also have impaired secretion of neutrophil chemotactic factors compared with adult cattle (Lu et al ., 1996) This implies that th e alveolar macrophages in calves are functionally immature even though their numbers are equivalent to those found in immunocompetent adults. Reduced phagocytosis, decreased secretion of cytokines and chemotactic factors, and/or lowered bactericidal activi ty in neonates compared with adults has been reported for alveolar macrophages in other species including humans, rhesus monkeys, horses, pigs, rats, and sheep (Weiss et al ., 1986; Liu et al ., 1987; D'Ambola et al ., 1988; Kurland et al ., 1988; Grigg et al 1999; du Manoir et al ., 2002; Goldman et al ., 2004) Adaptive I mmune R esponses in N eonatal C alves The initial site of immune system interactions with respiratory pathogens in the URT is MALT. Palatine and pharyngeal tonsils are not fully developed in th e neonatal calf and do not attain a mature MALT structure until approximately 2 months of age (Schuh and Oliphant, 1992; Manesse et al ., 1998) In 3 week old calves, T and B cell dependent areas in the tonsils are not well differentiated, with few germinal centers and few WC1+ T cells as compared with tonsils of 2 month old calves. Numbers of T and B cells are much less than in mature tonsils. Maturation of MALT in the URT is thought to be triggered by exposure to antigens over the first

PAGE 80

80 few weeks of lif e (Manesse et al ., 1998) The impact of the apparent immaturity of the neonatal calf tonsils has not been studied, but lower numbers of B and T cells at these sites could be expected to limit the number of antigens in the URT that the calf is able to respo nd to early in life. The circulating lymphocyte population in young calves differs significantly from that of adult cattle. Calves have higher absolute numbers of lymphocytes in peripheral blood than do adult cattle (Kulberg et al ., 2004) but calves have a much lower proportion of circulating B cells (Senogles et al ., 1978; Nonnecke et al ., 1999; Kampen et al ., 2006) and a much higher proportion of T cells (Wilson et al ., 1996; Nonnecke et al ., 1999; Kampen et al ., 2006) Composition of the circulating lymphocyte population changes gradually over the first few months of life, and by 3 to 4 months the relative proportions of various lymphocyte populations are similar to those of adult cattle (Nonnecke et al ., 1999; Nonnecke et al ., 2005; Kampen et al ., 20 06) The relative proportion of peripheral blood mononuclear cells (PBMC) reported to be T cells is 35 40% in the first week of life, decreasing to approximately 25% at one month of age (Wilson et al ., 1996) The decrease in the relative proportion of T cells that occurs over the first few months of life is due to an increase in the absolute numbers of other lymphocyte subsets, mainly CD4 + T cells and B cells, rather than a decrease in the absolute T cell numbers (Kampen et al ., 2006) The absolute n umber and proportion of CD4 + T cells in healthy calves increases in the first few weeks of life, whereas there is little difference between calves and adults in the number or relative proportion of CD8 + T cells (Kampen et al ., 2006; Foote et al ., 2007) P erhaps the most obvious difference between the lymphocyte populations of calves and adults is that young calves have markedly lower numbers and relative proportions of circulating

PAGE 81

81 B cells than do adults (Senogles et al ., 1978; Nagahata et al ., 1991; Nonnec ke et al ., 2003; Kampen et al ., 2006) For example, the relative proportion of PBMC that were B cells expressing the maturation marker CD21 was very low in the first week of life (4%) and then increased gradually to 6 months of age (30%) (Kampen et al ., 20 06) Other investigators have reported that B cell numbers reach adult levels by a month of age (Senogles et al ., 1978; Nagahata et al ., 1991) Endogenous antibody production is measurable as early as a few days of age (Barrington and Parish, 2001) but ex pression of some isotypes and/or allotypes of antibody is delayed for weeks to months after birth (Corbeil et al ., 1997) Overall, humoral antibody responses and in vitro responses of B cells to stimulation are markedly less in neonatal calves than in adul t cattle (Nagahata et al ., 1991; Barrington and Parish, 2001; Nonnecke et al ., 2003) Immunoglobulin secreted into the lumen of the respiratory tract helps prevent adhesion of pathogens to host cells and acts as an opsonin for phagocytic cells (Daniele, 19 90; Brandtzaeg et al ., 1996) In mature animals, most immunoglobulin on mucosal surfaces is secretory IgA, but other isotypes may predominate in young animals (Sheoran et al ., 2000) BAL fluid from 2 week old calves contains a higher proportion of IgG 2 com pared to serum, suggesting that local selective transfer of IgG 2 occurs in the LRT of calves (Pringle et al ., 1988) The ratio of IgG/IgA and of IgG 1 /IgG 2 were found to be 12:1 and 1.3:1, respectively in BAL fluid from 2 week old calves (Pringle et al ., 19 88), although the ratio of IgG/IgA in BAL of young calves has varied among reports, probably due to differences in sampling technique (Walker et al ., 1980; Wilkie and Markham, 1981) Plasma cells secreting IgG 2 do not appear in the respiratory tract of cal ves until after the second week of life (Allan et al ., 1979) so IgG 2 present in BAL fluid of younger calves is likely to be derived from distant lymphoid tissues or from maternal immunoglobulin. In the intestinal tract, IgM is the predominant endogenous a ntibody present in the first few weeks of

PAGE 82

82 life (Logan and Pearson, 1978; Heckert et al ., 1991) but there is little data on the levels of IgM in respiratory secretions of young calves. The number of antigens to which the calf can produce an adaptive immun e response is limited at birth compared with mature cattle, and calves respond to specific antigens at different times early in life. Some antigens may elicit an antibody response at birth, whereas others may not elicit a response until weeks or months of age (Barrington and Parish, 2001) The mechanisms by which this occurs are poorly understood, but several factors may contribute to the limited immune response observed in the newborn calf. The low numbers of functional B cells in neonatal calves and the s uppression of humoral responses by colostrum have already been discussed. In addition, T cells of neonatal calves are hypo responsive in activation (Nonnecke et al ., 2003; Foote et al ., 2005a) and homing mechanisms (Foote et al ., 2005a) when compared to th ose of older calves and adults. Relative to the mitogen induced responses of T cells from adult cattle, T cells from neonatal calves show decreased proliferative capacity (CD4 + cells), delayed increase in the expression of the IL 2 receptor (CD25) associat ed with activation (CD4 + cells), no expression of the adhesion molecule CD44 associated with leukocyte trafficking to sites of inflammation (CD4 + and T cells), and no decrease in expression of the lymph node homing receptor, CD62L (CD4 + CD8 + and T cel ls). However, by 8 weeks of age mitogen induced and antigen specific responses are similar to those of adult cattle, indicating that T cell function matures rapidly during the first few weeks of life (Foote et al ., 2005a; Foote et al ., 2005b) The neonate s of many species have a decreased capacity to produce cytokines, especially those associated with Th1 responses. There is a tendency to a Th2 biased immune response characterized by a predominance of IL 4 and IgG 1 in neonatal response to antigens (Adkins,

PAGE 83

83 2000; Siegrist, 2000) This Th2 bias is also observed in calves, and the capacity of PBMCs from neonatal calves to produce IFN is substantially less than that of adult cattle (Nonnecke et al ., 2003) However, neonates, including calves, are capable of p roducing a Th1 biased response when exposed to potent inducers of such responses such as purified proteins from Mycobacterium bovis (Adkins, 1999; Ota et al ., 2002; Nonnecke et al ., 2005) The nutritional status of the neonatal calf affects immune respons es. F eeding calves at a high plane of nutrition is associated with reduced viability of circulating T cell populations (Foote et al ., 2007) as well as reduced mitogen induced proliferative responses of T cells (Foote et al ., 2005a) The effects of p rotein energy malnutrition on the neonatal calf immune system is unknown, but in other species malnutrition and weight loss are associated with defects in cell mediated immunity, antibody production, cytokine product ion, and phagocytic function (Chandra, 2002) A lthough the mechanism by which nutrition influences immune function in the neonate is unknown, it is clear that nutrition during the pre weaning period can have a major impact on the rate of maturity of the immune system in the young calf. Summary of the Neonatal Calf Immune Response In summary, components from all arms of the immune system (local and systemic, innate and adaptive) of the neonatal calf differ substantially from that of adult cattle; these components undergo rapid immunological maturation d uring the first few months of life. The young calf initially can respond to only a limited number of antigens and this repertoire of antigens increases gradually over time. Humoral immune responses, in particular, are suppressed during the first few weeks of life, especially in colostrum fed calves. The relative proportion of T cell subsets, the intensity of their response to antigen, and the types of cytokines that are secreted all differ substantially in neonates as compared with adults. Importantly, neon ates tend to produce a

PAGE 84

84 Th2 polarized immune response. The relative immaturity of innate and adaptive immune responses likely contributes to the increased susceptibility to infectious disease that is observed in young calves. The immaturity of adaptive immu ne responses in young calves also has important implications for development of effective vaccines for use in neonates. Immunology of the Eustachian Tube and Middle Ear Otitis media can occur in all age groups, but young animals and human infants are at gr eate st risk. Although there is little published on age related anatomical changes in the middle ear and eustachian tubes of cattle, anatomical features that vary between adults and infants such as the length and the angle of the eustachian tube are thought to contribute to susceptibility to otitis media (Bluestone, 1996) Because of inefficient eustachian tube opening, infants are more likely than adults to develop negative pressure in the middle ear which can increase the risk of entry of nasopharyngeal fl uids and bacteria (Bluestone, 1996) However, the major factor determining age related susceptibility to otitis media is the functional immaturity of the immune system in neonates and high susceptibility to viral and secondary bacterial infections of the U RT observed in this age group (Giebink, 1994; Bakaletz, 1995; Chonmaitree and Heikkinen, 1997; Adkins, 2000; Barrington and Parish, 2001) The age at which colonization of the nasopharynx or tonsils first occurs affects the risk of developing otitis media. For example, infants that are first colonized in the nasopharynx with Streptococcus pneumoniae, H. influenzae or Moraxella catarrhalis before 3 months of age have increased risk and severity of otitis media compared with infants who are first colonized af ter 3 months of age (Faden et al ., 1997) Colonization of the nasopharynx with bacterial pathogens within the first week of life is associated with extremely high rates of otitis media (Leach et al ., 1994) Interestingly, a similar pattern is observed in a nimals. Age related susceptibility to otitis media is also observed in M. hyorhinis infections of piglets and M. bovis infections of calves, although age specific factors contributing

PAGE 85

85 to susceptibility in these species have not been determined (Morita et a l ., 1995; Friis et al ., 2002) These findings suggest that the ability to delay colonization by only a few weeks might have a dramatic impact on susceptibility to M. bovis associated otitis media in calves. Pathogens that cause otitis media in children are able to colonize and cause a local inflammatory response in the nasopharyngeal tonsils (adenoids). The adenoids may act as a nidus of infection, seeding the distal end of the eustachian tube, which is in close physical proximity (Rynnel Dagoo and Freijd, 1988; Kiroglu et al ., 1998) In fact, surgical removal of the adenoids is often effective at curing older children with chronic or recurrent otitis media (Rynnel Dagoo and Freijd, 1988; Paradise et al ., 1999; Rosenfeld et al ., 2004) The pharyngeal tonsil in cattle is the anatomical equivalent of the adenoids (Schuh and Oliphant, 1992) However, its role in colonization of the URT and subsequent seeding of the eustachian tubes has not been addressed in calves. For all species studied, the middle ear and eu stachian tube are lined by a respiratory epithelium. The mucosa of the eustachian tube and parts of the middle ear consists of ciliated epithelial cells and mucous secreting cells. Cilia beat in a coordinated fashion to clear fluid, bacteria and other part icles from the middle ear to the nasopharynx, as well as to prevent entry of pathogens into the middle ear (Bluestone, 1996) Cells within the eustachian tube mucosa also secrete non specific antibacterial substances such as surfactant proteins that may be important in protection against pathogens (Lim et al ., 1987; Paananen et al ., 2001). Increased mucus production by cells of the eustachian tube is stimulated by the presence of inflammatory mediators (Lim et al ., 1987) Viral and bacterial infections of t he nasopharynx and eustachian tube are associated with damage to the eustachian tube epithelium and disruption of ciliary function (Miyamoto and Bakaletz, 1997; Chonmaitree, 2000; Heikkinen and Chonmaitree,

PAGE 86

86 2003) In addition, the inflammation associated w ith these infections, along with other causes of inflammation of nasopharyngeal mucosa such as allergic disease, can cause physical obstruction of the eustachian tube (Lim et al ., 1987; Bluestone, 1996) In fact, eustachian tube dysfunction is thought to b e the most important risk factor for the development of otitis media (Bluestone, 1996) In animal models of human otitis, macrophages are the primary cells responding to infection of the middle ear during the acute phase of otitis media (Bakaletz et al ., 1987; Takahashi et al ., 1992) Impaired function of alveolar macrophages is described in neonatal calves (Yeo et al ., 1993; Lu et al ., 1996) but whether macrophages of the middle ear are likewise suppressed in young calves has not been determined. Substan tial numbers of mast cells are also present in the middle ear of rodents and humans, mainly located adjacent to blood vessels in the lamina propria (Brandtzaeg et al ., 1996) Although no definitive data are available, it is generally assumed that mast cell s play a role in inflammation; whether there are similar numbers of mast cells in the middle ears of young calves has not been reported. The middle ear and eustachian tubes contain MALT that is involved in the production of a localized specific immune resp onse to bacterial and viral agents (Ogra, 2000) However, MALT is typically not found in healthy children less than 1 month of age, and this may be a factor in the increased susceptibility to otitis media in this very young age group (Kamimura et al ., 2000 ) Both B cells and T cells are present in the MALT of the middle ear during otitis media, but data regarding the cell mediated immune response in the middle ear are limited (Ogra, 2000) In healthy rats, IgA can be detected in the mucosa of the eustachian tubes but in relatively small amounts; in the healthy, uninfected middle ear almost no antibody secreting cells are present (Watanabe et al ., 1992) D uring otitis media however, large amounts of IgA are

PAGE 87

87 detected in the eustachian tube, and IgA, IgG, and IgM are all detected in the middle ear (Svinhufvud et al ., 1992) In young children with otitis media, a s trong local IgA response can occur in the nasopharynx without a detectable systemic antibody response (Virolainen et al ., 1995; Nieminen et al ., 1996) Passive protection against bacterial otitis media in infants is provided by feeding breast milk containing high amounts of pathogen specific IgA, which prevents adherence to and colonization of the pharyngeal mucosa (Hanson et al ., 1984; Duffy et al ., 19 97) Similarly, passive transfer with IgA has been effective in limiting colonization of the nasopharynx and preventing clinical disease in animal models of H. influenzae otitis media (Kennedy et al ., 2000) Interestingly, while complete eradication of H. influenzae from the nasopharynx was highly effective at preventing otitis media, reduction of the bacterial load in the nasopharynx to below a critical threshold level appeared similarly effective (Kennedy et al ., 2000) In humans and in animal models of human otitis media, viral infection of the URT is a major predisposing factor to bacterial otitis media. In pigs, no specific viruses have been identified in association with M. hyorhinis induced otitis media (Morita et al ., 1995; Friis et al ., 2002) Howe ver, M. hyorhinis itself causes eustachitis and it may therefore induce the eustachian tube dysfunction that is an important factor leading to development of otitis media (Morita et al ., 1999) Whether viral infections play a role in M. bovis associated ot itis media in cattle has not been established; unlike some mycoplasmal pathogens, M. bovis did not cause marked disruption of ciliary activity in tracheal organ cultures (Howard et al ., 1987b) Immune Responses to Mycoplasmal Infections, with a Focus on M. bovis Mycoplasmal respiratory infections are characterized by an initial inflammatory response triggered by interactions of mycoplasmas with cells of the respiratory tract Frequently, the host is unable to clear the infection and the mycoplasma persists despite an active immune response

PAGE 88

88 (Fernald, 1982; Cartner et al ., 1998; Razin et al ., 1998) These features mean that virtually all aspects of the host immune system are involved in responses to mycoplasmal infections, and immune responses critically affec t the level of mycoplasmal infection and the progression of disease. Innate responses and humoral immunity are the major contributors to defense against mycoplasmal respiratory infections, whereas cell mediated immunity is less important in protection (Car tner et al ., 1998; Jones and Simecka, 2003; Woolard et al ., 2005) However, much of the pathology and resulting clinical manifestations that occur in mycoplasmal diseases are an effect of the host immune response rather than a direct effect of the mycoplas mas themselves. Cell mediated immunity likely plays a major role in these immunopathological responses (Rottem and Naot, 1998; Rosengarten et al ., 2000; Jones and Simecka, 2003) Interactions between mycoplasmal pathogens and their hosts are much more comp lex than might be expected from the small genome, structural simplicity and limited biosynthetic capacity of mycoplasmas Mycoplasmas can induce a broad range of immunomodulatory events by direct effects on macrophages, neutrophils, and lymphocytes, and by indirect effects through induc tion of cytokine secretion from these and other cells such as epithelial cells (Baseman and Tully, 1997; Rosengarten et al ., 2000) The complicated relationship between mycoplasmas and their hosts means that many aspects of t hese interactions are poorly understood, even for the host pathogen relationships for which there is a large body of research data. For M. bovis infections, very little is known about the ho st and microbial factors that contribute to development of disease or to the production of an effective immune response. Innate I mmune R esponses to M ycoplasmal I nfections Innate immune responses are critical in the early phase of mycoplasmal respiratory infections for clearance of the microorganism and control of infect ion (Cartner et al ., 1998; Hickman Davis, 2002) Macrophages and alveolar macrophages in particular are the most

PAGE 89

89 important cells in innate defense of the respiratory tract. However, other cells including neutrophils, NK cells and epithelial cells play im portant roles in initial responses to mycoplasmal infections and, in some cases, contribute to detrimental host responses (Cartner et al ., 1998; Hickman Davis, 2002) The importance of alveolar macrophages in control of mycoplasmal respiratory infections i s illustrated by comparing strains of mice that are genetically resistant or susceptible to M. pulmonis induced lung disease (Parker et al ., 1987; Hickman Davis et al ., 1997; Cartner et al ., 1998) This difference in disease susceptibility is due to enhanc ed clearance of M. pulmonis from the lungs of resistant, compared with susceptible strains of mice Clearance from the lungs in resistant mice occurs early in the course of infection, before any influx of inflammatory cells, suggesting that resident alveo lar macrophages are responsible (Parker et al ., 1987) Consistent with this hypothesis, mice of the same resistant or susceptible genetic backgrounds but which lacked the ability to produce antibody or T cell responses retained the differences in pulmonary clearance of mycoplasma (Cartner et al ., 1998) Depletion of alveolar macrophages in resistant strains of mice resulted in a dramatic increase in the numbers of M. pulmonis in the lung and in the severity of disease, whereas depletion of alveolar macropha ges in susceptible strains had minimal effect, confirming the essential role of alveolar macrophages in mycoplasmal killing during early lung infection (Hickman Davis et al ., 1997) Alveolar macrophage s are often unable to engulf and kill mycoplasmas witho ut opsonization (Howard and Taylor, 1983; Hickman Davis, 2002) Various opsonins have been identified as important in this role, including specific antibodies, complement and surfactant proteins (Bredt et al ., 1977; Howard and Taylor, 1979; Howard and Tayl or, 1983; Hickman Davis, 2002) Opsonization with specific antibody was required in vitro for killing of M. bovis by

PAGE 90

90 macrophage s (Howard et al ., 1976) IgG 2 was a superior opsonin to IgG 1 but both isotypes could mediate these interactions (Howard, 1984) Whether other opsonins, such as surfactant proteins, are important in defense against M. bovis has not been determined. In addition to opsonization, alveolar macrophages also require activation for efficient phagocytosis and killing of some mycoplasmas (Hi ckman Davis, 2002) As well as displaying enhanced killing abilities, a ctivated macrophages secrete large amounts of pro inflammatory cytokines and recruit neutrophils and other immune cells to the site of infection (Razin et al ., 1998) Many mycoplasmal p athogens, including M. bovis are potent activators of alveolar macrophages (Jungi et al ., 1996; Rottem and Naot, 1998) Detrimental host inflammatory responses have been attributed to excessive TNF production by alveolar macrophages in mycoplasmal infec tions (Faulkner et al ., 1995) including M. bovis (Rosenbusch, 2001) What benefit stimulation of an exuberant inflammatory response has to the survival of mycoplasmal pathogens is unclear, but induction of TNF is not a feature of non pathogenic mycoplasm al species. The bovine mycoplasmal pathogens M. bovis, Mycoplasma dispar and M. mycoides subsp. mycoides bio type SC are all potent in vitro stimulators of TNF production by bovine alveolar macrophages but the non pathogenic species M. bovirhinis and Ac holeplasma laidlawii do not trigger this response (Jungi et al ., 1996) Following macrophage activation and expression of pro inflammatory cytokines and chemoattractants, neutrophils are recruited to sites of inflammation. In fact, neutrophils are often th e most abundant immune cell early in mycoplasma associated respiratory disease, and they may remain relatively abundant even in chronic disease. The extent of neutrophil recruitment is often directly correlat ed with the severity of disease N eutrophils are a prominent cell type in the lungs, middle ear, and joints of M. bovis infected calves (Adegboye et al ., 1995a; Rodriguez et

PAGE 91

91 al ., 1996; Clark, 2002; Shahriar et al ., 2002; Maeda et al ., 2003; Khodakaram Tafti and Lopez, 2004; Lamm et al ., 2004; Gagea et a l ., 2006) Even in calves without clinical lung disease, the presence of M. bovis is associated with increased numbers of neutrophils in BAL fluid (Allen et al ., 1992b) Widespread activation of macrophages by pathogenic mycoplasmas can result in excessive recruitment of neutrophils to sites of infection, with subsequent release of large amounts of inflammatory mediators that are associated with increased disease severity (Xu et al ., 2006b). In vitro studies showed that bovine neutrophils are able to kill o psonized M. bovis but this interaction requires the presence of IgG 2 ; IgG 1 was not an effective opsonin (Howard, 1984) Despite their ability to kill opsonized mycoplasmas in vitro the overall contribution of neutrophils to clearance of mycoplasmas in vi vo is unknown. Thomas et al ., (1991) showed that unopsonized M. bovis can adhere to the surface of neutrophils without being ingested, and that adherent viable or non viable M. bovis cells inhibit respiratory burst activity. Th is ability to suppress neutro phil function, coupled with the fact that young calves produce very little IgG 2 which is required, at least in vitro for neutrophil mediated killing of M. bovis may mean that neutrophils are not particularly effective in the clearance of M. bovis in you ng calves. In addition to interactions with macrophages and neutrophils, m ycoplasmas can interact with other cell types such as epithelial cells (Seya et al ., 2002) In fact, interactions between mycoplasmas and other cells are probably critical in the in itiation of an inflammatory response. Mycoplasmas have been shown to stimulate both nasal epithelial cells (Kazachkov et al ., 2002) and type II epithelial cells in the lung (Kruger and Baier, 1997) to produce IL 8 and ot her neutrophil chemoattractants Myc oplasma bovis activates bovine lung microvascular endothelial cells to express cell surface molecules specific for mononuclear cell and neutrophil transmigration (Lu and Rosenbusch, 2004)

PAGE 92

92 Little is known about the role of NK cells in mycoplasmal respirat ory disease ; they are recruited to sites of inflammation in the initial stages of infection by chemoattrac tants released from macrophages Large amounts of IFN are secreted by NK cells, as well as by other cells such as T cells. IFN is thought to be important for the activation of macrophages during the initiation of the inflammatory response, and may have other protective or potentially pathologic roles in mycoplasmal disease (Lai et al ., 1990b; Woolard et al ., 2005) Like NK cells, little is known about the role of mast cells in mycoplasmal disease. Recent studies (Xu et al ., 2006a) using mast cell deficient mice indicate that mast cells may be important in innate immune containment and clearance of M. pulmonis infection in mice. Potential roles for mast cells in bovine mycoplasmal disease have not been reported. To summarize, innate immune responses are very important in the early clearance of mycoplasmas from the lung. In particular, alveolar macrophages are essential in the early response to infec tion. However, inappropriate activation of alveolar macrophages by mycoplasmas may promote an excessive inflammatory response. Little is known about the innate responses specific to M. bovis infections in the lungs of calves, or in other sites including th e middle ear, mammary gland and joints of affected cattle. Given the ability of M. bovis to modulate responses of macrophages and neutrophils in vitro together with the relative scarcity of effective opsonins and the functional immaturity of macrophages i n young calves, it is reasonable to conclude that impaired innate responses are likely to contribute to the increased susceptibility to M. bovis infections that is observed in this age group. Adaptive I mmune R esponses to M ycoplasmal I nfections Adaptive im mune responses to mycoplasmal infections play important roles in determining the progression of disease. Adaptive responses can clearly be beneficial in clearing

