<%BANNER%>

Development of Non-Viral Gene Therapy Targeting the Insulin-Like Growth Factor System for the Treatment of Brain Tumors

Permanent Link: http://ufdc.ufl.edu/UFE0019759/00001

Material Information

Title: Development of Non-Viral Gene Therapy Targeting the Insulin-Like Growth Factor System for the Treatment of Brain Tumors
Physical Description: 1 online resource (98 p.)
Language: english
Creator: Villegas, Leah Redondo
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2007

Subjects

Subjects / Keywords: binding, brain, cancer, factor, gene, geneswitch, glioma, growth, igf, igfbp, igfbp3, insulin, like, lipids, lymxsorb, mmp2, mutations, non, plasmid, protein, rat, rg2, ribozyme, therapy, tumor, viral
Pharmacy -- Dissertations, Academic -- UF
Genre: Pharmaceutical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: According to the American Cancer Society, there are an estimated 1,372,910 new cases of cancer in the United States in 2005; 18,500 cases being brain cancer resulting in 12,760 deaths. Although there are treatments for brain tumors such as surgery, radiation therapy and chemotherapy, there is a growing need for alternative treatments because current methods are invasive or may cause severe side effects. Advances in cancer and gene therapy research have established that acquired diseases such as cancer typically involve more than one gene defect and several genes can serve as targets for therapy. Specifically, it has been shown in many studies that under-regulated insulin-like growth factor (IGF1) signaling is involved in many cancers, including brain cancer. Further characterization of the IGF1 signaling pathway in brain tumor cells can lead to identification of more target genes for gene therapy applications. The goal of this project was to develop gene expression targeting the IGF1 system for the treatment of brain tumors. The objectives of this project were to (1) investigate the role of IGF1 signaling in rat glioblastoma (RG2) cells by IGF1R knockdown via (a) inducible expression of an IGF1R-ribozyme in a stable cell line (b) therapeutic application of the ribozyme in lipid mediated transient transfections (2) develop and characterize alternate approach to inhibit IGF1 signaling by lipid mediated gene delivery of an IGFBP3 expression vector (3) develop protease resistant IGFBP3 to increase inhibition of IGF ligand-receptor interactions.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Leah Redondo Villegas.
Thesis: Thesis (Ph.D.)--University of Florida, 2007.
Local: Adviser: Sullivan, Sean M.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2008-08-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2007
System ID: UFE0019759:00001

Permanent Link: http://ufdc.ufl.edu/UFE0019759/00001

Material Information

Title: Development of Non-Viral Gene Therapy Targeting the Insulin-Like Growth Factor System for the Treatment of Brain Tumors
Physical Description: 1 online resource (98 p.)
Language: english
Creator: Villegas, Leah Redondo
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2007

Subjects

Subjects / Keywords: binding, brain, cancer, factor, gene, geneswitch, glioma, growth, igf, igfbp, igfbp3, insulin, like, lipids, lymxsorb, mmp2, mutations, non, plasmid, protein, rat, rg2, ribozyme, therapy, tumor, viral
Pharmacy -- Dissertations, Academic -- UF
Genre: Pharmaceutical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: According to the American Cancer Society, there are an estimated 1,372,910 new cases of cancer in the United States in 2005; 18,500 cases being brain cancer resulting in 12,760 deaths. Although there are treatments for brain tumors such as surgery, radiation therapy and chemotherapy, there is a growing need for alternative treatments because current methods are invasive or may cause severe side effects. Advances in cancer and gene therapy research have established that acquired diseases such as cancer typically involve more than one gene defect and several genes can serve as targets for therapy. Specifically, it has been shown in many studies that under-regulated insulin-like growth factor (IGF1) signaling is involved in many cancers, including brain cancer. Further characterization of the IGF1 signaling pathway in brain tumor cells can lead to identification of more target genes for gene therapy applications. The goal of this project was to develop gene expression targeting the IGF1 system for the treatment of brain tumors. The objectives of this project were to (1) investigate the role of IGF1 signaling in rat glioblastoma (RG2) cells by IGF1R knockdown via (a) inducible expression of an IGF1R-ribozyme in a stable cell line (b) therapeutic application of the ribozyme in lipid mediated transient transfections (2) develop and characterize alternate approach to inhibit IGF1 signaling by lipid mediated gene delivery of an IGFBP3 expression vector (3) develop protease resistant IGFBP3 to increase inhibition of IGF ligand-receptor interactions.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Leah Redondo Villegas.
Thesis: Thesis (Ph.D.)--University of Florida, 2007.
Local: Adviser: Sullivan, Sean M.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2008-08-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2007
System ID: UFE0019759:00001


This item has the following downloads:


Full Text

PAGE 1

1 DEVELOPMENT OF NON-VIRAL GENE THERAPY TARGETING THE INSULIN-LIKE GROW TH FACTOR SYSTEM FOR THE TREATMENT OF BRAIN TUMORS By LEAH REDONDO VILLEGAS A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2007

PAGE 2

2 2007 Leah Redondo Villegas

PAGE 3

3 To my parents, Thor and Carmelita Villegas

PAGE 4

4 ACKNOWLEDGMENTS I thank m y graduate supervisory comm ittee, Sihong Song, Jeffrey Hughes, Anthony Yachnis and my mentor, Sean Sullivan, for their va luable wisdom, guidance and encouragement. I also thank the group of Maria Gran t for all their collaborative efforts. I thank the Home of the Brains for all their support and friendship during the frustrations, achievements and memorable fun times: Nathalie Toussaint, Wouter Driesse n, Hao Zhu, Jaquelin Baltunis, Sonja Parisek, Ben Looney, Helen Riek, Candace White, Joao Arrais, Nor een Spliess, and all the other Brains, past and present. I thank the College of Pharmac y, the Department of Pharmaceutics and all my colleagues and friends of the Univer sity of Florida. I especially thank my friends and family for their inspiration: MyPhuong Le, Ruby Almazan, Maria Ledbetter, Cezar Montemayor, and my brothersThom, Carl, and Mark Villegas, with sp ecial recognition to Aly ssa, Nicole, and Caleb. Last but not least I thank my parents, Thor and Carmelita Villegas, for all their love, support and encouragementnot only throughout my gra duate career, but throughout a lifetime.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS...............................................................................................................4 LIST OF TABLES................................................................................................................. ..........8 LIST OF FIGURES.........................................................................................................................9 ABSTRACT...................................................................................................................................11 CHAP TER 1 BACKGROUND AND SIGNFICANCE............................................................................... 13 Introduction................................................................................................................... ..........13 Brain Tumor Characteristics................................................................................................... 13 The Insulin-Like Growth Factor System and Cancer............................................................. 14 IGFBPs and Cancer................................................................................................................16 Gene Therapy Applications....................................................................................................17 2 MATERIALS AND METHODS........................................................................................... 19 Rat Glioma Cell Culture (RG2).............................................................................................. 19 Insulin-Like Growth Factor 1 Receptor-Ribozyme GeneSwitch........................................... 19 GeneSwitch Plasmids......................................................................................................19 Rat Glioma Stable Cell Line............................................................................................ 19 Rat Glioma Cell Growth Analysis................................................................................... 20 Insulin-Like Growth Factor 1 Receptor Western Analysis............................................. 20 Lipid Mediated Delivery of Ribozyme...................................................................................21 Ribozyme Expression Plasmid........................................................................................ 21 Cationic Lipid Transfection Reagent...............................................................................21 Lipoplexes and Transfections.......................................................................................... 22 Ribozyme Transient Transfections.................................................................................. 22 Transfections with Green Fluorescent Protein................................................................ 22 Wild Type and Mutant Insulin-Like Growth Factor Binding P rotein 3 Expression.............. 23 Wild Type Expression Cassettes.....................................................................................23 Mutant Expression Cassettes...........................................................................................24 Wild Type Growth Curves.............................................................................................. 24 Receptor Phosphorylation............................................................................................... 25 Mutant Growth Curves....................................................................................................25 Insulin-Like Growth Fact or 1 Bioavailability ................................................................. 25 Statistical Analysis........................................................................................................... .......26

PAGE 6

6 3 INSULIN-LIKE GORWTH FACTOR 1 SIGNALING PLAYS AN IMPORTANT ROLE IN RAT GLIOM A CELL GROWTH......................................................................... 31 Introduction................................................................................................................... ..........31 Results.....................................................................................................................................32 Induced Expression of Insulin-Like Growth Factor 1 Receptor Ribozyme.................... 32 Insulin-Like Growth Factor 1 Receptor Knockdown...................................................... 32 Limitations.................................................................................................................... ..........33 GeneSwitch System Stability.......................................................................................... 33 Mifepristone Dose-Response...........................................................................................33 Discussion...............................................................................................................................34 4 LIPID MEDIATED DELIVERY OF THE INS ULIN-LIKE GROWTH FACTOR 1 RECEPTOR RIBOZYME IN TO RAT GLIOMA CELLS.................................................... 40 Introduction................................................................................................................... ..........40 Results.....................................................................................................................................41 Transfection Efficiency in Rat Glioma Cells..................................................................41 Transfections with the Insulin-Like G rowth Factor 1 Receptor Ribozyme.................... 41 Discussion...............................................................................................................................42 5 INSULIN-LIKE GROWTH FACTOR BINDING PROTEIN 3 EXP RESSION INHIBITS RAT GLIOMA CELL GROWTH........................................................................ 46 Introduction................................................................................................................... ..........46 Results.....................................................................................................................................46 Development of Insulin-Like Growth Factor Binding Protein 3 E xpression Cassette ... 46 Insulin-Like Growth Factor Binding Prot ein 3 Expression Inhibits Tum or Cell Growth.........................................................................................................................48 Insulin-Like Growth Fact or 1 Bioavailability ................................................................. 48 Discussion...............................................................................................................................49 6 PROTEASE RESISTANT INSULIN-LIKE GROWTH FAC TOR BINDING PROTEIN 3 INHIBITS RAT GLIOMA CELL GROWTH..................................................................... 56 Introduction................................................................................................................... ..........56 Results.....................................................................................................................................57 Insulin-Like Growth Factor Binding Protein 3 Mutant ................................................... 57 Insulin-Like Growth Fact or 1 Bioavailability ................................................................. 57 Insulin-Like Growth Factor Binding Protein 3 Mutant 0 ................................................ 59 Insulin-Like Growth Factor Binding Protein 3 Mutant 1 ................................................ 60 Insulin-Like Growth Factor Binding Protein 3 Mutant 2 ................................................ 60 Insulin-Like Growth Factor Binding Protein 3 Mutant 3 ................................................ 61 Insulin-Like Growth Factor Binding Protein 3 Mutant 4 ................................................ 61 Insulin-Like Growth Factor Binding Protein 3 Mutant 5 ................................................ 61 Discussion...............................................................................................................................62

PAGE 7

7 APPENDIX A GENESWITCH......................................................................................................................71 Introduction................................................................................................................... ..........71 Materials and Methods...........................................................................................................73 Results.....................................................................................................................................74 Rat Glioma Cell Sensitivity to Selective Antibiotics...................................................... 74 Mifepristone Regulated Expr ession of -galactosidase .................................................. 74 Discussion...............................................................................................................................74 B BUFFERS AND REAGENTS............................................................................................... 78 LIST OF REFERENCES...............................................................................................................81 BIOGRAPHICAL SKETCH.........................................................................................................98

PAGE 8

8 LIST OF TABLES Table page 2-1 IGFBP3 primers and adaptors............................................................................................ 28 2-2 PCR conditions for wtIGFBP3..........................................................................................28 2-3 PCR conditions for IGFBP3 signal sequence deletion......................................................28 2-4 Mutant IGFBP3 forward primers....................................................................................... 29 2-5 Mutant IGFBP3 primer s for QuikChange method............................................................. 29 2-6 Mutant IGFBP3 PCR conditions using iProof................................................................... 29

PAGE 9

9 LIST OF FIGURES Figure page 2-1 pSwitch and pGene/IGF1R-Rz plasmids...........................................................................27 2-2 Schematic diagram of GeneSwitch RG2 cell growth analysis.......................................... 27 2-3 Schematic diagram of RG2 tr ansient transfection procedure. ........................................... 27 2-4 Schematic diagram of IGF1 bioavailability procedures.................................................... 30 3-1 Structure and target sites of the IGF1R-Rz........................................................................35 3-2 RG2 cells transformed with IGF1R-Rz.............................................................................35 3-3 Inhibition of cell prol iferation by IGF1R-Rz. ....................................................................36 3-4 Growth curves comparing mifepristone -induced (Rz ON) and non-induced (Rz OFF) cells from RG2/IGF1R-Rz colonies after in itial screening of stable transformation........ 37 3-5 Western analysis of transformed RG 2 cells showing IGF1R knockdown by IGF1RRz .......................................................................................................................................38 3-6 Growth curves comparing mifepristone -induced (Rz ON) and non-induced (Rz OFF) RG2/IGF1R-Rz cells at later passages ............................................................................... 38 3-7 Mifepristone dose-response...............................................................................................39 4-1 Cationic lipid medi ated gene delivery ............................................................................... 43 4-2 Structure of lipids used fo r RG2 transient transfections .................................................... 43 4-3 Lipid89/LXS transfection efficiency in RG2 cells ............................................................ 44 4-4 Inhibition of RG2 growth using lipid me diated delivery of the IGF1R-Rz expression cassette. ...................................................................................................................... ........45 5-1 Cell bystander effect..........................................................................................................51 5-2 IGFBP3 expression cassette............................................................................................... 51 5-3 RG2 growth after transfection wi th expression cassette variations ...................................52 5-4 Inhibition of RG2 growth after wtIGFBP3 expression...................................................... 53 5-5 IGF1R phosphorylation measured by ELISA.................................................................... 54 5-6 IGFBP3 proteolysis......................................................................................................... ...54

PAGE 10

10 5-7 IGF1 Bioavailability....................................................................................................... ...55 5-8 IGFBP3 proteolysis by MMP2.......................................................................................... 55 6-1 MMP2 cleavage site in IG FBP3 and m utations induced by site-directed mutagenesis.... 63 6-2 IGF1 binding in presence of MMP2 inhibitor...................................................................63 6-3 IGF1 binding in presence of recombinant MMP2............................................................. 64 6-4 GF1 binding in presence of MMP 2 inhibitor and recom binant MMP2............................. 64 6-5 RG2 cell growth after transf ection w ith Mutant 0 IGFBP3...............................................65 6-6 Sequencing data of mutIGFBP3 (Mutant 1) expression plasm id...................................... 66 6-7 RG2 cell growth after transf ection w ith Mutant 1 IGFBP3...............................................66 6-8 Sequencing data of mutIGFBP3 (Mutant 2) expression plasm id 67 6-9 RG2 cell growth after transf ection w ith Mutant 2 IGFBP3...............................................67 6-10 Sequencing data of mutIGFBP3 (Mutant 3) expression plasm id...................................... 68 6-11 RG2 cell growth after transf ection w ith Mutant 3 IGFBP3...............................................68 6-12 Sequencing data of mutIGFBP3 (Mutant 4) expression plasm id...................................... 69 6-13 RG2 cell growth after transf ection w ith Mutant 4 IGFBP3...............................................69 6-14 Sequencing data of mutIGFBP3 (Mutant 5) expression plasm id...................................... 70 6-15 RG2 cell growth after transf ection w ith Mutant 5 IGFBP3...............................................70 A-1 GeneSwitch plasmids........................................................................................................ .76 A-2 Antibiotic sensitivity in RG2 cells..................................................................................... 76 A-3 RG2 GeneSwitch stable cell line expressing -galactosidase............................................ 77

PAGE 11

11 Abstract of Dissertation Pres ented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy DEVELOPMENT OF NON-VIRAL GENE THERAPY TARGETING THE INSULIN-LIKE GROW TH FACTOR SYSTEM FOR THE TREATMENT OF BRAIN TUMORS By Leah Redondo Villegas August 2007 Chair: Sean Sullivan Major: Pharmaceutical Sciences According to the American Cancer Society, there are an estimated 1,372,910 new cases of cancer in the United States in 2005; 18,500 cases be ing brain cancer resulting in 12,760 deaths. Although there are treatments for brain tumors such as surgery, radiation therapy and chemotherapy, there is a growing need for altern ative treatments because current methods are invasive or may cause severe side effects. Adva nces in cancer and gene therapy research have established that acquired diseases such as cancer typically involve more than one gene defect and several genes can serve as targets for therapy. Specifically, it has been shown in many studies that under-regulated insulin-like growth factor (IGF1) signaling is invo lved in many cancers, including brain cancer. Further characterizati on of the IGF1 signaling pathway in brain tumor cells can lead to identification of more target genes for gene therapy applications. The goal of this project was to develop gene expression targeting the IGF1 system for the treatment of brain tumors. The obj ectives of this project were to (1) investigate the role of IGF1 signaling in rat glioblastoma (RG2) cells by IGF1R knockdown via (a) in ducible expression of an IGF1R-ribozyme in a stable cell line (b) ther apeutic application of the ribozyme in lipid mediated transient transfections (2) develop and characterize alternate appr oach to inhibit IGF1

PAGE 12

12 signaling by lipid mediated gene delivery of an IGFBP3 expression vector (3) develop protease resistant IGFBP3 to increase inhibiti on of IGF ligand-receptor interactions.

