<%BANNER%>

Genetic Engineering to Improve Nutritional Quality and Pest Resistance in Bahiagrass (Paspalum notatum var. Flugge)

Permanent Link: http://ufdc.ufl.edu/UFE0019820/00001

Material Information

Title: Genetic Engineering to Improve Nutritional Quality and Pest Resistance in Bahiagrass (Paspalum notatum var. Flugge)
Physical Description: 1 online resource (143 p.)
Language: english
Creator: Luciani, Gabriela F
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2007

Subjects

Subjects / Keywords: bahiagrass, cry1f, notatum, nutritional, paspalum, pest, quality, resistance, vspb
Agronomy -- Dissertations, Academic -- UF
Genre: Agronomy thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Bahiagrass (Paspalum notatum var. Flugge) is the predominant grass in forage pastures in tropical and subtropical regions worldwide. It supports the beef and dairy cattle industries in the state of Florida. To improve forage production and animal performance, the low nutritional quality and the insect pest susceptibility of this subtropical grass should be addressed. To improve nutritional quality, the vspB gene encoding a soybean VSP & #946; that is a lysine-enriched and rumen proteolysis-resistant protein seems to be a promising candidate. To improve insect pest resistance, the cry1F gene encoding a & #948;-endotoxin from Bacillus thuringiensis that provides protection against Lepidopteran pests in commercial crops such as cotton and corn seems to be a suitable candidate. Our objectives were: to overexpress the vspB gene for improving nutritional in bahiagrass cv. & #8220;Argentine & #8221;, and to express a synthetic cry1F gene for enhancing resistance against fall armyworm in bahiagrass cvs. & #8220;Argentine & #8221; and & #8220;Tifton 9. & #8221; To overexpress the vspB gene, we cloned an expression vector containing a constitutive and strongly expressed promoter for monocots; a KDEL signal for ER-retention and a c-myc tag for antibody detection. We cobombarded mature seed-derived calli from bahiagrass cv. & #8220;Argentine & #8221; with minimal constructs containing the vspB gene from pGL4 and pRSVP1 vectors and the nptII gene as selectable marker from pJFNPTII vector. Following previous reports, we generated 91 nptII(+) plants from 110 analyzed plants. Based on the results from nptII expression detected by ELISA and VSP & #946; expression detected by western blots, 89% of the plants coexpressed the nptII and the vspB genes. Western blot analyses indicated that VSP & #946; expression levels varied among plants, tillers within plants and leaves within tillers. This is the first report on expression of the vspB gene in bahiagrass cv. & #8220;Argentine. & #8221; The VSP & #946; expression levels observed in transgenic bahiagrass plants were low and similar to those previously reported in transgenic corn plants. Potentially, these VSP & #946; expression levels could be enhanced by coexpressing recombinant VSP & #946; and VSP & #945; subunits, and/or by targeting the subunit to different cell compartments in transgenic bahiagrass plants. To express the synthetic cry1F gene, we co-bombarded mature seed-derived calli from bahiagrass with minimal constructs containing the synthetic cry1F gene from pHZCRY vector and the nptII gene as selectable marker from pHZ35SNPTII vector. Based on previous reports, we regenerated three paromomycin-resistant plants from bahiagrass cvs. & #8220;Argentine & #8221; and & #8220;Tifton 9. & #8221; PCR and southern blots analyses indicated independent transgene integration, and RT-PCR analyses confirmed cry1F expression in all transgenic bahiagrass lines. Two immunoassays for cry1F gene expression indicated detectable cry1F levels in two bahiagrass lines from cv. & #8220;Tifton 9. & #8221; Cry1F expression levels correlated well to resistance levels determined by insect bioassays. An average mortality rate of 83 % was observed when fall armyworm neonates were fed with transgenic leaves of the highest cry1F expressing line. These results indicated that high and stable cry1F expression levels can control fall armyworm in transgenic bahiagrass plants. The expression of the cry1F gene in plants of cv. & #8220;Tifton 9 & #8221; enhanced the resistance against fall armyworm in insect bioassays indicating that these transgenic lines seem to be suitable candidates for field studies.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Gabriela F Luciani.
Thesis: Thesis (Ph.D.)--University of Florida, 2007.
Local: Adviser: Wofford, David S.
Local: Co-adviser: Altpeter, Fredy.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2007
System ID: UFE0019820:00001

Permanent Link: http://ufdc.ufl.edu/UFE0019820/00001

Material Information

Title: Genetic Engineering to Improve Nutritional Quality and Pest Resistance in Bahiagrass (Paspalum notatum var. Flugge)
Physical Description: 1 online resource (143 p.)
Language: english
Creator: Luciani, Gabriela F
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2007

Subjects

Subjects / Keywords: bahiagrass, cry1f, notatum, nutritional, paspalum, pest, quality, resistance, vspb
Agronomy -- Dissertations, Academic -- UF
Genre: Agronomy thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Bahiagrass (Paspalum notatum var. Flugge) is the predominant grass in forage pastures in tropical and subtropical regions worldwide. It supports the beef and dairy cattle industries in the state of Florida. To improve forage production and animal performance, the low nutritional quality and the insect pest susceptibility of this subtropical grass should be addressed. To improve nutritional quality, the vspB gene encoding a soybean VSP & #946; that is a lysine-enriched and rumen proteolysis-resistant protein seems to be a promising candidate. To improve insect pest resistance, the cry1F gene encoding a & #948;-endotoxin from Bacillus thuringiensis that provides protection against Lepidopteran pests in commercial crops such as cotton and corn seems to be a suitable candidate. Our objectives were: to overexpress the vspB gene for improving nutritional in bahiagrass cv. & #8220;Argentine & #8221;, and to express a synthetic cry1F gene for enhancing resistance against fall armyworm in bahiagrass cvs. & #8220;Argentine & #8221; and & #8220;Tifton 9. & #8221; To overexpress the vspB gene, we cloned an expression vector containing a constitutive and strongly expressed promoter for monocots; a KDEL signal for ER-retention and a c-myc tag for antibody detection. We cobombarded mature seed-derived calli from bahiagrass cv. & #8220;Argentine & #8221; with minimal constructs containing the vspB gene from pGL4 and pRSVP1 vectors and the nptII gene as selectable marker from pJFNPTII vector. Following previous reports, we generated 91 nptII(+) plants from 110 analyzed plants. Based on the results from nptII expression detected by ELISA and VSP & #946; expression detected by western blots, 89% of the plants coexpressed the nptII and the vspB genes. Western blot analyses indicated that VSP & #946; expression levels varied among plants, tillers within plants and leaves within tillers. This is the first report on expression of the vspB gene in bahiagrass cv. & #8220;Argentine. & #8221; The VSP & #946; expression levels observed in transgenic bahiagrass plants were low and similar to those previously reported in transgenic corn plants. Potentially, these VSP & #946; expression levels could be enhanced by coexpressing recombinant VSP & #946; and VSP & #945; subunits, and/or by targeting the subunit to different cell compartments in transgenic bahiagrass plants. To express the synthetic cry1F gene, we co-bombarded mature seed-derived calli from bahiagrass with minimal constructs containing the synthetic cry1F gene from pHZCRY vector and the nptII gene as selectable marker from pHZ35SNPTII vector. Based on previous reports, we regenerated three paromomycin-resistant plants from bahiagrass cvs. & #8220;Argentine & #8221; and & #8220;Tifton 9. & #8221; PCR and southern blots analyses indicated independent transgene integration, and RT-PCR analyses confirmed cry1F expression in all transgenic bahiagrass lines. Two immunoassays for cry1F gene expression indicated detectable cry1F levels in two bahiagrass lines from cv. & #8220;Tifton 9. & #8221; Cry1F expression levels correlated well to resistance levels determined by insect bioassays. An average mortality rate of 83 % was observed when fall armyworm neonates were fed with transgenic leaves of the highest cry1F expressing line. These results indicated that high and stable cry1F expression levels can control fall armyworm in transgenic bahiagrass plants. The expression of the cry1F gene in plants of cv. & #8220;Tifton 9 & #8221; enhanced the resistance against fall armyworm in insect bioassays indicating that these transgenic lines seem to be suitable candidates for field studies.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Gabriela F Luciani.
Thesis: Thesis (Ph.D.)--University of Florida, 2007.
Local: Adviser: Wofford, David S.
Local: Co-adviser: Altpeter, Fredy.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2007
System ID: UFE0019820:00001


This item has the following downloads:


Full Text
xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E20101207_AAAABL INGEST_TIME 2010-12-07T10:23:48Z PACKAGE UFE0019820_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES
FILE SIZE 5354 DFID F20101207_AAAXLE ORIGIN DEPOSITOR PATH luciani_g_Page_072thm.jpg GLOBAL false PRESERVATION BIT MESSAGE_DIGEST ALGORITHM MD5
2c5a3f320fe0db609e9b0b22bfa40cc2
SHA-1
3b0edb0ab63d00b02cf9207bfc5e579114b34447
25966 F20101207_AAAXKQ luciani_g_Page_061.QC.jpg
230e9f0db89c7589ce77629259aa32cd
d82fe8da8f693d7a0c76a9ebe71a1498ed73e249
1051983 F20101207_AAAWIC luciani_g_Page_134.jp2
97331ccf7eb10ea346734787fd3416e8
5c29ce711f1e0b76f888192185f07d0c18c17c15
7207 F20101207_AAAWHO luciani_g_Page_109thm.jpg
a62b40d9d5741d62928bdf9e5b08c2c1
64a058bfb0d592b72db001c47aa36c5500c4475f
16796 F20101207_AAAXLF luciani_g_Page_073.QC.jpg
0d1202e9ceb9b1b6956ab7ae48604622
71d43b59754af72176f9eadd5af58311da907840
24669 F20101207_AAAXKR luciani_g_Page_063.QC.jpg
82a38740669162cfbb0fc097813e9539
f9b7592f8f59857358904697a86763d92211c828
7371 F20101207_AAAWID luciani_g_Page_099thm.jpg
0a627c0eef6e37e578672dfe34ac5e34
bd95f53b9251afb1fd179da1961f344319ed5a85
2311 F20101207_AAAWHP luciani_g_Page_140.txt
30a7cfb8ebbab2c89f356b663ce1dabc
efdfda047842c21b997929eacfbda5fd849f7ac7
5011 F20101207_AAAXLG luciani_g_Page_075thm.jpg
002d1a7a50a5498c0f671257b1224f0c
09d666845228c0cce267d7bfaa16d3b5180d403d
26000 F20101207_AAAXKS luciani_g_Page_064.QC.jpg
81d63924093d872bcb7fe562fc70447a
3130a40446fd547a42437ea71e2d375c1729dd25
845542 F20101207_AAAWIE luciani_g_Page_053.jp2
dd2bcfa02825585de5be6d02a7ae623c
8d1c1a47367dd7f13f9a29a06447882f71ab618f
26634 F20101207_AAAWHQ luciani_g_Page_131.QC.jpg
0a4fee81580fefd173199cc2abff140d
4ab5aaee586b01d12e657a71b7545a481cd93634
19399 F20101207_AAAXLH luciani_g_Page_076.QC.jpg
73de1f9784d6ff828cc7c0c86e268051
31d009ac5fc390ff074e1c26007312a90f406af0
6967 F20101207_AAAXKT luciani_g_Page_064thm.jpg
37ddc224d56698ded54c9de0afb077b2
9b619cb20591179fc93e356989bbb8bf2312a639
2233 F20101207_AAAWIF luciani_g_Page_029.txt
4a120ec6d180cce69ed2fdc00de9b414
13b9558b098dd5f56abe125760765ff51df0ad71
28288 F20101207_AAAWHR luciani_g_Page_135.QC.jpg
632cff5d6dadd473caf5569c334a1eb8
1458099f6f79d0cbbbc3c774afdce0a2b545d4e7
5460 F20101207_AAAXLI luciani_g_Page_076thm.jpg
cf7f699cfa0123a6efd8a1586f240373
bd6c1768b68262586f6ee6b5e3d1258522ab880c
6915 F20101207_AAAXKU luciani_g_Page_065thm.jpg
0679002de2c97bd1bab6e3c5d4b21dc1
52beb65514400a0715be93851a315f6cb09e67bc
2092 F20101207_AAAWIG luciani_g_Page_083.txt
b222cd3d52d85484b15e85c1a0514819
445ad17a6827d329762440c955aed1311ddaca81
2134 F20101207_AAAWHS luciani_g_Page_068.txt
f601ee7ae3253bc5aadde1588715c012
4e1f0a511769f9a75fef22cb6fb498afc3c319d2
13065 F20101207_AAAXLJ luciani_g_Page_077.QC.jpg
b64f40be12f49502cca4fa210a90cca6
5c4997f698f0b565b39586928cff0b652b3a6a52
26513 F20101207_AAAXKV luciani_g_Page_066.QC.jpg
2418e7e55fe6bd08a76da2e606f2bafc
a7a73cade588c5c09cba9f5a3efd89a502647a84
22551 F20101207_AAAWIH luciani_g_Page_105.pro
487c0b802c03aae0becc9388c20c9a82
f2ec877c253d18e2ec120d8f7672b7e664b637aa
2530 F20101207_AAAWHT luciani_g_Page_137.txt
823b48fa538b37fb3a46b9b2bc4d5c83
4ce6ed9c34c2a2ab76992159d9d0c871a14d92d4
10629 F20101207_AAAXLK luciani_g_Page_079.QC.jpg
7a9c32fbb3482828798b9ffd4364e7a8
c914b567761e895c4a758be941b6c0c6ab8418ed
22368 F20101207_AAAXKW luciani_g_Page_067.QC.jpg
17914443d3c79cd38e8a0c66f52cec24
e886b524c06819b83915e18a3a93bd999cb23a23
1053954 F20101207_AAAWII luciani_g_Page_114.tif
fc98685701a7c99273ca414845e640bb
3d5c8ebb1a1209496d5e16ed7926540c56bdb95e
7420 F20101207_AAAWHU luciani_g_Page_141thm.jpg
b835e4eb945af23a65e11d4608eeb277
83d2dcb4a2dc24b59a8bbf9a7f83aae699a4d07f
1603 F20101207_AAAXMA luciani_g_Page_092thm.jpg
ab66885b299e06965567767aade4e895
5fb198a499d790c6c824b805bbe51f9ee7e9c668
25363 F20101207_AAAXLL luciani_g_Page_080.QC.jpg
bf0c8ab0fddf6a88a5a69de65f906d6a
a27866f8fa5d246599191b0b77b79ebf054f7de2
26657 F20101207_AAAXKX luciani_g_Page_069.QC.jpg
bf8e2b9f597934da1c54439d412389f6
6f16c4c0df1df3e5e6d1cbced42daadce0223013
25271604 F20101207_AAAWIJ luciani_g_Page_095.tif
a941296a53016bb83edd3aa109cc22be
cd2d2d6c25b68bc723911f2a64d6a1aca4257075
50667 F20101207_AAAWHV luciani_g_Page_058.pro
2812ab478ab46e4ae4df5675e2817e68
c64b1b920387cb0707b981bcc9db21265be54e89
6940 F20101207_AAAXLM luciani_g_Page_080thm.jpg
42c81d2bba2cca1fd8bfe8042e567f5d
7407e3ecb5a92f4fd744cf5779bd50e03e0e5dcf
7218 F20101207_AAAXKY luciani_g_Page_069thm.jpg
7a154da7136411d49bf8bd44eb43b45a
38a06c02ca3fba6039e1e6193141522621deade3
F20101207_AAAWIK luciani_g_Page_069.tif
92522852e8725b33405809edf97c9b97
f96b8cc37f44536ea080e9261c804fb1eb2f2dfd
1051900 F20101207_AAAWHW luciani_g_Page_130.jp2
8e1067508c861d3b7d5e3c47b05770f5
63555807d51ad2ff2d1099afa00bbd346c4f69f7
5100 F20101207_AAAXMB luciani_g_Page_093thm.jpg
e7091b131255b86061dcac48840bb5ba
0e27a8eefac0832128c1a473cc43e765560df124
6735 F20101207_AAAXLN luciani_g_Page_081thm.jpg
216238906a46731988ba128717e230fe
96de31fe2b8bdc86cf4c3e38be5b0cef765cbfe6
28442 F20101207_AAAXKZ luciani_g_Page_070.QC.jpg
59bf91184580938726020a808d9e5e84
6cb1d2e0cd50e2f684ec845b2ceadeb525111c97
6991 F20101207_AAAWIL luciani_g_Page_011thm.jpg
5423a24ceeb5c0246c87ca153b403cd0
ed190c773f1d2ca63b420844df15d976a35b6b6b
7292 F20101207_AAAWHX luciani_g_Page_120thm.jpg
62d84f4e8293584f11f8fafd56f4b85a
1fb2444314a73804f12f41561f412d8fafd7fa3e
17356 F20101207_AAAXMC luciani_g_Page_094.QC.jpg
e3b94de3d078f6093aa3b6b50dda186a
a70cee912246daea35b7be64a2298fb263d43c36
26572 F20101207_AAAXLO luciani_g_Page_082.QC.jpg
808e5d9f17ab25e66ff6f02ea9b9dfdd
aaa4fe23597855909f6035d40726ffaf61e1aa3f
F20101207_AAAWJA luciani_g_Page_017.tif
b007df1123ff3bbfc553265ae43389e3
b69ff59e69c6c6d2c750d0c91bbf7dc843814291
79760 F20101207_AAAWIM luciani_g_Page_015.jpg
3031f6415510c511ec21f40521545d5c
134545a6ce27f13ff982c8a5a72838706ca49b34
79568 F20101207_AAAWHY luciani_g_Page_042.jpg
a35a0b41910ca2c488274ee24702ad7a
e7e7ebe57ed839c018e20ad479bfb3af3ffde727
12747 F20101207_AAAXMD luciani_g_Page_096.QC.jpg
c6fc8a1a021bd2a0bc0b8786405a193a
1a353bc78858cb2c2d562f906b31f0aa86cec476
7097 F20101207_AAAXLP luciani_g_Page_082thm.jpg
59553d45177a63582fdf29a99e5c154e
57cfd3461bb4cc55aee3ac1109bf11dda5c96afe
5916 F20101207_AAAWJB luciani_g_Page_002.jp2
194556ec2302cf38ce800865d1587beb
ab8c0ecdcd889dd685bb3d3dbf0e7bec46bfa677
2038 F20101207_AAAWIN luciani_g_Page_032.txt
640fe40318812a37a9bb1bbba5760d0f
7b4e0e944213c20988cb25c2887f03f7067c9ea9
117522 F20101207_AAAWHZ luciani_g_Page_083.jp2
1bdb09b040b6e7a8b041dc67760e651b
07b86b6c5510abf517783af17abf72a74b76c32b
4176 F20101207_AAAXME luciani_g_Page_096thm.jpg
1ca5b308abf5d286237e83c980797dd9
c01b5df3ef81287b58edf00d664a1f556bca55e9
6986 F20101207_AAAXLQ luciani_g_Page_083thm.jpg
f5b1963284b57e11410b88bf8bcfef1c
69bc3e6f7c266ae940f1a4a7a63cbbef4d09739a
6581 F20101207_AAAWJC luciani_g_Page_118thm.jpg
a3cd4e9946978ea9997a418149bd5cff
744a7c0244c66e779120f55be3746b567ef4eafe
F20101207_AAAWIO luciani_g_Page_039.tif
7610db2f725b10a177f64e67c03e17d7
a58621d316c616fc0d6eee89d6852b05421319e2
5381 F20101207_AAAXMF luciani_g_Page_097thm.jpg
d08fdf5d61a31a637d70e41ec6f3d41f
d6762e38dd45e6db92287769cee470658e708ede
25223 F20101207_AAAXLR luciani_g_Page_084.QC.jpg
52c9c6ec7c1d920d155d2684f77c345a
fdb82732539e59381a299169084d9a78d6858e35
113967 F20101207_AAAWJD luciani_g_Page_058.jp2
e184b30e18c5a509b9647e07822ac7ef
24ed883eeb0e4856099fbbdb1737c799632414bd
23819 F20101207_AAAWIP luciani_g_Page_089.QC.jpg
1e027f8ec0b1798978698af8a44f4d01
94d0350488f8f2e73d0b24ef0c92af9bf3b05c14
14969 F20101207_AAAXMG luciani_g_Page_098.QC.jpg
c0eb48a7ce2f6d9c16c33efb6037ffb0
ce1282fc38cd25efe6199d8681eb53a0ea6ca7f7
24967 F20101207_AAAXLS luciani_g_Page_085.QC.jpg
999b20ddc6ff5a68569bff380bcf3879
2758b2c2a2904af8ced835616fd203cfee34b198
85607 F20101207_AAAWJE luciani_g_Page_119.pro
9b0e71b8615eb3c70060c717955f132b
3eaf600496e01f676fdd6ca92f3f872257b37ab0
94427 F20101207_AAAWIQ luciani_g_Page_131.jpg
df36809fd7e632783e4c99be56baa9cb
131fb8534a88b253156c0ad507ff058371391018
4638 F20101207_AAAXMH luciani_g_Page_098thm.jpg
2378aa4dbc6d0e256cb4d43a5fc57d5d
b0edcf97448d27df39053c9ddb881c90b90c60b1
6908 F20101207_AAAXLT luciani_g_Page_085thm.jpg
c4aa032a0839b3cbe0d64c5bcec5aade
9a88c1e0b630a5c451feeaa55076851ecc75b7c7
92598 F20101207_AAAWJF luciani_g_Page_071.jp2
4a4fa4f392bffecbb4cb813be3ab76dc
3ddc926f6ba017a26c205f63beca203845f47bf8
F20101207_AAAWIR luciani_g_Page_056.tif
b220d8e8907b581136a18789dfdd9308
a31abd384bb23af110d594752d0aa1d571046dcf
27432 F20101207_AAAXMI luciani_g_Page_100.QC.jpg
e56637f59a320f3ab08ffd7706124b0a
7de3fa70558e5aadbe1ab335403e2e570eef2548
6934 F20101207_AAAXLU luciani_g_Page_086thm.jpg
87ce53e47a1aae4747123c8aba0aaf37
17ae9d0e7ddfc3201990f4340ea7b17917936158
3040 F20101207_AAAWJG luciani_g_Page_108thm.jpg
9c1d463603302d0681f3c469292cc228
182b2ee028508dd6e1a414f0877106d294bea292
6731 F20101207_AAAWIS luciani_g_Page_046thm.jpg
8d3ff1e19935ddb635b2fcf30f686f76
5f9fb872c34f7740c925a9b15cbbfdeee6a0f3a7
7299 F20101207_AAAXMJ luciani_g_Page_100thm.jpg
f1a5c950409d211bc5ef9e99877bbca7
ce7d1691c86ab7d5a3d001ead0a913c63d88c041
21493 F20101207_AAAXLV luciani_g_Page_087.QC.jpg
1b5baaef774dc4c3f5042e88dbf9b0b5
292fadebe5da33f758fbf0c0f488e8d5f1fb8082
3427 F20101207_AAAWJH luciani_g_Page_117.txt
4401af8aa95de8c56eccb888405e6bcf
7f5515cfcca7219f1831ecb1348aedd54704537d
49409 F20101207_AAAWIT luciani_g_Page_102.jpg
76adf1af43eca7e85903d2745066cb9b
9c1dca462b3bf7199c50ad5c6b521a076d923cc3
25892 F20101207_AAAXMK luciani_g_Page_101.QC.jpg
673115b3a477a0ba5fc17949d808772b
0d3b11e35a2ccabe2c9092d608c5e7b83ad91411
6425 F20101207_AAAXLW luciani_g_Page_087thm.jpg
8dff63925d1bb4d4730617d5cd5d24b2
25db9c134f44ae9b6ddbe499378e378556b0d9be
F20101207_AAAWJI luciani_g_Page_081.tif
d623867c91dbbae1ab6ea11e4d2300ee
9f04b7719b252469685dfe79f9053d98c0073088
7553 F20101207_AAAWIU luciani_g_Page_119thm.jpg
93dd0dee57cc38322c57431fda924ecb
a09be65163fba3f8230fec567f216cbec3d060f5
6906 F20101207_AAAXNA luciani_g_Page_116thm.jpg
728d0f03b3d0eca440e95661a621719e
59ec391850418046111dddce3502e6ec243ef2d1
18385 F20101207_AAAXML luciani_g_Page_104.QC.jpg
e5ddf9b288bd3fb4d466a3569a272387
1f4b2d3236c83463f40f544977fefb7e5fe4bc20
7089 F20101207_AAAXLX luciani_g_Page_088thm.jpg
b0c04bced73c1073860903c1844f5505
71a9dcf1b4c645bd5e95d977992d2031794defaf
58879 F20101207_AAAWJJ luciani_g_Page_094.jpg
e974d54a22b02aa51d750baffd58e28a
0116e7db2ae96ce7e85c555bbb64eb78a6e9b426
138657 F20101207_AAAWIV luciani_g_Page_020.jp2
bdb6e200b578244e77ad14d8e35ab4f1
5da90cc11e4f5470a8451adf900dc425bd126441
31869 F20101207_AAAXNB luciani_g_Page_117.QC.jpg
13f836660b09a72303b3215feb87bdd0
e4925f773a488e0ca93a07f1858c293a6d8053e9
5064 F20101207_AAAXMM luciani_g_Page_104thm.jpg
ecfef2a2d256960f20c398ba6534fac5
c68f09ed5c6d71532bd88faddbfcb9dcc0f2c7a6
6929 F20101207_AAAXLY luciani_g_Page_089thm.jpg
40fed8696965d7edf525654a36e5b0c0
3e91dbde584984b6c0376b382e90af5370489baf
23416 F20101207_AAAWJK luciani_g_Page_018.QC.jpg
c8714ba68c4ba7fd6b289a14d81c07f3
49b8f4eb57db5cf300fa22def6ff2df480f2206a
26617 F20101207_AAAWIW luciani_g_Page_068.QC.jpg
db6890fe89f30b0d382de8817eab1d29
841129f9050d1d11db9e1b1c62fc6723295cdb56
12103 F20101207_AAAXMN luciani_g_Page_105.QC.jpg
86d5db062b0888b3057357cf8cc55bbf
1b743ca353765f89d12c72829e1beb58ade2e2aa
4261 F20101207_AAAXLZ luciani_g_Page_092.QC.jpg
9f3d5ac6fcd372c9d03d2c3727e0ef20
784a3583b03673e802e63c4e9f1e103a09f19c70
7279 F20101207_AAAWJL luciani_g_Page_036thm.jpg
d6923faa8d8ee63e5c142b5f5289dd41
0964309fac49b3c5564166bbfd2e722ecfe2f62a
F20101207_AAAWIX luciani_g_Page_135.tif
9731599fcc217771b3e831d4f6593d92
ba3c5e86331ebaa87f77c78813b0db639710ebf0
7666 F20101207_AAAXNC luciani_g_Page_117thm.jpg
55a67f3f8a1f8092a8d81509a2e98529
0115f9a85b6e46c607c4dec32b08f3769bc0877d
3846 F20101207_AAAXMO luciani_g_Page_105thm.jpg
f79b94fb202cb34b2317b99fa350e415
97c1af6b9781055ea386172648e72f35b04e50f3
3978 F20101207_AAAWJM luciani_g_Page_095thm.jpg
8d39dedc94e043150a29bf1e32e78fa5
0d30fc0099aeea4967fcb53e03517ef56fa649c1
F20101207_AAAWIY luciani_g_Page_143.tif
809796706198aaedb929875fefadf50c
4efd39d0a98adea139a283db9bffe93d47dd6b82
16398 F20101207_AAAWKA luciani_g_Page_102.QC.jpg
584100823e886572d09d6f85aff1363a
363c7860dc6fd9b4b5ba69b0e097f09693effb30
25841 F20101207_AAAXND luciani_g_Page_118.QC.jpg
cd92edd2737ca6bcf884885f7d2a4be1
c1af461e35184a819b8c7d03efeda35ab6d90e50
10193 F20101207_AAAXMP luciani_g_Page_106.QC.jpg
bd0621c1393d53cf2a188bbc2ea7aa2f
0008d3a9d978a7c42b51e014c0735608a20607a0
57999 F20101207_AAAWJN luciani_g_Page_134.pro
9197f6bca4f302adff7d6e2cc8fc0726
68c5e743d0ff2fa3a377242825a2b122cdde9723
6753 F20101207_AAAWIZ luciani_g_Page_003.jp2
a4930776e11e8bf5f68d71565c108104
5966f081f2fe9787654c530a07329a884b4c6a8b
10961 F20101207_AAAWKB luciani_g_Page_008.QC.jpg
fe71621907663fff6b80f2b1906027fa
68bc57da1006f507deeb166f27955626274e9422
7189 F20101207_AAAXNE luciani_g_Page_121thm.jpg
35b7b7749697928d7042b05c8aee9fe3
b544d19edc4b82e67d51d2887d673606d52eae1c
11649 F20101207_AAAXMQ luciani_g_Page_107.QC.jpg
c94996ac06bac529b7f75e2c1c5df3e0
db5d22efe955859f76674485e1e2e1dc83b5ea01
2088 F20101207_AAAWJO luciani_g_Page_043.txt
7fc546ff632aac0cae4fa9c0996f1b5b
aadc2049462b8597ad783f15779a79b8fe69562b
6651 F20101207_AAAWKC luciani_g_Page_016thm.jpg
d1f1c693bc44c2c47b6e8b6b9f240c70
fc57a8c0d1163404e03cdff4224ca9c719d5c862
22787 F20101207_AAAXNF luciani_g_Page_122.QC.jpg
e3ae42b1b456ea77254123bdebd4f185
a307a5e6bec8d8c8779d6baf68baacb0a93a779c
29775 F20101207_AAAXMR luciani_g_Page_109.QC.jpg
ef81326dde2199994ce20826ee3d1da8
3f3cd529ff7344b3fd5352b86a30fbfa834c6cb9
29509 F20101207_AAAWJP luciani_g_Page_120.QC.jpg
926fc99738a2e10804c5df18269983f6
49781d410944da4be808e052396aa3b4d37f8433
54600 F20101207_AAAWKD luciani_g_Page_026.pro
dab5a6a3c0ab66315d8428eed367cbd7
cf503a4b6537bcafec0a4c05d56142b857a30eef
6357 F20101207_AAAXNG luciani_g_Page_122thm.jpg
23b86b90d9839a61b376f79c72b9751a
c331b9a1b974904f5e168711a72b304fabfc7291
28417 F20101207_AAAXMS luciani_g_Page_110.QC.jpg
a30b037968d430169ef832631acea11e
18ef676b151bb0c19ec0fe6602f87e4a2fec0a8b
30428 F20101207_AAAWKE luciani_g_Page_130.QC.jpg
e9959d28bca2be68caa109b10f171ff3
0a564fffab010972484efe67c5b7d09b967022cd
F20101207_AAAWJQ luciani_g_Page_142.tif
ae5e1c27e432414bb890e24df7ca053a
222da82dbbd9606dce892aefdbdaf7678401a60f
22520 F20101207_AAAXNH luciani_g_Page_123.QC.jpg
ba59478a90eb83d710275e660a6aedf8
00c3bc544a4f291ceecee86f52f5529725e81310
7281 F20101207_AAAXMT luciani_g_Page_111thm.jpg
e6dee592534e6c1173b22a1624153dd0
0b9b3d83614e73e8d9e331216fef71ae40249d16
F20101207_AAAWKF luciani_g_Page_044.tif
38f75a53ebff63a0369b279ca551dda7
f0795d08ec9616ea15192116ad33aeafd9556205
119568 F20101207_AAAWJR luciani_g_Page_062.jp2
27b45dafa2f3493c8f1e7574efc3f446
e40482d2f1353e380acc1a1716f257e54932c614
6042 F20101207_AAAXNI luciani_g_Page_123thm.jpg
6b02392c69aef2b19a986fa1055ecbfe
308eb2b260bfa565b71d43b24ed7f55fa8c5db2b
7769 F20101207_AAAXMU luciani_g_Page_112thm.jpg
b10f9fa9578f781fd678c79ac331e23e
44ee5119903662866cabaaef8577d868ef8cc5ef
26999 F20101207_AAAWKG luciani_g_Page_099.QC.jpg
75267ffccff10638741485a7e24718a6
77b54c30233c6f2269fe2f5cc02bab6ef9967d74
7179 F20101207_AAAWJS luciani_g_Page_013thm.jpg
6aa5f7e99b7cbbdcc076434d91d07702
c6e2327453be59779ae85bd6164d709dbc32b66b
17057 F20101207_AAAXNJ luciani_g_Page_124.QC.jpg
42e9caa62a77a52f81251fae3516f94e
4edee5fd8b33d49b618070e795525ece1cb4cf1c
29035 F20101207_AAAXMV luciani_g_Page_114.QC.jpg
d9ccb8954b4091eda21e3ee6bdec3433
0e0dee65e2e8a5803c424130c381134a924a3e00
97459 F20101207_AAAWKH luciani_g_Page_141.jpg
6cfecc11e8de6c6b01300e01826b1ffa
2289d08df1cb6b5d0eab2fb050053152d0cc73eb
117918 F20101207_AAAWJT luciani_g_Page_136.jp2
6ccaa87f7e326846f093e76d2b1db8cd
0d733b09cec0167b0949279e6a82e579d3c600d3
9008 F20101207_AAAXNK luciani_g_Page_125.QC.jpg
21ae9b47ed1cd37a42d14a17fb8c826b
f3ac78820f116375a80718d7e5a21029cad40c64
7329 F20101207_AAAXMW luciani_g_Page_114thm.jpg
63dd2e38742c2d9a66a06c8aba2848f0
72975c64fa6c0efa941f77bb64558625240cd1c2
75784 F20101207_AAAWKI luciani_g_Page_043.jpg
98b7202e632bf1e16b94311851c39513
aa03e1f65a85774d41373a47d2f4246e28250ed2
24551 F20101207_AAAWJU luciani_g_Page_081.QC.jpg
3d1483233b3cd62d0016c5210b027e8e
7ebdc1fcffd54f551fe2deb1a9421871f9a3f2c3
25953 F20101207_AAAXOA luciani_g_Page_140.QC.jpg
11d95b726d5a708094078cce04578180
bf422ed832f78536c2658535f1755e3af9dbd19a
3005 F20101207_AAAXNL luciani_g_Page_125thm.jpg
a5192d970d406e0d6d7ff054ae8ab616
6304b73c38827b683eb3bc1e8f2abf55d58d2ad8
31627 F20101207_AAAXMX luciani_g_Page_115.QC.jpg
bfc4540cd2d9557f3a6dc2342c2d38b4
23ae4b5bd6369b314ccbc598e6a4af3f38627f77
3622 F20101207_AAAWKJ luciani_g_Page_079thm.jpg
4d5caf6e1015126099ae881b933d67e3
ccf40892f11fce4c9ba3165689550f4f631a2e5c
6805 F20101207_AAAWJV luciani_g_Page_045thm.jpg
b261e9ca127d459c6be011da0c2d5f31
dccf80c623cdeafb1b835388395434fa65232a83
17862 F20101207_AAAXOB luciani_g_Page_142.QC.jpg
7f40e725cece5428df1469fce130b4ca
5df969fae3daa85ff7f77e2514ad5a2714661a1f
28013 F20101207_AAAXNM luciani_g_Page_126.QC.jpg
a4389bcaf97145f8d2c8ef56022389a8
1c698e6a08405e7ee8cda416aec9eddd4ce6e1dd
7657 F20101207_AAAXMY luciani_g_Page_115thm.jpg
8b74eb631dacc7534349f7f7814fe833
61084332d59c5624539a04394235eea243c256cb
80432 F20101207_AAAWKK luciani_g_Page_034.jpg
7f7d5c931675a3af65ee7080424c6996
12d82a84be9139b120a6591180b53da40b5b3b5f
113476 F20101207_AAAWJW luciani_g_Page_035.jp2
56ab281a376987a68ce9933cb0d675dd
f25483b18bcee45c937e55f5b578670544e02369
4932 F20101207_AAAXOC luciani_g_Page_142thm.jpg
3da76119eb60ef5a79dcf372ee1cdeca
4f5353b9fdbdfae4d9c8e9a65c17fdc15464c34a
7710 F20101207_AAAXNN luciani_g_Page_126thm.jpg
75efbcf3763e384b81a59bc9bf29a3f2
afdc1b073b7cf45978dc0db6b656610ba080ee83
28365 F20101207_AAAXMZ luciani_g_Page_116.QC.jpg
c733540072c1d6a82fa7a726a1edaa21
5b7547bdc6418f65c87c0c1e4302114a6c18d76e
6815 F20101207_AAAWLA luciani_g_Page_056thm.jpg
930ebb2a73f8f7d957183725fb37863a
622c2b11d09bc79382ebe19e62c41861cadf172d
12726 F20101207_AAAWKL luciani_g_Page_054.QC.jpg
a90b251859599a182394296d0a2ebe2c
ad80fd54cb658075fe39bfcf799c8d31fb616968
126154 F20101207_AAAWJX luciani_g_Page_033.jp2
945d49cd8221777330f544981d755dd0
f3dc7ff69319743769c2f48ccd49cd795b0684ad
25930 F20101207_AAAXNO luciani_g_Page_128.QC.jpg
1480ad73888ff25eaede88f178ce4f25
bf1da672f248ea3a2ad47e62bd30c54c6d4c1333
F20101207_AAAWKM luciani_g_Page_129.tif
617b7858eefdf5c6abb4476095b659f3
52f394da029e3a92692e65a04b68a9cac3ae2c4e
55745 F20101207_AAAWJY luciani_g_Page_069.pro
1783d14872a886b1abff22480f071149
23ab20238e49d25d77cac796fa846d178cdb7df7
18750 F20101207_AAAXOD luciani_g_Page_143.QC.jpg
020ff08f18969846026912f104eab3e1
82549368f0ecafb394b09128e10ad2a95d9c34be
7093 F20101207_AAAXNP luciani_g_Page_128thm.jpg
83721feb1c66785d9acac97ef1037676
b664db052576ad5df08bc3490d63bedf6c21ad1a
3054 F20101207_AAAWLB luciani_g_Page_114.txt
326710b979a5ec11ff2bb116f0651c7c
c1a2cc1efb3f925260c6c4a81d129b1fd6ae12ca
1355 F20101207_AAAWKN luciani_g_Page_002thm.jpg
6988ea143e4b37dcb7cc0e30385ee44a
4716ce7fb9da3842440bc5f1e87a2beb352798ce
55945 F20101207_AAAWJZ luciani_g_Page_101.pro
efd2a35d97cebac2533ac63018000b7b
0e4908c2a0f5e285e6be790c5dbab348d2c4a9a6
5240 F20101207_AAAXOE luciani_g_Page_143thm.jpg
156ae0e5e6d732357d997367cb5ccf87
9d6e02c1e3096d996f0d72370957a2191d3f5825
7600 F20101207_AAAXNQ luciani_g_Page_129thm.jpg
f196bfd21312e92224502d550a71e280
2a8d5d84d7a204bf779c19c81ae5415a26ad6562
117059 F20101207_AAAWLC luciani_g_Page_081.jp2
df8a79c54754c0e5224e714cb25ad62d
4384fe8cc0d6886249a5102f4ac23bbf3f838802
24977 F20101207_AAAWKO luciani_g_Page_103.QC.jpg
8d48bbd95208017c46076cce4494d6c9
dae7e35f71422f1a4c4305723fed972a6e49e6d5
8015 F20101207_AAAXNR luciani_g_Page_130thm.jpg
06caf738d123cec704b3fd2e032f9bef
ad7ac9b435c04f105bb1e7ccf7e5dd685e1c35c3
126132 F20101207_AAAWLD luciani_g_Page_039.jp2
0af0ab2ecf207042761ead1b9d9a4a30
64b7d8c6af25250e64a0c8f9ffd4d15fb4630788
43691 F20101207_AAAWKP luciani_g_Page_123.pro
b7587eda809946c16d1bfbf44288db98
670f2392dbb96991d18544c9571db4189c4b9e8f
7696 F20101207_AAAXNS luciani_g_Page_132thm.jpg
458a5a3900171b146faefb8de59037c3
512e3b41f5c09a009bb289cdab76ed7b9a28e9d3
28166 F20101207_AAAWLE luciani_g_Page_111.QC.jpg
4190b3c8de12a7d5c5b4e28d860ed423
74e9af38ed2dc690de9e3bd51a796ad52c0cb10d
78715 F20101207_AAAWKQ luciani_g_Page_109.pro
42cce0ac4315ec26c5d1df560b9d38d9
0d20e8f10cdf720fb773cd996b93b3025544bf67
27576 F20101207_AAAXNT luciani_g_Page_133.QC.jpg
a5ea530d2b3fd8977b923c1ed7962095
d8802185daa1c11d7b96279f37f87467fda5588c
54139 F20101207_AAAWLF luciani_g_Page_024.pro
bf116078f5cf8a5ec8072fae5ce8db52
64c97ec7420ad830b171c4ee5c9512a8ed1e0a36
7870 F20101207_AAAWKR luciani_g_Page_127thm.jpg
625a3d7edbc9f05dc2bd48b7a131a4f8
b3aaf7aec756b43e9f4b6b9b07da8f8254cda4a8
28558 F20101207_AAAXNU luciani_g_Page_134.QC.jpg
bd0d82f1f477818a9cb74f248495cb62
d113ed7c9a6ce2456fca1749054ef06dc0cbe946
35328 F20101207_AAAWLG luciani_g_Page_108.jp2
b9320a3c5c506f3dc25c55468d74eb5f
f0d24baf04d5bb31bef6a4ed225dda610733a44a
82583 F20101207_AAAWKS luciani_g_Page_050.jpg
13739ff2debda0366399ed8d55efea82
bd6cfe516148ec39ac5047a18b87d17fdfff7dd3
24461 F20101207_AAAXNV luciani_g_Page_136.QC.jpg
2fe4e2e169676d41f2f7bb87b35bb4ec
9007b6b87fb9728f5a914f2e1b7949c50feb71b1
2102 F20101207_AAAWLH luciani_g_Page_136.txt
76649cd55f7afbfffa83a1ef34b80626
84fda619d11aca63cefa294a64b1064cc4f20f58
102455 F20101207_AAAWKT luciani_g_Page_116.jpg
3ae8e808702009bd2a524636f3b0c2db
11a94973aa35c547e243fc62c4374796a73be00c
7010 F20101207_AAAXNW luciani_g_Page_136thm.jpg
4bb48d9593919141caa46dffb6c7cb4a
39baa0364e4d0a8a26b241c0a8159078f8c3779a
49065 F20101207_AAAWLI luciani_g_Page_063.pro
8dece9f2907de7f5300579c9ec742b41
b5bc227fb503d0ea44d9058b3fcdcf965ff0019c
12717 F20101207_AAAWKU luciani_g_Page_092.jpg
2e50c7fd0fb14b404f5c2365032fcd5e
286f82e36ef19c76f4c5b23734656e8ba725b573
28561 F20101207_AAAXNX luciani_g_Page_137.QC.jpg
f8cb9a3fe053d6988b3c823e39c3ee19
58cea0aeafb5976613e9dace4762acbd3f75fc83
F20101207_AAAWLJ luciani_g_Page_133.tif
07c302706fd9c8ddf87ec0ffa413e611
e29990de4a32cd110239a8b5ca4239aa5a4681f7
121903 F20101207_AAAWKV luciani_g_Page_101.jp2
732fd2adb48d7164b016db34fe9bf37f
0e0de0cebc7a15d3536ad096a9b7b108c946d8d3
27014 F20101207_AAAXNY luciani_g_Page_138.QC.jpg
3cd769523136129176d4849c7a484f22
38b389c2075430b829dfb3008a8cc825c003003e
26397 F20101207_AAAWLK luciani_g_Page_033.QC.jpg
893c7eccae54678245db17060a61c561
26f6dfaa6ae0161d1e4efdb1f0af9a370129fa5a
117151 F20101207_AAAWKW luciani_g_Page_088.jp2
4e20acd3e1c82b39831d43dc00a2081c
adafd95f02b0bd5aaaf17d7d893efe26a791839e
7258 F20101207_AAAXNZ luciani_g_Page_139thm.jpg
c08fef80159af7270da429d74dc01d8d
9fb9ef15184b46855a3db3a8f678b8266e396a3c
57117 F20101207_AAAWLL luciani_g_Page_082.pro
4f901c58197364d613e9617b8daf2f68
4e2fb4c0700140303e9ddfc9f037dbbe752c2def
F20101207_AAAWKX luciani_g_Page_141.tif
03673daa0b742faf4cad4fb2526bb60d
9acc379175952b805c97afe2791957f2d4bbe28c
6258 F20101207_AAAWMA luciani_g_Page_067thm.jpg
1c23e20ff4fec06558e0c9ceb3ed4a39
6c0c4b241f563a47424c267f00014b350275edbd
7115 F20101207_AAAWLM luciani_g_Page_034thm.jpg
aa30a11e3e1fe8f6708b966076598429
be7a41240f6cf4687090f8883e4a8fbd71ee0c2d
1121 F20101207_AAAWKY luciani_g_Page_076.txt
2899532795d3552839bddd1b11093e61
9e2ab88b0be31479056c9cb34fec92f52cff9f6f
7566 F20101207_AAAWMB luciani_g_Page_133thm.jpg
2b05aeeef6659e22bff30153554f93d2
f4eeea8bbe8b029ae45b090aba43a83bff96a1b1
704 F20101207_AAAWLN luciani_g_Page_077.txt
8de893fec6d1d407aa2a7c036eb386b0
3d03e7902df4d9a8f4db4c04e2136eeb64d22ce1
2331 F20101207_AAAWKZ luciani_g_Page_128.txt
940da32ee2b4c61a9ccf479ae40fa6f4
18337cc4e016f7f6b9d8488957e2347beaddd2ac
106370 F20101207_AAAWLO luciani_g_Page_130.jpg
78606f91c2dad18a0eecb6e20e35b45b
c580ab11c21e89a940d51167d4933da174e8fb30
50386 F20101207_AAAWMC luciani_g_Page_085.pro
a35142289552d859bf66e74ac2bad52e
eef2a7c3f6d8cd37515dac494af986ad3fd86be6
12055 F20101207_AAAWLP luciani_g_Page_075.pro
ac5a48e20bbdf2675809d0041064333a
0be4fbdf8efdc341c9a25521568e217ff5ff8b66
F20101207_AAAWMD luciani_g_Page_019.tif
3fc86e6bf70fcf795fc4f886ea04fa0e
28d10335cc3876dc6ebea277f3fd3fdd72edfcaa
26121 F20101207_AAAWLQ luciani_g_Page_015.QC.jpg
7d2ad9c43eef1d8486bf28b26cebc701
369a06f2bfe94371bb4a758da44d8b2e96f20d4e
F20101207_AAAWME luciani_g_Page_024.tif
ee98b6186e30c7a075f8cd0f5d33ec8c
7be1f94c5e21221ae43a564c8ce1b3ad4c9cad4e
7069 F20101207_AAAWLR luciani_g_Page_057thm.jpg
2ccddb5da634cb12e232497981da631f
38ccd41718184f9e12b9b28507fd73aea660e590
263 F20101207_AAAWMF luciani_g_Page_005.txt
e6dbccede85474ad4ff70e08a2f5dfd7
6cf4349a91de0d3b2e5fea791cddb09c2a3c1e45
6969 F20101207_AAAWLS luciani_g_Page_063thm.jpg
e47311087c09a13db2f833c2973b696d
2033a16edfe91baa1e60da6e80f7b07d9b097189
54228 F20101207_AAAWMG luciani_g_Page_068.pro
55a12cda3cbbd074597ae56115071ddb
bce5389a7ef33fce425ddd0e74d5a38a781f5a1f
30204 F20101207_AAAWLT luciani_g_Page_112.QC.jpg
2c64dc54a8ebfaac0c572c3a40f94814
2089b93c90c805c5fb666eeef1db2f357b154efd
2026 F20101207_AAAWMH luciani_g_Page_035.txt
f0b5a54f2570768b527d2a036323913e
103f05a344573c41a5cc39d19544cb469a1ffdd0
158183 F20101207_AAAWLU luciani_g_Page_112.jp2
d0d973e184aa24f6e37473eb2adb9312
e32b63a936e7ba26eedd3d6adfbbe787e71c4d43
16248 F20101207_AAAWMI luciani_g_Page_074.QC.jpg
af686424345fd08975eddb17d15481b1
5b3cf572abdda5855b94ff3f959e8129655d430f
55356 F20101207_AAAWLV luciani_g_Page_021.pro
12dbaecda92d7866372e50f278ebdf3b
20394d6327970c8cffd1d237dd368cdef5c0e963
6989 F20101207_AAAWMJ luciani_g_Page_021thm.jpg
2c0b76a511d3996bb3916bd4a5283d43
d2bcb8a8327881b1ab8c76514bf613757ac7f257
2834 F20101207_AAAWLW luciani_g_Page_110.txt
63e97008b1354f586fc182485de34246
abc9bb4b0aa87e740f00319e53a214c1e7fb657f
5265 F20101207_AAAWMK luciani_g_Page_073thm.jpg
80b9f696a01f8d0650553b5872a1155b
4f29d708653c19a03fea67d5c4655fef5b0d56d4
2039 F20101207_AAAWLX luciani_g_Page_064.txt
7ae6e6e8b68447dc456a2e61956efc9b
ffeec05524c598e052f810f22e6a54ef4ed8b588
F20101207_AAAWNA luciani_g_Page_025.tif
a915b7b8c96a6ca918c2a89b1891903a
e24fac25bccd3b79f87d0c9696c0285e389b6f39
55714 F20101207_AAAWML luciani_g_Page_057.pro
f79e7540b81cbffc3011f72bddd288f1
43787f6393a52c824abab2a4ddc0823cce4eab13
F20101207_AAAWLY luciani_g_Page_103.tif
b5275424d507fc7657d4716cf53944a0
aa079a49a0c36f00cac7f30f7d01ddf60d14a8bb
3579 F20101207_AAAWNB luciani_g_Page_092.pro
729912ae547d264d6b5d5a698d419ee4
591a9957ff6da9b31db7a71c31329086dfb975c4
7113 F20101207_AAAWMM luciani_g_Page_068thm.jpg
e9a2a817696158b07ae05e9f7b2172ee
7069e0199c1c7eb1243ef636929ac8e9bfa7c7f0
7102 F20101207_AAAWLZ luciani_g_Page_014thm.jpg
96ee221f618e06b90ea3c0c2d04f3fb2
8765698e36c0de51dca9e75aff98d576670d4b5e
25750 F20101207_AAAWNC luciani_g_Page_024.QC.jpg
0a7717a777950f846d0c77973341d190
43d56096f2dd4ce9f63d3f2aabfbc0caaa00754c
1009 F20101207_AAAWMN luciani_g_Page_105.txt
f76128cd4ae59a6051a48fd0151c3f6c
05de36416c0f077b7956f37c51db6d6d83a5a441
97208 F20101207_AAAWMO luciani_g_Page_126.jpg
62ab31bad0a9679f7b677f5242fdb06c
fe8d5113a62460317d73b4d8aa3b27602fc6704a
F20101207_AAAWND luciani_g_Page_085.tif
52276b47325c4e8760438a6623bd192d
763658e94b870bbd4be6136c43d0a375e820dbe5
61727 F20101207_AAAWMP luciani_g_Page_132.pro
c1a65925b3667eca312588412b83e5d4
b0f6b061e11c931d202dec9a389c064b39f6a01a
6638 F20101207_AAAWNE luciani_g_Page_044thm.jpg
7c1a94f73d020b41529cf1c175132f09
24d3dfdcae1844087ad2e7817d93f958218eb97f
106573 F20101207_AAAWMQ luciani_g_Page_010.jp2
f6147b786e2221fb53327eff294da087
b2ba339a3e7d1a25894f74a32760b278a3c12500
156814 F20101207_AAAWNF luciani_g_Page_121.jp2
d80ccc5048994b6aaa9de3a2b884169b
75dd5ac73701539093ef3cba3827cc0d12d2f7ed
7139 F20101207_AAAWMR luciani_g_Page_040thm.jpg
b2ef61661ad931de3eac9afbd7522183
682e98b916c847902ef8350db0ef338acdae2517
54767 F20101207_AAAWNG luciani_g_Page_038.pro
394abb27f202625c15372bdd5488ea2e
a11b8b58b8fd8f7c3864141bc138e179ff6e9082
1051926 F20101207_AAAWMS luciani_g_Page_094.jp2
94965f96b19bf556c7427afe55e83066
ab1843e6760d8defbe74a04de2090bee0cb7fc8c
F20101207_AAAWNH luciani_g_Page_121.tif
0a2b9f013df018ed71eb6c3c2a81ed01
90e151c54d18f0b1fd45d06afa5e8abf3c3a6b6d
F20101207_AAAWMT luciani_g_Page_077.tif
96376f05ada9af085fb658c319f78b3f
47d61e60c1aedc92e4dfd74829a62ffc1e93bc09
7497 F20101207_AAAWNI luciani_g_Page_113thm.jpg
759ff556f89ef76df702e3b28fc348cb
b4cd9e272b8af4f05d63249591053ef96da03b88
77552 F20101207_AAAWMU luciani_g_Page_060.jpg
17f03b7c56c6f4a3f3bdda4224c84ced
3d328bae2f5d4fb617f8ac88d4570f535a900ca1
7185 F20101207_AAAWNJ luciani_g_Page_060thm.jpg
d68f9e818a8c954812785b0388286181
3c60a7679bdd38fe367714ceeff6d24a857bacb1
115639 F20101207_AAAWMV luciani_g_Page_044.jp2
209b7e0435dc5f95529c26f2247a7ece
bad9b0b700c3675f16ee40c6c0cc920aa6997fe6
3141 F20101207_AAAWNK luciani_g_Page_002.QC.jpg
40790ce43e5e40d2c001c9251a5e21e8
3bac3e8c7e02bec04c306709915cf62daf2b3d86
F20101207_AAAWMW luciani_g_Page_111.tif
66fa75cdbf9ec5e1c55588a2827a80c9
e6e2b50ab651e042949ffb089ab863a2b7823d68
71182 F20101207_AAAWOA luciani_g_Page_018.jpg
eeed8b77d309f9fdc8054e08d413c8a9
944bbe3e8955cba373beb4e87e48ed1e6e15af9e
77204 F20101207_AAAWNL luciani_g_Page_056.jpg
122d1dbde9bcfb7027559a52f59f3194
68af45e561c09262c417fe7eb8a3002732323335
27484 F20101207_AAAWMX luciani_g_Page_007.QC.jpg
660bcf6a618f4825939b6e096d696aac
0c8bcbd579151a4334f4f5b445f68c0be7983fa7
90104 F20101207_AAAWOB luciani_g_Page_138.jpg
70bb9e1a121004b32376a5dea881203b
a59c681061d42d48f6e335194bc54ca2aafffced
50011 F20101207_AAAWNM luciani_g_Page_012.pro
3f7c579a693d82be0244ffcae498899a
6880b586698649dc3f8b22e3da8079a3ca15c61c
28550 F20101207_AAAWMY luciani_g_Page_051.jpg
fe8db080d4722c61daeda9b220ed0313
e95e6e61e05db4f10c401deb01251e5c31f89b65
2073 F20101207_AAAWOC luciani_g_Page_044.txt
62809703483d8742f3987a37f3d9e0c1
8cb268cc6ebe1dc52e5d4c9809f3dea71d214f29
7748 F20101207_AAAWNN luciani_g_Page_134thm.jpg
8baa7829099224774e78a617a4188bf1
c4715967a9ce219bc794ec08d375c39b59544e10
2451 F20101207_AAAWMZ luciani_g_Page_132.txt
77e4a4c21f7fb88293fe156a1c79352e
eb0ab191f08f50cf8a2dc8d78f1615bed07dc97d
F20101207_AAAWOD luciani_g_Page_049.tif
222548c7e451d7feae656891ab6c84f6
63d9d24eb4ce22ff314848a244c62e8be81a1783
58408 F20101207_AAAWNO luciani_g_Page_019.pro
f32ea76734dc5152dac73a12d231c81a
a74b09f080938b30f2d86b24ef886888a8c12fad
79910 F20101207_AAAWNP luciani_g_Page_066.jpg
680d68a06a7e92155f688a81ef8fb823
56c62e30a2d14a1aaa5c4b511d7e94927ec19120
686980 F20101207_AAAWOE luciani_g_Page_078.jp2
481108123a5d429b6be3f933c101ddd7
29a5b25fcbf7d00efc2d7fe9df0c6da002ef48b7
2126 F20101207_AAAWNQ luciani_g_Page_042.txt
16986e39035906a19f7ac3ff4c8e2fe0
919caa5dde9164f4b3de3a7d50b7417924cbc5dc
1051980 F20101207_AAAWOF luciani_g_Page_075.jp2
0a20b7866a91086dc33bdf881d5588e8
9cae53acc1cef78f836a8974ffb1f198ae5a7473
F20101207_AAAWNR luciani_g_Page_016.tif
b82c58c6cf3302613eb5deb70acca21e
55dbf5cc63b064fc95c15cebfb223018efc076ce
45992 F20101207_AAAWOG luciani_g_Page_107.jp2
88c589f5ac467d637828a7de699a3ecd
402d4e3594e7c6ffa75ecf6ae676a9aeacda0d94
75645 F20101207_AAAWNS luciani_g_Page_044.jpg
6c0af2ba3efac6c0f39d363537a74c1f
c7614d69623703e4c22fffff552fb3be1dfaa52f
11177 F20101207_AAAWOH luciani_g_Page_092.jp2
a4bc7f32656e65dc46becb9755a299ba
bde16dea7f47e603bff52bd6bb97945708e5b1b0
7195 F20101207_AAAWNT luciani_g_Page_140thm.jpg
77965897dd44f35baa1da0059c5f47be
6453b759cada5d6257eefb15d922249b24552a9b
632 F20101207_AAAWOI luciani_g_Page_051.txt
98061aa2cf435564da765b5ccc6fd9b9
bcf68df0d95fb13933f2ca4ecdb9f69984e4c18c
53013 F20101207_AAAWNU luciani_g_Page_046.pro
3a4eb577208e6bf305d9a45e6a3703ba
611eea6da06adca380b082423fe74af806869c29
29295 F20101207_AAAWOJ luciani_g_Page_127.QC.jpg
e111fc22647e02b9b7248b61fd292763
30d30a097f6d95cfc11fea8f1a8c5846b73d03d0
2437 F20101207_AAAWNV luciani_g_Page_138.txt
0b91445e48970ee95f497b52eea89e3f
a0dd5a497a20ffdd4dd6c5533bd4ab23353d349e
154858 F20101207_AAAWOK luciani_g_Page_114.jp2
66b0dfe24ddeb6ebba05386f7e28c13c
481832169062ba1bcb0c4e5e2a7b657ec45d15ba
66817 F20101207_AAAWNW luciani_g_Page_020.pro
c74d2ca47519858eebad1de5c2e1fea0
46a91957bc0222f7f06431c978991fcc0ae0f298
121003 F20101207_AAAWOL luciani_g_Page_011.jp2
93f43bb89f18a29de1a4a6c26d7cf47e
18f2c1ecd314d7c65897ef68fc9917f7352b4716
80344 F20101207_AAAWNX luciani_g_Page_049.jpg
f2b8c0fe9f3c5590881c6aadf4d1fc09
34abfff7faa40f62bcda7fe4fb659433f9f181f6
25592 F20101207_AAAWPA luciani_g_Page_088.QC.jpg
8983824616a5a419e9e283c9ff26205d
4464f12ed90362f9316a46bcf27d62c3d602e478
497 F20101207_AAAWOM luciani_g_Page_017.txt
9cc90ab094de935f8eab2ed960b0a554
de2af16b3a7fb5a0d360c3687f98a8b4fa0be904
69526 F20101207_AAAWNY luciani_g_Page_118.pro
e072ae1c30c26e1275c67aeccdab4303
4bfc343751e70878398183a8fcde2ddd2b7eee79
25889 F20101207_AAAWPB luciani_g_Page_090.QC.jpg
0ed9e86621b746064a259921cd853fd9
c9cb8595bbd83a368634f996159b3127d3fadb4d
51693 F20101207_AAAWNZ luciani_g_Page_084.pro
5893ebaafa083973ff5cb8b0d9c2841f
5460d00ecb6d1794c86b474d5faa062cd96b2537
F20101207_AAAWPC luciani_g_Page_089.tif
8c9555199f575ecba00a3a8dbdead428
9a664629d468c1d964497fdd7eed704f7ce01029
6558 F20101207_AAAWON luciani_g_Page_103thm.jpg
461da3863068b324458c53c47fa7ba4b
bd5c8a3be3522b3a2f4b9b809db7a5a8c47ed4f5
2544 F20101207_AAAWPD luciani_g_Page_130.txt
8120b58c1657b6e4db55cb2600e3fb29
f4b9f57cbf733a6f040bfdae42195ea20df7cd7b
1676 F20101207_AAAWOO luciani_g_Page_104.txt
eaaa445d3e39f245addf1dd966ac5b30
d5532a667102904949e3d2ee0bf487f90f983fc0
101776 F20101207_AAAWPE luciani_g_Page_129.jpg
1902b8cef3a76288674e04e3da7b5732
ca8a3c55c35fe2b0a31c89c739ff25b1c3b2f239
123765 F20101207_AAAWOP luciani_g_Page_049.jp2
6dbe68287faac72ece9e3129f1f6929f
148681763af9c607b157f4bd43b999b887bd50fc
111257 F20101207_AAAWOQ luciani_g_Page_063.jp2
ed8dd9c46c1fa247cf462e2a4ecebcfd
2b7181db361360d7728cac04ed784d77d27df7ae
100163 F20101207_AAAWPF luciani_g_Page_113.jpg
ac01dbc706fdd43533d42c9bdfa8a003
3ebef9095a78ab05960d93011d1385b4229a154a
52955 F20101207_AAAWOR luciani_g_Page_062.pro
828ff98660781c8ff425baf1c6733652
20406846554de979467bab5dcc8dca666e74a389
139464 F20101207_AAAWPG luciani_g_Page_133.jp2
e2f0ac0f623383007c642d0568482e04
7ee77f497dcc8581829b10ab24c376d21a8afc49
881 F20101207_AAAWOS luciani_g_Page_125.txt
0cd89ef0c6d5765ff506ce9f1dd90076
ef564b63f7e490da93b5bb2421bd5787d1870dd4
51237 F20101207_AAAWPH luciani_g_Page_105.jp2
a22fcec2348043a288e75284aea81d60
90847f5c10f5f4c8eb31c6dd69855bab0f41d979
77895 F20101207_AAAWOT luciani_g_Page_026.jpg
2c0c372e69fa3a247eedcef73eb8da4c
8001c7ee4fd2c32b6e76c203cf3f5019d19672b8
47110 F20101207_AAAWPI luciani_g_Page_078.jpg
8af25971c337a70cf3097a9363e99f35
86f5ccb12781be52b47e01a1126433a504a3f35d
F20101207_AAAWOU luciani_g_Page_125.tif
6d9112511346234f9a3932312962a8b2
ac5b67c96b18fd9f0b78865ed8861641334e9cbf
78249 F20101207_AAAWPJ luciani_g_Page_090.jpg
08e9a4a32b32a3b6e839452c3bbeb948
1f881779ee5cb2166519a6c8eaa8b1e01af0ebfa
19914 F20101207_AAAWOV luciani_g_Page_093.QC.jpg
afb59b7e39705e0c19ea901c3b7979cb
3a7f71d544b1befe660b39b68ecbec84eed9b836
54165 F20101207_AAAWPK luciani_g_Page_027.pro
9f530c5fce391786b060ce327108820d
df5255ef0f268d31b974f3f52add9a34c8803fb3
58686 F20101207_AAAWOW luciani_g_Page_009.pro
464b1431c21bbe6878aaecdd7dc38364
2f868c5ce85ba1b1b4ca917c52998ca15958b8ce
4204 F20101207_AAAWQA luciani_g_Page_006.txt
3aba4fea4998d3b78a381e67dc06c633
a88c93b443014d0e4f1fdcba38986356f87f6135
10778 F20101207_AAAWPL luciani_g_Page_079.pro
3f5356d66e2eb05e3d9043f04e510c30
e1712ff2ea95c03c5d89ce4ab0583139b3e09826
27349 F20101207_AAAWOX luciani_g_Page_141.QC.jpg
38ee2f889aac4a9c2ceb4dd95fe0c52e
74a129d1daee78b018d639c6b90e34f6bc282924
7403 F20101207_AAAWQB luciani_g_Page_110thm.jpg
4fbc9bf02975214a456cd2e770efd777
edf232c2ecd9ee960b8471a7401502674f750046
7799 F20101207_AAAWPM luciani_g_Page_001.QC.jpg
99605bd0a73805aa45fe795296a0ee94
3c4b0084ced0e82d3312c28768c447f51ce48f64
78434 F20101207_AAAWOY luciani_g_Page_038.jpg
ee83bd2fc1aab5b4b67788b0f22ce4af
cea9a877e581c7071fb01a57a71c0c6cd87f5a2b
F20101207_AAAWQC luciani_g_Page_122.tif
11005e3aa59d1d0c8d59382244c6458e
eb6a64c53df1967a8ba11da25727844aec18a264
2569 F20101207_AAAWPN luciani_g_Page_135.txt
9913b25ab0dc11ec3424f68def89546f
e935f8587229d87160b294e3e7cf5eb258595429
F20101207_AAAWOZ luciani_g_Page_088.txt
81bbc0a5c1f6cfcd538f3ed022f702df
4693c18ce4f25c07d635026a69b1299d154a33d1
16692 F20101207_AAAWQD luciani_g_Page_005.jpg
12f80efc79f56495b4b53f819f4f8890
d183551fdb394c4feb25728cdef121a58e329dbb
2010 F20101207_AAAWPO luciani_g_Page_065.txt
903aa0334ae4718078bb044b65fd5e72
3ac43033b21d1dc2ff0d855bcfe49f6358230b3d
6697 F20101207_AAAWQE luciani_g_Page_037thm.jpg
35971ced2c2dfd286705f0b481b60228
530c60c8bc4f62168e937f0fe852004ccfe6c912
F20101207_AAAWPP luciani_g_Page_062.tif
fa575d14b674ded353959d3867b91f36
ee87fa82d4ecce960481e5a89c59fc0f2c08cc94
F20101207_AAAWQF luciani_g_Page_042.tif
8903b96340f7714b1f0f91cfce967c69
e268903b717c34fa14af490a38b5e81d2213cf07
87646 F20101207_AAAWPQ luciani_g_Page_115.pro
0f04d6ae910fd83176ec39656616deeb
dda88fd9da7b7493c740ac03b84947021449864d
32059 F20101207_AAAWPR luciani_g_Page_102.pro
61c7aae0b229391e9361db4ab3cc61cd
4bbb85e236886b9a9249939a489f29f636db2c2b
53011 F20101207_AAAWQG luciani_g_Page_122.pro
aa5d95199e3282e7dad1e05c68dcb0dd
68fe5378bcf8b1cc92fd7b0a9f86be3543733288
F20101207_AAAWPS luciani_g_Page_123.tif
9fef18a241845771fa3e7b18f391d95d
1cd740475aeaeccac70710439abbea54500cb090
F20101207_AAAWQH luciani_g_Page_026.tif
8609a6057128242c9994bc76458876b5
73ce6d14959aca432f259a0c4b18048605fb01cf
F20101207_AAAWPT luciani_g_Page_063.tif
be19cdce338f43534a7191546a4653bd
e23fd028457644964e155ef8000f4a409e40512a
F20101207_AAAWQI luciani_g_Page_054.tif
e06ab9a41023b19c2b5291ae6db7d0a5
2e1076b96cbc009a520fef0fbe5ad949d8f89bb6
24862 F20101207_AAAWPU luciani_g_Page_006.QC.jpg
187d438609672802d4f9a149efe28972
7d817a58a52c71658adae9b364bd6588bd26c364
2179 F20101207_AAAWQJ luciani_g_Page_090.txt
9749c14fc6e249704e956cfd03801f90
4d76a153e3357da6a0f1cc115049d147289621d3
F20101207_AAAWPV luciani_g_Page_138.tif
f0cabf58f161aaa1a9d61886d820a85e
a049960cfec6eabccf6bc367fb6833085791f442
136691 F20101207_AAAWQK luciani_g_Page_137.jp2
46ef94d6f8b8606fa89386581aaa0063
1e58a0ba78c6c633ce30383b3df9517433e47778
25194 F20101207_AAAWPW luciani_g_Page_086.QC.jpg
6b560ce49d6cf517617b134bdc65d02b
42c12741dec69c44226b7fcbfa2e1c2772f91524
64203 F20101207_AAAWQL luciani_g_Page_130.pro
ec7f8a5535380661674e733a4037ccc0
b1218394332ee97b2836b4a23f2bbac09f661cf2
95045 F20101207_AAAWPX luciani_g_Page_093.pro
7dc1943bff56020e22d41a661a9ce30c
946c642180da8e0a230ab2b166ad37f7e49e6ec0
73511 F20101207_AAAWRA luciani_g_Page_012.jpg
7a289980ae76f3078471f9336a7bf220
9b77c9000cdc3de062715bc52a79b14aa6f083da
48067 F20101207_AAAWQM luciani_g_Page_010.pro
6c1a68aa321daca2588b3793f1ca09a5
75a3b3ee691eff0cfacf5382f3b4e3eb21915495
2305 F20101207_AAAWPY luciani_g_Page_141.txt
a04fc5c0cf7bc759cc556f44d1d356ff
504b165cab43f6563cd257560cca2013c4530b3e
81973 F20101207_AAAWRB luciani_g_Page_013.jpg
139e94649157c45bc03a126ce82ef920
209e8fdbaa9f2a03430e778fa348920169f7edac
F20101207_AAAWQN luciani_g_Page_136.tif
7f86ff1459e0cd645f359227ae1082ed
06c5ef9459cb5424e980e9ca9a18c11c32fc4d8c
4982 F20101207_AAAWPZ luciani_g_Page_074thm.jpg
05cfa059a21feba76fa8c4146626ffa5
845d605af89b8d4692e5e2cacae1750fee651e2a
79337 F20101207_AAAWRC luciani_g_Page_014.jpg
e17daef6b499fbf57cc3cc9b59dcdb63
6e14109914e786677f7e42c7c2f3e49b5c1acf36
F20101207_AAAWQO luciani_g_Page_086.tif
fbf056080ae49f4000ab0d6bd10c8441
1aa39252d99b611bcaebd4b72506d426da75b2d9
83393 F20101207_AAAWRD luciani_g_Page_019.jpg
cab81fc5e4c34d10843e6e0bf1eaa6e1
de48b57bdbaf0f2945ab4852521017e3f5dc3220
166044 F20101207_AAAWQP UFE0019820_00001.mets FULL
9d60b9c9579162116d859dbf5514b5a3
b097b54e99ea2e08b15d464c56e851b397c25b8e
90794 F20101207_AAAWRE luciani_g_Page_020.jpg
70190990ada2f682f6c6d54f67701cd4
de15a297d5e3965c36e54506df128816dcd6c695
75111 F20101207_AAAWRF luciani_g_Page_023.jpg
366b72bef0910afaedb63c932a6663f8
ab9a23c7ff26598fa72835ae8f7d60cc11102984
78405 F20101207_AAAWRG luciani_g_Page_024.jpg
a261be5cb124c1b14ec608a778615612
124648cec9d65de6f3f92a197ff97e5216c8ee5b
25051 F20101207_AAAWQS luciani_g_Page_001.jpg
d31c92c623289a4053a328e14b661575
70bda0b47211895a24dd35efc3417b82378361be
10202 F20101207_AAAWQT luciani_g_Page_002.jpg
67c8ae759bf40071acf1d0b868733266
07f1df022237327e919e0f279fc7a1da51eecea9
74003 F20101207_AAAWRH luciani_g_Page_025.jpg
d532a57dff3f1b83bb5395c7bc9673c3
8e0d709c7dc2253e92e15cebfefd878bbe70c40a
10503 F20101207_AAAWQU luciani_g_Page_003.jpg
b2f0c38feb11cf56460d431161760170
0df9513835bd5a94c31f9c30977059b0945457c5
85505 F20101207_AAAWRI luciani_g_Page_027.jpg
88c103c39a45c6cb9bebc2a117ea0f6a
624ce7863669cbf8bbc59f3f449d553ab0108430
95679 F20101207_AAAWQV luciani_g_Page_006.jpg
38b6ed6878a3a27f1a0fee724ac9fbe5
7e1e6943ed707723bc91e665b3cc4b8a110ee1de
90527 F20101207_AAAWRJ luciani_g_Page_028.jpg
387c4e58614a3083171c5fa5f607256c
1fd68dd988dfb04f7f86083633b7aa68aa7e933d
112143 F20101207_AAAWQW luciani_g_Page_007.jpg
0b65d94fbf8cbe62e0c796f3a3ff0e43
329ddadd05e98857c029a94f3575bd66b7059954
81440 F20101207_AAAWRK luciani_g_Page_029.jpg
9489b6d4151e97b5685ef1b4eabbcddc
9bb95285759623f43c343ed53178978394c42b1f
41015 F20101207_AAAWQX luciani_g_Page_008.jpg
aa7f65d479e564a29b5291aa7ffd41ae
d619d1d99040870c1ee1101fc91a2e8bc14e8a5c
80363 F20101207_AAAWSA luciani_g_Page_057.jpg
9c55dc7c063c625338db9158f882894e
5fe50e335e08c93e1b489870d4ac18ffeef2fbc8
78778 F20101207_AAAWRL luciani_g_Page_030.jpg
56bc36ff5c8c50f0ebe6789b707ef0c4
0fd2c401be897f21af6e79b0fba4fc1e1cb0ed8f
77078 F20101207_AAAWQY luciani_g_Page_009.jpg
02d589c7dfe8fa49c3481a7a0f04c146
e956382a2c28d87d2f1093402a0cf6f228e14062
79971 F20101207_AAAWSB luciani_g_Page_059.jpg
b16b6526719c1e86c48f8f29ec6eab61
995d1c5a2e28b9636a9916898dee22a2add83f9f
78692 F20101207_AAAWRM luciani_g_Page_031.jpg
2f8014b164a3a97c7183eb851f3bd5da
62aae5db9349a9d2f3c8f9e5f5aa217efa75f834
71809 F20101207_AAAWQZ luciani_g_Page_010.jpg
780d152a550f5ef8fba51d0e706ba387
a58a9747aba110e86b5742e6ef9796eb3b2fa505
79382 F20101207_AAAWSC luciani_g_Page_061.jpg
beaa344116c3a3d1b0b349ece425b5da
0404b0958de49f30a18b6b1a5a15170bf7604e0c
72879 F20101207_AAAWRN luciani_g_Page_032.jpg
c442a92cb50baacbf14f81222c23e65a
5d280494501db74fee93c73bc019edb9e73f93b5
76716 F20101207_AAAWSD luciani_g_Page_062.jpg
4856a77a2eeb7a120921c0ed3ff011d6
c3c939facdb073c8d3a192d02e1530d08d6f1886
80459 F20101207_AAAWRO luciani_g_Page_033.jpg
e042784831d290cbab76e842c8ec0e49
e418aaa7a51700d04433dc4fae6a58df1027a7f0
75067 F20101207_AAAWSE luciani_g_Page_063.jpg
3dc15167edcc854131d2d9dab724a127
1c6dca61928f7f808bfc1541425d4eaef1db3ebf
74435 F20101207_AAAWRP luciani_g_Page_035.jpg
fcc4787bb585384e6f930ffe0b0a30e8
3aee244ea9216d295fe295d77d5a7812b1f92b49
79690 F20101207_AAAWSF luciani_g_Page_064.jpg
167fb1039a784fc07a083f5108cd54c9
414ce920af9f8216c5e418042ff5a4e3d0afa039
83024 F20101207_AAAWRQ luciani_g_Page_036.jpg
9b4222ac7aa3b2baec02cd70e8a8e02c
f7a8d844671253614f39e5b47f7c348dbf36fdb3
77163 F20101207_AAAWSG luciani_g_Page_065.jpg
238431f3a377c6d2bfa590a5f594c6dd
072ab7e715d1fab3967e30b483ef083e03ba72f7
78436 F20101207_AAAWRR luciani_g_Page_040.jpg
90957a3e196b856357d454d7a320a90d
e8564f605411c6e6a442ef8ec8e3a3f2a9d4046f
68316 F20101207_AAAWSH luciani_g_Page_067.jpg
ac679c5b320d4085acd567a9ce539a66
4d7f7166f9c0767b4e406db6d53ab68dcfc03067
76858 F20101207_AAAWRS luciani_g_Page_041.jpg
1165697a45232f1aa525947c47de413d
17a4121740f7518c128a13822cd3beeb9cf550d9
74484 F20101207_AAAWRT luciani_g_Page_045.jpg
17b726f70ec741d224690cb610015111
8f6265c7e58c2e6d14a331e6b10093be829ec797
78178 F20101207_AAAWSI luciani_g_Page_068.jpg
26d6b197bd9523b2d2e7aa47ce488775
be2c6c38bd9ca8399d8844eb10be6d20965d1731
76257 F20101207_AAAWRU luciani_g_Page_046.jpg
ccf75bcd87d61c4b2e7d94d920247b5d
b50f7a9ee1e8d8f79fa9115b8aa0529285f48341
79943 F20101207_AAAWSJ luciani_g_Page_069.jpg
22c55a6973e71e4e8193bc6be28891f9
2cdd59033476d6d44a167ff1f5f5f0d2906aa08e
74389 F20101207_AAAWRV luciani_g_Page_047.jpg
5da440b27ecc38cd6e84cb30b3820ff5
74f5b2bf3eecbba1d6b150f6a8dbc1b2e4619d99
61369 F20101207_AAAWSK luciani_g_Page_071.jpg
d35007fddd9ea01d0b9a9aac58a443a1
a5311a93598f98e921908c47040f4432e2a46fe8
81725 F20101207_AAAWRW luciani_g_Page_048.jpg
b8f62f321be22c80af5d97d4cebc2d69
7adf9e7930e017f6acdfbb852b7104780567fef8
39358 F20101207_AAAWTA luciani_g_Page_095.jpg
3105f3686fbf856f423a10d6f4acfbab
11143e584e9e5a6dbdab3bbc7cb07f93c34264ca
53742 F20101207_AAAWSL luciani_g_Page_073.jpg
3c7529f1db335ec5f61f35cac0b58df7
55ea6df6000d9306baf6d42d39ce8564d9800483
56639 F20101207_AAAWRX luciani_g_Page_052.jpg
d3d78b06813877e0e9dc88c34a0a014d
0eb1779dbf473b3fdfbaee8e0f7e6c2b100a59a3
41799 F20101207_AAAWTB luciani_g_Page_096.jpg
677f98e55c150029558a61ebd6e63dfe
dea74e7948996c233bdf2dc5ea0adc507ff99969
54658 F20101207_AAAWSM luciani_g_Page_074.jpg
3bc7d2bc35c927ee520f1444c6d568ad
d7a818706b831bff888e2462d57f37ea41335f6b
43135 F20101207_AAAWRY luciani_g_Page_054.jpg
76b0c5ede879266978c3df1081f5176c
89419b4cdb4376d7934bc4e2da2fa2a009f85054
61853 F20101207_AAAWTC luciani_g_Page_097.jpg
68315cf67a87797299b0613cfd7a04cb
556239c13e1f0a3f1c57135dcaea3ffac3c50250
54093 F20101207_AAAWSN luciani_g_Page_075.jpg
3a590a62dc3e32195bbb957edaedad88
14140e23bc1386f95f4fac6d627ee4fe5339750e
81113 F20101207_AAAWRZ luciani_g_Page_055.jpg
d27a89086897fba482d3fef9c3ae9281
b9c5eb5b0c74b7036a809bb2a7bc97eca8dc374f
50263 F20101207_AAAWTD luciani_g_Page_098.jpg
6beb12a309180a268737e26174b009a3
a7e980840662ce58da77f580368f200c7db3983f
69752 F20101207_AAAWSO luciani_g_Page_076.jpg
5ddfe72ba241879f1971a6d52457d7ba
5f5c3e7f685b7fd787722b8adffc4c86444d62d0
85816 F20101207_AAAWTE luciani_g_Page_099.jpg
c48bed5d70445867c0acec95fbbfbbb0
8d4b05ae4c6fbdbff0b4c65589b160d9e365b5bf
42010 F20101207_AAAWSP luciani_g_Page_077.jpg
96ffd5d78339be5185371114062c9f28
78cdf8293be9ebc9dee7c69cabfdbce7bf677bda
82174 F20101207_AAAWTF luciani_g_Page_100.jpg
f609e0236e31332e4be1f8968c206dfb
39e176e7048860b5b61d8e02cb135bb9042d763d
77553 F20101207_AAAWSQ luciani_g_Page_080.jpg
86e1bfa2c2386e8fa2891e33f2dd645e
43b8108aca4c4246c7d7655b5e0ff35453778b35
86144 F20101207_AAAWTG luciani_g_Page_103.jpg
e456ec913666bb2ec06436a2872833e8
1a6ee75bc4f5f512eab9ea922103876a99580ea5
76674 F20101207_AAAWSR luciani_g_Page_081.jpg
ed1bef52abfa0c29cd30a46520429e43
4d279884346100b508c08bc9921dfe404bc93807
60874 F20101207_AAAWTH luciani_g_Page_104.jpg
81e26a64e41ff8ad2972d74372dc8a38
01e4e169a766f1d2267b2cc801f79a601b2e1eae
81300 F20101207_AAAWSS luciani_g_Page_082.jpg
5f164c11e158c21173d117b752c17f0b
b0fc1b183ce9d79985e6a2c97c04df0382e828c4
38270 F20101207_AAAWTI luciani_g_Page_105.jpg
35c6da362f707e62875f42fad3473199
9871b799dfa739133c2d1f6300c6974e213fd7b1
78086 F20101207_AAAWST luciani_g_Page_083.jpg
41c859a0bfb655411860bf21556aae56
2944fec630b867af139b644f2fc1f06f65a2bad2
76223 F20101207_AAAWSU luciani_g_Page_084.jpg
51f3a4e86f9fc6b651467d86c4ba0c60
c3e57c03fce2a2da6d64d845a1dcfffb38c920e0
30783 F20101207_AAAWTJ luciani_g_Page_106.jpg
831f9b2fc5d01c2d28668fb3576cee50
7b052a6e1da1360658bf769e1e8b077433757e32
76574 F20101207_AAAWSV luciani_g_Page_085.jpg
8a2361777056f979bfcd5ca4da53b7b0
e6f7cf905b24e582ff91244cd420548f2cc3110f
75947 F20101207_AAAWSW luciani_g_Page_086.jpg
214cf0815681f7dba50183fcba50e3fa
09babda75243973233f85907796e2e2c47b0700d
34670 F20101207_AAAWTK luciani_g_Page_107.jpg
e3deae153163348d6672e037adf80d86
360cc7ebc74c434e191a073b7e4317675df461bd
64879 F20101207_AAAWSX luciani_g_Page_087.jpg
5e10f456d9de2dc45487a3033faa1ebe
22386decbea4463628e6d5101782d345458a8233
92746 F20101207_AAAWUA luciani_g_Page_137.jpg
cf1bdf98bc4f9c19efcdabf98cc87b0e
eea929a97c1abb7dd04774c931a67b659f651362
28167 F20101207_AAAWTL luciani_g_Page_108.jpg
bc4ac844e4cb7145b516343582fd15d6
ba219680c225a97da712868a4c98b2e0c906a243
72779 F20101207_AAAWSY luciani_g_Page_089.jpg
e34a5ec713db5057ff8f57fa30455767
d3042d2f73d9500d0511d88535018dc41cd20892
89326 F20101207_AAAWUB luciani_g_Page_139.jpg
607d4ed93dc512fec0e4831f862e8ddc
f500b8b8b3cc4620f34497340473ee9e38fef6b5
100169 F20101207_AAAWTM luciani_g_Page_110.jpg
1f0782ea7d01e3eeb76767f91d51beec
456e9bce1f0f68e34942009d71a936ecc9a8708e
78902 F20101207_AAAWSZ luciani_g_Page_091.jpg
189fa11c3c4cfd4452fae039bc3da694
695bca3ded92cad15e9e59c96d76a29089bea6e9
86604 F20101207_AAAWUC luciani_g_Page_140.jpg
19c93ec196e97d068237d1c77ffe200c
9f3b75351256ad531884de8c00594d025eec0a97
94590 F20101207_AAAWTN luciani_g_Page_111.jpg
75eb31d5a0572ab194a3cca36a3f839e
925173d205581581b1196897c20a328dd6f28b2a
60111 F20101207_AAAWUD luciani_g_Page_142.jpg
43ccbee65ed937f8489587b214531003
4af37a4278c8f34a406bcfe9084d159ca56088aa
107097 F20101207_AAAWTO luciani_g_Page_112.jpg
6625c622c9013864615222ba5f10dffa
90f72262d06c29c8bcc01db15681f6ea4c6c48e2
58373 F20101207_AAAWUE luciani_g_Page_143.jpg
bb6715dfe31df3ab9405034d9630c1da
20ec5288fc46ac38ae34efe433f59da5f9638bc0
116738 F20101207_AAAWTP luciani_g_Page_115.jpg
495091fd5b509ce7671ca8ffc14ad25c
7d8791e2ce20fb3af441ae75b13cb4dfb62dc69c
28022 F20101207_AAAWUF luciani_g_Page_001.jp2
7c83509b9b163831b654ec7d61c791b5
241af7540a1028d3cf753ca7913bf475e663d53c
93259 F20101207_AAAWTQ luciani_g_Page_118.jpg
80e1d95d31a0cd8ef3e59153db0702b4
17fbb4117ae60bc3b48b7ed08b0402808d513826
F20101207_AAAXAA luciani_g_Page_108.tif
07510813ab84d00f0e75d0b46c6d9db4
37aa4bd3b348316d106822aac2c36cf07bac2fe4
101499 F20101207_AAAWUG luciani_g_Page_004.jp2
41d6b280240d4b0e260a15d316a10a48
bc1df4b58a88bee2a6bb04d0dd8b768a682dbd59
113788 F20101207_AAAWTR luciani_g_Page_119.jpg
e0150674a29b077c96f5ed5a18f7f0f0
4e5b1f41b9ecba9a874ca5b8162721b8f9c0e5d2
F20101207_AAAXAB luciani_g_Page_109.tif
ce3c8b96bd65fff7baa32f428af0a7ca
c4e1919fc4111d218e7459f7e5aba17cae216199
17170 F20101207_AAAWUH luciani_g_Page_005.jp2
72de15552d0da0d0f8226534f1520c01
fccbdb64b2ad71a8f8ee09092020a7d1aff76daa
76932 F20101207_AAAWTS luciani_g_Page_122.jpg
f2795b72298efe610f652d808608dfc3
1494c360d5c872c85af1bfd00fc8b723856044b4
F20101207_AAAXAC luciani_g_Page_110.tif
fb288ef72cc27afe5f1b088db2dd0a35
95ea3d05a3a07c5a5c680e782c12f020987a0617
1051984 F20101207_AAAWUI luciani_g_Page_006.jp2
4d702db8dacf34e777a9763301ad3a43
2c277e3065e1f17bf5a41dd7d0c8fedbfd4a0def
67273 F20101207_AAAWTT luciani_g_Page_123.jpg
cf52ccb3ec400d1a147f197b6e17819a
f510d5380552f8c89f068e0fa00eb38d6244ccc6
F20101207_AAAXAD luciani_g_Page_112.tif
8135bb7d35db41e82f723be424e88758
9a2141be30784b8e103a2629386909fc1db11cb0
1051959 F20101207_AAAWUJ luciani_g_Page_007.jp2
311f31a5a89f06888a1f972b9fc0ad76
1859e184ed68e770155d1275500fea79775bd5d0
100195 F20101207_AAAWTU luciani_g_Page_127.jpg
ca70434eb31f60acb6e0b5d126bf8d48
be9c4269bde1d9028b6da24688f16698354d0366
F20101207_AAAXAE luciani_g_Page_113.tif
d8d68c2478de069945ca47f64981e15b
5bc4dad93fdffdd8eb1815b104d847a0073124c4
87798 F20101207_AAAWTV luciani_g_Page_128.jpg
5cba24b3e5e3da9695d067b82938a944
79a685fbdb33aff27ceddc97b2247273d68615ab
F20101207_AAAXAF luciani_g_Page_115.tif
66f5263d6771594d23d5da0aa9732ab3
86b7a781d8c0f32041f41fa341db2d2fa62cf47f
1051986 F20101207_AAAWUK luciani_g_Page_008.jp2
bd05d835b6b4de6b939d2a0213ac67f4
068b91f412db8703b2e8e8b5e6fca618f24c1f54
102538 F20101207_AAAWTW luciani_g_Page_132.jpg
1c59850ef9883d984622c181cf186101
e5b43f4245c151f837407deaa5d7cf03828ab3be
F20101207_AAAXAG luciani_g_Page_116.tif
af6537f117b3ffdc8feca01a989db57d
56e3662250d46f239f7d05602b2c962cc78a8d36
120014 F20101207_AAAWVA luciani_g_Page_030.jp2
e1c35a1c2658d72bb25212e9c7ba550b
4a08728d2bb20b6c755d50a1c9f87096192ce551
109645 F20101207_AAAWUL luciani_g_Page_012.jp2
616e4afe65765d1d39b21dd173bd3d5b
e81853025c70e7572aeafd859480b7dd3d24074b
95641 F20101207_AAAWTX luciani_g_Page_133.jpg
b72ecd5807a7eac034675abaefa35184
e284e6415dc9938d87dbfd63a46318cd7cf5412e
F20101207_AAAXAH luciani_g_Page_117.tif
390f7606376abc52f59adee0c24a23f7
3e08ed8650e155ece305dc992052b7def8537075
113824 F20101207_AAAWVB luciani_g_Page_032.jp2
03f8acf9692eaca61506baa8d11d6926
54891d81b18848bb28712750c0d5e620e204ce0a
125817 F20101207_AAAWUM luciani_g_Page_013.jp2
b2c5fed393bb5fefb8019513f68be141
681f209f2c8bd160a7f61e12d0b342e6fb1fd1d9
97776 F20101207_AAAWTY luciani_g_Page_134.jpg
4b6f1390c487baa8c0879434db825365
16dded860fb257114248a12f68555dec22f27691
129129 F20101207_AAAWVC luciani_g_Page_036.jp2
75a418b8b2f74e4b826ae10f6bd8dcac
0dadb7465f11f39445f215f8e976a626be36d5a9
123578 F20101207_AAAWUN luciani_g_Page_014.jp2
e3f6810aa6da9aeb9f88c0155df536d4
1be8b493525774f1a6ccc652e3832d7d5a81d417
78825 F20101207_AAAWTZ luciani_g_Page_136.jpg
926c4dddfd3eab4748d1ec5fb46d0626
3d6f2ebcddb736f063c4c6980c015998fa2ea576
F20101207_AAAXAI luciani_g_Page_118.tif
719378a36de4e1b0e711a4f814fcc47f
6ad02f99290ebeaccc56cb9eadedde86ef4f9f3d
114564 F20101207_AAAWVD luciani_g_Page_037.jp2
36939133cdd7abc51e212d1664bde45e
cec202baf21d907da43c5dbd211ea10591b61b60
122284 F20101207_AAAWUO luciani_g_Page_015.jp2
4294da5b3d309d6b0f54484a78624e56
c755cdfbe47ec019cedde9e55fddb866e124f000
F20101207_AAAXAJ luciani_g_Page_119.tif
424e17455ea4e78febd5ec89ff209740
447b34a285b7ac9b84a6dbaf180bc6a83f9c804e
120938 F20101207_AAAWVE luciani_g_Page_038.jp2
98c5d61a7f5a4997caeba094f9090570
64cbaba3f05e07399d71f5eeca9f22196449c9ce
28652 F20101207_AAAWUP luciani_g_Page_017.jp2
9251c9b9586bc0db72077a90b2606b3b
4f8ecef303c0f1873ccddc1fb2ccea87392293be
F20101207_AAAXAK luciani_g_Page_120.tif
fdd9dbc01d7546f0684d9da5b04f48f0
eaade201d2ddd766fc97512a32a5e79ef0594f32
120234 F20101207_AAAWVF luciani_g_Page_040.jp2
fb0c563298a05bd2f0a022823493c0c1
6f29916494caea3a3011e5402db4685f6b1989fe
125154 F20101207_AAAWUQ luciani_g_Page_019.jp2
36991102513e6c6929761fada1354abe
6db0898857825cfd1c197c2bd5bdc2e4ca323cb1
F20101207_AAAXAL luciani_g_Page_124.tif
86a9ab95475efa98e05d29a8defbe250
85694a8305825c20ea33bec1405b80889657ab16
117567 F20101207_AAAWVG luciani_g_Page_041.jp2
df5ba4421c35ae6c0d83c1bf33a0bf86
786c45fd933a28a946e076e488e7ed4baec769d8
121867 F20101207_AAAWUR luciani_g_Page_021.jp2
3e6d7913ffd1bb5111cb2dc2b4fb0bea
77fc00ee2659b3609d4e7fa97db6ed92637a4a21
38149 F20101207_AAAXBA luciani_g_Page_008.pro
24903415d15e721dcbbc24cd4f312f0f
5dbf48e4e05b70371f908a3cbd405f459f65c6b6
F20101207_AAAXAM luciani_g_Page_126.tif
31dd94a02722c95cc0564d98738ce82e
26da183fc415f783fee0b031d1e2629144c2afd0
122633 F20101207_AAAWVH luciani_g_Page_042.jp2
cbce53c133fd969e5e4b29f4c9cbec11
ce28a1cc523e53d1bbc032c7881ede7d0a640554
118183 F20101207_AAAWUS luciani_g_Page_022.jp2
b6c9b3d5a2496373eac0246641ba4149
4b6fc81ebbbae9c55bacd104ddaf3a820edff3eb
55395 F20101207_AAAXBB luciani_g_Page_011.pro
2a43b5354077ec72ae213f3ebc8ab3cf
d0a42c6cd9a90bd990ae765c8e4768c3b4931f58
F20101207_AAAXAN luciani_g_Page_127.tif
e643174c44628042f59b6c71189c42a0
5830244135865d3ab37b5aca5c150351efb97f13
117191 F20101207_AAAWVI luciani_g_Page_043.jp2
1b156af25b51a5e47c55c0729907b46c
08bbaee0f0d5112c35c48643f681209a6504fe55
114548 F20101207_AAAWUT luciani_g_Page_023.jp2
eb2067e49c13e413ad90957a087d4150
555decd9ef904a26d1c16ab57e33433750df255b
57997 F20101207_AAAXBC luciani_g_Page_013.pro
9ed8f4e6ee73250ccc4c76b6d57800d2
179e19c10deea90c0d8b7480bdc387eec27b15f7
F20101207_AAAXAO luciani_g_Page_130.tif
cb923041ccd97ce162736c29637565d8
cf88404828bd34ca2ae158122c3dbde2580377ac
114809 F20101207_AAAWVJ luciani_g_Page_045.jp2
11657fa8b1636ccd15282c3ecc8beb14
e65f1e4921c80dc08ea1adb431d6a60bccc59834
121325 F20101207_AAAWUU luciani_g_Page_024.jp2
e2579eb9022b6da6cec4c6017fc158bc
c98bd9bfe2b3d0d07c6c0fa36d03284c0d09e16b
56119 F20101207_AAAXBD luciani_g_Page_014.pro
aae1198c8a1ffd6d9f2b3da0a78ac6c9
1e183159eb4fd8025955b1ce84a11db919011a8d
F20101207_AAAXAP luciani_g_Page_131.tif
6a63ca5e4d68e9b7b5d081f41ba5a16e
d44cfe9c5e6e195d6e8c7a3b47f78935d8c7b1a1
115978 F20101207_AAAWVK luciani_g_Page_046.jp2
b5121d40428b4a0bb06a9ce8705ce434
1e86991b7a6bbff01a4de7631f3cb38276d75510
114013 F20101207_AAAWUV luciani_g_Page_025.jp2
24b0b9bf38ae7687d86f7300bb31fd9e
11617e3273271975f16d428227614a01a33fed6c
56267 F20101207_AAAXBE luciani_g_Page_015.pro
6af96ff67b3a4eed3b24a00ca041f674
c152a2ce50d115390cc8c400b490959497610efa
F20101207_AAAXAQ luciani_g_Page_132.tif
fad1df8f026c5259894c8b12e55e8aa3
6d42aed37994db7cb079fccb6009418d8c74e868
119267 F20101207_AAAWUW luciani_g_Page_026.jp2
b3e8f779ebd93d0ecc3a4580d664a4c8
fc09e8f953671c6225babf3af07a5035c00c545e
52332 F20101207_AAAXBF luciani_g_Page_016.pro
3adb0543308240bb23f2e9bd6b0526e4
b0a76921fdafa0b9bf5ee473f68c2ec66bdbd086
F20101207_AAAXAR luciani_g_Page_137.tif
fe712ae2931e100b1ec1363329ac3b5a
aec4b6f29a1d36bc3e4b31f9a6c1c2669262b889
111975 F20101207_AAAWVL luciani_g_Page_047.jp2
b600ce1037d0289162627c18cea8ef95
9e77bb3633611847485174153d304d5826519d0a
1051971 F20101207_AAAWUX luciani_g_Page_027.jp2
f36d4c343a0b432aa765bbacd5864ba4
b08defd8af8b81f06ee0e623ba214f236791f62a
11902 F20101207_AAAXBG luciani_g_Page_017.pro
dd55a2e4748e83a336055a7455b48c3b
b53ed3a4fa7e0ac1d301dca1d11eae5b649ad066
124997 F20101207_AAAWWA luciani_g_Page_082.jp2
e17152bef1c7a8a98de4e9f4ae14c1d2
5ae46239efe2306c60a0c2b1ab5b2111b1a38659
F20101207_AAAXAS luciani_g_Page_140.tif
64ca2aa429d63bd98a7795ff9a356adb
5d61fe64bf87e84489cda149f4952ad83489df1b
125030 F20101207_AAAWVM luciani_g_Page_048.jp2
2f2a55bfec7ac6b5933e69838c9dcc2a
ff1e64ae9d2cc8433c44e5240db39a58f82d9637
1051970 F20101207_AAAWUY luciani_g_Page_028.jp2
861ec1b8b61a664eb7b28ce417716ed8
287730942220639c1a657398915691d495b98abc
48497 F20101207_AAAXBH luciani_g_Page_018.pro
550fd7faacac862542a6d01bba93eec0
0f54cdcbeb66ee13476cff3d34a6c68682dc1e2c
115287 F20101207_AAAWWB luciani_g_Page_085.jp2
635ae6b191f2cade4308ded7c35b33a9
bb877bff64d0ddde5afb03b57f657c436c111eaf
9374 F20101207_AAAXAT luciani_g_Page_001.pro
f1841f1d4a314f46b8480638850f9df5
71469897378c512285fef68979946077952130c2
37891 F20101207_AAAWVN luciani_g_Page_051.jp2
7f9df1daf44cdf76b842e269708ac8da
2a418de98160589c12d8101e9fbdcd64904175aa
125135 F20101207_AAAWUZ luciani_g_Page_029.jp2
5d1b678a98dc53180357c926bb7ae0ad
48697465889a78e266ef270ce7af926ca6642939
52841 F20101207_AAAXBI luciani_g_Page_022.pro
723c4e2ec4379a83c3a181296d75531b
36903be8813f353b64203031c438e8c0e230d74e
99892 F20101207_AAAWWC luciani_g_Page_087.jp2
59c09a39718d5bc405ce8cfbc8d47f11
449673c1ce27701603e62de0422a1069e2f17cda
1096 F20101207_AAAXAU luciani_g_Page_002.pro
7a98fb0b1c2a70f8cad70e68222d090c
7ea40313991b8b577543db5affb3921ea089292e
994688 F20101207_AAAWVO luciani_g_Page_054.jp2
07f502ed8a56bfc83b4d8ce9f10de284
ae6daa0bcfad09bece0bd79805dd94c3f362db68
52646 F20101207_AAAXBJ luciani_g_Page_023.pro
687e1b559f3dacc9ed23a5a544e6e633
1c920cedae185c0dac30b3e7926e594bcb9ff288
112501 F20101207_AAAWWD luciani_g_Page_089.jp2
fab5efc9e38c63c41ff5fca2948e5965
ce289865942a7a4b8f9af347d165a44fa19d6a16
122156 F20101207_AAAWVP luciani_g_Page_055.jp2
8070298f98a6c70ee47492a2973fb339
90f3f899c4fe9c2cbddefe903662a86f6996df15
57372 F20101207_AAAXBK luciani_g_Page_028.pro
96bfefbb483e08d6d5ad52e509a273b9
28112e0ace21c2b7a55db01b431e412c5a5afce4
120050 F20101207_AAAWWE luciani_g_Page_090.jp2
d7660cda171c9164aa478281be5d3061
1ea484353b07fb6b6783d1e1e17dcf9be42e45d8
1629 F20101207_AAAXAV luciani_g_Page_003.pro
04a0247c7dc6fbed4a63c11f94fe412b
41aafda4b99fe5f8c505bcf162b89ca55dc972dd
120176 F20101207_AAAWVQ luciani_g_Page_056.jp2
d06dee22fa50d059fb567daa848582df
88437575b0c4e317b6d07797c02292b1f3651ff1
57030 F20101207_AAAXBL luciani_g_Page_029.pro
4d434f2339987e7038cfdb9b15a13d3f
60941a3c63cf7733301b439995c34fb6466e8fd5
121103 F20101207_AAAWWF luciani_g_Page_091.jp2
caee511e3ab9bdc4a40dec974046fa72
3e5629238a83dfd41be9b82f9ac0b40ef44e16e3
46251 F20101207_AAAXAW luciani_g_Page_004.pro
35338f76ec0c11374f4ed981b3b7a21f
9d7701c57f103707194db17aa55a43a313e36a1d
118405 F20101207_AAAWVR luciani_g_Page_061.jp2
49ef5eef4a29903cc42e1082b1a6496a
617597341315e304de64a74828b866106071c1fc
57836 F20101207_AAAXCA luciani_g_Page_050.pro
0f402d4a17a05f4f662d58438b3cdc84
ccc6ac374f1d379319795d74e82b6bee4273757c
55615 F20101207_AAAXBM luciani_g_Page_030.pro
4ac4ab4db20fc72f404d24a06c7c7a58
1cb29e33c8dced4b6ed460fc881f273a066068c2
599615 F20101207_AAAWWG luciani_g_Page_095.jp2
52b38d59232ff8fbe40b499e2a8eca2e
afb64efcff24da483a2c654c78474b4ad51240ed
6428 F20101207_AAAXAX luciani_g_Page_005.pro
2e6809e5f33e84d69485182caaaef8c0
249aefbc524670d75ff759479a23e251a66e1c4b
115594 F20101207_AAAWVS luciani_g_Page_065.jp2
6b23b9e83fd284079c2fd2becb4e6825
2201c4cbac49c9a56ea23df2c96374017582ab19
15900 F20101207_AAAXCB luciani_g_Page_051.pro
6c5042415725538d640a34a1052244ed
07e031101c7f74d7f6cb2bdacacec2b9701b7d0e
55462 F20101207_AAAXBN luciani_g_Page_031.pro
4500938dbf5624c615111d321b7dc1e2
f9341b0f8a130dd4bf2e101293f8546771cb644a
595212 F20101207_AAAWWH luciani_g_Page_096.jp2
f4646710336441dbd72f91555708a785
1cdb83767db89c9daab89f29fbeacaaa901da55d
99441 F20101207_AAAXAY luciani_g_Page_006.pro
e8c83b45383ed94a95d7b32e2d4a6ac7
25e4b21bd17b67b85957f584559490554fc8ae15
119963 F20101207_AAAWVT luciani_g_Page_066.jp2
3d2f1ed81d864dcc216949659e898336
9ddb8ef1e9d75458ec5382a5ac671f83441def07
13579 F20101207_AAAXCC luciani_g_Page_052.pro
adfb140a8c7da497de98854385f01251
0ca2ab7d23176b2a708f3b9eb30ad9c648c5f1ca
51911 F20101207_AAAXBO luciani_g_Page_032.pro
4a8902fa0f6f01ae1a5f312719edf99a
aceb66ab70e5de46ac103d6ffa759f82e5b7263a
1051906 F20101207_AAAWWI luciani_g_Page_097.jp2
0e701ba6ac9e21168e8104c8d0a7779c
778c29dd1c4685ea807f7b1b7035532409765e94
115272 F20101207_AAAXAZ luciani_g_Page_007.pro
6dd8d05640488555fce1522a822f1f57
35e4a6f87208d4a90185604e468a8f8220719b63
119233 F20101207_AAAWVU luciani_g_Page_068.jp2
869fc82aa689586eb06c2a071e210fdf
b357504ac37cd6e03853b3fb251ff15c8e3de787
26399 F20101207_AAAXCD luciani_g_Page_053.pro
4ab41440884d136affa49a08370927b2
2b2bcfd1a62f84ab6a02d469fefeb88a02de1154
56877 F20101207_AAAXBP luciani_g_Page_033.pro
677e701709b063066451fe06c3b0ed74
3c06ae2ea1660f9a97bc57653d3a681e83449621
890588 F20101207_AAAWWJ luciani_g_Page_098.jp2
aae2a50fe546f6b5787d241ff830f1bf
26355c11860092d15815189ae69e1d4a1965ac7a
1051968 F20101207_AAAWVV luciani_g_Page_070.jp2
1ad376f045c1f438fe0f4f329636ae57
35b051464c5cb91ff1d9ac72e5bc698df1db3d28
27089 F20101207_AAAXCE luciani_g_Page_054.pro
bf134bbdd7b02a7370c102c4884420c5
431826f0eecc87cd6758e35f59e9862965783714
51662 F20101207_AAAXBQ luciani_g_Page_037.pro
87e3a9dc3849b2685fd0814728152eb4
93a36d5026bcb38b046af3516d75a759c2e6d033
1051978 F20101207_AAAWWK luciani_g_Page_099.jp2
6f45c474bef8537eac3e28377b45e8d4
4b8a11ae8d4865ecd0bb45ca4d1677082b30070c
1051975 F20101207_AAAWVW luciani_g_Page_072.jp2
fb913a92e471b45235d6a68ff091c9cd
0fa6236437db257c35b627cf9b358d5e3b73fb4f
54738 F20101207_AAAXCF luciani_g_Page_056.pro
9398d4378ddfc6b9dbf32ffc7293abd4
2be15d50d135efcd58fc62d48fdf14cf4aaf0645
57731 F20101207_AAAXBR luciani_g_Page_039.pro
e4bb839b7bdc17f0080acfec2d7653f6
68fd312cb660beef6bc8375a4df664e668a8a867
71819 F20101207_AAAWWL luciani_g_Page_102.jp2
91ce5b20f00002af501974f4d46ddfd1
2ccbae1952cd7db2befe6c406f691eeafdb5d91b
988994 F20101207_AAAWVX luciani_g_Page_073.jp2
43407702aa094612632e25c28366beb5
ab3b1e25eaf63a5538d4cbcd297b50857f193023
52306 F20101207_AAAXCG luciani_g_Page_059.pro
a72fcd65ae7125666439d0e7b28d9c7f
06aed0a7a7d485a7333403e242320252ad2781eb
F20101207_AAAWXA luciani_g_Page_127.jp2
5b672dcf1ca301ad4546ebad622b787e
2e676024fa0c6206a05f481c3c52ae2c3b8c1865
53057 F20101207_AAAXBS luciani_g_Page_041.pro
daceea65c07319be50fc8db193b53217
5ed70230b39c52a22d1b8a3268f1e4dadd09d451
1051797 F20101207_AAAWVY luciani_g_Page_076.jp2
7fa4516d9b1e77270593fcfc4c06b641
99bb15eb02af876d8a7c3a6f044c235de8b51aa6
50697 F20101207_AAAXCH luciani_g_Page_060.pro
885bab79a1fb134635ed1cb2e10ad72b
a7860573ee9300713f7e52aef3ff18e88daecabb
127223 F20101207_AAAWXB luciani_g_Page_128.jp2
f5a6bbb59cfbd7a0bf2b7bb17e279139
fba8a07030fb0136cf1b61581e65530fc0eaa0f5
54343 F20101207_AAAXBT luciani_g_Page_042.pro
7c006ebf6607ec3940c97bd3e5f317a6
fce1f2176e620f3130913085d0625a341ca29eb8
124054 F20101207_AAAWWM luciani_g_Page_103.jp2
5d4893a6604b36363638ed1b26c5f08b
f297740a7ab74fd8c9b8c5990bc76fd9c54727c3
116991 F20101207_AAAWVZ luciani_g_Page_080.jp2
ea5876ee024aeaeb99b11fa2daa68f7c
7e734c2d326fda4827bde928a68311e9aafeb7e8
51990 F20101207_AAAXCI luciani_g_Page_064.pro
d7df5476a7e5b0407efc66d3002e85d6
8685c439cd56ee1e1ac018765e718bb0a7bd7967
1051951 F20101207_AAAWXC luciani_g_Page_129.jp2
2f76b1d8a620295a4e17aeee9f1ac23d
751492477a26c645e6ce8504504e264b55ec4486
53140 F20101207_AAAXBU luciani_g_Page_043.pro
02fab1564632124ad7ed332f38b1f1aa
8fe14ad4c1e24607c7e3bef341b31177505ce7da
86772 F20101207_AAAWWN luciani_g_Page_104.jp2
8512357571dc73ca40b85fc13bce5175
16756f01022b06faeebf34f565055999e832ce01
51227 F20101207_AAAXCJ luciani_g_Page_065.pro
1dcbff56460dab60046ead5ab57ebb1c
35b2ab2c4b2352fc4e30e1f1fcb0d9d3d604aba0
1051963 F20101207_AAAWXD luciani_g_Page_131.jp2
3fb2cbe499421c79d0357775d7d17778
dc4b12a59ba34b505d21834fa8c091717ea80473
52782 F20101207_AAAXBV luciani_g_Page_044.pro
ac335be208621a65473175d3626f56a6
3601bad37e3bb98c0577a3b47e712f01ee6e77ca
39561 F20101207_AAAWWO luciani_g_Page_106.jp2
e8923692d8e112e20572629a7b0f33af
bace0fe83f215d005de904c078fdc68c7a252487
55272 F20101207_AAAXCK luciani_g_Page_066.pro
b6e7bbf6182315d8bb72a4c4ff2da521
d030cb29137164fade22edc8af33b81f59561e5e
138914 F20101207_AAAWXE luciani_g_Page_135.jp2
db56b01eefb27575a460e72e29339661
12082eced33e1a3343c8c033fa719c2a536c0aff
156090 F20101207_AAAWWP luciani_g_Page_109.jp2
4fc50e5a516a3e6ecf57f781deb3cb28
0f138e752de942c5b1843315d888c345c032ca91
56957 F20101207_AAAXCL luciani_g_Page_070.pro
fac4b20056e73f442f927dd8682b4736
d7c424189194a910b0e60b62c9cc50ada2f5c443
131979 F20101207_AAAWXF luciani_g_Page_138.jp2
5e4aa8f46703f2f01108dc5f0cb38b08
40b0552f413e5e87d90d096974faf1d18a842972
52734 F20101207_AAAXBW luciani_g_Page_045.pro
5d2b82a9b89f112791c3ece98029e4a2
efce860eeb4395e773bcc318aac62bc821d644b3
138811 F20101207_AAAWWQ luciani_g_Page_111.jp2
25050ad1f7600c3e51e0400057f4a3f2
ec66991c9b3a3b4580b0e6f0f7edfe397ab12a47
10244 F20101207_AAAXCM luciani_g_Page_072.pro
d5d383e5f92a0e6fd22724709bc61428
f1b5683348204e4b2c1d1a3a4d18805921f44889
134042 F20101207_AAAWXG luciani_g_Page_139.jp2
5b3dd87b9465af663070fca6f5c34aca
83f797d0d8b436404b626ca5f0d2f9e3fb413931
50663 F20101207_AAAXBX luciani_g_Page_047.pro
be2752f355ddd55661e8ed03ead059a5
9685ad59113202f7cc8544d70ba418a9ae52529f
147813 F20101207_AAAWWR luciani_g_Page_113.jp2
998bb2766e0c87ab287ddc4e09022a3a
d9ec772e7105c82ab5e6eef1fb04f1479df69129
21691 F20101207_AAAXDA luciani_g_Page_094.pro
7b6c357d84d9b5be422c93c2227a8735
cf8183156908829ad7d35d83ca2a7693f0c1e564
18525 F20101207_AAAXCN luciani_g_Page_073.pro
406b9045294ff0fc411372374fbc812d
514822e4be5f2117d0fa7984e8b8ea85c605d39a
125211 F20101207_AAAWXH luciani_g_Page_140.jp2
291e330cdf414c7fc0f14342cc3be96a
5876e985e0f5b36b0d805c293523c8d72b2e152c
57445 F20101207_AAAXBY luciani_g_Page_048.pro
f811f1577fdc040dc2b08cfd91ccd0d1
b82ceb14a8fefeaa8cde2c99cde75f09d3b4c642
170609 F20101207_AAAWWS luciani_g_Page_115.jp2
48863825742ecb3f1391bf2d4aef8e38
33e6ef6e1530e67c3f1619d640683066fef72035
16980 F20101207_AAAXDB luciani_g_Page_095.pro
9526250f075fcbbde48d941a6dda67a8
5f15111cf97347ab9c3ee1e6da33d68ca93571d8
23595 F20101207_AAAXCO luciani_g_Page_076.pro
e3488c3f80943b82f9158dbfb7f5cd65
517b937b8f42be9715ca66dde1061d6b10f8fbfc
1051979 F20101207_AAAWXI luciani_g_Page_141.jp2
2b61c455e64501b70ca5b69f3cff3328
6f472633d60dbed1e48c6c44cc0ef56fcb348b09
57271 F20101207_AAAXBZ luciani_g_Page_049.pro
fcdaed811dd6d8c70f7fdb6eaf83977b
844af4508541cb8fc473713e798f0fe652bacac6
148152 F20101207_AAAWWT luciani_g_Page_116.jp2
f28c310d52beb22b325b0b34531da72c
30294dcfda685161a00aea910168a719ceece03b
17518 F20101207_AAAXDC luciani_g_Page_096.pro
9d87bde23458bb0dac8a169d23982bc9
ef0acb4e799d622741deeda76ac5d5f8fbc7574e
15337 F20101207_AAAXCP luciani_g_Page_077.pro
5de37009d6d2cf4e5fdbe9fdec0fe467
c87d489cce4cf6ddd6d1f1f9544088bd2d38afa9
82487 F20101207_AAAWXJ luciani_g_Page_142.jp2
ad9dcabb213e48d1884ce57b8412e5c7
bfae6088a3a2a9952d9078f5d0d6dfe02004f5ff
170148 F20101207_AAAWWU luciani_g_Page_117.jp2
ee0f502c975848c2c353a54ec9d7a31b
0635e09fbec1f57c88a8419c910ffd0e18dd0a3a
22576 F20101207_AAAXDD luciani_g_Page_097.pro
65fb4f2cbecb217fc576ff4881c83b17
838d17f1df09b8becdd7c15e78436f2cb39d4da5
21158 F20101207_AAAXCQ luciani_g_Page_078.pro
31bc3522a7182e9753d990b1f251d52f
bdde6301113935a8d398eb97394d535c5b123b93
F20101207_AAAWXK luciani_g_Page_003.tif
6c2e66759b9460974d476f02137e5649
702337f225e5a1ae1672c4721b9efea1b7450d2f
138920 F20101207_AAAWWV luciani_g_Page_118.jp2
685afff2c7649a684f55d4925727021d
257597fbc0383a482103d0b369d3bdd72e9d7736
53023 F20101207_AAAXDE luciani_g_Page_099.pro
771d930c8544b04e9a64e202f730e1d7
b9f45d3b01391857e39774c520f597559eedd8a9
52505 F20101207_AAAXCR luciani_g_Page_080.pro
b7e15cb12b474417c21efcfe279ce316
82885cbf0ce85b19c93e6249e6754868fe7a40e1
F20101207_AAAWXL luciani_g_Page_005.tif
e30e2a79afd47bee9a95565351f21cad
ac2c6a1c1c233c51a929accc9c568d10f98c0061
168411 F20101207_AAAWWW luciani_g_Page_119.jp2
4bb50fd5f21508816a63c7d0687a7412
c4cdf26a8c85d6973f75c2c0efbe37bc591fe49f
58185 F20101207_AAAXDF luciani_g_Page_100.pro
521324c57ce2ec2ebe5e943c6ae71752
0df6376588bb092f7e2870d5520712ee3fff8a47
F20101207_AAAWYA luciani_g_Page_030.tif
c51fdea4698146c76e268858d97868de
7f1b475cfcbc03b57f979115e078ce0bcc323df7
53583 F20101207_AAAXCS luciani_g_Page_081.pro
4e62a9a27a2ad28bd3f48a129a9530f7
2d0d2adada41044e9aa03639e866f78f151f6974
F20101207_AAAWXM luciani_g_Page_006.tif
661540aa6c7857e059c2c217a24c57cb
d8d7461ba46726cb1cfa2692b9e923faefb0273f
155761 F20101207_AAAWWX luciani_g_Page_120.jp2
52b77be241b427df1ad90f236abab353
3015d5d3e966077d0d9f30df39a70f4bf25872fc
62057 F20101207_AAAXDG luciani_g_Page_103.pro
ba14c2dfbc3d749a2bc1d403f215b1fb
becafddd373c7ddb8be8ce35dce7e1d57ba55661
F20101207_AAAWYB luciani_g_Page_031.tif
c3ddaada47e036290c976f1a287a5759
21e8fca723aa60748f7484a88acd5eaa419fa01f
52261 F20101207_AAAXCT luciani_g_Page_083.pro
fd37a21500e88d7bcda0eecdc124d68a
3d5d5bb161331fa5ca8d247b077029607f782217
97392 F20101207_AAAWWY luciani_g_Page_123.jp2
f8f667784aed4d657946726698831847
b7aa1a0582ac8294afaf1350829982b69d2f2a30
17021 F20101207_AAAXDH luciani_g_Page_106.pro
36ca8a2266b8ce90f04b8e7b66cbfd1f
da4206798109b058ec8bc73526d1e278bca52a01
F20101207_AAAWYC luciani_g_Page_032.tif
4716211c2406143dd34d4f6be18bdfdb
4f339b6382cd2217866652c08cdf35d51c3bb795
52750 F20101207_AAAXCU luciani_g_Page_086.pro
0dcc39bbdee2609e1c15382128af73a5
83811ca6a911c74abc454477b91c7101cbb0fe7b
F20101207_AAAWXN luciani_g_Page_009.tif
41a015ec8d7fedbb88c069bda715b137
abeeda4a0f7f105660be246d2f10c0afe90452e7
F20101207_AAAWWZ luciani_g_Page_126.jp2
5992ed51a2f211de9efb45bc8997f2d3
75b335600885ec7b55fe5af16ae0f7402dbe0cc7
17311 F20101207_AAAXDI luciani_g_Page_108.pro
52b62040b62eaaceac2b91d2a823ca1a
2c5078b3672ade27851da225c2509dd04f013743
F20101207_AAAWYD luciani_g_Page_033.tif
666f92b599bf1f0ba07ce281bf772b39
58a5c1caede22abefcd6429eb1870e581cb7c978
44643 F20101207_AAAXCV luciani_g_Page_087.pro
fd5dfde5f9c259b6c8cf674ae82c68b3
d16c764a1cdce9a2afb5d361f83f24f54bd2e6ba
F20101207_AAAWXO luciani_g_Page_010.tif
4f16ba6b5011e8fff593f47ba5f0fc4f
4adfdc85a6ee8d8f92cc9663764996cb7c1b72b8
69591 F20101207_AAAXDJ luciani_g_Page_111.pro
a356f5dc923e592108c6569b07bbd40c
ccd29a19fe89426eac37535b624e79df642bdc2a
F20101207_AAAWYE luciani_g_Page_034.tif
e0fb9de7e3d84118a347d95cbdfdf6dd
147b40e176fe56ff638056312392d3ebfb064998
54320 F20101207_AAAXCW luciani_g_Page_088.pro
c030c226aa00008ea95dfdcddd0b1d49
de6c6af3c2fae31fa2d25c88b541022716400700
F20101207_AAAWXP luciani_g_Page_011.tif
00861b9b7b754fb199946200247252d2
0cce7b61986c3c6562e1bf24a3042b1bc327affc
80172 F20101207_AAAXDK luciani_g_Page_112.pro
f4c653ae8c880c61fb2a6389e35f11f4
5ed251a48b727301a469b6412eee8bbd9875846b
F20101207_AAAWYF luciani_g_Page_035.tif
48d8e20458b1e6b99e6d54240453d426
e700c3aa06da4f569bce52eeb1e20e2ee0ae39fd
F20101207_AAAWXQ luciani_g_Page_012.tif
632552c7ee2906bdbc58bc3279f11362
0b182881dc80c30169d8bb0cb3dc4e74f0ca594f
73117 F20101207_AAAXDL luciani_g_Page_113.pro
fa40275ac1ce2649a729210a5ff18823
ade8f09fabb1a2ba1c2d6a4e244f98abbfa6c5f7
F20101207_AAAWYG luciani_g_Page_036.tif
cbeab0245517aee18ff3b50f4bb377db
01f19f0c39d29894570f0e41e2752ddd7867bbb3
51137 F20101207_AAAXCX luciani_g_Page_089.pro
2a99bc31a2b3db6168b735743a013dc4
a1d3829b5f8c83e7e74575b107bd7aeae6a865ff
F20101207_AAAWXR luciani_g_Page_013.tif
430ab8af3b973f9b94c858483f460f5e
e543b8d5cc5077b62f7d85d5bcb48112e36104db
64111 F20101207_AAAXEA luciani_g_Page_137.pro
d88dd21c28dbf914933170b5f5c25ef2
08e0a50b2c162aae0e9de6787f4c67b77be8a1bf
77936 F20101207_AAAXDM luciani_g_Page_114.pro
2202c096313ec683425839785d47cb77
0842ac788db87e8bbba38cd85b556de1d3732005
F20101207_AAAWYH luciani_g_Page_038.tif
a514d5ce29d3b77fdbf4bd21a63e3c79
94d0fb560edeca1e64c76c9c341c75de7c97c0de
55645 F20101207_AAAXCY luciani_g_Page_090.pro
aafdc51949ac1c926b7ff320409a31fc
6e2e998e8890a7b7fd6dc0e17e92f0de38953cb1
F20101207_AAAWXS luciani_g_Page_014.tif
15953b311f04b402c13ead7d88d8c244
05553811f4a9910c8e5600649eb581064691c21e
61507 F20101207_AAAXEB luciani_g_Page_138.pro
e23d027090fed0497277c6d03a7f847e
bfbf3a8f83c8f29568f962a55a4c4472abe9632b
75053 F20101207_AAAXDN luciani_g_Page_116.pro
2ddf9857eeadc77cc0ff57f7213b7330
883fb72633d3da10fbf54d0c4adaa0c7a5439aba
55077 F20101207_AAAXCZ luciani_g_Page_091.pro
d537ee790a498fefed34852db4927396
74ac00ba9d4fcf2228341d189cb6ac65b5f058d1
F20101207_AAAWXT luciani_g_Page_020.tif
8d5d29cc7f9722ca0d9d1874e6d172f4
e3457d6798c92d98edd898cd5c85e9e9d6be0afc
61189 F20101207_AAAXEC luciani_g_Page_139.pro
c3115de0c1d3a25fdd3c98c3f52f8e0a
2d76a9105faa5ae315496c7a04d4d206b10f92d7
87098 F20101207_AAAXDO luciani_g_Page_117.pro
6ad307e48ab332cec892e213241627bd
24267822d28a79657dad366bb21a6b04fc92e3cd
F20101207_AAAWYI luciani_g_Page_040.tif
eea071db2a749f9f45e3fa11093a0397
1eb3c46319d18264579d5e7f4995cad806241d3f
F20101207_AAAWXU luciani_g_Page_021.tif
6e7cc823ae6397b51cd8ea4c9b2df256
3e4981abc299eddd4d0fe724750aa11c25bce665
58094 F20101207_AAAXED luciani_g_Page_140.pro
a012c31f2fe63c38c88cb295ff6f6f8e
402868287ed07dcbf73850c4ddd658832eedc555
78120 F20101207_AAAXDP luciani_g_Page_120.pro
341b7e33dd87a487421962577cd376d2
2ccd8f85943ad9c6177b524da3a70021e1252029
F20101207_AAAWYJ luciani_g_Page_043.tif
f7effc648ce638358fd8555c4b6c17a5
1022cd826331f71660f4fa65e2b9ee79d566395c
F20101207_AAAWXV luciani_g_Page_022.tif
7843f5c61f8920229f7be37d832b2e70
62bdc9302ed6950930020729b65510938397fd53
57885 F20101207_AAAXEE luciani_g_Page_141.pro
e15d1e1d0ad36f3e6739f77ef6254341
f2a587dab210ed479ec7af01480833686ebf4d3f
78154 F20101207_AAAXDQ luciani_g_Page_121.pro
9f4214dee96eafebf4ebd7dc96f2c569
12318b4ca95593a2ed8453247966ee5a63e1eab0
F20101207_AAAWYK luciani_g_Page_045.tif
63c5878e34d62cf6bf849788ab4cbf3d
e7c39b75c0fc2a79fd31089726673fe8eee90a62
F20101207_AAAWXW luciani_g_Page_023.tif
6cf1303fe58ea0405179feb354229b32
4920ec2b573c241a164e2297f096050317bfb624
36751 F20101207_AAAXEF luciani_g_Page_142.pro
e0c0a04a20f975db5e9140defd1383b0
e49db363ef1df82f397059fa6c3a53a83854d335
35061 F20101207_AAAXDR luciani_g_Page_124.pro
c854f6d162327a631e0d7b738b42c400
cb4d429a4f96342add965ab1c72247ef2dd62d50
F20101207_AAAWYL luciani_g_Page_046.tif
aa6e2c75be3120ee7a8b2183c3231ba2
ea25c213e063faaf4d62746072e0eef7d425b44c
F20101207_AAAWXX luciani_g_Page_027.tif
8205fd7223f7bba66b028d02ba31adaf
4f681a931135c01fdb5e08ce52137bae3714a500
37293 F20101207_AAAXEG luciani_g_Page_143.pro
99b775652805ad1fceaf0f7ead2b1a6c
36023de5276bf472927fdd7e3c28768cb484153a
F20101207_AAAWZA luciani_g_Page_068.tif
11df4da181b3d06b9a65755e1b6de118
892db464cdbabed8b5de80d07923664cb03f9a2e
17306 F20101207_AAAXDS luciani_g_Page_125.pro
bada8558d3bdd8f2e6f77a70af54c71e
f91cdb1041dec028f0f83e0082d829cac3d20036
F20101207_AAAWYM luciani_g_Page_048.tif
a517b8c9fbbfd767d9932e44efd6ffa3
81fe5f95e94372d5725ade3bb4b89bc4e8e0ee70
F20101207_AAAWXY luciani_g_Page_028.tif
cb722a2d74685d249b0528a853ded1a3
ad8130d775bb5eca51187f0f6fee69f51a8201cf
511 F20101207_AAAXEH luciani_g_Page_001.txt
16dee4294e17563980f6e680738866bb
656935e9e7b95f9db775f2f6837f6673dd267b65
F20101207_AAAWZB luciani_g_Page_070.tif
307f297c54e3014dc66e8ae4a1c2b86c
ad9831f0c143d6aadd740356d892cc876b76793b
60484 F20101207_AAAXDT luciani_g_Page_126.pro
3a2407b3717554c5c70e641a80eae285
10c30e958855370aa1a5798379a45bf2145d8793
F20101207_AAAWYN luciani_g_Page_050.tif
8340e950f30084811de3b0f8eac4cb4b
0be366136e5974a1ab714cd314e1d9bc4ec55329
F20101207_AAAWXZ luciani_g_Page_029.tif
e35d54d3d5da33a149193bdef60384ac
510673d3d39e4c43594a4090d5b3fc1265665e71
98 F20101207_AAAXEI luciani_g_Page_002.txt
72823330096b759962f3b3081d5dcfbe
0a2d62cfa9bd2c3668e33de689b73a651642aaa4
F20101207_AAAWZC luciani_g_Page_071.tif
bfd528d29318c1286e7fc3a5bdbb784a
5c6894c4055203ab1efb8550fdf965a33e3f6640
64830 F20101207_AAAXDU luciani_g_Page_127.pro
dfc9b84fcbd9a93c1f2cfca54726c703
e943e091032d1ed188a33f3e59ce814eea0c99e3
109 F20101207_AAAXEJ luciani_g_Page_003.txt
c71168edb86c163f9db70f389be12f41
78af3eb7c6fe5e59c09695d2e551bfedf8cf54ea
F20101207_AAAWZD luciani_g_Page_072.tif
f94e418363e0dc458d6517a5d9200d1f
c19e35025c8c15435b06bc4450998bdbb8114a59
58473 F20101207_AAAXDV luciani_g_Page_128.pro
c36897d99f224542be176b9f428d739c
c9c371aeed32e944921336bd2cbedd45fd80fd53
F20101207_AAAWYO luciani_g_Page_052.tif
2f1992e15f6dad1be412b34a7507a8c7
07f36646aea70e5157d80f7f7ca0c71410791796
1869 F20101207_AAAXEK luciani_g_Page_004.txt
5b75c97befd0a24dfccb6858077aa720
9760e0988dfbc6dab56dc2b14333d1898f4dcb90
F20101207_AAAWZE luciani_g_Page_074.tif
c1acf234072c878eb09fa84df94b712e
eaae9f724de96584a1f519b2c27dd29a0f12d4ef
64891 F20101207_AAAXDW luciani_g_Page_129.pro
f95c8cae57973a1d0431971997e7e359
14b2fc4343b5d8960f156e24620842d2f287198c
F20101207_AAAWYP luciani_g_Page_053.tif
ff220354f3470cf171eaf63e5ee08805
45e03983424d173cd5072e420351b97a53c01dbe
4745 F20101207_AAAXEL luciani_g_Page_007.txt
34dacb3c91e67fbaad79c1e52c2efe1a
2d87341e47111941c0ef380fcc0d0a589b52d84d
F20101207_AAAWZF luciani_g_Page_075.tif
997a2599ceccdf2af784611f4f0ecea0
d716deb83a7de60caa2cf8b62ccfd2f93af82948
56812 F20101207_AAAXDX luciani_g_Page_131.pro
6d29e78155a0b3bca5dd1e6b0a50e29f
986326c9ca086c708cb79165f9575b7341dd6620
F20101207_AAAWYQ luciani_g_Page_055.tif
b1ffccf7432423db04b452bfec44690e
6656858226d8c87ed365e650da63f7e9154f5533
2121 F20101207_AAAXFA luciani_g_Page_024.txt
d5d71f790ab6d5d6e028a99ecc99db85
105331cf0d232dcdb5d7e5c6a027c80aa9fcb88a
1633 F20101207_AAAXEM luciani_g_Page_008.txt
3a35d7ce02c5a1f0fecf69a1ea63d6f6
2902702c145aa6c736cda1a980b6886634d6b068
F20101207_AAAWZG luciani_g_Page_076.tif
4ed2769d07a71e52eae3ab4ac32c8c02
930087a85c431748a200e23ef3717df4fa8136f6
F20101207_AAAWYR luciani_g_Page_057.tif
b89ea665413f15b9c3ffea7f6e4d2a67
f7a2be90faef428540a8673e89c3c96969812049
2036 F20101207_AAAXFB luciani_g_Page_025.txt
058a2606bfe8de6992cc49605ae70d76
37b3a73a6c0fe7132cb73975a6bf3fd749ee3782
2402 F20101207_AAAXEN luciani_g_Page_009.txt
5d6840194930394626016b5c310b5ecd
9d03fe3370e50fe4c1614b82982d4859840207b8
F20101207_AAAWZH luciani_g_Page_078.tif
6c56bf8de9315065afa16bcb0d4380e1
1628bcb8bc223f55be6b16a6109680cd18ecbde6
64909 F20101207_AAAXDY luciani_g_Page_135.pro
96a03ac6709c61405765fbd1c32a75da
06c9f1ea01a0caa4644f36b93e1085830e8b2276
F20101207_AAAWYS luciani_g_Page_058.tif
404cd37c8521d262472863cbd73694b4
d2195209c709ca2e15330bc52d313daf20070af5
2138 F20101207_AAAXFC luciani_g_Page_026.txt
bb511a99ba60e13a1b2e5be41749525a
956786bee7f64fe09f79216340cfe419167208d4
2068 F20101207_AAAXEO luciani_g_Page_010.txt
90f06cc300ecab89de958090e8445c02
0ccd1939e20ba72403ee3148a088b115d4c2add9
F20101207_AAAWZI luciani_g_Page_079.tif
0705ed84156d0d38aca676227606c593
69f18aa243344448f88e99e8a93fc75dcca26611
52834 F20101207_AAAXDZ luciani_g_Page_136.pro
2c1a8c421908694bd9735c46c36ce9ee
f2b978c4ca6835dfbd40f7c5af27f992cd606c88
F20101207_AAAWYT luciani_g_Page_059.tif
aca3951935bee17c74570dae29ba4fb2
e4618146e5e2e929219812253d6c5cc4cdeec6f7
F20101207_AAAWCA luciani_g_Page_091.tif
8b0fd76431d938c73c06b278c35b8fe3
a9abe2229dd13e5d7c9f735e8f2aeeed15d0a3c0
2129 F20101207_AAAXFD luciani_g_Page_027.txt
80b43864449de922a150f073f3a388ac
743dcabd1fbbf490bcd9527a912a7171fd01554d
7423 F20101207_AAAWBN luciani_g_Page_138thm.jpg
fab37fb436dbd14af8776f28ed85a9a5
37164f47fbdff10bf1f7a51c491b551f470d9583
2093 F20101207_AAAXEP luciani_g_Page_012.txt
157807620fe64892698445e16d8bfa29
e00958e2776d2459d2f34d0658d5de3fdddc8062
F20101207_AAAWZJ luciani_g_Page_082.tif
68328aca939385be4ac11c9d2fbc6c68
703342a4298f4dd7d28ee0710df5875eee4d14ff
F20101207_AAAWYU luciani_g_Page_060.tif
ba865b6ba2fbd81a439703baf233dcd9
854e224c7d22f71ebbe72757d34793bd65cc1b92
7041 F20101207_AAAWCB luciani_g_Page_048thm.jpg
921479465b9c2aa368bc6f929124de31
a42a6c90d89fd7fd4d0c5f7ab483bf7b374777ac
2238 F20101207_AAAXFE luciani_g_Page_028.txt
741563e0287683675bc017a8c9624a8b
f99a7a00f4edd0a316eb97cfbac512b13548e62b
26092 F20101207_AAAWBO luciani_g_Page_091.QC.jpg
8d35d14dc6c5782f8420c13cb2a3073a
05089e26b530dae23ca6b38e890252416883bfcb
2267 F20101207_AAAXEQ luciani_g_Page_013.txt
373de4fed3942f11a2a2515d510bf977
a19c5cf84e1f44b07b1e0c1de105629959e0258d
F20101207_AAAWZK luciani_g_Page_083.tif
3f12b08ca79617ab45010aea8368e0d3
a8c7e451987ec04751ea7ad747771d467c045826
F20101207_AAAWYV luciani_g_Page_061.tif
86ea3c2a1eff6e895fa5cb16ffe73170
b17c9759a5929a3cae5b99adfdec1fd58e2ef82f
7658 F20101207_AAAWCC luciani_g_Page_137thm.jpg
763ba3ecddfe9a84822cc359fb64bb5c
17aab1fb410e27a6b8cb1b029eb305cb1b7c2f30
26034 F20101207_AAAWBP luciani_g_Page_062.QC.jpg
30c5d3530e11891194216925dc8d4353
c488c99100c47ba3ceec989cba6178c11bf8c100
2204 F20101207_AAAXER luciani_g_Page_014.txt
b7a256715c2368887ba4f65d1353a471
14b182424464ed481c7c8979257f975e715ab601
F20101207_AAAWZL luciani_g_Page_084.tif
f25f3f266e11aa0889681ff02a86b50b
298fbf4f48a9b2e8d1794cb3eb0c62b66a7651e2
F20101207_AAAWYW luciani_g_Page_064.tif
d497471f7a921e2e1a2ca8f4e9cd1b3b
9d398966ef42f8553ecf594ac5c7bcc33b586f81
F20101207_AAAWCD luciani_g_Page_080.tif
71d1b4351f87377387006391e44cbd5b
711ff7df40bf1a0068c008ea35245cb7e0cdc0d6
2177 F20101207_AAAXFF luciani_g_Page_030.txt
11b94e2644bb8a1887778c9181a09e7b
f613131668e14f0dcd154d152947e472801638bc
52748 F20101207_AAAWBQ luciani_g_Page_061.pro
da1e28155fcb6b1f959977f9efc8e8e6
521c0cc46e5bb4916c80025d8832d5fadaa163a0
2208 F20101207_AAAXES luciani_g_Page_015.txt
a618280cbbdf93be33de2d1f071dc98b
99fbed7a5194964875adb5e8f21e356b55497ab7
F20101207_AAAWZM luciani_g_Page_087.tif
032e0c5bc36a5437551ee7b24ce4edde
b1df15ffb17cf0f846525937268ec7103320318c
F20101207_AAAWYX luciani_g_Page_065.tif
94a3fbeb8125cc744f60f86140ce9a01
96a69abda0a6096ca67eb7257c41add4c88664f0
7117 F20101207_AAAWCE luciani_g_Page_039thm.jpg
79c9633ae41fe81ba8328faea2339cc8
4d072af0d0ca68e8db3c3576fb01d0ef6ba975b3
2174 F20101207_AAAXFG luciani_g_Page_031.txt
d685fc1e17377ad29dd3ec37dcff3d9e
2db0939585eab4b7ad1bcaa49c7652b22da15a49
19177 F20101207_AAAWBR luciani_g_Page_098.pro
85caca59d81182a88bb727710deb79a9
8e407b4578c931dc698ebc7236eaa59c22423e0c
F20101207_AAAXET luciani_g_Page_016.txt
530f1e9852e7e31fd72ad62e7b0054a4
54b10167188130a3b2f96ec7f9b6284c3066b717
F20101207_AAAWZN luciani_g_Page_088.tif
eeab284667cca0321b514e49e9bb148c
673c2961f0eeb33691f1d6c10421fd887d8f34a0
F20101207_AAAWYY luciani_g_Page_066.tif
66d1f7eb571fe6e1f934b536cfc2d5ba
17cc58da1f7f1e4abd781386f85295ffde0a5d7e
56249 F20101207_AAAWCF luciani_g_Page_055.pro
38b580a237c2af6937fcabb6696a5b47
2d4d1559108c7566163b70cd53183d93c9561620
2220 F20101207_AAAXFH luciani_g_Page_033.txt
7317e67f9ecc019ef607e5c05161235a
6e2b302795dde820a60293837b2f84bd06cbad6c
2167 F20101207_AAAWBS luciani_g_Page_011.txt
44572b21256d1be8652e33fbe6e69908
e1e7f0ab395dc06473bb04d584059e658c3fe284
2012 F20101207_AAAXEU luciani_g_Page_018.txt
061490a1b48fc92056e8a6f7ba8cbeba
c02b2829447e290dd698038d05fa5d92f82be678
F20101207_AAAWZO luciani_g_Page_090.tif
1874397151bc5bfbb09394f4d0b9e939
c38369f335f65ca3a03697967bc26b31cbd18be7
F20101207_AAAWYZ luciani_g_Page_067.tif
826c862eeaca2015d45dd3966275f650
83ea2eff81d35e696e16b1b061a17c4be2dad6e1
51699 F20101207_AAAWCG luciani_g_Page_025.pro
98c4bcd958906afe8d9d25ad8f7801f3
0d605fa4efbf304f0c8492dd8263c52b9d2225b3
2029 F20101207_AAAXFI luciani_g_Page_037.txt
f162771c1922a5fbd47c1f31b3988132
176852a3775cde72de183511a78fb1bc5d17b152
23517 F20101207_AAAWBT luciani_g_Page_012.QC.jpg
339a70fdc108d456fa6140e7c64c518a
aec590d022fd2f6fd4461180cdf049b42bdf8a44
2291 F20101207_AAAXEV luciani_g_Page_019.txt
1a34785ad16789b45496356d64144c7e
0049d35a7bca9c01a4000a2389d146cd204e5768
F20101207_AAAWCH luciani_g_Page_041.tif
64f3d421a56d5e44c3daaecfb15fecb0
e1d3b6cc704e19720798e04684e4f6f60002fa63
F20101207_AAAXFJ luciani_g_Page_038.txt
240af3b61ae5d6ea79b193d09996042e
c6cc532221501dec17d9bc29740a423a296aefe4
26787 F20101207_AAAWBU luciani_g_Page_029.QC.jpg
87e18a789016ada5bdb8d2de2ba31445
03bf3c72e1761e4a83b3478591fb4bb83e1251f4
2736 F20101207_AAAXEW luciani_g_Page_020.txt
6795a979594c15379d1dc1c09fb03c46
34757930f6cd26afc40a490eeee15d2a263b2376
F20101207_AAAWZP luciani_g_Page_092.tif
095d59dc84b0f6d7261149d7b51066f8
37881eba80b284ebc7cd0a5bd034ff0547f560f3
123270 F20101207_AAAWCI luciani_g_Page_057.jp2
5e0999daf3324182823c14d574a4f2e8
e12f6b298471826c9f054e3e854b8b85181dfc1a
2259 F20101207_AAAXFK luciani_g_Page_039.txt
3dafc35400b030a794aa671a4d47f750
51f5c78895cd9ee68f941c3fa1d893eaa516d5e0
2089 F20101207_AAAWBV luciani_g_Page_046.txt
aaebba8542d9b8cd9e15d8f7409f2fb6
03e96c0b5001bb142e0da878ca1add15fabfd84b
2175 F20101207_AAAXEX luciani_g_Page_021.txt
753dbd027ba9fa870aa7f8365df13f9c
45c6666a5a374ee831dd6047af41e7b9fb1201ae
F20101207_AAAWZQ luciani_g_Page_093.tif
e02b075179d9926142ffbefbb4cb00f3
ff61bb28923203a3caef42d3cb64828fec023929
115710 F20101207_AAAWCJ luciani_g_Page_086.jp2
92d5b35e6de2daa84e792d92850f1c7a
8802809ea9a9c0592b2d3b30f7881774f426fa40
2147 F20101207_AAAXFL luciani_g_Page_040.txt
f5784b01f9dd9443338ce4112078c0ce
e2fb4f5e8db6bfdad25b901c2ebcd6bf8c99d1a0
2224 F20101207_AAAXGA luciani_g_Page_069.txt
5bb52ed1980c7165b99cf4470671d45b
025b37e1f6b2665eab2ab40153829df88270c91a
6790 F20101207_AAAWBW luciani_g_Page_026thm.jpg
78d19c18a7368ba92747037c4451534a
81c3848c4108cfd1fc7b23b4eecb6f2ad60ea888
2076 F20101207_AAAXEY luciani_g_Page_022.txt
6bc26528b31605d13a32aa6f5cd22e42
a9bc7952cf1d1fcc16928ecbd1e99851d047f0e7
F20101207_AAAWZR luciani_g_Page_096.tif
8ef3378d275dddddc88c934928a4d7dc
3b359c7e3ca2c941d0b5da079f539e68713542ee
2241 F20101207_AAAWCK luciani_g_Page_049.txt
0b950b812472089b771f5ac210f12acb
45664e23ff30021e0e3f163d6d1b472956de7ed8
2077 F20101207_AAAXFM luciani_g_Page_045.txt
148be3ace6cb4a52a0e3e2b417f8757b
ab9ef2906fff664cec0ce6ac4f9077396ee96b58
2228 F20101207_AAAXGB luciani_g_Page_070.txt
a78825ecd2730bba08bf0b068232f5c5
6d3dd7dca55b95787adb9e17bf8163e076064e2c
F20101207_AAAWZS luciani_g_Page_097.tif
f925f8703d4c46b9c1a61c8bb4d0dd77
4385c232100812c766beb26700cf63962778df11
3075 F20101207_AAAWCL luciani_g_Page_120.txt
cf67f25cbbc46caccd1ccc22e6b2ca15
9a4ba9d40190747b725f254b98fe98aa3318e5a1
2002 F20101207_AAAXFN luciani_g_Page_047.txt
19804dec1fd7c00f981eb9228fde0ce4
ec42bb4073f60d9f7ecdd865c7089eceaeeaa104
1639 F20101207_AAAXGC luciani_g_Page_071.txt
15717e27cace6c4abc7a38b33b836e31
d3c1d8ddfc817ba00e3bdee32b5eaac4174ce174
2948 F20101207_AAAWBX luciani_g_Page_116.txt
6d159f461b0290645f1777e9e1bb8f8d
a537352b471a8b838e464eacd8c276ebd441af86
2066 F20101207_AAAXEZ luciani_g_Page_023.txt
ff613ddd69fbdc9b3e81245642efbca4
535a4d2c6419607b20c79bc33061ee4eff097ba8
F20101207_AAAWZT luciani_g_Page_098.tif
baee9aa4c84a6ebbd325e0a808ed75b6
773954b5fbbf910b08ee35577dc5f40a175ba1d8
F20101207_AAAWDA luciani_g_Page_047.tif
09035b1b693daa4f11eb9c2a81927955
157d742a7720e0eb249ca184d6f336bfd246781f
25478 F20101207_AAAWCM luciani_g_Page_065.QC.jpg
5aa464c5f67529c3404dec581da1a249
92bf2e6b43c3b87e3c8b4ecadd9dcebfde83aff0
2257 F20101207_AAAXFO luciani_g_Page_050.txt
cc395b0c641994767fb3a0bb8dec7377
70d5b29c767e8bac44b406b68ef05fee140a19f9
458 F20101207_AAAXGD luciani_g_Page_072.txt
8be653001b72cbf9112fbe946e5cf936
f22bda573e1144e495c7e785f27e2546a783e3fe
F20101207_AAAWBY luciani_g_Page_139.tif
d6d0f6fa3971646704989330fd5ad413
cd54cb9d65a62a4beb792db47a9f303b3fa471c3
F20101207_AAAWZU luciani_g_Page_099.tif
e99cc88193bb80a441c89cd3b8551bbd
cf71b193ee648fbec3dd3593d2c4b0ae44c1fb7e
2322 F20101207_AAAWDB luciani_g_Page_036.txt
22e2c2d4ca342955bc047a46ba7d41b2
b269a79410df4e1d64fb45357d1a0ac661f9bb66
124641 F20101207_AAAWCN luciani_g_Page_034.jp2
f7abb5b1479ef3eb9a9a1a906aadae6d
e67138117c5f9e4b73339645a3f28934b256904c
614 F20101207_AAAXFP luciani_g_Page_052.txt
32866fa313a7a64b75cf042134a95588
114edc451cf440a09fdb6d47a67145a81fe7b366
860 F20101207_AAAXGE luciani_g_Page_073.txt
8ae7e13ee13fa184d766e2b83061d14a
3a0edc64d6d8bf940ba0219972a609d63ecf5fee
22958 F20101207_AAAWBZ luciani_g_Page_010.QC.jpg
a111a56545c323bde2d5eb3e2d9e085b
74cb6db097d453afab33f8a23c28aa7927cdc434
F20101207_AAAWZV luciani_g_Page_101.tif
da536f59ddcdf350dd051d0a568760ba
ebad75999a61b31a32d508244f87bc11dd4243a4
16059 F20101207_AAAWDC luciani_g_Page_075.QC.jpg
c6c71d0d10cca1e7f220932710c515e2
e56d10648e990f999b620614f1a4e0ce4adf5905
106517 F20101207_AAAWCO luciani_g_Page_121.jpg
22f79be47ef0513e95634e4f131dd7ac
2a25f30e030083b7b1a6e279e2dbea982d642dbe
1441 F20101207_AAAXFQ luciani_g_Page_053.txt
6c4a4b543053886980929d0785796248
f2634319cbca39834b95419942010a74585901d0
1241 F20101207_AAAXGF luciani_g_Page_074.txt
6bbd43008dad42ff3d13fdef2bf241c6
d16864260a4f99e75a64ed3c45c6ac4565aa6a3e
F20101207_AAAWZW luciani_g_Page_104.tif
d1abdea69cb20840cd57184653d56f48
6ac95db1cae68e63abd305aad847ee917e343499
28533 F20101207_AAAWDD luciani_g_Page_132.QC.jpg
348454e05fd2d6126e227b24da72ab4d
a74b43fac60f9e4b7b67eaf032828bff0cd239c0
54599 F20101207_AAAWCP luciani_g_Page_040.pro
2bfe7a3dd45c39a09def853d8c42ce7b
8b73b090b04ad80529e684d4782f7ed7201efe75
1544 F20101207_AAAXFR luciani_g_Page_054.txt
3b289a8a158ffa6d95183e22d09100e5
444b51e508b14685e0fb47cf890621d8dd7ba983
583 F20101207_AAAXGG luciani_g_Page_075.txt
fd4a9fe12721d952a453bc196fa0d458
93e7e17be04b469fe126701ec674ef3dae932c35
F20101207_AAAWZX luciani_g_Page_105.tif
05de6a3fff54684c42a4b4c0264905d9
9a0aca16f38baa077d41b78c20298f036ba6c704
4543 F20101207_AAAWDE luciani_g_Page_102thm.jpg
0deddf746260bfd3097ede3551fd51ec
e0f94aabb5521fd0882494264c93a899170a2b14
2248 F20101207_AAAWCQ luciani_g_Page_048.txt
285d15346ede8d7d878a48092c977a2c
f7ccf4c6b99f3e057a1a4beb10bb9d1eab53cf8f
2285 F20101207_AAAXFS luciani_g_Page_055.txt
c7661dd2c832e6bf553ee781fc85f2aa
2e1c4550c910e726151ad2bb3e638a130ed00f6f
1025 F20101207_AAAXGH luciani_g_Page_078.txt
17a3de124d97f6ea15555f9db316a578
8a59660d7288b5397a7bc75d42def94a1ee6fa54
2161 F20101207_AAAXFT luciani_g_Page_056.txt
42735431b8544572a89243491eb9958b
64da701adf023f5a4f18584a80cd68233db3ffbf
F20101207_AAAWZY luciani_g_Page_106.tif
8a692a7e82adabf74c47fd619192b2ca
27832eadcde0c8b9c2604ecc236b281a799ed60f
75070 F20101207_AAAWDF luciani_g_Page_058.jpg
629c8175ffb10f831c5038d8a68a1bdf
c969f2dc805f3dc78e06060426ce1e0920503e29
1051957 F20101207_AAAWCR luciani_g_Page_009.jp2
28d0abef1e6373d6dcfcf71c80866567
bb1bf673d9ef879650507bd49fd2d5c51da22869
2180 F20101207_AAAXGI luciani_g_Page_080.txt
1bdf9591473a9747d121481a085b7210
3b125965056f1f1f99f5c27cbfe1afb9ba06924f
1996 F20101207_AAAXFU luciani_g_Page_060.txt
23f331506c7680d027ce4fe6e168e766
8bad8c44f387c6b6eadcc0771aeecbb61558e37b
F20101207_AAAWZZ luciani_g_Page_107.tif
4bd9e75bb5b5dca99a51215c1309a1cb
928de9c3fd8dd1100a1e1eb05d58c248b9d1916d
68471 F20101207_AAAWDG luciani_g_Page_004.jpg
5ef911996190adc366faa32c5fbd30fa
07a16cd7850d6d98c6be58166e0f3621454d68e0
F20101207_AAAWCS luciani_g_Page_002.tif
783b38d99b8bc4dc26dc350f08eb7d33
8026ae8128d705d6c1dd2454b61086de774bb0bc
2035 F20101207_AAAXGJ luciani_g_Page_084.txt
95bca560a0f96399a2c5cadea2f8cb62
577fa841cc2390d94de9c325cb816bb7ed13e72f
2071 F20101207_AAAXFV luciani_g_Page_061.txt
8fad20ffc092af1d1aa52843c68447ce
35583716a56702e6918a7108284bf676933869a1
F20101207_AAAWDH luciani_g_Page_100.tif
0fd3ba6529e97d13483aead786fabd6a
7f02f61e55f8dd0913a8c931ad8e430bde856d61
4824 F20101207_AAAWCT luciani_g_Page_078thm.jpg
ee8b04a45e9ddd609d29c8f46aa5bc2b
77eafa63b80ae580f413d21cf3d9c3df077d2e13
F20101207_AAAXGK luciani_g_Page_086.txt
00118ea6350a02eefcf8ec53d35b8f54
5396a62ccfb1e1c53b6ad40feb4cf21ebf15d06c
2075 F20101207_AAAXFW luciani_g_Page_062.txt
da0943ae693cd73cfa543d6a05a41432
dbf4d182c618ae2a739904e59a5e469fa45cf230
72182 F20101207_AAAWDI luciani_g_Page_110.pro
7ddb9f78b0eb9ef15cc74ef52af9ca6f
aef598983889d55edbf01cc0d813ad9b26043c66
116053 F20101207_AAAWCU luciani_g_Page_117.jpg
4af8e01b6b4d7f68f07f9456f5284cb7
7b47c6eacfbf5fe8019d0b4711d5e0cb2665551d
2055 F20101207_AAAXGL luciani_g_Page_089.txt
2167d51bafb3707a4da9b2caa683eb3d
d2525516b3cb919a1d3528262d46c39978723265
1935 F20101207_AAAXFX luciani_g_Page_063.txt
29157b7ad4e6e19427fa7b205b471209
30c03be6c700f0aade0b0177fc0178b42479fbeb
110410 F20101207_AAAWDJ luciani_g_Page_122.jp2
154005fdffcb4e94679501c168bfe557
537fed2e31ccf727a6324caf7428f4b76f241725
118786 F20101207_AAAWCV luciani_g_Page_059.jp2
c802c8af4924454e2096e5f31398a66e
fe0c4702f06bab075dfbc0ba7e9f77e618500611
2733 F20101207_AAAXHA luciani_g_Page_111.txt
99e0867e2d3f39727d8239d08ac3fbe8
b1c7c9d48c7d87d582c553ce64a53538c7584288
2164 F20101207_AAAXGM luciani_g_Page_091.txt
e30ed30d8c47b3c89c595d1dfa20bb1d
9f923777c41a7573c9974881d2c4a514072b0d44
2160 F20101207_AAAXFY luciani_g_Page_066.txt
9dec6977a9b9e33732b34b939eb0a87e
d10acae08d2dc2ce8902844ff2940ecdec335832
7545 F20101207_AAAWDK luciani_g_Page_027thm.jpg
3a8d432718713165cffed319c469708e
63c30093cbab68c145f944fbd11298dfe0772457
7235 F20101207_AAAWCW luciani_g_Page_029thm.jpg
66aea16bdf8bdd1b4ead0c408d8257cb
dba1368c4077d52a4b35a7520eb3600cbb7f6c10
3125 F20101207_AAAXHB luciani_g_Page_112.txt
2b9955e3d9be83fc95ff3120f79b1d64
3f04f6636ff5dc4a09882058d98604730da6b892
146 F20101207_AAAXGN luciani_g_Page_092.txt
b05f91e114ab6da1d48026661f836e6f
f42849b7f2a4fce2604e508ee0df438c870c70b8
1823 F20101207_AAAXFZ luciani_g_Page_067.txt
1dbea328f85c249cd7c7c391039928a2
8909e47c7046f9c83c0fcb279e73b4ae72553ad4
1813 F20101207_AAAWDL luciani_g_Page_087.txt
53596416ddfb7dde00f87832a651aa86
75e023980df23c40ce11e51bd5b6b9bc0b636817
105142 F20101207_AAAWCX luciani_g_Page_120.jpg
01709d22031b3f840b403202cff80506
dc5a5a2ed6d49201b40d3b2dfd7bb3d6a556cdfb
2872 F20101207_AAAXHC luciani_g_Page_113.txt
11e8acd4993d53d279e51fc2b3e519d0
76b8f93dd8957ac108767c6427c7c57db4177e9e
5774 F20101207_AAAXGO luciani_g_Page_093.txt
c72684d9e64f49b2d3b3f111ec30bae7
eb0221a66c061497f3bffbacbf720c397feb660b
2081 F20101207_AAAWEA luciani_g_Page_041.txt
06fa0516f91a7d8b5007b5bcd0f53bc4
0e2821b66ecd94c93a9afd7e5b0ddfaa10900a2a
26457 F20101207_AAAWDM luciani_g_Page_057.QC.jpg
a46ff6412c49dc347fada42071b2d491
f3eec51025fa85e48660f3a9e63dc2eb9795a547
2759 F20101207_AAAXHD luciani_g_Page_118.txt
479c42c9e5f3508ce934c88e75c0c9af
de443390efe1ee4061f5233ec42c06982be52df7
793 F20101207_AAAXGP luciani_g_Page_095.txt
284d50566dbd467ac6516ee42400edc6
7cab8c572201a93fec8d570637ae5d8e91edc5ae
82916 F20101207_AAAWEB luciani_g_Page_039.jpg
1160d0a6711509ebd2adac0b376628c9
f9ce728a680fcd2e8e720c5569fab6648d99a838
23352 F20101207_AAAWDN luciani_g_Page_017.jpg
11ed7717c969c23c5928f92ddb493c59
dca4d7905f151dd4caeadcd424183619ac02e5b8
29287 F20101207_AAAWCY luciani_g_Page_129.QC.jpg
5a5511395113402772d8b5e0f88878ea
839880ea9dc40e05b0c1157ab5d8535f0da274bc
3370 F20101207_AAAXHE luciani_g_Page_119.txt
4953c0f3a338403d508698f0fafd1cca
4cba1c5ae143b924cdcd008cb458111e84f8aef8
857 F20101207_AAAXGQ luciani_g_Page_096.txt
7895c3198a936c76a0a4a25e98cb9c7c
8453cb7903666f602ee557391fc7078783af8ffc
7059 F20101207_AAAWEC luciani_g_Page_042thm.jpg
7f1bdeeef8fe69f254a0c71340938abf
e06a09d12675e5e429ed722773f4944f96a00722
90883 F20101207_AAAWDO luciani_g_Page_070.jpg
eb4a2ddff7baa1affe0e0677eb22b987
5df18f98ff2597466731c7f84f584643c17f04e1
22028 F20101207_AAAWCZ luciani_g_Page_004.QC.jpg
6ad188a6a60d0af9baa11b3e35088d9d
33768c457c5bb6734c2db83d434493ebf9125d80
3089 F20101207_AAAXHF luciani_g_Page_121.txt
4e7777bf0eac7b4a60d705c11092865c
1689daef3d3c1b1ee77127c2c472456cb8f85e93
1068 F20101207_AAAXGR luciani_g_Page_097.txt
687d7bcc4147d0928a3bdcba4beae06e
3b11a6dc0dc38d362669c4f19d46d108962d89bd
126645 F20101207_AAAWED luciani_g_Page_050.jp2
79baeb993be881f5421bba1a1553f57b
acee0b5010dacf3863c41198ac02a8171296909e
449892 F20101207_AAAWDP luciani_g_Page_079.jp2
d58b4b53b3db779e3a4e19dcc5952947
a6bb882a031b485394d19bb698d46bdcf901584a
F20101207_AAAXHG luciani_g_Page_122.txt
48d6224d2c90a20e46672593c95ce0cf
ee93625c15d47024603099b7a021b66702f48ae4
980 F20101207_AAAXGS luciani_g_Page_098.txt
b9df16cd9394def08f13a5f4e2e08a38
173ba99d59d44d694309a6dbffa0757b9070c17a
2032 F20101207_AAAWEE luciani_g_Page_058.txt
683f6f4f25ff1ad3a93988e625d308e8
2c95a40970c0bfc56b3564fcf5b41799dd133340
9368 F20101207_AAAWDQ luciani_g_Page_108.QC.jpg
bc9c2716ed77078d1a35125a2fae724d
987639cdfc2e7cee57017f99376f3050bf70522d
1787 F20101207_AAAXHH luciani_g_Page_123.txt
839bbf9f04b26b8dba6efdd01745d1a1
3a3bf23322f239364b82d160a157c5d6ff21620e
F20101207_AAAXGT luciani_g_Page_099.txt
673963714c00fb844b95b597009a9c1e
d24ca3687d316a5114b7eca5d9b0759681905538
1051974 F20101207_AAAWEF luciani_g_Page_052.jp2
3ecbdd1269f2c51acd8ff158ad95a09f
aba319151fc0509d12ba2c253a7066192286d119
F20101207_AAAWDR luciani_g_Page_001.tif
9692eced0247303e328021c88db92f3d
db42e6938602a4cc9cc8f429686892bfe0c177ae
1509 F20101207_AAAXHI luciani_g_Page_124.txt
61be306fe8a0fdcd401cec6d2a69d9b1
b18f99430c2c59ae57496a7848f6f9e7bd54e8a6
2280 F20101207_AAAXGU luciani_g_Page_100.txt
dd55cfd6ea73a37d0a5bff62c64a92c0
067885c350db4708bf5a913e5c47fcc0f736a7af
25047 F20101207_AAAWEG luciani_g_Page_022.QC.jpg
6d59ecc105b433bf83f852f78cf70cc9
1d060f9b85f51f54d18b0a71ee807d7073298858
119013 F20101207_AAAWDS luciani_g_Page_064.jp2
7379bf647e1b9176a95192482ba6d2b2
46bbae0b1c4f31891e690d37e8a08758d04d32b4
2578 F20101207_AAAXHJ luciani_g_Page_127.txt
fc06b8c6a2a221cc93cfc57ed6bed3f1
b67853ceac1fc57c7ece4cf29deae30a04e915f9
2189 F20101207_AAAXGV luciani_g_Page_101.txt
e42108aa7a45261433405a6865485332
48226e98defdb46ccfab3ec52393043362733074
25769 F20101207_AAAWEH luciani_g_Page_038.QC.jpg
fe9a6db7c5fb19d7cd49908de5ddc769
7d60574f62ab53307a3f717441d2946b561d287d
6813 F20101207_AAAWDT luciani_g_Page_041thm.jpg
bf2974c06df242478c0ad46bb957b0dc
ec21e76d82b9a20f373f8ca4f2543c6465f7a3d0
2567 F20101207_AAAXHK luciani_g_Page_129.txt
46b8ac49f6933f0fa02c1b0c690b591b
9073e5795e2fbd03e524c939312de5afbaeaa8c0
1268 F20101207_AAAXGW luciani_g_Page_102.txt
c1f710f010d6f48353c8debc5dbd75f5
a9b04e2a9d5137b66c60154646266e0897f6caa3
121624 F20101207_AAAWEI luciani_g_Page_069.jp2
e21fd15b10deeeb2c3dea8e2d03a3d8c
af3f193be5ea032433d8c2fb4494b83ea280007e
48548 F20101207_AAAWDU luciani_g_Page_053.jpg
649a3384642a7f4db05c6e7e8f32535d
c54cb1a73958709929f4b7089df645f0403fdbfe
2262 F20101207_AAAXHL luciani_g_Page_131.txt
5797c6117157dcc6524e7d9fab883c5b
ae1c14300adb3aa71e62413f8bbf728f4c8839fe
2516 F20101207_AAAXGX luciani_g_Page_103.txt
0f813390cff7d84197bd56b8f44fbcee
78f99fe7f1026f8f8b31b3866644820076c04cc2
F20101207_AAAWEJ luciani_g_Page_008.tif
335611534f4059d98bf5374e097c247f
ee0b7ecad95a2b321932888c857c8031dcf795a3
95143 F20101207_AAAWDV luciani_g_Page_135.jpg
f35aa3332bd0e84686fe67facbc4d376
b72dfd5c5e009e0aa3688e00ab3f89f7233508f1
1450 F20101207_AAAXIA luciani_g_Page_003thm.jpg
bcce6c88b99595875c27dfacdd948bc4
3e3f589f97b883eb48dac8988fd56b68ae5574cc
2307 F20101207_AAAXHM luciani_g_Page_134.txt
93210211cc7c24b6cb36e56922801154
493aefbcd2ad47c651f3ba63ffa6a0ba5f2c5e09
712 F20101207_AAAXGY luciani_g_Page_106.txt
b4e2fda1185f6d098edc37a94be83ab3
34ce31ccd154326d78a8befb28a9d9a62882ff8a
F20101207_AAAWEK luciani_g_Page_018.tif
5f9ee62cec419ff710f4f1a532fc0d6a
05f3681cd12cd9c16a06b061ec73dda05f6c6204
7375 F20101207_AAAWDW luciani_g_Page_017.QC.jpg
d1d96ee3a035a76bc9e22602023cf093
7982d55b831dd3fbc00c0d01c2f65c9f7d92c96f
6329 F20101207_AAAXIB luciani_g_Page_004thm.jpg
b0968f4663f500be664a7d8279f4422c
cf550731ca8ea31d6a11b3990c6990ce2944e83e
2421 F20101207_AAAXHN luciani_g_Page_139.txt
bb1b55a2e1da108a5459ba899de53757
d0301095913a8e1f50c9c35a7224e4bafa52efae
802 F20101207_AAAXGZ luciani_g_Page_108.txt
749dd9526ce702bc951e560e4d7fe905
d5cbbb171c23df1f7d329aeb8ea8b3fa57bd6ebf
59541 F20101207_AAAWEL luciani_g_Page_036.pro
a4e8383eb58206f9ce54b19809bb767c
dca1ef8e182bc4a4802e9817145f5ea64a61f6ef
7029 F20101207_AAAWDX luciani_g_Page_090thm.jpg
6289121adeae4ba6112c8ef0a95e5bc9
909dc7cc23ab3a055bdb01a49aaec2f77ca7ae3c
5824 F20101207_AAAXIC luciani_g_Page_005.QC.jpg
ac0a414358e128ace4fb669ecfd2ba00
c4d1b65ca1a123a7c2602dbbe9ac93fd2374d12d
1521 F20101207_AAAXHO luciani_g_Page_143.txt
1ee088029763e51863cfada6a92791fe
f056d9c15a4d9b35bb2a59b5f7269a699e0071b2
2217 F20101207_AAAWEM luciani_g_Page_034.txt
2f54aa812c8ca67f5b60886c06acedfd
6c70f1d49d73c6c8436f88efdc8499ca3d0bbf85
121609 F20101207_AAAWDY luciani_g_Page_031.jp2
9c846df4b8c0d49167313a7b39b39bb7
fac18d97e648d9680c5f22024901ec8b7cf364de
28959 F20101207_AAAWFA luciani_g_Page_074.pro
68b79e84646f210136513ee745e83d25
4fee2850a90177e46f2efe16e9f3a4cbecd3fbb8
2003 F20101207_AAAXID luciani_g_Page_005thm.jpg
f54dbe9f0d9a4b76eb18a58a3de87df8
2083d5f306a6c76de9041707a9a43dc62a08aeae
2364 F20101207_AAAXHP luciani_g_Page_001thm.jpg
016ae4a4e52a13cbe2f91477176cc421
602fb008da7f6ce0a299551e2270cdca6da06c73
F20101207_AAAWEN luciani_g_Page_015.tif
cc25e0c7e506fe32c030ef52728ffdfa
1927da6df446018044c2d80cf6984a36f0cb2c11
3507 F20101207_AAAWFB luciani_g_Page_107thm.jpg
8484c8b41ecd4ce080e680101557f31c
b908bd25fdc97556cca7da4f5c4e1e736cd928b2
6087 F20101207_AAAXIE luciani_g_Page_006thm.jpg
a233c3ca9fff8b1a28f96b9bb729e3a1
ce82bc95e9bc17d094d4cf948dfd08e3b833f612
2566895 F20101207_AAAXHQ luciani_g.pdf
6c700204887562a8f171c69e705d6d43
54e995adc13c45eea98eac96828b8262411254fe
3223 F20101207_AAAWEO luciani_g_Page_106thm.jpg
04ec3bd918a1b57abbe9b296a61ddff2
f6c5064f9a8962db1a61a5ce1237ebebef9be41c
79423 F20101207_AAAWDZ luciani_g_Page_101.jpg
5d0d5258c727fffec31ff8cc86e5ddef
ce38617be01ffc5fb8a82dfbb1ae39bbd7915d56
37591 F20101207_AAAWFC luciani_g_Page_125.jp2
9ffa72c923a8b1f7f8b80009b5dc2b02
ff165cb1f76bb8ab054f13e6f143cfb9ff4aa903
3343 F20101207_AAAXIF luciani_g_Page_008thm.jpg
16116b8445c66a18a8c60781919a6d9a
b756dc3caf094ec9c3ec9cc20a66980e8d7089e2
7396 F20101207_AAAXHR luciani_g_Page_131thm.jpg
5ffdd1278e734453efab5e4af2319f4f
acaee7427d71fac6ab3a26d36aad0882b515f043
2053 F20101207_AAAWEP luciani_g_Page_059.txt
8f78e697e0a3b87b18c7803ded900e3b
627c38c9dbacdce284d6786fe87079bdd998700a
107571 F20101207_AAAWFD luciani_g_Page_109.jpg
2b345402f3a0175d6beb047841db3c24
c5b447c57189ddccba669e8e77dda0f749f80717
22359 F20101207_AAAXIG luciani_g_Page_009.QC.jpg
e3fbc1e7c7acd86e381d6ca0ebcfc7a5
8a7f306248029cca86d6d78be50d6f0b974c3c3e
5234 F20101207_AAAXHS luciani_g_Page_124thm.jpg
a3f37af6632459f62fe02d289f0d33b0
4c3b7f432a4bf180dd5f7c083fab8ea2ce433491
6792 F20101207_AAAWEQ luciani_g_Page_084thm.jpg
06eca445de8b12f012e584c64a54e638
5f47d5032a4de881638d901e13bccf8e2350a87a
77797 F20101207_AAAWFE luciani_g_Page_124.jp2
7aefaa0bdbc6af34a7e762849b163b1e
82d1b800f2309596b6104aee9c847bd87543bea8
6038 F20101207_AAAXIH luciani_g_Page_009thm.jpg
97d9f7b7b28467fa183361476b07c4db
c40bc222806de6d867b7783e2f77aef009f9a10d
31207 F20101207_AAAXHT luciani_g_Page_119.QC.jpg
30a70bab2a076507fb70604e7117e612
0af74efc7862e97b7953b4f02827f52ce5f943a8
5167 F20101207_AAAWER luciani_g_Page_094thm.jpg
5bafd3e9cccdba77360a1542d19eca73
9033ad9aecedc5b587465ae8281e2a9a68bccb06
64911 F20101207_AAAWFF luciani_g_Page_133.pro
33dff542a4935f9fcb1b6dfc2052531d
2d83366c02f1b028061471da00fbbc2f695d846a
25899 F20101207_AAAXII luciani_g_Page_011.QC.jpg
29973833e4600732164d9da122b9f31b
ab4ff98c710be83fc6f4b925c8313ad0e5815e66
26168 F20101207_AAAXHU luciani_g_Page_042.QC.jpg
758195f04a96441ce4faa1e8bc7800dd
6e5228af57063b29fe3ee7e5ca2bd6226085f726
6920 F20101207_AAAWES luciani_g_Page_061thm.jpg
51ba67e8d6b2708196369d6406e5aa70
5757daa05d2b20d25a48d96aab2fe9802fd618bc
74872 F20101207_AAAWFG luciani_g_Page_037.jpg
262ef99d8c7137d4789fbab1a1478514
f91b9d93f547ccaa37a68737d50293edf6d6df10
6528 F20101207_AAAXIJ luciani_g_Page_012thm.jpg
946be0bf0d53bbadcfed8e9248021451
734c445176a7020b7a1dcd9cf8826ac97804f24b
4367 F20101207_AAAXHV luciani_g_Page_077thm.jpg
5213be0fe5a06c97d9fe377f4341aca9
7fd3ca60bf95873228a26dd9b06bccbd45512de4
76996 F20101207_AAAWFH luciani_g_Page_022.jpg
514e52d4971f74a6226196e6eccfeb1c
0c46014d9fcc747779d6eb13747b144de3905b02
F20101207_AAAWET luciani_g_Page_004.tif
61969771d3185634b01d59b199050fac
5e7a9956f7663d914f541a87a77c0e3bbb722d26
27142 F20101207_AAAXIK luciani_g_Page_013.QC.jpg
a67c839134a2ed188af96c5bf800e98f
7027da47f1efca6951a27c1a121e1d219d15021e
6268 F20101207_AAAXHW luciani_g_Page_010thm.jpg
1c4d74650ae74173674ce608e13ca0fa
4c4b4f60f38ff5f6e3e4c2d69cd48d8e88790707
79595 F20101207_AAAWFI luciani_g_Page_011.jpg
ff0dd2a05a1cbecb547f44c634bff08e
6a58b7f2ebb4867401d0a309cd98d51a84bb3c5f
56768 F20101207_AAAWEU luciani_g_Page_034.pro
88eb4b814def983ed09645525e0e33cb
59deeef899386ddabc8a45d0fb63cf292c4544c3
26795 F20101207_AAAXIL luciani_g_Page_014.QC.jpg
573c8da124ccf1f405bddbbaa95248f6
b2cd9ad7b01581125283598ddafc71c69cafde38
11789 F20101207_AAAXHX luciani_g_Page_095.QC.jpg
631c25991c72bf76738922b43c16e511
3f63bf92633d07bc0829aaf2ef2aca17b755edea
2397 F20101207_AAAWFJ luciani_g_Page_126.txt
eebf83b3c10253f705c1ceca0b455440
7709575f1082f7c0b9a520763d6d256393becc1f
107282 F20101207_AAAWEV luciani_g_Page_018.jp2
abba890bb98567428c0d94884e8cfdc5
471cdb5df4b4a85a3f2e54c6677b9a2fc74ba1e9
7542 F20101207_AAAXJA luciani_g_Page_028thm.jpg
5ba0e5c33c5d66420a80347eaa673521
89a61444ce8cbb4c676f93988e96e26f40a674d0
6973 F20101207_AAAXIM luciani_g_Page_015thm.jpg
aa537095b262cc23a038775d2e980e45
b8523db211a370455298dc49460b8e857aec10df
215044 F20101207_AAAXHY UFE0019820_00001.xml
e2b28f7872e1435198d5749179baa3ae
b7c6a32b85b46200721cad5ac97bbcd8b1756d91
75454 F20101207_AAAWFK luciani_g_Page_016.jpg
61bf863e1843912e4b10f341729161b4
7ad21d9d25ad7a3168dfe55151074ace4925f303
879448 F20101207_AAAWEW luciani_g_Page_074.jp2
c6dc037b74a39485d1466293a8a8cc67
f3e099c2691bb44306c948f9992ff25426453178
25805 F20101207_AAAXJB luciani_g_Page_030.QC.jpg
a57bb57134527b07b747da081b9ed048
95df1ac5cbbe7a05a87418a75614f310ba166ba9
24655 F20101207_AAAXIN luciani_g_Page_016.QC.jpg
d84a29ce3603de9bfb92cf430d17dbb9
eaeffa354fcbb3fec6e14414c0a157d22859a2f1
3384 F20101207_AAAXHZ luciani_g_Page_003.QC.jpg
89c11067a7da922c985aa778183c477b
b783fcff95cdd99bd83aeb66320eba0aa91150f1
113315 F20101207_AAAWFL luciani_g_Page_084.jp2
bd5cad6e3ebbe4b745e773c224bce45a
30a207f51578be7cab601b67de9ee0839a3a07ea
2181 F20101207_AAAWEX luciani_g_Page_057.txt
b461b0c713e57b2a5edfc5ab45adf56d
bb537b06bbf93df884c5781645e4316e0486d7e3
6797 F20101207_AAAXJC luciani_g_Page_030thm.jpg
815b9f424409faf040054307f7b509c4
8df9cf1b18a4310a98f3ca92724a22258886ed88
2524 F20101207_AAAXIO luciani_g_Page_017thm.jpg
09ea0fc20ba7162e530c36dbccd58f57
412e8b0c9d74477faa515722a7a259aa18fe7765
24981 F20101207_AAAWGA luciani_g_Page_083.QC.jpg
3af0018bb98c9f1fc4578efdf03785b9
ecfeb10fbc016bde0adb582016e9465b555d93d8
116140 F20101207_AAAWFM luciani_g_Page_060.jp2
3457617ae4dbe8691a09cfcc556891cf
fece50f885c1da539a3c15c06e388423b0d6bc51
634290 F20101207_AAAWEY luciani_g_Page_077.jp2
295e3e5a4b638eeade8e7f954cb21ea4
74b76b6a7c3769ab1b8232d48ef475fff8d8b862
F20101207_AAAXJD luciani_g_Page_031.QC.jpg
4d67606d9fcc5f53602b6272067f3fca
248f793d8f18ed396a74675f94e2817a604a54ed
6341 F20101207_AAAXIP luciani_g_Page_018thm.jpg
b6a5fb8196e85f2fc26d9652198ab37c
f93bfcb7109065c32fc48f5994414f0a0b35f970
32917 F20101207_AAAWGB luciani_g_Page_079.jpg
eff935111c36df304b054964e587b379
de98ed76ed8ecef6a08a4c9a5bb351960dc1b99f
F20101207_AAAWFN luciani_g_Page_102.tif
fc86aa22843fc4cdb8bbbe20ca691e6f
4b42d7f1a39648204270f8895442c7ee1ce210af
28618 F20101207_AAAWEZ luciani_g_Page_121.QC.jpg
ad996293e176e9f84ea98289cad96607
8dfec6095a6484bdeced8a23d77c10f9946091f0
7000 F20101207_AAAXJE luciani_g_Page_031thm.jpg
15f1327e20ccdd79117c8fa99ab82ce4
8258187e87b03330322cc3c776bce194f18e124b
27683 F20101207_AAAXIQ luciani_g_Page_019.QC.jpg
5f695e9d65bfae563117dcc3df807598
9bec2b7e75859aeecf00135a94403ae81b61b110
3454 F20101207_AAAWGC luciani_g_Page_115.txt
c4ec986c13f9bcbaedb37829defe660b
cfdc4e5c4ab129ecf3b014de76104d2d05fb463b
F20101207_AAAWFO luciani_g_Page_073.tif
084bfe310d1b1bef1ef25e668de65f01
5fb93ca6523fc1b6b221a28a5a0f7c293ec1980a
24250 F20101207_AAAXJF luciani_g_Page_032.QC.jpg
8b9c6d4d8f06eb6f9ada5adc8f7bdbf2
b956a2ac01ac6daf841fec6cdcfafd4acf361d6a
7382 F20101207_AAAXIR luciani_g_Page_019thm.jpg
7be0fcc3873c75139f4b7f0bc67452f3
745c34427ab474dddf17d61f99e12805d36fc0e4
2575 F20101207_AAAWGD luciani_g_Page_133.txt
5c7f9cd74f6073ea6fd2da6d330dcab8
dfbc88e24ccb07f4fec12954f10111bdb6c34103
14947 F20101207_AAAWFP luciani_g_Page_078.QC.jpg
d43db821d2f21fbe0beab16e1858d402
a63989fae6b6371e5e8b63cbbd0591fd5409cca0
6635 F20101207_AAAXJG luciani_g_Page_032thm.jpg
aba0d58dcf12813bbb3fc016d4ef76f7
f4a0a5accfef045370433a6426caa6ed8ef5cd20
26403 F20101207_AAAXIS luciani_g_Page_020.QC.jpg
3b80e4d6e71dd602e3e346ac35c1e93b
de8a6ce993f37297c6d2255d5550ad948a4355fb
80085 F20101207_AAAWGE luciani_g_Page_093.jpg
247058fab825bac5e39755cb94978e82
d86d82ca545f5567f8c598c12b7690d5c40cd269
44955 F20101207_AAAWFQ luciani_g_Page_067.pro
fc4b7911102fb5cf3aa21c94f79d55bb
fee929f9bfc251fd5a3486ea477a4be6583e20cc
7026 F20101207_AAAXJH luciani_g_Page_033thm.jpg
81e0df74d1bc7b2b13aa9b6afd945658
9b9ccfd5ac4ee1cf082e050ba81a564c87c9faae
6916 F20101207_AAAXIT luciani_g_Page_020thm.jpg
e48c182866f36b1c77ce9af26f8d2893
0afb2503cf86af93701329dd4086f127d4965e8f
6691 F20101207_AAAWGF luciani_g_Page_023thm.jpg
5bb7f2d7c4c24e95a189fa63254c1db8
602425a9a3431b68b9a6e59f0cd87754dab992c4
1475 F20101207_AAAWFR luciani_g_Page_142.txt
88b9bc867ee74c905f7e6eb886fb1bea
696b370be4af9ae4939a678477cede23b237cc27
26385 F20101207_AAAXJI luciani_g_Page_034.QC.jpg
59f1456a763a0b93658d6f4dc12528f7
a46dfab1313daaa385dcd0b20bb99d04f9cf5b32
25908 F20101207_AAAXIU luciani_g_Page_021.QC.jpg
36f60a323ed26c4bb3a92595b8c8e5e9
650c6944f5c7610af70af15c9205252c4a8bb0fd
2110 F20101207_AAAWGG luciani_g_Page_081.txt
3bbd4e2ced0791329e53982bb3517548
7d33d1921d6eddff73944a0001e3a1e14f76b48f
7780 F20101207_AAAWFS luciani_g_Page_135thm.jpg
7aa39de9bc28fc575f972bc96bd37065
b779d5602e9301027d23837b70e7a6979d214c88
24435 F20101207_AAAXJJ luciani_g_Page_035.QC.jpg
bbfe33fa3dbb174cb561ffe3572b6d77
f9727bbacdb02bbd14c05d2af29c9bcd1e885d85
24268 F20101207_AAAXIV luciani_g_Page_023.QC.jpg
cd6e34db988b6ba44f035dea2915c746
fcfc06eb6faa2951e9ba37411c1a32d5f7ea0150
F20101207_AAAWGH luciani_g_Page_037.tif
ecd5356736c0ae2e34f4dad272f4ac72
ed87ee9dc6eca9c565c622214690805f0b85c1ce
7188 F20101207_AAAWFT luciani_g_Page_049thm.jpg
ba0a5bfae3e52ae3a37874850bb19da8
ee37671902bccc26f74b3b0e094fe528832e175e
6625 F20101207_AAAXJK luciani_g_Page_035thm.jpg
9e66ed3492f2575e3b068ed1554fb705
f2d8f2cb93d3646f5fd89f70cb46c284affa8834
24581 F20101207_AAAXIW luciani_g_Page_025.QC.jpg
0196d4eadd4e676f32930c76709e831f
49a1bfc2974baa0a4650f8df7be93d6aa1ddcb8e
F20101207_AAAWGI luciani_g_Page_128.tif
92914dba5efd786f43d063424acd6731
0959a7e47a3c8ce38e3825a2ca87094f67e223aa
2240 F20101207_AAAWFU luciani_g_Page_082.txt
b298886bda12d1951a4a0dd2252f849a
37fcff6207a666ad6ea9b01c36c99f8ec59b49fe
27191 F20101207_AAAXJL luciani_g_Page_036.QC.jpg
51e3b6e2cd249ff2d509559518de5c1c
b648ca6d803836540a900f748eb9bc18f5835d88
6807 F20101207_AAAXIX luciani_g_Page_025thm.jpg
433496046eb1168e9c4141bda4327978
67a16fae464845d878f67637a0899aa70402b5cf
86823 F20101207_AAAWGJ luciani_g_Page_072.jpg
e1f58769584e12956ff05476f5ce0c95
dfbd7be076ceaa333b9af2578ff7d4a5ed9011f2
1051851 F20101207_AAAWFV luciani_g_Page_093.jp2
260bddb243840687e5e1bde29bf513e0
c68946e5d3b3c7310af639518ffe9d15c6bfb521
7283 F20101207_AAAXKA luciani_g_Page_050thm.jpg
365ea0309d59441695b4c1396b887574
563b7dccf3e125cd3baaf5b02026e40e1b090176
24029 F20101207_AAAXJM luciani_g_Page_037.QC.jpg
35dcd7fc01922d1642277867d621eead
f1fcf07ef1f5c8fa1cee537c9867db16b906d009
27034 F20101207_AAAXIY luciani_g_Page_027.QC.jpg
9dd9de18485d382fbd13ad4c0655ac32
62356eccfdb75e4de208a1b6100ccdf0c961f802
29103 F20101207_AAAWGK luciani_g_Page_113.QC.jpg
464c3615609f8417789fb5f9506e24db
2f1a5b065fec4459c511242a4440ab9f9dfb696b
25414 F20101207_AAAWFW luciani_g_Page_040.QC.jpg
677b65d8bcdf816c81d07d2e411f6489
9cc44bece6c2ef5368eeb3dc2a5efa20df97a105
9571 F20101207_AAAXKB luciani_g_Page_051.QC.jpg
97f85938a9dae9878f7c531a2c7f9613
bd2b7a679bcc49656a26ca7aec222489843e06fb
6890 F20101207_AAAXJN luciani_g_Page_038thm.jpg
3fd97b913339333767a78a82be2467e7
61951f3e1299885e9ce51970c1490d99e98d2c01
28762 F20101207_AAAXIZ luciani_g_Page_028.QC.jpg
d348162e021649bcbe552678044a20ca
98e240db85701b53b4eacc462f2deea0167d7818
41453 F20101207_AAAWGL luciani_g_Page_071.pro
e018f4231793f1061c19a83c59f8220d
92e3fc16f69b1f80a4e8149b2f69bcb05000d653
7148 F20101207_AAAWFX luciani_g_Page_062thm.jpg
27b88e4f200ceb3169ec0cc0bbef647a
bb3d678d3ff733430eeb9b7caee2d806cbbbb4b9
2831 F20101207_AAAXKC luciani_g_Page_051thm.jpg
315376de269197d658787e5d4995800e
b49e5e3593b3597bdb654c9bd695bc8a65287626
26750 F20101207_AAAXJO luciani_g_Page_039.QC.jpg
622e85b83ad9f801414db1c517ca88ad
9fc3f8a819ff608e70e6c5bf52de16ba26f82423
40329 F20101207_AAAWGM luciani_g_Page_104.pro
7a08da20b991d349d988cfeb45b4bd0e
374e3b00f1d453e521d108479a37642a0bd3d3fd
F20101207_AAAWFY luciani_g_Page_007thm.jpg
fb3abdf9b36551daf4a41e1d348256de
0bd905d5afb2a108f82c4a5146e7672c6159ae40
26881 F20101207_AAAWHA luciani_g_Page_139.QC.jpg
507180ad210e3278aabb58a81a16cca8
f238ce354f81da6211ac590df947e6ae05621e67
F20101207_AAAXKD luciani_g_Page_052.QC.jpg
8b03b5c9782de2b1412ba75aeaabd5cc
a073f1a235adad9ac031e3f02ea8372e06799833
F20101207_AAAXJP luciani_g_Page_041.QC.jpg
46132780bccda9c4f7b4619510820fc0
3d02c6c56a77fe8fe6782a379c8ada84bd7d73d2
24407 F20101207_AAAWGN luciani_g_Page_107.pro
40f0df870fe936fa5f6a95d5510b4a36
70fb5041cc3b383c14cd1d0e2854f85384984653
115614 F20101207_AAAWFZ luciani_g_Page_016.jp2
e948b3503a3ae241004113fdbb404cea
7fb06e529494df896f7e918a3d69c76a0533ac98
18111 F20101207_AAAWHB luciani_g_Page_097.QC.jpg
f2d18de71830c2897e20cbd9ac475853
8c533e938b3ce8c8307b96b69821d56d1478fd23
4664 F20101207_AAAXKE luciani_g_Page_052thm.jpg
7ea888a5c7d5b188ade510ae8de6e3c9
e11734a8e671cae94f2f40e4e9706cee1e23cb90
25337 F20101207_AAAXJQ luciani_g_Page_043.QC.jpg
ab4977754feaf95c6f73f73050991a9c
9313023dbff3a906e96b588cd91e4ebf0776ef79
1998 F20101207_AAAWGO luciani_g_Page_085.txt
a0abb14e1427f59fba162c6c4204c8f9
83e6480d3bbfca3978eafd7a4063ddf5efbd0bb6
28856 F20101207_AAAWHC luciani_g_Page_125.jpg
dd323137ad67ff804abcd30df5be7874
8be7e106220d0d8492351b54680bddce6e901172
15432 F20101207_AAAXKF luciani_g_Page_053.QC.jpg
1bf668edc367672468e391ac4f713204
43f88b685f803e7dd27af8851bfd4c2ebc96cb74
6933 F20101207_AAAXJR luciani_g_Page_043thm.jpg
1dc61d0e1b5b61f9dfc8e233abd007cf
7e293126da27ed09f94509b0844605b7b80cd1a4
6978 F20101207_AAAWGP luciani_g_Page_091thm.jpg
c23b6688a2ad30d3cf55399586426409
94fe55bb6a00d0aca0b935c886c19f02abf00bcf
53886 F20101207_AAAWHD luciani_g_Page_124.jpg
5fefc3d1420c157a7d2d9762369a0ef8
a81c391e7f56fd4be7e7e122844f265f8b397d70
4886 F20101207_AAAXKG luciani_g_Page_053thm.jpg
0aa27d8e1a411c6ed9cf5454cebd2c46
1422642097ce387c7285348613733349bc947a86
25010 F20101207_AAAXJS luciani_g_Page_044.QC.jpg
d1e20f79117996a8b1c2744b5f9dd9c4
c01d94a04a80a51268380ca7a01b2e67018083a4
106608 F20101207_AAAWGQ luciani_g_Page_114.jpg
b37e909f785413b2ea2893adfec6e251
5b370756b777d73fa557265305509c9a6409a735
25514 F20101207_AAAWHE luciani_g_Page_026.QC.jpg
e7f04d713d8f87d470eabc0857370e04
7fa561a80cfa3d92450de67605c3f1122024e02c
3922 F20101207_AAAXKH luciani_g_Page_054thm.jpg
681039b2bb83c9af73dcb08c16840112
ae2198a3cc055ab881b9a3bbca6c0712972cb70c
24606 F20101207_AAAXJT luciani_g_Page_045.QC.jpg
c3f981ced46248b39ebafaf125cd981c
e4ca3262a92741cd0d7a4b4bfb86d3337bec26d6
51275 F20101207_AAAWGR luciani_g_Page_035.pro
e8d8f3af729b595e5bce6b0168034fc0
3c2b45ae10cdd0728f4158cb32d2c00b051fda68
1051985 F20101207_AAAWHF luciani_g_Page_132.jp2
6b7559065f8afac31803216ed3649aec
9c4db60a54a5c83534a193b82587a03d65f03ff7
26722 F20101207_AAAXKI luciani_g_Page_055.QC.jpg
a87db98bc04516d261a69a9452ee1c79
f2e3318fe671419a240d55683ce6b62a969de714
24651 F20101207_AAAXJU luciani_g_Page_046.QC.jpg
025a73730b261cb50a6b9ac33a8ef0a6
327a5bfe9ae58fa744a4fd3a75eeaaa848d74be3
F20101207_AAAWGS luciani_g_Page_134.tif
c33b28dfbafd954c5277e3bcf1d00075
4b3118f8d8cc282aa4aa25877c9a910ba231a48c
145332 F20101207_AAAWHG luciani_g_Page_110.jp2
7e5bf8854f0566b48bf394300b5c3143
3607c4fca246ab8723b1c452b63dcb0896b04cc9
7169 F20101207_AAAXKJ luciani_g_Page_055thm.jpg
b6ea7ec2fe630de190350ef82dac6724
c0e1e89a64fb057fce63001ae57dece3802a775a
24301 F20101207_AAAXJV luciani_g_Page_047.QC.jpg
a0a425d398ff940446f7359cd2430caf
56e0f8c6396cba540f958817c338b7d73c481160
101007 F20101207_AAAWGT luciani_g_Page_067.jp2
36f42e5526ed92ef56e385ab5c9bef6a
114091bed0554c8e426cb87beef875d00512a475
6895 F20101207_AAAWHH luciani_g_Page_024thm.jpg
9ea1e43480004a5ed99fe4b5c4a888c3
65ed1bfdde337eec3c500ee15ce22ff09de2aed6
25615 F20101207_AAAXKK luciani_g_Page_056.QC.jpg
ff40bb8d22000bf504b4ab32194806e4
ca0c5055a7f16ad3cc02b97f9690894527d63dac
6452 F20101207_AAAXJW luciani_g_Page_047thm.jpg
09ea5df554f166f5c29c81d999a12853
d8ace0d8ce401ae937d4e34b9c76dd5077f130ed
79377 F20101207_AAAWGU luciani_g_Page_021.jpg
43ca579e1e5541027aad4ab504abbdda
2febc048692d0b0331c8a6ff75e0498bfbaab3c4
84660 F20101207_AAAWHI luciani_g_Page_143.jp2
6dc8f9008d5ed38d0010b99dca0be529
f9efbff939949c0eadd0b2ff06be233aac3ea156
24616 F20101207_AAAXKL luciani_g_Page_058.QC.jpg
4221e391910ae7880ee08fad0872a977
8b4758c3da6fbf66807014ad3ba6699a138ea368
26598 F20101207_AAAXJX luciani_g_Page_048.QC.jpg
12af55e3c9be76187e6e81feef384626
63c0f1bb0b78d43852cea2aa0d8a3f5f4bd1cdb1
F20101207_AAAWGV luciani_g_Page_007.tif
8a170645143a7eb790cc107419bd1239
72de64b246b96a005f7ace763eebeeefdb011903
6769 F20101207_AAAWHJ luciani_g_Page_022thm.jpg
6102e6ad283b7da37b6e270b32be77c3
30ce204f7c77805555ec3b996eaf68ba23c383dc
7495 F20101207_AAAXLA luciani_g_Page_070thm.jpg
5a0c1b48f61805c98addb81f3329766c
bad8482bcaaa4e4cf7eb197a41f550fe033e41ce
6849 F20101207_AAAXKM luciani_g_Page_058thm.jpg
8f8ac94406c26da0bb87644a91e9009d
fb72e23e86bbbbc3f8a941c749dcd1e342fbcf72
26643 F20101207_AAAXJY luciani_g_Page_049.QC.jpg
7d55e3f658652ea218df53b14afd414a
88a9a3d60105a649cfdbd583ecccc8e53953f76a
F20101207_AAAWGW luciani_g_Page_094.tif
fe5e813f8d560476eb595a75a675e889
04fcce0cb11a9b0f770190c271f9853d799d1dd3
78305 F20101207_AAAWHK luciani_g_Page_088.jpg
95ecb426ad1e0da5c4bf63116937d8f2
fb5cb0c370d7a4ab60073b9b8480152ff72178b7
20178 F20101207_AAAXLB luciani_g_Page_071.QC.jpg
dff7e8209d7efa58bc89d7f427cab944
87d717e2be4db3fc98ade34cee9b8bf3e3495184
26300 F20101207_AAAXKN luciani_g_Page_059.QC.jpg
bae918b7ddc9679ce44f9e00a371ce37
f5e6cf9d7016bee728e23fdc28f28044618fc6c1
27343 F20101207_AAAXJZ luciani_g_Page_050.QC.jpg
e870b7046805ec431ea0b2c4d170deda
3b9e31ff98fa30f87759095b9551845cb2010651
490 F20101207_AAAWGX luciani_g_Page_079.txt
df3d8a26db34d3d77f809950af5ee7f1
aa2d6c5e01747e9467d06cf866f688141da93481
F20101207_AAAWHL luciani_g_Page_051.tif
e2da4dbf2cfc5d3bbb8e9ce4657e7087
975e67acd87ba7a3a5b7b1759744f69277027da3
5495 F20101207_AAAXLC luciani_g_Page_071thm.jpg
b6650802f13be5f9dd08eaf4e8337418
36714a045d4bb3e8e98a4c9f2d3e87989ad5fc36
7063 F20101207_AAAXKO luciani_g_Page_059thm.jpg
c53917fa5c90ff70e1fa4752ff8f02d8
d2beb310ae18daafa41eef668b4e90946d1f748e
127741 F20101207_AAAWGY luciani_g_Page_100.jp2
211e117a6d8fca7dd6ce945113317616
c8dfb48e86f7691dd76394fceb34d76fd682f9d2
6997 F20101207_AAAWIA luciani_g_Page_101thm.jpg
41b22af2ebba8c3812099c2158c0ad78
c9a93ed9ba8c24cbef89aee8642610395f7b2378
929 F20101207_AAAWHM luciani_g_Page_094.txt
cf3d978cdbac05f25423726262f73cd3
17f0a2de210aa8c38d109ba93f03f1f365d6e58c
21217 F20101207_AAAXLD luciani_g_Page_072.QC.jpg
bce7c0a190546f27cb61db070b2a0e03
7aa55412b7e65c62311e56bb985385b4d1c3e0ff
25945 F20101207_AAAXKP luciani_g_Page_060.QC.jpg
95fdf1b6a384df56ec1b8fd896cc9838
237d8902e560e1838d1e847f8cbd4f3090836e7e
3064 F20101207_AAAWGZ luciani_g_Page_109.txt
338ef3a0a4ddc617b45b0188f0b55e1a
4994210964b65661df0bea3f389fddaab0937bd3
7062 F20101207_AAAWIB luciani_g_Page_066thm.jpg
67bfd0633443a14afe7628f1be88f536
c2b5ca55d97cfc5f5b54413c46965d52c289768e
1174 F20101207_AAAWHN luciani_g_Page_107.txt
9b28c93b0ce32a265a581a9747f9c9d9
47269f35b8a40213f6b1643eb10c2699761e5f32