PAGE 93

93 or controlling mycoplasmal infections, but they also can be ineffective and can be major contr ibutors to the severity of disease (Rottem and Naot, 1998; Rosengarten et al ., 2000; Jones and Simecka, 2003) Despite a substantial body of work examining adaptive responses to mycoplasmal infections, the optimal immune responses for protection and the ty pes of responses contributing to disease remain poorly defined. The fact that adaptive immune responses can protect from disease is illustrated by examples of successful vaccination against some mycoplasmal infections (Taylor et al ., 1977; Cassell and Davi s, 1978; Howard et al ., 1987a; Thacker et al ., 2000; Kyriakis et al ., 2001) However, immunity after vaccination or infection is often short lived. For example, after inoculation of the mammary gland with M. bovis cows were resistant to subsequent re chal lenge after 2 months in both previously infected and non infected quarters; at 6 months, cows were generally resistant to infection only in the previously challenged quarter, and at one year all quarters were susceptible (Bennett and Jasper, 1978a) Prior infection with M. bovis seems to protect cows from developing the severe clinical mycoplasmal mastitis that is typically observed on primary infection; most re infections result in subclinical or very mild clinical disease (Bennett and Jasper, 1978b) Thus adaptive immune responses that are in place at the time of mycoplasmal exposure do appear to contribute to the control or prevention of new mycoplasmal infections. Adaptive immune responses are frequently ineffective at eliminating established mycoplasma l infection s and mycoplasmas are often able to persist in the face of an intense response (Fernald, 1982; Cartner et al ., 1998; Razin et al ., 1998; Rosengarten et al ., 2000) Ongoing, ineffective immune responses result in the chronic inflammation that is associated with many mycoplasmal diseases (Cartner et al ., 1998; Rosengarten et al ., 2000; Jones and Simecka,

PAGE 94

94 2003) Exactly how mycoplasmas manage to avoid clearance by the host is not well understood. However, mycoplasmas exhibit the ability to induce a broad range of immunomodulatory events (Baseman and Tully, 1997) that may induce ineffective responses. In addition, variation of surface antigens may help mycoplasmas to avoid clearance mediated by adaptive immune responses (Rosengarten et al ., 2000) Ad aptive responses also play an important role in immunopathologic disease. Cellular responses in mycoplasmal infections are characterized by large accumulations of lymphocytes (Simecka et al ., 1992) suggesting that lymphocyte activation and recruitment to sites of mycoplasmal infection are important in the development of pathology. Autoimmune reactions also contribute to some mycoplasmal respiratory diseases (Kitazawa et al ., 1998; Wilson et al ., 2007), but have not been identified in disease caused by M. b ovis Humoral I mmune R esponses to M. bovis in C attle Experimental infection of cattle with M. bovis usually elicits a strong humoral immune response. Specific serum immunoglobulin is detectable as early as 6 days (IgM) to 10 days (IgG) after experimental i noculation of M. bovis into the respiratory tract of calves (Brank et al ., 1999; Le Grand et al ., 2002) Humoral responses to M. bovis in calves are characterized by high levels of IgG 1 (Howard and Gourlay, 1983; Vanden Bush and Rosenbusch, 2003) Very lit tle IgG 2 is produced in calves infected at 12 weeks of age (Vanden Bush and Rosenbusch, 2003) suggesting that the response to M. bovis respiratory infection in calves has a Th2 bias. In addition, the younger the calf, the higher the ratio of IgG 1 to IgG 2 produced in response to M. bovis infection (Howard and Gourlay, 1983) consistent with the delay in IgG 2 production observed in very young animals (Adkins, 2000; Siegrist, 2000) In cattle infected with non mycoplasmal pathogens, both IgG and IgA are impo rtant in immune responses of the LRT, and IgA is important in the URT (Mosier, 1997; Potter et al .,

PAGE 95

95 1999; Ackermann and Brogden, 2000); both compartments contribute significantly to antibody responses. Although data are limited, these types of local respon se s seem to also occur in M. bovis infections of calves. In one study, IgG 1 producing plasma cells predominated in the lungs at 2 weeks after M. bovis inoculation, accompanied by smaller numbers of IgM, IgG 2 and IgA producing cells. By 4 weeks, a significa nt increase in the number of IgG 2 producing cells was observed (Howard et al ., 1987c) These studies used 4 to 6 week old calves, and the distribution of antibody producing cells in the respiratory tract of other age groups with M bovis infection has not been reported. In the URT, IgG 1 producing cells were observed in the submucosa of the trachea, and IgA producing cells were abundant in the trachea and nasal cavity of infected calves (Howard et al ., 1987c) These findings are consistent with the distribu tion of immunoglobulin isotypes found in nasal lavage and BAL fluids after M. bovis infection (Howard et al ., 1980) In calves with experimentally induced M. bovis arthritis, titers of IgG 1 IgG 2 and IgM are similar in both serum and joint fluid, consisten t with leakage of serum proteins into affected joints. However, IgA concentrations in joint fluid are greater than those in serum, indicating some local production of IgA during M. bovis arthritis (Chima et al ., 1981) Local humoral responses in calves wit h M. bovis associated otitis media have not been reported. In contrast with the humoral response observed after experimental M. bovis infection of calves, responses in naturally infected calves are more variable. Virtala et al ., (2000) reported that only 5 7% of 75 pneumonic dairy calves less than 3 months of age in which M. bovis was isolated from tracheal wash samples had a 4 fold or greater increase in M. bovis serum antibody titers by IHA. The authors concluded that a rise in titer on paired serum sample s was not a good predictor of M. bovis associated respiratory disease, possibly due to the presence of maternal antibody. Ma ternal antibody is associated with suppression of humoral responses to specific

PAGE 96

96 antigens, but vaccination of young calves with kille d M. bovis or respiratory challenge with live M. bovis in the face of maternal antibody usually elicits a detectable humoral response (Howard and Gourlay, 1983) It is reasonable to hypothesize that mild or superficial infections of the respiratory tract f ail to elicit a systemic antibody response in colostrum fed calves, whereas more significant challenges or systemic presentation of antigen usually do elicit such a response. Other investigators have also failed to find a correlation between serum antibody titers and the presence M. bovis in the LRT of naturally infected individual animals (Rosendal and Martin, 1986; Martin et al ., 1989) However, on a group level, seroconversion has been predictive of M. bovis associated respiratory disease (Martin et al ., 1990; Tschopp et al ., 2001) Specific serum immunoglobulin concentrations remain elevated for months to years after an immune response to clinical M. bovis associated disease (Le Grand et al ., 2001; Nicholas and Ayling, 2003) In adult cows, inoculation o f the mammary gland with M. bovis results in a classical early serum IgM response followed by IgG as the response matures. Peak serum titers occur 6 to 8 weeks after experimental infection (Bennett and Jasper, 1980) Both IgG 1 and IgG 2 are produced by infe cted cows (Boothby et al ., 1987) suggesting that the immune response to intramammary infection in mature animals is less Th2 biased than that of young animals with respiratory tract infections. In the mammary gland, local IgG 1 IgG 2 and IgA responses to M bovis mastitis are observed (Bennett and Jasper, 1980; Bennett and Jasper, 1978b; Boothby et al ., 1987) In summary, it appears that specific antibody to M. bovis is generally present in respiratory secretions of M. bovis infected calves. Systemic humor al responses are also often present, but subclinical infections of the respiratory tract may not generate a detectable ser um antibody response

PAGE 97

97 Function of H umoral R esponse s to M ycoplasmal I nfections Together with innate immune responses, humoral response s are probably the most important in protection from mycoplasmal infections. Systemic humoral responses are particularly important in preventing disseminated mycoplasmal infections such as arthritis (Cartner et al ., 1998) and local humoral responses provi de important opsonins to the cells of the innate immune system to aid in clearance of mycoplasmas (Howard and Taylor, 1983) Animals and humans with humoral deficiencies initially develop mycoplasma induced lung disease that is of similar severity to that of immunocompetent hosts. However, immunodeficient hosts typically go on to develop chronic pneumonia and disseminated disease such as arthritis or meningitis, while these events occur less frequently in immunocompetent hosts (Taylor Robinson et al ., 1980; Berglof et al ., 1997) Consistent with these observations, pre existing serum IgG titers to M. bovis are correlated with protection from arthritis by intravenous or aerosol challenge (Chima et al ., 1981; Nicholas et al ., 2002) The role of humoral respon ses in protection from mycoplasmal infections is also illustrated by the fact that passive transfer of antibody can prevent disseminated mycoplasmal infections. P assive transfer of antibody in immunodeficient mice prevents the development of mycoplasmal ar thritis (Cartner et al ., 1998), and has also been associated with protection from some mycoplasmal respiratory pathogens (Taylor and Taylor Robinson, 1977; Barile et al ., 1988; Rautiainen and Wallgren, 2001) The role of passively transferred antibody in p rotection from M. bovis associated disease has not been evaluated in controlled challenge studies. Limited data from field studies do not support a protective role for maternal antibody against M. bovis infections. In one study of 325 colostrum fed dairy c alves, there was no significant association between M. bovis specific serum antibody titers in the first 2 weeks of life and occurrence of pneumonia (Van Donkersgoed et al ., 1993) Likewise, Brown et al ., (1998a) did not find an

PAGE 98

98 association between M. bovi s specific serum antibody concentrations at 7 days of age and occurrence of M. bovis associated disease in 50 Holstein calves. Administration of large volumes of hyperimmune serum against M. bovis to calves at the same time as or following intranasal inocu lation of M. bovis had no effect on the severity of respiratory disease (Brys and Pfutzner, 1989) Antibody present at the site of infection may be more important for protection from M. bovis infections than is systemic antibody. Concentrations of antibodi es in serum after experimental induction of M. bovis mastitis did not differentiate between cows susceptible or resistant to reinfection of the mammary gland but concentrations of IgA and IgG in milk from glands resistant to reinfection were higher than t hose in susceptible glands (Bennett and Jasper, 1978a; Bennett and Jasper, 1978b) In addition, the daily production of total IgG and IgA during peak infection was greater in mammary glands that were able to resolve the infection than in glands that remain ed chronically infected (Bennett and Jasper, 1980) In studies where vaccination resulted in some protection from M. bovis associated respiratory disease, both serum antibody titers (Nicholas et al ., 2002) and IgG concentrations in BAL fluids (Howard et a l ., 1980) have been correlated with disease protection. The Vsps are the preferred targets of the humoral immune response in M. bovis infections (Brank et al ., 1999; Rosengarten et al ., 2000) although other M. bovis surface lipoproteins also elicit antib ody responses (Behrens et al ., 1996; Robino et al ., 2005) However, the specific surface molecules of M. bovis involved in eliciting protective humoral responses have not been defined. In summary, humoral immune responses, especially local antibody respons es at the site of infection appear to be important in protection from M. bovis infections. Conversely, strong

PAGE 99

99 humoral responses often develop during M. bovis associated clinical disease but fail to clear M. bovis from the host. The tendency towards a n IgG 1 dominated humoral response in calves may not be optimal for clearance of M. bovis given that IgG 2 is a superior opsonin for macrophage and neutrophil mediated killing of M. bovis (Howard, 1984) More work is needed in calves to better define the humora l responses that are most efficient at M. bovis clearance as well as responses that protect from new infections. The R ole of T C ell R esponses to M ycoplasmal I nfections Over 30 years ago, histopathological similarities between perivascular cellular infiltr ates observed in M. pneumoniae infections and the lesions of cutaneous delayed hypersensitivity reactions led to the suggestion that cell mediated mechanisms might be contributing to mycoplasmal disease (Fernald et al ., 1972) It is now widely accepted tha t mycoplasmal respiratory infections have substantial immunopathological components, characterized in part by large accumulations of lymphocytes in affected areas of the respiratory tract (Simecka et al ., 1992) Lymphocyte aggregation is not as marked in M bovis infections (Rosenbusch, 2001) as with some mycoplasmal infections in other hosts, but lymphocytes are still a substantial contributor to lesions in M. bovis associated disease. Both B and T cells accumulate in the lungs of affected calves (Howard e t al ., 1987c), in the joints of calves with mycoplasmal arthritis (Gourlay et al ., 1976; Adegboye et al ., 1996; Gagea et al ., 2006) and in the mammary glands of cows with M. bovis mastitis (Bennett and Jasper, 1977a; Seffner and Pfutzner, 1980) These find ings suggest that lymphocyte activation and recruitment to sites of M. bovis infection are important in the development of pathology. However, there are only limited data describing the lymphocyte populations that contribute to these responses in cattle, a nd virtually no data specifically from neonatal calves.

PAGE 100

100 Because of their essential role as regulators of the immune system, T cells play a pivotal role in the development of protective responses as well as in host mediated immunopathogenesis. T cells are a major component of the mononuclear infiltrates observed in the lungs and draining lymph nodes of mycoplasma infected hosts (Davis et al ., 1982; Rodriguez et al ., 1996; Rodriguez et al ., 2001; Jones and Simecka, 2003) Studies of M. pulmonis disease in mi ce suggest that T cells are of limited importance in initial responses to mycoplasmal infections. Both T cell deficient mice and severe combined immunodeficiency mice develop less severe lung disease than their immunocompetent counterparts (Keystone et al 1980; Cartner et al ., 1998) These effects are independent of mycoplasmal numbers in the lungs. Reconstitution of immunodeficient mice with naive T cells restores the severity of respiratory disease to the level observed in immunocompetent mice (Cartner et al ., 1998) These studies indicate that T cells are unlikely to play a major role in early control of mycoplasmal infections but instead are associated with regulating detrimental host inflammatory responses. However, T cells do contribute to the establ ishment of humoral responses that, as discussed earlier, are beneficial in control of mycoplasmal infections. Much of the current understanding of T cell responses in mycoplasmal infections is based on studies of M. pulmonis infections in resistant and su sceptible strains of mice. In susceptible strains of mice, increases in both CD4 + and, to a lesser extent, CD8 + T cells occur in the lungs and draining lymph nodes during infection with M. pulmonis. These major T cell subsets have opposing regulatory roles in the progression of mycoplasmal lung disease. In vivo depletion of CD4 + cells results in reduced lung lesions in infected mice, but depletion of CD8 + cells results in dramatically more severe lung lesions; these changes are not associated with changes i n mycoplasma numbers in the lungs. Therefore, CD8 + T cells are involved in dampening of the

PAGE 101

101 inflammatory reaction in mycoplasmal lung disease, whereas CD4 + T cells contribute to disease pathology (Jones et al ., 2002) The interaction between these cell typ es has a major impact on the outcome of mycoplasmal respiratory disease. he role of T cells in mycoplasmal respiratory disease has not been clearly defined, but they appear to be important in the pathogenesis of murine mycoplasma infection In mice, T cell numbers in the lungs increase early in infection and re turn to basal levels by day 14 (J. W. Simecka, personal communication) Knockout mice unable to produce T cells develop significantly less severe M. pulmonis associated disease than immunoco mpetent mice, despite similar numbers of mycoplasmas in the lungs of both groups, suggesting that T cells play a role in the development of inflammatory lesions (J. W. Simecka, personal communication) T cells are thought to contribute to IFN secre tion early in the infection process, and therefore play a role in macrophage activation and initiation of the host response, but ot her roles of T cells in mycoplasmal infections are poorly defined. In calves, T cells are a major lymphocyte population and have been shown to play a role in other infectious diseases. Thus, there is a clear need to determine whether T cells respond to M. bovis infection in cattle and if they contribute to the regulatory network involved in the generation of immunity an d pathologic responses against the mycoplasma. T cell subsets in the lungs of calves with M. bovis infection have not been defined. In a study of M. bovis infection in 3 month old goat kids, intratracheal inoculation resulted in clinical respiratory disea se and pathology similar to that reported for calves (Rodriguez et al ., 2000). T cells predominated in lymphoid accumulations in the lungs at 14 and 21 days post infection, and CD4 + T cells were a greater contributor to these lesions than were CD8 + T cells Although

PAGE 102

102 this study was conducted in a different host species, it suggests that activation of CD4 + T cells plays a prominent role in M. bovis infections. Cytokine and T Helper S ubset R esponses to M ycoplasmal I nfections Respiratory mycoplasmal infections are characterized by production of pro inflammatory cytokines and associated lung inflammation (Faulkner et al ., 1995; Narita et al ., 2000; Sun et al ., 2006) Mycoplasmas also induce cytokines that can down regulate inflammatory responses in vitro and in a nimal models (Sun et al ., 2006) The intensity of the inflammatory response following mycoplasma infection is driven by the balance of cytokines produced (Chambaud et al ., 1999) IFN is produced early in infection by a variety of cells, including NK cell s, T cells and others, resulting in macrophage activation and in the promotion of Th1 responses. In contrast, IL 4 promotes Th2 cell maturation, IgE responses, and is important in maintenance of humoral mucosal responses, which are an important contributor to protection from mycoplasmal disease. The immune response in the lungs of mice infected with M. pulmonis is characterized by both IL 4 and IFN responses, with IFN predominating at 14 days post infection (Jones et al ., 2002). These findings are consi stent with a mixed Th1 Th2 response in mice with mycoplasmal lung disease. Experiments using IFN knockout mice found that the presence of IFN early in infection is important for innate clearance of mycoplasmas. Infected knockout mice had higher mycopla smal numbers in the lungs and increased severity of lung lesions compared with immunocompetent mice (Woolard et al ., 2004) Similarly, T bet deficient mice, which are unable to produce IFN as well as producing very strong Th2 cytokine responses, develop much more severe mycoplasmal lung disease than do immunocompetent mice (Bakshi et al ., 2006) Little is known about the cytokine environment or the Th subsets present in the lungs of calves with mycoplasmal disease. However, PBMC responses, serum cytokine and serum

PAGE 103

103 antibody responses were characterized in 12 week old calves infected by combined intratracheal and intranasal inoculation with M. bovis (Vanden Bush and Rosenbusch, 2003) At 21 days after inoculation, PBMCs from M. bovis infected calves exhibite d antigen specific proliferative responses in vitro In addition, CD4 + CD8 + and T cells all exhibited higher in vitro activation (CD25 expression) in response to M. bovis antigens than did cells from uninfected control calves. The PBMCs from infected a nimals secreted IFN and IL4 in response to in vitro stimulation with M. bovis antigen. Intracellular staining of stimulated cells revealed approximately equal numbers of IFN and IL 4 secreting cells. There was a strong IgG 1 humoral response, and little IgG 2 was present in the serum of infected calves. These findings indicate that calves infected with M. bovis produce a mixed Th1 Th2 systemic cytokine response, although the lack of IgG 2 production is consistent with a Th2 bias ed response. Studies in M. p ulmonis infected mice have demonstrated that the Th profile can differ between compartments of the immune system (Jones et al ., 2001; Jones et al ., 2002) and so whether the above findings using PBMCs of M. bovis infected calves are representative of the i mmune environment at the site of infection is unknown. Recruitment of T C ells in M ycoplasmal I nfections Lymphocytes are recruited to sites of mycoplasmal infection by chemokines released from cells of the innate immune system. In a recent study, microarray analysis of cytokine and chemokine expression in the lungs of genetically resistant and susceptible strains of mice during M. pulmonis infection was examined (Sun et al ., 2006) Pro inflammatory cytokines and a number of chemokines were produced in suscep tible, but not resistant, mice and the degree of cytokine expression was correlated with the severity of disease. The expression of two potent chemokines for monocytes and lymphocytes, macrophage inflammatory protein 1 and monocyte chemoattractant protei n 2, was markedly up regulated during mycoplasmal disease.

PAGE 104

104 These chemokines were preferentially associated with lesions within the lungs of infected mice, and cells producing these chemokines were physically associated with clusters of CD4 + T cells that ex pressed receptors for these proteins. Thus, it may be that chemotactic factors released at sites of mycoplasmal infection in the lung are largely responsible for recruitment of lymphocytes, and thereby determine the severity and type of inflammatory respon se This is in contrast to previous hypotheses that local non specific proliferation of lymphocytes by M. pulmonis mitogens is responsible for the observed lymphocyte accumulation (Naot et al ., 1984; Davis et al ., 1985) M. bovis has not displayed lymphocy tes mitogenic potential in vitro so it may be that a similar mechanism of lymphocyte recruitment occurs in infected calves. Immunomodulatory E ffects of M. bovis on B ovine L ymphocytes Several studies have demonstrated immunomodulatory effects of M. bovis on cell mediated immune responses Thomas et al ., (1990), reported that M. bovis suppresses bovine PBMC responses to the mitogen phytohemagglutinin in vitro. Earlier studies had found that lymphocytes from calves immunized with killed M. bovis antigens (an d no adjuvant) have reduced proliferative responses in M. bovis specific and mitogen induced in vitro assays (Bennett and Jasper, 1977b) Similar findings were reported for lymphocytes from cows that had recovered from M. bovis mastitis, although uninfecte d controls were not included for comparison (Bennett and Jasper, 1978b) Supernatant from M. bovis cultures has also been reported to suppress in vitro lymphocyte proliferation (Bennett and Jasper, 1977b) Consistent with this observation, a 26 kD peptide homologous to the C terminal region of the M. bovis surface lipoprotein Vsp L and present in culture supernatant inhibited mitogen induced in vitro proliferation of bovine lymphocytes (Vanden Bush and Rosenbusch, 2003) The recombinant peptide was recogniz ed by sera from calves with naturally occurring M. bovis infections,

PAGE 105

105 suggesting that the protein is expressed in vivo Whether it is shed in vivo or is surface bound is unknown. M. bovis has been reported to induce apoptosis of bovine lymphocytes in vitro (Vanden Bush and Rosenbusch, 2002) ; this action was inhibited by treatment with chloramphenicol, indicating that M. bovis protein production is necessary for the induction of programmed lymphocyte death. The in vivo significance, the extent to which induc tion of apoptosis occurs, and the cell type(s) targeted are unknown, but induction of apoptosis in a particular lymphocyte subset could be another mechanism by which M. bovis modulates the host immune response. Hypersensitivity R esponses to M. bovis I nfec tions An interesting finding from early experimental infection studies of calves with mycoplasmal respiratory disease and cows with M. bovis mastitis was the presence of acute and, in some cases, delayed type hypersensitivity reactions to intradermal injec tion of M. bovis antigen (Bennett et al ., 1977; Bennett and Jasper, 1978b; Boothby et al ., 1988) Maximal inflammatory responses at skin test sites were reported to occur within th e first 4 hours after injection and skin reactions resolve d rapidly (Bennet t and Jasper, 1978b) or persist ed at close to maximal levels for more than 72 hours (Boothby et al ., 1988) Animal to animal variation was been reported; pronounced skin sensitivity test responses to M. bovis antigens were present in some cows that had rec overed from M. bovis mastitis, but not in others. Further, skin test results did not differentiate between cows susceptible or resistant to re infection of the mammary gland (Bennett and Jasper, 1978a) These observations could indicate that hypersensitivi ty responses contribute to development of pathology in some animals during M. bovis infections. However, the antigens involved in these dermal responses need to be better defined. Serum IgE levels in M. bovis infected animals have not been reported. IgE me diated responses have been implicated as important in the pathogenesis of M. pneumoniae infections in atopic humans (Yano et al .,

PAGE 106

106 1994; Seggev et al ., 1996; Stelmach et al ., 2005) Acute and delayed type hypersensitivity responses to intradermal administra tion of mycoplasmal antigens have also been reported with M. mycoides subsp. mycoides biotype SC and M. pneumoniae in fections (Windsor et al ., 1974; Yano et al ., 1994) Protective Immunity to M. bovis Relevant E xperiences with M ycoplasmal V accines for D is eases O ther T han M. bovis Vaccination that results in reduced severity of disease is possible for a number of mycoplasmal pathogens (Taylor et al ., 1977; Cassell and Davis, 1978; Whithear, 1996; Maes et al ., 1998; Thacker et al ., 2000; Dawson et al ., 2002; Dedieu et al ., 2005) including M. bovis (Howard et al ., 1987a; Stott et al ., 1987; Nicholas et al ., 2002) However, vaccination rarely prevents establishment of infection or shedding of mycoplasmas (Cassell and Davis, 1978; Howard et al ., 1980; Thacker e t al ., 2000; Nicholas et al ., 2002) Furthermore, vaccination can result in harmful exacerbation of immune responses (Boothby et al ., 1986b; Thiaucourt et al ., 2003) Positive or negative host responses to mycoplasmal vaccination seem difficult to predict; vaccines will appear efficacious in some studies and some individuals, but not others. These findings are not surprising given the complex nature of host mycoplasmal relationships, and are likely to be at least partly attributable to the fact that immune responses to mycoplasmas are strongly influenced by genetic s and other host related factors (Simecka et al ., 1987; Parker et al ., 1989; Shahriar et al ., 2002) The frequent switching of dominant surface antigen expression in many mycoplasmas is another fac tor that may influence vaccine efficacy. Most mycoplasmal vaccines in use today are administered systemically. However, studies of M. pulmonis infection in mice have shown that the nasal route of immunization can protect from mycoplasmal disease (Lai et a l ., 1990a), and is superior to systemic immunization in generating mucosal IgA responses in both the URT and LRT (Taylor and Howard 1980; Hodge