PAGE 13

13 CHAPTER 1 BACKGROUND AND SIGNFICANCE Introduction It was es timated that in the year 2000 in th e U.S. there was a prevalence of more than 81,000 diagnosed cases of primary malignant brai n tumors. Incidence of brain tumors is estimated to be 18,500 new cases in 2005. Although this represents only 1.34% of all cancers expected to be diagnosed, five -year survival rates following di agnosis can be less than 5%.1 Current treatments for brain tumors include ch emotherapy, radiation therapy and surgery. But chemotherapy causes common side effects includi ng nausea and anemia and cranial radiotherapy has shown to increase the incide nce of secondary brain tumors.2 Surgical resection is invasive and it often requires gross total ex cision of the brain tumor in orde r to increase survival of the patient3, or may require repeated resections with recurring tumors. The growing need for less invasive and more effective treatments for brain tumors has advanced cancer therapy research to explore alternative treatments such as gene ther apy. Studies have identified numerous molecular markers which serve to characteri ze tumor malignancy and invasivene ss that can also be applied as gene therapy targets. The role of the insulin-like growth factor (IGF) system, for example, has been studied extensively in colo rectal, prostate, breast and lung cancer, but limited studies in brain cancer. Utilizing the IGF system as a gene therapy target for brain tumors will require further characterization of IGF -related signaling and cell prolifer ation of a brain tumor cell culture model. Brain Tumor Characteristics Gliom as are categorized as astrocytic or oligodendroglial tumors, accounting for approximately 70% of all brain tumors. High grade (malignant) tumors may develop as a primary glioblastoma or from a pre-existi ng low-grade tumor (secondary glioblastoma),

PAGE 14

14 characterized according to histologi cal features such as nuclear atypia, mitosis, microvascular proliferation, and necrosis. Molecular charact eristics of gliomas incl ude TP53 mutation, PTEN mutation, LOH 10q, EGFR amp lification or p16 deletion4 and more recent studies using gene expression profiling have iden tified other markers such as EGFR, MDM2, CDK4, CD44, IGFBP25, ATX, BCLW, and PTK2.6 Recently, studies show that the IGF system also plays a role in brain tumorogenesis. In central nervous system malignancies expression of IGF1 and IGF2 mRNA transcripts are increased, IGF1 bindi ng to its receptor is higher, and expression of IGFBPs and protease activ ity are increased compared to normal brain tissue.7 Proteases also play a critical role in brain tumor invasion or metastasis, where studies have identified several matrix metalloproteinases (MMPs) in human gliomas. Tissues from 21 cases of human gliomas identified MMP2 and MMP9 by immunohistochemistry and RT-PCR; MMP2 was detected in 38% of cases by immunohistochemistry and 62 % by RT-PCR, MMP9 was detected in 81% of cases by immunohistochemistry and in 91% by RT-PCR.8 Immunostaining demonstrated that strong expression of MMP7, MMP10, and MMP11 contribute to the worst prognosis of astrocytic tumors, while MMP2 and MMP9 expressi on in vasculature implicate their role in tumor angiogenesis.9 The Insulin-Like Growth Factor System and Cancer The IGF system is composed of the ligands IGF1 and IGF2, their respective receptors IGF1R and IGF2R and the IGF binding proteins (IGFBPs). Mature IGF1 and IGF2 proteins are approximately 8000 Daltons in size and consist of A, B and C domainshomologous to those of proinsulinin addition to a short D domain and a C-terminal E domain that is cleaved during secretion. Most IGFs present in the body are produced in the liver and circulate in the blood as a ternary complex with IGFBPs and an acid labi le subunit (ALS), but can also be produced by autocrine and paracrine processes.10

PAGE 15

15 While IGF2 can interact with either IG F1R or IGF2R, there is no known downstream signaling of the IGF2R. However, IGF1 bindi ng to IGF1R induces intracellular signaling. IGF1R, a transmembrane protein structurally and f unctionally similar to the insulin receptor, is a heterotetramer consisting of two extracellular alpha ( ) domains and two inte rcellular beta () domains. IGF1R is a tyrosine kinase signali ng molecule that undergoe s autophosphorylation of tyrosine residues in the domains, which serve as docking sites for insulin receptor substrate (IRS) and Shc adaptor proteins. Phosphorylatio n of these proteins in itiates a cascade of downstream signaling which include activation of the PI3K/AKT/TOR pathway and recruitment of Grb2/SOS for activation of the Ras/Raf/MA PK pathway. The major effect of signaling downstream of AKT involves regula tion of mRNA translation and cell survival, where PTEN is an important negative regulator of this pathwa y. The major effect of signaling downstream to Raf involves regulation of cell proliferation.11, 12 Cancer development can be attributed to an under-regulated IGF1-induced signaling pathway. Carcinogenesis involves an accumulation of sequential hits that genetically damage or mutate a proliferating somatic cell that, over time, will result in a transformed population. The most apparent mechanism is that presence of IGFs result in a population of cells that favor survival and growth rather than apoptosis as gene tic damage occurs. Therefore, individuals with higher IGF levels are more probable to develop cancer if an accumulation of genetic mutations occur.12 The correlation of IGF1 signaling and ca ncer development can be evidenced by IGF1R density and the impact on downstream signaling, especially the AKT pathway. In primary prostate tissue samples, immunostaining and in situ hybridization showed significant increases of IGF1R and IRS expression, and l acked significant PTEN staining.13 IGF1R silencing with siRNA showed significant increase in apoptosis and inhibition of survival in both PTEN wild

PAGE 16

16 type and PTEN mutant prostate cancer cells,14 confirming the importance of the IGF1-induced AKT signaling pathway. IGFBPs and Cancer There are six different IGFBPs that have been well characterized. IGFBPs have molecular masses ranging from 22.8 to 31.3 kDa, sh aring similar domains and functional motifs. The amino-terminal domain is conserved containi ng five to six disulfide bonds and IGF-binding residues. The cysteine rich carboxy-terminal do main is also conserved, with three disulfide bonds and IGF-binding residues, su ggesting a pocket formation between the aminoand carboxy domains for proper IGF binding. The carboxy-termina l also contains important functional motifs such as Arg-Gly-Asp (RGD) integrin binding re sidues in IGFBP1 and IGFBP2 and heparin, ALS and cell surface binding residues in IGFBP3 and IGFBP5. It is also important to note the presence of a nuclear localization signal w ithin the carboxy-terminal. Although the central domain is not conserved, it contains severa l important functional motifs such as N-linked glycosylation, phosphorylation a nd proteolytic cleavage sites.15 IGFBPs present in blood circulation as we ll as in the cellular microenvironment are involved in regulating cell growth and survival, therefore are also an important factor in cancer risk and tumor development. Of the six IGFBPs IGFBP3 has been the most extensively studied, but there is conflicting evidence as to its direct correlation with cell growth and survival. IGFBP3 is the most abundant in circulation, bi nding approximately 75% IGFs and is generally thought to inhibit IGF1-IGF 1R interactions at the extracellular environment. In NIH-3T3 cells overexpressing the IGF1R, IGFBP3 was shown to inhibit IGF1-induced autophosphorylation of the receptor in a dose-dependent manner, with complete inhi bition at the maximum dose.16 Through IGF-independent processes, IGFBP3 may also attenuate cell pro liferation by inducing apoptosis. Human retinal endot helial cells (HRECs) treated with IGFBP3 showed a dose-

PAGE 17

17 responsive inhibition of prolifera tion, with approximately 30% i nhibition at the maximum dose, in correlation with annexin V st aining to illustrate a significa nt increase in apoptotic cells.17 An IGF-independent mechanism of apoptosis has been identified by de monstrating retinoid X receptorand nuclear receptor Nur77 translocation a nd initiation of the apoptotic cascade in IGF1R-knockout mouse fibroblast cells.18 In contrast, IGFBP3 can poten tiate IGF1-induced signaling by increasing the circulation half-life of IGF1 and may possess a mechanism of sequestering IGFs to the cell surface. Preincubation of cultured bovine fibroblasts wi th IGFBP3 demonstrated cell surface binding with 10-fold lower binding affinity to IGF1 and a two to four fold augmentation of IGF1dependent responsiveness, when compared to treatment with solublized IGFBP3.19 IGFBP3 is also susceptible to proteolytic cleavage in th e extracellular environment, providing an additional mechanism to allow free IGF1 to interact with its receptor. MMPs are the most prominent proteases present in the tumor microenvir onment that regulate IGFBP3 interactions.20 In human prostate adenocarcinoma cell lin e (DU-145), immunoblots detected MMP9 in a solubilized and membrane-bound form and selective proteolysis of IGFBP3 yielding 31 and 19 kDa fragments. Furthermore, overexpression of MMP9 antisense cDNA inhibited cell proliferation by 80% that was reversed by IGF1 in a dose-dependent manner.21 Addition of IGFBP3/IGF1 complexes to BALB/c 3T3 fibroblasts overexpressing IGF1R s howed complete inhibi tion of IGF1R and AKT phosphorylation but addition of MMP7 restored the stimulatory effect.22 The specific protease cleavage sites of MMP7 as well as MMP223 was determined by amino acid sequence analysis. Gene Therapy Applications Numerous studies have esta blished the importance of the IGF system in carcinogenesis by demonstrating that tumor growth and survival is associated with increased IGF1-induced signaling. Since IGF1-signaling can be a result from several mechanisms such as increased

PAGE 18

18 IGF1 levels, increased IGF1R density, IGFB P degradation, or unregulated downstream signaling, therapeutic app lications can target this signaling pathway by several methods such as IGF1 inhibitors or competitive binding, IGF1R silencing, AKT inhibitors, PTEN expression and so on. This current project will apply IGF1R s ilencing and IGFBP expressi on to target the IGF1 signaling pathway in brain tumors. A pilot stud y has already assessed the efficacy of an IGF1R antisense oligonucleotide in patien ts with malignant astrocytomas.24 Because ribozymes have a greater range of target sites and have a lower effective molar concentration than antisense oligonucleotides another study applied a ribozyme targeted against IGF1R to characterize IGF1R downregulation and decreased IGF1-induced human retinal endothelial cell migration.25 Since IGFBP can be applied as an effective IGF1 inhi bitor but can be countered by IGFBP proteinases, mutation of proteolytic cleavage site s can serve to alleviate this lim itation. The feasibility of this method has been justified in an IG FBP5 study where mutation of the Arg138-Arg139 to Asn138Asn139 showed the same binding affinity to IGF1 as the wild type protein, and showed 77-84% decrease in IGF1-stimulated DNA and protein synthesis.26, 27

PAGE 19

19 CHAPTER 2 MATERIALS AND METHODS Rat Glioma Cell Culture (RG2) RG2 cells were cu ltured in complete growth media (DMEM, 10% FBS, 1% Pen/Strep). Incubation was at 37C with 5% CO2. To seed 6 or 24-well plat es, cells were grown in T-75 (75cm2) flasks to approximately 80% confluency. Cells were washed once with Dubecos Phosphate Buffered Saline (DBPS), detached using 1mL trypsin/EDTA (Cellgro), and resuspended in 8mL complete growth media. For each 6-well plate 2mL of the cell suspension was diluted in complete growth media to a final volume of 12mL or 2mL/well. For each 24-well plate 500uL of the cell suspension was diluted to a final volume of 24mL or 1mL/well. Cells were incubated for 24 hours to give an approxi mate 25% confluency. For higher confluency, cells were suspended at higher co ncentrations or incubated for an additional 24 to 48 hours prior to further analysis. Cells in th e T-75 flasks were passed every three to four days by transferring 1/10 of the cell population into a new flask. Insulin-Like Growth Factor 1 Receptor-Ribozyme GeneS witch GeneSwitch Plasmids pGene and pSwitch plasm ids (Invitrogen) were grown in DH5 chemically competent E. coli (kanamycin resistance) and purified accord ing to manufacturers protocol using Endotoxinfree Giga Prep (Qiagen). The IGF1R-Rz was incorporated into the pGene at the HinDIII and PmeI multiple cloning site (Figure 2-1). Rat Glioma Stable Cell Line To m ake an RG2 stable cell line contai ning an IGF1R-Rz under the GeneSwitch, RG2/pSwitch cells were transfected in 6-well plat es with linear pGene/IGF1R-Rz using the same protocol as in transient transfec tions (below). RG2/pSwitch is a stable cell line containing the

PAGE 20

20 mifepristone-inducible GeneSwitch transcripti on regulator that was created and validated previously (Appendix A). Cells were selected by incubation in complete growth media containing 600ug/mL Hygromycin B and 750ug/mL Zeocin for 10 days. Each well was then transferred into 96-well plates by seeding at densities of 1 cell /well, 10 cells/well, 25 cells/well and 100 cells/well. Growth was maintained in selective media and monitored closely over a period of two weeks by tracking wells containi ng only one colony. 16 colonies were expanded by transferring into 24-well plates. An a liquot of each colony was induced with 10nM mifepristone and growth after 72 hours was m easured by BCA total protein assay (Pierce) according to manufacturers protocol. Four co lonies (Colonies #1, 3, 6 and12) that showed greatest growth inhibition were expanded further in T-75 flasks. Rat Glioma Cell Growth Analysis The RG2 stable cells were seeded into 6-well p lates. One set of cells was treated with 10nM mifepristone in the selectiv e media while the other set receiv ed only selective media. The cells were incubated over 96 hours with media ch anges every 24 hours and harvesting an aliquot every 24 hours (Figure 2-2). Cell growth was analyzed using BCA total protein assay. Control assays consisted of RG2/pSwitch cells (containing only GeneSwitch transcription regulator) and non-transfected RG2 cells grown over 96 hours, either with or without mifepristone treatment. Samples were prepared and assayed in triplicates. Insulin-Like Growth Factor 1 Receptor Western Analysis The RG2 stable ce lls were grown in two T-75 flasks until approximately 25% confluency was reached. One flask was treated with 10nM mi fepristone in the selective media while the other flask received only selective media. Th e cells were incubated for 96 hours with media changes every 24 hours. The cells were then pelleted and resuspended in lysis buffer with incubation for 25 minutes at room temperature. Total protein of each sample was measured by

PAGE 21

21 BCA assay. Each sample (500ug) was then im munoprecipitated using 3ug anti-IGF1R rabbit polyclonal IgG (Santa Cruz Biotech Inc.) and MagnaBind protein A magnetic beads (Pierce). Samples were eluted in 30uL Laemmli sample buffer heated to 90C. The samples were then separated by sodium dodecyl su lfate polyacrylamide gel electr ophoresis (SDS-PAGE) using 520% Tris-HCl gel in electrophoresis running buffe r at 100V on ice for approximately 2 hours. Proteins were transferred onto a nitrocellulose membrane (Millipor e) at 100 volts for 1 hour in transfer buffer. After overnight incubation at 4C in blocki ng buffer, the membranes were probed with anti-IGF1R rabbit polyclonal pr imary antibody (1:200) for 1 hour at 4C in blotting buffer then with anti-rabbit IgG mouse monoclonal HRP conjugate (Santa Cruz Biotech Inc.) secondary antibody (1:2000) for 1 hour at 4C in blotting buffer. Bands were visualized by chemiluminesence detection on film (ECL) according to manufacturers protocol (GE Healthcare) and quantified using Quantity One soft ware (Bio-Rad). Samples were prepared and assayed in triplicates. Lipid Mediated Delivery of Ribozyme Ribozyme Expression Plasmid The IGF1R-Rz plasm id was given by the lab of Maria Grant (Unive rsity of Florida, Gainesville). The plasmid was a mammalian e xpression vector containing a chick -actin promoter, grown in Max Efficiency Stbl2 compet ent cells (Invitrogen), purified and sequence verified. Cationic Lipid Transfection Reagent Lipid89 (Genzym e) and Lym-X-Sorb (LXS) (Avant i), in chloroform solution, were thawed to room temperature. The following were pi petted into a glass cu lture tube: 8uL Lipid89 (25mg/mL, 0.038 umol/uL), 7.5ug LXS (138 mg/m L, 0.365 umol/uL), 2uL Vitamin E (5.905 mg/mL, 0.0137 umol/uL). The mixture was vor texed for 30 seconds. The chloroform was

PAGE 22

22 evaporated using argon gas until a thin film was formed. The lipid film was placed in a vacuum desiccator for 30 minutes, then resuspended in 3mL of sterile HEPES Buffered Saline (HBS) by vortexing for 3 minutes, followed by sonication in a water bath for 5 minutes. The lipid suspension was used for transfections at a ratio of 60uL per 1ug DNA to give N:P of 2:1. Lipoplexes and Transfections Lipoplexes were form ed by complexation of plasmid DNA to cationic lipid. Plasmid DNA was diluted in sterile HBS to a concentra tion of 20ng/uL. Cationic lipid formulation (Lipid89/LXS) was added to the plasmid DNA at a ratio of 60uL per 1ug DNA (N:P=2), mixed by pipette, and incubated at room temperature for 15 minutes. This lipoplex was diluted in serum-free media to a final concentration of desired DNA dose per 500uL total volume. Meanwhile, the complete growth media of RG2 cells was replaced with 500uL serum-free media after cells were washed once with DBPS. 500uL of the diluted lipoplex was then added to each well, to give a total volume of 1mL per well. The cells then were inc ubated at 37C with 5% CO2 for 4 hours. After incubation, the serumfree media was replaced with 1mL complete growth media. The cells were then incubated fo r at least 24 hours more to allow gene expression before further anal ysis (Figure 2-3). Ribozyme Transient Transfections RG2 cells were seeded into 6-well plates and tran sfected with the IGF1R-Ribozyme expression cassette using Lipid89/LXS as described above. 0.25ug, 0.5ug, 1.0ug and 1.5ug DNA doses were used. A blank mammalian expression vector (p VC1157) was used for control transfections. Cell growth af ter 72 hours was measured by BCA total protein assay. Transfections with Green Fluorescent Protein Sim ultaneous transfections with GFP reporter gene were used to visualize transfection efficiency. RG2 cells were plated into 6-well plates and transfected with 0.25ug, 0.5ug, 1.0ug

PAGE 23

23 and 1.5ug pGFP using Lipid89/LXS. Transfection e fficiency was visualized by fluorescence and bright field using Nikon inverted microscope at 200X magnification. Wild Type and Mutant Insulin-Like Growth Factor Binding Protein 3 Expression Wild Type Expression Cassettes Rat IGFBP3 coding region was taken from rat liver cDNA (Bio Chain Institute) by polym erase chain reaction (PCR) using Taq polymerase pCR8/GW/TOPO TA Cloning Kit (Invitrogen) with the conditions indicated below (Table 2-2). The reactions used 2.5mM dNTPs, 1X Buffer I (Invitrogen), 10pmol primers, a nd 10% DMSO. The expected product fragment length (878kb) was visualized by 1% agarose gel electrophoresis, then cloned into the TOPO vector using TOP10 chemically competent E. coli After purification of the plasmid (TOPO/IGFBP3), the IGFBP3 in sert was confirmed by sequenci ng using the provided GW1 and GW2 forward and reverse primer s. TOPO/IGFBP3 was then digested with NsiI and XbaI restriction endonucleases (Promega, New Engla nd Biolab) to isolate the IGFBP3 insert by agarose gel purification. Using ad aptors (Table 2-1), the IGFBP3 in sert was then ligated into the HinDIII and XbaI sites of a mammalian expres sion vector (pVC1157) using T4 DNA ligase (Promega) with overnight incubation at 14C followed by transformation of DH5 chemically competent E. coli (Invitrogen). The adaptors contained either the Kozak sequence or HA tag between the HindDIII/XbaI cloning sites. Primers designed to anneal just after the coding region of the signal sequence were used to amplify an IGFBP3 fragment with a signal sequence deletion using the PCR conditions below (Table 2-3). pVC1157 contains a CMV enhancer promoter, UT12 5 untranslated region, and 3 human growth hormone polyadenylation signal sequence. The resulting plasmids were purified using Endo-free Giga Prep (Qiagen), then sequence verified.