GENETIC ENGINEERING TO IMPROVE NUTRITIONAL QUALITY AND PEST
RESISTANCE IN BAHIAGRASS (Paspalum notatum VAR. FLUGGE)





















By

GABRIELA FABIANA LUCIANI


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA

2007

































2007 Gabriela Fabiana Luciani




























To my family and friends
To McNair, Carmen and Luca









ACKNOWLEDGMENTS

I would like to acknowledge Fulbright LASPAU-Argentina and University of Florida for

supporting this Ph.D. program. I also would like to thank Universidad Nacional del Sur and

CONICET for providing the training and economical support that allowed me to pursue this

program.

I am deeply grateful to my chair, Dr. David Wofford and my cochair Dr. Fredy Altpeter for

their guidance and assistance during the development of the program. I would like to

acknowledge the members of my committee: Dr. Ken Boote, Dr. Rex Smith and Dr. Paul Lyrene

for their valuable discussions and contributions to this project. Special thanks are extended to

Dr.Robert Shatters and Dr. Robert Meagher for their unconditional support.

Also, I would like to thank the people from our laboratory including research associates,

graduate students and technicians. I thank Dr. Walid Fouad, Dr. Hangning Zhang, and Dr. Xi

Xiong for their contributions in the discussion of this research project. Special thanks to Dr.

Victoria James for her technical training and friendly support and to Loan Ngo, Jeff Seib and

Charly for their assistance in the work at the laboratory. I thank my fellow graduate students

Mrinalini Agharkar, Sukhpreet Sandhu, Isaac Neibaur, Paula Lomba and Jose Celedon for their

friendship and support during the difficult times of this journey. My thanks are also extended to

graduate students: Miriam, Raquel, Laura, Jorge and Carlos for sharing very Argentinean

moments.

I thank my parents, Betty and Alberto; my younger brother, Guillermo; my older brother

and his family, specially my nephew and niece, Gonzalo and Maria Paz; and my grandmother,

Teresa; for being so supportive and staying so close during the difficult times.









Finally, I would like to thank all my amazing friends: Veronica, Belkys, Salvador, Claudia,

Carlos and Federico, for their continuous support and encouragement. I thank McNair, Carmen

and Luca for helping me to be a better human being.









TABLE OF CONTENTS

page

A CK N O W LED G M EN T S ................................................................. ........... ............. .....

LIST OF FIGURES ................................... .. .... .... ................. .9

ABSTRAC T ................................................... ............... 10

CHAPTER

1 INTRODUCTION ............... ................. ........... .............................. 12

Bahiagrass (Paspalum notatum var.Flugge)............................................... ........ ....... 12
Genetic Engineering for Crop Im provem ent ..................................................... ..................12
Genetic Engineering to Improve Nutritional Quality: Vegetative Storage Proteins .............13
Genetic Engineering to Enhance Insect Resistance: Bacillus thuringiensis Toxins..............14
O bjectiv es .............. ......... ................ ...............................................16

2 L IT E R A T U R E R E V IE W ......... ................. .......................................................................18

Bahiagrass (Paspalum notatum var. Flugge)............... ........................................ 18
G general D escription................ .... ... .... ....... ............. ............... 18
Role of Bahiagrass as Subtropical Grass in Southeast United States...........................19
Traditional Breeding of Grasses................................ ... ............... 21
G genetic E engineering in P plants ........................................................................ .................. 23
Plant Transformation ............... .................... ...... ............. ........ .... 23
T issue C culture Protocols........... ........................................................ .... .. .... ..... 23
T transform action M methods ....................................................................... ....................25
Particle B om bardm ent M ethod................................................ ............................ 27
Selectable M arkers and Selection Protocols......................................... ............... 29
Transgene Integration and Expression Patterns ................................... .................31
Future P respects ................................................................... 32
Tissue culture ........................................32
Agrobacterium-mediated transformation...................................... ............... 33
Particle bombardment transformation ............... ....... ........................ ............... 34
Selectable markers............... ............. .... ... ..........................35
New strategies: Multigene engineering, chloroplast engineering and SM-free
plants ....................... ......... ...........................36
Genetic Engineering for Crop Improvem ent...... ........................ ........................ ............... 38
Genetic Engineering to Improve Nutritional Quality .................................................39
Vegetative Storage Proteins (V SPs)................................................... ............... ... 40
G general characteristics .......................... .... ................ ... .... .. ........... 40
G enes and polypeptides........................................................................... 41
Trafficking pathw ay ................. ...................... ............ .... ............ ............ 43
Overexpression of vspB Gene to Improve Nutritional Quality in Bahiagrass.................45
Genetic Engineering to Enhance Pest Resistance ................................. ............... 47


6









D ev elopm ent of B t crop s............................................ ........................................ 47
B acillus thuringiensis toxins ................................................... ............... .... 48
Strategies to increase cry genes expression levels ................................................49
Expression of crylF Gene to Enhance Insect Resistance in Bahiagrass.........................50

3 OVEREXPRESSION OF THE vspB GENE FROM SOYBEAN TO ENHANCE
NUTRITIONAL QUALITY IN BAHIAGRASS (Paspalum notatum VAR. FLUGGE)......55

Introduction ................. ......................................... ............................55
M materials and M methods ..................................... ... .. .......... ....... ...... 58
Soybean vspB G ene .................... ....................................................................... .. ..58
Construction of Expression Vectors for the vspB Gene................... .............. 58
Other Expression Vectors and Cassettes ........................................ ...... ............... 62
Transformation and Regeneration Protocols........................................... ..............63
M molecular Studies ........... .... ..... ......... ................................... 63
Enzyme linked-immunoadsorbent assays (ELISA) ...........................................63
Polym erase chain reaction (PC R ) ................................................. .....................64
Sodium dodecyl sulphate polyacrilamide gels (SDS-PAGE) ................................65
W western blot analysis ............... .... .. ........ ..................... 65
Co-immunoprecipitation of recombinant VSP ...................... ...................66
R e su lts ..................... .............. .... ............ ........................... ................ 6 7
Transformation and Regeneration Protocols .........................................................67
M olecular Studies ................. ................ ............................... .........67
Enzyme linked-immunoadsorbent assays ..................................... .................67
Polym erase chain reaction ......................................................... ............... 67
Sodium dodecyl sulphate polyacrilamide gels ...................................................68
W western blot analysis ............. ......................................................... ...... 68
Co-immunoprecipitation of recombinant VSP ...................................................69
D iscu ssio n ......... ............ ......................... ............................6 9

4 EXPRESSION OF A SYNTHETIC crylF GENE FROM Bacillus i/un iligiellci, TO
ENHANCE RESISTANCE AGAINST FALL ARMYWORM IN BAHIAGRASS
(Paspalum notatum V AR FLU G GE) ......................................................... .....................80

In tro du ctio n ................... ...................8...................0..........
M materials and M ethods .......................................... ................ ..................... ......... ..... ...83
M inim al Transgene Expression Constructs............................................................... 83
Tissue Culture, Transformation and Regeneration of Bahiagrass................................83
Polymerase Chain Reaction, Reverse Transcriptase Polymerase Chain Reaction and
Southern B lot A analysis ........................................ ................... ..... .... 85
Im m unological A says ............................................... .... ........ ......... 86
In sect B io a ssay s ................................................................................................ ..... 8 6
R e su lts................. ............ ... ................ ........................................................................ .... 8 7
Generation of Transgenic Bahiagrass Lines............................................................... 87
Polymerase Chain Reaction, Reverse Transcriptase Polymerase Chain Reaction and
Southern B lot A analysis ........................................ ................... ..... .... 87
Im m unological A says .......................................... ... .... ........ ......... 88









Insect Bioassays ..................... ......... ........................................................... 89
D iscu ssion .......... ..... .... ......... ..............................................89

5 SUMMARY AND CONCLUSIONS ........... ................... .................... 99

Overexpression of the vspB Gene to Improve Nutritional Quality in Bahiagrass..................99
Expression of the crylF Gene to Enhance Pest Resistance in Bahiagrass.........................100


APPENDIX: LABORATORY PROTOCOLS...................................................................... 103

Protocols for M molecular Cloning ................ ..... ....................................................... 103
Protocols for Bahiagrass Transformation and Regeneration...............................................109
Protocols for M molecular Techniques....... ............................................... .. ................. 110
Protocol for Insect B ioassays ........................................................................... 122
Buffers and Reagents .................. ................................. ............ ............... 122

L IST O F R E F E R E N C E S ..................................................................................... ..................126

B IO G R A PH IC A L SK E T C H ......................................................................... ... ..................... 143

































8









LIST OF FIGURES


Figure page

2-1 Bahiagrass (Paspalum notatum var. Flugge). ........................................ ............... 52

2-2 Transgenic crops under field trials and deregulation process in the United States. ..........53

3-1 The complete coding sequence of the vspB gene.......... ............ .......... ........ 72

3-2 Cloning strategy for incorporating the vspB sequence into the vector pGL4...................73

3-3 Minimal constructs used in the biolistic experiments to generate transgenic lines
from bahiagrass (Paspalum notatum var. Flugge) cv. "Argentine.".................................74

3-4 Transformation and regeneration protocols for bahiagrass (Paspalum notatum var.
Flugge) cv. "A rgentine."......................................... ...... ...................... 75

3-5 Transgenic plants from bahiagrass (Paspalum notatum var. Flugge) cv. "Argentine." ....76

3-6 SDS-PAGE gels for soybean and transgenic bahiagrass plants............ ...................... 77

3-7 SDS-PAGE and Western blots from transgenic bahiagrass (Paspalum notatum var.
Flugge) cv. "A rgentine."......................................... ...... ...................... 78

3-8 Co-immunoprecipitation of recombinant VSP3 from transgenic bahiagrass
(Paspalum notatum Flugge) cv. "Argentine." ........................................ ...............79

4-1 The synthetic coding sequence of the crylF gene......... .................... ...............93

4-2 Transgenic plants obtained from bahiagrass (Paspalum notatum var. Flugge) cv.
T ifto n 9 ...................................................................... .. ................ .. 9 4

4-3 Molecular analyses of transgenic bahiagrass lines from cv. "Tifton 9" ............................95

4-4 Molecular analyses of transgenic bahiagrass lines from cv. "Argentine" .....................96

4-5 Levels of expression in leaves of transgenic bahiagrass lines, from cv. "Tifton 9." ........97

4-6 Insect bioassays with fall armyworm larvae feeding on leaves from bahiagrass cv.
"Tifton 9" at 5 days after feeding ............................................. ............................. 98









Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

GENETIC ENGINEERING TO IMPROVE NUTRITIONAL QUALITY AND PEST
RESISTANCE IN BAHIAGRASS (Paspalum notatum VAR. FLUGGE)

By

Gabriela Fabiana Luciani

August 2007

Chair: David Scott Wofford
Cochair: Fredy Altpeter
Major: Agronomy

Bahiagrass (Paspalum notatum var. Flugge) is the predominant grass in forage pastures in

tropical and subtropical regions worldwide. It supports the beef and dairy cattle industries in the

state of Florida. To improve forage production and animal performance, the low nutritional

quality and the insect pest susceptibility of this subtropical grass should be addressed. To

improve nutritional quality, the vspB gene encoding a soybean VSP3 that is a lysine-enriched

and rumen proteolysis-resistant protein seems to be a promising candidate. To improve insect

pest resistance, the crylF gene encoding a 6-endotoxin from Bacillus iluin iigie'n\i\ that provides

protection against Lepidopteran pests in commercial crops such as cotton and corn seems to be a

suitable candidate. Our objectives were: to overexpress the vspB gene for improving nutritional

in bahiagrass cv. "Argentine", and to express a synthetic crylF gene for enhancing resistance

against fall armyworm in bahiagrass cvs. "Argentine" and "Tifton 9." To overexpress the vspB

gene, we cloned an expression vector containing a constitutive and strongly expressed promoter

for monocots; a KDEL signal for ER-retention and a c-myc tag for antibody detection. We co-

bombarded mature seed-derived calli from bahiagrass cv. "Argentine" with minimal constructs

containing the vspB gene from pGL4 and pRSVP1 vectors and the nptll gene as selectable









marker from pJFNPTII vector. Following previous reports, we generated 91 nptlI(+) plants from

110 analyzed plants. Based on the results from nptll expression detected by ELISA and VSP3

expression detected by western blots, 89% of the plants coexpressed the nptll and the vspB

genes. Western blot analyses indicated that VSP3 expression levels varied among plants, tillers

within plants and leaves within tillers. This is the first report on expression of the vspB gene in

bahiagrass cv. "Argentine." The VSP3 expression levels observed in transgenic bahiagrass plants

were low and similar to those previously reported in transgenic corn plants. Potentially, these

VSPP expression levels could be enhanced by coexpressing recombinant VSP3 and VSPa

subunits, and/or by targeting the subunit to different cell compartments in transgenic bahiagrass

plants. To express the synthetic crylF gene, we co-bombarded mature seed-derived calli from

bahiagrass with minimal constructs containing the synthetic crylF gene from pHZCRY vector

and the nptll gene as selectable marker from pHZ35SNPTII vector. Based on previous reports,

we regenerated three paromomycin-resistant plants from bahiagrass cvs. "Argentine" and "Tifton

9." PCR and southern blots analyses indicated independent transgene integration, and RT-PCR

analyses confirmed crylF expression in all transgenic bahiagrass lines. Two immunoassays for

cryIF gene expression indicated detectable cry IF levels in two bahiagrass lines from cv. "Tifton

9." Cry IF expression levels correlated well to resistance levels determined by insect bioassays.

An average mortality rate of 83 % was observed when fall armyworm neonates were fed with

transgenic leaves of the highest cry 1F expressing line. These results indicated that high and

stable crylF expression levels can control fall armyworm in transgenic bahiagrass plants. The

expression of the crylF gene in plants of cv. "Tifton 9" enhanced the resistance against fall

armyworm in insect bioassays indicating that these transgenic lines seem to be suitable

candidates for field studies.









CHAPTER 1
INTRODUCTION

Bahiagrass (Paspalum notatum var.Flugge)

Bahiagrass (Paspalum notatum Flugge) is a perennial, warm-season grass widely grown in

southern United States and other tropical and subtropical regions of the world. Also, it is one of

the most important forage grasses for supporting beef and dairy cattle industries in Florida and

other southeastern states such as Georgia, Alabama and over the Gulf Coastal Plain (Chambliss,

2002). Bahiagrass low management requirements and good yield under biotic stresses such as

heavy grazing or frequent harvests and abiotic stresses such as drought and poor soils, make it

the preferred forage grass by beef cattle producers in Florida (Smith et al., 2002; Chambliss,

2002; Blount et al., 2001).

The main cultivars grown in Florida are sexual diploids such as "Pensacola" and "Tifton

9", and apomictic tetraploids such as "Argentine." The cultivar "Argentine" is a wide-leaf, cold-

susceptible and late-flowering cultivar mainly grown in South Florida for landscaping. It is

commonly used as a turf grass in home lawns and along highways. The cultivar "Tifton-9" is a

narrow-leaf, and early-flowering cultivar, which is less cold-susceptible than cv. "Argentine";

and it is used as forage grass in the Panhandle region (Chambliss, 2002).

Genetic Engineering for Crop Improvement

Currently, genetic engineering combined with plant breeding programs has become a

common and efficient tool for crop improvement. It is used not only for gene function and

expression studies but also for a wide range of applications in plant breeding programs mostly

focused in generating new cultivars with higher yields (Hansen and Wright, 1999). These

biotechnological applications are mostly related to agriculture, industry and human health

(Newell, 2000). In agriculture, genetic engineering studies have been used to improve from









simple agronomic traits such as herbicide, insect, disease and nematode resistance to more

complex traits such as stress tolerance for improving crop yield (Dunwell, 2000; Newell, 2000;

Bhalla, 2006). Pesticide-resistant crops are a remarkable example where these products resulted

in economic and environmental benefits including higher crop yields, reduced economic losses

and no adverse effects on the environment (Cannon, 2000). Also, genetic engineering has been

used to improve nutritional quality of field crops or to produce biopharmaceutical products such

as antibodies, vaccines or human therapeutic proteins (Newell, 2000; Horn et al., 2004).

Nutritional deficiencies in animal and human diets could be compensated by improving lysine

and threonine levels in cereals, methionine in legumes and vitamins A and E in crucifers and

rice. These genetic improvements would have a strong impact since these crops represent the

staple food for one-third of the world population (Job, 2002).

Genetic Engineering to Improve Nutritional Quality: Vegetative Storage Proteins

To improve nutritional quality, several molecular approaches were developed (Tabe and

Higgins, 1998; Galili and Hoefgen, 2002; Sun and Liu, 2004). These approaches include:

developing synthetic proteins, optimizing protein sequence, overexpressing proteins or

regulating the free aminoacid pool or the sink demand (Sun and Liu, 2004). Two alternative

strategies successfully enhanced nutritional quality of crops: to increase the free essential

aminoacid pools or to increase the enriched-protein pools in the transgenic plants. The first

strategy includes increasing the levels of free aminoacid pools by upregulating or

downregulating the expression levels of those enzymes involved in aminoacid biosynthesis

and/or degradation respectively. An enhanced production of free essential aminoacids may lead

to an increase of total protein content and protein quality in plants (Galili et al., 2000; Habben et

al., 1995). The second strategy includes increasing the levels of essential aminoacids-enriched

proteins, mostly by overexpressing seed storage proteins (SSPs) or vegetative storage proteins









(VSPs). Early reports indicated that SSPs were efficiently degraded in vegetative tissues

(Saalbach et al., 1994). Therefore, to prevent protein degradation two approaches were followed:

to target the transgenic proteins to cell compartments avoiding cytoplasmic degradation (Khan et

al., 1996; Tabe et al., 1995) or to use VSPs that were naturally accumulated in vegetative tissues.

These storage proteins include plant proteins such as patatin from potato, sporamin from sweet

potato, VSPs and lipoxygenase from soybean, crown storage proteins from alfalfa and lectin-like

proteins from the bark of certain deciduous trees (Staswick, 1994; Cunningham and Volenec,

1996).

VSPs seem to be promising candidates for increasing protein content and quality because

they are naturally accumulated in vegetative tissues. VSP-a and VSP-P, reached 15% of the total

soluble proteins in soybean paraveinal tissue (Grando et al., 2005) and high levels were

associated with shoot regrowth after cutting and deppoding in soybean plants (Wittenbach et al.,

1983).VSP-a and VSP-P are polypeptides with 27-28 and 29-31 kD of molecular weight

respectively. These glycoproteins share 80% aminoacid homology, have ER- and vacuolar

targeting signals, form homo- or hetero-dimers when they are assembled, and have 7% lysine

content (Mason et al., 1988; Staswick et al., 1988, 1989a, 1994).

Genetic Engineering to Enhance Insect Resistance: Bacillus thuringiensis Toxins

To improve insect resistance, most integrated pest management strategies involved the use

of pesticides. The indiscriminate use of pesticides produces adverse effects on human health and

the environment including the development of insect resistance and the elimination of other

beneficial insects (Ranjekar et al., 2003; Ferry et al., 2006). To overcome these problems,

environmentally-friendly pesticides containing Bt (Bacillus thuringiensis) spores and crystals

were developed. But these spray formulations were only partially effective because they did not

reach burrowing insects and did not persist long enough in the environment. Therefore, Bt









transgenic crops expressing 6-endotoxins were developed (Schnepf et al., 1998; Kaur, 2006).

Currently, this technology is adopted worldwide resulting in 14 million hectares covered with Bt

crops (James, 2005). In the USA, Bt crops represent almost 20% of the total cropping area and

their use is directly linked to higher yields and profits in corn and cotton (Cannon, 2000).

These cry-encoded 6-endotoxins are classified in four groups providing protection against

four insect orders: cryl (Lepidoptera), cry2 (Lepidoptera and Diptera), cry3 (Coleoptera) and

cry4 (Diptera) (de Maagd et al., 2001; Ferre and Van Rie, 2002; Griffits and Aroian, 2005). First,

these crystal protoxins are solubilized and proteolitically activated in the insect midgut and

second, the active toxins bind to specific receptors in the intestine epithelial cells leading to pore

formation and cell death. The active toxins have a conserved structure formed by three domains

and domains II and III determine host specificity because they have very high affinity to

receptors located in the gut epithelium of different insect orders (Schenpf et al., 1998; Ranjekar

et al., 2003; Abanti, 2004; de Maagd et al., 2001).

Based on laboratory studies on field-selected strains, the potential of resistance

development exists in insect populations; however, only one case of field-developed resistance

was reported (Ferre and Van Rie, 2002; Griffits and Araoin, 2005). To delay insect resistance,

different molecular and management approaches were developed. To boost cry gene expression,

the use of cry truncated sequences expressing the active toxins, the use of cry codon-optimized

sequences for enhanced plant expression, the stacking of cry genes with different binding sites

and genes encoding proteins with different toxicity mechanisms are the most commonly used

molecular approaches (Schenpf et al., 1998; Bohorova et al., 2001; Kaur, 2006; Ferry et al.,

2006). However, high dose levels are still difficult to reach and cry expression patterns may be

limited by external factors like nitrogen fertilization (Abel and Adamczyck, 2004).









Objectives

Bahiagrass (Paspalum notatum Flugge) plays a key role supporting beef and dairy cattle

industries in Florida and other southern states of the United States (Chambliss, 2002). Targets

for bahiagrass genetic improvement include its low nutritive value and its susceptibility to insect

pests like mole crickets and fall armyworm.

Naturally, subtropical bahiagrass cultivars have low protein content, ca. 11% protein

content, which directly affects animal performance (Cuomo et al., 1996). This protein content

decreases to 5-7% affecting cattle growth and reducing cattle weight during summer and fall

(Grando, 2001). Therefore, high and stable expression levels of the vspB gene in transgenic

bahiagrass plants would have two main advantages: rumen stability and enriched essential

aminoacid composition. While most plant proteins are degraded by rumen proteolysis, bypass

proteins remained intact and they are absorbed in ruminant intestines. It was previously observed

that VSPP not only contains ca.7% lysine (Mason et al., 1988; Staswick, 1988) but also behaves

as a bypass protein being stable in the rumen and absorbed in the cattle intestines (Guenoume et

al., 2002b). Previous reports indicated that VSPs contributed to the accumulation of high lysine

levels in transgenic tobacco plants and, therefore they could compensate lysine deficiency in

ruminant feeding (Guenoune et al., 2003).

Bahiagrass is susceptible to insect pests such as mole crickets (Scapteriscus spp) and fall

armyworm [Spodopterafrugiperda (J. E. Smith)]. Fall armyworm (FAW) is one of the most

important insect pests in the southeast of United States, causing seasonal economic losses in

forage and turf grasses and field crops such as corn, rice and sorghum (Sparks 1979, Meagher

and Nagoshi, 2004). Recently, field trials with corn hybrids expressing a full length cryIF gene

(Herculex I) indicated that this gene provided protection against a wide range of insect pests









including FAW (EPA, 2001). However, there are no reports on transgenic insect resistance to

insect pests in forage or turfgrasses.

The objectives of our research project were:

* To overexpress a soybean vegetative storage protein gene and to evaluate the effects of this
gene on the nutritional quality of bahiagrass.

* To express a synthetic cryIF gene and to evaluate the effects of this gene on resistance to
fall armyworm in bahiagrass.









CHAPTER 2
LITERATURE REVIEW

Bahiagrass (Paspalum notatum var. Flugge)

General Description

The genus Paspalum (Poaceae family) originated along the Parana River in the border

between Brasil and Argentina. The notata group (Chase et al., 1929; Burton, 1967) was spread

from this region to other subtropical and tropical regions. Phylogenetic and cytogenetic studies

showed that the genus is characterized by a basic chromosomic number X=10 but its species

vary from diploids (2n = 2x =20) to pentaploids (2n = 2x = 50) with sexual diploids (2n = 2x =

20) and apomictic tetraploids (2n = 4x = 40) being the most common forage species. During the

evolution ofPaspalum spp., the apomictic autotetraploid forms, that were more robust, fit and

competitive, originated from the sexual diploid forms (Gates et al., 2004). Also, bahiagrass is a

C4 plant with an efficient photosynthetic system which allows it to colonize new environments

with high temperature, humidity and light intensity. It is important to note that C4 grasses have

higher water use and nitrogen use efficiencies than C3 grasses indicating that C4 growth rate

doubles C3 growth rate using the same water and nitrogen supplies (Gates et al., 2004; Moser et

al., 2004).

Bahiagrass (Paspalum notatum Flugge) is a rhizomatous plant with short internodes that

produce adventitious shoots and roots. It has a deep and well developed root system that supports

several tillers with broad leaves and inflorescences that are panicles formed by two terminal

racemes (Gates et al., 2004) (Figure 2-1).

The species is distributed in tropical and subtropical regions worldwide including

Argentina, Australia, Belize, Benin, Bolivia, Brazil, Colombia, Costa Rica, Cuba, Ecuador, El

Salvador, Gabon, Guatemala, Guyana, Honduras, Japan, Mexico, Nicaragua, Panama, Paraguay,









United States and Zambia. In the United States, bahiagrass was introduced as a forage grass in

early 1900s. According to the PLANTS Database, generated by the Natural Resources and

Conservation Services from the United States Department of Agriculture (USDA-NCRS, 2007),

it is found in the states of Alabama, Arizona, California, Florida, Georgia, Louisiana,

Massachusetts, North Carolina, South Carolina, Tennessee and Texas. Bahiagrass covers ca. 2.5

million hectares including the southeastern states in the Gulf Coastal Plain in the United States

(Burton et al., 1997; Blount et al., 2001), and more than 1 million hectares of which ca. 70 %

represent improved pastures in the state of Florida. As a forage crop, bahiagrass supports beef

and dairy cattle industries in Florida and other southern states (Chambliss, 2002).

The main cultivars grown in Florida are sexual diploids like "Pensacola" and "Tifton 9,"

and apomictic tetraploids like "Argentine" (Chambliss, 2002). According to the Bureau of Plant

Industry-Office of Foreign Seed and Plant Introductions (BPI-OFSPI), the cultivar "Argentine"

(Plant Introduction N 148996) was introduced from Argentina in 1944 and released in the

United States in 1950. It is a wide-leaf, cold-susceptible and late-flowering cultivar. It is mainly

grown for landscaping in south Florida (Chambliss, 2002). The cultivar "Tifton-9" (Plant

Introduction N 531086) was released in 1987 by a breeding program at Tifton (Georgia, USA)

after nine cycles of recurrent restricted phenotypic selection from the cultivar "Pensacola." It is a

narrow-leaf, cold-tolerant and an early-flowering cultivar mainly grown and used as forage in the

states of Georgia, Alabama, Louisiana and north Florida (Cook et al., 2005).

Role of Bahiagrass as Subtropical Grass in Southeast United States

In Florida, beef and dairy cattle industries are formed by 1.5 million cows and 140,000

cows respectively (Florida Department of Agriculture and Consumer Services, Division Animal

Industry, 2007). These industries represent 85 and 8% of the livestock production respectively

and they are mainly supported by bahiagrass pastures covering one million hectares in the state









(Chambliss, 2002). Bahiagrass is preferred by farmers and producers because it has low

management requirements and very good persistence and yield (Smith et al., 2002; Chambliss,

2002; Blount et al., 2001). Among these advantages are (Cook et al., 2005):

* It is well adapted to sandy and light-textured soils, and not only tolerates drought but also
its root system penetrates soil and improves water holding capacity and prevents nutrient
leaching.

* It is well adapted to low fertility soils with marginal pH (i.e. 5.5-6.5). These deficiencies
are partially compensated by root interactions with arbuscular mycorrhizal fungi and
nitrogen-fixing bacteria like Azotobacter ppaspali.

* Once established, it spreads fast by stolons and is highly tolerant to overgrazing and high
cutting frequencies during summer, these factors favors plant regrowth and maintains
nutritional quality (Stewart et al., 2007).

* It is very tolerant to fungal diseases and insect pests. The most important fungal pathogens
are the ergot (Claviceps spp) that reduces seed set and the leaf spot (Helminthosporium
spp) that produces leaf lesions in cv. "Argentine." The most important insect pests are
mole crickets that feed on the roots (Scapteriscus vicinus, S. borellii and S. abbreviatus
commonly known as tawny, southern and short-winged mole crickets respectively) and fall
armyworms (Spodoptera spp) that feed on the leaves (Burson and Watson, 1995;
Chambliss, 2002).

* It reduces nematode populations when it is used in sod-rotation cropping systems and
alternated with cotton, peanut and corn showed the same or increased yields (Gates, 2003;
Wright et al., 2005).

However, it also has several physiological and nutritional limitations:

* It has a slow rate of seed establishment. It requires high sowing rates and good weed
control because bahiagrass seedlings are weak and susceptible to the most commonly used
post-emergency herbicides (Cook et al., 2005).

* Plant growth has a seasonal pattern which directly affects plant yield. So that, slower
growth produces low yield during fall and winter, and faster growth produces higher yield
during summer in subtropical bahiagrass cultivars (Cuomo et al., 1996).

* This seasonal pattern also affects plant nutritive value, because of the fast growth rate
directly related to high temperatures which implies secondary growth and reproductive
growth (Stewart, 2006). Specifically, subtropical grasses nutritional quality decreases with
maturity (Johnson et al., 2001).









Traditional Breeding of Grasses

Forage and turfgrasses contribute to support economical and sustainable agriculture

systems that represent the basis of most economies in the world. Forage grasses are not

commonly appreciated as a commodity because its value is measured indirectly as a feed cost for

cattle production. Turfgrasses are mostly grown with recreational purposes on sport fields, parks,

home lawns and roadsides (Wang et al., 2001).

Breeding of forage grasses is mainly focused on supporting ruminant feeding and includes

increasing herbage production by increasing dry matter yield and different feeding value

paremeters. These parameters are in vitro dry matter digestibility (IVDMD), crude protein (CP)

content, water-soluble carbohydrate (WSC) content. Also, there are antiquality factors which

affect it, such as lignin and alkaloid contents (Wilkins and Humphreys, 2003). Therefore, the

objectives of breeding programs for improving nutritional quality include increasing voluntary

intake, dry matter yield, IVDMD, CP and WSC and decreasing lignin and alkaloid contents.

Other breeding objectives include to enhance persistence, tolerance to environmental stresses

such as cold, frost, heat and drought, resistance to insect pests and viral and fungal diseases, and

to increase seed yield (Wilkins and Humphreys, 2003).

Most grasses are crosspollinated and most traits are quantitative including DMY, IVDMD,

tolerance to stresses and resistance to pests and diseases. Before, breeding programs focused on

identifying those natural populations with superior phenotypes (Wilkins and Humphreys, 2003).

In the United States, some examples of those cultivars are 'Kentucky-31' tall fescue (Festuca

arundinacea), 'Linn' perennial ryegrass (Loliumperenne), 'Lincoln' smooth bromegrass

(Bromus inermis), and 'Merion' Kentucky bluegrass (Poapratensis) (Alderson and Sharp,

1994). Later, breeding programs.focused on phenotypic selection and progeny tests including

full-sib or half-sib family selection (Cunningham et al. 1994). Basically, traits such as DMY and









IVDMD, with broad-sense heritabilities ranking between 30-70%, showed an increased of 10 %

decade, and this increase was almost doubled (Wilkins and Humphreys, 2003). Other classical

breeding approaches such as gene introgression by backcrossing and chromosome doubling were

reported with limited success. However, most forage grasses breeding programs are supported by

seed companies and low seed value and long breeding cycles (2-3 years/each) limit their

expansion (Wilkins and Humphreys, 2003).

Bahiagrass breeding efforts followed the same breeding approaches and focused in the

same breeding objectives. Early on, sexual tetraploids were generated by chromosme doubling

with colchicines from cv. "Pensacola" (Forbes and Burton 1961). Later on, cv. "Tfiton 9" was

generated by restricted recurrent phenotypic selection (Burton 1974). A breeding program was

established at Tifton (Georgia) and starting material was selected from several farms. Based on

herbage production, this program included breeding cycles where the best plants were selected

and intermated in a polycross to produce seeds for the next selection cycle. At the ninth cycle,

the cultivar "Tifton 9" was released (Burton, 1989). This cultivar not only showed 30 % more

biomass production and more seedling vigour than cv. "Pensacola" but also the same IVDMD.

Later reports indicated that early germination and reduced dormancy were related to higher

yields (Gates and Burton 1998). Stronger and faster seed establishment makes bahiagrass

cultivars more competitive against weeds in early stages and more productive extending the

growing season. To increase DMY in bahiagrass subtropical cultivars, other factors such as cold

resistance, photoperiod sensitivity and crown vigor had been considered. For example, day-

neutral and cold- resistant plants with vigorous crown (expressed as fast growth and profuse

tillering) will have an extended growing season and higher biomass production (Blount et al.

2001, 2003).









Genetic Engineering in Plants


Plant Transformation

In the last forty years, genetic engineering has overcome the basic problems concerning to

the development of protocols for DNA transfer, tissue culture and selection in specific genotypes

or cultivars. Genetic engineering is focused on crop improvement and a wide range of

biotechnological applications in industry and human health (Hansen and Wright, 1999; Newell,

2000). In agriculture, genetic engineering and plant breeding has improved agronomic traits such

as herbicide, insect, disease and nematode resistance (Dunwell, 2000; Newell, 2000; Bhalla,

2006). Improving yield and nutritional quality of field crops is more complicated because traits

such as drought tolerance or essential aminoacid deficiencies are regulated in more complex

ways. Increasing lysine and threonine levels in cereals, methionine in legumes and vitamins A

and E in crucifers and rice could compensate nutritional deficiencies in animal and human diets

(Job, 2002). Also, molecular farming can efficiently produce biopharmaceutical products. Some

of these products, such as trypsin and aprotinin, have already reached the market. Other products,

such as industrial enzymes (phytases, proteases, glycosidases and oxido-reductases) or

monoclonal antibodies and antigens for edible vaccines are close to commercialization (Newell,

2000; Horn et al., 2004).

Tissue Culture Protocols

Tissue culture protocols are a prerequisite for a successful plant transformation. However,

monocotyledoneus plants were considered as recalcitrant species for being propagated in tissue

culture. Early reports in wheat focused on identifying suitable explants for the induction of

embryogenic callus like scutelli, mature and immature embryos; adjusting bombarding

parameters and selection and regeneration protocols (Altpeter et al., 1996a, Rasco-Gaunt et al.,

1999). Later reports focused on the screening of commercially important cultivars for tissue









culture and transformation experiments (Takumi and Shimada, 1997; Iser et al., 1999, Altpeter et

al., 2001).

Early reports indicated that plant regeneration from bahiagrass (Paspalum notatum Flugge)

and other Paspalum spp was possible through the use of young inflorescence-derived callus

(Bovo and Mroginski, 1986, 1989). Bahiagrass regeneration using mature seeds via somatic

embryogenesis was firstly described by Marousky and West (1990). They indicated that seeds

from bahiagrass cv. "Pensacola" germinated and developed small callus at the basis of the

coleoptile in Murashige and Skoog medium (MS, Murashige and Skoog, 1962) supplemented

with 9 iM 2,4-D. However, authors reported very low embryogenic callus and plant

regeneration rates (12 and 29% respectively). Also, Akashi et al. (1993) regenerated bahiagrass

plants from six bahiagrass genotypes using seed-derived callus cultured in the same medium.

They observed that callus induction, callus proliferation and plant regeneration were influenced

by genotype effects. Besides, cv. "Pensacola" was the best regenerant with 40% embryogenic

callus formation and 74% plant regeneration. Later reports focused on regeneration of bahiagrass

cv. "Tifton 9" that was derived from cv. "Pensacola" by restricted recurrent phenotypic selection

and released to the market in 1989 (Burton, 1989). Shatters et al. (1994) investigated bahiagrass

using leaf-stem cross sections cultured in a Schenk and Hildebrandt medium (Schenk and

Hildebrandt, 1968) supplemented with 30 [M dicamba. Authors reported 96% regenerant callus

and indicated that regeneration ability declined with the longer subcultures in the earlier selected

lines while remained steady until 10 months in the later ones. Grando et al. (2002) reported an

optimized bahiagrass regeneration protocol based on the use mature seed-derived callus. Authors

observed 66% germination and 21% embryogenic callus formation using MS medium

supplemented with 30 uM dicamba and 5 uM BAP. Subsequently, Altpeter and Positano (2005)









produced 85% germination and 55% embryogenic callus rates in cultivar "Argentine" using 13.5

IM dicamba and 5 [iM BAP. Currently, this bahiagrass regeneration protocol is a routine

protocol used to generate stable transgenic plants for the different lines of research developed in

our laboratory.

Transformation Methods

To generate transgenic plants, efficient protocols for plant regeneration, DNA delivery,

transgenic tissue selection and recovery of normal and fertile phenotypes are required. In

addition, these protocols should be highly reproducible and efficient, so that they can be used in

a large scale and a short time frame. Currently, three methods fulfill these criteria: protoplast

transformation, biolistic transformation and Agrobacterium-mediated transformation (Hansen

and Wright, 1999).

Protoplast transformation involves protoplast isolation from different callus lines derived

from immature tissues like embryos, inflorescences, leaves and anthers. These young tissues can

be dedifferentiated and more susceptible to DNA uptake. Therefore, protoplasts could be

transformed by different methods such as electroporation, microinjection and polyethyleneglycol

(PEG). These technologies were used in the absence of Agrobacterium-mediated transformation

protocols for monocots, but they were highly genotype-dependent and they were not suitable for

transforming most important agronomic crops (Hansen and Wright, 1999; Newell, 2000; Taylor

and Fauquet, 2002).

Agrobacterium is a gram-positive, soil-borne bacterium that produces a crown-gall disease

and naturally infects different dicotyledonous plants. This disease is characterized by the transfer

of the Ti plasmid, i.e. specific DNA fragment with specific flanking regions, from

Agrobacterium tumefaciens into the plant cells. The Ti plasmid contains genes encoding

enzymes involved in the synthesis of growth regulators inducing plant cell growth and tumor









formation, and the production of opines that support bacterial growth. Initially, Agrobacterium-

mediated transformation was very successful in dicotyledonous plants because they are the

natural host range for the bacterium. To overcome the host-plant specificity, Agrobacterium-

mediated transformation was optimized by the use of hypervirulent strains and the use of

wounding methods to enhance bacterial infection. To improve transformation efficiency, specific

protocols for bacterial infection, inoculation, and cocultivation; and plant selection and

regeneration were developed according to the specific requirements of the bacterial strain and the

plant host. Recently, several protocols bypassed tissue culture by using in vivo inoculations;

however, these protocols are restricted to model species such as A. thaliana and N. tabacum. The

use of this technology has several advantages: Transgene integration patterns showed fewer and

intact copies after T-DNA transfer compared with those transgene integration patterns produced

by biolistic experiments. Subsequently, Agrobacterium host range was extended to

monocotyledonous plants such as corn, rice, wheat and barley (Hansen and Wright, 1999;

Newell, 2000; Gelvin, 2003).

Biolistic or microparticle bombardment technology involves the acceleration of

microprojectiles coated with foreign DNA into target plant tissues. These gold or tungsten

particles pass through the plant cell wall and nuclear envelope to release and integrate the DNA

into the plant genome. This technology allows a wide range of transformation strategies

including transient and stable expression studies, chloroplast and mitochondrial transformation

studies and also viral expression studies (Altpeter et al., 2005). Due to its physical nature,

microparticle bombardment is not limited by the pathogen-host interaction observed in

Agrobacterium-mediated transformation. Therefore, it is used in a broad range of targets

including not only those groups considered as recalcitrant groups among plants such as cereals









and grasses, but also other living organisms such as bacteria, fungi, algae, insects and mammals

(Hansen and Wright, 1999; Newell, 2000; Taylor and Fauquet, 2002, Altpeter et al., 2005).

Particle Bombardment Method

Currently, particle bombardment is the most widely used and successful method for

introducing genes into monocotyledonous plants (James, 2003; Altpeter et al., 2005). This

technology is routinely used to improve agronomic traits such as crop yield and quality,

resistance to biotic stresses like fungal diseases and insect pests, tolerance to abiotic stresses like

drought and cold, and molecular farming (Newell, 2000; Dunwell, 2000; Job, 2002; Horn et al.,

2004).

There are two important factors that determine the success of gene transfer by particle

bombardment: the physical parameters of the bombardment process and the biological

requirements of the plant tissues before, during and after bombardment. Transient studies with

reporter genes such as GUS, luciferase and GFP genes were designed to optimize these physical

parameters according to the specific needs of each genotype (Southgate et al., 1995; Taylor and

Fauquet, 2002). However, the target tissues to produce transgenic plants need to be prepared to

integrate the foreign DNA, to undergo selection and to regenerate normal and fertile plants.

Hence, the challenge is to develop an efficient transformation protocol using embryogenic or

meristematic tissues and shortening the tissue culture time for avoiding somaclonal variation and

the development of aberrant or infertile phenotypes.

Recently, the production of stable transgenic plants from forage and turf grasses including

tall fescue (Festuca arundinacea Schreb.), red fescue (Festuca rubra L.), ryegrass (Lolium

perenne L.), bermudagrass [ Cynodon dactylon (L.) Pers.] and creeping bentgrass (Agrostis

palustris). Specifically, earlier protocols indicated the successful transformation and

regeneration of fescue using tall fescue protoplasts (Ha et al., 1992) and tall and red fescue









embryogenic cell suspensions (Spagenberg et al., 1995). Robust protocols with efficient selection

systems allowed to generate large numbers of red fescue plants using the nptll gene and

paromomycin as selective agent (Altpeter & Xu, 2000). Recently, tall fescue nutritional quality

was improved by overexpressing a sulphur-rich sunflower albumin (SFA8) under the control of

cab wheat promoter (Wang et al., 2001). Also, tall fescue forage digestibility was enhanced by

downregulating the expression of cinnamyl alcohol dehydrogenase (CAD), an enzyme involved

in lignin biosynthetic pahtway, in transgenic plants containing sense and antisense constructs of

the cad gene (Chen et al., 2003). Altpeter et al. (2000) reported a rapid and efficient protocol for

generating perennial ryegrass plants by using an expression cassette with the ubiquitin promoter

and the nptll gene and obtaining the highest transformation efficiencies (4-11%) using calli

derived from immature inflorescences and embryos in 9-12 weeks. Recently, Hisano et al. (2004)

reported an increased tolerance to freezing in perennial ryegrass overexpressing wheat

fructosyltransferase genes, wft] and i J-', which encode sucrose-fructan 6-fructosyltransferase

(6-SFT) and sucrose-sucrose 1-fructosyltransierase (1-SST), respectively, under the control of

CaMV 35S promoter. These plants contained significantly higher fructan levels than wild type

and tolerated freezing at cellular level. Reports on common and triploid bermudagrass (Li and

Qu, 2004; Zhang et al., 2003) indicated variable success in the production of transgenic

bermudagrass plants probably related to not very efficient transformation, regeneration and

selection protocols. The production of stable transgenic plants from bahiagrass (Paspalum

notatum Flugge) cv. "Tifton 7" was firstly reported by Smith et al. (2002). However, this

apomictic tetraploid genotype is not a commercially used cultivar, and authors reported that the

transgenic nature of most of the glufosinate resistant plant could not be confirmed by PCR

analyses (Smith et al., 2002). Later, unpublished studies revealed that the glufosinate resistance









was conclusive to indicate the transgenic nature nature and that the PCR analyses had resulted in

false negative events (Smith, personal communication). In this context, there was a need of

developing efficient protocols for transformation and regeneration of bahiagrass commercial

cultivars such as "Argentine" and "Tifton 9" that are preferred for commercial production.

Selectable Markers and Selection Protocols

To generate transgenic plants, tissue culture and transformation protocols should be

coupled to efficient selection protocols. These protocols are based on the use of selectable

marker genes (SMGs) which encode enzymes that regulate the growth or death of the

transformed tissues. These SMGs conferred resistance to agents such as antibiotics, herbicides,

toxic metabolic intermediates, or non-toxic metabolic intermediates. However, all these systems

depend on the application of a selection agent in the culture medium. Instead, new SMGs

encode enzymes such as isopentyltransferases, histidine kinase homologues and hairy-root

inducing genes that regulate and limit plant growth (Miki and McHugh, 2004).

Currently, kanamycin, hygromycin and phosphoinotricin comprised more than 90% of the

selectable markers in research studies and field trials for selection of yeast, plant and animal

tissues (Miki and McHugh, 2004). The gene nptll encodes the neomycin phosphotransferase

from E. coli, an ATP-dependent dephosphorylase that acts on several aminoglycosides including

neomycin, kanamycin, gentomycin (G418) and paromomycin. The nptll gene is the most widely

used in plants and its use includes model species of dicots such as Arabidopsis and tobacco (15

and 73% studies respectively) and monocots like rice and corn (4 and 33% respectively). The

hph or hpt genes from E. coli encode the hygromycin B phosphotransferase which is an ATP-

dependent phosphorylase that phosphorylates and inactivates hygromycin B (inhibitor of protein

synthesis). Thepat or bar genes confer resistance to the L-isomer of phosphoinotricin (PPT).

This enzyme transforms toxic ammonia radicals into glutamic acid in plant cells. The bar gene









(S. higroscopicus) and the pat gene (S. viridochromogenes) encode the phosphoinotricin N-

acetyltransferase that acetylates and inactivates PPT. Therefore, the toxicity of the commercial

herbicides containing PPT such as BastaTM, IgniteTM and LibertyTM is due to an increase in

ammonia levels which leads to plant death. The bar gene is widely used in plants including

important crops like corn, wheat, rice, and other species like conifers and orchids. Both SM

systems, hygromycin and phosphoinotricin based-systems, are widely used in 30% of the

research studies (Miki and McHugh, 2004).

Public and regulatory concerns were raised about the risks of using antibiotic- resistant

genes given that horizontal transfer to pathogenic soil or gastrointestinal bacteria could affect

environment and human health. However, antibiotic resistance transfer from transgenic crops to

animal or humans should fulfill several conditions including no DNA degradation in field

conditions and the presence of a potential bacterial host for transgene integration and expression.

In this context, Gay and Gillispie (2005) contrasted the potential increase in the antibiotic

resistance reservoir created by plants with SMGs with the current situation created by medical

antibiotic prescribing. Authors concluded that even though these SMGs could survive

environmental conditions, the barriers to transfer, incorporation, and transmission indicated that

SMGs contribution to antibiotic resistance is minimal compared with the contribution made by

antibiotic prescription in clinical practice (Gay and Gillispie, 2005). Additionally, the horizontal

transfer of herbicide-resistant genes from commercial crops to closely related weeds by cross-

pollination could create new superweeds. Therefore, the use of selectable marker (SM)-free

plants eliminates human and environment potential risks and favors public and governmental

acceptance of transgenic crops (Sreekala et al., 2005; Darbani et al., 2007). To eliminate SMGs,

several strategies were developed including the use of SMGs not based on antibiotic or









herbicide-resistant genes and the use of excision systems to eliminate the SMGs after

regenerating the transgenic plants. The SM cassettes could be excised by cotransformation with

both genes in different DNA fragments, the use of site-specific recombination systems

transitorily expressed like Cre/loxP, FLP/FRT and R/RS, transposon-based systems and

interchromosomal recombination-based systems (Miki and McHugh, 2004; Darbani et al., 2007).

Transgene Integration and Expression Patterns

Currently, Agrobacterium-mediated and microparticle bombardment are the most

commonly used transformation methods to generate transgenic plants. In both cases, transgene

integration plays a key role determining transgene stability and expression in primary

transformants and subsequent generations. However, transgene integration and expression still

remain as poorly understood phenomena (Kohli et al., 2003).

Traditionally, biolistic methods were used to generate transgenic plants from

monocotyledonous plants, mostly cereals and grasses, which were not natural hosts for A.

tumefaciens. The integration pattern observed involves a high number of transgene copies

inserted in one single locus (Kohli et al., 2003; Latham et al., 2006). The locus structure varies

from a single copy that could be intact, truncated or rearranged to several copies forming tandem

or inverted repeats, concatemers or clusters with interspersed genomic DNA. Detailed studies on

the structure of the junctions between the transgene and the genomic DNA suggested that the

integration occurs by illegitimate recombination. These events are recognized due to the

presence of microhomologies in the coding sequence of both recombinant DNAs, the presence of

filler DNA, not belonging to either molecule, and similar motifs to those found in the

topoisomerase I cleaveage sites. Besides, vector backbone sequences seemed to have

recombination hotspots that favored transgene rearrangements. Therefore, the use of minimal

constructs (MCs) containing only the expression cassettes, instead of the complete plasmid









vectors, will enhance the expression levels in the transgenic plants (Altpeter et al., 2005). The

proposed transgene integration models considered that transgene rearrangement and integration

involves the participation of DNA repairing complexes generating a hotspot for further

integration of other transgene copies in the genomic DNA. Authors suggested that these hotspots

could be impediments for transcription complexes suppressing gene expression and leading to

gene silencing (Kohli et al., 2003).

Agrobacterium-mediated methods are commonly used to generate transgenic plants mostly

from dicotyledoneus plants. Recently, the method was improved and showed similar efficiences

to those obtained by particle bombardment protocols for cereals and other monocotyledonous

plants. The transgene integration usually implies a lower number of transgene copies and the

locus structure is less complex than those observed in the transgenic plants obtained by biolistic

experiments. However, its complexity depends on several factors including the Agrobacterium

strain, the transformation method, the plant species and the explant. Besides, the integration of

vector sequences is a very common phenomenon. Also, it is interesting to notice that the

integration occurs by illegitimate recombination and the integration process occurs in hotspots as

those plants generated by microparticule bombardment (Kohli et al., 2003; Filipecki and

Malepsky, 2006).

Future Prospects

Tissue culture

During tissue culture, plant tissues are exposed to different stress factors including

wounding, desiccation, osmotic stress, limited access to nutrient supplies and high concentrations

of growth regulators and antibiotics (Carman, 1995). These factors lead not only to plant

dedifferentiation and regeneration but also to other uncontrolled results such as somatic

recombination, chromosome rearrangements, ploidy changes, mutations, deletions and insertions









among other DNA rearrangements. These genetic changes induced by tissue culture conditions,

called somaclonal variation, have direct effects on gene expression (Kaeppler et al., 2000).

Besides, these changes accumulate with prolonged tissue culture (Fukui, 1983). Therefore,

transformation methods should include the development of protocols reducing the tissue culture

time (Altpeter et al., 1996a, Filipecki and Malepsky, 2006).

Agrobacterium-mediated transformation

Currently, Agrobacterium-mediated transformation protocols were efficiently developed

for most cereals including wheat (Triticum aestivum L.), rice (Oryza sativa), maize (Zea mays

L.), barley (Hordeum vulgare L.), sorghum (Sorghum bicolor L.) and rye (Secale cereal L.)

(Agrobacterium Protocols, Humana Press eds, 2006). Specifically, Wu et al. (2003) observed

that factors such as embryo size, pre-culture, inoculation, and cocultivation times,

acetosyringone and surfactant inclusions and selection time were important factors on

transformation efficiencies (0.3-3%)obtained in four bread wheat cultivars. Recently, Toki et al.

(2006) reported a successful rice transformation protocol based on the use of scutellum tissue

obtained from one day pre-cultured seeds; the use of these explants enhanced further selection

and shortened the tissue culture step avoiding somaclonal variation risks. Also, forage and

turfgrasses were mostly transformed with scorable and selectable marker genes including tall

fescue (Festuca arundinacea Schreb.), switchgrass (Panicum vrigatum L.) and perennial

ryegrass (Lolium perenne L.) (Agrobacterium Protocols, Humana Press eds, 2006). Recently,

successful protocols were reported for perennial ryegrass (Altpeter et al., 2006; Bajaj et al.,

2006) and zoysiagrass (Ge et al., 2006). To improve Agrobacterium-mediated transformation, a

large repertoire of plasmids, bacterial strains and transformation protocols were developed. New

approaches included transgene and bacterial or host factors cotransformation with the purpose of

enhancing bacterial infection and transgene integration. It is expected that these factors will









broaden the host range and improve the transformation efficiencies of those still recalcitrant

plant species (Tzfira and Citovsky, 2006; Lacroix et al., 2006).

Particle bombardment transformation

Transgene integration, either by Agrobacterium or particle bombardment, plays a

determining role not only in further expression of the transgene but also in other endogenous

genes, being able to affect gene expression in all levels in the transgenic plants. Amongst the

insertion effects, the most important ones include favoring new rearrangements and integration

events, leading to silencing in the transcriptional or posttranscriptional levels. Transgenic RNAs

could interact with endogenous RNA generating an iRNA response and shutting down some

endogenous genes and/or transgenic polypeptide products could act as new sinks for endogenous

free aminoacid pools or as new substrate for endogenous enzymes. In this context, transcript,

protein and metabolic profiles are affected and the response could affect plant fitness and

productivity. According to Filipecki and Malepsky (2006), these changes among different

transgenic lines are minimal compared with those changes in profiles from plants belonging to

different cultivars or ecotypes. However, particle bombardment generates very complex

integration patterns with higher number of transgene copies and rearrangements (Latham et al.,

2006). Therefore, transgene copy number affects transgene expression and could led to a wide

range of expression levels from silencing to enhanced expression. Early reports in Petunia

indicated that higher copy number lead to lower anthocyanin expression levels (Napoli et al.,

1990; Jorgensen et al., 1996; Grant-Downton and Dickinson, 2005). Recently, a detailed

screening of 132 Arabidposis transgenic lines containing the GFP, GUS and SPT genes through

generations indicated that plants containing one or two transgene copies expressed the reporter

genes with twofold differences, while plants containing higher number of copies showed

posttranscriptional gene silencing. In addition, transcriptional gene silencing could also ocurr









(Schubert et al., 2004; Filipecki and Malepsky, 2006). Besides, transgene expression could be

naturally enhanced if the integration occurs within the minimal promoter sequence and is

influenced by endogenous enhancers. Transgene expression and stability also could be enhanced

by using matrix attachment regions as flanking sequences or by removing vector backbone

sequences prior bombardment (Allen et al., 2000; Altpeter et al., 2005; Filipecki and Malepsky,

2006).

Selectable markers

According to Darbani et al. (2007), the production of selectable marker-free transgenic

plants could be approached by using different technologies. So far, cotransformation systems,

site-specific recombination systems and positive markers based on non-toxic metabolites are the

most widely used.

Specifically, Park and coworkers (2004) observed independent segregation of the

transgenes and produced nptlI-free transgenic tobacco plants by cotransforming two binary

vectors containing the nptll and the coda genes in one T-DNA and the GUS gene in the other T-

DNA. One alternative strategy involves the daol gene encoding a D-aminoacid oxidase which

shifts from a positive marker with the substrates D-alanine or D-serine to a negative marker with

the substrates D-isoleucine or D-valine (Erikson et al., 2004).

Amongst the non-toxic metabolites, the phospho-mannose isomerase (PMI) is the most

widely used positive SM included in the production of transgenic plants from sugar beet, canola,

corn, wheat, rice and pearl millet (Darbani et al., 2007). Recently, O'Kennedy et al. (2004)

reported stable integration and inheritance of the PMI gene and increased transformation

efficiency using the PMI gene for selecting transgenic plants from pearl millet.

Amongst the site-specific recombination systems, the Cre/lox is the most exploited

because of its precise, complete and stable SM removal which implies that the SMGs could be









recycled in a stacking gene engineering strategy. Recent reports indicated the successful

production of SM-free transgenic plants in rice (Sreekala et al., 2005) and corn (Zhang et al.,

2003). Interestingly, Zhang et al. (2003) observed that cotransformation of the SMG with the

recombinase gene under the control of a heat shock promoter allowed the excision of both

cassettes by using heat shocks in early stages of callus regeneration.

New strategies: Multigene engineering, chloroplast engineering and SM-free plants

Currently, most genetic engineering studies use microparticle bombardment because it is a

very versatile and efficient tool allowing for transgene integration and expression in transient

expression studies with reporter genes, stable expression studies with genes integrated in the

nucleus, chloroplasts and mitochondrias and host-pathogen interaction studies with virus

(Altpeter et al., 2005). Several advantages contributed to the success of the microparticle

bombardment including a large range of plant species and genotypes, a large range of target

tissues and organs, the elimination of shuttle vectors and the stacking of multiple genes. It is not

restricted by biological requirements being used in a wide range of plant species and genotypes.

It could target a broad range of tissues and explants including embryos, seeds, shoot apices, leaf

discs, callus, microspores, pollen grains and inflorescences generating an embryogenic or

organogenic response. Also, shuttle vector is not required and vector backbone sequences (origin

of replication, antibiotic gene and others) could be eliminated. It facilitates transgene stacking

allowing for the integration of genes encoding different agronomic traits, multimeric proteins

and several enzymes involved in a specific metabolic pathway. Recently, metabolic engineering

studies in rice focused on the carotenoid pathway to increase provitamin A levels for preventing

blindness, and the phenylpropanoid pathway to increase lignan levels for preventing different

cancer types and coronary heart disease (Altpeter et al., 2005). Specifically, transgenic rice

plants expressing three genes involved in 3-carotene pathway in the plastids from rice endosperm









showed not only high levels of provitamin A but also a normal and fertile genotype (Ye et al.,

2000; Datta et al., 2003).

Furthermore, microparticle bombardment combined with chloroplast engineering has

shown several advantages including no transgene silencing, no position effects affecting

transgene expression, high and uniform transgene expression levels, polycystronic translation

allowing the expression of multiple genes under a common promoter, specific-site integration

through homologous recombination and protein storage preventing cytoplasm degradation and

transgene containment due to maternal inheritance (Heiftez, 200; Bock, 2001; Daniell et al.,

2002; Daniell, 2006). Similarly to nuclear engineering, chloroplast engineering early efforts were

focused in generating plants with traits such as herbicide tolerance, insect resistance and

metabolite production. Early reports indicated that tobacco plants overexpressing the gene

encoding 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) where tolerant to glyphosate

(Roundup) (WO 00/03022 international patent application). Also, McBride et al. (1994)

expressed the crylAc gene in tobacco reaching 3-5% total soluble protein. Besides the

simultaneous expression of multiple genes at high levels, chloroplast folding and assembly

complexes assured the correct processing of proteins formed by single or multiple subunits

making the system highly suitable for the production of biopharmaceuticals and vaccines

(Daniell, 2006). Vaccine antigens against human diseases like cholera, anthrax, tetanus, plague

or canine parvovirus were overexpressed reaching transgene expression levels of 4-31% of the

total soluble protein. Also, therapeutic proteins like human serum albumin, somatotropin,

interferon gamma and antimicrobial peptides were expressed at 6-21.5% of the total soluble

protein. Chloroplast engineering allows oral delivery and an easy, efficient and economic protein









purification system (Daniell, 2006). Therefore, chloroplast engineering seems to be a very

promising technology for crop improvement in the future.

Genetic Engineering for Crop Improvement

According to the APHIS-USDA database (2007), genetic engineering coupled to breeding

programs has generated more than 50 transgenic cultivars from the most important commercial

crops since 1996 in the United States. Based on the number of approved releases for field tests,

the dominant crops in the market are soybean, cotton, potato, tomato and wheat with 1104, 785,

769, 599 and 392 approved releases. Cereals are represented by wheat, rice and barley (with 392,

226 and 61 approved releases) and grasses are represented by creeping bentgrass, Kentucky

bluegrass, tall fescue, St. Agustine grass, bermudagrass and bahiagrass (with 175, 35, 20, 17, 15

and 10 approved releases). Looking at the phenotype categories of these transgenic crops,

research efforts are mostly focused in herbicide tolerance, insect resistance, product quality,

agronomic properties and virus resistance represented by 4,064, 3,447, 2,917, 1,596 and 1,275

approved releases (26, 22, 18.6, 9.9 and 8.1% total releases, respectively)(Figure 2-2a). These

efforts are further reflected by 33, 24, 14, 9 and 6 petitions for deregulation in the phenotypes for

herbicide tolerance, insect resistance, product quality, virus resistance and enhanced agronomic

properties respectively (Figure 2-2b). The states leading the field tests are Hawaii, Illinois, Iowa,

California, Indiana and Florida, along with the Commonwealth of Puerto Rico, with 2,016,

1,926, 1,513, 1,311, 822, 737 and 1,675 issued or acknowledged field test locations in 2007

respectively (APHIS-USDA database, 2007) (Figure 2-3).

It is interesting to note that most crops were improved by using single gene traits like

herbicide tolerance and insect resistance while few crops were improved for increasing yield by

growth rate and photosynthetic efficiency because these traits are controlled in more complex

ways (Dunwell, 2000).









Genetic Engineering to Improve Nutritional Quality

Plant proteins provide the essential aminoacids required for a balanced diet and appropriate

development of humans and animals. Cereals, grasses and legumes are the basis of human and

animal diets. However, cereal proteins are deficient in lysine, tryptophan and threonine, while

legume proteins are deficient in methionine and cysteine (Tabe and Higgins, 1998; Guenoune et

al., 1999; Galili and Hoefgen, 2002; Sun and Liu, 2004).

To overcome the nutritional deficiencies of plant-based foods, two metabolic engineering

approaches were considered: to increase the free aminoacid pools or to increase the essential

aminoacid enriched-protein pools (Sun and Liu, 2004). Essential aminoacid pools could be

regulated by modifying the expression levels of those enzymes involved in their biosynthetic or

degradation pathways. The aspartate biosynthetic pathway leads to lysine formation on one

branch and threonine, methionine and isoleucine formation on the other branch in the chloroplast

(Galili, 1995). The expression of bacterial genes, encoding enzymes from the aspartate pathway

that are insensitive to the plant feedback mechanisms, produced increased levels of free

aminoacids and altered phenotype in cases like tobacco (Shaul and Galili, 1992b) but normal

phenotypes in potato (Perl et al., 1992), Arabidopsis (Ben Tzvi-Tzchori et al., 1996) and alfalfa

(Galili et al., 2000). Essential aminoacids-enriched protein pools could be modified by

overexpressing SSPs or VSPs in cereal or legume crops. Early reports indicated the potential of

corn zeins and soybean VSPs for being accumulated in transgenic tobacco leaves (Guenoune et

al., 1999). Specifically, 0 and 6-zein were expressed and stably accumulated but they showed

low expression levels in tobacco leaves (Bagga et al., 1995, 1997; Sharma et al., 1998). Soybean

VSPs were accumulated up to 2-6% total soluble protein in transgenic tobacco leaves (Guenoune

et al., 1999; 2002a, 2003). Authors suggested that these high VSP expression levels in transgenic

tobacco plants were probably due to the strong activity of the CAMV35S promoter and the lack









of those endogenous proteases founded in vacuoles of mature soybean leaf tissue (Guenoune et

al., 1999). These high and stable transgene expression levels are necessary to assure an impact in

animal feeding and performance.

From a nutritional standpoint, transgenic plants not only need to have higher and enriched-

protein contents but also these proteins should be resistant to rumen degradation and absorbed in

the intestines. Early studies indicated that nearly 40% of the plant proteins undergo rumen

degradation in animals feeding on temperate pastures (Ulyatt et al., 1988). Methionine and lysine

are the most limiting essential aminoacids for lactating (Rulquin and Verite, 1993) and growing

animals (Merchen and Trigemeyer, 1992); therefore, they should be incorporated in bypass

proteins and these proteins should be at least 30% to assure animal weight gain (NRC, 1989).

Vegetative Storage Proteins (VSPs)

Vegetative storage proteins (VSP) are proteins which are accumulated at high levels in

storage vacuoles of vegetative tissues (at least more than 5 % of total protein), used as temporary

nitrogen reserves and without any other obvious enzymatic or metabolic role. So, these proteins

regulate nitrogen availability according to the plant requirements, have a turnover rate controlled

by the sink/source status of the storage organs and can be preferentially synthesized or degraded

at different developmental stages of the plant (Staswick, 1994).

General characteristics

First reports on VSPs described 27 and 29 Kda polypeptides in soybean plants (vsp-a and

vsp-0 respectively) that were preferentially accumulated in young leaves reaching 6-15% of the

total protein before flowering and declined to 1% during seed growth (Wittenbach, 1983). It was

observed that VSP content increased with depodding, reaching 45% of the total protein in

soybean leaves. Besides, it increased after petiole girdling in soybean cotyledons during seed

germination (Wittenbach, 1983). This fact suggested that VSPs may also have a storage role in









young seedlings where the cotyledon changes from a storage organ to a photosynthetic organ

involving degradation of storage vacuoles and releasing of protein content (Staswick, 1991,

1994).

Simultaneously, the paraveinal mesophyll (PVM) was characterized in soybean plants

(Franceschi and Giaquinta 1982a, b, 1983a,b). This tissue consisted in one thick layer of larger

cells interconnected by tubular arms that are wrapped around the phloem bundles. Ultrastructural

and histochemistry studies showed that this tissue is directly involved in synthesis and

degradation of proteins during the change of vegetative to reproductive growth in soybean plants.

Later on, inmunoblotting and inmunocytochemical studies showed that three polypeptides of 27,

29 and 94 Kda where specifically accumulated in the PVM vacuoles and their turnover rate was

regulated by sink/source status (i.e. high levels in young leaves and/or depodded plants)(Klauer

et al., 1991). Furthermore, Klauer et al. (1996) observed the presence of these three polypeptides

in the vacuoles of PVM in other legumes species. However, the 94 kda polypepetide was

identified as a lypoxigenase (Tranbarger et al., 1991). Furthermore, DeWald et al. (1992) showed

that VSPs had high sequence homology to a tomato acid phosphatase and low acid phosphatase

activity. Later on, phylogenetic analyses showed that the loss of the catalytic site and activity is

probably a requirement for changing to a storage function in legume species (Leelapon et al.,

2004).

Genes and polypeptides

VSPs and vsp genes were identified and characterized using different soybean tissues by

different authors (Staswick, 1988; Mason et al., 1988; Rapp et al., 1991). Staswick (1988)

detected the polypeptides VSP25 and VSP27 in leaves with high levels of mRNA of depodded

soybean plants (Glycine max L. Merr. Cv. Williams 82). Simultaneously, Mason et al. (1988)

detected the polypeptides VSP28 and VSP31 in stems of dark-grown seedlings from the same









soybean cultivar. This study showed that polypeptides and their encoding genes have 80%

sequence homology. The pVSP28 and pVSP31 have N-terminal leader peptide sequences of 34

and 35 aminoacids respectively and their predicted cleavage sites are located after Glnl8-Ala21

and Prol7-Gly20 respectively. These cleavages yielded 25 and 29 Kda mature products. PKSH5

and pKSH3 are the genomic clones encoding pVSP28 and pVSP31 respectively. Based on

alignment studies, it was determined that pKSH3 and pVSP27 were the same transcript while

pKSH5 and pVSP25 corresponded to different genes or they had alternative splicing (Staswick,

1988; Mason et al., 1988). Rapp et al. (1991) screened a genomic library of soybean leaves from

depodded plants with the pVSP27 probe and detected both polypeptide products assembling and

forming homo- or heterodimers. Specifically, these authors identified the putative CAAT box,

the TATA box and a TGTTGT(A/T)(G/T) enhancer in the 5' flanking region and three exons

and two introns in the coding sequence of pVSP29. Also, this coding sequence appeared as an

inverted tandem repeat in one of the genomic clones indicating a recent duplication (Rapp et al.,

1991). Currently, these genes are called vspA and vspB and their polypeptide products VSPa and

VSPP, respectively.

Homologous genes have been identified in other species such as Atvsp in Arabidopsis

thaliana, and Bspa in hybrid poplar (Populus alba x P. tremula). The Atvsp gene encodes two

polypeptide products of 29 and 30 kda proteins, is accumulated to high levels in hypocotyls,

young leaves, flowers and pods and is regulated by sugars, jasmonates, wounding, light,

phosphates and auxins (Berger et al., 1995). The Bspa gene encodes a bark storage protein of 32

kda, which accumulates in storage vacuoles of inner bark parenchyma and xylem rays reaching

almost 50% storage proteins during fall (Zhu and Coleman, 2001). Three VSPs of 15, 19 and 32

kda were identified as a major component of the soluble proteins in the taproots of alfalfa. These









proteins are accumulated during fall, when the plants are dormant, and degraded during spring or

after defoliation (Hendershot and Volenec, 1993). Thus, it was observed that their level was 28

% of the total soluble protein before defoliation, decreased after defoliation but it was recovered

30 days later (Avice et al., 1996).

Trafficking pathway

Plant tissues usually store reduced nitrogen into proteins or polypeptides so-called storage

proteins that are allocated into storage vacuoles. In this way, they are able to retain nitrogen and

some essential aminoacids without creating an osmotic imbalance in the plant cell. These

proteins are called seed or vegetative storage proteins according to the plant tissues where they

were produced and stored (SSPs or VSPs respectively). SSPs include the albumins, globulins,

prolamins and glutelins. For example, the prolamins include zeins from maize (Zea mays L.),

gliadins from wheat (Triticum sativum L.) and hordeins from barley (Hordeum vulgare L.). VSPs

were found in plants with storage organs such as tubers from potato (Solanum tuberosum L.) and

sweet potato (Ipomea batata L.), taproots of alfalfa (Medicago sativa), paraveinal mesophyll

tissue from soybean (Glycine max) and other legumes and bark tissues from trees such as poplar

(Populus spp) or willow (Salix spp) (Muntz, 1998).

These soluble proteins could follow three different pathways (Vitale and Raikhel, 1999;

Nehaus and Rogers, 1998; Muntz, 1998). Naturally, the default pathway implies that proteins are

primarily processed in the endoplasmic reticulum (ER), further processed in the Golgi apparatus

(GA) and secreted outside the cell. Some polypeptides are produced in the rough ER and

accumulated into large vesicles attached to it. These vesicles are storage vacuoles (also called

protein bodies) like those vacuoles commonly formed by prolamins in the endosperm cells from

maize and rice. Finally, these storage vacuoles, coming either from the ER or the GA, could be









fused in the central vacuole or tonoplast like globulins from dicotyledonous plants and some

prolamins from other cereals (Muntz, 1998).

In the latest pathway, the first processing step involves a specific docking mechanism at

the ER with loss of the targeting peptide during the translation and incorporation of the

polypeptides into the ER lumen for further modifications including glycosilation, formation of

disulfide bonds, folding and polymerization. In the second processing step, ER, GA or

tonoplast-derived vacuoles have other specific docking mechanism at the GA and this

mechanism involves internal, carboxy-terminal or amino-terminal vacuolar targeting signals.