PAGE 107

107 and Simecka 2002) As well as protecting from clinical disease, nasal immunization can reduce mycoplasmal coloni zation of the URT (Taylor and Howard 1980; Hodge and Simecka 2002) However, mucosal adjuvants may be required to achieve these effects (Hodge and Simecka 2002) and some of these adjutants have been associated with development of adverse inflammatory resp onses to mycoplasmal antigens (Simecka et al ., 2000) Together, these data suggest that mucosal targeting of vaccines against mycoplasmal respiratory pathogens may be more effective than current systemic approaches, but further work is needed to identify a ppropriate mucosal adjuvants for mycoplasmal vaccines. Despite the limitations of current vaccines, a number of commercially successful vaccines for mycoplasmal diseases of livestock are in use throughout the world. Most current mycoplasmal vaccines are ei ther live attenuated or inactivated preparations of whole cells. Subunit or recombinant protein vaccines have been largely unsuccessful to date, although newer technologies are resulting in experimental vaccines and delivery systems that may prove to be ef ficacious against some mycoplasmal diseases (Barry et al ., 1995; Abusugra and Morein, 1999; March et al ., 2006) Perhaps the most widely used mycoplasmal vaccines are M ycoplasma hyopneumoniae bacterins in pigs. Mycoplasma hyopneumonia e is a pathogen contr ibuting to the porcine respiratory disease complex, a world wide disease that causes substantial economic losses in the grower finisher phase of pig production (Pfutzner and Blaha, 1995) A number of field efficacy trials, as well as experimental infection studies, have found that vaccination against M. hyopneumoniae is associated with reduced rates of clinical disease, reduced treatment costs, improved feed efficiency and improved weight gain (Le Grand and Kobisch, 1996; Maes et al ., 1998; Maes et al ., 199 9; Okada et al ., 1999; Bouwkamp et al ., 2000; Thacker et al ., 2000;

PAGE 108

108 Kyriakis et al ., 2001; Dawson et al ., 2002) although it must be pointed out that several of these trials were industry sponsored. Vaccine induced immunity in pigs is associated with incre ased levels of M. hyopneumoniae specific IgG and IgA in BAL fluid (Boettcher et al ., 2002) and increased IFN production and reduced TNF production in lungs (Thacker et al ., 2000) Pigs are first vaccinated as early as 7 days of age, indicating that in some hosts, neonates can be successfully immunized against mycoplasmas. Passive transfer of specific antibodies in the colostrum of vaccinated sows occurs, and has been associated with reduced prevalence of M. hyopneumoniae in piglets (Ruiz et al ., 2003; Kristensen et al ., 2004) Although these vaccines are associated with reductions in clinical disease, they do not prevent colonization of the URT or shedding of M. hyopneumoniae (Meyns et al ., 2006) To address these issues, several experimental M. hyopneu moniae vaccines targeted to the mucosal immune system have been reported (Fagan et al ., 2001; Shimoji et al ., 2002; Lin et al ., 2003) but further work is required to determine their field efficacy and potential benefits over the current vaccines. Inactiva ted mycoplasmal vaccines are also used in other livestock species, including vaccines against M. agalactiae in sheep, a pathogen that is closely related to M. bovis However, little data are available on the efficacy of these vaccines. Vaccines against the important avian respiratory pathogens Mycoplasma gallisepticum and Mycoplasma synoviae are widely used in commercial poultry production. In contrast to the killed bacterins used for M. hyopneumoniae in pigs, attenuated live strains of M. gallisepticum and M. synoviae are used to vaccinate poultry (Whithear, 1996; Papazisi et al ., 2002) They are administered by mucosal routes, including in drinking water, by aerosol or by eye drop. These strains colonize the URT, displacing endemic strains in infected floc ks and stimulating mucosal cellular and humoral immune responses against future virulent challenges (Whithear, 1996) A

PAGE 109

109 number of studies have demonstrated these vaccines to be efficacious in reducing losses due to clinical and subclinical mycoplasmal dise ase (Markham et al ., 1998a; Markham et al ., 1998b; Barbour et al ., 2000; Biro et al ., 2005; Feberwee et al ., 2006; Jones et al ., 2006) However, problems do occur with these vaccines, including inherent virulence of some vaccine strains and failure to esta blish infection in the URT or to stimulate long term immunity in other strains (Whithear, 1996) Live attenuated mycoplasmal vaccines are also used for the control of contagious bovine pleuropneumonia (CBPP) caused by M. mycoides subsp. mycoides biotype S C in endemically infected sub Saharan Africa (Thiaucourt et al ., 1998) Vacci nes are injected subcutaneously and stimulate short lived serum antibody responses ; protection is associated with induction of a mucosal Th1 biased response (Dedieu et al ., 2005) Th e vaccines do not prevent colonization of vaccinated animals (Thiaucourt et al ., 1998) CBPP vaccines are typically administered to susceptible cattle in regions surrounding an outbreak, but have only limited efficacy in containing these outbreaks (Thia ucourt et al ., 2004) Several strains of varying degrees of attenuation have been used (Dyson and Smith, 1975) Unfortunately, the more virulent vaccine strain that provides better protection against CBPP has a high rate of serious, and sometimes fatal, si de effects including severe hypersensitivity reactions and reversion to virulence (Mbulu et al ., 2004; Thiaucourt et al ., 2004) Other experimental vaccines for CBPP have not been successful ; inactivated vaccines have often resulted in exacerbation of clin ical disease in challenge studies (Gourlay, 1975) A recent study described a bacteriophage DNA vaccine for M. mycoides subsp. mycoides biotype SC that was effective in a mouse challenge model, but this approach has not yet been applied in the natural host (March et al ., 2006)

PAGE 110

110 From these studies of mycoplasmal vaccines in use today, it can be concluded that some vaccines provide disease protection, but that virtually none are able to prevent chronic infection of the host and shedding of mycoplasmas. In add ition, deleterious effects of vaccination are often reported. More sophisticated approaches to vaccine development and delivery, as well as a better understanding of the host immune response in mycoplasmal diseases are clearly required. Vaccination A gainst M. bovis A number of attempts to vaccinate cattle against M. bovis mastitis have been reported, but have been largely unsuccessful. In one series of studies evaluating the effect of vaccination on susceptibility to M. bovis mastitis, cows were vaccinated five times at 2 week intervals during the dry period with killed M. bovis ; the first three doses were administered subcutaneously in infusion (Boothby et al ., 1986a; Boothby et al ., 1986b; Boothby et al ., 1987) One week after calving, vaccinated and control cows were experimentally challenged in two of four quarters with live M. bovis All challenged quarters became infected, developed clinical mastitis, and had a dr astic (greater than 85%) loss of milk production. Inflammatory responses occurred earlier and were more severe in vaccinated cows. Vaccinated cows cleared M. bovis from the milk earlier than unvaccinated cows, but inflammation persisted. In addition, vacci nation did not protect from quarter to quarter spread of M. bovis Serum antibody titers to IgM, IgG 1 and IgG 2 and milk whey titers for IgG 1 were higher prior to challenge in vaccinated compared to control cows. After challenge, M. bovis specific IgA, IgG 1 and IgG 2 were elevated in milk whey of both vaccinated and control cows, suggesting that intramammary exposure to live organisms was necessary to elicit a local, specific IgA response. A number of vaccines for prevention of M. bovis associated disease in calves have been evaluated in experimental challenge studies and field trials. Many of these have demonstrated

PAGE 111

111 that vaccination can offer some protection from clinical mycoplasmal disease in calves. For example, in an experimental study, (Chima et al ., 19 80) 1 to 5 month old beef calves were vaccinated subcutaneously with live M. bovis intraperitoneal l y with live M. bovis or subcutaneously with a formalin inactivated bacterin Two boosters were given at 10 day intervals and animals were challenged by i ntravenous inoculation of M. bovis Clinical arthritis was seen in 100% of non vaccinated as compared with 13% of vaccinated calves and lesion severity was decreased in those vaccinated calves that did get arthritis. In a study of an apparently efficacio us vaccine in young calves, Nicholas et al ., (2002) vaccinated 3 week old dairy calves with a single dose of saponin inactivated bacterin. Calves received an aerosol challenge with live M. bovis 3 weeks after vaccination. Vaccinated calves had fewer number s of M. bovis at colonized sites fewer numbers of body sites colonized by M. bovis, and reduced severity and incidence of clinical disease and lesions compared with control calves. There was also a significant decrease in body weight gain in control calve s compared with vaccinates. Additionally, no vaccinated calves and two of seven control calves developed arthritis. Vaccinated calves produced a strong IgG response prior to challenge, but IgG subtypes were not reported. No adverse events associated with v accination were reported. A killed vaccine against four bovine respiratory pathogens (BRSV, PI 3 M. bovis, and M dispar ) was evaluated for protection against naturally occurring respiratory disease in beef calves (Howard et al ., 1987a; Stott et al ., 1987) Calves were vaccinated subcutaneously and received two boosters at 3 week intervals. In one study (Stott et al ., 1987) three batches of beef calves aged 12, 7 and 3 weeks at the time of first vaccination were used, and calves were followed for 6 months. Respiratory disease occurred in a significantly higher ( P < 0.05) proportion of the control calves (27%) compared with the vaccinates (16.3%). In a second study

PAGE 112

112 (Howard et al ., 1987a) using the same vaccination protocol, M. bovis and BRSV were implicated in outbreaks of respiratory disease during the trial period. Morbidity due to respiratory disease was significantly reduced in vaccinated calves (25%) compared with controls (32%), and mortality in the vaccinated group was similarly reduced (2% and 9% for vaccinates and controls, respectively). No adverse effects of vaccination were noted. In a report of M. bovis vaccination of feedlot cattle (Urbaneck et al ., 2000) a bacterin consisting of autogenous formalin inactivated strains of M. bovis and M. haemoly tica was used in 3,000 cattle at arrival. The feedlot had a history of M. bovis associated clinical disease. The vaccine was reported to be efficacious for the prevention of respiratory disease in newly introduced cattle, but, unfortunately, comparisons we re made to an historical control group. No adverse effects of vaccination were noted. Despite the promise shown in some of the studies discussed above, other vaccine trials have been less successful. Rosenbusch (1998) vaccinated 2 month old dairy calves wi th a formalin inactivated bacterin prepared from two strains of M. bovis ; calves received a single booster at 3 weeks post vaccination. Calves were challenged by transthoracic inoculation of M. bovis Vaccination exacerbated disease, with four of five vacc inated calves and one of five control calves developing severe respiratory disease A similar exacerbation of disease was seen in calves vaccinated with partially purified membrane proteins from M. bovis ; i ncreased clinical disease and pathology following aerosol challenge was greater in vaccinated calves than in controls (Bryson et al ., 1999). Mycoplasma bovis vaccine antigens have been s hown to exert some of the immuno modulatory effects that are observed with live M. bovis and these effects can be alter ed by the presence of specific adjuvants. For example, lymphocytes from calves inoculated subcutaneously

PAGE 113

113 with killed M. bovis had reduced mitogen induced and antigen specific lymphoproliferative responses in vitro while those inoculated with killed M. bov is in FCA exhibited increased responses (Bennett and Jasper, 1977b) Calves given the vaccine in FCA also developed higher serum antibody titers against M. bovis and much greater immediate and delayed cutaneous hypersensitivity responses to M bovis antige ns than did calves given the unadjuvanated vaccine. Even where M. bovis vaccines have been associated with clinical benefits, they often fail to induce an immune response that clears infection (Chima et al ., 1980; Nicholas et al ., 2002) For example, intra muscular injection with formalin killed M. bovis with adjuvant followed after 14 days by intratracheal inoculation with killed organisms without adjuvant resulted in reduced M. bovis in the lungs compared to control calves after intratracheal challenge bu t significant numbers of mycoplasmas were still present in vaccinated calves (Howard et al ., 1980) Induction of protective immune responses against M. bovis by vaccination is also complex. For example, in the aforementioned study (Howard et al ., 1980) a vaccination protocol of three subcutaneous injections also induced protective responses, but two intramuscular or two int ratracheal inoculations did not In these studies, the number of M. bovis isolated from the lungs of calves was negatively correlated w ith IgG concentrations in BAL fluid, and different vaccination regimens were more or less effective at inducing an IgG response in the respiratory tract. Despite very limited data on the field efficacy of M. bovis vaccines, several bacterin based vaccines for M. bovis are license d for marketing in the U.S. Currently, one vaccine is licensed for reducing the duration and severity of mycoplasmal mastitis in adult dairy cattle (Mycomune; Biomune, Lenexa, KS). At least two vaccines are licensed for prevention of M. bovis associated respiratory disease in cattle. One product (Myco B Bac ; Texas Vet. Labs, Inc ., San Angelo, TX), is aimed at stocker and feeder cattle. Another product (Pulmo Guard

PAGE 114

114 MbP; Boehringer Ingelh e im Vetmedica, Inc ., St. Joseph, MO) is licen sed for vaccination of cattle older than 45 days of age and is primarily marketed to the beef industry. The technical bulletin for Pulmo Guard (Boehringer Ingelheim, 2003) describes two experimental challenge trials using 4 to 6 week old Holstein calves, each trial using 10 vaccinated and five control animals. Calves were vaccinated twice, 2 weeks apart by subcutaneous injection. The company reports that vaccinated calves had reduced gross lung lesion scores, higher M. bovis specific serum IgG 1 and IgG 2 t iters, and higher levels of M. bovis specific IgA in BAL fluid compared with controls. In addition to these vaccines, a number of U.S. companies are licensed to produce custom autogenous bacterins using strains of M. bovis isolated from the target herds. T o the best of the author's knowledge, no controlled, peer evaluated efficacy studies of any of the above commercial or autogenous bacterins have been reported. To date, no commercial M. bovis vaccines are labeled for use in young dairy calves in North Amer ica. The lack of well designed, independent efficacy studies that include a valid control group, blinding of evaluators, adequate power, clinically relevant outcomes, and are conducted in an appropriate age group is a major gap in our understanding of the true potential value of currently available vaccines as a management strategy to control M. bovis infection. In conclusion, vaccination against M. bovis is possible, but vaccines reported to date do not prevent colonization of the URT with M. bovis V accin ation can also induce harmful effects. Probably the biggest challenge for the development of vaccines for use in dairy calves is the early age at which these calves often become infected. Achieving a protective immune response in young calves prior to chal lenge may be very difficult. New approaches, including investigation of passive transfer, the mucosal route of immunization and development of more sophisticated vaccines and delivery systems are needed. Also, appropriate field efficacy studies

PAGE 115

115 of the avai lable commercial and autogenous vaccines in North American dairy calf production systems are urgently needed. Experimental Infection with M. bovis in Calves A number of experimental models have been used to study M. bovis infection in calves. Various route s of inoculation have been employed, including inhalation of aerosolized bacteria, intranasal, intra or transtracheal, endobronchial, transthoracic, intravenous, intraarticular or subcutaneous inoculation, as well as combinations of these routes (Chima et al ., 1980; Howard et al ., 1980; Pfutzner et al ., 1983a; Ryan et al ., 1983; Gourlay and Houghton, 1985; Lopez et al ., 1986; Brys et al ., 1989; Gourlay et al ., 1989b; Nicholas et al ., 2002; Vanden Bush and Rosenbusch, 2003) Although useful in the study of events associated with M. bovis infection at particular body sites, none of these models mimic the ingestion of M. bovis contaminated milk, a major route of infection in young calves (Bennett and Jasper, 1977c; Walz et al ., 1997; Brown et al ., 1998a; Butle r et al ., 2000) In addition, most experimental infection studies have been conducted in calves that are at least 2 weeks of age, whereas natural colonization with M. bovis o ften occurs in younger calves (Brown et al ., 1998a; Stipkovits et al ., 2000) Alth ough neonatal calves are immunocompetent, their immune system responds differently to many antigens than that of older calves (Barrington and Parish, 2001) so selection of an appropriate age group is likely to be important for a model to accurately mimic natural disease. Importantly, t he experimental models previously used to study M. bovis infection in calves did not induce clinical otitis media, which is a newly emerging disease in young calves. An experimental infection model to study the events that oc cur in the URT of young calves after exposure to M. bovis in milk, particularly those factors leading to the dissemination of infection and the development of otitis media and LRT disease, would be invaluable.

PAGE 116

116 Summary and Critical Gaps in Knowledge M ycopla sma bovis has emerged as an important pathogen of young dairy calves. A variety of clinical diseases are associated with M. bovis infections of calves, including respiratory disease, otitis media, arthritis and some other less common presentations. Clinica l disease associated with M. bovis is often chronic, debilitating and poorly responsive to antimicrobial therapy, and current management strategies often fail to control clinical mycoplasmal disease. Thus, there is a critical need to develop better prevent ive, control and treatment strategies for M. bovis associated disease in young calves. Improvements in these areas are hampered by a lack of understanding of the epidemiology of M. bovis infections in young calves and of the host pathogen interactions invo lved in the establishment of infection and development of clinical disease. A number of critical gaps in knowledge need to be addressed: Other than the feeding of M. bovis contaminated milk, few specific risk factors for M. bovis infections in young calves have been identified. In addition, risk factors associated with dissemination of M. bovis from the URT to the LRT and with clinical disease expression are poorly understood. Clearly, well designed epidemiological studies of M. bovis in infected calf reari ng facilities are required to establish risk factors and provide guidance for dairy producers to prevent and control disease. In addition, long term epidemiological studies would be helpful to determine the impact of M. bovis infection in young calves on t he risk of URT or mammary gland infection with M. bovis as adults. Prevalence estimates for M. bovis associated disease in U.S. dairy calves have not been published and would be useful in determining the true extent of this problem and in estimating associ ated losses. Because effective biosecurity is probably one of the best ways to prevent M. bovis infections, studies to define the optimal diagnostic tests for determining the M. bovis infection status of young calves need to be conducted. Current treatme nt measures need to be critically evaluated. Controlled clinical trials evaluating the efficacy of particular therapeutic and metaphylactic antibiotic regimens for clinical disease in U.S. dairy calves are needed. In addition, the safety and efficacy of my ringotomy and irrigation of the middle ear in calves with otitis media needs to be assessed. The role of passive transfer of maternal antibodies in M. bovis associated disease needs to be defined from both epidemiological and immunological perspectives.

PAGE 117

117 Re search into the microbial factors involved in the ability of M. bovis to colonize, persist, and cause disease in the host is ongoing, but many critical gaps in knowledge remain. This field will likely be greatly assisted by the M. bovis genome sequencing p rojects that are currently nearing completion. One factor in particular that needs to be addressed is to define whether specific surface antigens of M. bovis are involved in protective versus immunopathological responses. Current understanding of the patho genesis of otitis media in young calves is extremely limited. Although current data from field and pathology studies indicate that M. bovis does cause otitis media in calves, experimental infection studies are required to fulfill Koch's postulates and to b etter define the host pathogen interactions leading to this disease. In particular, the route of infection with otitis media needs to be defined. Whether other agents, such as viruses, increase the risk of mycoplasmal otitis media in calves also needs to b e determined. The immune response to M. bovis infections appears to be complex. A much better understanding of the immune responses of young calves to M. bovis is needed. In particular, responses that contribute to development of disease or production of an effective immune response need to be determined; this knowledge may lead to improved vaccines against M. bovis infections. Specifically, the local innate and adaptive immune responses to M. bovis that are important at sites of infection in the URT, LRT and middle ear of young calves need to be defined. The lymphocyte populations and cytokines involved in these responses at the sites of infection also need to be determined. The role, if any, of hypersensitivity responses and IgE in M. bovis associated dis ease needs to be investigated. Experimental models that mimic naturally occurring disease as closely as possible may improve our understanding of M. bovis infections in calves. Models that utilize the appropriate age group and a natural route of infection, so as to accurately represent events involved in establishment of URT infection, dissemination of M. bovis to other sites and development of clinical otitis media and LRT would be invaluable. In experimental challenge and field studies, efficacy of vaccin ation against M. bovis has been variable. Although some vaccines have reduced clinical disease, they do not prevent colonization and shedding; some have been associated with exacerbation of clinical disease. More sophisticated approaches to vaccine develop ment and delivery systems and a better understanding of host immune response in mycoplasmal diseases would likely lead to improved vaccine strategies. A better understanding of the immunology of the neonatal calf, especially with respect to ability to resp ond to different antigens, the types of responses that are produced, and modulation of these responses by mucosal and systemic adjuvants may improve our ability to produce efficacious vaccines, if, indeed, vaccination of the very young calf against M. bovi s is possible. The efficacy of the mucosal route for immunization of young calves against M. bovis needs to be evaluated in a relevant experimental infection model. In addition to research into new vaccination strategies, critical evaluation of currently m arketed M. bovis vaccines for use in young calves in well designed, independent efficacy studies that include a valid control group, blinding, adequate power, relevant clinical outcomes and that are conducted in an appropriate age

PAGE 118

118 group are clearly require d. The lack of such studies is a major gap in understanding the potential of currently available vaccines as a management strategy to control M. bovis infections in young calves. Overall Goals of Study The overall goal of these studies w as to address key deficiencies in the current knowledge of M. bovis associated disease in young calves. Ultimately, these studies may lead to the development of improved preventative or control strategies for M. bovis Because there is a lack of data on the efficacy of curr ently available M. bovis vaccines, especially in young calves, we conducted a field trial to determine the efficacy of a commercial vaccine for the prevention of M. bovis associated disease in this age group In addition to this field trial, the major focu s of the studies presented here was to improve our knowledge of the local immune response to M. bovis in the respiratory tract of young dairy calves. This second main objective involved development of a reproducible model of M. bovis infection of the URT t hat closely mimicked natural infection in young dairy calves This model was then used to define the lymphocyte responses generated along the respiratory tract during infection with M. bovis

PAGE 119

119 Figure 1 1. Clinical manifestations of Mycoplasma bovis associated respiratory disease. A) Calf with purulent nasal discharge as well as a right ear droop. B) Calf with purulent nasal discharge. B A

PAGE 120

120 Figure 1 2. Clinical manifestations and macroscopic lesions of Mycoplasma bovis associated otitis media. A) Calf with left ear droop and epiphora. B) Transverse section of skull at the level of the tympanic bullae. Bullae are impacted with caseous exudate, especially on the left side. B A

PAGE 121

121 Figure 1 3. Clinical manifestations and macroscopic lesions of Mycoplasma bovis associated arthritis and tenosynovitis. A) Swollen right carpal joint and p roximal forelimb due to M. bovis arthritis and tenosynovitis. B) Flexed carpal joint with an incision into the extensor tendons containing purulent exudate, as well as dermal necrosis over the carpal joint. C) Incision into the dorsal aspect of the carpal joint containing copious purulent exudate. A B C

PAGE 122

122 Figure 1 4. Substantial economic costs are incurred for treatment and management of calves with Mycoplasma bovis associated disease.

PAGE 123

123 Figure 1 5. Ingestion of milk contamina ted with Mycoplasma bovis is a primary route of transmission in pre weaned calves.