PAGE 24

24 Mutant Expression Cassettes Mutant IGFBP3s were generated by site directed mutagenesis us ing either of two m ethods. In the first method, forward primers (Table 2-4) containing the mutations (blue highlight) were used to amplify a fragment of the IGFBP3 gene by PCR using iProof (Bio-Rad) at the conditions below (Table 2-6). The same reverse primer used in generating the wtIGFBP3 was used for each mutant. The fragment was purified by agarose gel electrophoresis and ge l extraction (Qiagen). This 3 fragment was then ligated to the 5 fragment between the BbsI and XbaI restriction sites using T4 DNA ligase with overnight incubati on at 14C followed by transformation of DH5 E. coli and selection in kanamycin-containing LB broth (50ug/mL). Several colonies of each mutant were isolated, purified, sequence verified using universal primers, then prepared using Endo-free Giga-prep. The second method utilized the QuikChange (Stratagene) principal. Another set of forward 5 phos phorylated primers were design ed to contain the IGFBP3 mutations (Table 2-5); no revers e primers were used. The entire IGFBP3 plasmid was amplified by PCR using iProof (Table 2-6). The methylated wtIGFBP3 parent plas mid was digested using 10U DpnI (Promega) with incubation at 37C for 3 hours followed by enzyme deactivation at 65C for 20 minutes. An aliquot of the reaction was then used for transformation of DH10B Chemically Competent cells (Inv itrogen) selected with kanamycin. After an initial sequence screening, one colony containing eac h mutation was selected and amplified. The plasmids were purified using Endotoxin-free Giga Prep and sequence verified. Wild Type Growth Curves RG2 cells were seeded into 6-well plates a nd tran sfected with the wtIGFBP3 expression cassette using Lipid89/Lym-X-Sorb as described above. 0.5ug, 1.0ug and 1.5ug DNA doses were used. pVC1157 was used for control tran sfections. Cell growth was measured over 72 hours by BCA total protein assay every 24 hours.

PAGE 25

25 Receptor Phosphorylation RG2 cells were seeded into 24-well pl ates and transfected with 1.0ug wtIGFBP3 expression cassette using Lipid89/LX S. Cells were incubated for 48 hours to allow expression. The conditioned m edia was pipetted into separa te 24-well plates then supplemented with 0.01ng/mL, 0.1ng/mL, 1.0ng/mL, 10ng/ mL, or 100ng/mL of recombinant rat IGF1 (US Biological) and incubated at 37C for 4 hours. Meanwhile, the cells were incubated in serumfree media at 37C for 4 hours. The serum-free media was then replaced with the conditioned media and incubated for an additional 1 hour. The cells were then harvested and incubated in cell lysis buffer containing 1% Phosphatase Inhibitor Cocktail Set II (Calbiochem) at room temperature for 20 minutes. Lysates were meas ured for phosphorylated IGF1 receptor by ELISA (R & D). Total IGF1 receptor was also measured for normalization. Mutant Growth Curves RG2 cells were seeded into 24-well pl ates and transfected with 1.0ug wtIGFBP3, mutIGFBP3, or control expression plasm ids us ing Lipid89/Lym-X-Sorb as described above. Cell growth in serum-free (PC-1) media was measured over 72 hours by total DNA CyQuant assay (Invitrogen) every 24 hours. This analysis was repeated in serum-free media containing 1ug/mL recombinant MMP2 protein (Abcam). All samples were assayed in triplicates. Insulin-Like Growth Factor 1 Bioavailability RG2 cells were seeded into 24-well pl ates and transfected with 1.0ug wtIGFBP3, mutIGFBP3 or control expression plasm ids us ing Lipid89/LXS as described above, followed by immunoprecipitation and ELISAs measuri ng IGFBP3 cleavage by MMP2 and IGF1 bioavailability (Figure 2-2). After transfection, cells were incubated in serum-free (PC-1) media for 48 hours. The conditioned media was transferred into new 24-well plates. For the endogenous MMP2 activity studies, 24nM MMP2 inhibitor (Calbiochem) was added. The media

PAGE 26

26 was supplemented with several doses of r ecombinant rat IGF1 (10ng/mL, 50ng/mL 100ng/mL) and incubated at 37C for 2 hours. The 100ng/mL IGF1 dose was determined to be a saturating dose. For the exogenous MMP2 studies, 1ug/mL recombinant MMP2 (Abcam) was added to the conditioned media, incubated at 37C for 2 hours, then several doses of recombinant rat IGF1 was added followed by another 2 hour incubation. IGFBP3/IGF1 complexes were immunoprecipitated from 200uL of media using 1.5ug rabbit polyclonal IgG (Santa Cruz Biotech Inc. ) against the C-termi nus of IGFBP3 with incubation at 4C for 1 hour. This was purif ied by adding 7.5uL MagnaBind Protein A Beads (Binding Capacity: ~0.20 mg rabbit IgG/mL of beads) (Pierce) followed by incubation at 4C for 1 hour then magnetic separation from supernatan t and 3 washes with DPBS. The complexes were eluted in 200uL high-salt elution buffer (pH 6.6) to dissoc iate IGFBP3/IGF1 complexes but retain antibodies. An aliquot of the immunoprecipitates were mi xed with Laemmli sample buffer (1:1 v/v) and heated to 90C in a water bath for 10 mi nutes, then cooled on ice for 2 minutes. The samples were electrophoresed by SDS-PAGE on a 5% Tris-HCl gel at 100V on ice for approximately 2 hours. The gels were then fixe d and stained with silver nitrate according to manufacturers protocol (Bio-Rad). Statistical Analysis Data points repres ent the mean of replicate samples. Error bars represent 1 standard deviation from the mean. To evaluate differences between means, Students T-test was used to test the null hypothesis that the means of two normally distributed populations are equal, where the p-value threshold was set to 0.05.

PAGE 27

27 Figure 2-1. pSwitch and pGene/IGF1R-Rz plasmids. Figure 2-2. Schematic diagram of Ge neSwitch RG2 cell growth analysis. Figure 2-3. Schematic diagram of RG2 transient transfection procedure.

PAGE 28

28 Table 2-1. IGFBP3 primers and adaptors. Forward Primer/Adaptor Reverse Primer/Adaptor IGFBP3 (No Kozak) 5ATGCATCCCGCGCG CCCC-3 5CTACTGGCTCTGCACGCTGA-3 Kozak-IGFBP3 5CTGACTGAGAAGACTCAGCTTAC CATGCATCCCGCGC-3 5CTGACTGAGAAGACTCCTAGAGGAGG CATGATGATATATTTTTATCTTGTGC-3 IGFBP3-HAtag 5AAGCTTACCATGCATGTCGACCA AGGGGAAAGACGACGTGCATTGCC TCAGCGTGCAGAGCCAGTATCCGT ATGATGTGCCGGATTATGCGTAGT CTAGA-3 (REVERSE COMPLIMENT) Signal Sequence Del 5CTGACTGAGAAGACTCAGCTTAC CATGGGCGCGGGCGCGGTG-3 5CTGACTGAGAAGACTCCTAGAGGAGG CATGATGATATATTTTTATCTTGTGC-3 Table 2-2. PCR conditions for wtIGFBP3. Cycle Step Temp (C) Time (min) # Cycles Initial Denaturation 94.0 2 1 Denaturation 94.0 1 Annealing 60.7 2 Extension 72.0 3 34 Final Extension 72.0 7 1 Hold 4.0 Table 2-3. PCR conditions for IGFBP3 signal sequence deletion. Cycle Step Temp (C) Time # Cycles Initial Denaturation 98 3 min 1 Denaturation 98 10 s Annealing 62 Extension 72 30 s 34 Final Extension 72 7 min 1 Hold 4

PAGE 29

29 Table 2-4. Mutant IGFBP3 forward primers. Forward Primer Melting Temp. (C) Mutant 0 5CTGACTGAGAAGACTCCAGC AACCTGAGTGCCTACCT CCCC-3 Tm 64.7 Mutant 1 5CTGACTGAGAAGACTCCAGCAACCTGAGTGCCTACGCC-3 Tm 60.6 Mutant 2 5CTGACTGAGAAGACTCCAGCAACCTGAGTGCCTACGGC-3 Tm 60.6 Mutant 3 5CTGACTGAGAAGACTCCAGCAACCTG AGTGCCTTCCTCCCC-3 Tm 66.5 Mutant 4 5CTGACTGAGAAGACTCCAGCAACCTG AGTGCCTTCGCC-3 Tm 62.7 Mutant 5 5CTGACTGAGAAGACTCCAGCAACCTGAGTGCCTTCGGC-3 Tm 62.7 Table 2-5. Mutant IGFBP3 pr imers for QuikChange method. Forward Primer Melting Temp. (C) Mutant 0 5P-GCAACCTGAGTGCCTA CCTCCCCTCCCAGCCGTCTCCTGG-3 Tm 82.3 Mutant 1 5P-GCAACCTGAGTGCCTACGCCCCCTCCCAGCCGTCTCCTGG-3 Tm 84.5 Mutant 2 5P-GCAACCTGAGTGCCTACGGCCCCTCCC AGCCGTCTCCTGG-3 Tm 84.5 Mutant 3 5P-GCAACCTGAGTGCCTTCCTCCCCTCCCAGCCGTCTCCTGG-3 Tm 83.4 Mutant 4 5P-GCAACCTGAGTGCCTTCGCCCCCTCCCAGCCGTCTCCTGG-3 Tm 85.6 Mutant 5 5P-GCAACCTGAGTGCCTTCGGCCCCTCCC AGCCGTCTCCTGG-3 Tm 85.6 Table 2-6. Mutant IGFBP3 PCR conditions using iProof. Cycle Step Temp (C) Time # Cycles Initial Denaturation 98 3 min 1 Denaturation 98 10 s Annealing 60 / 62* 1 min Extension 72 30 s 24 Final Extension 72 7 min 1 Hold 4 Forward primers for IGFBP3 fragment, QuikChange primers

PAGE 30

30 Figure 2-4. Schematic diagram of IGF1 bioavailability procedures.

PAGE 31

31 CHAPTER 3 INSULIN-LIKE GORWTH FACTOR 1 SIGNALING PLAYS AN IMPORTANT ROLE IN RAT GLIOMA CELL GROWTH Introduction Binding of IGF1 to its receptor (IGF1R) indu ces a cascad e of signaling involved in growth and survival of cancer cells. The importance of IGF1 signaling has been implicated in other cancers such as breast,28-33 colon,34-43 prostate,13, 44-53 and lung cancer,54-56 where some studies have shown that knockdown or silencing of the IGF1R using antisense RNA in certain cancers cells significantly reduced IGF1 signaling a nd cell growth or increased sensitivity to chemotherapeutic agents.14, 28, 57 Essentially, because these studies indicate that there are several target sites in the IGF1R mRNA that are acces sible to antisense RNA, these sites are also potentially susceptible to ribozyme cleavage. A ribozyme is an enzymatic RNA molecule that hybridizes and cleav es mRNA at specific sites which has several advantages when us ed as an alternative to antisense RNA.58-77 Because its catalytic activity allows increased potency and lower effective doses, t oxicities can be reduced relative to other cancer therapeutics including antise nse RNA. It can also be incorporated into plasmid vectors for viral or non-vi ral delivery into targ et cells. Grant et al developed a hammer head ribozyme (IGF1R-Rz) that was designed to cleave rat, human and mouse IGF1R mRNA (Figure 3-1). Their studies showed approximately 40% decreases in IGF1R mRNA and protein, reduced IGF1R function in human retinal endothelial cells (HRECs) and reduced neovascularization in mice.25, 78 Although the objectives of their studies were not focused on cancer, the IGF1R-Rz can also be applied to tumor vasculature as well as tumor cells. The objective of the following studies was to investigate the role of IGF1 signaling in a stable rat glioblastoma (RG2) cell culture mode l containing an inducible IGF1R-Rz expression system (GeneSwitch). This stable cell line had two major advantages such as to allow (1)

PAGE 32

32 investigation of the impact of IGF1R knockdown in 100% of the cell population; and (2) regulation of IGF1R knockdown by switching on ribozyme expression upon exposure to a steroid inducer (mifepristone). See Appendix A for a more detailed description of the GeneSwitch mechanism and development of the GeneSwitch stable cell line. The hypothesis was that IGF1 signaling has a critical role in glioma proliferation and survival; therefore downregulation of the receptor using a ribozyme will inhibit RG2 cell growth. Results Induced Expression of Insulin-Like Gr ow th Factor 1 Receptor Ribozyme After stable transformation of RG2 cells with the IGF1R-Rz GeneSwitch (RG2/IGF1RRz), 16 colonies were selected and expanded. These colonies were screened by analyzing growth inhibition 72 hours after addition of the steroid inducer. Four colonies showing the greatest reduction in cell growth (Colonies 1, 3, 6, and 12) were selected for further analysis (Figure 3-2). Colony 3 was the most effective, showing th at induced expression of the IGF1R-Rz (Rz ON) inhibited cell growth to a plateau after 24 hours and showed 80% inhibition of cell growth after 96 hours (p<0.05), compared to non-induced cells (Rz OFF) (Figure 3-3A). Control cells continued to proliferate at the same rate with or without mifepristone induction, showing that inhibition of cell proliferation was due to ribozyme expression, not the GeneSwitch protein (Figure 3-3B) or mifepristone its elf (Figure 3-3C). Analysis of colonies 1, 6 and 12 showed reduced or no significant inhibition or cell growth after 96 hours (Figure 3-4). For this reason, colony 3 was utilized in proceeding experiments. Insulin-Like Growth Factor 1 Receptor Knockdown Western analysis of RG2/IGF1R-Rz showed a decrease of the IGF1R after induced ribozym e expression, as indicated by the 95kD band in lanes 1, 2, a nd 3 (triplicate samples). The

PAGE 33

33 95kD bands in lanes 4, 5 and 6 repr esent the IGF1R that was presen t in non-induced cells (Figure 3-5A). Quantification of band intensities revealed an 89% decrease (Figur e 3-5B). These results verified that expression of th e IGF1R-Rz down-regulated IGF1R expression, therefore inhibition of cell proliferation was most lik ely due to lack IGF1 induced si gnaling in the absence of IGF1R. Limitations GeneSwitch System Stability One lim itation to these studies was the stability of the IGF1R-Rz expression system, where a diminished effect on inhibition of cell grow th was observed as the number of cell passages increased. Cells at pass 6 and pass 10 demonstrated reduced inhibition of growth of 40% after 96 hours, which is approximately half the effect seen in earlier passages. Growth curves at pass 10 began to exhibit a sigmoidal shape, which is more typical of non-transformed RG2 cells (Figure 3-6). Mifepristone Dose-Response A dose-response study was conducted to investig ate possible increases in efficacy with increasing doses of the m ifepristone inducer. RG2/IGF1R-Rz and non-transformed RG2 cells were induced with up to 100X more mifepristone than was used in previous experiments (1X = 10nM). Results showed that in non-transforme d cells there was no significant decrease of cell growth 48 hours after treatment with up to 10 X mi fepristone doses. At 25X to 100X doses cell growth was reduced significantly but this eff ect may be due to mife pristone toxicity. RG2/IGF1R-Rz cells showed a 40% decrease in cell growth at the 1X mifepristone dose, similar to that seen previously. Ther e also was no significant decrease in cell growth after treatment with up to 10 X mifepristone doses. The effects seen at the 25X to 100X doses were also most likely due to mifepristone toxicity rather than IGF1R-Rz expression (Figure 3-7).

PAGE 34

34 Discussion Overall, thes e studies demonstr ated that IGF1 signaling play ed a critical role in rat glioblastoma cell growth. Incorporation of an IGF1R-Rz into an RG2 stable cell line showed that the knockdown of the IGF1R caused cell growth to be inhibi ted significantly. Despite the limitations of these studies, the results suggest th at the IGF system can potentially be used as an effective therapeutic target for gliomas. Because these studies utilized a population of stably transformed cells, a more therapeutic approach using cationic lipid mediated delivery of the IGF1R-Rz in a mammalian expression plasmid was investigated in the proceeding studies.

PAGE 35

35 Figure 3-1. Structure and target sites of the IGF1R-Rz. (A) Hammer head structure of the ribozyme showing 3 and 5 arms that hybridize and cleave specific mRNA. (B) Target sites of rat, human and mouse IGF1R-Rz showing cleavage after the underscored C. (Taken from Grant et al). Figure 3-2. RG2 cells transformed with IGF1R-Rz. Colonies 1-16 were screened by comparing growth inhibition 72 hours after mifepris tone induction. % Growth was measured by total protein assay and normali zed to non-induced cell growth.