These docking systems are highly conserved among kingdoms and they were better described in

animal models. Some remarkable examples are the docking systems formed by BIP at the ER

and BP-80 at the vacuoles (Vitale and Raikhel, 1999). In the final processing step, plant proteins

lose the targeting peptides and acquire their final conformation as storage products at the

vacuoles (Muntz, 1998).

According to VSP coding sequences, targeting peptides to the ER and the vacuole were

predicted (Staswick, 1988, 1994; Mason et al., 1988). Later on, ultrastructural and

immunocytochemical studies showed that VSPs were accumulated via RER and/or GA in the

storage vacuole of the PVM from several legume species. It was reported that PVM cells were

enriched with RER and AG and that VSPa and 0 were detected along the whole pathway in

induced soybean plants where these proteins reached 50% of the total protein content (Klauer

and Franceschi, 1997). Previous studies indicated that vacuoles were differentially labeled by

antibodies against tonoplast intrinsic proteins (TIPs) which were indicators of the storage or lytic

conditions of the vacuole (y and 6-TIPs respectively) (Jauh et al., 1998; Vitale and Raikhel,

1999). Recently, immunolabelling studies showed that these vacuoles are functionally flexible









and can be converted from storage to lytic forms or viceversa according to the soybean nitrogen

requirements (Murphy et al., 2005).

Overexpression of vspB Gene to Improve Nutritional Quality in Bahiagrass

Subtropical bahiagrass cultivars have a seasonal growth pattern which directly affects plant

yield. Slower growth produces low yield during fall and winter, and faster growth produces

higher yield during spring and summer in subtropical bahiagrass cultivars. Specifically, Cuomo

et al. (1996) observed that biomass production varied between 2-3 Mg ha-1 for cultivars

"Pensacola", "Argentine" and "Tifton 9" in late spring, while they reached 11-12 Mg ha-1 in

summer. Early on, Mislevy et al. (1990) indicated that cultivar "Tifton 9" had 30% more biomass

production than cultivar "Pensacola" during early winter. Later on, cultivars "Pensacola",

"Tifton 9" and RRPS cycle 18 were evaluated for biomass production during the cool-season and

authors observed that cultivar "Tifton 9" and RRPS cycle 18 doubled the yield of "Pensacola."

This seasonal growth pattern also affects plant nutritive value, because of the fast growth

rate directly related to high temperatures which implies secondary growth and reproductive

growth (Stewart, 2006). Therefore, nutritional quality of subtropical grasses decreases with

maturity during spring and summer. Specifically, Johnson et al. (2001) observed that dry matter

yield increased while forage quality parameters such as digestibility and protein fractions

decreased through successive cuttings during the summer in three subtropical grasses

(bermudagrass cv. "Tifton 85", stargrass cv. "Florona" and bahiagrass cv. "Pensacola"). This

decrease in digestibility and soluble nitrogen fractions across summer could be partially

compensated through nitrogen fertilization. However, this fertilization treatment reaches a

threshold after midsummer, so that new dietary supplements need to be considered to support

further animal performance.









Digestibility and voluntary intake studies indicated that crude protein content and in vitro

organic matter digestibility (IVOMD) decreased in four tropical grasses (bermudagrass cv.

"Tifton 85", stargrass cv. "Florona" bahiagrass, cv. "Pensacola" and limpograss cv. "Floralta")

between 4-week and 10-week harvests during fall. However, the feeding value of "Pensacola"

bahiagrass, represented by in vitro and in vivo OMD, remained steady while feeding values of

"Tifton 85" bermudagrass and "Florona" stargrass decreased through the 6 weeks. Therefore,

bahiagrass seems to retain its forage quality through fall season compared with other tropical

grasses (Arthington and Brown, 2005). Therefore, nitrogen fertilization increases biomass

production and crude protein content in tropical grasses in general and in bahiagrass in

particular, and these increases could be reflected in animal performance (Stewart, 2006).

In summary, bahiagrass shows a seasonal growth pattern that is reflected not only in

biomass production but also in nutritional quality. According to Cuomo et al. (1996), Jhonson et

al. (2001), Arthington and Brown (2005) and Stewart (2006), this seasonal pattern involves an

increase in biomass production and decrease in nutritional quality during the warm-season which

directly limits animal growth and performance. This loss could be partially compensated by

nitrogen fertilization and dietary supplies. However, the use of the vspB gene, encoding the

VSPP, presents two main advantages: rumen stability and enriched aminoacid composition.

While most plant proteins are degraded by rumen proteolysis, bypass proteins remained intact

and they are absorbed in ruminant intestines. Also, engineered plants containing VSPs

accumulated high levels of lysine in heterologous plants (Guenoune et al., 2003). Therefore,

soybean VSP3 seems to be a promising candidate to enhance the nutritional quality of bahiagrass

and it could affect total protein and essential aminoacid contents.









Genetic Engineering to Enhance Pest Resistance

Development of Bt crops

Currently, insect pests cause 10-20% of crop losses and are a major limiting factor in crop

production (Ferry et al., 2006). Traditionally, these pests were controlled by Integrated Pest

Management (IPM) strategies involving the use of pesticides. However, the indiscriminate use of

pesticides can produce adverse effects on human health and the environment, including the

development of insect resistance and the elimination of other beneficial insects (Ranjekar et al.,

2003; Ferry et al., 2006). To overcome these problems, environmentally-friendly pesticides

containing Bt (Bacillus thuringiensis) spores and crystals were developed. But these spray

formulations were partially effective because they did not reach burrowing insects and did not

persist long enough in the environment. Therefore, Bt transgenic crops expressing 6-endotoxins

were developed (Schnepf et al., 1998; Ferre and Van Rie, 2002; Ranjekar et al., 2003; Kaur,

2006).

Currently, this technology has been adopted not only in the United States but also in the

rest of the world including developing countries such as China and India, where it was easily

adopted by small farmers because it has a direct economic impact due to the reduction of

pesticide applications and the increase of crop yields (Huesing and English, 2004).

The first generation of Bt crops include several commercial products expressing crylAb

and crylF genes for protecting crops like cotton and corn against different insect pests like

european corn borer (Ostrinia nubilalis Huebner), southwestern corn borer (Diatraea

grandiosella Dyar) and corn earworm (Helicoverpa zea Boddie) that were released since 1996

in the United States (Mendelsohn et al., 2003). These examples include marketed products

expressing the crylAb gene like YieldGardTM corn hybrids (events MON810 and BT11 from









Monsanto and Syngenta respectively). Later, Herculexl corn expressing a full length crylF gene

was produced by Pioneer Hi-Bred International and Dow Agrosciences / Mycogen.

In cotton, the second generation of Bt products is already in the market. These products

included Bollgard II, expressing the cry2Ab and crylAc genes (from Monsanto) and WideStrike

expressing the crylAc and crylF genes (from Dow AgroSciences). These products offer a

broader spectrum of protection against insect pests (Bates et al., 2005).

Bacillus thuringiensis toxins

Delta-endotoxins protect plants against nematodes and a large group of insects including

Lepidoptera (butterflies and moths), Diptera (flies and mosquitoes), Coleoptera (beetles and

weevils) and Hymenoptera (wasps and bees)(de Maagd et al., 2001; Ferre and Van Rie, 2002;

Griffits and Aroian, 2005). These crystal protoxins are solubilized and proteolitically activated in

the insect midgut where the active toxins bind to specific receptors in the intestine epithelial cells

leading to pore formation and cell death. The active toxins have a conserved structure formed by

three domains. Based on conformational studies, domain I showed hydrophobic helices

indicating that it could be responsible for pore formation, while domain II showed external loops

in the P-sheets suggesting that it is involved in receptor binding and therefore host specificity,

similar to those specific binding mechanisms observed in immunoglobin-antigen binding

reactions (Schenpf et al., 1998). Also, domain III is also involved in both phenomena because it

has very high affinity to receptors located in the gut epithelium of different insect orders

(Schenpf et al., 1998; Ranjekar et al., 2003; Abanti, 2004; de Maagd et al., 2001). These 6-

endotoxins are classified into four groups providing protection against four insect orders: cryl

(Lepidoptera), cry2 (Lepidoptera and Diptera), cry3 (Coleoptera) and cry4 (Diptera). So far,

more than 100 cry genes had been already identified. Besides these crystal proteins produced

during sporulation, other bacterial proteins with insecticidal activities produced during vegetative









growth such as the vegetative insecticidal proteins (vips) are under study (Schenpf et al., 1998;

de Maagd et al., 2001; Bates et al., 2005).

Strategies to increase cry genes expression levels

Currently, only one case of field-developed resistance was reported but laboratory studies

on field-selected strains indicated the potential of resistance development in different insect

populations (Ferre and Van Rie, 2002). According to Bates et al. (2005), this delay in resistance

development under field trials could be explained by several factors including resistant

individuals with higher fitness costs than the susceptible ones, a low frequency of resistant

alleles, a dilution of resistant alleles in susceptible individuals feeding on non-transgenic plants,

and high toxin doses in the transgenic plants. Originally, the use of transgenic crops expressing

moderate 6-endotoxin levels to ensure the survival of susceptible individuals in the insect

population seemed to be the best strategy. But, this strategy was influenced by environmental

conditions producing a small delay and affecting crop yield. Currently, the use of transgenic

crops expressing high toxin levels to ensure the death of the heterozygous individuals for the

resistance gene autosomall, recessive), produces a longer delay and maintains the crop damage

below an economic threshold (Bates et al., 2005).

Therefore, to increase Bt expression levels different molecular approaches were taken: the

use of cry truncated sequences only expressing the active toxins, the use of cry codon-optimized

sequences for enhanced plant expression and the reduced use of AT sequences for eliminating

alternative splicing sites and polyadenilation signals (Schenpf et al., 1998; Bohorova et al., 2001;

Kaur, 2006). Other strategies involve creating fusion constructs (Bohorova et al., 2001), stacking

cry genes with different binding sites (like hybrid or site-directed mutagenesis-generated

genes)(Kaur, 2006), and pyramiding genes encoding proteins with different toxicity mechanisms

like vegetative insecticidal proteins (vip) or proteinase inhibitors (PI) (Ferry et al., 2006). To









delay insect resistance development, these molecular strategies were combined with insect pest

management (IPM) strategies including the use of refuges formed by non-transgenic plants

(Cannon, 2000; Ranjekar et al., 2003; Bates et al., 2006).

Expression of crylF Gene to Enhance Insect Resistance in Bahiagrass

Bahiagrass (Paspalum notatum var. Flugge) is the predominant grass in forage in the

southeast of the United States and it plays a key role supporting beef and dairy cattle industries

in North Florida (Chambliss, 2002). Even though bahiagrass withstands most plant diseases, it is

susceptible to insect pests such as mole crickets (Scapteriscus spp) and fall armyworm

(Spodopterafrugiperda J. E. Smith). Fall armyworm (FAW) is one of the most important insect

pests in the southeast of United States, causing seasonal economic losses in field crops such as

sweet and field corn, forage and turf grasses, other cereals like rice and sorghum, and other crops

like cotton and peanut (Sparks 1979, Meagher and Nagoshi, 2004). In the 1970s, these outbreaks

resulted in economic losses of 30-60 million dollars (Sparks, 1979, Meagher, personal

communication). Initially, it was observed that crylAb and crylF genes provided good

protection levels against different insect pests like European corn borer, southwestern corn borer

and Corn Earworm in cotton and corn crops (Mendelsohn et al., 2003). Amongst these pests, the

ECB is considered the most important insect pest in the Midwestern and northeastern, while

FAW and CEW are the most important pests in the southeastern United States. In southeastern

U.S., the subtropical weather allows double cropping if the tropical crops like corn and cotton are

resistant enough to overcome summer pests and diseases. Further studies showed that all Bt

events expressing the crylAc gene (YieldGard corn hybrids) were effective in controlling whorl

damage by FAW and ear infestation and damage by CEW at normal and late planting dates

(Williams et al., 1997; Buntin et al., 2004; Wiatrak et al., 2004). However, Abel and Adamczyck

(2004) suggested that differential crylAb expression patterns could be limited by reduced









nitrogen supply or photosynthesis rate in green tissues. Recently, field trials with corn hybrids

expressing a full length cryIF gene (Herculex I) indicated that this gene provided protection

against a wide range of insect pests including FAW (EPA, 2001). However, these reports are

limited to commercial products from crops like corn and cotton and there are no reports on the

effects of cry genes against insect pests in forage or turfgrasses. Therefore, the expression of a

synthetic cryIF gene encoding a 6-endotoxin was evaluated as a strategy to enhance resistance

against FAW in bahiagrass.































B) / C)








Figure 2-1. Bahiagrass (Paspalum notatum Flugge). A) erect or semipostrate plant growth habit
indicating aboveground stolons, underground rhizomes, aerial stems and roots with details of the
ligule and spikelet http://www.tropicalforages.info/key/Forages/Media/Html/Paspalumnotatum.htm.
B) bahiagrass pasture with inflorescences http://plant-materials.nrcs.usda.gov/gapmc/photo.html. C)
cattle grazing on bahiagrass pastures in Florida http://www.animal.ufl.edu/facilities/sbru/.











A) APPROVED Releases By Phenotype Category
Total Numbwe Of APPROVED Releases Unde Prmits Arnd NitliortOsw
0 1000O 2,000 3,000 4,000 5.000
I I I I
Herblcid Ti olernce (40d)

rendct Resstarce (3447)

Product Quality(217)

AgrorNormiC Ptrop.es (1548)

Mcrus Rstac [1275)

Other (781]

Fungal R~s~itance (760)

Marker Gene [728]

Bact~ea11l Re~~Itancr e (124)

Nematode Resistance (37)








B) Phenoltpe Of Approved Peitions For Deregulation
Ier Of Petitirns For Dregultion
0 5 10 15 20 25 30 36
II I I I I I
Herbicide Toleranc 33)
Isect Resistane (4)
Product ualhity 141
Virus Residbrce(9J
Agrorrnic Properties (S)
Other (2)



Figure 2-2. Transgenic crops under field trials and deregulation process in the United States
(APHIS-USDA database http://www.nbiap.vt.edu/, last accused May, 2007). A)
Approved field releases by phenotypes, B) Approved deregulation petitions by
phenotypes










Total Number of Issued or Acknowledged Field Tests by U.S. State
('o r,. nimb.r Lndir: 3t.s a value of Q)
1987-Present (Febuary 2a, 20)


L

43 ;


J
r\~1


i


36



325


.rIC 54
V ----


( S .
. ,


I A40


16 311 -
700 ". ,-
t 9 I E *
317 3 i '1
--..' _a r,..
"1 13 I Ni
1822 W4 *d
',',. i / -, : E 23
199 --9 1 .,J, N
.' 20: [.MD.'
--3 .. .. 3SS M
/ 29S .'*
103 I '
37 -_ 3 2 -. 335 r'

3- *" 17 \ / .L.,


24d~


' ,


2,016 -. '
,.. K .
2~OI6


VI 12
PR I.675


Figure 2-3. Total number of issued or acknowledged field tests of transgenic crops sorted by
state in the United States (http://www.isb.vt.edu/cfdocs/fieldtestsl.cfm, last accessed
May, 2007).


4


MA 19
RI9
T 270
91
11:
!23


-z
-" -~t~~


k









CHAPTER 3
OVEREXPRESSION OF THE vspB GENE FROM SOYBEAN TO ENHANCE
NUTRITIONAL QUALITY IN BAHIAGRASS (Paspalum notatum VAR. FLUGGE)

Introduction

Bahiagrass (Paspalum notatum var. Flugge) is the predominant grass in forage pastures in

tropical and subtropical regions and it supports ruminant production in these areas worldwide.

This subtropical grass is a C4 plant, like corn and sorghum, which implies that it has higher

water and nitrogen use efficiencies and performs better than C3 plants under high temperature,

moisture and light intensity conditions (Gates et al., 2004; Moser et al., 2004). In Florida,

bahiagrass is the primary forage crop supporting beef and dairy cattle industries and covering 2.5

million hectares (Chambliss, 1996, 2002; Burton et al., 1997; Blount et al., 2001). It is preferred

by farmers and producers because it has low management requirements and very good

persistence and yield under different environmental stresses. It is tolerant to poor soils including

light-textured, low fertility and marginal pH soils. It is tolerant to drought stress because it has a

well-developed root system that helps to improve water holding capacity and to reduce nutrient

leaching in soils. It is tolerant to most fungal diseases and insect pests, except for ergot

(Claviceps spp), dollar spot (Sclerotinia spp), mole crickets (Scapteriscus spp) and fall

armyworms (Spodoptera spp). Moreover, it is tolerant to overgrazing and high cutting

frequencies which favors plant regrowth and maintains nutritional quality during summer

(Chambliss, 2002; Blount et al., 2001; Stewart, 2006). However, it requires high sowing rates

and is susceptible to common herbicides. Most C4 tropical grasses, including bahiagrass, have a

low protein content which affects animal performance. Bahiagrass protein content reaches 11%

during spring and decreases to 5-7% during summer and fall. This decrease in protein content

with an increase in fiber content reduces not only bahiagrass nutritional value but also animal

performance giving reduced average daily gain (Cuomo et al., 1996; Gates et al., 2004).









Genetic engineering and breeding efforts has been focused in crop improvement. Most

transgenic crops are improved by incorporating traits like herbicide tolerance and insect

resistance while few crops are improved for increasing crop yield and quality because these traits

are controlled in more complex ways (Dunwell, 2000). Specifically, grass pastures have low

nutritive value compared with legume based-pastures because grasses have low protein content

and are deficient in essential aminoacids like lysine, tryptophan and threonine (Sun and Liu,

2004). Nutritional quality is a complex trait because it requires the regulation of some metabolic

pathways without affecting the metabolic profile of the plants.

To improve nutritional quality new molecular approaches were developed (Tabe and

Higgins, 1998; Galili and Hoefgen, 2002; Sun and Liu, 2004). These molecular studies are

focused on up- or down-regulating expression levels of enzymes involved in the aminoacid

synthesis or degradation pathways so that an enhanced production of free essential aminoacids

may lead to an increase of total protein content and protein quality in plants (Galili et al., 2000;

Habben et al., 1995). Also, they are focused on increasing the levels of essential aminoacids-

enriched proteins, mostly by overexpressing storage proteins in forage crops.

To prevent heterologous protein degradation, two approaches were followed: producing

recombinant proteins including endoplasmic reticulum (ER)-retention signals like lys-asp-glu-leu

(KDEL) (Khan et al., 1996; Tabe et al., 1995; Wandelt et al., 1992) or using those storage

proteins that are naturally accumulated in vegetative tissues (VSPs).

Several VSPs were identified, isolated and used for increasing protein content and quality

in forages. Vegetative storage proteins were found in plants with storage organs such as tubers

from potato (Solanum tuberosum L.) and sweet potato (Ipomea batata L.), taproots of alfalfa

(Medicago sativa), paraveinal mesophyll tissue from soybean (Glycine max) and other legumes









and bark tissues from trees such as poplar (Populus sp) or willow (Salix sp) (Staswick, 1994;

Muntz, 1998). Although soybean-derived VSPs have high homology with a tomato acid

phosphatase (DeWald et al., 1992), they have very low acid phosphatase activity probably due to

the loss of the catalytic site (Leelapon et al., 2004). These proteins have a turnover rate

controlled by the sink/source status of the storage organs and they could be preferentially

synthesized or degraded at different developmental stages of the plant. Originally, VSPa and

VSPP and their encoding genes, vspA and vspB, were characterized from soybean tissues

(Staswick, 1988; Mason et al., 1988; Rapp et al., 1991). Later, ultrastructural and

immunocytochemical studies showed that VSPs were accumulated via rough ER (RER) and/or

golgi apparatus (GA) in the storage vacuole of the paraveinal mesophyll (PVM) from several

legume species. It was reported that PVM cells were enriched with RER and GA and that vspa

and p were detected along the whole pathway in induced soybean plants where these proteins

reached 50% total protein content (Klauer and Franceschi, 1997). Recently, immunolabelling

studies showed that these vacuoles are functionally flexible being converted from storage to lytic

forms and viceversa according to the soybean nitrogen requirements (Murphy et al., 2005).

The use of the vspB gene, encoding the soybean VSPp, presents two main advantages:

rumen stability and enriched aminoacid composition. While most plant proteins are degraded by

rumen proteolysis, bypass proteins remained intact and they are absorbed in ruminant intestines.

It was previously observed that VSP3 behaves as a bypass protein being stable in the rumen and

absorbed in the cattle intestines (Guenoume et al., 2002). Besides, VSPs contain ca.7% lysine

(Mason et al., 1988; Staswick, 1988). Engineered plants containing VSPs accumulated high

levels of lysine in heterologous plants (Guenoune et al., 2003). Because vspp is a rumen

proteolysis-resistant (Galili et al., 2002) and lysine-enriched protein (Mason et al., 1988;









Staswick, 1988), it is a promising candidate to improve plant nutritional quality in bahiagrass for

ruminant feeding. Therefore, the objective of this work was to overexpress a soybean vegetative

storage protein gene and to evaluate the effects of this gene on the nutritional quality of

bahiagrass (Paspalum notatum Flugge).

Materials and Methods

Soybean vspB Gene

The vspB gene and VSP3 polypeptide from different soybean tissues were molecularly

characterized by different authors (Staswick, 1988; Mason et al., 1988; Rapp et al., 1991).

Specifically, they identified two cDNA clones that were highly homologous: pVSP27 (Staswick,

1988) and pKSH3 (Mason et al., 1988). Further studies using genomic libraries identified the

putative CAAT box, the TATA box and a TGTTGT(A/T)(G/T) enhancer at the 5' flanking

region and three exons and two introns in the coding sequence of vspB gene (Rapp et al., 1991).

The vspB gene from the vsp27 cDNA clone, as reported in the NCBI database (M20038), has a

coding sequence that is 762 bp in length (Figure 3-1). The VSP3 polypeptide is 254 aa length

and contains a 35 residue ER-signal peptide (Mason et al., 1988) and a putative FPLR vacuolar-

transit peptide (DeWald, 1992) in the NH2-terminal region. The soybean vspB coding sequence

in the pKSH3 vector was kindly provided by Dr. R. Shatters (ARS-USDA, Ft. Pierce, Fl). To

enhance vspB expression, the pKSH3 vector was used in further cloning strategies.

Construction of Expression Vectors for the vspB Gene

A precise description of the cloning strategy to generate the expression vectors and

respective cassettes is described in Figure 3-2 and the specific cloning protocols and vector maps

are described in Appendix 1 and 2 respectively.

The complete soybean vspB sequence was amplified from the plasmid pKSH3 and

introduced in the pGEM-T Easy Vector (Promega). For amplifying the vspB coding sequence,









we used the forward primer: 5' CGTCTAGAACGCGT

ATGAAGTTGTTTGTTTTCTTTGTTGC including the XbaI and Mlul sites and the reverse

primer: 5' CGGCGGCCGCACTAGTCTCAATGTAGTACATGGGATTAGGAAG including

the NotI and Spel sites. A 25 pl PCR reaction was set up using the PCR Core System II

(Promega). The PCR product was used in a ligation reaction 1:1 (insert:vector) with the

LigaFastTM Rapid DNA Ligation System (Promega) and incubated overnight at 40C. The

ligation products were transformed into commercial chemical competent cells (Life

Technologies), plated in Luria Broth (LB) medium with 7 [l IPTGX, 40 [l X-gal and 100 [tg/ml

ampicillin and incubated overnight at 37C. Primary colony screening identified four white

colonies. These colonies were grown in 4 ml LB medium containing ampicillin overnight at 37C

and 220 rpm. Plasmid DNA was isolated using the QIAprep Spin Miniprep Kit (QIAGEN) and

plasmid quantity and quality was confirmed by running a 0.8% agarose gel. Further screening by

PCR and by restriction digestions with Xbal and NotI, Mlul and Spel and XbaI, NotI and BamHI

indicated that all colonies contained the 712 bp amplified fragment and all the restriction sites

were functional. According to the sequencing results, both colonies were completely

homologous to the vspB sequence. The intermediate vector was called pGFL1 (Figure2).

The vspB sequence was excised as an XbaI-NotI fragment from the intermediate vector

pGFL1 and cloned into the plasmid pCMYCKDEL (kindly provided by Dr. Altpeter, Agronomy

Department, University of Florida). The plasmid pCMYCKDEL contained the 35S CAMV

promoter, the c-myc tag, the ER-retention signal KDEL and the 35S CAMV polyadenilation

signal. The KDEL is a carboxy-terminal tetrapeptide that allows the retention of a family of

soluble proteins in the ER (Munro & Pelham, 1987). The c-myc tag is a synthetic peptide formed

by ten aminoacid residues corresponding to the coding sequence between the 408-439bp of









human c-myc gene product (EQKLISEEDL from the 9E10 hybridoma, Evan et al., 1985).

Epitope tagging is widely used for different protein studies like protein expression, localization,

purification, topology, dynamics, interactions, functional analysis, and discovery (Jarvik and

Telmer, 1998).

Plasmid DNA was isolated using the QIAprep Spin Miniprep Kit (QIAGEN) and plasmid

concentration and quality were evaluated by running a 0.8% agarose gel. Plasmid backbone was

prepared for ligation by 3' end dephosphorylation with shrimp alkaline phosphatase (SAP,

Promega) and cleaned with spin columns from the QIAquick Gel Extraction Kit (QIAGEN). The

XbaI-NotI insert vector was gel-extracted and cleaned with spin columns from the QIAquick Gel

Extraction Kit (QIAGEN). Both fragments were used in a ligation reaction 1:1 (insert:vector)

incubated overnight at 40C. The ligation products were transformed into electrocompetent cells

of E. coli DH5a Six colonies were screened by PCR. Four positive colonies were further

checked by restriction digestions with Xbal, Xbal and NotI and PstI showing the right size

fragments. Two colonies were sequenced and one colony was homologous to the vspB sequence.

Besides, the translation frame of vspB coding sequence was aligned with the c-myc tag and the

ER-retention signal KDEL, and the CAMV 35S terminator from the pCMYCKDEL vector. This

plasmid was called pGL2 (Figure 3-2).

From the pGL2, a fragment containing the vspB sequence, the c-myc tag, the ER-retention

signal SKDEL and the 35S CaMV terminator was amplified. A forward primer: 5'

CGGGTACCATGAAGTTGTTTGTTTTCTTTGTTGC including the Kpnl and a reverse primer:

5' CGGAGCTCGTTTAAACGCATGCCTGCAGGTCACTG including the Sac and Pmel sites

were used. The 25 pl PCR reaction was set up using the PCR Core System II (Promega). PCR

product was cleaned with spin columns from the QIAquick Gel Extraction Kit (QIAGEN).









A PstI fragment containing ubil promoter and first intron (Christensen and Quail, 1992)

from pJFNPTII (Altpeter, 2000) was cloned into the pCAMBIA2300 vector. The

pCAMBIA2300 contained a selectable marker cassette formed by a double 35S promoter, the

nptll gene and a 35S terminator (Figure 3-2). The PstI insert was gel-extracted and cleaned using

the spin columns from the QIAquick Gel Extraction Kit (QIAGEN). The pCAMBIA2300

backbone was digested with PstI, dephosphorylated with SAP (QUIAGEN) and cleaned with

spin columns from the QIAquick Gel Extraction Kit (QIAGEN). Both fragments were used in a

1:1 ligation reaction incubated overnight at 40C. Ligation products were electroporated into

electrocompetent cells of E. coli DH5a. Four colonies were screened. These colonies were

grown in 4 ml cultures overnight in LB medium and kanamycin at 370C and 220 rpm. Plasmid

DNA was isolated using the QIAprep Spin Miniprep Kit (QIAGEN). Further screening by

restriction digestions with Xhol, EcoRI and PstI indicated that the insert was correctly oriented in

one colony. This intermediate vector was called pGFL2 and used as recipient vector for further

cloning steps (Figure 3-2).

The PCR fragment from pGL2 was cloned into the pGFL2 vector to produce the

expression vector pGL4. Insert and vector were digested with Sacd and KpnI. The pGFL2 vector

was further dephosphorylated with SAP (Promega) and cleaned with spin-columns from the

QIAquick Gel Extraction Kit (QIAGEN). The 3:1 (insert:vector) ligation reaction was set up

using LigaFastTM Rapid DNA Ligation System (Promega), and incubated overnight at 40C. The

ligation products were transformed into electrocompetent cells. Five colonies were screened by

PCR and restriction digestions. These colonies were grown in 4 ml LB medium and ampicillin

overnight at 370C and 220 rpm. Plasmid DNA was isolated with QIAprep Spin Miniprep Kit

(QIAGEN) and plasmid quantity and quality were confirmed by 0.8% agarose gel. PCR and









restriction digestions with Pmel and SacI, KpnI and SacI, Pmel and SacII and Hindlll indicated

the presence of the insert. Two colonies were sequenced. One colony was completely

homologous to the KpnI-SacI fragment sequence and all the restriction sites were functional

(Figure 3-2).

Other Expression Vectors and Cassettes

The vectors pJFNPTII and pHZ35 SNPTII were used as selectable markers. The pJFNPTII

vector contains a selectable marker cassette formed by maize ubiquitin promoter and first intron

(Christensen and Quail, 1992), the nptll coding sequence (Bevan, 1984) and the CAMV35S

polyadenilation signal (Dixon et al., 1986). The pHZ35SNPTII vector contains a selectable

marker cassette formed by the CAMV35S promoter (Odell et al., 1985) and hsp70 intron

(Rochester et al., 1986), the nptll coding sequence (Bevan, 1984) and the CAMV35S

polyadenilation signal (Dixon et al., 1986). The vector pRSVP1 (provided by Dr. R. Shatters,

ARS-USDA, Ft. Pierce, Fl) contains a vspB expression cassette formed by maize ubil promoter

and Adh intron, the vspB coding sequence and a 3' nos polyadenilation signal (Grando, 2001;

Grando et al., 2005).

Plasmid DNA was isolated using the QIAprep Midiprep Kit (QIAGEN). Fu et al. (2000)

indicated that the use of minimal constructs (MCs) containing only the expression cassettes,

instead of the complete plasmid vectors, enhanced the expression levels in the transgenic plants.

Therefore, plasmids were digested, their respective fragments were gel-extracted and fragment

quality and concentration were confirmed by a 0.8% agarose gel. The vspB cassette was excised

as a PvuII fragment (3.4kb) from the pGL4 vector and as an EcoRl fragment (1.9kb) from the

pRSVP1 vector. The nptll cassette was excised as an I-Scel fragment (3kb) from the pJFNPTII

vector and as AlwnI-NotI fragment (2.6kb) from the pHZ35SNPTII. These expression cassettes

were isolated by gel electrophoresis, and the corresponding band was excised and purified using









the Wizard SV Gel and PCR cleanup system (Promega, Madison, WI) to remove vector

backbone sequences. These expression cassettes were used for the biolistic gene transfer (Figure

3-3).

Transformation and Regeneration Protocols

Mature seeds were used for generating embryogenic calli from bahiagrass (Paspalum

notatum Flugge) cultivar "Argentine" (Altpeter and Positano, 2005). Plates with embryogenic

calli were cobombarded with microparticles coated with the MCs from the pGL4, pRSVP1,

pJFNPTII and pHZ35SNPTII vectors. Four independent gene transfer experiments were carried

out. Specifically, 49 petri dishes, with approx. 30 callus pieces each, were cobombarded with

MCs from pGL4 and pJFNPTII, 23 petri dishes with MCs from pGL4, pRSVP1 and pJFNPTII,

and 19 petri dishes with MCs from pGL4 and pHZ35SNPTII. Transgenic calli expressing the

nptll gene were identified during subsequent subcultures in a medium containing 50 mg L-1

paromomycin sulfate as a selective agent (Altpeter and James, 2005). Transgenic plants were

grown under 16 h light photoperiod at 26-290C in growth chambers and transferred to the

greenhouse after two or three weeks.

Molecular Studies

Transgene integration was evaluated by molecular studies including polymerase chain

reaction (PCR) analyses while transgene expression was evaluated by enzyme linked-

immunoadsorbent assays (ELISA) for the nptll gene and western blots for the vspB gene.

Recombinant VSP3 was isolated by co-immunoprecipitation using anti c-myc antibodies.

Enzyme linked-immunoadsorbent assays (ELISA)

A rapid qualitative assay was performed to evaluate the expression of the nptll marker

gene in leaf tissue from bahiagrass transgenic lines. Pieces of young leaf tissue were ground with

a disposable pestle in an ependorf tube and protein extracts were obtained in a phosphate saline









buffer (PBS). Protein concentration was estimated with the Coomasie Plus Protein Assay reagent

and Coomasie standards (Pierce Biotechnology, Inc.) at OD595 with a spectrophotometer

(BioRad Laboratories). Twenty micrograms of total protein were loaded in each well and wild

type, positive and negative controls were included. ELISA assays were performed according to

the protocol suggested by the Agdia kit (Agdia, Elkhart, IN) and colorimetric data were captured

with a digital camera.

Polymerase chain reaction (PCR)

PCR analyses were performed to confirm the integration of the vspB gene into the

bahiagrass transgenic lines. Genomic DNA from the transgenic lines was extracted following a

modified Dellaporta method (1983). Three sets of primers were used for the screening. The

forward primer 5'CGGGTACCATGAAGTTGTTTGTTTTCTTTGTTGC and the reverse primer

5'CGGAGCTCGTTTAAAC GCATGCCTGCAGGTCACTG were designed for amplifying a

1kb fragment containing the coding sequence of the vspB gene, the c-myc tag, the SKDEL signal

and the 35S polyadenilation signal. PCR was performed using the PCR Core System II

(Promega).The cycling conditions were 95C 2 min initial denaturation, 30 cycles of 950C 1 min,

500C 1 min, 720C Imin and 720C 5 min final extension. Also, two sets of primers were used

according to Grando (2001). The first pair included the forward primer P1

5'GTTCTTCGGAGGTAAAAT and the reverse primer P2 5' TTCGCCTCTGTGGT and it

amplified a 611 bp fragment. The second pair included the forward primer P3

5'GCAGGCTACCAAAGGT and the reverse primer P4 5'TAGGTGACTTACCCACAT which

amplified an 843 bp fragment. Both fragments contained the vspB coding sequence. PCR was

performed using the PCR Core System II (Promega).The cycling conditions were 95C 15 min

initial denaturation, 35 cycles of 950C 1 min, 570C 1 min, 720C Imin and 720C 15 min final

extension. The PCR products were electrophoresed in 0.8% agarose gel, stained with ethidium









bromide and digital images were captured with the QuantityOne Software (BioRad

Laboratories).

Sodium dodecyl sulphate polyacrilamide gels (SDS-PAGE)

Five hundred milligrams of leaves were ground with liquid nitrogen and 1 ml of extraction

buffer (100 mM Tris.HCl (pH 8.0), 200 mM NaC1, 1Mm EDTA, 5% glycerol, 0.2% TritonX100,

ImM P-mercaptoethanol or DTT) supplemented with 32 tl/ml buffer of the Protease Inhibitor

Cocktail (Sigma). Two successive centrifugation steps for 20 and 10 min at 4000 rpm (Sorwall

SS-34) were done to obtain a clear supernatant. Protein concentration was estimated with the

Coomasie Plus Protein Assay reagent and Coomasie standards (Pierce Biotechnology, Inc.) at

OD595 with a spectrophotometer (BioRad Laboratories). Fifteen or twenty micrograms of total

protein were separated on 12% Sodium Dodecyl Sulphate Polyacrylamide Gels (SDS-PAGE).

Two molecular markers were used: Prestained SDS-PAGE standards, low range (Bio-Rad

Laboratories) and Magic Mark XP Western protein standards (In vitrogen). Gels were

electrophoresed in Mini PROTEAN 3 Electrophoresis Cell (Bio-Rad Laboratories) at 125 v and

room temperature for 75 min. Gels were either stained with Coomasie blue (Sigma R-250,

Sigma) or further used for western blot analysis.

Western blot analysis

SDS-PAGE gels were transferred to nitrocellulose or PVDF membranes using a Mini

Trans-blot Electrophoretic Transfer Cell and the recommended protocols (Bio-Rad

Laboratories). VSP was detected with VSP3 antibodies (provided by Dr. S. Galili, Agronomy

and Natural Resources Department, The Volcani Center, Israel) or c-myc antibodies (anti c-myc

antibody, Sigma). Protocols were adjusted for VSP3 antibodies with soybean leaves and for c-

myc antibodies with bahiagrass leaves. Parameters evaluated were different leaves, extraction

buffers, protein concentrations, primary and secondary antibody dilutions and incubation times.









For VSPP antibody detection, a tissue sample of soybean leaves was used as starting material, 15

pg total protein were loaded in the SDS-PAGE, and the VSPp antibody was incubated in a

1:1000 dilution in orbital shaker for 4 hr. For c-myc antibody detection, a tissue sample of

bahiagrass leaves was used as starting material, 20 .g total protein were loaded in the SDS-

PAGE gel and the c-myc antibody was incubated in a 1:1000 dilution in orbital shaker for 2 hr.

Secondary antibodies were incubated in a 1:50,000 dilution in orbital shaker for 2 hr. Detection

was performed using a very sensitive chemiluminescent substrate (Supersignal West Femto

Maximun Sensitivity Substrate, Pierce Biotechnology, Inc.). Western blots with c-myc

antibodies were performed in bahiagrass samples to evaluate the VSPp expression levels

variation from different leaves, tillers, and plants. To compare different leaves, four samples

were taken from the the youngest to the oldest leaf and they were labeled consecutively as 1, 2, 3

and 4. Highest expression was observed in third and four bahiagrass leaves. Therefore, to

compare different plants and tillers whitin plants, two samples from the third fully emerged leaf

were taken.

Co-immunoprecipitation of recombinant VSPO

The Pro-FoundTM c-myc Tag IP/Co-IP kit and application set (Pierce Biotechnology, Inc.)

was used to purify the VSP3 recombinant protein. Five grams of leaf tissue were ground with

liquid nitrogen, and 15 ml extraction buffer (100 mM Tris.HCl (pH 8.0), 200 mM NaC1, 1Mm

EDTA, 5% glycerol, 0.2% TritonX100, ImM P-mercaptoethanol or DTT) was added. Two

successive centrifugation steps for 20 and 10 min at 4000 rpm (Sorwall SS-34) were done to

obtain a clear supernatant. Acetone precipitation was done to concentrate the protein extracts.

Protein concentration was estimated with the Coomasie Plus Protein Assay reagent and

Coomasie standards (Pierce Biotechnology, Inc.) at OD595 with a spectrophotometer (BioRad

Laboratories). Ten microliters of anti c-myc agarose with 2 mg protein sample and with 50 [il c-









myc tagged control were incubated overnight in an orbital shaker at 4C. The mixture was loaded

into the spin-columns, washed three times with TBS-T buffer, and eluted with Elution buffer

according to the instructions of the manufacturer (Pierce Biotechnology, Inc.). The elutants of

the three steps (i.e. loading, washing and eluting) were recovered. To evaluate the quality and

quantity of the recombinant VSPO, twenty microliters samples were loaded into a SDS-PAGE

gel and western blots were performed.

Results

Transformation and Regeneration Protocols

Four independent gene transfer experiments produced 214 regenerated plants from 91 petri

dishes with an average of 2.31 regenerated plants/plate (Figure 3-4). Specifically, these

experiments included 156 regenerated plants with MCs from pGL4 and pJFNPTII, 16

regenerated plants with MCs from pGL4, pRSVP1 and pJFNPTII, and 42 regenerated plants

with MCs from pGL4 and pHZ35SNPTII.

Molecular Studies

Enzyme linked-immunoadsorbent assays

The screening of the putative transgenic plants by nptll ELISA indicated that 91 plants

expressed the nptlI gene from 110 plants analyzed. Specifically, 83 nptll(+)/ 102 analyzed plants

with MCs from pGL4 and pJFNPTII, 8 nptlI(+)/8 analyzed plants with MCs from pGL4,

pRSVP1 and pJFNPTII. Figure 3-5C shows the ELISA plate arrangement for one set of

transgenic bahiagrass lines, including negative and positive controls from nptll protein and a

control of transgenic bahiagrass.

Polymerase chain reaction

The screening of the putative transgenic bahiagrass plants by PCR with the three primers

sets confirmed the presence of the vspB gene in 34 transgenic plants (Figure 3-5A). These plants









include 28 transgenic plants with MCs from pGL4 and pJFNPTII, 6 transgenic plants with MCs

from pGL4, pRSVP1 and pJFNPTII, and no transgenic plants with MCs from pGL4 and

pHZ35SNPTII. Figure 3-5B shows the 1 kb fragment amplified with the first set of primers in

gDNA from the transgenic bahiagrass lines.

Sodium dodecyl sulphate polyacrilamide gels

According to the SDS-PAGE gels, VSPs were detected in the total protein profile from

three soybean samples. In the soybean profile, VSP3 appeared as a strong 32kda band with

variable concentration ranking between 10-15% total protein/plant (Figure 3-6A). A weak 32kda

band (31.5kda predicted size, Gasteiger et al., 2003) corresponding to the recombinant VSP3 was

detected in the total profile from several transgenic bahiagrass lines. However, it was not clear if

this band corresponded to the recombinant VSP3 or to some other endogenous protein (3-6B).

Western blot analysis

Western blots with VSP antibodies indicated that VSP3 levels were directly related to total

protein levels in the range of 15 to 60 .g total protein in soybean. In order to estimate the

sensitivity of the VSP antibodies, a calibration curve with a range from 0.5 to 15 .g total protein

was established using the soybean samples. Based on this curve, the VSP antibodies were able to

detect less than 50 ng soybean VSPs. To determine the detection limit of VSP3 antibodies in

bahiagrass, a calibration curve in the range of 15 to 75 ug total protein was established using

bahiagrass samples. Irrespective of the strong band in the soybean control and the corresponding

bands in the bahiagrass samples observed in the SDS-PAGE gels, the recombinant VSP3 was not

detected in bahiagrass samples by VSP antibodies (data not shown).

Western blots with more sensitive c-myc antibodies indicated that VSP3 levels varied

among different plants (Figure 3-7A,B), different tillers within plants (Figure 3-7C) and different

leaves within tillers (Figure 3-7D). The highest VSP3 levels were observed in third and four









leaves from the tillers and in AT22-4 and AT22-7 among bahiagrass plants. According to the

sensitivity limit for Supersignal West Femto Maximun Sensitivity Substrate, the substrate detects

between pico and femtomoles per microgram of loaded protein, therefore the bands obtained

from bahiagrass leaf samples corresponded to 0.001-0.01% total proteins.

Co-immunoprecipitation of recombinant VSPO

Based on the co-immunoprecipitation kit protocol three fractions were recovered for the

bahiagrass protein extracts and the c-myc control. These fractions corresponded to unbound

proteins from the original protein extract, washing buffer and elution buffer containing the c-myc

antibodies bound to the recombinant VSP3. The SDS-PAGE gels containing these fractions

indicated no degradation in the total proteins from bahiagrass samples.The western blots with

tthe anti c-myc antibodies indicated the presence of the recombinant VSP3 (32kda) in the elution

fraction and of a large polypeptide (approx. 50kda) in the unbound fraction from bahiagrass leaf

samples. The control fractions showed the presence of the c-myc control in the elution fraction

indicating that co-immunoprecipitation was efficient; however, it seemed to be an excess of c-

myc protein because a small band was detected in the washing fraction (Figure 3-8).

Discussion

We designed an expression vector including a constitutive and strongly expressed

promoter for monocots; a KDEL signal for ER-retention and a c-myc tag for antibody detection

to enhance the expression of the vspB gene in the transgenic bahiagrass plants. The maize ubil

promoter is one of the strongest promoters in monocot transgenic plants. Transgene expression is

normally enhanced by including its first intron (Christensen et al., 1992; Christensen and Quail,

1996; McElroy and Brettell, 1994). Previous molecular farming studies indicated that KDEL ER-

retention signal increased expression levels of functional single-chain antibodies (Schouten et al.,

1996) and monoclonal antibodies (Ramirez et al., 2003). Also, sorting signals such as the ER-









signal peptide (Mason et al., 1988) and a putative FPLR vacuolar-transit peptide (DeWald, 1992)

in the NH2-terminal from the VSP3 enhanced expression of a hepatitis B antigen in transgenic

potatoes for oral immunization studies (Richter et al., 2000). To increase transformation

efficiency and transgene expression and stability, we also used MCs in the biolistics experiments

because its use should generate simple integration patterns with low number of transgene copies

and rearrangements and less chances of silencing events (Fu et al, 2000).

Based on bahiagrass transformation, selection and regeneration protocols previously

established (Altpeter and Positano, 2005; Altpeter and James, 2005), we generated 91 nptll(+)

plants from 110 analyzed plants. Based on the results from nptll expression detected by ELISA

and VSPp expression detected by western blots, 89% of the plants coexpressed the nptll and the

vspB genes. Also, VSPp expression levels varied among different plants, different tillers within

plants and different leaves within tillers having the highest expression levels in third and four

bahiagrass leaves. However, VSP3 expression levels in bahiagrass leaves corresponded to 0.001-

0.01% total proteins. Currently, VSPs have a controversial role as storage proteins in soybean

plants because even though they represented 10-15% total protein in young soybean leaves

(Grando et al., 2005) and increased to 45% total soluble protein after deppoding; VSP expression

levels could be reduced without affecting plant yield. These results indicated that VSPs do not

play a key role in seed protein accumulation and seed production (Staswick et al., 2001).

Nevertheless, transgenic tobacco studies indicated that high VSP levels were stored in tobacco

leaves. Specifically, VSPa was stably expressed reaching 2-6% total proteins (Guenoune et al.,

1999) while VSPp only reached 2% total protein and it was degraded with leaf age (Guenoune et

al., 2002b). To enhance these expression levels, authors co- targeted VSPs to the vacuole and the

chloroplast (Guenoune et al., 2002a) or coexpressed both soybean VSPs or VSPp and DHPS









reaching ca. 4% total protein in leaves (Guenoune et al., 2003). In contrast, we observed VSP3

expression levels corresponded to 0.001-0.01% total proteins in bahiagrass leaves from

preflowering plants. These levels were similar to those reported in corn by Grando et al. (2005).

Specifically, these studies indicated low VSP3 expression levels showing 0.5% total soluble

protein and still lower 0.03% in leaves of preflowering plants from primary transformants and

their progeny (Grando et al., 2005). Based on low VSP3 expression levels observed in corn and

bahiagrass, it seems that transgenic proteins are more difficult to express in monocotyledoneus

plants probably because their reduced translation or their degradation by endogenous proteases

(Grando et al., 2005). Particularly, Bellucci et al. (2000) coexpressed 6 and p-zeins containing

the KDEL signal in tobacco for enhancing ER accumulation (Wandelt et al., 1992). Authors

observed that the 6-zein was able to undergo posttranslational changes and form protein bodies

while the p-zein remained accumulated into the ER lumen indicating that the KDEL signal could

have interfered in molecule stearic conformation. Hence, this is the first report on expression of

the vspB gene in bahiagrass cv. "Argentine." It may be possible to increase VSP3 expression

levels in transgenic bahiagrass plants by coexpressing recombinant VSP3 and VSPa subunits,

and/or by targeting the subunit to different cell compartments. However, these increased levels

may not likely enhance the total protein content of transgenic plants.



















Bk .1r*~ N


M2W3B
914 b,


Figure 3-1. The complete coding sequence of the vspB gene (M20038, NCBI database). A)

restriction map B) the detailed cDNA and polypeptide sequences indicating the main

features of the cDNA clone according to Stawisck (1988). ER-signal, Vacuolar

signal, Coding sequence and Translation line


m*vii,~r
n,..raln,~, rn,4al-llr
I-








pKSH3




I ----r,/",-- i" I---
Xbal-Mlul vspb gene Not -
PCR



pGFL1 pCMYCK


spb N
XbqJ Nfot


pGL2 -


pGEM T-Easy


DEL DJFNPTII


pCAMBIA2300



PsWr-J Pstl


pGFL2


Kpni vspb gene c-myc KDEL 35S polyA Sacd

PCR
pGL4 expression cassette

I r'. ...


ubil promoter
1 intron


vspb
coding sequence


c-myc KDEL 35S polyA tail


Figure 3-2. Cloning strategy for incorporating the vspB sequence from pKSH3 vector; the c-myc
tag, KDEL ER-signal and 3'35S polyadenilation tail from pCMYCKDEL, and the
ubil promoter and first intron from pJFNPTII into the vector pGL4.


Snhti ne
u, pro er
Xba Noft Pst W PstI


ii











A) vspb expression cassette (3.4kb)


Pvull


ubif
promoter


ubif
intron


vspb
coding sequence


c-myc SKDEL
35S polyA signal


B) vspb expression cassette (1.9kb)


EcoRI EcoRI


ubil Adh
promoter intron


vspb 3' nos polyA signal
coding sequence


C) nptlf expression cassette (3.0kb)


r
npft/ 35S polyA signal
coding sequence


D) nptll expression cassette (2.5kb)


Alwnl


_ B~ca~


CAMV35S Hsp70
promoter Intron


nptll
coding sequence


35S polyA signal


Figure 3-3. Minimal constructs used in the biolistic experiments to generate transgenic lines
from bahiagrass (Paspalum notatum var. Flugge) cv. "Argentine" A) PvulI fragment
(3.4kb) containing MC from pGL4 vector B) EcoRI fragment (1.9kb) containing MC
from pRSVP1 vector C) I-SceI fragment (3.0kb) containing MC from pJFNPTII D)
AhwnI-NotI fragment (2.5kb) containing MC from pHZ35SNPTII vector.


Pvull


I-Scel


ubil
promoter


0


ubil
intron


i-Scel


Notl


------


- ~,~. . . .


...............o oos~.;lc

















































Figure 3-4. Transformation and regeneration protocols for bahiagrass (Paspalum notatum
Flugge) cultivar "Argentine" Different stages during the tissue culture: a) two-week
seedlings, b) four-week seedlings, c) six-week calli, d) seven-week calli plate ready
for bombardment, e) after 4 weeks of selection, f) after 4 weeks in regeneration with
50 mg L-1 paromomycin, g) after 2 weeks in root medium, and h) after 2 weeks in
pots.




























2 kb
1.6kb
1 kb i ..
O.Skb .
















Figure 3-5. Transgenic plants from bahiagrass (Paspalum notatum Flugge) cv. "Argentine" A)
Transgenic bahiagrass lines in the greenhouse. B) PCR analyses for the vspB gene. A
1kb fragment was amplified using the forward primer
5'CGGGTACCATGAAGTTGTTTGTTTTCTTTGTTGC and the reverse primer
5'CGGAGCTCGTTTAAA CGCATGCCTGCAGGTCACTG. The cycling conditions
were 95C 2 min initial denaturation, 30 cycles of 950C 1 min, 500C 1 min, 72C
Imin and 720C 5 min final extension. AT10-1 to AT22-4, transgenic bahiagrass lines;
WT, wild type bahiagrass; NC,negative control; PC, positive control; 1kb ladder. C)
ELISA assays for the nptlI gene (Agdia kit). A-G columns: AT10-1 to ATI 1-22
bahiagrass samples. H column: (-) negative control, (+) nptlI positive control, PC
transgenic positive control and WT wild type.












19 20 34 19 20 34 19 20 34


A)

103 kda
77 kda

50 kda

34.3 kda

28.8 kda




20 kda


B)

103 kda
77 kda

50 kda

34.3 kda

28.8 kda




20 kda


22-4 10-2 10-4 10-5 11-2 11-4 11-6 22-1 22-7


Figure 3-6. SDS-PAGE gels for soybean (G. max) and transgenic bahiagrass plants (P. notatum
var. Flugge) cv. "Argentine" A) Soybean plants (three different protein extracts of
lines 19, 20, 34). B) Transgenic bahiagrass plants (lines 10-2, 10-4, 10-5, 11-2, 11-4,
11-6, 22-1, 22-4, 22-7). Arrows indicate the 32 kda band corresponding to VSPB.


=32 kda











22-4 10-2 10-4 10-5 11-2 11-4 11-6 22-1 22-7


A)
103 kda
77 kda
50 kda


34 kda

29 kda


20 kda


B)

120 kda
100 kda
80 kda
60 kda
50 kda
40 kda

30 kda



C)


50 kda

40 kda

30 kda





D)


WT 22#4 22#7
1 I 4


22#7
2 3 4 1 2 3 4


32 kda
















32 kda










__ 32 kda









L 32 kda


Figure 3-7. Transgenic bahiagrass (Paspalum notatum Flugge) cv. "Argentine" A) SDS-PAGE
of different transgenic bahiagrass lines. B) Western blots with c-myc antibodies from
different transgenic bahiagrass lines. C) Western blot of three different tillers (#1,2,3)
within lines (lines 22-4 and 22-7). D) Western blot of four different leaves (#1,2,3,4)
within lines (lines 22-4 and 22-7).


22-4 10-2 10-4 10-5 11-2 11-4 11-6 22-1 22-7










Kda Sd

60

50


40

30



20


Bahiagrass #224
E W UB


C-myc control
E W UB


Figure 3-8. Co-immunoprecipitation of recombinant VSP3 from transgenic bahiagrass
(Paspalum notatum Flugge) cv. "Argentine" Western blot with c-myc antibodies
indicating three fractions: unbound fraction, wash fraction and elutant fraction with
the recombinant VSP3 from plant 22-4 and anti c-myc (+) control.









CHAPTER 4
EXPRESSION OF A SYNTHETIC crylF GENE FROM Bacillus ilun ingiewli, TO ENHANCE
RESISTANCE AGAINST FALL ARMYWORM IN BAHIAGRASS (Paspalum notatum VAR.
FLUGGE)

Introduction

Bahiagrass (Paspalum notatum var. Flugge) is an important forage grass in tropical and

subtropical regions around the world. It is grown on 2.5 million hectares in the southern United

States (Burton et al., 1997; Blount et al. 2001). Its popularity is based on low maintenance

requirements and tolerance to drought, heat, many diseases and overgrazing (Chambliss, 2002).

However, bahiagrass is susceptible to two major insect pests: mole crickets (Scapteriscus spp.)

and fall armyworm (Spodopterafrugiperda J. E. Smith). Fall armyworm is one of the most

important insect pests in the southeastern U.S., causing significant seasonal economic losses in

forage and turf grasses and many other crops (Sparks, 1979; Nagoshi and Meagher, 2004; The

bugwood network, 2007).

Traditionally, many insect pests are controlled using Integrated Pest Management (IPM)

strategies involving the use of pesticides with resistant varieties or biological control agents.

However, the indiscriminate use of pesticides produces adverse effects on human health and the

environment including the development of insect resistance and the elimination of other

beneficial insects (Ranjekar et al., 2003; Ferry et al., 2006). Transgenic crops expressing Bacillus

dln1 iiigenll\i\ (Bt) 6-endotoxins were a natural choice for controlling insects since Bt crystal

protein (Cry) and spore formulation products have been successfully used for many years

(Schnepf et al., 1998; Ferre and Van Rie, 2002; Ranjekar et al., 2003; Kaur, 2006).

The crystal protoxins require solubilization, followed by proteolytic activation in the insect

midgut. The activated toxins bind to specific receptors in the intestine epithelial cells leading to

pore formation and cell death. Based on amino acid sequence homologies and phylogenetic









relationships, these crystal endotoxins are classified in four groups providing protection against

four insect orders: cryl (Lepidoptera), cry2 (Lepidoptera and Diptera), cry3 (Coleoptera) and

cry4 (Diptera) (de Maagd et al., 2001; Ferre and Van Rie, 2002; Griffits and Aroian, 2005). The

active toxins have a conserved structure formed by three domains, and domains II and III are

involved in the specificity to particular insects through receptor binding (Schenpf et al., 1998; de

Maagd et al., 2001; Ranjekar et al., 2003; Abanti, 2004).

Insect resistance to Bt toxins in targeted populations arises through different mechanisms

and/or at different levels (Ferre and Van Rie, 2002; Griffits and Araoin, 2005). Laboratory

bioassays indicated that cross-resistance occurs in populations of diamondback moth (Plutella

xylostella L.) which were resistant to four closely-related 6-endotoxins with highly homologous

binding sites (Tabashnik et al., 1997a, 2001). To date, only one case of field-developed

resistance has been reported, but laboratory studies on field-selected strains indicated the

potential for resistance development in different insect populations (Ferre and Van Rie, 2002).

To increase Bt expression levels in transgenic plants, codon-optimization of cry sequences,

the reduction of AT sequences and the truncation of the native cry sequence have been

successfully used (Schenpf et al., 1998; Bohorova et al., 2001; Kaur, 2006). Elimination of

vector backbone sequences and biolistic transfer of minimal transgene expression constructs (Fu

et al., 2000) also supported high transgene expression levels (Agrawal et al., 2005). Stacking of

different cry genes (Kaur, 2006), expression of cry fusion constructs (Bohorova et al., 2001), and

pyramiding genes including cry genes with genes encoding proteins having alternative insect

control mechanisms like vegetative insecticidal proteins or proteinase inhibitors, will reduce the

risk of insects developing resistance to Bt toxins (Ferry et al., 2006).









In the U.S., growers must conform to the high-dose refuge strategy to delay insect

resistance development. The first component of this strategy is to express toxins in plants at a

high enough level to kill heterozygotes in the insect population. The second component is to

provide structured refuges. Refuges are small areas cultivated with non-transgenic crops which

are interspersed with the transgenic crop. Mating of susceptible adults that developed from non-

transformed plants with those from transgenic plants allow for the elimination of homozygous

resistant individuals and the reduction of resistant alleles (Cannon, 2000; Ranjekar et al., 2003).

Currently, Bt transgenic technology is adopted worldwide and Bt crops are grown on more

than 14 million hectares (James, 2005). In the U.S., Bt crops are grown on approximately 20% of

the crop acreage and their use is directly linked to higher yields and profits and reduced pesticide

application (Cannon, 2000). Currently, marketed products include Bt corn containing the crylAb,

crylF, cry3Bbl and stacked crylAb and cry3Bbl genes for controlling European corn borer

[Ostrinia nubilalis Hibner], southwestern corn borer [Diatraea grandiosella Dyar] and corn

rootworm [Diabrotica barberi Smith and Lawrence], and Bt cotton containing crylAc, stacked

crylAc and cry2Ab2, stacked crylAc and crylF for controlling tobacco budworm [Heliothis

virescens Fabricius], cotton bollworm [Helicoverpa zea Boddie], and pink bollworm

[Pectinophora gossypiella Saunders] (Castle et al., 2006). Cry IF has been reported to control fall

armyworm in cotton (Adamczyk and Gore, 2004). However, there are no previous reports on Cry

proteins expressed in forage and turf grasses and their effects against fall armyworm. Transgenic

plants of the non-commercial apomictic genotype "Tifton 7", diploid bahiagrass cultivar

"Pensacola", and apomictic cultivar "Argentine" have been recently reported (Smith et al., 2002;

Gondo et al., 2005; Altpeter and James, 2005). These genetic transformation protocols allow the

introduction of exogenous insect resistance genes into bahiagrass. Hence, the objective of this









work was to evaluate the expression of a synthetic cryIF gene in transgenic bahiagrass and its

effect on resistance to fall armyworm.

Materials and Methods

Minimal Transgene Expression Constructs

Based on the cryIF gene sequence available in the NCBI database (M73254), a codon-

optimized sequence for the 6-endotoxin was generated. The synthetic cry F gene (1863 bp) was

synthesized and subcloned into a pPCR-Script vector by Geneart (Regensburg, Germany).

BamHI and HindIIl sites were introduced 5' and 3' of the cryIF coding sequence respectively

(Figure 1), to facilitate subcloning of cryIF under transcriptional control of the maize ubiquitin 1

promoter and first intron (Christensen and Quail, 1992) and the CaMV 35S polyadenylation

signal (Dixon et al., 1986) (pHZCRY vector, Figure 2A).

The pHZ35SNPTII selectable marker cassette contains the neomycin phosphotransferase II

(nptll) coding sequence (Bevan, 1984) under transcriptional control of the CaMV 35S promoter

(Odell, 1985) and hsp70 intron (Rochester, 1986), and the CaMV 35S polyadenylation signal

(Dixon et al., 1986) (Figure 2A). Following the strategy described by Fu et al. (2000), minimal

transgene expression constructs (MCs) containing only the expression cassettes without vector

backbone were used for biolistic gene transfer. The nptll and cryIF gene expression cassettes

were excised from their plasmids by restriction digestion with NotI resulting in a 2.55 kb or 4.15

kb fragments, respectively (Figure 2A). Transgene expression cassettes were isolated by gel

electrophoresis, and the corresponding band was excised and purified using the Wizard SV Gel

and PCR cleanup system (Promega, Madison, WI) to remove vector backbone sequences.

Tissue Culture, Transformation and Regeneration of Bahiagrass

Embryogenic callus was induced from mature seeds of bahiagrass cultivars "Tifton 9" and

"Argentine" following a protocol previously described by Altpeter and Positano (2005). The









callus induction medium (CIM) consisted of 4.3 g L-1 MS salts (Murashige and Skoog, 1962),

30 g L-1 sucrose, 1.1 mg L-1 6- Benzylaminopurine (BAP), 3 mg L-1 3,6-Dichloro-2-methoxy

benzoic acid (dicamba) and 6 g L-1 Agarose (Sigma, St. Louis, MO), supplemented with filter

sterilized MS vitamins (Murashige and Skoog, 1962) which were added after the medium was

autoclaved for 20 min. Calli were kept in darkness at a temperature of 280C and subcultured to

fresh CIM biweekly. Embryogenic calli were placed on CIM medium supplemented with 0.4 M

sorbitol, for 4-6 h prior to gene transfer. The nptll and crylF gene expression cassettes were used

in a 1:2 molar ratio and co-precipitated on 1.0 [tm diameter gold particles (Altpeter and James,

2005). The BioRad PDS-1000 / He device (BioRad Laboratories Inc., Hercules, CA) was used

for biolistic gene transfer at 1100psi and 28mm Hg. Bombarded calli were transferred to fresh

CIM following gene transfer, and kept in the dark for 10 days before being transferred to low

light conditions (30iEm-2s-1), with 16h/8h light/dark photoperiod, at 280C, on selection CIM

containing 50 mg/1 of paramomycin. After four weeks, calli were subcultured on shoot

regeneration medium, similar to CIM but containing 0.1 mg/1 BAP and no dicamba, and

transferred to high light (150 iEm-2s-1) intensity with a 16h/8h light/dark photoperiod at 280C.

After two weeks, calli were transferred to hormone-free CIM to induce root formation. After four

to six weeks, regenerated plantlets were transplanted into Fafard 2 mix (Fafard Inc., Apopka, FL)

and acclimatized in growth chambers at 400 iEm-2s-llight intensity with a 16h/8h light/dark

photoperiod at 280C / 20C day / night.Two weeks later plants were transferred to an air-

conditioned greenhouse at 300C / 20C day / night and natural photoperiod. Plants were fertilized

bi-weekly with Miracle Grow Lawn Food (Scotts Miracle-Gro, Marysville, OH) at the

recommended rate.









Polymerase Chain Reaction, Reverse Transcriptase Polymerase Chain Reaction and
Southern Blot Analysis

Genomic DNA was extracted from bahiagrass transgenic and wild type lines as described

by Dellaporta et al. (1983). The forward primer 5'ATGGTTTCAACAGGGCTGAG3' and the

reverse primer 5'CCTTCACCAAGGGAATCTGA3' were designed for amplifying a 570 bp

fragment internal to the coding sequence of the crylF gene. Approximately 100 ng genomic

DNA was used as template for PCR in a BioRad Icycler (BioRad Laboratories Inc., Hercules,

CA). PCR was performed using the HotStart PCR kit (Qiagen, Valencia, CA). The cycling

conditions were 95C for 15 min initial denaturation, 35 cycles of 95C for 1 min, 57C for 1

min, 720C for 1 min and 720C for 15 min final extension. PCR products were analyzed by

electrophoresis on a 0.8% agarose gel.

Total RNA was extracted from emerging young leaves using the RNeasy Plant Mini Kit

(Qiagen, Valencia, CA), followed by RNAse free DNase I (Qiagen, Valencia, CA) treatment to

eliminate genomic DNA contamination. Total RNA (500 ng) was used for cDNA synthesis via

reverse transcription with the iScript cDNA Synthesis kit (Bio-Rad Laboratories Inc., Hercules,

CA) in a reaction volume of 20 al. cDNA (2 [l) was used as a template to detect the transcripts

of the crylF gene by PCR with the same primer pair as described above for PCR from genomic

DNA. PCR products were analyzed by electrophoresis on a 0.8% agarose gel.

For Southern blot analysis, genomic DNA from bahiagrass transgenic and wild type lines

was isolated using the CTAB method (Murray and Thompson, 1980). Genomic DNA (15 Gg)

was digested with BamHI and fractionated on a 1% agarose gel, transferred onto a nitrocellulose

membrane (Hybond, Amersham BioSciences, Piscataway, NJ) and hybridized using the

complete crylF coding sequence (1.8kb) as a probe, labeled with P32 using the Prime-a-Gene kit









(Promega). Hybridization and detection were performed according to the instructions of the

manufacturer.

Immunological Assays

Qualitative expression of the crylF endotoxin in leaf tissue of the transgenic lines from

cultivars "Tifton 9" and "Argentine" was evaluated using the QuickstixTM kit for crylF

(EnviroLogixTM, Portland, ME), originally developed for Herculex I corn, and following the

recommendations of the manufacturer. Relative levels of expression of the crylF endotoxin in

leaf tissue were estimated by using the ELISA QualiPlateTM kit for cry 1F (EnviroLogixTM)

originally developed for Herculex I corn. Following eight months of vegetative propagation of

the primary transformants, protein extracts were obtained from wild type and three transgenic

lines from cv. "Tifton 9" including three different vegetative clones per line and three different

replicates per clone. Protein extracts from crylF expressing corn grain were quantified and used

as a positive control in a dilution series. Protein concentration of the extracts was determined

using the Bradford assay (Bradford, 1976) and absorbance was measured at 595 nm. BSA was

used to prepare a standard curve (R2 value of 96%). Ten micrograms of total protein were loaded

per well. The immunoassay was performed according to the instructions of the manufacturer.

Reaction kinetics was recorded at 450 nm using an ELISA microplate reader (Bio-Rad

Laboratories Inc., Model 680). Optical density (OD) values for each line were compared within

the linear range of the reaction kinetics after addition of the ELISA substrate. OD data from

bahiagrass transgenic and wild type lines were analyzed by Proc ANOVA and means were

separated according to Tukey's test (P<0.05) (Littell et al., 1996, SAS Institute, 2002).

Insect Bioassays

Insecticidal activity of the transgenic lines was evaluated by following a modified version

of the protocol described by Adamczyk and Gore (2004). Fall armyworm neonates (rice host









strain) were obtained from egg masses hatched the same day, placed in Petri dishes and fed on

four leaf pieces of 2 cm length of the third fully emerged leaf. A completely randomized

experimental design was used. There were 10 replications per transgenic line represented by

individual Petri dishes with leaves and larvae, and the experiment was repeated four times. For

estimating fall armyworm resistance, neonate mortality rates from bahiagrass transgenic and wild

type lines were evaluated after five days of feeding. Fall armyworm mortality rates, expressed as

a percentage, were analyzed by Proc Mixed and means were separated according to Fisher's

protected LSD (Littell et al., 1996, SAS Institute, 2002).

Results

Generation of Transgenic Bahiagrass Lines

Co-bombardment experiments with the MCs from the pHZCRY vector and the

pHZ3 5 SNPTII vector were done (Figure 4-2A). Three hundred calli were obtained from ten

shots and three transgenic lines from each cultivar, cvs. "Argentine" and "Tifton 9", were

generated in four months of tissue culture (4-2B,C). These six transgenic lines were transferred

to small pots under controlled growing conditions and later to larger pots under greenhouse

conditions (4- 2D,E).

Polymerase Chain Reaction, Reverse Transcriptase Polymerase Chain Reaction and
Southern Blot Analysis

PCR analyses showed that the six transgenic lines from cultivars "Tifton 9" and

"Argentine" amplified the 570 bp internal fragment of the synthetic crylF gene confirming the

gene integration into the plant genome. Also, this 570bp fragment was amplified in the plasmid

control (PC) and not amplified in the wild type bahiagrass (WT)(Figure 4-3A, 4-4A).









RT-PCR analyses also showed that the six bahiagrass lines amplified the same 570 bp

internal fragment of the crylF confirming gene expression at the RNA level in the transgenic

plants (Figure 4-3B, 4-4B).

Both southern blot analyses, i.e. with BamHI and EcoRI gDNA digestions, showed an

independent integration pattern for each transgenic line and the transgene integration varied from

simple to more complex integration patterns in cv. "Tifton 9." Specifically with BamHI, Line 1

showed seven hybridization bands, while Lines 2 and 3 showed two and four hybridization

patterns respectively (Figure 4-3C). Instead, the three transgenic lines from cv. "Argentine"

showed complex integration patterns with more than two hybridization bands in the three

transgenic lines (Figure 4-4C).

Immunological Assays

A qualitative immunoassay, the QuickstixTM kit for crylF (EnviroLogixTM), indicated that

bahiagrass Lines 2 and 3 from cv. "Tifton 9" contained detectable levels (Figure 4-5A), while the

same assay showed no detectable levels of crylF in those lines from cv. "Argentine." A

semiquantitative immunoassay, based on the QualiPlateTM kit for crylF (EnvirologixTM), showed

that Line 1 had a low expression level only detected by the plate reader whereas Lines 2 and 3

had higher expression levels that were easily detected by naked eye in cv. "Tifton 9" (Figure 4-

5B). However, low expression levels were detected in the three lines from cv. "Argentine."

These observations were correlated to the OD450 values obtained for the six transgenic lines. The

OD450 values indicated that Line 1 produced relatively low levels of CrylF, while Lines 2 and 3

displayed crylF expression levels that were 4 and 12-fold higher than those levels, respectively

(P< 0.05)(Figure 4b). Also, no significant differences in crylF expression between clones of the

same line were found (P< 0.05; data not shown). CrylF protein levels in bahiagrass leaves were

estimated by comparison with a crude CrylF protein standard supplied by the manufacturer and









were approximately 1.4 and 4.5 tg protein/ g fresh weight for Lines 2 and 3 from cv. "Tifton 9"

respectively.

Insect Bioassays

Fall armyworm mortality rate showed differences between the wild type and the bahiagrass

transgenic lines from cultivar "Tifton 9." Lines 1, 2 and 3 produced 35, 65 and 83% neonate

mortality rate respectively (Figure 4-6A). Wild type and Line 1 showed intense feeding while

Lines 2 and 3 showed limited feeding indicating early larvae death (Figure 4-6B). Instead,

survival rate was no different between the wild type and the three transgenic low expressing lines

from cultivar "Argentine" after five days of feeding (Figure 4-6C).

Discussion

This is the first report of stable, transgene expression of a Bt crystal protein gene that

enhances insect resistance in a forage and turf grass. Bahiagrass (Paspalum notatum Flugge) is

an important subtropical forage grass that is also used as low input turf. Constitutive over-

expression of the crylF gene in bahiagrass resulted in increased resistance to fall armyworm

(Spodopterafrugiperda J.E. Smith).

The transformation protocol for the apomictic tetraploid bahiagrass cultivar "Argentine"

(Altpeter and James, 2005; Sandhu et al., 2007) was successfully applied to generate transgenic,

sexual, diploid bahiagrass plants of cultivars "Tifton 9" and "Argentine." The transformation

efficiency for "Tifton 9" (1%) was similar to those earlier reported for the diploid sexual

bahiagrass cultivar "Pensacola" (2.2%) (Gondo et al., 2005). However, 10% transformation

efficiency was reported for the apomictic cultivar "Argentine" (Sandhu et al., 2007). Genotypic

differences in tissue culture response and transformation efficiency have been reported

previously. The production of stable transgenic plants from bahiagrass (Paspalum notatum

Flugge) cv. "Tifton 7" was firstly reported by Smith et al. (2002). However, authors reported that









the transgenic nature of most of the glufosinate resistant plant could not be confirmed by PCR

analyses (Smith et al., 2002). Later, unpublished studies revealed that the glufosinate resistance

was conclusive to indicate the transgenic nature nature and that the PCR analyses had resulted in

false negative events (Smith, personal communication). In contrast, following co-bombardment

of the target gene and nptlI gene and selection using paromomycin, all of the regenerated plants

in this study and in a previous bahiagrass transformation study (Sandhu et al., 2007) were

transgenic as indicated by Southern blot analysis. Genotypic differences and alterations in tissue

culture and selection protocols may have contributed to the lack of escapes in these more recent

bahiagrass studies.

Analysis of the complexity of minimal transgene expression construct (MC) integration

patterns has resulted in controversial results in the past. Fu et al. (2000) described that biolistic

transfer of MCs resulted in simpler integration patterns and lower copy numbers than plasmids.

In contrast, no differences between the two DNA forms were reported by Breitler et al. (2001)

and Romano et al. (2003). Southern blot analysis of the three transgenic bahiagrass lines

transformed with MC's of the crylF gene showed multiple transgene copies in all lines with line

1 displaying the most complex transgene integration pattern. This complex transgene integration

pattern following biolistic transfer of MC's into bahiagrass is in agreement with findings of

Breitler et al. (2001) and Romano et al. (2003). It suggests that the complexity of transgene

integration is more likely dependent on factors intrinsic to the plant rather than on the form of

DNA as proposed by Agrawal et al. (2005). Nevertheless, elimination of vector backbone

integration through MC technology is important for increasing transgene expression stability and

to remove prokaryotic antibiotic expression constructs to obtain regulatory approval for

commercial release. Clean DNA technology by employing the use of MC's for biolistic









transformation is capable of producing similar or higher transformation and expression

efficiencies than whole plasmids (Castle et al., 2006). In the present study, two bahiagrass lines

from cultivar "Tifton 9" expressed the crylF transgene in vegetative progeny at a high enough

level to control FAW neonate larvae.

Transgenic corn expressing the crylAb gene was first commercially released in 1996.

Constitutive crylAb expression of 3.3 or 10.3 .g/g fresh weight of leaves resulted in 50-75% or

98% control of the European corn borer (0. nubilalis) in corn field trials (Mendelsohn et al.,

2003). This pest is considered the most important corn insect pest in the midwestern and

northeastern regions of the U.S. (Wiatrak et al., 2004); while fall armyworm is the most

important pest on grasses and other crops in the southeastern U.S. Recently, corn expressing the

crylF gene (Herculex I) was commercially released by Pioneer Hi-Bred International and Dow

Agrosciences (Events TC1507 and DAS-06275-8). Field trials indicated that these transgenic

corn lines effectively controlled multiple insect pests like 0. nubilalis, D. grandiosella, H. zea, S.

frugiperda, A. ipsilon and R. albicosta (US EPA, 2001). In cotton, fall armyworm bioassays

indicated that neonate mortality was significantly higher when larvae were fed on leaves

expressing crylF (80%) compared with non-transgenic leaves (48%) or leaves expressing

crylAc (45%) (Adamczyk and Gore, 2004). CrylF concentrations were estimated at 1.4 and 4.5

pg/g fresh weight in bahiagrass transgenic lines 2 and 3, respectively. These expression levels

were associated with 65% and 83% neonate mortality rates, respectively, while wild type and

transgenic bahiagrass with barely detectable crylF expression showed a significantly lower fall

armyworm mortality rate. These results indicate the potential of crylF to control fall armyworm

in accordance with the results reported for crylF expressing cotton (Adamczyk and Gore, 2004)

and corn (US EPA, 2001). In conclusion, stable expression of minimal synthetic crylF









expression constructs in bahiagrass enhanced resistance to the difficult to control, and important

insect pest, fall armyworm.















ggt acc aYL~ac ggc gc gc c ac gc gt at gagaac aa at ac a aa acagat gc gt c c c
I E NN I Q N Q C U P
t acaactgcctcaac sat ctgagt aggagatttcaaagagggtcgactggcaga
Y N C L N P E UE IL N E E S T G
ttgccgttagacattccctgtcccttacacgtttcctgttgtctgagtttgttccaggt
L P L D I S L L T R F L L SE F P
gtgggagttgcgtttggcctcttcgacctcatctggggctt catcactccattgattgg
S U A F GL D L I G F I T P S D
age ctcttcttct cc agattgaac agttgattgaacaaaggattgagaccttggaaagg
S L F L L Q I E Q L I E Q R I E L ER
aatcgggccatcacacacccttcgtggcttagagacagctatgagatctacattgaagca
R A I T T L R G L A D S E I Y I E A
ctaagagagtgggaagcc aatcctaacaat gcccaact gagagaagatgtgc gtatacgc
L E T E A NP NN A Q L E D UR IR
ttt gt aacac agat gat gcttt gatcacagct caacaactt acc ttaccagcttc
F A NT D D A L I T A INN FT L T SF
gagatccctcttctctctggtctatgtt caagtgtaacctgcacttgtcactactgcgc
E I P L S V Y U A A NL H L S L L R
gacgetgt ggttt c ggaaggttggggactggacat agctact gt aacaat act ac
D A S F G Q L D I A T V NN H Y
aacagactcat caatct gatt cat c gatacacgaaac attgtttggatacct acaatcag
NR L I N L I H R Y T H C L D T Y
ggattggagaacctgagaggtactaacactcgccaatgggccaggttcaatcagttcagg
GL E N L R GT N T R Q A R F F R
agagaccttacacttactgtgttagacatagttgctctcttccgaactacgatgttcgt
R D L T LT L D I A L F P Y D UR
acctat ccgattcaaagtcatcc aacttacaagggagatctacaccagttcagtcatt
TY P I QT S L T E I Y T S S U I
gaagactctccagtttctgcgaacatacccaatggtttcaacagggtgagtttggagtc
E D S PU S A N I P N F R A E F G
agaccaccccatctcatggacttcatgaactctttgtttgtgactgcagagactgttaga
SP P H L D F S L F U T A E T U R
tcccaaactgtgtggggaggacacttagttagctcacgcaacacggctggcaatcgtatc
S Q T V G H L SS R N T A N R I
aactttcctagttacggggtcttcaatcccgggggcgccatctggattgcagatgaagat
NI F P S Y G U F N P G G A I I I A D E D
ccacgtcctttctatcggaccttgtcagatcctgtcttcgtccgaggaggctttggcaat
P P F Y T L S D P V F R F G
cctcactatgtactcggtcttaggggagtggcctttcaacaaactggtacgaatcacacc
P H Y L GL R G A F Q T T H T
cgcacattcaggaactccgggacc attgactcct agatgagataccacctcaagacaac
RT F N S T I D S L D E I P P D
agcggcgcaccttggaatgactactcccatgtgetgaatcatgttacctttgtgcgctgg
S A P N D Y S H VL N H V T F R
ccaggtgagatetcaggttccgactcatggagagcacc aatgttctcttggacgcatcgt
P E I S GS D S R A P H F S T H R
agcgctaccccacaaacaccattgatccagagagaatcactcagattcccttggtgaag
S A T P T T I D P E I T I P L UK
gcacac cacttcagtcaggaactactagttgtagagggccggggttcacgggaggagac
A H T L S T T U U G P G FT G D
attcttcgacgcactagtggaggaccattcgcgtaacccattgtcaacatcaatgggcaa
I L R R T S P F A YT I V N IN G Q
cttccccaaaggtatcgtgccaggaacgaagctagcct ctactaccaatctaagaat ctac
L P R R A IR Y A T T N L R I Y
gttacggttgcaggtgaacggatctttgctggtcagttcaacaagacaatggataceggt
VT A G E R I F A Q F N KT D T
gat CCttac att ca SatCttt te ctaCge caCtat eaaC eggtt cac ttt CCa
D P L T F S F S A T I NT A F F P
atgagccagagcagtttcacagtaggtgct gatac cttcagttcagg aacgaagtgtac
H S S S F T G A D T F S S N E Y
att gac aggtttgagtt gatt cc agtt aactgc sact c gagt aqact agtt aatt aagc
I D R F E L I P U T A T L E
t&!ctagctttit





Figure 4-1. The synthetic coding sequence of the crylF gene (M73254) including the BamHI

(ggatcc) and Hindlll (gagctc) sites used for the cloning into the pHZCRY vector.

The atg (M) and tag (-) codons indicate the initiation and the end of the translation

frame.











. Not!


5'CAMV35S Hsp70
promoter intron

Not!


ubif HP
promoter in


npftl CAMV35S
coding terminator
sequence


Noft


sp70
tron


cryIF
coding
sequence


nos
terminator


D / E
.. ', --- -- / L I 1


Figure 4-2. A) The expression cassettes for synthetic crylF gene (4155bp) from vector
pHZCRY and nptll gene (2554bp) from vector pHZ35SNPTII used for biolistics
experiments. B) and C) In vitro plants under selection with paromomycin from
bahiagrass (Paspalum notatum Flugge) cvs. "Tifton 9" and "Argentine"
respectively.D) and E) Transgenic plants obtained from bahiagrass (Paspalum
notatum Flugge) cvs. "Tifton 9" and "Argentine" respectively. Lines 1, 2, 3 and wild
type (WT).


~8888888888888~


. Alwnl












3- T


F'


'N
1 ~ ~ T 'I


570 bp


Figure 4-3. A 570 bp fragment was amplified by PCR using the forward primer
5'atggtttcaacagggctgag and the reverse primer 5'ccttcaccaagggaatctga. The cycling
conditions were 95C 15 min initial denaturation, 35 cycles of 950C 1 min, 57C 1
min, 720C Imin and 720C 15 min final extension. A) PCR, B) RT-PCR, C) Southern
blot of genomic DNA digested with BamHI of transgenic bahiagrass lines from cv.
"Tifton 9" (1, 2, 3). Wild type bahiagrass (Wt), negative control (NC), positive
control (PC).


[14
FA


570 bli







C
kb
23.1
9.4-
G.5_
4.3-

2.3 -
2.0-


AMLAML


*L~s LJ 4Y~











P
-1 1)


Ht t*
I 2 3


Figure 4-4. A 570 bp fragment was amplified by PCR using the forward primer
5'atggtttcaacagggctgag and the reverse primer 5'ccttcaccaagggaatctga. The cycling
conditions were 95C 15 min initial denaturation, 35 cycles of 950C 1 min, 57C 1
min, 720C Imin and 720C 15 min final extension. A) PCR, B) RT-PCR, C) Southern
blot of genomic DNA digested with BamHI of transgenic bahiagrass lines from cv.
"Argentine" (1, 2, 3). Wild type bahiagrass (Wt), negative control (NC), positive
control (PC).


A
H


IP


23.1 kb
9.4 kb
6.6 kb
4.4 kb
2.3 kb
2.0 kb

570 bp





C
9.4 kb
6.6 kb
4.4 kb

2.3 kb
2.0 kb














Ia a Al3 a 1
i~r~l^. ^.,,^


a






b





2 3


0.12
0.12 T-


--H


WITAB AB1 A82 A83


Lines


Figure 4-5. Levels of expression in leaves of transgenic lines from bahiagrass (Paspalum
notatum var. Flugge). A) Lines from cv. "Tifton 9" tested with QuickstixTM kit for the
crylF gene (EnvirologixTM). B) Lines from cv. "Tifton 9" tested with the
QualiPlateTMkit for the crylF gene (EnvirologixTM). C) Levels of expression
represented by OD450 values in lines from cv. "Tifton 9" D) Levels of expression
represented by OD450 in lines from cv. "Argentine" values. Wild type bahiagrass
(Wt), transgenic lines (1,2,3), negative control (NC), positive control (PC).


OD o C
1.40

1.20

1.00

0.80

0.60

0.40

0.20

0.00
WT


1


'


m


---------t------


-- *- -


q


,Al *; *I

AI ^ ^S|









































Mo


TIFTON 9
B 100
90
80
70
rtality 6o -c
rate 50 -
40

20


WT 1
ARGENTINE


C


Mortality
rate
Cf)


100
90
80
70
60
50
40
30
20
10
0


ab








2 3


WT 1 2
Bahiagrass transgenic lines


Figure 4-6. Insect bioassays with fall armyworm larvae feeding on leaves from bahiagrass
(Paspalum notatum var. Flugge) cv. "Tifton 9" after 5 feeding days. A) Feeding
pattern from wild type and three transgenic lines. B) Mortality rate (%) for neonates
in wild type and three transgenic lines from cv. "Tifton 9" (WT and Lines 1,2,3). C)
Mortality rate (%) for neonates in wild type and three transgenic lines from cv.
"Argentine" (WT and Lines 1,2,3).


I









CHAPTER 5
SUMMARY AND CONCLUSIONS

Overexpression of the vspB Gene to Improve Nutritional Quality in Bahiagrass

Amongst vegetative storage proteins, soybean VSP3 is a lysine enriched-protein resistant

to rumen proteolysis (Mason et al., 1988; Staswick, 1994; Galili et al., 2002). The objective of

this work was to overexpress this soybean vegetative storage protein gene in bahiagrass and to

evaluate the effects of this gene on the nutritional quality of bahiagrass.

To enhance the expression of the vspB gene in transgenic plants, we designed an

expression vector including a constitutive and strongly expressed promoter for monocots; a

KDEL signal for ER-retention and a c-myc tag for antibody detection. To enhance

transformation efficiency and transgene expression and stability (Fu et al, 2000), we used

minimal constructs containing only the transgene expression cassettes without vector backbone

sequences during the biolistic experiments. We co-bombarded mature seed-derived calli from

bahiagrass cv. Argentine with minimal constructs containing the vspB gene from pGL4 and

pRSVP1 vectors and the nptll gene as selectable marker from pJFNPTII vector.

Based on bahiagrass transformation, selection and regeneration protocols previously

established (Altpeter and Positano, 2005; Altpeter and James, 2005), we generated 172

paromomycin-resistant bahiagrass plants. An ELISA screening confirmed the expression of the

nptll gene detecting 83% of these plants. Western blots confirmed the expression of the vspB

gene in 89% of the plants expressing the nptll gene. Also, Western blot analyses indicated that

VSPP expression levels varied among different plants, different tillers within plants and different

leaves within tillers having the highest expression levels in third and four bahiagrass leaves.

According to previous reports, VSPs represented between 10-15% total protein in young leaves

of soybean plants and VSPs were degraded during plant growth (Staswisck et al., 2001).









Transgenic studies in tobacco indicated that VSPa was stably expressed reaching 2-6% total

proteins (Guenoune et al., 1999) while VSP3 reached a maximum of 2% total protein in young

leaves and it was degraded with leaf age (Guenoune et al., 2002b). These expression levels were

enhanced by targeting the heterologous protein to the vacuole and the chloroplast simultaneously

(Guenoune et al., 2002a) or enhanced by co-expressing both soybean VSPs or VSP3 and

dihydrodipicolinate synthase reaching ca. 4% total protein in leaves (Guenoune et al., 2003). In

contrast, corn transgenic studies showed that VSP3 was accumulated to 0.03-0.004% total

protein in leaves (Grando et al., 2001). Similarly, VSP3 expression levels accumulated to 0.001-

0.01% of the total proteins in bahiagrass leaves indicating that high VSP3 expression levels are

difficult to reach in monocot plants such as cereals and grasses. Hence, this is the first report on

expression of the vspB gene in bahiagrass cv. "Argentine." The VSP3 expression levels observed

in transgenic bahiagrass plants were low and similar to those previously reported for corn plants.

These VSP3 expression levels in transgenic bahiagrass plants could be enhanced by coexpressing

recombinant VSP3 and VSPa subunits, and/or by targeting the subunit simultaneously to

different cell compartments. However, these improvements may not enhance the total protein

content of transgenic bahiagrass significantly.

Expression of the crylF Gene to Enhance Pest Resistance in Bahiagrass

Bt (Bacillus ithin iigie'l\i\) transgenic crops expressing 6-endotoxins were developed to

control different insect and nematodes (Schnepf et al., 1998; Ranjekar et al., 2003; Kaur, 2006).

Currently, Bt crops cover 14 million hectares and represent 20% total for crops like cotton and

corn (Cannon, 2000). Marketed products include Bt corn containing the crylAb, crylAc, cry9C

genes for controlling European corn borer populations and Bt cotton containing crylAc, crylAc

and cry F for controlling bollworm (Mendelsohn et al., 2003). However, there are no previous

reports on crylF proteins expressed in forage and turf grasses and their effects against fall









armyworm. Hence, the objectives of this work were to generate transgenic lines expressing a

synthetic crylF gene and to evaluate the effects of this gene on resistance against fall armyworm

in subtropical bahiagrass cultivars "Tifton 9" and "Argentine."

For enhancing transformation efficiency and transgene expression stability (Fu et al, 2000),

we co-bombarded mature seed-derived calli from bahiagrass with minimal constructs containing

the synthetic crylF gene from pHZCRY vector and the nptll gene as selectable marker from

pHZ35SNPTII vector. Based on previously reported protocols (Altpeter and Positano, 2005;

Altpeter and James, 2005) for bahiagrass transformation and regeneration, we generated six

paromomycin-resistant bahiagrass plants (three from cv. "Argentine" and three from cv. "Tifton

9"). PCR analyses confirmed the presence of the crylF gene and Southern blots analyses

indicated independent transgene integration in all transgenic bahiagrass lines. Transgene

integration varied from simple to more complex integration patterns in cv. "Tifton 9" while

showed complex integration patterns in cv. "Argentine." RT-PCR analyses confirmed crylF

expression in all transgenic bahiagrass lines. A qualitative immunoassay for crylF gene

expression (QuickstixTM kit, EnviroLogixTM) indicated detectable levels in two bahiagrass lines

from cv. "Tifton 9" and no detectable levels in one line from cv. "Tifton 9" and three lines from

cv. "Argentine." A semiquantitative immunoassay for crylF gene expression (QualiPlateTM kit,

EnvirologixTM) showed that Line 1 had a low expression level only detected by the plate reader

while Lines 2 and 3 had higher expression levels that were easily detected by naked eye in cv.