PAGE 124

124 CHAPTER 2 FIELD EVALUATION OF A Mycoplasma bovis BACTERIN IN YOUNG DA IRY CALVES Introduction Mycopla s ma bovis is distributed world wide and is a significant pathogen of adult dairy cows as well as intensively reared beef and dairy calves (Brown et al ., 199 8a; Stipkovits et al ., 2001; Thomas et al ., 2002a; Fox et al ., 2003; Gonzalez and Wilson, 2003; Nicholas and Ayling, 2003; Lamm et al ., 2004; Gagea et al ., 2006) Clinical manifestations include mastitis, respiratory diseas e, otitis media, polyarthritis, a nd tenosynovitis (Adegboye et al ., 1996; Brown et al ., 1998a; Step and Kirkpatrick, 2001a; Step and Kirkpatrick, 2001b; Nicholas and Ayling, 2003) Although the pathogenicity of M. bovis is well established, the disease patterns associated with the microor ganism are variable Outbreaks can be acute with substantive morbidity and mortality or manifest as endemic disease with sporadic cases (Rodriguez et al ., 1996; Walz et al ., 1997; Brown et al ., 1998a; Butler et al ., 2000; Nicholas and Ayling, 2003; Gagea e t al ., 2006) In addition to its role as a primary pathogen, M. bovis also exhi b its s ynergism with other pathogens in the bovine respirat ory disease complex (Houghton and Gourlay, 1983; Gourlay and Houghton, 1985; Lopez et al ., 1986; Thomas et al ., 1986; V irtala et al ., 1996b; Shahriar et al ., 2000; Poumarat et al ., 2001; Gagea et al ., 2006) In the past decade M. bovis has emerged as an important cause of respiratory disease, otitis media and arthritis in pre weaned calves (Brown et al ., 1998a; Stipkovit s et al ., 2000; Stipkovits et al ., 2001; Nicholas and Ayling, 2003; Lamm et al ., 2004) Onset of clinical disease occurs between 2 and 6 weeks of age. The disease is chronic and poorly responsive to antibiotic therapy (Gourlay et al ., 1989a; Allen et al ., 1992a; Adegboye et al ., 1995a; Apley and Fajt, 1998; Shahriar et al ., 2000; Stipkovits et al ., 2000; Gagea et al ., 2006) In herds with clinical M. bovis disease, a high prevalence of upper respiratory tract (URT) colonization occurs in

PAGE 125

125 healthy calves, sug gesting that only a subset of calves develop clinical disease (Bennett and Jasper, 1977c; Springer et al ., 1982; Allen et al ., 1992a; ter Laak et al ., 1992a; Brown et al ., 1998a; Mettifogo et al ., 1998) Morbidity and mortality occurs as a result of respir atory infection, otitis media, and arthritis, acting alone or in concert Respiratory infection occurs when M. bovis spreads from the URT to the lower respiratory tract. Otitis media occurs when M. bovis spreads to the middle ear probably via the eustachi an tube. Respiratory disease and otitis can present independently, together, or sequentially. Arthritis occurs as a result of hematogenous spread with localization in joints, usually as sequelae to respiratory disease. Multiple joints are often affected a nd mortality is frequently observed in arthritic calves. Ingestion of contaminated milk especially unpasteurized waste milk, has been identified as an important primary route of transmission of M. bovis to young calves (Pfutzner and Schimmel, 1985; Walz e t al ., 1997; Brown et al ., 1998a; Butler et al ., 2000) The role of colostrum in transmission is l ess well established in dairy c a l ves, but is known to be important in small ruminant mycoplasmal disease (DaMassa et al ., 1983) Once infection has establishe d, aerosol droplet and direct contact probably play a n important role in calf to calf transmission (Jasper et al ., 1974; Bennett and Jasper, 1977c; Nicholas and Ayling, 2003) The economic consequences of infection are primarily associated with intensive t reatment of affected calves coupled with culling of animals that are unresponsive to therapy (Nicholas and Ayling, 2003). Control of M. bovis infection in calves focuses on removal of identified risk factors for acquisition of M. bovis. Removal of infected milk from the diet by pasteurization or feeding of milk replacer has been successfully applied to reduce infection (Pfutzner and Meeser, 1986; Walz et al ., 1997; Brown et al ., 1998a; Butler et al ., 2000; Stabel et al ., 2004); breaks in pasteurization have been associated with subsequent infection outbreaks. Management practices

PAGE 126

126 to reduc e stocking density and improve ventilation are examples of changes that can reduce undifferentiated respiratory disease and are often recommended for M. bovis control (Ames, 1997; Rosenbusch, 2001; Step and Kirkpatrick, 2001a) Similarly, control of o ther pathogens that are involved in the bovine respiratory disease complex is likely to reduce M. bovis infections. At the level of the calf, management techniques that improve g eneral immune function, such as improving nutritional status and minimizing environmental stress, have been suggested as beneficial (Rosenbusch, 2001; Step and Kirkpatrick, 2001a) Vaccination is a potential strategy to control infection, but as discussed in Chapter 1 and briefly summarized below, efforts to develop efficacious vaccines have been problematic. Mycoplasma bovis vaccines have afforded some protection from respiratory disease in European field trials (Howard et al ., 1987a; Stott et al ., 1987; U rbaneck et al ., 2000). Other vaccines have been efficacious against respiratory disease (Howard et al ., 1980; Nicholas et al ., 2002) and arthritis (Chima et al ., 1980; Chima et al ., 1981; Nicholas et al ., 2002) in experimental challenge studies Important ly, in some cases vaccination has significantly exacerbated clinical disease (Rosenbusch, 1998; Bryson et al ., 1999). Most vaccine studies have been performed in calves that are older than the age at which colonization with M. bovis is often first observed (Stipkovits et al ., 1993; Walz et al ., 1997; Brown et al ., 1998a; Butler et al ., 2000; Stipkovits et al ., 2001) There are several commercial M. bovis vaccines currently marketed in the U.S ., as well as a number of companies that manufacture autogenous M. bovis bacterins However, none are licensed for use in young dairy calves, and, to the best of the author's knowledge, no independent studies have been published on their efficacy. Thus, there is a critical gap in the knowledge of vaccine strategy and eff icacy for protection of the young dairy calf that is at risk for otitis media, pneumonia, and arthritis.

PAGE 127

127 In order to address the lack of knowledge on the efficacy of currently available vaccines in young calves, we conducted a field trial using a commercia l M bovis bacterin that was approved for use in feeder and stocker calves. The objective of this field trial was to determine the efficacy of th is commercially produced M bovis bacterin for the prevention of M. bovis associated disease (respiratory disea se, otitis media, arthritis) and mortality in dairy calves from birth to 90 days of age. Additional objectives were to compare vaccinated and placebo treated calves with respect to 1) weight gain from birt h to 90 days of age, 2) rates of nasal colonization by M. bovis and 3) M. bovis specific serum immunoglobulin (Ig) concentrations. Methods Study P opulations We studied 3 73 Holstein heifers in three Florida herds using a randomized field trial design. The reference population for this study was heifer calv es in Florida dairy herds with endemic M. bovis infection. The study unit was a Holstein heifer calf clustered in one of three herds in n orth c entral Florida. Herds were selected based on their willingness to participate and on a history of mycoplasma asso ciated disease in calves. According to calf health records, at least 15% of calves were treated for respiratory disease, otitis media and /or arthritis during each of the 2 years preceding the study. Herd A, containing approximately 500 lactating cows, was the University of Florida Institute of Food and Agricultural Sciences Dairy Research Unit. Calves were bedded on sand in individual hutches placed approximately 1 m apart, in an open sided barn (Figure 2 1 A). C alves were fed unpasteurized bulk tank milk. Calves received a modified live virus (MLV) intranasal vaccine against parainfluenza virus type 3 ( PI 3 ) virus and infectious bovine rhinotracheitis virus (IBR) in the first week of life. An intramus cular MLV vaccine against IBR, PI 3 bovine respiratory syn cytial virus (BRSV) and bovine viral diarrhea virus ( BVDV ) types 1 and 2 was

PAGE 128

128 administered at 2, 6 and 8 weeks of age. A 7 way clostridial vaccine was administered at 2 and 6 weeks of age. Calves were weaned at approximately 6 weeks of age and turned out in to group pens at approximately 8 weeks of age. Herd B was a commercial herd of approximately 750 lactating cows. The majority of calves were housed in individual elevated metal crates in a concrete floored open sided barn (Figure 2 1 B) with some calves ho used on grass in individual hutches. Calves housed in metal crates had nose to nose contact with neighboring calves. The calf feeding protocol varied during the study period and included milk replacer and unpasteurized or pasteurized waste milk. The vaccin ation protocol was similar to that described for H erd A. Calves were weaned at 6 to 8 weeks of age and turned out into group pens at 8 to 10 weeks of age. Herd C was a commercial herd of approximately 1,000 lactating cows. Calves were housed on grass in in dividual hutches placed at least 1 m apart (Figure 2 1 C). Calves were primarily fed pasteurized waste milk, supplemented with milk replacer when necessary. Several failures of pasteurization were documented during the study period. Calves received an oral bolus containing antibodies against b ovine c oronavirus and Escherichia coli at the time of colostrum feeding (First Defense, Portland, ME) The vaccination protocol for MLV intranasal PI 3 /IBR and clostridial vaccines was similar to that described for H erd A. An intramuscular MLV vaccine against PI 3 IBR, BVD V types 1 and 2 and BRSV was administered at 4 and 8 weeks of age. Calves were weaned at 6 to 8 weeks of age and turned out into group pens at 8 to 10 weeks of age. Study Design All Holstein heifer calv es that were born during the study period and were considered healthy by the producer at 3 days of age were enrolled in the study. The enrollment period extended from March to December, 2002. Calves were assigned to either a vaccinated or a

PAGE 129

129 control group b ased on ear tag numbers, with odd numbers assigned to one group and even numbers to the other group. Assignment of odd and even numbers to groups was decided on a per farm basis by a coin flip. A 1 ml dose of a heat inactivated single strain, M. bovis bac terin in proprietary oil based adjuvant that had a conditional license for use in U.S. feeder and stocker calves (Texas Vet Lab, Inc .) or a sterile vaccine vehicle (control group) was administered subcutaneously in the neck at 3 days and 2 weeks of age. A 2 ml booster dose was administered at 5 weeks of age. Vaccine or placebo boosters were not administered to calves that were sick at 2 weeks of age; however, if the calf recovered within 5 days, then the booster was administered at 3 weeks of age. Calves th at failed to recover within 5 days remained in the study but were coded as "booster 1 missed". A similar protocol was followed for calves that were sick at the time of their 5 week booster. The bacterin and placebo were prepared and coded by the vaccine ma nufacturer. Investigators and farm personnel were blinded throughout data collection and analysis. Data recorded for each calf included date of birth, ear tag number, group allocation, dates of vaccine/placebo administration, and date of weaning. The dates of administration of any preventative treatments or other vaccines were recorded for each calf. The primary outcomes of interest were treatment for respiratory disease, otitis media and arthritis as well as mortality attributed to these diseases. Calve s were followed until 90 days of age and all treatment for clinical disease was recorded by farm personnel using standardized case definitions (Table 2 1) Sick calves were treated as per normal farm protocols. For each clinically ill calf, farm personnel recorded the type and dose of antimicrobial, the date(s) of treatment and the reason for treatment. Whenever a calf died, farm personnel recorded the cause of death if this was obvious. In most cases, cause of death was verified by field necropsy perform ed by the investigators. Study personnel visited each of the dairies at least once a week to

PAGE 130

130 collect calf health data, monitor compliance and collect samples. Because passive transfer of colostral immunoglobulins can influence the immune response to vacci nation or to infectious agents, blood was collected from all calves between 2 and 9 days of age for the measurement of total serum protein concentration. A subset of calves from H erds A ( n =40) and B ( n =60) was studied more intensively. These calves were we ighed at birth and approximately 90 days of age. Weight gain from birth to 90 days was expressed in kg/day. N asal swabs (Figure 2 2 A) and b lood samples (Figure 2 2 B) were collected weekly until 8 weeks of age and then at 90 days of age. Serum was analyzed for M. bovis specific IgA, IgM, IgG 1 and IgG 2 by enzyme linked immunosorbent assay ( ELISA ) Swabs were cultured to detect nasal colonization with M. bovis Collection and P rocessing of N asal S wabs Prior to collecting nasal swabs, gross debris was wiped fro m the external nares using sterile gauze. A sterile rayon tipped swab with a polyurethane plastic shaft ( ) was inserted into the ventral nasal meatus to a depth of approximately 4 inches S wab s were kept on ice during transport and were processed within 6 hr of collection. Each swab was used to streak the surface of modified All mycoplasma cultures were performed in broth and agar medium contain ing 2 25 % (wt./vol.) My coplasma broth base ( Frey ) (BD Diagnostic Systems, Sparks, MD), 0. 0 2 % (wt./vol.) DNA from herring sperm, 20% (vol./vol.) horse serum, 10% (vol./vol.) fresh yeast extract, 0.5% (wt./vol.) glucose and supplemented with 100 ,000 U /l each of penicillin G and p olymixin B and 65 m g /l of cefoperazone with the final pH adjusted to 7.6 to 7.8. Plates were incubated at 37 C in 5% CO 2 and examined at 2, 4, 7 and 10 days for mycoplasmal growth. Colonies with typical M. bovis morphology were plugged into broth, incubat ed at 37 C for

PAGE 131

131 48 hours and stored at 80 C until they could be confirmed as M. bovis by polymerase chain reaction ( PCR ) Samples were confirmed as M. bovis by PCR amplification of the uvr C gene. To prepare samples for PCR, 500 l of broth culture was tha wed at room temperature then pelleted by centrifugation at 14,000 rpm at 4 C for 1 hr. The supernatant was discarded and the pellet resuspended in 20 l of lysis buffer (100 mM tris [hydroxymethyl] aminomethane, pH 7.5 with 0.05% [vol./vol.] Tween 20 and 6 .5 mM dithiothreitol). Samples were incubated at 99 C for 20 min then cooled to 20 C 5 l of clarified sample was used as the DNA template in the PCR As a positive control, broth was inoculated with the M. bovis type strain (ATCC 27368) and processed wit h nasal isolates. Sterile water was used as a negative control template. Mycoplasma bovis was identified by PCR of the housekeeping gene uvr C (Subramaniam et al ., 1998). PCR reactions were carried out in a total volume of 50 l containing 5 l of template, 2.5 U Taq DNA polymerase (Promega Corporation, Madison, WI), 3 l of 25 mM MgCl 2 (final concentration 2.0 mM, Promega), 5 l of 10X reaction buffer (final concentration 50 mM KCl, 10 mM Tris pH 9.0, 0.1% [vol./vol.] Triton X 100, Promega), 2 l of a mixtu re of equal parts 10 mM d eoxyribonucleotide triphosphate s 1 l of each primer (final amount 20 pmol, commercially synthesized), and 32.75 l of sterile, purified DEPC treated water. The primers used in the PCR were Mbo uvr C2 L (5 TTACGCAAGAGAATGCTTCA 3 ) and Mbo uvr C2 R (5 TAGGAAAGCACCCTATTGAT 3 ), corresponding to bases 362 to 381 and 1988 to 1969 in the uvr C coding sequence (Genbank AF003959), respectively. The PCR cycling conditions were initial denaturation at 94 C for 3 min, followed by 35 cycles of d enaturation at 94 C for 30 sec, annealing at 52 C for 30 sec, polymerization at 72 C for 60 sec, and a final extension for 10 min at 72 C. PCR products were analyzed by electrophoresis at 110 V for 1 hr in 1.5% agarose gels and visualized by staining with ethidium bromide.

PAGE 132

132 The ELISA Procedure Blood samples were allowed to clot after collection, and then serum was harvested by centrifugation and stored at 80C. Whole cell lysate antigen (Schumacher et al ., 1993) was prepared from a 1 l iter culture of M. bo vis type strain PG45 grown at 37 C in modified Frey's broth. The protein concentration was determined using a colorimetric assay (Bio Rad, Hercules, CA) and adjusted to 100 g/ml. The antigen was stored in aliquots at 80 C and thawed at room temperature w hen required. The ELISA procedure was optimized using standard methodology. Microtiter plates (Maxisorb F96, Nunc, Kamstrup, Denmark) were coated with 20 g per well of antigen in 0.01 M sodium phosphate buffer (pH 7.2) cont aining 0.15 M NaCl and 0.02% (wt ./vol.) Na N 3 (PBS/A), and incubated overnight at 4 C. Plates were then washed three times with PBS/A containing 0.05% (vol./vol.) Tween 20 (PBS/T) using an automated plate washer (ELx405 Auto Plate Washer, BioTek Instruments, Inc ., Winooski, VT), blocked w ith 300 l per well of blocking buffer (PBS/T containing 1% [wt./vol.] egg albumin), and stored at 4 C for a minimum of 24 hr or until needed. Sera were diluted ( 1:100 for IgG 1 assay ; 1:50 for IgM and IgG 2 assays ; 1 :25 for IgA assay) in blocking buffer and 50 l of the dilut ed serum was added to duplicate wells ; plates were incubated at room temperature for 1 hr. Plates were washed as described above and 50 l of goat anti bovine isotype conjugated to alkaline phosphatase (Bethyl Laboratories Inc ., Montgome ry, TX) and diluted to 1:1 000 i n blocking buffer was added to each well. Plates were incubated at room temperature for 2 hr and then washed as described above. 100 l of 0.1% (wt./vol.) p nitrophenol phosphate was added to each well and plates were incuba ted in the dark at room temperature for 1 hr. The optical density (OD) in each well was read at a wavelength of 405 nm using an automated plate reader (ELx808 Ultra Microplate Reader, BioTek Instruments, Inc ., Winooski, VT). For each microtiter plate, the blank was the

PAGE 133

133 mean value for two wells coated with antigen and incubated with the conjugated secondary antibody and substrate only. The blank OD value was subtracted from each sample well, and mean values for each pair of duplicate tests calculated. A pool of ser a from 20 calves with naturally occurring mycoplasmal disease and high M. bovis specific titers were included on each plate as a positive control ; the negative control was a pool of serum collected from the same 20 calves prior to ingestion of their first colostrum meal. The cutoff for a positive titer was the average OD value (minus the blank) for the negative control sera plus two standard deviations, established over ten assay runs. The highest dilution of the test serum that gave an average OD va lue higher than the cutoff was defined as the titer for that sample. Within batch and between batch assay variability was assessed by using the Youden plot graphic method (Jeffcoate, 1982) The ELISA values obtained for the lowest, middle and highest dilut ion of the control serum included on each plate were used to establish target values and control limits to be used for monitoring the consistency of the assay ( ten batches). The values obtained at the beginning of a series of assays were plotted against th e values obtained for the same standards at the end of the series. If values for the pooled sera deviated more than 10% from target values, the assay was repeated. Field Necropsy A standard field necropsy was performed by one of the study veterinarians on most calves that died or had to be euthanized during the study. Calves were examined to determine the cause of death and specifically determine the involvement of M. bovis associated pathology. All necropsies included culture of swabs of the palatine tonsi ls, tympanic bullae and primary bronchi for mycoplasmas. Additionally, if the animal had previously been diagnosed with respiratory disease, arthritis or otitis media, or if any macroscopic lung pathology was observed, appropriate samples were collected fr om the lesion site (s) to determine the involvement of M. bovis as well

PAGE 134

134 as other viral and bacterial respiratory pathogens. Further samples were collected when deemed necessary to determine the cause of death by the veterinarian performing the necropsy. All swabs and fresh tissue samples were transported on ice to the laboratory as soon as possible and were processed within 24 hr after collection. When tissue samples for fixation were collected they were placed into containers of 10% buffered formalin and s ubmitted to t he Diagnostic Pathology Service, College of Veterinary Medicine, University of Florida Samples then were embedded in paraffin and sections (5 m) stained with hematoxylin and eosin Histopathology was read by diagnostic pathologists without k nowledge of experimental treatment groups. In addition to culture for mycoplasmas (described under nasal swabs, above), swabs for aerobic microbiological culture were processed and isolates identified using routine clinical bacteriological methods These m ethods w ere focused on identifying bacterial pathogens of the respiratory tract other than mycoplasmas, particularly Arcanobacterium pyogenes, Histophilus somni, Mannheimia haemolytica and Pasteurella multocida as well as pathogens that may cause septicemi a and associated sequelae in young calves. Additional diagnostic testing was performed as requested by the veterinarian who conducted the necropsy based on the presumptive diagnosis and any macroscopic pathology. S amples were submitted to the Florida State Diagnostic Laboratory (Kissimmee, FL) for detection of bovine respiratory viruses when indicated. Sample Size Morbidity due to M. bovis was the major outcome of interest and was therefore used to calculate sample size. At the time the study was initiated, health records indicated that the incidence of respiratory disease, otitis media and/or arthritis in the study herds was at least 15%. We hypothesized that a reduction in incidence to 5% would be biologically and economically significant. Using these valu es together with 95% confidence and 80% power, and taking into

PAGE 135

135 consideration an attrition rate of approximately 10%, the calculated sample size was 180 calves per group. For the secondary outcomes of interest from a subset of calves in Herds A and B, we hy pothesized that a reduction in the nasal colonization rate from 50% to 20% would be biologically significant. Using these values together with the parameters outlined above, the calculated sample size was 50 calves per group. Statistical M ethods Calves wer e excluded from analyses if clinical signs referable to other organ systems occurred concurrently with respiratory disease, otitis media or arthritis, with the exception of diarrhea without fever of less than 7 days duration. Categorical variables were com pared among groups using Chi square tests ; data were analyzed for effects of herd and passive transfer status by Strat ified Mantel Haenszel analysis. Simple continuous variables were compared among groups using t tests and ELISA data were analyzed using r epeated measures ANOVA. Analyses were performed using commercial statistical software (SPSS 12.0, SPSS Inc, Chicago IL) Results Between March and December, 2002, 328 calves from Herds B and C (166 and 162 calves, respectively) were enrolled and were elig ible for inclusion in the study (Table 2 2). Despite a history of M. bovis infection, Herd A did not experience any M. bovis associated disease during the study and therefore is excluded from some analyses, but data from this herd are included where releva nt. The incidence risk for clinical respiratory disease, otitis media, and arthritis was assessed from birth to 90 days of age (Table 2 3). Mycoplasma bovis associated respiratory disease and otitis media were major contributors to calf disease in Herds B and C. One case of arthritis was observed in Herd B, and none were observed in Herd C. Herd A had a much lower overall

PAGE 136

136 mortality risk (0.02) than did Herds B (0.13) and C (0.10); M. bovis associated mortality in Herd B accounted for the majority of the mo rtality risk (0.10 vs. 0.13 overall). The baseline data for vaccinated and control animals are shown in Table 2 4. Vaccinated and control groups had equivalent levels of post colostral total serum protein. A small percentage of calves did not receive their second vaccine due to illness. In Herd B, no control calves missed the third vaccine as opposed to 9% of the vaccine group that missed this vaccination ( P = 0.005). Vaccination did not influence the age of first treatment for either otitis media or respi ratory disease (Table 2 5). Similarly, vaccination neither reduced overall M. bovis associated morbidity nor altered the temporal expression of disease in either herd (Table 2 6). Morbidity specifically associated with respiratory disease also was not affe cted by vaccination (Table 2 7). The incidence of otitis media was higher ( P = 0.004) in vaccinated calves than in control calves in Herd B, but no differences in the incidence of otitis media between groups were observed in Herd C (Table 2 8). There was n o difference between vaccinated and control calves in Herd B in the age of first treatment for otitis media (data not shown). There was no significant difference between vaccinated and control calves with respect to mortality (Table 2 9). For Herds A and B weight gain was monitored from birth to 90 days of age ; no significant difference was observed in average daily gain between groups in Herd A. Similarly, no significant difference was observed in average daily gain between vaccinated (0.48 0.18 kg/day, n =27) and control (0.54 0.11 kg/day, n =29) calves in Herd B, where endemic M. bovis disease was present. Nasal colonization was not affected by vaccination; in Herd B where endemic M. bovis disease was present, the mean percentage ( SEM) of calves with M. bovis positive nasal swabs at each sampling time was 81.4 8.2% for vaccinated calves and 75.8 6.7% in control calves.