PAGE 36

36 Figure 3-3. Inhibition of cell proliferati on by IGF1R-Rz. Growth curves comparing mifepristone-induced (Rz ON) and non-i nduced cells (Rz OFF). = p<0.05. (A) Colony 3 of transformed RG2 cells contai ning IGF1R-Rz in GeneSwitch system. (B) RG2 cells containing only pSwitch pl asmid. (C) Non-transformed RG2 cells. A C B

PAGE 37

37 Figure 3-4. Growth curves comparing mifepris tone-induced (Rz ON) and non-induced (Rz OFF) cells from RG2/IGF1R-Rz colonies after in itial screening of stable transformation. (A) Colony 1. (B) Colony 6. (C) Colony 12. = p<0.05 C B A

PAGE 38

38 Figure 3-5. Western analysis of transforme d RG2 cells showing IGF1R knockdown by IGF1RRz. (A) Immunoprecipitation of IGF1R indicated by 95kD band. Lanes 1-3 are triplicate samples of mifepristone-induced cells. Lane s 4-6 are non-induced cells. (B) Quantification of 95kD band intensities. = p<0.05 Figure 3-6. Growth curves comparing mifepris tone-induced (Rz ON) and non-induced (Rz OFF) RG2/IGF1R-Rz cells at later passages. (A) Passage 6. (B) Passage 10. = p<0.05 A B

PAGE 39

39 Figure 3-7. Mifepristone dose-re sponse. Growth of transforme d RG2/IGF1R-Rz (Pass<6) and non-transformed RG2 cells meas ured by total protein assay 48 hours after addition of mifepristone. = p<0.05

PAGE 40

40 CHAPTER 4 LIPID MEDIATED DELIVERY OF THE INSU LIN-LIKE GROWTH FACTOR 1 RECEPTOR RIBOZYME INTO RAT GLIOMA CELLS Introduction Genes can be delivered into cells by viral or non-viral m et hods. Viral vectors such as retroviruses,79-83 adenovirus,84-88 and adeno-associated viruses89-95 have several advantages over non-viral methods such as serum stability, hi gh gene transfer efficiency and long term expression. Some disadvantages include gene size limitations and difficulty of large scale preparation. Immuno-responses and genetic inco rporation into the host chromosome are other concerns that have attracted the use of non-viral vectors. Methods such as hydrodynamic gene transfer96-103 and the gene gun have demonstrated high ge ne transfer efficiency but are usually not therapeutically feasible and often only applied to liver and local gene expression. More recent and promising strategies for non-viral methods utilize poly cationic lipids and other nanoparticles (Figure 4-1).104-113 These methods have several advantages that outweigh their lower gene transfer efficiencies such as reduced inflammatory and immuno-toxicities and easier manufacturing of small and large scale preparations. There are al so numerous efforts to improve gene transfer efficiency by de veloping modifications to non-vi ral vectors to increase serum stablility,114-120 develop tissue-targeted delivery121-124 and improve nuclear localization.125-129 Although long term gene expression would be id eal to treat monogeneic, hereditary diseases such as hemophilia and cystic fi brosis, other disease states such as cancer would benefit from transient gene expression. Because cancer is an acquired disease that results from an accumulation of mutations of several genes, the duration of treatment would only need to be long enough to kill the tumor cells where treatment co uld be applied to target several genes. The previous study established the significan ce of IGF1 signaling in glioma growth; therefore to investigate a mo re therapeutic approach of IGF1R knockdown in gliomas, the

PAGE 41

41 IGF1R-Rz was delivered into RG2 cells using cationic lipids (Lipid89/LXS) for transient expression. The IGF1R-Rz sequence was incorp orated into a mammalian expression plasmid containing a 5 chick -actin promoter. The lip ids were a formulation of a spermine based cationic lipid and lysooleoyl phosphatidylcholin e, mono-oleoylglycerol, and oleic acid helper lipids (Figure 4-2). The lipoplex (N:P = 2) was suspended in an optimized hepes-buffered saline solution (HBS) for in vitro delivery. Results Transfection Efficiency in Rat Glioma Cells RG2 cells were firs t transfected with varyi ng doses of green fluorescent protein (pGFP) reporter plasmid using Lipid89/LXS to visualize a pproximate transfection e fficiencies (Figure 42). Doses of 0.5ug or lower showed lowest gene transfer efficiency, with GFP expression in 10% or less of the cell popul ation (Figure 4-3A/D). Th e 1ug/well dose consistently demonstrated to be the most efficient dose sh owing GFP expression in 20-40% of the RG2 cell population (Figure 4-3B/E). Doses of 1.5ug or highe r have the same transfection efficiency as the 1.0ug dose but typically demonstrate cytot oxicity most likely due to lipid and/or DNA overdoses as evidenced by morphology changes (Figure 4-3C/F). Transfections with the Insulin-Like Growth Factor 1 Receptor Ribozyme After estab lishing transfection efficiency with pGFP, RG2 cells were transfected with the IGF1R-Rz expression plasmid using Lipid89/LXS. In a transient expression system where only a small percent of cells were expected to uptak e the IGF1R-Rz plasmid, inhibition of cell growth was still seen. 72 hours after tran sfection cell growth was inhibite d by 20% at the most effective dose of 1.0ug DNA/well (Figure 4-4A). This ef fect correlated with the normal 20-40% transfection efficiency as evidenced by simulta neous transfections with pGFP (Figure 4-3B). DNA doses of 0.5ug and 0.25ug or lower showed a ge neral trend of decreasing efficacy. DNA

PAGE 42

42 doses of 1.5ug or higher also exhibited non-spec ific cytotoxicity due to lipid and/or DNA overdoses. Discussion One of the m ajor challenges of non-viral gene de livery is the efficiency of cellular uptake and ultimately the efficacy of gene expression. This concept is important in cancer therapy applications, especially brain tumors because el iminating the entire population of cancerous cells to prevent recurring tumors increases the probability of successful therapy. In these studies, lipid mediated delivery of the IGF1R-Rz was sufficien t to achieve a maximum inhibition of tumor cell growth, although this efficacy was directly dependent on transfection efficiency. This correlation suggested the possibility of utilizing se veral methods to increase transfection efficiency. Alternatively, while maintaining the same transfection efficiency, inhibition of cell growth can still be increased by expression of a gene that has the ability to impact surrounding cells. The later strategy was us ed in the following studies.

PAGE 43

43 Figure 4-1. Cationic lipid mediated gene delivery. Plasmid DNA is complexed with poly cationic lipids for delivery into cell nucleus. (1) C oding region is then transcribed into mRNA and translated into therapeutic protein. (2 ) Gene silencing is another method achieved by delivery of RNAi or expression of a ribozyme that targets endogenous mRNA. Figure 4-2. Structure of lipids used for RG2 transient transfections. (A) Genzyme Lipid 89: spermine based with carbamate linkage; 4 possible cationic charge s. (B) Lym-X-Sorb helper lipids: lysooleoyl phosphatidylchol ine (L-PC), mono-oleoylglycerol (MG), oleic acid (OA).

PAGE 44

44 Figure 4-3. Lipid89/LXS transfect ion efficiency in RG2 cells Transfections with 0.5ug, 1.0ug and 1.5ug pGFP. (A, B, C) green fluore scence. (D, E, F) bright field. A B C F E D 0.5ug 1.0ug 1.5ug

PAGE 45

45 50 75 100 00.250.511.5 DNA Dose (ug)% Growth Control IGF1R-Rz Figure 4-4. Inhibition of RG2 growth using lipi d mediated delivery of the IGF1R-Rz expression cassette. (A) Transient transfections with several doses of IGF1R-Rz plasmids using Lipid89/LXS. Total protein was measured after 72 hours and scale set to 100% of control transfections (Note: y-axis starts at 50%) = p<0.05. (B) Transfection with pGFP to show transfection efficiency. A B

PAGE 46

46 CHAPTER 5 INSULIN-LIKE GROWTH FACTOR BINDING PROTEIN 3 EXPRESSION INHIBITS RAT GLIOMA CELL GROWTH Introduction Effective gene therapy for treatm ent of tu mors would be contingent upon impacting an entire cancerous cell population to prevent tumor recurrence or me tastasis. Methods such as targeted delivery to increase affinity to the cell surface,130-135 modification of the plasma membrane or endocytotic signaling to increase uptake,136-138 or modification of lipid formulation to increase endosomal release139-145 have been developed to incr ease efficiency of therapeutic gene delivery. On the other hand, expressing a gene that impacts surr ounding cells (cell bystander effect) may be another approach to incr ease efficacy of a therapeutic treatment. Signal sequences146-148 and nuclear localization sequences149-153 are peptides that mediate protein secretion and nuclear uptake that may act as factors to the cell by-stander effect. Because IGFBP3 is a secreted protein, its inhibitory effects will rely less on transfection efficiency since expression will affect surroundin g cells (Figure 5-1A). When considering a therapeutic application and system ic administration, targeted gene delivery to endothelial cells124 of highly vascularized tu mors may also be very beneficial (F igure 5-2B). This approach would allow the bypass of the blood brain barrier by util izing endothelial cells as a bioreactor to produce secreted IGFBP3 that can impact neighbor ing tumor cells. In a ddition, previous studies have shown that IGFBP3 aff ects vasculature as well, by inducing endothelial cell growth inhibition and apoptosis.17 Results Development of Insulin-Like Growth Factor Binding Protein 3 Expression Cassette Because previous stud ies established the significance of IGF1 signaling in RG2 cell growth it was predicted that a secreted IGF1 binding protein (I GFBP3) could be used as a

PAGE 47

47 therapeutic gene to inhibit IGF1-dependent cell growth. The IGFBP3 gene was taken from rat liver cDNA using PCR and was ligated into a mammalian expression vect or containing a 5 CMV enhancer/promoter, UT12 untranslated region, IVS8 intron, Kozak sequence, and 3 human growth hormone poly-adenyl ation signal sequence (Figure 52A). During the process of developing the wild type IGFBP3, three variations of the expre ssion cassette were generated to demonstrate the importance of proper gene expr ession and modification (Figure 5-2B) (1) Kozak sequence deletion; (2) 3 HA-tag addition; and (3) signal sequence deletion. First, it has been well established that a Kozak sequence located just upstream of the ATG start codon highly regulates initiation of translation.154-156 This 5 non-coding motif (A/GCCATG G) was originally identified as a consensus sequence in vertebr ae mRNA, with the purine in position -3 being the most highly conserved. Second, an HA-tag was added in frame to the C-terminus of IGFBP3 as a method of detecting gene expres sion. But because of the shape of IGFBP3, studies have shown that the entire RG2 cells were transfected with 1.0ug of the mo dified IGFBP3 expression plasmids. Total protein was measured at 24 hours, 48 hours and 72 hours after transfection to generate a growth curve, where percent growth was normalized to growth of cells tran sfected with a blank expression plasmid (Control) that was scaled to 100% after 72 hours. Results showed no difference of cell growth compared to control transfections, suggesting that inhibition of cell growth would most likely be larg ely dependent on proper gene tran slation (Figure 5-3A), protein folding (Figure 5-3B) and protein secretion (Fig ure 5-3C). This was confirmed in proceeding studies using the complete IGFBP3 expression cassette, with Kozak and signal sequences and without the interfering HA-tag.

PAGE 48

48 Insulin-Like Growth Factor Binding Protein 3 Expression Inhibits Tumor Cell Grow th When proper expression, translation, folding and secretion of IGFBP3 were presumed, it was predicted that increased IGFBP3 e xpression (through the highly processive CMV enhancer/promoter) would be sufficient to bind IG Fs in the tumor extracellular environment and inhibit growth. RG2 cells were transfected wi th 1.0ug of the wild type IGFBP3 expression plasmid (wtIGFBP3) using Lipid89/LXS. Total protein was measured at 24 hours, 48hours and 72 hours after transfection to genera te a growth curve. Cells e xpressing IGFBP3 demonstrated a 20% inhibition of growth (Figure 5-3A), whic h was seemingly correlated with transfection efficiency (Figure 5-3B), similar to that seen with the previous IGF1R-Rz transfections. Total and phosphorylated IGF1R were measured by ELISA 48 hours after transfection. Results showed that, compared to control transfections there was only a slight decrease (3%5%) of IGF1-induced phosphorylation in cells that were transfected with wtIGFBP3 (Figure 5-4), but this was not statistically signifi cant. Because a greater inhibiti on of IGF1-induced signaling and cell growth was expected, further investigation of the tumo r cell environment was conducted. Insulin-Like Growth Factor 1 Bioavailability Because the tum or microenvironment secretes proteases, overexpression of certain IGFBPs may actually potentiate tumor cell growth by accumu lating IGFs near the cell surface where they may be cleaved to allow IGF1 to freely intera ct with its receptor and initiate signaling for survival and growth (Figure 5-5). Other studies have shown that IGFBP3 has a number of proteolytic cleavage sites. The following will focus on matrix metalloproteinases (MMP), a class of protease found in high abundance in the tumor environment, with MMP2 being expressed predominantly in the tumor vasculature. The following studies investigated IGF1 bioava ilability in relation to increased IGFBP3 expression through the CMV enhancer/promoter and the susceptibility of IGFBP3 to MMP2

PAGE 49

49 proteolytic degradation. RG2 cells were transf ected with 1.0ug wtIGFBP3 or control expression plasmids and incubated for 48 hours in serum-free media to allow gene expression. The conditioned media was saturated with recombinant IGF1 and immunoprecipitated using an antibody against the C-terminus of IGFBP3. This allowed isolation of either cleaved IGFBP3 that has released IGF1 or in tact IGFBP3 bound to IGF1 that was measured by ELISA (Figure 57). Results showed 25% more IGF1 binding in cel ls transfected wtIGFBP3 compared to control transfections (blue bars). To evaluate the extent of possible endogenous MMP2 activity, an MMP2 inhibitor was added to the cell culture media (white bars). Compared to the non-treated media, results demonstrated 30% increases in IGF1 binding in both control and wtIGFBP3 transfected cells, where wtIGFB P3 transfected cells showed 50% more IGF1 binding than control transfections. To evaluate the full exte nt of IGFBP3 cleavage and IGF1 bioavailability, the conditioned media was treated with recombin ant MMP2 (gray bars). Control transfections showed a 10% decrease in IGF1 binding compared to the non-treated media. Cells transfected with wtIGFBP3 showed a 25% decrease in IGF1 binding, concentrations comparable to that of the control transfections. These finding suggest ed that endogenous IGFBP3 as well as the IGFBP3 being expressed from the CMV enhancer /promoter expression cassette are susceptible to MMP2 proteolysis. IGFBP3 cleavage was further illustrated when the eluted immunoprecipitated samples were electrophoresed using SDS-PAGE and stained with silver nitrate (Figure 5-8). The 43kD bands (doublet ) represented intact IGFBP3 and 26kD bands represented cleaved IGFBP3. Conditioned medi a that was treated with recombinant MMP2 showed 26kD bands with twice the intens ities compared to non-treated media. Discussion Overall, thes e studies demonstrated that expr ession of a secreted protein, IGFBP3, resulted in rat glioma cell growth inhi bition, where the Kozak sequence, signal sequence and tertiary

PAGE 50

50 structure of the protein were important factors. It was also demonstrat ed that proteolysis of IGFBP3 influenced IGF1 bioavailability that may be impacting the efficacy of IGFBP3 induced growth inhibition. These studies showed that MMP2 was a factor that altered IGFBP3/IGF1 binding. Since MMP2 is a predominant in tumo r vasculature, its proteolytic activity may influence IGFBP3s therapeutic affects when app lied to tumor endothelial cell targeted delivery. This observation led to the idea of developing protease resistant IGFBP3 to further increase its growth inhibitory effects.

PAGE 51

51 Figure 5-1. Cell bystander effect. (A) IGFBP3 secr eted from a small population of cell can affect surrounding cells by binding extracellular IGF 1. (B) Tumor endothelial cells used as a bioreactor to secrete IGFBP3. IGFBP3 expression cassette4150 bp Kanamycin R wtIGFBP3 IVS8 intron Ori Kozak/START hGH polyA CMV enhancer/promoter UT12 Figure 5-2. IGFBP3 expression cassette. (A) Wild type IGFBP3 with 5 CMV enhancer/promoter, UT12 untranslated re gion, IVS8 intron, Kozak sequence and 3 hGH polyA signal. (B) Modifications to IGFBP3: signal sequence deletion, Kozak sequence deletion and HA-tag addition. A B A B

PAGE 52

52 Figure 5-3. RG2 growth after transfection wi th expression cassette variations: (A) Kozak sequence deletion, (B) HA-tag addition, a nd (C) signal sequence deletion. Growth was measured by total protein assay. A C B

PAGE 53

53 Figure 5-4. Inhibition of RG2 growth after wt IGFBP3 expression. (A) Comparison of growth curves of cells transfected with wtIG FBP3 and control plasmid. = p<0.05. (B) Transfections with pGFP to show transfection efficiency. A B

PAGE 54

54 Figure 5-5. IGF1R phosphorylation measured by ELISA. (A) RG2 cells transfected with blank expression plasmid. (B) RG2 cells transfected with wtIGFBP3. Figure 5-6. IGFBP3 proteolysis. IGFBP3 prot eolytic cleavage near tumor cell surface allows free IGF1 to interact with receptor and initiate survival/growth signaling. I I G G F F B B P P P P r r o o t t e e a a s s e e A B

PAGE 55

55 Figure 5-7. IGF1 Bioavailabilit y. Immunoprecipitations and ELISA s measuring amount of IGF1 bound to IGFBP3 with MMP2 inhibitor (wh ite bars) or with recombinant MMP2 (gray bars) compared to non-treated conditioned media (blue bars) = p<0.05. Figure 5-8. IGFBP3 proteolysi s by MMP2. (A) RG2 transfections with wtIGFBP3 expression cassette followed by (B) treatment of conditioned media with recombinant MMP2, immunoprecipitation and silver staining of SDS-PAGE.

PAGE 56

56 CHAPTER 6 PROTEASE RESISTANT INSULIN-LIKE GROWTH FAC TOR BINDING PROTEIN 3 INHIBITS RAT GLIOMA CELL GROWTH Introduction MMP2 is abundant in gliom a vasc ulature and therefore is an important regulator of tumor growth and metastasis. Proteoly tic degradation of IGFBPs allows release of IGF1 to freely interact with its receptor and ini tiate cell growth. Because wild type IGFBP3 is susceptible to proteolysis, as a proof of prin ciple, IGFBP3 was muta ted at the MMP2 cleavage site to increase efficacy of tumor growth inhibition. The feasib ility of this method has been justified in an IGFBP5 study where mutation of the Arg138-Arg139 to Asn138-Asn139 showed the same binding affinity to IGF1 as the wild type protein, and showed 77% decrease in IGF1-stimulated DNA and protein synthesis.27 Another study also showed that IGFBP4 that was mutated at the L120 and H121 proteolytic cleavage site acted as a potent inhibitor of DN A and cell migration responses to IGF1.157 Yet another study showed that a proteolytic cleavage domain substitution in IGFBP4 resulted in reduced muscle cell grow th while retaining equivalent wild type IGF1 binding affinity.158 Since the IGF1 binding site is located in a hydrophobic pocket of IGFBP3 that involves the N-terminal, cent ral, and C-terminal domains, muta tions that change its tertiary structure may cause severe decreases in IGF1 bi nding affinity. A previous study demonstrated that proteolytic fragments of IG FBP3 still bound IGF1 but with si gnificantly reduced affinity and decreased or no inhibition of IG F1R phosphorylation, therefore concl uding that the interactions between the N-terminal and C-terminal domains are essential for high-affinity IGF1 binding.16 In this study, the IGFBP3 mutations consisted of five different amino acid changes that were designed to be conservative e nough to maintain IGF1 binding affinity, yet divergent enough to resist MMP2 proteolysis.