"Tifton 9." Low expression levels were detected in the three lines from cv. "Argentine."

According to fresh weight and protein concentration of the samples, the estimated crylF

expression levels were 1.4 and 4.5 [g cry toxin/ g fresh weight in Lines 2 and 3 from cv. "Tifton

9." Insect bioassays indicated significant differences between wildtype and transgenic lines in cv.









"Tifton 9" showing 35, 65 and 83% mortality rates in Lines 1, 2 and 3. Instead, no differences

were observed between wild type and transgenic bahiagrass lines from cultivar "Argentine." The

cryiF expression levels in bahiagrass lines from cv. "Tifton 9" were similar to those crylAb

levels reported for commercial corn lines (Abel and Adamczyck, 2004). Besides, the protection

levels against FAW neonates were similar to those observed in cryiF cotton lines (Adamczyck

and Gore, 2004). Hence, we cloned a codon-optimized version of the cryiF gene under the

control of the ubil promoter and first intron in two bahiagrass cultivars. In cultivar "Tifton 9",

results indicated that the expression levels of the cryiF gene detected by immunological assays

and the protection levels detected by insect feeding bioassays were positively correlated.

Moreover, the cryiF expression and protection levels were similar to those levels detected for

commercial crops in corn and cotton. Therefore, the expression of the cryiF gene in bahiagrass

cultivar "Tifton 9" enhanced the resistance against fall armyworm in insect bioassays indicating

that these transgenic lines seem to be suitable candidates for further field studies.









APPENDIX A
LABORATORY PROTOCOLS

Protocols for Molecular Cloning

Preparation of Electrocompetent E.coli

1. Grow o/n DH5a culture in 5ml LB.
2. Inoculate 2 x 250ml LB in 1L flasks with 2ml o/n culture. Incubate shaking at 370C until
OD600 = 0.6-0.8 (Approx 5.5 hours).
3. Pellet cells for 15 mins, 4000g at 40C (Sorvall with GSA rotor, 3x 250ml bottles).
4. Pour off supernatant and resuspend in an equivalent volume of ice-cold sterile water (3x
165ml). Handle cells gently at all times.
5. Centrifuge 15 mins, 4000g, 40C.
6. Pour off supernatant and resuspend in 0.5 volume of ice-cold sterile water (3x 83ml). Divide
cell culture between 2 bottles.
7. Centrifuge 15 mins, 4000g, 40C.
8. Pour off supernatant and resuspend in 0.5 volume of ice-cold sterile water (2x 125ml).
9. Centrifuge 15 mins, 4000g, 40C.
10. Pour off supernatant and resuspend in 0.02 volume of ice-cold sterile water (2x 5ml).
Transfer cell culture to 30ml centrifuge tube.
11. Centrifuge 15 mins, 4000g, 4C (Sorvall, SS-34 rotor).
12. Pour off supernatant and resuspend in 0.02 volume ice-cold sterile 10% glycerol (1.2ml).
13. Transfer 40[tl aliquots to sterile 1.5ml eppendorf tubes with holes pierced in the lids using a
sterile needle. Quick-freeze in liquid nitrogen and store at -700C.

Electroporation of E.coli

1. Chill 0.1cm gap cuvettes (BioRad) on ice.
2. Place DNA for transformation (usually 1-2dtl 10-15ng ligation) in 1.5ml eppendorf tubes
on ice.
3. Thaw required number of 40[tl aliquots of electrocompetent cells on ice.
4. Set BioRad micropulser to Ecl (1.8kV, 5msec, 0.1cm gap).
5. Add cells to DNA. Leave on ice 1 min.
6. Transfer cells to cuvette. Tap suspension to bottom.
7. Place cuvette in slide and push slide into chamber ensuring that cuvette is seated between
contacts in the base of the chamber.
8. Pulse once by pressing pulse button. Alarm signifies pulse is complete.
9. Remove cuvette and immediately add 360ml SOC medium to the cuvette. Quickly but gently
transfer cells to a 2ml tube. Time is critical.
10. Check and record pulse parameters (time constant should be close to 5msec).
11. Incubate cells at 370C shaking for 1 hour before plating on appropriate antibiotic medium
(50[tl for circular plasmid, 100-200[tl for ligation product).


Plasmid DNA Extraction Method (modified Dellaporta et al., 1983)









1. Harvest one length eppendorf tube of leaf material.
2. Add 300 gtl Extraction Buffer D and grind with micropestle until the buffer is green.
3. Add 20 gl 20% SDS. Vortex.
4. Incubate at 65C, 10 minutes.
5. Add 100 gtl 5 M potassium acetate. Shake vigorously.
6. Incubate on ice (or -20C), 20 minutes.
7. Centrifuge at maximum speed, 20 minutes and transfer supernatant to new tube.
8. Add 450 gtl isopropanol.
9. Incubate on ice (or -20C), 30 minutes.
10. Centrifuge at maximum speed, 15 minutes, pour off the supernatant, air-dry the pellet.
11. Resuspend pellet in 100 gtl TE.
12. Add 10 gl 3 M sodium acetate and 220 gl 100% ethanol.
13. Centrifuge at maximum speed, 10 minutes, pour off the supernatant, add 500 gtl 70% ethanol.
14. Centrifuge at maximum speed, 10 minutes, pour off the supernatant, air-dry pellet for 10
minutes.
15. Resuspend pellet in 150 gtl TE buffer.
16. Use 1 gl for PCR reaction.

Polymerase Chain Reactions

To amplify fragment from pCMYCKDEL vector


PCR kit
Primer sequences






PCR program


PCR reaction
DNA template
Forward primer
Reverse primer
PCR Buffer 10 X
DNTPs
Taq polymerase
Dd water
Final volume


PCR Core System II(Promega)
5' CGTCTAGAACGCGT
Forward
ATGAAGTTGTTTGTTTTCTTTGTTGC
5'
Reverse CGGCGGCCGCACTAGTCTCAATGTAGTACAT
GGGATTAGGAAG
2' 95C for initial denaturation, 25 cycles with 1' 95C
G l for denaturation, 1' 48C for annealing and 1' 72C
for extension, 5' 72 for final extension and hold at
4C


0.5-1.5 gl
1 gl
1 gl
2.5 gl
0.5 gl
0.125 Kl
19-18.375 gl
25 gl









To amplify fragment from pGL2 vector


PCR kit


Primer sequences


PCR program


PCR reaction
DNA template 2 il
Forward primer 1 pl
Reverse primer 1 il
PCR Buffer 10 X 2.5 pl
DNTPs 0.5 il
Taq polymerase 0.125 pl
Dd water 17.875 .l
Final volume 25 [l


Restriction Digestions

To digest pCMYCKDEL vector

Restriction Enzymes
Digestion reaction
pCMYCKDEL Vector (3 ug)
Restriction Buffer D 10X
BSA 10X
XbaI
NotI
Dd water
Final volume


PCR Core System II(Promega)
5'
Forward CGGGTACCATGAAGTTGTTTGTTTTCTTTGTT
GC
5'
Reverse CGGAGCTCGTTTAAACGCATGCCTGCAGGTCA
CTG
2' 95C for initial denaturation, 25 cycles with 1' 95C
for denaturation, 1' 48C for annealing and 1' 72C
S for extension, 5' 72 for final extension and hold at
4C


NotI and XbaI (Promega)


12 [l
3.5 pl
3.5 pl
3.5 pl
3.5 pl
9 [l
35 [tl









To digest pGFL1 vector

Restriction Enzymes
Digestion reaction
pGFL 1Vector (4 ug)
Restriction Buffer D 10X
BSA 10X
XbaI
NotI
Dd water
Final volume


To digest pJFNPTII vector

Restriction Enzymes
Digestion reaction
pJFNPTII Vector (5 ug)
Restriction Buffer H 10X
BSA 10X
PstI
Dd water
Final volume


To digest pCAMBIA2300 vector

Restriction Enzymes
Digestion reaction
pCAMBIA2300 Vector (8.5 ug)
Restriction Buffer H 10X
BSA 10X
PstI
Dd water
Final volume


NotI and XbaI (Promega)


12 gl
4 gl
4 gl
4 gl
4 gl
7 gl
40 gl


PstI (Promega)


20 gl
4 gl
4 gl
4 gl
7 gl
40 gl


PstI (Promega)


3 gl
1.5 gl
1.5 gl
7 gl
2 gl
15 gl









To digest pGFL2 vector


Restriction Enzymes Kpnl and Sacd (Promega)
Digestion reaction
pGFL2 Vector (5.5 ug) 14 gl
Multicore Buffer 10X 3 gl
BSA 10X 3 gl
KpnI 4.3 pl
SacI 2.2 tl
Dd water 3.5 gl
Final volume 30 gl


To digest PCR fragment from pGL2 vector

Restriction Enzymes Kpnl and Sacd (Promega)
Digestion reaction
PCR fragment 28 gl
Multicore Buffer 10X 4 gl
BSA 10X 4 gl
KpnI 3 gl
SacI 1 gl
Dd water 0 gl
Final volume 40 gl


Ligation Reactions

To ligate PCR fragment from pKSH3 vector

Ligation kit LigaFastTM Rapid DNA Ligation System (Promega)
Ligation reaction
pGEM-T Easy Vector (50 ng) 1 tl
PCR product (14 ng) 0.65 gtl
Ligation Buffer 2 X 5 gl
T4 ligase 1 gtl
Dd water 2.35 gl
Final volume 10 gl









To ligate PCR fragment from pCMYCKDEL vector


Ligation kit LigaFastTM Rapid DNA Ligation System (Promega)
Ligation reaction
pCMYCKDEL Vector (100 ng) 1 [tl
PCR product (25 ng) 0.25 [tl
Ligation Buffer 2 X 5 [tl
T4 ligase 1 itl
Dd water 2.75 [tl
Final volume 10 [tl


To ligate PstI fragments from pJFNPTII and pCAMBIA2300 vectors

Ligation kit LigaFastTM Rapid DNA Ligation System (Promega)
Ligation reaction
pJFNPTII insert 0.8 pl
pCAMBIA2300 backbone 2 tl
Ligation Buffer 2 X 5 tl
T4 ligase 1 itl
Dd water 1.2 ptl
Final volume 10 [tl









Protocols for Bahiagrass Transformation and Regeneration


Protocol for Bahiagrass Seed Sterilization (modified from Smith et al., 2002)

1. Sort out good seeds. Remove any broken or black seeds (check both sides of seed). Put into
tube to fill 1/3 full (approx 500 seeds).
2. Prepare 3-4 1L beakers of DI H20 plus 1 empty beaker and a 2-ply square of cheesecloth for
each tube.
3. In fume hood, add concentrated sulphuric acid to /2 full and shake well to mix.
4. Leave for 16 minutes (may vary between 15 20 mins depending on seed).
5. Using half a large beaker of DI H20, wash seeds into a second large beaker of DI H20. Stir
seeds with glass rod to wash.
6. Pour off the liquid and floating debris.
7. Add half a beaker of DI H20 to the seeds and stir.
8. Pour off floating debris.
9. Strain seeds through cheesecloth using a little more water.
10. Squeeze seeds in cloth and wash into a clean beaker with the next half beaker of DI H20.
11. Repeat 2x leaving seeds in cheesecloth after 3rd wash.
12. Allow seeds to dry partially on the cheesecloth (15-20 mins).
13. Transfer seeds to a deep petri dish.
14. Fill a small beaker with 20ml Clorox bleach (5.25% sodium hypoclorite) and 10ml glacial
acetic acid. Place in bottom of glass desiccator in fume hood.
15. Place open petri dish of seeds and lid into desiccator. Leave 1 hour.
16. Add small amount of sterile dH20, seal plate and leave to soak for 1 hour.
17. Transfer to IF medium, 20 seeds per plate.
18. Incubate at 280C in the dark.


Protocol for Bahiagrass Particle Bombardment (Altpeter and James, 2005)

1. Gold stocks (60mg/ml): Weigh 12mg gold into an eppendorf tube. Wash several times in
Absolute EtOH by vortexing and centrifuging briefly. Resuspend in 200[tl ddH2O.
2. Gold preparation: Mix 15[tl 0.75[tm gold, 15[tl 1tm gold and 30[tl DNA by vortexing 1 min.
Add 20[tl 0.1M spermidine and 50dtl 2.5M CaCl2 while vortexing. Keep vortexing for 1 min.
Centrifuge briefly to settle gold. Wash in 250[tl Absolute EtOH by vortexing. Spin and
remove supernatant. Resuspend gold in 180[tl Absolute EtOH. (or resuspend in 90[tl for
more gold per shot). Use 5[tl per shot to deliver 50[tg gold. Enough for 25 shots.
3. Sterilization of gun components: Autoclave 5 macrocarrier holders, stopping screens and
macrocarriers. Lay out in laminar flow hood to dry. Sterilize 1100psi rupture discs by
dipping in Absolute EtOH and allowing to dry in flow hood. Place all sterile components in
sealed petri dishes. Clean gun chamber, assembly and flow hood thoroughly with EtOH and
allow to dry half and hour before use.
4. Bombardment: Turn on gun, vacuum pump and helium.Place macrocarriers into holders.
Spread 5[tl gold prep evenly onto macrocarriers and allow todry briefly. Place rupture disc
into holder and screw tightly into place. Place stopping screen into shelf assembly and put
inverted macrocarrier assembly on top. Place shelf at highest level. Place tissue culture plate









on shelf 2 levels below gold. Close door and switch on vacuum to reach 27in Hg. Press fire
button and check that disc ruptures at 1100psi. Vent vacuum and remove sample. Dismantle
assembly and set up for next shot. Use stopping screen 4-5 times.


Protocol for Bahiagrass Regeneration (Altpeter and Positano, 2005)

1. Culture of mature seeds in Callus Induction Medium (CIM, IF medium with 400ptl MS
vitamins, 600|pl dicamba, 440pl BAP), in darkness at 28C for two weeks.
2. Culture of seedlings in CIM under the same conditions for two weeks.
3. Culture of callus CIM under the same conditions for two weeks.
4. Transfer of callus to fresh CIM one week before bombardment.
5. Prebombardment treatment in CIM supplemented with 0.4 M sorbitol for 4-6 h.
6. Bombardment.
7. Culture of callus in no selection medium for one week.
8. Culture of callus in Selection Medium (SM, IF medium supplemented with with 400pl MS
vitamins, 600pl dicamba, 440Lpl BAP, 50 mgL1 paromomycin) in darkness at 28C for two
weeks.
9. Culture of callus in SM under 30 tEm-2s1 light at 28C for two weeks.
10. Culture of callus with shoots in Regeneration medium (ReM, IF medium supplemented with
400ptl MS vitamins, 40ptl BAP, 50 mgL1 paromomycin) under 150 tEm-2s1 light at 28C for
two weeks.
11. Culture of callus with shoots in ReM under 150 tEm-2s1 light at 28C for two weeks.
12. Culture of callus with shoots in Rooting Medium (RoM, IF medium supplemented with
400ptl MS vitamins, 50 mgL1 paromomycin) under 150 tEm-2s1 light at 28C for two weeks.
13. Culture of callus with shoots in RoM under 150 tEm-2s1 light at 28C for two weeks.
14. Transfer of in vitro plants to small pots with Farfard#2 potting mix into the growth chamber.


Protocols for Molecular Techniques

Plasmid DNA Extraction Method (QIAprep Miniprep kit, Qiagen)

1. Grow over-night cultures each from a single colony of bacteria in 5 ml LB broth containing
50 gg/ml kanamycin at 370C with constant shaking.
2. Add the provided RNase A solution to Buffer P1, mix well by inverting and store at 40C.
3. Add 100% ethanol (volume provided on the bottle label) to the Buffer PE concentrate to
prepare the working solution.
4. Centrifuge the cultures at 13,200 rpm for 1 min to pellet the bacterial cells. Remove the
supernatant by pipetting and autoclave before disposing.
5. Resuspend the bacterial cells in 250 gtl Buffer P1 by vortexing and transfer the suspension to
a sterile 1.5 ml microcentrifuge tube.
6. Add 250 [tl Buffer P2 and mix well by inverting the tube gently 4-6 times.
7. Add 350 [tl Buffer P3 and mix immediately but gently by inverting the tube 4-6 times.
8. Centrifuge the samples at 13,000 rpm for 10 min. A compact white pellet will form.









9. Pipet the supernatant onto QIAprep Spin Columns and centrifuge for 1 min at 13,000 rpm.
Discard the flow-through.
10. Pipet 750 pl Buffer PE onto the columns and centrifuge for 1 min at 13,000 rpm to wash the
columns.
11. Discard the flow-through and centrifuge for 1 min to remove all traces of the wash buffer
(Buffer PE).
12. Place the QIAprep columns in clean 1.5 ml microcentrifuge tubes. Add 50 [l Buffer EB to
the center of each QIAprep column to elute DNA. Let stand for 1 min and centrifuge at
13,000 rpm for 1 min.
13. Estimate the DNA concentration using a spectrophotometer or by running on a gel.
14. Store the samples at -200C.


Plasmid DNA Extraction Method (Plasmid Midi Kit, Qiagen)

1. Inoculate a starter culture from either a single colony or a glycerol stock of the bacteria in 5
ml LB broth containing 50 [g/ml kanamycin. Grow the culture at 370C for 8 hours with
constant vigorous shaking.
2. Prepare Buffer P1 by adding the provided RNase A solution, mix well by inverting and store
at 40C.
3. Prepare 250 ml flasks containing 25 ml LB broth, one per midi prep. Sterilize the broth by
autoclaving the flasks for 20 min. Cool the broth before use.
4. Prepare 50 ml corning tubes (3 per sample) by autoclaving for 20 min followed by drying at
600C.
5. After cooling add kanamycin to each flask to get a final concentration of 50 pg/ml
kanamycin (25 1l) in a clean bench. Add 250 pl of the actively growing starter culture to
each flask (1:1000 dilution) and incubate for 16 hr at 370C with constant vigorous shaking.
6. Transfer each culture to a sterile 50 ml corning tube and centrifuge at 6000 x g for 15 min at
4C.
7. Place Buffer P3 in ice.
8. Resuspend the bacterial pellet in 4 ml Buffer P1 by vortexing the samples until no clumps are
visible.
9. Add 4 ml Buffer P2 and mix well by gently inverting 4-6 times. Incubate the samples at room
temperature for 5 min.
10. Add 4 ml of chilled Buffer P3 and mix immediately but gently by inverting the tube 4-6
times. Incubate the samples in ice for 20 min.
11. Centrifuge at 20,000 x g for 30 min at 40C. Immediately transfer the supernatant to a new
tube by pipetting.
12. Centrifuge the supernatant again at 20,000 x g for 15 min at 40C. Transfer the supernatant to
a new tube by pipetting immediately.
13. Apply 4 ml Buffer QBT to a QIAGEN-tip 100 for equilibration and allow the column to
empty by gravity flow.
14. Apply the supernatant from Step 12 immediately to the equilibrated tip and allow it to enter
the resin by gravity flow.
15. After all the liquid has entered the column wash the QIAGEN-tip 2x with 10 ml Buffer QC.









16. Add 5 ml Buffer QF to the column to elute the DNA. Collect the eluate in a sterile 50 ml
tube.
17. Add 3.5 ml (0.7 volumes) room-temperature isopropanol to the eluted DNA to precipitate it.
Mix well and centrifuge immediately at 15,000 x g for 30 min at 40C. Carefully decant the
supernatant taking care not to disturb the pellet.
18. Wash the DNA pellet with 2 ml room-temperature ethanol and centrifuge at 15,000 x g for
10 min. Remove the supernatant by pipetting.
19. Air-dry the pellet by inverting the tube on absorbent paper for 5-10 min.
20. Add 200 pl TE to the tube and rinse the walls of the tube thoroughly to resuspend the DNA.
21. Leave resuspending over-night at 40C. Transfer to a sterile microcentrifuge tube, estimate
concentration and store at -200C.

Plasmid DNA Gel-Extraction Method (QIAquick Gel Extraction kit, Qiagen)

1. Prepare Buffer PE by adding 40 ml 100% ethanol to the provided concentrate.
2. Excise the DNA fragment precisely from the agarose gel using a clean sharp scalpel. Avoid
excess agarose.
3. Weigh the gel slice in a colorless sterile microcentrifuge tube. Restrict the volume of gel in
each tube to 400 mg or less.
4. Add 3 volumes of Buffer QG to 1 volume of gel.
5. Incubate at 500C in a heating block for 10 min or until the gel has completely dissolve.
Vortex every 2 min during incubation to ensure complete dissolution of gel.
6. Following incubation check that the color of the mixture remains similar to Buffer QG
(yellow), indicating that the pH has not changed.
7. Add 1 gel volume of isopropanol to the mixture and mix by inverting the tube several times.
8. Place a QIAquick spin column in a provided 2 ml collection tube and apply the sample to the
column. Centrifuge at 13,200 rpm for 1 min. Repeat this step if the volume of the mixture is
more than 800 [il, the maximum capacity of the QIAquick column.
9. Discard the flow-through and place the column in the same collection tube.
10. Wash the QIAquick column by adding 750 [l Buffer PE to the column and centrifuging for 1
min at 13,000 rpm.
11. Discard the flow-through, place the column back in the same collection tube and spin for an
additional 1 min at 13,000 rpm to remove residual ethanol from Buffer PE.
12. Place the QIAquick column in a clean, sterile 1.5 ml microcentrifuge tube.
13. Add 30 pl Buffer EB (10 mM Tris-C1, pH 8.5) to the center of the QIAquick membrane to
elute DNA, let stand for 1 min and then centrifuge for 1 min at 13,000 rpm.
14. Store DNA at -200C.

Genomic RNA Extraction Method ( RNeasy Plant Mini Kit,Qiagen)

1. Prepare enough Buffer RLT for use by adding 10 pl 1-Mercaptoethanol (Sigma) per 1 ml of
buffer.
2. Add 44 ml of 100% ethanol to the RPE buffer concentrate to prepare the working solution.
3. Harvest 100 mg young leaves and freeze immediately using liquid nitrogen.
4. Grind the sample to a fine powder using a sterile (Autoclaved for 30 min) mortar and pestle.
Transfer the ground sample to a sterile, liquid-nitrogen cooled 2 ml microcentrifuge tube.









5. Add 450 [l prepared Buffer RLT to the powder and vortex vigorously.
6. Pipet the lysate onto a QIAshredder spin column placed in a 2 ml collection tube and
centrifuge for 2 min at maximum speed (13,200 rpm). Transfer the supernatant of the flow-
through to a new sterile microcentrifuge tube taking care not to disturb the pellet of cell-
debris. Estimate the approximate volume of the supernatant.
7. Add 0.5 volume (225 pl) ethanol (200 proof) to the collected supernatant and mix
immediately by pipetting.
8. Immediately transfer sample, including any precipitate formed, to an RNeasy mini column
placed in a 2 ml collection tube. Close the tube gently and centrifuge for 15s at 10,000 rpm.
Discard the flow-through.
9. Perform DNase treatment using the RNase-Free DNase Set (Qiagen).
10. Transfer the RNeasy column to a new 2 ml collection tube. Wash the column by pipetting
500 pl Buffer RPE onto it and centrifuging for 15 s at 10,000 rpm. Discard the flow-through.
11. To dry the RNeasy silica-gel membrane, pipette another 500 pl of Buffer RPE onto the
column and centrifuge for 2 min at 10,000 rpm. Discard the flow-through.
12. Transfer the column to a new sterile 1.5 ml collection tube supplied with the kit. To elute
RNA, pipet 30 il RNase-free water directly onto the RNeasy silica membrane in the center
of the column. Close the tube gently and centrifuge for 1 min at 10,000 rpm.
13. Estimate concentration and use 1 lg RNA immediately to prepare cDNA.
14. Store remaining RNA at -800C.

DNase Treatment using the RNase-Free DNase Set (Qiagen)

1. Dissolve the solid DNase I (1500 Kunitz units) in 550 il of the provided RNase-free water to
prepare the DNase I stock solution. Mix gently by inverting the vial. Store the solution at -
200C.
2. Wash the RNeasy column by pipetting 350 pl Buffer RW1 onto the column and centrifuging
for 15 s at 10,000 rpm. Discard the flow-through.
3. Add 10 pl DNase I stock solution to 70 il Buffer RDD for each sample and mix by inverting
gently.
4. Pipet the 80 il DNase I mixture onto the RNeasy silica-gel membrane and incubate on the
bench (20-30C) for 15 min.
5. Wash the RNeasy column again using 350 [il Buffer RW1 and centrifuge for 15 s at 10,000
rpm.
6. Continue with step 10 of the total RNA isolation protocol.


Large-Scale Genomic DNA Extraction Method (CTAB method, Murray and Thompson,

1980)

1. Sterilize mortar, pestles and spatulas by autoclaving for 20 min and drying in 60 oC oven.
2. Pipet 15 ml of CTAB buffer (5 ml/gram leaf material) into 50 ml sterile disposable
polypropylene tubes, one for each sample. Add 30 p1l P-Mercaptoethanol to each tube and
mix well. Heat to 650C in a water bath.
3. Harvest 3 g young leaf material and store on ice or freeze in liquid nitrogen.









4. Cool mortar and pestle by adding liquid nitrogen. Chop fresh leaf into liquid nitrogen using
scissors. Grind to a fine powder using nitrogen approximately three times.
5. Add the frozen leaf powder to the pre-heated buffer and mix well to remove lumps using a
spatula or glass rod.
6. Incubate at 65 C for 1 hour. Mix the contents 2-3 times during the incubation. Cool to room
temperature.
7. Add equal volume (15 ml) chloroform/isoamyl alcohol (24:1) and mix gently by hand. Then
place on a shaker with gentle mixing for 30 min to form an emulsion. Mix samples by hand
once half-way through the incubation.
8. Centrifuge at 4,000 rpm for 1 min. Discard lower layer.
9. Centrifuge at 4,000 rpm for 10 min. Transfer the top layer to a new sterile 50 ml tube.
10. Add 2/3 volumes (10 ml) isopropanol and mix gently by inverting.
11. Use a sterile blue pipette tip to hold the spool of DNA and pour away the liquid. Transfer the
DNA to a sterile 2 ml microcentrifuge tube.
12. Wash the DNA 2x in 70% ethanol, while holding the DNA inside the tube.
13. Centrifuge at 13,200 rpm for 1 min and remove the supernatant.
14. Air-dry the pellet for 15 min in a clean bench and resuspend in 500 pl TE.
15. Add 2 pl RNase A (30 mg/ml) and incubate at 600C over-night.
16. Add 300 pl phenol/chloroform (25:24:1 Phenol:Chloroform:Isoamylalcohol) and mix by
inverting and tapping to form an emulsion.
17. Centrifuge at 13,200 rpm for 5 min at 40C. Remove the top layer and transfer to a new sterile
2 ml microcentrifuge tube.
18. Repeat the phenol/chloroform extraction.
19. Add 300 pl chloroform/isoamylalcohol (24:1) and mix well to form an emulsion.
20. Centrifuge at 13,200 rpm for 5 min at 40C. Remove the top layer and transfer to a new sterile
2 ml microcentrifuge tube.
21. Repeat the chloroform extraction.
22. Add 1/10 volume (50 pl) 3M sodium acetate and 2 volumes (1 ml) 100% ethanol.
23. Spin for 1 min at 13,200 rpm and remove the supernatant by pipetting.
24. Wash 2x in 70% ethanol. After the first wash pour off the supernatant and after the second
wash spin for 1 min at 13,200 rpm and remove supernatant by pipetting. This allows faster
drying of the DNA pellet.
25. Dry the pellet for 15-25 min (depending on the size of the pellet) in a vacuum rotatory
evaporator (Speed-Vac) with the heating on. Do not over-dry the pellet as this may
compromise the solubility of the DNA.
26. Resuspend in 200 pl T1/10E. Incubate at 600C over-night to help resuspension.
27. Make 10X dilutions for all samples. Use these samples to estimate DNA concentration using
a spectrophotometer and by running on a gel.
28. Store the dilutions and stocks at 40C.


Protocol for Southern Blot (Sambrook and Russell, 2001)

1. Turn on the incubator and the water bath at 650C, remove P32 and salmon sperm from the
frezeer and placed the closed P32 behind the plastic shield to let them thaw.Take the
hybridization buffer and placed it on the hot water bath.









2. Pre-wet the blots: Assemble needed hybridization tubes in the rack, place blots inside the
tubes, wrap top with teflon tape (to avoid lackingg, and prewet blots with 5X SSC solution.
Thaw the Prime-a-gene kit (Promega) components and keep Klenow on ice. Thaw your
probe, prepare the dNTP mixture (10 pl TTP, ATP and GTP) and use screw cap eppendorf
tubes for the probes.
3. Prepare the probe adding DNA and water (30 pl total volume). Prepare 500 pl salmon sperm.
To denature, place both screw-cap tubes in a beaker with boiling water for 5 min. Then, place
them back on ice for 5 min.
4. To pre-hybridize the blots: Take the hybridization tubes, eliminate the 5X SSC solution and
add 20 ml of hot IX SSC (650C, water bath), add 500 pl salmon sperm, cap tightly, and place
the tubes in opposite directions inside the incubator. Close the door, turn on the rotator and
check for leaky lids and proper rotation.
5. Probe labeling: Add 10 tl buffer, 2 p1l BSA, 2 pl dNTPs and 1ltl Klenow to the probe tube
working on ice and outside the yield. Move behind the yield, add 5 pl P32, cap tightly, mix
lightly, and place them in the rack (50 [il total volumen.
6. Let the hybridization tubes (incubator) and probe tubes (radioactive bench) incubate for 3-4
hours.
7. Behind the yield, dilute the probe with 1/10 TE buffer (1 ml) and add 500 ptl salmon sperm.
Denature the mix in boiling water for 5 min. Remove the hybridization tubes from the
incubator, eliminate the pre-hybridization solution and place them in the rack.
8. Blot hybridization: Add 10 ml hybridization solution, add probe-salmon sperm mix, taking
care that the pippette dispenses the hot probe in the hybridization solution and not on the
blots. Recap the tubes and place them back in the incubator. Close the door, turn on the
rotator and check for leaky lids and proper rotation. Allow to incubate overnight.
9. Washing blots: Next day, eliminate the probe solution in the radioactive waste container, wash
the blots in the tubes with a hot solution (650C) of 0. IX SSC and 0.1% SDS. Do three washes
of 15 ml each: one quick wash and two 20 min washes in the incubator. All the washing
solutions is pour into the radioactive waste container.
10. Behind the yield, remove the blots from the tubes and wrap them with Saran wrap. Check for
radioactivity with the Geiger counter and place the blots into the film cassettes. Add the film
and place the cassettes in the freezer at -800C for 2-3 days.
11. Develop the film in the darkroom.

Protocol for Enzyme Linked Immunadsorbent-Assay for the nptll gene (Agdia kit)

1. Dilute the PEB 1 buffer concentrate (10x) to lx using sterile ddH2O. Prepare enough to use
600 tl per sample plus a little extra (for use as negative control).
2. Harvest 3 eppendorf lengths of leaf, always choosing the youngest full expanded leaf. Store
samples on ice.
3. Add a pinch of polyvinyl pyrrolidone PVP and 600 tl PEB 1 buffer to each sample. Grind the
leaf materials as much as possible using a sterile blue micropestle. Keep the samples on ice.
4. Centrifuge the samples at 14,000 rpm at 40C for 15 min. Transfer the supernatant to a new
microcentrifuge tube by pipetting and store on ice.
5. If the samples contain a lot of debris, centrifuge again.
6. Turn on spectrophotometer half an hour before use.









7. Dilute Bradford's reagent 1:5 using sterile ddH20. Prepare enough to use 1 ml per sample
including standards and blank.
8. Prepare a dilution series using BSA for use as standards.
9. Add 1 ml diluted Bradford's reagent to each cuvette. Add 10 il of sample to each cuvette
and mix by pipetting.
10. To ensure complete mixing, immediately invert the cuvette using a piece of parafilm. Leave
to incubate at room-temperature while preparing the remaining samples. Use a new piece of
parafilm for each sample to prevent contamination.
11. Measure OD595 of each sample (ideally these should be between 0.2 and 0.8).
12. Plot a standard curve using BSA and use it to estimate protein concentration of the samples.
13. Calculate the volume of each sample required to get 15 Gg.
14. Prepare the samples, including wild-type, in new tubes using 15 pg protein and the volume of
buffer PEB 1 required to make the total volume 110 il.
15. Prepare standards as follows: 110 .il buffer PEB1 (negative control) and 110 .il of the
provided positive control. Keep all prepared samples on ice.
16. Prepare a humid box by putting some damp paper towel in a box with a lid.
17. Add 100 .il of each prepared samples into the test wells, making note of the sequence in
which the samples were applied. Also add 100 .il of the prepared standards.
18. Place the plate in humid box and incubate for 2 hours at room temperature.
19. Prepare the wash buffer PBST by diluting 5 ml to 100 ml (20x) with dd H20..
20. Prepare the enzyme conjugate diluent by mixing 1 part MRS-2 with 4 parts lx buffer PBST.
Make enough to add 100 pl per well.
21. A few minutes before the incubation ends, add 10 pl from bottle A and 10 pl from bottle B
per 1 ml of enzyme conjugate diluent to prepare the enzyme conjugate.
22. When incubation is complete, remove plate from humid box and empty wells into the sink by
flipping quickly while squeezing the sides of the frame.
23. Fill all wells to over-flowing with lx buffer PBST and then quickly empty them again.
Repeat 5x.
24. After washing tap the frame firmly upside down on paper towels to dry the wells.
25. Add 100 pl of prepared enzyme conjugate into each well.
26. Place the plate in humid box and incubate for 2 hours at room temperature.
27. Measure out sufficient TMB substrate solution for 100 .il per well into a clean container.
Allow to warm to room temperature during the 2 hour incubation.
28. When the incubation is complete, wash the plate with lx buffer PBST as before.
29. Add 100 pl of room temperature TMB substrate solution to each well and place the plate in
humid box for 15 min.
30. Add 50 pl 3M sulphuric acid (stop solution) to each well. The substrate color will change
from blue to yellow.
31. The results must be recorded within 15 min after addition of the stop solution otherwise the
reading will decline.









High sensitivity Protocol for Enzyme Linked Immunadsorbent-Assay for the crylF gene
(QualiPlateTM Kit for CrylF, EnviroLogix)

Buffer, control and leaf sample preparation for ELISA

1. Prepare washing buffer as follows: Add the contents of the packet of Wash Buffer Salts
(phosphate buffered saline, pH 7.4 Tween 20) to 1 liter of distilled or deionized water and
stir to dissolve. Store refrigerated when not in use; warm to room temperature prior to assay.
If more wash buffer is needed, order item # P-3563 from Sigma Chemical Co. ( St. Louis,
MO), or prepare the equivalent.
2. Prepare Extraction Buffer: Add 0.5 ml Tween-20 to 100 ml of prepared Wash Buffer, and stir
to dissolve. Store refrigerated when not in use; warm to room temperature prior to assay.
3. Prepare Positive and Negative Control ground corn extracts: Extracts of these controls must
be run in every assay. To extract, add 5 ml of Extraction Buffer to each tube containing 2
grams of ground Control corn. Cap and shake vigorously by hand or vortex for 20-30
seconds. Let stand at room temperature for 1 hour to extract. Mix again at the end of the
hour, then clarify by allowing to settle 10 minutes or by centrifuging 5 minutes at 5000 x g.
The High Sensitivity Protocol requires that the Positive Control ground corn extract be
diluted 1:3 in Negative Control ground corn extract (mix 100 tl Positive extract plus 200 tl
Negative extract) prior to use.
4. Prepare leaf samples from the third fully emerged leaf: Take two leaf segments from the
second and third uppermost leaves of length equivalent to that of a 1.5ml eppendorf tube.
Mash the leaf tissue with a pestle matched to the micro-tube, or with a disposable pipette tip,
or a Hypure cutter (HCT-200, PerkinElmer) in a 96-well. Add 0.25 ml of Extraction Buffer
per leaf punch. Mix for at least 30 seconds, then allow particles to settle. Take extreme care
not to crosscontaminate between leaf samples. Dispensing particles into the test plate can
cause false positive results.
ELISA

1. Dilute the Positive Control ground corn extract 1:3 in Negative Control ground corn extract
for this protocol.
2. Add 50 ul of Extraction Buffer Blank (BL), 50 ul of Negative Control (NC) ground corn
extract, 50 ul of diluted Positive Control (PC) ground corn extract, and 50 ul of each sample
extract (S) to their respective wells.
3. Thoroughly mix the contents of the wells by moving the plate in a rapid circular motion on
the benchtop for a full 20-30 seconds. Be careful not to spill the contents!
4. Cover the wells with tape or Parafilm to prevent evaporation and incubate at ambient
temperature for 30 minutes. If an orbital plate shaker is available, shake plate at 200 rpm.
5. Add 50 ul CrylF-enzyme Conjugate to each well. Thoroughly mix the contents of the wells,
as in step 2.
6. Cover the wells with tape or Parafilm to prevent evaporation and incubate at ambient
temperature for 90 minutes. If an orbital plate shaker is available, shake plate at 200 rpm.
7. After incubation, carefully remove the covering and vigorously shake the contents of the
wells into a sink or other suitable container. Flood the wells completely with Wash Buffer,
then shake to empty. Repeat this wash step three times.
8. Add 100 ul of Substrate to each well.









9. Thoroughly mix the contents of the wells, as in step 2. Cover the wells with new tape or
Parafilm and incubate for 30 minutes at ambient temperature. Use orbital shaker if available.
Caution: Stop Solution is 1.ON Hydrochloric acid. Handle carefully.
10. Add 100 ul of Stop Solution to each well and mix thoroughly. This will turn the well
contents yellow NOTE: Read the plate within 30 minutes of the addition of Stop Solution.


Protocol for immunochromatography strip test for crylF gene (Quickstix kit for crylF,
EnviroLogix)

Sample Preparation

1. Prepare leaf samples from the third fully emerged leaf: Take two leaf segments from the
second and third uppermost leaves of length equivalent to that of a 1.5ml eppendorf tube.
Mash the leaf tissue with a pestle. Sample identification should be marked on the tube with a
waterproof marker.
2. Insert the pestle into the tube and grind the tissue by rotating the pestle against the sides of
the tube with twisting motions. Continue this process for 20 to 30 seconds or until the leaf
tissue is well ground.
3. Add 0.25 mL of extraction Buffer into the tube. Repeat the grinding step to mix tissue with
Extraction Buffer. Dispose of the pestle(do not re-use pestles on more than one sample to
avoid cross-contamination).
QuickStix Strip Test

1. Allow refrigerated canisters to come to room temperature before opening. Remove the
QuickStix Strips to be used. Avoid bending the strips. Reseal the canister immediately.
2. Place the strip into the extraction tube. The sample will travel up the strip. Use a rack to
support multiple tubes if needed.
3. Allow the strip to develop for 10 minutes before making final assay interpretations. Positive
sample results may become obvious much more quickly.
4. To retain the strip, cut off the bottom section of the strip covered by the arrow tape.
5. Development of the Control Line within 10 minutes indicates that the strip has functioned
properly. Any strip that does not develop a Control Line should be discarded and the sample
re-tested using another strip.
6. If the sample extract contained CrylF endotoxin, a second line (Test Line) will develop on
the membrane strip between the Control Line and the protective tape, within 10 minutes of
sample addition. The results should be interpreted as positive for CrylF endotoxin
expression. Any clearly discernible pink Test Line is considered positive.
7. If no Test Line is observed after 10 minutes have elapsed, the results should be interpreted as
negative,meaning that the sample contained less CrylF endotoxin than is typically expressed
in the tissues of Bt-modified plants.









Protocol for co-immunoprecipitation of recombinant VSPP (ProFoundTM c-Myc Tag IP/Co-
IP Kit, Pierce Biotechnology)

Material Preparation:

1. Prepare the extraction and TBS buffers.
2. Prepare leaf samples: Weight and freeze 5 grams of young leaf tissue. Use mortar and pestle
to grind the leaves with liquid nitrogen. Add 15 ml extraction buffer (1:3 weight: volume
ratio). Centrifugate tube samples for 20 minutes at 4000 rpm and 4C(Sorwall SS-34). Take
the supernatant and centrifugate samples for 10 minutes at 4000 rpm and 4C. Take the
supernatant.
3. Concentrate the protein extract by acetone precipitation: Cool the acetone required volume to
-200C. The final volume is four times the volume of your protein extract (ex. 15 ml extract
needs 60 ml acetone). Place protein sample a polypropylene tube (split the extract in two
tubes before adding the acetone because polypropylene tubes hold 30 ml). Add four times the
sample volume of cold acetone to the tube. Vortex tube and incubate for 60 minutes at -200C.
Centrifuge 10 minutes at 13,000-15,000 rpm (Sorwall). Decant and properly dispose of the
supernatant, being careful to not dislodge the protein pellet.
4. Add resuspension buffer (4 ml/tube) and resuspend the pellet using an orbital shaker.
5. Estimate protein concentration with the Coomasie Plus Protein Assay reagent and Coomasie
standards (Pierce Biotechnology, Inc.) at OD595 with a spectrophotometer. Protein
concentration should be approx. 1 mg/ml.
Immunoprecipitation/Co-immunoprecipitation (IP/Co-IP) of c-Myc-tagged protein

1. Set up a positive control: Use 50 tl c-Myc-tagged Positive Control diluted in 150 tl TBS.
2. Thoroughly resuspend the anti-c-Myc agarose by inverting the vial several times
immediately before dispensing (do not vortex!). Dispense 10 ul anti-c-myc agarose slurry (5
[tg anti-c-Myc antibody) into each tube containing lml of protein extract using a wide-bore
pipette tip. Close the tube.
3. Incubate the tube with an orbital shaker at 40C overnight (in the fridge).
4. Next day, get the spin column and remove the bottom plug. Put a collection tube under the
column, add 0.5 ml of the mix slurry-protein extract and pulse for 10 seconds at maximum
speed in microcentrifuge. Save the flow-through for future analysis. Repeat this step because
the maximum volume for the spin column is 850 [l.
5. Prepare a wash solution of TBS plus 0.05% Tween20 (TTBS). For each spin column prepare
approximately 3 ml of wash solution. Add 0.5 ml TTBS to each column. Loosely screw on
the cap and gently invert the column with the collection tube 2-3 times. Pulse centrifuge for
10 seconds. Save the wash for future analysis. Repeat this step two additional times.
6. Elution of c-myc-tagged protein: Place the spin column in a new collection tube. Add 10 ul
elution buffer to the anti-c-myc agarose, loosely screw on the cap and gently tap the tube to
mix. Pulse centrifuge for 10 seconds. (It is not necessary to place the bottom plug on the spin
column for this step).
7. Repeat this step two additional times. The three elutions may be recovered and pooled in one
collection tube. Neutralize the elutant immediately by adding 1 tl of 1 M Tris, pH 9.5 per 20
tl of Elution Buffer.









8. To prepare the sample for reducing SDS-PAGE and western blot, take 25 kl sample and add
2-3 kl of 1 M DTT or 1-2 kl of mercaptoehtanol and loading buffer. The sample is ready to
load.
9. Usually, the eluted c-myc-tagged positive control can be detected by coomassie or silver
staining. But, for more sensitive detection methods such as Western blotting, dilute the
control 10- to 50-fold (0.2-0.5 kl elution is sufficient for analysis).


Protocols for Western Blots

Western blots with VSPI antibodies

1. Prepare samples: Grind 500 mg leaf tissue (including leaves from all stages) with liquid
nitrogen in a 2 ml tube. Add 1 ml extraction buffer (Bellucci et al., 2000). Vortex and place it
on ice until finish processing all the samples. Centrifuge at 14,000 g 20 minutes. Take
supernatant. Centrifuge at 14,000 g 10 minutes. Take supernatant.
2. Estimate protein concentration: Prepare calibration curve with a range between 0.5 and 5
mg/ml. Make 10X dilutions of the samples (5 gl sample: 45 gl ddH20). Take OD595
readings with the spectrophotometer. Estimate sample concentrations.
3. Prepare loading samples: Add 15 gg total protein per sample. Add 5 ul loading buffer per
sample. Incubate the samples at 100C 10 minutes. Store at -20C or place them on ice until
use.
4. Prepare SDS-PAGE gels. Load molecular markers: 10 gl Prestained SDS-PAGE standards,
low range (Bio-Rad Laboratories) and 1 gl MagicMark TM (Qiagen). Load 20 gl plant
samples.
5. Run SDS-PAGE gels in electrophoretic tank at 150 v, 1 hr 15 minutes.
6. Prepare fresh transfer buffer and keep it on ice or in the fridge (-20C). Place SDS-PAGE gels
and nitrocellulose membrane (NC-membrane, Bio-Rad Laboratories) in transfer buffer; and
rinse them 5 minutes twice.
7. Prepare transfer sandwich keeping all the pieces wet in transfer buffer. Place the transfer cell
in the electrophoretic tank and run the transfer while stirring and keeping the tank cold with
ice or inside the fridge, at at 150 v, 1 hr 15 minutes.
8. To confirm protein transfer, stain gels with Coomasie blue (Sigma R-250, Sigma) or NC-
membrane with Ponceau solution. Rinse nitrocellulose membranes with Tween Tris Buffer
(TTBS) twice, 5 minutes.
9. To avoid unspecific binding, incubate NC-membrane in a solution with TTBS and 5% non-
fat dry milk (Bio-Rad Laboratories) (0.75 g milk and 15 ml TTBS) in orbital shaker at room
temperature. Rinse NC-membrane with TTBS buffer twice, 5 minutes.
10. Incubate NC-membrane in a solution with TTBS, 5% non-fat dry milk and 1:1000 VSPb
antibody dilution (10 gl batch#73, 0.75 g milk and 15 ml TTBS) in orbital shaker at room
temperature, 4 hr. Rinse NC-membrane with TTBS buffer twice, 5 minutes.
11. Incubate NC-membrane in a solution with TTBS, 5% non-fat dry milk and 1:50,000
secondary antibody dilution (1.2 gl Pierce, 0.75 g milk and 15 ml TTBS) in orbital shaker at
room temperature, 2 hr. Rinse NC-membrane with TTBS buffer twice, 5 minutes.









12. Incubate NC-membrane in a 1:1 solution with TTBS : cheminoluminescent substrate
(Supersignal West Femto Maximun Sensitivity Substrate, Pierce Biotechnology, Inc.)
according Pierce recommendations, and develop in dark room after 5-15 minutes.

Western blots with c-myc antibodies

1. Prepare samples: Grind 500 mg leaf tissue (including leaves from all stages) with liquid
nitrogen in a 2 ml tube. Add 1 ml extraction buffer (Bellucci et al., 2000). Vortex and place it
on ice until finish processing all the samples. Centrifuge at 14,000 g 20 minutes. Take
supernatant. Centrifuge at 14,000 g 10 minutes. Take supernatant.
2. Estimate protein concentration: Prepare calibration curve with a range between 0.5 and 5
mg/ml. Make 10X dilutions of the samples (5 pl sample: 45 ul pl ddH20). Take OD595
readings with the spectrophotometer. Estimate sample concentrations.
3. Prepare loading samples: Add 15 .g total protein per sample. Add 5 .il loading buffer per
sample. Incubate the samples at 100C 10 minutes. Store at -20C or place them on ice until
use.
4. Prepare SDS-PAGE gels. Load molecular markers: 10 [l Prestained SDS-PAGE standards,
low range (Bio-Rad Laboratories) and 1 pl MagicMark TM (Qiagen). Load 20 pl plant
samples.
5. Run SDS-PAGE gels in electrophoretic tank at 150 v, 1 hr 15 minutes.
6. Prepare fresh transfer buffer and keep it on ice or in the fridge (-20C). Place SDS-PAGE gels
and nitrocellulose membrane (NC-membrane, Bio-Rad Laboratories) in transfer buffer; and
rinse them 5 minutes twice.
7. Prepare transfer sandwich keeping all the pieces wet in transfer buffer. Place the transfer cell
in the electrophoretic tank and run the transfer while stirring and keeping the tank cold with
ice or inside the fridge, at at 150 v, 1 hr 15 minutes.
8. To confirm protein transfer, stain gels with Coomasie blue (Sigma R-250, Sigma) or NC-
membrane with Ponceau solution. Rinse nitrocellulose membranes with Tween Tris Buffer
(TTBS) twice, 5 minutes.
9. To avoid unspecific binding, incubate NC-membrane in a solution with TTBS and 5% non-
fat dry milk (Bio-Rad Laboratories) (0.75 g milk and 15 ml TTBS) in orbital shaker at room
temperature. Rinse NC-membrane with TTBS buffer twice, 5 minutes.
10. Incubate NC-membrane in a solution with TTBS, 5% non-fat dry milk and 1:1000 c-myc
antibody dilution (Sigma, 0.75 g milk and 15 ml TTBS) in orbital shaker at room
temperature, 2 hr. Rinse NC-membrane with TTBS buffer twice, 5 minutes.
11. Incubate NC-membrane in a solution with TTBS, 5% non-fat dry milk and 1:50,000
secondary antibody dilution (1.2 pl Pierce, 0.75 g milk and 15 ml TTBS) in orbital shaker at
room temperature, 2 hr. Rinse NC-membrane with TTBS buffer twice, 5 minutes.
12. Incubate NC-membrane in a 1:1 solution with TTBS : cheminoluminescent substrate
(Supersignal West Femto Maximun Sensitivity Substrate, Pierce Biotechnology, Inc.)
according Pierce recommendations, and develop in dark room after 5-15 minutes.









Protocol for Insect Bioassays


Feeding Experiments (Adamczyk and Gore, 2004)

1. Prepare Petri dishes containing lg/1 agar medium.
2. Harvest bahiagrass plants. Collect the third fully emerged leaf from different tillers whitin the
same plant. Cut bahiagrass leaves discarding the top and the bottom of the leaf and using
intermediate pieces of 2 cm length. Place four leaf pieces with the abaxial surface in contact
with the medium on each Petri dish.
3. Collect fall armyworm neonate larvae from egg masses (hatching the same day) with a
camel-hair brush and place on the top of the leaves. Place one larvae per Petri dish and seal
the dish. Prepare 10 dishes per treatment and replicate.
4. Place Petri dishes in the incubator at 26-280C. Leave the dishes for five days.
5. Then, open the Petri dish and look for the neonate larvae under the dissectoscope. Larvae
were considered alive if coordinated movement was observed. Record mortality data.

Buffers and Reagents

Bacterial Growth

SOC medium

SOB: 4g tryptone, Ig yeast extract and 0.lg NaC1. Dissolve in 180ml dH20. Add 2ml

250mM KC1. Adjust to pH7 with 5N NaOH. Make up to 200ml. Just before use, add 10l 1M

MgC12 and 20 pl 1M glucose per lml SOB.

Antibiotics

* Ampicillin: Weigh 100 mg ampicillin. Dissolve in 2 ml of ddH20. Filter sterilize into
autoclaved Eppendorf tubes. Freeze at -200 C. Stock concentration: 50 mg/ml. Use 2 pl
(100 [g)/ml LB.

* Kanamycin: Weigh 100 mg kanamycin. Dissolve in 10 ml of ddH20. Filter sterilize into
autoclaved Eppendorf tubes. Freeze at -200 C. Stock concentration: 10 mg/ml. Use 5 pl (50
[g)/ml LB.

* Tetracycline: Weigh 50 mg tetracycline. Dissolve in 10 ml of 100% ethanol. Aliquot into
autoclaved Eppendorf tubes. Freeze at -200 C. Stock concentration: 5 mg/ml. Use 2 [l (10
[g)/ml LB.

* Paromomycin: Weigh 500 mg paromomycin. Dissolve in 10 ml of ddH20. Filter sterilize
into autoclaved Eppendorf tubes. Freeze at -200 C. Stock concentration: 50 mg/ml. Use 1
ml (50 mg)/1 IF.









* Rifampicin: Weigh 100 mg rifampicin. Dissolve in 4 ml of DMSO. Filter sterilize into
autoclaved Eppendorf tubes. Wrap tubes in aluminum foil. Freeze at -200 C. Stock
concentration: 25 mg/ml. Use 6 pl (150 tg)/ml LB.

Glycerol stocks

Incubate the E.coli culture containing your plasmid overnight at 37C. Add 0.85 ml

bacterial culture. Add 0.15 ml glycerol (previously autoclaved and at room temperature). Vortex

for mixing. Freeze in liquid nitrogen. Store -80C. Prepare several tubes for plasmid. Avoid

successive freeze-thaw cycles.

Ethanol precipitation

Add 0.1 volume 3 M sodium acetate and 2 volumes 100% ethanol to plasmid DNA

solution. Place -20C for 15-30 minutes. Spin 12,000 g 10 minutes. Remove supernatant. Add 200

ul 70% ethanol. Spin 12,000 g 10 minutes. Remove supernatant. Air-dry or speed-vaccum the

pellet. Resuspend in ddH20 or TE buffer.

Plasmid DNA Extraction

* Extraction buffer (Buffer D): Add 4.44 g Tris.HC1, 2.65 g Tris base, 9.3 g EDTA, 7.3 G
NaC1. Add ddH20 up to 500 ml.

* Sodium Dodecyl Sulphate stock (20% SDS): Add 100 g SDS in 450 ml ddH20 with heat.
Adjust pH=7.2 with concentrated HC1. Add ddH20 up to 500 ml.

* Potassium acetate stock (5 M): Add 29.44 g potassium acetate, 11.5 ml glacial acetic acid,
and make volume up to 100 ml ddH20.

* Sodium acetate stock (3 M): Add 0.82 g sodium acetate to 5 ml ddH20. adjust pH=5.2
with glacial acetic acid and make volume up to 10 ml with ddH20.

Bahiagrass Tissue Culture Medium

IF Medium

Add 1.72g MS salts (Murashige and Skoog, 1962), 401tl CuSO4 (12.45mg/ml), 1.2g

Phytagel and 8g Sucrose to 400 ml ddH20. Adjust pH to 5.8 with KOH. Autoclave 20 mins.









Add 6001tl dicamba (2mg/ml), 440tl BAP (Img/ml) and 4001tl MS vitamins (1000x) in sterile

conditions.

DICAMBA (3,6-dichloro-2-methoxibenzoic acid)

Weigh 100 mg dicamba. Dissolve in 0.5 ml of 100% ethanol with heat. Add 49.5 ml

ddH20 with heat. Filter-sterlize the stock solution. Aliquot into autoclaved Eppendorf tubes.

Freeze at -200 C. Stock concentration: 2 mg/ml. Use 600 il (1200 mg)/400 ml IF.

BAP (6-benzylaminopurine)

Weigh 825 mg BAP. Dissolve in 0.5 ml ofNaOH (IN). Add 19.5 ml ddH20. Filter-

sterlize the stock solution. Aliquot into autoclaved Eppendorf tubes. Freeze at -20C. Stock

concentration: Img/ml. Use 440 pl (1200 mg)/400 ml IF.

Western bBots

Extraction buffer (Bellucci et al., 2000)

100 ml
100 mM Tris 1.21 g
200 mM NaCl 1.17 g
1 mM EDTA 29.2 mg
10% glycerol 10 ml
0.2% Tritonl00X 0.2 ml
4% P-mercaptoethanol 4 ml
Adjust final volume with ddH20. Add fresh P-mercaptoethanol before use. Reduce to 1,2 mM P-
mercaptoethanol and 5% glycerol to use co-immunoprecipitation columns.
Loading buffer

10 ml
40% glycerol 4 ml
0.5 M Tris.HC1 (pH=6.8) 2.5 ml
8% SDS 800 mg
0.24% Bromophenolblue 12 mg
Adjust final volume with ddH20. Aliquot 200 pl and add 50 pl fresh P-mercaptoethanol before
use.
Electrophoresis buffer (Tris-glycine-SDS 10X)









1000 ml
25 mM Tris 30 g
192 mM glycine 144 g
0.1% SDS 10 g
Adjust final volume with ddH20. Add components in order and wait until they are dissolved. pH
is adjusted naturally (pH=8.3).
Destaining solution

500 ml
30% methanol 150 ml
10% acetic acid 50 ml
60% ddH20 300 ml
Rinse in fume hood.
Tris base buffer (TBS)

1000 ml
Tris base 24.22 g
NaCl 87.66 g
Adjust pH=7.5 by adding 15-20 ml IN HC1. To prepare TTBS, add 0.1% Tween 20 before use.
Transfer buffer

1000 ml
48 mM Tris 5.82 g
39 mM glycine 2.93 g
SDS 2.5 mg
20% methanol 200 ml
ddH20 800 ml









LIST OF REFERENCES


Abanti C, Bhatnagar NB, Bhatnagar R (2004) Bacterial insecticidal toxins. Crit Rev
Microbiol 30: 33-54

Abel CA, Adamczyk JJ Jr (2004) Relative concentration of crylA in maize leaves and cotton
bolls with diverse chlorophyll content and corresponding larval development of fall
armyworm (Lepidoptera: Noctuidae) and southwestern corn borer (Lepidoptera: Crambidae)
on maize whorl leaf profiles. J Econ Entomol 97: 1737-1744

Adamczyk JJ Jr, J.Gore (2004) Laboratory and field performance of cotton containing crylAc,
crylF, and both crylAc and crylF (Widestrike) against beet armyworm and fall armyworm
larvae (Lepidoptera: Noctuidae). Fl Entomol 87: 427-432

Agrawal PK, Kohli A, Twyman RM, Christou P (2005) Transformation of plants with
multiple cassettes generates simple transgene integration patterns and high expression levels.
Mol Breeding 16: 247-260

Akashi R, Hashimoto A, Adachi T (1993) Plant regeneration from seed-derived embryogenic
callus and cell suspension cultures of bahiagrass (Paspalum notatum). Plant Cell 90:73-80

Alderson J, Sharp WC (1995) Grass varieties in theUnited States. Lewis Publishers, Boca
Raton, New York.

Allen G, Spiker S, Thompson W (2000) Use of matrix attachment regions to minimize
transgene silencing. Plant Mol Biol 42: 361-376

Altpeter F and Xu J (2000) Rapid production of transgenic turfgrass (Festuca rubra L.) plants.
J Plant Physiol 157: 441-448

Altpeter F, Baisakh N, Beachy R et al (2005) Particle bombardment and the genetic
enhancement of crops: myths and realities. Mol Breeding 15: 305-327

Altpeter F, Diaz I, McAuslane H, Gaddour K, Carbonero P, Vasil IK (1999) Increased insect
resistance in transgenic wheat stably expressing trypsin inhibitor CMe. Mol Breeding 5: 53-
63

Altpeter F, James V (2005) Genetic transformation of turf-type bahiagrass (Paspalum notatum
Flugge) by biolistic gene transfer. Inter Turfgrass Soc Res J 10: 485-489

Altpeter F, Positano M (2005) Efficient plant regeneration from mature seed derived
embryogenic callus of turf-type bahiagrass (Paspalum notatum Flugge). Int Turfgrass Soc
Res J 10: 479-484

Altpeter F, Vasil V, Srivastava V, Stoger E, Vasil IK (1996a) Accelerated production of
transgenic wheat (Triticum aestivum L.) plants. Plant Cell Rep 16:12-17









Altpeter F, Vasil V, Srivastava V, Vasil IK (1996b) Integration and expression of the high-
molecular-weight glutenin subunit 1Axl gene into wheat. Nature Biotech 14: 1155-1159

Altpeter F, Xu J, Ahmed S (2000) Generation of large numbers of independently transformed
fertile perennial ryegrass (Lolium perenne L.) plants of forage- and turf-type cultivars. Mol
Breeding 6: 519-528

Aphis-USDA database, 2007. Information Systems for Biotechnology, National Biological
Impact Assessment Program (ISB, NBIAP). Transgenic crops under field trials and
deregulation process in the United States. Updated: May 3, 2007 (last accessed May 6, 2007).
http://nbiap.vt.edu

Aphis-USDA database, 2007. Information Systems for Biotechnology, National Biological
Impact Assessment Program (ISB, NBIAP). Total number of issued or acknowledged field
tests of transgenic crops sorted by state in the United States. Updated: May 3, 2007 (last
accessed May 6, 2007). http://www.isb.vt.edu/cfdocs/fieldtestsl.cfm

Arthington JD, Brown WF (2005) Estimation of feeding value of four tropical forage species at
two stages of maturity. J Anim Sci 83: 1726-1731

Avice JC, Ourry A, Lemaire C, Boucaud J (1996) Nitrogen and carbon flows estimated by
15N and 13C pulse-chase labeling during regrowth of alfalfa. Plant Physiol 112: 281-290

Bajaj S, Ran Y, Phillips J, Kularajathevan G, Pal S, Cohen D, Elborough K, Puthigae S
(2006) A high throughput Agrobacterium tumefaciens-mediated transformation method for
functional genomics of perennial ryegrass (Loliumperenne L.). Plant Cell Rep 25: 651-659

Bates SL, Zhao J-Z, Roush RT, Shelton AM (2005) Insect resistance management in GM
crops: past, present and future. Nature Biotechnol 23: 57-62

Belluci M, Alpini A, Arcioni S (2000) Expression of maize 6-zein and P-zein genes in
transgenic Nicotiana tabacum and Lotus corniculatus. Plant Cell Tissue Organ Cult 62: 141-
151

Berger S, Bell E, Sadka A, Mullet JE (1995) Arabidopsis thaliana Atvsp is homologous to
soybean VspA and VspB, genes encoding vegetative storage protein acid phosphatases, and is
regulated similarly by methyl jasmonate, wounding, sugars, light and phosphate. Plant Mol
Biol 27:933-942

Betz FS, Hammond BG, Fuchs RL (2000) Safety and advantages of Bacillus /thn ilg/ie'lli\-
protected plants to control insect pests. Reg Toxicol Pharmacol 32: 156-173

Bevan M (1984) Binary Agrobacterium vectors for plant transformation. Nucleic Acids Res 12:
8711-8721









Bhalla PM (2006) Genetic engineering of wheat current challenges and opportunities. Trends
Biotech 24: 305-311

Bieri S, Potrykus I, Futterer J (2000) Expression of active barley seed ribosome-inactivating
protein in transgenic wheat. Theor Applied Genet 100: 755-763

Blount AR, Gates NR, Pfahler PL, Quesenberry KH (2003) Early plant selection effects on
crown traits in Pensacola bahiagrass with selection cycle. Crop Sci 43: 1996-1998

Blount AR, Quesenberry KH, Mislevy P, Gates RN, Sinclair TR (2001) Bahiagrass and
other Paspalum species: An overview of the plant breeding efforts in the Southern Coastal
Plain. Proc. 56th Southern Pasture and Forage Crop Improvement Conference, Springdale,
US

Bock R (2001) Transgenic plastids in basic research and plant biotechnology. J Mol Biol 312:
425-438

Bohorova N, Frutos R, Royer M, Estanol P, Pacheco M, Rascon Q, McLean S, Hoisington
D (2001) Novel synthetic Bacillus thuringiensis crylB gene and the crylB-crylAb
translational fusion confer resistance to southwestern corn borer, sugarcane borer and fall
armyworm in transgenic tropical maize. TAG 103: 817-826

Bouquin T, Thomsen M, Nielsen LK, Green TH, Mundy J, Dziegiel MH (2002). Human
anti-Rhesus D IgG1 antibody produced in transgenic plants. Transgenic Res 11: 115-122

Bovo OA, Mroginski LA (1986) Tissue culture in Paspalum (Gramineae): Plant regeneration
from cultured inflorescences. J Plant Physiol 124: 481-492

Bovo OA, Mroginski LA (1989) Somatic embryogenesis and plant regeneration from cultured
mature and immature embryos of Paspalum notatum (Gramineae). Plant Sci 65: 217-223

Bradford MM (1976) Rapid and sensitive method for quantification of microgram quantities of
protein utilizing principle of protein-dye binding. Ann Biochem 72: 248-254

Breitler JC, Cordero MJ, Royer M, Meynard D, San Segundo B, Guiderdoni E (2001) The
-689/+197 region of the maize protease inhibitor gene directs high level, wound inducible
expression of the crylB gene which protects transgenic rice plants from stemborer attack.
Mol Breeding 7: 259-274

Buntin GD, Flanders KL, Lynch RE (2004) Assesment of experimental Bt events against fall
armyworm and corn earworm in field corn. J Econ Entomol 97: 259-264









Buntin GD, Hudson RD, Hudson WG, Gardner WA (1997) Summary of Losses from Insect
Damage and Costs of Control in Georgia.Pastures and forage insects. The Bugwood Network
and ForestryImages Image Archive and Database Systems, Warnell School of Forestry and
Natural Resources and College of Agricultural and Environmental Sciences, Dept. of
Entomology University of Georgia. Updated March 19, 2003 (last accessed May 6, 2007).
http://www.bugwood.org

Burson BL, Watson VH (1995) Bahiagrass, dallisgrass and other Paspalum species. In RF
Barnes ed, Forages: An introduction to Grassland Agriculture. Iowa State Univ. Press, Ames,
IA, pp 431-440

Burton GW (1967) A search for the origin of Pensacola bahiagrass. Econ Bot 21: 273-281

Burton GW (1974) Recurrent restricted phenotype selection increases forage yields of
'Pensacola' bahiagrass. Crop Sci 14: 831-835

Burton GW, Gates RN, Gasho GJ (1997) Response of Pensacola bahiagrass to rates of
nitrogen, phosphorus and potassium fertilizers. Soil Crop Sci Soc Florida Proc 56: 31-35

Cannon RJC (2000). Bt transgenic crops: Risks and benefits. PM Rev 5: 151-173

Carman JG (1995) Nutrient absorption and the development and genetic stability of cultured
meristems. In: Current Issues in Plant Molecular and Cellular Biology. Terzi M, Cella R, A
Falavigna, eds, Kluwer Academic Publishers, Dordrecht, Netherlands, pp 393-403

Castle LA, Wu G, McElroy D (2006) Agricultural input traits: Past, present and future. Current
Opin Biotech 17: 105-112

Chambliss CG (2002) Bahiagrass. EDIS SSR-36 Agronomy Department, Cooperative
Extension Service, Institute of Food and Agricultural Sciences, University of Florida,
Gainesville, F1,USA

Chase A (1929) The North American species of Paspalum. Contrib US Natl Herb 28:310

Chen L, Auh Ch-K, Dowling P, Bell J, Chen F, Hopkins A, Dixon RA, Wang Z-Y (2003)
Improved forage digestibility of tall fescue (Festuca arundinacea) by transgenic down-
regulation of cinnamyl alcohol dehydrogenase. Plant Biotechnol J 1: 437-449

Christensen AH, Quail PH (1996) Ubiquitin promoter-based vectors for high-level expression
of selectable and/or screenable marker genes in monocotyledonous plants. Transgenic Res 5:
213-218

Christensen AH, Sharrock RA, Quail PH (1992) Maize polyubiquitin genes: structure, thermal
perturbation of expression and transcript splicing, and promoter activity following transfer to
protoplasts by electroporation. Plant Mol Biol 18: 675-689









Cook BG, Pengelly BC, Brown SD, Donnelly JL, Eagles DA, Franco MA, Hanson J, Mullen
BF, Partridge IJ, Peters M, Schultze-Kraft R (2005) Tropical Forages: An interactive
selection tool. CSIRO, DPI&F(Qld), CIAT and ILRI, Brisbane, Australia (last accused May
6, 2007). http://www.tropicalforages.info

Cunningham PJ, Lee CK, Anderson MW, Rowe JR, Clarke RG, Eagling DR, Villalta O,
Easton HS (1994) Breeding improved perennial ryegrass in Australia. In Proceedings of the
XVII International Grassland Congress 1993, New Zealand (Eds M. J.Baker, J. R. Crush &
L. R. Humphreys), 449- 450. Palmerston North: New Zealand Grassland Association.

Cunningham SM, Volenec JJ (1996) Purification and characterization of vegetative storage
proteins from alfalfa (Medicago sativa L.) taproots. J Plant Physiol 147: 625-632

Cuomo GJ, Blouin DC, Corkern DL, McCoy JE, Walz R (1996) Plant morphology and
forage nutritive value of 3 bahiagrasses as affected by harvest frequency. Agron J 88: 85-89

Daniell H (2006) Production of biopharmaceuticals and vaccines in plants via the chloroplast
genome. Biotechnol J 1: 1071-1079

Daniell H, Dhingra A (2002) Multigene engineering: Dawn of an exciting era in biotechnology.
Curr Op Biotechnol 13: 136-141

Daniell H, Khan MS, Allison LA (2002) Milestones in chloroplast genetic engineering: an
environmentally friendly era in biotechnology. Trends Plant Sci 7: 84-91

Darbani B, Eimanifar A, Stewart CN Jr, Camargo WN (2007) Methods to produce marker-
free transgenic plants. Biotechnol J 2: 83-90

Datta et al 2003 K, Baisakh N, Oliva N, Torrizo L, Abrigo E, Tan J, Rai M, Rehana S, Al-
Babili S, Beyer P, Potrykus I, Datta SK (2003) Bioengineered 'golden' indica rice cultivars
with beta-carotene metabolism in the endosperm with hygromycin and mannose selection
systems. Plant Biotechnol J 1: 81-90

De Maagd RE, Bravo A, Crickmore N (2001) How Bacillus ilhi iugiel'\i\ has evolved specific
toxins to colonize the insect world. Trends Genetics 17: 93-199

Dellaporta SL, Wood J, Hicks JB (1983) A plant DNA minipreparation: version II. Plant Mol
Biol Rep 1: 19-21

DeWald DB, Mason HS, Mullet JE (1992) The soybean vegetative storage proteins VSPa and
VSPP are acid phosphatases active on polyphosphates. J Biol Chem 267: 15958-15964

Dixon L, Nyffenegger T, Delley G, Martinez-Izquierdo J, Hohn T (1986) Evidence for
replicative recombination in Cauliflower Mosaic-Virus. Virology 150: 463-468









Duke JA (1981) Hand book of legumes of world economic importance. Plenum Press, New
York.

Dunwell JM (2000) Transgenic approaches to crop improvement. J Exp Bot 51:487-496

Ellgaard L, Molinari M, Helenius A (1999) Setting the standards: Quality control in the
secretary pathway. Science 256: 1882-1887

Erikson O, Hertzberg M, Nasholm T (2004) A conditional marker gene allowing both positive
and negative selection in plants. Nat Biotechnol 22: 455-458

Evan G, Lewis G, Ramsey G, Bishop JM (1985) Isolation of monoclonal antibodies specific
for human c-myc proto-oncogene product. Mol Cell Biol 5: 3610-3616

Ferre J, Van Rie J (2002) Biochemistry and genetics of insect resistance to Bacillus
/unl i/igiel'ii\ Annu Rev Entomol 47: 501-33

Ferry N, Edwards MG, Gatehouse J, Capell T, Christou P, Gatehouse AMR (2006)
Transgenic plants for insect pest control: a forward looking scientific perspective. Trans Res
15: 13-19

Filipecki M, Malepsky S (2006) Unintended consequences of plant transformation: a molecular
insight. J Applied Genet 47: 277-286

Florida Department of Agriculture and Consumer Services, Division Animal Industry. C. H.
Bronson and T.J. Holt. Overview. 2004-2007 (last accessed May 6, 2007).
http://www.doacs.state.fl.us/ai/

Forbes I, Burton GW (1961a) Induction of tetraploidy and a rapid field method of detecting
induced tetraploidy in 'Pensacola' bahiagrass. Crop Sci 1: 383-384

Franceschi VR, Wittenbach VA, Giaquinta RT (1983a) The paraveinal mesophyll of soybean
leaves in relation to assimilate transfer and compartmentation. III. Immunohistochemical
localization of specific glycopeptides in the vacuole after depodding. Plant Physiol 72: 586-
589

Franceschi VR, Giaquinta RT (1982a) The paraveinal mesophyll of soybean leaves in relation
to assimilate transfer and compartmentation: I. Ultrastructure and histochemistry during
vegetative development. Planta 157: 411-421

Franceschi VR, Giaquinta RT (1982b) The paraveinal mesophyll of soybean leaves in relation
to assimilate transfer and compartmentation: II. Structural, metabolic and compartmental
changes during reproductive growth. Planta 157: 422-431









Franceschi VR, Giaquinta RT (1983b) Specialized cellular arrangements in legume leaves in
relation to assimilate transport and compartmentation: comparison of the paraveinal
mesophyll. Planta 159: 415-422

Fu X, Duc LT, Fontana S, Bong BB, Sudhakar PTD, Twyman RM, Christou P, Kohli A
(2000) Linear transgene constructs lacking vector backbone sequences generate low-copy-
number transgenic plants with simple integration patterns. Transgenic Res 9: 11-19

Fukui K (1983) Sequential occurrence of mutations in a growing rice callus. Theor Appl Genet
65:225-230

Galili G, Sengupta-Gopalan C, Ceriotti A (1998) The endoplasmic reticulum of plant cells and
its role in protein maturation and biogenesis of oil bodies Plant Mol Biol 38: 1277-1284

Galili G, Hofgen R (2002) Metabolic Engineering of Amino Acids and Storage Proteins in
Plants. Met Eng 4: 3-11

Galili S, Guenoune D, Wininger S, Badani H, Schupper A, Ben-Dor B and Kapulnik Y
(2000) Enhanced levels of free and protein-bound threonine in transgenic alfalfa (Medicago
sativa L.): expressing a bacterial feedback-insensitive aspartate kinase gene. Transgenic Res
9: 137-144

Gasteiger E, Gattiker A, Hoogland C, Ivanyi I, Appel RD, Bairoch A (2003) ExPASy: the
proteomics server for in-depth protein knowledge and analysis Nucleic Acids Res 31: 3784-
3788. Updated: January 25, 2007 (last accessed May 6, 2007).http://www.expasy.tools.com

Gates RN (2003) Integration of perennial forages and grazing in sod based crop rotations.
Proceedings of Sod based cropping systems conference, NFREC, University of Florida,
Quincy, February 2003.

Gates RN, Burton GW (1998) Seed yield and seed quality response of 'Pensacola' and
improved bahiagrasses to fertilization. Agron J 90: 607-611

Gates RN, Mislevy P, Martin FG (2001) Herbage accumulation of three bahiagrass populations
during the cool season. Agron J 93: 112-117

Gates RN, Quarin CL, Pedreira CGS (2004) Bahiagrass. In: Moser LE, Burson BL,
Sollenberger LE, eds, Warm season C4 grasses. ASA, CSSA, SSSA Agronomy N 45.

Gay PB, Gillispie SH (2005) Antibiotic resistance markers in genetically modified plants: A risk
to human health? Lancet Infect Dis 5: 637-646

Ge Y, Norton T, Wang Z-Y (2006) Transgenic zoysiagrass (Zoysiajaponica) plants obtained
by Agrobacterium-mediated transformation. Plant Cell Rep 25: 792-798









Gelvin SB (2003) Agrobacterium-mediated plant transformation: the biology behind the "gene-
jockeying" tool. Microbiol Mol Biol Rev 67: 16-37

Giddings G, Allison G, Brooks D, Carter A (2000) Transgenic plants as factories for
biopharmaceuticals. Nat Biotechnol 18: 1151-1155

Goldman JJ, Hanna WW, Fleming G, Ozias-Akins P (2003) Fertile transgenic pearl millet
[Pennisetum glaucum (L.) R. Br.] plants recovered through microprojectile bombardment
and phosphinothricin selection of apical meristem-, inflorescence-, and immature embryo-
derived embryogenic tissues. Plant Cell Rep 21: 999-1009

Gondo T, Tsuruta S, Akashi R, Kawamura O, Hoffmann F (2005) Green, herbicide-resistant
plants by particle inflow gun-mediated gene transfer to diploid bahiagrass (Paspalum
notatum). J Plant Physiol 162: 1367-1375

Grando MF (2001) Genetic transformation approach for improving forage/silage nutritional
value. PhD thesis, University of Florida, Gainesville, US

Grando MF, Shatters JR, Franklin CI (2002) Optimizing embryogenic callus production and
plant regeneration from Tifton 9 bahiagrass (Paspalun notatum Flugge) seed explants for
genetic manipulation. Plant Cell Tiss Organ Cult 71: 213-222

Grando MF, Smith RL, Moreira C, Scully BT, Shatters R (2005) Developmental changes in
abundance of the VSPI protein following nuclear transformation of maize with the soybean
vspB cDNA. BMC Plant Biology 5:3

Grant-Downton RT, Dickinson HG (2005) Epigenetics and its implications for plant biology.
1. The epigenetic network in plants. Ann Bot 96: 1143-1164

Griffitts JS, Aroian RV (2005) Many roads to resistance: How invertebrates adapt to Bt toxins.
BioEssays 27: 614-624

Guenoune D, Amir R, Badani H, Wolf S and Galili S (2002) Combined expression of S-VSPa
in two different organelles enhances its accumulation and total lysine production in leaves of
transgenic tobacco plants. J Exp Bot 53: 1867-1870

Guenoune D, Amir R, Badani H, Wolf S and Galili S (2003) Co-expression of the soybean
vegetative storage protein 0 subunit (S-VSP3) either with the bacterial feedback-insensitive
dihydrodipicolinate synthase or with S-VSPa stabilizes the S-VSPI transgene protein and
enhances lysine production in transgenic tobacco plants. Transgenic Res 12: 123 126

Guenoune D, Amir R, Ben-Dor B, Wolf S and Galili S (1999) A soybean vegetative storage
protein accumulates to high levels in various organs of transgenic tobacco plants. Plant Sci
145: 93-98









Guenoune D, Landau S, Amir R, Badani H, Devash L, Wolf S and Galili S (2002)
Resistance of soybean vegetative storage proteins (S-VSPs) to proteolysis by rumen
microorganisms. J. Agric. Food Chem 50: 2256-2260

Ha SB, Wu FS and Thorne TK (1992) Transgenic turf-type tall fescue (Festuca arundinacea
Schreb.) obtained by direct gene transfer to protoplasts. Plant Cell Rep 11: 601-604

Habben JE, Moro GL, Hunter BG, Hamaker BR and Larkins BA (1995) Elongation factor-
1 l concentration is highly correlated with the lysine content of maize endosperm. Proc Natl
Acad Sci USA 92: 8640-8644

Hansen G, Wright MS (1999) Recent advances in the transformation of plants. Trends Plant Sci
4: 226-231

Heifetz PB (2000) Genetic engineering of the chloroplast. Biochimie 82: 655-666

Hendershot KL, Volenec JJ (1993) Taproot nitrogen accumulation and use in overwintering
alfalfa (Medicago sativa L.). J Plant Physiol 141: 68-74

Hiatt A, Cafferkey R, Bowdish K (1989) Production of antibodies in transgenic plants. Nature
342: 76 78

Hisano H, Kanazawa A, Kawakami A, Yoshida AM, Shimamoto Y, Toshihiko Y (2004)
Transgenic perennial ryegrass plants expressing wheat fructosyltransferase genes accumulate
increased amounts of fructan and acquire increased tolerance on a cellular level to freezing.
Plant Sci 167: 861-868

Horn ME, Woodard SL, Howard JA (2004) Plant molecular farming: Systems and products.
Plant Cell Rep 22: 711-720

Huesing J, English L (2004) The impact of Bt crops on the developing world. AgBioForum 7:
84-95

Iser M, Fettig S, Scheyhing F, Viertel K and Hess D (1999) Genotype-dependent stable
genetic transformation in german spring wheat varieties selected for high regeneration
potential. J Plant Physiol 154: 509-516

James C (2005) Global status of commercialized biotech/GM crops: 2005. ISAAA BRIEFS NO.
34-2005. 2007 (last accessed May 6, 2007). http://www.isaaa.org

Jarvik JW, Telmer CA (1998) Epitope tagging. Ann Rev Genet 32: 601-18

Jauh G-Y, Fishcer AM, Grimes HD, Ryan CA, Rogers JC (1998) 6-Tonoplast intrinsic
protein defines unique plant vacuole functions. PNAS 95 : 12995-12999

Job D (2002) Plant biotechnology in agriculture. Biochimie 84: 1105-1110










Johnson CR, Reiling BA, Mislevy P, Hall MB (2001) Effects of nitrogen fertilization and
harvest date on yield, digestibility, fiber and protein fractions of tropical grasses. J Anim Sci
79:2439-2448

Jorgensen R, Cluster P, English J, Que Q, Napoli C (1996) Chalcone synthase co-suppression
phenotypes in Petunia flowers: comparison of sense vs. antisense and single copu vs.
complex T-DNA sequences. Plant Mol Biol 31: 957-973

Kaeppler SM, Kaeppler HF, Rhee Y (2000) Epigenetic aspects of somaclonal variation in
plants. Plant Mol Biol 43: 179-188

Kaur S (2006) Molecular approaches for identification and construction of novel insecticidal
genes for crop protection. W J Microbiol & Biotech 22: 233-253

Khan MRI, Ceriotti A, Tabe L, Aryan A, McNabb W, Moore A, Craig S, Spencer D,
Higgins TJV (1996) Accumulation of a sulphur-rich seed albumin from sunflower in the
leaves of transgenic subterranean clover (Trifolium subterraneum L.) Trans Res 5: 179-185

Klauer SF, Franceschi VR (1997) Mechanism of transport of vegetative storage proteins to the
vacuole of the paraveinal mesophyll of soybean leaf. Protoplasma 200: 174-185

Klauer SF, Franceschi VR, Ku MSB (1991) Protein compositions of mesophyll and paraveinal
mesophyll of soybean leaves at various developmental stages. Plant Physiol 97: 1306-1316

Klauer SF, Franceschi VR, Ku MSB, Zhang D (1996) Identification and localization of
vegetative storage proteins in legume leaves. Am J Bot 83: 1-10
Kohli A, Twyman RM, Abranches R, Wegel E, Stoger E, Christou P (2003) Transgene
integration, organization and interaction in plants. Plant Mol Biol 52: 247-258

Kusnadi AR, Nikolov ZL, Howard JA, John A (1998) Production of recombinant proteins in
transgenic plants: Practical considerations. Biotechnol Bioeng 56: 473-484

Lacroix B, Li J, Tzfira T, Citovsky V (2006) Will you let me use your nucleus? How
Agrobacterium gets its T-DNA expressed in the host plant cell. Can J Physiol Pharmacol 84:
333-345

Latham JR, Wilson AK, Steinbrecher RA (2006) The mutational consequences of plant
transformation. J Biomed Biotech 25376: 1-7

Leelapon O, Sarath G, Staswick P (2004). A single aminoacid substitution in soybean vspa
increases its acid phosphatase activity nearly 20-fold. Planta 219: 1071-1079

Li L, Qu R (2004) Development of highly regenerable callus lines and biolistic transformation
of turf-type common bermudagrass [ Cynodon dactylon (L.) Pers.]. Plant Cell Rep 22: 403-
407










Littell RC, Milliken GA, Stroup WW, Wolfinger RD (1996) SAS system for mixed models.
SAS Institute, Cary, NC.

Marousky FJ, West SH (1990) Somatic embryogenesis and plant regeneration from cultured
mature caryopses ofbahiagrass (Paspalum notatum Flugge). Plant Cell Tissue Organ Cult
20: 125-129

Mason HS, Guerrero FD, Boyer JS, Mullet JE (1988) Proteins homologous to leaf
glycoproteins are abundant in stems of dark-grown soybean seedlings: analysis of proteins
and cDNAs. Plant Mol Biol 11: 845-856

McBride KE, Svab Z, Schaaf DJ, Hogan PS, Stalker DM, Maliga P (1995) Amplification of
a chimeric Bacillus gene in chloroplasts leads to an extraordinary level of an insecticidal
protein in tobacco. Bio/Technology 13: 362-5

McElroy D,Brettell RIS (1994) Foreign gene expression in transgenic cereals. Trends
Biotechnol 12: 62-68

Mendelsohn M, Kough J, Vaituzis Z, Matthews K (2003). Are Bt crops safe? Nat Biotech 21:
1003-1009

Merchen NR, Titgmeyer EC (1992) Manipulation of amino acid supply to the growing
ruminant. J Anim Sci 70: 3238-3247

Miki B, McHugh S (2004) Selectable marker genes in transgenic plants: Applications,
alternatives and biosafety. J Biotechnol 107: 193-232
Mislevy P, Burton GW, Busey P (1990) Bahiagrass response to grazing frequency. Soil Crop
Sci Fl Proc 50: 58-64.

Moser LE (2004). Warm season C4 grasses overview. In: Moser LE, Burson BL and LE
Sollenberger, eds, Warm season C4 grasses. ASA, CSSA, SSSA Agronomy N 45.

Munro S, Pelham HRB (1987) A C-terminal signal prevents secretion of luminal ER proteins.
Cell 48: 899-907

Muntz K (1998) Deposition of storage proteins. Plant Mol Biol 38: 77-99

Murashige T, Skoog F (1962) A revised medium for rapid growth and bio-assays with tobacco
tissue cultures. Physiol Plant 15: 473-497

Murphy KA, Kuhle RA, Fischer AM, Anterola AM, Grimes HD (2005) The functional status
of paraveinal mesophyll vacuoles changes in response to altered metabolic conditions in
soybean leaves. Funct Plant Biol 32: 335-344









Murray MG, Thompson WF (1980) Rapid isolation of high molecular weight plant DNA.
Nucleic Acids Res 8: 4321-4325

Nagoshi RN, Meagher RL (2004) Behaviour and distribution of the two fall armyworm host
strains in Florida. Fl Entomol 87: 440-449
Napoli C, Lemieux C, Jorgensen R (1990) Introduction of the chalcone synthase gene into
Petunia results in reversible co-suppression of homologous genes in trans. Plant Cell 2: 279-
289

National Research Council (1989) Nutrient requirement of dairy cattle. 6th rev. Eds Natl Acad
Sci, Washington, DC.

Neuhaus J-M, Rogers JC (1998) Sorting of proteins to vacuoles in plant cells. Plant Mol Biol
38: 127-144

Newell CA (2000) Plant transformation technology: Developments and applications. Mol
Biotechnol 16:

O'Kennedy MM, Burger JT, Botha FC (2004) Pearl millet transformation system using the
positive selectable marker gene phosphor-mannose isomerase. Plant Cell Rep 22: 684-690

Odell JT, Nagy F, Chua NH (1985) Identification of DNA-sequences required for activity of
the cauliflower mosaic virus-35S promoter. Nature 313: 810-812

Pagny S, Cabanes-Macheteau M, Gillikin JW, Leborgne-Castel N, Lerouge P, Boston RS,
Faye L, Gomord V (2000) Protein recycling from the Golgi apparatus to the endoplasmic
reticulum in plants and its minor contribution to calreticulin retention. Plant Cell 12: 355-739

Park J, Lee YK, Kang BK, Chung WI (2004) Co-transformation using a negative selectable
marker gene for the production of selectable marker gene-free transgenic plants. Theor Appl
Genet 109: 1562-1567

Pelham HR (1990) The retention signal for soluble proteins of the endoplasmic reticulum.

Popelka JC, Xu J, Altpeter F (2003) Generation of rye (Secale cereale L.) plants with low
transgene copy number after biolistic gene transfer and production of instantly marker-free
transgenic rye. Transgenic Res 12: 587-596

Ramirez N, Rodrlguez M, Ayala M, Cremata J, Perez M, Martinez A, Linares M, Hevia Y,
Paez R, Valdes R, Gavilondo JV, Selman-Housein G (2003) Expression and
characterization of an anti-(hepatitis B surface antigen) glycosylated mouse antibody in
transgenic tobacco (Nicotiana tabacum) plants and its use in the immunopurification of its
target antigen. Biotechnol Appl Biochem 38: 223-230

Ranjekar PK, Patankar A, Gupta V, Bhatnagar R, Bentur J, Kumar PA (2003) Genetic
engineering of crop plants for insect resistance. Curr Sci 84: 321-329










Rapp WD, Lilley GG, Nielsen NC (1991). Characterization of soybean vegetative storage
protein and genes. Theor Appl Genet 79: 785-792

Rasco-Gaunt S, Riley A, Barcelo P and Lazzeri PA (1999) Analysis of particle bombardment
parameters to optimise DNA delivery into wheat tissues. Plant Cell Rep 19: 118-127

Richter LJ, Thanavala J, Arntzen CJ, Mason HS (2000) Production of hepatitis B surface
antigen in transgenic plants for oral immunization. Nature Biotech 18: 1167-1171

Rochester DE, Winer JA, Shah DM (1986) The structure and expression of maize genes
encoding the major heat shock protein, hsp70. EMBO J 5: 451-458

Romano A, Raemakers K, Bernardi J, Visser R, Mooibroek H (2003) Transgene
organization in potato after particle bombardment-mediated co-transformation using
plasmids and gene cassettes. Transgenic Res 12: 461-473

Rulquin H, Verite R (1993) Amino acid nutrition and dairy cows: Productive effects and animal
requirements. In: PC Garnsworthy, DJA Cole, eds, Recent Advances in Animal Nutrition,
Nottingham University Press, Loughborough, UK p55-77

Saalbach I (1994) The sulfur-rich Brazil nut 2S albumin is specifically formed in transgenic
seeds of the rain legume Vicia narnonensis. Euphytica 85: 181-192

Sambrook J, Russell DW (2001) Molecular cloning a laboratory manual. Cold Spring Harbor,
NY. Cold Spring Harbor Laboratory Press.