PAGE 137

137 The average number of sampling times that M. bovis was recovered from each calf was also not affected by vaccination. However the temporal pattern of colonization observed in calves from Herd A (no mycoplasmal disease) was quite different from that observed in calves in Herd B (significant mycoplasmal disease; Figure 2 3). Calves in Herd A had minimal to no nasal shedding of M. bovis during the pre weaning period. Calves in Herd A were moved out of individual hutches into group pens after the 8 week samples were collected; at the next sampling period (12 weeks of age), the level of nasal colonization was similar to that in the herd th at experienced M. bovis associated disease. In Herd B, calves were shedding M. bovis as early as 1 week of age, and by 3 weeks of age over 70% of calves were colonized in the URT. This level of colonization was maintained throughout the sampling period. Th e serum antibody subclass response in a subset of calves in Herds A and B was assessed by ELISA. No significant differences between vaccinated and control calves were found in either Herd A or B for IgA (Figure 2 4), IgM (Figure 2 5), or IgG 2 (Figure 2 6). However, vaccination did induce a serum IgG 1 response (Figure 2 7). Significant differences ( P < 0.05) between vaccinated and control groups were first evident at 7 weeks of age in Herd A (no endemic disease) and at 12 weeks of age in Herd B (endemic dise ase). We then assessed if there was an association between Ig subclass response and morbidity in calves from Herd B. There was no association of any Ig subclass response with morbidity, nasal colonization rate, or weight gain. Interestingly, there was no s ignificant association between post colostral total serum protein concentrations and the incidence or duration of treatment for respiratory disease or otitis media in Herds B and C (data not shown). Similarly, the incidence of M. bovis specific calf mortal ity in Herds B and C was not associated with post colostral total serum protein

PAGE 138

138 concentrations (data not shown). There was also no association between M. bovis specific IgA, IgM, IgG 1 or IgG 2 post colostral serum titers and either morbidity or mortality in a subset of calves in Herd B (data not shown). Discussion The commercial M. bovis bacterin tested in this trial was not efficacious in prevention of either M. bovis associated respiratory disease or otitis media in pre weaned calves in two north central F lorida herds with endemic M. bovis disease. The response to vaccination was herd dependent, and a higher rate of otitis media was associated with vaccination in one herd. Other investigators have reported some protection from mycoplasmal respiratory disea se by subcutaneous vaccination of calves with killed whole cell bacterins (Howard et al ., 1980; Howard et al ., 1997; Nicholas et al ., 2002). In a study of an apparently efficacious vaccine in young calves, Nicholas et al ., (2002) vaccinated 3 week old dair y calves with a single dose of saponin inactivated bacterin. Calves received an aerosol challenge with live M. bovis 3 weeks after vaccination. Vaccinated calves had fewer numbers of M. bovis at colonized sites fewer body sites colonized by M. bovis, and reduced severity and incidence of clinical disease and lesions as compared to control calves. There was also a significant decrease in body weight gain in control calves compared with vaccinates. Additionally, no vaccinated calves and two of seven control calves developed arthritis. Vaccinated calves produced a strong IgG response prior to challenge, but IgG subtypes were not reported. No adverse events associated with vaccination were reported. A killed vaccine against four bovine respiratory pathogens (BR SV, PI 3 M. bovis, and M dispar ) was evaluated for protection against naturally occurring respiratory disease in beef calves (Howard et al ., 1987a; Stott et al ., 1987) Calves were vaccinated subcutaneously and received two boosters at 3 week intervals. I n one study (Stott et al ., 1987) three groups of beef

PAGE 139

139 calves aged 12, 7 and 3 weeks at the time of first vaccination were used, and calves were followed for 6 months. Respiratory disease occurred in a significantly higher ( P < 0.05) proportion of the cont rol calves (27%) compared with the vaccinates (16.3%). In a second study (Howard et al ., 1987a) using the same vaccination protocol, M. bovis and BRSV were implicated in outbreaks of respiratory disease during the trial period. Morbidity due to respiratory disease was significantly reduced in vaccinated calves (25%) compared with controls (32%), and mortality in the vaccinated group was similarly reduced (2% and 9% for vaccinates and controls, respectively). No adverse effects of vaccination were noted. Th ere are a number of key differences between the studies reported above and our study that may have influenced vaccine efficacy. Firstly, the strain of bacteria the antigen concentration, the method of bacterial inactivation and the adjuvant used are all f actors that exert significant effects on the efficacy of bacterial vaccines, although there are limited data on how these affect M. bovis vaccines in particular. Although some of these data are not reported in the above studies, and some are not available for our vaccine (e.g. the adjuvant used is proprietary), it is likely that all these factors varied significantly between our study and those listed above. Secondly, calves in the above studies were first vaccinated at a substantially older age than the ca lves in our study. As discussed in Chapter 1, immune responses of the newborn calf have unique characteristics and undergo rapid changes during the first few weeks of life (Barrington and Parish, 2001). Vaccination at 3, 14 and 35 days of age (as was perfo rmed in our study) may not elicit the same type of immune response as vaccination at 3 weeks of age (as in the Nicholson et al ., 2002 study, above). Our vaccination protocol was chosen based on a) protocols that were being applied on dairies in Florida, an d b) the early age of infection that had been observed in previous studies (Brown et al ., 1998a). Thirdly, calves in endemically infected herds

PAGE 140

140 in our study became colonized at a very early age, meaning that infection was likely well established before a v accine induced immune response could develop. As discussed in Chapter 1, adaptive immune responses that develop after infection are very inefficient at clearing mycoplasmal infections and often result in detrimental chronic inflammatory responses. Lastly, the challenge load of M. bovis that calves are exposed to can affect the efficacy of vaccination. Given the high incidence of clinical mycoplasmal disease and the early age of colonization observed in our endemically infected herds, the level of M. bovis c hallenge that calves were exposed to may have been significantly greater than that of the calves in other vaccine studies (Howard et al ., 1980; Howard et al ., 1997; Nicholas et al ., 2002). Vaccinated calves in one herd in our study had a greater risk of ot itis media than did control calves. The risk of otitis media in control calves in Herd B seemed substantially less than that in Herd C, but examination of calf health records from previous years in Herd B showed that the risk of otitis media observed in co ntrol calves was similar to that which had been historically present (data not shown). Therefore, vaccination seemed to exacerbate clinical otitis media in this herd. There are other reports of exacerbation of clinical disease following M. bovis vaccinatio n (Boothby et al ., 1987; Rosenbusch 1998; Bryson et al ., 1999). However, the immune mechanisms associated with adverse outcomes after M. bovis vaccination have not been determined. Vaccination of calves did stimulate a systemic humoral immune response, wi th an increase in serum IgG 1 being detectable after the third vaccination. A tendency towards Th2 biased IgG 1 dominated humoral responses has also been reported after infection of calves with M. bovis (Howard et al ., 1987c; Vanden Bush and Rosenbusch, 2003 ). As IgG 2 is a much more effective opsonin for phagocytosis of M. bovis than is IgG 1 it is not surprising that an IgG 1

PAGE 141

141 response is ineffective for control of M. bovis respiratory infections (Howard et al ., 1976). It is somewhat puzzling that a humoral re sponse to infection was not obvious in control calves in Herd B where there was a high incidence of M. bovis associated disease. Statistical comparison of IgG 1 responses in control groups in Herds A and B was not conducted. However, it appears that in the control group in Herd A, post colostral IgG 1 antibody levels continued to decline throughout the study period (see Figure 2 7), whereas in the control group in Herd B, they did not decline after 7 weeks of age. This result may reflect continued stimulation of the immune response as a result of the endemic nature of M. bovis in this herd. Other investigators have also noted a poor correlation between serum antibody responses and M. bovis infection in individual calves during the first 3 months of life (Virta la et al ., 2000). However, M. bovis infection can result in local mucosal antibody responses without eliciting a substantial systemic humoral response (Howard et al ., 1980). The vaccine used in our study was ineffective at preventing URT colonization with M. bovis in calves, even when colonization occurred after a humoral immune response was well established. Calves in Herd A were not colonized until between 8 and 12 weeks of age, whereas a significant increase in serum IgG 1 responses was evident by 7 weeks of age. This is consistent with other reports on M. bovis vaccines; e ven where M. bovis vaccines have been associated with clinical benefits, they typically fail to induce an immune response that prevents URT infection (Chima et al ., 1980; Nicholas et al 2002) As discussed in Chapter 1, protection from URT colonization and from clinical respiratory tract disease is better correlated with local mucosal immune responses than with serum antibody titers. Post colostral total serum protein concentrations or M. bovis specific antibody levels were not associated with protection from M. bovis associated disease in calves in this study.

PAGE 142

142 However, as colostrum was not pasteurized on this farm, it is possible that some colostrum containing high antibody concentratio ns to M. bovis may have come from cows with intramammary infection and therefore may also have contained live M. bovis This could certainly mask any protective effect of passive transfer when assessed on a herd level. Further studies are required to deter mine the efficacy of passive transfer for prevention of M. bovis associated disease in a controlled setting. To the best of the author's knowledge this is the first controlled, independent efficacy stud y of any of the M. bovis vaccines available in North A merica. The response to vaccination was herd dependent, and a higher rate of otitis media was associated with vaccination in one herd. The vaccine did stimulate a systemic IgG 1 response that was detectable after the third vaccination. However, most clinica l disease occurred prior to this adaptive humoral immune response. Pre weaned calves in endemically infected herds were colonized with M. bovis at a very young age, and it is likely that this represents the greatest impediment to successful vaccination in this age group. Whether vaccination may be efficacious at preventing clinical disease in older calves was not evaluated in this study. In conclusion, vaccination was not efficacious in preventing M. bovis associated disease in pre weaned calves in two ende mically infected Florida dairy herds, nor was it effective at preventing colonization of the URT in older calves in a third dairy herd. New approaches to immune protection of young calves from M. bovis infections including controlled studies investigating the efficacy of passive transfer and the mucosal route of immunization are needed

PAGE 143

143 Figure 2 1. Calf housing conditions for the three study farms. A) Herd A. B) Herd B. C) Herd C. A B C

PAGE 144

144 Table 2 1. Clinical defini tions of disease used by calf producers during this study. Disease Clinical definition Scours D iarrhea plus rectal temperature of < 103.5 F Scours with fever D 103.5 F Digestive C linical signs attributable to a limentary tract disease, other than scours Fever of unknown cause F ever in the absence of specific clinical signs Respiratory disease F 103.5 F) plus increased respiratory rate or effort and/or coughing and/or nasal dischar ge Otitis media E ar droop and/or evidence of ear pain (head shaking, scratching or rubbing ear) Arthritis L ameness attributable to painful distention of any joint Navel infection E nlarged umbilical stalk that is non reducible on palpation, confirm ed by a veterinarian at next visit Other C linical signs described by farm personnel or veterinarian. Figure 2 2. Sampling of a subset of calves in Herds A and B. A) Collection of nasal swabs. B) Collection of blood from the jugu lar vein. A B

PAGE 145

145 Table 2 2. Summary of calves enrolled in vaccine field efficacy study. Herd Vaccinated Control Exclusions* Total A 21 20 0 41 B 8 1 85 2 1 68 C 8 2 80 2 16 4 All Herds 184 185 4 373 In Herd B, one calf was excluded because of concurrent dise ase and one calf was excluded because of a booster was inadvertently missed ; in Herd C, one calf was excluded because of concurrent disease and one calf was excluded because it received the wrong booster. Table 2 3 Incidence risk for Mycoplasma bovis associated disease and mortality between 3 and 90 days of age in calves in the three study herds. Herd A Herd B Herd C Disease All M bovis associated 0.00 0.55 0.74 Otitis media 0.00 0.22 0.35 Respiratory disease 0.00 0.48 0.69 Arthritis 0.00 0.04 0.00 Other 0.07 0.15 0.19 Mortality M. bovis associated 0.00 0.10 0.03 All causes 0.02 0.13 0.10 Table 2 4. Baseline data for calves in Herds B and C. Vaccinated ( n =163) Control ( n =165) P Herds B+C TSP (g/dl) 5.84 0.73 5.76 0. 58 ns No 2 nd vaccine 9/157 (6%) 7/157 (4%) ns No 3 rd vaccine 10/153 (7%) 8/153 (5%) ns Herd B No 3 rd vaccine 7/77 (9%) 0/82 (0%) 0.005 TSP = total serum protein; Results are expressed as mean standard deviation. Results are expressed as number of calves that missed the vaccine/total number of calves eligible for that vaccine, percentage is given in parentheses. ns = no significant difference

PAGE 146

146 Table 2 5. The age at which calves in Herds B and C received their first treatment for oti tis media or respiratory disease. Age in days at first treatment Disease Vaccinated Control P Otitis media Herd B 37 16 37 17 ns Herd C 27 10 24 9 ns Herd B+C 32 13 31 13 ns Respiratory disease Herd B 30 13 33 14 n s Herd C 20 17 21 17 ns Herd B+C 24 15 25 16 ns Results are expressed as mean age in days standard deviation; ns = no significant difference Table 2 6. Temporal expression of M ycoplasma bovis associated disease in vaccinated and contro l cal ves in Herds B and C Age Herd Vaccinated (%) Control (%) P 4 weeks B 19/81 (23) 17/85 (20) ns C 46/82 (56) 46/80 (58) ns B+C 65/163 (40) 63/165 (38) ns 8 weeks B 42/81 (52) 38/85 (45) ns C 57/82 (70) 53/80 (66) ns B+C 99/163 (61) 91/165 (55) ns 12 weeks B 44/81 (54) 40/85 (47) ns C 58/82 (71) 55/80 (69) ns B+C 102/163 (63) 95/165 (58) ns Results are expressed as the number of calves receiving their first therapeutic intervention by 4, 8, or 12 weeks of age/total number of calves. ns = no significant difference.

PAGE 147

147 Table 2 7 Morbidity due to respiratory disease in vaccinated and control calves. Vaccinated (%) Control (%) P Herd B Respiratory only 18/81 (22) 26/85 (31) ns All Respiratory 38/81 (47) 36/85 (42) ns Herd C Respiratory only 35/82 (43) 25/80 (31) ns All Respiratory 55/82 (67) 51/80 (64) ns Herd B + C All Respiratory 93/163 (57) 87/165 (53) ns Results are expressed as the number of calv es with respiratory disease/total number of calves in that group. "All Respiratory" includes calves that were treated for respiratory disease alone or for respiratory disease and otitis media or arthritis. ns = no significant difference. Table 2 8 Mor bidity due to otitis media i n vaccinated and control calves. Vaccinated (%) Control (%) P Herd B Otitis media only 4/81 (5) 1/85 (1) ns Otitis media + Respiratory 20/81 (25) 9/85 (11) 0.017 All otitis media 24/8 (30) 10/85 (12) 0.004 Herd C Otitis media only 3/82 (4) 4/80 (5) ns Otitis media + Respiratory 20/82 (24) 26/80 (33) ns All otitis media 23/82 (28) 30/80 (38) ns Results are expressed as the number of calves with otitis media/total number of c alves in that group. ns = no significant difference.

PAGE 148

148 Table 2 9 Overall and Mycoplasma bovis associated mortality in vaccinated and control calves Vaccinated (%) Control (%) P All mortality Herd B 11/81 (14) 10/85 (12) ns Herd C 6/82 (7) 11 /80 (13) ns Herd B+C 17/163 (10) 21/165 (13) ns M. bovis associated Herd B 9/81 (11) 7/85 (8) ns Herd C 1/82 (1) 4/80 (5) ns Herd B+C 10/163 (6) 11/165 (7) ns Results are expressed as the number of calves that died/total number of calves in that group. ns = no significant difference. Figure 2 3. Temporal pattern of nasal colonization of calves by Mycoplasma bovis in Herds A and B.

PAGE 149

149 Figure 2 4. Immunoglobulin A response in vaccinated and control calves. A) Herd A. B) Herd B. A B

PAGE 150

150 Figure 2 5. Immunoglobulin M response in vaccinated and control calves. A) Herd A. B) Herd B. B A

PAGE 151

151 Figur e 2 6. Immunoglobulin G 2 response in vaccinated and control calves. A) Herd A. B) Herd B. B A A

PAGE 152

152 Figure 2 7. Immunoglobulin G 1 response in vaccinated and control calves. A) Herd A. B) Herd B. *Asterisks indicates time points at which vaccinated and control groups were statistically different ( P < 0.05). A B *

PAGE 153

153 CHAPTER 3 ORAL INOCULATION OF DAIRY CALVES WITH Mycoplasma bovis RESULTS IN RESPIRATORY TRACT IN FECTION AND OTITIS M EDIA: ESTABLISHMENT OF A MODEL OF AN EMERGING PROBLEM Introduction Mycoplasma bovis has emerged in recent years as a widespread and importan t etiologic agent of otitis media, respiratory disease and arthritis in intensively reared pre weaned dairy calves. Clinical disease caused by M. bovis tends to be chronic, debilitating and unresponsive to antimicrobial therapy (Gourlay et al ., 1989a; Adeg boye et al ., 1995a; Apley and Fajt, 1998; Pollock et al ., 2000; Stipkovits et al ., 2000; Rosenbusch, 2001; Shahriar et al ., 2002). Disease outbreaks with high morbidity rates occur (Gourlay et al ., 1989a; Walz et al ., 1997; Brown et al ., 1998a; Butler et a l ., 2000; Stipkovits et al ., 2001) and can be economically devastating for the affected farm. An absence of efficacious vaccines for use in young calves combined with a poor response to therapeutic agents means that this disease is often very difficult to control once established in a herd. Therefore, there is a critical need to develop improved preventative or control measures for M. bovis associated calf disease. I ngestion of milk or colostrum from cows shedding M. bovis from the mammary gland is conside red to be a major means of transmission to young dairy calves (Bennett and Jasper, 1977c; Walz et al ., 1997; Brown et al ., 1998a; Butler et al ., 2000), although d irect contact with infected animals and secondary transmission through fomites are also likely to be important. Following exposure by any of these routes, the upper respiratory tract (URT) appears to be the initial site of colonization (Bennett and Jasper, 1977c; Brys and Pfutzner, 1989) and this colonization precedes the development of clinical d isease. However, as with many other pathogens which inhabit mucosal surfaces, colonization alone does not necessarily result in the development of clinical disease, and M. bovis is frequently isolated from the nasal passages of

PAGE 154

154 apparently healthy cattle (t er Laak et al ., 1992a; Brown et al ., 1998a; Mettifogo et al ., 1998; Maeda et al ., 2003) The host and microbial factors that contribute to development of disease after colonization of the URT by M. bovis are poorly understood. A defined experimental anima l model that mimics naturally occurring disease would facilitate understanding of these factors. In addition such a model could be applied in the development of optimal vaccine approaches against M. bovis as well as efficacy testing of new treatments and v accines for use in young dairy calves. A number of experimental models have been used to study M. bovis infection in calves. Various routes of inoculation have been employed, including inhalation of aerosolized bacteria, intranasal, intra or transtracheal endobronchial, transthoracic, intravenous, intraarticular or subcutaneous inoculation, as well as combinations of these routes (Chima et al ., 1980; Howard et al ., 1980; Pfutzner et al ., 1983a; Ryan et al ., 1983; Gourlay and Houghton, 1985; Lopez et al ., 1986; Brys et al ., 1989; Gourlay et al ., 1989b; Nicholas et al ., 2002; Vanden Bush and Rosenbusch, 2003). Although useful in the study of events associated with M. bovis infection at particular body sites, none of these models mimic the ingestion of M. bov is contaminated milk, a major route of infection in young calves (Bennett and Jasper, 1977c; Walz et al ., 1997; Brown et al ., 1998a; Butler et al ., 2000). In addition, most experimental infection studies have been conducted in calves that are at least 2 we eks of age, whereas natural infection often occurs in younger calves (Brown et al ., 1998a; Stipkovits et al ., 2000). Although neonatal calves are immunocompetent, their immune system responds differently to many antigens than does that of older calves (Bar rington and Parish, 2001), so selection of an appropriate age group is likely to be important for a model to accurately mimic natural disease. Importantly, t he experimental models previously used to study M. bovis infection in calves did not induce clinica l otitis media,

PAGE 155

155 which is a newly emerging disease in young calves. An experimental infection model to study the events that occur in the URT of young calves after exposure to M. bovis in milk, particularly those factors leading to the dissemination of infe ction and the development of otitis media and lower respiratory tract (LRT) disease would be invaluable. The goal of this study was to develop a reproducible model of M. bovis infection of the URT that closely mimicked natural infection, and to compare thi s model with a transtracheal inoculation approach. Because the very young calf presents some special challenges with respect to vaccine development and treatment of clinical disease, we chose to focus our studies on this age group. To best mimic a natural route of infection, we infected calves by feeding milk replacer inoculated with a field strain of M. bovis This model consistently resulted in colonization of the URT and eustachian (auditory) tubes and caused otitis media in 37% of calves by two weeks po st infection. The model is suitable for use in further studies to define local and systemic immune responses to M. bovis infection of the URT and to evaluate new therapeutic or preventative strategies against M. bovis associated disease. Methods Calves Al l animal work was approved by the University of Florida (UF) Institutional Animal Care and Use Committee. Healthy male Holstein calves were obtained from the UF Dairy Research Unit, where no clinical mycoplasmal disease had been observed in calves for 2 ye ars preceding the study. Calves were removed from the cow at birth before suckling could occur. In the first 12 hr of life, calves were fed two doses of a mycoplasma free colostrum replacement product formulated from a spray PC Inc., Ames, IA). Calves were weighed, ear tagged and given one oral dose of a commercial product containing antibody against F5 piliated E. coli (Bovine Ecolizer, Novartis Animal Health U.S., Inc., Greensboro,

PAGE 156

156 NC). Serum and nasal swabs were collected p rior to initial colostrum replacer feeding and at approximately 48 hr of age. Total serum protein was measured at 48 hr of age as an estimate of passive transfer of immunoglobulin (Ig). Nasal swabs were cultured to detect mycoplasmas and other URT pathogen s. At 1 to 4 days of age, calves were transported to UF research facilities where they were housed in individual stalls with no direct contact between animals. Calves were maintained on non medicated milk replacer and had free choice access to non medicate d starter pellets and fresh water. Calves that developed uncomplicated diarrhea (diarrhea without fever) in the pre as needed to replace fluid and electrolyte losses. Ca lves that developed other clinical signs of disease were not enrolled in the study. Control and infected groups were housed in different rooms. Strain of M. bovis and Experimental Infection Mycoplasma bovis F1, confirmed as M. bovis by 16S rRNA gene sequen cing (data not shown), is a field strain isolated from a lung abscess in a calf with severe fibrinous bronchopneumonia. The source herd had experienced high morbidity rates due to M. bovis associated pneumonia and otitis media in pre weaned dairy calves in the two years prior to the isolate being obtained. A second passage culture of M. bovis F1 in Frey's broth was stored in aliquots at 80 C and used for all infection studies. All calves were inoculated between 7 and 11 days of age (Day 0 = day of inocula tion). For the oral inoculation groups, calves received a total dose of 2.9 2.5 10 10 colony forming units (CFU) of M. bovis F1 (infected group, n= 8) or an identical volume of sterile Frey's broth (control group, n= 4) over three consecutive feedings in a 24 hr period. At each feeding, an aliquot of M. bovis F1 was thawed at room temperature, mixed with two pints of milk replacer at

PAGE 157

157 was then added to the bucket and fed. For the transtracheal inoculation groups, calves received a single inoculum (3.8 1.1 10 9 CFU/ml) of M. bovis F1 in sterile, endotoxin free isotonic saline (Abbott Laboratories, Chicago, IL; infected group, n= 5) or an identical volume of sali ne (control group, n= 4). Approximately two hr prior to inoculation, an aliquot of M. bovis F1 was thawed at room temperature, pelleted, washed twice, and resuspended in 20 ml of saline. Each calf was sedated with xylazine hydrochloride, and the inoculum de livered at the level of the tracheal bifurcation using a commercial transtracheal wash kit (MILA International, Inc., Florence, KY). Clinical Monitoring and Sample Collection A complete physical examination was performed or supervised by a veterinarian on each calf at approximately the same time each day, and data were recorded using standardized forms. Calves were also observed a second time during the day for clinical abnormalities. Due to biosecurity protocols in the housing facility, the examiners were not blinded as to calf infection status. A clinical scoring system was developed in which calves were scored in four categories: Behavior (0: normal behavior, gets up when approached; 1: depressed or dull, must be stimulated to get up; 2: gets up only wit h assistance) r ectal temperature (0: < 103 F; 1:103 to 104.9 F; 2: > 105 F), c linical signs of otitis media ( 0: no clinical signs of otitis media; 1: occasional head shaking and/or scratching ears, ear droop evident at rest; 2: occasional head shaking and /or scratching ears, ear droop evident continuously; 3: frequent head shaking or ear scratching, pronounced ear droop) and clinical signs of respiratory disease (0: none of the following clinical abnormalities: cough, mucopurulent nasal discharge, abnorma l breath sounds on thoracic

PAGE 158

158 auscultation, tachypnea (> 60 breaths/min) or dyspnea; 1: one of the above clinical abnormalities; 2: two of the above clinical abnormalities; 3: three or more of the above clinical abnormalities). The scores for each of the fo ur categories were summed each day to give a maximum overall daily clinical score of 10. Franklin Lakes, NJ) were collected at 0, 3, 7 and 14 days post infection for mycoplasma culture. Blood samples were collected by jugular venipuncture at the same times for mycoplasma culture (all time points) and for assay of M. bovis specific serum IgG titers by enzyme linked immunosorbent assay (ELISA) (days 0 and 14). Collection of Tissu es Calves were euthanized 14 days after the first inoculation of M. bovis or earlier if criteria for euthanasia were met. One calf had to be euthanized at 10 days post infection; samples were collected immediately prior to euthanasia from this animal. At necropsy, each of the six major lung lobes, the spleen, the tracheobronchial lymph nodes (TBLN) and the medial and lateral retropharyngeal lymph nodes (MRPLN and LRPLN) were examined for gross lesions and samples collected for culture and histopathology. L ymph nodes were weighed prior to sample collection. Each lung lobe was weighed and photographed; digital photographs were later used to calculate the percentage of each lobe affected with visible lesions. Mean lung lobe weights of control calves were used to calculate the ratio of each lobe to the total lung mass, and these figures used to determine the total percentage of visibly affected lung for each calf (Jericho and Langford, 1982). For mycoplasmal culture, approximately 300 mg of tissue was collected aseptically from a standard site in each lung lobe and the spleen. In addition, the cut surface of each of these tissues was swabbed. Swabs were collected aseptically from the mucosal or synovial surfaces of the palatine tonsils, trachea, primary bronchi, carpal and stifle joints, and

PAGE 159

159 from the cut surface of the MRPLN, LRPLN and TBLN. Samples also were collected from each of these tissues for histopathology. Spinal fluid was aspirated from the atlanto occipital space for culture. The exterior and cut surfac es of the tissues described above as well as all other major organs were examined for gross abnormalities. Samples from the nasopharynx, eustachian tubes and tympanic bullae were collected after removal of the brain and bisection of the skull. The brain, m eninges, nasal passages and sinuses were examined for gross lesions. Swabs of the mucosal surface of the pharyngeal tonsil (Schuh and Oliphant, 1992) and nasal mucosa were collected for culture, and tissue collected for histopathology. After collection of swabs from the distal eustachian tubes via the nasopharyngeal openings, the external ear canal, tympanic bulla and the eustachian tube were removed using a reticulating saw. The distal portion of the eustachian tube was removed for histopathology. A small (4 4mm) section of bone was removed aseptically from the most ventral aspect of the tympanic bulla. Any exudate present within the bulla was aspirated for culture, and the tympanic mucosa was swabbed. Histopathology Tissue samples were fixed in 10% neutra l buffered formalin, embedded in paraffin wax and sections (5 m) stained with hematoxylin and eosin. The ear was fixed in 10% neutral buffered formalin, subsequently band sawed through a line incorporating the rostral margins of the insertion of the stylo hyoid bone and the external auditory meatus, then trimmed and decalcified for 24 hr prior to embedding. Histopathology was read in a blinded fashion without knowledge of experimental groups or gross pathologic findings. Histopathology of the eustachian tub es, nasal mucosa, tonsils, trachea, primary bronchi and lymph nodes was graded on a scale from 1 (minimal to no lesions and/or lymphoid hyperplasia) to 3 (most severe lesions