PAGE 57

57 Results Insulin-Like Growth Factor Bi nding Protein 3 Mutant Five IGFBP3 m utants (Mut1Mut5) were gene rated by site-directed mutagenesis at the MMP2 cleavage site (Figure 5-1). Mutant 0 was homologous to th e wild type IGFBP3 except a nucleic acid substitution was made (that produced degenerate amino acid codon) to more closely match a published rat IGFBP3 sequence. The seque ncing data are shown below in each of the mutant subsections. Insulin-Like Growth Factor 1 Bioavailability The f ollowing studies investigated IGF1 bioa vailability in relation to mutant IGFBP3 resistance to MMP2 proteolytic degradati on. RG2 cells were transfected with 1.0ug mutIGFBP3, wtIGFBP3 or cont rol expression plasmids and in cubated for 48hrs in serum-free (PC-1) media to allow gene expression. To evaluate possible e ndogenous MMP2 activity, the conditioned media was treated with an MMP2 inhibitor then saturated with recombinant IGF1. Immunoprecipitation with an IGFBP3 antibody wa s used to pull down IGFBP3/IGF1 complexes followed by analysis with ELISA to measure the amount of IGF1 present in the immunoprecipitates (Figure 6-2). Under serum-fr ee (PC-1) cell culture conditions, all mutant IGFBP3s bound up to 80% more IGF1 than endo genous or CMV-expressed wild type IGFBP3s (dark blue bars). Mutant 2 showed highest binding, measuring 76% more IGF1 compared to wtIGFBP3. Interestingly, Mutant 0 bound 50% le ss IGF1 than wtIGFBP3. Because the nucleic acid substitution in Mutant 0 wa s a degenerate codon for the same wild type amino acid, this may be due to codon bias in this particular ce ll type. When MMP2 activity was inhibited, results showed approximately 10% increases in IGF1 binding in endogenous IGFBP3, CMVexpressed wild type IGFBP3, and mutant IGFBP3s (light blue bars). Mu tant 3 showed highest binding with 77% more measured IGF1 than wtIGFB P3. Measurements with a large increase of

PAGE 58

58 IGF1 detection in the presence of the MMP2 inhi bitor may indicate higher IGFBP3 susceptibility to MMP2 proteolysis as evidenced in Mutant 0, Mutant 3 and Mutant 4. But because there are several cleavage sites in IGFBP3 that make it su sceptible to multiple proteases that are secreted by RG2 cells, the large increases may rather be du e to proteolytic degradation by proteases other than MMP2. Also, the analysis incorporated endogenous IGFBP3s that may be influencing IGFBP3/IGF1 detection. This speculation was fu rther justified in the following experiments. To investigate the extent of mutant IGFBP3 binding affinity to IGF1 associated with resistance to MMP2 proteolysis, conditioned me dia was supplemented with recombinant MMP2 then saturated with recombinant IGF1. IGFBP3/IGF1 binding was analyzed by immunoprecipitation and ELISA (Fi gure 6-3) as described above. Mutant IGFBP3s showed approximately 30% more IGF1 binding than wt IGFBP3, except for 50% less with Mutant 0 (gray bars). Mutant 2 and Muta nt 3 had the highest measured IG F1 (69% and 75%, respectively, compared to wtIGFBP3). In this experiment, measurements with a la rge decrease of IGF1 detection after MMP2 treatment indicated, more c onclusively, higher IGFBP3 susceptibility to proteolysis (compared to no treatment). While wtIGFBP3 showed a 25% decrease in IGF1 binding, Mutant 0, Mutant 1 and Mutant 2 showed a 33%, 50% a nd 42% decrease, respectively. Although the decrease in Mutant 2 was statistica lly significant, its higher susceptibility to proteolysis may not be fully conclusive due to th e large standard deviatio n. Interestingly, Mutant 4 demonstrated a 40% increase in IGF1 binding. One explanation to this was possible activation of IGFBP3 domains or other effector molecule s to promote IGF1 binding in the presence of MMP2. Mutant 3 and Mutant 5 showed no signifi cant differences in IGF1 detection with or without MMP2 treatment, suggesting resistan ce to proteolysis a nd improved IGFBP3/IGF1 binding. The most effective mutIGFBP3 would be one that had highest IGF1 binding while

PAGE 59

59 demonstrating least susceptibili ty to MMP2 proteolysis. Although Mutant 2 bound the most IGF1, it showed high susceptibility to proteolysi s while Mutant 5 showed least susceptibility to proteolysis but also bound low am ounts of IGF1. Considering th is data set, Mutant 3 was proposed to be the most effective mutIGFBP3 because it bound relatively higher amounts of IGF1 (75% more than wtIGFBP3) while maintaining this binding affinity ev en in the presence of MMP2. Combining MMP2 inhibitor treatment fo llowed by addition of recombinant MMP2 allowed the comparison of the ex tent of proteolysis in a more controlled environment that eliminated the activity of endogenous MMP2 of unknown concentrations (Figure 6-4). Again, all mutant IGFBP3s except Mutant 0 showed hi gher IGF1 binding compared to wtIGFBP3. In this experiment, a large decrease in IGF1 de tection after recombinan t MMP2 treatment also indicated higher susceptibility to proteolysis. The wtIGFBP3 showed a 21% decrease in IGF1 binding, similar to that seen pr eviously. Mutant 0, Mutant 1 and Mutant 2 also showed 46%, 36% and 46% decreases in IGF1 binding, respectively. Mutant 3, Mutant 4 and Mutant 5 showed slight increases in IGF1 binding, but this also may be not fully conclusive because of the relatively larger standard deviat ions. Therefore these mutants we re concluded to have no change in IGF1 binding after recombinan t MMP2 treatment. Overall, thes e results further supported that IGFBP3/IGF1 binding and/or release was mediated by MMP2 proteolysis. Mutant 3 was again proposed to be the most effective mutIGFBP3 b ecause it bound 86% more IGF1 than wtIGFBP3 even in the presence of MMP2. Efficacy of each mutIGFBP3 was further analyzed in proceeding RG2 growth assays. Insulin-Like Growth Factor Binding Protein 3 Mutant 0 Mutant 0 was a nucleic acid substitution ups tream of the MMP2 cleavage site, producing a wild type degenerate codon that m ore cl osely matched the published rat IGFBP3 coding

PAGE 60

60 sequence. Although the previous studies showed a decrease in IGFBP3/IGF1 binding, growth analysis using total DNA assay showed no differen ce in RG2 growth inhibition in both complete and serum-free media (Figure 6-5). Insulin-Like Growth Factor Binding Protein 3 Mutant 1 Mutant 1 Leu129 Ala129 amino acid change was confirmed by sequencing of the purified mutIGFBP3 expression plasmid (Figure 6-6). This mutation resulted in a deletion of a three carbon group, which is a conservative change becau se there was only ~1.3 kcal/mol decrease in hydrophobicity (free energy transfer to water). B ecause of this conservative change, IGFBP3 was able to retain its binding affinity to IGF 1, with a 64% increase compared to wtIGFBP3. But due to a possible reduction of st eric hindrance due to the car bon group deletion, Mutant 1 also demonstrated high susceptibility to MMP2 proteolysis (Figure 6-3). Therefore the net effect resulted in RG2 growth similar to that seen in wtIGFBP3 expression (Figure 6-7A). Growth analysis was repeated in serum-free (PC-1) medi a to more closely represent conditions used in the IGFBP3/IGF1 binding ELISA studies, and resulte d in the same growth pattern (Figure 6-7B). Insulin-Like Growth Factor Binding Protein 3 Mutant 2 Mutant 2 Leu129 Gly129 amino acid change was confirme d by sequencing of the purified mutIGFBP3 expression plasmid (Figure 6-8). This conservative change resulted in a deletion of a four carbon group, with a ~1.8 kcal/mol decr ease in hydrophobicity. Although Mutant 2 was also able to bind 76% more IGF1 than wtIGFBP3, a further reduction of ster ic hindrance (due to a 4 carbon group deletion compared to a 3 carbon group deletion in Mutant 1) caused higher susceptibility to MMP2 proteolysis (F igure 6-3). This net effect al so resulted in RG2 growth that was similar to that seen in wtIGFBP3 expressi on in both complete and serum-free (PC-1) media (Figure 6-9).

PAGE 61

61 Insulin-Like Growth Factor Binding Protein 3 Mutant 3 Mutant 3 Tyr128 Phe128 amino acid change was confirmed by sequencing of the purified mutIGFBP3 expression plasmid (Figure 6-10). Sin ce MMP2 is a metalloproteinase that requires a calcium or zinc ion in its catalytic site the tyrosine hydroxyl gr oup on the carbon 4 of the aromatic ring may be a crucial component for its proteolytic activity. Deletion of the hydroxyl group in Mutant 3 allowed resist ance to MMP2 proteoly sis and a 63% increase of IGF1 binding compared to wtIGFBP3 (Figure 6-3). The mu tation was also a relatively conservative amino change, with only ~0.6 kcal/mol increase in hydr ophobicity. Because of these properties, Mutant 3 showed the greatest efficacy of growth inhibi tion of 40% when compared to wtIGFBP3 (Figure 6-11A). Analysis in serum-free (PC-1) me dia showed an even greater, 40% growth inhibition (Figure 6-11B). Insulin-Like Growth Factor Binding Protein 3 Mutant 4 Mutant 4 Tyr128 Phe128 and Leu129 Ala129 amino acid changes were confirmed by sequencing of the purified mutIGF BP3 expression plasmid (Figure 6-12). The tyrosine hydroxyl group deletion also demonstrated resistance to MMP2 proteolysis, but because the mutation involved two amino acid changes that were re latively less conserva tive, possibly altering IGFBP3 tertiary structure and resulted in onl y a 12% increase in IGF1 binding compared wtIGFBP3 but 58% less IGF1 binding than Mutant 3 (Figure 6-3). Mutant 4 expression in RG2 cells demonstrated a 17% growth inhibition rela tive to wtIGFBP3 but no difference in growth rate by 72 hours (Figure 6-13A). Growth in serum-free (PC-1) media showed 18% inhibition only after 72 hours (Figure 6-13B). Insulin-Like Growth Factor Binding Protein 3 Mutant 5 Mutant 5 Tyr128 Phe128 and Leu129 Gly129 amino acid changes were confirmed by sequencing of the purified mutIGF BP3 expression plasmid (Figure 6-14). Again, the tyrosine

PAGE 62

62 hydroxyl group deletion also demonstrated resi stance to MMP2 proteolysis, but the less conservative amino acid changes resulted in 20% more IGF1 binding th an wtIGFBP3 but 55% less IGF1 binding than Mutant 3 (F igure 6-3). Mutant 5 expressi on in RG2 cells demonstrated a 10% growth inhibition relative to wtIGFBP3 but no difference in growth rate by 72 hours (Figure 6-15A). Analysis in serum-free (PC-1) media showed no signi ficant difference in growth inhibition (Figure 6-15B). Discussion Overall, d evelopment of mutant IGFBP3s in creased IGF1 binding a nd resistance to MMP2 proteolytic degradation compared to wtIGFBP3. Because the IGFBP3 te rtiary structure is important for high affinity IGF1 binding, the ami no acid changes were designed to be relatively conservative. This was justified by demonstratin g that all mutant IGFBPs retained or improved IGF1 binding. Results also indicated that the hydroxyl group of the Tyr128 at the proteolytic cleavage site was important for MMP2 activity, as evidenced by resistance to MMP2 in all mutant IGFBP3s with the Tyr128 Phe128 amino acid change. Compared to wtIGFBP3, Mutant 1 and Mutant 2 showed significant increases in IGF1 binding but also demonstrated higher susceptibility to MMP2 proteolysis, while Muta nt 4 and Mutant 5 showed significantly better resistance to MMP2 proteolysis bu t did not bind as much IGF1. Mu tant 3 demonstrated to be the most effective mutIGFBP3 due to its high IGF1 bi nding, resistance to MMP2 proteolysis, as well as increased inhibition of cell growth when expressed in rat glioma cells.

PAGE 63

63 Figure 6-1. MMP2 cleavage site in IGFBP3 and mutations induced by site-directed mutagenesis. Figure 6-2. IGF1 binding in presence of MMP2 inhibitor. Conditioned media of wtIGFBP3, mutIGFBP3 and control transfected cells treated with an MMP2 inhibitor were immunoprecipitated and analyzed by ELISA to measure IGF1/IGFBP3 binding. = p<0.05 when compared to no treatment. = p<0.05 when compared to wild type.

PAGE 64

64 Figure 6-3. IGF1 binding in presence of reco mbinant MMP2. Conditioned media of wtIGFBP3, mutIGFBP3 and control transfected cells following recombinant MMP2 treatment were immunoprecipitated a nd analyzed by ELISA to measure IGF1/IGFBP3 binding. = p<0.05 when compared to no treatment. = p<0.05 when compared to wild type. Figure 6-4. IGF1 binding in presence of MMP2 inhibitor and recombinant MMP2. Conditioned media of wtIGFBP3, mutIGFBP3 and c ontrol transfected cells following MMP2 inhibitor and recombinant MMP2 treatment were immunoprecipitated and analyzed by ELISA to measure IGF1/IGFBP3 bi nding. = p<0.05 when compared to no treatment. = p<0.05 when compared to wild type.

PAGE 65

65 Figure 6-5. RG2 cell growth after transfection with Mutant 0 IGFB P3. Growth in complete (A) and serum-free (B) media was measured by total DNA assay. = p<0.05. B A

PAGE 66

66 Figure 6-6. Sequencing data of mutIGFBP3 (M utant 1) expression plasmid. Box indicates position of nucleotide mutagenesis with resulting amino acid change. Amino acid structure is illustrated below. Figure 6-7. RG2 cell growth after transfection with Mutant 1 IGFB P3. Growth in complete (A) and serum-free (B) media was measured by total DNA assay. = p<0.05. A B

PAGE 67

67 Figure 6-8. Sequencing data of mutIGFBP3 (M utant 2) expression plasmid. Box indicates position of nucleotide mutagenesis with resulting amino acid change. Amino acid structure is illustrated below. Figure 6-9. RG2 cell growth after transfection with Mutant 2 IGFB P3. Growth in complete (A) and serum-free (B) media was measured by total DNA assay. = p<0.05. A B

PAGE 68

68 Figure 6-10. Sequencing data of mutIGFBP3 (M utant 3) expression plasmid. Box indicates position of nucleotide mutagenesis with resulting amino acid change. Amino acid structure is illustrated below. Figure 6-11. RG2 cell growth afte r transfection with Mutant 3 IG FBP3. Growth in complete (A) and serum-free (B) media was measured by total DNA assay. = p<0.05. A B

PAGE 69

69 Figure 6-12. Sequencing data of mutIGFBP3 (M utant 4) expression plasmid. Box indicates position of nucleotide mutagenesis with resulting amino acid change. Figure 6-13. RG2 cell growth afte r transfection with Mutant 4 IG FBP3. Growth in complete (A) and serum-free (B) media was measured by total DNA assay. = p<0.05. A B

PAGE 70

70 Figure 6-14. Sequencing data of mutIGFBP3 (M utant 5) expression plasmid. Box indicates position of nucleotide mutagenesis with resulting amino acid change. Figure 6-15. RG2 cell growth afte r transfection with Mutant 5 IG FBP3. Growth in complete (A) and serum-free (B) media was measured by total DNA assay. = p<0.05. A B

PAGE 71

71 APPENDIX A GENESWITCH Introduction Gene therapy generally involves the delivery of nucleotides in to cells for either protein expression or gene silencing. One part of the intricacies of successful therapy assim ilates DNA, RNA and delivery vehicle stability, cell specific uptake, efficient plasma and/or nuclear membrane entry and efficient endosomal or delivery vehicle release. Once the therapeutic DNA/RNA reaches its target tissue and overcomes these stability and cellular barriers, another part of successful therapy en tails tissue-specific gene e xpression or downregulation to therapeutic levels. Because a major concern for ge ne therapy research is constitutive expression that may lead to down-regulation of effector sy stems and cellular toxicity, a regulatory system for use in gene transfer was developed.159-162 Earlier developments of gene expression systems have successfully utilized methods of regulati on but have several disa dvantages. The Cre-Lox recombination163-170 and FLP-FRT recombination171-179 systems are useful for efficient gene knockout but their activity is irreversible once recombination occurs. Therefore, these systems are more valuable for generating knockout animal m odels rather than therapeutic applications to human disease states. Te t-OFF and Tet-ON systems180-192 utilize the tetracycline responsive element and tetracycline repressor/VP16 fusion pr oteins that are capable of repressing or inducing gene expression upon exposure to te tracycline or doxycyclin e. Although the Tet systems have a very tight control on expression, the major disadvantages are the tetracycline/doxycycline doses that may cause pleiotropic or toxic effects to the host organism. These limitations have lead to the development of other gene expression systems such as the steroid regulated GeneSwitch.

PAGE 72

72 Scientists who developed the GeneSwitch de scribed the desired characteristics of a coupled regulatory system to in clude: a regulator that should be activated upon administration of a ligand and terminated upon removal of the ligand; a ligand that is non-toxic and active upon oral administration; and compone nts that do not activate other endogenous cellular genes. The GeneSwitch is a two plasmid system consisti ng of pGene and pSwitch. The pGene is an inducible expression plasmid containing the gene of interest under the co ntrol of a yeast Gal4 upstream activating sequence (UAS) and a TATA box sequence from the adenovirus major late E1b gene. The pSwitch encodes a regulatory fu sion protein consisting of the yeast Gal4 DNA binding domain (DBD), human progesterone li gand binding domain (LBD), and human NFprotein activation domain (AD). The regulator protein is under the control of a Gal4 UAS and minimal promoter from a HSV thymidine kinase gene which allows ba sal expression of an inactive form that is localized in the nucleus. Addition of a steroid, mifepristone, binds to the progesterone LBD to cause a conformational change and dimerization. This activated homodimer then binds to the Gal4 UAS of th e pGene plasmid allowing recruitment of RNA polymerase to the TATA box for tran scription initiation of the gene of interest. The Gal4 UAS located in the pSwitch allows a positive feedb ack loop for amplificati on of gene expression. Because the Gal4 UAS and DBD are from yeast and not found in mammalian cells, the binding interactions are specific for this system only, therefore any potential pleiotropic effects are reduced. The ligand, mifepristone, is a synthetic steroi d that acts as a proge sterone antagonist at high doses,193-197 but at low concentrations acts as a GeneSwitch agonist with a high binding affinity (Kd ~ 30nM).198 A clinical oral dose of 200mg (~10mg/kg) normally results in 1uM serum concentrations. The concentrations used for GeneSwitch ac tivation are 1000X lower

PAGE 73

73 when used in vitro (10nM) and 100X lower when 5-70ug/kg (1nm) doses are used via IP administration in mice.199, 200 Although mifepristone can bi nd to endogenous progesterone and glucocorticoid receptors, the concentrations used to induce the Gene Switch would minimize pleiotropic or toxic effects. Materials and Methods RG2 cells were cultured in m edia contai ning Hygromycin (Cellgro) and Zeocin (Invitrogen) to determine antibiotic sensitivity. Cells were plated in 6-well plates and incubated at 37C with CO2 for 10 days in complete growth media containing 10ug/mL Hygromycin or 50ug/mL Zeocin. Media and antibiotics were replaced every 48 hours. Cell killing was monitored by estimating the amount of cells that remain attached to the wells. The pSwitch plasmid, pGene plasmid and mifepr istone were purchased from Invitrogen. The pSwitch plasmid (Figure A-1A) was linearize d with SapI and purified by phenol/chloroform phase separation and ethanol precipitation. RG2 cel ls were transfected in a 6-well plate with linear pSwitch, using Lipid89/LXS cationic lipids (Cha pter 2). Cells were se lected by incubation in complete growth media containing 600ug/mL Hygromycin (Cellgro) for 10 days. Each well was then transferred into 96-well plates by seeding at densities of 1 cell/well, 10cells/well, 25cells/well and 100cells/well. Growth was m onitored closely over a period of two weeks by tracking wells containing only one colony. 12 co lonies were expanded by transferring into 25cm2 flasks. Cells were cryopreserved in li quid nitrogen until ready for subsequent transfections. Stable RG2/pSwitch cells were thawed and tran sfected with -galactos idase reporter gene, pGene/LacZ (Figure A-1B), using Lipid89/LXS. Cells were incubated in complete growth media (with Hygromycin) for 24 hours to allow pl asmid uptake. -galactosidase expression was induced by adding 10nM mifepristone followed by another 24 hour incubation. Expression was

PAGE 74

74 visualized using -gal staining k it (Invitrogen) according to manuf acturers protocol. Controls included RG2 cells that were transfected with only the pGene/LacZ plasmid and non-transfected RG2 cells. Images were taken from Nikon inverted microscope at 100X magnification. Results Rat Glioma Cell Sensitivity to Selective Antibiotics RG2 cells were subjecte d to antibiotics to de termine the dose required to kill all sensitive cells within a period of 10 days. Several doses of Hygromycin were tested, where the 600ug/mL dose demonstrated to be the lowest dose to effect ively kill all cells (Figure A-2A). Several doses of Zeocin were also tested, where the 750ug/mL dose demonstrated to be the lowest dose to effectively kill all cells (Figure A-2B). The remaining 25% cell confluency in the Zeocin treatments were due to cells that remained a ttached but were no longer viable as indicated by morphology changes such as plasma and nuclear membrane degradation. In subsequent experiments, 600ug/mL Hygromycin and 750ug/mL Ze ocin were used for stable RG2 selection. Mifepristone Regulated Expression of -galactosidase The GeneSwitch system expressing a -galactos idase repo rter gene was incorporated into RG2 cells by stable transfections. RG2 cells tr ansfected with both the pGene/LacZ and pSwitch plasmids showed ~20X increased expression wh en induced with 10nM mifepristone (Figure A3A) compared to basal expressi on in non-induced cells (Figure A3B). RG2 cells transfected with only pGene/LacZ showed basal expression in mifeprist one-induced and non-induced cells (Figure A-3C,D). Non-transfected RG2 cells showed no -galactosidase staining (Control). Discussion The application of gene therapy to hum an di sease states will require efficient gene delivery, uptake, expression, and just as critical regulation of gene e xpression. These studies utilized the GeneSwitch to establish a steroid in ducible expression system in a rat glioblastoma

PAGE 75

75 cell culture model. After demonstrating its capab ilities, other genes may be incorporated into this system to utilize as a research tool to id entify and characterize esse ntial oncolytic genes or apply therapeutically as a treatment that would require differing expression levels.