Sandhu S, Altpeter F, Blount AR (2007) Apomictic turf and forage grass (Paspalum notatum
Flugge) expressing the bar gene is highly resistant to glufosinate under field conditions. Crop
Sci in press.

SAS Institute (2002) Propietary Software Release 9.0, Cary, NC.

Schnepf E, Crickmore N, Van Rie J, Lereclus D, Baum J, Feitelson J, Zeigler DR, Dean DH
(1998) Bacillus thuringiensis and its pesticidal crystal proteins. Microbiol Mol Biol Rev 62:
775-806

Schouten A, Roosien J, von Engelen FA, De Jong GA, Borst-Vressen AW, Zilverentant JF
(1996) The C-terminal KDEL sequence increases the expression level of a single-chain
antibody designed to be targeted to both the cytosol and the secretary pathway. Plant Mol
Biol

Schubert D, Lechtenberg B, Forsbach A, Gils M, Bahadur S, Schmidt R (2004) Silencing in
Arabidopsis T-DNA transformants: The predominant role of a gene-specific DNA sensing
mechanism versus position effects. Plant Cell 16: 2561-2572









Shatters RG, Wheeler RA, West SH (1994) Somatic embryogenesis and plant regeneration
from callus culture of'Tifton 9' bahiagrass. Crop Sci 34:1378-1384

Sivamani E, Bahieldin A, Wraith JM, Al-Niemi T, Dyer WE, Ho TDH and Qu R (2000)
Improved biomass productivity and water use efficiency under water deficit conditions in
transgenic wheat constitutively expressing the barley HVA1 gene. Plant Sci 155: 1-9

Smith RL, Grando MF, Li YY, Seib JC, Shatters RG (2002) Transformation of bahiagrass
(Paspalum notatum Flugge). Plant Cell Rep 20: 1017-1021

Southgate E, Davey M, Power J, Marchant R (1995) Factors affecting the genetic engineering
of plants by microparticle bombardment. Biotechnol Adv 13: 631-651

Spagenberg G, Wang ZY, Wu XL, Nagel J and Potrykus I (1995) Transgenic perennial
ryegrass (Lolium perenne) plants from microproj ectile bombardment of embryogenic
suspension cells. Plant Sci 108: 209-217

Spangenberg GG, Wang ZY, Nagel J, Iglesias VA, Potrykus I (1995) Transgenic tall fescue
(Festuca arundinacea) and red fescue (F. rubra) plants from microprojectile bombardment
of embryogenic suspension cells. J Plant Physiol 145: 693-701

Sparks AN (1979) A review of the biology of the fall armyworm. Fl Entomol 62: 82-87

Sreekala C, Wu L, Gu K, Wang D, Tian D, Yin Z (2005) Excision of a selectable marker in
transgenic rice (Oryza sativa L.) using a chemically regulated Cre/loxP system. Plant Cell
Rep 24: 86-94
Staswick PE (1988) Soybean vegetative storage protein structure and gene expression. Plant
Physiol 87: 250-254

Staswick PE (1989) Developmental regulation and the influence of plant sinks on vegetative
storage protein expression in soybean leaves. Plant Physiol 89: 309-315

Staswick PE (1994) Storage proteins of vegetative plant tissues. Annu Rev Plant Physiol Plant
Mol Biol 45:303-322

Staswick PE (1997) The occurrence and gene expression of vegetative storage proteins and a
Rubisco complex protein in several perennial soybean species. J Exp Bot 48: 2031-2036

Staswick PE, Huang J, Rhee Y (1991) Nitrogen and methyl jasmonate induction of soybean
vegetative storage protein genes. Plant Physiol 96: 130-136

Stewart RL Jr (2006) Management intensity effects on animal performance and herbage
response in bahiagrass pastures. PhD thesis, University of Florida, Gainesville, US









Stewart RL Jr, Sollenberger LE, Dubeux JCB Jr, Vendramini JMB, Interrante SM,
Newman YC (2007) Herbage and animal responses to management intensity of continuously
stocked bahiagrass pastures. Agron J 99: 107-112

Stoger E, Vaquero C, Torres E, Sack M, Nicholson L, Drossard J, Williams S, Keen D,
Perrin Y, Christou P and Fischer R (2000). Cereal crops as viable production and storage
systems for pharmaceutical scFv antibodies. Plant Mol Biol 42: 583-590

Sun SS, Liu Q (2004) Transgenic approaches to improve the nutritional quality of plant proteins.
In Vitro Cell Dev Biol Plant 40: 155-162

Tabashnik BE, Liu YB, Finson N, Masson L, Heckel DG (1997) One gene in diamondback
moth confers resistance to four Bacillus thuringiensis toxins. PNAS 94: 1640-1644

Tabashnik BE, Roush RT, Earle ED, Shelton AM (2000) Resistance to Bt toxins. Science
287: 42.

Tabe L, Higgins TJV (1998) Engineering plant protein composition for improved nutrition.
Trends Plant Sci 3: 282-286

Tabe LM, Wardley-Richardson T, Ceriotti A, Aryan A, McNabb W, Moore A and Higgins
TJV (1995) A biotechnological approach to improve the nutritive value of alfalfa. J Anim
Sci 73:2752-2759

Takumi S, and Shimada T (1996) Production of trangenic wheat through particle bombardment
of scutellar tissue: frequency is influenced by culture duration. J Plant Physiol 149: 418-423

Taylor NJ, Fauquet CM (2002) Microparticle bombardment as a tool in plant science and
agricultural biotechnology. DNA Cell Biol 21: 963-977

Teasdale RD, Jackson MR (1996) Signal-mediated sorting of membrane proteins between the
endoplasmic reticulum and the golgi apparatus. Ann Rev Cell Dev Biol 12: 27-54

Toki S, Hara N, Ono K, Onodera H, Tagiri A, Oka S, Tanaka H (2006) Early infection of
scutellum tissue with Agrobacterium allows high-speed transformation of rice. The Plant J
47:969-976

Tranbarger TJ, Franceschi VR, Hildebrand DF, Grimes HD (1991) The soybean 94-
kilodalton vegetative storage protein is a lipoxygenase that is localized in paraveinal
mesophyll cell vacuoles Plant Cell 3: 973-987

Tzfira T, Citovsky V (2006) Agrobacterium-mediated transformation of plants: Biology and
biotechnology. Curr Op Biotechnol 17: 147-154









Ulyatt, MJ, Thomson DJ, Beever DE, Evans RT, Haines MJ (1988) The digestion of
perennial ryegrass (Lolium perenne cv. Melle) and white clover (Trifolium repens cv.
Blanca) by grazing cattle. Brit J Nutr 60: 137-149

US EPA (2001) Biopesticide Registration Action Document: Bacillus /hin iuigie'/l\i CrylF
Corn.Office of Pesticide Programs, Biopesticides and Pollution Prevention Division. Updated
August, 2005 (last accessed May 6, 2007).
http://www.epa.gov/pesticides/biopesticides/ingredients/techdocs/brad006481 .pdf

USDA-NRCS (2007) Paspalum notatum Fluegge, bahiagrass.The PLANTS Database. National
Plant Data Center (last accesesd May 6, 2007). http://plants.usda.gov

Varshney A, Altpeter F (2002) Stable transformation- and tissue culture response in current
European winter wheat (Triticum aestivum L.) germplasm. Mol Breeding 8: 295-309

Vitale A, Raikhel N (1999) What do proteins need to reach different vacuoles? Trends Plant Sci
4: 149-155

Wandelt CI, Khan MRI, Craig S, Achroeder HE, Spencer D, Higgins TJV (1992) Vicilin
with carboxy terminal KDEL is retained in the endoplasmic reticulum and accumulates to
high levels in the leaves of transgenic plants. The Plant Journal 2:181-192

Wang Z, Hopkins A, Mian R (2001) Forage and turf grass biotechnology. Crit Rev Plant Sci
20: 573-619

Wang Z-Y, Ge Y (2006) Recent advances in genetic transformation of forage and turfgrasses. In
Vitro Cell Dev Biol Plant 42: 1-18

Wang ZY, Ye XD, Nagel J, Potrykus I, Spangenberg GG (2001) Expression of a sulphur-rich
sunflower albumin gene in transgenic tall fescue (Festuca arundinacea Schreb.) plants. Plant
Cell Rep 20: 213-219

Wiatrak PJ, Wright DL, Morais JJ, Sprenkel R (2004) Corn hybrids for late planting in the
southeast. Agron J 96: 1118-1124

Wilkins PW, Humphreys MO (2003) Progress in breeding perennial forage grasses for
temperate agriculture. J Agric Sci 140: 129-150

Williams WP, Sagers JB, Hanten JA, Davis FM, Buckley PM (1997) Transgenic corn
evaluated for resistance to fall armyworm and southweatern corn borer. Crop Sci 37: 957-
962

Wittenbach VA (1983) Purification and characterization of a soybean leaf storage glycoprotein.
Plant Physiol 73: 125-129









Wright D, Marois J, Katsvairo T, Wiatrak P, Rich J (2005) Sod based rotations- The next
step after conservation tillage. South Cons Tillage Sys Conference, Clemson University, SC.

Wu H, Sparks C, Amoah B, Jones HD (2003) Factors influencing successful Agrobacterium-
mediated transformation of wheat. Plant Cell Rep 21: 659-668

Yamamoto K, Fujii R, Toyofuku Y, Saito T, Koseki H, Hsu VW, Aoe T (2001) The KDEL
receptor mediates a retrieval mechanism that contributes to quality control at the endoplasmic
reticulum. EMBO J 20: 3082-3091

Ye XD, Al-Babili S, Kloti A, Zhang J, Lucca P, Beyer P, Potrykus I (2000) Engineering the
provitamin A (1-carotene) biosynthetic pathway into (carotenoid-free) rice endosperm.
Science 287: 303-305

Zhang G, Lu S, Chen TA, Funk CR, Meyer WA (2003) Transformation of triploid
bermudagrass (Cynodon dactylon x C. transvaalensis cv. TifEagle) by means of biolistic
bombardment. Plant Cell Reports 21: 860-864

Zhang W, Subbarao S, Addae P, Shen A, Armstrong C, Peschke V, Gilbertson L (2003)
Cre/lox-mediated marker gene excision in transgenic maize (Zea mays L.) plants. Theor Appl
Genet 107: 1157-1168

Zhu B, Coleman GD (2001) The poplar bark storage protein gene (Bspa) promoter is responsive
to photoperiod and nitrogen in transgenic poplar and active in floral tissues, immature seeds
and germinating seeds of trasngenic tobacco. Plant Mol Biol 46: 383-394









BIOGRAPHICAL SKETCH

Gabriela Fabiana Luciani, the oldest daughter of Beatriz Marta Tica de Luciani and

Alberto Daniel Luciani, was born in Bahia Blanca, Buenos Aires Province, Argentina, on

October 7, 1968. In 1986, Gabriela started her college studies in biology, oriented to ecology, at

the Facultad de Ciencias Naturales y Museo, Universidad Nacional de La Plata, La Plata; where

she received her degree in biology in 1993. During this time, she was actively involved in the

academic life as a teaching assistant in different classes.

In 1996, she was hired by Comision de Investigaciones Cientificas (CIC), to develop tissue

culture techniques to improve garlic micropropagation. In 1997, she was hired by Comision

Nacional de Investigaciones Cientificas y Tecnologicas (CONICET), to continue her studies

focused on eliminating a viral complex during garlic tissue culture. After a car accident and more

than a year in rehabilitation, and encouraged by her supervisor, Dr. Nestor Curvetto, she was

admitted to pursue a M. Sc. degree in agronomy at the Facultad de Agronomia, Universidad

Nacional del Sur, Bahia Blanca, in 1999. Encouraged by friends, she applied for a Fulbright-

LASPAU fellowship to pursue her Ph. D. program in the United States. She received her M. Sc.

degree in Agronomy in 2001, and moved immediately to Gainesville, to begin her program at the

Agronomy Department, University of Florida.





PAGE 1

1 GENETIC ENGINEERING TO IMPROVE NUTRITIONAL QUALITY AND PEST RESISTANCE IN BAHIAGRASS ( Paspalum notatum VAR. FLUGGE) By GABRIELA FABI ANA LUCIANI A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2007

PAGE 2

2 2007 Gabriela Fabiana Luciani

PAGE 3

3 To my family and friends To McNair, Carmen and Luca

PAGE 4

4 ACKNOWLEDGMENTS I would like to acknowledge Fu lbright LASPAU-Argentina and University of Florida for supporting this Ph.D. program. I also would lik e to thank Universidad Nacional del Sur and CONICET for providing the trai ning and economical support that allowed me to pursue this program. I am deeply grateful to my chair, Dr. David Wofford and my cochair Dr. Fredy Altpeter for their guidance and assistance during the deve lopment of the program. I would like to acknowledge the members of my committee: Dr. Ke n Boote, Dr. Rex Smith and Dr. Paul Lyrene for their valuable discussions a nd contributions to this project. Special thanks are extended to Dr.Robert Shatters and Dr. Robert M eagher for their unconditional support. Also, I would like to thank the people from our laboratory including research associates, graduate students and technicians. I thank Dr. Walid Fouad, Dr. Hangning Zhang, and Dr. Xi Xiong for their contributions in the discussion of this research project. Special thanks to Dr. Victoria James for her technica l training and friendly support and to Loan Ngo, Jeff Seib and Charly for their assistance in the work at the laboratory. I thank my fellow graduate students Mrinalini Agharkar, Sukhpreet Sandhu, Isaac Neibau r, Paula Lomba and Jose Celedon for their friendship and support during the difficult times of this journey. My thanks are also extended to graduate students: Miriam, Raquel, Laura, Jo rge and Carlos for shar ing very Argentinean moments. I thank my parents, Betty and Alberto; my younger brother, Guillermo; my older brother and his family, specially my nephew and niece, Gonzalo and Maria Paz; and my grandmother, Teresa; for being so supportive and stay ing so close during the difficult times.

PAGE 5

5 Finally, I would like to thank all my amazing fr iends: Veronica, Belkys, Salvador, Claudia, Carlos and Federico, for their continuous suppor t and encouragement. I thank McNair, Carmen and Luca for helping me to be a better human being.

PAGE 6

6 TABLE OF CONTENTS page ACKNOWLEDGMENTS...............................................................................................................4 LIST OF FIGURES................................................................................................................ .........9 ABSTRACT....................................................................................................................... ............10 CHAPTER 1 INTRODUCTION..................................................................................................................12 Bahiagrass ( Paspalum notatum var.Flugge)...........................................................................12 Genetic Engineering for Crop Improvement..........................................................................12 Genetic Engineering to Improve Nutriti onal Quality: Vegetative Storage Proteins..............13 Genetic Engineering to Enhance Insect Resistance: Bacillus thuringiensis Toxins...............14 Objectives..................................................................................................................... ..........16 2 LITERATURE REVIEW.......................................................................................................18 Bahiagrass ( Paspalum notatum var. Flugge)..........................................................................18 General Description.........................................................................................................18 Role of Bahiagrass as Subtropical Grass in Southeast United States..............................19 Traditional Breeding of Grasses......................................................................................21 Genetic Engineering in Plants................................................................................................23 Plant Transformation.......................................................................................................23 Tissue Culture Protocols..................................................................................................23 Transformation Methods.................................................................................................25 Particle Bombardment Method........................................................................................27 Selectable Markers and Selection Protocols....................................................................29 Transgene Integration and Expression Patterns..............................................................31 Future Prospects..............................................................................................................32 Tissue culture...........................................................................................................32 Agrobacterium -mediated transformation.................................................................33 Particle bombardment transformation......................................................................34 Selectable markers....................................................................................................35 New strategies: Multigene engineering, chloroplast engineering and SM-free plants.....................................................................................................................36 Genetic Engineering for Crop Improvement..........................................................................38 Genetic Engineering to Improve Nutritional Quality......................................................39 Vegetative Storage Proteins (VSPs)................................................................................40 General characteristics.............................................................................................40 Genes and polypeptides............................................................................................41 Trafficking pathway.................................................................................................43 Overexpression of vspB Gene to Improve Nutritional Quality in Bahiagrass.................45 Genetic Engineering to Enhance Pest Resistance...........................................................47

PAGE 7

7 Development of Bt crops..........................................................................................47 Bacillus thuringiensis toxins....................................................................................48 Strategies to increase cry genes expression levels...................................................49 Expression of cry1F Gene to Enhance Insect Resistance in Bahiagrass.........................50 3 OVEREXPRESSION OF THE vspB GENE FROM SOYBEAN TO ENHANCE NUTRITIONAL QUALITY IN BAHIAGRASS ( Paspalum notatum VAR. FLUGGE)......55 Introduction................................................................................................................... ..........55 Materials and Methods.......................................................................................................... .58 Soybean vspB Gene.........................................................................................................58 Construction of Expression Vectors for the vspB Gene..................................................58 Other Expression Vectors and Cassettes.........................................................................62 Transformation and Regeneration Protocols...................................................................63 Molecular Studies............................................................................................................63 Enzyme linked-immunoadsorbent assays (ELISA).................................................63 Polymerase chain reaction (PCR)............................................................................64 Sodium dodecyl sulphate polyacrilamide gels (SDS-PAGE)..................................65 Western blot analysis...............................................................................................65 Co-immunoprecipitation of recombinant VSP .......................................................66 Results........................................................................................................................ .............67 Transformation and Regeneration Protocols...................................................................67 Molecular Studies............................................................................................................67 Enzyme linked-immunoadsorbent assays................................................................67 Polymerase chain reaction........................................................................................67 Sodium dodecyl sulphate polyacrilamide gels.........................................................68 Western blot analysis...............................................................................................68 Co-immunoprecipitation of recombinant VSP .......................................................69 Discussion..................................................................................................................... ..........69 4 EXPRESSION OF A SYNTHETIC cry1F GENE FROM Bacillus thuringiensis TO ENHANCE RESISTANCE AGAINST FA LL ARMYWORM IN BAHIAGRASS ( Paspalum notatum VAR. FLUGGE)....................................................................................80 Introduction................................................................................................................... ..........80 Materials and Methods.......................................................................................................... .83 Minimal Transgene Expression Constructs.....................................................................83 Tissue Culture, Transformation and Regeneration of Bahiagrass...................................83 Polymerase Chain Reaction, Reverse Transc riptase Polymerase Chain Reaction and Southern Blot Analysis................................................................................................85 Immunological Assays....................................................................................................86 Insect Bioassays...............................................................................................................86 Results........................................................................................................................ .............87 Generation of Transgenic Bahiagrass Lines....................................................................87 Polymerase Chain Reaction, Reverse Transc riptase Polymerase Chain Reaction and Southern Blot Analysis................................................................................................87 Immunological Assays....................................................................................................88

PAGE 8

8 Insect Bioassays...............................................................................................................89 Discussion..................................................................................................................... ..........89 5 SUMMARY AND CONCLUSIONS.....................................................................................99 Overexpression of the vspB Gene to Improve Nutritional Quality in Bahiagrass..................99 Expression of the cry1F Gene to Enhance Pest Re sistance in Bahiagrass...........................100 APPENDIX: LABORATORY PROTOCOLS............................................................................103 Protocols for Molecular Cloning..........................................................................................103 Protocols for Bahiagrass Tran sformation and Regeneration................................................109 Protocols for Molecular Techniques.....................................................................................110 Protocol for Insect Bioassays................................................................................................122 Buffers and Reagents........................................................................................................... .122 LIST OF REFERENCES.............................................................................................................126 BIOGRAPHICAL SKETCH.......................................................................................................143

PAGE 9

9 LIST OF FIGURES Figure page 2-1 Bahiagrass ( Paspalum notatum var. Flugge).....................................................................52 2-2 Transgenic crops under field trials and deregulation process in the United States...........53 3-1 The complete coding sequence of the vspB gene...............................................................72 3-2 Cloning strategy fo r incorporating the vspB sequence into the vector pGL4....................73 3-3 Minimal constructs used in the biolistic experiments to genera te transgenic lines from bahiagrass ( Paspalum notatum var. Flugge) cv. Argentine...................................74 3-4 Transformation and regenerati on protocols for bahiagrass ( Paspalum notatum var. Flugge) cv. Argentine.....................................................................................................75 3-5 Transgenic plants from bahiagrass ( Paspalum notatum var. Flugge) cv. Argentine.....76 3-6 SDS-PAGE gels for soybean a nd transgenic bahiagrass plants.........................................77 3-7 SDS-PAGE and Western blot s from transgenic bahiagrass ( Paspalum notatum var. Flugge) cv. Argentine.....................................................................................................78 3-8 Co-immunoprecipitation of recombinant VSP from transgenic bahiagrass ( Paspalum notatum Flugge) cv. Argentine....................................................................79 4-1 The synthetic coding sequence of the cry1F gene.............................................................93 4-2 Transgenic plants obtained from bahiagrass ( Paspalum notatum var. Flugge) cv. Tifton 9..................................................................................................................... ......94 4-3 Molecular analyses of transgenic bahiagrass lines from cv. Tifton 9............................95 4-4 Molecular analyses of transgenic bahiagrass lines from cv. Argentine.........................96 4-5 Levels of expression in l eaves of transgenic bahiagrass lines. from cv. Tifton 9..........97 4-6 Insect bioassays with fall armyworm la rvae feeding on leaves from bahiagrass cv. Tifton 9 at 5 days after feeding......................................................................................98

PAGE 10

10 Abstract of Dissertation Pres ented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy GENETIC ENGINEERING TO IMPROVE NUTRITIONAL QUALITY AND PEST RESISTANCE IN BAHIAGRASS ( Paspalum notatum VAR. FLUGGE) By Gabriela Fabiana Luciani August 2007 Chair: David Scott Wofford Cochair: Fredy Altpeter Major: Agronomy Bahiagrass ( Paspalum notatum var. Flugge) is the predominant grass in forage pastures in tropical and subtropical regions wo rldwide. It supports th e beef and dairy cattl e industries in the state of Florida. To improve forage producti on and animal performance, the low nutritional quality and the insect pest susceptibility of this subtropical grass should be addressed. To improve nutritional quality, the vspB gene encoding a soybean VSP that is a lysine-enriched and rumen proteolysis-re sistant protein seems to be a prom ising candidate. To improve insect pest resistance, the cry1F gene encoding a -endotoxin from Bacillus thuringiensis that provides protection against Lepidopteran pests in commercial crops such as cotton and corn seems to be a suitable candidate. Our objectiv es were: to overexpress the vspB gene for improving nutritional in bahiagrass cv. Argentine, and to express a synthetic cry1F gene for enhancing resistance against fall armyworm in bahiagrass cvs. A rgentine and Tifton 9. To overexpress the vspB gene, we cloned an expression ve ctor containing a cons titutive and strongly expressed promoter for monocots; a KDEL signal for ER-retention and a c-myc tag for antibody detection. We cobombarded mature seed-derived calli from bahi agrass cv. Argentine with minimal constructs containing the vspB gene from pGL4 and pRSVP1 vectors and the nptII gene as selectable

PAGE 11

11 marker from pJFNPTII vector. Followi ng previous reports, we generated 91 nptII (+) plants from 110 analyzed plants. Based on the results from nptII expression detected by ELISA and VSP expression detected by western blots, 89% of the plants coexpressed the nptII and the vspB genes. Western blot analyses indicated that VSP expression levels varied among plants, tillers within plants and leaves within tillers. This is the first report on expression of the vspB gene in bahiagrass cv. Argentine. The VSP expression levels observed in transgenic bahiagrass plants were low and similar to those previously reported in transgenic corn plants. Potentially, these VSP expression levels could be enhan ced by coexpressing recombinant VSP and VSP subunits, and/or by targeting the su bunit to different cell compartm ents in transgenic bahiagrass plants. To express the synthetic cry1F gene, we co-bombarded mature seed-derived calli from bahiagrass with minimal constr ucts containing the synthetic cry1F gene from pHZCRY vector and the nptII gene as selectable marker from pHZ 35SNPTII vector. Based on previous reports, we regenerated three paromomycin -resistant plants from bahiagra ss cvs. Argentine and Tifton 9. PCR and southern blots an alyses indicated independent tr ansgene integration, and RT-PCR analyses confirmed cry1F expression in all transgenic bahiagrass lines. Two immunoassays for cry1F gene expression indicated det ectable cry1F levels in two ba hiagrass lines from cv. Tifton 9. Cry1F expression levels correl ated well to resistance levels determined by insect bioassays. An average mortality rate of 83 % was observe d when fall armyworm neonates were fed with transgenic leaves of the highest cry1F expressi ng line. These results i ndicated that high and stable cry1F expression levels can control fall armywo rm in transgenic bahiagrass plants. The expression of the cry1F gene in plants of cv. Tifton 9 enhanced the resistance against fall armyworm in insect bioassays indicating that these transgenic lines seem to be suitable candidates for field studies.

PAGE 12

12 CHAPTER 1 INTRODUCTION Bahiagrass ( Paspalum notatum var.Flugge) Bahiagrass ( Paspalum notatum Flugge) is a perennial, warm-season grass widely grown in southern United States and other tropical and subtropical regions of the world. Also, it is one of the most important forage grasses for supporting beef and dairy cattle in dustries in Florida and other southeastern states such as Georgia, Alabama and over the Gulf Coastal Plain (Chambliss, 2002). Bahiagrass low management requirements and good yield under biotic stresses such as heavy grazing or frequent harvests and abiotic stresses such as drought and poor soils, make it the preferred forage grass by b eef cattle producers in Florida (S mith et al., 2002; Chambliss, 2002; Blount et al., 2001). The main cultivars grown in Florida are sexual diploids such as Pensacola and Tifton 9, and apomictic tetraploids such as Argentine. The cultivar Argentine is a wide-leaf, coldsusceptible and late-flowering cultivar mainly grown in South Florida for landscaping. It is commonly used as a turf grass in home lawns a nd along highways. The cultivar Tifton-9 is a narrow-leaf, and early-flowering cultivar, which is less cold-susceptible than cv. Argentine; and it is used as forage grass in the Panhandle region (Chambliss, 2002). Genetic Engineering for Crop Improvement Currently, genetic engineering combined w ith plant breeding programs has become a common and efficient tool for crop improvement. It is used not only for gene function and expression studies but also for a wide range of applications in plant breeding programs mostly focused in generating new cultivars with hi gher yields (Hansen and Wright, 1999). These biotechnological applica tions are mostly related to agri culture, industry an d human health (Newell, 2000). In agriculture, genetic engineer ing studies have been used to improve from

PAGE 13

13 simple agronomic traits such as herbicide, in sect, disease and nematode resistance to more complex traits such as stress tolerance for improving crop yield (Dunw ell, 2000; Newell, 2000; Bhalla, 2006). Pesticide-resistant crops are a re markable example where these products resulted in economic and environmental benefits includi ng higher crop yields, reduced economic losses and no adverse effects on the environment (C annon, 2000). Also, genetic engineering has been used to improve nutritional quality of field cr ops or to produce biopharmaceutical products such as antibodies, vaccines or human therapeutic proteins (Newell, 2000; Horn et al., 2004). Nutritional deficiencies in an imal and human diets could be compensated by improving lysine and threonine levels in cereals, methionine in legumes and vitamins A and E in crucifers and rice. These genetic improvements would have a strong impact since these crops represent the staple food for one-third of the world population (Job, 2002). Genetic Engineering to Improve Nutritiona l Quality: Vegetative Storage Proteins To improve nutritional quality, several molecu lar approaches were developed (Tabe and Higgins, 1998; Galili and Ho efgen, 2002; Sun and Liu, 2004). These approaches include: developing synthetic proteins, optimizing protein sequence, ov erexpressing proteins or regulating the free aminoacid pool or the si nk demand (Sun and Liu, 2004). Two alternative strategies successfully enhanced nutritional quality of cr ops: to increase the free essential aminoacid pools or to increase th e enriched-protein pools in the transgenic plants. The first strategy includes increasing the levels of free aminoacid pools by upregulating or downregulating the expression levels of thos e enzymes involved in aminoacid biosynthesis and/or degradation respectively. An enhanced production of free essentia l aminoacids may lead to an increase of total protein content and protei n quality in plants (Gal ili et al., 2000; Habben et al., 1995). The second strategy incl udes increasing the levels of essential aminoacids-enriched proteins, mostly by overexpressing seed storage pr oteins (SSPs) or vege tative storage proteins

PAGE 14

14 (VSPs). Early reports indicated that SSPs were efficiently degraded in vegetative tissues (Saalbach et al., 1994). Therefore, to prevent protein degradation two approaches were followed: to target the transgenic proteins to cell compar tments avoiding cytoplasmic degradation (Khan et al., 1996; Tabe et al., 1995) or to use VSPs that were naturally accumulated in vegetative tissues. These storage proteins include pl ant proteins such as patatin fr om potato, sporamin from sweet potato, VSPs and lipoxygenase from soybean, crown storage proteins from alfalfa and lectin-like proteins from the bark of certain deciduous trees (Staswick, 1994; C unningham and Volenec, 1996). VSPs seem to be promising candidates for in creasing protein content and quality because they are naturally accumulated in vegetative tissues. VSPand VSP, reached 15% of the total soluble proteins in soybean paraveinal ti ssue (Grando et al., 2005) and high levels were associated with shoot regrowth after cutting a nd deppoding in soybean plants (Wittenbach et al., 1983).VSPand VSPare polypeptides with 27-28 a nd 29-31 kD of molecular weight respectively. These glycoproteins share 80% aminoacid homology, have ERand vacuolar targeting signals, form homoor hetero-dimers when they are assembled, and have 7% lysine content (Mason et al., 1988; St aswick et al., 1988, 1989a, 1994). Genetic Engineering to Enhance Insect Resistance: Bacillus thuringiensis Toxins To improve insect resistance, most integrated pest management stra tegies involved the use of pesticides. The indiscriminate use of pesticides produces adverse effects on human health and the environment including the development of in sect resistance and the elimination of other beneficial insects (Ranjekar et al., 2003; Ferry et al., 2006) To overcome these problems, environmentally-friendly pesticides containing Bt ( Bacillus thuringiensis ) spores and crystals were developed. But these spray formulations were only partially effectiv e because they did not reach burrowing insects and did not persist long enough in the environment. Therefore, Bt

PAGE 15

15 transgenic crops expressing -endotoxins were developed (Sc hnepf et al., 1998; Kaur, 2006). Currently, this technology is adopted worldwide resulting in 14 million hectares covered with Bt crops (James, 2005). In the USA, Bt crops represent almost 20% of the total cropping area and their use is directly linked to higher yields and profits in corn and cotton (Cannon, 2000). These cry -encoded -endotoxins are classified in four groups providing protection against four insect orders: cry1 (Lepi doptera), cry2 (Lepidoptera and Dipt era), cry3 (Coleoptera) and cry4 (Diptera) (de Maagd et al., 2001; Ferre and Van Rie, 2002; Gr iffits and Aroian, 2005). First, these crystal protoxins are sol ubilized and proteolitic ally activated in the insect midgut and second, the active toxins bind to sp ecific receptors in the intestine epithelial cells leading to pore formation and cell death. The active toxins have a conserved structure formed by three domains and domains II and III determine host specificity because they have very high affinity to receptors located in the gut epithelium of differ ent insect orders (Schenpf et al., 1998; Ranjekar et al., 2003; Abanti, 2004; de Maagd et al., 2001). Based on laboratory studies on field-selected strains, the potential of resistance development exists in insect populations; however, only one case of field-developed resistance was reported (Ferre and Van Rie, 2002; Griffits and Araoin, 2005). To delay insect resistance, different molecular and management approaches were developed. To boost cry gene expression, the use of cry truncated sequences expressing the active toxins, the use of cry codon-optimized sequences for enhanced plant expression, the stacking of cry genes with differe nt binding sites and genes encoding proteins with different toxicity mechanisms are the most commonly used molecular approaches (Schenpf et al., 1998; Bohorova et al., 2001; Kaur, 2006; Ferry et al., 2006). However, high dose levels are still difficult to reach and cry expression patterns may be limited by external factors like nitrogen fertilization (Abel and Adamczyck, 2004).

PAGE 16

16 Objectives Bahiagrass ( Paspalum notatum Flugge) plays a key role supp orting beef and dairy cattle industries in Florida and other so uthern states of the United Stat es (Chambliss, 2002). Targets for bahiagrass genetic improvement include its low nutritive value a nd its susceptibility to insect pests like mole crickets and fall armyworm. Naturally, subtropical bahiagrass cultivars ha ve low protein content, ca. 11% protein content, which directly affects animal perfor mance (Cuomo et al., 1996). This protein content decreases to 5-7% affecting cattle growth a nd reducing cattle weight during summer and fall (Grando, 2001). Therefore, high and st able expression levels of the vspB gene in transgenic bahiagrass plants would have two main advant ages: rumen stability and enriched essential aminoacid composition. While most plant proteins are degraded by rumen proteolysis, bypass proteins remained intact and they are absorbed in ruminant intestines. It was previously observed that VSP not only contains ca.7% lysine (Mason et al., 1988; Staswick, 1988) but also behaves as a bypass protein being stable in the rumen and absorbed in the cattle intestines (Guenoume et al., 2002b). Previous reports indicated that VSPs contributed to the accumulation of high lysine levels in transgenic tobacco pl ants and, therefore they could co mpensate lysine deficiency in ruminant feeding (Guenoune et al., 2003). Bahiagrass is susceptible to insect pests such as mole crickets ( Scapteriscus spp) and fall armyworm [ Spodoptera frugiperda (J. E. Smith)]. Fall armyworm (FAW) is one of the most important insect pests in the southeast of United States, cau sing seasonal economic losses in forage and turf grasses and field crops such as corn, rice and sorghum (Sparks 1979, Meagher and Nagoshi, 2004). Recently, field trials w ith corn hybrids expressing a full length cry1F gene (Herculex I) indicated th at this gene provided protection agai nst a wide range of insect pests

PAGE 17

17 including FAW (EPA, 2001). However, there are no reports on transgenic insect resistance to insect pests in forage or turfgrasses. The objectives of our re search project were: To overexpress a soybean vegetative storage protei n gene and to evaluate the effects of this gene on the nutritional quality of bahiagrass. To express a synthetic cry1F gene and to evaluate the effect s of this gene on resistance to fall armyworm in bahiagrass.

PAGE 18

18 CHAPTER 2 LITERATURE REVIEW Bahiagrass ( Paspalum notatum var. Flugge) General Description The genus Paspalum (Poaceae family) originated along the Parana River in the border between Brasil and Argentina. The notata group (Chase et al., 1929; Burton, 1967) was spread from this region to other subtropical and tropi cal regions. Phylogenetic and cytogenetic studies showed that the genus is ch aracterized by a basic chromosomic number X=10 but its species vary from diploids (2n = 2x =20) to pentaploid s (2n = 2x = 50) with sexual diploids (2n = 2x = 20) and apomictic tetraploids (2n = 4x = 40) be ing the most common forage species. During the evolution of Paspalum spp., the apomictic autotetraploid forms, that were more robust, fit and competitive, originated from the sexual diploid forms (Gates et al., 2004). Also, bahiagrass is a C4 plant with an efficient photos ynthetic system which allows it to colonize new environments with high temperature, humidity a nd light intensity. It is importan t to note that C4 grasses have higher water use and nitrogen use e fficiencies than C3 grasses i ndicating that C4 growth rate doubles C3 growth rate using the same water and nitrogen supplies (Gates et al., 2004; Moser et al., 2004). Bahiagrass ( Paspalum notatum Flugge) is a rhizomatous plan t with short internodes that produce adventitious shoots and roots. It has a de ep and well developed root system that supports several tillers with broad leaves and inflorescences that are pa nicles formed by two terminal racemes (Gates et al., 2004) (Figure 2-1). The species is distributed in tropical and subtropical regions worldwide including Argentina, Australia, Belize, Benin, Bolivia, Brazil, Colombia, Costa Rica, Cuba, Ecuador, El Salvador, Gabon, Guatemala, Guyana, Honduras, Japan, Mexico, Nicaragua, Panama, Paraguay,

PAGE 19

19 United States and Zambia. In the United States, bahiagrass was introduced as a forage grass in early 1900s. According to the PLANTS Databa se, generated by the Natural Resources and Conservation Services from the United States Department of Agricu lture (USDA-NCRS, 2007), it is found in the states of Alabama, Arizona California, Florida, Georgia, Louisiana, Massachusetts, North Carolina, South Carolina, Tennessee and Texas. Bahiagrass covers ca. 2.5 million hectares including the southeastern states in the Gulf Coastal Plain in the United States (Burton et al., 1997; Blount et al., 2001), and more than 1 million hectares of which ca. 70 % represent improved pastures in th e state of Florida. As a forage crop, bahiagrass supports beef and dairy cattle industries in Florida and other southern states (Chambliss, 2002). The main cultivars grown in Florida are sexual diploids like Pensacola and Tifton 9, and apomictic tetraploid s like Argentine (Chambli ss, 2002). According to the Bureau of Plant Industry-Office of Foreign Seed and Plant Introd uctions (BPI-OFSPI), the cultivar Argentine (Plant Introduction N 148996) was introduced from Argentina in 1944 an d released in the United States in 1950. It is a wide-leaf, cold-suscep tible and late-flowering cultivar. It is mainly grown for landscaping in south Florida (Chambliss, 2002). The cu ltivar Tifton-9 (Plant Introduction N 531086) was released in 1987 by a breeding program at Tifton (Georgia, USA) after nine cycles of recurrent re stricted phenotypic selection from th e cultivar Pensacola. It is a narrow-leaf, cold-tolerant and an ea rly-flowering cultivar mainly gr own and used as forage in the states of Georgia, Alabama, Louisian a and north Florida (Cook et al., 2005). Role of Bahiagrass as Subtropical Grass in Southeast United States In Florida, beef and dairy cattle indust ries are formed by 1.5 million cows and 140,000 cows respectively (Florida Department of Agri culture and Consumer Services, Division Animal Industry, 2007). These industries represent 85 a nd 8% of the livestock production respectively and they are mainly supported by bahiagrass pastures covering one million hectares in the state

PAGE 20

20 (Chambliss, 2002). Bahiagrass is preferred by farmers and producers because it has low management requirements and very good persiste nce and yield (Smith et al., 2002; Chambliss, 2002; Blount et al., 2001). Among these advantages are (Cook et al., 2005): It is well adapted to sandy a nd light-textured soils, and not on ly tolerates drought but also its root system penetrates soil and improves water holding capacity a nd prevents nutrient leaching. It is well adapted to low fer tility soils with marginal pH (i.e. 5.5-6.5). These deficiencies are partially compensated by root interacti ons with arbuscular mycorrhizal fungi and nitrogen-fixing bacteria like Azotobacter paspali Once established, it spreads fast by stolons a nd is highly tolerant to overgrazing and high cutting frequencies during summer, these f actors favors plant regrowth and maintains nutritional quality (Stewart et al., 2007). It is very tolerant to fungal diseases and insect pests. The most important fungal pathogens are the ergot ( Claviceps spp) that reduces seed set and the leaf spot ( Helminthosporium spp) that produces leaf lesi ons in cv. Argentine. The most important insect pests are mole crickets that feed on the roots ( Scapteriscus vicinus S. borellii and S. abbreviatus commonly known as tawny, southern and short-wi nged mole crickets re spectively) and fall armyworms ( Spodoptera spp) that feed on the leaves (Burson and Watson, 1995; Chambliss, 2002). It reduces nematode populations when it is used in sod-rotation cropping systems and alternated with cotton, peanut and corn showed the same or increased yields (Gates, 2003; Wright et al., 2005). However, it also has several physio logical and nutritional limitations: It has a slow rate of seed establishment. It requires high sowing rates and good weed control because bahiagrass seedlings are weak and susceptible to the most commonly used post-emergency herbicides (Cook et al., 2005). Plant growth has a seasonal pattern which dire ctly affects plant yield. So that, slower growth produces low yield during fall and wi nter, and faster growth produces higher yield during summer in subtropical bahiag rass cultivars (Cuomo et al., 1996). This seasonal pattern also aff ects plant nutritive value, beca use of the fast growth rate directly related to high temp eratures which implies seconda ry growth and reproductive growth (Stewart, 2006). Specifically, subtropical grasses nutritional quality decreases with maturity (Johnson et al., 2001).

PAGE 21

21 Traditional Breeding of Grasses Forage and turfgrasses contribute to s upport economical and sust ainable agriculture systems that represent the ba sis of most economies in the world. Forage grasses are not commonly appreciated as a commodity because its valu e is measured indirectly as a feed cost for cattle production. Turfgrasses are mostly grown w ith recreational purposes on sport fields, parks, home lawns and roadsides (Wang et al., 2001). Breeding of forage grasses is mainly focuse d on supporting ruminant feeding and includes increasing herbage production by increasing dr y matter yield and diffe rent feeding value paremeters. These parameters are in vitro dry matter digestibility (IVDM D), crude protein (CP) content, water-soluble carbohydrat e (WSC) content. Also, there are antiquality factors which affect it, such as lignin and alkaloid conten ts (Wilkins and Humphreys, 2003). Therefore, the objectives of breeding programs for improving nut ritional quality include increasing voluntary intake, dry matter yield, IVDMD, CP and WSC and decreasing lignin an d alkaloid contents. Other breeding objectives include to enhance pers istence, tolerance to environmental stresses such as cold, frost, heat and dr ought, resistance to insect pests and viral and fungal diseases, and to increase seed yield (Wilkins and Humphreys, 2003). Most grasses are crosspollinated and most traits are quantitative including DMY, IVDMD, tolerance to stresses and resist ance to pests and diseases. Be fore, breeding programs focused on identifying those natural populations with s uperior phenotypes (Wilkins and Humphreys, 2003). In the United States, some examples of those cultivars are Kentucky-31 tall fescue ( Festuca arundinacea ), Linn perennial ryegrass ( Lolium perenne ), Lincoln smooth bromegrass ( Bromus inermis ), and Merion Kentucky bluegrass ( Poa pratensis ) (Alderson and Sharp, 1994). Later, breeding programs.focused on pheno typic selection and progeny tests including full-sib or half-sib family sele ction (Cunningham et al. 1994). Basi cally, traits su ch as DMY and

PAGE 22

22 IVDMD, with broad-sense heritabilities ranki ng between 30%, showed an increased of 10 % decade, and this increase was almost doubled (Wilkins and Humphreys, 2003). Other classical breeding approaches such as ge ne introgression by backcrossing and chromosome doubling were reported with limited success. However, most fo rage grasses breeding programs are supported by seed companies and low seed value and long br eeding cycles (2-3 years/each) limit their expansion (Wilkins and Humphreys, 2003). Bahiagrass breeding efforts followed the same breeding approaches and focused in the same breeding objectives. Early on, sexual tetr aploids were generated by chromosme doubling with colchicines from cv. Pensacola (Forbe s and Burton 1961). Later o n, cv. Tfiton 9 was generated by restricted recurrent phenotypic selection (Burton 1974). A breeding program was established at Tifton (Georgia) a nd starting material was selected from several farms. Based on herbage production, this program included breeding cycles where the best plants were selected and intermated in a polycross to produce seeds for the next selection cycle. At the ninth cycle, the cultivar Tifton 9 was released (Burton, 1989). This cultivar not only showed 30 % more biomass production and more seedling vigour than cv. Pensacola but also the same IVDMD. Later reports indicated that ea rly germination and reduced dormancy were related to higher yields (Gates and Burton 1998) Stronger and faster seed es tablishment makes bahiagrass cultivars more competitive against weeds in early stages and more productive extending the growing season. To increase DMY in bahiagrass subt ropical cultivars, other factors such as cold resistance, photoperiod sensitivity and crown vi gor had been considered. For example, dayneutral and coldresistant plants with vigorous crown (expressed as fa st growth and profuse tillering) will have an extended growing seas on and higher biomass pr oduction (Blount et al. 2001, 2003).

PAGE 23

23 Genetic Engineering in Plants Plant Transformation In the last forty years, gene tic engineering has overcome th e basic problems concerning to the development of protocols for DNA transfer, ti ssue culture and selecti on in specific genotypes or cultivars. Genetic engineering is focuse d on crop improvement and a wide range of biotechnological applications in industry and human health (Hansen and Wright, 1999; Newell, 2000). In agriculture, genetic engi neering and plant breeding has improved agronomic traits such as herbicide, insect, disease and nematode resistance (Dunwell, 2000; Newell, 2000; Bhalla, 2006). Improving yield and nutritional quality of fiel d crops is more complicated because traits such as drought tolerance or essential aminoaci d deficiencies are regulated in more complex ways. Increasing lysine and threonine levels in cereals, methionine in legumes and vitamins A and E in crucifers and rice could compensate nutritional deficienci es in animal and human diets (Job, 2002). Also, molecular farming can effici ently produce biopharmaceutical products. Some of these products, such as trypsin and aprotini n, have already reached the market. Other products, such as industrial enzymes (phytases, prot eases, glycosidases a nd oxido-reductases) or monoclonal antibodies and antigens for edible vaccines are cl ose to commercialization (Newell, 2000; Horn et al., 2004). Tissue Culture Protocols Tissue culture protocols are a prerequisite for a successful plant transformation. However, monocotyledoneus plants were cons idered as recalcitrant specie s for being propagated in tissue culture. Early reports in wheat focused on identi fying suitable explants for the induction of embryogenic callus like scutelli, mature and immature embryos; adjusting bombarding parameters and selection and regeneration protoc ols (Altpeter et al., 1996a, Rasco-Gaunt et al., 1999). Later reports focused on the screening of commercially important cultivars for tissue

PAGE 24

24 culture and transformation experiments (Takumi a nd Shimada, 1997; Iser et al., 1999, Altpeter et al., 2001). Early reports indicated that pl ant regeneration from bahiagrass ( Paspalum notatum Flugge) and other Paspalum spp was possible through the use of young inflorescence-derived callus (Bovo and Mroginski, 1986, 1989). Bahiagrass regene ration using mature seeds via somatic embryogenesis was firstly descri bed by Marousky and West (1990) They indicated that seeds from bahiagrass cv. Pensacola germinated and developed small callus at the basis of the coleoptile in Murashige and Skoog medium (MS, Murashige and Skoog, 1962) supplemented with 9 M 2,4-D. However, authors repor ted very low embryogenic callus and plant regeneration rates (12 and 29% re spectively). Also, Akashi et al (1993) regenerated bahiagrass plants from six bahiagrass genotypes using seed -derived callus cultured in the same medium. They observed that callus inducti on, callus proliferation and plant regeneration were influenced by genotype effects. Besides, cv. Pensacola was the best regenerant with 40% embryogenic callus formation and 74% plant regeneration. Late r reports focused on regeneration of bahiagrass cv. Tifton 9 that was derived from cv. Pensacola by restrict ed recurrent phe notypic selection and released to the market in 1989 (Burton, 1989). Shatters et al. (1994) investigated bahiagrass using leaf-stem cross sections cultured in a Schenk and H ildebrandt medium (Schenk and Hildebrandt, 1968) supplemented with 30 M dica mba. Authors reported 96% regenerant callus and indicated that regeneration abil ity declined with the longer subc ultures in the ear lier selected lines while remained steady until 10 months in th e later ones. Grando et al. (2002) reported an optimized bahiagrass regeneration protocol based on the use mature seed-d erived callus. Authors observed 66% germination and 21% embryoge nic callus formation using MS medium supplemented with 30 M dicamba and 5 M BAP. Subsequently, Altpeter and Positano (2005)

PAGE 25

25 produced 85% germination and 55% embryogenic cal lus rates in cultivar Argentine using 13.5 M dicamba and 5 M BAP. Currently, this ba hiagrass regeneration pr otocol is a routine protocol used to generate stable transgenic plants for the different lines of research developed in our laboratory. Transformation Methods To generate transgenic plan ts, efficient protocols for pl ant regeneration, DNA delivery, transgenic tissue selection a nd recovery of normal and fertile phenotypes are required. In addition, these protocols should be hi ghly reproducible and efficient, so that they can be used in a large scale and a short time frame. Currently, three methods fulfill these criteria: protoplast transformation, biolisti c transformation and Agrobacterium -mediated transformation (Hansen and Wright, 1999). Protoplast transformation involve s protoplast isolation from di fferent callus lines derived from immature tissues like embryos, infloresce nces, leaves and anthers. These young tissues can be dedifferentiated and more susceptible to DNA uptake. Therefore, protoplasts could be transformed by different methods such as electr oporation, microinjection and polyethyleneglycol (PEG). These technologies were used in the absence of Agrobacterium -mediated transformation protocols for monocots, but they were highly geno type-dependent and they were not suitable for transforming most important ag ronomic crops (Hansen and Wright, 1999; Newell, 2000; Taylor and Fauquet, 2002). Agrobacterium is a gram-positive, soil-borne bacteriu m that produces a crown-gall disease and naturally infects different dicotyledonous plants This disease is charac terized by the transfer of the Ti plasmid, i.e. specific DNA fragment with specific flanking regions, from Agrobacterium tumefaciens into the plant cells. The Ti plasmid contains genes encoding enzymes involved in the synthesis of growth re gulators inducing plant cell growth and tumor

PAGE 26

26 formation, and the production of opines that support bacterial growth. Initially, Agrobacterium mediated transformation was very successful in dicotyledonous plants because they are the natural host range for the bacterium. To overcome the host-plant specificity, Agrobacterium mediated transformation was optimized by the use of hypervirulent st rains and the use of wounding methods to enhance bacter ial infection. To improve tran sformation efficiency, specific protocols for bacterial infection, inoculation, and cocultivation; a nd plant selection and regeneration were developed according to the specif ic requirements of the bacterial strain and the plant host. Recently, several protocols bypassed tissue culture by using in vivo inoculations; however, these protocols are restri cted to model species such as A. thaliana and N. tabacum The use of this technology has severa l advantages: Transgene integr ation patterns showed fewer and intact copies after T-DNA transfer compared wi th those transgene integration patterns produced by biolistic experiments. Subsequently, Agrobacterium host range was extended to monocotyledonous plants such as corn, rice, wheat and barley (Hansen and Wright, 1999; Newell, 2000; Gelvin, 2003). Biolistic or microparticle bombardment technology i nvolves the acceleration of microprojectiles coated with foreign DNA into ta rget plant tissues. These gold or tungsten particles pass through the plant cell wall and nuclear envelope to release and integrate the DNA into the plant genome. This te chnology allows a wide range of transformation strategies including transient and stable expression studi es, chloroplast and mitochondrial transformation studies and also viral expressi on studies (Altpeter et al., 2005) Due to its physical nature, microparticle bombardment is not limited by the pathogen-host interaction observed in Agrobacterium -mediated transformation. Therefore, it is used in a broad range of targets including not only those groups cons idered as recalcitrant groups among plants such as cereals

PAGE 27

27 and grasses, but also other livi ng organisms such as bacteria, fungi, algae, insects and mammals (Hansen and Wright, 1999; Newell, 2000; Tayl or and Fauquet, 2002, Altp eter et al., 2005). Particle Bombardment Method Currently, particle bombardment is the mo st widely used and successful method for introducing genes into monocotyl edonous plants (James, 2003; Altpeter et al., 2005). This technology is routinely used to improve agronom ic traits such as crop yield and quality, resistance to biotic stresses like fungal diseases and insect pests, tolerance to abiotic stresses like drought and cold, and molecular farming (Newe ll, 2000; Dunwell, 2000; Job, 2002; Horn et al., 2004). There are two important factors that determin e the success of gene transfer by particle bombardment: the physical parameters of th e bombardment process and the biological requirements of the plant tissues before, during and after bombardment. Tr ansient studies with reporter genes such as GUS, luciferase and G FP genes were designed to optimize these physical parameters according to the specific needs of each genotype (Southgate et al., 1995; Taylor and Fauquet, 2002). However, the target tissues to produce transgenic pl ants need to be prepared to integrate the foreign DNA, to undergo selection a nd to regenerate normal and fertile plants. Hence, the challenge is to develop an efficien t transformation protocol using embryogenic or meristematic tissues and shortening the tissue cu lture time for avoiding somaclonal variation and the development of aberrant or infertile phenotypes. Recently, the production of stable transgenic pl ants from forage and turf grasses including tall fescue ( Festuca arundinacea Schreb.), red fescue ( Festuca rubra L.), ryegrass ( Lolium perenne L.), bermudagrass [ Cynodon dactylon (L.) Pers.] and creeping bentgrass ( Agrostis palustris ). Specifically, earlier protocols indi cated the successful transformation and regeneration of fescue using tall fescue prot oplasts (Ha et al., 1992) and tall and red fescue

PAGE 28

28 embryogenic cell suspensions (Spagenberg et al., 1995). Robust protocols with efficient selection systems allowed to generate large numb ers of red fescue plants using the nptII gene and paromomycin as selective agent (Altpeter & Xu, 2000). Recently, ta ll fescue nutritional quality was improved by overexpressing a sulphur-rich sunflower albumin (SFA8) under the control of cab wheat promoter (Wang et al., 2001). Also, tall fescue forage digestibility was enhanced by downregulating the expression of cinnamyl alcohol dehydrogenase (CAD), an enzyme involved in lignin biosynthetic pahtway, in transgenic plants containing sense and an tisense constructs of the cad gene (Chen et al., 2003). Altp eter et al. (2000) reported a ra pid and efficient protocol for generating perennial ryegrass plants by using an expression cassette with the ubiquitin promoter and the nptII gene and obtaining the hi ghest transformation efficien cies (4-11%) using calli derived from immature inflorescences and embryos in 9-12 weeks. Recentl y, Hisano et al. (2004) reported an increased tolerance to freezi ng in perennial ryegrass overexpressing wheat fructosyltransferase genes, wft1 and wft2 which encode sucrose-fruc tan 6-fructosyltransferase (6-SFT) and sucrose-sucrose 1-fructosyltransieras e (1-SST), respectively, under the control of CaMV 35S promoter. These plants contained signif icantly higher fructan levels than wild type and tolerated freezing at cellular level. Reports on common and triploid bermudagrass (Li and Qu, 2004; Zhang et al., 2003) indi cated variable success in the production of transgenic bermudagrass plants probably related to not ve ry efficient transformation, regeneration and selection protocols. The pr oduction of stable transgenic plants from bahiagrass ( Paspalum notatum Flugge) cv. Tifton 7 was firstly repor ted by Smith et al. (2002). However, this apomictic tetraploid genotype is not a commercia lly used cultivar, and au thors reported that the transgenic nature of most of the glufosinate resistant plant could not be confirmed by PCR analyses (Smith et al., 2002). Later, unpublished st udies revealed that the glufosinate resistance

PAGE 29

29 was conclusive to indicate the transgenic nature nature and that the PCR analyses had resulted in false negative events (Smith, personal communica tion). In this context, there was a need of developing efficient protocols for transformation and regenera tion of bahiagrass commercial cultivars such as Argentine and Tifton 9 that are preferred fo r commercial production. Selectable Markers and Selection Protocols To generate transgenic plants, tissue cultu re and transformation protocols should be coupled to efficient selection protocols. These protocols are based on the use of selectable marker genes (SMGs) which encode enzymes th at regulate the grow th or death of the transformed tissues. These SMGs conferred resistan ce to agents such as antibiotics, herbicides, toxic metabolic intermediates, or non-toxic meta bolic intermediates. However, all these systems depend on the application of a selection agent in the culture medium. Instead, new SMGs encode enzymes such as isopentyltransferases histidine kinase homologues and hairy-root inducing genes that regulate and lim it plant growth (Miki and McHugh, 2004). Currently, kanamycin, hygromycin and phosphoinotricin comprised more than 90% of the selectable markers in research studies and field trials for selection of yeast, plant and animal tissues (Miki and McHugh, 2004). The gene nptII encodes the neomycin phosphotransferase from E. coli, an ATP-dependent dephosphorylase that ac ts on several aminogl ycosides including neomycin, kanamycin, gentomycin (G418) and paromomycin. The nptII gene is the most widely used in plants and its use includes model species of dicots such as Arabidopsis and tobacco (15 and 73% studies respectively) and monocots like rice and corn (4 and 33% respectively). The hph or hpt genes from E. coli encode the hygromycin B phosphot ransferase which is an ATPdependent phosphorylase that phosp horylates and inactivates hygrom ycin B (inhibitor of protein synthesis). The pat or bar genes confer resistance to the L-isomer of phosphoinotricin (PPT). This enzyme transforms toxic ammonia radica ls into glutamic acid in plant cells. The bar gene

PAGE 30

30 ( S. higroscopicus ) and the pat gene ( S. viridochromogenes ) encode the phosphoinotricin Nacetyltransferase that acetylates and inactivates PPT. Therefore, the toxicity of the commercial herbicides containing PPT such as Basta, Ig nite and Liberty is due to an increase in ammonia levels which leads to plant death. The bar gene is widely used in plants including important crops like corn, wheat, rice, and other species like conifers and orchids. Both SM systems, hygromycin and phosphoinotricin basedsystems, are widely used in 30% of the research studies (Miki and McHugh, 2004). Public and regulatory concerns were raised about the risks of using antibioticresistant genes given that horizontal transf er to pathogenic soil or gastroin testinal bacteria could affect environment and human health. However, antibiotic resistance transfer from transgenic crops to animal or humans should fulfill several condi tions including no DNA degradation in field conditions and the presence of a potential bacterial host for transg ene integration and expression. In this context, Gay and Gillispie (2005) cont rasted the potential increase in the antibiotic resistance reservoir created by plants with SMGs with the current situation created by medical antibiotic prescribing. Author s concluded that even though these SMGs could survive environmental conditions, the barriers to transfer incorporation, and transmission indicated that SMGs contribution to antibiotic resistance is minimal compared with the contribution made by antibiotic prescription in clini cal practice (Gay and Gillispie, 2005). Additionally, the horizontal transfer of herbicide-resistant genes from co mmercial crops to closely related weeds by crosspollination could create new superweeds. Therefor e, the use of selectable marker (SM)-free plants eliminates human and environment poten tial risks and favors public and governmental acceptance of transgenic crops (Sreekala et al., 2005; Darbani et al., 2007). To eliminate SMGs, several strategies were deve loped including the use of SMGs not based on antibiotic or

PAGE 31

31 herbicide-resistant genes and the use of excision systems to eliminate the SMGs after regenerating the transgenic plan ts. The SM cassettes could be excised by cotransformation with both genes in different DNA fragments, the use of site -specific recombination systems transitorily expressed like Cre/loxP, FLP/ FRT and R/RS, transposon-based systems and interchromosomal recombination-based systems (Miki and McHugh, 2004; Da rbani et al., 2007). Transgene Integration and Expression Patterns Currently, Agrobacterium -mediated and microparticle bombardment are the most commonly used transformation methods to generate transgenic plants. In both cases, transgene integration plays a key role determining tran sgene stability and expression in primary transformants and subsequent generations. Howeve r, transgene integration and expression still remain as poorly understood phe nomena (Kohli et al., 2003). Traditionally, biolistic methods were used to generate transgenic plants from monocotyledonous plants, mostly cereals and grasses, which were not natural hosts for A. tumefaciens The integration pattern observed involves a high number of transgene copies inserted in one single locus (Kohli et al., 2003; Latham et al., 2006). The locus structure varies from a single copy that could be intact, truncated or re arranged to several copies forming tandem or inverted repeats, concatemer s or clusters with interspersed genomic DNA. Detailed studies on the structure of the junctions between the tran sgene and the genomic DNA suggested that the integration occurs by illegitimate recombina tion. These events are recognized due to the presence of microhomologies in the coding sequ ence of both recombinant DNAs, the presence of filler DNA, not belonging to either molecule and similar motifs to those found in the topoisomerase I cleaveage sites. Besides, vector backbone sequences seemed to have recombination hotspots that favored transgene re arrangements. Therefore, the use of minimal constructs (MCs) containing only the expression cassettes, instead of the complete plasmid

PAGE 32

32 vectors, will enhance the expression levels in th e transgenic plants (Alt peter et al., 2005). The proposed transgene integration models considered that transgene rearra ngement and integration involves the participation of DNA repairing complexes generating a hotspot for further integration of other transgene copies in the ge nomic DNA. Authors suggested that these hotspots could be impediments for transcription comple xes suppressing gene expression and leading to gene silencing (Kohli et al., 2003). Agrobacterium -mediated methods are commonly used to generate transgenic plants mostly from dicotyledoneus plants. Recently, the method was improved and showed similar efficiences to those obtained by particle bombardment pr otocols for cereals and other monocotyledonous plants. The transgene integration usually implie s a lower number of transgene copies and the locus structure is less complex than those observed in the transgenic plants obtained by biolistic experiments. However, its complexity de pends on several factors including the Agrobacterium strain, the transformation method, th e plant species and the explant. Besides, the integration of vector sequences is a very common phenomenon. Also, it is interesti ng to notice that the integration occurs by illegitimate recombination and the integration process occurs in hotspots as those plants generated by microparticule bom bardment (Kohli et al ., 2003; Filipecki and Malepsky, 2006). Future Prospects Tissue culture During tissue culture, plant ti ssues are exposed to differe nt stress factors including wounding, desiccation, osmotic stress, limited access to nutrient supplies a nd high concentrations of growth regulators and antibiotics (Carman, 1995). These factors lead not only to plant dedifferentiation and regenerati on but also to other uncontroll ed results such as somatic recombination, chromosome rearrangements, ploidy changes, mutations, dele tions and insertions

PAGE 33

33 among other DNA rearrangements. These genetic ch anges induced by tissue culture conditions, called somaclonal variation, have direct effect s on gene expression (Kaeppler et al., 2000). Besides, these changes accumulate with pr olonged tissue culture (Fukui, 1983). Therefore, transformation methods should include the develo pment of protocols reducing the tissue culture time (Altpeter et al., 1996a, Filipecki and Malepsky, 2006). Agrobacterium -mediated transformation Currently, Agrobacterium -mediated transformation protocol s were efficiently developed for most cereals including wheat ( Triticum aestivum L.), rice ( Oryza sativa ), maize ( Zea mays L.), barley ( Hordeum vulgare L.), sorghum ( Sorghum bicolor L.) and rye ( Secale cereale L.) ( Agrobacterium Protocols, Humana Press eds, 2006). Specifically, Wu et al. (2003) observed that factors such as embryo size, pre-cu lture, inoculation, and cocultivation times, acetosyringone and surfactant inclusions a nd selection time were important factors on transformation efficiencies (0.3-3% )obtained in four bread wheat cultivars. Recently, Toki et al. (2006) reported a successful ri ce transformation protocol based on the use of scutellum tissue obtained from one day pre-cultured seeds; the use of these explan ts enhanced further selection and shortened the tissue culture step avoiding somaclonal variation risks. Also, forage and turfgrasses were mostly transfor med with scorable and selectab le marker genes including tall fescue ( Festuca arundinacea Schreb.), switchgrass ( Panicum vrigatum L.) and perennial ryegrass ( Lolium perenne L.) ( Agrobacterium Protocols, Humana Press eds, 2006). Recently, successful protocols were reported for perennia l ryegrass (Altpeter et al., 2006; Bajaj et al., 2006) and zoysiagrass (Ge et al., 2006). To improve Agrobacterium -mediated transformation, a large repertoire of plasmids, b acterial strains and transformati on protocols were developed. New approaches included transgene and bacterial or ho st factors cotransforma tion with the purpose of enhancing bacterial infection and transgene integr ation. It is expected that these factors will

PAGE 34

34 broaden the host range and improve the transformation efficiencies of those still recalcitrant plant species (Tzfira and Citovs ky, 2006; Lacroix et al., 2006). Particle bombardmen t transformation Transgene integration, either by Agrobacterium or particle bombardment, plays a determining role not only in further expression of the transgene but also in other endogenous genes, being able to affect gene expression in all levels in the transgenic plants. Amongst the insertion effects, the most important ones incl ude favoring new rearrangements and integration events, leading to silencing in the transcriptional or posttranscriptional levels. Transgenic RNAs could interact with endogenous RNA generati ng an iRNA response and shutting down some endogenous genes and/or transgenic polypeptide products could act as new sinks for endogenous free aminoacid pools or as new s ubstrate for endogenous enzymes. In this context, transcript, protein and metabolic profiles are affected a nd the response could affe ct plant fitness and productivity. According to Filipecki and Malepsky (2006), these changes among different transgenic lines are minimal comp ared with those changes in pr ofiles from plants belonging to different cultivars or ecotypes. However, pa rticle bombardment generates very complex integration patterns with higher number of transg ene copies and rearrangements (Latham et al., 2006). Therefore, transgene copy nu mber affects transgene expre ssion and could led to a wide range of expression levels from silencing to enhanced expression. Early reports in Petunia indicated that higher copy number lead to lower anthocyanin expr ession levels (Napoli et al., 1990; Jorgensen et al., 1996; Grant-Downton and Dickinson, 2005). Recently, a detailed screening of 132 Arabidposis transgenic lines containing th e GFP, GUS and SPT genes through generations indicated that plants containing one or two tran sgene copies expressed the reporter genes with twofold differences, while plants containing higher number of copies showed posttranscriptional gene silencing. In addition, tr anscriptional gene silencing could also ocurr

PAGE 35

35 (Schubert et al., 2004; Filipecki and Malepsky, 2006). Besides, tr ansgene expression could be naturally enhanced if the integration occurs within the minimal promoter sequence and is influenced by endogenous enhancers. Transgene e xpression and stability also could be enhanced by using matrix attachment re gions as flanking sequences or by removing vector backbone sequences prior bombardment (Allen et al., 2000; Altpeter et al., 2005; Filipecki and Malepsky, 2006). Selectable markers According to Darbani et al. (2007), the producti on of selectable marker-free transgenic plants could be approached by using different technologies. So far, cotransformation systems, site-specific recombination systems and positive markers based on non-toxic metabolites are the most widely used. Specifically, Park and coworkers (2004) observed independent segregation of the transgenes and produced nptII -free transgenic tobacco plants by cotransforming two binary vectors containing the nptII and the coda genes in one T-DNA and the GUS gene in the other TDNA. One alternative st rategy involves the dao1 gene encoding a D-am inoacid oxidase which shifts from a positive marker with the substrates Dalanine or D-serine to a negative marker with the substrates D-isoleucine or D-valine (Erikson et al., 2004). Amongst the non-toxic metabolites, the phospho-mannose isomerase (PMI) is the most widely used positive SM included in the production of transgenic plants from sugar beet, canola, corn, wheat, rice and pearl millet (Darbani et al., 2007). Recently, OKennedy et al. (2004) reported stable integration and inheritance of the PMI gene and increased transformation efficiency using the PMI gene for selecti ng transgenic plants from pearl millet. Amongst the site-specific recombination systems, the Cre/lox is the most exploited because of its precise, complete and stable SM removal which implies that the SMGs could be

PAGE 36

36 recycled in a stacking gene engineering stra tegy. Recent reports indi cated the successful production of SM-free transgenic plants in rice (S reekala et al., 2005) a nd corn (Zhang et al., 2003). Interestingly, Zhang et al. (2003) observed that cotransformation of the SMG with the recombinase gene under the control of a heat shock promoter allowed the excision of both cassettes by using heat shocks in early stages of callus regeneration. New strategies: Multigene engineering, chlo roplast engineering and SM-free plants Currently, most genetic engineering studies us e microparticle bombardment because it is a very versatile and efficient tool allowing for tr ansgene integration and expression in transient expression studies with reporter genes, stable ex pression studies with ge nes integrated in the nucleus, chloroplasts and mito chondrias and host-p athogen interaction studies with virus (Altpeter et al., 2005). Several a dvantages contributed to the success of the microparticle bombardment including a large rang e of plant species and genotype s, a large range of target tissues and organs, the elimination of shuttle vect ors and the stacking of multiple genes. It is not restricted by biological requireme nts being used in a wide range of plant species and genotypes. It could target a broad range of tissues and expl ants including embryos, seeds, shoot apices, leaf discs, callus, microspores, pollen grains a nd inflorescences generating an embryogenic or organogenic response. Also, shuttle vector is not required and vector ba ckbone sequences (origin of replication, antibiotic gene a nd others) could be eliminated. It facilitates transgene stacking allowing for the integration of genes encoding different agronomic traits, multimeric proteins and several enzymes involved in a specific meta bolic pathway. Recently, metabolic engineering studies in rice focused on the carotenoid pathwa y to increase provitamin A levels for preventing blindness, and the phenylpropanoid pathway to increase lignan levels fo r preventing different cancer types and coronary heart disease (Altpet er et al., 2005). Specifi cally, transgenic rice plants expressing three genes involved in -carotene pathway in the plastids from rice endosperm

PAGE 37

37 showed not only high levels of provitamin A but also a normal and fertile genotype (Ye et al., 2000; Datta et al., 2003). Furthermore, microparticle bombardment co mbined with chloroplast engineering has shown several advantages including no transg ene silencing, no position effects affecting transgene expression, high and uniform transgen e expression levels, poly cystronic translation allowing the expression of multiple genes under a common promoter, specific-site integration through homologous recombination and protein st orage preventing cytoplasm degradation and transgene containment due to ma ternal inheritance (Heiftez, 2 00; Bock, 2001; Daniell et al., 2002; Daniell, 2006). Similarly to nuclear engineer ing, chloroplast engineer ing early efforts were focused in generating plants with traits such as herbicide tolerance, insect resistance and metabolite production. Early repor ts indicated that tobacco pl ants overexpressing the gene encoding 5-enolpyruvylshikimate-3-phosphate synt hase (EPSPS) where tolerant to glyphosate (Roundup) (WO 00/03022 internationa l patent application). Also, McBride et al. (1994) expressed the cry1Ac gene in tobacco reaching 3-5% to tal soluble protein. Besides the simultaneous expression of multiple genes at high levels, chloroplast folding and assembly complexes assured the correct processing of pr oteins formed by single or multiple subunits making the system highly suitable for the production of biopharmaceuticals and vaccines (Daniell, 2006). Vaccine antigens against human di seases like cholera, anthrax, tetanus, plague or canine parvovirus were overexpressed reaching transgene expression le vels of 4-31% of the total soluble protein. Also, therapeutic prot eins like human serum albumin, somatotropin, interferon gamma and antimicrobial peptides we re expressed at 6-21.5% of the total soluble protein. Chloroplast engineering allows oral de livery and an easy, effici ent and economic protein

PAGE 38

38 purification system (Daniell, 2006) Therefore, chloroplast engineering seems to be a very promising technology for crop improvement in the future. Genetic Engineering for Crop Improvement According to the APHIS-USDA database (2007) genetic engineering coupled to breeding programs has generated more than 50 transgenic cultivars from the most important commercial crops since 1996 in the United States. Based on the number of approved releases for field tests, the dominant crops in the market are soybea n, cotton, potato, tomato and wheat with 1104, 785, 769, 599 and 392 approved releases. Cereals are re presented by wheat, rice and barley (with 392, 226 and 61 approved releases) and grasses are re presented by creeping bentgrass, Kentucky bluegrass, tall fescue, St. Agustine grass, bermudagrass and bahiagrass (with 175, 35, 20, 17, 15 and 10 approved releases). Looking at the phen otype categories of these transgenic crops, research efforts are mostly focused in herbicid e tolerance, insect resistance, product quality, agronomic properties and virus resist ance represented by 4,064, 3,447, 2,917, 1,596 and 1,275 approved releases (26, 22, 18.6, 9.9 and 8.1% total releases, respectively)(Figure 2-2a). These efforts are further reflected by 33, 24, 14, 9 and 6 petitions for deregulation in the phenotypes for herbicide tolerance, insect re sistance, product quality, virus re sistance and enhanced agronomic properties respectively (Figure 2-2b ). The states leading the field tests are Hawaii, Illinois, Iowa, California, Indiana and Florida, along with the Commonwealth of Puerto Rico, with 2,016, 1,926, 1,513, 1,311, 822, 737 and 1,675 issued or acknowle dged field test locations in 2007 respectively (APHIS-USDA da tabase, 2007) (Figure 2-3). It is interesting to note that most crops were improved by using single gene traits like herbicide tolerance and insect resistance while few crops were improved for increasing yield by growth rate and photosynthetic efficiency because these traits are controlled in more complex ways (Dunwell, 2000).

PAGE 39

39 Genetic Engineering to Improve Nutritional Quality Plant proteins provide the esse ntial aminoacids required for a balanced diet and appropriate development of humans and animals. Cereals, grasses and legumes are the basis of human and animal diets. However, cereal proteins are defi cient in lysine, tryptophan and threonine, while legume proteins are deficient in methionine a nd cysteine (Tabe and Higgins, 1998; Guenoune et al., 1999; Galili and Hoefgen, 2002; Sun and Liu, 2004). To overcome the nutritional defi ciencies of plant-based foods two metabolic engineering approaches were considered: to increase the free aminoacid pools or to increase the essential aminoacid enriched-protein pools (Sun and Li u, 2004). Essential ami noacid pools could be regulated by modifying the expres sion levels of those enzymes involved in their biosynthetic or degradation pathways. The aspartate biosynthetic pathway leads to lysine formation on one branch and threonine, methionine and isoleucine formation on the other branch in the chloroplast (Galili, 1995). The expression of bacterial genes, encoding enzy mes from the aspartate pathway that are insensitive to the plant feedback m echanisms, produced increased levels of free aminoacids and altered phenotype in cases like tobacco (Shaul and Galili, 1992b) but normal phenotypes in potato (P erl et al., 1992), Arabidopsis (Ben Tzvi-Tzchori et al., 1996) and alfalfa (Galili et al., 2000). Essentia l aminoacids-enriched protein pools could be modified by overexpressing SSPs or VSPs in cereal or legume cr ops. Early reports indicated the potential of corn zeins and soybean VSPs for being accumulate d in transgenic tobacco leaves (Guenoune et al., 1999). Specifically, and -zein were expressed and stably accumulated but they showed low expression levels in tobacco leaves (Bagga et al., 1995, 1997; Sharma et al., 1998). Soybean VSPs were accumulated up to 2-6% total soluble protein in transgenic tobacco leaves (Guenoune et al., 1999; 2002a, 2003). Authors sugge sted that these high VSP expr ession levels in transgenic tobacco plants were probably due to the strong activity of the CAMV35S promoter and the lack

PAGE 40

40 of those endogenous proteases founded in vacuoles of mature soybean l eaf tissue (Guenoune et al., 1999). These high and stable tran sgene expression levels are necessary to assure an impact in animal feeding and performance. From a nutritional standpoint, tr ansgenic plants not only need to have higher and enrichedprotein contents but also these pr oteins should be resistant to ru men degradation and absorbed in the intestines. Early studies indicated that ne arly 40% of the plant proteins undergo rumen degradation in animals feeding on temperate pastures (Ulyatt et al ., 1988). Methionine and lysine are the most limiting essential aminoacids for la ctating (Rulquin and Verite, 1993) and growing animals (Merchen and Trigemeyer, 1992); therefor e, they should be incorporated in bypass proteins and these proteins should be at least 30% to assure animal weight gain (NRC, 1989). Vegetative Storage Proteins (VSPs) Vegetative storage proteins (VSP) are proteins which are accumulated at high levels in storage vacuoles of vegetative tissues (at least more than 5 % of total protein), used as temporary nitrogen reserves and without any other obvious en zymatic or metabolic role. So, these proteins regulate nitrogen availability according to the plan t requirements, have a turnover rate controlled by the sink/source status of the storage organs and can be pref erentially synthesized or degraded at different developmental stages of the plant (Staswick, 1994). General characteristics First reports on VSPs descri bed 27 and 29 Kda polypeptides in soybean plants (vspand vsprespectively) that were pref erentially accumulated in young leaves reaching 6-15% of the total protein before flowering and declined to 1% during seed growth (Wittenbach, 1983). It was observed that VSP content increased with depodd ing, reaching 45% of the total protein in soybean leaves. Besides, it increased after peti ole girdling in soybean cotyledons during seed germination (Wittenbach, 1983). This fact suggested that VSPs may also have a storage role in

PAGE 41

41 young seedlings where the cotyledon changes from a storage organ to a photosynthetic organ involving degradation of storag e vacuoles and releasing of protein content (Staswick, 1991, 1994). Simultaneously, the paraveinal mesophyll (PVM ) was characterized in soybean plants (Franceschi and Giaquinta 1982a, b, 1983a,b). This ti ssue consisted in one th ick layer of larger cells interconnected by tubular arms that are wrapped around the phloem bundles. Ultrastructural and histochemistry studies showed that this tissue is directly invol ved in synthesis and degradation of proteins during th e change of vegetative to repr oductive growth in soybean plants. Later on, inmunoblotting and inmunocytochemical st udies showed that three polypeptides of 27, 29 and 94 Kda where specifically accumulated in th e PVM vacuoles and their turnover rate was regulated by sink/source status (i.e. high levels in young leaves and/or depodded plants)(Klauer et al., 1991). Furthermore, Klauer et al. (1996) observed the presen ce of these three polypeptides in the vacuoles of PVM in other legumes species. However, the 94 kda polypepetide was identified as a lypoxigenase (Tra nbarger et al., 1991). Furthermore, DeWald et al. (1992) showed that VSPs had high sequence homology to a tomato acid phosphatase and low acid phosphatase activity. Later on, phylogenetic analyses showed that the loss of the catalytic site and activity is probably a requirement for changi ng to a storage function in le gume species (Leelapon et al., 2004). Genes and polypeptides VSPs and vsp genes were identified and characteri zed using different soybean tissues by different authors (Staswick, 1988; Mason et al ., 1988; Rapp et al., 1991). Staswick (1988) detected the polypeptides VSP25 and VSP27 in leaves with high levels of mRNA of depodded soybean plants ( Glycine max L. Merr. Cv. Williams 82). Simultaneously, Mason et al. (1988) detected the polypeptides VSP28 and VSP31 in st ems of dark-grown seedlings from the same

PAGE 42

42 soybean cultivar. This study showed that pol ypeptides and their en coding genes have 80% sequence homology. The pVSP28 and pVSP31 have Nterminal leader pep tide sequences of 34 and 35 aminoacids respectively and their predicte d cleavage sites are located after Gln18-Ala21 and Pro17-Gly20 respectively. These cleavages yi elded 25 and 29 Kda mature products. PKSH5 and pKSH3 are the genomic clones encodi ng pVSP28 and pVSP31 respectively. Based on alignment studies, it was determined that pKSH3 and pVSP27 were the same transcript while pKSH5 and pVSP25 corresponded to different genes or they had alternative splicing (Staswick, 1988; Mason et al., 1988). Rapp et al. (1991) screen ed a genomic library of soybean leaves from depodded plants with the pVSP27 probe and dete cted both polypeptide products assembling and forming homoor heterodimers. Specifically, these authors identified the putative CAAT box, the TATA box and a TGTTGT(A/T)(G/T) enhancer in the 5 flanking region and three exons and two introns in the coding se quence of pVSP29. Also, this c oding sequence appeared as an inverted tandem repeat in one of the genomic clones indicating a recent duplication (Rapp et al., 1991). Currently, these genes are called vspA and vspB and their polypeptide products VSP and VSP respectively. Homologous genes have been identif ied in other species such as Atvsp in Arabidopsis thaliana and Bspa in hybrid poplar ( Populus alba x P. tremula ). The Atvsp gene encodes two polypeptide products of 29 and 30 kda proteins, is accumulated to high levels in hypocotyls, young leaves, flowers and pods and is regulat ed by sugars, jasmonates, wounding, light, phosphates and auxins (Berger et al., 1995). The Bspa gene encodes a bark storage protein of 32 kda, which accumulates in storage vacuoles of inner bark parenchyma and xylem rays reaching almost 50% storage proteins during fall (Zhu and Coleman, 2001). Three VSPs of 15, 19 and 32 kda were identified as a major component of the so luble proteins in the taproots of alfalfa. These

PAGE 43

43 proteins are accumulated during fall, when the plants are dormant, and degraded during spring or after defoliation (Hendershot and Volenec, 1993). Thus, it was observed that their level was 28 % of the total soluble protein before defoliation, decreased after defoliation but it was recovered 30 days later (Avice et al., 1996). Trafficking pathway Plant tissues usually store reduced nitrogen into proteins or polypeptides so-called storage proteins that are allocated into storage vacuoles. In this way, they are able to retain nitrogen and some essential aminoacids without creating an osmotic imbalance in the plant cell. These proteins are called seed or vegetative storage pr oteins according to the plant tissues where they were produced and stored (SSPs or VSPs resp ectively). SSPs include the albumins, globulins, prolamins and glutelins. For example, th e prolamins include zeins from maize ( Zea mays L.), gliadins from wheat ( Triticum sativum L.) and hordeins from barley ( Hordeum vulgare L.). VSPs were found in plants with storage or gans such as tubers from potato ( Solanum tuberosum L.) and sweet potato ( Ipomea batata L.), taproots of alfalfa ( Medicago sativa ), paraveinal mesophyll tissue from soybean ( Glycine max ) and other legumes and bark tissu es from trees such as poplar ( Populus spp) or willow ( Salix spp) (Muntz, 1998). These soluble proteins could follow three diffe rent pathways (Vitale and Raikhel, 1999; Nehaus and Rogers, 1998; Muntz, 1998). Naturally, the default pathway implies that proteins are primarily processed in the endoplasmic reticulum (ER), further processed in the Golgi apparatus (GA) and secreted outside the cell. Some polypeptides are produced in the rough ER and accumulated into large vesicles attached to it. These vesicles are storage vacuoles (also called protein bodies) like those vacuol es commonly formed by prolamins in the endosperm cells from maize and rice. Finally, these storage vacuoles, co ming either from the ER or the GA, could be

PAGE 44

44 fused in the central vacuole or tonoplast like globulins from dicotyledonous plants and some prolamins from other cereals (Muntz, 1998). In the lattest pathway, the first processing st ep involves a specific docking mechanism at the ER with loss of the targeting peptide dur ing the translation and incorporation of the polypeptides into the ER lumen for further modifications includ ing glycosilation, formation of disulfide bonds, folding and polymerization. In the second processing step, ER, GA or tonoplast-derived vacuoles have other speci fic docking mechanism at the GA and this mechanism involves internal, carboxy-terminal or amino-terminal vacuolar targeting signals. These docking systems are highly conserved am ong kingdoms and they were better described in animal models. Some remarkable examples are the docking systems formed by BIP at the ER and BP-80 at the vacuoles (Vitale and Raikhel, 19 99). In the final processi ng step, plant proteins lose the targeting pep tides and acquire their final confor mation as storage products at the vacuoles (Muntz, 1998). According to VSP coding sequences, targeting peptides to the ER and the vacuole were predicted (Staswick, 1988, 1994; Mason et al ., 1988). Later on, ultrastructural and immunocytochemical studies showed that VSPs were accumulated via RER and/or GA in the storage vacuole of the PVM from several legume species. It was reported that PVM cells were enriched with RER and AG and that VSP and were detected along the whole pathway in induced soybean plants where these proteins r eached 50% of the total protein content (Klauer and Franceschi, 1997). Previous studies indicated that vacuoles were differentially labeled by antibodies against tonoplast intrinsi c proteins (TIPs) which were indicators of the storage or lytic conditions of the vacuole ( and -TIPs respectively) (Jauh et al., 1998; Vitale and Raikhel, 1999). Recently, immunolabelling studies showed th at these vacuoles are functionally flexible

PAGE 45

45 and can be converted from storage to lytic form s or viceversa according to the soybean nitrogen requirements (Murphy et al., 2005). Overexpression of vspB Gene to Improve Nutritional Quality in Bahiagrass Subtropical bahiagrass cultivars have a seasonal growth pattern which directly affects plant yield. Slower growth produces low yield during fall and winter, and fast er growth produces higher yield during spring and su mmer in subtropical bahiagrass cultivars. Specifically, Cuomo et al. (1996) observed th at biomass production varied between 2-3 Mg ha-1 for cultivars Pensacola, Argentine and Tifton 9 in late spring, while they reached 11-12 Mg ha-1 in summer. Early on, Mislevy et al. (1 990) indicated that cultivar Tifton 9 had 30% more biomass production than cultivar Pensacola during ea rly winter. Later on, cultivars Pensacola, Tifton 9 and RRPS cycle 18 were evaluated for biomass production during the cool-season and authors observed that cultivar Tifton 9 and RRP S cycle 18 doubled the yield of Pensacola. This seasonal growth pattern al so affects plant nutritive value, because of the fast growth rate directly related to high temperatures which implies secondary growth and reproductive growth (Stewart, 2006). Therefor e, nutritional quality of subtr opical grasses decreases with maturity during spring and summer. Specifically, Johnson et al. (2001) obse rved that dry matter yield increased while forage quality parameters such as digestibilit y and protein fractions decreased through successive cu ttings during the summer in three subtropical grasses (bermudagrass cv. Tifton 85, stargrass cv. Flo rona and bahiagrass cv. Pensacola). This decrease in digestibility and soluble nitrogen fractions across summer could be partially compensated through nitrogen fertilization. Howeve r, this fertilizati on treatment reaches a threshold after midsummer, so that new dietary supplements need to be considered to support further animal performance.

PAGE 46

46 Digestibility and voluntary intake studies indicated that crude protein content and in vitro organic matter digestibility (IVOMD) decrease d in four tropical grasses (bermudagrass cv. Tifton 85, stargrass cv. Florona bahiagrass, cv. Pensacola and limpograss cv. Floralta) between 4-week and 10-week harvests during fall. However, the feeding value of Pensacola bahiagrass, represented by in vitro and in vivo OMD, remained steady while feeding values of Tifton 85 bermudagrass and Florona stargra ss decreased through the 6 weeks. Therefore, bahiagrass seems to retain its forage quality through fall season compared with other tropical grasses (Arthington and Brown, 2005). Therefore, nitrogen fertilization increases biomass production and crude protein cont ent in tropical grasses in general and in bahiagrass in particular, and these increases could be refl ected in animal perfor mance (Stewart, 2006). In summary, bahiagrass shows a seasonal grow th pattern that is reflected not only in biomass production but also in nu tritional quality. Acco rding to Cuomo et al. (1996), Jhonson et al. (2001), Arthington and Brown (2005) and Stewar t (2006), this seasonal pattern involves an increase in biomass production and decrease in nutritional quality during the warm-season which directly limits animal growth and performance. This loss coul d be partially compensated by nitrogen fertilization and dietary su pplies. However, the use of the vspB gene, encoding the VSP presents two main advantages: rumen st ability and enriched aminoacid composition. While most plant proteins are degraded by rume n proteolysis, bypass proteins remained intact and they are absorbed in ruminant intestin es. Also, engineered pl ants containing VSPs accumulated high levels of lysine in heterol ogous plants (Guenoune et al., 2003). Therefore, soybean VSP seems to be a promising candidate to enhance the nutritional quality of bahiagrass and it could affect total protein a nd essential aminoacid contents.