PAGE 160

160 and or lymphoid hyperplasia). In addition, tissues were graded with respect to nu mbers of plasma cells present on a scale from 1 (minimal or no plasma cells) to 4 (large numbers of plasma cells). Histopathology of the tympanic bullae and lungs was graded from 1 (minimal to no lesions) to 5 (most severe lesions), and lungs were also gra ded with respect to the degree of lymphoid infiltration and hyperplasia of bronchial associated lymphoid tissue from 1 (minimal to no lymphoid hyperplasia) to 4 (marked and widespread lymphoid hyperplasia). Microbiology All mycoplasma cultures were perform containing 2.25% (wt/vol) Mycoplasma broth base (Frey) (BD Diagnostic Systems, Sparks, MD), 0.02% (wt/vol) DNA from herring sperm, 20% (vol/vol) horse serum, 10% (vol/vol) fresh yeast extract, 0.5% (wt/vol) gluco se and supplemented with 100,000 U/l each of penicillin G and polymixin B and 65 mg/l of cefoperazone, with the final pH adjusted to 7.6 to 7.8. For culture of blood samples, 5 ml of blood collected into tubes containing sodium citrate was inoculated into 45 ml of broth within 15 min after collection and subcultured onto agar at the time of broth inoculation and after 48 hr incubation at 37C. Swabs were streaked on agar plates within 30 min after collection and also used to inoculate broth, from which ten fold serial dilutions were plated (20 l) in duplicate on agar. When present, the volume of exudate aspirated from the tympanic bulla was measured, a specified volume inoculated into broth and serial dilutions plated as described. Spinal fluid was inoculat ed into broth and subcultured onto agar plates. Tissues collected for quantitative culture were weighed and minced in broth from which ten fold serial dilutions were plated (20 l) in duplicate on agar. Plates were incubated in 5% CO 2 at 37C and examine d at 2, 3, 5, 7 and 10 days for the presence of mycoplasmal colonies. Colonies with typical morphology were classified as positive

PAGE 161

161 pending polymerase chain reaction (PCR) confirmation. Two to eight single isolated colonies were inoculated into separate ali quots of broth, incubated for 24 hours at 37C, and then stored at 80C. In addition, when plates were positive for mycoplasmal growth, the original broth dilutions were subcultured on agar to check viability and stored at 80C. Isolates were identified as M. bovis based on PCR of the 16S rRNA gene (Mattsson et al ., 1991). DNA fingerprinting by insertion sequence (IS) typing was performed (see below) to ensure that recovered isolates originated from the F1 strain used for inoculation. Results for streaked plates were recorded as positive or negative for mycoplasmal growth. Semiquantitative culture results for swabbed tissues were expressed as Log 10 of the highest dilution that yielded mycoplasmal colonies. When only the undiluted broth was positive, results were assigned a Log 10 value of 0.5. Quantitative culture results were expressed as CFU/g of tissue or CFU/ml of exudate. Whole lung culture data represents an average of the six standardized lung sites sampled and was calculated by summing the CFU isolate d from all lung sites and dividing this by the total weight of lung tissue sampled. In addition to culturing for mycoplasma, swabs of the nares, palatine tonsils, trachea, lungs and tympanic bullae were processed using routine clinical bacteriological meth ods to identify other potential bacterial pathogens of the respiratory tract. Appropriate samples were submitted to the Florida State Diagnostic Laboratory for diagnosis of bovine respiratory syncytial virus, bovine viral diarrhea virus, infectious bovine rhinotracheitis virus, and parainfluenza 3 virus. Insertion Sequence Typing Stored M. bovis broth cultures representing a single colony expansion from each positive site were thawed at room temperature. The inoculating isolate ( M. bovis F1) was used as th e reference for hybridization profiles and the PG45 type strain of M. bovis used for probe

PAGE 162

162 synthesis. Cells were harvested by centrifugation at 1500 g for 30 min, rinsed twice with sterile PBS and centrifuged at 10,000 g for 15 min. Genomic DNA extract ions were performed using protocol. DNA was quantified spectrophotometrically and stored at 80C. Probes for the insertion sequences IS Mbov 2 and IS Mbov 3 (Miles et al 2005) were synthesized by PCR in a 50 L reaction mixture which contained a final concentration of 40 ng of M. bovis PG45 template DNA, 0.8 M each of the forward and reverse primers, 1.5 mM MgCl 2 200 M of each dNTP with 70 M DIG 11 dUTP nucleotide mi x and 3.5 U Taq enzyme (PCR DIG Probe Synthesis Kit, Roche Applied Science, Penzberg, Germany). The primers used were IS Mbov 2 F (GGTAAATCTAGTTCGAAGATG), IS Mbov 2 R (GGGTAAACAGAACTTGCAAC), IS Mbov 3 F (CAGGAAATGTTACTGATTCA) and IS Mbov 3 R (TTGTTTGCTTCCAGCTTTCA) (Miles et al ., 2005). PCR conditions for probe synthesis were 3 min denaturation at 95C followed by 30 cycles of denaturation for 30 sec at 95, annealing for 30 sec at 55C for IS Mbov 2 or 50C for IS Mbov 3, extension for 1 min at 68C, and a 5 min final extension at 68C. Genomic DNA (4.5 to 5 g) was digested with 20 U Eco RI (New England Bio Labs, Inc., Ipswich, MA) overnight at 37C in a final volume of 30 L. The resulting fragments were separated on 0.8% agarose gel by electrophoresis at 20 V for 18 to 20 hr. The ensuing gel was depurinated and denatured then transferred to a nylon membrane (Nytran SPC, pore size 0.45 m, Whatman, Inc., Florham Park NJ) using a vacuum blotting apparatus for 90 min Rad Lab oratories, Inc., Hercules, CA). After transfer, the membrane was probed overnight at 65C. The IS Mbov 2 probe was diluted to 1.5 g/ml of hybridization buffer (DIG Easy Hyb, Roche Applied Science, Penzberg, Germany)

PAGE 163

163 per 100 cm 2 membrane and the IS Mbov 3 prob e was diluted to 2.0 g/ml of hybridization buffer per 100 cm 2 membrane. After probing, the membrane was washed twice with low stringency buffer (2X NaCl sodium citrate [SSC], 0.1% sodium dodecyl sulfate [SDS]) at room temperature for 5 min with shaking an d twice with high stringency buffer (0.5X SSC, 0.1% SDS) at 65C for 15 min with shaking. Blocking, washing and detection were performed using DIG Wash and (Roche Appli ed Science, Penzberg, Germany). Hybridization profiles were recorded digitally (FluorChem 8900, Alpha Innotech, San Leandro, CA) and examined for differences in banding patterns between the F1 isolate used for inoculation and isolates recovered from tissue s at necropsy. The ELISA Procedure Blood samples were allowed to clot after collection, and then serum was harvested by centrifugation and stored at 80C. Serum end point titers of M. bovis specific IgG were determined using ELISA. Whole cell lysate antig en (Schumacher et al ., 1993) was prepared from a 1 liter culture of M. bovis type strain PG45 grown at 37 C in Frey's broth. The protein concentration was determined using a colorimetric assay (Bio Rad, Hercules, CA) and adjusted to 100 g/ml. The antigen was stored in aliquots at 80 C and thawed at room temperature when required. The ELISA procedure was optimized using standard methodology. Microtiter plates (Maxisorb F96, Nunc, Kamstrup, Denmark) were coated with 20 g per well of antigen in 0.01 M sodiu m phosphate buffer (pH 7.2) containing 0.15 M NaCl and (wt./vol.) NaN 3 (PBS/A), and incubated overnight at 4 C. Plates were then washed three times with PBS/A containing 0.05% (vol./vol.) Tween 20 (PBS/T) using an automated plate washer (ELx405 Auto Plate Washer, BioTek Instruments, Inc., Winooski, VT), blocked with 300 l per well of blocking

PAGE 164

164 buffer (PBS/T containing 1% [wt./vol.] egg albumin), and stored at 4 C for a minimum of 24 hr or until needed. Two fold serial dilutions of serum were made in blockin g buffer and 50 l of each dilution added to duplicate wells; plates were incubated at room temperature for 1 hr. The highest serum dilution tested was 1:8,196. Plates were washed as described above and 50 l of goat anti bovine IgG conjugated to alkaline phosphatase (Bethyl Laboratories Inc., Montgomery, TX) and diluted to 1:1,000 in blocking buffer was added to each well. Plates were incubated at room temperature for 2 hr and then washed as described above. 100 l of 0.1% (wt./vol.) p nitrophenol phospha te was added to each well and plates incubated in the dark at room temperature for 1 hr. The optical density (OD) in each well was read at a wavelength of 405 nm using an automated plate reader (ELx808 Ultra Microplate Reader, BioTek Instruments, Inc., Win ooski, VT). For each microtiter plate, the blank was the mean value for two wells coated with antigen and incubated with the conjugated secondary antibody and substrate only. The blank OD value was subtracted from each sample well, and mean values for each pair of duplicate tests calculated. Two fold serial dilutions of a pool of sera from 20 calves with naturally occurring mycoplasmal disease and high M. bovis specific IgG titers were included on each plate as a positive control, as well as a 1:2 dilution of a negative control pool of serum collected from the same 20 calves prior to ingestion of their first colostrum meal. The cutoff for a positive titer was the average OD value (minus the blank) for the negative control sera plus two standard deviations, e stablished over ten assay runs. The highest dilution of the test serum that gave an average OD value higher than the cutoff was defined as the titer for that sample. Within batch and between batch assay variability was assessed by using the Youden plot gra phic method (Jeffcoate, 1982). The ELISA values obtained for the lowest, middle and highest dilution of the

PAGE 165

165 control serum included on each plate were used to establish target values and control limits to be used for monitoring the consistency of the assay (ten batches). The values obtained at the beginning of a series of assays were plotted against the values obtained for the same standards at the end of the series. If values for the pooled sera deviated more than 10% from target values, the assay was repea ted. Statistical Analysis Continuous variables (total serum protein concentrations, bodyweight, % of lung with macroscopic lesions, serum IgG titers) were compared between groups using ANOVA or repeated measures ANOVA (IgG titers). Tukey's tests were appli ed to post hoc comparisons. Ordinal variables (lesion scores, daily clinical scores) were analyzed using Kruskal Wallace ANOVA or Friedman Test, as appropriate. Correlations between numbers of mycoplasmas isolated at various body sites were examined using Pearson's correlation analyses. A P value of 0.05 or less was considered statistically significant, with the exception of the overall significance levels in ANOVA, where a P value of 0.1 was considered significant. Preliminary analyses performed on data fr om the oral and transtracheal control groups determined that there were no statistical differences between the 2 groups for any outcome variable. Data from the 2 control groups were then pooled for the main analyses to increase statistical power. Analyses were performed using commercial statistical analyses packages (SPSS 12.0, SPSS Inc, Chicago IL and SAS/STAT, SAS institute, Inc., Cary NC). Results Oral Inoculation of Calves and Development of Clinical Disease Oral inoculation of calves resulted in develo pment of clinical disease. Prior to infection, calves were monitored for their health and serology. Post colostral total serum protein concentrations, pre and post colostral M. bovis specific serum antibody titers, and bodyweight

PAGE 166

166 on day 0 did not vary bet ween infected and control calves (data not shown). Most calves were treated with oral electrolytes for uncomplicated calf diarrhea during the pre enrollment period, and there was no significant difference in the number of calves treated among groups. No my coplasmas or other respiratory tract pathogens were isolated from calves prior to enrollment, and the calves were in good health at the time of infection. Eight calves were inoculated orally, and five calves were inoculated transtracheally with M. bovis F1 As controls, four calves per route were inoculated with sterile carrier (Frey's broth or sterile saline for the orally or transtracheally inoculated groups, respectively). The clinical status of each calf was monitored twice a day. Three of the eight (37 %) calves infected by the oral route developed clinical signs of otitis media. These clinical signs were first observed on 7, 9 or 13 days post infection, depending on the individual calf. Affected calves developed unilateral or bilateral ear droops, occas ional head shaking and were mildly depressed or lethargic. Two of the three calves developed ptosis. Calves with otitis media were febrile (rectal temperature > 103 F) on the day prior to ( n= 2) or on the day ( n= 1) that an ear droop was first observed. In c ontrast to orally inoculated calves, c linical signs of otitis media were not observed in any of the calves inoculated by the transtracheal route. Six of the eight (75%) calves infected by the oral route exhibited clinical signs of LRT disease. In most case s, clinical signs were transient and mild. However, two of the calves with otitis media developed more serious LRT disease (mucopurulent nasal discharge, coughing, intermittent tachypnea and dyspnea and persistent abnormalities of breath sounds on ausculta tion), and one was euthanized at 10 days post inoculation due to increasing severity of clinical disease including persistent fever. None of the orally inoculated control calves exhibited clinical signs of respiratory disease. Within the transtracheally in oculated group, four of the five

PAGE 167

167 infected calves and two of the four control calves exhibited transient tachypnea and/or abnormal breath sounds on auscultation in the first few days after inoculation. During the second week of the study, control calves wer e all clinically normal, whereas three of five (60%) transtracheally infected calves exhibited mild and transient clinical signs of respiratory disease (tachypnea, abnormal breath sounds on auscultation, mucopurulent nasal discharge). Clinical signs of art hritis were not observed in calves inoculated by oral or transtracheal routes. There was no statistically significant difference among groups in median daily clinical scores. However, calves that received M. bovis via the oral route tended ( P = 0.06) to ha ve more days when a daily clinical score of > 2 was present than transtracheally inoculated or control calves (Figure 3 1). Colonization of the Upper Respiratory Tract The URT, and in particular, the tonsils, was a major site of colonization by M. bovis Mycoplasma bovis was isolated from both palatine and pharyngeal tonsils of all inoculated calves at necropsy (Figure 3 2A and B). Colonization at these sites tended to be heavier in orally than transtracheally inoculated calves. Similarly, M. bovis was iso lated from the eustachian tubes of calves inoculated by either route, but the CFU recovered from the eustachian tubes were up to 10 5 times higher in orally than transtracheally inoculated calves (Figure 3 2C and D). Eustachian tube colonization was bilater al in all cases except one. Large numbers (10 5 to 10 9 CFU/ml) of M. bovis were isolated from both tympanic bullae of all three calves with clinical signs of otitis media (Figure 3 2C). Once M. bovis colonization of the bullae occurred, the CFU levels were the highest achieved at any body site. M. bovis was not isolated from the bullae of orally inoculated calves without clinical signs of otitis media or from any of the transtracheally inoculated calves. In addition, M. bovis was isolated from the MRPLN of a ll except one of the infected calves (Figure 3 2A and B). It is notable that despite heavy colonization of tonsils, M. bovis was only isolated from nasal swabs of two calves over the complete course of the study (Figure 3 2A and

PAGE 168

168 B), and then only on day 14 post infection. No mycoplasmas were recovered from control calves, nor were other bacterial or viral pathogens of the respiratory tract isolated from any calf. All mycoplasmal isolates recovered from infected calves were confirmed to be M. bovis by PCR se quencing of the 16S rRNA gene (data not shown) and had IS hybridization profiles consistent with that of the F1 isolate used for inoculation (data not shown). Isolation of M. bovis from Lungs and Clinical Signs of Respiratory Disease Isolation of M. bov is from the lungs was associated with clinical signs of respiratory disease in calves inoculated by the oral route. Four of the eight (50%) orally inoculated calves were colonized in at least one LRT site (trachea, bronchi, TBLN and/or lung) at necropsy (F igure 3 2E to H). However, colonization was most extensive in the two calves that had more severe clinical signs of respiratory disease, and importantly, these were the only orally inoculated calves in which M. bovis was isolated from the lungs (Figure 3 2 G and H). In contrast, M. bovis was isolated from the lungs of four of five (80%) transtracheally inoculated calves (Figure 3 2G and H), but these calves only exhibited transient and mild clinical signs of respiratory disease. M. bovis appeared to have bee n cleared from the LRT in one of the transtracheally inoculated calves and was only recovered from URT sites (both tonsil sites and the MRPLN). Colonization of the Tonsil and Development of Disease The level of tonsil colonization was associated with the d evelopment of disease. The Log 10 CFU of M. bovis isolated from the pharyngeal tonsils was positively correlated with that isolated from both the left (R 2 = 0.74, P = 0.004) and right (R 2 = 0.72, P = 0.005) eustachian tubes (Figure 3 3). In addition, the se verity of lesions in the eustachian tube and in the tympanic bullae was positively correlated with the number of mycoplasma isolated from the same site (J. Powe, F. P. Maunsell, J. W. Simecka and M. B. Brown, submitted for publication). Similarly,

PAGE 169

169 there wa s a trend ( P = 0.11) for the number of M. bovis isolated from the palatine tonsils to be positively correlated with that isolated from the lungs (data not shown). Gross and Histopathologic Lesions Experimentally inoculated calves had gross and/or histopat hologic lesions typical of M. bovis infection. In nasal passages, there was little evidence of inflammation or other pathologies in either orally or transtracheally inoculated calves, and histopathologic scores of nasal passages were no different than thos e from control calves. There was also no difference among groups in histopathologic scores of pharyngeal tonsils. Histopathologic scores of the palatine tonsils of infected calves tended to be higher than those of control calves, but these differences were not statistically significant ( P = 0.1). All three calves with clinical signs of otitis media had bilateral suppurative otitis media at necropsy (Figure 3 4). There was an obvious purulent discharge from the nasopharyngeal opening of the eustachian tube from one of these calves, but other gross abnormalities of the URT were not observed. As indicated above, these calves with otitis media were inoculated orally with M. bovis and the pathology is fully characterized in a companion paper (J. Powe, F. P. Mau nsell, J. W. Simecka and M. B. Brown, submitted for publication) Importantly, there was no evidence of eustachitis or middle ear disease in transtracheally inoculated calves. There were histopathologic changes in the lymph nodes draining the URT of calves after mycoplasma inoculation. In orally inoculated calves, histopathologic scores for both MRPLN and LPRLN were higher ( P < 0.05) than those of control calves (Figure 3 5A and B). Lymphoid hyperplasia, edema and focal areas of necrosis and suppurative lym phadenitis were observed in these lymph nodes (Figure 3 6). Transtracheally infected calves tended to have higher scores than control calves (Figure 3 5A and B) but these differences were not statistically significant. As part of the overall histopathologi c score, lymphoid tissues were graded based on the number

PAGE 170

170 of plasma cells present. Plasma cell subscores for MRPLN and LRPLN were significantly higher in infected calves when compared with control calves, regardless of the route of inoculation (Figure 3 5C and D). In the LRT, neither orally nor transtracheally inoculated calves had significant gross or histopathologic lesions in tracheal or primary bronchial mucosa. Focal areas of consolidation and pneumonic lesions were observed in the lungs of four of eig ht (50%) orally inoculated and four of five (80%) transtracheally inoculated calves (Figure 3 7), although there was no statistically significant difference in the percentage of visibly affected lung among groups. In contrast, histopathologic lung lesion s cores differed among groups ( P < 0.05); calves infected by the transtracheal route had higher lung lesion scores when compared with control calves (Figure 3 8A). Calves from which M. bovis was isolated from the lung had focal areas of suppurative or non su ppurative broncho or bronchointerstitial pneumonia, sometimes with foci of coagulative necrosis surrounded by a mixed inflammatory cell population (Figure 3 8D). These calves also had areas of bronchiolitis with peribronchial infiltration of lymphocytes, plasma cells and macrophages, often accompanied by suppurative bronchial exudates. The bronchiolar changes were mostly limited to small airways. Subscores for lymphoid hyperplasia in lungs were significantly higher ( P < 0.05) in both orally and transtrache ally inoculated calves than in control calves (Figure 3 8B). In contrast to the findings for the lymph nodes in the URT, histopathological scores or plasma cell subscores for tracheobronchial lymph nodes did not vary significantly among groups (data not sh own). Immunoglobulin Response Orally infected calves exhibited a M. bovis specific serum IgG response. It is important to note that some M. bovis specific Ig was passively transferred via the colostrum substitute fed to the calves, and, therefore colostral derived antibody to M. bovis was detected at day 0. While

PAGE 171

171 the titer of passively acquired serum IgG in control calves either remained static or declined over the study period, the titer of M. bovis specific serum IgG in infected calves remained stable or increased (Figure 3 9), indicating an active immune response to infection in these animals. When the fold change in M. bovis specific serum antibody titers between days 0 and 14 of the study were compared among groups, calves in the orally infected group h ad a significant fold increase in IgG ( P = 0.049), compared with the control group. Calves infected by the oral route exhibited a stronger serum IgG response than calves infected by the transtracheal route, although there were individual calf variations. Discussion We have definitively demonstrated that bucket nursing of milk containing M. bovis does result in colonization of the URT of young calves and can cause clinical disease. Despite the fact that ingestion of M. bovis contaminated milk or colostrum i s thought to be a major route of natural infection in young calves (Bennett and Jasper, 1977c; Walz et al ., 1997; Brown et al ., 1998a; Butler et al ., 2000), experimental infection by this route has not previously been reported. Other investigators have rep orted that calves allowed to nurse cows with M. bovis mastitis develop URT colonization and/or M. bovis associated clinical disease (Stalheim and Page, 1975; Bennett and Jasper, 1977c), and colonization of the URT by M. bovis occurs more frequently in calv es fed infected milk than in those fed uninfected milk (Bennett and Jasper, 1977c) Reports of a strong temporal association between the feeding of milk containing M. bovis and disease outbreaks have added support to the hypothesis that contaminated milk i s a means by which infection is introduced into a group of calves (Dechant and Donovan, 1995; Walz et al ., 1997), although direct contact with infected animals and secondary transmission through respiratory aerosols or fomites are also likely to play a sig nificant role in calf to calf spread. Because our model mimics an important natural route of M. bovis infection, it will facilitate studies of host

PAGE 172

172 and pathogen related events that are relevant to natural infection in young calves, especially those events involved in colonization of the URT and dissemination from the URT to the LRT and/or middle ear. In addition, experimental verification that calves fed contaminated milk do become colonized with M. bovis lends support to control measures aimed at eliminati ng M. bovis contaminated milk and colostrum from calf diets. Using the oral route of inoculation, our model resulted in colonization of the eustachian tubes with M. bovis in seven of eight inoculated calves, with otitis media developing in 37% of calves by 2 weeks post infection. The clinical signs of otitis media observed in naturally infected calves include fever, anorexia, listlessness, ear pain evidenced by head shaking and scratching at or rubbing ears, epiphora, and ear droop and other signs of facial nerve paralysis (Walz et al ., 1997; Brown et al ., 1998a; Maeda et al ., 2003; Francoz et al ., 2004). In some cases, purulent discharge from the ear canal is observed following rupture of the tympanic membrane (Walz et al ., 1997; Francoz et al ., 2004). Seco ndary complications such as otitis interna (Lamm et al ., 2004) and meningitis (Francoz et al ., 2004) can occur. In addition, calves with M. bovis induced otitis media often have concurrent pneumonia (Walz et al ., 1997; Maeda et al ., 2003; Lamm et al ., 2004 ). With the exception of rupture of the tympanic membrane and secondary complications of otitis media, all of the clinical signs reported in natural infections were observed in our experimentally infected animals, providing support for the validity of the oral route of infection in our model system. The more severe sequelae, which were not observed in calves in this study, are most frequently associated with chronic otitis media, and under our protocol, calves were euthanized prior to reaching this stage of disease. Otitis media in our experimentally infected calves was shown to be histopathologically similar to natural disease and was likely due to an ascending infection through the eustachian tubes (J. Powe, F. P. Maunsell,

PAGE 173

173 J. W. Simecka and M. B. Brown, s ubmitted for publication). Thus, the clinical signs and pathology observed in our study is consistent with that described for naturally occurring M. bovis induced otitis media in young calves. Clinical signs of LRT disease were observed in six of eight cal ves inoculated by the oral route. Although clinical signs were mainly transient and mild, two calves developed more serious LRT disease and these were the only calves from which M. bovis was recovered from the lung at necropsy. Histopathological lesions in these calves were consistent with other reports of naturally occurring and experimentally induced M. bovis pneumonia (Rodriguez et al ., 1996; Maeda et al ., 2003). Interestingly, there was little gross or histopathological evidence of tracheitis or lesions involving large bronchi in inoculated calves, even when M. bovis was recovered from these sites. Large airway lesions are reported to accompany field cases of mycoplasmal pneumonia (Dungworth, 1993), although it may be that these lesions do not develop un til later in the course of disease, that they require the presence of other pathogens, or that they are not a prominent feature of M. bovis infection in this age animal. Variable disease expression is a key feature of mycoplasmal infections in general (Ros engarten et al ., 2000), including M. bovis (Gourlay and Houghton, 1985; Allen et al ., 1991). Consistent with this feature of the naturally occurring disease, 37% of the orally inoculated calves in our model developed clinical otitis media and 75% exhibited mild, transient clinical signs of respiratory disease. Although inoculation of a larger dose of M. bovis may have resulted in increased severity or incidence of clinical disease and/or pathology, we selected our inoculum dose to be biologically relevant i n order to mimic naturally occurring disease as closely as possible. The dose utilized in our model was a total of 2.9 2.5 x 10 10 CFU over 3 milk feedings, which equated to approximately 10 6 CFU/ml of milk replacer. Concentrations of