PAGE 76

76 Figure A-1. GeneSwitch plasmids. (A) pSwitc h plasmid containing GeneSwitch regulatory fusion protein under the minimal TK pr omoter, Gal4 UAS, and Hygromycin resistance. (B) pGene plasmid containing LacZ reporter gene, Gal4 UAS and TATA box, and Zeocin resistance. 0 25 50 75 100 123456789101112 DayApprox. % Confluenc y 0 ug/mL 10 ug/mL 50 ug/mL 100 ug/mL 200 ug/mL 400 ug/mL 600 ug/mL 0 25 50 75 100 123456789101112 DayApprox. % Confluenc y 0 ug/mL 50 ug/mL 125 ug/mL 250 ug/mL 500 ug/mL 750 ug/mL 1000 ug/mL Figure A-2. Antibiotic sensitivity in RG2 ce lls. (A) RG2 sensitivity to several doses of Hygromycin. (B) RG2 sensitivity to several doses of Zeocin. A B A B

PAGE 77

77 Figure A-3. RG2 GeneSwitch stable cell line expr essing -galactosidase. RG2 cells transfected with pSwitch and pGene/LacZ (A) induced with mifepris tone and (B) non-induced cells. RG2 cells transfected with pGene/LacZ only, (C) i nduced and (D) non-induced. Control was non-tran sfected RG2 cells. A C D B

PAGE 78

78 APPENDIX B BUFFERS AND REAGENTS Rat Gliom a (RG2) Cell Culture Complete Growth Media o DMEM (Cellgro) o 10% Fetal Bovine Serum (HyClone) o 1% Penicillin/Streptomycin (Cellgro) Serum-free Media o DMEM o 1% Penicillin/Streptomycin Serum-free Media (PC-1) o PC-1 Supplement o 4mM L-Glutamine o 1% Penicillin/Streptomycin Dubecos Phosphate Buffered Saline (DPBS) o 8.0 g/L Sodium Chloride o 1.15 g/L Sodium Phosphate Diabasic o 0.20 g/L Potassium Chloride o 0.20 g/L Potassium Phosphate Monobasic o 0.10 g/L Magnesium Chloride o 0.10 g/L Calcium Chloride

PAGE 79

79 Transfection Reagent (Lipid89/LXS) o 0.038 umol/uL Lipid 89 (Genzyme) o 0.365 umol/uL Lym-X-Sorb (Avanti) o 0.0137 umol/uL Vitamin E Cell Lysis Buffer o 50 mM Tris (pH 7.8) o 150 mN NaCl o 1% (v/v) Triton X100 o 1% (v/v) Protease Inhibitor Cocktail (Sigma) Laemmli Sample Buffer (2X) o 4% SDS o 20% glycerol o 10% 2-mercaptoethanol o 0.004% bromphenol blue o 0.125 M Tris HCl (pH 6.8) Electrophoresis Running Buffer o 25mM Tris (pH 8.3) o 192mM Glycine o 0.1% (w/v) SDS Transfer Buffer o 25 mM Tris (pH 8.3) o 192 mM Glycine

PAGE 80

80 o 20% (v/v)Methanol Tris-Buffered Saline with Tween 20 (TBST) o 20 mM Tris (pH 7.6) o 137 mM NaCl o 0.1% Tween 20 Blocking Buffer o 10% (w/v) Non-fat Dry Milk o 1X TBST Blotting Buffer o 1% (w/v) Non-fat Dry Milk o 1X TBST HEPES Buffered Saline (HBS) o 7.5 mM HEPES (pH 7.4) o 100 mM NaCl

PAGE 81

81 LIST OF REFERENCES 1. CBTRUS (2004). Statistical Report: Primary Brain Tumors in the United States, 19972001. Published by the Central Brain Tumo r Registry of the United States. 2. Relling, M. V., Rubnitz, J. E., Rivera, G. K., Boyett, J. M., Hancock, M. L., Felix, C. A., et al. (1999). High incidence of secondary brain tumours after ra diotherapy and antimetabolites. Lancet 354: 34-39. 3. Nitta, T., and Sato, K. (1995). Prognostic impli cations of the extent of surgical resection in patients with intracranial malignant gliomas. Cancer 75: 2727-2731. 4. DeAngelis, L. M. (2001). Brain tumors. The New England journal of medicine 344: 114123. 5. Rickman, D. S., Bobek, M. P., Misek, D. E., Ku ick, R., Blaivas, M., Kurnit, D. M., et al. (2001). Distinctive molecular profiles of high-grade and low-grade gliomas based on oligonucleotide microarray analysis. Cancer research 61: 6885-6891. 6. Hoelzinger, D. B., Mariani, L., Weis, J., Woyke, T., Berens, T. J., McDonough, W. S., et al. (2005). Gene expression profile of glioblastoma multiforme invasive phenotype points to new therapeutic targets. Neoplasia (New York, N.Y 7: 7-16. 7. Zumkeller, W., and Westpha l, M. (2001). The IGF/IGFBP system in CNS malignancy. Mol Pathol 54: 227-229. 8. Komatsu, K., Nakanishi, Y., Nemoto, N., Hori, T., Sawada, T., and Kobayashi, M. (2004). Expression and quantitative analysis of matrix metalloproteinase -2 and -9 in human gliomas. Brain tumor pathology 21: 105-112. 9. Thorns, V., Walter, G. F., and Thorns, C. (2003). Expression of MMP-2, MMP-7, MMP9, MMP-10 and MMP-11 in human astrocyt ic and oligodendroglial gliomas. Anticancer research 23: 3937-3944. 10. LeRoith, D., and Roberts, C. T., Jr. (2003). The insulin-like growth factor system and cancer. Cancer letters 195: 127-137. 11. Pollak, M. (2007). Insulin-like growth factor-related signaling and cancer development. Recent results in cancer resear ch. Fortschritte der Krebsforschung 174: 49-53. 12. Pollak, M. N. (2004). Insulin-lik e growth factors and neoplasia. Novartis Foundation symposium 262: 84-98; discussion 98-107, 265-108. 13. Hellawell, G. O., Turner, G. D., Davies, D. R., Poulsom, R., Brewster, S. F., and Macaulay, V. M. (2002). Expression of the type 1 insulin-like growth factor receptor is up-

PAGE 82

82 regulated in primary prostate cancer and co mmonly persists in metastatic disease. Cancer research 62: 2942-2950. 14. Rochester, M. A., Riedemann, J., Hellawell, G. O., Brewster, S. F., and Macaulay, V. M. (2005). Silencing of the IGF1R gene enhances sensitivity to DNA-damaging agents in both PTEN wild-type and mutant human prostate cancer. Cancer gene therapy 12: 90-100. 15. Firth, S. M., and Baxter, R. C. (2002). Cellula r actions of the insulin -like growth factor binding proteins. Endocrine reviews 23: 824-854. 16. Devi, G. R., Yang, D. H., Rosenfeld, R. G ., and Oh, Y. (2000). Differential effects of insulin-like growth factor (IG F)-binding protein-3 and its pr oteolytic fragments on ligand binding, cell surface association, and IGF-I receptor signaling. Endocrinology 141: 4171-4179. 17. Spoerri, P. E., Caballero, S., Wilson, S. H., Shaw, L. C., and Grant, M. B. (2003). Expression of IGFBP-3 by human retinal endothelial cell cultur es: IGFBP-3 involvement in growth inhibition and apoptosis. Investigative ophthalmol ogy & visual science 44: 365-369. 18. Lee, K. W., Ma, L., Yan, X., Liu, B., Zhang, X. K., and Cohen, P. (2005). Rapid apoptosis induction by IGFBP3 involves an insulin-like growth factor-independent nucleomitochondrial translocation of RXRalpha/Nur77. The Journal of biological chemistry 280: 16942-16948. 19. Conover, C. A. (1992). Potentiation of insu lin-like growth factor (IGF) action by IGFbinding protein-3: studies of underlying mechanism. Endocrinology 130: 3191-3199. 20. Mira, E., Manes, S., Lacalle, R. A., Marquez, G., and Martinez, A. C. (1999). Insulin-like growth factor I-triggered cell migration and invasion are mediat ed by matrix metalloproteinase9. Endocrinology 140: 1657-1664. 21. Manes, S., Llorente, M., Lacalle, R. A., Go mez-Mouton, C., Kremer, L., Mira, E., et al. (1999). The matrix metalloproteinase-9 regulat es the insulin-like gr owth factor-triggered autocrine response in DU-145 carcinoma cells. The Journal of biological chemistry 274: 69356945. 22. Miyamoto, S., Yano, K., Sugimoto, S., Ish ii, G., Hasebe, T., Endoh, Y., et al. (2004). Matrix metalloproteinase-7 facilitates insulin-like growth factor bioavailability through its proteinase activity on insulin-like growth factor binding protein 3. Cancer research 64: 665-671. 23. Fowlkes, J. L., Enghild, J. J., Suz uki, K., and Nagase, H. (1994). Matrix metalloproteinases degrade insulin-like growth factor-binding protein3 in dermal fibroblast cultures. The Journal of biological chemistry 269: 25742-25746. 24. Andrews, D. W., Resnicoff, M., Flanders, A. E., Kenyon, L., Curtis, M., Merli, G., et al. (2001). Results of a pilot study in volving the use of an antisense oligodeox ynucleotide directed against the insulin-like grow th factor type I receptor in malignant astrocytomas. J Clin Oncol 19: 2189-2200.

PAGE 83

83 25. Shaw, L. C., Afzal, A., Lewin, A. S., Timmers, A. M., Spoerri, P. E., and Grant, M. B. (2003). Decreased expression of the insulin-like gr owth factor 1 receptor by ribozyme cleavage. Investigative ophthalmology & visual science 44: 4105-4113. 26. Imai, Y., Moralez, A., Andag, U., Clarke, J. B., Busby, W. H., Jr., and Clemmons, D. R. (2000). Substitutions for hydrophobic amino acids in the N-terminal domains of IGFBP-3 and -5 markedly reduce IGF-I binding a nd alter their biologic actions. The Journal of biological chemistry 275: 18188-18194. 27. Imai, Y., Busby, W. H., Jr., Sm ith, C. E., Clarke, J. B., Garm ong, A. J., Horwitz, G. D., et al. (1997). Protease-resistant form of insulin-like growth factor-binding protei n 5 is an inhibitor of insulin-like growth factor-I actions on porcine smooth muscle cells in culture. The Journal of clinical investigation 100: 2596-2605. 28. Riedemann, J., Sohail, M., and Macaulay, V. M. (2007). Dual silencing of the EGF and type 1 IGF receptors suggests dominance of IGF signaling in human breast cancer cells. Biochemical and biophysical research communications 355: 700-706. 29. Shin, A., Ren, Z., Shu, X. O., Cai, Q., Ga o, Y. T., and Zheng, W. (2006). Expression patterns of insulin-like growth factor 1 (IGF-I) and its receptor in mammary tissues and their associations with breast cancer survival. Breast Cancer Res Treat 30. Sarfstein, R., Maor, S., Reizner, N., Abramovitch, S., and Werner, H. (2006). Transcriptional regulation of the insulin-like gr owth factor-I receptor gene in breast cancer. Molecular and cellu lar endocrinology 252: 241-246. 31. Jones, H. E., Goddard, L., Gee, J. M., Hi scox, S., Rubini, M., Barrow, D., et al. (2004). Insulin-like growth factor-I recep tor signalling and acquired resi stance to gefitinib (ZD1839; Iressa) in human breast and prostate cancer cells. Endocrine-related cancer 11: 793-814. 32. Sachdev, D., Singh, R., Fujita-Yamaguchi, Y ., and Yee, D. (2006). Down-regulation of insulin receptor by antibodies against the type I in sulin-like growth factor receptor: implications for anti-insulin-like growth factor therapy in breast cancer. Cancer research 66: 2391-2402. 33. Sachdev, D., and Yee, D. (2006). Inhibitors of insulin-like growth factor signaling: a therapeutic approach for breast cancer. Journal of mammary gl and biology and neoplasia 11: 2739. 34. Li, M., He, Z., Ermakova, S., Zheng, D., Tang, F., Cho, Y. Y., et al. (2007). Direct inhibition of insulin-like growth factor-I receptor kinase activity by (-)-epigallocatechin-3-gallate regulates cell transformation. Cancer Epidemiol Biomarkers Prev 16: 598-605. 35. Sulkowski, S., Kanczuga-Koda, L., Koda, M., Wincewicz, A., and Sulkowska, M. (2006). Insulin-like growth factor-I receptor corr elates with connexin 26 and Bcl-xL expression in human colorectal cancer. Annals of the New York Academy of Sciences 1090: 265-275.

PAGE 84

84 36. Koda, M., Reszec, J., Sulkowska, M., Kanczuga-Koda, L., and Sulkowski, S. (2004). Expression of the insulin-like grow th factor-I receptor and proapopt otic Bax and Bak proteins in human colorectal cancer. Annals of the New York Academy of Sciences 1030: 377-383. 37. Sekharam, M., Zhao, H., Sun, M., Fang, Q., Zhang, Q., Yuan, Z., et al. (2003). Insulinlike growth factor 1 receptor e nhances invasion and induces resi stance to apoptosis of colon cancer cells through the Akt/Bcl-x(L) pathway. Cancer research 63: 7708-7716. 38. Sekharam, M., Nasir, A., Kaiser, H. E., and Coppola, D. (2003). Insulin-like growth factor 1 receptor activates c-SRC and modifies transformation and motility of colon cancer in vitro. Anticancer research 23: 1517-1524. 39. Reinmuth, N., Fan, F., Liu, W., Parikh, A. A ., Stoeltzing, O., Jung, Y. D., et al. (2002). Impact of insulin-like growth f actor receptor-I function on angioge nesis, growth, and metastasis of colon cancer. Laboratory investigation; a journal of techni cal methods and pathology 82: 1377-1389. 40. Reinmuth, N., Liu, W., Fan, F., Jung, Y. D., Ahmad, S. A., Stoeltzing, O., et al. (2002). Blockade of insulin-like growth factor I receptor func tion inhibits growth and angiogenesis of colon cancer. Clin Cancer Res 8: 3259-3269. 41. Adachi, Y., Lee, C. T., Coffee, K., Yamagata, N., Ohm, J. E., Park, K. H., et al. (2002). Effects of genetic blockade of the insulin-like growth factor receptor in human colon cancer cell lines. Gastroenterology 123: 1191-1204. 42. Wu, Y., Yakar, S., Zhao, L., Hennighause n, L., and LeRoith, D. (2002). Circulating insulin-like growth factor-I levels regulate colon cancer growth and metastasis. Cancer research 62: 1030-1035. 43. Kelly, R. G., Nally, K., Shanahan, F., and O'Connell, J. (2002). Type I insulin-like growth factor receptor expre ssion on colorectal adenocarcinoma cell lines is decreased in response to the chemopreventiv e agent N-acetyl-l-cysteine. Annals of the New York Academy of Sciences 973: 555-558. 44. Fang, J., Zhou, Q., Shi, X. L., and Jiang, B. H. (2007). Luteolin inhibits insulin-like growth factor 1 receptor signa ling in prostate cancer cells. Carcinogenesis 28: 713-723. 45. Liu, B., Lee, K. W., Anzo, M., Zhang, B., Zi, X., Tao, Y., et al. (2007). Insulin-like growth factor-binding protein-3 inhibition of pr ostate cancer growth i nvolves suppression of angiogenesis. Oncogene 26: 1811-1819. 46. Wu, J. D., Haugk, K., Coleman, I., Woodke, L ., Vessella, R., Nelson, P., et al. (2006). Combined in vivo effect of A12, a type 1 in sulin-like growth factor receptor antibody, and docetaxel against prostate cancer tumors. Clin Cancer Res 12: 6153-6160. 47. Marelli, M. M., Moretti, R. M., Procacci, P ., Motta, M., and Limonta, P. (2006). Insulinlike growth factor-I promotes migration in human androgen-independent pr ostate cancer cells via

PAGE 85

85 the alphavbeta3 integrin and PI3-K/Akt signaling. International journal of oncology 28: 723730. 48. Kawada, M., Inoue, H., Masuda, T., and Ikeda, D. (2006). Insulinlike growth factor I secreted from prostate stromal cells mediates tu mor-stromal cell interacti ons of prostate cancer. Cancer research 66: 4419-4425. 49. Chen, C., Freeman, R., Voigt, L. F., Fitzpatr ick, A., Plymate, S. R., and Weiss, N. S. (2006). Prostate cancer risk in re lation to selected ge netic polymorphisms in insulin-like growth factor-I, insulin-like growth factor binding protei n-3, and insulin-like growth factor-I receptor. Cancer Epidemiol Biomarkers Prev 15: 2461-2466. 50. Papatsoris, A. G., Karamouzis, M. V., a nd Papavassiliou, A. G. (2005). Novel insights into the implication of the IGF-1 network in prostate cancer. Trends in molecular medicine 11: 52-55. 51. Zhao, H., Dupont, J., Yakar, S., Karas, M., and LeRoith, D. (2004). PTEN inhibits cell proliferation and induces apoptosis by downregulating cell surface IGF-IR expression in prostate cancer cells. Oncogene 23: 786-794. 52. Roberts, C. T., Jr. (2004). IGF-1 and prostate cancer. Novartis Foundation symposium 262: 193-199; discussion 199-204, 265-198. 53. Cardillo, M. R., Monti, S., Di Silverio, F ., Gentile, V., Sciarra, F., and Toscano, V. (2003). Insulin-like growth factor (IGF)-I, IGF-II and IGF type I receptor (IGFR-I) expression in prostatic cancer. Anticancer research 23: 3825-3835. 54. Qian, J., Dong, A., Kong, M., Ma, Z., Fan, J., and Jiang, G. (2007). Suppression of type 1 Insulin-like growth factor rece ptor expression by small interf ering RNA inhibits A549 human lung cancer cell invasion in vitro a nd metastasis in xenograft nude mice. Acta biochimica et biophysica Sinica 39: 137-147. 55. Cappuzzo, F., Toschi, L., Tallini, G., Ceresoli, G. L., Domenichini, I., Bartolini, S., et al. (2006). Insulin-like growth factor receptor 1 (IGFR-1) is signifi cantly associated with longer survival in non-small-cell lung cance r patients treated with gefitinib. Ann Oncol 17: 1120-1127. 56. Lee, C. T., Park, K. H., Adachi, Y., Seol, J. Y., Yoo, C. G., Kim, Y. W., et al. (2003). Recombinant adenoviruses expressing dominant negative insulin-like growth factor-I receptor demonstrate antitumor effects on lung cancer. Cancer gene therapy 10: 57-63. 57. Dong, A. Q., Kong, M. J., Ma, Z. Y., Qian, J. F., and Xu, X. H. (2006). Down-regulation of IGF-IR using small, interfering, hairpin RNA (siRNA) inhibits growth of human lung cancer cell line A549 in vitro and in nude mice. Cell Biol Int 58. Wilson, T. J., Nahas, M., Araki, L., Harusa wa, S., Ha, T., and Lilley, D. M. (2007). RNA folding and the origins of catalytic activity in the hairpin ribozyme. Blood cells, molecules & diseases 38: 8-14.