PAGE 47

47 Genetic Engineering to Enhance Pest Resistance Development of Bt crops Currently, insect pests cause 10-20% of crop losses and are a major limiting factor in crop production (Ferry et al., 2006). Traditionally, these pests were controlled by Integrated Pest Management (IPM) strategies invol ving the use of pesticides. Howeve r, the indiscriminate use of pesticides can produce adverse effects on human health and th e environment, including the development of insect resistance and the elimination of other bene ficial insects (Ranjekar et al., 2003; Ferry et al., 2006). To overcome these pr oblems, environmentally -friendly pesticides containing Bt ( Bacillus thuringiensis ) spores and crystals were developed. But these spray formulations were partially effective because th ey did not reach burrowing insects and did not persist long enough in the e nvironment. Therefore, Bt transgenic crops expressing -endotoxins were developed (Schnepf et al., 1998; Ferre a nd Van Rie, 2002; Ranjek ar et al., 2003; Kaur, 2006). Currently, this technology has b een adopted not only in the Un ited States but also in the rest of the world including developing countries such as China and India, where it was easily adopted by small farmers because it has a dir ect economic impact due to the reduction of pesticide applications and th e increase of crop yields (Huesing and English, 2004). The first generation of Bt crops include several comm ercial products expressing cry1Ab and cry1F genes for protecting crops lik e cotton and corn against di fferent insect pests like european corn borer ( Ostrinia nubilalis Huebner), southwestern corn borer ( Diatraea grandiosella Dyar) and corn earworm ( Helicoverpa zea Boddie) that were released since 1996 in the United States (Mende lsohn et al., 2003). These examples include marketed products expressing the cry1Ab gene like YieldGardTM corn hybrids (events MON810 and BT11 from

PAGE 48

48 Monsanto and Syngenta respectively). Later, HerculexI corn expressing a full length cry1F gene was produced by Pioneer Hi-Bred Internati onal and Dow Agrosciences / Mycogen. In cotton, the second generation of Bt products is already in the market. These products included Bollgard II, expressing the cry2Ab and cry1Ac genes (from Monsanto) and WideStrike expressing the cry1Ac and cry1F genes (from Dow AgroSciences). These products offer a broader spectrum of protection agains t insect pests (Bates et al., 2005). Bacillus thuringiensis toxins Delta-endotoxins protect plants against nemat odes and a large group of insects including Lepidoptera (butterflies and moth s), Diptera (flies and mosquito es), Coleoptera (beetles and weevils) and Hymenoptera (wasps and bees)(de Maagd et al., 2001; Ferre and Van Rie, 2002; Griffits and Aroian, 2005). These crystal protoxins are solubilized and proteolitically activated in the insect midgut where the active toxins bind to sp ecific receptors in the in testine epit helial cells leading to pore formation and cell death. The acti ve toxins have a conser ved structure formed by three domains. Based on conformational stud ies, domain I showed hydrophobic helices indicating that it could be res ponsible for pore formation, while domain II showed external loops in the -sheets suggesting that it is involved in r eceptor binding and therefore host specificity, similar to those specific binding mechanisms observed in immunogl obin-antigen binding reactions (Schenpf et al., 1998). Also, domain III is also invo lved in both phenomena because it has very high affinity to receptors located in the gut epithelium of different insect orders (Schenpf et al., 1998; Ranjekar et al., 2003; Abanti, 2004; de Maagd et al., 2001). These endotoxins are classified into four groups providing protecti on against four insect orders: cry 1 (Lepidoptera), cry 2 (Lepidoptera and Diptera), cry 3 (Coleoptera) and cry 4 (Diptera). So far, more than 100 cry genes had been already identified. Besi des these crystal proteins produced during sporulation, other bacterial proteins with insecticidal activ ities produced during vegetative

PAGE 49

49 growth such as the vegetativ e insecticidal proteins ( vip s) are under study (Schenpf et al., 1998; de Maagd et al., 2001; Bates et al., 2005). Strategies to increase cry genes expression levels Currently, only one case of field-developed resistance was reported but laboratory studies on field-selected strains indicated the potential of resistance de velopment in different insect populations (Ferre and Van Rie, 2002). According to Bates et al. (2005), this delay in resistance development under field trials could be explained by several factors including resistant individuals with higher fitness costs than the susceptible ones, a low frequency of resistant alleles, a dilution of resistant alleles in susceptible individuals feeding on non-transgenic plants, and high toxin doses in the transgenic plants. Or iginally, the use of tran sgenic crops expressing moderate -endotoxin levels to ensure the survival of susceptible individuals in the insect population seemed to be the best strategy. But, this strategy was influenced by environmental conditions producing a small delay and affecting crop yield. Currently, th e use of transgenic crops expressing high toxi n levels to ensure th e death of the heteroz ygous individuals for the resistance gene (autosomal, r ecessive), produces a longer delay and maintains the crop damage below an economic threshol d (Bates et al., 2005). Therefore, to increase Bt expression levels different molecu lar approaches were taken: the use of cry truncated sequences only expressi ng the active toxins, the use of cry codon-optimized sequences for enhanced plant expression and the reduced use of AT sequences for eliminating alternative splicing sites and pol yadenilation signals (Schenpf et al., 1998; Bohorova et al., 2001; Kaur, 2006). Other strategies invo lve creating fusion constructs (Bohorova et al., 2001), stacking cry genes with different binding sites (like hybrid or site-dir ected mutagenesis-generated genes)(Kaur, 2006), and pyramiding genes encoding pr oteins with different toxicity mechanisms like vegetative insecticidal proteins ( vip ) or proteinase inhibitors (P I) (Ferry et al., 2006). To

PAGE 50

50 delay insect resistance development, these molecu lar strategies were combined with insect pest management (IPM) strategies including the use of refuges formed by non-transgenic plants (Cannon, 2000; Ranjekar et al ., 2003; Bates et al., 2006). Expression of cry1F Gene to Enhance Insect Resistance in Bahiagrass Bahiagrass ( Paspalum notatum var. Flugge) is the predomin ant grass in forage in the southeast of the United States and it plays a ke y role supporting beef and dairy cattle industries in North Florida (Chambliss, 2002). Even though ba hiagrass withstands most plant diseases, it is susceptible to insect pests such as mole crickets ( Scapteriscus spp) and fall armyworm ( Spodoptera frugiperda J. E. Smith). Fall armyworm (FAW) is one of the most important insect pests in the southeast of United States, causing seasonal economic losses in field crops such as sweet and field corn, forage and turf grasses, other cereals like rice and so rghum, and other crops like cotton and peanut (Sparks 1979, Meagher an d Nagoshi, 2004). In the 1970s, these outbreaks resulted in economic losses of 30-60 million dollars (Sparks, 1979, Meagher, personal communication). Initiall y, it was observed that cry1Ab and cry1F genes provided good protection levels against different insect pests like European corn borer, southwestern corn borer and Corn Earworm in cotton and corn crops (M endelsohn et al., 2003). Amongst these pests, the ECB is considered the most important insect pe st in the Midwestern and northeastern, while FAW and CEW are the most important pests in the southeastern United States. In southeastern U.S., the subtropical weather a llows double cropping if the tropical crops like corn and cotton are resistant enough to overcome su mmer pests and diseases. Furt her studies showed that all Bt events expressing the cry1Ac gene (YieldGard corn hybrids) were effective in controlling whorl damage by FAW and ear infestation and damage by CEW at normal and late planting dates (Williams et al., 1997; Buntin et al., 2004; Wiatra k et al., 2004). However, Abel and Adamczyck (2004) suggested that differential cry1Ab expression patterns could be limited by reduced

PAGE 51

51 nitrogen supply or photosynthesis rate in green tissues. Recently, field tr ials with corn hybrids expressing a full length cry1F gene (Herculex I) indicated that this gene provided protection against a wide range of insect pests includi ng FAW (EPA, 2001). However, these reports are limited to commercial products from crops like co rn and cotton and there are no reports on the effects of cry genes against insect pests in forage or turfgrasses. Therefore, the expression of a synthetic cry1F gene encoding a -endotoxin was evaluated as a stra tegy to enhance resistance against FAW in bahiagrass.

PAGE 52

52 Figure 2-1. Bahiagrass ( Paspalum notatum Flugge ). A) erect or semipostrate plant growth habit indicating aboveground stolons, under ground rhizomes, aerial stems and roots with details of the ligule and spikelet http://www.tropicalforages.info/key/Forages/Media/Html/Paspalum_notatum.htm B) bahiagrass pasture with inflorescences http://plant-materials.nrcs. usda.gov/gapmc/photo.html C) cattle grazing on bahiagra ss pastures in Florida http://www.animal.ufl.edu/facilities/sbru/

PAGE 53

53 Figure 2-2. Transgenic crops unde r field trials and deregulation process in the United States (APHIS-USDA database http://www.nbiap.vt.edu/ last accesed May, 2007). A) Approved field releases by phenotypes, B) Approved deregulation petitions by phenotypes

PAGE 54

54 Figure 2-3. Total number of issued or acknowledg ed field tests of transgenic crops sorted by state in the United States (http://www.isb.vt.edu/cfdocs/fieldtests1.cfm last accessed May, 2007).

PAGE 55

55 CHAPTER 3 OVEREXPRESSION OF THE vspB GENE FROM SOYBEAN TO ENHANCE NUTRITIONAL QUALITY IN BAHIAGRASS ( Paspalum notatum VAR. FLUGGE) Introduction Bahiagrass ( Paspalum notatum var. Flugge) is the predominant grass in forage pastures in tropical and subtropical regions and it supports ruminant producti on in these areas worldwide. This subtropical grass is a C4 plant, like corn and sorghum, which implies that it has higher water and nitrogen use efficiencies and performs better than C3 plants under high temperature, moisture and light intensity c onditions (Gates et al., 2004; Mo ser et al., 2004). In Florida, bahiagrass is the primary forage crop supporting b eef and dairy cattle industries and covering 2.5 million hectares (Chambliss, 1996, 2002; Burton et al., 1997; Blount et al., 2001). It is preferred by farmers and producers because it has low management requirements and very good persistence and yield under different environmental stresses. It is tolerant to poor soils including light-textured, low fertility and marginal pH soils. It is tolerant to drought stress because it has a well-developed root system that helps to impr ove water holding capacity and to reduce nutrient leaching in soils. It is tolerant to most funga l diseases and insect pests, except for ergot ( Claviceps spp), dollar spot ( Sclerotinia spp), mole crickets ( Scapteriscus spp) and fall armyworms ( Spodoptera spp). Moreover, it is tolerant to overgrazing and high cutting frequencies which favors plant regrowth and maintains nutritional quality during summer (Chambliss, 2002; Blount et al., 2001; Stewart, 20 06). However, it requires high sowing rates and is susceptible to common herbicides. Most C4 tropical grasses, incl uding bahiagrass, have a low protein content which affects animal perfor mance. Bahiagrass protein content reaches 11% during spring and decreases to 57% during summer and fall. This decrease in protein content with an increase in fiber content reduces not on ly bahiagrass nutritional value but also animal performance giving reduced aver age daily gain (Cuomo et al., 1996; Gates et al., 2004).

PAGE 56

56 Genetic engineering and breeding efforts ha s been focused in crop improvement. Most transgenic crops are improved by incorporating traits like herbicide tolerance and insect resistance while few crops are improved for increa sing crop yield and quality because these traits are controlled in more complex ways (Dunwell, 2000). Specifically, gra ss pastures have low nutritive value compared with legume based-pastures because grasses have low protein content and are deficient in essential aminoacids like lysine, tryptophan a nd threonine (Sun and Liu, 2004). Nutritional quality is a complex trait beca use it requires the regulation of some metabolic pathways without affecting the me tabolic profile of the plants. To improve nutritional quality new molecula r approaches were developed (Tabe and Higgins, 1998; Galili and Hoef gen, 2002; Sun and Liu, 2004). These molecular studies are focused on upor down-regulating expression le vels of enzymes involved in the aminoacid synthesis or degradation pathways so that an enhanced producti on of free essential aminoacids may lead to an increase of total protein content and protein qualit y in plants (Galili et al., 2000; Habben et al., 1995). Also, they are focused on in creasing the levels of essential aminoacidsenriched proteins, mostly by overexpressi ng storage proteins in forage crops. To prevent heterologous protein degradati on, two approaches were followed: producing recombinant proteins including endoplasmic reticulum (ER)-retention signals like lys-asp-glu-leu (KDEL) (Khan et al., 1996; Tabe et al., 1995; Wandelt et al., 1992) or using those storage proteins that are naturally accumula ted in vegetative tissues (VSPs). Several VSPs were identified, isolated and us ed for increasing protei n content and quality in forages. Vegetative storage pr oteins were found in plants with storage organs such as tubers from potato ( Solanum tuberosum L.) and sweet potato ( Ipomea batata L.), taproots of alfalfa ( Medicago sativa ), paraveinal mesophyll tissue from soybean ( Glycine max ) and other legumes

PAGE 57

57 and bark tissues from trees such as poplar ( Populus sp) or willow ( Salix sp) (Staswick, 1994; Muntz, 1998). Although soybean-derived VSPs have high homology with a tomato acid phosphatase (DeWald et al., 1992), they have very low acid phosphatase activity probably due to the loss of the catalytic site (Leelapon et al., 2004). These pr oteins have a turnover rate controlled by the sink/source status of the st orage organs and they could be preferentially synthesized or degraded at di fferent developmental stages of the plant. Originally, VSP and VSP and their encoding genes, vspA and vspB were characterized from soybean tissues (Staswick, 1988; Mason et al., 1988; Rapp et al., 1991). La ter, ultrastructural and immunocytochemical studies showed that VSPs were accumulated via rough ER (RER) and/or golgi apparatus (GA) in the storage vacuole of the paraveinal mesophy ll (PVM) from several legume species. It was reported that PVM cells were enriched with RER and GA and that vsp and were detected along the whole pathway in induced soybean plants where these proteins reached 50% total protein content (Klauer a nd Franceschi, 1997). Rece ntly, immunolabelling studies showed that these vacuoles are functionally flexible being converted from storage to lytic forms and viceversa according to the soybean nitrogen requirements (Murphy et al., 2005). The use of the vspB gene, encoding the soybean VSP presents two main advantages: rumen stability and enriched aminoacid compositi on. While most plant proteins are degraded by rumen proteolysis, bypass proteins remained intact and they are absorbed in ruminant intestines. It was previously observed that VSP behaves as a bypass protein be ing stable in the rumen and absorbed in the cattle in testines (Guenoume et al., 2002). Be sides, VSPs contain ca.7% lysine (Mason et al., 1988; Staswick, 1988). Engineered plants containing VSPs accumulated high levels of lysine in heterologous plan ts (Guenoune et al., 2003). Because vsp is a rumen proteolysis-resistant (Galili et al., 2002) and lysine-enriched protein (Mason et al., 1988;

PAGE 58

58 Staswick, 1988), it is a promising candidate to improve plant nutriti onal quality in bahiagrass for ruminant feeding. Therefore, the objective of th is work was to overexpress a soybean vegetative storage protein gene and to evaluate the effect s of this gene on the nutritional quality of bahiagrass ( Paspalum notatum Flugge). Materials and Methods Soybean vspB Gene The vspB gene and VSP polypeptide from different soyb ean tissues were molecularly characterized by different authors (Staswick, 1988; Mason et al., 1988; Rapp et al., 1991). Specifically, they identified two cDNA clones th at were highly homologous: pVSP27 (Staswick, 1988) and pKSH3 (Mason et al., 1988). Further studi es using genomic libraries identified the putative CAAT box, the TATA box and a TGTTGT (A/T)(G/T) enhancer at the 5 flanking region and three exons and two in trons in the coding sequence of vspB gene (Rapp et al., 1991). The vspB gene from the vsp27 cDNA clone, as reporte d in the NCBI database (M20038), has a coding sequence that is 762 bp in length (Figure 3-1). The VSP polypeptide is 254 aa length and contains a 35 residue ER-signal peptide (Mas on et al., 1988) and a putative FPLR vacuolartransit peptide (DeWald, 1992) in the NH2-terminal region. The soybean vspB coding sequence in the pKSH3 vector was kindly provided by Dr. R. Shatters (ARS-USDA, Ft. Pierce, Fl). To enhance vspB expression, the pKSH3 vector was us ed in further clon ing strategies. Construction of Expression Vectors for the vspB Gene A precise description of the cloning strate gy to generate the expression vectors and respective cassettes is described in Figure 3-2 and the specific cl oning protocols and vector maps are described in Appendix 1 and 2 respectively. The complete soybean vspB sequence was amplified from the plasmid pKSH3 and introduced in the pGEM-T Easy Vector (Promega). For amplifying the vspB coding sequence,

PAGE 59

59 we used the forward primer: 5 CG TCTAGAACGCGT ATGAAGTTGTTTGTTTTCTTT GTTGC including the XbaI and MluI sites and the reverse primer: 5 CG GCGGCCGCACTAGT CTCAATGTAGTACATGGGATTAGGAAG including the NotI and SpeI sites. A 25 l PCR reaction was set up using the PCR Core System II (Promega). The PCR product was used in a lig ation reaction 1:1 (ins ert:vector) with the LigaFast Rapid DNA Ligation Sy stem (Promega) and incubated overnight at 4C. The ligation products were transformed into co mmercial chemical competent cells (Life Technologies), plated in Luri a Broth (LB) medium with 7 l IPTGX, 40 l X-gal and 100 g/ml ampicillin and incubated overnight at 37C. Pr imary colony screening identified four white colonies. These colonies were grown in 4 ml LB medium containing ampicil lin overnight at 37C and 220 rpm. Plasmid DNA was isolated using th e QIAprep Spin Miniprep Kit (QIAGEN) and plasmid quantity and quality was confirmed by running a 0.8% agarose gel. Further screening by PCR and by restriction digestions with XbaI and NotI MluI and SpeI and XbaI NotI and BamHI indicated that all colonies contained the 712 bp am plified fragment and a ll the restriction sites were functional. According to the sequenci ng results, both colonies were completely homologous to the vspB sequence. The intermediate vector was called pGFL1 (Figure2). The vspB sequence was excised as an XbaI NotI fragment from the intermediate vector pGFL1 and cloned into the plasmid pCMYCKDEL (k indly provided by Dr. Altpeter, Agronomy Department, University of Florida). The plasmid pCMYCKDEL contained the 35S CAMV promoter, the c-myc tag, the ER-retention si gnal KDEL and the 35S CAMV polyadenilation signal. The KDEL is a carboxy-terminal tetrapeptid e that allows the rete ntion of a family of soluble proteins in the ER (Munro & Pelham, 1987) The c-myc tag is a synthetic peptide formed by ten aminoacid residues corresponding to the coding sequence be tween the 408-439bp of

PAGE 60

60 human c-myc gene product (EQKLISEEDL from the 9E10 hybridoma, Evan et al., 1985). Epitope tagging is widely used for different pr otein studies like protei n expression, localization, purification, topology, dynamics, interactions, functional analysis, and discovery (Jarvik and Telmer, 1998). Plasmid DNA was isolated using the QIAprep Spin Miniprep Kit (QIAGEN) and plasmid concentration and quality were evaluated by r unning a 0.8% agarose gel. Plasmid backbone was prepared for ligation by 3 e nd dephosphorylation with shrimp alkaline phosphatase (SAP, Promega) and cleaned with spin columns from the QIAquick Gel Extraction Kit (QIAGEN). The XbaI NotI insert vector was gel-extract ed and cleaned with spin columns from the QIAquick Gel Extraction Kit (QIAGEN). Both fr agments were used in a ligati on reaction 1:1 (i nsert:vector) incubated overnight at 4C. Th e ligation products were transfor med into electrocompetent cells of E. coli DH5 Six colonies were screened by PCR. Four positive colonies were further checked by restriction digestions with XbaI XbaI and NotI and PstI showing the right size fragments. Two colonies were sequenced and one colony was homologous to the vspB sequence. Besides, the translation frame of vspB coding sequence was aligned with the c-myc tag and the ER-retention signal KDEL, and th e CAMV 35S terminator from the pCMYCKDEL vector. This plasmid was called pGL2 (Figure 3-2). From the pGL2, a fragment containing the vspB sequence, the c-myc tag, the ER-retention signal SKDEL and the 35S CaMV terminator was amplified. A forward primer: 5 CG GGTACC ATGAAGTTGTTTGTTTTCTTTG TTGC including the KpnI and a reverse primer: 5 CG GAGCTCGTTTAAAC GCATGCCTGCAGGTCACTG including the SacI and PmeI sites were used. The 25 l PCR reac tion was set up using the PCR Core System II (Promega). PCR product was cleaned with spin columns from the QIAquick Gel Extraction Kit (QIAGEN).

PAGE 61

61 A PstI fragment containing ubi1 promoter and first intron (C hristensen and Quail, 1992) from pJF NPTII (Altpeter, 2000) was cloned into the pCAMBIA2300 vector. The pCAMBIA2300 contained a selectable marker cassette formed by a double 35S promoter, the nptII gene and a 35S terminator (Figure 3-2). The PstI insert was gel-extracted and cleaned using the spin columns from the QIAquick Ge l Extraction Kit (QIAGEN). The pCAMBIA2300 backbone was digested with PstI dephosphorylated with SAP ( QUIAGEN) and cleaned with spin columns from the QIAquick Gel Extraction Kit (QIAGEN). Both fragments were used in a 1:1 ligation reaction inc ubated overnight at 4C. Ligation products were electroporated into electrocompetent cells of E. coli DH5 Four colonies were screened. These colonies were grown in 4 ml cultures overnight in LB medium and kanamycin at 37C and 220 rpm. Plasmid DNA was isolated using the QIAprep Spin Mi niprep Kit (QIAGEN). Further screening by restriction digestions with XhoI EcoRI and PstI indicated that the insert was correctly oriented in one colony. This intermediate vect or was called pGFL2 and used as recipient vector for further cloning steps (Figure 3-2). The PCR fragment from pGL2 was cloned into the pGFL2 vect or to produce the expression vector pGL4. Insert and vector were digested with SacI and KpnI The pGFL2 vector was further dephosphorylated with SAP (Promega) and cleaned with spin-columns from the QIAquick Gel Extraction Kit (QIAGEN). The 3: 1 (insert:vector) liga tion reaction was set up using LigaFast Rapid DNA Ligation System (Promega), and incubated overnight at 4C. The ligation products were transforme d into electrocompetent cells. Fi ve colonies were screened by PCR and restriction digestions. These colonies we re grown in 4 ml LB medium and ampicillin overnight at 37C and 220 rpm. Plasmid DNA was isolated with QIAprep Spin Miniprep Kit (QIAGEN) and plasmid quantity and quality we re confirmed by 0.8% agarose gel. PCR and

PAGE 62

62 restriction digestions with PmeI and SacI KpnI and SacI PmeI and SacII and HindIII indicated the presence of the insert. Two colonies were sequenced. One colony was completely homologous to the KpnI SacI fragment sequence and all the re striction sites were functional (Figure 3-2). Other Expression Vectors and Cassettes The vectors pJF NPTII and pHZ35S NPTII were used as selectable markers. The pJF NPTII vector contains a selectable ma rker cassette formed by maize ubi quitin promoter and first intron (Christensen and Quail, 1992), the nptII coding sequence (Bevan, 1984) and the CAMV35S polyadenilation signal (Dixon et al., 1986). The pHZ35S NPTII vector contains a selectable marker cassette formed by the CAMV35S pr omoter (Odell et al., 1985) and hsp70 intron (Rochester et al., 1986), the nptII coding sequence (Bevan, 1984) and the CAMV35S polyadenilation signal (Dixon et al., 1986). The v ector pRSVP1 (provided by Dr. R. Shatters, ARS-USDA, Ft. Pierce Fl) contains a vspB expression cassette formed by maize ubi1 promoter and Adh intron, the vspB coding sequence and a 3 nos polyadenilation signal (Grando, 2001; Grando et al., 2005). Plasmid DNA was isolated using the QIAprep Midiprep Kit (QIAGEN). Fu et al. (2000) indicated that the use of minimal constructs (MCs) containing only the expression cassettes, instead of the complete plasmid vectors, enhanced the expression levels in the transgenic plants. Therefore, plasmids were digested, their respec tive fragments were gel-extracted and fragment quality and concentration were conf irmed by a 0.8% agarose gel. The vspB cassette was excised as a PvuII fragment (3.4kb) from the pGL4 vector and as an EcoR1 fragment (1.9kb) from the pRSVP1 vector. The nptII cassette was excised as an I-SceI fragment (3kb) from the pJFNPTII vector and as AlwnI NotI fragment (2.6kb) from the pHZ35SNP TII. These expression cassettes were isolated by gel electrophoresis, and the corresponding band was excised and purified using

PAGE 63

63 the Wizard SV Gel and PCR cleanup system (Promega, Madison, WI) to remove vector backbone sequences. These expression cassettes were used for the biolistic gene transfer (Figure 3-3). Transformation and Regeneration Protocols Mature seeds were used for generating embryogenic calli from bahiagrass ( Paspalum notatum Flugge) cultivar Argentine (Altpeter and Positano, 2005). Plates with embryogenic calli were cobombarded with microparticles co ated with the MCs fr om the pGL4, pRSVP1, pJFNPTII and pHZ35SNPTII vectors. Four independe nt gene transfer experiments were carried out. Specifically, 49 petri dishes, with approx. 30 callus pieces each, were cobombarded with MCs from pGL4 and pJFNPTII, 23 petri dishes with MCs from pGL4, pRSVP1 and pJFNPTII, and 19 petri dishes with MCs fr om pGL4 and pHZ35SNPTII. Transgenic calli expressing the nptII gene were identified during subsequent su bcultures in a medium containing 50 mg L-1 paromomycin sulfate as a selec tive agent (Altpeter and James, 2005). Transgenic plants were grown under 16 h light photoperiod at 26-29C in growth chambers and transferred to the greenhouse after two or three weeks. Molecular Studies Transgene integration was evaluated by mol ecular studies includi ng polymerase chain reaction (PCR) analyses while transgene expression was evaluated by enzyme linkedimmunoadsorbent assays (ELISA) for the nptII gene and western blots for the vspB gene. Recombinant VSP was isolated by co-immunoprecipitati on using anti c-myc antibodies. Enzyme linked-immunoadsorbent assays (ELISA) A rapid qualitative assay was performed to evaluate the expression of the nptII marker gene in leaf tissue from bahiagrass transgenic lines. Pieces of young leaf tissue were ground with a disposable pestle in an ependorf tube and pr otein extracts were obtained in a phosphate saline

PAGE 64

64 buffer (PBS). Protein concentration was estimated with the Coomasie Plus Protein Assay reagent and Coomasie standards (Pierce Biotechnology, Inc.) at OD595 with a spectrophotometer (BioRad Laboratories). Twenty micrograms of tota l protein were loaded in each well and wild type, positive and negative controls were includ ed. ELISA assays were performed according to the protocol suggested by the A gdia kit (Agdia, Elkhart, IN) and co lorimetric data were captured with a digital camera. Polymerase chain reaction (PCR) PCR analyses were performed to confirm the integration of the vspB gene into the bahiagrass transgenic lines. Genomic DNA from the transgenic lines was extracted following a modified Dellaporta method (1983). Three sets of primers were used for the screening. The forward primer 5'CG GGTACC ATGAAGTTGTTTGTTTTCTTTGTTGC a nd the reverse primer 5'CG GAGCTC GTTTAAAC GCATGCCTGCAGGTCACTG were designed for amplifying a 1kb fragment containing th e coding sequence of the vspB gene, the c-myc tag, the SKDEL signal and the 35S polyadenilation signal. PCR was performed using the PCR Core System II (Promega).The cycling conditions were 95C 2 mi n initial denaturation, 30 cycles of 95C 1 min, 50C 1 min, 72C 1min and 72C 5 min final extens ion. Also, two sets of primers were used according to Grando (2001). The first pair included the forward primer P1 5GTTCTTCGGAGGTAAAAT and the reverse primer P2 5 TTCGCCTCTGTGGT and it amplified a 611 bp fragment. The second pa ir included the forward primer P3 5GCAGGCTACCAAAGGT and the reverse pr imer P4 5TAGGTGACTTACCCACAT which amplified an 843 bp fragment. Both fragments contained the vspB coding sequence. PCR was performed using the PCR Core System II (Prome ga).The cycling conditi ons were 95C 15 min initial denaturation, 35 cycles of 95C 1 mi n, 57C 1 min, 72C 1min and 72C 15 min final extension. The PCR products were electrophoresed in 0.8% agarose gel, stained with ethidium

PAGE 65

65 bromide and digital images were captured with the QuantityOne Software (BioRad Laboratories). Sodium dodecyl sulphate pol yacrilamide gels (SDS-PAGE) Five hundred milligrams of leaves were ground w ith liquid nitrogen and 1 ml of extraction buffer (100 mM Tris.HCl (pH 8.0), 200 mM NaCl 1Mm EDTA, 5% glycerol, 0.2% TritonX100, 1mM -mercaptoethanol or DTT) supplemented with 32 l/ml buffer of the Protease Inhibitor Cocktail (Sigma). Two successive centrifugati on steps for 20 and 10 min at 4000 rpm (Sorwall SS-34) were done to obtain a clear supernatant. Protein concentration wa s estimated with the Coomasie Plus Protein Assay reagent and Coom asie standards (Pierce Biotechnology, Inc.) at OD595 with a spectrophotometer (Bio Rad Laboratories). Fifteen or twenty micrograms of total protein were separated on 12% Sodium Dodecy l Sulphate Polyacrylamide Gels (SDS-PAGE). Two molecular markers were used: Prestained SDS-PAGE standards, low range (Bio-Rad Laboratories) and Magic Mark XP Western protein standard s (In vitrogen). Gels were electrophoresed in Mini PROTE AN 3 Electrophoresis Cell (Bio-R ad Laboratories) at 125 v and room temperature for 75 min. Gels were eith er stained with Coomasie blue (Sigma R-250, Sigma) or further used fo r western blot analysis. Western blot analysis SDS-PAGE gels were transferred to nitro cellulose or PVDF membranes using a Mini Trans-blot Electrophoretic Transfer Cell and the recommended protocols (Bio-Rad Laboratories). VSP was detected with VSP antibodies (provided by Dr. S. Galili, Agronomy and Natural Resources Department, The Volcani Ce nter, Israel) or c-myc antibodies (anti c-myc antibody, Sigma). Protocols were adjusted for VSP antibodies with soybean leaves and for cmyc antibodies with bahiagrass leaves. Parameters evaluated were differe nt leaves, extraction buffers, protein concentrations, primary and se condary antibody dilutions and incubation times.

PAGE 66

66 For VSP antibody detection, a tis sue sample of soybean leaves was used as starting material, 15 g total protein were loaded in the SDS-PAGE, and the VSP antibody was incubated in a 1:1000 dilution in orbital shaker for 4 hr. For c-myc antibody detection, a tissue sample of bahiagrass leaves was used as starting material 20 g total protein were loaded in the SDSPAGE gel and the c-myc antibody was incubated in a 1:1000 dilution in orbital shaker for 2 hr. Secondary antibodies were incubated in a 1:50,000 dilution in orbital shaker for 2 hr. Detection was performed using a very sensitive chemilu minescent substrate (Supersignal West Femto Maximun Sensitivity Substrate, Pierce Biot echnology, Inc.). Western blots with c-myc antibodies were performed in bahiag rass samples to evaluate the VSP expression levels variation from different leaves, tillers, and plants. To compare different leaves, four samples were taken from the the youngest to the oldest leaf and they were labeled consecutively as 1, 2, 3 and 4. Highest expression was observed in third and four bahiagrass leaves. Therefore, to compare different plants and tillers whitin plants two samples from the third fully emerged leaf were taken. Co-immunoprecipitation of recombinant VSP The Pro-Found c-myc Tag IP/Co-IP kit and application set (Pie rce Biotechnology, Inc.) was used to purify the VSP recombinant protein. Five grams of leaf tissue were ground with liquid nitrogen, and 15 ml extraction buffer (100 mM Tris.HCl (pH 8.0), 200 mM NaCl, 1Mm EDTA, 5% glycerol, 0.2% TritonX100, 1mM -mercaptoethanol or DTT) was added. Two successive centrifugation steps for 20 and 10 min at 4000 rpm (Sorwall SS-34) were done to obtain a clear supernatant. Acet one precipitation was done to con centrate the protein extracts. Protein concentration was estimated with th e Coomasie Plus Protein Assay reagent and Coomasie standards (Pierce Biotechnology, Inc.) at OD595 with a spectrophotometer (BioRad Laboratories). Ten microliters of anti c-myc agar ose with 2 mg protein sample and with 50 l c-

PAGE 67

67 myc tagged control were incubated overnight in an orbital shaker at 4C. The mixture was loaded into the spin-columns, washed three times with TBS-T buffer, and eluted with Elution buffer according to the instructions of the manufacturer (Pierce Biotechnology, Inc.). The elutants of the three steps (i.e. loading, washing and eluting) were recovered. To evaluate the quality and quantity of the recombinant VSP twenty microliters samples were loaded into a SDS-PAGE gel and western blots were performed. Results Transformation and Regeneration Protocols Four independent gene transfer experiments produced 214 regene rated plants from 91 petri dishes with an average of 2.31 regenerated pl ants/plate (Figure 3-4) Specifically, these experiments included 156 regenerated plants with MCs from pGL4 and pJFNPTII, 16 regenerated plants with MCs from pGL4, pRSVP1 and pJFNPTII, and 42 regenerated plants with MCs from pGL4 and pHZ35SNPTII. Molecular Studies Enzyme linked-immunoadsorbent assays The screening of the putativ e transgenic plants by nptII ELISA indicated that 91 plants expressed the nptII gene from 110 plants analyzed. Specifically, 83 nptII (+)/ 102 analyzed plants with MCs from pGL4 and pJFNPTII, 8 nptII (+)/8 analyzed plants with MCs from pGL4, pRSVP1 and pJFNPTII. Figure 3-5C shows th e ELISA plate arrangement for one set of transgenic bahiagrass lines, including negative and positive controls from nptII protein and a control of transgenic bahiagrass. Polymerase chain reaction The screening of the putative transgenic bahiagrass plants by PCR with the three primers sets confirmed the presence of the vspB gene in 34 transgenic plants (Figure 3-5A). These plants

PAGE 68

68 include 28 transgenic plants with MCs from pGL4 and pJFNPTII, 6 transgenic plants with MCs from pGL4, pRSVP1 and pJFNPTII, and no tran sgenic plants with MCs from pGL4 and pHZ35SNPTII. Figure 3-5B shows the 1 kb fragment amplified with the first set of primers in gDNA from the transgenic bahiagrass lines. Sodium dodecyl sulphate polyacrilamide gels According to the SDS-PAGE gels, VSPs were detected in the total protein profile from three soybean samples. In the soybean profile, VSP appeared as a strong 32kda band with variable concentration ranking between 10-15% total protein/ plant (Figure 3-6A). A weak 32kda band (31.5kda predicted size, Gasteiger et al ., 2003) corresponding to the recombinant VSP was detected in the total profile from several transg enic bahiagrass lines. Howe ver, it was not clear if this band corresponded to the recombinant VSP or to some other endogenous protein (3-6B). Western blot analysis Western blots with VSP antibodies indicated that VSP levels were directly related to total protein levels in the range of 15 to 60 g tota l protein in soybean. In order to estimate the sensitivity of the VSP antibodies, a calibration curve with a range from 0.5 to 15 g total protein was established using the soybean samples. Based on this curve, the VSP antibodies were able to detect less than 50 ng soybean VSPs. To determine the detection limit of VSP antibodies in bahiagrass, a calibration curve in the range of 15 to 75 ug total protein was established using bahiagrass samples. Irrespective of the strong ba nd in the soybean control and the corresponding bands in the bahiagrass samples observed in the SDS-PAGE gels, the recombinant VSP was not detected in bahiagrass samples by VSP antibodies (data not shown). Western blots with more sensitive c-myc antibodies indicated that VSP levels varied among different plants (Figure 3-7A,B), different ti llers within plants (Fig ure 3-7C) and different leaves within tillers (Figure 3-7D). The highest VSP levels were observed in third and four

PAGE 69

69 leaves from the tillers and in AT22-4 and AT22-7 among bahiagrass plants. According to the sensitivity limit for Supersignal West Femto Maxi mun Sensitivity Substrate, the substrate detects between pico and femtomoles per microgram of loaded protein, therefore the bands obtained from bahiagrass leaf samples corr esponded to 0.001-0.01% total proteins. Co-immunoprecipitation of recombinant VSP Based on the co-immunoprecipitation kit protocol three fractions were recovered for the bahiagrass protein extracts and the c-myc c ontrol. These fractions corresponded to unbound proteins from the original protein extract, wash ing buffer and elution buffer containing the c-myc antibodies bound to th e recombinant VSP The SDS-PAGE gels co ntaining these fractions indicated no degradation in the total proteins from bahiagrass samples.The western blots with tthe anti c-myc antibodies indicated th e presence of the recombinant VSP (32kda) in the elution fraction and of a large polype ptide (approx. 50kda) in the unbound fr action from bahiagrass leaf samples. The control fractions showed the presen ce of the c-myc control in the elution fraction indicating that co-immunoprecipita tion was efficient; however, it seemed to be an excess of cmyc protein because a small band was detected in the washing fraction (Figure 3-8). Discussion We designed an expression vector incl uding a constitutive and strongly expressed promoter for monocots; a KDEL signal for ER-retention and a c-myc tag for antibody detection to enhance the expression of the vspB gene in the transgenic bahiagrass plants. The maize ubi1 promoter is one of the strongest promoters in monocot transgenic plants. Transgene expression is normally enhanced by including its first intron (Christensen et al ., 1992; Christensen and Quail, 1996; McElroy and Brettell, 1994). Previous mol ecular farming studies in dicated that KDEL ERretention signal increased expressi on levels of functional single-cha in antibodies (Schouten et al., 1996) and monoclonal antibodies (Ramirez et al., 2003). Also, sorting signals such as the ER-

PAGE 70

70 signal peptide (Mason et al., 1988) and a putativ e FPLR vacuolar-transit peptide (DeWald, 1992) in the NH2-terminal from the VSP enhanced expression of a hepa titis B antigen in transgenic potatoes for oral immunization studies (Richter et al., 2000). To increase transformation efficiency and transgene expression and stability, we also used MCs in the biolistics experiments because its use should generate simple integration patterns with low number of transgene copies and rearrangements and less ch ances of silencing events (Fu et al, 2000) Based on bahiagrass transformation, selecti on and regeneration protocols previously established ( Altpeter and Positano, 2005; Altpeter and James, 2005), we generated 91 nptII (+) plants from 110 analyzed plants. Based on the results from nptII expression detected by ELISA and VSP expression detected by western blots, 89% of the plants coexpressed the nptII and the vspB genes. Also, VSP expression levels varied among differ ent plants, different tillers within plants and different leaves with in tillers having the highest expr ession levels in third and four bahiagrass leaves. However, VSP expression levels in bahiag rass leaves corresponded to 0.0010.01% total proteins. Currently, VSPs have a contr oversial role as storag e proteins in soybean plants because even though they represented 10-15% total protein in young soybean leaves (Grando et al., 2005) and increased to 45% total soluble protein after de ppoding; VSP expression levels could be reduced without affecting plant yield. These resu lts indicated that VSPs do not play a key role in seed protein accumulation and seed production (Staswick et al., 2001). Nevertheless, transgenic tobacco studies indicate d that high VSP levels we re stored in tobacco leaves. Specifically, VSP was stably expressed reaching 2-6% total proteins (Guenoune et al., 1999) while VSP only reached 2% total protein and it wa s degraded with leaf age (Guenoune et al., 2002b). To enhance these expression levels, aut hors cotargeted VSPs to the vacuole and the chloroplast (Guenoune et al., 2002a) or co expressed both soybean VSPs or VSP and DHPS

PAGE 71

71 reaching ca. 4% total protein in leaves (Guenoune et al., 2003). In contrast, we observed VSP expression levels corresponded to 0.001-0.01% tota l proteins in bahiagrass leaves from preflowering plants. These levels were similar to those reported in corn by Grando et al. (2005). Specifically, these studies indicated low VSP expression levels show ing 0.5% total soluble protein and still lower 0.03% in leaves of preflowering plants from primary transformants and their progeny (Grando et al., 2005). Based on low VSP expression levels observed in corn and bahiagrass, it seems that transg enic proteins are more difficult to express in monocotyledoneus plants probably because their reduced translat ion or their degradation by endogenous proteases (Grando et al., 2005). Part icularly, Bellucci et al. (2000) coexpressed and -zeins containing the KDEL signal in tobacco for enhancing ER accumulation (Wandelt et al., 1992). Authors observed that the -zein was able to undergo posttranslational changes and form protein bodies while the -zein remained accumulated into the ER lu men indicating that the KDEL signal could have interfered in molecule stear ic conformation. Hence, this is the first report on expression of the vspB gene in bahiagrass cv. Argentine. It may be possible to increase VSP expression levels in transgenic bahiagrass plants by coexpressing recombinant VSP and VSP subunits, and/or by targeting the subunit to different cell compartments. However, these increased levels may not likely enhance the total protei n content of transgenic plants.

PAGE 72

72 Met 1 TGCAAGAGTT TGTTGTGAGC TATAAGCTAG TTTATCGTGA GGAGAATATG ACGTTCTCAA ACAACACTCG ATATTCGATC AAATAGCACT CCTCTTATAC LysLeuPheVal PhePheVal AlaAlaVal ValLeuValAla TrpProCys 51 AAGTTGTTTG TTTTCTTTGT TGCTGCAGTA GTTTTGGTAG CATGGCCATG TTCAACAAAC AAAAGAAACA ACGACGTCAT CAAAACCATC GTACCGGTAC HisGlyAla GlyTyrGlnArg PheProLeu ArgMetLys ThrGlyTyrGly 101 CCATGGCGCA GGCTACCAAA GGTTCCCTCT CCGAATGAAA ACTGGCTATG GGTACCGCGT CCGATGGTTT CCAAGGGAGA GGCTTACTTT TGACCGATAC GGluArgSer SerGluVal LysCysAlaSer PheArgLeu AlaValGlu 151 GTGAGCGTTC TTCGGAGGTA AAATGCGCAA GTTTTAGGCT TGCTGTGGAA CACTCGCAAG AAGCCTCCAT TTTACGCGTT CAAAATCCGA ACGACACCTT AlaHisAsnIle ArgAlaPhe LysThrIle ProGluGluCys ValGluPro 201 GCACACAACA TCCGAGCCTT TAAAACCATT CCTGAAGAGT GCGTTGAACC CGTGTGTTGT AGGCTCGGAA ATTTTGGTAA GGACTTCTCA CGCAACTTGG ThrLysAsp TyrIleAsnGly GluGlnPhe ArgSerAsp SerLysThrVal 251 AACAAAGGAC TACATTAATG GCGAACAATT TAGATCAGAC TCTAAAACAG TTGTTTCCTG ATGTAATTAC CGCTTGTTAA ATCTAGTCTG AGATTTTGTC VAsnGlnGln AlaPhePhe TyrAlaSerGlu ArgGluVal HisHisAsn 301 TTAACCAACA AGCTTTCTTT TATGCTAGTG AACGCGAAGT CCATCACAAC AATTGGTTGT TCGAAAGAAA ATACGATCAC TTGCGCTTCA GGTAGTGTTG AspIlePheIle PheGlyIle AspAsnThr ValLeuSerAsn IleProTyr 351 GACATATTTA TATTCGGCAT AGATAACACC GTACTCTCTA ATATCCCATA CTGTATAAAT ATAAGCCGTA TCTATTGTGG CATGAGAGAT TATAGGGTAT TyrGluLys HisGlyTyrGly ValGluGlu PheAsnGlu ThrLeuTyrAsp 401 CTATGAAAAA CATGGATATG GGGTGGAGGA ATTTAATGAA ACCTTATATG GATACTTTTT GTACCTATAC CCCACCTCCT TAAATTACTT TGGAATATAC AGluTrpVal AsnLysGly AspAlaProAla LeuProGlu ThrLeuLys 451 ATGAATGGGT TAACAAGGGC GACGCACCGG CATTGCCAGA GACTCTTAAA TACTTACCCA ATTGTTCCCG CTGCGTGGCC GTAACGGTCT CTGAGAATTT AsnTyrAsnLys LeuLeuSer LeuGlyPhe LysIleValPhe LeuSerGly 501 AATTACAACA AGCTGTTGTC TCTTGGCTTC AAGATTGTAT TCTTGTCAGG TTAATGTTGT TCGACAACAG AGAACCGAAG TTCTAACATA AGAACAGTCC ArgTyrLeu AspLysMetAla ValThrGlu AlaAsnLeu LysLysAlaGly 551 AAGATATCTT GACAAAATGG CCGTAACAGA AGCAAACCTA AAGAAGGCTG TTCTATAGAA CTGTTTTACC GGCATTGTCT TCGTTTGGAT TTCTTCCGAC GPheHisThr TrpGluGln LeuIleLeuLys AspProHis LeuIleThr 601 GCTTCCACAC ATGGGAGCAG TTAATTCTCA AGGATCCACA TCTTATCACT CGAAGGTGTG TACCCTCGTC AATTAAGAGT TCCTAGGTGT AGAATAGTGA ProAsnAlaLeu SerTyrLys SerAlaMet ArgGluAsnLeu LeuArgGln 651 CCAAATGCAC TTTCATACAA ATCAGCAATG AGAGAGAATC TGTTGAGGCA GGTTTACGTG AAAGTATGTT TAGTCGTTAC TCTCTCTTAG ACAACTCCGT GlyTyrArg IleValGlyIle IleGlyAsp GlnTrpSer AspLeuLeuGly 701 GGGATACAGA ATTGTTGGAA TCATTGGAGA CCAATGGAGC GATCTGCTTG CCCTATGTCT TAACAACCTT AGTAACCTCT GGTTACCTCG CTAGACGAAC GAspHisArg GlyGluSer ArgThrPheLys LeuProAsn ProMetTyr 751 GAGACCACAG AGGCGAAAGC AGGACCTTTA AGCTTCCTAA TCCCATGTAC CTCTGGTGTC TCCGCTTTCG TCCTGGAAAT TCGAAGGATT AGGGTACATG TyrIleGlu*** 801 TACATTGAGT AGTACCTTCA CCTCTCTCAA CAATCTAGCT AGAGTTTGCT ATGTAACTCA TCATGGAAGT GGAGAGAGTT GTTAGATCGA TCTCAAACGA Figure 3-1. The complete coding sequence of the vspB gene (M20038, NCBI database). A) restriction map B) the detailed cDNA a nd polypeptide sequences indicating the main features of the cDNA clone according to Stawisck (1988). ER-signal, Vacuolar signal, Coding sequence and Translation line

PAGE 73

73 Figure 3-2. Cloning strate gy for incorporating the vspB sequence from pKSH3 vector; the c-myc tag, KDEL ER-signal and 3S polyadenila tion tail from pCMYCKDEL, and the ubi1 promoter and first intron from pJFNPTII into the vector pGL4.

PAGE 74

74 Figure 3-3. Minimal constructs used in the biol istic experiments to gene rate transgenic lines from bahiagrass ( Paspalum notatum var. Flugge) cv. Argentine A) PvuII fragment (3.4kb) containing MC from pGL4 vector B) EcoRI fragment (1.9kb) containing MC from pRSVP1 vector C) I-SceI fragment (3.0kb) containi ng MC from pJFNPTII D) AlwnI NotI fragment (2.5kb) containing MC from pHZ35SNPTII vector.

PAGE 75

75 Figure 3-4. Transformation and regene ration protocols for bahiagrass ( Paspalum notatum Flugge ) cultivar Argentine Different stages during the tissue cult ure: a) two-week seedlings, b) four-week seedlings, c) six-week calli, d) seven-week calli plate ready for bombardment, e) after 4 weeks of sele ction, f) after 4 weeks in regeneration with 50 mg L-1 paromomycin, g) after 2 weeks in ro ot medium, and h) after 2 weeks in pots.

PAGE 76

76 Figure 3-5. Transgenic pl ants from bahiagrass ( Paspalum notatum Flugge) cv. Argentine A) Transgenic bahiagrass lines in the greenhouse. B) PCR analyses for the vspB gene. A 1kb fragment was amplified using the forward primer 5'CG GGTACC ATGAAGTTGTTTGTTTTCTTTGTTGC and the reverse primer 5'CG GAGCTC GTTTAAAC GCATGCCTGCAGGTCACTG. The cycling conditions were 95C 2 min initial denaturation, 30 cycles of 95C 1 min, 50C 1 min, 72C 1min and 72C 5 min final extension. AT101 to AT22-4, transgenic bahiagrass lines; WT, wild type bahiagrass; NC,negative control; PC, positive control; 1kb ladder. C) ELISA assays for the nptII gene (Agdia kit). A-G columns: AT10-1 to AT11-22 bahiagrass samples. H column: (-) negative control, (+) nptII positive control, PC transgenic positive control and WT wild type.

PAGE 77

77 Figure 3-6. SDS-PAGE gels for soybean ( G. max ) and transgenic bahiagrass plants ( P. notatum var. Flugge) cv. Argentine A) Soybean plan ts (three different protein extracts of lines 19, 20, 34). B) Transgenic bahiagrass plants (lines 10-2, 10-4, 10-5, 11-2, 11-4, 11-6, 22-1, 22-4, 22-7). Arrows indicate the 32 kda band corresponding to VSP

PAGE 78

78 Figure 3-7. Transgenic bahiagrass ( Paspalum notatum Flugge) cv. Argentine A) SDS-PAGE of different transgenic bahiagrass lines. B) Western blots with c-myc antibodies from different transgenic bahiagrass lines. C) West ern blot of three di fferent tillers (#1,2,3) within lines (lines 22-4 and 22-7). D) Western blot of f our different leaves (#1,2,3,4) within lines (lines 22-4 and 22-7).

PAGE 79

79 Figure 3-8. Co-immunoprecip itation of recombinant VSP from transgenic bahiagrass ( Paspalum notatum Flugge) cv. Argentine Western blot with c-myc antibodies indicating three frac tions: unbound fraction, wash fracti on and elutant fraction with the recombinant VSP from plant 22-4 and anti c-myc (+) control.

PAGE 80

80 CHAPTER 4 EXPRESSION OF A SYNTHETIC cry1F GENE FROM Bacillus thuringiensis TO ENHANCE RESISTANCE AGAINST FALL ARMYWORM IN BAHIAGRASS ( Paspalum notatum VAR. FLUGGE) Introduction Bahiagrass ( Paspalum notatum var. Flugge) is an important forage grass in tropical and subtropical regions around the world. It is gr own on 2.5 million hectares in the southern United States (Burton et al., 1997; Blount et al. 2001). Its popularit y is based on low maintenance requirements and tolerance to drought, heat, many diseases and overgrazing (Chambliss, 2002). However, bahiagrass is susceptible to tw o major insect pests: mole crickets ( Scapteriscus spp.) and fall armyworm ( Spodoptera frugiperda J. E. Smith). Fall armyworm is one of the most important insect pests in the s outheastern U.S., causing signif icant seasonal economic losses in forage and turf grasses and many other crops (Sparks, 1979; Nagoshi and Meagher, 2004; The bugwood network, 2007). Traditionally, many insect pest s are controlled using Integrat ed Pest Management (IPM) strategies involving the use of pesticides with resistant varieties or biological control agents. However, the indiscriminate use of pesticides pr oduces adverse effects on human health and the environment including the development of ins ect resistance and the elimination of other beneficial insects (Ranjekar et al., 2003; Ferry et al., 2006) Transgenic crops expressing Bacillus thuringiensis ( Bt ) -endotoxins were a natural choi ce for controlling insects since Bt crystal protein (Cry) and spore formulation products ha ve been successfully used for many years (Schnepf et al., 1998; Ferre and Van Rie, 2002; Ranjekar et al., 2003; Kaur, 2006). The crystal protoxins require so lubilization, followed by proteoly tic activation in the insect midgut. The activated toxins bind to specific receptors in the intest ine epithelial ce lls leading to pore formation and cell death. Based on amino acid sequence homologies and phylogenetic

PAGE 81

81 relationships, these crystal endotoxins are classi fied in four groups pr oviding protection against four insect orders: cry 1 (Lepidoptera), cry 2 (Lepidoptera and Diptera), cry 3 (Coleoptera) and cry 4 (Diptera) (de Maagd et al., 2001; Ferre and Van Rie, 2002; Griffits and Aroian, 2005). The active toxins have a conserved structure formed by three domains, and domains II and III are involved in the specificity to particular insect s through receptor binding (S chenpf et al., 1998; de Maagd et al., 2001; Ranjekar et al., 2003; Abanti, 2004). Insect resistance to Bt toxins in targeted populations ar ises through different mechanisms and/or at different levels (F erre and Van Rie, 2002; Griff its and Araoin, 2005). Laboratory bioassays indicated that cro ss-resistance occurs in populations of diamondback moth ( Plutella xylostella L.) which were resistant to four closely-related -endotoxins with highly homologous binding sites (Tabashnik et al., 1997a, 2001). To date, only one case of field-developed resistance has been reported, but laboratory studies on field-selected strains indicated the potential for resistance development in differe nt insect populations (Ferre and Van Rie, 2002). To increase Bt expression levels in transgen ic plants, codon-optimization of cry sequences, the reduction of AT sequences a nd the truncation of the native cry sequence have been successfully used (Schenpf et al., 1998; Bohorova et al., 2001 ; Kaur, 2006). Elimination of vector backbone sequences and biol istic transfer of minimal tran sgene expression constructs (Fu et al., 2000) also supported high tr ansgene expression levels (Agr awal et al., 2005). Stacking of different cry genes (Kaur, 2006), expression of cry fusion constructs (Bohor ova et al., 2001), and pyramiding genes including cry genes with genes encoding protei ns having alternative insect control mechanisms like vegetative insecticidal pr oteins or proteinase inhibitors, will reduce the risk of insects devel oping resistance to Bt toxins (Ferry et al., 2006).

PAGE 82

82 In the U.S., growers must conform to the high-dose refuge stra tegy to delay insect resistance development. The first component of th is strategy is to express toxins in plants at a high enough level to kill heterozygotes in the in sect population. The second component is to provide structured refuges. Refuges are small areas cultivated with non-transgenic crops which are interspersed with the transg enic crop. Mating of susceptible adults that developed from nontransformed plants with those from transgenic plants allow for the elimination of homozygous resistant individuals and the re duction of resistant alleles (Cannon, 2000; Ranjekar et al., 2003). Currently, Bt transgenic technology is adopted worldwide and Bt crops are grown on more than 14 million hectares (James, 2005). In the U.S., Bt crops are grown on approximately 20% of the crop acreage and their use is di rectly linked to higher yields a nd profits and reduced pesticide application (Cannon, 2000). Currentl y, marketed products include Bt corn containing the cry1Ab cry1F cry3Bb1 and stacked cry1Ab and cry3Bb1 genes for controlling European corn borer [ Ostrinia nubilalis Hbner], southwestern corn borer [ Diatraea grandiosella Dyar] and corn rootworm [ Diabrotica barberi Smith and Lawrence], and Bt cotton containing cry1Ac stacked cry1Ac and cry2Ab2, stacked cry1Ac and cry1F for controlling tobacco budworm [ Heliothis virescens Fabricius], cotton bollworm [ Helicoverpa zea Boddie], and pink bollworm [ Pectinophora gossypiella Saunders] (Castle et al., 2006). Cry1F has been reported to control fall armyworm in cotton (Adamczyk and Gore, 2004). Ho wever, there are no previous reports on Cry proteins expressed in forage a nd turf grasses and their effects against fall armyworm. Transgenic plants of the non-commercial apomictic genot ype Tifton 7, diploi d bahiagrass cultivar Pensacola, and apomictic cultiv ar Argentine have been recent ly reported (Smith et al., 2002; Gondo et al., 2005; Altpeter and James, 2005). Th ese genetic transformati on protocols allow the introduction of exogenous insect resistance genes into bahiagrass. Hence, the objective of this

PAGE 83

83 work was to evaluate the expression of a synthetic cry1F gene in transgenic bahiagrass and its effect on resistance to fall armyworm. Materials and Methods Minimal Transgene Expression Constructs Based on the cry1F gene sequence available in the NCBI database (M73254), a codonoptimized sequence for the -endotoxin was generated. The synthetic cry1F gene (1863 bp) was synthesized and subcloned into a pPCR-Script vector by Geneart (Regensburg, Germany). BamHI and HindIII sites were introduced 5 and 3 of the cry1F coding sequence respectively (Figure 1), to facilitate subcloning of cry1F under transcriptional contro l of the maize ubiquitin 1 promoter and first intron (Christensen and Quail, 1992) and the CaMV 35S polyadenylation signal (Dixon et al., 1986) (pHZCRY vector, Figure 2A). The pHZ35SNPTII selectable marker cassette c ontains the neomycin phosphotransferase II ( nptII ) coding sequence (Bevan, 1984) under transcrip tional control of the CaMV 35S promoter (Odell, 1985) and hsp70 intron (R ochester, 1986), and the CaMV 35S polyadenylation signal (Dixon et al., 1986) (Figure 2A). Following the strategy described by Fu et al. (2000), minimal transgene expression constructs (MCs) containing only the expre ssion cassettes without vector backbone were used for biolistic gene transfer. The nptII and cry1F gene expression cassettes were excised from their plasmids by restriction digestion with NotI resulting in a 2.55 kb or 4.15 kb fragments, respectively (Figure 2A). Transgen e expression cassettes were isolated by gel electrophoresis, and the correspond ing band was excised and purif ied using the Wizard SV Gel and PCR cleanup system (Promega, Madison, W I) to remove vector backbone sequences. Tissue Culture, Transformation and Regeneration of Bahiagrass Embryogenic callus was induced from mature se eds of bahiagrass cultivars Tifton 9 and Argentine following a protocol previously de scribed by Altpeter and Positano (2005). The

PAGE 84

84 callus induction medium (CIM ) consisted of 4.3 g L-1 MS salts (Murashige and Skoog, 1962), 30 g L-1 sucrose, 1.1 mg L-1 6Benzylaminopurine (BAP), 3 mg L-1 3,6-Dichloro-2-methoxy benzoic acid (dicamba) and 6 g L-1 Agarose (Sigma, St. Louis, MO), supplemented with filter sterilized MS vitamins (Murashige and Skoog, 1962) which were added after the medium was autoclaved for 20 min. Calli were kept in darkne ss at a temperature of 28C and subcultured to fresh CIM biweekly. Embryogenic calli were placed on CIM medium supplemented with 0.4 M sorbitol, for 4-6 h prior to gene transfer. The nptII and cry1F gene expression cas settes were used in a 1:2 molar ratio and co-precipitated on 1.0 m diameter gold particle s (Altpeter and James, 2005). The BioRad PDS-1000 / He device (BioRad Laboratories Inc., Hercules, CA) was used for biolistic gene transfer at 1100psi and 28mm Hg. Bombarded cal li were transferred to fresh CIM following gene transfer, and kept in the dark for 10 days before being transferred to low light conditions (30Em-2s-1), with 16h/8h light/dark photoper iod, at 28C, on selection CIM containing 50 mg/l of paramomycin. After f our weeks, calli were subcultured on shoot regeneration medium, similar to CIM but containing 0.1 mg/l BAP and no dicamba, and transferred to high light (150 Em-2s-1) intensity with a 16h/8h li ght/dark photoperiod at 28C. After two weeks, calli were transferred to hormone -free CIM to induce root formation. After four to six weeks, regenerated plantlets were transpla nted into Fafard 2 mix (Fafard Inc., Apopka, FL) and acclimatized in growth chambers at 400 Em-2s-1light intensity with a 16h/8h light/dark photoperiod at 28C / 20C day / night.Two weeks later plants were transf erred to an airconditioned greenhouse at 30C / 20 C day / night and natural photope riod. Plants were fertilized bi-weekly with Miracle Grow Lawn Food (S cotts Miracle-Gro, Marysville, OH) at the recommended rate.

PAGE 85

85 Polymerase Chain Reaction, Reverse Transc riptase Polymerase Chain Reaction and Southern Blot Analysis Genomic DNA was extracted from bahiagrass tran sgenic and wild type lines as described by Dellaporta et al. (1983). The forward primer 5'ATGGTTTCAACAGGGCTGAG3 and the reverse primer 5'CCTTCACCAAGGGAATCTGA3 were designed for amplifying a 570 bp fragment internal to th e coding sequence of the cry1F gene. Approximately 100 ng genomic DNA was used as template for PCR in a BioRad Icycler (BioRad Laborat ories Inc., Hercules, CA). PCR was performed using the HotStart PCR kit (Qiagen, Valencia, CA). The cycling conditions were 95C for 15 min initial denatu ration, 35 cycles of 95C for 1 min, 57C for 1 min, 72C for 1 min and 72C for 15 min fina l extension. PCR products were analyzed by electrophoresis on a 0.8% agarose gel. Total RNA was extracted from emerging young l eaves using the RNeasy Plant Mini Kit (Qiagen, Valencia, CA), followed by RNAse free DNase I (Qiagen, Valencia, CA) treatment to eliminate genomic DNA contamination. Total R NA (500 ng) was used for cDNA synthesis via reverse transcription with the iScript cDNA Synt hesis kit (Bio-Rad Labor atories Inc., Hercules, CA) in a reaction volume of 20 l. cDNA (2 l) was used as a template to detect the transcripts of the cry1F gene by PCR with the same primer pair as described above for PCR from genomic DNA. PCR products were analyzed by elec trophoresis on a 0.8% agarose gel. For Southern blot analysis, genomic DNA from bahiagrass transgenic and wild type lines was isolated using the CTAB method (Mur ray and Thompson, 1980). Genomic DNA (15 g) was digested with BamHI and fractionated on a 1% agarose gel, transferred onto a nitrocellulose membrane (Hybond, Amersham BioSciences, Pi scataway, NJ) and hybridized using the complete cry1F coding sequence (1.8kb) as a probe, labeled with P32 using the Prime-a-Gene kit

PAGE 86

86 (Promega). Hybridization and detection were pe rformed according to the instructions of the manufacturer. Immunological Assays Qualitative expression of the cry1F endotoxin in leaf tissue of the transgenic lines from cultivars Tifton 9 and Argentine was evaluated using the QuickstixTM kit for cry1F (EnviroLogixTM, Portland, ME), originally developed for Herculex I corn, and following the recommendations of the manufacturer. Re lative levels of expression of the cry1F endotoxin in leaf tissue were estimated by using the ELISA QualiPlateTM kit for cry1F (EnviroLogixTM) originally developed for Herculex I corn. Follo wing eight months of vegetative propagation of the primary transformants, protein extracts were obtained from wild type and three transgenic lines from cv. Tifton 9 including three differe nt vegetative clones per line and three different replicates per clone. Pr otein extracts from cry1F expressing corn grain were quantified and used as a positive control in a dilution series. Protei n concentration of the extracts was determined using the Bradford assay (Bradford, 1976) and absorbance was measured at 595 nm. BSA was used to prepare a standard curve (R2 value of 96%). Ten micrograms of total protein were loaded per well. The immunoassay was performed according to the instructions of the manufacturer. Reaction kinetics was recorded at 450 nm us ing an ELISA microplate reader (Bio-Rad Laboratories Inc., Model 680). Optical density (OD) values for each line were compared within the linear range of the reaction kinetics after addition of the ELISA substrate. OD data from bahiagrass transgenic and wild type lines were analyzed by Proc ANOVA and means were separated according to Tukeys test ( P <0.05) (Littell et al., 1996, SAS Institute, 2002). Insect Bioassays Insecticidal activity of the transgenic lines was evaluated by following a modified version of the protocol described by Adamczyk and Go re (2004). Fall armyworm neonates (rice host

PAGE 87

87 strain) were obtained from egg masses hatched the same day, placed in Petri dishes and fed on four leaf pieces of 2 cm le ngth of the third fully emerged leaf. A completely randomized experimental design was used. Th ere were 10 replications per tr ansgenic line represented by individual Petri dishes with leaves and larvae, and the experiment was repeated four times. For estimating fall armyworm resistance, neonate morta lity rates from bahiagrass transgenic and wild type lines were evaluated after fi ve days of feeding. Fall armyworm mortality rates, expressed as a percentage, were analyzed by Proc Mixed and means were separated according to Fishers protected LSD (Littell et al., 1996, SAS Institute, 2002). Results Generation of Transgenic Bahiagrass Lines Co-bombardment experiments with the MCs from the pHZCRY vector and the pHZ35S NPTII vector were done (Figure 4-2A). Th ree hundred calli were obtained from ten shots and three transgenic lines from each cu ltivar, cvs. Argentine and Tifton 9, were generated in four months of ti ssue culture (4-2B,C). These six transgenic lines were transferred to small pots under controlled growing conditions and later to larger pots under greenhouse conditions (42D,E). Polymerase Chain Reaction, Reverse Transc riptase Polymerase Chain Reaction and Southern Blot Analysis PCR analyses showed that the six transg enic lines from cultivars Tifton 9 and Argentine amplified the 570 bp inte rnal fragment of the synthetic cry1F gene confirming the gene integration into the plant genome. Also, this 570bp fragment was amplified in the plasmid control (PC) and not amplifie d in the wild type bahiagra ss (WT)(Figure 4-3A, 4-4A).

PAGE 88

88 RT-PCR analyses also showed that the six bahiagrass lines amplified the same 570 bp internal fragment of the cry1F confirming gene expression at th e RNA level in the transgenic plants (Figure 4-3B, 4-4B). Both southern blot analyses, i.e. with BamHI and EcoRI gDNA digestions, showed an independent integration pattern for each transgenic line and the tr ansgene integration varied from simple to more complex integration patte rns in cv. Tifton 9. Specifically with BamHI Line 1 showed seven hybridization bands, while Lines 2 and 3 showed two a nd four hybridization patterns respectively (Fig ure 4-3C). Instead, the three transg enic lines from cv. Argentine showed complex integration patterns with mo re than two hybridization bands in the three transgenic lines (F igure 4-4C). Immunological Assays A qualitative immunoassay, the QuickstixTM kit for cry1F (EnviroLogixTM), indicated that bahiagrass Lines 2 and 3 from cv. Tifton 9 contai ned detectable levels (Figure 4-5A), while the same assay showed no detectable levels of cry1F in those lines from cv. Argentine. A semiquantitative immunoassay, based on the QualiPlateTM kit for cry1F (EnvirologixTM), showed that Line 1 had a low expression level only dete cted by the plate reader whereas Lines 2 and 3 had higher expression levels that were easily detected by naked ey e in cv. Tifton 9 (Figure 45B). However, low expression levels were dete cted in the three lines from cv. Argentine. These observations were correlated to the OD450 values obtained for the six transgenic lines. The OD450 values indicated that Line 1 produced relativ ely low levels of Cry1F, while Lines 2 and 3 displayed cry1F expression levels that were 4 and 12-fold higher than those levels, respectively ( P < 0.05)(Figure 4b). Also, no significant differences in cry1F expression between clones of the same line were found ( P < 0.05; data not shown). Cr y1F protein levels in bahiagrass leaves were estimated by comparison with a crude Cry1F pr otein standard supplied by the manufacturer and

PAGE 89

89 were approximately 1.4 and 4.5 g protein/ g fresh weight for Lines 2 and 3 from cv. Tifton 9 respectively. Insect Bioassays Fall armyworm mortality rate showed differen ces between the wild t ype and the bahiagrass transgenic lines from cultivar Tifton 9. Li nes 1, 2 and 3 produced 35, 65 and 83% neonate mortality rate respectively (Figur e 4-6A). Wild type and Line 1 showed intense feeding while Lines 2 and 3 showed limited feeding indicati ng early larvae death (F igure 4-6B). Instead, survival rate was no different between the wild ty pe and the three transgenic low expressing lines from cultivar Argentine after five days of feeding (Figure 4-6C). Discussion This is the first report of stable, transgene expression of a Bt crys tal protein gene that enhances insect resistance in a fo rage and turf grass. Bahiagrass ( Paspalum notatum Flugge) is an important subtropical forage grass that is also used as low input turf. Constitutive overexpression of the cry1F gene in bahiagrass resulted in incr eased resistance to fall armyworm ( Spodoptera frugiperda J.E. Smith). The transformation protocol for the apomictic tetraploid bahiagrass cultivar Argentine (Altpeter and James, 2005; Sandhu et al., 2007) was successfully applied to generate transgenic, sexual, diploid bahiagrass plants of cultivars Tifton 9 and Argentine. The transformation efficiency for Tifton 9 (1%) was similar to those earlier reported for the diploid sexual bahiagrass cultivar Pensacola (2.2%) (Gondo et al., 2005). However, 10% transformation efficiency was reported for the apomictic cult ivar Argentine (Sandhu et al., 2007). Genotypic differences in tissue culture response and tr ansformation efficiency have been reported previously. The production of stable tr ansgenic plants from bahiagrass ( Paspalum notatum Flugge) cv. Tifton 7 was firstly reported by Smith et al. (2002). However, authors reported that

PAGE 90

90 the transgenic nature of most of the glufosinate resistant plan t could not be confirmed by PCR analyses (Smith et al., 2002). Later, unpublished st udies revealed that the glufosinate resistance was conclusive to indicate the transgenic nature nature and that the PCR analyses had resulted in false negative events (Smith, personal communi cation). In contrast, following co-bombardment of the target gene and nptII gene and selection using paromomy cin, all of the regenerated plants in this study and in a prev ious bahiagrass transformation study (Sandhu et al., 2007) were transgenic as indicated by Southern blot analys is. Genotypic differences a nd alterations in tissue culture and selection protocols may have contributed to the lack of escapes in these more recent bahiagrass studies. Analysis of the complexity of minimal tran sgene expression constr uct (MC) integration patterns has resulted in controvers ial results in the past. Fu et al (2000) described that biolistic transfer of MCs resulted in si mpler integration patterns and lo wer copy numbers than plasmids. In contrast, no differences betw een the two DNA forms were repor ted by Breitler et al. (2001) and Romano et al. (2003). Southern blot analysis of the three transgenic bahiagrass lines transformed with MCs of the cry1F gene showed multiple transgene copies in all lines with line 1 displaying the most complex transgene integra tion pattern. This comple x transgene integration pattern following biolistic transfer of MCs into bahiagrass is in agreement with findings of Breitler et al. (2001) a nd Romano et al. (2003). It suggests that the complexity of transgene integration is more likely dependent on factors intr insic to the plant rather than on the form of DNA as proposed by Agrawal et al. (2005). Neve rtheless, elimination of vector backbone integration through MC technology is important fo r increasing transgene expression stability and to remove prokaryotic antibio tic expression constructs to obtain regulatory approval for commercial release. Clean DNA technology by em ploying the use of MCs for biolistic

PAGE 91

91 transformation is capable of producing simila r or higher transformation and expression efficiencies than whole plasmids (Castle et al., 2006). In the pr esent study, two bahiagrass lines from cultivar Tifton 9 expressed the cry1F transgene in vegetative progeny at a high enough level to control FAW neonate larvae. Transgenic corn expressing the cry1Ab gene was first commercially released in 1996. Constitutive cry1Ab expression of 3.3 or 10.3 g/g fresh wei ght of leaves resulted in 50-75% or 98% control of the European corn borer ( O. nubilalis ) in corn field trials (Mendelsohn et al., 2003). This pest is considered the most importa nt corn insect pest in the midwestern and northeastern regions of the U. S. (Wiatrak et al., 2004); whil e fall armyworm is the most important pest on grasses and other crops in the southeastern U.S. Recently, corn expressing the cry1F gene (Herculex I) was commercially released by Pioneer Hi-Bred In ternational and Dow Agrosciences (Events TC1507 and DAS-06275-8). Fiel d trials indicated that these transgenic corn lines effectively controlled multiple insect pests like O. nubilalis D. grandiosella H. zea S. frugiperda A. ipsilon and R. albicosta (US EPA, 2001). In cotton, fall armyworm bioassays indicated that neonate mortality was significantly higher when larvae were fed on leaves expressing cry1F (80%) compared with non-transgenic leaves (48%) or leaves expressing cry1Ac (45%) (Adamczyk and Gore, 2004). Cry1F con centrations were estimated at 1.4 and 4.5 g/g fresh weight in bahiagrass transgenic line s 2 and 3, respectively. These expression levels were associated with 65% and 83% neonate mortal ity rates, respectivel y, while wild type and transgenic bahiagrass with barely detectable cry1F expression showed a significantly lower fall armyworm mortality rate. These re sults indicate the potential of cry1F to control fall armyworm in accordance with th e results reported for cry1F expressing cotton (Adamczyk and Gore, 2004) and corn (US EPA, 2001). In conclusion, stable expression of minimal synthetic cry1F

PAGE 92

92 expression constructs in bahiagrass enhanced resi stance to the difficult to control, and important insect pest, fall armyworm.

PAGE 93

93 Figure 4-1. The synthetic coding sequence of the cry1F gene (M73254) including the BamHI ( ggatcc ) and HindIII ( gagctc ) sites used for the cloning into the pHZCRY vector. The atg ( M ) and tag ( ) codons indicate the initiation and the end of the translation frame.

PAGE 94

94 Figure 4-2. A) The expression cassettes for synthetic cry1F gene (4155bp) from vector pHZCRY and nptII gene (2554bp) from vector pHZ 35SNPTII used for biolistics experiments. B) and C) In vitro plants under selection with paromomycin from bahiagrass ( Paspalum notatum Flugge) cvs. Tifton 9 and Argentine respectively.D) and E) Transgenic plants obtained from bahiagrass ( Paspalum notatum Flugge) cvs. Tifton 9 and Argentin e respectively. Lines 1, 2, 3 and wild type (WT).

PAGE 95

95 Figure 4-3. A 570 bp fragment was amplif ied by PCR using the forward primer 5'atggtttcaacagggctgag and the reverse primer 5'ccttcaccaagggaatctga. The cycling conditions were 95C 15 min initial dena turation, 35 cycles of 95C 1 min, 57C 1 min, 72C 1min and 72C 15 min final extensi on. A) PCR, B) RT-PCR, C) Southern blot of genomic DNA digested with BamHI of transgenic bahiagrass lines from cv. Tifton 9 (1, 2, 3). Wild type bahiagrass (Wt), negative control (NC), positive control (PC).

PAGE 96

96 Figure 4-4. A 570 bp fragment was amplif ied by PCR using the forward primer 5'atggtttcaacagggctgag and the reverse primer 5'ccttcaccaagggaatctga. The cycling conditions were 95C 15 min initial dena turation, 35 cycles of 95C 1 min, 57C 1 min, 72C 1min and 72C 15 min final extensi on. A) PCR, B) RT-PCR, C) Southern blot of genomic DNA digested with BamHI of transgenic bahiagrass lines from cv. Argentine (1, 2, 3). Wild type bahiag rass (Wt), negative control (NC), positive control (PC).

PAGE 97

97 Figure 4-5. Levels of expression in leaves of transgenic lines from bahiagrass ( Paspalum notatum var. Flugge). A) Lines from cv. Tifton 9 tested with QuickstixTM kit for the cry1F gene (EnvirologixTM). B) Lines from cv. Tifton 9 tested with the QualiPlateTMkit for the cry1F gene (EnvirologixTM). C) Levels of expression represented by OD450 values in lines from cv. Tift on 9 D) Levels of expression represented by OD450 in lines from cv. Argentine values. Wild type bahiagrass (Wt), transgenic lines (1,2,3), negative control (NC), positive control (PC).

PAGE 98

98 Figure 4-6. Insect bioassays w ith fall armyworm larvae feeding on leaves from bahiagrass ( Paspalum notatum var. Flugge) cv. Tifton 9 af ter 5 feeding days. A) Feeding pattern from wild type and three transgenic lines. B) Mortality rate (%) for neonates in wild type and three transgenic lines from cv. Tifton 9 (WT and Lines 1,2,3). C) Mortality rate (%) for neonates in wild t ype and three transgenic lines from cv. Argentine (WT and Lines 1,2,3).

PAGE 99

99 CHAPTER 5 SUMMARY AND CONCLUSIONS Overexpression of the vspB Gene to Improve Nutritional Quality in Bahiagrass Amongst vegetative storage proteins, soybean VSP is a lysine enriched-protein resistant to rumen proteolysis (Mason et al., 1988; Stas wick, 1994; Galili et al., 2002). The objective of this work was to overexpress this soybean vegeta tive storage protein gene in bahiagrass and to evaluate the effects of this gene on the nutritional quality of bahiagrass. To enhance the expression of the vspB gene in transgenic plants, we designed an expression vector including a constitutive and strongly expre ssed promoter for monocots; a KDEL signal for ER-retention and a c-myc tag for antibody detection. To enhance transformation efficiency and transgene expre ssion and stability (Fu et al, 2000), we used minimal constructs containing only the transgen e expression cassettes wi thout vector backbone sequences during the biolistic experiments. We co-bombarded mature seed-derived calli from bahiagrass cv. Argentine with minimal constructs containing the vspB gene from pGL4 and pRSVP1 vectors and the nptII gene as selectable marker from pJFNPTII vector. Based on bahiagrass transformation, selecti on and regeneration protocols previously established ( Altpeter and Positano, 2005; Altpeter and James, 2005), we generated 172 paromomycin-resistant bahiagrass plants. An ELI SA screening confirmed the expression of the nptII gene detecting 83% of these plants. West ern blots confirmed the expression of the vspB gene in 89% of the plants expressing the nptII gene. Also, Western blot analyses indicated that VSP expression levels varied among different plants, different tillers within plants and different leaves within tillers having the highest expressi on levels in third and four bahiagrass leaves. According to previous reports, VSPs represente d between 10-15% total protein in young leaves of soybean plants and VSPs were degraded during plant growth (Staswisck et al., 2001).

PAGE 100

100 Transgenic studies in tobacco indicated that VSP was stably expressed reaching 2-6% total proteins (Guenoune et al., 1999) while VSP reached a maximum of 2% total protein in young leaves and it was degraded with leaf age (Guenoune et al., 2002b) These expression levels were enhanced by targeting th e heterologous protein to the vacuol e and the chloropl ast simultaneously (Guenoune et al., 2002a) or enhanced by co-expressing both soybean VSPs or VSP and dihydrodipicolinate synthase reaching ca. 4% total protein in leaves (Gue noune et al., 2003). In contrast, corn transgenic studies showed that VSP was accumulated to 0.03-0.004% total protein in leaves (Grando et al., 2001). Similarly, VSP expression levels accumulated to 0.0010.01% of the total proteins in bahiag rass leaves indicating that high VSP expression levels are difficult to reach in monocot plants such as cereal s and grasses. Hence, this is the first report on expression of the vspB gene in bahiagrass cv. Argentine. The VSP expression levels observed in transgenic bahiagrass plants were low and sim ilar to those previously reported for corn plants. These VSP expression levels in transgenic bahiagra ss plants could be enhanced by coexpressing recombinant VSP and VSP subunits, and/or by targeting the subunit simultaneously to different cell compartments. However, these im provements may not enha nce the total protein content of transgenic bahiagrass significantly. Expression of the cry1F Gene to Enhance Pest Resistance in Bahiagrass Bt ( Bacillus thuringiensis ) transgenic crops expressing -endotoxins were developed to control different insect and nematodes (Schnepf et al., 1998; Ranjekar et al., 2003; Kaur, 2006). Currently, Bt crops cover 14 million hectares and represent 20% total for crops like cotton and corn (Cannon, 2000). Market ed products include Bt corn containing the cry1Ab cry1Ac cry9C genes for controlling European corn borer populations and Bt cotton containing cry1Ac cry1Ac and cry1F for controlling bollworm (Me ndelsohn et al., 2003). Howeve r, there are no previous reports on cry1F proteins expressed in forage and turf grasses and their effects against fall

PAGE 101

101 armyworm. Hence, the objectives of this work were to generate transgenic lines expressing a synthetic cry1F gene and to evaluate the e ffects of this gene on resist ance against fall armyworm in subtropical bahiagrass cultiv ars Tifton 9 and Argentine. For enhancing transformation efficiency and tr ansgene expression stability (Fu et al, 2000), we co-bombarded mature seed-derived calli from bahiagrass with minima l constructs containing the synthetic cry1F gene from pHZCRY vector and the nptII gene as selectable marker from pHZ35S NPTII vector. Based on previously reported protocols (Altpeter and Positano, 2005; Altpeter and James, 2005) for bahiagrass tran sformation and regeneration, we generated six paromomycin-resistant bahiagrass plants (three fr om cv. Argentine and three from cv. Tifton 9). PCR analyses confirmed the presence of the cry1F gene and Southern blots analyses indicated independent transgene integration in all transgenic bahiagrass lines. Transgene integration varied from simple to more comple x integration patterns in cv. Tifton 9 while showed complex integration patterns in cv. Argentine. RT-PCR analyses confirmed cry1F expression in all transgenic bahiagra ss lines. A qualitative immunoassay for cry1F gene expression (QuickstixTM kit, EnviroLogixTM) indicated detectable leve ls in two bahiagrass lines from cv. Tifton 9 and no detectable levels in one line from cv. Tifton 9 and three lines from cv. Argentine. A semiquantitative immunoassay for cry1F gene expression (QualiPlateTM kit, EnvirologixTM) showed that Line 1 had a low expressi on level only detected by the plate reader while Lines 2 and 3 had higher expr ession levels that were easily detected by naked eye in cv. Tifton 9. Low expression levels were detect ed in the three lines from cv. Argentine. According to fresh weight and protein con centration of the samples, the estimated cry1F expression levels were 1.4 and 4.5 g cry toxin/ g fresh weight in Lines 2 and 3 from cv. Tifton 9. Insect bioassays indicated significant differences between wildtype and transgenic lines in cv.

PAGE 102

102 Tifton 9 showing 35, 65 and 83% mortality rates in Lines 1, 2 and 3. Instead, no differences were observed between wild type and transgenic bahiagrass lines from cultivar Argentine. The cry1F expression levels in bahiagrass lines fr om cv. Tifton 9 were similar to those cry1Ab levels reported for commercial corn lines (Abel and Adamczyc k, 2004). Besides, the protection levels against FAW neonates were similar to those observed in cry1F cotton lines (Adamczyck and Gore, 2004). Hence, we cloned a codon-optimized version of the cry1F gene under the control of the ubi1 promoter and first intron in two bahiagra ss cultivars. In cultivar Tifton 9, results indicated that the expression levels of the cry1F gene detected by immunological assays and the protection levels detect ed by insect feeding bioassays were positively correlated. Moreover, the cry1F expression and protection le vels were similar to those levels detected for commercial crops in corn and cotton. Therefore, the expression of the cry1F gene in bahiagrass cultivar Tifton 9 enhanced the resistance agai nst fall armyworm in insect bioassays indicating that these transgenic lines seem to be suitable candidates for further field studies.

PAGE 103

103 APPENDIX A LABORATORY PROTOCOLS Protocols for Molecular Cloning Preparation of Electrocompetent E.coli 1. Grow o/n DH5 culture in 5ml LB. 2. Inoculate 2 x 250ml LB in 1L flasks with 2ml o/n cultu re. Incubate shaking at 37 C until OD600 = 0.6-0.8 (Approx 5.5 hours). 3. Pellet cells for 15 mins, 4000g at 4 C (Sorvall with GSA rotor, 3x 250ml bottles). 4. Pour off supernatant and resuspend in an equi valent volume of ice-cold sterile water (3x 165ml). Handle cells gently at all times. 5. Centrifuge 15 mins, 4000g, 4 C. 6. Pour off supernatant and resuspend in 0.5 volume of ice-cold sterile wa ter (3x 83ml). Divide cell culture between 2 bottles. 7. Centrifuge 15 mins, 4000g, 4 C. 8. Pour off supernatant and resuspend in 0.5 vol ume of ice-cold ster ile water (2x 125ml). 9. Centrifuge 15 mins, 4000g, 4 C. 10. Pour off supernatant and resuspend in 0.02 vol ume of ice-cold sterile water (2x 5ml). Transfer cell culture to 30ml centrifuge tube. 11. Centrifuge 15 mins, 4000g, 4 C (Sorvall, SS-34 rotor). 12. Pour off supernatant and resuspend in 0.02 volum e ice-cold sterile 10 % glycerol (1.2ml). 13. Transfer 40 l aliquots to sterile 1.5ml eppendorf tube s with holes pierced in the lids using a sterile needle. Quick-freeze in liquid nitrogen and store at 0 C. Electroporation of E.coli 1. Chill 0.1cm gap cuvettes (BioRad) on ice. 2. Place DNA for transformation (usually 1-2 l 10-15ng ligation) in 1.5ml eppendorf tubes on ice. 3. Thaw required number of 40 l aliquots of electrocompetent cells on ice. 4. Set BioRad micropulser to Ec1 (1.8kV, 5msec, 0.1cm gap). 5. Add cells to DNA. Leave on ice 1 min. 6. Transfer cells to cuvette. Tap suspension to bottom. 7. Place cuvette in slide and push slide into cham ber ensuring that cuvette is seated between contacts in the base of the chamber. 8. Pulse once by pressing pulse button. Al arm signifies pulse is complete. 9. Remove cuvette and immediately add 360ml SOC medium to the cuvette. Quickly but gently transfer cells to a 2ml tube. Time is critical. 10. Check and record pulse parameters (tim e constant should be close to 5msec). 11. Incubate cells at 37 C shaking for 1 hour before plati ng on appropriate antibiotic medium (50 l for circular plasmid, 100-200 l for ligation product). Plasmid DNA Extraction Method (modified Dellaporta et al., 1983)

PAGE 104

104 1. Harvest one length eppendorf tube of leaf material. 2. Add 300 l Extraction Buffer D and grind with micropestle until the buffer is green. 3. Add 20 l 20% SDS. Vortex. 4. Incubate at 65C, 10 minutes. 5. Add 100 l 5 M potassium acetate. Shake vigorously. 6. Incubate on ice (or -20C), 20 minutes. 7. Centrifuge at maximum speed, 20 minutes and transfer supernatant to new tube. 8. Add 450 l isopropanol. 9. Incubate on ice (or -20C), 30 minutes. 10. Centrifuge at maximum speed, 15 minutes, pour off the supernatant, air-dry the pellet. 11. Resuspend pellet in 100 l TE. 12. Add 10 l 3 M sodium acetat e and 220 l 100% ethanol. 13. Centrifuge at maximum speed, 10 minutes, pour off the supernatant, add 500 l 70% ethanol. 14. Centrifuge at maximum speed, 10 minutes, pour off the supernatant, air-dry pellet for 10 minutes. 15. Resuspend pellet in 150 l TE buffer. 16. Use 1 l for PCR reaction. Polymerase Chain Reactions To amplify fragment from pCMYCKDEL vector PCR kit PCR Core System II(Promega) Primer sequences Forward 5 CG TCTAGAACGCGT ATGAAGTTGTTTGT TTTCTTTGTTGC Reverse 5 CG GCGGCCGCACTAGT CTCAATGTAGTACAT GGGATTAGGAAG PCR program Gaby1 2 95C for initial denatura tion, 25 cycles with 1 95C for denaturation, 1 48C fo r annealing and 1 72C for extension, 5 72 for final extension and hold at 4C PCR reaction DNA template 0.5-1.5 l Forward primer 1 l Reverse primer 1 l PCR Buffer 10 X 2.5 l DNTPs 0.5 l Taq polymerase 0.125 l Dd water 19-18.375 l Final volume 25 l

PAGE 105

105 To amplify fragment from pGL2 vector PCR kit PCR Core System II(Promega) Primer sequences Forward 5 CG GGTACC ATGAAGTTGTTTGTTTTCTTTGTT GC Reverse 5 CG GAGCTCGTTTAAAC GCATGCCTGCAGGTCA CTG PCR program Gaby4 2 95C for initial denatura tion, 25 cycles with 1 95C for denaturation, 1 48C fo r annealing and 1 72C for extension, 5 72 for final extension and hold at 4C PCR reaction DNA template 2 l Forward primer 1 l Reverse primer 1 l PCR Buffer 10 X 2.5 l DNTPs 0.5 l Taq polymerase 0.125 l Dd water 17.875 l Final volume 25 l Restriction Digestions To digest pCMYCKDEL vector Restriction Enzymes NotI and XbaI (Promega) Digestion reaction pCMYCKDEL Vector (3 ug) 12 l Restriction Buffer D 10X 3.5 l BSA 10X 3.5 l XbaI 3.5 l NotI 3.5 l Dd water 9 l Final volume 35 l

PAGE 106

106 To digest pGFL1 vector Restriction Enzymes NotI and XbaI (Promega) Digestion reaction pGFL1Vector (4 ug) 12 l Restriction Buffer D 10X 4 l BSA 10X 4 l XbaI 4 l NotI 4 l Dd water 7 l Final volume 40 l To digest pJFNPTII vector Restriction Enzymes PstI (Promega) Digestion reaction pJFNPTII Vector (5 ug) 20 l Restriction Buffer H 10X 4 l BSA 10X 4 l PstI 4 l Dd water 7 l Final volume 40 l To digest pCAMBIA2300 vector Restriction Enzymes PstI (Promega) Digestion reaction pCAMBIA2300 Vector (8.5 ug) 3 l Restriction Buffer H 10X 1.5 l BSA 10X 1.5 l PstI 7 l Dd water 2 l Final volume 15 l

PAGE 107

107 To digest pGFL2 vector Restriction Enzymes KpnI and SacI (Promega) Digestion reaction pGFL2 Vector (5.5 ug) 14 l Multicore Buffer 10X 3 l BSA 10X 3 l KpnI 4.3 l SacI 2.2 l Dd water 3.5 l Final volume 30 l To digest PCR fragment from pGL2 vector Restriction Enzymes KpnI and SacI (Promega) Digestion reaction PCR fragment 28 l Multicore Buffer 10X 4 l BSA 10X 4 l KpnI 3 l SacI 1 l Dd water 0 l Final volume 40 l Ligation Reactions To ligate PCR fragment from pKSH3 vector Ligation kit LigaFast Rapid DNA Ligation System (Promega) Ligation reaction pGEM-T Easy Vector (50 ng) 1 l PCR product (14 ng) 0.65 l Ligation Buffer 2 X 5 l T4 ligase 1 l Dd water 2.35 l Final volume 10 l

PAGE 108

108 To ligate PCR fragment from pCMYCKDEL vector Ligation kit LigaFast Rapid DNA Ligation System (Promega) Ligation reaction pCMYCKDEL Vector (100 ng) 1 l PCR product (25 ng) 0.25 l Ligation Buffer 2 X 5 l T4 ligase 1 l Dd water 2.75 l Final volume 10 l To ligate PstI fragments from pJFNPTII and pCAMBIA2300 vectors Ligation kit LigaFast Rapid DNA Ligation System (Promega) Ligation reaction pJFNPTII insert 0.8 l pCAMBIA2300 backbone 2 l Ligation Buffer 2 X 5 l T4 ligase 1 l Dd water 1.2 l Final volume 10 l

PAGE 109

109 Protocols for Bahiagrass Transf ormation and Regeneration Protocol for Bahiagrass Seed Sterilizatio n (modified from Sm ith et al., 2002) 1. Sort out good seeds. Remove any broken or black seeds (check both sides of seed). Put into tube to fill 1/3 full (approx 500 seeds). 2. Prepare 3-4 1L beakers of DI H2O plus 1 empty beaker and a 2-ply square of cheesecloth for each tube. 3. In fume hood, add concentrated sulphuric acid to full and shake well to mix. 4. Leave for 16 minutes (may vary betw een 15 20 mins depending on seed). 5. Using half a large beaker of DI H2O, wash seeds into a second large beaker of DI H2O. Stir seeds with glass rod to wash. 6. Pour off the liquid and floating debris. 7. Add half a beaker of DI H2O to the seeds and stir. 8. Pour off floating debris. 9. Strain seeds through cheeseclot h using a little more water. 10. Squeeze seeds in cloth and wash into a clean be aker with the next half beaker of DI H2O. 11. Repeat 2x leaving seeds in cheesecloth after 3rd wash. 12. Allow seeds to dry partially on the cheesecloth (15-20 mins). 13. Transfer seeds to a deep petri dish. 14. Fill a small beaker with 20ml Clorox bleach (5.25% sodium hypoclorite) and 10ml glacial acetic acid. Place in bottom of glass desiccator in fume hood. 15. Place open petri dish of seeds and lid into desiccator. Leave 1 hour. 16. Add small amount of sterile dH2O, seal plate and leave to soak for 1 hour. 17. Transfer to IF medium, 20 seeds per plate. 18. Incubate at 28 C in the dark. Protocol for Bahiagrass Particle Bo mbardment (Altpeter and James, 2005) 1. Gold stocks (60mg/ml): Weigh 12mg gold into an eppendorf tube. Wash several times in Absolute EtOH by vortexing and centrifuging briefly. Resuspend in 200 l ddH2O. 2. Gold preparation: Mix 15 l 0.75 m gold, 15 l 1 m gold and 30 l DNA by vortexing 1 min. Add 20 l 0.1M spermidine and 50 l 2.5M CaCl2 while vortexing. Keep vortexing for 1 min. Centrifuge briefly to settle gold. Wash in 250 l Absolute EtOH by vortexing. Spin and remove supernatant. Resuspend gold in 180 l Absolute EtOH. (or resuspend in 90 l for more gold per shot). Use 5 l per shot to deliver 50 g gold. Enough for 25 shots. 3. Sterilization of gun components: Autoclave 5 macrocarrier ho lders, stopping screens and macrocarriers. Lay out in laminar flow hood to dry. Sterilize 1100psi rupture discs by dipping in Absolute EtOH and allowing to dry in flow hood. Place all sterile components in sealed petri dishes. Clean gun chamber, asse mbly and flow hood thoroughly with EtOH and allow to dry half and hour before use. 4. Bombardment: Turn on gun, vacuum pump and helium.Place macrocarriers into holders. Spread 5 l gold prep evenly onto macrocarriers a nd allow todry briefly. Place rupture disc into holder and screw tightly into place. Place stopping screen into shelf assembly and put inverted macrocarrier assembly on top. Place shel f at highest level. Place tissue culture plate

PAGE 110

110 on shelf 2 levels below gold. Close door and switch on vacuum to reach 27in Hg. Press fire button and check that disc ruptures at 1100psi. Vent vacuum and remove sample. Dismantle assembly and set up for next s hot. Use stopping screen 4-5 times. Protocol for Bahiagrass Regenerati on (Altpeter and Positano, 2005) 1. Culture of mature seeds in Callus Indu ction Medium (CIM, IF medium with 400 l MS vitamins, 600 l dicamba, 440 l BAP), in darkness at 28C for two weeks. 2. Culture of seedlings in CIM under th e same conditions for two weeks. 3. Culture of callus CIM under the same conditions for two weeks. 4. Transfer of callus to fresh CIM one week before bombardment. 5. Prebombardment treatment in CIM suppl emented with 0.4 M sorbitol for 4-6 h. 6. Bombardment. 7. Culture of callus in no selection medium for one week. 8. Culture of callus in Selection Medium (SM, IF medium supplemented with with 400 l MS vitamins, 600 l dicamba, 440 l BAP, 50 mgL-1 paromomycin) in darkness at 28C for two weeks. 9. Culture of callus in SM under 30 Em-2s-1 light at 28C for two weeks. 10. Culture of callus with shoots in Regeneration medium (ReM, IF medium supplemented with 400 l MS vitamins, 40 l BAP, 50 mgL-1 paromomycin) under 150 Em-2s-1 light at 28C for two weeks. 11. Culture of callus with shoots in ReM under 150 Em-2s-1 light at 28C for two weeks. 12. Culture of callus with shoots in Rooting Me dium (RoM, IF medium supplemented with 400 l MS vitamins, 50 mgL-1 paromomycin) under 150 Em-2s-1 light at 28C for two weeks. 13. Culture of callus with shoots in RoM under 150 Em-2s-1 light at 28C for two weeks. 14. Transfer of in vitro plants to small pots with Farfard#2 potting mix into the growth chamber. Protocols for Molecular Techniques Plasmid DNA Extraction Method (Q IAprep Miniprep kit, Qiagen) 1. Grow over-night cultures each from a single colo ny of bacteria in 5 ml LB broth containing 50 g/ml kanamycin at 37C with constant shaking. 2. Add the provided RNase A solution to Buffer P1, mix well by inverti ng and store at 4C. 3. Add 100% ethanol (volume provided on the bottle label) to the Buffer PE concentrate to prepare the working solution. 4. Centrifuge the cultures at 13,200 rpm for 1 min to pellet the bacterial cells. Remove the supernatant by pipetting and autoclave before disposing. 5. Resuspend the bacterial cells in 250 l Buffer P1 by vortexing and transfer the suspension to a sterile 1.5 ml microcentrifuge tube. 6. Add 250 l Buffer P2 and mix well by i nverting the tube gently 4-6 times. 7. Add 350 l Buffer P3 and mix immediately but gently by inve rting the tube 4-6 times. 8. Centrifuge the samples at 13,000 rpm for 10 min. A compact white pellet will form.