PAGE 174

174 M. bovis in mammary secretions of infected cows vary markedly, but are frequently 10 6 CFU/ml or greater (Jasper, 1981; Fox and Gay, 1993). In pilot studies, we found that repeated exposure to 10 6 CFU of M. bovis per ml of milk was necessary to achieve colonization of the URT in all inoculated calves (data not shown). Variation in disease expression may also have been influenced by genetic variability among calves; this is a potential disadvantage of using an outbred host in an experimental infection model. However, there are currently no suitable alternative inbred laboratory animals in which to model M. bovis infection of young calves. An additional factor that is likely to have contributed to the variable disease expression observed in our study is that calves were euthanize d on or prior to 14 days after infection. This infection period was chosen because we are primarily interested in studying the immunological events that occur early in infection. However, several calves without otitis media did have colonization of the eus tachian tubes at necropsy, but with lower CFU of M. bovis recovered than those with otitis media. Given the direct correlation between CFU in tonsils, eustachian tubes and the bullae, it is likely that a longer infection period would result in increased nu mbers of M. bovis in these sites with a concomitant increased rate of otitis media in this model. Increasing the length of the infection period may also result in an increase in the rate and severity of LRT disease, although further studies would be requir ed to determine this. The URT, and in particular, the tonsilar mucosa was an important site of colonization following oral inoculation of M. bovis in this study. In fact, both the palatine and pharyngeal tonsils of all inoculated calves were colonized with M. bovis at the time of necropsy. Our findings are consistent with studies of naturally occurring M. bovis infection in calves that have suggested that the URT is the initial site of colonization (Bennett and Jasper, 1977c; Brys et al .,

PAGE 175

175 1989). We found th at the number of M. bovis recovered from the tonsils was correlated with the presence of clinical disease. It is intriguing to hypothesize that control strategies specifically aimed at limiting growth of M. bovis in tonsils may be effective in preventing c linical disease, and this oral inoculation model could be applied to evaluate such potential control measures. Additionally, we found that the tonsils of infected calves can be heavily colonized with M bovis without the microorganism being recovered from deep nasal swabs, suggesting that, although more technically challenging to obtain, tonsil swabs may be a better choice for determining the true M. bovis colonization status of an animal. Our tonsil swabs were obtained at necropsy which eliminated the diff iculties of obtaining good access to the sampling site; further studies will be required in live animals of various ages to determine the usefulness of tonsil swabs for determining the M. bovis status of an animal in a clinical setting. Once colonization o f the URT occurs, a variety of factors are likely to influence dissemination from this site and development of disease; these may include virulence factors expressed in vivo by M. bovis the host immune response, the frequency and dose of exposure, the pre sence of other pathogens and various environmental factors. The use of our model to obtain a better understanding of these factors may lead to improved preventative strategies against this disease. Calves inoculated with M. bovis by either the oral or tra nstracheal routes exhibited local and systemic immune responses to infection. Both transtracheally and orally inoculated calves had increased lymphoid hyperplasia in the lymph nodes of the URT and in the lungs when compared with control calves, consistent with an active response to infection. Calves inoculated by the oral route had a higher serum IgG response than calves infected by the transtracheal route, despite the presence of significant histopathological lung lesions in the latter group. Although ther e did appear to be a trend for serum IgG titers to M. bovis to increase over the 14 day

PAGE 176

176 infection period in transtracheally inoculated calves (Figure 3 9), they were not statistically different from the control group. The difference in IgG response between orally and transtracheally inoculated calves may reflect differences in inoculation dose between the two groups, or could indicate that a M. bovis infection of the URT stimulates a stronger humoral response than one which originates primarily in the LRT. Calves infected transtracheally did become colonized in the URT, presumably by ciliary transport of organisms up the trachea. However, the numbers of M. bovis recovered from URT sites were usually fewer than for orally inoculated calves, and transtracheal ly inoculated calves did not develop otitis media. These findings indicate that oral inoculation is better suited to study of events occurring during M. bovis infection of the URT and middle ear than a model where M. bovis is inoculated directly into the L RT. It was also interesting that transtracheally inoculated calves had significantly greater lung lesion scores than orally inoculated calves, despite exhibiting only mild and transient clinical signs of LRT disease. M. bovis was recovered from the lung of four of the five transtracheally inoculated calves and only two of the eight orally inoculated calves, suggesting that if lung colonization within 14 days of inoculation is the goal of a particular experimental inoculation procedure then transtracheal rou te may be a better choice. However, the host and pathogen events involved in dissemination from URT sites to the lung are likely to be important in naturally occurring disease and may not be present in a model where M. bovis is inoculated directly into the LRT. In summary, we have developed a reproducible model of M. bovis infection of the URT that closely mimics naturally occurring M. bovis infections in young (pre weaned) calves. There are important differences between very young calves and older cattle i n terms of their immune environment and the occurrence of middle ear infections. Therefore, an infection model that uses

PAGE 177

177 a clinically relevant age group, especially when considering events leading to middle ear infection, is likely to be critical when stud ying this emerging disease problem. Our study also has direct clinical relevance by definitively demonstrating for the first time that calves consistently become infected when they ingest M. bovis contaminated milk, and that calves can be colonized heavily in the tonsils without M. bovis being detected on nasal swabs. The oral inoculation model that we have presented here is particularly suited to the study of host pathogen interactions during initial colonization of the tonsils, expansion of infection and dissemination to the LRT and middle ear. In addition, the model could be used to investigate potential new preventative or control strategies, especially those aimed at limiting colonization of the tonsils and/or spread to the middle ear.

PAGE 178

178 Figure 3 1. Number of days that calves had a daily clinical score of > 2. Calves were followed for 14 days post inoculation or until they reached criteria for euthanasia (*One calf was euthanized at 10 days post inoculation). The maximum dai ly clinical score was 10. Calves were inoculated with sterile carrier (controls, n =8) or with Mycoplasma bovis by oral ( n =8) or transtracheal ( n =5) routes.

PAGE 179

179 Figure 3 2. The number of M ycoplasma bovis recovered at necropsy A) M. bovis recovered from u pper respiratory tract sites (URT) for calves inoculated by the oral ( n= 8) route B) M. bovis recovered from URT sites for calves inoculated by the transtracheal ( n = 5) route. C) M. bovis recovered from middle ear sites for calv es inoculated by the oral route D) M. bovis recovered from middle ear sites for calves inoculated by the transtracheal route E) M. bovis recovered from lower respiratory tract (LRT) sites of calves inoculated by the oral route F) M. bovis recovered from LRT sites of calves inoculated by the transtracheal route. G) M. bovis recovered from the lungs of calves in the oral and transtracheal inoculation groups. H) T he number of lung sites from which M. bovis was recovered out of a total of 6 standard sites wh ich were cultured (1 site per lung lobe) for calves in the oral and transtracheal inoculation groups Semiquantitative culture results are expressed as Log 10 of the highest dilution that yielded mycoplasmal colonies. When only the undiluted broth was posit ive, results were assigned a L og 10 value of 0.5. Quantitative culture results are expressed as colony forming units (CFU) /g of tissue (lung) or CFU /ml of exudate (tympanic bulla e ). No mycoplasmas were recovered from control calves (data not shown). Pha Ton sil = pharyngeal tonsil, A B C D

PAGE 180

180 Figure 3 2. (continued). Pal Tonsil = palatine tonsil, MRPLN=medial retropharyngeal lymph node s LRPLN = lateral retropharyngeal lymph nodes, L ET = left eustachian tube, R ET = right eustachian t ube, L Bulla = left tympanic bulla, R Bulla = right tympanic bulla, L Bronchus = left primary bronchus, R Bronchus = right primary bronchus, TBLN = tracheobronchial lymph nodes, No. = number, Mb = Mycoplasma bovis G H E F

PAGE 181

181 Figure 3 3. Relationship between the number of M ycoplasma bovis recovered from the left and right eustachian tubes (L ET and R ET, respectively) and pharyngeal tonsils in calves inoculated with M bovis by either the oral ( n =8) or transtracheal ( n =5) routes Culture results are expressed as Log 10 of the highest dilution that yielded mycoplasmal colonies. When only the undiluted broth was positive, results were assigned a Log 10 value of 0.5. No mycoplasmas were recovered from carrier inoculated control calves (data no t shown).

PAGE 182

182 Figure 3 4 Macroscopic lesions of otitis media in calves orally inoculated with Mycoplasma bovis A) Ventral aspect of the t ympan ic bulla reflected to reveal exudate. B) Caseous exudate within a sag ittal section of the tympanic bulla after tissue fixation C) Syringe containing suppu rative exudat e aspirated from the tympanic bulla A B C

PAGE 183

183 Figure 3 5. Histopathology of retropharyngeal lymph nodes from control calves ( n= 8) o r calves inoculated with M ycoplasma bovis by oral ( n= 8) or transtracheal ( n= 5 ) route s. A) Histopathological lesion scores of medial retropharyngeal lymph nodes (MRPLN). B) Histopathological lesion scores of lateral retropharyngeal lymph nodes (LRPLN). C) P lasma cell subscores of MRPLN. D) Plasma cell subscores of LRPLN. Samples were collected at necropsy (14 days post infection except for one calf inoculated with M bovis by the oral route which had to be euthanized at 10 days post infection ). Tissues were graded on a scale from 1 (minimal or no lesions or lymphoid hyperplasia) to 3 (severe lesions and/or marked lymphoid hyperplasia) and from 1 (few plasma cells) to 4 (large numbers of plasma cells) for histopathologic scores and plasma cell subscores, respe ctively. Data are represented as scores for individual calves with the median value for the group indicated by a horizontal line. ab Superscript letters at the top of each data column indicate significant ( P < 0.05) differences between groups. A B C D

PAGE 184

184 Figure 3 6. Representative histopathological findings in retropharyngeal lymph nodes of calves inoculated with sterile carrier (controls) or with M ycoplasma bovis by oral or transtracheal routes. A) Medial retropharyngeal lymph node of an infected calf. Scattered small accumulations of neutrophils can be seen in this region of cortex, indicative of focal lymphadenitis. Magnification 60. B) Lateral retropharyngeal lymph node (LRPLN) of an infected calf with lymphoid hyperplasia. Magnification 4. C) LRPLN of a control calf. Medullary sinuses contain scattered small lymphocytes. Magnification 60. D) LRPLN of an infected calf. Medullary sinuses contain large numbers of plasma cells and small and large lymphocytes. Magnification 60 A B C D

PAGE 185

185 Figure 3 7 Representative macroscopic lung lesion in a calf experimentally infected with M ycoplasma bovis by the oral route

PAGE 186

186 Figure 3 8. Histopathological findings in the lungs of calves inoculated with sterile carrier (controls, n= 8) or with M ycoplasma bovis by oral ( n= 8) or transtracheal ( n= 5 ) route s. Samples were collected at necropsy (14 days post infection except for one calf inoculated with M bovis by the oral route which ha d to be euthanized at 10 days post infection ). A) Overall histopathological lesion scores. B) Subscores for lymphoid hyperplasia Data in A and B are represented as scores for individual calves with the median value indicated by a horizontal line. Tissues were graded on a scale from 1 (minimal or no lesions) to 5 (most severe lesions) and from 1 (no lymphoid hyperplasia) to 4 (marked lymphoid hyperplasia) for lesion scores and lymphoid hyperplasia subscores, respectively. ab Superscript letters indicate significant ( P < 0.05) differences between groups. C) Representative histopathologic appearance of a lung section with a lesion score of 1 (control calf). D) Representative histopathologic appearance of a lung section with a le sion score of 5 (orally inoculated calf from which M. bovis was recovered from the lung). Magnification 10. A B C D

PAGE 187

187 Figure 3 9. Geometric mean end point titers for Mycoplasma bovis specific serum IgG Calves were experimentally ino culated with sterile carrier ( n= 8, solid white bars) or with M bovis by the oral ( n= 8, solid black bars) or transtracheal ( n= 5, hatched bars) r outes. Geometric mean end point titers are shown at the time of inoculation (day 0) and at necropsy (14 days pos t infection, except for one calf inoculated with M. bovis by the oral route which was had to be euthanized at 10 days post infection)

PAGE 188

188 CHAPTER 4 IMMUNE RESPONSES IN THE RESPIRATORY TRAC T OF CALVES INFECTED WITH Mycoplasma bovis Introduction Mycoplasma bovis is an important contributor to morbidity and mortality in pre weaned dairy calves, causing respiratory disease, otitis media and art hritis as well as some other less common clinical manifestations (Stipkovits et al ., 2001 ; Nicholas and Ayling 2003; Francoz et al ., 2004; Lamm et al ., 2004 ). In addition, M. bovis causes chronic respiratory disease and arthritis in stocker and feeder cat tle (Haines et al ., 2001; Thomas et al ., 2002 a; Gagea et al ., 2006 ) and is a major mastitis pathogen in adult dairy cattle (Jasper 1981 ; Fox et al ., 2003; Gonzalez and Wilson 2003 ). One of the major routes of transmission of M. bovis to young calves is t hought to be ingestion of contaminated milk from cows with M. bovis mastitis (Stalheim and Page 1975; Pfutzner and Schimmel 1985; Walz et al ., 1997 ; Brown et al ., 1998a; Butler et al ., 2000 ). Calf to calf transmission via aerosols, fomites and direct con tact are also likely to be important (Jasper et al ., 1974; Bennett and Jasper 1977c; Tschopp et al ., 2001 ; Nicholas and Ayling 2003 ). Regardless of the route of exposure M. bovis first colonizes the upper respiratory tract (URT) (Bennett and Jasper, 197 7c; Pfutzner and Sachse 1996). Colonization often occurs very early in life; during some M. bovis associated disease outbreaks the majority of calves have been infected before 2 weeks of age (Brown et al ., 1998a; Stipkovits et al ., 2000). Infection may re main localized, or M. bovis can disseminate to the lower respiratory tract (LRT), middle ear, joints and/or other body sites where it may cause clinical disease. Factors controlling dissemination of M. bovis from the URT and clinical disease expression are unknown Immune responses to M. bovis infection s in young calves are poorly defined, despite the fact that immunologic responses probably have the greatest impact on the progression of

PAGE 189

189 mycoplasma l disease. Innate responses and mucosal antibody responses are critical for early clearance and control of mycoplasmal infections (Cartner et al ., 1998; Hickman Davis 2002) Eff ective killing of M. bovis by phagocytes requires the presence of mucosal antibody, particularly IgG 2 ( Howard, 1984 ). Early mucosal and s erum antibody responses in young calves infected with M. bovis are characterized by high levels of IgG 1 and little IgG 2 which is unlikely to be optimal for clearance of the infection (Howard et al ., 1980; Howard and Gourlay 1983; Howard et al ., 1987c; Va nden Bush and Rosenbusch 2003). Although antibody responses in M. bovis infections have been defined, there is only limited data describing the lymphocyte populations that contribute to adaptive immune responses in cattle, and virtually no data is availab le from neonatal calves. Advances in the development of vaccines or other strategies to prevent M. bovis associated disease in young dairy calves are likely require a better understanding of the immune response to M. bovis in this age group. In particular, the local immune responses generated at the site of M. bovis infection, as well as immune system events leading to dissemination of infection need to be defined in young calves. Adaptive immune responses can protect from mycoplasmal respiratory infection s (Taylor et al ., 1977; Cassell and Davis 1978; Whithear 1996 ; Thacker et al ., 2000; Kyriakis et al ., 2001; Dedieu et al ., 2005 ), including M. bovis (Howard et al ., 1987a; Nicholas et al ., 2002). However, immunity is often short lived, and animals are su sceptible to repeated infections ( Bennett and Jasper, 1978b ). Vaccination against M. bovis, M ycoplasma hyopneumoniae and M ycoplasma pulmonis confers only partial protection from disease, as organisms are easily isolated from challenged animals (Cassell and Davis 1978; Howard et al ., 1980; Thacker et al ., 2000 ; Nicholas et al ., 2002 ). Although adaptive responses that are present prior to challenge may afford some degree of protection, responses that develop after mycoplasmal infection often fail

PAGE 190

190 to clear th e organisms or prevent clinical disease. In fact, adaptive immune responses also contribute to the development of disease. Many mycoplasma l respiratory diseases are clearly immunopathologic. One of the consistent characteristics of respiratory disease cau sed by a wide variety of mycoplasmal species is the large accumulation of lymphoid ce lls along the respiratory tract, independent of the host species (Simecka et al ., 1992 ; Rodriguez et al ., 1996 ). Both B and T cells accumulate in lungs of affected calves (Howard et al ., 1987c ) in joints of calves with mycoplasmal arthritis (Gourlay et al ., 1976 ; Adegboye et al ., 1996; Gagea et al ., 2006 ) and in the mammary glands of cows with M. bovis mastitis (Bennett and Jasper, 1977a; Seffner and Pfutzner, 1980). These findings, together with similar findings in other host species (Jones and Simecka, 2003 ) suggest that lymphocyte activation and recruitment to sites of mycoplasmal infection are important in the development of pathology. Probably the best evidence for an immunopathologic response comes from studies in laboratory rats and mice infected with M pulmonis where the number of T cells recovered from the lungs is correlated with the severity of disease ( Davis et al ., 1982; Jones et al ., 2002 ). I mmunodeficient ( T cell deficient and severe combined immunodeficiency ) mice or T cell deficient hamsters develop significantly less severe mycoplasmal respiratory disease than their immunocompetent counterparts (Keystone et al ., 1980 ; Cartner et al ., 1998 ). Importantly, t hese changes in severity occur with little effect on the number of mycoplasmas in the lungs of infected animals. Thus, the severity of mycoplasma l respiratory diseases is increased by an intact T cell response A similar phenomenon may occur in M. bovis in fections; the accumulation of lymphocytes at sites of infection together with reports of e nhanced disease severity after immunization for M. bovis (Rosenbusch 1998 ; Bryson et al ., 1999 ) are certainly consistent with the development of immunopathologic res ponses.

PAGE 191

191 Specific T cell subsets have been associated with protective or immunopathologic responses in M. pulmonis respiratory disease. In mice infected with M. pulmonis CD4 + T cells are the major population contributing to lymphoid accumulations in the l ungs and lymphoid tissues of the LRT, and in vivo depletion of CD4 + T cells results in reduced severity of M pulmonis induced pulmonary lesions but has no effect on the numbers of mycoplasmas in the lungs (Jones et al ., 2002). Thus, CD4 + T cells appear to exacerbate the severity of mycoplasmal respiratory disease rather than resolving the infection. CD8 + T cells also contribute to the T cell responses in mycoplasmal respiratory infections, but to a lesser extent than CD4 + T cells (Jones et al ., 2002). CD8 + T cells appear to play an immunomodulatory role in mycoplasmal disease. Strains of rats that are resistant to M. pulmonis infections have a higher CD8 + :CD4 + T cell ratio in their lungs than do susceptible strains of rats ( Davis et al ., 1985 ). I n vivo depl etion of CD8 + T cells in mice results in a dramatic increase in the severity of mycoplasmal respiratory disease that is independent of mycoplasma numbers in the lungs. Thus CD8 + T cells play a significant role in modulating the inflammatory response agains t M. pulmonis lung infections. The interaction between CD8 + and CD4 + T cell s is thought to have a major impact on the outcome of M. pulmonis respiratory disease. The T cell subsets involved in protective and immunopathologic responses in the lungs of calv es with M. bovis infection have not been defined. However, in goat kids experimentally infected with M. bovis T cells predominated in lymphoid accumulations in the lungs, and CD4 + T cells were a greater contributor to these lesions than were CD8 + T cells (Rodriguez et al ., 2000). Although conducted in a different host species, the clinical disease and pathology were similar to that reported for M. bovis infection of calves. These findings suggest that activation of

PAGE 192

192 CD4 + T cells plays a prominent role in M. bovis infections, similar to findings reported for M. pulmonis disease in mice. T cells are a major component of the bovine lymphoid population and can comprise up to 40% of the circulating mononuclear cell population in young calves (Wilson et al ., 1 996; Kampen et al ., 2006) Distinct subpopulations of T cells are present in calves and differ in terms of their tissue distribution and function (Wyatt et al ., 1994; Wyatt et al ., 1996; Wilson et al ., 1998). The presence or absence of the surface m olec ule WC1 can be used to divide bovine T cells into two major subpopulations. WC1 + T cells are CD3 + but do not express CD2, CD4, or CD8 ( MacHugh et al ., 1997 ). B etween 6 5 and 90 % of circulating T cells are WC1 + ( Blumerman et al ., 2006; Kampen et al 2006) WC1 + T cells are also found in the white pulp of the spleen, outer cortex of peripheral lymph nodes, muc osal associated lymphoid tissue, epithelial layers of the gut and respiratory tract, and in skin ( Clevers et al ., 1990 ; Wilson et al ., 1999). I n contrast, WC1 T cells, which do express CD2 and CD8, represent a small percentage of the circulating T cell population ( MacHugh et al ., 1997 ), and a large percentage of the T cells in some tissues including the red pulp of the spleen and many m ucosal epithelial sites (Hedges et al ., 2003). T cells are thought to be important in early immune responses to a broad range of antigens, and distinct T cell subsets are likely to have unique functions in these immune responses (Pollock and Welsh, 2 002). In calves, WC1 + T cells contribute to early production of interferon during infection (Price et al ., 2006) and are the major T cell population recruited to sites of inflammation ( Wilson et al 2002 ). Although the role of T cells in M. bovis infections has not been determined, preliminary data suggests that T cells contribute to the pathogenesis of murine mycoplasmal respiratory disease (J.W. Simecka, personal communication).

PAGE 193

193 The broad, long term objective of our studies is to determine the immune and inflammatory responses that impact the pathogenesis of and foster protection from bovine mycoplasmal respiratory disease. Based on studies of mycoplasmal disease in laboratory rodents, we hypothesize that t he balance between beneficial and detr imental host responses during M. bovis respiratory disease is a function of distinct T cell populations. The primary objective of th e work presented here was to characterize the B and T lymphocyte populations generated in the URT and LRT of neonatal calves infected with M. bovis As described in Chapter 3, we have defined a model for M. bovis infection in young calves that uses feeding of M. bovis in milk as the means of inoculation This model mimics natural infection of calves and results in cons istent co lonization of the URT. Additionally, the model results in clinical disease expression in a subset of infected calves by 2 weeks post inoculation. In the current study, we use this model to define the local lymphocyte responses to M. bovis infection in youn g calves and compare these findings with calves infected by transtracheal inoculation. Materials and Methods Calves The calves used for this study have been described in Chapter 3. Briefly, mycoplasma free m ale Holstein calves were obtained at birth and we re fed two doses of a mycoplasma free colostrum replacement product ( Calves were maintained on non medicated milk replacer and had access to non medicated calf starter pellet s and fresh water at all times. All procedures were conducted with the approval of the University of Florida (UF) Instit utional Animal Care and Use Committee.