PAGE 86

86 59. Vashishta, A., Ohri, S. S., Proctor, M ., Fusek, M., and Vetvicka, V. (2007). Ribozymetargeting procathepsin D and its effect on in vasion and growth of breast cancer cells: An implication in breast cancer therapy. International journal of oncology 30: 1223-1230. 60. Tahira, Y., Fukuda, N., Endo, M., Ueno, T ., Matsuda, H., Saito, S., et al. (2007). Chimeric DNA-RNA hammerhead ribozyme targeti ng transforming growth factor-beta1 mRNA ameliorates renal injury in hypertensive rats. Journal of hypertension 25: 671-678. 61. Sano, M., and Taira, K. (2007). Hammer head ribozyme-based target discovery. Methods in molecular biology (Clifton, N.J 360: 143-153. 62. Robertson, M. P., and Scott, W. G. (2007). The structural basis of ribozyme-catalyzed RNA assembly. Science (New York, N.Y 315: 1549-1553. 63. Li, Q. X., Tan, P., Ke, N., and Wong-Sta al, F. (2007). Ribozyme technology for cancer gene target identific ation and validation. Advances in cancer research 96: 103-143. 64. Chen, L., Li, J., Zhang, X., Liu, Q., Yin, J., Ya o, L., et al. (2007). Inhi bition of krr1 gene expression in Giardia canis by a vi rus-mediated hammerhead ribozyme. Veterinary parasitology 143: 14-20. 65. Menon, R. P., Menon, M. R., Shi-Wen, X., Renzoni, E., Bou-Gharios, G., Black, C. M., et al. (2006). Hammerhead ribozymemediated silencing of the muta nt fibrillin-1 of tight skin mouse: insight into the functional role of mutant fibrillin-1. Experimental cell research 312: 1463-1474. 66. Khan, A. U. (2006). Ribozyme: a clinical tool. Clinica chimica acta; international journal of clinical chemistry 367: 20-27. 67. Jung, H. S., and Lee, S. W. (2006). Ribozymemediated selective kil ling of cancer cells expressing carcinoembryonic antige n RNA by targeted trans-splicing. Biochemical and biophysical research communications 349: 556-563. 68. Song, Y. H., Zhou, X. M., Xue, X. N., Liu, N. Z., Tian, D. A., Kong, X. J., et al. (2005). Effect of ribozyme against transforming growth factorbeta1 on biological character of activated HSCs. IUBMB life 57: 31-39. 69. Qian, S., Somlo, G., Zhou, B., Zhu, L., Mi, S ., Mo, X., et al. (2005). Ribozyme cleavage leads to decreased expression of fibroblast grow th factor receptor 3 in human multiple myeloma cells, which is associated with apoptosis and downregulation of vascul ar endothelial growth factor. Oligonucleotides 15: 1-11. 70. Malerczyk, C., Schulte, A. M., Czubayko, F., Be llon, L., Macejak, D., Riegel, A. T., et al. (2005). Ribozyme targeting of the growth factor pleiotrophin in establ ished tumors: a gene therapy approach. Gene therapy 12: 339-346.

PAGE 87

87 71. Liu, J., Timmers, A. M., Lewin, A. S., and Hauswirth, W. W. (2005). Ribozyme knockdown of the gamma-subunit of rod cGMP phos phodiesterase alters the ERG and retinal morphology in wild-type mice. Investigative ophthalmology & visual science 46: 3836-3844. 72. Kumar, R., Dammai, V., Ya dava, P. K., and Kleinau, S. (2005). Gene targeting by ribozyme against TNF-alpha mRNA inhibits autoimmune arthritis. Gene therapy 12: 1486-1493. 73. Katona, R. L., Cserpan, I., Fatyol, K., Csonka, E., and Hadlaczky, G. (2005). Transgenic mice, carrying an expressed anti-HIV ribozyme in their genome, show no sign of phenotypic alterations. Acta biologica Hungarica 56: 67-74. 74. Gorbatyuk, M. S., Pang, J. J., Thomas, J., Jr., Hauswirth, W. W., and Lewin, A. S. (2005). Knockdown of wild-type m ouse rhodopsin using an AAV vect ored ribozyme as part of an RNA replacement approach. Molecular vision 11: 648-656. 75. Callison, S. A., Hilt, D. A., and Jackwood, M. W. (2005). In vitro analysis of a hammerhead ribozyme targeted to infecti ous bronchitis virus nucleocapsid mRNA. Avian diseases 49: 159-163. 76. Zhang, Q., Ohannesian, D. W., and Eric kson, L. C. (2004). Hammerhead ribozymemediated sensitization of human tumor cells af ter treatment with 1,3-bis(2-chloroethyl)-1nitrosourea. The Journal of pharmacology and experimental therapeutics 309: 506-514. 77. Yamazaki, H., Handa, A., Nishi, M., Tokunaga T., Tomisawa, M., Hatanaka, H., et al. (2004). Ribozyme mediated down -regulation of thrombospondin receptor CD36 inhibits the growth of the human osteosarcoma cell line. Oncology reports 11: 371-374. 78. Shaw, L. C., Pan, H., Afzal, A., Calzi, S. L., Spoerri, P. E., Sullivan, S. M., et al. (2006). Proliferating endothelial cell-sp ecific expression of IGF-I receptor ribozyme inhibits retinal neovascularization. Gene therapy 13: 752-760. 79. Qiao, J., Moreno, J., Sanchez-Perez, L., Ko ttke, T., Thompson, J., Caruso, M., et al. (2006). VSV-G pseudotyped, MuLV-based, semi-re plication-competent retrovirus for cancer treatment. Gene therapy 13: 1457-1470. 80. Jia, F., Zhang, Y. Z., and Liu, C. M. (2006). A retrovirus-based system to stably silence hepatitis B virus genes by RNA interference. Biotechnology letters 28: 1679-1685. 81. Finger, C., Sun, Y., Sanz, L., Alvarez-Vallin a, L., Buchholz, C. J., and Cichutek, K. (2005). Replicating retroviral vectors mediating continuous production and secretion of therapeutic gene produc ts from cancer cells. Cancer gene therapy 12: 464-474. 82. Dalba, C., Klatzmann, D., Logg, C. R., and Kasahara, N. (2005). Beyond oncolytic virotherapy: replication-competen t retrovirus vectors for selec tive and stable transduction of tumors. Current gene therapy 5: 655-667. 83. Anderson, J. L., and Hope, T. J. (2005). Intr acellular trafficking of retroviral vectors: obstacles and advances. Gene therapy 12: 1667-1678.

PAGE 88

88 84. Hamada, K., Desaki, J., Nakagawa, K., Zhang, T., Shirakawa, T., Gotoh, A., et al. (2007). Carrier Cell-mediated Delivery of a Replication-competent Adenovirus for Cancer Gene Therapy. Mol Ther. 85. Kholova, I., Koota, S., Kaskenpaa, N., Leppa nen, P., Narvainen, J., Kavec, M., et al. (2007). Adenovirus-mediated gene transfer of human vascular endothelial growth factor-d induces transient angiogenic e ffects in mouse hind limb muscle. Human gene therapy 18: 232244. 86. Othman, E. E., Salama, S., Ismail, N., and Al-Hendy, A. (2007). Toward gene therapy of endometriosis: adenovirus-mediated delivery of dominant negative estrogen receptor gene inhibits cell proliferation, redu ces cytokine production, and indu ces apoptosis of endometriotic cells. Fertil Steril. 87. Kinoshita, K., Iimuro, Y., Fujimoto, J., Inag aki, Y., Namikawa, K., Kiyama, H., et al. (2007). Targeted and regulable expression of transgenes in hepatic stella te cells and myofibroblasts in culture and in vivo using an adenoviral Cre /loxP system to antagonise hepatic fibrosis. Gut 56: 396-404. 88. Wang, Y., Yang, Z., Liu, S., Kon, T., Krol, A., Li C. Y., et al. (2005). Characterisation of systemic dissemination of nonreplicating adenoviral vectors from tumours in local gene delivery. British journal of cancer 92: 1414-1420. 89. Cheng, H., Wolfe, S. H., Valencia, V., Qian, K., Shen, L., Phillips, M. I., et al. (2007). Efficient and persistent transduction of exocri ne and endocrine pancre as by adeno-associated virus type 8. J Biomed Sci. 90. Adriaansen, J., Khoury, M., de Cortie, C. J., Fa llaux, F. J., Bigey, P., Scherman, D., et al. (2007). Reduction of arthritis following intra-artic ular administration of an adeno-associated virus serotype 5 expressing a disease-inducible TNF-blocking agent. Ann Rheum Dis 91. Miller, D. G., Wang, P. R., Petek, L. M., Hira ta, R. K., Sands, M. S., and Russell, D. W. (2006). Gene targeting in vivo by ad eno-associated virus vectors. Nature biotechnology 24: 1022-1026. 92. Sumner-Jones, S. G., Davies, L. A., Varath alingam, A., Gill, D. R., and Hyde, S. C. (2006). Long-term persistence of gene expression from adeno-associated virus serotype 5 in the mouse airways. Gene therapy 13: 1703-1713. 93. Inagaki, K., Fuess, S., Storm, T. A., Gibs on, G. A., McTiernan, C. F., Kay, M. A., et al. (2006). Robust systemic transduction with AAV9 v ectors in mice: efficient global cardiac gene transfer superior to that of AAV8. Mol Ther 14: 45-53. 94. Broekman, M. L., Comer, L. A., Hyman, B. T., and Sena-Esteves, M. (2006). Adenoassociated virus vectors serotyped with AAV8 capsid are more efficient than AAV-1 or -2 serotypes for widespread gene delivery to the neonatal mouse brain. Neuroscience 138: 501-510.

PAGE 89

89 95. Apparailly, F., Khoury, M., Vervoordeldonk, M. J., Adriaansen, J., Gicquel, E., Perez, N., et al. (2005). Adeno-associated virus pseudot ype 5 vector improves gene transfer in arthritic joints. Human gene therapy 16: 426-434. 96. Neal, Z. C., Bates, M. K., Albertini, M. R., and Herweijer, H. (2007). Hydrodynamic limb vein delivery of a xenogeneic DNA cancer v accine effectively induces antitumor immunity. Mol Ther 15: 422-430. 97. Herweijer, H., and Wolff, J. A. (200 7). Gene therapy progress and prospects: hydrodynamic gene delivery. Gene therapy 14: 99-107. 98. Suda, T., Gao, X., Stolz, D. B., and Liu, D. (2007). Structural impact of hydrodynamic injection on mouse liver. Gene therapy 14: 129-137. 99. Chang, H., Hanawa, H., Liu, H., Yoshida, T., Hayashi, M., Watanabe, R., et al. (2006). Hydrodynamic-based delivery of an interleukin-22 -Ig fusion gene ameliorates experimental autoimmune myocarditis in rats. J Immunol 177: 3635-3643. 100. Sebestyen, M. G., Budker, V. G., Budker, T., Subbotin, V. M., Zhang, G., Monahan, S. D., et al. (2006). Mechanism of plasmid de livery by hydrodynamic tail vein injection. I. Hepatocyte uptake of various molecules. The journal of gene medicine 8: 852-873. 101. Arad, U., Zeira, E., El-Latif, M. A., Mukherj ee, S., Mitchell, L., Pappo, O., et al. (2005). Liver-targeted gene therapy by SV40-based vectors using the hydrodyna mic injection method. Human gene therapy 16: 361-371. 102. Wells, D. J. (2004). Opening the floodgates: clinically applicable hydrodynamic delivery of plasmid DNA to skeletal muscle. Mol Ther 10: 207-208. 103. Knapp, J. E., and Liu, D. (2004). Hydrodynamic delivery of DNA. Methods in molecular biology (Clifton, N.J 245: 245-250. 104. Li, W., and Szoka, F. C., Jr. (2007). Li pid-based Nanoparticles for Nucleic Acid Delivery. Pharm Res 105. Gvili, K., Benny, O., Danino, D., and Machluf, M. (2007). Poly(D,L-lactide-co-glycolide acid) nanoparticles for DNA delivery: Waivi ng preparation complexity and increasing efficiency. Biopolymers 85: 379-391. 106. Zuhorn, I. S., Engberts, J. B., and Hoekst ra, D. (2006). Gene delivery by cationic lipid vectors: overcoming cellular barriers. Eur Biophys J 107. Wasungu, L., and Hoekstra, D. (2006). Cationic lipids, lipoplexes and intracellular delivery of genes. J Control Release 116: 255-264. 108. Pietersz, G. A., Tang, C. K., and Apostol opoulos, V. (2006). Structure and design of polycationic carriers for gene delivery. Mini reviews in medicinal chemistry 6: 1285-1298.

PAGE 90

90 109. Karmali, P. P., and Chaudhuri, A. (2006). Cationic liposomes as non-viral carriers of gene medicines: Resolved issues, open questions, and future promises. Med Res Rev. 110. Zintchenko, A., and Konak, C. (2005). Interaction of DNA/polycation complexes with phospholipids: stabilizing st rategy for gene delivery. Macromolecular bioscience 5: 1169-1174. 111. Yoon, K. C., Ahn, K. Y., Lee, J. H., Chun, B. J., Park, S. W., Seo, M. S., et al. (2005). Lipid-mediated delivery of br ain-specific angiogenesis inhi bitor 1 gene reduces corneal neovascularization in an in vivo rabbit model. Gene therapy 12: 617-624. 112. Lungwitz, U., Breunig, M., Blunk, T., and Gopf erich, A. (2005). Polyethylenimine-based non-viral gene delivery systems. Eur J Pharm Biopharm 60: 247-266. 113. Hassani, Z., Lemkine, G. F., Erbacher, P., Palmier, K., Alfama, G., Giovannangeli, C., et al. (2005). Lipid-mediated siRNA delivery down-regulates exogenous gene expression in the mouse brain at picomolar levels. The journal of gene medicine 7: 198-207. 114. Garcia, L., Bunuales, M., Duzgunes, N., and Tros de Ilarduya, C. (2007). Serum-resistant lipopolyplexes for gene deliver y to liver tumour cells. Eur J Pharm Biopharm 115. Srinivasachari, S., Liu, Y., Prevette, L. E., and Reineke, T. M. (2007). Effects of trehalose click polymer length on pDNA co mplex stability and delivery efficacy. Biomaterials 28: 2885-2898. 116. Gambari, R. (2004). Biological activity a nd delivery of peptide nucleic acids (PNA)DNA chimeras for transcription f actor decoy (TFD) pharmacotherapy. Current medicinal chemistry 11: 1253-1263. 117. Kuo, J. H. (2003). Effect of Pluronic-block copolymers on th e reduction of serummediated inhibition of gene transfer of polyethyleneimine-DNA complexes. Biotechnology and applied biochemistry 37: 267-271. 118. Kim, J. K., Choi, S. H., Kim, C. O., Par k, J. S., Ahn, W. S., and Kim, C. K. (2003). Enhancement of polyethylene glycol (PEG)-m odified cationic liposome-mediated gene deliveries: effects on serum stabil ity and transfection efficiency. The Journal of pharmacy and pharmacology 55: 453-460. 119. Yi, S. W., Yune, T. Y., Kim, T. W., Chung, H ., Choi, Y. W., Kwon, I. C., et al. (2000). A cationic lipid emulsion/DNA complex as a physically stable and serum-resistant gene delivery system. Pharm Res 17: 314-320. 120. Turek, J., Dubertret, C., Jaslin, G., Antonakis, K., Scherman, D., and Pitard, B. (2000). Formulations which increase the size of lipoplex es prevent serum-associated inhibition of transfection. The journal of gene medicine 2: 32-40. 121. Hashida, M., Kawakami, S., and Yamashita, F. (2005). Lipid carrier systems for targeted drug and gene delivery. Chemical & pharmaceutical bulletin 53: 871-880.