PAGE 111

111 9. Pipet the supernatant onto QI Aprep Spin Columns and centrifuge for 1 min at 13,000 rpm. Discard the flow-through. 10. Pipet 750 l Buffer PE onto the columns and centrifuge for 1 min at 13,000 rpm to wash the columns. 11. Discard the flow-through and centr ifuge for 1 min to remove all traces of the wash buffer (Buffer PE). 12. Place the QIAprep columns in clean 1.5 ml micr ocentrifuge tubes. Add 50 l Buffer EB to the center of each QIAprep column to elute DNA. Let stand for 1 min and centrifuge at 13,000 rpm for 1 min. 13. Estimate the DNA concentration using a spect rophotometer or by running on a gel. 14. Store the samples at -20C. Plasmid DNA Extraction Method (Plasmid Midi Kit, Qiagen) 1. Inoculate a starter culture from e ither a single colony or a glycer ol stock of the bacteria in 5 ml LB broth containing 50 g/ml kanamycin. Gr ow the culture at 37C for 8 hours with constant vigorous shaking. 2. Prepare Buffer P1 by adding the provided RNase A solution, mix well by inverting and store at 4C. 3. Prepare 250 ml flasks containi ng 25 ml LB broth, one per midi prep. Sterilize the broth by autoclaving the flasks for 20 mi n. Cool the broth before use. 4. Prepare 50 ml corning tubes (3 per sample) by autoclaving for 20 min followed by drying at 60C. 5. After cooling add kanamycin to each flask to get a final concentration of 50 g/ml kanamycin (25 l) in a clean bench. Add 250 l of the actively growi ng starter culture to each flask (1:1000 dilution) and incubate for 16 hr at 37C with constant vigorous shaking. 6. Transfer each culture to a ster ile 50 ml corning tube and centrifuge at 6000 x g for 15 min at 4C. 7. Place Buffer P3 in ice. 8. Resuspend the bacterial pellet in 4 ml Buffer P1 by vortexing the samples until no clumps are visible. 9. Add 4 ml Buffer P2 and mix well by gently inve rting 4-6 times. Incubate the samples at room temperature for 5 min. 10. Add 4 ml of chilled Buffer P3 and mix imme diately but gently by inverting the tube 4-6 times. Incubate the samples in ice for 20 min. 11. Centrifuge at 20,000 x g for 30 min at 4C. Imme diately transfer the supernatant to a new tube by pipetting. 12. Centrifuge the supernatant again at 20,000 x g fo r 15 min at 4C. Transfer the supernatant to a new tube by pipetting immediately. 13. Apply 4 ml Buffer QBT to a QIAGEN-tip 100 for equilibration and allow the column to empty by gravity flow. 14. Apply the supernatant from Step 12 immediately to the equilibrate d tip and allow it to enter the resin by gravity flow. 15. After all the liquid has entered the column wa sh the QIAGEN-tip 2x with 10 ml Buffer QC.

PAGE 112

112 16. Add 5 ml Buffer QF to the column to elute th e DNA. Collect the eluate in a sterile 50 ml tube. 17. Add 3.5 ml (0.7 volumes) room-temperature isopr opanol to the eluted DNA to precipitate it. Mix well and centrifuge immediately at 15,000 x g for 30 min at 4C. Carefully decant the supernatant taking care not to disturb the pellet. 18. Wash the DNA pellet with 2 ml room-tempera ture ethanol and centrifuge at 15,000 x g for 10 min. Remove the supe rnatant by pipetting. 19. Air-dry the pellet by inverting the tu be on absorbent paper for 5-10 min. 20. Add 200 l TE to the tube and rinse the walls of the tube thoroughly to resuspend the DNA. 21. Leave resuspending over-night at 4C. Transfer to a sterile microcentr ifuge tube, estimate concentration and store at -20C. Plasmid DNA Gel-Extraction Method (Q IAquick Gel Extracti on kit, Qiagen) 1. Prepare Buffer PE by adding 40 ml 100% ethanol to the provided concentrate. 2. Excise the DNA fragment precisely from the ag arose gel using a clean sharp scalpel. Avoid excess agarose. 3. Weigh the gel slice in a colorless sterile micro centrifuge tube. Restrict the volume of gel in each tube to 400 mg or less. 4. Add 3 volumes of Buffer QG to 1 volume of gel. 5. Incubate at 50C in a heating block for 10 mi n or until the gel has completely dissolve. Vortex every 2 min during incubation to ensure complete dissolution of gel. 6. Following incubation check that the color of the mixture remains similar to Buffer QG (yellow), indicating that the pH has not changed. 7. Add 1 gel volume of isopropanol to the mixture and mix by inverting the tube several times. 8. Place a QIAquick spin column in a provided 2 ml collection tube and apply the sample to the column. Centrifuge at 13,200 rpm for 1 min. Repeat this step if the volume of the mixture is more than 800 l, the maximum capacity of the QIAquick column. 9. Discard the flow-through and place the co lumn in the same collection tube. 10. Wash the QIAquick column by adding 750 l Buffer PE to the column and centrifuging for 1 min at 13,000 rpm. 11. Discard the flow-through, place the column back in the same collection tube and spin for an additional 1 min at 13,000 rpm to remove residual ethanol from Buffer PE. 12. Place the QIAquick column in a clean, sterile 1.5 ml microcentrifuge tube. 13. Add 30 l Buffer EB (10 mM Tris-Cl, pH 8.5) to the center of the QIAquick membrane to elute DNA, let stand for 1 min and th en centrifuge for 1 min at 13,000 rpm. 14. Store DNA at -20C. Genomic RNA Extraction Method ( RNeasy Plant Mini Kit,Qiagen) 1. Prepare enough Buffer RLT for use by adding 10 l -Mercaptoethanol (Sigma) per 1 ml of buffer. 2. Add 44 ml of 100% ethanol to the RPE buffer concentrate to prepare the working solution. 3. Harvest 100 mg young leaves and freeze immediately using liquid nitrogen. 4. Grind the sample to a fine powder using a ster ile (Autoclaved for 30 mi n) mortar and pestle. Transfer the ground sample to a sterile, liquid-nitroge n cooled 2 ml microcentrifuge tube.

PAGE 113

113 5. Add 450 l prepared Buffer RLT to the powder and vortex vigorously. 6. Pipet the lysate onto a QIAshredder spin co lumn placed in a 2 ml collection tube and centrifuge for 2 min at maximum speed (13,200 rp m). Transfer the supe rnatant of the flowthrough to a new sterile microcen trifuge tube taking care not to disturb the pellet of celldebris. Estimate the approximate volume of the supernatant. 7. Add 0.5 volume (225 l) ethanol (200 proof) to the collected supernatant and mix immediately by pipetting. 8. Immediately transfer sample, including any preci pitate formed, to an RNeasy mini column placed in a 2 ml collection tube. Close the tube gently and centrifuge for 15s at 10,000 rpm. Discard the flow-through. 9. Perform DNase treatment using th e RNase-Free DNase Set (Qiagen). 10. Transfer the RNeasy column to a new 2 ml co llection tube. Wash th e column by pipetting 500 l Buffer RPE onto it and centrifuging fo r 15 s at 10,000 rpm. Discard the flow-through. 11. To dry the RNeasy silica-gel membrane, pipe tte another 500 l of Buffer RPE onto the column and centrifuge for 2 min at 10,000 rpm. Discard the flow-through. 12. Transfer the column to a new sterile 1.5 ml co llection tube supplied with the kit. To elute RNA, pipet 30 l RNase-free water directly on to the RNeasy silica membrane in the center of the column. Close the tube gently and centrifuge for 1 min at 10,000 rpm. 13. Estimate concentration and use 1g RNA immediately to prepare cDNA. 14. Store remaining RNA at -80C. DNase Treatment using the RNase-Free DNase Set (Qiagen) 1. Dissolve the solid DNase I (1500 Kunitz units) in 550 l of the provided RNase-free water to prepare the DNase I stock solution. Mix gently by inverting the vial. Store the solution at 20C. 2. Wash the RNeasy column by pipetting 350 l Buffer RW1 onto the column and centrifuging for 15 s at 10,000 rpm. Di scard the flow-through. 3. Add 10 l DNase I stock solution to 70 l Bu ffer RDD for each sample and mix by inverting gently. 4. Pipet the 80 l DNase I mixture onto the RNeas y silica-gel membrane and incubate on the bench (20-30C) for 15 min. 5. Wash the RNeasy column again using 350 l Buffer RW1 and centrifuge for 15 s at 10,000 rpm. 6. Continue with step 10 of the total RNA isolation protocol. Large-Scale Genomic DNA Extraction Method (CTAB method, Murray and Thompson, 1980) 1. Sterilize mortar, pestles and spatulas by auto claving for 20 min and drying in 60 C oven. 2. Pipet 15 ml of CTAB buffer (5 ml/gram leaf material) into 50 ml sterile disposable polypropylene tubes, one for each sample. Add 30 l -Mercaptoethanol to each tube and mix well. Heat to 65C in a water bath. 3. Harvest 3 g young leaf material and stor e on ice or freeze in liquid nitrogen.

PAGE 114

114 4. Cool mortar and pestle by a dding liquid nitrogen. Chop fresh leaf into liquid nitrogen using scissors. Grind to a fine powder usin g nitrogen approximately three times. 5. Add the frozen leaf powder to the pre-heated buffer and mix well to remove lumps using a spatula or glass rod. 6. Incubate at 65 C for 1 hour. Mix the contents 2-3 times during the incubation. Cool to room temperature. 7. Add equal volume (15 ml) chloroform/isoamyl al cohol (24:1) and mix gently by hand. Then place on a shaker with gentle mixing for 30 min to form an emulsion. Mix samples by hand once half-way through the incubation. 8. Centrifuge at 4,000 rpm for 1 min. Discard lower layer. 9. Centrifuge at 4,000 rpm for 10 min. Transfer th e top layer to a new sterile 50 ml tube. 10. Add 2/3 volumes (10 ml) isopropanol and mix gently by inverting. 11. Use a sterile blue pipette tip to hold the spool of DNA and pour away the liquid. Transfer the DNA to a sterile 2 ml microcentrifuge tube. 12. Wash the DNA 2x in 70% ethanol, while holding the DNA inside the tube. 13. Centrifuge at 13,200 rpm for 1 min and remove the supernatant. 14. Air-dry the pellet for 15 min in a clean bench and resuspend in 500 l TE. 15. Add 2 l RNase A (30 mg/ml) and incubate at 60C over-night. 16. Add 300 l phenol/chloroform (25:24:1 Phenol :Chloroform:Isoamylalcohol) and mix by inverting and tapping to form an emulsion. 17. Centrifuge at 13,200 rpm for 5 min at 4C. Remove the top layer and transfer to a new sterile 2 ml microcentrifuge tube. 18. Repeat the phenol/chloroform extraction. 19. Add 300 l chloroform/isoamylalcohol (24: 1) and mix well to form an emulsion. 20. Centrifuge at 13,200 rpm for 5 min at 4C. Remove the top layer and transfer to a new sterile 2 ml microcentrifuge tube. 21. Repeat the chloroform extraction. 22. Add 1/10 volume (50 l) 3M sodium acetat e and 2 volumes (1 ml) 100% ethanol. 23. Spin for 1 min at 13,200 rpm and rem ove the supernatant by pipetting. 24. Wash 2x in 70% ethanol. After the first wash pour off the supernatant and after the second wash spin for 1 min at 13,200 rpm and remove su pernatant by pipetting. This allows faster drying of the DNA pellet. 25. Dry the pellet for 15-25 min (depending on the size of the pellet) in a vacuum rotatory evaporator (Speed-Vac) with the heating on. Do not over-dry the pellet as this may compromise the solubility of the DNA. 26. Resuspend in 200 l T1/10E. Incubate at 60C over-night to help resuspension. 27. Make 10X dilutions for all samples. Use these samples to estimate DNA concentration using a spectrophotometer and by running on a gel. 28. Store the dilutions and stocks at 4C. Protocol for Southern Blot (Sambrook and Russell, 2001) 1. Turn on the incubator and the water bath at 65C, remove P32 and salmon sperm from the frezeer and placed the closed P32 behind the pl astic shield to let them thaw.Take the hybridization buffer and placed it on the hot water bath.

PAGE 115

115 2. Pre-wet the blots: Assemble n eeded hybridization tube s in the rack, plac e blots inside the tubes, wrap top with teflon tape (to avoid leacking), and prew et blots with 5X SSC solution. Thaw the Prime-a-gene kit (Promega) compone nts and keep Klenow on ice. Thaw your probe, prepare the dNTP mixture (10 l TTP, ATP and GTP) and use screw cap eppendorf tubes for the probes. 3. Prepare the probe adding DNA a nd water (30 l total volume). Prepare 500 l salmon sperm. To denature, place both screw-cap tubes in a b eaker with boiling water for 5 min. Then, place them back on ice for 5 min. 4. To pre-hybridize the blots: Take the hybridization tubes, elim inate the 5X SSC solution and add 20 ml of hot 1X SSC (65C, water bath), add 500 l salmon sperm, cap tightly, and place the tubes in opposite directions inside the inc ubator. Close the door, turn on the rotator and check for leaky lids and proper rotation. 5. Probe labeling: Add 10 l buffer, 2 l BSA, 2 l dNTPs and 1l Klenow to the probe tube working on ice and outside the yield. Move be hind the yield, add 5 l P32, cap tightly, mix lightly, and place them in the ra ck (50 l total volumen). 6. Let the hybridization tubes (incub ator) and probe tubes (radioac tive bench) incubate for 3-4 hours. 7. Behind the yield, dilute the probe with 1/10 TE buffer (1 ml) and add 500 l salmon sperm. Denature the mix in boiling water for 5 mi n. Remove the hybridization tubes from the incubator, eliminate the pre-hybridizati on solution and place them in the rack. 8. Blot hybridization: Add 10 ml hybridization solution, add probe-salmon sperm mix, taking care that the pippette dispenses the hot probe in the hybridization solution and not on the blots. Recap the tubes and place them back in the incubator. Close the door, turn on the rotator and check for leaky lids and proper rotation. Allow to in cubate overnight. 9. Washing blots: Next day, eliminate the probe so lution in the radiactive waste container, wash the blots in the tubes with a hot solution (65 C) of 0.1X SSC and 0.1% SDS. Do three washes of 15 ml each: one quick wash and two 20 min washes in the incubator. All the washing solutions is pour into the ra dioactive waste container. 10. Behind the yield, remove the blots from the tube s and wrap them with Saran wrap. Check for radioactivity with the Geiger c ounter and place the blots into th e film cassettes. Add the film and place the cassettes in the freezer at -80C for 2-3 days. 11. Develop the film in the darkroom. Protocol for Enzyme Linked Immunadsorbent-Assay for the nptII gene (Agdia kit) 1. Dilute the PEB1 buffer concentr ate (10x) to 1x using sterile ddH2O. Prepare enough to use 600 l per sample plus a little ex tra (for use as negative control). 2. Harvest 3 eppendorf lengths of leaf, always choosing the youngest full expanded leaf. Store samples on ice. 3. Add a pinch of polyvinyl pyrrolidone PVP and 600 l PEB1 buffer to each sample. Grind the leaf materials as much as possible using a ster ile blue micropestle. Keep the samples on ice. 4. Centrifuge the samples at 14,000 rpm at 4C fo r 15 min. Transfer the supernatant to a new microcentrifuge tube by pi petting and store on ice. 5. If the samples contain a lot of debris, centrifuge again. 6. Turn on spectrophotometer half an hour before use.

PAGE 116

116 7. Dilute Bradfords reag ent 1:5 using sterile ddH2O. Prepare enough to use 1 ml per sample including standards and blank. 8. Prepare a dilution series using BSA for use as standards. 9. Add 1 ml diluted Bradfords reagent to each c uvette. Add 10 l of sample to each cuvette and mix by pipetting. 10. To ensure complete mixing, immediately invert the cuvette using a piece of parafilm. Leave to incubate at room-temperature while preparing the remaining samples. Use a new piece of parafilm for each sample to prevent contamination. 11. Measure OD595 of each sample (ideally these should be between 0.2 and 0.8). 12. Plot a standard curve using BSA and use it to estimate protein concentration of the samples. 13. Calculate the volume of each sample required to get 15 g. 14. Prepare the samples, including wild-type, in new tubes using 15 g protein and the volume of buffer PEB1 required to make the total volume 110 l. 15. Prepare standards as follows: 110 l buffer PEB1 (negative control) and 110 l of the provided positive control. Keep all prepared samples on ice. 16. Prepare a humid box by putting some damp paper towel in a box with a lid. 17. Add 100 l of each prepared samples into th e test wells, making note of the sequence in which the samples were applied. Also a dd 100 l of the prepared standards. 18. Place the plate in humid box and incubate for 2 hours at room temperature. 19. Prepare the wash buffer PBST by diluting 5 ml to 100 ml (20x) with dd H2O.. 20. Prepare the enzyme conjugate diluent by mixi ng 1 part MRS-2 with 4 parts 1x buffer PBST. Make enough to add 100 l per well. 21. A few minutes before the incubation ends, add 10 l from bottle A and 10 l from bottle B per 1 ml of enzyme conjugate diluen t to prepare the enzyme conjugate. 22. When incubation is complete, remove plate fr om humid box and empty wells into the sink by flipping quickly while squeezi ng the sides of the frame. 23. Fill all wells to over-flowing with 1x buffer PBST and then quickly empty them again. Repeat 5x. 24. After washing tap the frame firmly upsid e down on paper towels to dry the wells. 25. Add 100 l of prepared enzyme conjugate into each well. 26. Place the plate in humid box and incubate for 2 hours at room temperature. 27. Measure out sufficient TMB substrate solution for 100 l per well into a clean container. Allow to warm to room temper ature during the 2 hour incubation. 28. When the incubation is complete, wash th e plate with 1x buffer PBST as before. 29. Add 100 l of room temperature TMB substrate solution to each well and place the plate in humid box for 15 min. 30. Add 50 l 3M sulphuric acid (stop solution) to each well. The substrate color will change from blue to yellow. 31. The results must be recorded within 15 min after addition of the stop solution otherwise the reading will decline.

PAGE 117

117 High sensitivity Protocol for Enzyme Linked Immunadsorbent-Assay for the cry1F gene (QualiPlate Kit for Cry1F EnviroLogix) Buffer, control and leaf sample preparation for ELISA 1. Prepare washing buffer as follows: Add the cont ents of the packet of Wash Buffer Salts (phosphate buffered saline, pH 7.4 Tween 20) to 1 liter of distilled or deionized water and stir to dissolve. Store refrigerat ed when not in use; warm to room temperature prior to assay. If more wash buffer is needed, order item # P-3563 from Sigma Chemical Co. ( St. Louis, MO), or prepare the equivalent. 2. Prepare Extraction Buffer: Add 0.5 ml Tween-20 to 100 ml of prepared Wash Buffer, and stir to dissolve. Store refrigerated wh en not in use; warm to room temperature prior to assay. 3. Prepare Positive and Negative Control ground corn extracts: Extracts of these controls must be run in every assay. To extract, add 5 ml of Extraction Buffer to each tube containing 2 grams of ground Control corn. Cap and sh ake vigorously by hand or vortex for 20-30 seconds. Let stand at room temperature for 1 hour to extract. Mix again at the end of the hour, then clarify by allowing to settle 10 mi nutes or by centrifuging 5 minutes at 5000 x g. The High Sensitivity Protocol requires that the Positive Control ground corn extract be diluted 1:3 in Negative Control ground corn extract (mix 100 l Positive extract plus 200 l Negative extract) prior to use. 4. Prepare leaf samples from the third fully emer ged leaf: Take two leaf segments from the second and third uppermost leaves of length eq uivalent to that of a 1.5ml eppendorf tube. Mash the leaf tissue with a pestle matched to th e micro-tube, or with a disposable pipette tip, or a Hypure cutter (HCT-200, Pe rkinElmer) in a 96-well. Add 0.25 ml of Extraction Buffer per leaf punch. Mix for at least 30 seconds, then allow particles to settle. Take extreme care not to crosscontaminate between leaf samples. Dispensing particles into the test plate can cause false positive results. ELISA 1. Dilute the Positive Control gr ound corn extract 1:3 in Negative Control ground corn extract for this protocol. 2. Add 50 l of Extraction Buffer Blank (BL), 50 l of Negative Control (NC) ground corn extract 50 l of diluted Positive Control (P C) ground corn extract, and 50 l of each sample extract (S) to their respective wells. 3. Thoroughly mix the contents of the wells by mo ving the plate in a rapid circular motion on the benchtop for a full 20-30 seconds. Be careful not to sp ill the contents! 4. Cover the wells with tape or Parafilm to pr event evaporation and incubate at ambient temperature for 30 minutes. If an orbital plate shaker is available, shake plate at 200 rpm. 5. Add 50 l Cry1F-enzyme Conjugate to each well. T horoughly mix the contents of the wells, as in step 2. 6. Cover the wells with tape or Parafilm to pr event evaporation and incubate at ambient temperature for 90 minutes. If an orbital plate shaker is available, shake plate at 200 rpm. 7. After incubation, carefully remove the coveri ng and vigorously shake the contents of the wells into a sink or other suitable container. Flood the wells completely with Wash Buffer, then shake to empty. Repeat this wash step three times. 8. Add 100 l of Substrate to each well.

PAGE 118

118 9. Thoroughly mix the contents of the wells, as in step 2. Cover the wells with new tape or Parafilm and incubate for 30 minutes at ambient temperature. Use orbital shaker if available. Caution: Stop Solution is 1.0N H ydrochloric acid. Handle carefully. 10. Add 100 l of Stop Solution to each well and mi x thoroughly. This will turn the well contents yellow NOTE: Read the plate within 30 minutes of the addition of Stop Solution. Protocol for immunochroma tography strip test for cry1F gene (QuickstixTM kit for cry1F EnviroLogix) Sample Preparation 1. Prepare leaf samples from the third fully emer ged leaf: Take two leaf segments from the second and third uppermost leaves of length eq uivalent to that of a 1.5ml eppendorf tube. Mash the leaf tissue with a pestle. Sample iden tification should be marked on the tube with a waterproof marker. 2. Insert the pestle into the tube and grind the tissue by rotating the pestle against the sides of the tube with twisting motions. Continue this process for 20 to 30 seconds or until the leaf tissue is well ground. 3. Add 0.25 mL of extraction Buffer into the tube. Repeat the grinding step to mix tissue with Extraction Buffer. Dispose of the pestle(do not re-use pestles on more than one sample to avoid cross-contamination). QuickStix Strip Test 1. Allow refrigerated canisters to come to room temperature before opening. Remove the QuickStix Strips to be used. Avoid bending the strips. Reseal th e canister immediately. 2. Place the strip into the extraction tube. The samp le will travel up the strip. Use a rack to support multiple tubes if needed. 3. Allow the strip to develop for 10 minutes before making final assay interpretations. Positive sample results may become obvious much more quickly. 4. To retain the strip, cut off the bottom sect ion of the strip covered by the arrow tape. 5. Development of the Control Line within 10 mi nutes indicates that th e strip has functioned properly. Any strip that does not develop a Control Line should be discarded and the sample re-tested using another strip. 6. If the sample extract contained Cry1F endotoxin, a second line (Test Line) will develop on the membrane strip between the Control Line and the protective tape, within 10 minutes of sample addition. The results should be interpreted as positive for Cry1F endotoxin expression. Any clearly discernible pink Test Line is considered positive. 7. If no Test Line is observed after 10 minutes have elapsed, the results shou ld be interpreted as negative,meaning that the sample contained le ss Cry1F endotoxin than is typically expressed in the tissues of Bt-modified plants.

PAGE 119

119 Protocol for co-immunoprecipi tation of recombinant VSP (ProFound c-Myc Tag IP/CoIP Kit, Pierce Biotechnology) Material Preparation: 1. Prepare the extraction and TBS buffers. 2. Prepare leaf samples: Weight and freeze 5 grams of young leaf ti ssue. Use mortar and pestle to grind the leaves with liquid nitrogen. A dd 15 ml extraction buffer (1:3 weight: volumen ratio). Centrifugate tube sa mples for 20 minutes at 4000 rpm and 4C(Sorwall SS-34). Take the supernatant and centrifugate samples fo r 10 minutes at 4000 rpm and 4C. Take the supernatant. 3. Concentrate the protein extract by acetone prec ipitation: Cool the acetone required volume to -20C. The final volume is four times the vol ume of your protein extract (ex. 15 ml extract needs 60 ml acetone). Place protein sample a polypropylene tube (split the extract in two tubes before adding the acetone because polypropyl ene tubes hold 30 ml). Add four times the sample volume of cold acetone to the tube. Vortex tube and incubate for 60 minutes at -20C. Centrifuge 10 minutes at 13,000-15,000 rpm (Sor wall). Decant and properly dispose of the supernatant, being careful to not dislodge the protein pellet. 4. Add resuspension buffer (4 ml/tube) and resusp end the pellet using an orbital shaker. 5. Estimate protein concentration with the Coomasie Plus Protein Assay reagent and Coomasie standards (Pierce Biotechnology, Inc.) at OD595 with a spectrophotometer. Protein concentration should be approx. 1 mg/ml. Immunoprecipitation/Co-immunoprecipitation (IP/Co-IP) of c-Myc-tagged protein 1. Set up a positive control: Use 50 l c-Myc-tagged Positive Control diluted in 150 l TBS. 2. Thoroughly resuspend the anti-c-Myc agaros e by inverting the vial several times immediately before dispensing ( do not vortex!). Dispense 10 l anti-c-myc agarose slurry (5 g anti-c-Myc antibody) into each tube containi ng 1ml of protein extract using a wide-bore pipette tip. Close the tube. 3. Incubate the tube with an orbital shak er at 4C overnight (in the fridge). 4. Next day, get the spin column and remove th e bottom plug. Put a collection tube under the column, add 0.5 ml of the mix slurry-protein extract and pu lse for 10 seconds at maximum speed in microcentrifuge. Save the flow-through fo r future analysis. Repeat this step because the maximum volume for the spin column is 850 l. 5. Prepare a wash solution of TBS plus 0.05% Tw een20 (TTBS). For each spin column prepare approximately 3 ml of wash solution. Add 0.5 ml TTBS to each column. Loosely screw on the cap and gently invert the column with the collection tube 2-3 times Pulse centrifuge for 10 seconds. Save the wash for future analysis Repeat this step two additional times. 6. Elution of c-myc-tagged protei n: Place the spin column in a new collection tube. Add 10 l elution buffer to the anti-c-myc agarose, loosel y screw on the cap and gently tap the tube to mix. Pulse centrifuge for 10 seconds. (It is not necessary to place the bottom plug on the spin column for this step). 7. Repeat this step two additional times. The thr ee elutions may be recovered and pooled in one collection tube. Neutralize the elutant immediately by adding 1 l of 1 M Tris, pH 9.5 per 20 l of Elution Buffer.

PAGE 120

120 8. To prepare the sample for reducing SDS-PAGE and western blot, take 25 l sample and add 2-3 l of 1 M DTT or 1-2 l of mercaptoehtanol and loading buffer. The sample is ready to load. 9. Usually, the eluted c-myc-tagged positive contro l can be detected by coomassie or silver staining. But, for more sensitive detection methods such as Western blotting, dilute the control 10to 50-fold (0.2-0.5 l elution is sufficient for analysis). Protocols for Western Blots Western blots with VSP antibodies 1. Prepare samples: Grind 500 mg leaf tissue (including leaves from all stages) with liquid nitrogen in a 2 ml tube. Add 1 ml extraction buffer (Bellucci et al., 2000). Vortex and place it on ice until finish processing all the samples. Centrifuge at 14,000 g 20 minutes. Take supernatant. Centrifuge at 14,000 g 10 minutes. Take supernatant. 2. Estimate protein concentration: Prepare calib ration curve with a range between 0.5 and 5 mg/ml. Make 10X dilutions of the samples (5 l sample: 45 l ddH2O). Take OD595 readings with the spectrophotometer Estimate sample concentrations. 3. Prepare loading samples: Add 15 g total prot ein per sample. Add 5 ul loading buffer per sample. Incubate the samples at 100C 10 minut es. Store at -20C or place them on ice until use. 4. Prepare SDS-PAGE gels. Load molecular markers: 10 l Prestained SDS-PAGE standards, low range (Bio-Rad Laboratories) and 1 l MagicMark (Qiagen). Load 20 l plant samples. 5. Run SDS-PAGE gels in electrophore tic tank at 150 v, 1 hr 15 minutes. 6. Prepare fresh transfer buffer and keep it on ice or in the fridge (-20C). Place SDS-PAGE gels and nitrocellulose membrane (NC-membrane, Bi o-Rad Laboratories) in transfer buffer; and rinse them 5 minutes twice. 7. Prepare transfer sandwich keeping all the pieces wet in transfer buffer. Place the transfer cell in the electrophoretic tank and run the transfer while stirring and keeping the tank cold with ice or inside the fridge, at at 150 v, 1 hr 15 minutes. 8. To confirm protein transfer, st ain gels with Coomasie blue (Sigma R-250, Sigma) or NCmembrane with Ponceau solution. Rinse nitroc ellulose membranes with Tween Tris Buffer (TTBS) twice, 5 minutes. 9. To avoid unspecific binding, incubate NC-m embrane in a solution with TTBS and 5% nonfat dry milk (Bio-Rad Laborator ies) (0.75 g milk and 15 ml TTBS) in orbital shaker at room temperature. Rinse NC-membrane w ith TTBS buffer twice, 5 minutes. 10. Incubate NC-membrane in a solution w ith TTBS, 5% non-fat dry milk and 1:1000 VSPb antibody dilution (10 l batch#73, 0.75 g milk and 15 ml TTBS) in orbital shaker at room temperature, 4 hr. Rinse NC-membran e with TTBS buffer twice, 5 minutes. 11. Incubate NC-membrane in a solution w ith TTBS, 5% non-fat dry milk and 1:50,000 secondary antibody dilution (1.2 l Pierce, 0.75 g milk and 15 ml TTBS) in orbital shaker at room temperature, 2 hr. Rinse NC-membr ane with TTBS buffer twice, 5 minutes.

PAGE 121

121 12. Incubate NC-membrane in a 1:1 solution with TTBS : cheminoluminescent substrate (Supersignal West Femto Maximun Sensitiv ity Substrate, Pierce Biotechnology, Inc.) according Pierce recommendations, and devel op in dark room after 5-15 minutes. Western blots with c-myc antibodies 1. Prepare samples: Grind 500 mg leaf tissue (including leaves from all stages) with liquid nitrogen in a 2 ml tube. Add 1 ml extraction buffer (Bellucci et al., 2000). Vortex and place it on ice until finish processing all the samples. Centrifuge at 14,000 g 20 minutes. Take supernatant. Centrifuge at 14,000 g 10 minutes. Take supernatant. 2. Estimate protein concentration: Prepare calib ration curve with a range between 0.5 and 5 mg/ml. Make 10X dilutions of the samples (5 l sample: 45 ul l ddH2O). Take OD595 readings with the spectrophotometer Estimate sample concentrations. 3. Prepare loading samples: Add 15 g total prot ein per sample. Add 5 l loading buffer per sample. Incubate the samples at 100C 10 minut es. Store at -20C or place them on ice until use. 4. Prepare SDS-PAGE gels. Load molecular markers: 10 l Prestained SDS-PAGE standards, low range (Bio-Rad Laboratories) and 1 l MagicMark (Qiagen). Load 20 l plant samples. 5. Run SDS-PAGE gels in electrophore tic tank at 150 v, 1 hr 15 minutes. 6. Prepare fresh transfer buffer and keep it on ice or in the fridge (-20C). Place SDS-PAGE gels and nitrocellulose membrane (NC-membrane, Bi o-Rad Laboratories) in transfer buffer; and rinse them 5 minutes twice. 7. Prepare transfer sandwich keeping all the pieces wet in transfer buffer. Place the transfer cell in the electrophoretic tank and run the transfer while stirring and keeping the tank cold with ice or inside the fridge, at at 150 v, 1 hr 15 minutes. 8. To confirm protein transfer, st ain gels with Coomasie blue (Sigma R-250, Sigma) or NCmembrane with Ponceau solution. Rinse nitroc ellulose membranes with Tween Tris Buffer (TTBS) twice, 5 minutes. 9. To avoid unspecific binding, incubate NC-m embrane in a solution with TTBS and 5% nonfat dry milk (Bio-Rad Laborator ies) (0.75 g milk and 15 ml TTBS) in orbital shaker at room temperature. Rinse NC-membrane w ith TTBS buffer twice, 5 minutes. 10. Incubate NC-membrane in a solution w ith TTBS, 5% non-fat dry milk and 1:1000 c-myc antibody dilution (Sigma, 0.75 g milk and 15 ml TTBS) in orbital shaker at room temperature, 2 hr. Rinse NC-membran e with TTBS buffer twice, 5 minutes. 11. Incubate NC-membrane in a solution w ith TTBS, 5% non-fat dry milk and 1:50,000 secondary antibody dilution (1.2 l Pierce, 0.75 g milk and 15 ml TTBS) in orbital shaker at room temperature, 2 hr. Rinse NC-membr ane with TTBS buffer twice, 5 minutes. 12. Incubate NC-membrane in a 1:1 solution with TTBS : cheminoluminescent substrate (Supersignal West Femto Maximun Sensitiv ity Substrate, Pierce Biotechnology, Inc.) according Pierce recommendations, and devel op in dark room after 5-15 minutes.

PAGE 122

122 Protocol for Insect Bioassays Feeding Experiments (Adamczyk and Gore, 2004) 1. Prepare Petri dishes cont aining 1g/l agar medium. 2. Harvest bahiagrass plants. Collect the third fully emerged leaf from different tillers whitin the same plant. Cut bahiagrass leaves discarding the top and the bottom of the leaf and using intermediate pieces of 2 cm le ngth. Place four leaf pieces with the abaxial surface in contact with the medium on each Petri dish. 3. Collect fall armyworm neonate larvae from egg masses (hatching the same day) with a camel-hair brush and place on the top of the leav es. Place one larvae per Petri dish and seal the dish. Prepare 10 dishes per treatment and replicate. 4. Place Petri dishes in the incubator at 2628C. Leave the dishes for five days. 5. Then, open the Petri dish and look for the ne onate larvae under the dissectoscope. Larvae were considered alive if coordinated move ment was observed. Record mortality data. Buffers and Reagents Bacterial Growth SOC medium SOB: 4g tryptone, 1g yeast extract and 0.1g NaCl. Dissolve in 180ml dH2O. Add 2ml 250mM KCl. Adjust to pH7 with 5N NaOH. Make up to 200ml. Just before use, add 10l 1M MgCl2 and 20 l 1M glucose per 1ml SOB. Antibiotics Ampicillin: Weigh 100 mg ampicillin. Dissolve in 2 ml of ddH2O. Filter sterilize into autoclaved Eppendorf tubes. Freeze at -20 C. Stock concentration: 50 mg/ml. Use 2 l (100 g)/ml LB. Kanamycin: Weigh 100 mg kanamycin. Dissolve in 10 ml of ddH2O. Filter sterilize into autoclaved Eppendorf tubes. Freeze at -20 C. Stock concentration: 10 mg/ml. Use 5 l (50 g)/ml LB. Tetracycline: Weigh 50 mg tetr acycline. Dissolve in 10 ml of 100% ethanol. Aliquot into autoclaved Eppendorf tubes. Freeze at -20 C. Stock concentration: 5 mg/ml. Use 2 l (10 g)/ml LB. Paromomycin: Weigh 500 mg paromomycin. Dissolve in 10 ml of ddH2O. Filter sterilize into autoclaved Eppendorf tubes. Freeze at -20 C. Stock concentration: 50 mg/ml. Use 1 ml (50 mg)/ l IF.

PAGE 123

123 Rifampicin: Weigh 100 mg rifampicin. Dissolve in 4 ml of DMSO. F ilter sterilize into autoclaved Eppendorf tubes. Wrap tube s in aluminum foil. Freeze at -20 C. Stock concentration: 25 mg/ml. Use 6 l (150 g)/ml LB. Glycerol stocks Incubate the E.coli culture containing your plasmi d overnight at 37C. Add 0.85 ml bacterial culture. Add 0.15 ml gl ycerol (previously autoclaved and at room temperature). Vortex for mixing. Freeze in liquid nitrogen. Store -80C Prepare several tube s for plasmid. Avoid successive freeze-thaw cycles. Ethanol precipitation Add 0.1 volumen 3 M sodium acetate and 2 volumes 100% ethanol to plasmid DNA solution. Place -20C for 15-30 minutes. Spin 12, 000 g 10 minutes. Remove supernatant. Add 200 ul 70% ethanol. Spin 12,000 g 10 minutes. Remove supernatant. Air-dry or speed-vaccum the pellet. Resuspend in ddH2O or TE buffer. Plasmid DNA Extraction Extraction buffer (Buffer D): Add 4.44 g Tris .HCl, 2.65 g Tris base, 9.3 g EDTA, 7.3 G NaCl. Add ddH2O up to 500 ml. Sodium Dodecyl Sulphate stock (20% SDS) : Add 100 g SDS in 450 ml ddH2O with heat. Adjust pH=7.2 with concentrated HCl. Add ddH2O up to 500 ml. Potassium acetate stock (5 M): Add 29.44 g pot assium acetate, 11.5 ml glacial acetic acid, and make volume up to 100 ml ddH2O. Sodium acetate stock (3 M): Add 0.82 g sodi um acetate to 5 ml ddH2O. adjust pH=5.2 with glacial acetic ac id and make volume up to 10 ml with ddH2O. Bahiagrass Tissue Culture Medium IF Medium Add 1.72g MS salts (Murashige and Skoog, 1962), 40 l CuSO4 (12.45mg/ml), 1.2g Phytagel and 8g Sucrose to 400 ml ddH2O. Adju st pH to 5.8 with KOH. Autoclave 20 mins.

PAGE 124

124 Add 600 l dicamba (2mg/ml), 440 l BAP (1mg/ml) and 400 l MS vitamins (1000x) in sterile conditions. DICAMBA (3,6-dichloro-2-methoxibenzoic acid) Weigh 100 mg dicamba. Dissolve in 0.5 ml of 100% ethanol with heat. Add 49.5 ml ddH2O with heat. Filtersterlize the stock solutio n. Aliquot into autoclaved Eppendorf tubes. Freeze at -20 C. Stock concentration: 2 mg/m l. Use 600 l (1200 mg)/400 ml IF. BAP (6-benzylaminopurine) Weigh 825 mg BAP. Dissolve in 0.5 ml of NaOH (1N). Add 19.5 ml ddH2O. Filtersterlize the stock solutio n. Aliquot into autoclaved Eppendor f tubes. Freeze at -20C. Stock concentration: 1mg/ml. Use 440 l (1200 mg)/400 ml IF. Western bBots Extraction buffer (Be llucci et al., 2000) 100 ml 100 mM Tris 1.21 g 200 mM NaCl 1.17 g 1 mM EDTA 29.2 mg 10% glycerol 10 ml 0.2% Triton100X 0.2 ml 4% -mercaptoethanol 4 ml Adjust final volume with ddH2O. Add fresh -mercaptoethanol before use. Reduce to 1,2 mM mercaptoethanol and 5% glycerol to use co-immunoprecip itation columns. Loading buffer 10 ml 40% glycerol 4 ml 0.5 M Tris.HCl (pH=6.8) 2.5 ml 8% SDS 800 mg 0.24% Bromophenolblue 12 mg Adjust final volume with ddH2O. A liquot 200 l and add 50 l fresh -mercaptoethanol before use. Electrophoresis buffer (Tris-glycine-SDS 10X)

PAGE 125

125 1000 ml 25 mM Tris 30 g 192 mM glycine 144 g 0.1% SDS 10 g Adjust final volume with ddH2O. Add components in order and wait until they are dissolved. pH is adjusted naturally (pH=8.3). Destaining solution 500 ml 30% methanol 150 ml 10% acetic acid 50 ml 60% ddH2O 300 ml Rinse in fume hood. Tris base buffer (TBS) 1000 ml Tris base 24.22 g NaCl 87.66 g Adjust pH=7.5 by adding 15-20 ml 1N HCl. To prepare TTBS, add 0.1% Tween 20 before use. Transfer buffer 1000 ml 48 mM Tris 5.82 g 39 mM glycine 2.93 g SDS 2.5 mg 20% methanol 200 ml ddH2O 800 ml

PAGE 126

126 LIST OF REFERENCES Abanti C, Bhatnagar NB, Bhatnagar R (2004) Bacterial insect icidal toxins. Crit Rev Microbiol 30 : 33 Abel CA, Adamczyk JJ Jr (2004) Relative concentration of cry1A in maize leaves and cotton bolls with diverse chlorophyll content and correspondi ng larval development of fall armyworm (Lepidoptera: Noctuida e) and southwestern corn borer (Lepidoptera: Crambidae) on maize whorl leaf profiles. J Econ Entomol 97 : 1737-1744 Adamczyk JJ Jr, J.Gore (2004) Laboratory and field pe rformance of cotton containing cry1Ac cry1F and both cry1Ac and cry1F (Widestrike) against beet armyworm and fall armyworm larvae (Lepidoptera: Noctuidae). Fl Entomol 87 : 427-432 Agrawal PK, Kohli A, Twyman RM, Christou P (2005) Transformation of plants with multiple cassettes generates simple transgene in tegration patterns and high expression levels. Mol Breeding 16 : 247-260 Akashi R, Hashimoto A, Adachi T (1993) Plant regeneration from seed-derived embryogenic callus and cell suspension cu ltures of bahiagrass ( Paspalum notatum ). Plant Cell 90 :73-80 Alderson J, Sharp WC (1995) Grass varieties in theUnite d States. Lewis Publishers, Boca Raton, New York. Allen G, Spiker S, Thompson W (2000) Use of matrix attachment regions to minimize transgene silencing. Plant Mol Biol 42 : 361-376 Altpeter F and Xu J (2000) Rapid production of transgenic turfgrass ( Festuca rubra L.) plants. J Plant Physiol 157 : 441-448 Altpeter F, Baisakh N, Beachy R et al (2005) Particle bombardment and the genetic enhancement of crops: myths and realities. Mol Breeding 15 : 305-327 Altpeter F, Diaz I, McAuslane H, Gaddour K, Carbonero P, Vasil IK (1999) Increased insect resistance in transgenic wheat stably e xpressing trypsin inhibitor CMe. Mol Breeding 5 : 5363 Altpeter F, James V (2005) Genetic transformati on of turf-type bahiagrass ( Paspalum notatum Flugge) by biolistic gene transf er. Inter Turfgrass Soc Res J 10 : 485-489 Altpeter F, Positano M (2005) Efficient plant regenera tion from mature seed derived embryogenic callus of turf-type bahiagrass (Paspalum notatum Flugge). Int Turfgrass Soc Res J 10 : 479-484 Altpeter F, Vasil V, Srivastava V, Stoger E, Vasil IK (1996a) Accelerated production of transgenic wheat ( Triticum aestivum L.) plants. Plant Cell Rep 16 :12-17

PAGE 127

127 Altpeter F, Vasil V, Srivastava V, Vasil IK (1996b) Integration and expression of the highmolecular-weight glutenin subunit 1A x1 gene into wheat. Nature Biotech 14 : 1155-1159 Altpeter F, Xu J, Ahmed S (2000) Generation of large numbers of independently transformed fertile perennial ryegrass ( Lolium perenne L.) plants of forageand turf-type cultivars. Mol Breeding 6 : 519-528 Aphis-USDA database, 2007. Information Systems for Bi otechnology, National Biological Impact Assessment Program (ISB, NBIAP). Transgenic crops under field trials and deregulation process in the United States. U pdated: May 3, 2007 (last accessed May 6, 2007). http://nbiap.vt.edu Aphis-USDA database, 2007. Information Systems for Bi otechnology, National Biological Impact Assessment Program (ISB, NBIAP). To tal number of issued or acknowledged field tests of transgenic crops sorted by state in the United States. U pdated: May 3, 2007 (last accessed May 6, 2007). http://www.isb.vt.edu/cf docs/fieldtests1.cfm Arthington JD, Brown WF (2005) Estimation of feeding value of four tropical forage species at two stages of maturity. J Anim Sci 83 : 1726-1731 Avice JC, Ourry A, Lemaire C, Boucaud J (1996) Nitrogen and carbon flows estimated by 15N and 13C pulse-chase labeling during regrowth of alfalfa. Plant Physiol 112 : 281-290 Bajaj S, Ran Y, Phillips J, Kularajathevan G, Pal S, Cohen D, Elborough K, Puthigae S (2006) A high throughput Agrobacterium tumefaciens -mediated transformation method for functional genomics of perennial ryegrass ( Lolium perenne L.). Plant Cell Rep 25 : 651-659 Bates SL, Zhao J-Z, Roush RT, Shelton AM (2005) Insect resistance management in GM crops: past, present and fu ture. Nature Biotechnol 23 : 57-62 Belluci M, Alpini A, Arcioni S (2000) Expression of maize -zein and -zein genes in transgenic Nicotiana tabacum and Lotus corniculatus Plant Cell Tissue Organ Cult 62 : 141151 Berger S, Bell E, Sadka A, Mullet JE (1995) Arabidopsis thaliana Atvsp is homologous to soybean VspA and VspB genes encoding vegetative storage protein acid phosphatases, and is regulated similarly by methyl jasmonate, w ounding, sugars, light and phosphate. Plant Mol Biol 27 : 933 Betz FS, Hammond BG, Fuchs RL (2000) Safety and advantages of Bacillus thuringiensis protected plants to control inse ct pests. Reg Toxicol Pharmacol 32 : 156-173 Bevan M (1984) Binary Agrobacterium vectors for plant transf ormation. Nucleic Acids Res 12 : 8711-8721

PAGE 128

128 Bhalla PM (2006) Genetic engineering of wheat cu rrent challenges and opportunities. Trends Biotech 24 : 305-311 Bieri S, Potrykus I, Futterer J (2000) Expression of active ba rley seed ribosome-inactivating protein in transgenic wheat. Theor Applied Genet 100 : 755-763 Blount AR, Gates NR, Pfahler PL, Quesenberry KH (2003) Early plant selection effects on crown traits in Pensacola bahiagra ss with selection cycle. Crop Sci 43 : 1996-1998 Blount AR, Quesenberry KH, Mislevy P, Gates RN, Sinclair TR (2001) Bahiagrass and other Paspalum species: An overview of the plant breed ing efforts in the Southern Coastal Plain. Proc. 56th Southern Pasture and Forage Crop Improvement Conference, Springdale, US Bock R (2001) Transgenic plastids in basic re search and plant biotechnology. J Mol Biol 312 : 425-438 Bohorova N, Frutos R, Royer M, Estanol P, Pacheco M, Rascon Q, McLean S, Hoisington D (2001) Novel synthetic Bacillus thuringiensis cry1B gene and the cry1B-cry1Ab translational fusion confer resistance to sout hwestern corn borer, sugarcane borer and fall armyworm in transgenic tropical maize. TAG 103 : 817-826 Bouquin T, Thomsen M, Nielsen LK, Green TH, Mundy J, Dziegiel MH (2002). Human anti-Rhesus D IgG1 antibody produced in transgenic plants. Transgenic Res 11 : 115-122 Bovo OA, Mroginski LA (1986) Tissue culture in Paspalum (Gramineae): Plant regeneration from cultured inflorescences. J Plant Physiol 124 : 481-492 Bovo OA, Mroginski LA (1989) Somatic embryogenesis and plant regeneration from cultured mature and immature embryos of Paspalum notatum (Gramineae). Plant Sci 65 : 217-223 Bradford MM (1976) Rapid and sensitive method for qua ntification of microgram quantities of protein utilizing principle of protein-dye binding. Ann Biochem 72 : 248-254 Breitler JC, Cordero MJ, Royer M, Meynard D, San Segundo B, Guiderdoni E (2001) The -689/+197 region of the maize protease inhib itor gene directs high level, wound inducible expression of the cry1B gene which protects transgenic rice plants from stemborer attack. Mol Breeding 7 : 259-274 Buntin GD, Flanders KL, Lynch RE (2004) Assesment of experiment al Bt events against fall armyworm and corn earworm in field corn. J Econ Entomol 97 : 259-264

PAGE 129

129 Buntin GD, Hudson RD, Hudson WG, Gardner WA (1997) Summary of Losses from Insect Damage and Costs of Control in Georgia.Pastures and forage insects. The Bugwood Network and ForestryImages Image Archive and Database Systems, Warnell Sc hool of Forestry and Natural Resources and College of Agricultur al and Environmental Sciences, Dept. of Entomology University of Georgia. Upda ted March 19, 2003 (last accessed May 6, 2007). http://www.bugwood.org Burson BL, Watson VH (1995) Bahiagrass, dallisgrass and other Paspalum species. In RF Barnes ed, Forages: An introduction to Grasslan d Agriculture. Iowa St ate Univ. Press, Ames, IA, pp 431 Burton GW (1967) A search for the origin of Pensacola bahiagrass. Econ Bot 21 : 273-281 Burton GW (1974) Recurrent restricted phenotype selection incr eases forage yields of Pensacola bahiagrass. Crop Sci 14 : 831-835 Burton GW, Gates RN, Gasho GJ (1997) Response of Pensacola bahiagrass to rates of nitrogen, phosphorus and potassium fertil izers. Soil Crop Sci Soc Florida Proc 56 : 31-35 Cannon RJC (2000). Bt transgenic crops: Risks and benefits. PM Rev 5 : 151 Carman JG (1995) Nutrient absorption and the devel opment and genetic stability of cultured meristems. In : Current Issues in Plant Molecular a nd Cellular Biology. Terzi M, Cella R, A Falavigna, eds, Kluwer Academic Pub lishers, Dordrecht, Netherlands, pp 393 Castle LA, Wu G, McElroy D (2006) Agricultural input traits: Past, present and future. Current Opin Biotech 17 : 105-112 Chambliss CG (2002) Bahiagrass. EDIS SSR-36 Agronomy Department, Cooperative Extension Service, Institute of Food and Agri cultural Sciences, University of Florida, Gainesville, Fl,USA Chase A (1929) The North American species of Paspalum. Contrib US Natl Herb 28 :310 Chen L, Auh Ch-K, Dowling P, Bell J, Chen F, Hopkins A, Dixon RA, Wang Z-Y (2003) Improved forage digestibili ty of tall fescue ( Festuca arundinacea ) by transgenic downregulation of cinnamyl alcohol de hydrogenase. Plant Biotechnol J 1 : 437 Christensen AH, Quail PH (1996) Ubiquitin promoter-based vectors for high-level expression of selectable and/or screenable marker gene s in monocotyledonous plants. Transgenic Res 5 : 213-218 Christensen AH, Sharrock RA, Quail PH (1992) Maize polyubiquitin ge nes: structure, thermal perturbation of expression and transcript splicing, and promoter activity following transfer to protoplasts by electropo ration. Plant Mol Biol 18 : 675-689

PAGE 130

130 Cook BG, Pengelly BC, Brown SD, Donnelly JL, Eagles DA, Franco MA, Hanson J, Mullen BF, Partridge IJ, Peters M, Schultze-Kraft R (2005) Tropical Forages: An interasctive selection tool. CSIRO, DPI&F(Qld), CIAT and ILRI, Brisbane, Australia (last accesed May 6, 2007). http://www.tropicalforages.info Cunningham PJ, Lee CK, Anderson MW, Rowe JR, Clarke RG, Eagling DR, Villalta O, Easton HS (1994) Breeding improved perennial ryegrass in Australia. In Proceedings of the XVII International Grassland C ongress 1993, New Zealand (Eds M. J.Baker, J. R. Crush & L. R. Humphreys), 449 450. Palmerston Nort h: New Zealand Gra ssland Association. Cunningham SM, Volenec JJ (1996) Purification and characte rization of vegetative storage proteins from alfalfa ( Medicago sativa L.) taproots. J Plant Physiol 147 : 625-632 Cuomo GJ, Blouin DC, Corkern DL, McCoy JE, Walz R (1996) Plant morphology and forage nutritive value of 3 bahiagrasses as affected by harvest frequency. Agron J 88 : 85-89 Daniell H (2006) Production of biopharmaceuticals and vaccines in plants via the chloroplast genome. Biotechnol J 1 : 1071-1079 Daniell H, Dhingra A (2002) Multigene engineering: Dawn of an exciting era in biotechnology. Curr Op Biotechnol 13 : 136-141 Daniell H, Khan MS, Allison LA (2002) Milestones in chloroplas t genetic engineering: an environmentally friendly era in biotechnology. Trends Plant Sci 7 : 84-91 Darbani B, Eimanifar A, Stewart CN Jr, Camargo WN (2007) Methods to produce markerfree transgenic plants. Biotechnol J 2 : 83-90 Datta et al 2003 K, Baisakh N, Oliva N, Torrizo L, Abrigo E, Tan J, Rai M, Rehana S, AlBabili S, Beyer P, Potrykus I, Datta SK (2003) Bioengineered golde n indica rice cultivars with beta-carotene metabolism in the endos perm with hygromycin and mannose selection systems. Plant Biotechnol J 1 : 81-90 De Maagd RE, Bravo A, Crickmore N (2001) How Bacillus thuringiensis has evolved specific toxins to colonize the insect world. Trends Genetics 17 : 93-199 Dellaporta SL, Wood J, Hicks JB (1983) A plant DNA minipreparat ion: version II. Plant Mol Biol Rep 1 : 19-21 DeWald DB, Mason HS, Mullet JE (1992) The soybean vegetative storage proteins VSP and VSP are acid phosphatases active on polyphosphates. J Biol Chem 267 : 15958-15964 Dixon L, Nyffenegger T, Delley G, Martinez-Izquierdo J, Hohn T (1986) Evidence for replicative recombination in Ca uliflower Mosaic-Virus. Virology 150 : 463-468

PAGE 131

131 Duke JA (1981) Hand book of legumes of world economic importance. Plenum Press, New York. Dunwell JM (2000) Transgenic approaches to crop improvement. J Exp Bot 51 :487 Ellgaard L, Molinari M, Helenius A (1999) Setting the standards: Quality control in the secretory pathway. Science 256 : 1882-1887 Erikson O, Hertzberg M, Nasholm T (2004) A conditional marker gene allowing both positive and negative selection in plants. Nat Biotechnol 22 : 455-458 Evan G, Lewis G, Ramsey G, Bishop JM (1985) Isolation of monoc lonal antibodies specific for human c-myc proto-oncogene product. Mol Cell Biol 5 : 3610 Ferre J, Van Rie J (2002) Biochemistry and genetics of insect resistance to Bacillus thuringiensis Annu Rev Entomol 47 : 501 Ferry N, Edwards MG, Gatehouse J, Capell T, Christou P, Gatehouse AMR (2006) Transgenic plants for insect pe st control: a forward looking scientific perspective. Trans Res 15 : 13-19 Filipecki M, Malepsky S (2006) Unintended consequences of plant transformation: a molecular insight. J Applied Genet 47 : 277-286 Florida Department of Agriculture and Consumer Services Division Animal Industry. C. H. Bronson and T.J. Holt. Overview. 2004-2007 (last accessed May 6, 2007). http://www.doacs.state.fl.us/ai/ Forbes I, Burton GW (1961a) Induction of tetraploidy a nd a rapid field method of detecting induced tetraploidy in Pensacola bahiagrass. Crop Sci 1 : 383-384 Franceschi VR, Wittenbach VA, Giaquinta RT (1983a) The paraveinal mesophyll of soybean leaves in relation to assimilate transfer and compartmentation. III. Immunohistochemical localization of specific glyc opeptides in the vacuole af ter depodding. Plant Physiol 72 : 586589 Franceschi VR, Giaquinta RT (1982a) The paraveinal mesophyll of soybean leaves in relation to assimilate transfer and compartmentation: I. Ultrastructure and histochemistry during vegetative development. Planta 157 : 411-421 Franceschi VR, Giaquinta RT (1982b) The paraveinal mesophyll of soybean leaves in relation to assimilate transfer and compartmentation: II. Structural, metabolic and compartmental changes during reproductive growth. Planta 157 : 422-431

PAGE 132

132 Franceschi VR, Giaquinta RT (1983b) Specialized cellular arra ngements in legume leaves in relation to assimilate transport and compartmentation: comparison of the paraveinal mesophyll. Planta 159 : 415 Fu X, Duc LT, Fontana S, Bong BB, Sudhakar PTD, Twyman RM, Christou P, Kohli A (2000) Linear transgene constr ucts lacking vector backbone sequences generate low-copynumber transgenic plants with simple integration patterns. Transgenic Res 9 : 11 Fukui K (1983) Sequential occurrence of mutations in a growing ri ce callus. Theor Appl Genet 65 : 225 Galili G, Sengupta-Gopalan C, Ceriotti A (1998) The endoplasmic reticulum of plant cells and its role in protein maturation and biog enesis of oil bodies Plant Mol Biol 38 : 1277 Galili G, Hfgen R (2002) Metabolic Engineering of Amin o Acids and Storage Proteins in Plants. Met Eng 4 : 3-11 Galili S, Guenoune D, Wininger S, Badani H, Schupper A, Ben-Dor B and Kapulnik Y (2000) Enhanced levels of free and protei n-bound threonine in tr ansgenic alfalfa ( Medicago sativa L.): expressing a bacterial feedback-insensitive aspartate kinase gene Transgenic Res 9 : 137-144 Gasteiger E, Gattiker A, Hoogland C, Ivanyi I, Appel RD, Bairoch A (2003) ExPASy: the proteomics server for in-depth protein knowledge and analysis Nucleic Acids Res 31 : 37843788. Updated: January 25, 2007 (last accessed May 6, 2007). http://www.expasy.tools.com Gates RN (2003) Integration of perennial forages and grazing in sod based crop rotations. Proceedings of Sod based cropping systems conf erence, NFREC, University of Florida, Quincy, February 2003. Gates RN, Burton GW (1998) Seed yield and seed quali ty response of Pensacola and improved bahiagrasses to fertilization. Agron J 90 : 607-611 Gates RN, Mislevy P, Martin FG (2001) Herbage accumulation of three bahiagrass populations during the cool season. Agron J 93 : 112-117 Gates RN, Quarin CL, Pedreira CGS (2004) Bahiagrass. In : Moser LE, Burson BL, Sollenberger LE, eds, Warm season C4 gr asses. ASA, CSSA, SSSA Agronomy N 45. Gay PB, Gillispie SH (2005) Antibiotic resistan ce markers in genetically modified plants: A risk to human health? Lancet Infect Dis 5 : 637-646 Ge Y, Norton T, Wang Z-Y (2006) Transgenic zoysiagrass ( Zoysia japonica ) plants obtained by Agrobacterium -mediated transformation. Plant Cell Rep 25 : 792-798

PAGE 133

133 Gelvin SB (2003) Agrobacterium -mediated plant transformation: the biology behind the genejockeying tool. Microbiol Mol Biol Rev 67 : 16-37 Giddings G, Allison G, Brooks D, Carter A (2000) Transgenic plants as factories for biopharmaceuticals. Nat Biotechnol 18 : 1151 Goldman JJ, Hanna WW, Fleming G, Ozias-Akins P (2003) Fertile transgenic pearl millet [ Pennisetum glaucum (L.) R. Br.] plants recovered through microproject ile bombardment and phosphinothricin selection of apical me ristem-, inflorescence-, and immature embryoderived embryogenic tissues. Plant Cell Rep 21 : 999-1009 Gondo T, Tsuruta S, Akashi R, Kawamura O, Hoffmann F (2005) Green, herbicide-resistant plants by particle inflow gun-mediated ge ne transfer to diploid bahiagrass ( Paspalum notatum ). J Plant Physiol 162 : 1367-1375 Grando MF (2001) Genetic transformation approach for improving forage/silage nutritional value. PhD thesis, University of Florida, Gainesville, US Grando MF, Shatters JR, Franklin CI (2002) Optimizing embryogenic callus production and plant regeneration from Tifton 9 bahiagrass ( Paspalun notatum Flugge) seed explants for genetic manipulation. Plant Ce ll Tiss Organ Cult 71: 213-222 Grando MF, Smith RL, Moreira C, Scully BT, Shatters R (2005) Developmental changes in abundance of the VSP protein following nuclear transfor mation of maize with the soybean vspB cDNA. BMC Plant Biology 5 :3 Grant-Downton RT, Dickinson HG (2005) Epigenetics and its im plications for plant biology. 1. The epigenetic network in plants. Ann Bot 96 : 1143-1164 Griffitts JS, Aroian RV (2005) Many roads to resistan ce: How invertebrates adapt to Bt toxins. BioEssays 27 : 614 Guenoune D, Amir R, Badani H, Wolf S and Galili S (2002) Combined expression of S-VSP in two different organelles enhances its accumu lation and total lysine pr oduction in leaves of transgenic tobacco plants. J Exp Bot 53 : 1867-1870 Guenoune D, Amir R, Badani H, Wolf S and Galili S (2003) Co-expression of the soybean vegetative storage protein subunit (S-VSP ) either with the bacterial feedback-insensitive dihydrodipicolinate synthase or with S-VSP stabilizes the S-VSP transgene protein and enhances lysine production in transgenic tobacco plants. Transgenic Res 12 : 123 126 Guenoune D, Amir R, Ben-Dor B, Wolf S and Galili S (1999) A soybean vegetative storage protein accumulates to high levels in various organs of transgenic tobacco plants. Plant Sci 145 : 93-98

PAGE 134

134 Guenoune D, Landau S, Amir R, Bada ni H, Devash L, Wolf S and Galili S (2002) Resistance of soybean vegetative storage proteins (S-VSPs) to proteolysis by rumen microorganisms J. Agric. Food Chem 50 : 2256-2260 Ha SB, Wu FS and Thorne TK (1992) Transgenic turf-type tall fescue ( Festuca arundinacea Schreb.) obtained by direct gene tran sfer to protoplasts. Plant Cell Rep 11 : 601-604 Habben JE, Moro GL, Hunter BG Hamaker BR and Larkins BA (1995) Elongation factor1 concentration is highly correlated with the lysine content of maize endosperm. Proc Natl Acad Sci USA 92 : 8640-8644 Hansen G, Wright MS (1999) Recent advances in the transf ormation of plants. Trends Plant Sci 4 : 226-231 Heifetz PB (2000) Genetic engineering of the chloroplast. Biochimie 82 : 655-666 Hendershot KL, Volenec JJ (1993) Taproot nitrogen accumulation and use in overwintering alfalfa ( Medicago sativa L.). J Plant Physiol 141 : 68 Hiatt A, Cafferkey R, Bowdish K (1989) Production of antibodies in transgenic plants. Nature 342 : 76 78 Hisano H, Kanazawa A, Kawakami A, Yoshida AM, Shimamoto Y, Toshihiko Y (2004) Transgenic perennial ryegrass plants expressing wheat fructosyltransferase genes accumulate increased amounts of fructan and acquire incr eased tolerance on a cellular level to freezing. Plant Sci 167 : 861-868 Horn ME, Woodard SL, Howard JA (2004) Plant molecular farming: Systems and products. Plant Cell Rep 22 : 711-720 Huesing J, English L (2004) The impact of Bt crops on the developing world. AgBioForum 7 : 84-95 Iser M, Fettig S, Scheyhing F, Viertel K and Hess D (1999) Genotype-dependent stable genetic transformation in german spring wheat varieties selected for high regeneration potential. J Plant Physiol 154 : 509-516 James C (2005) Global status of commerc ialized biotech/GM crops: 2005. ISAAA BRIEFS NO. 34-2005. 2007 (last accessed May 6, 2007). http://www.isaaa.org Jarvik JW, Telmer CA (1998) Epitope tagging. Ann Rev Genet 32 : 601 Jauh G-Y, Fishcer AM, Grimes HD, Ryan CA, Rogers JC (1998) -Tonoplast intrinsic protein defines unique plan t vacuole functions. PNAS 95 : 12995-12999 Job D (2002) Plant biotechnology in agriculture. Biochimie 84 : 1105-1110

PAGE 135

135 Johnson CR, Reiling BA, Mislevy P, Hall MB (2001) Effects of nitrogen fertilization and harvest date on yield, digestibil ity, fiber and protein fractions of tropical grasses. J Anim Sci 79 : 2439-2448 Jorgensen R, Cluster P, English J, Que Q, Napoli C (1996) Chalcone s ynthase co-suppression phenotypes in Petunia flowers: comparison of sense vs. antisense and single copu vs. complex T-DNA sequences. Plant Mol Biol 31 : 957-973 Kaeppler SM, Kaeppler HF, Rhee Y (2000) Epigenetic aspects of somaclonal variation in plants. Plant Mol Biol 43 : 179 Kaur S (2006) Molecular approaches for identifi cation and construction of novel insecticidal genes for crop protection. W J Microbiol & Biotech 22 : 233 Khan MRI, Ceriotti A, Tabe L, Aryan A, McNabb W, Moore A, Craig S, Spencer D, Higgins TJV (1996) Accumulation of a sulphur-rich seed albumin from sunflower in the leaves of transgenic subterranean clover ( Trifolium subterraneum L.) Trans Res 5 : 179-185 Klauer SF, Franceschi VR (1997) Mechanism of transport of vegetative storage proteins to the vacuole of the paraveinal mesophyll of soybean leaf. Protoplasma 200 : 174-185 Klauer SF, Franceschi VR, Ku MSB (1991) Protein compositions of mesophyll and paraveinal mesophyll of soybean leaves at various developmental stages. Plant Physiol 97 : 1306-1316 Klauer SF, Franceschi VR, Ku MSB, Zhang D (1996) Identification and localization of vegetative storage proteins in legume leaves. Am J Bot 83 : 1 Kohli A, Twyman RM, Abranches R, Wegel E, Stoger E, Christou P (2003) Transgene integration, organization and intera ction in plants. Plant Mol Biol 52 : 247-258 Kusnadi AR, Nikolov ZL, Howard JA, John A (1998) Production of recombinant proteins in transgenic plants: Practical c onsiderations. Biotechnol Bioeng 56 : 473 Lacroix B, Li J, Tzfira T, Citovsky V (2006) Will you let me use your nucleus? How Agrobacterium gets its T-DNA expressed in the host plant cell. Can J Physiol Pharmacol 84 : 333-345 Latham JR, Wilson AK, Steinbrecher RA (2006) The mutational consequences of plant transformation. J Biomed Biotech 25376 : 1-7 Leelapon O, Sarath G, Staswick P (2004). A single aminoacid substitution in soybean vsp increases its acid phosphatase act ivity nearly 20-fold. Planta 219: 1071-1079 Li L, Qu R (2004) Development of highly regenerable callu s lines and biolistic transformation of turf-type common bermudagrass [ Cynodon dactylon (L.) Pers.]. Plant Cell Rep 22 : 403407

PAGE 136

136 Littell RC, Milliken GA, Stroup WW, Wolfinger RD (1996) SAS system for mixed models. SAS Institute, Cary, NC. Marousky FJ, West SH (1990) Somatic embryogenesis and plant regeneration from cultured mature caryopses of bahiagrass ( Paspalum notatum Flugge). Plant Cell Tissue Organ Cult 20 : 125-129 Mason HS, Guerrero FD, Boyer JS, Mullet JE (1988) Proteins homologous to leaf glycoproteins are abundant in stems of dark-gro wn soybean seedlings: analysis of proteins and cDNAs. Plant Mol Biol 11 : 845-856 McBride KE, Svab Z, Schaaf D J, Hogan PS, Stalker DM, Maliga P (1995) Amplification of a chimeric Bacillus gene in chloroplasts leads to an extraordinary level of an insecticidal protein in tobacco. Bio/Technology 13 : 362-5 McElroy D,Brettell RIS (1994) Foreign gene expression in transgenic cereals. Trends Biotechnol 12 : 62-68 Mendelsohn M, Kough J, Vaituzis Z, Matthews K (2003). Are Bt crops safe? Nat Biotech 21 : 1003-1009 Merchen NR, Titgmeyer EC (1992) Manipulation of amino acid supply to the growing ruminant. J Anim Sci 70 : 3238-3247 Miki B, McHugh S (2004) Selectable marker genes in transgenic plan ts: Applications, alternatives and bi osafety. J Biotechnol 107 : 193-232 Mislevy P, Burton GW, Busey P (1990) Bahiagrass response to grazing frequency. Soil Crop Sci Fl Proc 50: 58-64. Moser LE (2004). Warm season C4 grasses overview. In : Moser LE, Burson BL and LE Sollenberger, eds, Warm season C4 grasses. ASA, CSSA, SSSA Agronomy N 45. Munro S, Pelham HRB (1987) A C-terminal signal prevents secretion of luminal ER proteins. Cell 48 : 899-907 Muntz K (1998) Deposition of storag e proteins. Plant Mol Biol 38 : 77 Murashige T, Skoog F (1962) A revised medium for rapid gr owth and bio-assays with tobacco tissue cultures. Physiol Plant 15 : 473-497 Murphy KA, Kuhle RA, Fischer AM, Anterola AM, Grimes HD (2005) The functional status of paraveinal mesophyll vacuoles changes in response to altered metabolic conditions in soybean leaves. Funct Plant Biol 32 : 335-344

PAGE 137

137 Murray MG, Thompson WF (1980) Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res 8 : 4321-4325 Nagoshi RN, Meagher RL (2004) Behaviour and distribution of the two fall armyworm host strains in Florida. Fl Entomol 87 : 440-449 Napoli C, Lemieux C, Jorgensen R (1990) Introduction of the ch alcone synthase gene into Petunia results in reversible co-suppression of homologous genes in trans. Plant Cell 2 : 279289 National Research Council (1989) Nutrient requirement of dairy cattle. 6th rev. Eds Natl Acad Sci, Washington, DC. Neuhaus J-M, Rogers JC (1998) Sorting of proteins to vacu oles in plant cells. Plant Mol Biol 38 : 127-144 Newell CA (2000) Plant transformation technology: Developments and applications. Mol Biotechnol 16 : OKennedy MM, Burger JT, Botha FC (2004) Pearl millet transformation system using the positive selectable marker gene phosphor-m annose isomerase. Plant Cell Rep 22 : 684-690 Odell JT, Nagy F, Chua NH (1985) Identification of DNA-se quences required for activity of the cauliflower mosaic viru s-35S promoter. Nature 313 : 810-812 Pagny S, Cabanes-Macheteau M, Gillikin JW, Leborgne-Castel N, Lerouge P, Boston RS, Faye L, Gomord V (2000) Protein recycling from the Golgi apparatus to the endoplasmic reticulum in plants and its minor contribut ion to calreticulin retention. Plant Cell 12 : 355-739 Park J, Lee YK, Kang BK, Chung WI (2004) Co-transformation us ing a negative selectable marker gene for the production of selectable ma rker gene-free transgenic plants. Theor Appl Genet 109 : 1562-1567 Pelham HR (1990) The retention signal for solubl e proteins of the endoplasmic reticulum. Popelka JC, Xu J, Altpeter F (2003) Generation of rye ( Secale cereale L.) plants with low transgene copy number after bi olistic gene transfer and pr oduction of instantly marker-free transgenic rye. Transgenic Res 12 : 587-596 Ramirez N, Rodr guez M, Ayala M, C remata J, Perez M, Mart nez A, Linares M, Hevia Y, Paez R, Valdes R, Gavilondo JV, Selman-Housein G (2003) Expression and characterization of an anti -(hepatitis B surface antigen) gl ycosylated mouse antibody in transgenic tobacco ( Nicotiana tabacum ) plants and its use in th e immunopurification of its target antigen. Biotechnol Appl Biochem 38 : 223 Ranjekar PK, Patankar A, Gupta V, Bhatnagar R, Bentur J, Kumar PA (2003) Genetic engineering of crop plants fo r insect resistance. Curr Sci 84 : 321-329

PAGE 138

138 Rapp WD, Lilley GG, Nielsen NC (1991). Characterization of soybean vegetative storage protein and genes. Theor Appl Genet 79 : 785-792 Rasco-Gaunt S, Riley A, Barcelo P and Lazzeri PA (1999) Analysis of particle bombardment parameters to optimise DNA delivery into wheat tissues. Plant Cell Rep 19 : 118-127 Richter LJ, Thanavala J, Arntzen CJ, Mason HS (2000) Production of hepatitis B surface antigen in transgenic plants fo r oral immunization. Nature Biotech 18 : 1167-1171 Rochester DE, Winer JA, Shah DM (1986) The structure and expression of maize genes encoding the major heat shock protein, hsp70. EMBO J 5 : 451-458 Romano A, Raemakers K, Bern ardi J, Visser R, Mooibroek H (2003) Transgene organization in potato after particle bomb ardment-mediated co-transformation using plasmids and gene cassettes. Transgenic Res 12 : 461 Rulquin H, Verite R (1993) Amino acid nutrition and dairy cows: Productive effects and animal requirements. In : PC Garnsworthy, DJA Cole, eds, R ecent Advances in Animal Nutrition, Nottingham University Press, Loughborough, UK p55 Saalbach I (1994) The sulfur-rich Brazil nut 2S albumin is specifically formed in transgenic seeds of the rain legume Vicia narnonensis Euphytica 85 : 181-192 Sambrook J, Russell DW (2001) Molecular cloning a laboratory manual. Cold Spring Harbor, NY. Cold Spring Harbor Laboratory Press. Sandhu S, Altpeter F, Blount AR (2007) Apomictic turf and forage grass ( Paspalum notatum Flugge) expressing the bar gene is highly resistant to gluf osinate under field conditions. Crop Sci in press. SAS Institute (2002) Propietary Softwa re Release 9.0, Cary, NC. Schnepf E, Crickmore N, Van Rie J, Lereclus D, Baum J, Feitelson J, Zeigler DR, Dean DH (1998) Bacillus thuringiensis and its pesticidal crystal prot eins. Microbiol Mol Biol Rev 62 : 775-806 Schouten A, Roosien J, von Engelen FA, De Jong GA, Borst-Vressen AW, Zilverentant JF (1996) The C-terminal KDEL se quence increases the expressi on level of a single-chain antibody designed to be targeted to both the cytosol and the secret ory pathway. Plant Mol Biol Schubert D, Lechtenberg B, Forsbach A, Gils M, Bahadur S, Schmidt R (2004) Silencing in Arabidopsis T-DNA transformants: The predominant role of a gene-specific DNA sensing mechanism versus position effects. Plant Cell 16 : 2561-2572

PAGE 139

139 Shatters RG, Wheeler RA, West SH (1994) Somatic embryogenesis and plant regeneration from callus culture of 'Tift on 9' bahiagrass. Crop Sci 34 :1378-1384 Sivamani E, Bahieldin A, Wraith JM, Al-Niemi T, Dyer WE, Ho TDH and Qu R (2000) Improved biomass productivity and water use effi ciency under water de ficit conditions in transgenic wheat constitutiv ely expressing the barley HVA1 gene. Plant Sci 155 : 1-9 Smith RL, Grando MF, Li YY, Seib JC, Shatters RG (2002) Transformation of bahiagrass ( Paspalum notatum Flugge). Plant Cell Rep 20 : 1017-1021 Southgate E, Davey M, Power J, Marchant R (1995) Factors affecting the genetic engineering of plants by microparticle bombardment. Biotechnol Adv 13 : 631-651 Spagenberg G, Wang ZY, Wu XL, Nagel J and Potrykus I (1995) Transgenic perennial ryegrass ( Lolium perenne ) plants from microprojectil e bombardment of embryogenic suspension cells. Plant Sci 108 : 209-217 Spangenberg GG, Wang ZY, Nagel J, Iglesias VA, Potrykus I (1995) Transgenic tall fescue ( Festuca arundinacea ) and red fescue ( F. rubra ) plants from microprojectile bombardment of embryogenic suspension cells. J Plant Physiol 145 : 693-701 Sparks AN (1979) A review of the biology of the fall armyworm. Fl Entomol 62 : 82-87 Sreekala C, Wu L, Gu K, Wang D, Tian D, Yin Z (2005) Excision of a se lectable marker in transgenic rice ( Oryza sativa L.) using a chemically regulated Cre/ lox P system. Plant Cell Rep 24 : 86-94 Staswick PE (1988) Soybean vegetative storage protei n structure and gene expression. Plant Physiol 87 : 250 Staswick PE (1989) Developmental regulation and the influence of plant sinks on vegetative storage protein expression in soybean leaves. Plant Physiol 89 : 309 Staswick PE (1994) Storage proteins of vegetative pl ant tissues. Annu Rev Plant Physiol Plant Mol Biol 45 :303 Staswick PE (1997) The occurrence and gene expressi on of vegetative storage proteins and a Rubisco complex protein in several pe rennial soybean species. J Exp Bot 48 : 2031 Staswick PE, Huang J, Rhee Y (1991) Nitrogen and methyl jasmonate induction of soybean vegetative storage protein genes. Plant Physiol 96 : 130 Stewart RL Jr (2006) Management intensity effect s on animal performance and herbage response in bahiagrass pastures. PhD thesis, University of Florid a, Gainesville, US

PAGE 140

140 Stewart RL Jr, Sollenberger LE, Dubeux JC B Jr, Vendramini JMB, Interrante SM, Newman YC (2007) Herbage and animal responses to management intensity of continuously stocked bahiagrass pastures. Agron J 99 : 107-112 Stoger E, Vaquero C, Torres E, Sack M, Nicholson L, Drossard J, Williams S, Keen D, Perrin Y, Christou P and Fischer R (2000). Cereal crops as vi able production and storage systems for pharmaceutical scFv antibodies. Plant Mol Biol 42 : 583-590 Sun SS, Liu Q (2004) Transgenic approaches to improve the nutritional quality of plant proteins. In Vitro Cell Dev Biol Plant 40 : 155-162 Tabashnik BE, Liu YB, Finson N, Masson L, Heckel DG (1997) One gene in diamondback moth confers resistance to four Bacillus thuringiensis toxins. PNAS 94 : 1640-1644 Tabashnik BE, Roush RT, Earle ED, Shelton AM (2000) Resistance to Bt toxins. Science 287 : 42. Tabe L, Higgins TJV (1998) Engineering plant protei n composition for improved nutrition. Trends Plant Sci 3 : 282-286 Tabe LM, Wardley-Richardson T, Ceriotti A, Aryan A, McNabb W, Moore A and Higgins TJV (1995) A biotechnological approach to impr ove the nutritive value of alfalfa. J Anim Sci 73 :2752-2759 Takumi S, and Shimada T (1996) Production of trangenic wheat through particle bombardment of scutellar tissue: frequency is influe nced by culture duration. J Plant Physiol 149 : 418-423 Taylor NJ, Fauquet CM (2002) Microparticle bombardment as a tool in plant science and agricultural biotec hnology. DNA Cell Biol 21 : 963-977 Teasdale RD, Jackson MR (1996) Signal-mediated sorting of membrane proteins between the endoplasmic reticulum and the golgi apparatus. Ann Rev Cell Dev Biol 12 : 27-54 Toki S, Hara N, Ono K, Onodera H, Tagiri A, Oka S, Tanaka H (2006) Early infection of scutellum tissue with Agrobacterium allows high-speed transfor mation of rice. The Plant J 47 : 969 Tranbarger TJ, Franceschi VR, Hildebrand DF, Grimes HD (1991) The soybean 94kilodalton vegetative storage pr otein is a lipoxygenase that is localized in paraveinal mesophyll cell vacuoles Plant Cell 3 : 973 Tzfira T, Citovsky V (2006) Agrobacterium -mediated transformation of plants: Biology and biotechnology. Curr Op Biotechnol 17 : 147-154

PAGE 141

141 Ulyatt, MJ, Thomson DJ, Beev er DE, Evans RT, Haines MJ (1988) The digestion of perennial ryegrass ( Lolium perenne cv. Melle) and white clover ( Trifolium repens cv. Blanca) by grazing cattle. Brit J Nutr 60 : 137-149 US EPA (2001) Biopesticide Regist ration Action Document: Bacillus thuringiensis Cry1F Corn.Office of Pesticide Programs, Biopesticid es and Pollution Preven tion Division. Updated August, 2005 (last acc essed May 6, 2007). http://www.epa.gov/pesticides/biopes ticides/ingredients/ tech_docs/brad_006481.pdf USDA-NRCS (2007) Paspalum notatum Fluegge, bahiagrass.The PLANTS Database. National Plant Data Center (last accesesd May 6, 2007). http://plants.usda.gov Varshney A, Altpeter F (2002) Stable transformationand tissue culture response in current European winter wheat ( Triticum aestivum L.) germplasm. Mol Breeding 8 : 295-309 Vitale A, Raikhel N (1999) What do proteins need to reach different vacuoles? Trends Plant Sci 4 : 149-155 Wandelt CI, Khan MRI, Craig S, Achroeder HE, Spencer D, Higgins TJV (1992) Vicilin with carboxy terminal KDEL is retained in the endoplasmic reticulum and accumulates to high levels in the leaves of tran sgenic plants. The Plant Journal 2 :181 Wang Z, Hopkins A, Mian R (2001) Forage and turf grass biotechnology. Crit Rev Plant Sci 20 : 573-619 Wang Z-Y, Ge Y (2006) Recent advances in genetic transf ormation of forage and turfgrasses. In Vitro Cell Dev Biol Plant 42 : 1-18 Wang ZY, Ye XD, Nagel J, Potrykus I, Spangenberg GG (2001) Expression of a sulphur-rich sunflower albumin gene in transgenic tall fescue ( Festuca arundinacea Schreb.) plants. Plant Cell Rep 20 : 213-219 Wiatrak PJ, Wright DL, Morais JJ, Sprenkel R (2004) Corn hybrids for late planting in the southeast. Agron J 96 : 1118-1124 Wilkins PW, Humphreys MO (2003) Progress in breeding perennial forage grasses for temperate agriculture. J Agric Sci 140 : 129-150 Williams WP, Sagers JB, Hanten JA, Davis FM, Buckley PM (1997) Transgenic corn evaluated for resistance to fall armyworm and southweatern corn borer. Crop Sci 37 : 957 962 Wittenbach VA (1983) Purification and characterization of a soybean leaf storage glycoprotein. Plant Physiol 73 : 125

PAGE 142

142 Wright D, Marois J, Katsvai ro T, Wiatrak P, Rich J (2005) Sod based rotationsThe next step after conservation tillage. South Cons T illage Sys Conference, Clemson University, SC. Wu H, Sparks C, Amoah B, Jones HD (2003) Factors infl uencing successful Agrobacterium mediated transformation of wheat. Plant Cell Rep 21 : 659-668 Yamamoto K, Fujii R, Toyofuku Y, Saito T, Koseki H, Hsu VW, Aoe T (2001) The KDEL receptor mediates a retrieval mechanism that cont ributes to quality control at the endoplasmic reticulum. EMBO J 20 : 3082-3091 Ye XD, Al-Babili S, Kloti A, Zhang J, Lucca P, Beyer P, Potrykus I (2000) Engineering the provitamin A ( -carotene) biosynthetic pathway into (carotenoi d-free) rice endosperm. Science 287 : 303-305 Zhang G, Lu S, Chen TA, Funk CR, Meyer WA (2003) Transformation of triploid bermudagrass ( Cynodon dactylon x C. transvaalensis cv. TifEagle) by means of biolistic bombardment. Plant Cell Reports 21 : 860-864 Zhang W, Subbarao S, Addae P, Shen A, Armstrong C, Peschke V, Gilbertson L (2003) Cre/ lox -mediated marker gene excision in transgenic maize ( Zea mays L.) plants. Theor Appl Genet 107: 1157-1168 Zhu B, Coleman GD (2001) The poplar bark storage protein gene ( Bspa ) promoter is responsive to photoperiod and nitrogen in transgenic poplar and active in floral tissues, immature seeds and germinating seeds of tras ngenic tobacco. Plant Mol Biol 46 : 383-394

PAGE 143

143 BIOGRAPHICAL SKETCH Gabriela Fabiana Luciani, the oldest daught er of Beatriz Marta Tica de Luciani and Alberto Daniel Luciani, was born in Bahia Blanca, Buenos Aires Province, Argentina, on October 7, 1968. In 1986, Gabriela started her coll ege studies in biology, or iented to ecology, at the Facultad de Ciencias Naturales y Museo, Univ ersidad Nacional de La Plata, La Plata; where she received her degree in biology in 1993. During this time, she was activ ely involved in the academic life as a teaching assist ant in different classes. In 1996, she was hired by Comision de Investigac iones Cientificas (CIC), to develop tissue culture techniques to improve garlic micropropagation. In 1997, she was hired by Comision Nacional de Investigaciones Cientificas y Tec nologicas (CONICET), to continue her studies focused on eliminating a viral complex during garlic tissue culture. After a car accident and more than a year in rehabilitation, and encouraged by her supervisor, Dr. Nestor Curvetto, she was admitted to pursue a M. Sc. degree in agronomy at the Facultad de Agronomia, Universidad Nacional del Sur, Bahia Blanca, in 1999. Encour aged by friends, she ap plied for a FulbrightLASPAU fellowship to pursue her Ph. D. program in the United States. She received her M.Sc. degree in Agronomy in 2001, and moved immediately to Gainesville, to begin her program at the Agronomy Department, Univ ersity of Florida.