PAGE 194

194 Strain of M. bovis and Experimental Infection Mycoplasma bovis F1, confirmed as M. bovis by PCR and 16S rRNA sequence, is a field strain isolated from a lung abscess in a calf with severe fibrino purulent pneumonia and pleuritis. A second passage culture was stored in aliquots at 80 C and used for all infection studies. The overall infection design is shown in Figure 4 1 and t he details of the experimental infections are provided in Chapter 3. Briefly, ca lves were ex perimentally infected between 7 and 11 days of age with an oral dose of M. bovis F1 (total dose 2.9 2.5 10 10 colony forming units [ CFU ] infected group, n =8) or an identical volume of sterile modified Frey's broth (control group, n =4) at each of three consecutive feedings over a 24 hr period. The inoculum was added to milk replacer and bucket fed to calves. A second group of calves were infected via transtracheal inoculation of a single dose of 3 10 9 CFU of M. bovis F1 in 20 ml of PBS (infected group, n =5), or steril e PBS only (control group, n =4) A complete physical examination was performed daily and calves were scored as to the presence of clinical signs of mycoplasmal disease; the scoring system is described in Chapter 3. At 0, 3, and 7 days post infection, nasal swabs and blood were obtained for mycoplasmal culture. Serum was collected for determination of specific immunoglobulin (Ig) subclass response s to M. bovis Blood was collected for determination of T cell populations by immunofluorescent c ell staining, and additional blood was submitted to the UF Clinical Pathology Laboratory for total and differential leukocyte counts and measurement of plasma fibrinogen and total protein concentrations using standard methodology. Calves were euthanized at 14 days post infection with the exception of one orally infected calf that had to be euthanized 10 days post infection due to severity of clinical disease. At 14 days post infection, calves underwent full necropsy protocols The collection of samples

PAGE 195

195 for culture and histopathology, and the assessment of gross lesions were as described in Chapter 3. Histopathology of the e ustachian (auditory) tubes, nasal mucosa, tonsils, trachea, primary bronchi and lymph nodes was graded on a scale from 1 (minimal to no lesions and/or lymphoid hyperplasia) to 3 (most severe lesions and or lymphoid hyperplasia). In addition, tissues were graded with respect to numbers of plasma cells present on a scale from 1 (minimal or no plasma cells) to 4 (large numbers of plasma cells ). Histopathology of the tympanic bullae and lungs was graded from 1 (minimal to no lesions) to 5 (most severe lesions), and lungs were also graded with respect to the degree of lymphoid infiltration and hyperplasia of bronchial associated lymphoid tissue from 1 (minimal to no lymphoid hyperplasia) to 4 (marked and widespread lymphoid hyperplasia). All scoring was done in a blinded fashion and the coding system was broken for final data analysis. Preparation of Mononuclear Cells from Blood and Tissues To ex amine the changes in B and T lymphocyte populations in calves after infection with M. bovis mononuclear cells were isolated from blood samples collected at 0, 3, and 7 days post infection, and from lungs, tracheobronchial lymph nodes (TBLN) lateral retro pharyngeal lymph nodes ( LRPLN ), medial retropharyngeal lymph nodes (MRPLN) palatine tonsils, peripheral blood and spleen samples at necropsy Weights of whole organs and tissue samples were recorded prior to processing. H eparinized blood was diluted 1:1 i n Hank' s balanced salt solution (HBSS) and, using standard techniques p eripheral blood mononuclear cells (PBMC) were isolated by centrifug ation over Histopaque 1077 (Sigma Aldrich, St. Louis, MO). Lymph node and spleen mononuclear cells were isolated by t easing in HBSS, followed by centrifugation. Spleen preparations were treated with ACK (ammonium chloride potassium) lysis buffer (Quality Biological Inc., Gaithersburg, MD) to lyse erythrocytes then washed twice in HBSS. Pulmonary mononuclear cells were pr epared from at least 20 g of lung tissue pooled from two

PAGE 196

196 sites in each of the six lung lobe s Lung was finely chopped in RPMI 1640 medium containing 1% (vol./vol.) 1M Hepes solution (Sigma Aldrich, St. Louis, MO), 1% (vol./vol.) Cellgro Antibiotic Antimyco tic solution (Mediatech Inc., Herndon, VA), 1% (vol./vol.) L glutamine, 10% (vol./vol.) gamma free equine serum, 300 U/ml of DNase (Worthington Biochemical Corporation, Lakewood, NJ) and 300 U/ml Type IV collagenase (Worthington Biochemical Corporation, La kewood, NJ). Lung preparations were incubated for 1.5 hr at 37 C and were vigorously pipetted every 20 to 30 min during the incubation period. Cells were separated from debris by pouring through mesh and centrifuged over Histopaque 1077. Cells from the int erface were washed once in RPMI 1640 medium. Cells harvested from all sites were counted and re suspended in RPMI 1640 medium at the appropriate concentrations for the assays described below. Immunofluorescent Characterization of T Cell Populations The pro portions of CD3 + CD4 + T cells, CD3 + CD8 + T cells and WC1 + T cells in mononuclear cell populations were determined using immunofluorescent staining and flow cytometry. The monoclonal antibody (mAb) clones recognizing various bovine lymphocyte surface molec ules used were as follows: MM1A (CD3; VMRD Inc., Pullman, WA), CC88 (CD4; Serotech Inc., Raleigh, NC), CC63 (CD8; Serotech Inc., Raleigh, NC) and IL A29 (WC1; VMRD Inc., Pullman, WA). For detection, mAb were conjugated directly with fluorescein isothiocyan te (FITC) or phycoerythrin (PE) or were detected using a secondary FITC conjugated anti mouse Ig (Southern Biotechnology Associates Inc., Birmingham, AL). Monoclonal antibodies in staining buffer (PBS without calcium and magnesium containing 3% [vol./vol.] gamma free equine serum and 0.05% [vol./vol.] Tween 20) were added to 1 10 6 mononuclear cells per tube at a final concentration of 5 g/ml. Cells were incubated on ice for 30 min and

PAGE 197

197 washed once in staining buffer. When required, the secondary antibody was added to cell preparati ons and samples were incubated on ice for a further 30 min then washed once in staining buffer. Stained cell preparations were fixed in 2% paraformaldehyde for 30 min, then resuspended in staining buffer and stored at 4 C for a m aximum of 18 hr prior to flow cytometry. The samples were measured with a FACSCalibur flow cytometer (Becton Dickinson Biosciences, Mountain View, CA) using standard methodology. Lymphocyte gates and detector voltages were set using unstained cells from e ach tissue. Data were collected from 10, 000 cells per sample and the gate was set for lymphocytes A nalysis was performed with FCS Express software (De Novo Software, Thornhill, Ontario, CA) The percentage of gated cells positive for each cell surface ma rker combination was determined. ELIspot Assay To determine if the distribution of B cell responses correspond to the changes in T cell populations, we developed an enzyme linked immunospot ( ELIspot ) assay (Simecka et al ., 1991) to monitor the number of M. bovis specific antibody forming cells (AFC) along the respiratory tract. The assay was optimized using M. bovis immunized mice, followed by testing in infected calves. The number of c ells producing M. bovis specific antibody (IgM IgG and IgA) were determ ined. A crude preparation of M. bovis F1 membranes was used as antigen in the ELIspot assay and was prepared as previously described (Jones et al ., 2002). Ninety six well ELIspot plates were coated with antigen at a concentration of 5 g/ml, incubated at 4 C overnight, washed three times in PBS and blocked with PBS containing 10% (vol./vol.) gamma free equine serum. Three concentrations of mononuclear cells (10 5 10 4 10 3 cells/ml) were prepared for each tissue to be analyzed and 100 l of cell suspension was added to each well. Each sample was analyzed in triplicate. Plates were incubated overnight in 5% carbon dioxide at 37 C then

PAGE 198

198 washed three times in PBS containing 0.05% (vol./vol.) Tween 20. Polyclonal antibodies to bovine IgG, IgM and IgA conjugated to horseradish peroxidase (Bethyl Laboratories, Montgomery, TX ) were diluted 1:2, 000 in PBS con taining 0.05% (vol./vol.) Tween 20 and 1% (vol./vol.) gamma free equine serum. Primary antibodies were added to wells and plates were incubated at 4 C overnight. Plates were washed three times in PBS con taining 0.05% (vol./vol.) Tween 20 and avidin peroxidase diluted 1:1 000 in PBS con taining 0.05% (vol./vol.) Tween 20 was added. Plates were incubated at room temperature for 2 hr, then washed three times in PBS c on taining 0.05% (vol./vol.) Tween 20. Spots were developed using the chromogenic substrate 3 amino 9 ethylcarbazole (AEC), plates were washed in water and then air dried. Spots were counted manually under a stereomicroscope Results were expressed as the n umber of IgG, IgM or IgA AFC for the entire lymph node, per gram of lung or tonsil tissue, or per milliliter of blood. The ELISA Procedure Blood samples were allowed to clot after collection, and then serum was harvested by centrifugation and stored at 80 C. Serum end point titers of M. bovis specific IgG 1 IgG 2 IgM, and IgA were determined All secondary antibodies were polyclonal conjugated to alkaline phosphatase (Bethyl Lab oratories Inc., Montgomery, TX), and were used at a 1 :1 000 dilution All othe r methods, incubation times, concentrations, controls and data acquisition were the same as described for the IgG enzyme linked immunosorbent assay (ELISA) in C hapter 3. All s erum s amples were tested in duplicate. Nasal lavage was performed at necropsy wi th 40 ml of sterile PBS. Recovered lavage fluids were centrifuged at 400 g for 10 min, the cell fraction discarded and the supernatant stored at 80C. Mycoplasma bovis specific mucosal IgA, IgG, IgG 1 IgG 2 and IgM responses in

PAGE 199

199 undiluted nasal lavage fl uids were determined using an ELISA as described above. Total amount of each isotype in nasal lavage fluids were calculated by coating microtiter plates (Maxisorb F96, Nunc, Kamstrup, Denmark) with triplicates of serial 10 fold dilutions of lavage fluid in blocking buffer (0.01 M sodium phosphate buffer [pH 7.2] containing 0.15 M NaCl, 0.02% NaN 3 0.05% Tween 20 and 1% egg albumin). Serial dilutions of a standard bovine serum containing defined concentrations of immunoglobulins (Bethyl Laboratories Inc., Mo ntgomery, TX) were included on the plate. Plates were incubated at 4 C overnight, and isotypes were detected with secondary antibodies as described for the standard ELISA. The concentration of each isotype in nasal lavage samples was calculated from the cu rve created from the standard bovine serum. Results for M. bovis specific antibody levels were expressed as a ratio of the optical density ( OD ) units to the concentration of total antibody for that isotype in the sample. Statistical Analyses Continuous var iables were compared among groups using AN OVA or repeated measures ANOVA Tukey's tests were applied to post hoc comparisons. Ordinal variables were analyzed using Kruskal Wallace ANOVA or Friedman Test, as appropriate. A P value of 0.05 or less was consid ered statistically significant, with the exception of the overall significance levels in ANOVA, where a P value of 0.1 was considered significant. Preliminary analyses performed on data from the oral and transtracheal control groups determined that there w ere no statistical differences between the two groups for any outcome variable. Data from the two control groups were then pooled for the main analyses to increase statistical power. Analyses were performed using commercial statistical analyses packages (S PSS 12.0, SPSS Inc, Chicago IL and SAS/STAT, SAS institute, Inc., Cary NC).

PAGE 200

200 Results Isolation of M. bovis from Experimentally Infected Calves Details on the isolation of M. bovis from various body sites are presented in Chapter 3 (see Figure 3 2) and will be briefly summarized here. All inoculated calves became colonized in the URT, regardless of the route of infection. In the orally inoculated group ( n =8), m ycoplasmas were isolated from the palatine tonsils, pharyngeal tonsils and MRPLN of all calves, fro m the eustachian tube s of seven calves from both tympanic bulla of three calves and from the LRT of two calves. In calves inoculated by the transtracheal route ( n =5), M bovis was recovered from the palatine and pharyngeal tonsils of all calves, from the MRPLN of four calves, from the eustachian tubes of three calves, and from the LRT of four calves. There were no mycoplasmas isolated from any of the control calves. Clinical Disease and Pathology in Experimentally Infected Calves Details on the clinical disease and pathology observed in inoculated calves are presented in Chapter 3 and will be briefly summarized here. Clinical evidence of otitis media was observed in three of the eight orally inoculated calve s and none of the control calves. Transient and mild clinical signs of LRT disease were observed in most of the orally inoculated calves and none of the control calves Two calves with otitis media developed more severe respiratory disease ; one calf with severe clinical signs of disease was euthanized a t 10 days post infection Transtracheal inoculation of M. bovis resulted in mild c linical signs of LRT disease in four of five infected calves and no clinical signs of otitis media. Experimentally inoculated calves had gross and/or histopathologic al lesi ons typical of M. bovis infection. T hree of eight orally infected calves had suppurative otitis media. No gross lesions of the URT were observed in calves that were inoculated by the transtracheal route Increased histopathological scores, lymphoid hyperpl asia and increased numbers of plasma cells

PAGE 201

201 were observed in the URT lymph nodes of infected calves (see Chapter 3, and Figures 3 4 and 3 5 for more detail). Lymphoplasmacytic infiltrates were also observed in the tympanic mucosa of calves with otitis media and lymphocytes, plasma cells and histiocytes were present diffusely or in large dense aggregates in the lamina propria of eustachian tubes from which M. bovis was isolated ( J. Powe, F. P. Maunsell, J. W. Simecka and M. B. Brown, submitted for publicatio n). Calves inoculated by the oral route had significantly ( P = 0.041) heavier LRPLN at necropsy than did control calves or calves inoculated by the transtracheal route (Figure 4 2), but weights of MRPLN did not differ among groups. Lymphocyte accumulations were also a key feature of histopathology observed in the lungs. The lungs of calves infected by either route had significantly ( P < 0.05) greater lymphoid hyperplasia compared with lungs of control calves (data shown in Chapter 3; see Figure 3 8 for deta ils). In addition, in calves from which M. bovis was isolated from the lung, lymphocytes were a prominent component of the peribronchiolar and parenchymal cellular infiltrate in sites of lung pathology. In contrast to the findings for the lymph nodes in th e URT, histopathologic scores or plasma cell subscores for TBLN did not vary significantly among groups (data not shown). However, TBLN of transtracheally inoculated calves were significantly ( P = 0.049) heavier than those of control calves or calves inocu lated by the oral route (Figure 4 2). Co mplete Blood Counts and T Cell R esponses in Peripheral Blood and Spleen There were no significant differences among groups at any of the sampling times in total leukocyte, lymphocyte, segmented neutrophil or monocyte counts or in the relative proportions of these cells in peripheral blood (data not shown). Likewise, there were no significant differences among groups in total plasma protein concentration or plasma fibrinogen concentration at any of the sampling times ( data not shown). There were also no differences

PAGE 202

202 among groups in the percentages of CD4 + CD8 + or WC1 + T cell s in mononuclear cells from peripheral blood at any of the sampling times, or from spleen collected at necropsy (Figure 4 3) T Cell Populations in the URT and LRT Both CD4 + and CD8 + T cell responses were observed in the URT of calves at 14 days after M. bovis infection. CD4 + T helper (T h ) cells were the major responding T cell population in the tonsils of orally inoculated calves whereas the pro portion of CD8 + T cell s was increased in the MRPLN (Figure 4 3 ) The relative proportion of CD4 + and CD8 + T cell s in the URT of transtracheally inoculated calves were lowe r than those observed in orally inoculated calves. There was a tendency ( P = 0.089) f or an increase in the percentage of CD4 + T cells in the tonsils of the transtracheally inoculated group compared with control calves, but responses in the URT lymph nodes were no different than those of control calves The percentage of WC1 + T cell s in URT tissues at necropsy was not affected by infection via either route as there were no differences among groups (Figure 4 3). In a limited number of cases, low cell recovery from specific tissues and some sample loss precluded complete analysis. There was little difference between calves infected with M. bovis and control calves in the relative proportion of CD4 + CD8 + and WC1 + T cell s in the TBLN or lungs (Figure 4 3 ). CD4 + Th cell responses in the TBLN of calves inoculated by the transtracheal route w ere highly variable and ranged from 24% to 60% (Figure 4 3 ) B cell and Antibody Responses The URT was the major site of mycoplasma specific B cell responses in orally inoculated calves (Figure 4 4 ). Using the M. bovis specific ELIspot assay, the numbers of mycoplasma specific AFC were determined in URT (LRPLN and MRPLN) and LRT (TBLN) lymph nodes, lungs, peripheral blood and spleen samples Not all tissues were analyzed for every calf due to

PAGE 203

203 low cell recovery from some tissues and some sample loss. As sho wn in Figure 4 4 M. bovis specific B cell responses were observed in both the URT and LRT of orally inoculated calves. However, the URT had a much greater increase in the number of mycoplasma specific AFC (IgM, IgG and IgA) than did the LRT. C alves infect ed by the transtracheal route had significantly ( P < 0.05) higher numbers of IgG and IgA AFC in LRT sites when compared with orally inoculated and control calves ( Figure 4 4 ). Mycoplasma bovis specific B cell responses were also observed in the URT lymph n odes of calves inoculated by the transtracheal route, but responses were of a lesser magnitude than those observed for orally inoculated calves. In agreement with the ELIspot data, orally inoculated calves had increased levels of M. bovis specific IgA in n asal lavage flui ds, compared with control or transtracheally inoculated groups (Figure 4 5 ). Orally inoculated calves also tended ( P = 0.11) to have higher levels of M. bovis specific IgG 1 in nasal lavage fluids than did control or transtracheally inoculat ed calves, although this response was highly variable. Specific M. bovis IgG 2 responses were not observed in nasal lavage fluids of orally or transtracheally inoculated calves. Orally inoculated calves had higher concentrations of total IgM in nasal lavage fluids than did other groups (Figure 4 5), whereas transtracheally inoculated calves had statistically higher ( P = 0.02) concentrations of total IgG 2 in nasal lavage fluids than did control or orally inoculated calves (Figure 4 5). Calves with otitis medi a tended to have higher M. bovis specific IgG 1 responses and higher total IgM responses in the URT than did orally inoculated calves without otitis media; total and M. bovis IgG 2 and IgA responses were similar for calves with and without otitis media (Figu re 4 6). Calves with otitis media also tended ( P = 0.15) to have higher M. bovis specific IgG 1 :IgG 2 ratios in nasal lavage fluids than did other study calves, although there was inadequate statistical power to detect significant differences (Figure 4 6).

PAGE 204

204 Experimentally infected calves exhibited a M. bovis specific serum Ig response that was evident 14 days after infection (Figure 4 7 ) Antibody to M. bovis was detected at day 0 indicating passive transfer of specific Ig via the colostrum substitute fed to the calves While the titer of passively acquired serum IgG 1 in control calves remained static over the study period, the titer of M. bovis specific serum IgG 1 in infected calves remained stable or increased, suggesting an active immune response to infect ion in these animals. There was a large amount of variation in individual titers in all groups, and any difference s in M. bovis specific serum IgG 1 titers among groups over the course of the study were not statistically significant. When the fold change in M. bovis specific serum antibody titers between days 0 and 14 of the study were compared among groups, calves in the orally infected group had a significant fold increase in IgG 1 ( P < 0.001) compared with the control group. Transtracheally infected calves also had a significant fold increase in IgG 1 titers ( P = 0.015), when compared with the control group. In addition to the IgG 1 response a trend for an increase in serum IgA titers is apparent in infected calves over the course of the study, but no signif icant differences were detected among groups. Serum IgM responses followed a similar pattern as the serum IgG 1 and IgA, but responses were more marked, with the titer of M. bovis specific serum IgM being significantly higher ( P = 0.01) in orally infected c alves than in transtracheally infected or control calves at necropsy In contrast with the orally infected group, no differences were detected in serum IgM responses between the transtracheally inoculated group and the control group. Low post colostral IgG 2 titers to M. bovis were observed in both control and infected calves, and no serum IgG 2 response was observed to M. bovis infection. Overall, calves infected by the oral route exhibited a greater serum antibody response than calves infected by the transt racheal route, although there were individual calf variations.

PAGE 205

205 Discussion Accumulation of lymphoid cells at the local site of infection was a key feature of the histopathological findings in calves inoculated with M. bovis by the oral or transtracheal rou tes. Draining lymph nodes at the major sites of respiratory tract infection were enlarged, supportive of a local immune response at those sites. In calves inoculated by a natural route through feeding of M. bovis inoculated milk replacer the URT was the m ajor site of T cell immune responses and both CD4 + and CD8 + T cell respon ses were observed in URT lymphoid tissues. Thus the major site of T cell responses corresponded to the major site of infection in orally inoculated calves. Our findings are consisten t with the development of predominantly an URT disease and an accompanying local immune response after oral inoculation. Other investigators have reported that CD4 + and CD8 + T cells in PBMC of calves experimentally inoculated with M. bo vis exhibited higher in vitro activation (CD25 expression) in response to M. bovis antigens than did cells from uninfected control calves suggesting that these cell populations are responding to infection (Vanden Bush and Rosenbusch 2003) Our results indicate that in local lymphoid tissues, both CD4 + and CD8 + T cells are responding during the early stages of M. bovis infection by a natural route. Thus, both of the major T cell populations are likely to contribute to the immune responses in the URT similar to studies in mur ine mycoplasma respiratory disease (Jones et al ., 2002). In contrast with calves inoculated by the oral route, significant changes in the relative proportions of T cell subpopulations were not observed in calves inoculated by the transtracheal route, desp ite a significant increase in the weight of TBLN and a substantial contribution of lymphocytes to lung lesions in transtracheally inoculated calves. There are several possible explanations for these data: expansion of lymphoid populations could have occurr ed without changes to the relative proportions of the three major T cell subpopulations, our small sample

PAGE 206

206 size may have precluded finding significant differences if such differences did exist, or the lymphoid expansion may have been due to other cell popul ations (e.g. B cells, NK cells). Other investigators (Rodriguez et al ., 2000) found that CD4 + T cells were the major T cell population contributing to M. bovis induced lung lesions in infected goat kids by immunohistochemical staining of affected lung, but the relative proportions of T cell subpopulations in infected and control kids were not reported. There was no significant change in WC1 + T cell populations in either URT or LRT tissues of infected calves, suggesting that this population does not unde rgo preferential expansion during early M. bovis infection. Other investigators have shown that in young calves, WC1 + T cells are recruited to sites of epithelial inflammation (Wilson et al ., 2002) and contribute to local immune responses in other respi ratory diseases ( Price et al ., 2006 ). No substantial recruitment of WC1 + T cells was observed in lungs or palatine tonsils of infected calves. We did not examine T cell responses within the epithelium of the URT, so whether WC1 + T cells contribute to M. bovis responses at the level of the epithelium was not determined. The presence of large numbers of plasma cells at the local site of M. bovis infection was a prominent feature of the histopathological findings in calves inoculated by the oral or trans tracheal routes. Consistent with this finding, we observed that local B cell responses in the respiratory tract of calves experimentally inoculated with M. bovis corresponded to the site of infection. The URT was the major site of M bovis specific B cell and mucosal IgA responses in calves inoculated by the oral route, while the LRT was the major site of B cell responses in transtracheally inoculated calves. Calves infected by the transtracheal route did have significant B cell responses in the URT lymph n odes, which was not surprising given that all calves became colonized with M. bovis in the URT. However, responses were not as marked as those for orally

PAGE 207

207 infected calves, corresponding well with the level of colonization observed in the two infection group s. Interestingly, calves inoculated by the oral route had si gnificantly higher numbers of mycoplasma specific AFC in the LRT than uninfected calves. This suggests either the beginnings of an adaptive immune response developing in the lungs or, more likely, immune cells from the URT are migrating to other tissues. In support of tissue migration occasional mycoplasma specific AFC were found in the blood and spleen of orally inoculated calves (data not shown), demonstrating the presence of circulating cells. Taken together, our da ta demonstrate that B cells responses, similar to changes in T cell populations, are preferentially found at the site of infection and are likely to play a role in disease progression There are also indications that the B cell respo nses in the URT may augment responses in the lung and other tissues. The ratio of IgG 1 :IgG 2 is often used to indicate Th1 or Th2 biased responses in cattle ( Brown et al ., 1998c ). Calves with otitis media tended ( P = 0.15) to have higher local M. bovis sp ecific IgG 1 :IgG 2 ratios that did other calves inoculated with M. bovis by the oral route, suggesting that these calves had a more Th2 biased response than did calves without otitis media. Three of four calves with the highest M. bovis specific IgG 1 :IgG 2 ra tios had otitis media, and the fourth calf had the highest level of eustachian tube colonization without concurrent otitis media of any calf in the study (data not shown). In addition, the one transtracheally inoculated calf that cleared M. bovis infection from the LRT was the calf with the lowest M. bovis specific IgG 1 :IgG 2 ratio; this calf also had the highest total IgG 2 concentration in nasal lavage fluids of any calf in the study (0.512 g/ml). Although the data was obtained from a relatively small numb er of animals, these data support the idea that a local Th1 biased (IgG 2 ) antibody response

PAGE 208

2 08 may preferable to a Th2 biased response in clearing or controlling mycoplasmal infections. Thus, more extensive studies to define the role of Th1 local responses in protection are warranted. The MRPLN and LRPLN of calves infected with M. bovis by the oral route showed different immune responses. No differences between groups were observed in the weight of MRLPN, whereas LRPLN of infected calves were heavier than thos e of control calves. There were significant increases in the proportion of CD8 + T cells and in B cell responses in both lymph nodes, but B cell responses were much more marked in the LRPLN than in the MRPLN. Both lymph nodes drain the oro and nasopharynx as well as the middle ear, but the MRPLN receives a greater proportion of lymph drainage from the nasopharynx including the pharyngeal tonsils, while the LRPLN receives a greater proportion of lymph from the oropharynx including the palatine tonsils (Pasqu ini, 1983). Our findings may reflect differences in the level of M. bovis colonization within the drainage field of each lymph node, or could be consistent with different roles for the MRPLN and LRPLN in M. bovis infections. In any event, future studies sh ould take into account the fact that considerable differences can exist in the immune responses within these two lymph nodes. Our findings support the hypothesis that local and systemic immune responses generated using the transtracheal approach differ fr om those generated after oral inoculation. Overall, our data support the idea that local immune responses within the respiratory tract are im portant in disease pathogenesis. Further c omparison of immune responses generated after primary infection of the UR T to those generated in the LRT will help to discern the relative contributions of these sites during mycoplasmal disease. These local responses will also be important considerations in the development of new vaccination strategies against M. bovis

PAGE 209

209 Figure 4 1. Overall experimental design for the infection study. Calves were infected between 7 and 1 1 days of life. Calves were sampled at infection (day 0), po st infection days 3 and 7, and at necropsy (post infection day14 except for one calf inoculated with M ycoplasma bovis by the oral route which had to be euthanized at 10 days post infection) Ig = immunoglobulin; PB = peripheral b l ood. Birth 0 3 7 14 7 1 1 days Pre infection Days post infection Culture for M b ovis (blood and nasal swabs) M b ovis specific serum Ig PB leukocyte profile and plasma fi brinogen PB T cell subsets

PAGE 210

210 Figure 4 2 Weights ( mean SD) of upper and lower r espiratory tract ly mph nodes A) M edial retropharyngeal lymph nodes (MRPLN). B) L ateral retropharyngeal lymph nodes (LRPLN). C) T racheobronchial lymph nodes ( TBLN ) Weights for left and right retropharyngeal lymph nodes were combined for each calf. ab Superscript letters indi cate significant ( P < 0.05) differences between control calves ( n =8), and calves inoculated with Mycoplas m