PAGE 91

91 122. Waterhouse, J. E., Harbottle, R. P., Keller, M., Kostarelos, K., Coutelle, C., Jorgensen, M. R., et al. (2005). Synthesis and application of integrin targeting lipopeptides in targeted gene delivery. Chembiochem 6: 1212-1223. 123. Sun, X., Hai, L., Wu, Y., Hu, H. Y., and Zh ang, Z. R. (2005). Targeted gene delivery to hepatoma cells using galactosylated liposome-polycation-DNA complexes (LPD). Journal of drug targeting 13: 121-128. 124. Anwer, K., Kao, G., Rolland, A., Driessen, W. H., and Sullivan, S. M. (2004). Peptidemediated gene transfer of cationic lipid/p lasmid DNA complexes to endothelial cells. Journal of drug targeting 12: 215-221. 125. Manickam, D. S., and Oupicky, D. (2006). Multiblock reducible copolypeptides containing histidine-rich a nd nuclear localization seque nces for gene delivery. Bioconjugate chemistry 17: 1395-1403. 126. Laczko, I., Varo, G., Bottka, S., Balint, Z., I llyes, E., Vass, E., et al. (2006). N-terminal acylation of the SV40 nuclear localization signa l peptide enhances its oligonucleotide binding and membrane translocation efficiencies. Archives of biochemistry and biophysics 454: 146-154. 127. van der Aa, M. A., Mastrobattista, E., Oosting, R. S., He nnink, W. E., Koning, G. A., and Crommelin, D. J. (2006). The nuclear pore complex: the gateway to successful nonviral gene delivery. Pharm Res 23: 447-459. 128. Rolland, A. (2006). Nuclear gene deli very: the Trojan horse approach. Expert opinion on drug delivery 3: 1-10. 129. Rhee, M., and Davis, P. (2006). Mechanism of uptake of C105Y, a novel cell-penetrating peptide. The Journal of biological chemistry 281: 1233-1240. 130. Szecsi, J., Drury, R., Josserand, V., Grange, M. P., Boson, B., Hartl, I., et al. (2006). Targeted retroviral vectors disp laying a cleavage site-engineer ed hemagglutinin (HA) through HA-protease interactions. Mol Ther 14: 735-744. 131. Bonsted, A., Engesaeter, B. O., Hogset, A., Maelandsmo, G. M., Prasmickaite, L., D'Oliveira, C., et al. (2006). Photochemically enhanced transduction of polymer-complexed adenovirus targeted to the epid ermal growth factor receptor. The journal of gene medicine 8: 286-297. 132. Sapra, P., Tyagi, P., and Allen, T. M. (2005). Ligand-targeted liposomes for cancer treatment. Current drug delivery 2: 369-381. 133. Hattori, Y., and Maitani, Y. (2005). Folatelinked lipid-based nanoparticle for targeted gene delivery. Current drug delivery 2: 243-252. 134. Zhang, Z., Liu, Y. Y., and Jhiang, S. M. (2005). Cell surface targe ting accounts for the difference in iodide uptake activity between hum an Na+/Isymporter and rat Na+/Isymporter. The Journal of clinical endocrinology and metabolism 90: 6131-6140.

PAGE 92

92 135. Parker, A. L., Fisher, K. D., Oupicky, D., Rea d, M. L., Nicklin, S. A., Baker, A. H., et al. (2005). Enhanced gene transfer activity of peptide-targeted gene-delivery vectors. Journal of drug targeting 13: 39-51. 136. Fretz, M. M., Mastrobattista, E., Koning, G. A., Jiskoot, W., and Storm, G. (2005). Strategies for cytosolic deliver y of liposomal macromolecules. International journal of pharmaceutics 298: 305-309. 137. Kloeckner, J., Prasmickaite, L., Hogset A., Berg, K., and Wagner, E. (2004). Photochemically enhanced gene delivery of EGF receptor-targeted DNA polyplexes. Journal of drug targeting 12: 205-213. 138. Kostarelos, K., Emfietzoglou, D., Papakos tas, A., Yang, W. H., Ballangrud, A., and Sgouros, G. (2004). Binding and interstitial pene tration of liposomes within avascular tumor spheroids. Int J Cancer 112: 713-721. 139. Boomer, J. A., and Thompson, D. H. (1999). Synthesis of acid-lab ile diplasmenyl lipids for drug and gene delivery applications. Chemistry and physics of lipids 99: 145-153. 140. Brisson, M., Tseng, W. C., Almonte, C., Wa tkins, S., and Huang, L. (1999). Subcellular trafficking of the cytoplasmic expression system. Human gene therapy 10: 2601-2613. 141. Futaki, S., Masui, Y., Nakase, I., Sugiura, Y., Nakamura, T., Kogure, K., et al. (2005). Unique features of a pH-sensitive fusogenic pept ide that improves the transfection efficiency of cationic liposomes. The journal of gene medicine 7: 1450-1458. 142. Hafez, I. M., Maurer, N., and Cullis, P. R. (2001). On the mechanism whereby cationic lipids promote intracellular delivery of polynucleic acids. Gene therapy 8: 1188-1196. 143. Sandhu, A. P., Lam, A. M., Fenske, D. B., Pa lmer, L. R., Johnston, M., and Cullis, P. R. (2005). Calcium enhances the transfection potenc y of stabilized plasmid-lipid particles. Analytical biochemistry 341: 156-164. 144. Venugopalan, P., Jain, S., Sankar, S., Singh, P., Rawat, A., and Vyas, S. P. (2002). pHsensitive liposomes: mechanism of triggered re lease to drug and gene delivery prospects. Die Pharmazie 57: 659-671. 145. Wang, D. A., Narang, A. S., Kotb, M., Gaber, A. O., Miller, D. D., Kim, S. W., et al. (2002). Novel branched poly(ethyl enimine)-cholesterol water-so luble lipopolymers for gene delivery. Biomacromolecules 3: 1197-1207. 146. Li, Y., Chen, C. X., von Specht, B. U., and Hahn, H. P. (2002). Cloning and hemolysinmediated secretory expression of a codon-optimi zed synthetic human interleukin-6 gene in Escherichia coli. Protein expression and purification 25: 437-447. 147. Kim, C. Y., Jeong, M., Mushiake, H., Kim, B. M., Kim, W. B., Ko, J. P., et al. (2006). Cancer gene therapy using a nove l secretable trimeric TRAIL. Gene therapy 13: 330-338.

PAGE 93

93 148. Veach, R. A., Liu, D., Yao, S., Chen, Y., Liu, X. Y., Downs, S., et al. (2004). Receptor/transporter-independent targeting of functional peptides across the plasma membrane. The Journal of biological chemistry 279: 11425-11431. 149. Eguchi, A., Furusawa, H., Yamamoto, A., Akut a, T., Hasegawa, M., Okahata, Y., et al. (2005). Optimization of nuclear localization signal for nuclear transport of DNA-encapsulating particles. J Control Release 104: 507-519. 150. Vaysse, L., Gregory, L. G., Harbottle, R. P., Perouzel, E., Tolmachov, O., and Coutelle, C. (2006). Nuclear-targeted minicircle to enhance gene transfer with non-viral vectors in vitro and in vivo. The journal of gene medicine 8: 754-763. 151. Al-Taei, S., Penning, N. A., Simpson, J. C., Futaki, S., Takeuchi, T., Nakase, I., et al. (2006). Intracellular traffic and fate of protein transduction domains HIV-1 TAT peptide and octaarginine. Implications for their utilization as drug delivery vectors. Bioconjugate chemistry 17: 90-100. 152. Shiraishi, T., Hamzavi, R., and Nielsen, P. E. (2005). Targeted delivery of plasmid DNA into the nucleus of cells via nuclear localization signal peptid e conjugated to DNA intercalating bisand trisacridines. Bioconjugate chemistry 16: 1112-1116. 153. Wiseman, J. W., Scott, E. S., Shaw, P. A ., and Colledge, W. H. (2005). Enhancement of gene delivery to human airway epithelial cells in vitro using a peptide from the polyoma virus protein VP1. The journal of gene medicine 7: 759-770. 154. Kozak, M. (1987). An analysis of 5'-nonc oding sequences from 699 vertebrate messenger RNAs. Nucleic acids research 15: 8125-8148. 155. Kozak, M. (1991). An analysis of vert ebrate mRNA sequences: intimations of translational control. The Journal of cell biology 115: 887-903. 156. Kozak, M. (1990). Downstream secondary stru cture facilitates recognition of initiator codons by eukaryotic ribosomes. Proceedings of the National Academy of Sciences of the United States of America 87: 8301-8305. 157. Rees, C., Clemmons, D. R., Horvitz, G. D ., Clarke, J. B., and Busby, W. H. (1998). A protease-resistant form of insu lin-like growth factor (IGF) bi nding protein 4 inhibits IGF-1 actions. Endocrinology 139: 4182-4188. 158. Zhang, M., Smith, E. P., Kuroda, H., Banach, W., Chernausek, S. D., and Fagin, J. A. (2002). Targeted expression of a protease-resi stant IGFBP-4 mutant in smooth muscle of transgenic mice results in IGFBP-4 st abilization and smooth muscle hypotrophy. The Journal of biological chemistry 277: 21285-21290. 159. Bhat, R. A., Stauffer, B., Komm, B. S., a nd Bodine, P. V. (2004). Regulated expression of sFRP-1 protein by the GeneSwitch system. Protein expression and purification 37: 327-335.

PAGE 94

94 160. Nordstrom, J. L. (2003). The antiprogestin -dependent GeneSwitch system for regulated gene therapy. Steroids 68: 1085-1094. 161. Abruzzese, R. V., Godin, D., Mehta, V., Perrard, J. L., French, M., Nelson, W., et al. (2000). Ligand-dependent regulation of vascular endothe lial growth factor and erythropoietin expression by a plasmid-based autoinducible GeneSwitch system. Mol Ther 2: 276-287. 162. Abruzzese, R. V., Godin, D., Burcin, M., Meht a, V., French, M., Li, Y., et al. (1999). Ligand-dependent regulati on of plasmid-based transgene expression in vivo. Human gene therapy 10: 1499-1507. 163. Jia, H., Pang, Y., Chen, X., and Fang, R. (2006). Removal of the selectable marker gene from transgenic tobacco plants by expression of Cre recombinase from a tobacco mosaic virus vector through agroinfection. Transgenic research 15: 375-384. 164. Goebbels, S., Bode, U., Pieper, A., Funfschilling, U., Schwab, M. H., and Nave, K. A. (2005). Cre/loxP-mediated inactivation of the bH LH transcription factor gene NeuroD/BETA2. Genesis 42: 247-252. 165. Bordonaro, M., Lazarova, D. L., and Sart orelli, A. C. (2004). Pharmacological and genetic modulation of Wnt-targeted Cre-Lox-medi ated gene expression in colorectal cancer cells. Nucleic acids research 32: 2660-2674. 166. Zhang, W., Subbarao, S., Addae, P., Shen, A ., Armstrong, C., Peschke, V., et al. (2003). Cre/lox-mediated marker gene excision in transgenic maize (Zea mays L.) plants. TAG. Theoretical and applied genetics 107: 1157-1168. 167. Kaczmarczyk, S. J., and Green, J. E. (2001) A single vector cont aining modified cre recombinase and LOX recombination sequences for inducible tissue-specif ic amplification of gene expression. Nucleic acids research 29: E56-56. 168. Sauer, B. (1998). Inducible gene targ eting in mice using the Cre/lox system. Methods (San Diego, Calif 14: 381-392. 169. Wagner, K. U., Wall, R. J., St-Onge, L., Gruss, P., Wynshaw-Boris, A., Garrett, L., et al. (1997). Cre-mediated gene deletion in the mammary gland. Nucleic acids research 25: 43234330. 170. Feil, R., Brocard, J., Mascrez, B., LeMeur M., Metzger, D., and Chambon, P. (1996). Ligand-activated s ite-specific recombination in mice. Proceedings of the National Academy of Sciences of the United States of America 93: 10887-10890. 171. Mallo, M. (2006). Controlled gene activ ation and inactivation in the mouse. Front Biosci 11: 313-327. 172. Kondo, S., Takahashi, Y., Shiozawa, S., Ichi se, H., Yoshida, N., Kanegae, Y., et al. (2006). Efficient sequential gene regulation vi a FLP-and Cre-recombinase using adenovirus

PAGE 95

95 vector in mammalian cells including mouse ES cells. Microbiology and immunology 50: 831843. 173. Coroadinha, A. S., Schucht, R., Gama-Nor ton, L., Wirth, D., Hauser, H., and Carrondo, M. J. (2006). The use of recombinase mediated ca ssette exchange in retroviral vector producer cell lines: predictability and efficiency by transgene exchange. Journal of biotechnology 124: 457-468. 174. Werdien, D., Peiler, G., and Ryffel, G. U. (2001). FLP and Cre recombinase function in Xenopus embryos. Nucleic acids research 29: E53-53. 175. Schaft, J., Ashery-Padan, R., van der Hoeve n, F., Gruss, P., and Stewart, A. F. (2001). Efficient FLP recombination in mouse ES cells and oocytes. Genesis 31: 6-10. 176. Vooijs, M., van der Valk, M., te Riele, H ., and Berns, A. (1998). Flp-mediated tissuespecific inactivation of the retinoblastoma tumor suppressor ge ne in the mouse. Oncogene 17: 112. 177. Dymecki, S. M., and Tomasiewicz, H. (1998). Using Flp-recombinase to characterize expansion of Wnt1-expressing neur al progenitors in the mouse. Developmental biology 201: 5765. 178. Ludwig, D. L., Stringer, J. R., Wight, D. C., Doetschman, H. C., and Duffy, J. J. (1996). FLP-mediated site-specific recombinati on in microinjected murine zygotes. Transgenic research 5: 385-395. 179. Fiering, S., Kim, C. G., Epner, E. M., a nd Groudine, M. (1993). An "in-out" strategy using gene targeting and FLP recombinase fo r the functional dissection of complex DNA regulatory elements: analysis of th e beta-globin locus control region. Proceedings of the National Academy of Sciences of the United States of America 90: 8469-8473. 180. Sun, Y., Chen, X., and Xiao, D. (2007). Tetr acycline-inducible Expression Systems: New Strategies and Practices in the Transgenic Mouse Modeling. Acta biochimica et biophysica Sinica 39: 235-246. 181. Sprengel, R., and Hasan, M. T. (2007). Tetracycline-controlled genetic switches. Handbook of experimental pharmacology 178: 49-72. 182. Mathe, Z., Dupraz, P., Rinsch, C., Thorens, B., Bosco, D., Zbinden, M., et al. (2006). Tetracycline-regulated expression of VEGF-A in beta cells indu ces angiogenesis: improvement of engraftment following transplantation. Cell transplantation 15: 621-636. 183. Hwang, S. O., Chung, J. Y., and Lee, G. M. (2003). Effect of doxycycline-regulated ERp57 expression on specific thrombopoietin productivity of recombinant CHO cells. Biotechnology progress 19: 179-184.

PAGE 96

96 184. Chtarto, A., Bender, H. U., Hanemann, C. O., Kemp, T., Lehtonen, E., Levivier, M., et al. (2003). Tetracycline-inducible transgene e xpression mediated by a single AAV vector. Gene therapy 10: 84-94. 185. Zhu, Z., Zheng, T., Lee, C. G., Homer, R. J., and Elias, J. A. (2002). Tetracyclinecontrolled transcriptional regulation systems: a dvances and application in transgenic animal modeling. Seminars in cell & developmental biology 13: 121-128. 186. Sommer, B., Rinsch, C., Payen, E., Dalle, B ., Schneider, B., Degl on, N., et al. (2002). Long-term doxycycline-regulated secretion of erythropoietin by encapsulated myoblasts. Mol Ther 6: 155-161. 187. Sims, N. A., Sabatakos, G., Chen, J. S., Kelz M. B., Nestler, E. J., and Baron, R. (2002). Regulating DeltaFosB expression in adult TetOff-DeltaFosB transgenic mice alters bone formation and bone mass. Bone 30: 32-39. 188. Mizuguchi, H., and Hayakawa, T. (2002). The te t-off system is more effective than the tet-on system for regulating transgene expr ession in a single adenovirus vector. The journal of gene medicine 4: 240-247. 189. Ralph, G. S., Bienemann, A., Harding, T. C., Hopton, M., Henley, J., and Uney, J. B. (2000). Targeting of tetracyclineregulatable transgene expression specifically to neuronal and glial cell populations using adenoviral vectors. Neuroreport 11: 2051-2055. 190. Freundlieb, S., Schirra-Muller, C., and Bu jard, H. (1999). A tetracycline controlled activation/repression system with increased pote ntial for gene transfer into mammalian cells. The journal of gene medicine 1: 4-12. 191. Harding, T. C., Geddes, B. J., Noel, J. D., Murphy, D., and Uney, J. B. (1997). Tetracycline-regulated transgene expression in hippocampal neurones following transfection with adenoviral vectors. Journal of neurochemistry 69: 2620-2623. 192. Gossen, M., and Bujard, H. (1992). Tight cont rol of gene expression in mammalian cells by tetracycline-responsive promoters. Proceedings of the National Academy of Sciences of the United States of America 89: 5547-5551. 193. Baulieu, E. E. (1989). Contragestion and ot her clinical applications of RU 486, an antiprogesterone at the receptor. Science (New York, N.Y 245: 1351-1357. 194. Lebeau, M. C., and Baulieu, E. E. (1994). Steroid antagonists and receptor-associated proteins. Human reproduction (Oxford, England) 9: 437-444. 195. Baulieu, E. E. (1991). The steroid hormone antagonist RU486. Mechanism at the cellular level and clinical applications. Endocrinology and metabolism clinics of North America 20: 873891. 196. Baulieu, E. E. (1989). Contragestion with RU 486: a new approach to postovulatory fertility control. Acta obstetricia et gy necologica Scandinavica 149: 5-8.

PAGE 97

97 197. Dubois, C., Ulmann, A., and Baulieu, E. E. (1988). Contragestion with late luteal administration of RU 486 (Mifepristone). Fertil Steril 50: 593-596. 198. Vegeto, E., Allan, G. F., Schrader, W. T., Tsai, M. J., McDonnell, D. P., and O'Malley, B. W. (1992). The mechanism of RU486 antagon ism is dependent on the conformation of the carboxy-terminal tail of the human progesterone receptor. Cell 69: 703-713. 199. Terada, Y., Tanaka, H., Okado, T., Shimamura, H., Inoshita, S., Kuwahara, M., et al. (2002). Ligand-regulatable erythropoietin pr oduction by plasmid injection and in vivo electroporation. Kidney international 62: 1966-1976. 200. Wang, Y., O'Malley, B. W., Jr., Tsai, S. Y ., and O'Malley, B. W. (1994). A regulatory system for use in gene transfer. Proceedings of the National Academy of Sciences of the United States of America 91: 8180-8184.

PAGE 98

98 BIOGRAPHICAL SKETCH Leah Villeg as entered the Department of Bi ology at the University of North FloridaJacksonville, Florida in August 1997. Under the supervision of Greg Ahearn and Anita Mandal, she completed her senior thesis and received he r Bachelor of Science degree in biology in May 2002. She also completed a summer research fellow ship at the university before continuing with her graduate studies. In Augus t 2002, Leah joined the graduate program in the Department of Pharmaceutics at the University of FloridaGainesville, Florida. U nder the supervision of her graduate advisor, Sean Sullivan, she completed her dissertation and received her Doctor of Philosophy degree in pharmaceutic al sciences in August 2007.